Skip to main content

Essential Biochemistry, 3rd Edition Pratt, Cornely Solution Manual.pdf (22)

Page 1

For exam and test prep, contact excellentessaywriters@gmail.com 59 · · · CUACCAGGAGCAAAGCUAAUGGCUUUA · · · 39 39 · · · UCCUC · · · 59 34. S1 helps to maintain mRNA in the single-stranded state and prevents it from forming a double-stranded structure that would block initiation of translation because the initiator tRNA would be unable to bind. 35. Colicin

Ch 22 Solutions

103

44. The number of phosphoanhydride bonds (about 30 kJ ? mol 1 each) that are cleaved in order to synthesize a 20-residue polypeptide can be calculated as follows (the relevant ATP- or GTP-hydrolyzing proteins are indicated in parentheses):

Aminoacylation (AARS) E3 is lethal to the cells because it prevents accurate and effi cient Translation initiation (IF-2) translation. Cleavage of the 16S rRNA at A1493 destroys the part of the 30S ribosomal subunit that verifi es codon–anticodon pairing. As a result, Positioning of each aminoacyl–tRNA (EF-Tu) the ribosome is less able to incorporate the correct aminoacyl group into a Translocation after each transpeptidation (EF-G) growing polypeptide. In addition, EF-Tu hydrolysis of GTP is slow because EF-Tu does not receive a signal from the ribosome that an mRNA–tRNA Termination (RF-3) match has occurred, so the speed of translation decreases. 36. In 16S rRNA, Total: 80 ATP equivalents

2 3 20 ATP 1 GTP 19 GTP 19 GTP 1 GTP

A1492 and A1493 act as a sensor to distinguish correctly and incorrectly paired codons and anticodons. tRNA binding triggers Thus, approximately 80 30 kJ ? mol 1, or 2400 kJ, is required. In a cell, a conformational change in the rRNA that allows A1492 and A1493 to form proofreading during aminoacylation and during translation requires the hydrogen bonds with an mRNA that has correctly base paired with a tRNA hydrolysis of additional phosphoanhydride bonds, making the cost of accuanticodon in the A site. Changing one of these two rRNA residues would inrately synthesizing the 20-residue polypeptide greater than 2400 kJ ? mol 1. activate the translational proofreading mechanism by eliminating the specifi c 45. In prokaryotes, both mRNA and protein synthesis take place in the hydrogen bonding between the rRNA and the mRNA. As a result, incorrectly paired tRNAs could not be distinguished from correctly paired cytosol, so a ribosome can assemble on the 5 end of an mRNA even while tRNAs, RNA polymerase is synthesizing the 3 end of the transcript. In eukaryotes, and the error rate of translation would increase. 37. The correctly charged RNA is produced in the nucleus, but ribosomes are located in the cytosol. Because transcription and translation occur in separate compartments, they tRNAs (Ala–tRNAAla and Gln–tRNAGln) bind to EF-Tu with approximately the same affi nity, so they are delivered to the cannot occur simultaneously. A eukaryotic mRNA must be transported from the nucleus to the cytosol before it can be translated. ribosomal A site with the same effi ciency. The mischarged Ala–tRNAGln binds to EF-Tu more loosely, indicating that it may dissociate from EF-Tu 46. If a peptidyl–tRNA dissociates from the ribosome during translation, before it reaches the ribosome. The mischarged Gln–tRNAAla binds to EF- the hydrolase releases the peptide from the tRNA. Because peptide synthesis is prematurely terminated, the polypeptide is likely to be nonfunctional, and Tu much more tightly, indicating that EF-Tu may not be able to dissociate from its amino acids must be recycled. Similarly, the tRNA, once released from the it at the ribosome. These results suggest that either a higher or a lower bind- peptidyl group, can be reused. The essential nature of the peptidyl–tRNA ing affi nity could affect the ability of EF-Tu to carry out its function, which hydrolase suggests that ribosomes that have initiated translation sometimes would decrease the rate at which mischarged aminoacyl–tRNAs bind to the stop translating before reaching a stop codon. ribosomal A site during translation. 47. (a) The ribosome positions the peptidyl group for reaction with the incoming aminoacyl group, so a peptidyl group with a constrained 38. The ribosome minimizes the chances of misreading the A-site codon geometry, like Pro, is unable to react optimally. by binding the A-site tRNA with lower affi nity. If the tRNA bound with (b) Because Arg and Lys (both with positively charged side chains) react higher affi nity, it would be less likely to dissociate as part of the much faster than Asp (negatively charged side chain), the active site must be more accommodating of cationic groups than anionic groups. proofreading (c) Transpeptidation of Ala is faster than for Phe or Val, so for nonpolar mechanism. amino acids, small size is more favorable. [From Wohlgemuth, I., Brenner, 39. In a living cell, EF-Tu and EF-G enhance the rate of protein syntheS., Beringer, M., and Rodnina, M. V., J. Biol. Chem. 283, 32229–32235 sis by rendering various steps of translation irreversible. They also promote (2008).] the accuracy of protein synthesis through proofreading. In the absence of the elongation factors, translation would be too slow and too inaccurate to 48. During elongation, attack by the aminoacyl group attached to the support life. These constraints do not apply to an in vitro translation system, A-site tRNA breaks the ester bond linking the peptidyl group to the tRNA which can proceed in the absence of EF-Tu and EF-G. However, the result, the fMet–tRNA could ing protein is likely to contain more misincorporated amino acids than a in the P site. Bond cleavage by adding an amino group is aminolysis. During be delivered to the ribosomal protein synthesized in a cell. A site when a Met codon was positioned there. translation termination, a water molecule adds to the ester bond to remove However, transpeptidation could not occur because the amino group of fMet the peptidyl group from the tRNA. Bond cleavage by adding water is hy40. If EF-Tu a complex fMet–tRNAMetf is blocked byformed the formyl group.with Polypeptide synthesis would be halted until drolysis. Met et–tRNA in the A site. f the fMet–tRNAMet was replaced byM 49. (a) Transpeptidation involves the nucleophilic attack of the amino 41. The mRNA has the sequence group of the aminoacyl–tRNA on the carbonyl carbon of the peptidyl– tRNA (see Fig. 22-15). The higher the pH, the more nucleophilic the CGAUAAUGUCCGACCAAGCGAUCUCGUAGCA amino group (the less likely it is to be protonated). The start codon and stop codon are highlighted. The encoded protein has 50. (a) the sequence Met–Ser– Asp –Gln–Ala – Ile – Ser.

NH

Peptidyl–tRNA

42. (a) Translation begins at the fi rst AUG codon (ATG in the DNA). The polypeptide sequence is Met–Val–His–Leu–Thr. (b) The mutated sequence has a T residue inserted in the second codon. This is a frameshift mutation, so all codons following that point will be altered. The polypeptide sequence is Met–Val–Ala–Ser–Asp. 43. To encode 1480 amino acids, 1480 codons or 4440 nucleotides (1480 3) are needed, plus a stop codon. The 1686 additional mRNA nucleotides (6129 4443) include segments at the 3 and 5 ends where translation factors and the ribosome bind.

CHR O H

C N

O H

CHR Aminoacyl–tRNA

O

C O tRNA

tRNA


Turn static files into dynamic content formats.

Create a flipbook
Essential Biochemistry, 3rd Edition Pratt, Cornely Solution Manual.pdf (22) by Samuel Kisilu - Issuu