Issuu on Google+

2013

#3

årgång 9

VETENSKAPLIG OBEROENDE MEDICINSK TIDSKRIFT • www.medicinskaccess.se

Nya in s k c i d e M ! access

Kirurgiska världs­eliten samlas i Sverige

Kosttillskott som komplement till livsstils­modifikation och läkemedel

Glimtar från Svenska Kardiolog­föreningens Vårmöte i Göteborg Gästledare Lars Nilsson, Prof. emeritus Sluta byta äldres mediciner på apotek!

Kan kardiovaskulär sjukdom förebyggas med lipidsänkande terapi?

– Gamla och nya rön ifråga­ sätter nuvarande praxis.


• Det finns ett alternativ till det Salures® K (bendroflumetiazid 2,5 mg + kaliumklorid 570 mg) som har utgått* • Centyl® K mite och Centyl® K – ett tiaziddiuretikum i lågdos Alternati till Salures® v K som har utgått *

tyrka Lägre s

Förpackningar och priser 25 st 74,00 kr. 100 st 186,00 kr. 25 st 80,50 kr. 100 st 119,00 kr. www.fass.se *avregistrerades 2007-09-30

LEO Pharma AB Box 404 · SE-201 24 Malmö Tel.: 040-352200 · Fax: 040-352276 info.se@leo-pharma.com · www.leo-pharma.com Org.nr. 556075-4318

Centyl® K mite (bendroflumetiazid 1,25 mg och kaliumklorid 573 mg) och Centyl® K (bendroflumetiazid 2,5 mg och kaliumklorid 573 mg). Filmdragerade tabletter. Diuretikum och blodtryckssänkande medel. ATCkod: C03AB01. Indikation: Hypertoni. Ödem i samband med hjärtinsufficiens. Ödem av annan genes. Profylaktisk behandling av patienter med recidiverande idiopatisk njurstenssjukdom. Kontraindikationer: Svår lever- och njurinsufficiens. Manifest gikt. Överkänslighet mot tiazider och närstående sulfonamider. Överkänslighet mot de aktiva substanserna eller mot något hjälpämne. Dosering: Tabletterna ska sväljas hela med minst 1/2 glas vatten. Hypertoni: Vid långtidsbehandling som regel 1,25-5 mg bendroflumetiazid dagligen som engångsdos på morgonen. Med ledning av effekten på blodtrycket inställs patienten på lägsta möjliga underhållsdos. Bendroflumetiazid kan med fördel kombineras med betablockerare och andra blodtryckssänkande medel. Den vanligen rekommenderade dosen av dessa medel bör därvid reduceras. Ödem: 2,5-10 mg bendroflumetiazid. Lämplig initialdos 5 mg bendroflumetiazid dagligen. Underhållsdos: 2,5-5 mg bendroflumetiazid dagligen kontinuerligt eller intermittent med 2-4 behandlingsfria dagar per vecka. Hela dagsdosen ges i allmänhet på morgonen. Premenstruella ödem: 2,5 mg bendroflumetiazid dagligen 7-10 dagar premenstruellt. Varningar och försiktighet: Diabetes mellitus är ingen kontraindikation men patienten bör observeras med tanke på att Centyl® K mite/Centyl® K kan ge förändringar i kolhydratmetabolismen. I samband med utsvämning av ödem vid samtidig digitalismedicinering eller vid levercirrhos rekommenderas extra kaliumtillförsel. Centyl® K: Vid längre tids medicinering rekommenderas kontroll av S-kalium och beroende på svaret kan kaliumrik kost, eventuellt extra kaliumtillskott behöva ges. Förpackningar: 25 och 100 st. För fullständig produktinformation och priser se www.fass.se. Datum för översyn av produktresuméerna: 2009-05-04 och 2010-09-17. LEO® CT-2013-01-03 © LEO Pharma AB · April 2013 · ALLA LEO VARUMÄRKEN SOM NÄMNS ÄGS AV LEO GROUP


Innehåll #3 2013 Chefredaktör och redaktion: Håkan Hedin Nybohallen 820 40 Järvsö Tel: 0651-76 76 88, 070-206 14 09 E-post: hakan@ medicinskaccess.se Ansvarig utgivare: Tord Amré Medicinsk konsult: Zvi Wirschubsky Tel: 0651-76 76 88, 070-848 56 92 E-post: zvi@ medicinskaccess.se Marknadschef: Tord Amré Tel: 070-679 01 65 E-post: tord@ medicinskaccess.se Layout och illustrationer: Håpe Kommunikation Produktion: T & M Media AB Redaktionen an­ svarar ej för insänt icke beställt material. Delar av materialet publiceras på Inter­ net. Förbehåll mot detta måste anges innan publicering. Annonser: Bokning och frågor, kontakta Tord Amré. Tel: 070-679 01 65, 0652-151 10 E-post: tord@ medicinskaccess.se Annonstraffic: Tilda Amré E-post: info@ tmmedia.se Tel: 0652-151 10 Tryckeri: V-Tab Vimmerby Nästa nummer: Utkommer v.22 Medicinsk Access står oberoende i för­ hållande till företag, organisationer och politiska partier. Varje enskild skribent svarar för sina egna åsikter. ISSN: 1652-9782 medicinskaccess.se © T&M Media AB

35 Kosttillskott som komplement till livsstils­modifikation och läkemedel 4 Bli gästledare i Medicinsk Access 6 Hur kan hjärtsjukvården i Stockholms läns landsting nå bättre resultat?

5 Gästledare: Sluta byta äldres mediciner på apotek!

13 Kirurgiska världseliten samlas i Sverige i Juni 14 Några glimtar från Svenska Hjärt­förbundets Kardiovaskulära Vårmöte 20 Vårmötet samlade uppemot 1 300 kongressdeltagare

16 Finns det en Pheidippideskardiomyopati?

25 Kan kardiovaskulär sjuk­ dom före­byggas med lipidsänkande terapi?

32 Forskning och utveckling 40 Unga svenska medicin­ forskare belönas 42 Notiser 46 Forskning och utveckling 48 Vitalis – nordens ledande mötesplats för e-Hälsa 50 Notiser 53 Medicinteknik

Omslaget: Äpplen, framförallt äppel­skalet, innehåller flavo­noider, kalium och rikligt med C-vitamin.

56 Bokklubben 58 Månadens Pottholzt

22 En non-invasiv metod att hjälpa patienter med kranskärlssjukdom och kärlkramp #3 2013

3


Bli gästledare Du når många aktiva läsare genom att publicera dina åsikter i Medicinsk Access. Våra läsare är läkare, sjuksköterskor, forskare, beslutsfattare, läkemedelsindustri, vetgiriga patienter, opinions­bildare och mediafolk inom vård och medicin. Upplagan ligger för närvarande på 16 000 exemplar (TS kontroll 2012) men når mer än fyrdubbelt antal läsare. Vår policy är att låta personer och organisationer publicera åsikter och politiska vårdkrav i tidningen. Medicinsk access kommer dock inte att driva gästledarnas eller debattörernas frågor utan det får var och en göra själv. Vi är en oberoende medicinsk tidskrift som låter patientorganisationer, medicinska föreningar, läkarfackliga organisationer, sjuksköterskefackliga organisationer, landstingspolitiker, läkemedelsindustri, apotek och opinionsbildare att komma till tals genom att fritt delta i våra spalter. Vårdfolkets olika röster ger bredd och styrka i tidningen. Välkommen som gästledare, debattör eller artikelförfattare till Medicinsk Access spalter. Håkan Hedin chefredaktör Tidigare Gästledare från olika organisationer och föreningar inom vård och hälsa har fört fram sina åsikter och politiska budskap i Medicinsk Access. I faktarutor har de också kunnat presentera sina organisationer för läsarna. Mångfald är oberoendets bästa vapen mot passivitet och enfald. Medicinsk access nr 5 2012 Elisabeth Wallenius Ordförande i Riksför­ bundet Sällsynta diagnoser

“Uppskattningar visar att två procent av befolkningen, 180 000 svenskar, har en sällsynt diagnos.”

Medicinsk access nr 8/9 2012 Susanna Lindvall Ordförande för Parkinsonförbundets Forskningsfond/ Park­insonfonden och vice ordförande för den Europeiska Park­ inson­federationen

“Läkare behöver utbildning och information för att kunna diagnostisera den svårupptäckta sjukdomen tidigare och att be­ handla parkinsonsjuka i rätt tid med rätta metoder.” 4

#3 2013

Medicinsk access nr 6 2012 Lena Jonasson Professor/överlä­ kare, Kardiologiska kliniken, Linköpings Universitetssjukhus. Ordf. Svenska Cardio­ logföreningen.

“Vi kan röra oss mellan olika discipliner, var och en med sin specialkunskap, och tillsammans faktiskt utöva det där som varit på modet ett bra tag nu, näm­ ligen translationell medicin.”

Medicinsk access nr 1 2013 Ingalill Bjöörn Förbunds­ordförande Astma- och Allergi­ förbundet

”Politikerna brukar säga att bar­ nen är vår framtid. Upp till bevis säger vi.”

Medicinsk access nr 7 2012 Leif Hassel Ordförande Hjärtoch Lungsjukas Länsförening i Värmland

”Bara hälften av hjärtsvikts­ patienterna i undersökningen anser att de får det stöd de behöver i vården.”

Medicinsk access nr 2 2013 Johnny Ludvigsson Professor emeritus Ordförande Barn­ diabetesfonden

”Medan 75-80 procent av all barncancer kan botas, botas 0.0 procent av Typ 1 diabetes hos barn.”

Prenumeration / adressändringar: Prenumerationspris för 1 år (7-9 nr) är 350 kr inkl. moms och 2 år 530 kr inkl. moms. Utlands­prenumeration: 900 kr. Beloppet insättes på vårt bg: 5253-7149 Märk inbetalningskor­ tet prenumeration. Ange fullständig adress. Kontakt: info@ tmmedia.se Tel: 0652-151  10 (måndag-fredag 9-15) Naturligtvis går det att prenumerera på vår hemsida: medicinskaccess.se Det går även bra att använda talongen på Bokklubbenuppslaget.


Gästledare

Sluta byta äldres mediciner på apotek! När ett nytt läkemedel med en ny läkemedelssubstans introduceras på marknaden (ett så kallat original­ läkemedel) har läkemedlet som regel ett patentskydd och är därmed ensamt på marknaden så länge patentet gäller. Originalläkemedelet har i regel ett högt pris och stor försäljning under patenttiden, vilket leder till stora kostnader.

När patentet upphör kan det komma nya produkter med samma substans, så kallat generiska läkemedel. Med generika menar vi därför i dagligt tal läkemedel utan patent. De tillverkas då av ett annat företag och får ett annat namn än originalläkemedlet. Tabletternas utseende, form och färg, kan också skilja sig från originalläkemedlet. Generika innebär att flera olika läkemedel innehåller samma aktiva substans, de gör samma medicinska nytta och de är därför

”Om varje sådan fel- eller dubbel­ medicinering ledde till ett extra besök på vårdcentralen så skulle den samman­lagda kostnaden för dessa besök bli 256 miljoner kr per år.” utbytbara mot varandra. De är dessutom billigare och då uppstår en priskonkurrens på marknaden. Detta har staten insett och vill genom att favorisera generika minska läkemedelsnotan och därmed spara pengar åt skattebetalarna. Pengar som i stället kan användas till mer läkemedel eller till andra insatser i vården. Reformen beräknas spara runt 8 miljarder per år. I Sverige är det Läkemedelsverket som bestämmer vilka läkemedel som är utbytbara. Sedan 2002 har apoteken skyldighet att expediera det billigaste tillgängliga preparatet. Om det finns skäl för en läkare att skriva ett speciellt preparat som inte får bytas kan detta anges på receptet och patienten får då full läkemedelsförmån även för ett dyrare men likvärdigt läkemedel. Detta sker dock för mindre än 5 procent av alla recept. Negativt för patienterna

Generikautbyte på apotek är för det mesta negativt för patienterna eftersom många patienter kan ha flera olika läkemedel men med

samma aktiva ämne. Bytet skapar också förvirring och risken för felmedicinering är mycket stor. Enligt en undersökning från 2011 har man uppskattat att 7 procent av patienterna eller 200 000 individer under ett år samtidigt använt två eller flera mediciner med samma aktiva ämne eller på annat sätt felmedicinerat på grund av generikautbyte på apotek. Mycket tyder på att det främst är äldre som råkat ut för detta. Om varje sådan fel- eller dubbelmedicinering ledde till ett extra besök på vårdcentralen så skulle den sammanlagda kostnaden för dessa besök bli 256 miljoner kr per år. (Enligt SKL:s Öppna jämförelser 2010 är kostnaden 1283 kr per vårdkontakt i primärvården). Till detta kommer kostnaden för lidande och eventuell skada som felmedicineringen orsakar. Åldersgräns för generikautbyte

De flesta äldre behandlas med läkemedel som funnits länge på marknaden och priserna har därför sänkts efter att generika kommit till och priskonkurrerat. Generikautbyte för äldre ger därför troligen endast små besparingar, sannolikt betydligt mindre än de kostnader som utbytet kan medföra. SPF föreslår därför i sitt remissvar på Läkemedels- och apoteksutredningen (SOU 2012:75) att det införs en åldersgräns för generikautbyte. Sådant utbyte bör inte ske för patienter som är 75 år och äldre. Denna åldersgräns är densamma som gäller enligt Socialstyrelsens författning SOSFS 2012:9 om läkemedelsgenomgångar. Riskerna och de negativa följderna av generikautbyte för äldre patienter är så stora att de inte får ignoreras. Just nu arbetar den statliga läkemedels- och apoteksutredningen med sitt andra betänkande om tillgången till och prissättningen på läkemedel. Utredaren också fått möjlighet att komma med förslag till för­ ändringar av generikare­formen. Därför finns det möjlighet att föreslå förbättringar och förenklingar av generikasystemet och införa en åldersgräns för generika­utbyte. Det är bra att hålla nere läkemedels­ kostnaderna, men om det nuvarande systemet äventyrar patientsäkerheten och dessutom ger lidande och tveksamma besparingar vid behandling av äldre, så bör det reformeras. Lars Nilsson Professor emeritus Sakkunnig i läkemedelsfrågor vid SPF

#3 2013

5


F.v. Lena Vågberg, chef Regulatory Affairs, AstraZeneca Nordic- Baltic, Staffan Josephson, general­sekreterare, Hjärt-Lungfonden.

F.v. Dag Larsson, oppositionslandstingsråd, Socialdemokraterna, Lars-Joakim Lundqvist, landstingsråd, Moderaterna.

Hur kan hjärtsjukvård läns landsting nå bätt Stora framsteg har skett inom hjärtsjukvården under de senaste decennierna. Trots det ökar antalet avlidna i hjärtsvikt samtidigt som hjärtinfarkt fortsätter att vara den enskilt vanligaste dödsorsaken i Sverige.

Stockholmsområdet är Sveriges mest tätbefolkade region och trots närhet till vård och internationellt renommerad forskning är regionens sjukhus inte bäst i landet på behandling av till exempel hjärt­infarkt, enligt Socialstyrelsens Öppna jämförelser 2012. Hjärtsjukvården i Stockholms län står inför stora utmaningar. Det finns mycket som kan förbättras inom hjärtsjukvården men hur detta ska uppnås är en komplex fråga. Vad behöver och kan landstinget egentligen göra för att uppnå bättre resultat i hjärtsjukvården i Stockholm? För att besvara denna fråga bjöd AstraZeneca tillsammans med Hjärt-Lungfonden, in till ett seminarium med titeln ”Vad krävs för att rädda fler liv inom hjärtsjukvården i Stockholm?”. Vid detta seminarium deltog bland andra experter från hjärtsjukvården i Stockholm och beslutsfattare från Stockholms läns landsting, för att tillsammans söka svar på denna fråga. Syftet med seminariet var att föra Idag får en hjärtinfarktspatient en öppen 12 fler levnadsår jämfört med en diskussion patient som drabbades av samma kring möjsjukdom 1980. ligheter och utmaningar och försöka hitta konkreta lösningar för hjärtsjukvården. Denna sammanfattning belyser en del av de diskussioner och frågor som kom upp under seminaiet. Talare

Som talare under seminariet deltog: • Jan Andersson, prorektor, Karolinska Institutet 6

#3 2013

• Jan Nilsson, professor, Hjärt-Lungfonden • Tomas Jernberg, professor, Karolinska Universitetssjukhuset och samordnare för kvalitetsregistret Swedeheart • Cecilia Linde, professor, Karolinska Universitetssjukhuset • Lars Wallentin, professor, Uppsala Clinical Research Center • Hans Persson, överläkare, docent, Danderyds sjukhus • Lars-Joakim Lundqvist, landstingsråd, Moderaterna • Dag Larsson, oppositionslandstingsråd, Socialdemokraterna • Lena Vågberg, chef Regulatory Affairs, AstraZeneca NordicBaltic • Staffan Josephson, generalsekreterare, Hjärt-Lungfonden Forskning, sammanhållna vårdkedjor och preventiva åtgärder Det första avsnittet handlade om forsknings- och utvecklings­ frågor inom hjärtsjukvården. Här berördes bland annat frågor om hur grundforskning ska integreras i den tillämpade hjärtsjuk­vården samt hur dialog och samverkan mellan sjukvården, akademin och läkemedelsföretag kan definiera vårdens framtida behov. Det andra avsnittet, som handlade om sammanhållna vård­ kedjor, berörde hur sjukvårdens inre förändringsprocesser kan leda till bättre vårdresultat. Det tredje avsnittet handlade om hjärtsjukvårdens verksamhet och om hur nya behandlingsmetoder snabbare kan implementeras eller hur arbetet med preventiva åtgärder ska kunna utvecklas ytter­ligare. Den positiva utvecklingen måste fortsätta

Det har skett stora förbättringar inom hjärtsjukvården sedan 1980. Totalt har dessa förbättringar inneburit att 150 000 liv har räddats. Idag får en hjärtinfarktspatient 12 fler levnadsår jämfört med en patient som drabbades av samma sjukdom 1980. Denna utveckling är unik jämfört med många andra terapiområden. Trots dessa framgångar har vi fortfarande många utmaningar. Många beslutsfattare uppfattar att vi redan har löst de flesta utmaningar kring hjärtsjukdomar, att forskningen och vården inte


F.v. Lena Vågberg, chef Regulatory Affairs, AstraZeneca Nordic-Baltic, Jan Nilsson, professor, Hjärt- Lungfonden, Lars Wallentin, professor, Uppsala Clinical Research Center, Dag Larsson, oppositions- landstingsråd, Socialdemokraterna, Lars-Joakim Lundqvist, landstingsråd, Moderaterna,

den i Stockholms tre resultat? kan komma längre i den medicinska utvecklingen. Det finns fort­ farande mycket att göra eftersom det i Sverige dör 32 000 personer av hjärtsjukdom varje år. Därför är det viktigt att våra besluts­ fattare inser att det fortfarande finns mycket att göra och att vården har mycket mer att ge, givet goda förutsättningar. Hjärt-Lung­ fonden presenterade sin ambition; att halvera antalet dödsfall inom de nästkommande tio åren. Frågan är vad som krävs av sjukvården vad det gäller resursfördelning och förändrad organisation. Forskning som en naturlig del av verksamheten

En av de viktigaste faktorerna för att driva kvalitet och bättre vårdresultat är att verksamheten bygger på en forskningsbaserad sjukvård, vilket är en förutsättningen för att uppnå nya och ännu bättre behandlingsresultat. Förbättrad samverkan mellan grund­ forskningen, den tillämpade forskningen, sjukvården och läkemedelsföretag är nödvändig. Idag saknas det ett huvudmannaskap vilket är en av utmaningarna. Det är nödvändigt att tydliggöra målen för hjärtsjukvården, inte bara de politiska. Med tydligt uppsatta mål och planerade och genomförbara aktiviteter kan hjärtsjukvården utvecklas i rätt riktning. För att nå dessa mål och kunna uppnå bättre resultat krävs en bättre och systematisk uppföljning av patienterna, registrering och dokumentering i kvalitetsregistren samt utvärdering. Idag finns flera utmaningar som måste lösas för att kunna uppnå denna forskningsverksamhet. Sjukvården är splittrad och de medicinska disciplinernas verksamhetsområden prioriteras ofta mer än vårdens samlade resultat. Detta leder till att kommunikationen mellan olika aktörer brister som till exempel mellan sjukvården och läkemedelsföretag men även mellan sjukvården och den medicinska akademin. Ett annat problem är att sjukvården ofta betraktas som en produktionsenhet, vilket innebär att forskning ses som en sidoverksamhet och en kostnad. Kvalitetsutveckling blir därmed också en sidoverksamhet. Det saknas en övergripande forskningsanalys. Från landstingets sida blir det ett kortsiktigt finansiellt fokus. Även

om staten tillför medel i form av forskningsanslag så saknar även staten en strategisk analys av hur forskning inom sjukvården ska bedrivas. Detta innebär att ingen känner ett ansvar eller huvudmannaskap för hur forskning ska bedrivas inom sjukvården. Forskningen inom hjärtsjukvården måste lösa flera problem. Grund­forskningen måste komma i kontakt med den tillämpade forskningen och företag som utvecklar läkemedel måste förstå vilka behov som finns inom sjukvården samt få möjlighet att bedriva klinisk prövningsDet finns fortfarande mycket att verksamhet. göra eftersom det i Sverige dör Samtidigt 32 000 personer av hjärtsjukdom måste sjuk­ varje år. husen få resurser för att kunna vara delaktiga i denna verksamhet. Sjukvården måste definiera sitt eget behov av både forskning och utveckling och göra detta till en del av verksamhetsuppdraget. Forskningen måste helt enkelt bli en integrerad del av den kliniska vardagen. Stockholms läns landsting behöver definiera sitt ansvar och tydligt ange ett ledarskap för forskningsfrågorna. Sammanhållna vårdkedjor är nödvändiga

Stockholms läns landsting är den största huvudmannen för sjukvård i Sverige. Med 2,1 miljoner invånare är vårdbehovet mycket stort och att följa enskilda patienter är svårt. Det betyder att verksamheten blir svår att överblicka och i Stockholm har en mycket fragmentiserad sjukvård utvecklats som närmast går att beskriva som en typ av ”nätverkssjukvård”. Länet har 210 vårdcentraler och sju akutsjukhus. Problemet blir särskilt aktuellt när det kommer till hjärtpatienter eftersom sjukvårdens struktur inte utgår från patienternas behov eller de uppnådda vårdresultaten utan från hur sjukvården internt är organiserad. Till skillnad från små landsting med kanske ett eller #3 2013

7


2086-005-jan-2013-MedAcc-nr3.

NYTT LÄKEMEDEL!

D-vitaminbrist är enkelt att förebygga och behandla med Divisun® (kolekalciferol): • Tas en gång om dagen • Flexibel dosering 1-5 tabletter – redan en tablett 800 IE ger lägsta dagliga dos – upp till 5 tabletter vid behov • Ingår i läkemedelsförmånen1

Referens: 1. www.tlv.se. Notis: Divisun® är 33% billigare än marknadens andra D vitaminalternativ i tablettform med jämförbar dos (800 IE) www.tlv.se (april 2013) Divisun® (kolekalciferol). Receptbelagt läkemedel. Beredningsform: Tablett. ATC-kod: A11C C05. Indikationer: Profylax och behandling av D-vitaminbrist hos vuxna och ungdomar. Som komplement till specifik osteoporosbehandling hos patienter med risk för vitamin D-brist, tilläggsbehandling med kalcium bör då övervägas. Rekommenderad dosering: 1 tablett dagligen. Högre doser kan behövas för att uppnå önskad serumnivå av 25(OH)D. Den dagliga dosen bör inte överskrida 5 tabletter. Innehåll: 1 tablett innehåller: kolecalciferol (vitamin D3) 800IE (motsvarande 20 mikrogram vitamin D3). Förpackningsstorlek: 90 tabletter i blister, AUP 183 kr. Datum för översyn av produktresumé: 2012-09-12. För ytterligare information och pris se www.fass.se MEDA AB. Box 906, 170 09 Solna. Tel 08 630 19 00, Fax 08 630 19 50 E-post: info@meda.se www.medasverige.se

Förebygger och behandlar D-vitaminbrist


Tomas Jernberg, professor, Karolinska Universitetssjukhuset och samordnare för kvalitetsregistret Swedeheart, Cecilia Linde, professor, Karolinska Universitets­sjukhuset, Hans Persson, överläkare, docent, Danderyds sjukhus.

två sjukhus och ett tiotal vårdcentraler finns en risk att Stockholm ”tappar bort” sina hjärtpatienter. Detta får till följd att de vård­ resultat som ett litet landsting med en nära kontakt mellan patient och behandlande läkare blir bättre än i Stockholm. Därför är det mycket viktigt att se hur sammanhållna vårdkedjor i Stockholm kan kompensera för de brister som en stor och komplex sjukvårdsorganisation innebär. Det finns en ambition att lösa detta problem och inom landstinget har man initierat ett projekt som kallas för 4D (”Fyra Diagnoser”) med syfte att skapa bättre förutsättningar för klinisk forskning, där bland annat hjärtsvikt ingår. Ett problem som måste lösas är hur incitament kan skapas för att få primärvårdsenheter att bidra till fortlöpande kvalitets­arbete inom hjärt­ sjuk­vården. Stockholms läns landsting behöver Primärvårdefiniera sitt ansvar och tydligt den är viktig ange ett ledarskap för forsknings­ eftersom de frågorna. har en nära och kontinuerlig kontakt med patienterna. För att länka ihop hela vårdkedjan måste primärvården också vara integrerad. I Stockholm, som har en fragmenterad primärvård, är detta en stor utmaning – här krävs förändringar och även utökad information till patienter och allmänhet. En förutsättning för en sammanhållen vårdkedja är att patienter känner förtroende för den och att de är delaktiga i den och att den fungerar. Trots närheten till avancerad sjukvård för i stort sett alla stockholmare har länet en högre mortalitet i hjärtinfarkter än genomsnittet i övriga landet. Dessa data går inte att förklara enbart med socioekonomiska eller demografiska skillnader. Det finns en stor förbättringspotential för Stockholms hjärtsjukvård. Utöver att titta på resultatens kvalitet finns också så kal�lade process­mått. Även när Stockholms hjärtsjukvårdresultat

ses utifrån vilka processer som utförs, är länet inte bättre än genomsnittet i landet. Ju äldre hjärtpatienten är desto sämre blir hjärtsjukvården. Detta gäller såväl rent operativa ingrepp som läkemedelsbehandlingar men även uppföljningen av patienterna. Verksamhetsstrukturen inom hjärtsjukvården måste utgå från vilka mål vården vill uppnå och dessa mål bör utgå från individens uppnådda hälsa. Vikten av förebyggande arbete

Sekundärprevention är ett område som har stor förbättrings­ potential. Cirka 50 procent av överlevnadsvinsten ligger i preventiva åtgärder och basala livsstilsförändringar som bland annat hjälp till rökstopp och fysiska träningsprogram. Med livsstilsförändringar får patienterna mätbara resultat i form av lägre blodtryck och sänkta kolesterolvärden. Idag är det endast 19 procent av hjärtinfarktpatienterna i Stock­holms län som uppnår basala livsstilsförändringar. Endast 56 procent av de personer som rökte innan sin hjärtinfarkt slutar och endast 42 procent av patienterna påbörjar ett fysiskt träningsprogram. Stockholms resultat är sämre än övriga landets när det kommer till sekundärpreventiva åtgärder, vilket också visar sig i att blodtrycket är högre och kolesterolvärden är sämre än i övriga landet för dessa patienter. För att nå bättre resultat måste verksamheterna få utökat utrymme att arbeta mer förebyggande. Sekundärprevention är ett av de viktigaste områdena för att förbättra överlevnaden efter en hjärtinfarkt eller vid hjärtsjukdom vilket visar att större fokus bör läggas på prevention. Ett första steg är att göra en djupare analys kring dessa delar för att i ett andra steg hitta funktionella lösningar. Det finns mycket kompetens inom detta område som vi måste tillvarata. Eva Holmestig

#3 2013

9


Danny Starco får EECP behandling på Karolinska Universitetssjukhuset/Huddinge i april 2013 av sjuksköterskorna Eline Wu och Gunilla Förstedt. – Med denna behandling har min livskvalitét ökat betydligt, säger Danny. Foto: Emil Svensson

Figur 1: Behandlingsprincip EECP; tömning och fyllning av tryckmanschetter med hjälp av synkronisering med EKG.

10

#3 2013

Figur 2. Resultat från Centralsjukhuset Kristianstad. Antal patienter med CCS klass 3-4 minskade från 84,6procent före EECP till 23 procent direkt efter EECP. Effekten kvarstår minst 12 månader.


En non-invasiv metod att hjälpa patienter med kranskärlssjukdom och kärlkramp EECP, en behandling mot bröst­ smärta, har funnits i Sverige sedan ett tiotal år tillbaka. Metoden används vid Lunds Universitets­ sjukhus/Kristanstad och på Karo­ linska Unviersitets­sjukhuset Hud­ dinge/Stockholm och flera projekt är på gång.

Behandlingen kall­as för EECP vilket står för Enhanced External CounterPulsation och har i över tjugo år framgångsrikt använts i USA för att hjälpa patienter med refraktär angina det vill säga kärlkramp som man ej kan hjälpa med kirurgiska ingrepp eller medicinering. Mellan 70 och 80 procent av patienterna blir bättre och en del blir helt besvärs­fria. Patienter med svår angina har dålig livs­ kvalité och konsumerar mycket sjukvård. Bondesson et al visade i sin studie [5] att före EECP krävde denna sjukdom i genomsnitt 4-8 inläggningar per år. Efter EECP be­hövdes endast 1–2. Ett vårddygn med intensiv­övervakning beräknas kosta cirka 110 000 kr samt givetvis stort lidande för patienten. Vidare har dessa patienter nästan sam­tliga tidigare genomgått by-pass operation och eller PTCA (vidgning av hjärtats krans­kärl med hjälp av en liten ballong) samt står på optimal medicinering men har fort­farande bröstsmärtor. Eftersom EECP är non-invasiv finns det

få kontraindikationer. De som finns är bland­ annat nyligen genomgången hjärt­infarkt eller coronar by-pass operation, uttalat klafffel, aorta aneurysm, venös trombos och graviditet. Enkel behandling

Behandlingen med EECP går till så här: Tryckmanschetter sätts på benen och stussen och EKG kopplas till hjärt­rytmen. Under hjärtats vilofas trycks sedan blod tillbaka från benen och skapar en ökad fyllning i hjärtats kranskärl under diastole. På så sätts ökas hjärtats egen blod­­försörjning. Behandlingen varar en timme och upprepas 35 gånger, vilket ger en behandlingsperiod på cirka sju veckor. Patienterna kan åka hem direkt efter behandlingen och får komma tillbaka nästa dag. På helgerna vilar man. En av fördelarna med behandlingen är att den är helt non-invasiv, det vill säga ingenting förs in i patienten. Man har inte heller sett några större biverkningar med metoden. Effekterna håller i sig i minst två år och upp till fem år enligt de resultat man sett hittills. Det pågår en stor vetenskaplig aktivitet i ämnet, många studier är gjorda och flera är på gång.

I USA används metoden som standardbehandling vid refraktär angina. Klinisk dokumentation

Listan på kliniska studier är lång (full­ständig bibliografi finns på www.vasomedical.se). Eftersom me­t­oden tar lång tid att genomföra och svår att kontrollera mot något är de flesta studier av mindre slag men resultaten pekar på samma sak. MUST-EECP [1] är en randomiserad placebokontrollerad och dubbelblind studie där resultaten gav FDA godkännande för ersättning i USA. Studien omfattar 139 patienter som randomiserades till ”aktiv” behandling manschettryck 240-300 mmHg medan kontrollerna fick 75 mmHg. Den

Tryckmanschetter sätts på benen och stussen och EKG kopplas till hjärt­r ytmen. Under hjärtats vilofas trycks sedan blod tillbaka från benen och skapar en ökad fyllning i hjärtats kranskärl under diastole. aktiva behandlingsgruppen visade på signifikanta skillnader och förbättringar i sin anginaklass. Susanne Bondesson (et al.) i Kristianstad/Lund, som skrivit sin avhandling i ämnet, har bl.a jämfört bland annat med ryggmärgsstimulering, där man opererar in en typ av pacemaker som stimuleras att avge ström då patienten känner av sin #3 2013

11


Ta kontakt om det finns frågor Om du har problem med kärlkramp och/ eller undrar över metoden ta kontakt med EECP mottag­ ningarna i Huddinge eller Kristianstad för rådgivning. Telefonnummer: • EECP mottagningen Kristianstad 044-309 23 95 • EECP mottagningen Karolinska Sjukhuset/ Huddinge 08-585 868 02 • Distributör av ut­ rustningen i Sverige, Norge och Danmark är Octopus Medical AB / www.octopus­ medical.se / 08-756 71 10.

bröstsmärta. Resultaten av studien pekar på lika bra resultat med EECP som med denna metod. Dock gör man skillnad på dessa patienter i Kristianstad. Patienterna testas först om de svarar på TENS som är en extern ström-stimulator. Om det är fallet erbjuds de ryggmärgsstimulering. De som inte svarar på TENS eller inte kan eller vill få en device inopererad erbjuds EECP.

sjuka att de flesta inte kan träna. Med med hjälp av EECP kan man komma en bit på vägen vilket gör det lättare att själv öka sin rörlighet efter behandlingen. Goda resultat

Resultaten av behandlingar med EECP är mycket goda. Det finns fyra anginaklasser (CCS - Canadian Cardiovascular Society score) där grupp fyra är i princip sängbundna. Efter behandlingen förbättras 25 Mekanism procent av patienterna med tre klasser, 25 Mekanismen bakom den positiva effekten procent förbättras två klasser och 25 procent är delvis kartlagd. Kranskärlssjukdom är en klass. De övriga 25 procenten kan man en sjukdom där kranskärlen runt hjärtat inte hjälpa med denna behandlingsform. blivit förträngda och stela. Man har sett Samma resultat påvisas i flertalet studier. tecken på att EECP kan ”rekonditionera” I Kristianstad har man behandlat 501 dessa kärl samt stimulera tillväxt av nya patienter sedan starten 2002. En avhandling kärl [2]. Kliniskt har man sett ökad myocardperfusion, efter genomförd behandling, är skriven i ämnet och samtliga artiklar till denna finns på www.lu.se. i en PET scan-studie publicerad i JACC [3]. Eline Wu RN. MNSc på Karolinska Positiva effekter på tillväxtfaktorer samt Sjukhuset/Huddinge sammanfattar ”Sedan Efter behandlingen förbättras 25 procent hösten år 2005 har vi av patienterna med tre klasser, 25 procent på hjärtkliniken, Kaförbättras två klasser och 25 procent en rolinska Universitets­ klass. De övriga 25 procenten kan man inte sjukhuset i Huddinge, hjälpa med denna behandlingsform. haft möjlighet att erbjuda EECP till patienter som besväras av kronisk och svår öppning av passiva ”sovande” kärl är en del i förklaringen. EECP behandlingen påmin- kärl­kramp. I nuläget har vi gjort drygt 100 behandlingar och vår erfarenhet är att ner i sin påverkan på hemodynamiska patienter tolererar behandlingen väl. I slutet variabler om fysisik träning sägs i en av artiklarna från Sverige [4]. Patienterna är så av förra året publicerades vår studie i en

vetenskaplig tidskrift där vi presenterade de effekter som behandlingen har haft på våra kärlsjuka patienter med avseende fysisk funktionsförmåga och hälsorelaterat livskvalitet. Studien visade att EECP har god effekt på fysisk funktionsförmågan där patienterna i genomsnitt ökade sin gångsträcka, besvärades av mindre kärlkramp och var i en bättre funktionsklass efter behandling. Den hälsorelaterade livskvaliteten förbättrades signifikant och de positiva effekterna på både livskvalitet och funktionsklass kvarstod vid sex månaders uppföljning. Vi anser att EECP bör användas i syfte att förbättra fysisk hälsa och livskvalitet hos patienter med kronisk kärlkramp.” EECP och hjärtsvikt

Hjärtsvikt är ett av områdena som ut­forskas nu och på Vasomedical Inc., som tillverkar EECP systemen i USA (se mer på: www.vasomedical.com) har man nu, för­ utom studier på refraktär angina, gjort ett flertal studier på där man ser hur hjärtsvikts­ patienter reagerar på behandling med EECP. Bla har man kört en random­iserad studie i USA; ”PEECH” [6], där man såg motsvarande effekter på livskvalité. Referenslistan finns på: medicinskaccess.se Håkan Hedin

Framtidens mötesplats This is as much Scandinavia as you can get for your money.« lonely planet ´ s best in travel 2013 votes

gothenburg the no . 2 best value destination .

Lonely Planet har utsett Göteborg till en av världens mest prisvärda destinationer 2013. Med vår vackra skärgård runt knuten kan vi garantera er en helt ny mötesupplevelse. Staden sjuder av liv och det arrangeras ofta stora internationella möten, sportevenemang och konserter. En avslappnad och vänlig stämning får man på köpet. Liksom det faktum att hotell, restauranger, affärer och nöjen ligger inom bekvämt promenadavstånd. Framtidens mötesplats tar form och flera anläggningar utökar eller renoverar. När Svenska Mässan och Gothia Towers utbyggnad är klar blir det Europas största mötesplats.

Välkommen till Göteborg. Göteborg & Co. Convention Bureau | T: 031-368 4000 E: convention@goteborg.com | corporate.goteborg.com

12

Annons_189x128.indd 2013 1

#3

2013-04-22 11:35:47


Den andra upplagan av Surgicon Congress hålls nu i juni i Göteborg. Foto: Håkan Hedin

Kirurgiska världseliten samlas i Sverige i Juni Under 2010 togs ett unikt svenskt initiativ för att lyfta upp frågan om kirurgers utbildning. Grundförut­ sättningarna inom kirurgin föränd­ ras för närvarande genom stora pensions­avgångar, reglerad arbets­ tid för nya kirurger och genom till­gången till kirurgiska simulatorer, parallellt med hårda och åter­ kommande budget­åtstramningar.

Utvecklingen ställer höga krav på en tids­ effektiv och kostnadseffektiv upplärning av nya kirurger. Problemet är internationellt och berör alla opererande specialiteter. World Congress on Surgical Training

Resultatet av ansträngningarna har blivit en internationell styrelse som träffades i Dublin 2010 och stod bakom den första upplagan av ”Surgicon Congress” eller the

1st World Congress on Surgical Training som hölls i Göteborg 2011. Mötet blev en succé och lockade 200 deltagare och 32 före­ läsare av högsta klass från 30 länder på 6 kontinenter – från Nya Zealand, Australien till Asien, Europa och USA/Canada. För att inte tappa fart bildades 10 arbets­grupper direkt efter mötet, med en global spridning och engagemang av olika specialiteter, vilka utabetat programinnehållet i den andra upplagan av Surgicon Congress som hålls nu i juni på Svenska Mässan i Göteborg. På detta sätt har man skapat ett unikt globalt nätverk av ledare inom kirurgin. Styrelsen har utvidgats till 9 personer, varav bland annat Pr Carlos Pellegrini President-elect Am College of Surgeons och Dr Ajit Sachdeva Director of Education i samma organisation ingår tillsammans med ledande kollegor från Indien, Afrika

och Europa. Kommentaren ”We like to have a Swede in the driver’s seat” är en komplimang till svenska varumärken som diplomati, kvalitet och säkerhet. Ny bok: Cutting Edges in Surgical Training

Kongressen blev den 18/4 2013 CME-ackrediterad av UEMSEACCME och under mötet lanseras en ny Margareta Berg. bok: ”Cutting Edges in Surgical Training” där 23 författare från 11 länder skrivit fritt kring ämnet. Editor för boken är initiativtagaren och grundaren av Surgicon Foundation, Dr Margareta Berg, Göteborg. Håkan Hedin

#3 2013

13


Kardiovaskulära Vår­ mötet har blivit svensk kardiologis största år­ liga sammandragning med större symposier, fria föredrag och poster­presentationer som täcker de flesta kardiovaskulära aspekter.

Ulla-Britt Orrestedt Applikationsspecialist Siemens, genomför ultraljud av hjärtat på patientmodellen Olle Lindström. Foto: Tord Amré.

Några glimtar från Svenska Hjärt­ förbundets Kardiovaskulära Vårmöte Göteborg, 17–19 april Vårmötet har blivit svensk kardiologis största årliga sammandragning med större symposier, fria föredrag och posterpresentationer som täcker de flesta kardiovaskulära aspekter. Docent Gunnar Nyberg ger här några glimtar av de sessioner han bevistade som var intressanta utifrån hans eget intresse för cirkulationen och mätning av dess funktioner.

länder. I allmänhet förordades målblodtryck på 130/80, till exempel i USA, men högre i England, och varnades för att pressa för hårt; INVEST-studien visade att D2M med CHD hade ökad Felix Böhm talade så om blodtryckets inverkan mortalitet vid på det vaskulära åldrandet, och diskuterade systoliskt tryck utförligt de tänkbara rubbningar som kan under 120. föreligga med olika kroppsegna hormoner och Ofta föreligger substanser, som påverkar endotelfunktionen. non-dipping på natten, så 24-timmarsblodtryck rekommenderades, dosering måste göras noggrant, främst för men PN drog också en lans för användning att överbehandling med för lågt diastoliskt av andra och bättre mått, såsom pulsvågsblodtryck skall undvikas. Peter Nilsson hastighet för artärstyvhet, och centralt SBP. från Malmö talade om diabetespatienterna Det var glädjande att en session hade (typ 2, förkortning D2M), och redogjorde titeln ”Kan vi påverka vaskulärt åldrande?” för att guidelines är ganska olika i olika Ett avstamp gjordes med en session om blodtrycksbehandling av riskpatienter. För patienter med genomgången kardio­ vaskulär händelse betonades att individuell

14

#3 2013

Denna session kretsade mycket kring de metoder jag länge förespråkat, nämligen mätning av artärstyvhet och endotelfunktion. Margareta Ring, doktorand från KI i Stockholm, redogjorde föredömligt klart för tillgängliga metoder. Man kan mäta cellernas telomerlängd – den förkortas med ökande ålder. Endotelfunktion mäts med flödesmedierad vasodilatation av radialiseller brachialisartären, eller med Endo­ Patsystemet. Artärstyvhet som pulsvågshastighet (PWV), pulsvågsförstärkning och centralt blodtryck göres med SphygmoCor, en något omständlig metod, eller enklare med Arteriograph, som ger alla dessa mät­ värden i en mätsekvens på 3–4 minuter. Slutligen kan intima-mediatjockleken (cIMT) i carotisartären mätas med ultra­ ljud. Som de för kliniken lämpligaste måtten förordades cIMT och PWV. Felix Böhm, också Stockholm, talade så om blodtryckets inverkan på det vaskulära åldrandet, och diskuterade utförligt de tänkbara rubbningar som kan föreligga med olika


Glada och nöjda kongressdeltagare under Kardiovaskulära vårmötet i Göteborg 17-19 april. Från vänster Caroline Lundgren, Birgitta Hammarberg, Maria Söderlund och Erica Grundin, alla från Sundsvall. Foto: Tord Amré.

kroppsegna hormoner och substanser, som påverkar endotelfunktionen, och därmed blodtrycket.

i en session, och ämnet kom också upp i en session som diskuterade varför inga idrottare drabbas av plötslig hjärtdöd.

Förlångsamma blodkärlens åldrande

Skyddseffekt mot stroke med östro­ genbehandling

Slutligen berörde Åsa Cider från Göteborg hur fysisk träning och motion kan påverka kärlåldrandet. En studie citerades bland annat som visade att hos unga var inte effekten på artärstyvheten påfallande, men hos äldre gav ett motionsprogram en minskning av artärstyvheten och en förbättring av pulsvågsförstärkningen, indirekt ett mått på förbättrad endotelfunktion. Men allt med moderation: se min artikel om Pheidippides! Kraftträning, det vill säga ”skrotlyftning”, kan ge en ökning av artärstyvheten, som dock ganska snabbt kan gå tillbaka. Jag har tidigare skrivit om detta mer utförligt i Medicinsk Access nr 2, 2012. En värdefull och välbesökt session som utmynnade i övertygelsen att det går att förlångsamma våra blodkärls åldrande. Förmaksflimmer (AF) var ett viktigt ämne som avhandlades ur flera perspektiv. Den viktigaste aspekten, risken för stroke genom embolisering, belystes med sessioner om antikoagulantia i allmänhet och nya antikoagulerande substanser, såsom apixaban. En viktig studie som relaterades var en jämförelse mellan apixaban och aspirin (ASA). Den fick brytas i förtid därför att den visade så klart att ASA inte räcker som strokeprofylax vid AF. Hur man skall konvertera AF till sinusrytm, med el-shock eller med läkemedel (till exempel det senaste tillskottet vernakalant) diskuterades

nen och åstadkomma låggradig inflammation i kärlväggen. Hur förloppet sedan kan vara för att atherosklerotiska förändringar ska uppkomma genomgicks noggrant av Isabel Goncalves, kardiolog från Malmö. Anders Holmlund, övertandläkare i Gävle, gick slutligen igenom studier som visade klara samband mellan antalet friska tänder i munnen och förekomst av CVD, och hur incidensen har minskat med förbättrad tandhälsa. Det pågår en stor multicenter-

Östrogenbehandling som förebyggande mot CVD till kvinnor fick också en genomgång. Från att ha ansetts bra och effektivt för 10–20 år sedan har senare studier föranlett en revision av den åsikten. Litteraturen är komplex och grumlas av att Östrogenbehandling som förebyggande mot olika typer av CVD till kvinnor fick också en genomgång. preparat som Från att ha ansetts bra och effektivt för 10–20 år inte är helt sedan har senare studier föranlett en revision av jämförbara. En den åsikten. mycket kompetent genomgång studie med samarbete mellan tandkliniker av Åsa Tivesten, Göteborg, Lena Jonasson och medicin­kliniker i olika centra i Sverige, från Linköping och Karin Leander från som förhoppningsvis skall ge besked om Stockholm. Leander, som är epidemiolog hur viktig denna livsstilsfaktor är för hjärtoch bearbetar stora registerdata kunde hälsan. Det finns en hel del studier som presentera några preliminära resultat från påvisar samband mellan PWV och CVD, några stora kohorter. Slutsatsen för dagen som jag avser att återkomma till i ett komvar att det sannolikt finns en viss skyddsefmande nummer av Medicinsk Access. fekt mot stroke med östrogenbehandling. Slutligen vill jag nämna ett litet udda ämne: finns det ett samband mellan tandGunnar Nyberg lossningssjukdom, det vill säga parodontit Docent, avd. för (PD), och hjärtsjukdom. Björn Klinge, klinisk fysiologi övertandläkare i Stockholm visade på en Sahlgrenska undersökning där 88 procent av infarkt­ Universitetssjukh. patienter hade PD, medan endast 30 Göteborg procent av friska kontroller hade det. Ett ggnyberg@ samband är möjligt genom att bakterier glocalnet.net från tandfickor kan tränga ut i cirkulatio#3 2013

15


Finns det en Pheidippideskardiomyopati?

– eller hur går det för långlöparen i det långa loppet? Pheidippides var löparen som skickades från Marathon att meddela hemma i Aten att deras armé hade segrat över perserna. Namnet är belagt, han skall ha levat 530-490 FVT. Enligt berättelsen skall han ha ropat ”Stor glädje, segern är vår” (chairete nikomen) och sedan fallit ner död (se figur 1). Han var en hemerodrome vilket betyder ungefär ”professionell löpande kurir”.

Denna historia, som berättas av historieskrivaren Lucian (125-180 E Kr) är troligen en skröna. Den finns inte hos Herodotos som skrev sin historieuppteckning cirka 440 FVT. Han skrev om Pheidippides i en annan löparbragd istället. Atenarna ville ha hjälp av Sparta mot perserna och skickade P. den 246 km långa vägen dit, vilket han gjorde på 2 dagar. P vädjade till Sparta som ställde sig positiva men enligt deras regler måste de invänta fullmåne innan de kunde rycka ut i strid, och under den tiden marscherade perserna mot Aten, vägledda av Hippias, tidigare envåldshärskare i Aten som flytt till Per16

#3 2013

sien när Aten blev en demo­krati. Perserna ville återinsätta Hippias som tyrann. Men Pheidippides hade mött guden Pan på den där Spartaresan, som hade bett honom framföra till Aten att de skulle uppmärk­samma honom mer, för han var på deras sida. När han återkom till Aten och fram­förde hälsningen byggde atenarna ett tempel åt Pan. Som tack kämpade Pan på atenarnas sida och använde sin särskilda för­måga att hos fienden framkalla oresonlig fruktan och förlust av vettigt tänkande. Han orsakade helt enkelt panik, ett ord härlett från guden Pan. Skrönan om maratonloppet inspirerade

den engelske poeten Robert Browning till ett högstämt ode (1879), som senare inspirerade grundarna av de moderna olympiska spelen till att göra maratonloppet till åminnelse av denna bragd. Loppet Aten-Sparta, som alltså är historiskt väl belagt, återupplivades 1982 av 5 brittiska flygofficerare som ville testa om det gick att göra på 2 dagar. John Scholltens hette den som sprang snabbast, på tiden 34:30 tim. Sedan 1983 löps loppet varje år. Fortfarande står sig rekordet 20:25:00 för män från 1984, satt av greken Yiannis Kouros. Damer springer numera också loppet, rekordet innehas av engelskan Elizabeth Hawker, på 27:02:17, satt 2012. Någonstans på vägen finns en stilig staty av den första maraton­löparen (figur 2). Kan motion orsaka hjärtmuskelfibros?

Mitt intresse för Pheidippides fångades nyligen av diskussion på en mycket informativ


Figur 1, till vänster. Pheidippides stupar framför styresmannen i Aten och utropar sina sista ord i livet: ”stor glädje! vi har vunnit”. Målning av LucOlivier Merson 1869. Figur 2, ovan. Staty av Pheidippides på vägen mellan Marathon och Aten.

nätsida om hjärtsjukdomar, som heter www. theheart.org. Större och aktuella studier ur tidskrifter och större kongresser refereras och ger ofta upphov till livlig diskussion. I efterdyningarna till American College of Cardiology’s årliga möte nyligen skrev signaturen JMM en spalt med titeln ”Kan motion orsaka hjärtmuskelfibros? Snälla ni, säg inte att motion kan orsaka hjärtsjukdom!” Signaturen skrev, motvilligt, att vi inte egentligen vill höra att det skulle finnas problem med motion (termen ”exercise” är nog egentligen ett vidare begrepp än motion, men att skriva ”fysiskt arbete” är för klumpigt). Dock: ett föredrag vid kongressen hade påvisat att mångårigt utövande av uthållighetssporter definitivt ökar risken för förmaksflimmer (B Olshansky, Iowa). Detta gällde endast män, inte kvinnor. Vad skulle mekanismen kunna vara? R Lampert (Yale) presenterade data som kunde förklara detta med interaktion

fibrösa ärr i företrädesvis höger kammare och septum hos en betydande minoritet av maratonlöpare. Man har konstaterat ökning av hjärtenzymer och högerkammar­ dysfunktion efter maratonlopp. Men det finns motsägande data. Dr K Barkley från Texas hade undersökt 93 friska äldre med minst 20 års långdistanslöpar­anamnes. Fysisk arbetsförmåga korrelerade väl med rapporterad träningsdos. Ingen av de under­sökta hade myokardärr vid MRIundersökning. Att promenera är människans bästa medicin

Slutsatsen JMM drar blir att det finns nog en dos-responskurva, antagligen är den mycket individuell, möjligen på genetisk bas. Det är möjligt att motionera till en pro-arytmisk nivå. Superbra kondition vaccinerar inte mot hjärtsjukdom. (Senare har jag sett att JMM är en Dr John Mandrola, elektrofysiolog, som också har en egen hemsida www.drjohnm.org). Dock: ett föredrag vid kongressen Detta inlägg gav upphov till hade påvisat att mångårigt utövande många nya diskussionsinlägg. av uthållighetssporter definitivt ökar Den förste gav sig själv som risken för förmaksflimmer… exempel på att långvarig tyngdlyftarträning också kan orsaka mellan hög vagustonus i förening med förmaksflimmer. Nr 2 meddelar att han har häftiga adrenalinstötar. Detta går ihop många vänner i 50-årsåldern med anamnes med kända proarytmiska effekter av vagus på maratonlöpning under 30+ år. De talar och nor­adrenalin på aktionspotentialer och ständigt om sina ablationer (i förmaken elektrisk heterogenitet, respektive ökad alltså) och hjärtmediciner! automaticitet och ektopi. Nr 3 var en kvinna som fick infarkt. Hon Finns det alltså något som kan kallas hade simmat, sprungit och dansat i överPheidippides-kardiomyopati? Det finns mått. Hippokrates citeras: Att promenera är teorier: kortvarig inflammation orsakar människans bästa medicin. Nästa vittne var

också kvinna, en tränare, som tyckte sig ha funnit mer arytmi hos löpare, mindre hos cyklister. Ett längre inlägg av Dr John C Hagan, redaktör för Missouri Medicine Medical Journal, behandlar farligheten av för mycket träning. Själv är han ett levande bevis för detta. Som ”author’s disclosure” anger han sin ålder, 69 år, som sedan 43 år tillbaka har sprungit totalt ett 30-tal långlopp (mest halvmaror), fått förmaksflimer och har hög koronarkalksförekomst men i övrigt normal hjärtfunktion. Han gav också en länk till en video som visade hur Normann Stadler, tvåfaldig Iron Man segrare, diskuterade sitt aortaklaffel. Ett inlägg menade att interaktionen av för mycket motion och alkohol är farlig. En Dr Sid Nelson ger litet mer fakta än de ovannämnda mer anekdotiska vittnes­ börden. Han hänvisar till en översiktsartikel av Sattelmair et al (Circulation 2011;124:789795). I 9 studier där man kunde tala om olika doser av motion, konstruerade han en dos-respons-kurva. De fann att för män var det ingen ytterligare nytta med motion som krävde över 800 kcal/vecka. För kvinnor låg gränsen vid 500 kcal/vecka. Aldrig tar hänsyn till D-vitaminstatus

I en stor studie (Aerobics Center Longitudinal Study), som kom senare än nyss nämnda översikt och omfattade 52 000 män och kvinnor, befanns löpning 6-7 gånger per vecka i lugn takt (8 km/tim) ge en mortalitets­incidens som bara var 10 procent lägre än för den helt inaktive. Men inte nog med det, dos-responskurvan var #3 2013

17


U-formad så att vid högre motionsgrad minskade skillnaden mot de inaktiva. (Lee DC et al, presentation 3471 vid Am Coll Sports Med Ann Meeting 2012. Se även O’Keefe JH et al, Mayo Clin Proc 2012;87:587-95). Nelson framkastar till och med tanken på att det kanske är fråga om omvänd kausalitet: Att det är de redan friska som är villiga att motionera så mycket, och att skillnaden till ickemotionärerna beror på att de är de som inte vill eller kan motionera så mycket av allehanda skäl, bland annat andra sjuk­ domar, eller bara lättja. Nelson menar också att motionsstudier aldrig tar hänsyn till D-vitaminstatus. Självklart måste det vara så att motionärerna är utomhus mycket mer än kontrollerna och därför får högre 25-OH-D3-nivåer. Scagg et al (Aust NZ J Med 1995;25:218-23) visade i en studie att (citat) ”de som är inaktiva har lägre nivåer av vitamin D; detta kan delvis förklara deras ökade risk för kardiovaskulär sjukdom (CVD)”. Den senaste stora epidemiologiska studien av CVD och mortalitet där man undersökt 25-OH-D3nivåer är The Danish Copenhagen Study (Brœndum-Jacobsen P et al, Artscl, Thromb & Vasc Biol 2012;32:2794-2802). Man fann där, hos 10 170 personer, att med avseende på plasmanivåer av 25-OH-D3vitamin, hade de som låg inom percentil 1-4 40 procent ökad risk för ischemisk hjärtsjukdom jämfört med dem inom percentil 50-100. Motsvarande siffror för hjärtinfarkt resp. kardiovaskulär död var 64 resp. 81 procent. Författarna hade också gjort en meta-analys av 18 resp. 17 andra studier där man kunde bestämma risken för lägsta och

18

#3 2013

högsta kvartilen, och siffrorna var väldigt likartade i denna analys. I andra metaanalyser (Reid IR & Bolland MJ. Heart 2012;98:609-14 och Lavie CJ et al, JACC 2011;58:1547-56) som fokuserar på om substitutionsterapi skulle göra någon skillnad poängterar man att hittillsvarande studier ännu inte gett något statistiskt säkert resultat, men att 2 större kontrollerade studier f.n. pågår, som bör kunna ge svar på den frågan. Slutligen ställer Sid Nelson också frågan om nötningseffekter på kroppen i övrigt är värt insatsen av att springa långlopp. Hur är förekomsten av led- och muskelskador, och rena olycksfall, vägs de in i totala balansen om hälsoeffekten av motion i hög dos? High Intensity Interval Training

James J King är en herre som är mycket flitig i dessa diskussionsspalter. Han förutspår att substitutionsterapi med vanliga D-vitaminpiller inte kommer att fungera, då han påstår att endast sulfatet, som är det av solen naturligt bildade D-vitaminet, är verksamt. Det tror dock inte Sid Nelson på då han refererar till Vacek JL et al (Am J Cardiol 2012;109:359-63), där vitaminD-behandling till 70,3 procent (av 10 899) patienter som hade för låga serumvärden av D-vitamin gav en mycket signifikant minskning av minskad dödlighet. Under 68 månaders uppföljning var hazard ratio för död 0,39 (CI 0,28-0,53, p<0,0001) hos dem som tog D-vitamintillskott. Se även figur 3 och 4 som visar kumulativ mortalitet hos dem med låga (<30 ng/ml) resp. höga (>30 ng/ml) 25-OH-D-nivåer i serum, samt mot-

svarande bild för dem som tog resp. inte tog D-vitamin. Ett viktigt fynd var att de som hade normala nivåer av 25-OH-D-vitamin i serum hade ingen nytta av D-vitamin-

Hur är förekomsten av led- och muskel­ skador, och rena olycksfall, vägs de in i totala balansen om hälso­effekten av motion i hög dos? tillskott. Ett vägande skäl till att verkligen kontrollera nivån, särskilt vintertid i vårt mörka land. JJ King hade också bestämda åsikter om maratonlöpning i ett inlägg. ”Kalk i koronarkärlen ljuger inte” säger han, och påstår att detta alltid är ökat hos dem som löper många maratonlopp. Hans teori är att så långvarigt arbete utarmar cellen på ATP, varvid Na-K-pumpen fallerar och tvingar in calcium. Han ansåg också, utan att presentera bevis för det, att High Intensity Interval Training (HIIT) är en bra form av träning, men bör kombineras med intag av anti-oxidanter för att motverka den mängd fria syreradikaler som då bildas. HIIT innebär måttlig ansträngning avbruten av korta maxansträngningar som skall få upp hjärtfrekvensen till max för åldern under 1-2 min, och som uppenbarligen börjar vinna terräng. Som ytterligare ”grädde på moset” kom just en ny notis från theheart.org, som citerar en studie där man jämfört inaktivitet med olika grader av aktivitet (www.theheart.org/article/1527391). Det är en analys av Women’s Health Initiative (kohort 1), så det gäller postmenopausala


Figur 6: Akuta och kroniska förändringar i kärlstruktur och funktion som uppkommer vid lång­ distanslöpning. MMP = matrix metallproteinas, TGF = transforming growth factor, TIMP = tissue inhibitor of MMP. Från KS Heffernan, Clin. Cardiol 2012;35:65-8.

kvinnor. I huvudsak fann man hos >71 000 kvinnor i åldern 50-79 år att hos dem som rapporterade stillasittande över 10 timmar per dag var risken för CVD (hazard ratio) 1,15 (CI 1,05-1,25) jämfört med sittande mindre än 5 timmar per dag. Den ökade risk var oberoende av ansträngningsgrad!

Slutsatsen är att om man inte vill eller kan motionera ska man åtminstone inte sitta. Den minskade visserligen med ökande ansträngningsgrad, men blev lika först vid hög ansträngningsgrad. Slutsatsen är att om man inte vill eller kan motionera ska man åtminstone inte sitta. Man kan minska risken genom att vara uppe. Frågan är vad man gör då? Litet rör man i alla på sig, men det kanske är så långsamt att det knappast blir någon mätbar aktivitetsgrad. Vilka förhållanden i övrigt kan göra cirkulationen och hjärtat känsliga? Vlachopou8los et al (Am J Hypertens 2012;23:9749) har visat att maratonlöpare i vila har högre pulsvågshastighet (PWV) än ålders­ matchade normalaktiva men liknande blodtryck och augmentationsindex (AIx). De hade också undersökt effekten av ett maratonlopp omedelbart efteråt, och funnit att blodtryck och AIx sjönk men PWV förblev oförändrat. En annan omfattande studie av 25 frivilliga löpare, medelålder 55 år (21 män) har gjorts av Karlstedt E et al (J Cardiovasc Magn Res 2012;14:58-64). Man undersökte dem en vecka före och efter ett maratonlopp, samt omedelbart efter loppet med biomarkörer, ekokardiografi och MRI. Omedelbart efter loppet var kreatinkinas ökat cirka 7 gånger, myoglobin cirka 15

Ernst Mensen.

ggr och specifikt troponin T från 0 till 0,52 mikrog/L. Funktionsmässigt såg man högerkammardysfunktion. En vecka efter loppet var allt i stort sett normaliserat. Kevin S Heffernan har rett ut vilka akuta och kroniska förändringar som sker hos långlöpare vad beträffar kärlens struktur och funktion och detta ses bäst i figur 6. Den långvariga kraftiga ansträngningen ger, via bildning av mycket syreradikaler, nedsättning av endotelfunktion, som i sin tur leder till koronarischemi och nedsatt koronarperfusion på grund av att den trötta muskeln inte förmår uppehålla tillräckligt diastoliskt tryck i aorta. Detta ökar också risken för arytmier och förmaksflimmer. Förändringar i matrix metalloproteinaser och vävnadsinhibitorer av dessa ger en ökad vaskulär fibros, och i kroniskt till­stånd blir aorta och artärerna styvare, glattmuskelcellerna hypertrofierar, man får ökad pulsvågsreflektion och pulstryck, som sedan leder till vänsterkammarhypertrofi och förmaksförstoring. Det är i sanning ingen sinekur för hjärta och kärl att springa maraton. Långloppens värsting

Jag ska avsluta med att berätta litet om tidernas värsting när det gäller långlopp. Det är en norrman vid namn Ernst Mensen som föddes 1795 (sic), dock under ett annat namn: Mons Monsen Öyri. Han tog tjänst i engelska handelsflottan och sprang första gången i Kapstaden ett långlopp som han vann. Sedan blev det längre lopp i England och han försörjde sig på att springa, sannolikt också på vadslagning om hur han skulle lyckas. Så t.ex. sprang han ParisMoskva (2500 km) på 14 dagar. Han skulle få 3800 Francs om han gjorde det under 15 dagar, men när han kom fram till Kreml var han så trasig och medtagen, att man

trodde först han var en tiggare. Men han fick sina pengar. Andra lopp han sprang var Paris-Istanbul och Paris-Rom. 1841 anställdes han av en tysk greve som var intresserad av antropologi och geografi i norra Afrika. Han fick stöd för att springa igenom Afrika, och gärna också finna Nilens källor. Han sprang via Turkiet och Jerusalem till Kairo, sedan vidare söderut längs Nilen till Assuan. Där ändades sorgligt nog hans dagar – han dog i kolera. Hans grav lär finnas i Assuan, dock numera dränkt av den moderna dammen. Många som springer långlopp tror att han fuskade, åtminstone vad beträffar de riktigt långa loppen. Han skall ha sprungit London Liverpool, 241 km, på 32 timmar, och det är alls ingen omöjlighet – jämför med Spartathlon ovan, som löps varje år. Till slut landar man i den gamla maximen att allt som går till överdrift är skadligt och mot naturen. ”Att gå är människans bästa medicin” sade redan Hippokrates. Kan man inte gå ska man åtminstone inte sitta stilla för mycket, bara det är nyttigt. Personligen tror jag inte på att springa överhuvudtaget om man är 60+, möjligen åka skidor, men olycksfallsrisken blir ju större med åren också. Men kanske det också har betydelse att man motionerar ute och får sin D-vitamin­ produktion tillgodosedd. Gunnar Nyberg Docent, avd. för klinisk fysiologi Sahlgrenska Universitetssjukh. Göteborg ggnyberg@ glocalnet.net

#3 2013

19


Joakim Alfredsson tar emot lovord och pris av professor Lars Wallentin.

Vårmötet samlade uppemot 1 300 kongressdeltagare Årets Kardiovaskulära vårmöte samlade uppemot 1300 kongress­ deltagare, vilket är fler än på många år. Svenska Mässan i Göteborg var mötesplats och mötet arrangerades av Malmö Kongressbyrå.

På vårmötet deltog både läkare, sjuk­ sköterskor med fler från hela landet. Industrin var väl representerade och visade såväl nya läke­medel som äldre beprövade. Även den medicintekniska industrin fanns på plats. Stenestrandstipendiet delades ut under vårmötets andra dag. Årets stipendium 20

#3 2013

tilldelades Joakim Alfredsson Universitetssjukhuset Linköping. Joakim Alfredsson presenterades av professor Lars Wallentin, som betytt så väldigt mycket för kardiologin både inom Sverige samt i övriga världen. Joakim blev dubbelspecialist i intern­ medicin och kardiologi 2003 och har sedan dess varit anställd i Linköping. Joakims såväl kliniska- och forskningsintresse finns inom akuta koronara syndrom. Han försvarade sin avhandling om köns­perpektivet inom NSTEACS i september 2009. Hans specialintresse är trombocytfunktion,

framför allt inom det mest akuta skedet. Joakim har en förmåga att framgångsrikt kombinera laborativ forskning med klinisk forskning. Han har mycket goda kunskaper och stor erfarenhet av registerforskning och som grundades då han skrev sin avhandling på material insamlat i SWEDEHEART. Intresset har idag fokuserats på blödningskomplikationer under och efter en akut kranskärls-episod, med ett uttalat syfte att i förlängningen kunna individualisera den trombocythämmande behandlingen. Tord Amré Källa: Svensk Medicin AB


By reducing CV mortality with Brilique® (ticagrelor)* vs clopidogrel* in the treatment of ACS

lives could be saved 1

Brilique* treatment provides efficacy for 12 months in a broad spectrum of ACS patients regardless of management strategy and diagnosis 2,3 • Brilique* significantly reduced CV mortality with 21 % (RRR 21%, ARR 1.1% p=0.001) vs. clopidogrel* in 12 months.1 •

Brilique* significantly reduced the combined risk of CV death, MI or stroke vs clopidogrel*, with the benefit being seen in risk reduction already at 30 days 12 % (12 % RRR, 0.6 % ARR, P=0.045) and continuing to increase throughout the full 12-month treatment regimen 16 % (RRR 16 %, ARR 1.9 %, P<0.001).1

Brilique* provides efficacy, without an increase in overall total major bleeding and major fatal life-threatening bleeding events. Non-CABG major and non-procedural major and minor bleeding were significantly higher with Brilique* vs clopidogrel*.1

A130417T0912-39394-SWE-00

* In combination with ASA. 1 Wallentin L et al. N Engl J Med 2009; 361:1045–57 and Supplement. 2 Brilique SmPC. 3 Wallentin L et al. The Lancet 2010; 376:1320–28. Brilique (ticagrelor) Rx F SPC 2012-10-24 är ett trombocythämmande läkemedel, en cyklopentyltriazolopyrimidin (CPTP). Indikationer: Brilique, givet tillsammans med acetylsalicylsyra (ASA), är indicerat för prevention av aterotrombotiska händelser hos vuxna patienter med akut kranskärlssjukdom (instabil angina, icke-ST-höjningsinfarkt (NSTEMI) eller ST-höjningsinfarkt (STEMI) inklusive patienter som behandlas medicinskt och patienter som behandlas med perkutan koronarintervention (PCI) eller kranskärlskirurgi (CABG)). Förpackningar: Brilique finns i styrkan 90 mg i följande förpackningsstorlekar: 56 och 168 tabl kalenderblister (med sol-/månesymboler) samt 100x1 tabl perforerade blister. För information om kontraindikation, försiktighet, biverkningar, pris och doseringar, se www.fass.se

AstraZeneca AB AstraZeneca Sverige 151 85 Södertälje Tel 08-553 260 00 www.astrazenecacv.se


Durewall Institutet utbildar inom förflyttningsteknik samt hur man kan bemöta personer som i sin sjukdom blir utagerande och våldsamma. Foto: Tord Amré.

Hur bemöta personer som i sin sjuk­ dom blir utagerande och våldsamma? Fakta Durewall Institutet AB Grundat: slutet 1960. Sveriges äldsta utbildningsföretag inom förflyttning och mjukt självskydd Utbildar inom för­ flyttningskunskap, mjukt självskydd och ergonomi. Kunder: kommuner, landsting, privata vårdföretag och assistansföretag. Huvudkontor i Göte­ borg. Utbildar i hela Sverige www.durewall.se

Parallellt med Svenska Kardiovaskulära Vårmötet ar­ rangerades två andra stora mässor, också på Svenska Mässan. De var ”Leva och Fungera” samt ”Vitalis”.

Vitalis är en mötesplats för informationsteknik inom vård och omsorg.Namnet kommer från latinets vita, liv och IT, informationsteknik. Leva och fungera är Nordens största mässa för personer med funktionshinder. Besökare är brukare, anhöriga, personliga assistenter, vårdpersonal med mera. En stor blandning av utställare och besökare. En av utställarna, Durewall Institutet, är en veteran inom sitt område. De utbildar inom förflyttningsteknik samt hur man kan bemöta personer som i sin sjukdom blir utagerande och våldsamma. Redan i slutet av 1960-talet startades utbildning inom mjukt självskydd för vårdpersonal. Arbetar enligt en egen metod

Man arbetar enligt en egen metod, Durewallmetoden. En arbetsmetodik som har ett antal principer som grund och där etik och värdighet är den främsta. Varför är ni med på Leva och fungera? – För oss är det ett bra forum för att träffa kunder och samarbetspartners, säger Barbro Axelsson. Men också för att kunna berätta för t ex föräldrar om att det faktiskt finns hjälp att få med förflyttningar och kanske ännu viktigare vid utagerande beteenden. Gott fysiskt bemötande

Under vårt samtal kommer vi hela tiden tillbaka till vikten av händer och ett gott fysiskt bemötande. Vad är det egentligen? – Vi använder våra händer i allt vi gör. Inom vården är de av­görande, men hur använder vi dem? Hur känns de? Vad för­ medlar vi med händerna? Vilka grepp använder vi? Var tar vi och framförallt var tar vi inte? I våra utbildningar lägger vi stor 22

#3 2013

vikt vid handkunskap och kroppshanteringsmetodik. Det vill säga kunskapen om hur vi tar i en annan människa på ett mjukt och värdigt sätt. – Även personal från äldreomsorgen och demensvården kommer på våra utbildningar. Det handlar om att kunna hantera situationer som kan upplevas som svåra och ibland hotfulla. Det kan vara hårtag, fasthållningar, spark och slag. Utbildningarna är praktiska och man får träna på en rad olika situationer, men givetvis tar vi även upp vikten av det förebyggande arbetet. Utbildningarna är mycket uppskattade eftersom de är hands-on och ger redskap som kan användas direkt i verksamheten. Många berättar för oss att de känner sig mycket tryggare efter utbildningen, säger Barbro Axelsson till Medicinsk Access. Svenskt Demenscentrum har uppmärksammat Durewall Institutets utbildningar och de är nu rådgivare till dem i deras arbete med att utveckla webutbildningar för hemtjänst och äldreboenden. Deras arbete skall leda till ett antal tips och råd kring värdiga och trygga förflyttningar samt att kunna hantera våldsamma situationer. Utan att kränka eller skada den boende. Tord Amré


En av nyheterna från Företaget Lewel Plus från Danmark visades upp på Leva & Fungera. Plejeseng , inbyggd rotormekanism under madrassen. Foto: Tord Amré.

Leva och fungera är Nordens största mässa för personer med funktionshinder. Besökare är brukare, anhöriga, personliga assistenter, vårdpersonal med mera. Foto: Tord Amré.

!

ok Ny b

ben b u l okk

ib

Handbok för klinisk Genusmedicin Genusmedicin är ett viktigt nytt område i hälsa och sjukdom. Biologiska och sociala faktorer som ligger till grund för mottagligheten för sjukdomar och dess konsekvenser.

sid. 57! Beställningstalong på ATAAGCATCACGGTATCCAATGATAAGCATGATAAGC TCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGC TCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAEditors AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGAGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATA-

Handbook of Clinical Gender Medicine Karin Schenck-Gustafsson Paula R. DeCola Donald W. Pfaff David S. Pisetsky

ACGGTATCCAATGATAAGCATGATAAG

Boken täcker tolv olika medicinska områden, ger praktisk och användbar information. Författarna ACGGTATCCAATGATAAGCATGATAAG till denna handbok är alla experter som visar den CAATGATAAGCATCACGGTATCCAATGATA AGCATCACGGTATCCAATGATAAGCATGATAAG medicinska förståelsen och behandlingen av bl.a. TATCCAATGATAAGCCGGTATCCAA hjärtsjukdom, benskörhet, artrit, smärta, våld m. m. Av: K. Schenk-Gustafsson, P. R. DeCola, D.W. Pfaff och D. S. Pisetsky.

+ 450 kr

porto

Kontakta Tord på 0652-151 10 eller info@tmmedia.se #3 2013

23


Dormiplant

TM

500 mg valeriana

ww

w. fa

ss.

se

SoV gott

– vakna utvilad Dormiplant 500 mg är ett växtbaserat läkemedel som innehåller torkat extrakt från valerianarot. Dormiplant 500 mg används för lindrande av milda nervösa spänningstillstånd och sömnstörningar. SE_Dormiplant_Ad_MedicinskAccess_1012_210x297

Läs bipacksedeln noga innan användning. Finns på apoteket och i välsorterade hälsobutiker

Vi finns på Medicinska Riksstämman, monter nr. A01:33. Kom och besök oss. Välkomna!

08-36 30 36 • www.pharmanord.se


Kan kardiovaskulär sjukdom före­ byggas med lipidsänkande terapi? – Gamla och nya rön ifrågasätter nuvarande praxis. Aktuell statistik från Socialstyrelsen visar att förskrivningen av statiner accelererar i Sverige [1]. Mellan 2006 och 2009 ökade andelen personer av manligt kön i samtliga åldrar som förskrevs kolesterolsänkande läkemedel från 8, 4 till 9,5 procent. Mellan 2008 och 2009 ökade förskrivningen bland män med 5,4 procent och kvinnor med 6,5 procent. Detta innebär att nume­ ra över 800 000 svenskar årligen ordineras dessa medel i syfte att minska risken för kardiovaskulär sjukdom. Sådana bästsäljare bland läkemedel tar man för givet är effektiva och håller vad de lovar. Men faktum är att den pre­ ventiva effekten kraftigt ifrågasätts av nya studier, skriver här docent Ralf Sundberg, Malmö och Tore Scherstén, professor emeritus, Båstad.

All läkemedelsbehandling måste kunna motiveras utifrån en dokumenterad nytta för patienterna. När det gäller läkemedel som förmår bota en sjukdom som halsfluss eller häva ett symtom som ett astmaanfall är sådan nytta tämligen enkel att påvisa även i det enskilda fallet. Symtomen ger ju vika. Annorlunda förhåller det sig med läkemedel som ges för att förebygga en viss sjukdom, som i exemplet lipidsänkande terapi och hjärtinfarkt. En inträffad infarkt bevisar inte att behandlingen varit utan verkan och inte heller en utebliven infarkt kan tolkas som att behandlingen haft effekt. Randomiserade kontrollerade studier är således nödvändiga, men som vi skall se är varken genomförandet eller tolkningen av primärpreventiva studier alltid helt okomplicerad. Eftersom alla läkemedel har biverkningar och då även allvarliga sådana kan

förbli okända i många år – vem minns inte Vioxx-skandalen – borde därför endast en påtaglig reduktion av totalmortaliteten accepteras som grund för primärpreventiv behandling i stor skala. Statiner har i många år ordinerats till hundratals miljoner över hela världen, i tron att kolesterolsänkning verkligen förmår minska dödligheten. Två nyligen publicerade metaanalyser sätter nu strålkastarljuset på att vad de flesta trott sig veta om statiner som primärprofylax visar sig vara en illusion eftersom effekten vid närmare granskning i stort sett saknas [2,3]. Detta borde inte komma som någon överraskning. Primärprevention med statiner tidigt ifrågasatt

Redan 2004 publicerade det statligt initierade Nätverket för läkemedelsepidemiologi

(NEPI) en rapport med den provocerande titeln ”Kan läkemedel förebygga ohälsa?” [4]. Farmakologiprofessorerna Gunnar Lindeberg och Arne Melander utgick i denna från ett antal räkneexempel om absolut riskreduktion (AR) och ”number neaded to treat” (NNT) från kända studier, till att kalkylera fram hur många liv en allmänläkare kan rädda om gängse riktlinjer vid behandling av typ 2 diabetes, hypertoni eller hyperkolesterolemi följs. Resultaten av deras beräkningar borde ha fått många receptpennor att tveka eller darra redan då. Författarna ställde frågan: Vad krävs för att undvika ett dödsfall årligen genom blodfettssänkande behandling (statin) vid primär prevention. De besvarade sin fråga

Om siffror som dessa hade beaktats, hade primärprofylax med statiner knappast kunnat komma i fråga. genom att referera till West of Scotland COronary Prevention Study (WOSCOPS) från 1992 [5]. NNT i denna var 556 per år. Om således ett dödsfall per år bland som i detta fall medelålders män kunde undvikas, beräknade dessa läkemedelsepidemiologer att för svenska förhållanden skulle detta innebära att en genomsnittligt arbetande #3 2013

25


Historien har upprepade gånger visat att vetenskapliga samman­ slutningar misstar sig när makt och pengar står på spel. Men för de som vill att läkaryrket även i framtiden bör vila på såväl etiska som vetenskapliga grunder snarare än kommersiella, är gamla misstag i dessa avseenden något som bör exponeras snarare än döljas.

utvecklade formulerings­konst. Risken att dö av infarkt skulle således om siffran nu varit signifikant ha reducerats med 0,03 procent per år vilket ger ett NNT på 3333. Av större intresse är att totalmortaliteten i behandlingsgruppen var 2,4 procent mot kontrollernas 2,3 procent. Om siffror som dessa hade beaktats, hade Trots allt har primärpreventiva primärprofylax med statiner studier ändå visat att statiner förmår knappast kunnat komma i minska antalet större kardiovaskulära fråga. händelser med upp till 37 procent Tvärtemot gängse föreställningsvärld förefaller alltså statiner sakna eller som bäst ha en obetydlig Ett annat minst lika känt exempel NEPI effekt på kardiovaskulär och total morinte tog upp är AFCAPS/TexCAPS, ledd av talitet vid primärprofylax. Men att NEPI presidenten i American Heart Association kom till denna slutsats redan för 9 år sedan professor Antonio Gotto. Den beskrevs i fick inget genom­slag i klinisk praxis vilken media 1998 som en stor framgång, eftersom för­ändrats i motsatt riktning sedan dess. antalet ”major coronary events” i form av Frågan är huruvida vi vid dags dato i högre ”fatal or nonfatal myocardial infarction, grad än då är beredda att acceptera fakta på unstable angina, or sudden cardiac death” området i ljuset av två färska metaanalyser, reducerades signifikant med hela 37 procent [6]. Denna imponerande siffra var emellertid vars slutsatser är svåra att passera. den relativa riskreduktionen. Den absoluta riskreduktionen för större hjärthändelser Två metaanalyser visar ingen eller uppgick till endast 2,0 procent under de obetydlig effekt på totalmortalitet drygt fem år studien pågick eller 0,3 procent Juni 2010 publicerades i Archives of Interper år, vilket ger ett NNT på 256 per större nal Medicine en metaanalys från en forshjärthändelse. Dessutom var reduktionen kargrupp vid institutionen för primärvård av hjärtmortalitet för­vånansvärt låg, endast vid Cambridge University [2]. Författarna 0,1 procent i AR och inte signifikant vilket noterade att de flesta studier kring statiner man kan förledas tro av författarnas väl som citeras avser patienter med redan allmänläkare i så fall skulle behöva arbeta 16,3 år för att förebygga ett dödsfall. Detta förutsatt att resultaten från WOSCOPS hade varit signifikanta, vilket de nu inte var, samt även antogs ha gällt för kvinnor. Men var NEPI:s räkneexempel representativt?

26

#3 2013

etablerad kardiovaskulär sjukdom medan primärpreventiva studiers resultat sällan nämns. De identifierade 11 randomiserade kontrollerade studier med uppgift om totalmortalitet. Dessa omfattade 65 229 deltagare som uppgavs vara fria från kardiovaskulär sjukdom. Någon statistisk signifikant sänkning av mortaliteten kunde inte påvisas bland dessa.  Januari 2011 publicerades en Cochranestudie, som inkluderade 14 primärpreventiva studier av statiner med minst 12 månaders duration och 6 månaders uppföljning [3]. I denna genomgång som omfattade 34 272 deltagare sågs statiner visserligen orsaka en numerärt obetydlig men dock signifikant reduktion av total­ mortaliteten. Detta uppvägdes av en minskad revaskulariseringsfrekvens, till synes utan biverkningar. I konklusionen ansåg sig emellertid författarna ha grund att misstro dessa siffror, då de fann bevis för selektiv rapportering av utfallen, brister i biverkningsrapporteringen, samt inte minst att patienter med känd hjärtkärlsjukdom hade inkluderats i strid med protokollen, vilket måste ha snedvridit utfallen till förmån för statiner. Författarna ansåg sig därför ha anledning till en försiktig varning: “Only limited evidence showed that primary prevention with statins may be cost effective and improve patient quality of life. Caution


should be taken in prescribing statins for primary prevention among people at low cardiovascular risk”.* Dessa betydelsefulla studier har nämnts, visserligen i bisats i en animerad debatt i LT, men innehållet torde gått Läkarkåren förbi [7]. Effekt på hjärthändelser men inte hjärtdödlighet – en paradox

Detta borde tolkas som att grunden för dagens riktlinjer för profylax med lipidsänkande preparat till personer utan etablerad kardiovaskulär sjukdom saknas. Eller finns det en annan och säkrare grund? Trots allt har primärpreventiva studier ändå visat att statiner förmår minska antalet större kardiovaskulära händelser med upp till 37 procent. Med större kardiovaskulära händelser menas som nämnts dödlig hjärtinfarkt, icke dödlig hjärtinfarkt plötslig hjärtdöd och instabil angina. Siffror som dessa kan vara förföriskt övertygande, om man blundar för vad de verkligen står för. I absoluta tal handlar det som visat av exemplen ovan om enstaka eller bråkdelar av procent. Separerar man sedan begreppet major cardiovascular events i sina beståndsdelar finner man i studie efter studie att antalet dödliga infarkter och fall av plötslig död varken signifikant eller nämnvärda tal reduceras av lipidsänkande terapi. Men borde inte en minskning av antalet infarkter och fatala sådana ha gått hand i hand? Denna paradox – att hjärtdödligheten inte följer antalet hjärthändelser – är i själva verket ett genomgående tema i kliniska studier kring kolesterol och kolesterolreducerande behandling. Lägre kolesterolvärden tycks genomgående minska antalet kardiovaskulära händelser, men leder trots detta det inte till en minskning av den kardiovaskulära mortaliteten. Frågan är om inte detta är ett resultat av bias och att studier är svårare att blinda än vi hittills förmodat. Tydligast är detta i 30-årsuppföljningen av Framinghamstudien [8]. Resultaten av denna prospektiva kohortstudie publi­cerades emellertid i två separata artiklar. I den föga uppmärksammade första av dessa från

1987 finner vi att den kardiovaskulära och totala mortaliteten ökade med 14 procent respektive 9 procent för varje 10 mg/dl (0,26 mmol/l) kolesterolet sjönk under de första 17 av de 30 åren. Men två år senare kunde samma författare från samma material visa att antalet inträffade hjärtinfarkter ökade med 2-3 procent högre för varje procent ökning av kolesterolet, alltså till synes raka motsatsen [9]. Hur kan nu detta hänga ihop? Hjärtinfarkter för ju med sig en hög dödlighet, vilket är anledningen att överväga profylax. Hur kan då antalet hjärtinfarkter vara större hos dem med höga kolesterolvärden samtidigt som dödligheten i kardiovaskulär sjukdom vid högre kolesterolvärden tvärtom är mindre? Framingham­studiens ledning från NHLBI undvek att exponera denna paradox genom dubbel­publicering. En rimlig förklaring av dessa till synes oförenliga resultat skulle kunna vara att fler patienter med högt kolesterol har sökt vård för mindre allvarliga infarkter, medan de med lägre kolesterol sökt vård i mindre utsträckning och haft en större andel dödliga hjärtkärlhändelser.

pen. En diet som sedermera visat sig vara skadlig för hjärtat [10]. Det är inte heller orimligt att anta att oro för hjärtat resulterar i fler akutbesök hos kontrollgruppen, och detta i så fall leder till att fler icke-fatala kardiovaskulära händelser så som icke SThöjande infarkter (NSTEMI) registreras. Omvänt kan man anta att de patienter som funnit att kolesterolet gått ner känner sig trygga och är mindre benägna att söka sjukvården. Detta skulle i så fall ha kunna lett till att färre kardiovaskulära händelser

Är utfallet av kolesterolstudier ett resultat av bias?

Hur missförstånden uppkom och kunnat bibehållas

Vi utgår från att patienter i studier kring blodfetter är blindade för om de får aktiv behandling eller ej. Men är det verkligen så? Det bör här beaktas att man i USA sedan decennier kan få testat kolesterolvärdet på sin supermarket och det oftast gratis. Det vore därför märkligt om inte de som accepterat att ingå i en studie kring kolesterol och kardiovaskulär sjukdom uppmärksammat den propaganda som pågår i västvärlden för lägre kolesterolvärden. De som då ”tjuvkikat” och vet att de tillhör placebogruppen kan därför antas ha en ökad förväntan förenad med oro på hjärthändelser. Liksom i 4S-studien har man sannolikt fått information om kolesterolets farlighet och en introduktion i kolesterolsänkande diet som psykologisk utväg, ifall man skulle misstänka att man hamnat i placebogrup-

Att kolesterolsänkande medel kom till användning byggde på föreställningen om ett kausalt samband mellan höga kolesterolvärden i blodet och utvecklingen av arterioskleros. Åtskilliga vetenskapliga observationer talar mot hypotesen, men den har i decennier framförts som etablerad sanning av ledande hjärtläkare med ekonomiska band till industrin. Eftersom detta skett genom respekterade kanaler som American Heart Association (AHA), statliga National Heart Lung and Blood Institute (NHLBI) och deras gemensamma forum National Cholesterol Education Program, som kom till genom ett samspel mellan involverade läkare/opinionsledare och läkemedelsföretaget Merck inför lanseringen av statiner [11] har deras ”claims” inte tillräckligt ifrågasatts.

Det har först nyligen visats att patienter med hjärtinfarkt i genomsnitt har låga kolesterol­ värden och inte höga. registrerats hos dessa. En icke journalförd händelse registreras ju inte i studier, med mindre än att de leder till en tydlig och bestående EKG-förändring. Denna bias har vi hittills blundat för. Flertalet människor är sannolikt alltför begåvade för att i full utsträckning kunna användas som försöksdjur, när studier inte kan blindas helt.

#3 2013

27


MEN

WHO data for all deaths & cholesterol (males)

All cause death rate per 100,000

R = 0,43249

5 000,0 4 500,0 4 000,0 3 500,0 3 000,0 2 500,0 2 000,0 1 500,0 1 000,0 500,0 0,0 2,50

3,00

3,50

4,00

4,50

5,00

5,50

6,00

6,50

Mean cholesterol mmol/L

WOMEN WHO data for all deaths & cholesterol (females)

All cause death rate per 100,000

R = 0,54444

3 500,0 3 000,0 2 500,0 2 000,0 1 500,0 1 000,0 500,0 0,0 2,50 - 500,0

3,00

3,50

4,00

4,50

5,00

5,50

6,00

6,50

Mean cholesterol mmol/L

Fig 1-4: Genomsnittligt kolesterolvärde hos män och kvinnor, plottat mot dödlighet i hjärtkärlsjukdom eller total dödlighet per 100 000 invånare enligt officiell WHO-statistik som finns på denna URL: https://apps.who.int/infobase/Comparisons.aspx. Regressionsanalys gjord med Microsoft Excel. Publicerat med tillstånd av Zoë Harcombe, som berättar att analysen tog en eftermiddag att göra!

Det har först nyligen visats att patienter med hjärtinfarkt i genomsnitt har låga kolesterolvärden och inte höga [12]. Hade detta blivit känt på ett tidigare stadium skulle aldrig kolesterolsänkande behandling ens ha övervägts. Hur har vi då kommit att tro att motsatsen är fallet? Detta kan i efterhand synas märkligt, men bakom missuppfattningen låg epidemiologiska studier av tveksam karaktär så som Ancel Keys Seven Countries Study [13], vars slutsatser byggde på att data som inte stödde hypotesen ignorerades [14]. Faktum är att färska analyser av sambanden mellan såväl kardiovaskulär mortalitet som total mortalitet i förhållande till olika populationers kolesterolvärden, allt baserat på officiell WHO statistik framkommer samband som är rakt motsatta de vi trodde förelåg. Detta har bloggaren Zoë Harcombe nyligen påvisat (Fig 1-2). När högt kolesterol av opinionsledare som Ancel Keys väl utpekats som den främsta 28

#3 2013

orsaken till hjärtkärlsjukdom, började kliniskt verksamma läkare lita mer på kartan än terrängen. Det senaste exemplet på otillförlitliga ”kartor” är en metaanalys från en forskargrupp, Prospective Studies Collaboration PSC i Oxford, med statistikern Sir Richard Peto som senior medförfattare [15]. I denna som uppges omfatta 64 studier och 900 000 patienter påvisas ett samband mellan höga LDL och totalkolesterol och risken för infarkt i alla åldrar och för båda könen. Det är bara det att inga av de siffror författarna redovisar återfinns i original­publikationerna. Dessa är i vissa fall högre, i andra fall lägre och antalet försöks­personer skiljer sig med över 100 000 från verkligheten beträffande den största ingående studien från Paris [16]. Detta kunde passera läsarnas uppmärksamhet, genom att de relevanta tabellerna samt vilka studier som ingick aldrig återgavs i artikeln utan i ett supplement på webben [17]. Förutom detta ignorerades elva relevanta studier

där ett samband mellan kolesterol­värden och hjärtinfarkt aldrig påvisats [18-28], liksom vissa kohorter ur Seven Countriesstudien. PSC har tillskrivits, men svarar inte på brev från oss och inte heller på brev från the Lancet med upp­maning att besvara våra frågor [29]. Vi får därför i brist på annan förklaring förmoda att studien ifråga är ett exempel på ett modernt falsarium i syfte att invagga läkarkåren i en falsk säkerhet kring indikationerna för kolesterols­ änkande behandling. Preklinisk lipidforskning kring hälsa och sjukdom

Den prekliniska forskningen kring kolesterol är mycket omfattande, eftersom den alltsedan 50-talet varit ett prioriterat område med stora ekonomiska resurser främst från NIH och dess dotterinstitut NHLBI. Inte mindre än 14 Nobelpris har utdelats till kolesterolrelaterad forskning. Satsningen motiverades utifrån hoppet om att med


diet eller läkemedel förebygga hjärtinfarkt utifrån en hypotes vars ursprung härrör från tiden innan kolesterolets och lipidernas roll i organismer var klarlagd. Att kolesterol kan identifieras i kärlförträngningar är dock obestridligt. Men efterhand som kunskapen kring lipidernas naturliga roller vuxit har det alltmer framgått att det inte är nativt kolesterol och LDL som är skadligt. Det är sedan länge klarlagt att LDL och HDL är naturliga mekanismer för distribution och återvinning av cellmembranernas främsta beståndsdelar, kolesterol och fosfolipider. Dessa är framförallt nödvändiga för förnyandet av epitel- och endotelytornas celler, proliferation av immunförsvarets vita blodkroppar, alltså inte minst för underhålls-, reparations- och läkeprocesser. När den endogena syntesen är otillräcklig flaggas LDL-receptorn upp. Den normala fysiologin kring detta är väl kartlagd [30, 31]. Det är inte denna normala lipidtransport som i första hand påverkas av sjukliga processer, utan det är när ”små täta” LDLpartiklar med genomsnittsdiameter 25 nm eller mindre uppstått, eftersom just dessa kan deponeras i kärlväggen [31]. Dessa tas inte heller upp genom den normala LDLreceptorn, utan av renhållande scavengerreceptorer, bl.a. CD 36, vilka uttrycks av såväl endotelceller som makrofager [33-36]. Små täta LDL-partiklar uppkommer när prekursorn till LDL, VLDL bildas i överskott vid de novo lipogenes. Denna nybildning av fett från kolhydrater orsakas vanligen av fettsnål kost, stimuleras av insulin och ytterligare av fruktos framförallt från vanligt socker, och åtföljs av stegrade triglycerider i blodet [37-39]. Processer som dessa driver på den prematura arteriosklerosen genom att åstadkomma en abnorm ansamling av degenererade lipider i kärl­väggens makrofager, vilket även orsakar inflammation. Små täta LDL-partiklar är nämligen benägna till oxidation av deras last av kolesterol, fosfolipider och kolesterylestrar [40]. Dessutom är de utsatta för glykosylering och fruktosylering av dess apolipo­protein (s.k. AGE-bildning)

vilket gör dem antigena [41]. Det är således uppkomsten av små täta LDL, oxidationsprocesser, och högt blodsocker som har en cent­ral roll i arteriosklerosprocessen. Uppmätta halter av LDL- och totalkolesterol speglar inte dessa förhållanden. Sammantaget innebär detta att det livsviktiga kolesterolet i själva verket är offret i denna process, och inte skurken som vi alltför länge trott. Kolesterolets centrala roll i biologin

Forskningen kring kolesterol och membraner har letts in på nya spännande vägar som få kliniskt verksamma läkare är medvetna om, eftersom den inte redovisas i de tidskrifter som vanligtvis läses av dem. Av denna litteratur framgår att kolesterol som molekyl är själva förutsättningen för allt högre animaliskt liv. Evolutionens frambringande av de enzymsteg som krävs för att omvandla skvalen till kolesterol, möjliggjorde nämligen utvecklingen av de flesta livsformer vi känner alltsedan den kambriska explosionen med början för 530 miljoner år sedan [42]. Kolesterolets främsta uppgift är nämligen att skapa de egenskaper som kännetecknar cellernas membraner hos djur. Nittio procent av kroppens kolesterol lokaliseras i det hydrofoba mittskiktet av cellmembranerna och har där en tätande uppgift. Tjugofem procent av människans kolesterol finns i hjärnan. Ingen annan sterol ger membranerna den ogenomsläpplighet för vatten med bibehållen rörlighet, som är en förutsättning för membranpumpars, kanalers och porers funktioner samt därmed uppkomsten av en membranpotential [43-44]. Kolesterol reglerar vidare membrantjocklek, organisationen i receptorbärande domäner som lipid rafts och caveolae, fluiditet vid olika temperaturer och halten kolesterol anpassas till lipidsammansättningen i fosfolipidskiktet [31,45]. Detta senare förklarar vad som för kolesterolforskarna Scott Grundy och Edward Ahrens så sent som 1969 betraktades som ett mysterium, nämligen

hur fleromättade fetter kan sänka blodets kolesterolhalt. Deras kalkyl visade att nittio procent av kroppens kolesterol fanns på en för dem okänd plats [46]. Numera vet vi att den platsen är cellmembranerna! I cellen finns en stigande gradient av kolesterol inifrån och ut. Detta är en förutsättning för korrekt veckning och export av proteiner. I det endoplasmatiska retiklet (ER) där kolesterol och proteiner syntetiseras utgör kolesterol cirka 3-6 procent av lipiderna, halten ökar i Golgiapparaten och vidare till cellmembranen där kolesterol utgör hela 30-50 procent av lipiderna. Intressant nog har ER sensorer, vilket nobelpristagarna Brown och Goldstein påvisat, som kan känna av kolesterolhalten och vid behov öka syntesen av detsamma. Det så kallade sterol regulatory element-binding proteinets (SREBP) klyvningsaktive-

Sammantaget innebär detta att det livsviktiga kolesterolet i själva verket är offret i denna process, och inte skurken som vi alltför länge trott. ringsprocess (SCAP) ändrar således sin konfiguration vid brist på kolesterol [47]. Framkallad brist på kolesterol i Golgikomplexet leder till inhibition av proteinsekretion [48]. Således leder minskad kolesterolhalt i betacellers membraner till minskad insulinsekretion [49].  Risker med låga kolesterolvärden

Försök att sänka blodets halt av kolesterol med statiner och på andra sätt har således betydande risker, om behandlingen leder till kolesterolbrist på cellnivå. Om och i vilken grad detta äger rum av läkemedel ensamt eller i kombination med viss diet är otillräckligt kartlagt. Eftersom kolesterol är essentiellt för centrala funktioner som membranintegritet och proteinsekretion leder kongenitala defekter i kolesterolsyntesen till svåra missbildningar och mental retardation. Ett tiotal sådana inborn errors i kolesterolmetabolismen har hittills påvisats #3 2013

29


[50]. I hjärnan som huvudsakligen består av lipider utgör kolesterol 50 procent av dessa och är av essentiell betydelse för

Ett flertal sjukdomar i nerv­ systemet är associerat till låga kolesterol­nivåer, däribland ALS, MS, Alzheimer, polyneuropati, schizofreni och depression… återställandet av membranpotentialen och ”synaptic vesicle recycling” [51]. Ett flertal sjukdomar i nervsystemet är associerat till låga kolesterolnivåer, däribland ALS, MS, Alzheimer, polyneuropati, schizofreni och depression liksom beteenderubbningar som suicidalitet och våldsbenägenhet [52-57]. Låga kolesterolvärden, LDL och HDL ses även vid malnutrition och fattigdom, och korrelerar till ökad infektionsbenägenhet. Det bör i det sammanhanget påpekas att såväl LDL och HDL bidrar till sekvestrering av framförallt gramnegativa bakterier och endotoxin i blodbanan [58], och LDL-kärnans kolesteryllinoleat har visat sig ha en antibakteriell effekt [59]. Att låga kolesterolvärden associeras till infektionssjukdomar är intressant i förhållande till en plausibel hypotes om patogenesen vid kranskärlssjukdom [60]. HMG-CoA-reduktas som inhiberas av statiner är det första steget inte bara i kolesterol­syntesen utan även i syntesen av en rad andra essentiella ämnen, däribland ubiquinon, eller co-enzym Q10. Låga halter av detta ses vid hjärtsvikt och associerar till sämre prognos, och halten ubiquinon samvarierar då med LDL [61]. Al Mallah och medarbetare fann likaså att lågt LDL vid hjärtinfarkt korrelerar till högre dödlighet vid långtidsuppföljning, och att 36 procent av de med lågt LDL stod på statiner jäm­fört med 25 procent av de med högre LDL och bättre prognos [62]. En studier på diabetiker med electron beam computerized scanning visade att högre användning av statiner korrelerade till fler förkalkade kranskärlslesioner. En brittisk multicenterstudie kartlade 30

#3 2013

risken av att få vissa svåra biverkningar vid fem års användning av statiner som primärprofylax [63]. Analysen visade att behandlingen orsakade ett fall av katarakt per 35 kvinnor eller 52 män, ett fall av akut njursvikt per 434 kvinnor eller 346 män, ett fall av måttlig till svår leverskada per 136 kvinnor eller 142 män och ett fall av svår myopati per 259 kvinnor eller 91 män. Erektil dysfunktion nämns också som en trolig biverkan av statiner som troligen drabbar så många som en av fem [64]. Sekundärprofylax – andra mekanis­ mer verksamma?

Sekundärprofylax efter hjärtinfarkt berörs inte av metaanalyserna ovan. Oftast citeras 4S-studiens resultat som motivering för behandlingsrekommendationer [65]. I denna sågs en 4 procentig reduktion av mortaliteten efter hjärtinfarkt hos behandlingsgruppen, vars storlek senare och större studier inte kunnat reproducera. Anmärkningsvärt är att endast 4 444 patienter av 7 027 där studien påbörjats med provtagning och dietinstruktioner inkluderades i analyserna. Framförallt har studier efter Vioxx-skandalen, som ledde till ökad insyn i läkemedelsstudiernas primärdata, visat en avsevärt lägre skyddande effekt vilket kritiska röster påpekat [66]. Möjligen är det istället så att en antiproliferativ effekt hos så kallade läkemedelsstentar attenuerat statineffekten i dessa senare studier. För detta talar att en av statinernas ospecifika effekter i likhet med läkemedlen i stentar är antiproliferativ

Ralf Sundberg docent, privat­ läkare, Slotts­ stadens Läkarhus, Malmö

på bland annat makrofager [67, 69] Fram­ vtiden får visa om statiner kan försvara sin roll som profylax efter hjärtinfarkt. Stöd för primärprofylax med statiner saknas

Sammanfattningsvis tyder befintliga data på att föreställningen om ett samband mellan höga kolesterolvärden och risken för dödlig kardiovaskulär sjukdom upp­ kommit genom studier med bias, och selektiv tolkning av data. Metaanalyser av primär­preventiva studier tyder på att det vetenskapliga stödet för primär­profylax med statiner vid höga eller normala blodlipider saknas, eftersom reduktionen av journalförda hjärthändelser inte återföljs av minskad mortalitet. Att så skulle vara fallet har faktiskt aldrig uttalats av berörda läke­ medelsföretag eller opinionsledare, utan har bara uppfattats så, efter väl genomförda marknadsföringskampanjer. Att myndig­ heter och läkarkåren inte genomskådat detta är visserligen genant men detta får inte tillåtas leda till fortsatt ignorans. Historien har upprepade gånger visat att veten­ skapliga sammanslutningar misstar sig när makt och pengar står på spel. Men för de som vill att läkaryrket även i framtiden bör vila på såväl etiska som vetenskapliga grunder snarare än kommersiella, är gamla misstag i dessa avseenden något som bör exponeras snarare än döljas. Referenslistan finns på: medicinskaccess.se Jävsförhållanden: Inga uppgivna.

Tore Scherstén professor emeritus, leda­mot av Kungl. Veten­ skaps­akademin, f.d. huvud­sekr. Medicinska Forsknings­rådet, Båstad


Reerenser: A. Breslavsky, J. FRAND, Z. Matas, M. Boaz, Z. Barnea, M. Shargorodsky. Effekten av höga doser av vitamin D på arteriella egenskaper, adiponectin, leptin och glukoshomeostas i typ 2-diabetes. Källa: Clin Nutr 2013. http://www.clinical­ nutritionjournal. com/article/S02615614%2813%29000472/abstract

D-vitamin bildas i huden när solen lyser på oss. Med maten får vi ytterst lite D-vitamin jäm­förelsevis. Resultat: många svenskar (kanske de flesta) har brist på D-vitamin, särskilt under vintern och vå­ ren. D-vitamin är unikt bland vitaminerna. Det är ett steroidhormon, som våra könshormoner testosteron och östrogen. Allt mer forskning talar för att D-vitaminbrist har en roll i mängder av sjukdomar. Infektionssjukdomar, vinter- och vårdepressioner, cancer, hjärtsjukdom, benskörhet, autism, generell värk/fibromyalgi, övervikt… listan på sjukdomar där ett samband misstänks är lång.

Vitamin D skyddar diabetikers blodkärl D-vitamin har potential att lindra hjärtskador hos diabetes­patienter. Studien är utförd av israeliska forska­ re och stödjer tidigare forskning, som visar att D-vitamin minskar risken för hjärt-kärlsjukdom hos människor som antingen har eller riskerar att få diabetes.

Diabetespatienter har ofta låga halter vitamin D. Det är därför möjligt att en dos på 1 000 IE vitamin D per dag (som användes i studien) behöver ökas, men detta måste bestämmas av uppföljande forskning. I den aktuella studien, som var en randomiserad, dubbelblind placebokontrollerad studie rekryterade forskarna 47 patienter med typ-2 diabetes. Av dessa fick 24 patienter en daglig dos av vitamin D, medan 23 patienter fick placebokapslar under ett års tid. En rad analyser

I början och vid slutet av studien utfördes en rad analyser, inklusive fasteblodglukos, mängden fett i blodet, glykosylerat hemoglobin (ett tillstånd där de röda blodkropparna ansamlar glukos) nivåer av insulin, CRP (ett mått på inflammation i kroppen),

nivån av vitamin D, adiponectin (ett protein som finns i fettceller och används för att förutsäga graden av åderförkalkning och därmed styvhet i blodkärlen), och leptin (ett hormon som finns i fett­ vävnad, vilket förstärker känslan av mättnad). Dessutom graden av insulinresistens (där effekten av insulin på cellerna minskar) och Central aorta augmentation (AI) mättes. Detta index är ett mått på styvheten hos hjärtats artär och antal pulsvågor. Resultat

Studien visade att de två grupperna av patienter var likartade i början, men att augmentation-index minskade avsevärt i gruppen som fått D-vitamin Nedgången var 7 enheter, medan placebo­gruppen hade en ökning på 0,4 enheter. Dessutom ökade nivåerna av adiponectin under behandlingsperioden hos vitamin D behandlade patienter. Låga nivåer av adiponectin är associerade med sjukdomar och ateroskleros i blodkärl. Det fanns inga signifikanta skillnader i andra parametrar såsom blodsockernivåer. Håkan Hedin

#3 2013

31


Medicinnotiser

Kraftig minskning av död i hjärtinfarkt Antalet personer som dör i akut hjärtinfarkt har minskat med mer än en tredjedel, 36 procent, under den senaste tioårsperioden. Det visar en ny sammanställning från Hjärt-Lungfonden. Men fortfarande är hjärtinfarkt den enskilt vanligaste dödsorsaken i Sverige.

– Forskningsframsteg som har lett till nya behandlingar gör att betydligt fler överlever en hjärtinfarkt i dag. Nästa utmaning är att forska fram exempelvis ett vaccin mot själva sjukdomen i stället för att bara behandla symptomen, säger Jan Nilsson, ordförande i Hjärt-Lungfondens Forskningsråd. Under 2002 dog 13 000 personer i akut hjärtinfarkt. Därefter har antalet dödsfall stadigt sjunkit. År 2011 dog 8 500 personer, vilket innebär en minskning med 36 procent på tio år. Det visar nya be-

räkningar av Socialstyrelsens statistik som Hjärt-Lungfonden i dag presenterar i sammanställningen Ökad överlevnad i hjärtinfarkt. Propplösande behandling redan i ambulansen, blodfetts­ sänkande statiner och ballongsprängning är tre exempel på betydelse­fulla metoder som alla är resultat av forskning. Hjärt-Lungfonden har satt upp ett tioårsmål att med forskningens hjälp halvera dödsfallen i akut hjärtinfarkt. – Vi är en god bit på väg men det är fortfarande för många som dör i hjärtinfarkt. Nu tar vi ett krafttag för att samla in mer pengar till fler forskningsprojekt. Alla gåvor gör skillnad, säger Staffan Josephson, generalsekreterare för Hjärt-Lungfonden. Hjärt-Lungfonden har vikt april åt att samla in pengar till forskningsprojekt om hjärtinfarkt och att informera brett om sjukdomen. HH

Årets allmänläkarvän Svenska Distriktsläkarföreningen instiftade för några år sedan ett heders­p ris kallat Årets allmän­ läkarvän.

Mottagare ska var en person som genom sitt agerande och renommé stärker bilden av svensk primärvård och distriktsläkare. Årets pris tillfaller Saskia Bengtsson, distriktsläkare i Bankeryd, med

följande motivering: ”Hon strider på ett före­dömligt sätt för allmänmedicinska specialitetens särart och för kvalitet i vården i ordets egentliga bemärkelse samt ifrågasätter gärna givna ´sanningar´ inom sjukvården”. Priset delades ut vid Distriktsläkarföreningens fullmäktigemöte, den 19 april i Stockholm.

Saskia Bengtsson.

HH

Detremin

– flexibel behandling av D-vitaminbrist TM M

M dD Med Detremin t i kkan d du b behandla h dl D D-vitaminbrist it i b i t en gång å i veckan k eller ll en gång å per dag. d 1 Dropparna är enkla att svälja och oljelösningen bidrar till att dosen lättare tas upp i kroppen2. Varje droppe innehåller 667 IE och varje ml 20 000 IE.

Detremin – nu i läkemedelsförmånerna utan begränsning eller villkor Detremin (kolekalciferol, vitamin D3) (A11CC05) Rx (F). Indikation: Behandling av vitamin D-brist eller vitamin D-insufficiens. TLV: Produkten ingår i läkemedelsförmånen. Beredningsform: Orala droppar, lösning 20 000 IE/ml. Produktresumén uppdaterad 2011-08-26. För ytterligare information, förpackningar och priser, se www.fass.se. Renapharma AB, Box 938, 751 09 Uppsala, telefon: 018–700 11 40, www.renapharma.se. Apr 2013 Referenser: 1. Detremin SPC 2011. 2. Grossmann E et al. Evaluation of vehicle substances on vitamin D bioavailability: A systematic review. Mol Nutr Food Res. 2010 August; 54(8):1055-1061. Detremin har 5 års hållbarhet och innehåller inget konserveringsmedel. TM

kolekalciferol 32

#3 2013


Medicinnotiser 000_forsknanslag2013_91x262_Layout 1 2013-04-09 10:44 Sida 1

Färre allvarliga hjärt-kärlhändelser hos KOL-patienter som behandlades med Daxas

NU K SÖ

!

Hjärt-Lungfondens

forskningsanslag 2013

En ny analys av data som publicerats i tidskriften CHEST visar att det saknas en signal om kardiovaskulär risk vid behandling av patienter med KOL (kroniskt obstruktiv lungsjukdom). Resultaten av analysen antyder också att tilläggsbehandling med Daxas erbjuder potentiella kardiovaskulära fördelar.

KOL-patienter som behandlas med bronkdilaterare med eller utan in­halerade kortikosteroider, har en lägre risk för allvarliga kardiovaskulära händelser, Major Adverse Cardiovascular Events (MACE), då roflumilast ges som tilläggs­ behandling. Roflumilast är en mycket selektiv fosfodiesteras-4-hämmare (PDE4hämmare) som är godkänd för behandling av KOL-specifik inflammation. Förekomsten av hjärtsjukdom bland KOL-patienter är hög, olika studier visar att förekomsten av samtidig hypertoni varierar mellan 28 procent och 40 procent, diabetes mellitus mellan 12 procent och 14 procent och depression mellan 22,8 procent och 42 procent. Risken att utveckla Leif Bjermer hjärtarytmi, venösa tromboemboliska sjuk­­domar, hjärtinfarkt och stroke är betydligt större hos KOL-patienter än hos friska individer. Dessutom har 40 procent av KOL-patienterna en underliggande hjärt-kärlsjukdom och KOL-patienter är kända för att löpa förhöjd risk att läggas in på sjukhus och att dö i hjärt- och kärlsjukdomar. Nyligen genomförda studier har visat att patienter med lindrig och medelsvår KOL visar tecken på systemisk inflammation och detta har föreslagits vara en länk mellan KOL och andra systemiska sjukdomar såsom hjärt-kärlsjukdomar. Det finns också en viktig länk mellan systemisk KOL- inflammation och hjärtskada associerat till olika grad av luft­ flödesinskränkning. – Studieresultaten är intressanta eftersom de pekar på vikten av att se patienterna i ett vidare perspektiv än bara till deras lungsjukdom. Komorbiditet, det vill säga förekomst av annan parallell sjukdom, är vanlig hos patienter med KOL. Ett stort antal patienter har en kliniskt betydelsefull hjärt-kärlsjukdom parallellt med sin KOL-sjukdom. Diabetes och ben­ skörhet är andra exempel. När man utvärderar ett läkemedel läggs det, med tonvikt på säkerhet, vikt av att ha så rena grupper som möjligt. Därför utesluts patienter med betydelsefull ko-morbiditet från de flesta läkemedelsstudier vid KOL. Vi har i egna studier funnit att patienter som inkluderas i läkemedelsstudier mot KOL representerar mindre än 5 procent av de som sedan skall behandlas i ”verkliga livet”. Därför är det extra glädjande att man nu börjar se på behandlingseffekter som påverkar en kombination av olika ofta samtidigt förekommande sjukdomstillstånd”, säger Leif Bjermer, Professor, överläkare, Lung- och allergikliniken, Skånes Universitetssjukhus, Lund.

Hjärt-Lungfonden ger stöd till forskning för att besegra hjärt-, kärl- och lungsjukdomarna. Stödet från svenska folket är idag större än någonsin. Tack vare alla generösa gåvor kunde Hjärt-Lungfonden öka satsningen till 180 miljoner kronor 2012. Forskningsinsatserna förstärks ytterligare för 2013 och nu utlyses: Forskartjänster Projektbidrag Forskarmånader Stipendier för forskning utomlands Bedömningsgrund. Vid utvärdering av ansökningarna kommer originalitet och sannolik klinisk betydelse av de sökandes forskningsprogram att särskilt beaktas. Ansökningsförfarande. Ansökningar lämnas in från den 24 april t.o.m. 22 maj 2013. Mer information hittar du på www.hjart-lungfonden.se Ytterligare upplysningar. Vill du veta mer om forskningsanslagen kan du kontakta Hjärt-Lungfondens forskningsavdelning på tel 08-566 24 220.

HH

pg 90 91 92 -7 www.hjart-lungfonden.se #3 2013

33


N

u

Varför nöja sig med det näst bästa?

ENERGI till livet

ap o

te

Upplev full effekt med den originala Q10-produkten Om man inte prövat Bio-Qinon Q10, har man inte upplevt full effekt. Testa själv resultatet av mer än 20 års forskning och produktutveckling – och upplev skillnaden. Luft- och fukttät blisterförpackning; god hygien.

Fler än 90 vetenskapliga studier dokumenterar produktens egenskaper.

Det originala Q10märket från Pharma Nord.

Resultatet av 23 års produktutveckling och forskning.

100% naturidentiskt, Q10 Precise ingredienser.

Dokumentation på upptag, verkan och säkerhet.

Bio-Qinon är utvald som referensprodukt i internationell forskning.

Producerat, packat och kontrollerat på Pharma Nords egen anläggning i Danmark.

SE_Q10_Gold_Ad_Produkt_MedicinskAccess_0313_210x297

Varunummer apotek Bio-Qinon Q10 30 mg Bio-Qinon Q10 GOLD 100 mg

Oriola 753610 753621

Apoteket AB 209967 209969

Ljusskyddade kapslar med 100 mg Q10 upplöst i vegetabilisk olja.

Innehåller coenzym Q10 och C-vitamin, som bidrar till normal ämnesomsättning, minskad trötthet och utmattning.

Finns även i hälsobutikerna

Abonnera gratis på Pharma Nords Hälsonytt – registrera dig på www.pharmanord.se

08-36 30 00 www.pharmanord.se

k


Trots omfattande litteratur, som påvisat positiva effekter på riskfaktorer inte bara av stress­hantering, rökstopp, kost och motion utan även av antioxidanter, D-vitamin, fettsyror och andra kosttillskott, har sjukvården hittills i mycket liten utsträckning insett det potentiella värdet av kosttillskott.

Riskfaktorminimering:

Kosttillskott som komplement till livsstils­ modifikation och läkemedel Hälso- och sjukvården har mer och mer uppmärksammat behovet av prevention. Socialstyrelsen har rekommenderat vårdgivarna att mer aktivt verka för livsstilsmodifikation i befolkningen. Trots omfattande litteratur, som påvisat positiva effekter på riskfaktorer inte bara av stresshantering, rökstopp, kost och motion utan även av antioxidanter, D-vitamin, fettsyror och andra kosttillskott, har sjukvården hittills i mycket liten utsträckning insett det potentiella värdet av kosttillskott.

Med hjälp av pulsvågsanalys har jag, PerArne Öckerman, kunnat påvisa gynnsamma effekter av ett brett spektrum av kosttillskott. Jag kritiserar tendensen att studier om kosttillskott utförs med unieller oligonutrienter och att man drar ovetenskapliga slutsatser av sådana studier. För

att få besked om potentiellt positiva effekter måste man använda multinutrienter. Mät inte om du inte kan behandla avvikelser

Under 1960-talet gjordes befolkningsstudier i flera svenska län. Man mätte bl.a.

ett stort antal blodvariabler och hittade ett ganska litet antal personer med dittills odiagnostiserad sjukdom. Bland dessa fann man enstaka fall av leukemi, en då icke behandlingsbar sjukdom. Slutsatsen blev ganska självklar: Mät inte något, om du inte kan behandla avvikelser. Denna kunskap är för mig tillämplig på pulsvågsanalys. Jag började använda tek­niken 2001 på mina patienter, som behandlades med EDTA, och övergick 2008 till att använda Arteriograf. Socialstyrelsen hade länge försökt stoppa EDTA-behandling och lyckades 2010 få Regeringsrätten (nu­varande Högsta Förvaltningsdomstolen) #3 2013

35


man, om behovet är normalfördelat i befolkningen, utgå från att 2.5 procent ligger utanför. För 40 essentiella näringsämnen betyder detta att sannolikheten för att en person, som får i sig RDI av alla näringsämnena, får tillräckligt av alla 40, bara är 36 procent. Till detta kommer Den typiska västerländska dieten innehåller ovan nämnda energirika, men näringsfattiga livsmedel med faktorer, som hög halt raffinerat socker, fett och spannmål. minskar sanOdlings- och hanteringstekniker har inriktats nolikheten mer på volym än på näringstäthet. ytterligare [2]. Detta resonemang är inte nödvändigtvis ett argument mäta med Arteriograf i brist på åtgärdsför kosttillskott, men väl för bättre kost. möjlighet var för mig inte aktuellt. Det fanns redan erfarenheter, både egna och i litteraturen, som talade för att kosttillskott Subkliniska brister skulle kunna ge goda behandlingseffekter. Betydelsen av lätta brister på essentiella Men vad skulle man välja? Min bakgrund närings­ämnen i befolkningen är omdiskutesom klinisk kemist och som pensionär utan rad. Livsmedelsverket [3] brukar hävda, att stora resurser uteslöts försök med läkemedel. subkliniska brister är ovanliga och avråder Trots ett gammalt, stort intresse för kost och från kosttillskott då de kan öka morbiditet motion hindrade begränsade resurser studier och mortalitet. Bruce Ames, känd för sin över dessa variabler. Det återstod bara att ge test, har en helt annan inställning och memina patienter kosttillskott. Med hjälp av nar, att det bästa man kunde göra för befolknedanstående resonemang satte jag samman ningens hälsa är att ge kosttillskott till alla. ett ”MultiNutrient Supplement”, som jag gav Han anser, att subklinisk brister är vanliga till 85 patienter. Resultatet blev förvånande och ökar risken för de vanliga kroniska sjukpositivt på oväntat kort tid [1]. domarna [4-5]. Detta blev för mig ett motiv för att inkludera RDI-doser av essentiella vitaminer, mineraler och spårämnen. Skäl att använda kosttillskott Den typiska västerländska dieten innehåller energirika, men näringsfattiga livsmedel Interaktioner med hög halt raffinerat socker, fett och Höga doser av enskilda ämnen, särskilt spannmål. Odlings- och hanterings­tekniker mineraler och spårelement, kan åstadhar inriktats mer på volym än på näringskomma obalanser. Referens [6] illustrerar täthet. Många människor får därför lägre detta avseende zink och koppar. Detta såg tillförsel av essentiella näringsämnen, men jag som ett ytterligare skäl för att inkludera mer kalorier än önskvärt. Flera andra RDI-doser av ämnen, oavsett om de har (till faktorer kan öka risken, till exempel malexempel Zn,Ca,Mg) [7-9] eller inte direkt absorption, genetisk polymorfism, ökade har visats ha effekt på kärlfunktionen. behov vid stress och sjukdom, aptitlöshet. Vitaminer. En omfattande litteratur Biokemiska olikheter förekommer mellan påvisar ofta, men inte alltid, att flera vitaindivider och kan betyda ökat behov, som miner, till exempel C, D, E, K, kan påverka inte uppfylls av RDI-doser. Statistiskt kan risken för CVD [10-14]. att döma ut EDTA-behandling som icke förenlig med ”vetenskap och beprövad erfaren­het”. För att inte överge mina patienter fann jag mig då föranlåten att överväga behandling med kosttillskott, något som jag länge hade tänkt på. Alternativet att sluta

36

#3 2013

Spårelement. Mineraler. Samma resonemang kan föras för till exempel selen och magnesium [8,15]. Aminosyror. Översikt över bland annat l-arginin och kväveoxid har publicerats i denna tidskrift [16]. Fettsyror. Här, liksom för de flesta essentiella näringsämnena, råder ingen concensus om värdet av kosttillskott av EPA och DHA för CVD-risk [17]. Däremot är man mer överens om nyttan av att äta fet fisk, rik på EPA och DHA [3]. Probiotika. Det finns bara få studier, men de kan ge stöd för att, bakteriefloran i tarmen kan spela en roll för hälsan och kanske därmed för CVD-risken [18]. Leverfunktionen. Levern är central för avgiftning av endo- och exogena substanser. När kapaciteten överskrids, bildas fria radikaler, ökande risken för CVD. N-acetylcystein stärker avgiftnings­ kapaciteten och har därmed potentiell betydelse för CVD-risken [19]. Min tanke

Forskningen studerar ofta effekter av enskilda ämnen, men risken för CVD påverkas av många olika ämnen. Studier borde därför oftare göras med många ämnen samtidigt, trots att detta gör det svårt att genomföra dubbelblindtester. Antioxidantforskarna har insett detta [20]. Effekt av kombinationen selen + Q-10 [21] är en färsk illustration. Man hävdade tidigt att en antioxidantrik kost hade positiva effekter, men inte enskilda antioxidanter. Jag tolkar detta som ett bevis för vikten av multinutrienta terapier hellre än mono- eller oligonutrienta. De flesta studierna, till exempel JAMA 2012, där man gav beta-karotin och vitamin C och E [22], drar slutsatsen att multivitamintillskott inte minskar risken för CVDhändelser hos män. För mig är detta en allvarlig ologiskhet. Man har ju inte studerat, vad som händer, om man ger många fler mikronutrienter. Man har dessutom påvisat


ett linjärt, inverst för­hållande mellan halten cirkulerande 25 (OH) vitamin D och risken för CVD [23]. Andra studier visar samband mellan brist på B-vitaminer och antioxidanter och risk för mild kognitiv skada och Alzheimers sjukdom [24]. Nog är det dags att bli litet striktare i sina tolkningar av oligonutrienta dubbelblindstudier. Är det rimligt att konstatera, att ”multivitamintillskott inte minskar risken för CVD”, utgående från studier, där man bara gett tre vita­ miner av de kända tolv? Kanske man också skulle ha funderat över det faktum, att vitaminerna samverkar med andra co­faktorer såsom mineralämnen och spårelement i ett stort antal viktiga enzym-reaktioner. Dessutom finns det andra essentiella näringsämnen, fettsyror och aminosyror, som kan tänkas ha betydelse. MultiNutient-terapi

Resultat. Utgående från detta resonemang komponerade jag en MultiNutient-terapi, som gavs till 85 patienter under två månader. Resultaten visas i Tabell 1 (delvis publicerats i ref.1). I syfte att göra behandlingen enklare och billigare bytte jag ut acetylcystein (läkemedel) mot cystein (kosttillskott) och slog samman innehållet i sex olika burkar i en enda. Fiskoljan och probiotikan förblev separat preparat. Med denna variant behandlar jag nu mina patienter, som uppvisar problem vid pulsvågsanalys. Resultat av denna förenkling förelig-

Diskussion

Gunnar Nyberg skriver i Medicinsk access 2012 (ref. 26)om nyttan av att bestämma artärernas styvhet och påpekar att analysen ger information om riskfaktorer, som annars missas, bättre möjlighet till behandlingsuppföljning och ledtrådar till sjukdomar av inflammatorisk natur. Jag har avstått från att mera ingående redovisa forskning om enMin förhoppning är att större hänsyn skall tas till skilda ingående multinutrienttanken i fortsatt forskning och att, komponenter i om sådan forskning, som faktiskt redan finns, multinutrientteger stöd, detta skall leda till praktisk tillämpning rapien, då detta i sjukvården. skulle ta orimligt stor plats. Då måste man också övervinna alla de Då resultaten påvisar minskning av flera hinder, som idag gör det svårt för läkarna riskfaktorer, uppstår frågor: att tillämpa multinutrientterapi som ett • Betyder riskfaktorminskningen med komplement till kirurgi, läkemedel och multinutrientsupplementering även livsstilsmodifikation. minskad morbiditet och mortalitet? Svaret kräver långtidsstudier, som för närvarande saknas. Dock finns bevis Per-Arne för att här redovisade riskfaktorer Öckerman verk­ligen innebär, att risken för CVD Professor emeritus ökar med förhöjda riskfaktorvärden. •V  ad krävs av kosttillskott för att bibehålla Referenslistan lägre värden för de uppmätta variablerna/ finns på: riskfaktorerna? medicinskaccess.se • Kan lika bra eller bättre resultat uppnås med livsstilsmodifikation och/eller läkemedel?

Tabell 1: Pulsvågshastighet(PWV), augmentationsindex(AIX), brachialt och centralt blodtryck före och efter 2 månaders behandling med multinutrient supplementering hos 85 patienter. Före

Efter

p-värde

PWV, m/s*

12.0

10.0

<0.001

PWV, biol.ålder*/**

92.9

63.2

<0.001

AIX*

+5.2

-14.1

<0.001

SBT, mmHg

161.4

133.0

<0.001

DBT,mmHg

89.6

75.2

<0.001

c-SBT,mmHg

150.0

122.6

<0.001

*Från ref.1. **Beräknad enl. ref.25.

• Kan behandlingen med kosttillskott förenklas med färre komponenter och/ eller lägre doser? • Kan resultaten förbättras med ytter­ligare tillskott, till exempel andra amino­syror, Q-10 och nitrat/nitrit-inne­hållande kost­ koncentrat? Min förhoppning är att större hänsyn skall tas till multinutrienttanken i fortsatt forskning och att, om sådan forskning, som faktiskt redan finns [29], ger stöd, detta skall leda till praktisk tillämpning i sjuk­vården.

ger nu för 40 patienter och redovisas i Tabell 2.

Tabell 2: Pulsvågshastighet(PWV), augmentationsindex(AIX), brachialt och centralt blodtryck, Diastolisk Area Index (DAI) före och efter 2 månaders behandling med multinutrient supplementering hos 40 patienter. Före

Efter

p-värde

PWV, m/s

11.9

10.0

<0.001

PWV, biol.ålder*

89.5

62.6

<0.001

AIX

+27.4

+4.1

<0.001

SBT, mmHg

161.8

144.2

<0.001

DBT,mmHg

93.5

86.2

<0.001

c-SBT,mmHg

166.7

147.3

<0.001

DAI,%

45.7

50,6

<0.001

*Beräknad enl.ref.25.

#3 2013

37


forskning och utveckling

Unik kartläggning av genetiska stav­ fel som ökar risken för vanlig cancer Över 80 genetiska ”stavfel”, som påverkar risken för bröst-, äggstockseller prostatacancer har identifierats i ett omfattande internationellt forskningssamarbete som letts från Karolinska Institutet.

Dessutom har forskarna för första gången en relativt säker bild av hur många genetiska avvikelser som totalt kan associeras med de aktuella cancersjukdomarna. Forskarnas mål är att kunna beräkna individuella risker för cancer och att få fram bättre behandlingar. Resultaten publiceras i fem artiklar i ett temanummer om genetiska riskfaktorer för cancer i den ansedda vetenskapstidskriften Nature Genetics. Artiklarna kommer från COGS (Collaborative Oncological Gene-environment Study), ett EU-baserat samarbete där fler än 160 forskargrupper från hela världen ingår totalt. I de fem COGS-studierna ingår 100 000 patienter med bröst-, äggstocks- eller prostatacancer och lika många friska individer. Forskarna har gjort genetiska analyser

av samtliga studiedeltagare. I analysen har sammansättningen av kvävebaserna A, G, C och T studerats på 200 000 utvalda avsnitt av DNA-strängen. När cancer­patienterna hade förändringar som signifikant skilde sig från de friska kontrollpersonernas ansågs de vara relevanta för sjukdomens uppkomst. Förändringarna kan beskrivas som genetiska ”stavfel”, där ett A, G, C eller T bytts ut mot någon annan bokstav. Denna typ av stavfel kallas på engelska single nuceleotide polymorhism, SNP, som uttalas som ”snipp”. I de aktuella studierna har forskarna identifierat totalt 49 genetiska stavfel eller SNP som påverkar risken för bröstcancer, vilket är mer än dubbelt så många än vad som tidigare var känt. När det gäller prostatacancer har forskarna upptäckt ytterligare 26 förändringar, vilket innebär att totalt 78 SNP i dag kan kopplas till sjukdomen. För äggstockscancer hittades 8 nya relevanta SNP. – Ett lika viktigt fynd är att vi kunnat beräkna hur många ytter­ligare SNP:ar som bör påverka risken för bröstcancer respektive prostata­cancer, ungefär ett tusental

Per Hall.

respektive 2 000. Vi har dessutom en bild av var i genomet vi bör leta i kommande studier, säger Per Hall, professor vid Institutionen för medicinsk epidemiologi och biostatistik på Karo­linska Institutet samt koordinator för EU-nätverket COGS. Alla individer bär på SNP, det är en del av vårt naturliga arv. Hur det påverkar individen beror på var på DNA-strängen förändringen sitter. Forskarnas förhoppning är nu att kunna värdera betydelsen av de nu identifierade avvikelserna, så att det ska bli möjligt att tydligare förutsäga vilka individer som löper hög risk att få någon av dessa cancersjukdomar. – När det gäller risk för hjärt-kärlsjukdom vet vi att högt blodtryck är en riskfaktor och därför behandlar vi det i förebyggande syfte med läkemedel i dag. Jag tycker vi bör diskutera om vissa kvinnor med mycket hög risk för bröstcancer bör medicinera i preventivt syfte, till exempel med tamoxifen, som i dag ges i återfallsförebyggande syfte, säger Per Hall. HH Källa: Karolinska Institutet

Mälargården Rehab Center ligger i natursköna Sigtuna 40 minuter norr om Stockholm. Vi är ett multimodalt kompetent rehabiliteringsteam som tillsammans med patienten arbetar fram ett individuellt rehabiliteringsprogram för vistelsen.

Våra rehabiliteringsprogram omfattar nedanstående sjukdomar/skada: • Neurologisk rehab • Onkologisk rehab och lymfdränage • Astma/KOL Mälargården har avtal med ett antal landsting och kommuner som vårdgivare vid neurologisk rehabilitering, onkologisk rehabilitering, lymfödembehandling samt astma/KOL. Läs mer om oss på vår hemsida www.malargarden.se

Box 46 • 193 21 SIGTUNA • Tfn 08-5949 3630 • www.malargarden.se 38

#3 2013


forskning och utveckling

Ökad risk för hjärtsjukdom för gravida med högt blodtryck Forskare vid Sahlgrenska akademin, Göteborgs universitet, har i en studie följt 105 kvinnor som födde barn i början av 1970-talet. Hälften av kvinnorna hade ett förhöjt blodtryck under graviditeten, andra hälften hade en normal graviditet.

Studien visar att kvinnor som haft en blodtrycksökning under graviditeten oftare diagnostiseras med högt blodtryck även 35-40 år senare. Samma kvinnor uppvisade tecken på ökad kärlstelhet och viss påverkan på blodsockerbalansen. – Vi kan se att även en diskret blodtrycksförhöjning kan kopplas till en viss försämring i hjärtats struktur och funktion hos dessa kvinnor. Sammantaget kan de här fynden delvis förklara den ökade risken för hjärtkärlsjukdom, säger Anna-Clara Collén, som redovisar resultaten i sin avhandling. För att bevara ett friskt hjärt-kärlsystem efter klimakteriet bör kvinnor som har högt blodtryck under graviditeten sträva efter Anna-Clara Collén. att återgå till ett normalt blodtryck efter graviditeten. – Det handlar till exempel om att vara fysiskt aktiva och undvika övervikt. Det är också viktigt att ha en noggrann och regelbunden kontroll på blodtrycket, säger Anna-Clara Collén. Studien visar också att de kvinnor som uppgav en större självupplevd stress de senaste åren hade ett större midjeomfång än kvinnor som upplevde sig mindre stressade. Ett större midjeomfång är även det kopplat till en ökad risk för hjärt- och kärlsjukdomar. HH Källa: Sahlgrenska akademin

Ad 180 x128.indd 1

Kostintaget normaliseras efter gastric bypass-operation I sin avhandling från Sahlgrenska akademin, Göteborgs universitet, har legitimerade dietisten Anna Laurenius bland annat följt 128 personer med fetma som gastric bypass-opererats.

Studierna, där patienterna fått äta testmål­ tider och/eller svarat på enkäter, visar att det oftast fungerar mycket bra att äta efter en gastric bypass-operation men att det finns en risk för symtom efter måltid. – Efter operationen ses stora förändringar av livsmedelsval och ätbeteende som liknar de vi ser hos en frisk normalviktig kontrollgrupp, säger doktoranden Anna Laurenius.Många är överraskade över att de kan äta relativt stora portioner, och så länge maten inte är för fet går det ofta bra att äta lite större volymer. Några månader efter operationen ska de flesta kunna äta en normalstor portion eller som några opererade uttrycker det ”numera tar jag inte om av maten”. – Trots att mängden mat patienterna äter bara minskar i början, så minskar kaloriintaget. Det speglar att patienterna väljer annorlunda mat, där fettintaget

minskar och frukt- och grönsaksintaget ökar, säger Anna Laurenius. Trots att de opererade åt mindre portioner av testmåltiden blev de lika mätta som före operationen och äthastigheten sjönk. Intressant nog försköts kalori­ intaget till tidigare på dagen, medan antalet måltider per dag ökade endast något. – Vi har nu omvärderat kostråden till patienter som genomgår gastric bypass. Vi tror till exempel inte alls att man behöver småäta, det räcker oftast med de vanliga huvudmålen och kanske frukt däremellan, säger Anna Laurenius. Eftersom maten passerar förbi magsäcken och går direkt ut i tarmen kan operationen leda till så kallade dumpingsymtom, det vill säga att maten ”dumpas” ner i tarmen vilket bl a kan orsaka trötthet och illamående. – Min avhandling tyder snarare på att dumping-symtomen ska ses som ett verktyg. De flesta lär sig snabbt var gränserna går men 10 procent har bestående besvär, säger Anna Laurenius. HH Källa: Sahlgrenska akademin

#3 2013

21.03.13 18:06

39


Thomas Helleday. Foto: Ulf Sirborn.

Fredrik Almqvist. Foto: Dan Johnels.

Unga svenska me forskare belönas Årets Göran Gustafssonpriser, om sammanlagt nästan 24 miljoner kronor, fördelat på 4,75 miljoner per person, till­delas bland andra: Fredrik Almqvist (kemi), Kerstin Lindblad-Toh (molekylärbiologi) och Thomas Helleday (medicin).

40

#3 2013

vanliga celler i någon större utsträckning. I sin pågående forskning arbetar Helleday med att utveckla skräddarsydda behandlingar för cancerpatienter genom att undersöka hur syntetisk letalitet och kroppens reparation av DNA-skador fungerar.

Målsökande substanser botar cancer

”Frisörmolekyler” – ett sätt att bekämpa sjukdoms­ framkallande bakterier

Thomas Helleday, född 1971 (42 år), innehar Torsten och Ragnar Söderbergs donationsprofessur i translationell medicinsk forskning, och är professor i kemisk biologi vid Institutionen för medicinsk biokemi och biofysik vid Karolinska Institutet. Inom translationell forskning gör man laboratorieundersökningar baserade på sjukdomsproblem som identifieras inom sjukvården. Helleday fokuserar på metoder att bota cancer. Alla cancerceller är muterade, förändrade, jämfört med vanliga celler. Därför är sannolikheten hög att de också har någon svaghet som vanliga celler inte har, vilket är grundtanken i Helledays forskning. Ett spår i denna forskning är sökandet efter syntetisk letalitet, det vill säga par av gener där minst en av generna måste fungera normalt för att cellen ska överleva. I normala celler fungerar båda generna i genparet, men i cancercellen kan den ena av dem vara felaktig. Det betyder att cancern är helt beroende av den andra, fungerande genen för sin överlevnad. En behandling som slår ut denna kommer därför att döda cancercellerna, utan att påverka kroppens

Fredrik Almqvist, född 1967 (45 år), är professor i organisk kemi vid Umeå universitet. När antibiotika i form av penicillin, sulfapreparat med mera gjorde sitt intåg trodde många att vi en gång för alla hade kontroll över farliga infektionssjukdomar. Nu har bakterierna hunnit i kapp, och på grund av en allt högre grad av bakteriell resistens mot dagens antibiotika är återigen infektions­sjukdomar i topp på WHO:s lista över världsproblem. För att kunna utveckla helt nya antibakteriella substanser och kringgå resistensproblemen måste vi skaffa oss detaljerad kunskap om bakteriernas sjukdomsframkallande egenskaper, så kallade virulens­mekanismer. Almqvist har med hjälp av små designade molekyler identifierat nya möjligheter att utveckla substanser som specifikt slår mot bakteriella virulensmekanismer. Almqvist har tillsammans med forskare i USA studerat hur bakterier bygger upp organeller som ser ut som små hår, så kallade pili. Dessa hår hjälper bakterien att fastna på våra celler och orsaka en infektion, men de är också viktiga i andra skeenden under infektionscykeln.


000_forsknanslag2013_91x262_Layout 1 2013-04-09 10:44 Sida 1

NU K SÖ

!

Hjärt-Lungfondens

forskningsanslag 2013

Kerstin Lindblad-Toh. Foto: Privat.

edicin­ När bakterien utsätts för substanser, kallade ”frisörmolekyler”, som Almqvist och hans forskarteam tagit fram, kan dessa pili inte växa och bakterien förlorar på så sätt sin sjukdomsframkallande förmåga. Att skräddarsy behandlingar för hundar och människor

Kerstin Lindblad-Toh, född 1970 (42 år), är professor i komparativ genomik vid Institutionen för medicinsk biokemi och mikrobiologi vid Uppsala universitet. Lindblad-Toh har i sin forskning kartlagt ett stort antal arvsmassor för däggdjur, ödlor och fiskar och jämfört däggdjurens arvsmassor för att hitta specifika gener i människans arvsmassa, samt de signaler som avgör när gener slås på och av. Efter att ha kartlagt hundens arvsmassa har Lindblad-Toh hittat gener som förändrats när hunden domesticerats. Dessa inkluderar gener som styr hjärnans utveckling och funktion och metabolism av stärkelse. Dessutom fokuserar Lindblad-Toh på att hitta sjukdomsgener hos hundar, eftersom hundar och människor har nästan samma genuppsättning, lever i samma miljö och får samma åkommor såsom cancer, epilepsi, hjärtsjukdomar och inflammatoriska sjukdomar. I sin pågående forskning studerar Lindblad-Toh parallellt gener som identifierats hos hunden och gener hos människor med motsvarande sjukdom. Målet är att identifiera mutationer och på sikt få fram tidigare diagnoser och bättre, skräddarsydda behandlingar för både hundar och människor.

Hjärt-Lungfonden ger stöd till forskning för att besegra hjärt-, kärl- och lungsjukdomarna. Stödet från svenska folket är idag större än någonsin. Tack vare alla generösa gåvor kunde Hjärt-Lungfonden öka satsningen till 180 miljoner kronor 2012. Forskningsinsatserna förstärks ytterligare för 2013 och nu utlyses: Forskartjänster Projektbidrag Forskarmånader Stipendier för forskning utomlands Bedömningsgrund. Vid utvärdering av ansökningarna kommer originalitet och sannolik klinisk betydelse av de sökandes forskningsprogram att särskilt beaktas. Ansökningsförfarande. Ansökningar lämnas in från den 24 april t.o.m. 22 maj 2013. Mer information hittar du på www.hjart-lungfonden.se Ytterligare upplysningar. Vill du veta mer om forskningsanslagen kan du kontakta Hjärt-Lungfondens forskningsavdelning på tel 08-566 24 220.

pg 90 91 92 -7 www.hjart-lungfonden.se

Källa: Kungliga Vetenskapsakademin

#3 2013

41


Medicinnotiser

Hjärt- och kärlsjuka fortsätter leva farligt trots diagnos Läkemedel som behandlar hjärt- och kärlsjukdomar är de vanligaste i Sverige. I en ny stor Sifo-undersökning, där man kartlagt svenskarnas tankar och oro kring sitt hjärta, svarar nästan var fjärde att de äter hjärtkärlmedicin.

Motion är ett sätt att få ner blodtrycket och få hjärtat att må bättre, men många fortsätter med ohälsosam livsstil trots fastställd diagnos. Undersökningen, som är en del av Kronans Droghandels satsning ”Alla Hjärtans År”, genomfördes av Sifo i januari med 1 246 svaranden. Varje år skriver man ut cirka 23 miljoner recept inom läkemedelsgruppen hjärta och kärl i Sverige. Enligt Kronans Droghandels undersökning svarar nästan var fjärde (22 procent) att de äter hjärt-kärlmedicin. Tittar man på Stockholm, Skåne och Göteborg finns det också skillnader. Skåne är den region i landet där man använder mest medicin (29 procent), följt av Göteborg (25

procent) och Stockholm (20 procent). De som drabbats av hjärt- och kärlsjukdom måste ofta ändra sin livsstil för att inte bli sjuka igen. Undersökningen visar att många av de som tar hjärt- och kärlläkemedel behöver råd och stöd hur de ska leva med mer motion, mindre stress och bättre kost. Till exempel svarar 48 procent av de som tar medicin att de äter för mycket ohälsosam mat och 51 procent anser att de är överviktiga, jämfört med 38 samt 35 procent bland de som inte tar hjärt- och kärlläkemedel. Blodtryckssänkande är den medicinen för att skydda hjärta och kärl som flest (19 procent) uppger att de tar i undersökningen. Motsvarande siffra bland personer över 56 år är 42 procent. Kolesterolsänkande medicin (9 procent) kommer på andra plats följt av blodförtunnande medicin (7 procent). Blodtrycket mäts i regel när du sitter ned och när det mäts är det viktigt att du är avslappnad. Du bör helst ha vilat 5-10

minuter före. Blodtrycket mäts i enheten millimeter kvicksilver (mmHg). Blodtryck högre än 140/90 mmHg, som uppmätts vid fler än ett tillfälle, brukar räknas som förhöjt blodtryck. Kronans Droghandel har tagit fram ett självtest där man genom att svara på några enkla frågor kring hur man lever får en indikation på om man är i riskgruppen för hjärt- och kärlsjukdomar. HH

Bevisat mindre störd sömn med stöd och rättvisa på jobbet Det finns vetenskapligt stöd för ett samband mellan arbete och sömn. Goda arbetsförhållanden är kopplat till mindre sömnstörningar. Det visar en ny systematisk utvärdering från Statens beredning för medicinsk utvärdering, SBU.

Rapporten har också funnit vad i arbetet som har samband med högre förekomst av sömnstörningar. Sådana exempel är alltför höga krav i arbetet, psykiskt ansträngande arbete eller mobbning på arbetsplatsen. Även de som har ett arbete där belöningen är låg eller inte står i proportion till ansträngningen har mer sömnstörningar. Exempel på belöning kan vara lön eller uppskattning. Personer som arbetar skift har mer sömnstörningar. De som slutar arbeta skift får bättre sömn, visar SBU:s granskning. 42

#3 2013

Både kvinnor och män ingår i forskningen men studierna presenterar sällan resultaten ur ett könsperspektiv. Därför kan det finnas skillnader mellan könen som vi ännu inte känner till.SBU har granskat den samlade internationella forskningen på området. Projektgruppen har gått igenom nästan 8 000 sammanfattningar av forskningsartiklar. Störd sömn kan påverka hela tillvaron och på sikt leda till sjukdom. SBU:s resultat gäller grupper av människor. Forskningsresultat på gruppnivå kan ge viktiga ledtrådar för den enskilda, men aldrig ersätta en individuell bedömning. Rapporten innehåller inte några förslag till förändringar i regelverk eller ändringar i praxis. SBU:s roll är att ta fram ny kunskap som sedan kan komma till nytta hos andra aktörer. HH Källa: SBU


Medicinnotiser

Målinriktade läkemedel har bidragit till minskad dödlighet i njurcancer Den totala överlevnaden i njurcancer har ökat sedan läke­ medel av typen tyrosinkinashämmare blev till­gängliga i mitten på 2000-talet. Det visar resultatet av en nyligen publicerad svensk studie, RENCOMP.

Studien är en av de första i sitt slag på cancerområdet i Sverige där man har kombinerat data ur flera olika svenska register för att kunna följa vårdförlopp, medicinering och överlevnadstid för samtliga patienter med njurcancer under de senaste tio åren. – Att samla sjukdomsspecifika hälsodata för en hel befolkning på det sätt som det gjordes i RENCOMP-studien hade sannolikt inte kunnat göras någon annanstans än i Sverige. Vi har en lång tradition av att föra register i Sverige, till exempel startade det svenska cancerregistret redan 1958 och innehåller information om så gott som alla patienter med en cancerdiagnos. I kombination med personnumren som gör att vi kan följa enskilda patienter mellan olika register ger det Sverige unika förutsättningar för uppföljningsstudier som denna, säger Börje Ljungberg, professor i urologi, överläkare och expert på njurcancer vid Norrlands universitetssjukhus i Umeå, samt medförfattare till publikationen. Tyrosinkinashämmare är en grupp läkemedel som verkar genom att hämma specifika receptorer på cancercellernas yta och kan på så sätt hindra cellen från att växa och sprida sig. Vid njurcancer-

behandling påverkas särskilt blodkärlstillväxten, vilket har visat sig framgångsrikt vid denna i övrigt svårbehandlade tumörtyp. – Uppföljning och kontinuerlig kunskapsspridning är viktigt för att säkerställa att nya läkemedel används på bästa sätt. Att tillsammans med sjukvården kunna samverka i en registerstudie som denna ger alla parter värdefull information om läkemedelseffekter hos samtliga patienter med en viss tumördiagnos och utgör ett Thomas Wahlgren viktigt komplement till kliniska prövningar. Här har Sverige en särställning. Goda förutsättningar för samverkan kring utvärdering och uppföljning gör också Sverige mer attraktivt för kliniska studier av nya läkemedel i ett tidigt skede, säger Thomas Wahlgren, medicinsk rådgivare, Pfizer och huvudförfattare till publikationen. HH

Nya riktlinjer för anal­ inkontinens välkomnas I januari lanserade en expertgrupp Riktlinjer för analinkontinens för att öka kunskapen inom sjukvården och minska lidandet bland patienter.

Riktlinjerna välkomnas av Josefine Ottersten, 28, som drabbades av analinkontinens i samband med en förlossningsskada för fem år sedan. – När jag fick se riktlinjerna blev jag jätteglad. Det finns så många människor som lider av analinkontinens och tror att de är ensamma. Josefine Ottersten fick en sfinkterruptur och sprack från slidan till ändtarmen när hon födde sitt första barn som 23-åring. På mödravårdscentralen fick hon ingen information och ingen berättade att hon skulle bli analinkontinent. – Jag dolde mina besvär och anpassade

mitt liv efter inkontinensen. Det blev ett stort socialt hinder och inte ens min man visste om mina symptom, säger Josefine Ottersten. Studier visar att 2-15 procent av svenskarna läcker avföring, dock kan mörkertalet vara stort eftersom ämnet är tabubelagt bland både patienter och vårdpersonal. – Det finns en stor okunskap inom sjukvården. Jag blev ifrågasatt och hamnade mellan stolarna. Nu hoppas jag att de nya riktlinjerna sprids och att rätt personer läser dem, säger Josefine Ottersten. Kunskapen om analinkontinens varierar inom sjukvården och ämnet är så tabubelagt att vårdpersonalen drar sig för att fråga om patienten läcker avföring av rädsla för att genera någon. – Det är sjukvårdens ansvar att våga

Eva Westling

fråga patienten, säger Eva Westling, uroterapeut på Danderyds sjukhus, och en av experterna bakom riktlinjerna för analinkontinens. Projektet med riktlinjerna startade för fyra år sedan då Eva Westling och Meta Gylin, uroterapeut på Södertälje sjukhus, var i London och såg nyttan med de riktlinjer som används inom den brittiska vården. Tillsammans med kollegorna Mari Dahlberg, uroterapeut på Skånes universitetssjukhus, Silvana Häggqvist, uroterapeut på Sahlgrenska Universitetssjukhuset/Östra och Ann-Chatrin Sonesson, stomiterapeut på Akademiska sjukhuset i Uppsala har de tagit fram riktlinjerna, som ska öka kunskapen om analinkontinens och bidra till att fler patienter får hjälp i tid. HH

#3 2013

43


Medicinnotiser

Läkemedel lanseras mot pollenallergi En analys - två resultat! QuikRead go CRP+Hb ®

Nyhet!

CRP+Hb

Nästan var femte svensk lider på vårkanten av rinnsnuva, nästäppa och röda ögon och det som även kallas för hösnuva är inte enkelt att behandla. Nu har ett nytt läkemedel mot pollenallergi, BLOX4 Allergy, lanserats. Det har utvecklats av svenska forskare särskilt för nordiska förhållanden.

Två reklamfilmer ”Fågelskådaren” och ”Golfaren”, som är producerade av Animero visas på TV3. Idén bygger på två karaktärer där den ene stör den andre med sin hösnuva. – Vi ville visa symptomen som alla allergiker känner igen så väl, utan att förmedla en negativ känsla, säger Patrik Asterhag, Creative på Animero. Läkemedelsföretaget Bioglan står bakom produkten BLOX4 Allergy. Det är speciellt på flera sätt, först och främst blockerar det allergener som pollen och kvalster innan de får fäste i slemhinnorna. Det innehåller ingen aktiv substans och inga konserverings­medel som kan ge upphov till biverkningar. Därför kan också gravida tryggt använda produkten. BLOX4 Allergy är ett nässpray som lägger en mikroemulsion, en skyddande hinna över näsans slemhinna. Skyddet kommer redan efter en minut och kvarstår i upp till sex timmar dagtid. Nattetid består skyddet dubbla tiden. HH

Bristol-Myers Squibb och Astra­ Zeneca tar över rättig­heterna för Byetta och Bydureon från Eli Lilly Bristol-Myers Squibb och AstraZeneca har slutfört övertagandet av rättigheterna för Byetta (exenatide) och Bydureon (exenatide) från Eli Lilly. De båda diabetesläkemedlen är godkända i Sverige för behandling av typ 2-diabetes som tilläggsbehandling till andra diabetesläkemedel när patienten inte erhållit tillräcklig effekt av dessa.

www.oriondiagnostica.se

Företagens förvärv av dessa båda läkemedel markerar en tydlig satsning inom diabetesområdet. I november 2011 avslutade företagen Lilly och Amylin sitt samarbete kring exenatide. Bristol-Myers Squibb slutförde i augusti 2012 förvärvet av Amylin Pharmaceuticals. AstraZeneca och Bristol-Myers Squibb utökade därmed också sin befintliga diabetesallians genom att inkludera Amylins diabetesläkemedel. – AstraZeneca och Bristol Myers-Squibb kommer i samband med övertagandet av rättigheterna för Byetta och Bydureon att kunna erbjuda fem olika läkemedel som behandlar typ 2-diabetes. Det är viktigt att vården har tillgång till flera olika behandlingsalternativ för att så långt som möjligt kunna skräddarsy behandlingen för varje individuell patient, säger Martin Olovsson, VD för det Nordisk-Baltiska marknadsbolaget, AstraZeneca. – Förekomsten av typ 2-diabetes ökar över hela världen och det finns därför ett växande behov av olika behandlingsalternativ. Bydureon och Byetta tillhör en klass av läkemedel (GLP-1) som blir allt viktigare vid behandling av typ 2-diabetes, säger Maria Messerer, Vetenskaplig rådgivare diabetes, Bristol-Myers Squibb Sverige. HH

44

#3 2013


Medicinnotiser

Stöd Lions Cancerforskningsfond Stöd Lions Cancerforskningsfond

Övergripande resultat med fostamatinib för behandling av reumatoid artrit Övergripande resultat i OSKIRA-1, en fas 3- studie för att bedöma effekt och säkerhet av fostamatinib, den första i klassen av orala hämmare av spleen tyrosine kinase (SYK) som utvecklats för reumatoid artrit.

OSKIRA -1 hade två primära mål: bedömning av tecken och symptom av reumatoid artrit enligt en vedertagen skala (ACR 20) som bygger på procentuell förbättring av symptom samt enligt en vedertagen röntgenologisk skala (mTSS) som mäter benerosion och minskning av ledspringan med hjälp av röntgen. I studien uppvisade fostamatinib en statistiskt signifikant förbättring av behandlingssvaret enligt ACR 20 efter 24 veckors behandling både i gruppen med dosering på 100 mg två gånger per dag och i gruppen med en dosering på 100 mg två gånger per dag i fyra veckor följt av 150 mg en gång per dag, jämfört med placebo. Fostamatinib visade ingen statistiskt signifikant skillnad i mTSS jämfört med placebo efter 24 veckor för någon av doseringarna. Briggs Morrison, Executive Vice President of Global Medicines Development and Chief Medical Officer säger i ett pressmeddelande från AstraZeneca: – Dessa övergripande resultat ger oss viktig information om säkerheten och effekten hos fostamatinib och visar att läkmedlet har effekt både på tecken och symptom av reumatoid artrit. Vi kommer att invänta resultaten från de återstående fas 3-studierna OSKIRA-2 och OSKIRA-3, för att fortsätta att utvärdera och klargöra profilen hos fostamatinib som en potentiell behandling av reumatoid artrit. HH

plusgiro 900940-8 bankgiro 900-9408 plusgiro 900940-8 bankgiro 900-9408

Telefon 0652-10892 www.lcff .se Telefon 0652-10892 www.lcff.se #3 2013

45


Missa inte vå r nya hemsida –

www.medic inskaccess.s e Där p ublicerar vi kontinuerligt aktuella medicinska n yheter. Varmt välko mna!

b

ler a i c pe

S

!

de n a d ju

sid. 57! Beställningstalong på

Välfärdens Ohälsa För första gången presenteras det evolutionsmedicinska synsättet för en bred publik. Författaren visar med exempel från modern och äldre forskning hur den moderna livsstilen med fokus på kosten, leder till att vi idag i förtid drabbas av kroniska ålders- och livsstilsrelaterade sjukdomar. Av: Lars Wilsson

40 kr + Kontakta Tord på 0652-151 10 eller info@tmmedia.se 46

#3 2013

porto


forskning och utveckling

Forskning om järn­ brist hos barn med låg födelsevikt till­ delas Stora Barn­ medicinpriset Staffan Berglund, Umeå Universitet, tilldelas Stora Barnmedicinpriset 2013 för sin forskning om järnbrist hos barn som föds med marginellt låg födelsevikt. Forskningen har redan lett till förbättringar inom sjukvården.

Stiftelsen Ronald McDonald Barnfond delar för tionde året i rad ut Stora Barnmedicin priset med en prissumma på 100 000 kronor. Priset delades ut 24 april i Karlstad i samband med Barnläkarveckan. I avhandlingen ”Effects of iron supplementation on iron status, health and neurological development in marginally low birth weight infants” visar Staffan Berglund att barn med låg födelsevikt riskerar järnbrist, men Staffan Berglund att man med järntillskott första levnadsåret kan motverka detta, utan biverkningar. Han har också visat att för denna barngrupp kan järntillskott minska risken för beteendeproblem i förskoleåldern. Den medicinska juryn, ledd av professor Már Tulinius framhåller särskilt att Staffans arbete redan lett till förbättrad hälsa för denna riskgrupp av barn. – Det här var en glad nyhet och det känns fantastiskt att vårt arbete uppmärksammas på detta sätt. Det stimulerar till fortsatt forskning kring barns kost och dess betydelse för utveckling och hälsa. Jag kommer nu att fortsätta kombinera forskning med mitt arbete som barn­läkare och vi har flera spännande projekt på gång säger Staffan Berglund. Staffan Berglund är utbildad barnläkare född och verksam i Umeå där han studerat, forskar och jobbar på barnkliniken. Staffan har tillsammans med Svensk Barnläkarförening och Svensk förening för Neonatologi, skrivit nationella riktlinjer som innebär att barn med låg födelsevikt nu tilldelas järntillskott. HH Källa: Ronald McDonald Barnfond

Nytt ljus över tidigt sjukdomsförlopp vid Alzheimers Hos patienter med Alzheimers sjukdom ansamlas plack i hjärnan, bestående av en proteindel som kallas amyloid-beta-peptid (Aβ).

Det är också välkänt att dessa patienter har en störd omsättning av bland annat glukos och kalcium i nervcellerna, något som är kopplat till celldöden. I cellen är det mitokondrierna som ska sköta omsättningen av dessa ämnen, eftersom de fungerar som ett kraftverk och står för cellens energiförsörjning. Men för att mitokondrierna ska lyckas måste de i sin tur ha bra kontakt med en annan del av cellen, som kallas endo­ plasmatiskt retikulum (ER). Kontakt­ytan mellan mitokondrierna och ER finns i den så kallade MAM-regionen i cellen. Tidigare studier, gjorda på bland annat jästceller, har påvisat att inaktivering av vissa proteiner i MAM-regionen förstör kontaktpunkterna mellan mitokondrier och ER. Därmed kan mitokondrierna inte leverera energi till cellen, som dör. Forskare vid Karolinska Institutet har nu för första gången studerat MAMregionen i nervceller. I studien undersöks samverkan mellan mitokondrierna och ER i ett tidigt stadium av Alzheimers sjukdom. I det skedet har Aβ ännu inte bildat stora, klumpliknande plack. Sjukdomen ger dock ofta symtom redan i detta skede, så Aβ som ännu inte har hunnit bilda plack är giftigt för nervcellerna.

Resultatet, som publiceras i webb­ upplagan av vetenskapstidskriften PNAS, är något överraskande. När nervceller exponeras för låga doser Aβ leder det till att kontakt­punkterna mellan mitokondrier och ER blir fler. Det leder i sin tur till att mer kalcium överförs från ER till mitokondrierna, som samlar på sig för mycket kalcium. Något som också är giftigt för dem och påverkar deras funktion som energiförsörjare till nervcellen. – Det är mycket viktigt att ta Maria Ankarcrona reda på vad som orsakar nervcells­ döden för att kunna utveckla molekyler som påverkar sjukdoms­förloppet. På sikt kan vi kanske få fram ett läkemedel som kan bromsa sjukdomen i ett skede där patienten fortfarande kan hantera sin vardag. Kan vi förlänga den perioden med ett antal år är mycket vunnet, i dag finns inga läkemedel som påverkar själva sjukdomsprocessen, säger Maria Ankarcrona, docent och forskare vid Alzheimercentrum, Institutionen för neurobiologi, vårdvetenskap och samhälle. HH Källa: Karolinska Institutet

Evidensbaserad stegräkning Vetenskapligt validerade stegräknare. Ledande inom forskning. Rekommenderas till hälso- och sjukvård. Stegrekommendationer för olika sjukdomstillstånd. Stegkalender till patienter. Följ dina patienter på nätet. Beställ stegräknare och läs mer på KeepWalking Scandinavia 070- 403 21 91

LS2000: inga inställningar

www.keepwalking.se #3 2013

47


Eva Martinsson, ordf i stipendiejuryn, Kurt Boman Skellefteå lasarett, Maria Gill och Mats Rundqvist båda Västerås kommun samt Björn Myrvold vd Tieto HC Scandinavia.

Vitalis – nordens ledande mötesplats för e-Hälsa Årets konferens och utställning i Göteborg befäste Vitalis ställning som Sveriges och Nordens ledande mötesplats för eHälsa.

Konferensen samlade 1 158 delegater, ett hundratal fler än i fjol. Utställningen, med fri entré, hade flera tusen besök och över 100 utställare - fler än någonsin. Anna Sandström, mässansvarig för Vitalis, försöker förklara framgången: – Vi har lyckats fånga de angelägna och brännande frågorna, vilket också det ökade mediala intresset visar. Förhoppningsvis har vi bidragit till att lyfta upp eHälso­frågan på agendan, i såväl rikspolitiken som i landsting och kommuner. Vad tyckte besökarna?

Så här tyckte några konferens­deltagare om Vitalis 2013: Roland Frisdalen från Frösön, projektledare inom IT-branschen som besökt många Vitalis-konferenser. – Årets konferens var ovanligt bra. Spåret kring semantisk interoperabilitet gav 48

#3 2013

mig en hel del. Men allra bäst var tisdagens paneldebatt med läkarna, där det framkom hur illa ställt det är med dagens IT-stöd. Annika Lagerqvist, verksamhetsutvecklare IT-stöd i Vaggeryds kommun, som i år var med för första gången. – Jag har lyssnat på flera intressanta spår. Det bästa var nog patientsäkerhet och informationssäkerhet, där finns stora ut­maningar. Jag fick också värdefull input kring förändringsledning. Man behöver alltid lite nytänk. Att alla systemleverantörer fanns på plats var också värdefullt, man kunde göra en riktigt bra omvärldsbevakning. Vad tyckte utställarna?

Terese Hedin, Cambio. – Vi var med för sjätte gången på Vitalis och jag måste säga att årets mässa var en av de absolut bästa vi upplevt! Vi hade inte en lugn stund, trots att vi hade många medarbetare i montern. Intresset för våra produkter, framförallt Cosmic Nova, har varit helt otroligt. Inte minst bland läkare och sjuksköterskor, som upptäckt att man

kan få en skräddarsydd version, så att det blir en helt ny upplevelse. Vitalis-stipendiet 2013.

Maria Gill och Kurt Boman är vinnarna av Vitalis-stipendiet 2013. De belönas för två helt olika insatser – eHemtjänst respektive ätverktyget CheckUp – men med en gemensam nämnare: I båda fallen ger de tusentals människor ett rikare och tryggare liv! Utdelningen ägde rum den 17 april vid den stora Vitalis-banketten på Rondo i Göteborg. Bakom stipendierna, på vardera 25 000 kr, står Tieto i samarbete med Svenska Mässan. Stipendierna, som i år utdelas för sjunde gången, belönar personal inom vård och omsorg som utvecklat IT-tillämpningar med klara nyttoeffekter. I kommunklassen vann Maria Gill, sjuksköterska och projektledare inom välfärdsteknologi i Västerås kommun. Tillsammans med sjukgymnasten Mats Rundkvist har hon startat projektet eHemtjänst. HH


Portvin, choklad och lite olivolja Är du glad, modig, agerar moraliskt och utan ånger? Då har du chans att bli riktigt gammal. Dricker du dessutom portvin, äter choklad och får i dig lite olivolja varje dag? Då kan du, med mycket tur och vilja, kanske bli hela 122 år gammal. Det var i alla fall så hon levde fransyskan Jeanne Louise Calment som hade fyllt 122 år när hon dog i Paris 1997. I ”Receptfritt i praktiken” punktbelyser vi några stora problemområden som många bottnar i vår kost och livsstil. Det handlar bland annat om magen och olika kostrekommendationer – vilken är den ”rätta”? Finns det över huvud taget något rätt? Vi försöker också ge instrumentell information om egenvård vid exempelvis prostataproblem, klimakteriebesvär samt vid lättare depressioner och nedstämdhet.

Birger Jarlsgatan 55, 111 45 Stockholm Telefon: 08-545 411 60 www.svenskegenvard.se

Beställ boken via vår hemsida www.svenskegenvard.se alternativt mejla till Ann Wahlgren, ann@svenskegenvard.se. Boken kostar 75 kronor styck, inkl moms plus porto. (Riktpris i butik 175 kr) #3 2013

49


Bokerbjudande till alla Prenumeranter Ditt pris per bokpaket

100 kr in kl. moms och frakt!

Fyll i och skicka in till oss på: T&M Media AB Fiskvik 100 820 70 Bergsjö

Eller hör av er på: E-post: info@tmmedia.se Tel. 0652-151 10 Fax 0652-151 90

Ja tack!

Plats för frimärke

beställning av . . . . . . . . . . . . . . . . . . bokpaket Pottholzt, pris 100 kr/paket inkl. moms och porto! Skicka faktura! namn InstItutIon/Företag adress postadress

T&M Media AB

teleFon

Fiskvik 100

e-post

820 70 Bergsjö


Medicinnotiser

D-vitamin effektivt mot luftvägsinfektioner Sedan länge vet man att D-vitamin behövs för att skelet­ tet ska må bra, men ny kunskap finns som visar att Dvitamin även har effekter på både det naturliga och det adaptiva immunförsvaret. En forskargrupp vid Karolinska Universitetssjukhuset i Huddinge har studerat om vitamin D3 kan reducera antalet luftvägsinfektioner hos personer med primär immunbrist.

140 personer mellan 18 och 75 år deltog. Personerna hade IgA-brist, IgG-subklassbrist eller Variabel immunbrist (CVID). De hade haft minst 42 dygn per år med dokumenterad luftvägsproblematik och fick inte stå på profylaktisk antibiotikabehandling eller ha någon njurstenssjukdom, bland flera kriterier. 70 personer fick vitamin D och resterande 70 placebo. Samtliga ordinerades åtta droppar per dag under ett år. Mängden D-vitamin som gavs per dag, 4 000 IE, baserades på andra studier som visar att denna mängd behövs för att få effekter på immunförsvaret. Personerna följdes upp med infektionsdagbok, provtagning och läkarbesök. Eftersom D-vitamin aktiverar produktionen av så kallade antimikrobiella peptider i slemhinnorna, mättes nivåerna av dessa ämnen i nässekret. Dessutom räknades antal dagar

med antibiotika samt antal positiva NPH/sputum-odlingar. Studien visade att tillskott av vitamin D3 minskar symptom och antibiotikaförbrukning bland personer med en ökad frekvens av luftvägsinfektioner. Tillskott av vitamin D3 kan därför vara en alternativ strategi för att minska användningen av antibiotika hos patienter med återkommande luftvägsinfektioner. Vitamin D kan man få via mat, som kosttillskott eller i form av oljeberedning. Och effektivast genom solljuset. UVB-ljuset gör att vitamin D bildas i huden. 30 minuters helkroppsexponering i solen per dag ger 10 000 IE (gäller ljushyade), vilket räcker för att tillgodose D-vitaminbehovet. Man behöver alltså inte bränna sig utan det räcker med korta stunder i solen under sommarhalvåret. Överdriven solning leder dock inte till överdosering eftersom kroppen inte kan bilda mer än cirka 10 000 IU/dag via denna syntesväg. Kroppen är sedan ”uppladdad” i ett par veckor upp till en månad. En brittisk studie påvisar lägsta D-vitaminnivåerna i februari och högsta i september. HH Källa: Primär immunbrist organisationen PIO Örebro Referens: Bergman P, Norlin AC et al, BMJ Open, 2012

Patienterna bör sättas mer i centrum i arbetet med nationella riktlinjer Staten kan använda nationella riktlinjer mer effektivt för att främja en vård som sätter patienten i centrum. Det visar en granskning från Riks­ revisionen.

Riksrevisionen har granskat om statens styrning genom nationella riktlinjer främjar en vård som utgår från patienternas perspektiv. Granskningen visar att Social­styrelsen kan arbeta mer effektivt för att främja en mer patientcentrerad vård. Idag saknar flera riktlinjer i en eller flera viktiga dimensioner av patientpers­pektivet. Av totalt 2 700 rekommendationer till vården är det endast tolv som syftar till att göra vården mer tillgänglig för patienterna. Patient- och brukarföreträdare har också

en otydlig roll i arbetet med riktlinjerna och därför i praktiken ett lågt inflytande. I det nuvarande riktlinjearbetet saknas metoder för att systematiskt fånga upp patient- och brukarkunskap. Internationella erfaren­heter visar samtidigt att det finns metoder för hur denna kunskap kan tas in i riktlinjearbetet. – Forskning visar att en vård som sätter patienten i centrum leder till bättre vård­resultat och minskade kostnader för samhället. Samtidigt finns det undersökningar som visar att Sverige i jämförelse med andra länder uppvisar stora brister i det avseendet. Det är därför viktigt att utveckla arbetet med de nationella riktlinjerna så att staten mer effektivt kan använda dem som ett sätt att främja ett pa-

tientperspektiv i vården, säger riksrevisor Gudrun Antemar. Granskningen visar att Socialstyrelsen kan göra mer för att stödja vårdens implementering av riktlinjerna. Myndigheten bör också göra återkommande uppföljningar av hur riktlinjerna uppfattas och används av mottagarna. Riksrevisionen rekommenderar regeringen att ge Socialstyrelsen i uppdrag att utveckla en arbetsmetod för att ytterligare lyfta fram patientperspektivet i rikt­linjerna. Myndigheten för vårdanalys bör få i uppdrag att följa upp riktlinjernas effekter ur ett patientperspektiv. HH Källa: Riksrevisionen

#3 2013

51


Villa Pierrette, Fayence Hyr nyrenoverat stenhus från 1600-talet i södra Frankrike

Välkommen till Pezenas, en Huset maison Delacroix har

vacker medeltida småstad två mil från medelhavet och milsvida sandstränder. Pezenas är en kulturhistorisk stad, där Moliere höll till på sin tid, med en otroligt vacker och välbevarad gammal stadsdel. Staden har över 60 restauranger och under juli och augusti arrangeras vinfestivaler.

4 våningar, nyrustat kök, tre sovrum, två badrum och en toppvåning med utsikt över takåsarna. Huset ligger mitt i staden med öppning mot paradgatan Cours Jean Jaures. Fler bilder på huset? Kontakta Lena Bauer via mail: lena@bauermedia.se eller telefon 0706702671

SVENSKA LÄKARE MOT KÄRNVAPEN – för en kärnvapenfri värld

VILL DU BLI MEDLEM?

VILL DU STÖDJA OSS?

Vi välkomnar dig som är läkare eller läkarstuderande att bli medlem. Maila till: blimedlem@slmk.org!

Vi tar tacksamt emot bidrag stora som små. PlusGiro 901090-1 BankGiro 901-0901

www.slmk.org 52

#3 2013

45 min från Nice flygplats, nordväst om Cannes. Centralt beläget hus i villagen. Ogenerat läge, 4000 kvm tomt, pool. Plats för sex plus fyra personer i två våningar. Seperata kök o badrum. Stort uterum med grill. Nära till golfbanor. Uthyres veckovis v. 21-36. Upplysning på tel. 090-12 10 25, 070-687 58 25, 0033-494 84 17 30, 070-647 49 33.

Aktuella medicinska nyheter publiceras kontinuerligt på vår hemsida:

www.medicinskaccess.se


Medicinteknik

Stomibandage med ett revolutionerande elastiskt häftmaterial Nytt stomibandage, SenSura Mio, lanseras med ett revolutionerande häftmaterial som åtgärdar orsaken till det allra viktigaste problemet för stomiopererade: läckage på grund av dålig passform.

– Under decennier har fokus legat på själva stomin, inte på området runt den – magen. Vår forskning visar att läckage uppkommer på grund av dålig passform mellan magen och häftmaterialet, och att läckage är det allra största problemet för personer med stomi, säger Rasmus Hanneman Möller, chef för Ostomy Care Marketing på Coloplast. För att åtgärda passformsproblemet introducerar Coloplast en ny BodyFit Technology® som ingår i företagets nyligen lanserade stomipåse SenSura® Mio. Tack vare BodyFit Technology har SenSura Mio en unik elastisk häfta som anpassar sig efter kroppen, följer med i kroppens rörelser och därmed sitter säkert mot huden. BodyFit Technology har utvecklats i nära samarbete med stomisköterskor och slutanvändare,

och är helt ny inom branschen för medicintekniska produkter. Jane Fellows, klinisk specialistsjuk­ sköterska inom kirurgi vid Duke University Medical Center i Durham, North Carolina (USA), bekräftar att passformen är ett nyckel­problem inom stomivård. – När magen är stor och har en oregel­ bunden form finns det stor risk för att stomin hamnar i en rynka eller ett hudveck, eller att stomin ligger i jämnhöjd med eller under hudnivån. Detta gör det svårare att sätta fast en påse och kan leda till läckage och hudirritation runt stomin, säger Jane Fellows. 46-åriga Margit Pedersen, som har en kolostomi, har provat SenSura Mio. Enligt henne klarade den testet. – Med SenSura Mio har jag färre läckage, jag känner mig säkrare, och den är också mycket lätt att använda. Jag har använt den medan jag tränade. En gång fick påsen sitta på i tre timmar efter ett spinningspass - och den satt kvar hur bra som helst. Det är faktiskt fantastiskt, säger hon. HH

Första hjälpen i mobilen – ny app Cederroths, kända för sina ”Första hjälpen-produkter” har sedan mitten av 70-talet utvecklat lösningar som gör det möjligt för alla människor att ge Första Hjälpen utan speciella förkunskaper.

Med den nya serien, Ögonduschstationen och Första Hjälpen-stationen kan varje arbetsplats skräddarsy en egen liten akutmottagning för maximal beredskap. Nu finns även Cederroths ”Första Hjälpen-instruktioner” ocksa som en app. Med tydliga illustrationen beskriver den, steg-för-steg, hur man ger Första Hjälpen till vuxna och barn. Här kan användaren i sin egen takt repetera och utöka sina kunskaper för att vara förberedd om en olycka skulle inträffa. HH

Med tydliga illustrationen beskriver den, stegför-steg, hur man ger Första Hjälpen till vuxna och barn.

Lätt, smidig och funktionell design.

Saltinhalator med näsadapter ger naturlig lindring Salt har antiseptiska och antibakteriella egenskaper.

Den huvudsakliga effekten av salt på bronkialsystemet är att det stimulerar sekretionen, löser upp och eliminerar segt slem, förhindrar inflammation, reducerar irritation som ger hosta och renar flimmerhårens slemhinnor. Sedan urminnes tider har bergssalt använts för att lindra olika besvär i luftvägarna. DSI-saltinhalatorn simulerar det naturliga mikroklimat som finns i saltgruvor. I DSI-saltinhalatorn används speciellt utvalda kontrollerade mineralsalter i naturlig form som utvinns från den berömda saltgruvan Praid i Transsylvanien. Inhalatorn kan med fördel användas i förebyggande syfte mot influensa och förkylning och även vid rökavvänjning. Genom att andas genom DSI-saltinhalatorn lindras, lugnas och stimuleras hela andningssystemet genom att de orenheter som förorsakar besvär i andningsorganen avlägsnas. HH

#3 2013

53


Tack alla nya prenumeranter! nya prenumeranter inkommer varje dag. Vi är mycket glada för det. alla har intemöjlighet att kunna prenumerera via sin arbetsplats i dag, men är mycket välkommen som privat prenumerant, vilket många av er är i dag. Vi kommer att ge dig en tidning fylld med intressanta reportage och artiklar. I och med detta nummer som du har i din hand kan du se en helt ny design på medicinsk access. Vi har även lanserat vår nya hemsida: www.medicinskaccess.se , där kan du läsa nyheter som inte finns med i tidningen. Vi tar gärna emot nyheter till nyhetsavdelningen. om du inte förnyat din prenumeration, gör det snart, annars riskerar du bli utan tidning! Medicinsk access vänder sig till dem som arbetar i vården, men även till andra med intresse av medicin, hälsa, förebyggande och vårdande. Tidskriften fylls med aktuella kunskaper och angelägen debatt. Målsättningen är att sätta hälsan i fokus. Huvuddelen av innehållet skrivs av professionen, det vill säga läkare, forskare, sjuksköterskor, medicinjournalister m.fl. Nya rön och erfarenheter från forskning och klinisk vardag kommer kontinuerligt att redovisas. oberoende Tidskriften Medicinsk access står oberoende i förhållande till läkarkår, industri, organisationer och politiska partier. Det ger tidskriften frihet och ett visst svängrum. Medicinsk access är en populärvetenskaplig tidskrift och är Sveriges största oberoende medicinska tidskrift. Skribenterna står för sin egen kunskap och erfarenhet inom sina respektive verksamhetsområden. Medicinsk access utkommer med 7-10 nummer om året. Här hittar du begripliga och intresseväckande artiklar om allt från människans minsta beståndsdelar till det utomkroppsliga. Alla sjukdomar från livets uppkomst och dagens behandlingsterapier tas upp i varje nummer. I tidningen möter du Sveriges och kanske världens mest framstående forskare, läkare, med fler. Vi har ett flertal från professionen som medverkar kontinuerligt i varje nummer som delger sina erfarenheter om dagens behandlingsformer och ny medicinsk teknik. Medicinsk access har bokklubb där ni kan köpa aktuella böcker till rabatterade priser. Vi publicerar dagligen nyheter samt artikelarkiv: www.medicinskaccess.se Vi har sedan 1991 medverkat och utgivit medicinska tidskrifter. Välkommen till ett nytt år med tidningen! Ansvarig utgivare

Chefredaktör

Tord Amré tord@medinskaccess.se

Håkan Hedin hakan@medicinskaccess.se

Medicinsk access utges av T & M Media AB Tel. 0652-151 10 www.medicinskaccess.se


VETENSKAPLIG OBEROENDE MEDICINSK TIDSKRIFT • www.MEDICINSKACCESS.SE

Medicinsk access är Sveriges största oberoende medicin­ tidskrift. Medicinsk access kommer ut med 7 till 10 nummer per år. Varje nummer har intressanta artiklar om erfarenhet och kunskap inom medicin och hälsa. Nyheter, medicinsk teknik, ny forskning, debatt samt gästledare har blivit signum för innehållet. Medicinsk access har bokklubb där ni kan köpa aktuella böcker till rabatterade priser.

Fyll i och skicka in till oss på: T&M Media AB Fiskvik 100 820 70 Bergsjö

Eller hör av er på: E-post: info@tmmedia.se Tel. 0652-151 10 Fax 0652-151 90

Ja tack!

Plats för frimärke

Jag vill prenumerera! Jag vill prenumerera 1 år för 350 kr inkl moms.

Jag vill prenumerera 2 år för 530 kr inkl moms.

namn InstItutIon/Företag adress postadress

T&M Media AB

teleFon

Fiskvik 100

e-post

820 70 Bergsjö


Bokklubben KOL – Våga skaffa ett bättre liv Kjell Larsson Det borde vara lätt att bestämma sig för att sluta röka när man känner till att det är skadligt. KOL är en sjukdom som främst drabbar rökare. Innehåll bl.a. Vad är KOL? Symtom vid KOL, Riskfaktorer vid KOL, Forskning om KOL m.m. Ord. pris 220:-

Faxa eller skicka in beställnings­ talongen på höger sida. Faxnummer: 0652-15190. Eller beställ på vår hemsida.

170:-

150:-

150:-

150:Magens språk Lars Fändriks Krånglande magar inkluderar allt från livshotande cancer och svåra inflammatoriska tillstånd till läkemedels­ biverkningar och ’magont’ utan påvisbara orsaker. Ord. pris 290:-

56

#3 2013

NY!

Diabetes hos barn och unga Gisela Dahlquist Diabetes ökar snabbt bland barn i Sverige. Sjukdomen innebär ett dolt handikapp men man kan leva bra med diabetes som barn och ung. Författaren har summerat det som idag tycks gälla, och avslutningsvis samman­f attat var den framtida forskningen inom ämnesområdet går mot. Ord. pris 290:-

TBC – Dödsängelns budbärare Björn Petrini En bok om tuberkelbacillen och andra mykobakterier. Om en enskild mikroorganism skulle utnämnas till bakteriernas konung skulle TBC vara värdig titeln. 3 miljoner människor dör per år och 10 miljoner insjuknar i tbc, samtidigt som 2 miljarder bär på symtomlös infektion. Ord. pris 280:-

40:Välfärdens ohälsa Lars Wilsson För första gången presenteras det evolutions­ medicinska syn­ sättet för en bred publik. Författaren visar med exempel från modern och äldre forskning hur den moderna livsstilen… Ord. pris 240:-

170:Prostata­ cancer Hans-Olov Adami, Henrik Grönberg, Lars Holmberg, JanErik Johansson, Anders Widmark En av fem svenska män kommer någon gång under sin livstid att få beskedet att han har prostata­cancer. Ord. pris 198:-

150:Candida och andra svampar i våra kroppar Björn Petrini Om candida och andra svampar i våra kroppar. I industri­länderna är svamp­vaginit en vanlig åkomma, där värdinnans egen candida får över­ taget över vaginans bakteriella normal­ flora. Ord. pris 280:-

100:-

150:-

180:Omega-3revolutionen Olle Haglund Ny aktuell bok om fettsyrornas stora betydelse vid hälsa och sjukdom. Den allra senaste forskningen, om förekomst, orsaker, och behandling. Ord. pris 220:-

150:Sömnens betydelse för hälsa och arbete Torbjörn Åkerstedt De flesta av oss råkar då och då ut för dålig eller otillräcklig sömn. Den här boken handlar om vad sömnstörningar beror på och hur man undviker dem. Ord. pris 220:-

150:Friterad orm i Guangzhou Stephan Rössner Unika rese­ berättelser från jordens alla hörn. Skriven med magnifik humor. Ord. pris 240:-

Vill ha barn Ingela Johansson-Rosander och Kerstin Fredholm Att få barn är självklart för de allra flesta men inte för alla. I Sverige finns upp­ skattningsvis 500 000 personer i fertil ålder som är ofrivilligt barnlösa. I boken Vill ha barn får experter och ofrivilligt barnlösa komma till tals. Ord. pris 220:-

Om bakterier och bakterie­ sjukdomar Björn Petrini En bok om bakterier och bakteriesjukdomar. Bakterierna orsakar inte alltid sjukdom, utan ingår i kroppens normalflora. Det finns ändå tusentals bakteriearter som orsakar allehanda infektionssjukdomar, från banala som finnar i huden till dödliga infektioner som pest eller gasbrand. Ord. pris 280:-

170:Reumatism Johan Frostegård I boken förklaras immunsystemets betydelse för de flesta reumatiska sjukdomar, dess grundläggande uppbyggnad och sätt att fungera – kunskap som är viktig för patienten. Ord. pris 198:-

30:Rössners ABCbok om hälsa Stephan Rössner Vad är hälsa egentligen? Stephan Rössner tar alfabetet till hjälp i en ofullständig uppslagsbok om hälsa som ingen kan vara utan. En nöjesläsning där några av de senaste rönen presenteras. Ord. pris 196:-


Pottholzt funderingar Tomas Weitoft Ett gott skratt förlänger livet. Sjukvården är en tummelplats för många olika sorters män­niskor och personligheter. Här sker dråpliga möten mellan personal och patienter. Kvicka kommentarer fälls och de mest be­fängda situationer kan uppstå. Ord. pris 125:-

50:-

Pottholzt andra funderingar Tomas Weitoft Det här är den andra utgivna samlingen av teckningar med sjuka skämt, som utspelas i en värld som befolkas av galna läkare och hopplösa sjuksköterskor. Hit kommer det olyckliga patienter, som mer eller mindre frivilligt sökt sig till detta kaos av skalpeller, piller och överbeläggningar. Ord. pris 125:-

75:-

100:Kallet döden kärleken Pelle Olsson Boken är en livs­ berättelse om Karin Borgström född 1912 i Bom­hus utanför Gävle som trots mot­stånd driver igenom sin högsta önskan – att komma in på Röda korset i Stockholm och bli sjuk­sköterska. Ord. pris 150:-

Handbok för klinisk Genus­medicin Karin SchenkGustafsson, De­ Cola, Pfaff, m.fl. Genusmedicin är ett viktigt nytt område i hälsa och sjukdom. Biologiska och sociala faktorer som ligger till grund för mot­ tagligheten för sjukdomar och dess konse­ kvenser. Ord. pris 695:-

490:-

170:-

170:-

180:-

40:-

170:-

Bröstcancer Jonas Bergh m.fl. Karolinska Institutet Boken ger en detaljerad överblick av vad bröstcancer är, hur sjukdomen botas och vad den framtida forskningen koncentreras på. Vad väntar dig som fått diagnosen bröstcancer? Ord. pris 198:-

Melanom Yvonne Brand­ berg m.fl. Karolinska Institutet Malignt hudmelanom är en av de cancerformer som ökar mest i vårt land och en av de mest betydelsefulla orsakerna är sannolikt ändrade sol- och resvanor. Ord. pris 198:-

Framtidens farliga smitta – hur kan vi skydda oss Britta Wahren och Patrik Wahren Vi lever som i ett moln av virus och bakterier. Mikroorganismer muterar och blir farligare. Ord. pris 250:-

Outsidern: min fars kamp med galen­ skapen Nathaniel Lachenmeyer En välskriven och modig berättelse som får oss att se ansiktena bakom de hemlösas masker. Ord. pris 149:-

Alzheimer Forskare vid Karolinska Institutet Bokens författare är forskare som ägnar sig åt att försöka förstå denna sjukdom – vad händer i hjärnan hos den som är sjuk, vilka riskfaktorer leder till att Alzheimer bryter ut. Ord. pris 198:-

Leverans­ villkor: Böckerna lever­ eras mot faktura och skickas van­ligen inom två arbets­dagar från det beställningen mot­tagits, har vi inte böckerna i lager tar det normalt en vecka innan böckerna kan skickas. Priserna inkluderar 6% moms. Fraktkostnad tillkommer. Vi reserverar oss för felskrivningar, pris­ändringar och slutförsäljning. Ord. pris är för­­lagens rekom­ menderade cirka­ priser. Kreditupplysning kan göras. Självklart går det bra att skicka in en kopierad talong om du inte vill klippa sönder tidningen. Det går även bra att faxa 0652151 90 eller ringa 0652-151 10 och beställa. Besök vår hemsida för mer infor­mation om bokklubben.

Ja tack, jag beställer: st Friterad orm i Guangzhou

st Välfärdens ohälsa

st Pottholzt andra funderingar

st Candida och andra...

st Prostatacancer

st Kallet, döden kärleken

st Sömnens betydelse...

st Omega-3-revolutionen

st Bröstcancer

st Diabetes hos barn...

st Reumatism

st Melanom

st Vill ha barn

st Rössners ABC-bok

st Evidensbaserad medicin...

st TBC – Dödsängelns...

st Handbok för klinisk...

st Outsidern: min fars kamp...

st Om bakterier...

st Allt om Omega-3

st Alzheimer

st Magens språk

st Pottholzt funderingar

st Framtidens farliga smitta

Jag vill prenumerera 1 år för 350 kr inkl moms.

Plats för frimärke

Jag vill prenumerera 2 år för 530 kr inkl moms.

namn Institution/Företag adress postadress

T&M Media AB

telefon

Fiskvik 100

e-post

820 70 Bergsjö #3 2013

57


Månadens Pottholzt

Medicinsk access publicerar valda godbitar från Pott­ holzt funderingar.

Pottholzt andra funderingar om… …ETT SLAGTÅLIGT HJÄRTA

Tomas Weitoft, uppväxt i Stockholm bosatt i Gävle. Han har doktorerat vid Uppsala universitet och arbetar som läkare med reumatiska sjukdomar som specialitet. ”Pottholzt funderingar” såg dagens ljus i mars 1999. Boken Pottholzt andra funderingar kom ut 2007.

Smycka ditt hem, kontor, mottagning eller väntrum med välgjorda handmålade kopior, olja på duk, från de stora mästarna. Förgyll arbetsmiljön med historiska konstverk.

50 % rabatt på tavlor och ramar under april 2013!

Kröyer Hip, hip hurra

Välkomna till Nästan Äkta på Skånegatan 66, Stockholm Öppettider: onsd-fredag 12.00-18.00, lördag 11.00-1500. Telefon 070-6702671 58

#3 2013

Klimt Kyssen


Resolor® (prukaloprid) är indicerat för symtomatisk behandling av kronisk förstoppning hos kvinnor där laxativ inte ger tillfredsställande lindring. Läs produktresumén för Resolor innan läkemedlet förskrivs, särskilt beträffande överkänslighet mot något av innehållsämnena, nedsatt njurfunktion som kräver dialys, tarmperforation eller – obstruktion, obstruktiv ileus, svåra inflammatoriska tillstånd i tarmkanalen, svår och kliniskt instabil samtidig sjukdom, särskilt hos patienter med arytmi eller ischemisk kardiovaskulär sjukdom. Mycket vanliga biverkningar som associeras med Resolor är huvudvärk, illamående, diarré, buksmärta, som företrädesvis uppträder i början av behandlingen och vanligtvis försvinner inom ett par dagar med fortsatt behandling. Vanliga biverkningar är yrsel, kräkning, dyspepsi, rektal blödning, flatulens, onormala tarmljud, pollakisuri, trötthet.

Hennes väg bort... ...från kronisk förstoppning

Begränsning av subvention: Resolor® är subventionerat för symtomatisk behandling av kronisk förstoppning hos kvinnor där laxativ inte ger tillfredsställande lindring.

Referenser: 1. Resolor® (prukaloprid), SPC 2012. 2. Camilleri M et al. N Engl J Med 2008; 358:2344–54. 3. Quigley EM et al. Aliment Pharmacol Ther 2009; 29:315–28. 4. Tack J et al. Gut 2009; 58:357–65. 5. Shire-Movetis. Data on file, SPD555–12, 2012.

L I N D H & PA R T N E R S

t e h Ny

Nu finns det ett nytt läkemedel för kvinnor med kronisk förstoppning Resolor® är en selektiv 5-HT4-receptoragonist indicerad för symtomatisk behandling av kronisk förstoppning hos kvinnor där laxativ inte ger tillfredsställande lindring.1 Resolor® ger signifikant större andel patienter som uppnår normalisering av tarmtömning*, förbättring av sjukdomsspecifika symtom samt förbättrad livskvalitet jämfört med placebo.1-5 *Definierat som ett medeltal på ≥ 3 spontana, fullständiga tarmtömningar per vecka under den 12 veckor långa studieperioden.

Shire Nordic Regional Office, Svärdvägen 11D, 182 33 Danderyd, Tel 08 544 964 00, medinfoglobal@shire.com

Dags att gå vidare

SE/LO/RES/12/0040

Resolor® (prukaloprid) , (F). Indikation: Resolor® är avsett för symtomatisk behandling av kronisk förstoppning hos kvinnor där laxativ inte ger tillfredsställande lindring. AtC-kod: A03AE04. Kontraindikationer: Överkänslighet mot den aktiva substansen eller mot något hjälpämne, nedsatt njurfunktion som kräver dialys, tarmperforation eller -obstruktion på grund av strukturell eller funktionell störning i tarmväggen, obstruktiv ileus, svåra inflammatoriska tillstånd i tarmkanalen, såsom Crohns sjukdom och ulcerös kolit och toxisk megakolon/megarektum. Varningar och försiktighet: Försiktighet bör iakttas vid förskrivning av Resolor® till patienter med svårt nedsatt leverfunktion, arytmi eller ischemisk kardiovaskulär sjukdom, lungsjukdom, neurologiska eller psykiska störningar, cancer eller AIDS och andra endokrina störningar. En dos på 1 mg rekommenderas till patienter med svårt nedsatt njurfunktion. Vid svår diarré kan verkan av orala preventivmedel försvagas och användning av en ytterligare preventivmetod rekommenderas för att förhindra att det orala preventivmedlet eventuellt inte skyddar. Rekommenderas inte till män förrän ytterligare data blir tillgängliga, inte heller till patienter med ärftliga tillstånd såsom: galaktosintolerans, total laktasbrist eller glukos-galaktosmalabsorption. Graviditet och amning: Rekommenderas inte under graviditet och amning. effekter på förmågan att framföra fordon och använda maskiner: Resolor® har associerats med yrsel och trötthet, speciellt under första dagen av behandling, vilket kan ha en effekt på förmågan att framföra fordon och använda maskiner. Förpackningar: Filmdragerade tabletter 1 mg och 2 mg, 28 st. Texten är baserad på produktresumé: 03/2012. För ytterligare information och priser se www.fass.se.


POSTTIDNING B T&M Media AB Fiskvik 100 820 70 Bergsjö

Oestring – lokal östrogenbehandling med låg och jämn frisättning 1

Dokumenterad effekt på urogenitala symtom såsom torrhet, klåda, sveda, dyspareuni, täta urinträngningar och recidiverande urinvägsinfektioner2–5

Byts var tredje månad1

OES20120917PSE10 2013

Oestring®(estradiol) är en lokalt verkande vaginalring som utsöndrar 7,5 µg östradiol per dygn. Oestring, som byts var tredje månad, ger en jämn och kontinuerlig dos. Ref: 1. Oestring SPC. 2. Smith P et al. Maturitas 1993; 16: 145–54. 3. Lose G. et al. Br J Obstet Gynecol 2000; 107: 1029–34. 4. Hormonbehandling i Klimakteriet, ARG-Rapport 2010, nr 67, sid 46. 5. Eriksen Bjarne, Am J Obstet Gynecol, Vol 180, Number 5, May 1999, 1072–1079. Oestring® (estradiol) RX. Ingår i läkemedelsförmånen, se www.fass.se. Indikation: Substitutionsterapi vid lokal östrogenbristsymtom. Förpackningar och styrkor: Vaginalinlägg 7,5 mikrog/24 timmar. 1 styck foliepåse. Datum för översyn av produktresumén: 2013-03-12. För ytterligare information: www.fass.se och www.pfizer.se

För en bra känsla

Pfizer AB. 191 90 Sollentuna. 08-550 520 00. www.pfizermedica.se/gynekologi. www.oestring.se


Medicinsk access 3-2013