Page 1

Caracterización de la actividad animal en alojamientos porcinos de la fase de destete T. Arango1; J. Ortega1; M. R. Rodríguez1; M. D. Fernández1; L. Osorio1 1

Grupo de investigación GI-1720, Energía y Mecanización Agroforestal, Departamento de Ingeniería Agroforestal, Escuela Politécnica Superior, Universidad de Santiago de Compostela, Campus Universitario s/n 27002 Lugo e-mail: tamara.arango@rai.usc.es

Resumen La influencia de la temperatura sobre la actividad animal es importante y ésta a su vez incide sobre la concentración de CO2, y por tanto sobre el bienestar animal. En consecuencia, el comportamiento animal tiene una incidencia decisiva en el funcionamiento de las instalaciones de climatización y por tanto en el consumo energético de las explotaciones. El objetivo de este trabajo es caracterizar la actividad animal, diaria y estacionalmente, en lechones de 6 a 20 kg de peso vivo en condiciones convencionales de explotación. El estudio se ha realizado en una sala de destete de una explotación porcina situada en el Noroeste peninsular. La actividad animal se ha medido mediante sensores de infrarrojo pasivo en el período comprendido entre el 06/10/2011 y el 15/09/2012. Para granjas con suelos emparrillados, se producen picos de actividad por la mañana y por la tarde, coincidiendo con el suministro de la alimentación a los animales (dos veces al día). Los datos registrados sitúan el inicio de la actividad en torno a las 7:00 de la mañana en verano y sobre las 8:00 en invierno. El pico de actividad se produce entre las 9:00 y las 10:00, aproximadamente 2 horas tras el inicio, reduciéndose esta al mínimo hacia la 13:00 y asciende hasta a un pequeño repunte hacia las 15:00 volviendo a un mínimo a las 17:00 y alcanzando de nuevo un máximo entre las 18:00 y las 19:00. Observando la evolución de la actividad se percibe que a medida que nos acercamos al verano, la actividad se reparte a lo largo del día a diferencia de los ciclos de invierno en las que la actividad se centraba en las últimas horas de la tarde. Palabras clave: Lechones, actividad animal, sensores PIR

Abstract The temperature influences on animal activity, which affects on the CO 2 concentration, a variable with high impact on animal welfare. Animal behavior has a decisive impact on the operation of air conditioning systems, with consequent impact on the energy consumption of farms. The objective of this work is to characterize animal activity, daily and seasonally, in piglets of 6-20 kg, in conventional operating conditions. The study was conducted in a weaning pig farm located in the Northwest of the Iberian Peninsula. The animal activity was measured by the use of passive infrared (PIR) sensors during the time period between 06/10/2011 and 15/09/2012. The farms with slatted floors generally have peaks of activity in the morning and evening, during feeding (twice a day). According to the recorded data, the beginning of the activity of the animals takes place around 7:00 at the morning in summer cycles and about 8:00 in winter. The peak activity occurs between 9:00 and 10:00, about 2 hours after the start of the activity, this one reduces to the minimum at 13:00 and goes up slightly towards at 15:00, coming back to the minimum at 17:00 and finally reaching again a maximum between 18:00 and 19:00. Analyzing the evolution of the activity, it observes that in summer cycles the activity is spread throughout the day, while in the winter cycles the activity is focused in the last hours of the afternoon. Keywords: Piglets, animal activity, PIR sensors.

317


Introducción Los sistemas de producción en explotaciones porcinas tienden a ser más exigentes, en cuanto al bienestar de los animales y a la reducción del impacto ambiental que producen. Son varios los autores que proponen protocolos para la evaluación de los diferentes parámetros ambientales, Carr (2009), López et al (2008a, b), Kornbek (2005), pero también, analizando las condiciones ambientales de diferentes granjas, como Aguilar (2006). Además, existen diversos trabajos que evalúan la influencia de los parámetros ambientales en el comportamiento animal, así como en sus resultados productivos (Huynh et al 2005). La temperatura ambiente es el componente predominante del ambiente climático, influyendo sobre la actividad animal, y ésta, a su vez, sobre la concentración de CO2, variable de gran incidencia en el bienestar animal. Las necesidades de temperatura dependen de varios factores, entre los cuales destacan, por su importancia, la cantidad de alimento consumido y el aislamiento corporal (J.R. Pluske, J. Le Dividich, M.W.A. Verstegen (2007)). Según Maenz et al (1994), los lechones mantenidos a 21ºC durante los primeros 10 días postdestete crecen un 33% menos y consumen un 53% más de alimento que los lechones mantenidos a 29ºC. Por encima de ciertas temperaturas ambiente, a partir de aproximadamente 22ºC, se producen cambios fisiológicos claros en cerdos de engorde. Los indicadores fisiológicos de estrés por calor son, en orden de aparición, aumento de la respiración y la relación agua-alimentación, seguida por la producción de calor y disminución de la ingesta de alimento, y finalmente aumento de la temperatura rectal. La disminución de la ingesta de alimento y el aumento de la temperatura rectal son buenos indicadores de una disminución del rendimiento de los cerdos con estrés de calor. En cuanto a la humedad, va a tener efectos menores, sin embargo, existe una diferencia significativa en la ganancia de peso de los animales cuando la humedad alta se encuentra combinada con una alta temperatura ambiente (Huynh et al 2005). El dióxido de carbono y la producción de calor varían cíclicamente durante las 24-horas del día. Por lo tanto, la estimación de la tasa de ventilación, sobre la base de mediciones de dióxido de carbono, se puede mejorar teniendo en cuenta la actividad de los animales. La actividad de los cerdos puede, medirse mediante un sistema de medición basado en detectores de presencia infrarrojos (Pedersen & Pedersen, 1995). La actividad que se mide en mV, se convierte normalmente a valores relativos no dimensionales con respecto a, por ejemplo la media diaria o semanal. Diferentes trabajos de investigación (CIGR 2002) han demostrado una alta correlación entre la actividad animal y la producción de dióxido de carbono medido de esta manera. Para granjas con suelos emparrillados, por lo general se produce un pico de actividad en la mañana y otra por la tarde, correspondientes al momento en el que se suministra la alimentación a los animales (dos veces al día). Pedersen et al. (1998), demostró la relación entre la actividad de los animales y la producción de dióxido de carbono. Las mediciones sobre la actividad animal, dióxido de carbono y la producción de calor animal fueron realizadas en laboratorio en las mismas condiciones climáticas con cerdos de engorde y suelo emparrillado mostrando que el 55% de las variaciones diurnas de CO2 podía ser debido a las variaciones en la actividad animal. (Pedersen & Rom, 1998). El comportamiento animal tiene una incidencia decisiva en el funcionamiento de las instalaciones de climatización, con la consecuente incidencia en el consumo energético de las explotaciones. Por otra parte, Pedersen & Pedersen (1995) observaron que la actividad presenta dos máximos durante el día, probablemente coincidentes con la reposición de la alimentación por parte del granjero Estos dos máximos están relativamente próximos uno del otro, lo cual puede estar asociado a la falta de luz del día en el período de invierno. El objetivo de este trabajo es caracterizar la actividad animal en lechones de 6 a 20 kg de peso vivo en condiciones convencionales de explotación tanto diaria, como estacionalmente. El estudio se ha realizado en una sala de destete de una explotación porcina de producción de lechones de 20 kg de p.v. en el noroeste de la península ibérica.

318


Material y Métodos La actividad animal fue medida mediante el empleo de sensores de infrarrojo pasivo. El registro de datos se realizó en una sala en la que se encuentran lechones de 6 a 20 kg de peso vivo entre el 06/10/2011 y el 15/09/2012. Esta sala alberga a 300 lechones repartidos en 12 corrales de 30 lechones en cada uno. Presenta unas dimensiones de 5,86x12,00 m2 y una altura de 2,05 m. La ventilación en la sala se realiza mediante un ventilador con una potencia de 0,48 kW y un caudal a máxima potencia de 1.333 litros por minuto. La ventilación tiene un doble propósito, por un lado sirve para controlar la temperatura de la sala, introduciendo aire caliente del pasillo en invierno con el fin de aumentar la temperatura interior de la sala y en verano, introducir aire fresco para bajar la temperatura. Además, la renovación de la atmósfera interior controla la concentración de partículas en suspensión y gases como el vapor de agua, NH3 o CO2, proporcionando un ambiente confortable a los lechones. La calefacción con suelo radiante con agua caliente en cada uno de los corrales. Para medir la actividad animal en la sala se instalaron sensores de presencia Modelo RX40QZ, de las siguientes características: una cobertura de medición de 12m x 12m y 85°, zonas de detección con un ancho de 78 zonas, una velocidad de detección de 0.3 ~ 1.5 m/s y con sensibilidad de 2ºC 0.6 m/s. Se utilizaron 4 sensores PIR (infrarrojo pasivo) distribuidos, 2 en la entrada de la sala para controlar la actividad en la sala de forma general (sensor PIR 1 y sensor PIR 2) y otros dos en el centro (sensor PIR 3 y sensor PIR 4), para conocer la actividad en el interior de unos de los boxes control, los cuatro situados a una altura de 2 m. Se dispone de dos tipos de mediciones, la de actividad moderada y actividad intensa. Se define como actividad moderada la que produce activación del detector de presencia configurado para 2 pulsos en 20 segundos y la actividad intensa la que produce activación del detector para 4 pulsos en 20 segundos.

Resultados y discusión En este trabajo, la actividad fue expresada como actividad relativa en relación con la actividad media de cada ciclo. Analizando la evolución de la actividad, se observa que en los ciclos de verano, la actividad se distribuye a lo largo del día, a diferencia de los ciclos de invierno en los que la actividad se concentra en las últimas horas de la tarde. La actividad de los animales en el invierno (fig. 1) comienza aproximadamente a las 8:00. El pico de actividad se produce entre las 9:00 y las 10:00, 2 horas después de su inicio, reduciéndose al mínimo hacia las 13:00 h, con un pequeño repunte en el entorno de las 15:00 h. Se va a producir un mínimo a las 17:00 h y un nuevo máximo entre las 18:00 y las 19:00 h. Actividad Ciclo I

1,20

1,00

0,80 G:PIR1 G:PIR2

0,60

G:PIR3 G:PIR4 0,40

0,20

0,00 0

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

319


Figura 1. Actividad medida mediante los sensores de infrarrojo pasivo (PIR) en ciclo de invierno

En verano (fig. 2), la actividad de los animales comienza aproximadamente 7:00 de la mañana. Observando la evolución de la actividad de los diferentes ciclos, se percibe que a medida que nos acercamos al verano, la actividad se encuentra distribuida a lo largo de todo el día, experimentando tres máximos en el entorno de las 11:00, las 15:00 y las 19:00 h, a diferencia de los ciclos de invierno en las que la actividad se centraba en las últimas horas de la tarde. Actividad Ciclo VI

1,20

1,00

0,80

G:PIR1 G:PIR2

0,60

G:PIR3 G:PIR4 0,40

0,20

0,00 0

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

Figura 2. Actividad medida mediante los sensores de infrarrojo pasivo (PIR) en ciclo de verano

Se observa además, una variación importante en la duración del período de descanso nocturno, con una duración de 12 h en invierno (de 20:00 a 8:00 h) frente a las 9 h de verano (de 22:00 a 7:00 h). Los resultados obtenidos confirman lo establecido por Pedersen et al. (1998), según el cual, se producen picos de actividad por la mañana y por la tarde, coincidentes con el suministro de la alimentación a los animales, lo cual se produce dos veces al día.

Conclusiones La actividad animal presenta variaciones diarias y estacionales. La actividad nocturna es muy reducida y su duración es mayor en invierno (12 h), que en verano (9 h). Durante el día la actividad se incrementa presentando 3 máximos. Dos de ellos se producen a primera hora de la mañana y a última de la tarde. Estacionalmente, la actividad en invierno se intensifica a última hora de la tarde de forma muy clara, mientras que en verano, la mayor intensidad se produce hasta las 15:00 h. Teniendo en cuenta que la actividad animal tiene una influencia importante sobre la concentración de CO2, así como sobre la temperatura, la adaptación de los sistemas de climatización a la actividad de los lechones mejoraría considerablemente el bienestar animal y en la reducción del consumo energético.

Agradecimientos El presente trabajo ha sido financiado por la Xunta de Galicia y el Fondo Europeo de Desarrollo Regional (FEDER), a través del proyecto de investigación Estrategias de control y automatización para la eficiencia energética y productiva en explotaciones porcinas de destete, perteneciente a los programas sectoriales de investigación aplicada, PEME I+D Suma del Plan Gallego de Investigación, Desarrollo e Innovación Tecnológica, en el marco del programa operativo FEDER Galicia 2007-2013.

320


Bibliografía Aguilar, M. (2006). Control ambiental en alojamientos ganaderos de Navarra II. ITG Ganadero. Versión electrónica en disco compacto. Carr, J. (2009). Herramientas básicas para controlar el ambiente en las explotaciones. SUIS, 57, 24-37. CIGR, December, (2002). International Commission of Agricultural Engineering, Section II4th Report of Working Group on Climatization of Animal Houses Heat and moisture production at animal and house levels. Huynh, T.T.T., Aarnink, A.J.A., Verstegen, M.W.A., Gerrits, W.J.J., Heetkamp, M.J.W., Kemp, B. y Canh, T.T. (2005). Effects of increasing temperatures on physiological changes in pigs at different relative humidities. Journal of Animal Science. Kornbek, B. (2005). Control del medio ambiente del cerdo. Danish Farm Design. Compenhagen. Maenz, D.D., Patience, J.F. y Wolynetz, M.S. (1994). The influence of the mineral level in drinking water and the thermal environment on the performance and intestinal fluid flux of newlyweaned pigs. Journal of Animal Science, 72, 300–308. López, P., Revuelta, M. y Babot, D. (2008). Plan de evaluación de las condiciones ambientales en explotaciones porcinas. I. Pautas y equipos. Anaporc, 50, 38-40. Pedersen, S. y Pedersen, C.B. (1995). Animal Activity measured by infrared detectors. Journal of Agricultural Engineering Research, 61, 239-246. Pedersen, S. y Rom, H.B. (1998).Diurnal variation in heat production from pigs in relation to animal activity. International Conference on Agricultural Engineering Oslo, Paper 98-B-025. Pedersen, S. A. (1998). Comparison of three balance methods for calculating ventilation rates in livestock buildings. Journal of Agricultural Engineering Research, 70, 25-37. Pluske JR, J Le Dividich, MWA Verstegen. Edicionespecuarias.com Sousa, P. y Pedersen, S. (2004). Ammonia Emission from Fattening Pig Houses in Relation to Animal Activity and Carbon Dioxide Production. Agricultural Engineering International: The CIGR Journal of Scientific Research and Development. Manuscript BC04 003. Vol.VI.

321


Efecto del brasinosteroide de sĂ­ntesis DI-31 sobre la tolerancia a la salinidad de lechugas (Lactuca sativa L.) ; %+84'  522   &'6':' ?  358E9



9);+2' 52/:B)4/)' !;6+8/58 *+ 8/.;+2' ¤#4/<+89/*'* /-;+2 +84A4*+@¼ :8' +4/+2 3   

 8/.;+2' 96'D' +Â&#x2014;3'/2 ''35859;3.+9 +4:85 *+ 9:;*/59 *+ 85*;):59 ':;8'2+9 ');2:'* *+ ;C3/)' #4/<+89/*'* *+ 2' '('4' &'6':' ?  $+*'*5 ;(' )6  

Resumen !+ );2:/<'854 62A4:;2'9 *+ 2+).;-' +4 952;)/E4 4;:8/:/<' J 5'-2'4* ? +4 )A3'8' *+ );2:/<5 ('05 )54*/)/54+9 )54:852'*'9 ;'4*5 2'9 62A4:;2'9 :+4C'4  *C'9 9+ 2+9 6;2<+8/@E )54 +2 (8'9/459:+85/*+ Â&#x2014;  '  E  ĂŤ ' '62/)')/E4 *+2 '2  3 9+ 8+'2/@E '2 *C' 9/-;/+4:+ );'4*5 9+ ./@5 +4 ;4' 952' '62/)')/E4 5 ;4 :+8)/5 +4 )'*' ;45 *+ 259 :8+9 *C'9 9/-;/+4:+9  259 *C'9 *+ +9:' '62/)')/E4 9+ :53'854 2'9 3;+9:8'9 7;+ 9+ 9+6'8'854 +4 2' 6'8:+ 'B8+' ¤ÂĽ ? 8'*/);2'8 ¤ ÂĽ )588+9654*/+4:+  )'*' 3;+9:8' 9+ 2+ *+:+83/4E +2 6+95 ,8+9)5 +3/9/E4 *+ +:/2+45 ? )54:+4/*5 +4 2'9 652/'3/4'9 6;:8+9)/4' ¤#"ÂĽ +96+83/*/4' ¤!ÂĽ ? +96+83/4' ¤!ÂĽ )535 3+*/*'9 *+2 +9:8B9 9'2/45 59 8+9;2:'*59 .'4 *+359:8'*5 7;+ 2' 9'2/4/*'* .' */93/4;/*5 +2 6+95 :'4:5 *+ 2'  )535 *+ 2'  *+ 2'9 62A4:;2'9 *+ 2+).;-' )54 ;4 3'?58 +,+):5 9/ 2' '62/)')/E4 9'2/4' .' 9/*5 *+ ;4' 952' <+@ 7;+ );'4*5 .' 9/*5 +4 :8+9 '62/)')/54+9 ? 7;+ +2 Â&#x2014;  .' )549+-;/*5 */93/4;/8 2' 6B8*/*' *+ 6+95 *+(/*' '2 '2 )54 ;4 3'?58 +,+):5 '  7;+ '  ĂŤ ' :'9' *+ +3/9/E4 *+ +:/2+45 .' /4)8+3+4:'*5 )54 2' '62/)')/E4 *+ '2 ? +2 :8':'3/+4:5 )54 Â&#x2014;  2' .' */93/4;/*5 ';47;+ 45 9/+368+ *+ ,583' 9/-4/,/)':/<' +,+):5 685*;)/*5 +4 2'  6+85 45 +4 2'   2 )54:+4/*5 +4 #" .' */93/4;/*5 )54 2' 9'2/4/*'* ? +2 Â&#x2014;  .' 8+<+8:/*5 +2 +,+):5 +4 2'  ? 25 .' 3'4:+4/*5 +4 2'   59 )54:+4/*59 *+ +96+83/*/4' ? +96+83/4' .'4 /4)8+3+4:'*5 +4 2'  658 +2 +,+):5 9'2/45 2 Â&#x2014;  .' 8+<+8:/*5 +2 +,+):5 *+2 '2 :'4:5 +4 2'  )535  +4 '3('9 652/'3/4'9 +>)+6:5 +4 2'  *+ ! 7;+ 25 .' 3'4:+4/*5 !+ 6;+*+ )54)2;/8 7;+ +2 (8'9/459:+85/*+ :/+4+ ;4 +,+):5 685:+):58 *+ 2' 9'2/4/*'* *+ 2'9 62A4:;2'9 *+ 2+).;-' ?' 7;+ .' 8+<+8:/*5 +2 +,+):5 *+2 '2 95(8+ 2' 6B8*/*' *+ 6+95 +3/9/E4 *+ +:/2+45 ? )54:+4/*5 *+ 652/'3/4'9 *+ 2'9 62A4:;2'9 *+ 2+).;-' 9'2/4/@'*'9 '2'(8'9 )2'<+ 8'9/459:+85/*+ Â&#x2014;  9'2/4/*'* +:/2+45 652/'3/4'9 2+).;-'

Effects of a brassinosteroid analogue (DI-31) on salt tolerance of lettuce Abstract +::;)+ 9++*2/4-9 =+8+ -85=4 /4 4;:8/+4: 952;:/54 J 5'-2'4* '4* -85=:. ).'3(+8 ;4*+8 )54:8522+* )54*/:/549 %.+4 :.+ 9++*2/4-9 =+8+  *'?9Â&#x2014;52* :.+? =+8+ 968'?+* =/:. Â&#x2014;  ' (8'9/459:+85/*+ '4'25-;+ :5  58  G ".+ '662/)':/54 5,  3 '2 ='9 )54*;):+* :.+ 4+>: *'? =.+4 :.+ '662/)':/54 ='9 3'*+ /4 ' 9/4-2+ '662/)':/54 58 54+ :./8* /4 +'). 5, :.+ 4+>: :.8++ *'?9 ,:+8 *'?9 5, :./9 '662/)':/54 =+ :551 9'362+9 :.': =+8+ 9+6'8':+* /4 :.+ '+8/'2 ¤ÂĽ '4* 855: ¤ ÂĽ 658:/549 4 +'). 9'362+ ,8+9. =+/-.: +:.?2+4+ +3/99/54 '4* )54:+4: 5, 652?'3/4+9 6;:8+9)/4+ ¤#"ÂĽ 96+83/*/4+ ¤!ÂĽ '4* 96+83/4+ ¤!ÂĽ =+8+ *+:+83/4+* '9 3+'9;8+9 5, 9'2: 9:8+99 ".+ 8+9;2:9 .'<+ 9.5=4 :.': 9'2/4/:? .'9 *+)8+'9+* :.+ =+/-.: 5, (5:. :.+  '4* :.+  5, :.+ 9++*2/4-9 5, 2+::;)+ =/:. ' -8+':+8 +,,+): /, :.+ '662/)':/54 9'2/4+ ='9 3'*+ 54)+ :.': =.+4 .+ ='9 3'*+ /4 :.8++ '662/)':/549 '4* :.': Â&#x2014;  ')./+<+* ' 8+*;):/54 5, :.+ =+/-.: 2599 *;+ :5 '2 =/:. ' -8+':+8 +,,+): ':  :.': :5  G ".+ +3/99/54 5, +:.?2+4+ ='9 /4)8+'9+* =/:. :.+ '662/)':/54 5, '2 '4* Â&#x2014;  :8+':3+4: *+)8+'9+* :./9 +,,+): '2:.5;-. 45: '2='?9 9/-4/,/)'4:2? :.+ +,,+): 685*;)+* /4  (;: 45: /4 :.+   ".+ #" )54:+4: *+)8+'9+* =/:. 9'2/4/:? '4* Â&#x2014;  8+<+89+* :.+ +,,+): 54 :.+  '4* /: ='9 8+3'/4+* /4 :.+   ".+ )54:+4:9 5, 96+83/*/4+ '4* 96+83/4+ /4)8+'9+* /4 :.+  (? :.+ 9'2: +,,+): ".+ Â&#x2014;

 8+<+89+* :.+ +,,+): 5, '2 (5:. :.+  '4*  /4 (5:. 652?'3/4+9 +>)+6: /4  :.': :.+ )54:+4: 5, ! ='9 3'/4:'/4+* %+ )54)2;*+ :.': Â&#x2014;  .'9 ' 685:+):/<+ 852+ '-'/49: 9'2/4/:? 54 2+::;)+ 9++*2/4-9 (+)';9+ /: 8+<+89+* :.+ ,8+9. =+/-.: 2599 :.+ +:.?2+4+ +3/99/54 '4* :.+ ).'4-+9 /4 652?'3/4+9 )';9+* (? '2

+?=58*9 8'99/459:+85/* Â&#x2014;  9'2/4/:? +:.?2+4+ 652?'3/4+9 2+::;)+

322


Introducciรณn y/o Justificaciรณn ^ย„ ย‹ย„ย‚^ย„` ^ย‚ ย„ ย„^ ย€ ยˆย‚[ย‚  ^ยˆย‡ย€ ย„`^ย„ ยžย€ ย„ ย™ ^`^  `^^ [  ย‚^ ยƒ \ `[ < ย™ ย„ย‚^  ยˆ^ย„` ย„ย€ =ย‚ย„` ย‚  ย„ย‚ `^ย„ [ย„ ย‡` ย„  [ย„ ย‡[`ย„ `[ ย„ ^ยˆ^ ย‡^[  < ยˆย„ [^[ ย„ ย€`^ย„ ย„ ยˆย‚[[ย„ ยˆย‹ย‚ย€ยˆ ยƒย„ย€[ ย™^]ย„ `[[^ย„ < > ย„ 3]\ย€? <  `< 4DD57 "ย„`^ย„ ^ยˆย‡ย€ ย„`^ย„ ย„` ^ย‚[ ย„ ย‡ย€   ย‡    ^ยˆ [ย‚ย‹ ^ ^]ย€\ ^ ?@ ย„ ^ Aย‚^ย„ \ย„^ย„7 Iย„` [ ยˆ^ยˆ `^ ย™ ย„ย‚^ ย‚ย„[^ย„    D ย‹ย„ย‚^ย„` ^ย‚ ย„  ย‡[`ย„ 3]\ย€? <  `< 4DD57 ย‹]^ย„  [ย‚?^ย„ ^ ย‡[`ย„ ย„ย€ย‡ ย‚^ ย„ ย„ย€\ย‚   ยžย€ ย‡ ย„ ` ย€ ย‡ย‡ [ >`ย‚^  ย€ ยˆย‡[ย‚^ \^  ย‡^ ย„^ย„  [  ย„^[[^ `[ ย„ ^ยˆ^ [  ย‚ยˆย‚ `^  `[[^ย„ > ย„ ย‚ย‚ย‚ย‚I [^[ < [  ย„^[[^  [^ ย„ < ย€`^ย„ )ย„ย„  4DD57 ^ย„ ย‹ย„ย‚^ย„` ^ย‚ ย„ `ยˆย‹ย‚F ย™ ย„ย‚^ ย‚ยˆย‡[ย‚^ย„   ย„ย‡ย€ ย„`ย„  [ย„ ย‡[`ย„  ย‚  ` ย„ `ย‚ย‡^ย„  ย„`Fย„ ``^ ย‹ย‚I`ย‚^ย„ ^ยˆ^ ย‹ย‚I`ย‚^ย„ 3]\ย€? < I<` 4DD27 .^ยˆ^ [ ย‚ย„[ยˆย‚ `^ ย‚ `ย‚ย‚ย‚I  [^ย„ ย‹ย„ย‚^ย„` ^ย‚ ย„ `ย€[ ย„ ย„^ ย‡^ ย„^ย„ ^ย„`^ย„^ย„ ย™ ย‡^[ย‚ ^ [^ย„ `ย‹]^ย„  ย„>` ย„ย‚ย„ < ยƒ[ย€ย‚I  ย‹ย„ย‚^ย„` ^ย‚ ย„ ย„ย‚`F`ย‚^ย„ ^ ย„ ยˆย‚ย„ย‚`F`ย‚^ย„ Eย™ย‚ย‡ย™ +ย™ย‹ย‚ย„6ย‚ย‚ C  ^^`

 )ย‚^ย„  ย„`^ย„ E[^\^ย„  ย‹ย„ย‚^ย„` ^ย‚ ย„ ย™ ย„ย‚^ ยˆ^ย„`^ย„ ย„  J`ย‚[ ย„  \ย‚ย€[`ย€ #JH D %^ย‹ย‚ C ^[[

 &  ` [

 C ย‹ [ ^ย‹] `ย‚ยƒ^  ย„` ย„`ย€ย‚^ ย™ ย„ย‚^ ย„`ย€ย‚ [^ย„  `^ย„  [ ย‡[ย‚ย‚I  ย€ E[^\^  % [   [ย„ ^ `ย‚^ ย„   C L" ย‡ ^` ย„` [^ย„  `^ย„  [ #[

ยˆ" ย„^ย‹ ย‡[E`ย€[ย„  [ ย™ย€\ย„

Material y Mรฉtodos & ยˆย‚[[ย„  [ ย™ย€\ ยƒ [ย‹ย„  [ ย„  ย„ ยˆย‚[[ย„ % +*# ย„ ยˆ`ย€ยƒย‚ ^  Eยˆ  \ ยˆย‚ย‚I ย€` ^ย„ Gย„  ย„ย‡ย€Fย„ ย„ `ย„[^  [ Eยˆ  ย€[`ย‚ยƒ^  [ย„ ย„ย‚\ย€ย‚ ` ย„ ^ย‚ย‚^ ย„ ย€ ย‚[^  [ย€D    ย™ ย€ ` ยˆย‡ `ย€ 

M ย€ ย™ย€ยˆ   [`ย‚ยƒ     C ย€ ย‚` ย„ย‚ [ย€ยˆย‚^ย„  

Lยˆ^[ ยˆ ย„  !^ย„ ย‡ย‚ยˆ ^ย„ Gย„ ย„`ย€ยƒย‚ ^ ^ \ย€  ย„`ย‚[ !^ย„` ย‚^ยˆ ` ย„ `ย„ย‡[`^   ย‚ย‡ย‚ ` ย„ ^ ย„^[ย€ย‚I ย€`ย‚`ย‚ยƒ ^\[ C ^ ย‚ ย‚I ย‡ ยˆ `  & ย€`ย‚[ย‚D^  ย‚ย‡ย‚ ` ย„ ย‡  ``ยˆย‚ `^ ^

ย‡[E`ย€[ย„ ย‡^  ย‚ย‡ย‚ `   [^ย„  Gย„  ย„ [ `ย„[^  [^ย„  ย‚ย‡ย‚ ` ย„ ย„  [ย‚D^ [^ย„ ``ยˆย‚ `^ย„ ย‡ย‚ยˆ ^ ^ [  C [ G ย„ย‚\ย€ย‚ ` ^ [ #[ ย‡[ย‚ย‚I ยžย€ ย„  [ย‚DI  ย€ ^  ` ย„ ย‚ย‚^ ย„  ย„` ย„^ ^ ย€    [ ^ `ย‚I   ย€^  [^ย„ ` ย„ Gย„ ^ย„ ย€`ย‚ยƒ^ย„ ยžย€ ย€I [ ย‡[ย‚ย‚I  ` ย„ ย‚ย‚^ ย„ !^ย„ ``ยˆย‚ `^ย„  [ย‚D^ย„ ย€ ^ [^ย„ ย„ย‚\ย€ย‚ ` ย„ '  ^`^[ '



ยˆ" #[  \^[ย‡  ' 

ยˆ" #[  ยƒ  ย„ '   L"  

ยˆ" #[  \^[ย‡  '  L"  

ยˆ" #[  \^[ย‡  '   L"  

ยˆ" #[  ยƒ  ย„ ' L"  

ยˆ" #[  ยƒ  ย„  [^ย„ Gย„  [ ย‡[ย‚ย‚I ย„[ย‚ ย„ `^ยˆ^ [ย„ ยˆย€ ย„`ย„ ยžย€ ย„ ย„ ย‡^  [ ย‡` F  ! C ย‚ย€[ !% ^ ย„ย‡^ย‚ `    ยˆย€ ย„` ย„ [  ` ยˆย‚I [ ย‡ ย„^  ย„^ ยˆย‚ย„ย‚I  `ย‚[ ^ C ^` ย‚^  [ย„ ย‡^[ย‚ยˆย‚ย„ ย‡ย€` ย„ย‚ !(' ย„ย‡ ยˆย‚ย‚ &! C ย„ย‡ ยˆย‚ &!" ^ยˆ^ ยˆ ย‚ย„  [ ย„`Fย„ ย„[ย‚^ [ `ย‚[ ^ ย„ ย€`ย‚ย‚I ย‡^ ^ยˆ`^\G \ย„ ^ย„ ! [[^ [ย„ ! C !% ย„ ย‡ ย„^ C ย„ ย‚`^ย€] ^ ย‚ย‚ยƒย‚ย€[ยˆ ` C ย‡^ ย„ ย‡^  ย€  ย‚ย‡ย‚ `  ยƒย‚ย‚^  ^ ย™ ยˆF`ย‚ยˆ ` ^ ย€ ^ย‚ย‚ย‚^  [ `ย‡   [ ยžย€ ย„ ย‡ย€ย„^ ย€ ย„ ย‡`ย€ยˆ  \^ยˆ ^ ย‡ ยˆ ย‚ ^ ย‚ย„[ย„ ย€` ย€ ย™^ [ ย‹^  [ ย€[ ย„ B`] ^ ยˆย€ ย„`ย„  ย€ ยˆ!  [ `ยˆIย„  \    [ ย‚` ย‚^  [  ย‚ย‡ย‚ ` ^ ] ย‚\ย„ !ย„ ยˆย€ ย„`ย„ ย„ ย‚C `^  ย€ ^ยˆ`I\^  \ย„ ย„ *!'' ! % ยˆ^ [^   ย‡^ยƒย‚ย„`^   ` `^  ย‚^ย‚Dย‚I  [[ยˆ C ^[ย€ยˆ   ^ ย‚^Bย‚ย‹[   ยˆ  [^\ย‚`ย€ C KK  ย‚Eยˆ `^ ย‚` ^ ^  [[ ^  [Jยˆย‚ `ย‚ยƒ  

ยˆ ย„ย™ !ย„ ย‡^[ย‚ยˆย‚ย„ ย„  ` ยˆย‚^ ย‡^ !! ! [ B`ย‚I  ย‡^[ย‚ยˆย‚ย„ ย„ ย€`ย‚[ย‚DI [ ยˆF`^^  [^ ย„

323


> H29:54 >4Â&#x2013;J &,96;A9 9, ,80<854 29 65203049 658 ,2 3A:55 , ,4?502E0A4 , @,354 > $9,4. >C>J )59:,80583,4:, 9, E;4:0-0E854 29 65203049 658 E853:5.8-A 2A7;0 , 2: 68,90A4 ,4 ;4 8I)FI$$K)3JG3@& 9,80, J )8 ,9:2,E,8 ;4 90.40-0EE0A4 ,4 259 :59 8,E5.059 ,4 ,2 ,9:;05 , 259 0-,8,4:,9 68@3,:859 9, 8,20?A ;4 4@20909 ,9:A9:0E5 E54 ,2 685.83 HB::.86/0E9 )2;9 Â&#x2022;JB 8,20?45 ;4 4@20909 , <804? 90362, , ;4 9525 -E:58 32833 > ;4 :,9: , 84.5 3<2:062, 68 ,:,83048 2 0-,8,4E0 3A403 90.40-0E:0< & B ,4 7;,229 E5368E054,9 ,4 29 7;, 68,EA4 0-,8,4E09 ,9:A9:0E3,4:, 90.40-0E:0<9J

Resultados y DiscusiĂłn Efecto del DI-31 sobre la pĂŠrdida de peso I4 2 -0.J  9, 6;,, 59,8<8 7;, 2 620EE0A4 , 2J2 685;15 ;4 09304;E0A4 ,2 6,95 -8,9E5 , 29 62@4:;29 , 2,E/;. :4:5 ,4 2 )3 E535 ,4 2 )@J I4 2 )3 0.J  9, 6;,, 59,8<8 7;, ,2 6,95 -8,9E5 , 29 62@4:;29 :,9:0.5 $ ,9 ,2 3@=035 5:,405 7;, 9, <05 09304;05 2 04E586588 ,2 2J2J J;45 ,2 2J2 9, 04E58658A , .526, $Â&#x2013; 685;15 ;4 09304;E0A4 ,2 J 30,4:89 7;, E;45 9, 04E58658A ,4 :8,9 <,E,9 9, 685;15 ;4 09304;E0A4 ,2 Â&#x2022;Â&#x2013;JÂ&#x2013;J I9:9 09304;E054,9 -;,854 9;-0E0,4:,9 68 359:88 0-,8,4E09 90.40-0E:0<9 ,4:8, 29 62@4:;29 92040?9 > 29 624:9 E54:852 ;47;, 45 359:8854 0-,8,4E09 90.40-0E:0<9 29 62@4:;29 92040?9 ,4:8, 9AJ I4 2 )@ 0.J  ,2 6:8A4 , E53658:30,4:5 , 259 09:04:59 :8:30,4:59 -8,4:, 2 2J2 -;, ,2 30935 E54 ;4 09304;E0A4 ,2 "J4 E;45 ,2 2J2 -;, 620E5 ,4 ;4 952 <,? $Â&#x2013; > ;4 09304;E0A4 ,2 Â&#x2022;"J4 E;45 9, 620EA ,4 :8,9 <,E,9 $Â&#x2022;J I4 39 68:,9 29 09304;E054,9 954 3>58,9 E;45 ,2 :8:30,4:5 92045 9, /E, ,4 ;4 952 620EE0A4 7;, E;45 9, /E, ,4 :8,9 620EE054,9 ;47;, 904 0-,8,4E09 90.40-0E:0<9 ,05 2 ,-,E:5 593A:0E5J $559 ,9:59 :59 ,9:@4 , E;,85 E54 5:859 ;:58,9 E535 '(6(:( ,: (2 Â&#x2013; > Â&#x2013; > 03 ,: (2 Â&#x2013; 59 :8(:(30,4:59 *54 Â&#x2022; /(4 8,<,8:0+5 ,2 ,-,*:5 +,2 (2 (2*(4?(4+5 ,2 30935 6,95 7;, 259 :,9:0.59 :(4:5 ,4 2( ! *535 !" ( 2( *54*,4:8(*0D4 +,  G +, Â&#x2022; > *;(4+5 2( (620*(*0D4 9(204( 9, /0?5 ,4 :8,9 <,*,9 ,-,*:5 ,4*54:8(+5 *54 5:859 " > ,4 5:8(9 ,96,*0,9 20 ,: (2 Â&#x2013; ;C,? ,: (2 Â&#x2013;Â&#x2022; 9:, 04*8,3,4:5 +,2 6,95 6;,+, 9,8 +,)0+5 ( 7;, 9, /( *53685)(+5 7;, 259 )8(90459:,850+,9 04*8,3,4:(4 ,2 40<,2 +,2 909:,3( (4:05=0+(4:, > +0<,8959 593520:59 ,4 62(4:(9 9(2040?(+(9 *54 25 7;, 04*8,3,4:(4 2( :52,8(4*0( (2 ,9:8A9 9(2045 > (9B 685:,.,4 2( 3(7;04(80( -5:5904:A:0*( > 2( 6,85=0+(*0D4 +, 2B60+59 685<5*(4+5 ,2 *8,*030,4:5 <,.,:(2 a

20 18 16

e

T01 : control. PARTE AĂ&#x2030;REA T02 : 100 mM NaCl de golpe. T03 : 100 mM NaCl en 3 veces. T1 : 0.1 ÎźM DI-3 + 100 mM NaCl de golpe. T2 : 1 ÎźM DI-31 + 100 mM NaCl de golpe. T3 : 0.1 ÎźM DI-31 + 100 mM NaCl en 3 veces. e T4 : 1 ÎźM DI-31 + 100 mM NaCl en 3 veces.

cd

14

b

PARTE RADICULAR

c

de

cd

c

2.0

1.5

a

a

10

c

2.5

ab

abc

12

d

d

8

1.0

6 4

0.5

Peso Fresco (g/planta)

Peso Fresco (g/planta)

22

2 T01

T02

T03

T1

T2

Tratamientos

T3

T4

T01

T02

T03

T1

T2

T3

T4

Tratamientos

0.  !,95 -8,9*5 +, 2( 6(8:, (A8,( ( > 8(B? ) +, 62@4:;2(9 +, 2,*/;.(9 *54:852 > :8(:(+(9

324


Efecto del DI-31 sobre sĂ­ntesis de etileno

d

a

bcd abcd

Etileno (nL/gh)

5.0

abc

g

abcd abc

a

4.0

PARTE RADICULAR

b

PARTE AĂ&#x2030;REA

cdef

ef bcde

abcd

3.0

abc

a

2.0

1.0

T01

T02

T03

T1

T2

T3

T4

T01

Tratamientos

T02

T03

T1

T2

T3

28 26 24 22 20 18 16 14 12 10 8 6 4 2

Etileno (nL/gh)

Â? + C '/ ' /- ' ( +  / *+ + C  G)' /)+1+ + ' * ))/D *+ +/+ )1 +  +*+ ( +G' + ' ,/- H )1  ' + .' +)'* ¤&''' + ' ÂĽ Â? ' Â&#x161; ¤/- 'ÂĽ + ''1/+ *+ ' G)D  /)+1+ + ' ' ' *+ * ))/D *+ +/+ *+ ' L ' *+ +). -' ''*' )  G'+ 1+*/ *+ , , H  -C. ¤'' # H # + +)/G'1++ÂĽ + )1'')/D ) ' L ' 1'+/*' +  )/D  //G' ¤ 0 -C.ÂĽ 1'H + + )'  *+ ''1/+ '/ + ' ' G+" ¤# ÂĽ ( + ) '* + +'/"D + + '/)')/+ ¤# ÂĽ H D 1 D */,++)/' /-/,/)'/G' + *+ +*/1/+ *+ +/+ *+ ' '+ 'C+' *+ ' L ' + /- ¤# ÂĽ ) + +) ' *+ +*/*  ' L ' ) '* + ''1/+ '/ + ./" + ' '/)')/D ¤# ÂĽ Â? '  ¤/- (ÂĽ +  +*+ ( +G' ( + + ''1/+ *+ ' '1(/C G)D  /)+1+ + ' ' ' *+ * ))/D *+ +/+ *+ ' L ' ''*' )  G'+ 1+*/ *+   H , -C. ¤'' # H # + +)/G'1++ÂĽ + )1'')/D ) ' L ' 1'+/*' +  )/D  //G' ¤// -C.ÂĽ ' ( + + + + )'  + 1'H '' + ''1/+ '/ '/)'* + + G+)+ ¤# ÂĽ ( + ) '* + +'/"D + ' ' '/)')/D ¤# ÂĽ H D 1 D */,++)/' /-/,/)'/G' + + /1+ )'  Â&#x161; E + /)+1+ *+ ' E+ / *+ +/+ .' /* 1'H + '  ( + + ' Â&#x161; H' ( + '( +' + L + )') */+) ) ' ' H  ' ' +  + '  +*+ ''+)+ '+ H ) 1'H /+ /*'*  ''1/+ ) Â&#x2020;

.' */ 1/ /* ' * ))/D *+ +/+ .' ' /G++ /)  /,+/+ ' + /- #  + D + ' Â&#x161; 1/+' ( + .' +- /* ' 1+'* + '  +- '1++  1'H + C 

T4

Tratamientos

/-  /G++ *+ +1/ /D *+ +/+ *+ ' '+ 'C+' ¤'¼ H 'E" ¤(¼ *+ L ' *+ +). -' ) H ''*' 

Efecto del DI-31 sobre la sĂ­ntesis de poliaminas Â? )1'1/+ *+ ' Â&#x161; H  *+ ' L ' *+ +). -' .' /* */,+++ ) '* ' L ' , + ''*' ) ' + +) ' ' E+ / *+ /'1/' ¤/- ÂĽ Â? ' Â&#x161;  ''1/+ )' ' ' */ 1/ )/D +  )+/* *+ ' /'1/'  $# H Â&#x2020; H .' 1'+/*  *+  / +1('- + '   ''1/+ ) ' )' ' */ 1/ )/+ + $# + /)+1+ + Â&#x2020; H  %'/ ' + .' +)'* ( + ' '//*'* G)' */ 1/ )/+ *+ /G+ *+ $# + /)+1+ +  *+ Â&#x2020; H  ¤&''' + ' ? +--/'/ Â&#x201C;" H Â&#x201C;+'/

00 ? / H ' 00,ÂĽ ' )1   '1(/C .+1 +)'* + ' 'E)+ *+ ' L ' *+ +). -' '//"'*' ¤/- ÂĽ ( + + + D-' ( + + L + )') */+) ) + ' H + + D-' + + ( +  +*+ ''+)+ '+  E1' *+ + C '/  ''1/+ ) Â&#x2020;

.' +G+/* + +,+) *+  ''1/+ ) '   ( +  )+/* *+ $# H Â&#x2020; .' /)+1+'* 1/+' ( + ' ))+')/D *+   .' )'1(/'* + ' Â&#x161; Â? '  

325


&$& &!% !   % '! !% ! & !%   )  )   & ! !%   ' #' %&!% !% ! %"$  %! % &(!% PARTE RADICULAR

c

35

de

bcd

abcd

60

a

ab

30

ab

abc

ab

20

ab

40

a

20

e

c

PARTE AĂ&#x2030;REA

d

de

1000

10

PARTE RADICULAR

e 200

d

900

cd

800

bcd

700

c

600 550 500 450 400 350 300 250 200 150 100 50

abc

c ab

e Espermina "SPM" (nmol/g)

15

5

1100

Espermidina "SPD" (nmol/g)

25

ab

ab

a

PARTE AĂ&#x2030;REA

a

6

100

ab

a

a

150

d

f

50

PARTE RADICULAR 12

a a

a

a

a

a

10

cd

8

4

bc

bc

6

ab 4

2

a

2

a T01

T02

T03

T1

T2

Tratamientos

T3

T4

T01

T02

Putrescina "PUT" (nmol/g)

80

b

Espermidina "SPD" (nmol/g)

Putrescina "PUT" (nmol/g)

e

T03

T1

T2

T3

Espermina "SPM" (nmol/g)

PARTE AĂ&#x2030;REA

a

T4

Tratamientos

  (%  "! %   "$& ,$ ) $-*  "+ &'%  '% ! &$! ) &$&%

Conclusiones  "' ! '$ #'  $% !%&$! '&*!  %& &$!    & ! ' &! "$!&&!$  % "+ &'%  ' $ &   %  ) #' %' &$& &!  $($&!  &!    %!$  ",$  "%! %.  & ! ) ! & !  "! %  % "+ &'%  ' % *% %& &!  %! )!$   #'   0  

326


Agradecimientos !<9C/>9 38839 :9< 6 98=/66/<F / ?3H8 / 6 /8/<63>> <6/838Â&#x203A; <Â&#x;§ 

BibliografĂ­a 63  C>  <3?38 " +8. 27+.  ¤Â&#x2013;ÂŁÂĽ Â&#x2013;Â&#x2014;:3,<+==38963./ :<9>/->= +1+38=> >2/ =></== 1/8/<+>/. ,C =+6383>C +8. 83-5/6 38 Brassica juncea Chemosphere 72 Â&#x2022;ÂŁÂ&#x;Â&#x2014;Â&#x2022;ÂĄÂ&#x2013; +41?D  +8. +C+> $ ¤Â&#x2013;ÂĄÂĽ 00/->= 90 ,<+==389=>/<93. 98 >2/ :6+8> </=:98=/= >9 /8@3<987/8>+6 =></==/= Plant Physiology and Biochemistry 47 Â&#x2014;ÂŁ +41?D  +8. %</>C8  ¤Â&#x2013;Â&#x2022;ÂĽ %2/ -2/73-+6= -2+<+->/<3=>3- +8. .3=><3,?>398 90 ,<+==389=>/<93.= 38 :6+8>= Phytochemistry 62 Â&#x2013;Â&#x;Â&#x2014;  69</=  +8. +6=>98 ' ¤ÂĄÂŁÂ&#x2013;ÂĽ !96C+738/= +8. :6+8> =></==Â&#x203A; +->3@+>398 90 :?></=-38/ .39=C8>2/=3= ,C 9=79>3- =29-5 Science 217 Â&#x2013;Š¥Â&#x2014;Â&#x2013;  2<3:+-2 &  *2+,38=533 & +8. / <99>   ¤Â&#x2013;ÂĽ %A/8>C C/+<= 90 ,<+==389=>/<93.=Â&#x203A; =>/<93.+6 :6+8> 29<798/= A+<<+8> ,/>>/< -<9:= 09< >2/ (( /8>?<C Annals of Botany 86 Â&#x2014; Â&#x; 37  98=/-+  293  ?,9>+  +8. A98 ) ¤Â&#x2013;ÂŁÂĽ $+6> 38 3<<31+>398 A+>/< +00/->= >2/ 8?><3>398+6 +8. @3=?+6 :<9:/<>3/= 90 <97+38/ 6/>>?-/ ¤Lactuca sativa ÂĽ Journal of Agriculture and Food Chemistry 56 Â&#x2022;Â&#x;Â&#x;Â&#x2013;Â&#x2014;Â&#x2022;Â&#x;Â&#x;  38  +8. +9  ¤¥¥Š¼ /@/6= 90 /8.91/89?= :96C+738/= +8. +6Â&#x2014; 3823,3>/. 1<9A>2 90 <3-/ =//.6381 Plant Growth Regulation 17 ŠÂ&#x2014;Â&#x2013; IG/D  +DD+0/<+ ! +D9<<+  $3;?3/<+ ' +8. *?669 % ¤Â&#x2013;Â&#x2022;ÂĽ 806?/8-/ 90 ,<+==389=>/<93. +8+691?/ 98 +8>39B3.+8> /8DC7/= 38 <3-/ 38 -?6>?</ 7/.3?7 A3>2 +6 Plant Biology 47  Â&#x;Â&#x2014;Â&#x; IG/D  #9,+38+  +8. 966  ¤Â&#x2013;Â&#x2022;ÂĽ $C8>2/=3= +8. :<+->3-+6 +::63-+>398= 90 ,<+==389=>/<93. +8+691= 8Â&#x203A; +C+> $ +8. 27+.  ¤/.=ÂĽ <+==389=>/<93.=Â&#x203A; ,39+->3@3>C +8. -<9: :<9.?->3@3>C 6?A/< 9<.</-2> #/.798 ' +8. %=/81  ¤ÂĄÂ&#x;ÂĄÂĽ 312Â&#x2014;:</==?</ 63;?3. -2<97+>91<+:23- ./>/<738+>398 90 :?></=-38/ -+.+@/<38/ =:/<73.38/ +8. =:/<738/ Journal of Chromatography A 170 Â&#x;ÂĄÂ&#x2014;ÂŁ #/113+83 # 9D9 $ +8. /<>+83  ¤ÂĄÂĄÂĽ 2+81/= 38 :96C+738/ 7/>+,963=7 38 =//.6381 90 >2<// A2/+> ¤Triticum aestivum ÂĽ -?6>3@+<= .300/<381 38 =+6> =/8=3>3@3>C Plant Science 102 Â&#x2013;Â&#x2014;Â&#x2013;  $+==/  ¤Â&#x2013;Â&#x2022;ÂĽ !2C=396913-+6 +->398= 90 ,<+==389=>/<93.=Â&#x203A; +8 ?:.+>/ Journal of Plant Growth Regulation 22 Â&#x2013;Â&#x; Â&#x2014;Â&#x2013;ÂŁÂŁ $/<8+  /<8E8./D  966  +8. 79<H=  ¤Â&#x2013;Â&#x2013; +ÂĽ <+==389=>/<93. +8+691?/= /00/-> 98 C3/6. +8. ;?+63>C :+<+7/>/<= 90 03/6.Â&#x2014;1<9A8 6/>>?-/ ¤Lactuca sativa ÂĽ Scientia Horticulturae 143 Â&#x2013;ÂĄKÂ&#x2022;Â&#x; $/<8+  /<8E8./D  966  966 ) +8. 79<H=  ¤Â&#x2013;Â&#x2013; ,ÂĽ <+==389=>/<93. +8+691?/= /00/->= 98 >2/ C3/6. +8. ;?+63>C :+<+7/>/<= 90 1<//829?=/Â&#x2014;1<9A8 :/::/< ¤Capsicum annuum ÂĽ Plant Growth Regulation 68 Â&#x2022;Â&#x2022;Â&#x2022;KÂ&#x2022;Â&#x2013; *+:+>+ ! 9>/66+  !/></6 % +8. $/<<+89  ¤Â&#x2013;Â&#x;ÂĽ #/=:98=/= 90 />2C6/8/ ,39=C8>2/=3= >9 =+638/ =></== 38 =//.6381= 90 /312> :6+8> =:/-3/= Plant Growth Regulation 53 ÂĄÂ&#x;Â&#x2014;  *+:+>+ ! $/<<+89  !/></6 % 79<H=  +8. 9>/66+  ¤Â&#x2013;ÂĽ !96C+738/= +8. />2C6/8/ -2+81/= .?<381 1/<738+>398 90 .300/</8> :6+8> =:/-3/= ?8./< =+6383>C Plant Science 167 Â&#x;ÂŁÂ&#x2014;Â&#x;ÂŁÂŁ *+:+>+ ! $/<<+89  !/></6 % +8. 9>/66+  ¤Â&#x2013;ÂŁÂĽ 2+81/= 38 0<// :96C+738/ -98-/8><+>398 38.?-/. ,C =+6> =></== 38 =//.6381 90 .300/</8> =:/-3/= Plant Growth Regulation 56  Â&#x;Â&#x2014;Â&#x;Â&#x;

327


Caracterización de la microbiota bacteriana asociada al cultivo del ajo y su papel en la podredumbre durante el almacenamiento. L. Gálvez1, I. García1, M. García-Díaz2, M. García-Posada1, C. Iglesias1 y D. Palmero1. 1

Universidad Politécnica de Madrid, E.U.I.T. Agrícola, Avda. Puerta de Hierro, 4 (28040) Madrid Plant Genetic Resources Center. INIA, Autovía de Aragón Km 36, (28800) Alcalá de Henares. e-mail: daniel.palmero@upm.es

2

Resumen Existen diversos patógenos que pueden estar asociados a la podredumbre del ajo almacenado, sin embargo, hasta el momento no se ha estudiado el efecto que puede tener las bacterias sobre la misma. Los objetivos de este trabajo son caracterizar la microbiota bacteriana asociada al ajo de las principales comunidades productoras de ajo en España (Castilla-La Mancha, Andalucía y Castilla León). Además se ha comprobado la patogenicidad de dichas bacterias sobre dientes y plántulas sanas de ajo. La identificación de las cepas bacterianas se realizó mediante la secuenciación del gen 16S rRNA. La inoculación en plántula se realizó en tres cultivares diferentes de ajo (cv. Morado de Cuenca, cv. Garpek y cv. Chino blanco) con 7 cepas bacterianas diferentes y la patogenicidad se evaluó mediante un índice de gravedad de la enfermedad (IGE) según la podredumbre de las raíces. La inoculación en diente se realizó en el cv. Morado de Cuenca con 13 cepas diferentes y la patogenicidad se evaluó midiendo los diámetros de progresión de podredumbre de los dientes. En los análisis de la microbiota bacteriana se aislaron e identificaron principalmente tres géneros de bacterias: Pantoea, Bacillus y Erwinia. Mediante la inoculación en diente, se ha comprobado que algunas bacterias pueden tener cierta importancia en la podredumbre del ajo durante el almacenamiento. En cambio las pruebas de patogenicidad en plántulas no parecen indicar que las diferentes especies bacterianas presentes en las muestras analizadas tengan una gran importancia en el desarrollo de las plantas durante el cultivo. Palabras clave: Erwinia, Allium sativum, microbiota, podredumbre bacteriana.

Characterization of garlic-associated bacteria and their role on garlic clove rot during storage Abstract There are several pathogens that may be associated with garlic rot during storing, however the effect that bacteria can have on it has not been studied so far. The objectives of this study are to characterize the associated bacterial microbiota on garlic from the major producing areas in Spain (Castilla-La Mancha, Andalusia and Castilla León). Furthermore the pathogenicity of these bacteria has been proven on cloves and garlic seedlings. Identification of the bacterial strains was performed by sequencing the 16S rRNA gene. The seedling inoculation was conducted in three different cultivars of garlic (cv. Morado de Cuenca, cv. Garpek and cv. Chino blanco) with 7 different bacterial strains and pathogenicity was evaluated as root rot by using disease severity index (DSI). The cloves inoculation was carried out in cv. Morado de Cuenca with 13 different strains and pathogenicity was assessed by measuring the diameters of progression of cloves rot. Within the bacterial microbiota three species of bacteria, Pantoea, Bacillus and Erwinia, were isolated and identified. It has been found that certain bacteria may have some important role in garlic rot during storage. Pathogenicity tests (seedling inoculation) do not suggest that the different bacterial species present in the analyzed samples has great importance in the development of the plants during cultivation period. Keywords: Erwinia, Allium sativum, microbiota, bacterial rot.

328


Introducción Algunas de las patologías post-cosecha que afectan al cultivo del ajo (Allium sativum L.) pueden llegar a ocasionar importantes pérdidas en la producción final. Hasta la fecha se ha identificado a Fusarium proliferatum (Matsushima) Nirenberg, como el agente causal de la podredumbre del diente (Dugan et al., 2007). Los síntomas característicos observados en los ajos almacenados afectados por dicha patología son manchas deprimidas de color blanquecino con un halo necrótico, que pueden llegar a cubrir por completo el diente. Aunque F. proliferatum haya sido también citado como el principal agente causal de esta patología en España (Palmero et al., 2013; Basallote et al., 2011), otros microorganismos podrían estar implicadas en la podredumbre del diente. En el caso del género Allium, son varias las podredumbres bacterianas asociadas. Schwartz y Mohan (2008) citan a Erwinia rhapontici como la responsable de la necrosis foliar en cebollas (Allium cepa L.), así como de la descomposición interna de los bulbos en campo y durante el almacenamiento. Pantoea agglomerans es otra de las especies bacterianas que afecta tanto a cebollas como a ajos, causando pudriciones en el tallo y hojas, con sintomatología muy similar a la anterior. La correcta determinación taxonómica de los microorganismos implicados en la podredumbre del diente durante el almacenamiento es indispensable para poder abordar su control de manera efectiva. La identificación de las cepas de bacterias es compleja y requiere de varios criterios. Durante muchos años, los criterios taxonómicos se basaron en caracteres fenotípicos y bioquímicos. Hoy en día las clasificaciones se basan en métodos moleculares. Las técnicas de diagnóstico más recientes, se basan en la secuenciación de regiones altamente conservadas del DNA bacteriano, como es el caso del gen 16S rRNA y otros genes constitutivos (multilocus sequence typing, MLST) (Gehring and Geider, 2012). El objetivo principal de este trabajo es la identificación de la microbiota bacteriana asociada a la podredumbre del ajo durante su almacenamiento. Para ello se ha analizado la microbiota bacteriana de diferentes lotes de ajos con podredumbres procedentes de las tres comarcas ajeras de mayor producción (Castilla-La Mancha, Andalucía y Castilla León). Además se comprobó la patogenicidad de las diferentes cepas aisladas tanto en dientes sanos como en plántulas de ajo de diferentes cultivares.

Material y Métodos En agosto del 2012 se recibieron en el laboratorio de la Unidad de Protección Vegetal de la EUIT Agrícola diferentes lotes de cabezas de ajo, procedentes de varias provincias españolas: Blancomor de Vallelado de la provincia de Albacete y Palencia, Chino blanco de la provincia Córdoba y Morado de Cuenca de Palencia. La sintomatología observada al desgranar los dientes y eliminar sus catáfilas externas era variable. Algunos dientes mostraban podredumbres blandas con coloraciones que iban desde un marrón canela al rosa. En la mayoría de los casos los dientes presentaban una consistencia blanda. Se extrajeron pequeñas porciones de la zona interna de los dientes sintomáticos con ayuda de un bisturí y se sembraron en diferentes medios de cultivo patata-glucosa-agar (PDA) y tripticaseínasoja-agar (TSA). Tras 2 días de incubación a 25 ºC se seleccionaron al menos dos cepas por tipo mediante agotamiento por asa en placas con medio TSA. En los análisis moleculares para la identificación de las cepas bacterianas, el DNA genómico se extrajo siguiendo el protocolo descrito por Querol et al. (1992). Se amplificó la región del gen 16S RNAr mediante los cebadores y el programa descrito por McCabe et al. (1999). En los ensayos de

329


PCR (Polymerase Chain Reaction), cada 25 μl de mix se compuso de 2,5μl 10X PCR buffer, 0,5 μl dNTP’s (10 mM cada uno), 1μl forward cebador (20 μM), 1μl reverse cebador (20 μM), 0,15 μl de Taq DNA polimerasa (5 U/μl), 2 μl muestra de DNA y 23 μl agua estéril MilliQ. Los productos de PCR fueron separados en geles de agarosa (1%) a 80V 30 min. La purificación del producto de amplificación se realizó con el kit UltraClean PCR Clean-up kit (MO-BIO). La secuenciación se realizó con un analizador ABI 3730xl (Applied Biosystems) con los mismos cebadores que los utilizados en la amplificación. Las secuencias consenso para cada cepa fueron comparadas mediante la alineación de las secuencias utilizando el programa Bio Edit Sequence Alignment Editor v 5.0.9. Las secuencias del gen 16S rRNA se obtuvieron para todas las cepas analizadas y se compararon con las secuencias depositadas en el NCBI, mediante BLAST. Las pruebas de patogenicidad se realizaron sobre dientes sanos del cv. Morado de Cuenca inoculándose 14 cepas bacterianas en 5 dientes por 2 repeticiones. Los dientes se desinfectaron superficialmente con hipoclorito sódico al 5% durante 20 minutos y se aclararon tres veces con agua estéril. En la inoculación se siguió la metodología modificada de Hwang et al. (2012), para ello se perforaron los dientes (5 mm de profundidad). Se dispuso 10 µl de la suspensión bacteriana a una concentración de 107 CFU.mL-1 en el agujero, y posteriormente los dientes se incubaron a 28ºC en cámara húmeda. A los 10 días se analizaron los síntomas y se midieron los diámetros de podredumbre en los dientes. La inoculación de las plántulas se realizó con 7 cepas bacterianas en tres cultivares diferentes de ajo, A. sativum cv. Morado de Cuenca, cv. Garpek y cv. Chino blanco. Los dientes, previamente desinfectados, se plantaron en alveolos con sustrato estéril y se incubaron con luz y temperatura controlada (12/12h luz/oscuridad; 25/21 ºC). A las dos semanas las plántulas fueron inoculadas, las raíces de las plántulas se sumergieron durante 24 horas en una suspensión bacteriana de 107 CFU.mL-1 obtenida tras 14 horas de agitación a temperatura ambiente en medio tripticaseína-soja. Se inocularon 4 plántulas por aislado, realizándose 2 repeticiones. Transcurridas las 24 horas, las plantas se volvieron a plantar en el sustrato, regándose con la suspensión bacteriana sobrante y se cultivaron durante tres semanas en cámara con las mismas condiciones. Los síntomas de la enfermedad se clasificaron según el método de Stankovick et al. (2007). El índice de gravedad de la enfermedad (IGE) se calculó para cada tratamiento como la media de las plantas de cada cultivar. Al final del experimento, las plantas se secaron a 65ºC durante 48 horas y se anotaron los pesos. Los resultados de las pruebas de patogenicidad de las cepas se sometieron a un análisis de la varianza (ANOVA) la comparación de medias se realizó mediante test de rangos múltiples, método de la mínima diferencia significativa (Montgomery, 1991), utilizando el software StatsGraphics Centurion XV.II (Statistical 195 Graphics Corp., Herndon, VA).

Resultados Los análisis microbiológicos mostraron leves diferencias en cuanto a las diferentes especies de bacterias y hongos aisladas en relación a la procedencia de la muestra. En los análisis de la microbiota bacteriana realizados en las muestras de ajos sintomáticas, se aislaron e identificaron principalmente tres géneros de bacterias: Pantoea, Bacillus y Erwinia. Tras aislar los géneros de mayor importancia cuantitativa del inventario bacteriano, se seleccionaron 13 cepas con diferente morfología de colonia y tras realizar cultivos puros, se procedió a su identificación mediante la secuenciación del gen 16S rRNA.

330


Las secuencias del gen 16S rRNA de las cepas E1, E2, Y1 y Y2 mostraron una identidad del 99% con secuencias de varias especies del género Erwinia, concretamente con E. aphidicola, E. persicina y E. rhopantici. En el caso de las cepas X1 y X2, mostraron un 99% de identidad con varias especies del género Bacillus (B. subtilis, B. mojavensis, B. methylotrophicus y B. amyloliquefaciens). Las cepas V1 y V2 también mostraron 99% de identidad con especies del género Bacillus (B. methylotrophicus, B. amyloliquefaciens y B. subtilis). Las cepas Z1 y Z2 mostraron una identidad del 100% con las especies Bacillus subtilis y B. amyloquefaciens y la cepa L2 mostró también una identidad de 99% con diferentes especies de Bacillus (B. mojavensis, B. axarquiensis, B. subtilis y B. tequilensis). Mientras que las cepas W3 y W4, obtuvieron una identidad del 99% con Pantoea agglomerans. Los análisis de patogenicidad realizados con las 13 cepas sobre los dientes sanos, mostraron una baja patogenicidad en la mayoría de los casos. Doce de las 13 cepas inoculadas produjeron podredumbres, si bien únicamente cuatro de ellas (E1, E2, Y1 e Y2) pertenecientes al género Erwinia mostraron un claro halo de avance de la podredumbre en la superficie del ajo inoculado. El diente inoculado con estas cepas mostraba una coloración rosácea reproduciéndose así los síntomas observados en los lotes iniciales. Únicamente las bacterias codificadas como L2 no produjeron síntoma alguno tras su inoculación. El análisis de la varianza del IGE de las raíces (Tabla 1) muestra que uno de los 7 aislados produce índices hasta medio punto superiores al testigo sin inocular (Y1). Sin embargo, hay que tener en cuenta que los índices de podredumbre son, en todos los casos, inferiores a uno, lo que supone menos del 10% de las raíces afectadas en la escala utilizada. Tabla 1. Índice de gravedad de la enfermedad (IGE) observado en plántulas ajo tras la inoculación con diferentes cepas bacterianas. Código del aislado Testigo E1 (Erwinia sp.) E2 (Erwinia sp.) L2 (Bacillus sp.) Y1 (Erwinia sp.) Y2 (Erwinia sp.) Z1 (Bacillus sp.) Z2 (Bacillus sp.) Significación cv. Morado de Cuenca cv. Garpeck cv. Chino blanco Significación Aislado x cv.

IGE 0,29 0,29 0,31 0,49 0,79 0,54 0,35 0,38 ** 0,45 0,32 0,62 *** **

a a a ab c abc a a ab a b

% de reducción de peso del sistema radicular -15,26 0,95 0,00 0,00 3,76 10,32 2,75 *** 5,89 3,75 4,08 NS NS

c a a a a bc ab a a a

Valores (IGE y porcentajes de reducción) seguidos de misma letra no son significativamente diferentes. NS, No significativo. **, *** P≤ 0.01 y 0.001, respectivamente.

El estudio de los pesos del sistema radicular se ha realizado sobre los datos de porcentaje de disminución respecto al testigo, de esta manera podemos comparar cultivares cuyo sistema radicular es a veces muy diferente entre cultivares. Los resultados del análisis del porcentaje de disminución de los pesos del sistema radicular indican que las cepas E1 y Z1 disminuyen entre un 10-15% el peso seco de la raíz de la plántula inoculada. El resto de las cepas no disminuyen significativamente el peso de la raíz al ser inoculadas en plántulas de ajo de dos semanas.

331


Respecto a la susceptibilidad varietal, el análisis realizado con todas las cepas en su conjunto muestra una mayor sensibilidad varietal del ajo Chino blanco, con índice de gravedad de la enfermedad que duplican los observados en los otros dos cultivares analizados (Tabla 1).

Discusión El inventario de microbiota bacteriana realizado sobre bulbos sintomáticos procedentes de las principales regiones productoras españolas ha permitido aislar y caracterizar diferentes géneros bacterianos. Es muy poca la bibliografía disponible al respecto y sorprende la ausencia de géneros asociados anteriormente al cultivo del ajo, como Pseudomonas o Enterobacter (Schwartz and Mohan (2008). Aunque la secuenciación del gen 16S rRNA es utilizado a menudo como método para identificar las especies bacterianas, en realidad su uso es limitado por el alto número de homología entre las secuencias de especies estrechamente relacionadas (Brady et al., 2008). En el caso particular de la familia Enterobacteriaceae, se ha citado que el gen 16S rRNA en diferentes especies puede compartir alta homología, en estos casos, su uso en la taxonomía se limita mucho, sobre todo en especies dentro de un mismo género, debido a la gran similitud de las secuencias (Gehring y Geider, 2012). Esta situación se ha observado con los aislados E1, E2, Y1 e Y2 que muestran la misma identidad para diferentes especies de Erwinia y de la misma forma sucede con los aislados L2, V1, V2, X1, X2, Z1 y Z2 que muestran la misma identidad para distintas especies del grupo Bacillus subtilis. En vista a estos resultados, será necesario realizar posteriores estudios para caracterizar las diferentes cepas mediante otras pruebas y/o secuenciando otros genes como los multilocus sequence typing (MLST) o multilocus sequence analysis (MLSA), que permiten diferenciar entre especies de Erwinia y Pantoea (Gehring y Geider, 2012; Brady et al., 2008; Moretti et al., 2011). En el caso de las especies del género Bacillus, Madhaiyan et al. (2010) son capaces de diferenciar especies muy cercanas (B. methylotrophicus, B. amyloliquefaciens B. subtilis y B. mojavensis entre otras) mediante pruebas bioquímicas. P. agglomerans puede afectar tanto a cebollas como a ajos, causando podredumbres en el tallo y hojas (Schwartz y Mohan, 2008). En cuanto a las especies del género Bacillus, Hwang et al. (2012) cita a B. amyloliquefaciens como el causante de podredumbres bacterianas en cebolla. Por otro lado, varios estudios citan a B. subtilis, B. methylotrophicus y B. mojavensis como agentes de control biológico en fruta de postcosecha como antagonistas de hongos fitopatógenos (Bacon y Hinton, 2000). Las pruebas de patogenicidad sobre diente, han permitido conocer el efecto que pueden tener las bacterias sobre los ajos durante el almacenamiento. En la mayoría de los casos, se ha comprobado que algunas bacterias pueden tener cierta importancia en la podredumbre del ajo. No obstante, ha de estudiarse la interacción entre dichas bacterias y otras patologías y fisiopatías, para determinar si las bacterias pueden actuar sinérgicamente y causar mayor podredumbre en los dientes de ajo durante el almacenamiento. En cambio, las pruebas de patogenicidad en campo (inoculación en plántulas) no parecen indicar que las diferentes especies bacterianas tengan una gran importancia en el desarrollo de las plantas durante el cultivo.

Conclusiones Los análisis realizados sobre bulbos cosechados procedentes de cuatro localidades productoras de ajo, han permitido aislar y caracterizar diferentes géneros bacterianos asociados a la podredumbre de los

332


dientes de ajo durante el almacenamiento de los mismos. Varias de las cepas inoculadas de los géneros Erwinia y Bacillus mostraron cierta patogenicidad al ser inoculados sobre dientes pero muy baja al inocularse sobre plántulas de dos semanas, lo que nos permite especular sobre su posible papel secundario en el desarrollo de podredumbres durante el almacenamiento del ajo, pero permite descartar a los aislados estudiados como una patología de importancia durante el cultivo en campo.

Bibliografía Bacon, C. W. and Hinton, D. M. (2000). Endophytic and biological control potential of Bacillus mojavensis and related species. Biological Control 23, 274-284. Basallote, M. J., Zurera, C., Melero, J. M. y Prados, A. M. (2011). Nueva enfermedad en el cultivo del ajo ocasionada por Fusarium spp. Phytoma España 229, 26-28. Brady, C., Cleenwerck, I., Venter, S., Vancanneyt, M., Swings, J. and Coutinho, T. (2008). Phylogeny and identification of Pantoea species associated with plants, humans and the natural environment based on multilocus sequence analysis (MLSA). Systematic and Applied Microbiology 31, 447–460. Dugan, F. M., Hellier, B. C. and Lupien, S. L. (2007). Pathogenic ungi in garlic seed cloves from the United States and China, and efficacy of fungicides against pathogens in garlic germplasm in Washington State. Journal Phytopathology 155, 437-445. Gehring, I. and Geider, K. (2012). Identification of Erwinia species isolated from apples and pears by differential PCR. Journal of Microbiological Methods 89, 57-62. Hwang, S. K., Back, C. G., Win, N. K., Kim, M. K., Kim, H. D., Kang I. K., Lee, S. C. and Jung, H. Y. (2012). Occurrence of bacterial rot of onion caused by Bacillus amyloliquefaciens in Korea. Journal of General Plant Pathology 78, 227-232. Madhaiyan, M., Poonguzhali, S., Kwon, S. W. and Sa, T. M. (2010). Bacillus methylotrophicus sp. nov., a methanol-utilizing, plant-growth-promoting bacterium isolated from rice rhizosphere soil. International Journal of Systematic and Evolutionary 60, 2490-2495. McCabe, K. M., Zhang, Y-H., Huang, B. L., Wagar, E. A. and McCabe, E. R. B. (1999) Bacterial species identification after DNA amplification with a universal primer pair molecular genetics and metabolism. Molecular Genetics and Metabolism 66, 205–211. Montgomery D.C. (1991). Design and analysis of experiments. John Wiley and Sons Inc. 649 pp. Moretti, C., Hosni, T., Vandemeulebroecke, K., Brady, C., De Vos, P., Buonaurio, R. and Cleenwerck, I. (2011). Erwinia oleae sp. nov., isolated from olive knots caused by Pseudomonas savastanoi pv. savastanoi. International Journal of Systematic and Evolutionary Microbiology 61, 2745–2752. Palmero, D., Gálvez ,L., García, M., Gil, J. and Benito, S. (2013). The effects of storage duration, temperature and cultivar on the severity of garlic clove rot caused by Fusarium proliferatum. Postharvest Biology and Technology 78, 34–39. Querol, A., Barrio, E. and Ramon, D. (1992). A comparative study of different methods of yeast strain characterization. Systematic and Applied Microbiology 21, 315-323. Schwartz, H.F., Mohan S.K. (2008). Compendium of onion and garlic diseases and pests. APS Press. 127 pp. Stankovic, S., Levic, J., Petrovic, T., Logrieco, A. and Moretti, A. (2007). Pathogenicity and mycotoxin production by Fusarium proliferatum isolated from onion and garlic in Serbia. European Journal of Plant Pathology 118, 165-172.

333


                                       ! ""  #    $     $ %  !$" $ ! &'( ( ! ) * +"$"

   ,  ""   "     "    " "   " #   -" "-" )      "   "    " .  " "0     *  " "     #  *)   "       0 *  "      "  .*    "    " "        " 0   $.$" ,       "  *     "$  0  "   1       *"$   .        $      0       3445  

0 " "$      0       6 "  $.$"  6    "$     7       "   "     #   0         $   *       *  $  0  7      "     9(

"   . * "     $.$"          :              "      "            ;*<   0 " .  =* "   "   

   7    # "       $ *        *  $  0 *"$ " 

   "  >>( 9=     &&' 9=               "  !    "0   "   "     "          :*  $?     $$" .*  

     

              ! ""      "         ;     $     

   "  "   "   *    

    ; "      

   *      @     "       $     $ *   $$ " A    " *                 

           *      4

    4   3445 !      $       " $$ "              @         

  ;       "      *  $           

 " !   9( $   "      $$   *      A "   " -"   "       *  

     ! =*     " "

         ""    ; "   $ *      

  *  $   "   $   >>(  9=    &&'  9= 

"           "   "  "

    $           B ?   

  $$    @

334


                                            -         2      -              $   $      3 +34           $      (1 5333*          $      (    *         6    2       $      $   -           $      ( $0   * -             0                 0              !     $                             -       $     .    $       $ $        $ .       %  -   $   $      $          !      $        $ $                    $        2           !      $       $ $      $ $  $   -                             -        $ 0           $               !                2            %   0 7   $  0               ())*  $   $   -   $       ))  0          $      2               -                          $   Â&#x2020;             $0          -               (-  "8 *                      (0   ""/* -  2   $          (     533"9 &    533"* -                       0   $   

                   !   $                  (  

""8*         $                        $0     ,     %                     $0       %  -                           (    53 39 :    53 3*    $        (  Â&#x2020; 533"9    533#* -  $     

335


     &  

  ("" "   1  *     

     " &   

  - "        ,       %    )  " !"  ()!*   ,   )  (,)*  &       ,       3   " &        "    (0..  * (6  5447* -    "     

            &  ))   "   

            (6  * (   54 +* -    &       54   

    +$ 

         

 

  !"

    

      

      

;"  

'         

  "

"    

$%   

     

 

"  $%

"    

& $; &; ' !""  

!""   

    " ($    

   

 "    

- ))      !-                    !-  (9)) : !'  ;< 54 5* -          & ' 

             ( *                        , )  !-     

  "      -            

       

&       (2,*          & " &  '  

  

   (   1 ##5* -    "  &        &  &   &    3  2, "       

 - &           "     (>,* "   &        (   1 ##58 1   ##/*

   54 ?  4    (5* 

336


7  '@8  2;     ,/( 40  "      

  $ "   "  ) , "  #+"     )  ! !. :     )  40  

  $       $   )3   40  )       40 1 

    +"   "" #1    

  $ (" )        40 40 :     )  #1 

                    +"   #1    

  1    

     3     ,50  #- - !$  ! !.      1   )   "               3  "   )  ,: "  8. #      #98% # &  "    ,  $ - 0" ! !.    " )  , A 3 ** A ! !.     )  72&

?   $$ ,)    ! " ! !. - 0& 77  ! -/' @&?  "   "  ,- 1  - $ 4- !.          3        "       "     "    3         

  #6  "       "  $      )      

    ,: "  8). 1 "      "  "        

   



  

    

  

!  

    

)

"  

  "

 



 

           $ BH BH H(Q 

 

    

U

"$    %& &'( )<!>?@

# 

 A 3  ""  ,.  "    6  " ,).

:     6    "   "        40 ) 

     

  $  6    6  "    1         +"    ) 

     6    6  "   

      

*     1 "       )($     40 $"    "   6 $ )   40 $"       "   ,: "  /. 1

 )      40 $    

 ,8 B7&/. %       "     )  )  "  40 $   40 )    ,: "  /). 1 $ )  

      

 )      40 $  " ,8 B7;8. A   $ )  "       " )    

     ,CD77&. :   ")           "       $  =:,888.B2@;< B777//>         "     3  =:,888.B@8 < B778;/>     3  "

337


&  G G      "4 &   G    &     G       & G &      G   @  GG  73 "   225   "  22%    (                74'3 .):99 6 :2235.8   &     &    &     '    )        "    ;229-*     

    0      *5*  -     ;. 2%- &  !, &       

          (         *3%  -    &  !, &        ;*#52-     ;*5%-/    ') ' 32 3)                     !, &   1 59 /- '229 /- )     

  4      ')  ;3**-/ ' 32 3)                !, &   1 .25 /- '22$ /- )    

 

 +

 

2. 39 32 3

2. 3. 32 3

2. * 32 3

25 2* 32 3

25 2. 32 3

25 2 32 3

& +

 

2. 39 32 3

25 9 32 3

2. 3. 32 3

2. * 32 3

25 2* 32 3

25 3 32 3

25 39 32 3

2# 9 32 3

25 2. 32 3

25 2 32 3

          ')    '&)

  ,          /  &       &  32 

     & ((      "        & "        &    

        0           

338


 * $    "     ""  

                 

   5 "         *   "  $  "    9    <$     "     '  5 "  " 9  9   J 1"  @  ! ""      01 ! J1@! J >= = = > 32  ?  !   B "     !  

  "   "    $  $        5     $  "    "     " " 

" "   $

&  !   +" 4    9      &&A      [#[ \#]^_`     {|] 8 @!%   ! 4 K  5) B "  / # @    @ H* >==& C  "  :1  %$ %    ?  " 5    1  F }# # 3 0 28 >3A=L>3AA 8 = = (6) >==&=(= A C11 D #," EF >= > ! %* 3= 866  $66##,")      4  >==' C4  1

   %  8 $    H *   9 F  ~   €]‚  ~ ~  #  [  _[     :     >==& C:   J 9  1

      F }_, _`, `^ƒ_ _  '> 0328 &7 L&A  @   >==A  „   @  H  $ %M  1 B    ; K  ? : ?  !  5 >= = C% "  1 $ 1

  #  N"$   :    :  5 F ۠  _[   [[ IA 0= 28 L (     "  >= 3 CH *  1

 8         @ #$"    %  F $  8  5 $     $       ! ""  #    " ?  ; ! 9 &&> C  4   $ 1  :    4 " 5  04 ""  + $ @ 2F †]_#] []ƒ] [] 7 0I28 (=7L(      5  H  % $ H !  O  >= = C  :       1

  * 5  1    !    " F [_[  0>28 IAL (> 9 ; ! ? ! :   "   B   B" "   ?   &&7 C4 : "   1<  1

  J  "" @ " 5 F ƒ[€ ‚ 7 0 28 >3L>& "-   + 4 K  5) !   H B - "   # @   >==& C 41  :     $ 5  F }# # 3 0I28 73=L7II 8 = = (6) >==A >==  5"   J &A  C5,"  <      "     "F     'A 0 328 33&L3(( 8 = ==76 @=> A==(>     ! ""  J ! ""    $  ]‡ˆ ## ‚ J ! ""    $ >= > 866"= *   "6"66 H""66>= =6>= >6 H"" => ( >= > 0 %* 3= >= >2 :  >=== C1  ! ""  :  #   @""  @ 4 "F _[ ~[‚#‰# A> 0 L328 ='L & 8 = = (6= (7 AA=&0==2==>>= (

339


Uso de la espectroscopía en el infrarrojo cercano (NIRS) para la predicción de compuestos fenólicos en frutos de calabacín M.T. Blanco-Díaz1, M. Del Río-Celestino1, D. Martínez1, J.M. Moreno2, F. Peña2 y R. Font1 1 IFAPA Centro La Mojonera. Consejería de Agricultura, Pesca y Desarrollo Rural. Camino de San Nicolás, 1. 04745. La Mojonera. Almería. 2 IFAPA Centro Alameda del Obispo. Avda. Menéndez Pidal s/n. 14971. Córdoba. e-mail: g32bldim@hotmail.com

Resumen El interés de la industria alimentaria por satisfacer las demandas del consumidor hacia productos sanos, saludables y con alto contenido nutricional, da lugar a un continuo desarrollo de cultivares capaces de adaptarse a las diferentes condiciones ambientales. Tal es el caso del calabacín (Cucurbita pepo spp. pepo) caracterizado por mostrar una gran variabilidad morfotípica y elevados contenidos en compuestos antioxidantes, entre los cuales se incluyen los compuestos fenólicos. En la actualidad, son diversas las técnicas que pueden ser empleadas para cuantificar el contenido en compuestos fenólicos totales (CFT) en hortalizas, tales como la Cromatografía Líquida de Alta Resolución (HPLC) y la Espectrofotometría UV-VIS. Sin embargo, son escasos los trabajos en los que se ha estudiado el potencial de técnicas rápidas y no contaminantes, como la espectrofotometría por reflectancia en el infrarrojo cercano (NIRS) para la cuantificación de estos compuestos en vegetales. Dicha técnica, se caracteriza por ser limpia, no usar reactivos y ahorrar tiempo de análisis. Por estos motivos, su aplicación en la industria alimentaria está incrementándose en los últimos años. El objetivo de este estudio es determinar el potencial de la tecnología NIRS para predecir el CFT de cultivares de calabacín. El estudio se llevó a cabo sobre 499 frutos de calabacín (exocarpo y mesocarpo) pertenecientes a 31 cultivares, en el Centro IFAPA La Mojonera (Almería, España). Las muestras fueron congeladas y liofilizadas y posteriormente molidas. Los espectros NIRS fueron registrados con un equipo NIRS (Foss NIRSystems model 6500), en modo de reflectancia, registrándose los espectros cada 2 nm en el intervalo de 400-2500 nm (región visible e infrarroja). Las ecuaciones de calibración y el tratamiento quimiométrico de los datos se llevó a cabo mediante el empleo de la aplicación WINISI II (v. 1.50 Infrasoft International). Los coeficientes de determinación obtenidos en la validación (r2val) para los CFT fueron 0.76 (mesocarpo) y 0.61 (exocarpo). Estos resultados ponen de manifiesto que es posible utilizar esta técnica analítica para la predicción rápida de CFT en calabacín con suficiente exactitud para propósitos de “screening”, permitiendo de esta forma una reducción del trabajo de laboratorio. Este trabajo ha sido financiado por el Ministerio de Economía y Competitividad (INIA) y por la Unión Europea (Fondos FEDER) en el marco del Proyecto RTA2009-00036-00-00. Palabras clave: polifenoles, NIRS, análisis no destructivo

Use of near-infrared spectroscopy for predicting total phenolic compounds in zucchini fruits Abstract The interest of the food industry to satisfy consumer demands towards natural products, healthy and high nutritional content is the reason for continuous development of new cultivars adapted to different climatic zones. Such is the case of zucchini (Cucurbita pepo spp. pepo) fruits characterized by showing a large morphotype variability and high content in antioxidant compounds, among which polyphenol compounds are included. Nowadays, various techniques can be employed to quantify the content of total phenolic compounds (TPC) in vegetables, such as high performance liquid chromatography (HPLC) and UV-VIS spectrophotometry. However, studies on the potential of rapid and environmental-friendly analytical techniques as nearinfrared spectroscopy (NIRS) for determining TPC are scarce. This technique is characterized to be clean, not to

340


use reagents, and to minimize analysis time. For these reasons, its application in the food industry is increasing in recent years. The objective of this study was to determine the potential of NIRS for predicting TPC in zucchini cultivars. The study was conducted on 499 zucchini fruits (exocarp and mesocarp) belonging to 31 cultivars, at Centre IFAPA La Mojonera (Almería, España). Samples of zucchini fruit were freeze-dried and then ground. NIRS spectra were recorded with an NIRS equipment (Foss NIRSystems model 6500) in reflectance mode, and the spectra recorded every 2 nm in the range of 400-2500 nm (visible and infrared region). Data processing was conducted by using the application WINISI II (v. 1.50 Infrasoft International). The coefficients of determination in validation (r2val) for TPC were 0.76 (mesocarp) and 0.61 (exocarp). These results show that it is possible to use this analytical technique for rapid prediction of TPC in zucchini with sufficient accuracy for screening purposes, thus minimizing the lab input. This work was supported by the Ministry of Economy and Competitiveness (INIA) and the European Union (FEDER Funds) under the Project RTA2009-00036-00-00. Key words: polyphenols, NIRS, non-destructive analysis

Introducción y/o Justificación La caracterización nutricional de frutas y hortalizas es un aspecto de elevada importancia tanto en la industria alimentaria como en programas de mejora genética, donde identificar la variabilidad existente es un objetivo prioritario. El calabacín (Cucurbita pepo ssp. pepo) es una de las principales hortalizas producidas en Europa, especialmente en Almería (España), debido a sus propiedades saludables y organolépticas. Las técnicas llevadas a cabo para la determinación de compuestos fenólicos totales (CFT) son técnicas analíticas que requieren numerosas etapas durante la extracción, las cuales conllevan mucho tiempo. Adicionalmente, en los programas de mejora genética de esta hortaliza se hace necesario el análisis de numerosos frutos para caracterizar el perfil de CFT existente. Durante décadas, la espectroscopia en el infrarrojo cercano (NIRS) se ha empleado como técnica rápida y de bajo coste para el análisis de múltiples componentes en matrices orgánicas. Sin embargo, no existen referencias bibliográficas sobre esta técnica para la cuantificación de CFT en frutos de calabacín, a pesar de su importancia en programas de mejora genética y en la industria alimentaria. En este trabajo, se estudia el potencial de esta técnica para la predicción del CFT en frutos de calabacín.

Material y Métodos Un total de 499 muestras de frutos de calabacín (237 para piel y 262 para pulpa) procedentes de 14 accesiones por el Centro IFAPA La Mojonera (Almería, España) y de 17 variedades comerciales fueron utilizadas en este estudio. Los frutos fueron recogidos durante campañas consecutivas (2009 a 2012).

Material vegetal Tras ser germinadas, las plántulas de calabacín fueron trasplantadas a sacos de perlita (Grodan BV, 6040KD Roermond, NL) ubicados en un invernadero (36º 46' N, 2º 48' O).Para el crecimiento de éstas se siguieron las prácticas culturales locales referentes al riego, control de plagas y enfermedades. Cada variedad estuvo representada por al menos 3 frutos. Aproximadamente 100 g de muestra de calabacín fresco fue liofilizado (Telstar, Terrasa, Spain) hasta conseguir peso constante. Finalmente, las muestras fueron finamente molidas.  Análisis del contenido en fenólicos totales  Los valores de referencias para la determinación de CFT se llevaron a cabo siguiendo el método Folin-Ciocalteu (Sellappan, Akoh y Krewer, 2002) con ligeras modificaciones basadas en el empleo de recta de calibrado con ácido gálico medida a 750 nm usando la espectroscopía UV-Visible (Perkin Elmer). Análisis NIRS  Tras la liofilización, los frutos de calabacín fueron finamente molidos. El registro de espectros NIR se llevó a cabo con un espectrofotómetro (NIRSystems model 6500, Foss NIR Systems, Inc.,

341


Silver Spring, MD, USA) en modo de reflectancia, realizando un barrido desde los 400 a 2500 nm (regiones visible e infrarroja cercana). Los valores de absorbancia (log 1/R, donde R es la reflectancia) fueron registrados en intervalos de 2 nm. Las ecuaciones de calibración para el CFT, tanto en piel como en pulpa, así como el tratamiento quimiométrico de los datos se llevó a cabo mediante el programa informático GLOBAL v. 1,50 (WINISI II, Infrasoft International, LLC, Port Matilda, PA, USA). Las ecuaciones de calibración se llevaron a cabo usando los datos de absorbancia (log ½, donde R es la reflectancia), o derivadas de segundo orden de los datos log 1/R, mediante diferentes combinaciones referentes a tamaño del segmento de derivación y suavizado. Longitudes de onda desde los 400 a 2500 nm cada 8 nm fueron empleadas para el desarrollo de las ecuaciones de calibración. El análisis mediante regresión parcial (MPLS) fue el empleado para correlacionar los datos espectrales con la información de CFT de las muestras. La validación cruzada fue usada para determinar el número óptimo de términos a usar en la ecuación (Shenk y Westerhaus, 1991), y determinar el error de la predicción (SECV) mostrado por las diferentes ecuaciones desarrolladas. El método de validación cruzada fue también empleado para identificar aquellas muestras ‘outliers’ mediante el valor químico (t) o espectral (H). Las muestras ‘t outliers’ son muestras que tienen una relación entre su valor de referencia y el valor espectral que difieren del valor de otras muestras de la población (valores de t > 2,5). Un valor identificado como H outlier significa que una muestra es espectralmente diferente al resto de las muestras de la población, por esto el valor de H debe ser de forma estándar < 3,0.

Resultados y Discusión La Tabla 1 muestra la composición en CFT de las muestras empleadas para el estudio. Tanto la media como la desviación estándar (DE) para el CFT fue similar para exocarpo y mesocarpo. El rango de CFT fue similar tanto para el exocarpo como para el mesocarpo, los cuales mostraron contenidos desde 1,34 a 7,11 mg/ g PS y de 0,97 a 8,29 mg/ g PS, respectivamente. Tabla 1. Estadística descriptiva para el contendido en compuestos fenólicos en calabacín mg/g PS. Tejido n Media D.E. Min Max 122 3,97 1,34 8,29 Exocarpo 0,97 150 3,54 1,37 1,34 7,11 Mesocarpo D.E.: desviación estándar; Min.: valor mínimo; Max.: valor máximo

Éstos resultados fueron similares a los obtenidos previamente en calabaza (Oloyede et al., 2012). Sin embargo, otros autores encontraron valores en CFT ligeramente mayores en otros frutos perteneciente a la familia Cucurbitaceae (Mongkolsilp et al., 2004). La distribución en el CFT para ambos tejidos de calabacín (exocarpo y mesocarpo) se indican en la Figura 1. Tal y como se puede observar, la distribución en el CFT en mesocarpo sigue una distribución geométrica más rectangular, motivo por el cual se han obtenido mejores resultados de predicción que en exocarpo.

342


Exocarpo

Mesocarpo 28

24

24

Número de muestras

Número de muestras

20

16

12

8

4

0

20

16

12

8

4

0 0,75

0,75 1,50 2,25 3,00 3,75 4,50 5,25 6,00 6,75 7,50

CFT (mg/g PS)

1,50

2,25

3,00

3,75

4,50

5,25

6,00

6,75

7,50

CFT (mg/g PS)

Figura 1. Distribución del CFT para mesocarpo y exocarpo en frutos de calabacín.

  Para determinar la capacidad predictiva de las ecuaciones se consideró aquella que poseía el mayor coeficiente de validación cruzada (r2val) y el mayor ratio entre la DE y SECV, definido como RPD (Williams, 1987).   La Tabla 2 muestra la capacidad predictiva de las ecuaciones desarrolladas para CFT para exocarpo y mesocarpo en frutos de calabacín. En base a estos estadísticos, la predicción de CFT en el mesocarpo y exocarpo fue superior en base a la segunda derivada espectral (2,10,5,1). Tabla 2. Estadísticos de calibración y validación para el CFT con el mejor tratamiento matemático en exocarpo y mesocarpo de frutos de calabacín mediante el empleo de regresión MPLS Tejido

Tratamiento matemático

Calibración R2cal

SEC

Validación cruzada r2val

SECV

RPD

2,10,5,1 0,72 0,70 0,61 0,83 1,60 Exocarpo 2,10,5,1 0,83 0,56 0,76 0,66 2,07 Mesocarpo R2cal: coeficiente de determinación en calibración; SEC: error estándar de calibración; r2val: coeficiente de determinación de validación cruzada; SECV: error estándar de validación cruzada; RPD: ratio entre SD y SECV.

La predicción de CFT en el mesocarpo del fruto de calabacín mostró un r2val de 0,76 y un RPD de 2,07, mientras que en el exocarpo se obtuvo un r2val de 0,61 y un RPD de 1,60, tal y como se muestra en los diagramas de dispersión de la Figura 2.

343


Exocarpo

7

6

CFT (Predicho)

6

CFT (Predicho)

Mesocarpo

7

5

4

3

5

4

3

2 2

1 1 0

1

2

3

4

CFT (Referencia)

5

6

7

8

1

2

3

4

5

6

7

8

CFT (Referencia)

Figura 2. Valores predichos por NIRS vs. valores obtenidos en laboratorio para el CFT (mg/g PS) en frutos de calabacín (excocarpo y mesocarpo).

Según los valores de RPD obtenidos para ambas matrices, estas ecuaciones son útiles para propósitos de muestreo, siguiendo las recomendaciones propuestas por Williams y Sobering (1996), que establecieron diferentes grupos en función del valor del ratio: valores de RPD menores a 1,5 son considerados como no útiles, valores comprendidos entre 1,5-2,0 pueden ser empleados para predicciones aproximadas, aquellos entre 2,0-2,5 permiten desarrollar predicciones cuantitativas, mientras que valores mayores de 3,0 pueden ser considerados para hacer buenas y excelentes modelos predictivos. El histograma de cada una de las poblaciones se presenta en la figura En base a estas consideraciones, en nuestro estudio, estos ratios confirman que el desarrollo de modelos Vis/NIRS pueden ser válidos para desarrollar ecuaciones cuantitativas capaces de predecir valores aproximados de CFT en mesocarpo (RPD: 2,07) y exocarpo (RPD: 1,60). Los valores obtenidos de RPD para la predicción de CFT en mesocarpo de calabacín fueron similares a los desarrollados en estudios con arándanos (RPD: 2,05) (Sinelli et al., 2008). Por otra parte, y teniendo en cuenta los valores de r2val para el CFT en mesocarpo, las ecuaciones obtenidas mostraron buena precisión (r2val = 0,76) y una adecuada separación entre valores bajos, medios y altos en muestras de exocarpo de calabacín (Shenk y Westerhaus, 1996).

Conclusiones La tecnología NIRS es una técnica altamente empleada para la determinación de parámetros de calidad en productos vegetales. En este trabajo se ha puesto de manifiesto el potencial de la tecnología NIRS para la predicción rápida del contenido en fenólicos totales en frutos de calabacín. Las ecuaciones obtenidas para la predicción del CFT en el mesocarpo del calabacín mostraron una buena precisión. Para el exocarpo, los valores de RPD son cercanos a los establecidos como límite por Williams y Sobering (1996), si bien el r2val mostrado en la calibración cruzada define a la tecnología NIRS como apta para una buena correcta separación entre muestras con contenido alto, medio y bajo contenido en CFT. Por este motivo, la tecnología NIRS puede ser empleada en programas de mejora genética y en control rutinario de la industria alimentaria con la finalidad de reducir el trabajo de laboratorio. Una vez sean seleccionadas las muestras cuyo contenido en CFT sea de interés, se procedería a analizar las mismas mediante las técnicas de laboratorio convencionales.

344


Agradecimientos Este trabajo ha sido financiado por el Proyecto RTA2009-00036-00-00 (INIA) y Fondos FEDER. M.T. Blanco-Díaz agradece la financiación por el Ministerio de Ciencia e Innovación a través del Programa Formación de Personal Investigador, FPI-INIA.

Bibliografía Mongkolsilp, S., Pongbupakit, I., Sae-Lee, N., and Sitthithaworn, W. (2004). Radical scavenging activity and total phenolic content of medicinal plants used in primary health care SWU. Journal of Pharmaceutical Sciences 9, No. 1, November. Oloyede, F.M., Agbaje, G.O., Obuotor, E.M., and Obisesan, I.O. (2012). Nutritional and antioxidant profiles of pumpkin (Cucurbita pepo Linn.) immature and mature fruits as influenced by NPK fertilizer. Food Chemistry 135, 460–463. Sellappan, S., Akoh, C.C., and Krewer, G. (2002). Phenolic compounds and antioxidant capacity of Georgiagrown blueberries and blackberries. Journal of Agricultural and Food Chemistry 50, 2432–2438. Shenk, J.S., and Westerhaus, M.O. (1991). Population structuring of near infrared spectra and modified partial least squares regression. Crop Science 31, 1548-1555. Shenk, J.S., and Westerhaus, M.O. (1996). Calibration the ISI way. In: Near Infrared Reflectance Spectroscopy. The Future Waves, Davies, A.M.C. and Williams, Ph. (eds). NIR Publications, Chichester, UK, 198202. Sinelli, N., Spinardi, A., Di Egidio, V., Mignani, I., and Casiraghi, E. (2008). Evaluation of quality and nutraceutical content of blueberries (Vaccinium corymbosum L.) by near and mid-infrared spectroscopy. Postharvest Biology and Technology 50, 31–36. Williams, P.C. (1987). Variables affecting near-infrarred reflectance scpectroscopy analysis. In: Agricultural in Near Infrared Technology and Food Industries. AACC Inc., St. Paul, MN, 145–169. Williams, P.C., and Sobering, D.C. (1996). How do we do it: a brief summary of the methods we use in developing near infrared calibrations. In: Near Infrared Spectroscopy: The Future Waves; Davies, A.M.C., Williams, P.C., (Eds).; Nir Publications: Chichester, U.K, 185-188.

345


Estudio de la podredumbre del cormo de azafrán (Crocus sativus L.) en Castilla La-Mancha y especificidad parasitaria del agente causal L. Gálvez1, C. Abato1, M. García-Díaz2, S. Benito1, L. Gómez-Gómez3, O. Ahrazem3 y D. Palmero1. 1

Universidad Politécnica de Madrid, E.U.I.T. Agrícola, Avda. Puerta de Hierro, 4 (28040) Madrid e-mail: daniel.palmero@upm.es. 2 Plant Genetic Resources Center. INIA, Autovía de Aragón Km 36, (28800) Alcalá de Henares. 3 Universidad de Castilla La-Mancha. Instituto Botánico. Campus Universitario s/n (02071) Albacete.

Resumen El azafrán (Crocus sativus L.) es una especie ampliamente conocida a nivel mundial y con gran valor económico. La sanidad de sus cormos es de vital importancia ya que se multiplica vegetativamente. En la pasada campaña, en los términos de Minaya y Tarazona (Albacete) en Castilla La-Mancha se observaron más del 80% de los cormos afectados por podredumbres. El artículo presenta resultados de los análisis microbiológicos para aislar al agente causante de la podredumbre. Posteriormente se realizaron inoculaciones sobre plantas de azafrán y otros cultivos de iridáceas, para comprobar la patogenicidad de los aislados. Los análisis microbiológicos realizados en estos cormos han permitido aislar de forma consistente a la especie Fusarium oxysporum. Las pruebas de patogenicidad realizadas sobre cormos sanos de azafrán han permitido reproducir los síntomas de podredumbre observados en las muestras iniciales, reaislándose posteriormente el patógeno. Debido a la existencia de diferentes formas especiales de F. oxysporum que pueden afectar al azafrán (f. sp. croci, f. sp. gladioli y f. sp. iridacearum) se han realizado inoculaciones sobre diferentes especies cercanas al azafrán como son los gladiolos, crocus ornamentales y narcisos. Los resultados de estas inoculaciones han permitido confirmar la patogenicidad sobre los diferentes genotipos inoculados y discutir la especificidad parasitaria del agente causal de la podredumbre del azafrán. Las pruebas de inoculación mostraron algunas variaciones interespecíficas y diferencias en la patogenicidad entre los aislados. Palabras clave: Fusarium oxysporum, formas especiales, croci, gladioli, iridacearum.

Study of the etiology of corm rot of saffron (Crocus sativus L.) in Castilla La-Mancha (Spain) and parasitic specificity of the causative agent Abstract Crocus sativus L. is a worldwide specie cultivated for its economic value. The health of their corms is critical because the specie is multiplied through them. Last year over 80% of the corms were affected by rot in the terms of Minaya and Tarazona in the area of Albacete in Castilla La-Mancha. For this, microbiological test were carried out for isolation of the causative agent of corms rot and subsequently inoculations were performed on seedlings of saffron and other Iridiaceous crops to check pathogenicity of the isolates. Microbiological test carried out in these corms have consistently led to the isolation of the specie Fusarium oxysporum. Pathogenicity tests conducted on healthy corms of saffron have allowed to reproduce rot symptoms observed in the initial samples, re-isolating later the pathogen. Due to the existence of different special forms of F. oxysporum that can affect saffron (f. sp. croci, f. sp. gladioli and f. sp. iridacearum) inoculations were made on different species close to saffron such as gladiolus, daffodils and ornamental crocus. The results of these inoculations have confirmed the pathogenicity of different genotypes inoculated and discuss the specific parasitic ability of the causal agent of saffron rot. Inoculation tests showed some interspecific variations and differences in pathogenicity between isolates. Keywords: Fusarium oxysporum, special forms, croci, gladioli, iridacearum

346


Introducción La especie Crocus sativus L. se cultiva por sus estigmas de color rojo, que una vez secos constituyen la especia tan valiosa conocida en el nombre de azafrán. Este condimento es reconocido a nivel mundial por sus propiedades culinarias. El azafrán es estéril, de manera que se propaga vegetativamente cada año por medio de sus cormos. La producción de este cultivo depende en gran medida de la sanidad de estos cormos, ya que pueden servir como fuente de inóculo de enfermedades para las siguientes campañas. España siempre ha sido un referente de este cultivo, sin embargo, desde hace décadas la superficie de este cultivo ha sufrido una drástica reducción. Según los últimos datos disponibles por el MAGRAMA (2011), la superficie actual de este cultivo es de 165 ha (con un rendimiento total es de 2.332 Kg). Dentro del territorio español, destaca la importancia de este cultivo en Castilla La-Mancha donde el 94% de la superficie total se concentra en esta comunidad, mayoritariamente en la provincia Albacete. Se han citado diversas enfermedades fúngicas que pueden afectar al azafrán, entre ellas destacan las que afectan a la podredumbre del cormo. Varias especies de Penicillium conocidas como las causantes de la podredumbre azul se han citado en Italia, Japón, Escocia y España, afectando predominantemente durante el almacenamiento. Rhizoctonia ocasiona graves pérdidas en Francia y Sclerotium rolfsii se ha citado recientemente en la India, causando podredumbre de los cormos (Ahrazem et al. 2010). Sin embargo, en la podredumbre del cormo, el patógeno más frecuentemente citado ha sido Fusarium oxysporum. F. oxysporum ha sido objeto de una considerable atención por parte de los fitopatólogos en los últimos 80 años. La razón es su especial habilidad parasitaria al causar traqueomicosis o enfermedades vasculares. Esta habilidad, junto con la capacidad de muchos de los aislados de producir podredumbres radiculares, convierte a esta especie en uno de los patógenos vegetales más importantes a nivel mundial. A pesar del amplio rango de hospedantes a los que afecta, la especificidad parasitaria de los aislados puede llegar a ser mucho más específica. Aislados con el mismo (o similar) rango de hospedantes se asignan a una misma forma especial. De esta manera hay descritas en la bibliografía especializada más de 70 formas especiales. En muchos casos su actividad patogénica se ve circunscrita a unas pocas especies vegetales. Por ejemplo, F. oxysporum f. sp. lycopersici causa fusariosis vascular en tomate, y afecta exclusivamente a esta especie vegetal por lo que no causaría enfermedad en especies cercanas como el pimiento o la berenjena. Sin embargo morfológicamente todos los aislados de F. oxysporum son indistinguibles entre sí, siendo su habilidad patógena lo que los diferencia. En otros casos algunas formas especiales tienen un rango más amplio de hospedantes, así F. oxysporum f. sp. radicis-lycopersici puede, al menos en estudios realizados en invernadero, causar enfermedad en familias diferentes a la del tomate (Kistler, 1997). La podredumbre del cormo causada por Fusarium oxysporum f. sp. gladioli (F. o. gladioli) es la enfermedad más destructiva del azafrán, y ha sido citada como patógeno en Crocus y otros cultivos de la Familia Iridaceae (Gladiolus, Iris, Freesia e Ixia), llegando a causar graves pérdidas en Italia (Cappelli, 1994; Roebroek, 2000). Los síntomas de esta enfermedad pueden referirse a podredumbres húmedas, podredumbres pardas o podredumbres basales. Los síntomas ocurren fundamentalmente durante la floración donde posteriormente se muestran marchitamientos, amarilleamientos y podredumbre de raíces y cormos. El objetivo de este trabajo es identificar el agente causal de la podredumbre del azafrán y conocer la patogenicidad diferencial de los aislados de F. oxysporum sobre otros cultivos de iridáceas realizándose para ello inoculaciones sobre plantas de azafrán, crocus ornamental, gladiolo y narciso.

Material y Métodos En la campaña 2011, agricultores de los términos de Minaya y Tarazona de la zona de Albacete en Castilla La-Mancha (España) se mostraron preocupados por la pérdida de producción de flores y

347


estigmas en sus explotaciones de azafrán, donde más del 80% de los cormos estaban afectados por podredumbres. La sintomatología consistía en una podredumbre de los cormos que, en un inicio era de consistencia blanda, pero que avanzaba y terminaba por pudrir por completo el cormo tomando éste una coloración oscura y finalmente secándose. Varios fragmentos de cormos sintomáticos fueron desinfectados superficialmente y sembrados en diferentes medios de cultivos: medio general (PDA), medio selectivo para Fusarium (Komada, 1975) y medio King B para bacterias. Después de 5 días de incubación a 25 ºC, las colonias fueron examinadas visualmente y al microscopio para observar las características morfológicas de los aislados. Se realizaron cultivos monospóricos de los diferentes aislados para comprobar su patogenicidad mediante pruebas de inoculación. En las pruebas de patogenicidad, se utilizaron cormos sanos de azafrán, crocus ornamentales (Crocus vernus cv. Pickwick y cv. Jeanne d´Arc), narciso (Narcissus sp.) y gladiolos (Gladioulus x grandiflorus cv. Peter Pears y Gladiolus x hortulanus cv. White Friendship). Los cormos fueron previamente desinfectados con hipoclorito sódico al 5% durante 15 minutos, seguido de tres lavados con agua estéril. Se realizaron 2 repeticiones de 3 plantas para cada combinación aislado x cultivar (o especie). Los cormos fueron plantados en sustrato estéril y se mantuvieron durante 3 semanas con temperatura y luz controlada (12 h/12 h luz/oscuridad; 25/21ºC). Se seleccionaron siete aislados de F. oxysporum de los cormos analizados y un aislado de F. oxysporum f. sp, gladioli cedido por el Dr. Woodward (Universidad de Aberdeen, Escocia) que sirvió como control positivo en la inoculación. El inóculo consistió en una suspensión de conidios obtenida durante una semana en medio patataglucosa en agitación a 150 rpm. Para eliminar el micelio, la suspensión se filtró con doble capa de muselina quedando de esta forma sólo una suspensión de conidios. La suspensión de conidios se ajustó a 107 conidia.mL-1 y se utilizó para la inoculación del material vegetal. Las raíces de las plantas se sumergieron durante 24 h en la suspensión de conidios y posteriormente se trasplantaron de nuevo y se mantuvieron en las mismas condiciones de temperatura y luz durante 3 semanas. Tras el trasplante, el inóculo (200mL de suspensión) se utilizó para regar las plantas. Tras tres semanas, las plantas se levantaron y se evaluó la sintomatología de las raíces. Según la sintomatología observada se definió una escala en seis clases: 0 = sin síntomas de podredumbre en las raíces; 1 = < 20% de raíces con podredumbre; 2 = 21–40% de raíces con podredumbre; 3 = 41-60% de raíces con podredumbre; 4 = 61-80% de raíces con podredumbre; 5 = 81-99% de raíces con podredumbre; 6 = 100% de raíces con podredumbre. Se calculo el índice de gravedad de la enfermedad (IGE) para planta de cada cultivar o especie. El análisis de la varianza (ANOVA) se realizó sobre los datos del IGE para determinar los efectos del aislado y del cultivar. Para las comparaciones de los aislados según su huésped se utilizó la prueba de rangos múltiples de Duncan (P<0.05) mediante el programa StatsGraphics Centurion XV.II (Statistical 195 Graphics Corp., Herndon, VA). Los datos de los experimentos fueron analizados según el modelo lineal Υijk = μ + αI + βj + (αβ)ij +τk + εijk donde Υijk es la observación ijk, μ es la media de la variable en cuestión (IGE o peso), αi es el efecto del aislado correspondiente, βj es el efecto del cultivar (en los análisis con gladiolo y crocus ornamental), (αβ)ij es el efecto de la interacción aislado x cultivar, τk es el efecto del bloque experimental, y εijk es el error experimental.

Resultados En los análisis microbiológicos realizados en el laboratorio de la Unidad de Protección Vegetal de la E.U.I.T. Agrícola con los diferentes cormos con síntomas de podredumbre se aisló de forma consistente colonias de la especie F. oxysporum, apareciendo de forma aislada Penicillium spp. La identificación de la especie F. oxysporum se realizó siguiendo los criterios descritos por Leslie and Summerell (2006). El micelio de los aislados de Fusarium procedentes de cormos de azafrán sintomáticos en medio de cultivo PDA era abundante y de color blanco violáceo. En cultivos de una semana F. oxysporum produce un pigmento violeta pálido a oscuro en el agar. Los macroconidios se producen de forma abundante en su parte central sobre esporodoquios y son de longitud media ligeramente curvados y con pared delgada. La célula apical es curvada y presenta una ligera forma de

348


gancho. La célula basal es talonada y el número de septos medio es de tres. Los microconidios son ovales o ligeramente elípticos y unicelulares y se forman sobre cortos conidióforos sin ramificar (monofiálidas) en las denominadas “falsas cabezas” que son agrupaciones de microconidios. Las clamidosporas se forman abundantemente en medio pobre en nutrientes (Agar-KCl) en dos semanas, individuales o en pequeños grupos. Transcurridas tres semanas desde la inoculación, las plantas se examinaron visualmente anotándose los amarilleamientos y marchiteces observadas. Posteriormente los cormos fueron desenterrados para evaluar las lesiones superficiales y las podredumbres internas. Las plantas pertenecientes a los controles sin inocular fueron sumergidas en caldo de patata-dextrosa y no mostraron síntoma alguno tras el periodo de cultivo. Los ensayos realizados con plantas de azafrán, gladiolo, narciso y crocus ornamental mostraron la capacidad patógena de los aislados de F. oxysporum sobre todos los cultivos. Tras la inoculación, los aislados inducieron la aparición de la sintomatología típica de marchiteces causadas por F. oxysporum y fueron por tanto identificados como F. o. gladioli. Los aislados analizados causan mayores índices de gravedad de la enfermedad (IGE) en azafrán y en crocus ornamentales, que en gladiolo y narciso (Tabla 1). Tabla 1. Análisis de la varianza entre los Índices de Gravedad de la Enfermedad evaluados tras la inoculación sobre cuatro especies con aislados de F. oxysporum procedentes de azafranes sintomáticos Especies inoculadas Azafrán Gladiolo Narciso Crocus ornamental Significación Aislado x Especie

IGE 5,54 c 2,67 a 2,19 a 4,07 b *** ***

Valores seguidos de misma letra no son significativamente diferentes. NS, No significativo. *, **, *** P≤0.05, 0.01, y 0.001, respectivamente.

En azafrán todos los aislados evaluados producían índices significativamente superiores a los de los controles sin inocular (p<0.001). Los IGE provocados tras la inoculación con todos los aislados evaluados fueron también siempre significativamente superiores a los producidos tras la inoculación con el aislado de F. oxysporum f. sp. gladioli (Tabla 2). Tabla 2. Índices de Gravedad de la Enfermedad (IGE) en el azafrán, gladiolo, narciso y crocus ornamental después de la inoculación artificial con aislamientos de F. oxysporum procedentes de azafran Código del aislado Control Ox2 Ox3 Ox4 Ox6 Ox7 Ox8 Ox10 F.O. gladioli Significación

Azafrán

Gladiolo

Narciso

3,17 a 5,84 b 6,00 b 5,67 b 5,84 b 5,84 b 6,00 b 6,00 b 3,00 a ***

1,50 ab 1,17 a 4,92 d 1,33 a 4,42 d 2,83 c 2,50 bc 2,67 c 1,25 a *** 1:Peter Pears; 2:White Friendship 2,88 a 2,79 a NS **

0,75 ab 0,75 ab 3,50 cd 0,25 a 5,00 d 2,25 bc 2,50 c 2,50 c 5,00 d ***

Cultivar Cv1 Cv2 Significación Aislado x Cv

NT NT

NT NT

Crocus ornamental 1,13 a 5,00 c 4,67 c 1,58 a 5,00 c 5,17 c 4,92c 5,08 c 2,88 b *** 1: Jeanne d´Arc; 2: Pickwick 4,50 a 4,48 a NS **

Valores seguidos de misma letra no son significativamente diferentes. NS, No significativo. *, **, *** P≤0.05, 0.01, y 0.001, respectivamente

349


A las tres semanas de la inoculación las plántulas de azafrán mostraron claros síntomas de marchitez con raíces podridas de consistencia acuosa que eventualmente se deshacían. En gladiolo, los mayores IGE se observaron tras la inoculación con los aislados Ox3 y Ox6, con índices tres puntos por encima de las plántulas no inoculadas. En general no se han observado diferencias significativas (p>0.05) en lo que a la susceptibilidad respecta entre los dos cultivares de gladiolo utilizados en los ensayos (cv. Peter Pears y cv. White Friendship). En narciso, cuatro aislados produjeron podredumbres, aunque con valores muy inferiores en la escala a aquellos observados tras la inoculación en azafrán. El aislado de F. oxysporum f. sp. gladioli (utilizado como control possitvo) afectó gravemente a las plántulas inoculadas. Seis de los siete aislados procedentes de azafranes con síntomas de podredumbre causaron enfermedad tras inocularse en las dos cultivares de cormos ornamentales (Tabla 2). Los índices de podredumbre registrados variaron entre 4.5 y 5, el equivalente a prácticamente la totalidad del sistema radicular podrido.

Discusión Los resultados experimentales han permitido comprobar la patogenicidad de los aislados de F. oxysporum sobre plantas de azafrán, reproduciendo los mismos síntomas y reaislándose de nuevo al mismo patógeno. Dichos resultados permiten afirmar que F. oxyporum es el agente causal de la podredumbre de los cormos coincidiendo con el trabajo realizado por Di Primo et al. (2002) quienes citan a F. oxysporum como el causante de la podredumbre de los cormos de azafrán en Italia. Estos autores consideran, al igual que en el presente trabajo, que el agente causal se trata de F. oxysporum f. sp. gladioli por reproducir los síntomas de podredumbre en cormos de azafrán. Además, los resultados de este trabajo muestran la patogenicidad de los aislados de F. oxysporum procedentes de cormos de azafrán sobre diferentes especies (gladiolo, narciso y crocus ornamental), observándose cierto grado de patogenicidad sobre todas las especies. Roebroeck (2000) comprobó la patogenicidad de F. oxysporum sobre Crocus y otros cultivos, como Gladiolus, Iris y Freesia. Estos resultados indicaron la presencia de diez patotipos diferentes según la virulencia en los diferentes huéspedes. En cuanto a la patogenicidad en crocus, el autor cita la existencia de aislados que sólo afectan a crocus y les considera F. oxysporum f. sp. croci, mientras que existen otros aislados que considera F. oxysporum f. sp. gladioli porque son patógenos sobre otras especies iridáceas. El investigador indica que, aunque fueron patógenos en gladiolo, también mostraron cierta patogenicidad en otros cultivos de iridáceas, proponiendo que todos estos aislados sean considerados dentro de una nueva forma especial denominada F. oxysporum f. sp. iridacearum. En este sentido, nuestros resultados coinciden con lo expuesto anteriormente por Roebroeck (2000), quien cita diferentes razas para poder diferenciar aislados, de manera que aquellos aislados patógenos solo en crocus les consideraba raza 3 mientras que los que lo fueron también en otras especies de iridiáceas les consideró raza 4. De seguir este criterio los aislados españoles utilizados en este estudio serían considerados como F. oxysporum f. sp iridiacearum raza 3 (aislados Ox2, Ox7, Ox8, y Ox10) y raza 4 (Ox 3 y Ox6). Hasta la fecha, la podredumbre basal del narciso ha sido citada por F. oxysporum f. sp. narcissi, por lo tanto ésta sería la primera vez que se cita a F. oxyporum f. sp. gladioli como el agente causal de la podredumbre basal del narciso. En cuanto a la inoculación realizada en los dos cultivares de gladiolo (Peter Pears y White Friendship) los resultados indican que no existen diferencias significativas en cuanto a susceptibilidad varietal. Roebroeck y Mes (1992) describen que existen dos razas diferentes de F. oxysporum f. sp. gladioli en cuanto a la patogenicidad diferencial en cultivares de gladiolo. F.o. gladioli raza 1 es capaz de infectar cultivares de flores grandes y cultivares de flores pequeñas, mientras que la raza 2 sólo es capaz de infectar a los cultivares de flores grandes. En base a estos datos, Haant et al. (2000) inoculan aislados de F.o. gladioli en los cvs. Peter Pears y Nymph para diferenciar las dos razas. Según estos resultados citados por Haant et al. (2000) y Roebroeck y Mes (1992) los aislados Ox3, Ox6, Ox7 y Ox8 pueden

350


considerarse F.o. gladioli raza 1 (ya que infecta a cultivares de flores grandes), mientras que los otros aislados Ox2, Ox4 y gladioli tendrían que ser inoculados en un cv. de flor pequeña de gladiolo para descartarse su patogenicidad. Así mismo, en otro estudio realizado por Baayen et al. (1998) cita que F.o. gladioli también puede afectar a Ixia, además de Gladiolus e Iris. Los resultados obtenidos en el presente trabajo muestran los efectos de la inoculación con siete aislados diferentes en cuatro especies vegetales y proporcionan información novedosa sobre los aspectos epidemiológicos de F. oxysporum aislados de cormos de azafrán. No se han encontrado variaciones importantes en la respuesta varietal a la inoculación. En posteriores estudios, una mayor gama de variedades debería ser estudiada para determinar si la selección de diferentes cultivares es una posibilidad para el control de este patógeno.

Conclusiones Los resultados de este trabajo permiten concluir que el patógeno presente en los cormos de azafrán ha sido F. oxysporum y éste puede ocasionar graves pérdidas en el rendimiento de la cosecha. La presencia del patógeno en los cormos junto con la confirmación de la capacidad patógena del mismo, hace necesaria una desinfección previa del material vegetal antes de la plantación. Además, en las parcelas de cultivo en las que se conoce la existencia de dicha enfermedad, tendrá que tenerse en cuenta para llevar a cabo una posible desinfección del terreno de cultivo o elegir la parcela adecuada. La inoculación de aislados de F. oxysporum sobre otras especies ha proporcionado además información adicional sobre la patogenicidad del hongo y su gama de huéspedes. Las pruebas de inoculación mostraron algunas variaciones interespecíficas y diferencias en la patogenicidad entre los aislados. En general, los narcisos y gladiolos mostraron menores índices de gravedad de la enfermedad, mientras que el azafrán cultivado y el crocus ornamental mostraron alta sensibilidad al patógeno.

Bibliografía Abrazem O., Rubio-Moraga A., Castillo-López R., Trapero A. and Gómez-Gómez L. (2010). Crocus sativus pathogens and defence responses. Functional Plant Science and Biotecnology 4, 81-90. Baayen, R. P., Förch, M. G., Waalwijk, C., Bonants, P. J. M., Löffler, H. J. M. and Roebroeck, E. J. A .(1998). Pathogenic, genetic and molecular characterisation of Fusarium oxysporum f.sp. lilii. European Journal of Plant Pathology 104, 887-894. Cappelli, C. (1994) Ocurrence of Fusarium oxysporum f.sp. gladioli on saffron in Italy. Phytopathologia Mediterranea 33, 93-94. Di Primo P., Cappelli C. and Katan T. (2002). Vegetative compatibility grouping of Fusarium oxysporum f. sp. gladioli from saffron. European Journal of Plant Pathology 108, 869-875. Haant L. A. M., Numansen A., Roebroeck E. J. A. and van Doorn J. (2000). PCR detection of Fusarium oxysporum f. sp. gladioli race 1, causal agent of Gladiolus yellows disease, form infected corms. Plant Pathology 49, 89-100. Kistler H. C. (1997). Genetic divertisity in the plant-pathogenis fungus Fusarium oxysporum. Phytopathology 87, 474-479. Komada H. (1975). Development of a selective medium for quantitative isolation of Fusarium oxysporum from natural soil. Review in Plant Protection Research 8, 114-125. Leslie J. F. and Summerell B. A. (2006). The Fusarium Laboratory Manual. Blackwell Publishing. MAGRAMA (Ministerio de Agricultura, Alimentación y Medio Ambiente). Anuario de Estadística 2011. Catálogo de Publicaciones de la Administración General del Estado. Roebroeck, E. J. A. (2000). Fusarium oxysporum from iridaceous crops: Analysis of genetic diversity and host specialisation. Ph.D.thesis, University of Amsterdam, The Netherlands. Roebroeck, E. J. A. and Mes, J. J. (1992). Physiological races and vegetative compatibility groups within Fusarium oxysporum f.sp. gladioli. European Journal of Plant Pathology 98(1), 57–64.

351


Caracterización preliminar de los frutos de ocho clones de Morus sp. E. M. Sánchez-Salcedo, Fca. Hernández, J. J. Martínez Departamento de Producción Vegetal y Microbiología, Escuela Politécnica Superior de Orihuela (Universidad Miguel Hernández). Ctra. de Beniel, Km 3,2. Orihuela (Alicante). España. e-mail: juanjose.martinez@umh.es

Resumen En España, el cultivo de la morera para producir fruto, es de poca importancia. Sin embargo, su importancia en otros países es mucho mayor, así la producción de moras en Turquía fue de 78.000 toneladas en 2005. Varios estudios han sido publicados sobre las características morfológicas y bioquímicas de este fruto en variedades. Los clones estudiados en este trabajo fueron utilizadas inicialmente en el sureste español para alimentar al gusano de seda (Bombyx mori L.). Teniendo en cuenta que los frutos de estos clones de morera presentan buenas características organolépticas y un alto contenido en compuestos bioactivos; el objetivo principal de este trabajo de investigación fue evaluar los principales atributos físico-químicos. Los parámetros que han sido estudiados son: peso y tamaño del fruto, humedad, rendimiento en zumo, pH, sólidos solubles totales, acidez total e índice de madurez, con el fin de obtener más conocimientos sobre el potencial de esta fruta. Se han elegido 8 clones, cuatro de Morus alba (MA1, MA2, MA3 y MA4) y cuatro de Morus nigra (MN1, MN2, MN3 y MN4), que se obtuvieron de la Escuela Politécnica Superior de Orihuela (Universidad Miguel Hernández), en el sureste español, durante los años 2011 y 2012. El peso medio de los frutos osciló entre 2,26 g y 4,15 g, correspondiendo respectivamente a MN2 y MN4. El diámetro del fruto varió entre 12,19 mm (MA4) y 15,64 mm (MA3), la longitud del pedúnculo variaba entre 4,55 mm (MA3) y 6,97 mm (MN4). Los contenidos de humedad oscilaron desde 61,86% (MN3) hasta 78,48% (MN1), el rendimiento de zumo lo hizo de 41,00% (MA4) a 62,00% (MA2). El pH osciló desde 5,95 (MN1) a 7,39 (MN3), los SST de 12.03% (MN1) a 25,77% (MN3), la AT de 0,93% (MN3) a 2,65% (MN1) y el IM desde 46.59 (MN1) hasta 277,62 (MN3). A la vista de estos resultados la variabilidad obtenida es elevada, observándose que los clones MN1 y MN2 son los que presentan frutos más grandes y ácidos, mientras que MN3 y MN4 tienen frutos más dulces y de mayor índice de madurez. Los clones de la especie Morus alba mostraban, en general, un comportamiento intermedio para dichas variables. Palabras clave: moras, morera, peso, acidez.

Preliminary characterization of the fruits of eight clones of Morus sp. Abstract Mulberry commercial cultivation is quite unusual in Spain. However, its cultivation in other countries as Turkey is fairly important (78,000 t of mulberries in 2005). Several studies on fruit morphological and biochemical characterisation of Turkish mulberry cultivars have been published. The clones characterised in this study have been traditionally grown in Southeastern Spain to feed the silkworm (Bombyx mori L.). Since the fruits of these mulberry clones show good organoleptic traits and high contents of bioactive compounds, the objective of this study was to evaluate the physicochemical attributes of mulberry fruit. The parameters evaluated to assess the potential of this fruit were: fruit weight and size, moisture content, juice content, pH, total soluble solids, total acidity and maturity index. The mulberry trees were located in the experimental farm of the Higher Polytechnic School of Orihuela (EPSO, Miguel Hernández Univeristy). Eight clones of Morus alba L. and Morus nigra L. were evaluated (MA1, MA2, MA3, MA4, MN1, MN2, MN3 and MN4). Mulberry fruit were collected during the years 2011 and 2012. The average fruit weight varied between 2.26 g (MN2) and 4.15 g (MN4). Fruit diameters ranged from 12.19 mm (MA4) to 15.64 mm (MA3), and the peduncle length varied from 4.55 mm (MA3) to 6.97 mm (MN4). Fruit

352


moisture contents ranged from 61.86% (MN3) to 78.48% (MN1), and juice contents from 41.00% (MA4) to 62.00% (MA2). Juice pH ranged from 5.95 (MN1) to 7.39 (MN3), and total soluble solids from 12.03% (MN1) to 25.77% (MN3); total acidity fluctuated from 0.93% (MN3) to 2.65% (MN1) and maturity index from 46.59 (MN1) to 277.62 (MN3). The mulberry clones MN1 and MN2 showed the largest and more acid fruits, while the MN3 and MN4 were the sweetest with higher maturity indexes. Morus alba clones generally showed average values for these variables. Keywords: mulberry tree, mulberries, fruit weight, acidity.

Introducción y/o Justificación La morera pertenece al género Morus de la familia Moraceae, es un árbol caducifolio de crecimiento rápido. Hay al menos 100 variedades conocidas. La morera se encuentra desde regiones templadas y subtropicales del hemisferio norte a las zonas tropicales del hemisferio sur y puede crecer en una amplia gama de condiciones climáticas, de suelo y desde el nivel del mar hasta altitudes de 4000 m (Machii, Koyama y Yamanouchi, 2000; Vijayan, 2010). En India y China, la morera se utiliza por su follaje, para alimentar a los gusanos de seda (Bombyx mori L.), y los trabajos realizados en morera se han centrado en mejorar la producción de hoja como follaje (Vijayan et al, 1997). Sin embargo, en la mayoría de países europeos, como Turquía y Grecia, las moreras son cultivadas para la producción de fruta en lugar de follaje (Ercisli y Orhan, 2008). En España, el cultivo de la morera para producir fruto, es de poca importancia. Sin embargo, su importancia en otros países es mucho mayor, por lo que la producción de frutas de mora en 2005 fue de 78.000 toneladas en Turquía (Ercisli y Orhan, 2005) y su cultivo se conoce desde hace más de 400 años (Ercisli y Orhan, 2007). La morera negra, que proviene de Irán, se cultiva por sus frutos en el sur de Europa, el suroeste de Asia, y es la especie más importante en los países mediterráneos (Tutin, 1996). Recientemente, las plantas silvestres comestibles han recibido mucha atención como fuentes de las sustancias biológicamente activas que incluyen antioxidantes, antimutagénicos y anticancerígenos (Dillard y German, 2000). Varios estudios han sido publicados sobre las características morfológicas y bioquímicas de la fruta de la morera en variedades turcas, entre otros, Ercisli y Orhan (2008), Gundogdu et al., (2011). Por otra parte, los clones estudiados en este trabajo preliminar fueron utilizados inicialmente en el sureste español para alimentar al gusano de seda (Bombyx mori L.), pero teniendo en cuenta las características que muestran sus frutos (tamaño, dulzor, acidez, sabor y gusto) se ha tratado de determinar algunas de sus principales características físicas y químicas. Por lo tanto, el objetivo principal de este trabajo fue determinar, por primera vez, los principales atributos físico-químicos de ocho clones de morera cultivadas en el sureste español. Los siguientes parámetros se han considerado para su descripción y caracterización: peso y tamaño del fruto, humedad, rendimiento en zumo, pH, sólidos solubles totales, acidez total e índice de madurez, con el fin de obtener más conocimientos sobre el potencial de esta fruta.

Material y Métodos Recogida y preparación de muestras de frutas de morera Se han elegido 8 clones de morera, cuatro de Morus alba (clones MA1, MA2, MA3 y MA4) y cuatro de Morus nigra (clones MN1, MN2, MN3 y MN4), se obtuvieron en la Escuela Politécnica Superior de Orihuela (Universidad Miguel Hernández) (latitud 38 º 04'08'' N, longitud 0 º 58 '58'' O y 27 m de altitud), en el sureste español durante los años 2011 y 2012. De cada clon se cogían al azar 60 frutos por año. Las muestras de fruta fueron transportadas al laboratorio inmediatamente después de su recogida. No hubo diferencias estadísticas significativas de las diferentes propiedades físico-químicas, entre los datos de los 2 años, por lo tanto, los resultados se presentan de forma conjunta.

353


Características de los frutos Los análisis se realizaron sobre 60 frutos de cada clon, que se dividieron en tres submuestras (cada una compuesta por 20 frutos elegidos al azar). Fueron estudiadas las siguientes características físicas y químicas de los frutos: peso del fruto (PF), expresada en g, diámetro ecuatorial (DE), expresado en mm, longitud del fruto (HF), expresado en mm, longitud de pecíolo (LP), expresado en mm. El diámetro, la longitud del fruto y longitud del pecíolo se midieron con un calibre electrónico marca Mitutoyo (modelo CD-15 DC, Inglaterra, 0,01 mm de precisión). Los pesos de fruto fueron tomados con una balanza (Mettler AJ50, 0,0001 g de precisión). Otras características que se determinaron fueron: rendimiento en zumo (%), usando un extractor eléctrico y una muestra de 100 g, el total de sólidos solubles se determinaron con un refractómetro digital Atago N1 (Atago Co. Ltd., Tokio, Japón) a 20 ° C, y se expresa como un porcentaje (°Brix). El pH y la acidez total valorable (AT) también se determinó por triplicado mediante un dispositivo de titulación automática (877 Titrino plus, Metrohm análisis de iones CH9101, Herisau, Suiza) con 0,1 N NaOH hasta pH 8,1, usando 1 ml de jugo diluido en 25 ml de H2O destilada, y los resultados se expresaron como gramos de ácido cítrico por litro. El índice de madurez (IM) se calculó como la relación entre SST/AT. Todos los resultados se muestran como valores medios ± SE (error estándar).El porcentaje de humedad (%H) se determinó después de ser secado en un horno de aire caliente a 50ºC hasta alcanzar un peso constante.

Tratamiento estadístico de los datos Se realiza en primer lugar una estadística descriptiva básica, seguida posteriormente de un análisis de la varianza. Cuando se obtuvo una F significativa, las medias se separaron por el test de rango múltiple LSD al 5% de nivel de significación.

Resultados y Discusión Características físicas de los frutos El peso, diámetro, longitud del fruto y longitud del pedúnculo de los frutos, así como la humedad y el rendimiento en zumo se muestran en la Tabla 1. El peso de los frutos osciló entre 2,26 g y 4,15 g, correspondientes respectivamente a MN2 y MN4. El diámetro del fruto varía entre 12,19 mm (MA4) y 15,64 mm (MA3), la longitud del pedúnculo variaba entre 4,55 mm (MA3) y 6,97 mm (MN4). Los contenidos de humedad oscilaron entre 61,86% (MN3) hasta 78,48% (MN1), el rendimiento de zumo lo hizo desde 41,00% (MA4) a 62,00% (MA2) (Tabla 1). En general, los clones de Morus nigra y Morus alba mostrados en este trabajo presentan un peso de los frutos inferior al obtenido en otros estudios realizados en Turquía (Ercisli and Orhan, 2007, 2008). La variación del peso de los frutos podría ser debido a que se trata de materiales vegetales diferentes, así como a las distintas condiciones ecológicas y nutricionales en el que se encontraban.

354


Tabla 1. Características físicas de los frutos de 8 clones de morera.

Parámetros Peso del fruto (g) D ecuatorial (mm) Longitud del fruto(mm) Longitud peciolo (mm) Humedad (%) Rend. en zumo (%)

MA1 3,19±0,11 c* 13,25±0,17 b 25,89±0,46 e 5,16±0,22 abc 73,17±0,56 c 55,83±0,44 b

MA2 3,03±0,10 bc 13,30±0,16 b 24,49±0,46 d

MA3 2,8±10,12 b 15,64±0,20 e 20,47±0,47 a

Clones MA4 MN1 2,10±0,06 a 3,49±0,09 d 12,19±0,12 a 13,87±0,13 c 23,18±0,41 c 27,65±0,40 f

MN2 4,15±0,11 e 14,39±0,18 d 30,26±0,35 g

MN3 2,89±0,10 b 14,34±0,17 d 22,55±0,47 bc

MN4 2,26±0,05 a 12,96±0,13 b 21,55±0,30 ab

5,80±0,27 cd

4,55±0,23 a

5,03±0,18 ab

5,68±0,24 bcd

6,09±0,20 d

5,99±0,32 b

6,97±0,30 e

76,45±0,24 d 62,00±0,58 c

76,44±0,36 d 44,03±2,98 a

72,56±0,26 c 41,00±1,53 a

78,48±0,92 d 58,50±0,29 bc

71,01±1,56 c 59,17±0,60 bc

61,86±1,36 a 41,33±1,45 a

66,87±0,11 b 44,67±1,45 a

Valores(media± error estándar) seguidos por la misma letra, dentro de cada fila, no presentan diferencias estadísticamente diferentes para pd0,05

*

Tabla 2. Características químicas de los frutos de 8 clones de morera.

Parámetros pH Sólidos solubles totales (ºBrix) Acidez total (g·L-1) Índice de Madurez

MA1 7,20±0,08 bcd*

MA2 7,05±0,07 bcd

MA3 6,99±0,06 bc

Clones MA4 MN1 7,26±0,09 bcd 5,95±0,10 a

MN2 6,89±0,10 b

MN3 7,39±0,17 d

MN4 7,29±0,23 cd

16,97±0,23 c

15,60±0,36 b

15,07±0,23 b

17,37±0,23 cd

12,03±0,33 a

18,03±0,15 d

25,77±0,09 f

24,07±0,18 e

0,97±0,02 a 175,28±1,73 d

1,17±0,08 a 134,58±9,22 c

1,08±0,01 a 139,30±2,53 c

0,97±0,04 a 179,17±8,43 d

2,65±0,31 c 46,59±4,97 a

1,81±0,09 b 100,43±6,27 b

0,93±0,03 a 277,62±10,99 f

0,94±0,02 a 256,04±4,25 e

Valores(media± error estándar) seguidos por la misma letra, dentro de cada fila, no presentan diferencias estadísticamente diferentes para pd0,05

*

355

325


Características químicas de los frutos El pH, SST (sólidos solubles totales), AT (acidez total) e IM (índice de madurez), se muestran en la Tabla 2. El pH osciló desde 5,95 (MN1) a 7,39 (MN3), los SST de 12.03% (MN1) a 25,77% (MN3), la AT de 0,93% (MN3) a 2,65% (MN1) y el IM desde 46,59 (MN1) hasta 277,62 (MN3). A la vista de estos resultados la variabilidad obtenida es elevada. Los SST, AT, pH e IM de los frutos de M. alba y M. nigra, cultivados en diferentes regiones de Turquía fueron 16,70-20,40%, 0,25-2,00 g·L-1, 3,205,60 y 12,00-81,60, respectivamente (Ercisli y Orhan, 2008; Imran et al, 2010), por lo que algunos de los clones que hemos estudiado tienen valores fuera de los rangos que se muestran en estas obras. La variación del contenido de SST, AT, pH e IM de los frutos podría deberse a que se trata de diferentes especies, variedades, portainjertos, así como a las condiciones ambientales y el estado nutricional de los huertos.

Conclusiones Se observan diferencias morfométricas y químicas en los frutos de Morus nigra y de Morus alba, pero también entre los diferentes clones de cada una de estas especies. Dada la alta variabilidad que presentan los resultados, es interesante profundizar en otras características de estos frutos. El presente estudio es también un paso hacia la normalización de los llamados frutales menores, como potenciales productores de alimentos saludables, que también pueden ser utilizados en las industrias alimentaria y farmacéutica. Este primer estudio preliminar sobre moras de origen español podría ser el punto de partida para futuros trabajos.

Bibliografía Dillard, C.J., German, J.B. (2000). Phytochemicals: nutraceuticals and human health. J. Sci. Food Agric. 80, 1744–1756. Ercisli Sezai, Orhan Emine. (2007). Chemical composition of white (Morus alba), red (Morus rubra) and black (Morus nigra) mulberry fruits. Food Chemistry 103, 1380–1384. Ercisli Sezai, Orhan Emine. (2008).Some physico-chemical characteristics of black mulberry (Morus nigra L.) genotypes from Northeast Anatolia region of Turkey. Scientia Horticulturae 116, 41–46. Ercisli, S., Orhan, E. (2005). Natural mulberry (Morus spp.) production in Erzurum region in Turkey. In Proceedings of the international scientific conference, ‘environmentally friendly fruit growing’ (p. 129– 136). 7–9 September 2005, Tartu – Estonia. Gundogdu, M., Muradoglu, F., Gazioglu Sensoy, R.I., Yilmaz, H. (2011). Determination of fruit chemical properties of Morus nigra L., Morus alba L. and Morus rubra L. by HPLC. Scientia Horticulturae 132, 37–41. Imran Mohammad, Khan Hamayun, Shah Mohibullah, Khan Rasool, Khan Faridullah. (2010). Chemical composition and antioxidant activity of certain Morus species. Biomed & Biotechnol 11(12), 973-980 Machii, H., Koyama, A., Yamanouchi, H., (2000). FAO Electronic Conference: Mulberry for animal production. Available from http://www.fao.org/livestock/agap/frg/mulberry. Tutin, G.T. (1996). Morus L. In: Tutin, G.T., Burges, N.A., Chater, A.O., Edmondson, J.R., Heywood, V.H., Moore, D.M., Valentine, D.H., Walters, S.M., Webb, D.A. (Eds.), Flora Europa, Psilotaceae to Platanaceae, 2nd ed., vol. 1. Cambridge University Press, Australia. Vijayan, K. (2010). The emerging role of genomics tools in mulberry (Morus) genetic improvement. Tree Genet. Genom 6, 613–625. Vijayan, K., Chauhan, S., Das, N. K., Chakraborti, S. P., & Roy, B. N. (1997). Leaf yield component combining abilities in mulberry (Morus spp.). Euphytica 98(1–2), 47–52.

356


Efecto del brasinosteroide de sĂ­ntesis DI-31 sobre la tolerancia a la salinidad de escarolas (Cichorium endivia L.)  !+84'  522   &'6':' ?  358E9



9);+2' 52/:B)4/)' !;6+8/58 *+ 8/.;+2' ¤#4/<+89/*'* /-;+2 +84A4*+@¼ :8' +4/+2 3   

 8/.;+2' 96'D' +Â&#x2014;3'/2 ''35859;3.+9 +4:85 *+ 9:;*/59 *+ 85*;):59 ':;8'2+9 ');2:'* *+ ;C3/)' #4/<+89/*'* *+ 2' '('4' &'6':' ?  $+*'*5 ;(' )6  

Resumen !+ );2:/<'854 62A4:;2'9 *+ +9)'852'9 +4 952;)/E4 4;:8/:/<' J 5'-2'4* ? +4 )A3'8' *+ );2:/<5 ('05 )54*/)/54+9 )54:852'*'9 ;'4*5 2'9 62A4:;2'9 :+4C'4  *C'9 9+ 2+9 6;2<+8/@E )54 +2 '4A25-5 *+ (8'9/459:+85/*+ Â&#x2014;  '  E  ĂŤ ' '62/)')/E4 *+2 '2  3 9+ 8+'2/@E '2 *C' 9/-;/+4:+ );'4*5 9+ ./@5 +4 ;4' 952' '62/)')/E4 5 ;4 :+8)/5 +4 )'*' ;45 *+ 259 :8+9 *C'9 9/-;/+4:+9  259 *C'9 *+ +9:' '62/)')/E4 9+ :53'854 2'9 3;+9:8'9 7;+ 9+ 9+6'8'854 +4 2' 6'8:+ 'B8+' ¤ÂĽ ? 8'*/);2'8 ¤ ÂĽ  )'*' 3;+9:8' 9+ 2+ *+:+83/4E +2 6+95 ,8+9)5 +3/9/E4 *+ +:/2+45 ? )54:+4/*5 +4 2'9 652/'3/4'9 6;:8+9)/4' ¤#"ÂĽ +96+83/*/4' ¤!ÂĽ ? +96+83/4' ¤!ÂĽ )535 3+*/*'9 *+2 +9:8B9 9'2/45 59 8+9;2:'*59 .'4 *+359:8'*5 7;+ 2' 9'2/4/*'* .' */93/4;/*5 +2 6+95 *+ 2'  ? 25 .' /4)8+3+4:'*5 +4 2'   2 Â&#x2014;  45 .' )549+-;/*5 8+<+8:/8 +9:' :+4*+4)/' ' :'9' *+ +3/9/E4 *+ +:/2+45 .' /4)8+3+4:'*5 )54 2' '62/)')/E4 *+ '2 6+85 9E25 .' 9/*5 9/-4/,/)':/<5 );'4*5 +2 :8':'3/+4:5 .' 9/*5 +4 ;4' '62/)')/E4 ? +4 2' 6'8:+ 'B8+' 2 :8':'3/+4:5 )54 Â&#x2014;  45 .' :+4/*5 +,+):5 95(8+ +9:+ 6'8A3+:85 2 )54:+4/*5 +4 #" 9+ .' 3'4:+4/*5 )54 2' 9'2/4/*'* ? +2 Â&#x2014;  .' :+4/*5 ;4 )53658:'3/+4:5 +88A:/)5 59 )54:+4/*59 *+ ! 45 .'4 /4)8+3+4:'*5 4/ +4 2'  4/ +4 2'  ? +2 Â&#x2014;  .' */93/4;/*5 +2 )54:+4/*5 *+ ! +4 2'   2 )54:+4/*5 *+ ! .' /4)8+3+4:'*5 +4 2'  ?  658 +,+):5 9'2/45 ? +2 Â&#x2014;  45 .' )549+-;/*5 8+<+8:/8 +9:+ +,+):5 9E25 +4 2'  ' 2' 3'?58 )54)+4:8')/E4 !+ 6;+*+ )54)2;/8 7;+ +2 Â&#x2014;  ' 2'9 )54)+4:8')/54+9 '62/)'*'9 +4 +9:+ +>6+8/3+4:5 45 .' :+4/*5 ;4 +,+):5 685:+):58 )54:8' 2' 9'2/4/*'* *+ 2'9 62A4:;2'9 *+ +4*/</' 658 25 7;+ *+(+8A4 +49'?'89+ )54)+4:8')/54+9 9;6+8/58+9 '2'(8'9 )2'<+ 8'9/459:+85/*+ Â&#x2014;  9'2/4/*'* +:/2+45 652/'3/4'9 +9)'852'

Effects of a brassinosteroid analogue (DI-31) on salt tolerance of endive Abstract 4*/<+ 9++*2/4-9 =+8+ -85=4 /4 4;:8/+4: 952;:/54 J 5'-2'4* '4* -85=:. ).'3(+8 ;4*+8 )54:8522+* )54*/:/549 %.+4 :.+ 9++*2/4-9 =+8+  *'?9 :.+? =+8+ 968'?+* =/:. Â&#x2014;  ' (8'9/459:+85/*+ '4'25-;+ :5  58  G ".+ '662/)':/54 5,  3 '2 ='9 )54*;):+* :.+ 4+>: *'? =.+4 :.+ '662/)':/54 ='9 3'*+ /4 ' 9/4-2+ '662/)':/54 58 54+ :./8* /4 +'). 5, :.+ 4+>: :.8++ *'?9 ,:+8 *'?9 5, :./9 '662/)':/54 =+ :551 9'362+9 :.': =+8+ 9+6'8':+* /4 :.+ '+8/'2 ¤ÂĽ '4* 855: ¤ ÂĽ 658:/549 4 +'). 9'362+ =+8+ *+:+83/4+* ,8+9. =+/-.: +:.?2+4+ +3/99/54 '4* )54:+4: 5, 652?'3/4+9 6;:8+9)/4+ ¤#"ÂĽ 96+83/*/4+ ¤!ÂĽ '4* 96+83/4+ ¤!ÂĽ '9 3+'9;8+9 5, 9'2: 9:8+99 ".+ 8+9;2:9 9.5=+* :.': 9'2/4/:? *+)8+'9+* =+/-.: /4  '4* /: /4)8+'9+* =+/-.: /4   ".+ Â&#x2014;  .'9 ,'/2+* :5 8+<+89+ :./9 :8+4* ".+ +:.?2+4+ +3/99/54 /4)8+'9+* =/:. :.+ '662/)':/54 5, '2 (;: ='9 9/-4/,/)'4: 542? =.+4 :.+ :8+':3+4: ='9 3'*+ /4 ' 9/4-2+ '662/)':/54 '4* /4 :.+ '+8/'2 658:/54 "8+':3+4: =/:. Â&#x2014;  .'* 45 +,,+): 54 :./9 6'8'3+:+8 ".+ #" )54:+4: ='9 1+6: =/:. 9'2/4/:? '4* Â&#x2014;  9.5=+* '4 +88':/) (+.'</5;8 ".+ )54:+4:9 5, ! .'<+ 45: /4)8+'9+* 54 :.+  58 :.+  '4* Â&#x2014;  *+)8+'9+* :.+ )54:+4: 5, ! /4 :.+   ".+ ! )54:+4: /4)8+'9+* /4 :.+  '4*  (? 9'2: +,,+): '4* Â&#x2014;  9.5=+* 45 8+<+89+ :./9 +,,+): 542? :.+  ': :.+ ./-.+9: )54)+4:8':/54 %+ )54)2;*+ :.': :.+ Â&#x2014;  ': :.+ )54)+4:8':/549 '662/+* /4 :./9 +>6+8/3+4: .'9 45: ' 685:+):/<+ 852+ '-'/49: 9'2/4/:? 54 +4*/<+ 9++*2/4-9 .+4)+ ./-.+8 )54)+4:8':/549 9.5;2* (+ '99'?+*

+?=58*9 8'99/459:+85/* Â&#x2014;  9'2/4/:? +:.?2+4+ 652?'3/4+9 +4*/<+

357


IntroducciĂłn y/o JustificaciĂłn 9= ,<+=389=>/<93./= =98 ?8+ 0+7363+ ./ -97:?/=>9= ;?/ =/ 2+8 /8-98><+.9 /8 >9.9 /6 </389 @/1/>+6 B 2+ =3.9 ./79=><+.+ =? /A3=>/8-3+ /8 -+=3 >9.+= 6+= :+<>/= ./ 6+= :6+8>+= >+6/= -979 :96/8 B/7+= 069<+6/= 0<?>9= =/7366+= -+7,3?7 @+=-?6+< 294+= >+669= B <+F-/= +41?C B </>B8

 =>9= -97:?/=>9= /=>/<93.+6/= :?/./8 +:+</-/< /8 09<7+ 63,</ 9 -984?1+.+ -98 +CI-+</= 9 D-3.9= 1<+=9= +=>+ /6 797/8>9 2+8 =3.9 +3=6+.9= -/<-+ ./ ,<+=389=>/<93./= ./ :6+8>+= +41?C B </>B8

 <+,+49= </+63C+.9= -98 :6+8>+= =?:/<39</= =?13/</8 ;?/ :</=/8>+8 ?8 :+:/6 -<F>3-9 /8 ?8 +7:639 <+819 ./ :<9-/=9= ./6 ./=+<<9669 >+6/= -979 /6 -</-373/8>9 ./ >+669= <+F-/= 383-3+-3H8 069<+6 B /6 ./=+<<9669 ./ 069</= B 0<?>9= '+==/

 9= ,<+=389=>/<93./= >+7,3E8 2+8 =3.9 37:63-+.9= /8 </=:?/=>+= ./ 6+= :6+8>+= + .30/</8>/= >3:9= ./ /=><E= >+8>9 ,3H>3-9= -979 +,3H>3-9= +41?C B +B+>

 979 /6 +3=6+73/8>9 / 3./8>303-+-3H8 ./ 69= ,<+=389=>/<93./= 8+>?<+6/= =98 :<9-/=9= -9=>9=9= 2+8 :<9630/<+.9 69= ><+,+49= ./ =F8>/=3= B /@+6?+-3H8 ./ ,<+=389=>/<93./= =38>E>3-9= 9 =/73=38>E>3-9= ²2<3:+-2 *2+,38=533 B / Â&#x152;<99>

 :+<39= ./ /=>9= +8D6919= ./ ,<+=389=>/<93./= 2+8 =3.9 79=><+.9= =/< I>36/= /8 +1<3-?6>?<+ IG/C #9,+38+ B 966

 '/<8+ /> +6

+ B , 6 9,4/>3@9 ./ /=>/ /=>?.39 2+ =3.9 /=>?.3+< 69= /0/->9= ./ 6+ +:63-+-3H8 ./ ?8 +8D6919 ./ # /6 ÂŹ + 6+= -98-/8><+-398/= ./  B K# :+<+ -98><+<</=>+< 69= /0/->9= ./6 +6

7# =9,</ :6D8>?6+= ./ /=-+<96+=

Material y MÊtodos '/7366+= ./ /=-+<96+ <3C+.+ @+< #98></+6 ./ 6+ -+=+ ./ =/7366+= #}² *) =/ 7+8>?@3/<98 /8 -D7+<+ ./ 1/<738+-3H8 .?<+8>/ .9= .F+= /=:?E= =/ ><+=6+.+<98 + 6+ -D7+<+ ./ -?6>3@9 /8 6+= =31?3/8>/= -98.3-398/= ?8 -3-69 ./ 6?C ./   2 ?8+ >/7:/<+>?<+ ./

 ?8+ 2?7/.+. </6+>3@+ ./    B ?8+ 38>/8=3.+. 6?7389=+ ./ 

K796 7 =  9= :<37/<9= .F+= /=>?@3/<98 -98 +1?+ ./=>36+.+ #9=>/<39<7/8>/ =/ ><+=:6+8>+<98 + </-3:3/8>/= -98 =96?-3H8 8?><3>3@+ 9+16+8. B -98 +3</+-3H8 :/<7+8/8>/ %/ ?>363C+<98 </-3:3/8>/= :+<+ -+.+ ><+>+73/8>9 -98

:6D8>?6+= :9< </-3:3/8>/  69=  .F+= ./=./ /6 ><+=6+.9 + 69= </-3:3/8>/= =/ </+63C+<98 69= ><+>+73/8>9= :<37/<9 -98 /6 ÂŹ B +6 .F+ =31?3/8>/ -98 /6 +6 +:63-+-3H8 ;?/ =/ </+63CH /8 ?8+ 9 /8 ></= +.3-398/= /8 /=>/ -+=9 -98 ?8   ./ 6+ -98-/8><+-3H8 /8 -+.+ ?89 ./ 69= ></= .F+= -98=/-?>3@9= ;?/ .?<H 6+ +:63-+-3H8 /8 ></= +.3-398/= 9= ><+>+73/8>9= </+63C+.9= 0?/<98 69= =31?3/8>/= &  -98><96 &



7# +6 ./ 196:/ & 

7# +6 /8 @/-/= &   K# ÂŹ 

7# +6 ./ 196:/ &  K# ÂŹ 

7# +6 ./ 196:/ &   K# ÂŹ 

7# +6 /8 @/-/= & K# ÂŹ 

7# +6 /8 @/-/=  69= .F+= ./ 6+ +:63-+-3H8 =+638+ =/ >97+<98 6+= 7?/=><+= ;?/ =/ =/:+<+<98 /8 6+ :+<>/ +E</+ # B <+.3-?6+< #$ -9<</=:98.3/8>/  -+.+ 7?/=><+ =/ 6/ ./>/<738H /6 :/=9 0</=-9 /73=3H8 ./ />36/89 B -98>/83.9 /8 6+= :963+738+= :?></=-38+ #'& /=:/<73.38+ %# B /=:/<738+ %## -979 7/.3.+= ./6 /=><E= =+6389 6 />36/89 =/ -?+8>303-H :9< -<97+>91<+0F+ 1+=/9=+ #+<+ /669 6+= # B #$ =/ :/=+<98 B =/ 38><9.?4/<98 38.3@3.?+67/8>/ B :9< =/:+<+.9 /8 ?8 </-3:3/8>/ ./ @3.<39 -/<<+.9 2/<7E>3-+7/8>/ -98 ?8 9<303-39 /8 6+ >+:+./<+ /8 /6 ;?/ =/ :?=9 ?8 =/:>?7 ./ 197+ .98./ :/<7+8/-3/<98 +3=6+.+= .?<+8>/ ?8+ 29<+ +6 -+,9 ./ 6+ -?+6 =/ /A><+4/<98 7?/=><+= ./ ?8 7 ./ 6+ +>7H=0/<+ 1/8/<+.+ /8 /6 38>/<39< ./6 </-3:3/8>/ -98 4/<381+= += 7?/=><+= =/ 38B/->+<98 /8 ?8 -<97+>H1<+09 ./ 1+=/= )&& #²$ 79./69   :<9@3=>9 ./ ./>/->9< ./ 3983C+-3H8 ./ 66+7+ B -96?78+ ./ +-/<9 389A3.+,6/

358


 5 ? ÂŁGG A  5 5 5   5 F5 =  ÂŁ   D D 5D D  55  "" "  >E5 5D D @E  B  D D ? >D5  ÂĄÂŁ   DBD D =5 D 5D   B  * 5@E5 # 5 ? %D 5  ÂĄÂ&#x;ÂĄ "D  5 D 55 D 5D  C C5    DE5 5 5 '%%"1"1# D 

 " D*   5 D5E5 5 D D   D 5  D  D   5 D A D D  @E 5 5ADD D CD 5   H$D "D  I  @5  5 5ADD =5@ D 5 D  1 !&1 ? 5  D 5 F   5    5 C5 D5= $ 5 5 D 5 D 5 D 5  C5   5D D CD 5 D5=D

Resultados y DiscusiĂłn Efecto del DI-31 sobre la pĂŠrdida de peso 5    D  *D = 5 D A5D  D %   D 5 DE5 5= *= 5  A>  D 5 5 =  

Â&#x;, A5 5 D = D5   5  " "5   " D 5E  %    5 D5E5   D  ÂĄ  5 5  D   Â&#x;ÂŁÂŁ A5  5D 5 5  D 5E 5  D =  D D   5

D5E5   5 5  D   ÂĄ A5 DD D55 D D5

  5D D5=D 5 D A5D D5@ D ? D 5 D 55 5 D5

  5D D5=D D A5D D5@ D 5 DC  D5E5   D  "1 D ? 5    5 D5 D  5 5 D E5 5 5  D  5  D 5 D

*     DE D D5E5 DA    5 D  D  (    Â&#x; ? ÂŁ ?     ÂŁ " D  *D = 5   *      D DE 5 5  5   D  D  D5@ D D A5D 5  5 5  D5=  D A5D 5  5 D5@ D  D D D E5  " 5 5 5  5



ÂĄ   D A5D  D 5 D  D E  "  ? 5 ÂĄ  5  5  D A5D  D 5 D  D E  " 5  D =  D  5  5   D  "#  D  *   5  C@ ?    AD 5  D5@E5  *D D @5D  5D D5D   5 5 

 5 5  D B  D  D  "1  5 5 5 55  D  D   5 D #D ? 5 D D  D 1   ÂŁÂŻ D @   

20 18 16 14 12

a

T01 : control. T02 : 100 mM NaCl de golpe. T03 : 100 mM NaCl en 3 veces. T1 : 0.1 ÎźM DI-3 + 100 mM NaCl de golpe. T2 : 1 ÎźM DI-31 + 100 mM NaCl de golpe. T3 : 0.1 ÎźM DI-31 + 100 mM NaCl en 3 veces. T4 : 1 ÎźM DI-31 + 100 mM NaCl en 3 veces.

PARTE AĂ&#x2030;REA

a

abc

a

ab

PARTE RADICULAR

bc b

bc b

bc

c

4

a

d

10

b

bc

3

bc 2

8 6

1

4

Peso Fresco (g/planta)

Peso Fresco (g/planta)

22

2 T01

T02

T03

T1

T2

Tratamientos

T3

T4

T01

T02

T03

T1

T2

T3

T4

Tratamientos

D Â&#x203A; " D  D   B   ? C@ * A5D DD 5 ?  D

359


Efecto del DI-31 sobre síntesis de etileno ,  <       %   <  %    %E    ¤1%    0¥ '  % $         K'    <       % =    ¤$  $ ¥  %   % =     ¤$¥           %E    % E 

    E    % < C       E    E   % =     C   9Â&#x2014;       E      % = 

   %  >              E    E            E              % =      %E   $   E   % =     

Etileno (nl/g.h)

5.0

4.0

PARTE RADICULAR

b

PARTE AĂ&#x2030;REA

c

c abc ab

abc

abc abc

abc ab

abc a

20 18 16

abc

a

14

a

12

3.0

10 8

2.0

Etileno (nl/g.h)

a

6 4

1.0

2 T01

T02

T03

T1

T2

T3

T4

T01

Tratamientos

T02

T03

T1

T2

T3

T4

Tratamientos

( 8 K       % < ¤¥  < ¤$¥        

Efecto del DI-31 sobre la sĂ­ntesis de poliaminas ,   %  ¤E;$ÂĽ           E    E   % =      ¤   $ÂĽ / $         %      E;$ ¤1%     H  %  %  H C  #0  ÂĽ 103 -0 26' /0 '45#3=#/ &' #%6'3&0 %0/ -04 &#504 '/%0/53#&04 '/ '45' 53#$#,0 04 53#5#.+'/504 %0/ '- #/;-0)0 &' $3#4+/045'30+&' Â&#x2014;  /0 *#/ 5'/+&0 4+'.13' '- .+4.0 '('%50 9# 26' *#/ .#/5'/+&0 -# %0/%'/53#%+>/ &' ! '/ -#  '8%'150 26' -0 *# +/%3'.'/5#&0 4+)/+(+%#5+7#.'/5' 9 '/ -#  -# *#/ .#/5'/+&0 #6/26' -# *# &+4.+/6+&0 4+)/+(+%#5+7#.'/5' '/  / %6#/50 # -04 %0/5'/+&04 &' '41'3.+&+/# ¤ÂĽ -# 4#-+/+&#& *# &+4.+/6+&0 -# %0/%'/53#%+>/ &'  '/ -#  #6/26' 4>-0 4+)/+(+%#5+7#.'/5' '/   9 4' *#/ .#/5'/+&0 '/ -#  5304 #6503'4 *#/ '/%0/53#&0 +/%3'.'/504 &'  13070%#&04 103 -# 4#-+/+&#& 103 -0 26' 5#.10%0 '45#3=#/ &' #%6'3&0 %0/ -04 &#504 0$5'/+&04 '/ '45' 53#$#,0 ¤"#1#5# '5 #-   '))+#/+ 0:0 9 '35#/+   +/ 9 #0  ÂĽ 04 53#5#.+'/504 %0/ Â&#x2014;  *#/ .#/5'/+&0 '- %0/5'/+&0 &'  '/ -#  9 -0 *#/ .#/5'/+&0 '/ -#  %6#/&0 '- 53#5#.+'/50 4#-+/0 *# 4+&0 '/ 53'4 7'%'4 9 -0 *#/ &+4.+/6+&0 %6#/&0 *# 4+&0 '/ 6/# 40-# #1-+%#%+>/ ¤(+) % 9 &ÂĽ 103 -0 26' '4504 '('%504 *#/ 4+&0 6/ 10%0 '33;5+%04 - %0/5'/+&0 &' '41'3.+/# ¤ÂĽ *# +/%3'.'/5#&0 '/ -#  9  103 '('%50 4#-+/0 9 '- Â&#x2014;  /0 *# %0/4')6+&0 3'7'35+3 '45' '('%50 4>-0 '/ -#  # -# .#903 %0/%'/53#%+>/ ¤(+) ' 9 (ÂĽ

360


c

50

PARTE RADICULAR

bc bc

c

40

bc

ab

30

ab

ab

40

b

b

b 30

ab

a

a

20

20 10

Espermidina "SPD" (nmol/g)

10

140

c

120

PARTE AĂ&#x2030;REA

b

ab

bc

bc

bc

b

PARTE RADICULAR

c

ab

100

a

80

a a

300

ab

ab

200

a

60

100

40 20

25

Espermina "SPM" (nmol/g)

d

Putrescina "PUT" (nmol/g)

Putrescina "PUT" (nmol/g)

b

c

e bc

20

PARTE AĂ&#x2030;REA

bc

f

PARTE RADICULAR

c

bc b

bc

bc

c

bc

12

b

10

ab

15

a

a

8 6

10

4

5 2

T01

T02

T03

T1

T2

Tratamientos

T3

T4

Espermidina "SPD" (nmol/g)

PARTE AĂ&#x2030;REA

a

T01

T02

T03

T1

T2

T3

Espermina "SPM" (nmol/g)

T4

Tratamientos

                

Conclusiones                 !"          #    $     %     &    %              $     %  '        (

         &  $         &       

Agradecimientos )  %    '

 * (  +    ,  +,-./-"0

361


BibliografĂ­a &12  -34 B A52 6

27 ! *7- 16*-  ¤ ÂĽ Â&#x2014;92+;*<<27852-. 9;8=.,=< *0*27<= =1. <=;.<< 0.7.;*=.- +B <*5272=B *7- 72,4.5 27 Brassica juncea Chemosphere 72  Â&#x2014;   *30>C  *7- *B*= # ¤ ÂĽ //.,=< 8/ +;*<<278<=.;82- 87 =1. 95*7= ;.<987<.< =8 .7?2;876.7=*5 <=;.<<.< Plant Physiology and Biochemistry 47 Â&#x2014; *30>C  *7- $;.=B7  ¤  ÂĽ $1. ,1.62,*5< ,1*;*,=.;2<=2, *7- -2<=;2+>=287 8/ +;*<<278<=.;82-< 27 95*7=< Phytochemistry 62  Â&#x2014;  58;.<  *7- *5<=87 & ¤ ÂĽ 85B*627.< *7- 95*7= <=;.<< *,=2?*=287 8/ 9>=;.<,27. -28<B7=1.<2< +B 8<68=2, <18,4 Science 217  Â&#x2014;  1;29*,1 %  )1*+27<422 % *7- . ;88=   ¤ ÂĽ $@.7=B B.*;< 8/ +;*<<278<=.;82-< <=.;82-*5 95*7= 18;687.< @*;;*7= +.==.; ,;89< /8; =1. '' .7=>;B Annals of Botany 86 Â&#x2014;  26  87<.,*  182  >+8=*  *7- @87 ( ¤ ÂĽ #*5= 27 2;;20*=287 @*=.; *//.,=< =1. 7>=;2=287*5 *7- ?2<>*5 9;89.;=2.< 8/ ;86*27. 5.==>,. ¤Lactuca sativa ÂĽ Journal of Agriculture and Food Chemistry 56  Â&#x2014;   27  *7- *8  ¤ ÂĽ .?.5< 8/ .7-80.78>< 985B*627.< *7- *5Â&#x2014; 2712+2=.- 0;8@=1 8/ ;2,. <..-5270 Plant Growth Regulation 17  Â&#x2014;  GE.C  *CC*/.;*  *C8;;*  #2:>2.;* & *7- )>558 $ ¤  ÂĽ 7/5>.7,. 8/ +;*<<278<=.;82- *7*580>. 87 *7=28A2-*7= .7CB6.< 27 ;2,. 27 ,>5=>;. 6.-2>6 @2=1 *5 Plant Biology 47 Â&#x2014; GE.C  "8+*27*  *7- 855  ¤  ÂĽ #B7=1.<2< *7- 9;*,=2,*5 *9952,*=287< 8/ +;*<<278<=.;82- *7*580< 7 *B*= # *7- 16*-  ¤.-<ÂĽ ;*<<278<=.;82-< +28*,=2?2=B *7- ,;89 9;8->,=2?2=B 5>@.; 8;-;.,1= ".-687 & *7- $<.70  ¤ÂĽ 201Â&#x2014;9;.<<>;. 52:>2- ,1;86*=80;*912, -.=.;627*=287 8/ 9>=;.<,27. ,*-*?.;27. <9.;62-27. *7- <9.;627. Journal of Chromatography A 170 Â&#x2014;  ".002*72 " 8C8 # *7- .;=*72  ¤ ÂĽ 1*70.< 27 985B*627. 6.=*+852<6 27 <..-5270 8/ =1;.. @1.*= ¤Triticum aestivum ÂĽ ,>5=2?*;< -2//.;270 27 <*5= <.7<2=2?2=B Plant Science 102  Â&#x2014;  #*<<.  ¤  ÂĽ 1B<285802,*5 *,=287< 8/ +;*<<278<=.;82-< *7 >9-*=. Journal of Plant Growth Regulation 22  Â&#x2014;  #.;7*  .;7D7-.C  855  *7- 68;F<  ¤  *ÂĽ ;*<<278<=.;82- *7*580>.< .//.,= 87 B2.5- *7- :>*52=B 9*;*6.=.;< 8/ /2.5-Â&#x2014;0;8@7 5.==>,. ¤Lactuca sativa ÂĽ Scientia Horticulturae 143 I  #.;7*  .;7D7-.C  855  855 ( *7- 68;F<  ¤  +ÂĽ ;*<<278<=.;82- *7*580>.< .//.,=< 87 =1. B2.5- *7- :>*52=B 9*;*6.=.;< 8/ 0;..718><.Â&#x2014;0;8@7 9.99.; ¤Capsicum annuum ÂĽ Plant Growth Regulation 68

I )*9*=*  8=.55*  .=;.5 $ *7- #.;;*78  ¤ ÂĽ ".<987<.< 8/ .=1B5.7. +28<B7=1.<2< =8 <*527. <=;.<< 27 <..-5270< 8/ .201= 95*7= <9.,2.< Plant Growth Regulation 53 Â&#x2014;  )*9*=*  #.;;*78  .=;.5 $ 68;F<  *7- 8=.55*  ¤  ÂĽ 85B*627.< *7- .=1B5.7. ,1*70.< ->;270 0.;627*=287 8/ -2//.;.7= 95*7= <9.,2.< >7-.; <*5272=B Plant Science 167 Â&#x2014; )*9*=*  #.;;*78  .=;.5 $ *7- 8=.55*  ¤ ÂĽ 1*70.< 27 /;.. 985B*627. ,87,.7=;*=287 27->,.- +B <*5= <=;.<< 27 <..-5270 8/ -2//.;.7= <9.,2.< Plant Growth Regulation 56  Â&#x2014;

362


Análisis elastoplástico de pórticos planos de acero a dos aguas José Javier Ferrán Gozálvez 1, Carlos Ferrer Gisbert, Miguel Redón Santafé, Francisco Javier Sanchez Romero, Juan Bautista Torregrosa Soler 1

Universidad Politécnica de Valencia, Departamento de Ingeniería Rural y Agroalimentaria. Camino de Vera s/n 46022 Valencia. jjferran@agf.upv.es

Resumen La teoría clásica de cálculo plástico en pórticos de acero a dos aguas presenta notables limitaciones en relación a su utilización práctica en las comprobaciones en Estado Límite Último. El continuo desarrollo de los programas de cálculo estructural y las recientes prescripciones de la Instrucción de Acero Estructural (EAE Art. 19.5), pueden permitir abordar el cálculo de la carga última de la estructura por el método general de análisis no lineal elastoplástico. En este trabajo se propone una metodología de cálculo y se analizan comparativamente los resultados del cálculo de varios pórticos. Palabras clave: calculo elastoplástico, acero, pórticos

Elastoplastic analysis of double-pitched portal frames Abstract The calculation of double- pitched steel portal frames by means of the classical plastic theory has significant limitations regarding its practical use when checking the Ultimate Limit State. The continued development of the structural software together with the recent prescriptions of the Spanish ‘Steel Structural Instruction’ (EAE Art. 19.5) can help to address the calculation of the ultimate load of the structure through the general method of nonlinear elastoplastic analysis. The present paper proposes a methodology of calculation which is used to analyse and compare several portal frames. Keywords: elastoplastic analysis, steel, portal frames

Introducción y/o Justificación El cálculo de estructuras en régimen elastoplástico supone un avance en el conocimiento del comportamiento de la estructura en Estado Límite Último (E.L.U.). Se destacan los siguientes objetivos de este tipo de análisis según Lasheras (1983): - Obtención de la carga última o de colapso qu - Obtención del mecanismo de colapso con la posición de las secciones donde se desarrollan las rótulas plásticas. Conocimiento del proceso de formación del mecanismo de colapso: carga soportada cada vez que se forma una rótula y giros plásticos. Optimización estructural. Entre los métodos que consideran el comportamiento no lineal del material, ha tenido una cierta difusión el análisis plástico, con hipótesis muy simplificadas. En el caso de un pórtico a dos aguas de nudos rígidos, puede recurrirse a este tipo de cálculo avanzado en ciertos casos: - En la comprobación resistente, en situación persistente o transitoria, en E.L.U. Una consecuencia es un posible dimensionado con perfiles más ajustados que en un cálculo elástico lineal - El análisis del tipo y proceso de formación del mecanismo de colapso, puede repercutir en el diseño con una mejora del comportamiento estructural (más ductilidad)

363


- En comprobaciones en situación accidental relativa al sismo o en caso de incendio según Mahmoud (2012) Tradicionalmente se han desarrollado procedimientos para efectuar un análisis global plástico. Sin embargo, según el Artículo 19.4 de la Instrucción de Acero Estructural (EAE), sólo pueden ser aplicados en estructuras convencionales de edificación, con condiciones estrictas de las secciones transversales (Art. 20.5) y en general no está permitido en estructuras traslacionales (Art. 24.3). El desarrollo de los programas ha permitido implementar en el cálculo procedimientos que permiten mejorar el cálculo y transformarlo propiamente en un cálculo elastoplástico según Grigorian (2012). Además, la Instrucción de Acero Estructural (EAE Art. 19.5) recomienda el método general de análisis no lineal elastoplástico, que respecto al cálculo plástico, supone un gran avance ya que considera: - Diagramas momento-curvatura de las secciones obtenidas bajo solicitaciones monótonas crecientes hasta su resistencia última - Diagrama tensión-deformación con rama plástica ascendente (EAE Art.32.2) - Definir la longitud de la rótula en la que se realizará la integración de la curvatura - Control de las deformaciones plásticas límites (EAE Art. 19.5.1. a 19.5.3.) - Consideración de la interacción axil flector - Consideración conjunta con el cálculo plástico de la no linealidad geométrica (efecto P-Delta)

Métodos 1. Método de cálculo El método de cálculo se basa en las recomendaciones del Federal Emergency Management Agency (FEMA-356 5.5.2.2.2. Nonlinear Static Procedure). Se efectúa el análisis según el programa de análisis estructural SAP2000. Se efectúa una adaptación de los parámetros de cálculo para realizar un análisis elastoplástico global según las prescripciones de la EAE. El cálculo se realiza con fracciones de la carga introducida, discretamente crecientes (salvo niveles de carga cercanos a la formación de cada rótula), hasta alcanzarse la resistencia última de las secciones y si es el caso, la formación del mecanismo de colapso según White (1993). Para ello se efectúa, un cálculo elástico lineal para cada nivel o estado de carga (step), hasta que en alguna posible rótula, las tensiones alcancen el límite elástico fyd del acero, desarrollando deformaciones plásticas en la sección implicada. 2. Modelos estructurales Cada modelo estructural ha sido analizado de forma independiente, ya que no admite un análisis paramétrico. En función de los resultados obtenidos, las variables tenidas en consideración se han ido modificando durante el desarrollo del trabajo. La estructura básica consiste en pórticos planos de nudos rígidos a dos aguas, con bases empotradas en la cimentación según King (1995). Geometría: Se han analizado pórticos de 15, 20, 25 y 30 m. de luz. Altura de pilares de 8 m. Pendiente de cubierta del 8 y 14%. Perfiles y tipo de acero: Dintel y pilar de la serie IPE. Se han fijado relaciones de inercia pilar respecto a la inercia del dintel, de 2 y 3. Los perfiles son de Clase 1 a flexocompresión. Pilar de sección constante, dintel acartelado en esquina y cumbrera, de longitud Luz/10. Acero tipo S275. Condiciones de seguridad: Situación persistente o transitoria según criterios del Código Técnico de la Edificación, Seguridad Estructural (CTE SE) para Estados Límites Últimos.

364


Acciones: Adoptadas del Código Técnico de la Edificación, Acciones en la Edificación. Cubierta ligera de peso propio inferior a 1 kN/m2. Sobrecarga de uso: 0.4 kN/m2. Sobrecarga de nieve 0.2 kN/m2. Viento 0.42 kN/m2. 3. Cálculos iniciales Para cada caso, se ha realizado un dimensionado completo previo al análisis plástico mediante un análisis elástico lineal de 1º orden (perfiles, longitud y canto de cartabones) que ha debido ser revisado al modificarse alguna de las variables consideradas. El índice resistente de los perfiles i, o relación entre esfuerzos actuantes y resistidos, se calcula siguiendo las prescripciones del Título 4º de la Instrucción de Acero Estructural (EAE). El índice resistente se ajusta al valor más cercano inferior a 1. Los análisis realizados corresponden al plano principal del pórtico. En sentido transversal se considera que existe un eficaz sistema de arriostrado a pandeo por compresión y a vuelco lateral. Respecto a las fórmulas de interacción axil-flector, se ha utilizado el Método 2 de la EAE. Las imperfecciones de las barras se consideran mediante el método del coeficiente capa (χ) de pandeo (Art. 35 EAE). Se comprobó la escasa influencia de las imperfecciones iniciales estructurales globales. Se define una carga arbitraria que cumpla la condición de que sea superior a la carga última o de colapso qu que es la que se pretende calcular. En todos los casos se ha adoptado un valor del doble de la carga introducida (2·qd), de forma que qu se ha alcanzado siempre en los casos analizados, al ser inferior a esa carga arbitraria. Se establece un mínimo número de escalones de carga (steps) de 20. 4. Definición geométrica de las rótulas plásticas Se desconoce el número, posición y longitud de las rótulas plásticas (hinges). Por tanto es necesario definir en las barras un determinado número de secciones susceptibles de plastificarse. En general se colocan en extremos de barras, en puntos de aplicación de cargas puntuales o en cambios de sección. Respecto al dintel sometido a carga uniforme, se desconoce a priori la posición de una posible rótula interna. En la realidad se localizan preferentemente en los puntos de apoyo de correas. Se opta por introducirlas a separaciones de 1 m. a lo largo del dintel, y corregir posteriormente su posición si es el caso. En el pilar se definen en ambos extremos. Se aproxima como longitud de la rótula un 10% de la longitud de la barra para perfiles en doble T tipo IPE. En esta longitud se realiza la integración de la curvatura. 5. Definición del tipo de rótula plástica Para las barras de un pórtico a dos aguas, la plastificación se debe fundamentalmente al flector principal (M3), siendo menor la influencia del axil (P) y despreciable en el caso del cortante (V2). Para la interacción entre el axil (P) y flector (M3), en perfiles IPE, es necesario considerar una reducción de la resistencia a flexión Mc,Rd de valor (EAE, Art. 34.7.2.1.) (Ecuación 1):

⎞ ⎛ 2A ⎛ N MN,Rd = Mc,Rd ⋅ ⎜1 − Ed ⎟ ⋅ ⎜⎜ ⎜ Npl,Rd ⎟ ⎝ A + 2bt f ⎠ ⎝

⎞ ⎟⎟ ≤ Mc,Rd ⎠

(1)

Dónde NEd/Npl,Rd, es la relación entre el axil de cálculo y el de plastificación. En perfiles laminados, el término [2A/(A+2 b·tf)] oscila entre 1.11 a 1.30. Se tabularon los valores para los distintos perfiles de la serie IPE. Según las recomendaciones del FEMA-356 (ecuación 5.4.), este término vale 1.18. 6. Definición de la curva de deformación plástica Para cada grado de libertad, puede definirse una curva momento-rotación, que proporciona el punto de fluencia plástica y otros puntos significativos posteriores al límite elástico. Para el FEMA-356 (Figura 1), existe una rama elástica AB donde B representa el inicio de la plastificación. El FEMA-356 indica la posibilidad de que durante el proceso de plastificación, al

365


alcanzar el punto C, ocurra una repentina pĂŠrdida de capacidad de resistencia. El tramo DE representa una resistencia residual hasta el fallo, es decir, alcanzar la deformaciĂłn lĂ­mite E segĂşn Dharma y Kang-Hai Tan (2007). A partir del punto E, se puede considerar, segĂşn el caso, una tendencia del flector hasta anularse, o bien mantenerse constante para deformaciones mĂĄs elevadas al lĂ­mite E.

Figura 1: Curvas elastoplĂĄsticas

Para definir esta curva en este trabajo, se adaptarå al Apartado 19.5.1 de la EAE, en donde se especifican las deformaciones límites. La curva se define simÊtrica con el mismo valor límite a tracción y compresión, para secciones de Clase 1, con una deformación límite de ξcu = 6¡ξy. En los cålculos iniciales, el tramo BC es horizontal, siendo el momento de plastificación un valor fijo con la deformación. En cålculos posteriores se considera la pendiente β, pues evita problemas de cålculo al mejorar la convergencia del resultado a una solución única. El momento de plastificación aumenta ligeramente con la deformación plåstica. Para aprovechar las salidas gråficas que indican la magnitud del giro plåstico en una rótula, al existir 7 puntos alineados, en cada tramo se define una deformación ξy, y el punto E se sitúa en el límite 6¡ξy. 7. Consideración de fenómenos de 2º orden Se analiza la influencia que pueden tener los movimientos de los nudos en la respuesta estructural según Davis (2002). Las estructuras para pórticos a dos aguas, pese a los grandes desplazamientos y giros de sus nudos, suelen clasificarse como intraslacionales cuando se aplican los criterios del Art. 23.2 de la EAE. Al formarse la primera rótula, los giros plåsticos aumentan significativamente los desplazamientos, por lo que su influencia en los esfuerzos puede ser notable. Si las deformaciones son elevadas, se realiza un cålculo P-Delta con grandes desplazamientos (equilibrio con los esfuerzos sobre la posición deformada). Se considera la inestabilidad elåstica de las barras (pandeo) según Silvestre y Camotin (2007). El procedimiento consiste en utilizar la definición de la interacción P-M3 para ese propósito. Para ello, en tracción se sustituye en la expresión Npl,Rd, mientras que en compresión por la resistencia a pandeo Nb,Rd. Tabla 1. Principales valores de los paråmetros 





    

%& '+ %* %) %- %( '+

%' %' '' '% '' *& **

      

  ! !  

 % ( % ( % ( + + % ( +!- %,!&,' +!( %'!%%)

    " #  !      $    )%*!(' +  '" ,)-!++ &)+!,, +!+&)) .  $)%*!-/ +  %" ,&&!&% )%*!*, +  ," ,(-!*$)%*!-/ $+!+/%/ .  ,,*!,% +  /" /+&!,' ,,'!,+!%+&) . 

366


15

16



17

18 Figura 2: Mecanismo de colapso de un pórtico a dos aguas

Resultados Se obtienen: el proceso de formación de las rótulas plásticas, la carga de colapso qu y el tipo de colapso. Se analizan, para cada escalón (step) de la carga los esfuerzos y giros plásticos que han tenido lugar. Se alcanza la carga última o de colapso por un mecanismo completo de 4 rótulas, incompleto de 3 rótulas en el dintel (no habitual) o por giro plástico máximo en alguna de las rótulas (Punto E). Se comprueba, por el teorema estático de plasticidad o del límite inferior, que ningún valor del flector supera el momento de plastificación en cada sección. En caso contrario, debe modificarse la posición predeterminada de la rótula plástica más cercana. Como ejemplo representativo, se exponen los resultados (Figura 2) para un pórtico de 30 m. de luz, 8 m. de altura de pilares, 14% de pendiente, pilar IPE-550 y dintel IPE-400. La resultante de la carga vertical mayorada es de 257.73 kN. Se confeccionan Tablas y Figuras. La carga de colapso es qu = 406.32 kN. El factor de carga de colapso es qu/qd = 1.58. En cada modelo, sobre la base de este cálculo inicial, se han ido incorporando por separado, el resto de parámetros referenciados, y con ello confrontar la influencia en cada caso.

Conclusiones - En los análisis elastoplásticos, la carga de colapso resulta inferior a la obtenida por el cálculo clásico plástico. Para esta tipología estructural, la reserva plástica suele ser pequeña si la estructura ha sido adecuadamente dimensionada en estado elástico.

367


- Las imperfecciones geométricas estructurales globales no alteran los resultados. Las imperfecciones geométricas locales de las barras influyen en el resultado, de forma más notable con una mayor esbeltez del pilar o dintel. - La influencia de la interacción axil-flector es despreciable en cubiertas ligeras. - La consideración de una rama plástica ascendente del diagrama tensión deformación afecta muy poco a los resultados pero mejora la convergencia a una solución. - Los fenómenos de 2º orden (P-Delta) modifican en general de forma notable el comportamiento plástico, bien por alcanzarse las deformaciones plásticas límites, por lo que se interrumpe la formación de nuevas rótulas, hasta incluso por no alcanzarse el equilibrio (estructura inestable). - La longitud y canto del cartabón de esquina y de cumbrera, modifican la posición y el orden de aparición de las rótulas. - Si los índices resistentes del pilar y dintel, obtenidos tras un cálculo clásico, son similares, la carga de colapso está próxima a la carga en el límite elástico. Si los índices resistentes son distintos, la carga de colapso puede ser bastante superior a la carga en el límite elástico, salvo cuando se forma un mecanismo incompleto o se alcanzan las deformaciones plásticas límites.

Bibliografía CSI Analysis and Reference Manual for SAP2000. (2011). Computer and Structures Federal Emergency Management Agency (FEMA-356). (2000). American Society of Civil Engineers (ASCE) Grigorian M, Grigorian C. (2012). Recent developments in plastic design analysis of steel moment frames. Journal of Constructional Steel Research 76, 83-92 Instrucción de Acero Estructural (EAE). (2011). Ministerio de Fomento King C. (1995). Plastic design of single-storey pitched-roof portal frames to Eurocode 3. The Steel Construction Institute. Technical report. Publication 147 Martinez Lasheras, C. (1983). Cuadernos de Estructuras: Análisis Plástico, Escuela Técnica Superior de Arquitectura UPV Michael Davies J. (2002). Second-order elastic-plastic analysis of plane frames. Journal of Constructional Steel Research 58, 1315-1330 Mohamed Mahmoud El-Heweity. (2012). Behaviour of portal frames of steel hollow sections exposed to fire. Alexandria Engineering Journal 51, 95-107 O’Brien E.J., Dixson A.S. (1997). Optimal plastic design of pitched roof frames for multiple loading. Computers & Structures Vol 64. No. 1-4, pp 737-740 Ronny Budi Dharma, Kang-Hai Tan. (2007). Rotational capacity of steel I-beams under fire conditions. Part II: Numerical simulations. Engineering Structures 29, 2403-2418 Silvestre N., Camotin D. (2007). Elastic buckling and second-order behaviour of pitched-roof steel frames. Journal of Constructional Steel Research 63, 804-818 White D.W. (1993). Plastic-hinge methods for advanced analysis and design of steel frames. Journal of Constructional Steel Research 24, (2):121-52

368


                   1% $8-920:.;  F %2<*=Â&#x2014;>*5-*9* Â&#x2013; >  1=<.2-*Â&#x2022;



5;2:8 "8=2?,52,8 -. :2*5* -8 *;.=8 ;,8=* %:.9289 109B92* ÂĄÂĄÂ&#x2014;Â&#x; "85. -. 2<* "89:0*= § .59. /89 $.;.*9,1 *5- &.,158=80> 8/ 1098Â&#x2014;5=2985<.5*= *5- 28=802,*= %,2.5,.;â&#x20AC;&#x201C;&1  ŠÂ&#x2014;ÂŁ :2=* $.*= "89:0*= ;8/2*.:*27=,7; Â&#x2013; '52=.9:2-*- . (206Â&#x2014;  2.5,2*: -. !<9.5:. #<242,* 5*32;2,* @ 324.5;*92* Â&#x2014;Â&#x2022;Â&#x2013; !<9.5:. Â&#x2013; '52=.9:2-*-. 6 "69;6 *,<3-*-. . 2F5,2*: $<* 6 *476 3.09. ÂŁÂ&#x2013;Â&#x2022; ŠÂ&#x2014;ÂŁ "69;6 "69;<0*3

   ,.+63* E ,65:2-.9*-* <4* -*: 4*2: 24769;*5;.: /65;.: *324.5;*9.: -. /3*=65H2-.: 6: +63+6: 6,699.4 .::.5,2*34.5;. /3*=65H2: . *5;6,2*525*: 7.:*9 -*: =*92*DI.: 5* ,6476:2DC6 .4 /3*=65H2-.: .:;*9.4 7925,27*34.5;. *::6,2*-*: * /*,;69.: 0.5E;2,6: 6: .:;G4<36: .?;.956: 76-.4 46-<3*9 * :G5;.:.§-.09*-*DC6 . 769;*5;6 *3;.9*9 * ,6476:2DC6 5*: 73*5;*: "6-.Â&#x2014;:. =.92/2,*9 <4* 9.*,DC6 -2:;25;* .5;9. ,=: * .:;.: .:;G4<36: .?;.956: :.5-6 *::24 6 /*,;69 0.5E;2,6 -.;.9425*5;. 5* 9.:76:;* ! 36,*3 -. 796-<DC6 . *: ,65-2DI.: *4+2.5;*2: *::6,2*-*: 25/3<.5,2*4 6 ;.69 .4 /3*=65H2-.: 56: +63+6: -. ,.+63* ! 79.:.5;. .:;<-6 ,.5;96<Â&#x2014;:. 5* *5B32:. -. -<*: ,=: 9.0265*2: 769;<0<.:*: -. ,.+63* ¤   09<76 Cepa), a â&#x20AC;&#x2DC;Branca da PĂłvoaâ&#x20AC;&#x2122; e a â&#x20AC;&#x2DC;Vermelha da PĂłvoaâ&#x20AC;&#x2122;. !: -*-6: ,324B;2,6: <;232A*-6: 7*9* *5*32:*9 6 ./.2;6 -*: =*92*DI.: 25;.9*5<*2: -. ,65-2DI.: 4.;.6963H02,*: ¤Š *56: :<,.::2=6:ÂĽ 5* ,6476:2DC6 -*: ,.+63*: /69*4 6+;2-6: * 7*9;29 -. <4* .:;*DC6 -6 5:;2;<;6 *,265*3 -. .;.6963602* -. "69;<0*3 :2;<*-* 5*: 796?242-*-.: -6 36,*3 -. 796-<DC6 ¤"9.,272;*DC6Â&#x2014; &.47.9*;<9* E-2* -6 9Â&#x2014;  &.47.9*;<9* E-2* -6 %636 ¤ ,4ÂĽÂ&#x2014;  <42-*-. $.3*;2=* E-2*Â&#x2014; $*-2*DC6 36+*3 &6;*3 Â&#x2014; . &.69 E-26 -. M0<* 56 %636 â&#x20AC;&#x201C;% 7*9* 6 7.9G6-6 -. *9D6Â&#x2014;<316ÂĽ !: /3*=65H2-.: =*92*9*4 :2052/2,*;2=*4.5;. 56: ,25,6 *56: :<,.::2=6: -. 796-<DC6 ;.5-6Â&#x2014;:. 6+;2-6 6: =*369.: 4*2: .3.=*-6: 56: *56: ,64 *: .:;*DI.: -. ,9.:,24.5;6 4*2: 8<.5;.: . :.,*: . ,64 6 4*269 G5-2,. -. $ ! *56 .4 8<. *: -<*: ,=: *79.:.5;*9*4 6: =*369.: 4*2: +*2?6: -. /3*=65H2-.: /62 6 *56 ,64 *: 4.569.: & . &% . 4*269 7.9,.5;*0.4 -. % . $ !: 9.:<3;*-6: *79.:.5;*-6: 46:;9*4 8<. 6: /*,;69.: 0.5E;2,6: . 4.;.6963H02,6: 7*9;2,<3*94.5;. * 9*-2*DC6 . 9.3*DC6 ,64 -2:7652+232-*-. -. B0<* . ;.47.9*;<9* ;F4 <4* 796/<5-* 25/3<F5,2* 56 ,65;.J-6 .4 /3*=65H2-.: 56: +63+6: -. ,.+63* "*3*=9*: ,1*=.Â&#x203A;             

    

     

   !5265: *9. ,65:2-.9.- 65. 6/ ;1. 46:; 24769;*5; -2.;*9@ :6<9,.: 6/ /3*=6562-: 5 65265 +<3+: 6,,<9 4*253@ /3*=6563: *5- *5;16,@*525: .:72;. =*92*;265: 25 ;1. ,6476:2;265 6/ /3*=6562-: *9. 7924*923@ *::6,2*;.- >2;1 0.5.;2, /*,;69: .?;.95*3 :;24<32 4*@ 46-<3*;. ;1. :@5;1.:2: § -.09*-*;265 *5- ;1<: *3;.9 ;1. ,6476:2;265 25 73*5;: &1.9. 4*@ +. * -2:;25,; 9.*,;265 +.;>..5 ,= 25 9.:765:. ;6 ;1.:. .?;.95*3 :;24<32 *5- ;1<: ;1. 0.5.;2, /*,;69 2: -.;.9425*5; &1. 36,*3 796-<,;265 *5- .5=29654.5;*3 ,65-2;265: *9. ,92;2,*3 /*,;69: *::6,2*;.- >2;1 ;1. ,65;.5; 25 /3*=6562-: 25 65265 +<3+: &12: :;<-@ /6,<:.- 65 ;1. *5*3@:2: 6/ ;>6 769;<0<.:. 9.0265*3 65265 ,=:¤   .7*ÂĽ ;1. >12;. â&#x20AC;&#x2DC;Branca da PĂłvoaâ&#x20AC;&#x2122; and the red â&#x20AC;&#x2DC;Vermelha da PĂłvoaâ&#x20AC;&#x2122;. &1. ,324*;. -*;* <:.- ;6 *5*3@A. ;1. .//.,; 6/ 25;.9*55<*3 =*92*;265: 6/ >.*;1.9 ¤Š ,65:.,<;2=. @.*9:ÂĽ 25 ;1. ,6476:2;265 6/ 65265: >.9. 6+;*25.- /964 * :;*;265 6/ ;1. *;265*3 5:;2;<;. 6/ .;.696360@ 6/ "69;<0*3 36,*;.- 5.*9 ;1. 796-<,;265 :2;. ¤"9.,272;*;265Â&#x2014;" =.9*0. 29 ;.47.9*;<9.Â&#x2014;& =.9*0. %623 &.47.9*;<9. ¤ ,4ÂĽ Â&#x2014; %& =.9*0. $.3*;2=. <42-2;@Â&#x2014;$ &6;*3 36+*3 $*-2*;265â&#x20AC;&#x201C;$ =.9*0. %623 )*;.9 65;.5; Â&#x2014;%) /69 ;1. 7.926- *9,1Â&#x2014;<3@ÂĽ 3*=6562-: =*92.- :2052/2,*5;3@ 6=.9 ;1. Š :<,,.::2=. @.*9: 6/ 796-<,;265 >2;1 1201.9 =*3<.: 25

369


B.*;< @2=1 @*;6.; *7- -;2.; 0;8@270 <.*<87< *7- @2=1 =1. 1201.<= ;*=. 8/ " $1. B.*; 27 @12,1 =1. =@8 ,?< <18@.- =1. 58@.<= /5*?8782-< ?*5>.< @*< =1. B.*; @2=1 =1. 58@.<= $ *7- $# *7- 1201.; 9.;,.7=*0. 8/ #' *7- " $1.<. ;.<>5=< <18@ =1*= 0.7.=2, /*,=8;< *7- @.*=1.; 9*;=2,>5*;5B @2=1 ;.<9.,= =8 ;*-2*=287 *7- @*=.; *?*25*+252=B *7- =.69.;*=>;. 1*?. * 9;8/8>7- 27/5>.7,. 87 =1. ,87=.7= 27 /5*?8782-< 8/ 87287 +>5+< .B@8;-<         

 8 =.8; . 8 9.;/25 -. /5*?87M2-.< 9;.<.7=.< 7*< ,.+85*< 68<=;*6 >6* 0;*7-. ?*;2*+252-*-. .7=;. ,?< -. -2/.;.7=.< ,858;*HN.< -. +85+8< -. -2/.;.7=.< /8=89.;K8-8< . 9.;/2< :>K62,8< #.0>7-8 &@0.7 . #526.<=*-   *< ,?< 6*2< 9>70.7=.< ,86 .5.?*-8< =.8;.< .6 ##$ <M52-8< <85O?.2< =8=*2< . 8# /;>,=885208<<*,D;2-8< . 6*28;  -. # 6*=A;2* <.,* <B8 *< :>. *9;.<.7=*6 =*6+A6 6*28; =.8; .6 /5*?87M2< . <26>5=*7.*6.7=. * 6*28; ,*9*,2-*-. *7=28A2-*7=. ".<>5=*-8< 8+=2-8< 98; ?D;28< *>=8;.< -.687<=;*6 * *,.7=>*-* ?*;2*HB8 78 9.;/25 . =.8; .6 /5*?87M2-.< .6 ,.+85* $*+.5* 

&  $$$         $         5*?87M2-.< $8=*2<    #.55*99*7 . 481    *;8==2 .= *5   *;8==2 .= *5    & *;8==2 .= *5   (*70 .= *5  *;278?* .= *5   & 852<8?D .= *5   

  !# #*7=*< .= *5  5*?87M2< $8=*2<    !;2,. . "18-.<     " #62=1 .= *5 9,85 (A) (ฮผmol/g PS) A6.=1 .= *5    & 87*,,8;<2 .= *5 

  >9.;     86+*;- .= *5   & 86+*;- .= *5  &@0.7 . #526.<=*-     7=8,2*727*< $8=*2<    & *CC* . 272*=2 

9.<*; -*< ?*;2*HN.< 7* ,8698<2HB8 .6 /5*?87M2-.< .<=*;.6 9;27,29*56.7=. *<<8,2*-*< * /*,=8;.< 0.7A=2,8< *;8==2 . !2,,*052*  8< .<=K6>58< .A=.;78< 98-.6 68->5*; * <K7=.<.-.0;*-*HB8 . 98;=*7=8 *5=.;*; * ,8698<2HB8 -*< 95*7=*< <<.< .<=K6>58< 27,5>.6 * ;*-2*HB8 '& . * -2<9872+252-*-. -. 7>=;2.7=.< . D0>* *72.5 .= *5  8 :>. <. 98-. ?.;2/2,*; A >6* ;.*,HB8 -2<=27=* .7=;. ,?< * .<=.< .<=K6>58< .A=.;78< 80;.7  <.7-8 *<<26 8 /*,=8; 0.7A=2,8 -.=.;627*7=. 7* ;.<98<=* #.0>7-8 !*=25 .= *5   8 58,*5 -. 9;8->HB8 . *< ,87-2HN.< *6+2.7=*2< *<<8,2*-*< <B8 >6 -8< /*,=8;.< 6*2< -.=.;627*7=.< 78 =.8; .6 /5*?87M2-.< 7* ,.+85* 3D :>. 8 =298 -. <858 . *< ,87-2HN.< ,526D=2,*< =J6 >6* /8;=. 27/5>J7,2* 78 =.8; -.<=.< ,8698<=8< #.0>7-8 80;.7   *< ?*;2*HN.< *7>*2< <B8 <2072/2,*=2?*< -.?.7-8<. 9;8?*?.56.7=. E< -2/.;.7H*< 7* ;*-2*HB8 058+*5 78 /27*5 -8 9.;K8-8 -. 9;8->HB8 #R5=8/= .= *5   ?.;2/2,*;*6 :>. 8 =.8; -8< /5*?87M2< A <>9.;28; .6 *78< 6*2< :>.7=.< . -. 6*28; 9;.,292=*HB8 !*;* * 6.<6* .<9A,2. *< ?*;2*HN.< 7* />7HB8,><=8 98-.6 .<=*; 6*2< ;.5*,287*-*< ,86 8 0;*> -. 5262=*HB8 -. ;.,>;<8< 9;.<.7=.< 8;7872 .= *5  . ,86 8< /*,=8;.< :>. */.,=*6 8 .:>25K+;28 ,*;+878*C8=8  <=2*;=. . !.L>.5*<  6 ,87-2HN.< <=;.<<. 8 -.,5K728 7* ,*9*,2-*-. -. *:>2<2HB8 -. -.=.;627*-8 ;.,>;<8 9;8->C >6* 6>-*7H* 7* ;.5*HB8  8 :>. 5.?* * >6* 6>-*7H* 78 +*5*7H8 -. ,8698<=8< :>K62,8< 9;8->C2-8< 8< ,8698<=8< /.7M52,8< <B8 ,86postos secundรกrios baseados em carbono (โ€œCarbon Based Secondary Compounds

370


CBSCâ&#x20AC;?), cuja sĂ­ntese ĂŠ regulada por factores biĂłticos e abiĂłticos e muito dependente da forma como CCC 'C  ' )  C)    'CCF C     <)  D' ) nutrientes e em ĂĄgua afecta mais o crescimento do que a fotossĂ­ntese, induzindo a um â&#x20AC;&#x153;excessoâ&#x20AC;? de   )  C  C C FC   CC 5  C    EB    ) C&) C )CC ' HC ) ' EB C EIC CÂ&#x2014;C 0 6:* 4(477*2 3& 51&39& ¤89.&79* * *G:*1&8 ÂĽ  (43(*397&CB4 *2 (42548948 +*3H1.(48 54)*7? 8*7 &88.2 548.9.;&2*39* (477*1&(.43&)& (42 & 7*1&CB4  ¤4: 3*,&9.;&2*39* (477*1&(.43&)& (42 & (43(*397&CB4 )* ÂĽ 42 '&8* 3& designada â&#x20AC;&#x153;HipĂłtese do 6:.1F'7.4 entre Nutrientes e Carbonoâ&#x20AC;? ¤&7'43 :97.*39 &1&3(* .549-*8.8Â&#x2014;ÂĽ ¤7=&39 *9 &1  ÂĽ "*,:3)4 &  4 7?(.4  3& 51&39& )*9*72.3& 4 9.54 )* (42548948 )* )*+*8& 6:* *1& 574):> 8*3)4 (42548948 )* )*+*8& )* '&8* (&7'434 ¤*< +*3H1.(48ÂĽ 4: )* '&8* &>49&)& ¤*< &1(&1H.)*8ÂĽ )*5*3)*3)4 8* 9*2 1.2.9&CB4 )* ).8543.'.1.)&)* )*  4: )*  7*85*(9.;&2*39* "*,:3)4 &  &8 51&39&8 9&2'D2 97&3814(&2 2&.8  5&7& 4 2*9&'41.824 8*(:3)?7.4 6:&3)4 -? :2& &(:2:1&CB4 *<(*88.;& )*  (424 *2 8.9:&CI*8 )* )D+.(* )* 3:97.*39*8 )* 897*88* -F)7.(4 *1*;&)& .39*38.)&)* 1:2.348& *1*;&)& (43(*397&CB4 )*   *397* 4:97&8 ¤7=&39 *9 &1  ÂĽ 8*3)4 & 574):CB4 )* " +&;47*(.)& 547 :2& 7*&14(&CB4 )*  )*;.)4 &4 &'7&3)&2*394 4: 5&7&,*2 )4 (7*8(.2*394 )& 51&39& ¤7.9> *9 &1  ÂĽ   '&8*.&Â&#x2014;8* *39B4 3&8 8*,:.39*8 57*2.88&8 )*+.(.E3(.& 24)*7&)& )* 3:97.*39*8 4: ?,:& 1.2.9& 2&.8 4 (7*8(.2*394 )4 6:* & +49488F39*8* 1*;&3)4 @ &(:2:1&CB4 )*  .3(7*2*39&3)4 4 7?(.4  * *88*8  &(:2:1&)48 6:* 3B4 54)*2 8*7 :8&)48 34 (7*8(.2*394 ¤54.8 *89? 1.2.9&)4 547 3:97.*39*8ÂĽ 8*7B4 :8&)48 *2 " 2 (4397&89* &:2*39&3)4 & ).8543.'.1.)&)* )* 3:97.*39*8 )*(7*8(* &  5476:* 48  *89B4 & 8*7 &14(&)48 5&7& 4 (7*8(.2*394 8 51&39&8 *;41:F7&2 )* +472& & +&>*7 +&(* &48 (43897&3,.2*3948 &2'.*39&.8 )* $*7B4 (&7&(9*7.>&)48 547 *1*;&)&8 9*25*7&9:7&8 * '&.<& ).8543.'.1.)&)* )* ?,:& * (438*6:*39*2*39* 2*347 *+.(.E3(.& +49488.39D9.(& 1*;&3)4 & :2 &:2*394 )* (42548948 +*3H1.(48 348 &348 )* 2&.8 (&147 * 7*):CB4 )*88*8 (42548948 *2 &348 *2 6:* &8 (43).CI*8 * (7*8(.2*394 )& 51&39& 8B4 2*1-47*8 ¤ .25B4 ÂĽ "*,:3)4 &:2&3 *9 &1 ¤ ÂĽ *2 (43).CI*8 )* 897*88* -F)7.(4 48 2*(&3.8248 )* ).88.5&CB4 )* *<(*884 )* *3*7,.& )*.<&2 )* +:3(.43&7 *+.(.*39*2*39* 574;4(&3)4 &19*7&CI*8 3&8 7*&(CI*8 (425*9.9.;&8 )* +4946:F2.(& ).88.5&CB4 )* (&147 * +1:47*8(E3(.& 89* 574(*884 4(477*3)4 348 (147451&8948 54)* 1*;&7 @ 574):CB4 )* !" ¤85D(.*8 !*&(9.;&8 )* <.,D3.4ÂĽ 547 .3(&5&(.)&)* )* ).88.5&CB4 )& *3*7,.& +4946:F2.(& *<(*)*39?7.& *7&39* *89& 8.9:&CB4 54)*7? 8*7 )*8*3(&)*&)& & 8F39*8* )* 8:'89A3(.&8 &39.4<.)&39*8 (424 +1&;43H.)*8 5&7& (42'&9*7 *88& 574):CB4 )* !" ¤&79*18 * ":30&7  ÂĽ  '&.<& .39*38.)&)* 1:2.348& 9&2'D2 .3):> & :2 &'&.<&2*394 3& 7*1&CB4  (43):>.3)4 & :2& 2*347 8F39*8* )* (42548948 +*3H1.(48 42 '&8* *2 *;.)E3(.&8 (.*39F+.(&8 4'9.)&8 34:97&8 7*,.I*8 * 5&7& 4:97&8 (;8 (414(4:Â&#x2014;8* & -.5H9*8* )* 6:* &8 ):&8 (;8 7*,.43&.8 )* (*'41& â&#x20AC;&#x153;ranca da PĂłvoaâ&#x20AC;? e Vermelha da PĂłvoaâ&#x20AC;? 9.;*88*2 ).+*7*39*8 9*47*8 )* +1&;43H.)*8 * 6:* &8 ;&7.&CI*8 .39*7&3:&.8 3&8 (43).CI*8 2*9*4741H,.(&8 )& 7*,.B4 )& H;4& )* $&7>.2 5:)*88*2 9*7 :2& +479* .3+1:E3(.& 3& (42548.CB4 6:F2.(& )&8 (;8 7*,.43&.8 &F 574):>.)&8 88.2 +4. +*.9& :2& &;&1.&CB4 )& ;&7.&CB4 .39*7Â&#x2014;&3:&1 *2 &348 8:(*88.;48 )*  &  348 3F;*.8 )* +1&;43H.)*8 348 '41'48 )&8 ):&8 (;8 )* (*'41&8

    8 *38&.48 +47&2 7*&1.>&)48 3& H;4& )* $&7>.2 +7*,:*8.& )* 247.2 3:2 9*77*34 & (*7(& )*  02 )4 2&7 3& 7*,.B4 ,7F(41& )4 397*Â&#x2014;4:74 * .3-4 34 474*89* 5479:,:E8 +7439*.7& & 479* (42 & &1.>& * & *89* (42 4 (*&34 91A39.(4 8 )&)48 (1.2?9.(48 :9.1.>&)48 ¤#&'*1& ÂĽ 5&7& &3&1.8&7 4 *+*.94 )&8 ;&7.&CI*8 )&8 (43).CI*8 2*9*4741H,.(&8 .39*7&3:&.8 ¤  &  5&7& 4 5*7F4)4 )* &7C4Â&#x2014; :1-4ÂĽ 3& (42548.CB4 )&8 (*'41&8 +47&2 4'9.)48 & 5&79.7 ):2& *89&CB4 )4 389.9:94 &(.43&1 )* *9*47414,.& )* 479:,&1 8.9:&)& 3&8 574<.2.)&)*8 )4 14(&1 )* 574):CB4

371


##"+/&!'#%# .&"#$%-##%+#( #     %$'+*# !$%'(%,# %!$%'(%,## #!(! '), +*# # #' #%,#1("## #â&#x20AC;&#x201C;   $$



 G G





%&



G





 . G   G G

 .    G 

 %

    

 "$     



 

  



  G  G G G  

!: 3=65E : 694 53: 6: 4 "E : /<5 6 4 ;6 636/ :9; 769 "C9 H9 /696 ; 3 

 6 53: 6  79; D= 3 6 *63*6 ; 5 6 : 6 <:   79; D= 3 6 4 :46 E 46:;9 6 79 79   79;9 <4 /9<76 *63*6: 796= 5 5; : 6 476 5:6: 63 6: 3 ;694 5;  6: 8<: : 69494 8<;96 9 7 ;BF : 5=   <4 : 9 7 ;BF : 65:;;<D  769 <4 9B@6 :473 : G / 9 ;9    *63*6: G /   *63*6 79 6949 <4 46:;9 6476:;  G / E 8<5;B@6 6: 3=65E: : 5;655: 4/ 2/ ,- " .61 6*;1,) +64 *):- 5): +<9=): ,- +)31*9)B@6 ,6: 7),9F-: 8<-9+-;15) - +1)51,15) /3<+E:1,6 9-:7-+;1=)4-5;-

')#(&'!')''+& 69)4 ,-;-+;),6: 61;6 .3)=65E1: -4 )4*): ): +=: )79-:-5;)5,6 6 4-:46 7-9.13 65;<,6 ->1:;-4 ,1.-9-5B): 4<1;6 :1/51.1+);1=): 56 ;-69 ,6: ,1=-9:6: .3)=65E1: &6,6: 6: .3)=65E1: 1,-5;1.1+),6: :@6 derivados de quercetina e de isorhamnetina, sendo por ordem de eluição: (1) quercetina 3,7,4â&#x20AC;&#x2122; triglucĂłsido, (2) quercetina 7,4â&#x20AC;&#x2122;diglucĂłsido, (3) quercetina 3,4â&#x20AC;&#x2122;diglucĂłsido, (4) isorhamnetina 3,4â&#x20AC;&#x2122; ,1/3<+E:1,6  8<-9+-;15) glucĂłsido, (6) quercetina 4â&#x20AC;&#x2122;/3<+E:1,6  1:690)45-;15a 4â&#x20AC;&#x2122;/3<+E:1,6 -  8<-9+-;15) 4 )4*): as cvs, o flavonol maioritĂĄrio foi o 3 (Q3,4G) seguido do 6 (Q4â&#x20AC;&#x2122;G). : )5;6+1)515): .69)4 1,-5;1.1+),): ->+3<:1=)4-5;- 5) += =-94-30) "69 69,-4 ,- -3<1B@6 :@6 ): :-/<15;-:   +1)51,15) /3<+E:1,6   +1)51,15) 3)415)91*1E:1,6   +1)51,15) (3â&#x20AC;&#x2122;â&#x20AC;&#x2122; 4)36513/3<+E:1,6  7-651,15) /3<+E:1,6  +1)51,15) (6â&#x20AC;&#x2122;â&#x20AC;&#x2122;4)36513/3<+E:1,6  +1)51,15)  (6â&#x20AC;&#x2122;â&#x20AC;&#x2122;4)365133)415)91*1E:1,6  7-651,15) 4)36513/3<+E:1,6 -  +1)51,15) ,14)36513 3)415)91*1E:1,6 ! ;-69 ,- .3)=65E1: - 6 ;-69 ;6;)3 ,- .3)=65E1,-: .3)=65E1: 4)1: )5;6+1)515): :@6 :<7-9169-: 5) += =-94-30) ,-  8<- ;)4*C4 C ) += 4)1: 7<5/-5;- - +64 4)169  ,- %%& - % 6 8<- +6996*69) 6: 9-:<3;),6: ,- ()5/ -; )3 

 - ,- 'A/-5 - %314-:;), 

 :-5,6 -4 /-9)3 -::- ;176 ,- +=: ): 8<- )79-:-5;)4 4)169 )+;1=1,),- )5;179631.-9);1=) - )5;16>1,)5;- !: .3)=65E1,-: =)91)9)4 :1/51.1+);1=)4-5;- -5;9- )56: ,- 796,<B@6 &)*-3)  ;-5,6:- 6*;1,6 6: =)369-: 4)1: -3-=),6: -4

 -

 )56: +64 ): -:;)BF-: ,- +9-:+14-5;6 4)1: 8<-5;-: - :-+): - +64 6 4)169 $ &)*-3)  !: =)369-: 4)1: *)1>6: ,- .3)=65E1,-: 6+699-9)4 -4

 )56 +64 ): 4-569-: & - &% - 4)169  ,- % - $ &)*-3)  # %+/&"'%"(&    "o teor em flavonĂłides nas cvs. de cebola â&#x20AC;&#x2DC;Branca da PĂłvoaâ&#x20AC;&#x2122; e â&#x20AC;&#x2DC;Vermelha da PĂłvoaâ&#x20AC;&#x2122;. â&#x20AC;&#x2DC;Branca da PĂłvoaâ&#x20AC;&#x2122; â&#x20AC;&#x2DC;Vermelha da PĂłvoaâ&#x20AC;&#x2122; %&

#*&%,!' $ "  

#*&%,!'%(&!%!%' &(##*&%,!'$ " 

    

     

    

    

     

   #

     

372


<=.< ;.<>5=*-8< <H8 ,87,8;-*7=.< ,86 80;.7 ¤  ¥ :>. ;.98;=8> ./.2=8 98<2=2?8 -* # . ,86 $S5=8/= .= *5 ¤ ¥ :>. ?.;2/2,*;*6 6.78< /5*?87N2< 78 *78 ,86 =.69.;*=>;* 6*2< +*2A*< . 6*28; 9;.,292=*IH8 ! ./.2=8 -* ;*-2*IH8 J ,8;;8+8;*-8 ,86 ;.<>5=*-8< <2625*;.< 8+=2-8< .6 6*I* ¤ #! !"¥ .6 :>. 8< =.8;.< -. :>.;,.=27* =8=*5 /8;*6 <>9.;28;.< 78< /;>=8< .A98<=8< F 5>C ¤%+2  ¥  *,>6>5*IH8 -. /.7N52,8< . * 6*28; *,=2?2-*-. -. .7C26*< +28<<27=J=2,*< .6 ;.98<=* F <.,* 68-.;*-* . =.69.;*=>;*< *5=*< =*6+J6 /8;*6 ;./.;2-*< .6   & !! ¤'*70 . (1.70 ¥ !"#! ¤1*?.< " ¥ . ' # !! ¤+;.> . *CC*/.;*  ¥  +*2A* 27=.7<2-*-. 5>6278<* ;.<>5=* 7>6* ;.->IH8 -* /8=8<<L7=.<. :>. 5.?* * >6* -2627>2IH8 -8< *IP,*;.< . 27->C F ;.9;.<<H8 -8< 0.7.< :>. ,8-2/2,*6 .7C26*< -* ,*-.2* +28<<27=J=2,* -8< /5*?87N2-.< ¤%+2  ¥ D 2698;=*7=. ;./.;2; :>. *9.<*; -8< *78<  .  <.;.6 ,87<2-.;*-8< :>.7=.< . <.,8< ;.5*=2?*6.7=. *8< 8>=;8< *78< .6 .<=>-8 7H8 <H8 ,87-2IO.< 6.=.8;85N02,*< ,87<2-.;*-*< -. <=;.<<. 27=.7<8 *=J 98;:>. * C87* -8< .7<*28< J 6>2=8 9;NA26* -8 6*; . *9;.<.7=* 0;*-2.7=.< =J;62,8< .<=E?.2< . 68-.;*-8< . 98;:>. *27-* <H8 =.69.;*=>;*< -.7=;8 -8< ?*58;.< N9=268< 9*;* -.<.7?85?26.7=8 ¤ * R¥ ";8?*?.56.7=. *,26* -8< ?*58;.< -. R *< 95*7=*< =.;2*6 >6* ;.<98<=* -2<=27=* *=J 98;:>. 98-. ;.->C2; * *,=2?2-*-. /8=8<<27=J=2,* . .6 <26>5=G7.8 *>6.7=*; * ;.<92;*IH8 -2627>27-8 8<  7* 95*7=* . 98;=*7=8 +*2A*7-8 * ;.5*IH8  . 8< ;.<9.,=2?8< <>+<=;*=8< 9*;* * ,*-.2* +28<<27=J=2,* -8< /5*?87N2-.< ¤%+2   8;2 " ¥ <=.< ;.<>5=*-8< 9*;.,.6 2; *8 .7,87=;8 -*   . -* ;.5*,287*-* 27/5>K7,2* -8 ;E,28  7* <L7=.<. . *,>6>5*IH8 -. /5*?87N2-.< 7*< 95*7=*<

   ! =.8; .6 /5*?87N2-.< ;.?.58>Â&#x2014;<. <><,.9=L?.5 F 27/5>K7,2* -*< ,87-2IO.< *6+2.7=*2< ?.;2/2,*7-8Â&#x2014;<. :>. *78< -. 6*28; ;*-2*IH8 <85*; ,873>0*-* ,86 =.69.;*=>;*< 6*2< *5=*< . <=;.<<. 1L-;2,8 68-.;*-8 /*?8;.,.6 * *,>6>5*IH8 -.<=.< ,8698<=8< .6 -.=;26.7=8 -. *78< 6*2< /;28< . ,86 6*28; 1>62-*-. -8 *; . -2<9872+252-*-. -. E0>* 78 <858 7,87=;*;*6Â&#x2014;<. -2/.;.7I*< <2072/2,*=2?*< 78 ,87=.P-8 .6 /5*?87N2-.< 7*< ,?< .<=>-*-*< &.;2/2,8>Â&#x2014;<. :>. * ,? â&#x20AC;&#x2DC;Vermelha da PĂłvoaâ&#x20AC;&#x2122; de Dias Longos *9;.<.7=8> =.8;.< 6*2< .5.?*-8< -. /5*?87N2-.< . <26>5=*7.*6.7=. 6*28;.< =.8;.< .6 <N52-8< <85>?J2< . 6*=J;2* <.,* -8 :>. *< ,? â&#x20AC;&#x2DC;Branca da PĂłvoaâ&#x20AC;&#x2122; :>. J 27=.;6J-2* . -. 6.78; ,*9*,2-*-. -. ,87<.;?*IH8

     +;.>   *CC*/.;* " ¤  ÂĽ //.,=< 8/ @*=.; *7- =.69.;*=>;. <=;.<< 8/ *,=2?2=B ,87<=2=>.7= ' #  !! 182<B "'!  Â&#x2014;  *;=.5<  $>74*; # ¤  ÂĽ ;8>01= *7- <*5= =85.;*7,. 27 95*7=<  "$%!"!  Â&#x2014;  ;B*7= " 1*927 $ 5.27 # ¤ ÂĽ *;+87 7>=;2.7= +*5*7,. 8/ +8;.*5 95*7=< 27 ;.5*=287 =8 ?.;=.+;*=. 1.;+2?8;B ! 

Â&#x2014;  *72.5 ! .2.; $ $,15*==.;  ;2<,147.,1= " ¤ÂĽ $.5.,=.- 91.7852, ,8698>7-< 27 ,>5=2?*=.- 95*7=< ,85802, />7,=287< 1.*5=1 26952,*=287< *7- 68->5*=287 +B 9.<=2,2-.< $  " ! Â&#x2014;  <=2*;=.  ".M>.5*<  ¤ÂĽ &!!   =1. ;.5*=287<129 @2=1 91.78=B92,*5 95*<=2,2=B 27 <=8;*0. *7- -./.7<. />7,=287< 8/ 95*7=< !!    Â&#x2014;   8;7872  PM.CÂ&#x2014;*;/E7  &*5?.;-. " #*><1.;  ¤  ÂĽ ?85>=287 8/ 62A.- <=;*=.02.< 8/ 95*7= -./.7<. *558,*=287 *0*27<= 7*=>;*5 .7.62.< $#"  ¤ÂĽ  Â&#x2014;   ;2=C  "*5*,28<Â&#x2014;#83*<  .25 # $=2==  ¤  ÂĽ #.0>5*=287 8/ <.,87-*;B 6.=*+852<6 +B =1. ,*;+87Â&#x2014;72=;80.7 <=*=>< 27 =8+*,,8 72=;*=. 2712+2=< 5*;0. <.,=8;< 8/ 91.7B59;89*782- 6.=*+852<6 "  ¤ ÂĽ

Â&#x2014;  olisovĂĄ, A., Slamka P., KĂłĹ&#x2C6;a J. ¤ ÂĽ 87=.7= 8/ /5*?8782-< 27 87287 ¤#  ÂĽ >7-.; ?*;28>< /.;=252C*=287 "  "#"# """#  ¤ ÂĽ Â&#x2014; 

373


I   ¤–©¥ % ?E (I@ (  @@?  ?@  $ I@(? /C @   @ !–  ( ?  @/  ?@ ? ?@  & ??   ?   & D? &  '( ?@E •© )  "  E   I  &?   /  ¤–©¥ #I  @   ¤$  ¥ @   @—@ @ @ ?I@/   @ $!    "#  '""  ¤ ¥ ©Ÿ—©£ (  $)(  @??(  ¤–©¥ &@  ?  @@ (?  )I/ I@?  ( / @) ? $!#%!"#'' #$!'¤•¥› –©©—–  @@  "/ $ ¤––¥ @ F@  (?    @ I@(?   ¤$  ¥

  ––¡—–•– @@  "/ $ ( @I  ¤–•¥ ! (?› I@ I?   @ )  @  —@ @ %I@ I %E?I—   ? / @E ©— E @@ " ?@   II   ¤–¥  @ @  (?  @ @  )E " C@  —E   @—E  @ @ $!  !$#$!   "#!'  ¤–¥ ©£•– ©£ FF  @  ¤¡¡•¥ #'"  !$#" %#"  !" ¤ FF   @ ?¥  $@ › $ " ?? /   ¤– ¥ #I  @ @ @  *188;C !:5;: ¤$  ¥› 221/@? ;2 A8@5B-@5;: 1@4;0? A>5:3 -:0 %@;>-31 ;/@;>-8 @41?5? %C105?4 ':5B1>?5@E ;2 3>5/A8@A>-8 %/51:/1? -/A8@E ;2 -:0?/-<1 "8-::5:3 ;>@5/A8@A>1 -:0 3>5/A8@A>-8 %/51:/1 1<->@91:@ ;2 >;< %/51:/1 8:->< /@- ':5B1>?5@-@5? 3>5/A8@A>-1 %A1/5-1 – › ¡  %%  ©–— ££ % ¡—©Ÿ —Ÿ©— ;>5  ;@;—*-9-9;@;  5@-E-9-  -?45FA91  ¤–Ÿ¥ ;?? ;2 -:@4;/E-:5:? 5: >10—C5:1 3>-<1 A:01> 4534 @19<1>-@A>1 & #©£¤£¥› ¡•©—¡© -A9-::  *;A:3 $ :01>?;:  ¤–Ÿ¥ 5:75:3 81-2 /48;>;<4E88 28A;>1?/1:/1 <>;<1>@51? @; <4E?5;8;35/-8 >1?<;:?1? 2;> 01@1/@5;: ;2 ?-8@ -:0 0>;A34@ ?@>1?? 5: /;-?@-8 <8-:@ ?<1/51? '" #!$ •›––—•• L91@4  &-7H/?;B-  "5?7A  ¤–•¥ 221/@ ;2 /;;75:3 ;: E188;C ;:5;: =A1>/1@5:   $#!  –§©•¤% ¥› Ÿ–Ÿ "-@58 % "571  *;; % ¤¡¡©¥ (->5-@5;: 5: @41 =A1>/1@5: /;:@1:@ 5: 05221>1:@ /;8;>10 ;:5;:? ¤$   ¥  !# ¤ ¥ ¡¡—¡• "L>1F—>13;>5; $ ->/·-—-8/O: % %59-8—G:0->-  $;0>53A1? % 89150- " ¤–¥ 01:@525/-@5;: -:0 =A-:@525/-@5;: ;2 28-B;:;50? 5: @>-05@5;:-8 /A8@5B->? ;2 >10 -:0 C45@1 ;:5;:? -@ 4->B1?@

$! "#'"" ¤ ¥ ©¡––©¡£ "59<I; $% ¤–¡¥ ;9<;?@;? 21:O85/;? 1 ?A- -/@5B50-01 -:@5;D50-:@1 19 1?<L/51? 01 6A:5<1>A?› -:G85?1 0- <>;0AKI; ?-F;:-8 1 ?;. /;:05KP1? 01 ?@>1??1 5??1>@-KI; 01 1?@>-0; ':5B1>?50-01 01 5?.;- -/A80-01 01 5M:/5-? 1<->@-91:@; 01 5;8;35- (131@-8 ©•<< ">5/1 $ $4;01?  ¤¡¡Ÿ¥ :-8E?5? ;2 @41 9-6;> 28-B;:;8 38E/;?501? <>1?1:@ 5: 2;A> B->51@51? ;2 ;:5;: ¤$ ¥ -:0 /4-:31? 5: /;9<;?5@5;: >1?A8@5:3 2>;9 -A@;8E?5? ! ¤•¥›••–••¡ %-:@-?  ->.; $ ;>0;:  89-6-:; " ¤–£¥ ;9<->5?;: ;2 @41 -:@5;D50-:@ -/@5B5@E ;2 @C; %<-:5?4 ;:5;: B->51@51?  ¤•¥ –––  %188-<<-: % 1 7;4  ¤––¥ 8-B;:;50? -:0 -:@5;D50-:@ /-<-/5@E ;2 1;>35-—3>;C: (50-85- ;:5;:?  !  ¤¡¥ ©••£—©•– %95@4  ;9.->0  "12281E  5A ) ¤–•¥ 1:1@5/ :-8E?5? ;2 #A1>/1@5: 5: !:5;: ¤$  ¥ ‘Lady Raider’. &" $!!$#$! #$!"$!  › –—–£ %S8@;2@  518?1:  -A>?1:  A?@10 % -817;4 ' :A@4?1: " ¤–¥ 221/@? ;2 !>3-:5/ -:0 ;:B1:@5;:-8 >;C@4 %E?@19? ;: @41 ;:@1:@ ;2 8-B;:;50? 5: !:5;:? -:0 "41:;85/ /50? 5: ->>;@? -:0 ";@-@;1? ;A>:-8 ;2 3>5/A8@A>-8 -:0 ;;0 4195?@>E©£ ¤¡¥ •–•—•–¡ '.5  ¤–¥ D@1>:-8 ?@59A8-@5;: ;2 -:@4;/E-:5: .5;?E:@41?5? 5: -<<81 2>A5@ !%!   ©— Ÿ (J31:  %8591?@-0 $ ¤–£¥ 9;A:@ ;2 /4->-/@1>5?@5/ /;9<;A:0? 5: © /A8@5B->? ;2 ;:5;: ¤$  ¥ 5: /;:@>;8810 25180 @>5-8? $!#!$#$! ¤•¥ — *-:3  1E1>?  B-: 01> 1501  5A $ ¤–¥ (->51@-8 05221>1:/1? 5: <41:;85/ /;:@1:@ -:0 -:@5;D50-:@ -:0 -:@5<>;8521>-@5B1 -/@5B5@51? ;2 ;:5;:? !  Ÿ£Ÿ— Ÿ¡• )-:3 %* +41:3 ) ¤–¥ 221/@ ;2 <8-:@ 3>;C@4 @19<1>-@A>1 ;: -:@5;D50-:@ /-<-/5@E 5: ?@>-C.1>>E !   › ¡ŸŸ–¡£–

374


Mudanças na estrutura agrícola, estimadas pelos efeitos de escala e de substituição (1999/2006), na Região do Vale do Ribeira, SP, Brasil. L. C. F. Almeida1 e P. F. Vargas1 1

Universidade Estadual Paulista, Campus Registro, Rua Nelson Brihi Badur 430, CEP 11900-000 Registro, SP, Brasil. E-mail: luiscarlos@registro.unesp.br 2 E-mail: pablo@registro.unesp.br

Resumo A compreensão dos fenômenos envolvidos na dinâmica da expansão e contração das áreas de culturas em determinada região é extremamente importante na medida em que diversos fatores podem estar envolvidos podendo trazer conseqüências sócio-econômicas extremamente graves, no caso da redução de atividades agrícolas afetando os setores relacionados a essa atividade ou, em uma situação de expansão das áreas de culturas em substituição às culturas já existentes, que podem requerer ações para estas que possam ser viabilizadas. A Região do Vale do Ribeira, localizada no extremo sul do Estado de São Paulo, composta por 13 municípios, notadamente reconhecida por sua baixa atividade econômica e que tem na agricultura sua principal fonte de renda, vem apresentando nos últimos anos grandes alterações nas áreas das culturas agrícolas, com importantes conseqüências sociais e econômicas. O objetivo deste trabalho foi de analisar a evolução das áreas das 26 principais atividades agrícolas nessa região no período 1996/2006. Para verificar a alteração na composição das atividades agrícolas adotou-se, para a determinação das áreas incorporadas ou cedidas pelas atividades, a metodologia da decomposição das áreas nos efeitos escala e substituição Identificaram-se modificações na estrutura agrícola da região com a redução, medida pelo efeito-substituição, das áreas com palmito (Euterpe edulis) em 14.135,10 ha, banana (Musa sp.) em 12.555,10 e chá preto (citrus sinensis) com 2.304 ha, totais que representam mais de 70% da área cedida, tendo como causas determinantes dessa redução problemas de ordem ambiental, fitossanitário e cambial. Alternativamente, os resultados mostram ainda a expansão de áreas com atividades voltadas a plantas ornamentais (1.214,50 ha), pupunha (Bactris gasipaes) em 2.115,60 ha, grama (Zoysia japonica) e, principalmente, pastagens formadas com 36.019,90 ha. Os dados confirmam observações empíricas de uma nova fase de atividades agrícolas na região, determinado pelo declínio da atividade da bananicultura/chá e ascensão do palmito cultivado/plantas ornamentais e pastagens. Palavras chave: efeito-escala, efeito-substituição, composição agrícola.

Changes in agricultural structure, estimated by the scale and substitution effects (1999/2006), in the region of Vale do Ribeira, Brazil. Abstract Understanding the phenomena involved in the dynamics of the expansion and contraction of crops areas in a given region is extremely important to the extent that several factors may be involved and may bring socio-economic consequences extremely serious, in case of reduction of agricultural activities affecting the sectors related to this activity or in a situation of expansion of crop areas to replace the existing cultures, which might require shares to which they may be feasible. The Vale do Ribeira, located in the southern state of São Paulo (Brazil), comprising 13 municipalities, notably recognized for its low economic activity and agriculture is their main source of income, has shown in recent years major changes in crops areas with important social and economic consequences. The aim of this study was to analyze the evolution of the areas of 26 major agricultural activities in this region in the period of 1996/2006. To verify the change in the composition of the agricultural activities, it was adopted for the determination of the incorporated areas or activities assigned the methodology of the decomposition of the areas in effects of scale and substitution. It was identified changes in the structure of the agricultural area with the reduction measured by the substitution effect of palm areas (Euterpe edulis) at 14,135.10 ha, banana (Musa sp.) at 12,555.10 and black tea (citrus sinensis) to 2,304 ha, total representing more than 70% of the assigned area, with the determinants of the reduction, problems of environmental, phytosanitary, and plant exchange. Alternatively, the results also showed the expansion of areas with activities focused on ornamental plants (1,214.50 ha), peach palm (Bactris gasipaes) in 2,115.60 ha, grass (Zoysia japonica) and mainly formed pastures (3,6019.90 ha). The data confirm empirical observations of a new phase of agricultural activities in the region, given the decline of the banana crop activity / tea and rise of cultivated palm/ornamental plants and pastures.

375


Keywords: scale effect, substitution effect, agricultural composition.

Introdução Ao longo do tempo as atividades agrícolas em determinada região podem variar. Culturas novas podem surgir, desaparecer ou terem, para aquelas já existentes, as suas áreas alteradas. A compreensão de como se dá esse processo e o entendimento dos fenômenos relacionados é muito importante, na medida que múltiplos fatores causadores podem estar envolvidos, desde a ocorrência de problemas fitossanitários, com o surgimento de novas doenças ou pragas, ou aqueles de ordem econômica, como o caso de uma sobrevalorização cambial, afetando sistemas com produtos destinados à exportação. Em uma situação, na qual uma região seja dependente de uma atividade agrícola, a redução de uma atividade pode trazer conseqüências sócio-econômicas extremamente graves, dado não só pela redução da atividade em si, mas também pelo impacto que essa redução pode causar em todos os setores direta ou indiretamente envolvidos afetando, dessa maneira, toda cadeia produtiva (fornecedores de insumos, mão-de-obra, processamento, etc.). Por outro lado, a expansão de outras culturas, em substituição às culturas já existentes, pode requerer ações do poder público para que estas possam ser viabilizadas. Vários autores (MONDAL, 2009, e HASSAN et al., 2011) realizaram trabalhos com o objetivo de analisar e medir os efeitos de modificações na estrutura agrícola regional, cabendo a primazia a Curtis (1972) que analisou e mediu os efeitos de modificações das variáveis renda e emprego na economia rural do Alabama decompondo-as em três efeitos: crescimento nacional, composição das atividades econômicas e diferenciação regional das atividades econômicas. De acordo com Santos et al. (2008) para análise da variação das áreas de culturas podem analisadas em modelos que permitem decompor a alteração da área cultivada de um produto em relação ao outro em função da variação do tamanho do somatório da área cultivada com os produtos plantados (efeitoescala) ou da substituição de um produto por outro, dentro desse mesmo sistema (efeito-substituição). O efeito-escala mensura a variação da área da cultura dentro do sistema, mantendo-se inalterada a sua participação dentro desse mesmo sistema. A partir da mensuração do efeito-escala – para cada cultura – este pode assumir valores positivos, situação essa que indica uma tendência de expansão da cultura analisada dentro do sistema, alternativamente, valores negativos, mostram a tendência da redução das áreas ocupadas dentro desse mesmo sistema. Os resultados para o efeito-escala, para cada produto, mostram como seria o comportamento da cultura se a ampliação da área total fosse distribuída de forma uniforme entre todas elas (OLIVETTE et al., 2003 e SANTOS et al., 2003). Assim, para cada cultura individualmente, se o valor obtido do efeito-escala for superior à sua variação bruta no período, temos que a cultura cedeu área, alternativamente, se a variação absoluta da área for superior ao efeito-escala a cultura em questão expandiu a sua área dentro do sistema. Por sua vez, ainda de acordo com Olivette et al. (2003), o efeito-substituição mostra a variação da cultura dentro sistema, ou seja, nesse caso tem-se informação quanto ao grau de substituição de uma atividade em relação a outra, ou seja, se uma cultura apresentar efeito-substituição positivo, significa que essa cultura substituiu outra(s) no sistema, caso contrário, seu efeito será negativo, o que não significa necessariamente que a área dessa cultura tenha se reduzido no período mas sim que, a sua expansão se deu de forma menos proporcional ao crescimento total da área na região analisada. Dessa forma, esse trabalho tem como objetivo avaliar, para a Região do Vale do Ribeira, localizada no extremo sul do Estado de São Paulo, notadamente reconhecida por seus baixos indicadores sócioeconômicos, que tem na agricultura sua principal fonte de renda, a qual vem apresentando nos últimos anos grandes alterações em suas áreas de culturas agrícolas, com importantes conseqüências sociais, que precisa ser mais bem compreendida. Assim sendo, o objetivo deste trabalho foi de analisar a evolução das áreas cultivadas com principais culturas na Região do Vale do Ribeira, no período 1996/2006, buscando entender quais os fatores envolvidos nesse processo pela análise da decomposição da área plantada no efeito-escala e efeito-substituição das diferentes culturas.

376


Material e Métodos Para esse trabalho foram utilizadas as informações constantes das áreas das 26 principais culturas agrícolas desenvolvidas na Região do Vale do Ribeira, para os municípios de Barra do Turvo, Cajati, Cananéia, Eldorado, Iguape, Itariri, Jacupiranga, Juquiá, Miracatu, Pariquera-Açu, Pedro Toledo, Registro e Sete Barras (Figura 1), tendo como base os dados do Levantamento Censitário das Unidades de Produção Agropecuária do Instituto de Economia Agrícola/Coordenadoria de Assistência Técnica Integral (IEA/CATI), para os anos de 1996 e 2006.

Figura 1 – Mapa da Região do Vale do Ribeira, São Paulo, Brasil (2009)

A alteração na composição das áreas das culturas, expansão das áreas incorporadas ou cedidas, no período em estudo, foi estimada associando-se os seus valores ao efeito-escala e a efeito-substituição conforme descrito por Santos et al. (2008) e Anefalos et al. (2007). O efeito – escala (1) e efeito – substituição (2) foi calculado segundo Olivetti et al. (2003). Efeito-escala = αAi1 − Ai1 (1) Efeito-substituição = ( Ai 2 − αAi1 ) (2), sendo α =

At 2 de tal forma que: At1

Ai corresponde à área cultivada com a i-ésima atividade agrícola;

i = 1, 2, ... , n atividades analisadas; At1 = tamanho do sistema no período 1; At 2 = tamanho do sistema no período 2;

α = relação entre At1 e At 2 , que mede a alteração do tamanho do sistema de produção.

Resultados e Discussão Na Tabela 1 encontra-se a variação das áreas para as principais atividades agrícolas, com os respectivos valores do efeito-escala e efeito-substituição, bem da variação absoluta de área entre os períodos analisados. Os resultados mostram que sete culturas (viveiros florestais, outras frutíferas, grama, plantas ornamentais, outras culturas temporárias, palmito pupunha e pastagens formadas) apresentaram efeito-

377


escala inferiores à expansão absoluta de suas áreas, indicando que estas possuem efeito-substituição positivo, ao passo que as restantes apresentaram efeito-escala superior à variação absoluta indicando que estas foram substituídas. Os valores do efeito-substituição mostram que, para essas sete culturas, o conjunto 39.247,6 ha dos quais 35.837,0 ha são representados pela expansão das pastagens formadas, sendo esse fato um indicador poderoso da redução da dinâmica agrícola local, uma vez que as principais atividades agrícolas de expressão econômica na região foram as que mais tiveram suas áreas substituídas, quais sejam, o palmito, cedendo 14.165,2 ha, banana (12.628,3 ha), chá-preto (2.311,3 ha), forrageiras (2.067,4 ha), seguidas das áreas de reflorestamento, maracujá e milho. Analisando as seis atividades que mais cederam área – palmito, banana, chá preto, forrageiras, reflorestamento e maracujá – que no conjunto totalizaram 34.531,4 ha, ou seja, 96,4% do total cedido, buscando compreender as causas desse fenômeno, foi possível verificar que não existe uma explicação única para tal, mas sim que vários fatores concorreram de forma conjunta para isso. Especificamente para o palmito, a principal explicação está relacionada da sua substituição, ainda que em escala reduzida, pelo palmito pupunha. Se, para o palmito, a sua extração implica no corte da planta após um período de quatro a cinco anos sem que ocorra a rebrota da mesma, para a planta do palmito pupunha isso não ocorre, uma vez que a mesma apresenta a característica de perfilhamento do caule, permitindo cortes sucessivos (em média a cada quatro meses) ao longo de vários anos a partir da mesma planta. O principal fator que contribuiu para a redução das atividades da bananicultura está relacionado ao aparecimento, em 2004, da Sigatoka-negra (Mycosphaerella fijiensi Morelet). Segundo Moraes e Ferrari (2007), esse patógeno, o de maior importância da bananicultura, implicou no aumento de custos dessa atividade o que fez que produtores com pouca escala de produção viessem a abandonar a cultura. A redução dessa atividade é a que mais prejuízos sociais e econômicos vêm trazendo à região uma vez que, 75% da população está ligada direta ou indiretamente a bananicultura (Gonçalves, 2006). Causas também de ordem fitossanitária explicam a redução das atividades relacionadas ao maracujá que tiveram como fator determinante a expansão do vírus do endurecimento dos frutos (Passion fruit woodiness virus – PWV) que concorreu, segundo Rossi (2006), não somente para a redução das áreas cultivadas no Vale do Ribeiro, como também para todo o estado de São Paulo. Segundo Oliveira (2006) o manejo inadequado da cultura foi o principal responsável pela disseminação da doença e sua consequente redução de área. Ainda Segundo, Rossi (2006) a queda acentuada dessa atividade é extremamente preocupante uma vez que essa cultura tem forte ambientação na pequena propriedade sendo um fator de fixação de famílias no meio rural, especificamente para o Vale do Ribeira essa situação é agravada dada a falta de alternativas para ocupação agrícola das famílias. A abertura comercial do Brasil combinada com a valorização do Real (moeda brasileira) frente ao Dólar Americano a partir dos anos 90 tem sido apontada como principal causa para o declínio da atividade do Chá-preto que teve sua área absoluta reduzida de 3.918,6 ha em 1996 para 2.280,5 ha em 2006, com um efeito-substituição superior a 2.000 ha no mesmo período. Segundo Perez (2007) a valorização cambial tem restringido as exportações desse produto, o qual passou de 2.992 toneladas exportadas em 1997 para 1.420 toneladas em 2007, situação essa que, aliada a defasagem cambial, implica em uma significativa redução de receitas, em uma das regiões mais carentes do Estado de São Paulo. Atualmente, das 15 empresas processadoras de chá-preto existentes no início dos anos 90 apenas uma continua em atividade. Considerando que o chá-preto é uma cultura perene, que apresenta altos custos para erradicação, o encerramento das atividades de processamento não implica numa redução imediata da área cultivada, mas, ao persistir a atual situação, mesmo que o câmbio venha a ser favorável, em curto espaço de

378


tempo as atividades relacionadas ao cultivo do chá-preto e o seu respectivo processamento serão extintas uma vez essa cultura necessita de mão-de-obra especializada que, paulatinamente, estão se deslocando para outras atividades, e, principalmente pelo desarticulação do arranjo produtivo. Alternativamente, os dados também mostram que, ao lado da redução de áreas com as culturas já enumeradas, observa-se a expansão de atividades de floricultura (plantas ornamentais) que apresentaram significativa expansão de área, medida tanto pela variação absoluta (23,9 ha em 1996, 962,1 em 2006) quanto pelo seu efeito-substituição (934,1 ha no período). Dentro desse mesmo contexto destaca-se também o cultivo de grama para uso paisagístico que passa de nenhum hectare em 1996 para 223,3 ha em 2006 com igual valor em seu efeito-substituição, o que pode ser um indicativo de que a Região possa a vir a se transformar em um pólo produtor de plantas ornamentais, situação essa que precisa ser mais bem avaliada uma vez não existirem dados recentes que possam confirmar essa tendência. Tabela 1. – Efeitos escala e substituição na Região do Vale do Ribeira, SP, Brasil (1996/2006) Variação Efeito Efeito Grupo de culturas 2006 % 1996 % área (ha) Escala Substituição 5.817,2 2,66 17.053,1 9,14 -11.235,9 2.929,3 -14.165,2 Palmito (Euterpe edulis) 35.990,6 16,46 41.491,7 22,24 -5.501,1 7.127,2 -12.628,3 Banana (Musa sp) 2.280,5 1,04 3.918,7 2,10 -1.638,2 673,1 -2.311,3 Chá-preto (Citrus sinensis) 453,0 0,21 2.150,9 1,15 -1.697,9 369,5 -2.067,4 Forrageiras 5.611,4 2,57 6.372,7 3,42 -761,3 1094,7 -1.856,0 Reflorestamento 446,0 0,20 1.663,5 0,89 -1.217,5 285,7 -1.503,2 Maracujá (Passiflora edulis) 757,2 0,35 1.903,3 1,02 -1.146,1 326,9 -1.473,0 Milho (Zea mays) 991,1 0,45 1.719,8 0,92 -728,7 295,4 -1.024,1 Arroz (Oryza sativa) 389,5 0,18 1.127,3 0,60 -737,8 193,6 -931,4 Feijão (Phaseolus vulgaris) 288,6 0,13 653,7 0,35 -365,1 112,3 -477,4 Olerícolas 873,7 0,40 1.074,0 0,58 -200,3 184,5 -384,8 Tangerina (Citrus reticulata) 62,7 0,03 345,0 0,18 -282,3 59,3 -341,6 Laranja (Citrus sinensis) Seringueira (Hevea 494,8 0,23 646,2 0,35 -151,4 111,0 -262,4 brasiliensis) 368,4 0,17 524,6 0,28 -156,2 90,1 -246,3 Chuchu (Sechium edule) Mandioca (Manihot 1.029,5 0,47 1.082,8 0,58 -53,3 186,0 -239,3 esculenta) 13,8 0,01 93,2 0,05 -79,4 16,0 -95,4 Café (Coffea arábica) Cana de açúcar (Saccharum 199,9 0,09 234,2 0,13 -34,3 40,2 -74,5 L.) 114,9 0,05 149,3 0,08 -34,4 25,6 -60,0 Bambu (Bambusa vulgaris) 429,0 0,20 400,2 0,21 28,8 68,7 -39,9 Cacau (Theobroma cacao) 57,1 0,03 0,0 0,00 57,1 0 57,1 Viveiros Florestais 454,6 0,21 324,2 0,17 130,4 55,7 74,7 Outras frutíferas 223,3 0,10 0,0 0,00 223,3 0 223,3 Grama ( Zoysia japonica) 962,1 0,44 23,9 0,01 938,2 4,1 934,1 Plantas ornamentais Outras Culturas 948,3 0,43 7,2 0,00 941,1 1,2 939,9 Temporárias Palmito Pupunha (Bactris 2.115,6 0,97 0,0 0,00 2.115,6 0 2.115,6 gasipaes) 53.631,2 17.794,2 35.837,0 157.221,5 71,92 103.590,3 55,53 Pastagens formadas 100 32.044,5 32.044,5 0,0 218.594,3 100 186.549,8 Total

Conclusões A análise dos resultados medidos pelos efeitos escala e substituição confirma, observações empíricas da redução do dinamismo das atividades agrícolas da região uma vez que, dos 39.247,6 ha das áreas

379


com culturas que tiveram variação positiva medida pelo efeito-substituição, 35.837,0 são representados por pastagens formadas, vindo a ocupar áreas antes com culturas tradicionais, como o palmito, banana e chá-preto. No entanto, se de um lado é possível detectar o declínio dessas culturas, por outro lado verifica-se que atividades que antes possuíam pouca expressão econômica começam a se destacar como o palmito pupunha e plantas ornamentais. Com base nos resultados conclui-se que as culturas pastagens formadas, palmito pupunha, outras culturas temporárias, plantas ornamentais e grama ganharam área e palmito, banana, chá-preto, reflorestamento e maracujá foram as principais culturas que perderam área (foram substituídas).

Bibliografía Anefalos, L. C.;Tucci, M. L. S., Modolo, V. A., Spiering, S. H. and Oliveira, A. F. (2007). Expansão do cultivo da pupunheira no Vale do Ribeira, Estado de São Paulo, 2002-2006. Informações Econômicas 10, 3743. Curtis, W. C. (1972). Shift-Share analysis as a technique in rural development research. American Journal of Agricultural Economics 54, 267-270. DER (2009). Mapa Rodoviário do Estado de São Paulo, DER, São Paulo, BR. Gonçalvez, J. S. (2006) Bananicultura no Estado de São Paulo, Brasil. In: Simpósio de manejo adequado da Sigatoka-negra na cultura da banana, 1, Pariquera-Açu, 83p. Hassan, M. K. H., Rashid, Z. A. and Hamid, K. A. (2011) East coast economic region from the perspective of shift-share analysis. International Journal of Business and Society 12, 79-88. Mondal, W. I. (2009). An analysis of the industrial development potential of Malaysia: a shift-share approach. Journal of Business & Economics Research 7, 41-46. Moraes, W. S., Ferrari, J. T. (2007) Sigatoka-negra, o constante desafio para a bananicultura: Focos da doença no Sudeste e avanços em diagnose e controle. Sociedade Brasileira de Fitopatologia, Lavras, BR, pp. 185-204. Oliveira, H. J. (2006). Incidência e manejo do vírus do endurecimento dos frutos no Estado de Minas Gerais. In: Sampaio, A. C., Fumis, A. D. and Rossi, A. D. (Eds.) Manejo no controle do vírus do endurecimento dos frutos (PWC) do maracujazeiro, Unesp, Jaboticabal, BR, pp. 37-46. Olivette, M. P. A., Almeida, M. P., Caser, D. V., Camargo, F. P. Siqueira, A. C. N. and Camargo, A. M. M. (2003). Uso do solo agrícola paulista e sua distribuição regional, 1990-2001. Informações Econômicas 10, 41-77. Perez, L. H. (2007). Chá, mate e especiarias: exportações brasileiras 1996 a 2006. Informações Econômicas 7, 40-49. Rossi, A. D. (2006). Situação atual da produção de maracujá no Estado de São Paulo. In: Sampaio, A. C., Fumis, A. D. and Rossi, A. D. (Eds.) Manejo no controle do vírus do endurecimento dos frutos (PWC) do maracujazeiro, Unesp, Jaboticabal, BR, pp. 9-20. Santos, F. A. A., Faria, R. A. and Teixeira, E. C. (2008). Mudança da composição agrícola em duas regiões de Minas Gerais. Revista de Economia e Sociologia Rural 3, 579-595.

380


Caracterização de bananas após aplicação de diferentes fungicidas na póscolheita Marcelo Vieira. Ferraz1, Luis Carlos Ferreira de. Almeida2, Lucas da. Silva3, Hernandes Damasceno Santos Ribeiro de. Amorim3, Carlos Osório Chehoud Lemos. Soares3, Marcos Vieira. Ferraz4 1

Prof. Assistente Doutor da UNESP - Campus Experimental de Registro, Rua Nelson Brihi Badur, Vila Tupy -

Registro, SP, CEP 11900-000. ferraz@registro.unesp.br ; 2 Prof. Assistente Doutor do Campus Experimental de Registro CER/UNESP , 3 Graduando do Campus Experimental de Registro/UNESP , 4 Doutor em Produção Vegetal UNESP/ Jaboticabal.

Resumo Pouca informação se tem sobre o comportamento pós-colheita de frutos de banana após a aplicação de fungicidas na região de Registro-SP. Objetivou-se avaliar os sólidos solúveis (ºBrix), pH e acidez total titulável das bananas após a aplicação de diferentes fungicidas. O delineamento experimental utilizado foi inteiramente casualizado em esquema fatorial 4x2, quatro fungicidas, duas concentrações para cada fungicida e dois graus de maturação, mais tratamento adicional utilizando somente água, repetidas nas quatro estações do ano. Cada experimento teve três repetições com 4 buquês de 5 frutos. Para as bananas climatizadas os maiores valores de ºBrix foram observados nos frutos tratados com Propiconazol e Imidazol. Já para as bananas não climatizadas os menores valores de ºBrix foram observados para os frutos tratados com Azoxistrobina no outono e os menores valores de pH e maiores de acidez foram paras as bananas tratadas com Azoxistrobina no inverno. Conclui-se que para as bananas climatizadas os produtos não interferem na qualidade dos frutos, independentemente de suas concentrações, nas estações de primavera, verão e outono, pois os valores de ºBrix, pH e acidez não diferiram da testemunha. O mesmo foi observado para as bananas não climatizadas no verão e inverno. Palavras chaves: Pós-colheita, amadurecimento, qualidade, Musa ssp.

Characterizacion of bananas after application of different fungicide in post-harvest

Abstract Little information exists about the postharvest behavior of bananas after application of fungicides in the RegistroSP region. This study aimed to evaluate the soluble solids (ºBrix), pH, and total acidity of the bananas after the application of fungicides. The experimental design was completely randomized in a 4x2 fungicidal factorial with two concentrations for each fungicide and two degrees of maturity, plus additional treatment using only water, repeated in four seasons. Each experiment had three replications with four bouquets of five fruits. For acclimatized bananas, higher values of ºBrix were observed in fruits treated with Propiconazole and Imidazole. For bananas not acclimatized minor ºBrix values were observed for fruit treated with Azoxystrobin in autumn and lower pH values and higher acidity for bananas that were treated with Azoxystrobin in winter. We conclude that for acclimatized bananas, the products do not interfere with the quality of the fruit, regardless of their concentrations, in spring, summer and fall, because the values of ºBrix, pH and acidity did not differ from the control. The same was observed for bananas not acclimatized in summer and winter. Keywords: Post-harvest, ripening, quality, Musa ssp.

381


Introdução A banana é um fruto tropical de maior produção no mundo com a colheita de 90.705.922 de toneladas. O Brasil é o 2º produtor mundial com uma produção de 7.116.808 toneladas numa área de 513.656 mil hectares; perdendo somente para a Índia FAO (2010). O Centro de origem da maior parte das variedades de banana é a Ásia tropical, com centros secundários na áfrica e Ilhas do Oceano Pacífico. São filhas de duas espécies selvagens Musa acuminata e Musa balbisiana, as bananeiras se espalharam por todas as regiões tropicais e subtropicais do globo (PBMH; 2006). Dentre as regiões onde esta planta se adaptou está o Vale do Ribeira no estado de São Paulo. Esta região possui diversas vantagens que podem permitir a ampliação da produção destes frutos tais como: micro climas privilegiados, a disponibilidade de terra, água, mão-de-obra e tecnologias agronômicas disponíveis.Uma das principais características de Registro-SP e região é que existem diversos produtores de bananas responsáveis por grande parte da produção do Estado de São Paulo, porém pouco se sabe sobre o comportamento destes frutos em sua vida de prateleira. Embora seja uma das principais frutas exportadas brasileiras, a banana está longe de liderar as exportações para os países mais desenvolvidos, uma vez que o produto nacional é de um modo geral desqualificado para os mercados europeus e norte-americanos, pois não atende as exigências dos mesmos, principalmente em relações às características organolépticas das bananas (MATTHIESEN; BOTEON, 2011).

Justificativa O presente projeto justifica-se pelo grande potencial econômico que estes frutos representam para os produtores da região do Vale do Ribeira e também pela pequena quantidade de pesquisas realizadas com fungicidas durante a fase de pós-colheita. As doenças nos frutos de bananas durante a pós-colheita contribuem para a diminuição da qualidade e vida útil dos mesmos. A aplicação de fungicidas nesta fase pode reverter este processo. Portanto conhecer o comportamento dos frutos após a aplicação de diferentes fungicidas torna-se tarefa importante já que pouco se sabe sobre o comportamento póscolheita destes frutos logo após a climatização e aplicação de fungicidas durante a fase de pós-colheita. Dada a quase total inexistência de pesquisas que investiguem a possibilidade do uso destes fungicidas em pós-colheita nos principais cultivares comercializados no país e visto ser subjetivo o sistema de classificação empregado por produtores e supermercados, é preciso determinar tratamentos químicos e criar critérios para melhor classificar estes frutos em pós-colheita na fase de pré-consumo. Esta pesquisa servirá de base para melhor conhecer o comportamento destes frutos com e sem a aplicação de fungicidas em diferentes concentrações em bananas climatizadas e não climatizadas na fase que precede o consumo dos mesmos, inovando o conceito e técnicas de pós-colheita para os produtores desta importante região fornecedora de bananas do Estado de São Paulo, criando assim critérios e técnicas que aumentem a competitividade destes produtos no mercado e melhorando a qualidade e prolongando a vida pós-colheita destes frutos. Material e Métodos Instalação e condução do experimento Os cachos de banana Nanica foram colhidos no estádio pré-climatérico de plantações comerciais de dois anos de idade de um único produtor, no município de Registro, São Paulo. Os cachos foram despencados e as pencas selecionadas, sendo dada prioridade às pencas centrais dos cachos, rejeitandose as duas pencas proximais e as três pencas distais, visando melhor uniformidade dos frutos durante a maturação em pós-colheita. Cada experimento foi repetido em cada estação do ano, sempre no último mês de cada estação. Posteriormente, no laboratório de Produção Vegetal da UNESP de Registro, as bananas receberam os tratamentos. Os tratamentos eram constituídos por: água (testemunha), Tiabendazol (250 mg L –1),

382


Tiabendazol (500 mg L –1), Propiconazol (250 mg L –1), Propiconazol (500 mg L –1), Azoxistrobina (250 mg L –1), Azoxistrobina (500 mg L –1), Imidazol (250 mg L –1) e Imidazol (500 mg L –1). Os frutos foram imersos nas diferentes suspensões fungicidas por 3 minutos. Decorrido o tempo de imersão, os buquês foram retirados, deixados secar e acondicionados em caixa de papelão tipo exportação e mantidos em laboratório para as análises. A climatização ou indução do amadurecimento foi feita com acetileno (carbureto de cálcio), com duas aplicações no intervalo de 24 horas e uma hora de exaustão, conforme recomendado por Moreira (1987). As características avaliadas foram: sólidos solúveis (ºBrix), pH e acidez titulável. Os sólidos solúveis (ºBrix) foram determinados com uma alíquota filtrada em gase dos frutos triturados anteriormente e medido por refratometria, através de refratômetro tipo ABBE, conforme recomendações feitas pela A.O.A.C. (1970). Os sólidos solúveis foram medidos no quando mais de 50% dos frutos do grupo testemunha atingiram a nota igual ou superior a 6 na tabela de classificação de Banana Cavendish (Figura 1).

Figura 1: índice de cor da casca de acordo com a classificação de bananas do Grupo Cavendish (Nanica e Grand Naine), durante os processos fisiológicos do amadurecimento.

Para a determinação do pH os frutos foram triturados em Graal e pistilo de porcelana e em seguida foi medido o pH, em extrato aquoso, elaborado com 10g do material fresco triturado e diluído em 100 ml de água destilada, por meio de potenciômetro conforme preconizado pelo I.A.L. (1985). A acidez total titulável (g/100g), determinada com NaOH 0,1N no mesmo extrato aquoso preparado para o pH até atingir pH 8,1 e expressa em g de ácido málico/100g de polpa, conforme preconizado pelo I.A.L. (1985). O pH e acidez foram medidos quando mais de 50% dos frutos do grupo testemunha atingiram a nota igual ou superior a 6 na tabela de classificação de Banana Cavendish (Figura 1). Análise estatística Foi realizada uma análise de variância multivariada, para as variáveis ºBrix, pH e acidez para cada uma das estações, tendo fatores produtos; concentração e produtos x concentrações. Todas estas análises foram feitas paras as bananas climatizadas e não climatizadas e todos os produtos foram comparados a testemunha. Por essa estatística valores significativos indicam que valores de WilKs Lâmbda com valores de p menores que 0,05 indicam que pelo menos uma das médias no fruto analisado é diferente dos demais. Resultados e discussões Bananas Climatizadas Os maiores valores de ºBrix foram verificados somente durante a estação de inverno quando foram usados os produtos Propiconazol e Imidazol, sendo estes superiores estatisticamente (p <0,05) independente da concentração utilizada (Tabela 1). Estes frutos com estes produtos poderiam estar mais amadurecidos que a testemunha no momento em que foram coletados para a análise, já que apresentaram maior ºBrix. Chitarra e Chitarra (2005) citam que os valores de ºBrix tendem a aumentar com o aumento da maturação. Tanto o Propiconazol como o Imidazol podem ter contribuído para a aceleração da maturação dos frutos, pois o valor de ºBrix destes estavam superiores aos 21º Brix, valor este considerado para um fruto estar amadurecido. Manoel e Vieites (2009) consideram a faixa de 1,5 °Brix para frutos verdes e 21°Brix para frutos amadurecidos. Já os valores de pH e acidez não diferiram estatisticamente.

383


Tabela 1: Médias das Análises de ºBrix, pH e Acidez das bananas climatizadas- Estação de inverno Médias (Acidez) Produto Concentração Médias (ºBrix) Médias (pH) Testemunha ZERO 20.8333 5.3100 0.1697 Propoiconazol 250 ML 23.2667 5.2700 0.1653 500 ML 22.8333 5.2867 0.3037 Imidazol 250 ML 22.9000 5.1900 0.3238 500 ML 23.4333 5.1900 0.1787

Bananas Não Climatizadas A Tabela 2 mostra que somente na estação de outono foram verificados os menores valores de ºBrix quando usado o produto Azoxistrobina sendo estes superiores estatisticamente (P<0,05). As bananas tratadas durante o outono com Azoxistrobina poderiam estar menos maduras na hora da coleta para as análises laboratoriais. Já para as demais bananas tratadas com os produtos restantes não foi observada alteração na qualidade dos frutos, já que os valores de ºBrix, pH acidez não diferiram estaticamente entre eles. Tabela 2: Médias das Análises de ºBrix, pH e Acidez das bananas não climatizadas- Estação de , outono Produto Concentração Médias (ºBrix) Médias (pH) Médias (Acidez) Testemunha ZERO 22.2333 5.0900 0.3305 250ML 16.0000 5.1733 0.3171 500ML 9.0333 5.5067 0.2635 Azoxistrobina

A Tabela 3 mostra que na estação de inverno os menores valores de pH e maiores de acidez foram observados para as bananas tratadas com Azoxistrobina, não diferindo nas concentrações utilizadas, sendo estes valores superiores (P<0,05). A alta acidez pode ser explicada pela não completa maturação dos frutos na hora da coleta do material para análise, já que os frutos maduros tendem a aumentar o pH e diminuir a acidez com a maturação. Chitarra e Chitarra (2006) citam que na faixa de concentração de ácidos entre 2,5 e 0,5%, o pH aumenta com a redução da acidez, fato não observado para os valores de pH e acidez das bananas climatizadas para a estação de inverno, já que não foi verificada diferença significativa para esta e demais estações. Tabela 3: Médias das Análises deº Brix, pH e Acidez das bananas não climatizadas- Estação de inverno Produto Concentração Médias (pH) Médias (Acidez) Testemunha ZERO 5.2733 0.2144 250ML 4.6967 0.4065 500ML 4.7633 0.4020 Azoxistrobina

Conclusões Para as bananas climatizadas os produtos não devem ser aplicados, independentemente de suas concentrações nas estações de primavera, verão e outono, pois os valores de ºBrix, pH e acidez não diferem da testemunha. Já para as bananas não climatizadas os produtos independentemente de suas concentrações não devem ser aplicados no verão e primavera, pois estes também não diferiram da testemunha. Agradecimentos À PROPE (Pró-Reitoria de Pesquisa) da UNESP (Universidade Estadual Paulista) e a FUNDUNESP (Fundação para o Desenvolvimento da UNESP) pelo apoio financeiro no desenvolvimento do trabalho.

384


Bibliografía A.O.A.C. - Association of Official Analytical Chemists. (1970). Official Methods of Analysis of the Association of official Analytical Chemists. William Horwitz. U.S.A .15, pp.1015. Chitarra, M. I. F.; Chitarra, A. B. (2005). Pós-colheita de frutas e hortaliças: fisiologia e manuseioUFLA, Lavras, Minas Gerais, pp.680-681. FAO, FAOSTA-CROP < http://faostat.fao.org/site/567/desktopdefault.aspx?pageID=567#ancar>. Acesso em 31, maio de 2010. I. A. L. – Instituto Adolfo Lutz. (1985). Normas analíticas: métodos químicos e físicos para a análise de alimentos. Instituto Adolfo Lutz, São Paulo, pp.370-371. Manoel, L., Vieites, R. L. (2009). Utilização da radiação gama, na dose de 0,4 KGY na redução da temperatura de armazenamento da banana “Nanica’. Energia na Agricultura 24, 85-97. Matthiesen, M. L. e Boteon, M. Análise dos principais pólos produtores de banana no Brasil. < http://www.abavar.com.br/pesquisas/2011/01.pdf Acesso em 01, junho de 2011. Moreira, R. S. (1987). Banana: teoria e pratica de cultivo. Fundação Cargil, Campinas, São Paulo, pp.335-336. PBMH– Programa Brasileiro para Modernização da Horticultura e Produção Integrada de Fruta (2006). Normas de Classificação de Banana. CEAGESP, São Paulo, São Paulo, 1-4. (suplemento).

385


Evolución del coste de la energía en España y su influencia en el Regadío desde la liberalización del mercado energético Ricardo Abadía Sánchez 1, Carmen Rocamora Osorio1, Jorge Vera Morales1, Miguel Mora Gómez1 1

Departamento de Ingeniería Escuela Politécnica Superior de Orihuela. Universidad Miguel Hernández. Carretera de Beniel km. 3,2 03312 Orihuela (Alicante). e-mail: abadia@umh.es

Resumen El regadío es uno de los sectores en los que la importancia de la energía como recurso básico es cada vez mayor, debido a la mayor dependencia energética de los regadíos modernizados y al incremento del precio de la energía. La modernización del regadío llevada a cabo en España en los últimos años, unido a la supresión de las tarifas especiales de riegos y a la liberalización del mercado energético, han situado a la energía como un recurso básico del regadío, siendo el gasto energético una de las principales partidas del balance económico de las Comunidades de Regantes. En este trabajo se hace un análisis de la influencia de la supresión de las tarifas especiales de riegos y el incremento del coste de energía, en el regadío. Para ello se analiza el coste de la energía antes y después de la liberalización del mercado eléctrico, desde el año 2007 hasta el 2012, así como la evolución del gasto energético de dos comunidades de regantes durante dicho periodo, mediante el análisis de su facturación energética. De las dos comunidades estudiadas, la primera pasó de un contrato con tarifa R.1 a un contrato con tarifa 3.1A, mientras que la segunda pasó de contrato con tarifa 2.1 a un contrato con tarifa 6.1. Los resultados muestran un incremento del coste del término de potencia del 75,2% en los tres periodos de la tarifa 3.1A y del 81% en los seis periodos de la tarifa 6.1. Respecto a la parte regulada del término de energía, el incremento de coste ha sido del 224%, 207% y 112% en P1, P2 y P3 respectivamente de la tarifa 3.1A y del 390,1%, 291,8%, 134,1%, 76,3%, 81,4% y 41,3% en P1, P2, P3, P4, P5 y P6 respectivamente de la tarifa 6.1. Estos incrementos de tarifa han dado lugar a incrementos del coste del kWh facturado en las dos comunidades de regantes analizadas, del 82,5% y el 34,4% respectivamente. Palabras clave: Tarifas eléctrica, coste energético, regadío

Cost evolution of energy in Spain and its influence on irrigation since energy market liberalisation Abstract Irrigation is one of the sectors in which the importance of energy as basic resource is growing because of a greater energy dependence of new modernized irrigation systems and the increase of the energy price. The modernization of irrigation carried out in Spain in recent years, coupled with the abolition of special electricity tariff of high and low voltage for irrigation and the liberalisation of the Spanish electricity market, have put energy as a basic resource of irrigation. Energy expenditure has become one of the main entries on the economic balance of water user’s associations. In this work an analysis of the suppression of the special electric tariffs for irrigation and the rise of the energy cost on the irrigation sector is done. For that, the energy cost before and after the liberalisation of the energy market, from 2007 to 2012, is analysed, as well as the evolution of the energy expenditure of 2 water user’s associations during the same period, based on their energy billing. The first of two water user’s associations change its electricity contract from rate R.1 to rate 3.1A, while the second change from rate 2.1 to rate 6.1. The results show an increase in the cost of the end of power of the 75.2% in all three billing periods of rate 3.1A and 81% in all six billing periods of rate 6.1. With respect to the regulated part of the energy term, the rise in cost has been 224%, 207% and 112% in P1, P2 and P3 billing periods respectively of rate 3.1A, and 390,1%, 291,8%, 134.1%, 76.3%, 81.4% and 41.3% in P1, P2, P3, P4, P5 and P6 billing periods respectively of rate 6.1. These rate increases have resulted in increases in the cost of the invoiced kWh in the two water user’s associations analyzed, of 82.5% for the one with rate 3.1A and 34.4% for the one with rate 6.1. Keywords: Electricity tariffs, energy cost, irrigation

386


Introducción La importancia de la energía en el regadío se ha incrementado considerablemente en los últimos años, debido principalmente a cuatro hechos claves que han influido de forma decisiva en el cambio de la configuración del regadío español. Estos hechos han sido los siguientes: 1. La masiva trasformación de los sistemas de aplicación de agua de riego, producida desde mediados de los años 70 del pasado siglo, pasando de riego por gravedad, que no necesitaba aporte de energía, a riego a presión (aspersión y goteo), que sí necesitan energía para su aplicación. Actualmente, en torno al 70% de la superficie de riego en España se riega por estos sistemas, como se puede ver en la Figura 1.

Figura 1. Reparto de la superficie de riego según sistema de aplicación. Fuente MAGRAMA 2011.

2. La ejecución de los sucesivos planes de modernización de regadíos, como el Plan Nacional de Regadíos Horizonte 2008 y el Plan de Choque de Modernización de Regadíos 2006-2008, han promovido la modernización de las redes colectivas de distribución de agua de riego, cambiando las acequias y canales por redes ramificadas de tuberías a presión, que necesitan aporte de energía. Esta modernización ha dado lugar a que se centralice en consumo energético en las Comunidades de Regantes, encargadas de asegurar el correcto aprovechamiento de las concesiones de agua para regadíos, repercutiendo en el coste del agua, el coste energético necesario para su correcta distribución y aprovechamiento. 3. La supresión definitiva de las tarifas especiales de alta y baja tensión para riegos, a partir del 1 de julio de 2008, tal y como se anunciaba en el Real Decreto 871/2007, de 29 de junio, por el que se ajustan las tarifas eléctricas a partir del 1 de julio de 2007. 4. La liberalización del mercado eléctrico español, obligando a los consumidores a la suscripción del contrato de suministro en el mercado libre a partir de 1 de julio del 2008, tal y como se recoge en la disposición transitoria primera de la Orden ITC/1857/2008, de 26 de junio, por la que se revisan las tarifas eléctricas a partir del 1 de julio de 2008. Como resultado de estos cuatro hechos, la dependencia energética del regadío ha aumentado casi hasta valores del 100%, en el caso del regadío modernizado, y al mismo tiempo, el precio de la energía ha aumentado considerablemente, por lo que el gasto energético ha pasado a ser una de las principales partidas del balance económico de las comunidades de regantes. Según Corominas (2010), el consumo energético medio del regadío pasó de 206 kWh/ha en el año 1950 a 1560 kWh/ha en el año 2007, lo que ha supuesto un incremento del 657%. Abadía et al. (2010) obtienen un consumo medio aún mayor: en 24 auditorías energéticas realizadas en comunidades de regantes con su infraestructura parcial o totalmente modernizada, localizadas en Castilla La Mancha, Alicante y Murcia, obtuvieron un consumo de 2498 kWh/ha pare el año 2007. En cuanto al coste de la energía, Ederra y Murugarren (2010) lo analizan en una comunidad de regantes, antes y después de la liberalización del mercado eléctrico, siendo el incremento de su coste energético del 80%. En este trabajo se hace un análisis de la influencia de la supresión de las tarifas especiales de riegos y el incremento del coste de energía en el regadío. Para ello se analiza el coste de la energía antes y después de la liberalización del mercado eléctrico, desde el año 2007 hasta el 2012, así como la evolución del gasto energético de dos comunidades de regantes durante dicho periodo, mediante el análisis de su facturación energética.

387


Material y Métodos El estudio del coste de la energía antes y después de la liberalización del mercado eléctrico, se basa en los precios de los términos de potencia y energía de las tarifas de acceso 3.1A y 6.1 publicadas en el BOE, desde el año 2007, antes de la liberalización del mercado energético, hasta el año 2012. Se debe tener en cuenta que la parte regulada de ambas tarifas se corresponde con el término de potencia y una pequeña parte del término de energía, diferentes en ambos casos para cada periodo horario de facturación. Ese término de energía fijo regulado por BOE incluye como principales conceptos los peajes por la utilización de las redes de distribución, la subvención a las renovables y la compensación a las eléctricas por el déficit tarifario. El coste final que ha de pagar el cliente por cada kWh consumido será la suma de ese coste del kWh regulado por BOE más el coste de la energía del día en el que se consume más el margen de beneficio de la compañía comercializadora. Par el estudio de la evolución del gasto energético en dos comunidades de regantes, la comunidad de regantes 1 (CCRR1) pasó de un contrato con tarifa regulada de riegos R.1 a un contrato con tarifa libre 3.1A, mientras que la CCRR2 pasó de contrato con tarifa regulada 2.1 a un contrato con tarifa libre 6.1. En ambas comunidades de regantes se ha analizado la evolución del coste del kWh facturado para todo el periodo de estudio. Para determinar la influencia del periodo horario de facturación en el coste del kWh facturado, se ha analizado también el porcentaje del consumo en cada uno de los periodos horarios de facturación.

Resultados y Discusión En la Tabla 1 se muestran los costes de los términos de potencia y energía de las tarifas de suministro especial de Riegos R.1 y de Media utilización 2.1, vigentes hasta el primer semestre de 2008, justo antes de la entrada en vigor de la supresión de las tarifas especiales y la obligatoriedad de suscribir contratos en el mercado libre de energía mediante las tarifas de acceso. Los precios que aparecen en la Tabla 1 son los precios finales que figuraban en factura, ya que hasta esa fecha, el precio de la energía estaba regulado. Tabla 1. Costes de las tarifas de suministro R.1 y 2.1en el 1ersemestre de 2008 T. Energía (€/kWh) T. Potencia Tarifa (€/kW mes) Punta pico Punta Llano Valle Riegos (R.1) DH3 0,647756 0,177782 0,088891 0,050668 Media utilización (2.1) DH5 4,944381 0,30210 0,15105 0,075525 0,043049

Valle bajo 0,037762

En cuanto a la evolución de los costes de las tarifas de acceso, en la Figura 2 se puede ver la evolución del coste de los términos de potencia y energía de la tarifa 3.1A, desde el año 2007 al 2012. En ella se aprecia un incremento del 75,2% del término de potencia, para los tres periodos horarios, y un incremento del 224%, 207% y 112% del término de energía en P1, P2 y P3 respectivamente. Estos incrementos ponen de manifiesto la importancia de ajustarse a los periodos tarifarios para evitar el sobre coste del kWh consumido. No obstante, como se ha comentado en el apartado anterior, estos incrementos de coste del término de energía son solo de la parte regulada de dicho término, por lo que no se traducen en los mismos incrementos de coste del kWh finalmente facturado, no pudiendo compararlo con el coste del término de energía de la tarifa R.1. Comparando el coste del término de potencia de la tarifa de Riegos, (0,648 €/kW mes) con el de la tarifa 3.1A para el año 2008 (15,09, 9,31 y 2,13 €/kW año para P1, P2 y P3 respectivamente), si consideramos un mes de 30 días, se obtienen 1,24, 0,764 y 0,175 €/kW mes para P1, P2, y P3. Suponiendo que se contrata las misma potencia en los tres periodos, supondría un coste mensual de 2,181 €/kW mes para el año 2008, y de 3,697 €/kW mes para el año 2012, lo que supone unos incrementos del 236,6% y del 470,8% respectivamente sobre la tarifa R.1. No obstante, existe la posibilidad de que la potencia contratada en P1 sea inferior a la contratada en P2 y a la contratada en P3, lo que abarataría un poco el coste final del kW contratado.

388


Evolución término de potencia Tarifa 3.1

Evolución término de energía Tarifa 3.1 90%

P1

P2

P3

0,05

Incr

250%

75%

20

60%

15

45%

10

30%

5

15%

0

€/kWh

25

% incremento año 2007

€/kW año

P1

0% 2007

P2

P3

Incr P1

Incr P2

Incr P3

0,04

200%

0,03

150%

0,02

100%

0,01

50%

0

% incremento año 2007

30

0%

2008 1er sem 2º sem 1er sem 2º sem abr-11 ene-12 abr-12 2009 2009 2010 2010 Periodo

2007

2008

1er sem 2º sem 1er sem 2º sem 2009 2009 2010 2010 Periodo

abr-11

ene-12 abr-12

Figura 2. Evolución del coste del término de potencia y energía de la tarifa 3.1A.

En la Figura 3 se puede ver la evolución del coste de los términos de potencia y energía de la tarifa 6.1, desde el año 2007 al 2012. En ella se aprecia un incremento del 81% del término de potencia, para los seis periodos horarios, y un incremento del 390,1%, 291,8%, 134,1%, 76,3%, 81,4% y 41,3% en P1, P2, P3, P4, P5 y P6 respectivamente. Evolución término de potencia Tarifa 6.1 P1

P2

P3

P4

P5

P6

Incr

80%

16

70%

14

€/kW año

90%

18

60%

12

50% 10

40%

8

30%

6 4

20%

2

10%

0

% incremento año 2007

20

0%

2007

2008 1er sem 2º sem 1er sem 2º sem abr-11 ene-12 abr-12 2009 2009 2010 2010 Periodo

Evolución término de energía Tarifa 6.1

Evolución incremento término de energía Tarifa 6.1 450%

0,08

P2

P3

P4

P5

P6

0,07 €/kWh

Incr P2

Incr P3

Incr P4

Incr P5

Incr P6

400% % incremento año 2007

P1

Incr P1

0,06 0,05 0,04 0,03

350% 300% 250% 200% 150% 100%

0,02 50% 0,01

0%

0

-50% 2007

2008

1er sem 2º sem 2009 2009

1er sem 2010

Periodo

2º sem 2010

abr-11

ene-12

abr-12

2007

2008

1er sem 2º sem 1er sem 2º sem 2009 2009 2010 2010 Periodo

abr-11

ene-12

abr-12

Figura 3. Evolución del coste del término de potencia y energía de la tarifa 6.1.

En la tarifa 6.1 se aprecia en mayor medida que en la 3.1A, la importancia de ajustarse a los periodos horarios de facturación, ya que el incremento de la parte regulada del término de energía es casi diez veces mayor en P1 que en P6, por lo se penaliza el mucho más el consumo en horas punta. Comparando el coste del término de potencia con el coste del término de potencia de las tarifas de riegos R.1 y general de Media utilización 2.1 mostrados en la Tabla 1 y procediendo del mismo modo que para la tarifa 3.1A, si se contrata las misma potencia en los seis periodos, supondría un coste mensual de 2,295 €/kW mes para el año 2008, y de 4,025 €/kW mes para el año 2012, lo que supone un incremento del 254,3% y el 520,7% respectivamente sobre la tarifa R.1, y un descenso del coste del 53,6% y el 18,7% respectivamente sobre la tarifa 2.1. Se observa que este precio es menor con la tarifa

389


actual que con las tarifa 2.1. El problema de sobre coste con la tarifa actual se produce por el incremento del mayor coste final del kWh y por la facturación del exceso de potencia, lo que exige ajustarse minuciosamente a la discriminación horaria contratada, ya que en la tarifa 6.1 el exceso de potencia se paga tantas veces como períodos de 15 minutos se haya registrado una potencia superior a la contratada. Para determinar la repercusión del incremento de coste de la parte regulada del término de energía en el coste final del kWh facturado, se analiza la evolución del kWh finalmente facturado en las dos comunidades de regantes estudiadas, cuyas características se recogen en la Tabla 2. Tabla 2. Características de las dos comunidades de regantes estudidadas CCRR1 CCRR2 Superficie regable (ha) 2.213 5240 Potencia total instalada (kW) 826 2590 Tipo contrato hasta 2008 R.1. DH3 2.1 Tipo contrato desde 2008 3.1A 6.1 Potencia instalada contrato analizado (kW) 70 2590 Energía anual media consumida contrato (kWh) 68.885 12.363.740 Coste anual medio de la energía facturada contrato (€) 12.417 1.091.901

En la Figura 4 se muestra la evolución del precio medio, en €/kWh, pagados por la CCRR1, obtenido como el total de la factura dividido entre la energía consumida, desde el año 2008, cuando se empezó a facturar con la tarifa 3.1A, hasta el año 2012. También se muestra el porcentaje de consumo por periodo horario. No se tienen datos anteriores a 2008. Evolución del consumo de enrgía por periodo horario

Evolución del coste del kWh facturado tarifa 3.1A 0,24

90,0%

%P1

% incr 75,0%

0,16

60,0%

0,12

45,0%

0,08

30,0%

0,04

15,0%

%P2

%P3

70% % consumo por periodo

0,2

% incremento año 2008

€/kWh

€/kWh

80%

60% 50% 40% 30% 20% 10% 0%

0 2008

0,0%

2009

2010 Periodo

2011

2012

2008

2009

2010

2011

2012

Periodo

Figura 4. Evolución del coste del kWh facturado y % de consumo por periodo en la CCRR1

Se observa un incremento global del coste del kWh facturado del 82,5% en el periodo estudiado. El mayor incremento del coste se produjo entre 2008 y 2010, coincidiendo con los mayores aumentos de la parte regulada de la tarifa (Figura 2). Además, en el año 2011, el coste del kWh facturado descendió de un incremento respecto al 2008 del 53,4% en 2010 a un incremento del 38,5% en 2011, debido principalmente al mayor porcentaje de consumo de energía en P3 y menor en P1 que se produjo en 2011 respecto a 2010. Esto pone de manifiesto la importancia de ajustarse a los periodos horarios de facturación para conseguir un menor precio del kWh facturado. En la Figura 5 se representa la evolución del precio medio (€/kWh) facturado a la CCRR2, desde el año 2007, cuando la tarifa era de Media utilización 2.1, hasta el año 2012 con tarifa 6.1. También muestra el porcentaje de consumo por periodo horario de facturación. Los datos correspondientes a los periodos horarios del año 2007 son los periodos Punta pico, Punta, Llano, Valle y Valle bajo, habiéndolos asignado a periodos P1, P2, P3, P4 y P5 respectivamente, por lo que en 2007 no aparece consumo en P6. El incremento del coste del kWh facturado durante todo el periodo fue del 34,2%. Se observa un incremento muy brusco del coste del kWh a pesar del menor coste del término de potencia de la tarifa 6.1 respecto a la 2.1. Esto se debe al que el cambio de tarifa produjo un incremento del coste del kWh y un cambio en los periodos horarios de facturación, lo que hizo que el consumo de

390


energía no estuviese perfectamente adaptado a los periodos horarios más económicos, como muestra la Figura 5. En la figura se aprecia que en 2008 el porcentaje de consumo en P6 es mínimo y en P2 es máximo, lo que hace que el precio finalmente facturado del kWh sea el más elevado del todo el periodo estudiado. Evolución del consumo de enrgía por periodo horario

Evolución del coste del kWh facturado tarifa 6.1 0,15

50%

%P1

% Incr

%P2

%P3

%P4

%P5

%P6

40%

0,09

30%

0,06

20%

0,03

10%

€/kWh

0,12

% consumo por periodo

80%

% incremento año 2007

€/kWh

90%

70% 60% 50% 40% 30% 20% 10% 0%

0 2007

0%

2008

2009

2010 Periodo

2011

2012

-10%

2007

2008

2009

2010

2011

2012

Periodo

Figura 5. Evolución del coste del kWh facturado y % de consumo por periodo en la CCRR2

A pesar del gran incremento del coste de la parte regulada de la tarifa mostrado en la Figura 3, los resultados muestran que con un buen manejo de los periodos horarios de consumo, el incremento final del coste del kWh facturado no es tan grande como inicialmente se preveía en el año 2008, cuando se suprimieron las tarifas de suministro reguladas y entraron en vigor las nuevas tarifas de acceso. En la CCRR2, este hecho se debe en gran medida a que el porcentaje de consumo en P6 es muy elevado y alrededor del 80% de la facturación se debe al término de energía, siendo la repercusión del término de potencia de alrededor del 7%. Para tener una mayor representatividad de la influencia real que la liberalización del mercado ha tenido sobre el regadío, se deberían analizar un mayor número de comunidades de regantes con diferentes hábitos y consumos de energía.

Conclusiones -

-

En el periodo estudiado, se ha producido un incremento del coste del término de potencia del 75,2% en la tarifa 3.1A y del 81% en la tarifa 6.1. Respecto a la parte regulada del término de energía, el incremento en ambas tarifas oscila entre el 224% y 112% en la tarifa 3.1A y el 390,1% y 41,3% en la tarifa 6.1. A pesar del gran incremento del coste de las tarifas de acceso, en las dos comunidades estudiadas, el incremento del coste medio de la energía(€/kWh) fue del 82,5% para la CCRR con tarifa 3.1A y del 34,4% para la CCRR con tarifa 6.1. Se comprobado en las dos comunidades de regantes analizadas, la importancia que tiene consumir la energía en los periodos horarios de menor coste, sobre la reducción del coste final del kWh facturado.

Bibliografía Abadía, R., Rocamora, C., Corcoles, J., Ruiz-Canales, A., Martinez-Romero, A., Moreno, M. (2010). Comparative analysis of energy efficiency in water users associations. Spanish Journal of Agricultural Research, 8(S2), 134-142. Corominas, J. (2010). Agua y energía en el riego, en la época de la sostenibilidad. Ingeniería del agua 17(3): 219-233. Ederra, I., y Murugarren, N. (2010). La nueva tarifa eléctrica: la escalada de precios del agua. Servicio de Asesoramiento al Regante. Riegos de Navarra S.A. 47 pp. MAGRAMA. (2011). Encuesta sobre superficies y rendimientos de cultivos (ESYRCE). Informe sobre regadíos en España. Ministerio de Agricultura, Alimentación y Medio Ambiente. Secretaría General Técnica. Subdirección General de Estadística. Madrid.

391


Efeito da secagem nos teores de compostos fenólicos e da atividade antioxidante de bananas Musa nana e Musa cavendishii Raquel P. F. Guiné1,2, Maria João Barroca3, Mariana Alves2, Solange Oliveira2, Fernando J. Gonçalves1,2, Paula M. R. Correia1,2 1

2

Dep. Indústrias Alimentares – Escola superior Agrária de Viseu, Viseu, Portugal. CI&DETS – Instituto Politécnico de Viseu, Viseu, Portugal. *e-mail: goncalves7ster@gmail.com c CERNAS / ISEC, Instituto Politécnico de Coimbra, Coimbra, Portugal.

Resumo Bananas e plátanos são hoje cultivadas em todas as regiões tropicais húmidas e constituem o quarto fruto mais cultivado do mundo. A casca da fruta varia de verde profundo a amarelo ou vermelho, enquanto que a polpa varia de branco-marfim para amarelo ou salmão-amarelo. A polpa pode ser firme, adstringente e pegajosa, quando verde, tornando-se escorregadia quando madura. O sabor pode ser leve e doce ou sub-ácido com um tom de maçã. As bananas das cultivares Musa nana (MN) e Musa cavendishii (MC) foram submetidas a secagem para a comparação das suas propriedades com a correspondente fruta em fresco. Os processos de secagem usados foram a secagem em estufa convectiva e a liofilização. Todas as amostras, bananas em fresco e após secagem, foram trituradas e depois foram usadas 5 g de amostra. Subsequentemente, foram realizadas seis extrações sucessivas para cada amostra (três com metanol e três com uma solução de acetona (40% v/v) ), com duração de uma hora cada, feitas com o auxílio de um banho de ultrassons. Para cada extrato foi determinado o conteúdo fenólico por reagente Folin-Ciocalteu, e a capacidade antioxidante foi estimada utilizando os ensaios de ABTS. Os resultados permitiram concluir que os dois tipos de banana estudados apresentaram resultados semelhantes no que diz respeito aos compostos fenólicos totais presentes. Ainda mais, observou-se que a secagem em estufa, para as duas temperaturas testadas (50ºC e 70ºC) diminuiu o teor de fenóis totais (expressos em base seca) relativamente às bananas frescas. A liofilização aumentou o teor de compostos fenólicos das amostras quando comparado a secagem em estufa. Palavras-chave: bananas, compostos fenólicos, capacidade antioxidante, processo secagem

Effect of drying on the total phenols content and antioxidant activity of bananas from cvs. Musa nana and Musa cavendishii Abstract Bananas and plantains are today grown in every humid tropical region and constitute the 4th largest fruit crop of the world. The fruit peel turns from deep green to yellow or red while the flesh varies from ivory-white to yellow or salmon-yellow. The pulp may be firm, astringent, even gummy when unripe, turning tender, slippery or starchy when ripe. The flavor may be mild and sweet or subacid with a distinct apple tone. Bananas of cultivars Musa nana (MN) and Musa cavendishii (MC) were subject to drying for comparison of their properties with the corresponding fresh fruits, namely convective air drying and lyofilization in a freeze-drier. All samples, for fresh and dried bananas, were obtained by crushing the product, having taken a mass of 5 g. Subsequently, 6 successive extractions were performed for each sample (three with methanol and three with acetone solution (40% v/v)), lasting one hour each, done with the aid of an ultrasonic bath. For each extract it was determined phenolic content by Folin-Ciocalteu reagent, and the antioxidant capacity was estimated using the ABTS assays.

392


The results allowed concluding that both types of banana studied present quite similar results in what concerns the total phenolic compounds present. Furthermore, it was observed that air drying decreased total phenols content relatively to the fresh bananas, when expressed as dry matter basis, for both temperatures tested (50 ºc and 70 ºC). Also lyophilisation decreased the phenolic content, but in a lesser extent when compared to air drying.

Keywords: bananas, phenolic compounds, antioxidant capacity, drying process

Introdução Os compostos antioxidantes podem ser definidos como substâncias que em pequenas concentrações, em comparação ao substrato oxidável, retardam ou previnem significativamente o início ou a propagação da cadeia de reações de oxidação. Estes compostos químicos naturais geralmente são aromáticos e contêm pelo menos um grupo hidroxílico, sendo denominados substâncias bioativas, que incluem entre outros compostos fenólicos que fazem parte da constituição de diversos alimentos. Os compostos fenólicos estão muito presentes no reino vegetal, podendo apresentar estruturas simples ou bastante complexas, são essenciais no crescimento e reprodução das plantas, além de serem responsáveis pela cor, adstringência e aroma em diversos alimentos (Peleg et al, 1998). Estes compostos sendo antioxidantes, combatem os radicais livres (Giada e Mancini-Filho, 2006), previnem doenças cardíacas, neurodegenerativas (Virgili e Contestabile, 2000), cancerígenas, circulatórias, inflamatórias (Soleas et al., 2002), e inibem a oxidação lipídica. A banana é um fruto bastante apreciado pela população e é amplamente consumida por todas as classes sociais, alcançando 162 Kg/pessoa/ano em algumas regiões do globo (FAO, 2012). Devido a essas particularidades, destaca-se pelo seu alto potencial como alimento funcional, comparativamente a outras frutas.

Material e Métodos Neste trabalho foram usadas amostras de duas variedades de banana, a Musa nana (MN) e Musa cavendishii (MC). As amostras foram analisadas em fresco, após secagem convectiva a 50 e 70ºC e após liofilização. Para a secagem por convecção, foi usada uma câmara de ventilação. O caudal do ar foi de 0,2 m/s, e as secagens foram realizados a temperaturas constantes de 50 ºC e 70 ºC. Para estes dois ensaios o tempo de secagem foi de cerca de 8 e 5 horas, respetivamente. Para a liofilização as amostras foram congeladas num congelador convencional da cozinha e, em seguida, deixada no liofilizador durante 96 horas a uma temperatura de cerca de -50 ° C e a uma pressão de 1 Pa. De cada uma das amostras foram obtidos extratos ricos em compostos fenólicos segundo adaptação do método proposto por Ferreira et al. (2002). Cada um dos frutos foi macerado e extraído sucessivamente com uma solução de metanol:ácido acético (98:2) (3x) e acetona/água (60:40) (3x), durante 1 hora, em banho de ultrassons à temperatura ambiente. O procedimento executado deu origem a 3 extratos de metanol (E1-M, E2-M e E3-M) e a 3 extratos de acetona (E1-A, E2-A e E3-A). Os compostos fenólicos totais foram determinados pelo método de Folin-Ciocalteu de acordo com as condições descritas por Gonçalves et al. (2012). A capacidade antioxidante foi determinada através do métodos do ABTS, descrito por Miller et al. (1993).

Resultados e Discussão A Figura 1 mostra a quantidade de compostos fenólicos presentes nos extratos de metanol e de acetona, expressos em equivalentes de ácido gálico (EAG) por grama de matéria seca, para as amostras analisadas em fresco e após os tratamentos de secagem.

393


Figura 1. Fenóis totais dos extratos de metanol e de acetona das diferentes amostras de banana. Resultados expressos em base seca. MN F- Musa nana fresca; MN 50- Musa nana secada a 50ºC; MN 70- Musa nana secada a 70ºC; MN LMusa nana liofilizada. MC F- Musa cavendishii fresca; MC 50- Musa cavendishii secada a 50ºC; MC 70Musa cavendishii secada a 70ºC; MC L- Musa cavendishii liofilizada.

Analisando a figura, é possível observar que, em geral, a quantidade de compostos fenólicos presentes nos extratos metanólicos das amostras era superior à dos extratos de acetona. A exceção era a amostra liofilizada da variedade Musa cavendishii. Considerando o total de compostos fenólicos quantificados nos dois extratos, a amostra MN F apresentava 7,11 mg GAE/g matéria seca, mais 57% do que a amostra MC F. No caso da variedade Musa nana, a quantidade média de compostos fenólicos totais das amostras secadas variou entre 3,92 e 4,79 mg GAE/g matéria seca. A secagem em estufa ventilada de bananas da variedade Musa cavendishii deu origem a amostras com teores mais baixos de compostos fenólicos (3,40 e 3,60 mg GAE/g matéria seca), enquanto que a liofilização originou amostras mais ricas em compostos fenólicos (6,57 mg GAE/g matéria seca). A quantidade de compostos fenólicos presente nos 3 extratos de metanol e nos 3 extratos de acetona está descrita na tabela 1. Tabela 1. Compostos fenólicos totais dos extratos de metanol e de acetona, das diferentes amostras de banana. E1-M E2-M E3-M E1-A E2-A E3-A MN F 2,82±0,15 1,07±0,05 0,82±0,03 1,25±0,05 0,69±0,19 0,25±0,03 MN 50 1,25±0,04 0,66±0,04 0,49±0,05 1,17±0,07 0,20±0,07 0,17±0,01 MN 70 1,29±0,10 0,63±0,03 0,47±0,02 0,87±0,04 0,33±0,01 0,21±0,03 MN L 1,57±0,07 0,75±0,01 0,51±0,04 1,00±0,16 0,57±0,09 0,31±0,04 E1-M E2-M E3-M E1-A E2-A E3-A MC F 1,81±0,20 0,44±0,15 0,39±0,10 0,64±0,08 0,49±0,07 0,41±0,10 MC 50 0,85±0,03 0,63±0,05 0,52±0,16 0,79±0,03 0,34±0,08 0,17±0,02 MC 70 1,16±0,02 0,61±0,12 0,44±0,15 0,84±0,04 0,30±0,03 0,17±0,08 MC L 1,66±0,12 0,75±0,18 0,33±0,07 2,04±0,16 0,91±0,10 0,58±0,07 MN F- Musa nana fresca; MN 50- Musa nana secada a 50ºC; MN 70- Musa nana secada a 70ºC; MN L- Musa nana liofilizada. MC F- Musa cavendishii fresca; MC 50- Musa cavendishii secada a 50ºC; MC 70- Musa cavendishii secada a 70ºC; MC L- Musa cavendishii liofilizada. Média ± desvio padrão.

394


Relativamente à variedade Musa nana, a quantidade de compostos presentes nos primeiros extratos de metanol e de acetona representavam entre 50 e 57% e entre 53 e 76%, respetivamente da soma de compostos extraídos com metanol e com acetona. A figura 2 mostra a atividade antioxidante das amostras de banana sujeitas aos diferentes tratamentos. Analisando os resultados, é possível observar que os extratos metanólicos das amostras frescas e secadas a 50 e 70ºC apresentavam um valor médio de atividade antioxidante superior aos extratos de acetona. Por outro lado, no caso das amostras liofilizadas, o extrato de acetona possuía uma atividade antioxidante superior ao extrato de metanol. Estes resultados poderão indicar que os compostos fenólicos presentes no extrato de acetona das amostras liofilizadas possuíam maior atividade antioxidante quando comparados com os presentes no extrato de metanol. Comparando as duas variedades em estudo, verificou-se que a amostra fresca Musa nana possuía um valor de de atividade antioxidante de 16,0 mol trolox/g de matéria seca, superior ao 13,7 mol trolox/g obtido para a Mana cavendishii. Em ambas as variedades verificou-se uma diminuição da atividade antioxidante com os processos de secagem em estufa convectiva, em particular na Musa nana. Os valores das amostras liofilizadas eram 14,1 e 164,4 mol trolox/g, respetivamente para a MN-L e MC-L.

Figura 2. Atividade antioxidante dos extratos de metanol e de acetona das diferentes amostras de banana. MN F- Musa nana fresca; MN 50- Musa nana secada a 50ºC; MN 70- Musa nana secada a 70ºC; MN LMusa nana liofilizada. MC F- Musa cavendishii fresca; MC 50- Musa cavendishii secada a 50ºC; MC 70Musa cavendishii secada a 70ºC; MC L- Musa cavendishii liofilizada.

A tabela 2 mostra os valores de atividade antioxidante, (mol trolox/g de fruto expressos em base seca), determinada pelo método do ABTS para os três extratos de metanol e de acetona. Os valores de atividade antioxidante dos primeiros extratos de metanol das amostras frescas representavam 74 e 65% da soma dos três extratos. A desidratação das amostras provocou uma diminuição deste valor para cerca de 50%.

395


Tabela 2. Atividade antioxidante dos extratos de metanol e de acetona, determinada pelo método do ABTS, das diferentes amostras de banana. E1-M E2-M E3-M E1-A E2-A E3-A 6,8 ± 0,6 1,5±0,1 0,9±0,2 3,6±0,2 2,6±0,9 0,7±0,2 3,4±0,1 1,6±0,1 1,2±0,1 3,6±0,4 1,1±0,0 0,6±0,1 2,6±0,3 1,7±0,1 1,3±0,2 3,1±0,2 1,4±0,1 0,8±0,1 3,3±0,5 2,1±0,1 1,2±0,1 3,4±0,4 2,9±0,0 1,2±0,3 E1-M E2-M E3-M E1-A E2-A E3-A MC F 4,8±0,3 1,4±0,4 1,2±0,2 3,2±0,2 2,0±0,9 1,2±0,4 MC 50 2,7±0,1 2,8±0,3 2,0±0,1 2,5±0,3 1,6±0,3 0,8±0,1 MC 70 3,8±0,2 1,8±0,1 1,4±0,2 3,7±0,2 1,4±0,2 0,9±0,3 MC L 3,5±0,4 2,1±0,1 1,3±0,4 3,3±0,2 3,3±0,0 2,8±0,1 MN F- Musa nana fresca; MN 50- Musa nana secada a 50ºC; MN 70- Musa nana secada a 70ºC; MN L- Musa nana liofilizada. MC F- Musa cavendishii fresca; MC 50- Musa cavendishii secada a 50ºC; MC 70- Musa cavendishii secada a 70ºC; MC L- Musa cavendishii liofilizada. Média ± desvio padrão. MN F MN 50 MN 70 MN L

A composição dos diferentes extratos em compostos fenólicos totais foi correlacionada com a atividade antioxidante dos mesmos. Os resultados mostraram uma boa correlação entre os dois parâmetros, com um coeficiente de correlação de 0,7777. Estes resultados estão de acordo com o descrito por diferentes autores que correlacionam positivamente o teor em compostos fenólicos e a atividade antioxidante de alimentos (Sulaiman et al., 2011, Katalinic et al., 2004).

Conclusões Em geral, os extratos de metanol continham maior quantidade de compostos fenólicos totais do que os extratos de acetona A secagem em estufa a 50 e 70ºC deram origem a amostras com valores mais baixos de compostos fenólicos totais e de atividade antioxidante relativamente à amostra em fresco. O processo de liofilização mostrou ser um processo de secagem que preserva mais os compostos fenólicos e a atividade antioxidante, quando comparadas com a secagem em estufa.

Agradecimentos À Fundação para a Ciência e Tecnologia (FCT) e ao Centro de Investigação CI&DETS (PEstOE/CED/UI4016/2011).

Bibliografia Giada MLR; Mancini J. (2006) Importância dos compostos fenólicos da dieta na promoção da saúde humana. Ciências Biológicas e da Saúde, 12 (4), 7-15. Gonçalves, FJ; Rocha, SM.; Coimbra, MA; (2012) Study of the retention capacity of anthocyanins by wine polymeric material. Food Chemistry, 134 (2), 957-963. Katalinic, V.; Milos, M.; Modun, D.; Music, I.; Boban, M. (2004). Antioxidant effectiveness of selected wines in comparison with (+)-catechin. Food Chemistry, 86(4), 593-600. Miller, N.J.; Rice-Evans, C.; Davies, M. J.; Gopinathan, V.; Milner, A. (1993). A novel method for measuring antioxidant capacity and its application to monitoring the antioxidant status in premature neonates. Clinical Science 84(4), 407-412. Peleg, H; Bodine, KK; Noble, AC. (1998) The influence of acid on adstringency of alum and phenolic compounds. Chemical Senses, Oxford, 23 (3), 371-378. Sulaiman, SF.; Nor Adlin Md.; Yusoff, Ibrahim M. Eldeen, Seow.; Sajak, A.; Supriatno, K. (2011) Correlation between total phenolic and mineral contents with antioxidant activity of eight Malaysian bananas (Musa sp.). Journal of Food Composition and Analysis 24, 1–10.

396


Singleton, V.L.; Rossi, A. (1965). Colorimetric of total phenolics with phosphomolybdic-phosphotungstic acid reagents. American Journal of Enology and Viticulture 16, 144-158. Soleas, G.; Grassc, L.; Josephy, P.; Goldberg, D.; Diamandis, E. (2002) Comparison of the anticarcinogenic properties of four red wine polyphenols. Clinical Biochemistry, 35, 119-124. Virgili, M.; Contestabile, A. (2000) Partial neuroprotection of in vivo excitotoxic brain damage by chronic administration of the red wine antioxidant agent, trans-resveratrol in rats. Neuroscience Letters, 281, 123-126.

397


Influencia de la salinidad y el enriquecimiento carbónico en invernadero sobre la calidad en tomate tipo Raf (Delizia). Resultados preliminares M.J. Sánchez, P. Lorenzo, M.C. Sánchez-Guerrero, E. Medrano, M.J. Cabezas e I. Domínguez Centro IFAPA “La Mojonera”. Camino San Nicolás, 1. 04745 Almería e-mail: mariaj.sanchez.gonzalez.ext@juntadeandalucia.es

Resumen La preservación de la calidad de frutas y hortalizas se inicia en la precosecha y es en esa etapa donde se determina la calidad del producto en el momento de la recolección. A pesar del alto valor que adopta el tomate Raf en el mercado, en ocasiones, el consumidor no siempre recibe una calidad aceptable, con frecuencia debido a que las condiciones de crecimiento del fruto tanto térmicas como osmóticas no han sido las adecuadas. Se pretende evaluar el efecto que sobre la calidad de los frutos ejercen factores ambientales que influyen sobre el aporte de asimilados en el crecimiento vegetal, como es el caso de la concentración de CO 2 . El objetivo general del estudio es evaluar la influencia del enriquecimiento carbónico del aire del invernadero sobre la calidad, de una variedad de tomate híbrido tipo Raf (cv. Delizia), cultivada en sustrato de perlita, bajo diferentes condiciones de salinidad. Para ello, se dispuso de dos invernaderos multitúnel iguales, dotados de instalaciones para el control de clima y equipo de fertirrigación automatizado, que permitieron ajustar los niveles de salinidad de la solución nutritiva a estudiar (CE 4 y 7 dS m-1) y el aporte de CO 2 al aire, para enriquecerlo hasta 800 ëP¹ÆP¹Æ-1 para apertura de ventanas cenitales inferior al 20% y para ventanas más abiertas mantenerlo a F ëP¹ÆP¹Æ-1. Se determinaron parámetros físicos de calidad como color (ºHue) y firmeza (N) y parámetros químicos como pH, acidez valorable (% ácido cítrico) y contenido en sólidos solubles totales (ºBrix), así como el contenido en materia seca de fruto (%M.S.). Los resultados preliminares del estudio mostraron que el aumento de la salinidad incrementó la firmeza, el contenido en sólidos solubles totales, la acidez valorable y el porcentaje de materia seca de los frutos y por el contrario, redujo el pH. El enriquecimiento carbónico no afectó al pH, a la acidez valorable y al porcentaje de materia seca de fruto. En cambio, en alguno de los muestreos se observa influencia en la firmeza del fruto y el contenido en sólidos solubles totales. El estudio completo permitirá concluir con mayor contundencia sobre la influencia de este factor. Palabras clave: color, firmeza, sólidos solubles, sustrato.

Influence of salinity and greenhouse CO 2 enrichment on fruit quality in Raf type tomato (Delizia). Preliminary results Abstract Quality preservation of fruits and vegetables is initiated in preharvest and product quality at the time of harvest is determined in this stage. Despite the high value of Raf tomato in the markets, the consumer does not always gets an acceptable quality, often because the fruit growth conditions, both thermal as osmotic, were not adequate. In the present experiment the effect of environmental factors that influence the supply of assimilates in plant growth, such as the CO 2 concentration, on the quality of fruits was evaluated. The general objective of this study is to evaluate the influence of greenhouse air CO 2 enrichment on the quality of the fruits of a hybrid variety of Raf tomato type (cv. Delizia) grown in perlite substrate, under different salinity conditions. The experiment was conducted in two adjacent identical multispan plastic greenhouse of 720 m2, both equipped with climate control and automated fertigation, which allowed for the adjusting of the salinity levels of the nutrient solution (EC 4 and 7 dS m-1) and an installation for the supply of CO 2 to the greenhouse air, establishing a set point of 800 ëmol mol-1 when the roof and side vents were closed and 350 ëmol mol-1 when the percentage of roof vent opening was greater than 20%. Physical quality parameters of the fruit such as colour (ºh) and firmness (N) were measured as well as chemical parameters such as pH, titratable acidity (% citric acid) and total soluble solids content (oBrix) and the dry matter content of fruit (% DM). The preliminary results of the study showed that increasing the salinity increases firmness, total soluble solids content, titratable acidity and the percentage of dry matter of the fruit, however, the pH was reduced. CO 2 enrichment did not affect the pH, titratable acidity and the percentage of dry matter of the fruit. Instead, in some of the samples an influence on fruit firmness and total

398


soluble solids content was observed. The complete study will allow for stronger conclusions on the influence of this factor. Keywords: colour, firmness, soluble solids, substrate

Introducción El tomate asurcado tipo Raf se comercializa como producto de gran calidad por sus características organolépticas. Algunas características como contenido en sólidos solubles totales, azúcares, acidez y pH son importantes parámetros de calidad para el mercado en fresco y procesado de tomate (Cuartero y Fernández-Muñoz, 1999). A pesar del alto valor que adopta este producto en el mercado, en ocasiones, el consumidor no siempre recibe una calidad aceptable, con frecuencia debido a que las condiciones de crecimiento del fruto tanto térmicas como osmóticas no han sido las adecuadas. La calidad y el rendimiento de la producción hortofrutícola es derivada del manejo de los factores precosecha (Moccia et al., 2006). Los factores ambientales más conocidos que afectan a la calidad organoléptica del fruto de tomate son la luz y la temperatura, parámetros estrechamente relacionados (Gautier et al., 2008) y el incremento en la conductividad eléctrica de la solución nutritiva (Cornish, 1992). La práctica de riego con agua salina es una herramienta que se está utilizando cada vez más para aprovechar los efectos beneficiosos que tiene sobre la calidad de los frutos y así ha sido apreciado por mesas de catadores adiestrados desde hace mucho tiempo (Petersen et al., 1998). Por el contrario, existen pocos estudios que hayan evaluado el efecto del enriquecimiento carbónico del aire del invernadero, sobre la calidad de frutas y hortalizas, a pesar de ser una técnica que ha mostrado interés agrícola, en condiciones mediterráneas, por la mejora que supone en términos productivos (Sánchez-Guerrero et al., 2005; Alonso et al., 2012). El objetivo de este trabajo es evaluar la influencia del enriquecimiento carbónico del aire del invernadero sobre la calidad, de una variedad de tomate híbrido tipo Raf (cv. Delizia), en cultivo en sustrato, bajo diferentes condiciones de salinidad.

Material y Métodos El estudio se realizó sobre un cultivo de tomate tipo Raf (Lycopersicon esculentum Mill.) cv. Delizia, trasplantado el 29 de septiembre de 2011 en sustrato de perlita (2,5 plantas m-2), en dos invernaderos multitúnel de 720 m2 cada uno, localizados en el centro IFAPA La Mojonera (Almería), dotados de ventilación automatizada (lateral y cenital), sistema de sombreado móvil exterior y equipo de fertirrigación automatizado que permitió ajustar los niveles de conductividad eléctrica (CE) de la solución nutritiva (SN) a estudiar (4 y 7 dS m-1). El aumento de la CE de la SN en los tratamientos se realizó mediante el aporte de cloruro sódico (NaCl) al agua de riego. Los valores de CE de la solución lixiviada estuvieron entorno a 6 dS m-1 para (SN 4) y 12 dS m-1 para (SN 7). El ciclo de cultivo fue de 168 días. Uno de los invernaderos, disponía de una instalación para el aporte de CO 2 puro al aire, compuesta de bloques de 12 botellas que lo contenían en estado líquido. Se aportó CO 2 para mantener una concentración en el aire del invernadero de   ëP¹Æ P¹Æ-1 cuando la apertura de las ventanas cenitales fue inferior al 20% y para ventanas más abiertas mantenerla a F  ëP¹Æ P¹Æ-1. El gas se distribuyó a través de una red de tuberías de polietileno y emisores que se situaron en la base de las plantas. El otro invernadero, sin instalación de aporte externo de CO 2 , se consideró como testigo. Se estableció un diseño factorial de dos factores: concentración de CO 2 (CO 2 ) y CE de la SN (CE) y dos niveles para cada factor: invernadero enriquecido (C) e invernadero no enriquecido (T) y CE de la SN (4 y 7 dS m-1), obteniendo 4 tratamientos representados como T4, T7, C4 y C7. Se evaluó también la posible interacción entre ellos. Para discriminar entre las medias se utilizó el método de la mínima diferencia significativa (LSD) con un nivel de confianza del 95%.

399


En el estudio se llevaron a cabo 3 muestreos a lo largo del ciclo, correspondientes a las recolecciones efectuadas a los 110, 124 y 145 días después del trasplante (ddt). Como los parámetros de calidad del tomate están muy afectados por el estado de madurez, la recolección de los frutos se realizó manualmente cuando alcanzaron su estado de madurez comercial que para este cultivar, se considera el estado pintón (índice de color 3-4, según la carta de colores Kleur-stadia, Holanda). Para la selección de las muestras se consideró ausencia de defectos y la uniformidad en color externo, tamaño y forma. Para cada tratamiento en estudio, los frutos seleccionados se agruparon en 3 réplicas constituidas por 5 tomates cada una de ellas. Los parámetros de calidad se analizaron inmediatamente después de cosechar los frutos. Los análisis de color y de textura se realizaron en cada uno de los frutos presentes en las distintas réplicas. El color de la superficie del tomate se analizó a través de las coordenadas (CIELAB) L* (luminosidad de color) a* (rango desde verde a rojo) b* (rango desde azul a amarillo) y específicamente a través del ángulo Hue (ºh) (tono o matiz de color), con un espectrofotómetro Minolta (Minolta CM-2600d/2500d, Ramsey, NJ, EE.UU.), en tres puntos diferentes situados en la zona ecuatorial del fruto. La firmeza se determinó usando un texturómetro (TA-XT-Plus, Stable Micro System, Surrey, Reino Unido) equipado con dos placas planas. Este parámetro se expresa como una función de la fuerza requerida (N) para producir una deformación de 5 mm a una velocidad de 10 mm min-1 (Artés et al., 1999). Las medidas de pH, acidez valorable (AV) y contenido de sólidos solubles totales (SST), se realizaron sobre el jugo de la mezcla de los 5 frutos obtenidos con una licuadora Turmix (Moulinex, Barcelona, España) y posteriormente filtrados. La AV se expresó como % de ácido cítrico después de realizar una valoración con 0,1 mol L-1 NaOH (AOAC, 1984). El contenido SST se midió con un refractómetro Abbe digital (WYAS, China) y se expresó como ºBrix. En las mismas fechas de muestreo se determinó el % de materia seca de fruto comercial. Para cada tratamiento, se recogieron 6 réplicas constituidas por 4 tomates cada una de ellas, las cuales se pesaron en fresco y seco, tras ser sometidas durante 48 horas a 80ºC en estufa ventilada.

Resultados y Discusión Parámetros físicos No se observaron diferencias significativas entre tratamientos sobre el color, determinado instrumentalmente a través del ángulo Hue (ºh) (Tabla 1). Estos resultados ponen de manifiesto la homogeneidad del muestreo, presentando todos los frutos un estado de madurez similar. Las muestras se cogieron en un estado pintón (verde con algunas manchas naranja externamente y naranja en el mucílago interior) con un ºh entre 100 y 80. La salinidad y el enriquecimiento carbónico, analizados como factores independientes, afectaron significativamente a la firmeza de los frutos a partir de los 124 ddt (Tabla 1). La salinidad mejoró la firmeza de acuerdo a los resultados de Del Amor et al. (2001). La tendencia contraria se ha mostrado en otros trabajos (Krauss et al., 2006) y otros autores como Cornish (1992) no observaron ninguna modificación de este parámetro de calidad con el incremento de la CE. Este resultado pone de manifiesto que la influencia que ejerce este tratamiento en la firmeza podría depender de la capacidad de los distintos genotipos de tomate para adaptarse a la salinidad a través de mecanismos de regulación relacionados con la concentración de cloruro y sodio (Bolarin et al., 1993) y al rango de CE evaluado. Respecto al efecto del enriquecimiento carbónico, no se muestra una tendencia clara, el cual varía en el tiempo. Islam et al. (1996) no observaron diferencias significativas en la firmeza de tomates cultivados bajo distintas concentraciones de CO 2 .

400


Parámetros químicos El pH, SST (ºBrix) y AV (% ac. cítrico) se vieron influidos significativamente por la salinidad (Tabla 2). La salinidad redujo el pH de las muestras entre 1-1,8%, efecto descrito por Magán et al. (2008) para un cultivo de tomate en sustrato recirculante en el sureste español, quienes cuantificaron un 2,1% de reducción de pH para un incremento de CE de la solución nutritiva de 4 a 7 dS m-1. Por el contrario, el enriquecimiento carbónico no afectó al pH, resultado coincidente con los obtenidos por Bindi et al. (2001). El contenido de SST y la AV aumentaron con la salinidad, resultados que corroboran los obtenidos por distintos autores (Petersen et al., 1998, Cuartero y Fernández-Muñoz, 1999, Krauss et al., 2006). El contenido de SST de las muestras aumentó entre 18,9-30,1% y la AV entre 11,7-24,7%. Magán et al. (2008) cuantificaron dichos incrementos en 16,2% y 27,6% respectivamente, para un incremento de CE de la solución nutritiva de 4 a 7 dS m-1. La diferencia en la respuesta podría ser debida a la variedad de tomate en estudio. El enriquecimiento carbónico mostró una reducción puntual a los 124 ddt en el contenido de SST. Helyes et al. (2012) mostraron que el incremento de CO 2 en el ambiente (700 ppm) aumentaba el contenido de SST en tomate. La AV no se vio afectada por el enriquecimiento carbónico, resultado que coincide con los obtenidos por Bindi et al. (2001). Otros autores como Islam et al. (1996) observaron valores más bajos de ácido cítrico en tomates cultivados bajo distintas concentraciones de CO 2 .

Porcentaje de materia seca de fruto comercial El porcentaje de materia seca aumentó con la salinidad (Tabla 3), de acuerdo con otros trabajos anteriores (Li et al. 2001). En este estudio, el aumento se cifró entre 1,15-1,77 unidades. Magán (2005) estableció que dicho porcentaje aumentó en 0,9 unidades para un incremento de CE de la solución nutritiva de 4 a 7 dS m-1 para el cultivar de tomate Boludo. La diferencia en la respuesta podría ser debida a la variedad de tomate en estudio y a su capacidad de acumular materia seca en el fruto. El enriquecimiento carbónico no afectó al parámetro en estudio, lo que corrobora los resultados obtenidos por Alonso et al. (2012) para un cultivo de pimiento.

Conclusiones El incremento de salinidad, al combinar la adicción de ClNa en la solución nutritiva, ha mejorado los parámetros de calidad: firmeza, contenido en sólidos solubles totales (ºBrix), acidez valorable (% ácido cítrico) y porcentaje de materia seca de los frutos del cv. Delizia. Los resultados de este experimento preliminar, en general, indican que la aplicación del enriquecimiento carbónico en el aire del invernadero sobre dichos parámetros de calidad no tiene influencia, sin embargo, en lo relativo a la firmeza y al contenido en SST del fruto no son totalmente consistentes. En la actualidad se está llevando a cabo un segundo experimento que incluye el análisis de un mayor número de resultados y variables, lo que permitirá concluir el efecto que dicho parámetro ejerce en la calidad de los frutos.

Agradecimientos Esta investigación ha sido cofinanciada por INIA y con recursos procedentes del FEDER en el marco del “Programa Operativo de Economía basada en el Conocimiento”, a través del proyecto RTA 201000043-00-00. También se agradece la colaboración en la financiación a IFAPA y Carburos Metálicos.

Bibliografía Alonso, F.J., Lorenzo, P., Medrano, E. and Sánchez-Guerrero, M.C. (2012). Greenhouse sweet pepper productive response to carbon dioxide enrichment and crop pruning. Acta Horticulturae 927, 345-352. AOAC, 1984. Official methods of analysis, 14th Ed. Virginia, USA: Association of Official Analytical Chemists, pp. 414-420.

401


Artés, F., Conesa, M. A., Hernández, S. and Gil, M. I. (1999). Keeping quality of fresh-cut tomatoes. Postharvest Biology and Technology 17, 153-162. Bindi, M., Fibbi, L. and Miglietta, F. (2001). Free Air CO 2 Enrichment (FACE) of grapevine (Vitis vinifera L.): II. Growth and quality of grape and wine in response to elevated CO 2 concentrations. European Journal of Agronomy 14, 145-155. Bolarin, M.C., Perez-Alfocea, F., Cano, E.A., Estan, M.T. and Caro, M. (1993). Growth, fruit yield, and ion concentration in tomato genotypes after pre- and post-emergence salt treatments. Journal of the American Society for Horticultural Science 118, 655-660. Cornish, P.S. (1992). Use of high electrical conductivity of nutrient solution to improve the quality of salad tomatoes (Lycopersicon esculentum) grown in hydroponic culture. Australian Journal of Experimental Agriculture 32, 513-520. Del Amor, F. M., Martinez, V. and Cerdá, A. (2001). Salt tolerance of tomato plants as affected by stage of plant development. HortScience 36, 1260-1263. Cuartero, J. and Fernández-Muñoz, R. (1999). Tomato and salinity. Scientia Horticulturae 78, 83-125. Gautier, H., Diakou-Verdin, V., Bénard, C., Reich, M., Buret, M., Bourgaud, F., Poëssel, J. L., Caris-Veyrat, C. and Génard, M. (2008). How does tomato quality (sugar, acid, and nutritional quality) vary with ripening stage, temperature and irradiance? Journal of Agricultural and Food Chemistry 56, 1241-1250. Helyes, L., Lugasi, A., Neményi, A. and Pék, Z. (2012). The simultaneous effect of elevated CO 2 -level and nitrogen-supply on the fruit components of tomato. Acta Alimentaria 41, 265-271. Islam, M. S., Matsui, T., and Yoshida, Y. (1996). Effect of carbon dioxide enrichment on physico-chemical and enzymatic changes in tomato fruits at various stages of maturity. Scientia Horticulturae 65, 137-149. Krauss, S., Wilfried, Schnitzler, H., Grassmann, J. and Woitke, M. (2006). The influence of different electrical conductivity values in a simplified recirculating soilless system on inner and outer fruit quality characteristics of tomato. Journal of Agricultural and Food Chemistry 54, 441-448. Li, Y. L., Stanghellini, C. and Challa, H. (2001). Effect of electrical conductivity and transpiration on production of greenhouse tomato (Lycopersicon esculentum L.). Scientia Horticulturae 88, 11-29. Magán, J.J. (2005). Respuesta a la salinidad del tomate larga vida en cultivo sin suelo recirculante en el sureste español. Tesis doctoral. Universidad de Almería. Magán, J.J., Gallardo, M., Thompson, R.B. and Lorenzo, P. (2008). Effects of salinity on fruit yield and quality of tomato grown in soil-less culture in greenhouses in Mediterranean climatic conditions. Agricultural Water Management 95, 1041-1055. Moccia, S., Chiesa, A., Oberti, A. and Tittonell, P. A. (2006). Yield and quality of sequentially grown cherry tomato and lettuce under long-term conventional, low-input and organic soil management systems. European Journal of Horticultural Science 71, 183-191. Petersen, K. K., Willumsen, J. and Kaack, K. (1998). Composition and taste of tomatoes as affected by increased salinity and different salinity sources. Journal of Horticultural Science and Biotechnology 73, 205-215. Sánchez-Guerrero, M. C., Lorenzo, P., Medrano, E., Castilla, N., Soriano, T. and Baille, A. (2005). Effect of variable CO2 enrichment on greenhouse production in mild winter climates. Agricultural and Forest Meteorology 132, 244-252.

402


Tabla 1.- Efecto de la conductividad elĂŠctrica y del enriquecimiento carbĂłnico sobre el color (Âşhue) y la firmeza en la cosecha del cv. Delizia. Los asteriscos indican diferencias significativas a (*pÂ&#x160; **p0,01 n.s. diferencias no significativas) 110 ddt 124 ddt 145 ddt

T4

88,44Âą10,5

Firmeza (N) 29,33Âą6,6

T7

86,59Âą11,5

C4

96,74Âą6,9

Firmeza (N) 27,35Âą6,9

31,08Âą6,0

96,84Âą7,9

87,10Âą12,3

30,12Âą5,0

C7

86,56Âą13,0

CO 2

97,63Âą8,5

Firmeza (N) 26,99Âą6,4

30,99Âą6,4

98,50Âą7,5

30,63Âą6,7

96,47Âą8,6

25,13Âą5,6

98,38Âą8,4

30,17Âą6,5

28,31Âą4,3

94,08Âą8,5

27,91Âą6,4

97,30Âą8,7

32,36Âą5,4

n.s.

n.s.

n.s.

*

n.s.

*

CE

n.s.

n.s.

n.s.

**

n.s.

*

CO 2 *CE

n.s.

n.s.

n.s.

n.s.

n.s.

n.s.

Color (Âşh)

Color (Âşh)

Color (Âşh)

Tabla 2.- Efecto de la conductividad elĂŠctrica y del enriquecimiento carbĂłnico sobre el pH, SST (ÂşBrix) y acidez valorable (% ac.cĂ­trico) en la cosecha del cv. Delizia. Los asteriscos indican diferencias significativas a (*p**p0,01 y ***pn.s. diferencias no significativas) 110 ddt 124 ddt 145 ddt pH

AV

SST

pH

AV

SST

pH

AV

SST

T4

4,51Âą0,02

0,43Âą0,02

3,60Âą0,10

4,46Âą0,02

0,42Âą0,03

4,10Âą0,05

4,42Âą0,02

0,39Âą0,03

4,76Âą0,42

T7

4,44Âą0,02

0,47Âą0,04

4,49Âą0,15

4,43Âą0,05

0,48Âą0,02

5,26Âą0,03

4,36Âą0,02

0,47Âą0,02

5,74Âą0,33

C4

4,50Âą0,03

0,42Âą0,02

3,66Âą0,06

4,48Âą0,05

0,40Âą0,02

3,88Âą0,15

4,45Âą0,09

0,38Âą0,02

4,97Âą0,29

C7

4,41Âą0,02

0,48Âą0,02

4,74Âą0,21

4,42Âą0,03

0,44Âą0,03

5,12Âą0,08

4,36Âą0,04

0,49Âą0,05

5,83Âą0,14

CO 2

n.s.

n.s.

n.s.

n.s.

n.s.

*

n.s.

n.s.

n.s.

CE

***

*

***

n.s.

*

***

*

**

**

CO 2 *CE

n.s.

n.s.

n.s.

n.s.

n.s.

n.s.

n.s.

n.s.

n.s.

Tabla 3.- Efecto de la conductividad elĂŠctrica y del enriquecimiento carbĂłnico sobre el porcentaje de materia seca de fruto comercial en la cosecha del cv. Delizia. Los asteriscos indican diferencias significativas a (***pn.s. diferencias no significativas) 110 ddt 124 ddt 145 ddt Porcentaje de materia seca de fruto comercial (%) T4

4,75Âą0,23

5,11Âą0,70

6,02Âą0,31

T7

5,77Âą0,21

6,67Âą0,26

7,85Âą0,71

C4

4,64Âą0,27

5,10Âą0,18

6,28Âą0,21

C7

5,92Âą0,44

6,76Âą0,43

8,00Âą0,41

CO 2

n.s.

n.s.

n.s.

CE

***

***

***

CO 2 *CE

n.s.

n.s.

n.s.

403


Variation of physical properties of banana along drying for cvs. Musa nana and Musa cavendishii M. J. Barroca1 and R. P. F. Guiné2 1

CERNAS / Instituto Superior de Engenharia de Coimbra, Rua Pedro Nunes-Quinta da Nora, 3030-199 Coimbra, Portugal. e-mail: mjbarroca@gmail.com 2 CI&DETS / Dep. Indústrias Alimentares – Escola Superior Agrária de Viseu, Quinta da Alagoa, Estrada de Nelas, Ranhados, 3500-606 Viseu, Portugal. e-mail: raquelguine@esav.ipv.pt

Resumo O presente trabalho teve como objectivo proceder à secagem de duas variedades de banana (Musa nana e Musa cavendishii) à temperatura de 50 ºC e 70 ºC e comparar as propriedades dos frutos secados com as do fruto em fresco. Com os resultados obtidos concluiu-se que a densidade aparente aumenta com a perda de água durante a secagem e que os produtos secados têm menos luminosidade e são mais acastanhados, independentemente da variedade da banana. Em relação à textura, verificou-se uma redução da dureza superior a 60 % com a secagem a 70 ºC para ambas as variedades, quando comparado com o fruto fresco. Por outro lado, não se observou uma alteração significativa na coesividade e elasticidade da banana com a secagem, independentemente da temperatura de secagem e da variedade. Palavras chave: banana, secagem, densidade, cor, textura

Variation of physical properties of banana along drying for cvs. Musa nana and Musa cavendishii Abstract Bananas from two different cultivars, Musa nana and Musa cavendishii, were dried by hot air at two different temperatures (50 ºC and 70 ºC) with the purpose of comparing their properties with the corresponding fresh products. Along the drying process, it was possible to conclude that bulk density of both types of banana increased as the water content was diminishing. The results also indicate that drying originated darker products when compared to the fresh ones, with lower L* (luminosity) and b* (yellowness) and with higher a* (intensification of reddish color). These results were obtained for both cultivars under study and the two hot air temperatures (50 ºC and 70 ºC). With respect to texture, it was observed a reduction of hardness, with drying at 70 ºC, higher than 60 % for the two banana varieties, when compared with the fresh fruits. In addition, the values of cohesiveness and springiness are similar among the fresh and dried state, independently of the banana variety and the temperature of drying. Keywords: banana, dried, density, color, texture.

Introduction Banana (genus Musa) is one of the oldest cultivated plants. It is native from tropical South and Southeast Asia, but, at present, it is cultivated all over the tropics. Bananas are grown at least in 107

404


countries, primarily for their fruit, and, to a lesser extent, to produce fiber from banana. They present a variety of sizes and colors when ripe, including yellow, purple, and red. The banana, which is an excellent tropical fruit, has an agreeable flavor and a high nutritional value. The characteristic aroma of bananas arises from a complex mixture of compounds, esters of shortchain fatty acids such as acetates, butanoates, and 3-methylbutyl esters (Macku and Jennings, 1987; Perez et al., 1993). It is a calorific food, rich in carbohydrates, sugar, fiber, minerals and vitamins, and with a very low contribution of fat (Arvanitoyannis and Mavromatis, 2009). However, the chemical composition, the nutritional value and the sensory properties of the bananas can be influenced by several factors, such as cultivar, climatic conditions of the growing area, soil composition or arable land of the region, agricultural practices, storage and the commercialization conditions (Galan and Cabrera, 1999). Fresh banana changes rapidly after harvesting and the color, firmness, and flavor of the fruit are always damaged during storage (Collin and Dalnic, 1991). Drying stabilizes the product by decreasing its water activity and moisture content, but the quality of the fruit and particularly its color and flavor are sensitive to thermal treatment. Bananas are dried by several methods, including convective drying, vacuum drying, microwave drying, and microwave freeze drying with or without pretreatments (Corrêa et al., 2012). Yet, air-drying is the most common drying method employed for foodstuffs, including banana (Demirel and Turhan, 2003; Hofsetz et al., 2007). The main objective of this work was to study the effect of a convective air drying at temperature of 50 ºC and 70 ºC on the physical properties such as bulk density, color and texture of two banana varieties.

Material and Methods Banana fruits from Madeira island - Portugal (M. nana) and Costa Rica (M. cavendishii) were obtained from a local supermarket. Before starting the experiments, each banana was peeled, both ends were discarded, and then the fruit was sliced by a knife to disks with a thickness of 5 mm. The convective drying was made in an electrical FD 155 Binder drying chamber with air flow of 0.5 m/s and in perforated tray. The samples were dried until reaching a final moisture content lower than 10% (wet basis) in order to ensure good preservation characteristics as well as good final physical and chemical properties. Moisture content was determined by a halogen moisture analyser (Mettler Toledo HG 53) set to 130 ºC and velocity 3 (medium). Each experimental point was the mean value of four samples. Bulk density was evaluated by liquid displacement using water at 4 ºC in a picnometer. Color was measured according to the CIELAB color scale relative to the standard illuminant D65 over a white tile. The coordinates L* a* b* were measured using a colorimeter chroma meter CR-400 and it was used the average of 10 measurements taken in five slices for each experimental point. The texture profile analyses (TPAs) were assessed using a texture analyser (Stable Microsystems TA.XT.Plus,) and were obtained by compression of the sample in two consecutive cycles between parallel plates using a probe of 75 mm diameter with a 5 second interval between cycles. The load used cell was 5 kg and the test speed was 0.5 mm/s. The textural properties were then calculated.

Results and Discussion The initial moisture content of fresh banana was, respectively, 2.06 g/g (d.b.) and 2.61g/g (d.b.) to Musa nana and Musa cavendishii varieties. Corrêa et al. (2012) refer values of moisture content ranged between 2.38 g/g (d.b.) and 2.99 g/g (d.b.) to fresh bananas (M. acuminata var. nanica), depending on the ripe degree (unripe and overripe). Table 1 presents the drying time and the corresponding moisture content of M. nana and M. cavendishii at the end of the drying process at 50 ºC and 70 ºC.

405


Table 1. Final drying conditions at 50 ºC and 70 ºC to M. nana and M. cavendishii Final conditions Drying time (h) Moisture content (g/g w.b.) Moisture content (g/g d.b.)

M. nana 50 ºC 70 ºC 8.75 4.50 9.36 4.71 0.10 0.05

M. cavendishii 50 ºC 70 ºC 7.50 5.00 6.37 8.83 0.07 0.10

The bulk density of fresh M. nana and M. cavendishii is, respectively, 1.09 g/cm3 and 1.19 g/cm3. Figure 1 illustrates the variation of this property along drying at 50 ºC and 70 ºC of both banana varieties. During the drying process it was observed an increase of the bulk density, independently of the banana variety. The extent of change in density at 50 ºC to slices of Cavendishii banana and M. nana is, respectively, 27.1 % and 17.5 %. However, with the increase in temperature it was observed a different behavior on the extent of change in bulk density with the variety. In fact, the change of bulk density with the increase of temperature is much more pronounced in M. nana than in M. cavendishii. The obtained results for the M. cavendishii variety are consistent with the ones highlighted by Demirel and Turhan (2003), who refer that, for the Cavendishii and Gros Michel banana slices, the extent in diameter, thickness, volume area and density of the slices was not affected neither by temperature of air drying in the range of 40 ºC to 70 ºC nor the pretreatments (sodium bisulphite and ascorbic/citric acid). These authors refer also that, excluding the thickness, all the remaining parameters were affected by the banana variety. The change of bulk density with temperature to M. nana can be explained by a major effect of temperature on changes on banana physical structure and phenomena such as shrinkage, that determine the structural and physical properties of the dried product.

Figure 1. Bulk density along the drying at 50 ºC and 70 ºC of M. nana and M cavendishii.

The values for the color parameters of the Musa nana and Musa cavendishii obtained from fresh and dried fruits at 50 ºC and 70 ºC are presented in Figures 2 and 3. The coordinate L* refers to lightness, the a* coordinate refers to green (−)/red (+) chromaticity and the coordinate b* indicates blue (−)/yellow (+) chromaticity. L* values closer to 100 represent greater brightness, while values near 0 indicate less brightness. The L*, a*, and b* parameters of fresh Musa nana and Musa cavendishii are approximately 72.7, 2.5 and 32.7, and 70.5, 0.6 and 31.5, respectively. Even considering the slight differences observed in the color according to the variety Corrêa et al. (2012) identified similar values for ripe fresh bananas (M. acuminata var. nanica) 65.09, 3.49 and 25.63, respectively, for L*, a* and b* color parameter.

406


In general, the slices of the two banana varieties were white-yellowish at the fresh state and developed a yellow-brownish color along drying. Furthermore, it is possible to conclude that an increase in temperature from 50 ยบC to 70 ยบC originated a small effect on the color parameters.

Figure 2. Color coordinates versus moisture content along the drying at 50 ยบC and 70 ยบC of M. nana.

Figure 3. Color coordinates versus moisture content along the drying at 50 ยบC and 70 ยบC of M. cavendishii.

The total colour difference (ฮ”E) along the drying of the two banana varieties at 50 ยบC and 70 ยบC is illustrated, respectively, in Figure 4.

Figure 4. Total colour difference for dried M. nana and M. cavendishiiii at 50 ยบC (a) and 70 ยบC (b).

The total color difference for the two banana varieties along the drying at 50 ยบC and 70 ยบC reveals a similar color deviation in relation to the fresh fruit. However, the increase in temperature tends to

407


decrease the discoloration, particularly in M. cadendishii, implying an enzymatic character of the browning as shown by Demirel and Turhan (2003). The hardness of the samples taken from the fresh and dried bananas at 50 ºC and 70 ºC is presented in Figure 5. The results show that the two varieties of banana in the fresh state possess a similar hardness. With drying the M. cavendishii variety shows a decrease of firmness with the increase of temperature from 50 ºC to 70 ºC, while M. nana presents presents itself harder at 50 ºC when compared with the fresh state. However, for the drying of 70 ºC, both varieties show a reduction in hardness higher than 60 %. Adhesiveness in the fresh banana is 4.48 N.s to M. nana and 4.30 N.s to M. cavendishii. The dried banana has very low values of adhesiveness, independently of the drying temperature and variety.

Figure 5. Hardness of fresh and air convective dried M. nana and M. cavendishii.

Figure 6(a) shows the values found for cohesiveness of the fresh and dried banana varieties. Cohesiveness refers to the strength of the internal bonds that keep the sample cohesive. It is possible to observe that the values are similar among the fresh and dried state, independently of both the variety and the temperature of drying. Figure 6(b) reveals the springiness found for the different samples analysed in the fresh and air dried bananas. Springiness, which expresses the percentage of recovery of the sample, is similar for the two fresh banana varieties. The results also reveal that the drying temperature does not alter springiness in a visible way. (a)

(b)

Figure 6. Cohesiveness (a) and Springiness (b) of fresh and dried M. nana and M. cavendishii.

408


Conclusions Bananas from two different cultivars, Musa nana and Musa cavendishii, were dried by hot air at two different temperatures (50 ºC and 70 ºC) with the purpose of comparing their properties with the corresponding fresh products. Along the drying process, it was possible to conclude that bulk density of both types of banana increased as the water content was diminishing. The results also indicate that drying originated darker products when compared to the fresh ones, with lower L* (luminosity) and b* (yellowness) and with higher a* (intensification of reddish color). These results were obtained for both cultivars under study and the two hot air temperatures (50 ºC and 70 ºC). With respect to texture, it was observed a reduction of hardness, with drying at 70 ºC, higher than 60 % for the two banana varieties, when compared with the fresh fruits. In addition, the values of cohesiveness and springiness are similar among the fresh and dried state, independently of the banana variety and the temperature of drying.

Acknowledgments The authors thank the Portuguese Foundation for Science and Technology (FCT) and Research centres CERNAS and CI&DETS (PEst-OE/CED/UI4016/2011).

References Arvanitoyannis, I. S., and Mavromatis, A. (2009). Banana cultivars, cultivation practices, and physicochemical properties. Critical Reviews in Food Science and Nutrition 49, 113-135. Collin, M. N., and Dalnic, R. (1991). Evolution de quelques criteres physicochimiques de la banane plantain (cultivar Orishele) au cours de la maturation. Fruits 46, 13-17. Corrêa, J. L. G., Braga, A. M. P., Hochheim, M., and Silva, M. A. (2012). The Influence of ethanol on the convective drying of unripe, ripe, and overripe bananas. Drying Technology 30, 817-826. Demirel, D., and Turhan, M. (2003). Air-drying behavior of Dwarf Cavendishii and Gros Michel banana slices. Journal of Food Engineering 59, 1-11. Galan, S. V., and Cabrera, J. (1999). Variedades de platanos cultivadas en Canarias. Mercados 24, 8-11. Hofsetz, K, Lopes, C. C., Hubinger, M. D., Mayor, L., and Sereno A. M. (2007). Changes in the physical properties of bananas on applying HTST pulse during air-drying. Journal of Food Engineering 83, 531540. Macku, C., and Jennings, W. G. (1987). Production of volatiles by ripening bananas. Journal of Agricultural and Food Chemistry 35, 845-848. Perez, A. G., Sanz, C., Rios, J. J., and Olias, J. M. (1993). Comparison of main aroma constituents of apple, banana and strawberry. Rev. Esp. Cien. Tee. Ah. 33, 665-667.

409


Comportamento de Crambe abyssinica Hochst em substrato com aplicação de corretivos e fertilizantes A.X.Campos1 y M.C.Salas2 1

Faculdade de Agronomia e Medicina Veterinária. Universidade de Brasília. Brasil e e-mail: xavierac@unb.br 2

Departamento de Agronomía. Universidad de Almería. España e e-mail:csalas@ual.es.

Resumo A espécie Crambe abyssinica Hochst tolera solos marginais e possui potencial para produção de óleo. Seu cultivo é viável, mas necessita melhorar a fertilidade do solo. O objetivo do trabalho foi avaliar doses de corretivos e fertilizantes no desenvolvimento e produção do Crambe. O delineamento experimental foi em blocos inteiramente casualizados, com quatro tratamentos e quatro repetições. Foram realizados cinco experimentos sendo 1-com calcário dolomítico (Cd) nos níveis de 0 kgha-1, 1000kg ha-1, 2000 kgha-1 e 3000 kgha-1. 2-com esterco de ovinos nos níveis de 0%, 10%, 20% e 30%. 3-com Nitrogênio nos níveis de 0 kgha-1N, 50 kgha-1N, 100 kgha-1 N e 150 kgha-1N na fonte de uréia. 4-com Fósforo nos níveis de 0 kgha-1P2O5, 50 kgha-1P2O5, 100 kgha-1 P2O5 e 150 kgha-1P2O5 na fonte de superfosfato simples.5-com Potássio nos níveis de 0 kgha-1K2O, 50 kgha-1K2O, 100 kgha-1K2O e 150 kgha-1K2O na fonte de Cloreto de potássio. Em todos os experimentos foram colocados os elementos faltantes correspondente a 2000Kgha-1 para Cd, 20% para M.O.,100 kgha-1N, 100 kgha-1 P2O5 e 100 kgha-1K2O. Como substrato foi utilizado horizonte B do solo Latossolo Vermelho Amarelo (oxissol) acondicionado em vasos com capacidade de 2 l. As sementes foram semeadas diretamente no substrato, e após a germinação foram desbastadas deixando quatro plântulas por vaso em condições de ambiente protegido com densidade correspondente a 100 plantas m-2. Os resultados com doses de M.O. mostraram ser significante ao nível de 95% e não houve crescimento das plântulas de Crambe quando foi omitida a presença de M.O. No experimento com doses de Cd a dose acima de 1000 kg ha-1 diminuiu a produção de Crambe. No experimento com as doses de nitrogênio mostraram ser significantes ao nível de 95%. No experimento com as doses de fósforo foi significante ao nível de 95%. No experimento com doses de potássio não houve resposta para o Crambe. Aplicações de M.O. Cd e fertilizantes minerais melhoram a fertilidade do substrato e aumenta produção do Crambe. Palavras chaves: fertilização, produção sustentável, cultivos oleaginosos, solos, correção.

PERFORMANCE OF Crambe abyssinica Hochst GROWN IN substratE WITH APPLICATION OF LIME AND FERTILIZER Abstract The species Crambe abyssinica Hochst tolerates marginal soils and has potential for oil production. Its cultivation is feasible and needs to improve fertility of the soil. The aim of this study was to evaluate rates of lime and fertilizer on the development and yield of Crambe. The study consisted of five experiments, a randomized complete block design, with four treatments and four replications. 1- with dolomitic limestone (Cd) doses of 0, 1000, 2000 and 3000 kg ha-1. 2- with sheep manure levels of 0, 10, 20 and 30%. 3 – with nitrogen, levels 0 kgha-1N, 50 kgha-1N, 100 kgha-1 N e 150 kgha-1N source urea. 4 – with Phosphorus levels 0 kgha1 P2O5, 50 kgha-1P2O5, 100 kgha-1 P2O5 e 150 kgha-1P2O5 source superphosphate and 5- with potassium levels 0 kgha-1K2O, 50 kgha-1K2O, 100 kgha-1K2O e 150 kgha-1K2O source potassium chloride. The substrate used was the B horizon soil type Oxisol packaged in containers with a capacity of 2 L. The seeds were sown directly on the container, and after germination were thinned leaving 4 plants per pot in greenhouse conditions with corresponding density of 100 plantas m-2. When the presence of O.M. was omitted of the substrate, the results showed that Crambe seeds did not growth. In the experiment with Cd levels, the dose above 1000 kg ha-1 decreased the yield of Crambe. In the experiment with nitrogen, it showed that the doses used there were no relevant air mass production but there was a tendency of increased mass production of fruit with increasing doses of N. In the experiment with phosphorus levels has been shown that the highest dose gave higher fruit production and root system. In the experiment with potassium levels was not observed increase in yield of Crambe. Applications of O.M., of Cd and of N-P2O5-K2O improves fertility and increases production of the of Crambe

Palavras chaves: fertilization, yield, oleaginous crops, soil, amendment.

410


Introdução O crambe (Crambe abyssinica Hochst) é uma planta oleaginosa pertencente à família Brassicaceae. Originária da região do Mediterrâneo e com relatos de ocorrência de algumas espécies na Etiópia (Weiss, 2000) e Ilhas Espanholas (Carlsson, 2012). Essa cultura apresenta potencial para a produção industrial de biocombustíveis pelo elevado teor de óleo de suas sementes, em torno de 26 a 38% (Katepa-Mupondwa et al., 1999). Além disso, a planta tem mais de 20% de proteínas, e o seu óleo possui de 50 a 60% de ácido erúcico (Carlsson, 2012). Apresenta-se potencial paisagístico, melífero, alimentar e adapta-se em solos marginais de clima tropical e subtropical. O cultivo dessa espécie deve ser incrementado inclusive em ambientes protegidos para que se obtenham de forma imediata resultados com relação ao uso de variedades melhoradas e manejo cultural. A planta está sendo cultivada no cerrado brasileiro e estudos preliminares em condições de campo mostraram bom desenvolvimento vegetativo e boa produção de frutos. Os solos predominantes no cerrado brasileiro pertencem ao grupo Latossolos (oxissol) que são intemperizados, possui argila de atividade baixa, e são responsivos a aplicação de corretivos e fertilizantes. Possui teor de matéria orgânica variando de médio a alto empobrecida de nutrientes, mas que tem papel fundamental na adsorção de óxidos. No horizonte B a matéria orgânica é quase inexistente, há grande ocorrência de óxidos de ferro e/ou de alumínio e essa camada tem sido muita utilizada para uso como componentes de substratos. A estrutura é microgranular e sem a matéria orgânica tende a produzir compactação diminuindo os macroporos e dificultando o movimento da água com agravamento no período da falta de precipitação pluviométrica. Como visto a matéria orgânica desse solo em forma nativa é pobre em nutrientes e quase inexistente no horizonte B, havendo necessidade de enriquecer esses solos com nutrientes para adequá-los as exigências dos cultivos. Estudos realizados com estes solos por Campos e Salas (2012) mostraram que com a aplicação de doses fixas de calcário dolomítico, materia orgânica enriquecida em nutrientes e aplicação de fertilizantes minerais houve resposta significativa do Crambe atingindo produção acima de 2000 Kg ha-1 em condições de ambientes protegidos. A formação e as características de substratos e de seus componentes assim como as propriedades físicas, químicas e físico-químicas do substrato variam segundo a finalidade de seu uso e o objetivo de qualquer substrato de cultivo é produzir uma planta de qualidade no mais curto período de tempo e com baixo custo de produção (Abad, et al. 1993). Penningsfeld (1985) considera que um substrato adequado ao seu cultivo deva apresentar alto espaço de aeração, boa estabilidade de estrutura das partículas, suficiente retenção de água, alta capacidade de troca de cátions e valores de pH entre 4,0 e 6,0. Portanto, na busca de componentes alternativos para uso como substrato procuram-se materiais de baixo custo, disponíveis em quantidade e a pouca distância dos centros produtores e com identificação dos componentes de mistura e com os dados das suas características físicas, físico-química, químicas e biológicas. Entre as propriedades físicas destacam-se a densidade, a porosidade, a disponibilidade de ar e água e distribuição granulométrica, e entre as características químicas e físico-quimicas destacam-se pH em água, teor total de sais solúveis, condutividade, CTC, teor de carbono orgânico, relação C/N, taxa ou teor de metais pesados (Abad, et al. 1993). Sabe-se que em ambiente protegidos são usados substratos provenientes de matéria prima de diferentes origens como turfa, lã de rocha, perlita, argila expandida, fibra de coco, esponja fenólica e outros citados por diversos autores (Kämpf, 2000). Mas muitos substratos ainda são baseados em mistura de solos, composto, serapilheira e outros produtos de origem local que podem ser aproveitados. Em Brasília, e na região do entorno do Distrito Federal é praxe a utilização do horizonte B de solos Latossolos (oxissol) como substratos principalmente para fins de cultivos ornamentais, olerícolas, silvícolas e frutíferas. Esse componente de substrato apresenta boas condições físicas, baixa fertilidade natural e teor de material orgânico quase nulo. A melhoria desse substrato com aplicação de corretivos, adubos minerais e orgânicos é fundamental para o desenvolvimento e produção de plantas

411


destacando-se a espécie Crambe abyssinica cujo conhecimento técnico agronômico ainda é incipiente. O solo sem matéria orgânica expõe com maior intensidade os valores de óxidos e hidróxidos de ferro e alumínio e nessa condição a aplicação de fertilizantes minerais pode também causar problema de salinidade e diminuir o potencial produtivo das culturas. O material orgânico tem sido um componente importante na formação de substratos e é fundamental na produção de culturas. Segundo Bayer e Mielniczuk (1999), a matéria orgânica do solo promove grande influência no fornecimento de nutrientes às culturas, retenção de cátions, complexação de elementos tóxicos e de micronutrientes, estabilidade da estrutura, infiltração, retenção de água e aeração. A matéria orgânica ativa a população microbiana e estes microrganismos provocam a decomposição dos resíduos orgânicos, realizam a mineralização, fixam o nitrogênio e liberam os nutrientes para as plantas (Bento, 1997). Em substratos, no uso de componentes orgânicos é importante considerar a degrabilidade do material e possível retenção de nutrientes para aperfeiçoar o manejo do cultivo (Domeño et al., 2009). O objetivo do trabalho foi avaliar doses de corretivos e fertilizantes no desenvolvimento e na produção de Crambe.

Material e Métodos O experimento foi conduzido em ambiente protegido localizado na Fazenda Água Limpa da Universidade de Brasília, Brasília-DF, no período de maio a agosto/2011. O objetivo do trabalho foi avaliar doses de corretivos e fertilizantes no desenvolvimento e na produção de Crambe. O trabalho constou de cinco experimentos conduzidos de forma independente, com delineamento experimental em blocos inteiramente casualizados, com quatro tratamentos e quatro repetições. No experimento de corretivo foi utilizado calcário dolomítico (Cd) nos níveis de 0, 1000, 2000 e 3000 kg ha-1. No experimento de matéria orgânica (M.O.) foi utilizado esterco de ovinos nos níveis de 0, 10, 20 e 30%. No experimento com Nitrogênio usou os níveis de 0, 50, 100 e 150 kgha-1N na fonte de uréia. No experimento com Fósforo usou os níveis de 0, 50, 100 e 150 kgha-1P2O5 na fonte de superfosfato simples e no experimento de Potássio usou os níveis de 0, 50, 100 e 150 kgha-1K2O na fonte de Cloreto de potássio. Em todos os experimentos foram colocados os elementos faltantes correspondentes a 2000kgha-1 para Cd, 20% para M.O.,100 kgha-1N, 100 kgha-1 P2O5 e 100 kgha-1K2O, nas mesmas fontes citadas anteriormente. Os elementos faltantes foram adicionados em todos os experimentos que não os continham, por exemplo, fósforo foi adicionado no experimento com níveis de nitrogênio e assim sucessivamente. Como substrato foi utilizado o horizonte B do solo Latossolo Vermelho Amarelo (oxissol) acondicionado em vasos com capacidade de 2 l.. As sementes foram semeadas diretamente no substrato, e após a germinação foram desbastadas deixando 4 plântulas por vaso em condições de ambiente protegido com densidade correspondente a 100 plantas m-2. A M.O. e o calcário quer como tratamentos quer como elementos faltantes foram adicionados no substrato e incubados por um período de 15 dias com água destilada na capacidade do substrato. Após esse período foi aplicados os níveis de fertilizantes minerais na superfície do substrato com incorporação e em seguida foram semeadas as sementes de Crambe com posterior irrigação. As fases de preparo do substrato, desenvolvimento vegetativo e produção foram realizados de acordo com o manejo agronômico da região. O ciclo da espécie Crambe abyssinica foi de aproximadamente 90 dias sendo realizada a avaliação experimental com a média dos dados vegetativos e reprodutivos obtidos do diâmetro da haste (D) (2cm a partir da superfície do substrato), altura da haste (H) (a partir da superfície do substrato até o término da haste principal), área foliar (A) (1ª folha expansiva e madura a partir da parte de cima), teor de clorofila (C) (avaliado por meio de clorofilômetro e na mesma folha tomada para avaliação do teor de área foliar), massa verde de raízes (R) e massa seca da parte aérea (MS). Esses dados foram coletados em três plantas no período da inflorescência. A massa verde de frutos (F) foi determinada com a produção de uma planta restante de cada unidade experimental. Os dados foram submetidos à análise de variância (ANOVA) e suas diferenças foram comparadas por meio da Diferença Mínima Significativa (DMS) a 95% de significância. Com os níveis de corretivos e fertilizantes minerais e orgânicos foi realizada a regressão com a produção de Crambe.

412


Resultados e Discussão A cultura do Crambe pode ser cultivada em ambiente protegido e a utilização desse espaço será mais favorável e menos oneroso na busca e obtenção de resultados mais imediatos no processo de desenvolvimento vegetativo e produtivo. Os componentes da mistura do substrato e o substrato propriamente dito foram decisivos não somente como suporte da planta, mas também com boas qualidades que caracterizam um bom substrato (Abad et al., 1993, Penningsfeld, 1985). Os resultados com níveis de M.O. mostraram ser significante ao nível de 95% e não houve crescimento das plântulas de Crambe quando foi omitida a presença de M.O no substrato (Fig. 1). O teor da matéria orgânica aplicada na formação do substrato foi providencial e efetiva na obtenção dos resultados e reforça as informações dadas por Bayer e Mielniczuk (1999) e Bento (1997) com relação à influência da aplicação de matéria orgânica. Os nutrientes minerais aplicados no substrato sem o emprego da matéria orgânica provocaram o fenômeno da osmose e o efeito da salinização ocasionou diminuição no crescimento de raízes a medida que aumentaram os níveis de aplicação de cloreto de potássio (Fig.2). No entanto o efeito de salinidade não foi observado nos níveis menores de potássio e com a dose de 100Kgha-1 K2O aplicada como elemento faltante nos demais experimentos. Os aportes de nutrientes minerais adicionados como elementos faltantes necessários para fertilizar o solo e alimentar a planta de Crambe podem ter sido adicionados de forma exagerada, porem não se tinha muito conhecimento das exigências nutricionais dessa cultura por ser de recente introdução e cultivo. Com relação ao calcário dolomítico observa-se que as doses acima de 1000 Kg ha-1, foram prejudiciais a produção de Crambe (Fig.1) Tal fato pode ser explicado que nesse solo o alumínio não apresenta em sua forma tóxica e com isso as doses de calcário podem ser menores servindo apenas como fonte de alimentação de cálcio e magnésio. A figura 2 mostra a importância da aplicação de calcário em níveis menores e o aumento em relação ao tratamento 0 (zero) no crescimento e produção da cultura do Crambe. Houve uma resposta linear na massa verde de frutos quanto a aplicação de níveis de nitrogênio (Fig.1 e 2) e uma diminuição na variável altura das plantas (Fig-.2) que provavelmente tenha ocorrido pela maior oferta de nitrogênio com o aporte de M.O e maiores níveis de fertilizantes minerais. O fertilizante fosfatado mostrou-se ser imprescindível para o crescimento de raízes e produção de frutos (Fig.1 e 2). Na variável altura das plantas houve uma redução a medida que aumentava os níveis de fósforo (Fig. 2).Talvez ocasionado pela não absorção de íons nitratos em competição com íons fosfatos. No experimento com doses de potássio não houve resposta para a massa verde de frutos de Crambe mas os níveis maiores da aplicação de cloreto de potássio foram prejudiciais ao crescimento de raízes de Crambe devido a presença de salinidade. O controle na aplicação de níveis de calcário dolomítico e a necessidade de aplicação de fósforo para aumento na produção de frutos de Crambe corrobora com aqueles encontrados por Campos e Salas (2012).

Conclusão O crambe é uma cultura que pode ser cultivada em ambiente protegido. O horizonte B do grupo Latossol pode ser usado como componente de substrato para cultivar o Crambe. O Calcário dolomítico, a matéria orgânica e os adubos minerais quando aplicados em níveis adequados no substrato utilizado são favoráveis ao desenvolvimento e produção da espécie Crambe abyssinica.

413


Bibliografía Abad, M., Martinez, P.F., Martinez, M.D., and Martinez, J. (1993) Evaluación agronómica de los sustratos de cultivo. Actas de Horticultura 11, 141 – 151. Bayer C. and Mielniczuk J. (1999). Dinâmica e Função da Matéria Orgânica. In: Fundamentos da Matéria Orgânica do Solo: Ecossistemas Tropicais e subtropicais, G. A. Santos e F.A.O.Camargo (ed.). Porto Alegre: Gênesis, pp. 9-26. Bento M. M. (1997). Fontes de Matéria Orgânica na Composição de Substratos para a Produção de Mudas Micorrizadas de Maracujazeiro. Dissertação de Mestrado, ESALQ, Piracicaba, Estado de São Paulo, Brasil. Campos, A. X. and Salas, M. C. (2012). Aplicação de níveis de NPK no desenvolvimento vegetativo e produtivo de Crambe Abyssinica Hochst cultivada em substratos sob ambiente protegido. Libro de Resúmenes, XIV Simposio Hispano-Luso de Nutrición Mineral de las Plantas. Cantoblanco, Madrid. Carlsson, A. S. (2012). Crambe, a novel oil crop platorm for industrial uses. Department of Plant Breeding and Biotecnology Swedish University of Agricutural Sciences- Anarp, Sweden. http://www.ruralsementes.com.br/produtos/Uso%20industrial%20para%20o%20%C3%B3leo%20 do%20crambe.pdf. Consultado em abril 2012. Domeño, I. Irigoyen, I., and Muro, J. (2009). Evolution o organic matter and drainages in wood ibre and coconut fibre substrates. Scientia Horticulturae 122,269-274. Penningsfeld, F. (1985). Soilless propagation and cultivation of orchids. Possibilities, advantages and disadvantage. Soilless Culture, Wageningen, v.1, pl 55-66. Kámpf, A.N. (2000). Produção de Plantas Ornamentais. Guaiba: Agropecuária. 254p. Katepa-Mupondwa F., Rakow G., and Raney P. (1999). Developing Oilseed Yellow Mustard (Sinapis Alba L.) in Western Canada. In: International Rapeseed Congress, 10. Canberra: Austrália. Anais. The Regional Institute Ltd. 6p. Weiss E. A. (2000). Oilseed crops. London: Blackwell Science. 364p.















Figura 1. Efeito da aplicação de doses de corretivos, condicionadores e fertilizantes minerais na produção de massa verde de fruto de Crambe abyssinica Hochst no horizonte B de um Latossol do Cerrado brasileiro. Letras diferentes indicam diferenças significativas (P0,05).

414


a b c c

a b b b a b b b

a b c c a b b b a b b b

a b b b

a a a a a ab b b

a a a a a a a a a a a a a a a a

a b b b

a ab bc c

a a a a

a a a a a b b b

a ab ab b a ab b b a a a a

a ab c ab

a ab c ab

a bc c ab

a b c d

ab ab a b

a ab bc c

a b b b

a ab ab b ab b b a

a a a a

a a a a b b a a

a a a a

a a a a

Figura 2. Efeito da fertilização na produção de Crambe abyssinica Hochst com diferentes variáveis. Letras diferentes indicam diferenças significativas (P0,05).

415






 

EVALUACIÓN DE LA UTILIZACIÓN DE AEROGENERADORES Y BALANCE NETO EN EL ÁMBITO RURAL R. Velo 1, F. Maseda1 1

Departamento de Ingeniería Agroforestal. Escuela Politécnica Superior. Universidad de Santiago de Compostela. Campus Universitario 27002 Lugo e-mailramon.velo@usc.es ; francisco.maseda@usc.es

Resumen El autoconsumo con la modalidad de balance neto permite que un usuario pueda generar, mediante energías renovables, parte de la electricidad que consume y aquella que es excedentaria se vierte a la red, la cual no se vende directamente sino que representa un derecho de poder disminuir el coste de la factura con la compañía eléctrica. En esta comunicación se lleva a cabo un análisis económico de la utilización de aerogeneradores de potencias inferiores a 100 kW, en función del valor del recurso eólico disponible y del coste de la energía eléctrica. Palabras clave: pequeños aerogeneradores, balance neto, autoconsumo.

EVALUATION OF THE USE OF WIND TURBINES AND NET METERING IN RURAL AREAS Abstract Consumption with the net metering allows that a user can generate, through renewable energy, part of the electricity that it consumes and that surplus is discharged into the grid, which does not sell directly, but it represents a right to be able to reduce the cost of the bill with the power company. This paper is carried out an economic analysis of the use of power turbines below 100 kW, depending on the value of the wind resource and the cost of electricity Keywords: small wind turbines, net metering, self-consumption.

Introducción El sistema eléctrico actual está basado en la generación en grandes centrales para su posterior transporte y distribución a las zonas de consumo, por lo que se trata de un sistema de generación eléctrica centralizado, en el que los principales puntos de generación se sitúan lejos del consumo. En España en siete años se han multiplicado casi por doce los puntos de generación, es decir estamos ante un cambio en el modelo actual en el que podremos ser consumidores y generadores al mismo tiempo. Todo indica que en los próximos años se va a producir un desarrollo notable de la generación distribuida mediante energías renovables y el balance neto puede ser una alternativa a otro tipo de incentivos (Yamamoto, 2012). Entre las ventajas de la generación distribuida con energías renovables destacamos la disminución de las pérdidas en el sistema, un ahorro en el consumo de energía primaria, una reducción de las emisiones de gases de efecto invernadero, menores inversiones en redes de transporte y distribución y una reducción de las puntas de demanda de energía.

   416


   La Directiva 2009/28/CE (Diario Oficial de la UE, 2009) establece un objetivo para España que el 20% de consumo final bruto de energía debe proceder de fuentes renovables. El Plan de Energías Renovables 2011-2020 (PER, 2011) propone que el 20,8 % en términos de energía final (38,1 % en el sector eléctrico) proceda de fuentes renovables. En esta dirección se enmarca el RD 1699 (BOE, 2011) por el que se regula la conexión a la red de instalaciones de pequeña potencia y el RD Ley 13/2012 (BOE, 2012) que contempla que podrán establecerse para determinados consumidores modalidades singulares de suministro para fomentar la producción individual de energía eléctrica destinada al consumo en la misma ubicación (CNE, 2012). En la modalidad de autoconsumo con balance neto no hay venta de electricidad ya que los excedentes netos no se venden sino que se inyectan en la red y se canjean por una cantidad semejante de energía en los momentos en que la demanda no pueda ser cubierta (IDAE, 2012). En la Figura 1 se recoge un esquema del sistema.    



USUARIO

AUTOCONSUMO

DÉFICITS

 

 EXCEDENTES

CENTRAL Figura 1. Esquema flujos con balance neto

En España todavía no se aprobó la normativa que regule las condiciones técnicas necesarias para las conexiones ni la clarificación del tipo de modelo de balance neto pero en otros país se aplica, como en Estados Unidos (Darghouth, Barbose y Wiser, 2011).

Materiales y métodos Para la realización del estudio se eligen cinco modelos de aerogeneradores con potencias nominales entre 3 y 100 kW de diversos fabricantes, tecnologías y configuraciones que son representativos de la gran amplitud del mercado de los pequeños aerogeneradores (Tabla 1). Tabla 1. Tipología de los pequeños aerogeneradores estudiados Compañía

Modelo

Potencia (kW)

Diámetro (m)

Nº de palas

Altura de la torre (m)

Precio total instalado (€)

Bornay

Inclin 3000

3

3,7

2

25

15535

Bergey

BWC Excel

10

7,0

3

25

50700

Westwind

Westwind 20

20

10,4

3

25

98514

Seaforth

AOC 15/50

50

15

3

30

237900

Norvento

NED 100

100

22

3

37

429000

   417


   Para el análisis económico financiero partimos de diversos condicionantes para realizar el estudio. La tasa de actualización considerada es del 4% y la inversión se financia con un préstamo del 80% del total que se devuelve en 10 años. Los costes fijos son los ocasionados por el mantenimiento y la reparación de los aerogeneradores y para ello se consideran que dichos costes ascienden a un 3% del precio que tenga en cada caso el aerogenerador. Otros costes son el precio del aerogenerador, en el que se incluye el precio de la turbina, de la torre y los costes de instalación, que en todos los modelos se ha considerado que asciende a un 30% del precio de la turbina. Los beneficios de la instalación se consideran originados por la energía generada que se destina para autoconsumo y por lo tanto se considera que el beneficio es igual al ahorro ocasionado al no tener que comprar dicha energía a una compañía eléctrica. La vida útil del aerogenerador se considera de 20 años. La energía producida se expresa en función de las horas equivalentes (heq) de funcionamiento de los aerogeneradores es decir el tiempo en que el generador está en funcionamiento a la potencia nominal a lo largo del año, de esta forma se podrán extender los resultados a cualquier ubicación. Los parámetros económicos analizados son la Tasa Interna de Rendimiento (TIR) y el Pay-Back. El TIR de una inversión (ecuación 1), está definido como la tasa de interés a la cual el VAN se iguala a cero. n

VAN = ∑ J =1

Rj (1 + TIR) j

−K =0

(1)

Siendo Rj los flujos de caja, K es el valor inicial de la inversión, n es el número de años considerado. El Pay-Back o periodo de recuperación es el tiempo que transcurre hasta amortizarse la inversión inicial. Los precios de la energía eléctrica son fijados por el gobierno trimestralmente si se trata de las tarifas de último recurso. Sin embargo existen otra opción es la que fija el mercado a la que hay que añadir los costes de acceso, es decir los costes de utilización de las redes de transporte y distribución. En este caso, los precios de la energía consumida que cada usuario contrata con las compañías eléctricas son el resultado de un acuerdo, en el que influye la potencia contratada (término de potencia), el consumo (término de energía), los recargos o bonificaciones por discriminación horaria, los recargos por demanda de energía reactiva, los impuestos especiales y del IVA. Considerando los precios actuales, fijamos para el estudio los siguientes: 0,25; 0,20; 0,15; 0,10 €/kWh. Las zonas consideradas para el estudio son aquellas en que las turbinas eólicas generan durante 2000, 2500 y 3000 heq y que se corresponden con ubicaciones con velocidades medias entre 3,5 y 5 m/s.

Resultados y discusión Los valores obtenidos del TIR son negativos (Figura 2) si el precio de la energía es de 0,10 €/kWh. También esto ocurre en los casos cuando el precio de 0,15 €/kWh a excepción de lugares con 3000 heq, no muy abundantes en zonas con aprovechamientos agroindustriales. Si el funcionamiento es de 1500 heq también siempre se obtienen TIR menores de cero, independientemente de los precios considerados de la energía. Las tasas superiores al 10% se alcanzan en zonas de 3000 heq y tanto con precios de la energía de 0,20 como de 0,25 €/kWh. Si la utilización para el autoconsumo de la energía generada por la turbina no es completa sino parcial ya que el acoplamiento entre demanda y generación es menor del 100 %, las rentabilidades se reducen de forma acusada, como se puede observar en la Tabla 2. Únicamente si los precios de la energía son de 0,25 €/kWh en el acoplamientos del 60 % se llega a recuperar la inversión pero aun así los valores de Pay-Back son muy elevados.    418


   Para conseguir periodos de recuperación de la inversión menores de 10 años es necesario que la ubicación del aerogenerador garantice 3000 heq y además que se consuma la totalidad de la energía generada. En la mayoría de los casos estudiados no se recupera la inversión si el precio de la energía es de 0,15 €/kWh. Variación del TIR para un precio de la energía de 0,15 €/kWh

Variación del TIR para un precio de la energía de 0,10 €/kWh 







$

$

$

$

$ 1500

3 kW

18,0%

2000

2500

Horas equivalentes 10 kW 20 kW 50 kW

$

100 kW

1500

3 kW

Variación del TIR para un precio de la energía de 0,20 €/kWh

2000

10 kW

2500

Horas equivalentes 20 kW 50 kW

3000

100 kW

Variación del TIR para un precio de la energía de 0,25 €/kWh

27,0% 22,0%

13,0%

17,0%

8,0%

12,0%

3,0%

7,0%

-2,0%

2,0% -3,0%

-7,0% 1500

3 kW

2000

2500

Horas equivalentes 10 kW 20 kW 50 kW

1500

3000

3 kW

100 kW

2000

2500

Horas equivalentes 10 kW 20 kW 50 kW

3000

10 kW

Figura 2. Variación del TIR para los cuatro precios de la energía en función de las horas equivalentes de la ubicación y del tamaño de la turbina eólica Tabla 2. Pay-Back para distintos precios de la energía eléctrica y potencias de las turbinas 0,25 €/ kW heq acopl 2000 100

3

10

3

10

15,9 15,6 15,1 14,8 14,1

>20

>20

>20

>20

>20

50

3

10

20

50

100

19,9 19,1 18,2

>20

>20

>20

>20

>20

>20

>20

>20

>20

>20

2500 100

>20

>20

>20

>20

2500

15,9 15,6 15,1 14,5 13,8

>20

>20

>20

>20

>20

>20

3000 100

8,5

13,0 12,7 12,3 11,8 11,3 18,0 17,6 17,0 16,3 15,5

3000

80

13,0 12,7 12,6 11,8 11,6 16,7 16,3 15,8 15,2 14,4

>20

>20

>20

>20

>20

3000

60

18,0 17,6 17,4 16,3 15,9

>20

>20

>20

>20

>20

7,1

6,3

5,4

>20

>20

>20

>20

100

>20

7,9

18,2

20

>20

80

>20

100

>20

80

>20

50

0,15 €/ kW

12,4 12,1 11,7 11,3 10,3 15,9 15,6 15,4 15,1 14,1

2000

>20

20

0,20 €/ kW

19,9 19,4 18,2

>20

>20

>20

   419






 En la Figura 3 se observa la variación del TIR en función del grado de aprovechamiento de la energía generada para todas las turbinas eólicas y dos zonas estudiadas. Se obtienen valores superiores al 10% en todas las turbinas ubicadas en las zonas con 3000 heq siempre y cuando se pueda aprovechar al menos un 80% de la energía generada que deberá ser del 100 % en ubicaciones con 2500 heq. 3000 Horas equivalentes

2500 Horas equivalentes

30,0%

20,0%

25,0%

15,0% 10,0%

15,0%

100%

10,0%

80%

5,0% 0,0% -5,0% -10,0% 3

10

20

50

100

TIR

TIR

20,0%

100% 5,0%

60%

0,0%

40%

-5,0% -10,0%

Potencia del aerogenerador (kW)

80% 60% 40%

3

10

20

50

100

Potencia del aerogenerador (kW)

Figura 3. Variación del TIR para el precio de 0,25 €/kWh en función del grado de acoplamiento entre generación y autoconsumo

Si analizamos la rentabilidad en función de la energía demanda para el autoconsumo, en la Tabla 3 se recogen los valores del TIR positivos agrupados por las horas equivalentes y las potencias de las turbinas eólicas. Tabla 3. Tasas internas de rendimiento en función de la ubicación y del consumo de energía 



Horas equivalentes





3000

2500

2000

kW

3

10

20

50

100

kWh

TIR (%)

kWh

TIR (%)

kWh

TIR (%)

9000

20,3

7500

11,8

6000

4,7

7200

10,3

6000

4,7

4800

<0

5400

2,0

4500

<0

3600

<0

30000

21,5

25000

12,6

20000

5,3

24000

11,1

20000

5,3

16000

<0

18000

2,5

15000

<0

12000

<0

60000

23,3

50000

13,8

40000

6,1

48000

12,2

40000

6,1

32000

<0

36000

3,3

30000

<0

24000

<0

150000

25,6

125000

15,3

100000

7,1

120000

13,6

100000

7,1

80000

<0

90000

4,1

75000

<0

60000

<0

300000

29,1

250000

17,4

200000

8,5

240000

15,5

200000

8,5

160000

<0

180000

5,4

150000

<0

120000

<0

   420






 En el caso de una turbina de 3 kW es necesario consumir al menos 5400 kWh de la energía generada para alcanzar rentabilidades positivas. Si la turbina es de 10 kW la demanda deberá ser de 18000 kWh. Para una turbina de 100 kW la demanda debería llegar a ser de 180000 kWh, por lo que estaríamos considerando industrias agrarias o núcleos rurales de medio tamaño. Otro aspecto relevante que se debe considerar es la actual inestabilidad regulatoria y la coyuntura económica nacional que disuaden a un consumidor a realizar una inversión que no recuperará hasta pasados ese número de años que se obtienen en los distintos casos.

Conclusiones Una instalación eólica individual y acogida al sistema de balance neto, puede ser una alternativa al consumo tradicional de la red, pero todavía no alcanza las ratios de rentabilidad para un desarrollo generalizado, a no ser que los poderes públicos establezcan algún tipo de incentivo como pueden ser los de carácter fiscal. En el caso de instalación de un pequeño aerogenerador de 3 kW para autoabastecimiento con balance neto, se alcanzan valores de TIR positivos con precios de la energía de 0,20 y 0,25 €/kWh pero deberá estar ubicado en zonas con al menos 2500 horas equivalentes de funcionamiento. Si el precio de la energía es de 0,15 €/kWh prácticamente nunca se recupera la inversión en los casos estudiados y si el precio es de 0,20 €/kWh la ubicación debe proporcionar 2500 horas de funcionamiento de las turbinas estudiadas desde 3 a 100 kW.

Agradecimientos Está investigación ha sido financiada por la Xunta de Galicia a través del programa INCITE 09REM001201PR

Bibliografía BOE (2011). RD1699, de 18 de noviembre, por el que se regula la conexión a red de instalaciones de producción de energía eléctrica de pequeña potencia. BOE (2012). RD Ley 13/2012, de 30 de marzo, por el que se transponen directivas en materia de mercados interiores de electricidad y gas y en materia de comunicaciones electrónicas, y por el que se adoptan medidas para la corrección de las desviaciones por desajustes entre los costes e ingresos de los sectores eléctrico y gasista. CNE (2012). Informe sobre la propuesta de real decreto por el que se establece la regulación de las condiciones administrativas, técnicas y económicas de la modalidad de suministro de energía eléctrica con balance neto. http://www.cne.es/cne/doc/publicaciones/cne09_12.pdf. Darghouth, R., Barbose, G., and Wiser, R. (2011). The impact of rate design and net metering on the bill savings from distributed PV for residential customers in California. Energy Policy 39, 5243-5253. Diario Oficial de la UE (2009). Directiva 2009/28/CE del Parlamento Europeo y del Consejo, de 23 de abril de 2009, relativa al fomento del uso de energía procedente de fuentes renovables y por la que se modifican y se derogan las Directivas 2001/77/CE y 2003/30/CE. IDAE (2012). Dirección de Energías Renovables. Referencias sobre autoconsumo de energía eléctrica en la normativa vigente. Nota informativa de 3 de febrero. www.idae.es. PER (2011). Resumen del Plan de Energías Renovables. http://www.minetur.gob.es/energia/es-ES/ Novedades/ Documents/ Resumen_ PER_2011-2020. pdf. pp 64. Yamamoto. Y. (2012). Pricing electricity from residential photovoltaic systems: A comparison of feed-in tariffs, net metering, and net purchase and sale. Solar Energy 86, 2678-2685.

   421


Evaluation of biomass sorghum genotypes during three harvesting dates in East Central Italy A. Del Gatto1, L. Mangoni and S. Pieri 1

: Consiglio per la Ricerca e la sperimentazione in Agricoltura – Centro di ricerca per le colture industriali, Via Cagiata, 90, 60027 Osimo (AN) – Italy. e-mail: andrea.delgatto@entecra.it

Abstract Referring to the solid biofuels sustainable chain, the research carried out until now identified, among the species most suitable to Italian areas, annual herbaceous plants, perennial herbaceous plants and woody species. Sorghum, in particular, is among the most interesting species since it shows, among its most significant peculiarities, a good yield performance, remarkable environmental adaptability and flexible use of the products. The availability of varieties, almost all selected in North Europe, is abundant. Therefore, within the project SuSCACE, funded by MiPAAF, a comparison of the available germoplasm has been carried out to identify the best varieties for the production of lignocellulosic biomass in Central Italy. During the years 2011 and 2012 the Centro di ricerca per le colture industriali in Osimo of the Consiglio per la Ricerca e la sperimentazione in Agricoltura carried out in eastern Central Italy a comparison between 12 biomass sorghum cultivars in three harvesting dates in order to identify the one capable of best production. In both years the trials have been sowed at the end of April. However, because of emergence problems in 2012, the final sowing has been completed around mid June. The crop received irrigation until the reaching of 7-8 leaves, in order to guarantee a good stand for the crop; 74 kg of nitrogen have been distributed in two portions: at seeding and covering. The harvests have been carried out starting from 20 days after the anthesis of the first cultivar and with intervals of around 20 days during the first year; the same dates were kept for the second year. Despite the differences between the years the production has always been satisfactory, reaching an average of 22 tha -1 of dry mass during 2011 and exceeding 19 tha-1 during 2012, showing the efficiency of the material. The most productive cultivar during 2011 was Bulldozer (26.26 tha-1) while Biomass 150 (24.83) e Hercules (24.42) didn’t statistically differentiated themselves; these performances were confirmed during 2012, even if with relatively lower values. The best results were obtained with the third harvesting date of 2012 (23.66 tha -1), with a progressive increase since the first harvesting date. Conversely, in the year 2011, the production of the three sowing dates were indifferent. This is probably due to the displacement of the cultivation period caused by the delay of the seeding during the second year. Keywords: sweet sorghum, fiber sorghum, biomass yield, harvesting date

Valoración de los genotipos del sorgo de biomasa durante tres periodos de recolección en Italia Centro-oriental Resumen El uso de cultivación herbacea a fines energéticos tiene una finalidad agrícola, ambiental y social. Con referencia a la hilera de producción de los biocombustibles solidos, las investigaciones desarrolladas hasta ahora han permitido individuar entre las especies más idoneas al territorio italiano, plantas herbaceas anuales, plantas herbaceas perennes y essencias leñosas. Entre las primeras el sorgo es una de las especies de mayor interés, ya que presenta entre sus peculiaridades más significativas una buena potencialidad productiva, una relevante adaptabilidad a la zona de cultivo y flexibilidad a la destinación del producto. La oferta de las nuevas variedades es multiple, casi todas selecionadas en el norte de Europa, en ambientes distintos al italiano. Por lo tanto, en el ámbito del proyecto SUSCACE financiado por MIPAAF (Ministerio para las políticas agrícolas, alimentares y forestales) se ha creído oportuno realizar pruebas de valoración con el objetivo de caracterizar el germoplasma disponible e individuar las variedades más apropiadas para la producción de biomasa ligneo-celulósica en Centro Italia donde son escasos los resultados científicos de referencia. En 2011 y 2012 el Centro di ricerca per le colture industriali de Osimo (Ancona) del Consiglio per la Ricerca e la sperimentazione in Agricoltura, ha efectuado, en la zona centro-oriental italiana, una comparación entre 12 cultivos de sorgo de biomasa en tres épocas de recolección con el fin de individuar aquellos capaces de optimizar al máximo la producción. En ambos años las pruebas iniciaron la siembra a finales de abril, pero por problemas relacionados con un mal brote

422


durante el segundo año, la siembra definitiva se realizó a mitad de junio. El cultivo se benefició de irrigación auxiliar hasta alcanzar 7-8 hojas, con el fin de garantizar un buen inicio a la labor; fueron subministrados 74 kg de nitrógeno en dos fases, siembra y cobertura. Las recolecciones se llevaron a cabo despues de 20 días tras la espigada del primer cultivo y a intervalos de casi 20 días, el primer año, manteniendo las mismas fechas el segundo. No obstante de diversidad de las añadas, las producciones resultaron satisfactorias alcanzando de media casi 22 tha-1 de substancia seca en 2011 y superando las 19 tha-1en 2012, demostrando la validez del material en consideración. El cultivo más productivo resultó ser Buldozer (26.26 tha-1) del qual no se ha diferenciado estadísticamente Biomass 150 (24.83 tha-1) y Hércules (24.24 tha-1), en el año 2011 confirmándose tal actuación también en el año 2012, aunque con valores relativamente inferiores. Los mejores resultados se alcanzaron en el tercer periodo de cosecha de 2012 (23.66 tha -1) con un aumento lineal desde la primera. En 2011 las producciones de las tres épocas fueron indiferentes. Esto se debe imputar probablemente al desfase relevante del ciclo de cultivo causado por el retraso en la plantación sucedido al segundo año. Palabras clave: Sorgo para fibra, sorgo dulce, produccíon para biomasa, periodo de recolección

Introduction The use of herbaceous cultivations for energetic production has various socio-economic advantages: the reduction of CO2 emissions compared to the systems based on fossil fuels, which has considerably increased the gas concentration in the atmosphere in the last two centuries [1], is an advantage for the environment [2]; it represents an opportunity of diversification of the activities and creation of surplus value for the farmers; also the planning and building of biomass power plants can allow new jobs and the development of economically disadvantaged areas [3;4]. Referring to the solid biofuels sustainable chain, the researches carried out until now have allowed to identify, among the species most suitable to Italian areas [5], annual herbaceous plants (sweet and fiber sorghum), perennial herbaceous plants (giant reed, miscanthus, switchgrass, cardoon) and woody species (poplar, robinia, eucalyptus). Sorghum is among the most interesting species since it shows, among its most significant peculiarities, a high growth rate, resistance to water and thermal stress, remarkable environmental adaptability and simplicity in the cultivation [6]. Moreover, sorghum could be grown in crop rotations with food crops, allowing the use of common crop management practices and farm machineries [7]. The two typologies, morphologically similar, are characterized by a photosynthetic cycle C4, good tolerance to water stress [8; 9], good adaptation to a wide set of environments and good efficiency of the use of water [10; 11] and nitrogen [12; 13]. Moreover, the use of the products can be very flexible: the biomass obtained from fiber sorghum can be used for combustion installations to produce heat and/or be intended to cogeneration installations to obtain heat and electricity [14; 15; 16; 17; 18]; sweet sorghum can be also used, other than for thermo chemical conversion, for the bioethanol and biogas sustainable chain. Both the typologies can be used to produce “second generation” bioethanol via hydrolysis of the cellulose [19]. Lately seed companies considerably increased the offer of new varieties, almost all selected in North Europe, and whose biological and productive responses to central Italy environments are still unknown [20]. Therefore, within the project “Supporto Scientifico alla Conversione Agronomica verso le Colture Energetiche - SuSCACE”, funded by MiPAAF, it was considered worthwhile to carry out evaluations to characterize the available germoplasm and identify the most suitable varieties for the production of lignocellulosic biomass.

Materials and Metods During the years 2011 and 2012 the Centro di ricerca per le colture industriali in Osimo (AN) of the Consiglio per la Ricerca e la sperimentazione in Agricoltura carried out in eastern central Italy (43° 27’ 39” N 13° 29’ 46”; 44 m. s.l.) a comparison between 12 biomass sorghum cultivars in three harvesting dates, starting with intervals of about 20 days after the last decade of August; using a full factorial experimental design with 3 replications and 7.5 m2-sized elementary plots. In both years the trials have been sowed with a parcellar mechanical seeder at the end of April, but because of bad emergence related problems the final sowing has been completed around mid Jun after 3 re-sowings in

423


2012. The phosphatic fertilizers were applied at the annual rate of 100 kg ha-1 of P2O5 . The nitrogen fertilizers were applied at the rate of 80 kg ha-1 of N, distributed ½ during the emergence and ½ at the emission of the 6th/8th leaf; the crop received additional irrigation (20 mm each) until the reaching of 7-8 leaves, in order to guarantee a good growth of the crop. The first year the harvests have been carried out with single row tractor-mounted forage harvester with intervals of around 20 days starting from the date at least 50% of the varieties had bloomed; the same dates were kept for the second year. The plant density, the height and diameter of stem and the knot number for plant were evaluated on a sample area of 1 square meter per each plot. Dry weight and moisture content of biomass were measured after oven drying at 105°C until a constant dry weight was obtained. The data has been put before analysis of variance (ANOVA); only statistically significant results will be shown.

Results and Discussion The two years differentiated each other for temperature trends, on average around 3°C higher during the summer period of the second year (the month of July resulting as the driest) and the part of spring and autumn seasons included in the period of cultivation, which presented in 2012 abundant rainfall (Figure 1). 



























Deviations 2011

Rainfall (mm)

Temperature (°C)

1980-2012

Deviations 2012

 















 





Temperature (°C)

Rainfall (mm)

1980-2011

 

" ! !"

! 





Apr

May June July

Aug Sept Oct

 !#

Figure 1. Rainfall and average temperatures during the polyannual period of the experimental site and their deviations during the cropping season

Despite the differences between the years the yield has been satisfactory, with an average of 22 tha-1 of dry mass in 2011 and 19 tha-1 in 2012, indicating the efficiency of the varieties (Table 1). During both years the same yield level has been reached, even if in different harvesting times: in 2011 the crop reached the highest yield right at the beginning; in 2012, at the contrary, the production result increased progressively with the harvest date; the fresh biomass production showed mostly the same tendency, even if there are no statistical differences between the ends of the harvesting times in 2012. Table 1. Effects of the interaction years x harvesting times on biomass yield and final stand density Years Stand density Biomass yield (t ha-1)

424


(n m-2) I

2011 2012 Means LSD P≤0.05

II

fresh weight III

21.3 20.0 14.6 15.0 17.5 1.0

I

19.4 14.6

II

dry matter

III

I

II

III

69.83 61.73 58.82 22.39 21.12 21.92 84.22 79.11 88.67 13.14 20.40 23.66 73.73 20.44 5.78 1.36

The behavior of the moisture content of the plants at the end of summer was different between the

years: while during 2011 there was an almost constant decrease around 2-3% among the harvesting times, during 2012 in the first time interval there was a decrease of more than 10% that later settled down to 1%. It could have been important the shift in the crop cycle in 2012 caused by the delay of the planting due to the already mentioned emergence problems of the cultivar (the final number of plants, even if enough for the experimental purposes, resulted on average different for more than 5 plants per square meter between the two years): in fact only a few varieties reached the anthesis at the time of harvesting, contrary to the more than a half of the previous year. Furthermore, some biometric characters (Table 2), like the height of the stalks and number of knots per plant didn’t point out differences in the values of 2011, but showed a constant growth during the season of 2012, indicating that already at the end of August of the first year the plants had reached their final size, but that the crop was still growing in the second year. Table 2. Effects of the interaction years x harvesting times on some biometric characters Plant height Node/plant Stem diameter (mm) (m) (n) Years base apical 2011 2012 Means LSD P≤0.05

I

II

III

2.50 1.85

2.49 2.37 2.44 0.06

2.52 2.89

I

II

III

I

II

III

I

17.6 16.9 17.4 11.1 9.2 9.4 22.4 21.0 20.6 14.5 10.3 8.7 19.3 10.5 0.5 0.6

II

III

11.0 10.8 10.8 10.5 13.4 16,3 12.1 0.4

The development of trunk diameters in particular, a character mainly linked to the humidity content in the plants, showed a decrease between the first and second period per basal and apical diameter in the first year, the apical diameter constantly decreasing in the second year. This theory is also supported by the varietal response, which was influenced by the experimental year (Table 3). Table 3. Effects of the interaction varieties x years on biomass yield and stand density and varieties x years x harvesting times on sugar content of the stem juices Genotypes BIOMASS 133 BIOMASS 140 BIOMASS 150 SUCRO 506 BULLDOZER HERKULES P 811 GOLIATH ZERBERUS

Stem density (n m-2) 2011 2012 16.5 10.8 16.6 13.4 18.6 11.8 20.2 10.6 22.0 14.1 19.4 12.9 20.2 16.3 19.5 12.6 19.8 12.7

Biomass yield (t ha-1) fresh weight dry matter 2011 2012 2011 2012 58.62 79.00 23.00 18.08 67.38 91.74 22.80 20.63 72.76 86.07 24.83 19.26 63.38 77.84 22.84 17.27 79.18 91.00 26.26 21.61 59.71 88.67 24.42 20.21 60.53 93.67 16.57 20.49 58.16 87.60 22.02 19.96 43.36 79.58 21.47 18.95

Sugar content (% stem juice) 2011 2012 I

II

15.7 16.8 14.7 16.4 15.9 14.5 13.3 14.9 15.5

14.6 16.7 15.2 15.9 15.6 15.0 12.9 15.8 13.4

III

I

II

III

15.5 8.2 10.2 11.9 17.6 8.5 8.5 11.3 18.0 8.4 9.2 11.4 17.7 8.7 10.0 11.5 17.7 8.6 7.9 10.8 14.5 8.7 8.5 11.7 16.1 8.3 7.3 10.0 17.5 9.1 9.0 11.6 16.6 10.4 9.4 11.0

425


P.S.E. 98456 TRUDAN HL JUMBO Means LSD P≤0.05

21.8 24.1 24.0

19.0 21.7 21.2 17.5 1.9

68.16 83.33 50.87 67.20 79.42 82.31 73.73 11.57

18.56 18.06 16.25 15.82 22.72 18.47 20.44 2.71

13.5 13.5 15.4 9.0 17.4 15.7 17.9 9.8 14.1 13.7 15.6 9.1 12.5 1.4

7.5 9.4 7.0

10.1 11.1 9.2

The production of wet biomass overall resulted higher in 2012 of more than 20 tha-1 which didn’t result in an actual correspondence with yield of dry matter which, in terms of absolute value, resulted inferior of 2.74 t ha-1 compared to the previous year: in fact during the second year the varieties showed on average a humidity level of 12.27% higher at the harvesting time. P811 had the highest yield in 2012; in the same year, 7 cultivars, all with yields higher than 80 tha-1, didn’t result statistically different from it; however these resulted similar, in 2011, to Jumbo e Bulldozer. The latter in particular resulted at the top of the productive ranking of both years with 85.09 tha-1, followed by Jumbo, Biomass 140 and 150. Concerning the production of biomass as dry matter it’s again Bulldozer to show the best result with more than 26 t ha-1 achieved in 2011, Biomass 150 and Herkules being right after with no statistically significant differences. These two were followed by Biomass 133 e 140 (which confirmed the same performance of 2011), Sucro 506, Goliath, Jumbo and Zerberius, with yields higher than 20 t ha-1. These results were almost reached in 2012 by P811, which produced more than 20 tha-1 of dry matter together with the already mentioned Bulldozer, Biomass 140, and Herkules. In the productive average of the years 2011-2012 Bulldozer results as the best variety with 23.93 tha-1 followed by Herkules (22.31 t ha-1), Biomass 150 (22.04) and Biomass 140 (21.72). The sugary content (Table 3) proved to be conditioned by both the year and the time of harvesting. In 2011 in fact the genotypes showed on average a sugar content (% stem juice) of almost 6 points higher than the following year (15.4 vs 9.5). This was certainly due to the different level of humidity of the plants, the density of the rainfall during the period preceding the harvesting in 2012, when around 115 mm of rain occurred during the decade preceding the second harvesting and more than 20 mm during the third evaluation, unlike 2011 which didn’t present significant rainfall during the harvesting period. In most cases a improvement of the value has been observed during the third harvesting, but often the results of the three data remained stable. In any case, in 2011 Biomass 150 and Trudan HL, despite not being genotypes of the sugary type, showed the highest value, next to Bulldozer, Biomass 140, Goliath and Sucro 506 and Zerberus, among which only the last two had their characteristics expressly labeled as sugary by production companies. In 2012, during the third harvesting, 11/12 entities showed similar values ≥10,0 %.

Conclusions The experimentation confirmed the high productivity of the sorghum, placing it among the species most suitable for biomass production. Among the fiber types the best cultivar was Bulldozer, a late cycle hybrid characterized by tall and bending resistant plants. Other interesting hybrids are Biomass 150 and Hercules, with characteristics similar to the previous ones but expressed at lower levels. The varieties indicated by seed companies as sweet types produced smaller biomass yields, but didn’t show the higher sugar content of the juices. This character resulted quite unstable and conditioned by the humidity level of the ground: concerning this fact, the first five places in the average ranking are Trudan HL, Sucro 506, Biomass 140, Goliath and Biomass 150, among which only the second one is indicated as type-specific. Another important consideration concerns the humidity level of the biomass at the time of harvesting which must be taken into consideration for transportation: humidity differences up to 30% have been observed and this can affect the economic crop balance. Concerning the most suitable times for harvesting, this resulted affected by the years, since the different pedo-climatic and growth conditions shifted the maximum yield from the end of August 2011 to middle October 2012. In any case the best dry matter yield were obtained with a humidity level of

426


about 68% in 2011 and just after reaching 73% in 2012. These are the extremes of the range of moisture content that the crop should reach in order to be harvested.

References 1. Houghton J. Global Warming: The Complete Briefing. 3rd ed. Cambridge University Press; 2004. 2. Barbanti L, Grandi S, Vecchi A, Venturi G. Sweet and fibre sorghum (Sorghum bicolor (L.) Moench), energy crops in the frame of environmental protection from excessive nitrogen loads. European Journal of Agronomy. 2006; 25: 30–39. 3. Rooney WL, Blumenthal J, Bean B, Mullet JE. Designing sorghum as a dedicated bioenergy feedstock. Biofuels Bioproducts and Biorefining. 2007; 7 (1): 147-157. 4. Smith GA, Bagby MO, Lewellan RT, Doney DL, Moore PH, Hills FJ, et al. Evaluation of sweet sorghum for fermentable sugar production potential. Crop Science. 1987; 27: 788-793. 5. Di Candilo M, Ceotto E, Del Gatto A, Mangoni L, Pieri S, Diozzi, M.. Valutazione delle caratteristiche produttive ed energetico-qualitative di varietà di sorgo da fibra e da zucchero in ambienti del Centro-nord Italia. Dal Seme. 2010; 3: 46-55. Italian 6. Di Candilo M, Facciotto G. Colture da biomassa ad uso energertico. Sherwood. 2012; 4: 10-19. Italian 7. Zegada-Lizarazu W, Monti A. Are we ready to cultivate sweet sorghum as a bioenergy feedstock? A review on field management practices. Biomass and Bioenergy. 2012; 40: 1-12. 8. Kebede H, Subudhi PK, Rosenow DT, Nguyen HT. Quantitative trait loci influencing drought tolerance in grain sorghum (Sorghum bicolor L. Moench). Theoretical and Applied Genetics. 2001; 103: 266-276 9. Habyarimana E, Laureti D, Di Fonzo N, Lorenzoni C. Biomass production and drought resistance at the seedling stage and in field conditions in Sorghum. Maydica. 2002; 47: 303-309 10. Gherbin P, Perniola M, Tarantino E. Sweet and paper sorghum yield as influenced by water use in southern Italy. In: Proceedings of the First European Seminar on Sorghum for Energy and Industry, Toulouse, April 1–3 1996: 222–227. 11. Mariani G, Belocchi A, Calabrò G, Nisi D. Sorghum for cellulose production. Cellulosa Carta. 1989; 2: 14– 22. 12. Fagnano M, Postiglione L. Sorgo da energia in ambiente mediterraneo: effetto della concimazione azotata con limitati apporti idrici. Rivista di Agronomia. 2002; 36: 227-232. Italian 13. Lovelli S, Perniola M. Monteleone M, Nardiello I, Rivelle AR. Bilancio e dinamica dell’azoto in coltura di sorgo zuccherino (Sorghum vulgare L. var saccharatum): aspetti agronomici ed ambientali. In: Atti del 34° Convegno della Società Italiana di Agronomia. Pisa, 17-21 Settembre 2001: 188-189. Italian 14. Rexen E. The non-food dimension in EEC research programmes. Industrial Crops and Products. 1992; 1: 14. 15. Gosse G. Agricolture as an energy source. In: Proceedings of the Euroforum New Energies (Sarbrücken, F.R.G. Oct. 1988). 1998; (1) 46-49. Bedfrod (U.K.): H.S. Stephens and Associates 16. Grassi G. Definition of Programme Biomass. Bioenergy European Science and Technology: BEST. Elsevier Applied Science, London. 1989: 39–43 17. Abbate V, Patané C. Biomass crops for energy of possible introduction to Sicily. In: Proceedings of Ninth European Bioenergy Conference, Redwood Books Ltd., Copenhagen, Denmark, June 24–27. 1996: 622–627. 18. Venturi P, Venturi G. Analysis of energy comparison for crops in European agricultural systems. Biomass and Bioenergy. 2003; 25: 235–255 19. Di Rienzo GC, Genovese F, Tauriello A. Utilizzo e destinazione delle colture erbacee annuali. In Pari L. Ed. Lo sviluppo delle colture energetiche in Italia. Centro stampa “Nuova cultura”. 2011: 593-609. Italian 20. Di Candilo M, Ceotto E, Barbanti L, Fazio S, Monti A, Venturi G. Le colture ligno-cellulosiche per la produzione di biomassa da energia. In Ranalli P. Ed. Le piante industriali per una agricoltura multifunzionale. Edizioni Avenue Media. 2009; 9: 199-244. Italian

427


Evolución de la eficiencia energética de bombeo en pozos profundos Carmen Rocamora Osorio1, Ricardo Abadía Sánchez1, Jorge Vera Morales1, Miguel Mora Gómez1 1

Departamento de Ingeniería Escuela Politécnica Superior de Orihuela. Universidad Miguel Hernández. Carretera de Beniel km. 3,2 03312 Orihuela (Alicante). rocamora@umh.es

Resumen La modernización del regadío llevada a cabo en España en las últimas décadas ha supuesto una mejora significativa en la eficiencia de uso del agua, pero al mismo tiempo ha significado un incremento de la dependencia energética del regadío. La creciente preocupación por el uso sostenible de los recursos, unida a las subidas en las tarifas eléctricas experimentadas tras la liberalización del mercado han llevado a las administraciones y a los usuarios a adoptar medidas para mejorar la eficiencia energética de los bombeos. Estas medidas son tanto más importantes cuanto mayor es la dependencia energética de la zona regable. Las aguas subterráneas representan el 20% del agua de riego en España y su elevación representa el 80% del consumo de energía en regadío. En el caso de pozos profundos la dependencia energética es absoluta y el gasto energético es la principal partida del balance económico, por lo que los incrementos en el coste de la energía observados en los últimos años son aún más importantes. La pérdida de rendimiento en bombeos es inevitable por desgaste de elementos de la bomba. Con un adecuado mantenimiento se puede conseguir que la eficiencia del bombeo se mantenga en niveles próximos al óptimo de la instalación. Sin embargo, en las bombas sumergidas no se suelen realizar labores de mantenimiento por la dificultad de la extracción de los grupos que encarece estas labores, por lo que la pérdida de rendimiento en pozos que trabajan muchas horas al año es más acusada que en estaciones de bombeo con bombas superficiales, donde sí se realizan. En este trabajo se analiza la evolución de la eficiencia energética en pozos de una Comunidad de Regantes del Levante español. Se instalaron bombas nuevas en cuatro pozos con una profundidad de 400 m. Se midió la eficiencia energética tras la instalación de los nuevos grupos motobomba y transcurridos 18 meses. Se observó una importante pérdida de rendimiento en tres de las bombas. A la vista de los resultados se estableció un programa de mantenimiento y se llevó a cabo la extracción de dos de las bombas. Tras el mantenimiento se midió de nuevo la eficiencia energética de bombeo. Los indicadores utilizados para evaluar la evolución del rendimiento fueron la eficiencia energética del bombeo (%) y el consumo específico (kWh m -3). Ambos indicadores mejoraron tras las labores de mantenimiento, alcanzando valores próximos a los registrados tras la instalación de los nuevos grupos. Palabras clave: eficiencia energética, pozo profundo, mantenimiento preventivo

Evolution of pumping energy efficiency in deep wells Abstract The modernization of irrigation that has been carried out in Spain in recent decades has brought about a significant improvement in water use efficiency, however, at the same time, it has increased the energy dependency of irrigated agriculture. The growing concern regarding sustainable use of resources, together with the sharp rise in electricity rates since the liberalization of the electricity market have led to both administrators and users adopting measures to improve energy efficiency in pumping systems. These measures are of the utmost importance where energy dependency is greater in irrigation areas. Groundwater is an important water resource: it provides 20% of the total irrigation water in Spain and represents the largest component of energy consumption in the irrigation sector. Energy dependence is absolute in deep

428


wells and the energy cost is the main expense in Water Users’ Associations pumping groundwater. In these cases cost increases over recent years have been even more important. The loss of hydraulic performance of pumps due to a progressive deterioration, even under normal use, is unavoidable. Through an adequate maintenance it is possible to keep acceptable energy efficiency values, close to the optimal performance of the installation. Nevertheless, maintenance is not frequent in deep wells since extraction of pumps makes the work very expensive. Therefore, efficiency losses in deep wells that accumulate many annual operation hours are more pronounced than losses in pumping stations equipped with surface pumps where maintenance works are performed. In this paper the evolution of pumping energy efficiency in four deep wells of a Water Users’ Association in southeast Spain is analyzed. New pumps replaced the previous ones in the four wells, with a depth of 400 to 415 m. Energy efficiency was measured just after the installation of the pumps and after 18 months. Significant efficiency losses were observed in three of the pumps. A preventive maintenance program was established and two pumps were extracted and set up. Afterwards pumping energy efficiency was measured again. Indicators used to evaluate the evolution of the pumping performance were pumping energy efficiency (%) and specific energy consumption (kWh m-3). Both indicators improved after the maintenance work, reaching efficiency values close to those measured just after installing the new pumps. Keywords: energy efficiency, deep well, preventive maintenance

Introducción En España el agua subterránea aporta el 20% de agua de riego y abastece al 28% de la superficie regable, dando lugar al 38% de la producción agraria final (MARM, 2002). Al mismo tiempo, la extracción de agua subterránea representa el 80% del consumo energético del sector. Los bombeos de pozos profundos presentan una serie de singularidades que los diferencian de los de aguas superficiales. Por una parte, las oscilaciones del nivel dinámico del agua pueden hacer que el grupo motobomba trabaje lejos de su punto óptimo de funcionamiento, disminuyendo así la eficiencia energética (Moreno et al., 2010). Por otra parte, la profundidad a la que se encuentran enmascara ruidos y vibraciones indicativos de un funcionamiento anómalo de los grupos motobomba, por lo que es necesario controlar parámetros de funcionamiento como caudal, consumo, nivel estático y dinámico, turbidez, número de arranques del motor, y temperatura del motor y del agua (Ortiz y Palomo, 2012). Cuando se diseña y ejecuta correctamente una instalación para la captación de aguas subterráneas de riego (principalmente bomba, motor y cable), ésta funciona cerca del punto de máximo rendimiento. Sin embargo, a medida que la instalación acumula horas de trabajo su eficiencia energética va disminuyendo progresivamente, y como consecuencia se van incrementado los consumos y costes energéticos de elevación de agua. Este deterioro se produce fundamentalmente por desgastes mecánicos, fenómenos de oxidación e incrustaciones (European Commission, 2001) y en la infraestructura por fugas en la columna de impulsión por corrosión. Las pérdidas de rendimiento pueden llegar al 20,5% en los primeros años de funcionamiento (Reeves, 1960; Fleming, 1989). El mantenimiento periódico del grupo motobomba logra una mejora de la eficiencia energética, con el consiguiente descenso en el consumo de energía y, por tanto, en los costes de operación. Un plan de mantenimiento preventivo se justifica económicamente porque los costes totales de explotación (mantenimiento y operación) son menores que los costes de operación de un grupo motobomba sin mantenimiento. Además de la rentabilidad económica, la implantación de un programa de mantenimiento preventivo lleva consigo otras ventajas. Se minimiza el riesgo de averías, con lo que aumenta la garantía de suministro a los regantes. El mantenimiento se puede programar en épocas de baja o nula demanda hídrica, en cambio las averías suelen ocurrir en momentos de máxima demanda, agravando las consecuencias por la falta de suministro a los regantes. Por último, la extracción de los grupos de bombeo permite revisar otros elementos como las columnas de impulsión, que pueden tener

429


perforaciones que desencadenan bruscos descensos de rendimiento en el sistema, y los cables, que pueden sufrir deterioros en los aislantes con el consiguiente riesgo de cortocircuito. En la actualidad en gran parte de las Comunidades de Regantes y otras organizaciones de riego no se lleva a cabo un mantenimiento preventivo de los sondeos y sólo cuando se produce una avería se extraen los grupos motobomba para su reparación. En una comunidad de regantes del Levante español se han instalado nuevos grupos motobomba en los sondeos y transcurrido un tiempo se ha constatado la disminución del rendimiento. Se ha establecido un plan de mantenimiento y se ha analizado la eficiencia energética tras la puesta a punto de grupos motobomba. En esta comunicación se exponen los resultados.

Material y Métodos La superficie regable de la comunidad de regantes es de 5240 ha. Los principales cultivos son frutales, viña y hortalizas. La comunidad de regantes dispone de cuatro sondeos con profundidades entre 400 y 415 m que elevan el agua extraída a un embalse situado a 15 m sobre el nivel del brocal de los pozos, desde el cual se abastece por gravedad la totalidad de la superficie regable, ya que la cota del embalse garantiza la presión requerida en los hidrantes. En los cuatro pozos se instalaron bombas nuevas en marzo de 2009. El modelo de bomba y motor instalado en todos ellos es el mismo, y suministra una altura manométrica y caudal nominal de 429 m y 100 L s-1 respectivamente, y una potencia absorbida de 600 kW. Para el suministro eléctrico de los cuatro motores se dispone de un único contrato con una compañía comercializadora. La tarifa contratada es de 6 periodos con potencias contratadas de 100 kW en P1 y 2590 kW en los restantes periodos. Tras la instalación y puesta en marcha de los nuevos grupos motobomba la empresa instaladora realizó una medición de la eficiencia energética de éstos. Los resultados, así como los parámetros de funcionamiento de los grupos motobomba, se muestran en la tabla 1. Los valores iniciales de rendimiento son elevados y la calificación energética de los cuatro sondeos es A (eficiencia energética excelente) de acuerdo con la clasificación propuesta por el Auditorías Energéticas en Comunidades de Regantes (Abadía et al., 2008). Transcurridos 18 meses desde la puesta en marcha de las bombas se midió de nuevo la eficiencia energética de los sondeos. El análisis de la eficiencia energética se realizó siguiendo la metodología propuesta en el Protocolo de Auditorías Energéticas en Comunidades de Regantes (Abadía, et al., 2008). Los parámetros medidos se muestran en la tabla 2. Como consecuencia de la pérdida de rendimiento, la calificación energética del bombeo 1 pasó a tipo B (buena), y la de los bombeos 2 y 3 a tipo C (normal). Únicamente el sondeo 1 mantuvo la calificación A (excelente). Tras la evaluación del consumo energético y la constatación de pérdida de la eficiencia se estableció un plan de mantenimiento de los equipos de bombeo, que constaba de las siguientes fases: 1) Planificación de la inversión y ejecución de los trabajos de mantenimiento y puesta a punto de los bombeos 1, 2 y 3. 2) Verificación de los ahorros logrados tras la puesta a punto de los equipos. 3) Seguimiento continuo de la eficiencia energética con el objeto de identificar el momento óptimo de mantenimiento que minimice los costes de explotación, garantizando el suministro a los regantes. Los indicadores a monitorizar son el valor de la eficiencia energética de bombeo, EEB (%) y el consumo específico, Ce (kWh m-3).

430


En marzo de 2011 se realizaron las labores de mantenimiento de los equipos de los sondeos 1 y 2, siendo necesaria la reparación del rotor del sondeo 2. El coste, que se había estimado previamente en 10.900 € por bomba, ascendió a 36.627 € debido a la reparación. Se evaluó de nuevo la eficiencia energética en marzo/abril de 2011 para verificar la efectividad del mantenimiento. Los resultados se muestran en la tabla 3.

Resultados y Discusión Las tablas 1, 2 y 3 recogen los parámetros de funcionamiento, eficiencia energética y consumo específico de los cuatro sondeos a lo largo del período de estudio. Tabla 1. Parámetros de funcionamiento, eficiencia energética y consumo específico tras la sustitución de los grupos motobomba (marzo 2009) Hm Ns Na EEB Ce Q (mca) (kW) (kW) (%) (kWh m-³) (m³ h-1) 370,8 407,4 411,6 609 67,4 1,642 1 367,2 397,3 397,6 605,7 65,6 1,649 2 360,0 409,9 402,1 607,6 66,2 1,688 3 366,5 395,2 394,7 597,9 66,0 1,631 4 Q: caudal medio suministrado; Hm: altura manométrica suministrada por el bombeo; Ns: potencia suministrada por la bomba; Na: potencia eléctrica absorbida; EEB: eficiencia energética del bombeo; Ce: consumo específico. Sondeo

Tabla 2. Parámetros de funcionamiento, eficiencia energética y consumo específico medidos en octubre de 2010 Sondeo 1 2 3 4

Q (m³ h-1) 328,1 326,1 341,3 379,6

Hm (mca) 410,6 409,7 415,2 392,2

Ns (kW) 367,1 364,1 386,1 405,7

Na (kW) 604,0 647,3 653,2 609,8

EEB (%) 60,6 56,0 58,5 66,7

Ce (kWh m-³) 1,841 1,998 1,934 1,607

Tabla 3. Parámetros de funcionamiento, eficiencia energética y consumo específico tras el mantenimiento de los grupos 1 y 2 (marzo-abril 2011) Sondeo 1 2 3 4

Q (m³ h-1) 375,12 357,12 352,8 364,32

Hm (mca) 415,31 391,60 407,67 391,80

Ns (kW) 424,62 381,09 391,92 389,00

Na (kW) 655,5 632,0 664,5 617,5

EEB (%) 64,8 60,3 59,0 63,0

Ce (kWh m-³) 1,747 1,770 1,884 1,695

En los meses transcurridos desde la instalación de los grupos motobomba hasta la siguiente evaluación de la eficiencia, el aumento del consumo específico se debe en su mayor parte a la pérdida de rendimiento de la instalación de bombeo (bomba y motor) y no tanto al incremento de la demanda energética por descenso en los niveles dinámicos. En promedio, la extracción de agua de los sondeos 1, 2 y 3 demandaba un 15% más de potencia que al inicio, lo que repercutía directamente en un mayor coste por volumen extraído. Por otro lado, esa pérdida de rendimiento también había provocado un descenso del caudal extraído, y como consecuencia las bombas debían trabajar más horas para obtener el mismo volumen, lo que podría obligar a bombear en periodos tarifarios más caros. Como consecuencia del mantenimiento y puesta a punto, el rendimiento del grupo 1 aumentó hasta un valor próximo al inicial, observándose una reducción en el consumo específico del 5.1% respecto al valor registrado en octubre de 2010. El rendimiento del grupo 1 también mejoró; sin embargo, la recuperación fue menor de lo esperado debido probablemente a la avería detectada, que había afectado

431


seriamente al rotor del motor. Aun así, el consumo específico se redujo en un 11,4% respecto al valor anterior. En cuanto al sondeo 3, cuyo mantenimiento se pospuso para garantizar el suministro, no se observó pérdida de eficiencia entre octubre de 2010 y marzo de 2011, posiblemente debido a los cambios en el nivel piezométrico. El sondeo 4 no había mostrado signos de desgaste antes de la implantación del plan de mantenimiento. Sin embargo en la evaluación de 2011 se observó ya cierta pérdida de rendimiento, aunque su eficiencia seguía siendo alta. La calificación energética de los bombeos 1, 2 y 4 fue B (buena), y la del 3 se mantuvo como tipo C (normal). Hay que señalar que la calificación es tipo B si la eficiencia energética es mayor que 60,0% y menor que 65,0%, por lo que en el caso del bombeo 1 la calificación no cambió pero la eficiencia pasó del umbral inferior al superior. Tras la implantación del plan energético, en la campaña de riego 2010/2011, el consumo de energía se redujo un 13,4% respecto a la campaña anterior y el coste energético en un 9,9%. La eficiencia energética de los grupos se mantuvo en niveles próximos a los registrados tras la instalación de las bombas. El consumo específico medio de los sondeos se mantuvo en 1,691 kWh m-3. Tabla 4. Datos globales de volumen extraído, consumo y coste energético en las campañas de riego 2009/2010 y 2010/2011. Año hidrológico 2009/2010 2010/2011

Volumen extraído (m3) 8.548.161 7.406.400

Consumo energía (kWh) 14.455.780 12.525.184

Coste factura energía (€) 1.202.155 1.083.224

La reducción del volumen extraído en la campaña 2010/2011 respecto a la anterior explica en parte la reducción en el consumo de energía. Sin embargo, si no se hubiera realizado el mantenimiento, se habría observado un descenso en el rendimiento de los bombeos. A fin de evaluar el plan de mantenimiento se ha estimado el consumo de energía durante la campaña de riego 2010/2011 sin realizar el mantenimiento y se ha comparado con el consumo real. Para la estimación se ha considerado un aumento lineal del consumo específico de los sondeos 1 y 2, y se ha utilizado el consumo específico real de los sondeos 3 y 4. El coste de implementación del plan de mantenimiento preventivo fue de 42.937 €, que engloba el coste de mantenimiento, la instalación de analizadores de redes para registrar parámetros de funcionamiento y los servicios de un gestor energético. El coste de explotación (coste energético más mantenimiento) en la campaña 2010/2011 fue de 1.126.161 €. El consumo de energía estimado para la campaña 2010/2011 sin llevar a cabo mantenimiento se eleva a 13.916.158 kWh. El coste estimado, utilizando el coste ponderado (€ kWh-1) calculado para dicha campaña, es de 1.203.521 €, lo que supone un incremento del 7,1% respecto al coste de explotación real. Tras la verificación del plan de mantenimiento, se ha incluido en el siguiente plan la puesta a punto de la bomba 3, la determinación del momento óptimo de mantenimiento para la bomba 4 y el seguimiento energético de los equipos de bombeo mediante lectura quincenal de parámetros hidráulicos y eléctricos para detectar pérdidas de rendimiento en los cuatro sondeos.

Conclusiones Tras las labores de mantenimiento, y en su caso reparación, de las bombas de los pozos 1 y 2, estos equipos han visto mejorada su eficiencia energética y sus consumos energéticos específicos, reduciéndose el coste energético de la extracción de agua de riego.

432


El coste del plan de mantenimiento ha supuesto un 0,6% del coste energético de la Comunidad de Regantes y ha evitado un incremento significativo del consumo y del coste energético. El seguimiento de forma precisa de los parámetros de funcionamiento de los equipos aporta información sobre la rentabilidad del mantenimiento efectuado y sobre cuándo serán necesarias las futuras labores de mantenimiento y puesta a punto de los equipos. Mediante el mantenimiento preventivo se ha logrado reducir los costes totales de explotación y se ha asegurado un correcto funcionamiento de los bombeos, manteniendo su eficiencia energética en niveles óptimos, y garantizando el suministro a los regantes al evitar paradas intempestivas provocadas por averías.

Agradecimientos Los autores desean expresar su agradecimiento a la empresa Medyser por su colaboración.

Bibliografía Abadía, R., Rocamora, C., y Ruiz, A. (2008). Protocolo de auditoría energética en comunidades de regantes. Instituto para Diversificación y Ahorro de la Energía, (IDAE) Serie Divulgación Ahorro y Eficiencia Energética en Agricultura nº 10. Ministerio de Industria, Turismo y Comercio, Madrid. European Commission (2001). Study on improving the energy efficiency of pumps. En: http://re.jrc.ec.europa.eu/energyefficiency/motorchallenge/pdf/SAVE_PUMPS_Final_Report_June_200 3.pdf. [16 Octubre 2012]. Fleming, J. (1989). Identification and implementation of effective pumping system energy cost savings. Pumping Cost Savings in the Water Supply Industry Seminar. Institution of Mechanical Engineers. Ministerio de Medio Ambiente y Medio Rural y Marino. (2002). Plan Nacional de Regadíos. Horizonte 2008. Moreno, M.A., Corcóles, J.I., Moraleda, D.A., Martínez, A., Tarjuelo, J.M. (2010). Optimization of Underground Water Pumping. Journal of Irrigation and Drainage Engineering 136, 414-420. Ortiz, M., Palomo, A. (2012). Maintaining deep well submersibles. World pumps magazine. April 2012. Elsevier. Digital issue (http://www.worldpumps.com/download/778). Reeves. D.T. (1960). Deterioration of a centrifugal pump in service. Allen Engineering Review. Noviembre 1960.

433










Validación de un modelo CFD del comportamiento del aire producido por un turboatomizador frente a la copa de un naranjo E. Moltó(1), R. Salcedo(1), R. Granell(1), C. Garcerá(1), G. Palau(2), P. Chueca(1) 1

Centro de Agroingeniería, Instituto Valenciano de Investigaciones Agrarias. Ctra. Moncada-Náquera km. 4,5 46113 Moncada (Valencia). E-mail: molto_enr@gva.es 2 Departamento de Ingeniería Rural y Agroalimentaria, Universidad Politécnica de Valencia, Camino de Vera s/n 46022 Valencia

Resumen Durante la aplicación de fitosanitarios con turboatomizador, una fracción del producto se pierde (deriva) en la atmósfera, generando un riesgo medioambiental. Pese a que hay un gran interés por cuantificar la deriva de los productos fitosanitarios, las mediciones de campo son extraordinariamente complejas y caras. La Dinámica de Fluidos Computacional (CFD) permite realizar modelos matemáticos de este fenómeno que pueden ayudar a comprenderlo y cuantificarlo. La corriente de aire producida por el ventilador se ve afectada por la copa de los árboles, modificando las trayectorias de las gotas pulverizadas. En la literatura científica sobre CFD se encuentran diversos trabajos en los que la vegetación se considera como un cuerpo poroso y se trabaja con el modelo de turbulencia denominado k-(. Sin embargo, esta aproximación no es adecuada para los tratamientos de las copas de los cítricos con turboatomizador. En el presente trabajo se propone y valida un modelo CFD bidimensional diferente a partir de medidas de campo. El nuevo modelo CFD considera la primera copa de árbol como un cuerpo sólido y utiliza un modelo de turbulencia SST k-ω. Como condición de entrada se introducen las velocidades del aire a la salida del ventilador medidas experimentalmente. Para comprobar los resultados del modelo, se comparan los datos de velocidad del aire obtenidos con la simulación con los datos experimentales obtenidos en diferentes puntos detrás del árbol, calculando los coeficientes de determinación R2 y la raíz cuadrada del error medio de predicción RMSEP para cada componente de la velocidad. El modelo ha sido capaz de representar los reflujos de aire que se producen detrás y encima del árbol. Palabras clave: turboatomizador, aire, simulación

CFD model validation of the air flow produced by an air-assisted sprayer in front of an orange tree canopy Abstract During plant protection treatments using air blast sprayers, part of the chemical is lost in the atmosphere (spray drift), causing risks to the environment. Although there is a growing interest in quantifying spray drift, field measurements are extraordinarily complex and expensive. Computational Fluid Dynamics (CFD) generates mathematical models of this phenomenon that may help to understand and qunatify it. The air flow produced by the fan is affected by the canopies, which modify the trajectories of spray droplets. Current state of the art in CFD consider canopies as a porous bodies and use the a k-( turbulent model. This work proposes and validates a two dimensional CFD model to be applied in citrus tree applications from experimental data. This new CFD model considers canopies as solid bodies and uses a SST k-ω turbulent model. Air velocities measured before the canopy are introduced as boundary conditions. In order to test the validity of the model, air velocities obtained with the model are compared with the experimental data obtained at the other side of the canopy by calculation determination coefficients R2 and root mean standard error of prediction RMSEP for each R f Nº C0166 434








 velocity component. The model was able to simulate the turbulent flows observed after and over the canopy. Key words: fan, spray drift, simulation

Introducción El aumento de la concienciación social en materia de medio ambiente ha motivado a la comunidad científica a analizar y cuantificar los fenómenos relacionadas con la aplicación de productos fitosanitarios que puedan suponer un riesgo para nuestro entorno, ya que se ha observado que durante los tratamientos fitosanitarios hasta un 50% de la cantidad de pesticida puede llegar a acabar en la atmósfera (Van den Berg, Kubiak y Benjey, 1999). Para medir o estimar la cantidad de deriva que se producen en una aplicación de fitosanitarios, se realizan ensayos experimentales según la norma ISO 22866 (2005). Sin embargo, estos ensayos son muy dificultosos debido a que hay muchas variables que no se pueden controlar. Además, estos ensayos no permiten conocer cuál es el comportamiento de las trayectorias de los fluidos ya que únicamente miden deposiciones del producto sobre colectores. Estas limitaciones han impulsado el desarrollo de modelos físico-matemáticos que ayudan a explicar estos fenómenos. La aproximación numérica de este fenómeno mediante la Dinámica de Fluidos Computacional (CFD) puede ser una buena herramienta. Para hacer un uso adecuado de esta técnica se necesita representar el comportamiento de la vegetación durante los tratamientos, ya que la corriente de aire producida por el ventilador se ve afectada por la copa de los árboles, lo que modifica las trayectorias de las gotas pulverizadas. El modelo turbulento k-( (Launder y Sharma, 1974) es el más empleado en CFD para simular el comportamiento del aire durante los tratamientos de fitosanitarios (Da Silva et al., 2006). En estos trabajos la vegetación se suele considerar como un cuerpo poroso (Endalew et al., 2010). De este modo, se diseñó un primer modelo para las aplicaciones de fitosantiarios con turboatomizador para cítricos (Salcedo et al., 2011 y 2012). Los resultados mostraron que la simulación no representaba los fenómenos de turbulencia que se producen detrás de la copa. Esto pudo ser debido a que el modelo turbulento k-( no era el más adecuado para reproducir los remolinos de aire (llamados vórtices o reflujos), debido a sus limitaciones matemáticas, y a que la densidad foliar de los cítricos es tan alta (en comparación con otros cultivos) que se comporta como un sólido más que como un cuerpo poroso. Este trabajo se propone un nuevo modelo CFD, considerando el árbol enfrentado al turboatomizador como un sólido y se emplea un modelo turbulento diferente, el SST k-ω (Menter, 1993), que está mejor preparado para representar flujos sometidos a gradientes de presión adversos (Pope, 2000), que es lo que sucede con la corriente de aire al enfrentarse con el árbol. Por último, se comparan las predicciones del nuevo modelo con los datos experimentales.

Materiales y métodos En primer lugar, se obtuvieron datos experimentales sobre las velocidades del aire procedente de un turboatomizador convencional (pulverizador FEDE, modelo FUTUR 1500) situado frente a un naranjo siendo la velocidad en la t.d.f. de 480 rev/min y utilizando la segunda velocidad del ventilador (caudal medio de aire de aproximadamente 24.4 m3/s). La salida del ventilador estaba alineada con el tronco (Figura 1).

R f Nº C0166 435










Figura 1. Alzado del ensayo de campo Se han realizado medidas en cuatro postes verticales paralelos y uno horizontal: A) entre el equipo y el árbol, B) entre el plano A y el centro del ventilador C) inmediatamente detrás de la copa, D) en mitad de la calle adyacente y E) antes del árbol más cercano en la fila adyacente. En cada poste vertical se ha medido la velocidad del aire cada 30 cm, desde los 0.3 m hasta los 3.3 m de altura. En el poste horizontal se ha medido cada 20 cm desde el centro del ventilador hasta coincidir con el plano A a una altura de 1.8 m sobre el suelo. La velocidad y dirección del aire en cada punto se ha medido con un anemómetro de ultrasonidos 3D (WindMaster 1590-PK-020, Gill Instruments Ltd., Hampshire, UK) colocado en posición vertical. El tiempo de adquisición de datos ha sido de 60 s en cada punto de medida, con una frecuencia de muestreo de 1 Hz. Luego los datos han sido promediados en cada punto. Este procedimiento ha proporcionado la coordenada horizontal U(y) y vertical W(z) de la velocidad del aire en cada punto. Posteriormente se construyó un modelo CFD (Fig. 2) en dos dimensiones que incluye una entrada de aire, que simula la corriente de aire procedente del ventilador, y tres árboles. Se ha trabajado con la hipótesis de que el árbol más próximo al turboatomizador se comporta como un sólido, con una resistencia porosa entre la copa y el suelo. El resto de las copas se consideran medios porosos.

Figura 2. Geometría del modelo El diámetro y la altura de las copas tienen las mismas dimensiones que las medidas en el campo, excepto la primera copa, que fue determinada tras una serie de simulaciones previas, en las que se variaba el tamaño y las anchuras de la copa. Se seleccionó aquella geometría cuyos datos detrás de la copa presentaron un mayor R2 y un menor error de predicción RMSEP para las dos componentes de la velocidad respecto a los datos experimentales de Salcedo et al., (2012). El espacio computacional ha R f Nº C0166 436








 sido discretizado en celdas cuadriláteras de 4 cm de lado siguiendo el método de los volúmenes finitos (Versteeg y Malalasekera, 1995). Todos los cálculos se han realizado con un ordenador de 8 procesadores Intel (R) Xeon (R) CPU, 2.80 GHz Windows 7 y 16 Gb RAM. El programa utilizado para la simulación fue ANSYS Fluent 12.0 (ANSYS, Inc. Canonsburg, PA, USA). El modelo de turbulencia utilizado es el SST k-ω. La energía cinética turbulenta (k) ha sido obtenida a partir de los datos experimentales e introducida como condición de entrada. En cambio, para el valor del ratio de disipación de la energía (ω) se ha usado el valor por defecto de Fluent (1 s-1). Como condición de entrada, se han introducido las velocidades medidas en los postes A y B. El aire ha sido considerado como un fluido incompresible e isotérmico. El aire puede salir por el resto del dominio salvo por el extremo inferior, que representa el suelo. La simulación ha consistido en procesos iterativos que han convergido a una escala mínima residual normalizada de 10-4. Se ha empleado el algoritmo SIMPLE (Ferziger y Peric, 2001) y el esquema numérico ha sido de segundo orden. Para determinar la resistencia de un cuerpo poroso al paso de un flujo, Fluent relaciona la caída de presión que se produce con la ecuación de Darcy. Esta ecuación es una suma de las pérdidas por la inercia y por la viscosidad. La viscosidad se ha considerado despreciable. Se ha trabajado directamente con la inercia (m-1). Tanto en la resistencia bajo el sólido como en los otros dos árboles se ha asignado un valor de 7 m-1. Para validar el modelo, se midieron las velocidades obtenidas en la simulación detrás de la primera copa y se compararon con los datos de los postes C, D y E utilizando el coeficiente de determinación R2 y el error medio estándar de predicción RMSEP para cada componente de la velocidad en cada punto de medida. Se han tenido en cuenta tres zonas: la zona inferior entre 0.0 y 0.6 m, la zona media (M) entre 0.6 y 2.0 m y la zona superior entre 2.0 m y 3.3 m, y. Las zonas superior e inferior son por donde circula el aire, mientras que la zona M corresponde a la del sólido. Por último, se han dibujado las líneas de corrientes.

Resultados y discusión La simulación (Fig. 3) representó un vórtice entre árboles así como otro reflujo sobre el árbol. En este caso, la velocidad U es dominante, mientras que la componente W va hacia el suelo salvo los primeros 0.6 m en las posiciones de los postes C y D y los 2.1 m en el poste E.

 Figura 4. Líneas de corriente de la simulación finalizada y líneas de medida coincidentes con los postes del ensayo En el diagrama de las líneas de corriente también se aprecia un corriente muy vertical cerca de la copa. Esta corriente correspondería al efecto pantalla que produce la vegetación. R f Nº C0166 437








 Los datos experimentales (Fig. 3) señalan que que la componente horizontal del aire (U) siempre fue mayor que la vertical (V). Los datos del poste C, el más próximo a la primera copa, muestran que hay una corriente de aire hacia la fila adyacente en los primeros 0.9 m, que corresponde al flujo que pasa por debajo del árbol. A partir de entonces, U cambia de signo y se dirige de nuevo hacia el primer árbol, lo que pone de manifiesto un posible reflujo entre árboles. Esta componente mantiene esta misma dirección hasta pasar la altura de la copa y llegar hasta los 3.3 m de altura. Esto sugiere que hay un segundo reflujo sobre la copa. Las velocidades verticales W siempre han sido en dirección del suelo, excepto en los primeros 0.6 m del poste E, situado frente al segundo árbol.

Figura 4. Diagrama de los vectores velocidad del aire medidos en campo En la zona inferior, la media de los coeficientes R2 entre los datos del modelo y los tres postes fue 1.00, el error de predicción RMSEP para la componente horizontal U fue de 2.01 m/s mientras que para la vertical w tuvimos un RMSEP = 0.28 m/s. Para la componente U, la media de los coeficientes de determinación en la zona media es de R2 = 0.54, y RMSEP = 0.67 m/s. Para la componente W es de R2 = 0.48 y RMSEP = 0.25 m/s. Para la componente U, en la zona superior se ha obtenido un valor medio de R2 = 0.68 y de RMSEP = 0.76 m/s y para la W un valor de R2 = 0.49 y un RMSEP = 0.13 m/s (Tabla 1). Tabla 1. Valores medios de R2y RMSEP (m/s) para las dos componentes de la velocidad, U(y) y W(z) en las tres zonas de la copa (Superior, Media e Inferior) RMSEP (m/s) R2 Zona U(y) W(z) U(y) W(z) 0.76 0.13 0.68 0.49 Superior 0.67 0.25 0.54 0.48 Media 2.01 0.28 1.00 1.00 Inferior

Conclusiones Al considerar la primera copa frente al turboatomizador como un sólido y utilizar un modelo de turbulencia SST k- ω, los resultados la simulación mostraron dos reflujos, uno entre árboles y otro sobre la copa, que concuerdan con los datos experimentales. De este modo, se ha conseguido representar los principales fenómenos turbulentos que suceden detrás de la copa, lo que es muy importante, ya que estos reflujos no son detectados en los ensayos ISO y también influyen en las trayectorias de las gotas pulverizadas, lo que en futuro servirá para estimar la cantidad de deriva. No obstante, somos conscientes de que la solución de modelizar el árbol como un único cuerpo sólido no es real, puesto que el aire atraviesa la copa. Sin embargo el modelo sienta las bases para un modelo más completo en el que la copa se represente con propiedades de sólido y de cuerpo poroso.

R f Nº C0166 438










Agradecimientos Este trabajo ha sido parcialmente financiado por el Ministerio de Economía de España (proyectos AGL2007-66093-C04-01 y AGL2010-22304-C04-01) y los Fondos Europeos de Desarrollo Rural (FEDER).

Bibliografía Da Silva, A., Sinfort, C., Tinet, C., Pierrat, D., and Huberson S. (2006) A Lagrangian model for spray behaviour within vine canopies. Aerosol Science 37: 658-674. Endalew, M.A., Debaer, C., Rutten N., Vercammen, J, Delele M.A., Ramon, H., Nicolaï, B.M., and Verboven, P. (2010) A new integrated CFD modelling approach towards air-assisted orchard spraying. Part I. Model development and effect of wind speed and direction on sprayer airflow. Computers and Electronics in Agriculture 71:128-136. Ferziger, J.H and Peric, M. (2001) Computational Methods for Fluid Dynamics. Springer – Verlag. ISO TC 23/SC 06 N 22866. (2005) Equipment for crop protection—methods for the field measurement of spray drift. Launder, B.E and Sharma, B.I. (1974) Application of the Energy Dissipation Model of Turbulence to the Calculation of Flow Near a Spinning Disc. Letters in Heat and Mass Transfer, 1: 131-138. Menter, F.R. (1993) "Zonal two equation k-ω turbulence models for aerodynamic flows", AIAA Paper 93-2906. Pope, S.B. (2000) “Turbulent flows”. Cambridge University Press. Salcedo, R., Granell, R., Garcerá, C., Palau, G., Moltó, E., and Chueca, P. (2012) CFD model of the effect of canopy on air velocity in air-assisted treatments in mandarin orchards. CIGR-EurAgEng International Conference of Agricultural Engineering 2012. Valencia (España), 8-12 de Julio de 2012. Salcedo, R., Granell, R., Garcerá, C., Palau, G., Chueca, P., and Moltó E. (2011). Modelizado del flujo del aire en la copa de los cítricos durante los tratamientos fitosanitarios. VI Congreso Ibérico de Agroingeniería. Évora (Portugal). Van den Berg, F., R. Kubiak., and W.G. Benjey. (1999) Emission of pesticides into the air. Water, Air and Soil Pollution 115: 195-218. Versteeg, H.K., and Malalasekera, W. (1995) An introduction to Computational Fluid Dynamics. The finite volume method. Prentice Hall.

R f Nº C0166 439


Materia orgánica carbonizada como componente de sustrato para el cultivo en contenedor 1

F. Fornes1, A. Janackova2, M. Sánchez-Perales2 y R. M. Belda1 Instituto Agroforestal Mediterráneo. Universitat Politècnica de València, Camino de Vera s/n, 46022 Valencia. ffornes@bvg.upv.es 2 Departamento de Producción Vegetal

Resumen Se ensayaron dos materiales orgánicos carbonizados (MOC), mezclados con fibra de coco (FC) en las proporciones 50:50, 25:75, 10:90 y 0:100 (control de fibra de coco) en volumen, para la preparación de sustratos de cultivo. Los MOC utilizados fueron, 1) HTC = biochar de residuos forestales y de jardinería producido por el sistema de carbonización hidrotermal, y 2) Cisco = obtenido tras la combustión parcial de orujo seco (residuo de hueso y piel de aceituna) procedente de la extracción de aceite. Los siete sustratos se caracterizaron física y físico-químicamente. Se realizaron ensayos de evaluación agronómica utilizando seis especies vegetales, dos hortícolas (tomate y berro), dos ornamentales (petunia y caléndula) y dos arbustivas forestales (lentisco y mirto). Aunque ambos materiales presentaron propiedades físicas inadecuadas para su uso como sustrato –baja aireación y excesiva retención de agua en el caso del HTC y lo contrario en el caso del Cisco– las mezclas con FC ensayadas sí que presentaron características dentro de los márgenes considerados adecuados para HTC aunque mantuvieron una excesiva aireación para el Cisco. Ambos materiales son alcalinos siendo el pH del HTC de 8,6 y el del Cisco de 9,7. La mezcla con FC (pH = 6) hizo disminuir el pH en el caso del HTC pero escasamente en el del Cisco que mostró una elevada capacidad tampón. La conductividad eléctrica fue aceptable para el HTC (136 mS m-1) y muy elevada para el Cisco (918 mS m-1), disminuyendo marcadamente en las mezclas conforme aumentó la proporción de FC. De acuerdo con esto, los bioensayos de germinación con semillas de berro y lechuga pusieron de manifiesto la toxicidad del Cisco y la ausencia de la misma respecto al HTC. Los ensayos agronómicos pusieron a su vez de manifiesto la diferente tolerancia de las especies vegetales a la presencia de estos materiales en el sustrato de cultivo. El HTC provocó en general una disminución del crecimiento de las plantas cuando se empleó en proporciones elevadas (25%-50%) en el sustrato. Este efecto fue menor en las ornamentales que en hortícolas y forestales y se debió probablemente a la inmovilización del nitrógeno causada por este material. El Cisco al 25%-50% impidió la supervivencia de caléndula, petunia y mirto. En los demás casos el crecimiento de las plantas se redujo marcadamente, en mayor medida cuanto mayor fue la proporción del material en el sustrato. La excepción fue el tomate que admitió hasta un 25% de Cisco sin presentar problemas de fitotoxicidad. Palabras clave: biochar; biocarbón; HTC; cisco; sustrato

Carbonized organic matter as growing media constituent for potted plant cultivation Abstract Six mixes of carbonized organic matter (COM) and coir fibre (CF) were assayed as growing media for potted vegetable (tomato and cress), ornamental (petunia and marigold) and shrub (mastic and myrtle) cultivation. Two COM were used: 1) HTC = biochar from forest and garden wastes produced by hydrothermal carbonization; and 2) Cisco = partially burned olive mill and stone waste. The seven substrates were HTC:FC and Cisco:FC mixes at 50:50, 25:75, 10:90 and 0:100 (CF control) proportions by volume. The physical and physico-chemical properties of the raw materials and the substrates were determined. Whilst the raw materials showed inadequate physical properties for their use as only components in growing media (low air content and too high water content for HTC and the opposite for Cisco), the mixes with CF showed adequate properties in the case of HTC although the air content was still too high in the case of Cisco mixes. Both COM were alkaline (pH for HTC = 8.6; pH for Cisco = 9.7). Whilst mixing HTC with CF (pH = 6.0) decreased substrate pH, mixing Cisco with CF decreased only slightly the original Cisco pH indicating that Cisco had a strong buffer capacity. Electrical conductivity was acceptable for HTC (136 mS m-1) but markedly high for Cisco (918 mS m-1) and decreased significantly in the mixes as the proportion of CF increased. As expected, the germination bioassays carried out

440


with lettuce and cress seeds indicated that Cisco was potentially phytotoxic whilst HTC was not. In the growing assays HTC at higher proportions (25% to 50%) caused a decrease in plant growth, more remarkably in the vegetables and shrubs than in the ornamental specimens. This effect was probably due to nitrogen immobilization in the medium. The plant response to Cisco differed among species in relation to their tolerance to salinity. Petunia, marigold and myrtle did not survive in media containing 25% or 50% Cisco. For cress and mastic growth decrease was the more remarkable the more Cisco was present in the substrate. Tomato grew well in substrates containing up to 25% of Cisco but growth decreased in Cisco at 50%. Keywords: biochar;; cisco; HTC; substrate

Introducción y/o Justificación En la búsqueda de nuevos materiales que puedan constituir, solos o en mezcla con otros materiales, sustratos para el cultivo sin suelo de planta en contenedor deberán considerarse en primer lugar las propiedades físicas que aporten al sustrato, ya que éstas no se pueden manipular una vez iniciado el cultivo, y en segundo término las características físico-químicas, nutricionales, supresoras de enfermedades, beneficios medioambientales y consideraciones económicas pertinentes. El biochar o biocarbón es un material granular, rico en carbono, que se obtiene a partir de cualquier tipo de residuo orgánico por un proceso de carbonización a baja presión de oxígeno que puede tener lugar por vía seca (pirolisis) o por vía húmeda (carbonización hidrotermal, HTC) (Libra et al., 2011). Además de su uso como combustible, durante la última década se han realizado numerosos estudios y revisiones sobre los efectos del biochar (principalmente de pirolisis) en suelos agrícolas, buscando mejorar las propiedades del suelo, la retención de agua y nutrientes y el crecimiento y productividad de los cultivos, y todo ello justificado por un objetivo principal que es la posibilidad de secuestro de carbono en el suelo con la disminución de las emisiones de gases de efecto invernadero (emisión de CO2 negativa) que ello conlleva (Atkinson et al., 2010; Sohi et al., 2010; Lehmann et al., 2011; Xu et al., 2012). Dados los beneficios que se han descrito de tipo ambiental y de tipo agronómico de la aplicación de biochar al suelo parece lógico esperar que estos materiales también presenten ventajas cuando se usen en la formulación de sustratos para cultivo sin suelo. Sin embargo, existen muy pocos estudios publicados que exploren esta posibilidad y, frecuentemente, el biochar ha sido ensayado más como aditivo que entra en escasa proporción en el medio de cultivo que como un elemento principal (Graber et al., 2010). Por otra parte, como ocurre con otros materiales de origen heterogéneo (i.e. composts, vermicomposts, residuos de fibra de coco, turbas, etc.) diferentes biochares pueden presentar características físicas, físico-químicas y químicas marcadamente distintas. Además, estos materiales sólo esporádicamente han sido caracterizados desde el punto de vista de su utilización como componentes de sustrato (Suo et al., 2011; Tian et al., 2012) pero no lo han sido siguiendo la normativa española oficial que aplica a este uso (Normas UNE-EN sobre mejoradores del suelo y sustratos de cultivo). El objetivo de este trabajo ha sido evaluar la potencialidad de dos materiales orgánicos carbonizados (MOC) de diferente origen y naturaleza (HTC y Cisco) como componentes de sustrato para cultivo en contenedor. Para ello se han preparado 7sustratos diferentes que se han caracterizado física y físicoquímicamente y se han cultivado en ellos 6 especies vegetales distintas.

Material y Métodos Los MOC utilizados en este ensayo fueron los siguientes: 1) HTC, proporcionado por INGELIA S.L. que lo produce a partir de restos de poda forestal y de jardinería siguiendo un proceso de carbonización hidrotermal, y 2) Cisco, obtenido a través de Carbones Alcaraz, S.L. y producido por combustión parcial de orujo de aceituna de la industria aceitera. Las seis especies vegetales utilizadas en los ensayos agronómicos fueron las siguientes: Calendula officinalis, Petunia x hybrida, Lepidium sativum cv. Alenois, Solanum lycopersicum cv. Money Maker, Pistacia lentiscus y Myrtus communis.

441


Se prepararon nueve sustratos mezclando los MOC con fibra de coco (HorticocoÂŽ, Valimex, S.L.) en las siguientes proporciones (% en volumen): 0:100 (control de fibra de coco), 10:90, 25:75, 50:50 y 100:0 (MOC pura). De entre ellos, los MOC puros no se utilizaron en los ensayos agronĂłmicos. La caracterizaciĂłn fĂ­sica y fĂ­sico-quĂ­mica se realizĂł siguiendo las normas espaĂąolas (UNE-EN) sobre mejoradores del suelo y sustratos de cultivo. Los bioensayos de germinaciĂłn se realizaron siguiendo la propuesta de Zucconi et al. (1981). El porcentaje de germinaciĂłn se determinĂł sembrando 30 semillas sobre cada sustrato en placas Petri (3 placas por sustrato = 150 semillas de cada especie). Para los ensayos agronĂłmicos los sustratos se fertilizaron aĂąadiendo un abono de liberaciĂłn lenta (Multicote-6ÂŽ) a razĂłn de 3 g por litro de sustrato y se utilizaron bandejas de semillero de planta forestal con 32 pocillos de 300 mL de capacidad por bandeja. Treinta y dos semillas (una por pocillo) pre-germinadas por especie y sustrato fueron trasplantadas a las bandejas y mantenidas bajo condiciones de riego por nebulizaciĂłn en invernadero con calefacciĂłn hasta el final del cultivo cuando se determinĂł el peso del vĂĄstago y se evaluĂł mediante un panel de expertos el desarrollo de la raĂ­z en una escala visual de 1 a 4 puntos. Los resultados se sometieron a un anĂĄlisis de varianza y cuando hubo diferencias entre tratamientos se analizaron mediante el test de Student-Newman-Keuls.

Resultados y DiscusiĂłn Las propiedades fĂ­sicas (tabla 1) y fĂ­sico-quĂ­micas (tabla 2) de los materiales estudiados difirieron marcadamente. Tabla 1. Propiedades fĂ­sicas de los sustratos conteniendo los biocarbones de HTC y Cisco en mezclas al 0-100 (control), 10:90, 25:75, 50:50 y 100:0 en volumen con fibra de coco.

DAa

a

Sustrato HTC 100 HTC 50 HTC 25 HTC 10 Cisco 100 Cisco 50 Cisco 25 Cisco 10 F. coco Pb

324b 213e 129i 97j 247d 173f 146h 101j 81k ***

DP (kg mâ&#x20AC;&#x201C;3) 1653ab 1637abcd 1573ef 1593def 1663a 1633abcd 1617bcde 1607cde 1550f ***

PT

Vair

80,4j 87,0g 91,8cd 93,9b 85,2h 89,4f 90,9de 93,7b 94,8a ***

9,3f 21,3e 35,5bc 43,2a 42,5a 36,8bc 39,6ab 43,7a 36,1bc ***

Vagua (% v/v) 71,1a 65,7b 56,3cd 50,7ef 42,6g 52,6ef 51,4ef 50,0ef 58,7c ***

ContracciĂłn 20,7b 26,5a 26,5a 25,9a 2,0d 12,3c 19,6b 26,7a 24,2a ***

DA = Densidad aparente; DP = Densidad de partĂ­cula; PT = porosidad total; Vair = volumen de poros conteniendo aire; Vagua = volumen de poros conteniendo agua. b*** indica diferencia significativa a P â&#x2030;¤ 0.001. Letras diferentes en cada columna representan diferencias significativas a P â&#x2030;¤ 0.05 (test de Student-Newman-Keuls).

En comparaciĂłn con los rangos considerados adecuados (RA) para el uso de materiales orgĂĄnicos en la preparaciĂłn de sustratos para cultivo sin suelo en contenedor (Bunt, 1988; Carmona y Abad, 2008) el HTC presentĂł una DA y DP dentro del RA (<400â&#x20AC;&#x201C;â&#x20AC;&#x201C; 

   y una PT ligeramente inferior al mismo (Ë&#x192;. Sin embargo, la aireaciĂłn, del 9,3%, estuvo muy por debajo del RA (20-30%) y la retenciĂłn de agua, del 71,1%, fue excesiva. El Cisco, por su parte, es un material mĂĄs ligero (con menor valor de D A y mayor de PT) que el HTC y presentĂł una relaciĂłn aire-agua opuesta a la de este material ya que la aireaciĂłn en el Cisco fue excesiva, del 42,5%, y el contenido en agua, del 42,6%, mucho menor que en el HTC. En cuanto a la contracciĂłn que experimenta el material al secarse, tanto el HTC como el Cisco lo hicieron dentro del RA (<30%) si bien hubo una marcada diferencia entre ellos siendo que el Cisco prĂĄcticamente no se contrajo mientras que el HTC lo hizo en un 20,7% de su volumen, de modo similar a como lo hizo la fibra de coco. En biochares caracterizados

442


en otros estudios se encontraron siempre valores de DA, DP y PT adecuados (Suo et al., 2011; Terra et al., 2011) aunque en algún caso, como es el del biochar de cascarilla de arroz, la aireación fue muy elevada y la retención de agua escasa (Terra et al., 2011). El pH fue alcalino en ambos materiales, más en el Cisco (9,7) que en el HTC (8,6), estando su valor muy por encima del RA (5,5-6,3). La CE fue aceptablemente baja en el HTC (136 mS m–1) y marcadamente elevada en el Cisco (918 mS m–1). En los bioensayos de germinación (tabla 2) el Cisco presentó una marcada inhibición de la misma (fitotoxicidad) debido a su elevada salinidad, si no a otras causas añadidas, mientras que el HTC no afectó en absoluto a la correcta germinación y crecimiento de la radícula de las semillas de berro y lechuga ofreciendo resultados similares o mejores que los de la fibra de coco. Estos valores de pH y de CE no son extraños en este tipo de materiales. De hecho, de la bibliografía se extrae que, de unos 40 materiales revisados, los valores de pH y de CE de biochares de pirolisis oscilan ampliamente, entre 5,9-10,4 de pH y 12 -1470 mS m−1 de CE, respectivamente, mientras que los de HTC, aunque también varían ampliamente, son más bajos (4,88,6 para el pH y 42-280 mS m−1 para la CE). Tabla 2. Características físico-químicas de los sustratos conteniendo los biocarbones de HTC y Cisco en mezclas al 0-100 (control), 10:90, 25:75, 50:50 y 100:0 en volumen con fibra de coco e índices de germinación obtenidos sobre los materiales sin mezclar. Cond. eléctrica Índice de germinación Sustrato pH (mS m–1) Berro Lechuga HTC 100 8,6d 136e 121 119 HTC 50 7,4f 104f HTC 25 7,7e 92g HTC 10 7,3g 86h Cisco 100 9,7a 918a 11 20 Cisco 50 9,7a 568b Cisco 25 9,6b 316c Cisco 10 9,1c 139d F. coco 6,0h 81i 115 96 Pa *** *** a *** indica diferencia significativa a P ≤ 0.001. Letras diferentes en cada columna representan diferencias significativas a P ≤ 0.05 (test de Student-Newman-Keuls).

La evaluación agronómica de los sustratos conteniendo HTC y Cisco se presenta en la tabla 3. El HTC provocó en algunas especies una disminución del porcentaje de germinación de semillas, en unos casos, como en las ornamentales, cuando la dosis de HTC en el sustrato fue elevada (50%), en otros, como en las forestales, cuando la proporción fue baja (10%). Respecto al crecimiento, el HTC tuvo un efecto depresivo en general en todas las especies a partir del 25%, siendo más acusado en la proporción del 50%. La dosis del 10%, por su parte, o no afectó al crecimiento o incluso lo estimuló en el caso de caléndula. Se han descrito efectos favorables del biochar de pirolisis, presente en el sustrato en pequeñas proporciones (del 1% al 5% en peso), en cultivos de tomate, pimiento y fresa, tanto en el desarrollo de las plantas (Graber et al., 2010) como en su resistencia sistémica a enfermedades (Elad et al., 2010; Harel et al., 2012) Este efecto fue achacado a causas de tipo químico y microbiano ya que a las proporciones utilizadas no se vieron afectadas ni las propiedades físicas ni las nutricionales del sustrato. En nuestro experimento, dada la falta de fitotoxicidad del HTC, su efecto reductor del crecimiento se debió probablemente a un proceso de inmovilización de nitrógeno, causa que ya ha sido apuntada por otros autores (Libra et al., 2011; Gajić y Koch, 2012) Como ya apuntaron los bioensayos de germinación, el Cisco fue mucho más nocivo que el HTC para todas las especies salvo para el tomate. En caléndula, petunia y mirto no hubo supervivencia de plantas en presencia de más del 10% de Cisco en el sustrato y a esta proporción el crecimiento se vio

443


Tabla 3. Efecto de los sustratos conteniendo los biocarbones de HTC y Cisco en mezclas al 0:100 (control), 10:90, 25:75 y 50:50 en volumen con fibra de coco, sobre la germinación (%) y el crecimiento de plántulas (vástago [mg de peso seco]; raíz [apreciación visual del desarrollo del cepellón en una escala de 1 mínimo a 4 máximo]) de diversas especies ornamentales, hortícolas y forestales. Caléndula Petunia Vástago Raíz Germinación Vástago Raíz 768c 2,4c 59 818bc 2,6cd 846bc 2,9b 65 1093abc 2,9bc 1179a 3,5a 70 1393a 3,6ab 0 0 427d 1,6d 27 606c 1,9d 969b 3,4ab 67 1195ab 3,8a *** *** ** *** Tomate Berro Germinación Vástago Raiz Germinación Vástago Raiz HTC 50% 90 161b 161b 96 184bc 2,2bc HTC 25% 85 171b 171b 98 176c 2,8a HTC 10% 92 742a 742a 97 234ab 3,0a Cisco 50% 91 287b 287b 13 74d 1,4d Cisco 25% 93 774a 774a 31 100d 1,6cd Cisco 10% 91 870a 870a 52 171c 2,7ab Fibra Coco 97 727a 727a 97 250a 3,2a P *** *** *** *** Lentisco Mirto Germinación Vástago Raiz Germinación Vástago Raiz HTC 50% 26 1290b 2,3bc 34 672c 1,6 HTC 25% 25 1615b 2,8ab 28 823bc 2,1 HTC 10% 21 2069a 3,2a 23 1158ab 2,4 Cisco 50% 21 514c 1,9c 20 Cisco 25% 27 1480b 2,8ab 27 Cisco 10% 27 1647b 3,2a 32 1187ab 2,5 Fibra Coco 31 2182a 3,2a 31 1335a 2,7 P *** *** * ns a ns, *, *** indican diferencia no significativa o significativa a P ≤ 0.05 y P ≤ 0.001, respectivamente. Letras diferentes en cada columna representan diferencias significativas a P ≤ 0.05 (test de Student-Newman-Keuls). Sustrato HTC 50% HTC 25% HTC 10% Cisco 50% Cisco 25% Cisco 10% Fibra Coco Pa

Germinación 64 73 80 0 0 24 84

marcadamente reducido salvo en el caso del mirto. En el caso del berro y el lentisco, el Cisco provocó una reducción progresivamente mayor del crecimiento con el incremento de su proporción en el sustrato hasta reducirse el peso del vástago en aproximadamente un 75% en el sustrato con un 50% de Cisco en comparación con el control de fibra de coco. El tomate, por su parte, al ser una especie relativamente tolerante a la salinidad, creció de manera adecuada en sustratos conteniendo hasta el 25% de Cisco, aunque la proporción del 50% sí que afectó marcadamente al crecimiento de la planta. Aunque por unas razones u otras el HTC y el Cisco no parecen ser componentes adecuados para la formulación de sustratos a proporciones moderadas o altas, en la bibliografía si se encuentran algunos trabajos que indican la posibilidad de utilizar otros biochares en proporciones de hasta el 50% en el cultivo de especies como Tachigali vulgaris L. (Souchie et al., 2011) que es una especie forestal amazónica y las ornamentales Anthurium andraeanum (Suo et al. 2011), Calathea rotundifola (Tian et al., 2012) y el crisantemo (Terra et al., 2011).

444


Conclusiones Ninguno de los dos MOC estudiados se podría utilizar en proporción elevada como componente de sustrato de cultivo debido a problemas de fitotoxicidad en el caso del Cisco y de presumible inmovilización de nitrógeno en el caso del HTC. Usados en baja proporción pueden llegar a favorecer el cultivo. Estas conclusiones no son generalizables a otros MOC.

Agradecimientos Este trabajo ha sido financiado por el Programa de Apoyo a la Investigación y Desarrollo 2012, Proyectos de nuevas Líneas de Investigación Multidisciplinares (PAID-05-12), del Vicerrectorado de Investigación de la Universitat Politècnica de València.

Bibliografía Atkinson, C.J., Fitzgerald, J.D., Hipps, N.A. (2010). Potential mechanisms for achieving agricultural benefits from biochar application to temperate soils: A review. Plant Soil 337, 1-18. Bunt, A.C. (1988). Mediaand Mixes for Container-Grown Plants. 2nd ed. Unwin Hyman Ltd, London. 309 p. Carmona, E. Abad, M. (2008). Aplicación del compost en viveros y semilleros. En: Compostaje. Moreno, J. Moral, R. (eds). Editorial Mundi Prensa, Madrid. P. 397-424. Elad, Y., David, D.R., Harel, Y.M., Borenshtein, M., Kalifa, H.B., Silver, A., Graber, E.R. (2010). Induction of systemic resistance in plants by biochar, a soil-applied carbon sequestering agent. Phytopathology 100, 913-921. Gajić, A., Koch, H.J. (2012). Sugar beet (Beta vulgaris L.) growth reduction caused by hydrochar is related to nitrogen supply. Journal of Environmental Quality 41, 1067-1075. Graber, E.R., Harel, Y.M., Kolton, M., Cytryn, E., Silver, A., David, D.R., Tsechansky, L., Borenshtein, M., Elad, Y. (2010). Biochar impact on development and productivity of pepper and tomato grown in fertigated soilless media. Plant Soil 337, 481-496. Harel, Y.M., Elad, Y., David, D.R., Borenshtein, M., Shulchani, R., Lew, B., Graber, E.R. (2012). Biochar mediates systemic response of strawberry to foliar fungal pathogens. Plant Soil 357, 245-257. Lehmann, J., Rilling, M.C., Thies, J., Masiello, C.A., Hockaday, W.C., Crowley, D. (2011). Biochar effects on soil biota – A review. Soil Biology and Biochemistry 43, 1812-1836. Libra, J.A., Ro, K.S., Kammann, C., Funke, A., Berge, N.D., Neubauer, Y., Titirici, M.M., Fühner, C., Bens, O., Kern, J., Emmerich, K.H. (2011). Hydrothermal carbonization of biomass residuals: a comparative review of the chemistry, processes and applications of wet and dry pyrolysis. Biofuels 2, 89-124. Sohi, S.P., Krull, E., López-Capel, E., Bol, R. (2010). A review of biochar and its use and function in soil. Advances in Agronomy 105, 47-82. Souchie, F.F., Marimon Jr, B.H., Petter, F.A., Madari, B.E., Marimon, B.S., Lenza, E., (2011). Charcoal as amendment to substrate of seedlings of Tachigali vulgaris L. G. Silva & H.C. Lima. Ciência Florestal 21, 811-821. Suo, L.N., Sun, X.Y., Li, S.Y. (2011). Use of organic agricultural wastes as Growing media for the production of Anthurium andraeanum ‘Pink Lady’. Journal of Horticultural Science and Biotechmology 86, 366–370. Terra, S.B., Ferreira, A.A.F., Peil, R.M.N., Stumpf, E.R.T., Beckmann-Cavalcante, M.Z., Cavalcante, I.H.L. (2011). Alternative substrates for growth and production of potted chrysanthemum (cv. Funny). Acta Scientiarum. Agronomy Maringá 33, 465-471. Tian, Y., Sun, X., Li, S., Wang, H., Wang, L., Cao, J., Zhang, L. (2012). Biochar made from green waste as peat substitute in growth media for Calathea rotundifola cv. Fasciata. Scientia Horticulturae 143, 15-18. UNE-EN: 13037 (2012), 13038 (2012), 13040 (2008), 13041 (2012),. Xu, G., Mv, Y.C., Sun, J.N., Shao, H.B., Wei, L.L. (2012). Recent advances on biochar application in agricultural soils: Benefits and environmental implications. Clean-Soil Air Water 40, 1093-1098. Zucconi, F., Pera, A., Forte, M., De Bertoldi, M. (1981). Evaluating toxicity of inmature compost. BioCycle 22, 27-29.

445


Water use, transpiration and crop coefficients for irrigated hedgerow olives grown in Southern Portugal F. L. Santos1, M. M. Correia1, P. C. Valverde1, R. R. Coelho1, M. Vaz1, T. A. Paço2 1

Instituto de Ciências Agrárias e Ambientais Mediterrânicas, Polo da Mitra da Universidade de Évora, Évora 7002-554, Portugal, fls@uevora.pt; 2 CEER – Biosystems Engineering, Instituto Superior de Agronomia, Universidade Técnica de Lisboa, Lisboa, Portugal . Abstract Olive trees are well adapted to the Mediterranean-type agro-ecosystems of southern Portugal and have traditionally been cultivated in areas with no irrigation. According to the 2009 agricultural census, the olive tree cultivation area was around 336,000 ha, of which 164,000 ha are in the southern province of Alentejo. In this southern region of semi arid Mediterranean climate where the erratic annual precipitation of around 300 to 550 mm is not enough to fulfil crop water requirements when needed, summer irrigation is a necessity to prevent crop water stress and ensure profitable yields. Hundreds of high and also very high tree-density hedgerow orchards of the Spanish cultivar Arbequina have recently been established in the region to take advantage of the European Commission decision 2000/406/CE (Official Journal L 154, 27/06/2000 P. 0033-0033) that allowed the expansion of Portuguese olive tree planting quota to 30,000 ha of new orchards. With enhanced olive production and yield depending on irrigation water supply and management, estimating hedgerow olive orchard water uptake in southern Portugal and appropriately scheduling irrigation have since been the primary concern of researchers, farmers and water resources managers. The objective of this study was to establish relationships between olive transpiration and crop transpiration coefficients of very high tree-density hedgerow orchard grown in Alentejo under well-irrigated treatment A (3.05 mm d-1) and sustained deficit irrigation treatment B (2.12 mm d-1) regimes, to understand and improve their irrigation management. On both treatments, daily transpiration at the stand scale (mm day-1) was obtained by sap flow and by dividing the tree transpiration by the area of the planting pattern. The results were compared to the daily outputs obtained with the Penman-Monteith “big leaf” equation coupled with the Orgaz et al. (2007) specific model of bulk daily canopy conductance (Gc) for unstressed olive canopies. With the Willmott index of agreement IA and the root-mean-square error RMSE above 0.8 and below 0.4 mm d-1, respectively (Willmott, 1982), the synthetic model proved sufficiently precise to be used as an appropriate simulation tool for predicting olive stand transpiration for the region. Crop and stress transpiration coefficients were proposed for both treatments. Keywords: Olea europaea, transpiration, crop transpiration coefficient, hedgerow olive orchard, Arbequina

Uso da água, transpiração e coeficientes culturais para olivais regados e em sebe no sul de Portugal Resumo As oliveiras são árvores bem adaptadas ao clima Mediterrânico do sul de Portugal e têm sido cultivadas em áreas de sequeiro. De acordo com o censo agrícola de 2009, a área nacional de ocupação da oliveira estima-se em 336,000 ha, dos quais 164,000 ha estão distribuídos na região sul do Alentejo. Nesta região de clima semi-árido e em que a distribuição errática da precipitação anual entre 300 e 500 mm não é suficiente para a satisfação das necessidades hídricas da cultura, a rega de verão é uma necessidade real para prevenir deficiências de água e assegurar produções comerciais aceitáveis. Centenas de hectares de oliveiras de densidades de plantio alta a muito alta, com as últimas normalmente projetadas em sebe e baseadas na cultivar espanhola Arbequina, foram recentemente estabelecidas na região, aproveitando a decisão 2000/406/CE da Comissão Europeia (Jornal oficial L 154 de 27/06/2000 P. 0033-0033) que permitiu a expansão do olival nacional com mais 30,000 novos hectares. Com produções e rendimentos dependentes da rega e da sua adequada gestão, a estimativa das necessidades

446


hídricas e consumos de água pelo olival super-intensivo em sebe no sul de Portugal, bem como a sua distribuição temporal, tornou-se desde então preocupação dominante de investigadores, empresários e gestores de recursos hídricos. O objectivo deste estudo foi establecer relações funcionais entre a transpiração e os coeficientes culturais para o olival superintensivo em sebe com regimes de rega plena (tratamento A, 3.05 mm d-1) e rega deficitária sustentada (tratamento B, 2.12 mm d-1), para melhor perceber e gerir a rega deste tipo de olival no Alentejo. Nos dois tratamentos, a transpiração do olival (mm d-1) foi obtida pelo método de fluxo de seiva e relacionando a transpiração da árvore com a área de plantio. Os resultados diários da transpiração foram comparados com os obtidos através da aplicação do modelo “big leaf” de Penman-Monteith, incluindo neste a condutância estomática diária obtida com o “specific model of bulk daily canopy conductance (Gc) for unstressed olive canopies” de Orgaz et al. (2007). Com os índices de concordância IA e erro quadrado médio RSME acima de 0.8 e abaixo de 0.4 mm d-1, respectivamente (Willmott, 1982), o modelo sintético provou ser suficientemente preciso para ser usado como instrumento de simulação na previsão da transpiração do olival em sebe na região Alentejo. No estudo são ainda propostos coeficientes culturais e de stress para os dois tratamentos. Palavras-chave: Olea europaea, transpiração, coeficiente cultural, olival em sebe, Arbequina

Introduction To improve yields and compete worldwide, newly and productive non-indigenous drip irrigated olive cultivars (Arbequina, Picual and Hojiblanca among others) have been introduced in southern Portugal, in the Alentejo region, particularly since year 2000, to take full advantage of the European Commission decision 2000/406/CE (Official Journal L 154, 27/06/2000 P. 0033- 0033) to expand the Portuguese olive tree planting quota to 30 000 ha of new orchards. In the process, hundreds of high (>300 trees/ha) and very high-density (>1700 trees/ha) drip irrigated orchards, mainly of the cultivar Arbequina, have been established. This abrupt change in olive planting technique and production in a region of severe low water availability prompted a regional debate over the need to increase the water use efficiency and the productivity of the irrigated orchards, with deficit irrigation management being advocated as a way out to better yields, oil quality and economic returns of the newly commercial orchards. The large demand for water rising from the increasing number of hectares devoted to olive orchards in southern Portugal make the optimal use of irrigation water critical for the long term sustainability of the commercial orchards. In this case, a precise estimation of transpiration under nonlimiting conditions is required to set the upper limit of irrigation requirements, and to assess the opportunities of reducing transpiration via deficit irrigation (DI; Santos et al., 2007). Furthermore, crop coefficients are needed to help better schedule irrigation and water delivery. The objectives of this study were to: (1) determine and compare the actual differences in transpiration and water use of a hedge row olive orchard in southern Portugal under well-irrigated and an imposed deficit irrigation programme, (2) calculate and compare actual transpiration coefficient values based on the evaluated transpiration rates patterns, (3) estimate the maximum unstressed transpiration values for the orchard by using the conductance model of Orgaz et al. (2007), (4) compare the calculated PM-Orgaz model daily transpiration values with those obtained from the unstressed and deficit irrigation measurements, and (5) relate mean daily values of transpiration to variables such as radiation and vapor water pressure deficit.

Material and Methods The research was conducted during 2012 in the region of Alentejo, Portugal, and in a commercial orchard at the Herdade da Azambuja, Monte do Trigo, near Évora (38º 24' 47.03'' N, 7º 43' 38.36'' W; alt. 75 m) in a Eutric Cambisoil (WRB, 1998). The average apparent bulk soil density was 1,67 Mg m-3, and average volumetric soil water content at field capacity (i.e. at 0,03 MPa) was 0,36 m3 m-3, whereas it was 0,12 m3 m-3 at wilting point (i.e. at 1,5 MPa). Using an orchard stand of 6 year-old olive trees (Olea europaea L. cv. Arbequina) planted on hedgerow in a 3,75 by 1,35 m spacing layout and drip irrigated, the trees were subject from mid-May to the end of October to one of two irrigation treatments: a treatment A with full-rate irrigation to the full soil water holding capacity and

447


continuously replenished, a SDI treatment B with irrigation to trees to provide for approximately 70% of the water applied to treatment A. Reference evapotranspiration, ETo was calculated using the FAOPenman–Monteith method and the procedures prescribed by Allen et al. (1998). Each tree of treatments A and B were supplied with water by a single drip line with emitters spaced 0,75 m apart throughout the entire length of the emitter line placed at the soil surface and laid out along each tree row, and serviced by 2,3 and 1,6 l h-1 emitters, respectively. The irrigation scheduling and time of water delivery to trees were the same to both treatments throughout the irrigation cycle. Half-hour averages of the meteorological parameters, wind speed, air temperature, solar radiation, precipitation and relative humidity were evaluated from data recorded in a nearby meteorological station. Half-hour averages of the net radiation above the canopy of the trees were measured using one NrLite net radiometer (Kipp & Konen, Holland) connected to a data logger (Delta-T, DL2e, Delta-T Devices, Cambridge, U.K). To evaluate sap flow rates and transpiration, three representative trees in each treatment were selected and their trunks implanted with one set of heat- pulse probes. Using the compensation heat-pulse technique (CHP) described in Santos et al. (2007), sap flow measurements were taken at 30min intervals and tree transpiration rates were estimated as average sap flow rates of the three probes. Photosynthetically active radiaton (PAR) where evaluated using a set of eight Quantum sensors (QPAR-02, 400 – 700 nm, Tranzflo, Palmerston, NZ) placed in a fixed grid around the trees and one at the top of the canopy. Measured daily transpiration values estimated from sap flow were compared to values obtained with the Penman-Monteith (PM) “big leaf” equation (1981) coupled with the Orgaz et al. (2007) specific model of bulk daily canopy conductance (Gc) for unstressed olive canopies (hereafter the PM-Orgaz model).

Results and Discussion Average daily temperature was 22, 7 ºC during summer (1 June-30 September) while daytime average temperature for the same period was 26,3ºC (Table 1). Estimations of average daily and daytime net radiation (NR), vapour pressure deficit (D), and wind speed (U) are also shown in Table 1. Estimations of ETo for reference conditions (grass) were 5,0 mm d-1, reflecting the prevailing weather conditions in Alentejo, of hot and dry summers with scarce or null rainfall. Total rainfall in the period was 29, 4 mm in 9 rainy days. Average daily and daytime values shown in Table 1 reflect the need of using daytime meteorological parameters in the Orgaz et al. (2007) model for calculating daily canopy conductance for water vapour (Gs) and daily olive tree transpiration (T). Table 1. Weather conditions during summer (1 June-30 September) for the experiment location. Values indicated in asterisk (*) are averages for the daytime period. Average NR Average Total Rainy days Average T Average D Average U ETo rainfall (W m-2) (mm d-1 ) (mm) (no.) (ºC) (kPa) (m s-1) 29,4 9 22,7 1,6 1,4 140 5 26,3* 2,3* 1,6* 344*

Transpiration rates estimated from sap flow were highly variable throughout the irrigation cycle (Figure 1), increasing in treatment A from spring to summer and then decreasing again in autumn. Average maximum and minimum daily treatment A canopy transpiration were 4,22 and 0,77 mm d-1, respectively while corresponding values for treatment B were 2,34 and 0,67 mm d-1 (Figure 1). Total transpiration values for each treatment were 320 and 185 mm, respectively. For the unstressed treatment A, average maximum and minimum daily olive transpiration estimated with the PM-Orgaz model were 4,59 and 0, 145 mm d-1, respectively, while the total transpiration was estimated as 294 mm, values that reflect the good match of the model to the seasonal pattern of treatment A transpiration rates (Figure 2). The high Willmott index of agreement IA of 0, 8 and the low root-meansquare error RMSE, of 0.4 mm d-1 (Willmott, 1982) confirm the goodness-of-fit and warrant treatment A as well-irrigated. Irrigation applied water for the period and for treatment A and B were 296 and

448


206 mm, respectively, a ratio of 0,7 as initially proposed. Decline of treatment B transpiration rates throughout the summer reflect such ratio.

Figure 1. Time series of CHP-base olive transpiration (mm d-1) for treatments A (solid circle) and B (open circle). The line is the transpiration rates calculated with the PM-Orgaz model.

Figure 2a establishes the relationships between CHP-based transpiration rates for treatments A and B and daily net radiation (NR), while Figure 2b establishes similar relationships with average vapour pressure deficit (D). The high goodness-of-fit (R2=0,56 and 0,76, respectively) observed for treatment A suggests, as pointed out in Orgaz at al. (2007), that the PM-Orgaz model that critically bases its simulation of olive transpiration on those variables should be used solely for unstressed canopies. a)

b)

Figure 2. CHP-based olive transpiration (mm d-1) relationship with a) daily net radiation (NR, MJ m2 d-1) and b) average daily vapour pressure deficit (D, kPa) for treatments A (solid circle) and B (open circle)

The average treatment A transpiration coefficient Kcb (the ratio of crop maximum transpiration over reference evapotranspiration, Tmax/ETo) during summer (1 June to 30 September) was around 0,398, with a maximum of 0,975 and a minimum of 0,082, showing high variability during the period (Figure 3a). The U shape of the crop coefficient Kcb is a characteristic of olive trees and should be taken into account in the irrigation scheduling of olive orchards (Testi et al., 2005). The variability of Kcb was also high during spring, closely following the variability of transpiration in the same period. A marked increase in its values was registered at the end of summer and onwards. When plants are under water stress the standard transpiration (Tmax) is reduced and the crop coefficient Kcb is adjusted to those conditions using a water stress coefficient Ks (Allen et al., 1998). The adjusted transpiration rate (Ta) is the product of Kcb, Ks, and ETo. The crop stress coefficient Ks (the ratio of stressed to unstressed crop

449


transpiration, Ta/Tm) is therefore often used to manage deficit irrigation by adjusting the upper limit of irrigation requirements (i.e. treatment A) to the soil water limiting conditions. Figure 3b plots the temporal evolution of Ks, recording an average Ks of 0,691 for the summer, and maximum and minimum of 0,92 and 0,462, respectively, to confirm the steadily decline in transpiration rates of treatment B from June to September, when its transpiration dropped to 59% of treatment A. a)

b)

Figure 3. Time series of (a) coefficient of transpiration K cb (the ratio of crop transpiration over reference evapotranspiration, or T/ETo) for the unstressed treatment A, and (b) the coefficient of stress Ks (the ratio of stressed to unstressed crop transpiration) for treatment B.

Conclusions The irrigation regimes of treatment A and B were differently affected olive transpiration rates and crop coefficients. The low average Kcb coefficients obtained during summer suggest that hedgerow olive trees slow down their physiological processes in the period to improve their water use efficiency. Trees from deficit irrigation treatment B also showed a sharp decline in transpiration rates during summer reflected in their low Ks stress coefficients. The PM-Orgaz synthetic model accounted for the seasonal variability of treatment, proving sufficiently precise to be used as an appropriate simulation tool for predicting the upper limit of hedgerow olive stand transpiration rates for the region.

Acknowledgements Financial support from the Fundação para a Ciência e a Tecnologia (FCT) and Instituto de Ciências Agrárias e Ambientais Mediterrânicas (ICAAM) for the projects PTDC/AGR-PRO/111717/2009 (H2Olive3S) and PEst-C/AGR/UI0115/2011, respectively, are gratefully acknowledged. Acknoweldgments are extended to the Estates Olivais do Sul for acess and research support in their commercial orchard at the Herdade da Azambuja.

References Allen, R.G., Pereira, L.S., Raes D., and Smith, M. (1998). Crop Evapotranspiration: Guide- lines for Computing Crop Water Requirements. FAO, Rome, Irrigation and Drainage Paper, 56. Monteith, J.L., (1981). Evaporation and surface temperature. Quartely Journal of the Royal Meteorological Society, 107 (451), 1-27. Orgaz, F., Villalobos, F.J., Testi, L., and Fereres, E. (2007). A model of daily mean canopy conductance for calculating transpiration of olive canopies. Functional Plant Biology, 34, 178-188. Santos, F.L., Valverde, P.C., Ramos, A.F., Reis, J.L., and Castanheira, N.L. (2007). Water use and response of a dry-farmed olive orchard recently converted to irrigation. Biosyst. Eng. 98 (1), 102–114. WRB, (1998). World Reference Base for Soil Resources. World Soil Resources Report 84. FAO, Rome.

450


Willmott, C.J. (1982). Some comments on the evaluation of model performance. Bulletin of American Meteorological Society, 63 (11), 1309-1313. Testi, L., Villalobos, F.J., Orgaz, F., and Fereres, E. (2005). Water requirements of olive orchards 窶的: simulation of daily evapotranspiration for scenario analysis. Irrigation Science 24: 69-76.

451


Evaluación de la exposición a ruido de los operarios que manejan maquinaria en la construcción de invernaderos Tipo Almería J. Pérez-Alonso1, A. Callejón-Ferre1, J. Martín-Gil1 y J. Sánchez-Hermosilla1 1

Departamento de Ingeniería, Universidad de Almería. Carretera de Sacramento s/n, La Cañada de San Urbano, 04120 Almería, e-mail: jpalonso@ual.es

Resumen El objetivo del presente trabajo fue determinar el nivel de exposición a ruido al que se ven sometidos los operarios que trabajan en las inmediaciones de maquinaria generadora de ruido que intervienen en la construcción de invernaderos Tipo Almería. El estudio se realizó durante la construcción de un invernadero Tipo Almería del subtipo “raspa y amagado” en la Finca Experimental UAL-ANECOOP de la Universidad de Almería (36°52’ N, 2°17’ W, 98 m MSL), en el primer trimestre de 2009. Para ello, mediante una evaluación de riesgos previa, primero se fijaron los puestos de trabajo susceptibles de exposición a un nivel de ruido no permitido, de acuerdo al Real Decreto 286/2006, de 10 de marzo, sobre la protección de la salud y la seguridad de los trabajadores contra los riesgos relacionados con la exposición al ruido, y posteriormente, se realizaron las mediciones mediante un sonómetro integrador promediador (Tipo 1) marca Cirrus modelo CR-831. La evaluación se realizó de acuerdo al mencionado Real Decreto 286/2006, determinando el Nivel diario continuo equivalente ponderado en A (LAeq.D) y el Nivel de pico máximo (Lmax). En función de los límites prescritos por el Real Decreto 286/2006, de 10 de marzo, se han clasificado los puestos de trabajo asociados a cada máquina y se han propuesto medidas a adoptar para controlar el riesgo, resaltando que los puestos de trabajo de los conductores de los camiones y tractor se encuentran por debajo de los niveles de acción. Sin embargo, la máquina perforadora es la que provoca mayor problemática en la exposición al ruido de los trabajadores. El operador de dicha perforadora porta protección auditiva siempre en su puesto de trabajo, sin embargo, se ha observado a veces, que otros operarios pueden realizar sus tareas en las proximidades de la perforadora sin portar protección auditiva, por lo que se han realizado 23 mediciones para distintas distancias a la perforadora, con el objetivo de obtener a que distancia de la misma el Nivel diario continuo equivalente ponderado en A (LAeq.D) es inferior al nivel de acción de 85 dB. Una vez obtenidas las mediciones se ha elaborado una curva de regresión logarítmica de LAeq.D frente a la distancia a la perforadora a la que se obtuvo el nivel de ruido, que permite concluir para el terreno donde se ha construido el invernadero, que los trabajadores que no porten protección auditiva no deben trabajar a menos de 40 m de la misma. Palabras clave: Invernaderos, ruido, evaluación, riesgos, prevención

Evaluation of noise exposure of operators that handle construction machinery Almería type greenhouses Abstract The aim of this study was to determine the level of noise exposure to which they are subjected operators working in the vicinity of noise generating machinery involved in the construction of greenhouses. The study was conducted during the construction of Almería type greenhouse, subtype "raspa y amagado", at the Experimental Estate of the University of Almería (Spain) (36°52’ N, 2°17’ W, 98 m MSL), in the first quarter of 2009. To do this, using a risk assessment prior, first set the jobs likely exposure to a noise level not allowed, according to the Royal Decree 286/2006, of 10 March, on the protection of workers against risks from exposure to noise at work, and then measurements were made using a sound level meter (Type 1) brand Cirrus CR-831. The evaluation was conducted in accordance of Royal Decree 286/2006, determining the daily level A-weighted equivalent continuous (LAeq.D) and the peak level (Lmax). Depending on the limits prescribed by the Royal Decree 286/2006, of 10 March, were classified associated jobs with each machine and it´s proposed measures to be taken to control the risk, noting that the jobs of the truck drivers and tractor are below action levels. However, the drilling machine is causing the most problems in noise

452


exposure of workers. The drill operator has always hearing protection in the workplace, however, is sometimes observed that other workers can perform their duties in the vicinity of the drill without wearing hearing protection, so there have been 23 measurements for different distances to the punch, in order to get away from the same daily level a-weighted equivalent continuous (LAeq.D) is below the action level of 85 dB. After obtaining the measurements has developed a logarithmic regression curve LAeq.D versus distance to the punch which was obtained noise level, which allows to conclude to the land where the greenhouse was built, workers not wearing hearing protection should not work within 40 m of the same. Keywords: Greenhouses, noise, evaluation, risks, prevention

Introducción El 40 % de la actividad económica de la provincia de Almería es la agricultura basada en el cultivo de productos hortofrutícolas bajo invernadero. Los invernaderos son construcciones agrarias que facilitan las condiciones microclimáticas que necesitan los cultivos. El 96,5 % de la infraestructura de invernaderos de Almería se corresponden con la tipología estructural conocida como invernadero Tipo Almería (Fernández y Pérez, 2004) con tres variantes principales: “parral plano” (38,2 %), “raspa y amagado” (55,0 %) y “asimétrico” (3,3 %), que son adaptaciones estructurales, que se han desarrollado a lo largo de los últimos 40 años, de los antiguos parrales de uva de mesa que durante mucho tiempo fue el motor de la economía almeriense. Sin embargo, estos sistemas estructurales de bajo coste presentan ciertos problemas ambientales y sobre todo de siniestralidad laboral. En este sentido, hay que destacar que durante la fase de construcción de este tipo de invernaderos los trabajadores se encuentran expuestos a diferentes riesgos laborales, y sin embargo a lo largo del periodo de consolidación de este tipo de estructuras se han realizado numerosas mejoras, pero ninguna se ha orientado a reducir la siniestralidad laboral de su proceso constructivo. En este sentido, las investigaciones en seguridad en este campo son más bien escasas, en Europa, destacan los estudios efectuados por Lundqvist (Lundqvist, 1982; Lundqvist y Gustafsson, 1992) en Suecia, de forma que lograron relacionar las causas habituales de accidentalidad con las lesiones asociadas, catalogando las operaciones de mantenimiento y reparación de las estructuras de invernadero como una de las de mayor riesgo. En España, se analizaron las condiciones laborales de los trabajadores agrícolas dentro de los invernaderos del Sudeste de España en general, sin considerar las de los operarios dedicados a la construcción de los mismos (Callejón-Ferre et al., 2009, 2011b), y mediante varios índices directos de estrés térmico, se determinó el estrés térmico sufrido por los operarios que trabajan en el interior de los invernaderos realizando las labores propias del manejo de cultivo (Callejón-Ferre et al., 2011a). Pérez-Alonso et al. (2008), realizaron la evaluación de riesgos laborales de las diferentes fases de construcción de los invernaderos del sudeste de España, poniendo de relieve la existencia de riesgos higiénicos tales como estrés térmico y riesgo de exposición a ruido. Posteriormente, Pérez-Alonso et al. (2011a) han caracterizado la actividad preventiva de la industria de construcción de invernaderos del sudeste de España, concluyéndose que la gestión de riesgos laborales es muy pobre, no adoptando ningún modelo de gestión de prevención de riesgos laborales reconocidos internacionalmente. Con posterioridad Pérez-Alonso et al. (2011b) determinaron el estrés térmico al que se encuentran sometidos los trabajadores de construcción de invernaderos del sureste de España, y propusieron índices directos para determinar el estrés térmico de estos trabajadores (Pérez-Alonso et al., 2011c). Asimismo, se han analizado los accidentes laborales ocurridos en la industria de construcción de invernaderos del sudeste de España para el periodo 1999-2007, habiéndose cifrado una siniestralidad laboral en las empresas de construcción de invernaderos del orden a las del sector de la construcción en Almería y en España (Pérez-Alonso et al., 2012).

453


Por otra parte, el ruido es un factor importante de los ambientes de trabajo, no solo por las molestias que ocasiona, sino por los riesgos de sordera, las perturbaciones en las comunicaciones verbales y otros efectos fisiológicos y psicológicos (Fundación MAPFRE, 2003). En la construcción de los invernaderos se utiliza maquinaria que son fuentes de ruido, tales como camiones, hormigoneras, perforadoras, tractores, etc. (Pérez-Alonso et al., 2008). Por todo ello, y ante la falta de conocimiento científico al respecto, el objetivo del presente trabajo fue determinar el nivel de exposición a ruido al que se ven sometidos los operarios que trabajan en las inmediaciones de maquinaria generadora de ruido que intervienen en la construcción de invernaderos Tipo Almería.

Material y Métodos El estudio se realizó durante la construcción de un invernadero Tipo Almería del subtipo “raspa y amagado” de 1024 m2 de superficie en la Finca Experimental UAL-ANECOOP de la Universidad de Almería (36°52’ N, 2°17’ W, 98 m MSL), en el primer trimestre de 2009 (Figura 1). Para ello, mediante una evaluación de riesgos previa, primero se fijaron los puestos de trabajo susceptibles de exposición a un nivel de ruido no permitido, de acuerdo al Real Decreto 286/2006, de 10 de marzo, sobre la protección de la salud y la seguridad de los trabajadores contra los riesgos relacionados con la exposición al ruido, y posteriormente, se realizaron las mediciones mediante un sonómetro integrador promediador (Tipo 1) marca Cirrus modelo CR-831. La evaluación se realizó de acuerdo al mencionado Real Decreto 286/2006, determinando el Nivel diario continuo equivalente ponderado en A (LAeq.D) y el Nivel de pico máximo (Lmax). Asimismo, en función de los límites prescritos por el citado Real Decreto 286/2006, de 10 de marzo, se clasificaron los puestos de trabajo asociados a cada máquina y se propusieron medidas a adoptar para controlar el riesgo.

Figura 1. Operario manipulando máquina perforadora en la fase de apertura de hoyos

Resultados y Discusión En la Tabla 1 se exponen los resultados de las mediciones realizadas para cada uno de los puestos de trabajo asociados a las máquinas que en principio se sospechaba que su emisión de ruido podría sobrepasar los niveles permitidos por el Real Decreto 286/2006, de 10 de marzo, sobre protección de los trabajadores frente a los riesgos derivados de la exposición al ruido durante el trabajo. De acuerdo al mencionado Real Decreto 286/2006 los valores límites y de acción para los parámetros evaluados son los siguientes:

454


Valores límites: LAeq.D  87 dB y/o Lmax  140 dB. Niveles de acción: LAeq.D  85 dB y/o Lmax  137 dB y LAeq.D  80 dB y/o Lmax  135 dB. Tabla 1. Cuadro resumen de las mediciones de ruido realizadas en la evaluación Maquinaria Camiones Tractor Perforadora Hormigonera manual

LAeq.D (dB) 76,4 71,3 105,7 82,0

Lmax (dB) 98,4 96,5 119,8 105,0

En función de los límites anteriores en la Tabla 2 se expone la clasificación de los puestos de trabajo asociados a cada máquina y el resumen de medidas a adoptar según Real Decreto 286/2006, resaltando que los de los camiones y tractor se encuentran por debajo de los niveles de acción. Tabla 2. Clasificación de los puestos de trabajo asociados a cada máquina y resumen de medidas a adoptar Real Decreto 286/2006 Evaluación higiénica Formación e información a los trabajadores y/o sus representantes Control médico periódico Protectores auditivos individuales Señalización de las zonas de exposición Programa técnico/organizativo para reducir la exposición al ruido. Reducción inmediata de la exposición al ruido y actuación para evitar nuevas sobreexposiciones. Clasificación de los puestos de trabajo por niveles de exposición

LAeq.D  80 dB y/o Lmax  135 dB. Trienal

Niveles de acción LAeq.D  85 dB y/o Lmax  137 dB Anual

LAeq.D  87 dB y/o Lmax  140 dB Anual

Sí (mínimo cada 3 años)

Sí (anual)

Sí (si existe riesgo para la salud; mínimo cada 3 años) Poner a disposición de todo el personal expuesto -

Uso obligatorio de todo el personal expuesto Sí (Restringir el acceso si es viable)

Uso obligatorio de todo el personal expuesto Sí (Restringir el acceso si es viable)

-

-

-

Sí (informar a los delegados de la prevención)

Operarios hormigonera manual

-

Operario perforadora

De los resultados obtenidos, se observa que los camiones no producen un nivel de ruido problemático que conlleve ningún tipo de acción. Sin embargo, la máquina perforadora es la que provoca mayor problemática en la exposición al ruido de los trabajadores. El operador de dicha perforadora porta protección auditiva normalmente en su puesto de trabajo, sin embargo, se ha observado, que a veces otros operarios pueden realizar sus tareas en las proximidades de la perforadora sin portar protección auditiva, por lo que se han realizado 23 mediciones para distintas distancias a la perforadora, con el objetivo de obtener a que distancia de la misma el Nivel diario continuo equivalente ponderado en A (LAeq.D) es inferior al nivel de acción de 85 dB. Una vez obtenidas las mediciones se ha elaborado

455


una curva de regresión logarítmica (Figura 2) de LAeq.D frente a la distancia a la perforadora a la que se obtuvo el nivel de ruido, que permite concluir para el terreno donde se ha construido el invernadero, que los trabajadores que no porten protección auditiva no deben trabajar a menos de 40 m de la misma. Aunque interesa matizar que una misma fuente de ruido, como puede ser una máquina determinada, puede provocar diferentes niveles de ruido, dependiendo de su ubicación, orientación y características del local donde se instale (Fundación MAPFRE, 2003).

120

LAeq.D (dB)

100 80 y = -6,6741Ln(x) + 109,6 R2 = 0,9867

60 40 20 0 0

10

20

30

40

50

60

70

80

90

100

Distancia al foco emisor (m)

Figura 2. Regresión logarítmica de LAeq.D (dB) frente a la distancia (m) al foco emisor (perforadora)

Conclusiones Se ha realizado una evaluación de riesgos de los puestos de trabajo donde se maneja maquinaria en la construcción de invernaderos Tipo Almería, susceptibles de exposición a un nivel de ruido no permitido, destacando que solamente se necesita adoptar medidas de acción en la hormigonera manual y la perforadora, siendo esta la más problemática. Por ello, se ha elaborado una curva de regresión logarítmica de LAeq.D frente a la distancia a la perforadora, que permite concluir que los trabajadores que no porten protección auditiva no deben trabajar a menos de 40 m de la misma.

Agradecimientos Los autores desean expresar su agradecimiento al Ministerio de Ciencia e Innovación del Gobierno de España, así como a los Fondos Europeos de Desarrollo Regional (FEDER), por financiar el presente trabajo mediante proyecto de investigación AGL2006-11186. Asimismo, también expresan su agradecimiento a la Fundación Finca Experimental UAL-ANECOOP por permitir la construcción del invernadero experimental en la Finca Experimental de la Universidad de Almería (UAL).

Bibliografía Callejón-Ferre, A.J., Pérez-Alonso, J., Sánchez-Hermosilla J., Carreño-Ortega, A. (2009). Ergonomics and psycho-sociological quality indices in greenhouses, Almería (Spain). Journal of Agricultural Research 7, 50-58.

456


Callejón-Ferre, A.J., Manzano-Agugliaro, F., Díaz-Pérez, M., Carreño-Sánchez, J., (2011a). Improving the climate safety of workers in Almería-type greenhouses in Spain by predicting the periods when they are most likely to suffer thermal stress. Applied Ergonomics 42(2), 391-396. Callejón-Ferre, A. J., Pérez-Alonso, J., Carreño-Ortega, A., Velázquez-Martí, B. (2011b). Indices of ergonomicpsychosociological workplace quality in the greenhouses of Almería (Spain): crops of cucumbers, peppers, aubergines and melons. Safety Science 49, 746-750. Fernández, C., Pérez, J.J. (2004). Caracterización de los invernaderos de la provincia de Almería, Cajamar, Almería, 20 pp. Fundación MAPFRE. (2003). Manual de higiene industrial, MAPFRE, Madrid, 903 pp. Lundqvist, P. (1982). Olycksrisker i växthusodlingen. Sveriges lantbruksuniversitet. Institutionen för lantbrukets byggnadsteknik. Rapport 22. Lund. Suecia. Lundqvist, P., Gustafsson, B. (1992). Accidents and accident prevention in agriculture. A review of selected studies. International Journal of Industrial Ergonomics 10(4), 311-319. Pérez-Alonso, J., Carreño-Ortega, A., Salinas-Andújar, J.A., Martín-Gil, J., Pérez-Parra, J.J., Rubio-Gámez, M.C., Sánchez-Hermosilla, J., Callejón-Ferre, A.J., López-Díaz, G. (2008). Análisis de riesgos laborales de los procedimientos constructivos de los invernaderos Tipo Almería. 6th International Conference on Occupational Risk Prevention. 14-16 mayo, La Coruña. España. Pérez-Alonso, J., Carreño-Ortega, A., Callejón-Ferre, A.J., Vázquez-Cabrera, F.J. (2011a). Preventive activity in the greenhouse-construction industry of south-eastern Spain. Safety Science, 49(2), 345-354. Pérez-Alonso, J., Callejón-Ferre, A.J., Carreño-Ortega, A., Sánchez-Hermosilla, J. (2011b). Approach to the evaluation of the thermal work environment in the greenhouse-construction industry of SE Spain. Building and Environment 46, 1725-1734. Pérez-Alonso, J., Callejón-Ferre, A.J., Carreño-Ortega, A., Vázquez-Cabrera F.J. (2011c). Propuesta de índices directos para determinar el estrés térmico de los trabajadores de construcción de invernaderos de Almería (España). VI Congreso Ibérico de AgroIngeniería. 5-7 septiembre, Évora, Portugal. Pérez-Alonso, J., Carreño-Ortega, A., Vázquez-Cabrera, F.J., Callejón-Ferre, A.J. (2012). Accidents in the Greenhouse-Construction Industry of SE Spain. Applied Ergonomics 43, 69-80.

457


La acción fisiológica del ácido naftalenacético como aclarante de frutos del níspero japonés (Eriobotrya japonica Lindl.) C. Reig, C. Mesejo, A. Martínez-Fuentes y M. Agustí Instituto Agroforestal Mediterráneo, Universitat Politècnica de València, Camino de Vera, s/n, 46022 Valencia mareiva@prv.upv.es

Resumen En el níspero japonés la aplicación de la sal potásica del ácido naftalenacético reduce el número de frutos que cuajan, y este efecto permite su utilización como agente aclarante reduciendo los costes de cultivo en un 25-30%. Bajo el punto de vista agronómico, el momento de mayor eficacia de este regulador del desarrollo ha sido bien determinado, pero su mecanismo de acción no había sido todavía estudiado en el níspero japonés. Dependiendo del momento en que se aplicó, el ácido naftalenacético inhibió la germinación del grano de polen o detuvo el desarrollo del tubo polínico, evitando la fecundación, o provocó el aborto del embrión y la abscisión del fruto recién cuajado. Palabras clave: Aclareo de frutos, Polen, Desarrollo del embrión, Cuajado, Abscisión

Physiological effects of naphthalene acetic acid as a fruit thinner in loquat (Eriobotrya japonica Lindl.) Abstract In loquat, potassium salt of naphthalene acetic acid is currently used as a fruit thinner, which reduces 25%-30% of total costs. Under horticultural point of view, the date of treatment is well established, but its mechanism of action remains unknown. Naphthaleneacetic acid inhibits pollen germination or halts pollen tube growth, avoiding fruit set, or causes embryo abortion and fruitlet abscission, depending on the date of treatment. Keywords: Fruit thinning, Pollen grain, Embryo development, Fruit set, Abscission

Introducción En Fruticultura el ácido naftalenacético (ANA) se utiliza con fines diversos, entre ellos como aclarante de frutos en manzano y peral (Wertheim, 2000), cítricos (El-Otmani et al., 2000), melocotonero (Childers, 1959) y níspero japonés (Eti et al., 1990). En éste último, su eficacia depende de la formulación utilizada, la concentración aplicada y, sobre todo, de la fecha de aplicación (Agustí et al., 2000). Su aplicación cuando son visibles 2-3 frutos por panícula presenta resultados óptimos, ya que, finalmente, se recolectan 4-5 frutos por panícula evitando el cuajado del resto de flores.

458


Su acción sobre manzano, cítricos y melocotonero se ha relacionado con el aborto del embrión, pero en el níspero japonés nunca se ha demostrado. Este efecto, sin embargo, podría ser indirecto ya que su aplicación en antesis evitando el cuajado podría ser consecuencia de su acción sobre el grano de polen. La acción del ANA impidiendo la germinación del grano de polen y/o interrumpiendo el crecimiento del tubo polínico también se ha estudiado en el manzano, peral, melocotonero, olivo y cítricos pero en condiciones in vitro, nunca in vivo. Y en ningún caso ha sido estudiado en el níspero japonés. En este trabajo se presentan los resultados preliminares sobre la acción del ANA in vivo impidiendo el cuajado de la flor del níspero japonés.

Material y Métodos La sal potásica del ácido α-naftalenacético (ANA; 8,5% m.a.) se aplicó a una concentración de 20 mg L-1 en los estados fenológicos 505, 508, 605, 609, 700, 701, 703 y 704 de la escala BBCH (MartínezCalvo et al., 1999). A la solución acuosa se le añadió un agente tensoactivo (éter de nonilfenilpolietilenglicol; 20% v/v), a una concentración del 0,01%. Se utilizaron para el estudio árboles adultos, similares en tamaño y vigor, de los que se marcaron 10 panículas por árbol para seguir la evolución de sus flores. Se diseñó un experimento de bloques al azar con 5 repeticiones de un árbol cada una. El desarrollo del tubo polínico en el estigma y estilo de la flor se evaluó a partir de preparaciones (squash) de pistilos reblandecidos con una solución de sulfito sódico en un microondas durante 1,5 min, tiñéndolos con 0,1% de azul de anilina en 0,1N K3PO4, y observándolos en un microscopio de fluorescencia (Olympus BX50, Tokyo, Japón) equipado con un filtro U-MWU. La receptividad del estigma se evaluó como la capacidad de éste para facilitar la germinación del grano de polen y el inicio del tubo polínico y sólo aquellos estigmas que tenían, al menos, 25 granos de polen germinando se consideraron receptivos. El crecimiento del tubo polínico en el estilo se determinó como el porcentaje de estilo recorrido por el tubo polínico más largo. La degeneración de los óvulos se determinó mediante squash (ver más arriba) y se evaluó como porcentaje de óvulos con callosa en el extremo de su chalaza. A los resultados se les aplicó el análisis de la varianza, utilizando el test de Student-Newman-Keuls para la separación de las medias.

Resultados La aplicación de 20 mg L-1 de ANA en el momento de la antesis (estado fenológico 605 de la escala BBCH) inhibió completamente la germinación de los granos de polen. Dos días después del tratamiento ningún grano de polen había germinado sobre la superficie de los estigmas, mientras que en las flores de los árboles control 1,5 estigmas por flor tenían, al menos, un grano de polen germinando. Dos días más tarde el número de estigmas por flor con granos de polen germinando era de 1,7 ± 0,5 y 3,7 ± 0,5 por flor tratada y sin tratar, respectivamente, indicando que el tratamiento no había dañado a los estigmas y que nuevos granos de polen, evidentemente no tratados, habían llegado a éstos. Siete días después del tratamiento los 5 estigmas de las flores, tanto tratadas como sin tratar, tenían 25 granos de polen, al menos, germinando (Fig. 1).

459


Figura 1. Efecto del ANA (20 mg L-1) aplicado en antesis sobre la receptividad de los estigmas de las flores de níspero japonés. Valores expresados como número de estigmas con, al menos, 25 granos de polen germinando La aplicación de ANA, 20 mg L-1, también interrumpió el crecimiento del tubo polínico. Siete días después del tratamiento realizado en antesis, los tubos polínicos que habían iniciado su recorrido solo consiguieron alcanzar el 40% de la longitud total del estilo, mientras que en las flores sin tratar habían alcanzado el ovario. El estudio de la acción del ANA sobre los óvulos revela una estricta dependencia del estado fenológico de las flores en el momento del tratamiento. Así, los óvulos de flores tratadas en diferentes estados fenológicos presentaban síntomas de degeneración 10 días después del tratamiento, siendo los estados fenológicos 605 a 700 los más sensibles. En los estados 605, 609 y 700 (escala BBCH), 9,3 ± 02, 9,6 ± 0,3 y 9,2 ± 0,5 óvulos, respectivamente, de los 10 que contiene el ovario presentaban callosa, mientras que en estados fenológicos anteriores, 505 y 506, y posteriores, 701 y 704, el número de los que mostraban callosa oscilaba entre 7,9 ± 0,4 y 8,1 ± 0,3 (Fig. 2). Las flores de los árboles control tenían 8,1 ± 0,4 óvulos degenerados por flor.

Figura 2. Influencia del estado fenológico (escala BBCH) en el momento del tratamiento con ANA (20 mg L-1) sobre el porcentaje de óvulos con callosa en el níspero japonés. Valores correspondientes a los 10 días del tratamiento. Letras distintas indican diferencias significativas (P ≤ 0.05)

460


De acuerdo con ello, los tratamientos redujeron el peso medio de los óvulos de las flores tratadas en los estados 609 y 700 de la escala BBCH. Diez días después del tratamiento los óvulos de las flores tratadas pesaban 69,3 µg y 2,8 mg, respectivamente, mientras que los de las flores control pesaban 72,0 µg (P ≤ 0,05) y 3,3 mg (P ≤ 0,05), respectivamente (Tabla 1). Las flores tratadas en los estados 505 y 508 BBCH, sin embargo, promovieron el desarrollo del óvulo. Así, 10 días después del tratamiento los óvulos de estas flores tratadas pesaban 131,3 µg y 153,2 µg, respectivamente, mientras que los de los controles pesaban 55,0 µg (P ≤ 0,05) y 51,1 µg (P ≤ 0,05), respectivamente (Tabla 1). El tratamiento realizado en el estado fenológico 701 BBCH también incrementó significativamente el peso medio del óvulo con respecto a los controles, 15,6 mg y 3,5 mg, respectivamente. El efecto del ANA sobre los óvulos de las flores en estados más avanzados del desarrollo, 703 y 704 de la escala BBCH, resultó insignificante (Tabla 1). Tabla 1. Influencia del estado fenológico (escala BBCH) de la panícula del níspero japones cv. Algerie en el momento del tratamiento con ANA (20 mg l-1) sobre el desarrollo del óvulo/semilla en condiciones in vivo

Fecha 04 Diciembre 10 Diciembre 02 Enero 14 Enero 27 Enero 11 Febrero 25 Febrero 11 Marzo

Tratamiento Estado BBCH 505 508 605 609 700 701 703 704

Peso del óvulo/semilla Al tratamiento Control 54,4 ± 1,5 55,0 ± 1,2 54,5 ± 1,5 51,1 ± 1,1 55,4 ± 1,4 56,0 ± 0,9 66,7 ± 2,6 72,0 ± 1,7 2,8 ± 0,7 3,3 ± 0,1 3,3 ± 0,1 3,5 ± 0,1 60,5 ± 0,9 69,3 ± 1,6 81,8 ± 1,3 86,1 ± 2,0

Tratado 131,2 ± 9,7 153,2 ± 10,4 ---y 69,3 ± 1,6 2,8 ± 0,1 15,6 ± 0,5 69,5 ± 1,7 85,4 ± 2,0

Valores correspondientes a los 10 días del tratamiento z Valores expresados en µg para los estados 505 a 509 y en mg para los 700 a 704 y No hubo flores cuajadas

Discusión La aplicación de 20 mg L-1 de ANA en antesis redujo la germinación del grano de polen y el crecimiento del tubo polínico en condiciones in vivo, previniendo al óvulo de ser fecundado. Estos efectos han sido demostrados para diversas especies en condiciones in vitro, pero no in vivo. Nuestros resultados muestran evidencias de que in vivo esta sustancia reduce el número de estigmas con granos de polen germinando, interrumpe el crecimiento del tubo polínico y provoca la degeneración de los óvulos. El hecho de que a los 7 días del tratamiento los granos de polen procedentes de flores sin tratar que llegaron a los estigmas de las flores tratadas consiguieran germinar, indica que el efecto del ANA impidiendo la germinación del grano de polen es un efecto directo y no indirecto a través de una acción sobre el estigma, ya que éste ni se secó ni vio dañanda su funcionalidad. El efecto del ANA interrumpiendo el crecimiento del tubo polínico se desconoce, pero se ha sugerido que podría actuar alterando la corriente de vesículas y organelos celulares (Geitman et al., 1996), la concentración de cationes (Tefter y Taylor, 1981) y el metabolismo celular (Lin y Yang, 1997) que, de este modo, interferiría con la síntesis y/o resistencia del plasmalema. Resultados similares a los nuestros con el

461


níspero japonés han sido demostrados, también, para el AIA en la cebolla (Kwan et al., 1969) y el CuSO4 en los cítricos (Mesejo et al., 2006). Este efecto del ANA inhibiendo la germinación del grano de polen e interrumpiendo el crecimiento del tubo polínico evita la fecundación y, como consecuencia, la flor cae. El estado fenológico de mayor sensibilidad a estos efectos es el 605 de la escala BBCH, explicándose la ausencia de cuajado cuando se aplica en antesis. Asimismo, su acción sobre las primeras fases del desarrollo del fruto, estados 609 y 700 de la escala BBCH, provoca la degeneración del óvulo recién fecundado o del embrión que inicia su desarrollo. No obstante, el níspero florece en panículas de más de 100 flores, de modo que cuando gran parte de ellas se encuentran en antesis otras ya lo sufrieron con anterioridad y otras permanecen todavía cerradas. Nuestros resultados explican por qué se recomienda que los tratamientos para aclarar frutos se lleven a cabo cuando sean visibles 2-3 fruto por panícula ya que dichos frutos, recién cuajados y con los embriones de sus semillas en crecimiento, son insensibles al tratamiento. Las flores más retrasadas en esa fecha han perdido sus pétalos o se encuentran en antesis. Las primeras (estados 609 – 700 BBCH) verán interrumpido el crecimiento del tubo polínico o sus óvulos degenerarán y, por tanto, caerán por acción del ANA, y las segundas (estado 605 BBCH) ven inhibida la germinación de sus granos de polen, interrumpido el crecimiento de los tubos polínicos y sus óvulos degeneran.

Conclusiones La sal potásica del ácido α-naftalenacético a una concentración de 20 mg L-1 provoca, dependiendo del momento de su aplicación, la inhibición de la germinación del grano de polen, la interrupción del crecimiento del tubo polínico y la degeneración del óvulo maduro o recién fecundado del níspero japonés, explicando así su efecto aclarante en esta especie.

Agradecimientos Los autores agradecen a la Coperativa Agrícola de Callosa d’En Sarriá la cesión de su parcela experimental, a D. Esteban Soler su asesoramiento técnico, y a D. Vicente Martínez su ayuda en las labores de campo.

Bibliografía Agustí, M., Juan, M., Almela, V., y Gariglio, (2000). Loquat fruit size is increased through the thinning effect of naphthaleneacetic acid. Plant Growth Regulation 31, 167-1711 Childers, N.F. (Ed.) (1959) Chemical fruit thinning of peach and apple. New Brunswick, New Jersey Conference Procedings, Rutgers University, USA El-Otmani, M., Coggins, Jr., Ch.W., Agustí, M., y Lovatt, C.J. (2000). Plant growth regulators in Citriculture: World current uses. Critical Reviews in Plant Sciences 195, 395-447 Eti, S., Kilavuz, M., y Kaska, N. (1990) The effect of flower thinning by chemicals and by han don fruit set and fruit quality in some loquat cultivars (Eriobotrya japónica Lindl.). I. The application of NAAm and Ethrel to the cultivars Ottawiani, Baffico and Champagne de Grasse. Bahce 19, 1-9 Geitmann, A., Wojciechowicz, K., y Cresti, M. (1996). Inhibition of intracellular pectin transport in pollen tubes by monensin, brefeldin A and cytochalasin D. Botanical Acta 109, 373 -381 Kwan, S.C., Hamson, A.R., y Campbell, W.F. (1969). The effects of different chemicals on pollen germination and tube growth in Allium cepa L. Journal of the American Society for Horticultural Science 94, 561-562 Lin Y., y Yang Z. (1997). Inhibition of pollen tube elongation by microinjected anti-Rop1Ps antibodies suggests a crucial role for Rho-type GTPases in the contol of tip growth. Plant Cell 9, 1647–1659

462


Martínez-Calvo, J., Badenes, M.L., Llácer, G., Bleiholder, H., Hack, H., y Meier, U. (1999). Phenological growth stages of loquat tree [Eriobotrya japónica (Thunb) Lindl.]. Annals of Applied Biology 134, 353-357 Mesejo, C., Martínez-Fuentes, A., Reig, C., Rivas, F., y Agustí, M. (2006). The inhibitory effect of CuSO4 on Citrus pollen germination and pollen tuve growth and its application for the production of seedless fruit. Plant Science 170, 37-43 Tefter, M. y Taylor, I.E.P. (1981). The interaction of divalent cations with pectic substances and their influence on acid-induced cell wall loosening. Canadian Journal of Botany 59, 1522-1525 Wertheim, S.J. (2000). Developments in the chemical thinning of apple and pear. Plant Growth Regulation 31, 85-100

463


Estimation and mapping transpiration with basal and stress crop coefficients derived from remote sensing and ground-based plant water stress indicator F. L. Santos1, M. M. Correia1, I. Pôças2, P. C. Valverde1, R. R. Coelho1, M. Vaz1, T. A. Paço2 1

Instituto de Ciências Agrárias e Ambientais Mediterrânicas, Polo da Mitra da Universidade de Évora, Évora 7002-554, Portugal, fls@uevora.pt; 2 CEER – Biosystems Engineering, Instituto Superior de Agronomia, Universidade Técnica de Lisboa, Lisboa, Portugal . Abstract The use of remote sensing for obtaining evapotranspiration (ET) from natural and agricultural surfaces is already widely used. For irrigated agriculture the two basic approaches are: (1) the solution of the energy balance equation, using remotely sensed surface temperatures and reflectances to estimate variables and components of this equation, and (2) the crop coefficient and reference evapotranspiration (ETo) approach where the crop coefficient is obtained through canopy reflectance measurements. For the latter, theoretical and field studies have shown that satellite reflectance-derived vegetation indices (VIs) are closely relate to carbon and moisture fluxes and, when combined with ground data or appropriately calibrated models, they can produce valuable estimates of crop transpiration and related processes at the canopy or ecosystem scale (D´Urso and Calera, 2006). In this study the crop coefficient approach was used. For estimation of actual transpiration of irrigated and very high tree-density hedgerow orchards grown in Alentejo the procedure correlates (a) the basal crop transpiration coefficients (Kcb = Tmax/ETo) of the unstressed full irrigated treatment to the normalized difference vegetation index (NDVI) values assessed from Landsat5 TM and Landsat7 ETM+ (r2 = 0.86) and (b) the crop stress coefficient (Ks = Ta/KcbETo), obtained from the ratio of the sustained deficit irrigation (Ta) and fully irrigated (Tmax) daily transpiration rates, to a plant stress indicator, in the case, the basal leaf water potential (r2= 0.85). Daily tree transpiration rates on both treatments were obtained from sap flow measurements. The unstressed crop status of the full irrigation treatment was warranted from the high Willmott index of agreement (IA = 0.88) obtained with transpiration values simulated with the Penman-Monteith “big leaf” model (Willmott, 1982). In this algorithm, a specific model of bulk daily canopy conductance (Gc) for unstressed olive canopies was used (Orgaz et al., 2007). From the resulting relationship equations, known field values of leaf basal water potential and satellite-derived NDVI´s suffice to get estimates of Ks and Kcb, respectively and from them derive and map the actual olive tree transpiration (Ta = Kcb Ks ETo) rates. The study is under way, and thus further validation applications are planned prior to using the approach for mapping olive transpiration orchards of different tree density and scale areas. Keywords: Olea europaea, transpiration, crop coefficient, hedgerow olive orchard, mapping transpiration

Estimativa e mapeamento da transpiração com os coeficientes culturais basal e de stress derivados de deteção remota e de indicadores de stress hídrico Resumo O uso da deteção remota para a obtenção de estimativas da evapotranspiração (ET) de superfícies naturais e agrícolas é hoje uma realidade. Para a agricultura de regadio, as duas aproximações mais usadas nessa estimativa são: (1) a solução da equação do balanço de energia, com as temperaturas da superfície e as reflectâncias obtidas por deteção remota, o que garante a estimativa de variáveis e componentes dessa equação, e (2) a obtenção de coeficientes culturais e da evapotranspiração da cultura (ET) com base na evapotranspiração de referência (ETo) e na reflectância do copado, esta obtida por deteção remota. Para esta aproximação, os estudos teóricos e experimentais demonstram que os índices de vegetação (VIs), derivados de informação de reflectâncias obtida de imagens de satélite, apresentam elevada correlação com os fluxos de carbono e de vapor de água e que, quando

464


combinados com dados derivados de ensaios experimentais e de modelos devidamente calibrados, produzem estimativas válidas da transpiração das culturas regadas e de processos com esta relacionados, à escala do copado e do ecossistema. Neste estudo foi usada a aproximação dos coeficientes culturais. Para a estimativa da transpiração actual de pomares de olival superintensivo regados e em sebe na região do Alentejo, o procedimento relaciona (a) valores do coeficiente cultural basal (Kcb = Tmax/ETo) do tratamento de rega plena, em que a cultura é bem abastecida de água, com o índice de vegetação diferença normalizada (the normalized difference vegetation index NDVI) obtido a partir dos sensores Landsat5 TM and Landsat7 ETM+ (r2 = 0.86) e (b) valores do coeficiente de stress hídrico (Ks = Ta/KcbETo), em que a transpiração máxima da cultura é obtida do tratamento de rega plena (Tmax) e a transpiração actual da situação de rega deficitária sustentada (Ta), com indicadores de stress da cultura, no caso, o potencial hídrico de base (r2= 0.85). Nos dois tratamentos, os valores diários da transpiração do olival foram obtidos através de medições de fluxos de seiva no tronco de árvores. O estado de rega plena e olival bem abastecido de água foi assegurado pelo elevado índice de concordância de Willmott (IA = 0.88) obtido entre os valores de transpiração medidos pelo fluxo de seiva e os derivados com a equação "big leaf" de Penman-Monteith (Willmott, 1982). Neste algoritmo, a condutância estomática diária global do olival foi obtida através do "specific model of bulk daily canopy conductance (Gc) for unstressed olive canopies" de (Orgaz et al., 2007). Com as relações estabelecidas em (a) e (b), para se obterem valores de transpiração actual do olival (Ta = Kcb Ks ETo) e mapear a sua distribuição temporal, bastará obter valores experimentais de um indicador de stress da cultura (potencial hídrico de base), para daí derivar estimativas de Ks, e valores do índice de vegetação NDVI, para daí derivar as de Kcb. Mais aplicações e validações estão planeadas para comprovar o uso do modelo no mapeamento global da transpiração de pomares de olival de diferentes densidades e áreas de plantio. Palavras-chave: Olea europaea, transpiração, coeficiente cultural, olival em sebe, mapeamento da transpiração

Introduction The large demand for water rising from the increasing number of hectares devoted to olive orchards in southern Portugal make the optimal use of irrigation water critical for the sustainability of commercial orchards. A precise estimation of transpiration under non-limiting conditions is required to set the upper limit of irrigation requirements, and to assess the opportunities for reducing transpiration and water applications via deficit irrigation (DI; Santos et al., 2007). This growing need to estimate crop transpiration under water‐limiting conditions, i.e., deficit irrigation, is also greatly felt in many dry areas of the world with a shrinking share of agricultural water and current and pressing water allocation issues. The Kc approach with an empirical Ks stress coefficient has been proposed and used to describe the effect of water stress on crop transpiration (Allen et al., 1998). Furthermore, crop coefficients are used to help better schedule irrigation and water delivery. Crop coefficient values are also related to canopy development and fractional vegetation cover. Since these vegetation characteristics are well correlated with canopy spectral reflectances, it is possible to establish a correlation between remote multi-spectral observations of uniformly growing crops and corresponding Kc values derived from field investigations (Bausch and Neale, 1987; Bausch, 1995; Choudhury et al., 1994). They established the potential for modeling crop coefficient as a function of the Normalized Difference Vegetation Index (NDVI) and used this approach to perform irrigation scheduling. On the basis of intensive multi-temporal spectral reflectance acquisitions and simultaneous field evaluations, a linear relationship, relating the basal crop coefficient Kcb and NDVI, has also been defined by D´Urso and Calera (2006). The objective of this study was to develop a simple predictive model to estimate and help map the actual transpiration of irrigated and very high tree-density hedgerow olive orchards in Alentejo taking into account the Normalized Difference Vegetation Index, NDVI and a crop water stress indicator (i.e., the basal leaf water potential), by: (1) correlating the basal crop transpiration coefficients (Kcb = Tmax/ETo) of the unstressed irrigation treatment to NDVI values remotely assessed by Landsat5 TM and Landsat7 ETM+ satelite sensors, and (2) correlating the crop stress coefficient values (Ks = Ta/KcbETo), a ratio of the sustained deficit irrigation daily transpiration rates (Ta) to the corresponding unstressed transpiration (Tmax= KcbETo) values, to basal leaf water potential, ψb measurements.

465


Material and Methods The research was conducted during 2012 in the region of Alentejo, Portugal, and in a commercial orchard at the Herdade da Azambuja, Monte do Trigo, near Évora (38º 24' 47.03'' N, 7º 43' 38.36'' W; alt. 75 m) in a Eutric Cambisoil (WRB, 1998). The average apparent bulk soil density was 1,67 Mg m-3, and average volumetric soil water content at field capacity (i.e. at 0,03 MPa) was 0,36 m3 m-3, whereas it was 0,12 m3 m-3 at wilting point (i.e. at 1,5 MPa). Using an orchard stand of 6 year-old olive trees (Olea europaea L. cv. Arbequina) planted on hedgerow in a 3,75 by 1,35 m spacing layout and drip irrigated, the trees were treated from mid-May to the end of October using one of two irrigation treatments: a treatment A with full-rate irrigation to the full soil water holding capacity and continuously replenished, and a SDI treatment B with irrigation to trees to provide for approximately 70% of the water applied in treatment A. Reference evapotranspiration, ETo was calculated using the FAO-Penman–Monteith method and the procedures prescribed by Allen et al. (1998). Each tree of treatments A and B were supplied with water by a single drip line with emitters spaced 0,75 m apart throughout the entire length of the emitter line placed at the soil surface and laid out along each tree row, and serviced by 2,3 and 1,6 l h-1 emitters, respectively. The irrigation scheduling and time of water delivery to trees were the same for both treatments throughout the irrigation cycle. Half-hour averages of the meteorological parameters, wind speed, air temperature, solar radiation, precipitation and relative humidity were evaluated from data recorded in a nearby meteorological station. Half-hour averages of the net radiation above the canopy of the trees were measured using one NrLite net radiometer (Kipp & Konen, Holland) connected to a data logger (Delta-T, DL2e, Delta-T Devices, Cambridge, U.K). To evaluate sap flow rates and transpiration, three representative trees in each treatment were selected and their trunk implanted with heat- pulse probes. Using the compensation heat-pulse technique (CHP) described in Santos et al. (2007), sap flow measurements were taken at 30min intervals and tree transpiration rates were estimated as average sap flow rates of the three probes. Photosynthetically active radiation (PAR) was evaluated using a set of eight Quantum sensors (QPAR-02, 400 – 700 nm, Tranzflo, Palmerston, NZ) placed in a fixed grid around the trees and one at the top of the canopy. Basal leaf water potential, ψb was evaluated in leaves of trees chosen for sap flow measurements with a pressure chamber (PMS Instruments, Corvallis, USA). Acquired radiometrically corrected reflectance values for red and near infrared bands available from the Landsat5 and Landsat7 ETM+ sensors were used as inputs for generating the Normalized Difference Vegetation Index, NDVI. Measured daily transpiration values estimated from sap flow were compared to simulated transpiration values obtained with the Penman-Monteith (PM) “big leaf” equation (Monteith, 1981) coupled with the Orgaz et al. (2007) specific model of bulk daily canopy conductance (Gc) for unstressed olive canopies (hereafter the PM-Orgaz model).

Results and Discussion Daily transpiration rates of treatment A estimated from sap flow measurements were highly correlated with the corresponding transpiration values simulated with the PM-Orgaz model (Figure 1). Line 1:1 in the Figure reflects the good match between the observed and simulated values, demostrating that the PM-Orgaz model was able to capture the variations in the seasonal pattern of the well-watered transpiration rates of treatment A. Also, the high Willmott index of agreement IA of 0,8, and the low root-mean-square error RMSE of 0,4 mm d-1 (Willmott, 1982) corroborates the goodness-of-fit, securing that treatment A was well irrigated. Treatment A average maximum and minimum daily transpiration rates were 4,2 and 0,8 mm d-1, and 4,6 and 0,2 mm d-1 with the PM-Orgaz simulation model, respectively. Irrigation applied water between 1 June and 30 September were 296 and 206 mm for treatment A and B, respectively.

466


Figure 1. Observed (CHP-based) and derived (PM-Orgaz based) transpiration (mm d-1) rates for hedgerow olive orchard grown in southern Portugal. Solid line is the 11 line

The basal transpiration coefficient Kcb for treatment A, the ratio of crop transpiration over reference evapotranspiration (Tmax/ETo) when the soil surface is dry and transpiration is occurring at a nonâ&#x20AC;?waterâ&#x20AC;?limiting rate, during summer (1 June to 30 September) was 0,398, with a maximum of 0,975 and a minimum of 0,082, but highly variable (Figure 2a) and with a marked increase at the end of summer and onwards. The variability was also high during spring. The U shape is a characteristic of olive trees (Testi et al., 2005). According to Allen et al. (1998), under water stress standard transpiration (Tmax) is usually reduced and the crop coefficient Kcb must be adjusted to those conditions using a stress coefficient Ks. The adjusted transpiration, Ta is the product of Kcb, Ks, and ETo. Ks is also often used in the management of deficit irrigation regimes to adjust the upper limit of irrigation requirements to reflect the soil water limiting conditions. The evolution of Ks stress coefficients values obtained for treatment B during summer is shown in Figure 3b. The average Ks was 0,691, with a maximum of 0,92 and a minimum of 0,462, corroborating the steadily decline in transpiration rates of treatment B from June to September, when transpiration dropped to 59% of treatment A. a)

b)

Figure 2. Time series of (a) coefficient of transpiration Kcb (the ratio of crop transpiration over reference evapotranspiration, or T/ETo) for the unstressed treatment A, and (b) the coefficient of stress Ks (the ratio of stressed to unstressed crop transpiration) for deficit irrigation treatment B.

Figure 3a plots the relationship between Kcb and the Landsat based NDVI (R2=0,86) for the unstressed treatment A and shows the linear Equation 1,

467


Kcb = 2,9 NDVI - 0,84

(1)

required to predict Kcb known corresponding values of NDVI. Figure 3b plots a similar relationship between Ks and the basal leaf water potential (R2=0,73), showing the logarithmic Equation 2, Ks = 0,63 ln (ψb) - 0,51

(2)

also required to predict Ks known corresponding values of ψb.

Figure 3. Scatter plot for (a) calculated basal crop coefficient Kcb and the corresponding Landsat-based NDVI values, and for (b) calculated stress coefficient Ks and the corresponding basal leaf water potential (MPa) for a hedgerow olive orchard grown in southern Portugal

Conclusions From the resulting relationships in Equations 1 and 2, known field values of basal leaf plant water potential, ψb and satellite-derived NDVI´s suffice to get estimates of Kcb and Ks, respectively and from them derive and map the actual olive tree transpiration (Ta = Kcb Ks ETo) rates. The study is under way, and thus further validation applications are planned prior to using the approach for mapping olive transpiration orchards of different tree density and scale areas.

Acknowledgements Financial support from the Fundação para a Ciência e a Tecnologia (FCT) and Instituto de Ciências Agrárias e Ambientais Mediterrânicas (ICAAM) for the projects PTDC/AGR-PRO/111717/2009 (H2Olive3S) and PEst-C/AGR/UI0115/2011, respectively, are gratefully acknowledged. Acknoweldgments are extended to the Estates Olivais do Sul for acess and research support in their commercial orchard at the Herdade da Azambuja.

References Allen, R.G., Pereira, L.S., Raes D., and Smith, M. (1998). Crop Evapotranspiration: Guide- lines for Computing Crop Water Requirements. FAO, Rome, Irrigation and Drainage Paper, 56. Bausch, W.C. (1995). Remote sensing of crop coefficients for improving the irrigation scheduling of corn. Agric. Water Manag., (27):55-68. Bausch, W.C., and Neale, C.M.U. (1987). Crop coefficients derived from reflected canopy radiation: a concept. Transactions American Soc. Agric. Engin., (30), 3:703-709. Choudhury, B.J., Ahmed, N.U., Idso, S.B., Reginato, R.J., and Daughtry, C.S.T. (1994). Relations between evaporation coefficients and vegetation indices studied by model simulations. Remote Sens. Environ., (50):1-17. D’Urso, G., and Calera, B.A. (2006). Operative ap- proaches to determine crop water requirements from Earth

468


Observation data: methodologies and applications. AIP conference proceedings 852: Earth Observation for Vegetation and Water Management, 14-25. Monteith, J.L., (1981). Evaporation and surface temperature. Quartely Journal of the Royal Meteorological Society, 107 (451), 1-27. Orgaz, F., Villalobos, F.J., Testi, L., and Fereres, E. (2007). A model of daily mean canopy conductance for calculating transpiration of olive canopies. Functional Plant Biology, (34): 178-188. Santos, F.L., Valverde, P.C., Ramos, A.F., Reis, J.L., and Castanheira, N.L. (2007). Water use and response of a dry-farmed olive orchard recently converted to irrigation. Biosyst. Eng. (98): 1, 102â&#x20AC;&#x201C;114. Testi, L., Villalobos, F.J., Orgaz, F., and Fereres, E. (2005). Water requirements of olive orchards â&#x20AC;&#x201C;I: simulation of daily evapotranspiration for scenario analysis. Irrigation Science (24): 69-76. Willmott, C.J. (1982). Some comments on the evaluation of model performance. Bulletin of American Meteorological Society, (63): 11, 1309-1313. WRB, (1998). World Reference Base for Soil Resources. World Soil Resources Report 84. FAO, Rome.

469


Evaluación de la producción de cultivo de tomate sometido a sombreo selectivo exterior en invernadero tipo raspa y amagado J. Pérez-Alonso1, A. Callejón-Ferre1, M. Pérez-García2 y J. Sánchez-Hermosilla1 1

Departamento de Ingeniería, Universidad de Almería. Carretera de Sacramento s/n, La Cañada de San Urbano. 04120 Almería, e-mail: jpalonso@ual.es 2 Centro de Investigación de la Energía Solar (CIESOL). Universidad de Almería. Carretera de Sacramento s/n, La Cañada de San Urbano. 04120 Almería

Resumen El objetivo del presente trabajo fue evaluar los parámetros de producción en cultivo de tomate (Solanum lycopersycum L.) tipo “Daniela” en un invernadero "raspa y amagado" de 1024 m2 ubicado en la Finca Experimental de la Universidad de Almería (36°52’ N, 2°17’ W, 98 m MSL), en el que se emplazó una instalación de paneles fotovoltaicos en su cubierta, con la finalidad de compatibilizar ambos tipos de producción, tomate y energía eléctrica. El material de cubierta del invernadero fue polietileno termoaislante de 200 micras de espesor, y el suelo de tipo arenado. El ensayo se realizó desde septiembre a mayo durante 2 campañas (2009-10 y 2010-11) con un marco de plantación de 1,5*0,5 m. El estudio se realizó mediante un diseño experimental basado en bloques al azar con tres tratamientos y cuatro repeticiones: T0 (control), T1 y T2. Se analizó el efecto en la producción de tomate del sombreo producido por el uso de láminas fotovoltaicas flexibles colocadas en la cubierta del invernadero en dos disposiciones distintas T1 y T2 con un sombreo del 9,8% cada una, respecto a una zona testigo sin paneles fotovoltaicos T0. Los parámetros analizados fueron producción total, producción comercial, peso y tamaño medio de fruto, así como CE y pH de la solución del suelo. Asimismo, se cuantificaron parámetros medioambientales para cada tratamiento, tales como temperatura y humedad relativa mediante cuatro psicómetros. Se realizó un análisis de la varianza para los datos de ambas campañas, y no se obtuvieron diferencias significativas entre los tres tratamientos para producción total y producción comercial, aunque para ambas campañas, el valor de ambos parámetros ha sido mayor en T2. De igual forma, no existen diferencias significativas entre los tres tratamientos para la segunda campaña para los parámetros peso medio de fruto y diámetro máximo de fruto. Sin embargo, para la primera campaña sí existen diferencias significativas de T0 con respecto de T1 y T2 para estos últimos parámetros. Las diferencias de mayor diámetro de T0 con respecto a T1 y T2 (primera campaña) no deberían ser un problema debido a que los intervalos de calibre de las normas de comercialización de tomate son muy superiores a dichas diferencias, y por ello los tomates de los tres tratamientos presentan el mismo calibre comercial. Por todo ello, el sombreo del 9,8% producido por láminas fotovoltaicas flexibles podría ser compatible con la producción comercial de tomate. Palabras clave: Invernaderos, producción, sombreo, tomate, paneles fotovoltaicos

Evaluation of the tomato crop production under exterior selective shading in “raspa y amagado” greenhouses Abstract The aim of this study was to evaluate the production parameters in tomato (Solanum lycopersycum L.) "Daniela" in a greenhouse "raspa y amagado" of 1024 m2 located at the Experimental Estate of the University of Almería (Spain) (36°52’ N, 2°17’ W, 98 m MSL), on whose roof was installed a set of photovoltaic modules aiming to supplement with electricity the greenhouse overall production. The base cladding material was thermal polyethylene of thickness 200 microns, and soil type was sandblasting. The trial was conducted from September to May for 2 seasons (2009-10 and 2010-11) with a planting 1,5*0,5 m. The study was performed using an experimental design based on randomized complete block with three treatments and four replications: T0 (control), T1 and T2. We analyzed the effect on tomato production of shade produced by the use of flexible

470


photovoltaic film placed in the greenhouse roof in two provisions T1 and T2 with a shade of 9,8% each, compared to a control area without solar panels T0 . The parameters analyzed were total production, commercial production, average weight and average size of fruit, and EC and pH of the soil solution. In addition, environmental parameters were quantified for each treatment, such as temperature and relative humidity through four psychrometers. An analysis of variance was performed for the data of both campaigns, and no significant differences among the three treatments for total production and commercial production, although for both campaigns, the value of both parameters was higher in T2. Similarly, no significant differences among the three treatments for the second season for the parameters mean fruit weight and maximum diameter of the fruit. However, for the first year there were significant differences with respect T0 to T1 and T2 for the latter parameters. Differences of greater diameter with respect T0 to T1 and T2 (first campaign) should not be a problem because the caliber intervals marketing standard tomato far outweigh these differences and thus the tomatoes three treatments show the same commercial gauge. Therefore, 9,8% shading produced by flexible photovoltaic panels could be compatible with the commercial production of tomato. Keywords: Greenhouses, production, shading, tomato, solar panels

Introducción La integración de fuentes de energía renovable en los procesos productivos de los cultivos bajo invernadero del Sureste de España podría aportar un valor añadido a los agricultores. Entre estas fuentes de energías renovables se puede mencionar el aprovechamiento de la energía fotovoltaica, de forma que existen numerosos ejemplos de uso de esta energía en la agricultura, como su empleo para abastecer la demanda de energía de comunidades de regantes aisladas de las redes de distribución eléctrica, analizando su viabilidad económica frente al uso de grupos electrógenos (Qoaider y Steinbrecht, 2010); el bombeo de aguas subterráneas de pozos alejados de las redes de distribución eléctrica (Meah et al., 2008); su empleo en sistemas de desalinización (Al-Karaghouli et al., 2010) e incluso la integración en la cubierta de invernaderos de módulos de desalación solar cuyos efectos sobre la transmisión de la luz y el crecimiento del cultivo han sido estudiados (Chaibi y Jilar, 2005), controladores de ventilación lateral impulsados por energía fotovoltaica (Yano et al., 2007), así como la energía eléctrica generada por módulos fotovoltaicos instalados en la cubierta de un invernadero tipo multitúnel (Yano et al., 2009) y otras experiencias relacionados con la calefacción y refrigeración de invernaderos mediante energía solar fotovoltaica (Nayak y Tiwari, 2009). La provincia de Almería es una de las áreas europeas con mayor nivel de radiación solar por unidad de superficie y año, lo que unido a la gran superficie de invernaderos existente, que según Callejón-Ferre et al., (2009) es de 27000 ha, la hace potencialmente idónea para la integración de la tecnología fotovoltaica sobre las cubiertas, aunque pueda ocasionar pérdidas en la producción del cultivo o alteraciones en las propiedades de la fruta, ya que parte de la radiación PAR (Photosynthetically Active Radiation) queda bloqueada debido al efecto de sombreo sobre las plantas (Ureña-Sánchez et al, 2012). Por todo ello, el objetivo del presente trabajo fue evaluar los parámetros de producción en cultivo de tomate (Solanum lycopersycum L.) tipo “Daniela” en un invernadero "raspa y amagado" en el que se emplazó una instalación de paneles fotovoltaicos en su cubierta, con la finalidad de compatibilizar ambos tipos de producción, tomate y energía eléctrica, como continuación de un trabajo previó (Ureña-Sánchez et al, 2012).

Material y Métodos Se ha diseñado un procedimiento experimental en un invernadero tipo “raspa y amagado” (Figura 1) de 1024 m2 situado en la Finca Experimental UAL-ANECOOP de la Universidad de Almería (36°52’ N, 2°17’ W, 98 m MSL).

471


El material de cubierta del invernadero fue polietileno termoaislante de 200 micras de espesor y el invernadero dispone de ventilación mediante ventanas laterales extensibles manuales, ventilación cenital abatible (automáticas), con una superficie de ventilación 12,50 %. Todas las superficies de ventilación están provistas de mallas antiinsectos. El invernadero dispone de riego por goteo y sistema enarenado. El material vegetal usado es tomate (Solanum lycopersycum L.) cv. Daniela. El marco de plantación es de 1,5 x 0,5 m. El ensayo se realizó desde septiembre a mayo durante 2 campañas (2009-10 y 201011). El diseño experimental ha sido de bloques al azar con tres tratamientos (T0, T1 y T2) y cuatro repeticiones. En cuanto a los tratamientos se han estudiado dos tipos de sombreo, T1 y T2, con una superficie de 192 m2 en cada tratamiento; y el testigo T0, ocupando el resto del invernadero, según Figura 1.







Figura 1. Localización de los 3 tratamientos y distribución de los paneles solares

En la cubierta del invernadero correspondiente a los tratamientos T1 y T2 se han colocado 12 módulos fotovoltaicos flexibles modelo FUJI FPV 1092, con una superficie por módulo de 1,54 m2, lo que supone 18,48 m2. La disposición de los módulos en la cubierta es diferente para T1 y T2, como se muestra en la Figura 1. Ambos tratamientos presentan un factor de superficie de sombreado de 9,8 %. El control de producción se ha efectuado sobre parcelas elementales, evitando el efecto “borde o banda”. Los parámetros analizados fueron producción total, producción comercial, peso y tamaño medio de fruto, así como CE y pH de la solución del suelo. Asimismo, se cuantificaron parámetros medioambientales para cada tratamiento, tales como temperatura y humedad relativa mediante cuatro psicómetros. Las plantas analizadas por repetición fueron 70 en T0, 50 en T1 y 50 en T2, con parcelas elementales de 35 m2 para T0 y 25 m2 para T1 y T2. La CE y pH de la solución del suelo se han medido con un conductivimetro-phmetro modelo Hanna 9811 EC-pH-TDS con 0,01 de sensibilidad. La solución del suelo se ha obtenido mediante sondas de succión de 15 cm (Himarcan) realizando 3 mediciones en cada tratamiento. La producción total se ha cuantificado directamente de la cosecha obtenida en las parcelas elementales mediante una báscula digital EKS modelo Premium con 10 g de precisión. El peso de fruto ha sido medido con una balanza electrónica BEC Engeneering Electronic con 1 g de sensibilidad, y el diámetro máximo del fruto se ha obtenido mediante calibrador de lazo en mm. Así mismo se registraron los datos de radiación, temperatura y humedad relativa en el exterior mediante una estación meteorológica, y en el interior del invernadero temperatura y humedad, para los distintos tratamientos. La temperatura y humedad relativa se han registrado mediante 4 psicómetros provistos con sensor de Humedad relativa y Temperatura Nutricontrol (Nutricontrol S.L., Cartagena,

472


Murcia, España), que se colocaron protegidos de la luz solar directa, ventilado y situado a una altura de 1,85 m sobre el suelo. Para la primera campaña (2009-10), desde el transplante se han realizado 27 medidas de CE y pH (a los 29, 37, 44, 51, 58, 65, 72, 79, 87, 94, 100, 106, 114, 121, 127, 133, 139, 147, 155, 162, 169, 176, 183, 190, 197, 204 y 212 dat), 9 medidas de producción total y comercial, peso y diámetro máximo de fruto (125, 139, 149, 162, 170, 177, 184, 202 y 212 dat). Para la segunda campaña (2010-11) desde el transplante se han realizado 14 medidas de CE y pH de la solución del suelo (29, 44, 58, 72, 87, 100, 114, 127, 139, 155, 169, 183, 197, 212 ddt), 8 medidas de producción comercial, peso y tamaño medios (136, 150, 158, 165, 173, 179, 186 y 193 ddt). El tamaño de la muestra para cada parcela elemental y recolección fue de 25 frutos. La producción comercial se ha obtenido por la eliminación de los frutos no aptos por presentar BER, inmaduros, rajados, deformados o fuera de normalización. El calibre del fruto viene determinado por el diámetro máximo de la sección ecuatorial. El calibre mínimo de los tomates clasificados en las categorías “extra”, I y II se fija en 35 mm para los tomates del tipo “redondo liso”. Finalmente, para saber si existían diferencias significativas estadísticamente para los parámetros de producción analizados entre los diferentes tratamientos, se realizó un análisis de varianza (p<0.05), validando previamente los datos experimentales mediante los estudios de normalidad y homocedasticidad.

Resultados y Discusión En cuanto a los resultados obtenidos, del análisis de la varianza, se desprende que para ambas campañas, no existen diferencias significativas entre los tres tratamientos para producción total y producción comercial, aunque para ambas campañas ha sido mayor tanto la producción comercial como la total para T2 y sin embargo para peso medio de fruto no. De igual forma, no existen diferencias significativas entre los tres tratamientos para la segunda campaña (2010-11) para los parámetros peso medio de fruto y diámetro máximo de fruto (Tablas 1 y 2). Sin embargo, para la primera campaña (2009-10) si existen diferencias significativas de T0 con respecto de T1 y T2 para los parámetros peso medio de fruto y diámetro máximo de fruto (Tablas 1 y 2). Así como indica Cockshull et al. (1992) la existencia de un mayor porcentaje de sombreo produce una disminución del tamaño de fruto lo que coincide para la primera campaña, ya que el diámetro máximo de fruto es mayor en T0 que en T1 y T2, sin embargo en la segunda campaña en T1 es superior a T0 y T2, aunque T0 es mayor a T2. Las diferencias de mayor diámetro de T0 con respecto a T1 y T2 (primera campaña) no deberían ser un problema debido a que los intervalos de calibre de las normas de comercialización de tomate son muy superiores a dichas diferencias, y por ello los tomates de los tres tratamientos presentarían el mismo calibre comercial. 

Tabla 1.Producción comercial (kg m–2), producción total (kg m–2), peso medio de fruto (g), diámetro máximo del fruto (mm) de los tres tratamientos de la campaña 2009-10 Tratamientos

Producción comercial

Producción total

Peso medio de fruto

Diámetro máximo de fruto

T0 T1 T2

9,15a 8,64a 9,69a

11,62a 10,74a 12,18a

150,09b 141,13a 143,42a

69,73b 68,08a 68,70a

Números con diferentes letras indican diferencias estadísticamente significativas (p<0.05; Test de Bonferroni) 

473


Tabla 2.Producción comercial (kg m–2), producción total (kg m–2), peso medio de fruto (g), diámetro máximo del fruto (mm) de los tres tratamientos de la campaña 2010-11 Tratamientos

Producción comercial

Producción total

Peso medio de fruto

Diámetro máximo de fruto

T0 T1 T2

10,54a 10,19a 11,18a

12,44a 11,75a 12,62a

191,64a 193,13a 191,18a

75,51a 75,75a 75,35a

Números con diferentes letras indican diferencias estadísticamente significativas (p<0.05; Test de Bonferroni)

En cuanto a la CE y pH de la solución del suelo, en ambas campañas han existido diferencias significativas, de forma que en T2 la CE es menor que en T0 y T1, lo cual puede ser debido a la heterogeneidad del suelo enarenado (Castilla, 2005), y el pH es mayor en T1 que en T0 y T2, aunque en la segunda campaña no han existido diferencias estadísticamente significativas para pH (Tabla 3). La CE disminuyó de la primera campaña a la segunda en todos los tratamientos, lo cual es debido fundamentalmente a la mineralización del estiércol del suelo, ya que el cultivo de la primera campaña que se ha realizado en el ensayo, es el primero que se ha plantado en dicho invernadero. Asimismo, se observa como en T2 que presenta menor CE se produce la mayor producción comercial y total para ambas campañas, aunque no sucede así con el peso medio del fruto. Tabla 3.Conductividad eléctrica (CE) de la solución del suelo (dS m–1) y pH de la solución del suelo de los tres tratamientos de las campañas 2009-10 y 2010-11 Campaña 2009-10 Tratamientos T0 T1 T2

CE solución suelo 6,04b 5,40b 3,45a

pH solución del suelo 8,01a 8,24b 8,12ab

Campaña 2010-11 CE solución suelo 4,03a 3,49b 3,17c

pH solución del suelo 7,64a 7,64a 7,57a

Números con diferentes letras indican diferencias estadísticamente significativas (p<0.05; Test de Bonferroni)

Como resumen de lo expuesto, para algunos autores (Awang et al., 1993; Petersen et al., 1998; Lorenzo et al., 2006) valores elevados de CE indican menor producción total y comercial, menor calibre y peso medio de fruto. Se podría esperar en esta investigación que debido a una menor CE en T2 la producción total y comercial fuese superior respecto a T0 y T1, lo cual ocurre, pero no significativamente (Tablas 1 y 2) posiblemente debido a la heterogeneidad del suelo enarenado (Castilla, 2005). Lo que sí ocurre significativamente en la primera campaña es que los frutos más grandes se obtienen en T0 donde la CE es mayor, respecto a T1 y T2 que a su vez presentan CE menores, por lo que esta situación se podría atribuir más a un efecto del sombreo que a la propia CE. Sin embargo, en la segunda campaña no existe esta significación estadística y los frutos de T0 solamente son más grandes con respecto de los de T2.

Conclusiones No se obtuvieron diferencias significativas entre los tres tratamientos para producción total y producción comercial, aunque para ambas campañas, el valor de ambos parámetros ha sido mayor en T2. De igual forma, no existen diferencias significativas entre los tres tratamientos para la segunda campaña para los parámetros peso medio de fruto y diámetro máximo de fruto. Sin embargo, para la primera campaña sí existen diferencias significativas de T0 con respecto de T1 y T2 para estos últimos parámetros. Las diferencias de mayor diámetro de T0 con respecto a T1 y T2 (primera campaña) no

474


deberían ser un problema debido a que los intervalos de calibre de las normas de comercialización de tomate son muy superiores a dichas diferencias, y por ello los tomates de los tres tratamientos presentan el mismo calibre comercial. Por todo ello, el sombreo del 9,8% producido por láminas fotovoltaicas flexibles podría ser compatible con la producción comercial de tomate.

Agradecimientos Los autores desean expresar su agradecimiento a la Consejería de Innovación, Ciencia y Empresa de la Junta de Andalucía, y al Ministerio de Ciencia e Innovación del Gobierno de España por financiar el presente trabajo mediante los proyectos de investigación P08-AGR-04231 y AGL2006-11186 respectivamente, así como a los Fondos Europeos de Desarrollo Regional (FEDER). Asimismo, también expresan su agradecimiento a la Fundación Finca Experimental UAL-ANECOOP por permitir la construcción del invernadero experimental en la Finca Experimental de la Universidad de Almería (UAL).

Bibliografía Al-karaghouli, A., Renne, D., Kazmerski, L. (2010). Technical and economic assessment of photovoltaic-driven desalination systems. Renewable Energy 35(2), 323-328. Awanng, Y.B., Atherton, J.G., Taylor, A.J. (1993). Salinity effects on strawberry plants grown in rockwool. II. Fruit quality. Journal Horticulturae Science 68, 791-795. Callejón-Ferre, A.J., Manzano-Agugliaro, F., Díaz-Pérez, M., Carreño-Ortega, A., Pérez-Alonso, J. (2009). Effect of shading with aluminised screens on fruit production and quality in tomato (Solanum lycopersicum L.) under greenhouses conditions. Spanish Journal Agricultural Research 7, 41-49. Castilla, N. (2005). Invernaderos de plástico. Tecnología y manejo. Editorial Mundi-Prensa. Madrid, España. Chaibi, M.T., Jilar, T. (2005). Effects of a solar module integrated in a greenhouse roo fon Light transmisión and crop growth. Biosystems engineering 90(3), 319-330. Cockshull, K.E., Graves, C.J., Cave, C.R.J. (1992). The influence of shaing on yield of glasshouse tomatoes. Journal of Horticultural Science 67(1), 11-24. Lorenzo, P., García, M.L., Sánchez-Guerrero, M.C., Medrano, E., Caparrós, I., Jiménez, M. (2006). Influence of mobile shading on yield, crop transpiration and water use efficiency. Acta Horticulturae (ISHS) 719, 471-478. Meah, K., Fletcher, S., Ula, S. (2008). Solar photovoltaic water pumping for remote locations. Renewable & Sustainable Energy Reviews 12(2), 472-487. Kayak, S., Tiwari, G.M. (2009). Theoretical performance assessment of an integrated photovoltaic and earth air heat exchanger greenhouse using energy and exergy analysis methods. Energy and Buildings 41(8), 888-896. Petersen, K.K.; Willumsen, J.; Kaach, K. (1998). Composition and taste of tomato as affected by increased salinity and different salinity sources. Journal of Horticultural Science & Biotechnology 73, 205–215. Qoaider, L., Steinbrech, D. (2010). Photovoltaic systems: A cost competitive option to supply energy to off-grid agricultural communities in arid regions. Applied Energy 87(2), 427-435. Ureña-Sánchez, R., Callejón-Ferre, A., Pérez-Alonso, J., Carreño-Ortega, A. (2012). Greenhouse tomato production with electricity generation by roof-mounted flexible solar panels. Scientia Agricola 69(4), 233-239. Yano, A., Tsuchiya, K., Nishi, K., Moriyama, T., Ide, O. (2007). Development of a Greenhouse Side-ventilation Controller driven by Photovoltaic Energy. Biosystems Engineering 96(4), 633-641. Yano A., Furue, A. Kadowaki, M. Tanaka, T. Hiraki, E. Miyamoto, M. Ishizu, F., Noda, S. (2009). Electrical energy generated by photovoltaic modules mounted inside the roof of a north-south oriented greenhouse. Biosystems Engineering 103(2), 228-238.

475


En el níspero japonés (Eriobotrya japonica Lindl.) la brotación, el desarrollo vegetativo y la floración están regulados por el fruto. C. Reig, C. Mesejo, A. Martínez-Fuentes y M. Agustí Instituto Agroforestal Mediterráneo, Universitat Politècnica de València, Camino de Vera, s/n, 46022 Valencia mareiva@prv.upv.es

Resumen El efecto del fruto sobre el desarrollo del níspero japonés se estudió comparando árboles intactos con árboles a los que se les eliminaron todos los frutos en el momento del cuajado. En los árboles sin fruto, muchas yemas brotaron en invierno después de su eliminación, mientras que en los árboles con fruto no brotaron hasta que éste completó su crecimiento. Asimismo, el número de brotes nuevos, principales y anticipados, y su longitud, fueron significativamente reducidos por la presencia del fruto. La reducción en el número de brotes contribuyó indirectamente a reducir el número de flores en el árbol. Sin embargo, no se encontró ninguna relación entre la brotación y la concentración de azúcares solubles, de transporte y de reserva, ni de las fracciones nitrogenadas. Pero la presencia/ausencia del fruto modificó la relación IAA/zeatina que fue significativamente mayor en los árboles con fruto en el momento de la brotación. Palabras clave: Brotación, Carbohidratos, Nitrógeno, Hormonas Vegetales

Abstract The effect of fruit on loquat tree development was compared on fruiting and de-fruited trees from fruit set onwards. On de-fruited trees a significant proportion of buds sprouted in winter, whereas buds from fruiting trees only sprouted in the spring when fruit reached its final size. Fruit also affected on vegetative growth, by reducing both current and premature shoot length. This effect contributed to reduce the number of flowers per tree. Quantitative changes in carbohydrate and nitrogen fraction concentrations in leaves and bark tissues caused by fruit removal was related to vegetative growth, but there was no evidence that these changes were responsible for bud burst. Fruit sink activity also modified IAA/zeatin ratio that was higher in frutiting trees. Keywords: Bud burst, Carbohydrates, Nitrogen, Hormones

Introducción La presencia de los frutos en el árbol reduce el transporte de fotoasimilados hacia las yemas y las partes vegetativas del árbol reduciendo el desarrollo vegetativo. Sin embargo, la falta de correlación entre el contenido en carbohidratos y el porcentaje de brotación de las yemas indica que éste es sólo decisivo para atender el proceso (Lenz, 1986). Por otra parte, la importancia de las reservas nitrogenadas para la brotación y el crecimiento vegetativo del melocotonero está fuera de duda (Taylor, 1967). Es más, las alteraciones en la reducción de NH3-NH4+ y su relación con la floración se han demostrado en cítricos (Monselise et al., 1981) y en el melocotonero como respuesta a la presencia del fruto (Reig et al., 2006). Las variaciones en el transporte y acumulación de auxinas (Monselise, 1979; Dann et al., 1985), giberelinas (Cutting y Lyne, 1993) y citoquininas (Cutting y Lyne, 1993) provocadas por la presencia del fruto y su relación con la brotación de las yemas invitan a pensar en un control hormonal, aunque su mecanismo todavía se desconoce. El hecho de que el contenido en giberelinas sea mayor en las hojas de brotes con frutos que en las hojas de brotes sin frutos (Koshita et al., 1999), indica que el papel de éstas en la floración de muchas especies frutales como el mango (Reece et al., 1949), el manzano (Harley et al., 1932) y el níspero japonés (Fatta del Bosco., 1961), debe ser hormonal y no nutricional.

476


En este trabajo se presentan los resultados sobre el efecto que la presencia del fruto tiene en el balance nutricional y hormonal de la planta y la relación que esto tiene en la brotación, desarrollo vegetativo y floración del níspero japonés.

Material y Métodos Se seleccionaron 8 árboles adultos en cultivo del cv. Algerie de níspero japonés (Eriobotrya japonica Lindl.) de cosecha y volumen de copa similares. A cuatro de ellos se les eliminaron manualmente todos sus frutos en el momento del cuajado (SF), mientras que a los cuatro restantes se les dejaron todos hasta su recolección (CF). De cada uno de ellos se seleccionaron 4 brotes al azar a los que se les midieron regularmente el número de brotes principales y anticipados, así como su longitud y el número de hojas hasta el momento de la antesis, en que también se evaluó el número de flores por panícula. De otros brotes similares se tomaron muestras de sus hojas, floema y frutos, en diferentes estados fenológicos para el análisis hormonal y de carbohidratos. A los resultados se les aplicó el análisis de la varianza, utilizando el test de Student-Newman-Keuls para la separación de las medias.

Resultados La eliminación de todos los frutos del árbol al inicio de su desarrollo, esto es, en el momento del cuajado, anticipó significativamente el desborre de las yemas en, aproximadamente, 35 días, así como y aumentó el número de nuevos brotes en desarrollo durante todo el ciclo vegetativo de la planta cuando se comparó con los árboles que conservaron todos sus frutos hasta la recolección (Fig. 1). También el número de brotes anticipados fue significativamente superior en los primeros, anticipando también su desborre en, aproximadamente, 15 días.

 











Figura 1. Influencia del fruto sobre la evolución de la brotación del níspero japonés cv. Algerie a lo largo de su ciclo vegetativo. Las barras verticales indican el ES. La flecha indica el momento de la recolección. * indica diferencias significativas (P< < 0.05) para una misma fecha

477


Los brotes de los árboles CF fueron significativamente más cortos que los de los árboles SF durante todo el periodo estudiado. Al final del crecimiento vegetativo, en el momento de la antesis, los primeros apenas midieron 7 cm mientras los segundos alcanzaron 20.5 cm. Este efecto, sin embargo, no alcanzó al número de hojas formadas en estos brotes, que fue prácticamente el mismo, pero sí a la longitud de los entrenudos que se vio reducida por la presencia de los frutos (Fig. 2).



 



 

Figura 2. Influencia del fruto sobre el crecimiento de los brotes vegetativos y su número de hojas en el níspero japonés cv. Algerie a lo largo de su ciclo vegetativo. Las barras verticales indican el ES. La flecha indica el momento de la recolección. * indica diferencias significativas (P< < 0.05) para una misma fecha

La concentración foliar de azúcares reductores en los árboles CF fue significativamente superior a la de los árboles SF durante el periodo de crecimiento activo del fruto, es decir, desde que éste alcanzó el 70% de su tamaño final hasta que cambió de color. La respuesta de las hojas a la eliminación de todos los frutos fue tan rápida que a los 15 días de la descarga las hojas de estos árboles ya tenían 2.1 mg g-1 ms más de glucosa y fructosa que los árboles que tenían todos sus frutos (Fig. 3A). Respecto a los azúcares de transporte, el contenido conjunto de sacarosa y sorbitol en los árboles CF fue significativamente superior (prácticamente el doble) que el de los SF hasta que el fruto alcanzó el 70% de su tamaño final, igualándose para dicho estado fenológico (707 BBCH).

478


A partir de ese momento y hasta el final del periodo estudiado la tendencia fue completamente divergente entre ambos grupos de árboles (Fig. 3B)

A

B

Figura 3. Influencia del fruto sobre la evolución de la concentración de carbohidratos reductores en las hojas (A) y de transporte en los tejidos floemáticos (B) del níspero japonés cv. Algerie a lo largo de su ciclo vegetativo. Las barras verticales indican el ES.

A

El contenido endógeno de hormonas en la planta también se vio alterado por la presencia de los frutos. Este efecto resulta claro al comparar la evolución del ratio AIA/zeatina, más bajo para los árboles SF a lo largo de todo el periodo estudiado (Fig. 4). El descenso de este ratio se relaciona con la brotación, y viceversa, explicándose de este modo las diferencias de la brotación encontradas entre ambos tipos de árboles, CF y SF (Fig. 1).

Figura 4. Influencia del fruto sobre la evolución del ratio AIA/zeatina en el floema de árboles de níspero japonés cv. Algerie a lo largo de su ciclo vegetativo. Las barras verticales indican el ES.

479


La presencia del fruto redujo significativamente el número de flores totales del árbol, directamente reduciendo el número de flores por panícula (Tabla 1) e, indirectamente reduciendo el número de brotes y, por tanto, de panículas en el árbol (Fig.1). Resulta interesante destacar la importancia que el tiempo de permanencia del fruto en el brote tiene sobre la floración. Así, en nuestras condiciones climáticas, las panículas principales y anticipadas de un árbol en condiciones de cultivo y soportando la totalidad de sus frutos, tuvieron 141.4 y 78.8 flores, respectivamente, mientras que la eliminación de todos ellos las elevó, significativamente, hasta 160.2 y 114.1 flores, respectivamente (Tabla 1). Tabla 1. Influencia de la presencia del fruto hasta su recolección o su eliminación al inicio del desarrollo sobre la floración del níspero japonés cv. Algerie. Letras distintas en la misma columna indican diferencias significativas (P<0.05)

TRATAMIENTO

Días tras la eliminación

Ø (mm)

Nº flores/panícula ppal

Nº flores/panícula anticipada

Sin frutos Con frutos

240 135

18,5 38,3

160,2 a 141,4 b

114,1 a 78,8 b

Discusión Las relaciones fuente-sumidero juegan un papel dominante en la utilización de carbohidratos por parte del árbol frutal (Gifford y Evans, 1981; Patrick, 1989). En este sentido, la presencia del fruto en crecimiento restringe el transporte de carbohidratos hacia las partes vegetativas en beneficio propio, retardando y/o reduciendo su desarrollo. Así se refleja en nuestros experimentos, de modo que los cambios detectados en el contenido de azúcares de transporte en el floema de los árboles sometidos a la carga completa de sus frutos son consecuencia directa del reparto regido por el fruto, como lo demuestra su comparación con árboles sin frutos. En coherencia con ello, la eliminación de todos los frutos al inicio de su crecimiento anticipó y aumentó el número de yemas principales y anticipadas que brotaron al final del crecimiento vegetativo. Como consecuencia de ello, los brotes principales desarrollados presentaron al final de su crecimiento mayor longitud de los entrenudos. El efecto del fruto sobre el desarrollo vegetativo es, por tanto, decisivo. Esta acción ya ha sido demostrada en otras especies como el manzano, melocotonero y cítricos (Faust, 1989). A la vista de nuestros resultados no es posible afirmar que las variaciones en la densidad de floración sean sólo consecuencia de las alteraciones en el desarrollo vegetativo. En efecto, la relación encontrada entre el descenso del número de entrenudos y el la disminución de la densidad de floración, inexistente, sin embargo, con el contenido en carbohidratos, parece indicar una acción del fruto sobre la floración sujeta a un control hormonal, como se ha demostrado en otras especies (Bernier, 1988; García-Luís et al, 1995). Mas claro resulta este efecto al comparar la evolución del ratio AIA/zeatina, más baja en los árboles sin frutos a lo largo de todo el ciclo vegetativo. Sin embargo, no todos los cambios fenotípicos relacionados con la brotación pueden ser explicados por alteraciones de este ratio ya que plantas transgénicas sobreproductoras de AIA presentan aspectos distintos a las infraproductoras de citoquininas (Werner et al., 2001).

480


Conclusiones El fruto, mientras está presente en el árbol, impide la brotación de las yemas manteniendo un elevado ratio AIA/zeatina. Su mayor permanencia en el árbol reduce el número de brotes principales y anticipados al final del crecimiento vegetativo, así como su longitud, contribuyendo indirectamente a reducir la intensidad de floración. El fruto también tiene un efecto directo sobre la floración reduciendo el número de flores por panícula en ambos tipos de brotes.

Agradecimientos Los autores agradecen a la Coperativa Agrícola de Callosa d’En Sarriá la cesión de su parcela experimental, a D. Esteban Soler su asesoramiento técnico, y a D. Vicente Martínez su ayuda en las labores de campo.

Bibliografía Bernier, G. (1988). The control of floral avocation and morphogenesis. Annual Review of Plant Physiology and Plant Molecular Biology 39, 175-219. Cutting, J. G. M., and Lyne, M. C. (1993). Girdling and the reduction in shoot xylem sap concentrations of cytokinins and gibberellins in peach. Journal of Horticultural Science 68, 619-626. Dann, I. R., Jerie, P. H., and Chalmers, D. J. (1985). Short-term changes in cambial growth and endogenous IAA concentrations in relation to phloem girdling of peach Prunus persica. Australian Journal of Plant Physiology 12, 395-402. Fatta del Bosco, G. (1961). Indagini sull’epoca di differenziazione delle gemme nel nespolo del giappone. Riv Ortoflorofrutticoltura Italiana 86, 104-118. Faust, M. (1989). Physiology of temperature zone fruit trees, Editorial John Wiley & Sons, NY, EEUU. García-Luís, A., Fornes, F., and Guardiola, J.L. (1995). Leaf carbohydrates and flower formation in Citrus. Journal of American Society and Horticultural Science 120, 222-227 Gifford, R.M., and Evans, L.T. (1981). Photosynthesis, carbon partitioning and yield. Annual Review of Plant Physiology 32, 485-509. Harley, C. P., Masure, M. P., and Magness, J. R. (1932). Effect of leaf area, nitrate of soda and soil moisture on fruit bud formation in the ´Delicious´apple. Proceedings of American Society and Horticultural Science 29, 193-198. Koshita, Y., Takahara, T., Ogata, T., and Goto, A. (1999). Involvement of endogenous plant hormones (IAA, ABA,GAs) in leaves and flower bud formation of Satsuma mandarin (Citrus unshiu Marc.). Scientia Horticulturae 79, 185-194. Lenz, F. (1986). Fruit effects on transpiration and dry matter production in apple. En: Regulation of photosynthesis in fruit trees, A. N. Lakso y F. Lenz, (Eds.), Symposium Proceedings NY State Agricultural Express State, Ginebra, NY, pp 101-104. Monselise, S. P. (1979). The use of growth regulators in citriculture, a review of Scientia Horticulturae 11, 151-162. Monselise, S. P., Goldschmidt, E. E., and Golomb, A. (1981). Alternate bearing in citrus and ways of control. Proceedings of the International Society of Citriculture 1, 232-242. Patrick, J.W. (1989). Asimilate partitioning in relation to crop productivity. Hortscience 23, 33-40. Reece, P. C., Furr, J. R., and Cooper, W. C. (1949). Further studies of floral induction in the ´Haden´mango (Magnifera indica L.). American Journal of Botany 36, 734-740. Reig, C., González-Rossia, D., Juan, M., and Agustí, M. (2006). Effects of fruit load on flower bud initiation and development in peach. Journal of Horticultural Science and Biotechnology 81, 1079-1085

481


Taylor, B.K. (1967). Storage and mobilization of nitrogen in fruit trees. Journal of Australian Institute of Agricultural Science 33, 23-29. Werner, T., Motyka, V., Strnad, M., and Schm端lling, T. (2001). Regulation of plant growth by cytokinin. Proceedings of the National Academy of Sciences 98, 10487-10492.

482


¿Están implicadas las giberelinas en el proceso de la floración de los cítricos? C. Mesejo1, N. Muñoz-Fambuena1, A. Martínez-Fuentes1, C. Reig1, D. J. Iglesias2, M.C. González-Mas2, E. Primo-Millo2 y M. Agustí1 1

Instituto Agroforestal Mediterráneo, Universitat Politècnica de València, Camino de Vera, s/n, 46022 València carmeco@upv.es 2 Departamento de Citricultura, Instituto Valenciano de Investigaciones Agrarias, Carretera Moncada-Náquera km 4.5, 46113, Moncada, València.

Resumen En los cítricos la presencia del fruto reduce la floración, hasta casi anularla en algunos casos. Este efecto se ha relacionado con un aumento de la concentración de giberelinas endógenas en el momento de la inducción floral (noviembre – diciembre) promovida por el fruto. La única razón que apoya esta hipótesis es el efecto inhibidor de la floración que se consigue cuando se aplican exógenamente, pero su acción endógena en el proceso floracional no ha sido todavía demostrada en los cítricos. Los resultados moleculares sugieren que la presencia del fruto afecta a la floración alterando la expresión de los genes responsables del proceso, tanto en las hojas como en las yemas. Así, el fruto reprime la expresión del gen de la inducción floral CiFT en las hojas y de éste y de los CsAP1 y CsLFY, responsables de la diferenciación floral, en las yemas, al mismo tiempo que los genes homólogos de la inhibición floral, CsTFL, TFL2 y FLC, se hallan sobreexpresados. Por otra parte, la expresión del gen GA20ox1, fundamental en la ruta de síntesis de giberelinas, no muestra relación alguna con la presencia del fruto, mientras que sí se expresa en hojas y yemas de árboles que van a florecer durante la brotación; al mismo tiempo, su actividad parece ser independiente de la expresión de CiFT. Todo ello sugiere que las giberelinas están implicadas tan solo indirectamente en el proceso de la floración de los cítricos afectando al proceso de brotación. Palabras clave: Cítricos, Floración, Fruto, Giberelinas

Do gibberellins regulate flowering in citrus? Abstract In citrus, fruit load reduces and even blocks flowering. This effect has been related to an increase of endogenous gibberellins (GAs) due to fruit during the floral bud inductive period (November-December). This hypothesis is supported by the effect of gibberellic acid inhibiting flowering when applied during the floral bud inductive period, but the role of endogenous GAs controlling citrus flowering has not ever been demonstrated. Molecular studies demonstrate that fruit inhibits flowering by repressing expression of genes CiFT, and CsAP1 and CsLFY, responsible for floral bud induction and differentiation, respectively, and increasing expression of genes CsTFL, TFL2 and FLC, responsible for floral bud inhibition, in leaves and buds. On the other hand, GAs-biosynthesis genes expression (i.e GA20ox1) in leaves and buds did not correlate to CiFT expression in fully loaded trees while it correlated to the ability to sprout. Results suggest that GAs may be indirectly related to the flowering process regulating bud sprouting. Keywords: Citrus, Flowering, Fruit, Gibberellins

483


Introducción La inhibición de la floración depende de la cuantía de la cosecha y del tiempo que el fruto permanece en el árbol (Monselise y Goldschmidt, 1982; Verreyne y Lovatt, 2009; Martínez-Fuentes et al., 2010; Muñoz-Fambuena et al., 2011). En concreto, el fruto comienza a ejercer su acción inhibitoria a partir de momentos próximos a completar su desarrollo (octubre-noviembre) (Martínez-Fuentes et al., 2010; Muñoz-Fambuena et al., 2011), coincidiendo con la época de sensibilidad de las yemas a las aplicaciones de ácido giberélico (GA3) para inhibir exógenamente la floración (Guardiola et al., 1982). A partir de ese momento, el fruto inhibe drásticamente la floración, lo que sugiere que existe un punto de no retorno para la inducción de las yemas en reposo, y que provoca la activación de algunos procesos fisiológicos, metabólicos o moleculares irreversibles que deben ser responsables de la inhibición. Concretamente, el fruto inhibe la inducción floral a través de la represión de la expresión en las hojas del gen CiFT y en las yemas de los genes responsables de la diferenciación floral CsAP1 y CsLFY (Muñoz-Fambuena et al., 2011; 2012). Por otra parte, la hipótesis hormonal que relaciona la acción endógena inhibitoria de las giberelinas (GAs) sobre la inducción floral en las hojas o la diferenciación en las yemas por efecto de la presencia del fruto no ha sido convincentemente demostrada en los cítricos. El objetivo de este trabajo es determinar si el efecto inhibidor del fruto sobre la inducción y diferenciación floral en hojas y yemas, respectivamente, es a través de la síntesis de GAs. Para ello, se estudia la evolución de la expresión del gen GA20ox1, responsable de la síntesis de la GA20 y precursor de la GA1, en hojas y yemas de árboles ON (con muchos frutos) y árboles OFF (sin frutos)

Material y Métodos Se utilizaron hojas y yemas de árboles ON y OFF de 12 años de edad, de la variedad de mandarina ‘Moncada’(Clementina cv.‘Oroval’ (Citrus clementina Hort. ex Tan.). x mandarina cv. ‘Kara’ (C. unshiu (Swingle) Marcow. × C. nobilis Lour.), injertados sobre el patrón citrange Carrizo (C. sinensis Osbeck x Poncirus trifoliata (L.) Raf.), y situados con un marco de plantación de 5 m × 5 m de distancia. El campo utilizado para el experimento se encuentra ubicado en el Instituto Valenciano de Investigaciones Agrarias (IVIA) en Moncada. Se evaluó la intensidad de la floración en cuatro ramas de tres años de cada árbol, con unos 300 nudos por rama. Antes de la antesis, se evaluó la brotación, se contaron las flores y las hojas y se clasificaron de acuerdo con Guardiola et al., (1982). También se contaron los nudos sin brotar. Los cálculos se hicieron en base al número de nudos por rama, el número de brotes desarrollados, el número de flores por brote, el número de brotes por 100 nudos, y el número de flores por 100 nudos. Los resultados se expresaron por 100 nudos para compensar las diferencias en el tamaño de las ramas seleccionadas para el recuento. Desde principios de septiembre hasta finales de febrero, se recogieron 30 hojas adultas totalmente desarrolladas por árbol, de árboles ON (100% frutos) y de árboles OFF (0% frutos). Además, en estos mismos árboles se realizaron 3 muestreos de yemas, septiembre, noviembre, en pleno periodo de inducción, y el otro en febrero, justo antes de la brotación. Se tomó 1 réplica biológica por tratamiento y fecha, que inmediatamente se trituró y almacenó a -80 ºC hasta la extracción de RNA y posterior análisis mediante RT-PCR, con la metodología descrita en Muñoz-Fambuena et al., 2011). Para el estudio del gen GA20ox1, se utilizó el gen descrito en citrange Carrizo CcGA20ox1 (Huerta et al., 2009). Se buscó la secuencia homóloga en el mandarino Clementino (Citrus clementina) en la base de datos www.phytozome.net, y se diseñaron los correspondientes cebadores. Para el diseño de los cebadores se utilizó la página web: http://frodo.wi.mit.edu/. Los detalles sobre los cebadores se dan en la Tabla 1.

484


Tabla 1. Cebadores utilizados para el estudio de la expresiĂłn de gen normalizador (ACTINA) y el gen GA20ox1 5â&#x20AC;˛ -Direct primer- 3â&#x20AC;˛

Predicted product (bp)

AnotaciĂłn

EST

ACTINA

Ciclev10025866m.g

TTAACCCCAAGGCCAACAGA TCCCTCATAGATTGGTACAGTATGAGAC

141

GA20ox1

Ciclev10005157m.g

ACCAAGTGGGTGGTCTTCAG TGAAGGTGTCGCCAATGTTA

96

5â&#x20AC;˛ -Reverse primer- 3â&#x20AC;˛

Resultados En el mandarino â&#x20AC;&#x2DC;Moncadaâ&#x20AC;&#x2122;, la presencia del fruto redujo significativamente la floraciĂłn, y el nĂşmero de nudos que brotaron en otoĂąo y en primavera. AsĂ­, el fruto anulĂł por completo el proceso de inducciĂłn y diferenciaciĂłn floral, de modo que los ĂĄrboles ON no florecieron mientras que los ĂĄrboles OFF mostraron una intensidad de floraciĂłn de 139 flores 100 nudos-1. El nĂşmero de nudos brotados en otoĂąo se redujo un 50%, aproximadamente, en los ĂĄrboles ON respecto de los ĂĄrboles OFF. El nĂşmero de nudos brotados durante la brotaciĂłn de primavera, por otra parte, se redujo un 66% (Figura 1). En los ĂĄrboles ON solamente brotaron brotes vegetativos en la primavera. Por el contrario, en los ĂĄrboles OFF la mayorĂ­a de los nudos formaron inflorescencias sin hojas (60 brotes 100 nudos-1), seguidas de inflorescencias con hojas (10 brotes 100 nudos-1) y de brotes vegetativos (2 brotes 100 nudos-1) (Figura 2).

     

# 1 ! 







   

  

Figura 1. Influencia de la presencia del fruto sobre la intensidad de brotaciĂłn de otoĂąo y primavera en el mandarino â&#x20AC;&#x2DC;Moncadaâ&#x20AC;&#x2122;. ON: ĂĄrboles con muchos frutos; OFF: ĂĄrboles sin frutos. Cada valor es la media de 6 ĂĄrboles. Las barras verticales representan el error estĂĄndar.

485




    









      



Figura 2. Influencia de la presencia del fruto sobre la distribuciรณn de la brotaciรณn de primavera. BV: brote vegetativo; BM: brote mixto; I: inflorescencia. ON: รกrboles con muchos frutos; OFF: รกrboles sin frutos. Cada valor es la media de 6 รกrboles. Las barras verticales representan el error estรกndar.

La evoluciรณn de la expresiรณn del gen homรณlogo de CcGA20ox1 (citrange Carrizo GA20ox1) en mandarino Clementino, GA20ox1, en las hojas, durante todo el estudio mostrรณ una tendencia similar entre los รกrboles ON y OFF, pero con diferencias cuantitativas en dos momentos puntuales, octubre y diciembre (Figura 3). Asรญ, en ambos tipos de รกrboles, se detectรณ un incremento significativo de la expresiรณn del gen GA20ox1 entre el 10-9 y el 10-10, coincidiendo con la brotaciรณn vegetativa de otoรฑo. Sin embargo, dicho aumento fue un 70% mayor en los รกrboles OFF que en los รกrboles ON. Un mes despuรฉs (noviembre), la expresiรณn del gen GA20ox1 se redujo intensamente en los รกrboles OFF (70%) hasta anularse durante el mes de diciembre. Sin embargo, en los รกrboles ON la reducciรณn de la expresiรณn de GA20ox1 fue mรกs moderada (-30% en noviembre), de modo que el 17-12 las hojas de los รกrboles ON presentaron una expresiรณn 10 veces mayor que las hojas de los รกrboles OFF (Figura 3).

     

Por otra parte, la expresiรณn del gen GA20ox1 en las yemas de รกrboles ON y OFF no mostrรณ diferencias significativas en el mes de septiembre, pero sรญ en noviembre (2,9 veces mayor en los รกrboles ON) y en febrero (2,3 veces mayor en los รกrboles OFF), justo antes de la brotaciรณn (Figura 4).

   

      







   





Figura 3. Influencia de la presencia del fruto sobre la expresiรณn relativa del gen GA20ox1 en las hojas del mandarino โ€˜Moncadaโ€™. ON: รกrboles con muchos frutos; OFF: รกrboles sin frutos. Cada valor es la media de 3 replicas tรฉcnicas. Las barras verticales representan el error estรกndar.

486


    

  



    

   

 



Figura 4. Influencia de la presencia del fruto sobre la expresiĂłn relativa del gen GA20ox1 en las yemas del mandarino â&#x20AC;&#x2DC;Moncadaâ&#x20AC;&#x2122;. ON: ĂĄrboles con muchos frutos; OFF: ĂĄrboles sin frutos. Cada valor es la media de 3 replicas tĂŠcnicas. Las barras verticales representan el error estĂĄndar.

DiscusiĂłn En el mandarino â&#x20AC;&#x2DC;Moncadaâ&#x20AC;&#x2122;, como en el resto de cĂ­tricos, el fruto reduce el nĂşmero de nudos que brotan, tanto en otoĂąo como en primavera, y el nĂşmero de yemas brotadas por nudo, particularmente las florales (Figuras 1 y 2), sin afectar el nĂşmero de flores por brote desarrollado (MartĂ­nez-Fuentes et al., 2010). Recientemente, Verreynne y Lovatt (2009) demostraron que la eliminaciĂłn de todos los frutos al inicio del verano en ĂĄrboles ON del mandarino â&#x20AC;&#x2DC;Pixieâ&#x20AC;&#x2122; aumenta la floraciĂłn de la primavera siguiente, y propusieron un mecanismo a travĂŠs del aumento de la brotaciĂłn de otoĂąo, sobre la que mayoritariamente se sustenta la brotaciĂłn de primavera (AgustĂ­, 1980). Sin embargo, ĂŠste no debe ser el modo de acciĂłn directo a travĂŠs del cual el fruto inhibe la floraciĂłn ya que, en nuestros experimentos, mientras el fruto incapacitĂł a todas las yemas del ĂĄrbol para florecer no anulĂł la brotaciĂłn de otoĂąo, que fue reducida en un 50 % respecto de los ĂĄrboles que florecieron intensamente (Figura 1). Por otra parte, MuĂąoz-Fambuena et al (2011) demostraron que la presencia del fruto reprime la expresiĂłn del gen CiFT, en las hojas desde el mes de octubre hasta el momento de la diferenciaciĂłn floral, anulando, por tanto, el proceso de inducciĂłn floral de las yemas. Sin embargo, el modo a travĂŠs del cual el fruto reprime la expresiĂłn del gen responsable de la inducciĂłn floral, CiFT, se desconoce. Y, a la vista de nuestros resultados, este papel no parece estar atribuido a las giberelinas. En nuestros experimentos, el anĂĄlisis de la expresiĂłn del gen GA20ox1, responsable de la sĂ­ntesis de la GA20, precursor de la GA1, revelĂł resultados interesantes. En el momento en que el fruto inicia su acciĂłn inhibidora sobre la expresiĂłn del gen CiFT en las hojas, octubre, encontramos un incremento significativo (+70%) de la expresiĂłn del gen GA20ox1 en los ĂĄrboles OFF respecto de los ĂĄrboles ON. Solamente a mediados de diciembre, cuando la expresiĂłn del gen CiFT en ĂĄrboles OFF ya se ha saturado en un nivel mĂĄximo (MuĂąoz-Fambuena et al., 2011), la expresiĂłn de gen GA20ox1 fue mayor en los ĂĄrboles ON. Este resultado puntual es coherente con las hipĂłtesis formuladas durante el S.XX sobre el mecanismo hormonal de inhibiciĂłn de la floraciĂłn, basadas en la aplicaciĂłn de GA3 e inhibidores de la sĂ­ntesis de GAs (Goldschmidt y Monselise, 1972). Sin embargo, no es capaz de explicar el proceso desde el punto de vista molecular. AĂşn mĂĄs, la expresiĂłn del gen GA20ox1 en las yemas en comparaciĂłn con la expresiĂłn de los genes CiFT, CsAP1 y CsLFY revela resultados contradictorios. Los genes reguladores de la inducciĂłn y diferenciaciĂłn de las yemas presentan una

487


menor expresión en las yemas de árboles ON que en las yemas de árboles OFF tanto en noviembre como en febrero (Muñoz-Fambuena et al., 2012). Sin embargo, la expresión de GA20ox1 fue significativamente mayor en los árboles ON en noviembre y en los árboles OFF en febrero, momento de la micro-diferenciación. La mayor capacidad de brotación de los nudos de los árboles OFF podría estar relacionada con este resultado, del mismo modo que la mayor capacidad de emitir brotes de otoño podría explicar la mayor expresión de la GA20ox1 en las hojas de árboles OFF en octubre.

Conclusión La expresión del gen GA20ox1 se relaciona con la brotación de otoño y primavera pero no con el mecanismo de acción del fruto en la inhibición de la floración.

Agradecimientos Este trabajo ha sido financiado por el INIA (Projecto Nº RTA2009-00147-C02-00).

Bibliografía Agustí, M. (1980). Biología y control de la floración en el género Citrus. PhD Thesis. Universidad Politécnica de Valencia. España. Guardiola, J.L., Monerri, C. and Agustí, M. (1982). The inhibitory effect of gibberellic acid on flowering in citrus. Physiologia Plantarum 55, 136-142. Goldschmidt, E.E. and Monselise, S.P. (1972). Hormonal control of flowering in citrus and some other woody perenials. In: Carr, D. J. (ed.) Plant growth Substances, Springer-Verdag, New York, pp. 758-766. Huerta, L., García-Lor, A., and García-Martínez, J.L. (2009). Characterization of gibberellin 20-oxidases in the citrus hybrid Carrizo citrange. Tree Physiology 29, 569–577 Martínez-Fuentes, A., Mesejo, C., Reig, C., and Agustí, M. (2010). Timing of the inhibitory effect of frui ton return bloom of ‘Valencia’ sweet orange (Citrus sinensis (L.) Osbeck). J Sci Food Agric 90,1936-1943. Monselise, S.P. and Goldshmindt, E.E. 1982. Alternating bearing in fruit trees. Horticultural reviews, 4, 128- 73. Muñoz-Fambuena, N., Mesejo, C., González-Mas, M.C., Primo-Millo, E., Agustí, M., and Iglesias, D.J. (2011). Fruit regulates seasonal expression of flowering genes in alternate bearing ‘Moncada’ mandarin. Annals of Botany 108, 511–519. Muñoz-Fambuena, N., Mesejo, C., González-Mas, M.C., Primo-Millo, E., Agustí, M., and Iglesias, D.J. (2012). Fruit load modulates flowering-related gene expression in buds of alternate-bearing ‘Moncada’ mandarin. Annals of Botany 110, 1109–1118. Verreynne, J.S. and Lovatt, C.J. (2009). The effect of crop load on bud break influences return bloom in alternate bearing 'Pixie' mandarin. Journal American Society Horticultural Science 134, 299-307.

488


 







                       (B1  >1&+(= /2162 25$*(6 



372216758&&,B1<#@$685$/(6! *5B12026"1,9(56,'$'2/,7?&1,&$'($'5,'9203/87(16( 61  $'5,'63$A$-25',0$66$1$830(6

3721*(1,(5@$,9,/216758&&,B1! '($0,126$1$/(6<8(5726"1,9(56,'$'2/,7?&1,&$'( $'5,'52)(6255$1*85(1   $'5,'63$A$ 372,(1&,$<!(&12/2*@$3/,&$'$6$/$!*5@&2/$"!*5@&2/$"1,9(56,'$'2/,7?&1,&$'($'5,' 9203/87(16(61  $'5,'63$A$ 

   1*(1(5$//$662/(5$6<3$9,0(1726'(/26(',),&,26$*52*$1$'(5261235(6(17$1$/7$61(&(6,'$'(60(&>1,&$6 ,1 (0%$5*2 (6 &212&,'2 (/ '(7(5,252 683(5),&,$/ 48( (;3(5,0(17$1 (6726 68(/26 '(%,'2 35,1&,3$/0(17( $ /$ $%5$6,B1325/$63(=8A$6'(/26$1,0$/(62325/$52'$'85$'(9(+@&8/26$,1&25325$&,B1'(1$126@/,&(<1$12 $/C0,1$(1/$)$%5,&$&,B1'(0257(526<+250,*21(6*(1(5$1&$0%,260,&52(6758&785$/(6(1/$0$75,=&(0(17,&,$ 0(-25$1'268635(67$&,21(60$&52(6758&785$/(66726('(%($48(685('8&,'27$0$A2352325&,21$81$0$<25 <0>65>3,'$5($&7,9,'$'81,'$$&$0%,26(1/$025)2/2*@$'($/*8126&2038(6726*(1(5$'26(1/$+,'5$7$&,B1 6726)(1B0(126(67>1$62&,$'26$&$0%,26(1/$63523,('$'(67$/(6&20275$%$-$%,/,'$'5(6,67(1&,$32526,'$' 3(50($%,/,'$48($3$5(&(1'2&80(17$'26(1/$%,%/,2*5$),$ ,1(0%$5*212+$<75$%$-26(1/2648(6((678',( /$,1)/8(1&,$'(',&+$61$12$',&,21(6(1/$'85(=$683(5),&,$/<(1(/&203257$0,(1725(6,67(17($/$$%5$6,B1 / 2%-(7,92 '( (67( 75$%$-2 (6 '(7(50,1$5 /$,1)/8(1&,$'(/$,1&25325$&,B1'(1$12 ,  <1$12/  62%5(/$6 3523,('$'(60$&52(6758&785$/(6'(5(6,67(1&,$'85(=$683(5),&,$/<$%5$6,B1(10257(526'(&(0(172$5$(//26( +$ '(7(50,1$'2 /$ 5(6,67(1&,$ $ &2035(6,B1 /$ '85(=$ #,&.(56 < (/ &2(),&,(17( '( 26 1*(/(6 (1 &8$752 '26,),&$&,21(6 '( 0257(52 '( &(0(172     &2181$ 5(/$&,B1 $*8$0$7(5,$/ &(0(17$17( '(   $6 '26,),&$&,21(6(16$<$'$6)8(521/$'(810257(521250$/,=$'2$/$48(6($A$'(81 '(1 ,81 '(1/< 81$$',&,B10(=&/$'(  '(1 ,<  '(1/ (87,/,=2810257(521250$/,=$'26,1$',&,B1&202&21752/ 265(68/7$'26&21),50$148($8148(12+$<',)(5(1&,$66,*1,),&$7,9$6(1/$65(6,67(1&,$6$&2035(6,B1+$<81 $80(172 &216,'(5$%/( '( /$ '85(=$ 683(5),&,$/ #,&.(56 (1 (/ 0257(52 &21 81  '( /$ $',&,B1 '( 1 , 672 (6 '(%,'2$81$'(16,),&$&,B1'(/$0$75,=325815(),1$0,(172'(/$(6758&785$32526$<81$5('8&&,B1'(/7$0$A2 '(3252&5@7,&2 ,1(0%$5*2/265(68/7$'26'('(6*$67(1235(6(17$1',)(5(1&,$66,*1,),&$7,9$6(175(/260257(526 (678',$'26 ,1 (0%$5*2 /26 &2(),&,(17(6 '( 26 F1*(/(6 (67>1 $/5('('25 '(   /2 48( /(6 &/$6,),&$ &202 0$7(5,$/(6&21%8(1&203257$0,(172$/'(6*$67( $/$%5$6&/$9(257(521$12 , 1$12/  '85(=$'(6*$67( 

                      

 1*(1(5$/62,/6$1'$*52/,9(672&.%8,/',1*63$9(0(176+$9(12+,*+0(&+$1,&$/1(('62:(9(5,7,6.12:17+$762,/68))(5,1*$/7(5$7,216 $5( 0$,1/< '8( 72 7+( $%5$6,21 %< 7+( +229(6 2) 7+( $1,0$/6 25 :+((/(' 9(+,&/(6 !+( $'',7,216 2) 1$12 6,/,&$ $1' 1$12 $/80,1$ ,1 7+( 0$18)$&785(2)0257$56$1'&21&5(7(6&$86(0,&526758&785$/&+$1*(6,17+(&(0(170$75,;,03529,1*,760$&526758&785$/3(5)250$1&(6!+,6 ,6&$86('%<,7660$//6,=(3529,',1*$/$5*(5$1')$67(55($&7,9,7<72*(7+(5:,7+&+$1*(6,17+(0253+2/2*<2)620(&203281'6*(1(5$7(',1 7+( +<'5$7,21 !+(6( 3+(120(1$ $5( $662&,$7(' :,7+ &+$1*(6 ,1 3523(57,(6 68&+ $6 :25.$%,/,7< 675(1*7+ 32526,7< 3(50($%,/,7<  (7& 2:(9(57+(5(,6125(6($5&+,1:+,&+678',(67+(,1)/8(1&(2)7+(6(1$12$'',7,216217+(685)$&(+$5'1(66$1'217+($%5$6,215(6,67$17 %(+$9,25,1&(0(170257$56 !+($,02)7+,6678'<:$672'(7(50,1(7+(,1)/8(1&(2)$'',7,212)1$12 , $1'1$12/  217+(0$&526758&785$/3523(57,(62)675(1*7+ 685)$&(+$5'1(66$1'&(0(170257$56$%5$6,21!27+,6(1':(+$9('(7(50,1('7+(&2035(66,9(675(1*7+#,&.(56+$5'1(66$1'&2()),&,(172) 261*(/(6,1)2850,;785(62)  &(0(170257$5:,7+$:$7(5&(0(175$7,22) $1':$7(5%,1'(52) !+(0,;785(67(67('

489


 







 !!"#!$!#!%&!'()#!$)#!%&%  !!(!("!!& * (& "! ) &!(+   ! +" "  "!,- +    "!.& "   ("/"0!#!$!*(!"!!'.1,!!(("( !"("!!""&,! !-,!""!"!@%2!+"&1. !(!-)"!"!@!%+&!(33#)""&&+!!.-!

81!45!)!$))!%&)3))

!"%# " !% @"!,!"*!6,E"(&&!&."!(,7"""(1!D!  (!  & I& D" %&+(  & !6"! 8(  ,&  & 7  & 9+E -& "&(1 & !6,E"(&  *'!  E&") !) &I 1 ! $"  1 $!.!&-))  2@(& &,!"*&+),&,!,8(8( :! ! "! & &)  &"* "! & ("!& 8(  & 8(  @ 1! "!""*(!&"!,!"*!6,E"(&&7&+E "-& ! &   & !6$) 8) ) 32 @ 1!E  (! "!"   8( & "!,!"*  !6$) ,!(" ".! "!("(& 8( (&  ( "!  & " "7") "-!  & ""! ,( !&7") (""*  & ,.& & &) ""* & & 1 "!!&  & &'-.& & ); <1+&)) =$"&)) 32 @ 1!E  &! "!  &"! + ! (& , & "  ""7">+&)"!!3 63#5?!(","& !&!("!!,."!$.+!)&!8(! (.&!&-!18("(!!."!+-8(E"! 7"! "! ,"  ! 7"! +-!) &6) ;=) K2 1 E" ,",& !* 1 .*,!&, (@&!&!,!&!(-E"(&!K"2$7" &))  2 >!."8(&!&""!(& !."(,&8(!( 1 "&+"*1&+%7.&"!,"!,"(,& &'+"(.&$.+!!1.:!&!8((&&("" !6"!   ,!, ! "!-"!&) 1 8( ! 7 ,!,  & !" ?!  & &("  & "!,!"*  !6$) 1 !6%&)3 E "!! (  "&  .)!.&,!,"!("(&( (,"&1"&+"* !!"!,"!!"8(,!,,!'&&E& "!,!! & 7! C :!  & ,!, ( ,E !. ( & (1"(!,&"!+)!"!+!.*1!!).,! ""!"7"!,!""*&!!&!+E

!#$!  @! & (! (! "! >5 9 #)# C>6>  6) )

2) !6E&" @-& )

=  .(! ,! . "! ( (," ,"E"  )

 ) +) !6&I (.6 "*" .( ,! /" $%) -! (,,&" $98% /"!" # )  $?2)  !&  > C>6>  A6) )

#2 1 +( ,!.& @ "!,!"* 8(E" & "!  "("!+&*.& 4    

     



















A3=

 )

A



 

)#A

3)

333

6

33

) 

$ ."! "(! ,!  !! 5B$ "! ( #  $) 5B%& "! ( #  %&) 5B$4B%&"!())#$1))#%&1 5!!!& !">

490


 







D ! ! ! "D##,H D/  $%  &'(D 5 C)/  $  *%(* +% '  * %*&#H( *$"*,'*D%#* &'(D*(D"  D5* *%(*,&'(D),C *&"% **%'*?"%+*?C;10C2 / *-%#&*%( +%-D*!+%&* *D#+ '%D%D CD CC1 ''*!+%-D*!"%( !' * *! * *! D .%*! 5 !"'%$# *! ( "( -*G  *$"* &&*  (D%  "(* &<'*%*  &"%*  * "(* D'+%*D"%*  L J  7 !  E 5 ;  8*!  !" *-%#&*&#H( ! +%-D*! ! (!*5*%( * &'+%!#H( !$I( * (%'* =?0? C;10C / 5 "(* D%&%* " !'D# * * (!*5  +%!#'D%8* #(D%"!#H( '%&"%#/9$2 *&"% **(%'*79$HDD D0ED D20CE? (!*5 +%!#'D%8*!.*1* *&*-&("(2"#+$#&%'%#D#&!' 7"D+%9:;/  &('"!D%*! )L  C$!D*-##,* *!*D M .*!D*+!&(!D*(D?(*/9$!.*( D%'#(* * +%!# * DD* &* *'%D%(!*5*  *!CC+%-D*!%!D*(D!+%&* *'%D%"%(&%D* *!(&"-! D CD CD ''*! E 8*! !"*-%#&*&#H(H!DD&"-!+%'%D%1"%($# !**,*%5(!*5* !("( "%H'D% "(#1%!* F%#( G  /,1 /,)  5 G  /,CE,) +*%* D%'#(*% * "%,* :#&3%! ? 9H 1/ 12 /2' #*(D*&(1%!#H( !%!"D* !-D(# !?(!*5!%*#,(*&*%* &%D 5  (I'%  ."*! +% '"!D%* "  C1 !+*&#* *! * '(!  '' =(* 1, %*#,*  !D (!*5 ! +%& #H * %*#,*%  (!*5  ! 7($! * D%'#(*&#H(  &#&#(D  ! 7($! ! %*#,H  *&"%  * *! (%'*! =?0C ; 2 C  !+&8#&* +*%* <%# ! 7 '#!' D#'+ ! &%D*%( 5 (!*5*%( )  &"-!  $%*(#D  D CD CD  '', +*%* D%'#(*% !" "%,* :#3%!5!"&#&#(D !7($! ! *D!  * %!#!D(&#* * &'+%!#H( 5 "%,* "%( *(*#,* ! !D* 8!D#&*'(D ' #*(D "( *(<#!#!  * 1*%#*(,* &(  +%$%*'* D*D)%*+.#&! 1/  2 ? #!&%#'#(*(D "!*  +*%* *! ' #*!"+%& #'#(D *!'(%! #%(&#*!!#$(##&*D#1*! J#!.%H2&("(+:  /

  .*( &*%*&D%#,*  ! '%D%! '&<(#&* %!#!D(&#* * &'+%!#H(2 5 '#&%!D%"&D"%*'(D +%!# * DD*2?(*D*-*)!+%!(D*!%!"D* ! *(<#!#! *1*%#*(,* !(!*5!  %!#!D(&#**&'+%!#H(!$I(*&D%ND#+ '%D%OND#'+O5!"#(D%*&&#H(         



$ $0(7E $0(#E $0(#E20(7E   E ;     

C  C  C  C   C1 C1 C1   

        $0 / ;* - /1C $0 E 1 /; - $0;  /D - $0(7E0   $0(7E0 E * DEEC $0(7E0;  /E E- 11 $0(#E0 1C1& $0(#E0 E   $0(#E0;    $0(#E20(7E0   $0(#E20(7E0 E   $0(#E20(7E0; 

 D D D D D D D D D D D D

     * D1 ; /)C - /;1;& D E* 1 1)& 1  )& C)  D; * 1 ;D& 1)/& / EC- /EDD& 1C &

*-

$ #*!&( #!D#(D!!"+%8( #&!+%!(D*( #%(&#*!!D* 8!D#&*!!#$(##&*D#1*!/:  /2H0;/ 5I'% -!%1*&#(!:??$5?%%%!D<( *% *' #*

*%!#!D(&#**&'+%!#H( '%D% %%(&#*+%!(D* #%(&#*!!#$(##&*D#1*!&(%!+&D  %!D  ! '%D%! &( (*(0* #&#(! 2" D#(( 1*%! %!#!D(D! ' #! +%<&D#&*'(D #$"*! (D% !# 5 !"+%#%! * $ #( '-*%$ 5 &' %*  !+%*% C#!D( #%(&#*! !#$(##&*D#1*!(D%!D#'+!+% "&#H( !"(#(&%'(D!!D(# .*!D*!;  8*! &"%* 

491


 







'6'(67$&$%/(48((172'26/260257(526&211$120$',&,21(6/269$/25(6'(5(6,67(1&,$$/26 6- '$6 '( &85$'2 12 35(6(17$1 ',)(5(1&,$6 6,*1,),&$7,9$6 6,(1'2 6,*1,),&$7,9$0(17( ',)(5(17(6 (1 (/ 0257(52&219(1&,21$/'67238',(5$(3/,&$56(325/$0(125',6326,&,51'($*8$/,%5((1(/0$7(5,$/ &(0(17$17(325(/$80(172'(683(5),&,((63(&),&$'(/$61$120$',&,21(6/248(',),&8/7$(/$9$1&('(/ 352&(62'(+,'5$7$&,51 %8148(/$$',&,51'(1$1203$57&8/$6352'8&(81,1&5(0(172'(/$5(6,67(1&,$$&2035(6,51(67((6 32&26,*1,),&$7,926,(1'2'(/5(1(/0257(5261%/7'(/-(1617,7'(/6(1617,7861%/7&21 5(63(72 $/ 9$/25 0(',2 '(/ 0257(52 &219(1&,21$/ '6726 ,1&5(0(1726 621 0(125(6 48( /26 2%7(1,'26 32527526,19(67,*$'25(6I*$1,7,',6(7$/  (7,1*+(7$/  2%6,   2&21(/0,602 325&(17$-('(17,2%7,(1(1,1&5(0(1726'(5(6,67(1&,$'(/ $/26 6',$6'(&85$'2'67238('(6(5 (3/,&$'2325/$,1)/8(1&,$48(7,(1((/7$0$ 2'(/$3$57&8/$68',63(56,51(1/$0$75,!7$1&+(! $1'72%2/(9  2 '1/$7$%/$ 6(35(6(17$1/$632526,'$'(6727$/(6'(/260257(526(16$$'26        

  - 5   65

 617,7 61%/7 617,70  861%/7

     7 -   

  7 5-    7

269$/25(6'(32526,'$'727$/621&2+(5(17(6&21/262%7(1,'26(1(/(16$2'(&2035(6,51'/9$/25 01,02 '( 32526,'$' 6( 352'8&( (1 (/ 617,7 $ /26 - '$6 '( &85$'2 &255(6321',(1'2 $/ 08,02 9$/25 '( 5(6,67(1&,$ 7 5  9$ '1 *(1(5$/ /$6 32526,'$'(6 2%7(1,'$6 (1 /26 0257(526 &21 1$120 $',&,21(6621,1)(5,25(6$/$6'(/0257(52&219(1&,21$//248(,03/,&$81$80(172(1/$&203$&7$&,51 '( ',&+26 0257(526 '672 (6 '(%,'2 12 62/2 $/ ()(&72 '( 5(//(12 '( /26 32526 '(/ 0$7(5,$/ 325 /$ *5$18/20(75$ 1$120975,&$ '( /$6 1$120$',&,21(6 6,12 48( /$ 1$1207, 02',),&$ (/ 352&(62 '( +,'5$7$&,51$&78$1'2&2021:&/(26'(35(&,3,7$&,51$/5('('25'(/26&8$/(66('(326,7(1/26352'8&726 5(68/7$17(6'(/$0,60$I+$1*  2 $ 683(5),&,( '( &8$/48,(5 0$7(5,$/ )250$'2 325 ',67,1726 0,1(5$/(6 52&$62 2 ',67,1726 0$7(5,$/(6 0257(526235(6(17$'85(!$6',)(5(17(66(*:1(//8*$5'(/$683(5),&,((1'21'(6(5($/,!$/$0(',&,51 9$5$2%7(1(5/$'85(!$;,&.(56)8(521'(7(50,1$'$6-7+8(//$6$*583$'266869$/25(6325,17(59$/26 '672 3(50,7( 2%7(1(5 325 ,17(59$/2 (/ 325&(17$-( 48( 5(35(6(17$ &21 5(63(&72 $ /$ 727$/,'$' '( /26 9$/25(6 '(/ 0$7(5,$/ (16$$'2 '1 /$ 7$%/$  6( 35(6(17$ /26 5(68/7$'26 '(/ $18/,6,6 '( 9$5,$1!$ '( '85(!$;,&.(56'1/$),*85$ 6(08(675$1/26325&(17$-(48(5(35(6(17$1&$'$812'(/26,17(59$/26             617,7 61%/7 617,7861%/7

 -  5  66 5 

 

$ 55 % 5 & 7  7&



 6

$%

(',$6&21',67,1726683(51',&(635(6(17$1',)(5(1&,$6(67$'67,&$66,*1,),&$7,9$69 2 7<0- (;:0(52'(2%6(59$&,21(6('';'5525(6781'$5'(/$0(',$

'/9$/250(',2'(/$'85(!$;,.(56'(/0257(52617,7(66,*1,),&$7,9$0(17(683(5,2555 2$/5(672 '(/260257(526$,1&25325$&,51'(81 '(17,&21'8&($81,1&5(0(172'(/$'85(!$;,.(56'(81

21/$$',&,51'(1%/(/,1&5(0(172(6'(/ 

5(63(&7,9$0(17(&8$1'26(,1&25325$ 62/$  2 2 0(!&/$'$ &21 17,   2 '672 38('( '(%(56( $ 81 &$0%,2 (1 /$ 0,&52(6758&785$ '( /$ 0$75,!&(0(17,&,$325/248(+$16,'2$1$/,!$'26/26,17(59$/26(1/2648(6(+$1$*583$'2/269$/25(6

492


 







;D;")=#D;;")ID<>;F";G*?D$F;D$D%D&>@>FGD))D@FG)>;D$"=#D;"%$F<"<>;>;";;D=#DD;;#$+?D&$F &F?D;"&F);D;#$DH";D;=$>;FD)>;'G&>@"%"$"@";"#G";D;")?#D)&$")





         

G;"E>A#$" )DF<)D$("#G)>AG>E>@"&>(F@"?<>FDG;F)>G&D$(";F);D;#$DH"A),;"";>@>+GD)@;#)>(" ;D G<> %$F;#@D =#D (";F$D) ;D ;#$DH" >GED$>F$D) "  ;D)"%"$DH@"G J =#D ;") ;#$DH") ;D ;") =#D;;") DG&$D0$D%$D)DG&DGD; ;D;F);"&F)-";#$DH")#%D$E>@>";=>>D$)&"?<>'G)D>G@$D?DG&"@FG ;"";>@>+G;DGA;"#G=#DDG?DGF$%$F%F$@>+G-F)(";F$D);DG&$F;D;>G&D$(";F* =#D)#%FGDGD;  DG D; ?F$&D$F IA %")"G ";  J  DG ;F) ?F$&D$F) I+GA;, J I+G<>,3+GA;, ";D?=) ;D >G@$D?DG&"$)D ;" %$F%F$@>+G ;D; >G&D$(";F DG&$D 0 ;D #G  DG IA " #G  J  $D)%D@&>("?DG&D ; >G@$D?DG&F ;D ;#$DH" =#D )D %$F;#@D DG&$D ;") ?#D)&$") ;D $DED$DG@>" J ;") ?#D)&$") @FG G"GF0 ";>@>FGD) %F;$," I#)&>E>@"$)D %F$ ;" ;DG)>E>@"@>+G =#D )D %$F;#@D DG ;" ?"&$>H @D?DG&>@>" J %F$ ;F) @"?<>F) DG ;F) &>%F) ;D AD;D) =>;$"&";F) ADGD$";F) %F$ ;" $D"@@>+G %#HF;=G>@" ;D ;" G"GF0)>;>@D <=G@=DH "G; <F<F;D(  2 ) >?%F$&"G&D ;D)&"@"$ =#D D)&D DG)"JF GF D) GF$?";?DG&D #&>;>H";F %"$" D(";#"$ ;F) ?"&D$>";D) @D?DG&>@>F) "#G=#D %D$?>&D @F?%"$"$ ;F) ?F$&D$F) DG&$D ), =";F$D) ;D ;#$DH"=>>D$)F<&DG>;")%F$;F)"#&F$D);D#GA$"G>&F 2F;D#G<")";&F 2?#D)&$"G=#D;" ;#$DH" ?D;>" ";@"GH";" %F$ D; ?F$&D$F I+G<>, D) "@D%&"<;D )> D) @F?%"$";" @FG ";A#G") $F@") G"&#$";D) G @#"G&F " ;F) (";F$D) ;D $D)>)&DG@>" "; ;D)A")&D )D %$D)DG&"G DG ;" E>A#$"  ;F) @FDE>@>DG&D) ;D&D$?>G";F)"%"$&>$;D;DG)"JF;D-F).GAD;D)

   !



493


 







5 2/ 1/1"#2''24.2#'6 2+ !#! 2" G!2"#."'1!"/1.2214"11/.#1;.2"#!66 2.&"=& 216 0./"/ "!2G/# .64!."1# / "'/!+"# 2''24.2#"# !" .6 D-1"+@.!4 <!1' 2 / " / 1/1"# 5 '  2 " / "21'!.' 2 / +  +.#!1.62 / " @&" / +G !#.+1"#  .6 '24.2# >2#  G&' 1"'1/.! =& + !#! 2 / " !6.#1;.2 @.F.2 !6./1 "2 .,/ G!2"#." @&" 2 / 1/1"#2 ' 5.&"=&6.2"." 0.'1/1 "2&#161,.'.2" +F !"6.!212#"/1..6'24.2#'6+.#!1.6 *&!."# 6 "2.5  2 @2!;G =& "1"4&". ' 6.2 G1,.2 ' + !#!  2 !.4+"#G 5 6 '24.2# 2 6 /.61,G"6 2;B!#1/2'6 2/&@ 2>6&2 'G! @#.2'4 +#!H./I@1/.61+1"G6.C12#"/1.' 6+"# 2./1/&6.!2 6.F 2 2G !6 /&.66;.6 !'6/ 1/1"#'5&G!;121@6+"#+F !=& " 6 /.2  ' #!.2 4 +#!H.2 -H 2&!1! " !.4+"#./1G" 6. G1,.2 ' 4!."1#  /) .&"=& 2#. !.4+"#./1G" "  ./#G .6 / 1/1"# 5 G !=& 6 2 !.4+"# 2 /&+G6H." / " 6.2 !.//1 "2 4!."&6 +B#!1/.22#.@6/1'.2G !6." !+.A! G ""'+."112# 6.1"6&"/1.=&G&'#"!6. G!2"/1.''/# 25@#.2/&."' 2+G6."+.#!1.62' !14"".#&!.6

 5.&#161,./1G"'"-1"6 6.+,/6.'.+@.2G! '&/&"1"/!+"# '!212#"/1../ +G!21G" / "!2G/# .6+ !#! '!!"/1.21""." 0.'1/1 "2.2 /1.' .&"!1".+1"# '6.2#!&/#&!. G ! 2. / " !'&//1G" " 6. G ! 21'.' # #.6 ' 6. +.#!1, *1/0  1"/!+"#  ' 6. !212#"/1. . / +G!21G"2!6.#1;.+"#@.F " F&2#11/."' 6.&#161,./1G"'6.2"." 0.'1/1 "2"2.5.'.G.!. .&+"#.! 214"11/.#1;.+"# !212#"/1.2 -1" +@.!4  21 C12# &" " #.@6 1"/!+"#  ' 6. '&!,. 2&G!1/1.6 :1/>!2 / " /.+@1 2 214"11/.#1; 2 " 6. 2#!&/#&!. ' 6. +.#!1, '@1' 2 . &". '"211/./1G"'6.+12+.>2'2#./.@6=&2#.&+"# '6./ +G./1'.'" 4.!."#1,.&".+.5 ! !212#"/1..6'24.2#.&"=&6 2+ !#! 2 @#"1' 2+&2#!.";.6 !2'/ 1/1"#2'5=&6 2 /6.211/."/ + +.#!1.62/ "@&"/ +G !#.+1"# .6'24.2#

  5 2.&# !2.4!.'/"6.G 5 1"."/1! '61"12#!1 '"1"/1.5B/" 6 4H.A! 5/# > ;0 CD);/0" D0 D5'61"12#!1 ' +"# G! 5/# 2"CD, 15" C, 

    .K.201+.- &A" !!*A-0.0-A C)2 '11/.#1 " /+"#0@.2'+.#!1.62K1#0"." G.!#1/62   E0C/ 51  %0."4 00 6& A0G  2 6C&!.6 .#14& G! !+."/  / "/!# / "#.1"1"4 " " 0G.!#1/62  ! G.;+"# 2C ; 0C) C -<"/0, >( .!/1+.!#H" ( A !B "( >&!G"   C 2 ."&.6 G.!. 6 +G6  '6 0 !+14G" " @!.2 .4!H/ 6.2"2#1#&# 2G.J 6'6/+"# 52&2.G61/./1 "2>"2.'!1'>2G.J. -."/0, - @ 6; C 22." #/0" 6 451"/ "/!#K!;1K      1 K C -/0+1'#  +!01"  >!.&" B 6 #,@./0 " .+.!&''1" - BC",!   C)2 2." #/0" 6 41/.6 1+G! ;+"#  2#!&/#&!.6 +.#!1.620 +G./# " +.#!1.6 G! !+."/ ."' 2#!&/#&!.6 '214" 

 )0 -1"40 5A 4.!K.6 - >0.##./0.!55. - -0.!+. D ."' 0.6.K.# -  CC2 A!G.!.#1 "  2161/. "." G.!#1/62."'1#2@"1/1.6! 61"/+"#1#1 &2+.#!1.62

 

 C2DD0/C %0."426.+A C 2D2 "." 02161/.# !'&/2##1"4#1+."'1"/!.2.!652#!"40# / "/!#2 K1#00140; 6&+2 65.20 !26.4 /)0/E  %54."1#1'12 ( -#."1' & ( .6.41.""12 2( 5 4 #0#1'12 -  CC2 2." +/0."1/.6 /0.!./#!1,.#1 "  /+"#0@.2' G.2#2 "!1/0' K1#0 -16  "." G.!#1/62         C/E 0C/ED 

494


Caracterización agromorfológica de cultivares tradicionales españoles de higuera (Ficus carica L.) R. Pérez-Sánchez, M.R. Morales-Corts y M.A. Gómez-Sánchez Facultad de Ciencias Agrarias y Ambientales (Universidad de Salamanca) Avda. Filiberto Villalobos, 119. 37007-Salamanca E-mail: rodrigopere@usal.es

Resumen Nueve cultivares tradicionales de higuera de “Arribes del Duero”, región situada en el centro-oeste de España, fueron caracterizados agromorfológicamente. Veintisiete descriptores, principalmente definidos por el Instituto Internacional de Recursos Genéticos de Plantas y la Unión Internacional para la Protección de Nuevas Variedades de Plantas, fueron empleados para describir frutos, hojas y el propio árbol durante un periodo de tres años consecutivos (2009-2011). Algunos cultivares mostraron características agronómicas interesantes desde el punto de vista comercial, tales como doble producción anual (higos/brevas), altos rendimientos y calidad frutal. Uno de estos cultivares fue “Cuarterón”. Sus frutos fueron bastante pesados y dulces (breva: 92,75 g y 25,91º Brix; higo: 42,41 g y 31,50º Brix), fáciles de pelar y jugosos. “Carballar Negra” y “Moscatel” fueron los únicos cultivares que no tuvieron una producción breval. Este trabajo constituye un paso importante para la conservación de los recursos genéticos de higuera presentes en la provincia de Salamanca (Spain). Palabras clave: Moráceas, descriptores de higuera, conservación, cultivares amenazados, recursos genéticos

Agromorphological characterization of tradicional Spanish fig (Ficus carica L.) cultivars Abstract Nine tradicional fig cultivars from “Arribes del Duero” in Central-Western Spain were characterized agromorphologically. A total of twenty seven descriptors, mainly defined by the Internacional Plant Genetic Resources Institute and the Internacional Union for the Protection of New Varieties of Plants, were used to describe fruits, leaves and the tree itself over three consecutive years (2009-2011). Some of the cultivars showed distinctive and interesting agronomical characters from a commercial point of view such as two crops per year (breva and fig), high yields, and fruit quality. This was the case with the fig cultivar called “Cuarterón”. Its fruits were quite heavy and sweet (breva: 92,75 g and 25,91º Brix; fig: 42,41 g and 31,50º Brix), easy to peel and juicy. “Carballar Negra” and “Moscatel” were the unique fig cultivars which had not breva crops. This work is an important step in the conservation of genetic fig resources in Salamanca province (Spain). Keywords: Moraceae, fig descriptors, conservation, endangered cultivars, genetic resources

Introducción En la provincia de Salamanca existen dos zonas principales de cultivo de higuera (Ficus carica L.), “Arribes del Duero” y “Sierra de Francia”, que se incluyen dentro del núcleo productivo conocido como “Valle del Jerte y comarcas próximas”. En estas zonas, la base de la producción hasta mediados del siglo XIX la constituían cultivares autóctonos o de antigua introducción que, poco a poco, han ido siendo desplazados por cultivares más productivos procedentes de las regiones más diversas. Un primer paso para evitar la desaparición de este material genético es la realización de exhaustivos trabajos de prospección, caracterización e identificación de los cultivares existentes en estas regiones para posteriormente introducirlos en alguno de los principales Bancos de Germoplasma de higuera establecidos en nuestro país: “Finca La Orden-Valdesequera” (Badajoz, Extremadura) y “Campo Experimental de Son Mut Nou” (Mallorca, Islas Baleares). Algunos investigadores que han realizado

495


trabajos de caracterización agromorfológica en cultivares de higuera en España son: Sánchez et al. (2003), López y Guzmán (2007), Giraldo, López and Hormaza (2008; 2010), López et al. (2011), González y Grajal (2012), entre otros. El presente trabajo tiene como objetivo caracterizar desde el punto de vista agromorfológico los cultivares tradicionales de higuera presentes en la región de las “Arribes del Duero”.

Material y Métodos Material vegetal Un exhaustivo trabajo de prospección realizado durante el año 2008 en la región productiva de “Arribes del Duero” (Salamanca, España) permitió identificar un total de 54 árboles correspondientes a 9 cultivares de higuera: ‘Antigua’, ‘Blanca Común’, ‘Carballar Blanca’, ‘Carballar Negra’, ‘Cuarterón’, ‘Moscatel’, ‘Prieto’, ‘Pringo de Miel’ y ‘Tardía Portuguesa’. 6 ejemplares por cultivar fueron analizados.

Descriptores analizados La caracterización agromorfológica se realizó tomando como base 27 descriptores elaborados por el Ipgri and Ciheam (2003) y la Upov (2010) para el cultivo de la higuera. Durante el periodo de 20092011 se tomaron muestran de hojas y frutos para el estudio de algunos de los descriptores seleccionados. Frutos. Se cosecharon 10 frutos (higos y brevas) por árbol y cultivar en el momento de madurez óptima (junio/julio para la primera cosecha y septiembre para la segunda cosecha). Los descriptores de fruto seleccionados fueron los siguientes: longitud del pedúnculo (LPF, cm), ratio longitud/anchura (LAR), peso fresco (PSF, g), sólidos solubles totales (SST, ºBrix), color del fondo de la piel (CFP: amarillo, amarillo-verdoso, verde-amarillento, verde, bandas amarillas y verdes, púrpura y negro), jugosidad (JUG: baja, media y alta) y facilidad de pelado (FCP: fácil, media y difícil). Todas las medidas longitudinales se tomaron con un calibre milimétrico de lectura digital (DIN-862, Acha, España), los pesos mediante una balanza electrónica de precisión (BP 110S, Sartorius, Alemania) y los sólidos solubles con un refractómetro digital (PR-101, Atago Co. Ltd, Japón) a 20ºC. Hojas. Se recolectaron 10 hojas por cultivar y árbol durante el verano (momento en el que se ha alcanzado su máximo desarrollo). Todas las observaciones se realizaron sobre el tipo de hoja predominante en cada cultivar. Las hojas se tomaron de la zona media de las ramas en crecimiento. Los descriptores foliares empleados fueron los siguientes: longitud de la hoja (LGH, cm), longitud del pecíolo (LGP, cm), anchura del pecíolo (ANP, cm), longitud del limbo (LGL, cm), anchura del limbo (ANL, cm), longitud del lóbulo central (LLC, cm), ratio longitud del pecíolo / longitud del limbo (LGP/LGL), tipos predominantes de hojas (TPH: entera, trilobulada y pentalobulada), forma de la hoja entera (FHE: cordiforme, triangular, lanceolada y oblonga), forma del lóbulo central (FLC: triangular, rómbica estrecha, rómbica ancha, espatulada, lineal y en forma de lira) y color del pecíolo (CPC: amarillento, verdoso, rosado y marrón). Todas las medidas longitudinales se tomaron con un calibre milimétrico de lectura digital, Árbol. Las observaciones relativas al árbol se realizaron en pleno invierno, cuando todos los ejemplares habían tirado sus hojas. Concretamente se evaluaron los siguientes descriptores: porte (PRT: erecto, semi-erecto, abierto, extendido y caedizo) y ramificación (RMF: baja, media y alta). Medias y desviaciones estándar fueron calculadas para cada uno de los parámetros cuantitativos analizados a lo largo del periodo de estudio en los nueve cultivares de higuera seleccionados.

496


Resultados y Discusión Frutos Siete de los cultivares de higuera estudiados fueron bíferos, es decir, presentaron una producción anual de higos y otra de brevas (Tabla 1). La única excepción la constituyeron ‘Carballar Negra’ y ‘Moscatel’. Sus brevas no llegaron a recolectarse porque se perdieron a lo largo de su desarrollo. En este sentido, López et al. (2011) reflejaron que la mayor parte de los cultivares existentes en España son partenocárpicos (uníferos o bíferos). Higos. La longitud de los pedúnculos del fruto osciló entre 0,33 y 1,18 cm, siendo ‘Carballar Negra’, ‘Moscatel’ y ‘Pringo de Miel’ los cultivares que presentaron unos pedúnculos más cortos (0,33, 0,41 y 0,53 cm, respectivamente). González y Grajal (2012) registraron rangos de variación en cuanto a la longitud del pedúnculo similares para cultivares de Canarias. Los siconos de todos los cultivares fueron más largos que anchos, a excepción de los obtenidos en ‘Moscatel’ que registraron un ratio longitud / anchura bastante bajo (0,67). El peso de los frutos mostró una gran variabilidad, siendo ‘Antigua’, ‘Cuarterón’ y ‘Moscatel’ los cultivares que registraron los frutos más pesados (35,20, 42,41 y 48,62 g, respectivamente). Por el contrario, ‘Tardía Portuguesa’ presentó unos frutos de apenas 11,86 g, que los hacían poco aptos para la comercialización. Además, sus frutos tampoco alcanzaron valores muy altos de sólidos solubles (16,23º Brix). Tres cultivares muy interesantes en cuanto al nivel de sólidos solubles de sus frutos fueron ‘Cuarterón’ (31,50º Brix), ‘Carballar Blanca’ (32,03º Brix) y ‘Carballar Negra’ (32,34º Brix). López y Guzmán (2007) también registraron importantes variaciones en cuanto al nivel de sólidos solubles totales presentes en los frutos de diferentes cultivares. La coloración del fondo de la piel más frecuente fue verde-amarillenta (‘Antigua’, ‘Blanca Común’, ‘Carballar Blanca’, ‘Pringo de Miel’ y ‘Tardía Portuguesa’). Únicamente ‘Carballar Negra’ y ‘Cuarterón’ presentaron una coloración púrpura-negra. Finalmente, en relación con la jugosidad y la facilidad de pelado, ‘Antigua’, ‘Cuarterón’ y ‘Pringo de Miel’ fueron los cultivares que presentaron una mayor jugosidad y facilidad de pelado de sus frutos. Brevas. Todos los cultivares brevales presentaron una longitud del pedúnculo frutal inferior a 0,76 cm, a excepción de Blanca Común’ (1,05 cm), y siconos más largos que anchos. El parámetro peso de la brevas mostró una gran variabilidad entre unos y otros cultivares. Las brevas más pesadas se registraron en ‘Cuarterón’ (92,75 g), ‘Pringo de Miel’ (92,55 g) y ‘Antigua’ (88,85 g). En el lado opuesto se encontraron ‘Prieto’ (40,23 g) y ‘Tardía Portuguesa’ (42,05 g). Este último cultivar solamente mereció la pena para la producción de brevas. Los sólidos solubles totales oscilaron entre 13,76º Brix y 25,91º Brix, siendo ‘Cuarterón’, ‘Carballar blanca’ y ‘Pringo de Miel’ los cultivares que registraron los mayores valores. En general, las brevas presentaron un nivel inferior de sólidos solubles totales que los higos. López y Guzmán (2007) también constataron esta afirmación. El color del fondo de la piel fue generalmente verde-amarillento, con las únicas excepciones de ‘Prieto’ (púrpura) y ‘Cuarterón’ (púrpura-negro). Con respecto a la jugosidad y la facilidad de pelado, nuevamente ‘Antigua’, ‘Cuarterón’ y ‘Pringo de Miel’, junto con ‘Tardía Portuguesa’, fueron los cultivares que presentaron una mayor jugosidad y facilidad de pelado de sus frutos.

Hojas Importantes diferencias entre unos y otros cultivares se observaron también en relación con los parámetros foliares (Tablas 2-3). Algunos cultivares mostraron hojas con gran superficie foliar (limbo muy desarrollado), como ‘Carballar Negra’ (21,58 cm x 14,27 cm) y ‘Tardía Portuguesa’ (24,28 cm x 14,66 cm), y otros, por el contrario, presentaron un menor desarrollo de las mismas, como en ‘Antigua’ (15,02 cm x 10,47 cm) y ‘Blanca Común’ (15.82 cm x 10,36 cm). La longitud de los pecíolos osciló entre 4,89 cm (‘Moscatel’) y 13,37 cm (‘Carballar Negra’). En todos los casos, la

497


longitud del limbo fue muy superior a la longitud de los pecíolos (ratio longitud limbo / longitud pecíolo: 0,22-0,65). La forma general de las hojas enteras fue acorazonada. Los tipos principales de hojas que se observaron fueron trilobuladas y pentalobuladas. Otros investigadores que destacaron la presencia de hojas trilobuladas y pentalobuladas en multitud de cultivares fueron López y Guzmán (2007) y González y Grajal (2012). ‘Cuarterón’, ‘Moscatel’ y ‘Carballar Blanca’ fueron los únicos cultivares en los que se pudieron observar, con cierta frecuencia, hojas enteras (no lobuladas). Mayores diferencias se observaron entre los cultivares a nivel de la forma del lóbulo central. ‘Tardía Portuguesa’ y ‘Blanca Común’ fueron los únicos cultivares que mostraron formas del lóbulo central espatulada y lanceolada, respectivamente. La coloración típica de los pecíolos fue verdosa.

Árbol Destacadas diferencias se observaron también entre los diferentes cultivares en relación a su hábito de crecimiento y nivel ramificación (Tabla 4). Los cultivares de higuera presentaron un amplio abanico de portes, desde semi-erecto (‘Carballar Negra’) hasta extendido-caedizo (‘Antigua’, ‘Moscatel’, ‘Prieto’ y ‘Pringo de Miel’). ‘Antigua’, ‘Blanca Común’, ‘Prieto’ y ‘Pringo de Miel’ fueron los cultivares que presentaron una mayor intensidad de ramificación.

Conclusiones En la región salmantina de “Arribes del Duero” (Salamanca) aún se conserva un pequeño número de cultivares tradicionales de higuera que se encuentran en clara regresión o a punto de desaparecer. Algunos de estos cultivares muestran características agronómicas interesantes (dos producciones/año, altos rendimientos, calidad frutal, etc.) que podrían justificar su inclusión en futuros programas de mejora de la especie.

Agradecimientos Los autores agradecen la colaboración prestada por los agricultores de “Arribes del Duero” (Salamanca, España). Proyecto financiado por Federación Española de Municipios y Provincias (FEMP) y Ministerio de Medio Ambiente y Medio Rural y Marino (MAGRAMA).

Bibliografía López, B., y Guzmán, G. (2007). Catálogo de variedades locales de higuera (Ficus carica L.) de la Sierra de la Contraviesa (Granada). Consorcio Centro de Investigación y Formación en Agricultura Ecológica y Desarrollo Rural, Granada, España. Giraldo, E., López, M., and Hormaza, J.I. (2008). Selection of morphological quantitative variables in fig characterization. Acta Horticulturae 798, 103-108. Giraldo, E., López, M., and Hormaza, J.I. (2010). Selection of the most discriminating morphological qualitative variables for characterization of fig germplasm. Journal of American of the Horticultural Science 135, 240-249. González, A.M., y Grajal, M.J. (2012). Higueras de Canarias. Caracterización morfológica de variedades. Instituto Canario de Investigaciones Agrarias, Gobierno de Canarias, Tenerife. Ipgri, and Ciheam (2003). Descriptors for fig. Ficus carica. International Plant Genetic Resources Institute, Rome, Italy, and International Centre for Advanced Mediterranean Agronomic Studies, Paris, France. López, M., Gil, M., Pérez, F., Cortés, J., Serradilla, M., y Chomé, P.M. (2011). Variedades de higuera: descripción y registro de variedades. Ministerio de Medio Ambiente y Medio Rural y Marino, Madrid. Sánchez, J., Melgarejo, P., Hernández, F., and Martínez, J.J. (2003). Chemical and morphological characterization of four fig tree cultivars (Ficus carica L.) grown under similar culture conditions. Acta Horticulturae 605, 33-36. Upov (2010). Guidelines for the conduct of tests for distinctness, uniformity and stability. Ficus carica L. International Union for the Protection of New Varieties of Plants, Geneva, Switzerland.

498


Tabla 1. Parámetros de fruto estudiados en los cultivares de higuera (incluyendo desviación estándar) Higos LPF PSF SST LAR CFP JUG FCP (cm) (g) (ºBrix) 0,64 1,00 35,20 19,50 Verde-Amarillento Alta Fácil Antigua (0,35) (0,06) (4,15) (4,31) 1,09 1,11 17,10 21,14 Verde-Amarillento Media Media Blanca Común (0,42) (0,17) (5,07) (6,82) 0,85 1,25 26,29 32,03 Verde-Amarillento Alta Difícil Carballar Blanca (0,36) (0,18) (3,77) (3,26) 0,33 1,43 18,00 32,34 Púrpura-Negro Alta Difícil Carballar Negra (0,18) (0,21) (2,83) (3,64) 0,74 1,15 42,41 31,50 Púrpura-Negro Alta Fácil Cuarterón (0,33) (0,21) (11,85) (0,71) 0,41 0,67 48,62 22,39 Verde-Púrpura Media Fácil-Media Moscatel (0,26) (0,16) (7,64) (2,64) 0,77 1,04 22,33 17,25 Púrpura Baja Difícil Prieto (0,36) (0,21) (5,99) (2,47) 0,53 1,27 26,41 26,38 Verde-Amarillento Alta Fácil Pringo de Miel (0,21) (0,17) (10,77) (3,90) 1,18 1,25 11,86 16,23 Verde-Amarillento Baja Difícil Tardía Portuguesa (0,25) (0,15) (2,31) (2,74) LPF: longitud del pedúnculo; LAR: ratio longitud/anchura; PSF: peso fresco; SST: sólidos solubles totales; CFP: color del fondo de la piel; JUG: jugosidad; FCP: facilidad de pelado Cultivar

Tabla 1. Parámetros de fruto estudiados en los cultivares de higuera (incluyendo desviación estándar). Cont. Brevas PSF SST LAR CFP JUG FCP (g) (ºBrix) 1,31 88,85 16,88 Verde-Amarillento Alta Fácil Antigua (0,08) (6,94) (2,67) 1,26 48,74 17,83 Verde-Amarillento Media Media Blanca Común (0,11) (4,98) (1,82) 1,31 51,59 24,18 Verde-Amarillento Alta Difícil Carballar Blanca (0,15) (6,37) (2,88) No se llegan a recolectar – Se pierden durante su desarrollo Carballar Negra 0,48 1,38 92,75 25,91 Púrpura-Negro Alta Fácil Cuarterón (0,05) (0,14) (13,43) (3,82 No se llegan a recolectar – Se pierden durante su desarrollo Moscatel 0,76 1,17 40,23 13,76 Púrpura Baja Difícil Prieto (0,07) (0,09) (5,81) (2,81) 0,51 1,34 92,55 24,13 Verde-Amarillento Alta Fácil Pringo de Miel (0,11) (0,06) (4,82) (1,97) 0,52 1,43 42,05 17,91 Verde-Amarillento Alta Fácil Tardía Portuguesa (0,08) (0,09) (2,37) (2,71) LPF: longitud del pedúnculo; LAR: ratio longitud/anchura; PSF: peso fresco; SST: sólidos solubles totales; CFP: color del fondo de la piel; JUG: jugosidad; FCP: facilidad de pelado Cultivar

LPF (cm) 0,56 (0,08) 1,05 (0,17) 0,47 (0,08)

499


Tabla 2. Parámetros de hoja estudiados en los cultivares de higuera (incluyendo desviación estándar) LGH LGP ANP LGL ANL LLC LGP/LGL (cm) (cm) (cm) (cm) (cm) (cm) 24,78 8,21 0,46 16,57 15,02 10,47 0,50 Antigua (2,59) (1,46) (0,04) (1,97) (1,87) (1,10) (0,10) 26,60 10,16 0,45 16,18 15,82 10,36 0,65 Blanca Común (4,46) (2,13) (0,11) (2,55) (3,05) (1,98) (0,11) 28,96 10,76 0,55 18,28 20,04 12,22 0,59 Carballar Blanca (2,98) (1,64) (0,06) (2,37) (2,30) (1,24) (0,09) 36,30 13,37 0,50 23,01 21,58 14,27 0,58 Carballar Negra (2,74) (1,43) (0,05) (1,85) (2,05) (1,59) (0,10) 27,64 8,70 0,61 18,94 17,09 9,20 0,47 Cuarterón (3,79) (1,73) (0,10) (2,47) (2,15) (1,07) (0,09) 27.25 4,89 0,55 22,36 23,64 12,49 0,22 Moscatel (2.08) (2,34) (0,06) (2,64) (3,14) (2,64) (0,07) 27,92 9,30 0,26 18,62 15,65 10,67 0,50 Prieto (3,04) (1,59) (0,04) (2,07) (1,50) (2,32) (0,08) 27,57 9,21 0,49 18,36 17,47 10,63 0,51 Pringo de Miel (2,96) (1,88) (0,08) (1,72) (2,12) (1,63) (0,11) 36,10 10,73 0,70 29,46 24,28 14,66 0,36 Tardía Portuguesa (2,81) (1,82) (0,05) (1,94) (2,09) (1,28) (0,08) LGH: longitud de la hoja; LGP: longitud del pecíolo; ANP: anchura del pecíolo; LGL: longitud del limbo; ANL: anchura del limbo; LLC: longitud del lóbulo central; LGP/LGL: ratio longitud del pecíolo/longitud del limbo Cultivar

Tabla 3. Parámetros de hoja estudiados en los cultivares de higuera Cultivar Antigua Blanca Común Carballar Blanca Carballar Negra Cuarterón Moscatel

TPH Trilobuladas y pentalobuladas Trilobuladas y pentalobuladas Enteras y trilobuladas Trilobuladas y pentalobuladas Enteras y trilobuladas Enteras, trilobuladas y pentalobuladas

FHE Acorazonada Acorazonada Acorazonada Acorazonada Acorazonada

FLC Romboidal Lanceolada Triangular Romboidal Triangular

CPC Verdoso Amarillento Amarillento Verdoso Verdoso

Acorazonada

Romboidal

Verdoso

TriangularRomboidal Verdoso Acorazonada Trilobuladas y pentalobuladas Acorazonada Romboidal Verdoso Pringo de Miel Trilobuladas y pentalobuladas Acorazonada Espatulada Verdoso Tardía Portuguesa TPH: tipos predominantes de hojas; FHE: forma de la hoja entera; FLC: forma del lóbulo central; CPC: color del pecíolo Prieto

Trilobuladas y pentalobuladas

Tabla 4. Parámetros de árbol estudiados en los cultivares de higuera Cultivar PRT Extendido-Caedizo Antigua Abierto-Extendido Blanca Común Semierecto-Abierto Carballar Blanca Semierecto Carballar Negra Abierto-Extendido Cuarterón Extendido-Caedizo Moscatel Extendido-Caedizo Prieto Extendido-Caedizo Pringo de Miel Semierecto-Abierto Tardía Portuguesa PRT: porte; RMF: ramificación

RMF Alta Alta Baja Media Media Media Alta Alta Media

500


PROPIEDADES MECANICAS DE MORTEROS DE SULFATO CALCICO ADITIVADOS Y ADICIONADO CON FIBRAS DE CARBONO Flores Yepes, J.A.1, Pastor Pérez, J.J.1, Gimeno Blanes, F.J.1, Berná Serna, J.M.1, Moneo Peco, L.1 Martínez Gabarrón, A.1, Montesinos Martínez, M.1 1

Universidad Miguel Hernández de Elche. Escuela Politécnica Superior de Orihuela. Ctra de Beniel Km 3,2Desamparados-ORIHUELA (AL) CP: 03312; e mail: jjpastor@umh.es

Resumen Los morteros a base de sulfato cálcico están teniendo un nuevo auge en la actualidad debido a sus destacadas propiedades tanto de resistencia al fuego como térmicas, y acústicas. Desarrollos para absorciones de ondas de presión entre otros, permiten obtener materiales que consideremos de nueva generación. Estos desarrollos van ligados al uso de nuevos aditivos que permiten manejar tanto los tiempos de fraguado como el contenido en agua de la mezcla, y además, la posibilidad de incluir al mortero distintos agregados que mejoren aun más sus propiedades de resistencia. El objetivo fundamental del presente trabajo es el de obtener resultados significativos comparando algunas propiedades mecánicas de morteros formados con yeso moreno aditivado mediante la adicción de distintos porcentajes y longitudes de fibras de polipropileno. Fibras por otra parte impuestas en el mercado de la construcción como elemento de bajo coste y de rendimientos mecánicos adecuados. Estudiaremos la trabajabilidad de la mezcla, así como la necesidad de aporte de mayor o menor cantidad de agua. Además se evalúan las propiedades de: dureza superficial, resistencia a flexión, modulo de elasticidad, densidad del conjunto. La necesidad de utilizar aditivos, tiene por objeto el de aumentar los tiempos de fraguado reduciendo la cantidad de agua del soporte, así, de este modo el material base tendrá unas propiedades mecánicas intrínsecas mayores, y la aportación de dichas fibras mejorarán aun más las propiedades, no solo mecánicas, si no de capacidad de deformación, con respecto al mortero convencional. Palabras clave: mortero, yeso, sulfato cálcico, fibra de carbono

Abstract Mortars based on calcium sulphate are nowadays enjoying a new boom due to its outstanding properties such as its fire resistance and its thermal and acoustic properties. Mortars developed to absorb pressure waves, among others, allow the production of materials considered of new generation. These developments are linked to the use of new additives, which facilitate the management of both the setting time and the water amount in the mixture. Furthermore, they allow the addition to the mortar of different aggregates that improve its resistance properties even more. The fundamental objective of this study is to obtain significant results by means of comparing some mechanical properties of the mortars made of browning plaster with the addition of different percentages and lengths of polypropylene fibres. Fibres imposed by the building market as a low-cost elements and appropriate mechanical performance. We will study the workability of the mixture as well as the need of more or less water. In addition, we assess the following properties: superficial hardness, bending resistance, elasticity modulus and density. Additives are added in order to increase the setting times reducing the amount of water of the mixture. This way, the base material shall have some major intrinsic and mechanical properties and the inclusion of such fibres shall further improve not only the mechanical properties but also the deformability capacity compared to traditional mortars. Keywords: mortar, plaster, calcic sulfate, carbon fibers

Introducción y Justificación El empleo de mortero a base de sulfato cálcico tiene su aplicación en el campo de la seguridad pasiva en combinación con paredes de obra civil basadas en ladrillo cerámico o bloque conjunto en el revestimiento de 1 o 2 cm (Novo de Miguel, Luciano. 1970). El desarrollo de aditivos especiales incorporados a la base, se extendió a nuevas aplicaciones, por ejemplo, en el desarrollo de cartón yeso como elemento divisorio y/o de aplicación junto con la lana de roca en la sectorización de establecimientos.

501


El uso de perlita, vermiculita, fibras, etc. (Foster, 1964; BS, 1973), permitió el desarrollo de nuevas aplicaciones, fundamentalmente para la protección pasiva como elemento de protección de estructuras, distintas empresas, ofrecen desarrollos y soluciones técnicas basadas en el empleo de sulfato cálcico como base en sus desarrollos. Actualmente, en el Departamento de Ingeniería de la Universidad Miguel Hernández, se estudian distintas aplicaciones relacionadas con desarrollos de morteros en base al sulfato cálcico. Las más importantes van el la línea de protección de estructuras ante el fuego, así como en absorción de ondas de presión (resistencia a explosiones). La base de desarrollo de morteros de sulfato cálcico aditivados (Arredondo, 1961), se fundamenta en la incorporación a la matriz de la menor cantidad de agua, de modo que se consigan morteros lo más duros y resistentes posibles. Esto se consigue aplicando aditivos especiales. También en este sentido se persigue mejorar la trabajabilidad (García Figuereo; July Altagracia, 2011). de modo que el mortero sea fácil en su aplicación para: proyectar, verter, etc. También en igual sentido los aditivos forman parte de la solución. El empleo de aditivos especiales en base orgánica, en la línea de los ácidos policarboxílicos como base, permite estas dos consignas indicadas (García Santos, 2004). Estamos por lo tanto en un antes y un después en el uso de yeso como material a aplicar en multitud de aplicaciones tal y como se ha expuesto. El objetivo de este estudio, es el de conferir al “mortero”, de una resistencia adicional mecánica y de ductilidad. Es evidente pues, que la aportación de fibras de cualquier tipo que adhieran bien a la matriz, conferirá un aumento de dicha propiedad mecánica; pero la cantidad y el tamaño de dichas fibras serán objeto de estudio para determinar cual es el % y longitud ideal para que el comportamiento sea optimo.

Material y Métodos Se ha utilizado yeso moreno (yeso de construcción B1/8/2) y agua de la red para el amasado, a la que se ha añadido un retardante de fraguado líquido de tipo orgánico (llamado ADIFOC) para permitir una mayor manejabilidad del yeso (relación A/Y = 0,5) con el objeto de no perjudicar su capacidad resistente. Se fija la cantidad de aditivo en el 3‰ del peso de agua o 1,5‰ si referimos al peso de yeso; esto confiere tiempo suficiente para mezclar la fibra y verter el mortero en los moldes normalizados, y como ya se ha indicado como elmento de refuerzo, fibra de carbono para la unión de la matriz (Muñoz, 2011). La fibra de carbono constituye el objetivo principal de este trabajo, suministrada en forma de bobina; siendo la tabla 1, la define la referencia del ensayo, así como porcentaje y longitud de dicha fibra. LONGITUD FIBRA 12 mm

25 mm

32 mm

PORCENTAJE 0,25% 0,50% 0,75% 1,50% 0,25% 0,50% 0,75% 1,50%

PESO 6,25 gr 12,50 gr 18.75 gr 37,50 gr

IDENTIFICACION ENSAYO C1 C2 C3 C4

6,25 gr 12,50 gr 18.75 gr 37,50 gr

C5 C6 C7 C8

0,25% 0,50%

6,25 gr 12,50 gr

C9 C10

502


18.75 gr 37,50 gr

0,75% 1,50%

C11 C12

6,25 gr C13 0,25% 12,50 gr C14 0,50% 50 mm 18.75 gr C15 0,75% 37,50 gr C16 1,50% Tabla 1. Tamaños, proporciones, cantidad de la fibra por cada 2.5 kg de yeso y nomenclatura empleada.

Se ha escogido como muestra de referencia los resultados de la Suficiencia de Investigación del Ingeniero D. Luis Moneo (Moneo, 2011). Los datos son del yeso aditivado a un 1,5‰ de ADIFOC para poder compararlos con los obtenidos en este ensayo y de esta manera analizar como influye en los resultados la aportación de dicha la fibra de carbono, así como de su longitud. ‰

Dureza

Muestra

Shore 1,5‰

Y1

Flexión 2

N/mm

M. Elasticidad

Densidad 3

kg/m

86,56 5,14 657,62 1310,903 Tabla 2. Datos de yeso aditivado a un 1,5‰ de peso de yeso

Compresión N/mm2 12,18

Se han ensayado para cada lote, un número de 8 probetas de 160x40x40mm por ensayo; obteniendo datos de peso, resistencia a flexión y módulo de elasticidad, a partir de la máquina universal de ensayos. El método adaoptado, es el definido por la Norma UNE-EN 196-1. Para conocer los valores de resistencia a la penetración en superficie, o dureza, se ha empleado el método Shore, con un aparato de la escala C, según recomienda también dicha norma UNE-EN132792. Siguiendo el protocolo normalizado, se realizan las amasadas de yeso, y el posterior llenado de los moldes, donde previamente se han colocado las cañas para cada uno de los diseños que se pretenden ensayar (4 probetas por diseño y dos repeticiones). Una vez fraguadas se desmoldan, secan y guardan conforme a la norma, hasta su ensayo. Los resultados han sido tratados estadísticamente por diversos métodos: para calcular el tamaño se ha empleado la fórmula simplificada de Cochran et al. (1991). Se han calculado parámetros muestrales descriptivos para cada serie (media, desviación típica y coeficiente de variación). La detección de los valores atípicos se ha realizado mediante diagramas de caja. El ajuste a normalidad de cada serie, con métodos gráficos (curva normal sobre diagrama de frecuencia y funciones transformadas Q-Q normales) y mediante prueba K-S con significación del 95%. Para garantizar la relación entre factores y variables dependientes, se ha empleado el ANOVA al 95% de significación para varianzas iguales entre series, y la prueba robusta de Welch, cuando aquellas son diferentes, con igual significación. Las comparaciones de series dos a dos se ha realizado mediante el test de comparaciones múltiples de Tukey, y el estudio de comportamientos semejantes, mediante el análisis de Tukey-Duncan.

Resultados y Discusión A continuación se muestran las tablas comparativas en relación a la longitud del corte y al tanto por ciento utilizado en los distintos ensayos. Esta comparación, permitirá obtener que porcentaje y longitud de fibra obtiene un valor óptimo en el resultado del mortero.

503


Foto 1. Lote de probetas.

Se pretende logar: por un lado la disminución del peso de este tipo de morteros (que irá evidentemente relacionado con los gramos de aportación de fibra a la masa), así como el aumento de la resistencia mecánica, fundamentalmente a flexión. En las graficas siguientes, se comparan los resultados obtenidos con la referencia Y1 de yeso aditivado sin aportación de fibras. DUREZA SHORE 94 92

Y1

92,9 91,71 90,81 89,71

90

91,21

89,29

88,98

88,42

87,67

88

88,88 87,88

88,5 87,77

85,96

86

84,81

84,63

84 82 80 C1

C2

C3

C4

C5

C6

C7

C8

C9

C10

C11

C12

C13

C14

C15

C16

Gráfico 1. Resultados comparativos de la dureza Shore C.

Se observan en el grafico 1, como hay valores por debajo de la referencia. Dichos valores atípicos, corresponden a amasadas con problemas de dispersión, bien por la cantidad o por una longitud excesiva. La mayor dureza, se obtiene en el ensayo C5 con tamaño de fibra de 25 mm y proporción de la misma de 0,25%, la serie C5, C6, C7, destaca del resto.

FLEXION 10 9 8 7 6 5 4 3 2 1 0

Y1 9,12

8,17 7,05

7,6

7,18

6,33

6,11

8,64

8,38

8,12

7,37 6,38

6,22

5,79

5,71 4,66

C1

C2

C3

C4

C5

C6

C7

C8

C9

C10

C11

C12

C13

C14

C15

C16

Gráfico 2. Resultados comparativos de flexión.

El ensayo de rotura de probatas a flexión, observamos que las C4, C8, C12, C14, C16 destacan del resto y corresponde a la mayor aportación de fibras. A excepción del ensayo C9 (de longitud de fibra 32mm y porcentaje de 0.25%) todos están por encima del yeso aditivado sin fibras

504


MODULO DE ELASTICIDAD 800

Y1

735,53 683,01 692,43

700 600 500

517,51

490,15

458,92

655,95 546,46

531,24

528,02 471,05 420,48

429,96

C10

C11

467,23 395,35

365,64

400 300 200 100 0 C1

C2

C3

C4

C5

C6

C7

C8

C9

C12

C13

C14

C15

C16

Gráfico 3. Resultados comparativos del módulo de elasticidad.

Se consigue mejorar el módulo de elasticidad levemente en los ensayos C3, C4, C7 y C8, sin embargo el yeso aditivado sin fibras está por encima de la mayoría de ensayos, no siendo significativo este valor en comparación con la referencia. DENSIDAD

Y1

13500 13114,67

13000

12919,89

12930,36

12812,81

12634,87 12419,74

12500

12525,83 12481,32 12467,81

12581,5 12381,99

12430,5 12501,29 12371,31

12078,98

12000 11500

11215,4

11000 10500 10000 C1

C2

C3

C4

C5

C6

C7

C8

C9

C10

C11

C12 C13

C14

C15

C16

Gráfico 4. Resultados comparativos de densidad.

La reducción de la densidad es redundante. Cuanta mayor cantidad de fibra, menor peso. Si se observan como contrariedad resultados dispersos que sirven para fijar criterios de trabajo y que se deben a restos de fibras perdidos en el ensayo; siendo mayoritariamente provocados por las longitudes de corte excesivas. El resultado que mejor comportamiento a flexión ha dado, es 9,12 N/mm2, con 32 mm y 1.50% de aportación, ensayo C12. Valor que destaca del resto. Se indican para esta longitud (Grafico 5) la evolución así como la regresión de los resultados del ensayo: Dureza Shore

Y1

Lineal (Dureza Shore)

Flexión N/mm2

89 C10; 87,88

88

Y1

Lineal (Flexión N/mm2)

10

C12; 9,12

9

C9; 88,42 8

87

7

86,56

C10; 5,71 C11; 6,22

6

86 C11; 85,96

5

85

C9; 4,66

5,14

4

C12; 84,81 3

84 83

y = 1,389x + 2,955 R2 = 0,8825

2

y = -1,275x + 89,955 R2 = 0,9616

1

82

0

C9

C10

C11

C12

C9

C10

C11

C12

Gráfico 5. Resultados para longitud de 32mm, de dureza y resistencia a flexión.

505


Conclusiones •

La longitud de 50 mm es muy difícil de manejar, estando fuera de la trabajabilidad del mortero. No se debe usar este tamaño para conseguir resultados de resistencia homogéneos salvo que se modifiquen las condiciones de mezcla y amasado.

La longitud de 32 mm, es el que mejor resultado ha ofrecido en el análisis de resistencia.

El tamaño de corte de 25 mm, ofrece resultados ligeramente menores que el de 32 mm, pero aporta una mejor trabajabilidad, entendiendo como conclusión que es la que debiera emplearse industrialmente al mortero para aumentar su resistencia mecánica.

La aportación de fibras de carbono, hace aumentar la resistencia mecánica a flexión en comparación con el yeso aditivado, de 5 N/mm2 a valores de hasta 9.12 N/mm2. El yeso sin aditivar, está en valores de 2-3 N/mm2.

Bibliografía AENOR. (2012). Recopilación de normas. UNE 13.279-2; 2006.1, UNE 196-1. Arredondo, F. (1961). Materiales de construcción: II.- el yeso. Instituto Eduardo Torroja. Madrid BS 1191: part. 2. (1973). Gypsum building plasters. Premixed ligtweiht plasters. Foster, N. (1964). Yesos aligerados. Conferencia en el IV Congreso de Eurogypsum. Madrid Actas del Congreso. García Figuereo, July Altagracia (2011). Incorporación de la cáscara de mejillón en el yeso y el mortero. Trabajo fin de Máster. García Santos (2004). Informes de la Construcción, Vol 56, No 493 (2004). Caracterización de compuestos de escayola reforzados, en relación con el tipo de refuerzo y la relación A/Y. Moneo, L. (2011). Análisis y evaluación de aditivos para aplicación al sulfato cálcico. Suficiencia Investigadora. Novo de Miguel, Luciano. (1970). El yeso en la construcción. España, Ediciones CEAC, S.A.

506


Experimental determination of the pressures exerted by wheat stored in silos under different conditions of discharge. (Determinación experimental de los empujes del trigo almacenado en silos bajo diferentes condiciones de descarga) A. Couto1, A. Ruiz1, A. Tascón2, L. Herráez1, P. Aguado1 1

1 Department of Agricultural Engineering and Sciences, ESTI Agricultural, University of Leon, Av. Portugal 41, 24071 León, Spain. E-mail: acouy@unileon.es. 2 Departamento de Agricultura y Alimentación, Universidad de La Rioja, Av. Madre de Dios 51, 26006, Logroño, Spain.

Resumen En esta comunicación se describe el resultado y conclusiones de los trabajos realizados en una estación de ensayo de presiones en silos a tamaño real. Se ensaya con trigo, obteniendo resultados de las presiones durante el llenado, en estado estático y durante la descarga, además, se estudia la evolución de las presiones en el tiempo al detener la descarga. Los resultados obtenidos se comparan con el Eurocódigo 1, parte IV. De los resultados obtenidos se concluye que las presiones en el interior del silo en estado estático no son constantes y que la variación del flujo durante la descarga no lleva asociado una variación de presiones. También se concluye que el estado de sobrepresiones durante la descarga se debe fundamentalmente a la compactación del material en determinadas zonas del silo y en mucha menor medida a la dilatancia. Además, los valores de presiones obtenidos durante la descarga superaron en algunos casos al método de cálculo propuesto por el Eurocodigo 1, Parte 4. Palabras clave: Ensayos en silos, Presiones en silos, Almacenamiento de trigo, Variación en el flujo de descarga

Experimental determination of the pressures exerted by wheat stored in silos under different conditions of discharge. Abstract In this article, we report the results and conclusions of studies conducted using a mid- size test station for assaying pressures in silos. Assays were conducted with wheat, obtaining results for pressures during loading, in static state and during discharge. In addition, different flow rates (kg/s) of the granular material were tested during discharge. The results obtained were compared with Eurocode 1, Part 4. The results obtained indicate that in static state, the pressures inside the silo are not constant, and that varying the flow rate during discharge does not entail an associated variation in pressures. They also show that the state of overpressure during discharge is mainly due to an increment in the unit weight of the material in certain areas of the silo and, to a much lesser extent, to dilatancy. Furthermore, the pressure values obtained during discharge were higher than those obtained using the calculation method proposed in Eurocode 1, part 4. Keywords: maximun Test silo, Silo pressures, Wheat storage, Discharge flow variation

507


Introduction The question of calculating actions in silos used for the storage of particulate solids in order to determine their correct structural design has been a subject of enquiry since the end of the 19th century (Janssen, 1895) . Since then, many advances in knowledge have been made but numerous aspects of silo structural design still remain unresolved (Ayuga, 2008; Dogangun et al., 2009; Nielsen, 2008). It is well known that the highest thrust forces are exerted on the walls during silo discharge (Askegaard and Munch-Andersen, 1985; Ayuga et al., 2001; CEN, 2006; Härtl et al., 2008; Ramirez et al., 2010; Zhong et al., 2001). However, despite the numerous studies which have been conducted, determining pressure during discharge continues to present considerable difficulties because this is a complex phenomenon that depends on how the material flows as well as other parameters such as initial solid volumetric weight, wall roughness, etc. (Chen et al., 2007; Jenike and Johanson, 1969). In this article, we present the results of several assays conducted using an experimental cylindrical silo to determine the thrust forces exerted by the stored material on the walls. The material employed was common wheat (Triticum aestivum), using the variety Galera R2, produced and registered in Spain in 1999 by the company NICKERSON GEIE. Assays were performed in static state and during discharge, analysing the influence of variations in the flow rate (kg/s) of material during unloading. We also tested the effect of partial discharges on pressures. The results were compared with values obtained using the European standard for calculating actions in silos (CEN, 2006).

Materials and methods The geometry and dimensions of the test silo are shown in Figure 1. The silo is cylindrical, with a central hopper. The silo body (a vertical cylinder) and the hopper independent and can be dismantled.

z

dc=1000 GA7

150

GA6 GA5

ph GA4 GA3

pv GA2 GA1

250 250

hc=2000

250 250 250

pw

250

zt

pn

GA0

β=34.3|

ht =480 h =738

e0=0

h

x dh=350

Figure 1. Symbology, dimensions and points of measurement of normal wall pressures of the test silo.

508


To measure normal wall pressures, a vertical generatrix was located on the cylinder wall, along which 7 readings were taken at the different heights indicated in Figures 1, whilst hopper pressures were measured immediately below the silo-hopper transition, at the prolongation of the generatrix mentioned above for measuring cylinder pressures. In order to measure vertical forces caused by friction of the stored material against the wall, the cylinder and hopper were connected by mounting the external reinforcing rings of each on the tension/compression load cells. The rings were very close but did not come into contact, and thus all vertical pressures were absorbed by the load cells. More detailed information is provided in the two articles cited above (Couto et al., 2012; Ruiz et al., 2012). Tests were conducted using common wheat (Triticum aestivum), Galera R2 variety, with a minimum purity of 98%. The properties of this material were previously determined experimentally in the School of Agricultural Engineering (E.S.T.I.A.) laboratories in accordance with test methods proposed in Eurocode 1, part 4 Annex C (CEN, 2006). The values obtained were: specific weight, 8,4 kN/m3 ), angle of repose, 34.22ยบ; steel wall friction coefficient, 0.20, and humidity, 10.3%. Using the granular material described above, 13 assays were conducted, consisting of central loading and discharge of the silo. In assays, a small amount of stored material, between 1.7% and 3.2% of the total, was discharged before halting the process. The grain was thus returned to static state before finally emptying the silo completely. The grain flow rate (kg/s) was varied four outlet gate opening positions were used.

Results and discussion Figure 2 shows the shape of the curves obtained, the shape of the curves obtained for each assay was similar, and only the dwell time in each of the static-discharge stages and the maximum and minimum values attained varied. Thus, in order to avoid an excessive number of figures, only the curves corresponding to one assay are shown. This Figure 2 shows that in static state, the vertical stress in the stored material at the level of the silohopper transition increased over time, as did the normal hopper wall pressure. The opposite occurred in the case of normal cylinder wall pressures, as these decreased over time. In other words, in static state the cylinder walls discharged their load, increasing the weight resting on the hopper, and this was due to resettling of the grain in the silo, a phenomenon which has already been discussed in more detail in a previous publication (Ruiz et al., 2012). The curves shown also indicate that once the initial discharge was halted, lateral pressures during the second static phase did not return to the previous static state values. This phenomenon should be borne in mind when developing new numerical theories and methods for calculating pressures during silo discharge since it indicates that the movement of material within the silo during the initial discharge induces changes in solid unit weight, which increases or decreases in certain areas along the height of the silo, and the main variations in pressure that occur inside the silo are primarily due to this phenomenon rather than to an increase in volume caused by lateral displacement of the particles during discharge, a phenomenon known as dilatancy, since if this latter were responsible, initial values would be recovered once discharge was halted.

509


The normal wall pressure presented a substantial variation at the beginning of the first discharge, however, the variation in pressure following the second discharge was much smaller. Consequently, we believe that this second increase in pressure can be attributed to dilatancy (Couto et al., 2013). Due to an increase in the specific weight of the material during the first discharge, an increase in pressure was registered at GA0 which ranged from 108.1% to 185.6%, and at GA1 from 59.5% and 80.6%, depending on the test in question. The pressure also that increase during the second discharge occurred, attributed to dilatancy, which at GA0 ranged from 1.3% to 18.9% and from 3.1% at GA1 to 25.8%.

Figure 2. Normal silo wall pressures and vertical stress in the stored material at the transition (pvt,t), at each time t.

Figure 3 gives the maximum normal wall pressures in the lower section of the silo (GA0 and GA1) recorded throughout the entire test (maximum for both discharges), for each discharge flow rate. Pressures on the hopper wall (GA0) decreased linearly as the discharge rate increased (r2=0.423), whereas pressures in the cylinder (GA1) remained virtually constant, independently of the rate of discharge, it is therefore concluded that a slow discharge does not imply lower pressures than those produced during a rapid discharge. In Figure 4, the normal wall pressures obtained in the assays are compared with Eurocode 1, Part 4 (CEN, 2006). This figure shows the maximum pressures obtained in discharge phase assays throughout the entire test. As can be seen, during discharge, the normal cylinder wall pressure at the level of the silo-hopper transition obtained in the assays was always below that given in the Eurocode. However, at the same level, the normal hopper wall pressures exceeded those given in the Eurocode in 2 of the tests, reaching a value greater than 11.56% with respect to the calculation method proposed in the Eurocode.

510


Figure 3. Regression lines obtained from the maximum normal pressures on the cylinder wall and the hopper wall at the silo-hopper transition registered during the assays (discharge 1 and discharge 2), for each discharge flow rate.

Figure 4. Maximum values of normal wall pressures obtained during discharge throughout the entire test, compared with Eurocode 1, part 4.

Conclusions Pressures were not constant in the static state, since the grain underwent a process of resettling at increasingly wider spaced intervals. In contrast to other tests, in the assays conducted, a reduced flow rate (kg/s) of the granular material during discharge did not entail an associated decrease in pressures on the silo wall, but rather the opposite. At the beginning of discharge, the granular material underwent a process of variation in unit weight, where unit weight increased in some areas more than others or even decreased, and it was this effect

511


which was primarily responsible for the variations in pressure inside the silo during discharge. Even if discharge was halted at this point, the silo did not recover the previous pressure values, and attained a state of overpressure similar to that produced when complete discharge was effected in a single step. Once the material had reached a certain degree of unit weight, which could be called "critical", variations in pressure during discharge were due to the phenomenon known as dilatancy, i.e., the increase in volume caused by dilatancy in a vertical direction due to the presence of stiff walls. During discharge, the normal hopper wall pressures at the level of the silo-hopper transition can exceed those obtained using the calculation method proposed in the Eurocode 1, part 4.

Acknowledgements The authors thank the Spanish Research and Technology Commission (CICYT) (Research Project AGL2005-07430-C02-01/AGR) and the Regional Executive of Castile and León (Research Project LE020A10-2) for financing this research.

References Askegaard, V., and Munch-Andersen, J. (1985). Results from tests with normal and shear stress cells in a medium-scale model silo. Powder Technology 44, 151-157. Ayuga, F. (2008). "Some unresolved problems in the design of steel cylindrical silos," Crc Press-Taylor & Francis Group, Boca Raton. Ayuga, F., Guaita, M., Aguado, P. J., and Couto, A. (2001). Discharge and the eccentricity of the hopper influence on the silo wall pressures. Journal of Engineering Mechanics-Asce 127, 1067-1074. CEN (2006). EN 1991-4:2006. Eurocode 1: Actions on structures. Part 4: Silos and Tanks. European Committee for Standardization. Brussels. Chen, J. F., Rotter, J. M., Ooi, J. Y., and Zhong, Z. (2007). Correlation between the flow pattern and wall pressures in a full scale experimental silo. Engineering Structures 29, 2308-2320. Couto, A., Ruiz, A., and Aguado, P. J. (2012). Design and instrumentation of a mid-size test station for measuring static and dynamic pressures in silos under different conditions – Part I: Description. Computers and Electronics in Agriculture 85, 164-173. Couto, A., Ruiz, A., and Aguado, P. J. (2013). Experimental study of the pressures exerted by wheat stored in slender cylindrical silos, varying the flow rate of material during discharge. Comparison with Eurocode 1 part 4. Powder Technology 237, 450-467. Dogangun, A., Karaca, Z., Durmus, A., and Sezen, H. (2009). Cause of Damage and Failures in Silo Structures. Journal of Performance of Constructed Facilities 23, 65-71. Härtl, J., Ooi, J. Y., Rotter, J. M., Wojcik, M., Ding, S., and Enstad, G. G. (2008). The influence of a cone-incone insert on flow pattern and wall pressure in a full-scale silo. Chemical Engineering Research and Design 86, 370-378. Janssen, H. A. (1895). Versuch über Getreidedruck in Sillozellen. Zeitschrift des Vereins Deutscher Ingenieure 39, 1045-1049. Jenike, A. W., and Johanson, J. R. (1969). ON THEORY OF BIN LOADS. Mechanical Engineering 91, 43-&. Nielsen, J. (2008). "From silo phenomena to load models." Ramirez, A., Nielsen, J., and Ayuga, F. (2010). Pressure measurements in steel silos with eccentric hoppers. Powder Technology 201, 7-20. Ruiz, A., Couto, A., and Aguado, P. J. (2012). Design and instrumentation of a mid-size test station for measuring static and dynamic pressures in silos under different conditions – Part II: Construction and validation. Computers and Electronics in Agriculture 85, 174-187. Zhong, Z., Ooi, J. Y., and Rotter, J. M. (2001). The sensitivity of silo flow and wall stresses to filling method. Engineering Structures 23, 756-767.

512


Estudio del uso de equipos de protección individual (EPI) en invernaderos de Galicia M. Barrasa1, S. Lamosa, J. Maciñeiras, I. Piñeiro 1

Escuela Politécnica Superior, Campus Universitario de Lugo, 27002 Lugo martin.barrasa@usc.es

Resumen La utilización de productos fitosanitarios en el sector agrícola tiene una gran relevancia en los cultivos en invernadero y la exposición a los mismos de todas las personas que intervienen en el proceso productivo es evidente. Por eso, las condiciones de trabajo en los invernaderos de Galicia constituyen un objetivo prioritario en los contenidos y actuaciones que abordan los diversos estudios para tratar de reducir la siniestralidad laboral y mejorar las condiciones de vida de las personas ligadas a esa actividad. Uno de los aspectos clave para poder mejorar las condiciones de trabajo y reducir la siniestralidad laboral en los invernaderos es el uso de los equipos de protección individual. El ambiente cerrado de los invernaderos conlleva mayores riesgos de exposición a los productos fitosanitarios, así como las temperaturas elevadas que se alcanzan en el interior de los mismos favorecen el uso inadecuado de los Equipos de Protección Individual (EPI) debido a la incomodidad que supone el trabajar con ellos a dichas temperaturas. El RD 1407/1992, el RD 773/1997 y la Ley 31/1995 regulan la obligatoriedad del empleo de Equipos de Protección Individual certificados y con marcado CE en los trabajos donde la emisión de contaminantes no esté controlada, siendo adecuados a los riesgos definidos en cada proceso. La formación específica del agricultor propicia una mayor concienciación del sujeto, así como el correcto empleo de los EPI adecuados. La Ley 31/1995 establece que el empresario deberá garantizar que cada trabajador reciba una formación teórica y práctica, suficiente y adecuada, en materia preventiva. En la Orden de 8 de Marzo de 1994 se establecen las normativas reguladoras de la homologación de cursos de capacitación para realizar tratamientos con fitosanitarios. El objetivo de este estudio es conocer a través de la realización de encuestas los equipos de protección individual existentes en los invernaderos de Galicia para la realización de los tratamientos, el uso de los mismos y los conocimientos que los manipuladores poseen sobre estos equipos. Palabras clave: Invernadero, fitosanitario, EPI

Study of the use of personal protective equipment (PPE) in greenhouses of Galicia Abstract Pesticide use in agriculture has great relevance in greenhouse cultivation. Accordingly, exposure to pesticides cannot be avoided by the workers involved in the production process. For this reason, the working conditions in the greenhouses of Galicia have been a major concern for researchers, as evidenced by the content and actions proposed in many studies aimed at reducing workplace accidents and improving the living conditions of the people linked to pesticide handling. One of the key factors in the improvement of working conditions and the reduction of accidents in greenhouses is the use of personal protective equipment (PPE). The closed environment of greenhouses involves greater risks from pesticide exposure, and the high temperatures reached inside greenhouses favour inappropriate use of PPE due to lack of comfort when wearing the equipment at such high temperatures. Spanish Royal Decrees RD 1407/1992 and RD 773/1997 and Spanish Law 31/1995 govern the mandatory use of Personal Protective Equipment certified with CE labels on jobs where polluting emissions are not controlled, being appropriate to the risks defined in each process.

513


Specific training for farmers leads to greater awareness of risks and to proper use of appropriate PPE. Spanish law 31/1995 envisages that the employer shall ensure that every worker receives adequate and appropriate training and education in prevention. Order of March 8, 1994 establishes the regulations for the approval of training courses for performing pesticide treatments. The aim of this study is to determine through surveys what personal protective equipment is used to perform treatments in the greenhouses of Galicia, how PPE is used, and the amount of knowledge than handlers have of PPE. Keywords: Greenhouse, pesticide, PPE

Introducción y/o Justificación La superficie mundial cubierta por algún tipo de protección varía entre 4 e 5 millones de hectáreas. Dejando de lado la protección de tipo acolchado, cubiertas y túneles bajos y centrándonos en invernaderos de plástico más o menos tecnificados, a escala mundial la superficie actual supera las 450.000 hectáreas. En Europa, España es el país que consta con una mayor superficie de invernaderos con 52.723 ha agrupadas en 31.618 explotaciones según datos del anuario de estadística (Ministerio de Medio Ambiente y Medio Rural y Marino, 2010). Esta superficie se concentra fundamentalmente en la zona de Levante (Andalucía, Murcia y Valencia). Según los datos de este anuario la superficie cultivada bajo invernadero en el territorio gallego es de 210 ha agrupadas en 2034 explotaciones. El constante crecimiento y la tecnificación del sector, provoco en los últimos años un aumento de la calidad y competitividad de los productos en el mercado, resultando indispensable el empleo de fitosanitarios en el control de las plagas y enfermedades. Los beneficios que estos productos tienen sobre la calidad de las cosechas y las producciones de las mismas son conocidos, pero su aplicación lleva asociada impactos sobre la salud y el medio ambiente; problemas que se agudizan más en la agricultura intensiva bajo plástico, donde las condiciones ambientales favorecen el desarrollo de enfermedades y plagas y por tanto el uso de este tipo de productos es muy frecuente. Por este motivo bajo los invernaderos es especialmente importante el uso de Equipos de Protección Individual (EPI) para prevenir los posibles impactos de los fitosanitarios sobre la salud de los trabajadores. Así este trabajo tratará de poner de manifiesto los conocimientos, actitudes y prácticas de los manipuladores de fitosanitarios en los invernaderos de Galicia en lo que se refiere al uso de Equipos de Protección Individual.

Material y Métodos Se partió del directorio de hortofruticultura proporcionado por la Consellería do Medio Rural (Xunta de Galicia) en el que figuraban 1260 explotaciones con superficie igual o mayor a 500 m . Estas explotaciones se clasificaron según su superficie en cuatro estratos: •

E1: explotaciones entre 500-1000 m

E2: explotaciones entre 1000-2000 m

E31: explotaciones entre 2000-5000 m

E32: explotaciones con más de 5000 m

Atendiendo a esta clasificación, el 46% de las explotaciones se sitúan en el estrato E1, un 33% en el E2, el 17% en el E31 y el 4% en el E32. Para determinar el tamaño muestral, se admite un error del 5%, para un nivel de confianza del 95%, obteniéndose un tamaño muestral de 304, lo que supone encuestar el 24% de los invernaderos gallegos.

514


Dentro de cada provincia, en las que se divide la comunidad autónoma gallega, el muestreo que se aplica es estratificado unietápico, definiéndose los estratos en función de la superficie que ocupan los invernaderos como se fijó en la población, empleándose para la construcción de los estratos el procedimiento propuesto por Dalenius y Hodges (1959). En cada provincia, dentro de cada estrato, los invernaderos fueron seleccionados con probabilidad proporcional a su tamaño toda vez que el marco que se empleó para la extracción de la muestra fue el directorio de hortofloricultura de la Consejería de Medio Rural de la Xunta de Galicia. Una vez seleccionadas las explotaciones, se procedió a contactar con los manipuladores de las mismas con la finalidad de poder ir a las explotaciones y encuestarlos. El cuestionario estaba constituido por 71 preguntas distribuidas en IX bloques. Para el diseño del mismo nos basamos en otras encuestas muy conocidas como la Encuesta Nacional de Condiciones de Trabajo (Almodóvar, A. y Pinilla, F.J., 2007) y la Encuesta Nacional de Condiciones de Trabajo en el Sector Agropecuario (Almodóvar, A., Pinilla, F. J. y Giner, N., 2009)

Las encuestas se realizaron entre abril y septiembre del año 2009. Los datos obtenidos fueron sometidos a un análisis con el programa estadístico SPSS 15.0, donde se realizaron básicamente análisis de frecuencias, tablas de contingencia y estadísticos básicos para la realización de un trabajo descriptivo. Para la elaboración final de tablas y gráficos se empleó Excel en su versión 2010.

Resultados y Discusión Al analizar la utilización de los equipos de protección durante a manipulación encontramos que un 96,4% de los manipuladores principales encuestados pone algún EPI antes de la manipulación de los productos, frente a tan sólo un 3,6% que reconoce no utilizar ninguno. Sin embargo al terminar de manipular los plaguicidas el porcentaje de manipuladores principales encuestados que no quita los EPI asciende a 20,9%, esto es debido principalmente a que al terminar la manipulación /aplicación de fitosanitarios siguen trabajando con el mismo calzado.

Figura 1. Utilización de EPI por los manipuladores principales.

En la encuesta se consideraron como EPI para el manejo de los fitosanitarios los guantes, el traje / mono, la protección ocular, el mandil, las botas, el gorro, la protección respiratoria y otros EPI a través de preguntas con cuatro categorías de respuesta, nunca, poco, bastante y siempre. Se evaluaron los siguientes aspectos para los EPI: disponibilidad, empleo, marcado CE, lectura de las instrucciones, revisión periódica del funcionamiento, conocimiento y fechas de caducidad y renovación por caducidad. En la gráfica anterior puede verse como la disponibilidad de guantes, botas y protección respiratoria es elevada superando siempre el 90%. En la mitad de los casos se dispone de traje / mono, protección ocular, gorro y otros EPI.

515


Figura 2. Disponibilidad de distintos EPI por los manipuladores principales.

Por norma general cuando el trabajador dispone de EPI los utiliza obteniéndose porcentajes de uso superiores el 75% en todos los equipos analizados excepto en la protección ocular y en el gorro que generalmente no se usan o se emplean con poca frecuencia. En la gráfica siguiente se muestra el porcentaje de utilización de cada uno de los EPI analizados. Puede verse como todos los manipuladores que disponen de mandil lo utilizan y se supera el porcentaje de utilización del 90% para la protección respiratoria y los guantes.

Figura 3. Uso de EPI por los manipuladores principales que disponen de ellos bastantes veces o siempre.

En la tabla 1 se muestra la disponibilidad y el uso de EPI según los estratos que caracterizan el tamaño de explotación agrupando las categorías de respuesta bastante y siempre. Tabla 1. Disponibilidad y uso de EPI por estratos. Categorías de respuesta bastante y siempre EPI Guantes Traje/Mono P. Ocular Mandil Botas Gorro P. Respiratoria Otros

E1 99,0 43,8 44,8 93,8 45,8 96,9 41,7

Disponibilidad EPI E2 E31 98,1 97,7 57,5 56,8 50,9 47,7 3,8 1,1 97,2 93,2 53,8 58,0 97,2 96,6 38,1 48,9

E32 100,0 50,0 41,7

E1 92,6 69,0 48,8

100,0 16,7 100,0 50,0

82,2 81,8 94,6 90,0

Uso de EPI E2 E31 95,2 97,7 83,6 86,0 38,9 52,4 100,0 100,0 78,6 87,8 64,9 76,5 95,1 95,3 90,0 88,4

E32 91,7 100,0 60,0 75,0 50,0 100,0 83,3

516


Como se puede observar no existen variaciones importantes en los EPI disponibles siendo los disponibles en mayor frecuencia para todos los estratos los guantes, las botas y la protección respiratoria. En lo que se refiere a la utilización, las diferencias vuelven a ser mínimas aunque en las explotaciones de mayor tamaño los porcentajes de uso son algo superiores. Los EPI más usados en todos los estratos vuelven a ser los mandiles, guantes y protección respiratoria. La lectura de las instrucciones facilita el uso adecuado de los EPI. Generalmente los manipuladores que leen las instrucciones normalmente lo hacen la primera vez que usan ese equipo de protección individual. Aún así los porcentajes de trabajadores que leen las instrucciones de los EPI son muy bajos, con porcentajes de trabajadores que nunca las leen superiores al 50% para todos los equipos excepto para la protección respiratoria.

Figura 4. Lectura de instrucciones de EPI por los manipuladores que los usan bastante o siempre.

En cuanto a la revisión de los EPI antes de la utilización para poder garantizar la seguridad del manipulador se observan porcentajes bastante bajos. Los mayores porcentajes de revisión se obtienen como muestra la gráfica para la protección respiratoria y otros EPI.

Figura 5. Revisión de EPI por los manipuladores que los usan bastante o siempre.

La homologación de los EPI garantiza su funcionalidad. La mayoría de los manipuladores encuestados afirmaron que los equipos empleados poseían el marcado CE, aunque en equipos como el mandil, o el gorro desconocían esta cuestión. Los EPI que alcanzan mayores porcentajes de marcado CE son los protectores oculares y respiratorios, seguidos de los guantes, el traje el mono y las botas.

517


Respecto al conocimiento de la caducidad de los EPI usados los datos son bajísimos no superando para ningún equipo el 10%. La renovación de los EPI en función de esta fecha se cumple en un tercio de los casos para guantes, protección respiratoria y traje/mono bajando en el resto de los casos a valores menores del 10%. Tabla 2. Marcado CE y caducidad en manipuladores que usan EPI. Categorías de respuesta bastante y siempre

Guantes Traje/Mono P. Ocular Mandil Botas Gorro P. Respiratoria Otros

Marcado CE Siempre Nunca 97,2 2,8 92,8 7,2 100,0 0,0 20,0 80,0 87,2 12,8 38,4 61,6 100,0 0,0 48,8 51,2

Conocimiento caducidad Siempre Nunca 6,4 93,6 6,2 93,8 6,1 93,9 100,0 4,3 95,7 1,8 98,2 5,4 94,6 0,9 99,1

Renovación por caducidad Siempre Nunca 29,1 70,9 33,3 66,7 12,1 87,9 100,0 5,1 94,9 1,8 98,2 40,0 60,0 2,6 97,4

Conclusiones Más de un 95% de los manipuladores principales encuestados pone algún EPI antes da manipulación sin embargo un 20% reconoce que no se quita los EPI tras la manipulación debido a que siguen trabajando con el mismo calzado. La disponibilidad de EPI es elevada alcanzando porcentajes superiores al 90% para guantes, botas y protección respiratoria. La utilización de los EPI es superior al 75% para todos los EPI estudiados excepto para la protección ocular y el gorro que generalmente no se usan o se emplean con poca frecuencia por la incomodidad de los mismos en el invernadero. Los EPI más usados son la protección respiratoria y los guantes. No se observaron grandes diferencias de disponibilidad ni uso de EPI según el tamaño de explotación. El porcentaje de encuestados que afirma que los equipos de protección disponen de marcado CE es superior al 90% para guantes, mono, protección ocular y protección respiratoria y alcanza el 87% en el caso de las botas. Afirman leer las instrucciones de los equipos un porcentaje de manipuladores principales bastante bajo no superándose el 40% para ningún equipo y los equipos que se revisan periódicamente con mayor frecuencia son las protecciones respiratorias, mono, guantes y botas con valores próximos al 60%. El conocimiento de las fechas de caducidad de los equipos de protección es realmente bajo no superando el valor del 10% para ninguno de los equipos estudiados. En lo referente a la renovación de equipos según la caducidad de los mismos se vuelven a obtener valores bajos no superándose el 40% en ningún caso.

Bibliografía Almodóvar, A. y Pinilla, F.J. (2007). IV “Encuesta Nacional de Condiciones de Trabajo”. Ministerio de Trabajo y Asuntos Sociales y. Instituto Nacional de Seguridad e Higiene en el Trabajo. Madrid. Almodóvar, A., Pinilla, F. J. y Giner, N. (2009). “Encuesta Nacional de Condiciones de Trabajo en el Sector Agropecuario”. Instituto Nacional de Seguridad e Higiene en el Trabajo. Ministerio de Trabajo e Inmigración. Madrid. Dalenius, T. y Hodges, J. L. (1959) “Minimum Variance Stratification”. Journal of American Statistical Association, P. 1959. Ministerio de Medio Ambiente y Medio Rural y Marino. (2010). “Anuario de estadística 2009”. Madrid.

518


Estudio de los accidentes mortales en el sector agrario de Galicia desde el 2004 al 2010 M. Barrasa1, S. Lamosa, J. Maciñeiras, I. Piñeiro 1

Escuela Politécnica Superior, Campus Universitario de Lugo, 27002 Lugo martin.barrasa@usc.es

Resumen Las especiales características del sector agrario, donde se realizan multitud de tareas, empleando una gran variedad de maquinaria, que va desde la más rudimentaria a la más avanzada, unido muchas veces, a una baja cualificación de los trabajadores, el desconocimiento de las prácticas de seguridad y la inexistencia o el uso inadecuado de equipos de protección, hacen que los riesgos a los que se ven sometidos los trabajadores sean muy elevados y variados. Como consecuencia de todo esto, las tasas de siniestralidad en el sector son muy elevadas, y más si tenemos en cuenta, que en muchas ocasión los accidentes no reúnen los requisitos necesarios para ser considerados como accidentes de trabajo ya que los sufren familiares, colaboradores, personas jubiladas o aquellas que tienen cómo segunda actividad la que se realiza en la agricultura o que simplemente no son notificados a los servicios competentes. El objetivo de este estudio es elaborar un análisis detallado de los partes de accidentes de trabajo mortales en el sector agrario en Galicia en el periodo 2004-2010 analizando diferentes características de los trabajadores, las actividades que llevaban a cabo y las características del accidente. Para llevar a cabo este estudio se usaron los partes de accidentes durante la jornada laboral en el sector agrario en el periodo 2004-2010, proporcionados por el Instituto Gallego de Seguridad y Salud de Galicia (ISSGA). El número de accidentes mortales durante la jornada laboral fue de 30, representando el 4.71% de los totales. Palabras clave: Mortalidad, agricultura, accidente

Study of Fatal Accidents in Agriculture in Galicia between 2004 and 2010 Abstract Agricultural workers are exposed to many and varied risks because of the special characteristics of the agricultural sector, where many tasks are carried out using a wide variety of machinery, from the most rudimentary to the most advanced. In addition, these characteristics are often combined with the use of lowskilled workers, the lack of knowledge of the relevant safety practices and the lack or improper use of protective equipment. As a result, accident rates in the agricultural sector are high, particularly considering that many accidents do not meet the requirements to be considered workplace accidents because they are not reported to the relevant services or because the person involved in the accident is a family member, an employee, a retiree or a person with agriculture as their second activity. The aim of this study is to perform a detailed analysis of the reports of fatal work accidents in the agricultural sector in Galicia for the period 2004-2010. To this end, the characteristics of agricultural workers, the activities performed by those workers and the characteristics of the accident are explored in detail. For the analysis, we used the reports of fatal accidents occurred during working hours in the agricultural Galician sector between 2004 and 2010 provided by the Galician Safety and Health Institute (ISSGA). The number of fatal accidents occurred during working hours was 30, which accounts for 4.71% of the total number of fatal accidents. Keywords: Mortality, agriculturae, accident

519


Introducción y/o Justificación Las especiales características del sector agrario, donde se realizan multitud de tareas, empleando una gran variedad de maquinaria, que va desde la más rudimentaria a la más avanzada, unido muchas veces, a una baja calificación de los trabajadores, el desconocimiento de las prácticas de seguridad y la inexistencia o el uso inadecuado de equipos de protección, hacen que los riesgos a los que se ven expuestos los trabajadores sean muy elevados y variados. Como consecuencia de esta problemática las tasas de siniestralidad en el sector son muy elevadas siendo muy frecuentes los accidentes de trabajo, teniendo estos en algunas ocasiones una elevada gravedad, lo que puede llegar a provocar la muerte del trabajador. Este estudio tiene como objetivo general la realización de un análisis pormenorizado de los partes de accidentes de trabajo mortales en el sector agrario en Galicia para el período 2004-2010 para tratar de conocer las características principales de los accidentes y de los trabajadores afectados, los trabajos realizados y las actividades desencadenantes de los mismos, etc...

Material y Métodos Para realizar el estudio en el sector agrario gallego entendiendo como tal las actividades agrícolas, ganaderas y silvícolas, se emplearon los partes de accidentes graves y mortales del período 2004-2010, facilitados por el Instituto de Seguridade e Saúde Galego (ISSGA). La razón de hacer el estudio desde el año 2004 se debe a que ese año se implanta el Sistema de Declaración Electrónica de Accidentes de Trabajo (Delt@), sistema que permite la presentación de los partes de accidentes por vía electrónica. Antes de realizar la petición de los partes oficiales, se hizo una revisión de todos los campos que forman el parte de accidente, seleccionado aquellos que pueden ser útiles para el estudio. Una vez se obtuvieron los datos, fue necesario realizar una homogeneización de los ficheros proporcionados por el ISSGA, pues a pesar de emplear el mismo modelo de parte desde 2004, los ficheros no poseían los mismos campos ni estaban codificados de la misma manera. En el momento en que se obtuvo un único fichero homogeneizado con los datos del período 20042010, se realiza el tratamiento del mismo con el programa informático SPSS 15.0, haciendo un análisis estadístico descriptivo.

Resultados y Discusión El número total de partes de accidente con baja (grave y mortal) en jornada laboral es de 637, siendo el año de mayor siniestralidad 2004 con 140 partes, disminuyendo a partir de ese momento para alcanzar el mínimo en el 2008 con 56 casos. En los últimos años hay un repunte que quizás pueda deberse a la entrada en vigor de la ley 20/2007 del 11 de julio “Del estatuto del trabajo autónomo”, donde se equiparan las protecciones y coberturas sociales en caso de enfermedad y/o accidente para estos trabajadores. El número de accidentes mortales durante la jornada laboral y en el periodo estudiado fue de 30, lo que supone un 4,71% de los totales. La distribución es muy variable, alcanzando el mínimo en el año 2005 con una víctima y el máximo en el 2009 con 7 oscilando los porcentajes entre el 1% y el 9% aproximadamente. En un año medio en nuestra comunidad en el sector agrario se producirían 87 accidentes graves y 4 mortales (Tabla 1). Este porcentaje del 4,71% difiere bastante entre los dos sexos (Tabla 2) contabilizándose en el caso de los varones 26 accidentes mortales frente a tan solo 4 en el caso de las mujeres, lo que provoca que el porcentaje de accidentes mortales en el género masculino sea del 6,63% frente al 1,63% que se alcanza en el género femenino. Otros parámetros como la edad media del trabajador accidentado o la antigüedad media en el puesto de trabajo que también se recogen en la tabla 2 apenas difieren obteniéndose una edad media para los

520


accidentados mortales de 43,63 años con un valor de 43,23 años para los hombres frente a los 46,25 años de las mujeres. Respecto a la antigüedad media en el puesto de trabajo el valor medio es de 5,01 años, con un valor inferior en los hombres con 4,75 años frente a los 6,69 años de las mujeres. Tabla 1. Partes de accidente de trabajo graves y mortales con baja durante la jornada laboral Año

Grave

Mortal

Total

%

%

2004

136

97,14

4

2,86

140

2005

117

99,15

1

0,85

118

2006

98

97,03

3

2,97

101

2007

58

92,06

5

7,94

63

2008

51

91,07

5

8,93

56

2009

70

90,91

7

9,09

77

2010

77

93,90

5

6,10

82

Total

607

95,29

30

4,71

637

Media

87

95,29

4

4,71

91

Tabla 2. Edad y antigüedad media de los accidentes mortales con baja durante la jornada laboral por sexo Mortales

Totales

%

Edad

Antigüedad

Hombres

26

392

6,63

43,23

4,75

Mujeres

4

245

1,63

46,25

6,69

Total

30

637

4,71

43,63

5,01

Analizando la nacionalidad de las víctimas en el sector agrario destaca el elevado peso de accidentes mortales sufridos por trabajadores extranjeros a pesar de los bajos niveles de población inmigrante en Galicia. Así el 26,67% de las víctimas son trabajadores extranjeros frente al 46,67% de trabajadores españoles. También destaca el hecho de que en más de un 25% de los partes de accidente no se recogiera información para este campo lo que hace pensar que el porcentaje de la nacionalidad española sería ligeramente superior.

Figura 1. Distribución por nacionalidad de los accidentes mortales.

En cuanto a la actividad económica del trabajador o la empresa según la clasificación nacional de actividades económicas de 1993 (CNE-93) se puede ver como el porcentaje más elevado de accidentes mortales se alcanza para la actividad económica “Silvicultura, explotación forestal y actividades de los servicios relacionadas con las mismas” con en porcentaje del 16,07%. El porcentaje de accidentes mortales para la “producción ganadera” se sitúa en torno a la media mientras que en el resto de actividades los valores no alcanzan el 2% (Tabla 3). Esto pone de manifiesto la elevada peligrosidad

521


de las actividades silvícolas y más aún si tenemos en cuenta que aunque importantes no son las más comunes en la comunidad gallega. Tabla 3. Accidentes mortales según la actividad económica Cód.

Actividad económica CNAE-93

Mortales

Totales

%

11

Producción agrícola

3

165

1,82

12

Producción ganadera

4

84

4,76

13

Producción agraria combinada con la producción ganadera Actividades de servicios relacionados con la agricultura y ganadería, excepto actividades veterinarias; mantenimiento de jardines Caza, captura de animales y repoblación cinegética, incluidas las actividades de los servicios relacionados con las mismas Silvicultura, explotación forestal y actividades de los servicios relacionadas con las mismas Total

4

217

1,84

1

56

1,79

--

3

--

18

112

16,07

30

637

4,71

14 15 20

Atendiendo al lugar donde se produce el accidente (Tabla4), los accidentes mortales ocurren con mayor frecuencia en otros centros de trabajo distintos del habitual alcanzando un porcentaje del 21,88%. El porcentaje de accidentes mortales también es ligeramente superior al valor medio para los desplazamientos durante la jornada laboral con un 8,06% mientas que en el centro de trabajo habitual el dato es ligeramente inferior a la media. Tabla 4. Accidentes mortales según el lugar del accidente Lugar del accidente

Totales

Mortales

%

En el centro de trabajo habitual

543

18

3,31

Desplazamiento en su jornada laboral En otro centro o lugar de trabajo

62 32

5 7

8,06 21,88

Total

637

30

4,71

De los 30 accidentes mortales contabilizados 12 ocurrieron en jueves lo que supone un porcentaje del 33,3% (Figura2). El resto de los días de la semana alcanzan porcentajes bastante similares con porcentajes que oscilan entre el 13,89% y el 16,67% bajando mucho como cabía esperar durante el fin de semana con porcentajes de 2,78% tanto para el sábado como para el domingo.

Figura 2. Distribución semanal de los accidentes mortales.

522


Para terminar analizamos el tipo de trabajo específico que realizaba el trabajador cuando se produce el accidente mortal. De los 30 accidentes mortales 17 ocurrieron realizando labores de tipo forestal lo que supone un 56,67% del total. Destaca también el elevado porcentaje de casos en los que no se recoge ninguna información en los partes para este campo. Tabla 5. Accidentes mortales según el trabajo al ocurrir el accidente Cód.

%

8

26,67

30

Ninguna información Labores de tipo agrícola, forestal, hortícola, piscícola, con animales vivos – Sin especificar

1

3,33

31

Labores de tipo agrícola – trabajos en la tierra

1

3,33

33

Labores de tipo ganadero – sobre/con animales vivos

1

3,33

34

17

56,67

42

Labores de tipo forestal Actividades intelectuales – enseñanza, formación, tratamiento de la información, trabajos de oficina, de organización y de gestión

1

3,33

52

Mantenimiento, reparación, reglaje, puesta a punto

1

3,33

30

100,00

0

Tipo de trabajo al ocurrir el accidente

Total

Conclusiones Se detectó un bajo grado de cumplimentación de los partes con muchos campos sin cubrir o con falta de información en los mismos, si bien a partir del año 2008 se detecta una mejoría, apareciendo los partes más completos y con más información. En un año medio se producen en Galicia 87 accidentes graves y 4 mortales lo que supone un porcentaje de un 4,71% Los accidentes mortales se producen con mayor frecuencia entre los hombres, los trabajadores extranjeros y en un lugar distinto del centro de trabajo habitual. Las actividades más peligrosas son las actividades de tipo forestal donde ocurren más de la mitad de los accidentes mortales lo que se relaciona con el mayor porcentaje de accidentes extranjeros pues el subsector forestal es sin lugar a dudas el que absorbe la mayor cantidad de mano de obra extranjera dentro del sector agrícola.

Bibliografía BOE, núm. 279 de 21 de noviembre de 2002. Orden TAS 2926/2002, de 19 de noviembre, por la que se establecen nuevos modelos para la notificación de los accidentes de trabajo y se posibilita su transmisión por procedimiento electrónico. BOE, núm. 166 de 12 de julio de 2007. Ley 20/2007, de 11 de julio, del Estatuto del trabajo autónomo.

523




Compactación de un suelo hortícola por paso de vehículos pesados. Efecto sobre la resistencia a la penetración C. Gracia1, J. Estivill, I. Bautista2 1

Universitat Politècnica de València, Camino de Vera s/n 46022-Valencia. e-mail: cgracia@dmta.upv.es 2

Grupo Re-Forest, Departamento de Ingeniería Hidráulica y Medio Ambiente.

Resumen En este trabajo, se ensaya y analiza en laboratorio, el comportamiento de un suelo hortícola homogeneizado, sometido a cargas superficiales, con diferentes niveles de humedad. Se determinan básicamente la compactación y resistencia a la penetración provocada por esas cargas, aplicadas mediante prensa. Para poder estudiar la variación de densidad aparente en función de la profundidad, las probetas han sido segmentadas en cuatro anillos iguales. Cada anillo se puede pesar y secar independientemente con la porción de muestra de suelo que contiene. Para las medidas de resistencia a la penetración también se ha utilizado la misma máquina de ensayos, colocando una varilla de 4 mm de grosor, con punta cónica de base 4,5 mm de diámetro y ángulo en el vértice de 60º.Tanto la densidad aparente como los valores de RP son mayores en la primera capa de suelo, alrededor de los 3 cm, precisamente la zona donde las semillas deben germinar y las plantitas iniciar el desarrollo de su sistema radicular. Palabras clave: compactación suelo, resistencia penetración, maquinaria

Abstract The performance of a homogenized horticultural soil with different moisture levels is tested and analyzed in the laboratory under surface loads applied by a press. Compaction and soil penetration resistance (RP) caused by these loads are determined. In order to study the change of density as a function of depth, the specimens have been segmented into four equal rings. Each ring can be weighed and dried independently. To measure RP the same testing machine has also been used, placing a rod of 4 mm thick, with a nose cone base diameter of 4.5 mm and a vertex angle 60 °. Both bulk density and RP values are higher in the first soil layer, around 3 cm depth, which is the area where seeds should germinate and seedlings start developing their root system. Keywords: Soil compaction, Penetration resistance, Machinery,

Introducción Los suelos dedicados a cultivos hortícolas soportan actualmente importantes cargas por el paso de grandes equipos: tractores de alta potencia, cosechadoras integrales y vehículos de transporte. Las presiones que llegan a la superficie del suelo, a pesar del empleo de anchos neumáticos, superan en ocasiones los 250 kPa como presión media en el área de contacto, especialmente al paso de los vehículos de cosecha y transporte. Además, la frecuencia de pasadas de la maquinaria y la anchura de su rodada implican una intensidad de tráfico muy elevada (Gracia et al., 2013). Por otro lado, como los dibujos y geometría de los neumáticos impiden una distribución uniforme de la presión, puede haber puntos del área de contacto donde la presión alcance hasta cinco veces el valor medio (Gupta y Raper, 1994). Estas presiones producen importantes alteraciones en la capa superficial del suelo. Se modifica el perfil – deformación plástica -, aumenta la densidad aparente del suelo - compactación-, disminuye la capacidad de infiltración, y aumenta la resistencia a la penetración, comprometiendo la nascencia y el desarrollo radicular de las plantas. Los valores de resistencia superiores a 2 MPa son críticos para muchos cultivos (Eavis et. al., 1969).    524


 Por otro lado, se ha comprobado que pequeños cambios en la densidad aparente pueden dar lugar a aumentos importantes en la resistencia a la penetración. Por ejemplo, un aumento del 20% de la densidad, puede llegar a suponer un incremento de la resistencia a la penetración de hasta un 400% (Vorhees et al. 1978). Esto quiere decir, que la resistencia a la penetración es un parámetro mucho más sensible a las cargas, y con ello al tráfico rodado, que la misma compactación. La relación entre ambas variables con la carga depende de la humedad del suelo. Cualquier estudio que pretenda relacionar carga, densidad aparente –compactación- y resistencia a la penetración, debe incluir información sobre el estado inicial del suelo y su humedad. La relación entre la resistencia a la penetración, la densidad aparente y humedad de los suelos ha sido tratada en numerosos trabajos, en su mayoría empíricos (Busscher, 1990; Da Silva et al. 1997; Smith et al. 1997) La compactación del suelo se puede reducir en determinadas circunstancias. En efecto, las altas presiones rompen agregados del suelo, deslizándose las partículas hasta encontrar más puntos de contacto entre ellas, lo que incrementa su resistencia mecánica (Gudeus, 1981) y minimiza, en cierto modo, tanto la deformación como la compactación. La materia orgánica, por ejemplo, favorece los puntos de contacto ofreciendo al suelo mayor resistencia a las cargas (Horn, 1993). Lo mismo sucede cuando disminuye la humedad y aumenta la cohesión. En suelos saturados por el contrario, se aumenta la transmisión de presiones en profundidad, y con ello las deformaciones. En este trabajo, se ensaya y analiza en laboratorio el comportamiento de un suelo hortícola homogeneizado, sometido a cargas superficiales, con diferentes niveles de humedad. Se determinan básicamente la compactación y resistencia a la penetración provocada por esas cargas, aplicadas mediante prensa.

Materiales y Métodos Diseño de la experiencia De la capa arable de un suelo hortícola se toman muestras para el proceso de compactación en laboratorio. Las muestras, una vez mezcladas, desprovistas de piedra, de residuos vegetales y elementos extraños, se criban y secan. El suelo se extiende sobre una bandeja (fig.1), se rocía con agua de modo uniforme hasta alcanzar la humedad deseada. El suelo húmedo se introduce en probetas cilíndricas segmentadas y se le aplica mediante prensa diferentes cargas verticales para su compactación. Como indicador de la compactación en función de la carga superficial aplicada y la humedad del suelo, se determina la densidad aparente a distintas profundidades. Con un penetrómetro de pequeñas dimensiones, se mide la resistencia del suelo a la penetración a diferentes profundidades. Posteriormente se ajusta estadísticamente una función polinómica para explicar los valores de la resistencia a la penetración a partir de las variables humedad y densidad aparente (compactación). Se han ensayado un total de 80 probetas de suelo, aplicando tres niveles de carga superficial, con diferentes niveles de humedad, con tres repeticiones para cada uno de los tratamientos. Las presiones que soporta el suelo debido al paso de la maquinaria agrícola oscilan normalmente entre 150 y 250 kPa - presión media en el área de contacto -. Teniendo en cuenta que en ciertos puntos del área de contacto rueda suelo las tensiones se concentran alcanzando con frecuencia 2 y 3 veces la presión media. Por este motivo, se ha decidido aplicar cargas axiales de 250, 500 y 1000 N. Es decir, presiones de 160, 320 y 640 kPa, respectivamente. Suelo El suelo empleado en los ensayos presenta textura franco arenosa (Tabla 1), sin piedras visibles en la superficie. Se considera apto para cualquier tipo de cultivo hortícola. La textura se ha determinado por sedimentación diferencial. Para la determinación de materia orgánica se ha recurrido al método Walkey-Black. También se ha determinado el contenido en carbonato cálcico por el método del    525


 calcímetro de Bernard. El alto valor de este último componente es frecuente en suelos de la zona de Levante por su origen calizo. Tabla 1. Características del suelo Arena (50 -2000 m)

78,44 %

Materia y carbono orgánicos

Limo (2-50 m)

7,75 %

Carbonato cálcico

Arcilla (< 2 m)

13,81 %

Humedad campo

de

capacidad

1,56 % y 0,9 % 23 % de

33 %

El suelo utilizado para las muestras en laboratorio se ha cribado con un tamiz de 2 milímetros y desecado en estufa a 105ºC. Después se ha distribuido uniformemente agua pulverizada hasta llegar al porcentaje de humedad de cada ensayo, controlando la aportación por el pesado continuo de la masa de suelo tratada. La muestra se ha colocado en una probeta cilíndrica de PVC (fig.1), de 2 mm de espesor, 45 mmm de diámetro interior y 200 mm de altura. Los cilindros son suficientemente rígidos para no deformarse con las presiones de compactación ni con las temperaturas de secado en estufa. La base de las probetas está cerrada por una tapa del mismo material, a la que se le han practicado de 20 a 30 pequeños orificios de 2 mm a modo de drenaje o bien para permitir la adsorción de agua por ascenso capilar, según el caso.

 Figura 1. Bandejas de humectación y probetas segmentadas.

Para poder estudiar la variación de densidad aparente en función de la profundidad, las probetas han sido segmentadas en cuatro anillos iguales, de 50 mm de altura. Durante el llenado de la tierra y la aplicación de la carga vertical, la probeta mantiene unidos sus anillos mediante tres manguitos deslizantes. Cuando se vaya a estudiar la evolución de la densidad en cada sección se retirarán los manguitos. Así, cada anillo se puede pesar y secar independientemente con la porción de muestra de suelo que contiene. Instrumentación. Para realizar las pruebas de compactación se ha utilizado una máquina de sobremesa de ensayos tracción-compresión marca Ibertest modelo TH-2730. El movimiento vertical se transmite a la columna con un tornillo sinfín conectado a un motor eléctrico. Es capaz de ejercer una fuerza máxima de tracción-compresión de 3 kN, y desplazamientos de 540 mm. La carga aplicada se realiza a velocidad controlada desde 1 a 700 mm/min. La precisión de lectura es de 0,1 N para la fuerza, y 0,001 mm para el desplazamiento. Para las pruebas de compactación, la mordaza móvil de la máquina se ha sustituido por un disco de 44 mm de diámetro y 3 mm de espesor que permite comprimir el suelo dejando un huelgo de 0,5 mm con las paredes de la probeta. Así evita rozamiento con ella y eventualmente permite la salida de agua en suelos saturados.

   526








Figura 2. Máquina universal de ensayos y útiles empleados: “compactador” y “varilla penetrómetro”

Para las medidas de resistencia a la penetración también se ha utilizado la misma máquina de ensayos, colocando ahora, en lugar del disco una varilla de 4 mm de grosor, con punta cónica de base 4,5 mm y ángulo en el vértice de 60º. El modelo empírico de Whalley et al. (2007) , para estimar la resistencia a la penetración de los suelos, también fue parametrizado usando un pequeño cono de 4 mm de diámetro. Hernanz et al. (2000) han demostrado que la resistencia a la penetración no es particularmente sensible al diámetro del cono. Por otro lado, dada la pequeña base del cono, 0,16 cm2, la penetración de la varilla requiere una fuerza moderada – por ejemplo, para resistencias de suelo de 5 MPa, bastan 79 N -. Además, el volumen de suelo desalojado en su trayectoria, aunque pueda incrementar la compactación, es irrelevante. La baja velocidad a la que se realiza la prueba, 0,33 mm/s, y la precisión de las lecturas de fuerza y distancia recorrida, permiten obtener gráficas precisas, aspecto poco frecuente en los penetrómetros convencionales de campo. 

Resultados y Discusión En la tabla 2, se recogen los valores de las densidades aparentes de cada estrato de suelo, tras la aplicación de cargas de 500 y 1000 N, y con humedades de 10, 16 y 24 %. Puede observarse que el primer estrato es el más afectado por la compactación. En el segundo la densidad aparente con respecto al primero se reduce en un 87 % y en el tercero, el más alejado, sólo es un 80 % del valor del primero. Tabla 2. Densidad aparente del suelo por estratos (kg/m3) Carga en N y Humedad en % Profundidad 0-5 cm 5-10 cm 10-15 cm densidad inicial densidad media final

500 /10 1509 1294

500/16 1591 1495

500/24 1932 1518

1000/10 1667 1480

1000/16 1640 1565

1000/24 2010 1598

1148 1030 1317

1311 1080 1466

1498 1280 1649

1325 890 1491

1422 1210 1542

1582 1240 1730

Por otro lado, para determinar la relación entre la carga y la densidad aparente (DA) media obtenida a lo largo de la capa arable (0 a 20 cm) con diferentes humedades de suelo (H) se partió de densidades iniciales semejantes ( alrededor de 1,1 kg/m3) y sin recurrir a probeta segmentada. Los resultados se exponen en la tabla 3 e ilustrados en la figura 3. Se observa que para cualquier nivel de humedad la densidad aparente aumenta de modo significativo con la carga: 29% para la carga de 500 N y 39% para la carga de 1000 N.

   527


 Tabla 3. Densidad aparente del su uelo (kg/m3)

       

           Figura 3. Compactaciรณn segรบn caargas y humedades.

Al comparar los resultados de laas tablas 2 y 3 se detecta la influencia de la DA innicial del suelo, en el sentido de que con mayor densiidad inicial los valores finales son algo mayorees. Por ejemplo, para N=1000N y H=24%, de la tablaa 2, con densidad inicial 1240 kg/m3, se alcanzza DA media = 1730 kg/m3. Mientras en la tabla 3 paraa ese caso DA = 1607 kg/m3, siendo la densidad inicial i 1100 kg/m3. Tambiรฉn es evidente que a iguualdad de carga aplicada, DA aumenta con laa humedad de forma significativa: de H = 10% a H = 16% la DA aumenta un 8%, y de H = 16% a H = 24% aumenta un 5% mรกs. En la tabla 4 se recogen los vaalores la resistencia a la penetraciรณn (RP) para distintas densidades aparentes del suelo (DA) y hum medades (H). Paralelamente la figura 4, ilustraa la evoluciรณn de la resistencia a la penetraciรณn (RP) en funciรณn de la profundidad, para las tres humeddades de ensayo - 10, 16 y 24% - y las dos cargas - 500 y 1000 N -. Se desprende que el suelo seeco proporciona mรกs cohesiรณn y a igualdad de densiddad, la resistencia a la penetraciรณn es mayor. Effecto inverso al de la compactaciรณn que aumentaba conn la humedad. Tabla 4. Resistencia a la penetraciรณn.

DA A (kg/m3)

H (%)

RP (Mpa)

1326

10

1,54

1472

16

0,76

1602

24

0,05

1450

10

2,26

1572

16

1,28

1608

24

0,08

Figura 4. Resistencia a la penetraciรณn.

   528


 Del grĂĄfico 4 se desprende que los valores de RP son mayores en la primera capa de suelo, alrededor de los 3 cm, precisamente la zona donde las semillas deben germinar y las plantitas iniciar el desarrollo de su sistema radicular. A partir de 28 determinaciones se ha ajustado una ecuaciĂłn que relaciona la funciĂłn RP con las variables DA y H obteniendo una expresiĂłn polinĂłmica con una calidad de ajuste de R2 = 0,82.                  

RP se expresa en MPa, H en % y DA en kg/m3.

Conclusiones â&#x20AC;˘ â&#x20AC;˘

â&#x20AC;˘

La humedad del suelo se presenta como un parĂĄmetro decisivo a la hora de prevenir la compactaciĂłn del suelo por cargas superficiales. El efecto de compactaciĂłn por el paso de las mĂĄquinas es especialmente relevante en los primeros centĂ­metros del perfil del suelo. A partir de 15 cm, por tĂŠrmino medio, el aumento de la densidad aparente por las cargas verticales es menos de la mitad que el ocurrido en la superficie. La sostenibilidad en el manejo del suelo va a depender en gran medida de la humedad con la que se opera. En ningĂşn caso debe permitirse el trĂĄnsito de maquinaria pesada cuando la humedad del suelo es prĂłxima al punto de saturaciĂłn. En ese momento la compactaciĂłn es muy alta y tras un secado posterior se produce una resistencia a la penetraciĂłn tan elevada que comprometerĂ­a el desarrollo normal de las plantas.

BibliografĂ­a Busscher, W.J., (1990). Adjustment of "at-tipped penetrometer resistance data to a common water content. Transactions. ASAE 33, 519â&#x20AC;&#x201C;524. Da Silva, A.P. , and B.D. Kay, (1997). Estimating the least limiting water range of soils from properties and management. Soil Sci. Soc. Am. J., 61, 877â&#x20AC;&#x201C;883

Eavis, B.W.; Ratcliff, L.E. and Taylor, H.M. (1969). Use of dead load technique to determine axial root growth pressure. Agronomy Journal 61, 640-643. Gracia, C. et al. (2013) TrĂĄfico de maquinaria pesada en cultivos hortĂ­colas. DeformaciĂłn del suelo. VII Congreso IbĂŠrico de AgroingenierĂ­a. Madrid. C0190, 1-6 Gudeus, G. (1981) Soil Mechanics. Enke Stuttgart. Germany, 281 pp Gupta, S. y Raper, L. (1994) Prediction of soil compaction under vehicles. In: Soil compaction in crop production. Soane and Ouwerkerk. Minesota, 71-90

Hernanz, J.L., Peixoto, H., Cerisola, C., Sanchez-Geron, V.,(2000). An empirical model to predict soil bulk density profiles in field conditions using penetration resistance, moisture content and soil depth. Journal of Terramechanics 37,167â&#x20AC;&#x201C;184. Horn, R. (1993) Mechanical properties of structured unsatured soils. Soil Technology 6, 47-75 Smith, C.W., Johnston, M.A., Lorentz, S.,(1997). The effect of soil compaction and soil physical properties on the mechanical resistance of South African forestry soils. Geoderma 78, 93â&#x20AC;&#x201C;111.

Vorhees, W.B., Senst, C.G. y Nelson, L. (1978). Compaction and soil structure modification by wheel traffic in the nothern Corn Belt. Soil Science Society of America Journal, 42: 344-349 Whalley, W.R., To, J., Kay, B.D., Whitmore, A.P., (2007). Prediction of the penetrometer resistance of soils with models with few parameters. Geoderma 137, 370â&#x20AC;&#x201C;377    529


Comportamiento de morteros de cemento con nano adiciones sometidos a ciclos hielo-deshielo N. León1*, J. Massana2, F. Alonso3, A. Morages1, E. Sánchez3 1

Dpto. Ingeniería Civil: Construcción, E.T.S.I. de Caminos, Canales y Puertos, Universidad Politécnica de Madrid.C/ Profesor Aranguren 3, 28040, Madrid, España. 2 Dpto. Construcción y Vías Rurales, E.T.S.I. Agrónomos, Universidad Politécnica de Madrid. Av. Complutense s/n, 28040 Madrid, España. 3 Dpto. Ciencia y Tecnología Aplicadas a la I.T. Agrícola, E.U.I.T. Agrícola, Universidad Politécnica de Madrid. Av. Complutense s/n, 28040 Madrid, España. elvira.sanchez.espinosa@upm.es

Resumen El auge de la nanotecnología en las últimas dos décadas, ha sido de considerable interés científico para la industria de la construcción, debido al alto potencial en la utilización de nano-partículas en materiales cementicios. Estos permiten una reingeniería de los productos existentes y el diseño de nuevos materiales de altas prestaciones. En esta línea son muchos los trabajos realizados en los que se estudia el efecto de las nanoadiciones en morteros y hormigones. Sin embargo son muy pocos los trabajos en los que se analiza el comportamiento de estos materiales bajo ciclos de hielo-deshielo. El objetivo de este trabajo es determinar la influencia de la incorporación de nanoSiO2, nanoAl2O3 así como la mezcla de ambas adiciones, en morteros de cemento cuando son sometidos a ciclos de hielo-deshielo, e interpretar dicho comportamiento a través de los cambios microestructurales. Para ello se fabricaron cuatro morteros de cemento con distintas adiciones. Un mortero de cemento CEM I 52,5R normalizado de acuerdo a la Norma Europea EN 196-1:2005 como control. Otro de igual composición, al que se incorporó un 5% de nano-SiO2 respecto a la cantidad total de cemento, un tercero con un 5% de nano-Al2O3 y un cuarto con un 2,5% de nano-SiO2 y un 2,5% de nano-Al2O3. La relación agua/material cementante de 0,47. Para cada mortero, se fabricaron 4 probetas de 15x15x15 cm con el fin de determinar su resistencia a ciclos de hielodeshielo de acuerdo a la UNE-CEN/TS 12390-9 EX. Además, se caracterizaron microestructuralmente mediante porosimetría por intrusión de mercurio, análisis termogravimétrico y micrografía electrónica. Los resultados de la caracterización microestructural ponen de manifiesto un refinamiento de la matriz porosa, con aumento de la cantidad de geles hidratados. Las imágenes de SEM revelan cambios en la morfología de los productos hidratados de la matriz cementicia, siendo notables tanto en la portlandita como en la ettringita. Los cambios producidos por la adición de nano sílice muestran una gran influencia en la estructura porosa y determinan una mejora muy significativa en el comportamiento de estos morteros bajo ciclos hielo-deshielo. Palabras clave: Mortero, nano-SiO2, nano-Al2O3, durabilidad, ciclos hielo-deshielo.

Influence of addition of nano-silica and nano-alumina cement mortars in livestock farming use Abstract The rise of nanotechnology in the last two decades has been of scientific interest considerable for the construction industry due to the high potential in the use of nano-particles in cementitious materials. These allow a reengineering of existing products and the design of new highperformance materials. In this line there are many works in which we study the effect of additions of nano-particles in mortars and concretes. However, were very few scientific papers in which we study the behavior of these materials under freeze-thaw cycles. The aim of this study was to determine the influence of incorporating nano-SiO2, nano-Al2O3 and the mixture of both additions in cement mortar when subjected to freeze-thaw cycles, and interpret such behavior through microstructural changes.

530


For this purpose four cement mortars have been fabricated with different additions. A cement mortar CEM I 52,5 R normalized according to the European standard EN 196-1:2005 was manufactured as control . Another mortar with a 5% nano-SiO2 in respect to the total amount of cement, other with 5% nano-Al2O3 and for last a mortar with 2.5% of nano-SiO2 and 2.5% of nano-Al2O3. The water/binder ratio was 0.47. For each mortar, four specimens were made of 150x150x150 mm in order to determine its behavior under freeze-thaw cycles according to UNE-CEN/TS EX 12390-9. Furthermore, the mortars were characterized microstructurally by mercury intrusion porosimetry, thermogravimetric analysis and electron micrograph. The microstructural characterization results show a refinement of the porous matrix, with increased amount of hydrated gels. The SEM images show changes in the morphology of the products of the hydrated cement matrix being remarkable both in the portlandite as in the ettringite. The changes produced by the addition of nanosilica show a great influence on the porous structure and determine a significant improvement in the behavior of these mortars under freeze-thaw cycles.

Keywords: Mortar, nano-SiO2, nano-Al2O3, durability, freeze-thaw cycles.

Introducción La Instrucción Española del Hormigón Estructural EHE (2010) define la durabilidad de un elemento o estructura como su capacidad para soportar, durante la vida útil para la que ha sido proyectada, las condiciones físicas y químicas a las que está expuesta, y que podrían llegar a provocar su degradación como consecuencia de efectos diferentes a las cargas y solicitaciones consideradas en el análisis estructural. Por lo tanto, es de gran interés conocer el comportamiento de los materiales cementicios frente a acciones que puedan degradar a estos materiales como son las heladas. En el sector agro-ganadero la utilización del hormigón es imprescindible, siendo el material constituyente de numerosas instalaciones (Sánchez et al., 2009). Es destacable su utilización en suelos tanto continuos como en elementos prefabricados que en muchas de las explotaciones, se encuentran a la intemperie y por tanto sometidos a las condiciones meteorológicas de la zona. Estas condiciones pueden llegar a producir daños en estos elementos con descascarillados o pérdidas de material que deterioran la instalación e incrementan el riesgo de corrosión de las armaduras pudiendo llegar al colapso parcial o total de esta con riesgo de producir accidentes en los animales y el consecuente perjuicio económico. Tanto las propiedades mecánicas como durables de un material cementicio, dependen, en gran medida, de la cantidad de silicatos de calcio hidratados o geles hidratados (CSH), en la estructura de la matriz de la pasta de cemento, y de la interfaz árido-pasta (ITZ). El auge de la nanotecnología en las últimas dos décadas, ha despertado un considerable interés científico en la industria de la construcción, debido al alto potencial que tiene la utilización de nano-partículas en materiales cementicios. Estos permiten una reingeniería de los productos existentes y el diseño de nuevos materiales de altas prestaciones (Zyganitidis et al., 2011). El caso particular de la adición de óxido de silicio de tamaño nanométrico, o nano-SiO2, ha despertado un creciente interés por su conocida actividad puzolánica, que es mayor que la del humo de sílice debido a su mayor superficie especifica. La nano-SiO2 puede reaccionar con el hidróxido de calcio o portlandita (Ca(OH)2), produciendo una mayor cantidad de CSH y por tanto mejorando su resistencia mecánica a edades tempranas (Kawashima et al., 2013; Schmidt et al., 2013), además de densificar la matriz. Así, el tamaño y cantidad de cristales de portlandita se ven significativamente disminuidos, agrupándose en los poros pequeños de la pasta cerrando los mismos. Son varios los autores que han estudiado la influencia de esta nano-SiO2 en morteros (Jo et al., 2007) y sola o con cenizas volantes o con escorias de alto horno en hormigones convencionales (Said et al., 2012) y en hormigones autocompactantes (Jalal et al., 2012).Sin embargo son muy pocos los trabajos en los que se estudia la influencia de la adición de nano-partículas, en el comportamiento de materiales cementicios frente a ciclos de hielo-deshielo. Son todavía más escasos los trabajos en que se incluyen en dicho estudio la nano-Al2O3. Cabe destacar, que en los materiales cementicios, la pérdida de masa superficial estará condicionada por la microestructura de la matriz cementicia, por la naturaleza porosa que presenta, y por el grado de adherencia que presenten los áridos y la matriz. La debilidad encontrada en esta zona viene determinada por su mayor contenido en especies cristalinas que presentan valores significativamente menores de superficie especifica, que los geles del cemento hidratado. Cambiar esta situación permite asegurar un mejor comportamiento durable.

531


El objetivo de este trabajo es estudiar la influencia de la adición de nano-SiO2, nano-Al2O3 y la mezcla de ambas, en morteros de cemento cuando son sometidos a ciclos hielo-deshielo e interpretar dicho comportamiento a través de los cambios microestructurales.

Material y Métodos Los materiales usados fueron cemento CEM I 52.5R (UNE-EN 197-1, 2000), nano-sílice Levasil 200/40% distribuido por Obermeier con una superficie específica de 200 m2/g, nano-alúmina submicrónica distribuida por Vicar S.A., aditivo superplastificante SIKA Viscocrete 5720 (SP), arena normalizada CEN (UNE-EN 196-1, 2005) y agua potable. La composición química del cemento se encuentra recogida en la Tabla 1. Tabla 1: Composición química del cemento (% en peso) CaO

SiO2

Al2O3

Fe2O3

MgO

K2O

SO3

Cl-

Na2O

I.L.

63.41

19.2

6.07

1.7

2.56

0.82

3.38

-

0.33

2.09

Se diseñaron cuatro tipos de morteros M[nSi] con un 5% de nano-SiO2, M[nAl] con un 5% de nanoAl2O3, M[nSi]:[nAl] con un 2,5% de nano-SiO2 y 2,5% de nano-Al2O3 y MN mortero normalizado de referencia. En todos ellos se utilizó 450 gr de cemento y 1350 g de arena por molde. La relación agua/material cementante fue de 0,47 y la de arena/cemento 3/1 de acuerdo a la Norma Europea EN 196-1:2005. Se fabricaron 6 probetas de 150x150x75 mm por cada tipo de mortero. Las probetas fueron desmoldadas a las 24 horas y ensayadas de acuerdo a la UNE-CEN/TS 12390 EX: 2008. Los datos de pérdida de masa fueron analizados estadísticamente mediante un análisis de la varianza con el programa StatGraphics v.5 (2000). El discriminante usado para las medias fue el procedimiento de las menores diferencias significativas de Fisher (LSD) con un p<0.05. La distribución porosa de las probetas se determinó mediante el ensayo de porosimetría de intrusión de mercurio (PIM) de acuerdo a la norma ASTM D4404-84 (2004). Este ensayo fue llevado a cabo con un equipo Micromeritics, modelo Autopore IV 9500 que alcanza una presión máxima de 33.000 psi, cubriendo un rango de tamaño de poros entre 5 nm y 180 µm., con muestras de 3±0.01 g estabilizadas a 40ºC hasta peso constante. El análisis termogravimétrico (ATG) se realizó de acuerdo a ASTM E1131:(2008), utilizando un analizador térmico simultáneo, marca Setaram, modelo Labsys Evo, con una balanza de precisión de 0,1 µg que permitió determinar la cantidad de CSH y de Ca(OH)2 presente en cada mortero. Las micrografías se realizaron mediante un microscopio electrónico de barrido (MEB) JEOL JSM 6335F de microscopía electrónica equipado con un analizador de energía dispersivas de rayos X (EDX) Oxford Instruments, modelo X-Max de 80 mm2 con una resolución de 127 eV a 5,9 KeV, para obtener imágenes mediante electrones secundarios (SE) y retrodispersados (back-scattering, BSEM).

Resultados y Discusión En la gráfica 1 se presentan los valores medios y su desviación estándar de los resultados obtenidos en los ensayos de hielo-deshielo. El deterioro producido por los ciclos hielo-deshielo comienza en la superficie del hormigón. La pasta cementicia que posee agua en sus poros capilares, se ve fuertemente dañada por tensiones de tracción al sufrir varios ciclos hielo-deshielo (Mao y Ayuta, 2008). Así, en la figura 1, se observa que hasta el sexto ciclo no hay diferencias significativas de pérdidas de masa entre los morteros ensayados. Sin embargo, al final del ciclo 14, los morteros MN y M[nAl] no presentan diferencias entre ellos pero si existen respecto a los morteros que contienen nano-SiO2. Esta situación desaparece después de 28 ciclos, existiendo diferencias significativas entre todos los morteros, siendo el que presenta un notable mejor comportamiento el mortero M[nSi]. Es de destacar que la pérdida de masa que experimenta este

532


mortero a los 28 ciclos es similar a la que experimenta el mortero con un 5% de nano-Al2O3 con la mitad de ciclos de hielo-deshielo.

Figura 1. Masa desprendida del mortero respecto al area de exposición (kg/m2)

Mao y Ayuta (2008) afirman que la congelación del agua en los poros capilares más grandes es la principal causa del daño del hielo en el hormigón estructural, por lo que se procedió al análisis de la distribución porosa. En la figura 2 se presenta la distribución de tamaño de poro que es una adaptación de la clasificación de Mindess (2003). Se establecen 4 rangos de tamaño de poro: macroporos (Ø > 10 µm), capilares grandes (50 nm < Ø < 10 µm), capilares medianos (10 nm < Ø < 50 nm) y capilares pequeños (5 nm < Ø < 10 nm). En ella, se observa un mayor refinamiento de la estructura porosa del mortero M[nSi] en todas las edades con respecto al resto, resultando un mortero más compacto (Jo et al., 2007).

Figura 2. Distribución de tamaño de poro de los morteros según la clasificación de Mindess (2003)

En la tabla 2, se muestran la porosidad total y los tamaños de poro crítico de los morteros ensayados. Tabla 2. Tamaño de poro crítico y porosidad total de los morteros ensayados Días curado

MN

M[nSi]

M[nAl]

M[nSi]:[nAl]

P. crít. P. total

P. crít.

P. total

P. crít.

P. total

P. crít.

P. total

7

0,062

14,29

0,027

12,07

0,040

13,05

0,050

12,87

28

0,052

13,25

0,021

11,56

0,032

12,91

0,032

12,12

90

0,040

12,46

0,021

10,79

0,040

12,10

0,032

13,46

Las variaciones de porosidad total respecto al tiempo de curado, muestran que el avance del proceso de hidratación va cerrado la estructura porosa resultando valores de porosidad total decrecientes. La incorporación de la nano-SiO2 afecta al tamaño de poro crítico reduciéndolo significativamente, de valores 0,062 a 0,021 µm a los 28 días de curado. Esto es debido no solo al efecto de relleno de los poros del material por su granulometría nanométrica sino que la nano-SiO2 modifica el proceso de hidratación actuando como núcleos de precipitación alrededor de los cuales se depositen los productos resultantes de la misma (Zhang, 2012). Cabe destacar la influencia de la nano-SiO2 al ser utilizada conjuntamente con la nano-Al2O3. La reacción puzolánica de la primera es practicamente lineal con el

533


porcentaje de adición. Sin embargo, la distribución porcentual de los diferentes tamaños de poros es prácticamente homogénea para las dos muestras que contienen nano-Al2O3. La porosidad total varía en función de contener o no nano-SiO2, por lo que en ultimo termino, el número de poros grandes, de los que depende en gran medida la durabilidad de un hormigón (Mindess, 2003), es mayor en el mortero que solo contienen nano-Al2O3, siendo ello coherente con los resultados frente a hielo-deshielo. En la figura 3 se resumen los resultados del ATG. Se muestran los porcentajes de CSH, tomando como referencia las pérdidas de agua en un rango de temperaturas entre 100ºC y 400ºC y de Ca(OH)2, tomando como referencia las pérdidas de agua en un rango de temperaturas entre 400ºC y 500ºC (Rivera, 2004).

Figura 3. Resultados del análisis termogravimétrico

El análisis termogravimétrico muestra que los mayores aumentos en la cantidad de CSH están asociados a una disminución en la cantidad de Ca(OH)2 en función de la masa total. Este resultado permite afirmar que la mayor actividad puzolanica se da en el mortero con un 5% de nano-SiO2, esta adición reacciona con la portlandita, reduciendo su contenido, y formando mayor cantidad de geles CSH. En la figura 4 se muestra la relación entre las pérdidas de gel y las pérdidas de portlandita.

Figura 4. Relación entre las pérdidas de gel y las pérdidas de portlandita

En la figura 4, se observa que en prácticamente todas las edades de curado, los menores valores, son los que corresponde al mortero M[nAl]. Estos datos ponen de manifiesto que si la única reacción de formación de portlandita es la de hidratación de los silicatos del cemento, los geles formados con presencia de alumina experimentan cambios en la estequiometria, no produciéndose el consumo de la portlandita generada en ninguna reacción secundaria. En la figura 5 se muestran las micrografías, a los 28 días de curado, de los morteros ensayados. En el MN (fig. 5(a)) se observa una gran cantidad de portlandita en forma de placas y que tapiza la pared de los poros y las zonas exteriores de los mismos. No se observa presencia de etringita. En M[nSi] (fig. 3(b)) se aprecia gran cantidad de geles CSH compactos, etringita en bastones independientes, en ramilletes y en forma de bola. No se aprecian cristales convencionales de portlandita. En la fig. 3(c) (M[nAl]) no se observa etringita definida, puesto que potencialmente ha derivado a monosulfoaluminatocalcico. Se observa gran cantidad de portlandita en poros pequeños. Por último,

534


en la fig. 3(d), M[nSi]:[nAl], se observa gran cantidad de portlandita en bloques en los poros, y poca cantidad de etringita en bastoncillos dispuestos de forma desordenada, en la interfaz árido-pasta. Es de destacar que siempre que se ha añadido nano-SiO2 se mantiene a edades largas una pequeña proporción de etringita

Figura 5. Micrografías con microscopio electrónico de barrido (MEB) de los morteros ensayados

Conclusiones La incorporación de 5% de nano-SiO2, produce en el mortero M[nSi] un notable mejor comportamiento frente a ciclos hielo-deshielo, siendo despreciable el efecto de la nano-Al2O3. La nano-SiO2 produce un refinamiento de la estructura porosa con reducción de la porosidad total como consecuencia de la menor cantidad de poros grandes debido a su mayor actividad puzolánica con gran formación de geles CSH. Sin embargo, en morteros con nano-Al2O3 los geles formados con presencia de alúmina experimentan cambios en la estequiometria, no produciéndose el consumo de la portlandita generada en ninguna reacción secundaria asociada a una mayor cantidad de poros grandes.

Agradecimientos Los autores agradecen el apoyo financiero del Ministerio de Ciencia y Tecnología, Proyecto BIA200914395-C04-04 y del Ministerio de Fomento proyectos C14/2006 y C01/2007.

Bibliografía EHE. Instrucción de Hormigón Estructural. Serie Normativa. (2010). Ministerio de Fomento. Secretaría General Técnica. 4ª Edición 2010. Madrid. Jalal, M., Mansouri, E., Sharifipour, M., Pouladkhan, A. R. (2012). Mechanical, rheological, durability and microstructural properties of high performance self-compacting concrete containing SiO2 micro and nanoparticles. Materials and Design. 34, 389–400. Jo B-W., Kim C-H., Tae G-h., Park J-B. (2007). Characteristics of cement mortar with nano-SiO2 particles. Construction and Building Materials. 21. 1351-1355. Kawashima S., Hou P., Corr D.J., Shah S.P. (2013). Modification of cement-based materials with nanoparticles. Cement and Concrete Composite. 36, 8-15. Mao J., Ayuta K. Freeze-Thaw resistance of lightweight concrete and aggregate at different freezinh rates. Journal of Materials in Civil Engineering ASCE. 20, 78-84. Mindess, S., Young, J.F., Darwin, D. (2003).Concrete. Prentice Hall, Pearson Education, Inc. Upper Saddle River, NJ 07458. 2nd Edition. Rivera Lozano, J. (2004). La hidratación de la pasta de cemento con adiciones activas. Tesis doctoral. Facultad de Ciencias, Universidad Autónoma de Madrid. Said, A.M., Zeidan M.S., Bassuoni, M.T., Tian Y. (2012). Properties of concrete incorporating nano-silica. Construction and Building Materials. 36, 838–844. Sánchez, E.; Garcimartín M.A.; Jofré, C.; Burón M. (2010). Manual para el empleo del hormigón en obras agrícolas. Instituto Español del Cemento y sus Aplicaciones (IECA). Madrid. España. Schmidt M, Amrhein K., Braun T., Glotzbach C., Kamaruddin S. Tänzer R. (2013). Nanotechnological improvement of structural materials.- Impact on material performance and structural design. Cement and Concrete Composite. 36, 3-7. Zhang M.H., Islam J., (2012). Use of nano-silica to reduce setting time and increase early strenght of concretes with high volumes of fly ash or slag. Constr. Buil. Mater. 29, 573-580. Zyganitidis, I.; Stefanidou, M.; Kalfagiannis, N.; Logothetidis, S. (2011). Nanomechanical characterization of cement-based pastes enriched with SiO2 nanoparticles. Materials Science and Engineering B. 176, 1580-1584.

535




Tráfico de maquinaria pesada en cultivos hortícolas. Deformación del suelo C. Gracia, J. Estivill y C. Gracia-López1 1

Universitatd Politècnica de València, Camino de Vera s/n 46022-Valencia. e-mail:cgracia@dmta.upv.es

Resumen Se revisa la intensidad de tráfico rodado sobre las parcelas destinadas a producción de cultivos hortícolas. Por el porcentaje de superficie afectada y por el número de pasadas, estas parcelas están sometidas a mayor intensidad de tráfico que la explotaciones de cultivos extensivos –cereal, forraje, remolacha,..- o cultivos frutícolas. Con pequeños perfilómetros se ha medido la huella de la rodada tras uno y varios pases de tractor, y con distintas humedades de suelo. La deformación producida y las variaciones de la densidad aparente por el paso de esta máquina, han sido objeto de medida y discusión. Palabras clave: tráfico, suelo, horticultura

Abstract This work examines the loads and pressures applied to soil by high capacity harvesting machinery and heavy transport equipment, in horticultural crops. As a result of the percentage of affected surface and because of the number of passes, these plots are under higher traffic intensity than cereal crops, forage, or sugar beet farms. Small profilometres have been used in order to recognize tracks on the ground after different ruts and under various soil moisture conditions. Deformation and changes in bulk density caused by machinery passages have also been measured and discussed. Keywords: Traffic, Soil, Horticulture

Introducción La maquinaria en los cultivos hortícolas para industria En la horticultura actual, donde las producciones se destinan bien a industria, bien a mercado fresco con confección previa en almacenes, las explotaciones adquieren una dimensión importante que basan su rentabilidad en una mecanización integral. Los equipos de gran capacidad, tractores, cosechadoras y camiones de transporte particularmente, convierten las parcelas en vías de circulación permanente soportando altas cargas y frecuencias de paso. Amplias superficies, donde se producen cosechas muy importantes, entre 10 y 40 t/ha, según casos, y en el corto espacio de pocos días, suponen la recolección y el transporte de 500, 1000, 2000 y más t de producto. El tránsito de máquinas es pues, muy elevado. Además, lo habitual en la zona de clima mediterráneo es producir dos y tres cosechas anuales. Con ello la intensidad de tráfico al año queda duplicada y hasta triplicada. Los tractores de media y alta potencia que suelen emplearse en las labores de estas explotaciones eliminación o enterrado de residuos del cultivo anterior, subsolado, gradeo, fresado, nivelado y conformado, siembra, abonado, tratamientos,.. – (Gracia y Palau, 1983), considerando que llevan aperos colgados –subsoladores, abonadoras, cultivadores, fresadoras, sembradoras, etc..-, cargan sobre cada una de sus ruedas entre 1 y 2 t por término medio. La superficie sobre la que ruedan puede oscilar

536


 entre 10% y 35 %, dependiendo del ancho del neumático y del ancho de trabajo del apero acoplado. Por otro lado, considerando por término medio, cuatro pases para preparación de suelo, un pase de sembradora, dos pases de abonadora y tres de equipos de aplicación de fitosanitarios, el número de pasadas totales alcanza la cifra de 10. Si se tiene en cuenta el paso independiente de rueda delantera y trasera, resultarán 20 pases de rueda de tractor en labores de preparación y cultivo. Para la cosecha, al referirnos a las cosechadoras integrales - de espinaca, de guisante, de judía verde, de patata, de tomate, de maíz dulce..- , estamos ante máquinas que cargan sobre el suelo, normalmente entre 10 y 30 t (incluido el peso del producto en las tolvas). Por lo general van provistas de anchos neumáticos, 600 a 1000 mm, y los anchos de trabajo, entre 2 y 4 m por término medio. En consecuencia, la superficie de rodada alcanza con frecuencia el 50% del total. Por último, la flota de camiones que participa en el transporte de la cosecha desde la parcela a industria o almacén, puede afectar al tránsito en parcela de diversos modos. En unos casos, espera en calles adyacentes a que sea la cosechadora la que se desplace a descargar su tolva. En otros, transita por la parcela hasta llegar a la cosechadora, que se detiene y descarga su tolva. En otros circula en paralelo, cuando la descarga es continua. En definitiva, son distintas las situaciones y con ello el porcentaje de superficie rodada imputable a la operación de descarga de cosecha. Además, también dependerá de la autonomía de la cosechadora, de la dimensión de las parcelas y sus accesos. Cuando se utilizan cosechadoras de descarga continua, la superficie de rodada de los camiones puede estimarse de 25 a 50 %, según sean de rueda simple o de ruedas gemelas. Los neumáticos y el suelo agrícola El paso de las máquinas transmite cargas verticales y tangenciales sobre su superficie, que amenazan con hundir y cizallar respectivamente, las capas superficiales. Los neumáticos agrícolas actuales presentan diseños que tratan de reducir el impacto sobre el suelo de cultivo. Son de mayor anchura, con bandas de rodadura planas –aunque provistas de resaltes-. Al aumentar el área de contacto y repartir más la carga, trabajan con baja presión de inflado. El neumático se convierte en un anillo cilíndrico, más que anillo tórico, y la superficie de contacto se aproxima a un rectángulo, en lugar de una elipse. Los neumáticos de tracción utilizados en tractores de media y alta potencia trabajan a presión de 60 a 100 kPa y rigidez de cubierta equivalente a 50 kPa. Lo que supone de 110 a 150 kPa de presión sobre el suelo. En neumáticos de cosechadoras y camiones las presiones son algo mayores. Sumando la rigidez de cubierta, suponen de 150 a 250 kPa de presión sobre el suelo. No obstante, al no ser la distribución de presiones uniforme debido a los resaltes y hendiduras del propio neumático, se puede alcanzar en algunos puntos valores hasta cinco veces superiores a los de referencia (Gupta y Raper, 1994). Pero los efectos nocivos sobre el suelo, como es la compactación y la deformación del perfil, dependen no sólo de la presión y de las cargas que sobre él actúan, sino de la respuesta de cada suelo según su naturaleza y estado. De ahí, el interés de trabajos empíricos que relacionan, y determinan mediante análisis multivariante, los valores de: resistencia a la penetración, compactación, humedad, textura, materia orgánica,.. de los suelos de labor (Busscher, 1990; Da Silva et al; Smith et al. 1997) El trabajo que aquí se presenta tiene dos objetivos: a) estimar la intensidad de tráfico rodado en una explotación hortícola y b) constatar y medir la modificación del perfil del suelo y de su densidad aparente, tras el tránsito de un tractor de media potencia.

Materiales y Métodos La intensidad de tráfico rodado (T)

537


 Para estimar la intensidad de tráfico rodado en una explotación, se ha analizado las operaciones habituales en el ciclo de cultivo y las dimensiones de los equipos utilizados. Por un lado, se contabiliza el paso de los tractores con aperos en labores de preparación y cultivo, y por otro, el paso de cosechadoras integrales con equipos de transporte en la operación de recolección. El indicador de “intensidad de tráfico rodado” se ha definido como la relación entre superficie rodada (S) y la superficie total de la parcela, multiplicada por el número de veces (n) que cada rueda transita – sea delantera o trasera-. Es decir, T = S . n Diseño de la experiencia de campo El ensayo se ha realizado en un huerto en barbecho propiedad de la Universidad Politécnica de Valencia, sita en el municipio de Valencia polígono 87, recinto 1, parcela 287, cuyas coordenadas geográficas son: 39º 28’ 59,34” N; 0º 20’ 15,31” W. Suelo típico de la zona hortícola valenciana. Se trata de un suelo franco arenoso. Sin piedras visibles en la superficie del suelo. El contenido de materia orgánica es bajo, 1,55 %, mientras que presenta alto porcentaje de carbonato cálcico, 23 %, habitual en estas zonas por su procedencia de rocas calcáreas. Tras un pase de fresadora sobre suelo desnudo, quedó el suelo nivelado y relativamente suelto. Antes de iniciar las pruebas se dejó secar –quedó con una humedad de sólo el 4%- y se midió su densidad aparente. Se acotaron tres zonas en la parcela, aportando agua a dos de ellas. Así se consiguieron tres niveles de humedad diferentes (4%, 10% y 14%, aproximadamente). Con un tractor de media potencia (marca John Deere, mod 5820), lastrado y con apero suspendido alcanzando un peso total 65000 N, se hizo dos tipos de tránsito: a) Una sola pasada y b) diez pasadas por la misma rodada. Resultaron pues 9 casos distintos (3 humedades x 2 tipos de pasada). Se realizaron tres repeticiones para cada caso.

Figura 1. Parcela de ensayo

Figura 2. Perfilómetro

Figura 3. Medición densidad

Con un perfilómetro (fig 2), se determinó el perfil del suelo en secciones trasversales a la rodada, antes y después del pase de ruedas. Las deformaciones obtenidas se expresan en términos de hundimiento, tanto en profundidad de huella como volumen hundido de suelo por metro lineal. El perfilómetro construido al efecto, consta de 2 perfiles de aluminio, graduados cada 2cm. Se mantienen paralelos, dejando una separación por donde desliza el calibre, pie de rey, para medir la profundidad de las huellas del suelo. Las medidas obtenidas con el perfilómetro se han ajustado a funciones polinómicas en el intervalo del ancho de rodada. Además, de cada sección se obtuvo muestras de densidad aparente, después del pase de tractor. Se ha utilizado un cilindro de acero de 6 cm de diámetro y 8 cm de altura (fig. 3).

538




Resultados y Discusión La intensidad de tráfico rodado En la tabla 1 se resume la intensidad de tráfico estimada a partir del análisis de campo verificado para cada proceso mecanizado: Tabla1. Cargas, superficie de rodada y pasadas de vehículos en horticultura CARGA Superficie Número de INTENSIDAD DE MÁQUINA y por rueda RODADA PASADAS DE TRÁFICO OPERACIÓN (t) (S%) RUEDA (n) RODADO (T) TRACTORES de media y alta potencia con aperos 1a2 20 a 35 % 10 2 a 3,5 para preparación de suelo y siembra (total 5 pases) TRACTORES de media y alta potencia con 1a2 10 a 25 % 10 1 a 2,5 abonadoras (2 pases) y pulverizadores (3 pases) Grandes 3a5 50 % 2 1 COSECHADORAS integrales (1 pase) CAMIONES de alta capacidad con cosechadoras 3a5 25 a 50 % 2 0,5 a 1 de descarga continua Tránsito adicional por parcela de cosechadora o 3a5 5% 2 0,1 camión en la descarga discontinua de tolvas

Así pues, la intensidad de tráfico T será: • • •

Conjunto de LABORES de preparación y cultivo, T= de 3 a 6 y presiones sobre el suelo de 1,1 a 1,5 kPa COSECHA MECÁNICA con descarga continua sobre camiones, T= de 1,5 a 2,5 y presiones sobre el suelo de 1,5 a 2,5 kPa COSECHA MECÁNICA con descarga discontinua , T= 1,1 y presiones de 1,5 a 2,5 kPa

Sumando labores de preparación, cultivo y cosecha se obtiene desde una intensidad mínima de T= 4,1 hasta una máxima de T= 8,5. Puede interpretarse como que toda la superficie de la parcela es “rodada” por la maquinaria entre 4 y 8 veces por ciclo de cultivo; y entre 8 y 16 veces anualmente, si hay dos cosechas al año. O también, es equivalente a decir, que el 50 % de la superficie de la parcela es “rodada” por las máquinas entre 8 y 16 veces por ciclo de cultivo; y entre 16 y 32 veces anualmente, si hay dos cosechas. En comparación con las explotaciones extensivas de cereal y forraje, donde la intensidad de tráfico anual se mantendría entre 3 y 5, se observa que la intensidad es mucho mayor en la horticultura. Por un lado, hay más pases anuales, por otro la maquinaria, de cosecha especialmente, rueda un porcentaje mayor de superficie. Deformación del perfil En los siguientes gráficos (fig 4) se puede observar, las deformaciones del perfil del suelo, como hundimiento producido tras el pase del tractor, para 1 pasada y para 10 pasadas, en suelo seco, con 4 % de humedad.

539




Figura 4. Deformación del perfil del suelo en la rodada tras 1 y 10 pases, con humedad 4 %

Se observa que la huella de la roodada no es plana debido a los resaltes de la cubierta. El hundimiento se reparte a lo ancho de la rodaada de modo simétrico y bastante uniforme, espeecialmente cuando se trata de la primera pasada. Mientras con la primera pasada, el hundimiento del terreno alcanza los 5 cm, coon las diez pasadas se llega a los 8 cm. En términos de área hundida en la sección trasversal el resultaddo obtenido es 15 cm2 con una pasada, frente a 25 cm2 con c diez. En el siguiente histograma (figuura 5), se muestran los volúmenes de suelo desallojado y hundido por metro lineal, al paso del tracttor. Se representan los seis diferentes casos ensayados, con tres humedades y dos intensidades dee tránsito –de 1 y 10 pases-.

Figuraa 5. Volumen de suelo hundido en las rodadas

540


 Al igual que sucede aumentandoo el número de pasadas, se observa que la profunndidad de la huella, y con ello la deformación, es mayyor con el aumento de la humedad. Además, al aumentar a la humedad todavía es más clara la diferenciaa de deformación causada con 10 pasadas que conn una. Compactación del suelo El mejor indicador de la compaactación del suelo es la variación de su densiddad aparente. En ese sentido, el histograma de la fig. 6, muestra los valores resultantes de la densidaad aparente del suelo, antes del pase de rueda y en cadaa uno de los seis casos, como reflejo del efecto dee compactación. La densidad aparente deel suelo, ha pasado de 1,26 g/cm3 a valores enttre 1,41 y 1,56 según el caso. El error de las mediciones ha oscilado entre 0,01 y 0,06 g/cm3. Por tanto, la compactación no se s ha visto influida significativamente con la l humedad, ni con el aumento del número de pasadas. Eso indica que el hundimiento del suelo se d de las ha traducido en un deslizamiento partículas a modo de fluidización, fl más que en una compactación. Para P algunos autores Figura 6. Compactación n (Becher, 1992) eso califfica al suelo de poco estable, con pocaa agregación y consecuentemente con baja resisstencia a las cargas. Entonces, la mayor deformaación ocurrida con el aumento de las pasadas, al no coorresponderse con un aumento de densidad, se innterpreta, de acuerdo con Ellies et al. (2001) como unaa pérdida de estabilidad del suelo por la frecuenciaa de pasadas.

Conclusiones 1. Existe elevada intensidad de tráfico t en horticultura como se infiere de la observvación de la tabla 1. 2. La deformación del suelo al paso p de la máquina muestra una distribución unifoorme de la carga, sólo alterada por los resaltes dee la cubierta del neumático. La humedad deel suelo favorece la deformación bajo el paso de las ruedas 3. El suelo pobre en materia orgánica o ofrece poca estabilidad ante las cargass transmitidas por el tráfico rodado. En esas condiiciones se produce un deslizamiento de las partíículas del suelo antes que una compactación.

Bibliografía Becher, H. (1992) Agregate densiity and its posible effects on transport of soil soolution. Pflanzenernähr Bodenkunde 155, 361-366 c water content. Busscher, W.J., (1990). Adjustmennt of "at-tipped penetrometer resistance data to a common Transactions. ASAE 33, 5199–524. Da Silva, A.P. , and B.D. Kay, (19997). Estimating the least limiting water range of soiils from properties and management. Soil Sci. Soc. Am. J., 61, 877–883 Ellies, A., Santibañez, P. y Daroch, R. (2001) Efecto de los distintos rodados sobre la distribución de las tensiones en un perfil de suuelo. Suelo y Nutrición vegetal 2, 17-25 Gracia, C. y Palau E. (1983) Mecaniización de los cultivos hortícolas. Ed Mundi Prensa, Madrid M Gupta, S. y Raper, L. (1994) Prrediction of soil compaction under vehicles. In: Sooil compaction in crop production. Soane and Ouw werkerk. Minesota, 71-90 Smith, C.W., Johnston, M.A., Lorenntz, S.,(1997). The effect of soil compaction and soill physical properties on the mechanical resistance of o South African forestry soils. Geoderma 78, 93–111.

541


SOIL STERILIZING MACHINERY PROTOTYPE FOR PROTECTED CROPS Andrea. Formato1, Gian Piero. Scaglione1, Maria. Carillo1, Rita. Federico1, Antonio. Abagnale1 1 Department of Agricultural Science, University of Naples “Fed. II”, via Università 100, 80045 Portici, Naples,Italy; E-mail: formato@unina.it

Resumen La técnica de la esterilización del suelo es una praxi consolidada que permite eliminar, por medio de la elevación de temperatura, la mayoría de los fitopatógenos, insectos y malas hierbas. En este papel de trabajo se muestran los resultados experimentales conseguidos con una máquina termoesterilizadora de nueva concepción, proyectada para ser utilizada en el ámbito de las cultivaciones de invernaderos. El análisis de los resultados experimentales, llevado bajo el perfil químico y microbiológico ha permitido evaluar la eficacia y la eficienza del tratamiento obtenido con la nueva máquina. El suelo, tras haber sido transladado a través de una tolva es dirigido de forma continuada hacia un horno rotatorio instalado en la máquina. Cuando esté dentro de dicho horno, es triturado en pequeñas partes y mezclado gracias a la acción combinada de la fuerza de gravedad y de pequeñas alitas para el movimento. En esta fase cada una de las partículas entra en contacto con la llama del quemador y está expuesta a una temperatura que varía entre los 290 y los 1900 [°C], durante un tiempo incluido entre los 3 y 5 [min]. La tierra tratada es volcada otra vez al suelo, donde, en virtud de la propia inercia térmica, es capaz de conservar la temperatura de proceso predeterminada durante un tiempo suficiente para esterilizar definitivamentela la carga batérica todavía contenida. La capacidad operativa de la nueva máquina termoesterilizadora, que se puede expresar en [m3/h] de suelo esterilizado, depende de las específicas condiciones del proceso (humedad, temperatura y características mecánicas del suelo, velocidad de la máquina y profundidad del suelo esterilizado de una sola vez). Dicha máquina puede ser de tipo “semovente” o de “traino”, garantiza una considerable reducción de los tiempos del proceso con respecto a los metodos tradicionales y no requiere operatores especializados. Palabras clave: esterilización, suelo, maquina

SOIL STERILIZING MACHINERY PROTOTYPE FOR PROTECTED CROPS Abstract The heat-sterilization of the soil is an established practice that allows us to kill, by increasing its temperature, infestant weeds and pathogens that can damage crops that will be planted. A new machine for the soil sterilization has been designed to be used for protected crops in greenhouse. The analysis of both chemical and microbiological data allowed us to evaluate the efficiency and effectiveness of the treatment performed. The soil, after being cut, through a loading hopper, is conveyed continuously to a rotary kiln installed on the machine. Once inside this, it is crushed and mixed due to the tumbling vanes distributed on the inner shell of the kiln. During this phase, each particle comes in contact with the burner flame and, therefore, is exposed to a temperature ranging between 290-1900 [°C] for 3-5 [minutes], until the attainment of a pre-set temperature. Subsequently, after being sterilized, it is downloaded to the ground. So treated, due to its thermal inertia, the soil retains the process temperature for long enough to kill the infesting weeds and the soil pathogenic. The working capacity of the new machine, that we can express in [m3/h] of soil sterilized, depends on the specific operating conditions (humidity, temperature, soil strenght parameters, forward speed of the machine and depth of cut), it guarantees a considerable reduction of the process time compared to the traditional methods and does not require the use of specialized operator. Keywords: soil sterilizing, soil sterilizing machineries

542


Introduction Soil thermal treatments are aimed to destroy the infesting weeds and the soil pathogenic (mushrooms, nematodes, bugs, etc.). A very diffused method consists in the use of vapor, heating the soil layer. (Jenkins, 1960; Hansen and Reimann, 1963; Bollen, 1969; Miller et al., 1976; Robinson and Foster, 1987; Triolo and Vannacci, 1993; Keck et al., 1995; Gaillard et al., 1998; Tanaka et al., 2003; Van Loenen et al, 2003 ; Berruto et al. 2004). Another method is the flame wedding, it consists in the use of a free flame (whose temperature is ranged between 1200 - 2000 °C), produced by burners fed by GPL, acting on the infesting weeds for around 0,1-0.9 s. (Formato and Capaldo, 2002; Peruzzi et al 2002). Other methodologies of application of the “dry” heat, what for instance the use of infrared radiations, of microwaves, of laser, etc., have not been successful for different motives, among which: high risks for the users, the excessive overhead, the scarce reliability. The soil thermal sterilization, consists of increasing the soil temperature up to a determined value, for a sufficient time to reduce the bacterial load within determined values range. Experimentally it has been observed by different authors (Cayrol, 1971; Cuany, 1971 ; Finkelman et al., 2006; Gilardi et al., 2007,), that the decrement of the cells (or spores) of a microorganism, it follows a kinetics of the first order, dN/dt = - k x N

(1)

where N is the number of cells (spores) present and the constant k (constant of extinction) it depends from the type of microorganism and temperature. It is defined Thermal Death Time TDT, the necessary time to kill a determined number of microorganisms at a specific temperature, and it is time range corresponding to 12 times the time of decimal reduction: TDT =12 x D

(2)

Where D is the time of decimal reduction or the time required to destroy the 90% of the microorganisms. The point of thermal death, is equivalent to the necessary temperature to kill a determined number of microorganisms in a preset time range (usually 10 minutes). Death is defined as the incapability of the microorganism to form visible colonies after a period prolonged of incubation. The TDT is assumed for convention as the necessary time range to obtain the “practical” sterilization of the system (since that “ theoretical” is not attainable in finite time range). In table 1, temperature-time conditions necessary for the eradicating in 10 minutes of some vegetable pathogens are reported. Addressed in such sense, a soil sterilizing machine has been set up. Table 1. Temperature-time conditions for the eradicating of some vegetable pathogens (in 10 minutes). Pathogens Sclerotinia sclerotiorum Sclerotium cepivorum Verticillium dahliae Fusarium oxysporum f.sp.lycopersici Fusarium oxysporum f.sp.lactucae Pythium ultimum Erwinia amylovora Elateridi

Temperature 60 °C 50 °C 55 °C 60 °C 60 °C 60 °C 55 °C 50 °C

Reference van Loenen et al. (2003) van Loenen et al. (2003) van Loenen et al. (2003) van Loenen et al. (2003) van Loenen et al. (2003) van Loenen et al. (2003) Keck et al. (1995) van Loenen et al. (2003)

543


Materials and methods It has been designed and realized a prototype of soil sterilizing machine (fig.1,2). It is constituted from: a system to cut, remove and carriage the soil, in continuous way, toward the hopper of the rotating oven; a rotating oven installed on a self-propelled structure (or hauled) with a downloading system of the sterilized soil. During the operative phase a portion of cut soil is submitted to a crushing and remixing action that happens inside the rotating cylinder (rotating oven), provided of special inside ribs. In such oven it happens the wanted condition that, every single soil particle, in a determined time, it crosses a preset temperatures field, produced by a flame acting in the rotating cylinder, so that the particle underwent the desired temperature increase. Insofar the soil final temperature depends on the crossing speed of the rotating oven, which is function of the cylinder rotation speed and the longitudinal slope. Then acting on such parameters, the soil final temperature, at the output of the rotating oven, can be changed. The soil particles final temperature will be set up on the basis of pathogens to eliminate and considering the soil cooling curve (tab.1). The soil-treated downloading system through of the loopholes located on the extremity of the cylinder has been modeled by numerical code Solid Works 2011. To evaluate and to optimize the soil permanence times in the cylinder and the cylinder slope, thermodynamic numerical simulations have been performed by the computational code ABAQUS 6.

Figure 1. Components of soil sterilizing machine prototype

Figure 2. Scheme of the soil sterilizing machine

Experimental tests have been performed by using the considered machine, aimed to evaluate the working performed for different soil typologies. Two different typologies of greenhouse soils with different moisture values have been considered: type A (sand 83%, silt 2%, clay 15%) with moisture values of 17, 18, 18.4 and 21.5%; type B (sand 42%, silt 23%, clay 35%) with moisture values of 17, 18, 19 and 21%. The values of thermal conductibility and thermal capacity for the two soil typologies are: type A : thermal conductibility 0.8 W/mK and thermal capacity 1.4 MJ/m3K; type B : thermal conductibility 1 W/mK and thermal capacity 1.5 MJ/m3K.

544


Further, the cooling curve for the two soil typologies considered has been evaluated, starting from an initial temperature of 121°C. A soil mass contained in a volume of a cube with a side of 40 cm has been considered. Such soil volume has been arranged on trays on which a soil layer of 0.5 cm has been formed, so that to avoid, at the most, the thermal gradients inside the soil layer and to obtain a soil temperature the more possible uniform. Such trays have been put in heater and heated up to a temperature uniform of 121°C. Such heated soil has been put, then, in the cube with a side of 40 cm and inside it, 3 thermocouples have been located: the first one at a depth of 2 cm, the second at 2 cm from the bottom (depth 38 cm), and the third at a depth of 20 cm. The environmental temperature was of about 20 °C. The test has been repeated 3 times for both the soil typologies, detecting a maximum difference lower than 5%. The cooling curve of the 1° thermocouple has been considered, (it cools more quickly in comparison to the others) and therefore the mean values of the temperatures detected by the 1° thermocouples during the cooling of the considered soils have been reported. To evaluate the effectiveness of the sterilizing action of the considered machine, comparison between not-treated and treated soils have been performed, by mean the analysis of the microbiological and chemical effects on the micro-fauna, due to the treatment performed. The soil samples used for the analyses, have been obtained by a protocol, for which for the considered area, 3 sub-samples at three different depths (10 cm, 20 cm, 30 cm) have been withdrawn. After an accurate remixing 3 samples with volume of 0.5 dm3 have been obtained on which analyses have been performed.

Results and Discussion By the performed thermodynamic analysis, it has been possible to obtain the temperatures distribution inside the rotating oven in the considered operative conditions, with 30 turns per minute; slope of 15° (fig. 3). The soil quantity treated has been of 0.030 m3/s. In the operative conditions performed during the experimental tests, the soil crossed the whole cylinder in 3-4 s around, and the final temperature of the considered soil has been of around 80 °C. The flame escapes from a burner with circular section, with diameter of 150 mm, and the length of the flame, in the operative conditions considered, it is of around 500 mm and that the flame has a geometric shape similar to half-ellipsoid, with smaller diameter of 150 mm and greater diameter of 1000 mm.

Figure 3. Temperatures distributions inside rotating oven obtained by numerical simulation

By mean the experimental tests, the cooling experimental curves of the considered soils have been obtained, and it has been reported the curve detected by the thermocouple n.1 (Figure 4). These data show us as, considering a determined pathogen, whose TDT is 60 °C for 10 minutes, to perform the total eradicating of it, from the considered soil, it is necessary to heat the soil up to temperature of around 80°C, in this way the considered soil has for 10 minutes, the temperature greater than 60°C. In fact, according to the soil cooling curve calculated, after about 10 minutes the soil will reach the temperature of 60°C, fully satisfying the conditions of temperature-time for the eradicating of the pathogen reported in table 1, from the considered soil. Insofar as previously said and reported

545


in the table 1, all the microorganisms, exposed to lethal temperatures, and ranged in the considered thermal interval, for a time period equal to their TDT they suffer a total demolition, inside the treated soil.

Figure 4. Mean cooling curve of the considered soils

During the experimental tests performed, all the examined soils had an initial temperature around the 20 °C, and they have been heated up to the temperature of around 80°C, with an increase of temperature of around 60°C. The considered soils, with initial moisture ranged between 17 and 21%, after the treatment, they have made to notice a loss of the 3-4% of water, and they have not shown signs of cooking i. e. pulverization and skinniness of organic substance. In the agricultural soils, the risk of a strong pulverization is always avoided by the presence of water in the soil to treat, that vaporizing because of the heat effect, spreads in the soil mass, making uniform the temperature of it, and protecting at the same time it against the action of the flame. At the soil moisture is added the quantity of water present in the fuel and also that, during the process of combustion is formed. Such water represents a further guarantee against the risks of the pulverization from excessive heating and contemporarily allows to obtain useful temperatures to perform the soil sterilization. In the table are reported the operative parameters values detected before and after the soil treatment, for the soil types considered. Every experimental test has been repeated three times. The maximum difference among the obtained results was lower than 5%, for which in the following table 2 the mean values obtained have been reported. Tinitial = initial temperature of the soil considered; Tfinal = outlet soil temperature (at the output of the rotating cylinder); :T= (Tfinal- Tinitial); Ui = initial soil moisture percentage (moisture mass content in the soil / total mass*100) (kg/kg); Uf = final soil moisture percentage (at the output of the rotating cylinder) (moisture mass content in the soil/total mass)*100 (kg/kg); :U = Ui-Uf Table 2. Experimental results obtained by soil sterilizing tests Test

Soil type

1 2 3 4 5 6 7 8

A A A A B B B B

Ti °C 20,0 22,0 19,0 21,0 21,0 20,0 22,0 19,0

Tf °C 80,0 81,0 79,0 82,0 82,0 80,0 81,0 79,0

:T °C 60,0 59,0 60,0 61,0 61,0 60,0 59,0 60,0

Ui % 18,0% 18,4% 21,5% 17,0% 21,0% 21,0% 18,0% 19,0%

Uf % 14,7% 15,9% 19,0% 14,0% 18,0% 17,0% 15,0% 15,0%

:U=Ui-Uf % 3,3% 2,5% 2,5% 3,0% 3,0% 4,0% 3,0% 4,0%

546


A T-statistic with a probability of 95% was performed on each group of samples, and has led to the values shown in the subsequent table 3. Table 3. T-statistic with a probability of 95% for A and B Tests

Experiment A Experiment B

:T (°C) 60,0 ± 1,3 60,0 ± 1,3

:U=Ui-Uf (%) 2,8% ± 0,6% 3,5% ± 0,9%

It has been calculated that, in the soil treated, a decrement of the total microbial load until zero or at few unity has been obtained. Besides performing an evaluation of the micro-fauna existing in the soil, before and after the treatment, a decrement, and in some cases a total absence, of the harmful micro- fauna for the growth and the development of the different agricultural crops has been noticed. Besides the heating and the loss of water in the tests conditions performed, they have not involved meaningful transformations in the structure of the mineral, in the fraction of the clay. The light transformations detected, they do not concern the soil fundamental structures but essentially reversing water losses.

Conclusions A soil sterilizing machine has been set up with a working capacity of 360 m2/h. It has been realized for greenhouse protected crops and it has been verified its validity from the functional point of view and of the effectiveness of the treatment of soil sterilization, examining the obtained results also by different points of view: chemical and microbiological. Besides with such machine, although its working is tied up to a determined operative capacity, the time necessary to perform the soil sterilizing, is reduced in way that, it does not fear comparisons with other chemical methods traditionally used. Besides, the proposed machine can be used in the farms, as a normal operative machine, without the necessity to use specialized user. Finally, with such system, it is obtained a saving in terms of cost of sterilizing treatment and contemporarily it does not cause a soil environmental pollution.

References Berruto, R., Gay, P., Piccarolo, P., and Tortia, C. (2004). Grey-box models for steam soil disinfestation simulation. Mathematica and Computer in Simulation 65,191-200. Bollen, G.J. (1969). The selective effect of heat treatment on the microflora of a green house soil. Netherlands Journal of Plant Pathology 75, 157-163. Cayrol, J. C. (1971). Influence des traitements nématicides. Le Nématodes des cultures. Journées d'étude et d'information. 3-5 Novembre 1971 Paris, 123-128. Cuany, A. (1971). Les methodes physiques de lutte. Le Nématodes des cultures. Journées d'études et d'information. 3-5 Novembre 1971, Paris, 595-606. Finkelman, S., Navarro, S., Rindner, M.,and Dias, R. (2006). Use of heat for disinfestation and control of insects indates: laboratory and field trials. Phytoparasitica 31, 37-48. Formato, A., and Capaldo, N. (2002). Optimal design of a thermo-mechanical soil sterilizer by the use of computational fluid dynamics. International Conference on Agricultural on Agricultural Engineering AgEng 2002 Budapest 30 June-4 July. Gaillard, S., Leguerinel, I., and Mafart, P. (1998). Model for combined effects of temperature, pH and water activity on thermal inactivation of bacillus cereus spores. Journal of Food Science 63, 887889.

547


Gilardi, G., Said, K., Gullino, M.L., and Garibaldi, A. (2007). Phisical soil sterilizing: letal temperatures for any pathogens. Informatore Fitopatologo 57, 47-52. Hansen, N.H., and Reimann H. (1963). Factors affecting the heat resistance of nonosporing organism. Journal of Applied Bacteriology 26, 314-333 Jenkins, W. R. (1960). Control of Nematodes by physical methods. Nematology. Foundamentals and Recent Advance with Ernphasis on Plant Parasitic and Soil Forms edited by J. N. Sasser and W.R. Jenkins, 443-446. Keck, M., Chartier, R., Zislavsky, W., Lecomte, P., and Paulin, J.P. (1995). Heat treatment of plant propagation material for the control of fire blight. Plant Pathology 44, 124-129. Miller, F. C., Munnecke, D. M., Wilbur, W., and Darley, E. F. (1976). Effect of heating or drying on Armillaria mellea or Trichoderma viride and the relation to survival of A. mellea in soil. Phytopathology 66,1363-1368. Peruzzi, A., Raffaelli, M., Ginanni, M., and Mainardi, M. (2002). Development of innovative machines for soil disinfection by means of steam and substances in exothermic reaction. Proceedings of the 5th EWRS Workshop on “Physical and Cultural Weed Control”, Pisa 11-13 March 2002, 220- 229. Robinson, K., and Foster, G., (1987). Control of potato blackleg by tuber pasteurisation: the determination of time–temperature combinations for the inactivation of pectolytic erwinia. Potato Research 30, 121-125. Tanaka, S., Kobayashi, T., Iwasaki, K.,Yamane, S., Maeda, K., and Sakurai K. (2003) Properties and metabolic diversity of microbial communities in soils treated with steam sterilization compared with methyl bromide and chloropicrin fumigations. Soil Science and Plant Nutriction 49, 603-610. Triolo, E., and Vannacci, G. (1993)- Innovative Methods for the disinfestation for protected crops. Metodi innovativi per la geodisinfezione in coltura protetta. Colture Protette 1, 56-62. Van Loenen, M.C.A., Turbett, Y., Millins, C.E., Feilden, N.E.H., Wilson, M.J., Leifert, C., and Seel, W.E. (2003). Low temperature-short duration steaming of soil kills soil-borne pathologens, nematode pests and weeds. European Journal of Plant Pathology, 109, 993-1002.

548


Influencia de los mecanismos de gobierno en el desempeño en las cooperativas agrarias de comercialización G. Marcos-Matás 1, M. Hernández-Espallardo2 y N. Arcas Lario1 1

Dpto. de Economía de la Empresa, Escuela Técnica Superior de Ingeniería Agronómica, Universidad Politécnica de Cartagena, 30203, Cartagena. Email contacto: gustavo.marcos@um.es 2 Dpto. Comercialización e Investigación de Mercados, Universidad de Murcia, Campus de Espinardo, 30100, Murcia.

Cátedra Cajamar de Cooperativismo Agroalimentario - Universidad Politécnica de Cartagena

Resumen Las cooperativas agrarias de comercialización tienen que competir contra otras alternativas de comercialización que operan también en origen, en mercados caracterizados por una gran presión de la demanda debido al gran poder de negociación de la distribución, y al creciente número de comercializadores fruto de la globalización y desregularización de los mercados. En este escenario, la fórmula cooperativa se pone en entredicho como una forma viable para los agricultores para conseguir el máximo desempeño en estos mercados. Apoyados en la Teoría de los Recursos y Capacidades establecemos un marco teórico para explicar el desempeño de la cooperativa a partir de los mecanismos que gobiernan la relación entre la cooperativa y sus socios. Sobre una muestra de 249 cooperativas son testadas las hipótesis planteadas. Los resultados permiten comprobar la bondad de estos mecanismos para explicar el desempeño de la cooperativa. Palabras clave: desempeño,, mecanismos de gobierno, cooperativas agrarias de comercialización

Inter-firm governance mechanisms in agricultural marketing co-operatives: Effects on their performance Abstract The co-operative sector is in a quandary with a vast number of farmers supplying the co-operatives’ competitors at the origin of the supply chain (Spear, 2000), while many of the current farmers-members of the co-operatives do not show enough level of commitment to allow co-operatives to react in good conditions to the new market challenges (Nilsson, 2001). A basic postulate of this research is that the inter-firm governance mechanisms that the cooperative maintains with its members-suppliers have an influence on the cooperatives its market performance. We rely on Resourced-based View to posit the hypotheses of the model proposed in this research. 249 questionnaires were obtained from managers of Spanish agricultural marketing co-operatives. A structural equations model was developed to test the hypotheses. The results show that several inter-firm governance mechanisms do have a positive influence in co-operatives performance. It allows us to draw some managerial recommendations to the management of agricultural co-operatives. Keywords: performance, governance mechanisms, agricultural marketing co-operatives

Introducción Las cooperativas agrarias de comercialización son una de las alternativas que poseen los agricultores para comercializar su producción. Desde el punto de vista organizativo y de gobierno, estas alternativas difieren en su grado de integración, suponiendo la cooperativa un paso intermedio entre la transacción libre en el mercado a través de alhóndigas, donde no existe ningún tipo de integración; y la empresa productora-comercializadora, la cual supone el extremo más integrado (Bijman y Hendrikse, 2003).

549


La cooperativa agraria se aprovisiona casi en su totalidad de las producciones de sus socios, los cuales además son también sus propietarios, usuarios de sus servicios y supervisores de una organización que distribuye el beneficio de forma igualitaria sobre la base del uso o volumen comercializado por el agricultor (Barton, 1989). Este tipo de relación peculiar dota a la organización de una forma de gobierno relacional, lo que confiere al análisis de la relación socio-cooperativa un papel muy relevante en el estudio de las cooperativas y sus posibilidades de competir en los mercados de destino (Nilsson, 2001). Las cooperativas agrarias atraviesan un periodo complejo, propiciado no sólo por la coyuntura económica actual, sino por la existencia de un mercado cada día más globalizado, concentrado y menos regulado (Baamonde, 2009). El modelo cooperativo se ha enfrentado a grandes desafíos que han cuestionado su eficacia como forma de gobierno (Nilsson, 2001). Ya desde mediados de los años noventa la Alianza Cooperativa Internacional ha prestado un creciente interés a la problemática del gobierno cooperativo. La importancia de disponer de eficaces sistemas de gobierno es evidente, pero acertar en el establecimiento de un buen gobierno no es fácil, por lo que el mayor desafío teórico y empresarial reside en implementar modelos óptimos de relaciones de gobierno en las cooperativas (Chaves y Schediwy, 2004). Dicho esto, el presente estudio se centra en cómo es gobernada dicha relación de aprovisionamiento, y cómo ello determina el desempeño de la sociedad cooperativa y, consecuentemente, sus posibilidades de supervivencia en el mercado (Bijman, 2002). Dada la relevancia que tienen las cooperativas dentro de la comercialización de productos agrarios, resulta de especial interés estudiar los factores que influyen en su desempeño (Vargas y García, 2003), más aún en un sector cada vez más competitivo como es el de la cadena de suministro de productos del primer sector. Así pues, el objetivo principal de este trabajo es el de comprobar empíricamente que el desempeño de la cooperativa se puede explicar a través del gobierno que hace ésta de la relación que mantiene con sus socios. La contrastación empírica de dichos modelos se realiza con la información obtenida mediante encuestas a una muestra de gerentes de cooperativas agrarias que recogen sus percepciones acerca de las variables objeto de estudio en este modelo.

Marco teórico La Teoría de los Recursos y Capacidades sugiere que el gobierno de una relación afecta a cómo son gestionados los recursos y por tanto su capacidad para generar rentas relacionales (Dyer y Singh, 1998). Se presentan así estos mecanismos de gobierno como herramientas capaces de generar ventajas competitivas y mejorar el desempeño (Wang y Wei, 2007). La creación de rentas relacionales es posible cuando las partes combinan, intercambian, o invierten en activos idiosincrásicos, conocimiento, y recursos o capacidades, y cuando emplean mecanismos de gobierno efectivos que permiten la creación de rentas a través de la combinación sinérgica de activos, conocimiento o capacidades (Dyer y Singh, 1998). Los mecanismos de gobierno facilitan la creación de rutinas de intercambio de conocimiento (Dyer y Singh, 1998), entendiendo estas rutinas como interacciones entre las partes que permiten la transferencia, recombinación, o creación de conocimiento específico (Dyer y Singh, 1998). Compartir conocimientos y aprender de la otra parte mejora su habilidad para desempeñar su papel más eficientemente (Grant, 1996) y puede convertirse en una importante fuente de coordinación y, por tanto, ser crítica para la creación de valor (Hult, et al., 2004). Además, el conocimiento recibido sirve para educar sobre las operaciones que se dan dentro de la relación y sobre las necesidades y preferencias de los clientes (Hult et al., 2002). Así, entendemos que los mecanismos de gobierno de la relación tienen potencial para afectar directamente al desempeño. Concretamente, en este trabajo nos apoyamos en los mecanismos reconocidos por Wathne y Heide (2000): la supervisión, los incentivos, la selección y la socialización.

550


Particularmente, los mecanismos de selección de los socios, o más concretamente, la evaluación y período de prueba a los que son sometidos, no solo en cuanto a sus aptitudes, sino también en cuanto a sus valores o actitudes es un mecanismo capaz de generar un intercambio y aprendizaje de conocimientos. De esta manera, este proceso puede ser fuente de creación de valor. Pero más allá del valor que se genere por este proceso, en la medida en que la cooperativa ponga en marcha estos mecanismos será capaz de seleccionar los socios más productivos e identificados con los valores de la cooperativa y cuya contribución a la cooperativa mejore su desempeño. En esta línea, Chukwu e Igwe (2012) encontraron que existía una relación positiva entre las entrevistas de selección y los resultados. De tal forma, proponemos: H1: Los mecanismos de selección de la cooperativa mejoran el desempeño de la relación Los mecanismos de socialización descansan en relaciones de confianza personal que generan (Dyer y Singh, 1998) y favorecen las rutinas de intercambio de conocimiento. En este sentido, la confianza actúa como un mecanismo de control social continuo y reductor de riesgo, promoviendo la cantidad de conocimiento intercambiado (Cheng et al., 2008). Estas reglas sociales y confianza reducen los posibles costes de conflicto y otros costes de transacción y son más eficientes que otros mecanismos de gobierno en cuanto a encontrar y desarrollar posibles sinergias en la relación (Aulakh et al., 1996; Dyer y Singh, 1998). Por ello, estos mecanismos son vehículo para la generación de rentas relacionales (Dyer y Singh, 1998). Establecemos pues que: H2: Los mecanismos de socialización de la cooperativa mejoran el desempeño de la relación En cuanto a los incentivos propiamente dichos, entendidos como recompensas por el buen comportamiento, en la medida que fomentan los comportamientos cooperativos serán capaces de generar rentas relacionales y por tanto traducirse en un mejor desempeño de la relación. H3: Los incentivos de la cooperativa mejoran el desempeño de la relación Por su parte, los hostages o rehenes, es decir, las inversiones no recuperables que actúan como incentivos, pueden resultar altamente productivos desde el punto de vista tanto de reducción de costes e incremento de ingresos (Wathne y Heide, 2000). Este tipo de inversiones son necesarias en algunas ocasiones y son más eficientes y efectivas que los activos generales por estar centradas en una relación de intercambio específica (Brown et al., 2000; Brown et al., 2009). Adicionalmente, desde un punto de vista relacional, en tanto que los activos basados en el conocimiento propician la creación e intercambio de conocimiento, pueden producir ventajas competitivas a través de la creación de rentas relacionales (Dyer y Singh, 1998). Proponemos entonces que: H4: Los hostages de la cooperativa con los socios mejoran el desempeño de la relación Por último, en cuanto a los mecanismos de gobierno de supervisión, se puede esperar un efecto directo en el desempeño consecuencia del aprendizaje que se produce derivado del intercambio de conocimiento acerca del mercado y procedimientos (Hernández-Espallardo y Arcas-Lario, 2003). Igualmente, también tendrán una influencia positiva a través de la reducción de la incertidumbre asociada al establecimiento de reglas (Cai et al., 2009), incentivando a los socios a conseguir los resultados o seguir las normas (Hernández-Espallardo y Arcas-Lario, 2003). Pero esta supervisión puede ser interpretada como una falta de confianza y restricción de la autonomía, provocando comportamientos poco cooperativos que erosionen la relación (Ramaswami, 1996), y por tanto puede suponer un grado de frustración y desmotivación de los socios que puede acabar afectando a su actividad y al desempeño de la cooperativa. De tal manera, proponemos: H5: Los mecanismos de supervisión de la cooperativa no tienen un efecto significativo en el desempeño de la relación

551


Metodología Como población han sido consideradas las cooperativas agrarias españolas de comercialización. La recogida de información se llevó a cabo mediante encuestas online dirigidas al gerente. Por este método se han conseguido 140 cuestionarios referentes a las escalas que se presentarán a continuación. Adicionalmente, se lanzó otro cuestionario a cooperativas que estuvieran asociadas a una cooperativa de segundo grado, midiendo este último los mismos conceptos que se postulan en el trabajo para los socios, pero en este caso referidos a las cooperativas asociadas que forman la cooperativa de segundo grado a la que pertenece el encuestado. De este sondeo se obtuvieron 109 cuestionarios válidos, por lo que finalmente se contó con un total de 249 cuestionarios. Para la medición de los conceptos se han utilizado medidas con múltiples enunciados que están inspiradas en la literatura. Sin embargo, como ninguna de las medidas había sido utilizada previamente en estudios en el ámbito de las cooperativas, se hizo un trabajo importante de adaptación en los pretest. Para la contrastación del modelo de medida y estructural se ha utilizado un modelo de ecuaciones estructurales basado en la técnica de Partial Least Square (PLS). Esta técnica es especialmente útil para tratar las medidas de carácter formativo (Henseler et al., 2009) como es el caso de las utilizadas en nuestro modelo.

Resultados Para la evaluación del modelo estructural mediante PLS se ha de atender a la varianza de las variables latentes dependientes explicadas por las independientes que las predicen (R2) y evaluar de forma particular la significatividad de los coeficientes asociados a las relaciones propuestas. En este sentido, el modelo tiene suficiente poder predictivo para la explicación de la variable desempeño (R2=0,34), siendo además el estadístico Q2 superior a cero, mostrando una adecuada capacidad de predicción (Geisser, 1975). La Tabla 1 muestra para las relaciones propuestas los coeficientes estandarizados y sus valores t. Tabla 1. Contraste de hipótesis Hipótesis H1 H2 H3 H4 H5

SelecciónÆDesempeño SocializaciónÆDesempeño IncentivosÆDesempeño HostagesÆDesempeño SupervisiónÆDesempeño

Coef. estand. 0,06 0,31 0,06 0,34 0,04

Valor t 0,84 4,91 0,94 4,65 0,51

La estimación de esta validez es realizada dentro del enfoque PLS por la técnica de bootstraping, la cual calcula los pesos de los ítemes sobre el constructo y su significatividad (Chin, 1998). Para un test de una t de dos colas se considera el 1,65; 1,96 y el 2,58 como valores críticos para el estadístico t para una significatividad (valor p) de 0,10; 0,05 y 0,01 respectivamente. De esta manera, las los resultados del análisis muestran un efecto positivo y significativo de los mecanismos de socialización en el desempeño de la cooperativa, tal como se propuso en H2. De igual forma los mecanismos de hostages muestran un efecto positivo y significativo en el desempeño, como se postuló en H4. Por su parte, la hipótesis planteada sobre la supervisión (H5) puede ser aceptada al demostrarse que no existe una relación significativa entra la ejecución de mecanismos de supervisión por parte de la cooperativa y la mejora del desempeño. Sin embargo, el análisis de datos no ha mostrado apoyo para las hipótesis planteadas sobre el posible efecto que pudieran tener los mecanismos de selección (H1), incentivos (H3) y mecanismos de supervisión (H5).

552


Conclusiones Aunque la relación entre la cooperativa y sus socios ha sido tratada bajo múltiples perspectivas y enfoques teóricos, la conexión entre la forma como es administrada dicha relación peculiar de aprovisionamiento y el desempeño de la cooperativa en los mercados de destino es un aspecto inédito en la literatura empírica sobre cooperativas agrarias, a pesar de que dicho análisis tiene interés para la realización de propuestas a la dirección de las cooperativas. Este aspecto del desempeño de las cooperativas adquiere especial relevancia en nuestros días donde la crisis económica, la alta competitividad en el sector y la concentración en la distribución hacen de éste un aspecto vital para la supervivencia de las empresas. Pero el desempeño no solo se presenta como un factor relevante por la situación en el sector, sino que desde un punto de vista organizativo cobra también importancia en momentos en los que la competitividad de la cooperativa como fórmula de organización en la fase de producción en origen está siendo sometida a revisión (Bijman, 2002). Por otra parte, aunque el efecto de la organización de las relaciones de aprovisionamiento sobre el desempeño de la firma ha sido tratado en otro tipo de relaciones de aprovisionamiento más convencionales, merece la pena observar hasta qué punto sus prescripciones son de aplicación a la peculiar fórmula organizativa que representa la sociedad cooperativa. Específicamente, el estudio ha aportado evidencia empírica de la influencia de los mecanismos de gobierno propuestos por Wathne y Heide (2000) en el desempeño en la relación entre las cooperativas agrarias y sus socios. Concretamente, la socialización y hostages han mostrado ser mecanismos eficaces para la mejora del desempeño. Sin embargo, los incentivos no han mostrado tener ningún efecto sobre el desempeño. Estos resultados permiten subrayar la importancia del papel que juegan estos mecanismos, y especialmente la importancia de los de un carácter más social de la relación, como la confianza y la alineación de valores y objetivos. Por el contrario, los mecanismos de gobierno de tipo más formal como los incentivos y la supervisión se han presentado como menos relevantes en este tipo específico de relación. Como apunta la literatura, las relaciones entre los agentes de la cooperativa se caracterizan sobre todo por la confianza, entendimiento mutuo, problemas y objetivos comunes y espíritu de grupo (Nilsson, 1996). Estos factores, hasta cierto punto, confieren un gobierno tipo clan entre sus miembros (Ouchi, 1979). Es por ello que el problema de control se hace menos relevante bajo un alto compromiso de los miembros. Adicionalmente se podría esgrimir otra razón del porqué los incentivos no muestran los efectos predichos en el desempeño, ya que podría deberse a que su uso necesita de cierto tipo de información y que ésta sea fiable para poder administrar las recompensas. Si esta información no es suficiente, poco fiable o distorsionada, puede dar lugar a una distribución de recompensas inadecuadas que pueden ser percibidas como injustas entre los socios y desincentivar así los buenos comportamientos. Del estudio se pueden desprender ciertas recomendaciones para la dirección de las cooperativas. Por ejemplo, deberían preocuparse por promover mecanismos de socialización, esto es, difundir e implantar una cultura en toda la cooperativa y unos valores que fomenten la cooperación y adaptación mutua. E igualmente promover las inversiones en activos y en formación específicos a su negocio y relación particular. Estos mecanismos han mostrado ser los más eficientes para mejorar el desempeño de la cooperativa.

Agradecimientos Los autores agradecen a la Cátedra Cajamar de Cooperativismo Agroalimentario-Universidad Politécnica de Cartagena y al Ministerio de Ciencia e Innovación (MICINN) y FEDER (proyectos AGL2010-22335-C03-02 y AGL2010-22335-C03-03) por la financiación recibida, sin la cual este trabajo no podría haberse llevado a cabo.

553


Bibliografía Aulakh, P. S., Kotabe, M., y Sahay, A. (1996). Trust and performance in cross-border marketing partnerships: A behavioral approach. Journal of International BusinessStudies 27, 1005-1032. Baamonde, E. (2009). El cooperativismo agroalimentario. En Lamo J. (Coord.), El nuevo sistema agroalimentario en una crisis global. Colección Mediterráneo Económico. Almería: CAJAMAR, 229246. Barton, D. (1989). Co-operatives in Agriculture. En Cobia, D. (Ed.). Prentice-Hall, 21- 34. Bijman, J. (2002). Essays on agricultural co-operatives, governance structures in fruit and vegetables chains. ERIM Ph. D. Series Research in Management 15. Bijman, J., y Hendrikse, G. (2003). Co-operatives in chains: institutional restructuring in the Dutch fruit and vegetables industry. ERIM Report Series Research in Management, ERS-2003-089-ORG. Brown, J. R., Crosno, J. L., y Dev, C. S. (2009). The effects of transaction-specific investments in marketing channels: The moderation role of relational norms. Journal of Marketing Theory and Practice 17, 317333. Brown, J. R., Dev, C. S., y Lee, D-J. (2000). Managing marketing channel opportunism: the efficacy of alternative governance mechanisms. Journal of Marketing 64, 51-65. Cai, S., Yang, Z., y Hu, Z. (2009). Exploring the governance mechanisms of quasi-integration in buyer-supplier relationships. Journal of Business Research 62, 660-666. Chaves R. y Schediwy R. (2004). Introducción al monográfico “Gobierno, democracia y directivos en las empresas cooperativas”. Revista de Economía Pública, Social y Cooperativa, CIRIEC-España 48, 5-10. Cheng, J.-H., Yeh, C.-H., y Tu, C.-W. (2008). Trust and knowledge sharing in green supply chains. Supply Chain Management: An International Journal 11, 283-295. Chukwu, B. I., e Igwe, A. A. (2012). Effect of selecition proces on organizational performance in the brewery industry of Southern Nigeria. European Journal of Business Management 14, 103-117. Dyer, J. H. Y Singh, H. (1998). The relational view: cooperative strategy and sources of interorganizational competitive advantage. Academy of Management Review 23, 660-679. Geisser, S. (1975). A predictive approach to the random effect model. Biometrika 61, 101-107. Grant, R. M. (1996). Toward a knowledge-based theory of the firm. Strategic Management Journal 17, 232-249. Hernández-Espallardo, M., y Arcas-Lario, N. (2003). The effects of authoritative mechanisms of coordination on market orientation in asymmetrical channel partnerships. International Journal of Research in Marketing 20, 133-152. Henseler, J., Ringle, C. M., y Sinkovics, R. R. (2009). The use partial least squares path modelling in international marketing. Advances in International Marketing 20, 277-319. Hult, G. T. M., Ketchen, D. J. Jr., y Nichols, E. L. (2002). An examination of cultural competitiveness and order fulfillment cycle time within supply chains. Academy of Management Journal 45, 501-511. Hult, G. T. M., Ketchen, D. J. Jr, y Slater, S. F. (2004). Information processing, knowledge development, and strategic supply chain performance. Academy of Management Journal 47, 241-253. Nilsson, J. (1996). Co-operative principles and practices in Swedish agricultural co-operatives. En J. L. Monzón et al. (Eds.), Co-operatives, markets, co-operatives principles. Valencia: CIRIEC, 219-248. Nilsson, J. (2001). Organisational principles for co-operative firms. Scandinavian Journal of Management 17, 329-356. Ouchi, W. G. (1979). A conceptual framework for the design of organizational control mechanisms. Management Science 25, 833-848. Ramaswami, S. N. (1996). Marketing controls and dysfunctional employee behaviors: A test of traditional and contingency theory postulates. Journal of Marketing 60, 105-120. Spear, R. (2000). The co-operative advantage. Annals of Public and Cooperative Economics 71, 507-523. Vargas A., y García, E. (2003). La medición del desempeño de las sociedades cooperativas agrarias. Perspectiva de los directores-gerentes de las provincias de Huelva y Jaén. Revista de la economía pública, social y cooperativa, CIRIEC-España 46, 85-116. Wang, E. T. G., y Wei, H.-L. (2007). Interorganizational governance value creation: coordinating for information visibility and flexibility in supply chains. Decision Science 38, 647-74. Wathne, K.. H., y Heide, J. B. (2000). Opportunism in interfirm relationships: forms, outcomes, and solutions. Journal of Marketing 64, 36-51.

554


Estudo comparativo das alterações climáticas e da sua influência sobre as necessidades de rega no clima Mediterrâneo Shakib. Shahidian 1, José Luís. Teixeira2, João. Serrano1, João. Rolim2 1

ICAAM Instituto de Ciências Agrárias e Ambientais Mediterrâneas/ Universidade de Évora, Apt. 94; 7005 Évora, Portugal: shakib@uevora.pt 2 Instituto Superior de Agronomia, Tapada da Ajuda, Lisboa, Portugal

Resumo É geralmente aceite que o aumento das emissões de gases com efeito de estufa, e a utilização extensiva de combustíveis fósseis está a provocar uma alteração climática ao nível mundial. O crescimento das culturas é muito afectado pelo clima e as suas alterações podem afectar seriamente a segurança alimentar a nível global. Por outro lado, as reservas de água para a rega estão a diminuir e é importante avaliar os efeitos das alterações climáticas sobre o consumo de água pelas plantas. Estudos anteriores indicam que na Ibéria as temperaturas médias do ar aumentaram ao ritmo de 0,3-0,7 ºC década-1 em Espanha e 0,4 ºC década-1 no Sul de Portugal. O presente estudo utiliza séries de dados de 20 anos da Califórnia, região que também tem um clima Mediterrâneo, para estudar as implicações das alterações climáticas sobre as necessidades de rega. Os dados referem-se a 20 estações climáticas distribuídas pelo Estado da Califórnia. Os resultados indicam que as temperaturas aumentaram ao ritmo de 0,15 ºC década-1 nos últimos 20 anos, o que está de acordo com a tendência de aumento da temperatura do ar verificada em estudos realizados em Portugal e Espanha. Adicionalmente, a radiação solar aumentou em 8 W m-2 durante os vinte anos do estudo, o que representa um aumento de 4% na energia total recebida através da radiação. Este aumento importante no input de energia solar, associado ao aumento da temperatura resultou num aumento de 0,11 mm dia-1 década-1 na evapotranspiração calculada pelo método de CIMIS Penman e de 0,12 mm dia-1 década-1 na evapotranspiração quando calculado pela equação de Penman Monteith. Estes valores representam um aumento de, respectivamente, 6,6 e 7,2% no período 1991-2011. Palavras chave: Alterações Climáticas, Clima Mediterrâneo, Evapotranspiração, Califórnia

Comparative study of climate change and its influence on irrigation requirements in the Mediterranean climate Abstract It is generally accepted that the increase in the emissions of greenhouse gases and the extensive use of fossil fuel is leading to a global climate change. Crop production is very much affected by climate and any changes can greatly affect the world´s food security. Additionally, the reserves of water for irrigation are decreasing and it is important to study how climate change can affect water consumption by crops. Previous studies have shown that in Iberia the average air temperature has increased at the rate of 0.3 - 0.7 ºC decade-1 in Spain and up to 0.4 ºC decade-1 in southern Portugal This study uses 20 year data series from California, which also has a Mediterranean climate to study the implications of climate change on crops irrigation requirements. The meteorological data used in this study is from 20 stations distributed throughout the State. The results indicate the temperatures have increased at the rate of 0.15ºC decade-1 over the past twenty year study period, which is in line with the air temperature increase trend identified in previous studies carried out in Portugal and Spain. Additionally, solar radiation increased by 8 W m-2 during the twenty years of the study period, which represents an increase of 4% in the total energy received through radiation. This increase in the solar energy input as well as the increase in temperatures resulted in an increase of 0.11 mm day-1 decade-1 in evapotranspiration when using the CIMIS Penman ETo equation and 0.12

555


mm day-1 decade -1 when using the Penman Monteith ETo equation. These values represent an increase of 6.6 and 7.2%, respectively in the 1991-2011 period. Keywords: Climate Change, Mediterranean Climate, Evapotranspiration, California

Introduction and justification It is estimated that agriculture is responsible for 85% of the total human water use (Haie et al. 2008). Presently the existing water resources have reached their limits in some areas of Iberia, such as the Guadalquivir river basin, where the water authority has reduced the amount of water assigned to each irrigation district (Rodríguez Dias et al. 2007). Global climate change is expected to have a significant impact on the availability and use of water resources and thus on the future of irrigated agriculture. According to the 4th report of the evaluation of the inter-government panel for climate change (IPCC), between 1906 and 2005 the average air temperature increased 0.74ºC, while most of the change was at the northern hemisphere. During the same period, the average air temperature in Europe increased 1ºC. Since the industrial revolution and until 2004, the concentration of CO2 in the atmosphere has increased 35% due to human activity (Santos et al., 2006). The annual emission of CO2 increased 70% between 1970 and 2004 (IPCC; 2007). Additionally the increase in global temperatures has caused other climate changes, such as a change in the rainfall patterns, resulting in significant cycles of draught and floods. Various researchers have used climate models to simulate the impact of different scenarios on the agricultural use of water (Guereña, 2001; Döll e Siebert, 2001). For example the GIM model (Doll, 2002) foresees an increase of 3-5% in net radiation until 2020. This work also indicates an increase of up to 15% in irrigation water requirements in south east Asia until 2070. Marsal e Utset (2007) simulated various scenarios for Lérida (Spain) and foresee an increase of 4ºC until the end of the Century. Rodríguez Dias et al. 2007 modeled the impacts of climate change on irrigation water demand in Southern Spain and observed a increase of between 15 and 20% in seasonal irrigation requirements by the 2050s, depending on the location. The general purpose of this work is to compare the recent changes in climate in two regions with Mediterranean climate and evaluate to what extent this change has translated into increased water requirements for irrigation, in the form of reference evapotranspiration (ETo). The study will focus on California, and compare the climate change data with previous studies carried out in tow other Mediterranean regions: Southern Spain and Portugal.

Material and Methodology The United Nations Food and Agriculture Organization (FAO) adopted the Penman-Monteith method as a global standard to estimate ETo from four meteorological data (temperature, wind speed, radiation and relative humidity), with details presented in the Irrigation and Drainage Paper no. 56 (Allen et al. 1998), referred to hereafter as PM:

ETo =

900 u2 (es − ea ) T + 273 ∆ + γ (1 + 0.34u2 )

0.408∆ (Rn − G ) + γ

(1)

where:

556


Rn – net radiation at crop surface [MJ m-2 day-1], G – soil heat flux density [MJ m-2 day-1], T – air temperature at 2 m height [ºC], u2 – wind speed at 2 m height [m s-1], es – saturation vapor pressure [kPa], ea – actual vapor pressure [kPa], es-ea – saturation vapor pressure deficit [kPa],  – slope vapor pressure curve [kPa ºC-1],  – psychrometric constant [kPa ºC-1],

The PM model uses an hypothetical green grass reference surface that is actively growing and is adequately watered with an assumed height of 0.12 m having a surface resistance of 70 s m-1 and an albedo of 0.23 which would closely resemble evapotranspiration from an extensive surface of green grass cover of uniform height, completely shading the ground and not short of water (Allen et al., 1998). This methodology is generally considered to be the most reliable in a wide range of climates and locations because it is based on physical principles and considers the main climatic factors which affect evapotranspiration. The CIMIS Equation uses a version of the Penman combination equation, as modified by Pruitt and Doorenbos (1977) which calculates hourly ETo. It also employs a wind function developed at the University of California, Davis. For California, 20 years of daily data from 20 CIMIS stations were collected and used in this study. The twenty stations were selected to be as diverse as possible, covering different geographic areas, as well as different elevations (Table 1). The data were then averaged to obtain the annual values. Table 1: The twenty CIMIS stations used in this study. Station number

Station name

Elevation (m)

Latitude (deg)

Longitude (deg)

2

Five Points

86.87

36.34

-120.11

6

Davis

18.29

38.54

-121.78

8

Gerber

76.20

40.05

-122.16

13

Camino

847.34

38.75

-120.73

19

Castroville

2.74

36.77

-121.77

35

Bishop

1271.02

37.36

-118.4

41

Calipatria/Mulberry

33.53

33.04

-115.42

McArthur

1008.89

41.07

-121.45

Blackwells Corner

214.88

35.65

-119.96

57

Buntingville

1220.72

40.29

120.43

62

43 54

Temecula

432.82

33.49

-117.22

64

Santa Ynez

149.35

34.58

-120.08

71

Modesto

10.67

37.65

-121.19

77

Oakville

57.91

38.43

-122.41

78

Pomona

222.50

34.06

-117.81

88

Cuyama

697.99

34.93

-119.61

91

Tulelake

1229.87

41.96

-121.47

99

Santa Monica

103.63

34.04

-118.48

105

Westlands

58.22

36.63

-120.38

Sanel Valley

160.02

38.98

-123.09

106

557


Results and Discussion The results indicate a small change in average temperature, which increased 0.15 ºC decade-1 over the twenty year study period (Figure 1). Additionally a slight increase in the maximum temperature (0.28 ºC decade-1) and a slight decrease in the minimum temperature (0.03 ºC decade-1) can be observed. The changes in air temperature are not significant, since the coefficient of determination is low. 25

20

Max Air Temp ( 剂 C) Linear (Max Air Temp ( 剂 C)) Min Air Temp ( 剂 C) Linear (Min Air Temp ( 剂 C)) Avg Air Temp ( 剂 C) Linear (Avg Air Temp ( 剂 C))

f(x) = 0,028x + 21,541 R² = 0,067

Temperature, ºC

15

10

5

f(x) = 0,015x + 13,926 R² = 0,030

f(x) = -0,003x + 6,893 R² = 0,002

0 1992 1994 1996 1998 2000 2002 2004 2006 2008 2010 1991 1993 1995 1997 1999 2001 2003 2005 2007 2009 2011 Year

Figure 1. Evolution of minimum, average and maximum temperature over the study period.

The Analysis of the other climate variables required for the ETo calculation with the Penman equationindicate that the solar radiation increased by 8 W m-2 during the twenty years of the study period (Figure 2). This represents an increase of 4% in the total energy received through radiation. Additionally this was accompanied by an increase of 0.1 m s-1 in the wind speed and an increase of 0.7 percentage points in the relative humidity. It can be observed for the four main parameters affecting evapotranspiration, that while the increase in temperature, radiation and wind speed contribute to an increase in evapotranspiration, the slight increase in relative humidity has the inverse effect. Sol Rad (W.sq.m) Linear (Sol Rad (W.sq.m)) Avg wind Spd (m/s) Linear (Avg wind Spd (m/s)) Avg Rel Hum (%) Linear (Avg Rel Hum (%))

3 f(x) = 0,410x + 197,859 R² = 0,090 2,5

200

2 150 f(x) = 0,005x + 1,998 R² = 0,206

1,5

100 1 50 f(x) = 0,037x + 60,219 R² = 0,004

Wind speed m s-1

Solar radiation, W.Sq.m and Relative humidity, %

250

0,5

0

0 1992 1994 1996 1998 2000 2002 2004 2006 2008 2010 1991 1993 1995 1997 1999 2001 2003 2005 2007 2009 2011 Year

Figure 2 Evolution of the solar radiation, relative humidity and wind speed during the study period.

558


The evolution of the annual evapotranspiration values is presented in Figure 3. The results indicate that the average ETo increased in the 20 California stations between 1991 and 2011 at an average rate of 0.11 mm day-1 decade-1 when using the CIMIS Penman ETo equation and 0.12 mm day-1 decade -1 when using the PM ETo equation. These values represent an increase of 6.6 and 7.2%, respectively, in the 1991-2011 period. 3,9 3,8

f(x) = 0,012x + 3,505 R² = 0,225

3,7

Eto, mm per day

3,6 3,5 3,4 f(x) = 0,011x + 3,492 R² = 0,200

3,3

CIMIS ETo (mm) Linear (CIMIS ETo (mm)) PM ETo (mm) Linear (PM ETo (mm))

3,2 3,1 3 2,9 1992 1994 1996 1998 2000 2002 2004 2006 2008 2010 1991 1993 1995 1997 1999 2001 2003 2005 2007 2009 2011

Year

Figure 3. Evolution of the CIMIS ETo and Penman-Monteith ETo during the study period.

These results are in agreement with what has been observed in southern Iberia. For example the work of Moratiel et al. (2010) shows that in the 38 meteorological stations they studied, between 1973 and 2002, the average temperature increased between 0.3 and 0.7 ºC decade-1. Additionally they observed that the relative humidity fluctuated between 0.1 and -3.7% decade-1. In a previous work on the evolution of climate in southern Portugal covering the 1965-2009 period (Shahidian et al. 2012) a gradual increase in the average temperatures was observed, with some areas showing an increase of up to 0.4 ºC decade-1. These authors also observed an increase of 0.1mm day-1 in the daily average ETo values during the 1965-2009 period, which translated into an increase of 35mm year-1. The data from California indicate that besides the increase in average temperatures, there is an important increase in the average daily radiation, which can be assumed as one of the causes for the increase in the daily temperatures. There is still little information on what is the compound result of the various changes in the climate parameters. A recent study (Famiglietti and Min-Hui Lo, 2003) shows that the large amount of evapotranspiration from the California Central Valley irrigations boost humidity, and eventually using a climate model, they concluded that in some areas, the water evaporated from the fields can return in the form of rainfall, reaching a maximum of 350 mm year-1. It can thus be assumed that the increase in evapotranspiration observed might be responsible for the increase in relative humidity, and that eventually some of this evapotranspiration might be returned in the form of precipitation.

Conclusions Twenty years of climate data from California CIMIS stations indicate that the temperatures have increased at the rate of 0.15 ºC decade-1 over the twenty year study period, although the time series are

559


not long enough to statistically validate the results. These temperature increase trend is in line with previous studies carried out in Portugal and Spain, where temperature has increased at the rate of 0.3 0.7 ºC decade-1 in Spain and up to 0.4 ºC decade-1 in southern Portugal. Additionally the data indicate an important increase in the solar radiation received at the stations. The solar radiation increased by 8 W m-2 during the twenty years of the study period, which represents an increase of 4% in the total energy received through radiation. This increase in the solar energy input as well as the increase in temperatures resulted in an increase of 0.11 mm day-1 decade-1 in evapotranspiration when using the CIMIS Penman ETo equation and 0.12 mm day-1 decade -1 when using the PM ETo equation. These values represent an increase of 6.6 and 7.2%, respectively, in the 1991-2011 period. If these tendencies continue over the next decades, it might be important to seriously reconsider the prevailing lifestyle of the developed world, and reduce the use of fossil fuels.

Acknowlegement The authors would like to express their gratitude to FCT- Fundação para a Ciência e Tecnologia for financing this research work and to ICAAM- Instituto de Ciências Agrárias e Ambientais Mediterrânicas for supporting the participation in the Conference.

Bibliografía Allen R.G., Pereira L.S., Raes D. & Smith M. 1998. Crop evapotranspiration: Guidelines for computing crop requirements. Irrigation and Drainage Paper No. 56, FAO, Rome, Italy. Pruit, W.O., Doorenbos, J. (1977) Empirical calibration a requisite for evapotranspiration formulae based on daily or longer mean climatic data. Proceeding of the International Round Table Conference on "Evapotranspiration", Budapest, Hungary. Haie, N, Pereira, R, Machado, G. (2008) Irrigation Water Use and its Effective Efficiency in Portugal. XIII IWRA World Water Congress, Montepellier, France IPCC (1996) Climate Change 1995, Impacts, Adaptation and Mitigation of Climate Change: Scientific Technical Analysis. Contribution of Working Group II to the Second Assessment of the IPCC. Eds. RT Watson, MC Zinyowera and RH Moss, Cambridge University Press, United Kingdom. Min-Hui Lo, Famiglietti, J. (2013) Irrigation in California's Central Valley strengthens the southwestern U.S. water cycle. Geophysical Research Letters 40(2): 301–306 Moratiel, R., Durán J.M., Snyder, R.L.(2010). Responses of reference evapotranspiration to changes in atmospheric humidity and air temperature in Spain. Climate Research 44: 27-40 Rodríguez Días J, Weather head E, Knox, J, Camacho E. Climate change impacts on irrigation water requirements in the Guadalquivir river basin in Spain. Reg. Environ Change, 7:149-159 Santos, F.D., Forbes, K., Moita, R. (2002) Climate Change in Portugal. Scenarios, Impacts and Adaptation Measures – SIAM Project, Gradiva, Lisboa, Portugal, 454 pp. Shahidian, S., Serralheiro, R, Valverde, P, Teixeira, JL, Serrano, J, Toureiro, C. (2012) Estudo de alguns impactos das Alterações Climáticas sobre o regadio no Alentejo. VI Congresso Nacional de Rega e Drenagem, Coimbra

560


Efecto de dos tipos de mallas anti insectos, 10×20 y 13×30 hilos cm-2, sobre la ventilación natural en invernaderos mediterráneos A. López, D.L. Valera1, F.D. Molina-Aiz, A. Peña y P. Marín 1

Universidad de Almería. Ctra. de Sacramento s/n. 04120 Almería, e-mail: dvalera@ual.es

Resumen En este trabajo se ha aplicado la anemometría sónica para el estudio de la ventilación natural en un invernadero mediterráneo con dos mallas anti-insectos de diferente densidad de hilo: una malla testigo comercial de 10×20 hilos cm-2 y una malla experimental de 13×30 hilos cm-2. El invernadero fue dividido en dos sectores independientes, colocando en las ventanas de un sector la malla testigo y en otro la malla experimental. Este diseño del invernadero nos ha permitido analizar la ventilación natural en ambos sectores de forma simultánea. La velocidad del aire en las ventanas laterales se midió con 2 anemómetros sónicos tridimensionales (1 por sector); en la ventana cenital se colocaron 6 anemómetros sónicos bidimensionales (3 por sector). No se observaron diferencias importantes en el patrón del flujo de aire en las ventanas de los dos sectores. Una diferencia del 5.5% entre la porosidad de la malla testigo y de la malla experimental supone una reducción media del 15% en el número de renovaciones de aire, siendo la superficie de ventilación ligeramente superior en el sector con la malla testigo. Como consecuencia del menor número de renovaciones de aire observado en el sector con la malla testigo se observó un incremento medio de 0.5ºC en la temperatura media del aire interior, es decir, un incremento de la temperatura de 0.1ºC por cada punto de diferencia porcentual entre la porosidad de las mallas. La eficiencia de la ventilación para la temperatura ‘T fue superior en el sector con la malla experimental (valor medio de 0.9) en comparación con el sector con la malla testigo (valor medio 0.6). Se ha diseñado una malla anti-insectos experimental (13×30 hilos cm-2) que, gracias al uso de hilos de menor diámetro a los utilizados en la mayoría de las mallas comerciales, presenta una mayor densidad de hilos, menor tamaño de poro y mayor porosidad que las mallas comerciales más utilizadas y, todo ello, favorece la ventilación natural y el microclima del invernadero. Palabras clave: mallas anti-insectos, ventilación, anemometría sónica

Effect of two types of insect-proof screens, 10×20 and 13×30 threads cm-2, on natural ventilation in Mediterranean greenhouses Abstract In this work we have applied sonic anemometry to study natural ventilation in a Mediterranean greenhouse with two insect-proof screens of different density of threads: commercial control screen 10×20 threads cm-2 and experimental screen 13×30 threads cm-2. The greenhouse was divided in two separate sections, one for each type of insect-proof screen, allowing us to analyze natural ventilation in both sectors simultaneously. Air velocity was measured in the lateral vent with two 3D sonic anemometers (1 per sector); in the roof vent we placed six 2D sonic anemometers (3 per sector). There were no significant differences in the pattern of airflow in the vents of the two sectors. A difference of 5.5% between the porosity of the screens caused an average reduction of 15% in ventilation rate. As a result of less ventilation rate, the sector with the control mesh shows an average increase of 0.5ºC in the average indoor air temperature, i.e., an increase of 0.1ºC per point percentage difference between the porosity of the mesh. The ventilation efficiency ‘T was higher in the experimental mesh sector (mean value of 0.9) compared with the mesh control sector (mean value 0.6). We have designed an experimental insect-proof screen (13×30 threads cm-2) witch smaller diameter thread used in most commercial meshes, higher thread density, smaller pore size, and higher porosity than the commercial nets used and, all, promotes natural ventilation and microclimate of the greenhouse. Keywords: insect-proof screens, ventilation, sonic anemometry

561


Introducción La colocación de mallas anti-insectos en los invernaderos es uno de los principales métodos físicos de protección contra la entrada de insectos perjudiciales para los cultivos, sobretodo en países mediterráneos donde las condiciones climáticas favorecen la propagación de las plagas de insectos. Las mallas se diseñan con tamaños de poro muy pequeños para reducir la entrada de insectos, reduciendo la necesidad de tratamientos fitosanitarios (Baker y Jones, 1989), evitando la salida de insectos beneficiosos (Teitel, 2007). Como principal inconveniente, dada su baja porosidad, repercuten de manera negativa sobre la ventilación natural y el microclima del invernadero. Reducen la tasa de ventilación y la velocidad del aire en el interior del invernadero (Kittas et al., 2008), aumentando la temperatura y la humedad en el interior (Fatnassi, Boulard y Bouirden, 2003). Una malla con el 28% de porosidad puede llegar a reducir la tasa de ventilación un 77-87% (Baeza et al., 2009). En este trabajo se ha estudiado la ventilación natural en un invernadero mediterráneo con dos mallas antiinsectos: una malla comercial (10×20 hilos cm-2) y una experimental (13×30 hilos cm-2) diseñada en la Universidad de Almería que, gracias al uso de hilos de menor diámetro, se consigue mayor densidad de hilo y menor tamaño de poro, pero con una porosidad igual o superior a otras mallas comerciales.

Material y Métodos Los ensayos se realizaron en un invernadero multitúnel (24 × 45 m2), dividido en dos sectores (este 24 × 25 m2 y oeste 24 × 20 m2), localizado en la Finca “Catedrático Eduardo Fernández” de la Fundación UAL-ANECOOP en la provincia de Almería (Fig. 1; Tabla 2). Se trabajaba con un ciclo de cultivo primavera-verano (2011) de Solanum lycopersicum L. var. cerasiforme Hort., cv. Salomee (altura media 1.20 y 1.88 m e índice de área foliar 0.78 y 2.75 m2hoja m-2suelo, para el primer y último ensayo).

a)

b)

c)

Figura 1. Situación del invernadero (a). Imagen tomada con microscopio de la malla experimental 13×30 hilos cm-2 (b) y de la malla testigo 10×20 hilos cm-2 (c)

En cada sector del invernadero (Fig. 1) se colocaron dos mallas anti-insectos diferentes (Tabla 1). Se utilizó una malla experimental de mayor densidad de hilo (13×30 hilos cm-2) y mayor porosidad que la malla testigo-comercial (10×20 hilos cm-2). La ventilación natural se estudió en ambos sectores del invernadero de forma simultánea. La velocidad del aire se midió en 12 puntos por ventana lateral (Fig. 2a) y 3 puntos por ventana cenital (Fig. 2b). El área de ventana que corresponde a cada punto fue de 2.0 m2 (lateral) y 7.5 m2 (cenital) para el sector este y 1.5 m2 (lateral) y 5.8 m2 (cenital) para el sector oeste. Se utilizaron dos anemómetros sónicos 3D y seis anemómetros sónicos 2D: la mitad para el sector este y la mitad para el sector oeste. Con los anemómetros 3D se midió la velocidad del aire durante 3 minutos en cada punto de las ventanas laterales. Con los anemómetros 2D se midió la velocidad del aire en cada punto de la ventana cenital de forma continua. La velocidad y temperatura del aire se midió con dos anemómetros sónicos 3D modelo CSAT3 (Campbell Scientific Spain S.L., Barcelona, España; precisión ±0.04 m s-1 y ±0.026ºC; frecuencia de registro 10 Hz). La velocidad del aire se midió también con 6 anemómetros sónicos 2D modelo Windsonic (Gill Instrument LTD, Lymington, Hampshire, Reino Unido; precisión ±2% y ±3º; frecuencia de registro 1 Hz). Las

562


condiciones climĂĄticas exteriores se midieron con una estaciĂłn meteorolĂłgica (Fig. 1) equipada con una caja de medida BUTRON II (Hortimax S.L., AlmerĂ­a, Spain) con sonda de temperatura Pt1000 (precisiĂłn Âą0.6ÂşC) y un sensor capacitivo de humedad (precisiĂłn Âą3%). La velocidad y direcciĂłn del viento se midiĂł con un equipo Meteostation II (Hortimax S.L.) con un anemĂłmetro de cazoletas (precisiĂłn Âą5%) y una veleta (precisiĂłn Âą5Âş). La radiaciĂłn solar se midiĂł con un piranĂłmetro Kipp Solari (Hortimax S.L.; precisiĂłn Âą20 W m-2). La temperatura y humedad en el interior se midiĂł con 12 dispositivos de registro y almacenamiento de datos HOBOÂŽ Pro Temp-HR U23-001 (Onset Computer Corp., Pocasset, EE.UU.), colocados a 1 y 2 m de altura (Fig. 1), equipados con un sensor de temperatura resistivo y una sonda de humedad capacitivo (precisiĂłn Âą0.18ÂşC y Âą2.5%). Tabla 1. CaracterĂ­sticas geomĂŠtricas de las mallas anti-insectos. Df y Dr, densidad de hilo segĂşn fabricante y medida [hilos cm-2Â&#x201C;Â&#x201D;Â&#x2022;Â&#x2013;Â&#x2014;Â&#x2DC; Â&#x2DC;Â&#x2122;Â&#x201C;/px,y Lpy, longitud del poro en los ejes x e y [Îźm]; Dh, diĂĄmetro medio de los hilos [Îźm]; Di, diĂĄmetro de la circunferencia inscrita en el poro [Îźm]; Sp, superficie media del poro [mm2]; e, espesor [Îźm]. Malla Testigo Malla Experimental

Df 10 Ă&#x2014; 20 13 Ă&#x2014; 30

Dr 9.9 Ă&#x2014; 19.7 13.1 Ă&#x2014; 30.5

33.5 39.0

Lpx 233.7 164.6

Lpy 734.0 593.3

Dh 274.5 165.5

Di 236.6 167.4

Sp 0.171 0.098

e 563.8 391.7

Tabla 2. Dimensiones de las ventanas [m2]. SV/SA, superficie de ventana/superficie invernada [%]. Sector este â&#x20AC;&#x201C; Testigo Sector oeste â&#x20AC;&#x201C; Experimental

Ventana lateral norte 1.05 Ă&#x2014; 22.5 1.05 Ă&#x2014; 17.5

Ventana lateral sur 1.05 Ă&#x2014; 22.5 1.05 Ă&#x2014; 17.5

Ventana cenital 1.00 Ă&#x2014; 22.5 1.00 Ă&#x2014; 17.5

SV/SA 11.6 11.3

Figura 2. Puntos de medida en las ventanas laterales (a) y en las ventanas cenitales (b)

Para calcular el caudal se debe corregir la componente longitudinal de la velocidad del aire ux (perpendicular a las ventanas) en funciĂłn de la velocidad del viento (Boulard, Wang y Haxaire, 2000):

u xâ&#x2C6;&#x2014;, j =

u x, j uo , j

uo

(1)

siendo uo, la velocidad media del viento durante el ensayo [m s-1], uo,j y ux,j, el valor medio de dichos parĂĄmetros correspondiente al punto de medida j. El caudal volumĂŠtrico de aire se calcula multiplicando u*x,j por la superficie de ventana que le corresponde a cada punto (Boulard et al., 1998): m

G = â&#x2C6;&#x2018; S j u xc, j

(2)

j =1

Resultados y DiscusiĂłn Los ensayos se realizaron con viento de Poniente del suroeste. Las condiciones climĂĄticas exteriores se mantuvieron relativamente estables durante los seis ensayos (Tabla 3).

Flujo de Aire y Renovaciones de Aire Con la configuraciĂłn de nuestro invernadero (una ventana cenital a barlovento, una ventana lateral Norte-barlovento obstaculizada y una ventana lateral Sur-sotavento) los efectos eĂłlico y tĂŠrmico son opuestos. Por efecto eĂłlico el aire tiende a entrar por la ventana cenital (presiĂłn del viento) y a salir

563


por la ventana lateral Norte (succiĂłn del viento) y por la ventana lateral Sur (protegida de la acciĂłn del viento). Por efecto tĂŠrmico el aire caliente asciende para salir por la ventana cenital, favoreciendo la entrada de aire del exterior por las ventanas laterales. Combinando ambos efectos, en las tres ventanas nos encontramos flujos de aire opuestos de entrada y salida (Fig. 3a). Para invernaderos con ventanas laterales y cenitales, Kittas, Boulard y Papadakis (1997) establecieron que el efecto tĂŠrmico es importante en la ventilaciĂłn natural cuando el ratio uo/Â&#x153;Â?io0.5 es menor que 1. En nuestro caso, se observĂł entrada y salida de aire por la ventana cenital en todos los ensayos, lo que indica que el efecto tĂŠrmico tiene un papel importante en nuestro invernadero, aunque uo/Â&#x153;Â?io0.5 sea superior a 1. Tabla 3. Condiciones exteriores durante los ensayos. uo, velocidad del viento [m s-1Â&#x201C;Â&#x17E;Â&#x2DC;Â&#x2014;Â&#x2013; Â&#x2014;Ăłn del viento [Âş]. HRo, humedad relativa exterior [%]. To, temperatura exterior [ÂşC]. Ro, radiaciĂłn exterior [W m-2]. Ensayo - Fecha 1 2 3 4 5 6

Hora

uo

Â&#x17E;a

17/04/2009 11:06-13:07 1.94 Âą 0.70 226 Âą 25 23/04/2009 11:23-13:16 2.34 Âą 0.98 267 Âą 14 22/06/2009 11:14-12:58 3.42 Âą 0.50 258 Âą 8 26/06/2009 11:17-13:04 2.67 Âą 0.72 227 Âą 20 02/07/2009a 11:00-12:45 2.62 Âą 0.63 239 Âą 17 02/07/2009b 14:41-16:28 3.22 Âą 0.48 242 Âą 14 a La direcciĂłn perpendicular a las ventanas es de 208Âş. a)

HRo

To

Ro

59 Âą 5 38 Âą 2 56 Âą 4 64 Âą 2 65 Âą 3 60 Âą 2

16.9 Âą 0.4 22.1 Âą 0.6 25.5 Âą 0.4 24.0 Âą 0.5 27.0 Âą 0.9 28.0 Âą 0.8

584 Âą 175 809 Âą 56 617 Âą 71 751 Âą 102 725 Âą 68 868 Âą 37

uo/Â&#x153;Â?io0.5 (10Ă&#x2014;20) 0.65 0.92 2.08 1.23 1.26 1.47

uo/Â&#x153;Â?io0.5 (13Ă&#x2014;30) 0.65 0.94 2.55 1.29 1.34 1.57

b)

c)

Figura 3. Flujo de aire en las superficies de ventilaciĂłn durante el ensayo 1. Sector este (verde) y sector oeste (naranja) (a). Renovaciones de aire RM (b) y eficiencia de la ventilaciĂłn para la temperatura T (c). Â&#x192;, sector oeste con la malla 13Ă&#x2014;30 hilos cm-2; Â&#x201E;, sector este con la malla 10Ă&#x2014;20 hilos cm-2.

La precisiĂłn de los valores medios de intercambio de aire puede evaluarse sumando los caudales de entrada y de salida (Boulard et al., 1996) con el objeto de verificar el grado de satisfacciĂłn de la Ley de la ConservaciĂłn de la Masa (Antoine Laurent Lavoisier, 1789). El error medio de cierre de los caudales de entrada y salida fue del 11.8% y 67.0% para el sector oeste y este, respectivamente (Tabla 4). Sorprende que siguiendo la misma metodologĂ­a y haciendo los ensayos simultĂĄneos en ambos sectores, el error sea mucho menor en el sector oeste que en el sector este. Esta diferencia puede deberse a la obstaculizaciĂłn parcial de la ventana lateral norte del sector este (Fig. 1). Posiblemente, la menor porosidad de la malla testigo (33.5%) frente a la malla experimental (39%), sea la principal causa de la reducciĂłn en el nĂşmero de renovaciones observado en el sector este (Tabla 4, Fig. 3b); aunque, la obstaculizaciĂłn parcial de la ventana lateral norte del sector este tambiĂŠn debiĂł contribuir

564


en tal reducción. Si consideramos el número de renovaciones RM calculado a partir del caudal medio GM se observa una reducción media de RM del 16% en el sector este (con un ratio RM(10×20)/RM(13×30) = 0.85), siendo la diferencia de porosidad entre las mallas del 5.5%. Este resultado discrepa bastante con los resultados obtenidos por Harmanto, Tantau y Salokhe (2006), dos mallas (30% y 38% porosidad) reducían la tasa de ventilación un 50% y 35%, respectivamente, respecto a otra malla (porosidad 41%). Fatnassi, Boulard y Bouirden (2003) determinaron que una malla (porosidad 19%) reducía la velocidad del aire en el interior del invernadero un 50% respecto a otra malla (porosidad 69%). Tabla 4. Caudales de aire [m3 s-1] obtenidos en los diferentes ensayos. GLS, caudal de aire en la ventana lateral a sotavento; GLB, en la ventana lateral a barlovento; GCB, en la ventana cenital a barlovento; GM, caudal medio; EG, error de cierre de caudales [%]; RM, renovaciones de aire calculadas a partir del caudal medio [h-1].

13 × 30

10 × 20

Ensayo 1 2 3 4 5 6 1 2 3 4 5 6

*

Fecha

GLS (ux )

GLB (ux*)

17/04/2009 23/04/2009 22/06/2009 26/06/2009 02/07/2009 02/07/2009 17/04/2009 23/04/2009 22/06/2009 26/06/2009 02/07/2009 02/07/2009

0.16 0.46 -0.35 -0.36 -0.55 -1.54 -0.10 0.29 -1.50 0.47 -0.19 -1.17

-0.95 -2.07 -4.14 -3.87 -3.26 -4.98 -1.46 -1.98 -3.07 -2.64 -2.02 -2.57

*

*

GCB (ux )

GM (ux )

1.60 1.46 2.36 1.84 1.12 2.64 1.59 1.94 4.30 2.03 1.80 2.93

1.36 1.99 3.42 3.03 2.47 4.58 1.57 2.11 4.44 2.57 2.01 3.33

( ) ( )

ΔG u x∗ E G= G M u x∗ 59.6 -7.4 -62.2 -78.7 -109.1 -84.8 1.8 12.3 -6.3 -5.3 -20.8 -24.3

RM 1.45 2.13 3.66 3.24 2.64 4.90 2.11 2.83 5.96 3.46 2.69 4.48

Microclima interior Para valorar objetivamente el efecto de la ventilación en la temperatura interior se ha determinado la eficiencia de la ventilación para la temperatura ‘T (Qingyan, Van der Kooi y Meyers, 1988):

ηT =

Ti −o − To ΔTio

(2)

donde Ti-o es la temperatura media del aire que sale por las ventanas y œio es la diferencia de temperatura entre el interior y el exterior del invernadero durante el ensayo. El término ‘T representa la efectividad para eliminar calor de la zona del invernadero ocupada por el cultivo. Cuando el aire del exterior que entra al invernadero se mezcla perfectamente con el aire del interior, entonces ‘T = 1. Tabla 5. Condiciones climáticas en el invernadero durante el tiempo de realización de los ensayos. Ti, temperatura interior [ºC]; œio, diferencia de temperatura entre el interior y el exterior [ºC]; TWS y TLS, temperatura del aire (medida con los anemómetros sónicos) en las ventanas laterales de barlovento y sotavento [ºC]; ‘T eficiencia de la ventilación para la temperatura. N, número de ensayo N 1 2 3 4 5

Ti œio TWS TLS Sector este – Testigo (10 × 20 hilos cm-2)

‘t

Ti œio TWS TLS ‘t Sector oeste – experimental (13 × 30 hilos cm-2)

26.0 ± 0.9* 9.0 21.2 ± 0.7 22.4 ± 0.3 0.54 25.7 ± 1.0* 28.6 ± 0.5* 6.5 24.2 ± 0.9 25.8 ± 0.1 0.45 28.3 ± 0.1* 28.2 ± 0.4* 2.7 26.4 ± 1.0 27.6 ± 0.1 0.58 27.2 ± 0.5* 28.6 ± 0.2* 4.7 26.5 ± 0.6 28.2 ± 0.0 0.72 28.2 ± 0.2* 31.3 ± 0.2* 4.3 29.1 ± 0.6 30.4 ± 0.5 0.65 30.8 ± 0.4* 32.7 ± 0.5* 4.8 30.3 ± 0.6 31.5 ± 0.1 0.62 32.1 ± 0.5* 6 * Diferencia estadística entre los sectores oeste y este (nivel de confianza 95%; método LSD).

8.8 6.2 1.8 4.3 3.8 4.2

21.4 ± 0.9 24.9 ± 0.8 27.5 ± 0.7 27.4 ± 0.5 30.5 ± 0.7 31.5 ± 1.2

22.8 ± 0.6 26.3 ± 0.5 28.0 ± 0.6 28.2 ± 0.3 31.0 ± 0.3 32.6 ± 0.7

0.59 0.56 1.30 0.89 0.99 0.98

Se ha observado un diferencia media en la temperatura interior de 0.5ºC (diferencia de porosidad entre mallas = 5.5%), siendo menor la temperatura en el sector oeste que en el sector este (Tabla 5). La reducción en las renovaciones de aire observadas con en el sector este (testigo) hace que sea menor la

565


capacidad de evacuación de calor del invernadero, haciendo que la eficiencia de la ventilación para la temperatura sea menor en el sector este que en el sector oeste (Fig. 3c). Los resultados obtenidos en este trabajo, vienen a confirmar el incremento medio de temperatura observado por Harmanto, Tantau y Salokhe (2006) de 0.1ºC por cada punto porcentual de diferencia entre las porosidades de las mallas. El incremento de la diferencia de temperatura œio debido a la reducción de porosidad de la malla testigo respecto de la malla experimental, expresado como la ratio œio-10×20/œio-13×30=1.16, es similar al 1.25 observado por Kittas et al. (2002) entre mallas con porosidades del 50 y 60%; o al 1.50 observado por Fatnassi et al. (2004) entre mallas con porosidades del 29 y 40%.

Conclusiones Se ha diseñado una malla experimental (13×30 hilos cm-2; porosidad 39.0%) que, en comparación con una malla comercial (10×20 hilos cm-2; porosidad 33.5%): (i) no afecta al patrón del flujo de aire en el interior del invernadero; (ii) con una diferencia del 5.5% en la porosidad de las mallas se ha observado un incremento media del 15% en el número de renovaciones de aire en el sector del invernadero con la malla experimental; (iii) se ha observado un descenso de 0.5ºC en la temperatura interior del invernadero en el sector con la malla experimental; (iv) la eficiencia de la ventilación para la temperatura ‘T fue superior en el sector con la malla experimental (valor medio de 0.9) en comparación con el sector con la malla testigo (valor medio 0.6).

Agradecimientos Este trabajo ha sido financiado por la Junta de Andalucía y por el Ministerio de Ciencia e Innovación mediante los proyectos P09-AGR-4593 y AGL2010-22284-C03-01, respectivamente.

Bibliografía Baeza, E.J., Pérez-Parra, J.J., Montero, J.I., Bailey, B.J., López, J.C., and Gázquez, J.C. (2009). Analysis of the role of sidewall vents on buoyancy-driven natural ventilation in parral-type greenhouses with and without insect screens using computational fluid dynamics. Biosystems Engineering 104, 86-96. Baker, J.R., and Jones, R.K. (1989). Screening as part of insect and disease management in the greenhouse. North Carolina Flower Growers’ Bulletin 34, 1-9. Boulard, T., Meneses, J.F., Mermier, M., and Papadakis, G. (1996). The mechanisms involved in the natural ventilation of greenhouses. Agricultural and Forest Meteorology, 79, 61-77. Boulard, T., Kittas, C., Papadakis, G., and Mermier, M. (1998). Pressure Field and Airflow at the Opening of a Naturally Ventilated Greenhouse. Journal of Agricultural Engineering Research 71, 93-102. Boulard, T., Wang, S., and Haxaire, R. (2000). Mean and turbulent air flows and microclimatic patterns in an empty greenhouse tunnel. Agricultural and Forest Meteorology 100, 169-181. Fatnassi, H., Boulard, T., and Bouirden, L. (2003). Simulation of climatic conditions in full-scale greenhouse fitted with insect-proof screens. Agricultural and Forest Meteorology 118, 97-111. Fatnassi, H., Boulard, T., Poncet, C., and Chave, M. (2004). Greenhouse insect screening optimization based on CFD studies. In: Greensys2004, Leuven, Belgium, 12-16 September. Harmanto, Tantau, H., and Salokhe, V.M. (2006). Microclimate and air exchange rates in greenhouses covered with different nets in the humid tropics. Biosystems Engineering 94(2), 239-253. Kittas, C., Boulard, T., and Papadakis, G. (1997). Natural ventilation of a greenhouse with ridge and side openings: sensitivity to temperature and wind effects. Transactions of the ASAE 40(2), 415-425. Kittas, C., Boulard, T., Bartzanas, T., Katsoulas, N., and Mermier, M. (2002). Influence of an insect screen on greenhouse ventilation. Transactions of the ASAE 45(4), 1083-1090. Kittas, C., Katsoulas, N., Bartzanas, T., Mermier, M., and Boulard, T. (2008). The impact of insect screens and ventilation openings on the greenhouse microclimate. Transactions of the ASABE 51(6), 2151-2165. Qingyan, C., Van der Kooi, J., and Meyers, A.T. (1988). Measurements and Computations of Ventilation Efficiency and Temperature Efficiency in a Ventilated Room. Energy and Buildings 12(2), 85-99. Teitel, M. (2007). The effect of screened openings on greenhouse microclimate. Agricultural and Forest Meteorology 143(3–4), 159-175.

566


Desarrollo de una aplicación informática para la realización de las inspecciones de los equipos de aplicación de productos fitosanitarios Jiménez Jiménez, A.1; García Ramos, F.J.2; Vidal Cortés, M.2; Boné Garasa, A.2 1

Escuela Universitaria Politécnica La Almunia de Doña Godina (Adscrita Univ. Zaragoza) angelji@unizar.es 2 Escuela Politécnica Superior (Univ. Zaragoza). Ctra. Cuarte. 22071 Huesca. e-mail: fjavier@unizar.es; vidalcor@unizar.es ; anbone@unizar.es

Resumen El objetivo de este trabajo fue el desarrollo de un software para la ejecución y el procesamiento de la información generada en las inspecciones técnicas de los Equipos de Aplicación de Fitosanitarios (EAF), adaptado a las condiciones específicas que el RD 1702/2011 de Inspecciones periódicas de los equipos de aplicación de productos fitosanitarios estableció para todo el territorio nacional. Para conseguir el mencionado objetivo, han sido desarrollados previamente los protocolos que permiten aplicarlo a las diferentes tipologías de EAF definidas en el Manual de Inspección, adjuntado por el Ministerio de Agricultura, Alimentación y Medio Ambiente (MAGRAMA) para el desarrollo práctico de las inspecciones técnicas reguladas en el mencionado RD. Se ha establecido asimismo una propuesta de hardware adecuada para la realización de las inspecciones con unidades móviles autónomas, buscando objetivos de eficacia técnica y eficiencia económica. Por último se ha integrado en la aplicación un módulo para la gestión de la información obtenida en las inspecciones pudiéndose generar los ficheros con el resumen de la información de las inspecciones realizadas, que el MAGRAMA requerirá, en formato normalizado, a los Órganos Competentes de las Comunidades Autónomas. Palabras clave: Inspección de pulverizadores, productos fitosanitarios, protocolo de inspección, software.

Development of a software for implement mandatory inspections of sprayers in use Abstract The aim of this work was the development of a software to implement the mandatory inspections of sprayers in use, adapted to the specific requirements of the Spanish legislation: RD 1702/2011 “Periodic inspection of sprayers”. To achieve the above objective, several protocols have been previously developed in function of the sprayer type an according to the Inspection Manual developed by the Ministry of Agriculture, Food and Environment (MAGRAMA). The research has also established appropriate hardware proposal for conducting inspections by using autonomous mobile units, looking for technical performance goals and economic efficiency. Finally, the software also integrates a module for the management of the information obtained during inspections being able to generate the information required by the Regional Administrations and the MAGRAMA in a standardized format. Keywords: Inspection of sprayers, plant protection products, inspection protocol, software.

567


Introducción La inspección de los equipos de aplicación de productos fitosanitarios (EAF) es uno de los instrumentos más eficaces para cumplir el triple objetivo (ambiental, de seguridad y económico) de la Directiva 2009/128/CE para el Uso Sostenible de Plaguicidas (Friedrich, 2006, Wehmann, 2009). En España todo lo relativo a la inspección técnica de equipos para la aplicación de fitosanitarios, fue recogido por el R.D. 1702/2011, proporcionando asimismo un “Manual de inspección de equipos de aplicación de fitosanitarios en uso” (Gil et al., 2011), donde se desarrolla técnicamente el contenido de la inspección que se debe realizar a cada tipo de EAF. Con estos precedentes se hacía necesaria el desarrollo de unos protocolos de inspección adaptados a cada tipo de máquina y que permitiese a las entidades inspectoras estandarizar el procedimiento inspector, la captura de información, el registro y almacenamiento de la misma, la emisión de la documentación a entregar a los titulares y la comunicación a los órganos administrativos de control de la actividad desarrollada por las Estaciones de Inspección Técnica de Equipos de Aplicación de Fitosanitarios (ITEAF), tal y como establece el mencionado Real Decreto regulador. En el caso de la Unión Europea, este tipo de herramientas informáticas, en algunos casos, han sido desarrolladas por las casas comerciales que fabrican los equipos de inspección (Herbst y Herbst, 2009; Langenakens, 2009; Mostade y Briffeuil, 2009) y, en otros casos, son elaboradas por la Administración Pública encargada de gestionar las inspecciones. En este último caso, ya existe experiencia con diferentes grados de implantación en países como Italia (Biocca, 2008), Países Bajos (Kole, 2009) o Alemania (Haller y Loga, 2007). El objetivo principal de los trabajos descritos en este artículo ha sido el integrar todas las necesidades anteriormente descritas en un conjunto de software + hardware, dado que los dispositivos informáticos adoptados tendrán repercusión en los protocolos de inspección y la comunicación de los resultados, para poder realizar inspecciones de calidad con una reducción del tiempo de inspección, respecto de las metodologías empleadas hasta ahora. Esa reducción de los tiempos totales necesarios para cumplimentar todos los aspectos que componen una inspección, producirá una disminución del coste total del acto, ya que supondrá un menor coste directo y un menor coste indirecto al propiciar una mayor productividad de las inversiones necesarias de cada ITEAF. En el caso de España, el Ministerio de Agricultura, Alimentación y Medio Ambiente (MAGRAMA) está desarrollando una base de datos, para el almacenamiento de los resultados de las inspecciones realizadas por las Comunidades Autónomas, que deberá nutrirse de la información proporcionada por todas las ITEAF. Por consiguiente, se generó la necesidad de incorporar un módulo específico para la emisión de los archivos de comunicación en los formatos requeridos por esa base de datos.

Material y Métodos Dado que un software de inspección se estructura en base a la operativa en campo, es necesario establecer previamente los protocolos de toma de datos con el objetivo de optimizar la realización práctica de la inspección. El contenido de los aspectos objeto de inspección ya viene regulado por el Manual de Inspecciones (Gil et al., 2011), sin embargo, es necesario identificar los principales factores que condicionan la realización práctica de las inspecciones y, entre los cuales podemos citar:      

Tiempo empleado en la inspección. Principales defectos de los equipos. Problemas derivados del tipo de equipamiento de inspección empleado. Tipología de los equipos a inspeccionar. Soporte de registro de datos. Almacenamiento de datos.

568


 

Capacidad para emitir el informe y el certificado de inspección en tiempo real. Número de inspectores por unidad móvil.

Por lo tanto, en una primera fase, se ha realizado un diagnóstico de los principales condicionantes que se producen durante la inspección de los equipos en uso que ha servido de base para el diseño de la aplicación informática, principalmente en lo relativo a los protocolos prácticos de toma de datos que condicionan el diseño de la aplicación. Para ello, durante el año 2010, se han inspeccionado 100 pulverizadores hidroneumáticos (atomizadores) y 51 pulverizadores hidráulicos (barra) ubicados en la Comunidad Autónoma de Aragón, pertenecientes a agricultores y empresas de servicios. En base a la información obtenida, se han establecido los protocolos de inspección que han sido implementados en la aplicación informática. Procedimiento de inspección. El equipo de inspección se desplazó utilizando una furgoneta al lugar de inspección en el que se concentraron las máquinas para realizar una jornada de trabajo. Las inspecciones fueron programadas para que, por cada jornada de trabajo, el número mínimo de máquinas inspeccionadas fueran 5. La toma de datos de cada inspección se realizó utilizando un estadillo en papel para, posteriormente, introducir dicha información en un ordenador y elaborar los informes. El protocolo utilizado en esta fase del trabajo fue el recogido en las normas UNE-EN 13790: 1 y UNEEN 13790: 2 ya que en esta fase de inspecciones todavía no había sido publicado el Manual de Inspecciones por el MAGRAMA Equipo humano. El equipo que participó en la realización de las inspecciones (trabajo de toma de datos en campo) se compuso de dos personas para el protocolo de pulverizadores hidroneumáticos y de tres personas en la inspección de los pulverizadores hidráulicos. La incorporación de los datos a la base de datos informática para su procesamiento y emisión de los informes y certificados se realizó en gabinete por una sola persona. Material. Para la ejecución material de las inspecciones se optó por la utilización del equipamiento más básico que cumpliese las exigencias mínimas establecidas en el borrador del futuro RD 1702/2011 (figura 1), integrado por los siguientes elementos: a) Contrastador de manómetros. Se utilizó un contrastador de manómetros Marti que dispone de un circuito oleo-hidráulico integrado por un pistón con usillo y dos conexiones en sendos extremos del mismo, una para el manómetro de contraste y otra para el manómetro de la máquina objeto de inspección. Para posibilitar la conexión de diferentes tipos de aparatos se dispuso de adaptadores de ¼”, ½” y ¾”. b) Caudalímetro. Se utilizó un caudalímetro manual AAMS de ocho probetas, que permite recoger el agua pulverizada por las boquillas y determinar el volumen arrojado. Este equipo está construido sobre una estructura de acero inoxidable con ruedas para poder desplazarlo cómodamente, dispone de probetas de 2.000 cm3 con marcas cada 100 cm3 y conducciones de tubo de goma que vierten el agua recogida mediante gatillos con rosca manual que se ajustan a las boquillas. Permite la determinación del volumen arrojado por ocho boquillas en un tiempo establecido en función del caudal nominal del modelo de boquilla testado (normalmente 30 s). c) Manómetros de medida de presiones en circuito. Manómetros equipados con conectores que permiten medir la presión al ser ubicados en las boquillas de los sectores de pulverización. d) Furgoneta para transporte y ubicación del despacho de campo. Las limitaciones en el desplazamiento de las máquinas nos impone la necesidad de contar con un equipo móvil y autónomo. d) Otros materiales. Mesa para comprobador manómetros, cronómetro, caja con herramientas múltiples, manómetros de reserva, juntas tóricas de varias medidas, bomba manual con manómetro y equipamiento para protección de los operadores, ordenador portátil, impresora y material de oficina.

569


Verificación. Una vez desarrollada la primera versión de la aplicación informática PRITEAF, se procedió a la verificación de la misma, mediante la programación de 115 inspecciones a realizar en la Comunidad Áutónoma de Aragón. El objetivo fue el ajustar el diseño de los protocolos, comprobar el funcionamiento de los dispositivos diseñados y la obtención de la información para la reprogramación y generación de la versión definitiva de PRITEAF. En la verificación se aplicaron los protocolos definidos de acuerdo a la información obtenida en la primera fase, ajustándolos a lo especificado en el “Manual de inspección de equipos de aplicación de fitosanitarios en uso”. Al equipamiento utilizado en la primera fase se le sumó el dispositivo informático necesario para la toma de datos, procesamiento y elaboración de los informes y certificados, integrado por: -

Ordenador portátil : Windows 7 , FileMaker Pro v.12 y PRITEAF v1.

-

iPad 2 con wifi y FileMaker Go v12.

-

Modem Wi-Fi (AirPort Express).

-

Impresora.

-

Convertidor 12v/230v con conector a mechero/batería.

Ficheros de comunicación de actividad. Para diseñar los contenidos de los documentos acreditativos del resultado de la inspección, se ha tenido en cuenta lo dispuesto en el Art. 12 y en el Anexo III del R.D. 1702/2011, donde se especifican los contenidos mínimos de dichos documentos, así como lo dispuesto en su Art. 6.3, relativo a la comunicación de los Órganos Competentes de las CCAA con el MAGRAMA.

Resultados y Discusión El análisis de los resultados de las inspecciones realizadas en la primera fase nos indican que los defectos más frecuentes encontrados en los EAF en uso se localizaron en la bomba, el sistema de distribución, las boquillas, el sistema de regulación y el depósito. Muchos de ellos fueron consecuencia del incorrecto mantenimiento de los equipos, y en algunos casos consecuencia de la elevada edad de los mismos. Como consecuencia del estudio del orden de realización de los diferentes apartados que establece el Manual de inspección, se ha establecido un protocolo genérico (figura 1), sobre el que se desarrollan los protocolos específicos de cada tipo de equipo aplicador de fitosanitarios.

Figura 1. Estructura de los protocolos

Para la realización práctica de la inspección se diseña una aplicación informática que nos permita agilizar el procedimiento inspector, tanto en lo referente a la captura de la información contenida en los protocolos, como al procesamiento y gestión de dicha información para la obtención de los

570


documentos requeridos por las disposiciones normativas. Por consiguiente la estructura de PRITEAF (figura 2), ha sido desarrollada sobre la base de datos “FileMaker Pro 12”, donde se estructura en tres bases de datos principales relacionadas jerárquicamente: ƒ

Titulares: Máquinas: Inspecciones

Además la aplicación dispone de la posibilidad de elección del idioma y de la definición de los datos identificativos de la Unidad Inspectora (ITEAF), que deberán figurar en todos los documentos emitidos (denominación, dirección, anagrama, Director, Inspector, etc.)

Figura 2. Menú principal de PRITEAF

Para mayor utilidad de la aplicación se han incorporado dos bases auxiliares, editables por el usuario, para poder disponer al realizar las inspecciones de las marcas y modelos de EAF, y las marcas, modelos y tablas de caudales nominales de las boquillas y difusores disponibles en el mercado. La generación de ficheros de inspecciones dará acceso a la creación de un archivo normalizado con la información básica de las inspecciones realizadas por la ITEAF en un determinado periodo de tiempo. Tanto el nombre del archivo como su contenido se ajustan a las instrucciones establecidas por el MAGRAMA, con el fin de que puedan ser incorporados a una base de datos Nacional.

Conclusiones El trabajo ha proporcionado las bases para la elaboración de un software, denominado PRITEAF, que puede ser la herramienta adecuada para la realización de la inspección técnica de EAF de forma eficiente con un equipamiento básico y una dotación mínima de personal técnico, a la vez que permitirá realizar las operaciones de generación y almacenamiento de la documentación requerida por la normativa vigente, así como la obtención de los archivos de comunicación de la actividad con las diferentes administraciones en los formatos normalizados que ellas han establecido. La aplicación permite su uso en cualquiera de los cuatro idiomas oficiales de España (Castellano, Catalá, Euskara y Galego), para poder ser utilizado en todo el territorio nacional. También se ha obtenido una propuesta de protocolos de inspección, adecuados a cada uno de los tipos de EAF, acordes con los criterios definidos en el Manual de Inspección, y una solución técnica para el operativo, consistente en un dispositivo integrado por un ordenador portátil, una impresora y un iPad conectados mediante un modem wi-fi. La aplicación PRITEAF, soportada en la base de datos FileMaker, será compartida por el ordenador, donde reside la base de datos, y una o varias tablet iPad que permitirán trabajar simultáneamente en una o varias inspecciones.

571


Agradecimientos a primera fase de este trabajo se desarrolló con el patrocinio del Centro de Protección Vegetal de la Diputación General de Aragón. La fase definitiva del trabajo ha sido financiada mediante encargo realizado por la Subdirección General de Medios de Producción Agrícolas del Ministerio de Agricultura, Alimentación y Medio Ambiente.

Bibliografía Biocca, M., Limongelli, R., Imperi, G. (2008). Un applicativo informatico per la gestione del controllo funzionale delle irroratrici usate. ATTI Giornate Fitopatologiche 2, 25-31. Friedrich, T. (2006). Do we need international standards on pesticide application?. Aspects of Applied Biology 77, 13-21. Gil, E., Gracia, F., Escolá, A. (2011). Manual de inspección de equipos de aplicación de fitosanitarios en uso. Ministerio de Medio Ambiente y Medio Rural y Marino. Madrid. Haller, G., Loga, J. (2007). GUVERTO – internet based software for sprayer control. Second European Workshop on Standardized Procedure for the Inspection of Sprayers in Europe -, SPISE 2 -, Straelen (Germany), April 10-12, 2007. Herbst, E., Herbst, K. (2009). Sprayer-Testing - Electronic analysis of the test reports. 3th European Workshop on Standardized Procedure for the Inspection of Sprayers in Europe -SPISE 3 -Brno, September 22-24, 2009. Kole, JC. (2009) Electronic inspection reports in the Netherlands. Efficient and uniform data transfer of performed inspections to the owner of the sprayer and the supervising organization. 3th European Workshop on Standardized Procedure for the Inspection of Sprayers in Europe -SPISE 3 -Brno, September 22-24, 2009. Langenakens, J. (2009). Software for inspections of sprayers: needs and solution. 3th European Workshop on Standardized Procedure for the Inspection of Sprayers in Europe -SPISE 3 -Brno, September 22-24, 2009. Mostade, O., Briffeuil, P. (2009). ITEQ sprayer diagnostic software. 3th European Workshop on Standardized Procedure for the Inspection of Sprayers in Europe -SPISE 3 -Brno, September 22-24, 2009. Wehmann, H.J. (2009). Actual survey about inspection of sprayers in the European countries. Third European Workshop on Standardized Procedure for the Inspection of Sprayers – 3th European Workshop on Standardized Procedure for the Inspection of Sprayers in Europe -, SPISE 3 -Brno, September 22-24, 2009.

572


 







Anรกlisis del comportamiento de la uniรณn pilar-zapata en uniones en cรกliz de pilares prefabricados mediante modelizaciรณn por el Mรฉtodo de los Elementos Finitos       



 !" #$%& ' ' (()*  +,-.$   /.%  -0".% 



Resumen 1-$1 1111/() 1" 2 /3   % 1  1 /$ -31 1    1  112%  014     / 1    - 1  %  1    3  1  153%-142%1%4-11111 1    2% 12  $1% 1    4      2      30"1/1%$11$1%1+%12%1 -113111-  &  3", % 11  "-31 /$  

Analysis of the behavior of isolated foundation-column connection in precast concrete structures by using the Finite Element Method Abstract 6 - /   "  - /  - $+1 31$  /  -  -/11-134/+14 7-/-1 -1 71 /11-1/--/ -$ -$/381-18/  9/ 4 -  3/1 38 3/ -  1 -1  1 /1/ -  - / /1/---/0  9/  - /  8  4% / 1$ - -- - / +-1    34$131-/1 &  :481, 1-1   /1

Introducciรณn 1- $1 -311/$1;11 1%10431" 51 $1  <1$; 4 111/()  4 1- $1&   /3   1  -31 1     "01 112%11 1 0/-1%111-314

573


 







'41#%+0 '/53' #.$04 4' 3'--'/# %0/ .035'30 &' %'.'/50 0 %0/ *03.+)=/  4+/ 13#%5+%#3 /+/)>/ 53#5#.+'/50 0 .'%#/+;#&0 '41'%+#- # -#4 461'3(+%+'4 '95'3+03'4 &'- 1+-#3  26' 5#/ 4=-0 13'4'/5#/ -# 36)04+&#& &' -# 461'3(+%+' -+4# &'- *03.+)=/ 13'(#$3+%#&0  03 5#/50  5#/50 '- 1+-#3 %0.0 -# ;#1#5# %0/45+56:'/1+';#4+/&+7+&6#-'426'+/5'3#%5>#/'/53'4?#53#7@4&'464461'3(+%+'4&'%0/5#%50  #3# '-%#40 &''4536%563#4&' '&+(+%#%+=/ 40.'5+&#4#)3#/&'4%#3)#4  '9+45'/ 7#3+04'456&+04'/-04 26' 4' *# &'5'3.+/#&0 26' &+%*# 3+)+&'; &'1'/&' &' -# 1301+# 130(6/&+&#& &' '.1053#.+'/50 : &'- %0'(+%+'/5'&'30;#.+'/50'/53'-#4461'3(+%+'4'/%0/5#%50 .$04(#%503'4%0/&+%+0/#/-#53#/4.+4+=/ &''4(6'3;04:'-'26+-+$3+0'45A5+%0&'-%0/,6/50&'-#6/+=/ :'/&'(+/+5+7#46%0.1035#.+'/50.A4 5'/&'/5' # 6/# #35+%6-#%+=/ 0 # 6/ '.1053#.+'/50  !+/ '.$#3)0  : 1#3# '- %#40 &' '4536%563#4 #)30+/&6453+#-'4&'6/#1-#/5# %0/%#3)#4)3#7+5#%+0/#-'43'-#5+7#.'/5'$#,#4'/%0.1#3#%+=/%0/-#4 #/5'3+03'4 /0'9+45'/#1'/#43'46-5#&04'91'3+.'/5#-'426'1'3.+5#/#4')63#3%6A-'4-#130(6/&+&#& &''.1053#.+'/50&'-1+-#3'/-#7#+/##1#35+3&'-#%6#-4'16'&'#(+3.#326''-%0.1035#.+'/50&' &+%*0/6&04'#4'.',##6/#6/+=/3?)+&#0#6/#6/+=/#35+%6-#&#  / %6#/50 # -# 130(6/&+&#& &' +/530&6%%+=/ &'- 1+-#3 '/ '- %A-+;  &+7'3404 #6503'4 : 0$-+)#%+0/'4 /03.#5+7#4'45#$-'%'/-#130(6/&+&#&.?/+.#1#3#%0/4+&'3#3-#6/+=/'.1053#&# #/03.#'41#B0-# + &(+,#6/#130(6/&+&#&.?/+.#&' C* 4+'/&0*'-%#/50&'-1+-#3&'-%=&+)0$3#4+-'B0  +    & '9+)' 130(6/&+&#&'4 '/53' C* : C* -# /03.# +5#-+#/#  +   '/53' C*: C*'0/*#3&5:0'//+/) &'-'7#/'45047#-03'4# C*: C* .+'/53#426'4#/#+ '5 #- & (+,#/ 6/ 7#-03 .?/+.0 &' C*  / %6#/50 #- %0'(+%+'/5' &' 30;#.+'/50 '/53' -#4 461'3(+%+'4 -0413016'45047#3?#/'/53'D  +  "    &:D  #/*# 

 &  /'45'#35?%6-04'.6'453#/-043'46-5#&040$5'/+&04#1#35+3&'6/#4'3+'&'.0&'-04/6.@3+%04 %0/ -0426'4'3'#-+;#13+.'306/#7#-+&#%+=/&'-.@50&0%0/3'41'%50#-04.@50&04&'%A-%6-0&'4%3+504 '/ -# 5'03?# %-A4+%#  : 1045'3+03.'/5' 4' '456&+# '- %0.1035#.+'/50 &' '45' 5+10 &' 6/+=/ # &+45+/5#4 130(6/&+&#&'4 &' '.1053#.+'/50  $#,0 6/ %0'(+%+'/5' &' 30;#.+'/50 &'5'3.+/#&0  : #46.+'/&0 -# 104+$+-+&#& &' &'4-+;#.+'/504 : &' 4'1#3#%+=/ '/53' 461'3(+%+'4  - '456&+0 4' 3'#-+;= 4+/ 3'$#4#3 '- &0.+/+0'-A45+%0 :1035#/504+/+/530&6%+3'//+/)>/%#40%0.1035#.+'/501-A45+%0'/-04.#5'3+#-'4  -0$,'5+70(+/#-&'-#35?%6-0'4&'5'3.+/#3'-(6/%+0/#.+'/50&'-#6/+=/$#,0-#4%#3)#4646#-.'/5' 65+-+;#&#4'/'4536%563#4#)30+/&6453+#-'4&'6/#40-#1-#/5# 

Material y MĂŠtodos !' 3'#-+;#30/ 7#3+#4 4'3+'4 &' .0&'-04 /6.@3+%04 103 '- @50&0 &' -04 -'.'/504 +/+504 &  1#35+'/&0&'.0&'-0413'-+.+/#3'4&'6/1+-#3'.1053#&0'/46$#4':-+$3''/%030/#%+=/ %0/-0426' 4'%0.130$=-#7#-+&';&'-.@50&0%0/3'41'%50#-#5'03?#%-A4+%# 1#3#1045'3+03.'/5'.0&'-+;#3-# 6/+=/&'4%3+5#:'456&+#346%0.1035#.+'/50#&+45+/5#4130(6/&+&#&'4&''.1053#.+'/50  - 40(58#3' 65+-+;#&0 1#3# '- .#--#&0 (6' '- 130)3#.# #53#/  +  - %A-%6-0 &' -04 .0&'-04 : '- #/A-+4+4&'3'46-5#&044'3'#-+;#30/%0/$#264 +  /%6#/50#-#)'0.'53?#:.#--#&0&'-04.0&'-04 4'.0&'-+;=6/1+-#3&'*03.+)=/#3.#&0&'  ..9 ..&'$#4':6/##-563#-+$3'&' ..&'4&'-#3#4#/5'&'-%A-+; #461'3(+%+'&'-# $#4' '.1053#&# &'- 1+-#3 4' 30&'= %0/ 6/ %A-+; &' %'.'/50 &'  .. &' '41'403  # 1#35+3 &'- 26' 4' .0&'-+;=6/#;#1#5#&'*03.+)=/&' ..9 ..&'$#4': ..&'#-563# /-#$#4' &'-#;#1#5# #&'.A4 4'+/530&6,0'/'-.0&'-06/#%#1#&'*03.+)=/&'-+.1+';#&''41'403 ..  !'&+4164+'30/5#.$+@/$#33#4&'#3.#&63#'/-#$#4'&'-#;#1#5#:#-3'&'&03&'-%A-+;  #4 $#33#4 &' #3.#&63# &' #%'30 4' .0&'-+;#30/ .'&+#/5' '-'.'/504 -+/'#-'4 %0/ 6/# &+.'/4+=/ '-'.'/504$#33#&.+'/53#426''-3'450&'.#5'3+#-'4 *03.+)=/ %'.'/50:46'-0&4'.0&'-+;#30/%0/ '-'.'/504*'9#@&3+%04'/ &+.'/4+0/'4 '-'.'/504*'9#@&3+%044=-+&04& #+/5'3#%%+=/'/53''-1+-#3 : '- %A-+; 4' .0&'-+;= +/530&6%+'/&0 4'/&#4 461'3(+%+'4 &' %0/5#%50 '/53' -#4 %#3#4 '95'3+03'4 &' -04 '-'.'/504&'-1+-#3'.1053#&0:-#4+/5'3+03'4&'-04'-'.'/504&'-%A-+;&'%'.'/50 

574


 







$6 352)81','$'(6 '( (03275$0,(172 '(/ 3,/$5 /(0%& (1 (/ &=/,< )8(521 '(  00  00  00 000000;00 $5$(/&$172'(3,/$502'(/,<$'2 + 00& /$0$;25 '((67$6352)81','$'(6 00&6(&255(6321'($81$352)81','$''((03275$0,(172/(0% C+  1&8$172$/260$7(5,$/(6'(/02'(/2 686&$5$&7(5?67,&$66(5()/(-$1(1/$!$%/$  Tabla 1. Materiales y sus propiedades. $7(5,$/ &(52 250,*=1  (0(172

5832'( (/(0(1726 50$'85$6 ,/$5 #$3$7$ 250,*=1'(/,03,(<$ =/,<

203257$0,(172  /=67,&2+/,1($/

='8/2(/=67,&2 2(),&,(17( '(2,6621 00 &

   

(16,'$' .*00 &  : +

/=67,&2+/,1($/

 

 

: +

/=67,&2+/,1($/



 

: +

(620(7,=$/2602'(/26$&20%,1$&,21(6'(81$ &$5*$*5$9,7$&,21$/38178$/(1&$%(<$'(3,/$5'(

 .  -8172 &21 &$5*$6 /$7(5$/(6 '(         ;  .0  1 &8$172 $ /$6 &21',&,21(6 '( &2172512 6(/,0,7$52172'26/26*5$'26'(/,%(57$''(/2612'26'(/$%$6(;/$6&$5$6/$7(5$/(6'(&$'$ 02'(/2 1/25()(5(17($/$,17(5$&&,=1(175(683(5),&,(6'(&217$&72 6(3(50,7,='(6/,<$0,(172(175( 683(5),&,(6;6(3$5$&,=181$9(<(67$%/(&,'2(/&217$&72(175((/(0(1726 172'26/26&$626 6($3/,&= 81&2(),&,(17('(52<$0,(172D &202(/48(0(-25&255(/$&,=1'$(175((/02'(/2180>5,&2;(/ (:3(5,0(17$/ $1+$   &  3$57,5'(/02'(/2*(1(5$/6(2%789,(52102'(/263$8/$7,1$0(17(6,03/,),&$'26+$67$//(*$5$/0=6 6(1&,//2'(3,/$5(03275$'2(168%$6( 1(67((678',26($1$/,<$1 '(/26 02'(/265($/,<$'26 &8;$ '(6&5,3&,=16(5()/(-$(1/$!$%/$  Tabla 2. TipologĂ­a de modelos pilar-cĂĄliz analizados. 2'(/2

$5$&7(5?67,&$6

2'26(03275$'26



,/$5(03275$'2(168%$6( ,/$5(03275$'2(172'$68 352)81','$''((03275$0,(172 ,/$5&21&=/,<(03275$'2

$5$,1)(5,253,/$5 $5$6,1)(5,25;(:7(5,25(6'(72'$/$ /21*,78'(03275$'$ $5$6,1)(5,25;(:7(5,25(6'(/&=/,< 

   

83(5),&,(6'( &217$&72 ,1*81$ ,1*81$ ,/$5+&=/,<

$5$/$9$/,'$&,=1'(/0>72'2)5(17($/$7(25?$(/=67,&$&/=6,&$ 6(5($/,<=81$9$5,$17('(/2602'(/26 ; %$-2&21',&,21(67(=5,&$6'($3/,&$&,=1'(/  ((/,0,1=/$&$5*$$:,/;6(0$1789281$ &$5*$ /$7(5$/ 81,)250(0(17( 5(3$57,'$ '( 9$/25 4 .0  $5$ $6,0,/$5/26 $/ &$62 7(=5,&2  6( (/,0,1$521'(/02'(/2/$6$50$'85$6'($&(52;6('(6$&7,9$521'(/&=/&8/2/26()(&726'(%,'26$12 /,1($/,'$'(6*(20>75,&$6 /248(5(68/7$(1813,/$5'(6(&&,=1&2167$17(;+202*>1($'(+250,*=112 620(7,'2$()(&726'( E25'(1  ((/,0,1=7$0%,>1/$)8(5<$92/80>75,&$*5$9,7$725,$ &21/248(6( (/,0,1$(/3(623523,2'(/260$7(5,$/(6 ;/$(67$%,/,<$&,=1(1(5*>7,&$ /248((/,0,1$(/(5525 $8148( '(635(&,$%/(&,1752'8&,'2325',6,3$&,=1'((1(5*?$  $'()250$'$;)/(&+$0=:,0$'(/3,/$5$6?2%7(1,'$6(1/2602'(/26180>5,&266(&203$5$1&21/$6 &255(6321',(17(62%7(1,'$6'(/$7(25?$'(/$(/=67,&$3$5$(/&$62'(81$9,*$(03275$'$(192/$',<2 &21 81$ &$5*$ 81,)250(0(17( 5(3$57,'$  /2 48( 3(50,7( 9$/,'$5 /26 5(68/7$'26 2%7(1,'26 &21 /26 (63(5$'267(=5,&$0(17(  "1$ 9(< 9$/,'$'2 (/ 0>72'2  6( 5($/,<= (/ &=/&8/2 '( /26 02'(/26 (1 &21',&,21(6 5($/(6  (672 (6 ,1752'8&,(1'2 /$ &$5*$ (1 &2521$&,=1 '(  . (1 &20%,1$&,=1 &21 /$6 ',67,17$6 &$5*$6 /$7(5$/(6 '(6'(.0+$67$ .0  (,1&/8;(521/$6$50$'85$6'($&(52 ;6(&216,'(5=(/3(623523,2'( /260$7(5,$/(6;/26()(&726'( E25'(1'(%,'26$12/,1($/,'$'(6*(20>75,&$6  / &203257$0,(172 '( /$ 81,=1 6( $1$/,<= &203$5$1'2 /26 5(68/7$'26 2%7(1,'26 (1 /26 02'(/26   &21/262%7(1,'26(1/2602'(/26 72'26(//26&$/&8/$'26(1/$6&21',&,21(65($/(6$17(5,250(17( '(6&5,7$6 

575


 







Resultados y Discusiรณn Validaciรณn del Mรฉtodo de Elementos Finitos (MEF) 9( .!"(!&,.1*.#(0!.(-')4/%*.#3%((/"(!$/)63%)/+0!*% /!* (+/)+ !(+/*1)7.%+/ 4(+/ +//+/!30.!)+/ !()+ !(+ 4(+..!/,+* %!*0!(/+ ! 2%#!),+0. !*2+( %5++0!*%  !(0!+.8 !(!(6/0%!+),.+9+)+( %"!.!*%!*(+/ !/,(5)%!*0+/!*0.!!(4(0!+.8 !(!(6/0%"1!!*0+ +/(+//+/%#1(+)!*+.(  !+),.+90)%7*+)+!*0.!(+/)+ !(+/ *+!3%/0!* %"!.!*%//%#*%"%0%2//%!* +7/0/ !*0+ +/(+//+/%*"!.%+.!/(  %* !,!* %!*0!)!*0! !(,.+"1* %   !!),+0.)%!*0+ !( /! !(,%(. "%#1. .!"(!&(/ !"+.) / !(,%(.,.0.!/ !(+//+/*0!.%+.!/+0!*%7* +/! %"!.!*%/ !*(+/ !/,(5)%!*0+/% 7*0%/(/*0!.%+.!/(+(.#+ !0+ ((01. !(,%(. Tabla 3. Flecha mรกxima del pilar. Condiciones teรณricas de aplicaciรณn del MEF con q=6kN/m.

+ !(+      

.+"1* %   ! !),+0.)%!*0+!*( /! !(,%(. (!)))    

(!$)63%) !( )+ !(+*1)7.%+ ")63))

(!$)63%) 0!9.%)) 2%#!),+0.  !*2+( %5+

F ")63 

      

 

     

 

altura pilar (mm)





2%#!),+0. !*2+( %5+



  (!) ))



f lecha mรกxima (mm)







Figura 1. Deformada del pilar. Aplicaciรณn del MEF bajo condiciones teรณricas con q= 6 KN/m.

 ( 2%/0 ! !/0+/ .!/1(0 +/ 4  )%0%!* + 1* !..+. )!*+. + %#1( (  /! ,1! ! "%.). -1! !( .!/1(01*)70+ +26(% +,.*(%5.(+/)+ !(+/!*!/01 %+($!$+ !-1!( !"+.)%9* /!%* !,!* %!*0! !(,.+"1* %   !!),+0.)%!*0+!*!()+ !(+ !/+*/%/0!*0!,1!/0+-1!!* %$+ )+ !(+ 0+ +/ (+/ *+ +/ ! ( /!  1(-1%!. ,.+"1* %   !/06* !),+0. +/ !/0+ !/ )+ !(%5 +/+*0+ +//1/#. +/ !(%!.0 .!/0.%*#% +/,+.(+-1!!*(,.60%(,.+"1* %   ! !),+0.)%!*0+,!*/0%!*!%*"(1!*%!*(+/.!/1(0 +/

576


 







Comportamiento de la uniรณn tipo cรกliz de superficies lisas !6%703713()03746):-37():%0-(%'-=27)%2%0-==)0'314368%1-)283()0%92-=2)203713()037  %6%)0037)%2%0-=%6320%7()*361%'-32)7<*0)',%71>;-1%7463(9'-(%7)2)04-0%6283(37037'%737 7) '327-()6= 59) 0% 92-=2 )6% -2:-%&0) 7-)146) 59) 7) 794)6%7) &%.3 )0 '6-8)6-3 () #32 -7)7 0% 8)27-=21>;-1%'%6%'8)6?78-'%()0,361-+=2 )783)7G1>; 11 4%68-6()(-',3:%036)0 13()037)6)',%==436794)6%6)00?1-8)()63896%()01%8)6-%0 %!%&0% 6)*0).%0%7*0)',%71>;-1%73&8)2-(%7)203713()037<79436')28%.)():%6-%'-=2)286)0% 1)236 11<1%<36 11463*92(-(%(())14386%1-)2834%6%'%(%'%73()'%6+%"2%$)2 0376)'9%(637-2(-'%59))013()03*9)6)',%=%(3436794)6%6G1>;  0% :-78% () 037 6)7908%(37 7) '31469)&% 59) 4%6% 92% 1-71% '%6+% 0%8)6%0 0% *0)',% 1>;-1% %91)28% % 1)(-(% 59) (-71-29<) 0% 463*92(-(%( () )14386%1-)283 6)7908%(37 '3,)6)28)7 '32 03 3&8)2-(3436)32,%6(8<3)22-2+ <7%2%-)8%0 ()1>78%0<'3137)()19)786% )230-2% '9%2831)236)70%463*92(-(%(())14386%1-)2831%<36)7)0-2'6)1)283()(-',% *0)',% % 1)(-(% 59) %91)28% 0% '%6+% 0%8)6%0 %40-'%(% 783 )7 -2'6)1)2837 ()0 1-713 :%036 )2 0% '%6+% 0%8)6%0 463(9')2 92% 1%<36 ()*361%'-=2 6)0%8-:% '9%283 1)236 )7 0% 463*92(-(%( () )14386%1-)283 )74)'83%0%1%+2-89(()0%'%6+%0%8)6%0%40-'%(%)0-2'6)1)283()0%*0)',%1>;-1%%1)(-(%59) (-71-29<)0%463*92(-(%(())14386%1-)283)719',31)236)2'%6+%76)0%8-:%1)28)&%.%7<%91)28% %1)(-(%59)%91)28%0%'%6+% )'31469)&%'=134%6%92%'%6+%5/10%(-*)6)2'-%()*0)',%7 )286)0%1%<36<1)236463*92(-(%(())14386%1-)283)7()0 1-)286%759)4%6%5 /1 %0'%2=%)0   Tabla 4. Flechas mรกximas y variaciรณn mรกxima con carga axil N=200 KN y distinta carga lateral. 51

63*92(-(%(())14386%1-)283)2 0%&%7)()04-0%6 0)1&11







 

 

 

$

$



 

 

 

 

 

$









 

 

 

 

 





 

 



 

 

 

 

 

 



 

 

 

 

 

 



 

 

 

 

 

 



 

 

F*0)',%1>;-1%

 

 





 















0)',%1>;-1%*1>;11

)74)'83%0%78)27-32)7%0%759)7))2'9)286%731)8-(3)0,361-+=27)'31469)&%'=13%1)(-(% 59) -2'6)1)28% 0% '%6+% 037 13()037 '32 1)236 463*92(-(%( () )14386%1-)283 -2'9140)2 463+6)7-:%1)28))0'6-8)6-3()8)27-=21>;-1% )3&7)6:%'=13,%78%92%'%6+%0%8)6%05 /123 7) %0'%2=% 0% 8)27-=2 1>;-1% -2()4)2(-)28)1)28) () 0% 463*92(-(%(  4%68-6 () (-',% '%6+% 0% 8)27-=21>;-1%7)%0'%2=%4%90%8-2%1)28))203713()037'32463*92(-(%(())14386%1-)283 11 < 11%'%6+%0%8)6%00?1-8)4%6%83(3703713()0376)7908=7)65 /1)20%59)7)%0'%2== 0%8)27-=21>;-1%)283(%70%7463*92(-(%()7())14386%1-)283 2'9%283%0%7()*361%(%7()04-0%60%*-+96% 6)*0).%'313).)14030376)7908%(373&8)2-(37)20%7 (-78-28%7463*92(-(%()7())14386%1-)2834%6%037'%737()'%6+%%;-0 /<'%6+%0%8)6%05  /1<7)'314%6%2'32037'366)7432(-)28)7()013()03 

577


 













altura de pilar (mm.)





! 708-

88

! 708-

88

! 708-

88

! 708-

88

! 708-

88

! 708-

88

! 708-

88

!

















f (mm)



Figura 2. Modelo M2. Deformada del pilar. AplicaciĂłn del MEF bajo condiciones reales y una carga lateral q=12 KN/m.

:>=0>@7?,/:>8:>?=,=:9.H8:-,5:@9,.,=2,7,?0=,7<6" 87,/01:=8,/,/07;47,=>08,9?4090>49 .,8-4:> >429414.,?4A:> 3,>?, 7, ;=:1@9/4/,/ /0 08;:?=,8409?: 708-

 88 09 7, <@0 .:8409I, , ;=0>09?,=/0>;7,I,8409?:>>429414.,?4A,809?08,J:=0>/07:=/09/07.:9=0>;0.?:,7=0>?:/0 ;=:1@9/4/,/0>97,142@=, >0:->0=A,.H8:;,=,@9,.,=2,7,?0=,7< 6" 8.:8409I,9,/,=>0 ,@809?:> >429414.,?4A:> 09 7:> /0>;7,I,8409?:> /07   .:9 =0>;0.?: ,7 =0>?: /0 ;=:1@9/4/,/0> , ;,=?4= /0 7, ;=:1@9/4/,/ /0 08;:?=,8409?: 708- 

 88 >409/: ,K9 8,J:=0> , 708-

 88   

Conclusiones :>=0>@7?,/:>:-?094/:>49/4.,9<@0090>?0?4;:/00>?=@.?@=,>.:9.,=2,>,C47J7,?0=,7=07,?4A,809?0 -,5,> 7:> /0>;7,I,8409?:> 09 07 ;47,= 9: >@1=09 .,8-4:> >429414.,?4A:> 3,>?, @9, ;=:1@9/4/,/ /0 08;:?=,8409?: 708-

 88 >?: 49/4., <@0 3,>?, 7, ;=:1@9/4/,/ /0 08;:?=,8409?: 708-3 >409/:307.,9?:/07;47,=7,@94H98,9?4090@9,=424/0I>@14.409?0.:8:;,=,.:9>4/0=,=,7,;40I, 08;:?=,/, >?, =0>@7?, 7, ;=:1@9/4/,/ 7L84?0 , ;,=?4= /0 7, .@,7 7, @94H9 .:8409I, , ;0=/0= 7, .:9/4.4H9/008;:?=,8409?:

BibliografĂ­a ,93,%!

>?@/:?0H=4.:0C;0=4809?,7/,742,MN:;47,=1@9/,MN:;:=804:/0.O74.0080>?=@?@=,>/0 .:9.=0?:;=P8:7/,/:&N:,=7:>'0>0:@?:=,/:(94A0=>4/,/0/0&N:$,@7 "%

    "% ":=80 '0.94.30 >?=@I4:94 ;0= 47 ;=:20??: 70>0.@I4:90 0/ 47 .:9?=:77: /0770 >?=@??@=0;=01,--=4.,?049.,7.0>?=@II:   

 %0,7 0.=0?: 

 /0  /0 5@74: ;:=  07 <@0 >0 ,;=@0-, 7, 49>?=@..4H9 /0 3:=842H9 0>?=@.?@=,7 #"Q

/0

/0,2:>?:/0

 @=:.:/0 

0>429:1.:9.=0?0>?=@.?@=0>$,=?  090=,7=@70>,9/=@70>1:=-@47/492>"    

 0:93,=/?  !:099492    >?=@.?@=,> /0 3:=842H9 ,=8,/: ,=8,/: /0 0>?=@.?@=,> /0 3:=842H9 ,=8,/:/7?090: !:749,

9O74>4>/072=,/:/0=424/0I/07,@94H9;47,=I,;,?,?4;:.O74I090>?=@.?@=,>/03:=842H9 ,=8,/:;,=,0/414.4:>,2=:49/@>?=4,70>;:=078P?:/:/07:>070809?:>494?:>$=:J0.?:49/0!O>?0= (94A0=>4/,//0+,=,2:I,>.@07,$:74?P.94.,&@;0=4:=@0>.,

 "%   >>:.4,MN:-=,>4704=,/09:=8,>?P.94.,>"%  R$=:50?:00C0.@MN:/00>?=@?@=,> /0.:9.=0?:;=P8:7/,/:%4:/0,904=: #>,9,4 * ),?,9,-0  #6,8:?: &   &?=0>> ?=,9>10= 80.3,94>8 :1 >:.60? -,>0 .:990.?4:9> B4?3 ;=0.,>?.:9.=0?0.:7@89>ACI Structural Journal93(3)  

578


 







Influencia de diferentes tipos de estructuras de invernadero, mallas antiinsectos y tĂŠcnicas de control climĂĄtico, sobre la fotosĂ­ntesis y la transpiraciĂłn de plantas de tomate   0;,    *$0   -0$,-   -*(, +(8  =.$8  $< 



$,20-#$,4$12(& "(=,$,(-2$",-*-&; &0- *(+$,2 0( 9 !,(4$01(# ##$*+$0; 20 #$  "0 +$,2- 1,  *+$0; 1. < $++ (* #4 *$0 3 * $1



Resumen ,$12$20 ! )-1$'  , *(8 #-* (,%*3$,"( #$#-12(.-1#$$1203"230 1#$(,4$0, #$0- #-12(.-1#$+ **  ,2(+ (,1$"2-1  4$,2(* "(=, , 230 *  ,$!3*(8 "(=,  . ,$*$1 $4 .-0 #-0$1  " *$% ""(=, .-0 &3  " *($,2$ 7 .-0 (0$ " *($,2$ 1-!0$* %-2-1;,2$1(17* 20 ,1.(0 "(=,#$3,"3*2(4-#$2-+ 2$ -1$,1 7-11$' ,0$ *(8 #-$,"3 20- (,4$0, #$0-1 #$* " +.- #$ .09"2(" 1 #$ *  !,(4$01(# # #$ *+$0;  20$1 #$ $**-1 +3*2(2>,$* 7 $* -20- 2(.- *+$0;  $ '  32(*(8 #- 3, "3*2(4- #$ 2-+ 2$ 7  /3$ $1 $* +91 32(*(8 #- $, *  8-,  "-+. 0 ,#- $, $* "("*- -2-<-+(,4($0,-#-11(12$+ 1#$" *$% ""(=,%0$,2$ 4$,2(* "(=,, 230 * 7$*"("*-.0(+ 4$0 +4$0 ,- #-11(12$+ 1 #$ 0$%0(&$0 "(=, .-0 $4 .-0 "(=, #$ &3  %0$,2$  4$,2(* "(=, , 230 *  $, #-1 $1203"230 1 #$ (,4$0, #$0-  -1 $,1 7-11$0$ *(8 0-,$,* " +. <  &0;"-*     7$, +!-1"("*-12 +!(:,1$$123#(=* (,%*3$,"( #$* 2(.- #$ + **  ,2(+(,1$"2-1 32(*(8 #  -1 0$13*2 #-1 +3$120 , /3$ $6(12$, #(%$0$,"( 1 $12 #;12(" +$,2$ 1(&,(%(" 2(4 1 $,20$ $* 2(.- #$ (,4$0, #$0- 32(*(8 #-  -!2$,($,#- + 7-0 "2(4(# # %-2-1(,2:2("  * 1 .* ,2 1 #$ 2-+ 2$ #$ *-1 (,4$0, #$0-1 +3*2(2>,$* %0$,2$  * 1 "3*2(4 # 1 $, $* (,4$0, #$0- 2(.- *+$0;  (, $+! 0&-  "-+. 0 ,#-" # "("*-.-01$. 0 #- ,-1$' ,$,"-,20 #-#(%$0$,"( 1$12 #;12(" +$,2$1(&,(%(" 2(4 1$,20$*-1 #(12(,2-12(.-1#$" *$% ""(=, ,($,20$*-1#(12(,2-12(.-1#$0$%0(&$0 "(=, ,($,20$* 1+ ** 132(*(8 # 1   * !0 1"* 4$ (,4$0, #$0- "-,20-*"*(+92("- %-2-1;,2$1(1 20 ,1.(0 "(=, 

Influence of different greenhouse structures, insect-proof screens and climate control techniques, on photosynthesis and transpiration of tomato plants Abstract , 2'(1. .$05$ , *78$ 2'$ (,%*3$,"$ -%25- 27.$1-%&0$$,'-31$1  25- 27.$1 -% (,1$"2+.0--% 1"0$$,1 , 230 * 4$,2(* 2(-,  %-& 1712$+  "--*(,& 1712$+  '-2 5 2$0 '$ 2(,& ,# '-2 (0 '$ 2(,&  -, .'-2-17,2'$1(1 ,# 20 ,1.(0 2(-, -%  "0-. 2-+ 2-  9'$ 20( *1 5$0$ #$4$*-.$# (, %-30 &0$$,'-31$1 -% 2'$ $6.$0(+$,2 * % 0+ 2 2'$ !,(4$01(27-%*+$0; 2'0$$ +3*2(23,,$* ,#-,$*+$0; +27.$ $31$# 2-+ 2-"0-.!$" 31$(2(12'$+-12 31$#(,2'$ 0$ "-+. 0$#(, 323+,+5(,2$025-'$ 2(,&1712$+1 & (,12, 230 *4$,2(* 2(-,(,25-&0$$,'-31$ 1203"230$1  ,# (, 1.0(,&+13++$0  25- 0$%0(&$0 2(-, 1712$+1 !7 5 2$0 $4 .-0 2(-, "-+. 0$# 2- , 230 * 4$,2(* 2(-,  9'$ 20( *1 5$0$ " 00($# -32 (, 2'$ "0-. 1$ 1-,     ,# (, !-2' "7"*$1 323+,+5(,2$0 ,# 1.0(,&+13++$0& *1- 123#($# 2'$ (,%*3$,"$ -% 2'$ (,1$"2+.0--% 1"0$$, 31$#  9'$ 0$13*21 1'-5 2' 2 2'$0$ 5$0$ 12 2(12(" **71(&,(%(" ,2#(%%$0$,"$1!$25$$,2'$27.$-%&0$$,'-31$31$# -!2 (,(,&'(&'$0.'-2-17,2'$2(" "2(4(27 -% 2-+ 2- .* ,21 (, +3*2(23,,$* &0$$,'-31$1 & (,12 2'-1$ &0-5, (, 2'$ *+$0; +27.$ &0$$,'-31$1  -5$4$0  "-+. 0(,&$ "'"7"*$1$. 0 2$*7 ,-12 2(12(" **71(&,(%(" ,2#(%%$0$,"$1!$25$$,2'$4 0(-3127.$1-%'$ 2(,& -0 !$25$$,2'$#(%%$0$,227.$1-%0$%0(&$0 2(-, -0!$25$$,2'$+$1'31$#  $75-0#1 &0$$,'-31$ "*(+ 2$"-,20-* .'-2-17,2'$1(1 20 ,1.(0 2(-,

IntroducciĂłn   %-2-1;,2$1(1 $1 $* .0(,"(. * .0-"$1- %(1(-*=&("- /3$ (+.3*1  $* "0$"(+($,2- #$ * 1  .* ,2 1 7 *  .0-#3"2(4(# # #$ *-1 "3*2(4-1  #$+91 $129 +37 (,%*3$,"( #  .-0 $* +$#(- +!($,2$  3 $123#(- 1$ 43$*4$ " #  4$8 +91 (+.-02 ,2$ $, $* "-,2$62- #$ $4 *3 0 $* (+. "2- #$* " +!(- "*(+92("- $, *-1

579


 







,*6:0:;,4(:(.9(906:?+,,>7369(96769;<50+(+,:7(9(3(796+<**0E5+,,5,9.C(+,)(:,)063E.0*('05 ,; (3   65 *(9A*;,9 .,5,9(3 3( ;(:( -6;6:05;B;0*( +,7,5+, )A:0*(4,5;, +, 3(: *65+0*065,: +, ;,47,9(;<9( ? +, 3( 05;,5:0+(+ 3<4C50*( /(:;( <5 4A>046 ( 7(9;09 +,3 *<(3 3( ;(:( -6;6:05;B;0*( +0:405<?,769-6;605/0)0*0E5!<,96,;(3 ",/(6):,9=(+68<,3(05*69769(*0E5+,:0:;,4(: +, *(3,-(**0E5 ,5 ,:;, ;076 +, 05=,95(+,96 7,940;,5 4(5;,5,9 <56: 50=,3,: ;B940*6: (+,*<(+6: +<9(5;,3(B76*(05=,95(3796769*065(5+605*9,4,5;6:56;()3,:,53(796+<**0E5:0,5+6+,3,5 *<3;0=6+,1<+C(69,5@6,;(3 )?+,3 ,57,705669,5@6,;(3 (57904(=,9(3( ,3,=(+( ;,47,9(;<9( , 05:<-0*0,5;, =,5;03(*0E5 ,5 36: 05=,95(+,96: /(*,5 4A: +0-C*03 *65:,.<09 3(: ;,47,9(;<9(:(+,*<(+(:7(9(,3*<3;0=69<5?(.0,9  65;,96,;(3 53(4(?69C(+, 3(:A9,(:+,796+<**0E5/69;C*63(3(:,:;9<*;<9(:+,05=,95(+,96;0,5,58<,:,9,5-90(+(:,5<54(?69 64,569.9(+6(363(9.6+,3(;,4769(+(+,*9,*040,5;6(22,9,;(3 (:4(33(:9,+<*,53( ;(:(+,=,5;03(*0E5+,4(5,9(,=0+,5;,*65+,:*,5:6:,505=,95(+,96:;076I34,9C(J+,/(:;(,3  %(3,9( ,; (3  $5( (+,*<(+( =,5;03(*0E5 ,5 05=,95(+,96: 4,+0;,99A5,6: ,: *9<*0(3 7(9( 4(5;,5,9 3(: *65+0*065,: 40*96*304A;0*(: (+,*<(+(: 7(9( 36: *<3;0=6: 0;(?( ,; (3   +,46:;9(9658<,3(-6;6:C5;,:0:5,;(+,73A5;<3(:+,;64(;,)(1605=,95(+,96(<4,5;(*65,3(<4,5;6 +,3(*09*<3(*0E5+,(09,+,:+,  /(:;(  4: 36)1,;0=6+,,:;,,5:(?6,:(5(30@(9+0-,9,5;,: ;B*50*(: +, *304(;0@(*0E5 (730*(+(: ,5 05=,95(+,96: ( ;9(=B: +, 3( ,=(3<(*0E5 +, 3( (*;0=0+(+ -6;6:05;B;0*( ,5 <5 *<3;0=6 +, ;64(;, +, *0*36 3(9.6 +,4A: 4,+0(5;, ,3 (5A30:0: +, 3( ;(:( -6;6:05;B;0*(;(4)0B5:,*647(9(9A536:+6:;076:+,,:;9<*;<9(:+,05=,95(+,96:4A:-9,*<,5;,:,53( @65(4,+0;,99A5,(?+6:;076:+,4(33(:(5;005:,*;6:

Material y MĂŠtodos 6:05=,95(+,96::,,5*<,5;9(5:0;<(+6:,53(7(9;,569;,+,3(476+, 9A*;0*(:+,3($50=,9:0+(++, 34,9C( :0,5+6 :< :0;<(*0E5 65.0;<+ H   (;0;<+ H    ? 3;0;<+   4 #9,: +, 36: 05=,95(+,96: ;076 I4<3;0;F5,3J :65 :0403(9,: ,5 .,64,;9C( ;076 +, =,5;(5(: 690,5;(*0E5 ? +04,5:065,: 6: +, ,:;6: 05=,95(+,96: ,:;A5 *65:;0;<0+6: 769 ;9,: 4E+<36: +,  4 +, (5*/<9( *65 =,5;(5(:*,50;(3,:,5;6+6:,336:5<56+,,336:/(?=,5;(5(:3(;,9(3,:,536:*6:;(+6:69;,?"<9 40,5;9(:8<,,53(;,9(3 69;,+,36;9605=,95(+,96:,05:;(3(965,>;9(*;69,:+,(09,?,5,3"<9;0,5, <5( =,5;(5( 3(;,9(3 *65 <5 7(5,3 ,=(769(+69 cooling system (: +04,5:065,: +, ,:;6: +6: 05=,95(+,96: :65 +,   4    4  3 ;,9*,9 05=,95(+,96 ;0,5, <5( 365.0;<+ :0403(9 +,  4 7,96:<(5*/<9(,:(3.64,569 4(3,:;(9*65:;0;<0+6769+6:4E+<36:+,4 4 5,:;, 05=,95(+,96/(?+6:=,5;(5(:*,50;(3,:?+6:3(;,9(3,:<5(,5,3*6:;(+669;,?6;9(,5,3"<93 *<(9;605=,95(+,96;076I9(:7(?(4(.(+6J,:;A1<5;6(B:;6:?;0,5,<5(:+04,5:065,:+,  4 

4 ,:;(*647<,:;6,5;6+6:<7,9C4,;96769=,5;(5(:3(;,9(3,:?;9,:=,5;(5(:*,50;(3,:6: *<(;96 05=,95(+,96: ,:;A5 *65;0.<6:  769 36 8<, 3(: *65+0*065,: *304A;0*(: ,>;,9069,: :65 4<? :0403(9,::C7<,::,/(7904(+63(*,9*(5C(+,36:05=,95(+,96:-9,5;,(6;9(:*65:0+,9(*065,:*646 3(,>(*;0;<+,53(:<7,9-0*0,+,*(+(;9(;(40,5;6?(8<,;,5,46: *65+0*065,:9,(3,:+,*(476<5 (:C*65:0+,9(46:8<,36:9,:<3;(+6:+,36:,5:(?6:,5,:;6:05=,95(+,96::6536:4A:*,9*(56:(3( 9,(30+(+?+,.9(5<;030+(+7(9(,3:,*;69 3 ,5:(?6 *65:;( +, +6: -(:,: ,5 3( 7904,9( -(:, :, ;9(;( +, *647(9(9 ,3 ,-,*;6 +, +6: :0:;,4(: +, *(3,-(**0E5,53(:,.<5+(:,*647(9(9A5+6::0:;,4(:+,9,-90.,9(*0E57(9(<5*<3;0=6+,;64(;,+, *0*36 3(9.6 +<9(5;, 3( *(47(D(

  3 *<3;0=6 (5(30@(+6 ,: ;64(;, +, 3( =(90,+(+ *64,9*0(3 Ventero051,9;(+6:6)9,,37(;9E5+,3(=(90,+(+*64,9*0(3Arnold3(:(*;0=0+(+,:(:6*0(+(:(34(5,16 +,3 *<3;0=6 ,5 ,3 ;9(5:*<9:6 +, :< +,:(996336 =,.,;(;0=6 ? *6:,*/( ;0,5,5 *646 7967E:0;6 7905*07(3 *65:,.<0936:4A>046:9,5+040,5;6:?-<,965;6+(:9,(30@(+6:7690.<(3,53(:+0:;05;(:7(9*,3(:3 *<3;0=6:,73(5;E,3+C( +,(.6:;6+,

,5:(*6:+,4,@*3(+,-0)9(+,*6*6?;<9)( (9( ,:;( 7904,9( -(:, ,5:(?6 +, *(3,-(**0E5 :, /( <;030@(+6 ,3 4E+<36 $ *65 ,3 :0:;,4( +, *(3,-(**0E5769(09,,34E+<36$

*65,3:0:;,4(+,*(3,-(**0E5769(.<(?,34E+<36$ *646 ;,:;0.63:0:;,4(+,*(3,-(**0E5769(.<(,:;A-694(+6769<5(*(3+,9(+,)064(:("#   "#,*5636.C(+,3(369"*65<5(76;,5*0(+,  2&?<59,5+040,5;6+,3 7,940;,

580


 







;9()(1(9 *65 <5 :(3;6 ;B940*6 +, /(:;(  J *65 9,:7,*;6 ( 3( ;,47,9(;<9( ,>;,9069 3 :0:;,4( +, *(3,-(**0E5 769 (09, *65:;( +, +6: .,5,9(+69,: +, (09, *(30,5;, 769 *64)<:;0E5 05+09,*;( !  <5;,9: #7(05 # +,  2' +, 76;,5*0( 56405(3 *65 <5 9,5+040,5;6 ;B940*6 +,3   ? <5 *(<+(3 +, (09, +,   4  /  6: *(3,-(*;69,: -<5*065(5 *65 8<,4(+69,: +, .(:603 "  <330=,9 "0,336#7*65*(<+(3=(90()3,+, ( 2./ +, (

2' 5 3( :,.<5+( -(:, ,5:(?6 +, 9,-90.,9(*0E5 :, /( <;030@(+6 ,3 4E+<36 % *65 :0:;,4( +, 7(5,3,: ,=(769(+69,:,34E+<36%

*655,)<30@(*0E5()(1(79,:0E5?,34E+<36% *646;,:;0.6(+,4A: +,;,9405(9,46: :0 ,>0:;,5 +0-,9,5*0(: *65 ,3 05=,95(+,96 % ;076 9(:7( ? (4(.(+6 3 :0:;,4( +, 5,)<30@(*0E5,473,(+6,:+,(09,*6479040+6*65<5*6479,:6996;(;0=6+,;6950336"$ !<:2( !5,<4(;0*#*65<5(76;,5*0(56405(3+,2'<5(79,:0E5+,;9()(16+,)(9,:?<5*(<+(3 +,(09,+,  3405 ,5;96+,305=,95(+,96:,+0:765,+,<5(9,++6)3,+,;<),9C(:+,(.<(?+, (09,8<,()(:;,*,5(3(:)68<033(:+,5,)<30@(*0E5+0:;90)<0+(:*65<5(+,5:0+(++,  )68<033(:4K  3:0:;,4(+,9,-90.,9(*0E5769,=(769(*0E5+,(.<(*65:;(+,7(5,3,:,=(769(+69,:+,2G  

<5;,9:#7(05#?,>;9(*;69,: +<5;,9:#7(05#+, '+,76;,5*0(*65<5 *(<+(356405(3( !(+,

 4 /  (+( 05=,95(+,96 4<3;0;F5,3 :, ,5*<,5;9( +0=0+0+6 769 3( 40;(+ *65:;0;<?,5+6 *(+( 40;(+ +, 05=,95(+,96<5(:<)7(9*,3(+,36:,5:(?6:5,33(+6:;,+,36:;9,:05=,95(+,96::,*636*(965,5 3(: (),9;<9(: +, =,5;03(*0E5 3(;,9(3 ? *,50;(3 4(33(: +, >  *646 ;,:;0.6 $  ? ,5 ,3 3(+6 ,:;, 4(33(:,>7,904,5;(3,:+,

> $ 8<,+(5+6-05(34,5;,:0,;,7(9*,3(:+,,>7,904,5;(*0E5*646:, 4<,:;9(,53(:0.<0,5;,;()3( Tabla 1.Ensayos realizados en cada parcela de experimentaciรณn. Parcela Sistema de calefacciรณn Sistema de refrigeraciรณn Malla Estructura  ! $   U9-E  ! $   U9-O   $   U11-E   $   U11-O & & $   U12-E & & $   U12-O  & $  " U8 )9,=0(;<9(: & =,5;03(*0E5 5(;<9(3  *(3,-(**0E5 769 (.<( *(30,5;, *65 *(3+,9( +, )064(:(  *(3,-(**0E5 769 (09, *(30,5;, *65 .,5,9(+69,: +, (09, *(30,5;, 769 *64)<:;0E5 05+09,*;(  :0:;,4( +, 5,)<30@(*0E5 +, )(1( 79,:0E5 ! 7(5,3,: ,=(769(+69,: $  (33( ;,:;0.6 +, >  /036:*4  $  (33( ,>7,904,5;(3+,

> /036:*4 5=,95(+,96;0764<3;0;F5,3"5=,95(+,96;0769(:7(?(4(.(+6

( 4,+0+( +, 3( ;(:( -6;6:05;B;0*( +, 3(: 73(5;(: :, 9,(30@E 4,+0(5;, <5 4,+0+69 0 !69;()3, !/6;6:?5;/,:0: #?:;,4  06#*0,5;0-0* 040;,+ ,9;-69+:/09, ",056 %50+6 3 6)1,;0=6 ,: 4,+09,3(4)0,5;,+,<5(/61(?*(3*<3(93((*;0=0+(+-6;6:05;B;0*(!6:,,<505;,9=(36+,4,+0+(+,  774  4)(9 ?<5(79,*0:0E5+,I 3:0:;,4(;(4)0B5(769;(4,+0+(:+, ;,47,9(;<9(+,3(/61(?+,3(09,+,/<4,+(++,9(+0(*0E5!"?+,79,:0E5(;46:-B90*(7(9;09+,3 *(<+(3+,(09,*656*0+6:,*(3*<3(3((:0403(*0E5?3(:;(:(:+,;9(5:709(*0E58<,:,(*;<(30@(5*(+( :,.<5+6;(9+(5+6 :,.<5+6:769*(+(*0*36*6473,;6!(9(3(;64(+,4,+0(+(:*65,34,+0+69+, -6;6:C5;,:0::,796.9(4E<59,*6990+6-016;,50,5+6,5*<,5;(3(,:;(*0E5+,3(D6?3(690,5;(*0E5+,36: 05=,95(+,96: ? +<9(5;, <5 7,906+6 *6479,5+0+6 ,5;9, 3(:  / ? 3(:

 / +,3 4,+06+C( 7(9( (:C *65:,.<09*65+0*065,:*304A;0*(::0403(9,:,5*(+(:,*;69+,4,+0+(#,40+0,96573(5;(:769:,*;69 ? <5 ;6;(3 +,   73(5;(: *(+( +C( :0,5+6 ,:;6: +C(: :,3,**065(+6: ,5 -<5*0E5 +, 3(: *65+0*065,: ,>;,9069,:E7;04(:+,9(+0(*0E5 6: (5A30:0: ,:;(+C:;0*6: 9,(30@(+6: /(5 :0+6 ,5 36: *(:6: ,5 8<, ,3 (5A30:0: 7(9(4B;90*6 ,: =0()3, Pruebas de Rango Mรบltiple?Verificaciรณn de la Varianza4,+0(5;,+,CochranBartlett?Hartley ?,536:*(:6:,58<,56:,*<473,3(=,90-0*(*0E5+,3(=(90(5@((5A30:0:567(9(4B;90*6:4,+0(5;,3( Prueba de Kruskal-Wallis?,3(5A30:0:+,3(:4,+0(5(:4,+0(5;,,3.9A-0*6+,Caja y Bigotes

581


 







Resultados y DiscusiĂłn Periodo otoĂąo-invierno 11574-83":19 181"13"1//1 &519  1918131115 =   1" 131$ &1  =   ." 311:/15"3$1111111  /  D     5 / 1  130 1  31  6  &   1 :/1111151   1 1 "1  / $1 /    > 1  11   1  - 1  /0 / 1 11 

 5  > 71    " 11   5 $  & 1    >  " 1 11"3513/11 >5 1   1  5 -3   1  >   "1  -: "115$  &1  >3$ 1"1-:"/113011:$1 $>:1 /111 5

 111":416 &  : -8 1  : -:    5 11" 11-:3"50"11-8      -:    5       -:  $ 15   1  "1 $  1    -8  1 117301:$1"1 1 1-:41-19$-"-"3$; 1-:171-$ :3"1-:"111 1"7115"1-:111  1  1  "1 ; 3"    "1   1-1741:1 51-1-951:11 $5"5"1 41- 19 $-"     $; 7   "1    1-19$-"-851: 5381:15" Tabla 2: Resultados obtenidos en el periodo otoĂąo-invierno. A: tasa fotosintĂŠtica [Îźmol CO2 m-2 s-1]. Q: radiaciĂłn PAR incidente en la hoja [Îźmol m-2 s-1]. E: tasa de transpiraciĂłn [mmol H2O m-2 s-1]. T: temperatura de la superficie de la hoja [ÂşC]. CO2: concentraciĂłn de CO2 [ppm]. A Q E T CO2  

   



3  3 U9-E  3    

   U9-O  3   3

 3   3 U11-E  3

  

 3  3 U11-O  3

  

 3

 3    U12-E  

  3

 

 3    U12-O $15/51-5111- 19$-"

582


 







Periodo primavera-verano 0/#+0+/&*070& "*(+/&*2".*!".+/)1(0&0:*"(%"/0!+ +),."*!&!"*0."4 <)+(6 )  / "* 1!.6*!+/"!"*0.+!"(+/2(+."/!"0".)&*!+/,+.*0&$+"0( &*"(/" 0+.!(+/ 2(+."/ ."$&/0.!+/ &*& &()"*0" "/0* "* 0+.*+   <)+( 6  )  /   ,.0&. !"(  !" '1*&+ /" ,.+!1 "*1*!"/ "*/+%/0(("$.(#&*(!"("*/4+1*0/#+0+/&*070& !" <)+(6 ) /  .!& &9*  &* &!"*0" "* ( %+' % "2+(1 &+*!+ +* 2(+."/ &*#".&+."/ (+/ ."$&/0.!+/ "* "( &*2".*!".+!9+!+/(+/2(+."//""* 1"*0.*"*0." 4 D)+(-) / /&"*!+"/0+/'+/ !"&!+ +)+"3,(& 9+."*5+"0( &(,.6 0& %&01("*(5+* +*/&/0"*0""*(*-1". ( 1&".0 +*+'"0+!"."!1 &.(/0"),".01./"3 "/&2/*"( /+!"(0/!"0.*/,&. &9*( &$1(-1"(0/#+0+/&*070& "*"(&*2".*!".+!/"!"0" 01*!"/ "*/+.1/ +,.0&.!"(!8!" '1*&+%/0"(#&*(!"("*/4+(("$.2(+."/!" ))+( 6) / "*"(."/0+!""3,(+0 &+*"/(+/ 2(+."/%*"/0!+ +),."*!&!+/"*0."  4  ))+( 6) / * 1*0+(0"),".01.!"( %+' (+/ )4+."/ 2(+."/ /" %* ."$&/0.!+ "* "( /" 0+. ! "/0/ (0/ 0"),".01./ /"$:* &"0+ 4 9(+* & %* ,+!&!+ 1)"*0. ( 2"(+ &!! !" (/ ." &+*"/ &+-18)& / /&* ").$+ ,+. "* &) !" 1* &".0+ 1).( !" 0"),".01. )1 %/ "*5&)/ ,&".!"* /1 #1* &9* !" %8 ( ' 0/ #+0+/&*070& *0+!+/(+/&*2".*!".+/*+/%")+/"* +*0.!+,+."* &)!"(+/2(+."/9,0&)+/!" 0"),".01. *+ +/0*0" "* "( &*2".*!".+ ! %* /&!+ )6/ "30.")+/  +* "*0. &9* !" 6  % "/0!+ +),."*!&! "*0."  4  ,,) !1.*0" 0+!/ (/ )"!& &+*"/ 4 /&"),." +* 2(+."/ &*#".&+."/"*"(&*2".*!".+! +),.*!+ (+/ !&/0&*0+/ /&/0")/ !" ."#.&$". &9* *+ /" +/".2 1*+/ 2(+."/ )6/ "("2!+/ !" ( 0/#+0+/&*070& "*(+/&*2".*!".+/ +*/&/0")!"."#.&$". &9*()4+.0/!"0.*/,&. &9*/" !"0" 0 "* "( &*2".*!".+ ! 6 /&* /&/0") !" ."#.&$". &9* 4 "* "( !  +* /&/0") !" *"1(&5 &9* ( &$1( -1" "* ,".&+!+ !" "*/4+/ *0".&+. "* "( ."/0+ !" ,.6)"0.+/ "* +*0.)+/ !&#"."* &/,".+*+/&$1"*1*,0.9* (.+*++/0*0""*$"*".((+/2(+."/"*(+/&*2".*!".+/ +* ."#.&$". &9*/""* 1!.* )"'+.!"*0.+ !"(+/2(+."/9,0&)+/,."( 1(0&2++),.*!+(/!+/ )((/&*/0(!/"* !/" 0+.!"(+/&*2".*!".+/)1(0&0:*"(2")+/ +)+"*"(&*2".*!".+!/9(+ "* +*0.)+/!&#"."* &/"*( +* "*0. &9*!"6 *"(&*2".*!".+! /9(+,." "*!&#"."* &/ "*(0"),".01.!"(/1,".#& &"!"(%+'/&"*!+()4+.0"),".01.."$&/0.!( +.."/,+*!&"*0" ( /" 0+. "/0" !"( &*2".*!".+ * "( &*2".*!".+ !  "* +*0.)+/ !&#"."* &/ "* ( 0/ !" 0.*/,&. &9*40"),".01.!"(/1,".#& &"!"(%+'+0"*&7*!+/"(+/)4+."/2(+."/"*"(/" 0+. +"/0" 4 "* "( ,.6)"0.+ !" +* "*0. &9* !" 6  ."$&/0.*!+ "* "( /" 0+. "/0" (+/ 2(+."/ )6/ "("2!+/ +),.*!+ (+/ !+/ 0&,+/ !" "/0.1 01./ !" &*2".*!".+/ ,+!")+/ +/".2. 1* $.* !&#"."* & "* /& 0+!+/ (+/ ,.6)"0.+/ )"!&!+/ ,.&* &,()"*0" "/0+ /" ."#("' "* 1* 0/ #+0+/&*070&  )14 ,+. !"'+ !" (+/ 2(+."/ 9,0&)+/ "* "( &*2".*!".+ ! +.."/,+*!&"*0"  ( "/0.1 01.0&,+./,4)$!+9)&7*"3&/0"1*$.*!&#"."* &"*(0"),".01.!"(/1,".#& &" !"(%+'"/0*!+(+/2(+."/"*"(&*2".*!".+!,+."* &)!"(+/!"(&*2".*!".+)1(0&0:*"( Tabla 3: Resultados obtenidos en el periodo primavera-verano. A: tasa fotosintĂŠtica [Îźmol CO2 m-2 s-1]. Q: radiaciĂłn PAR incidente en la hoja [Îźmol m-2 s-1]. E: tasa de transpiraciĂłn [mmol H2O m-2 s-1]. T: temperatura de la superficie de la hoja [ÂşC]. CO2: concentraciĂłn de CO2 [ppm]. A Q E T CO2   



     U9-E 

 

     U9-O              U11-E              U11-O   

     ! U12-E               U12-O

   

  !    U8 "0./&$1("/&*!& *-1"*+%4!&#"."* &/"*0."0.0)&"*0+/4("0./!&/0&*0/&*!& *1*!&#"."* & "/0!8/0& )"*0"/&$*&#& 0&2

583


 







Conclusiones "*;* 5*< ,87-2,287.< .<9.,F/2,*< -. .<=. .7<*B8 78 <. 1*7 *9;.*,2*-8 -2/.;.7,2*< <2072/2,*=2?*< .7 ,>*7=8*5**,=2?2-*-/8=8<27=E=2,*-.;2?*-*-.7270I7<2<=.6*-.,526*=2C*,2H7*,=2?*>=252C*-887 ;.<9.,=8 * 5*< 6*55*< *7=227<.,=8< .?*5>*-*< 78 1*7 .A2<=2-8 -2/.;.7,2*< .<=*-F<=2,*6.7=. <2072/2,*=2?*< .7=;. .55*< 78 8+<=*7=. <. 1*7 ;.02<=;*-8 .7 0.7.;*5 ?*58;.< 6D< .5.?*-8< -. 5* =*<* /8=8<27=E=2,* .7 58< <.,=8;.< .:>29*-8< ,87 5* 6*55* =.<=208 869*;*7-8 5*< -2<=27=*< .<=;>,=>;*< .< -87-.<F<.1*78+<.;?*-80;*7-.<-2/.;.7,2*<*/*?8;-.5*.<=;>,=>;*6>5=2=I7.5/>7-*6.7=*56.7=. -.;2?*-*<-.5*+*3*;*-2*,2H727,2-.7=..75*183*B5*<*5=*<=.69.;*=>;*<;.02<=;*-*<.758<.7<*B8< ;.*52C*-8<.7.527?.;7*-.;8=29856.;F*

Agradecimientos <=.=;*+*381*<2-8/27*7,2*-898;5*>7=*-.7-*5>,F*B98;.5272<=.;28-.2.7,2*.778?*,2H7 6.-2*7=.58<9;8B.,=8<"$  B  

   ;.<9.,=2?*6.7=.

BibliografĂ­a *44.; % -*6< % 8>5*;- & *7- 87=.;8    778?*=2?. =.,1785802.< /8; *7 .//2,2.7= ><. 8/ .7.;0BItalus Hortus15,   2.=8B&*587 Fisiologia y bioquimica vegetal*-;2-7=.;*6.;2,*7*,;*@255  9 ;>7$.=*02.; (  <=>-.->778?>?.*>=B9.-*+;2 62.>A*-*9=E*>,526*= 6.-2=.;;*7..>. P.H.M 245,   2=*B* ) !4*B*6* & >;*4*62  *7- &*4.>,12 &    //.,=< 8/ !  ,87,.7=;*=287 *7- 5201= 27=.7<2=B87918=8<B7=1.<2<8/*;88=5.<<<>+6.;0.-95*7=.;*=891B55>6-.6.;<>6><.-/8;*:>*=2, /88- 9;8->,=287 27 +28;.0.7.;*=2?. 52/. <>998;= <B<=.6< Advances in Space Research 31 (7),     8;.7C8"%D7,1.C>.;;.;8.-;*78<,8+*;B*;,F* *.<=2H7-.5,526*.75* 18;=2,>5=>;*27=.7<2?*-.5<>;6.-2=.;;D7.8Horticultura.119,  8;.7C8 " %D7,1.C>.;;.;8   .-;*78  <,8+*;  B *;,F*    + ?*5>*,2H7 -. 5* 27,8;98;*,2H7-.<2<=.6*<-.,*5./*,,2H7.75*18;=2,>5=>;*27=.7<2?*+*38,>+2.;=*-.95D<=2,8.7.5<>; 6.-2=.;;D7.8 ,=*< -. 8;=2,>5=>;* '85   870;.<8 +.;8*6.;2,*78 B  870;.<8 +E;2,8 -. 2.7,2*<8;=F,85*<50*;+.I,    8;.7C8"*;8=8B*<=255*   ! 2795*<=2,0;..718><.2756.;F*%9*27 Acta Hort268    87=.;8*<=255* >=2E;;.C-.$*?E*7-;.=87.<  526*=.>7-.;95*<=2,27=1.56.;F* *;.*Acta Hort170,

  #>.;8   *;*GH7 & B '255*; $    &*<*< -. /8=8<F7=.<2< .7 95D7=>5*< -. *5,8;78:>. B ;8+5. .7 -2<=27=8<62,;8<2=28<-.7=;8-.5<8=8+8<:>.Almoraima.31,    %*7=2*08  .7-8C*  B 8;;.08    ?*5>*,2H7 -.5 =86*=. Lycopersicon esculentum  .7 27?.;7*-.;8,;2=.;28</.785H02,8<B/2<285H02,8<AgronomĂ­a Mesoamericana.9(1)   %12<12-8);*2>6*,>;*)>7*7-%.B*6*  //.,=<8/-.?.5896.7=*5<=*0.<*7- =89927087918=8<B7=1.<2<=;*7<58,*=287*7--2<=;2+>=2878/ *<<2625*=.<27=86*=8Bull. Nat. Res. Inst. Vegetables, Ornamental Plants and Tea1,   '*5.;*   ".G*  8527*   L5?*;.C  H9.C   B *->.G8     *;*,=.;2C*,2H7 0.86E=;2,* B 6.,D72,* -. -2/.;.7=.< =298< -. *0;8=.A=25.< >=252C*-8< .7 27?.;7*-.;8< 2Âş Congreso Nacional de AgroingenierĂ­aI,   )27 ( *;+27<87  *7- %=>24 "    *=1.6*=2,*5 ;.?2.@ 8/ 52=.;*=>;. =8 *<<.<< =.;7*=2?. .5.,=;87 =;*7<98;=<*7-27=.;918=8<B<=.6.A,2=*=2879*;=2=287270/<=.*-B<=*=. 918=8<B7=1.<2<>7-.;5262=270 5201= Plant Cell and Environment 29  K   @2=1 ,8;;20.7->6 27 Plant, Cell and Environment





584


Comportamento Hídrico de um Argissolo sob Sistemas Agroflorestais no Extremo Sul do Estado de São Paulo, Brasil R. B. Silva1, C.C. Lima2, F. A. M. Silva1, R. Nakamura3, P. Iori1 1

Professor, Universidade Estadual Paulista, Campus Experimental de Registro, Rua Nelson Brihi Badur nº 430, CEP: 11900-000, Registro – SP. E.mail: rbsilva@registro.unesp.br, 2 Estudante do Curso de Agronomia , Universidade Estadual Paulista, Campus de Registro, Rua Nelson Brihi Badur nº 430, CEP: 11900-000, Registro – SP., 3 Engenheiro Agrônomo, Mestre, Departamento de Ciência do Solo, Universidade Estadual Paulista, CEP: 18310-307, Botucatu – SP.

Resumo A caracterização ou quantificação da retenção de água do solo, que representa a relação entre o teor de água e a energia com a qual ela está retida é essencial no estudo das relações solo-água, e a exemplo do que tem sido feito para solos de áreas agrícolas, também pode ser aplicadas para solos sob sistemas agroflorestais. O objetivo do presente trabalho foi avaliar o impacto dos sistemas agroflorestais (SAF’s) em diferentes estágios sucessionais de desenvolvimento sobre o comportamento hídrico de um Argissolo Vermelho Amarelo, através das curvas de retenção de água (CRA), capacidade de campo (CC), ponto de murcha permanente (PMP) e capacidade de água disponível do solo (CAD). O trabalho foi realizado no extremo sul do estado de São Paulo, no município de Cananéia/SP, Brasil. SAF`s em três estágios sucessionais foram avaliados: 1) SAF de 12 anos; 2) SAF de 2,5 anos e 3) SAF de 1 ano. Uma área de mata nativa foi tomada como área controle. Os ensaios foram conduzidos em amostras de duas camadas do solo (0–0,20 m e 0,20-0,40 m). O tempo de utilização dos sistemas agroflorestais alterou o comportamento hídrico do solo em relação à mata nativa, utilizada como referência. Os sistemas agroflorestais com maior tempo de uso apresentaram maior retenção e disponibilidade de água nas camadas superficiais. Os resultados evidenciam que os sistemas agroflorestais podem ser, quando devidamente manejados, uma alternativa viável na melhoraria da retenção de água no solo. Palavras chave: manejo sustentável, água, conservação do solo.

Behavior of a water Ferrasol under agroforestry systems in extreme south of the state of São Paulo, Brazil Abstract The characterization and quantification of the soil water retention, representing the relationship between the water content and energy that takes place is essential to study the relationships between the soil and the water, as made for farmland soil, can also be applied to soils under agroforestry. The aim of this study was to evaluate the impact of agroforestry (SAF) in different stages of succession in the behavioral development of Alfissol water through water retention curves (CRA), field capacity (CC) , wilting point (PMP) and water holding capacity of the soil (CAD). The study was conducted in the southern state of São Paulo, in the municipality of Cananea / SP, Brazil. SAF `s in three stages of succession were evaluated: 1) SAF 12 years, 2) SAF 2.5 years and 3) SAF 1 year. A native forest area was taken as control. The tests were conducted on samples of two layers of the earth (0 to 0.20 m and 0.20-0.40 m). The usage time of agroforestry changed the soil water behavior in relation to native forests, which is used as a reference. Agroforestry already shown using a larger amount of water retention and water available in the surface layers. The results show that agroforestry systems can be, when properly managed, a viable alternative would be to improve water retention in the soil. Keywords: sustanable management, wáter, soil conservation.

Introdução O Vale do Ribeira, localizado no extremo sul do Estado de São Paulo é considerado patrimônio natural, socioambiental e cultural da humanidade por tratar-se da maior área contínua de Mata Atlântica do Brasil, estendendo-se ao longo de 2,8 milhões de hectares (Unesco, 1999). Devido à importância deste bioma, o uso ou manejo do solo devem estar em consonância com a conservação da

585


sua biodiversidade. Neste contexto, os Sistemas Agroflorestais (SAF’s) apresentam inúmeras vantagens que contribuem para o estabelecimento de modelos de produção mais estáveis e que podem amenizar as adversidades encontradas pela agropecuária, pois, buscam maior equilíbrio do ecossistema a partir do aumento da diversidade de espécies cultivadas, em que culturas tradicionais (anuais e perenes) são consorciadas com componentes arbóreos e/ou animais, havendo um melhor aproveitamento dos componentes do agroecossistema, no tempo e no espaço (Nair, 1993). A compreensão e a quantificação do impacto do uso e manejo do solo na sua qualidade física e hídrica são fundamentais no desenvolvimento de sistemas agrícolas sustentáveis (Dexter e Youngs, 1992). Apesar da qualidade química e física do solo ser tema frequente em vários estudos, ainda faltam informações técnico-científicas a respeito do comportamento hídrico do solo e sua relação com atributos físicos em áreas manejadas com SAF’s, e este fato tem dificultado o reconhecimento e consolidação dos benefícios deste sistema no meio acadêmico. Segundo Godefroy & Jacquin, (1975) a introdução de sistemas agrícolas em substituição às florestas causa um desequilíbrio no ecossistema, modificando as propriedades do solo, cuja intensidade varia com as condições de clima, uso e manejos adotados e a natureza do solo. A qualidade do solo para o crescimento das plantas é determinada não só pela disponibilidade de água, aeração e temperatura do solo, mas também pela deterioração das suas propriedades físicas que diretamente estarão relacionadas à capacidade de retenção e disponibilidade de água. Objetivou-se com o presente trabalho avaliar o impacto dos SAF’s em diferentes estágios sucessionais de desenvolvimento sobre o comportamento hídrico de um Argissolo Vermelho Amarelo através das curvas de retenção de água, capacidade de campo, ponto de murcha permanente e capacidade de água disponível do solo. .

Material e Métodos O trabalho foi realizado no município de Cananéia, localizado na região do Vale do Ribeira – São Paulo – Brazil. O clima da região é classificado como Tropical Chuvoso (Af) segundo a classificação de KOPPEN (Rolim, et al., 2007), com precipitação pluvial média anual de 1.700 mm. As áreas em estudo estão sobre um Argissolo Vermelho-Amarelo distrófico (Embrapa, 2006), de classe textural franco-arenoso, cuja caracterização físico-química está apresentada na Tabela 1. O experimento foi conduzido em áreas cujo histórico de uso/manejo são descritos a seguir: a) Sistema de Agroflorestamento implantado há doze anos: ocupa uma área de 2 ha, cujas coordenadas geográficas são 24° 54’ 16” Sul e 48° 00’ 21” Norte e altitude média de 31m. Nesta área pratica-se o plantio de amora preta, capim napier, seguido de frutíferas como banana, citrus, café, cajá, manga, espécies de regeneração espontânea e espécies florestais manejadas; b) Sistema de Agroflorestamento implantado há 2,5 anos: era uma pastagem degradada seguida de regeneração natural por cinco anos, cujas coordenadas geográficas são 24° 54’ 22” Sul e 48° 00’ 25” Norte e altitude média de 49 m. Com a implantação do SAF efetuou-se o plantio de mandioca, mucuna preta seguida de pupunha, maracujá, banana, graviola e citrus; c) Sistema de Agroflorestamento em estágio de implantação, com aproximadamente um ano: ocupa uma área de 1,5 ha, cujas coordenadas geográficas são 24° 54’ 19’’ Sul e 48° 00’ 23’’ Norte e altitude média de 21m. Nesta área realizava-se o manejo de braquiária e sapé no sistema de corte e queima. Atualmente está sendo implantado o sistema de agroflorestamento com o plantio de leguminosas como guandu, feijão de porco e crotalária seguido de pupunha, cana, banana da terra, banana pão e nanica; d) Mata Nativa: cujas coordenadas geográficas são 24° 54’ 24” Sul e 48° 00’ 23” Norte e altitude média de 99 m. A capacidade de água disponível (CAD) foi determinada pela diferença do conteúdo de água referente aos potenciais matricial da capacidade de campo (CC = 10 kPa) e o ponto de murcha permanente (PMP = 1500 kPa) de acordo com Ritchie (1981) e Silva et al. (1994) e, através destes foram plotadas

586


as curvas de retenção de água do solo utlizando o sofware SigmaPlot, ajustadas ao modelo de van Genutchen (1980). O experimento foi conduzido em esquema fatorial 4 x 2 (4 usos e 2 camadas), totalizando 8 condições. A amostragem de solo foi feita nas camadas de 0 - 0,20 m e 0,20 - 0,40 m, com três repetições, contabilizando24 unidades experimentais. A análise de variância foi realizada aplicando-se o teste F (P < 0,05), sendo as médias submetidas ao teste de Tuckey. Para realização de análises estatísticas foi utilizado o software SISVAR (Ferreira, 2000).

Resultados e Discussão Na Tabela 1 são apresentados os valores médios para granulometria, índice de floculação, matéria orgânica e teor de água atual em um Argissolo Vermelho-Amarelo distrófico. Foram observadas classes texturais semelhantes para os uso/manejos do solo. Os valores de índice de floculação apresentaram comportamento semelhante aos teores de matéria orgânica do solo. Tabela 1. Distribuição granulométrica (g kg-1), índice de floculação (%), matéria orgânica (g kg-1) e teor de água (m m-3) de um Argissolo Vermelho-Amarelo distrófico. Areia IF(1) Camada de 0 – 0,20 m

MO(2)

Ua(3)

15,75

30,5

530

51,45

39,6

0,218 0,240

448

346

39,27

36,4

0,289

194

297

509

49,00

37,8

0,149

Média

170

363

30,08

0,224

SAF 12 anos

179

467 38,87 Camada de 0,20 – 0,40 m 437 384 20,82

21,7

0,204

SAF 2,5 anos SAF 1 ano

171 226

340 406

489 368

48,90 43,72

23,5 21,7

Mata Nativa

216

284

500

37,34

29,8

0,226 0,354 0,124

198

367

435

37,69

24,18

0,227

Uso/Manejo

Argila

Silte

SAF 12 anos

133

385

482

SAF 2,5 anos

147

323

SAF 1 ano

206

Mata Nativa

Média (1) Índice de Floculação;

(2)

Matéria Orgânica;

(3)

Teor de água atual.

São apresentadas na figura 1 as curvas de retenção de água dos diversos usos estudados para duas camadas do solo. É possível observar para a camada superficial que as maiores retenções de água no solo foram encontradas para os SAF’s com 1 e 12 anos (Figura 1A). Em maiores potenciais matriciais as maiores retenções de água foram obtidas no SAF de 12 anos, por outro lado, em menores potenciais matriciais as maiores retenções foram encontradas no SAF com 1 ano. Já para a camada mais profunda (Figura 1B) as maiores retenções foram obtidas para SAF com 2,5 anos, seguidos pelo SAF de 1 ano. O resultado referente à capacidade de campo dos usos avaliados neste estudo pode ser observado na figura 2. Nota-se que na camada de 0-0,20 m o SAF de 1 ano apresentou maiores teores de água na capacidade de campo, diferindo do SAF de 12 anos, SAF de 2,5 anos e Mata Nativa, sendo que, estes dois últimos foram estatisticamente semelhantes. Na camada de 0,20-0,40 m o SAF de 2,5 apresentou os maiores conteúdos de água na capacidade de campo, diferindo do SAF de 1 ano, SAF de 12 anos e Mata Nativa. O SAF de 12 anos e a Mata Nativa utilizada como área controle foram semelhantes entre si e foram os usos do solo que apresentaram os menores conteúdos de água na capacidade de campo. A umidade do solo na capacidade de campo é mais relacionada à estrutura do solo (Or & Wraith, 1997; Silva et al., 2012), sendo assim, um uso do solo que recentemente foi manejado para o inicio da atividade agroflorestal, como é caso do SAF de 1 e 2,5 anos, apresentaram sua estrutura pouco alterada devido ao uso agroflorestal, promovendo maior retenção de água na capacidade de campo.

587


Avaliando cada uso do solo e comparando as camadas estudadas (Figura 2B), verifica-se que houve diferenças estatísticas entre as camadas, para os todos os SAF’s avaliados. A única exceção, quanto uso do solo, foi com relação a mata nativa, cuja as camadas, superficial e subsuperficial, se comportaram de maneira semelhante. Isto ocorreu devido à mata nativa se tratar de um sistema “não pertubado”, o qual não sofreu alterações nas suas propriedades físico-mecânicas, por se tratar de um ambientel em estado de equilíbrio. Iori et al. (2010) estudando propriedades físico-mecânicas em um Cambissolo no Vale do Ribeira, também verificaram que a mata nativa apresenta poucas alterações nas propriedades físico-mecânicas em relação ao uso agrícola do solo.  0,3 SAF 12 anos SAF 2,5 anos SAF 1 ano Mata Nativa

0,2

0,1

Umidade (kg/kg)

Umidade (kg/kg)

0,3

SAF 12 anos SAF 2,5 anos SAF 1 ano Mata Nativa

0,2

0,1

A

B 0,0

0,0 1

10

100

1000

1

10000

10

100

1000

10000

m (kPa)

m (kPa)

Figura 1. Curvas de retenção de água do solo sob distintos Sistemas Agroflorestais e Mata Nativa ajustadas ao modelo de van Genutchen (1980). A – Camada de 0 – 0,20 m e B – Camada de 0,20 – 0,40 m. 0,25

a

a

b

A

c

A

0,20 c

Mata Nativa SAF 12 anos SAF 2,5 anos SAF 1 ano

0,10

A -1

c

CC, Kg Kg

-1

CC, Kg Kg

A

B

c

0,15

0,25

b

0,20

A

B

0,15

B

0 - 0,20 m 0,20 - 0,40 m 0,10

0,05

A

0,05

B

0,00 0 - 0,20

0,20 - 0,40

Profundidade, m

0,00 Mata Nativa

SAF 12 anos

SAF 2,5 anos

SAF 1 ano

Figura 2. Valores médios de capacidade de campo (CC) para as camadas de solo de 0 – 0,20 m e de 0,20 – 0,40 m para os diversos SAF’s estudados e para a Mata Nativa. (A) – Letra minúscula compara usos/manejo do solo para uma mesma camada de solo. (B) – Letra maiúscula compara camadas de solo para um mesmo uso/manejo do solo, pelo teste Tukey (P<0,05). Para SAF’s de 1 e 12 anos, as camadas superficiais apresentaram maiores retenções de água em relação às camadas subsuperficiais na capacidade de campo. Para o SAF de 2,5 anos o comportamento observado foi o oposto aos outros SAF’s, ou seja, a camada subsuperficial apresentou maior retenção de água na capacidade de campo em relação à camada superficial. Avaliando a influência dos diversos usos do solo no ponto de murcha permanente (PMP) para cada camada do solo (Figura 3A), observa-se que todos os usos foram estaticamente diferentes entre si nas duas camadas analisadas. Porém, a ordem de retenção de água para a camada superficial foi de: SAF de 1 ano, SAF de 2,5 anos, mata nativa e SAF de 12 anos; enquanto para a camada mais profunda a ordem de retenção foi de: SAF de 1 ano, mata nativa, SAF de 2,5 anos e SAF de 12 anos. Para valor de potencial matricial mais elevado, como o ponto de murcha permanente (1500 kPa), a retenção de água está mais relacionada à superfície específica do solo (Jury et al., 1991; Silva et al., 2010). Sendo

588


assim, a textura do solo foi uma característica que afetou de maneira direta na retenção de água para o SAF com 1 ano no ponto de murcha permanente, pois estas áreas apresentaram as maiores retenções de água em relação as demais áreas, devido provavelmente a maior quantidade de partículas de argila (Tabela 1). Avaliando cada uso do solo estudado dentro de cada camada do solo (Figura 3B), observa-se que houve diferença entre as camadas (0-0,20 e 0,20-0,40 m) para o SAF de 2,5 anos e o SAF de 1 ano. Já para mata nativa e para o SAF de 12 anos, as camadas se comportaram de maneira homogênea, ou seja, não houve diferenças significativas entre camadas para estes usos do solo. A mata nativa se encontra num estado de equilíbrio natural, por isso a semelhança entre camadas, e desta maneira é possível destacar que as áreas com SAF de 12 anos estão se aproximando deste mesmo equilíbrio. 0,18 a

0,18

0,16

A

0,16

0,14

a B

c c

b

0,12

Mata Nativa SAF 12 anos SAF 2,5 anos SAF 1 ano

0,10 d

d

0,08 0,06

-1

b

PMP, Kg Kg

PMP, Kg Kg-1

0,14

0,12

A A

A

B

0,10 A

A

0 - 0,20 m 0,20 - 0,40 m

0,08 0,06

0,04 0,04

A

0,02

B

0,02

0,00 0 - 0,20

0,20 - 0,40

Profundidade, m

0,00 Mata Nativa

SAF 12 anos

SAF 2,5 anos

SAF 1 ano

Figura 3. Valores médios para o ponto de murcha permanente (PMP) para as camadas de solo de 0 – 0,20 m e de 0,20 – 0,40 m para os diversos SAF’s estudados e para a Mata Nativa. (A) – Letra minúscula compara usos/manejo do solo para uma mesma camada de solo. (B) – Letra maiúscula compara camadas de solo para um mesmo uso/manejo do solo, pelo teste Tukey (P<0,05). A capacidade de água disponível (CAD) é importante para o desenvolvimento das plantas, por proporcionar influencias nas reações químicas do solo, no movimento e absorção de nutrientes e, consequentemente, afetando a produção das diversas culturas. Na Figura 4 é apresentada a CAD nos diversos usos estudados. Na camada superficial do solo (Figura 4A) observa-se que apenas a mata nativa e o SAF de 2,5 anos foram semelhantes entre si, sendo que estes foram os usos do solo que apresentaram a menor quantidade de água disponível. Nesta camada as maiores quantidade de água disponível foram encontradas para os SAF com 12 anos seguido pelo SAF de 1 ano. Já na camada subsuperficial (Figura 4B), todos os usos do solo foram estatisticamente diferentes entre si. A maior capacidade de disponibilização de água às espécies foi apresentada pelo SAF de 2,5 anos, seguido do SAF de 1 ano, SAF de 12 anos e, mata nativa, com a menor capacidade de água disponível. Comparando as duas camadas estudadas para cada uso do solo (Figura 4B), nota-se semelhança somente para a mata nativa. Entretanto, para os SAF’s verificou-se resultado de CAD estatisticamente diferente entre camadas. A maior CAD no SAF de 12 anos ocorreu na camada superficial do solo. Por outro lado, para os SAF’s de 1 e 2,5 anos os maiores valores de CAD foi observado nas camadas mais profundas, ou seja, em subsuperfície. No SAF’s mais novos (1 e 2,5 anos) a perda de água do solo se deu principalmente pela evaporação, pois por estarem num estagio menos avançado (em tempo de estabelecimento) do que SAF’s mais velhos (12 anos) promove menor disposição de material orgânico sobre o solo, apresentando, consequentemente, menores quantidade de água disponível na camada superficial. Por outro lado, as áreas com SAF de 12 anos apresentou uma maior quantidade de material orgânico não decomposto sobre o solo (serrapilheira) em decorrência das maiores quantidade de podas e quedas das folhas das plantas consorciadas, sendo que esse material orgânico não decomposto sobre a superfície do solo, aliado às plantas do consórcio agroflorestal, atuou protegendo-o contra a incidência direta dos raios solares e dos ventos, que são importantes fatores na perda de água por evaporação.

589


0,14 0,14

a

0,12

a

A

0,12

A

b

0,06 c

c

Mata Nativa SAF 12 anos SAF 2,5 anos SAF 1 ano

c d

0,04

0,10 A

-1

b

0,08

CAD, Kg Kg

CAD, Kg Kg

-1

0,10

0,08

B B

0,06

0 - 0,20 m 0,20- 0,40 m

A B

A

0,04

0,02

A

0,02

B

0,00 0 - 0,20

0,20 - 0,40

Profundidade, m

0,00 Mata Nativa

SAF 12 anos

SAF 2,5 anos

SAF 1 ano

Figura 4. Valores médios de capacidade de água disponível (CAD) para as camadas de solo de 0 – 0,20 m e de 0,20 – 0,40 m para os diversos SAF’s estudados e para a mata nativa. (B) – Letra maiúscula compara camadas de solo para um mesmo uso/manejo do solo, pelo teste Tukey (P<0,05).

Conclusões O tempo de utilização e estabelecimento dos sistemas agroflorestais alteraram o comportamento hídrico do solo em relação à mata nativa, utilizada como referência. Os sistemas agroflorestais com maior tempo de uso apresentaram maior retenção e disponibilidade de água nas camadas superficiais do Argissolo. Os resultados evidenciam que os sistemas agroflorestais podem ser, quando devidamente manejados, uma alternativa viável na melhoraria da retenção e armazenamento de água no solo.

Bibliografía Dexter, A.R., Youngs, I.M. (1992). Soil physic toward 2000. Soil Till. Res., 24, 101-106. Embrapa – Empresa brasileira de pesquisas agropecuárias (2006). Centro Nacional de Pesquisa de Solos. Sistema Brasileiro de Classificação de Solos, 2, 306. Ferreira, D. F. (2000). Manual do sistema Sisvar para análises estatísticas. Lavras, Universidade Federal de Lavras, 66. Genuchten, M.T. (1980). A closed-form equation for predicting the hydraulic conductivity of unsaturated soils. Soil Science Society of America Journal, 44, 892-898. Godefroy, J. Jacquin, F. (1975). Relation entre la stabilité structurale des sols cultivés et le apports organiques en conditions tropicales;comparasion avec les sols forestiers. Fruits, 30, 595-612. Iori, P.; Silva, R. B.; Dias Júnior, M. S.; Lima, J. M. (2012). Pressão de preconsolidação como ferramenta de análise da sustentabilidade estrutural de Cambissolo Háplico, Argissolo Amarelo e Gleissolo Háplico em Registro, SP. Revista Brasileira de Ciência do Solo, 36, 1448-1456. Jury, W. A.; Gardner, W. R.; Gardner, W. H. (1991). Soil physics. New York: J. Wiley, 1991. 328 p. Nair, P.K.R. (1993). An introduction to agroforestry. Dordrecht: Kluwer, 499. Or, D.; Wraith, J. M. (1997). Agricultural and environmental soil physics. Logan: USD, 218 p. Richards, L.A. (1965). Physical conditions of water in soil. In: Black, C.A., Evans, D.D., White, J.L., Ensminger, L.E., Clark, F.E., (Ed.). Methods of soil analysis: physical and mineralogical properties, including statistics of measurements and sampling. Madison: American Society of Agronomy, 128-152. Rolim, G.S.; Camargo, M.B.P.; Lania, D.G.; Moraes, J.F.L. (2007). Classificação Climática de Köppen e de Thornthwaite e sua aplicabilidade na determinação de Zonas Agroclimáticas para o Estado de São Paulo. Bragantia, 66, 711-720. Silva, A. P., Kay, B. D., Perfect, E. (1994). Characterization of the least limiting water range. Soil Sci. Soc. Am. J., 58, 1775-1781. Silva, R. B.; Iori, P.; Dias Junior, M. S.; Martins, P. A. (2010). Degradação estrutural do solo de em áreas de preservação permanente da Subbacia Rio Ribeira de Iguape. In: Silva, R. B.; Ming, L. C. Relatos de pesquisas e outras experiências vividas no vale do ribeira. Jaboticabal: Maria de Lourdes Brandel – ME.

590


EL CONFORT DE LOS OVINOS AL COMER EN LAS UNIDADES DE PRODUCCIÓN Manuel Galicia Reyes1, Abraham Rojano Aguilar1 1

Profesor-investigador, Universidad Autónoma Chapingo Carretera. México -Texcoco Km 37,5. Chapingo, México, CP 56230 galrey01@gmail.com, galrey02@yahoo.com.mx Resumen Brindar las condiciones ambientales, físicas y sociales, que proporcionan confort a los animales en las unidades de producción, implica tener alojamientos y equipos pecuarios que permitan expresar sus comportamientos naturales convenientes. Los comederos para corderos deben permitir fácil acceso y respeto por su movimiento natural. Actualmente los comederos para ovinos existentes comercialmente priorizan el manejo y minimizan el confort animal. Mediante videos laterales y frontales de ovinos adultos en plena libertad al momento de ingerir sus alimentos, se generan trayectorias secuenciales que sigue su cabeza en el proceso de alimentación. Se analizan las trayectorias para definir espacios disponibles en el área de alimentación, identificar zonas críticas y generar geometrías ideales de comederos. Se ofrece comida a los corderos a diferentes alturas para determinar la altura a la que prefieren comer. Se confronta la información generada con los comederos existentes comercialmente, se generan alternativas de solución y se dimensiona un comedero que permite expresar a los ovinos los movimientos naturales que le propician confort en su alimentación. El comedero tiene un receptáculo trapezoidal que facilita la concentración del alimento en un punto, delimita el área individual de acceso para cada animal, ayuda a disminuir disputas hegemónicas características de las manadas, evita que los animales se metan al comedero, ensucien y desperdicien alimento. La base mayor del trapecio es definida por el movimiento y alcance frontal de la cabeza. Las características geométricas y dimensiones del comedero muestran como los barandales perimetrales en las zonas de alimentación no son necesarios. Los parámetros de diseño que satisfacen las características dimensionales del comedero funcional y versátil son: Adaptación a diferentes tallas de animal, generación de confort al comer, ayudar a disminuir las disputas hegemónicas de los animales cuando se alimentan y fácil fabricación, resistente y durable. Palabras clave: Diseño, Comedero, ovino, Confort

The comfort of sheep to eat in production units Abstract Provide environmental conditions, physical and social, that provide comfort to the animals in the production units, involves having livestock facilities and equipment that allow animals to express their natural behaviors appropriate. The Appropriately designed animal feeders should allow easy access and respect for their natural movement. Currently the existing sheep feeders commercially prioritized handling and minimize animal comfort. With side and front video adult sheep at full liberty at the time of eating their food, sequential paths are generated following his head in the feeding process. Trajectories are analyzed to determine the available space in the feeding area, identify critical areas and generate feeder ideals geometries. Food is offered the lambs at different heights to determine the height at which they prefer to eat. When designing a trough, is confronted with information generated commercially existing feeders, alternative solutions are generated and dimensioning a feeder that allows sheep to express natural movements that propitiate comfort food. The feeder has a trapezoidal enclosure facilitates concentration of food at one point, defines the individual area for each animal access and helps reduce disputes hegemonic characteristics of animals in herds, prevents animals from getting to the feeder, dirty and wasted food. The larger base of the trapezoid is defined by movement and front reach of the animal's head. The geometric features and dimensions of the feeder as shown in the perimeter rails feeding areas are not needed. The design parameters that satisfy the dimensional characteristics of a feeder functional and versatile: Adapting to different sizes of animal, eat comfort generation, help reduce disputes hegemonic of animals in herds when feeding and easy to manufacture, tough and durable.

591


Keywords: Design, Feeding, Comfort, sheep. Introducción Brindar las condiciones ambientales, físicas y sociales, que proporcionan confort a los animales en las unidades de producción, implica tener alojamientos y equipos pecuarios que permitan expresar a los animales sus comportamientos naturales convenientes, facilitar la satisfacción de sus necesidades primarias e inducir actitudes afectivas positivas (Echevarría, A. 2002). Actualmente se define al bienestar animal en términos de su funcionamiento biológico, en la medida en la que la conducta natural de la especie se puede expresar, y en términos de las emociones que experimentan los animales (Inma E., Inger-Lise A., Eric N. 2007). Para evaluar el bienestar animal en las unidades de producción diversas normas y protocolos se han desarrollado (Welfare Quality. 2009). En particular la ausencia de hambre se evalúa con el registro de una condición corporal, la cual, es resultado de muchas situaciones cotidianas en la vida del animal y del mismo proceso de producción. Algunas normas registran aspectos de distribución, número y capacidad de comederos y ninguna analiza el confort de los animales al momento de consumir sus alimentos. A medida que el bienestar animal continúa convirtiéndose en una exigencia global, la ingeniería pecuaria se potencializa, y exige que los desarrollos tecnológicos de equipos e instalaciones incorporen en sus parámetros de diseño el concepto de confort animal (Marek Š. 2006). En el diseño de un alojamiento pecuario se debe cuidar el número, posición dentro del alojamiento (nunca en esquinas) y capacidad de los comederos. Sin embargo, estos tres parámetros no son suficientes para determinar si los animales toman sus alimentos con cierto grado de confort. Algunos de los parámetros que se contemplan en el proceso de diseño y que ayudan a motivar una actitud de consumo son: Las dimensiones y geometría de un comedero que se determinan mediante el análisis del movimiento natural del cuerpo del animal y en particular el movimiento de la cabeza al momento de acceder a sus alimentos. La profundidad de los comederos función de la talla del animal y la altura a la que prefieren comer. Respeto por el espacio de intolerancia de los animales, es decir, el espacio longitudinal que necesita un animal para sentirse cómodo y evitar o disminuir la disputa por el alimento depositado en los comederos. Pisos que proporcionen firmeza, secos y con pendiente no mayor a 5%, parámetro que sirve para hacer sentir al animal seguro en el espacio que ocupa al comer (Galicia, R, M. 2012). El presente estudio analiza el movimiento natural que sigue la cabeza de los ovinos en plena libertad al momento de alimentarse e identifica la disponibilidad de espacios en su zona de alimentación, como argumento para establecer los parámetros necesarios en la implementación de la metodología de diseño de un comedero de ovinos en engorde, que les genere confort al momento de alimentarse. Material y Métodos Para entender los movimientos corporales que realizan los ovinos cuando en libertad ingieren sus alimentos, a diez corderos en engorde intensiva, se les ofrece alimento en lugares y condiciones que generen libertad y no limiten sus movimientos naturales al momento de ingerir sus alimentos. Los corderos seleccionados con masa de 23 a 40 kg y estatura de 0.25 a 0.48 m, caracterizan al animal desde que inicia y hasta que termina el proceso de engorde. Se acerca individualmente cada animal a la zona de prueba y se le induce a comer su alimento. El alimento utilizado es concentrado con alto contenido de fibra y no es variable del trabajo de investigación. Con una cámara convencional Sony Cybershot Dsc P 41, 4.1 Mega pixeles, se toman videos laterales y frontales del movimiento del cuerpo de cada cordero. Una persona opera la cámara y otra trabaja con los animales, las dos se mantienen a 5 m de la zona de prueba. Referencias físicas, tales como, reglas graduadas a cada 0.1 m, muros y mallas metálicas, se colocan a una distancia de entre 0.5 a 1 m del animal. Al momento de analizar el material, estas referencias indican si el foco de la cámara está posicionado correctamente y entonces si la calidad del material es aceptable. El foco de la cámara, debe estar perpendicular al cuerpo del animal en los videos laterales y colineal en los videos frontales. Con los videos editados y fragmentados secuencialmente en periodos de tiempo de 0.2 s. se generan imágenes, que insertadas en el software AUTOCAD2013 y con el comando poli línea, generan contornos de los corderos a escala real. Al sobre ponerlos ilustran la trayectorias que discretizan el movimiento de la cabeza de los

592


corderos y definen espacios disponibles. Analizar el desplazamiento de la cabeza permite identificar cualitativamente y cuantitativamente, ángulos de inclinación de superficies, radios de giro, zonas de restricción, profundidad de comedero y posición de alcance máximo, conceptos que definen la geometría de la sección transversal del comedero y por consecuencia los parámetros de diseño que se deben cumplir. Posteriormente una investigación exhaustiva de los comederos existentes comercialmente permitió conocer y entender los principios de solución utilizados en los comederos convencionales, tendencias e incluso principios que han probado no viabilidad. Finalmente se confronta la información recopilada y generada como estrategia para definir los parámetros de diseño y generar los principios de solución. La evaluación de alternativas de solución, diseño de materialización y detalle, se acompañó de argumentos relacionados con el animal y constructivos, que juntos generaron un diseño funcional y versátil, de fácil construcción, durable, resistente y mantenimiento mínimo. Para conceptualizar mejor el comportamiento de los ovinos y determinar la altura a la que prefieren comer los ovinos, se ofreció a 30 corderos comida. A nivel de piso, 0.05, 0.1 y 0.15 metros, Los animales caracterizan las tallas corporales de corderos en la etapa de engorde. Resultados Un comedero para ovinos debe permitir adquirir su equilibrio corporal. La figura 1a, muestra la posición desfasada que asumen las extremidades delanteras de los corderos para lograrlo. El espacio esencial que necesita el animal para comer se define por: La posición inclinada de una de las extremidades delanteras, el espacio entre el hocico y la extremidad delantera, la inclinación natural del hocico a la altura que prefieren comer y la tendencia lineal que sigue la trayectoria vertical de la cabeza al moverla (ver figura 1b).

A B C Figura 1. Movimiento natural de ovinos al ingerir su alimento.

D

La figura 1c, muestra la sección transversal de un comedero para ovinos debe contener las siguientes zonas: Superficie A, forma parte de la tolva del comedero y tiene pendiente mínima igual al ángulo de reposo del alimento. Superficie B, concentra el alimento en la parte baja del comedero, define el máximo alcance del animal, su pendiente es función de la inclinación del hocico del animal cuando come a la altura óptima. Superficie C, define la profundidad y capacidad del comedero, cuyas dimensiones dependen del hocico del animal. Superficie D, concentra el alimento en la parte baja, con pendiente mayor a la superficie A y limita el movimiento frontal. Superficie E, limita el movimiento frontal, es parte de la tolva y sustituye a los barandales perimetrales en la zona de alimentación. Para concentrar el alimento, el comedero longitudinalmente es dividido en receptáculos trapezoidales, cuya base mayor es el alcance lateral de la cabeza. La distancia que hay desde la superficie A hasta la superficie E, permite el flujo de alimento, de ser necesario debe existir un sistema de regulación. El flujo apropiado de alimento en esta zona evita desperdicios y elimina la necesidad del cordero por moverse para alcanzar su alimento (ver figura 1c). Finalmente aunque la altura a la que prefieren comer los corderos es función de la altura del animal se mantiene en un rango de 0.8 a 0.12 m (ver figura 1d).

593


Los parámetros de diseño que satisfacen las características dimensionales de un comedero para corderos funcional y versátil son: Adaptación a diferentes tallas de animal, generación de confort al comer, ayudar a disminuir las disputas hegemónicas características de animales en manada, cuando se alimentan y ser de fácil fabricación, resistente y durable (ver figura 2a). El análisis del movimiento que sigue la cabeza de corderos cuando se alimentan, define la trayectoria ideal de la geometría del comedero (ver figura 2b). Las tallas de los animales caracterizan el inicio y final de la engorde (ver figura 2c). Generar confort a los corderos al comer implica acercar el alimento al hocico del animal para disminuir su movimiento al tratar de alcanzar su comida y permitirle asumir una posición de equilibrio corporal. Para disminuir problemas de hegemonías y dominancias sociales en la manada, el comedero tiene divisores que definen el espacio longitudinal que le corresponde a cada cordero. Además se recomiendan pendientes del 5 a 10 % en los pisos de la zona de alimentación, para obligarlo, en su arribó al comedero, a entrar de frente y disminuir su movimiento longitudinal. Construcción sencilla, sin partes móviles y mantenimiento prácticamente es nulo.

a

B

C

Figura 2. Comedero para ovinos en engorde. La superficie inclinada del comedero que ocupa el espacio entre el hocico y la extremidad delantera del cordero, es un sensor para el animal que le indica el máximo acercamiento que puede tener, concentra el alimento para evitar el movimiento del animal y disminuye el desperdicio de alimento (ver figura 2c). El divisor asigna el espacio longitudinal por cordero, evita que el animal se meta al receptáculo y ayuda a disminuir actitudes hegemónicas. El divisor, la pared vertical de la tolva, la inclinación de las superficies y la relación dimensional de los componentes del comedero hacen innecesaria la instalación de barandales perimetrales en el área de alimentación (ver figura 2). CONCLUSIONES 1. Actualmente los comederos comerciales existentes priorizan el manejo animal, minimizan el confort y no motivan el comportamiento natural de los ovinos. 2. El bienestar animal continúa convirtiéndose en una exigencia global, la ingeniería pecuaria se potencializa y los desarrollos tecnológicos de equipos e instalaciones deben incorporar aspectos del comportamiento animal que le generen confort. 3. Es factible adicionar a los protocolos de bienestar animal, el confort con el que desarrollan sus actividades cotidianas los animales. Al medir la ausencia de hambre, no basta con el registro de una condición corporal, se debe considera el comportamiento natural al momento de ingerir sus alimentos.

594


4. Se recomienda ampliar el presente en temas tales como: Altura a la que prefieren comer los corderos, Color de los comederos, versatilidad de los comederos y evaluación técnica del comedero

Bibliografía - Echevarría A., Miazzo R. (2002). El ambiente en la producción animal. Cursos de Producción Animal, FAV UNRC. www.produccion-animal.com.ar - Galicia, R, M. (2012). Natural movement of the animal when eating. Ninth International Livestock Environment Symposium, Sponsored by ASABE. Valencia, Spain. - Inma E., Inger-Lise A., Eric N. (2007). Group size, density and social dynamics in farm animals. Applied Animal Behaviour Science, Volume 103, Issues 3–4, 20 March 2007, Pages 185-204. - Marek Š., (2006). How important is natural behaviour in animal farming systems?. Applied Animal Behaviour Science, Volume 100, Issues 1–2, October 2006, Pages 117-128. - Welfare Quality® Assessment Protocol for Cattle, 2009, ISBN/EAN 978-90-78240-04-4, 180 pages. http://www.welfarequality.net/everyone.

595


 







        +6/+ &+61+.9 /-/<<+ %!+<;?/=+&36@+ 6+8-9 $I</D  !9<+6 +=/61+ C!'/<<L8 



/8><9./8@/=>31+-3L8 +#<./8)+6./=/;?/<+?6>3@9=B>/8=3@9=<?:91<3-?6>?<+./$</-3=3L8><+ )7   ?+.+43<++.+49D/7+360<+81+6/+17+36-97

(83@/<=3.+../B></7+.?<+81/83/<K+./6!/.391<98L73-9C9</=>+6@.+./6@+==8 +.+49D  8=>3>?>9./3J8-3+=1<F<3+=/7,3/8>+3=!/.3>/<<G83-+=-++7(83@/<=3.+././E@9<+81/82+<3+%?<+6 <?:9./1<3-?6>?<+./$</-3=H9"M-6/9.+!3><+:+<>+.9   E@9<+

 (83@/<=3.+../B></7+.?<+/:+<>+7/8>9B:</=3L8<F03-+@.+./6@+==8 +.+49D  1<9$</-3=3L881/83/<K+&6(<, += 97+=+.+49D 

  (89 ./69=9,4/>3@9= ./ 6+ 1<3-?6>?<+ ./ $</-3=3L8 /= 6+ D98303-+-3L8 ./ 6+= :+<-/6+= -98 /6 038 ./ /=>+,6/-/< /=><+>/13+= ./ 1/=>3L8 .30/</8-3+.+= :+<+ =? </+63D+-3L8 /8 /=>/ ><+,+49 =/ 2+ ?>363D+.9 /6 7?/=></9 ./ -98.?->3@3.+./6I-><3-++:+</8>/+C./:-98/69,4/>3@9././>/<738+<6+3806?/8-3+./6+>9:91<+0K+=9,</ /=>+=@+<3+,6/= += 7/.3-398/=/86+ :+<-/6+/B:/<37/8>+6=/</+63D+<98?>363D+8.9?8+ :6+>+09<7+./=/8=9</= 7L@36/=)/<3= 6+-?+6:<9:9<-398L.+>9=./-98.?->3@3.+./6I-><3-++:+</8>/=?:/<03-3+6= :<90?8.+ .C: 9=.+>9=./:9=3-3L8=/9,>?@3/<987/.3+8>/?8=3=>/7+$&./.9,6/0</-?/8-3+-98-9<</--398/= .30/</8-3+6/= %' C :</-3=3L8 -/8>37I><3-+ 6 ><+>+73/8>9 ./ .+>9= 0?/ </+63D+.9 7/.3+8>/ /6 &3=>/7+ ./ 809<7+-3L8/91<F03-+<-3= C/6=90>A+</&&C=>/709<?>97+>/./9=-3/8>303- 9=</=?6>+.9= ./6/=>?.39 2+8 :?/=>9 ./ 7+8303/=>9 ;?/ -98 -+<F->/< 1/8/<+6 6+ ./:/8./8-3+ /8></ 6+ + C 6+= @+<3+,6/= >9:91<F03-+=/=,+=>+8>/7/89<;?/6+/B3=>/8>//8><//6:C.3-2+=@+<3+,6/="99,=>+8>/7/.3+8>//6?=9./6+ </1</=3L8 :98./<+.+ 1/91<F03-+7/8>/ *% =/ 2+ 9,=/<@+.9 ;?/ /=>+= -9<</6+-398/= 89 =98 -98=>+8>/= /8 /6 /=:+-39=389;?/2+C6?1+</=/869=;?/+?7/8>+8-98=3./<+,6/7/8>/$9<>+8>96++/=?8:+<F7/><9;?/89 =/ @/ 3806?/8-3+.9 =318303-+>3@+7/8>/ :9< 6+ >9:91<+0K+ ./6 6?1+< /=>?.3+.9 89 +=K /6 : ;?/ /=>F +619 7F= +0/->+.9 $+6+,<+=-6+@/1<3-?6>?<+./$</-3=3L898.?->3@3.+.6I-><3-+:+</8>/'9:91<+0K+&:

    ! ! ! 

"  #8/90$</-3=3981<3-?6>?</7+389,4/->3@/=3=>2/D98/.300/</8>3+>39890>2/:69>389<./<>9/=>+,63=2.300/</8> 7+8+1/7/8>=><+>/13/=8>23=A9<5>2/=/D98/=2+@/,//8-6+==303/.>2<9?12>2/=:+>3+6@+<3+,363>C90+::+</8> /6/-><3-+6 -98.?->3@3>C + +8. : =936 -2+<+->/<3=>3-= >2+> 2+. ,//8 .3</->6C 6385/. A3>2 >9:91<+:2C @+<3+>398=!/+=?</7/8>=98>2//B:/<37/8>+6:69>A/</:/<09<7/.?=381+79,36/=/8=9<:6+>09<7)/<3=  A23-2 :<9@3./. .+>+ 09< +::+</8> /6/-><3-+6 -98.?->3@3>C + ,9>2 =2+669A = +8. .//: . +8. : $9=3>398.+>+A/</9,>+38/.?=381+.?+60</;?/8-C$&=C=>/7A3>2%'-9<</->398=+8.-/8>37/>/<+--?<+-C +>+ :<9-/==381 A+= :/<09<7/. ?=381 >2/ /91<+:23- 809<7+>398 &C=>/7 =90>A+</ <-&  +8. & &C=>/7 09< ?>97+>/. /9=-3/8>303- =90>A+</ &>?.C </=?6>= 2+@/ =29A8 >2+> 38 1/8/<+6 >2/ ./:/8./8-/ ,/>A//8++8.>9:91<+:23-@+<3+,6/=3==7+66/<>2+8>2+>,/>A//8>2/:+8.>2/=/@+<3+,6/=9A/@/<>2/ ?=/901/91<+:23-+66CA/312>/.</1</==398*%2+=:<9@/.>2+>>2/=/</6/>398=23:=+</89>-98=>+8>38=:+-/ +=>2/</+</:6+-/=A2/</>2/C38-</+=/-98=3./<+,6C'2/</09</>2/+3=+:+<+7/>/<>2+>3=89>=318303-+8>6C 3806?/8-/.,C>2/69-+6>9:91<+:2C90=?<@/C+</++6>29?12>2/:3=79</+00/->/.,C>2/=/@+<3+>398= /CA9<.=$</-3=398+1<3-?6>?</::+</8>6/-><3-98.?->3@3>C:>9:91<+:2C&

596


 







         8B -F* <. 9.;<20>. >7* *0;2,>5=>;* +*<*-* .7 5* <8<=.72+252-*- -.3*7-8 -. <.; >7* ,>.<=2H7 .<=;2,=*6.7=. 6.-28*6+2.7=*5 . 27,5>BE7-8<. 5* ?2*+252-*- .,87H62,* B 5* *,.9=*,2H7 <8,2*5 * 0;2,>5=>;* -. ";.,2<2H7 <.0I7 8;@27 .= *5   .< .5 6E=8-8 6D< ?2*+5. 9*;* ,87<.0>2;  .<=. -.<*;;8558<8<=.72+5. 5><8-.6.-2-*<-.,87->,=2?2-*-.5E,=;2,**9*;.7=.-.5<>.58*,868?*;2*+5.<.,>7-*;2*9*;* 68-.5*; -.=.;627*-*< 9;892.-*-.< /F<2,8:>F62,*< -.5 62<68 ;.5*,287*-*< ,87 <> /.;=252-*- .< >7* =E,72,*6>B/2*+5.9*;*,*;*,=.;2C*;5*?*;2*+252-*-.<9*,2*5-.>7*9*;,.5* 8;*5.=*5  * C872/2,*,2H7 -. >7* 9*;,.5* <. 9>.-. ;.*52C*; 6.-2*7=. =E,72,*< 0.8.<=*-F<=2,*< >72?*;2*7=.< 8 6>5=2?*;2*7=.< 8 6.-2*7=. ;.0;.<2H7 987-.;*-* 0.80;D/2,*6.7=. %.;;H7 .= *5   <.0I7 58< ,*<8< * =8980;*/F* =2.7. >7 0;*7 2698;=*7,2* .7 5* *0;2,>5=>;* -. 9;.,2<2H7  *-.6D< -. <.; >7 /*,=8; /8;6*-8; -.5 <>.58 =2.7. >7* 27/5>.7,2* 2698;=*7=. .7 5*< 9;892.-*-.< -.5 62<68 . 27,5><8 9>.-. 55.0*;*-./272;5*?*;2*+252-*--.*50>7*<9;892.-*-.<-.5<>.58;*?,1.748*7->558,4 87 5**952,*,2H7-.5*0.868;/8580F*<.8+=2.7.7>7*<.;2.-.?*;2*+5.<=8980;D/2,*<:>.9>.-.7.695.*; 9*;*.A952,*;5*?*;2*+252-*--.5;.7-262.7=8-.58<,>5=2?8<*<9*;.=*5   *;:>.<-*$25?**7- 5.A*7-;.   %8-8< .<=8< -*=8< * 9 B *5=2=>- 9>.-.7 <.; 8+=.72-8< <26>5=D7.*6.7=. 6.-2*7=. .5 ><8 -. 5* 95*=*/8;6*6H?25-.<.7<8;.<'.;2< '.;2<%.,1785802.<7,$*527*$&$ !>6.;8<8< *>=8;.< 1*7 27=.7=*-8 ;.5*,287*; 58< =298< -. <>.58 B 5* -2<=;2+>,2H7 .<9*,2*5 -. -.=.;627*-8<*=;2+>=8<-.5=.;;.78*9*;=2;-.68-.58<-202=*5.<-..5.?*,287.<  ,;*=7.B.= *5   J17 .=*5   ;.5*,287*7 5* ,87->,=2?2-*- .5E,=;2,* *9*;.7=. ,8;;.02-* * M ,87 *50>7*<?*;2*+5.<=8980;D/2,*<9.;8.5?*58;9;.-2,=2?8-..<=8<68-.58<.<5262=*-8 *;:>.<-*$25?* B $25?*   ;.*52C*;87 >7* ,5*<2/2,*,2H7 -. 58< *=;2+>=8< =8980;D/2,8< 2 *=;2+>=8< 9;26*;28< ,*5,>5*-8<-2;.,=*6.7=.-.5 B22*=;2+>=8<<.,>7-*;28<8,869>.<=8<,*5,>5*-8<*9*;=2;-.5* ,86+27*,2H7 -. *=;2+>=8< 9;26*;28< <87 F7-2,.< :>. 9>.-.7 ,*;*,=.;2C*; 9;8,.<8< 8,>;;2-8< .7 5* <>9.;/2,2. -.5 ;.52.?. .+2-8 * 5* 2698;=*7,2* -. 5* * .5 9 B 5* =8980;*/F* .7 58< .<=>-28< -.<*;;855*-8< .7 *0;2,>5=>;* -. 9;.,2<2H7 <. 1* 95*7=.*-8 .<=. =;*+*38 ,87 .5 /27 -. *7*52C*; B ,>*7=2/2,*;5*<;.5*,287.<.7=;.*=;2+>=8<9;26*;28<B<.,>7-*;28<-.5*=8980;*/F*,875**B9-.5 <>.58 -. 5* 9*;,.5* 8+3.=8 -. .<=>-28 <F <. 98-;D7 .7=.7-.; 6.38; 58< /*,=8;.< :>. ;.0>5*7 5* 1.=.;80.7.2-*--.-2,1*<?*;2*+5.<=*7><*-*<.7*0;2,>5=>;*-.9;.,2<2H7

     59;.<.7=..<=>-28<.1*55.?*-8*,*+8,87-*=8<8+=.72-8<.7>7I72,86>.<=;.8-.<*;;855*-8.7 78?2.6+;.-.  .7>7*9*;,.5*-.5*/27,*-.78627*-*N 87=.-*'271*O.75*<,.;,*7F*<-..3* "8;=>0*5 ,87 ,88;-.7*-* ,.7=;*5 (   )

  %#$ &% ! $. =;*=* -. >7* 9*;,.5* -. /8;6* *9;8A26*-*6.7=. 9.7=*087*5 ,;>C*-* .7 <> C87* ,.7=;*5 98; >7 9.:>.G8 *;;8B8 .<=*,287*5:>./5>B..7-2;.,,2H7<>;8.<=.**5=2=>-6F726*<.<2=I** 6B5*6DA26*=2.7.>7* ,8=*-. 

6,87>7*9.7-2.7=.6DA26*-.5 .75*<C87*<*-B*,.7=.<*5*;;8B8<2.7-8.7 0.7.;*5.5;.52.?.<>*?.,87,*F-*-.<-.58<.A=;.68<-.5*9*;,.5*1*,2*.562<68 8< -*=8< <. ;.,802.;87 ,87 .5 <.7<8; -. ,87=*,=8 '.;2< 5 .:>298 >=252C*-8 9*;* 98<2,287*; 5*< 6.-2-*</>.>76872=8;;?*%.,,87>7;.,.9=8;"$%89,8729.;9;8%89,878;98;*=287%8428 *9H7 +2/;.,>.7,2*  B ,8;;.,,287.< #% ;.,2+2-*< ?F* ;*-28 -.<-. >7* +*<. *A8;% *?*- !*?20*=287 $B<=.6< $*7 8<.  &$ :>. 9.;62=2H .5 98<2,287*62.7=8 -. 5*< 6.-2,287.< ,87 9;.,2<2H7 ,.7=26E=;2,* B 5* 8+=.7,2H7 -. 58< -*=8< *5=26E=;2,8< 9*;* .5*+8;*; .5 68-.58 -202=*5 -. .5.?*,287.<   5 <.7<8; '.;2<  .<=D .:>29*-8 ,87 >7 -8+5. <2<=.6* :>. 9.;62=. 6.-2; <26>5=D7.*6.7=.5**B-.59-.5<>.58-.6D<-*-*5*-2<98<2,2H7-.58<.5.,=;8-8<.5<.7<8; 8/;.,.-8<=298<-.6.-2-*<-.*<>9.;/2,2*5* ,6B9;8/>7-**,6

597


 









             

,*,-0,-/#3',)'+1#%/!':+#+#)"#),0"'$#/#+1#0"1,00#-/,!#"':)+7)'0'0#4-),/1,/', "#),0*'0*,0-,/*#"',"#)#01"901'!2+'"'*#+0',+).2#-#/*'1':"#*70)#)'*'+!':+"#),0 #//,/#0)#1,/',0!#!'",0"2/+1##)*2#01/#,+3#6!,//#%'",0),0#//,/#0),0"1,0*2#01/)#0 $2#/,+ '+1/,"2!'",0 #+ 2+  #+ #01# !0, /!  "#   !- "# "1,0 /#02)1+1# #+ $,/*1,3#!1,/')"#1'-,*2)1'-2+1,0#'+1#/-,):-/!/#/02-#/$'!'#0!,+1'+20"#1'-,/01#/ + 3#6 , 1#+'"0 )0 "'3#/00 02-#/$'!'#0 /01#/ 0# !,*#+6:  1/ (/ !,+ #)  -/ !/#/ )0 "'$#/#+1#0 3/' )#0 /#)!',+"0 !,+ ) 1,-,%/$9 / #)), 0# #*-)#: 1+1, /! !,*,    501#* $,/ 21,*1#"#,0!'#+1'$'! +)50#0 2+   !,+ *:"2),0 "#0//,))",0 #0-#!9$'!*#+1#-/#)+7)'0'0&'"/,):%'!,5*,/$,*81/'!,"#)1#//#+,03/' )#0!,+0'"#/"00# "'3'"'#/,+ #+1/# .2#))0 /#)!',+"0 "'/#!1*#+1# !,+ ) 1,-,%/$9 5 02 *,/$,*#1/9 !,*, ) -#+"'#+1# , )0.2#0'*2)+ #) !,*-,/1*'#+1, "#)$)2(,0, /# #)1#//#+,#0"#!'/)0 /#)!',+"0 !,+)&'"/,),%9  /' )#0/#)!',+"0!,+)1,-,%/$95*,/$,*#1/9    )1'12"/#)1'3/#0-#!1,)*#"'"#+1/,"#)-/!#)+ #+"'#+1##+-,/!#+1(# =+"'!#"#)+2/"#,+",0"#))#05"#'*0"#/#010

=+"'!#"#/2%,0'""1,-,%/7$'! #"'""#)3#!1,/"#/2%,0'"" /' )#0/#)!',+"0!,+)&'"/,),%9    !2*2)!':+"#$)2(,)2(,  !1,/"#-,1#+!'"#!2!#  =+"'!#1,-,%/7$'!,"#&2*#"" 

=+"'!#"#&2*#""   0",#+)!2#+!  ,)-#+"'#+1#   )#012"',#01"901'!,0#!#+1/:#+) ;0.2#""#!,//#)!',+#0#+1/#)03/' )#0*#"'"0#+!*-, 0 " 5 - !,+0'"#/"0 3/' )#0 "#-#+"'#+1#0 5 )0 "'3#/00 -/,-'#""#0 # 9+"'!#0 1,-,%/7$'!,0"#/'3",0"#)21')'6"0!,*,3/' )#0'+"#-#+"'#+1#0/#)),0#&#*-)#:#) +7)'0'0 "# ) /#%/#0':+ )'+#) 5 .2# '+"'!/ .2# !,*, -0, -/#3', ) +7)'0'0 "# /#%/#0':+ 0# +,/*)'6/,+-,/*#"',"#)"#+,*'+", )0*#"'"0"#!,+"2!1'3'""#)8!1/'!5-09

598


 







%0.0'-1301+0'813'4#/&0-#7#3+#%+>/104+5+7#0/')#5+7#3'41'%50#-#.'&+#&'#-563#'/-# 1#3%'-#&'#/;-+4+4&'/0.+/#&0"/ - '456&+0 &' -#4 %033'-#%+0/'4 4' *# 3'#-+:#&0 103 .'&+0 &' -# '45#&=45+%# 53#&+%+0/#- .'&+#/5' -# 3')3'4+>/ -+/'#- #/#-+:#/&0 '- %0'(+%+'/5' &' %033'-#%+>/ 9 &'5'3.+/#%+>/ 9 -# 130$#$+-+&#& &' -# *+1>5'4+4/6-#1#3# 0$4'37#34+ #-)6/# 7#3+#$-' 4'-'%%+0/#&#104'=# 6/# 3'-#%+>/ -+/'#-$#4#&#'/'- #:#3#3#'--04'*#&+7+&+&0-#:0/#&''456&+0'/1#3%'-#4*0.0)</'#4&'53'+/5#10353'+/5#.'5304 +)&'-#426'4''853#,0#1#35+3&'-3;45'3'-7#-03.'&+0/505#-4'#/#-+:#30/  4'%503'426' 4+37+'30/1#3#&+4.+/6+3-#7#3+#$+-+&#&+/5'3/#&'-04&#50445'#/;-+4+4#46.'-#'45#%+0/#-+&#&&' -04&#504'4&'%+346*0.0)'/'+&#&#-0-#3)0&'50&#-#1#3%'-# 045'3+03.'/5' %0/ '- (+/ &' #/#-+:#3 -# +/(-6'/%+# 26' -# *'5'30)'/'+&#& -0%#- 0 (#-5# &' '45#%+0/#-+&#&&'-04&#50416'&#5'/'3'/'-3'46-5#&04'3'#-+:>6/#/;-+4+4'45#&=45+%0&'3')3'4+>/ 10/&'3#&#)'0)3;(+%#.'/5'!-)3#&0&'#,645'&'-#43')3'4+0/'416'&''456&+#34'103.'&+0 &'-#*'33#.+'/5#&'.=/+.04%6#&3#&0403&+/#3+0426'130103%+0/#'-.+4.0%0'(+%+'/5'&' &'5'3.+/#%+>/0$5'/+&0%0/#/5'3+03+&#&9'41'%+#-.'/5'-043'4+&604'/%#&#6/#&'-044'%503'4&' #/;-+4+4 # #1-+%#%+>/ &' -# *'33#.+'/5# 1#3# '8#.+/#3 -# #650%033'-#%+>/ '41#%+#- &' -04 3'4+&604 )'/'3#&0446#)361#.+'/50&+41'34+>/0#-'#503+'&#&103.'&+0&'-'45#&=45+%0)-0$#-&'03#/ &#504/0+/%-6+&04&'.0453>26'<45044'%0/%'/53#$#/'/:0/#4&'5'3.+/#&#445'*'%*0'7+&'/%+> 26'-#'8+45'/%+#&'*'5'30)'/'+&#&-0%#-#('%5##-##1-+%#%+>/&'6/#?/+%#'%6#%+>/&'3')3'4+>/9 1035#/50/04'16'&''45#$-'%'36/#?/+%#%033'-#%+>/1#3#50&0'-;3'#&''456&+0 4=#46.+&#-#/0'45#%+0/#-+&#&&'-04&#5044'&'5'3.+/>26'-##1-+%#%+>/&'-#5<%/+%#'45#&=45+%# !10&3=#'45#$-'%'3.',03#,645''/53'-#47#3+#$-'445'.<50&0'-#$03#6/#3')3'4+>/-0%#-1#3# %#&# -0%#-+:#%+>/  5'/+'/&0 '/ %6'/5# -04 7#-03'4 &' -#4 -0%#-+:#%+0/'4 %'3%#/#4 36/4&0/ '5 #-  #3#%0.130$#34+'-#,645'*#4+&0$6'/0'/50&#4-#4:0/#4&'-;3'#&'53#$#,0-#*'33#.+'/5# 130103%+0/# 6/ 7#-03 &'   -0%#- 9 -04 3'4+&604 '/ %#&# 6/0 &' -04 16/504 4504 *#/ 4+&0 5#.$+</ #/#-+:#&041#3#0$4'37#346)3#&0&'#650%033'-#%+>/0$4'37;/&04'&'/6'706/##)361#%+>/'41#%+#- &'-047#-03'45#/50&'- %0.0&'-043'4+&604 +/#-.'/5' %0/ '- (+/ &' 0$4'37#3 4+ -#4 :0/#4 &' #)361#.+'/50 &' -04 7#-03'4   -0%#-'4 40/ %0+/%+&'/5'4%0/%#3#%5'3=45+%#4&'3+7#&#4&'46104+%+>/5010)3;(+%#4'3'#-+:#30/#/;-+4+4%#5')>3+%04 &'- 3'-+'7' 9 4' %36:#30/ -04 3'46-5#&04 %0/ '- 7#-03   -0%#- &' -# ! #3# '--0 103 .'&+0 &'  4' 3'#-+:> 6/# %-#4+(+%#%+>/ &' (03.#4 &'- 5'33'/0 26' $#4#&0 '/ '- A/&+%' &' 04+%+>/ 010)3;(+%#   %#5')03+:# '-  '/ &+7'34#4 %-#4'4 &' #%6'3&0 # 464 %#3#%5'3=45+%#4 .03(0.<53+%#4 %0/5+/6#%+>/ 4' '853#,'30/ -04 7#-03'4 .0&#-'4 '/ %#&# 6/#&' -#4 %6#&3=%6-#4 &' #/;-+4+494'0$4'37>-#&+453+$6%+>/&'-047#-03'4&' '/%#&#%#5')03=#&'3'-+'7'45'130%'404' 3'#-+:> 1#3# %#&# 6/# &' -#4 7#3+#$-'4 +/&+7+&6#-.'/5' 9 5#.$+</ 1#3# -# .'&+# &'- =/&+%' &' &'5'3.+/#%+>/&'50&#4-#47#3+#$-'4'/%#&#3')+>/

   04 3'46-5#&04 &'- 13+.'3 #/;-+4+4 &' 3')3'4+>/ -+/'#-  #$-#4  9  &'4#330--#&0 4+/ #5'/&'3 # -# -0%#-+:#%+>/'41#%+#-&'-047#-03'4.0453#30/26'/+/)6/#&'-#47#3+#$-'44'%0.1035#$#&'.#/'3# #-'#503+#926'-#%033'-#%+>/4>-0'4(6'35'0.0&'3#&#'/53'-#49'-"/

0'/53''-19'- "/ 0 -# 1'/&+'/5'   9    3'41'%5+7#.'/5' +/ '.$#3)0 '- %0'(+%+'/5' &' &'5'3.+/#%+>/ +/&+%# 26' 4#-70 '/ -# 3'-#%+>/ '/53' "/ 9 1   -# 7#3+#$+-+&#& '/ -# 5010)3#(=# /0 '81-+%# 4+)/+(+%#5+7#.'/5' -#4 7#3+#%+0/'4 '/53' -# # 9 '- 1 03 5#/50 &'- #/;-+4+4 &' 3')3'4+>/ -+/'#- #46.+'/&0 -# '45#%+0/#-+&#& '41#%+#- &' -04 &#504 4' 16'&' &'45#%#3 26' '/ -#4 %0/&+%+0/'4 &' .6'453'09#/;-+4+4&'4#330--#&04/0*#96/#3'-#%+>/#%'15#$-''/53'-#47#3+#$-'45010)3;(+%#49-# # 9 26' %#40 &' '8+45+3 -# 7#3+#$+-+&#& 5010)3;(+%# '81-+%# '4%#4#.'/5' -#4 7#3+#%+0/'4 &' -# %0/&6%5+7+&#& 03 46 1#35' '- 1 4= 104'' 6/# %033'-#%+>/ .0&'3#&# %0/ -# #-563# 3'-#5+7# 9 -# 1'/&+'/5'1'30/+/)6/0&'-0405304(#%503'4#/#-+:#&04'81-+%#'45#3'-#%+>/ 

599


 







         % & ' ''(   )*        

                   &                                

   

       +          % & ' ''(   )*                           &                   

 

               +

 $( ',") )')  '/ -., & *&$$6(   & , ", -$6( *), '5($')- /,)- ),$(,$)- & *,)*$0,$$&$ -*$& &-0,$& - * ($ (. --2*! .&)-, -/&.)- & (4&$-$-   , ", -$6( &$( & .,$$)(& *)($ ()   '($!$ -.) & $'*),.($   &  +/  )(-$ ,&-$./$6( -*$& &-0,$& -' $- & (4&$-$-   & $-.,$/$6( -*$&   &)- 0&), - &)& -  &   ). ($)- ' $(.   . ($ ()-/ 1. (-$6( (.,) &*, &  -./$)$" '/ -.,+/ ()#2/(&.)",)  %/-.  (&'$. &-/* ,!$$  &*, &  -./$)-$ ()') ,))!/ ,.  (/(*), (.%  '/2 --) 

 )%  , *+ % -''(% *&. *%& * , &)+% ,*% & + %  



-. # #)*),5),, -*)( ,& 1$-. ($ 3)(-)(/(-/&$ -.)*)",4!$-*,)* (-- /( , &$6( '4- &. 2  . ,'$((.  , -* .)  &- 0,$& - )(-$ ,- &) +/  -  (&$36 )( & ,/  &)-0&), -  )(&-&- - !),'- &. ,, ()$" )- ,04()- +/ .(.)&)- 0&), - &.)- )') &)- %)- -  $-.,$/5( *), & '2),5   . "),5- ), .(.) &- 3)(-   ),, &$6( -*$&&.()),, -*)( ()(($("7(.$*) !),' &. ,, () . ,'$(

*' )&*'& )-, -/&.)- & -./$)#(*/ -.) '($!$ -.)+/ )(,4. ," ( ,&& * ( ($ (., & 2&-0,$& -.)*)",4!$- --.(. ' (),+/ & 1$-. (.  (.,  &*2$#-0,$& -) )-.(.  ' $(.  & /-)   & , ", -$6( *)( , " )",4!$' (.   -  # )- ,0) +/  -.- ),, &$)( - () -)( )(-.(. - ( & -*$) -$() +/  #2 &/", - ( &)- +/  /' (.( )(-$ ,& ' (. ),.(.)& -/(*,4' .,)+/ ()- 0 $(!&/ ($)-$"($!$.$0' (. *), &.)*)",!5 &&/", -./$)()-5 &*+/  -.4&")'4-! .)),.(.)-/0,$$&$ $(. ,( -     , &$)(, )( &- ,. ,5-.$- !5-$)+/5'$-  & -/ &) )') 0,$)- .,%)-

600


 







*7=.;28;.<1*7-.68<=;*-88;*5.=*5 <F9>.<5**.<>76E=8-8:>.9.;62=..?*5>*;5*< ,87-2,287.<-.5<>.58,87,>*5:>2.;,*;*,=.;F<=2,*=8980;D/2,*

 8<-*=8<-..<=..<=>-281*7<2-8/27*7,2*-8<98;5*.69;.<*0;8";.,2<2G7$ %;*+*38,8/27*7,2*-898;.58+2.;78-.A=;.6*->;*B58<87-8<>;89.8<-..<*;;8558#.0287*5 #6.-2*7=.5**B>-**50;>98-.27?.<=20*,2G7%

  ;>7<-87  8=1.;2701*6  $ *7- 1*;5=87     .80;*912,*55B @.201=.- <>66*;B <=*=2<=2,<  /;*6.@8;4/8;58,*52C.-.A958;*=8;B-*=**7*5B<2<"! #!$ !   K

 8;@278*0>.*7-55<@8;=1%# <<.<<2707879827=<8>;,.9855>=28727=1.?*-8<.C87. @2=1 *-?*7,.- 27/8;6*=287 =.,1785802.< 7 8;@27  8*0>.  55<@8;=1 %# -< <<.<<6.7= 8/ 879827=$8>;,."855>=28727=1.&*-8<.)87. $      *<9*; %  % $ 85?27   *B7.<  *;5.7  *6.< ' ..4  ">52-8 *7-  >=5.;   #.5*=287<129+.=@..7<2AB.*;<8/,8;7B2.5-<*7-=.;;*27*==;2+>=.<  "!"    ;*?,1.748 *7->558,4 8;;.5*=2878/,8;7*7-<8B+.*70;*27B2.5-@2=1=8980;*91B*7- <8259;89.;=2.<$ "!   H17H;0.7;.772705.A*7-.;'.1;1*7*;,8<C27<42$B5?2**7-$866.;2,1*.5 7=.;9;.=*=287 8/ .5.,=;2,*5 ,87->,=2?2=B 9*==.;7< +B <825 9;89.;=2.< *7- 0.85802,*5 6*9< /8; 9;.,2<287 *0;2,>5=>;.   "!""

  -82  <   C *;:>.<*$25?*#*7-5.A*7-;.  $9*=2*5&*;2*+252=B8/;;20*=.-8;7(2.5-27#.5*=287=82.5- %8980;*91B*7-$8251.62,*51*;*,=.;2<=2,<  "!""# K  *;:>.<*$25?*#*7-$25?*   ?*5>*=287 8/=1.;.5*=287<129+.=@..7 6*2C. B2.5-<9*=2*5*7- =.698;*5?*;2*+252=B*7--2//.;.7==8980;*912,*==;2+>=.< $ !  $%    ,;*=7.B.7-87,M*$*7=8<*7-27*<7B  !7-202=*5<8256*99270   K -82   $   

 



8;*5*;,F*%.;;G7G9.C*7-*;:>.<* $25?*#  .527.*=2878/ 6*7*0.6.7=C87.< ><270 68+25. 6.*<>;.6.7=< 8/ <825 *99*;.7= .5.,=;2,*5 ,87->,=2?2=B *7- 6>5=2?*;2*=. 0.8<=*=2<=2,*5 =.,172:>.<       %.;;G7  *;:>.< * $25?* # 8;*5 *;,F*  *7- *;,F* .;;.;     $825 *99*;.7= .5.,=;2,*5 ,87->,=2?2=B*7-0.80;*912,*55B@.201=.-;.0;.<<287/8;6*99270<825";.,2<2870;2,>5=>;."

  K -82  <    

601


Puesta en valor de la berenjena de Almagro a través de la caracterización y mejora genética M. Hurtado1, S. Vilanova1, M. Plazas1, P. Gramazio1, F.J. Herraiz1, I. Andújar1, A. Castro2 y J. Prohens1 1

Instituto de Conservación y Mejora de la Agrodiversidad Valenciana, Universitat Politècnica de València, Camino de Vera 14, 46022 Valencia, e-mail: jprohens@btc.upv.es 2 Asociación para la Promoción de la I.G.P. “Berenjena de Almagro”, C/ Ramón y Cajal 12, 13260 Bolaños de Calatrava, Ciudad Real

Resumen La berenjena de Almagro (Solanum melongena) es una variedad tradicional de la comarca del Campo de Calatrava utilizada para la elaboración de encurtidos. La berenjena de Almagro es la única variedad de berenjena reconocida en Europa con una Indicación Geográfica Protegida. Durante los últimos años hemos llevado a cabo un programa encaminado a conocer la diversidad y características más relevantes de esta berenjena. Asimismo hemos llevado a cabo una selección de la misma y un programa de retrocruzamiento para su mejora genética. Los estudios de diversidad llevados a cabo con descriptores morfológicos y marcadores moleculares muestran que la berenjena de Almagro no es genéticamente uniforme. No obstante, presenta caracteres morfológicos y marcadores de tipo microsatélite (SSR) que permiten diferenciarla claramente de otras variedades de encurtido. A pesar de presentar ciertas similitudes con berenjenas de tipo asiático, los análisis moleculares muestran que, genéticamente, se agrupa con el resto de variedades españolas. La evaluación de la composición química muestra que la berenjena de Almagro es la que mayor valor presenta en contenido en polifenoles en una colección de variedades de berenjena, lo cual le confiere un alto valor nutracéutico. Un análisis más detallado ha permitido determinar que presenta altos niveles de ácido clorogénico, con valores superiores a los de la especie silvestre S. incanum. Los trabajos de selección dentro de la variedad han permitido la selección de una línea (H15) con una producción más elevada y menor espinosidad que la variedad original y que al mismo tiempo mantiene las características propias de la variedad. Por otra parte, el programa de retrocruzamiento realizado utilizando como donantes de baja espinosidad a la berenjena andaluza de encurtido y variedades de consumo en fresco ha dado lugar a la selección de varios materiales con características adecuadas, como alta productividad y baja espinosidad y que en la actualidad se encuentran en fase de evaluación y fijación. En definitiva, este trabajo muestra que la caracterización, junto con la selección y mejora genética puede contribuir a poner en valor nuestras variedades locales más representativas. Palabras clave: diversidad, marcadores, polifenoles, retrocruzamiento, Solanum melongena

Enhancing the value of Almagro eggplant through characterization and breeding Abstract Almagro eggplant (Solanum melongena) is a traditional variety from the Campo de Calatrava county used for pickling. Almagro eggplant is the only eggplant variety recognized with a Protected Geographical Indication status. During the last years we have undertaken a program aimed at studying its diversity and most relevant characteristics of this eggplant variety. Also, we have performed a selection of this variety and a backcross breeding program. Diversity studies performed with morphological and molecular markers show that Almagro eggplant is genetically heterogeneous. Nonetheless, it presents morphological and microsatellite (SSR) molecular markers that allow differentiating it clearly from other pickling varieties. Despite presenting certain similarities with Asian eggplants, the molecular analyses show that, genetically, Almagro eggplant clusters with the rest of Spanish varieties. Evaluation of the chemical composition shows that Almagro eggplant is the one presenting a highest content in phenolics in a collection of eggplant varieties, which confers it a high nutraceutical value. A more detailed analysis shows that it presents high levels of chlorogenic acid, with values higher than those of the wild species S. incanum. Selection works within this variety have allowed the selection

602


of one line (H15) with a higher yield and lower prickliness than the original variety and that at the same time maintains the typical characteristics of the Almagro variety. Also, the backcrossing programs performed using the Andalusian pickling eggplant and varieties for the fresh market as donors of low prickliness has resulted in the selection of several materials with good characteristics, like high yield and low prickliness, and that at present are in the phase of evaluation and fixation. In summary, this works shows that characterization, together with selection and breeding can contribute to enhance our most representative local varieties. Keywords: diversity, markers, phenolics, backcrossing, Solanum melongena

Introducción España es un centro de secundario de diversidad para la berenjena (Prohens et al., 2005). Una de las variedades más peculiares es la berenjena de Almagro, la cual es la única berenjena en Europa reconocida con una Indicación Geográfica Protegida (IGP), la cual fue reconocida en 1994 (Castro, 2005). La berenjena de Almagro, al contrario que la mayor parte de variedades de berenjena, se utiliza fundamentalmente para la elaboración de encurtidos (Seseña y Palop, 2007). A pesar de la importancia económica de la berenjena de Almagro, con una producción anual de alrededor de 1500-2000 t, se han hecho pocos estudios sobre la caracterización y mejora genética de esta variedad local. El estudio de la diversidad, caracterización morfológica, genética y química de la berenjena de Almagro, es de gran interés ya que permite desarrollar estrategias de mejora y revelar propiedades o características que le proporcionen un valor añadido (Trichopolou et al., 2007). A este respecto, la demostración de que la berenjena de Almagro se trata de una variedad genéticamente diferenciada, junto con el estudio de la composición de caracteres de interés nutracéutico, como los polifenoles, para los cuales la berenjena presenta altos valores, puede contribuir a fomentar y poner en valor esta variedad local (Prohens et al., 2008; Plazas et al., 2013). Por otra parte, la berenjena de Almagro presenta una menor productividad y una mayor espinosidad que otras berenjenas de encurtido, como es la berenjena andaluza de encurtido. De esta forma, la selección dentro de esta variedad puede dar lugar a materiales con mejores características (Prohens et al., 2009). Asimismo, el desarrollo de programas de mejora genética de la berenjena de Almagro, en los cuales se introducen materiales donantes de caracteres de interés, como ausencia de espinas y mayor productividad, pueden contribuir a aumentar el interés por el cultivo de esta variedad local (Daunay, 2008; Fita et al., 2008). En este trabajo presentamos los resultados de los trabajos realizados durante los últimos años en lo que respecta a la caracterización, selección y mejora genética de la berenjena de Almagro. Estos trabajos están encaminados a la puesta en valor de esta variedad tradicional y pueden servir de modelo para la valorización de otras variedades locales.

Material y Métodos Caracterización morfológica, molecular y química Con el fin de estudiar las relaciones de la berenjena de Almagro con otros materiales españoles (13 accesiones) y de otros orígenes, en concreto China (20 accesiones) y Sri Lanka (18 accesiones). Con estos materiales se realizó una caracterización morfológica con 23 descriptores primarios de EGGNET (Prohens et al., 2005, van der Weerden et al, 2007) y una caracterización molecular con 12 SSR altamente polimórficos (Vilanova et al., 2012). También se llevó a cabo una caracterización morfológica y molecular en una colección que incluye accesiones de berenjena de Almagro mantenidas por agricultores asociados a la IGP berenjena de Almagro y accesiones de berenjena andaluza de encurtido. Para la caracterización morfológica se utilizaron 14 descriptores morfológicos de planta y fruto con los que se caracterizaron 16 accesiones de berenjena de Almagro y 7 de berenjena andaluza de encurtido. Para la caracterización molecular se

603


usaron tres combinaciones de marcadores AFLP y 36 marcadores SSR (Vilanova et al., 2012), con los que se caracterizaron 18 accesiones de berenjena de Almagro y 15 de berenjena andaluza de encurtido. Por otra parte, se realizó una caracterización de contenido en polifenoles totales en la berenjena de Almagro y se comparó con el de una colección de berenjenas de distintos orígenes, incluyendo otras variedades locales españolas (17 accesiones), variedades locales de tipo occidental de otros orígenes (9 accesiones), variedades comerciales de tipo occidental (12 accesiones) y variedades asiáticas (6 accesiones). También se evaluó el contenido en ácido clorogénico en la berenjena de Almagro y se comparó con el de la especie silvestre S. incanum.

Selección y mejora genética A partir de plantas de berenjena de Almagro seleccionadas en campo por baja espinosidad, se realizaron autofecundaciones para el desarrollo de líneas puras. Asimismo, se cruzaron materiales de baja espinosidad con accesiones de berenjena andaluza de encurtido sin espinas y con dos accesiones de berenjena negra sin espinas (CS16 y E1). Los híbridos obtenidos se han utilizado para un programa de retrocruzamiento para selección por baja espinosidad con el objetivo de desarrollar materiales de berenjena de Almagro con baja espinosidad e ideotipo correspondiente a la berenjena de Almagro. Las evaluaciones de plantas se han llevado a cabo en campos de agricultores asociados.

Resultados y Discusión Caracterización morfológica, molecular y química La caracterización morfológica realizada en una colección que incluye variedades españolas, chinas, y de Sri Lanka, muestran que comparado con otras variedades locales españolas, la berenjena de Almagro se caracteriza por presentar plantas de poca altura, muchas flores, las cuales son de tamaño pequeño, y frutos pequeños. Esas características hacen que a nivel morfológico, la berenjena de Almagro muestre ser muy similar a algunas variedades de tipo oriental, en particular a ciertas variedades chinas. Las variedades orientales y occidentales se consideran como grupos morfológicos diferentes (Vilanova et al., 2012) y presentan diferencias morfológicas importantes. Así, existen variedades orientales de tipo pequeño, incluyéndose entre ellas la variedad botánica depressum, caracterizada por tipos enanos (Bailey, 1947), y variedades de tamaño pequeño (Knapp et al., 2013). El hecho de que la berenjena de Almagro sea una berenjena pequeña en lo que respecta a tamaño de planta y fruto, hace que a nivel morfológico se encuentren una proximidad morfológica a variedades de áreas geográficamente alejadas. Sin embargo, cuando se estudian las relaciones genéticas de la berenjena de Almagro, se observa que molecularmente es mucho más parecida a las variedades locales españolas (Tabla 1), lo cual corrobora la diferenciación molecular entre las variedades occidentales y orientales (Vilanova et al., 2012). De esta forma, con las berenjenas chinas y de Sri Lanka, el número de loci SSR para los cuales se encuentran alelos distintos con respecto a la berenjena de Almagro es de al menos 6 (50%) (Tabla 1). Tabla 1. Número de loci SSR, entre 12 estudiados, para los que se encuentran diferencias entre una accesión de berenjena de Almagro y otras accesiones de berenjena de España, China, y Sri Lanka Origen España China Sri Lanka Total a Media±desviación típica

n 13 20 18 51

Mediaa 6.69±2.14 8.05±1.23 8.17±1.29 7.75±1.62

Mínimo 2 6 6 2

Máximo 10 10 11 11

Por otra parte, con las variedades españolas se encuentran diferencias genéticas mucho menores que con las asiaticas. En concreto, con una variedad española, correspondiente a la berenjena andaluza de

604


encurtido, se encuentran únicamente diferencias para dos loci SSR (Tabla 1), lo cual muestra que amb