GENIE Natuurwetenschappen 5 & 6 - Leerpakket 3 - Leerboek

Page 1

wetenschappen

LEERPAKKET

Natuur-
LEER BOEK GENIE
3 5 & 6

Proefversie©VANIN

MODULE 10: NANOMATERIALEN

1. Wat zijn nanomaterialen?

2. De productie van nanomaterialen

3. Toepassingen

MODULE 11: KRACHT EN BEWEGING

Proefversie©VANIN

Hoofdstuk 1: Beweging wiskundig beschrijven

1. Bewegingsgrootheden

2. Wetten van Newton

3. Krachten die de versnelling bepalen

4. Versnelling berekenen

Hoofdstuk 2: Bijzondere eendimensionale bewegingen

1. Rechtlijnige beweging met een constante snelheid

2. Verband tussen de oriëntatie van de kracht en de snelheidsverandering

3. Rechtlijnig beweging met een constante versnelling

4. Cirkelvormige beweging met een constante versnellingsgrootte

MODULE 12: ERFELIJKHEIDSLEER

Hoofdstuk 1: Mendeliaanse overerving

1. Inleidende begrippen

2. Wetten van Mendel

3. Variaties op de wetten van Mendel

Hoofdstuk 2: Overerving van het geslacht en geslachtsgebonden overerving (VERDIEPING)

1. Overerving van het geslacht

2. Genen op de geslachtschromosomen

MODULE 13: GENEXPRESSIE

Hoofdstuk 1: eiwitsynthese

1. DNA en RNA: even herhalen

2. Eiwitsynthese

Hoofdstuk 2: Mutatie en epigenetische modificatie

1. Genen versus omgeving

2. Mutatie

3. Epigenetische modificaties

MODULE 14: TRILLINGEN EN GOLVEN

Hoofdstuk 1: Kenmerken van trillingen

1. Eigenschappen van een trilling

2. Harmonische trillingen

3. Trillingen in de muziek

4. Mechanische energie van een harmonische oscillator

Proefversie©VANIN

Hoofdstuk 2: Lopende golven

1. Voortplanting van trillingen

2. Golflengte en golfsnelheid

3. Energietransport door geluidsgolven

Hoofdstuk 3: Elektromagnetische golven

1. Eigenschappen van elektromagnetische golven

2. De interactie tussen elektromagnetische golven en materie

3. Het elektromagnetisch spectrum

MODULE 15: BIOTECHNOLOGIE

Hoofdstuk 1: Biotechnologie, een groeiend onderzoeksdomein

1. Klassieke en moderne biotechnologie

2. Toepassingsgebieden van biotechnologie

3. Biotechnologie en ethiek

Hoofdstuk 2: Biotechnologische technieken

1. DNA vermenigvuldigen: de PCR-techniek

2. DNA zichtbaar maken: DNA-gelelektroforese

3. DNA manipuleren: recombinant DNA

4. DNA manipuleren: gene editing

MODULE 16: EVOLUTIE

Hoofdstuk 1: Mechanismen van evolutie

1. Evolutie en evolutietheorie

2. Mechanismen van evolutie

Proefversie©VANIN

Hoofdstuk 2: Evolutietheorie

1. De evolutietheorie in een historisch perspectief

2. Argumenten voor evolutie

Hoofdstuk 3: Evolutie van soorten

1. Het begrip ‘soort’

2. Mechanismen voor soortvorming

3. Mijlpalen van evolutie

Proefversie©VANIN

10 MODULE NANOMATERIALEN

Al meer dan 4 000 jaar gebruiken mensen (natuurlijke) nanomaterialen (heel kleine deeltjes met een grootte van 1 tot 100 nm) in onder andere de kunst en de geneeskunde. Bepaalde kleimineralen bevatten natuurlijke nanomaterialen, maar onderzoekers hebben vastgesteld dat synthetisch gemaakt loodsulfide, dat als haarverf gebruikt werd in het oude Egypte, ook nanokristallen bevat. De mensen waren op de hoogte van de specifieke eigenschappen, maar konden die nog niet verklaren.

` Wat zijn nanomaterialen?

` Waarvoor worden nanomaterialen gebruikt?

Proefversie©VANIN

` Welke risico’s zijn er verbonden aan het gebruik van nanomaterialen?

We zoeken het uit!

?

VERKEN

JE KUNT AL ...

• uitleggen dat materie is opgebouwd uit heel kleine deeltjes: moleculen, die zelf zijn opgebouwd uit atomen.

• toepassingen in verband brengen met concrete kunststoffen.

JE LEERT NU ...

Proefversie©VANIN

Als een nanodeeltje zo groot was als een voetbal …

… dan zou een virus zo groot zijn als een mens.

• op welke schaal je nanomaterialen moet situeren.

• toepassingen in verband brengen met nanomaterialen.

8 MODULE 10 VERKEN

MODULE 10

Nanomaterialen

Nanomaterialen worden ook weleens de ‘bouwstenen van de toekomst’ genoemd. Ze bieden ons de mogelijkheid om de wereld om ons heen op een revolutionaire manier te veranderen. In dit thema duik je in de nanowereld en ontdek je hoe kleine deeltjes een grote impact kunnen hebben.

LEERDOELEN

L De grootteorde van nanodeeltjes inschatten

L De indeling van nanomaterialen in 0D, 1D, 2D en 3D toepassen en toelichten in voorbeelden

L Voorbeelden van toepassingen van nanodeeltjes geven

L De vorming van nanomaterialen via bottom-up of top-down uitleggen

1 Wat zijn nanomaterialen?

Het prefix ‘nano-’ verwijst naar 10-9. Een nanometer is dus 10-9 meter. Nanomaterialen hebben minstens 1 dimensie in de grootteorde tussen 1 en 100 nm.

~ · 100 000 000

diameter nanodeeltje = 1 nm = 10-9 m

diameter honkbal = 12 cm = 12 · 10-2 m = 1,2 · 10-1 m

· 100 000 000

diameter aarde = 12 756 km = 13 · 106 m = 1,3 · 107 m

Aangezien nanodeeltjes zo klein zijn, is de verhouding tussen het contactoppervlak en het volume heel groot. Voor bijvoorbeeld katalysatoren is dat een enorm voordeel: je hebt immers een veel kleinere hoeveelheid nanokatalysatoren nodig in vergelijking met gewone katalysatoren om hetzelfde reactieve oppervlak te hebben.

contactoppervlak = 6 m2

Proefversie©VANIN

contactoppervlak = 12 m2

contactoppervlak = 24 m2

9 MODULE 10
Afb. 1 Als een nanodeeltje zo groot was als een honkbal, dan zou een honkbal zo groot zijn als de aarde.
~
1 m 1 m 0,5 m 0,5 m 0,25 m 0,25 m
Het volume is telkens 1 m3, maar het contactoppervlak neemt toe naarmate het volume meer verdeeld wordt over kleinere deeltjes.
Afb. 2

Er is geen strikte scheiding vanaf wanneer je werkelijk van een nanomateriaal spreekt. Typisch voor een nanomateriaal is dat het andere eigenschappen heeft dan een ‘gewone’ stof, maar vanaf welke afmetingen dat gebeurt, hangt af van stof tot stof. Zo kunnen er verschillen optreden in katalytische eigenschappen, maar ook verschillen in magnetische eigenschappen of elektrische geleidbaarheid zijn mogelijk.

0,1 nm watermolecule

goudnanodeeltje

koolstofnanobuis 5 nm diameter buckyball 1 nm benzeen 0,5 nm nanomaterialen

Afb. 3 Een aantal stoffen met hun afmetingen

rode bloedcel

muntstuk

Proefversie©VANIN

punt

tennisbal

Je kunt nanomaterialen nog verder indelen in 0D-, 1D-, 2D- en 3D-materialen. De nanomaterialen van de nuldimensie zijn de nanopartikels. 0D-materialen hebben geen enkele dimensie die ‘afwijkt’ van het nanoniveau. Met andere woorden: ze hebben nanoafmetingen in de x-, y- en z-richting. Eendimensionale nanomaterialen hebben 1 dimensie die ‘afwijkt’ van de nanoschaal. Bij 2D-nanomaterialen zijn er 2 dimensies die groter zijn dan de nanoschaal, en bij 3D-nanomaterialen zijn alle 3 de dimensies afwijkend. 3D-nanomaterialen kunnen bijvoorbeeld opgebouwd zijn uit nanokristallen of nanobuizen en vertonen vaak inwendig kenmerken van nanomaterialen.

goudnanodeeltje kwantumstip of kwantumdot

fullereenmetalen nanostaaf koolstof nanobuizen, metalen nanobuizen polymeer nanovezels, gouden nanodraad

grafeenbladen koolstof gecoate nanoplaten polykristalvormen dendrimeer liposomen

Afb. 4 Afhankelijk van hun afmetingen worden nanomaterialen ingedeeld in vier categorieën: 0D-, 1D-, 2D- en 3D-materialen.

10 MODULE 10
10-10 m 10-8 m 10-6 m 10-4 m 10-2 m 10-9 m 10-7 m 10-5 m 10-3 m 10-1 m
10
1 μm virus 100 μm haar 1 cm
nm
5 μm
1 mm
10 cm
0D 1D 2D 3D

De afmetingen van nanomaterialen zorgen ervoor dat ze veel licht verstrooien, wat resulteert in een schitterende kleurenpracht. Bij glas-in-loodramen mengt men metaalpoeder in gesmolten glas. Daardoor wordt het metaalpoeder heel fijn verdeeld, wat de prachtige kleuren van glas-in-loodramen veroorzaakt. Tegenwoordig gebruikt men die eigenschap in allerhande medische testen. Zo bevat de COVID-test goudnanodeeltjes (zie paragraaf 3.1). Maar ook de Nobelprijs van 2023 werd uitgereikt voor onderzoek naar de optische eigenschappen van nanomaterialen.

2 De productie van nanomaterialen

De productie van nanomaterialen kun je indelen in 2 grote groepen: de bottom-up- of top-downmanier. De bottom-upmanier is een chemische manier, waarbij atomen gecombineerd worden tot moleculen en vervolgens tot de gewenste nanostructuur. Bij de top-downmethode vertrek je van grotere structuren, die tot de gewenste afmetingen worden afgebroken. Dat is een fysisch proces.

nanoschaalstructuren clusters atomen fysisch proces

WEETJE

Proefversie©VANIN

chemische reactie

geheel onderdelen

TOP-DOWN BOTTOM-UP

Bij de afbraak van plastic, maar ook bij het gebruik ervan, komen er heel kleine deeltjes plastic in het milieu terecht. Een groot deel van die deeltjes bevinden zich op microschaal en zijn dus nog veel groter dan nanoplastics. Maar sommige plastics worden afgebroken tot op nanoniveau. De deeltjes die op die manier gevormd worden, zijn heel heterogeen van samenstelling, structuur, vorm en grootte. Daardoor hebben ze ook heel uiteenlopende eigenschappen, waardoor ze verschillen van kunstmatig gemaakte nanomaterialen. Met ‘nanomaterialen’ worden de kunstmatig geproduceerde nanodeeltjes bedoeld.

Losse atomen zijn geen nanomaterialen.

11 MODULE 10
WEETJE
Afb. 5 Een glas-in-loodraam Afb. 7 Microplastics behoren niet tot de nanomaterialen, omdat ze een heel heterogene samenstelling hebben. video: bottom-up en top-down Afb. 6 Er zijn 2 verschillende technieken om nanomaterialen te maken: top-down en bottom-up.

Zowel de microplastics als de plastics die tot op nanoniveau zijn afgebroken, vormen een heel groot probleem: ze komen in het milieu terecht en zijn heel moeilijk te verwijderen uit bijvoorbeeld water. Momenteel doet men onderzoek naar manieren om die verontreiniging uit het water te halen. Zo gebruikt men ijzernanodeeltjes (SPION’s of Super Paramagnetic Iron Nanoparticles) die speciaal behandeld zijn, zodat ze kunnen binden met het oppervlak van plasticdeeltjes. Wanneer die ijzerdeeltjes binden met plastic, vormen ze agglomeraten die men met behulp van magneten uit het water kan halen.

Proefversie©VANIN

3.1 Medische testen

Goudnanopartikels (0D-nanomateriaal) die vastgehecht zijn aan antilichamen, kunnen worden gebruikt in bijvoorbeeld de COVID-test. De antilichamen binden aan de spike-eiwitmoleculen van het virus. Wanneer dat gebeurt, zal de oplossing van kleur veranderen: doordat de antilichamen aan het virus binden, ontstaat er immers een veel groter deeltje, dat anders interageert met licht dan de veel kleinere goudantilichaamdeeltjes.

spike-eiwitmoleculen

virus goudnanopartikels

antilichamen

3.2 Antibacteriële eigenschappen

Zilvernanopartikels worden onder andere gebruikt vanwege hun antibacteriële eigenschappen. De zilvernanopartikels geven zilverionen vrij, die de celwand en het celmembraan van de bacterie verstoren. Eens ze in de cel zijn, kunnen die ionen onder andere de ribosomen denatureren en de eiwitsynthese afremmen. Maar ook de zilvernanopartikels zelf kunnen de celwand en het celmembraan denatureren. Vanwege die eigenschappen gebruikt men zilvernanopartikels in onder andere sportkleding (om zweetgeur te voorkomen), wasmachines en ziekenhuisuitrusting.

12 MODULE 10
WEETJE (VERVOLG)
Afb. 8 Met behulp van ijzernanodeeltjes (SPION’s) probeert men microplastics uit het water te halen.
3 Toepassingen
Afb. 9 De COVID-test maakt gebruik van goudnanopartikels die uitgerust zijn met antilichamen die kunnen hechten aan de spike-eiwitten van het virus.

3.3 Uv-blockers

Titaandioxide en zinkoxide zijn als nanopartikels aanwezig in zonnecrème. Anorganische deeltjes kunnen op 2 manieren interageren met licht: ze kunnen het licht absorberen of verstrooien Onderzoek heeft uitgewezen dat nanopartikels het uv-licht even goed absorberen als hun grotere versie (zie grafiek A). Maar door hun kleinere afmetingen verstrooien ze het zichtbare licht veel minder goed, waardoor de zonnecrème transparant is (zie grafiek B). Daarnaast speelt het relatief grotere contactoppervlak ook een rol: zonnecrème met nanopartikels is veel efficiënter.

% geabsorbeerd licht

% verstrooid licht

Grafiek A

50 nm ZnO-deeltjes 200 nm ZnO-deeltjes

Proefversie©VANIN

Grafiek B

380 λ (nm)

380

ULTRAVIOLET

λ (nm)

ZICHTBAAR LICHT

violet blauw groen geel oranje rood

Afb. 10 De deeltjes van 50 nm en die van 200 nm absorberen uv-licht even goed (grafiek A). De deeltjes van 50 nm verstrooien vooral licht met een heel kleine golflengte (uv-licht), terwijl de deeltjes van 200 nm vooral zichtbaar licht verstrooien (grafiek B).

De golflengte van ultraviolet licht is kleiner dan die van zichtbaar licht. Nanodeeltjes zullen anders interageren vmet zichtbaar licht dan met uv-licht.

zonnecrème

huid

nano-ZnOmicroformaat ZnO

Afb. 11 Hoe kleiner de deeltjes, hoe efficiënter ze als zonnecrème werken: er bereiken minder zonnestralen de huid.

13 MODULE 10
650
650 nm
380 nm

In wasmiddelen voor witte was worden vaak siliciumnanodeeltjes gebruikt als optische witmaker. Die deeltjes zijn fluorescerende stoffen: ze interageren met uv-licht en zenden blauw licht uit dat voor een wittere schijn zorgt. Maar ook de nieuwe generatie witmakers voor tanden zal uit nanodeeltjes bestaan.

3.4 Eetbare coatings

nanodeeltjes als witmakers

Proefversie©VANIN

In de voedingsindustrie zet men ook volop in op nanomaterialen. Zo doet men onderzoek naar eetbare coatings, die ervoor zorgen dat er geen kwaliteitsverlies is en voedsel langer bewaard kan worden. Die coatings zorgen er namelijk voor dat er onder andere geen vochtverlies is, maar ook dat er minder zuurstofgas bij het voedsel kan, zodat het voedsel minder snel oxideert en dus bederft. De coatings worden vaak van organische stoffen gemaakt, bijvoorbeeld van pectine of van etherische olie uit citroengras.

Men zet coatings niet alleen in om voedsel langer te bewaren. Sommige zaden worden voorzien van een nanocoating om ze minder vatbaar voor ziekten te maken. Zo garandeert men een betere opbrengst.

conventionele emulsie

bescherming tegen micro-organismen

bescherming tegen schadelijke stoffen

productie van nano-emulsies

bescherming tegen zonlicht

bescherming tegen schokken

minder verlies van CO 2 minder vochtverlies bescherming tegen O2

verhoogde bewaring verspreiden nano-emulsie

Afb. 13 Eetbare nanocoatings zorgen voor een betere bewaring van onder andere fruit.

14 MODULE 10
VOOR
NA
WEETJE
Afb. 12 In de toekomst zullen we waarschijnlijk nanodeeltjes gebruiken om tanden te bleken.

Aangezien de coatings ervoor zorgen dat we voedsel langer kunnen bewaren én dat we geen schadelijke sulfieten hoeven te gebruiken, dragen ze hun steentje bij aan een meer duurzame wereld. Toch maken veel mensen zich zorgen over het effect van nanomaterialen op het menselijk lichaam. Zijn de coatings zelf niet schadelijk? Of kunnen er misschien nanodeeltjes uit de coatings in het voedsel diffunderen? Veel onderzoekers zijn ermee bezig om antwoorden te vinden op die vragen.

3.5 Geheugenmateriaal

The sky is the limit gaat echt wel op voor nanomaterialen en nanotechnologie. Zo experimenteert men volop met nanogeheugenmateriaal. Zou het niet geweldig zijn als je na een botsing gewoon met je auto door een warme douche kon rijden en de deuken als sneeuw voor de zon verdwenen? Momenteel zijn er al brillen op de markt die gebruikmaken van nanogeheugenmateriaal.

Maar we moeten ook stilstaan bij de ethische kant. We weten nog altijd heel weinig over de mogelijke risico’s die nanomaterialen met zich meebrengen voor mens en milieu. Ook moeten we rekening houden met mogelijk misbruik van nanomaterialen in bijvoorbeeld wapens. Nanodeeltjes zouden explosies efficiënter kunnen laten verlopen. Nanosensoren zouden kunnen worden ingezet om heel nauwkeurig informatie te verzamelen, maar ze zouden ook wapens preciezer kunnen maken.

Proefversie©VANIN

15 MODULE 10
Afb. 14 Brillen uit nanogeheugenmateriaal zijn heel buigzaam. XX LABO

AAN DE SLAG

In welke grootte-orde situeren nanomaterialen zich?

a 1-10 nm

b 1-100 nm

c 100-1 000 nm

d > 1 000 nm

Welke eigenschap is voor nanomaterialen anders dan voor klassieke materialen?

a elektrische eigenschappen

b magnetische eigenschappen

c optische eigenschappen

d al de bovenstaande eigenschappen

Koolstofnanobuizen behoren tot de …

a 0D-materialen

b 1D-materialen

c 2D-materialen

d 3D-materialen

Wat is het grote voordeel van werken met een schaal met machten van 10 in plaats van met een klassieke ijking?

Lees de stellingen en vragen.

Neem een standpunt in.

Voer een debat en stel kritische vragen.

a Wil jij nanonaise op je bord? Die nanomayonaise smaakt hetzelfde als gewone mayonaise, maar bevat veel minder calorieën.

b Er moeten zo min mogelijk regels zijn rond nanotechnologie, want anders wordt de ontwikkeling ervan afgeremd.

Proefversie©VANIN

c Burgers moeten inspraak krijgen over het gebruik van nanotechnologie.

d Is nanotechnologie de nieuwe doping voor sporters?

16 MODULE 10 AAN DE SLAG
` Meer oefenen? Ga naar 1 2 3 4 5

KERNBEGRIPPEN

nanomaterialen

productie van nanomaterialen

toepassingen van nanomaterialen

NANOMATERIALEN

NOTITIES

• minstens 1 dimensie in de grootteorde van 1 nm tot 100 nm

• heel specifieke eigenschappen

• 0D-, 1D-, 2D-materialen: afhankelijk van het aantal dimensies waarin het materiaal van de nanoschaal afwijkt

• bottom-up

• top-down

• medische testen

Proefversie©VANIN

• antibacteriële eigenschappen

• uv-blockers

• eetbare coatings

• geheugenmateriaal

17 MODULE 10 THEMASYNTHESE
THEMASYNTHESE kennisclip

Proefversie©VANIN

KRACHT EN SNELHEIDSVERANDERING 11 MODULE

Je hebt het zeker al eens meegemaakt: in een bocht met de auto of op een pretparkattractie heb je het gevoel dat je bij een hoge snelheid uit de bocht gaat. Je lijkt een kracht te ondervinden die je naar buiten zwiert. Om dat te kunnen begrijpen, moet je op zoek gaan naar het verband tussen de krachten die op jou inwerken, en de beweging die je ervaart.

Proefversie©VANIN

` Hoe bewegen voorwerpen onder invloed van een kracht?

` Welke krachten werken er in op voorwerpen?

` Hoe kunnen bijzondere bewegingen worden beschreven?

We zoeken het uit!

1 MODULE 11
?

VERKEN

JE KUNT AL ...

• de positie en de verplaatsing bepalen;

• de snelheid berekenen;

• eenvoudige bewegingsgrafieken interpreteren;

• de effecten van een kracht omschrijven;

• de kracht als een vector voorstellen en gebruiken.

• bewegingsgrootheden berekenen en aflezen op grafieken;

• de wetten van Newton toepassen.

Proefversie©VANIN

JE LEERT NU ...

H1

• de begrippen ‘gemiddelde versnelling’ en ‘ogenblikkelijke versnelling’ omschrijven, bepalen en voorstellen;

• een krachtvector voorstellen;

• de wetten van Newton omschrijven;

• het effect van krachten op een voorwerp verklaren aan de hand van de tweede wet van Newton.

H2

• het verband tussen de oriëntatie van een kracht en een snelheidsverandering omschrijven en voorstellen;

• de x(t)-, vx(t)- en ax(t)-grafieken voor bijzondere rechtlijnige bewegingen lezen en gebruiken;

• de x(t)-, vx(t)- en ax(t)-functies voor bijzondere rechtlijnige bewegingen opstellen en toepassen;

• cirkelbewegingen beschrijven en verklaren;

• cirkelbewegingen met een constante omlooptijd kwantitatief uitwerken.

2 MODULE 11 VERKEN
F s F z F s F w F n v4 = 0 v1 F w F res

HOOFDSTUK 1

Kracht en beweging beschrijven

Proefversie©VANIN

Mensen, dieren, planeten, voorwerpen … bewegen. Maar wat is ‘bewegen’ precies en welk pad volgen ze? Welke eigenschappen hebben hun bewegingen? Om bewegingen te kunnen analyseren en vervolgens te optimaliseren voor sporters, vervoersmiddelen, technologische toepassingen …, moet je eerst een wetenschappelijke taal geven aan beweging.

Bij een beweging kan de snelheid veranderen doordat er krachten werken. Krachten kunnen de snelheid doen toenemen (de afstoot van een sprinter is bijvoorbeeld cruciaal om in beweging te komen) of afnemen (bijvoorbeeld als je op volle kracht met je fiets remt om te stoppen voor het verkeerslicht). Ook al kun je de krachten zelf niet zien, het effect van de krachten is wel merkbaar. Om de effecten te kunnen beschrijven, moet je nauwkeurig alle krachten in kaart brengen.

In de tweede graad bestudeerde je al krachten, beweging en het verband daartussen. In dit hoofdstuk geef je diepgaandere wetenschappelijke betekenis aan bewegingsbegrippen die je kent uit het dagelijks leven, en de inwerkende krachten. Je bestudeert het verband tussen kracht en versnelling door de wetten van Newton toe te passen.

LEERDOELEN

M De begrippen ‘gemiddelde versnelling’ en ‘ogenblikkelijke versnelling’ omschrijven, bepalen en voorstellen

M Een krachtvector voorstellen

M De wetten van Newton omschrijven

M Het effect van krachten op een voorwerp verklaren aan de hand van de tweede wet van Newton

1

1.1

Bewegingsgrootheden

Beweging

1

Een basketbal beweegt door de lucht nadat je hem weggooit: de positie van de bal verandert ten opzichte van de omgeving (lucht en grond).

2

Een man in een kajak beweegt op het water: de kajak verandert van positie ten opzichte van de omgeving (het water). De man is in rust ten opzichte van de kajak: zijn positie verandert niet ten opzichte van de kajak.

3

De aarde beweegt in een jaar rond de zon: de positie van de aarde verandert ten opzichte van de omgeving (de zon).

3 MODULE 11 HOOfDstUK 1
Afb.
Afb.
Afb.

Een voorwerp wordt vaak voorgesteld door een punt: het massapunt. Alle massa van het voorwerp ligt geconcentreerd in dat punt.

Een voorwerp is in beweging ten opzichte van een referentiepunt als de positie verandert ten opzichte van dat referentiepunt.

Het voorwerp is in rust als de positie niet verandert ten opzichte van het referentiepunt. Als het referentiepunt de aarde is, wordt dat referentiepunt (meestal) niet vernoemd.

VOORBEELD FIETSERS

Een vriendengroep fietst door de stad.

• De vriendengroep is in beweging ten opzichte van de gebouwen en de baan (die vasthangen aan de aarde). Het referentiepunt is de aarde. Je zegt kortweg dat de vriendengroep beweegt.

• Elke fietser is in rust ten opzichte van de eigen fiets. Het referentiepunt is in dit geval de eigen fiets. Eventuele kleine bewegingen (bv. de pedalen ronddraaien, vooroverbuigen …) worden verwaarloosd.

• De fietsers zijn in rust ten opzichte van elkaar als ze allemaal dezelfde snelheid hebben. Ze zijn in beweging ten opzichte van elkaar als ze elk een andere snelheid hebben. De andere fietsers zijn het referentiepunt.

Om een beweging te beschrijven, beschrijf je plaatsveranderingen. Die veranderingen kun je vaak rechtstreeks waarnemen.

Geen beweging, rustTrage horizontale beweging naar rechts

Snelle horizontale beweging naar links

▲ Afb. 5 Verschillende bewegingen van een wandelaar. Het referentiepunt is de aarde.

Om een beweging wetenschappelijk voor te stellen, gebruik je een model:

Verticale beweging omhoog

Proefversie©VANIN

• Je neemt aan dat het voorwerp star en onsamendrukbaar is: alle punten van het voorwerp zijn in rust ten opzichte van elkaar. Je kunt het voorwerp dan voorstellen door een massapunt.

• Het pad dat het massapunt volgt, noem je de baan. Je beperkt je in dit eerste hoofdstuk tot beschrijvingen van rechtlijnige of eendimensionale bewegingen. Dat zijn bewegingen waarbij de baan een rechte is.

• Je stelt de baan voor ten opzichte van een assenstelsel. Het assenstelsel is het referentiestelsel (met als oorsprong het referentiepunt). Voor een rechtlijnige beweging heb je maar één as nodig. Die noem je meestal de x-as. Je kunt de richting en de zin van de x-as kiezen. Meestal kies je: – een richting en zin volgens de beweging; – een oorsprong (vaak gekozen in het referentiepunt); – een gepaste schaalverdeling.

4 MODULE 11 HOOfDstUK 1
▲ Afb. 4 Fietsers in beweging

VOORBEELD BEWEGING VAN ROCKY

In de video zie je Rocky de hond bewegen op een skateboard. Je kunt die beweging wetenschappelijk voorstellen:

• Rocky wordt voorgesteld door een massapunt (de rode stipjes op de afbeelding)

• De baan is de verzameling van alle punten waar het massapunt langs komt. Je kunt de punten met een vast tijdsinterval ertussen aanduiden. Rocky volgt een rechte baan. Hij voert een rechtlijnige beweging uit.

• Het referentiepunt is een punt op het asfalt. Dat wordt voorgesteld door de oorsprong van een x-as.

Proefversie©VANIN

Een voorwerp is in rust of in beweging:

• In rust: de plaats verandert niet ten opzichte van een referentiepunt.

• In beweging: de plaats verandert ten opzichte van een referentiepunt.

Een beweging stel je voor door met massapunten een baan te tekenen die je weergeeft ten opzichte van een assenstelsel. Voor een rechtlijnige beweging is het assenstelsel beperkt tot een x-as.

5 MODULE 11 HOOfDstUK 1
0 1,00 m x (m) ▲ Afb. 6 Wetenschappelijke voorstelling van de beweging van Rocky video: Rocky

• Een scalaire grootheid heeft enkel een grootte.

• Een vectoriële grootheid heeft een grootte, een richting, een zin en een aangrijpingspunt.

1.2

Positie

A Positievector

Als een voowerp beweegt, verandert de positie van dat voowerp ten opzichte van een referentiepunt. Op elk tijdstip bevindt het voowerp zich op een bepaalde positie ten opzichte van dat referentiepunt.

Tijdstip is een scalaire grootheid met als SI-eenheid seconde. Het tijdstip wordt uitgedrukt ten opzichte van een gekozen nulpunt

Positie is een vectoriële grootheid. De positievector x is gedefinieerd als een vector met deze kenmerken:

• aangrijpingspunt: het referentiepunt;

• eindpunt: het massapunt;

• richting: volgens de as door het referentiepunt en het massapunt;

• zin: van het referentiepunt naar het massapunt, aangegeven door een pijlpunt;

• grootte |x|: aangegeven door de lengte van de pijl. De grootte van de positie heeft als SI-eenheid meter.

tijdstip t [t] = s positie x [x] = m

VOORBEELD POSITIEVECTOR VAN EEN BUS

Een bus rijdt op een horizontale rechte weg tussen twee haltes. Zijn beweging is weergegeven op de afbeelding aan de hand van het massapunt voor twaalf tijdstippen.

Proefversie©VANIN

Afb. 7 Positievectoren van een bus tussen twee haltes

De positievector is getekend voor het vijfde (x5) en zesde (x6) tijdstip. Beide vectoren zijn horizontaal naar links gericht. Uit de lengte van de pijlen en de schaalverdeling volgt: x5 = 52 m en x6 = 92 m.

Je kunt elke vector noteren met behulp van een eenheidsvector. Dat is een vector die aangrijpt in het referentiepunt en als grootte één heeft.

6 MODULE 11 HOOfDstUK 1
GROOTHEID MET SYMBOOL SI-EENHEID MET SYMBOOL
x (m) 0 x5 x6 Δx5-6 1 cm 20 m ▲

In één dimensie definieer je een x-as met dezelfde richting en zin als de beweging. De oorsprong van de as kies je in het referentiepunt. De richting en zin van de eenheidsvector e x kies je volgens de x-as. Het aangrijpingspunt kies je in de oorsprong van de as. Elke positievector kun je als volgt noteren: x = x · e x

De grootte |x| van de positievector x is altijd positief. Dat geeft informatie over de lengte, maar niet over de zin van de vector. Het getal x is de algebraïsche component of getalcomponent van de positievector x volgens de x-as. Dat noemt men vaak kortweg de x-coördinaat. De getalcomponent geeft informatie over de grootte en de zin van een vector. Voor rechtlijnige bewegingen komt de getalcomponent overeen met het getal dat je afleest op de x-as. Het is een positief getal (x = |x|) als de positie voorbij de oorsprong ligt (eenheidsvector en positievector hebben dezelfde zin), en een negatief getal (x = –|x|) als de positie vóór de oorsprong ligt (eenheidsvector en positievector hebben een tegengestelde zin).

VOORBEELD GETALCOMPONENTEN VAN POSITIEVECTOREN VAN EEN LIFT

Een lift kan van de ondergrondse garage naar de vijfde verdieping bewegen. Je kunt de beweging weergeven ten opzichte van de gelijkvloerse verdieping. De x-as en de bijbehorende eenheidsvector kies je verticaal naar boven. Je kiest het referentiepunt (de gelijkvloerse verdieping) als oorsprong.

LIFT BEVINDT ZICH TER HOOGTE VAN DE DERDE VERDIEPING

Proefversie©VANIN

LIFT BEVINDT ZICH TER HOOGTE VAN DE ONDERGRONDSE GARAGE

Ligging ten opzichte van referentiepunt positie x1 voorbij de oorsprongpositie x2 vóór de oorsprong Vectorvoorstelling

7 MODULE 11 HOOfDstUK 1
x (m) 5 4 3 2 1 5,0 0 -1 e x x1 x (m) 5 4 3 2 1 0 -1 e x x2 5,0 x-component x1 = 15,0 m x2 = –5,0 m Vectornotatie x1 · e x = 15,0 m · e x x2 · e x = –5,0 m · e x Grootte |x1| =
m| = 15,0 m |x2| = |–5,0 m| = 5,0 m x 0 x x e x x = x · ex, met |x| > 0 en x > 0 x 0 x x e x x = x · ex, met |x| > 0 en x < 0
|15,0

Een andere eenheid die vaak gebruikt wordt voor verplaatsing, is kilometer.

B Verplaatsing

Voorwerpen die bewegen, veranderen van positie. Om die verandering uit te drukken, moet je een onderscheid maken tussen de lengte van de baan en de afstand (in vogelvlucht) die effectief tussen het eind- en beginpunt ligt.

Een appel valt recht naar beneden. De lengte van de baan is even groot als het hoogteverschil.

De effectieve afstand tussen Leuven en Antwerpen (43 km) is een stuk korter dan de weg die je moet afleggen (50 km).

Een zwemmer zwemt 100 m in een olympisch zwembad van 50 m. Hij komt op hetzelfde punt aan en heeft zich dus strikt genomen niet verplaatst.

Voor een voorwerp dat een rechtlijnige beweging uitvoert, verandert de positie x volgens een rechte as. In de fysica ben je (meestal) geïnteresseerd in de verplaatsing tussen het begin- en eindpunt. De vectoriële grootheid verplaatsing is gedefinieerd als ∆x = xeind – xbegin

Voor een rechtlijnige beweging kun je dat als volgt schrijven:

∆x = xeind – xbegin

= xeind · e x – xbegin · e x

= (xeind – xbegin) · e x = ∆x · e x

De verplaatsingscomponent ∆x = xeind – xbegin geeft de verplaatsing in de x-richting weer. Dat is een positief getal als het systeem volgens de x-as beweegt (xeind > xbegin), en een negatief getal als het systeem tegengesteld aan de x-as beweegt (xeind < xbegin). Als het eindpunt samenvalt met het beginpunt (xeind = xbegin), is de verplaatsing nul. De SI-eenheid is meter.

De verplaatsingsvector ∆x is gedefinieerd als een vector met deze kenmerken:

• aangrijpingspunt: de beginpositie xbegin;

• richting: volgens de as door de aangrijpingspunten van xbegin en xeind;

• zin: volgens de bewegingszin (van de beginpositie xbegin naar de eindpositie xeind), aangegeven door de pijlpunt;

• grootte |Δx|: aangegeven door de lengte van de pijl.

instructiefilmpje: kopstaartmethode

Proefversie©VANIN

Het verschil van twee vectoren is de som van de eerste vector en het tegengestelde van de tweede vector. Voor de verplaatsing wordt dat:

Δx = xeind – xbegin = xeind + (–xbegin)

In het instructiefilmpje zie je hoe je de vector construeert met de kop-staartmethode.

8 MODULE 11 HOOfDstUK 1
▲ Afb.
▲ Afb. 8
Afb. 9
10
TIP

De positie van een massapunt ten opzichte van een referentiepunt beschrijf je met de positievector x. Dat is een vector met als aangrijpingspunt het referentiepunt en als eindpunt het massapunt.

In één dimensie geldt: x = x · e x Daarbij is:

• e x de eenheidsvector, met het aangrijpingspunt in het referentiepunt en met de richting en zin volgens de x-as (dat wil zeggen: volgens de richting en zin van de beweging);

• x de getalcomponent of x-component. Je kunt de getalcomponent aflezen op de x-as. De getalcomponent kan positief (posities voorbij de oorsprong) of negatief (posities vóór de oorsprong) zijn. De grootte |x| is altijd positief.

Je beschrijft de positieverandering van een rechtlijnige beweging aan de hand van de grootheid (met als SI-eenheid meter): verplaatsing ∆x: vector van positie xbegin tot positie xeind, met als verplaatsingscomponent

e x = (xeind – xbegin)

e x

Proefversie©VANIN

de x-as bewegen

aan de x-as bewegen

9 MODULE 11 HOOfDstUK 1
∆x ·
x xbegin xeind xbegin e x 0 xeind xbegin = xbegin · ex, met |xbegin| > 0 en xbegin > 0 xeind = xeind · ex, met |xeind| > 0 en xeind > 0 x xbegin xeind xbegin e x 0 xeind xbegin = xbegin · ex, met |xbegin| > 0 en xbegin < 0 xeind = xeind · ex, met |xeind| > 0 en xeind < 0 x xbegin xeind ∆x > 0 ∆x ∆x volgens
x xbegin x
∆x
0 tegengesteld
0 0
x:
x =
·
eind
<

Een tijdsinterval is een tijdsperiode tussen twee momenten in de tijd.

1.3 Snelheid

A Gemiddelde snelheid

Bij een beweging speelt niet enkel de positieverandering een rol, maar ook de tijd waarin die gebeurt.

De sprinter die honderd meter in de kortste tijd aflegt, wint.

Met de TGV ben je vanuit Brussel sneller in Parijs dan met de auto.

Het licht van de zon heeft ruim acht minuten nodig om de aarde te bereiken.

Bij een beweging verandert de positie van een systeem (ten opzichte van een referentiepunt) in functie van de tijd. In het tijdsinterval tussen de tijdstippen tbegin en teind is er een tijdsduur verstreken. De grootheid tijdsduur Δt = teind – tbegin is een scalaire grootheid. De SI-eenheid is seconde.

Bij een rechtlijnige beweging beweegt het systeem langs een rechte baan tussen de posities xbegin en xeind in een tijdsduur Δt.

Voor een rechtlijnige beweging is de gemiddelde snelheidscomponent <v x > gedefinieerd als de verhouding van de verplaatsingscomponent Δx tot de tijdsduur Δt:

<v x > = ∆x ∆t

De tijdsduur Δt is altijd positief. Het teken van de snelheidscomponent <v x > = ∆x ∆t wordt dus bepaald door het teken van de verplaatsingscomponent Δx. De gemiddelde snelheid is positief als het systeem volgens de x-as beweegt (Δx > 0), en negatief als het systeem tegengesteld aan de x-as beweegt (Δx < 0). Als het eindpunt samenvalt met het beginpunt (Δx = 0), is de gemiddelde snelheid nul.

GROOTHEID MET SYMBOOL

EENHEID MET SYMBOOL gemiddelde snelheidscomponent <v x > = ∆x ∆t

[<vx>] = m s vaak gebruikt: km h

Proefversie©VANIN

10 MODULE 11 HOOfDstUK 1
▲ Afb. 11 ▲ Afb. 12 ▲ Afb. 13

B Ogenblikkelijke snelheid

De gemiddelde snelheid geeft je informatie over de snelheid in een (lang) tijdsinterval. Je hebt daarbij geen informatie over de snelheid op elk moment van dat interval.

14

Een bestuurder wordt niet geflitst bij de trajectcontrole op de autosnelweg (max. 120 km h ): zijn gemiddelde snelheid is 115 km h . Tijdens het inhalen had hij een ogenblikkelijke snelheid van 140 km h .

15

De gemiddelde snelheid tijdens een Tourrit is 48 km h . Wanneer de renners een col beklimmen, zakt de ogenblikkelijke snelheid tot 20 km h

16

Na een rondje joggen is je gemiddelde snelheid 0 km h . Je smartwatch toont een topsnelheid van 11 km h

Proefversie©VANIN

Om een beweging in detail te bespreken, moet je de snelheid op elk moment kennen. Je kunt de ogenblikkelijke snelheid op een tijdstip t berekenen door de gemiddelde snelheid te bepalen voor een heel kleine tijdsduur (Δt 0).

Wiskundig betekent dat dat je de afgeleide van de plaatsfunctie naar de tijd neemt. Voor een rechtlijnige beweging kun je de getalcomponent vx(t) van de ogenblikkelijke snelheid op een tijdstip t als volgt berekenen:

vx(t) = lim

Δt 0

∆x(t)

∆t = dx(t) dt

De ogenblikkelijke snelheid v(t) op een tijdstip t is een vectoriële grootheid, die je voor een rechtlijnige beweging kunt noteren door de ogenblikkelijke snelheidscomponent te vermenigvuldigen met de eenheidsvector e x :

v(t) = dx (t) dt = dx(t) dt · e x = vx(t) · e x

In de praktijk wordt de ogenblikkelijke snelheid dikwijls kortweg de snelheid genoemd en, als er geen twijfel is over het tijdstip, genoteerd als v (eventueel met een index).

De ogenblikkelijke snelheidsvector v heeft deze kenmerken:

• aangrijpingspunt: het massapunt;

• richting: volgens de bewegingsrichting;

• zin: volgens de bewegingszin, aangegeven door de pijlpunt;

• grootte |v|: is in één dimensie de absolute waarde van de snelheidscomponent (|vx|), aangegeven door de lengte van de pijl. In het dagelijks leven lees je de grootte van de snelheid af op een snelheidsmeter of bereken je de snelheid voor een kleine tijdsduur Δt.

GROOTHEID MET SYMBOOL

EENHEID MET SYMBOOL ogenblikkelijke snelheid v(t) = vx(t) · e x = dx(t) dt · e x

[vx(t)] = m s vaak gebruikt: km h

11 MODULE 11 HOOfDstUK 1
▲ Afb.
▲ Afb.
▲ Afb.

VOORBEELD SNELHEIDSVECTOREN VAN DE PIZZABEZORGER

De pizzabezorger rijdt met verschillende (ogenblikkelijke) snelheden tijdens zijn rit. Je kunt de snelheid voor elk tijdstip voorstellen met een snelheidsvector.

Topsnelheid tijdens heenrit v1 Lagere snelheid door hinder van fietsers tijdens heenrit v2

Topsnelheid tijdens terugrit v3

Proefversie©VANIN

AANGRIJPINGSPUNT massapuntmassapuntmassapunt

RICHTING horizontaalhorizontaalhorizontaal

ZIN naar rechtsnaar rechtsnaar links

GROOTTE

SNELHEIDSCOMPONENT (x-AS NAAR RECHTS GEKOZEN)

SNELHEIDSVECTOR (x-AS NAAR RECHTS GEKOZEN) v1 = 40 km h

De gemiddelde snelheidscomponent van een rechtlijnige beweging is gedefinieerd als <v

De SI-eenheid is meter per seconde.

De gemiddelde snelheidscomponent is positief voor een beweging volgens de x-as en negatief voor een beweging tegengesteld aan de x-as.

De ogenblikkelijke snelheid van een rechtlijnige beweging wordt als volgt gedefinieerd:

v(t) = dx(t) dt · e x = vx(t) · e x

traag bewegen volgens de x-as

v1 e x 0

v1(t) = v1x(t) · e x met v1x(t) > 0

snel (|v2x(t)| > |v1x(t)|) bewegen, tegengesteld aan de x-as x v2 e x 0

v2(t) = v2x(t) · e x met v2x(t) < 0

12 MODULE 11 HOOfDstUK 1
km
40
h
40 km
|v2|
25 km h
v3| = 40 km h
|v1| =
h
=
|
v2 v
NOTATIE v1
3
v1x = 40 km h v2x = 25 km h v3x = –40 km h
e x v2
km
· e x v3 = –40 km h · e x
·
= 25
h
x > =
x
t
x

1.4 Versnelling

A Versnelde beweging

Bij de meeste bewegingen is de snelheid niet constant. De grootte, de richting of de zin van de snelheidsvector v verandert tijdens de beweging. Er is een verandering van bewegingstoestand. Zulke bewegingen zijn versnelde bewegingen.

17

De snelheidsgrootte neemt toe na het startschot.

19

18 ▲

De snelheid verandert van richting in de bocht.

De snelheidsgrootte neemt af na de finish.

Je kunt informatie over de snelheidsverandering bij een rechtlijnige beweging rechtstreeks afleiden uit de opeenvolgende posities van de massapunten

1 Versnelling: de opeenvolgende posities van de massapunten liggen steeds verder uit elkaar.

2 Constante snelheid: de opeenvolgende posities van de puntmassa’s liggen op gelijke afstand van elkaar.

3 Vertraging: de opeenvolgende posities van de massapunten liggen steeds dichter bij elkaar.

VOORBEELD DEELBEWEGINGEN VAN DE BUS

Uit de afstand van de massapunten leid je drie deelbewegingen van de bus af. x (m) 1 versnelling 3 vertraging 2 constante snelheid 0

▲ Afb. 20 Voorstelling van de drie deelbewegingen van de bus

• De bus versnelt bij het vertrek aan het zebrapad.

• De bus rijdt een stukje met een constante snelheid.

• De bus vertraagt voor de bushalte.

Proefversie©VANIN

Een versnelde beweging is een beweging waarbij de snelheidsvector v verandert.

13 MODULE 11 HOOfDstUK 1
▲ Afb.
Afb. Afb.

B Gemiddelde versnelling

Bij een veranderlijke beweging verandert de (ogenblikkelijke) snelheid van een systeem in functie van de tijd. In een tijdsduur Δt verandert de snelheid van het systeem van de snelheid vbegin tot veind.

De gemiddelde versnelling wordt gedefinieerd als de verhouding van de snelheidsverandering tot de tijdsduur Δv Δt

Proefversie©VANIN

Voor een rechtlijnige beweging wordt de gemiddelde versnellingscomponent <a x > gedefinieerd als de verhouding van de getalcomponent van de snelheidsverandering Δ

tot de tijdsduur Δ

GROOTHEID MET SYMBOOL SI-EENHEID MET SYMBOOL gemiddelde

versnellingscomponent

In het dagelijks leven gebruik je de begrippen ‘versnellen’ en ‘vertragen’. Om een beweging wetenschappelijk te beschrijven, gebruik je echter alleen de grootheid versnelling. De grootheid vertraging bestaat niet.

Voor een rechtlijnige beweging zijn er drie mogelijke bewegingen:

• ‘Versnellen’ betekent: de snelheidsgrootte neemt toe.

• ‘Vertragen’ betekent: de snelheidsgrootte neemt af.

• ‘Bewegen met een constante snelheid’ betekent: de snelheidsgrootte blijft gelijk.

Om de versnelling te berekenen, moet je de snelheidsverandering altijd in de SI-eenheid m s uitdrukken. De eenheid van versnelling is dan m s2

VOORBEELD POSITIEVE EN NEGATIEVE VERSNELLING

Een bus rijdt naar links. De x-as is naar links gekozen (positieve snelheidscomponenten vx).

• Een positieve gemiddelde versnellingscomponent <a x > = 2 m s2  betekent dat de snelheid van de bus toeneemt met 2 m s in een tijdsduur van 1 s. Als hij vertrekt, bereikt hij na 5 s een snelheid van 10 m s

• Een negatieve gemiddelde versnellingscomponent <a x > = –2 m s2  betekent dat de snelheid van de bus afneemt met 2 m s in 1 s. Als hij met een snelheid van 10 m s rijdt, staat hij na 5 s stil.

14 MODULE 11 HOOfDstUK 1
v x  = vx, begin – vx, eind
t: <a x > = Δv x Δt .
x
<a x > = Δv
Δt [<ax>] = m s2

VOORBEELDVRAAGSTUK

De bus vertrekt vanuit rust en bereikt na 11 s een snelheidsgrootte van 32 km h . Hij rijdt 15 s met die snelheid. Daarna moet hij afremmen voor de bushalte. Hij komt tot stilstand in 25 s.

1 Teken de snelheidsvectoren aan het begin en einde van elk van de drie deelbewegingen.

2 Bereken de gemiddelde versnellingscomponent tijdens elke deelbeweging. x (m) 1 versnelling 3 vertraging 2 constante snelheid 0 v1 = 0 v5 v8 v12 = 0

▲ Afb. 21 Een schematische voorstelling van het probleem

Gegeven:

• v1x = 0 km h

• v5x = 32 km h

• Δt1 = 11 s • v5x = v8x = 32 km h • Δt2 = 15 s

Gevraagd: • <a1x> = ? • <a2x> = ?

Oplossing: De basisformule is <a x > =

Proefversie©VANIN

• v8x = 32 km h

• v12x = 0 km h

• Δt3 = 25 s

v x

t , waarbij de eenheid m s2 is. Je moet de snelheden eerst omzetten naar m s : v5x = v8x = 32 km h = 32 3,6 m s = 8,9 m s

Je berekent voor elk tijdsinterval de gemiddelde versnelling.

<a1x> = ∆v1x ∆t

= 8,9 m s – 0 m s 11 s = 8,9 m s 11 s = 0,81 m s2

Reflectie: Bestudeer de berekende waarden.

• Klopt de eenheid?

8,9 m s – 8,9 m s 15 s = 0 m s 15 s = 0 m s2

Ja, m s2 is de eenheid van versnelling.

a3x> = ∆v3x ∆t3 = ∆v12x – ∆v

= 0 m s – 8,9 m s 25 s = –8,9 m s 25 s = –0,36 m s2

• Waarom heeft de gemiddelde versnellingscomponent van de volledige beweging weinig betekenis?

De begin- en eindsnelheidscomponent zijn nul, waardoor de gemiddelde versnellingscomponent ook nul is. Toch is de snelheid niet constant gedurende de beweging.

OPLOSSINGSSTRATEGIE

Schrijf de gegevens schematisch:

• Splits de beweging op in deelbewegingen.

• Teken de snelheidsvectoren voor het begin- en eindpunt van de verschillende deelbewegingen.

• Noteer de gegevens in symbolen voor elke deelbeweging.

15 MODULE 11 HOOfDstUK 1
• <a3x> = ?
1 = ∆v5x – ∆
1x ∆t1
<
∆v8x – ∆v5x ∆t2
∆t
v
a2x> =
v2x
t2 =
=
<
8x
3

C Ogenblikkelijke versnelling

De gemiddelde versnelling geeft je informatie over de versnelling in een (lang) tijdsinterval. Je hebt daarbij geen informatie over de versnelling op elk moment van dat interval.

Het moment dat het licht op groen springt, verandert de versnelling van de voetganger.

Een lift vertraagt bij aankomst en versnelt wanneer hij vertrekt aan elke verdieping.

Proefversie©VANIN

Een vliegtuig remt sterker af net na de landing dan net voor de landing.

Om een beweging in detail te bespreken, moet je de versnelling op elk moment kennen. Je kunt de ogenblikkelijke versnelling op een tijdstip t berekenen door de gemiddelde versnelling te bepalen voor een heel kleine tijdsduur (Δt  0).

Wiskundig betekent dat dat je de afgeleide van de snelheidsfunctie naar de tijd neemt. Voor een rechtlijnige beweging kun je de ogenblikkelijke versnellingscomponent ax(t) op een tijdstip t als volgt berekenen:

ax(t) = lim Δvx(t) Δt

= dvx(t) dt

De ogenblikkelijke versnelling a(t) op een tijdstip t is een vectoriële grootheid, die je voor een rechtlijnige beweging bekomt door de ogenblikkelijke versnellingscomponent te vermenigvuldigen met de eenheidsvector e x :

a(t) = dv(t) dt = dvx(t) dt · e x = ax(t) · e x

In de praktijk wordt de ogenblikkelijke versnelling dikwijls kortweg de versnelling genoemd en, als er geen twijfel is over het tijdstip, genoteerd als a (eventueel met een index).

De versnellingsvector a heeft deze kenmerken:

• aangrijpingspunt: het massapunt;

• richting: volgens de x-as;

• zin: aangegeven door de pijlpunt:

– versnelling: zelfde zin als de snelheid op dat moment; v x en a x hebben hetzelfde teken; – vertraging: tegengestelde zin als de snelheid op dat moment; v x en a x hebben een tegengesteld teken;

• grootte |a|: de absolute waarde van de versnellingscomponent (|ax|), aangegeven door de lengte van de pijl.

GROOTHEID MET SYMBOOL

SI-EENHEID MET SYMBOOL ogenblikkelijke versnelling(svector) a(t) = ax(t) · e x = dvx(t) dt · e x [ax(t)] = m s2 Δt 0

16 MODULE 11 HOOfDstUK 1
▲ Afb. 22 ▲ Afb. 23 ▲ Afb. 24

VOORBEELD VERSNELLINGSVECTOR VAN DE PIZZABEZORGER

De pizzabezorger versnelt en vertraagt zowel tijdens de heen- als tijdens de terugrit. Zijn ogenblikkelijke versnelling verschilt in grootte, maar ook in teken.

1 Hij vertrekt aan de pizzeria tijdens de heenrit.

De snelheid is gericht volgens de x-as en neemt toe:

• De versnellingsvector a heeft dezelfde zin als de snelheidsvector v.

• De snelheidscomponent v x en de versnellingscomponent a x zijn positief.

Proefversie©VANIN

2 Hij stopt aan het huis tijdens de heenrit.

De snelheid is gericht volgens de x-as en neemt af:

• De versnellingsvector a heeft een tegengestelde zin als de snelheidsvector v

• De snelheidscomponent v x is positief en de versnellingscomponent a x is negatief.

a x > 0 en v x > 0, dus versnelling e x e x

3 Hij vertrekt op zijn gemak aan het huis tijdens de terugrit.

De snelheid is gericht tegen de x-as in en neemt langzaam toe:

a x < 0 en v x > 0, dus vertraging

• De versnellingsvector a heeft dezelfde zin als de snelheidsvector v

• De snelheidscomponent v x en de versnellingscomponent a x zijn negatief.

a x < 0 en v x < 0, dus versnelling

4 Hij remt heel bruusk voor het rode licht tijdens de terugrit.

De snelheid is gericht tegen de x-as in en neemt sterk af.

• De versnellingsvector a heeft een tegengestelde zin als de snelheidsvector v

• De snelheidscomponent v x is negatief en de versnellingscomponent a x is positief. a = a x

a x > 0 en v x < 0, dus vertraging

17 MODULE 11 HOOfDstUK 1
a = a x · e x vbegin = vx, begin · e x veind = vx, eind · e x x
a = a x · e x vbegin = vx, begin · e x veind = vx, eind · e x x
·
x vbegin = vx, begin · e x v
vx,
· e x x
a = a x
e
eind =
eind
x v
· e x v
· e x x
· e
begin = vx, begin
eind = vx, eind
x e
e
x

Bij een versnelde beweging verandert de snelheid v Voor een rechtlijnige versnelde beweging verandert de snelheidsgrootte |v|.

De gemiddelde versnellingscomponent van een rechtlijnige beweging wordt gedefinieerd als <a x > =  Δv x Δt . De SI-eenheid is meter per seconde in het kwadraat ( m s2 ).

Voor een beweging in de richting en zin van de x-as is de gemiddelde versnellingscomponent positief bij een versnelling en negatief bij een vertraging.

De ogenblikkelijke versnelling van een rechtlijnige beweging is een vector.

versnellen (a en v hebben dezelfde zin) volgens de x-as

vbegin veind

Proefversie©VANIN

a(t) = ax(t) · e x met ax(t) > 0 (en vx(t) > 0)

vertragen (a en v hebben een tegengestelde zin) volgens de x-as

vbegin veind

a(t) = ax(t) · e x met ax(t) < 0 (en vx(t) > 0)

18 MODULE 11 HOOfDstUK 1
a x
a x

2 Wetten van Newton

2.1 Krachtvector

Om een voorwerp van snelheid of vorm te laten veranderen, is er een kracht nodig. De kracht wordt uitgeoefend door een voorwerp op een ander voorwerp. De kracht die uitgeoefend wordt, kun je niet rechtstreeks zien. Alleen het effect van de kracht is zichtbaar.

Een persoon oefent een kracht uit op de band.

Je ziet de inspanning, maar de duwkracht zie je niet.

Een kind beweegt op en neer door de zwaartekracht (uitgeoefend door de aarde) en de veerkracht (uitgeoefend door het elastiek).

Je kunt de uitgeoefende kracht voorstellen door de krachtvector F. Kracht is een vectoriële grootheid, die je kunt voorstellen met vier kenmerken:

• aangrijpingspunt: het punt van het voorwerp waar de kracht op inwerkt;

• richting: de oriëntatie van de rechte die je door de vector kunt tekenen;

• zin: de kant waarnaar de pijlpunt wijst;

• grootte |F|: de getalwaarde van de kracht, aangegeven door de lengte van de pijl. Dat is in één dimensie de absolute waarde van de krachtcomponent (|Fx|).

GROOTHEID MET SYMBOOL

SI-EENHEID MET SYMBOOL kracht F newton [F] = N

De uitwerking van een kracht wordt bepaald door alle kenmerken van de krachtvector. Door de kracht kan een voorwerp van vorm veranderen (statisch effect) of van snelheid veranderen (dynamisch effect). Een star voorwerp heeft een vaste vorm en kan dus enkel van snelheid veranderen door de inwerkende kracht.

WEETJE

Om de uitwerking van de kracht te bestuderen, is ook de oriëntatie van de kracht ten opzichte van de baan belangrijk. Meer specifiek zijn de component volgens de baan en de loodrechte component van belang. Op leer je hoe je die componenten vindt.

Proefversie©VANIN

19 MODULE 11 HOOfDstUK 1
▲ Afb. 25 ▲ Afb. 26

OPLOSSINGSSTRATEGIE

Om de loodrechte krachtcomponenten te kennen, gebruik je de projectiemethode:

• Je kiest een assenstelsel: de x-as volgens de baan, de y-as loodrecht op de baan.

• Je projecteert de kracht op beide assen.

Je bekomt twee loodrechte vectoren en kunt de kracht noteren als F = F x · e x + F y · ey, waarbij de onderschriften verwijzen naar de as.

Proefversie©VANIN

• De grootte van de krachtcomponenten kun je berekenen met de definities van cosinus en sinus. Het teken van de component wordt bepaald door de oriëntatie van de projectie ten opzichte van de eenheidsvector (positief bij een gelijke oriëntatie, negatief bij een tegengestelde oriëntatie). Voor de eenvoud zullen we in dit leerboek de grootte van de krachtcomponenten geven.

• Opgepast: de vectoren staan loodrecht op elkaar. Het verband tussen de grootte van de kracht en de grootte van de componenten vind je via de stelling van Pythagoras: F2 = F2 x + F2 y (en NIET F = F x + Fy)

Op de meeste voorwerpen werken meerdere krachten. Je kunt al die krachten optellen.

De vectorsom noem je ook de resulterende kracht(vector) of resultante. De kenmerken van de resultante worden bepaald door de onderlinge ligging van de vectoren.

De samenstelling van verschillende krachten die op een systeem inwerken, noem je de resulterende kracht Fres. Het is de som van alle krachten (F1, F2 … Fn) die inwerken op een systeem.

In symbolen: F res = F 1 + F2 + ... + F n

De snelheidsverandering wordt bepaald door de resulterende kracht. Je bestudeert dat in de volgende paragrafen.

20 MODULE 11 HOOfDstUK 1
x α F y · e y F x · e x e x e y F y

VOORBEELD KRACHTEN DIE INWERKEN OP EEN SLEE

De beweging van de slee (zie afbeelding XXX) wordt bepaald door de resulterende kracht van alle krachten die erop inwerken:

F res = F 1 + F2 + F3 + F4 + F 5

Daarbij is F 1 de zwaartekracht, F2 de normaalkracht, F3 een trekkracht, F4 een duwkracht en F5 de wrijvingskracht.

Proefversie©VANIN

In de x-richting (x-as horizontaal naar links) geldt:

res, x = F3x + F4 – F 5

In de y-richting (y-as verticaal naar boven) geldt: F res, y = F2 – F 1 + F 3y

Afb. 27 Op de slee werken verschillende krachten. De resulterende kracht is een samenstelling van alle krachten.

Herbekijk op hoe je vectoren optelt.

Een kracht veroorzaakt een vorm- of snelheidsverandering. Voor een star voorwerp verandert de snelheid als er een resulterende kracht op inwerkt. Je kunt de kracht enkel door haar effect zien en dus niet rechtstreeks. Kracht is een vectoriële grootheid.

GROOTHEID MET SYMBOOL

SI-EENHEID MET SYMBOOL

kracht F newton [F] = N

Elke kracht kun je ontbinden in loodrechte componenten: F = F x · e x + F y · e y Als er meerdere krachten inwerken op een voorwerp, is de resulterende kracht als volgt gedefinieerd:

F res = F 1 + F2 + F3 + …

21 MODULE 11 HOOfDstUK 1
F 1 F 5 F4 F
F
3
2
F
x α F y · e y F x · e x e x e y F y
TIP

2.2 Eerste wet van Newton DEMO

Hoe groot is de resulterende kracht bij rust en bij een beweging met een constante snelheid?

1 Je leerkracht hangt een blokje op aan een dynamometer. De kracht wordt opgemeten bij rust en bij een beweging met een constante snelheid (omhoog en omlaag).

Proefversie©VANIN

2 Hoe groot zal de afgelezen kracht zijn in de drie situaties?

Bespreek met je buur en test uit.

3 Formuleer een antwoord op de onderzoeksvraag. Teken de inwerkende en de resulterende kracht.

Als de resulterende kracht op een voorwerp nul (F res = 0) is, dan verandert de snelheid van het voorwerp niet:

1 Een voorwerp in rust blijft in rust

2 Een voorwerp dat met een snelheid v beweegt, blijft met dezelfde snelheid v (grootte, richting en zin) bewegen.

Dat is de eerste wet van Newton. De wet geldt ook omgekeerd: als een voorwerp in rust is of met een constante snelheid beweegt, dan is de resulterende kracht op dat voorwerp gelijk aan nul.

VOORBEELD FIETSEN MET EEN CONSTANTE SNELHEID

Als je tijdens een fietstocht op een vlakke weg stopt met trappen, vertraag je (door de krachten die worden uitgeoefend door de ondergrond en de wind). Om met een constante snelheid te fietsen, moet je een spierkracht uitoefenen, zodat de resulterende kracht nul is (F res = 0).

In de horizontale richting blijft je snelheid v constant. In de verticale richting ben en blijf je in rust.

22 MODULE 11 HOOfDstUK 1
demovideo: eerste wet van Newton
XX LABO
Afb. 28 Om een constante snelheid te hebben, moet je blijven trappen.

Om de snelheid van een voorwerp te veranderen, is er een kracht nodig. De neiging om de bewegingstoestand te bewaren, noem je de traagheid of inertie van een voorwerp. Daarom heet die wet, die voor het eerst zo geformuleerd werd door Isaac Newton, ook de traagheidswet of inertiewet.

Hoe groter de massa van een voorwerp, hoe moeilijker de snelheid (grootte, richting of zin) te veranderen is. Voorwerpen met een grotere massa hebben een grotere traagheid of inertie.

VOORBEELD VEILIGHEIDSGORDEL

Tijdens een autorit bereik je hoge snelheden. Als je met een constante snelheid rijdt, ervaar je de snelheid niet: je bent in rust ten opzichte van de auto. Bij een bruuske beweging (hard remmen of een botsing) ondervindt de auto een kracht, maar jij ondervindt die kracht niet. Je blijft door traagheid met een constante snelheid (en dus op een rechte baan en met dezelfde snelheidsgrootte) verder bewegen. Zonder veiligheidsgordel kun je tegen het raam van de auto gekatapulteerd worden. Door de veiligheidsgordel blijf je aan de stoel bevestigd en beweeg je mee met de auto. De veiligheidsgordel zorgt ervoor dat de kracht die op de auto werkt, op jou wordt overgedragen.

Proefversie©VANIN

Eerste wet van Newton (traagheidswet): als de (resulterende) kracht op een voorwerp nul is, dan verandert de snelheid v van het voorwerp niet. Omgekeerd geldt: als een voorwerp in rust is of met een constante snelheid beweegt, dan is de resulterende kracht op dat voorwerp nul.

2.3 Tweede wet van Newton

Door de zwaartekracht ondervindt de bungeespringer net na de sprong een versnelling naar beneden.

Om de volle kar (grote massa) in beweging te brengen, is een grote kracht nodig.

Vrachtwagens vertragen moeilijk door hun grote massa. Om ongevallen te voorkomen, zijn de snelheidsbeperkingen strikter voor vrachtwagens.

23 MODULE 11 HOOfDstUK 1
▲ Afb. 30 ▲ Afb. 31 ▲ Afb. 32
Bekijk de werking van een veiligheidsgordel in de video. ▲ Afb. 29 Een veiligheidsgordel zorgt ervoor dat je mee afremt met de auto. XX LABO FMarwan a

Dat de constante 1 is, volgt uit de definitie van de eenheid van kracht: een kracht die een voorwerp van 1 kg versnelt met een versnelling van 1 m s2 , heeft een grootte van 1 newton.

De definitie stamt pas uit 1946 en werd dus niet door Newton bepaald.

Als er een resulterende kracht F res op een voorwerp werkt, is er een dynamisch effect van de kracht: de bewegingstoestand verandert. De snelheid v verandert: er is een versnelling a. Hoe kleiner de massa m, hoe gemakkelijker het voorwerp versnelt. Omgekeerd, hoe groter de massa m, hoe moeilijker het voorwerp versnelt. Uit experimenten blijkt:

De versnelling neemt recht evenredig toe met een toenemende resulterende kracht.

|a| ~ |Fres|

De versnelling als gevolg van een resulterende kracht is omgekeerd evenredig met de massa.

|a| ~ 1 m

|a| = constante · |Fres| m

Proefversie©VANIN

definiëring: constante gedefinieerd als 1

|a| = |Fres| m

Het verband tussen de resulterende kracht en de versnelling kun je als volgt noteren:

|Fres| = m · |a|

Zowel de versnelling als de kracht is een vectoriële grootheid. Het verband F res = m · a geldt ook vectorieel:

F res = m · a

Dat is de tweede wet van Newton. De eenheid newton is een afgeleide eenheid. Via de tweede wet van Newton vind je de basiseenheden terug:

[Fres] = [m] · [a], dus 1 N = 1 kg · 1 m s2 = 1 kg · m s2

VOORBEELD WINKELKAR DUWEN

Je moet harder duwen tegen een volle winkelkar om de kar in beweging te krijgen dan tegen een lege winkelkar. Als de kar in beweging is, moet je meer kracht uitoefenen op een volle kar om ze tot stilstand te brengen.

Marwan oefent een kracht van 140 N uit om de volle winkelkar van 70 kg in beweging te brengen. De versnellingsgrootte is |a| = |FMarwan| m = 140 N 70 kg = 2,0 m s2

Noa moet slechts een kracht van 20 N uitoefenen om een kar van 10 kg dezelfde versnellingsgrootte te geven:

|a| = |FNoa| m = 20 N 10 kg = 2,0 m s2

Tweede wet van Newton: het verband tussen de resulterende kracht en de versnelling wordt gegeven door: F res = m · a.

24 MODULE 11 HOOfDstUK 1
FMarwan a a FNoa m =
kg m = 10 kg
70

2.4 Derde wet van Newton

Welke kracht oefenen twee systemen op elkaar uit?

1 Houd met twee leerlingen twee dynamometers vast, zoals op de afbeelding. Trek elk aan de dynamometers. Varieer de uitgeoefende kracht.

Proefversie©VANIN

▲ Afb. 33 Krachten van systemen op elkaar worden gemeten met twee dynamometers.

2 Welke uitspraak is correct volgens jou?

a De afgelezen krachten zijn op beide dynamometers altijd nul.

b De afgelezen krachten zijn op beide dynamometers altijd gelijk.

c De afgelezen kracht is het grootst bij degene die het hardst trekt.

Bespreek met je buur en test uit.

3 Formuleer een antwoord op de onderzoeksvraag.

Als een voorwerp A een kracht FAB uitoefent op een voorwerp B, dan oefent voorwerp B een even grote, maar tegengestelde kracht FBA uit op voorwerp A. In symbolen: FAB = –FBA

Dat is de derde wet van Newton. De kracht FAB is de actiekracht, de kracht FBA de reactiekracht.

Die wet wordt ook de wet van actie en reactie genoemd.

De twee krachten (die elk op een ander voorwerp inwerken en dus een ander aangrijpingspunt hebben) noem je een actie-reactiepaar. De kracht FAB grijpt aan op voorwerp B. De kracht FBA grijpt aan op voorwerp A.

VOORBEELD DERDE WET VAN NEWTON BIJ RUST EN BEWEGING

Afb. 34

Een studente op een stoel oefent een kracht uit op de stoel. De stoel oefent een even grote, tegengestelde kracht uit op de studente.

Afb. 35

Een kind op een springbal oefent bij de botsing een kracht uit op de grond. De grond oefent een even grote, tegengestelde kracht uit, die een versnelling (omkering van de snelheidszin) veroorzaakt.

Afb. 36

Bij het peddelen oefent de peddel een kracht naar achteren uit op het water. Het water oefent een even grote, tegengestelde kracht uit, waardoor de plank vooruitgaat.

25 MODULE 11 HOOfDstUK 1
DEMO
0,1 N 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 0,1 N 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9

Je kunt een lancering bekijken in deze video.

VOORBEELD RAKETSTUWING

Om de snelheid van een raket te veranderen, gebruikt men stuwmotoren. Tijdens de lancering neemt de snelheidsgrootte van de raket toe. De raket oefent (door de verbrandingsmotoren) een kracht uit op de verbrandingsgassen, die daardoor naar buiten worden geduwd. Dat is de actiekracht. De uitgestoten gassen oefenen op hun beurt een kracht uit op de raket en zorgen voor de voortstuwing van de raket. Dat is de reactiekracht.

Proefversie©VANIN

Fgas-raket

De raket wordt voortgestuwd.

▲ Afb. 37 De werking van een stuwmotor

Fraket-gas

Fgas-raket = kracht die het gas uitoefent op de raket

Fraket-gas = kracht die de raket uitoefent op de verbrandingsgassen

• Actiekracht uitgeoefend door de raket op de gassen: Fraket-gas (met als aangrijpingspunt het gas).

• Reactiekracht uitgeoefend door de gassen op de raket: Fgas-raket (met als aangrijpingspunt de raket).

Volgens de derde wet van Newton geldt:

Fgas-raket = –Fraket-gas

Ook in het luchtledige werken die krachten, waardoor de raket kan worden bijgestuurd: de snelheid verandert van grootte of van richting. De actie- en reactiekracht hebben een verschillend aangrijpingspunt en werken dus elk op een ander voorwerp in. De versnelling van die twee systemen als gevolg van de inwerkende actie- en reactiekracht verschilt, omdat de versnelling wordt bepaald door de massa van die voorwerpen:

• Uit de derde wet volgt: |FAB| = |FBA|.

• Gecombineerd met de tweede wet van Newton wordt dat:

mB · |aB| = mA · |aA| of mB mA = |aA| |aB|

Dat betekent dat het voorwerp met de grootste massa de kleinste versnelling ondervindt en omgekeerd.

26 MODULE 11 HOOfDstUK 1

VOORBEELD VERSNELLING VAN DE AARDE

• Een vallende appel (massa mappel) ondervindt de zwaartekracht uitgeoefend door de aarde Faarde-appel = mappel · g en heeft daardoor een versnelling g

• De aarde (massa maarde) ondervindt een (even grote, maar tegengestelde) kracht uitgeoefend door de appel Fappel-aarde = maarde · a en heeft daardoor een versnelling a.

Uit de derde wet van Newton volgt:

• Faarde-appel (op appel) = –Fappel-aarde (op aarde)

• De grootte mappel · g = maarde · |a|

→ |a| = mappel maarde · g ≈ 0

Die versnelling van de aarde is nauwelijks merkbaar, omdat de massa van de aarde veel groter is dan de massa van de appel.

Je kunt de versnellingsgrootte van de aarde berekenen:

|a| = mappel maarde · g = 0,100 kg 5,97 1024 kg kg · 9,81 m s2 = 1,6 · 10–23 m s2

Proefversie©VANIN

Je leerde g kennen als de zwaarteveldsterkte met als grootte g = 9,81 N kg Uit de definitie van de eenheid newton volgt: g = 9,81 m s2 . Je noemt dat de valversnelling. Dat is een positief getal.

Derde wet van Newton (actie-reactiewet): als een systeem A een kracht FAB uitoefent op een systeem B, dan oefent systeem B een even grote, maar tegengestelde kracht FBA uit op systeem A.

In symbolen: FAB = –FBA

De drie natuurwetten werden in 1687 door Isaac Newton geformuleerd in zijn boek Philosophiae Naturalis Principia Mathematica (Wiskundige beginselen van de natuurfilosofie). De traagheidswet werd voor het eerst geformuleerd door Galileo Galilei (1564-1642). Hij voerde daarvoor een gedachte-experiment uit om wrijving te kunnen uitsluiten.

Dankzij technologische innovaties kunnen we vandaag wrijving uitsluiten: in het ISS zijn voorwerpen niet ondersteund, waardoor ze geen wrijving van een oppervlak ondervinden.

De NASA heeft in het ISS de wetten van Newton onderzocht.

Je kunt het experiment van Galilei bekijken in de video.

Je kunt de STEMonstrationsvideo’s van NASA bekijken.

27 MODULE 11 HOOfDstUK 1
▲ Afb. 38 Een actie-reactiekoppel van de gravitatiekracht tussen de aarde en een appel Faarde-appel Fappel-aarde WEETJE ▲ Afb. 39 Een replica van de binnenkant van het ISS

3 Versnelling berekenen

De tweede wet van Newton geeft het vectoriële verband tussen de resulterende kracht en de versnelling: F res = m · a

VERDIEPING

Bij de beweging van voorwerpen spelen de zwaartekracht Fz, de normaalkracht F n en de wrijvingskracht F w een rol. Je leerde die krachten al kennen in de tweede graad. Je vindt die herhaling terug op

Proefversie©VANIN

Als er meerdere krachten inwerken, hebben ze vaak een verschillende richting. Om de versnelling in elke richting te kennen, kun je de wet van Newton toepassen in componenten door de krachten op te splitsen in componenten.

Dat doe je door ze te projecteren op een x-as volgens de beweging (tangentiële component) en op een y-as loodrecht op de beweging (normale component): in x-richting: F res, x = F 1, x + F

in y-richting: F

Voor rechtlijnige bewegingen is de versnelling a y = 0 m s2 , omdat het systeem in rust is in de y-richting.

OPLOSSINGSSTRATEGIE

1 Bepaal het voorwerp dat je wilt bestuderen. Hulpvraag: welk voorwerp versnelt?

2 Ga op zoek naar alle (uitwendige) krachten die inwerken op het voorwerp.

Hulpvraag: wie/wat oefent de kracht uit OP het voorwerp?

3 Teken een krachtenschema met alle krachten in een punt dat het voorwerp voorstelt.

4 Schrijf de tweede wet van Newton in vectoriële vorm en pas die toe op het voorwerp.

5 Kies een assenstelsel: voor rechtlijnige bewegingen x-as volgens de bewegingsrichting, y-as er loodrecht op.

6 Projecteer de vectorvergelijking: noteer de tweede wet van Newton met componenten voor elke as.

7 Los het stelsel van vergelijkingen op. Dat houdt in dat je evenveel vergelijkingen als onbekenden moet hebben!

28 MODULE 11 HOOfDstUK 1
m · a x
res, y = F 1, y + F 2, y + F 3, y + ... = m · a y
2, x + F 3, x + ... =
F z F z F s F s F s F w F w F n F n x y e x e y ▲ Afb. 40
Een systeem kiezen en een krachtenschema opstellen

VOORBEELD NORMAALKRACHT IN VERSCHILLENDE SITUATIES

Op elk ondersteund systeem werken de zwaartekracht (in het zwaartepunt) en de normaalkracht (in het contactpunt).

We tekenen het krachtenschema en berekenen de normaalkracht voor enkele voorbeelden.

Proefversie©VANIN

Deze voorwerpen zijn in rust in de richting loodrecht op het oppervlak. Je kiest de y-as naar beneden.

29 MODULE 11 HOOfDstUK 1
F z F n F z, y · e y F z F n α α
▲ Afb. 41 Een sinaasappel op een horizontaal oppervlak ▲ Afb. 42 Een skiër op een helling
F z, y + F n, y = |Fg| – |Fn| F z, y + F n, y = |Fg| – |Fn| |Fn| = |Fg| |Fn| =
Fg|
|

VOORBEELDVRAAGSTUK

Harald duwt horizontaal tegen een doos (m = 8,0 kg).

Bij 50,0 N komt de doos in beweging en versnelt ze.

De wrijvingskracht heeft een grootte van 30,0 N.

1 Teken alle krachten die inwerken op de doos op een figuur en in een krachtenschema.

2 Bereken de grootte van de krachten die niet gegeven zijn.

3 Bepaal de versnelling (grootte, richting en zin) van de doos.

Gegeven:

Proefversie©VANIN

• m = 8,0 kg

• Fduw = 50,0 N

• F w = 30,0 N

Gevraagd: 1 alle krachten die inwerken op de doos

2 |Fz| = ?; |Fn| = ?

3 a = ?

Oplossing: 1 Op de doos werken de zwaartekracht Fz, de duwkracht Fduw, de normaalkracht F n en de wrijvingskracht F w in.

Je kiest een x-as volgens de beweging en een y-as verticaal omhoog.

2 De duwkracht Fduw en de wrijvingskracht F w zijn gegeven.

Je moet de zwaartekracht F z en de normaalkracht F n nog bepalen.

De doos is in de y-richting in rust, dus: F res, y = F z, y + F n, y = |Fz| – |Fn| =0

Dat betekent:

|Fn| = |Fz| = m · g = 8,0 kg · 9,81 N kg = 78 N

30 MODULE 11 HOOfDstUK 1
F
n Fduw F w F z F n Fduw F y F x x y
FIGUUR
KRACHTENSCHEMA
w F z F

3 De tweede wet van Newton wordt:

F res = m · a

De doos versnelt in de x-richting door de duwkracht (die wordt tegengewerkt door de wrijvingskracht). Je vindt die versnelling door de tweede wet van Newton te noteren voor de x-richting.

De resulterende kracht is:

F res, x = Fduw, x + F w, x = |Fduw| – |Fw| = 50,0 N – 30,0 N = 20,0 N

De versnellingscomponent is dan:

a x = F res, x m = 20,0 N 8,0 kg = 2,5 N kg = 2,5 m s2

In de y-richting is de versnelling nul en a x is een positief getal, dus de versnelling heeft dezelfde richting en zin als de x-as (horizontaal, naar rechts).

Reflectie: Noteer de versnelling met eenheidsvector a = 2,5 m s2 · e x (horizontaal, naar rechts).

Hoe zou je de resulterende kracht F res tekenen?

Horizontaal naar rechts, met als lengte het verschil tussen de lengte van Fduw en F w

VOORBEELDVRAAGSTUK

Brick (m = 70,0 kg) neemt de lift van de gelijkvloerse tot de zesde verdieping. De lift versnelt bij het vertrek (|avertrek| = 2,00 m s2 ) en remt af net voor de aankomst (|aaankomst| = 1,00 m s2 ).

Tussen de verdiepingen beweegt de lift met een constante snelheid.

Bepaal de grootte van de normaalkracht op Brick en van het gewicht dat Brick uitoefent tijdens elk deel van de beweging.

Gegeven:

Proefversie©VANIN

• m = 70,0 kg

• bij vertrek: |avertrek| = 2,00 m s2

• bij aankomst: |aaankomst| = 1,00 m s2

• tussen verdiepingen: constante snelheid (a = 0 m s2 )

Gevraagd: F n en F g bij vertrek, bij aankomst en tussen de verdiepingen = ?

Oplossing: Op Brick werken twee krachten: de zwaartekracht F z (uitgeoefend door de aarde) en de normaalkracht F n (uitgeoefend door de bodem van de lift).

De lift heeft een versnelling a, die verandert gedurende de beweging.

Op elk moment is de tweede wet van Newton geldig, dus:

F res = F z + F n = m · a

De beweging is rechtlijnig. Je kiest de x-as omhoog.

De projectie op de x-as geeft de tweede wet van Newton in x-componenten:

F res, x = F z, x + F n, x = |–Fz| + |Fn| = m · a x

Daarmee kun je de normaalkracht bepalen:

|Fn| = |Fz| + m · a x = m · g + m · a x = m · (g + ax)

Het gewicht is de reactiekracht en is dus even groot als de normaalkracht.

31 MODULE 11 HOOfDstUK 1

TUSSEN VERDIEPINGEN

CONSTANTE SNELHEID

VERTREK

VERSNELLING NAAR BOVEN

AANKOMST VERTRAGING NAAR BOVEN

EEN KRACHTENSCHEMA TEKENEN OM DE COMPONENTEN TE KENNEN

Proefversie©VANIN

NORMAALKRACHT BEPALEN MET DE TWEEDE WET VAN NEWTON

Een constante snelheid betekent versnellingscomponent a x = 0, dus:

|Fn| = m · (g + ax) = m · (g + 0) = 70,0 kg · 9,81 m s2 = 687 N

Bij vertrek is de versnellingscomponent avertrek, x = 2,00 m s2

|Fn, vertrek| = m · (g + avertrek, x) = 70,0 kg · (9,81 m s2 + 2,00 m s2 ) = 827 N

Bij aankomst is de versnellingscomponent aaankomst, x = –1,00 m s2

|Fn, aankomst| = m · (g + aaankomst, x) = 70,0 kg · (9,81 m s2 – 1,00 m s2 ) = 617 N

HET GEWICHT BEPALEN ALS REACTIEKRACHT VAN DE NORMAALKRACHT

|Fg| = |Fn| = 687 N|Fg, vertrek| = |Fn, vertrek| = 827 N|Fg, aankomst| = |Fn, aankomst| = 617 N

Reflectie:

• Hoe kun je dat verschil in gewicht merken?

Als je bruusk naar boven vertrekt met een lift, word je een beetje tegen de bodem gedrukt. Als de lift afremt, kom je een beetje los van de bodem.

• Hoe zou je het verschil in gewicht zichtbaar kunnen maken?

Door op een balans te staan. In de balans wordt het gewicht omgerekend naar massa (met de zwaarteveldsterkte), dus bij vertrek zou je

mvertrek = 827 N 9,81 N kg = 84,3 kg en bij aankomst maankomst = 617 N 9,81 N kg = 62,9 kg aflezen.

32 MODULE 11 HOOfDstUK 1
F z F n y x e x e y e x e y y x F z F n avertrek e x e y y x F z F n aaankomst

Nafi Thiam loopt 800 m in 2 min 15 s.

Bereken haar gemiddelde snelheid in m s en km h

Een loper loopt met een gemiddelde snelheid van 16 km h . Hoelang doet hij over 200 m?

Bestudeer deze bewegingen en rangschik de versnellingen van klein naar groot.

a Een fietser vertrekt vanuit rust en versnelt naar 5,6 m s in 10,3 s.

b Een wandelaar versnelt van 2,4 m s naar 3,0 m s in 3,0 s.

c Een auto remt van 30 km h tot stilstand in 4,1 s.

d Een vrachtwagen remt van 60 km h  tot 20 km h in 5,2 s.

e Een raket wordt gelanceerd met een versnelling van 30 m s2 .

f Een vliegtuig remt af op de landingsbaan van 280 km h tot stilstand in 38 s.

Bestudeer de krantenkop.

Welke fouten zijn er ingeslopen?

Dit is de snelste Ferrari aller tijden: in 2,9 seconden naar 100 km/u

Uit: hln.be, 10/11/18

Na het startschot heeft een sprinter een gemiddelde versnellingscomponent van 4,4 m s2 gedurende 2,7 s.

Welke snelheid bereikt de sprinter?

Noteer in m s en km h

Een racewagen met een snelheid van 350 km h crasht en ondervindt daarbij een gemiddelde versnellingscomponent van –420 m s2 . In welke tijd komt de wagen tot stilstand?

Een rij auto’s staat achter elkaar te wachten voor het rode licht.

Welke stelling(en) is/zijn correct twee seconden nadat het groen wordt?

a Alle auto’s hebben dezelfde gemiddelde snelheid.

Proefversie©VANIN

b Alle auto’s hebben dezelfde gemiddelde versnelling.

c De eerste auto in de rij heeft de grootste gemiddelde snelheid.

d De eerste auto in de rij heeft de grootste gemiddelde versnelling.

e Je kunt geen uitspraak doen, want je kent het type auto niet.

f Geen van de bovenstaande antwoorden is correct.

Maak de uitspraken correct door ze te vervolledigen met ‘altijd’, ‘soms’ of ‘nooit’.

a Op een balletje in rust werken krachten.

b Op een balletje in beweging werkt een resulterende kracht.

c Als de resulterende kracht op een balletje nul is, is het in rust.

d Als de resulterende kracht op een balletje niet nul is, is het in rust.

e Als er een resulterende kracht inwerkt op een autootje, is de versnelling nul.

f Als er een resulterende kracht inwerkt, is de versnelling constant.

g Als de resulterende kracht constant is, is de versnelling constant.

Verklaar de volgende fenomenen.

a De passagier op een bromfiets moet zich stevig vasthouden bij het vertrek.

b Als je een hogedrukreiniger gebruikt, moet je de spuit stevig vasthouden.

c Sprinters stoten zich af met hun voeten tegen een startblok.

d Als een ezel een kar trekt, oefent hij een even grote kracht uit op de kar als de kar op hem. Toch komt de kar in beweging.

3333 MODULE 11 HOOfDstUK 1 - AAN DE sLAG
1 2 3 4 5 6 7 8 9 AAN DE SLAG

Wie heeft gelijk?

Verklaar je keuze.

A B

Ik oefen een even grote kracht op jou uit als jij op mij, dus niemand kan winnen.

Ik duw de hele tijd harder op jouw hand dan jij op mijn hand, dus uiteindelijk zal ik winnen.

C D

Er is alleen maar een winnaar als iemand stopt met duwen.

De verliezer is diegene die met zijn bovenarm de duwkracht niet kan tegenhouden.

Bestudeer de onderstaande versnelde rechtlijnige bewegingen naar rechts. Kies een x-as naar rechts.

1 De versnelling van een auto met een massa van 1,3 ton is 0,90 m s2 .

2 Een loper met een massa van 75 kg versnelt van 10,0 km h naar 15,0 km h in 3,0 s.

3 Een fietser (m = 48 kg) remt met een versnelling van 1,2 m s2

a Bepaal de versnellingscomponent in de x-richting.

b Bepaal de krachtcomponent in de x-richting.

Op een voorwerp werken drie krachten in. Welke pijl stelt de versnelling correct voor?

Op vier karretjes liggen identieke betonblokken.

Op de karretjes worden horizontale krachten uitgeoefend, zoals weergegeven op de afbeelding. Rangschik de situaties volgens toenemende versnelling. De massa van het karretje en de wrijving mag je verwaarlozen.

Proefversie©VANIN

Op een massa van 4,0 kg werken de krachten zoals weergegeven in het onderstaande krachtenschema.

a Noteer alle krachtcomponenten.

b Bepaal de resulterende kracht en de versnelling (grootte, richting en zin).

c Wat verandert er als de massa verdubbelt?

Als twee voorwerpen met een verschillende massa dezelfde versnelling ondergaan, dan zal …

a op het voorwerp met de grootste massa de kleinste kracht werken;

b op het voorwerp met de kleinste massa de kleinste kracht werken;

c op beide voorwerpen dezelfde kracht werken;

d de grootte van de kracht afhangen van de beginsnelheid.

3434 MODULE 11 HOOfDstUK 1 - AAN DE sLAG
F 1 F 3 F 2 a A a B aC a D a E
x 20° F 1 F2 F3 F4 y 1 cm 10 N
10 11 12 13 F F F F ’ F A C B D 14 15 AAN DE SLAG

Sterspeler Molina heeft een ijshockeypuck (170 g) weggeslagen, waardoor die volgens een rechtlijnige baan over het ijs glijdt. a Welk krachtenschema is correct voor de puck tijdens het glijden?

Proefversie©VANIN

b Bereken de voorgestelde krachten als

F w = 0,05 · F n

Bepaal de grootte van de horizontale trekkracht die je minimaal moet uitoefenen om een koperen bak met een massa van 80 kg een versnelling van a x = 2,0 m s2 te geven ... a op ijs (als er geen wrijvingskracht op inwerkt); b op een tafel (als de wrijvingskracht 60 N is).

` Meer oefenen? Ga naar .

3535 MODULE 11 HOOfDstUK 1 - AAN DE sLAG
P A P B P C P D P P P P A C D B
16 17

HOOFDSTUKSYNTHESE

KERNBEGRIPPEN

beweging positievector verplaatsingsvector

gemiddelde snelheid

Een voorwerp is in rust of in beweging:

NOTITIES

• In rust: de plaats verandert niet ten opzichte van een referentiepunt.

• In beweging: de plaats verandert ten opzichte van een referentiepunt.

Proefversie©VANIN

ogenblikkelijke snelheidsvector

positie x = x · e x [x] = m

verplaatsingΔx = x

e x – (xeind – xbegin) · e x [Δx] = m

De gemiddelde snelheidscomponent van een rechtlijnige beweging is gedefinieerd als <v x > = ∆x ∆t . De SI-eenheid is meter per seconde.

De gemiddelde snelheidscomponent is positief voor een beweging volgens de x-as en negatief voor een beweging tegengesteld aan de x-as.

De ogenblikkelijke snelheid van een rechtlijnige beweging wordt als volgt gedefinieerd: v(t) = dx(t) dt · e x = vx(t) · e x gemiddelde versnelling

De gemiddelde versnellingscomponent van een rechtlijnige beweging wordt gedefinieerd als <a x > =  Δv x Δt . De SI-eenheid is meter per seconde in het kwadraat ( m s2 ).

Voor een beweging in de richting en zin van de x-as is de gemiddelde versnellingscomponent positief bij een versnelling en negatief bij een vertraging.

ogenblikkelijke versnellingsvector

De ogenblikkelijke versnelling van een rechtlijnige beweging is een vector gedefinieerd als a(t) = ax(t) · e x = dvx(t) dt ·

versnellen (a en v hebben dezelfde vertragen (a en v hebben een zin) volgens de x-as tegengestelde zin) volgens de x-as vbegin veind a

krachtvector

krachtcomponenten

De vectoriële grootheid kracht kun je enkel zien door de uitwerking ervan (snelheids- of vormverandering).

GROOTHEID MET SYMBOOLSI-EENHEID MET SYMBOOL kracht F newton[F] = N

Elke kracht kan worden ontbonden in loodrechte componenten volgens een gekozen assenstelsel: F = F x · e x + F y · e y vbegin veind a x

36 MODULE 11 sYNtHEsE HOOfDstUK 1
GROOTHEID SYMBOOL SI-EENHEID
·
e x
x a(t) = ax(t) · e x met ax(t) > 0 (en vx(t) > 0) a(t) = ax(t) · e x met ax(t) < 0 (en vx(t
0)
) >
x α
y ·
x ·
F
e y F
e x e x e y F y

KERNBEGRIPPEN

NOTITIES

wetten van Newton In de mechanica zijn drie basiswetten van Newton altijd geldig:

• Eerste wet (traagheidswet): als de (resulterende) kracht op een voorwerp nul is, dan verandert de snelheid van het voorwerp niet. Omgekeerd geldt: als een voorwerp in rust is of met een constante snelheid beweegt, dan is de resulterende kracht op dat voorwerp nul.

Proefversie©VANIN

inwerkende krachten

• Tweede wet: het verband tussen de resulterende kracht en de versnelling wordt gegeven door: F res = m · a

• Derde wet (actie-reactiewet): als een voorwerp A een kracht FAB uitoefent op een voorwerp B, dan oefent voorwerp B een even grote, maar tegengestelde kracht FBA uit op voorwerp A.

In symbolen: FAB = –FBA

KRACHTEN MET AANGRIJPINGSPUNT OP HET SYSTEEM DAT KAN VERSNELLEN RICHTING ZIN GROOTTE

zwaartekracht F z verticaal naar het middelpunt van de aarde |Fz| = m · g

normaalkracht F n loodrecht op het contactoppervlak naar het ondersteunde systeem toe situatieafhankelijk (systeem liggend op oppervlak: |Fn| = |Fg|)

wrijvingskracht F w evenwijdig met het contactoppervlak

tegengesteld aan de beweging bepaald door de normaalkracht en de ruwheid

KRACHT MET AANGRIJPINGSPUNT IN CONTACTPUNT VAN HET SYSTEEM DAT ONDERSTEUNT

gewicht F g • systeem liggend op oppervlak: loodrecht op het  contactoppervlak

• hangend systeem: verticaal naar benedensituatieafhankelijk

krachtenschema

tweede wet van Newton per component

Tweede wet van Newton toepassen op blokje:

• Versnelling a x volgens de helling:

• Normaalkracht bepalen uit rusttoestand loodrecht op de helling:

37 MODULE 11 sYNtHEsE HOOfDstUK 1
F res = F z + Ftrek + F n + F w = m · a
F res, x = F z, x + F s, x + F w, x = |Fz| – |Fs| + F w = m · a x
F res, y = F z, y + F n, y = |–Fz| + |Fn| = m · a y = 0 F s F z F s F w F n F z F s F w F n x y e x e y

Bijzondere bewegingen

In technologie en sport worden krachten uitgeoefend om de gewenste versnelling en snelheid te bekomen. Bij de ontwikkeling en optimalisaties moet men antwoorden kennen op verschillende vragen: welk verband is er tussen tijd, positie, snelheid en versnelling? Welke kracht zorgt voor de gewenste beweging?

In dit hoofdstuk bestudeer je bijzondere bewegingen waarbij de snelheid of de versnellingsgrootte constant is. Je bestudeert de krachtwerking en beschrijft de positie, de snelheid en de versnelling.

LEERDOELEN

M  Het verband tussen de oriëntatie van een kracht en een snelheidsverandering omschrijven en voorstellen

M  De x(t)-, vx(t)- en ax(t)-grafieken voor bijzondere rechtlijnige bewegingen lezen en gebruiken

M  De x(t)-, vx(t)- en ax(t)-functies voor bijzondere rechtlijnige bewegingen opstellen en toepassen

M  Cirkelbewegingen beschrijven en verklaren

M  Cirkelbewegingen met een constante omlooptijd kwantitatief uitwerken

• Eenparig: de snelheid is constant en verschillend van nul.

• Rechtlijnige beweging: het is een beweging volgens één richting.

Een ERB is een model. In werkelijkheid zijn bewegingen vaak enkel bij benadering een ERB.

Je leert er meer over op . HOOFDSTUK 2

Proefversie©VANIN

1 Rechtlijnige beweging met een constante snelheid

A ERB

Als er geen resulterende kracht op een systeem in beweging werkt, dan is de snelheid constant (volgens de eerste wet van Newton).

Snelheid is een vectoriële grootheid. Een constante snelheid betekent dat de snelheidsvector v constant is. Daarvoor moeten de vier kenmerken constant zijn: de grootte v, de richting, de zin en het aangrijpingspunt. Een beweging met een constante snelheid noem je een eenparig rechtlijnige beweging (ERB)

B Bewegingsgrootheden

Je kunt uitdrukkingen voor de bewegingsgrootheden (positie, snelheid en versnelling) bepalen uit de definitie van de ERB. Voor elke ERB geldt dat de ogenblikkelijke snelheid op elk tijdstip gelijk is aan de gemiddelde snelheid. Voor een beweging volgens de x-as betekent dat: v x = <v x > = ∆x ∆t = x – x0 t – t0

Dus: v x · (t – t0) = x – x0, met x0 de beginpositie en t0 de begintijd. Je kiest t0 = 0 s.

38 MODULE 11 HOOfDstUK 2

Daaruit volgt:

• de uitdrukking voor de positie:

x = x0 + v x · (t – t0) = x0 + v x · t = x0 + v0x · t

Op elk tijdstip t geldt dat de snelheidscomponent v x  = v0x, met v0x de beginsnelheid. De positie verandert gelijkmatig met de tijd. Voor een beweging volgens de x-as is de snelheid positief en neemt de positie toe. Voor een beweging tegengesteld aan de x-as is de snelheid negatief en neemt de positie af.

• de uitdrukking voor de ogenblikkelijke snelheidscomponent (als afgeleide van de uitdrukking voor de positie):

v x = dx dt = d(v0x · t + x0) dt = v0x

De snelheidsvector en dus ook de snelheidscomponent zijn altijd constant. Voor een beweging volgens de x-as is de snelheid positief. Voor een beweging tegengesteld aan de x-as is de snelheid negatief.

• de uitdrukking voor de ogenblikkelijke versnellingscomponent (als afgeleide van de snelheidsfunctie):

ax(t) = dvx(t) dt = dv0x dt = 0

De versnellingscomponent is bij een ERB altijd nul.

VOORBEELD BEWEGINGSGROOTHEDEN EN KRACHTENANALYSE BIJ CRUISECONTROL

Proefversie©VANIN

Tijdens een rit op een autosnelweg kun je de cruisecontrol instellen, zodat de snelheidsgrootte constant is. Op een recht stuk autosnelweg behoudt de snelheid ook haar richting en zin. De auto voert een ERB uit. Voor een x-as die volgens de beweging gekozen is (snelheid positief) en met als beginpunt de oprit (x0 = 0 km) betekent dat met de gegevens op de kaart dat je na 3,00 minuten (= 0,0500 h) de volgende bewegingsgrootheden bekomt:

39 MODULE 11 HOOfDstUK 2
9,00
17,4 km v 0 x (km) 17,4 Δr v x (km) 17,4 v v 0 e x ▲ Afb. 43
min

Een trendlijn is een vloeiende lijn die de grafiekpunten benadert.

versnelling: a x = 0 m s2

snelheid: v x = v0x = <v x > = ∆x ∆t = 17,4 km ( 9,00 60,0 ) h = 116 km h

positie: x = x0 + v0x · t = 0 km + 116 km h · t = 0 km + 116 km h · 0,0500 h = 5,80 km

De resulterende kracht op de auto is nul. Als je de cruisecontrol gebruikt, betekent dat een aanpassing van de motorkracht, zodat die op elk moment net even groot is als de wrijvings- en weerstandskrachten. De resulterende kracht is dan nul. Bij een sterke tegenwind zal de motor een grotere kracht moeten uitoefenen om dezelfde snelheid aan te houden.

C Bewegingsgrafieken

Krachtenschema

n F z F w F motor

Proefversie©VANIN

res = 0 met |Fn| = |Fz| |Fmotor| = |Fw|

Je kunt de positie, de snelheid en de versnelling voorstellen op bewegingsgrafieken:

1 x(t)-grafiek

Bij een x(t)-grafiek is de positie uitgezet in functie van de tijd:

• Op de horizontale as staat de tijd t.

• Op de verticale as staat de positie x

• Elk punt op de grafiek geeft de (opgemeten) positie op een bepaald tijdstip.

• Door de punten wordt een trendlijn getrokken.

Bij een ERB is de x(t)-grafiek een rechte met deze eigenschappen:

• Richtingscoëfficiënt: de helling van de grafiek komt overeen met de snelheid v x  = v0x

• Snijpunt met de verticale as: de positie bij tijdstip t0 = 0 komt overeen met de beginpositie x0.

2 vx(t)-grafiek

Bij een vx(t)-grafiek is de snelheid uitgezet in functie van de tijd:

• Op de horizontale as staat de tijd t

• Op de verticale as staat de snelheid v x .

• Elk punt op de grafiek geeft de (berekende) snelheid op een bepaald tijdstip.

• Door de punten wordt een trendlijn getrokken.

Bij een ERB is de vx(t)-grafiek een horizontale rechte. Het snijpunt met de verticale as geeft de snelheid v x  = v0x aan.

Op een vx(t)-grafiek is de grootte van de verplaatsing gelijk aan de ingesloten oppervlakte tussen de trendlijn en de t-as. Voor een ERB is de grootte van Δx die van de oppervlakte van een rechthoek met lengte Δt en breedte v0x

3 ax(t)-grafiek

Bij een ax(t)-grafiek is de snelheid uitgezet in functie van de tijd:

• Op de horizontale as staat de tijd t.

• Op de verticale as staat de versnelling a x .

• Elk punt op de grafiek geeft de (berekende) versnelling op een bepaald tijdstip.

• Door de punten wordt een trendlijn getrokken.

Bij een ERB is de ax(t)-grafiek een rechte die door a x = 0 m s2 gaat.

40 MODULE 11 HOOfDstUK 2
F
F

VOORBEELD BEWEGINGSGRAFIEKEN VAN ERB OP AUTOSNELWEG

We bekijken opnieuw de autorit, waarbij we de snelheid van de cruisecontrole instellen op 116 km h . Je kunt de beweging van de auto op de autosnelweg voorstellen op grafieken.

De x(t)-grafiek is een stijgende rechte door de oorsprong.

De v(t)-grafiek is een horizontale rechte.

Merk op dat de verticale as van de vx(t)-grafiek niet start bij v = 0 km h

Proefversie©VANIN

5,0

= 15,0 km 0,0

= 8,0 km

= 4,20 h

De x(t)-grafiek is een stijgende schuine rechte: de auto voert een ERB uit volgens de x-as.

• De snelheid kun je aflezen als de richtingscoëfficiënt.

Bijvoorbeeld: tussen 4,20 minuten en 7,80 minuten geldt: v x = <v x > = ∆x ∆t = 15,0 km – 8,0 km 0,130 h – 0,070 h = 116 km h = 1,2 · 102 km h

• De beginpositie (x0) is het snijpunt met de verticale as.

In dit geval is x0 = 0,0 km.

De bijbehorende vx(t)-grafiek is een horizontale rechte die de verticale as snijdt bij v x  = 116 km h

De verplaatsing in het gekozen tijdsinterval is het oppervlak (rechthoek met lengte Δt en breedte v0x) onder de trendlijn.

Als de resulterende kracht op en versnelling van een bewegend systeem nul zijn, dan heeft dat systeem een constante snelheid v. Je noemt dat een eenparig rechtlijnige beweging (ERB) met als bewegingsgrootheden:

positie: x = x0 + v0x · t

snelheid: v x = v0x = constant

versnelling: a x = 0 m s2

Bij een ERB is de x(t)-grafiek een schuine rechte en de vx(t)-grafiek een horizontale rechte.

In functie van de leesbaarheid van de grafiek kozen we er in dit voorbeeld voor om de as pas te laten starten bij v = 105 km h . We duiden dat aan met twee schuine streepjes.

41 MODULE 11 HOOfDstUK 2
t = 7,80 h t
x
0,00 3,00 6,00 9,00 t (min)
x
10,0 15,0 20,0 x (km) x(t)-grafiek met x0 = 0 Δt = 0,130 h
0,070 h Δx = 15,0 m – 8,0 m 0 0,00 3,00 6,00 9,00 t (min) 105 110 115 120 vx(t)-grafiek met x0 = 0 km h v x ( ) km h v0x = 116 km h Δx = 116 · (0,130 h – 0,070 h) = 7,0 km Δ
t = 0,130 h – 0,070 h

demovideo: snelheidsverandering

2 Verband tussen de oriëntatie van de kracht en de snelheidsverandering

DEMO

Welk kenmerk van de snelheid verandert door een inwerkende kracht?

1 Je leerkracht maakt verschillende opstellingen waardoor er een kracht wordt uitgeoefend op een balletje. Je bestudeert de beweging die start na de beschreven werkwijze.

a Een balletje ligt in een gootje. Je geeft een duwtje aan het balletje.

b Een balletje hangt aan een touwtje. Je laat het balletje in een cirkel draaien.

c Je laat een balletje los. Het botst op de grond.

2 Hoe zal de snelheid volgens jou veranderen?

Bespreek met je buur en test uit

3 Formuleer een antwoord op de onderzoeksvraag.

Een kracht veroorzaakt een dynamisch effect op een systeem als het systeem een versnelling a ondervindt. Dat betekent dat er een snelheidsverandering (∆v = veind – vbegin ≠ 0) is. Op een systeem werken meestal meerdere krachten. Het effect dat zichtbaar is, is het effect van de resulterende kracht F res = F 1 + F2 + F3 + …

Een snelheidsverandering betekent dat een van de kenmerken van de snelheidsvector verandert. Het aangrijpingspunt kan niet veranderen, dus er zijn drie mogelijkheden (zie demo):

1 Verandering van snelheidsgrootte

Voor een snelheidsverandering waarbij enkel de grootte verandert, hebben de snelheidsvectoren vbegin en veind en de snelheidsverandering ∆v dezelfde richting.

Uit de definitie van versnelling en de tweede wet van Newton volgt dat ook de versnelling a en de resulterende kracht F res dezelfde richting hebben:

= lim

Proefversie©VANIN

e x veroorzaakt door F res =

Een rechtlijnige beweging blijft rechtlijnig.

Hoe de snelheidsgrootte verandert, hangt af van de zin van de resulterende kracht en de snelheid:

• Voor een kracht volgens de bewegingszin is er een snelheidstoename (a x > 0).

• Voor een kracht tegengesteld aan de bewegingszin is er een snelheidsafname (a x < 0).

2 Verandering van snelheidsrichting Voor een snelheidsverandering waarbij de richting verandert, hebben de snelheidsvectoren vbegin en veind een andere richting. Daardoor hebben ook de snelheidsverandering, de versnelling en de resulterende kracht die de snelheidsverandering veroorzaakt, een andere richting dan de beginsnelheid

Om een verandering van richting te veroorzaken, heeft de resulterende kracht een loodrechte component ten opzichte van de beginsnelheid. De versnelling maakt een hoek met de beginsnelheid. De baan van het systeem is tweedimensionaal. Als de kracht enkel een loodrechte component heeft, is er enkel een richtingsverandering en blijft de grootte van de snelheid constant.

42 MODULE 11 HOOfDstUK 2
x ∆t ·
x
·
m · a = m · a x · e x
a
v
t = lim
v
e
= a x
Δt 0Δt 0

3 Verandering van snelheidszin

Soms blijft de richting van de snelheid hetzelfde, maar verandert de zin van de snelheid onder invloed van een resulterende kracht. De resulterende kracht heeft dan:

• dezelfde richting als de beginsnelheid;

• een zin tegengesteld aan de zin van de beginsnelheid;

• een grootte die groot genoeg is om de snelheidsafname ∆v x zo groot te maken dat de snelheidscomponenten vbegin, x en veind, x een verschillend teken hebben en de zin van de snelheid verandert.

Die situatie doet zich bijvoorbeeld voor bij frontale botsingen. De normaalkracht zorgt dan voor een heel snelle omkering van de snelheidszin, waardoor de verandering van de grootte van de snelheid niet zichtbaar is, enkel de verandering van de zin van de snelheid. De versnelling en de inwerkende resulterende kracht hebben een richting volgens de bewegingsrichting. Een rechtlijnige beweging blijft rechtlijnig

VOORBEELD SNELHEIDSVERANDERINGEN

SNELHEIDSTOENAME

Je versnelt met de fiets op een recht stuk weg: de snelheid neemt toe. De resulterende kracht is de som van de spierkracht en de wrijvingskracht, en is volgens de beweging gericht.

Proefversie©VANIN

SNELHEIDSAFNAME

Je bolt uit: de snelheid neemt af. De resulterende kracht als gevolg van het remmen heeft dezelfde richting als de snelheid, maar een tegengestelde zin.

43 MODULE 11 HOOfDstUK 2
x (m) vbegin veind –vbegin ∆v F res ▲ Afb. 44
x
vbegin ∆v veind –vbegin F res ▲ Afb. 45
(m)

VERANDERING VAN SNELHEIDSRICHTING

Je draait een balletje aan een touwtje in het rond: de snelheid verandert van richting.

De resulterende kracht is de spankracht en staat loodrecht op de beginsnelheid. De grootte van de snelheid verandert niet.

VERANDERING VAN SNELHEIDSZIN

Een biljartbal botst loodrecht op de wand: de snelheid verandert van zin.

De resulterende kracht is de normaalkracht en is tegengesteld aan de beginsnelheid. De grootte van de snelheid verandert (bijna) niet.

Proefversie©VANIN

De oriëntatie van de kracht ten opzichte van de beginsnelheid bepaalt welke baan er gevolgd wordt en hoe de snelheid verandert. In dit hoofdstuk bekijk je speciale bewegingen waarbij de grootte van de versnelling constant is doordat de grootte van de kracht constant is:

• In paragraaf 3 bestudeer je rechtlijnige bewegingen waarbij er snelheidsveranderingen zijn door een kracht evenwijdig met de snelheid.

• In paragraaf 4 bestudeer je cirkelvormige bewegingen waarbij de kracht loodrecht op de snelheid staat.

Bij een resulterende kracht is er een snelheidsverandering (∆v = veind – vbegin ≠ 0).

De oriëntatie van de resulterende kracht bepaalt of de grootte, de richting of de zin van de snelheid (of een combinatie) verandert. De baan die daardoor gevolgd wordt, is eendimensionaal of tweedimensionaal.

44 MODULE 11 HOOfDstUK 2
v
veind –vbegin ∆v F res ▲ Afb. 46
begin
x (m) vbegin –vbegin veind ∆v F res ▲ Afb. 47

3

Rechtlijnig beweging met een constante versnelling

Een skiër op een helling kan gelijkmatig versnellen door de constante zwaartekracht.

Een trein versnelt gelijkmatig door de constante motorkracht.

Een speelgoedauto die in gang geduwd werd, vertraagt gelijkmatig door de constante wrijvingskracht.

Als er een resulterende kracht inwerkt op een systeem volgens de bewegingsrichting (x-richting), dan verandert de snelheidsgrootte: er is een versnelling. Als de resulterende kracht constant is, dan is de versnelling constant (tweede wet van Newton: a = F res m ).

Proefversie©VANIN

▲ Afb. 51 De bus versnelt gelijkmatig door een constante motorkracht.

horizontale krachten

▲ Afb. 52 De bus vertraagt gelijkmatig door een constante remkracht.

Versnelling is een vectoriële grootheid. Een constante versnelling betekent dat de versnellingsvector a constant is. Daarvoor moeten de vier kenmerken constant zijn: de grootte a, de richting, de zin en het aangrijpingspunt. Een beweging met een constante versnelling noem je een eenparig versnelde rechtlijnige beweging (EVRB).

• Eenparig: de versnelling is constant.

• Versnelde: de versnelling is verschillend van nul.

• Rechtlijnige beweging: het is een beweging volgens één richting.

45 MODULE 11 HOOfDstUK 2
▲ Afb. 48 ▲ Afb. 49 ▲ Afb. 50
x (m) 0 a v4 v3 v2 v1 = 0 beweging horizontale krachten F w F motor F res 20 30 90 100 40 80 20 30 90 100 40 80 20 30 90 100 40 80 20 30 90 100 40 80
x (m) 0 a v2 v3 v4 = 0 v1 beweging
F w F res 0 10 110 120 40 80 50 70 60 0 10 110 120 40 80 50 70 60 0 10 110 120 40 80 50 70 60 0 10 110 120 40 80 50 70 60
XX LABO

B Bewegingsgrootheden

Je kunt uitdrukkingen voor de bewegingsgrootheden (positie, snelheid en versnelling) bepalen uit de definitie van de EVRB. Voor elke EVRB geldt dat de ogenblikkelijke versnelling op elk tijdstip t gelijk is aan de gemiddelde versnelling. Voor een beweging volgens de x-as betekent dat:

a

Dus:

a x · (t – t0) = v x – v0x, met v0x de x-component van de beginsnelheid en t0 de begintijd. Je kiest t0 = 0.

Proefversie©VANIN

Daaruit volgt:

• de uitdrukking voor de ogenblikkelijke snelheidscomponent: v

De ogenblikkelijke snelheidscomponent verandert gelijkmatig met de tijd. Voor een beweging volgens de x-as en een positieve versnellingscomponent neemt de snelheid toe. Dat is een versnelde beweging. Voor een beweging volgens de x-as en een negatieve versnelling neemt de snelheid af. Dat is een vertraagde beweging.

• de uitdrukking voor de ogenblikkelijke versnellingscomponent (als afgeleide van de uitdrukking voor de ogenblikkelijke snelheidscomponent):

a x = dvx(t) dt = d(a x · t + v0x) dt = a x

De versnellingscomponent bij een EVRB is altijd constant. Voor een versnelde beweging volgens de x-as is de versnellingscomponent positief. Voor een vertraagde beweging volgens de x-as is de versnellingscomponent negatief

• De uitdrukking voor de positie kun je afleiden uit experimenten of berekenen aan de hand van de kenmerken van de EVRB of integraalrekenen:

x = x0 + v0x · t + a x 2 · t2

De positie bij een EVRB neemt kwadratisch toe met de tijd (want er staat een t2-term in de uitdrukking).

46 MODULE 11 HOOfDstUK 2
x = <a x > = ∆v x ∆t = v x – v0x t – t0
x = v0x + a x · (t – t0)
v0x + a x · t
=

VOORBEELDVRAAGSTUK

Christo geeft een duwtje aan een schijfje (m = 80 g) in een sjoelbak op een horizontaal oppervlak. Het schijfje vertrekt met een snelheid van 2,1 m s en komt na 1,3 s tot stilstand.

Bereken: 1 de verplaatsing; 2 de wrijvingskracht

Gegeven:

Proefversie©VANIN

• v0x = 2,1 m s

• vx(1,3 s) = 0 m s

Gevraagd: 1 ∆x = ?

2 F w = ?

Oplossing: 1

eind = 0

▲ Afb. 53

Het schijfje komt tot stilstand door de wrijvingskracht.

Die kracht is constant tijdens een beweging, dus de versnelling is constant.

Het schijfje voert een EVRB uit.

De positie op tijdstip t kun je als volgt berekenen:

x = x0 + v0x · t + a x 2 · t2

Voor een tijdstip t is de verplaatsing:

∆x = x – x0 = v0x · t + a x 2 · t2

De versnellingscomponent a x kun je bepalen uit de uitdrukking voor de ogenblikkelijke snelheidscomponent:

v x = a x · t + v0x

De beginsnelheidscomponent v0x is gegeven. Op tijdstip t = 1,3 s geldt:

v x (1,3 s) = v0x + a x · t = 0 m s

Daaruit volgt: a x

Als je dat invult in de uitdrukking voor de verplaatsing, bekom je:

∆x = v0x · t + a x 2 · t2 = 2,1 m s · 1,3 s – 1,6 m s2 2 · (1,3 s)2 = 1,4 m

2 De ruwheid van het oppervlak bepaalt de grootte van de tegenwerkende kracht (= wrijvingskracht) en dus van de negatieve versnelling in de x-richting.

Op het schijfje werken de zwaartekracht Fz, de normaalkracht F n en de wrijvingskracht Fw, dus volgens de tweede wet van Newton geldt:

F res = F z + F n + F w = m · a

In de x-richting is de wrijvingskracht de enige kracht, dus bekom je het verband met de versnelling:

F res, x = |–Fw| = m · a x

Daaruit volgt: |Fw| = –m · a x = –0,080 kg · (–1,6 m s2 ) = 1,3 N

Reflectie: Controleer de eenheden. x (m)

y y F n F z Fw, k

e x

47 MODULE 11 HOOfDstUK 2
v0x t = –2,1 m s 1,3 s = –1,6 m s2
= –
F
v
Δ
e
x
res vbegin
x
x
e
Afb. 54

C Bewegingsgrafieken

De bewegingsgrafieken van een EVRB hebben een specifieke vorm:

• De x(t)-grafiek is (vanwege het kwadratisch verband) een parabool: – een bergparabool voor een versnelling volgens de x-as; – een dalparabool voor een vertraging volgens de x-as.

• De vx(t)-grafiek is een schuine rechte: – een stijgende rechte voor een versnelling volgens de x-as; – een dalende rechte voor een vertraging volgens de x-as.

• De ax(t)-grafiek is een horizontale rechte.

Proefversie©VANIN

VOORBEELD BEWEGINGSGRAFIEKEN VAN EEN BUS DIE EENPARIG VERSNELT

Een bus vertrekt vanaf een halte met een constante versnelling. Je kunt dat bekijken in de animatie. De posities van de bus worden opgemeten in functie van de tijd. Als beginpunt is x0 = 0,0 m en t0 = 0,0 s gekozen, met een x-as naar rechts (= volgens de bewegingsrichting en -zin). Het resultaat is weergegeven met trendlijnen op de x(t)-, vx(t)- en ax(t)-grafiek.

Uit de vorm van de x(t)-grafiek kun je de volgende kenmerken afleiden:

• De curve is stijgend: de bus rijdt volgens de x-as.

• De curve wordt steeds steiler: de snelheid van de bus neemt toe. De bus versnelt.

• De x(t)-grafiek is een deel van een dalparabool door de oorsprong: de versnelling is constant en positief.

De uitdrukking voor de positie is gegeven door:

x = x0 + v0x · t + a x 2 · t2 = 0 + 0 + 0,55 · t2

Uit het voorschrift van de trendlijn kun je de versnelling afleiden uit de constante C bij t2:

a x = 2 · C = 2 · 0,55 m s2 = 1,1 m s2 , de beginpositie

x0 = 0 m s en de beginsnelheid v0x = 0 m s

Uit de vorm van de vx(t)-grafiek kun je de volgende kenmerken afleiden:

• De snelheid is positief: de bus rijdt volgens de x-as.

• De curve is stijgend: de snelheid neemt toe. De bus versnelt.

• De curve is een rechte: de snelheid van de bus neemt gelijkmatig toe. De versnelling is constant.

Uit het voorschrift van de trendlijn kun je de versnelling aflezen als de richtingscoëfficiënt:

v(t) = v0x + a x · t = 0 + 1,1 · t, dus

a x = dv x dt = 1,1 m s2

Dat komt overeen met de gemiddelde versnelling:

<a x > = ∆v x ∆t = 5,5 m s 5,0 s = 1,1 m s2

48 MODULE 11 HOOfDstUK 2
0 2 4 6 8 10 12 14 0,0 1,0 2,0 3,0 4,0 5,0 t (s) x (m) x(t)-grafiek versnelde EVRB x = 0,55 · t2 ▲ Grafiek 1
0,0 1,0 2,0 3,0 4,0 5,0 6,0 0,0 1,0 2,0 3,0 4,0 5,0 t (s) vx(t)-grafiek versnelde EVRB v x (m) s Δ v x = 5,5 m s Δ t = 5,0 s v x = 1,1 · t ▲
Grafiek 2
animatie: vertrek bus

a x (m) s2

ax(t)-grafiek versnelde EVRB

a x = 1,1

Uit de vorm van de ax(t)-grafiek kun je de volgende kenmerken afleiden:

• De versnelling is positief: de bus versnelt.

• De curve is een horizontale rechte: de versnelling is constant.

Uit het voorschrift van de trendlijn kun je de versnelling aflezen als het afsnijpunt a x : a x = 1,1 m s2

Proefversie©VANIN

▲ Grafiek 3

VOORBEELD BEWEGINGSGRAFIEKEN VAN EEN BUS DIE EENPARIG VERTRAAGT

Een bus vertraagt met een constante versnelling om te stoppen bij een halte. Je kunt dat bekijken in de animatie. De posities van de bus worden opgemeten in functie van de tijd. Als beginpunt is x0 = 0,0 m en t0 = 0,0 s gekozen, met een x-as naar rechts (= volgens de bewegingsrichting en -zin). Het resultaat is weergegeven met trendlijnen op de x(t)-, vx(t)- en ax(t)-grafiek.

Uit de vorm van de x(t)-grafiek kun je de volgende kenmerken afleiden:

• De curve is stijgend: de bus rijdt volgens de x-as.

• De helling van de curve neemt af: de snelheid van de bus neemt af. De bus vertraagt.

• De x(t)-grafiek is een deel van een bergparabool door de oorsprong: de versnelling is constant en negatief.

De uitdrukking voor de positie is gegeven door:

Uit het voorschrift van de trendlijn kun je de versnelling afleiden uit de constante C bij t2: a x = 2 · C = 2 · (–0,22 m s2 ) = –0,44 m s2 , de beginpositie x0 = 0 m s en de beginsnelheid v0x = 7,0 m s

Uit de vorm van de vx(t)-grafiek kun je de volgende kenmerken afleiden:

• De snelheid is positief: de bus rijdt volgens de x-as.

• De curve is dalend: de snelheid neemt af. De bus vertraagt.

• De curve is een rechte: de snelheid van de bus neemt gelijkmatig af. De versnelling is constant.

Uit het voorschrift van de trendlijn kun je de versnelling aflezen als de richtingscoëfficiënt:

v(t) = v0x + a x · t = v(t) = 7,0 – 0,44 · t dus v0x = 7,0 m s en a = –0,44 m s2

Dat komt overeen met de gemiddelde versnelling:

<a x > = ∆v x ∆t = –7,0 m s 6,0 s = –0,44 m s2

animatie: vertraging bus

49 MODULE 11 HOOfDstUK 2 0,0 0,3 0,6 0,9 1,2 1,5 0,0
1,0 2,0 3,0 4,0 5,0 t (s)
0 10 20 30 40 50 60 x (m) 0,0 5,0 10,0 15,0 t (s) x(t)-grafiek vertraagde EVRB x = 7,0 · t – 0,22 · t2 ▲ Grafiek
4
= x0 + v0x · t + a x 2 · t2 = 0 +
· t – 0,22
t
x
7,0
·
2
0,0 1,0 2,0 6,0 4,0 5,0 6,0 7,0 0,05,010,015,0 t (s) vx(t)-grafiek vertraagde EVRB v x (m) s Δ v = –7,0 m s Δ t = 16,0 s v x = 7,0 – 0,44 · t ▲ Grafiek 5

Je kunt de invloed van de beginpositie, de beginsnelheid en de versnelling op de bewegingsgrafieken bekijken in de applet.

Uit de vorm van de ax(t)-grafiek kun je de volgende kenmerken afleiden:

• De versnelling is negatief: de bus vertraagt.

• De curve is een horizontale rechte: de versnelling is constant.

Uit het voorschrift van de trendlijn kun je de versnelling aflezen als het afsnijpunt ax = –0,44 m s2 .

Proefversie©VANIN

Grafiek 6

Als de resulterende kracht constant is, dan ondervindt een systeem een constante versnelling a.

Je noemt dat een eenparig versnelde rechtlijnige beweging (EVRB) met als uitdrukkingen voor de bewegingsgrootheden: positie: x = x0 + v0x · t + a x 2 · t2 ogenblikkelijke snelheidscomponent: v x = v0x + a x · t versnellingscomponent: a x = constant

Bij een EVRB is de x(t)-grafiek een parabool, de vx(t)-grafiek een schuine rechte en de ax(t)-grafiek een horizontale rechte.

VERDIEPING

Als je een voorwerp laat vallen of het omhooggooit, dan werkt de (constante) zwaartekracht erop in. Die bewegingen zijn dus EVRB’s. Je leert er meer over op .

50 MODULE 11 HOOfDstUK 2 –0,50 –0,40 –0,30 –0,20 –0,10 0,0 0,10 1,0 6,0 11,0 16,0 t (s)
ax(t)-grafiek vertraagde EVRB a x (m) s2 a x = –0,44

4.1 Eenparig cirkelvormige beweging

De ophangpunten van de zitjes op het reuzenrad beschrijven een cirkel met als middelpunt het ophangpunt. De snelheid van de zitjes is op elk moment even groot, maar verandert voortdurend van richting.

De kogel bij het hamerslingeren voert een cirkelvormige beweging uit waarbij de snelheid van de kogel toeneemt. De snelheid verandert van grootte en van richting.

Proefversie©VANIN

De maan beweegt in een vast tempo op een cirkelvormige baan rond de aarde. De snelheid verandert enkel van richting.

Bij een rotatie of cirkelbeweging draait een systeem rond een vast rotatiepunt. Het is een tweedimensionale beweging. De positie van het vaste punt (het rotatiepunt) verandert niet. Alle andere delen van het systeem beschrijven een cirkel rond het rotatiepunt. Bij een cirkelbeweging verandert de snelheid voortdurend van richting: er is een versnelling a. De snelheidsgrootte kan daarbij constant zijn of veranderen. Een cirkelbeweging waarbij de snelheidsgrootte constant is, noem je een eenparig cirkelvormige beweging (ECB)

Je kunt de oriëntatie van de versnelling afleiden uit de definitie van versnelling:

= lim ∆v

= lim veind – vbegin

Bij een ECB is de snelheid op elk tijdstip even groot en rakend aan de cirkel. Je kunt twee willekeurige punten tekenen en ∆v construeren. Als je het tijdsinterval verkleint, bekom je de versnelling a, die naar het midden van de cirkel gericht is. De versnelling die naar het midden van een cirkel gericht is, noem je de middelpuntzoekende of centripetale versnelling, met als symbool a c p . Aangezien de versnelling en de kracht loodrecht op de snelheid staan, verandert de snelheid enkel van richting en blijft de grootte constant. veind

teind veind veind

vbegin

vbegin vbegin vbegin vbegin vbegin tbegin ▲ Afb. 58 De versnelling bij een ECB

vbegin

• Eenparig: de snelheidsgrootte is constant.

• Cirkelvormige beweging: de beweging verloopt volgens een cirkelbaan.

51 MODULE 11 HOOfDstUK 2 4 Cirkelvormige beweging met een constante versnellingsgrootte
▲ Afb. 55 ▲ Afb. 56 ▲ Afb. 57
∆t
a
t
∆v ∆v ∆v a c.p.
Δ
0
t 0Δt

De naam ‘middelpuntzoekende kracht’ is niet gebaseerd op de oorzaak van die kracht, zoals bij de zwaartekracht, maar op het gevolg van die kracht.

Uit de tweede wet van Newton volgt dat de kracht om een systeem een cirkelbeweging te laten uitvoeren, gelijk is aan m · a c p en naar het middelpunt van de cirkel gericht is. De kracht die naar het middelpunt van een cirkel gericht is, noem je de middelpuntzoekende of centripetale kracht, met als symbool F c p : F c p = F res = m · a c p

Zonder de centripetale kracht zou het systeem niet op de cirkelbaan kunnen blijven. Het zou zich zonder krachten (volgens de eerste wet van Newton) rechtlijnig verplaatsen met een constante snelheid.

VOORBEELD BALLETJE HORIZONTAAL RONDSLINGEREN

Je kunt een balletje aan een touw laten ronddraaien met een constante snelheidsgrootte door aan het touw te trekken. (Test dat uit.)

JE OEFENT DE KRACHT UIT: ECB JE LAAT LOS: HORIZONTALE WORP

Proefversie©VANIN

Het balletje ondervindt een kracht naar het midden van de cirkel. De spankracht in het touw (doordat jij eraan trekt) levert de centripetale kracht: F s = F c p . De snelheid v is rakend aan de baan. Volgens de derde wet van Newton oefent het balletje een even grote, maar tegengestelde kracht uit op jou: –Fs. Jij voelt een kracht die naar buiten gericht is.

Bij het loslaten ondervindt het balletje geen horizontale kracht. De snelheid v is rakend aan de baan en horizontaal. Het balletje voert een ERB uit in de horizontale richting. In de verticale richting voert het een vrije val uit. Het balletje volgt een kogelbaan (horizontale worp).

Een eenparig cirkelvormige beweging (ECB) is een cirkelvormige beweging waarbij de snelheidsgrootte constant is. De kracht om de snelheidsverandering te veroorzaken, is naar het midden van de cirkel gericht en staat loodrecht op de snelheidsvector: de centripetale kracht F c p .

52 MODULE 11 HOOfDstUK 2
F s = F c p –F s v v
▲ Afb. 59 ▲ Afb. 60

4.2 Bewegingsgrootheden bij een ECB

A Positie

Een systeem dat een cirkelbeweging uitvoert, beweegt op een cirkelbaan met straal R. Op elk tijdstip t kun je de positievector r (t) tekenen vanuit het middelpunt van de cirkel tot het punt op de baan. Die vector maakt een hoek α met het gekozen beginpunt. De hoek α wordt uitgedrukt in radialen.

Als een punt een cirkelbaan beschrijft, heeft het tijd nodig om één omwenteling te maken:

• De tijd die nodig is voor één omwenteling , noem je de periode T (uitgedrukt in seconden).

• Het aantal omwentelingen van een punt per tijdseenheid, noem je de frequentie f.

Uit de definities volgt: f = 1 T en de eenheid [f] = 1 [T] = s–1.

r (t) α

Proefversie©VANIN

De cirkelbeweging is een tweedimenionale beweging. De positie wordt daarom aangeduid met een r (in plaats van een x).

▲ Afb. 61 De positievector met componenten

Als eenheid voor frequentie gebruik je de hertz: 1 Hz = 1 s = 1 s–1.

Tijdens de cirkelbeweging verandert de hoek α in het tijdsinterval Δt. Dat noem je de hoekverplaatsing Δα (uitgedrukt in radialen). De verhouding van de hoekverandering Δα ten opzichte van het tijdsinterval noem je de hoeksnelheid:

Ꞷ =

Die druk je uit in radialen per seconde.

GROOTHEDEN MET SYMBOOL

EENHEDEN MET SYMBOOL periode T seconde s frequentie f hertz ( 1 seconde ) Hz = 1 s = 1 s–1 hoekverplaatsingΔα radialen rad hoeksnelheid Ꞷ = ∆α ∆t radialen per seconde rad s

Bij een ECB verandert de hoek α gelijkmatig. De hoeksnelheid Ꞷ is constant Voor een volledige omwenteling is de hoekverplaatsing Δα = 2 · π rad in een tijdsduur van een periode (Δt = T). Daarmee bereken je de hoeksnelheid:

= ∆α ∆t = 2 · π T = 2 · π · f

De hoeksnelheid is onafhankelijk van de straal.

De eenheid hertz is genoemd naar de Duitse natuurkundige Heinrich Hertz, die belangrijke bijdragen leverde op het gebied van elektromagnetisme.

ω is de Griekse kleine letter omega.

53 MODULE 11 HOOfDstUK 2
∆α ∆t
ω

VOORBEELD HOEKSNELHEID VAN EEN WINDMOLENTJE

In de animatie en op afbeeldingen XXX en XXX zie je de baan van twee verschillende punten:

• een punt A op de rand;

• een punt B meer naar het midden.

Beide punten bewegen op een cirkel rond hetzelfde middelpunt (O) en met een verschillende straal (RA en RB).

De punten A en B hebben dezelfde tijd nodig om een omwenteling te maken.

Voor het windmolentje is de periode T = 1,30 s. De hoeksnelheid is:

ω = 2 · π T = 4,83 rad s

De hoekverplaatsing en de hoeksnelheid zijn voor alle punten van het windmolentje gelijk.

De straal van de cirkelbaan heeft geen invloed.

▲ Afb. 62 De

Proefversie©VANIN

ECB

▲ Afb. 63 De hoekverplaatsing ∆α in het tijdsinterval [tbegin, teind] door een constante hoeksnelheid Ꞷ

Uit de definitie van hoeksnelheid kun je een uitdrukking voor de hoek in functie van de tijd afleiden:

=

=

t (voor α0 = 0 op t0), dus

De lengte van de positievector is op elk ogenblik de straal van de cirkel. Je kunt de positie van een punt bij een ECB beschrijven als je de straal van de cirkel, de beginpositie en de periode (of de frequentie) kent.

Je kunt de verandering van de positie-, snelheids-, en versnellingscomponenten in functie van de tijd bekijken in de applet.

54 MODULE 11 HOOfDstUK 2
baan van een punt A op de rand (blauw) en meer naar het midden B (rood) tijdens een
ω
∆α ∆t
α – α0 t – t0
t)
ω · t
π T · t
=
α
α(
=
= 2 ·
animatie:
ECB rB rA x y αeind αbegin Ꞷ ∆α TIP applet:
positie
cirkelbaan

B Baansnelheid

De ogenblikkelijke snelheidsvector v is rakend aan de baan en verandert bij een cirkelvormige beweging voortdurend van richting. Bij een cirkelvormige beweging noem je de ogenblikkelijke snelheid de baansnelheid, om het onderscheid te maken met de hoeksnelheid.

Bij een ECB is de grootte van de baansnelheid per definitie constant. Dat betekent dat de ogenblikkelijke baansnelheid en de gemiddelde baansnelheid gelijk zijn.

Bij een ECB legt elk punt een volledige cirkel af in een periode. Het punt legt dus per periode een afstand af gelijk aan de omtrek van de cirkel (2 · π · R).

De grootte van de baansnelheid bij een ECB is dus:

|v| = 2 · π · R T = ω · R

De baansnelheid v is een vector met deze eigenschappen:

• aangrijpingspunt: het gekozen punt;

• richting: rakend aan de cirkelbaan;

• zin: volgens de draaizin;

• grootte: |v| = R · ω. Je kunt de baansnelheid bij een ECB berekenen als je de straal van de cirkel en de periode kent.

VOORBEELD BAANSNELHEID VAN HET WINDMOLENTJE

Op afbeeldingen XXX en XXX zie je dat de afgelegde weg tussen de punten op een cirkel met dezelfde tijdsduur ertussen constant is voor de hele beweging.

rand (blauw) en meer naar het midden (rood) tijdens een ECB

Proefversie©VANIN

Afb. 65 De afgelegde weg l in het tijdsinterval [tbegin, teind] bij een constante baansnelheid v

Voor het windmolentje is de periode T = 1,30 s. Punt A en punt B bewegen op een cirkelbaan met een verschillende straal. De periode voor beide punten is 1,30 s. Dit is de grootte van hun baansnelheid:

• punt A op de rand: |vA| = r

• punt B meer naar het midden: |v

55 MODULE 11 HOOfDstUK 2
▲ Afb. 64 De snelheidsvectoren van een punt op de
A · ω = rA · 2 · π T = 2 ∙ π ∙ rA T = 2 ∙ π ∙ 0,25 m 1,30 s = 1,2
s
m
B| = 2 ∙ π ∙ rB T = 2 ∙ π ∙ 0,15 m 1,30 s = 0,72 m s x y vA vB

‘Normaal’ is een synoniem voor ‘loodrecht’. De normaalcomponent is de component die loodrecht op de baan staat.

C Versnelling

Uit de constructie van de snelheidsvectoren (zie paragraaf 4.1) blijkt dat een punt een ECB uitvoert als er een resulterende kracht (de centripetale kracht) op inwerkt die naar het middelpunt van de cirkel wijst en een constante grootte heeft. Uit de tweede wet van Newton volgt dat de versnelling dan ook naar het middelpunt van de cirkel wijst en een constante grootte heeft. Je kunt dat nagaan met berekeningen.

Afb. 66 Snelheids- en versnellingsvectoren tijdens een ECB v1 v2

Proefversie©VANIN

De centripetale versnelling a c p is een vector met deze eigenschappen:

• aangrijpingspunt: het gekozen punt;

• richting: loodrecht op de cirkelbaan (door het middelpunt van de cirkel);

• zin: naar het middelpunt van de cirkel;

• grootte: |a c p | = R · ω2 = v2 R . De versnelling heeft enkel een normaalcomponent. Je kunt de centripetale versnelling bij een ECB berekenen als je de straal van de cirkel en de periode (of de frequentie) kent.

Uit de tweede wet van Newton volgt dat de kracht om de versnelling te veroorzaken, gegeven is door: F c p = F res = m · a c p

Dat betekent: |F c p | = m · |a c p | = m · R · ω2 = m · v2 R

Hoe groter de snelheid van een systeem is, hoe groter de kracht moet zijn opdat het systeem een cirkelvormige beweging zou kunnen uitvoeren. De kracht heeft enkel een normaalcomponent die zorgt voor een richtingsverandering van de snelheid. De tangentiële component van de kracht is nul. De grootte van de snelheid verandert dus niet.

56 MODULE 11 HOOfDstUK 2
a a

VOORBEELDVRAAGSTUK

Een kogelslingeraar slingert een kogel (m = 7,3 kg) rond aan een staalkabel met een lengte van 140 cm.

De kogel beweegt in een (bijna) horizontaal vlak en voert net voor de lancering een ECB uit met een baansnelheid van 83 km h .

Bepaal de grootte van: 1 de periode;

2 de centripetale versnelling;

3 de spankracht in de staalkabel.

Gegeven:

Proefversie©VANIN

• |v| = 83 km h

• m = 7,3 kg

• R = 140 cm

Gevraagd: 1 T = ?

2 |a c p | = ?

3 |Fs| = ?

Oplossing: 1 De grootte van de baansnelheid (v = 83 km h = 23 m s ) is dit is geen definitie, maar afgeleid uit de eigenschappen van een ECB: |v| = ω · R = 2 · π T · R

De periode T kun je als volgt berekenen:

= 2 ·

|v| · R = 2 · π 23 m s · 1,40 m = 0,38 s

2 De grootte van de centripetale versnelling is:

|a c p | = |v|2 R = (23 m s )2 1,40 m = 3,8 · 102 m s2

3 De kogel voert een ECB uit door de spankracht in de staalkabel.

De spankracht is de centripetale kracht:

F c p = F s = m · a c p

Dat betekent:

|Fs| = m · |a c p | = 7,3 kg · 3,8 · 102 m s2 = 2,8 kN

Reflectie: • Vergelijk de centripetale versnelling a c p tijdens het ronddraaien met de valversnelling g

De centripetale versnelling is veel groter dan de valversnelling (|a c p | = 3,8 · 102 m s2 ≈ 38 · g) en is normaal gericht (a c p = 3,8 · 102 m s2 · e n ≈ 38 · g · en). De valversnelling is verticaal gericht (g = |g| · e y).

• Verklaar waarom kogelslingeraars heel gespierd zijn.

Ze oefenen een heel grote kracht (2,8 kN) uit: de spankracht is een aantal keer hun eigen gewicht (grootteorde van 1 kN).

57 MODULE 11 HOOfDstUK 2
T
π
▲ Afb. 67 Een ECB bij het kogelslingeren

Bij een ECB voert elk punt een cirkelbeweging uit met een vaste periode. De hoeksnelheid is constant.

GROOTHEDEN MET SYMBOOL

EENHEDEN MET SYMBOOL periode T seconde s frequentie f hertz ( 1 seconde ) Hz = 1 s = 1 s–1

hoekverplaatsingΔα radialen rad hoeksnelheid

baansnelheid (grootte)

centripetale versnelling (grootte)

Proefversie©VANIN

radialen per seconde rad s

meter per seconde m s

meter per seconde in het kwadraat m s2

• De bewegingsgrootheden worden bepaald door de hoek

• De baansnelheid v is rakend aan de baan. De snelheid heeft enkel een tangentiële component.

• De centripetale versnelling a c p is naar het midden van de cirkel gericht. De versnelling heeft enkel een normaalcomponent.

Een systeem voert een ECB uit als er een centripetale kracht F c p op inwerkt naar het middelpunt van de cirkel, met als grootte |F c p | = m · |v|2 R

De kracht heeft enkel een normaalcomponent die zorgt voor een richtingsverandering van de snelheid. De tangentiële component van de kracht is nul. De grootte van de snelheid verandert dus niet.

VERDIEPING

Door de gravitatiekracht kunnen satellieten zonder motor rond de aarde bewegen. Je leert er meer over op . met gravitatiekracht zonder gravitatiekracht

58 MODULE 11 HOOfDstUK 2
ω = ∆α ∆t
v| = R · ω
|
|a c p | = R · ω2 = v2 R
(t) = ω · t = 2 · π T · t
α
▲ Afb. 68 Rond de aarde bewegen er een natuurlijke maan en vele kunstmanen (zoals het bewoonbare ISS). ▲ Afb. 69 Dankzij de gravitatiekracht beweegt een satelliet op een cirkelbaan.

Je maakt een fietstocht.

Geef een voorbeeld waarbij de rit …

a een ERB is;

b rechtlijnig, maar niet eenparig is;

c eenparig, maar niet rechtlijnig is.

Je verschuift een kast (van 15,0 kg) in een tijdsduur van 5,0 s over een afstand van 80 cm met een constante snelheid.

Kies een x-as volgens de bewegingsrichting en -zin met de oorsprong in het startpunt. Bepaal: a de uitdrukking voor de positie en de snelheid; b de positie en de snelheid na 2,0 s.

Bestudeer de snelheidsgrafiek van een auto.

Een tennisser slaat tegen een tennisbal (m = 55 g) die met een snelheidsgrootte van 80 km h naar links vliegt. Door de slag van het racket vliegt de tennisbal 50 ms terug naar rechts met een snelheid die 20 km h groter is.

a Teken de snelheidsvectoren op een x-as naar rechts.

b Bepaal de grootte van de snelheidsverandering.

c Bereken de grootte van de kracht en teken de krachtvector.

Een biljartbal weerkaatst zonder snelheidsverlies tegen de tafelrand.

Hoe is de snelheidsverandering ∆v georiënteerd?

Proefversie©VANIN

a Bepaal de totale verplaatsing eerst grafisch.

b Bepaal vervolgens de verplaatsing met formules.

c Bereken de gemiddelde snelheidscomponent voor het volledige traject.

d Teken de bijbehorende x(t)-grafiek.

Een auto vertrekt in punt A en rijdt over een rechte weg met een constante snelheidsgrootte van 50 km h tot in punt B, dat zich op 500 km bevindt van punt A.

Op hetzelfde ogenblik vertrekt een tweede auto ook in punt A. Die rijdt over dezelfde weg in dezelfde zin met een constante snelheidsgrootte van 25 km h .

Na 2,0 h stopt die tweede auto, om 1,0 h later met 75 km h verder te rijden.

a Construeer voor beide auto’s de vx(t)-grafiek (op dezelfde grafiek).

b Construeer voor beide auto’s de x(t)-grafiek (op dezelfde grafiek).

c Wanneer en waar haalt de tweede auto de eerste in? Uit welke grafiek kun je dat afleiden?

d Met welk tijdsverschil komen de auto’s aan in punt B?

a ↑ b →

c ↓

d ←

e Er is geen snelheidsverandering.

Maak de uitspraken correct door ze te vervolledigen met ‘altijd’, ‘soms’ of ‘nooit’.

Bij een EVRB (volgens de x-as) zonder beginsnelheid is ...

a de versnellingscomponent negatief;

b de ogenblikkelijke versnelling op een tijdstip gelijk aan de gemiddelde versnelling van het volledige traject;

c de grootte van de eindsnelheid groter dan de grootte van de beginsnelheid;

d de eindsnelheid gelijk aan de gemiddelde snelheid van het volledige traject.

5959 MODULE 11 HOOfDstUK 2 - AAN DE sLAG
0 0 25 50 75 100 125 150 t (s) 5 10 15 20 v x ( ) m s
1 2 3 4 5 6 7 AAN DE SLAG

Op een systeem in beweging grijpen twee krachten in, zoals voorgesteld op de afbeelding. Bepaal het type beweging. Kies uit:

① ERB – ② versnelde rechtlijnige beweging –③ versnelde tweedimensionale beweging.

Door een constante kracht bereikt een voorwerp in rust na een bepaalde tijdsduur een snelheid v Welke snelheid wordt bereikt als de kracht en de massa gehalveerd worden?

Proefversie©VANIN

Een puntmassa beweegt op een horizontale baan. De beweging wordt beschreven op een naar rechts georiënteerde x-as met deze uitdrukking voor de positie:

x = 4,0 m s · t – 4,0 m s2 · t2

a Bepaal de versnelling op t = 3,0 s.

b Wanneer is de snelheid 4,0 m s naar links?

Een voorwerp dat beweegt op een rechte weg, vertraagt met een constante versnellingsgrootte van 2,5 m s2 tot stilstand.

a Hoelang duurt het voordat de snelheid is afgenomen met 30 m s ?

b Wat is de verplaatsing, als de beginsnelheid gelijk is aan 50 m s ?

Bestudeer de onderstaande bewegingen.

1 Een Tesla Model S trekt in 4,6 s gelijkmatig op tot 100 km h

2 Een Airbus 380 versnelt gelijkmatig in 35,0 s van 54 km h tot 270 km h en komt los van de startbaan.

a Bepaal voor een x-as volgens de bewegingsrichting met de oorsprong in het startpunt:

1 de uitdrukking voor de positie, de ogenblikkelijke snelheid en de versnelling;

2 de verplaatsing tijdens de snelheidstoename.

b Bereken de resulterende kracht (mTesla = 2,2 ton; mAirbus = 575 ton).

a v 4

b v 2

c v

d 2 · v

Bestudeer de vx(t)-grafiek van een landend vliegtuig (575 ton).

100 v x ( ) m s

50

0 0 10 20 30 t (s)

a Bepaal de remafstand grafisch.

b Bepaal de remafstand met berekeningen.

c Bepaal F res .

Ernest heeft een snelheid van 9,5 m s en versnelt gelijkmatig met 3,0 m s2 om Korneel, die met 12,4 m s rijdt, in te halen.

a Stel de beweging voor met de verplaatsings-, snelheids- en versnellingsvectoren.

b Na hoeveel tijd heeft Ernest dezelfde snelheid als Korneel? Hoe ver heeft Ernest dan gefietst?

c Maak de uitspraak correct en verklaar.

Ernest heeft Korneel dan zeker niet / misschien / zeker wel ingehaald.

Een bowlingbal heeft een beginsnelheid met een grootte van 22 km h en vertraagt gelijkmatig met een versnellingsgrootte van 0,34 m s2 . Na 4,5 s raakt hij de kegels.

a Welke snelheid heeft de bal als hij de kegels raakt? Hoe ver staan de kegels?

b Op welk tijdstip hoor je de kegels vallen (vgeluid = 340 m s )?

60 MODULE 11 HOOfDstUK 2 - AAN DE sLAG
ABCDEF v F2 F 1 v F 1 F2 v F 1 F2 v F 1 F2 v F 1 F2 v F 1 F2
8 9 10 11 12 13 14 15 AAN DE SLAG

Een auto versnelt vanuit rust gelijkmatig met een versnellingscomponent ax. Na een tijdsduur Δt bedraagt de snelheidscomponent v x en is de verplaatsing Δx.

Welke uitspraak is correct na een tijdsverloop 2 ∙ Δt?

a De versnellingscomponent is 2 ∙ a x .

b De snelheidscomponent is 2 ∙ v x .

c De verplaatsing is 2 ∙ Δx

d Meerdere uitspraken zijn correct.

e Geen enkele uitspraak is correct.

Bestudeer de vx(t)-grafiek van een fietser.

30 6 9 12 t (s)

a Op welk tijdstip keert de fietser om?

b Benoem de vier verschillende deelbewegingen.

(Kies uit: ‘versnelde EVRB’, ‘vertraagde EVRB’ of ‘ERB’. Benoem de bewegingszin.)

c Rangschik de versnellingen van klein naar groot.

d Bepaal de verplaatsing en de afgelegde weg voor het volledige traject.

Een blokje schuift wrijvingsloos van een helling.

b Bepaal (zonder rekentoestel):

1 de positie bij t = 2,0 s en bij aankomst;

2 de gemiddelde snelheid bij t = 2,0 s en bij aankomst;

3 de versnelling;

4 de snelheid bij t = 2,0 s en bij aankomst.

c Teken de bijbehorende vx(t)- en ax(t)-grafieken.

Een auto (1,2 ton) rijdt 4,0 s met een constante snelheid en remt dan gelijkmatig af. De grafiek toont zijn positie.

Proefversie©VANIN

a Welke curve toont de beweging van het blokje?

a Waar zou de auto zich bevinden na 12,0 s, als hij niet afremt?

b Bepaal de remkrachtvector.

Op de grafiek staan vier verschillende bewegingen met een constante versnelling weergegeven.

Rangschik de bewegingen volgens ...

a de beginpositie;

b de verplaatsing gedurende het volledige traject;

c de gemiddelde snelheidscomponent;

d de versnellingscomponent.

6161 MODULE 11 HOOfDstUK 2 - AAN DE sLAG
–10 0 5 10 15 20 –5 v x ( ) m s
0,0 10,0 20,0 30,0 40,0 50,0 x (m) 0,0 1,0 2,0 3,0 4,0 t (s) 1 2 3 4
0 0 x (m) 2,0 4,0 6,0 8,0 10,0 12,0 14,0 16,0 t (s) 10 20 30 40 50 60 70 80 90
0,0 10,0 20,0 30,0 40,0 50,0 x (m) 0,0 1,0 2,0 3,0 4,0 t (s) 1 2 3 4 16 17 18 19 20

Welke van de onderstaande bewegingen zijn ECB’s?

De blender mixt het fruit tot een smoothie met de snelheid die je instelt. De wastrommel versnelt om de was uit te zwieren. De microgolfschotel draait bij elk gekozen vermogen even snel.

Geef de gelijkenis en het verschil in snelheid(sverandering) tussen …

a een ERB en een ECB;

b een EVRB en een ECB.

Een horloge heeft een secondewijzer, een minutenwijzer en een uurwijzer.

Bereken de periode en de hoeksnelheid van elke wijzer.

Om een schrijf- en leessnelheid van 100 MB per seconde te halen, draait een harde schijf met 7 200 omwentelingen per minuut.

a Bereken de periode, de hoeksnelheid en de hoekverplaatsing na één minuut.

b Waarom gebruikt men het aantal omwentelingen per minuut om de draaisnelheid uit te drukken?

Een windmolen met wieken van 40,0 m lang maakt tien omwentelingen in 30,0 s.

Bepaal:

a de baansnelheid in km h aan het uiteinde van de wieken;

Verklaar deze fenomenen.

a Een hond schudt na een zwempartij het water uit zijn pels.

b Een piste voor baanwielrennen is steil in de bocht.

Je draait een balletje rond aan een touwtje in een horizontaal vlak. Het balletje voert een ECB uit.

Rangschik de groottes van de centripetale krachten van groot naar klein.

Proefversie©VANIN

b de centripetale versnelling aan het uiteinde van de wieken;

c de uitdrukkingen voor r (t), v(t) en a(t) in een t-n-assenstelsel met als oorsprong een punt op het uiteinde van de wieken.

Op de kermis staat een attractie waarbij je tijdens het ronddraaien tegen de wand van een ton wordt gedrukt als de grootte van de snelheid hoog genoeg is.

a Welke afbeelding stelt de krachten correct voor, als de ton een ECB uitvoert?

b Benoem de krachten.

62 MODULE 11 HOOfDstUK 2 - AAN DE sLAG
A B C D E v v v 2 · v 2 · v 2 · I 2 · I I I I m m m m m
A B C D E
21 A B C 22 23 24 25 26 27 28 AAN DE SLAG

Tijdens een bobsleewedstrijd nemen de Belgian Bullets een horizontale bocht met een straal van 65,0 m en een snelheid van 90,0 km h . De totale massa bedraagt 310 kg. Hoe groot is de centripetale kracht op de bobslee dan?

Bestudeer de onderstaande grafieken.

Proefversie©VANIN

Welke vorm hebben de grafieken van de onderstaande verbanden bij een ECB?

a ꞷ(t)

b v(t)

c a(t)

d ꞷ(T) e v(T) f ꞷ(r) g v(r) h a(r)

Een auto met een massa van 2,0 ton rijdt door een bocht met een snelheid van 80 km h . Een vrachtwagen van 8,0 ton rijdt even later door dezelfde bocht met 40 km h . Bepaal de verhouding van de grootte van: a de centripetale krachten die inwerken op de voertuigen; b de centripetale versnellingen die de voertuigen ondervinden.

Een blok (m = 0,70 kg) voert een ECB uit op een heel glad horizontaal vlak. Aan het blok is een touw met een lengte van 1,2 m vastgemaakt. Het touw breekt als de spankracht groter dan 50 N wordt.

Wat is de maximale snelheid waarmee het blok kan ronddraaien?

` Meer oefenen? Ga naar .

6363 MODULE 11 HOOfDstUK 2 - AAN DE sLAG
x y 1 2 3
29 30 31 32

HOOFDSTUKSYNTHESE

Op een voorwerp in beweging werken verschillende krachten. Ze bepalen of er een versnelling a (verandering van de snelheid v ) is.

F res = m · a = m · dv dt

Proefversie©VANIN

Beweging zonder versnelling:

∆v = 0

Een voorwerp in rust blijft in rust.

a x = ∆vx ∆t = 0

v x = 0

Een beweging met een constante snelheid in één richting: ERB

x = x0 + v0x · t

v x = v0x = constant

a x = 0

Bewegingen met verandering van snelheid (als F res ≠ 0): ∆v ≠ 0

versnelde bewegingen

F res heeft dezelfde richting als de snelheid v: verandering van de snelheidsgrootte in één richting

Rechtlijnige beweging met een constante versnelling a: EVRB

EVRB met snelheidstoename: constante kracht in de bewegingszin

beweging horizontale krachten

Voorbeeld: vrije val met de valversnelling a x = g = 9,81 m s2

64 MODULE 11 sYNtHEsE HOOfDstUK 2
x (m) 0 a v4 v3 v2 v1 = 0
F
F res 20 30 90 100 20 30 90 100 20 30 90 100 20 30 90 100
w F motor
x = x0 + v0x · t + a x 2 · t2 v x = v0x + a x · t a x = constant x (m) v 0 e x v v e x

GROOTHEDEN MET SYMBOOL EENHEDEN MET SYMBOOL

hoeksnelheid

radialen per seconde rad s

Proefversie©VANIN

F res staat altijd loodrecht op de snelheid v: verandering van de snelheidsrichting met een constante snelheidsgrootte

Voorbeeld: verticale worp met beginsnelheid v0x en versnelling a x = –g = –9,81 m s2 cirkelbeweging

baansnelheid v = R · ω meter per seconde m s

centripetale versnelling

meter per seconde in het kwadraat

Bij een ECB (eenparige cirkelbeweging) voert elk punt een cirkelbeweging uit met een vaste hoeksnelheid

ω = 2 · π T . De snelheid verandert van richting en van zin door de resulterende kracht (centripetale kracht F c p ) naar het middelpunt van de cirkel met als grootte F c

v2 R . De kracht heeft enkel een normaalcomponent

EVRB met snelheidsafname: constante kracht tegengesteld aan de bewegingszin

65 MODULE 11 sYNtHEsE HOOfDstUK 2
ω = ∆α ∆t
a c p = R · ω2 =
2
v
R
m s2
·
p = m
v1 v2 a a et e n r
t
(t)
n
x (m) 0 a v2 v3 v4 = 0 v1 beweging
F w F res 10 110 120 40 80 60 0 10 110 120 40 80 60 0 10 110 120 40 80 60 0 10 110 120 40 80 60 e x
horizontale krachten

Proefversie©VANIN

MODULE 12 ERFELIJKHEIDSLEER Proefversie©VANIN

Misschien ken je wel iemand die rood-groenkleurenblindheid heeft. Een kleurrijke verzameling fruit ziet er dan een pak minder aantrekkelijk uit. De kans dat die persoon tot het mannelijk geslacht behoort, is vrij groot. Meestal zal geen van zijn ouders en kinderen die afwijking hebben, maar zijn grootvader langs moederskant wel. Rood-groenkleurenblindheid is een van de vele erfelijke aandoeningen waarvan het overervingspatroon gemakkelijk kan worden verklaard. Kennis van dergelijke overervingsmechanismen is bijvoorbeeld belangrijk om de kans op een ernstigere aandoening te voorspellen bij het nageslacht, zodat men snel kan ingrijpen.

` Welke wetmatigheden gelden er bij de overerving van eigenschappen?

` Wat zijn de chromosomale mechanismen van overerving?

` Hoe kun je de kans voorspellen dat een bepaald kenmerk voorkomt bij het nageslacht?

We zoeken het uit! ?

VERKEN

JE KUNT AL ...

• de structuur van DNA bespreken;

• uitleggen dat voortplantingscellen haploïd en lichaamscellen diploïd zijn.

LEERT NU ...

• beschrijven hoe chromosomen zijn opgebouwd;

• uitleggen wat de geslachtschromosomen zijn;

• uitleggen hoe de meiose verloopt en bijdraagt aan de variatie tussen organismen;

• beschrijven wat ‘overkruising’ en ‘recombinatie’ betekenen.

Proefversie©VANIN

• uitleggen dat genen in de vorm van verschillende allelen kunnen voorkomen;

• uitleggen wat het verschil is tussen genotype en fenotype;

• uitleggen dat allelen bepalend zijn voor het fenotype;

• uitleggen welke wetmatigheid de verhouding tussen fenotypes en genotypes bij een kruising kan verklaren.

• verklaren waarom sommige allelen samen worden overgeërfd;

• uitleggen hoe het geslacht wordt overgeërfd;

• uitleggen dat sommige kenmerken op een geslachtsgebonden manier worden overgeërfd.

74 MODULE 12 vErkEn
JE H1 H2

HOOFDSTUK 1

Î Mendeliaanse overerving

Gregor Mendel wordt weleens de vader van de klassieke genetica genoemd. Hij voerde een groot aantal kruisingsproeven uit op erwtenplanten en ontrafelde de wetmatigheden die schuilen achter de overerving van kenmerken. Daarmee legde hij een solide basis voor een nieuwe tak in de wetenschappen: de erfelijkheidsleer.

LEERDOELEN

M Een kruisingsschema opstellen bij monohybride kruisingen

M De kans op de overerving van een kenmerk bij kruisingen bepalen

1 Inleidende begrippen

Overerving of erfelijkheid is het verschijnsel waarbij organismen kenmerken overdragen op de volgende generatie. Die overdracht vindt haar oorsprong in het feit dat bij een bevruchting een haploïd aantal chromosomen van de moeder samenkomt met een haploïd aantal chromosomen van de vader. De wetenschap die zich bezighoudt met het bestuderen van overerving, is de erfelijkheidsleer

Elk organisme bezit bepaalde kenmerken.

Proefversie©VANIN

diploïde lichaamscellen (2n)

diploïde voorlopercellen (2n) van gameten

MITOSE

diploïde lichaamscellen (2n)

S Afb. 1

MEIOSE BEVRUCHTING

haploïde spermatozoïde (n) haploïde oöcyt (n) diploïde zygote (2n)

MITOSE

Ouders geven erfelijke kenmerken door aan hun kinderen.

Voorbeelden daarvan zijn de kleur van je huid, de vorm van je oorlel of een bepaalde aandoening. In module 13 zul je zien dat die kenmerken van organismen hun oorsprong vinden in bepaalde eiwitten en dat de informatie voor de bouw daarvan vervat zit in de nucleotidevolgorde in het DNA. Een stuk DNA dat de informatie voor de bouw van een eiwit bevat, noem je een gen. Elk gen heeft een welbepaalde plaats op een chromosoom. Die plaats noem je de genlocus.

Je weet al dat een menselijke lichaamscel 23 chromosomenparen bezit. Men onderscheidt lichaamschromosomen en geslachtschromosomen. De chromosomen van een paar noem je homologe chromosomen. Bij de lichaamschromosomen hebben die elk een overeenkomstige genlocus voor een bepaald gen. De genen op die chromosomen komen dus altijd in paren voor. Van sommige genen zijn er door mutaties verschillende ‘varianten’ ontstaan, die je allelen noemt. Zo bestaat er bij erwtenplanten een gen dat codeert voor de bloemkleur. Van dat gen komen er twee allelen voor. Eén allel codeert voor een paarse kleur, het andere allel voor een witte kleur.

Mutaties zijn wijzigingen in de nucleotidevolgorde van het DNA. Je leert daarover meer in thema 03.

75 MODULE 12 hOOfDstUk 1

De letter P staat voor het Latijnse parentes (= ‘ouders’).

De letter F verwijst naar het Latijnse filia (= ‘dochter’).

Als een individu voor een bepaald gen twee identieke allelen bezit, dan is het homozygoot voor dat kenmerk. Bevat het twee verschillende allelen, dan is het heterozygoot voor dat gen.

Als een organisme voor een bepaald gen heterozygoot is en slechts een van de kenmerken tot uiting komt, dan is het allel dat tot uiting komt, het dominante allel. Het organisme vertoont dan de bijbehorende eigenschap. Bij het voorbeeld van de bloemkleur bij erwtenplanten is het allel voor paarse bloemkleur dominant. Een plant die dat allel bezit, zal paarse bloemen krijgen. Het allel dat niet tot uiting komt, is het recessieve allel

allel voor paarse bloemkleur

homozygoot

homologe chromosomen heterozygoot genlocus

S Afb. 2

allel voor witte bloemkleur

2n twee allelen voor groene erwtkleur

Proefversie©VANIN

Op een chromosoom komen meerdere genloci voor. Bij homologe chromosomen liggen beide allelen op een overeenkomstige plaats. De erwtenplant waarvan er hier een cel wordt voorgesteld, is heterozygoot voor het kenmerk bloemkleur en homozygoot voor de kleur van de zaden (erwten).

Bij kruisingen bestudeert men de overerving van kenmerken. Monohybride kruisingen zijn kruisingen tussen twee organismen waarbij men let op de overerving van één kenmerk. In voorstellingen van kruisingen worden de ouders aangeduid met de letter P en de nakomelingen met de letter F. De eerste generatie nakomelingen noem je de F1-generatie. De tweede generatie is de F2-generatie

Genetisch identieke individuen bezitten dezelfde genetische informatie: ze hebben hetzelfde genotype. Van dergelijke organismen zou je kunnen verwachten dat ze ook uiterlijk gezien perfecte kopieën zijn van elkaar. Maar vaak vertoont hun uiterlijke verschijningsvorm of fenotype verschillen. Denk bijvoorbeeld aan eeneiige tweelingen die je aan de hand van kleine verschillen toch uit elkaar kunt houden. De oorzaak van de verschillen is te vinden in omgevingsfactoren, zoals voeding, stress of levenswijze, die voor elk individu verschillend kunnen zijn. Ze kunnen een invloed hebben op de expressie van het genotype. Fenotypische verschillen tussen genotypisch gelijke individuen noem je modificaties. In module 13 leer je daar meer over.

BEGRIP

gen

VERKLARING

DNA-fragment dat de informatie voor de bouw van een eiwit bevat

allel variant waarin een gen kan voorkomen genlocus plaats van een gen op een chromosoom genotypegeheel van genen, de genetische informatie van een organisme fenotypegeheel van waarneembare kenmerken van een organisme homozygootorganisme met twee identieke allelen van een gen heterozygootorganisme met twee verschillende allelen van een gen dominant allelallel dat bij een heterozygoot organisme tot uiting komt in het fenotype recessief allelallel dat niet tot uiting komt als er een dominant allel aanwezig is monohybride kruising kruising waarbij de overerving van één kenmerk wordt bestudeerd

76 MODULE 12 hOOfDstUk 1

2 Wetten van Mendel

WEETJE

Gregor Mendel (1822-1884) werd geboren in een arm landbouwersgezin in Tsjechië en raakte op de boerderij vertrouwd met het veredelen van planten en dieren. Veredelen is het gericht kruisen van individuen om nieuwe variëteiten te bekomen. Mendel besloot om als monnik in te treden in een klooster, en daar kweekte hij planten met het oog op het ontwikkelen van nieuwe variëteiten.

Na enkele jaren in het klooster ging Mendel wiskunde studeren in Wenen. Daar leerde hij hoe hij experimenten kon opzetten en data moest analyseren en interpreteren. Terug in het klooster bestudeerde hij de overerving van kenmerken bij planten door talloze kruisingsexperimenten uit te voeren.

Gregor Mendel voerde kruisingsproeven uit met erwtenplanten. Die planten kunnen aan zelfbestuiving en aan kruisbestuiving doen. Mendel liet de natuur echter niet haar gang gaan. Hij verwijderde de meeldraden van een bloem en bracht zelf stuifmeel van een andere plant aan op haar stempel. Door de planten voor zijn experimenten doordacht te kiezen, verwierf hij inzicht in de overerving van een aantal kenmerken bij de erwtenplant, zoals bloemkleur, peulkleur en zaadvorm.

Proefversie©VANIN

kruisbestuivingen uit bij erwtenplanten.

Bij zelfbestuiving komt het stuifmeel uit de meeldraden van een bloem terecht op de stempel van dezelfde bloem. Bij kruisbestuiving komt het stuifmeel terecht op de stempel van een andere plant.

overbrengen naar

stuifmeel van de ene plant plant met gele zaden plant met groene zaden de stempel van de andere plant

77 MODULE 12 hOOfDstUk 1
S Afb. 5 Mendel voerde zelf S Afb. 3 Gregor Mendel, de pionier van de klassieke erfelijkheidsleer S Afb. 4 Een bloem van de erwtenplant (Pisum sativum)

In de tijd van Mendel was er over genetica nauwelijks iets bekend: chromosomen, genen, allelen, mitose en meiose waren nog nooit geobserveerd.

2.1 Uniformiteitswet

Voor zijn kruisingen gebruikte Mendel erwtenplanten die homozygoot zijn voor een bepaald kenmerk.

Een van de kruisingen die Mendel uitvoerde, was die tussen een plant met paarse bloemen en een plant met witte bloemen. Omdat de planten alleen verschilden in het kenmerk bloemkleur, is dat een monohybride kruising. Alle nakomelingen uit die kruising bleken paarse bloemen te hebben.

Het leek er dus op dat enkel de paarsbloemige plant dat kenmerk doorgaf aan de volgende generatie. Wanneer de F1-nakomelingen met elkaar werden gekruist, ontstond er een volgende generatie, de F2-generatie, met paarsbloemige en witbloemige erwtenplanten. De planten in de F1-generatie kunnen dus aanleiding geven tot fenotypisch verschillende nakomelingen

Proefversie©VANIN

zaadvaste planten

kruisbestuiving

S Afb. 6

Bij de kruising tussen zaadvaste planten met paarse bloemen en zaadvaste planten met witte bloemen zijn alle planten in de F1-generatie paarsbloemig. Bij de kruising tussen de paarsbloemige planten uit de F1-generatie komen er in de F2-generatie zowel paarsbloemige als witbloemige planten voor.

Mendel probeerde dat te verklaren door te veronderstellen dat er voor het kenmerk bloemkleur twee erffactoren bestaan, die worden doorgegeven van de ene generatie op de andere en die de uiterlijke kenmerken van de plant bepalen. Hij bestudeerde ook de overerving van andere kenmerken, zoals de vorm of de kleur van de erwten of de hoogte van de planten. Het overervingspatroon van die kenmerken kon hij ook verklaren aan de hand van erffactoren.

Bij zijn kruisingsexperimenten bekwam hij telkens hetzelfde resultaat: alle F1-nakomelingen bleken gelijk of uniform te zijn voor het onderzochte kenmerk. Daaruit leidde Mendel zijn eerste wet af, de uniformiteitswet

UNIFORMITEITSWET

Bij een monohybride kruising van homozygote organismen zijn alle F1-nakomelingen identiek.

De erffactoren noemt men vandaag allelen. Door onze kennis over geslachtelijke voortplanting weten we dat bij de vorming van de gameten de homologe chromosomen, en dus ook de allelen die erop liggen, van elkaar worden gescheiden tijdens de meiose. Bij de bevruchting levert elke ouder één gameet en komen voor elk kenmerk de allelen van beide ouders samen.

78 MODULE 12 hOOfDstUk 1
P
x
F1
F2

Omdat de F1-nakomelingen allemaal paarse bloemen hebben, noem je paars het dominante kenmerk. De nakomelingen bezitten ook een recessief allel, maar alleen het dominante allel komt tot uiting. Dominante allelen worden voorgesteld met een hoofdletter en recessieve met een kleine letter

Je kunt de kruising dan als volgt voorstellen:

Proefversie©VANIN

W Afb. 7 Bij een monohybride kruising van homozygote planten zijn alle F1-nakomelingen identiek. In de cirkel staat het allel dat aanwezig is in de gameten. P = allel voor paarse kleur (dominant) p = allel voor witte kleur (recessief)

WEETJE

Veredelingsmethoden zijn al zo oud als de landbouw zelf. Via kruising van wilde rassen en selectie worden er bepaalde kenmerken in de nakomelingen gebracht. De koolgewassen die we vandaag kennen, hebben een gemeenschappelijke voorouder, de wilde kool (Brassica oleracea). Elke variëteit werd bekomen na een proces van kruisen en selecteren. Van sommige kolen, zoals boerenkool of savooikool, eten we het blad. Bij koolrabi eten we de stengel en bij bloemkool of broccoli eten we de bloem. Spruitjes zijn de okselknoppen van de koolplant.

S Afb. 8

Heel wat groenten stammen af van wilde kool (

79 MODULE 12 hOOfDstUk 1
P
F1 P PP
x
paars Pp paars genotype fenotype gameten pp wit p
boerenkool wilde kool savooikool koolrabi bloemkool broccoli spruiten Brassica oleracea).

2.2 Splitsingswet

Je zag al dat Mendel ook nakomelingen van de eerste uniforme generatie (F1) met elkaar (F1 x F1) kruiste. Zo bekwam hij een tweede generatie (F2). Hij stelde niet alleen vast dat er onder de nakomelingen verschillende fenotypes voorkwamen, maar ook dat er een vaste getalsverhouding bestond tussen die verschillende fenotypes. Zo leverde de kruising van twee erwtenplanten met paarse bloemen uit de F1-generatie een F2-generatie op die zowel paarse als witte bloemen bezat. De verhouding paarse tot witte bloemen was ongeveer gelijk aan 3 : 1. Diezelfde verhouding bekwam hij ook bij de kruisingen tussen planten waarbij hij andere kenmerken onderzocht (zie tabel XXX).

Proefversie©VANIN

DOMINANTRECESSIEF bloemkleurpaars wit paars705 paars 224 wit 3,15 : 1

kleur van de zaadlob geel groen geel6 022 geel 2 001 groen 3,01 : 1 zaadvormrond hoekig rond5 474 rond 1 850 hoekig

peulvormopgezwollen ingesnoerd opgezwollen882 opgezwollen 299 ingesnoerd

peulkleurgroen geel groen428 groen 152 geel

: 1

inplantingsplaats van de bloem axiaal terminaal axiaal651 axiaal 207 terminaal 3,14 : 1 lengte van het stengellid lang kort lang787 lang 277 kort 2,84 : 1

80 MODULE 12 hOOfDstUk 1
P F1 F2 VERHOUDING DOMINANT/ RECESSIEF
KENMERK
2,96
2,95
: 1
2,82
: 1
de verschillende fenotypes in de F2-generatie na een monohybride
S Tabel XXX Een aantal van
kruising van twee homozygote ouders

Dat de ratio niet exact 3 : 1 was, schreef Mendel toe aan het feit dat de bevruchting een kansproces is. Je kunt het vergelijken met het opgooien van een munt. Hoewel er 50 % kans is op kop en 50 % op munt, zal de ratio kop : munt niet noodzakelijk 1 : 1 zijn als je het geldstuk tien keer opgooit. Hoe groter het aantal gooien, hoe meer je de ratio 1 : 1 zult benaderen, maar het is perfect mogelijk dat je 540 keer kop gooit en 460 keer munt als je een geldstuk 1 000 keer opgooit.

Proefversie©VANIN

De verklaring voor de 3 : 1-verhouding bij de fenotypes in de F2-generatie ligt in het feit dat de F1-nakomelingen heterozygoot zijn voor het  kenmerk bloemkleur. Daardoor bevat de helft van hun gameten het allel dat codeert voor de paarse bloemkleur.

De andere helft van de gameten bevat het allel dat codeert voor de witte bloemkleur. Een F2-nakomeling wordt gevormd door het samenkomen van een gameet van elke F1-ouder. De verschillende combinaties, met bijbehorende kansen, kun je weergeven in een Punnett-vierkant

Je weet al dat het allel voor paarse kleur domineert over het allel voor witte kleur.

Je duidt dat aan door het allel voor paarse kleur te benoemen met een hoofdletter (P) en het allel voor witte kleur met een kleine letter (p). Uit de kansen in het Punnettvierkant blijkt dat de verhouding van de kans op paarse bloemen tot de kans op witte bloemen 3 : 1 bedraagt. Dat komt doordat bij de vorming van de gameten de paren van allelen gesplitst worden, zodat er bij de vorming van een zygote nieuwe combinaties van allelen kunnen ontstaan.

genotype Pp fenotype paars

1

S Afb. 9

genotype Pp fenotype paars · = 1 4 1 2 1 2

genotype pp fenotype wit · = 1 4 1 2 1 2 1 2 1 2

In het voorbeeld is het genotype van de F1-plant Pp. Aangezien de allelen door meiose worden gescheiden, zal de helft van zowel de vrouwelijke als de mannelijke gameten een P dragen en de andere helft een p.

Op basis daarvan formuleerde Mendel zijn tweede wet of splitsingswet

SPLITSINGSWET

Bij de kruising van twee F1-nakomelingen van de eerste uniforme generatie ontstaan er nakomelingen met verschillende genotypes en fenotypes.

Het Punnett-vierkant is vernoemd naar Reginald Crundall Punnett (1875-1967), die het vierkant bedacht als hulpmiddel om de kruising van organismen visueel voor te stellen.

81 MODULE 12 hOOfDstUk 1
WEETJE gameten
gameten
Pp
P P P p p p 1 2 1 2 1 2 1 2 · = 1 4 1 2 1 2
F1
F2
genotype PP fenotype paars
· =
4 1 2 1 2

Via kruisingsexperimenten met verschillende erwtenrassen ontdekte Gregor Mendel wetmatigheden in de overerving van kenmerken bij organismen.

• Bij een monohybride kruising van homozygote organismen zijn alle F1-nakomelingen identiek.

• Bij de kruising van twee F1-nakomelingen uit de eerste uniforme generatie ontstaan er nakomelingen met verschillende genotypes en fenotypes. Tussen de verschillende genotypes/fenotypes bestaan er vaste getalsverhoudingen.

Proefversie©VANIN

3 Variaties op de wetten van Mendel

3.1 Onvolledige dominantie en codominantie

Bij de kruisingsexperimenten die Mendel uitvoerde, leken de F1-nakomelingen altijd op een van de ouders. De kruising van een paarsbloemige en een witbloemige plant leverde een paarsbloemige plant op. Er ontstonden geen planten met lichtpaarse of gevlekte bloemen. Dat komt doordat het allel voor paarse bloemkleur volledig dominant is tegenover het allel voor witte bloemkleur. Enkel het dominante allel laat zich gelden. Het fenotype van een heterozygoot individu is dan gelijk aan het fenotype van een homozygoot dominant individu

Voor sommige genen is geen van beide allelen volledig dominant, waardoor de nakomelingen van de F1-generatie een fenotype vertonen dat intermediair is aan dat van de ouders. In dat geval spreek je van onvolledige dominantie.

Een voorbeeld daarvan is de bloemkleur bij de leeuwenbek. Als de roodbloemige leeuwenbek wordt gekruist met de witbloemige leeuwenbek, dan hebben alle nakomelingen in de F1-generatie roze bloemen. De roze kleur is een mengvorm tussen rood en wit, de fenotypes die aanwezig zijn bij de ouderplanten. De onderlinge kruising van F1-nakomelingen levert een F2-generatie op met rode, roze en witte bloemen in een verhouding 1 : 2 : 1. In zo’n kruising stel je beide allelen voor door een verschillende (hoofd)letter.

KENMERK ALLELEN GENOTYPES FENOTYPES

bloemkleur R (rood) W (wit) RR WW RW rood wit roze

82 MODULE 12 hOOfDstUk 1

Proefversie©VANIN

S Afb. 10 De genen voor de bloemkleur van de leeuwenbek (Antirrhinum majus) vertonen onvolledige dominantie. Bij kruising van een homozygote rode en een homozygote witte bloem vertonen de nakomelingen uit de F2-generatie verschillende fenotypes met een verhouding 1 : 2 : 1.

Naast volledige en onvolledige dominantie bestaat er nog een derde dominantiepatroon, namelijk codominantie. Een voorbeeld vind je bij de Japanse roos, waarbij de kruising van homozygote roodbloemige en homozygote witbloemige planten nakomelingen oplevert met beide kleuren in één bloem. Dat wil zeggen dat beide allelen zich in dezelfde mate laten gelden

De drie dominantiepatronen kun je enkel zien bij heterozygote individuen:

• Bij volledige dominantie is het fenotype van een heterozygoot individu gelijk aan het fenotype van een homozygoot dominant individu.

• Bij onvolledige dominantie is het fenotype van een heterozygoot individu een mengvorm tussen de fenotypes van de homozygote individuen.

• Bij codominantie herken je in het fenotype van een heterozygoot individu het fenotype van zowel homozygoot dominante als homozygoot recessieve individuen.

83 MODULE 12 hOOfDstUk 1 R W R R W W R W P RR WW RW RW x F1 F2 RR gameten gameten 1 2 1 2 1 2 1 2 1 2 1 2 ·
4 1 2 1 2
WW
= 1 4 1 2 1 2 kans: · = 1
kans:
RW · = 1 4 1 2 1 2 kans: · = 1 4 1 2 1 2 kans:
S Afb. 11 Een Japanse roos (Camellia japonica)

In wat we tot nu toe bespraken, gingen we er altijd van uit dat één gen een invloed had op één fenotypisch kenmerk. In veel gevallen heeft één gen een invloed op meerdere fenotypische kenmerken. Wanneer er in zo’n gen een mutatie optreedt die de uiting van het gen of het genproduct wijzigt, dan heeft dat een invloed op al die fenotypische kenmerken. Een aantal complexe, erfelijke ziekten die gepaard gaan met talrijke symptomen, zoals sikkelcelanemie, zijn het gevolg van een mutatie in maar één gen.

frequente infecties

S Afb. 12

Een mutatie in het gen voor hemoglobine kan aan de basis liggen van een erfelijke aandoening met talrijke symptomen.

Bij sikkelcelanemie zorgt een mutatie voor de vorming van abnormale hemoglobine. Enkele symptomen van sikkelcelanemie zijn een abnormale vorm van de rode bloedcellen, bloedarmoede en een verstoorde doorbloeding van weefsels.

3.2 Multipele allelen

Volgens Mendel bestonden er van een gen twee vormen, een dominant en een recessief allel. Je weet al dat mensen en andere diploïde organismen twee allelen hebben voor een gen, maar op populatieniveau kunnen er voor een bepaald gen meer dan twee allelen voorkomen. Je spreekt van multipele allelen. Meerdere allelen kunnen talrijke combinaties van twee allelen opleveren.

VOORBEELD ABO-BLOEDGROEPEN

Een voorbeeld van multipele allelen is te vinden in het ABO-bloedgroepensysteem bij de mens. Vorig jaar leerde je al dat de bepaling van ABO-bloedgroepen te maken heeft met de aanwezigheid van suikermoleculen die gebonden zijn aan de fosfaatgroep van de fosfolipiden in het membraan van rode bloedcellen: het A-antigeen en B-antigeen. In het bloedplasma komen antilichamen tegen lichaamsvreemde bloedgroepantigenen voor.

Proefversie©VANIN

84 MODULE 12 hOOfDstUk 1
WEETJE

BLOEDGROEP ABLOEDGROEP BBLOEDGROEP ABBLOEDGROEP O

A-antigeen antigenen op de eigen rode bloedcel

B-antigeen A-antigeen B-antigeen geen A-antigeen geen B-antigeen

Proefversie©VANIN

antilichamen in het bloedplasma

anti-B anti-A geen anti-A geen anti-B anti-A anti-B

De aanwezigheid van antigenen is erfelijk bepaald door multipele allelen. In de populatie komen er drie allelen voor. Allel A codeert voor A-antigenen op de rode bloedcellen en allel B voor B-antigenen. Mensen met het 0-allel bezitten noch A-, noch B-antigenen op het oppervlak van de rode bloedcellen. De allelen A en B zijn allebei dominant ten opzichte van het 0-allel. Combinaties van telkens twee van de drie allelen per individu leiden tot de volgende genotypes en fenotypes:

KENMERK ALLELANTIGENENGENOTYPESFENOTYPES

bloedgroepA B 0 A B geen A, geen B

AA A0 bloedgroep A

BB B0 bloedgroep B

AB bloedgroep AB

00 bloedgroep O

Soms verloopt overerving complexer of wijken de verwachte frequenties bij de nakomelingen af ten opzichte van wat je op basis van de wetten van Mendel verwacht. Enkele bijzondere gevallen zijn:

BESCHRIJVING

onvolledige dominantie Geen van beide allelen van een gen is volledig dominant, waardoor nakomelingen een fenotype vertonen dat intermediair is. codominantieBeide allelen laten zich in dezelfde mate laten gelden. multipele allelenEr komen meer dan twee allelen van één gen voor, zodat er een groter aantal combinaties van allelen ontstaat.

Je spreekt van de bloedgroepen A, B en O. Het allel van bloedgroep O wordt het 0-allel (nul-allel) genoemd.

85 MODULE 12 hOOfDstUk 1

AAN DE SLAG

Bij de mens is het kenmerk ‘smalle neusgaten’ recessief ten opzichte van het kenmerk ‘brede neusgaten’. Een man met brede neusgaten en een vrouw met smalle neusgaten krijgen samen twee dochters: eentje met smalle neusgaten en eentje met brede neusgaten. Kan de dochter met brede neusgaten kinderen krijgen met smalle neusgaten? Verklaar.

Een tuinier heeft deze Japanse roos met rood-witte bloemen in zijn tuin staan. Hij wil graag een plant met volledig rode bloemen. Kan hij die zelf kweken?

Welke bloedgroepen zou je verwachten bij de kinderen van de volgende ouders, en in welke verhouding?

a Een vrouw met bloedgroep AB krijgt kinderen met een man met bloedgroep O.

b Een vrouw met bloedgroep B (genotype BO) krijgt kinderen met een man met bloedgroep AB.

De manx is een staartloze kat.

De eigenschap staartloos is het gevolg van het dominante gen A. Fokkers van dat ras hebben het volgende probleem: een homozygoot staartloze jongen is niet levensvatbaar. Ze sterven voor de geboorte. Wat is het genotype van een levenloze staartloze kat? a aa b Aa c AA d AA of Aa

Fruitvliegjes (Drosophila melanogaster) kunnen korte of lange vleugels hebben.

Een homozygoot fruitvliegje met lange vleugels wordt gekruist met een homozygoot fruitvliegje met korte vleugels. Alle nakomelingen hebben lange vleugels.

a Welk kenmerk is dominant?

b Als twee nakomelingen uit de F1-generatie worden gekruist, hoeveel procent zal dan statistisch gezien lange vleugels hebben?

c Hoeveel procent van de nakomelingen zal statistisch gezien homozygoot zijn?

Voor een bepaald kenmerk bestaan er twee allelen: een dominant en een recessief. Het dominante allel wordt voorgesteld door A, het recessieve allel door a. Bij welke kruising zal elke nakomeling uit de F1-generatie het dominante fenotype hebben?

a AA x AA

b AA x Aa

c AA x aa

d Aa x aa

Bij Andalusische hoenders erft de kleur van de veren codominant over. Een heterozygote hoender bezit veren met witte en zwarte vlekjes. Homozygote hoenders zijn zwart of wit gekleurd. Een zwarte hen wordt gekruist met een witte haan.

a Welke verhouding zul je zien bij de fenotypes in de F1-generatie?

b Welke verhouding zul je zien bij de fenotypes in de F2-generatie?

Proefversie©VANIN

Stel dat bij een hondenras de vachtkleur wordt bepaald door één gen. Het allel voor een zwarte vacht is dominant ten opzichte van het allel voor een witte vacht. Een heterozygoot vrouwtje en een wit mannetje krijgen nakomelingen.

a Stel die kruising voor in een kruisingsschema.

b Wat is de kans dat een nakomeling een witte vacht heeft?

Meer oefenen? Ga naar .

86 MODULE 12 hOOfDstUk 1 - AAn DE sLAG
1
2 3
S Een Japanse roos (Camellia japonica)
manxkitten 4 5
S Een staartloze
6 7 8

HOOFDSTUKSYNTHESE

KRUISINGSSCHEMA’S

• Monohybride kruisingen zijn kruisingen tussen twee organismen waarbij men let op de overerving van één kenmerk.

Proefversie©VANIN

• Dominante allelen worden voorgesteld met een hoofdletter, recessieve allelen met een kleine letter. In het geval van onvolledige dominantie worden er twee verschillende hoofdletters gebruikt.

• Als een individu voor een bepaald gen twee identieke allelen bezit, dan is het homozygoot voor dat kenmerk.

Bevat het twee verschillende allelen, dan is het heterozygoot.

• De verschillende combinaties van allelen in gameten, met bijbehorende kansen, worden weergegeven in een Punnett-vierkant

87 MODULE 12 sYnthEsE hOOfDstUk 1
. P x F1 P PP paars Pp paars genotype fenotype gameten pp wit p gameten F1 gameten F2 Pp genotype PP fenotype paars P P P p p p 1 2 1 2 1 2 1 2 · = 1 4 1 2 1 2 genotype Pp fenotype paars · = 1 4 1 2 1 2 genotype Pp fenotype paars · = 1 4 1 2 1 2 genotype pp fenotype wit · = 1 4 1 2 1 2 1 2 1 2
kennisclip VIDEO

WETTEN VAN MENDEL

Via kruisingsexperimenten met verschillende erwtenrassen ontdekte Gregor Mendel (1822-1884) wetmatigheden in de overerving van kenmerken bij organismen.

Proefversie©VANIN

VARIATIES OP MENDEL

1 Uniformiteitswet

Bij een monohybride kruising van homozygote organismen zijn alle F1-nakomelingen identiek.

2 Splitsingswet

Bij de kruising van twee F1-nakomelingen uit de eerste uniforme generatie ontstaan er nakomelingen met verschillende genotypes en fenotypes. Er bestaat een vaste getalsverhouding tussen de verschillende fenotypes.

BESCHRIJVING

onvolledige dominantieGeen van beide allelen is volledig dominant.

codominantie Er is geen dominant allel. Elk allel komt afzonderlijk tot uiting.

multipele allelen Het gen heeft meer dan twee allelen.

88 MODULE 12 sYnthEsE hOOfDstUk 1

HOOFDSTUK 2

VERDIEPING

Î Overerving van het geslacht en geslachtsgebonden overerving

Proefversie©VANIN

Chromosomen zijn de dragers van genen. Zowel op de lichaamschromosomen als op de geslachtschromosomen liggen er genen. Bepaalde aandoeningen bij de mens zijn te wijten aan een mutatie in een gen dat op een geslachtschromosoom ligt.

LEERDOELEN

M De overerving van het geslacht bij de mens uitleggen

M Geslachtsgebonden overerving bij de mens uitleggen

1 Overerving van het geslacht

In het begin van de twintigste eeuw ontdekte men bij een aantal soorten dat één chromosomenpaar verschillend was bij mannelijke en vrouwelijke individuen. Die geslachtschromosomen vormen de chromosomale basis voor het geslacht. Je weet al dat er bij de mens en de meeste andere zoogdieren twee verschillende geslachtschromosomen aanwezig zijn, die je voorstelt met X en Y. Vrouwelijke lichaamscellen bevatten twee X-chromosomen. Mannelijke cellen hebben een X- en een Y-chromosoom. De chromosomen die niet instaan voor de bepaling van het geslacht, zijn de autosomen

Vrouwelijke individuen produceren tijdens de oögenese oöcyten met 22 autosomen en één X-chromosoom. Omdat oöcyten altijd een X-chromosoom bevatten, zijn vrouwen homogametisch

Mannelijke individuen produceren tijdens de spermatogenese spermatozoïden met 22 autosomen en ofwel het X-chromosoom, ofwel het Y-chromosoom. Mannen zijn heterogametisch, omdat niet alle spermatozoïden hetzelfde geslachtschromosoom bevatten.

Tijdens de bevruchting versmelt een oöcyt met een spermatozoïde. Bij mensen en de meeste zoogdieren bepaalt de spermatozoïde het geslacht van de nakomeling:

• Als de spermatozoïde een X-chromosoom bevat, ontstaat er een meisje.

• Als de spermatozoïden een Y-chromosoom bevat, ontstaat er een jongen.

Omdat er bij de spermatogenese evenveel spermatozoïden met een X-chromosoom als met een Y-chromosoom worden gevormd, is de kans op een zoon of een dochter bij een bevruchting even groot (50 %).

Bij sommige mensen komen er variaties op die aantallen chromosomen voor.

Hoe bepalen de geslachtschromosomen het geslacht? Ontdek het op

89 MODULE 12 hOOfDstUk 2
GAMEET MET X-CHROMOSOOM GAMEET MET Y-CHROMOSOOM GAMEET MET X-CHROMOSOOM XX XY VERHOUDING 50 % 50 %

Het geslacht wordt niet bij alle dierlijke organismen op dezelfde manier bepaald. Bij vogels komen er ook geslachtschromosomen voor, maar daar zijn de vrouwelijke organismen heterogametisch en de mannelijke organismen homogametisch.

De geslachtschromosomen worden er voorgesteld door W en Z in plaats van X en Y. Bij heel wat spinachtigen en insecten bestaat er geen

Y-chromosoom: mannetjes bezitten één X-chromosoom (XO) en vrouwtjes twee X-chromosomen.

Proefversie©VANIN

Een sporenschildpad (Centrochelys sulcata) komt uit zijn ei.

De temperatuur tijdens de embryonale ontwikkeling is bepalend voor het geslacht bij sommige soorten schildpadden, slangen en hagedissen: bij hogere temperaturen worden er vooral vrouwtjes geboren, terwijl er bij lagere temperaturen eerder mannetjes worden geboren. De klimaatverstoring vormt dus op die manier een bedreiging voor het voorbestaan van heel wat soorten. Een daling in het aantal mannetjes zorgt er immers voor dat de oöcyten van de vrouwelijke soorten niet worden bevrucht en dat er onvoldoende of geen nakomelingen worden geproduceerd om de populatie in stand te houden.

2 Genen op de geslachtschromosomen

Omdat het Y-chromosoom korter is dan het X-chromosoom, bevat het minder genen. De X- en de Y-chromosomen hebben een verschillende vorm en worden daarom als niet-homoloog beschouwd. Genen die alleen aanwezig zijn op het X-chromosoom, kennen een X-gebonden overerving Genen die alleen op het Y-chromosoom voorkomen, kennen een Y-gebonden overerving

90 MODULE 12 hOOfDstUk 2
W Afb. 14
WEETJE
S Afb. 13 Bijeneters (Merops apiaster) S Afb. 15 Men schat dat het X-chromosoom tussen de 900 en de 1 600 genen bevat. Het Y-chromosoom zou tussen de 70 en de 200 genen bevatten.

2.1 X-gebonden recessieve aandoeningen

Een X-gebonden recessieve aandoening komt bij mannen tot uiting als ze het allel voor de aandoening op hun X-chromosoom bezitten. Bij vrouwen komt die aandoening tot uiting als ze op hun beide X-chromosomen het allel bezitten. Een vrouw die maar op één X-chromosoom het allel voor de aandoening bezit, noem je een drager

VOORBEELD DALTONISME

Proefversie©VANIN

Een voorbeeld van X-gebonden recessieve overerving is rood-groenkleurenblindheid, ook wel ‘daltonisme’ genoemd, omdat de Engelse scheikundige John Dalton (17661844) die oogafwijking had en er ook een artikel over schreef. Iemand met daltonisme heeft slecht werkende kegeltjes in het netvlies en kan daardoor het verschil tussen rood en groen moeilijk onderscheiden.

S Afb. 16

Als een kleurenblinde man kinderen krijgt met een vrouw die geen draagster is, dan zullen zowel de zonen als de dochters een normaal zicht hebben. Alle dochters zullen draagster zijn. Als een man die de aandoening niet heeft, kinderen krijgt met een draagster, zal statistisch gezien de helft van de zonen de aandoening hebben. De helft van de dochters zal statistisch gezien draagster zijn van het allel. Zonen hebben in dit geval dus een kans van 50 % op daltonisme, dochters een kans van 0 %.

moeder vader

vader

Een testkaart voor roodgroenkleurenblindheid. Een nietkleurenblinde persoon ziet het getal 74.

normaal X-chromosoomdrageraandoening op X-chromosoom

moeder

W Afb. 17

De overerving van een X-chromosoomgebonden recessieve aandoening

X-gebonden recessieve kenmerken komen bij vrouwen enkel tot uiting als ze homozygoot zijn voor het gemuteerde allel.

Je merkt dus dat bij X-gebonden overerving van een recessieve afwijking:

• er meer mannen worden getroffen door de afwijking;

• het kenmerk doorgaans niet in opeenvolgende generaties tot expressie komt: een kleurenblinde man heeft gewoonlijk geen kleurenblinde ouders, maar zijn grootvader aan moederskant vertoonde de afwijking wel.

91 MODULE 12 hOOfDstUk 2
XY xX XYxXxYXX X YxXXYxX xY XX

TDF staat voor Testes

Determining Factor.

2.2 X-gebonden dominante aandoeningen

Een X-gebonden dominante aandoening komt tot uiting zodra er één X-chromosoom met het allel voor de aandoening aanwezig is in de cel.

VOORBEELD DOMINANTE X-GEBONDEN AANDOENING

Als een gezonde man kinderen krijgt met een vrouw die de aandoening heeft, dan hebben zowel de dochters als de zonen 50 % kans om de aandoening van hun moeder te erven. Als een man met de aandoening kinderen krijgt met een gezonde vrouw, dan hebben alle dochters de aandoening, maar de zonen nooit. vader

normaal X-chromosoomaandoening op X-chromosoom moeder

S Afb. 18

De overerving van een X-chromosoomgebonden dominante aandoening

Proefversie©VANIN

2.3 Y-gebonden aandoeningen

Het Y-chromosoom bevat maar een beperkt aantal genen. Genen die een Y-gebonden overerving vertonen, komen enkel bij mannen tot uiting. Er zijn weinig voorbeelden van Y-gebonden overerving gekend bij de mens. Een voorbeeld is het TDF-gen, dat aan de basis ligt van de start van de ontwikkeling van de mannelijke geslachtsorganen. Het mannelijk geslacht wordt dus overgeërfd van vader op zoon, en komt niet bij dochters voor.

VOORBEELD SYNDROOM VAN SWYER

Het syndroom van Swyer is een Y-gebonden erfelijke aandoening waarbij TDF niet correct wordt aangemaakt. Daardoor zal het embryo, ondanks de aanwezigheid van het Y-chromosoom, zich toch uiterlijk ontwikkelen tot een meisje. Omdat die personen met vrouwelijke geslachtsorganen en een baarmoeder worden geboren, voeden hun ouders hen op als meisjes en valt de aanwezigheid van hun Y-chromosoom fenotypisch pas op in de puberteit. Hun eierstokken ontwikkelen niet goed en daardoor blijft de productie van vrouwelijke geslachtshormonen, zoals oestrogeen en progesteron, achter. Personen met het syndroom van Swyer menstrueren niet, krijgen geen borsten en zijn onvruchtbaar.

92 MODULE 12 hOOfDstUk 2
XY XX X YXXXYXXXYXXXYXX XY XX
moeder vader

De Europese koekoek is een broedparasiet: de vrouwtjes leggen hun eieren in het nest van een andere soort. Die andere soort noem je de gastheer. De gastheer staat volledig in voor het uitbroeden en grootbrengen van het koekoeksjong. De Europese koekoek parasiteert meer dan honderd verschillende soorten gastheren, maar elke vrouwtjeskoekoek legt haar eieren in het nest van maar één of een beperkt aantal soorten. Het koekoeksei heeft ongeveer dezelfde grootte en tekening als de eieren van de gastheer, en is daarom nauwelijks van de eieren van de gastheer te onderscheiden. Men vermoedt dat de genen die de keuze van de gastheer en ook de kleur en de tekening van de eieren bepalen, op het W-chromosoom liggen. Bij vogels hebben de vrouwtjes twee verschillende geslachtschromosomen, namelijk W en Z, terwijl de mannetjes twee dezelfde geslachtschromosomen hebben, namelijk WW.

koekoeksei

Proefversie©VANIN

koekoeksei

koekoeksei

gekraagde roodstaart (Phoenicurus phoenicurus) grote karekiet (Acrocephalus arundinaceus)

S Afb. 19

kleine karekiet (Acrocephalus scirpaceus)

De grootte en de kleur van een koekoeksei lijken sterk op die van de eieren van de gastheer. De genen die de grootte en de kleur bepalen, liggen vermoedelijk op het W-chromosoom.

De geslachtschromosomen vormen de chromosomale basis van het geslacht. Een oöcyt bevat 22 autosomen en één X-chromosoom. Spermatozoïden bezitten naast de 22 autosomen een X-chromosoom of een Y-chromosoom. Wanneer een oöcyt bevrucht wordt door een spermatozoïde met een X-chromosoom, ontstaat er een meisje. In het andere geval ontstaat er een jongen.

Omdat het Y-chromosoom korter is dan het X-chromosoom, bevat het minder genen. De X- en de Y-chromosomen hebben een verschillende vorm en worden daarom als niet-homoloog beschouwd.

Genen die alleen aanwezig zijn op het X-chromosoom, kennen een X-gebonden overerving

• Een X-gebonden recessieve aandoening komt bij mannen tot uiting als ze het allel voor de aandoening op hun X-chromosoom bezitten. Bij vrouwen komt die aandoening tot uiting als ze op hun beide X-chromosomen het allel bezitten. Een vrouw die maar op één X-chromosoom het allel voor de aandoening bezit, noem je een drager.

• Een X-gebonden dominante aandoening komt tot uiting zodra er een X-chromosoom met het allel voor de aandoening aanwezig is in de cel.

Genen die alleen op het Y-chromosoom voorkomen, kennen een Y-gebonden overerving Ze komen enkel bij mannen tot uiting.

93 MODULE 12 hOOfDstUk 2
WEETJE

AAN DE SLAG

Zijn de volgende stellingen juist of fout?

Verbeter de foute stellingen.

a Het is altijd zo dat op het ene chromosoom de dominante allelen liggen en op het andere chromosoom van dat paar de recessieve allelen.

b Overkruising vindt plaats tijdens meiose II.

Proefversie©VANIN

Duchenne spierdystrofie is een ernstige erfelijke spierziekte die wordt veroorzaakt door een defect in het dystrofinegen, wat leidt tot progressief spierverlies en vaak tot vroegtijdig overlijden. Het is een X-gebonden recessieve ziekte. Hoe groot is de kans dat een vrouw die het allel voor de ziekte van Duchenne draagt, toch een gezonde zoon krijgt?

Een vrouw die draagster is voor de aandoening hemofilie A, een X-gebonden recessief kenmerk, krijgt kinderen met een gezonde man. Hoe groot is de kans dat een dochter draagster is?

Meer oefenen? Ga naar .

94 MODULE 12 hOOfDstUk 2 - AAn DE sLAG
1
2 3

HOOFDSTUKSYNTHESE

GESLACHTSGEBONDEN OVERERVING

De geslachtschromosomen vormen de chromosomale basis van het geslacht:

• Een oöcyt bezit 22 autosomen en één X-chromosoom.

• Spermatozoïden bezitten naast de 22 autosomen een X-chromosoom of een Y-chromosoom

De spermatozoïde bepaalt het geslacht van de nakomeling:

• eicel X + zaadcel Y → XY =

• eicel X + zaadcel X → XX =

Proefversie©VANIN

X-GEBONDEN OVERERVING

• genen die alleen aanwezig zijn op het X-chromosoom

X-gebonden recessieve aandoening

• Komt bij mannen tot uiting als ze het allel voor de aandoening op hun X-chromosoom bezitten.

• Komt bij vrouwen tot uiting als ze op hun beide X-chromosomen het allel bezitten. Hebben ze maar op één X-chromosoom het allel voor de aandoening, dan zijn ze drager

X-gebonden dominante aandoening

• Komt zowel bij mannen als bij vrouwen tot uiting zodra er een X-chromosoom met het allel voor de aandoening aanwezig is in de cel.

Y-GEBONDEN OVERERVING

• genen die alleen op het Y-chromosoom voorkomen

• Komen alleen bij mannen tot uiting.

95 MODULE 12 sYnthEsE hOOfDstUk 2
kennisclip VIDEO

Proefversie©VANIN

MODULE 13 GENEXPRESSIE Proefversie©VANIN

Bij een albinopauw ontbreekt er pigment in de veren. Pigment wordt aangemaakt door een enzym. De erfelijke informatie voor dat enzym ligt in het DNA. Als er een mutatie aanwezig is in het gen daarvoor, werkt het enzym niet en kan het dus ook geen pigment aanmaken.

` Hoe werkt de genetische code?

` Wat gebeurt er tijdens de eiwitsynthese?

` Hoe wordt de genexpressie gereguleerd?

` Hoe ontstaan genmutaties?

We zoeken het uit!

?

VERKEN

fosfaatgroep

• uitleggen wat het onderscheid is tussen de twee soorten nucleïnezuren die voorkomen in een cel;

• uitleggen dat bij eukaryoten het DNA zich in de kern bevindt in de vorm van chromatine;

• uitleggen wat ribosomen zijn;

• uitleggen hoe eiwitten zijn opgebouwd.

A-plaats

P-plaats

• wat een gen is en hoe de genetische code werkt;

• hoe op basis van de genetische code een eiwit wordt aangemaakt.

• uitleggen wat het genotype en het fenotype van een organisme zijn.

Proefversie©VANIN

• wat de oorzaken en de gevolgen kunnen zijn van een wijziging in de DNA-sequentie;

• dat zowel het erfelijk materiaal als omgevingsfactoren bepalend kunnen zijn voor het tot expressie komen van genen.

5’ 3’
peptidyltransferase
O CH2 O P O O–O–N N-base
monosacharide 40 MODULE 13 vErkEn
H1 H2

HOOFDSTUK 1

Î Eiwitsynthese

Proefversie©VANIN

Eiwitten zorgen voor het grootste deel van de taken binnen de cel. Je kunt die biomoleculen gerust beschouwen als de ‘werkpaarden van de cel’. De genetische informatie voor de bouw van eiwitten ligt opgeslagen in het DNA. Genexpressie is het gebruiken van die genetische informatie voor de aanmaak van eiwitten.

LEERDOELEN

M Begrijpen dat organismen gebruikmaken van de genetische code

M De eiwitsynthese in een eukaryote cel beschrijven

1 DNA en RNA: even herhalen

Je weet al dat DNA en RNA nucleïnezuren zijn.

Nucleïnezuren zijn opgebouwd uit nucleotiden, die op hun beurt bestaan uit:

• een monosacharide;

• een fosfaatgroep;

• een stikstofbase (N-base).

De nucleotiden bij DNA en RNA verschillen op twee manieren:

1 in hun monosacharide

monosacharide

S Afb. 1

De algemene structuur van een nucleotide, met een fosfaatgroep, een monosacharide en een N-base

De monosacharide kan ofwel ribose, ofwel desoxyribose zijn. Het verschil tussen beide bestaat in een hydroxylgroep (-OH) op een van de koolstofatomen:

• DNA is opgebouwd uit desoxyribonucleotiden.

• RNA is opgebouwd uit ribonucleotiden.

2 in hun N-base

Er zijn vijf verschillende N-basen: adenine (A), cytosine (C), guanine (G), thymine (T) en uracil (U).

• De N-basen A, C en G komen zowel in DNA als in RNA voor.

• De N-base T komt enkel in DNA voor

• De N-base U komt enkel in RNA voor.

S Afb. 2

Desoxyribose en ribose verschillen van elkaar in een hydroxylgroep (-OH) op een van de koolstofatomen.

41 MODULE 13 hOOfDstUk 1
O CH2 O P O O–O–N N-base fosfaatgroep
OH
OH OH
O
desoxyribose O
ribose

fosfaat monoscharide

DNA RNA cytosine (C)guanine (G) thymine (T) desoxyribose

adenine (A)

Proefversie©VANIN

adenine (A)cytosine (C)guanine (G) uracil (U)

S Afb. 3 De structuur van de vier nucleotiden die voorkomen in DNA en RNA

DNA bestaat uit twee strengen. Elke streng is een polymeer van nucleotidemoleculen. De strengen zijn helixvormig rond elkaar gewonden tot een dubbele helix.

DNA is de drager van genetische informatie. Die informatie ligt vervat in de volgorde waarin de nucleotiden A, C, G en T aan elkaar gekoppeld zijn.

Ook RNA is een polymeer van nucleotidemoleculen. Het bestaat echter maar uit één streng. Er bestaan verschillende types RNA.

Je zult later zien dat zowel DNA als de verschillende types RNA belangrijk zijn voor de cel wanneer ze eiwitten aanmaakt.

42 MODULE 13 hOOfDstUk 1 NH2 N ON OH
CH2 O P O O–O– N N O O N N N H2N CH3 HN NH2 N O N N O HN NH2 N ON OHOH
ribose CH2 O P O O–O– N N O O N N N H2N HN NH2 N O N N O HN
N-basen

waterstofbrug

fosfaatgroep

= adenine (A)

= thymine (T)

= cytosine (C)

= guanine (G)

Proefversie©VANIN

desoxyribose

S Afb. 4

De basenparing tussen complementaire nucleotideketens (links) en de DNA-dubbelehelixstructuur (rechts).

Het einde van de keten met de sacharide wordt het 3’-einde genoemd, het fosfaateinde het 5’-einde.

Elke streng in de DNA-molecule heeft een 3’- en een 5’-einde.

De koolstofatomen van desoxyribose worden genummerd van 1’ tot en met 5’. Aan het uiteinde van een DNA-molecule draagt het 5’-C-atoom in beide strengen een fosfaatgroep. Het 3’-C-atoom draagt een OH-groep. Beide uiteinden van een streng zijn dus verschillend.

VERSCHILLEN

secundaire structuurdubbelstrengig enkelstrengig base thymine (T) uracil (U) monosacharide desoxyribose ribose

S Afb. 5

Voorstelling van de enkelstrengige polynucleotidestructuur van RNA. De thyminebase (T) wordt hier vervangen door een uracilbase (U).

desoxyribose CH2 5’ 4’ 1’ 3’2’

S Afb. 6

43 MODULE 13 hOOfDstUk 1
P P A C G U P P
ribose N-base 5’ 3’
ruggengraat
5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ ruggengraat P A A G G C C T T P P P P P P P
DNA-helixstructuur
antiparallelle polynucleotiden
fosfaatgroep
N-base
DNA RNA
VIDEO ON
3D-beeld DNA
OH

2 Eiwitsynthese

Eiwitten of proteïnen zijn opgebouwd uit aminozuren. Ze zorgen voor het grootste deel van de taken binnen de cel. Eiwitten worden in de cel aangemaakt tijdens een proces dat je de eiwitsynthese noemt. Tijdens dat proces wordt de informatie die in het DNA ligt opgeslagen, door de cel gebruikt om eiwitten aan te maken.

2.1 Definitie van een gen

Een gen is een sequentie of opeenvolging van DNA-nucleotiden die wordt omgezet naar RNA. Er zijn twee types van genen:

• genen die de code bevatten om een eiwit aan te maken. De DNA-sequentie wordt omgezet naar een type RNA dat je messenger-RNA of mRNA noemt;

• genen voor de aanmaak van andere types RNA. Een voorbeeld daarvan is ribosomaal RNA of rRNA, dat deel uitmaakt van de ribosomen.

In een stuk DNA dat de code voor een eiwit bevat, wordt de sequentie van één streng omgezet naar RNA. Je zegt dat die DNA-streng wordt overgeschreven of gekopieerd naar RNA. De nucleotidevolgorde in de RNA-kopie is hetzelfde als de nucleotidevolgorde in de 5’-3’-DNAstreng. Alleen bezit het DNA nucleotiden met de base thymine (T), terwijl in RNA de base uracil (U) voorkomt op die plaats. De 5’-3’-streng noem je de coderende streng

Wanneer men spreekt over de sequentie van een gen, bedoelt men daarmee de sequentie van de coderende streng. De sequentie van een gen lees je dus altijd van 5’ naar 3’.

coderende streng

Proefversie©VANIN

niet-coderende streng

RNA-kopie van de coderende streng

S Afb. 7

De niet-coderende streng wordt overgeschreven. De nucleotidevolgorde in de RNA-kopie is hetzelfde als de nucleotidevolgorde in de 5’-3’-DNA-streng of de coderende streng. In de RNA-streng komt er een U voor op de plaats waar er in de DNA-streng een T zit.

44 MODULE 13 hOOfDstUk 1
3’ 3’ 5’ 5’ 3’ 5’
G G G G G G G G G G G G C G C C C C C C C C C C C T T T T T T A A A A A A U U A A U
RNA

2.2 De genetische code

Coderend DNA bevat de code om eiwitten te maken. Eiwitten en DNA hebben nochtans een zeer verschillende opbouw. DNA kun je beschouwen als een moleculaire taal met vier verschillende letters (A, C, T en G). Je kunt daarmee zestien combinaties maken met twee letters (AA, AC, AT, AG …) en 64 combinaties met drie letters (AAA, AAC, AAT, AAG …).

Cellen gebruiken voor de aanmaak van eiwitten over het algemeen twintig verschillende aminozuren. Er moeten dus minstens twintig codes in het DNA aanwezig zijn om die te onderscheiden. Het is niet voldoende om combinaties te maken van twee DNA-nucleotiden, want dat levert maar zestien verschillende mogelijkheden op. Daarom maakt de cel gebruik van 64 combinaties van drie letters. Zo’n opeenvolging van drie DNA-nucleotiden op de coderende streng die overeenstemt met een bepaald aminozuur, heet een DNA-codon.

De genetische code wordt meestal voorgesteld met RNA-codons. Er wordt immers eerst een RNA-kopie gemaakt van het DNA dat de code voor een eiwit bevat. De RNA-codons zijn gelijk aan de DNA-codons, met uitzondering van het gebruik van U in plaats van T. De RNA-kopie is de leidraad voor de aanmaak van een polypeptide.

Proefversie©VANIN

S Afb. 8

Voorstelling van de genetische code in cirkelvorm. Deze afbeelding lees je van binnen naar buiten. Op de buitenste ring kun je de afkorting van het overeenkomstige aminozuur aflezen. Je leest een codon altijd van 5’ naar 3’.

45 MODULE 13 hOOfDstUk 1
G A A G C U A A A C C C C G G G U U U U U C C C C C C C C C C C C C C C C A A A A A A A A A A A A A A A A G G G G G G G G G G G G G G G G U U U U U U U U U U U U U U U Gly Phe 3’ 3’ 3’ 3’ Leu Ser Tyr Cys Trp Leu Pro His Gln Arg Met Thr Asn Lys Ser Arg Val Ala Asp Glu STOPSTOP START STOP 5’ Ile

Er zijn drie types van codons:

• Er zijn 61 aminozuurcodons. Die codons zorgen ervoor dat het overeenkomstige aminozuur wordt ingebouwd in het eiwit.

• Er zijn drie stopcodons (UAA, UAG en UGA). Die zorgen ervoor dat de aanmaak van het eiwit wordt stopgezet. Opgeteld zijn dat alle 64 codons.

• Het laatste type is het startcodon. Voor de vorming van een eiwit is er een duidelijk startpunt nodig. Het RNA-codon AUG heeft daarom een dubbele functie. Het codeert namelijk ook voor het inbouwen van het aminozuur methionine. Het eerste AUG in de code is het startcodon.

Aangezien er meer aminozuurcodons dan aminozuren zijn, zijn er voor de meeste aminozuren meerdere codons. Voor leucine (Leu) zijn er bijvoorbeeld zes codons. Voor tryptofaan (Trp) is er maar één codon.

S Afb. 9 Via de genetische code wordt het mRNA vanaf het startcodon omgezet in een polypeptide.

2.3 De stappen van de eiwitsynthese

De nucleotidevolgorde in het DNA levert de informatie die nodig is om een eiwit te maken.

De eiwitsynthese bestaat uit twee stappen:

A De transcriptie: een stuk DNA wordt omgezet naar een RNA-kopie. De RNA-kopie die de genetische code bevat voor de synthese van een eiwit, is het messenger-RNA of mRNA.

B De translatie: dat mRNA wordt vertaald naar een eiwit.

Proefversie©VANIN

groeiende aminozuurketen

kleine subeenheid grote subeenheid

kopie van de informatie uit de celkern (mRNA)

W Afb. 10

De eiwitsynthese bestaat uit twee processen, transcriptie en translatie. Tijdens de transcriptie maakt de cel een RNA-kopie van een gen. Die kopie, die bestaat uit nucleotiden, wordt tijdens de translatie vertaald naar een eiwit.

46 MODULE 13 hOOfDstUk 1
A A A A A A A U U U U U U U U U U G G G G G G G G G C C C C C mRNA 5’ 3’ peptide START STOP Val Met Leu Trp Met Arg Leu
G G C U A G C U A C U A G C U A G U U 5' 3' kern cytoplasma translatie tRNA
mRNA RNA DNA transcriptie

A Transcriptie

De transcriptie gebeurt in de celkern en verloopt in drie stappen: initiatie, elongatie en terminatie.

Stap 1: initiatie

De eerste stap van de transcriptie is de initiatie. Meerdere eiwitten, de transcriptiefactoren, binden op de promotor voor het gen. De promotor is een DNA-sequentie die net voor een gen ligt. Ze dient als startplaats voor de transcriptie, maar wordt zelf niet overgeschreven. Als de transcriptiefactoren gebonden zijn, kan het enzym RNA-polymerase binden. Transcriptiefactoren en RNA-polymerase vormen samen het startcomplex

Proefversie©VANIN

transcriptiefactoren

promotor

RNA-polymerase

Stap 2: elongatie

Na de initiatie volgt de elongatie: RNA-polymerase beweegt zich over het DNA en breekt de dubbele helix stukje per stukje open. Vervolgens maakt RNA-polymerase een RNA-kopie van de niet-coderende DNA-streng. Die kopie noem je het pre-mRNA. Terwijl RNA-polymerase opschuift, groeit de gevormde pre-mRNA-streng en sluit het DNA achter RNA-polymerase zich opnieuw tot een dubbele helix.

pre-mRNA

promotor

DNA

RNA-polymerase

coderende streng

De elongatie van de transcriptie in de celkern

niet-coderende streng

richting van de transcriptie

47 MODULE 13 hOOfDstUk 1
startcomplex
W Afb. 11 De initiatie van de transcriptie bij eukaryoten
5’
3’ 3’
5’
5’
RNA-nucleotiden
S Afb. 12

pre-mRNA

Stap 3: terminatie

De laatste stap van de transcriptie is de terminatie. Bij de vorming van het pre-mRNA stopt de transcriptie nadat er een specifieke sequentie (AAUAAA) is ingevuld. Enzymen herkennen die sequentie en maken vervolgens het gevormde pre-mRNA los van het DNA. Daarna voegen enzymen een serie van A-nucleotiden toe. Die vormen de poly-A-staart, die het pre-mRNA beschermt tegen afbraak.

Het pre-mRNA ondergaat nog een bewerking voordat het de kern verlaat. Die bewerking noem je splicing. Dat omvat het wegknippen van stukken uit het pre-mRNA om mRNA te vormen. Een complex van eiwitten en een bepaald type kleine RNA-moleculen, dat je het spliceosoom noemt, knipt sequenties weg. De weggeknipte sequenties noem je introns. Zo blijven enkel de exons over, de sequenties die deel zullen uitmaken van het mRNA en die tijdens de translatie zullen worden vertaald tot een eiwit.

Proefversie©VANIN

1

5’ startcodon voor translatie

mRNA

5’

startcodon voor translatie

S Afb. 13 Splicing van pre-mRNA met twee introns tussen drie exons

stopcodon voor translatie poly-A-staart

stopcodon voor translatie poly-A-staart AAAAAAAA

Het transcriptieproces bij eukaryoten gebeurt in de celkern. De aanmaak van een RNA-kopie, het pre-mRNA, verloopt in drie stappen:

• Het proces start met de initiatie. Eiwitten, de transcriptiefactoren, binden op een promotorsequentie en maken de binding van RNA-polymerase mogelijk. Op die manier ontstaat het startcomplex.

• Bij de elongatie opent RNA-polymerase de DNA-dubbelstreng en maakt het een RNAkopie. De streng die wordt overgeschreven, is de niet-coderende streng. De andere streng is de coderende streng

• In de laatste stap, de terminatie, komt RNA-polymerase voorbij een specifieke sequentie. Daardoor komt het RNA los van het DNA.

Vervolgens gebeurt de splicing. Tijdens dat proces wordt pre-mRNA omgevormd tot mRNA. Splicing gebeurt in de celkern door het spliceosoom. Het spliceosoom knipt de introns weg en hecht de overblijvende exons aan elkaar. Zo ontstaat mRNA, dat de celkern verlaat voor translatie.

48 MODULE 13 hOOfDstUk 1
EXON
INTRON
SPLICING INTRON
EXON
EXON
1
2
2
3
A A A A A A A A

B Translatie

Het mRNA wordt getransporteerd naar het cytoplasma van de cel en zal daar worden vertaald tot een eiwit. Voor de translatie van mRNA zijn er ribosomen en tRNA nodig.

B1 tRNA

Transfer-RNA’s of tRNA’s zijn kleine RNAmoleculen met een specifieke opvouwing. Aan één zijde van de molecule kan een mRNA-codon binden en aan de andere zijde een aminozuur dat bij datzelfde mRNAcodon hoort. De plaats waar het mRNAcodon kan binden, noem je het anticodon.

bindingsplaats voor aminozuur Asp

Proefversie©VANIN

lus 1 lus 2 lus 3

voor Asp

B2 rRNA en ribosomen

Het mRNA en de tRNA’s moeten op een gestructureerde manier met elkaar in contact komen. Dat is mogelijk door de ribosomen. Elk ribosoom bestaat uit twee delen, de kleine subeenheid en de grote subeenheid. Beide delen zijn opgebouwd uit eiwitten en ribosomaal RNA of rRNA.

De twee subeenheden binden aan elkaar en houden het mRNA ertussen vast. Een ribosoom schuift over het mRNA vanaf het startcodon tot het stopcodon om de code af te lezen. In de grote subeenheid bevinden zich twee plaatsen waar tRNA’s met hun aangehechte aminozuren kunnen binden op het mRNA: de P-plaats en de A-plaats.

S Afb. 14

Een vlakke voorstelling van het transfer-RNA. tRNA’s hechten met hun ene kant aan het mRNA via het juiste anticodon. Aan de andere kant van de molecule is het overeenkomstige aminozuur vastgehecht.

aminozuurketen

S Afb. 15

Voorstelling van een ribosoom 3D-beeld

P-plaats A-plaats anticodon anticodon

49 MODULE 13 hOOfDstUk 1
anticodon tRNA mRNA codon
5' 3'
3' 5' GAC A C C G A G G C G G GGG G G G G C C C x x CC C C C C C C C C G G G G C U U U C U U U U C x x UUU U U U C C G U G G G G G G A A A A A A A A A A A
GROTE SUBEENHEID KLEINE SUBEENHEID
codon
5’ 3’
codon
VIDEO
ribosoom

B3 Verloop van de translatie

De translatie gebeurt in het cytoplasma. Net zoals de transcriptie verloopt ze ook in drie stappen:

Stap 1: initiatie

tRNA

A-plaats

P-plaats grote subeenheid

De eerste stap van de translatie is de initiatie. Er wordt een startcomplex gevormd dat bestaat uit de grote en de kleine subeenheid van het ribosoom, het mRNA en het tRNA, dat het eerste aminozuur methionine aanbrengt. Een tRNA met een aangehechte methionine noteer je als tRNAMet. Dat tRNAMet bindt op het startcodon van het mRNA. Het bevindt zich op de P-plaats.

Stap 2: elongatie

De volgende stap is de elongatie peptidyltransferase

Proefversie©VANIN

startcodon kleine subeenheid

Afb. 16 De initiatie van de translatie

P-plaats

Een tRNA met het juiste anticodon bindt op het tweede codon van het mRNA. Op de afbeelding is dat tRNAAla. Het bevindt zich op de A-plaats.

P-plaats

A-plaats

Er wordt vervolgens een peptidebinding gevormd tussen het aminozuur dat door het tRNA wordt aangeleverd, en de methionine die al aanwezig is. De dipeptide (Met-Ala) is nu gebonden op het tRNA op de A-plaats.

50 MODULE 13 hOOfDstUk 1
5’ 3’ A-plaats
5’ 3’
5’
3’
S

A-plaats

P-plaats

Het ribosoom schuift vervolgens drie nucleotiden op van 5’ naar 3’. Daardoor komt het eerste tRNA los. Het tRNA met de groeiende aminozuurketen bevindt zich nu op de P-plaats en de A-plaats is vrij.

Stap 3: terminatie

A-plaats

P-plaats

Het proces herhaalt zich. Daarbij wordt de groeiende aminozuurketen telkens aangehecht op het aminozuur dat wordt aangeleverd door het tRNA op de A-plaats.

Proefversie©VANIN

De laatste stap is de terminatiefase. Op een bepaald moment zal er op de A-plaats een stopcodon voorkomen. Dat bindt niet met tRNA, maar met een eiwit, de release factor. Dat zorgt ervoor dat de gevormde aminozuurketen, het mRNA, het tRNA en de kleine en grote subeenheid van het ribosoom van elkaar loskomen.

De terminatie van de translatie

release factor

Na de terminatie gebeurt nog de nabewerking en opvouwing van de aminozuurketen tot een functioneel eiwit.

release factor

51 MODULE 13 hOOfDstUk 1
5’ 3’
5’ 3’
aminozuurketen
GROTE
KLEINE
mRNA tRNA
stopcodon
SUBEENHEID
SUBEENHEID
S Afb. 17

De studie van het genoom, transcriptoom en proteoom noem je respectievelijk genomics, transcriptomics en proteomics

WEETJE

Op basis van de stappen in de eiwitsynthese kun je de cel op drie niveaus bekijken:

• Het genoom bevat alle genetische informatie, alle DNA-sequenties in een cel. Het DNA in de mitochondriën en chloroplasten behoort dus ook tot het genoom van een cel.

• Het transcriptoom omvat al het RNA in een cel dat gevormd is via transcriptie. Naast (pre-)mRNA omvat dat ook andere types RNA-moleculen, zoals tRNA en rRNA.

• Het proteoom is het geheel van alle eiwitten die aanwezig zijn in een cel.

Binnen een individueel organisme is het genoom van alle lichaamscellen gelijk.

Het transcriptoom en proteoom zijn wel verschillend bij verschillende celtypes.

Het transcriptoom en proteoom dat aanwezig is in een cel, verschilt van moment tot moment.

GENOOM

Proefversie©VANIN

TRANSCRIPTOOM PROTEOOM

S Afb. 18 De begrippen ‘genoom’, ‘transcriptoom’ en ‘proteoom’

Het proces van translatie verloopt in drie stappen:

1 initiatie

Er wordt een startcomplex gevormd, dat bestaat uit de grote en de kleine subeenheid van een ribosoom, mRNA en tRNA met methionine. Het tRNA bindt met het startcodon AUG.

2 elongatie

Een tRNA met een aminozuur hecht zich op de A-plaats. Er wordt een peptidebinding gevormd tussen het aminozuur op de P-plaats en dat op de A-plaats. Het ribosoom schuift op. Het tRNA dat op de P-plaats voorkwam, komt vrij en het andere tRNA bezet nu de P-plaats. Het proces herhaalt zich en de aminozuurketen groeit.

3 terminatie

De release factor bindt op het stopcodon, waardoor de polypeptide, het tRNA en de release factor vrijkomen van het ribosoom.

52 MODULE 13 hOOfDstUk 1
bindingsplaats voor aminozuur Asp anticodon tRNA mRNA codon voor Asp 5' 3' lus 1 lus 2 lus 3 3' 5' GAC A C C G A G G C G G GGG G G G G C C C x x CC C C C C C C C C G G G G C U U U C U U U U C x x UUU U U U C C G U G G G G G G A A A A A A A A A A A tRNA mRNA

AAN DE SLAG

Bij welk nucleïnezuur kun je deze begrippen plaatsen?

nucleotidepolymeer – adenine –dubbele helix – uracil – nucleotide –desoxyribose – monosacharide

a DNA b RNA c beide

Zijn de onderstaande uitspraken juist of fout?

a RNA bevat ribose als suikermolecule, terwijl DNA desoxyribose bevat.

b RNA gebruikt uracil als een stikstofhoudende base in de nucleotiden, terwijl DNA thymine gebruikt.

c RNA is opgewonden tot een dubbele helix.

De sequentie van één streng van een stukje DNA is gegeven. Wat is de sequentie van de andere streng?

5’ACCGTTCGA3’

Vul de zin aan met de juiste aantallen.

Van de mogelijke codons komen er overeen met aminozuren.

Schrijf met behulp van de genetische code welk mRNA bij deze polypeptide hoort:

Met – Lys – Arg – Glu – Val – Phe – Cys – Pro

a Wat merk je op?

b Hoe verklaar je dat?

Welke peptide wordt er aangemaakt op basis van deze nucleotidesequentie in het RNA?

5’AUGAUUACGGAUUCA3’

De sequentie van de coderende streng van een stukje DNA is gegeven. Wat is de sequentie van het pre-mRNA dat tijdens de transcriptie wordt gevormd?

5’ACCAGTGTACTT3’

Waar horen de onderstaande begrippen en processen?

translatie – tRNA – DNA – ribosoom – mRNA –rRNA – pre-mRNA – groeiende aminozuurketen –transcriptie

De onderstaande afbeelding stelt een stap van de eiwitsynthese voor.

a Welke stap wordt er voorgesteld?

b Welke vier fouten merk je op?

Vul de tekst aan met de juiste benaming voor het omschreven proces en met de plaats waar dat proces gebeurt.

a Het overschrijven van DNA naar pre-mRNA gebeurt . Dat proces noem je .

b Het wegknippen van introns uit het pre-mRNA gebeurt . Dat proces noem je .

c Het vertalen van de nucleotidevolgorde in mRNA naar een aminozuurvolgorde gebeurt . Dat proces noem je

De onderstaande afbeelding stelt de processen transcriptie en translatie voor. Welke begrippen horen bij de aangeduide nummers?

Meer oefenen? Ga naar .

53 MODULE 13 hOOfDstUk 1 - AAn DE sLAG
a kern b cytoplasma 1 2 3 4 5 6 7 8
promotor DNA coderende streng DNA-polymerase promotor RNA richting van de transcriptie 5’ 5’ 5’ 3’ 3’ RNA-nucleotiden
1 5 6 7 8 4 2 3 9 10 11
Proefversie©VANIN

HOOFDSTUKSYNTHESE

Transcriptie

Verloopt in drie stappen:

• Initiatie: transcriptiefactoren en RNA-polymerase binden op de promotor. Het startcomplex wordt gevormd.

• Elongatie: RNA-polymerase opent de DNA-dubbelstreng en maakt een RNA-kopie.

• Terminatie: RNA komt los van DNA.

Translatie

Verloopt in drie stappen:

• Initiatie: de kleine subeenheid van een ribosoom bindt met rRNA. mRNA schuift door de kleine subeenheid, tot tRNA bindt met het startcodon. De grote subeenheid bindt aan het startcomplex.

• Elongatie: op elk codon van het mRNA wordt een tRNA met het juiste anticodon aangebracht. De aminozuren worden met peptidebindingen aaneengeschakeld. Zo wordt een aminozuurketen opgebouwd

EIWITSYNTHESE

Proefversie©VANIN

54 MODULE 13 synthEsE hOOfDstUk 1
promotor DNA coderende streng RNA-polymerase niet-coderende streng pre-mRNA richting van de transcriptie 5’ 5’ 5’ 3’ 3’ RNA-nucleotiden
5’ 3’ A-plaats P-plaats grote subeenheid tRNA startcodon kleine subeenheid 5’ 3’ A-plaats P-plaats release factor stopcodon aminozuurketen release factor GROTE SUBEENHEID KLEINE SUBEENHEID mRNA tRNA
kennisclip VIDEO

HOOFDSTUK 2

Î Mutatie en epigenetische modificatie

Proefversie©VANIN

Het begrip ‘modificatie’ betekent ‘aanpassing’ of ‘wijziging’. In dit hoofdstuk bespreken we wijzigingen van DNA, die we onderverdelen in twee groepen. Wijzigingen in de nucleotidesequentie van het DNA noem je mutaties. Wijzigingen in het methylatiepatroon op de nucleotiden of de histoneiwitten waarrond DNA gewikkeld zit, noem je epigenetische modificaties

LEERDOELEN

M Uitleggen dat zowel genen als omgevingsfactoren de kenmerken van een organisme beïnvloeden

M Uitleggen welke effecten mutaties kunnen hebben

M Uitleggen wat epigenetische modificaties zijn

M Uitleggen of epigenetische modificaties worden overgeërfd

M Mutaties en epigenetische modificaties onderscheiden

1 Genen versus omgeving

Je weet al dat niet alle individuen van dezelfde soort fenotypisch gelijk zijn. Dat komt doordat zowel genetische verschillen als omgevingsfactoren de kenmerken van organismen beïnvloeden. De discussie over hoe groot het aandeel van beide is in het ontstaan van een bepaald kenmerk, noem je het nature-nurturedebat. Met ‘nature’ bedoelt men het geheel van genetische informatie. ‘Nurture’ omvat de invloed van omgevingsfactoren, zoals opvoeding, stress, voeding of milieufactoren.

Er zijn nauwelijks of geen voorbeelden van kenmerken of aandoeningen te vinden waarvoor enkel genetische factoren of enkel omgevingsinvloeden verantwoordelijk zijn. Voor heel wat waarneembare kenmerken spelen zowel genetische als omgevingsfactoren een rol. Bij de ontwikkeling van diabetes type 2 is er bijvoorbeeld een erfelijke aanleg, maar er is ook duidelijk een link met overgewicht, een te vetrijke voeding en te weinig lichaamsbeweging.

syndroom van Down hemofilie klompvoet maagzweer

GENEN / NATURE

fenylketonurie (PKU)

hartziekte

diabetes type 2

OMGEVINGSFACTOREN / NURTURE

W Afb. 19 Voorbeelden van aandoeningen die zich in meer of mindere mate onder invloed van genen en/of de omgeving ontwikkelen

Diabetes type 2 wordt gekenmerkt door een verminderde gevoeligheid van je cellen voor insuline.

55 MODULE 13 hOOfDstUk 2
tuberculose
autisme

Op vind je meer info over tweelingstudies.

Autisme werd voor het eerst beschreven in de jaren 1940. Lange tijd werd bij kinderen met autisme de oorzaak van de aandoening bij de moeder gelegd. Wanneer die kil en afstandelijk was naar haar kind toe, zou dat leiden tot onvoldoende emotionele en sociale ontwikkeling bij het kind. Bij die zienswijze werd dus een zeer belangrijke rol toebedeeld aan het aspect ‘nurture’. Die theorie werd de ‘koelkastmoedertheorie’ genoemd.

Onderzoek wijst echter uit dat autisme een karaktereigenschap is die op zijn minst voor een deel erfelijk bepaald is. Waarschijnlijk spelen honderden genen een rol bij de ontwikkeling van autisme. Toch zijn er ook omgevingsfactoren die mogelijk belangrijk zijn. Statistisch onderzoek toont aan dat het risisco op autisme toeneemt met de leeftijd van de vader op het moment van bevruchting. Ook diabetes of een vitamine D-tekort bij de moeder doen het risico toenemen. Of er ook een oorzakelijk verband is, vraagt nog verder onderzoek.

Proefversie©VANIN

Om te onderzoeken of bij een bepaalde eigenschap eerder een genetische dan wel een omgevingscomponent bepalend is, voeren wetenschappers onder andere tweelingstudies uit. Eeneiige tweelingen delen hetzelfde genoom. Twee-eiige tweelingen zijn genetisch even verwant als gewone broers en zussen.

S Afb. 21

Een twee-eiige of dizygote tweeling ontstaat wanneer twee afzonderlijke eicellen bevrucht werden. Twee-eiige tweelingen kunnen een verschillend geslacht hebben.

Bij de tweelingen die bij een tweelingstudie worden onderzocht, groeien beide leden samen op, zodat een groot deel van de omgevingsfactoren hetzelfde is. In de studie gaat men na in hoeverre een bepaalde eigenschap aanwezig is bij de twee leden van een tweeling. Als er een grotere overeenkomst is bij eeneiige dan bij twee-eiige tweelingen, dan heeft de eigenschap mogelijk een belangrijke genetische component. Zo ontdekte men bijvoorbeeld dat het intelligentiequotiënt (IQ) vooral wordt bepaald door erfelijke factoren.

Kenmerken van een organisme zijn het resultaat van een interactie tussen genetische factoren en omgevingsfactoren.

• Het aandeel van genetische factoren duidt men aan met het begrip ‘nature’.

• De bijdrage van omgevingsfactoren noemt men ‘nurture’.

De effecten van genen en omgeving staan niet los van elkaar. Voor heel wat waarneembare kenmerken spelen beide factoren een rol. Om te onderzoeken hoe groot die rol is, kunnen er tweelingstudies worden uitgevoerd.

56 MODULE 13 hOOfDstUk 2
S Afb. 20 Eeneiige of monozygote tweelingen zijn genetisch identiek, aangezien ze ontstaan uit één bevruchte eicel.
WEETJE

2 Mutatie

Mutaties zijn erfelijke wijzigingen in de basensequentie van het DNA. De frequentie waarmee mutaties optreden, is heel laag. Bovendien bezit de cel systemen waarmee mutaties kunnen worden hersteld. Je kunt mutaties indelen op basis van oorzaak, organisatieniveau en effect.

2.1 Indeling op basis van oorzaak

A Spontane mutaties

Spontane mutaties zijn wijzigingen in de basensequentie van het DNA die plots ergens willekeurig ontstaan.

Je weet al dat bij de DNA-replicatie het enzym DNA-polymerase een nieuwe complementaire streng aanmaakt.

Soms maakt de polymerase een fout en bouwt ze een verkeerd nucleotide in. DNA-polymerase bezit echter proofreadingactiviteit: ze is in staat om haar eigen werk te controleren, een eventuele fout te detecteren en het verkeerde nucleotide te vervangen. Als een fout niet wordt hersteld, wordt ze bij de celdeling doorgegeven aan de dochtercellen.

B Geïnduceerde mutaties

Proefversie©VANIN

DNA-polymerase bouwt een verkeerd nucleotide in: T in plaats van C.

DNA-polymerase detecteert de fout.

DNA-polymerase verwijdert het verkeerde nucleotide.

S Afb. 22

Door de proofreadingactiviteit van DNA-polymerase kunnen spontane mutaties worden weggewerkt.

Geïnduceerde mutaties worden veroorzaakt door mutagene factoren of mutagenen. Voorbeelden van dergelijke factoren zijn bepaalde soorten straling, zoals ioniserende en uv-straling. Ook sommige moleculen, zoals benzopyreen, kunnen mutaties induceren.

B1 Ioniserende straling Ioniserende straling zorgt ervoor dat er in ons lichaam vrije radicalen ontstaan. Dat zijn moleculen met een vrij, ongepaard elektron. Ze gaan bij andere moleculen op zoek naar een elektron om de lege plaats op te vullen, en kunnen ze zo beschadigen. Bij de DNA-molecule kan een ontmoeting met een vrij radicaal leiden tot een breuk in de suikerfosfaatruggengraat van het DNA. Ook de basen kunnen door de vrije radicalen worden aangetast, waarbij hun structuur verandert.

Als de fout niet wordt opgemerkt, beschikt de cel nog over eiwitten die het verkeerde nucleotide en eventueel een stukje omringend DNA kunnen verwijderen en vervangen door de correcte sequentie. Dat noem je een  herstelmechanisme. Op vind je meer info daarover.

57 MODULE 13 hOOfDstUk 2
C C C C C C C C C G C T A T A T A T G C G C G T
G C T A T A T A T G C G C G T
PROOFREADING
G C T A T A T A T G C G C G T 5’ 3’ 3’ 5’ 5’ 5’ 5’ 3’ 3’ 5’ 3’ 3’

WEETJE

Bij heel wat metabole processen in ons lichaam ontstaan er schadelijke zuurstofradicalen. Die kunnen andere moleculen oxideren als ze daarbij een elektron weghalen. Onze cellen beschikken over enzymen die de toegebrachte schade kunnen herstellen. Ze hebben elementen als seleen, mangaan, koper of zink nodig om optimaal te kunnen werken. Die elementen zijn aanwezig in groenten en fruit. Ook antioxidanten zijn rijkelijk aanwezig in groenten en fruit. Dat zijn stoffen die reageren met de radicalen. Ze worden daarbij zelf in een radicaalvorm gebracht, maar eentje die minder schadelijk is dan de zuurstofradicalen. Vitaminen A, C en E zijn voorbeelden van dergelijke antioxidanten.

Proefversie©VANIN

B2 Uv-straling

Uv-straling is afkomstig van de zon. Ze kan bindingen tussen twee opeenvolgende thyminebasen in een DNA-streng veroorzaken. Zo ontstaat er een knik in de DNA-molecule, doordat de basenparing tussen de twee DNA-strengen wordt onderbroken. Daardoor vergroot de kans dat er bij de replicatie een verkeerd nucleotide wordt ingebouwd. Tegen uv-straling kun je je beschermen door zonnecrème te smeren.

covalente binding tussen thyminebasen

knik in de DNA-molecule

Xeroderma pigmentosum is een erfelijke aandoening waarbij de DNA-schade die wordt veroorzaakt door uv-straling, niet kan worden hersteld. Op zeer jonge leeftijd treedt er al schade aan de huid op. Daardoor lopen patiënten een erg groot risico om huidkanker te ontwikkelen.

Personen met xeroderma pigmentosum krijgen sproetjes of donkere vlekken op delen van de huid die zijn blootgesteld aan zonlicht.

58 MODULE 13 hOOfDstUk 2
A T A T G C A T G C G C A T A T T T G C A T G C G C uv-straling
5’ 5’ 5’ 3’ 5’ 3’ 3’ 3’
S Afb. 24 Uv-straling veroorzaakt een knik in de DNA-molecule, met mutaties tot gevolg. S Afb. 23 Groenten en fruit bevatten veel antioxidanten. WEETJE W Afb. 25

B3 Chemische stoffen

Bepaalde moleculen kunnen zich in de structuur van de DNA-molecule invoegen. Er kunnen dan bij de replicatie verkeerde nucleotiden worden ingebouwd.

VOORBEELD BENZOPYREEN

Benzopyreen is aanwezig in sigarettenrook en in uitlaatgassen van auto’s. De molecule is niet alleen mutageen, maar ook carcinogeen. De mutatie kan leiden tot ongecontroleerde delingen van de cellen, waardoor er kanker kan ontstaan.

Benzopyreen is ook een van de bestanddelen van het roet dat zich opstapelt in een schoorsteen. Op het einde van de achttiende eeuw stelde men vast dat schoorsteenvegers vaak getroffen werden door scrotumkanker. In 1933 werd benzopyreen de eerste stof die geïdentificeerd werd als verantwoordelijk voor een werkgerelateerde kanker. Vandaag beschikken schoorsteenvegers over persoonlijke beschermingsmiddelen, zoals filtrerende maskers, om de gezondheidsrisico’s van de job te beperken.

VOORBEELD AFLATOXINE

Aflatoxines zijn giftige stoffen die worden aangemaakt door schimmels van het geslacht

Aspergillus. Die schimmels kunnen voorkomen op gewassen, zoals maïs, granen en rijst, maar ook op pindanoten, gedroogd fruit of peulvruchten.

Wanneer besmette producten verwerkt worden tot bijvoorbeeld dierenvoeding, kunnen de toxines terechtkomen in melk en zuivelproducten. Aflatoxines zijn mutageen en carcinogeen. Er worden dan ook strenge controles uitgevoerd op producten waarop Aspergillus-soorten kunnen voorkomen.

Proefversie©VANIN

59 MODULE 13 hOOfDstUk 2
S Afb. 26 Benzopyreen komt voor in het roet in schoorstenen. S Afb. 27 Maïs besmet met de Aspergillus-schimmel

2.2 Indeling op basis van organisatieniveau

A Genmutaties

Bij een genmutatie zijn er maar een of enkele nucleotiden in een gen gewijzigd. Er zijn drie types genmutatie:

• Deletie: een of meer nucleotiden worden verwijderd.

• Insertie: een of meer nucleotiden worden ingevoegd.

• Substitutie: een basenpaar wordt vervangen door een ander basenpaar.

Als bij een mutatie maar één basenpaar wordt gewijzigd, noem je dat een puntmutatie.

Proefversie©VANIN

Afb. 28 Mogelijke vormen van genmutaties

Genmutaties veroorzaken maar een kleine wijziging in de DNA-sequentie, maar de gevolgen kunnen groot zijn. Een voorbeeld daarvan is sikkelcelanemie

VOORBEELD SIKKELCELANEMIE

Je weet al dat hemoglobine een eiwit is dat zich in de rode bloedcellen bevindt en een belangrijke rol speelt bij het transport van zuurstofgas in je lichaam. Sikkelcelanemie wordt veroorzaakt door een mutatie in het hemoglobinegen. Daardoor is er in de hemoglobine één aminozuur gewijzigd. Door een wijziging van dat ene aminozuur verandert de quaternaire structuur van hemoglobine en krijgen de moleculen de neiging om ketens te vormen.

NORMALE HEMOGLOBINE

In een normale rode bloedcel komen afzonderlijke hemoglobine-eiwitten voor.

SIKKELCELHEMOGLOBINE

Door de gewijzigde quaternaire structuur vormen de hemoglobineeiwitten ketens in de rode bloedcellen.

α-keten β-keten

W Afb. 29

Vergelijking tussen normale hemoglobine en hemoglobine bij sikkelcelanemie

60 MODULE 13 hOOfDstUk 2
A T G C G C G C G C G C G C G C G C A T A T A T A T A T A T A T G C G C G C G C G C G C G C A T A T A T A T A T A T A T A T G C G C G C G C G C G C A T A T A T A T A T G C G C A T A T A T A T G C G C G C G C G C G C G C G C A T A T A T A T A T A T A T A T niet-gemuteerd DNA insertie substitutie deletie 5’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ 3’ 5’ 3’ 5’ 3’
S

Daardoor krijgen de rode bloedcellen een sikkelvorm en verliezen ze de elasticiteit die nodig is om door de heel fijne haarvaten te kunnen. Ze blijven daar makkelijk steken en klonteren samen, waardoor de doorbloeding van de weefsels wordt verstoord. Dat veroorzaakt pijn en kan leiden tot een zuurstoftekort en zelfs het afsterven van het weefsel. Bij sikkelcelanemie worden de rode bloedcellen ook veel sneller afgebroken in de milt. Ze leven maar ongeveer dertig dagen, terwijl de normale levensduur zo’n honderdtwintig dagen is. Omdat het beenmerg niet snel genoeg nieuwe rode bloedcellen kan aanmaken, ontstaat er bloedarmoede of anemie.

verstoorde bloeddoorstroming

hemolyse

Proefversie©VANIN

normale rode bloedcel

schade aan de bloedvatwand

witte bloedcel bloedplaatje

B Chromosoommutaties

sikkelcel

W Afb. 30 Sikkelcellen zijn weinig elastisch, klitten samen en kunnen de bloedstroom hinderen.

Bij een chromosoommutatie wordt de structuur van een chromosoom gewijzigd. Dat gebeurt wanneer er in het DNA breuken optreden in een of beide strengen en de fragmenten verkeerd aan elkaar worden gezet.

Er zijn vier belangrijke groepen:

• Bij een deletie wordt een deel uit het chromosoom verwijderd. Het gaat om veel meer dan een of enkele nucleotiden zoals bij genmutaties.

• Bij een insertie wordt een nucleotidesequentie uit één chromosoom toegevoegd aan een ander chromosoom.

• Bij een inversie wordt een bepaalde sequentie in het chromosoom in de omgekeerde oriëntatie in het chromosoom aangetroffen.

• Wanneer tussen twee chromosomen een sequentie wordt uitgewisseld, noem je dat een translocatie

61 MODULE 13 hOOfDstUk 2
deletie insertie inversie translocatie A B A B S
Vier
Afb. 31
voorbeelden van chromosoommutaties

VOORBEELD CRI-DU-CHATSYNDROOM

Een deletie van een deel van chromosoom 5 kan leiden tot het cri-du-chatsyndroom. De naam van het syndroom verwijst naar het katachtige geschreeuw dat de kinderen maken door een slechte ontwikkeling van hun strottenhoofd.

W Afb. 32

Een meisje met het cri-duchatsyndroom. Kenmerkend zijn de ver uit elkaar staande ogen, de laag ingeplante oren en de brede neusbrug. Alle patiënten vertonen beperkte verstandelijke vermogens.

Proefversie©VANIN

VOORBEELD PHILADELPHIASYNDROOM

normale chromosomen

gebroken chromosomen veranderde chromosomen (translocatie)

chromosoom 22

chromosoom 9

S Afb. 33

De vorming van het Philadelphiachromosoom

Bij patiënten met een bepaalde chronische vorm van leukemie komt een translocatie voor.

Een stuk van chromosoom 9 is van plaats gewisseld met een stuk van chromosoom 22. Dat is voor het eerst beschreven in 1960 door een onderzoeksgroep in Philadelphia. Het gewijzigde chromosoom is daarnaar vernoemd en heet nu het Philadelphiachromosoom. Het genproduct van het Philadelphiachromosoom is een eiwit dat zorgt voor een ongecontroleerde deling van de beenmergcellen. Er worden dan te veel witte bloedcellen aangemaakt, waardoor er leukemie ontstaat.

C Genoommutaties

Een verandering in het aantal chromosomen noem je een genoommutatie

De oorzaak van een genoommutatie is een fout tijdens de meiose bij de vorming van de geslachtscellen of tijdens de mitotische deling.

Als een geslachtscel met een of meerdere chromosomen te veel of te weinig versmelt met een normale geslachtscel, ontstaat er een zygote met een abnormaal chromosomenaantal. Is er één chromosoom te weinig, dan noem je dat een monosomie. Is er één te veel, dan spreek je van een trisomie.

Philadelphiachromosoom

62 MODULE 13 hOOfDstUk 2

VOORBEELD SYNDROOM VAN TURNER

Het syndroom van Turner is een monosomie van de geslachtschromosomen, die meestal te wijten is aan een fout tijdens de vorming van de geslachtscellen. Er ontstaan geslachtscellen zonder geslachtschromosoom. Bij versmelting met een normale geslachtscel ontstaat er een zygote met maar één geslachtschromosoom. Het syndroom komt uitsluitend voor bij vrouwen, aangezien cellen met enkel een Y-chromosoom niet levensvatbaar zijn. Uiterlijke kenmerken zijn een kleine gestalte, een brede nek met aan weerszijden een huidplooi, laag ingeplante oren en een lage haarlijn. Omdat die vrouwen onderontwikkelde eierstokken hebben, zijn ze onvruchtbaar.

Proefversie©VANIN

VOORBEELD SYNDROOM VAN DOWN

Je weet al dat mensen die in hun lichaamscellen drie kopieën van chromosoom 21 bezitten, lijden aan het syndroom van Down. De oorzaak is meestal een fout tijdens meiose I of II bij de vorming van de geslachtscellen. Er worden dan geslachtscellen gevormd met een extra chromosoom 21. Wanneer zo’n geslachtscel versmelt met een normale geslachtscel, ontstaat er een zygote met een extra chromosoom 21.

De fout kan zowel bij de vorming van eicellen als bij de vorming van zaadcellen plaatsvinden. Er bestaat echter een verband tussen de leeftijd van de moeder op het moment van de bevruchting en de kans op een kind met trisomie-21. Als de moeder jonger is dan 30, heeft ze een kans van 1 op 1 000 op een kindje met trisomie-21. Bij een moeder ouder dan 40 is die kans al 1 op 100. Het risico stijgt aanzienlijk vanaf de leeftijd van 35 jaar.

Uiterlijke kenmerken van het downsyndroom zijn een vlak achterhoofd, scheefstaande ogen met ronde ooghoeken, een open mond met een te groot lijkende tong en een platte neusbrug. In de handpalmen is er een dwarse doorlopende plooi aanwezig en bij de voeten valt de grotere afstand tussen de eerste twee tenen op. De verstandelijke vermogens van personen met het downsyndroom zijn beperkt.

VOORBEELD SYNDROOM VAN KLINEFELTER

Het syndroom van Klinefelter komt voor bij mannen wanneer zij in hun lichaamscellen een extra X-chromosoom hebben. Het is dus een trisomie van de geslachtschromosomen. De aanwezigheid van het extra X-chromosoom wordt genoteerd als 47,XXY.

Mannen met het syndroom van Klinefelter zijn groter dan gemiddeld en hebben opvallend lange armen en benen. Ze hebben meestal kleine teelballen en daardoor een laag testosterongehalte. Dat leidt tot verminderde lichaamsbeharing en baardgroei, en tot een weinig ontwikkelde spiermassa. Vrijwel al die mannen zijn onvruchtbaar, en bij een aantal komt borstontwikkeling voor. Jongens met het syndroom hebben vaak ook moeilijkheden met leren lezen of schrijven, met spelling of wiskunde.

63 MODULE 13 hOOfDstUk 2
S Afb. 34 Een vrouw met het syndroom van Turner S Afb. 35 Een kind met trisomie-21

Er wordt gespeculeerd dat George Washington, de eerste Amerikaanse president, het syndroom van Klinefelter had. Een aantal kenmerken wijzen in die richting. Hij was immers onvruchtbaar en was heel groot van gestalte. Hij had ook grote handen en grote tanden. Het is bekend dat de grootte van de tanden onder andere wordt bepaald door het aantal extra X-chromosomen. Washingtons toespraken en de geschriften die hij achterliet, doen echter vermoeden dat hij geen problemen had met taal. Dat wijkt af van het fenotype dat bij het syndroom van Klinefelter hoort.

Proefversie©VANIN

2.3 Indeling op basis van het effect

• Bij een verliesmutatie resulteert een mutatie in een eiwit dat minder of niet meer functioneert. We bespraken eerder al het voorbeeld van sikkelcelanemie. Dat is een voorbeeld van een verliesmutatie, aangezien de hemoglobine door de mutatie haar functie niet meer kan uitvoeren.

• Wanneer een mutatie geen effect heeft op de functie van het eiwit, noem je dat een neutrale mutatie. Dat is het geval wanneer een mutatie ervoor zorgt dat er een aminozuur met gelijkaardige eigenschappen als het oorspronkelijke aminozuur wordt ingebouwd.

• Bij een winstmutatie resulteert de wijziging in de nucleotidesequentie van een gen in een eiwit met een verbeterde functie. Het organisme is daardoor beter aangepast aan de omgeving waarin het leeft. Daardoor bezit het een voordeel ten opzichte van zijn soortgenoten. Dat soort mutatie speelt een belangrijke rol in de evolutie van organismen, waarover we het in module XX hebben.

64 MODULE 13 hOOfDstUk 2
WEETJE
W Afb. 36 Een portret van George Washington (1732-1799)

VOORBEELD TAAISLIJMZIEKTE

Een ander voorbeeld van een verliesmutatie is cystische fibrose, mucoviscidose of taaislijmziekte. Dat is een aandoening die door meerdere mutaties kan worden veroorzaakt. Een van de mogelijke oorzaken is een deletie van drie nucleotiden in het gen dat codeert voor een eiwit dat betrokken is bij de vorming van een chloridekanaal in het celmembraan van slijmproducerende cellen. Door de mutatie wordt er een abnormaal eiwit gevormd waarin één fenylalanineaminozuur ontbreekt. Het transport van chloride-ionen kan niet plaatsvinden. De cellen produceren dan een taai slijm.

S Afb. 37

De behandeling van mucopatiënten bestaat uit een dagelijkse inhalatietherapie. Via een aerosolapparaat ademen ze slijmverdunnende middelen in.

Proefversie©VANIN

VOORBEELD LACTASE

Een voorbeeld van een winstmutatie is een mutatie in het lactasegen. Lactase is een enzym dat lactose, aanwezig in melk, kan afbreken. Bij veel zoogdieren, waaronder de mens, wordt er geen lactase meer aangemaakt wanneer het zogen stopt. Een mutatie in het lactasegen kan er echter voor zorgen dat er ook na het zogen lactase wordt gemaakt. Daardoor kan de lactose in melk ook op volwassen leeftijd worden verteerd. In onze westerse populatie is die voordelige mutatie wijdverspreid en kunnen de meeste mensen dus lactose afbreken.

Mutaties zijn erfelijke wijzigingen in de basensequentie van het DNA. Je kunt mutaties indelen op basis van oorzaak, organisatieniveau en effect.

• Op basis van de oorzaak van de mutatie onderscheid je spontane mutaties en geïnduceerde mutaties

• Op basis van het organisatieniveau van het erfelijk materiaal onderscheid je genmutaties, chromosoommutaties en genoommutaties

• Op basis van het effect op het eiwit onderscheid je verliesmutaties, neutrale mutaties en winstmutaties.

65 MODULE 13 hOOfDstUk 2
S Afb. 38 Door een winstmutatie kunnen de meeste mensen melk verteren.

3 Epigenetische modificaties

Hoewel elke lichaamscel hetzelfde genoom bevat, brengen de verschillende cellen van een organisme verschillende genen tot expressie. Zo moet er bijvoorbeeld in een rode bloedcel een hoge concentratie aan het eiwit hemoglobine aanwezig zijn. In huidcellen, zenuwcellen en botcellen komen dan weer andere genen tot expressie, ook al bezitten die cellen hetzelfde genoom. Elk celtype heeft dus zijn eigen expressiepatroon, afhankelijk van de functie die het vervult. Het tot expressie brengen van welbepaalde genen leidt tot het ontstaan van sterk gedifferentieerde cellen. Dat noem je celdifferentiatie

Je weet al dat bij eukaryoten het DNA met behulp van specifieke eiwitten in een compacte vorm wordt opgevouwen, zodat het in de kern past. Het geheel van het DNA en de eiwitten noem je chromatine. Als de chromatine heel compact is, zijn de genen die op het DNA liggen, niet bereikbaar voor transcriptiefactoren. De genen die in de lossere chromatine liggen, kunnen wel tot expressie worden gebracht.

De cel beschikt over manieren waarmee ze de toegankelijkheid van een gen voor transcriptiefactoren en dus ook de expressie ervan kan beïnvloeden. Er kunnen bijvoorbeeld op het DNA methylgroepen (-CH3) worden gehecht. Zo’n aanpassing van het DNA wijzigt de toegankelijkheid ervan. Dergelijke aanpassingen noem je epigenetische modificaties

Proefversie©VANIN

gemethyleerde promotorregio

66 MODULE 13 hOOfDstUk 2
compacte chromatine lossere chromatine
W Afb.
transcriptiefactoren
40
S Afb. 39 Compacte en losse chromatine in de celkern van een niet-delende cel compacte chromatine lossere chromatine

VOORBEELD MIERENKOLONIE

In een mierenkolonie is de koningin de enige die eitjes legt. Een bevrucht eitje groeit uit tot een werkster, een onbevrucht eitje tot een mannetje. Er heerst een strikte taakverdeling. De verschillende taken worden uitgevoerd door gespecialiseerde groepen van mieren die tot een welbepaalde kaste behoren.

Mieren die tot een verschillende kaste behoren, kunnen bij sommige soorten grote uiterlijke verschillen vertonen. Zo is de koningin veel groter dan de werksters. Een koningin kan bij sommige soorten tientallen jaren overleven, terwijl een werkster een levensduur heeft van enkele maanden. Nochtans kan elk vrouwelijk embryo zich ontwikkelen tot koningin of voedselverzamelaar, larvenverzorgster, nestbouwer …

Onderzoekers ontdekten dat het methyleringspatroon van het DNA bij een koningin en een werkster verschillend is. DNA-methylering bepaalt dus de kaste waartoe mieren behoren in een mierenpopulatie. De omgevingsfactoren die het verschillende methyleringspatroon veroorzaken, zijn vermoedelijk stoffen in de voeding en feromonen.

Bij mieren komen bij een aantal geslachten opvallende aanpassingen voor naargelang de kaste waartoe een mier behoort, en de taak die hij heeft in de populatie.

Proefversie©VANIN

67 MODULE 13 hOOfDstUk 2
S Afb. 42 In het geslacht Cephalotes hebben sommige mannetjes een groot, afgeplat, concaaf hoofd. Die vorm is perfect om de ingang van hun nest in een boomstam af te schermen voor indringers. S Afb. 41 Een koningin omringd door werksters en larven S Afb. 43 In het geslacht Myrmecocystus kunnen de werksters hun achterlijf laten opzwellen, zodat daar voedingsstoffen voor de andere mieren in de kolonie kunnen worden opgeslagen.

Je weet al dat mutaties wijzigingen in de nucleotidesequentie van het DNA zijn. Als een mutatie aanwezig is in de geslachtscellen, kan ze worden doorgegeven aan het nageslacht. De mutatie is dan erfelijk.

Epigenetische modificaties kunnen erfelijk of niet-erfelijk zijn. De overerving ervan is het onderzoeksdomein van de epigenetica. Wetenschappers bestuderen het doorgeven van modificaties van moedercel op dochtercel bij de celdeling.

Proefversie©VANIN

Methylering op de ouderlijke streng kan worden doorgegeven aan de dochterstrengen.

Ook het doorgeven van epigenetische modificaties van generatie op generatie wordt onderzocht. We bespreken een voorbeeld van epigenetische overerving bij de mens, bij planten en bij gisten.

VOORBEELD HONGERWINTERKINDEREN IN NEDERLAND

De hongerwinterkinderen werden verwekt tijdens de winter van 1944-1945, toen er in Nederland een hongersnood heerste. Mensen kregen maar een vierde van de voeding binnen die ze nodig hadden. Dat was ook zo voor zwangere vrouwen. De kinderen ondervonden gedurende hun hele verdere leven gevolgen van die omstandigheden. In vergelijking met mensen van wie de moeder geen honger had geleden tijdens de zwangerschap, kampten die kinderen vaker met overgewicht, diabetes type 2 en hoge cholesterolwaarden in het bloed. Onderzoek wees uit dat een gewijzigd methyleringspatroon van hun DNA daarvoor verantwoordelijk is.

68 MODULE 13 hOOfDstUk 2
3’ 3’ 3’ 3’ 3’ 5’ 5’ 5’ 5’ 5’ A T G C G C G C G C G C G C A T A T A T A T CH3 CH3 CH3 A T G C G C G C G C G C G C A T A T A T A T G C A T A T G C G C G C G C G C G C A T A T A T A T CH3 3’ 3’ 3’ 5’ 5’ 5’ CH3 CH3 A T G C G C G C G C G C G C A T A T A T A T G C A T A T G C G C G C G C G C G C A T A T A T A T CH3 CH3
S Afb. 44 S Afb. 45 Mensen staan in lange rijen voor een gaarkeuken tijdens de winter van 1944-1945 in Nederland.

VOORBEELD FOETAAL ALCOHOLSYNDROOM

Alcohol is een molecule die het methyleringspatroon van DNA kan beïnvloeden. Als een zwangere vrouw veelvuldig alcohol drinkt, kan het embryo afwijkingen oplopen. Enkele uiterlijke kenmerken bij het kind zijn een groeiachterstand, een smal hoofd, ogen die ver uit elkaar staan, een afgeplatte neus en een smalle bovenlip. Er kunnen ook andere problemen aanwezig zijn, zoals leermoeilijkheden of verminderde sociale vaardigheden.

W Afb. 46 Alcohol tijdens de zwangerschap kan leiden tot het foetaal alcoholsyndroom.

Proefversie©VANIN

minder groeven

smal hoofd lage neusbrug

korte, afgeplatte neus

dunne bovenlip

smalle oogspleten

vouw binnenste oogplooi plat middengezicht afgeplat neusgootje smalle kin

S Afb. 47 Mogelijke afwijkingen bij kinderen met het foetaal alcoholsyndroom

Momenteel voert men studies uit om te onderzoeken of epigenetische modificaties bij de mens worden doorgegeven aan generaties die nooit werden blootgesteld aan de onderzochte factor. Voor een zwangere vrouw die alcohol gebruikte tijdens haar zwangerschap, zou dat betekenen dat haar achterkleinkind de gevolgen daarvan ondervindt. Dergelijke overerving is bij de mens nog niet bewezen. Bij planten en schimmels is wel aangetoond dat epigenetische modificaties worden doorgegeven aan de volgende generatie.

69 MODULE 13 hOOfDstUk 2

VOORBEELD VLASBEKJE

Proefversie©VANIN

Bij het vlasbekje is de bloem tweezijdig symmetrisch. Dat wil zeggen dat je een as kunt tekenen die de bloem in twee gelijke helften verdeelt. Er bestaat ook een variant die een bloem bezit met meerdere symmetrieassen. Dat is te wijten aan een epigenetisch verschil. Een gen dat belangrijk is bij de bloemsymmetrie, wordt stilgelegd door een methylering. Dat patroon wordt doorgegeven aan de volgende generatie.

VOORBEELD GISTEN

Schimmelinfecties worden behandeld met antimycotica. Schimmels zijn in staat om resistentie te ontwikkelen tegen die middelen. Tot voor kort dacht men dat die resistentie veroorzaakt werd door mutaties in het DNA. Maar onderzoek bij de gist Schizosaccharomyces pombe toont aan dat epigenetische modificaties aan de basis liggen van de resistentie.

Onderzoekers voegden cafeïne toe aan het groeimedium van de gist. Cafeïne is toxisch voor de gist, net zoals antimycotica. Sommige gistcellen werden resistent tegen de cafeïne. DNA-onderzoek wees uit dat er geen wijziging in de basensequentie was opgetreden. De resistente gisten bleken meer DNA in de vorm van heterochromatine te bezitten dan niet-resistente gisten. Die eigenschap werd doorgegeven aan de dochtercellen.

Epigenetische modificaties zijn wijzigingen in de methylgroepen op het DNA of de eiwitten die in de chromatine aanwezig zijn. Ze kunnen erfelijk of niet-erfelijk zijn.

Overerving van epigenetische modificaties over meerdere generaties heen werd al aangetoond voor planten en schimmels. Bij de mens is er nog geen zekerheid. Wat wel vaststaat, is dat de omstandigheden tijdens de zwangerschap een invloed kunnen hebben op het kind na de geboorte.

70 MODULE 13 hOOfDstUk 2
S Afb. 48 Twee varianten van Linaria vulgaris. Links zie je de normale vorm, rechts de bloem met meerdere symmetrieassen. S Afb. 49 Men gebruikt Schizosacharomyces pombe als modelorganisme in de celbiologie.

AAN DE SLAG

Welke stelling over mutaties is fout?

a Puntmutaties resulteren in de wijziging van één basenpaar.

b Bij een translocatie wordt een deel van een chromosoom uitgewisseld tussen twee chromosomen.

c Een substitutie resulteert altijd in een gewijzigd fenotype.

Welk soort mutatie komt voor bij het hemoglobineeiwit bij sikkelcelanemie?

a een mutatie die resulteert in één gewijzigd aminozuur

b een mutatie die leidt tot een korter hemoglobine-eiwit

c een mutatie waarbij er één aminozuur ontbreekt

Bij mensen met het patausyndroom is het aantal chromosomen gewijzigd. Alle lichaamscellen bezitten de chromosoommutatie. Op de afbeelding zie je hoe het karyogram van een patiënt met het patausyndroom eruitziet.

a Welke afwijking zie je in het karyogram?

b Hoe kan die afwijking ontstaan zijn?

c Leg uit waarom alle cellen van de patiënt een afwijkend aantal chromosomen bezitten.

Welke mutatie op de afbeelding komt overeen met een inversie?

c Hoe noem je zo’n mutatie? 5 6 7 Meer oefenen? Ga naar .

Rangschik de volgende mutatievormen volgens de omvang van het gewijzigde DNA van groot naar klein:

translocatie – insertie – puntmutatie – trisomie

Een wetenschapper onderzocht het effect van wijzigingen in de aminozuursequentie van een enzym. Een aminozuur valine werd gewijzigd in alanine. De wijziging is het gevolg van een substitutie van één base. Welke substitutie van één base kan ervoor zorgen dat valine wordt vervangen door alanine?

a CAA → CGA

b GUU → GCA

c GUU → GUC

d CAC → CGG

De basensequentie van een deel van een gen is de volgende:

5’-ATGATTACGGATTCACTGGCCGTCGTTTTACAACGT-3’ 3’-TACTAATGCCTAAGTGACCGGCAGCAAAATGTTGCA-5’

a Noteer de aminozuursequentie die bij die basensequentie hoort. Gebruik daarvoor de afbeelding met de genetische code.

Proefversie©VANIN

b Wat kunnen de effecten zijn van een transversie ter hoogte van de zesde base van die sequentie?

71 MODULE 13 hOOfDstUk 2 - AAn DE sLAG
normaal a b c d e 1 2 3 4
G A A G C U A A A C C C C G G G U U U U U C C C C C C C C C C C C C C C C A A A A A A A A A A A A A A A A G G G G G G G G G G G G G G G G U U U U U U U U U U U U U U U Gly Phe 3’ 3’ 3’ 3’ Leu Ser Tyr Cys Trp Leu Pro His Gln Arg Met Thr Asn Lys Ser Arg Val Ala Asp Glu STOPSTOP START STOP 5’ Ile

HOOFDSTUKSYNTHESE

Mutaties zijn erfelijke wijzigingen in de basensequentie van het DNA.

Organisatieniveau

Spontane mutatie

mutatie in de basensequentie van het DNA die plots en willekeurig ontstaat

Proefversie©VANIN

Epigenetische modificaties zijn aanpassingen van het DNA zonder wijzigingen in de sequentie (zowel erfelijk als niet-erfelijk).

Effect op het eiwit

Geïnduceerde mutatie

mutatie die wordt uitgelokt door mutagenen

Genmutatie

Slechts een of enkele nucleotiden zijn gewijzigd.

Chromosoommutatie

De structuur van een chromosoom is gewijzigd.

Genoommutatie

Het aantal chromosomen is gewijzigd

Verliesmutatie

mutatie die resulteert in een slechter of niet-functionerend eiwit: missense-, nonsense- en frameshiftmutatie

Neutrale mutatie

mutatie die resulteert in een nucleotidesequentie die voor hetzelfde aminozuur of een aminozuur met gelijkaardige eigenschappen codeert

Winstmutatie

mutatie die resulteert in een eiwit met een verbeterde functie

72
Oorzaak

Voorbeelden: breuken in het DNA

Proefversie©VANIN

Voorbeelden: ioniserende straling, uv-straling, benzopyreen

Voorbeeld: sikkelcelanemie

Voorbeeld: cri-du-chat

Voorbeeld: trisomie-21

Voorbeelden: sikkelcelanemie, mucoviscidose

Voorbeeld nieterfelijke modificatie: kastesysteem bij mieren

73 MODULE 13 hOOfDstUk 3 kennisclip VIDEO
A T G C G C G C G C G C G C G C G C A T A T A T A T A T A T A T G C G C G C G C G C G C G C A T A T A T A T A T A T A T A T G C G C G C G C G C G C A T A T A T A T A T G C G C A T A T A T A T G C G C G C G C G C G C G C G C A T A T A T A T A T A T A T A T niet-gemuteerd DNA insertie substitutie deletie 5’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ deletie insertie substitutie = puntmutatie deletie insertie inversie translocatie A B A B deletie insertie inversie translocatie

Proefversie©VANIN

MODULE 15 BIOTECHNOLOGIE Proefversie©VANIN

Door klimaatverandering hebben sommige gewassen, zoals maïs, het moeilijk. In periodes waarin weinig of geen regen valt, mislukt de oogst. Met behulp van biotechnologie hebben wetenschappers een droogtebestendige maïssoort ontwikkeld. Net als bij andere planten is er bij maïs een gen gekend dat codeert voor een enzym dat betrokken is bij de synthese van het plantenhormoon ethyleen (etheen).

Ethyleen brengt de plant in een soort ‘overlevingsmodus’: het metabolisme werkt dan op een lager pitje, totdat de plant betere omstandigheden heeft. De genetisch gemodificeerde maïs kent een hogere productie van dat enzym, wat leidt tot een betere opbrengst tijdens droogtemaanden.

` Wat is de oorsprong van biotechnologie?

` Binnen welke domeinen wordt biotechnologie toegepast?

` Welke biotechnologische technieken bestaan er?

` Welke ethische overwegingen zijn er omtrent biotechnologie?

We zoeken het uit!

?

VERKEN

JE KUNT AL ...

• overervingsmechanismen beschrijven;

• de wetmatigheden bij overerving toepassen.

• de structuur van DNA uitleggen;

• het proces van DNA-replicatie, transcriptie en translatie beschrijven;

• beschrijven hoe genmutaties grote veranderingen in de genexpressie kunnen veroorzaken, waardoor er bijvoorbeeld sikkelcelanemie ontstaat.

Proefversie©VANIN

JE LEERT NU ...

• wat klassieke en moderne biotechnologie inhouden;

• wat genetische gemodificeerde organismen (ggo’s) zijn;

• toepassingen van biotechnologie vanuit een ethisch standpunt benaderen.

• de technieken waarmee wetenschappers DNA bestuderen;

• hoe wetenschappers gericht DNA kunnen manipuleren;

• hoe biotechnologie aan de basis kan liggen van een therapie.

198 MODULE 15 vErkEn
H1 H2

HOOFDSTUK 1

Î Biotechnologie, een groeiend onderzoeksdomein

Proefversie©VANIN

De kennis over DNA en celprocessen zoals eiwitsynthese en DNA-replicatie heeft geleid tot de ontwikkeling van een nieuw onderzoeksdomein: de biotechnologie. In dit eerste hoofdstuk leer je wat biotechnologie inhoudt, en bestudeer je enkele toepassingen van biotechnologie binnen verschillende gebieden. In het laatste deel ga je dieper in op de ethische vragen die leven rond biotechnologie.

LEERDOELEN

M Het verschil tussen klassieke en moderne biotechnologie beschrijven

M Voorbeelden van toepassingen van biotechnologie kort beschrijven

M Uitleggen wat we verstaan onder genetisch gemodificeerde organismen (ggo’s)

M Het maatschappelijk debat rond biotechnologie kritisch benaderen

1 Klassieke en moderne biotechnologie

Technieken zoals het kruisen van dieren of planten of het gebruik van micro-organismen om voedsel te bereiden, worden al eeuwen toegepast. Het zijn voorbeelden van biotechnologie

Biotechnologische toepassingen waarbij de mens niet rechtstreeks sleutelt aan het DNA van het organisme, deelt men in bij de klassieke biotechnologie. Die technieken spelen nog altijd een prominente rol in de landbouw en de voedingsindustrie.

Het kruisen van soorten om bepaalde eigenschappen in de soort te verbeteren, noem je ‘veredelen’. Dat kent echter twee beperkingen:

• Binnen één soort kan een kweker een specifieke eigenschap selecteren, bijvoorbeeld de spierkracht van een hondensoort of de kleur van een bloem. Twee verschillende soorten kruisen is echter in principe niet mogelijk. Je spreekt van de soortbarrière.

• Bij het kruisen van planten en dieren worden niet alleen de gewenste, maar ook andere eigenschappen overgedragen. Daardoor kan het soms generaties lang duren voordat men variëteiten of rassen met enkel de gewenste eigenschappen verkrijgt.

‘Biotechnologie’ komt van de Griekse woorden βιος (bios, ‘leven’) en τεγνικος (technikos, ‘gebruik’). Het betekent dus letterlijk ‘het gebruik van het leven’.

199 MODULE 15 hOOfDstUk 1
S Afb. 1 Het Belgisch witblauw is het resultaat van het jaren gericht kruisen van dieren. S Afb. 2 Een vondst van 3 200 jaar oude kaas in een Egyptische graftombe
VIDEO
artikel: 3 200 jaar oude kaas

Sinds de jaren 1970 kunnen wetenschappers gericht ingrijpen in het erfelijk materiaal van een organisme. De technieken die daarvoor gebruikt worden, behoren tot de moderne biotechnologie. Wanneer DNA geanalyseerd of aangepast wordt, spreek je van DNAtechnologie of gentechnologie. DNA-technologie wordt gebruikt in de moleculaire biologie, het onderzoeksdomein dat celprocessen bestudeert op het moleculaire niveau.

DNA-technologie wordt vaak gebruikt om gericht genetische aanpassingen uit te voeren. Zo bekomt men een genetisch gemodificeerd organisme (ggo). Afhankelijk van de oorsprong van de aanpassing spreek je van:

• transgene organismen: het organisme bezit erfelijk materiaal van een andere soort. Moderne biotechnologie maakt het mogelijk om genen over te zetten tussen soorten die normaal niet kruisen;

• cisgene organismen: het DNA van het organisme zelf wordt aangepast of DNA van een organisme van dezelfde soort wordt toegevoegd. Cisgenese wordt bijvoorbeeld gebruikt tussen appelvariëteiten. Natuurlijke genen voor resistentie tegen schurft worden overgebracht, waardoor er minder bestrijdingsmiddelen nodig zijn.

S Afb. 3

De katoenplant was een van de eerste transgene ggo’s die ontwikkeld werden in de landbouw. Ze zorgde voor een grotere opbrengst en minder gebruik van pesticiden.

Proefversie©VANIN

2 Toepassingsgebieden van biotechnologie

Men deelt biotechnologie vaak op in vier toepassingsgebieden: de rode, groene, witte en blauwe biotechnologie. Je ontdekt ze op de volgende pagina.

200 MODULE 15 hOOfDstUk 1
LABO XX

RODE BIOTECHNOLOGIE

Rode biotechnologie is gericht op de gezondheidszorg en/of biofarmaceutische doelen.

Ontdek nog andere toepassingen. VIDEO

GROENE BIOTECHNOLOGIE

Groene biotechnologie is gericht op de genetische modificatie van planten voor de landbouwen voedingsindustrie.

Ontdek nog andere toepassingen.

Sommige diabetici zijn niet in staat om insuline aan te maken. Vroeger werden die patiënten behandeld met insuline die geïsoleerd was uit de pancreas van runderen en varkens. Maar één varkenspancreas leverde slechts insuline op voor een behandeling van één week voor één patiënt. In 1982 ontwikkelden onderzoekers genetisch gewijzigde bacteriën die menselijke insuline aanmaken. Die gemodificeerde insuline is nu overal ter wereld te koop.

Intensief gebruik van insecticiden zorgt voor massale sterfte van insecten, waardoor de biodiversiteit daalt. Insecticiden schaden op lange termijn ook onze gezondheid, bijvoorbeeld door in te werken op ons hormoonstelsel. De ontwikkeling van transgene planten kan ervoor zorgen dat er minder insecticiden nodig zijn voor plaagbestrijding. Biotechnologen identificeerden een bacterieel gen dat codeert voor enzymen die betrokken zijn bij de synthese van een natuurlijke toxine die het spijsverteringsstelsel van insecten verlamt. Door dat succesvol in te brengen in het genoom van een tabaksplant, maakt de plant zelf de toxine aan en is het niet meer nodig om insecticiden te gebruiken.

WITTE BIOTECHNOLOGIE

Witte biotechnologie is gericht op de productie of afbraak van chemische stoffen op industriële schaal.

Ontdek nog andere toepassingen.

In de petrochemie synthetiseert men plastic uit aardolie. Witte biotechnologie maakt het mogelijk om aardolie als basisstof te vervangen door bioethanol. Bio-ethanol kan worden geproduceerd uit stro of overschotten uit de landbouw. Dat vereist het gebruik van enzymen die de polysachariden afbreken tot kleinere suikers. Vervolgens worden die sachariden dan via genetisch gemodificeerde micro-organismen omgezet tot bio-ethanol.

BLAUWE BIOTECHNOLOGIE

Proefversie©VANIN

Blauwe biotechnologie is gericht op een efficiënte en duurzame vorm van visserij, aquacultuur en het gebruik van mariene hulpbronnen.

Ontdek nog andere toepassingen.

Algen zijn potentiële producenten van biobrandstoffen en kunnen dienen als een basisbestanddeel van chemische producten (zoals verf) en voedsel. Biotechnologen onderzoeken daarom hoe algen duurzaam en economisch rendabel kunnen worden gekweekt.

VIDEO
201 thEMA 04 hOOfDstUk 1
VIDEO
VIDEO

Vitamine A is essentieel voor de aanmaak van retinal, het lichtgevoelige pigment in onze ogen.

Hoewel biotechnologie directe toepassingen belooft en veel verwachtingen schept, is er vaak een lange weg tussen de experimentele fase en de productionele fase. Het duurt vaak enkele jaren tot meerdere decennia voordat een toepassing op grote schaal kan worden uitgerold als therapie of voedingsmiddel. De rol van multinationals in de wereldwijde productie en de bijbehorende hoge kost zijn een bepalende factor. Als voorbeeld bekijken we gouden rijst.

Door een eenzijdig voedingspatroon kampen veel mensen in ontwikkelingslanden met een vitamine A-tekort. Dat kan leiden tot blindheid, een verminderde werking van het immuunsysteem en huidproblemen. Ook leidt het bij kinderen tot groeiachterstand en zelfs de dood. Gouden rijst is een verzamelnaam voor rijstvariëteiten die na genetische modificatie hogere gehaltes aan vitamine A bevatten en daarom een gele korrel hebben. Aan de transgene rijstsoorten werden genen uit narcissen en bacteriën toegevoegd. Ook de gouden banaan werd op die manier ontwikkeld. Gouden rijst en gouden banaan kunnen worden gebruikt om een vitamine A-tekort te bestrijden.

S Afb. 4 Gouden rijst (links) en gouden banaan (rechts) bevatten na genetische wijziging meer vitamine A.

De volgende tijdlijn toont aan hoelang het duurde vooraleer het transgene voedingsmiddel werd goedgekeurd. Een bijkomend probleem is het feit dat het product moeilijk zijn doelgroep bereikt, namelijk ontwikkelingslanden.

1991 start van het onderzoek door wetenschappers Ingo Potrykus en Peter Beyer

1999 prototype gouden rijst klaar

2000 start samenwerking met Syngenta, een biotechbedrijf dat actief is in de landbouw

2001 start van veredelingsprogramma’s met lokale rijstrassen in de Filipijnen

2004 eerste veldproef in de Verenigde Staten

2005 Syngenta ontwikkelt tweede versie met hogere provitamine A-productie

2008 eerste veldproef in de Filipijnen

2013 proefveld in de F ilipijnen vernietigd door tegenstanders van ggo’s

Proefversie©VANIN

2015 start proefvelden in Bangladesh

2020 commerciële teelt in de Filipijnen goedgekeurd

De ontwikkeling van gouden rijst als ggo kent voor- en tegenstanders. Zo pleit Greenpeace voor voorzichtigheid, terwijl 109 Nobelprijswinnaars in een open brief alle regeringen wereldwijd opriepen om geen gehoor te geven aan de Greenpeace-campagne.

202 MODULE 15 hOOfDstUk 1

Fluorescente schapen geboren in Uruguay

In Uruguay zijn schapen geboren die oplichten onder ultraviolet licht. Het gaat niet om een speling van de natuur: de schapen werden genetisch aangepast met een gen dat codeert voor een fluorescerend eiwit van een kwal.

Naar: demorgen.be

Biotechnologie wordt ook gebruikt om spectaculaire, populistische veranderingen in organismen tot stand te brengen. Dat leidde bijvoorbeeld tot de geboorte van varkens, fruitvliegen, zebravissen, muizen, varkens en schapen met fluorescerende eigenschappen. Biotechnologie is daarom vaak het onderwerp van een maatschappelijk debat.

VOORBEELD GENEESKUNDE (RODE BIOTECHNOLOGIE)

Toepassingen van biotechnologie in de farmacie en geneeskunde kennen meestal een breed draagvlak. Zo biedt biotechnologie ons de kans om ziektes al tijdens de embryonale ontwikkeling op te sporen en te genezen. Aan de andere kant vormt het een potentiële opstap naar eugenetica (rasverbetering).

S Afb. 5

Proefversie©VANIN

HOOG IQ

GEEN GENETISCHE ZIEKTES

ATLETISCHE VAARDIGHEDEN PERFECT ZICHT

LAAG RISICO OP ALZHEIMER EN HARTINFARCT

De eugenetica streeft ernaar om de genetische samenstelling van een populatie te verbeteren.

VOORBEELD LANDBOUW (GROENE BIOTECHNOLOGIE)

Ggo’s uit de groene biotechnologie zijn erg omstreden. Zo werd in 2011 een proefveld met genetisch gemodificeerde aardappelen in Wetteren grotendeels vernield door actievoerders van Field Liberation Movement. Met de veldproef wilden wetenschappers een aardappelvariëteit testen die via modificatie resistent werd gemaakt tegen de aardappelziekte Phytophthora

S Afb. 6 Actievoerders vernietigen een ggo-proefveld in Wetteren.

Parallel met de kansen die de wetenschap biedt, is er een maatschappelijk debat ontstaan over de grenzen waarbinnen biotechnologische technieken kunnen worden toegepast. Zo houdt bio-ethiek zich bezig met de ethische aspecten van menselijke ingrepen. De opmaak van een goed wettelijk kader is van belang.

203 MODULE 15 hOOfDstUk 1
3 Biotechnologie en ethiek

Het telen van genetisch gemodificeerde gewassen wordt wereldwijd opgevolgd door de lokale wetgeving. Het wordt pas toegelaten als er voldoende bewijs is dat het gewas onschadelijk is voor mens, dier en milieu. De Europese ggo-regelgeving is een van de strengste ter wereld. Daardoor worden er in Europa, in tegenstelling tot in Noord- en Zuid-Amerika, nauwelijks ggo-gewassen geteeld en gegeten.

Veelvoorkomende ggo-landbouwgewassen zijn maïs, soja en suikerbiet. Ze worden niet in Europa geteeld, maar wel gebruikt als veevoeding. Ggo’s kunnen daardoor wel aanwezig zijn in geïmporteerd en verwerkt voedsel dat we in de supermarkt kopen. In Europa moet de aanwezigheid van ggo’s op het etiket worden vermeld als het percentage hoger is dan 0,9 %. Met een groeiende wereldpopulatie en de klimaatverandering valt het te verwachten dat ggo’s een steeds belangrijkere rol zullen spelen in onze maatschappij.

Proefversie©VANIN

> 10 miljoen

> 1 miljoen

≤ 1 miljoen geen duidelijke gegevens hectare verbouwing met ggo-gewassen

dit is normale witruimte (2 tekstregels)

Biotechnologie wordt opgedeeld in:

• klassieke biotechnologie: selectief planten/dieren kruisen en micro-organismen gebruiken om voedsel te bereiden;

• moderne biotechnologie: met behulp van moleculaire technieken gericht DNA van organismen wijzigen, zodat ze kunnen worden benut voor specifieke toepassingen.

Genetisch gemodificeerde organismen (ggo) zijn:

• transgeen wanneer ze erfelijk materiaal van een andere soort hebben ontvangen;

• cisgeen wanneer ze erfelijk materiaal van dezelfde soort hebben ontvangen.

Afhankelijk van het toepassingsgebied onderscheidt men:

• rode biotechnologie: gezondheidszorg en/of biofarmaceutische doelen;

• groene biotechnologie: landbouw- en voedingsindustrie;

• witte biotechnologie: industriële productie of afbraak van chemische stoffen;

• blauwe biotechnologie: visserij en aquacultuur.

Biotechnologie omvat kansen, maar ook uitdagingen voor de maatschappij. Vanuit de wetenschap én vanuit de maatschappij moet er een duidelijk ethisch en wettelijk kader rond biotechnologie worden opgesteld.

204 MODULE 15 hOOfDstUk 1
WEETJE
S Afb. 7 Kaart met de verspreiding van ggo-gewassen wereldwijd

AAN DE SLAG

Geef een definitie voor de onderstaande begrippen.

a cisgeen organisme

b transgeen organisme

c ggo

Het bedrijf Those Vegan Cowboys produceert kaas zonder dat er een koe aan te pas komt. Zoek op het internet een antwoord op de onderstaande vragen.

a Tot welk toepassingsgebied van de biotechnologie behoort het voorbeeld?

b Welke organismen zijn betrokken?

c Welke voordelen biedt de biotechnologische toepassing?

Ga op zoek naar drie etiketten van voedingswaren waar ggo’s in verwerkt zijn.

De ontwikkeling van DNA-technologie en toepassingen ervan worden in de samenleving voortdurend ter discussie gesteld. Er rijzen ethische vragen naar mogelijke nadelen voor gezondheid, landbouw, voeding en milieu.

Proefversie©VANIN

a Formuleer zelf enkele vragen over de toepassingen van DNA-technologie en de maatschappelijke gevolgen ervan, of kies een van de onderstaande voorbeeldvragen.

1 Is het toegelaten om baby’s te selecteren op uiterlijke kenmerken?

2 Hebben mensen met een handicap niet evenveel recht om ter wereld te komen?

3 Willen we diversiteit beknotten door selectie en manipulatie?

4 Is het een goed idee om het genoom van jezelf en je kinderen te kennen?

5 Leidt het gebruik van ggo’s tot milieuvriendelijkere landbouw?

6 Krijgt de consument voldoende informatie over ggo’s in voeding?

7 Wordt de privacy voldoende beschermd wanneer men DNA-databanken wil aanleggen, bijvoorbeeld voor forensisch onderzoek?

b Werk met een groepje een of meerdere vragen uit.

c Wissel met andere groepjes vragen, antwoorden en bedenkingen uit. Probeer daarbij een genuanceerde mening te vormen en te verdedigen in een debat met je medeleerlingen.

Meer oefenen? Ga naar .

205 MODULE 15 hOOfDstUk 1 - AAn DE sLAG
S Veganistische kaas
1 2 3
4

HOOFDSTUK 2

Î Biotechnologische technieken

In hoofdstuk 1 heb je kennisgemaakt met nieuwe ontwikkelingen binnen de biotechnologie. In dit hoofdstuk bespreken we enkele technieken om DNA te bestuderen of aan te passen. Bij elke techniek lichten we het specifieke doel en de principes toe, en tonen we hoe ze gebruikt wordt in de geneeskunde, de landbouw of de industrie.

LEERDOELEN

M Uitleggen met welke technieken wetenschappers DNA bestuderen

M Toepassingen van DNA-technologie weergeven en interpreteren

1 DNA vermenigvuldigen: de PCR-techniek

In vitro betekent letterlijk ‘in glas’: het kweken van cellen en organismen of het reageren van biomoleculen buiten hun normale biologische context, bijvoorbeeld in een proefbuis, een petrischaaltje of een erlenmeyer.

Proefversie©VANIN

De polymerase chain reaction (polymerasekettingreactie) of PCR-techniek maakt gebruik van enzymatische reacties waarbij in vitro DNA-vermenigvuldiging gebeurt op een manier die vergelijkbaar is met DNA-replicatie in een cel.

De PCR-techniek stelt een onderzoeker in staat om vanuit enkele DNA-moleculen een specifiek gekozen DNA-fragment massaal te vermenigvuldigen. Als de aanwezigheid van een specifiek DNA-fragment kan worden aangetoond, kan dat bijvoorbeeld een identificatiemiddel zijn voor een bepaalde ziektekiem.

WEETJE

De PCR-techniek werd in 1983 ontwikkeld door de Amerikaanse biochemicus Kary Banks Mullis (1944-2019). Mullis is niet alleen bekend door die ontdekking, waarvoor hij in 1993 de Nobelprijs voor Scheikunde won, maar kwam ook in het nieuws door een aantal ideeën die verder door vrijwel geen van zijn vakgenoten en andere collega-wetenschappers worden gedeeld. Zo beweerde hij in een publicatie dat het hiv-virus niet de oorzaak zou zijn van aids.

206 MODULE 15 hOOfDstUk 2
W Afb. 8 Kary Banks Mullis

1.1 Principe van de PCR-techniek

PCR is gebaseerd op het proces van DNA-replicatie. Aan het DNA-staal worden daarom een DNApolymerase en afzonderlijke nucleotiden toegevoegd.

• Tijdens de PCR-reactie wordt het staal verwarmd tot 95 °C. Daarom is een hittestabiele DNApolymerase nodig. Een voorbeeld is de DNA-polymerase geïsoleerd uit de bacterie Thermus aquaticus, die onder andere voorkomt in warmwaterbronnen in Yellowstone National Park (VS). Men spreekt daarom van Taq-DNA-polymerase

• De vier noodzakelijke nucleotiden worden aangebracht als desoxynucleotiden, de zogenoemde dNTP’s: dATP, dGTP, dTTP en dCTP.

DNA-polymerase kan alleen een bestaande keten verlengen. Daarom voegt men korte enkelstrengige DNA-strengen (twintig tot dertig nucleotiden lang) aan het staal toe: de primers

Men voegt twee verschillende primers toe. Elke primer is complementair aan één uiteinde van het DNA-fragment dat men wil vermenigvuldigen.

• De reverse primer bindt aan de 5’-3’-DNA-streng.

• De forward primer bindt aan de 3’-5’-DNA-streng.

Proefversie©VANIN

Een PCR-toestel bestaat in essentie uit een verwarmingselement dat zeer snel de kamer in het toestel kan opwarmen of afkoelen. Eén cyclus duurt maar enkele minuten. In de kamer brengt men de stalen aan in kleine buisjes (eppendorfbuisjes).

Tijdens een PCR-test werkt men immers met kleine volumes, in de orde van enkele µL.

S Afb. 9 Een wetenschapper plaatst eppendorfbuisjes met DNA-stalen in de kamer van een PCR-toestel.

Het totale reactiemengsel moet maar één keer worden gemaakt, waarna het proces geautomatiseerd verloopt. De PCR-techniek omvat in totaal twintig tot dertig temperatuurcycli, die telkens uit dezelfde drie stappen bestaan. Daarom spreek je van een kettingreactie

207 MODULE 15 hOOfDstUk 2
WEETJE

1.2 Opbouw van één PCR-cyclus

• Denaturatie

Wanneer het reactiemengsel op 95 °C wordt gebracht, openen de DNA-dubbelstrengen zich. Dat is de denaturatie

• Annealing

Wanneer het reactiemengsel wordt afgekoeld tot 40-60 °C, hechten de twee primers op de verkregen enkelstrengen. De primers binden aan het enkelstrengige DNA op de unieke sequentie waarmee ze complementair zijn. Dat is de annealing

• Elongatie

Wanneer het reactiemengsel op 72 °C wordt gebracht, kan de aanhechting van nucleotiden door Taq-DNA-polymerase starten. Elke primer wordt verlengd vanaf het 3’-einde. Dat is de elongatie

te vermenigvuldigen DNA-fragment

nucleotiden (A, C, G, T) Taq-DNA-polymerase primers

denaturatie (scheiden van DNA-strengen) annealing (aanhechten van de twee primers)

elongatie (ketenverlenging vanaf primer) forward primer reverse primer

Proefversie©VANIN

gewenst DNA-fragment overtollig DNA overtollig DNA

S Afb. 10

Schematische voorstelling van de drie stappen in een PCR-cyclus

208 MODULE 15 hOOfDstUk 2
5’ 3’ 3’ 5’ 95 °C – 30 s
5’ 3’ 3’ 5’ 40-60
min
°C – 1
5’ 5’ 3’ 3’ 3’ 3’ 5’ 5’ 5’ 3’ 3’ 5’ 72 °C – 2 min

1.3 Exponentiële toename van het gewenste DNA-fragment

Op de afbeelding zie je dat vanaf de vierde PCR-cyclus het aandeel van het gewenste DNA fragment in het reactiemengsel zeer groot wordt.

Na de PCR wordt het gewenste fragment gescheiden van de ongewenste fragmenten met behulp van gelelektroforese. Vervolgens is het bruikbaar voor verder onderzoek. Gelelektroforese bespreken we in paragraaf 2.

vierde PCR-cyclus derde PCR-cyclus

Proefversie©VANIN

tweede PCR-cyclus

eerste PCR-cyclus

reverse primer forward primer

gewenste DNA-dubbelstreng

W Afb. 11 Schematische voorstelling van vier PCR-cycli. Pas na de derde cyclus worden er gewenste DNAdubbelstrengen gevormd, zonder overtollig DNA.

209 MODULE 15 hOOfDstUk 2

Ontdek nog meer toepassingen op

1.4 Toepassingen van de PCR-techniek

TOEPASSING PRENATALE AFWIJKINGEN OPSPOREN

De niet-invasieve prenatale test (NIPT) wordt gebruikt om prenatale afwijkingen, zoals het syndroom van Down, op te sporen. Uit een bloedmonster van de moeder worden stukjes foetaal DNA gehaald. Via PCR kan men die zeldzame DNAfragmenten vermeerderen. Van elk van die fragmenten wordt bepaald tot welk chromosoom het behoort. Als het foetaal DNA te veel fragmenten van een bepaald chromosoom bevat, is er een verhoogd risico dat de foetus een chromosomale afwijking heeft.

Proefversie©VANIN

TOEPASSING IDENTIFICATIE VAN MICRO-ORGANISMEN

De PCR-techniek laat toe om snel en met grote zekerheid micro-organismen te identificeren. PCR wordt bijvoorbeeld gebruikt om de aanwezigheid van microorganismen in de bodem, het water of de atmosfeer aan te tonen. Door het DNA in een bodemstaal te analyseren, kun je het bodemleven in kaart brengen. Via die analyse kun je een goed beeld krijgen van de verhouding tussen schimmels en bacteriën. In voedselrijke graslanden en in verstoorde milieus, zoals in landbouwgronden, vind je vaak veel bacteriën en relatief weinig schimmels, terwijl het in oude bossen juist de schimmels zijn die domineren.

PCR is een DNA-technologie waarbij een specifiek gekozen DNA-sequentie kan worden vermenigvuldigd. Tijdens PCR maakt men onder andere gebruik van:

• een reverse en een forward primer die complementair zijn aan de sequenties die een bepaald gewenst DNA-fragment begrenzen;

• Taq-DNA-polymerase: een enzym dat bij hoge temperaturen DNA-strengen aanmaakt.

PCR omvat twintig tot dertig cycli, waarbij telkens drie fasen worden doorlopen: denaturatie, annealing en elongatie.

PCR kent verschillende toepassingen binnen de biologie en de geneeskunde, zoals de screening van prenatale afwijkingen en de identificatie van micro-organismen.

210 MODULE 15 hOOfDstUk 2
S Afb. 12 Het gebruik van de NIPT om het syndroom van Down bij een foetus te diagnosticeren, is deel van het ethisch debat rond biotechnologie. S Afb. 13 Zwamvlok (Mycorrhizae) in de bodem

2 DNA zichtbaar maken: DNA-gelelektroforese

Na een PCR maakt men het DNA zichtbaar via gelelektroforese. Gelelektroforese laat toe om de verschillende DNA-fragmenten die tijdens de PCR werden gevormd, van elkaar te scheiden Op die manier kan men nagaan of de PCR gelukt is.

2.1 Principe van DNA-gelelektroforese

Tijdens een DNA-gelelektroforese brengt men PCR-stalen aan op een gel. Op basis van hun lengte (molecuulmassa) worden de DNA-fragmenten van elkaar gescheiden. Afbeelding XXX geeft het verloop van een DNA-gelelektroforese weer.

migratie van DNA-stalen en gekleurde oplossing

Proefversie©VANIN

agaroseoplossing

gietbakje

gieten van de agaroseoplossing

S Afb. 14

DNA-stalen met gekleurde oplossing

elektroforesekamer

De stalen in de gel worden geladen in de elektroforesekamer.

Schematische voorstelling van het verloop van een DNA-gelelektroforese

De DNA-stalen migreren naar de positieve pool. Alleen de kleurstof is zichtbaar.

Na kleuring van de gel verschijnt er een bandjespatroon.

1 In een bakje giet men een agaroseoplossing. Aan één kant plaatst men een kam. Na het stollen verwijdert men de kam en ontstaan er uitsparingen, die je welletjes of slotjes noemt en waarin men een kleine hoeveelheid DNA-staal pipetteert.

2 Men plaatst het bakje in de elektroforesekamer, die vervolgens gevuld wordt met een buffer. In het eerste slotje brengt men een DNA-ladder aan: een oplossing die DNA-fragmenten met een gekende lengte bevat en die wordt gebruikt als referentie. Aan elk staal wordt een kleurstof toegevoegd, waardoor het verloop van de gelelektroforese kan worden gevolgd.

tijdens een gelelektroforese

3 Over de buffer brengt men een spanningsverschil aan. Door de aanwezigheid van de fosfaatgroepen is DNA negatief geladen en zal het doorheen de gel migreren naar de positieve pool van het spanningsveld. Kleinere fragmenten ondervinden minder weerstand in de poriën van de gel en migreren sneller. Grotere fragmenten zullen het lastiger hebben om zich door de gel te bewegen. Op die manier worden de DNA-fragmenten – nog niet zichtbaar – gescheiden op basis van hun grootte. De aangebrachte kleurstof migreert het snelst doorheen de gel, zodat men kan controleren dat de DNA-stalen niet uit de gel migreren.

4 Na een kleuring worden de DNA-fragmenten zichtbaar: een karakteristiek bandjespatroon wordt duidelijk. Door de bandjes te vergelijken met de gekende massa’s van de DNA-ladder, schat men de lengte van elk DNA-fragment.

211 MODULE 15 hOOfDstUk 2
slotje kam
2 3 4 1
LABO XX S Afb. 15 Stalen laden

Ontdek nog meer toepassingen op

2.2

Toepassingen van DNA-gelelektroforese

TOEPASSING OUDERSCHAPSBEPALING

De combinatie PCR-gelelektroforese wordt toegepast bij een ouderschapsbepaling. Bij alle betrokken personen neemt men bloedstalen en vermeerdert men specifieke DNA-fragmenten. Die kunnen aan- of afwezig zijn of verschillen in lengte of sequentie. Na gelelektroforese van de DNA-stalen ontstaat er een uniek bandenpatroon, dat je kunt vergelijken met de unieke vingerafdruk van elke mens. Vandaar ook de term ‘genetische vingerafdruk’ of DNA fingerprint.

Proefversie©VANIN

De DNA-bandjes van de moeder worden geïdentificeerd in de vingerafdruk van het kind. De overblijvende bandjes van het kind moeten afkomstig zijn van de vader.

De resterende bandjes van het kind komen overeen met bandjes in de genetische vingerafdruk van de werkelijke vader. Zijn vaderschap is daarmee bewezen.

Dezelfde resterende bandjes van het kind komen niet overeen met bandjes in de genetische vingerafdruk van een vermoedelijke vader. Het vaderschap is daarmee weerlegd.

S Afb. 16 Schematische voorstelling van de genetische vingerafdrukken van een moeder (groen), een kind (rood) en twee mogelijke vaders (lichtblauw en donkerblauw)

TOEPASSING DADERIDENTIFICATIE BIJ MISDRIJVEN

Het zoeken naar de oorsprong van specifieke DNA-fragmenten wordt gebruikt in de forensische geneeskunde. Het laat toe om een verdachte als dader te identificeren als bijvoorbeeld zijn bandenpatroon overeenkomt met het bandenpatroon dat is opgemaakt met DNA van biologische misdaadsporen (sperma, bloed, haar, speeksel).

S Afb. 17

Men gebruikt DNA-gelelektroforese om een daderprofiel op te stellen bij misdaden.

Wetenschappers kunnen tegenwoordig ook vanuit een DNA-profiel uitwendige kenmerken van een persoon achterhalen. Zo lokaliseerden wetenschappers dertien merkers op elf verschillende genen die gelinkt zijn aan de haarkleur van een persoon. Door die dertien merkers met elkaar te combineren, kan men tot 90 % juist de haarkleur van een persoon voorspellen.

Tijdens DNA-gelelektroforese worden DNA-strengen in een elektrisch veld gescheiden op basis van hun grootte. Gelelektroforese stelt een onderzoeker in staat om met behulp van een DNA-ladder de lengte van een DNA-streng te bepalen.

Men gebruikt gelelektroforese onder andere bij ouderschapsbepaling en forensisch onderzoek. Daarbij bekomt men een persoonsunieke DNA fingerprint

212 MODULE 15 hOOfDstUk 2

3 DNA manipuleren: recombinant DNA

Met biotechnologische technieken kan DNA worden gemanipuleerd, waardoor er recombinant DNA ontstaat. Men verandert dan het genoom van een organisme. Men verrijkt het bijvoorbeeld met genen van een ander organisme met nuttige eigenschappen. Het organisme dat het extra DNA ontvangen heeft, is een ggo. De technieken zijn gebaseerd op natuurlijke genoverdracht bij bacteriën en virussen.

3.1 Natuurlijke genoverdracht

Een bacterie bevat één grote, ringvormige, gesloten DNA-molecule, het chromosoom, die als een langwerpig kluwen is opgerold. Het draagt genen die coderen voor vitale eiwitten, zoals enzymen voor de voedselvertering, de celademhaling en de celdeling. Een bacterie kan ook een of meerdere kleine, ringvormige DNA-moleculen bevatten, die je plasmiden noemt. Genoverdracht bij bacteriën en virussen gebeurt via transformatie, conjugatie of transductie.

• Plasmiden kunnen binnen een bacterie onafhankelijk van het chromosoom worden vermenigvuldigd. Die klonen kunnen aan andere bacteriën worden overgedragen door een cytoplasmabrug of pilus te vormen. Die natuurlijke manier van genoverdracht noem je conjugatie. De genen die op de plasmiden voorkomen, kunnen soms in het chromosoom van de gastheercel worden geïntegreerd.

chromosoom

AB AB AB AB AB

Proefversie©VANIN

pilus plasmide replicatie van plasmide

• Bacteriofagen zijn virussen die enkel bacteriën infecteren. Ze kunnen hun genetisch materiaal niet zelf repliceren en zijn dus aangewezen op de bacteriële DNA-replicatie en eiwitsynthese om zich te vermenigvuldigen. Tijdens dat proces kan een deel van het bacteriële DNA in een nieuwgevormd virus terechtkomen. Wanneer dat virus op zijn beurt een bacterie infecteert, komt samen met het virale DNA ook dat bacteriële DNA in de bacterie terecht. Op die manier kan bacterieel DNA van een bacterie in een andere bacterie terechtkomen zonder direct contact, maar met behulp van virussen. Dat is transductie

213 MODULE 15 hOOfDstUk 2
S Afb. 18 Schematische weergave van conjugatie

Restrictie-enzymen worden vaak genoemd naar het organisme waarin ze het eerst worden aangetroffen.

Voorbeelden zijn EcoRI en HindIII.

bacteriofaag viraal DNA

bacteriofaag met viraal DNA

bacteriofaag met een deel van het bacteriële DNA

Proefversie©VANIN

chromosoom

S Afb. 19

DNA-fragment van bacterie

Schematische weergave van transductie

bacteriofaag met een deel van het bacteriële DNA

gastheerbacterie

bacterieel DNA in chromosoom van gastheerbacterie

Bacteriën beschikken van nature over eiwitten die hen beschermen tegen een virale aanval. Die eiwitten noem je restrictie-enzymen. Restrictie-enzymen:

• herkennen specifieke nucleotidesequenties;

• knippen de nucleotidebindingen in DNA alleen ter hoogte van sequenties die wel in het virale, maar niet in het eigen DNA aanwezig zijn;

• knippen ook die sequenties wanneer ze aanwezig zijn in het DNA van gistcellen, planten en dieren

Restrictie-enzymen worden daarom ook knipenzymen of moleculaire scharen genoemd. Na het knippen vertonen de DNA-fragmenten aan hun uiteinden dikwijls een welbepaalde reeks van ongepaarde nucleotiden (enkelstrengig DNA). Die uiteinden noem je klevende einden of sticky ends. Rechte knipplaatsen leiden tot blunt ends

EcoRI = Escherichia coli R-stam

TaqI = Thermus aquaticus

HaeIII = Haemophilus aegyptus

HpaI = Haemophilus parainfluenzae

HindIII = Haemophilus influenzae d-stam

S Afb. 20 Voorbeelden van restrictie-enzymen en hun specifieke knipplaats. Daarbij ontstaan sticky ends of blunt ends

restrictie-enzym sticky ends blunt ends

De ontdekking van restrictie-enzymen en hun specifieke eigenschappen betekende een grote stap in de moderne biotechnologie. Voor het eerst kon men heel gericht DNA knippen op een bepaalde plaats.

214 MODULE 15 hOOfDstUk 2
EcoRI TaqI HaeIII HpaI
5’ 3’ HindIII 5’ 3’ G C C C G C G C G C G C G C G C A T A T A T A T A T A T A T A T A T A T A T A T A T A T G C G C C G C G C G C G C G C G C G C G C G C G C A T A T 5’ 3’ G C T T A A 5’ 3’ C C G A A T T C C T A T A T A T A G C C G G C C A A A T T T G G A T G C G C G C C G C

3.2 Kunstmatige genoverdracht

Dankzij hun kennis over de natuurlijke genoverdracht en restrictie-enzymen bij bacteriën hebben biotechnologen technieken ontwikkeld om een gewenst stukje DNA, het donor-DNA, over te dragen van het ene organisme naar het andere. Je spreekt van kunstmatige genoverdracht.

In de loop der jaren zijn er verschillende technieken ontwikkeld waarbij telkens vectoren worden gebruikt om het DNA binnen te brengen in een cel. We bespreken het verloop van kunstmatige genoverdracht waarbij een plasmide als vector wordt gebruikt.

VOORBEELD KUNSTMATIGE GENOVERDRACHT MET PLASMIDE

Proefversie©VANIN

plasmide

chromosoom

Een plasmide wordt geïsoleerd uit een bacterie en opengeknipt met een restrictie-enzym.

resistentiegen

Het gewenste stuk donor-DNA wordt samengevoegd met de opengeknipte plasmide. Er vormen zich H-bruggen tussen de complementaire sticky ends.

donor-DNA

knipplaatsen

Het donor-DNA wordt uit de cel gehaald en met hetzelfde restrictie-enzym geknipt.

Er is nu een recombinante plasmide ontstaan, opgebouwd uit bacterieel DNA en donor-DNA.

S Afb. 21 Schematische voorstelling van kunstmatige genoverdracht

recombinante plasmide

De recombinante plasmide wordt weer ingebracht in het nu transgene organisme.

Om te controleren of de bacterie inderdaad transgeen is, voegt men aan de transgene plasmide een gen toe dat zorgt voor resistentie tegen een specifiek antibioticum, bijvoorbeeld ampicilline. Wanneer de celkweek na transformatie wordt behandeld met dat antibioticum, dan zullen enkel de bacteriën die het resistentie-opwekkende gen bevatten, overleven.

215 MODULE 15 hOOfDstUk 2
AATT
A A AA T T TT A AA A T TT T A A A A T TT T
TTAA

De bacterie Bacillus thuringiensis (Bt) is een natuurlijke vijand van rupsen. Ze scheidt de Bt-toxine af, die de rupsen doodt. In de biologische landbouw brengt men een bacteriële kweek als een sproeistof aan op gewassen. Wanneer de bacterie groeit in de plant, is die beschermd tegen vraatzucht.

In 1985 slaagden Marc Van Montagu (°1933) en Jeff Schell (1935-2003) van de Universiteit Gent erin om het gen dat codeert voor die Bt-toxine, over te brengen in het tabaksgenoom. Ze maakten gebruik van een plasmide afkomstig van Rhizobium radiobacter. Die bodembacterie draagt DNA uit haar plasmide over aan planten en wekt er een tumor op. Aan die tumorinducerende plasmide (Ti-plasmide) voegden ze het Bt-toxinegen toe. Na transformatie wordt het gen opgenomen in het genoom van de tabaksplant: de transgene plant is dan beschermd tegen vraatzucht.

Proefversie©VANIN

gen voor Bt-toxine

Bacillus thurigiensis

Rhizobium radiobacter

zelf Bt-toxine aan te maken

Ti-plasmide

gen voor Bt-toxine

plant giftig voor insecten

Elke plantencel maakt nu de Bt-toxine.

cel van tabaksplant

DNA kan ook in een cel worden aangebracht via andere methodes:

• Liposomen: het gewenste DNA wordt verpakt in minuscule, kunstmatig gemaakte vetdruppeltjes, opgebouwd uit een fosfolipidendubbellaag. Door endocytose kan het dan in de doelwitcel terechtkomen.

• Micro-injectie: met een fijne injectienaald worden de gewenste genen rechtstreeks geïnjecteerd in een in vitro bevruchte eicel of een andere cel.

• Elektroporatie: met een korte stroomstoot maakt men poriën in het celmembraan, waardoor het gewenste DNA kan worden opgenomen.

• Het genenkanon: een toestel schiet met hoge snelheid microscopisch kleine (1,5 μm) goud-, wolfram- of zilverbolletjes, bekleed met het gewenste DNA, op doelwitcellen.

216 MODULE 15 hOOfDstUk 2
S Afb. 22
WEETJE
De productie van transgene tabaksplanten met het Bt-gen om WEETJE

3.3 Kloneren

Wanneer er een identieke kopie van een organisme of van een DNA-molecule wordt gemaakt, noem je dat kloneren of klonen. Je onderscheidt vier types.

A Natuurlijk kloneren

Verschillende planten en dieren kunnen zich vegetatief of ongeslachtelijk voortplanten. Voorbeelden vind je bij aardbeien, sponzen of kwallen. In de landbouw maakt men gretig gebruik van natuurlijk kloneren, omdat het nageslacht dezelfde eigenschappen bezit als het moederorganisme. Een genetisch identieke kopie noem je een kloon.

B Moleculair kloneren

Moleculair kloneren richt zich niet op het kloneren van een organisme, maar op de productie van specifieke moleculen door een transgeen organisme. Het woord ‘kloneren’ wijst hier dus op de verzameling identieke kopieën van het ingebrachte stukje DNA. Als gastheercel gebruikt men meestal bacteriën of gistcellen.

C Reproductief kloneren

In 1996 kloneerden wetenschappers een schaap door de kern uit een volwassen huidcel over te brengen in een eicel waaruit ze eerst de kern verwijderd hadden. Je noemt dat celkerntransplantatie. Het schaap dat daaruit geboren werd, heette Dolly. Sindsdien werden onder meer ratten, muizen, honden en apen gekloneerd. Veel gekloonde dieren bleken echter niet gezond te zijn en vroeg te sterven. Dat soort kloneren valt onder de term reproductief kloneren

Proefversie©VANIN

D Therapeutisch kloneren

Bij therapeutisch kloneren produceert men op een kunstmatige manier lichaamscellen die kunnen bijdragen aan de genezing van bepaalde ziekten. De bedoeling is om, uitgaande van stamcellen, persoonsspecifieke weefsels te maken, zodat die na transplantatie niet worden afgestoten.

Ga naar voor een schematische weergave van reproductief kloneren.

Stamcellen zijn niet-gespecialiseerde cellen die onbeperkt kunnen delen en differentiëren tot gespecialiseerde celtypes.

217 MODULE 15 hOOfDstUk 2
S Afb. 23 Natuurlijk kloneren bij een aardbei. De uitlopers vormen een nieuwe plant die genetisch identiek is aan de moederplant. S Afb. 24 De klassieke kaasproductie gebruikt het enzym chymosine uit de maag van kalveren. Kalfschymosine wordt nu ook door genetisch gemodificeerde gistcellen geproduceerd. S Afb. 25 Het schaap Dolly in het National Museum van Schotland

3.4

Toepassingen van recombinant DNA

TOEPASSING SYNTHESE VAN INSULINE DOOR TRANSGENE BACTERIËN

Sinds 1982 wordt er door moleculair kloneren recombinante insuline op de markt aangeboden. Vandaag is menselijke insuline, aangemaakt door genetisch gewijzigde bacteriën, overal ter wereld te koop. Hoe je komt tot een bacterie die insuline kan produceren, zie je op afbeelding XXX.

alvleeskliercel

DNA met gen voor insuline

Het insulinegen wordt geïsoleerd.

dezelfde restrictie-enzymen

geïsoleerde en opengeknipte plasmide

plasmide in nieuwe bacterie

DNA-ligase

recombinante plasmide (met insulinegen)

plasmide

bacterieel DNA

S Afb. 26

De productie van insuline door transgene bacteriën

De recombinante ggo-bacterie gaat op basis van het ingebrachte insulinegen insuline produceren.

Proefversie©VANIN

Bacteriën met het insulinegen worden gekweekt/gekloneerd in grote industriële tanken.

De insuline wordt geoogst en gebruikt als medicijn.

• Natuurlijke genoverdracht vindt bij bacteriën en virussen plaats via conjugatie of transductie.

• Tijdens kunstmatige genoverdracht gebruikt men een vector, bijvoorbeeld een plasmide, om DNA binnen te brengen in een ander organisme. Restrictie-enzymen knippen DNAstrengen op specifieke plaatsen.

• Kloneren is het maken van kopieën van cellen, organismen, moleculen ... Kloneren wordt opgedeeld in natuurlijk, reproductief, moleculair en therapeutisch kloneren.

De technologie van recombinant DNA kent vele toepassingen, zoals de productie van insuline door transgene bacteriën.

218 MODULE 15 hOOfDstUk 2

4 DNA manipuleren: gene editing

Gene editing biedt de mogelijkheid om specifieke veranderingen aan te brengen in het DNA van zowel prokaryote als eukaryote organismen. Op die manier kan men bijvoorbeeld met ongekende precisie een kleine mutatie in het DNA aanpassen of kan men een gen uitschakelen of manipuleren om de functie ervan te onderzoeken.

S Afb. 27

Gene editing: het gericht aanbrengen van veranderingen in het DNA

Gene editing laat toe om de DNAsequentie van een cel of een organisme specifiek te veranderen door DNA-nucleotiden toe te voegen (insertie), te vervangen (substitutie) of te verwijderen (deletie). Als er een ggo wordt gemaakt, is er sprake van recombinant DNA: DNA van een vector (bacterie, virus …) gecombineerd met een gewenst DNA-fragment. Bij gene editing wordt enkel de bestaande sequentie aangepast en wordt er dus geen vreemd DNA ingebracht.

4.1 Gene editing met behulp van CRISPR-Cas

Bacteriën beschikken over een verdedigingsmechanisme tegen virale infecties, het CRISPR-Cas-systeem.

Het bestaat uit verschillende onderdelen, die samen het CRISPR-Cas-register vormen. Het register is een soort geheugenbank waarin de bacterie viraal DNA van eerdere virale infecties bewaart. Dat variabele virale DNA noem je spacer DNA. Het ligt verspreid over het register tussen identieke, herhalende CRISPR-genen. De zone waarin de CRISPR-genen en het spacer DNA liggen, wordt geflankeerd door Cas-genen, kort voor CRISPR-associated genes.

De Cas-genen coderen voor enzymen die een DNA-dubbelstreng openen (helicasen) en een enkelvoudige streng in stukken knippen (nucleasen).

Proefversie©VANIN

S Afb. 28

Cas-genen

identieke, herhalende CRISPR-genen viraal DNA (spacer DNA)

De opbouw van een CRISPR-Cas-register in Escherichia coli

CRISPR is een acroniem van Clustered Regularly Interspaced Short Palindromic Repeats

Cas-gen

219 MODULE 15 hOOfDstUk 2

De werking van het natuurlijke CRISPR-Cas-systeem in bacteriën is weergegeven op afbeelding XXX.

eerste infectie tweede infectie

viraal DNA (spacer DNA)

CRISPR-genen Cas-gen

CRISPR-register

CRISPR-RNA spacer RNA

Cas-nuclease

Een Cas-nuclease (schaar) knipt tijdens een eerste infectie een stuk viraal DNA, het spacer DNA, en integreert het in zijn CRISPR-register.

Bij een tweede infectie met hetzelfde virus wordt het CRIPR-register afgeschreven. Ook het stuk specifiek spacer RNA wordt gevormd.

De CRISPR-RNA-streng bindt aan Cas-nuclease.

Het CRISPR-RNA-Cas-complex herkent de regio in het virale genoom en knipt het in stukken.

Proefversie©VANIN

S Afb. 29

CRISPR-Cas: een bacterieel verdedigingsmechanisme

4.2 Toepassingen van gene editing

TOEPASSING SIKKELCELANEMIE

In module XX leerde je dat sikkelcelanemie een erfelijke ziekte is die wordt veroorzaakt door een mutatie in het gen voor een van de subeenheden van hemoglobine. Amerikaanse onderzoekers slaagden er in 2016 in om met behulp van CRIPSR-Cas het foute gen voor de subeenheid te corrigeren in bloedvormende stamcellen van patiënten met sikkelcelanemie. Ze brachten die gecorrigeerde cellen ook in bij muizen en zagen dat de cellen na zestien weken nog altijd ‘gezonde’ hemoglobine produceerden.

Gene editing biedt de mogelijkheid om gericht veranderingen aan te brengen in het genetisch materiaal van bacteriën, planten, dieren en mensen.

CRISPR-Cas is gebaseerd op een beschermingsmechanisme van bacteriën tegen een virale infectie. De techniek wordt door wetenschappers gebruikt om heel nauwkeurige wijzigingen aan te brengen in DNA en zo specifieke genen te inactiveren

CRISPR-Cas kent verschillende medische toepassingen, zoals bij sikkelcelanemie.

220 MODULE 15 hOOfDstUk 2

AAN DE SLAG

Met welke DNA-technologie kun je het volgende bekomen?

a een DNA fingerprint van een persoon opstellen b een reeks gelijke cellen aanmaken

c een specifiek DNA-fragment vermenigvuldigen d een gen gericht inactiveren

Hoe noem je de ongepaarde nucleotiden die ontstaan door de werking van sommige restrictieenzymen?

a enkelstrengen

b sticky ends c ligasen d knipplaatsen

Tijdens een PCR maakt een wetenschapper gebruik van kleine DNA-strengen om gericht een specifieke DNA-streng te vermenigvuldigen. Dat zijn … a probes; b nucleasen; c primers; d polymerasen.

Waarom gebruikt men bij PCR het enzym Taq-DNApolymerase?

Waarom is het belangrijk dat een PCR twintig tot dertig cycli doorloopt?

Om een humaan gen in een plasmide in te bouwen, is het van belang dat …

a het gen en de plasmide dezelfde lengte hebben;

b het gen en de plasmide afkomstig zijn van hetzelfde organisme;

c het gen en de plasmide geknipt worden met hetzelfde restrictie-enzym; d het gen en de plasmide dezelfde sequentie dragen.

c gids-RNA 7 8

Men probeert de ouders van een overleden soldaat op te sporen. Op de afbeelding zie je de genetische vingerafdruk van de soldaat en van vier ouderparen.

Bepaal op basis van het strepenpatroon wie de ouders van de soldaat zijn.

ouders AB soldaat ouders CD ouders EF ouders GH

Proefversie©VANIN

Bespreek kort de functie van deze moleculen bij CRISPR-Cas9.

a Cas9

b spacer-DNA

Meer oefenen? Ga naar .

221 MODULE 15 hOOfDstUk 2 - AAn DE sLAG
1 2 3 4 5 6

KLASSIEKE BIOTECHNOLOGIE

• Veredeling van planten en dieren door selectief te kruisen

• Gebruik van micro-organismen bij het gebruik en de bereiding van voedingsmiddelen

• Nadelen: ‒Veredeling wordt beperkt door soortbarrière.

‒Pas na generaties verkrijg t men de gewenste eigenschappen.

MODERNE BIOTECHNOLOGIE = DNA-TECHNOLOGIE

• Ingrijpen in het erfelijk materiaal van een organisme door DNA te analyseren of aan te passen

• Genetisch gemodificeerde organismen (ggo)

Proefversie©VANIN

Doel: DNA vermenigvuldigen

• Een specifieke DNA-sequentie kan geïsoleerd en massaal vermenigvuldigd worden.

• De PCR-techniek omvat twintig à dertig cycli, waarbij drie fasen doorlopen worden: denaturatie, annealing en elongatie

• Toepassingen: identificatie van micro-organismen en opsporing van prenatale afwijkingen

‒Transgeen: ggo heeft erfelijk materiaal van een andere soort ontvangen.

‒Cisgeen: ggo heeft erfelijk materiaal van dezelfde soort ontvangen om een specifieke eigenschap in te brengen.

Afhankelijk van het toepassingsgebied onderscheid je:

1 rode biotechnologie: gezondheidszorg en/ of biofarmaceutische doelen;

2 groene biotechnologie: landbouw- en voedingsindustrie;

3 witte biotechnologie: industriële productie of afbraak van chemische stoffen;

4 blauwe biotechnologie: visserij en aquacultuur.

BIOTECHNOLOGISCHE TECHNIEKEN

CHAIN REACTION (PCR)

te vermenigvuldigen DNA-fragment

nucleotiden (A, C, G, T) Taq-DNA-polymerase primers

°C – 30 s

denaturatie (scheiden van DNA-strengen)

annealing (aanhechten van de twee primers)

forward primer reverse primer

°C – 2

elongatie (ketenverlenging vanaf primer)

222 MODULE 15 thEMAsYnthEsE
POLYMERASE
5’ 3’ 3’ 5’ 95
5’ 3’ 3’ 5’
40-60 °C – 1 min
5’ 5’ 3’ 3’ 3’ 3’ 5’ 5’ 5’ 3’ 3’ 5’
min
72
gewenst DNA-fragment overtollig DNA overtollig DNA THEMASYNTHESE

Doel: DNA-fragmenten van elkaar scheiden en zichtbaar maken

• Techniek om DNA-fragmenten te scheiden en hun lengte te schatten

• DNA-gelelektroforese wordt uitgevoerd op een agargel waarover men een spanningsverschil aanlegt.

• Grote en kleine DNA-fragmenten bewegen doorheen de gel met verschillende snelheden en laten een bandenpatroon achter.

• Toepassingen: ouderschapsbepaling en forensisch onderzoek

Doel: DNA manipuleren

• Natuurlijke genoverdracht vindt bij bacteriën en virussen plaats via conjugatie of transductie.

• Tijdens kunstmatige genoverdracht gebruikt men een vector om DNA binnen te brengen in een ander organisme. Restrictieenzymen knippen DNA-strengen op specifieke plaatsen. Daarbij ontstaan sticky ends. DNA-ligasen verbinden de strengen.

• Kloneren is een techniek om een organisme (een kloon) te creëren die genetisch een exacte kopie is van een ander organisme (de donor).

• Toepassingen: productie van insuline

DNA-GELELEKTROFORESE

Proefversie©VANIN

DNA-stalen worden in een gel aanbracht, waarna ze op basis van hun lading worden gescheiden.

RECOMBINANT DNA

chromosoom

Een plasmide wordt geïsoleerd uit een bacterie en opengeknipt met een restrictie-enzym.

resistentiegen

Het gewenste stuk donor-DNA wordt samengevoegd met de opengeknipte plasmide. Er vormen zich H-bruggen tussen de complementaire sticky ends

Een DNA-bandenpatroon wordt zichtbaar na een kleuring.

Er is nu een recombinante plasmide ontstaan, opgebouwd uit bacterieel DNA en donor-DNA.

donor-DNA

knipplaatsen

Het donor-DNA wordt uit de cel gehaald en met hetzelfde restrictie-enzym geknipt.

recombinante plasmide

De recombinante plasmide wordt weer ingebracht in het nu transgene organisme.

223 MODULE 15 thEMAsYnthEsE kennisclip VIDEO
AATT TTAA A A AA T T TT A AA A T TT T A A A A T TT T
plasmide

Doel: DNA-sequentie manipuleren

• Door gene editing kan men de DNAsequentie van een cel of organisme veranderen door DNA-nucleotiden toe te voegen (insertie), te vervangen (substitutie) of te verwijderen (deletie).

• De CRISPR-Cas-techniek wordt gebruikt om specifieke genen te inactiveren.

• Toepassingen: medische toepassingen, zoals bij sikkelcelanemie

GENE EDITING

tweede infectie

eerste infectie

Proefversie©VANIN

viraal DNA (spacer DNA)

CRISPR-genen Cas-gen

CRISPR-register

CRISPR-RNA spacer RNA

Cas-nuclease

Een Cas-nuclease (schaar) knipt tijdens een eerste infectie een stuk viraal DNA, het spacer en integreert het in zijn CRISPR-register.

Bij een tweede infectie met hetzelfde virus wordt het CRIPR-register afgeschreven.

Ook het stuk specifiek spacer RNA wordt gevormd.

De CRISPR-RNA-streng bindt aan Cas-nuclease.

Het CRISPR-RNA-Cas-complex herkent de regio in het virale genoom en knipt het in stukken.

224 MODULE 15 thEMAsYnthEsE

Proefversie©VANIN

Proefversie©VANIN

MODULE 16 EVOLUTIE Proefversie©VANIN

Uit één gemeenschappelijke voorouder is er een ongelooflijke diversiteit aan leven geëvolueerd. Je kunt elk organisme beschouwen als een ingenieus systeem dat bijzonder goed is aangepast aan de omstandigheden waarin het leeft. Een voorbeeld daarvan is de vlinder Papilio troilus. Evolutie zorgde ervoor dat de vlinder een meester is in zich vermommen. De jonge larven zijn bruin en scheiden een kwalijke geur af. Daardoor zien vogels ze aan voor uitwerpselen. In een later stadium blaast de rups zijn kop op als er een vogel in de buurt komt. Daardoor lijkt het de kop van een slang. Ook de volwassen vlinders vermommen zich. Ze lijken op een andere vlinder, die de vogels niet lusten.

` Welke mechanismen zijn verantwoordelijk voor evolutie?

` Welke feiten ondersteunen de evolutietheorie?

` Hoe ontstaan nieuwe soorten?

We zoeken het uit!

?

VERKEN

JE KUNT AL ...

• uitleggen hoe meiose voor genetische variatie kan zorgen;

• uitleggen wat allelen zijn en hoe die worden overgeërfd;

• verschillende soorten mutaties opsommen;

• het begrip ‘populatiegenetica’ uitleggen.

• uitleggen hoe je DNA kunt analyseren;

• verschillende groepen van organismen onderscheiden op basis van uiterlijke kenmerken.

• de bouw en de functie van een cel uitleggen.

Proefversie©VANIN

JE LEERT NU ...

• de begrippen ‘evolutie’ en ‘evolutietheorie’ uitleggen;

• welke rol mutatie, selectie, gene flow en genetische drift spelen bij evolutie.

• hoe de evolutiegedachte ontstond;

• wat de eerste evolutietheorieën waren;

• welke wetenschappelijke argumenten de evolutietheorie onderbouwen.

• uitleggen hoe soorten ontstaan;

• het ontstaan van het leven begrijpen;

• mijlpalen in de evolutie van de mens uitleggen;

• inzien dat alle organismen een gemeenschappelijke voorouder hebben.

232 MODULE 16 vErkEn
H1 H2 H3

HOOFDSTUK 1

Î Mechanismen van evolutie

De levensvormen die vandaag voorkomen, zien er anders uit dan die van 2 miljoen jaar geleden. Ook de huidige mens lijkt niet meer op zijn voorouders van 1 miljoen jaar geleden. Beide voorbeelden zijn een gevolg van evolutie. In dit thema ontdek je de processen die evolutie veroorzaken.

Proefversie©VANIN

LEERDOELEN

M Wetenschappelijk onderbouwde argumenten voor evolutie en de evolutietheorie geven

1 Evolutie en evolutietheorie

Als het in de biologie over ‘evolutie’ gaat, is het belangrijk om een onderscheid te maken tussen de begrippen ‘evolutie’, ‘evolutietheorie’ en ‘evolutieverloop’.

Evolutie is het proces waarbij erfelijke eigenschappen in een populatie veranderen over verschillende generaties. Als gevolg veranderen soorten in de loop van de tijd. Dat proces is een feit. Het wordt bevestigd door talloze observaties en onderzoeksresultaten.

Een evolutietheorie beschrijft de mechanismen die evolutie veroorzaken. Evolutiebiologen en andere wetenschappers blijven bepaalde aspecten van de evolutietheorie aanvullen of bijstellen. Daardoor is de huidige evolutietheorie veel uitgebreider dan de oorspronkelijke, die door Charles Darwin in de negentiende eeuw werd geformuleerd. Veel aspecten van de oorspronkelijke theorie blijven vandaag nog overeind, maar andere werden weerlegd.

• Evolutie is de verandering van de erfelijke eigenschappen in een populatie over verschillende generaties.

• De evolutietheorie beschrijft welke mechanismen evolutie veroorzaken.

233 MODULE 16 hOOfDstUk 1

2 Mechanismen van evolutie

Evolutie is de verandering van de genetische samenstelling van een populatie. We beschrijven hieronder de mechanismen die kunnen zorgen voor die verandering in de genetische samenstelling.

2.1 Mutatie

Door genmutaties ontstaan er nieuwe allelen van een gen. Als het gaat om een neutrale mutatie, hebben die nieuwe allelen geen effect op het organisme. In andere gevallen heeft het nieuwe allel meestal een nadelig effect. Soms geeft de mutatie het organisme een betere overlevings- of voortplantingskans. Dan spreek je van een winstmutatie.

Mutaties leiden tot genetische variatie. Dat kan op zijn beurt leiden tot variatie in het fenotype. De overige mechanismen van evolutie werken in op die variatie. Mutatie kun je dus zien als de drijvende kracht achter evolutie

Proefversie©VANIN

mutatie nieuw allel

Het is belangrijk om in het achterhoofd te houden dat niet alle erfelijke eigenschappen terug te vinden zijn in de nucleotidesequentie. In module XX toonden we al aan dat bij heel wat organismen epigenetische modificaties ook overgeërfd kunnen worden. Men gaat er op dit moment van uit dat het doorgeven van die epigenetische aanpassingen slechts een invloed heeft op enkele generaties. Evolutie op lange termijn wordt dus bepaald door de genetische variatie veroorzaakt door mutatie.

234 MODULE 16 hOOfDstUk 1
T A A G G C C T A G G C C G
S Afb. 253 In een populatie van groene kikkers kan mutatie ervoor zorgen dat er feller gekleurde individuen ontstaan. WEETJE

2.2 Mechanisme 1: natuurlijke selectie

Niet alle allelen bieden een individu dezelfde overlevings- en voortplantingskansen. Als een allel codeert voor een eigenschap die ervoor zorgt dat een individu beter is aangepast aan de omstandigheden waarin het leeft, dan zal dat allel meer en meer voorkomen in de volgende generaties. Een steeds groter aantal individuen zal beter aangepast zijn aan de omstandigheden. Dat is natuurlijke selectie.

Natuurlijke selectie is gebaseerd op drie principes:

• Er is een verschil in fenotype tussen verschillende individuen in een populatie.

• Individuen met een verschillend fenotype hebben een verschillende overlevings- of voortplantingskans, een andere fitness.

• De genetische informatie die zorgt voor de variatie in fenotypes, is overerfbaar.

Op afbeelding XXX zie je een populatie kikkers, waarvan één kikker als gevolg van mutatie feller gekleurd is. De feller gekleurde kikker in de populatie lijkt op een giftige kikkersoort in hetzelfde gebied. Daarom laten vogels hem met rust, waardoor de kikker een betere overlevingskans heeft.

Door natuurlijke selectie zal het allel voor felle kleur vaker voorkomen in de volgende generaties.

Proefversie©VANIN

verschillende generaties nieuwe genenpoel

van natuurlijke selectie in een kikkerpopulatie

De fitness van een bepaald fenotype is niet constant. Als de omgeving verandert, kan de fitness ook veranderen. Neutrale of nadelige eigenschappen kunnen voordelig worden in een veranderde omgeving. Zo zal bijvoorbeeld minder productie van pigment leiden tot een lichtere vorm van het organisme. Als er door een temperatuurdaling langzaam een sneeuwlandschap ontstaat, kan die lichtere vacht een voordeel vormen. Een witte mol zal immers in de sneeuw minder opvallen voor zijn natuurlijke vijanden, zoals de uil, de buizerd of de vos.

S Afb. 255

Albinovorm van de mol (Talpa europaea)

Een voorbeeld van natuurlijke selectie op korte termijn is industriemelanisme. Lees meer op

235 MODULE 16 hOOfDstUk 1
S Afb. 254 Een voorbeeld

2.3 Mechanisme 2: seksuele selectie

Seksuele selectie is een gevolg van de strijd om voort te planten:

• Het ene geslacht kiest een partner op basis van bepaalde eigenschappen bij het andere geslacht. Die eigenschappen zijn een indicatie van de fitness van de partner. Vrouwelijke organismen steken meestal meer energie in de voortplanting. Bij zoogdieren bijvoorbeeld draagt het vrouwtje gedurende de zwangerschap het jong en daarna zoogt ze het. Vrouwtjes hebben er dus alle belang bij om kieskeurig te zijn als ze een partner zoeken om zich voort te planten. Seksuele selectie komt daardoor vaak neer op de vrouwelijke keuze: het vrouwtje kiest de partner.

• Er is competitie tussen de individuen van het geslacht dat zichzelf moet bewijzen als meest geschikte voortplantingspartner.

Als het kenmerk dat de voortplantingskansen verhoogt, genetisch bepaald is, zal dat kenmerk in de volgende generatie meer voorkomen. We illustreren dat met een voorbeeld.

Veronderstel dat vrouwtjeskikkers een voorkeur hebben voor mannetjes met een luide lokroep. Op afbeelding XXX zie je hoe na meerdere generaties de mannetjes met een luide lokgroep in aantal toenemen.

meerdere generaties variatie in lokroep

Proefversie©VANIN

S Afb. 256

Door seksuele selectie zullen er in de volgende generaties meer mannetjes met een luide lokroep zijn.

Seksuele selectie bevoordeelt andere eigenschappen in de twee geslachten. Voor competitie om een territorium is kracht belangrijk. Als gevolg daarvan zijn veel zoogdiermannetjes groter en sterker dan hun vrouwelijke tegenhangers. Tussen vrouwelijke zoogdieren is er geen competitie voor voortplanting. De energie die steekt in onnodige groei en spieropbouw, is dan nadelig. Zo heeft seksuele selectie bij veel organismen geleid tot seksueel dimorfisme, opvallende verschillen tussen beide geslachten.

S Afb. 257 Seksueel dimorfisme bij het vliegend hert (Lucanus cervus). De kaken van de mannetjes dienen enkel om elkaar omver te werpen en zo vrouwtjes te imponeren.

Sommige wetenschappers beschouwen seksuele selectie als een onderdeel van natuurlijke selectie. Andere zien het als een apart selectiemechanisme dat evolutie stuurt.

236 MODULE 16 hOOfDstUk 1

Over het algemeen investeren vrouwelijke organismen meer energie en tijd in het nageslacht. Vrouwelijke organismen produceren immers grote, energierijke eicellen. Mannelijke organismen produceren zeer veel, maar kleine zaadcellen. Meestal is de enige bijdrage van die zaadcellen aan het embryo het genetisch materiaal. Door dat verschil in voortplantingsstrategie is er een verschil in ouderlijke investering tussen de geslachten.

Een uitzondering is de mormonenkrekel.

Bij die soort is er een hogere investering door het mannetje. Die zet tijdens het paren in het vrouwtje een pakketje af dat bestaat uit zaadcellen en eiwitrijke voeding.

De mannetjes steken ongeveer 30 % van hun eigen lichaamsgewicht in de pakketjes. Die grote energie-investering zorgt ervoor dat mannetjes selectief zijn. Ze paren bij voorkeur met zwaardere vrouwtjes. Die hebben meer onbevruchte eitjes en kunnen zo meer nageslacht geven.

Proefversie©VANIN

VOORBEELD SEKSUELE SELECTIE

Vrouwelijke keuze wordt vaak via observatie onderzocht. Vrouwelijke pauwen paren nooit met het eerste mannetje dat hen het hof maakt. De kans op paren verhoogt bovendien als de staart van het mannetje breder is en meer ogen bevat. De staart kan echter niet onbeperkt toenemen. Op een bepaald moment wordt immers de energie-investering te hoog of heeft het kenmerk een nadelige invloed op de overlevingskans. Een te grote staart maakt het bijvoorbeeld moeilijker om weg te vluchten bij gevaar. Recent onderzoek toont aan dat naast de staart ook geluid belangrijk is voor de partnerkeuze. De mannetjes maken infrasone geluiden om de vrouwtjespauw te overtuigen.

Infrasone geluiden zijn geluiden met een lage frequentie die onhoorbaar zijn voor de mens.

artikel: seksuele selectie bij pauwen

237 MODULE 16 hOOfDstUk 1
S Afb. 258 Een mormonenkrekel (Anabrus simplex) WEETJE
Een mannetjespauw
140 0 150 160 1 2 3 4 5 6 7 8 aantal ogen op de staart aantal vrouwtjes waarmee het mannetje paart
S Afb. 259 (Pavo cristatus)
Op de grafiek is het aantal ogen op de staart
x-as) uitgezet tegenover het aantal vrouwtjes waarmee de pauw paart (y-as).
S Afb. 260
(
VIDEO

2.4 Mechanisme 3: gene flow

Gene flow is het verspreiden van allelen van één populatie naar een andere. Dat zorgt voor een verandering van de allelfrequentie en op die manier voor evolutie.

Gene flow is vaak het gevolg van migratie van individuen tussen verwante populaties. Zo kan een volwassen dier terechtkomen in een andere populatie. Als het dier kan overleven en zich kan voortplanten, zal dat de genetische samenstelling van die populatie veranderen. Gene flow kan ook het gevolg zijn van de verspreiding van voortplantingscellen, zaden, sporen of een onvolwassen stadium van een organisme. Dat komt onder andere voor bij planten en vastzittende dieren in de zee.

Veronderstel dat de populatie met feller gekleurde kikkers aan één kant van een snelstromende rivier voorkomt. Bij de kikkers aan de andere kant van de rivier komt de mutatie niet voor en heeft de hele populatie een groene kleur. Een omgevallen boom maakt migratie mogelijk. Het voordelige allel voor felle kleur komt zo in de populatie groene kikkers terecht en kan daar worden verspreid. Omgekeerde migratie van groene kikkers naar de populatie die ook felgekleurde individuen bevat, vertraagt de natuurlijke selectie voor felle kleur. Beide zijn voorbeelden van gene flow

populatie A

Proefversie©VANIN

populatie B

migratie

Door het lage aantal individuen hebben bedreigde soorten weinig genetische variatie. Door gericht te kruisen, probeert de mens dat voor bepaalde soorten te verbeteren. Een voorbeeld is het internationale fokprogramma van de reuzenpanda. In gevangenschap is het voortplantingssucces van de reuzenpanda laag. Door gerichte keuze van de ouders en het gebruik van kunstmatige inseminatie slaagt men erin om de genetische diversiteit van de reuzenpanda te verhogen.

238 MODULE 16 hOOfDstUk 1
rivier S Afb. 261 Door migratie kan het allel voor felgekleurde kikkers in een verwante populatie terechtkomen. S Afb. 262 De reuzenpanda (Ailuropoda melanoleuca) is een bedreigde diersoort. WEETJE

2.5 Mechanisme 4: genetische drift

In populaties kan de allelfrequentie louter door toeval toenemen of afnemen. Dat verschijnsel heet genetische drift.

Veronderstel dat een orkaan ervoor zorgt dat drie individuen van de kikkerpopulatie terechtkomen in een gebied waar de kikkersoort niet voorkomt. De allelfrequentie van die drie individuen verschilt toevallig sterk van die van de oorspronkelijke populatie. Door toeval plant de kikker met felle kleuren zich niet voort en gaat het kenmerk verloren in de nieuwe habitat.

Proefversie©VANIN

oorspronkelijke habitat

toeval nieuwe habitat

S Afb. 263

Genetische drift zorgt ervoor dat het allel voor felgekleurde kikkers toevallig verdwijnt in een nieuwe habitat.

Hoe kleiner de populatie, hoe groter de kans dat genetische drift zorgt voor een verandering van de allelfrequentie van generatie op generatie.

WEETJE

Genetische drift veroorzaakt door de mens

De mens heeft in de laatste eeuwen op veel manieren de populatiegrootte van heel wat diersoorten beïnvloed. Zo was aan het begin van de twintigste eeuw de wisent door de jacht met uitsterven bedreigd. Alle dieren die nu leven, stammen af van twaalf individuen. Als gevolg daarvan vertoont de soort een beperkte genetische variatie.

De mens heeft ook bewust of onbewust exoten geïntroduceerd. In 1974 werden er in België een vijftigtal parkieten vrijgelaten. De vogels hebben zich sindsdien verspreid in Vlaanderen.

239 MODULE 16 hOOfDstUk 1
S Afb. 264 Een wisent of Europese bizon (Bison bonasus) S Afb. 265 Een halsbandparkiet (Psittacula krameri)

Een eerste vereiste voor de evolutie van een populatie is genetische variatie. Initieel ontstaat die altijd door mutatie. Mutatie is de drijvende kracht achter evolutie.

De volgende mechanismen kunnen zorgen voor een verandering in de genetische variatie:

• Natuurlijke selectie werkt in op de variatie binnen een populatie. Als de verschillende fenotypes een andere fitness hebben en dat verschil erfelijk is, zullen de fenotypes met een hogere fitness toenemen in opeenvolgende generaties.

Proefversie©VANIN

• Bij seksuele selectie kiest het ene geslacht een voortplantingspartner van het andere geslacht op basis van bepaalde kenmerken. Meestal investeren de vrouwelijke organismen meer energie in het nageslacht. Als gevolg is er vrouwelijke keuze en competitie tussen mannetjes om zich voort te planten.

• Bij gene flow komen allelen van één populatie terecht in een andere populatie. Dat gebeurt door migratie

• In een populatie kan de allelfrequentie door toeval veranderen. Dat is genetische drift De impact daarvan is groter bij kleine populaties.

240 MODULE 16 hOOfDstUk 1

In het laagveld van Zimbabwe werden leeuwen door de mens vermoedelijk teruggebracht tot maar vijf tot tien individuen. Nadat er in 2005 tien leeuwen werden geherintroduceerd, heeft de populatie zich hersteld tot meer dan tweehonderd leeuwen in 2016.

a Welke evolutiemechanismen hebben zich voorgedaan in die leeuwenpopulatie?

b Waarom introduceerde men tien leeuwen van buiten het gebied?

Onderzoek toont aan dat een teunisbloemsoort (Oenothera drummondii) het suikergehalte in de nectar met 20 % verhoogt binnen de drie minuten nadat de soort het geluid van een zoemende bij heeft waargenomen. Pas de principes van natuurlijke selectie toe op die kennis.

De keizerspinguïn leeft op Antarctica.

S Een mannelijke en vrouwelijke keizerspinguïn (Aptenodytes forsteri)

a Leg uit waarom het mannetje en vrouwtje bij een pinguïn een gelijkaardig uiterlijk hebben.

b Het verenkleed van de pinguïn dient als schutkleur en beschermt de pinguïn tegen zijn natuurlijke vijanden in het water (bijvoorbeeld de orka en het zeeluipaard). Welke evolutiemechanismen hebben geleid tot die schutkleur?

De volgende beweringen gaan over wijzigingen in een populatie. Welke bewering is geen resultaat van natuurlijke selectie?

a Een populatie vlinders met lichtgekleurde individuen en enkele donkere individuen die ontstaan zijn door mutatie, zal in een door roet zwartgeblakerd milieu evolueren naar een populatie met hoofdzakelijk donkergekleurde individuen.

b Langdurige toepassing van een chemisch insecticide leidt op termijn tot het bestaan van insectenpopulaties waarvan alle individuen resistent zijn tegen dat insecticide.

c Korte tijd na een niet-letale, virale epidemie zijn de meeste individuen minder vatbaar voor een infectie met dat virus.

d In Afrika wordt het kenmerk sikkelcelanemie veel frequenter aangetroffen in malariagebieden, omdat de dragers van dat kenmerk daar een hogere overlevingskans hebben.

De franjepoten zijn een geslacht (Phalaropus) van vogels waarbij de vrouwtjes groter en gekleurder zijn dan de mannetjes.

De mannetjes nemen alle broedzorg op zich.

Leg uit hoe dat uiterlijke verschil tot stand kwam.

Proefversie©VANIN

DNA-onderzoek bij het vlasbekje (Linaria vulgaris) toont aan dat er genen van de planteninfecterende bacterie Rhizobium rhizogenes in het genoom van de plant voorkomen. Welk evolutiemechanisme wordt daardoor aangetoond?

a gene flow

b genetische drift

c mutatie

d geen van de bovenstaande antwoorden

De bochelcicaden zijn een groep van onopvallende, kleine insecten waarbij het borststuk meestal is uitgegroeid tot een bladachtige of doornachtige structuur.

Leg hoe dat via natuurlijke selectie ontstaan is.

Meer oefenen? Ga naar .

241 MODULE 16 hOOfDstUk 1 - AAn DE sLAG
1 2 3 4 AAN DE SLAG
5
6
S Een vrouwtje van de grauwe franjepoot (Phalaropus lobatus)
7
S Een bochelcicade

HOOFDSTUKSYNTHESE

MECHANISMEN VAN EVOLUTIE

evolutie = de verandering van de erfelijke eigenschappen in een populatie over verschillende generaties heen

Proefversie©VANIN

mutatie

= drijvende kracht achter evolutie nieuw allel van een gen

genetische variatie

Adaptieve mutaties geven het organisme een betere overlevings- of voortplantingskans.

epigenetische modificatie

= ook overerfbaar bij sommige organismen, maar slechts invloed op enkele generaties

natuurlijke selectie mechanisme waarbij een fenotype dat overerfbaar is en een hogere fitness heeft, in de volgende generaties meer zal voorkomen

seksuele selectie mechanisme waarbij enerzijds competitie tussen mannetjes en anderzijds de vrouwelijke keuze voor het mannetje met de beste fitness als selecterende factoren werken

gene flow mechanisme waarbij allelen van één populatie naar een andere verspreiden (door migratie)

genetische drift mechanisme waarbij allelfrequenties door toevallige gebeurtenissen toe- of afnemen

242 MODULE 16 sYnthEsE hOOfDstUk 1
kennisclip VIDEO

HOOFDSTUK

2

Î Evolutietheorie

Mutatie, variatie, selectie, genetische drift en gene flow vormen een belangrijk onderdeel van de moderne evolutietheorie. In dit hoofdstuk leer je hoe die theorie tot stand kwam en welke onderzoeksdomeinen de moderne evolutietheorie ondersteunen.

LEERDOELEN

M Wetenschappelijk onderbouwde argumenten voor evolutie en de evolutietheorie geven

M Inzien hoe de evolutietheorie tot stand is gekomen

Proefversie©VANIN

1 De evolutietheorie in een historisch perspectief

Charles Darwin (1809-1882) wordt vaak beschreven als de vader van de evolutietheorie. Hij introduceerde het mechanisme van natuurlijke selectie om te verklaren hoe soorten evolueren uit een gemeenschappelijke voorouder.

Darwins werk vormde zonder twijfel de basis voor de moderne evolutietheorie. Hij inspireerde veel andere wetenschappers die op zijn werk voortbouwden.

Tegenwoordig zijn er jaarlijks meer dan tienduizend wetenschappelijke artikels gewijd aan een aspect van evolutie.

We bekijken verder het ontstaan van de evolutiegedachte en bespreken de evolutietheorieën van Lamarck en Darwin.

243 MODULE 16 hOOfDstUk 2
S Afb. 266 Een portret van Charles Darwin

1.1 De evolutietheorie van Lamarck

Lamarck (1744-1829) beschreef een evolutietheorie. Dat wil zeggen dat hij enerzijds stelde dat soorten veranderlijk zijn, en anderzijds mechanismen voorstelde die die verandering veroorzaken. De theorie van Lamarck werd later verworpen door die van Darwin.

De evolutietheorie van Lamarck stelde twee principes voorop:

1 De complexiteit van organismen neemt toe in de loop van de tijd. Dat is het gevolg van een aangeboren levenskracht.

2 De omgeving verandert voortdurend. Daardoor veranderen de noden van een organisme, wat leidt tot een verandering in gedrag. Dat zorgt ten slotte voor een verandering in het gebruik van organen. Die laatste verandering volgt twee wetmatigheden:

–Organen die veel gebruikt worden, nemen toe in grootte en functie. Het klassieke voorbeeld is het verlengen van de nek van de giraf als gevolg van het voortdurend strekken om aan blaadjes te kunnen. Organen die niet worden gebruikt, verkleinen en zullen uiteindelijk verdwijnen. Blindheid bij de mol en het ontbreken van tanden bij vogels waren volgens Lamarck voorbeelden daarvan.

–De verworven eigenschappen zijn erfelijk. Als er veranderingen aanwezig zijn bij de ouders, kunnen ze die doorgeven aan hun nakomelingen.

vooroudergiraf

S Afb. 267

Proefversie©VANIN

De nek van de giraf verlengt door voortdurend strekken om aan voedsel te komen.

De evolutietheorie van Lamarck, toegepast op de giraf

De verworven eigenschap (lange nek) wordt doorgegeven aan de nakomelingen.

Volgens Lamarck sterven soorten niet uit. Fossielen waren volgens hem vroegere vormen van dezelfde soort.

244 MODULE 16 hOOfDstUk 2

1.2 De evolutietheorie van Darwin

De huidige evolutietheorie is een uitbreiding van de theorie van Charles Darwin, gebaseerd op evolutie door natuurlijke selectie. Charles Darwin leidde het idee voor natuurlijke selectie af uit vier waarnemingen:

1 Er worden bij alle soorten meer nakomelingen geboren dan dat er ouders zijn. Toch groeien de populaties van soorten niet onbegrensd.

2 Omdat bronnen beperkt zijn, is er een strijd om het bestaan (struggle for life). Een deel van elke generatie sterft zonder zich voort te planten.

3 Binnen een soort is er variatie. Niet alle individuen zijn gelijk.

4 Bepaalde verschillen binnen de soort kunnen worden doorgegeven aan de nakomelingen

In de natuur worden de best aangepaste individuen geselecteerd (survival of the fittest). Die individuen kunnen beter overleven en krijgen gemiddeld meer nakomelingen die overleven en zich op hun beurt voortplanten. Daardoor stijgt het aantal individuen met de voordelige eigenschap. Op die manier veranderen soorten en ontstaan er nieuwe soorten

WEETJE

In 1859 publiceerde Darwin een afgeslankte versie van zijn theorie onder de titel On the Origin of Species by Means of Natural Selection. Het boek bleek onverwacht populair. Darwin schreef daarna nog verschillende boeken. Omdat hij beschreef hoe de mens volgens dezelfde principes was geëvolueerd als apen, publiceerden kranten spotprenten van hem als aap. Darwin stierf in 1882. Zijn werk zorgde voor een omwenteling in het denken over evolutie.

Proefversie©VANIN

De eerste evolutietheorie wordt toegeschreven aan Jean-Baptiste Lamarck.

• Hij stelde enerzijds dat door een aangeboren levenskracht de complexiteit van organismen in de loop van de tijd toeneemt.

• Anderzijds veranderen organismen volgens hem ook door veranderingen in de omgeving. Organen die veel gebruikt worden, nemen toe in grootte en functie. Organen die niet gebruikt worden, verdwijnen. Die verworven eigenschappen zijn erfelijk.

De grondlegger van de moderne evolutietheorie is Charles Darwin

• Hij nam waar dat er meer nakomelingen zijn dan ouders, waardoor er een strijd om het bestaan ontstaat.

• Verder is er binnen een soort variatie. Bepaalde kenmerken zijn erfelijk.

• Als gevolg treedt er natuurlijke selectie op: de best aangepaste individuen kunnen het best overleven en krijgen gemiddeld meer nakomelingen. Daardoor stijgt het aantal individuen met de voordelige eigenschap.

245 MODULE 16 hOOfDstUk 2
S Afb. 269 Een karikatuur van Darwin uit 1871 S Afb. 268 De titelpagina van Darwins beroemdste boek, gepubliceerd in 1859

2 Argumenten voor evolutie

2.1 Kunstmatige selectie als argument voor evolutie

Het selectief fokken van dieren en de selectie van planten door de mens gaan terug tot de prehistorie. Zo is er een grote variatie ontstaan aan verschillende vormen van een en dezelfde soort. Denk bijvoorbeeld maar aan de verscheidenheid in hondenrassen, die allemaal het resultaat zijn van selectie en kruising uit voorlopers van de huidige wolf. Door kunstmatige selectie kun je die variatie veel sneller bekomen dan via natuurlijke selectie. Het is dus een argument voor evolutie.

Proefversie©VANIN

WEETJE

Een langlopend experiment over domesticatie werd uitgevoerd onder leiding van Dmitri Beljajev (1917-1985) en Lyudmila Trut (°1933). Het project startte in 1959 in Novosibisrk (Siberië, Rusland). Een groep zilvervossen werd elke generatie getest op tamheid. Per generatie kozen de onderzoekers de 10 % tamste dieren uit om verder mee te kweken. Na zes generaties waren er al vossen die konden worden opgepakt en die met hun staart kwispelden als er een mens aankwam. Binnen de vijftien generaties had de domesticatie een effect op het uiterlijk van de vossen. Ze kregen slappe oren, een korte, gekrulde staart en een kortere, rondere snuit. Ook de concentratie aan stresshormoon in het bloed was gehalveerd. Dat zijn gelijkaardige veranderingen als bij andere gedomesticeerde dieren. Daarom noemt men dat het ‘domesticatiesyndroom’. Men gaat ervan uit dat selectie op de allelen die tamheid veroorzaken, er ook toe heeft geleid dat bepaalde allelen van andere genen frequenter voorkomen.

246 MODULE 16 hOOfDstUk 2
S Afb. 270 De nu bestaande hondenrassen (Canis lupus familiaris) zijn allemaal ontstaan uit de domesticatie van een voorloper van de huidige wolf (Canis lupus). Honden en wolven behoren tot dezelfde soort (Canis lupus). S Afb. 271 De zilvervos (Vulpes vulpes) is de donkere variant van de rode vos.

2.2 Argumenten uit de anatomie

De vergelijkende anatomie is de studie van gelijkenissen en verschillen in de bouw en structuur van verschillende soorten. Nauwer verwante soorten tonen meestal meer gelijkenissen. Dat wijst op evolutie vanuit een gemeenschappelijke voorouder.

A Homologie

Als je de skeletten van amfibieën, reptielen, vissen en zoogdieren vergelijkt, zie je veel overeenkomsten. Ze zijn grotendeels opgebouwd volgens hetzelfde basisbouwplan. Vanuit het basisbouwplan van de voorouder is er door evolutie wel een grote variatie ontstaan aan ledematen, telkens aangepast aan de functie. Als delen van het lichaam tussen verschillende taxonomische groepen een overeenkomstige bouw vertonen omdat de groepen een gemeenschappelijke voorouder hebben, spreek je van homologie. Hoe minder verwantschap er tussen organismen bestaat, hoe minder homologie ze normaal gezien vertonen.

salamander

mol

vogel hagedis

S Afb. 272

mens hond paard walvis

opperarmbeen

spaakbeen ellepijp handwortelbeentjes middelhandbeentjes vingerkootjes

Homologe organen: de opbouw van het voorste lidmaat van gewervelde dieren volgt hetzelfde schema. Alleen de vorm en de afmetingen van de beenderen zijn verschillend.

VOORBEELD VLEUGELS VAN INSECTEN

Een voorbeeld van homologie vind je bij de vleugels van insecten. De grote keizerlibel (A) bezit het basisbouwplan van twee paar vleugels. Bij de neushoornkever (B) zijn de bovenste vleugels geëvolueerd tot het dekschild. Bij de reuzenlangpootmug (C) zijn de achtervleugels omgevormd tot knotsvormige halters, die zorgen voor evenwicht en vluchtstabilisatie. Telkens is er dus wel een vergelijkbaar basisbouwplan aanwezig.

S Afb. 273

De vleugels van de keizerlibel (Anax imperator), de neushoornkever (Oryctes nasicornis) en de reuzenlangpootmug (Tipula maxima)

De taxonomie is de wetenschap die zich bezighoudt met het indelen en classificeren van het leven.

Proefversie©VANIN

247 MODULE 16 hOOfDstUk 2
C A B

VOORBEELD EMBRYONALE ONTWIKKELING

Ook de embryonale ontwikkeling van gewervelde dieren vertoont grote gelijkenissen. Zo leggen alle embryo’s kieuwbogen en kieuwspleten aan. Bij vissen en de larven van amfibieën groeien die uit tot functionele kieuwen. Bij de andere groepen verdwijnen ze of ontwikkelen ze zich tot andere structuren. De op elkaar gelijkende vroege embryonale ontwikkeling is een aanwijzing dat alle gewervelden zijn ontstaan uit een gemeenschappelijke voorouder. Hun embryonale ontwikkeling is een voorbeeld van homologie.

vis salamander hoenkonijnrundmens

Proefversie©VANIN

S Afb. 274 Drie fasen in de embryonale en foetale ontwikkeling van een aantal gewervelde dieren. In het eerste stadium zijn de gelijkenissen groot. Daarna nemen de verschillen toe.

B Rudimentaire kenmerken

Soms komen er bij een organisme kenmerken voor die hun oorspronkelijke functie verloren hebben en minder ontwikkeld zijn. Dat zijn rudimentaire kenmerken. Ze tonen aan dat het organisme geëvolueerd is uit een voorouder die die functie wel nog had. ‘Rudimentair’ betekent niet helemaal zonder functie. De vleugels bij pinguïns zijn bijvoorbeeld rudimentair omdat ze minder groot zijn en de pinguïns er niet meer mee kunnen vliegen. Ze hebben wel nog een functie bij het behouden van evenwicht en tijdens het zwemmen.

248 MODULE 16 hOOfDstUk 2

VOORBEELD RUDIMENTAIRE KENMERKEN BIJ DE MENS

• Het menselijk oog bevat een overblijfsel van wat bij andere dieren het knipvlies vormt. Dat knipvlies of ‘derde ooglid’ beweegt horizontaal over de oogbol. Bij vogels beschermt het knipvlies het oog en houdt het dat vochtig, bijvoorbeeld tijdens het vliegen.

• De appendix had bij een voorouder een functie bij de vertering. Die functie is verloren gegaan. De appendix speelt wel nog een rol in de immuniteit.

Proefversie©VANIN

Atavisme is de terugkeer van een kenmerk dat aanwezig was bij de voorouder, maar verdwenen was in de vorige generaties. Lees er meer over op

• Het staartbeen is een overblijfsel van een functionele staart. Het is wel nog belangrijk voor de aanhechting van bepaalde spieren.

• Bepaalde spieren hebben geen functie meer. Voorbeelden zijn de spieren die de oorschelp bewegen, en de lange handpalmspier.

• Kippenvel krijgen is een rudimentaire reflex. Spieren zetten de haartjes rechtop en zorgen er bij een pels voor dat de lichaamstemperatuur wordt geregeld. Omdat mensen geen dichte vacht meer hebben, heeft het kippenvel nu geen nut meer.

VOORBEELD RUDIMENTAIRE KENMERKEN BIJ ANDERE ORGANISMEN

• Bij bepaalde slangen komen nog pootresten voor. Dat toont aan dat slangen zijn geëvolueerd uit voorouderreptielen met poten.

• Bij een cactus zijn de stekels homoloog aan de bladeren bij andere planten. Bij sommige cactussoorten kunnen er wel rudimentaire bladeren voorkomen.

• Walvissen zijn ontstaan uit landdieren met een bekken en achterpoten. De achterpoten zijn via evolutie verdwenen. Er blijft nu nog enkel een rudimentaire botstructuur over van de bekkengordel. dijbeen heupbeen

249 MODULE 16 hOOfDstUk 2
S Afb. 278 Resten van een bekkengordel bij de walvis S Afb. 275 Bij mensen is in de ooghoeken een overblijfsel van het knipvlies bewaard. S Afb. 276 De lange handpalmspier is een rudimentair kenmerk. Ze komt bij 14 % van de mensen zelfs niet meer voor. S Afb. 277 Pootresten bij de python (Pythonidae)

Op leer je hoe je met behulp van gidsfossielen de ouderdom van een gesteente kunt bepalen.

2.3 Argumenten uit de paleontologie

De paleontologie is de wetenschappelijke studie van het leven dat in het verleden bestond. Een onderdeel van de paleontologie is de studie van fossielen. Dat laat toe om:

• de evolutie van het leven op aarde te reconstrueren;

• de bestudeerde aardlagen geologisch te dateren;

• het toenmalige milieu en klimaat te reconstrueren;

• kennis te verwerven over de interactie tussen uitgestorven organismen onderling en met hun omgeving.

Proefversie©VANIN

In dit onderdeel beperken we ons tot het belang van fossielen voor de evolutietheorie.

Fossielen zijn sporen van uitgestorven organismen in een gesteente. Die sporen zijn enerzijds overgebleven delen of een afdruk van het organisme. Meestal blijven daarbij enkel de hardste delen achter, zoals beenderen, schelpen, schalen, bladnerven, stengels of hout. Anderzijds zijn er fossielen die sporen van activiteit van een organisme tonen. Voorbeelden zijn graafgangen, nesten of uitwerpselen.

S Afb. 279 Hars zorgt voor een goede bewaring van organismen. Daardoor kan het barnsteen dat eruit ontstaat, ook de weke delen van bijvoorbeeld een insect bevatten.

S Afb. 280 Een fossiel uit het trias dat graafgangen vertoont

Als organismen sterven, zullen ze meestal snel ontbinden of worden opgegeten door aaseters. Zo blijft er geen spoor van hun bestaan achter. Fossielen zijn dan ook uiterst zeldzaam. Er zijn dus veel huidige organismen waarvoor er geen fossielen van mogelijke voorouders gekend zijn. De fossielen die wel voorhanden zijn, vormen een sterk argument voor evolutie. Ze tonen hoe uitgestorven organismen eruitzagen.

VERDIEPING

Datering van fossielen

De koolstof 14-methode is een methode om relatief jonge fossielen te dateren. Ze is gebaseerd op het voorkomen van zeer kleine hoeveelheden van het radioactieve isotoop 14C in de atmosfeer. Er is in een gegeven periode in de atmosfeer een vaste verhouding tussen koolstofdioxide dat 14C bevat, en koolstofdioxide dat de stabiele isotopen 12C of 13C bevat. Door de opname van CO2 voor de fotosynthese ontstaan er koolstofverbindingen met dezelfde verhouding van de verschillende C-isotopen. Die koolstofverbindingen komen via de voedselketen in alle andere organismen terecht. Daardoor is er in levende organismen dezelfde vaste verhouding te vinden tussen de verschillende koolstofisotopen.

Als een organisme sterft, zal door radioactief verval het 14C-gehalte in het organisme langzaam afnemen. Aan de hand van de actuele verhouding tussen 14C en stabiele C kan men op die manier de ouderdom van het gestorven organisme bepalen. 14C heeft een relatief korte halfwaardetijd. Dat is de tijd waarin de helft van de oorspronkelijke hoeveelheid van de radioactieve isotoop nog overblijft (voor 14C is dat 5 730 jaar). Daardoor is de methode enkel geschikt om recente fossielen te dateren tot een maximum van circa 60 000 jaar oud.

250 MODULE 16 hOOfDstUk 2

A Continue reeksen

Vaak is het aantal beschikbare fossielen dat verwant is aan soorten die momenteel voorkomen, beperkt. In sommige gevallen echter zijn er voldoende fossielen om de geleidelijke overgang van de voorouder naar de huidige vorm aan te tonen. Zo’n reeks van fossielen noem je een continue reeks.

VOORBEELD PAARDACHTIGEN

Proefversie©VANIN

Een voorbeeld van een continue reeks is de evolutie van de familie van de paardachtigen (Equidae), waartoe de huidige paarden, zebra’s en ezels behoren. De vroegste voorouders van de paardachtigen waren klein, met korte benen en brede voeten. Ze kwamen voor in beboste gebieden en aten waarschijnlijk bladeren en kruiden. Vanuit de vroegste voorouders was er een geleidelijke verandering zichtbaar op drie vlakken:

• Een toename in gestalte: de eerste paardensoorten waren zo groot als een grote huiskat.

• Een reductie van het aantal tenen: de vroegste voorouder had vier tenen aan het voorste been en drie aan het achterbeen. Er kwamen ook nog geen hoeven voor. Door de jaren heen verlengde de middelste teen, vormde er zich een hoef en gingen de andere tenen verloren.

• Een verandering van tandhoogte en -oppervlak: er is een evolutie te zien van lage naar hoge kronen.

Bovendien veranderde het tandoppervlak van knobbelig naar gericheld. Die aanpassingen tonen een overgang naar het eten van grassen.

PLEISTOCEEN

PLIOCEEN

geslacht Equus

Hipparion

Pliohippus Nannippus Neohipparion

MILJOEN JAAR

S Afb. 281 De evolutie van de paardachtigen

botten van voorste been

geslacht Merychippus Equus

Parahippus Anchitherium

geslacht Miohippus

Mesohippus

Epihippus

Orochippus

geslacht Hyracotherium

Merychippus

Miohippus

251 MODULE 16 hOOfDstUk 2
MIOCEEN OLIGOCEEN EOCEEN 5 10 15 20 25 30 35 40 45 50 55
1,80 m Hyracotherium

VOORBEELD WALVISACHTIGEN

De walvisachtigen evolueerden uit landdieren. De vroegste gemeenschappelijke voorouder van de huidige walvisachtigen had nog een typisch bouwplan voor het leven op het land. De andere verwante fossielen zijn aangepast aan het leven in het water. Uit onderzoek blijkt dat Ambulocetus zowel in zout- als in zoetwater voorkwam. De dieren leefden dus in de monding van een rivier, waar zout- en zoetwater zich mengen. Latere vormen waren meer en meer aangepast aan het leven in de open zee:

• De achterpoten werden steeds kleiner.

• Het bekken kwam los van de wervelkolom. Dat verhoogde de beweeglijkheid van de wervelkolom en vereenvoudigde de zwembeweging.

• De voorpoten verloren hun functie van voortbeweging en werden enkel nog gebruikt om te sturen.

Odontoceti (tandwalvissen)

Mysticeti (baleinwalvissen)

S Afb. 282

De evolutie van de walvisachtigen

B Overgangsfossielen

Protocetus

Remingtoncetus Ambulocetus

Pakicetidae

Proefversie©VANIN

S Afb. 283

Archaeopteryx, een evolutieve schakel tussen bepaalde reptielen en vogels

Aangezien de kans dat er een fossiel ontstaat en vervolgens gevonden wordt, zeer klein is, is het niet verwonderlijk dat er veel kennis ontbreekt over de overgang tussen verschillende groepen van organismen. Af en toe wordt er een fossiel gevonden dat toch belangrijke kennis toevoegt. Een overgangsfossiel is een overblijfsel van een levensvorm die kenmerken vertoont van zowel de vooroudergroep als de groep die eruit ontstaan is.

Een bekend voorbeeld is Archaeopterix, een fossiel dat enerzijds een benige staart en tanden heeft, zoals vele reptielen, en anderzijds pluimen, zoals de vogels. De eerste pluimen zullen het dier niet in staat hebben gesteld om te vliegen. Eén hypothese is dat de eerste pluimen warmteverlies tegengingen. Later zijn er bijkomende functies ontstaan van zweven en uiteindelijk vliegen. Sinds de ontdekking van Archaeopterix zijn er nog andere gevederde dinosauriërs gevonden.

252 MODULE 16 hOOfDstUk 2
MILJOEN JAAR MIOCEEN OLIGOCEEN EOCEEN PALEOCEEN 15 20 25 30 35 40 45 50 55
Basilosaurus Dorudon

2.4 Argumenten uit de biogeografie

De biogeografie is de studie van de verspreiding van organismen op aarde. Ook gegevens uit de biogeografie tonen aan dat huidige soorten ontstaan zijn uit een gemeenschappelijke voorouder. Dat kun je onder andere afleiden door de organismen op eilanden te bestuderen of door te kijken naar de verdeling van het leven over de continenten als gevolg van continentendrift.

Eilanden die door vulkanisme ontstaan, hebben in het begin een kale rotsbodem. Alle organismen die op een huidig vulkanisch eiland leven, moeten er dus via de zee of de lucht zijn terechtgekomen. Dat wordt bevestigd door de volgende observaties:

Proefversie©VANIN

• De soorten die op vulkanische eilanden voorkomen, zijn het meest verwant met soorten op het nabije vasteland.

• Bepaalde groepen van dieren en planten komen zelden voor op eilanden, omdat ze er niet of moeilijk kunnen raken. Zo ontbreken er amfibieën, die door hun huid snel uitdrogen in zeewater, en niet-vliegende zoogdieren.

Als gevolg van platentektoniek verschuiven de continenten enkele centimeters per jaar. Dat verschijnsel heet continentendrift. De verspreiding van landorganismen over de continenten komt overeen met de continentendrift.

VOORBEELD AUSTRALIË

Voordat het continent Australië wegdreef van de andere continenten, bestonden er enkel nog maar zoogdieren zonder placenta. Na het ontstaan van de placentale zoogdieren concurreerden die de andere zoogdieren weg. Als gevolg komen de eierleggende zoogdieren (de mierenegel en het vogelbekdier) nu enkel op Australië voor en is de variatie aan buideldieren er het grootst. De placentale zoogdieren die nu op Australië voorkomen, zijn later door de mens bewust of onbewust meegebracht.

zoogdieren

Placentale zoogdieren onderscheiden zich van andere zoogdieren doordat de moeder de foetus lange tijd via de placenta voedt. Bij buideldieren kruipt het embryo uit de baarmoeder en maakt het zijn ontwikkeling door in de buidel.

zoogdieren

253 MODULE 16 hOOfDstUk 2
MILJOEN JAAR CENOZOÏCUM NU 66 145 201 252 299 359 KRIJT JURA TRIAS PERM CARBOON vogels krokodilachtigen slangen, hagedissen en brughagedissenschildpadden eierleggende
levendbarende
zoogdieren buideldieren placentale
zoogdieren
Cynodontia Mammaliaformes
S Afb. 284 De evolutie van de drie groepen zoogdieren: de eierleggende zoogdieren (Monotremata), de buideldieren (Marsupialia) en de placentadieren (Placentalia)
Therapsida
Amniota

2.5 Argumenten uit de moleculaire biologie

De sterkste bewijzen voor evolutie vind je in de moleculaire biologie. Het bepalen en vergelijken van DNA- en aminozuursequenties laat toe om zowel zeer nauw verwante als zeer ver verwante organismen met elkaar te vergelijken. Hoe meer verschillen in de sequentie, hoe meer mutaties er zijn opgetreden en hoe minder verwant twee organismen zijn. Aangezien de mutatiesnelheid van een stuk DNA kan worden ingeschat, laat de vergelijking van moleculaire gegevens ook toe om te bepalen wanneer twee organismen een gemeenschappelijke voorouder hadden.

Op basis van DNA- en aminozuursequenties kunnen onderzoekers verwantschapsstambomen opstellen.

Proefversie©VANIN

VOORBEELD NIET-VLIEGENDE VOGELSOORTEN

Onderzoekers vergeleken DNA-sequenties van vogels die niet kunnen vliegen.

Ze gebruikten daarbij deze werkwijze:

1 Via computeranalyse vergelijkt men de DNA-sequenties met elkaar.

2 Op basis van de verschillen bepaalt men de afstand tussen twee soorten.

3 Op basis van de afstanden stelt men een stamboom op.

moa 1 kiwi 1 emoe kasuaris struisvogel nandoe

moa

kiwi

emoe kasuaris struisvogel nandoe

moa 1 kiwi 1 emoe kasuaris struisvogel

moa 1 kiwi 1 emoe

kasuaris

struisvogel

nandoe

S Afb. 285

––––––––ACGAAAGAGAAGGTGAAACCCTCGTCAAAAGGCGGATTTAGCAGTAAAATAGAACAAGAATGCCTATTTTAAGCCCGGCCCT

Een vergelijking van enkele niet-vliegende vogelsoorten op basis van een gedeeltelijke basensequentie van het mitochondriale 12S rRNA-gen. De DNA-sequentie van moa 1 is telkens de referentie. Enkel als de base verschilt bij de andere soort, wordt ze weergegeven.

254 MODULE 16 hOOfDstUk 2
••••••••• •• T •••••• ••••••••• CCCTAAATCC T T A • A T T T T T GA G TACT •••••• ••••••••••••• ••••••••••••• T C C A • TG CC G C T T A T ••• ACA C C C C C C T A T T T A •• •• • • •• • • • G G AGT • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • C ATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAATTACTTGGCGGTGCCCC T T T T T A C C C T
•••••••• •••••••• ••• ••••• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • T • • • • • A A A A • G • • • C T T T T T T T T T • • • A A A A A A A –A C • –––T T –A A A • • • • • • • • • • • • • • • • • • • • • • T • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • G G G G • • • • • • • • • • T • • • • • • • • • • • A • C T A A • GGAGCCTGTTCTATAATCGATAAT C C C C CCACGATACACCCGACCATCCCTCGCCCGT–GCAGCCTACATACCGCCGTCCCCAGCCCGCCT––A
1
1
nandoe C A C AG T T T T T T T A A A A C C A ––––––––––T T • T • • A • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • C G G • • • • • G G • A • G • • G T C ATAGCGAGCACAACAGCCCTCCCCCGCTAACAAGACAGGTCAAGGTATAGCA TATGAGATGGAAGAAATGGGCTACATTTTCTAACATAG
•••••••• •••••••• ••• ••••• • • • • • • • • • • • • G • • • • • • A • A • • • • A • G G G G G G • • G T T T T G • • • A A • • • • • • • • • • • • • • • T T T T • • • –• A A A A G G • G • • • • T • • • • T • T • • • G G G G G G • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • G C C C • • • • • • • • • G • • • T T • T T • • • C • • • • • • • • • G G G G A A A A A • • • T T T T • • • • • • C • • • • • • C • • • • • • • • • • • • • • • • A A –––––• • • T T T • • • • • • • • • • • T • T • • • • • •

Zuid-Amerika Afrika

TIJD

S Afb. 286

nandoe

Australië Nieuw-Guinea

Proefversie©VANIN

Nieuw-Zeeland

struisvogelkasuarisemoekiwi 2kiwi 1

moa 3moa 2

moa 1

Een verwanschapsstamboom van enkele huidige en uitgestorven vogels die niet kunnen vliegen op basis van DNA-sequenties. De gemeenschappelijke voorouder leefde ongeveer 75 miljoen jaar geleden.

WEETJE

DNA uit fossielen

Ook uit relatief jonge fossielen (tot ongeveer 2 miljoen jaar oud) kan men DNA extraheren. De analyse ervan helpt bij het onderzoek naar de evolutie van organismen. De betrouwbaarheid van de analyse daalt wanneer de ouderdom van het DNA stijgt. Dat heeft de volgende oorzaken:

• Het DNA zal met de tijd meer afbreken. Dat wil zeggen dat hoe ouder het fossiel is, hoe minder intact DNA er aanwezig is.

• Ook na de dood treden er veranderingen in het DNA op. Het aantal veranderingen stijgt met de tijd.

Afb. 287

Een fossiel van een mammoetentand. De mammoet stierf ongeveer vierduizend jaar geleden uit.

255 MODULE 16 hOOfDstUk 2
S

2.6 Argumenten uit recente observaties

De studie van evolutie beperkt zich niet enkel tot het verre verleden. Verschillende onderzoeken tonen aan dat evolutie ook op korte termijn waarneembaar is.

VOORBEELD ZELFBESTUIVING

Bij 80 % van de planten zijn insecten verantwoordelijk voor de bestuiving. Doordat het insectenbestand achteruitgaat, zijn er planten die vaker aan zelfbestuiving doen. Dat toonden onderzoekers onder andere aan bij het akkerviooltje, door zaden uit de jaren negentig te vergelijken met zaden uit 2000 en 2021. De zaden waren afkomstig uit dezelfde regio, waar de bestuivers waren afgenomen. Genetische analyse van de nakomelingen toonde aan dat zelfbevruchting sinds de jaren negentig met 27 % was toegenomen. Als gevolg hebben de recentere viooltjes minder opvallende kroonbladeren en produceren ze minder nectar Op die manier steken ze minder energie in mogelijke kruisbestuiving en worden ze minder aantrekkelijk voor insecten.

VOORBEELD VLEUGELLENGTE

Proefversie©VANIN

Wetenschappers onderzochten sinds 1982 gedurende dertig jaar een populatie Amerikaanse klifzwaluwen in Nebraska (VS). Ze telden daarbij het aantal zwaluwen dat werd gedood door het verkeer, en maten telkens de vleugellengte van de slachtoffers en van de gehele populatie. Het aantal getroffen vogels nam sterk af gedurende de dertig jaar. Ook de vleugellengte van de populatie nam af. Bovendien hadden vogels die door het verkeer werden gedood, over het algemeen langere vleugels. De wetenschappers zagen daarin een sterke aanwijzing dat door de toename van het verkeer de vleugellengte van de zwaluwen afnam. Dat maakte hen wendbaarder en dus beter in staat om voertuigen te ontwijken.

256 MODULE 16 hOOfDstUk 2
S Afb. 288 Akkerviooltjes (Viola arvensis) S Afb. 289 Amerikaanse klifzwaluwen (Petrochelidon pyrrhonata)

Argumenten voor gemeenschappelijk voorouderschap tussen huidige soorten komen uit verschillende disciplines:

• Via kunstmatige selectie bekom je uit een gemeenschappelijke voorouder individuen met uiteenlopende uiterlijke kenmerken.

• Als je de anatomie van verwante organismen bekijkt, valt vaak de homologie op. Ze zijn opgebouwd volgens hetzelfde basisbouwplan. Ook komen er bij bepaalde organismen rudimentaire kenmerken voor, kenmerken die minder ontwikkeld zijn en hun oorspronkelijke functie hebben verloren.

Proefversie©VANIN

• De paleontologie bestudeert fossielen, die door huidige technieken kunnen worden gedateerd. Dat maakt het mogelijk om de evolutie op aarde te reconstrueren. Voor sommige soorten is er een continue reeks beschikbaar, fossielen die de geleidelijke overgang van de voorouder naar de huidige vorm tonen. Overgangsfossielen vertonen kenmerken van enerzijds de voorouder en anderzijds de groep die eruit ontstaan is.

• De biogeografie bestudeert de verspreiding van organismen op aarde. Die verspreiding komt overeen met de continentendrift. Verder komen er op eilanden organismen voor die het meest lijken op soorten op het nabije vasteland.

• Dankzij de moleculaire biologie is men in staat om uit DNA- en aminozuursequenties van organismen verwantschapsstambomen op te stellen.

• Recente observaties tonen aan dat je ook evolutie op korte termijn kunt waarnemen.

257 MODULE 16 hOOfDstUk 2

Geef het antwoord van Lamarck, Darwin en een moderne evolutiebioloog op de vraag waarom de achterste ledematen bij walvissen zijn verdwenen.

theorie van Lamarck

theorie van Darwin

Net zoals 80 % van de flora op Madagaskar is de orchidee Angraecum sesquipedale endemisch voor dat land. Dat wil zeggen dat de plant enkel op Madagaskar voorkomt. Geef daar een verklaring voor.

S Angraecum sesquipedale

Proefversie©VANIN

Bespreek de theorieën van Lamarck en Darwin over het ontstaan van de giraf.

Hoe kun je de evolutie van het paard het best beschrijven?

a Het is een aanpassing aan een veranderende omgeving, waarbij de ene soort in de loop van de tijd wordt vervangen door een beter aangepaste soort.

b Het is een complexe geschiedenis van afstammingslijnen die veranderen in de loop van de tijd, waarvan er veel zijn uitgestorven.

c Het is een evolutie van soorten in de loop van de tijd, waarbij we nu een continue reeks hebben van de directe voorouders van het huidige paard.

d Geen van de bovenstaande antwoorden is correct.

S Een baby met lanugo

Lanugo is een soort vacht van erg dun haar die voorkomt bij een foetus van vijf maanden (en af en toe ook bij pasgeboren baby’s). Dat toont aan dat … a de baarmoeder een lage temperatuur heeft in dat deel van de zwangerschap; b mensen afstammen van een harige voorouder; c haar kenmerkend is voor zoogdieren; d sommige delen van de foetus sneller groeien dan andere.

Belgisch witblauw is een Belgisch runderras dat wordt gekenmerkt door een extreme spierontwikkeling. Die is het gevolg van een mutatie in een gen dat normaal de spierontwikkeling remt. Daardoor hebben de kalveren vaak een dubbelgespierde schouder en kunnen ze niet door het geboortekanaal. Men brengt de kalveren ter wereld via een keizersnede. Bespreek op basis van dat voorbeeld het verschil tussen natuurlijke en kunstmatige selectie.

Welke organen zijn rudimentair?

a de kieuwen van de amfibielarve

b de vleugels van de vleermuis

c de vleugels van Archaeopterix

d de staartwervels van de mens

Meer oefenen? Ga naar .

258 MODULE 16 hOOfDstUk 2 - AAn DE sLAG
S Samotherium
1 2 3 AAN DE SLAG
4
5 6 7

HOOFDSTUKSYNTHESE

EVOLUTIETHEORIE LAMARCK

1 De complexiteit van organismen neemt toe.

2 Het gebruik en ongebruik van organen zorgt voor verandering (bv. giraffen die hun nek rekken om aan eten te komen, krijgen een langere nek). Die verworven eigenschappen zijn erfelijk.

EVOLUTIETHEORIE DARWIN

Proefversie©VANIN

kunstmatige selectie als argument

argumenten uit de anatomie

argumenten uit de paleontologie

1 Er is te veel nageslacht bij alle soorten.

2 Omdat bronnen beperkt zijn, is er een strijd om het bestaan (struggle for life).

3 Er is variatie binnen een soort: niet alle individuen zijn gelijk. Bepaalde kenmerken zijn erfelijk.

4 Er is natuurlijke selectie (survival of the fittest): de individuen die het best zijn aangepast aan de omgeving, overleven.

argumenten uit de biogeografie

argumenten uit de moleculaire biologie

argumenten uit recente observaties

Via kunstmatige selectie bekom je uit een gemeenschappelijke voorouder individuen met uiteenlopende uiterlijke kenmerken.

Door de bouw van organismen te vergelijken, bijvoorbeeld het voorkomen van homologe en rudimentaire organen, kun je afleiden dat ze zijn voortgekomen uit een gemeenschappelijke voorouder.

• Fossielen zijn de voorlopers van huidige soorten. Door de datering van fossielen kun je de evolutie reconstrueren

• Voor sommige soorten is er een continue reeks beschikbaar.

• Overgangsfossielen vertonen kenmerken van enerzijds de voorouder en anderzijds de groep die eruit ontstaan is.

• De verspreiding van organismen op aarde komt overeen met de continentendrift

• Eilandbewoners hebben aanverwante soorten op het nabije vasteland.

Vergelijkingen van DNA- en aminozuursequenties tonen de afstamming en de verwantschap van organismen.

Recente observaties tonen aan dat evolutie op korte termijn kan worden waargenomen.

259 MODULE 16 sYnthEsE hOOfDstUk 2
kennisclip VIDEO
ARGUMENTEN VOOR DE EVOLUTIETHEORIE

HOOFDSTUK 3

Î Evolutie van soorten

Je zag al welke mechanismen evolutie veroorzaken, hoe de huidige evolutietheorie tot stand kwam, en welke gegevens die evolutietheorie omvat. In dit hoofdstuk zoek je naar antwoorden op de vraag wanneer organismen voldoende van elkaar verschillen om van verschillende soorten te spreken. Daarnaast overloop je enkele belangrijke stappen in het ontstaan van het leven en de mens.

LEERDOELEN

M Uitleggen hoe soorten ontstaan via evolutie

M Verschillende mechanismen van soortvorming beschrijven

1 Het begrip ‘soort’

Een soort is een groep van organismen die in uiterlijke kenmerken duidelijk verschilt van andere organismen en, onder natuurlijke omstandigheden, zich geslachtelijk voortplant en vruchtbare nakomelingen krijgt.

Rassen en ondersoorten

Als een populatie van één soort geografisch gescheiden is van de andere populaties en uiterlijke verschillen vertoont, dan beschrijft men die populatie als een geografische ondersoort. Bij de wetenschappelijke naam van de soort wordt dan nog een derde woord toegevoegd. Panthera tigris altaica is bijvoorbeeld de Siberische tijger.

S Afb. 290 Het Hollands kuifhoen (Gallus gallus domesticus) is een kippenras dat veel wordt gefokt, omdat die kippen goede eileggers en rustige, sterke dieren zijn.

Rassen zijn groepen van dieren en planten die tot dezelfde soort behoren en sterk op elkaar lijken. Rassen zijn altijd door de mens aangepast. Ze ontstaan doordat mensen selectief op welbepaalde kenmerken fokken: ze laten enkel individuen met welbepaalde kenmerken zich onderling voortplanten, net om die kenmerken nadrukkelijk te behouden of te versterken.

Proefversie©VANIN

Een soort is een groep van organismen die in uiterlijke kenmerken duidelijk verschilt van andere organismen en, onder natuurlijke omstandigheden, zich geslachtelijk voortplant en vruchtbare nakomelingen krijgt.

260 MODULE 16 hOOfDstUk 3
WEETJE

2 Mechanismen voor soortvorming

Soortvorming is het proces waarbij uit twee deelpopulaties na verloop van tijd twee verschillende soorten ontstaan. Dat kan enerzijds doordat een huidige populatie na een bepaalde tijd zodanig verschilt van de voorouderpopulatie dat ze een nieuwe soort is ten opzichte van de vooroudersoort. Anderzijds kunnen twee deelpopulaties van een soort reproductief geïsoleerd raken. Dat wil zeggen dat ze niet meer in staat zijn om zich onderling voort te planten. Na verloop van tijd kunnen er zo twee aparte soorten ontstaan.

Hieronder bespreken we de mechanismen die reproductieve isolatie, en dus ook soortvorming, veroorzaken. De isolatie kan op twee manieren ontstaan:

• Enerzijds kan ze ontstaan in geografisch gescheiden gebieden. Dat is geografische isolatie

• Anderzijds kan de reproductieve isolatie ontstaan tussen deelpopulaties in hetzelfde gebied. Daarbij onderscheidt men verschillende vormen: habitatisolatie, gedragsisolatie, morfologische isolatie, temporele isolatie en gametische isolatie.

2.1 Geografische isolatie

In het geval van allopatrische soortvorming ontstaat er reproductieve isolatie door een splitsing van een populatie in twee geografisch gescheiden deelpopulaties. Dat gebeurt bijvoorbeeld door het ontstaan van bergketens of rivieren in het oorspronkelijke leefgebied. Mutaties die bij de ene deelpopulatie optreden, komen dan niet meer terecht in de andere deelpopulatie en omgekeerd. Ook kan er een verschillende selectiedruk optreden in de twee gebieden.

Wanneer de deelpopulaties, zelfs als ze nog in contact komen met elkaar, zich niet meer onderling voortplanten, ontstaat er een reproductieve barrière. Er zijn dan twee verschillende soorten gevormd.

Proefversie©VANIN

voorouderpopulatie

mutaties in deelpopulatie 1 ravijn met snelstromende rivier

mutaties in deelpopulatie 2

soort 1

reproductieve barrière

soort 2

VERLEDEN HEDEN

S Afb. 291

Het proces van allopatrische soortvorming

261 MODULE 16 hOOfDstUk 3

VOORBEELD CHIMPANSEES

Een voorbeeld van geografische soortvorming vind je bij de chimpansees. De vorming van de Congorivier zorgde voor een splitsing van de voorouderpopulatie in twee geografisch gescheiden populaties. Daaruit ontstonden de twee huidige soorten, de chimpansee en de bonobo.

Een moeder

Een moeder en een jong van de bonobo (Pan paniscus)

2.2 Habitatisolatie

Proefversie©VANIN

leefgebied van de bonobo leefgebied van de chimpansee Congorivier

S Afb. 294

Het huidige leefgebied van de chimpansee (Pan troglodytes) in het lichtgroen en dat van de bonobo (Pan paniscus) in het donkergroen

Populaties van dezelfde soort kunnen binnen een gebied van elkaar gescheiden zijn door de voorkeur voor een aparte habitat. Als dat verschil in voorkeur ook betekent dat er minder kans is op onderlinge voortplanting, kan er reproductieve isolatie optreden.

VOORBEELD BOORVLIEG

Een voorbeeld van habitatisolatie komt voor bij de boorvlieg, een vliegensoort uit NoordAmerika. Oorspronkelijk at de soort enkel de vruchten van de meidoorn en legde ze er ook haar eitjes in. Na de introductie van de appel in het begin van de negentiende eeuw ontstond er een variant die zich daarmee voedde. De twee populaties van de soort, elk met een verschillende voedselvoorkeur, paren niet meer met elkaar.

S Afb. 295

Het patroon op de vleugels van de boorvlieg (Rhgoletis pomonella) is een afschrikmechanisme. Het lijkt op de poten van een spin.

262 MODULE 16 hOOfDstUk 3
S Afb. 292 en een jong van de chimpansee (Pan troglodytes) S Afb. 293

2.3 Gedragsisolatie

Veel soorten vertonen paringsrituelen. Enkel nadat de partner specifiek gedrag heeft getoond, wordt die herkend als mogelijk geschikt om mee te paren. Variatie binnen dat gedrag kan leiden tot reproductieve isolatie.

VOORBEELD GRASMUSSEN

Een voorbeeld van gedragsisolatie vind je bij drie grasmussen waarvan het leefgebied deels overlapt: de westelijke baardgrasmus, de balkanbaardgrasmus en de Moltoni’s baardgrasmus. De drie soorten lijken uiterlijk heel erg op elkaar, maar ze gebruiken elk een verschillende zang. Daardoor herkent de ene soort de andere niet als voortplantingspartner.

2.4 Morfologische isolatie

De bouw van de voortplantingsorganen voor inwendige bevruchting is bij mannelijke en vrouwelijke dieren van dezelfde soort op elkaar afgestemd. Dat is ook het geval voor de vorm en de positie van de stamper en de meeldraden bij bloemplanten die afhankelijk zijn van dieren voor bestuiving. Variatie in de vorm en de ligging van de voortplantingsorganen binnen een populatie kan leiden tot soortvorming. Als de bouw, de ligging of de oriëntatie van mannelijke en vrouwelijke voortplantingsorganen tussen bepaalde individuen niet compatibel is, kan er geen bevruchting meer plaatsvinden.

VOORBEELD SALIE

Proefversie©VANIN

Een voorbeeld van morfologische isolatie komt voor bij salie. Een bloem van de saliesoort Salvia mellifera heeft meeldraden en stampers die contact maken met de bovenkant van het achterlijf van een hommel, terwijl ze bij de soort Salvia apiana contact maken met de zijkant van het achterlijf van een hommel.

263 MODULE 16 hOOfDstUk 3
S Afb. 296 Een westelijke baardgrasmus (Curruca iberiae) S Afb. 297 Een balkanbaardgrasmus (Curruca cantillans) S Afb. 298 Een Moltoni’s baardgrasmus (Curruca subalpina) S Afb. 299 Een bloem van Salvia mellifera S Afb. 300 Een hommelsoort (Bombus vosnesenskii) bezoekt een bloem van Salvia apiana

2.5 Temporele isolatie

Veel organismen planten zich enkel voort op een bepaald tijdstip van het jaar. Als er variatie is binnen een populatie wat betreft het tijdstip van voortplanting, kan dat leiden tot reproductieve isolatie.

VOORBEELD KORALEN

Een voorbeeld van temporele isolatie vind je bij koraal van het genus Orbicella. Bij volle maan stelt de ene soort (O. franksi) twee uur eerder dan de twee andere soorten (O. annularis en O. faveolata) geslachtscellen vrij. Dat is voldoende om ervoor te zorgen dat de geslachtscellen die vrijkomen van de eerste soort, weinig kans hebben om in contact te komen met die van de andere soorten.

2.6 Gametische isolatie

Reproductieve isolatie kan ook ontstaan wanneer de voortplantingscellen of gameten chemisch onverenigbaar zijn. De zaadcel kan bijvoorbeeld niet binden op de receptor van de eicel. Er kan dan geen bevruchting tussen beide optreden.

VOORBEELD ZEE-EGELS

Een voorbeeld van gametische isolatie doet zich voor bij twee zee-egelsoorten. Ze komen in hetzelfde gebied voor, maar de voortplantingscellen van de soorten kunnen onderling geen zygote vormen.

Proefversie©VANIN

264 MODULE 16 hOOfDstUk 3
S Afb. 301 De rifkoralensoort Orbicella franksi S Afb. 302 De rifkoralensoort Orbicella faveolata stelt pakketjes met geslachtscellen vrij. S Afb. 303 De zee-egel Strongylocentrotus purpuratus S Afb. 304 De zee-egel Strongylocentrotus franciscanus

Mechanismen van reproductieve isolatie veroorzaken soortvorming. Er zijn twee soorten mechanismen: allopatrische en sympatrische soortvorming.

Bij geografische soortvorming splitst een populatie zich in twee geografisch gescheiden deelpopulaties. Als ze lang genoeg gescheiden blijven, kan er een reproductieve barrière ontstaan.

Sympatrische soortvorming treedt op in hetzelfde gebied.

Proefversie©VANIN

• Bij habitatisolatie hebben twee populaties van dezelfde soort een verschil in voorkeur voor een bepaalde habitat binnen hetzelfde gebied.

• Bij gedragsisolatie leidt variatie binnen paringsgedrag tot reproductieve isolatie.

• Morfologische isolatie treedt op wanneer variatie in de bouw van de voortplantingsorganen ervoor zorgt dat niet alle individuen van de soort zich met elkaar kunnen voortplanten.

• Temporele isolatie start vanuit variatie in het tijdstip van voortplanten.

• Bij gametische isolatie treedt er geen bevruchting op tussen de voortplantingscellen van de ene deelpopulatie en die van de andere.

265 MODULE 16 hOOfDstUk 3

Op ind je

een uitbreiding over de evolutie van de mens. tree of life

VIDEO

3 Mijlpalen van evolutie

Bij de start van dit thema benadrukten we de diversiteit van het leven. Evolutie heeft ervoor gezorgd dat er nu op aarde zeer veel verschillende organismen leven. Dat betekent ook dat er nog meer organismen zijn uitgestorven. Van een fractie daarvan zijn er nog restanten terug te vinden.

Al dat leven gebruikt nucleïnezuren als code om eiwitten te maken. Men gaat er dan ook van uit dat de evolutie van het leven gestart is vanuit één gemeenschappelijke voorouder, een oercel. Daaruit zijn de drie huidige domeinen van het leven geëvolueerd. Je ziet ze hieronder aangeduid in de tree of life.

Proefversie©VANIN

EUKARYOTEN

dieren slijmzwammen planten

algen

protozoën

nanoachaeota crenachaeota

euryachaeota

ARCHAEA

schimmels

grampositieven chlamydiae groene niet-zwavelbacteriën

straalzwammen

spirocheten blauwwieren

BACTERIËN

proteobacteriën

W Afb. 305

Een vereenvoudigde tree of life met de drie domeinen van het leven

Er zijn verschillende hypotheses over hoe de gemeenschappelijke vooroudercellen tot stand kwamen. Sommige wetenschappers gaan ervan uit dat het leven niet op aarde zelf is ontstaan, maar vanuit de ruimte hier terechtkwam. Aangezien er geen leven buiten de aarde bekend is, zijn er op dit moment geen aanwijzingen om die hypothese tegen te spreken of te bevestigen. Andere wetenschappers gaan ervan uit dat het leven is ontstaan op aarde. Als dat het geval is, moeten er drie vragen worden beantwoord om te verklaren hoe de eerste cel is ontstaan uit niet-levende materie:

• Hoe zijn de eerste biologische monomeren, zoals aminozuren en nucleotiden, ontstaan?

• Hoe zijn biologische polymeren, zoals DNA of RNA, gevormd en hoe ontstond replicatie?

• Hoe ontstonden uit die moleculen de eerste cellen of systemen met een intern metabolisme?

De vorming van complexe organische verbindingen uit de elementen C, H, N en O, nog voor er sprake was van cellen, noem je de chemische evolutie.

266 MODULE 16 hOOfDstUk 3
LECA LUCA

Met een bekend experiment van Harold Urey (1893-1981) en Stanley Miller (19302007) werd geprobeerd om een antwoord te vinden op de eerste vraag. In het experiment mengden Urey en Miller waterstofgas (H2), methaan (CH4), ammoniak (NH3) en waterdamp (H2O) in een verhouding die volgens hen overeenkwam met de oeratmosfeer. Daarna stelden ze het gasmengsel bloot aan elektrische ontladingen die de bliksem op de vroege aarde moesten nabootsen. Na een week waren uit de aanwezige elementen C, H, N en O complexe organische verbindingen gevormd (onder andere aminozuren, suikers en lipiden). Bij latere vergelijkbare experimenten gebruikte men andere condities, maar kwam men tot vergelijkbare resultaten.

Proefversie©VANIN

gastoevoer

elektroden

CH4 NH3 H2O H2 vonk

gasmengsel

waterkoeler

watertoevoer

kokend

water water met gevormde organische verbindingen

kraantje voor staalname

W Afb. 307

Het toestel waarmee Urey en Miller in 1953 hebben aangetoond dat er onder bepaalde omstandigheden complexe organische moleculen kunnen ontstaan uit de elementen C, H, N en O

De evolutie van het leven is gestart vanuit één gemeenschappelijke voorouder, een oercel. Uit die cel zijn de drie huidige domeinen van het leven geëvolueerd.

De voorouder kan hier vanuit de ruimte zijn terechtgekomen. Een andere hypothese is dat de voorouder is ontstaan na chemische evolutie. Chemische processen kunnen hebben gezorgd voor de vorming van complexe organische moleculen uit de elementen C, H, N en O.

267 MODULE 16 hOOfDstUk 3
S Afb. 306 Harold Urey
WEETJE

Mijlpalen in de evolutie van het leven per geologische periode

PRECAMBRIUM

4 600-539 miljoen jaar geleden

4 000 Ma

3 500 Ma

Proefversie©VANIN

3 000 Ma

De aarde wordt gevormd. Er is bewijs dat er water aanwezig was. Er ontstaan oceanen en de chemische evolutie begint. Er ontstaan cyanobacteriën. Die doen aan fotosynthese, waardoor de concentratie aan zuurstofgas in de oceanen en de atmosfeer toeneemt. De eerste eukaryote cellen ontstaan en ook de eerste meercelligen, schimmels en sponzen. Ook de ozonlaag wordt gevormd.

CAMBRIUM

539-485 miljoen jaar geleden

Tijdens het ordovicium speelt het leven zich nog voornamelijk af in het water. Het aantal geslachten van zeeorganismen verviervoudigt. De eerste kaakloze vissen verschijnen. Op het einde van het ordovicium vinden er een aantal massa-extincties plaats. Samen vormen ze de op een na grootste periode waarin levensvormen massaal zijn uitgestorven. Uit deze periode stammen de fossielen van de eerste landplanten 4 600 Ma

Op relatief korte tijd ontstaan bijna alle stammen van de dieren. Daarom spreekt men van de cambrische explosie. Een mogelijke hypothese voor die snelle diversificatie is de stijging van het zuurstofgasgehalte. In plaats van vast te zitten, gingen dieren actief zwemmend of gravend op zoek naar voedsel.

ORDOVICIUM

485-444 miljoen jaar geleden

Heb dit voorlopig zo laten staan...

Moet alles aansluiten?

Grijze balken aan zijkant weg?

2 500 Ma

2 000 Ma

268 MODULE 16 hOOfDstUk 3
VERDIEPING

de vijf grote massa-extincties

einde ordovicium (444) einde devoon (359) einde perm (252) einde trias (201)

einde krijt (66)

Proefversie©VANIN

miljoen jaar geleden

SILUUR

444-419 miljoen jaar geleden Tijdens het siluur ontwikkelen de eerste beenvissen zich. Uit deze periode dateren de oudste grotere fossielen van landleven. De eerste vaatplanten ontstaan. De periode eindigt met een aantal massa-extincties door klimaatverandering of meteorietinslagen. Ze zijn wel van kleiner belang dan die op het einde van het ordovicium.

DEVOON

419-359 miljoen jaar geleden Tijdens het devoon heerst er een relatief warm klimaat en een hoog zeeniveau. In zee komen er enorme riffen voor in de ondiepe zeeën. Kaakvissen domineren. Er ontstaan groepen vissen die nu ook nog leven. Op het land ontstaan er de eerste wouden van reuzenpaardenstaarten en boomvarens. Ook is er een enorme diversificatie van de insecten. De Acanthostega, een overgangsfossiel tussen vis en amfibie, dateert uit deze periode. Het devoon eindigt met een massa-extinctie, vermoedelijk omdat door de expansie van het plantenleven op het land het koolstofdioxidegehalte enorm daalt. Aangezien CO2 een broeikasgas is, zorgt dat voor een temperatuurdaling, die zich doorzet in de volgende periode.

CARBOON

359-299 miljoen jaar geleden In het carboon evolueren de insecten tot reusachtige vormen. Ook ontstaan de eerste zaadplanten. In het begin van deze periode zijn de enige gewervelden op het land de amfibieën. Naar het einde verschijnen de eerste reptielen. Door de vorming van een eischaal zijn ze niet meer afhankelijk van water voor hun voortplanting. Er is wel interne bevruchting nodig om de eicel te bevruchten voordat de eischaal wordt aangelegd. De oudste fossielen van de voorouders van dinosauriërs en de voorouders van de zoogdieren dateren uit deze periode.

269 MODULE 16 hOOfDstUk 3
0 1 2 3 4 5 aantal genera (x 1 000) 0 50 100 150 200 250 300 350 400 450 500 550
het aantal
in de loop
de tijd.
S
Afb. 308 De grafiek toont de evolutie van
geslachten
van
S Afb. 309 De Acanthostega kan zowel in het water als op het land leven en wordt beschouwd als de eerste amfibie. S Afb. 310
539 485 444 419 359 299 252 201 145 66 23 2,6 nu CAMBRIUM SILUUR ORDOVICIUM CARBOON DEVOON TRIAS PERM KRIJT JURA NEOGEEN PALEOGEEN KWARTAIR 2 000 Ma 1 500 Ma 1 000 Ma
Een illustratie van insecten tijdens het carboon, zoals de oerlibel (Meganeura), met een spanwijdte van ongeveer 70 cm, en de duizendpoot (Arthropleura), die tot wel twee meter lang kon worden

PERM

299-252 miljoen jaar geleden

In het perm ontstaan er veel naaktzadige planten. De gewervelde dieren op het land worden steeds groter. Naar het einde toe ontstaan er reptielen met zoogdierachtige kenmerken. De periode wordt afgesloten met de grootste massa-extinctie in de aardse geschiedenis. 90 tot 95 % van de mariene soorten en 70 % van alle soorten op het land sterven uit.

TRIAS

252-201 miljoen geleden

Proefversie©VANIN

Het supercontinent Pangea begint aan het einde van het trias uit elkaar te drijven. De naaktzadige planten winnen aan belang en de eerste dennen ontstaan. De periode eindigt opnieuw met een massa-extinctie, die voornamelijk het mariene leven treft.

JURA

201-145 miljoen jaar geleden

Door de extinctie tijdens het trias verdwenen op het land vooral amfibieën en zoogdierachtige reptielen. De dinosauriërs nemen hun plaats in en floreren. In het luchtruim domineren de pterosauriërs, een groep van vliegende reptielen die in de vorige periode werden gevormd. De eerste vogels ontstaan, maar hun belang is zeer beperkt. Coniferen zijn de dominante landplanten. In deze periode splitst Pangea zich verder.

KRIJT

145-66 miljoen jaar geleden

De continenten liggen al uit elkaar, waardoor de evolutie van de landdieren verschilt op elk continent. In deze periode overheersen op het land de dinosauriërs, waaronder Tyrannosaurus rex. In de lucht overheersen de pterosauriërs en de eerste vogels. Op het einde van de periode blijven enkel nog zeer grote pterosauriërs over. Zoogdieren zijn in het eerste deel van deze periode een relatief kleine en onbelangrijke groep. Op het einde van de periode ontstaan de buideldieren en placentale zoogdieren. Wanneer de bedektzadigen precies ontstaan zijn, staat nog ter discussie. Wel is het duidelijk dat ze tijdens het krijt aan belang winnen. Hun bloemen zorgen voor diversificatie van de insecten. Het einde van de periode wordt gekenmerkt door opnieuw een massa-extinctie, waarbij grote dieren, waaronder dinosauriërs, van de aardbodem verdwijnen. De twee belangrijkste hypotheses voor het uitsterven zijn een meteorietinslag, die zoveel stof teweegbracht dat de aarde gedurende enkele maanden verduisterd werd, en vulkanisme.

Heb dit voorlopig zo laten staan... Moet alles aansluiten?

Grijze balken aan zijkant weg?

270 MODULE 16 hOOfDstUk 3
S Afb. 311 Een varenpalm (Cycas), een naaktzadige
CAMBRIUM SILUUR ORDOVICIUM CARBOON DEVOON PERM 539 Ma 444 Ma 485 Ma 419 Ma 359 Ma 299 Ma 252 Ma
S Afb. 312 Een pterosauriër

Proefversie©VANIN

PALEOGEEN

66-23 miljoen jaar geleden

Zoogdieren maken in deze periode een enorme opgang. In het begin van de periode ontstaan de eerste primaten

NEOGEEN

23-2,6 miljoen jaar geleden

Het drogere en koelere klimaat dat in de vorige periode ontstond, blijft aanwezig. Daardoor is er een opkomst van dieren met grasland als habitat. Daartoe behoren ook de mensachtigen. Op het einde van de periode ontstaat het geslacht Homo. De verdroging van het klimaat en de verspreiding van grassen en kruiden leiden tot het succes van kleine knaagdieren, die droge grond nodig hebben om hun holen in te graven. Er komen ook andere mensachtigen (bijvoorbeeld de geslachten Australopithecus en Paranthropus), sabeltandkatten en mastodonten (onder andere de mammoet) voor.

KWARTAIR

2,6 miljoen jaar geleden – nu Deze periode begint met ijstijden. Daardoor sterven er veel plant- en diersoorten uit. Na de ijstijden volgt er een relatief warme periode. De evolutie van de mensachtigen zet zich door. De eerste mensen komen voor in Europa.

271 MODULE 16 hOOfDstUk 3
S Afb. 313 Een illustratie van dinosauriërs uit het krijt S Afb. 314 De chimpansee (Pan troglodytes) behoort samen met de mens en andere apen tot de orde van de primaten. S Afb. 315
TRIAS KRIJT JURA NEOGEEN PALEOGEEN KWARTAIR 252 Ma 201 Ma 145 Ma 66 Ma 23 Ma 2,6 Ma
Een illustratie van een mammoet

Een ezel en een paard kunnen zich onderling voortplanten. Daarbij ontstaat er een muilezel. Muilezels zijn onvruchtbaar en hebben een mengeling van kenmerken van zowel paard als ezel. Ook hebben ze een ander aantal chromosomen dan beide oudersoorten.

a Geef de definitie van een soort.

b Zou de muilezel volgens de verschillende onderdelen van de definitie als een soort worden gezien of niet? Beargumenteer je antwoord.

De sikkelvanga en de helmvanga zijn twee vogelsoorten op Madagaskar die, net zoals de andere soorten vanga’s op het eiland, zijn ontstaan uit één voorouderpopulatie.

De sikkelvanga schraapt met zijn gekromde bek onder de schors van bomen op zoek naar insecten. De helmvanga eet onder andere kikkers en gekko’s.

Leg uit hoe die soorten waarschijnlijk zijn ontstaan.

De gewone mossel (Mytilus edulis) komt voor in de getijdenzone van de Noordzeekust. Het is een vastzittende soort die ofwel mannelijk, ofwel vrouwelijk is.

a Geef de verschillende vormen van sympatrische isolatie.

b Bepaal voor elk type of het zou kunnen optreden bij de gewone mossel. Beargumenteer telkens je antwoord.

Leg de volgende uitspraak uit. ‘Eigenlijk zou de zwangerschap bij de mens 21 maanden moeten duren, maar door het rechtop lopen werd vroeggeboorte noodzakelijk.’

S 3D-echografie van een zwangerschap bij de mens

Proefversie©VANIN

Welke vorm van isolatie illustreren deze voorbeelden?

geelkaakweidespreeuw

a De witkaakweidespreeuw en de geelkaakweidespreeuw zijn twee Amerikaanse soorten die sterk op elkaar lijken. Ze eten gelijkaardig voedsel en hun leefgebied overlapt deels. Wel hebben ze een verschillende zang.

b Havikskruid (Hieracium) is een geslacht uit de composietenfamilie. Dat bestaat uit bijzonder veel soorten die heel moeilijk van elkaar te onderscheiden zijn. De meeste soorten havikskruid planten zich enkel ongeslachtelijk voort door zaden te vormen die genetisch identiek zijn aan de moederplant.

c In Noord-Amerika komen er twee soorten stinkdieren voor. De ene soort, Spilogale putorius, paart in de winter en de andere, Spilogale gracilis, in de zomer.

Meer oefenen? Ga naar .

272 MODULE 16 hOOfDstUk 3 - AAn DE sLAG
S Een sikkelvanga (Falculea palliata) S Een helmvanga (Euryceros prevostii)
1 2 3 AAN DE SLAG
S Een witkaakweidespreeuw (Sturnella magna) S Een (Sturnella neglecta)
4
5

Een soort is een groep van organismen die in uiterlijke kenmerken duidelijk verschilt van andere organismen en, onder natuurlijke omstandigheden, zich geslachtelijk voortplant en vruchtbare nakomelingen krijgt.

MECHANISMEN VOOR SOORTVORMING

gametische isolatie

temporele isolatie

morfologische isolatie

gedragsisolatie

habitatisolatie

Er treedt geen bevruchting op tussen de voortplantinsgs- cellen van twee deelpopulaties.

Proefversie©VANIN

geografische isolatie

Er is variatie binnen het paringsgedrag. Er is variatie in de bouw van de voortplantings- organen. Er is variatie in het tijdstip van voortplanten.

Twee deelpopulaties verkiezen een andere habitat.

Er treedt een reproductieve barrière op tussen twee deelpopulaties wanneer die geografisch worden gescheiden.

273 MODULE 16 sYnthEsE hOOfDstUk 3

De evolutie van al het leven op aarde is gestart vanuit één gemeenschappelijke voorouder, die men LUCA noemt. Een hypothese is dat die voorouder is ontstaan na chemische evolutie: uit eenvoudige moleculen zijn door chemische processen complexe organische moleculen gevormd.

Proefversie©VANIN

EUKARYOTEN

dieren slijmzwammen planten algen

protozoën

euryachaeota nanoachaeota crenachaeota

ARCHAEA

schimmels grampositieven chlamydiae

groene niet-zwavelbacteriën straalzwammen

spirocheten blauwwieren

BACTERIËN

proteobacteriën

274 MODULE 16 sYnthEsE hOOfDstUk 3 kennisclip VIDEO
LECA LUCA

Turn static files into dynamic content formats.

Create a flipbook
Issuu converts static files into: digital portfolios, online yearbooks, online catalogs, digital photo albums and more. Sign up and create your flipbook.