Page 1

고황산 및 교실환경의 공기 중에 부유하는 곰팡이 동정

경희여자고등학교 과학영재학급 장미 이수연 위가영 양경운 지도교사

김지광

2013년 11월


목차 목차 :

p. 1

Ⅰ. 탐구 동기 및 목적 : Ⅱ. 서론 :

p. 2

p. 2

Ⅲ. 재료 및 방법 : Ⅳ. 결과 :

p. 17

Ⅴ. 결론 :

p. 46

Ⅵ. 참고문헌 :

p. 10

p. 49

1


Ⅰ. 탐구 동기 및 목적 학교 과학실은 항상 습하고 서늘하여 벽이나 문틈에 보면 곰팡이가 많이 피어있다. 평소 생활 하면서 곰팡이를 많이 접해보지는 않았는데 과학실을 드나들며 곰팡이를 계속 보니까 주위에 잘 보이지 않는 곰팡이에 관해 호기심이 생겼다. 때마침 주변에 균을 연구하는 동아리에 있는 친구 가 있었는데 그 친구가 곰팡이를 채취하여 배지에 키워서 연구 하는 것을 보고 배워 곰팡이를 채 취해 배지에 키워 연구하기로 했다. 곰팡이를 연구하기 위해 알아보던 중 작년 학교 선배가 써 놓은 공기 중에 존재하는 곰팡이에 대한 논문을 발견하였다. 작년에 써 논 논문을 보니 올해는 어떻게 달라졌을지 궁금증이 생겨 공기 중에 떠다니는 곰팡이를 연구하기로 했다. 공기 중 곰팡이를 연구하기 위해 어느 장소에 놓을지 생각하다가 분필가루나 먼지 같은 것이 많이 떠다니는 교실과 나무가 많아 공기가 맑다고 하는 고황산 두 곳에 배지를 30분 동안 배치하 여 곰팡이를 채취해 연구하기로 하였다. 이번 실험의 주요 목적은 크게 공기의 맑기가 다른 교실 과 고황산의 공기 중 곰팡이를 채취해 순수분리하고 배양해서 어떤 종류인지 알아보는 것이고, 작게는 작년 경희여고 선배가 조사한 그 때의 공기 중 곰팡이와 현재를 비교하는 것이다.

Ⅱ. 서론 가. 균 균류는 다른 생명체들과는 달리 독특한 행동양식과 세포 구조를 가지고 있는 집단의 생명체이다. 균류는 우리가 살아가는데 많은 역할을 수행하는데, 균류 그 자체가 병원체이기도 하고 분해자 이기도 하며 유전학이나 생물학 연구에 이용되는 실험용 모델 생명체이기도 하다. 그리고 중요한 많은 대사산물의 생산자이기도 하다. 균류는 동물계, 식물계와 동등한 위치에서 균계를 이루는 생 물군이다. 균류는 유기물이 있으면 어느 곳에서나 생활할 수 있으며, 여러 가지 균류는 각기 알맞 은 환경에서 그 특성에 맞는 생활을 한다. 균류는 방대한 생물군 체제상으로 원핵균류와 진핵균 류의 2아계로 분류할 수 있다. 원핵균류는 미코플라스마문, 세균문, 점액세균문, 스피로헤타문, 방 선균문등이 속하고 진핵균류에는 변형균문, 세포점균문, 라비린툴라문, 난균문, 단모균문, 접합균문, 자낭균문, 담자균문등이 있다. 우리가 조사한 곰팡이는 대부분 자낭균과 접합균에 해당한다. 접합균문은 카이틴과 키토산으로 구성된 세포벽이 있는 균사체로, 다포도 당산의 혼합으로 구 성 되어 있다. (카이틴은 흔하면서도 중요한 중합체로 균류의 세포벽을 비롯하여 곤충과 다른 무 척추동물의 외골격에 있어서 중요한 구성성분이다.) 그리고 균사를 가르는 격벽이 없어 모든 핵이 하나의 세포질에 존재하는 다핵균사이며 기물의 표면에 번져서 집단을 형성한다. 대부분 육상에 서 부생하여 분해환원을 하고 있으며 드물게는 기생하는 것도 있다.

2


▪ Table. 1

형질 생육습성

영양

세포벽

핵 히스톤 미세소관

라이신 합성

골지체(골지조)

미토콘드리아

전이탄수화물

저장물질 미토콘드리아 유전암호 막스테롤

균류

동물

식물

균사가 아님

다세포 조직

종속영양, 음식 섭취

광합성

균사 선단생장 또는 출아효 모 종속영양, 가용성 양분의 흡 수

전형적으로 카이틴 함유

없음. 단 곤충의 외골격에는 카이틴이 존재함.

보통 반수체; 분열중 핵막이 전형적으로 배수체; 핵분열

주로 섬유소 배수체; 핵분열 중 핵막

존재

중 핵막이 깨짐

이 깨짐

히스톤 2B

히스톤 2B

식물 히스톤

콜히친에 감수성

콜히친에 감수성

합성되지 않음

DAP경로에 의하여 합성

공급이 필요함

벤지미다졸과 그리세오폴빈 에 감수성 AAA경로에 의하여 합성됨 층을 이루지 않음

층을 이룸

관모양

판모양

판 또는 원반 모양의

판 또는 원반 모양의

cisternae

cisternae

폴리올(만니톨, 아라비톨 등,

곤충의 균당

균당 글리코겐, 지질, 균당

글리코겐, 지질, 일부에서는 균당

UGA는 Tryptophan유전암호 UGA는 Tryptophan유전암호

에르고스테롤

콜레스테롤

3

층을 이룸, 판 모양

관모양의 cisternae

포도당, 과당, 자당

전분 UGA는 사슬 종결 유전 암호 Sitosterol과 다른 식물 스테롤


▪ Fig. 1

접한균류 성장과정

접합균류는 빠른 체세포 생장을 한 뒤에 균총 끝 부분에 직립의 기중가지인 포자낭경을 만들고 가지 끝에 얇은 벽을 지닌 포자낭을 형성한다. 포자낭 내용물은 각각 핵을 지닌 둥그런 형태로 분할되면서 많은 단핵의 포자낭 포자로 분화한다. 세포벽에 존재하는 멜라닌으로 인하여 포자낭 포자는 어두운 색을 띈다. 얇은 포자낭이 파열되면서 이들 포자는 대부분 바람에 의해 분산되지 만 어떤 종은 물에 의해 분산되기도 한다. 포자낭경 끝에서 포자낭 안으로 돌출된 부분인 중축은 포자가 방출된 이후에도 남아 있다. 포자낭 포자는 적절한 조건에서 빨리 발아할 수 있으며 무성 세대의 생활을 계속 반복하게 된다. 접합 균류 내에서도 포자낭과 포자낭경을 형성하는 형식에 있어 차이를 보이는데 어떤 종들은 길고 가지를 만들지 않은 포자낭경 끝에 포자낭을 형성하는 반면에, 고온균의 경우 흔히 분지된 포자낭경을 형성한다. 한편, 몇몇의 접합균은 인간의 생명을 위협하는 심각한 감염증을 일으 킬 수 있는데 이러한 질병을 총체적으로 접합균증이라고 부른다. 접합균증은 인체의 방어 체제가 부전한 상태에서 발생하고 급속하고 침습적으로 퍼지기 때문에 치료하기 매우 어려운 감염증이다.

4


자낭균문은 지금까지 밝혀진 균류의 약 75%를 포함하고 있으며 가장 중요하고도 다양하다. 자 낭균문은 세포벽이 주로 카이틴과 포도당질로 구성되있고, 균사에는 중앙에 구멍이 있어서 핵과 다른 세포 내용물질이 이동할 수 있는 격벽이 일정한 간격으로 존재하며 여러 가지 방법으로 이 동성이 없는 무성포자를 형성하지만 결코 포자낭에서 세포질을 파열하면서 형성하지 않는다는 특 성을 가지고 있다. 이 균에 속하는 모든 균의 특징은 자낭인데, 자낭 세포 안에서는 두 개의 교배 형이 다른 친화적인 반수성 핵이 융합하여 이핵체 핵이 된 후에 감수분열하고 반수성의 유성포자 인 자낭포자가 형성된다. 대다수의 종에 있어서 감수분열 이후에는 한번의 유사분열이 일어나므 로 각 자낭마다 8개의 자낭포자를 형성한다. 좀 더 진화된 종들은 자실체인 자낭과 안에 많은 자 낭을 만든다. 자낭과의 형태로는 플라스크 모양으로 위쪽 끝에 구멍이 있는 자낭각, 컵모양의 자 낭반, 폐쇠된 구조나 성숙 후에 열 개되는 자낭구, 대개 자좌라고 불리는 세포조직층애 박혀있으 면서 모양은 자낭각과 비슷한 위자낭각등이 있다. 그 외 경우로는 자낭들이 하나씩 형성되고 자 실체에 싸여있지 않은 모양이다. Fig. 2 자낭균 성장과정

자낭균은 보통 구멍이 있는 격벽을 가진 균사가 뻗어서 네트워크를 이루는 형태로 자라나 기중 균사를 만드는데, 나중에 기중균사는 분생포자(무성포자)가 가지형 사슬로 달린 형태로 분화한다. 이 과정은 가지에 눈이 나오는 것처럼 부풀고 격벽이 생기는 과정을 반복하명서 이루어진다. 포 자는 성숙하면서 핑크색을 띠고 공기 흐름에 의해 쉽게 분리된다. 이러한 포자의 형성, 분산, 발 아 과정은 이용할 영양기질이 존재하는 동안 계속 반복된다. 자낭균은 자연계에 널리 생육하며 주로 식물질을 환원하는데 토양·식물의 유체·낙엽 등을 비롯 하여 담수·해수에서도 살고 있다. 종류가 많으며 누룩곰팡이·푸른곰팡이·효모균 등의 유용균 외에 식물에 기생하여 병을 일으키는 식물병원균류가 다수 포함되어 있는데 그 예로는 흰가루 병균류, 물관시들음병균등이 있다.

5


나. 날씨와 위치 1) 날씨 ▪Table. 2 서울날씨시간2시30분~3시 날씨 cv 현재일기 17.14H

맑음

기온(도씨)

시정 운량 km

1/10

22.0

0

중하운량 0

강수

현재

이슬점

기온

온도

지수

28.4

5.8

73

바람

불쾌 일강수 습도 mm

% 24

풍향 남서

기압(hPs)

풍속

해면

m/sec

기압

1.8

1017.2

Fig. 3

2013.09.17.14:00(℃)

2013.09.17.14:00(m/s)

30

2

20

1.5 1

10

0.5 0

현재온도

0

이슬점온도

풍속

6


2)위치

Fig. 4 균 채집한 위치

그림 A : 경희여고 1학년 9반 교실 (37° 35' 43.878"N, 127° 03' 1.728"E ) 그림 B : 고황산 (37° 35' 43.878'' N, 127° 03' 1.728'' E)

7


다. 실험기구 및 재료 PDA배지: 감자와 dextrose의 영양분과 한천의 고체화 성질을 이용하여 미생물을 배양하는 배지 겔전기영동: 겔은 콜로이드(colloid) 용액이 굳어진 상태를 말하는 것이다. 전기영동이란 말은 전기 적인 힘에 의해 전하를 띤 입자가 이동하는 것을 가리키는 표현이다. 따라서 겔전기영동은 전류 를 흘려주어서 전하를 가진 입자가 겔 내부에서 이동하여 분리되도록 하는 기술이다. PCR: 2개의 프라이머 사이의 DNA 구역을 대량으로 증폭 합성할 수가 있다. 계산상 10cycle을 수 행하면 목적하는 DNA의 사슬 수는 약 1000배로 증폭된다. 1회의 cycle이 약 2분이므로 단시간에 증폭이 가능하다. 증폭 가능한 DNA의 길이는 일반적으로 수백 염기쌍인데 2~3kb까지도 증폭이 가능하다. 전기영동: 완성된 gel은 젤판에 붙어있는 채로 single cassette에 결합시켜 증류수 90g 와 10X TAE buffer 1.6g가 채워져 있는 DGGE tank안에 넣었다. PCR 산물 1ul 6X loading star 2ul를 추가 한 후, 증류수 9ul를 섞어 12ul 만들어 8ul씩 loading하였다. Gel 전기영동은 60℃의 일정한 온도 에서 110V로 25분 진행하였으며, UV transilluminator(WUV-L20, DAIHAN Scientific, Korea)상에 옮 겨 밴드를 확인하고 사진을 촬영하였다. 클링벤치: 세포(조직) 배양과 같은 엄중한 무균조작이 요구될 때에 무균실험대로 사용되는 박스형 용기이고 무균공기를 보내 외부와 에어커튼으로 차단할 수 있으므로 오염된 공기는 침입되지 않 는다. 내부에는 살균등, 조명등 및 가스버너가 장치되어 있으며 양면에서 마주 보고 2명이 작업할 수 있도록 되어 있다. 또 위험도가 높은 병원체를 다룰때에 병원체가 비산하는 것을 막기 위해서 도 사용된다. 배양기: 물과 미생물, 세포 등을 일정한 온도 하에서 사육 또는 배양하기 위한 상자형의 기구 또 는 방을 말한다. 진탕배양기(Shanking incubator): 온도를 자동 온도조절기로 조절하며, 회전장치를 하여 일정한 속도를 유지할 수 있어서 산소의 공급이 필요한 통성호기성 미생물의 배양에 사용한다. 항온수조기(water bath): 수온 속의 수온을 일정하게 유지하는 기구로 곰팡이, 세균, 바이러스 등 의 온도 저항력 실험 등의 용도로 사용된다. Auto clave: 고압반응솥이라고도 한다. 교반장치(攪拌裝置)·진동장치, 그 밖에 회전장치를 수반하는 것이 많다. 재질은 저탄소강·크로뮴·니켈·몰리브데넘 등 합금강이 사용된다. 용기 내의 온도는 150~600℃이고, 기압은 250∼1,200atm이며, 공업용인 것에는 5,000atm 이상인 것도 있다. 반응에 의한 온도·압력의 변화, 가스 누출 등에 의한 폭발, 안전밸브·압력계·기밀성 등 보안에 각별히 주의 해야 한다.

8


원심분리기: 원심력을 이용하여 균질액을 여러 부분으로 나눌 목적으로 가장 많이 이용되는 기계 로서, 균질액을 시험관에 넣고 원심분리기를 고속으로 회전시키면 입자의 크기와 밀도에 따라 물 질을 분리할 수 있다. 핵연료를 농축하기 위해서도 이 방법을 사용한다. 볼텍스 믹서: 기계의 진동을 이용하여, 시험관을 흔들어 주는 기구이다. 염기서열 분석: 염기서열 분석은 솔젠트(SolGent, http://solgent.com)에 의뢰하였다. 분석된 염기서 열은 NCBI(http://www.ncbi.nlm.nih.gov/)에서 BLAST(Basic Local Alignment Search Tool)하여 일치 도가 가장 높은 종을 확인하였다. 확인된 종들에 대한 염기서열을 NCBI로부터 내려 받아 대표적 인 AMF 염기서열로 지정한다. 이렇게 지정된 염기서열과 실험을 통해 분석된 염기서열들은 MEGA5를 이용하여 alignment후 유연관계 계통도로 나타낸다.(Tamura et al., 2011)

9


Ⅲ. 재료 및 방법 가. 배지 만들기 고체 PDA 배지를 이용하여 곰팡이를 키웠다. 다음과 같은 방법으로 고체 PDA 배지를 만들었다. 먼저 1L의 증류수에 PDA 가루 39g를 녹인 후 부드럽게 섞고 1분간 스터링을 한 후 121℃에서 15분간 멸균하였다. 다음 clean banch 안에서 알코올램프에 불을 붙이고 페트리접시를 가까이 가 져가서 뚜껑을 불꽃을 향하여 살짝 열고 소독한 액체 PDA를 부었다. 액체 PDA가 굳으면 뒤집어 서 3일간 보관하였다.

나. 곰팡이 채집 2013년 9월 11일 수요일 서울특별시 동대문구 회기동 경희여자고등학교 1학년 9반 교실 칠판 앞 과 경희대학교 고황산 총 2곳에서 오전 2시 30분부터 3시까지 30분간 각 장소에 4개의 PDA 배 지 뚜껑을 열고 공기 중에 부유하는 곰팡이가 배지에 앉을 수 있도록 하였다. 30분이 지난 후 다 른 곰팡이가 들어가지 않도록 그 자리에서 파라핀 테이프로 실링하였다. ▪Fig. 5 1-9 균 채집과정

▪Fig. 6 고황산 균 채집과정

10


다. 곰팡이 배양 배양기에 곰팡이를 배양하며 콜로니를 관찰하였다. 콜로니를 관찰한 후 콜로니의 생성 정도를 확 인하고 콜로니를 적당한 양으로 배양하였다.

라. 곰팡이 분리 순수분리란 미생물 등을 배양할 때 다른 미생물이나 종이 오염(혼입)되지 않은 상태에서 단일종만 을 배양하는 것을 말한다 여러 종류의 곰팡이가 자란 배지의 뚜껑을 알코올램프를 향하여 열고 종류가 다른 것처럼 보이는 곰팡이를 구별하였다. 각각 다른 종류의 곰팡이를 소독한 칼로 잘랐다. 그 후, 소독한 핀셋으로 집어 각각 새로운 배지에 옮겼다. (이때 배지를 멸균상태에서 실험하기 위해 배지의 뚜껑은 항상 알코올램프를 향하여 열도록 하였다.) 곰팡이를 옮긴 배지는 실링하고 뒤집어서 배양기에서 배양 하였다. ▪Fig. 7 곰팡이 순수분리 과정

마. 곰팡이의 형태적 동정 형태적 동정은 각 곰팡이별로 배지 앞면과 뒷면에서의 색, 모양, 균사의 형태, 냄새, 질감 등의 외 적인 요소를 분석하는 방법으로 진행되었다. 핸드폰 카메라(VEGA S5, OPTIMUS LTE1, VEGA RACER2, GLAXY3)를 이용하여 촬영한 후 비교분석하였다. 이렇게 얻어진 데이터를 이용하여 배지 의 생장 속도, 균사와 포자의 고유 색, 생장 형태, 균사의 형태 등을 이용하여 형태적 동정을 실 시하였다.

바. 곰팡이의 분자적 동정 분자적 동정은 순수 분리되어 배양된 배지에서 추출된 균사를 이용하여 DNA 추출, 유전자 증폭 (PCR), 염기서열분석을 이용한 종간 유사도 및 계통수를 분석하는 단계로 진행되었다.

11


1)균사로부터 DNA추출 형태 동정을 실시하여 동일종으로 간주되는 배지 중 상태가 양호한 배지 하나씩을 선택하여 DNA를 추출하였다. 선별된 배지에서 멸균된 이쑤시개를 이용하여 균사를 100mg 덜어 Ep tube에 옮겨 담는다. Ep tube에 PL buffer 400㎕와 RNase A solution 4㎕를 함께 넣어 강하게 Vortex해준 다. Ep tube를 65℃의 항온수조에 15분간 넣어둔다. 5분마다 Vortex해준다. 항온수조에서 Ep tube 를 꺼낸 후 140㎕ buffer PD를 넣어준다. 섞기 위해 Vortex해주고 얼음에 5분 동안 넣어둔다. 13500rpm으로 8분간 원심 분리한다. 원심분리 후 mini Ezsep filter에 상등액 450㎕을 옮겨 담고 13500rpm에서 3분간 원심 분리한다. 통과한 시료 450㎕을 EP tube에 옮겨 담는다. 옮긴 후 675 ㎕의 Buffer BD를 넣고 즉시 섞어준다. 위의 시료에서 700㎕을 따내 GeneAll SV column 튜브에 넣어준 후 8000rpm에서 1분 동안 원심분리 해준다. 밑에 남은 물질은 버리고 다시 끼운다. 700㎕ buffer CW를 SV column에 넣고 8000rpm 30초 동안 원심분리 해준다. 남은 것을 버리고 다시 끼 운 후 300㎕ buffer CW를 넣고 13500rpm에서 3분간 원심 분리한다. 새 EP tube SV column의 윗 부분을 빼서 끼운 후 buffer AE 100㎕을 SV column 중심에 정확히 넣는다. 상온에서 5분 놓아두 고(배양하고) 8000rpm 1분 원심 분리한다. 내려진 용액 100㎕를 피펫으로 따서 다시 column 가운 데에 정확히 넣어준다. 그 후 다시 EP tube SV column의 윗부분을 빼서 끼운 후 buffer AE 100㎕ 을 SV column 중심에 정확히 넣는다. 추출된 DNA는 PCR 반응에 이용하였다. ▪Fig. 8 분자적 동정 과정

12


▪Fig. 9

▪Fig. 10

13


14

▪Fig. 11

PCR

프라이머 서열 및 PCR 조건


15

▪Fig. 12

DNA 증폭 범위


2)추출된 DNA의 증폭(PCR) PCR 전용 튜브에 DNA의 ITS(internal transcribed spacer)영역을 선택적으로 증폭시켜주는 균 특이 적인 primer ITS1F와

ITS4를 각각 2㎕, DNA 2㎕, 멸균수 17㎕, DMSO 2㎕, PCR pre

Mix(dNTP,ddNTP etc) 25㎕를 넣어 최종부피가 50㎕로 되게 하여 PCR 장치에서 PCR을 수행하였 다. 이 PCR 반응물은 ECO Dye를 첨가한 1.5% agarose gel상에 2㎕씩 loading 후 전기영동하여 UV transilluminator에서 약 700 bp 밴드를 확인하였다.

▪Fig. 13

3)염기서열 분석 염기서열

분석은

솔젠트(SolGent,

http://solgent.com)에

의뢰하였다.

분석된

염기서열은

NCBI(http://www.ncbi.nlm.nih.gov/)에서 BLAST(Basic Local Alignment Search Tool)하여 일치도가 가장 높은 종을 확인하였다. 확인된 종들에 대한 염기서열을 NCBI로부터 내려 받아 대표적인 AMF 염기서열로 지정하였다. 이렇게 지정된 염기서열과 실험을 통해 분석된 염기서열들은 MEGA5를 이용하여 alignment후 유연관계 계통도로 나타내었다.(Tamura et al., 2011)

16


Ⅳ. 결과 가. 곰팡이 성장과정

▪Fig 14 1-9 곰팡이 성장과정

날짜

2013년 9월 26일

2013년 10월 10일

균이름

17

2013년 10월 14일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

B

18

2013년 10월 14일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

C

19

2013년 10월 14일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

b

20

2013년 10월 14일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

21

재분리중

2013년 10월 22일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

22

재분리중

2013년 10월 22일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

23

재분리중

2013년 10월 22일


Fig. 15

고황산 곰팡이 성장과정

날짜

2013년 9월 26일

2013년 10월 10일

균이름

24

2013년 10월 14일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

25

2013년 10월 14일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

26

2013년 10월 14일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

A

27

2013년 10월 14일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

a

28

2013년 10월 14일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

c

29

2013년 10월 14일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

d

30

2013년 10월 14일


날짜

2013년 9월 26일

2013년 10월 10일

균이름

31

재분리중

2013년 10월 22일


다. 곰팡이 동정 Fig. 16

1-9 곰팡이 동정

B

Uncultured

Alternaria clone

Flavodon flavus strain

C

Cochliobolus

lunatus isolate

Alternaria sp

Cochliobolus

heterostrophus strain

32

b

Alternaria

36lternate isolate

Irpex lacteus isolate


B Uncultured Alternaria clone : 앞면은 가운데에 검정색 점이 있으며, 주위에 회색의 균사가 풍성하게 있다. 뒷면 또한 가운데에 검정색 점이 있었으며, 주변에 황갈색의 균이 퍼져있다. 그리고 테두리에 연갈색의 균이 있다.

C

Cochliobolus lunatus isolate : 앞면 균 전체 위에 검정색 균사가 얹어있었다. 그리고 주변 배지색깔이 갈색으로 투명하게 물들었다. 뒷면 또한 검정에 가까운 갈색 균이 퍼져있다. 주변 배지가 갈색으로 투명하게 물들었다.

b

Alternaria 36lternate isolate : 앞면에 회색 균사가 덮어져 있고, 가운데에 좀더 흰색인 균사가 튀어나와있다. 뒷면 균은 가운데에 검정색으로 시작하며 퍼지며 갈색을 띈 색깔이 나오다가 마지막 테두리는 황토색의 균이 퍼져있다.

ㄹ Flavodon flavus strain : 앞면은 처음에 순수분리하며 배지 위에 얹어놓은 균의 모습인 회색균 모습 그대로 배지 전체에 흰색 얇은 균사가 퍼져있다. 뒷면 또한 처음에 순수분리한 검정균 모습 그대로 배지 전체에 흰색 균사가 얇게 퍼져있다.

Alternaria sp : 앞면은 가운데에 진한회색균사가 퍼져있고, 그 주변에 횐색의 균사가 테두리를 이루고 있다. 뒷면은 가운데에 작게 검정점이 있고, 그 주변에 얇은 띠같이 황토색이 있다. 그리고 다시 검정색이 나타나고, 흰색에 가까운 갈색테두리가 있다.

Irpex lacteus isolate : 앞면은 가운데에 회색의 균사가 뭉쳐있고, 주변에 연한갈색의 균사가 흰색의 균사와 겹쳐져 퍼져있다. 뒷면은 순수분리할 때의 모습인 가운데에 진한 갈색의 균을 중심으로 황토색의 균과 연한갈색의 균이 섞여 퍼져있다.

Ⅴ Cochliobolus heterostrophus strain : 앞면은 균사가 없었으며, 가운데에 검정색 균을 중심으로 주위에 축축하고 누런 균이 붙어있다. 뒷면 또한 가운데에 검정색 균을 두고 촉촉해보이는 누런 균이 감싸고 있었다.

33


Fig. 17

A

고황산 곰팡이 동정

Aspergillus niger

a

Ceriporia lacerata

strain

d

Penicillium

Aspergillus

japonicus strain

Aspergillus

japonicus strain

ochrochloron

c

Byssochlamys

Peziza sp

spectabilis strain

Ceriporia lacerata isolate

34

Cochliobolus

heterostrophus isolate


A

Aspergillus niger strain : 앞면은 검정색 균을 안쪽에 두고 풍성하고 하얀 균사가 주위를 많이 감싸 올라와있다. 뒷면은 가운데에 검정색을 중심으로 짙은 회색의 균이 퍼져있다.

a

Ceriporia lacerate : 앞면은 회색의 균이 퍼져있으며, 뒷면은 흰색의 균이 퍼져있었다.

c

Aspergillus japonicus strain : 앞면은 검은색 균을 중심으로 회색 균사가 테두리를 이루고 있고, 뒷면 회색의 균사 주위에 흰색의 균사가 둘러싸고 있다.

d

Penicillium ochrochloron : 앞면은 회색 균사를 흰색 균사가 덮고 있다. 뒤면은 회색 균사가 퍼져있다.

Byssochlamys spectabilis strain : 앞면은 순수분리한 균을 중심으로 연갈색의 균이 점점 더 연해지며 원을 이루고 있다. 뒷면은 연갈색의 균이 원의 모양으로 퍼져있다.

Peziza sp : 앞면은 흰색의 균사가 퍼져있다. 뒷면 또한 흰색의 균이 퍼져있다.

Aspergillus japonicus strain : 앞면은 균을 굴려 여러 군데에 회색과 흰색의 균사가 자라고 있으며, 뒷면은 회색의 균이 자라고있다.

Ceriporia lacerata isolate : 앞면은 중앙에 반원 모양으로 분포되어있으며 흰색 균사가 덮혀있다. 테두리는 노르스름한 균사로 둘러 쌓여있다. 뒤면은 연노란 균이 분포되어있다.

Cochliobolus heterostrophus isolate : 앞면은 중앙에 적은 양이 검은색으로 분포되어있으며 그 위에 약간의 흰색 균사가 있으며 주위에 흰색 균사로 뒤덮혀있다. 뒷면은 검정색 균이 분포되어 있다.

35


마. DNA 전기영동 결과 Fig. 18

2013년 10월 21일 DNA 전기영동 결과

크기: 700bp

ㄷ ㄹ

▪Fig. 19

A

B

C

a

c

2013년 10월 22일 DNA 전기영동 결과

크기: 700bp

36

d

b


바. 염기서열 ▪Fig. 20

기호

1-9 염기서열

염기서열

종류

GNTTACCTCTCGTAGGTGACCTGCGGAGGGWCATTACACAAATATGAA GGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCT TGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGA CAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATA ATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAAC

b

GCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATC GAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCT GTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTG

Alternaria 37lternate isolate

TCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTA CTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTA GCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGAT ACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA NNNTGAGTCTCGTAGGTGACCTGCGGAGGGATCATTACACAAATATGAAG GCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGT CTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAA CATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAA CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAA

B

ATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA ACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTC ATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGC TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCG CAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTT TTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGC ATATCAAAAGGCGGGAGGAA

37

Uncultured

Alternaria clone


NCAAGCCGTCATCGTAGGTGGCCTGCGGAGGGATCATTACACAAATACAA TATGAAGGCTTCGGCTGGATTATTTATTTCACCCTTGTCTTTTGCGCACTTG TTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCACACCATAAACCTTT TTTGTTAATGCAGTCAGCGTCAGTACAACAAATGTAAATCATTTACAACTTT CAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGC

C

GATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGC ACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTG TACCCTCAAGCTTTGCTTGGTGTTGGGCGTTTTGTCTTTGCTCGCCAAAGA

Cochliobolus lunatus isolate

CTCGCCTTAAAACGATTGGCAGCCGACCTCTTGGTTTCGCAGCGCAGCAC AATTTTGCGCTTGCAAATCAGCAAGTTGGCACTCCATCAAGAACATTTTCT TACGTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCA AAAGCCGGGAGGAA NNAGTTCGGTCTCGTAGGTGACCTGCGGAGGGATCATTACACAAATAT GAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCAC CCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAG GACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAA TAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGA

ACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATC ATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATG

Alternaria sp

CCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGC CTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGT CTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGG GATACCCGCTGAACTTAAGCATATCAAAAGCC ANCTTTCGCCTCGTAGGTGACCTGCGGAGGATCATTATCGAGTTTTGAA CGGGTTGTAGCTGGCCTCTCACGAGGCATGTGCACGCCTGGCTCATCCA CTCTTAACCTCTGTGCACTTTATGTAAGAGAAAAAAATGGTGGAAGCTT CCAGGATCTCGCGAGAGGTCTTCGGTTGAACAAGCCGTTTTTCTTTCTTA TGTTTTACTACAAACGCTTCAGTTATAGAATGTCAACTGTGTATAACACA TTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAG

AACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT CATCGAATCTTTGAACGCACCTTGCACTCCTTGGTATTCCGAGGAGTAT GCCTGTTTGAGTCTCATGGTATTCTCAACCCCTAAATTTTTGTAATGAAG GTTTAGCGGGCTTGGACTTGGAGGTTGTGTCGGCCCTCGCTGGTCGACT CCTCTGAAATGCATTAGCGTGAATCTTACGGATCGCCTTCAGTGTGATA ATTATCTGCGCTGTGGTGTTGAAGTATTTATGGTGTTCATGCTTCGAACC GTCTCCTTGCCGAGACAATCATTTGACAATCTGAGCTCAAATCAGGTAG GACTACCCGCTGAACTTAAGCATATCAAAA

38

Irpex lacteus isolate


NNTTCCTGGTTCTCAGTAGGTGACCTGCGGAGGGATCATTACACAACA AAATATGAAGGCCTGGCTTTGCGGCCGGCTGAAATATTTTTTTCACCCAT GTCTTTTGCGCACTTGTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGA CCAAACCATAAACCTTTTTTTTATGCAGTTGCAATCAGCGTCAGTATAAA CAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCG ATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCA

Cochliobolus

GTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAA heterostrophus GGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTT

strain

GGGCGTTTTTGTCTCCCTCTTTGCTGGGAGACTCGCCTTAAAACGATTGG CAGCCGGCCTACTGGTTTCGGAGCGCAGCACATATTTTGCACTCTGTAT CAGGAGAAAAGGACGGTAATCCATCAAGACTCTTACGATTTTTAACTTT TGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA GCGGAGGAA

NNNTTATGCTTCGTAGGTGACCTGCGGAGGATCATTAACGAGTTTTGAA CGGGTTGTAGCTGGTCTCTATCTGAGGCATGTGCACGCCCTGCTCATCC ACTCTCAACCTCTGTGCACTTATTGTAGGTCGGTGAAAGGTTCGCTCTGC GAGCTGGAAGCCTTCCTATGTTTCACTACAAACGCTTCAGTTTTAGAATG TAATCTTGCGTATAACGCATCTATATACAACTTTCAGCAACGGATCTCTT GGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA

ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC CTGGTATTCCGGGGAGCACGCCTGTTTGAGTGTCATGGTATTCTCAACC TTCATAACTTTTGTTACTGAAGGCTTGGACTTGGAGGTTGTGCTGGCTCT CGTTAGTCGGCTCCTCTTAAATGCATTAGCGTGAACGTTTGCCTCTCGCT ATCAGTGTGATAATTATCTGCGCTGTTAGTGTTGAAGCATCATTGGTGTC TCGCTTCTAACCGTCCTTCACTGGACAATTTACTTTGACATCTGACCTCA AATCAGGCGGGACTACCCGCTGAACTTAAGCATATCAAAA

39

Flavodon flavus strain


Fig. 21

고황산 염기서열

기호

염기서열

종류

NNGGTTTGCTTCGTAGTGACCTGCGGAGGATCATTATCGAGTTTTGAAC GGGTTGTAGCTGGCCTTTAACGAGGTATGTGCACGCCTGGCTCATCCAC TCTCAACCTCTGTGCACTTTATGTAAGAAACGGTGTAAGCCAGCTATTTA TTAGTTGGTAATAAGCCTTTCTTATGTTTACTACAAACGCTTCAGTTATAG AATGTTTACTGTGTATAACACAATTATATACAACTTTCAGCAACGGATCT CTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATG a

TGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCAC TCCTTGGTATTCCGAGGAGTATGCCTGTTTGAGTCTCATGGAATTCTCAA CCCCTAAATTTTGTAATGAAGTTTAGTGGGCTTGGACTTGGAGGTTGTGT

Ceriporia lacerata

CGGCTTCTAGTCGACTCCTCTGAAATGCATTAGCGTGAATCTTACGGAT CCCCTTCAGTGTGATAATTATCTGCGCTGTGGTGTTGAAGTATTTATTAG TTCRTGCTTATAATCGTCTCTTACCGAGACAATTTATGACAATCTGAGCT CAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCCGG AGGAA NNGTTCGGCTCGTAGGTGACCTGCGGAGGATCATTACCGAGTGCGGGT CCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGC GGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGG CCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCA GTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCT TGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTG A

AATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCC CCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAA GCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGC CCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGC TTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAA CCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACT TAAGCATATCAAAAGGCCGGAGGAA

40

Aspergillus niger strain


NNTTCGATCGTAGGTGACCTGCGGAGGATCATTACCGAGTGCTGGGTC CTTCGGGGCCCAACCTCCCACCCGTGCTTACCGTACCCTGTTGCTTCGG CGGGCCCGCCTTCGGGCGGCCCGGGGCCTGCCCCCGGGACCGCGCCC GCCGGAGACCCCAATGGAACACTGTCTGAAAGCGTGCAGTCTGAGTTG ATTGATACCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGC c

ATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAA TTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCC GGGGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTCCAGCCCCGCTGGT

Aspergillus japonicus strain

TGTTGGGCCGCGCCCCCCCGGGGGCGGGCCTCGAGAGAAACGGCGGC ACCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCTATGGGCC CGGCCGGGGCTTGCCTCGACCCCCAATCTTCTCAGATTGACCTCGGATC AGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAG NNTTCGATCGTAGGTGACCTGCGGAGGATCATTACCGAGTGCTGGGTC CTTCGGGGCCCAACCTCCCACCCGTGCTTACCGTACCCTGTTGCTTCGG CGGGCCCGCCTTCGGGCGGCCCGGGGCCTGCCCCCGGGACCGCGCCC GCCGGAGACCCCAATGGAACACTGTCTGAAAGCGTGCAGTCTGAGTTG ATTGATACCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGC ㄷ

ATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAA TTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCC GGGGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTCCAGCCCCGCTGGT

Aspergillus japonicus strain

TGTTGGGCCGCGCCCCCCCGGGGGCGGGCCTCGAGAGAAACGGCGGC ACCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCTATGGGCC CGGCCGGGGCTTGCCTCGACCCCCAATCTTCTCAGATTGACCTCGGATC AGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAG NNTTTAGGCTTCGTAGGTGACCTGCGGAGGATCATTACCGAGTGAGGG CCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTACCTTGTTGCTTCGGC GGGCCCGCCTCACGGCCGCCGGGGGGCATCTGCCCCCGGGCCCGCGC CCGCCGAAGACACCATTGAACTCTGTCTGAAGATTGCAGTCTGAGCGAT TAGCTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATC GATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTC d

AGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGG GGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGT GTTGGGCCCCGCCCCCCGGTCCCGGGGGGCGGGCCCGAAAGGCAGCG GCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTC CGTAGGCCCGGCCGGCGCCCGCCGGCGACCCCCAATCAATCTATCCAG GTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAT AAGCGGAGGAA

41

Penicillium ochrochloron


ANCGTCGTCTCGTAGGTGACCTGCGGAGGGATCATTACACAACAAAAT ATGAAGGCCTGGCTTTGCGGCCGGCTGAAATATTTTTTTCACCCATGTCT TTTGCGCACTTGTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAA ACCATAAACCTTTTTTTTATGCAGTTGCAATCAGCGTCAGTATAAACAAT GTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGA III

AGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGA ATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGC ATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGC

Cochliobolus heterostrophus isolate

GTTTTTGTCTCCCTCTTTGCTGGGAGACTCGCCTTAAAACGATTGGCAGC CGGCCTACTGGTTTCGGAGCGCAGCACATATTTTGCACTCTGTATCAGG AGAAAAGGACGGTAATCCATCAAGACTCTTACGATTTTTAACTTTTGACC TCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAA NNANTAGCTTCGTAGGTGACCTGCGGAGGATCATTATCGAGTTTTGAA CGGGTTGTAGCTGGCCTTTAACGAGGTATGTGCACGCCTGGCTCATCCA CTCTCAACCTCTGTGCACTTTATGTAAGAAACGGTGTAAGCCAGCTATTT ATTAGTTGGTAATAAGCCTTTCTTATGTTTACTACAAACGCTTCAGTTATA GAATGTTTACTGTGTATAACACAATTATATACAACTTTCAGCAACGGATC TCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT I

GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCA CTCCTTGGTATTCCGAGGAGTATGCCTGTTTGAGTCTCATGGAATTCTCA ACCCCTAAATTTTGTAATGAAGTTTAGTGGGCTTGGACTTGGAGGTTGT

Ceriporia lacerata

isolate

GTCGGCTTCTAGTCGACTCCTCTGAAATGCATTAGCGTGAATCTTACGG ATCGCCTTCAGTGTGATAATTATCTGCGCTGTGGTGTTGAAGTATTTATT AGTTCGTGCTTATAATCGTCTCTTACCGAGACAATTTATGACAATCTGAG CTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAA ANATTTAGCTCGTAGGTGACCTGCGGAGGATCATTACCGAGTGAGGGT CCCTCGGGGCCCAACCTCCCATCCGTGTTGTCCTGACACCTGTTGCTTC GGCGGGCCCGCCGTGGTTCACGCCCCGGCCGCCGGGGGGTTCACGCC CCCGGGCCCGCGCCCGCCGAAGACCCCTGGAACGCTGCCTGGAAGGT TGCCGTCTGAGTATACAATCAATCAATTAAAACTTTCAACAACGGATCTC TTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGT ㅋ

Byssochlamys

GAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCC

spectabilis

CCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTAACCCTC

strain

CAGCCCGGCTGGTGTGTTGGGCCGCCGTCCCCCCTCCCCGGGGGACGG GCCCGAAAGGCAGCGGCGGCGTCGCGTCCGGTCCTCGAGCGTATGGG GCTCTGTCACACGCTTCAGTAGAACCGGCCGGCTTGCTGGCCATCACCT ATATTTTTCTCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAA CTTAAGCATATCAAAAG

42


NNNTTCGCTCGTAGGTGACCTGCGGAGGATCATTATTGAAAAACTATTC TTAGTTTTTTACACCCCTTTGTTTACCTACCCTGTTGCTTCCACTGGACTG TGCTTCATCTCACAACGAGGTGGGCCCTTTGGCTTGTTGTTAACAGCACT TGCCCCGGAGTTGCCAGTGAATGGACTATAAACCAAAACTTGTTAAAAA CAAATGTCTGATTTTTCTTCTTAAATGAAATAAAACTTTCAACAACGGAT CTCTAGGCTCTTGCATCGATGAAGAACGCAGTGAAATGCGATAAGTAAT ㄴ

GTGAATTGCAGAATCTCGTGAATCATCGAATCTTTGAACGCACATTGCG CCCTATGGTATTCCGTAGGGCATGCCTGTCTGAGCGTCAGCTCCCCCCC ACTCAAGCATCTTTGTGAAGCTTGGATTACTTTGAAGAAGTGGCCTTCTT GCAAGGCTGCTCTTCAGAAATTCATCGGCAGTATGGTTTGTCTCTCAAC CAGACGTAATAATAATAAAACCGTCTATTGGGGAATCATTGTACTTGCC CAAACACACCCATCTTTAACTGGGTGACCTCAGATCAGGTAGGGATACC CGCTGAACTTAAGCATATCAAAAA

43

Peziza sp


마. 균 계통도 Fig. 22 1-9 균 계통도

44


Fig. 23 고황산 균 계통도

45


Ⅴ. 결론

▪Table. 3 1-9

sample 계통도

sample

추정여부

b

Alternaria alternata isolate

추정(98%)

B

Uncultured Alternaria clone

추정(99%)

C

Cochliobolus lunatus isolate

추정(97%)

II

Alternaria sp

확실

IV

Irpex lacteus isolate

확실

Flavodon flavus strain

확실

V

Cochliobolus heterostrophus strain

확실

▪Table. 4 고황산 sample 계통도 sample

추정여부

a

Ceriporia lacerata

추정(97%)

A

Aspergillus niger strain

확실

c

Aspergillus japonicus strain

확실

Aspergillus japonicus strain

추정(99%)

d

Penicillium ochrochloron

확실

III

Cochliobolus heterostrophus isolate

추정(98%)

I

Ceriporia lacerata isolate

확실

Byssochlamys spectabilis strain

추정(98%)

Peziza sp

추정(94%)

46


1-9 sample 의 계통도에서는 4 속 5 종이 나왔고 고황산 sample 의 계통도에서는 5 속 7 종이 나왔다. Table. 5 서로 다른 종

중복되는 종

Alternaria alternata Uncultured Alternaria

1-9 sample

Alternaria Irpex lacteus Flavodon flavus Ceriporia lacerata

Cochliobolus heterostrophus

Aspergillus niger Aspergillus japonicus Penicillium ochrochloron

고황산 sample

Ceriporia lacerata Byssochlamys spectabilis Peziza 1-9 sample 에서 나온 Alternaria alternata 는 잎의 반점과 380 종 이상의 질병을 유발한다고 기록되어있습니다. 농장물에 번식하는 곰팡이인 alternaria alternata 는 염화비닐과 플라스틱에 많이 성장하는 곰팡이입니다. 그것은 많은 식물의 부분에 잎 반점, 썩음 및 마름을 일으키는 원인이 여러 종의 기회 병원균입니다. 염화비닐과 플라스틱에 많이 성장하는 곰팡이다..

Irpex lacteus 은 세계의 온대 지역에 걸쳐 확산 일반적인 균류이다.Irpex lacteus 은 다공균 간주되지만, 성장 조건에 따라서도 자실 층탁를 생성 할 수 있습니다. Irpex lacteus 는 주로 속씨 식물 나뭇 가지와 줄기에 서식하는 백색 부후 균이다. 그것은 가장 일반적인 것중 하나인 북미 도시의 썩은 나무에 자라는 곰팡이다. 따라서 1-9sample 에서는 Alternaria alternata, Uncultured Alternaria ,Alternaria, Irpex lacteus ,

Flavodon flavus 가 나온 이유는 염화 비늘과 플라스틱이 많고 주위에 썩은 나무가 많아서 발견된다고 생각한다. 화장실이 근처에 있어 습하여 균이 살기 좋은 장소라고 생각된다. 식물에게 해를 끼치는 균의 종류가 많다. 고황산 sample 에서 나온

Ceriporia lacerata 는 구멍장이과 버섯으로 참나무나 적송에 부생하며 백색 부후균의 일종이다. 생태계에서

셀룰로오스,

헤미셀룰로오스,

기타

다당류

글리세롤(glycerol)등의

탄소원을

이용하기 위하여 리그닌(Lignin)분해라는 공동대사를 수행하는 것으로 알려져 있다. 자실체는 완전 배착성이며 기주위에 단단히 부착하여 넓게 퍼진다. 자실층은 관공으로 형성되어 있고 백색이며 짙은

솔향을

발산한다.

Ceriporia

lacerata

균사체의

액체배양물(세포외

다당체

-

Exopolysaccharide)은 대사질환의 치료에 우수한 효능이 있는 것으로 밝혀졌으며, 특히 당뇨 및

47


당뇨합병증의 진행을 즉시 차단하고, 상실된 베타세포의 재생을 촉진하여 당뇨질환의 완전한 치료를 가능케하는 천연 인슐린성 물질로 추정된다.

Aspergillus niger 는 곰팡이 와 속 가장 흔한 종 중 하나 누룩 곰팡이이다. 그것은 특정 과일과 같은 포도, 양파, 땅콩 등의 야채에 검은 곰팡이라는 질병을 원인이고 식품의 일반적인 오염 물질이다.

Peziza 는일 년 내내 썩은 짚이나 밭의 땅에 무리를 지어 자라거나 무리를 지어 자란다. 자실체는 지름 3~10 ㎝이고 주발처럼 생겼다. 자실체의 바깥면은 흰색이고 안쪽면은 연한 갈색이며 여러 개가

모여

나므로

서로

눌려서

불규칙하게

비뚤어져

있다.

버섯대는

없다.

홀씨는

20~24×11~14 ㎛이고 타원 모양이다. 홀씨 표면은 색이 없고 밋밋하다. 식용할 수 있다. 한국, 북한(백두산) 등 전 세계에 분포한다. 따라서 고황산 sample 에서는 Ceriporia lacerata, Aspergillus niger, Aspergillus japonicus,

Penicillium ochrochloron, Ceriporia lacerata, Byssochlamys spectabilis, Peziza 가 나온 이유는 버섯 종류의 균들이 많았다. 산이라서 썩은 나무와 썩은 짚들이 많아 버섯이 자라기 좋은 환경이라고 생각된다. 1-9 sample 과 달리 식용이거나 사람의 몸에 득을 주는 Ceriporia lacerata 와 같은 균이 있었다. 1-9 sample 과 고황산 sample 에 둘 다 나온

Cochliobolus heterostrophus 은 곰팡이 식물 병원균 이다. 그것은 옥수수 남부 옥수수 잎 마름병 이 발생할 수 있습니다. Cochliobolus heterstrophus 많은 열대 지역 과 미국 의 남쪽 부분 에서 발견된다. 매우 심각한 작물 병이 될 수 있습니다. 미국 옥수수 작물의 15 % 이상 을 파괴 하였었다. 이 균은 1-9 교실과 고황산 모두 화장실이나 강가가 있어 습하고 1-9 교실 같은 경우에는 고황산에 싸여진 형태여서 고황산에서 날라왔을 가능성이 있다고 생각을 하였다. 선배들이 한 경희여자고등학교 내 장소별로 부유하는 균류에 대한 연구와 비교해본 결과 균의 모양이나 자라는 형태는 비슷했으나 균의 종류가 하지만 겹치는 종은 Fugus clone 만 있었다.

48


Ⅵ. 참고문헌 1. 인삼의 잎에서 분리된 내생균의 다양성과 탄저병 내성 (한국교원대학교 대학원 생물교육전공 최민석) 2. 제 4 판 균류생물학(균류생물학번역위원회)

- 출판사: 월드 사이언스

3. 경희여자고등학교 내 장소별로 부유하는 균류에 대한 연구 – G.O.B(경희여자고등학교 균류 연구반) 4. 두산백과 www.dooPedia.co.kr 5. 기상청 www.kma.go.kr 6. 해양과학 대사전 한국해양협회편

49


고황산 및 교실환경의 공기중에 부유하는 곰팡이 동정  

경희여고 과학영재학급 창의적 결과물 산출 대회 http://kyunghee.hs.kr 지도 : 김지광 선생님

Advertisement
Read more
Read more
Similar to
Popular now
Just for you