Page 1


ÍNDICE Edición 130 - Agosto 2019 INFORMACIÓN DE COYUNTURA

8

CNA exige a jueces y fiscales actuar con mano dura

13

CAF aprobó USD 200 millones para electrificación del sector camaronero

16

Situación y perspectivas de la industria de camarón en India

22

El manejo de las enfermedades en los cultivos de camarón desde la perspectiva de los especialistas

26

Responsabilidad social, una tarea de todos

ARTÍCULOS TÉCNICOS

28

Detección del parásito amebiano (orden Dactylopodida) en camarón blanco del Pacífico (Litopenaeus vannamei) cultivado

34

Potenciador de palatabilidad funcional para mejorar el crecimiento, morfología intestinal y actividad de la proteasa del hepatopáncreas en dietas del camarón blanco, Litopenaeus vannamei, reemplazando la pasta de calamar

44 55 64

Cría del camarón blanco del Pacífico Litopenaeus vannamei (Boone, 1931) en un sistema BFT con diferentes fotoperíodos: efectos sobre la comunidad microbiana, la calidad del agua y el rendimiento zootécnico Toxicidad del amoníaco, nitrito y nitrato para juveniles de Litopenaeus vannamei en agua de baja salinidad en experimentos de exposición única y ternaria, y sus implicaciones ambientales El simbionte marino Pseudovibrio denitrificans es efectivo para controlar Vibrio spp. en la acuicultura del camarón

ESTADÍSTICAS

74

Exportaciones de camarón

Editora “AquaCultura” Msc. Shirley Suasnavas ssuasnavas@cna-ecuador.com Colaboración en edición Lcda. Esther Jurado ejurado@cna-ecuador.com Consejo Editorial Msc. Yahira Piedrahita Mphil. Leonardo Maridueña Ing. Attilio Cástano Econ. Heinz Grunauer Diseño, diagramación y foto de portada Ing. Orly Saltos osaltos@cna-ecuador.com Corrección de estilo Silvia Idrovo Valverde

NOTICIAS

78

Presidente Ejecutivo Ing. José Antonio Camposano

Noticias de interés

Comercialización Gabriela Nivelo gnivelo@cna-ecuador.com


EDITORIAL José Antonio Camposano Presidente Ejecutivo

Hacia una nueva Ley de Pesca y Acuicultura

E

l pasado viernes 16 de agosto, el Ministro de Producción, Comercio Exterior, Inversiones y Pesca entregó a la Asamblea Nacional el Proyecto de Ley Orgánica de Pesca y Acuicultura. Se trata de un texto trabajado durante varios años entre autoridades y el sector privado, debidamente representado por sus gremios, quienes participaron activamente de la construcción del mencionado articulado. El proyecto incluye un capítulo dedicado a la pesca y otro a la acuicultura con sus respectivas definiciones, responsabilidades y derechos de los actores privados, así como facultades de las autoridades competentes. Hay que recordar que el sector pesquero tiene una ley que data de mediados de la década de los setenta, mientras que el sector camaronero cuenta sólo con un reglamento a la mencionada ley cuya última actualización fue emitida a fines del año 2015. Al revisar el proyecto se puede concluir que se trata de un texto de fácil comprensión para quienes se dedican a las actividades productivas que este regulará. A diferencia de muchas iniciativas legales del ejecutivo que se emitían en la administración pasada, este texto no deja espacio a la interpretación de la autoridad de turno, aunque para evitar esa subjetividad aún quede pendiente la emisión del correspondiente reglamento. En lo que respecta puntualmente a la actividad acuícola, el proyecto de ley

recoge en gran parte la posición del sector camaronero, tanto en la claridad de las “reglas del juego” como en la necesidad de fomentar adecuadamente a nuestra industria. Si bien, no todos los pedidos del sector han sido incluidos, no está descartado que estos puedan abordarse durante las discusiones en la Comisión a cargo del tratamiento de la ley, así como en el Pleno de la casa legislativa. En todo caso, el proyecto constituye un buen punto de partida puesto que no se arranca desde la visión sancionadora ni limitadora al crecimiento de nuestra actividad; por el contrario, se reconoce el camino recorrido por los camaroneros y se propone una norma que, de forma sensata, le da a la autoridad las herramientas para ejercer su trabajo de manera adecuada con el objetivo de garantizar el cumplimiento de las exigencias de los mercados de destino. Luego de este breve comentario sobre el proyecto de ley, el sector camaronero aspira de la Asamblea Nacional un debate técnico y con altura, alejado del populismo y de propuestas sin sustento que desvirtúen el esfuerzo por impulsar la actividad y, por el contrario, generen camisas de fuerza que limiten nuestro crecimiento. Basta con observar lo que sucede con el sector bananero, presa de una norma que muchos califican de lastre, para saber que ese no es el futuro que deseamos para nuestra actividad productiva.


DIRECTORIO PRIMER VICEPRESIDENTE Ing. José Antonio Lince

PRESIDENTE DEL DIRECTORIO Econ. Carlos Miranda

SEGUNDO VICEPRESIDENTE Ing. Marcelo Vélez

VOCALES Blgo. Carlos Sánchez Ing. Ricardo Solá Ing. Alex Olsen Ing. Ori Nadan Ing. Attilio Cástano Ing. Luis Francisco Burgos Ing. Jorge Redrovan Sr. Isauro Fajardo Tinoco Ing. Leonardo De Wind Ing. Oswin Crespo Econ. Sandro Coglitore Ing. Rodrigo Laniado Econ. Roberto Coronel

Ing. Diego Illingworth Ing. Alex Elghoul Ing. Rodrigo Vélez Dr. Marco Tello Sr. Luis Alvarado Ing. Paulo Gutiérrez Sr. Luis Aguirre Ing. Fabricio Vargas Ing. Francisco Pons Dr. Alejandro Aguayo Econ. Heinz Grunauer Ing. Víctor Ramos Ing. David Eguiguren

Ing. Marcos Wilches Ing. Álvaro Pino Arroba Sr. Carlos Rosales Sr. Roberto Aguirre Ing. Miguel Uscocovich Ing. Alex De Wind Sra. Verónica Dueñas Ing. Walter Intriago Ing. Danny Vélez Sr. Wilson Alcívar Gómez Ing. Luis Gálvez Correa


COYUNTURA

- AGOSTO 2019

CNA exige a jueces y fiscales actuar con mano dura En el primer semestre de 2019 se registraron 12 delitos a camaroneros de los cuales, 10 se ejecutaron en zonas fluviales. El total de pérdidas a la fecha alcanza los USD 600.000.

U

na llamada de emergencia al 911 activó una alerta el pasado 18 de julio, aproximadamente a las 06h30, cuando un grupo de 30 antisociales a bordo de 8 embarcaciones tipo fibra fuertemente armados asaltaban una gabarra que transportaba 20 mil libras de camarón. De inmediato se activaron los protocolos de seguridad y de acuerdo a las coordenadas indicadas, el atraco se localizaba en el sector los Tres Cerritos. El Grupo de Intervención y Rescate (GIR) fue el primero en llegar al punto, logrando intersectar a varios de los delincuentes que estaban perpetrando este hecho doloso, pues el resto, al ver la presencia policial, huyó del lugar realizando varios disparos. Finalmente, la fuerza del orden consiguió la aprehensión de dos sujetos y la recuperación de casi la totalidad del producto robado. Los detenidos fueron puestos a disposición de la Fiscalía de Delitos Acuáticos, luego de haber realizado las pericias a las embarcaciones menores, mismas que fueron ingresadas a los patios de retención de la Policía Judicial y la verificación de los documentos que respaldaron la legitimidad del producto entregado a su propietario. En audiencia de formulación de cargos, los aprehendidos quedaron en calidad de detenidos, mientras dure el proceso de indagación previa. Ante este suceso, el décimo segundo en lo que va del año, lo que deja una pérdida que alcanza los USD 600.000, el Presidente Ejecutivo de la Cámara Nacional de Acuacultura, José Antonio Camposano en

rueda de prensa exhortó a las autoridades judiciales para que actúen con todo el rigor de la ley.

de 5 años de detención a una banda de delincuentes capturada en delito flagrante y posteriormente se conocía que el juez se abstenía de sancionar a los detenidos por supuestamente tratarse de pescadores artesanales”. En ese contexto, Camposano insiste en que todavía se encuentran embarcaciones que no están debidamente regularizadas y que circulan a lo largo y ancho del Golfo de Guayaquil sin ningún tipo de control.

"El sector camaronero es afectado por bandas muy bien armadas y agresivas, que llegan disparando, produciendo una sensación de inseguridad que se conjuga con otra de impunidad”, “porque aún quienes son capturados en delitos flagrantes quedan en libertad a pocas horas o se les dicta medidas sustitutivas, ya que un fiscal no acusa adecuadamente y un juez no sanciona como se debe".

"El Ministerio de Defensa debe fortalecer la autoridad marina e incrementar la capacidad que tiene para hacer patrullajes en las zonas que estamos denominando corredores o “Rutas Seguras”. Explica que “si se tiene una ruta segura activada, pero la autoridad pertinente demora hasta 45 minutos en llegar al momento que se está realizando un robo, es muy difícil augurar que se va a dar solución a un problema de inseguridad", refirió.

José Antonio Camposano Presidente de la Cámara Nacional de Acuacultura

Es así que la Cámara Nacional de Acuacultura hace un llamado al sector camaronero para que activen el plan de seguridad marítima “Rutas Seguras”, y de esta manera reducir la probabilidad de ser víctimas de las bandas organizadas que operan en el Golfo.

Recordó que “el pasado mes de abril, un fiscal anunciaba en rueda de prensa ante los medios de comunicación una sanción hasta

Pero, ¿Cómo actúan estos grupos delictivos dedicados al robo y comercio ilícito de camarón? Camposano explicó

8


COYUNTURA

- AGOSTO 2019 que estas bandas cuentan con unidades de financiamiento, comerciales, logística, planificación y que se trata de crimen organizado que afecta a la actividad camaronera. “Cuando se detecta un robo de más de 18 mil libras de camarón, no es un producto que va a un mercado popular, es un producto que va a ser procesado en centros clandestinos y posiblemente exportado”, dijo. La Subsecretaría de Acuacultura realiza en coordinación con la Policía Nacional, Comisión de Tránsito del Ecuador (CTE) y Servicio de Rentas Internas (SRI), operativos de control a los transportes de carga acuícola. De acuerdo a las estadísticas emitidas de dicha institución, de enero a julio de este año se han ejecutado un total de 50 operativos en las provincias de Guayas, Manabí y El Oro, que consisten en el control de la documentación, con el fin de verificar la procedencia del producto transportado, para así contrarrestar cualquier acto ilícito en zonas terrestres,

Operativo de control terrestre En los operativos de control la documentación que se solicita a los transportistas es la siguiente: - Guía o guías de remisión del producto transportado. - Cédula de identidad o licencia de conducir del chofer que transporta el producto acuícola. - Facturas o notas de venta del producto transportado, en caso de comerciantes. - Vehículo registrado con la Subsecretaría de Calidad e Inocuidad.

que están debidamente regularizadas. Un representante de la autoridad marítima manifestó que este es un plan piloto que se desarrollará en las provincias del Guayas y El Oro, para lo cual se estaría implementando la opción de pago en línea. La Armada del Ecuador se comprometió a socializar este tema, a través de una capacitación que duraría dos horas el cual prepararía al usuario para usar el aplicativo móvil y web. De acuerdo a las estadísticas proporcionadas, durante el 2019 se han ejecutado un total de 1392 operaciones de ejercicio de la Autoridad Marítima en el Golfo de Guayaquil, obteniendo como resultado la desarticulación de 4 bandas dedicadas al robo de camarón. Otra de las problemáticas que expone José Antonio Camposano para el sector camaronero, es la limitación al porte de armas y municiones por parte de las empresas de seguridad contratadas por el productor camaronero. Y es que, precisamente para poder garantizar mejores índices de seguridad, el sector productivo tiene que hacer inversiones que normalmente ascienden hasta los USD 30 millones de dólares anuales en cámaras, custodios, embarcaciones, equipos, entre otros. Camposano considera que dicho monto no le corresponde por ley asumir al gremio. “No es correcto que estemos desviando fondos de casi el 6% del costo de producción

- El personal del SRI verifica si las guías y facturas se encuentran hábiles y no han sido manipuladas. - Personal policial y de CTE verifica licencia, matrícula y demás permisos. Información proporcionada por parte de la Armada Nacional, nos hizo conocer que a través de la Dirección Nacional de Espacios Acuáticos (DIRNEA), se está implementando un sistema de información por medio de su página web cuya dirección es www.dirnea. org; sistema online en el que los usuarios podrán obtener los permisos de zarpe y consultar nombres de las embarcaciones

9

para cuidarnos de la delincuencia”, destacó. Cabe mencionar, que al cierre de esta edición, la Armada del Ecuador en un operativo de control, el pasado 3 de agosto, por el período de aguaje, capturó a 8 delincuentes fuertemente armados y produjo la retención de una embarcación cuyo código de motor había sido adulterado y no contaba con la respectiva documentación. El hecho se suscitó aproximadamente a las 06h00, cuando 2 embarcaciones que se encontraban en el área, procedieron a huir al ver la presencia de los uniformados, logrando el Cuerpo de Infantería de Marina detener a una de esas lanchas, donde se encontró una mochila que contenía una pistola con 17 proyectiles 9 mm, un cuchillo, radio de comunicaciones y celulares. De acuerdo a los datos de la Cámara Nacional de Acuacultura en el período enero – julio 2019, se registró la pérdida de una vida humana. El presidente Ejecutivo de la CNA insistió en que “la Armada continúe con los operativos y detenga toda embarcación en actitud sospechosa”, pues recuerda que “muchos de los hechos delictivos se llevan a cabo a plena luz del día, y que los delincuentes no temen ser capturados”. “Hago un llamado a jueces y fiscales para que actúen con mayor celeridad”, exhortó Camposano●


COYUNTURA

- AGOSTO 2019

“Rutas Seguras” se denomina el plan de seguridad marítima creado por la Armada del Ecuador para la prevención de robos a camaroneros que transporten su producto de un punto a otro en el Golfo de Guayaquil y Archipiélago de Jambelí. El objetivo es velar por la seguridad integrar y el traslado de valor en el mar y prevenir las actividades ilícitas en los espacios marítimos jurisdiccionales.

¿Cómo se garantiza la seguridad en la “Rutas Seguras”? Mediante el empleo de unidades de Guardacostas, de Capitanía, de Infantería de Marina y Aeronavales, con personal naval altamente capacitado en seguridad y presencia en los ejes fluviales del Golfo de Guayaquil. El plan ha sido diseñado entre los sectores productivos y las instituciones de seguridad como el ECU911 y la Armada del Ecuador.

¿Cómo activar una ruta segura en el Golfo de Guayaquil?

¿Cómo activar una ruta segura en el Archipiélago de Jambelí?

1.- Enviar correo electrónico: coguar@armada.mil.ec (24 horas de anticipación)

1.- Enviar correo electrónico: subsur@armada.mil.ec (24 horas de anticipación)

Nombre y matrícula de la embarcación Nombre del solicitante Lugar y fecha de zarpe Lugar y fecha de arribo Número de contácto Ruta requerida Actividad

Nombre y matrícula de la embarcación Nombre del solicitante Lugar y fecha de zarpe Lugar y fecha de arribo Número de contácto Ruta requerida Actividad

2.- Verificación de información por parte de la Capitanía del Puerto

2.- Verificación de información por parte de la Capitanía del Puerto

Datos enviados al correo Documentación en regla Guía de remisión de producto a trasportar Dispositivo de monitoreo satelital

Datos enviados al correo Documentación en regla Guía de remisión de producto a trasportar Dispositivo de monitoreo satelital

3.- Despliegue de unidades navales

3.- Despliegue de unidades navales

Unidades Guardacostas, Capitanía, Infantería de Marina

Unidades Guardacostas, Capitanía, Infantería de Marina

CONTACTO: Guayas Oficial de guardia Comando de Guardacostas 04 2480812 – 0988408608

CONTACTO: El Oro Oficial de guardia del Subsur 07 2927814 o al 911

10


COYUNTURA

- AGOSTO 2019

11


COYUNTURA

- AGOSTO 2019

CAF aprobó USD 200 millones para electrificación del sector camaronero 55.000 hectáreas dedicadas al cultivo de camarón en la costa ecuatoriana, serán beneficiadas con el programa de mejoramiento de los sistemas de transmisión y distribución eléctrica.

E

l pasado 9 de julio, en el marco de la inauguración del Aqua Expo El Oro 2019, se anunció una alentadora noticia para el sector camaronero. Durante la apertura del evento acuícola más grande de El Oro, el Presidente Ejecutivo de la Cámara Nacional de Acuacultura (CNA), José Antonio Camposano, adelantó que el gremio sería beneficiado con un crédito, sin embargo, había acordado previamente, con la Viceministra de Acuacultura en ese entonces, Catalina Cárdenas, que sea la encargada de informar que “el Directorio del Banco de Desarrollo de América Latina (CAF) aprobaba un financiamiento de USD 200 millones para reforzamiento de líneas eléctricas al sector". Y es que, desde Montevideo – Uruguay, el Directorio del CAF respaldó dos programas prioritarios para el Ecuador: 1) Programa de Reforzamiento de Redes de Distribución Eléctrica 2) Programa de apoyo a la Agenda Urbana y la Política de Hábitat del Ecuador, que comprende el diseño e implementación del Sistema Nacional de Catastro y un mecanismo de acceso a financiamiento para viviendas de interés social y público. En la cuenta oficial del Banco de Desarrollo de América Latina se comunicó, que más de 55.000 hectáreas dedicadas al cultivo de camarón en la costa ecuatoriana, serán beneficiadas con el programa que contempla el mejoramiento de los sistemas de transmisión y distribución eléctrica,

con énfasis en otorgar energía al sector camaronero. La implementación de sistemas eléctricos de energía limpia en las provincias de Guayas, El Oro, Manabí, Esmeraldas y Santa Elena que permitirá que dicho sector se beneficie, con la posibilidad de tener bombeo, aireación y alimentación automatizada para lograr una producción más intensiva por unidad de área.

"A través del desarrollo de la infraestructura eléctrica vamos a mejorar la productividad y la competitividad de la industria camaronera en Ecuador al incrementar la eficiencia y sustituir el uso de energía fósil por energía limpia, que les permitirá certificarse como producción verde. Otro aspecto relevante de este proyecto es que incluye un componente de electrificación rural y urbano marginal, con un alcance potencial de más de 6.500 viviendas de poblaciones vulnerables, mejorando sustancialmente su calidad de vida" . Luis Carranza Presidente ejecutivo del CAF

13

Por su parte, José Antonio Camposano, representante del gremio expresó que dicho financiamiento se había venido trabajando desde el 2016, cuando se presentó al Ministro de Agricultura de ese entonces, Xavier Ponce, la iniciativa de cambio de matriz energética del sector camaronero, que, en un levantamiento de información inicial, reflejaba que no había recursos suficientes para modernizar y fortalecer la infraestructura eléctrica pública que permitiera atender las 230 mil hectáreas de fincas camaroneras existentes en el país. Una de las preocupaciones del sector privado es que, en la actualidad, no existe un plan maestro de electrificación para el sector camaronero y que, en unos años, estas obras de infraestructura no cubran la demanda, lo que ocasionaría apagones que afecten la normal operación de las fincas camaroneras. Ante esto, Camposano informó que el gremio (CNA) aprobó un fondo para elaborar el levantamiento de información y que se trabajará en coordinación con la Corporación Nacional de Electricidad (CNEL), Ministerio de la Producción y la Subsecretaría de Acuacultura y Pesca, para obtener un sólo un documento que detalle provincia por provincia los requierimientos como: tendido eléctrico actual, necesidad de financiamiento para fortalecimiento de obra pública y demanda energética de todas las fincas camaroneras a nivel nacional, sino la necesidad de recursos para que el sector


COYUNTURA

- AGOSTO 2019

camaronero pueda tecnificar sus unidades productivas. “Esto permitirá planificar y determinar cuáles van a ser las obras de infraestructura que se irán ejecutando, conforme a los recursos que se vayan desembolsando”. Sin embargo, como se mencionó anteriormente, la empresa privada deberá realizar inversiones para el proceso de tecnificación. Es así, que el presidente ejecutivo de la CNA expresó que “se comenzó a dialogar con CAF para la aprobación de una segunda fase de financiamiento que vaya direccionado al camaronero, con el objetivo que tenga los recursos necesarios para electrificar su finca e implementar el cambio de matriz energética”, dijo. La electrificación de la finca, le costaría al camaronero, desde los USD 1.000 hasta alrededor de USD 5.000 por hectárea, por las siguientes razones: 1) Implementación de un sistema de bombeo de agua en la finca. 2) Compra de equipos y motores eléctricos eficientes. Pero, 70.000 hectáreas, principalmente asentadas en las provincias de Manabí y Esmeraldas, se encuentran en zonas concesionadas, es decir, en tierras que le pertenecen al Estado, y 140.000 hectáreas están ubicadas en terrenos privados. En ese sentido, Camposano explica que “lamentablemente, esas concesiones no constituyen una garantía a entidades bancarias del sector financiero público ni privado, y que se ha expuesto a las autoridades competentes, la necesidad de constituir una hipoteca acuícola sobre bienes construidos en esa camaronera y/o buscar la forma de titularizar esos territorios a través de la modificación de las normas vigentes”. Otro punto de discusión y análisis será el costo de la tarifa eléctrica. Camposano señaló, que “si el camaronero hace todas estas inversiones y a los dos años recibe una planilla que anuncie un incremento por el costo de energía eléctrica al 10% o 15%, como sucedió años atrás con el sector industrial, afectaría el costo de producción y la competitividad a nivel internacional”.

“El sector camaronero solicita y requiere que la Agencia de Control y Regulación de Electricidad (ARCONEL) establezca que la tarifa eléctrica sea un valor competitivo y no se modifique porque un camaronero no va a correr el riesgo de hacer todas las inversiones para ver incrementado el costo de ese servicio eléctrico a los pocos años”, enfatizó.

alrededor de 55 mil hectáreas en las provincias de El Oro, Esmeraldas, Guayas, Los Ríos, Manabí, Santa Elena y Santo Domingo.

Frente a varias interrogantes del sector camaronero, sobre la implementación del cambio de la matriz energética en el país, se consultó al Vicepresidente de Ecuador, Otto Sonnenholzner, sobre dicho tema:

El proyecto es un esfuerzo importante, porque contempla la ejecución de cinco obras de transmisión, 57 obras de distribución y 113 obras de electrificación rural. Esto demuestra que hay una política pública enfocada en apoyar al sector rural ampliando el servicio eléctrico.

Otto Sonnenholzner Vicepresidente del Ecuador ¿En qué consiste el programa de Reforzamiento de Redes de Distribución Eléctrica para el sector acuícola? Al Ecuador se lo saca adelante trabajando y, para trabajar, el sector productivo necesita que se le ofrezca todas las herramientas y condiciones necesarias. Eso es precisamente lo que hacemos desde el Gobierno con el Proyecto de Reforzamiento de Redes de Distribución Eléctrica del Sector Acuícola. Con este programa se electrificará

14

Proveeremos mediante ocho empresas distribuidoras 372 MW a las camaroneras, lo que permitirá mejorar su capacidad productiva.

La inversión en esta iniciativa asciende a USD 200 millones de crédito ordinario y una contrapartida local de USD 50 millones. Son acciones que demuestran el trabajo coordinado del Gobierno con los distintos sectores económicos y sociales. Hay corresponsabilidad para construir el camino a la prosperidad. En virtud de este plan ¿Cuál será el costo de energía que establecerá el ente regulador para el sector camaronero? Siempre en el Gobierno estamos pensando en ser facilitadores y apoyar a quienes buscan dar impulso a la economía ecuatoriana. Por eso, los costos corresponden a un precio justo y competitivo, establecido por el pliego tarifario 2019 emitido por la Agencia de Regulación y Control de Electricidad (ARCONEL).


COYUNTURA

- AGOSTO 2019 Es decir, el sector camaronero pagará aproximadamente 6 centavos por KWh entre las 07h00 y 22h00 y 4 centavos por el KWh entre las 22h00 y las 07h00, una tarifa preferencial que se ha mantenido desde 2017. Anteriormente, la tarifa era de alrededor de 10 centavos por KWh. ¿Cómo se coordinará con la empresa privada para que este programa de Reforzamiento de Distribución Eléctrica para el sector acuícola, se implemente y tenga un buen uso a largo plazo? Algo que le interesa a la ciudadanía es la necesidad de que el Estado y el Gobierno trabajen juntos y que las cosas funcionen lo mejor posible para todo el país. Eso es lo que hacemos en este programa. El Ministerio de Producción, Comercio Exterior, Inversiones y Pesca coordinará con la empresa privada para realizar las inspecciones. En los próximos días, la Corporación Nacional de Electricidad socializará al MPCEIP el detalle de los proyectos a realizarse. A este ministerio le corresponde dar seguimiento a las fincas camaroneras beneficiarias para que inicien el proceso de cambio tecnológico oportunamente. ¿En qué beneficiará este programa a la industria camaronera a nivel país? Uno de los beneficios más importante es el incremento de la productividad del sector camaronero, la calidad de su producto, tener mayor oportunidad de ingresar a nuevos mercados internacionales e incrementar las ventas. Si hay más ventas y más mercados, con eso las divisas que llegan al país también aumentan y la capacidad de crear empleo y dinamizar la economía se fortalecen. Otro beneficio es que este programa permite el uso de energías limpias en la cadena productiva. Somos un Gobierno responsable con el medio ambiente, por eso, con este programa se reducirá la emisión de dióxido de carbono en cerca de 400 mil toneladas al año. ¿Cuándo y dónde iniciará la implementación de este programa? En el Gobierno creemos que las cosas se deben hacer bien y con la mayor agilidad posible. Este programa se cumplirá bajo esa premisa y su plazo de ejecución es de cuatro años. Queremos dejar sembradas obras y beneficio, más allá de un mandato, para el futuro de los ecuatorianos. El programa dura este tiempo, porque comprende un conjunto de proyectos cuya ejecución varía de acuerdo a la infraestructura eléctrica a construirse y el nivel de voltaje que requiera cada uno de ellos. Inicia en enero 2020 y se proyecta que finalice en diciembre 2023. Luego de firmado el contrato, arrancan los estudios y las obras de transmisión, distribución y de electrificación rural. Estos proyectos incluyen trabajos en San Lorenzo, Cojimíes, Bahía, Chongón, Sabana Grande, Engunga, las Brisas, Taura, Naranjal, Tenguel y Jambelí y otras poblaciones, en función de las solicitudes de servicio eléctrico que se han recibido en la CNEL. Se trata de una obra de gran alcance que ya está en marcha porque hay los recursos y, sobre todo, hay la voluntad política de hacerla●

15


COYUNTURA

- AGOSTO 2019

Situación y perspectivas de la industria de camarón en India Autor: Yahira Piedrahita Directora Ejecutiva de la Cámara Nacional de Acuacultura

Con un crecimiento acelerado de su industria, India se ha convertido en el mayor exportador de camarón del mundo, alcanzando las 700.000 toneladas en 2017. Sin embargo, la producción empezó a caer en 2018 y se espera que para el 2019 el volumen se aproxime a las 530.000 toneladas. Los productores indios afrontan problemas de producción debido a las enfermedades y los precios del mercado no permiten mayores inversiones. Existen algunos cuellos de botella que deben ser resueltos y en los que tanto el sector productor como el gobierno concentran sus esfuerzos. Este artículo ha sido preparado por Yahira Piedrahita en base a la información proporcionada por los principales actores de la industria durante el congreso Asia Pacífico de la Sociedad Mundial de Acuicultura (WAS APA19), realizado en Chennai (Tamil Nadu) a finales del mes de junio.

E

l cultivo de camarón de manera tecnificada empezó en India la década de los 80 y la producción se incrementó de forma constante debido a la tecnología de producción en laboratorios implementada por la Autoridad de Desarrollo de las Exportaciones de Productos Marinos (The Marine Products Export Development Authority, MPEDA, por sus siglas en inglés), que impulsó la industria de camarón (Penaeus monodon) e incrementó las exportaciones de India hasta 1994. A partir de 1995, la producción se redujo debido a la caída de los precios, los impuestos antidumping de los países importadores y las enfermedades; por lo que la industria estaba buscando reproductores de P. monodon libres de enfermedades o cualquier otra especie alternativa para recuperar la producción. Esta búsqueda permitió identificar la disponibilidad de Penaeus vannamei libre de patógenos específicos (SPF). La autoridad india aprobó las operaciones de cultivo experimental de la nueva especie y pruebas de producción de postlarvas fueron realizadas en 2003 bajo

condiciones controladas de bioseguridad, así como el engorde por 3-4 ciclos en granjas experimentales. Desde entonces, el cultivo de P. vannamei se ha ido generalizando y en la actualidad más del 95% de las camaroneras se dedican a la producción de esta especie.

Producción de semilla Con estrictas medidas de bioseguridad, el cultivo de camarón blanco se abastece únicamente mediante la importación de reproductores SPF, que a su ingreso son mantenidos en las Instalaciones de cuarentena (Aquatic Quarantine Facility -AQF), y posteriormente en el Centro de Multiplicación de Reproductores (Broodstock Multiplication Centre -BMC), operados por el gobierno de India, en cooperación con el Instituto Oceánico de Hawaii. Tres BMC adicionales están en proceso de construcción y operación; y existen más de 550 laboratorios de larvas, con una capacidad total instalada para producir 100 billones de postlarvas por año, alcanzando en el 2018 una producción efectiva de más

Importaciones de reproductores SPF de P. vannamei en India Fuente: Balasubramaniam V., 2018

16


COYUNTURA

- AGOSTO 2019 de 70 billones, que fue la demanda máxima. Según información proporcionada por D. Ramraj, presidente de la Asociación de Laboratorios de Camarón de India (All India Hatcheries Association-AISHA), debido al exceso de instalaciones para producir semilla, existe una intensa competencia por lograr un espacio en el mercado de la venta de postlarvas, ocasionando una caída en el precio así como en la calidad de la semilla, ya que los costos de producción son elevados y es difícil mantener la calidad con precios de venta por debajo del punto de equilibrio. Mientras que en 2013 el precio del millar de PL se ubicaba cerca de Rs. 700 (rupias), en 2018 cayó a Rs. 400 y en lo que va del 2019 bordea las Rs. 300 (USD 4.28). El principal inconveniente para los productores de postlarvas es el alto costo de los nauplios, ya que los reproductores SPF resultan costosos y deben esperar cupos para poder importarlos y realizar la cuarentena obligatoria antes de su liberación a los centros de cultivo. Existen múltiples facilidades de maduración que operan con una eficiencia por debajo del nivel óptimo, con baja producción de nauplios. A pesar de que el uso de antibióticos en los laboratorios no está permitido, se ha detectado presencia de residuos en las postlarvas, lo que constituye motivo de preocupación. Al momento, existen ciertos inconvenientes durante el cambio de las larvas de zoea a misis, debido a causas que no han sido completamente explicadas, pero que podrían ser ocasionadas por las altas cargas bacterianas presentes en los sistemas de cultivo. También los alimentos vivos en maduración constituyen una entrada de patógenos como el Enterocytozoon hepatopenaei (EHP), por lo que los operadores de maduraciones y laboratorios de larvas buscan alternativas para minimizar los riesgos. Las buenas prácticas en cuanto a los procedimientos de desinfección e higiene deben ser revisadas para mejorar la bioseguridad general.

Componente

Costo USD*/1000 PL

% costo total

Reproductores/nauplios

0.43

12

Artemia

0.43

12

Alimento

0.57

16

Químicos

0.14

4

Sueldos y salarios

0.43

12

Energía y combustibles

0.29

8

Materiales de empaque

0.29

8

Incentivos y bonos

0.43

12

Intereses y depreciación

0.57

16

Total

3.58

100

Estructura de costos para la producción de post larvas en India *1 dólar= 70 rupias Fuente: Ramraj, 2019

Autoridad para el Desarrollo de Exportaciones de Productos Marinos, MPEDA) y pruebas rutinarias de muestras aleatorias realizadas por las autoridades reguladoras (Agencia de Inspección de Exportaciones, EIA).

Cultivo en granjas La Federación de Productores de Camarón de India (PFFI) reporta que el país cuenta con aproximadamente 200.000 hectáreas dedicadas al cultivo del crustáceo. La mayor superficie camaronera se localiza en el estado de Andhra Pradesh1 (63%) seguido por West Bengal2 (11%), Gujarat3 (8%), Orissa4 (7%) y Tamil Nadu5 (5%). India cuenta con alrededor de 153.000 hectáreas de camaroneras bajo lo que

Entre los mecanismos regulatorios para lograr un adecuado suministro de reproductores de calidad, así como el correcto funcionamiento de esta fase de la cadena de producción, se incluye el registro obligatorio con la Autoridad de Acuicultura Costera (CAA), inspecciones de rutina, obligatorias, en los protocolos establecidos por las autoridades (como la

17

denominan “cultivo científico”; es decir, con densidades entre 30-60 animales/ m2, mecanismos de bioseguridad implementados, uso de probióticos y tecnologías apropiadas, como aireadores y alimentadores automáticos. Otras 50.000 ha. son operadas bajo el sistema de cultivo tradicional y con densidades menores; y es probable que existan cientos de granjas que no han sido registradas ni monitoreadas por la autoridad. Adicionalmente, se menciona que existen 1’190.000 ha. con potencial para extender la acuicultura en el país, especialmente el cultivo de camarón, y el gobierno promueve el desarrollo de la actividad como una forma de apoyar a un segmento de la población a salir de la pobreza.


COYUNTURA

- AGOSTO 2019

La producción total en 2016-2018 se vio incrementada debido a la expansión de las áreas de cultivo; sin embargo, el cultivo de camarón indio está entrando en una fase de declive debido a la baja eficiencia de producción. La productividad se ha visto reducida y la tasa media de eficiencia bordea el 60%. El cultivo de camarón solo es rentable en un escenario de precios altos; pero los precios están cayendo, causando preocupación respecto a la sostenibilidad de la industria, por lo que en 2019 la tendencia ha sido reducir densidades u optar por mantener los estanques vacíos. Las enfermedades del camarón son la causa principal de la baja productividad y los bajos rendimientos. El mayor problema reportado es la alta prevalencia de mancha blanca (WSSV), que ocasiona elevadas mortalidades. La enfermedad causada por el microsporidio Enterocytozoon hepatopenaei (EHP) se extiende desenfrenadamente por las áreas de cultivo, provocando un crecimiento lento, lo que reduce significativamente el tamaño de cosecha y aumenta la tasa de conversión de alimento. En los últimos meses, el síndrome de Heces Blancas también afecta gravemente a los cultivos, ocasionando pérdidas a los productores. Hasta la fecha, India no ha reportado oficialmente la presencia de EMS en sus cultivos, así como tampoco de otros patógenos serios. La atención debe centrarse en la prevención de enfermedades y la mejora de la bioseguridad en criaderos y granjas. Adicionalmente, temperaturas extremadamente altas (Andrha Pradesh y Tamil Nadu) y lluvias intermitentes (CiclónFANI) golpean Orissa y Bengala Occidental. La ausencia de lluvias monzónicas a inicios de la estación y las inundaciones de las últimas semanas han afectado gravemente algunas zonas, especialmente en Gujarat y el noreste del país.

Nuevas tendencias en el cultivo de camarón Las medidas de bioseguridad se han incrementado en las granjas. Se utiliza precriaderos para llevar las postlarvas a estadios juveniles y fortalecer la salud en la fase inicial, lo que permite enfrentar mejor las enfermedades y mejorar las supervivencias finales, reduciendo el costo

Producción de camarón cultivado 2011-2020 (*estimados) Fuente: S. Santhana Krishnan, APA19

Índices de producción y productividad 2017 °Densidades medias de siembra: 30 animales/m² °Tamaño promedio de cosecha - 18 gramos °Supervivencia final promedio: 55% °Costo promedio de producción: US $ 4.42 (55-60 animales/kg) Fuente: Balasubramaniam V. (2018)

Productividad en las camaroneras indias 2018-2019 • Área de cultivo: 150.000 ha • Producción total 2017-2018: 700.000TM •Productividad: 4.6 TM/ha/año Cerca del 70% de las fincas realizan 2 cosechas/año •Esfuerzo de cosecha: 250.000 ha • Productividad actual: 2.5 TM/ha/año Densidades de siembra: 40-60 PL/m² dirigido a 6-10 TM/ha/ciclo Alrededor de 5-10% de nuevas granjas de camarones se agregan cada año. Las nuevas áreas y un pequeño porcentaje de estanques viejos continúan produciendo bien: 8-10 TM/ha/ciclo. La producción del área de alto rendimiento podría contribuir con aproximadamente el 40% de la producción total de camarón. La productividad de un gran porcentaje de granjas probablemente sea inferior a 2 TM/ha/ ciclo. Fuente: D. Ramraj (2019)

18


COYUNTURA

- AGOSTO 2019 de producción y aprovechando mejor la época de buenas condiciones climáticas para el cultivo. Para superar los problemas ocasionados por el EHP y el Síndrome de Heces Blancas, se aplica cal a los fondos, se controla la calidad de las semillas y se realiza una desinfección rigurosa de las aguas de origen antes de la siembra. Las piscinas utilizadas para precría en Andhra Pradesh, que produce el 60% del camarón indio, fluctúan entre 1 y 2 ha., en donde se mantienen animales a densidades de 2-3 millones/ha para transferirlos en aproximadamente 35 días a una talla de 3-5 g.

Producción de alimento balanceado Existe una capacidad instalada para producir más de 2’000.000 TM de alimentos para acuacultura. En 2017, la producción superó el millón de toneladas y cada año se están instalando una o dos nuevas fábricas en el país. El aumento del costo de las materias primas constituye una preocupación seria, ya que los productores enfrentan un aumento de la tasa de conversión (debido a problemas mencionados previamente) y un aumento general del costo de alimentación, a pesar de la gran competencia entre productores de balanceados.

Procesamiento del camarón A la fecha, existen 344 plantas procesadoras aprobadas por la UE (fuente MPEDA). Las unidades de procesamiento de camarón en India son aprobadas por el Consejo de Inspección de Exportaciones de la India (EIC), que los clasifica en unidades elegibles para exportar a la Unión Europea y unidades elegibles para exportar a otros países. La Agencia de Inspección de Exportaciones (EIA) y MPEDA están a cargo de controlar las operaciones y desempeño de las procesadoras y el control de calidad del camarón que se exporta. Sin embargo, India afronta numerosos rechazos en los mercados de destino debido a la detección de sustancias controladas por encima de los niveles máximos residuales o la presencia de sustancias prohibidas, especialmente antibióticos.

Aspectos relativos al mercado Los principales mercados del producto lo constituyen Estados Unidos, China y la Unión Europea. Para controlar la calidad de las exportaciones de camarón, India mantiene algunas regulaciones, controladas principalmente por MPEDA, que incluyen el Plan Nacional de Control de Residuos (NRCP), equivalente al Plan Nacional de Control de Ecuador, como un requisito legal para exportar a los países de la UE. Previo a la cosecha, los camaroneros deben realizar un muestreo obligatorio (pre-harvest test, PHT) para confirmar la ausencia de sustancias controladas y posteriormente, un muestreo preembarque (pre-shipping test, PST) para obtener el certificado sanitario emitido por EIA y poder exportar el producto. La industria ha adoptado métodos modernos de manejo y procesamiento, además de medidas de control de calidad adecuadas para mejorar la calidad de los alimentos marinos, como el cumplimiento obligatorio de HACCP para todas las plantas de procesamiento. Fuentes de la industria consideran que el porcentaje de rechazo a sus exportaciones es muy bajo y no debería representar una amenaza para el cierre de mercados. Sin embargo, constituye un grave problema de inocuidad de los alimentos (debido a la utilización de antibióticos específicamente

19


COYUNTURA

- AGOSTO 2019

prohibidos, como cloranfenicol y nitrofuranos), y aunque se detectan en solo el 0,22% de sus exportaciones, constituye una gran preocupación para los exportadores, ya que enfrentan la mayor parte de las pérdidas debido a los rechazos. Las inspecciones al camarón procedente de India se han vuelto más estrictas, en particular en Europa, donde los controles de calidad e inocuidad pasaron del 10% al del 50% de los contenedores que arriban al territorio comunitario y al momento existe una lista de observaciones y no conformidades emitidas por la Dirección General de Salud y Seguridad Alimentaria (DG SANTE) en su última auditoría realizada para verificar las garantías de India ofrece a las exportaciones de camarón, especialmente respecto al control de medicamentos y contaminantes. La disminución de la demanda de las tallas más grandes también representa un problema, especialmente para los productores pequeños y marginales, que en su mayoría prefieren producir animales de gran tamaño, por lo que en el futuro el equilibrio económico de los cultivos podría estar en riesgo. De acuerdo a la PFFI, India puede mantener su récord de producción si logra mejorar la productividad, superar las amenazas de los patógenos existentes y emergentes y también tomar medidas proactivas para garantizar el 100% de cumplimiento de las normativas de seguridad alimentaria. Por ello, consideran positivo que el gobierno esté tomando medidas para sostener la producción, garantizar el cumplimiento de los requisitos de acceso a los diferentes mercados de destino.

Evaluación típica de costos de producción - Cultivo promedio Fuente: S. Santhana Krishnan, APA19

contenedores se envían directamente previo estrictos controles de calidad.

Perspectivas de la industria Debido a las dificultades de producción ya descritos, India muestra mayor susceptibilidad a las fluctuaciones del mercado, ya que los pequeños productores bajo el sistema tradicional (la mayoría) no son capaces de asumir los costos de producción a los precios de venta actuales. Por ello, muchos ven como tendencia futura dar valor agregado a su producto, esforzándose en satisfacer las preferencias del cliente. Los problemas de trazabilidad y seguridad alimentaria juegan un papel importante, ya que los numerosos rechazos en Estados Unidos y Europa han desacreditado la calidad del camarón indio y han hecho que el precio que los importadores están

De acuerdo a NOAA Fisheries, India es el principal proveedor de camarón de los Estados Unidos, donde se prefieren tallas medianas; sin embargo, a decir de los exportadores indios, dicho mercado ha permanecido muy tranquilo desde diciembre de 2018, por lo que esperan un incremento en el 2019. Europa tiene una buena demanda; sin embargo, existe gran preocupación por la presencia de residuos de antibióticos, por lo que no es un mercado al que puedan acceder con facilidad. Por ello, el interés se ha volcado hacia China, destino al que ingresaban por el puerto de Haiphong, pero desde agosto de 2018 los

20

dispuestos a pagar sea menor. Existe una gran necesidad de mejorar los controles de calidad y la tecnología posterior a la cosecha. En este sentido, los voceros de la industria recomiendan aprender de las experiencias de Ecuador y Tailandia en cuanto a los controles sobre el producto y proceso. Por ahora, China es un mercado emergente, pero fuerte para el futuro; por lo que entrarán a competir por el espacio que hasta ahora ha sido logrado por otros países, entre ellos Ecuador. Por ello, los exportadores indios ya están manteniendo reuniones con los importadores chinos a fin de promover la cooperación técnica en producción y procesamiento de camarón, así como el fortalecimiento de las relaciones comerciales de modo que se incrementen las exportaciones de camarón hacia China●


COYUNTURA

- AGOSTO 2019

El manejo de las enfermedades en los cultivos de camarón desde la perspectiva de los especialistas Autor: Yahira Piedrahita Directora Ejecutiva de la Cámara Nacional de Acuacultura Los brotes de enfermedades constituyen la mayor amenaza para el cultivo del camarón a nivel mundial, y para asegurar la sostenibilidad, la industria debe implementar estrategias y planes de acción encaminados a la prevención y control de los patógenos en los sistemas de cultivo. En este artículo se recoge la opinión de tres expertos respecto a la prevención y control de enfermedades y las estrategias recomendadas para que Ecuador pueda seguir desarrollando su industria de forma sostenible.

A

nivel mundial, la mayor amenaza percibida por los actores de la industria la constituyen los patógenos presentes en los cultivos y el riesgo de desencadenar una enfermedad que ocasione mortalidades y grandes pérdidas, de acuerdo con los informes sobre las encuestas a la industria presentados en el GOAL 2018. Una enfermedad es cualquier alteración adversa en el desempeño de la salud o el cultivo de los individuos o la población de camarones, la misma que puede ser infecciosa (ocasionada por agentes patógenos como virus, bacterias, protozoarios, hongos, etc.) o no infecciosa (ocasionada por agentes no transmisibles, como aspectos ambientales,

genéticos, nutricionales, agentes tóxicos, entre otros). Ejemplos claros de los impactos de las enfermedades los hemos sentido en la década de los 90, con el virus de la Mancha Blanca, que representó pérdidas billonarias a la industria a nivel mundial y; en la última década con la enfermedad de la necrosis aguda del hepatopáncreas (AHPND) que ha ocasionado pérdidas estimadas en 7.5 billones de dólares en Asia, dejando a más de 100.000 personas sin empleo (Davies y Shinn, 20161). En ese sentido, revista Aquacultura ha realizado una breve entrevista a tres importantes patólogos para conocer su opinión en diversos aspectos relacionados

Encuesta: Problemas y desafíos en la industria del camarón - Todos los países

Fuente: GOAL 2018

22


COYUNTURA

- AGOSTO 2019 con la situación de las enfermedades que afectan a la industria, sus recomendaciones para el control de patógenos en los cultivos y su opinión sobre el desempeño de Ecuador con relación al modelo de producción que ha seguido a partir de que la mancha blanca azotara al sector camaronero. Los expertos que han contribuido con sus comentarios para la elaboración de este artículo son Arun K. Dhar, director del Laboratorio de Patología Acuática de la Universidad de Arizona, Luis Fernando Aranguren, investigador científico e histopatólogo del mismo centro de diagnóstico y Mohamed Megahed, investigador científico del Instituto Nacional de Oceanografía y Pesquerías de Egipto (NIOF). ¿Cómo ve usted la situación general de la industria camaronera a nivel mundial, en términos de manejo de la salud? ¿Cuáles son las principales amenazas o riesgos?

Fuente: Presentación del Dr. Arun K. Dhar en el Curso Corto de Patología de Camarón 2019. Laboratorio de Patología Acuícola de la Facultad de Ciencias Biomédicas y Animales de la Universidad de Arizona

AKD: Durante las últimas dos décadas, la industria del camarón ha hecho un gran progreso en el desarrollo de herramientas de diagnóstico para detectar enfermedades de manera temprana, lo que ha permitido prevenir la propagación de enfermedades.

(WFD) y la enfermedad de la necrosis aguda del hepatopáncreas (AHPND) son ahora nuevas amenazas, especialmente en el sudeste asiático y debemos tomar medidas para contener la propagación de estas enfermedades emergentes.

A pesar de estos esfuerzos, la industria continúa experimentando pérdidas devastadoras debido a enfermedades y la producción mundial de camarón todavía se ve afectada periódicamente por enfermedades. La disponibilidad de líneas de camarones resistentes a enfermedades y la falta de cualquier tratamiento terapéutico son ahora los cuellos de botella para hacer que la industria sea sostenible. Creo que estas son las dos áreas en las cuales es necesario avanzar mucho en los próximos años y décadas.

LFA: Veo dos situaciones diferentes: por un lado, en Asia, el uso de camarones SPF, el cultivo intensivo (alta densidad de población, etc.) lo convierten en un entorno inestable para la producción de camarones cuando hay presencia de patógenos. Por otro lado, en la mayoría de los países latinoamericanos la densidad de siembra es baja y se cultiva un camarón más adaptado a los patógenos endémicos; lo que hace que la industria del camarón tenga un entorno más predecible y estable.

La enfermedad de la mancha blanca sigue siendo una amenaza para la industria. En general, en algunos países la industria del camarón tuvo un buen desempeño a pesar de la presencia de WSD, mientras que otros países sufrieron mayores pérdidas. La enfermedad ocasionada por el microsporidio Enterocytozoon hepatopenaei (EHP), la enfermedad de las heces blancas

Al momento, los principales riesgos son AHPND y EHP. Según antecedentes históricos, es posible que surja un nuevo patógeno del camarón o vuelva a emerger uno que ya ocasionó problemas anteriormente. MM: La acuicultura del camarón es un contribuyente importante a la economía de muchos países del mundo. La expansión de las áreas de cultivo ha sido mal administrada en muchos países, ya sea que los países

23

hayan dado sus primeros pasos hacia la industria o que tengan una larga historia en el cultivo de camarones. La intensificación de la producción y la introducción de nuevas especies conducen a cambios adversos en la calidad del agua y han aumentado el riesgo de brotes de enfermedades. Por un lado, las enfermedades han aumentado y han sido reconocidas como la principal limitación para el desarrollo del sector del camarón en el mundo. Por otro lado, los altos costos de producción, el acceso al mercado y la competencia entre países han afectado a la industria del camarón en todo el mundo. ¿Cuáles cree que son las opciones de prevención y gestión, y las estrategias que la industria en general debería adoptar? AKD: Creo que el cultivo de camarón de manera sostenible dependerá del desarrollo de instalaciones bioseguras que mantengan líneas de camarones genéticamente superiores para el crecimiento y resistentes o tolerantes a patógenos específicos. La vigilancia efectiva de los patógenos debería ser un componente integral en el


COYUNTURA esquema de producción. El diagnóstico en el punto de atención respaldará aún más el programa de vigilancia de patógenos y, en última instancia, hará que las instalaciones de producción sean bioseguras. LFA: Sí, definitivamente la prevención es el camino a seguir. Sin embargo, las estrategias de prevención y gestión son diferentes en Asia vs. América Latina. También comenzaría a observar la prevalencia de los patógenos del camarón para crear una línea base de cada uno y determinar cuál está impactando realmente en la industria del camarón en los diferentes niveles. MM: La importancia de las prácticas de bioseguridad y gestión de la salud en los criaderos y granjas para mitigar el impacto de las enfermedades ha sido bien reconocida, pero la implementación real no siempre se ha logrado. La implementación de programas de manejo de enfermedades requiere mejorar los servicios de diagnóstico de las enfermedades actuales que afectan a la industria del camarón, así como las prácticas de manejo a nivel de criaderos y granjas. Para tener opciones efectivas de prevención y manejo, se debe cumplir con los siguientes aspectos: •

• •

• •

Los criaderos de camarones y las granjas deberán establecer las mejores prácticas de manejo específicas para cada nivel, para minimizar los impactos de los brotes de enfermedades; Múltiples siembras y cosechas por períodos cortos; Cosecha inmediata ante la aparición de brotes de enfermedades o síntomas de la enfermedad; Brindar capacitación en acuicultura y gestión de la salud de los animales acuáticos a los granjeros; Desarrollo de capacidades en el diagnóstico de enfermedades; Establecer laboratorios de referencia e instalaciones para el diagnóstico de enfermedades; Proporcionar kits de prueba y diagnóstico a bajo costo para aumentar la probabilidad de que los productores diagnostiquen una enfermedad; Proporcionar servicios de diagnóstico local para enfermedades del camarón; y

- AGOSTO 2019 •

Proporcionar enfoques innovadores y servicios de asesoramiento a través de teléfonos inteligentes, para proporcionar servicios veterinarios en línea y soluciones de mitigación para controlar los brotes de enfermedades.

Esto es lo más importante si la industria ecuatoriana trabaja para la producción de sus propias líneas SPR y SPF. Desde su perspectiva, ¿Cómo ve la industria ecuatoriana del camarón? ¿Qué cree que hacemos bien y qué hacemos mal? AKD: Creo que a la industria ecuatoriana del camarón le ha ido bastante bien después del brote de WSD en el pasado reciente. Los esfuerzos para desarrollar líneas de camarones resistentes WSD y tolerantes a enfermedades, y la cría semiintensiva junto con mejores prácticas de manejo de los estanques están dando sus frutos. Sin embargo, tomar medidas para prevenir la introducción de patógenos en las instalaciones de producción ayudará a la industria aún más para mantener el crecimiento de manera predecible. Hay que tener en cuenta que hay muchas enfermedades económicamente importantes en el camarón y es difícil encontrar líneas genéticas de camarón con resistencia/ tolerancia a múltiples patógenos. Sería prudente hacer que las instalaciones de producción sean lo más bioseguras posible y cultivar las líneas de camarón resistentes/ tolerantes en las áreas endémicas de las enfermedades. LFA: Veo una industria madura con amplio conocimiento y experiencia en el cultivo de camarones. En un corto plazo, continuar trabajando mano a mano con las compañías de alimentos que, definitivamente, están brindando soporte técnico y han ayudado a la industria del camarón a crecer de manera sostenible. Mejorar los procedimientos de “bioseguridad básica”; es un requisito. Es posible tener una semilla robusta y limpia al mismo tiempo. En el mediano plazo, es difícil predecir lo que sucederá con la industria del camarón; sin embargo, si no hay un nuevo patógeno emergente, el precio de mercado será uno de

24

los cuellos de botella del negocio. Siendo la alimentación el 40-50% del costo total, creo que se debe hacer esfuerzos para reducir este costo de producción. MM: Desde mi perspectiva, veo que la industria ecuatoriana tiene potencial para mejorar y liderar la industria del camarón en todo el mundo. Esto mediante esfuerzos consolidados en todos los aspectos, comenzando por proporcionar semillas de alta calidad hasta el acceso a los mercados. Adicionalmente, debe tener un programa de capacitación a los productores locales para mejorar sus conocimientos y habilidades, de modo que les permita hacer frente a los rápidos cambios en los sistemas de producción acuícola. Como podemos apreciar, las respuestas de los expertos apuntan siempre hacia las estrategias de prevención de las enfermedades, mediante las buenas prácticas en todas las fases de cultivo, la implementación de medidas de bioseguridad efectivas y el aprovisionamiento de semilla proveniente de reproductores debidamente seleccionados de programas genéticos adecuados a cada modelo de producción. Otro aspecto importante de destacar es la necesidad de implementar herramientas de diagnóstico temprano (en campo) que permitan identificar los patógenos de manera oportuna para tomar decisiones adecuadas y minimizar las pérdidas. En ese sentido, es indispensable la capacitación a los productores y la articulación entre industria y gobierno para el establecimiento de políticas que permitan la vigilancia efectiva del estado de salud de los cultivos y la implementación de mecanismos para evitar la propagación de los patógenos causantes de enfermedades emergentes (barreras sanitarias). A nivel mundial, Ecuador es visto como un modelo interesante de producción de camarón, y los patólogos entrevistados coinciden en que la industria puede continuar desarrollándose de manera sostenible si se mantienen las buenas prácticas en los cultivos y se implementan las recomendaciones aquí planteadas para la prevención y control de patógenos●


COYUNTURA

- AGOSTO 2019

Arun K. Dhar, PhD. Profesor asociado y director del Laboratorio de Patología Acuícola de la Facultad de Ciencias Biomédicas y Animales de la Universidad de Arizona. Ha dedicado gran parte de su carrera profesional a desarrollar diagnósticos, vacunas y terapias orales y marcadores genéticos para la resistencia a las enfermedades virales en camarones y peces. Formó parte del grupo pionero en secuenciar un genoma de virus del camarón (IHHNV), primero en desarrollar diagnósticos basados en PCR en tiempo real para detectar virus del camarón (IHHNV, WSSV, TSV y YHV). También ha participado activamente en la enseñanza y tutoría de estudiantes graduados y de pregrado en varios colegios y universidades en California, Maryland y Massachusetts. El Dr. Dhar ha publicado 70 artículos y ha emitido cuatro patentes.

Luis Fernando Aranguren, PhD. Biólogo Marino con maestría en Patobiología y PhD. en Patobiología y Microbiolo­ gía y Minor en Epidemiología en la Universidad de Arizona bajo la tutoría del Dr. Donald Ligthner. Ha venido trabajando en enfermedades de camarón en los últimos 20 años, y cuenta con amplia experiencia en diagnóstico y estrategias de prevención y control. Fue director del Programa de Salud Animal de CENIACUA por 8 años y Consultor de Bioseguridad del Reino de Arabia Saudi. Desarrolló las dos técnicas de diagnóstico de la hepatopancreatitis necrotizante (NHP) utilizadas por la OIE. Actualmente está a cargo del área de histopatología del laboratorio de Patología Acuícola de la Facultad de Ciencias Biomédicas y Animales de la Universidad de Arizona.

25

Mohamed Megahed, PhD. Investigador científico en el Instituto Nacional de Oceanografía y Pesca (NIOF), Egipto. Consultor de la Unión Africana y Proyectos financiados internacionalmente sobre acuicultura en Egipto. Cuenta con una maestría en genética de peces de la Universidad del Canal de Suez, y una maestría en acuicultura de la Universidad de Gante, Bélgica. Cuenta además con un doctorado en genética y cría de camarones de la Universidad del Canal de Suez. Ha contribuido con 15 libros científicos sobre diferentes aspectos de la acuicultura, especialmente la cría y la genética, 53 documentos de conferencias internacionales, 5 artículos profesionales en revistas internacionales de acuicultura, como Global Aquaculture Advocate, y 13 documentos internacionales de revisión por pares.


RESPONSABILIDAD SOCIAL

- AGOSTO 2019

Responsabilidad social, una tarea de todos Programas y proyectos de RSE en el sector camaronero, se han convertido en un compromiso al talento humano, comunidad y medio ambiente.

L

a Responsabilidad Social Empresarial (RSE) en el sector camaronero ecuatoriano, se ha convertido en un compromiso prioritario, que va enfocado al talento humano, desarrollo de las comunidades de influencia y medio ambiente. En este artículo, presentaremos la RSE que llevan a cabo las empresas acuicultoras con las comunidades vecinas y medio ambiente, implementando programas, proyectos y planes sustentables, enfocados en aspectos sociales, económicos y educativos. Iniciamos este primer recorrido en PRODUMAR, una organización dedicada a la cría y cultivo de camarón desde hace 37 años en el cantón Durán, que en coordinación con la Escuela Superior Politécnica del Litoral a través de la Unidad de Vinculación con la Comunidad, han ejecutado el programa denominado: ‘Fortalecimiento para el desarrollo sostenible del recinto La Unión’. Este programa inició desde hace cuatro años, con la implementación de 21 proyectos que permiten mejorar la calidad de vida de los casi 650 habitantes del lugar.

Ejecutivos de la empresa nos explicaron que desde la fundación de PRODUMAR, la camaronera siempre estuvo en colaboración con las comunidades vecinas, pero desde hace 4 años junto con la ESPOL, ejecutaron un programa de acción integral, eficaz y sostenible. El programa inició, con un censo realizado por la Facultad de Ciencias Sociales y Humanísticas de la ESPOL con apoyo y coordinación de PRODUMAR, que dejó como resultado un informe que detallaba necesidades y prioridades de sus pobladores. “En el levantamiento de información que realizó la ESPOL, uno de los principales problemas que afrontaba la comunidad estaba vinculada al autoestima de su gente, y se comenzó a trabajar con talleres y capacitaciones para emprendimientos”. Resultado de estas capacitaciones, derivó en la formación de un emprendimiento

26

que está en marcha a través de mujeres emprendedoras del recinto La Unión, que dotará de los uniformes a la empresa, denominado “Taller de costura”. También la ESPOL se encuentra capacitando a los moradores para el desarrollo del segundo emprendimiento enfocado en la creación de la “Panadería comunitaria”. En el proyecto de “apoyo a la educación”, PRODUMAR continuará invirtiendo en mejoras de las instalaciones de la escuela “Daniel Torres Ponce”, mientras en su programa “Yo decido vivir & Propósito de vida”, seguirá con talleres de prevención de drogas y alcohol, entre otros. Como dato adicional, se conoció que la empresa ha creado un Comité de Responsabilidad Social Interinstitucional adicionando más actores de la organización, que tiene por objeto continuar y ampliar los programas de impacto social.


RESPONSABILIDAD SOCIAL

- AGOSTO 2019 En nuestro siguiente recorrido, para conocer la Responsabilidad Social Empresarial (RSE), visitamos BioMar, una multinacional dedicada a la producción de alimento balanceado para más de 45 diferentes especies de peces y camarones en más de 80 países. Y es que BioMar ha desarrollado la campaña denominada ¨Sacos Llenos De…¨ la cual busca reducir el impacto negativo de los seres humanos en el medio ambiente. La empresa lleva realizando esta clase de iniciativas desde hace un par de años; esta vez las actividades se están llevando a cabo en Puerto Bolívar provincia de El Oro, pero el objetivo es ejecutarlas en diferentes provincias del país. Pero, ¿En qué consiste esta campaña?, Danny Vélez, Gerente General de BioMar, explicó que este programa se ha dividido en tres partes. 1° “Sacos llenos de diversión”, que consiste en promover la recompra de los sacos utilizados en el alimento y la transformación de estos en madera plástica reciclada, que servirán para la construcción de un parque infantil que será donado a la comunidad de Huaylá en Puerto Bolívar. “El objetivo de la campaña es reciclar 40 toneladas de sacos que serán obtenidos de nuestros clientes en el plazo de un año, que reduciría un total de 120 toneladas de CO2, es decir, que equivale a sacar de circulación 20 carros al año”, dijo. 2° “Sacos llenos de conocimiento”, consiste en charlas de sensibilización sobre el manejo sostenible de los recursos naturales en las comunidades.

Huaylá, la misma que fue realizada en dos modalidades de limpieza, una terrestre y otra fluvial”. La terrestre, recorrió una zona de 2 Km aproximadamente y se recopilaron desechos de las riberas del malecón de Puerto Bolívar y la fluvial se organizó a través de lanchas, donde cubrieron 3.5 Km del estero de Huaylá con el apoyo también de la comunidad, academia y municipio”. Esta campaña “Sacos Llenos De…”, continuará a nivel nacional con el lema: “La sostenibilidad no se habla, se practica”.

Vélez precisó que “en Puerto Bolívar se realizaron estas actividades durante el mes de julio, donde también se sumaron las escuelas, colegios, universidades, asociaciones y entidades públicas de la provincia de El Oro”. 3° “Sacos llenos de cooperación”, tiene la finalidad de realizar iniciativas de conservación ambiental en conjunto con comunidades locales como Plogging y Mingas. A esto, Vélez comentó que “el pasado 2 de agosto se organizó una minga de recolección de desechos en el estero de

27

Cabe mencionar que Antelo & Robaina (2015) sostienen que “la Responsabilidad Social Empresarial es el compromiso continuo de contribuir al desarrollo económico sostenible, mejorando la calidad de vida de los empleados y sus familias, así como la de la comunidad local y de la sociedad en general” (p.59).

En próximas ediciones, se conocerá de otras industrias nacionales del sector acuícola que exponen entre sus prioridades la Responsabilidad Social Empresarial como eje principal de su política de misión y visión●


PATOLOGÍA

- AGOSTO 2019

Detección del parásito amebiano (orden Dactylopodida) en camarón blanco del Pacífico (Litopenaeus vannamei) cultivado Autor: Jee Eun Han Laboratorio de Biomedicina Acuática, Facultad de Medicina Veterinaria, Universidad Nacional Kyungpook, Daegu 41566, República de Corea jehan@knu.ac.kr.

P

aramoeba sp. (sinónimo de Neoparamoeba sp.) es omnipresente, según Feehan et al. (2013), y normalmente es un protozoo de vida libre en agua marina (Dyková et al., 2000). Sin embargo, es el parásito protozoario ameboide más patogénico presente en el cultivo de peces. P. perurans colonizando branquias, lo que resulta en la enfermedad amebiana de las branquias (AGD, por sus siglas en inglés) en los salmónidos criados en granjas, y afecta más notablemente a la industria del salmón del Atlántico de Tasmania (Salmo salar), con pérdidas típicas en el costo de producción del 10-20% (Munday et al., 2001). Hasta ahora, la AGD se ha registrado en 15 especies de peces de 11 géneros diferentes, incluyendo el salmón del Atlántico, salmón coho, trucha arcoiris, salmón Chinook, trucha marrón, rodaballo, lubina, lubina nítida, ayu, lenguado, warehou azul, macarela “caballo”, maragota, tordos y grumos (Adams et al., 2008; Crosbie et al., 2010; Dyková et al., 1995, 1998, 2000; Dyková y Novoa, 2001; Fiskehelserapporten, 2013; Haugland et al., 2017; Karlsbakk et al., 2013; Kent et al., 1988; Kim et al., 2005; Mouton et al., 2014; Munday et al., 2001; Oldham et al., 2016; Stagg et al., 2015).

28

En los peces, la infección por P. perurans provoca reacciones celulares proliferativas en las branquias, incluyendo hiperplasia epitelial, hipertrofia, edema y la formación de vesículas interlamelares, que aparecen como manchas blancas mucosas y placas en la superficie de las branquias (Adams y Nowak, 2001, 2003, 2004). La evaluación patológica macroscópica de branquias ha sido ampliamente utilizada para el diagnóstico de AGD, pero se recomienda realizar un examen histológico posterior, para mejorar la precisión del diagnóstico (Adams et al., 2004). Además, los métodos de diagnóstico molecular basados ​​ en un ensayo de PCR convencional dirigido a la secuencia de subunidades pequeñas de ARNr (ARN de SSU) están disponibles para el diagnóstico de AGD (Wong et al., 2004; Young et al., 2008). Paramoeba spp. (P. branchiphila, P. invadens y P. eilhardi) también se han reportado en algunas especies de crustáceos y equinodermos, como la langosta, cangrejo y el erizo de mar (Bojko et al., 2018; Feehan et al., 2013; Johnson, 1977; Jones, 1985; Jones y Scheibling, 1985; Mullen et al., 2005). En estos huéspedes, las infecciones graves se asociaron con la muerte del huésped,


PATOLOGÍA

- AGOSTO 2019

Fig. 1. Signos graves del camarón Litopenaeus vannamei infectado de manera natural con protozoos ameboides en una granja de recirculación cerrada. Los camarones exhibieron daños graves en las branquias y el caparazón; (A) branquias negras, (B) laminillas faltantes y caparazón erosionado.

lo que resultó en pérdidas económicas significativas. Las infecciones también se reportaron en moluscos bivalvos como el mejillón, pero se consideró que era más probable que sea un ambiente reservorio potencial para este protozoo (Rolin et al., 2016). Hasta ahora, Paramoeba sp. no se ha reportado en infecciones en camarones peneidos. En las últimas tres décadas, el cultivo de camarón se ha expandido rápidamente (FAO, 2006). Esto ha sido una fuente de perturbaciones ambientales significativas, además de oportunidades para el aumento de la patogenicidad de infecciones existentes, de la transmisión rápida de enfermedades, y la exposición a nuevos patógenos (Walker y Mohan, 2009). Este estudio representa el primer reporte del parásito protozoario ameboide en camarón blanco del Pacífico (Litopenaeus vannamei). Camarones infectados con la ameba mostraron apetito reducido, letargo, dificultad respiratoria, caparazón erosionado y branquias ennegrecidas. Bajo el microscopio, las características histopatológicas incluyeron la morfología típica de protozoos amebianos que muestran endoplasma granular con vacuolas, núcleo, parasoma y ectoplasma con pseudopodia. Estas características sugirieron que el parásito está relacionado con el orden Dactylopodida, probablemente una especie de Paramoeba, lo que fue confirmado por

el análisis de secuencia de ARNr de SSU, el ensayo de PCR y la hibridación in situ (ISH). En el camarón, la infección por amebas ha resultado en una mortalidad significativa y pérdidas económicas asociadas. Por lo tanto, los ensayos de diagnóstico de ISH y PCR desarrollados en este estudio pueden proporcionar datos informativos para los productores y pueden usarse como métodos de detección inicial para el protozoo ameboide en camarón.

Materiales y métodos

Muestras de camarones El camarón adulto L. vannamei (promedio de 30 g) mostró reducción del apetito, letargo y dificultad respiratoria en un criadero de camarón anónimo ubicado en Norte América, en 2013. La mortalidad acumulada fue del 62.75% a los 120 días después de la siembra, los camarones enfermos tenían branquias negras, laminillas faltantes y caparazón erosionado, como se muestra en la Fig. 1. A partir de esta data, sospechamos que la infección por hongos fue causada por las especies de Fusarium, que anteriormente ha sido reportada como el agente causante de la enfermedad de branquias negras en crustáceos, como langostino, camarones y langosta (Karthikeyan et al., 2015; Khoa et al., 2004; Lightner y Fontaine, 1975). Sin embargo, se observaron parásitos protozoarios amebianos mediante la

29

observación directa en un portaobjetos húmedo (véase la figura complementaria Fig. S1). Se recogieron muestras de camarones moribundos a intervalos irregulares, se fijaron con AFA de Davidson o etanol al 95%, y examinados adicionalmente por histopatología, PCR e ISH. Examen de histopatología y análisis de secuencia Para el examen de histopatología, las muestras (dos camarones representantes) fijadas con AFA de Davidson se procesaron, se incrustaron en parafina y se seccionaron (4 µm de espesor) utilizando métodos estándar (Lightner, 1996). Después de teñir con hematoxilina y eosina (H&E), se analizaron las secciones mediante microscopía óptica y la gravedad de la infección se calificó de acuerdo con un sistema de clasificación G preestablecido (Lightner, 1996). Ensayo de PCR Para la extracción de ADN, se extrajeron los tejidos branquiales de cada camarón (cinco camarones representes), se conservaron en etanol al 95% y luego se extrajo el ADN usando un kit de tejido QIAamp (Qiagen). Los primers AMOEBA-131F (5′TACCAGGTCCAGACACAGTT) y AMOEBA131R (5′CTGAGGTCTCGTTCGTTATC) fueron diseñados, dirigidos a las secuencias conservadas de los protozoos amebianos (las familias Paramoebidae y Vexilliferidae) disponibles en el GenBank: P. invadens (KC790387.1), N. branchiphila


PATOLOGÍA (HQ132930.1), P. eilhardi (JN202441.1), N. aestuarina (EU331035.1), N. pemaquidensis (EF675607.1) y N. perurans (EU326494.1) para el desarrollo del ensayo de PCR. Las amplificaciones por PCR se realizaron utilizando los siguientes parámetros de ciclo: desnaturalización inicial a 94 °C durante 3 min, seguido de 40 ciclos de 94 °C durante 30 s, 55 °C durante 30 s y 72 °C durante 30 s, y una extensión final a 72 °C durante 7 min. Para probar la especificidad de los primers, se realizaron ensayos de PCR en las plantillas de ADN de tres enfermedades parasitarias de camarones: (1) ADN de un protozoo amebiano que infecta a L. vannamei, colectado en este estudio, (2) ADN de una Perezia sp. microsporidium que infecta a Penaeus monodon, determinado por secuenciación de ARNr SSR (número de acceso GenBank KP825331), y (3) ADN de un Enterocitozoon hepatopenaei que infecta L. vannamei, determinado por secuenciación ARNr SSR (número de acceso GenBank KP759285) (Tabla 1) . Para garantizar que los primers no reaccionaran a los genomas del camarón huésped, se prepararon plantillas de ADN a partir de: (1) L. vannamei (5 muestras) y P. monodon (3 muestras) libres de patógenos específicos (SPF) de Hawaii; Estados Unidos; (2) P. indicus (2 muestras) de Arabia Saudita; (3) P. stylirostris (2 muestras) cultivadas en Nueva Caledonia; (4) Macrobrachium rosenbergii (2 muestras) de Filipinas; (5) cangrejo (7 muestras, especies desconocidas) recolectadas en las cercanías de piscinas de camarón ubicadas en Arabia Saudita; (6) poliquetos (3 muestras), biomasa de Artemia (9 muestras), calamares (2 muestras) y kril (2 muestras). Estas muestras fueron enviadas por varios proveedores comerciales, y las plantillas de ADN se usaron para los ensayos de PCR (Tabla 1). Después de la PCR, los productos purificados de PCR se secuenciaron, y la búsqueda de la similitud significativa con las secuencias en GenBank se realizó utilizando BLAST en el Centro Nacional de Información Biotecnológica (NCBI). Para el análisis filogenético, la secuencia de ARNr de SSU y otras 14 especies de amebas recuperadas

- AGOSTO 2019 Tabla 1 Detalles de muestras usadas para cada test, y resultados del PCR.

Muestras SPF L. vannamei P. monodon P. indicus P. stylirostris Macrobrachium rosenbergii Cangrejos (especies desconocidas) Poliquetos Artemia Calamar Kril L. vannamei con infección de parameba sp. P. monodon con infección de Perezia sp. L. vannamei con infección de EHP

Número de muestras testeadas

Número de PCR testeado positivo

5 3 2 2 2 7 3 9 2 2 5 1 1

0 0 0 0 0 0 0 0 0 0 5 0 0

del GenBank, se alinearon usando ClustalW. El árbol filogenético se reconstruyó utilizando el método de unión de vecinos en el programa MEGA X (Kumar et al., 2018; Saitou y Nei, 1987; Tamura et al., 2004).

la noche a 42 °C. La detección final se realizó con un anticuerpo anti-digoxigenina conjugado con fosfatasa alcalina (Roche) que se visualizó usando nitroblue tetrazolium y 5-bromo-4-cloro-3-indolil fosfato.

Hibridación in situ (ISH) Para el ISH, los productos del PCR se clonaron en el vector TOPO TA (Invitrogen), y se designaron como un clon pAMOEBA-1. Luego, el ADN plasmídico pAMOEBA-1 y los primers (AMOEBA-131F/R), se usaron para generar la sonda génica similar a Paramoeba. La sonda génica se marcó con digoxigenina-11-dUTP (Roche) en una reacción de PCR, según lo descrito por Mari et al. (1998) Después de la PCR, la sonda de ADN marcada con digoxigenina se precipitó con etanol, se volvió a suspender en agua y se almacenó a -20 °C.

Para probar la especificidad, se prepararon 2 secciones de SPF L. vannamei, y el ensayo ISH se realizó como se describió anteriormente.

Las secciones histológicas (dos camarones representantes) fueron examinadas por ISH utilizando los métodos modificados de Mari et al. (1998). Después de la desparafinización, hidratación, digestión de proteinasa K y postfijación, las secciones se superpusieron con 500 μL de solución de hibridación (4 × SSC, 50% de formamida, 1 × solución de Denhardt, 5% de sulfato de dextrano, 0.5 μg/mL ADN de esperma de salmón) que contenía la sonda génica similar a Paramoeba (1 μg/ml). Los portaobjetos se calentaron a 90 °C durante 10 min y se hibridaron durante

30

Resultados y Discusión Examen de histopatología (H&E) El hallazgo más significativo en el examen microscópico de las muestras estudiadas fue la presencia de un parásito amebiano. La infestación por este parásito se encontró principalmente en las branquias, con un grado de severidad G4 (Fig. 2A-C), e hiperplasia extensa, laminillas con puntos y formación de espacios interlamelares. Según el productor, se observó letargo, anoxia y, finalmente, muerte en los camarones infectados, lo que podría estar asociado con el daño a las branquias (órganos respiratorios). La figura 2A muestra el núcleo de la ameba con un núcleo anfifílico rodeado por un anillo basófilo irregular, y el parasoma con citoplasma eosinófilo y vacuolas, indicando que la ameba está estrechamente relacionada con los miembros del orden Dactylopodida, y tal vez el género Paramoeba, según Sühnel y col. (2014)


PATOLOGÍA

- AGOSTO 2019 Además, se observaron formas de trofozoíto plano y de forma irregular con predominantemente radiación de pseudopodios (aproximadamente 25-30 μm de diámetro). La presencia de pseudopodios digitados, la falta de quistes (menos de 10 μm de diámetro) y el hábitat marino también identifican a la ameba como el género Paramoeba, según Kent et al. (1988). Estos parásitos amebianos también se observaron en otros órganos, como la glándula antenal, el órgano linfoide, el epitelio cuticular y el subcutis de los apéndices y el tejido conectivo que rodea el cordón nervioso ventral de las muestras analizadas, con un grado de gravedad G1 – G4 (Fig. 2D– G). Prueba de PCR y análisis de secuencia Se detectaron amplicones fuertes (131 pb) en los camarones testeados (cinco muestras representativas), mediante el ensayo de PCR dirigido a la secuencia de ARNr de SSU (Fig. 3). Según los resultados BLAST, la secuencia de nucleótidos era 100% idéntica a las secuencias de Paramoeba sp. (Neoparamoeba sp.) de varias especies de crustáceos marinos y equinodermos; P. branchiphila aislada de erizos de mar moribundos (HQ132930), P. invadens aislados de erizo de mar moribundo (KC790387.1) y P. eilhardi aislado de la langosta occidental de Long Island Sound (AY686575.1). La secuencia de nucleótidos del camarón infectante de amebas parecidas a (Paramoeba sp.) se depositó recientemente en el GenBank (número de acceso KU852700). No hubo reacción cruzada con el ADN genómico de los camarones L. vannamei y otros camarones (P. monodon, P. indicus, L. stylirostris y M. rosenbergii), poliquetos, calamares y Artemia spp., ni a otros parásitos de camarón, por la prueba de especificidad (Tabla 1). La evidencia molecular de Feehan et al. (2013) sugiere que las secuencias de ARNr de SSU están altamente conservadas dentro del orden Dactylopodida. Además,

Fig. 2. La infección de la ameba (Paramoeba sp.) se encontró en varios tejidos mediante un examen histopatológico y la hibridación in situ. Tinción de Mayer-Bennett con hematoxilina-eosina-floxina; (A), (B) y (C) la branquia, (D) glándula antenal, (E) las áreas subcuticulares, (F) el epitelio cuticular y (G) el perineuro. Por hibridación in situ con una sonda génica marcada con digoxigenina, el precipitado azul oscuro indica la presencia del parásito (H) dentro de la glándula antenal. Protozoo ameba aplanada y de forma irregular, formas de trofozoítos (diámetro de aproximadamente 25-30 μm; flecha negra), formas similares a quistes (diámetro inferior a 10 μm; flecha negra) y aumento de trofozoitos mostrando endoplasma granular con (V) vacuolas, núcleo (N), parasoma (PS) y ectoplasma con pseudopodia (PP). Barras de escala = 30 μm. (Para la interpretación de referencias de colores en esta leyenda de la figura, se remite al lector a la versión web de este artículo).

31


PATOLOGÍA

- AGOSTO 2019

dentro del orden Dactylopodida, los géneros Neoparamoeba y Paramoeba podrían ser sinónimos, e incluso estos no pueden diferenciarse en función de su morfología (Dyková et al., 2005; Feehan et al., 2013; Young et al., 2007). De manera similar al estudio anterior, la ameba identificada parecida a (Paramoeba sp.) no pudo diferenciarse de otras especies, como Korotnevella sp. y Pseudoparamoeba sp. (orden Dactypopodida) por el análisis de secuencia de ARNr de SSU, aunque mostró características distintas de Paramoeba sp. En el examen histopatológico. También realizamos un estudio filogenético para investigar la relación entre la especie identificada parecida a Paramoeba sp. en camarón, y otras especies de amebas. En el árbol, la secuencia de ARNr de SSU de la parecida a Paramoeba sp. (KU852700.1) se agrupó junto con secuencias del orden Dactylopodida, especialmente la familia Paramoebidae, como P. eilhardi (MH535953.1, JN202438.1), P. branchiphila (KY465844.1), P. invadens (KY465830. 1, KC790385.1), P. atlantica (JN202436.1), Korotnevella venosa (KU681502.1), K. stella (KU681501.1), K. heteracantha (KU681500.1) y K. jeppesenii (KP719185 .1) (véase la figura suplementaria S2). Hibridación in situ (ISH) El método ISH también se puede utilizar para determinar los agentes etiológicos de infecciones de protozoos. Para ISH, se generó la sonda génica para la especie parecida a Paramoeba (amplicon de 131 pb) a partir de la secuencia de ARNr de SSU la ameba que infecta al camarón, y esto se hibridó con las células amebianas en la muestra representativa (Fig. 2H), correspondiente a los resultados histopatológicos. La sonda parece ser altamente específica, y no se observó reacción en ninguno de los tejidos preparados a partir de camarones SPF (no se muestra data). Hasta ahora, el parásito protozoario ameboide Paramoeba sp. se ha reportado en varios crustáceos marinos, incluyendo la langosta americana y el cangrejo, pero no en camarones cultivados. Este estudio

Fig. 3. Ensayo de PCR dirigido a las secuencias de subunidades de ARNr. Amplificaciones potentes (131 pb) con ADN de tejidos branquiales de camarón infectado por Paramoeba sp. (Carriles 1-5), camarón libre de patógenos específicos (Carril 6), control sin plantilla (Carril 7) y 1 -kb Plus Escalera de ADN (Carril M).

revela la infección del parásito protozoario amebiano parecido a Paramoeba sp., en branquias de L. vannamei cultivado en un criadero anónimo, ubicado en una región estadounidense. Es muy probable que la infección por la ameba se deba a factores de estrés, como el aumento de la temperatura del agua y/o a altas salinidades, combinado a la alta densidad de animales en los estanques, lo que proporciona una ventaja a este protozoo presente de forma natural en el medio marino (Bridle et al., 2010; Nowak, 2007; Wright et al., 2015). Según los productores, la salinidad había disminuido de 34 a 10 ppt debido a un rociador roto al inicio del cultivo del camarón estudiado, por lo que asumimos que el estrés provocó la infección del parásito en el camarón. Este estudio proporciona datos informativos a los productores de camarones y los ayuda a monitorear la infección por amebas en

32

camaroneras. En los camarones examinados, los parásitos tienen características histológicas de Paramoeba sp., pero no se detectaron bandas de PCR para los primers generados a partir de P. perurans, P. pemaquidensis o P. branchiphila spp. (Crosbie et al., 2010; Dyková et al., 2005; Young et al., 2008). Por lo tanto, asumimos que podría ser una nueva especie de Paramoeba infectando camarón. Se necesita trabajos adicionales para diagnosticar la especie y desarrollar métodos de diagnóstico específicos de la especie de la ameba que infecta el camarón●

Este es un extracto del artículo original, para mayor información escriba a: jehan@knu.ac.kr


NUTRICIÓN

- AGOSTO 2019

Potenciador de palatabilidad funcional para mejorar el crecimiento, morfología intestinal y actividad de la proteasa del hepatopáncreas en dietas del camarón blanco, Litopenaeus vannamei, reemplazando la pasta de calamar Autores:

L

Tingting Zhu1 Sofia Morais2 Jiaxiang Luo1 Min Jin1 You Lu1 Yirong Le3 Qicun Zhou1 Laboratorio de Nutrición de Peces y Mariscos, Escuela de Ciencias Marinas, Universidad de Ningbo, Ningbo, China 1

Lucta S.A., División Bellaterra, España 2

de

Innovación,

Lucta (Guangzhou) Flavors Co. Ltd., División de Aditivos Alimentarios, Guangzhou, China 3

sofia.morais@lucta.com

os crustáceos utilizan varios sistemas quimiosensoriales sofisticados para identificar y orientarse hacia los alimentos, así como para evitar depredadores o encontrar pareja en entornos acuáticos que son químicamente complejos (ricos en diversos productos químicos disueltos) y con baja visibilidad (Derby y Sorensen, 2008). Por lo tanto, las señales químicas son esenciales para regular el comportamiento de alimentación, y atrayentes y estimulantes de alimentación se usan comúnmente en el cultivo de camarón para promover la identificación y el consumo rápido de alimento. Además, estos productos permiten maximizar la ingesta y reducir el desperdicio de alimento, disminuyendo así los costos de producción y la carga orgánica ambiental (Lee y Meyers, 1996; Tantikitti, 2014). Esto se vuelve aún más importante ante la tendencia de producir dietas con menor cantidad de harina de pescado, que tradicionalmente ha sido un ingrediente clave en el cultivo intensivo de camarón, debido a su alta calidad nutricional y palatabilidad. Sin embargo, la harina de pescado ahora se está convirtiendo en un ingrediente de uso más limitado como resultado de la disminución de poblaciones naturales de peces, el aumento de la demanda de una industria acuícola en rápido crecimiento, la escalada de costos y la volatilidad del mercado (Organización de las Naciones Unidas para la Agricultura y la Alimentación, 2018; Banco Mundial, 2013).

34

Como resultado, niveles crecientes de harina de pescado en dietas están siendo reemplazados por ingredientes alternativos, principalmente de origen vegetal, lo que puede dar como resultado un alimento menos sabroso para el camarón y una disminución del rendimiento animal (Nunes, Sá, AndriolaNeto y Lemos, 2006; Tantikitti, 2014; Yue et al., 2012). Por lo tanto, se ha sugerido que se debe prestar más atención a la investigación y el desarrollo de potenciadores de palatabilidad, o suplementos para mejorar el rendimiento del crecimiento en las dietas de origen vegetal (Gatlin III y Li, 2008). Los atrayentes y estimulantes del consumo de alimento más comunes son los subproductos de la pesca (por ejemplo, hidrolizados de peces o del procesamiento industrial de calamar) ricos en aminoácidos libres, aminas y nucleótidos, entre otras moléculas de bajo peso molecular y solubles en agua/etanol, que son bien conocidos como quimioestimulantes para el camarón (Carr y Derby, 1986; Deng, Ju, Dominy, Bechtel y Smiley, 2013; Gray, Forster, Dominy, Ako y Giesen, 2009; Nunes et al., 2006). Sin embargo, tales productos a menudo tienen disponibilidad limitada o fluctuante, y costo, composición y calidad variable, debido a la estacionalidad y/o poco control sobre las condiciones de procesamiento, particularmente en el caso de industrias locales de procesamiento de pescado a pequeña escala.


NUTRICIÓN

- AGOSTO 2019 El calamar es uno de los productos pesqueros comerciales más importantes del mundo, se estima que alrededor del 40-52% de su peso corporal total termina como desecho de procesamiento o subproducto, incluyendo su tinta, la pluma, piel, hígado y vísceras (Joseph, Prabhu y Madhavan, 1987; Lian, Lee y Park, 2005).

de 300 L, con 30 individuos por tanque, y se asignaron al azar tres tanques réplica a cada grupo de tratamiento. Los camarones fueron alimentados manualmente entre el 6 y el 8% del peso por día, tres veces al día, a las 7:00 a.m., 12:00 p.m. y 7:00 p.m., y el alimento no consumido, heces y las mudas fueron eliminadas mediante sifoneo antes de la comida de la mañana. Se suministró aireación continua a cada tanque para mantener el oxígeno disuelto a > 6.0 mg/L, y la temperatura del agua varió entre 27 y 35 °C, el pH fue de 7.5 a 8.1 y la salinidad de 24.7 a 29.1 durante la prueba de alimentación. El nivel de nitrógeno amoniacal se controló y ajustó diariamente a < 0.05 mg/L por recambios de agua filtrada. La salinidad, pH, el nitrógeno amoniacal y el oxígeno disuelto se midieron usando un YSI Proplus (YSI, Yellow Springs, OH).

Se probaron siete dietas: la dieta base sin suplementación (control), dos dietas suplementadas con pasta visceral de calamar (Ningbo Tech-Bank Aqua Feed Co., Ltd.) al 1 o 3% (S1 y S3), dos dietas suplementadas con pasta visceral de calamar al 1% y un potenciador de palatabilidad (PE, Lucta Guangzhou Flavors Co. Ltd.) al 0.1 o 0.15% (S1+PE0.1 y S1+PE0.15) y finalmente, dos dietas suplementadas solo con el potenciador de palatabilidad al 0.1 o 0.15% (PE0.1 y PE0.15).

Se ha demostrado que la harina de calamar tiene propiedades atrayentes y estimulantes de crecimiento en el cultivo de peces y camarón, lo que se atribuye a la presencia de péptidos pequeños, ciertos aminoácidos Las dietas fueron isoproteicas e isolipídicas, libres y betaína (Lian et al., 2005; Nunes et con la incorporación de pasta visceral de al., 2006), y los subproductos de calamar calamar equilibrada con harina de soya y una generalmente tienen un alto contenido mezcla 50:50 de aceite de pescado y aceite proteico. La pasta de calamar, producida de soya, que son ingredientes comúnmente a partir de vísceras de calamar (incluido el utilizados en formulaciones prácticas en hígado), mediante cocción a baja temperatura China. y/o fermentación, concentración y secado (X. Li, 2017), se usa muy comúnmente en China El potenciador de palatabilidad contiene como atrayente y estimulante del consumo Dietas experimentales fuentes concentradas de aminoácidos y en alimento balanceado para acuicultura. Se formuló una dieta base, como se indica en nucleótidos, incluidos extractos de levadura la Tabla 1, para contener aproximadamente e hidrolizados de proteínas de origen vegetal, El objetivo de este estudio fue evaluar la 43% de proteína cruda y 8% de lípido crudo. entre otros agentes saborizantes, pero aplicación de un potenciador de palatabilidad que contenga fuentes seleccionadas de Tabla 1: Formulación y composición proximal de dietas experimentales. aminoácidos y nucleótidos, entre otras Ingredientes: (%) Control S1 S3 S1+PE0.1 S1+PE0.15 PE0.1 PE0.15 sustancias saborizantes, ninguna de Harina de pescado a 20.00 20.00 20.00 20.00 20.00 20.00 20.00 origen animal, como una alternativa para a 25.00 24.16 22.48 24.16 24.16 25.00 25.00 reemplazar o reducir sustancialmente la Harina de soya a Concentrado de proteína de soya 5.00 5.00 5.00 5.00 5.00 5.00 5.00 inclusión de pasta visceral de calamar en alimento para camarón blanco, Litopenaeus Harina de subproductos avícolas a 5.00 5.00 5.00 5.00 5.00 5.00 5.00 vannamei, evaluando el rendimiento del Harina de trigo a 29.05 29.05 29.05 29.05 29.05 29.05 29.05 crecimiento y otros parámetros relacionados Harina de maní a 8.00 8.00 8.00 8.00 8.00 8.00 8.00 durante un ensayo de alimentación. Aceite de pescado a

0.89

0.82

0.68

0.82

0.82

0.89

0.89

Materiales y métodos

Aceite de soya

0.89

0.82

0.68

0.82

0.82

0.89

0.89

Organismos y prueba de alimentación El camarón blanco L. vannamei, se obtuvo del Centro de Reproducción de Henma en Zhejiang, China, y se sembró en un sistema de agua de flujo interior en la base de Innovación en Ciencia y Tecnología Marina y Pesquera de Ningbo, provincia de Zhejiang, China. Antes del inicio de la prueba, que duró 8 semanas, los organismos se aclimataron al sistema de cultivo y se alimentaron con un balanceado comercial para camarón juvenil (42% de proteína cruda, 8% de lípido crudo; Evergreen Aqua Feed Company, Guangdong, China) por 2 semanas. Posteriormente, se distribuyeron aleatoriamente 630 camarones sanos de tamaño similar (peso corporal promedio inicial: 0.90 ± 0.01 g) en tanques

Lecitina de soya a

2.00

2.00

2.00

2.00

2.00

2.00

2.00

b

Suplementos vitamínicos

a

Suplementos minerales a

1.00

1.00

1.00

1.00

1.00

1.00

1.00

2.00

2.00

2.00

2.00

2.00

2.00

2.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00

Celulosa a

0.17

0.15

0.11

0.05

0.00

0.07

0.02

Pasta de calamar a

0.00

1.00

3.00

1.00

1.00

0.00

0.00

Potenciador de palatabilidadc

0.00

0.00

0.00

0.10

0.15

0.10

0.15

11.96

12.72

12.09

12.46

12.84

12.71

13.03

Ca(H2PO4)2a

Composición aproximada (%) Humedad

43.64

43.47

43.14

43.47

43.47

43.64

43.64

Lípido

8.01

7.99

7.96

7.99

7.99

8.01

8.01

Ceniza

9.70

9.75

9.79

9.81

9.92

9.80

9.79

Proteína

Suministrado por Ningbo Tech-bank Aqua feed company, Ningbo, China. Suministrado por Kerry grain and oil Co., Ltd. Shanghai, China. c Suministrado por Lucta Co., Ltd. Guangzhou, China. a

b

35


NUTRICIÓN

- AGOSTO 2019

su valor nutricional puede considerarse insignificante para los bajos niveles de inclusión probados. Todos los ingredientes secos se molieron para obtener un polvo fino con tamaño de partícula < 177 μm y se mezclaron completamente en un mezclador tipo Hobart. Los microcomponentes se formularon luego utilizando el método de ampliación progresiva y se mezclaron. Se añadió a los ingredientes secos premezclados, lípidos y agua destilada, y se mezclaron hasta homogeneidad en un mezclador tipo Hobart. Se produjeron pellets extruidos en frío usando una extrusora de doble tornillo (F26, Fábrica General de Ciencia y Tecnología de la Universidad Tecnológica del Sur de China, Guangzhou, China), y los hilos de los gránulos se cortaron en dos tamaños de pellets uniformes (1.5 mm de diámetro/2.0 mm de longitud y 2.0 mm de diámetro/3 mm de longitud) utilizando una máquina de granulación (G-250, Fábrica General de Ciencia y Tecnología de la Universidad Tecnológica del Sur de China, Guangzhou, China). Los pellets se cocieron al vapor durante 30 minutos a 90 °C, seguido de un secado al aire hasta aproximadamente 100 g/kg de

humedad. Las dietas experimentales se almacenaron en congeladores a -20 °C en bolsas empaquetadas al vacío antes de usarse en las pruebas de alimentación.

histológico del intestino. Los organismos restantes se almacenaron a -20 °C para determinar la composición proximal de todo el cuerpo y del músculo.

Muestreo y análisis Cada 2 semanas, los camarones se pesaron a granel y se contaron en cada tanque replicado para monitorear el crecimiento y la supervivencia, y al final de 8 semanas, los organismos se pusieron en ayunas durante 24 horas antes del muestreo. Luego, todos los camarones se pesaron a granel y se contaron en cada réplica de tanque para determinar la supervivencia, el aumento de peso, la tasa de crecimiento específica, el factor de conversión alimenticio y la relación de eficiencia de proteínas durante la prueba.

El análisis proximal del contenido de materia seca, proteína cruda, lípidos crudos y cenizas en dietas y muestras de todo el cuerpo y músculo, se determinó de acuerdo a los métodos de la Asociación de Químicos Analíticos Oficiales (Asociación de Químicos Analíticos Oficiales (AOAC), 1995). Las muestras de alimento y tejido se secaron a un peso constante a 105 °C para determinar el contenido de materia seca.

El índice hepatosomático y el factor de condición se determinaron a partir de mediciones individuales de tres camarones por tanque midiendo la longitud total y pesando el animal entero o el tejido del hepatopáncreas extraído. Se diseccionó tejido intestinal y del hepatopáncreas de dos lotes de ocho camarones por tanque, uno para cada tipo de análisis, para luego almacenarlos a -80 °C para la determinación de las actividades de enzimas digestivas en el hepatopáncreas y el intestino, o se fijaron para el análisis

Los contenidos de proteína cruda (N × 6.25) se analizaron mediante el método de combustión Dumas utilizando un analizador de proteínas (FP-528, LECO), y los lípidos crudos se midieron mediante el método de extracción con éter de petróleo utilizando un Sistema Soxtec HT (SX360, OPSIS, Suecia). Finalmente, se determinó el contenido de cenizas después de una quema en un horno de mufla a 550 °C durante 8 h. Las actividades enzimáticas de la lipasa y la proteasa, así como el contenido total de proteínas, se analizaron en el hepatopáncreas e intestino de ocho camarones por tanque de un lote de animales.

Tabla 2: Rendimiento del crecimiento (aumento de peso y tasa de crecimiento específico), ingesta de alimento, eficiencia alimenticia (índice de conversión alimenticia e índice de eficiencia proteica), índice hepatosomático y supervivencia al final de la prueba de 8 semanas (media ± SEM, n = 3) Control

Peso inicial (g) Aumento de peso (%)

a

SGR (%/día)b Ingesta de alimento (g/ camarón)

S1

S3

S1+PE0.1

0.91 ± 0.00

0.90 ± 0.00

0.90 ± 0.00

581.51 ± 16.99a

615.90 ± 18.60ab

602.95 ± 18.16ab

3.37 ± 0.04a

3.45 ± 0.05ab

0.90 ± 0.00 654.31 ± 5.28b

3.42 ± 0.04ab

3.54 ± 0.01b

9.84 ± 0.02ab

S1+PE0.15

PE0.1

PE0.15

0.90 ± 0.00

0.90 ± 0.01

0.89 ± 0.01

637.76 ± 20.59ab

603.42 ± 26.20ab

653.28 ± 10.30b

3.42 ± 0.07ab

3.54 ± 0.02b

3.50 ± 0.05ab

9.52 ± 0.08a

10.21 ± 0.19b

10.04 ± 0.08ab

10.04 ± 0.24ab

10.25 ± 0.32b

10.36 ± 0.12b

FCRc

1.90 ± 0.09

1.87 ± 0.05

1.89 ± 0.08

1.75 ± 0.01

1.75 ± 0.03

1.99 ± 0.15

1.87 ± 0.07

PER

1.21 ± 0.06

1.22 ± 0.03

1.22 ± 0.05

1.31 ± 0.01

1.31 ± 0.02

1.16 ± 0.09

1.23 ± 0.04

HSI (%)e

3.76 ± 0.11

4.13 ± 0.19

3.91 ± 0.07

3.94 ± 0.36

4.28 ± 0.24

3.66 ± 0.24

4.09 ± 0.20

0.59 ± 0.02

0.59 ± 0.01

0.57 ± 0.02

0.54 ± 0.04

0.56 ± 0.02

0.59 ± 0.02

0.58 ± 0.01

92.22 ± 4.44

96.67 ± 3.33

94.44 ± 2.94

93.33 ± 1.92

98.89 ± 1.11

92.22 ± 4.01

92.22 ± 2.22

d

CF (g/cm )

3 f

Supervivencia (%)

g

NOTA: Las medias en la misma fila con superíndices diferentes son significativamente diferentes (evaluadas por la prueba LSD de Fisher; p < .05). Abreviaturas: CF, factor de condición; FCR, factor de conversión alimenticia; HSI, índice hepatosomático; PER, índice de eficiencia proteica; SGR, tasa de crecimiento específico a aumento de peso (%) = 100 × (Wf - Wi)/Wi b SGR, %/día = 100 × (ln Wf - ln Wi)/día. c FCR = alimento consumido (g, peso seco) / aumento de peso (g, peso húmedo). d PER = aumento de peso (g, peso húmedo) / ingesta de proteína (g, peso seco). e HSI,% = 100 × peso húmedo del hígado (g) / peso húmedo del cuerpo (g). f CF, g / cm3 = 100 × peso húmedo corporal (g) / longitud corporal (cm)3. g Supervivencia (%) = 100 × (número final de organismos) / (número inicial de organismos)

36


NUTRICIÓN

- AGOSTO 2019 Tabla 3: Composición proximal del cuerpo entero y músculo, al final de la prueba de 8 semanas (media ± SEM, n = 3) Control

S1

S3

S1+PE0.1

S1+PE0.15

PE0.1

PE0.15

Composición de cuerpo entero Materia seca (%)

23.03 ± 0.44

23.51 ± 0.34

23.09 ± 0.35

23.31 ± 0.07

23.05 ± 0.42

23.69 ± 0.33

23.94 ± 0.26

Proteína (% peso húmedo)

17.71 ± 0.30

17.72 ± 0.20

17.55 ± 0.42

18.19 ± 0.62

18.04 ± 0.32

1.80 ± 0.02

1.77 ± 0.05

1.91 ± 0.08

1.74 ± 0.06

3.51 ± 0.04

3.51 ± 0.07

3.44 ± 0.11

3.59 ± 0.11c

17.98 ± 0.33

18.32 ± 0.28

Lípidos (% de peso húmedo)

1.84 ± 0.07

1.81 ± 0.11

Ceniza (% peso húmedo)

3.42 ± 0.03

abc

3.29 ± 0.12

1.80 ± 0.02 ab

3.23 ± 0.02

a

bc

bc

abc

Composición muscular Materia seca (%)

24.14 ± 0.04

24.63 ± 0.08

24.35 ± 0.08

24.24 ± 0.35

24.24 ± 0.12

24.20 ± 0.06

24.77 ± 0.23

Proteína (% peso húmedo)

21.80 ± 0.03

22.03 ± 0.05

21.77 ± 0.10

21.61 ± 0.24

21.68 ± 0.09

21.62 ± 0.08

21.98 ± 0.11

Lípidos (% de peso húmedo)

1.03 ± 0.04

1.03 ± 0.08

0.96 ± 0.06

0.94 ± 0.07

0.92 ± 0.10

0.96 ± 0.02

1.05 ± 0.02

Ceniza (% peso húmedo)

1.71 ± 0.06

1.75 ± 0.01

1.68 ± 0.06

1.60 ± 0.07

1.71 ± 0.02

1.58 ± 0.04

1.74 ± 0.05

Nota: Las medias en la misma fila con superíndices diferentes, son significativamente diferentes (evaluadas por la prueba de Fisher; p < .05)

Las muestras del mismo tejido y tanque se agruparon y homogeneizaron en hielo en 9 vol (peso: vol) de solución salina fisiológica enfriada con hielo y luego se centrifugaron a 10.000 rpm durante 10 minutos a 4 °C. El sobrenadante se recogió en un tubo estéril nuevo y fue utilizado para análisis de la actividad enzimática. Las actividades de la proteasa y lipasa se midieron como un cambio en la absorbancia, utilizando kits de reactivos de diagnóstico del Instituto de Bioingeniería Nanjing Jiancheng (China), siguiendo las instrucciones del fabricante. La actividad de la lipasa se determinó midiendo los ácidos grasos liberados por hidrólisis enzimática de triglicéridos en una emulsión estabilizada de aceite de oliva (Borlongan, 1990; Z. L. Jin, 1995). Según este método, las emulsiones preparadas a partir de triglicéridos aparecen opacas dado que las micelas absorben y dispersan la luz incidente, mientras que la hidrólisis a través de la acción de la lipasa divide las micelas y disminuye la turbidez a una velocidad que se correlaciona con la actividad de la lipasa. Una unidad de actividad de lipasa se definió como 1 μmol de sustrato consumido por minuto, por g de proteína de tejido, a 37 °C. La actividad de proteasa se analizó de acuerdo con el método de Lowry, Rosebrough y Farr (1951) usando reactivo de fenol Folin y caseína como el sustrato. Se preparó una curva de calibración de absorbancia a 440 nm usando tirosina como estándar, y una unidad de actividad de proteasa se definió como el número de micromoles de tirosina liberados por minuto, por mg de proteína,

a 37 °C. El contenido total de proteína del sobrenadante se determinó utilizando el método de azul brillante de Coomassie, siguiendo el procedimiento estándar. Se diseccionaron muestras intestinales (intestino medio) de ocho camarones por tanque de un segundo lote de animales, y se fijaron segmentos (0.5–1.0 cm) en paraformaldehído al 4%. Después de la fijación, el tejido intestinal se embebió en parafina y luego, se tomaron secciones en serie y se tiñeron con hematoxilina-eosina (H&E) utilizando técnicas histológicas estándar. Los cortes histológicos se examinaron para determinar los parámetros de morfología intestinal bajo un microscopio óptico (Olympus, DP72). Las imágenes electrónicas se analizaron adicionalmente utilizando el software ImageJ (NIH, Bethesda, MD; Schneider, Rasband y Eliceiri, 2012) para medir las dimensiones de la altura del pliegue intestinal, del ancho del pliegue y la altura de las microvellosidades, que se tomaron con un aumento de ×100, ×200 y ×400, respectivamente. Se tomaron diez medidas para cada animal.

Análisis estadístico Los resultados se presentan como medias con el SEM y se analizaron utilizando un análisis de varianza de un factor seguido de la prueba LSD de Fisher, utilizando GraphPad Prism 6.01 (GraphPad Prism Software Inc., San Diego, CA). El nivel de significancia se estableció en p <.05.

37

Resultados Crecimiento, rendimiento alimenticio y supervivencia La suplementación del 1% de pasta visceral de calamar con 0.1% de PE (S1+PE0.1) o el reemplazo total de pasta visceral de calamar con 0.15% de PE (PE0.15), mejoró significativamente el crecimiento, evaluado por el aumento de peso (%) y la tasa de crecimiento específico (%/día), sobre el control no suplementado (Tabla 2). Además, se midió una ingesta de alimento significativamente mayor, por camarón, en los tratamientos S1, PE0.1 y PE0.15 en comparación con el control. Por otro lado, no se observaron diferencias significativas entre los tratamientos en términos de eficiencia alimenticia (factor de conversión alimenticia o índice de eficiencia proteica), índice hepatosomático, factor de condición o supervivencia al final del período experimental (Tabla 2). Composición proximal del cuerpo y músculo En general, la composición proximal del cuerpo y del músculo de camarones no se vio afectada significativamente por los tratamientos. La única excepción fue el contenido de cenizas del cuerpo, que se redujo significativamente en el tratamiento S3 en comparación con S1+PE0.1, S1+PE0.15 y PE0.15, y también se redujo significativamente en S1 en comparación con PE0.15 (Tabla 3). Actividad de lipasa y proteasa en hepatopáncreas e intestino del camarón La actividad de la proteasa (U/mg) en el hepatopáncreas aumentó significativamente


NUTRICIÓN

- AGOSTO 2019

Tabla 4: Actividad de la lipasa (U/g de proteína) y proteasa (U/mg proteína) en el intestino y el hepatopáncreas de camarones alimentados con las dietas experimentales al final del ensayo de 8 semanas (media ± SEM, n = 3) Control

S1

S3

S1+PE0.1

S1+PE0.15

PE0.1

PE0.15

118.42 ± 8.62

145.11 ± 38.85

181.94 ± 9.33

132.02 ± 36.18

99.61 ± 8.21

117.09 ± 13.25

132.44 ± 28.04

Intestino Lipasa Proteasa

120.51 ± 14.62

95.91 ± 35.70

97.67 ± 27.40

94.57 ± 23.36

83.96 ± 24.41

82.27 ± 6.55

Hepatopáncreas

85.30 ± 15.43

Lipasa

165.41 ± 7.22

197.99 ± 47.40

171.03 ± 30.26

170.45 ± 19.70

187.38 ± 40.59

207.36 ± 13.57

239.76 ± 25.14

Proteasa

181.74 ± 6.17a

196.03 ± 14.91ab

236.92 ± 14.95abc

230.18 ± 21.39abc

257.31 ± 5.97c

245.88 ± 25.61bc

244.20 ± 21.79bc

Nota: Las medias en la misma fila con superíndices diferentes, son significativamente diferentes (evaluadas por la prueba LSD de Fisher; p < .05)

en el tratamiento S1+PE0.15 en comparación con el control o la dieta S1, así como en los tratamientos PE0.1 y PE0.15 en comparación con el control (Tabla 4). No se observaron diferencias significativas en la actividad de la proteasa en el intestino o en la actividad de la lipasa hepatopancreática o intestinal.

relativamente poco especializados, con la excepción de las feromonas. Por lo tanto, la quimiorrecepción en ecosistemas acuáticos requiere la detección de pequeñas diferencias en la composición de la mezcla en fondos complejos (Derby y Sorensen, 2008).

Micromorfología del intestino Se encontraron diferencias significativas en la micromorfología del intestino (Figura 1), con alturas de pliegue intestinal significativamente más altas en el tratamiento con PE0.15 que en los camarones alimentados con las dietas control y S1, mientras que PE0.1 y S3 tenían alturas de pliegue intestinal significativamente más altas que S1 (Tabla 5).

El sistema olfativo de los crustáceos es particularmente adecuado para la discriminación de mezclas y la identificación de alimentos atractivos a distancia utilizando la quimiorrecepción antenular. Por otro lado, la localización precisa e ingestión se basa en señales del sistema gustativo en las patas y en las piezas bucales, una vez que el animal esté cerca de la fuente de alimento (Derby, 2000; Derby y Sorensen, 2008).

La altura de las células epiteliales, por otro lado, se vio significativamente aumentada en camarones alimentados con la dieta S1+PE0.1, en comparación con los tratamientos control y PE0.1. En términos de ancho de pliegue, no se observaron diferencias significativas entre los tratamientos (Tabla 5).

En ambos casos, los aminoácidos, pequeños compuestos nitrogenados y los nucleótidos, entre otros tipos de moléculas de tamaño molecular pequeño, son señales importantes para la evaluación y el consumo del alimento (Carr y Derby, 1986; Derby y Sorensen, 2008).

Discusión Los animales acuáticos viven y se comunican en un ambiente rico en productos metabólicos

Los subproductos de la pesca, incluida la pasta visceral de calamar, son particularmente ricos en este tipo de moléculas y se usan ampliamente en China

por su efecto atrayente y palatante en la alimentación del camarón. Sin embargo, este tipo de producto a menudo enfrenta problemas de disponibilidad, costo y calidad fluctuante, entre otros problemas que se analizarán más adelante. Este estudio prueba un producto concentrado alternativo que contiene una mezcla compleja de fuentes seleccionadas de aminoácidos (con un perfil específico de aminoácidos libres) y nucleótidos, incluyendo extractos de levadura e hidrolizados de proteínas de origen vegetal, entre otros agentes saborizantes, que se dirige a la capacidad de atracción y estimulación alimenticia en dietas de camarón, particularmente de formulaciones con baja palatabilidad. Las ventajas potenciales de este aditivo para la industria acuícola, es su uso en dosis bajas de inclusión (ahorrando espacio en las formulaciones) y una composición, calidad, suministro y costo bien estandarizado y consistente. En este estudio, probamos este potenciador de palatabilidad como una alternativa para reemplazar o reducir sustancialmente la pasta visceral de calamar en alimentos para camarón blanco. Este experimento no permite la evaluación de la aplicación de los productos probados

Tabla 5: Mediciones histológicas (μm) de la altura y ancho del pliegue intestinal y de la altura de las células epiteliales intestinales (media de 10 mediciones ± SEM de cuatro camarones por tratamiento) Control

S1

S3

S1+PE0.1

S1+PE0.15

PE0.1

PE0.15

Altura del pliegue

18.74 ± 1.51

Ancho del pliegue Altura de célula epitelial

11.31 ± 1.06

14.20 ± 1.32

13.89 ± 2.19

13.83 ± 0.29

13.79 ± 1.13

12.98 ± 1.34

14.17 ± 0.20

16.31 ± 0.41a

16.63 ± 0.80ab

19.36 ± 2.32ab

20.58 ± 1.11b

18.03 ± 0.33ab

15.78 ± 0.39a

18.71 ± 1.53ab

ab

16.63 ± 0.84

a

25.71 ± 3.29

bc

24.54 ± 1.63

abc

23.16 ± 2.56

ab

26.74 ± 3.39

bc

31.97 ± 2.89c

Nota: Las medias en la misma fila con superíndices diferentes, son significativamente diferentes (evaluadas por la prueba LSD de Fisher; p < .05)

38


NUTRICIÓN

- AGOSTO 2019

Figura 1: Apariencia histológica del intestino medio del camarón blanco, Litopenaeus vannamei (H&E), alimentado con cada una de las siete dietas experimentales al final de un ensayo de alimentación de 8 semanas. Barra = 100 μm. En las imágenes se indican células epiteliales representativas (Ec), cuya altura se midió en 10 posiciones (cortes histológicos) diferentes de cada camarón, así como microvellosidades, para las cuales se tomó un número similar de medidas para el ancho del pliegue (Fw) y la altura del pliegue (Fh). Las medidas promedio de cada animal se compararon estadísticamente, y los resultados se muestran en la Tabla 5.

como atrayentes, sino que se centra en sus efectos a largo plazo en la alimentación y el rendimiento del crecimiento. Los resultados sugirieron algunos beneficios en suplementar la dieta control con pasta visceral de calamar, a pesar de que esto solo se reflejó en un aumento numérico no significativo en el incremento de ingesta de alimento, y en el aumento de peso. Esto confirma el aumento de consumo de alimento previamente reportado y el efecto estimulante del crecimiento de la pasta de calamar en otra especie, la tortuga china

de caparazón blando (Sun et al., 2018). Sin embargo, cuando la suplementación con pasta visceral de calamar se aumentó de un nivel bajo (1%) a un nivel más alto (3%), que se usa más comúnmente en condiciones prácticas, la ingesta de alimento y el aumento de peso del camarón disminuyó ligeramente, aunque no fue estadísticamente significativo. El mecanismo a través del cual se suprimió el rendimiento del camarón por los niveles más altos de pasta visceral de calamar sigue sin estar claro. Se podría especular que los niveles excesivos

39

de pasta visceral de calamar pueden tener efectos adversos sobre el crecimiento, porque es propenso a la oxidación y deterioro de los ácidos grasos. Aunque se ha descubierto que las aminas biogénicas como la cadaverina son atractivas para las especies carroñeras, como el camarón, cuando se prueban en solución pura en agua (Mendoza, Montemayor y Verde, 1997; Montemayor-Leal, Mendoza-Alfaro, Aguilera-González y Rodríguez-Almaraz, 2005), las materias primas con menor frescura, como los solubles de pescado ricos en aminas biogénicas, fueron menos


NUTRICIÓN atractivas para el camarón blanco, que los solubles de pescado con bajos niveles de productos de degradación de proteínas (Nunes et al., 2006). Además, se sabe que los cefalópodos acumulan muy eficazmente oligoelementos en sus tejidos y, por lo tanto, el contenido de metales pesados, particularmente el cadmio, puede ser especialmente alto en las vísceras de calamar (Bustamante, Caurant, Fowler y Miramand, 1998; Martin y Flegal, 1975; Yamada, Takayanagi, Tateishi, Tagata e Ikeda, 1997). Por lo tanto, estos resultados podrían sugerir que, cuando se usa pasta visceral de calamar como ingrediente alimenticio, es importante realizar un control de calidad exhaustivo y se debe establecer una tasa de inclusión segura. Por otro lado, se logró un crecimiento significativamente mayor al final del experimento cuando el potenciador de palatabilidad se suplementó al 0.1% de la dieta que contenía un nivel bajo (1%) de pasta visceral de calamar o al 0.15%, en ausencia total de pasta de calamar en la dieta. También se mostró un efecto de estimulación de alimentación, con los tratamientos PE0.1 y PE0.15 presentando una ingesta de alimento más alta que el control. Cuando el potenciador de palatabilidad se suplementó solo al 0.1%, resultó en un crecimiento e ingesta de alimento comparable a los tratamientos con 1 o 3% de pasta visceral de calamar, que tendieron a ser más altos (no significativamente) que el control. Estos resultados demuestran que la pasta de calamar puede ser reemplazada por una inclusión del potenciador de palatabilidad alrededor de 10 veces menor; también demuestran que el valor nutritivo de la pasta de calamar es muy pobre y puede reemplazarse fácilmente. Además de estimular la alimentación, se ha reportado una multitud de otros efectos beneficiosos para los hidrolizados de proteínas, extractos de levadura y nucleótidos cuando se usan como suplementos dietéticos en las dietas para camarón, en particular una mejora de la digestibilidad de proteínas y de la arquitectura intestinal (Deng et al., 2013;

- AGOSTO 2019 Guo et al., 2016; M. Jin et al., 2018; X. Li et al., 2018; P. Li, Lawrence, Castilla y Gatlin III, 2007; Wang, Zhu, Tan y Kang, 2006). Considerando la composición del potenciador de palatabilidad, que contiene una mezcla sinérgica de este tipo de compuestos, también se anticipó la posibilidad de promover algunos de estos efectos funcionales. Por lo tanto, con el fin de dilucidar los posibles mecanismos subyacentes a la mejora en el rendimiento del crecimiento más allá de la atracción de la dieta y la estimulación de la ingesta de alimento, también se evaluaron otros parámetros. En general, la suplementación de la dieta de control tanto con la pasta visceral de calamar como con el potenciador de palatabilidad, dio como resultado una mejora en la actividad de la proteasa y, por lo general, también en la actividad de la lipasa, en el hepatopáncreas. El aumento en la actividad de la proteasa fue significativo en el tratamiento que combina 1% de pasta visceral de calamar con 0.15% de potenciador de palatabilidad, así como en ambos tratamientos que prueban el potenciador de palatabilidad solo, a 0.1 o 0.15%, en relación con el control. Un aumento en la actividad de la proteasa se reportó anteriormente en el intestino de la tortuga china de caparazón blando cuando se alimentó con una dieta suplementada con pasta de calamar al 1% (Sun et al., 2018), y esto también parece ser un efecto beneficioso de la pasta visceral de calamar para camarón blanco. Aún así, este efecto ha podido mejorarse significativamente mediante la combinación con el potenciador de palatabilidad y al menos igualarse con el aditivo por sí solo. La micromorfología del intestino, particularmente la altura de los pliegues de la mucosa, también se vio notablemente afectada por la suplementación de ambos productos. La suplementación con pasta visceral de calamar tuvo un efecto positivo, pero solo en la dosis más alta probada, y los aumentos significativos más altos en la altura de pliegues se midieron en los tratamientos con suplementación del potenciador de palatabilidad por sí solo al 0.15%, seguido de 0.1 %. Además, la suplementación de la dieta que contiene 1% de pasta

40

visceral de calamar con el potenciador de palatabilidad dio resultados similares a los de 3% de pasta visceral de calamar. Este aumento en la altura del pliegue intestinal probablemente resultará en una mayor área para la absorción de nutrientes, lo que se ha reportado previamente en camarón blanco asociado con la suplementación de la dieta con nucleótidos y extractos de levadura (Guo et al., 2016; Xiong et al., 2018). En conclusión, el aditivo que se reporta en esta investigación puede considerarse un potenciador de palatabilidad funcional, ya que no solo mejoró el rendimiento del crecimiento a través de la estimulación del consumo de alimento, sino que también tuvo efectos positivos en la actividad de la proteasa del hepatopáncreas y en la morfología intestinal, sin cambios en la composición proximal del cuerpo y músculo. Estos efectos tienen el potencial de aumentar la digestión de nutrientes y la eficiencia de absorción y, por lo tanto, afectar positivamente la utilización de nutrientes, aunque debe observarse que esto no se reflejó claramente en el índice de conversión alimenticia o índice de eficiencia proteica en este estudio. Sin embargo, es razonable suponer que el 20% de harina de pescado en la formulación base fue lo suficientemente alta como para contrarrestar los posibles efectos negativos de la inclusión de harina de soya y maní (Yue et al., 2012), y que una mejora en la eficiencia alimenticia sería más notable en formulaciones de dietas más exigentes. Además, se observó una mejora notable en el rendimiento en relación con los tratamientos que contenían pasta visceral de calamar cuando el potenciador de palatabilidad funcional se suplementó con 1% de pasta visceral de calamar, o se usó solo al 0.1 o 0.15%, demostrando su potencial para reemplazar parcial o completamente la pasta visceral de calamar como atrayente y estimulante del consumo en dietas de camarón● Para mayor información sobre este artículo escriba a: sofia.morais@lucta.com


PRODUCCIÓN

- AGOSTO 2019

Cría del camarón blanco del Pacífico Litopenaeus vannamei (Boone, 1931) en un sistema BFT con diferentes fotoperiodos: efectos sobre la comunidad microbiana, la calidad del agua y el rendimiento zootécnico Autores: Wellica G. Reis a, Wilson Wasielesky Jr b, Paulo C. Abreu c, Hellyjúnyor Brandão b, Dariano Krummenauer a

Laboratorio de Ecología de Microorganismos aplicados a la Acuicultura, Instituto de Oceanografía, Universidad Federal de Río Grande - FURG, C. P. 474, Río Grande, RS CEP 96201-900, Brasil a

Laboratorio de Carcinicultura, Instituto de Oceanografía, Universidad Federal de Río Grande - FURG, C. P. 474, Río Grande, RS CEP 96201-900, Brasil b

Laboratorio de Fitoplancton y Microrganismos Marinos, Instituto de Oceanografía, Universidad Federal de Río Grande - FURG, C. P. 474, Río Grande, RS CEP 96201- 900, Brasil c

dariano.krummenauer@furg.br

E

l Sistema BFT (Tecnología Biofloc) es una tecnología diseñada para aumentar la productividad al mismo tiempo que mejora el control ambiental sobre la producción, reduciendo o eliminando el intercambio de agua, reduce el desperdicio, minimizando el área de cultivo, restringiendo la propagación de enfermedades y aumentando la bioseguridad en el cultivo de camarón y peces (Krummenauer et al., 2014; Avnimelech, 2015; Samocha et al., 2017). Los bioflocs consisten en agregados colonizados por bacterias, microalgas, protozoos, zooplancton y nematodos, así como heces y restos de alimento (Hargreaves, 2013; Lara et al., 2017). También pueden servir como fuente de alimento complementaria para organismos de cultivo, reflejando un mayor crecimiento, aumento de peso y supervivencia y una menor conversión de alimento (Wasielesky et al., 2006; Ballester et al., 2010). De acuerdo con Cardona et al. (2015), el biofloc puede contribuir aproximadamente del 37 al 40% de la productividad natural, lo que a su vez, estimula las actividades de las enzimas digestivas; este aumento de la actividad puede contribuir a promover el

44

crecimiento del camarón cultivado en biofloc. En el sistema BFT, los cambios en las comunidades microbianas ocurren durante un ciclo de cultivo. Por lo general, el reemplazo de la comunidad fotoautotrófica o quimioautotrófica ocurre según el manejo. La exposición a la luz solar puede cambiar abruptamente la comunidad de un sistema heterotrófico (dominado principalmente por bacterias y protozoos) (Kirk, 2010; Hargreaves, 2013) a una con características fotoautotróficas dominadas por microalgas. La importancia relativa de cada proceso fotoautotrófico y heterotrófico depende de muchos factores, como la tasa de alimentación diaria, la concentración de sólidos en suspensión, la concentración de amoníaco, la intensidad de luz y la relación carbono-nitrógeno (C/N) (Avnimelech, 1999, 2015). Dentro del biofloc, hay diferentes comunidades que pueden controlar los compuestos nitrogenados en el agua, como las bacterias nitrificantes fotoautotróficas, heterotróficas y autotróficas (Ebeling et al., 2006; Crab et al., 2012). El proceso heterotrófico se basa en la eliminación de amoníaco (TA-N) mediante la asimilación de nitrógeno compuesto


PRODUCCIÓN

- AGOSTO 2019 en la biomasa bacteriana, como proteína. Esta incorporación ocurre a través de la manipulación de la relación carbono y nitrógeno (C/N) en el sistema, es decir, mediante la adición de una fuente de carbono orgánico en forma de carbohidratos (Avnimelech y Kochba, 2009). Esta estrategia permite acelerar la eliminación de nitrógeno inorgánico de manera rápida y eficiente, reduciendo la concentración de amoníaco total en el agua (Ebeling et al., 2006). En el proceso quimioautotrófico, se producen pequeñas cantidades de biomasa bacteriana, principalmente debido a la lenta tasa de crecimiento de las bacterias nitrificantes. Estas bacterias realizan la oxidación de amoníaco a nitrito (bacterias oxidantes de amoníaco - AOB) y luego a nitrato (bacterias oxidantes de nitrito - NOB) (Ebeling et al., 2006; Crab et al., 2007). De esta manera, es difícil tener un control total sobre las comunidades bacterianas que se formarán a lo largo del proceso del cultivo debido a la complejidad de interacciones que ocurren dentro de los sistemas de cultivo (Hargreaves, 2013). En el sistema BFT, cuando se expone predominantemente a la luz solar, se desarrolla un afloramiento denso de organismos fotoautotróficos (microalgas), en respuesta a la entrada de luz y nutrientes que provienen de los alimentos y de la descomposición de materia orgánica, como microorganismos muertos, heces y raciones de alimento no consumidas (Hargreaves, 2013; Samocha et al., 2017). Cuando existe una dependencia primaria de los organismos fotoautotróficos en este sistema, la concentración de amoníaco puede aumentar en condiciones de clima nublado y también puede producirse una fluctuación en la concentración de oxígeno disuelto y el pH, a pesar de la aireación adicional (Avnimelech, 2015). La luz es uno de los factores que puede modificar la abundancia de microalgas que consisten en grupos de cianobacterias, diatomeas, algas verdes y dinoflagelados, entre otros, lo que resulta en intensos afloramientos de especies que a menudo son tóxicas. Estos afloramientos pueden ser perjudiciales para la calidad del agua,

afectando el desarrollo animal y produciendo toxinas que pueden causar estrés fisiológico e incluso la mortalidad del camarón (AlonsoRodríguez y Páez-Osuna, 2003; Wasielesky et al., 2012; Samocha et al., 2017). Una compleja mezcla de procesos entre algas y bacterias controla la calidad del agua en los sistemas BFT. Básicamente, hay dos tipos de producción con bioflocs; aquellos que están expuestos a luz natural, como los estanques y tanques al aire libre (cultivo intensivo), normalmente se encuentran en regiones tropicales o subtropicales donde hay abundancia de luz natural donde predominan los organismos fotoautotróficos, lo que hace que el agua tenga un color verdoso (Ebeling et al., 2006; Prangnell et al., 2016). En ambientes de regiones templadas, el cultivo se lleva a cabo en invernaderos o en interiores (cultivo superintensivo) sin exposición a luz natural. En estos sistemas de invernadero, el color del agua tiende a ser marrón, donde los procesos bacterianos controlan la calidad del agua (Hargreaves, 2013; Samocha et al., 2017). Sin embargo, esta variación del color del agua dependerá exclusivamente de la composición microbiana de cada cultivo, y el color del agua no es un indicador preciso del estado de madurez del sistema (Hargreaves, 2013). La luz se considera un factor abiótico de suma importancia para los organismos que viven en un ambiente acuático. Los estudios muestran diferencias significativas en el comportamiento, crecimiento, la ingesta de alimento, maduración y la reproducción, y posiblemente cambios en la actividad de nado de peneidos cuando se exponen a diferentes condiciones de luminosidad (Gardner y Maguire, 1998; Guerra-Santos et al., 2017) Es decir, la intensidad lumínica puede afectar directamente a los animales de cultivo. Por lo tanto, la intensidad de la luz, cuando es apropiada para el cultivo de camarón, ofrece ventajas tales como una mayor productividad y reducción de los costos de producción, alimento y electricidad (Coyle et al., 2011). Varios autores han descrito la importancia de la luz sobre el rendimiento de peneidos, sin embargo, los resultados a veces no

45

son concluyentes. Por ejemplo, en un estudio realizado por Baloi et al. (2013), se observó que el rendimiento zootécnico de L. vannamei cultivado en bioflocs en ausencia de luz, mostró diferencias significativas en la conversión alimenticia y supervivencia. Por otro lado, Fleckenstein et al. (2019) al investigar los efectos suplementarios de la luz sobre el rendimiento de L. vannamei en sistemas intensivos, encontró que la presencia de luz puede mejorar la producción del camarón, mientras que Esparza-Leal et al. (2017) reportaron que el rendimiento zootécnico de la misma especie expuesta a limitada luz a baja salinidad, también en un sistema BFT, no se vio afectado significativamente por la limitación de luz. Además, hay poca información sobre la caracterización y cuantificación de la comunidad microbiana del cultivo del camarón blanco del Pacífico L. vannamei en sistemas BFT con restricción de luz, y especialmente sobre la contribución de estos microorganismos al desempeño del camarón, por lo tanto, es de suma importancia contar con estudios para aclarar esta brecha. En este contexto, el objetivo de este estudio fue evaluar la comunidad microbiana en el cultivo del camarón blanco del Pacífico L. vannamei en un sistema BFT con restricción de luz (fotoperíodo natural, 24 h de luz y 24 h de oscuridad).

Materiales y métodos Condiciones de cultivo El experimento se realizó entre el 16 de octubre y el 25 de diciembre de 2017 en la Estación Marina de Acuicultura del Instituto de Oceanografía de la Universidad Federal de Río Grande - FURG, ubicada en la ciudad de Río Grande, Cassino - RS, Brasil (32° 19’S, 52° 15′O). La especie utilizada en el experimento fue el camarón blanco del Pacífico Litopenaeus vannamei. Las postlarvas (Speedline Aqua) se obtuvieron de Aquatec® LTDA (Rio Grande do Norte). Los organismos se mantuvieron primero en una instalación de precría en el Laboratorio de Producción de Camarones en EMA durante un período de aproximadamente 30 días hasta alcanzar un peso promedio de 0.053 ± 0.010 g. Luego, los animales fueron transferidos a las unidades experimentales para el comienzo del experimento.


PRODUCCIÓN Diseño experimental El agua utilizada en cada unidad experimental fue previamente bombeada desde la playa de Cassino. Antes del experimento, el agua se cloraba con una concentración de 10 ppm y se dejaba actuar durante cuatro h antes de neutralizarse con ácido ascórbico (vitamina C) en la proporción de un gramo por mil litros de agua. El agua se transfirió a doce tanques rectangulares de cemento de una capacidad de 1000 l, y un volumen utilizable de 800 l con un área de superficie inferior de 1.4 m2. En cada unidad experimental, se instaló un sistema de aireación con una manguera microperforada (aerotubos) suministrada por un blower (Ibram® LTDA) de 2 CV. La densidad de población fue de 500 camarones m3, y el experimento simuló una siembra directa (fase de precría y engorde) y duró 25 días. Para el desarrollo del experimento, se realizaron tres tratamientos con cuatro réplicas cada una, como se detalla: 1) NP fotoperíodo natural con luz natural durante el día y cubierto con una lámina de plástico negro por la noche; 2) 24hLI (luz de 24 h) con luz natural durante el día e iluminación artificial durante la noche, utilizando una lámpara fluorescente de 80 vatios; y 3) 24hDA (24 h oscuro) con tanques cubiertos con plástico negro durante 24 h. La cantidad de luz que alcanzó la superficie del agua (luz ambiental) se midió en dos puntos diferentes del tanque diariamente a las 12:00 con la ayuda de un dispositivo luxómetro Chauvin Arnoux® (modelo C.A 810). Formación de biofloc Para estimular la formación de biofloc, la relación C/N del sistema se mantuvo en 15/1, de acuerdo con la metodología propuesta por Avnimelech (1999) y Ebeling et al. (2006) La fertilización orgánica se realizó con melaza de caña de azúcar con 37.27% de carbono; para mantener una relación C/N de 15/1, se agregó 6.0 g de carbono (melaza) por cada 1.0 g de nitrógeno amoniacal total (TA-N) medido en el agua. Además, se aplicaron probióticos comerciales (INVE® Sanolife PROeW) una vez por semana en una proporción de 1.0 g por cada mil litros de agua para ayudar en el mantenimiento de la calidad del agua en todos los tratamientos. Alimentación y monitoreo del camarón El camarón se alimentó dos veces al día

- AGOSTO 2019 utilizando el balanceado Potimar GUABI® (40% de proteína cruda en la fase de cría y 38% en la fase de engorde). Para controlar el consumo de alimento, el 10% de la cantidad diaria de alimento se ofrecía en bandejas de comida, y el resto se distribuía en el tanque. La tasa de alimentación de precría determinada se realizó de acuerdo con el método revisado por Jory et al. (2001); mientras que en la fase de engorde, los ajustes en las tasas alimenticias se realizaron siguiendo el método descrito por Yta et al. (2004) Rendimiento zootécnico El rendimiento zootécnico del camarón se controló semanalmente midiendo el peso promedio de 30 animales por unidad experimental, usando una balanza digital con una precisión de 0.01 g (Marte® scientific AS5000C). Al término del experimento, también evaluamos otros índices de rendimiento zootécnico semanales (Bagenal y Tesch, 1978; van Wyk y Scarpa, 1999) mediante los siguientes cálculos: WG = (FW- IW) /n semanas de cultivo donde WG = aumento de peso, IW = peso inicial, FW = peso final; FCR = Alimento ofrecido / aumento de biomasa donde FCR = tasa de conversión aparente del alimento; Supervivencia: (biomasa final / peso promedio individual) / número de individuos cosechados) x 100; y Productividad: (biomasa final - biomasa inicial) / volumen del tanque. Parámetros de calidad del agua Los parámetros físicos y químicos que se monitorearon dos veces al día fueron temperatura y oxígeno disuelto (YSI® Pro 20) y pH (pH meter® FE 20/FG2). La salinidad se verificó cada tres días (Hach® HQ40d). La turbidez se determinó una vez por semana con un turbidímetro (Hach® 2100P, Hack Company). Se recolectaron muestras de agua diariamente para cuantificar el nitrógeno amoniacal total (N- (NH3 + NH4 +)) y nitrito (NNO2). Cuando los valores excedieron el nivel seguro, se realizaron recambios de agua a una tasa del 20%. Las concentraciones de amoníaco se determinaron de acuerdo con los métodos de la UNESCO (1983) y Strickland y Parsons (1972). La alcalinidad se

46

analizó cada tres días según la metodología propuesta por APHA (2012). Cuando la alcalinidad alcanzó valores por debajo de 150 mg de CaCO3. L − 1 y/o el pH alcanzó valores por debajo de 7.6, los ajustes se hicieron siguiendo la metodología descrita por Furtado et al. (2011) y Zhang et al. (2017) Las cantidades de los compuestos químicos requeridos para corregir el pH y la alcalinidad se calcularon de acuerdo con las siguientes ecuaciones: K = Nf - Ni. K = donde K es el nivel a aumentar (pH o CaCO3L − 1); Nf = es el nivel deseado (pH o CaCO3L − 1); Ni = es el nivel actual (pH o CaCO3L − 1). Y = (W*K)/Z. Y = donde Y es la concentración del compuesto químico que se utilizará gL − 1; W = gL – 1 tabulado; Z = es la capacidad de W para aumentar el parámetro (pH o alcalinidad). Las concentraciones de nitrato (NNO3−) y fosfato (P-PO4−) se examinaron semanalmente utilizando la metodología de Strickland y Parsons (1972). Los sólidos suspendidos (ml L − 1) se midieron una vez por semana usando un cono Imho con lecturas registradas después de 15-20 min, siguiendo el método de Eaton et al. (1995) adaptado por Avnimelech (2007). Las muestras de agua se filtraron con filtros de fibra de vidrio GF50-A usando una bomba de vacío (Prismatec®) para determinar la concentración total de sólidos en suspensión. Los niveles de sólidos suspendidos totales se mantuvieron hasta 500 mg. L − 1 según lo recomendado por Gaona et al. (2011), y cuando los valores excedieron el valor recomendado, se usaron clarificadores (Ray et al., 2010; Gaona et al., 2011). Composición proximal de biofloc Al término del experimento, se recolectó el biofloc de los tanques para un análisis de composición proximal. Estas muestras fueron filtradas con una malla de 50 μm. Posteriormente, las muestras se secaron en un horno durante 48 h a una temperatura de 60 °C hasta que se mostró el peso constante. Los análisis se llevaron a cabo en el Laboratorio de Nutrición de Organismos Acuáticos de EMA, de acuerdo con los protocolos de AOAC (2000). Para la


PRODUCCIÓN

- AGOSTO 2019 cuantificación de cenizas (MM), las muestras se secaron y luego se llevaron a un horno a 600 °C durante cinco horas. El análisis de la proteína cruda se realizó de acuerdo al método de Kjeldahl, donde la digestión previa de las muestras ocurre antes de la destilación y titulación del nitrógeno, multiplicando todos los resultados por 6.25. El valor del extracto etéreo se obtuvo utilizando el método de extracción caliente mediante el extractor Soxhlet, utilizando éter de petróleo como disolvente, durante seis horas. Para el análisis de fibra cruda, se usó la digestión ácida y básica de la muestra durante 30 minutos en cada digestión, seguido de la quema del residuo en un horno mufla a 500 °C durante una hora, y el valor se obtuvo de la diferencia. Evaluación de la comunidad microbiana Para la cuantificación de microorganismos presentes en el agua de cultivo, se recogieron muestras de agua (20 ml) una vez por semana en cada unidad experimental. Las muestras se fijaron en formalina al 4% (concentración final) y se mantuvieron en un recipiente ámbar para un recuento e identificación de los principales grupos de microorganismos presentes. Para determinar la abundancia de bacterias, las muestras fijas pasaron por filtros de membrana de policarbonato (Nuclepore, 0.2 μm y 2.5 mm de diámetro de poro) previamente oscurecidas con Irlan Black y teñidas con 1% de naranja de acridina a una concentración de 1 μg/mL (Hobbie et al., 1977). Las bacterias se fotografiaron usando una cámara acoplada a un microscopio de epifluorescencia Axioplan-Zeiss, con una ampliación final de 1000 X, para un conteo posterior de 30 campos elegidos al azar. Para los protozoos, se utilizó un microscopio invertido Olympus IX51 con 200 de aumento final, donde se colocaron alícuotas de 2.1 mL de muestra en una cámara de sedimentación y se contaron 30 campos aleatoriamente (Utermöhl, 1958). Los microorganismos se clasificaron en diferentes grupos: para bacterias: cocoides libres, cocoides unidos, filamentos libres y bacterias filamentosas unidas, Vibrio y Bacillus; y para los protozoos: flagelados autotróficos, flagelados heterotróficos,

ciliados, amebas y grupos de rotíferos, nematodos, dinoflagelados. El recuento se realizó en el Laboratorio de Ecología de Fitoplancton y Microrganismos Marinos en FURG.

niveles de alcalinidad requeridos para las especies en estudio. Sin embargo, en el tratamiento de 24hDA, las correcciones se realizaron una semana antes que los otros tratamientos.

Análisis de clorofila a La concentración de clorofila se determinó una vez a la semana a partir de muestras de 10 ml de agua de cultivo filtrada a través de microfiltros de fibra de vidrio GF 50a. La extracción del pigmento fotosintético se realizó sumergiendo los filtros en 10 mL de acetona al 90% (Merck® PA), envasadas en botellas y guardadas en un congelador (-12 °C). Después de un período de 24 h, se midió la concentración de clorofila utilizando un fluorímetro Trilogy de Turner Designs. La concentración de clorofila a se determinó mediante un fluorímetro (Welschmeyer, 1994).

Se observaron diferencias (p < .05) en las concentraciones de nitrógeno amoniacal total (TA-N) entre los tratamientos, especialmente después del día 11, día del experimento cuando ocurrió un aumento en la concentración con un valor máximo de 2.7 mg L − 1 en el tratamiento con NP y 2.4 mg L −1 en el tratamiento con 24hLI, mientras que el tratamiento con 24hDA alcanzó 1.5 mg L − 1 en el mismo período. Después del séptimo día, la concentración de amoníaco disminuyó más rápidamente en el tratamiento oscuro de 24 h, que en los otros tratamientos (Fig. 1A).

Análisis estadístico Los datos fueron sometidos a un análisis de homocedasticidad de varianza y análisis de la normalidad de distribución de datos. Cuando no se cumplieron los supuestos, la data se sometió a transformaciones estadísticas. Posteriormente, se aplicó un análisis de varianza unidireccional - ANOVA (α = 0.05) seguido de una prueba de Tukey post hoc cuando se encontraron diferencias significativas (ZAR, 2010).

Resultados Los valores promedios (± DE) de los parámetros químicos y físicos del agua durante el período de estudio de 70 días se muestran en la (Tabla 1). Las variables como el amoníaco, el nitrito, la clorofila a, el CO2 y la luz (Ix) fueron significativamente mayores en los tratamientos expuestos a la luz, que en el tratamiento que no fue expuesto (p < .05). Las otras variables no mostraron diferencias significativas entre los tratamientos (p > .05). No hubo diferencias significativas entre los tratamientos (p > .05) para el pH ni la alcalinidad, con un valor máximo de 8.26 en el tratamiento de 24hDA y un mínimo de 7.6 pH en todos los tratamientos. Para la alcalinidad, hubo un máximo de 160 mg L − 1 para 24hLI y un mínimo de 120 mg L − 1 para 24hDA. En todos los tratamientos, se hicieron correcciones para mantener los

47

Los valores más altos de nitrito fueron 32 mg L − 1 en el tratamiento con 24hLI, 28 mg L − 1 en el tratamiento con NP y 23 mg L − 1 en el tratamiento con 24hDA. Vale la pena mencionar que trabajamos con un nivel de seguridad de nitrito de 26 mg L − 1. En los tratamientos NP y 24hLI, se realizó una renovación del 20% del volumen del tanque cuando se excedieron los niveles de seguridad, mientras que en el tratamiento de 24hDA no se realizó ninguna renovación. El tratamiento de 24hDA mostró una disminución en las concentraciones de nitrito antes que los otros tratamientos, iniciando la disminución al día 31 y presentando valores no detectables después del día 40 (Fig. 1B). La figura 1C muestra los niveles de nitrato a lo largo del experimento. No hubo diferencias significativas entre los tratamientos (p > .05), con un valor máximo de 97 mg L − 1 obtenido en los tratamientos 24hDA y 24hLI y 89 mg L − 1 para el tratamiento NP. La clorofila a presenta diferencias significativas (p < .05). El valor máximo obtenido fue de 250 μg L − 1 para el tratamiento de 24 hLI. El tratamiento oscuro (24 hDA) presentó una clorofila a residual de 2.4 μg L − 1. La figura 2A muestra las concentraciones de bacterias cocoides libres durante todo el experimento. No hubo diferencias significativas entre los tratamientos (p > .05), con un máximo de 2.6 × 106 y un mínimo de 0.6 × 106 en el tratamiento con NP. Para


PRODUCCIÓN las bacterias cocoides unidas, hubo un máximo de 2.5 × 105 para NP y un mínimo de 0.1 × 105 para 24hDA. Hubo diferencias significativas entre los tratamientos a los 15 días (p < .05) (Fig. 2B). La figura 2C muestra las concentraciones de bacterias filamentosas libres durante el experimento. Hubo una diferencia significativa entre los tratamientos a los 43 días (P < .05), con un máximo de 2.4 × 106 para 24hLI y un mínimo de 0.4 × 106 para 24hDA. Para las bacterias filamentosas adheridas, hubo un máximo de 17.8 × 104 para NP y un mínimo de 0.6 × 104 para NP y 24hLI. Se observaron diferencias significativas entre los tratamientos en los días 43 y 70 (p <.05) (Fig. 2D). La figura 2E muestra las concentraciones de Vibrio durante el experimento. Hubo una diferencia significativa entre los tratamientos en los días 15 y 43 (P < .05), con un máximo de 4.2 × 104 para 24hLI y un mínimo de 0.2 × 104 para 24hDA. Para Bacillus, no se observaron diferencias significativas entre los tratamientos (p > .05), donde hubo un máximo de 8.3 × 105 para NP y un mínimo de 2.3 × 105 para 24hDA (Fig. 2F). La Fig. 2G muestra las concentraciones de flagelados fotoautotróficos durante todo el experimento. Hubo una diferencia significativa entre los tratamientos en los días 15, 43 y 70 (P < .05), con un máximo de 10 × 103 para NP y un mínimo de 0.1 × 103 para 24hDA. Para los flagelados heterotróficos, hubo un máximo de 29 × 102 para NP y un mínimo de 2 × 102 para 24hLI. Hubo diferencias significativas entre los tratamientos en los días 43 y 70 (p < .05) (Fig. 2H). La figura 2I muestra las concentraciones de ciliados a lo largo del experimento. Hubo una diferencia significativa entre los tratamientos en los días 15, 43 y 70 (P < .05), con un máximo de 4.3 × 103 para NP y un mínimo de 0.3 × 103 para 24hDA. Para nematodos, hubo un máximo de 14 × 102 para 24hDA y un mínimo de 0.1 × 102 para 24hLI y NP. Hubo diferencias significativas entre los tratamientos a los 70 días (p < .05) (Fig. 2J). La figura 3 presenta fotomicrografías de microrganismos en los tres tratamientos a los 15 y 70 días del experimento. Los

- AGOSTO 2019 Tabla 1: Parámetros físicos y químicos del agua (valores promedio ± desviación estándar) en los tratamientos: Fotoperíodo Natural (NP), 24 h de Luz (24hLI) y 24 h de Oscuridad (24hDA). Las diferentes letras en superíndice en una fila denotan diferencias significativas (P < .05) entre tratamientos.

Parámetros

Temperature (°C) DO (mg L­­­­ˉ¹) pH Salinity Alkalinity (mg of CaCO3.Lˉ¹) TA-N (mg. Lˉ¹) NO²− N (mg.Lˉ¹) NO³ −N (mg.Lˉ¹) PO¾ -P (mg.Lˉ¹) Free CO2 (mg.Lˉ¹) Light (lx) TSS (mg.Lˉ¹) Turbidity (NTU) Settleable solids (mL.Lˉ¹) Chlorophyll a (μg Lˉ¹)

Tratamientos NP

24hLI

24hDA

29.01 ± 1.69 6.21 ± 0.33 7.90 ± 0.19 26.41 ± 0.70 150.31 ± 11.19

29.08 ± 1.67 6.36 ± 0.30 7.95 ± 0.18 26.40 ± 0.59 145.0 ± 19.21

29.19 ± 1.63 6.30 ± 0.31 7.98 ± 0.18 26.25 ± 0.65 136 ± 27.61

0.85 ± 0.92ᵃ 8.71 ± 10.12ᵃ 25.50 ± 33.41 1.37 ± 1.03 4.23 ± 1.80ᵃ 1071 ± 71.93ᵃ 330.0 ± 162.61 139.92 ± 112.19 7.15 ± 5.96

0.85 ± 0.85ᵃ 8.37 ± 10.88ᵃ 28.62 ± 37.57 1.27 ± 0.94 3.72 ± 1.52ᵃᵇ 1192 ± 106.25ᵃ 315.0 ± 158.63 134.73 ± 102.98 7.55 ± 6.35

0.57 ± 0.68ᵇ 5.04 ± 7.76ᵇ 33.87 ± 38.86 1.54 ± 1.06 3.48 ± 1.50ᵇ 0.0 ± 0.0ᵇ 297.50 ± 207.03 142.55 ± 118.84 8.66 ± 7.73

121.24 ± 88.05ᵃ

161.52 ± 91ᵃ

1.73 ± 0.71ᵇ

tratamientos con luz mostraron una mayor abundancia de flagelados y bacterias filamentosas (Fig. 3A y B) en comparación con los del tratamiento oscuro (24hDA) (Fig. 3E y F). También es posible identificar la presencia de ameba (3C) y bacterias cocoides libres (3D) como se muestra en las micrografías. Los resultados del análisis proximal del biofloc después de 70 días de estudio se presentan en la Tabla 2. La cuantificación de proteínas crudas y lípidos mostraron diferencias significativas (p < .05) entre los tratamientos. Los resultados del análisis de rendimiento zootécnico para el camarón L. vannamei en el día 70 de estudio, se muestra en la Tabla 3. Los tratamientos expuestos a la luz presentaron valores más altos de peso final, biomasa final, conversión alimenticia, supervivencia, crecimiento semanal después de un gramo y tasa de crecimiento en comparación a los del tratamiento oscuro de 24 h, con diferencias significativas (p < .05).

Discusión Influencia de la luz sobre la calidad del agua Hubo diferencias estadísticamente significativas para los resultados de la

48

cuantificación de amoníaco, nitrito, clorofila a, CO2 y lux en el experimento; no obstante, todos los niveles estaban dentro del nivel seguro para las especies criadas. Otros parámetros tales como temperatura, oxígeno disuelto, pH, nitrato, fosfato, alcalinidad, sólidos suspendidos totales y turbidez, no mostraron diferencias significativas. Todas estas variables se encuentran dentro del rango aceptable para las especies en estudio y, por lo tanto, probablemente no causaron diferencias en los índices de rendimiento (Van Wyk y Scarpa, 1999; Gaona et al., 2011; Furtado et al., 2011; Zhang et al., 2017). En este estudio, se encontraron diferencias significativas en los niveles de amoníaco entre los tratamientos con exposición a la luz (NP) y (24hLI) y con la restricción de la luz (24hDA), pero los valores no alcanzaron los niveles de seguridad, y el valor máximo registrado fue 2.7 mgL− 1. Cabe señalar que en el sistema BFT, la concentración de amoníaco se controla agregando una fuente de carbono orgánico (Avnimelech y Kochba, 2009). Se sabe que la tasa de crecimiento de las bacterias heterotróficas es significativamente más rápida que la de las bacterias autotróficas. Por lo tanto, con el rápido crecimiento de estas bacterias, se


PRODUCCIÓN

- AGOSTO 2019 produce una rápida eliminación del amoníaco en el agua, mediante la incorporación a la biomasa bacteriana (Ebeling et al., 2006; Avnimelech y Kochba, 2009). Los niveles de seguridad para las concentraciones de nitrito en cultivos de L. vannamei son de 15.2 a 25.7 mg. L − 1 para salinidades de 25–35, respectivamente (Lin y Chen, 2003). En este estudio, trabajamos con un nivel de seguridad de 26 mg de NO2. L −1 y se llevó a cabo un recambio del 20% del volumen total del tanque en el tratamiento en el que los niveles de nitrito excedieron el nivel seguro. En general, se observó que la nitrificación en el tratamiento de 24hDA fue mejor, lo que puede explicarse por la fotosensibilidad de las bacterias nitrificantes y por la competencia por nutrientes. Las bacterias nitrificantes responden a la luz de diferentes maneras. En el estudio de Guerrero y Jones (1996), los autores observaron fotosensibilidad de bacterias nitrificantes cuando se exponen a diferentes longitudes de onda y colores de luz. Observaron la inhibición de la actividad de las bacterias nitrificantes cuando se exponen a la luz solar, pero el efecto de la luz sobre las bacterias depende no solo del tipo de bacteria, sino también de condiciones ambientales. En otro estudio, Vergara et al. (2016), también observaron la sensibilidad a la luz de las bacterias nitrificantes, donde la irradiación con 500 y 1250 μmol m2 s – 1 causó una reducción del 20 al 60% de la tasa de eliminación de amoníaco y aproximadamente del 26 al 71% de la tasa de eliminación de nitrito. Esta fotosensibilidad puede explicar por qué en la oscuridad, la nitrificación ocurrió con anticipación y más fácilmente, en comparación con los tratamientos expuestos a la luz. La restricción de luz proporcionó un ambiente de cultivo favorable para el crecimiento de estas bacterias, evitando una posible inhibición de la actividad de las bacterias nitrificantes. Además, existe competencia por los nutrientes en el sistema de cultivo. Por cada gramo de amonio consumido, es necesaria la cantidad de 3.13 g / g NH4 + de alcalinidad para bacterias fotoautotróficas, 7.05 g / g NH4 + de alcalinidad para quimiótrofos y 3.57

Fig. 1. Valores promedio (± DE) de (A) nitrógeno amoniacal total, (B) nitrito y (C) nitrato (mg L­ˉ¹) en los tres tratamientos experimentales; fotoperíodo natural (NP), 24 h de luz (24hLI) y 24 h de oscuridad (24hDA).

g / g de NH4 + de alcalinidad para carbonatos heterotróficos (Ebeling et al., 2006). Por lo tanto, en los casos en que tenemos este tipo de bacterias en el cultivo, existe competencia por carbonatos y compuestos de nitrógeno. Este hecho puede explicar por qué la nitrificación en el tratamiento con restricción de luz fue mejor que en los tratamientos expuestos a la luz. En 24hDA, las bacterias heterotróficas presentaron un mejor crecimiento, proporcionando una fuente de nutrientes disponibles para las bacterias (carbonatos y compuestos de nitrógeno). En consecuencia, hay menos competencia con los organismos fotoautótrofos por los nutrientes. Se debe destacar que en el tratamiento de 24hDA, se realizaron más ajustes para mantener la alcalinidad, ya

49

que este tratamiento había disminuido los niveles de alcalinidad antes de los otros tratamientos. El dióxido de carbono disuelto (CO2) en agua de cultivo es el resultado de la respiración de organismos cultivados junto con la comunidad microbiana en un sistema de cultivo (van Wyk y Scarpa, 1999); en sistemas que funcionan con altas densidades de siembra, hay un aumento de CO2. Los tanques de cultivo expuestos a la luz mostraron tasas de supervivencia más altas y una mayor cuantificación de microorganismos en el tanque que los del tratamiento con restricción de luz, generando mayores concentraciones de CO2. De acuerdo con Furtado et al. (2016), los niveles adecuados son < 5 mg L − 1 CO2 durante el cultivo de L. vannamei para reducir


PRODUCCIÓN

- AGOSTO 2019

Fig. 2. Valores promedio (± DE) (A) de cocoides libres, (B) bacterias cocoides unidas, (C) bacterias filamentosas libres, (D) bacterias filamentosas unidas, (E) Vibrio, (F) Bacilo, (G) flagelados fotoautotróficos, (H) flagelados heterotróficos, (I) ciliados y (J) nematodos en los tres tratamientos experimentales; fotoperíodo natural (NP), 24 h de luz (24hLI) y 24 h de oscuridad (24hDA).

50


PRODUCCIÓN

- AGOSTO 2019

el consumo de oxígeno. En este estudio, hubo una diferencia significativa entre NP y 24hLI y los tratamientos de 24hDA. Sin embargo, el valor más alto encontrado en el experimento fue de 4.32 mg de CO2 L − 1, que no excedió los valores de seguridad recomendados por la literatura. Influencia de la luz sobre la abundancia de microorganismos Las variaciones del medio de cultivo, como los nutrientes, la competencia natural de las comunidades entre las diferentes especies y la luz, pueden influir en la productividad primaria y el predominio de grupos específicos de microorganismos adaptados a las condiciones ambientales establecidas (Irigoien y Castel, 1997; Pereira Neto et al., 2008). En este estudio, fue posible verificar la presencia abundante de microorganismos durante el período de cultivo en diferentes fotoperiodos. Es decir, en los tratamientos expuestos a la luz, hubo una mayor abundancia de bacterias como cocoides libres, cocoides unidos, filamentos libres y bacterias filamentosas unidas y grupos de Bacillus y protozoos como flagelados autótrofos, ciliados, amebas y rotíferos grupales, y cuando se compara con aquellos en tratamiento con restricción total de luz. En ambientes con abundante luz, hay una tendencia de que las microalgas se establezcan primero, y estos organismos sirven como fuente básica de alimento para el desarrollo de una comunidad zooplanctónica y nutritiva; Además de proporcionar alimento suplementario para el camarón, también proporcionan nutrientes para el crecimiento de bacterias en el agua del sistema de cultivo (Ju et al., 2008). En este estudio, la abundancia de microorganismos correspondió al medio de cultivo; es decir, los tratamientos expuestos a la luz mostraron una mayor abundancia de organismos fotoautotrófos, mientras que los tratamientos con restricción de luz tuvieron una mayor concentración de organismos heterotróficos. En general, es posible observar que la presencia de luz tuvo una influencia positiva en bacterias y protozoos, con diferencias significativas (p < .05) entre tratamientos.

Fig. 3. Abundancia de bacterias en el biofloc microbiano en el tratamiento con fotoperíodo natural (NP) en diferentes días de cultivo: (A) flagelado (protozoario) en el 15avo día de experimento; (B) bacterias filamentosas libres en el día 70; Abundancia de bacterias en el biofloc microbiano en el tratamiento con luz total (24hLI) en diferentes días de cultivos (C) ameba a los 15 días y (D) bacterias cocoides libres a los 70 días; Abundancia de bacterias en el biofloc microbiano en el tratamiento de oscuridad total (24hDA) en diferentes días de cultivos: (E) 15 días y (F) 70 días. Ampliación de 1000 × por microscopía de fluorescencia de epi (imagen: Wellica G. Reis).

Tabla 2: Análisis proximal biofloc (valores promedios ± desviación estándar) formado en los tratamientos: Fotoperíodo natural (NP), 24 h de luz (24hLI) y 24 h de oscuridad (24hDA). Las diferentes letras en superíndice en una fila, denotan diferencias significativas (P <.05) entre tratamientos.

Tratamientos

Crude protein (%) EE (%) Fibre (%) Ash (%) (ENN) (%)

NP

24hLI

24hDA

25.59 ± 0.64ᵃ 1.81 ± 0.09ᵃ 5.16 ± 1.56 53.68 ± 2.14 22.46

24.82 ± 0.34ᵃᵇ 2.28 ± 0.07ᵃ 6.41 ± 1.17 51.60 ± 1.45 24.82

23.89 ± 0.72ᵇ 1.02 ± 0.07ᵇ 4.37 ± 1.04 4.37 ± 1.04 23.89

ENN: Extracto sin nitrógeno, estimado a través de la diferencia [100- (PB+EE+FB+Ash)]. Todos los análisis se realizaron con materia seca del bioflocs.

La presencia de luz influyó en las bacterias cocoides adheridas, en comparación

51


PRODUCCIÓN al tratamiento de restricción de luz, especialmente en las primeras dos semanas de estudio, y posteriormente, hubo un aumento significativo durante el período de tratamiento en todos los tratamientos. En un estudio realizado por (Rocha et al., 2012a, 2012b) sobre la formación de láminas microbianas (flakes) formados por dos especies de camarón (L. vannamei y Farfantepenaeus paulensis), que pueden estar relacionados con la abundancia de bacterias formadoras de biofloc, principalmente bacterias cocoides, hubo una estrecha relación entre la cantidad de agregados y la presencia de bacterias cocoides adjuntas. En general, la presencia de luz en los tratamientos de FPN y 24hCL contribuyó positivamente a la abundancia de bacterias filamentosas libres y adheridas. Este hecho puede estar relacionado con la mayor disponibilidad de carbono orgánico disuelto en el agua, especialmente al comienzo del experimento cuando introdujimos una fuente externa de carbono orgánico (melaza). Anesio y et al. (2003) encontraron que las bacterias libres y adheridas actúan de diferentes maneras en el medio ambiente, y cuando hay una alta disponibilidad de carbono orgánico disuelto en el agua, se produce una gran abundancia de bacterias libres; después de ese período, las bacterias adheridas predominan, lo que lleva a la unión de alimento a niveles tróficos más altos. La cantidad de Vibrio disminuyó durante el estudio, lo que ocurrió después del aumento de bacterias probióticas que contienen altas concentraciones de bacilos. Con este resultado, la relación inversa entre la bacteria Vibrio y la bacteria del bacilo en el tanque de cultivo se hizo evidente, demostrando el efecto antagonista causado por las bacterias probióticas en el agua. Este resultado corrobora los hallazgos de los autores que encontraron un mejor control de Vibrio y un aumento de las bacterias tipo Bacillus cuando se usa probióticos en el sistema BFT (Krummenauer et al., 2014; Hostins et al., 2017). En un estudio realizado por Esparza-Leal et al. (2017) donde L. vannamei estuvo expuesto a biofloc de baja salinidad y limitada luz, los autores observaron diversidad en los recuentos totales de bacterias como Vibrio y bacilos.

- AGOSTO 2019 Tabla 3: Valores promedios (± desviación estándar) del rendimiento zootécnico de Litopenaeus vannamei en los tratamientos: Fotoperíodo natural (NP), 24 h de luz (24hLI) y 24 h de oscuridad (24hDA) después de 70 días. Las diferentes letras en superíndice en una fila, denotan diferencias significativas (P <.05) entre tratamientos. Tratamientos

Initial weight (g) Final Weight (g) Survival (%) FCR Yield (Kg/m³) Growth rate (g/Week) Weekly growth after 1 g

NP

24hLI

24hDA

0.053 ± 0.010 8.62 ± 0.98 ᵃ 90.12 ± 9.70ᵃ 1.32 ± 0.08ᵃ 3.88 ± 0.05ᵃ 0.86 ± 0.09ᵃ 1.12 ± 0.18ᵃ

0.053 ± 0.010 7.60 ± 0.88 ᵃ 91.87 ± 10.4 ᵃ 1.43 ± 0.16 ᵃ 3.45 ± 0.07 ᵃ 0.75 ± 0.06 ᵃᵇ 0.99 ± 0.15 ᵃᵇ

0.053 ± 0.010 6.76 ± 0.49 ᵇ 69.67 ± 14.36ᵇ 2.47 ± 0.27ᵇ 2.33 ± 0.22ᵇ 0.61 ± 0.05ᵇ 0.73 ± 0.07ᵇ

Sin embargo, en este estudio, no fue posible identificar las especies de Vibrio.

como en niveles tróficos en el sistema de cultivo.

Hubo una mayor abundancia de ciliados en el sistema de tratamientos expuestos a la luz. Los ciliados funcionan como un indicador de calidad del agua (Decamp et al., 1999). En el presente estudio, fue posible encontrar una mayor cantidad de flagelados y ciliados en los tratamientos expuestos a la luz, en comparación con el tratamiento de restricción de luz, que tenía mayores concentraciones de flagelados heterotróficos.

Influencia de la luz en el análisis proximal Los microorganismos no solo se conocen como fuente importante de proteína, sino también para suplir los requerimientos de lípidos, minerales y vitaminas del camarón. Además, sirven como fuente potencial de enzimas exógenas que ayudan en la digestión (Decamp et al., 2003; Ballester et al., 2010; Becerril-Cortés et al., 2018). Los diferentes fotoperÍodos influyeron en la abundancia de la comunidad microbiana y, en consecuencia, hubo alteraciones en los niveles de lípidos y proteínas del biofloc con y sin restricción de luz, pero no hubo diferencias en los niveles de cenizas y fibras.

A lo largo del período de estudio, hubo una disminución en la concentración de flagelados y un aumento correspondiente en la concentración de ciliados. Este hecho puede estar relacionado con la depredación de flagelados autotróficos por ciliados, lo que ocurre en interacciones tróficas entre microorganismos en tanques de cultivo. Los nematodos son uno de los grupos más importantes en bioflocs. Además, la tasa de depredación de los organismos cultivados puede interferir con su concentración (Ray et al., 2010). Esta baja concentración puede estar relacionada con la depredación de nematodos por el camarón, lo que disminuye la depredación de bacterias, causando un mayor aumento en su concentración “de arriba abajo” (Carpenter y Kitchell, 1993). Sin embargo, se observó un aumento en la concentración de nematodos en el período final del estudio, principalmente en el tratamiento con restricción de luz (24hDA), que parecía no tener depredación de nematodos por el camarón. Por lo tanto, la presencia de luz influyó positivamente en la comunidad microbiana, tanto en abundancia

52

El porcentaje de lípidos en bioflocs expuestos a la luz, fue significativamente mayor que los valores registrados por Wasielesky et al. (2006); Ballester y col. (2010) y Emerenciano et al. (2012) (0.49, 0.47 y 0,47%, respectivamente) y fue similar a los valores encontrados por Silva et al. (2013) y Fugimura et al. (2015) (2.48 y 2.57%, respectivamente). Esta alta concentración de lípidos en este estudio puede estar relacionado con una mayor abundancia de flagelados, bacterias filamentosas, ciliados, bacterias cocoides y bacilos en los tratamientos con NP y 24hsLI. Los flagelados son una fuente de ácidos grasos poliinsaturados (PUFAS) y esteroles (Decamp et al., 2003). Una mayor abundancia de microorganismos puede contribuir a una mayor cantidad de ese nutriente. Además, nematodos, flagelados heterotróficos, cianobacterias filamentosas, ciliados y las bacterias heterotróficas unicelulares también tienen una alta relación con los lípidos y


PRODUCCIÓN

- AGOSTO 2019 funcionan como una importante fuente de lípidos para el camarón (Silva et al., 2008; Rocha et al., 2012a, 2012b). Los niveles de proteínas de los bioflocs para tratamientos expuestos a la luz fueron significativamente más altos que los del tratamiento con restricción de luz. Los valores de proteínas fueron similares a los reportados por otros autores (Ballester et al., 2010; Wasielesky et al., 2012; Gaona et al., 2016). Los niveles de proteínas encontrados en este estudio pueden estar relacionados con la abundancia de microorganismos y su contribución de proteínas en cada tratamiento. De acuerdo con Silva et al. (2008), los nematodos, bacterias cocoides y las bacterias tipo Bacillus son importantes fuentes de proteínas. En los tratamientos con NP y (24hLI, se observaron concentraciones más altas de bacterias cocoides y bacilos que en el tratamiento con 24hDA, por lo que estos organismos pueden haber contribuido a los valores de proteínas en los tratamientos. Estos resultados corroboran los de Rocha et al. (2012a, 2012b), quienes encontraron que los bioflocs con un nivel más alto de proteína cruda, cerca del 30%, tenían una mayor abundancia de bacterias de tipo cocoide, mientras que los bioflocs con niveles más bajos de proteína, mostraron una abundancia más baja de bacterias de tipo cocoide en el mismo período. Los niveles de cenizas de los flakes microbianos en el cultivo del camarón juvenil L.vannamei en el sistema BFT fueron similares a los altos niveles de cenizas encontrados por los autores Wasielesky et al. (2006), Silva et al. (2008), y Gaona et al. (2016) (44.85%, 45.50 y 55.51%, respectivamente). Tacon et al. (2002) encontraron que los flakes son ricos en fósforo, calcio, potasio y magnesio, entre otros. La abundancia de fibras corrobora lo observado por Silva et al. (2013), Arias Moscoso et al. (2016) y Gaona et al. (2016) Influencia de la luz en el rendimiento zootécnico La presencia de luz en el cultivo de L. vannamei influyó positivamente en el rendimiento del crecimiento. La abundancia de la comunidad microbiana y los cambios en el comportamiento animal asociados con la presencia de luz, pueden ayudar a explicar estas diferencias.

Los estudios muestran que el camarón blanco del Pacífico tiene la capacidad de aprovechar la productividad natural en los sistemas de cultivo BFT (Hargreaves, 2013; Samocha et al., 2017). Los alimentos naturales sirven como una fuente suplementaria de nutrientes para el camarón, reflejando un rendimiento zootécnico en el aumento de peso y las tasas de conversión alimenticia (Wasielesky et al., 2006; Becerril-Cortés et al., 2018). La actividad de L. vannamei es mostrada en la fase clara y oscura; sin embargo, esta actividad varía de acuerdo a comportamientos específicos. El desempeño de la natación ocurre principalmente de noche, y la exploración del sustrato (búsqueda de alimento) ocurre en ambas fases, pero los animales tienden a iniciar el consumo de alimentos durante las horas de fase despejada (Pontes y Arruda, 2005; Pontes, 2006). Este estudio mostró variaciones en la tasa de supervivencia con diferencias significativas entre los tratamientos (NP, 24HLI y 24hDA); los tratamientos con exposición a la luz lograron tasas de supervivencia más altas que las del tratamiento con restricción de luz. Estos resultados corroboran los de Wasielesky et al. (2012) y Baloi et al. (2013), y los resultados para los tratamientos con restricción de luz fueron similares a los descritos por Neal et al. (2010) Si bien no fue posible identificar dinoflagelados, la baja tasa de supervivencia en el tratamiento con restricción total de luz podría atribuirse a la presencia del orden Gymnodiniales ya que algunas especies de Gymnodiniales tienen cierta toxicidad (Smayda, 2002). Además, los dinoflagelados no fotosintéticos absorben compuestos orgánicos disueltos y pueden sobrevivir en profundidades no iluminadas, y en agua y sedimentos, y se benefician en los meses de verano (Taylor et al., 2008). Las tasas de conversión alimenticia del presente estudio en los tratamientos expuestos a la luz (fotoperíodo natural y luz de 24 h) se consideran bajas en comparación con otros estudios con restricción de luz (24hDA) en sistemas de biofloc (Wasielesky et al., 2012; Baloi et al., 2013; Esparza-Leal et al., 2017), y los resultados del tratamiento con restricción de luz (24hDA) son similares a los de Neal et al. (2010) y Baloi et al. (2013).

53

La presencia de luz proporcionó una mayor disponibilidad de microorganismos en el sistema de cultivo tales como bacterias, protozoos y organismos fotoautótrofos, generando así un biofloc con una mayor concentración de proteínas y lípidos, que sirvió como fuente suplementaria que reflejando un mejor FCR. La tasa de crecimiento y el peso final fueron significativamente mayores en los tratamientos expuestos a la luz (NP y 24hLI) en comparación con los del tratamiento de restricción de luz. En los tratamientos con NP y 24hLI, una gran cantidad de microorganismos, principalmente organismos fotoautótrofos, contribuyeron a la producción primaria de alimento, influyendo en la tasa de lípidos en los bioflocs. La mayor abundancia de microorganismos también puede contribuir al contenido de proteínas en el flake; sin embargo, este hecho pudo haber influido en el crecimiento del camarón, resultando en un mayor peso específico. Los resultados de rendimiento son diferentes de los reportados por Esparza-Leal et al. (2017) y similar a Guo et al. (2012), Wasielesky et al. (2012) y Baloi et al. (2013) La restricción de la luz proporcionó una mejor nitrificación, evitando la foto inhibición de las bacterias nitrificantes y la generación de una mejor calidad de agua debido al crecimiento de bacterias heterotróficas. Por lo tanto, los nutrientes estaban destinados a estas bacterias, evitando la competencia con los organismos fotoautótrofos por los nutrientes. Por otro lado, la presencia de luz resultó en una mayor abundancia de bacterias, protozoos y organismos fotoautótrofos, que generaron mayores concentraciones de lípidos y proteínas, contribuyendo como una fuente adicional de alimento para el camarón.

Conclusión La presencia de luz influye positivamente en la abundancia de microorganismos, lo que refleja un mejor rendimiento de L. vannamei. Los resultados sugieren que el tratamiento con fotoperíodo (NP) es el indicado para el cultivo con sistema BFT● Para mayor información sobre este artículo escriba a: dariano.krummenauer@furg.br


PRODUCCIÓN

- AGOSTO 2019

Toxicidad del amoníaco, nitrito y nitrato para juveniles de Litopenaeus vannamei en agua de baja salinidad en experimentos de exposición única y ternaria, y sus implicaciones ambientales Autores: Gladys Valencia-Castañeda a, Martín G. Frías-Espericueta b, Ruth C. Vanegas-Pérez c, María C. Chávez-Sánchez d, Federico Páez-Osuna e,f,*

a Posgrado en Ciencias del Mar y Limnología, ICML-UNAM, Unidad Académica Mazatlán, Joel Montes Camarena s/n, Mazatlán, 82040, Sinaloa, México b Facultad de Ciencias del Mar, Universidad Autónoma de Sinaloa, Paseo Claussen s/n, Mazatlán, 82000, Sinaloa, México c Facultad de Ciencias, Universidad Nacional Autónoma de México, México, D.F. 04510, México d Centro de Investigación en Alimentación y Desarrollo, Av. Sábalo Cerritos s/n, Mazatlán, 82112, Sinaloa, México e Instituto de Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México, Unidad Académica Mazatlán, Joel Montes Camarena s/n, Mazatlán, 82040, Sinaloa, México f Miembro de El Colegio de Sinaloa, Centro, Culiacán, 80000, Sinaloa, México

paezos@ola.icmyl.unam.mx

E

n los últimos años, el cultivo de camarón ha alcanzado un crecimiento acelerado en las zonas costeras tropicales y subtropicales de todo el mundo. La alta tolerancia de L. vannamei a bajas salinidades y la disponibilidad de postlarvas (PL) durante todo el año, hacen de esta especie un excelente candidato para el cultivo. En 2015, la producción mundial del cultivo de camarón de L. vannamei fue de aproximadamente 3.9 millones de toneladas, de las cuales el 19.0% correspondió a cultivos en agua dulce o baja salinidad (FAO, 2017).

alcanzar niveles altos debido a los productos de desecho nitrogenados relacionados con la alta densidad del camarón, el exceso de alimentación y, por lo tanto, la producción de heces, así como el aumento de la descomposición de la materia orgánica (Hargreaves, 1998), lo que lleva a concentraciones elevadas de amoníaco, nitrito y nitrato que pueden afectar la salud de los organismos impactando negativamente el crecimiento y la supervivencia, y por lo tanto, la producción del camarón (Chen et al., 1989; Lin y Chen, 2003; Kim et al., 2019).

Se han propuesto muchas ventajas de desarrollar el cultivo de camarón marino en agua dulce o de baja salinidad (por ejemplo, minimiza el impacto de las enfermedades; evita la liberación de especies no nativas; cercanía de las fincas a los mercados; desarrollo potencial de la acuicultura acoplada a sistemas agrícolas) (Samocha et al., 2004; Mariscal-Lagarda et al., 2012; Chang et al., 2015).

En los ecosistemas naturales, generalmente los compuestos de nitrógeno mantienen niveles bajos, ya que los procesos naturales diluyen estos nutrientes y son asimilados por las plantas acuáticas y microbios. Sin embargo, debido al incremento de las actividades antropogénicas asociadas con el crecimiento de la población, los niveles de estos nutrientes han aumentado en las aguas costeras (Valiela, 2006).

Sin embargo, en ambientes de baja salinidad surgen varios problemas, como la disminución de tolerancia de especies de camarón al nitrógeno compuesto (Romano y Zeng, 2013; Valencia-Castañeda et al., 2018), lo que representa un gran problema de baja salinidad en cultivos en tierra. Durante el período de cultivo, las concentraciones in situ de compuestos de nitrógeno pueden

La procedencia de estos nutrientes está relacionada con una variedad de fuentes asociadas a la agricultura, acuicultura, ganadería, la deposición atmosférica, conversión de uso de suelo, alcantarillado de áreas domésticas y urbanas (Valiela, 2006; Romano y Zeng, 2013). Durante la etapa de postlarvas y juveniles, los camarones salvajes L. vannamei habitan y se alimentan en los

55


PRODUCCIÓN sistemas de lagunas y esteros (Hendrickx, 2001), donde pueden exponerse a aguas de baja salinidad impactadas por efluentes que ejercen numerosos efectos adversos por las concentraciones moderadas o altas de compuestos nitrogenados. La biogeoquímica del nitrógeno de ambientes costeros (estuarios y lagunas) y los estanques de camarón, está dominada por la transformación biológica de N agregado en forma de fertilizantes inorgánicos y orgánicos, alimentos, efluentes municipales y agrícolas, y cargas de la atmósfera; además, la columna de sedimentos funciona como una fuente de amoníaco y un sumidero de nitrato y nitrito (Hargreaves, 1998). La nitrificación es un proceso aeróbico realizado por bacterias nitrificantes que, en comparación con los heterótrofos, liberan diferentes metabolitos. Eventualmente se producen grandes cantidades de desechos similares al lodo durante el metabolismo heterotrófico aeróbico. La acumulación de bacterias heterotróficas y sus desechos evita la actividad de Nitrosomonas y Nitrobacter. Los heterótrofos asimilan el amoníaco y consumen oxígeno antes de llegar a los nitrificadores. En presencia de una gran cantidad de tasa de carga orgánica (p. ej., heces y alimento no consumido en estanques; materia orgánica de diversas fuentes en lagunas costeras (detritos de manglar, efluentes municipales, etc.), nitrificadores superados por bacterias heterotróficas (Sepehri y Sarrafzadeh, 2018). Está claro que en ambientes naturales y en estanques de camarón, dependiendo de las condiciones fisicoquímicas, las cargas de nitrógeno y el manejo, se alcanzan por varias concentraciones de amoníaco, nitrito y nitrato interactuando con la biota, incluyendo a los camarones. La mayoría de los estudios disponibles sobre la toxicidad de los compuestos de nitrógeno en camarón han considerado una exposición única (Romano y Zeng, 2013), mientras que en los ecosistemas naturales y en estanques comerciales, el camarón está expuesto al efecto combinado de estos compuestos. El número limitado de estudios sobre la toxicidad combinada con compuestos de nitrógeno encontró efectos sinérgicos y

- AGOSTO 2019 antagonistas en diferentes tiempos de exposición, y solo evalúa combinaciones binarias de compuestos de nitrógeno (amoníaco y nitrito, Alcaraz et al., 1999; nitrito y nitrato Cheng y Chen, 2002a; amoníaco y nitrito, Schuler et al., 2010). Por el contrario, se han documentado numerosos estudios que evalúan en mezclas únicas y mezclas varias de toxicidad de metales pesados​​ y/u otros productos químicos (compuestos orgánicos) en diferentes grupos taxonómicos como en peces (Feng et al., 2015; Yan et al., 2016), moluscos (Pearson et al., 2018; Zheng et al., 2018) y crustáceos (Sung et al., 2014; De Liguoro et al., 2018), estudios documentan que el comportamiento de las interacciones es muy variable. A partir de estos hallazgos, es de particular importancia el desarrollo de pruebas de toxicidad considerando la co-exposición de la mezcla de tres compuestos de nitrógeno para evaluar las respuestas antagonistas y/o sinérgicas en condiciones de baja salinidad en el camarón, ya que lo que está disponible (estudios binarios) se han desarrollado en salinidades superiores. Conociendo la importancia del cultivo de L. vannamei en aguas continentales y la escasa o nula información sobre la toxicidad conjunta de los compuestos de nitrógeno, así como la concurrencia de niveles elevados en los sistemas naturales y de cultivo, el objetivo de este estudio es determinar los efectos tóxicos agudos del amoníaco, nitrito y nitrato en exposición única y combinada (ternaria) en juveniles de L. vannamei a una salinidad de 3 g/L, así como para estimar los niveles de seguridad para el cultivo de esta especie y predecir los efectos del deterioro de la calidad del agua en ecosistemas costeros naturales donde habita este peneido.

Materiales y métodos Organismos experimentales y aclimatación Los juveniles de L. vannamei (3.3 g de peso húmedo) cultivados a una salinidad de 2 g/L fueron provistos por una granja comercial ubicada en Rosario, Sinaloa, México y transportados al módulo experimental Yum Kaax en la ciudad de Mazatlán, Sinaloa, México. Los camarones se aclimataron a una salinidad de 3 g/L durante 48 h y se mantuvieron en un período de habituación de 72 h antes de comenzar las pruebas de

56

toxicidad. Las mediciones de conductividad eléctrica (CE) se utilizaron para estimar la salinidad utilizando un medidor de CE (Oakton TDS 5; Vernon Hills, EE. UU.). La tasa de supervivencia del camarón durante la aclimatación fue del 98%. La tasa de aclimatación y el procedimiento que se utilizó fue según Li et al. (2008). La salinidad experimental (3 g/L) representa la salinidad promedio representativa de cultivos de bajo nivel de agua de L. vannamei (Roy et al., 2010), así como una salinidad característica de las zonas de hipohalina ubicadas en la parte interior de las lagunas costeras donde habita el camarón (Hendrickx, 2001). Durante la aclimatación y la habituación, los organismos se mantuvieron en tanques de polietileno de 400 L a 28 °C con períodos diurnos y nocturnos de 12 h, renovación de agua (50%) cada 24 h y niveles de oxígeno disuelto saturado con aireadores de piedras; los camarones fueron alimentados ad libitum 2 veces al día con alimento balanceado comercial (40% de proteína, 5% de grasa, 5% de fibra, Provimi, Animalnutri México S.A. de C.V.), hasta el inicio de las pruebas. Solo los juveniles en fase de muda fueron seleccionados para ensayos de toxicidad. La etapa de muda se determinó observando los urópodos bajo un microscopio (Wassenberg y Hill, 1984). Preparación de soluciones prueba Se usó agua de mar (salinidad, 34 g/L) en cada una de las soluciones prueba que se filtró a través de un sistema de filtros de 10 y 5 μm, filtro de carbón activado y radiación ultravioleta, y se diluyó a una salinidad de 3 g/L con agua (conductividad eléctrica, 290 μS/cm; sólidos disueltos, 0.182 g/L) previamente filtrados a través de un sistema de filtración de lecho profundo WaterTec® (Tucson, AZ) (grava, zeolita, arena, arcilla y carbón activado). El agua de baja salinidad a 3 g/L de salinidad utilizada para los experimentos tenía una concentración de fosfato y alcalinidad de 0.125 + 0.002 mg/ L y 185.5 + 7.3 mg/L (como carbonato), respectivamente. Las soluciones madre de amoníaco, nitrito y nitrato se prepararon disolviendo 115.20 g de NH4Cl (30,000 mg/L de nitrógeno


PRODUCCIÓN

- AGOSTO 2019 amoniacal total (TAN)), 49.28 g de NaNO2 (100,000 mg/L de nitrógeno como nitrito (NO2−-N)) y 151.79 g de NaNO3 (25,000 mg/L de nitrógeno como nitrato (NO3−-N)) en 1 L de agua milli-Q, respectivamente. Las concentraciones experimentales para la exposición única y combinada al amoníaco, nitrito y nitrato se seleccionaron de pruebas preliminares, para determinar su intervalo de toxicidad. Las concentraciones nominales seleccionadas de TAN, NO2−- N y NO3−- N para exposición única fueron 0, 10, 20, 40, 60, 80, 100, 120 y 150 mg de TAN/L; 0, 10, 20, 30, 40, 50, 70, 90 y 100 mg de NO2−- N/L; y 0, 200, 400, 600, 800, 1000, 1200, 1500 y 1800 mg de NO3−-N/L. En la prueba de toxicidad combinada, se consideró una relación de toxicidad (TR) de amoníaco, nitrito y nitrato de 1: 1: 1 en base a los valores de LC50 determinados previos a la exposición única. Las TU (Unidades de toxicidad) seleccionadas fueron 0.00, 0.50, 0.75, 1.00, 1.50, 2.00, 2.50, 2.75 y 3.00. TR y TU, calculadas de acuerdo a Sprague y Ramsay (1965), lo que nos permitió evaluar la toxicidad de las interacciones de los compuestos de nitrógeno: sinérgicos, antagonistas o aditivos. En los sistemas natural y de cultivo, el amoníaco, el nitrito y el nitrato están presentes en niveles y proporciones que dependen de numerosos factores (es decir, parámetros fisicoquímicos, cargas y sumideros). Tal proporción 1:1:1 utilizada en nuestro estudio, es equivalente a una proporción molar TAN: NO2−-N: NO3−-N de 1: 0.4: 32 que corresponde a un escenario típico dominado por nitrato en ambientes aeróbicos marinos o hipohalinos (Millero, 2006). Prueba de toxicidad Las pruebas de toxicidad se llevaron a cabo utilizando el método de renovación estática en el que las soluciones tóxicas se renovaron diariamente (Buikema et al., 1982). Se tomaron al azar grupos de 10 camarones aclimatados (3.3 g) de los tanques y fueron transferidos a cada contenedor de prueba y control con 10 L de las soluciones prueba para exposiciones a compuestos de nitrógeno individuales y combinados.

Tabla 1: Porcentajes de mortalidad acumulada en juveniles de L. vannamei expuestos a diferentes concentraciones de TAN, NO2 −- N y NO3 −-N solo (mg/L) y combinado (TU) a 3 g/L de salinidad a 24, 48, 72 y 96 h de exposición.

Tiempo

24 48 72 96

TAN (mg/L) 0 0 0 0 0

10 0 0 0 3.3

20 0 0 3.3 13.3

40 0 3.3 6.7 16.7

50 10 16.7 20 43.3

60 13.3 30 40 63.3

80 16.7 60 66.7 90

90 53.3 86.7 96.7 100

110 76.7 100 100 100

7.5 0 3.3 10 16.7

10 0 6.7 26.7 33.3

15 0 16.7 30 46.7

20 0 16.7 30 46.7

30 10 30 43.3 73.3

40 43.3 93.3 100 100

50 76.7 100 100 100

800 0 0 3.3 23.3

1200 0 16.7 40 53.3

1600 0 23.3 53.3 60

2000 3.3 40 66.7 86.7

2400 30 53.3 80 96.7

2600 46.7 66.7 100 100

2800 50 73.3 100 100

1 0 6.7 6.7 30

1.5 6.7 40 43.3 73.3

2 16.7 53.3 60 93.3

2.5 56.7 93.3 93.3 100

2.75 73.3 100 100 100

3 83.3 100 100 100

NO2 −-N (mg/L) 24 48 72 96

5 0 0 0 3.3

0 0 0 0 0

NO3 −-N (mg/L) 24 48 72 96

400 0 0 0 3.3

0 0 0 0 0

TAN/ NO2−-N/NO3−-N (TU) 24 48 72 96

0.5 0 0 0 6.7

0 0 0 0 0

0.75 0 0 3.3 13.3

Cada prueba de toxicidad se realizó por triplicado. Por lo tanto, se usaron 270 juveniles en cada prueba de toxicidad, dando un total de 1080 organismos. Durante las pruebas de toxicidad, se proporcionó aireación continua y los parámetros se mantuvieron a 26.0 ± 0.5 °C (25.8–26.3 °C) de temperatura, 6.0 ± 0.3 mg/L (5.8–6.3 mg/L) de oxígeno disuelto y 8.2 ± 0.2 (8.0–8.3) de pH. Los organismos se alimentaron cada 12 h con pellets (Provimi, Animalnutri México S.A. de C.V.). La mortalidad se verificó cada 12 h durante las 96 h de exposición, y los camarones muertos se retiraron inmediatamente de los contenedores. Las concentraciones nominales de amoníaco, nitrito y nitrato se verificaron cada 24 h antes y después de que se renovara cada solución prueba (100%) de acuerdo con métodos colorimétricos estándar (Grassho et al., 1990).

57

Análisis estadístico El LC50 y el TU50 para la exposición única y combinada de TAN, NO2−- N y NO3−- N y sus límites de confianza del 95%, se calcularon mediante el método Probit (ValenciaCastañeda et al., 2018). Se realizó una prueba de comparación entre los valores de LC50 (prueba Z) para establecer diferencias significativas entre LC50 (p < 0.05). Los niveles seguros se estimaron utilizando un factor de aplicación (f) de 0.05; es decir, multiplicando la LC50 de 96-h y la TU50 por f (Ramírez-Rochín et al., 2016). Para los valores de LC50 de amoníaco, las concentraciones se expresaron como mg/L de TAN y NH3-N, y este último se calculó de acuerdo con el correspondiente constante de equilibrio (Soderberg y Meade, 1991) para la salinidad, temperatura y pH registrado.


PRODUCCIÓN

- AGOSTO 2019

Fig. 1. Balance de masa para el nitrógeno amoniacal total (TAN) en el sistema experimental utilizando recipientes con 10 L de soluciones prueba, 10 camarones juveniles (3.3 g) cuando la solución tóxica se renueva diariamente (24 h).

Fig. 2. Valores de LC50 (+ error estándar) de TAN, NH3-N, NO2 −-N y NO3 −-N (mg/L) a las 24, 48, 72 y 96 h de exposición a juveniles de L. vannamei a salinidad de 3 g/L. Los intervalos de confianza del 95% se muestran entre paréntesis. Las diferentes letras indican diferencias significativas en los valores de LC50 entre los diferentes tiempos de exposición.

Resultados En cada una de las pruebas de toxicidad, las concentraciones de amoníaco, nitrito y nitrato determinadas cada 24 h estaban dentro del 10% de la concentración nominal, lo cual es una diferencia aceptable para pruebas de toxicidad (Buikema et al., 1982). Además, las diferencias en cada compuesto de nitrógeno medida antes y después de la renovación diaria de las soluciones experimentales, no diferían significativamente (p < 0.05). Para verificar la baja variación de N en los experimentos, se elaboró ​​ un balance de masa (Fig. 1) considerando las entradas y salidas en el contenedor en el que se

usaron los niveles más bajos de compuestos nitrogenados, es decir, pruebas TAN (10–150 mg/L de TAN). Los camarones excretan principalmente amoníaco (˜70%) y otros compuestos orgánicos (Lee y Chen, 2003); Zhang y col. (2009) cuantificaron una tasa de excreción de 0.05 μmol de amoníaco-N g−1 h− 1 para juveniles de L. vannamei en agua de baja salinidad; por lo tanto, 10 camarones (3.3 g) durante 24 h excretan 0.554 mg de TAN. Aproximadamente la alimentación de 10 camarones consistió en 1.65 g de alimento por 24 h conteniendo 6.4% de N (40%

58

de proteína) implica 105.6 mg de N; los camarones asimilan solo una fracción de ~27% (Páez-Osuna et al., 1997) del alimento, el resto se disuelve parcialmente, pero la mayor parte se deposita en el fondo del recipiente, como alimentos y heces no consumidos; suponiendo que el 10 o el 20% del N depositado se solubiliza durante las 24 h, por lo tanto, se podrían sumar 7.7 o 15.4 mg de N a la solución prueba, es decir, entre 0.5 (para niveles altos de TAN) y 15.2% (para niveles bajos de TAN) de las concentraciones nominales de TAN. La desnitrificación es un proceso anaeróbico, que requiere la presencia


PRODUCCIÓN

- AGOSTO 2019 de bacterias desnitrificantes en los sedimentos. Por ausencia de sedimentos en nuestro experimento, la desnitrificación probablemente es insignificante. Por otro lado, la volatilización del amoníaco ocurre en condiciones en las que se desarrollaron los experimentos; considerando un flujo de 50 mg m−2 d− 1 (Hargreaves, 1998) o el doble (por aireación), implica flujos de salida de 4.5 o 9.0 mg de N por día. La suma de los aportes de TAN por excreción y alimentación (heces solubilizadas y alimento no consumido) de camarón da 8.25 o 15.9 mg de TAN, mientras que la producción de TAN estimada a partir de la volatilización del amoníaco da 7.7 o 15.4 mg de TAN. Ignorando la TAN capturada por camarón de la solución prueba, el balance de masa da un acumulado neto de 0.4 a 0.5 mg de TAN, que es del orden de incertidumbres analíticas. Este balance de masas muestra que las entradas y salidas de TAN en estos experimentos de toxicidad aguda, son relativamente bajas. Sin embargo, demuestra que el TAN solubilizado de heces y alimento no consumido, podría ser significativo para las bajas concentraciones de las soluciones prueba. No se observaron muertes en los grupos control, lo que garantiza que los efectos observados en las concentraciones experimentales se debieron a la acción tóxica única o combinada de los compuestos de nitrógeno. En la Tabla 1 se muestra la mortalidad acumulada a las 24, 48, 72 y 96 h de la toxicidad individual y combinada para los compuestos nitrogenados. Los valores de LC50 a las 24, 48, 72 y 96 h de TAN para juveniles de L. vannamei a una salinidad de 3 g/L fueron 116.3, 44.6, 39.6 y 29.0 mg/L, respectivamente, mientras que los valores de LC50 de NH3-N a las 24, 48, 72 y 96 h fueron 10.1, 3.9, 3.4 y 2.5 mg/L,

Fig. 3. Valores de TU50 (+ error estándar) de la mezcla TAN/NO2 −- N/NO3 −- N (mg/L) a las 24, 48, 72 y 96 h de exposición en juveniles de L. vannamei a una salinidad de 3 g/L. Los intervalos de confianza del 95% se muestran entre paréntesis. Las diferentes letras, indican diferencias significativas en los valores de LC50 entre diferentes tiempos de exposición.

respectivamente. Los valores de LC50 para 24, 48, 72 y 96 h de NO2−-N y NO3−-N para L. vannamei a una salinidad de 3 g/L fueron 58.5, 15.4, 12.4 y 10.6 mg/L y 4874, 2254, 1091 y 900 mg/L , respectivamente (Fig. 2). De acuerdo con la toxicidad individual aguda de TAN, NO2−-N y NO3−-N en juveniles de L. vannamei, los valores de LC50 a 96 h con una salinidad de 3 g/L fueron 29.00, 10.6 y 900.09 mg/L, respectivamente. Cuando se considera la exposición combinada de los compuestos de nitrógeno a una relación de toxicidad de 1: 1: 1, las interacciones de amoníaco, nitrito y nitrato mostraron diferentes patrones de toxicidad a medida que el tiempo de exposición aumentó de 24 a 96 h. Por lo tanto, las TU de esta mezcla se definen como la suma de 9.7, 3.5 y 300 mg/L de TAN, NO2 −- N y NO3 −-N, respectivamente. La mortalidad del camarón cuando se expone a la mezcla de los tres compuestos de nitrógeno (TAN/NO− -N/NO −-N) a las 96 h a TUs de 0.5, 0.7, 1.0, 1.5, 2.0 y 2.5, las mortalidades acumuladas registradas

fueron 6.7, 13.3, 30.0, 73.3, 93.3 y 100%, respectivamente (Tabla 1). Los valores de TU50 de la mezcla de TAN/NO2 − - N/NO3 −-N a las 24, 48, 72 y 96 h fueron 2.50, 1.17, 1.12 y 0.99, respectivamente (Fig. 3). Los valores de TU50 a las 24, 48 y 72 h son mayores que la unidad 1.00; sin embargo, de acuerdo con los límites de confianza, el 1.12 TU50 muestra valores que van desde 1.00 – 1.20, lo que indica un comportamiento que es aditivo y/o ligeramente antagónico. Por lo tanto, el efecto de la combinación de los tres compuestos de nitrógeno es antagonista de 24 a 72 h de exposición; por lo contrario, a las 96 h, el TU50 es 0.99, lo que indica un efecto aditivo, donde las concentraciones equivalentes de cada compuesto de nitrógeno en la mezcla, refleja una suma igual o similar a 1 TU (Fig. 3 y Tabla 2). Los valores de LC50 a las 24 h de TAN, NH3-N y NO2 −- N mostraron diferencias significativas con respecto a los valores de CL50 de 48, 72

Tabla 2: Concentraciones equivalentes de TU50 de la mezcla TAN/NO2 − -N/NO3 −-N y LC50 única en juveniles de L. vannamei expuestos a una salinidad de 3 g/L. TU50 concentración equivalente

LC50 solo

Tiempo (h)

TU

TAN

NO2 −-N

NO3−-N

TAN

NO2 −-N

NO3−-N

24 48 72 96

2.5 (2.0, 3.1) 1.2 (1.1, 1.3) 1.1 (1.0, 1.2)

24.2 11.3 10.0

4.1 1.9 1.8

1125 351 336

58.5 15.4 12.4

4874 2254 1091

1.0 (0.9, 1.1)

9.6

1.6

297

116 44.6 39.6 29.0

10.6

900

59


PRODUCCIÓN

- AGOSTO 2019

Tabla 3: Valores de CL50 de TAN, NO2 −- N y NO3 −- N (mg/L) en juveniles de L. vannamei.

Nitrogenous compound

TAN:

Talla (g)

Salinidad (g/L)

LC50

Referencia

24h

48h

72h

96h

3.8 1.0 22 mm 22 mm 22 mm 3.3

35 35 15 25 35 3

120 59.7 66.4 68.8 116

111 92.5 40.6 48.8 53.8 44.6

84.5 69.2 32.1 43.2 44.9 39.6

70.2 64.2 24.4 35.4 39.5 29.0

Frías-Espericueta et al. (1999) Frías-Espericueta et al. (1999) Lin and Chen (2001) Lin and Chen (2001) Lin and Chen (2001) This study

3.9 3.9 3.9 0.21 0.08 0.70 0.62 4.4 4.4 4.4 3.3

15 25 35 2 2 2 3 2 1 0.6 3

188 274 521 30.4 21.4 31.3 19.4 14.4 8.1 55.5

142 244 423 16.4 13.9 24.3 15.4 9.6 7.9 15.4

92.5 225 375 10.4 11.2 20.3 13.4 8.8 6.8 12.4

76.5 178 321 8.9 9.6 8.4 15.2 12.4 7.0 5.7 10.6

Lin and Chen (2003) Lin and Chen (2003) Lin and Chen (2003) Gross et al. (2004) Gross et al. (2004) Sowers et al. (2004) Wang et al. (2006) Ramírez-Rochín et al. (2016) Ramírez-Rochín et al. (2016) Ramírez-Rochín et al. (2016) This study

3.3

3

4874

2254

1091

900

This study

NO2 −-N:

NO3 −-N:

y 96 h (p < 0.05). En el caso del nitrato, los valores de LC50 fueron significativamente diferentes en todos los tiempos de exposición (p < 0.05) (Fig. 2). Los valores de TU a las 24 h de la mezcla (TAN/NO2−-N/NO3−-N) mostraron diferencias significativas con respecto a los valores de TU50 a las 48, 72 y 96 h de exposición (p < 0.05) (Fig. 3). De acuerdo con los valores de LC50 a las 96 h de amoníaco, nitrito y nitrato, los niveles de seguridad para los juveniles de L. vannamei se estimaron en una salinidad de 3 g/L con el factor de aplicación de 0.05 (Boyd y Tucker, 1998). Los niveles de seguridad de TAN, NH3-N, NO2 −-N y NO3 −-N fueron 1.45, 0.13, 0.53 y 45.00 mg/L, respectivamente. El nivel de seguridad de la mezcla TAN/NO2 − -N/NO3 −-N es 0.050 TU, correspondiente a 0.48 0.08 y 14.58 mg/L de TAN, NO2 −-N y NO3 −-N, respectivamente.

Discusión Varios autores (por ejemplo, Romano y Zeng, 2013) han estudiado la toxicidad del amoníaco en peneidos juveniles; la Tabla 3

muestra los valores de CL50 de TAN (mg/L) a diferentes horas de exposición para juveniles de L. vannamei expuestos a diferentes ambientes de salinidad. Los estudios de toxicidad aguda de amoníaco en juveniles de L. vannamei en aguas de baja salinidad (< 5 g/L) son limitados. El valor de 96 h-LC50 estimado en este estudio para juveniles de L. vannamei fue menor (29.0 mg/L de TAN) que el valor estimado por Frías-Espericueta et al. (1999) en juveniles de tamaño similar pero a una salinidad de 35 g/L (70.2 mg/L de TAN), lo que indica que la toxicidad del amoníaco en juveniles de L. vannamei aumenta a una magnitud cercana al 40% en aguas de baja salinidad (3 g/L) (Tabla 3). La toxicidad aguda del nitrito en crustáceos ha sido sustancialmente menos estudiada que la del amoníaco. Sin embargo, la información disponible sugiere que el pH, la salinidad y las etapas de desarrollo, son los principales factores que influyen en la toxicidad (Romano y Zeng, 2013).

60

En comparación con los estudios de toxicidad de amoníaco, hay un número considerable de estudios de toxicidad aguda de nitrito en ambientes de baja salinidad en juveniles de L. vannamei (Gross et al., 2004; Sowers et al., 2004; Wang et al., 2006; Ramírez-Rochín et al., 2016). El valor de 96 h-LC50 de NO2 −-N estimado en el este trabajo para juveniles de 3.3 g (10.3 mg/L de NO2 −- N) es similar al valor registrado por Ramírez-Rochín et al. (2016) a una salinidad de 2 g/L (12.4 mg/L de NO2 −- N). En el caso de los valores de LC50 a las 96 h estimados por Gross et al. (2004) y Sowers et al. (2004) para juveniles de L. vannamei a una salinidad de 2 g/L, los valores son ligeramente más bajos que los de este estudio (10.6 mg/L de NO2 −-N). La mayor tolerancia de los organismos en este trabajo puede deberse a que eran de mayor tamaño (Tabla 3). La toxicidad del nitrato es significativamente menor en comparación con la del amoníaco y el nitrito; por lo tanto, no es sorprendente que este compuesto sea el menos estudiado entre las tres especies nitrogenadas


PRODUCCIÓN

- AGOSTO 2019

disueltas. La información sobre la toxicidad aguda del nitrato se limita a solo un pequeño número de especies de decápodos, incluidos Cherax destructor (Gomez-Isaza et al., 2018) y Penaeus pelagicus y Scylla serrata (Romano y Zeng, 2007a, 2007b). La toxicidad del nitrato en invertebrados acuáticos aumenta con el incremento de las concentraciones de nitrato y el tiempo de exposición (Camargo y Ward, 1992; Tsai y Chen, 2002). En contraste, la toxicidad del nitrato disminuye con el aumento del tamaño corporal y la salinidad del agua (Camargo y Ward, 1992, 1995; Tsai y Chen, 2002). Para los estudios de toxicidad aguda de nitrato en camarones peneidos, solo se han realizado dos estudios con juveniles de la especie P. monodon (Romano y Zeng, 2009; Tsai y Chen, 2002). No es posible hacer una comparación de la tolerancia al nitrato de L. vannamei y P. monodon porque los tamaños de los organismos experimentales fueron muy diferentes; además, P. monodon se expuso en aguas salobres y marinas (> 15 g/L de salinidad), mientras que L. vannamei se expuso a una salinidad de 3 g/L. La data generada en nuestro estudio constituye el comienzo de nuevas investigaciones de toxicidad de nitrato en aguas de baja salinidad con la especie L. vannamei y nos permite hacer comparaciones sobre la tolerancia entre diferentes especies, edades y salinidades. Estudios de toxicidad aguda de mezclas de compuestos nitrogenados en crustáceos, se reducen a tres especies de camarones peneidos a salinidades > 25 g/L, así como a L. vannamei en ambientes de baja salinidad (10 g/L); mientras que para los camarones de agua dulce solo hay un estudio sobre la toxicidad combinada de compuestos nitrogenados (Macrobachium ronsebergii). Chen y Chin (1988) expusieron postlarvas (PL6) de camarón P. monodon a una mezcla de amoníaco y nitrito. Cuando la relación de toxicidad de la mezcla de amoníaco y nitrito fue de 1: 1, los valores de CL50 a las 48, 72 y 96 h fueron 2.20, 1.43 y 0.84 TU, respectivamente, lo que es equivalente a 12.7 mg/L de TAN (0.6 mg/L de NH3-N) y

más de 14.9 mg/L de NO2 −-N; 8.23 mg/L de TAN (0.39 mg/L NH3-N) y más de 9.69 mg/L NO2 −-N; y 4.83 mg/L de TAN (0.23 mg/L de NH3-N) y más de 5.69 mg/L de NO2 − - N, respectivamente. Cuando la relación de toxicidad de la mezcla de amoníaco y nitrito fue de 5:1, los valores de CL50 a las 48, 72 y 96 h fueron 2.50, 1.56 y 0.85 TU, respectivamente, que fue equivalente a 23.98 mg/L de TAN (1.13 mg/L NH3-N) y más de 3.52 mg/L de NO2 −-N; y 8.15 mg/L de TAN (0.39 mg/L de NH3 -N) y más de 1.92 mg/L de NO2 −- N. Una mezcla de amoníaco y nitrito ejerció una mayor toxicidad que las concentraciones individuales de amoníaco o nitrito. El efecto combinado de amoníaco y nitrito en postlarvas de P. monodon fue antagónico durante 48 y 72 h de exposición, pero sinérgico después de 96 h de exposición. Postlarvas de P. setiferus fueron expuestas a niveles individuales agudos y a una combinación de amoníaco y nitrito; los valores de LC50 a las 72 h fueron 8.7 mg/L de TAN (1.12 mg/L de NH3-N) y 167.3 mg/L de NO2-N, y este último fue mucho menos tóxico que el amoníaco. El efecto combinado de amoníaco y nitrito (relación en peso: 1:29 y 1:39, respectivamente) en las postlarvas fue sinérgico a las 48 h de exposición y antagonista después de 72 h (Alcaraz et al., 1999). Cheng et al. (2004) expusieron M. japonicus a diferentes concentraciones de amoníaco y nitrito combinados (relación molar: 1:1 y 1:3.8) para examinar las acumulaciones de excreción nitrogenada de amoníaco, nitrito, urea y ácido úrico en tejidos después de 48 h de exposición. Llegaron a la conclusión de que M. japonicus aumenta el metabolismo del nitrógeno y la producción de urea-N y otros compuestos orgánicos, cuando se expone a la combinación de amoníaco y nitrito en comparación con una sola exposición de amoníaco. Cheng y et al. (2013) evaluaron los efectos de la combinación de amoníaco y nitrito (relación molar: 1: 1 y 1: 3.8) en el balance ácido-base hemolinfínico, electrolitos y oxihemocianina (OxyHc) en M. japonicus. La hemolinfa OxyHc, el contenido proteico, la

61

relación OxyHc/proteína, pH, pCO2, HCO3 -, OH− / H +, osmolalidad y niveles de electrolitos estuvieron inversamente relacionados con la dosis de amoníaco y nitrito. Sin embargo, los niveles de hemolinfa pO2 aumentaron directamente con el incremento de las concentraciones de amoníaco y nitrito. Ellos concluyen que la combinación de amoníaco y nitrito puede ejercer un efecto sinérgico sobre el camarón, en relación al estrés causado por el amoníaco o el nitrito solamente. Cheng y Chen (2002b) examinaron a P. monodon expuesto a una combinación de nitrito y nitrato (relación molar: 1:5 y 1:20) a una salinidad de 25 g/L, después de 24 h cuantificaron los niveles de compuestos de nitrógeno en la hemolinfa. La excreción de nitrógeno aumentó directamente con nitrito y nitrato ambiental. Los niveles de nitrito, nitrato, urea y ácido úrico en la hemolinfa aumentaron, mientras que la hemolinfa, el amoníaco, la oxihemocianina y la proteína estaban inversamente relacionadas con el nitrato ambiental. Después de la exposición a nitrito elevado, el nitrito se oxidó a nitrato y se mostró uricogénesis y uricolisis en P. monodon. Zhang et al. (2015) estudiaron el estrés oxidativo y la apoptosis en los hemocitos del camarón de agua dulce M. rosenbergii, bajo exposición única y combinada de nitrito y amoníaco (relación de peso: 1:1 y 1:1.25). Descubrieron que la generación de especies reactivas de oxígeno (ROS, por sus siglas en inglés), era sensible al efecto combinado de amoníaco y nitrito, que a su vez, inducía respuestas antioxidantes y estimulaba la activación de enzimas antioxidantes. Debido a la toxicidad similar en el equilibrio iónico, el amoníaco mejoró significativamente la actividad del superóxido dismutasa de Cu-Zn (SOD) al interactuar con el nitrito. La producción de óxido nítrico (NO) exhibió una gran sincronización con los índices de hemocitos apoptóticos. El nitrito no afectó el estrés oxidativo y la apoptosis al mismo nivel que el amoníaco, lo que puede deberse a una mayor tolerancia a la exposición al nitrito en M. rosenbergii y/o los efectos competitivos de los iones de cloruro. Schuler et al. (2010) determinaron los efectos


PRODUCCIÓN individuales y combinados de amoníaco y nitrito en postlarvas de L. vannamei (PL 25–45 días) a una salinidad de 10 g/L. Las pruebas TAN se realizaron a salinidades de 18 y 10 g/L, y la prueba de NO2−-N se realizó a una salinidad de 10 g/L. Las pruebas combinadas de TAN y NO2 −-N (relación de peso: 1:2.5 a 1:4.6) también se llevaron a cabo a una salinidad de 10 g/L. Los valores de 48 h- LC50 para TAN a 18 g/L de salinidad, TAN a 10 g/L de salinidad y NO2 −- N a una salinidad de 10 g/L fueron 42.9, 39.7 (2.3 y 2.1 mg/L de NH3 -N) y 153.7 mg/L, respectivamente. Cuando el NO2 −-N se ajustó al nivel más bajo de concentración de efecto observado (LOEC) y las concentraciones de TAN variaron, se observaron efectos sinérgicos, con un valor estimado de 48 h-LC50 de 28.2 mg/L de TAN (1.49 mg/L de NH3-N). Sin embargo, cuando el nivel de amoníaco se ajustó al LOEC y se varió el nitrito, se observaron efectos antagónicos. Con respecto a la mezcla ternaria a un TR de 1: 1: 1 en juveniles de este estudio a una salinidad de 3 g/L, se produjeron efectos antagonistas a las 24, 48 y 72 h, y efectos aditivos ocurrieron de 72 a 96 h de exposición. Estos efectos observados fueron similares a los registrados por Alcaraz et al. (1999), Cheng y Chen (2002a) y Schuler et al. (2010) a mezclas binarias y diferentes tiempos de exposición. La toxicidad de las mezclas de compuestos nitrogenados en camarón se limita a unas pocas especies, tamaños y ambientes de salinidad; por lo tanto, dada la acumulación de estos tóxicos a medida que avanza el período de cultivo y su toxicidad, es importante continuar realizando investigaciones sobre el efecto combinado sobre L. vannamei, así como sobre otras especies, edades y salinidades. En nuestro estudio, el mecanismo que podría asociarse durante las 0–72 h de la exposición ternaria a los compuestos nitrogenados en juveniles de L. vannamei es el antagonismo químico y de disposición, que implica la conversión química de uno o más tóxicos, la absorción, el transporte dentro del organismo, deposición en sitios específicos y la eliminación de los compuestos nitrogenados.

- AGOSTO 2019 Se sugiere que durante la exposición ternaria de 0 a 72 h, el amoníaco se puede convertir en una forma química menos tóxica como urea, ácido úrico y nitrito, que se excretan (Lee y Chen, 2003; Chen y Cheng, 1993; Cheng y Chen , 2002b); a medida que aumenta el tiempo de exposición, la absorción y el movimiento de los compuestos nitrogenados a través de la hemolinfa con la deposición/acumulación de estos compuestos en los órganos objetivos (branquias, hepatopáncreas, músculo y hemolinfa) continúan (Chen y Kou, 1991; Chen y Chen , 1992; Chen y Cheng, 1995), pero la capacidad de los procesos de desintoxicación se reduce en esta última etapa durante el período de exposición de 72-96 h cuando los camarones exhiben un comportamiento aditivo. Durante la exposición ternaria, se sugiere que el estrés oxidativo también ocurra como se documenta en M. rosenbergii (Zhang et al., 2015). Es imprescindible realizar investigación adicional en L. vannamei para comprender los mecanismos involucrados. Recientemente, se evaluó el estado antioxidante y otros parámetros bioquímicos en el pez C. auratus expuesto a una combinación de seis retardantes de llama bromados y hexabromobenceno, descubriendo que la exposición crónica causaba estrés oxidativo en el hígado (Feng et al., 2013a, b) e inhibía la actividad de Na +, K + -ATPasa en el hígado y tejidos branquiales (Feng et al., 2015). Estos experimentos revelan posibles respuestas de los parámetros bioquímicos que el camarón L. vannamei podría exhibir cuando están expuestos a niveles subletales de los compuestos nitrogenados en aguas de baja salinidad. Por lo tanto, es necesario investigar el estado antioxidante y los parámetros bioquímicos para comprender mejor la interacción del camarón L. vannamei con los compuestos nitrogenados. Con respecto a los niveles seguros propuestos en este estudio (usando un factor de 0.05) para juveniles de L. vannamei (3.3 g) a una salinidad de 3 g/L (TAN, 1.45 mg/l; NO2 −- N, 0.53 mg/L; NO3 −-N, 45.0 mg/L), es importante enfatizar los valores bajos para cada especie nitrogenada en comparación con los propuestos para aguas salobres y marinas.

62

Frías-Espericueta et al. (1999) establecieron un nivel seguro (usando un factor de 0.10) de 7.09 mg/L TAN para 3.8 g de juveniles a una salinidad de 33 g/L; Lin y Chen (2001) (usando un factor de 0.10) propusieron valores seguros de 2.44, 3.55 y 3.95 mg/L TAN para juveniles de 2.2 cm a salinidades de 15, 25 y 35 g/L, respectivamente; Lin y Chen (2003) determinaron valores seguros (usando un factor de 0.10) de 6.1, 15.2 y 25.7 mg/L NO2 −-N para juveniles de 5.6 cm a salinidades de 15, 25 y 35 g/L, respectivamente. Gross et al. (2004) propuso un valor seguro (usando un factor de 0.05) de 0.45 mg/L de NO2 −- N para 0.21 g de juveniles con una salinidad de 2.0 g/L. Los valores seguros propuestos aquí para el camarón L. vannamei tienen implicaciones ambientales diferentes para la supervivencia de esta especie en estanques comerciales y en los ecosistemas naturales del Pacífico oriental. En los sistemas de cultivo que utilizan aguas de baja salinidad, con frecuencia se encuentran concentraciones de compuestos de nitrógeno superiores a los niveles de seguridad propuestos en este estudio. Mariscal-Lagarda et al. (2012), reportaron niveles de 0.58 y 419.4 mg/L de NO2 −- N y NO3 −- N a una salinidad de 0.65 g/L, respectivamente; Samocha et al. (2004), a una salinidad de 2.2 g/L, registraron un TAN de 15.0 mg/L; Fregoso-López y col. (2017) encontraron 2.31 mg/L de TAN en un cultivo experimental a una salinidad de 1.9 g/L. El camarón salvaje L. vannamei se distribuye a lo largo de las costas del Pacífico tropical estadounidense, desde la costa de Sonora, México, hasta Perú (Hendrickx, 2001). Estos organismos residen temporalmente (PL y etapas juveniles) en los sistemas de lagunas y estuarios, donde pueden estar expuestos a concentraciones de compuestos nitrogenados que exceden los niveles seguros, afectando así su ciclo biológico. En tales entornos, los compuestos de nitrógeno alcanzan diversas concentraciones y ratios, debido a los diferentes procesos predominantes como la amonificación, la desnitrificación, el metabolismo heterotrófico aeróbico y la nitrificación (Sepehri y Sarrafzadeh, 2018).


PRODUCCIÓN

- AGOSTO 2019 Las aguas de la laguna del sureste del Golfo de California han registrado grandes variaciones en los niveles de nutrientes, pero eventualmente, durante la temporada de lluvias y en los sitios internos, alcanzan niveles de hasta 0.75, 0.18 y 5.94 mg/L para TAN, NO2 −-N y NO3 −-N, respectivamente (Piñón-Gimate et al., 2009; Páez-Osuna et al., 2013). Estos niveles están claramente por debajo de los valores de seguridad propuestos. Sin embargo, en el caso del nitrito, está cerca (34% del nivel seguro).

Conclusiones

Estos niveles seguros propuestos nos permiten alertar a los usuarios que desarrollan diversas actividades económicas (agricultura, ganadería y acuicultura) en áreas que rodean lagunas costeras, del impacto que puede resultar al exceder dichos niveles seguros. Por lo tanto, se deberían implementar medidas preventivas y un manejo costero, para evitar un impacto que deteriore la calidad del agua y afecte este hábitat sensible del camarón salvaje.

Comparando estas toxicidades agudas con las calculadas para la misma especie en aguas marinas (35.0 g/L de salinidad) de juveniles de 3.8 g, la LC50-96 h para TAN fue de 70.2 mg/L (Frías- Espericueta et al., 1999) y la del NO2 −-N fue de 321.0 mg/L (Lin y Chen, 2003), es decir, la del amoníaco es 4.6 veces mayor que la del nitrito, lo que confirma que el nitrito es más tóxico que el amoníaco en aguas de baja salinidad y que las toxicidades de ambos aumentan (es

La toxicidad de compuestos nitrogenados únicos y combinados en juveniles de L. vannamei (3.3 g) aumentó significativamente a medida que el período de exposición aumentó de 24 a 96 h. La toxicidad del nitrato (LC50-96 h, 900 mg/L NO3 −-N) es 31.0 veces menor que la del amoníaco (29.0 mg/L TAN), y el del amoníaco es 2.7 veces menor que el del nitrito (10.6 NO2 - N mg/L) con una salinidad de 3 g/L.

63

decir, LC50 reducida) con una disminución de la salinidad. En la toxicidad articular (TR 1:1:1; TAN: NO2 −- N: NO3 −-N), se observó una acción antagonista a las 24 h hasta las 72 h de exposición; después de 72 h, se observó un aumento en la acción tóxica con valores de UT50 de aproximadamente 1.0, lo que define la interacción aditiva de la mezcla hasta 96 h. Los niveles seguros propuestos para juveniles de L. vannamei (3.3 g) a una salinidad de 3 g/L son TAN, 1.45 mg/L; NO2 −N, 0.53 mg/L; y NO3 −-N, 45.0 mg/L, que son más bajos que los propuestos para aguas salobres y marinas. El nivel seguro para la mezcla de TAN, nitrito y nitrato es equivalente a un valor de TU de 0.050 (es decir, niveles de 0.48 mg/L TAN, 0.08 mg/L NO2 −-N y 14.58 mg/L N-NO3 –N)● Para mayor información sobre este artículo escriba a: paezos@ola.icmyl.unam.mx


MANEJO ACUÍCOLA

- AGOSTO 2019

El simbionte marino Pseudovibrio denitrificans es efectivo para controlar Vibrio spp. en la acuicultura del camarón Autores: Cristóbal Domínguez-Borbor1, Valeska 1,2 Ardiles , Marissa Bermeo1, Chalén BolívarAlvarado 1, Cecilia Tomalá1, Stanislaus Sonnenholzner1 & Jenny A. Rodríguez1*. ESPOL Polytechnic University, Escuela Superior Politécnica del Litoral, ESPOL, Centro Nacional de Investigaciones Marinas (CENAIM), Campus Gustavo Galindo Km. 30.5 Vía Perimetral, P.O. Box 09-01-5863. Guayaquil, Ecuador. 1

Pontificia Universidad Católica de Valparaíso, Avenida Altamirano 1480. Valparaíso, Chile. 2

jenrodi@espol.edu.ec

V

arios Vibrio spp. han sido asociados con la mortalidad del camarón (Austin y Zhang 2006; Goarant et al., 2006; Vanmaele et al., 2015; Soto-Rodríguez et al., 2015; Sathish Kumar et al., 2017), causando enormes pérdidas económicas en los países productores de camarones (Bell & Lightner, 1988; Tran et al., 2013; Dong et al., 2017a; Shinn et al., 2018). El caso más dramático causado por Vibrio es la enfermedad de necrosis hepatopancreática aguda (AHPND) para lo cual se ha encontrado responsable a varias especies Vibrio (Tran et al., 2013; Liu et al., 2015; Dong et al., 2017b; Restrepo et al., 2018), que llevan en común un plásmido de 70 kbp (pVA1) que alberga los genes de toxina PirA y PirB (Lee et al., 2015; Xiao et al., 2017; Liu et al., 2018). La poca eficiencia de los antibióticos y desinfectantes para controlar estos Vibrio spp. ha llevado a un creciente interés en el uso de probióticos como herramientas de control epidemiológico. El uso de probióticos es una práctica común en la acuicultura actual del camarón. A saber, existen dos modos principales de acción de los probióticos, la exclusión competitiva y la inmunomodulación (Lazado et al., 2011). Los probióticos ocupan y colonizan el tracto digestivo, reduciendo la capacidad del colonizador de colonizar (Chabrillón et al., 2005). Es bien sabido que los probióticos pueden modificar la microbiota intestinal en los

64

camarones (Vargas-Albores et al., 2017). Mediante la secreción de sustancias antibacterianas, los probióticos compiten contra los patógenos, evitan su adhesión al epitelio intestinal, compiten por los nutrientes necesarios y producen efectos antitóxicos (Martínez et al., 2012; Hai, 2015). Existen numerosos probióticos comerciales, principalmente basados ​​ en cepas bacterianas Lactobacillus y Bacillus (Thammasorn et al., 2017; Zheng y Wang, 2017; Le y Yang, 2018). Independientemente de su eficacia y posibles beneficios para los camarones, muchas de estas bacterias no son típicas de los ambientes marinos (Vargas-Albores et al., 2017), presentando problemas para cultivarlas en los sistemas de cultivo de camarones para Penaeus vannamei (VargasAlbores et al., 2016), donde deben competir contra Vibrio spp., propios del medio marino. En la búsqueda de bacterias probióticas, típicas de ambientes marinos y capaces de controlar Vibrio spp. de camarones, es esencial explorar otros géneros bacterianos típicos de los ambientes marinos. Las bacterias simbióticas de los organismos marinos podrían ser candidatos ideales, porque están adaptadas a las condiciones marinas y pueden prosperar en entornos adversos (Esteves et al., 2017). Es bien sabido que las esponjas marinas albergan comunidades microbianas muy diversas,


MANEJO ACUÍCOLA

- AGOSTO 2019 pero solo un pequeño grupo de estas bacterias simbióticas son cultivables (Taylor et al., 2007; Stewart, 2012; Esteves et al., 2016; Garate et al., 2017). El grupo de bacterias que más se destaca por ser cultivable pertenece al género Pseudovibrio (Esteves et al., 2013; Esteves et al., 2017; Nicacio et al., 2017). Pseudovibrio spp. se han aislado de varios invertebrados marinos, gusanos planos, esponjas y tunicados (Sertan-De Guzman et al., 2007; Crowley et al., 2014; Y. Zhang et al., 2016). Las cepas de Pseudovibrio tienen el potencial genómico para producir metabolitos secundarios y suministrar cofactores al huésped a través de los péptidos no ribosomales sintetasa y policétidos sintasa (NRPS / PKS) (Bondarev et al., 2013). Entre varias moléculas con diferentes actividades biológicas, las moléculas con la actividad antimicrobiana más activas son el ácido tropoditietico (TDA) (Harrington et al., 2014), alcaloides (He et al., 2017; Nicacio et al., 2017) y policétidos. como el eritronólido (Esteves et al., 2017). Recientemente, se informó que las bajas concentraciones de TDA (0.5 μg mL-1) exhibieron actividad contra dos vibrios patógenos de coral (Raina et al., 2016). Debido a la producción de nuevos compuestos y la versatilidad de sus metabolitos (Bondarev et al., 2013; Naughton et al., 2017), se ha señalado el potencial biotecnológico del género Pseudovibrio Crowley et al. (2014). A pesar de estas propiedades, hasta la fecha, no hay informes sobre el uso de Pseudovibrio spp. en la acuicultura del camarón para controlar Vibrio spp. patógeno emergente. El objetivo de este estudio fue determinar la capacidad probiótica en el cultivo de camarones de varios aislamientos de P. denitrificans aislados de la esponja marina Aplysina gerardogreeni recolectada en el Área Marina Protegida El Pelado (REMAPE), Santa Elena, Ecuador. Se obtuvieron 43 aislamientos de Pseudovibrio y ensayos de exclusión competitiva in vitro contra Vibrio spp. se llevaron a cabo. La mayoría de las cepas bioactivas fueron validadas por ensayos in vivo en el laboratorio y en estanques de camarones. En este artículo se presenta evidencia de las cualidades probióticas de varios aislamientos de P.

denitrificans, destacando su potencial como herramienta útil para controlar los Vibrio spp. emergentes en la acuicultura de camarón.

Materiales y Métodos Recolección de muestras y aislamiento bacteriano Un total de nueve muestras de la esponja marina A. gerardogreeni, fueron recolectadas por buceo en cuatro hábitats rocosos a diferentes profundidades desde 10-30 m en la REMAPE, ubicado en el extremo sur del Pacífico oriental tropical, en las aguas costeras de la Provincia de Santa Elena, Ecuador (01 ° 55, 9 ‘S - 08 ° 47.2’ W). Las muestras de esponja se colocaron individualmente en bolsas ZiplocR con agua de mar y se transportaron a los laboratorios del CENAIM. En el laboratorio se extrajeron los endobiontes y epibiontes macroscópicos de las muestras de esponja con bisturí y pinzas. Se maceraron cinco gramos de tejido tomado de diferentes partes del organismo y se diluyeron en 45 ml de agua de mar natural estéril (NSW). Posteriormente, las muestras homogeneizadas se diluyeron en serie a 10-5 en NSW. Cien (100) μl de diluciones 10-2 a 10-5 se sembraron por triplicado en placas Petri que contienen Marine Agar 2216 (MA) BD DifcoTM. Las placas se incubaron a 27 oC durante dos días. Posteriormente, se seleccionaron diferentes morfotipos y se purificaron mediante rayas sucesivas en placas de Petri que contenían MA. Las cepas de Pseudovibrio se seleccionaron inicialmente en función de las características morfológicas y bioquímicas de las colonias descritas previamente (Shieh et al., 2004; Sertan-De Guzman et al., 2007). Posteriormente, la taxonomía de los aislados que exhiben bioactividad se determinó en base a secuencias de nucleótidos del gen de 16 ARNr. Los cultivos puros de Pseudovibrio se realizaron alícuotas en medio Luria-Bertani con NSW y glicerol al 20% y se conservaron a -80 °C para ensayos posteriores. Caracterización bioquímica de las cepas de Pseudovibrio Los aislados de Pseudovibrio se caracterizaron por pruebas bioquímicas que incluyeron tinción de Gram, reacción de catálisis, presencia de oxidasa, utilización de aminoácidos (arginina, ornitina y lisina),

65

utilización de carbohidratos (sacarosa, glucosa y manosa), uso de citrato como fuente de carbono, la formación de diacetil (Voges-Proskauer) y producción de indol. Además, se caracterizó la morfología celular y se evaluó el requerimiento de cloruro de sodio (NaCl) determinando el crecimiento bacteriano en cultivos de caldo LB, agregue 1% a 5% de NaCl y caldo LB (sin NaCl adicional). Evaluación in vitro de la bioactividad antiVibrio. La bioactividad anti-Vibrio de los aislados de Pseudovibrio se evaluó contra cinco especies de Vibrio patógenas de camarones; Vibrio harveyi (cepa E22), Vibrio campbellii (cepa LM2013), Vibrio vulnificus (cepa S2), Vibrio parahaemolyticus (ATCC 27969) y Vibrio parahaemolyticus (cepa BA94C2, positivo para las toxinas PirA / PirB) (Restrepo et al., 2016). La evaluación anti-Vibrio se realizó con dos métodos, el método de inoculación puntual en agar descrito por Gao et al. (2017), empleado para realizar un cribado rápido, y el método de difusión de agar de pozo modificado por Al Atya et al. (2015), para confirmar los resultados. Prueba de exclusión competitiva por inoculación puntual en agar Este primer cribado se realizó para identificar los aislados de Pseudovibrio que ejercen un importante potencial anti-Vibrio. Cultivos frescos individuales de las cinco especies de Vibrio patógenas se prepararon en caldo de tripticasa de soja suplementado con NaCl al 2% (peso / volumen) (NaCl TSB al 2%) y se ajustó la concentración por densidad óptica (O.D600) lecturas de 0.6 a 0.8 correspondiente a 2 × 108 CFU mL-1. Doscientos (200) μl de cada suspensión bacteriana se colocaron por extensión en placas que contenían MA. Cada cepa de Pseudovibrio se inoculó como una mancha (diámetro ~ 2-3 mm) en la superficie de una placa MA previamente extendida con suspensiones de Vibrio patógenos. Las placas se incubaron a 28 ° C durante 72 horas. La bioactividad antiVibrio se evaluó por la aparición de una zona de inhibición del crecimiento alrededor del punto. Solo las zonas de inhibición mayores de 5 mm se consideraron reacciones positivas, según lo recomendado por Zidour et al. (2017). Este segundo método de exclusión


MANEJO ACUÍCOLA competitiva se empleó para obtener datos cuantitativos utilizando una concentración estándar de los aislados de Pseudovibrio. La preparación de las suspensiones patógenas de Vibrio fue idéntica al método de inoculación puntual descrito anteriormente. Doscientos (200) μl de cada suspensión bacteriana se extendieron en placas MA y se perforaron pocillos de 6 mm de diámetro en las placas de agar preparadas con una varilla de vidrio hueca estéril. Se inocularon colonias individuales de aislados de Pseudovibrio en 10 ml de medio LB preparado en NSW y se incubaron a 28 °C con agitación a 200 rpm durante 24 h. Los cultivos de Pseudovibrio se centrifugaron (3000 g, 10 min, 4 °C), se descartaron los sobrenadantes y los sedimentos celulares se resuspendieron en NSW. Se realizaron diluciones para obtener 1.1 × 106 CFU mL-1 inóculo. Cincuenta (50) μL de las suspensiones de Pseudovibrio se agregaron a los pocillos. Cada ensayo se realizó por triplicado. Las placas se incubaron durante 48 h y 72 h a 28 °C. Después de la incubación, se evaluó la actividad antibacteriana midiendo las zonas de inhibición alrededor del pozo que contiene el Pseudovibrio. Amplificación de la secuenciación del gen 16S rRNA Los tres aislamientos más bioactivos (Ps11, ps17 y Ps18) se identificaron mediante análisis molecular. El ADN bacteriano se extrajo siguiendo el procedimiento descrito por Anand et al. (2006) con ligeras modificaciones. En resumen, las colonias individuales frescas de cada aislado de Pseudovibrio se suspendieron en 500 μl de solución tampón (NaCl 100 mM, EDTA 0,1 mM, Tris-HCl 10 mM pH 8,0) y 80 μL de SDS al 10%. Las soluciones tamponadas se dejaron durante una hora en un baño de agua a 55 °C con la adición de 600 μl de fenol y se centrifugaron a 16000 g durante 10 min. Los sobrenadantes se recuperaron y se añadieron 100 μl de cloroformo-isoamilo (24:1). Las mezclas se agitaron y se centrifugaron a 16000 g durante 10 minutos a 4 ° C. Se añadieron doscientos cincuenta (250) μL de etanol al 100% y 500 μL de acetato de amonio (5 M) a las mezclas. Las soluciones se almacenaron a -20 °C durante la noche. Las soluciones se centrifugaron a 16000 g durante 15 minutos a 4 °C y se eliminaron

- AGOSTO 2019 los sobrenadantes. Los gránulos se lavaron dos veces con 300 μl de etanol al 70% y se dejaron secar durante 2 horas a 45 °C. El ADN resultante finalmente se resuspendió en 50 μl de agua Milli-Q. La amplificación del gen 16S rRNA se realizó por PCR utilizando los cebadores universales bacterianos 27F (5´-AGAGTTTGATCMTGGCTCAG-3 ‘) y 1492R (5´-TACGGYTACCTTGTTACGACTT-3’), específicos para las bacterias del dominio (Lane, 1991). Los productos de PCR de las cepas de ARNr 16s Ps11, Ps17 y Ps18 se enviaron a Macrogen (Seúl, Corea) para su secuenciación. Las secuencias obtenidas se compararon con una base de datos pública utilizando NCBI BLASTn, enfocándose en las identidades superior al 95%. Evaluación de seguridad de P. denitrificans en la supervivencia de postlarvas de P. vannamei Para descartar efectos negativos de P. denitrificans en la salud de las larvas de camarones, los camarones en etapa temprana zoea-1 fueron expuestos a los aislados de Pseudovibrio Ps11, Ps17 y Ps18. El bioensayo se realizó en placas de cultivo celular de 6 pocillos. Se colocaron diez larvas de camarones de la etapa P. vannamei zoea-1 en cada pocillo. Los aislados de Pseudovibrio se cultivaron como se describió anteriormente. Los cultivos de Pseudovibrio se centrifugaron (3000 g, 10 min, 4 oC) y los sedimentos bacterianos resultantes se resuspendieron en agua de mar estéril y se ajustaron las concentraciones por densitometría óptica (OD600 ~ 0.55) equivalentes a 1.5 × 108 CFU mL-1. Mil (1000) μL de cada suspensión de Pseudovibrio se aplicaron directamente a los pozos que contienen larvas de camarones zoea-1 (dosis final de 1.5 × 107 CFU mL-1). También se incluyó en el ensayo un grupo de control que contenía larvas de camarones en etapa zoea-1 no expuestas a Pseudovibrio. Cada tratamiento con 6 réplicas. La supervivencia se evaluó después de 48 h de exposición directa. La supervivencia de las larvas etapa zoea-1 de camarones del tratamiento de control se estableció en el 100% y los otros tratamientos se normalizaron en consecuencia. Ensayo in vivo: efecto de P. denitrificans

66

en postlarvas de P. vannamei expuestas a Vibrio patógenos. Efecto de P. denitrificans en la supervivencia de P. vannamei postlarvas y juveniles mediante prueba de desafío con V. campbellii y V. parahaemolyticus Primero, se evaluó el efecto protector de P. denitrificans Ps11, Ps17 y Ps18 en postlarvas sanas de P. vannamei (PL2), desafiadas con V. campbellii (LM2013). En la prueba de desafío, se distribuyeron 800 PL en 16 matraces de vidrio que contenían 2000 ml de agua de mar esterilizada por filtración y UV (Cincuenta PL2 por réplica). Se proporcionó aireación continua y se ajustó la temperatura a 30.5 ± 0.4 oC. Los PL2 fueron alimentados con una dieta comercial cada cuatro horas durante todo el bioensayo. Se aplicaron tres tratamientos (Ps11, Ps17 y Ps18) y un control (sin la aplicación de P. denitrificans). Los aislados de Pseudovibrio se prepararon como se describió anteriormente y se aplicaron en el agua cada doce horas a una concentración final de 105 UFC mL-1. Cada tratamiento tenía cuatro réplicas. Después de cinco días, los PL se expusieron a V. campbellii (106 UFC mL-1 de agua de mar). El intercambio de agua del (50%) se realizó veinticuatro horas después de la exposición (hpe) y la supervivencia de las larvas de camarones se cuantificó 48 hpe. Para preparar el inóculo bacteriano, se sembró V. campbellii en agar de tripticasa de soja (2% de NaCl TSA), se transfirieron ocho colonias a 1000 ml de NaCl TSB al 2% y se incubaron durante siete horas a 30 °C, con movimiento constante. Posteriormente, el cultivo se centrifugó (4000 g, 10 min, 25 °C), se descartaron los sobrenadantes, y los sedimentos celulares se resuspendieron en solución salina estéril (NaCl al 2%). La suspensión de Vibrio se ajustó por densitometría óptica a una densidad de 108 UFC mL-1, y se inoculó inmediatamente. El efecto protector de tres aislamientos también se verificó mediante una prueba de desafío con juveniles sanos de P. vannamei de peso 1.93 ± 0.66 g, con V. parahaemolyticus (BA94C2). En la prueba de desafío, se distribuyeron 160 juveniles de camarones en 16 matraces de vidrio que contenían 2000 ml de agua de mar filtrada y esterilizada con


MANEJO ACUÍCOLA

- AGOSTO 2019 UV (diez juveniles de camarones por unidad experimental). Se proporcionó aireación continua y la temperatura se ajustó a 31.2 ± 0.6 oC. Los juveniles de camarones fueron alimentados con dieta comercial cada 8 horas durante todo el bioensayo. Se aplicaron tres tratamientos (Ps11, Ps17 y Ps18) y un control (sin la aplicación de P. denitrificans). Los aislados de Pseudovibrio se prepararon como se describió anteriormente y se aplicaron en una sola dosis diaria con la comida a una concentración de (105 UFC g-1). Cada tratamiento tenía cuatro réplicas. Después de doce días, los juveniles de camarón fueron desafiados con V. parahaemolyticus (106 UFC mL-1 de agua de mar). El intercambio de agua (50%) se realizó a las 24 hpe y la supervivencia se determinó contando los juveniles de camarones cada cuatro horas, hasta 72 hpe. Se activó V. parahaemolyticus en TSB con NaCl al 2% y se preparó el inóculo bacteriano de V. parahaemolyticus en las mismas condiciones que el inóculo de V. campbellii. se inoculó inmediatamente a la concentración descrita anteriormente. Efecto de exclusión competitiva de P. denitrificans contra V. harveyi luminiscente. en postlarvas de P. vannamei infectadas naturalmente Se realizó un ensayo in vivo para evaluar la capacidad de las cepas seleccionadas de Pseudovibrio para excluir V. harveyi luminiscente en cultivos de postlarvas de camarones P. vannamei infectados. Se obtuvieron postlarvas de P. vannamei (PL3) de tres días de edad infectados con V. harveyi luminiscente de un criadero comercial de camarones y se transfirieron a nuestra sala de bioensayo en CENAIM. La infección de las postlarvas con V. harveyi luminiscente a concentraciones de 4.5 × 106 UFC g-1 se determinó en nuestros laboratorios. Se asignaron aleatoriamente cien postlarvas PL3 de camarones a doce acuarios de vidrio con 40 litros de agua de mar filtrada, a una salinidad de 34.5 (PSU). El bioensayo tuvo 3 tratamientos (postlarvas de camarón tratadas con cepas de Pseudovibrio Ps11, Ps17 y Ps18) y un grupo de control (postlarvas no tratadas). Cada tratamiento tenía tres réplicas. Las suspensiones de Pseudovibrio se prepararon de manera

similar a la descrita en secciones anteriores. Tres aislados de Pseudovibrio (Ps11, Ps17 y Ps18) se evaluaron individualmente a una concentración final de 105 UFC mL-1. Después de 48 horas de la inoculación de los Pseudovibrio, se extrajeron 1 g de muestras de postlarvas de cada acuario. Las muestras de postlarvas se lavaron y maceraron en solución salina estéril (NaCl al 2%) (p / v), y se diluyeron en serie de 10−1 a 10−5 en solución salina estéril. Luego, 100 μL de cada dilución se sembraron en placas Petri que contenían MA y tiosulfato-citrato-sales biliares-agar sacarosa (TCBS modificó NaCl al 2%). El número de UFC g-1 se determinó después de 18-24 h de incubación a 28 oC. Efecto de la aplicación de Pseudovibrio en estanques de cultivo de P. vannamei Producción de biomasa bacteriana. Dos aislados de P. denitrificans, Ps17 y Ps18 se cultivaron por agotamiento en placas de Petri individuales y se incubaron durante 48 horas a 26 oC. Posteriormente, las colonias individuales de P. denitrificans se transfirieron al medio LB (en NSW) y se incubaron durante 48 ha 26 °C. Después del período de incubación, el cultivo bacteriano se centrifugó a 4000 g durante 10 minutos a 4 oC, y los sedimentos microbianos resultantes se resuspendieron en NSW y se almacenaron a temperatura ambiente (25 oC). La concentración final (UFC mL-1) y la viabilidad bacteriana se determinaron colocando la suspensión bacteriana en MA, como fue descrito previamente. Bioensayo en piscinas Doce estanques de tierra de 400 m2 en la Estación Experimental del CENAIM (Provincia de Santa Elena) fueron asignados aleatoriamente a tres tratamientos de aplicación de Pseudovibrio; Pseudovibrio cepa Ps17, Pseudovibrio cepa Ps18 y sin aplicación de Pseudovibrio (grupo control). Cada tratamiento con cuatro replicas o estanques. Un total de 3200 postlarvas camarones en etapa PL12 se sembraron en cada piscina (densidad de población de 8 postlarvas por metro cuadrado). Los aislados de P. denitrificans se aplicaron en una sola dosis diaria en el alimento a una concentración de (105 UFC g-1) desde el primer día de cultivo durante todo el ciclo de producción que duró 108 días. Cada día,

67

el Pseudovibrio se incorporó al alimento granulado comercial (28% de proteína) y se suministró inmediatamente a los estanques asignados. La dosis de alimento comercial utilizada fue del 3% en relación con el peso corporal promedio de los camarones, y fue ajustado semanalmente. Los Parámetros ambientales tales como temperatura, O2 disuelto y salinidad, fueron monitoreados diariamente. La supervivencia final del camarón (%), el peso promedio (g), los rendimientos de producción (kg / ha) y el índice de conversión alimenticia (FCR) fueron las variables de respuesta de los efectos del tratamiento evaluados en la cosecha. Además, para confirmar la presencia del Pseudovibrio en los camarones tratados, el hepatopáncreas, el estómago y el intestino, se analizaron por separado mediante microbiología clásica. Después de que los camarones alcanzaron 2 g de peso corporal, se recolectaron 45 camarones al azar por tratamiento (15 por estanque) cada quince días durante todo el ciclo de producción. Los camarones se abrieron bajo estrictas condiciones de asepsia para extraer los tres órganos. Se hicieron tres agrupaciones por estanque, consistiendo en 5 hepatopáncreas, 5 estómagos y 5 intestinos. Cada grupo de órganos se analizó como una muestra independiente por triplicado. La presencia de Pseudovibrio en el agua y los sedimentos de los estanques también fue confirmada por análisis microbiológicos. Los recuentos microbianos se expresaron en UFC g-1 y UFC ml-1, según la muestra analizada (líquida o sólida). Análisis estadístico El análisis de los datos para ensayos in vitro e in vivo se realizó utilizando el software estadístico SPSS (versión 21). Todos los datos se analizaron mediante ANOVA de una vía después de la verificación de los supuestos de homogeneidad de normalidad y varianza. Cuando se detectaron diferencias significativas, se aplicó un análisis post hoc de Dunnett. El nivel de significancia se estableció en (P <0.05). Los datos expresados​​ en porcentajes se transformaron (usando arcsin), y los supuestos se cumplieron antes de realizar el análisis estadístico.

Resultados


MANEJO ACUÍCOLA

- AGOSTO 2019

Tabla 1. Características de las cepas aisladas de Pseudovibrio. Characteristics tested

Colony characteristics

Isolates exhibiting biochemical features of P. denitrificans. Ps:1, 2,3,4,5,6,7,8,9,10,11,13,14,15,16 ,17,18,19,20,21,22,23,24,25,26,1 7,28,29,30,31,32,33,34,36,37,38, 41,42,43.

Isolates exhibiting a difference in three biochemical tests in respect of P. denitrificans. Ps:12, 35, 39 y 40.

Pseudovibrio denitrificans strain DN34T*

convex colony, with an entire margin, big size, chewy appearance, whitish when young and turns brown on marine agar as the culture ages, nonluminescent

Circular, nonluminescent, with an entire margin, translucent.

Rod, straight or curved + 25-31 OC 3-4%

convex colony, with an entire margin, big size, chewy appearance, translucent when young and turns in bone color on marine agar as the culture ages, nonluminescent Rod, straight or curved + 25-31 OC 3-4%

+ + + + + + + + + +

+ + + + + + + + + + + +

+ + + + + ND + + + +

Gram reaction Cell shape Motility Range temperature for growth Range NaCl requirement for growth Fermentation of glucose Fermentation of mannose Fermentation of sucrose Nitrate reduction Oxidase N-Acetyl-D-glucosamine Catalase Gelatinase Arginine dihydrolase Ornithine decarboxylase Lysine decarboxylase Citrate utilization H2S production *Data from Shieh et al. 2004 Esculin hydrolysis Indole production a Data from Shieh et al., 2004.

Bacterias aisladas y caracterización morfológica Cuarenta y tres aislamientos de Pseudovibrio spp. se aislaron de varias muestras de A. gerardogreeni y se clasificaron de acuerdo con las características morfológicas y bioquímicas. Treinta y nueve aislamientos exhibieron características morfológicas, fisiológicas y bioquímicas similares a P. denitrificans (Shieh et al., 2004), mientras que cuatro aislamientos codificados como Ps12, Ps35, Ps39 y Ps40, diferían en tres pruebas bioquímicas (descarboxilasa de ornitina, descarboxilasa de lisina y utilización de citrato) con respecto a la descripción original de P. denitrificans (Tabla 1). En los 43 aislamientos de Pseudovibrio, se observó una consistencia pegajosa en las colonias, una característica no mencionada previamente en la literatura. Bioactividad anti-Vibrio de los aislados de Pseudovibrio Prueba de exclusión competitiva por inoculación puntual en agar Entre los 43 aislamientos de Pseudovibrio spp. evaluado contra Vibrio spp. patógeno, quince mostraron bioactividad contra los

cinco Vibrio spp. patógenos, veintitrés aislamientos mostraron bioactividad contra al menos un patógeno, mientras que cinco aislamientos no mostraron ninguna bioactividad anti-Vibrio. La mayoría de los aislamientos de Pseudovibrio mostraron zonas de inhibición de 8-15 mm de diámetro (Figura 1, Tabla 2). Los aislados codificados como Ps6, Ps11, Ps17, Ps18 y Ps37 mostraron una mayor bioactividad anti-Vibrio, formando zonas de exclusión mayores de 20 mm contra los cinco patógenos probados (Tabla 2). Tres de los patógenos Vibrio spp., V. campbellii, V. vulnificus y V. parahaemolyticus mostraron resistencia al antibiótico oxitetraciclina y fueron eficientemente excluidos por P. denitrificans (Fig. 1). Exclusión competitiva por prueba de difusión de agar de pozos Los cinco aislamientos de Pseudovibrio (Ps6, Ps11, Ps17, Ps18 y Ps37) que exhibieron una mayor bioactividad anti-Vibrio, presentaron zonas de inhibición para todos los Vibrio probados. Sin embargo, las zonas de inhibición más grandes fueron ejercidas por

68

Rod, straight or curved + 30 OC 3%

las cepas Ps11, Ps17 y Ps18 (Tabla 3). Por lo tanto, solo las cepas Ps11, Ps17 y Ps18 fueron evaluados adicionalmente en los ensayos in vivo. Identificación molecular de las cepas de Pseudovibrio más bioactivas contra Vibrio patógeno El análisis molecular confirmó que Pseudovibrio aislados Ps11, Ps17 y Ps18 con la mayor bioactividad antiVibrio correspondieron a las especies de Pseudovibrio denitrificans descritas previamente por Sertan-De Guzman et al. (2007) y Shieh et al. (2004). Las secuencias parciales de ADNr 16S de Ps11, Ps17 y Ps18 se enviaron a GenBank y el número de acceso se asignó como Ps11MH201036, Ps17MH201037, Ps18MH201038. Seguido por el análisis BLAST, la secuencia parcial del gen 16S rRNA de Ps11, Ps17 y Ps18 mostró un 100% de similitud con P. denitrificans. Las cepas Ps11, Ps17 y Ps18 se depositaron en el repositorio del Centro Nacional de Acuicultura e Investigaciones Marinas (Ecuador). Seguridad de las cepas de P. denitrificans


MANEJO ACUÍCOLA

- AGOSTO 2019 en larvas tempranas de camarones P. vannamei Para descartar los efectos negativos de P. denitrificans en las larvas de camarones, los camarones en etapa temprana zoea-1 fueron expuestos a los aislamientos Ps11, Ps17 y Ps18. Después de 48 horas de exposición directa, la supervivencia de zoea-1 expuesta a los tres aislamientos de P. denitrificans fue superior al 94%, no significativamente diferente (P <0.05) al tratamiento de control. Ensayo in vivo con P. denitrificans Efecto de P. denitrificans en la supervivencia de postlarvas y juveniles de P. vannamei mediante prueba de desafío con V. campbellii y V. parahaemolyticus En el primer desafío, la supervivencia de las postlarvas aumentó en los tres grupos tratados con los presuntos probióticos Ps11, Ps17 y Ps18 cuando fueron desafiadas con V. campbellii. Se observaron diferencias significativas en la supervivencia (P <0.05) entre las postlarvas tratadas con los aislamientos Ps11 y Ps17 (supervivencia 56 ± 10% y 53 ± 9%) y el grupo control (supervivencia 30 ± 8%) (Fig. 2A). En el segundo desafío, realizado con camarones juveniles desafiados con V. parahaemolyticus, la supervivencia en el grupo control fue de 17 ± 9%, mientras que la supervivencia en los tratamientos fue (38 ± 10%, 45 ± 6% y 42 ± 12%) siendo significativamente mayor (P <0.05), para Ps11, Ps17 y Ps 18 respectivamente (Fig. 2B). Efecto beneficioso del Pseudovibrio excluyendo Vibrio luminiscente en larvas de P. vannamei infectadas naturalmente Los Pseudovibrio evaluado (Ps11, Ps17 y Ps18) desplazaron eficientemente a el V. harveyi luminiscente presente en las postlarvas de P. vannamei (PL3) infectadas. Después de 48 horas, se estableció P. denitrificans en la población bacteriana de postlarvas, alcanzando el 50% de la biomasa bacteriana cultivable de postlarvas de camarones (Fig. 3). Vibrio total y V. harveyi se redujeron significativamente (P <0.05) con respecto al grupo de control. En este ensayo se observó que, además, la supervivencia de postlarvas expuestas a P. denitrificans fue de 57 ± 17%, 79 ± 12% y 69 ± 22%, para Ps11,

Fig. 1. Bioactividad de Pseudovibrio aislado, contra Vibrio patógeno. A) Pseudovibrio spp., frente a V. harveyi (E22). B) Pseudovibrio spp., frente a Vibrio campbellii (LM-2013). C) Pseudovibrio spp., frente a V. vulnificus (S2) y disco de oxitetraciclina D) Pseudovibrio spp., Frente V. parahaemolyticus (BA94C2) y disco de oxitetraciclina.

Ps17 y Ps18, respectivamente, mientras que la supervivencia del control fue del 49% ± 19%, sin diferencia significativa (P <0.05). Aplicación de P. denitrificans en el cultivo de P. vannamei: bioensayo en estanques Se mantuvieron los parámetros ambientales en rangos aceptables para el cultivo de P. vannamei a lo largo del experimento. La temperatura promedio fue de 26.5 oC, los niveles de oxígeno disuelto siempre se mantuvieron por encima de 3.5 mg L-1 y la salinidad fluctuó entre 34-45 g L-1. La supervivencia final para los tratamientos Ps17, Ps18 y control fue 79 ± 5%, 66 ± 7%, 63 ± 7%, respectivamente. La supervivencia del tratamiento Ps17 fue significativamente mayor (P <0.05) en comparación con el tratamiento Ps18 y el grupo control (Tabla 4). El rendimiento de producción del estanque tratado con P. denitrificans Ps17 también fue

69

significativamente mayor (P <0.05) en comparación con el tratamiento Ps18 y el grupo control. La relación de conversión de alimento entre tratamientos no fue diferente (P <0.05), variando entre 1.0 a 1.3 (Tabla 4). Con respecto a la presencia de P. denitrificans en los camarones analizados, el día 30 se registraron (103 UFC g-1) en el estómago y (104 UFC g-1) en el tracto digestivo. Los valores aumentaron a (105 UFC g-1) en el tracto digestivo y (104 UFC g-1) en el estómago el día 45 y permanecieron en el mismo orden de magnitud durante todo el experimento. Sin embargo, no hubo evidencia de colonias de P. denitrificans en los hepatopáncreas analizados. En el agua y el sedimento de los estanques tratados, los valores fluctuaron entre (103 a 104 UFC g-1) y (102 a 104 UFC ml-1), para agua y sedimento, respectivamente.


MANEJO ACUÍCOLA

- AGOSTO 2019

Tabla 2. Actividad antagonista de diferentes aislados de Pseudovibrio frente a cinco Vibrio spp. patógenos de camarones, por inoculación puntual en agar. Halos de exclusión expresado en (mm) después de la incubación durante 72 horas.

V. parahaemolyticus (27969)

V. campbellii (LM2013)

V. parahaemolyticus (BA94C2)

V. vulnificus (S2)

V. harveyi (E22)

Spectrum

Ps-1

15

11

11

15

20

5/5

Ps-2

15

24

-

16

21

4/5

Ps-3

17

11

12

17

15

5/5

Ps-4

-

30

-

7

17

3/5

Ps-5

8

26

13

15

26

5/5

Ps-6

23

25

21

25

19

5/5*

Ps-7

8

18

11

15

18

4/5

Ps-8

-

-

-

-

-

0/5

Ps-9

-

21

10

13

18

4/5

Codes

Ps-10

5

8

13

10

15

3/5

Ps-11

23

22

21

20

25

5/5*

Ps-12

-

3

11

-

18

2/5

Ps-13

-

-

15

-

-

1/5

Ps-14

10

21

13

11

20

5/5

Ps-15

-

-

6

-

12

1/5

Ps-16

11

1

8

21

21

4/5

Ps-17

22

30

35

27

31

5/5*

Ps-18

32

35

40

21

35

5/5*

Ps-19

-

21

6

21

11

3/5

Ps-20

6

35

10

22

29

4/5

Ps-21

-

-

-

-

-

0/5

Ps-22

18

16

17

19

17

5/5

Ps-23

-

-

-

27

-

1/5

Ps-24

-

-

-

12

-

1/5

Ps-25

10

12

15

11

18

5/5

Ps-26

-

4

-

-

-

0/5

Ps-27

-

17

-

1

-

1/5

Ps-28

10

11

15

15

21

5/5

Ps-29

19

15

17

16

12

5/5

Ps-30

-

5

-

6

-

0/5

Ps-31

-

-

4

-

-

0/5

Ps-32

15

15

14

11

11

5/5

Ps-33

-

-

15

9

4

1/5

Ps-34

22

24

12

22

25

5/5

Ps-35

12

7

10

5

-

2/5

Ps-36

6

3

4

12

-

1/5

Ps-37

22

24

23

22

25

5/5*

Ps-38

6

13

4

11

-

2/5

Ps-39

-

-

-

13

-

1/5

Ps-40

-

-

-

16

-

1/5

Ps-41

15

14

14

15

11

5/5

Ps-42

5

-

13

-

-

1/5

Ps-43

3

14

4

11

-

2/5

(−) means non-bioactive and (*) means activity>20mm for all pathogens.

70


MANEJO ACUÍCOLA

- AGOSTO 2019

Discusión Los probióticos comerciales utilizados en el cultivo de camarones pertenecen predominantemente a los géneros Lactobacillus y Bacillus (Hong et al., 2005; Martínez Cruz et al., 2012). Aunque algunas especies utilizadas comercialmente son marinas, la mayoría de las bacterias probióticas comerciales son de origen terrestre, porque inicialmente fueron formuladas para otros animales terrestres (Lauzon et al., 2008). Aunque estas formulaciones bacterianas son de probada eficacia para los organismos objetivos originales, su eficiencia puede verse comprometida cuando las condiciones ambientales son muy diferentes, como en el caso de los cultivos de camarones marinos. Los camarones peneidos están sujetos a alta salinidad y temperatura, lo que favorece el crecimiento de Vibrio spp. (Vezzulli et al., 2013; Zhang et al., 2016). El rango óptimo de salinidad y temperatura para cultivar P. vannamei es de 20 a 35 ups y entre 22 y 32 oC. Usando metagenómica, Zhang et al. (2016), muestra que la salinidad modifica la microbiota en los camarones, encontrando que a mayor salinidad los Vibrio son dominante en detrimento de Lactobacillus, mientras que Vezzulli et al. (2013), informan que una temperatura inferior a 37 oC afecta negativamente el crecimiento de los Lactobacillus. El biodescubrimiento marino es una alternativa prometedora para aislar bacterias marinas que funcionan como probióticos efectivos para organismos marinos cultivables. Los invertebrados marinos, particularmente las esponjas, albergan una gran diversidad bacteriana. Entre las bacterias marinas cultivables, destaca el género Pseudovibrio, y en las últimas décadas ha sido objeto de estudios debido a su versatilidad para producir moléculas bioactivas contra bacterias Gram negativas y positivas (O’Halloran et al., 2011; Penesyan et al., 2011; Bondarev et al., 2013; Naughton et al., 2017; Romano et al., 2018). En este estudio, aislamos varios aislamientos de P. denitrificans, que exhiben cualidades probióticas para los camarones, debido a su fuerte bioactividad anti-Vibrio. Estas cualidades se demostraron en nuestros

Tabla 3. Actividad antagonista de los aislados más activos de Pseudovibrio contra Vibrio spp. de camarones, por el método de difusión de agar de pozos. Halos de exclusión expresado en (mm) después de la incubación por 72 horas.

Codes Ps-6 Ps-11 Ps-17 Ps-18 Ps-37

V. parahaemolyticus (27969) 12 14 13 14 10

V. campbellii (LM2013)

V. parahaemolyticus (BA94C2)

9 12 15 14 11

11 10 12 13 10

V. vulnificus (S2) 13 14 13 12 12

V. harveyi (E22) 10 11 12 13 9

Fig. 2. A) Efecto de los tres aislados de Pseudovibrio sobre la supervivencia de las postlarvas de P. vannamei, desafiado con V. campbellii, inicialmente tratado durante cinco días con el Pseudovibrio, supervivencia (%) 72 hpe. B) Efecto de Pseudovibrio sobre la supervivencia de juveniles de P. vannamei, desafiados con V. parahaemolyticus, tratados inicialmente durante diez días con Pseudovibrio, supervivencia (%) 72 hpe. La barra de error representa el S.D. de la media (n = 4). El asterisco (*) representa significativamente diferente del control (P <0.05, Dunnett's).

experimentos, pruebas de desafío laboratorio y en estanques de cultivo.

en

En este estudio, se encontró bioactividad contra V. parahaemolyticus, V. campbellii, V. vulnificus y V. harveyi y para la cepa patógena altamente virulenta de V. parahaemolyticus BA94C2 positiva a PirA / PirB, toxinas asociadas a patologías AHPND en cultivos de camarones (FAO, 2013; Lai et al., 2015; Lee et al., 2015; Dong et al., 2017a; Zheng et al., 2018). Hasta donde sabemos, este es el primer informe que analiza el potencial antiVibrio de Pseudovibrio contra Vibrio spp. en camarones. La actividad antibacteriana del género Pseudovibrio ha sido mencionada en numerosos estudios (O’Halloran et al., 2011; Crowley et al., 2014; Raina et al., 2016; Naughton et al., 2017), contra Gram-positivos y Bacterias Gram-negativas, como E. coli, Bacillus subtilis, Kluyveromyces marxianus, Salmonella enterica serotipo Typhimurium, Staphylococcus aureus resistente a la meticilina (MRSA) y Clostridium difficile (Flemer et al., 2012; Margassery et al., 2012).

71

Recientemente, se informó la actividad contra dos Vibrio patógenos encontrados en corales, Vibrio coralliilyticus y Vibrio owensii (Raina et al., 2016). La actividad antibacteriana de las cepas de Pseudovibrio se ha asociado con su metaboloma, ácido sulfúrico, ácido tropodietetico (TDA) (Penesyan et al., 2011; Crowley et al., 2014; Harrington et al., 2014). El TDA puede matar o inhibir Vibrio spp. patógenos en larvas de peces (Grotkjær et al., 2016). Además, siendo Pseudovibrio una bacteria típica de los ambientes marinos (Versluis et al., 2018), la salinidad favorece su crecimiento. Además, los aislados de Pseudovibrio tuvieron un crecimiento óptimo entre 25 a 31 oC. Estas condiciones favorecen su capacidad de competir contra Vibrio spp. Un paso muy importante para evaluar las características probióticas es descartar la inocuidad de los candidatos bacterianos. Los resultados corroboran la inocuidad de tres aislados de Pseudovibrio evaluados en larvas de camarones zoea-1. El análisis microbiológico confirmó que los Pseudovibrio estaban asociados con el zoea-1, sin provocar


MANEJO ACUÍCOLA efectos adversos. Varios Pseudovibrio spp. han informado como simbiontes de muchos invertebrados bentónicos marinos, incluidos los camarones (Romano, 2018). Además, Pseudovibrio está bien equipado para sobrevivir en entornos adversos donde los nutrientes pueden fluctuar, como el agua de mar poco profunda (Fukunaga et al., 2006) y pueden proliferar en aguas marinas ultra oligotróficas (Schwedt et al., 2015). Esta versatilidad metabólica del género favorece su asociación con sus huéspedes invertebrados y son beneficiosos o al menos neutrales (Versluis et al., 2018a; Alex y Antunes, 2018), debido a que la mayoría de ellos están comúnmente asociados con animales sanos. Después de las pruebas de inocuidad, el siguiente paso fue determinar la efectividad de P. denitrificans contra Vibrio spp. pruebas in vivo. Para verificar la efectividad de P. denitrificans como probiótico, se realizaron dos pruebas de desafío empleando dos vibrios altamente virulentos, V. campbellii y V. parahaemolyticus. Un aumento significativo en la supervivencia de larvas y juveniles desafiados. Además, el ensayo realizado en PL3, que estaba naturalmente infectado con V. harveyi, indica fuertemente las capacidades de P. denitrificans para competir y desplazar a Vibrio spp. presente en cultivos de postlarvas de camarón mejorando su supervivencia. Este hallazgo es muy relevante, considerando que las bacterias del género Vibrio están bastante adaptadas al ambiente de cultivo de los organismos marinos (Moss y Leamaster, 2000; Tzuc et al., 2014). No hubo diferencias significativas en la supervivencia de las larvas de camarones tratadas con (Ps11, Ps17 y Ps18) en comparación con el grupo control. La alta mortalidad observada en las postlarvas en el grupo de control probablemente se relacionó con la alta carga de V. harveyi luminiscente presente. Vibrio luminiscente spp. se han asociado con mortalidades severas en el cultivo de camarones, principalmente larviculturas en criaderos de camarones (Defoirdt et al., 2012; Zhou et al., 2012).La prueba del estanque confirmó los efectos beneficiosos de la aplicación de P. denitrificans, demostrando su efectividad en el crecimiento de la producción, el aumento de la supervivencia,

- AGOSTO 2019 Tabla 4. Efecto beneficioso de las cepas de Pseudovibrio en el cultivo de camarones P. vannamei durante un bioensayo de 108 días (duración del ciclo de producción). Los resultados se presentan como media ± DS (n = 4). Diferentes letras minúsculas indican diferencias significativas (P <0.05). Treatments

Stocking density (shrimp/m2)

SRG (% day-1)

Average weight (g)

Survival (%)

Yield (kg ha-1)

FCR

Ps-17

8

7.7±0.2 a

10.2±2.0 a

79.2±5.3 a

899.6±59.5 a

0.99±0.16 a

Ps-18

8

7.7±0.3 a

10.8±3.4 a

66.3±6.8 b

753.4±77.2 b

1.14±0.28 a

Control

8

7.6±0.3 a

9.4±2.4 a

63.0±6.7 b

715.9±76.4 b

1.35±0.32 a

Fig. 3. Eficacia de las cepas de P. denitrificans para colonizar y desplazar Vibrio total y Vibrio luminiscente en camarones después de 48 horas de aplicación de P. denitrificans. La barra de error representa el S.D. de la media (n = 3). El asterisco (*) representa significativamente diferente del control (P <0.05, Dunnett's).

el peso promedio de la cosecha de camarones y los rendimientos. El mejor rendimiento de producción se registró con P. denitrificans aislado Ps17 en comparación con el aislado Ps18. Este resultado indica que los aislados de P. denitrificans probados pueden ejercer diferentes efectos y, por lo tanto, se debe tener precaución al extrapolar el efecto beneficioso de las cepas de P. denitrificans. La variabilidad en la bioactividad obtenida de diferentes aislamientos indica la necesidad de comenzar estudios similares utilizando varios aislamientos. En nuestro estudio, empleamos nueve muestras de esponja, tomadas en diferentes lugares, para aumentar la posibilidad de obtener un amplio conjunto genético de bacterias. Se han encontrado resultados similares en otras bacterias. Particularmente, la cepa (ILI) de V. algynoliticus funciona como un probiótico para el camarón (Rodríguez et al., 2007), mientras que otras cepas de la misma especie se han reportado como patógenas (Liu et al., 2004). Del mismo modo, Sonnenschein et al. (2018), informa toxicidad de diferentes cepas de Roseobacters contra microalgas.

72

Conclusión El biodescubrimiento marino es una alternativa prometedora para aislar bacterias marinas, que funciona como probióticos efectivos para organismos marinos cultivados. Para identificar, Pseudovibrio spp. altamente bioactivo contra el patógeno Vibrio spp. de camarones, se tomaron varias muestras de diferentes morfotipos de esponja A. gerardogreeni, en varios lugares del Área Marina Protegida El Pelado (REMAPE). Se obtuvieron 43 aislamientos, entre ellos, tres aislamientos codificados como Ps11, Ps17 y Ps18 mostraron la mayor bioactividad contra Vibrio spp. altamente patógeno de camarones. La bioactividad anti-Vibrio demostrada por ensayos in vitro fue confirmada por el efecto beneficioso observado en las pruebas de desafío, las larvas infectadas naturalmente y los estanques de cultivo de camarones. Los resultados de este estudio indican qué Pseudovibrio puede usarse como control biológico para Vibrio spp. en cultivo de camarones. Se necesitan más estudios para evaluar las concentraciones prácticas a escala comercial●


ESTADÍSTICAS

- AGOSTO 2019

COMERCIO EXTERIOR

EXPORTACIONES DE CAMARÓN ECUATORIANO (TONELADAS MÉTRICAS VS DÓLARES) 2010 - 2018

Fuente: Banco Central del Ecuador

EXPORTACIONES DE CAMARÓN ECUATORIANO: COMPARATIVO MENSUAL (LIBRAS) Enero 2016 hasta Julio 2019

Fuente: Cámara Nacional de Acuacultura

74


ESTADÍSTICAS

- AGOSTO 2019

COMERCIO EXTERIOR

EVOLUCIÓN DEL PRECIO DEL CAMARÓN ECUATORIANO: PROMEDIO ANUAL (LIBRA) 2013 - 2018

EVOLUCIÓN DEL PRECIO DEL CAMARÓN ECUATORIANO: PROMEDIO MENSUAL (LIBRA) Julio 2017 hasta Julio 2019

PORCENTAJE DE PARTICIPACIÓN DE MERCADO DEL CAMARÓN ECUATORIANO (LIBRAS) Enero a Julio 2018 vs Enero a Julio 2019

Fuente: Cámara Nacional de Acuacultura

75


NOTICIAS

- AGOSTO 2019

Aqua Expo El Oro, llegó a su décima edición

El pasado 19 de julio, se inauguró el más grande evento camaronero ‘Aqua Expo EL Oro 2019’, organizado por la Cámara Nacional de Acuacultura, que llegó a su décima edición en la ciudad de Machala, y que se constituyó en el evento técnico – comercial más grande de la provincia que contó con doble programa, conferencias nacionales e internacionales, feria comercial y la realización de la primera noche del camaronero orense. Al acto inaugural asistieron: Carlos Miranda, Presidente del Directorio CNA; Jose Antonio Camposano, Presidente Ejecutivo CNA; Catalina Cárdenas, ex - Viceministra de Acuacultura y Pesca; Clemente Bravo Riofrío, Prefecto de El Oro; Darío Macas, Alcalde de Machala; exportadores y productores de Ecuador y Perú, entre otros.

El evento contó con la participación de conferencistas de Estados Unidos, Brasil, Perú y Ecuador. En tanto, la feria comercial contó con más de 100 empresas nacionales en más de 130 stands, que presentaron

Sector público - privado unen esfuerzos por combatir delincuencia a gremio camaronero

las últimas tendencias en lo que respecta a innovación y tecnología de productos o servicios acuícolas.

Representantes globales de IBM visitan a miembros de Sustainable Shrimp Partnership (SSP) en Ecuador

Ante los últimos hechos delictivos ocurridos en el Golfo de Guayaquil y Archipiélago de Jambelí, la Armada del Ecuador, Policía Nacional, Subsecretaría de Acuacultura del Ministerio de la Producción, Comercio Exterior, Inversiones y Pesca y representantes de la Cámara Nacional de Acuacultura, mantuvieron una sesión de trabajo para evaluar y revisar los procedimientos de seguridad al gremio camaronero. José Antonio Camposano, Presidente Ejecutivo de la Cámara Nacional de Acuacultura informó que han hecho un llamado al Consejo de la Judicatura para que revise la actuación de ciertos jueces y fiscales que no están haciendo correctamente su trabajo, puntualizó. Por su parte, Jorge Cabrera, Director Nacional de Espacios Acuáticos (DIRNEA) explicó que la activación de "Rutas Seguras" ha logrado resultados favorables tras no registrarse ningún evento delictivo y dijo que en las instalaciones de los puestos de auxilio marítimo se ha facilitado para que los patrulleros y/o unidades de guardacostas puedan tener un punto logístico intermedio entre la base principal y a lo largo del río. Finalmente, Jaime Amores, Jefe de Operaciones Zona 8 de la Policía Nacional, detalló que se intensificarán operativos de seguridad para prevención de los delitos al sector camaronero.

78

Raj Rao, General Manager, Distribution, Industry Platforms; y Lou Izquierdo, Global Sales Manager Blockchain de IBM visitaron junto al equipo de SSP a varios de los miembros fundadores de esta iniciativa con el objetivo de conocer más a fondo el proceso de producción del camarón y las buenas prácticas de producción. SSP está trabajando con IBM para ofrecer completa trazabilidad del producto a través del ecosistema IBM Food Trust a base de tecnología Blockchain, Esta herramienta le permitirá al consumidor escanear un código QR en el empaque del camarón y descubrir en qué finca se lo cultivó, así como indicadores clave sobre el perfil de seguridad y sustentabilidad. El camarón ecuatoriano es el primero en el mundo en ser parte de este ecosistema.


AQUACULTURA #130  

Revista especializada de la Cámara Nacional de Acuacultura.

AQUACULTURA #130  

Revista especializada de la Cámara Nacional de Acuacultura.