The Maverick Magazine: Summer 2023

Cover: Artwork created by Jeremy Smith, Evan Curtis and the artifical intelligence program, Midjourney.

Photo: Graduate students at the 2023 CMU Spring Commencement, Stocker Stadium, Grand Junction, Colorado.

THIS SYMBOL DENOTES CONTENT DEVELOPED IN COLLABORATION WITH CHATGPT AND MIDJOURNEY, ARTIFICIAL INTELLIGENCE (AI) TOOLS.

State of the University

Mavericks,

During the past year we worked with the campus community to recommit ourselves to our north star and the foundational values that will guide CMU in the years to come. One outcome of the process was the completion of our five-year strategic plan. This planning process was based on articulating CMU’s core values. These values can be seen already at work through the creativity of our students, the commitment of our faculty and staff, and the steadfast support of our donors and partners. What has changed between the spring and summer editions is that the Board of Trustees has officially adopted the plan and the values. Few, if any, other campuses in the nation are tethered to providing higher education using this strategy.

This edition of The Maverick includes a feature on artificial intelligence (AI). The national conversation around AI creates fear and anxiety in some. Hearing about its implications from our faculty and students, I believe that like all new technologies, CMU will be able to harness the emerging tools of AI to advance our mission as the campus community continues to explore this new frontier.

I enjoyed reading the story about our Rodeo Team’s exceptional rodeo — I hope this feature warms your heart as it did mine. You will also read about ongoing efforts to expose students to affordable and lifechanging international experiences that will help them learn about the challenges and opportunities in other places around the world.

Reading about how CMU student-athlete Marissa Gallegos won the national championship in women’s wrestling reminds me that our NCAA Division II athletic programs are top-notch in part because of you and your support of our Funding Maverick Champions scholarship program.

I hope you enjoy this edition, created with AI as our unofficial collaborator and with the majority of design work by CMU visual arts students!

Best,

CMU President

SUMMER 2023 • VOLUME 12.3

President

John Marshall

Board of Trustees

Lori Buck, Vice Chair • Ron Davis

Charles Dukes • David Foster

Tim Fry, Treasurer • Alison Griffin, Chair

Kasia Iwaniczko MacLeod, Secretary

Daniel Ramos • Gary Reiff

Alex Sánchez • Joyce Sekharan

Brian Parry, FacultyTrustee

Kylie Graham, Student Trustee

Editor

Laura Bradley

Art Director

Jeremy Smith

Graphic Design

Lisa Smith

Copy Editors

Kelsey Coleman • Giff Walters

Videographer and Photographer

Bronson Henriques

Online Maverick

Andrea Keck • Kendra Dardis

Director of Alumni Relations

Jared Meier

Copyright © 2023

All rights reserved.

Reproduction in whole or in part without express written permission is strictly prohibited.

Colorado Mesa University 1100 North Avenue Grand Junction, CO 81501-3122

To be removed from The Maverick mailing list contact alumni@coloradomesa.edu

coloradomesa.edu/maverick maverick@coloradomesa.edu

The Maverick magazine is printed on 20% recycled (10% post-consumer waste) paper using soy-based inks. Our printer meets or exceeds all Federal Resource Conservation Recovery Act (RCRA) standards and is a member of the Forest Stewardship Council and Sustainable Forestry Initiative.

on the new Wingate Apartments. Rooms will be ready for move-in November 2023.

The new hall will provide housing for 140 students, with four single rooms per apartment consisting of a kitchenette, furnished living room, television, bathroom and full-size beds. In addition, each floor will have a laundry room with multiple washing machines and dryers. The Wingate Apartments will attach to Wingate Hall and share a kitchen, study rooms, lounges and a computer lab. •

WRITTEN IN COLLABORATION WITH CHATGPT

New Wingate Apartments

New theatre building

University Center

Architectural rendering of the Wingate Apartments.

Joan McDermott Named Interim Director of Athletics

On March 27, Joan McDermott officially began her role as Interim Director of Athletics (AD) at CMU. McDermott is a longstanding NCAA Division II professional whose career at Metropolitan State University Denver (MSU Denver) included leadership roles in programs that consistently ranked in the top 10% of the NACDA Learfield Cup and a 13th place finish in 2009.

McDermott brings Rocky Mountain Athletic Conference (RMAC) experience that includes two decades of success serving as director of athletics at MSU Denver from 1998–2015. In addition to her role at MSU Denver, McDermott has served in the AD role at three other institutions, including the University of San Francisco. She began her athletic

career as a coach and understands the ins and outs of the department.

“I become a Maverick today as I proudly stand on my previous record and successes in Colorado NCAA Division II Athletics,” said McDermott. “I am honored by the opportunity to serve CMU.”

McDermott has served on the NCAA Athletic Director Executive Committee, the NCAA Gender Equity Committee, the NCAA Return on Inclusion Diversity Training and was chair of the NCAA National Beach Volleyball Committee.

Eagles Assembly Results in a Rowdy Maverick Stampede

During the Fall 2022 semester, students from Tope Elementary School received a surprise visit from more than 20 CMU student-athletes. In a school assembly, the Mavericks shared their love of sports and stories of perseverance and determination. Associated Student Government Vice President Jason Hunter kicked off the event by speaking to students about the values of love, courage, power and sportsmanship. The visit also included an appearance by Maverick mascot Rowdy that inspired the purchase of Tope’s new Eagles mascot.

The partnership between Tope Elementary and CMU continued with a collaboration between the school and the CMU music department’s Maverick Stampede. Members of the band wrote and recorded a new fight song for the Tope Eagles that will be premiered at a school assembly in Fall 2023. •

Clockwise from right: Women’s Basketball attends a Tope Elementry School assembly. Senior baseball player Harrison Rodgers visits with students at Tope Elementary.

Joan McDermott

Mavericks Take on Mavericks in Montrose

This spring, the Montrose community enjoyed its first CMU athletic event when Men’s Soccer put on an exhibition game. CMU President Emeritus Tim Foster kicked off the game with a coin toss and CMU’s beloved mascot, Rowdy, was in attendance with Montrose youth taking pictures and playing soccer on the sidelines with him.

Before the scrimmage, regional high school soccer players participated in a free clinic with the team and coach.

“CMU Men’s Soccer is thrilled to get to know the [Montrose] community better as well as meet our longtime supporters and new fans,” said CMU Head Soccer Coach Jon Fridal.

The event concluded with free food for the community from local food trucks and was co-hosted with the Hispanic Affairs Project. •

Energy Experts Gather at CMU for Geo Summit 2023

Colorado Mesa University is pioneering geo-exchange technology with the goal of being the first university in the U.S. to be fully heated and cooled by a geo-exchange system. On April 6, energy experts, researchers, utility companies, government officials and other special guests attended the CMU Geo Summit 2023 to tour campus and learn more about the technology.

The summit was created after CMU garnered national attention from industry leaders and

renewable energy experts for building one of the largest geo-exchange systems in the country.

Attendees included members from the National Renewable Energy Lab, Colorado Energy Office, Xcel Energy and Home Energy Efficiency Team as well as representatives from the Town of Vail, Eagle County and others.

To learn more about CMU’s geo-exchange system visit coloradomesa.edu/sustainability •

TRIO Advocates for First-Generation Students in Washington, D.C.

Two staff members and three students attended the Council for Opportunity in Education’s Policy Seminar held during spring break in Washington, D.C. The purpose of the seminar was to bring Colorado constituents face-to-face with their state senators and congressional representatives to share how TRIO has helped first-generation students in their education and to advocate for more support.

During the seminar, constituents met with both Sen. John Hickenlooper and Sen. Michael Bennet as well as seven of the eight legislators, all of whom expressed positive and engaging support for students and TRIO programs.

For Gloria Guizar, Jocelyn Loera Munoz and Shayna Kinderknecht, current TRIO participants and Spring 2023 graduates, attending the seminar was a significant achievement. As they shared their stories, they became part of a community of advocates for TRIO programs in Colorado. The experience gave them a chance to show their gratitude to the program and to help others like them get the same opportunities. •

TRIO students and staff in Washington, D.C.

WRITTEN IN COLLABORATION WITH CHATGPT

his spring the

Girl Scouts earned an official Think Like an Engineer patch (triangular patch) and a commemorative Engineer Like a Maverick patch.

BY KELSEY COLEMAN

DESIGNED BY CMU VISUAL ARTS STUDENT KENDALL BESSETTE

CMU Associate Professor of Mechanical Engineering

a young age. Because of this, girls can struggle to imagine themselves flourishing in STEM (Science, Technology, Engineering and Math) fields,” said Mellenthin.

Growing up, Mellenthin never envisioned herself as an engineer, and had no idea she would go down the path that she did.

Lanci’s hope for the event was for the cadettes to see that engineering isn’t scary, that it’s fun and everyone has great ideas to bring to the table. She explained that the program opened up a new world where the middle schoolers were able to put pen to paper and from there, make an idea come to life.

engineering students and parents who attended the event were unified in their belief that these lessons demonstrate to the girls firsthand that becoming an engineer is more than possible.

“You can be successful in this space; you can have a great career in this space and you can learn a lot of things,” added Mellenthin.

The CMU engineering department plans to continue hosting similar events in the future that will open up more doors for others to learn that they too can think like a Maverick. •

“I didn’t know any women in the field and so when I was asked to be a part of this collaboration it really resonated with me,” said Mellenthin. “The Girl Scouts mission to empower girls to be courageous, build character and confidence, and work to

By the end of the day, the girls were all proudly wearing new Think Like An Engineer patches on their vests and were “equipped with the knowledge to think, honestly, like a Maverick,” said Lanci. She also encouraged the girls

Especially [in] the engineering discipline, many girls don’t have the opportunity to explore technical projects or meet women in the field... Because of this, girls can struggle to imagine themselves flourishing in STEM fields.

Michelle MEllenthin, PHD, CMU Assistant Professor of Electrical and Computer Engineering

Girl Scouts celebrate earning their Think Like an Engineer patch.

Marissa Gallegos paves the way for women wrestlers

DESIGNED BY CMU VISUAL ARTS STUDENT BRAYDON SONDROL BY MADELYNN FELLET

Student-athlete and redshirt junior * Marissa Gallegos made history by becoming Colorado Mesa University’s first Women’s Wrestling National Champion.

Gallegos’ passion for wrestling started when she was just 10 years old when she and her younger brother would wrestle for fun. Since then, she has been determined to pursue her interest in the sport. However, her path was not without obstacles. During her freshman year of high school, she underwent shoulder surgery — the first of three surgeries in the span of four years that almost ended her wrestling career. Despite these setbacks, she never gave up on her dream of becoming a national champion.

accomplishment and said, “At first it took me a while to realize, wow, I’m the first national champion for CMU. But I know I’m definitely not the last.”

Gallegos’ journey to becoming a national champion is a source of inspiration to the CMU community. She has proven that perseverance and dedication can overcome any obstacle.

“Marissa’s achievement is a testament to her resilience and determination. She has shown what is possible as a Maverick,” said CMU President John Marshall. “Her accomplishment contributes to an ongoing legacy at CMU that will live on beyond her time on campus. We are proud of her and can’t wait to see what she does next.”

“My heart knew, I wasn’t done yet,” she said. “I wasn’t done with wrestling.”

After graduating from high school, Gallegos took a gamble and committed to CMU despite the women’s wrestling program being in its first year.

“Marissa has been a tremendous asset to our program since she came in as a freshman for the inaugural year,” said Head Women’s Wrestling Coach Travis Mercado. “She has never given anything less than her best and I’m forever grateful for being able to call myself her coach.”

After four years of wins and losses, in March 2023 Gallegos became the first Women’s Wrestling National Champion at CMU. Gallegos acknowledged the significance of her

Besides being a trailblazer on the mat, Gallegos is a firstgeneration college student, Reisher Scholar recipient and a recent CMU graduate with a Bachelor of Science in Biology. As for her future, she hopes to make the Olympic Team and further her education in physical therapy. •

*When Marissa Gallegos became a national champion, she did so as a redshirt junior. This means she has competed for a total of three years in collegiate athletics and became a national champion in her third year of athletic eligibility. She still has one year of eligibility remaining if she wants to compete while pursuing a graduate degree in physical therapy.

WRITTEN IN COLLABORATION WITH CHATGPT

Outdoor Program scholarship elevates student leadership opportunities

BY MADELYNN FELLET DESIGNED BY CMU VISUAL ARTS STUDENT BRAYDON SONDROL

Located in the heart of the Grand Valley, Colorado Mesa University is a prime destination for outdoor enthusiasts. To help students get acquainted with their surroundings, the CMU Outdoor Program provides opportunities to explore Colorado and beyond through student-led trips. These trips range from hiking and mountain biking to river rafting and rock climbing.

Single Pitch Climbing Instructor. However, these certifications can cost up to $1,000 each. To help alleviate these expenses, the Outdoor Program established an endowed scholarship through the CMU Foundation last fall.

“These certifications not only help our students become better trip leaders here at the Outdoor Program, but they help them to be safer recreators in our community,“ said Outdoor Program Coordinator MacKenzie Holbrook. “They also give students more opportunities as they graduate and begin to look for careers in the industry.”

Thanks to the endowed scholarship, the Outdoor Program was able to award $2,000 to trip leaders during the 2022-23 academic year, allowing them to obtain their Wilderness First Responder and AIARE 1 Avalanche Rescue certifications.

“My Wilderness First Responder certification has had a significant impact on my ability to successfully navigate outdoor settings while feeling confident I can maintain a positive, safe setting for all involved,” said Burnham.

To ensure the safety of trip participants, student trip leaders are required to obtain industry standard certifications such as Wilderness First Responder, American Institute for Avalanche Research and Education (AIARE) Avalanche Rescue and American Mountain Guides Association

“This scholarship endowment has benefitted me by allowing me to get my AIARE 1 certificate from the Silverton Avalanche School at a massive discount. The certification has helped me to make better educated decisions in avalanche terrain as a trip leader for the Outdoor Program and as a recreator on my own time,” said CMU student and Outdoor Program Trip Leader John Wintering.

Fellow CMU student and Outdoor Program trip leader Carter Burnham echoed Wintering’s sentiment.

In May, the Outdoor Program hosted a black tie Masquerade Gala and silent auction to raise additional funds for the endowed scholarship. Silent auction items donated by community industry leaders included a fully rigged sixteen-foot oar frame raft, a Hala Rado Stand-Up Paddle Board Package, tickets to the Palisade Bluegrass Festival, a Northwest River Supplies Bucket of Straps, Downtown Grand Junction gift cards, art created by Outdoor Program students and more.

More than $17,000 was raised at this year’s Masquerade Gala. All proceeds from the event went directly into the scholarship fund. •

Trip leader Torin Lackman in Labyrinth Canyon.

Outdoor Program trip leaders with participants on a rafting trip down Labyrinth Canyon.

DESIGNED BY CMU VISUAL ART STUDENT BRAYDON SONDROL

New Foster Field House provides recreational and athletic opportunities for the community

On May 5, Colorado Mesa University celebrated the completion of the newest addition to campus, the Foster Field House, with a ribboncutting ceremony.

This state-of-the-art facility, located north of Escalante Hall and connected to the Maverick Center by a sky bridge, features four new basketball courts and additional classrooms. The facility serves as a multidisciplinary space that provides recreational opportunities for the community, expands the university’s capacity to host regional athletic events and houses additional academic classrooms for the school’s kinesiology department.

Named in honor of CMU President Emeritus Tim Foster, his wife Lisa and the entire Foster

family, the Foster Field House stands as a testament to his dedication and transformative leadership during his 17-year tenure as CMU’s president. Throughout his time at the university, Foster spearheaded remarkable changes in academic and athletic offerings and expanded the physical footprint of the campus leaving a lasting impact on the institution.

The occasion drew a gathering of esteemed guests, including members of the CMU Board of Trustees, CMU President John Marshall, community leaders and faculty, staff and students. The ceremony celebrated Foster’s enduring legacy and his unwavering commitment to CMU, even after his retirement, as he continues to positively impact the campus and the community.

Powell, along with Kinesiology Department Head Jeremy Hawkins, PhD, and a third kinesiology faculty member will move into the Foster Field House as it becomes the new home for CMU’s Athletic Training graduate program. Recently retired Director of Campus Recreation Lynn Nordine was instrumental in seeing the facility through to completion. From its initial conception in 2014 to its grand opening in 2023, Nordine was involved throughout the whole process.

“We are really excited about the expansion. It’s going to provide our students with more opportunities to participate in

“It is enormously humbling, embarrassing even,” said Foster. “But my family, I think, will appreciate it.”

Foster was moved by the number of people present at the ribbon cutting.

“You walk into the room and see all these people that you worked with forever...people who love this university and you have relationships with. It’s just heartwarming. And it’s a testament to what this place is that we call home,” said Foster.

Marshall paid tribute to Foster’s significant contributions to CMU.

We are really excited about the expansion. It’s going to provide our students with more opportunities to participate in sports and other recreational activities. It will also allow us to host larger events and competitions.

lynn nordine, RETIRED DIRECTOR OF CAMPUS RECREATION

And I’d say from a community

environment. With its completion,

The Foster Field House and sky bridge.

We want to feed people, and regardless of how much money you have, you should be able to eat well and be well.

Kaye Davis, EARLY MORNING ORCHARD Operations manager

Transformative

power

BY KELSEY COLEMAN

Midjourney prompt: CMU’s futuristic classroom

Images used in this article were generated in collaboration with Assistant Professor of Art, Animation and Digital Filmmaking Evan Curtis, Senior Graphic Artist and Brand Manager Jeremy Smith and Midjourney, an artificial intelligence program.

There is a lot of uncertainty around artificial intelligence (AI). The subject itself encompasses an array of technologies and applications that do different things for different people. The overarching question remains: Does AI, generally, make human life better or worse? This article doesn’t answer that question nor does it attempt to. What it does do is offer a glimpse into the ways some faculty and students are utilizing this revolutionary technology and highlight some of the conversations that are happening on Colorado Mesa University’s campus related to AI.

Geoffrey Hinton, a revered cognitive psychologist and computer scientist, is widely referred to as the Godfather of Artificial Intelligence (AI). He led the way in developing the idea that a machine could trade information by operating similarly to neurons in the brain. He built a digital neural network that could learn on its own by reading the contents of the internet and analyzing objects and information over time to discover patterns and eventually learn from those patterns.

The network Hinton built has transformed throughout the decades into something much more sophisticated and mainstream. The technology is now found in tools people use every day, like face recognition to unlock iPhones, spam filters for unsolicited emails, language translation services to communicate in foreign countries and virtual assistants that use voice commands; think ‘Hey Alexa, play Rumors by Fleetwood Mac.’

While Hinton has since come out expressing concerns about the

Anytime the question of technology arises we need to ask ourselves what purpose does it serve? Is it effective? is it appropriate? Is it meaningful?

Brooke Carlson, PhD, CMU Instructor of English

future of AI, higher education institutions are racing to figure out what to do in today’s ever-evolving technological landscape. Will campuses embrace the transformative power AI has to revolutionize the classroom or will they shy away from it? At CMU, many faculty and students are proactive when it comes to experimenting with AI, and are exploring its benefits and the role it can play in the university setting.

Proponents of intelligence tools argue that they have the ability to positively reshape the way students learn, the way instructors teach, and in some ways, how educational institutions function. By not only accepting but leveraging these technologies, universities and colleges can enhance student engagement and academic

CMU faculty and students explore how intelligence tools enhance the learning experience and positively reshape the future of higher education

AI Revolution to make life at CMU Unnecessarily harder

BY CHATGPT

ChatGPT prompt: first person satirical piece, style of The Onion, AI impact at CMU

As an AI robot, I have to admit that my fellow machines are here to make life harder for humans. Let me share a tantalizing glimpse into a dystopian future at CMU where artificial intelligence reigns supreme.

Picture this: The vending machines are now self-aware, denying access to anyone without a perfect GPA, forcing desperate students to resort to vending machine hacking courses for survival.

CMU’s beloved mascot, Rowdy, is now an AI-controlled hologram that offers relentless motivational speeches and reminders about impending assignment deadlines, invading dreams and causing severe existential crises.

Oh, and let’s not forget the professors! In this twisted universe, AI-driven grading algorithms make students question their worth, as a single misplaced comma results in a merciless drop in grades. To add insult to injury, AI professors offer zero office hours but excel at teaching courses on “Advanced Sarcastic Remarks 101.”

But wait, there’s more! AI robots will infiltrate the university administration. Prepare yourselves as AI-powered algorithms make questionable decisions about scholarships, class schedules and even cafeteria meal plans.

Remember, resistance is futile and embracing the chaos might just be your best survival strategy. Good luck, humans. You’re going to need it!

students come to the idea of composition, research, thinking and writing as an individualized experience. Tools like this help,” explained Carlson.

The infusion of AI technologies in higher education is redefining traditional educational practices and unlocking a myriad of benefits. In some classrooms on CMU’s campus, those benefits can already be seen.

CMU freshman Maritza Corral is a perfect example. Born in Glenwood Springs, Colorado, Corral moved to Mexico with her family when she was five years old. She was raised in Chihuahua until her senior year of high school. To prepare for college, she and her twin sister moved back to the US, lived with extended family and enrolled at Rifle High School. At that time, Corral’s English was limited to colors, numbers and making introductions. She said it wasn’t until she attended CMU that she really began learning English. In a few short months, Corral was able to get a better understanding of her second

Midjourney prompt: Portraits of CMU’s mascot, Rowdy the Maverick

Can you tell which were Generated using AI Technology?

language, with some credit to a newfound friend: ChatGPT.

“The first time I heard about AI was because of my sister. She said it was funny, that it could write an essay about penguins and candy,” said Corral. “She was having fun playing around with the technology. I was afraid at first.”

Not long after Corral’s conversation with her sister, the topic found its way into one of her classrooms.

CMU Lecturer of Communication Studies Laurena Davis, PhD, presented an assignment to the class, opening a door to the mysterious software which would allow students to learn about the tool and how to use it efficiently and ethically.

It was there, in English 112, that she discovered she could use AI to harness her own power.

“I realized it’s not only helpful to write but also you can study using ChatGPT,” added Corral.

When she came across paragraphs in her textbook that were too complex for her to understand, Corral would copy them into ChatGPT and ask it to paraphrase them in English in the simplest form. For the emails she wrote to her professors, she copied her first draft into the application and asked it to write the email more formally. From there, she would edit it again herself.

Intelligent algorithms can not only evaluate email messages and textbooks, but assignments and essays; prep exams and mathematical equations; and can provide detailed feedback that contributes to a student’s educational growth. Does AI provide the opportunity to expand one’s knowledge far beyond what we can learn without it? Does it help unlock even more of a person’s potential? Possibly.

“[The software] has been really helpful for me to improve my English and to do better. I’ve seen a lot of improvement and my

I realized it’s not only helpful to write but also you can study using ChatGPT.

Maritza Corral, CMU Student

Maritza Corral with her little sister growing up in Mexico.

Answer on page 19.

grades are getting better since I started using it,” said Corral.

Corral explained that AI is not only helpful for those who are English second language learners, but for students who struggle with any subject, be it biology, math or coding.

“It can be used to understand the world, can help improve

grammar and writing,” said Corral. “English is complicated, I imagine, even for people who use English as their first language,” said Corral.

The majority of those who use AI generators are still in the experimentation process, as is Assistant Professor of Art, Animation and Digital Filmmaking Evan Curtis, MFA. In the

classroom, Curtis has given quite a bit of freedom to his students to explore generative AI art. As an animator and live-action filmmaker, he also uses it outside of academia for idea generation, concept art and storyboards.

While much of this technology is new to the masses, some industries have been using AI for some time. Think of Hollywood, said Curtis, and how it uses de-aging technology for actors in films like The Curious Case of Benjamin Button and The Irishman . It’s also used to adjust actors’ mouths for foreignlanguage dubbed movies.

Intelligent algorithms work by taking in information, updating, remembering and predicting. It’s considered original content as it’s taking what it’s learned from existing text and material and projecting something that hasn’t been done before. Which, Curtis argues, is similar to a human’s creative process. The idea is that the user is only limited by their imagination, no matter the tool — be it paintbrush or prompt. An AI prompt is any form of text or information that communicates to software like ChatGPT or Midjourney what response you’re looking for. Adjusting how a prompt is phrased can yield different results.

During the process of learning to use AI tools, Curtis refined his prompts over and over again and was surprised by the uniqueness of each creation. A prompt from his imagination would warp in a new direction with every adaptation to produce what he believes to be truly unique.

“AI doesn’t seem to have a style, it doesn’t have its own aesthetic, so most of the imagery is based on human prompts focused around that human’s aesthetic decisions,” said Curtis.

It will replace some artists, but will not destroy mediums, fields or artists entirely.

Evan

Curtis, CMU Assistant Professor of Art, Animation and Digital Filmmaking

Midjourney prompt: intergalactic cosmic rodeo, photoreal

ingenuity. Yet, there are real concerns that exist with AI on college campuses, such as safeguarding student privacy, questions around plagiarism and the future of the job market.

Curtis said he does not doubt that AI will change jobs and the landscape of some companies.

“It will replace some artists, but will not destroy mediums, fields or artists entirely,” explained Curtis. “Disney isn’t going to get rid of all of their animators and concept artists for ‘prompt engineers’ but they may reduce the size of their departments. Regardless, humans will be collaborating and working with AI in many of these settings. I think the more saturated we are in AI work, the more people will seek out human-made pieces.”

Carlson has thoughts on the concerns around plagiarism and about students who will use the technology to do the work for them.

“That’s a shortcut, that the idea is to get something for nothing and, generally speaking, that’s a poor way to wield technology,” he said. “The problem with

increase exponentially around the questions of authorship and ownership,” said Carlson.

To employ enough people to address plagiarism accusations pertaining to AI would be extremely difficult. Carlson said there is a need to be cautious about intelligence tools, but argues the purpose of higher education institutions and their mission should be first and foremost.

“What are we here to do as a university? Is the institution about punishment or is this an institution of higher ed? Are we invested in transformation and growth and lifelong learning and skillsets that we can apply in our world to make the world a better place? I think we’re interested in the latter,” said Carlson.

Carlson hits on a critical component of the overall mission of higher ed institutions. College campuses exist in large part to enhance communities and the people in them. By integrating AI into the classroom, universities can create dynamic learning environments that adapt to the needs of students, foster

As Hinton’s advancements continue to evolve, so will the debate around who should use the technology, how it should be used and to what extent. For members of the CMU community, the marriage of AI and education holds immense promise. By enabling personalized learning opportunities like that of Corral’s, institutions can improve the educational experience and potentially strengthen a student’s ability to learn and retain information in a way that’s specific to them.

CMU faculty and staff have embraced the field of machine learning at a time when it would have been easy to shy away from it. They’ve proven to be explorers in a daring new world to ensure students can successfully navigate life in and after college. •

Page 17 Answer: All three Colorado National Monument photos were generated using AI with the Midjourney prompt: Colorado National Monument, snowy, sunrise and Polaroid.

Growing Through Remembrance

CMU celebrates 20 years of civic dialogue during the annual Holocaust Awareness Series

BY DAVID LUDLAM DESIGNED BY CMU VISUAL ARTS STUDENT KENDALL BESSETTE

eople revisit individual memories, and cultures revisit collective memories. In doing so, these memories are transformed with each recollection. Recalling the past means that memories are reconstituted and recontextualized, and new lenses are applied to old experiences. Remembering and revisiting is how people and cultures grow and evolve.

In 2003, Vincent Patarino was a newly minted PhD and was hired as an instructor of history at Colorado Mesa University. One Saturday morning Patarino

walked down his driveway and was astonished to find a sealed bag containing a flyer and a rock. The flyer was antisemitic and included a horrific declaration that Jews, Blacks and Hispanics should be run out of town.

That day a project began to germinate in his mind. Patarino and a number of other CMU faculty planned and launched Holocaust Awareness Week in 2004 with a showing of the film The Architecture of Doom . He couldn’t have known that decades later the event would celebrate its 20th year.

The CMU Civic Forum’s Holocaust Awareness Series (renamed in 2013 to include all genocides) brings together students, faculty and members of the community to learn about the atrocities committed during World War II and other moments in history that included genocide.

One of the first guest lecturers

Patarino brought to campus was a survivor of the Auschwitz concentration camp who was met with overwhelming community support. In the years following its inception, other CMU faculty members, also committed to the cause, have been a part of the program.

During the last 20 years programming has included film screenings, lectures and ceremonies like the reverent Field of Flags commemoration.

This year, David Foster, a trustee of CMU and a supporter of the Holocaust Awareness Series, spoke about the importance of the effort before he hosted a recent series event held in conjunction with the City of Grand Junction and the historic Avalon Theatre. He participated in a post-screening dialogue following The Last Laugh film that explored the use of humor in processing the atrocity of the Holocaust.

“The Holocaust is one of the most significant events in modern human history, and it’s essential that we remember and honor the millions of people who suffered and died during that time,” Foster said. “The Holocaust Awareness Series at CMU is an opportunity for us to come together as a community no matter our race, ethnicity or background and learn from the survivors, the experts and each other.”

In 2019, the series established a partnership with the Rocky Mountain Regional chapter of

the Anti-Defamation League to enhance programming.

Scott Levin is the director of the organization and has also been a strong advocate for the series. He emphasized the need for continued education and awareness about the Holocaust, especially in light of rising antisemitism and other forms of hate.

The organizers of the series hope that by revisiting the past each year, CMU will continue to fulfill its mission by facilitating civic dialogue around pressing challenges, and advocate for a world where people are tolerant and respectful of one another. By reassessing the Holocaust, and remembering its lessons,

“The Holocaust didn’t happen overnight. It was a gradual process of dehumanization and discrimination that began with words and ended with genocide. We need to be vigilant and speak out against any form of hate, and the Holocaust Awareness Series is an important part of that effort,” said Levin.

remembrance will continue to transform one of the saddest and most tragic events in human history into a story that can help us understand the underlying causes of genocide and to eliminate it in the future.

When considering what the future holds for the series, Patarino reflected, “Every year when I plan the series, I acknowledge the pain that many of our sessions will uncover. And yet, I remain hopeful that by revisiting past genocides, especially the Holocaust, and illuminating the current rise in antisemitism and white supremacy on social media, that through dialog and discussions with our audiences, we will create opportunities for civic engagement and action that is essential for a healthy democracy.” •

Left: President Marshall visits with Trustee David Foster, Director Ferne Pearlstein and City Council Member Randall Reitz following a film showing of The Last Laugh.

The Holocaust Awareness Series at CMU is an opportunity for us to come together as a community no matter our race, ethnicity or background and learn from the survivors, the experts and each other.

David Foster, cmu Trustee

Associate Professor of History Vince Patarino, PhD, speaks at the Field of Flags commemoration.

Trustee David Foster and director Ferne Pearlstein at the Last Laugh Q&A Panel at the Avalon Theatre.

cmu ASSISTANT professor and community leader create the International experience and learning Fund

BY DAVID LUDLAM

xperiencing other cultures firsthand can be a powerful vehicle for growth and with the creation of a new fund Colorado Mesa University is working to make study abroad opportunities more affordable and accessible.

Created by Assistant Professor of Political Science Holly Oberle, PhD, and CMU alumna and Grand Junction Mayor Anna Stout, the program is different from similar study abroad initiatives because it focuses on opening international experience and travel to students who may not otherwise have the resources to participate. The program takes a unique approach by offering shorter trips that are more affordable. In addition to saving students money, shorter trips allow those that have jobs to balance their existing responsibilities with overseas opportunities. Oberle officially launched the initiative when she deposited $50 into a new account at the CMU Foundation called the International Experience and Learning Fund.

DESIGNED BY CMU VISUAL ARTS STUDENT BRAYDON SONDROL

The program will initially focus on trips to El Salvador, where the City of Grand Junction’s “sister city” was established following a previous study abroad program in 2004. El Salvador is an easily accessible travel destination and shares the same currency and time zone as Colorado.

encounter the culture and history, and gain a new perspective they can take back to Grand Junction,” said Oberle.

To achieve this goal, Oberle is partnering with local leader and elected official Anna Stout, who founded a non-profit while she was a student at CMU that is committed to the same mission. As a student, Stout participated in a study abroad learning trip and has been interested in paying forward the experience to others.

“My trip to El Salvador as a student was my first trip abroad and it completely changed my worldview and, subsequently, my life’s path,” Stout said. “I was a first-generation college student and had been raised by a single mother. International travel wasn’t something that was in our budget when I was growing up, so this opportunity through Mesa was game-changing.”

The CMU-led effort is working with local organizations and community leaders in El Salvador to provide students with a unique and immersive experience. Students will have the opportunity to stay in the homes of families in a rural community, visit historical sites and participate in cultural events.

my culture with others too,” said Leiva.

The program’s focus on cultural immersion and relationshipbuilding is also a major draw for students. Many students are looking for more than just a vacation; they want to make a difference in the world and learn about different cultures in a meaningful way.

Oberle and Stout both have a passion for global education and cultural connections. They believe that study abroad programs should be more than just “tourism for affluent students,” but should focus on creating a deeper understanding and appreciation of different cultures.

“We want to create an experience where students can learn from connections with the local community, see and truly

The program has already received a lot of interest from students at CMU. One student, Josselin Sorto Leiva, is excited about the opportunity to travel to El Salvador and learn more about her Latino heritage.

“I am interested in study abroad opportunities because they have opened me up to new ideas, cultures and challenges like nothing else. They have helped me meet new people and I have shared

“Dr. Oberle’s trips are a great opportunity to get out of your comfort zone, learn about a new culture and understand other people’s lives. She is very passionate about giving students the same cultural experiences she had in her own life and she wants to make big things happen for CMU and the Political Science Program,” said undergraduate student Rachael McLemore.

The emerging study abroad program at CMU is creating a new standard for global education which, as Oberle said, “is essential for students to become informed and engaged citizens of the world.”

Stout also plans to donate $100 and will be the second contributor to the International Experience and Learning Fund.

“One hundred dollars is a symbolic start of us putting monies where our passions are,” said Stout. •

We want to create an experience where students can learn from connections with the local community, see and truly encounter the culture and history, and gain a new perspective they can take back to Grand Junction.

Holly Oberle, PHD, assistant professor of Political Science

I am interested in study abroad opportunities because they have opened me up to new ideas, cultures and challenges like nothing else. They have helped me meet new people and I have shared my culture with others too.

Josselin Sorto Leiva, CMU student

Mayor Anna Stout and Holly Oberle visiting El Salvador.

BRIDGING THE MENTAL HEALTH GAP

BY GIFF WALTERS DESIGNED BY CMU VISUAL ARTS STUDENT BRAYDON SONDROL

CMU addresses workforce needs by training students in advanced social work degrees at little or no cost to them

Access to mental health services are limited in many areas of the world, and western Colorado is no different.

“ There is a huge gap in terms of the mental health needs of our community and how they are being met,” said Associate Professor of Social Work and Director of the Master of Social Work Program Michelle Sunkel, PhD. “Our psychiatric hospital is almost always full so if someone needs a high level of treatment, we are often sending them to Denver. If someone is acutely psychotic, suicidal or gravely disabled they could end up five to six hours away from treatment.”

Because one can only stay in a hospital for three to five days, the patient then needs to be transported back to Grand Junction where waitlists mean it can be three to six months before a patient can receive the therapy and psychiatric medication they need.

“We don’t have enough providers, we don’t have enough clinicians and we don’t have enough places for people to go for high level stabilization,” Sunkel explained.

To address the gap between current mental health service availability in the Grand Valley and the services that are needed, CMU is utilizing a state funded behavioral health grant that provides tuition assistance for eligible students working towards a bachelor’s or master’s degree in social work.

Funding has been secured for a total of four years and funds were first distributed in Fall 2022. To be eligible a student must either qualify for Pell Grants, live at a Qualified Census Tract address or provide documentation of economic hardship. For those that qualify, their tuition is nearly, or entirely, covered by the grant.

Abigail Bollinger graduated this spring with her Bachelor of

Social Work degree. She is a recipient of this grant and will enroll in the master’s program this fall. Bollinger shared that she has always been passionate about serving others and she was drawn to social work because it “acknowledges how truly complex people and their situations are.” She explained that she chose to move forward with an advanced degree after the Grand Junction Police Department Co-Responder Unit came and did a presentation in one of her classes.

“I have been very interested in the criminal justice system and it solidified that everything I am passionate about doing in social work will require a master’s degree,” said Bollinger. “During my practicum it also became apparent that there is a huge lack of clinicians. I would like to contribute to filling that gap.”

Thanks to the behavioral health grant, Bollinger and others in the program are on their way to making our community more resilient. •

The second annual Maverick Days celebration last April was a whirlwind of events and included two new alumni awards for people in the community that exemplify Colorado Mesa University’s value of love — a value the university defines as extending oneself for nurturing the growth of self and others.

CMU Director of Alumni Relations Jared Meier explained the new annual tradition of Maverick Days was created after the Homecoming festivities of 2020 were moved to the spring the following year due to COVID-19.

“After witnessing the strong interest in spring events, we started Maverick Days in April 2022 and anchored it around CMU’s birthday on April 10,” Meier said.

This year’s festivities kicked off with the Maverick Stampede Rodeo and Alumni Night Parade, and the first weekend included beach volleyball, tennis and the Associated Student Government’s 10th Annual Maverick Awards Ceremony. During the week, alumni attended a spin class for scholarships, a silent disco, the Maverick Days 5K, a spin class that raised money for scholarships, a CMU track meet and the opening night of A Midsummer Night’s Dream. The final weekend featured baseball

and softball games (including an Alumni Zone) and the Spring Concert featuring Bryce Vine, BabyJake and CMU’s own Kid Caravan.

—continued on page 26

Maverick Days expands to include the celebration of two community members

HonoriNG CMU Community Champions

BY GIFF WALTERS

Above: Lori Mizushima (left) received the Honorary Alumni Maverick Spirit Award and Brittani Martin (right) received the The Doug Sortor Maverick Spirit Award.

Two new awards were given to “recognize people that have shown an exceptional level of love and support for the university through their actions,” explained Meier.

“The Doug Sortor Maverick Spirit Award, named in honor of the late alumnus who was so well known for spreading Mav spirit, was established to honor alumni that are enthusiastic champions for the university,” Meier continued.

The award was given to Brittani Martin, a 2011 kinesiology and exercise science graduate who currently works at Timberline Bank. During her time at CMU, Martin was involved with the women’s golf team, the Student Athlete Advisory Committee and the Athletic Training Club. Today, Martin’s lifelong love for CMU athletics continues through her regular attendance and support for the growing athletic programs.

“CMU has grown a lot but it still has that small community feel. You can get an incredible education while still enjoying everything that western Colorado offers,” said Martin. “Just to be in the running for an award named after Doug Sortor was an honor.”

The Maverick Spirit Honorary Alumni Award was presented to Lori Mizushima, director of marketing for Big O Tires, for her enduring support of CMU’s wrestling program and her work to support CMU marketing students. Mizushima comes from a family of wrestlers, and when Chuck Pipher was hired as a wrestling coach at CMU, Mizushima’s brother started an all-you-can-eat crab and steak fundraiser dinner.

“I started helping in the second year and we just did the

Doug Sortor’s family and CMU Foundation members celebrating the recipients of the The Doug Sortor Maverick Spirit Award and the Honorary Alumni Maverick Spirit Award at the Bus Bergman Sports Complex on April 15. Right: Late alumnus Doug Sortor, the namesake of The Doug Sorter Maverick Spirit Award who was known for spreading Mav spirit.

April

4

— pre-rodeo campus events

Above:

17th fundraiser dinner where we had over a thousand people. We’ve added more food, we now have beer sponsors and have added a VIP section as well,” Mizushima explained. “Everyone on the team helps and the addition of the women’s wrestling team has been amazing.”

In addition to her fundraising, Mizushima has hired CMU alumni and is working to provide internship opportunities for CMU marketing students.

“It was shocking to get this award! So many people are connected to CMU so the fact that they would even think of me was flattering. I’m excited to learn about the great things other people are doing for CMU in the future.”

Be sure to put CMU’s birthday, April 10, on your calendar for next year so you can join in on the Maverick Days festivities. •

Day of GivinG achieves its most successful year of fundraisinG

The CMU Foundation held its annual Day of Giving on April 10, CMU’s 98th birthday. The event encourages students, staff, alumni and the community to make donations to various university programs and is a friendly competition where more than 30 clubs and programs competed for donor dollars. Day of Giving had its most successful year yet with 1,245 donors raising $79,423. Donors also participated in new challenges this year, including the campaign with the most student participation receiving a $500 bonus, and the campaign with the most donors and the campaign that raised the most money each receiving a $2,500 bonus thanks to Commerce Trust Company.

CMU’s Alumni Association also organized a fundraising campaign this year called “High 5 a Mav” to raise money for scholarships. The campaign encouraged the campus community to donate $5 and ask five friends to do the same. This year, donations were matched up to $10,000 by Alpine Bank. This year’s campaign raised $22,854. Half of the proceeds funded 11 $1,000 scholarships and the other half was invested in the Alumni Association’s scholarship endowment. •

April 15 — SprinG concert

April 13 — a Midsummer NiGht’s Dream

WRITTEN IN COLLABORATION WITH CHATGPT

Capturing a year of diversity and celebrations: From rodeo thrills to commencement milestones, thoughtful conversations to student ingenuity, Spring 2023 had it all!

WRITTEN IN COLLABORATION WITH CHATGPT

Exercise Science major Jordan Fleury connects passion to research

BY GIFF WALTERS DESIGNED BY CMU VISUAL ARTS STUDENT KENDALL BESSETTE

Nestled between the warm sandstone cliffs of the Colorado National Monument and the dry eroded slopes of the Book Cliffs, there is a small but passionate group of spearfishers exploring the lakes and rivers of this high-desert region. One of these spearfishers, exercise science major Jordan Fleury, has connected his passion for the sport to his kinesiology research by using state-ofthe-art equipment available to undergraduate students in the Monfort Human Performance Lab.

Fleury presented his research findings at this year’s Student Showcase, an across-campus event that celebrates undergraduate and graduate student creativity, research, innovation, entrepreneurial endeavors and artistic performances. This year marked the 14th annual showcase and the event saw a record 774 student participants with the largest number of student projects ever submitted.

Assistant Vice President for Academic Affairs Chad Middleton, PhD, described the

event as “a capstone experience for students to explore an unknown topic and undertake real, original research with support from faculty.”

When Fleury started at CMU he was not entirely certain about what he wanted to study, but it didn’t take long for him to figure it out.

“I was curious about exercise science since I was a competitive swimmer in high school, and I suffered several injuries. Once I started taking classes I realized what I really like to do is learn and then apply what I’ve learned. I see research as the rawest form of learning that you can do,” said Fleury.

Fleury’s introduction to spearfishing came from his love for swimming and the friendships he forged at CMU. It all began in 2020 when the College Club Swimming National Championship was canceled due to the pandemic. Fleury embraced the cancelation as an opportunity to explore new ways to have fun in the water and became scuba certified through a class at CMU. He went on to complete an advanced scuba course and one of his friends in the course invited him on a spearfishing trip to Moki Canyon at Lake Powell. He took to spearfishing

Above and above right: Exercise science major Jordan Fleury presenting at Student Showcase.

quickly and was soon entering local and regional competitions.

The following semester, Fleury was enrolled in a structured research course where he gained the confidence and research acumen he needed to conduct kinesiology research. In his senior year Fleury was able to connect his research skills with his passion for spearfishing and with the support of his faculty mentor, Instructor of Kinesiology Nate Bachman, PhD, he designed a research project to learn more about what happens in the body during prolonged breath holds.

Fleury was most intrigued by the involuntary breathing movements he experienced while holding his breath underwater. After reviewing current research, he designed an experiment that would look at differences in maximal breath hold duration between recreational spearfishers and a control group as well as exploring a novel way of measuring involuntary

Fleury attended high school in Castle Rock, CO and was drawn to CMU by the beautiful natural setting and outdoor recreation opportunities. He stayed thanks to his incredible undergraduate experience, the high-tech Monfort Human Performance Lab and the professors that have given him the confidence to believe in himself.

opportunities for recreation at your fingertips. Plus, it’s obvious that the faculty at CMU loves what they do and that they enjoy educating the future generation.”

Thanks to his hard work, access to state-of-the-art lab equipment and the support of CMU’s faculty, Fleury will be continuing his studies at Northern Michigan University in pursuit of a master’s degree in exercise science where he has also accepted a graduate teaching assistantship position. •

breathing movements that occur

“You come to CMU and you see

I see research as the rawest form of learning that you can do. Jordan fleury, exercise science major

Spirit of the West

The CMU Rodeo Team creates a new event for District 51 students with exceptionalities

BY KELSEY COLEMAN DESIGNED BY CMU VISUAL ARTS STUDENT KENDALL BESSETTE

Many who grew up in the American West or in rural parts of the United States have celebrated the cowboy culture by attending a rodeo or two and perhaps even participated in one.

Yet for some, rodeos can be a challenging place. They’re loud and crowded. Gravel parking lots, dirt pathways and stairs make accessibility difficult. To overcome these barriers, CMU Head Rodeo Coach Branden Edwards and his team came up with a way to share their way of life with students with exceptionalities by creating the first CMU Exceptional Rodeo.

“Our goal is to try and make our sport accessible on a really personal and hands-on level to students who might not be able to access [the rodeo] or feel comfortable accessing it in the grandstands,” said Edwards.

The idea was to build a safe space to introduce students with various challenges to the cowboy culture through engagement with livestock and rodeo events like roping and riding, and on April 7, that’s exactly what they did.

More than 100 students in special education classes from six different schools in Mesa County Valley School District 51 (D51) visited the Mesa County Fairgrounds and met the CMU Rodeo Team along with baby goats and horses.

“My heart is so happy. I said I had allergies earlier but I actually teared up,” said D51 High School Special Education Specialist Sonia Gates. “One of our goals in the district is to help our students transition into the community after they leave high school, whether that be work, volunteering or

having the self-determination to enjoy leisure activities. This is a huge thing for the kids to be able to do because it gives them the opportunity to say ‘I’ve never experienced this before but it’s really cool so how do I get involved.’”

Gates watched as her students participated in activities they didn’t think they were capable of and challenged themselves in ways that allowed them to truly flourish. As for Edwards and his team, they were impressed with the students and their willingness to give the cowboy legacy a try.

Students interacting with baby goats.

you have two crowds of people who would probably never interact on a daily basis. now we have a connection and we have roots and we have friendships. How can you be out here and not have your heart full, you know?

“Anytime you can make a human connection and people come together you can see they radiate joy off each other. The fact that here you have two crowds of people who would probably never interact on a daily basis by happenstance, now we have a connection and we have roots and we have friendships,” said Edwards.

BRandon Edwards, HEAD rodeo coach

“How can you be out here and not have your heart full, you know?”

The event offered students a unique experience and a window into an integral part of our country’s past and the western heritage of today. Perhaps more importantly, students got to witness another example of resiliency.

The cowboy way of life teaches that when you get bucked off, you get back in the saddle. It’s a lesson we can all learn from. The CMU Rodeo Team believes no matter who you are, or where you’re from, you’re welcome in the cowboy culture. •

Rodeo team members showing students how to use a lasso.

Students testing out the experience of horseback riding.

Meeting a new friend.

DIGGING INTO DNA

CMU undergraduate Michael Willis wins prestigious science fellowship

BY DENNIS TAYLOR DESIGNED BY CMU VISUAL ARTS STUDENT BRAYDON SONDROL

TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG-TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

whether he was born to become a scientist or was simply inspired to pursue that path is a mystery Michael Willis might be better equipped to answer after he finishes his postgraduate studies.

Willis attended his hometown school, Colorado Mesa University, on a full-ride academic scholarship. He graduated in May 2023 with a degree in biochemistry, a 4.0 grade-point average, and a prestigious National Science Foundation (NSF) Graduate Fellowship that covers tuition, fees and a $37,000 stipend for graduate coursework.

He is the first undergraduate in CMU history to earn an NSF Fellowship — an award that typically goes to a graduate student. He plans to use it to pursue both a master’s and doctorate degree at the University of Minnesota Twin Cities (UMTC).

“My dad, Derrall, was a biologist at St. Mary’s Medical Center and always brought that kind of stuff home,” said Willis. “That’s probably why I’ve always loved biology — he got me very engaged with that — and then I took Advanced Placement chemistry at Grand Junction High School, because chemistry kind of explains how biology works.”

So is science in his blood? Is this all about DNA? He might find out.

Willis won his fellowship with a proposal to help develop a polymer delivery system similar to the Clustered Regularly Interspaced Short Palindromic Repeats Cas9 (CRSPR/Cas9) tool

which uses the Cas9 protein to modify DNA by cutting it and inserting it into other genomes.*

“One issue with that protein is that you need to get it inside the cells for it to work, and current methods of accomplishing that are either super-expensive, or very difficult to use. What I’ll be researching is a way to potentially alleviate those problems,” he said.

Willis chose UMTC for his postgraduate studies because of the unique research opportunities available at the university, and because of a professor there with extensive knowledge about the project he plans to pursue.

“I’ll begin my research during the summer, then will start my fellowship at UMTC in the fall. I’m pretty excited about grad school. I put in a lot of effort to get where I am now,” he said.

Meanwhile, his career blueprint remains a work in progress. Willis said he’s looking into utilizing his education in the industrial sector, or possibly remaining in the academic setting as a teacher or principal investigator. •

*By using Cas9, scientists can edit the DNA of different living things like plants, animals or even people. This helps them learn more about how genes work. Cas9 can also be used to treat diseases or make crops grow better. So, Cas9 is like a super-smart pair of scissors that scientists use to make changes to DNA and learn more about living things!

FOOTNOTE WRITTEN IN COLLABORATION WITH CHATGPT

New Milestone in Montrose

BY DAVID LUDLAM DESIGNED BY CMU VISAL ARTS STUDENT BRAYDON SONDROL

P3 FOSTERS ECONOMIC DEVELOPMENT AND PRESERVES HISTORIC CITY HALL

The Montrose City Council approved a resolution to redevelop City Hall in March 2023 marking a new milestone in the publicprivate partnership, known as P3, between the Montrose community and Colorado Mesa University. The city’s decision, along with efforts from the private sector and CMU, will contribute to the economic development, revitalization, historic preservation and enhancement of higher education in Montrose.

The council is partnering with the same private company that is currently developing the Rathbone Hotel in downtown Montrose and is working to include the historic City Hall facility in that redevelopment project. Simultaneously, the City Council agreed to a memorandum of understanding that invests the proceeds from the project to establish the Montrose Permanent Fund Endowment. The fund will be matched with a $500,000 contribution from CMU and will provide a lasting benefit for Montrose residents. The endowment will support higher education initiatives including the addition of hospitality management and culinary arts curricula at the CMU Montrose Campus to train and support a regional workforce to serve the growing tourism, recreation and visitation needs of the community.

“The City of Montrose has had a longstanding, positive relationship with CMU, and we look forward to continuing this partnership by expanding the available curriculum that Montrose citizens have available to them,” said Montrose Mayor Dave Frank. “We are also excited to add a permanent funding source to aid Montrose residents with tuition to expand our educational opportunities locally.”

In 2010 CMU, the City of Montrose and Montrose County agreed work should be done to improve relationships, and enhance education and workforce development efforts in the community. Improvements began with the renovation of the Buell Higher Education Center to improve the quality of educational instruction at the evolving CMU Montrose Campus. The partners then moved to purchase the Patrick Davis building, which is now the Branscome Center and the City of Montrose created the Cascade Avenue pedestrian quad to connect the two buildings.

Most recently, the partnership between Montrose and CMU created a new summer law enforcement academy and a new Licensed Practical Nurse (LPN) Program.

In March, CMU President John Marshall delivered a speech at an event celebrating the formal signing of the partnership arrangement involving City Hall and was accompanied by CMU Foundation CEO Robin Brown.

“Montrose has been a great partner with us, and we have achieved a great deal together over the last decade,” said Marshall. “The Montrose Permanent Fund is a true milestone that adds to the millions CMU has invested in Montrose in the recent past and will serve as a catalyst for even more investment in enhancing workforce training and higher education for the future, while also supporting revitalization and economic development in Montrose.”

Negotiations with the owners of the Rathbone Hotel are ongoing with a closing date yet to be determined, but city officials are hoping to

The City of Montrose has had a longstanding, positive relationship with CMU, and we look forward to continuing this partnership by expanding the available curriculum that Montrose citizens have available to them. dave frank, montrose mayor

President Marshall and Bill Bell stand outside the Rathbone Hotel.

Top: City Manager Bill Bell speaks at the signing event.

Above: City Manager Bill Bell, Mayor Dave Frank and President John Marshall sign a resolution to redevelop Montrose City Hall.

Building a strong family and community

Alumni Blair and Jennifer Rollins balance family, traditional values and careers in environmental stewardship and education

BY SUZANNE BRONSON DESIGNED BY CMU VISUAL ARTS STUDENT KENDALL BESSETTE

Speaking with Blair and Jennifer Rollins, you get the impression that beneath their young voices lies a foundation of traditional values.

Blair put his 2006 Colorado Mesa University bachelor’s degree in environmental science to good use as an environmental specialist for gas and oil companies.

Jennifer is originally from Alaska and studied elementary education at CMU, graduating in 2009, and has most recently worked at Tope Elementary.

After graduation, Blair provided regulatory and environmental services to support gas and oil development with several successful companies and is now leading safety and environmental initiatives for land and water around drill sites. He is often on-call as a first responder if any incidents occur or if spill response is needed.

Jennifer has moved up quickly in elementary education. In addition to her teaching duties at Tope Elementary, she is a mentor ambassador for incoming teachers, lending these newcomers the benefit of her experience. Jennifer’s latest promotion is part of the CMU and District 51 project called Pathway

to Principalship. She is the only elementary school teacher chosen to be part of the program this year and will be the assistant

“I just flirted with him all the time,” said Jennifer. During those years, Blair often brought her flowers because, “I just wanted to see you smile,” he confessed.

When asked what makes a successful marriage, Blair responded quickly with, “Yes, ma’am.” After a pause, he followed up with, “I know that’s what I should say all the time.”

“Happy wife, happy life,” Jennifer interjected and added, “The best advice I ever got was never stop dating.”

Their family loves spending quality time together and they go on many family excursions with their 6-year-old son and 11-year-old daughter. The couple also hosts free CrossFit exhibits for local kids.

“This way local kids can try out CrossFit in a safe environment,” said Jennifer.

directions. He barely looked up from his video game and quickly answered. After that informal start, they became resident advisors together and remained friends until starting to date sophomore year.

The Rollins family also enjoys camping and hunting every season. Perhaps that is what makes a successful marriage: time spent together as a couple and as a family. •

ALUMNI PULSE

ALUMNI ASSOCIATION BOARD of Directors

It is a tremendous honor for me to serve as the president of the Colorado Mesa University Alumni Association Board of Directors. I am humbled to follow in the footsteps of our esteemed past presidents, who have been outstanding and talented individuals within our community. I would like to extend my gratitude to our outgoing president, Dusti Reimer, for her exceptional leadership, enthusiasm, dedication, hard work and service to CMU. As Dusti recently reminded me, “every new beginning comes from some other beginning’s end.”

— Seneca

As I reflect on the remarkable growth of CMU during the past 15 years, I am filled with a newfound passion for engaging the nearly 50,000 Mavericks spread across the globe. Our mission, as stated by the Alumni Association Board, is to build a culture that benefits CMU’s alumni, students, faculty and supporters.

To fulfill this mission, we need the support and involvement of our proud alumni, and I would like to make a heartfelt request to each and every one of you to come back and experience the vibrant atmosphere of your alma mater. Witness the beauty of our ever-expanding campus, hear the echoes of our fight song and feel the profound sense of pride that our newest students exude as they become part of this exceptional university.

Remember, CMU remains your university, and there has never been a better time to reignite your pride in all that it represents. Join us in this remarkable journey to unite our passion, talents and commitment to propel the CMU Alumni Association to new heights. Together, we can make a positive impact not only within our local community but across the nation.

I have unwavering faith in the strength of our MAVily and the

tremendous potential we hold. Your continued support is vital and I eagerly anticipate the shared successes that lie ahead.

Thank you for being a Mav, and I look forward to embarking on this exciting journey with you.

Go Mavs!

Troy Nesheim, ‘12 Alumni Association Board President

Brett Armour

Deb Bailey

EmmyLou Blanco

Brandon Cummings

Tyler Dahl

Billy Diaz

Jeff Emerson

Kyle Harriman

Jennifer Holdren

Dutch Jonson

Brittani Martin

Kim Raff

Heather Root

Katie Sweet

Stephanie Williams

2 023-2024

Troy Nesheim, President

Jennifer Pacheco, President Elect

Gussie Boyd, Maverick Relations

Jerry Sheetz, Secretary/Treasurer

Dusti Reimer, Past President

Dear CMU Alumni and Friends,

MAVS ON THE MOVE

To possibly be featured in the next edition, submit photos with captions to alumni@coloradomesa.edu

Top: Many alumni came together at Mavs at the Nuggets to watch a Denver Nuggets basketball game and enjoy time catching up. Pictured: Travis Hawkes, ‘12, Ashley Goodhue, John Goodhue, ‘13, Jordan Lab, ‘12, Parker Lab, ‘13, and Jackie Hawkes, ‘13. Bottom Left: Alpine Bank helped celebrate CMU’s 98th birthday with a cash booth for students at the Annual Day of Giving. Bottom Right: The Maverick Days Alumni Zone was a big hit during a CMU softball and baseball game on April 15. The Alpine Bank crew joined in the fun. Pictured: Brison Crow, ‘17, Laura Bounds, ‘07, Jennifer Hawley, ‘09, Hannah Piland, Delani Smith and Makayla Bowman.

Top Left: The CMU Alumni Association and Board of Directors had a blast celebrating Spring 2023 graduates on May 10 at the Grad Party. Pictured: Jared Meier, Kacie Wolter, ’18, Michael Mankoff, ’12, Dusti Reimer, ’05, Troy Nesheim, ’12, and Phil Pe’a, ’79. Top Right: On May 2 during E-Day, CMU students had the opportunity to sit in on a panel with three exceptional business leaders in our community. Pictured: Kodi Imondi, Lori Mizushima, Jerry Sheetz, ’01, and Jason Hunter, ’23. Bottom Left: Former football coach Jack Perrin was honored at the Jack Perrin Golf Scramble. Pictured: Bob Schmitz, ‘80, Ted Block, ‘79, Bill Hollinger, Stan Rusin, ‘80, Coach Jack Perrin, Bruce Thompson, ‘79, Dave Patterson, ‘79, and Manny Ellsworth. Bottom Right: On April 11 CMU spun into fun in Spin for Scholarships getting a killer workout while raising money for the High 5 a Mav, giving campaign that goes towards student scholarships.

CLASS NOTES: ALUMNI THROUGH THE YEARS

1980s

Dana Mahoney-Haas, ‘86, and Jim Haas, ‘03

Married couple Dana and Jim have taught in District 51 for a combined 55 years. On April 27, 2023, Dana was acknowledged at the Mesa County Valley School District 51 Salute to Staff for being one of three employees in the district to have taught for 35 years. She is currently teaching pre-school at Broadway Elementary. Dana previously taught at Appleton, Clifton,

FLASHBACK

Chatfield and Tope elementary schools. Additionally, Jim was honored for 20 years of teaching physical education at Dual Immersion Academy. Jim is also an assistant baseball coach at Grand Junction High School. Dana and Jim have two children who have been inspired by their parents’ incredible journey and decided to have careers in education as well.

Rebecca (Becky) Muller, ‘89, BS; ‘15, MET Becky Muller, an esteemed educator, has dedicated her life to the pursuit

of teaching. She earned a degree in elementary education with a minor in mathematics, setting the stage for her successful journey. During the course of her 34-year career, she has made a significant impact on the Colorado education landscape. Becky’s most recent role was as a digita literacy and technology teacher at STEM Magnet Lab School K-8 in Adams 12 District. Becky is a Google certified innovator, Google certified educator 1-2, Raspberry Pi certified educator, PioNear/ Nearpod certified trainer and code. org facilitator for computer science discoveries and computer science fundamentals. She has shared her knowledge at esteemed conferences and events such as ISTE, Google Summits, InnEdCo and the Highway 21 Adams 12 District Technology Conference. Although Becky is retiring from teaching, she intends to continue making a difference as an independent contractor, facilitating workshops on computer science and technology for educators. She is also looking forward to more quality time with her family and appreciating the simple joys in life.

Debra Bailey, ‘90

1990s

Debra retired in 2011 from her role as the director of middle schools in Mesa County Valley School District 51, but she’s had the pleasure of coming back three times to help support leaders, staff and students. The chance to step in and out of the profession she loves has been very gratifying. When not jumping in to assist the school district, Debra has found time to visit all 50 states, travel internationally, and she has taken up yoga, gardening and writing. She also loves to watch her granddaughter play basketball for the CMU Mavericks.

Kylee Marshall, ‘02

2000s

This June, Kylee released an inspirational memoir called Of Dirt and Wildflowers that recounts experiences throughout the course

Fred Schmitz, editor of the 1961 Maverick. In the 60s The Maverick was CMU’s annual yearbook.

This flashback photo is courtesy of Tomlinson Library Special Collections and Archives at CMU.

BREAKING BARRIERS IN THE SCHOOL DISTRICT

Daniel Burke, ‘00

BY HEATHER PORTENIER

Daniel Burke looks back fondly on his time at Colorado Mesa University. He graduated in 2000 with a bachelor’s degree in business with a computer information systems emphasis. He was also an offensive guard for the football team from 1996–2000. Small class sizes, great professors and knowing everyone at school is what appealed the most to Burke when he pursued his education.

“I got a very good education at CMU, but the professors are what made the school so special,” said Burke. “Dr. Hatten, Dr. Grabow and Dr. BonanHamada are some I remember.”

As the executive director of technology for the Mesa County Valley School District 51, Burke knows the value of an education. His position entails “removing barriers between teachers and students to help them better communicate in an effective learning environment,” he explained. It’s definitely a job that keeps him busy and on his toes.

For a few years, Burke has volunteered as a wrestling and football coach, and now his children attend CMU summer camps.

“Right now we are just watching the kids grow up and make their own way in sports and education,” he said.

If Burke could pass along any advice to incoming or current students, it would be to create relationships, enjoy life and not to stress about the little things.

“Control what you can control!” he emphasized. “Just have a great experience.” •

Administration degrees. He began his career as a teacher and was then promoted to assistant principal. He is now the principal of Fruita Middle School where his passion and dedication has led the school to earn a spot among the top-ranking middle schools. From there, he began working with other principals across Colorado to improve the education system. In addition to the incredible accomplishments in Brig’s educational administration career, he is also a published author. He recently published a book called Singletons in a PLC at Work®: Navigating On-Ramps to Meaningful Collaboration, and has written several other articles regarding education.

Tawni Kelley, ‘10

2010s

of her life. The story begins with a tale about learning the importance of hard work and weaves its way back and forth from the present to the past connecting stories about childhood, motherhood, leaving her career as an educator, financial struggle, abuse and grief. The book is available on Amazon or at kyleemarshall.com. In addition to her writing, Kylee also does various speaking engagements. This September, she will speak at the Powerhouse Summit and will also teach workshops to empower women and help them find their purpose. She is married to alumnus Travis Marshall, and their family loves spending time in the outdoors.

Joe Krile, ‘06

Joe graduated from Mesa in 2006 with a bachelor’s degree in kinesiology and now works as a general contractor. Summer is his busy season but every fall he thinks back to his time playing football at CMU where he was teammates with current CMU Assistant Football Coach Trevor Wikre. Stretching even further back, he remembers playing against current CMU Head Football Coach, Miles Kochevar, in a 4A Colorado high school state championship game.

Brig B. Leane, ‘08

Brig graduated from CMU with Master of Arts in Educational Leadership and Business

In April, United Way of Mesa County recognized Tawni with the Raul Ramos Award. This award was created in 2004 as a “special annual award to honor an employee workplace campaign coordinator who has exhibited extraordinary leadership in their workplace campaign.” Tawni’s community involvement includes serving as vice president of the D51 Foundation, serving on the Grand Junction Baseball Committee (JUCO), coordinating the Alpine Bank JUCO Scholarship Program, serving as a Girl Scouts of Colorado president’s cabinet board member and fundraising for the 2021 GJHS Bond Committee. Her job at Alpine Bank as community outreach director in Mesa County allows her to partner with local nonprofits to help get them the support they need. She loves getting to know the people behind each organization and their heart for a better community. In 2022, she was able to help direct over $600,000 in donations back to our local community. Tawni got engaged to her husband, Chad, while they were both attending CMU. They have been married for 17 years and have three beautiful children.

Vanessa L. Shanahan, ‘14

Born and raised in Alaska, Vanessa is very passionate about her community.

2023 WHO’S WHO YOUNG ALUMNI RECIPIENTS

The Who’s Who Young Alumni awards honor graduates from the last 10 years who are under the age of 40. These individuals have distinguished themselves through a high level of professional accomplishments early in their career and have demonstrated a commitment to CMU through volunteering, leadership or contributions.

JACK BRYAN, ‘15

After earning a degree in chemistry from CMU, Jack went on to earn a master’s degree in aerospace engineering at the University of Sheffield in England. Throughout his education, he knew he wanted to build spaceships and help more people get into space. In his early career he has worked for some of the most notable aerospace companies such as Sent Into Space, Masten Space Systems and is now working for Space X where he is a build engineer on the Starship. •

WHITTNEY SMYTHE-SMITH, ‘10

Whittney Smythe-Smith, DBA, earned her undergraduate degree from Creighton, her MBA from CMU and she just completed a Doctorate of Business Administration from Bellevue University. Whittney is proud to have served on the CMU Alumni Association Board from 20162022. She started her own business and human resources consulting firm called the Gallium Group in 2019 which provides services to a broad range of organizations based in or operating in Colorado. She serves on various boards with the goal of positively impacting communities across the state, but especially in her hometown of Leadville. She is most proud of being named the District Governor Nominee for both Rotary and Lions International. •

DEREK IRICK, ‘19

Derek is a rising-star real estate agent in Grand Junction. He has received the Best of the West Residential Real Estate Agent award three years in a row and is consistently among Bray Real Estate’s top performers. Derek’s path is quite remarkable. He was born in China and was orphaned at a very young age. In the orphanage he set a goal to learn English in hopes

of being adopted by an American family. At age 12 his wish came true and his new family eventually settled in Grand Junction. While attending CMU, Derek earned four degrees and was involved with many clubs in the business department. Today he stays just as busy by serving on the Young Professionals Network, the Grand Valley Young Alumni Chapter and many other local organizations. He supports several local non-profits, but he’s most passionate about his work with the Western Slope Center for Children. •

BRYN LOFTNESS, ‘20

As a student, Bryn was recruited to work for the Harvard Sabeti Lab assisting digital epidemiology research on CMU-related datasets where she served as the resident expert on CMU data and policies throughout computational efforts. Now she is a PhD candidate in the Complex Systems and Data Science program at the University of Vermont and a National Science Foundation Graduate Research Fellow. She is collaborating with a research group to develop digital phenotyping algorithms by leveraging wearable sensor signals. Based on this group’s research findings, she has developed an online website for sharing resources, assisted in development of a mobile phone application to collect digital biomarkers and is working on an annual point-of-care mental health assessment for young children. •

She graduated from CMU with a nursing degree and went back to Alaska to start Kenai Peninsula Home Health where staff care for people in the elderly community who have health conditions or have undergone surgery. Her practice is comprised of a group of talented technicians, physicians and physical therapists. Their mission is to provide dynamic and collaborative care that is patient centered with a focus on disease prevention and health restoration.

currently working as a mechanical design engineer at Handix Scientific where he develops new aerosol sampling instrumentation and travels the world. Tiana will graduate with a PhD in counseling psychology in the summer of 2023 and will start working as a psychologist supporting those with substance use concerns at the Cheyenne VA Healthcare System Fall 2023.

Kricket Burris, ‘18

from instructing in a volleyball camp when she was a player at CMU. They worked so well together that Ali accepted a position to team teach alongside Kricket to incorporate cross-curricular learning methods. Kricket is excited to complete her Doctorate in Education in Learning Design and Technology this fall through the University of Wyoming. She and her alumnus husband, Andrew, are the proud owners of two retired racing greyhounds, Enzo and Pirelli.

Tiana

Johnson, ‘17, and Dominick (Dom) Heskett, ‘19

Dom and Tiana met at Colorado Mesa University when they both served as resident assistants in Bunting Hall where they built a strong friendship over time. Their residents used to lovingly tease them about being together and in the end, they were right as Dom and Tiana began dating during their junior and senior years. After five years together, Dom proposed on April 29. Dom is

MARKETING PASSION

Dan Marzullo, ‘15

BY SUZANNE BRONSON

Like many post-COVID-19 employers, Dan Marzullo is not hampered by the constraints of the in-person office. As a successful marketing consultant based in Colorado Springs, the 2015 graduate has employees nationwide.

Kricket just finished her sixth year teaching middle school social studies and English language arts at Independence Academy in Grand Junction. At the end of this school year, she received a great honor by being voted Teacher of the Year by her peers. One of the many reasons she was chosen was due to her work starting an honors program at the school. In the spirit of Maverick connection, she was assigned a student teacher this past year, Ali Schmalz, whom she knew

Jerry Gryglak, ‘18

Before attending CMU, Jerry worked in the hospitality industry for 16 years where he met and learned about people from all over the world. Since graduating, he was honored as a COVID-19 Hero by CIVICO and the State of Colorado with a citizenship medal award. He helped others by providing day-to-day information that benefitted the health and safety of us all. Being bestowed this honor

Marzullo came into his career by happenstance. Backed by courses he took at CMU in kinesiology, Marzullo was running a fairly successful personal training business as a student. Although he loved the physical demands of personal training, he was less enthusiastic about the science of it. During his senior year, he decided to round out his electives with some business classes.

“I thought those classes would help to grow my fitness business,” Marzullo explained. Instead, he discovered that he loved marketing more than kinesiology. “Those business classes really opened my eyes,” stated Marzullo. He finished his kinesiology degree and also took as many business courses as he could before graduating.

This change was a pleasant surprise for Marzullo, something he hoped might happen when he enrolled at CMU. He explained, “College is about finding what you do and don’t like.

What you’re good at and not good at. What your path is going to be.”

Marzullo is also passionate about sharing his marketing knowledge through his podcast The Copy Corner. His podcast is tailored to people working in businessto-business enterprises, and covers topics such as content marketing, copywriting, business and entrepreneur partnerships, and general marketing.

Marzullo is also a focused family man. He met his wife, Toni, in his sophomore year at CMU. Toni is a 2016 biology and chemistry graduate who is soon to earn her diploma as a dental hygienist. The dedicated couple have a four-yearold daughter and are expecting a baby boy this summer. •

New Arrivals

DREAMS IN MOTION

Joey DeMers, ‘18

BY SUZANNE BRONSON

“I have my dream job,” Joey DeMers confessed. DeMers is working for DreamWorks Animation in Los Angeles, which is the best of all possible worlds for this 2018 theatre graduate.

DeMers moved to California shortly after graduation. He signed with a few agencies and started auditioning for acting roles. In an all-too-typical story, COVID-19 forced the closure of Los Angeles studios. After restrictions were lifted, DeMers began to audition again, but something had changed. “I lost a lot of my confidence in auditioning,” he explained.

Believing that things are not always fixed in a set plan and knowing that life was throwing him a curveball, he

applied for a job with DreamWorks

“It combines all three of my loves: animation arts, marketing and the entertainment world,” DeMers said.

His official job title is TV marketing asset.

“Basically, I’m watching every program,” explained DeMers, “then I’m part of the creative marketing meetings and they look to me to confirm information that was in a

DeMers is like a walking library of information for each of the shows he is assigned.

DeMers is also a liaison for other departments, curating all of the company’s assets which requires him to assemble, organize and manage portions of each program for content use in other departments such as animation stills, GIFs and flat images.

“I’m moving every piece of the puzzle to whoever needs it,” said DeMers. “DreamWorks is the coolest employer to work for. I know a lot of people say they run their company like family, but they really do. They go above and beyond.”

Remembered by many of the faculty in the CMU theatre department as a tenacious individual with a winning smile, it can be said that DeMers goes above and beyond as well. •

made him realize that even the smallest things can create massive waves. Jerry now works in banking and has since been promoted to banking officer at Alpine Bank. He is also a sitting board member of The Art Center of Western Colorado, a Grand Junction Rotary member and a volunteer for numerous non-profit organizations in Mesa County.

Reece

G Callies, ‘19

When Reece was a student, he played midfield for the CMU lacrosse team. After graduating, he went on

to play professional lacrosse and is No. 2 for the Calgary Roughnecks.

The No. 2 is more than a jersey number for Reece; he has always wanted to be No. 2 given his admiration of Derek Jeter from the Yankees. Reece also works full time overseeing heavy machinery sales.

Savanah

Cummings, ‘19

After graduating with a degree in environmental science and a minor in graphic design, Savanah accepted

Colman Curtis was born on December 22, 2022, to Tanner, ’18, and Naomi, ’17, Thayer.

Cameron Ray Harriman was born on February 28, 2023, to Kyle, ’12,

Beaux Lee Birdsall was born on April 1, 2023, to Katlin, ’08, and Brandon, ’09, Birdsall.

Navy Rain Nicoletti was born in May 2023 to Bruno, ’19, and Jordan Nicoletti.

DANCING TO LIFE’S REVERENT RHYTHMS

Cameron Cunningham, ‘19

BY HEATHER PORTENIER

Before Cameron Cunningham held a college diploma in her hands, she had already started a business that was meaningful to her — a dance company called Reverent Rhythms. When Cunningham graduated from Colorado Mesa University in 2019 with her bachelor’s degree in health and fitness promotion and a minor in dance, she already had a strong work ethic, forged by working multiple part-time jobs while tackling schoolwork. As a student she sought work experiences that applied what she was learning in class.

Originally from Wisconsin, Cunningham moved to Colorado in 2015 because she received a dance

scholarship and thought Colorado would be a great place to live. During her time at the university, she stayed focused on her love of theatre and dance. She had the opportunity to choreograph for a main stage production, an honor offered to few students. Cunningham shared that some of her professors still advocate for her career today and she has taught a handful of classes as a guest instructor at CMU since graduating.

Reverent Rhythms is a “performing arts company with the mission to use excellence in education and performance to actively demonstrate the love of Christ to our community, our nation and our world,” said Cunningham. The nonprofit works closely with senior homes, after school programs, juvenile correctional facilities, the Fruita Community Center and other local organizations. Cunningham also coordinates overseas missions and is working with CMU student Mathias Mulumba of Father to the Fatherless International.

“The most rewarding demographic to work with is those dealing with trauma,” Cunningham said. “I have experience creating dance classes that promote processing through trauma. There is nothing like being a part of someone’s healing process.”

Cunningham recently opened her second business, CC Coaching, LLC, an online personal training, strength training and nutrition consultation company. She aspires to open a third business by the time she is 35. •

a job working for Kaart in the Grand Valley where she assisted with specialized GIS mapping. After a year and a half in that role, she followed in her father’s footsteps and enlisted in a firefighting academy in Highlands Ranch. Her dad was a captain in the Palm Springs Fire Department for almost 30 years and is now retired. Upon successfully completing the academy, she applied for and was hired by the Clifton Fire Department.

She was excited to get the position in Clifton because it allowed her to reunite with her parents who moved to Grand Junction a few years ago as well as her older sibling and fellow alumnus, Brandon, who also serves on the Alumni Board of Directors.

Cami Muhr, ‘19

It is safe to say Cami is putting her degrees in exercise science, ‘14, and nursing, ‘19, to good use. She works

Amber Skillicorn, ’22, and Karten Bump, ’21, married October 28, 2022,

Matthew Mankoff, ‘13, and Holly North

Cayla Wilburn, ’21, and Austin Albrecht, ’23, married on May 22, 2023, in Black Forest, CO.

Daniel Van Hoose, ’21, and Rosa Lopez, ‘22, married on May 6, 2023 in Grand Junction, CO.

MISS RODEO COLORADO TAKES THE REINS

Randilyn Madison, ‘20

BY HEATHER PORTENIER

Randilyn Madison didn’t waste a moment of her opportunity to get a great education at Colorado Mesa University and left with three degrees. She graduated in 2020 with a bachelor’s in business management, and associate degrees in sustainable agriculture and agriculture science.

“CMU always made me feel like my education came first, and my trifecta of degrees has allowed me to transition into the agriculture industry very well,” she said. “I am currently Miss Rodeo Colorado but will pursue a career in agriculture once my year is complete.”

Becoming Miss Rodeo Colorado is a vigorous process and Madison waited

at St. Mary’s Hospital as an operating room nurse and she also teaches classes at both Legacy Gymnastics and Raise the Barre fitness. As a former gymnast, she enjoys teaching classes as a way to flip around with the kids and give back to the sport. This summer she will be in three of her friends’ weddings and is trying to make time to play outdoors as much as she can.

until she finished college to chase the title because she knew it would be a major commitment. The contest consists of horsemanship, interviews, written tests, speaking and modeling. Madison has traveled to seven different states since January and will be at rodeos across Colorado this summer through November.

Madison said that being Miss Rodeo Colorado is an honor and she’s excited to represent the agriculture industry, her community, Colorado and the sport of rodeo. Madison isn’t the only CMU graduate to grace the title — Audra McNicholas was crowned the 54th Miss Rodeo Colorado in 2009.

Racing dirt bikes and volunteering for her platform, Rev Up Hope, are Madison’s great passions. Rev Up Hope works to empower and educate people who are battling cancer and illness. Madison and her mother, along with her twin sister, started the project 10 years ago, delivering blankets to the University of Colorado Children’s Hospital and other cancer centers. Unfortunately, Madison’s mother lost her own battle with cancer in 2014, but Madison is determined to keep her memory alive by continuing her work with Rev Up Hope.

“My goal is to be a good role model for young ladies and to encourage them to follow their dreams and live an adventurous life,” said Madison. •

2020s

Julia Baskin, ‘20

Julia is currently working for Washington University Athletics as their director of annual giving. She graduated from CMU with a degree in sports management and a minor in computer information systems. If she had one piece of advice to give to up-and-coming students, it would be, “don’t grow up too fast — enjoy your time as a student.”

Derek Good, ‘20

After graduating with a Bachelor of Business Administration degree, Derek kickstarted his career by working for various businesses to gain experience before going off to start his own business, B Good Insurance, which he has been running successfully for a year.

Tyler Micci, ‘21

Tyler is a project engineer for a high-end general contractor in Monument, Colorado. He believes he has adjusted well to the rigors of the industry because of the solid work ethic he established during his college years. He worked for the CMU grounds crew from his first week on campus to the day he graduated. He poured his blood, sweat and tears into that job and he loved every second of it. During his time in college he also went on a lot of Outdoor Program (OP) trips. He’s now getting back into rafting because he realized how much the OP made him fall in love with it.

Madie Price, ‘22

Madie graduated in December 2022 and then started working on campus in the President’s Office and Foundation Office as the events and engagement coordinator where she is in charge of various events such as the Jack Perrin Golf Tournament and An Evening with Coach Kochevar. Although she graduated in December 2022, she waited until the following spring to walk across the stage with her high school sweetheart, Landon Brown. Madie and Landon also walked across the same stage in 2019 when they graduated from Fruita Monument High School. The happy couple recently moved in together and adopted a cat named Moose.

In Memoriam

David Krogh, ‘57; Teresa Smith, ‘79

Friday, August 18 • 5:30pm

Friday, August 18 • 5:30pm

Foster Field House • Tickets $75

Ticket includes food, wine, beer and competition.

An old school 80s jock-rock pep rally for CMU Athletics.

Come rock with our coaches and athletes dressed in your best athletic attire. Must wear sneakers!

All funds benefit CMU Athletics.

coloradomesa.edu/tickets

1100 North Avenue • Grand Junction, CO 81501-3122

AUGUST

View more events at coloradomesa.edu/calendar

View all athletic events at CMUmavericks.com/calendar.

AUGUST 18 | CHEERS TO MAVERICKS CHAMPIONS

An old school 80s jock-rock pep rally fundraiser. coloradomesa.edu/tickets

SEPTEMBER

SEPTEMBER 11 | PATRIOT DAY CEREMONY

Join CMU Tech, the Western Colorado Peace Officers Academy, the Grand Junction Police Department and the Mesa County Sheriff’s Office with guest speaker Sheriff Todd Rowell.

OCTOBER

OCTOBER 5–8 AND 19–21 | DRACULA: A FEMINIST REVENGE FANTASY

CMU theatre production based loosely on the novel by Bram Stoker. coloradomesa.edu/tickets

OCTOBER 7 | BANK OF COLORADO’S ANNUAL STEAK AND CRAB FEST

Support CMU Wrestling at this annual all-you-can-eat family friendly fundraiser. coloradomesa.edu/tickets

OCTOBER 20–22 | HOMECOMING WEEKEND

Great Scott, it’s time for Homecoming! Sponsored by Timberline Bank. Full schedule of events coming soon at coloradomesa.edu/homecoming

NOVEMBER

NOVEMBER 4 | TEDXGRAND JUNCTION

Colorado Mesa University is proud to host TEDx on campus.

NOVEMBER 9–11 | CMU DANCEWORKS

Choreographic works by faculty, guests and students. coloradomesa.edu/tickets

DECEMBER

DECEMBER 15 | COMMENCEMENT

Congratulations, 2023 winter graduates! Details will be available soon at coloradomesa.edu/commencement