a product message image
{' '} {' '}
Limited time offer
SAVE % on your upgrade

Page 1


ÍNDICE Edición 132 - Diciembre 2019 INFORMACIÓN DE COYUNTURA

8

El Proyecto de Ley Orgánica de Acuicultura y Pesca en debate en la Asamblea

12

El camarón: el primero de los no petroleros

14

Pronóstico de etapa invernal en la costa ecuatoriana

16

Larvicultura responsable

21

Más de 10 millones de dólares generó AQUA EXPO 2019

ARTÍCULOS TÉCNICOS

22

Una visión del futuro para el control de enfermedades en la acuicultura del camarón

34

Krill - Estimulante alimenticio altamente atractivo para dietas de camarón

37

Microalgas de agua dulce (Schizochytrium sp.) como sustituto de aceite de pescado para balanceado de camarón

48

Baja de Hsp70 reduce la tolerancia al pH bajo y salinidad en postlarvas de Litopenaeus vannamei

55

La importancia de la salinidad en la acuacultura

58

Silencio transcripcional de la hormona inhibidora de vitelogénesis (VIH) del subtipo I en el camarón blanco, Litopenaeus vannamei

69

Evaluación de parámetros genéticos para rasgos reproductivos y tasa de crecimiento en el camarón blanco del Pacífico Litopenaeus vannamei cultivado en agua salobre

ESTADÍSTICAS

78

Exportaciones de camarón

80

Reporte del mercado EE. UU - Urner Barry

NOTICIAS

82

Noticias de interés

Presidente Ejecutivo Ing. José Antonio Camposano Editora “AquaCultura” Msc. Shirley Suasnavas ssuasnavas@cna-ecuador.com Consejo Editorial Msc. Yahira Piedrahita Mphil. Leonardo Maridueña Ing. Attilio Cástano Econ. Heinz Grunauer Diseño, diagramación y foto de portada Ing. Orly Saltos osaltos@cna-ecuador.com Corrección de estilo Silvia Idrovo Valverde Comercialización Gabriela Nivelo gnivelo@cna-ecuador.com


EDITORIAL José Antonio Camposano Presidente Ejecutivo

El sector camaronero debe adaptarse a las condiciones de los mercados de destino

E

ste año 2019 que casi termina estuvo marcado por un mayor acercamiento a nuestro principal mercado: la República Popular de China. Por un lado, las estadísticas demuestran que el apetito del consumidor chino por camarón ecuatoriano es indiscutible; por otro que el crecimiento de la producción y exportación del crustáceo de parte de nuestro país se debe casi exclusivamente a la creciente demanda del denominado “gigante asiático”.

Todo el sector ha sido testigo cómo las sanciones impuestas a algunas empresas exportadoras generaron un impacto considerable a toda la cadena productiva motivado por la incertidumbre de no contar con una hoja de ruta para solucionar el inconveniente. Ante esa realidad, la sola posibilidad de enfrentar una sanción al país motivó la acción inmediata y coordinada entre las autoridades del Gobierno Nacional y los miembros del sector privado técnicamente representados por la Cámara Nacional de Acuacultura.

Revisando con detalle los números, nuestro país ha exportado hasta el presente mes de octubre 600 millones de libras que equivalen a USD 1,560 millones, es decir que el 66% de nuestra producción se destina para atender la demanda del mercado chino. Asimismo, las cifras oficiales chinas, que en volumen coinciden con las cifras oficiales ecuatorianas, demuestran que el Ecuador domina las importaciones de ese mercado con un 50% del total, seguido de Argentina e India con 21% y 20% respectivamente.

Hoy en día nos encontramos en el proceso de asimilación de las nuevas condiciones de mercado a las que tenemos que regirnos. Respetuosos, como siempre lo hemos sido con nuestros socios comerciales, el sector se encuentra realizando las inversiones y ajustes para cumplir con los compromisos adquiridos. De igual manera, las autoridades están trabajando para acoplarse a la nueva realidad evitando, en lo posible, los impactos que todo cambio puede producir y procurando que las eventuales afectaciones sean momentáneas.

Lo dicho anteriormente demuestra que la relación comercial camaronera entre Ecuador y la China se acrecienta a partir del año 2010 en que exportamos sólo el 2% de nuestra producción a ese destino para crecer a 7% en 2011, luego a 15% en 2012 para terminar este 2019 vendiéndoles dos de cada tres libras que producen las casi 215,000 hectáreas de camaroneras que tiene nuestro país. Es necesario tomarse el tiempo para asimilar este panorama pues la coyuntura actual demanda que, una vez más, la industria ajuste su modelo de negocio si pretende no sólo seguir creciendo como lo ha hecho por casi dos décadas, justamente desde que dejamos atrás el embate de la mancha blanca, sino evitar contraerse peligrosamente ante la pérdida de su mercado más importante en cuestión de semanas o meses.

A toda industria le llega un momento en el que debe tomar decisiones para modificar sus prácticas y adecuarse a las nuevas realidades, más aún cuando se trata de sectores que participan en un mercado global como es nuestro caso. El Ecuador tiene un sistema de cultivo que ha demostrado generar crecimiento sostenido y sostenible. A pesar de ello, el mercado requiere que tomemos correctivos por lo que hemos asumido ese reto con responsabilidad con el objetivo de superar este inconveniente y seguir creciendo para no perder el espacio conseguido y, por el contrario, transformar una amenaza en una oportunidad que nos permita, al final de este proceso, inclusive ampliar la ventaja que tenemos frente a nuestros competidores.


DIRECTORIO PRIMER VICEPRESIDENTE Ing. José Antonio Lince

PRESIDENTE DEL DIRECTORIO Econ. Carlos Miranda

SEGUNDO VICEPRESIDENTE Ing. Marcelo Vélez

VOCALES Blgo. Carlos Sánchez Ing. Ricardo Solá Ing. Alex Olsen Ing. Ori Nadan Ing. Attilio Cástano Ing. Luis Francisco Burgos Ing. Jorge Redrovan Sr. Isauro Fajardo Tinoco Ing. Leonardo De Wind Ing. Oswin Crespo Econ. Sandro Coglitore Ing. Rodrigo Laniado Econ. Roberto Coronel

Ing. Diego Illingworth Ing. Alex Elghoul Ing. Rodrigo Vélez Dr. Marco Tello Sr. Luis Alvarado Ing. Paulo Gutiérrez Sr. Luis Aguirre Ing. Fabricio Vargas Ing. Francisco Pons Dr. Alejandro Aguayo Econ. Heinz Grunauer Ing. Víctor Ramos Ing. David Eguiguren

Ing. Marcos Wilches Ing. Álvaro Pino Arroba Sr. Carlos Rosales Sr. Roberto Aguirre Ing. Miguel Uscocovich Ing. Alex De Wind Sra. Verónica Dueñas Ing. Walter Intriago Ing. Danny Vélez Sr. Wilson Alcívar Gómez Ing. Luis Gálvez Correa


ElCOYUNTURA Proyecto de Ley Orgánica de Acuicultura y Pesca en debate en la Asamblea

- DICIEMBRE 2019

E

l 21 y 26 de noviembre de 2019, en el Pleno de la Asamblea Nacional, se desarrolló el primer debate del Proyecto de Ley Orgánica para el desarrollo de la Acuicultura y Pesca, que busca actualizar la Ley que está vigente desde hace 45 años y que necesita ajustarse a los requerimientos internacionales actuales e impulsar el desarrollo de ambos sectores que generan más de 4.800 millones en exportaciones y que representa casi el 5% del Producto Interno Bruto del país. El articulado fue preparado por la Comisión Especializada Permanente de la Soberanía Alimentaria y Desarrollo del Sector Agropecuario y Pesquero; contaba con 225 artículos, divididos en 7 títulos, 7 disposiciones generales, 11 disposiciones transitorias, 7 disposiciones reformatorias, 1 disposición derogatoria y 1 disposición final. El documento integró los insumos de propuestas presentadas, incluso, por exlegisladores en períodos anteriores: “Ley Orgánica para el Desarrollo de la Pesca, Manglar, Acuicultura y Recolección”, del exasambleísta Pedro De la Cruz; la “Ley Reformatoria a la Ley de Pesca y Desarrollo Pesquero”, del exasambleísta Montgómery Sánchez Reyes; la “Ley Reformatoria a la Ley de Pesca y Desarrollo Pesquero”, de Pedro Curichumbi Yupanqui y la “Ley Orgánica de Pesca y Acuicultura”, enviada por el Presidente Lenín Moreno Garcés.

representantes del sector público y privado, gremios y asociaciones de acuicultura y pesca, quienes efectuaron sus observaciones previamente en la Comisión. El Proyecto busca establecer un régimen jurídico para el desarrollo de la pesca y la acuicultura en todas sus fases. Además, de garantizar el control de las actividades, a través del Plan Nacional Acuícola y Pesquero; fomenta la producción de alimentos sanos, el desarrollo sostenible y sustentable, así como la protección, conservación y uso de recursos hidrobiológicos y ecosistemas. Contempla la creación del Fondo Nacional

“La Ley vigente desde 1974 estaba sujeta a los requerimientos de la época, pero que, actualmente, el mercado requiere que responda a los principios de sostenibilidad y sustentabilidad, y que contribuya al combate de la pesca ilegal”. Rafael Trujillo Director de la Cámara Nacional de Pesquería

El informe también integró los aportes de los

8

de Investigación Acuícola y Pesquero, que permitirá financiar planes, programas y proyectos de investigación, ciencia, tecnología e innovación. El Proyecto de Ley otorga incentivos a la producción, acceso a líneas de crédito, incentivos tributarios a la inversión privada, incentivos ambientales, ferias productivas, hipoteca especial acuícola y prenda acuícola. En el marco del tratamiento del Proyecto de Ley en primer debate, líderes de los sectores productivos expusieron ante el Pleno sus criterios.


COYUNTURA

- DICIEMBRE 2019 En representación del sector acuícola, el Presidente Ejecutivo de la Cámara Nacional de Acuacultura, José Antonio Camposano, destacó la importancia de contar con una Ley que brinde garantías jurídicas a través de un adecuado marco regulatorio que permita el desarrollo sostenido y sostenible de la actividad acuícola, “actividad que le hace tanto bien al país”; pues el sector camaronero es el principal producto de exportación del país, que genera más de 261 mil plazas de trabajo directas e indirectas. Oswin Crespo, Presidente de la Cooperativa de Camaroneros de Pedernales-Manabí y miembro del Directorio de la CNA ante el Pleno solicitó implementar un mecanismo que permita a los pequeños productores de camarón acceder a programas de crédito. En el debate, hubo 19 intervenciones por parte de los Legisladores, entre las observaciones se destacó: que se mantengan las ocho millas para la pesca artesanal; que no se dé paso a la creación de la Agencia de Regulación y Control Acuícola y Pesquero porque duplicaría las funciones con el ente rector; que se garantice la conservación de los ecosistemas y medio ambiente; que se impulsen programas para la sostenibilidad y sustentabilidad de ambos sectores. Con estos y otros planteamientos, se cerró el primer debate del Proyecto de Ley, el articulado regresó a la Comisión de Soberanía Alimentaria para la construcción del informe para segundo debate a inicios el 2020. Lenin Plaza Castillo, Presidente de la Comisión Especializada Permanente de la Soberanía Alimentaria y Desarrollo del Sector Agropecuario y Pesquero indicó que la Asamblea tiene la responsabilidad histórica de promulgar una Ley de Pesca y Acuicultura que por primera vez en 45 años crearía un marco jurídico que regule la actividad camaronera. La Comisión tomó en cuenta los aportes del Proyecto de Ley Orgánica para el Desarrollo de la Pesca, Manglar, Acuicultura y Recolección, propuesto por el exasambleísta Pedro de la Cruz; la Ley Reformatoria a la Ley de Pesca y Desarrollo Pesquero del exasambleísta Montgómery Sánchez, la Ley Reformatoria

“Esperamos contar con una Ley que brinde garantías jurídicas a través de un adecuado marco regulatorio que permita el desarrollo sostenido y sostenible de la actividad acuícola. El sector camaronero es el principal producto de exportación del país que genera más de 261 mil plazas de trabajo directas e indirectas”. José Antonio Camposano Presidente Ejecutivo de la Cámara Nacional de Acuacultura

“Nosotros estamos en un momento histórico, la responsabilidad de esta Comisión es bastante grande, queremos estar a la altura de las exigencias no solo en nuestro país, sino también a nivel internacional, que sigamos construyendo una Ley para todos. Como Hemos dicho que: Nadie se sienta ni dueño de la Ley, ni que nadie se sienta fuera de la Ley”. Lenin Plaza Castillo Presidente de la Comisión Especializada Permanente de la Soberanía Alimentaria y Desarrollo del Sector Agropecuario y Pesquero

a la Ley de Pesca y Desarrollo Pesquero del exasambleísta Pedro Curichumbi Yupanqui y la propuesta enviada por el Ejecutivo el 16 de agosto de 2019. Afirma que la Comisión que preside ha desarrollado sesiones itinerantes en territorio en las provincias de El Oro, Santa Elena, Guayas, Manabí y Esmeraldas para receptar las observaciones de los actores involucrados e incorporarlas al Proyecto. Uno de los temas que considera será discutido en Segundo Debate es la extensión de las concesiones de las zonas de playa y bahía,

9

que algunos legisladores creen que la Ley deba especificar. Para Boris Estupiñán Ortiz, Coordinador de la Subcomisión de Acuacultura y Pesca y líder del Proyecto de Ley elaborado por la Comisión, considera que una diferencia entre el Proyecto de Ley presentado por el Ejecutivo es que no incluía la defensa de las 8 millas y que el articulado del Gobierno tenía 160 artículos, mientras que la del Legislativo tiene 230 artículos.


COYUNTURA

- DICIEMBRE 2019

“Buscamos una Ley que no esté a favor del industrial ni del pequeño, ni del mediano. Hemos escuchado a todos los gremios para así poder hacer una Ley equitativa” afirmó Estupiñan.

“Antes el sector acuícola y pesquero estaban adscritos al Ministerio de Agricultura y Ganadería y actualmente, pertenece a un ministerio que tiene algunas atribuciones en el ámbito de la producción, atracción de inversiones, la generación de todos los temas de industria, comercio exterior. Planteamos que el mismo personal que labora en el Viceministerio de Acuacultura y Pesca pase a ser parte del Ministerio de Acuacultura y Pesca”.

Por su parte el Asambleísta Nacional Carlos Bergmann Reyna, durante una sesión de la Comisión propuso que se restituya el Ministerio de Acuacultura y Pesca que actualmente tiene categoría de Viceministerio. Considera que debe mantenerse en Manabí porque de esa provincia sale más del 70% de la producción industrial atunero, que junto al camarón son los dos de las tres principales divisas que genera fuentes de trabajo. La Comisión de Soberanía Alimentaria de la Asamblea Nacional inició en noviembre pasado el proceso de sistematización de observaciones recogidas sobre el proyecto de Ley para el Desarrollo de la Acuicultura y Pesca. Realizó reuniones del consejo técnico

Carlos Bergmann Reyna Miembro de la Comisión de Soberanía Alimentaria y Desarrollo del Sector Agropecuario y Pesquero

y el equipo interinstitucional como parte del cronograma de trabajo, previo a entregar a la Secretaría de la Asamblea el informe para

10

segundo y definitivo debate el 9 de enero de 2020, si las prioridades de la agenda Legislativa no cambian●


COYUNTURA

- DICIEMBRE 2019

El camarón: el primero de los no petroleros Ecuador enfrenta nuevas exigencias en los mercados internacionales

D

esde el 2017, el camarón se convirtió en el principal producto de exportación no petrolero del país y en el 2019 se prevé alcanzar una exportación total de 1.400 millones de libras, lo que equivaldrá a alrededor de USD 3.500 millones, de acuerdo a la proyección de la Cámara Nacional de Acuacultura. El principal destino de las exportaciones del sector es Asia, región a la que se destinó el 66% de sus ventas. En este 2019, el mercado que generó expectativa fue China, tras la prohibición temporal impuesta a empresas ecuatorianas por la supuesta presencia de los virus: “Mancha Blanca” y “Cabeza Amarilla”. Tras conocer la notificación, el Presidente Ejecutivo de la Cámara Nacional de Acuacultura y una delegación del sector privado viajaron junto con autoridades del gobierno nacional para reunirse con representantes de la Dirección General de Aduana China el 16 de septiembre pasado. El propósito de la reunión fue presentar los argumentos técnicos sobre los controles nacionales para cumplir con los requerimientos sanitarios de China.

Exportación de camarón del 2017 - 2019 AÑO

LIBRAS

TONELADAS

2017

938.583.529

425.734

2018

1.115.223.755

505.856

2019

1.300.000.000

589.670

Fuente: Cámara Nacional de Acuacultura

ecuatorianas que presentaron resultados positivos para “Mancha Blanca”. La Dirección General de Aduana reiteró que los monitoreos se intensificarían pues se habría detectado también Necrosis Infecciosa Hipodérmica y Hematopoyética (IHHNV) y no se permitiría el ingreso de producto positivo, indistintamente que ésta se encuentre presente en territorio Chino. Semanas más tarde, el 27 de noviembre, nuevamente Ecuador participó de una mesa de negociación con China y logró importantes avances.

Luego de varias horas de diálogo entre delegados de ambos países, las autoridades chinas resolvieron levantar la medida a una de las empresas exportadoras que habría dado un falso positivo para el virus de “Cabeza Amarilla”. Representantes de la Aduana China aceptaron el argumento técnico de que en Ecuador no ha sido declarada esa enfermedad. Lamentablemente, la medida no se levantó para las otras exportadoras

“Las autoridades chinas mostraron total apertura a lo largo de este proceso para encontrar un mecanismo que nos permita continuar con nuestras exportaciones mediante el cumplimiento de una serie de acciones acordadas en las mesas de diálogo”. José Antonio Camposano Presidente Ejecutivo de la Cámara Nacional de Acuacultura José Antonio Camposano, Presidente Ejecutivo de la Cámara Nacional de Acuacultura, reunido con autoridades de la Aduana de China.

12


COYUNTURA

- DICIEMBRE 2019 Indicó además que se está trabajando coordinadamente, entre autoridades y sector privado, para cumplir con los compromisos acordados a fin de garantizar el acatamiento de los requisitos de cada mercado de destino; en este caso, principalmente, el mercado de la República Popular de China. Por su parte, Iván Ontaneda, Ministro de Producción, Comercio Exterior, Inversiones y Pesca en rueda de prensa indicó que existe una hoja de ruta conjunta entre autoridades ecuatorianas y chinas, para garantizar un flujo regular del camarón ecuatoriano a este mercado asiático.

“Los resultados de la reunión mantenida entre autoridades chinas y ecuatorianas... han permitido mejorar nuestra relación, alcanzando entendimientos y compromisos con miras a continuar la exportación de camarón ecuatoriano a China”. Iván Ontaneda Ministro de Producción, Comercio Exterior, Inversiones y Pesca Por su parte, la Secretaría de Calidad e Inocuidad es la entidad encargada de realizar el análisis de Mancha Blanca (WSSV) a lotes de camarón que tengan como destino de exportación China, conforme a lo exigido por la Administración General de Aduana de ese país. La Constitución de la República del Ecuador reconoce el deber del Estado para promover la Soberanía Alimentaria, a través de lo que estipula El Plan Nacional de Control, expedido en el 2006 por la Autoridad Competente; el documento establece las regulaciones sanitarias adecuadas que permiten asegurar la calidad e inocuidad de los productos acuícolas y pesqueros. En fiel cumplimiento a la norma, Ecuador tiene que adaptarse a las condiciones y exigencias de su principal mercado: China. Según estadísticas de la Cámara Nacional de Acuacultura, de enero a octubre de 2019, Ecuador había exportado a China 606.146.545 de libras, lo que representó USD 1.557.472.906. De ahí la importancia de mantener este flujo comercial, para seguir impulsando el crecimiento del “primero de los no petroleros” que es uno de los pilares fundamentales de la economía ecuatoriana, que genera 261 mil empleos directos e indirectos y del cual el 6,3% del total de la producción total (PIB) de la economía nacional depende de la actividad de la cadena camaronera●

13


COYUNTURA

- DICIEMBRE 2019

Pronóstico de etapa invernal en la costa ecuatoriana Autor: Leonardo Maridueña, Director de Ambiente de la Cámara Nacional de Acuacultura lmariduena@cna-ecuador.com

P

ara la elaboración del presente diagnóstico - pronóstico, se tomó en consideración tres fuentes de investigación científica: el Centro Internacional para la Investigación del Fenómeno “El Niño”, (CIIFEN); el Instituto del Mar de Perú (IMARPE) y el informe de la Administración Océano Atmosférica de Estados Unidos (NOAA).

temperaturas más bajas de lo normal, como puede apreciarse en el gráfico 1 cuya fuente es el IMARPE; lo que demuestra que hasta noviembre hay una significativa influencia de la corriente de Humboldt, concordante con los resultados del CIIFEN; la corriente de Humboldt, trae consigo de manera normal aguas frías, que producen la estación seca en nuestras costas.

Existe una coincidencia entre las tres fuentes investigadas, según los resultados de los monitoreos aún se observan anomalías negativas en la temperatura superficial del mar, en el Pacífico sudoriental, esto significa

Sin embargo, en el informe de IMARPE actualizado al 21 de noviembre, ya se observa el debilitamiento de la corriente de Humboldt; lo que tiene como consecuencia el calentamiento de las aguas frente a nuestras

costas, y el descenso de la corriente “El Niño”, evento periódico y normal que ocurre cada año, produciendo la estación lluviosa en nuestra costa; como se observa en el gráfico 2. Esta información es concordante con los resultados presentados por la NOAA que se presentan a continuación en el gráfico 3, donde se puede apreciar la evolución de las temperaturas superficiales. Las temperaturas subsuperficiales, entre 50 y 300 mts de profundidad, publicados por la NOAA, dan fe; que el calentamiento no

Gráfico 1

Gráfico 2

Fuente: IMARPE, informe noviembre 2019.

Fuente: IMARPE Noviembre 21/2019

14


COYUNTURA

- DICIEMBRE 2019 es superficial sino que también es notable en el perfil de la columna de agua como se observa en el gráfico 4. Debiendo recordarles que en los gráficos de la NOAA, la posición de nuestras costas se encuentra a los 80 W.

Conclusión De acuerdo a la interpretación de los informes evaluados, tenderíamos a tener una temporada invernal normal; con inicio de la estación lluviosa, probablemente a

Gráfico 3

Gráfico 4

Fuente: NOAA

Fuente: NOAA

15

finales del mes de noviembre Conforme se presentan las condiciones actuales de las evaluaciones en tiempo real de las fuentes arriba citadas●


Larvicultura responsable REPORTAJE Efectivos protocolos de limpieza, desinfección y secado son imprescindibles para el proceso de producción de larvas.

- DICIEMBRE 2019 larvas para la empresa, enumera y describe lo que considera son aspectos claves para la producción sostenible y sustentable de larvas. 1) Bajas densidades de 100 -125 nauplios por litro. 2) Efectivos protocolos de limpieza, desinfección y secado. 3) Los secados sanitarios en las dos fases de cultivo larvario no deben ser menor a ocho días, con la debida desinfección de los materiales y utensilios. Después de cada final de ciclo de cultivo se limpian los tanques para remover materia orgánica, se desarman las líneas de aire y agua de los módulos y se vuelve a lavar y desinfectar los tanques dos días antes de la siembra. En maduración, se lavan y se desinfectan los tanques de desove, eclosión y enjuague de nauplios después de cada despacho. 4) Se monitorea cada dos horas los parámetros de oxígeno y temperatura, para mantener 32 grados en los tanques de cultivo y el oxígeno no menor de 4.5 mg/litro. Se efectúa el control de amonio, monitoreo diario de PH desde el inicio del cultivo. 5) Análisis físico-químico en las diversas áreas, con énfasis en la larvicultura como balance iónico (calcio, magnesio y potasio) Además de otros análisis según los requerimientos como alcalinidad, dureza total, cloro, hierro, fósforo, sulfato, cobre, manganeso.

E

n esta edición, la Revista Aquacultura busca compartir con sus lectores la experiencia de un laboratorio orgánico de producción de larvas, que funciona desde hace 20 años en Mar Bravo, provincia de Santa Elena (Ecuador).

En una extensión 16.733 M2 integra las áreas de cuarentena, maduración, cría larvaria, mejoramiento genético (masal), algas, bacteriología, control bacteriológico, artemia y alimento fresco; departamento de probióticos y simbiótica.

Se trata del laboratorio de Omarsa que cuenta con certificaciones internacionales de la Asociación de Agricultura Orgánica de Alemania, Naturland y también certificación Unión Europea; La norma mundial para las buenas prácticas agrícolas Global GAP y la Certificación de Buenas Prácticas Agrícolas, BAP.

En este laboratorio se siembran 125 nauplios por litro, en un ciclo de 20 días; su tamaño promedio es de 150-180 pl gramo. Cada mes, su promedio de producción es 180 millones de larvas, y una producción anual de 28.800 toneladas de algas. Aldo Vanoni Darquea, Presidente Ejecutivo de Omarsa y responsable del abastecimiento de

16

Aldo Vanoni Darquea Presidente Ejecutivo de Omarsa


REPORTAJE

- DICIEMBRE 2019 6) Los análisis microbiológicos se los realiza con el objetivo de prevenir algún brote bacteriano no deseado en el laboratorio, se utiliza el método clásico con cajas Petri; para ver morfología y conteo de colonias; los agares con los cuales se trabajan son: TCBS y Cromogénico para Vibrios, Cetrimide y Cromogénico para Pseudomonas, Dextrosa y PDA para hongos y levaduras, MRS para bacterias ácido lácticas, TSA y Marino para bacterias totales. Asimismo, de ser necesario, se realizan tinciones para identificar el tipo de bacteria. Los análisis microbiológicos se realizan a todas las áreas de laboratorio: • Agua de reservorio • Líneas de aire y agua (desove, eclosión y despacho) • Agua antes y después de la desinfección de huevos, nauplio 2 y nauplio 5. • Huevos, nauplio 2 y nauplio 5 antes y después de la desinfección. Agua y animales de cuarentena: • Alimento fresco. Algas: • Cepario (nutrientes, tubos, botellas, fiolas y fundas) • Exteriores (cilindros y masivos) Larvicultura (por cada corrida): • Líneas de aire y agua. • Agua de reservorio • Agua y nauplio (antes y después de la desinfección) de funda de maduración. • Agua de cultivo en N5-Z1-Z2-Z3 y desde M1 pasando un día hasta la cosecha

• Animales a partir de Z3, pasando un día hasta la cosecha. • Agua y animales antes del despacho (los resultados se envían a la camaronera para continuar la trazabilidad). • Microbiología del agua superficial del mar al frente del laboratorio dos veces por semana. Las buenas prácticas están principalmente orientadas a la Sanidad Animal, eliminando el uso de antibióticos, lo que ha sido posible gracias a la producción de probióticos. Vanoni explica que en sus instalaciones se inició la adecuación de instalaciones necesarias para la producción de probióticos y actualmente cuentan con equipos y materiales que garantizan la inocuidad y eficiencia de estos productos.

Anillado de hembras no ablacionadas

Hembra copulada

Asímismo cuenta con áreas separadas para la producción de cada tipo de probióticos acorde a sus condiciones de crecimiento. “En la actualidad se produce, un probiótico fermentativo en base a bacterias ácido lácticas, y otro de bacterias heterotróficas con aireación. La aplicación de estos probióticos masificados como control biológico es una alternativa viable para impedir el crecimiento de bacterias oportunistas e influir en general en el establecimiento de una comunidad microbiana tanto en los individuos como en el agua de cultivo” indicó Vanoni.

Nauplios en bicker, chequeando actividad de nauplio 1

Sistema de filtración y desinfección En larvicultura y maduración, filtros de piola de 1 micra; algas filtros piola de 1 micra, carbón activado y lámpara de UV. Mitigación de riesgos sanitarios por bombeo de agua En el caso de presencia de marea roja, presencia de hidrocarburos en el agua de mar, no se bombea para evitar la contaminación en el área de producción.

Observación de nauplio 1 en microscopio

Desinfección de efluentes El agua de descarga llega a un sedimentador en el cual se utiliza pastillas de cloro para su tratamiento, y previo a la descarga final se aplica prebiótico. Sistema de aireación en tanques de larvicultura

Se realizan constantes monitoreos y análisis de la descarga final.

17

PL's en estadío 9


REPORTAJE

- DICIEMBRE 2019

Evaluación y control de enfermedades El diagnóstico de enfermedades se realiza anualmente según exigencia de la autoridad competente. Si el caso lo amerita se realizan muestreos por PCR de IHHNV, NHP y WSSV de manera trimestral. La mortalidad de larvas se la evalúa cuantitativamente en los muestreos de población y observación microscópicas, y bajo el análisis microbiológico (exponentes altos de Vibriosis). En el caso de presentarse una Vibriosis con exponente mayor a 5 se procede a descartar la población y luego incinerar. Si el lote o producción es de 50 millones de larvas a la venta, la pérdida aproximada sería de $100.000. en una corrida. EL laboratorio integrado de Omarsa realiza 7 corridas al mes. Los parámetros que se evalúan en el muestreo para valorar la calidad de las postlarvas son: Actividad.- De 95 - 100% Deformación fisiológica.- no mayor al 5% Tamaño homogéneo.- no mayor a 3 tallas Supervivencia. Mayor a 50% Aspectos que influyen positivamente en la calidad de la larva • Desinfección de líneas de agua y aire. • Uso de alimentos de buena calidad. • Desinfección y preparación de agua antes y durante el cultivo. • Calidad de nauplios

Muestreo diario de todas las fases de producción en todos los estadíos • Buen secado sanitario • Utilización de Probióticos y Simbiótica • Calidad y cantidad de algas Selección genética (masal) Se efectúa con análisis de microsatélites para conocer el distanciamiento genético o consanguinidad de los reproductores y evitar así el “Inbreeding”, en español “endogamia” que es la producción de descendencia mediante el apareamiento o crianza de individuos u organismos que están estrechamente relacionados genéticamente. En este laboratorio se realiza los cruces con los lotes seleccionados. Además, como punto importante, desde hace más de 10 años en esta laboratorio no se realiza la ablación del tallo ocular de las hembras Litopenaeus vannamei, como

Área de maduración

18

método para la eliminación de la fuente de la hormona inhibidora de la vitelogénesis (VIH),para estimular la maduración ovárica y el desove en cautiverio. Los procesos antes descritos forman parte del manejo de producción de larvas en el laboratorio de larvas de Omarsa, donde se ejecutan protocolos responsables con la actividad productiva y la comunidad, como el buen manejo de descargas para evitar riesgos sanitarios; al igual que un adecuado manejo de desechos sólidos y químicos peligrosos. De esta forma mostramos a nuestros lectores cómo el primer eslabón de la cadena del camarón puede crecer de forma sostenible y sustentable, a través de buenas prácticas de larvicultura●


Más de 10 millones de dólares generó AQUA EXPO 2019

COYUNTURA

- DICIEMBRE 2019

L

a vigésima tercera edición de Aqua Expo, que se realizó del 21 al 24 de octubre en el Centro de Convenciones de Guayaquil, en sus 3 días de exposición, generó más de 10 millones de dólares en citas de negocios. Su extensa gama de servicios y productos de última tecnología fueron presentados por las 180 empresas participantes, en los 250 stands con que contó la feria comercial, la misma que en el 2019, tuvo una extensión de 6.500 metros cuadrados. La afluencia de visitantes superó las 3 mil personas diariamente. En lo que respecta al programa de conferencias hubo 35 expertos internacionales, entre los que estuvieron Nguyen Duy Hoa de Vietman; Sreeram Raavi de India, Stefan Hyttfors de Suecia; Alberto Nunez y Eduardo Yamashita de Brasil; Manoj M. Sharma de India, David Kawahigashi y Allen Davis de Estados Unidos, Sofia Morais de España, entre otros destacados expositores extranjeros que dictaron charlas sobre nutrición, patología, producción, trazabilidad y sostenibilidad. El éxito de Aqua Expo se debe a que reúne a todos los representantes de la cadena del camarón en un sólo lugar, con el propósito de promover la capacitación, la innovación y el desarrollo de nuevos negocios según José Antonio Camposano, Presidente Ejecutivo de la Cámara Nacional de Acuacultura, quien agradeció la acogida por parte del sector camaronero y anunció que el Comité Organizador del Congreso Mundial de Acuacultura ya se alista para AQUA EXPO 2020, que se desarrollará del 26 al 29 de octubre, en el Centro de Convenciones de Guayaquil●

“Es muy importante porque nosotros como productores podemos encontrar todas nuestras necesidades y más que todo las nuevas tecnologías que están incursionando en la industria”.

“Fantástica, excelente, hemos tenido visitas de clientes muy importantes y es una inversión muy válida, muy rentable”.

Telmo Romero – visitante de Aqua Expo 2019

Carlos Chávez - participante de Aqua Expo 2019

“Aqua Expo es importante porque es un encuentro de negocios y es el lugar de las Américas donde tiene que estar”.

“A nivel comercial muy bien, veo que es muy variado, hay prácticamente de todo lo que se necesita en el medio, para escoger“.

José Villalón – participante de Aqua Expo 2019

Franklin Solis - visitante de Aqua Expo 2019

21


PATOLOGÍA

- DICIEMBRE 2019

Una visión del futuro para el control de enfermedades en la acuicultura del camarón Autor: Timothy W. Flegel

1,2

Centro de excelencia para la biología molecular y la biotecnología del camarón (Centex Shrimp), Facultad de Ciencias, Universidad de Mahidol, Bangkok, Tailandia 1

Centro Nacional de Ingeniería Genética y Biotecnología, Agencia Nacional de Desarrollo de Ciencia y Tecnología, Khlong Luang, Pathum Thani, Tailandia 2

tim.flegel@gmail.com The Journal of the World Aquaculture Society

L

a acuicultura es el sector de producción animal de más rápido crecimiento, y la producción de camarón ya supera lo que corresponde a capturas de pesca. Los virus y bacterias representan la mayoría de las pérdidas por enfermedades para los productores. Las pandemias virales a mediados de la década de los 90, y más recientemente, una pandemia bacteriana de 2009 a 2015, han llevado a la conclusión de que el cultivo sostenible del camarón dependerá en el futuro, del desarrollo de instalaciones de producción más eficientes y bioseguras que cultiven camarón libre de patógenos específicos (SPF), genéticamente mejorados para el crecimiento y tolerancia o resistencia a enfermedades. Los principales requisitos para el desarrollo, mantenimiento y uso de stocks de organismos SPF en la acuicultura, son métodos eficaces de vigilancia de patógenos y prevención de enfermedades. Cuando las medidas de protección fallan y se producen enfermedades en los estanques de producción, actualmente solo hay unos pocos métodos terapéuticos aprobados y prácticos disponibles para su uso con patógenos bacterianos, pero ninguno hasta ahora para los patógenos virales. Para mejorar los métodos existentes de prevención y terapia, y para desarrollar otros nuevos, se están realizando investigaciones sobre la naturaleza de las interacciones entre el camarón y patógenos. Se han obtenido resultados prometedores a nivel de laboratorio para posibles aplicaciones del uso de inmunoestimulantes para “priming

22

inmunitario” o “inmunidad entrenada” del ARN de interferencia y de elementos endógenos virales. Se discute algunas de estas nuevas prometedoras alternativas. Me gustaría comenzar alentando a todos los lectores a que desistan de usar el sistema de 6-genus para nombrar camarones peneidos, lo que propuse en 1997 (Pérez Farfante y Kensley, 1997) antes de completar un trabajo filogenético basado en el análisis del genoma del camarón. Tan pronto como la información de la secuencia del genoma estuvo disponible, mostró que el sistema propuesto de 6-genus era científicamente insostenible basado en un análisis de genes mitocondriales como cromosómicos (Flegel, 2007a, 2008; Lavery, Chan, Tam y Chu, 2004; Ma, Chan y Chu, 2011; Voloch, Freire y Russo, 2005; Voloch, Freire y Russo, 2009). Por lo tanto, y con base científica, este sistema debe ser desistido a favor del anterior sistema (Holthuis, 1980) que ha sido utilizado sin interrupciones por la Organización de las Naciones Unidas para la Agricultura y la Alimentación y la Organización Mundial de Sanidad Animal, a pesar de la propuesta de 1997. Usaré el sistema Holthius en este documento, pero incluiré los nombres de género propuestos de Pérez Farfante y Kensley (1997) entre paréntesis en la primera mención como nombre no filogénico, el subgénero, simplemente para permitir una fácil referencia a publicaciones que han usado el sistema 6-gen (incorrectamente, en retrospectiva) desde 1997. El propósito de este documento es describir


PATOLOGÍA

- DICIEMBRE 2019 mi visión del futuro rol de la acuicultura, particularmente con respecto a problemas de control de enfermedades. La primera Conferencia técnica de la FAO sobre acuicultura realizada en Kyoto en 1976 (FAO, 1976). Luego, en 2000, se realizó en Bangkok la segunda conferencia más relevante “Acuicultura en el tercer milenio” (Subasinghe et al., 2001). Entre esos años, la acuicultura se había convertido en una industria global importante que competía o superaba la captura de varias especies de pesca, y hasta hoy, es el sector de alimentación de más rápido crecimiento. En ambas reuniones y desde entonces, la importancia de la acuicultura para la seguridad alimentaria mundial ha sido un tema dominante, y se considera que las enfermedades de especies acuícolas representan una gran amenaza para esa seguridad (Bondad-Reantaso, Subainse, Josupeit, Cai, & Zhou, 2012; Lafferty et al., 2015; Stentiford, 2011; Stentiford et al., 2012; Stentiford et al., 2017). Aquí, describo mi visión para el control de enfermedades en la acuicultura del camarón, pero los principios básicos para el camarón, pueden ser aplicados a cualquier especie acuícola.

Figura1: Ciclo de vida del camarón peneido

Figura1: Ilustración del ciclo de vida del camarón peneido (modificado de Rosenberry) demostrando que los reproductores se aparean en aguas marinas profundas y que los huevos fertilizados pasan por varias etapas de larvas y postlarvas planctónicas, que son arrastradas por las corrientes hacia manglares estuarinos, en donde pasan la mayor parte de su etapa juvenil y subadulta, antes de regresar gradualmente a aguas profundas para repetir el ciclo de vida.

Biotecnología y la industria del camarón La acuicultura del camarón a escala industrial comenzó en la década de los 80 basándose en el ciclo de desarrollo natural del camarón peneido (Figura 1) dispuesto en instalaciones secuenciales (Figura 2), comenzando con reproductores capturados y terminando con el cultivo de juveniles para entregarlos a instalaciones de procesamiento y congelado. Este ciclo industrial se hizo factible como resultado de una producción controlada de larvas, que fue posible gracias a la ablación unilateral del pedúnculo ocular de reproductores capturados. La ablación libró a las hembras de controles hormonales que limitaban el desarrollo ovárico y permitían la producción predecible de huevos y larvas (llamados postlarvas [PL]). Fue un temprano indicio de que el éxito en la acuicultura exigía una comprensión de la biología de las especies cultivadas y que la biotecnología desempeñaría un papel importante en el futuro de la industria (Figura 2).

Figura 2: Diagrama que indica cómo opera la industria del camarón para imitar las fases del ciclo de vida del camarón en instalaciones ordenadas secuencialmente (números en círculo del 1 al 6). También se indican ejemplos (flechas rojas a cuadros verdes) de cómo la investigación en áreas de biotecnología puede ayudar a mejorar la eficiencia y la calidad en las diversas fases de producción, investigando sobre temas de enfermedades relevantes en todas las etapas de producción (el recuadro rojo central). ADNe: ADN ambiental (por sus siglas en inglés DNAe); QA: evaluación de calidad.

23


PATOLOGÍA

- DICIEMBRE 2019

En esta primera década, el cultivo de camarón juvenil de PL se produjo principalmente en estanques de tierra al aire libre con libre intercambio de agua y el uso de piensos pelletizados. La industria avanzó intensificando el número de estanques y la densidad de siembra, acompañado de avances tecnológicos relevantes en el cultivo. En la década de 1990, ocurrió la primera epidemia masiva de enfermedad viral del camarón, causada primero por el virus de la cabeza amarilla (YHV) en Tailandia, y luego por el virus del síndrome de la mancha blanca (WSSV) en China y Japón. El WSSV luego se extendió rápida y ampliamente en Asia y eventualmente a las Américas. Fue un factor primordial el estimular el desarrollo de poblaciones del camarón blanco del Pacífico, Penaeus (litopenaeus) vannamei libres de patógenos específicos (SPF). Alrededor del 2000, la introducción de estas poblaciones tuvo tanto éxito que P. vannamei se convirtió en la especie dominante de camarones peneidos cultivada, no solo en las Américas, sino en el mundo. En la Figura 3, se muestra el impacto de las enfermedades en la producción de camarón en Tailandia desde 1988 hasta 2018. Esto muestra un aumento constante en la producción de 1988 a 1995 cuando se produjo la primera epidemia por la enfermedad de la mancha blanca (WSD). Esto fue seguido por un período de recuperación antes de otro episodio de disminución y recuperación, de una manera cíclica. La disminución más reciente y grave de la caída del 70% en la producción fue el resultado de la sincronización del síndrome de mortalidad temprana y de la enfermedad de necrosis hepatopancreática aguda (EMS/AHPND). Esto resultó no solo en la muerte del camarón, sino en la renuencia de productores por mantener grandes cantidades de estanques hasta que se pueda asegurar cosechas exitosas (Thitamadee et al., 2016).

Lecciones aprendidas últimas tres décadas

en

de recuperación que toman períodos de tiempo variables, dependiendo del conocimiento adquirido en investigaciones y por la capacidad técnica de cada país. Estas enfermedades se propagan de forma impredecible, principalmente por movimientos transfronterizos sin control o ilegales de stocks acuícolas infectados, de un área geográfica a otra, o por stocks exóticos no infectados que se trasladan a una nueva área en donde se infectan con patógenos locales, quizás previamente desconocidos porque no afectaban a las especies locales (Flegel, 2006; Flegel y Fegan, 2002). Actualmente la principal estrategia de control para la mayoría de las enfermedades, y especialmente para los patógenos virales, es su exclusión del sistema de cultivo. Esto requiere una constante vigilancia de patógenos nuevos y existentes, y la implementación de medidas de bioseguridad más estrictas y viables. Lo que se necesita son métodos terapéuticos aprobados prácticos y rentables, pero estos aún escasean para camarón, especialmente en estanques de engorde. Desafortunadamente, el enfoque casi miope sobre patógenos virales y la alta confianza en la libertad de la enfermedad en camarón SPF que existe desde principios de la década de 2000, resultó en una especie de laxitud en las operaciones de cultivo de camarón en los siguientes años. Por ejemplo, la práctica que se realizaba para evaluar el estado de salud de

PL mediante la detección de especies Vibrio potencialmente patógenos a través de un examen microscópico, fue abandonada. Esto dejó a la industria vulnerable a enfermedades no virales. El primer desastre resultante fue el advenimiento y la propagación de EMS (a partir de 2009), brotes de AHPND causados por especies Vibrio como causa componente (Sanguanrut et al., 2018; Thitamadee et al., 2016). Solo más tarde se descubrió que el microsporidio endémico, Enterocytozoon hepatopenaei, que causa el microsporidiosis hepatopancreática, se estaba extendiendo por todo el sistema de cultivo de laboratorios y de allí a granjas al mismo tiempo. Estos problemas ilustraron la necesidad de mantener una vigilancia de rutina para descubrir y prevenir la propagación de nuevos y conocidos patógenos. En términos de control, los métodos de detección de patógenos específicos rápidos y sensibles para la vigilancia y el monitoreo son esenciales para que los productores controlen las PL y los juveniles, y así como para el desarrollo de stocks de camarón SPF domesticado (ya disponibles). Consulten una reciente publicación sobre la definición de stocks SPF (Alday-Sanz et al., 2018). El desarrollo y uso generalizado de stocks de camarón SPF, ha resultado en una dramática mejora para la producción de camarón cultivado desde 2000. A través de una selección mayor, algunos de estos stocks también son altamente tolerantes a

las

El actual sistema de producción acuícola relativamente abierto en estanques al aire libre (de tierra o revestidos) está sujeto a periódicas epidemias de enfermedades catastróficas, seguidas de períodos

Figura 3: Registro de la producción de camarón tailandés mostrando la naturaleza cíclica de las disminuciones debido a epidemias de enfermedades, seguido de una recuperación después de haber encontrado soluciones. AHPND: enfermedad de necrosis hepatopancreática aguda; EMS: síndrome de mortalidad temprana; MSGS: síndrome de crecimiento lento de monodon; WSD: enfermedad de la mancha blanca.

24


PATOLOGÍA

- DICIEMBRE 2019 infecciones virales. (ej., el virus de la necrosis hipodérmica y hematopoyética infecciosa [IHHNV] y el virus del síndrome de Taura [TSV]), aunque el mecanismo para esta tolerancia no se entiende claramente. Una vez que los stocks SPF están disponibles, para obtener mejores resultados, es esencial que se cultiven en instalaciones con la mejor bioseguridad posible para evitar la entrada de patógenos. Para este propósito, es necesario contar con procedimientos estrictos de administración como el uso de barreras físicas, tratamiento del agua, la exclusión de portadores y el manejo de alimentos: los mejores resultados son siempre obtenidos en sistemas de cultivo cerrados y adecuadamente administrados en tierra. Sin embargo, el cultivo cerrado en operaciones de engorde siempre enfrenta limitantes con respecto a la rentabilidad y la viabilidad económica a largo plazo. Dada la situación actual, creo que la producción acuícola estable en el futuro no se logrará a menos que se desarrollen y optimicen sistemas cerrados modulares, rentables. Creo que esto debería ser atendido mediante un esfuerzo multidisciplinario de varios campos como ingeniería acuícola, ciencia de materiales, ingeniería bioquímica y biotecnología (Figura 2).

deba considerarse como otro elemento que debe ser apropiadamente integrado en el programa general. No hay una sola bala mágica que pueda resolver cualquier problema de enfermedad. Para productores de camarón y peces, es peligroso hacer caso omiso de este principio. Nuevos y futuros métodos de detección de patógenos Como el objetivo de excluir patógenos del sistema de producción acuícola (es decir, proporcionar la más alta bioseguridad posible), los métodos rápidos, sensibles y específicos de detección de patógenos, son un requisito previo para el monitoreo del desarrollo de stocks de camarón, producción de alevines y crecimiento de juveniles. Los mejores métodos deben ser los métodos de punto de atención (POC) (es decir, métodos que son lo suficientemente simples para que los propios productores los lleven a cabo e interpreten en las instalaciones de producción tales como laboratorios y granjas). Permiten tomar decisiones en tiempo real sin esperar un resultado atrasado de una prueba de un laboratorio distante.

Sin embargo, el utilizar métodos POC por productores y propietarios de laboratorios, es prevenido en varios países que prohíben por ley realizar pruebas de lo que el gobierno considera “enfermedades exóticas” (excepto laboratorios gubernamentales). Los infractores están sujetos a altas multas e incluso prisión. En mi opinión, esta tendencia relativamente reciente es contraproducente, ya que el mejor programa de control de enfermedades posible debe implicar una buena cooperación entre practicantes y funcionarios gubernamentales. Parece que la motivación detrás de tales leyes es el miedo a que personas “no calificadas” anuncien públicamente a medios resultados falsos positivos causando pánico, con serias repercusiones económicas. Yo creo que este miedo es injustificado. En mi experiencia, la respuesta normal de los actores de la industria del camarón que sospechan de algún brote de la enfermedad (por cualquier razón que sea) es consultar inmediatamente a representantes y especialistas del gobierno, y no el ir a la prensa. Para mí, una forma más simple de lidiar con ese miedo es promulgar una legislación que requiera

En este artículo, me centraré solo en los avances y tendencias de métodos de detección de patógenos, y en métodos para la prevención de enfermedades en camarón como ejemplo para todas las especies acuícolas. Sin embargo, al considerar mi enfoque altamente selectivo en presentar futuras posibilidades, es importante recordar que el principio básico para el control de enfermedades de camarón y otras especies, no ha cambiado mucho desde antes de la primera reunión de la DAA en Bali hace 27 años (1990). Esto se resumió maravillosamente en un diagrama presentado por Snieszko (1974) (Figura 4), que indica que la expresión de la enfermedad es el resultado de una interacción compleja de factores relacionados con la propia especie cultivada, el patógeno per se y el medio ambiente. Esto requiere que cualquier programa efectivo de control de enfermedades use un enfoque multifactorial, y cualquier nueva innovación

Figura 4: Diagrama de Snieszko (Snieszko, 1974) ilustrando que la expresión de la enfermedad (la nube de tormenta central) es el resultado de un conjunto de factores representados por el área de tres anillos superpuestos. Cada anillo representa todos los factores el camarón huésped, el patógeno y el medio ambiente, pero solo esos factores (conocidos o desconocidos) en el área superpuesta de los tres anillos, es relevante para la expresión de la enfermedad. Solo algunos ejemplos de factores que podrían ser relevantes en la expresión de la enfermedad se dan bajo las palabras “Camarón”, “Patógeno” y “Ambiente”. Determinando los factores relevantes para la expresión de cada enfermedad en particular, a menudo requieren investigación que puede resultar en mejorar medidas de control en un programa de control de enfermedades multifactorial integrado. PL: postlarvas.

25


PATOLOGÍA que las personas que obtienen resultados positivos de pruebas para “enfermedades exóticas”, debe informar primero a los funcionarios pertinentes antes de cualquier divulgación pública. De no hacerlo, podría ser penalizado haciéndolos responsables de cualquier pérdida económica que resulte de su negligencia. Sin embargo, si se confirman sus resultados, no se les debe evitar que informen públicamente los resultados de sus pruebas dentro de un tiempo razonable fijo, después de que funcionarios del gobierno hayan sido informados. Ese “tiempo razonable” simplemente debería ser suficiente tiempo para que los especialistas gubernamentales confirmen o no los resultados, y que hagan a través de un acuerdo con los actores ​​de la industria, un anuncio por cualquier medio sobre la validez de la prueba (por ejemplo, publicación o prensa). Esto es particularmente importante para las publicaciones científicas que se han preparado para su envío a revistas para una revisión de pares. Es importante garantizar la falta de interferencia del gobierno y libertad para publicar y comunicar rápidamente de los resultados de la investigación, para promover una respuesta rápida en la prevención de la propagación de la enfermedad. Este principio es efectivamente aplicado por la Organización Mundial de la Salud para enfermedades humanas. ¿Por qué se debería manejar las enfermedades de los animales acuáticos de otra manera? Buenos ejemplos de métodos POC son las tiras de prueba de diagnóstico como las pruebas de embarazo simples que están disponibles en cualquier farmacia. Estas pruebas usan anticuerpos y son excelentes para su uso en granjas o laboratorios, para verificar camarón moribundo por la presencia de patógenos específicos sospechosos. La desventaja es que pueden no ser lo suficientemente sensibles para detectar patógenos a nivel de portador en camarón normal, haciéndolos inadecuados para el trabajo de vigilancia de patógenos. Por otro lado, pueden ser efectivos para el trabajo de monitoreo de rutina. Por ejemplo, si el uso de dicha tira da un resultado positivo para la prueba de WSSV para 1 muestra de camarón de una muestra aleatoria de 10 de un estanque de cultivo, indicaría que el

- DICIEMBRE 2019 nivel preclínico de camarón con WSSV en la población del estanque ya era del 26% o más, y podría proveer de suficiente tiempo de espera para que el productor confirme el resultado y coseche el camarón antes de que ocurra una mortalidad grave con un brote de WSD total. Algunas de estas pruebas de tira pueden detectar más de un patógeno al mismo tiempo. Ahora, sin embargo, se están diseñado y desarrollado dispositivos portátiles con una muy alta sensibilidad e incluso con una capacidad cuantitativa para el uso de productores en estanques. Algunos están equipados con capacidad inalámbrica para que los resultados puedan ser transmitidos a una central a través de Internet desde una computadora o un teléfono, así los expertos pueden ayudar en interpretación de los resultados de la prueba y dar sus recomendaciones. Por ejemplo, un proyecto de investigación cooperativa para realizar pruebas de campo de dicho sistema ya ha comenzado en Tailandia con el apoyo del Fondo Newton del Reino Unido e involucrando al Departamento de Pesca de Tailandia, del Centro Nacional de Ingeniería Genética y Biotecnología de Tailandia (BIOTEC), Universidad de Mahidol, el Centro para el Medio Ambiente de Pesca y Ciencia de la Acuicultura (Reino Unido), y la Universidad de Exeter (Reino Unido). En este proyecto, un dispositivo de reacción en cadena de polimerasa (PCR) portátil y en tiempo real, capaz de usarse junto al estanque y con capacidad inalámbrica (Figura 5), está siendo probada para usar un modelo de vigilancia de enfermedades y una red de prevención llamada Red Internacional para la Salud del Camarón (INSH). El objetivo del proyecto es probar esta red modelo en Tailandia y luego ampliarla a la región y al mundo. Al igual que con las tiras reactivas, la tecnología basada en PCR generalmente se enfoca en la detección de una o, como máximo dos o tres patógenos a la vez. Sin embargo, las tecnologías más nuevas para la secuenciación de próximas generaciones de ADN y ARN se están desarrollando en campo. Tienen la capacidad de detectar múltiples patógenos a la vez. Un ejemplo es el dispositivo de secuenciación de ADN/ ARN MinIon (Oxford Nanopore Technologies, Oxford, Reino Unido) que puede conectarse a

26

una laptop y conectarse a una base de datos central para ensamblar y analizar secuencias a través de Internet (Figura 6). Por ejemplo, un kit inicial está disponible por $1.000!. Estas propuestas permiten un análisis, consulta y acción de la granja “en tiempo real”. Una de las ventajas abrumadoras de un sistema como este, es que sería capaz de identificar incluso patógenos nuevos y actualmente desconocidos que aparecerían inesperadamente como secuencias de ácido nucleico desconocido en camarón, y tal vez incluso nuevo para la ciencia, pero relacionado con patógenos ya conocidos. Además de la detección de patógenos conocidos y desconocidos, los enfoques de secuenciación de próxima generación (p. ej., metagenómica) (Martínez-Porchas y VargasAlbores, 2017) también permiten perfilar comunidades microbianas en, sobre y alrededor de especies acuícolas. Esto puede ser importante para comprender la sinergia y el antagonismo de interacciones que pueden ocurrir entre microbios residentes y patógenos. El conocimiento adquirido podría ser utilizado para desarrollar métodos más rentables para el control de enfermedades. Por ejemplo, la identificación de microbios que pueden matar a los patógenos o prevenir la expresión de factores de virulencia de patógenos (microbios probióticos), pueden proteger al camarón y otras especies acuícolas contra patógenos (Gatesoupe, 1999; Gómez-Gil, Roque y Turnbull, 2000; Kesarcodi-Watson, Kaspar, Lategan y Gibson, 2008; van Hai y Fotedar, 2010). Si pueden prevenir la expresión de factores de virulencia sin matar a los patógenos, reduce en gran medida la probabilidad de selección de mutantes de escape, como ha ocurrido con el desarrollo de bacterias resistentes a medicamentos, como resultado del uso generalizado de antibióticos. La identificación de microbios probióticos puede conducir a la identificación de inhibidores seguros de detección de quórum (QS) que impiden la expresión de factores de virulencia patógena y podrían fabricarse a bajo precio para su adición al alimento balanceado. Hasta donde sé, solo una bacteria probiótica comercial, Pediococcus acidilactici MA 18/5M (Bactocell, Lallemand Animal Nutrition), ha sido oficialmente aprobada para su uso en acuicultura de peces en Europa (revista Feed


PATOLOGÍA

- DICIEMBRE 2019 Additives, 28 de septiembre de 2012), pero creo que este enfoque, y tal vez el uso de inhibidores QS, será cada vez más importante en el futuro control de la enfermedades, no solo en acuicultura, sino también en agricultura en general y en medicina humana (Defoirdt, Brackman y Coenye, 2013; LaSarre y Federle, 2013; Pande et al., 2013; Pande, Natrah, Sorgeloos, Bossier y Defoirdt, 2013; Yang y Defoirdt, 2015). Al mismo tiempo, los estudios de ADN ambiental (ADNe) en sistemas de cultivo de camarón en laboratorio, precría y estanques de engorde, deberían dar una idea de la comunidad microbiana óptima en el agua de cultivo (bacterias, hongos, algas, protozoos, etc.) para obtener la máxima producción sostenible y estabilidad a largo plazo. Tales estudios no fueron realmente factibles hasta el desarrollo de la tecnología de secuenciación de próximas generaciones, y los estudios de este tipo en acuicultura están recién comenzando (Shaw, Weyrich y Cooper, 2017). Investigaciones sobre técnicas de fermentación tradicionales para productos como la salsa de soya, el vino y el tempe han dado como resultado procesos a escala industrial que tienen una producción más consistente, mayor eficiencia, productos de mayor calidad y la mayor seguridad que los procesos tradicionales, y se pueden lograr utilizando sustratos esterilizados o pasteurizados inoculados con solo unos pocos organismos controlados en entornos industriales apropiados. Debería ser posible utilizar el mismo enfoque para simplificar y controlar el ambiente de cultivo en laboratorios y engorde de camarón.

Prometer nuevas y futuras medidas antipatógenas Comentarios generales Aquí se presentan solo unas pocas áreas seleccionadas nuevas y potenciales de investigación, para mejorar la producción y estabilizar la industria del camarón. Algunas de estas áreas son aplicables a otras especies acuícolas, pero la metodología para lograr los objetivos puede ser diferente. Las áreas seleccionadas incluyen el desarrollo de reproductores SPF domesticados para todas las especies acuícolas, el uso de “vacunas” con moléculas derivadas de patógenos y huéspedes, el uso de péptidos antimicrobianos derivados del huésped

(AMP), la activación selectiva de respuestas variables antimicrobianas del huésped, el uso de inmunoestimulantes generales como aditivos en alimentos, la adición de ARN bicatenario (dsRNA por sus siglas en inglés) para alimentar la inducción del mecanismo de interferencia de ARN del huésped (ARNi) contra virus, y la selección o inducción de elementos virales endógenos (EVE) para proporcionar al camarón, una tolerancia hereditaria a infecciones virales. El tema específico de los probióticos (es decir, el uso de microbios vivos en el agua de cultivo o como ingredientes alimenticios) para proteger al camarón de patógenos no es abordado, pero las personas interesadas​​ pueden consultar varios estudios (Aly, 2009; Balcázar et al., 2006; Boyd & Gross, 1998; Gatesoupe, 1999; Irianto y Austin, 2002; Kesarcodi-Watson et al., 2008; Merrifield y Ringo, 2014; Ninawe y Selvin, 2009; van Hai y Fotedar, 2010; Wang et al., 2018; Wang, Li y Lin, 2008). Recientemente un metaanálisis publicado admitió que su uso fue eficaz mejorando la supervivencia del camarón, la tasa de crecimiento específica y la relación de conversión alimenticia (Toledo, Frizzo, Signorini, Bossier y Arenal, 2019). Tampoco incluye una discusión específica sobre la tecnología biofloc, que puede considerarse una variación multitrófica en el área de probióticos (Ahmad, Rani, Verma y Maqsood, 2017; Avnimelech, 2009; Bao, Zhu, Jin y Ye, en prensa; Emerenciano, Martínez-Córdova, Martínez-Porchas y Miranda-Baeza, 2017; Kathia, del Carmen, Aida, Jorge y Daniel, 2017; Martínez-Córdova, Emerenciano, Miranda-Baeza, y Martínez-Porchas, 2015; Neori, Shpigel y Guttman, 2017). Importancia de desarrollar stocks SPF domesticados Con respecto al stock de semillas, el desarrollo de stocks de reproductores SPF domesticados debería ser un objetivo primordial para cualquier especie cultivada si se desea una producción estable y predecible para esa especie. La domesticación de stocks libres de los principales agentes patógenos de cada especie, es un gran paso porque garantiza a los productores que comienzan su cultivo con animales limpios. Sin embargo, una vez que se han desarrollado tales stocks, una preocupación principal con peces y camarón siempre ha sido el seleccionar para

27

un crecimiento más rápido y para resistencia o tolerancia a enfermedades. Todos estos objetivos son importantes para mejorar la productividad, eficiencia y la estabilidad de la acuicultura para cualquier especie. Utilizando métodos de reproducción y selección estándar, se han desarrollado stocks SPF tolerantes al TSV (Cock, Gitterle, Salazar y Rye, 2009; Moss, Moss, Arce, Lightner y Lotz, 2012), y los stocks SPF actuales de P. vannamei ampliamente utilizados en Asia, son altamente tolerantes tanto a TSV como a IHHNV. Por ejemplo, no podemos usar estos stocks para estudiar TSV e infecciones por IHHNV en el laboratorio, porque se vuelven positivas para la PCR en el momento del ensayo, pero no desarrollan signos de enfermedad. Sin embargo, no entendemos el mecanismo subyacente a esta tolerancia, y se necesita de manera urgente investigación para hacerlo. Un ejemplo reciente es un estudio de secuenciación de próxima generación que demostró genes asociados con la tolerancia a la infección de TSV en P. vannamei (Sookruksawong, Sun, Liu y Tassanakajon, 2013). Dichos estudios proporcionarán conocimiento y marcadores que pueden usarse para ayudar en programas de selección genética para resistencia y tolerancia a enfermedades. Así, un continuo apoyo a la investigación básica sobre inmunología del camarón, es un requisito esencial para el futuro de la industria. Vacunación del camarón contra enfermedades Históricamente, la palabra vacunación se aplicó al proceso de seleccionar y usar en vertebrados, una molécula o moléculas de proteína (antígeno/antígenos) derivado de patógenos para inducir una respuesta de anticuerpos protectores basada en la memoria del huésped, contra un patógeno específico. Esto generalmente se llama inmunidad adaptativa, y no es heredable y se cree que no ocurre en invertebrados. Sin embargo, también se han desarrollado vacunas de “ADN”, mediante las cuales se inyecta al huésped vertebrado, una preparación de ADN que contiene el gen de un antígeno patógeno preseleccionado, de modo que el huésped vacunado producirá el antígeno protector


PATOLOGÍA por una expresión del ADN inyectado, y luego desarrollará el correspondiente anticuerpo protector. Por lo tanto, el éxito del proceso de la vacuna de ADN también se basa en el mecanismo antígeno-anticuerpo, y en teoría, no sería aplicable a camarón porque hasta donde se sabe, no producen anticuerpos. Aunque hay informes de que la inyección de construcciones de ADN viral en camarón puede protegerlos contra WSD (Ning, Zhu, Xu, Zheng y Meng, 2009; Rajeshkumar et al., 2009), el mecanismo exacto de protección no está claro (Chang, Kumar, Ng y Wang, 2017). A pesar de la falta de anticuerpos en el camarón, hay muchas publicaciones que describen el uso de bacterias muertas o proteínas bacterianas y proteínas huésped o virales para proteger al camarón contra patógenos bacterianos y virales (Alabi, Jones, & Latchford, 1999; Smith, Brown y Hauton, 2003). Ninguno de estos informes describe específicamente anticuerpos inducidos, similares a las proteínas anticuerpos (inmunidad adaptativa) como base para la protección observada, por lo que se ha propuesto que sería mejor llamar al proceso que ocurre en el camarón como “priming inmune” o “inmunidad entrenada” (Chang et al., 2017). Hasta que sabemos, actualmente no hay un producto comercial ampliamente utilizado de esta naturaleza disponible para ser utilizado por los productores. Sin embargo, todavía se está trabajando para comprender los mecanismos detrás de la protección observada, y una vez que se comprenda, debería conducir al desarrollo de reactivos más eficientes y prácticos que puedan aplicarse como aditivos para piensos. Activación de respuestas antimicrobianas variables del huésped a patrones microbianos Desde hace algún tiempo, se sabe que el camarón tiene la capacidad de producir una amplia variedad de AMP (Bachere, Destoumieux y Bulet, 2000; Tassanakajon, Somboonwiwat y Amparyup, 2015) que son efectivos contra bacterias, hongos, y virus. La producción de AMP está regulada por infecciones microbianas y está mediada por el patrón de reconocimiento de proteínas receptoras de camarón que se unen a sustancias microbianas como

- DICIEMBRE 2019 los lipopolisacáridos de bacterias gramnegativas, peptidoglucanos de bacterias gram-positivas y beta-glucanos de hongos. Por lo tanto, la variedad y tipos de AMP producidos depende de la vía del receptor del patógeno, por lo que puede ser posible la inducción semiespecífica por los ingredientes del alimento. Por ejemplo, algunos tienen un amplio espectro de actividad antibacteriana, mientras que otros son más efectivos contra las bacterias gram-positivos que gramnegativas, y viceversa. Por esta razón, algunos fabricantes de alimentos para camarón agregan sustancias a su balanceado con el objetivo de aumentar la respuesta inmune general del camarón. Sin embargo, con suficiente conocimiento sobre el sistema huésped-respuesta, puede ser posible seleccionar o diseñar moléculas apropiadas que podrían agregarse a los balanceados y unirse con receptores seleccionados, dando como resultado una regulación positiva de AMP que sería particularmente adecuado para la defensa contra un patógeno específico o grupo de patógenos. También es posible que AMP sea heterólogas producida y agregada a los alimentos balanceados. Incluso podrían encontrar aplicación en la lucha contra patógenos humanos, particularmente aquellos que son resistentes a múltiples antibióticos. Más recientemente, se descubrió la molécula de adhesión celular del síndrome de Down (Dscam1) en camarón y cangrejo de río (Chou et al., 2011; Watthanasurorot, Jiravanichpaisal, Liu, Söderhäll y Söderhäll, 2011). Su gen produce transcripciones hipervariables con capacidad de reconocimiento microbiano, y su unión puede inducir una actividad antimicrobiana de una manera específica (Hung et al., 2013). Por lo tanto, al igual que con el AMP anterior, esto puede proporcionar otra vía para adaptar la producción del AMP basada en materiales apropiados agregados a alimento de camarón (Armitage et al., 2017). Proteínas heterólogas y virales expresadas por el huésped Hay dos enfoques generales que se han utilizado para proteger al camarón contra patógenos virales en laboratorio y en pruebas de campo limitadas. Uno usa proteínas

28

heterólogas producidas de una cubierta viral que pueden unirse a células receptoras del huésped y bloquear el virus por una unión (Witteveldt, Cifuentes, Vlak y Van Hulten, 2004; Witteveldt, Vlak y van Hulten, 2004). El otro utiliza proteínas heterólogas del huésped producidas que tienen actividad viral de unión y supuestamente se unen con la cubierta viral, bloqueando la capacidad del virus para unirse a los receptores de las células huésped objetivo (Jupatanakul, Wannapapho, Eurwilaichitr, Flegel y Sritunyalucksana, 2011; Sritunyalucksana, Wannapapho, Lo y Flegel, 2006; Thagun, Srisala, Sritunyalucksana, Narangajavana y Sojikul, 2012). En ambos casos, las proteínas expresadas se considerarían mejor como medicamentos antivirales, en lugar de vacunas. Esto es respaldado por el hecho de que la eficacia de tales tratamientos es de aproximadamente 2–3 semanas, de modo que las exposiciones periódicas son necesarias para mantener la protección contra el patógeno objetivo a lo largo de un ciclo de producción. En todos los casos, uno de los principales problemas con la aplicación de estas tecnologías es encontrar un método rentable para la entrega de proteínas heterólogas producidas como aditivos alimenticios. A veces las proteínas se purifican antes de su adición al alimento y, a veces, se agregan como bacterias cosechadas o células de levadura que contienen las proteínas expresadas sin purificar. Recientemente, se ha preparado células de levadura conteniendo algunas proteínas de recubrimiento de WSSV expresada en la superficie VP28 y algunas células huésped del camarón expresada en la superficie WSSV con una unión de proteína PmRab, para su adición al alimento de camarón (Ananphongmanee, Srisala, Sritunyaluck-sana y Boonchird, 2015). El uso de células recolectadas completas tiene la ventaja de reducir el costo de producción, pero esto puede reducir la eficacia en comparación con las proteínas purificadas. Hasta el momento, no ha habido productos comercializados exitosamente de este tipo de trabajo, pero la investigación aplicada aún continúa. Uso de dsRNA para activar el mecanismo de ARNi del huésped El uso de dsRNA para proteger al camarón


PATOLOGÍA

- DICIEMBRE 2019 contra patógenos virales fue pionero en la década de 2000 por el grupo de Paul Gross en el Estados Unidos para WSD (Robalino et al., 2004; Robalino et al., 2005) y por el grupo de Skol Panyim en Tailandia para la enfermedad de cabeza amarilla (YHD) (Yodmuang, Tirasophon, Roshorm, Chinnirunvong y Panyim, 2006), y ha tenido éxito para todos los demás virus de camarón con los que se ha probado (ver la revisión de Labreuche & Warr, 2013). También ha sido muy útil para estudiar las funciones de muchas proteínas del camarón, no solo las involucradas con la inmunidad. El uso del dsRNA como aditivo en alimento para proteger el camarón contra virus en laboratorio y granjas, parece tener potencial si el costo de producción puede reducirse por economía a escala y, si se puede idear un método de administración oral adecuado (Itsathitphaisarn, Thitamadee, Weerachatyanukul y Sritunyalucksana, 2017). Sin embargo, puede ser factible que se utilice para eliminar virus de stocks de reproductores que se han contaminado con virus como el IHHNV (Attasart, Kaewkhaw, Chimwai, Kongphom y Panyim, 2011) o que se hayan descubierto que están infectados con un algún virus similar, como lo sucedido con el virus Laem-Singh (LSNV) (Saksmerprome et al., 2017). Con la eliminación del IHHNV, el proceso podría mejorarse mediante el uso simultáneo del antibiótico ivermectina (Nguyen, Sakuna, Kinobe y Owens, 2014). Si se demuestra su eficacia, la metodología podría aplicarse para eliminar virus de camarón de cultivo, pudiendo ser devueltos para su uso en programas de reproducción selectiva. Uso de EVE para la tolerancia del camarón a infecciones virales El primer reporte de tolerancia adaptativa del camarón a virus que se informó para IHHNV endémico, pero inocuo y desconocido en Penaeus monodon fue en Asia en la década de los 80, pero resultó mortal para Penaeus stylirostris en las Américas (Bell & Lightner, 1984; Lightner, Bell y Redman, 1990; Lightner, Redman y Bell, 1983). Después de la exposición al IHHNV, P. stylirostris desarrolló lo que se pensaba que era resistencia al IHHNV en 3 años por una fuerte selección de sobrevivientes en Tahití. Sin embargo, cuando el stock de camarón

Figura 5: Ejemplo de una plataforma de detección de PCR altamente portátil para la detección de patógenos de camarón a lado del estanque, y transmisión de los resultados de detección por internet, mediante tecnología inalámbrica. Esto se está probando en el Programa Newton INSH apoyado por fondos en Tailandia.

de Tahití fue enviado a América y expuesto a stocks de P. stylirostris sanos, se produjo una mortalidad masiva en los stocks vírgenes, lo que indica que las poblaciones de Tahití eran realmente tolerantes a infecciones persistentes y productivas (no latentes) de IHHNV. Más tarde, en la década de los 90, aproximadamente 1.5 años después de brotes graves de YHD en Tailandia, descubrimos que muchos estanques de camarón contenían camarón con infecciones persistentes de YHV, pero sin signos graves de enfermedad (Pasharawipas, Flegel, Sriurairatana y Morrison, 1997). Llamamos a esta capacidad de tolerar un virus sin mostrar signos de enfermedad como “acomodación viral” (Flegel y Pasharawipas, 1998), y desarrollamos una hipótesis comprobable para su mecanismo que ha sido actualizada continuamente durante los años siguientes, de acuerdo con resultados de investigaciones publicadas (Flegel, 2007b; Flegel, 2009; Utari, Soowannayan, Flegel, Whityachumnarnkul y Kruatrachue, 2017). Como la acomodación viral fue un proceso específico para cada virus, un elemento clave en la hipótesis era algún tipo de memoria. Al principio, la naturaleza de esta memoria era desconocida (Flegel y Pasharawipas, 1998), pero más tarde se propuso que sean las

29

mismas infecciones virales persistentes, esto es “el virus es la memoria” (Flegel, 2007b). Sin embargo, posteriores investigaciones sobre la ocurrencia de fragmentos no retrovirales genéricos del genoma viral insertados en el genoma del camarón, me sugirieron que podrían constituir la “memoria” requerida en la hipótesis de acomodación, y en consecuencia, se actualizó (Flegel, 2009) (Figura 5). Más tarde, se descubrieron fragmentos del genoma no retrovirales en el genoma de mamíferos y se denominaron EVE (Cui & Holmes, 2012; Feschotte, 2010; Feschotte y Gilbert, 2012; Holmes, 2011; Katzourakis y Gifford, 2010), así que ahora nos referimos a los fragmentos del genoma no retroviral en el genoma del camarón como EVE no retroviral, o simplemente EVE. Las palabras “acomodación viral” fueron elegidas para abarcar los significados de “hospedaje y apoyo” viral en una manera que permitió la persistencia viral con efectos mínimos negativos tanto en el huésped como en el virus. En términos simples, el proceso de acomodación viral permitió la selección positiva tanto de la virulencia reducida del patógeno, como una mayor tolerancia del huésped con el tiempo. Fue presentada como un mecanismo alternativo de respuesta viral al clásico basado en una batalla entre la defensa del


PATOLOGÍA

- DICIEMBRE 2019

huésped y los mecanismos de virulencia de patógenos. La acomodación viral puede haber evolucionado en el camarón e insectos porque permite más rápidamente que un huésped y un patógeno viral, alcancen un estado de clímax evolutivo de convivencia inocua. Los mecanismos hipotéticos de la más reciente revisión de la hipótesis, están resumidos en la Figura 7 se incluyen (a) generación aleatoria de fragmentos de genes de ADN complementario (ADNc) a partir del ARN mensajero del virus (ARNm) por enzimas transcriptasa inversa del huésped; (b) integración aleatoria de los fragmentos de ADNc a regiones no codificantes del genoma del huésped como EVE, por enzimas integrasa del huésped; (c) oportunidad de producción de transcriptasa antisentido, “ARN inmunoespecífico” (ARNim) por algunos de los EVE; y (d) unión del ARNm antisentido a ARNm viral complementario para activar el mecanismo de ARNi del huésped que derribaría, pero no eliminaría, el virus complementario. Según la hipótesis, el camarón portador de EVE protectora sería tolerante al virus letal correspondiente y tendría una ventaja selectiva sobre el camarón sin EVE protectora. Dado el gran número de descendientes y la baja supervivencia tasa de vida hasta la edad adulta, la presión selectiva de un virus letal podría ser muy alta y conducir al rápido desarrollo de tolerancia en la población. A partir de entonces, las mutaciones virales para reducir la virulencia tendrían una ventaja selectiva, mientras que aquellos para mayor virulencia serían seleccionados en contra. En el huésped, la mutación para una mayor tolerancia tendría ventaja selectiva, mientras que se seleccionaría una tolerancia inferior en contra. El punto final sería como el alto grado de tolerancia visto hoy para IHHNV en P. monodon en la región donde ambos son endémicos (Withyachumnarnkul et al., 2006). Los resultados de investigaciones recientes han respaldado las predicciones de la hipótesis de acomodación (Flegel, 2009). En un informe, EVE de un virus de ARN no retroviral (virus de parálisis aguda israelí) protegió a las abejas contra la enfermedad de ese virus (Maori, Tanne y

Figura 6: Ejemplo de un sistema de punto de atención para la secuenciación de ADN/ARN que puede usarse para la detección de múltiples patógenos simultáneamente y para la evaluación de comunidades microbianas asociadas a animales (microbiomas) y comunidades ambientales microscópicas (ADN ambiental).

Sela, 2007). Este artículo se omitió cuando se preparó el artículo de adaptación viral en 2009. En otra publicación, el quiebre de Dicer (un componente endonucleasa del mecanismo de ARNi) desestabilizó infecciones persistentes al virus asociado a las branquias (YHV Tipo 2) en camarón (YangSu et al., 2008). Además, muchos EVE del parvovirus del camarón (IHHNV) se encontró en P. monodon y P. vannamei en Tailandia, y variaron aleatoriamente en número y longitud en diferentes individuos de especímenes de camarón (Saksmerprome et al., 2011). También fue demostrado que están presentes en el esperma de camarón, que no contienen mitocondrias. Esto indicaba que el EVE estaba en ADN cromosómico y heredable. Los resultados también dieron una explicación de los datos anteriormente obtenidos en la tesis del estudiante que trabajó con IHHNV y que encontró solo secuencias parciales de IHHNV en la mayoría de las muestras naturales recolectadas (Chayaburakul, 2005). Se reportaron EVE similares de IHHNV en los stocks de reproductores de P. monodon en Hawai y fue demostrado que fue heredado en forma mendeliana (Brock, Antonio y Argue, 2013). En otra publicación, se mostró que la tolerancia al flock house virus (FHV) en las células de Drosophila depende de

30

la actividad de la transcriptasa inversa del huésped (RT) y de mecanismos de ARNi y de estar asociados con EVE de FHV (Goic et al., 2016). También hemos encontrado EVE de WSSV en P. monodon que son aleatorios en número, tipo y expresión de ARN (Utari et al., 2017) según lo predicho por la hipótesis de acomodación viral. El EVE tenía un 97% o más de identidad para encajar secuencias de WSSV existentes, lo que indica que fueron adquiridas relativamente recientemente. De 128 camarones muestreados, solo 33 (26%) portaban al menos uno de los tres WSSV-EVE diferentes estudiados, y del total de 37 EVE encontrados (un camarón con dos tipos, y otro con los tres tipos), 76% (33/37) fueron para lo que llamamos WSSVORF366. Su alta prevalencia sugirió que tenía una posible ventaja selectiva para el camarón huésped. Curiosamente, cinco de nueve camarones que dieron positivo para ORF366, mostraron expresión de ARN de sentido positivo y negativo. Están presentes en células germinales de camarón, y el trabajo preliminar ha demostrado que son heredables de una manera mendeliana (datos no publicados). El siguiente paso en el proceso de


PATOLOGÍA

- DICIEMBRE 2019

Figura 7: Diagrama de los pasos hipotéticos en el proceso de acomodación viral. (a) Producción de ARNm por cualquier ADN o ARN de virus; (b) reconocimiento del ARNm como extraño por un mecanismo actualmente desconocido, directo o indirecto por enzimas de transcriptasa inversa derivadas del huésped inducidas por virus que producen fragmentos de ADNc de longitud variable y tipo del fragmento de ARNm viral; (c) transporte de fragmentos de ADNc al núcleo del huésped donde se insertan aleatoriamente como EVE en regiones no codificantes (¿elementos transportables?) del ADN del huésped en cualquier sentido u orientación antisentido; (d) expresión aleatoria de ARN del EVE (es decir, expresión o no expresión) tal que algunos EVE expresarán fragmentos de ARN antisentido inmunoespecíficos (ARNim); (e) el ARNim se exporta al citoplasma donde se hibrida con ARNm viral e inicia el mecanismo de ARNi que derribará pero no eliminará la reproducción viral, conduciendo a una infección persistente. ADNc: ADN complementario; dsRNA: ARN bicatenario; EVE: elementos virales endógenos; ARNim: ARN inmunoespecífico; ARNm, ARN mensajero; ARNi: ARN de interferencia; RT: transcriptasa inversa.

investigación para ORF366 es reconfirmar la herencia mendeliana e identificar individuos machos que son heterocigotos para una variedad de WSSV-EVE que muestran expresión de ARN de sentido negativo o expresión de ARN de doble sentido. Estos serán apareados con hembras negativas para el mismo EVE. De esta manera, la mitad de la prole será positiva para el EVE, y otra mitad será negativa, mientras que otros genes se distribuirán aleatoriamente en la descendencia con respecto al EVE. La descendencia se dividirá en grupos positivos y negativos para EVE para evaluar cualquier protección significativa que pueda proporcionar contra WSD. Si se comprueba que el EVE protege al camarón contra enfermedades virales, y si el mecanismo subyacente puede ser dilucidado (incluso si los mecanismos en la hipótesis actual de acomodación viral necesitan modificarse aún más), puede ser posible diseñar reagentes apropiados para que el

EVE hecho a la medida sea protector y pueda ser administrado al camarón de una manera que se sepa en qué posición del genoma se inserta, por un mecanismo de inserción del propio camarón. Esto constituiría una modificación genética por un proceso natural del camarón, que ha venido dándose por milenios, y que continúa haciéndolo. Esto pudiera encaminar una producción de “diseño de stocks SPF” de camarón tolerante a múltiples virus. Buenas noticias para el uso de organismos genéticamente modificados La indisputable existencia de EVE no retroviral y su continua producción en camarón e insectos (y tal vez otros invertebrados) por procesos de respuesta de un huésped natural por milenios, demuestra que todos estos organismos son genéticamente modificados (AGMO). Un proceso de modificación genética natural similar (el mecanismo de repeticiones palindrómicas cortas regularmente espaciadas (CRISPR)

31

también está presente y activo en bacterias (Archaea y Eubacterias), que son mucho más antiguas en el registro geológico que los animales. Un mecanismo comparable también puede ocurren en plantas (da Fonseca et al., 2016). La evidencia muestra claramente que los AGMO son ubicuos en nuestro entorno y lo han sido por milenios. En otras palabras, hemos estado usando y comiendo AGMO natural con regularidad desde el origen del ser humano, sin consecuencias negativas. Esto debería constituir evidencia suficiente para satisfacernos sobre que la creación y el uso de organismos genéticamente modificados, no representan una amenaza para la supervivencia del humano o de cualquier otra planta o animal en la tierra. Conclusiones En resumen, creo que el control futuro de las enfermedades en la acuicultura dependerá de los avances en ingeniería y biotecnología.


PATOLOGÍA

Necesidades clave para el éxito futuro en el establecimiento de una producción estable y sostenible de todas las especies acuícolas serán el desarrollo de capacidades de diagnóstico POC rápidas y muy sensibles y específicas para los productores que serán (a través de internet), parte de redes nacionales, regionales y mundiales para el control de enfermedades. Para más de las principales especies acuícolas, se han seleccionado genéticamente stocks de SPF para desarrollar un crecimiento más rápido y para resistencia o tolerancia a las principales enfermedades. Para asegurar bioseguridad, una producción optimizada y el mínimo impacto negativo al medio ambiente, la tendencia será cultivos relativamente cerrados, diseñando sistemas de cultivo bioquímicamente desarrollados en base al análisis de ADNe. También creo que muchas de las nuevas terapias de prevención de enfermedades que ahora están en

- DICIEMBRE 2019

estudio, se convertirán en realidades. Un requisito de suma importancia para el logro de estos objetivos será un apoyo continuo a la investigación por parte de expertos trabajando en grupos multidisciplinarios, y para la educación de alumnos en escuelas y universidades, practicantes de acuicultura y de consumidores. Como una adición muy emocionante, leí una publicación después de la preparación del borrador original de este manuscrito (Poirier et al., 2018, lo que proporcionó apoyo adicional a la hipótesis de acomodación viral. Los autores describen cómo cuatro ARN de virus de insectos pueden inducir insectos y células de insecto cultivadas, producir de forma autónoma lineal y circular elementos de ADN bicatenario que portan secuencias virales homólogas. Las formas circulares que estudiaron fueron capaces de producir pequeñas

32

transcripciones de ARN interferentes que podrían inducir una respuesta protectora del huésped ARNi. Animo a todos para que lean este artículo y trabajen para determinar si este mecanismo también ocurre en camarón. Si es así, los plásmidos de ADN ofrecen un enfoque aún mejor para el control de enfermedades, que el uso de dsRNA como se describió anteriormente. Los plásmidos de ADN son muy fáciles y baratos de producir en gran cantidad in vitro utilizando técnicas de PCR, y los plásmidos resultantes son mucho más estables que el ARN. Esto podría abrir el camino para producir un tipo completamente nuevo de aditivo para piensos para control de virus del camarón, y no tendríamos que temer el resultado de su uso, ya que se han producido naturalmente durante milenios por el propio camarón, sin resultados negativos● Para mayor información sobre este artículo escriba a: tim.flegel@gmail.com


NUTRICIÓN

- DICIEMBRE 2019

Krill Estimulante alimenticio altamente atractivo para dietas de camarón Autores: Dra. Lena Burri Dr. Alberto Nunes Investigación desarrollada en el laboratorio de la Universidad Federal de Ceará LABOMAR en colaboración con Aker BioMarine. lena.burri@akerbiomarine.com

La importancia de los quimioatrayentes en las dietas de camarón basadas en harina de pescado

C

on un total de 4.5 millones de TM, que es el 81% de la producción mundial de camarón, el camarón blanco del Pacífico (Litopenaeus vannamei) es el camarón más cultivado en el mundo [1]. Para alcanzar el éxito económico en el cultivo del camarón, es esencial un consumo máximo de alimento con un mínimo de desperdicio del mismo. Una toma de alimento y un crecimiento alto depende de una dieta que sea nutricionalmente adecuada y que estimule células sensoriales especiales (quimiorreceptores). Los quimioatrayentes que se unen a estos receptores son sustancias químicas capaces de provocar respuestas conductuales positivas iniciales en la alimentación de los camarones [2]. Estas respuestas positivas incluyen la búsqueda, el movimiento o localización de la fuente de alimento que contiene uno o más quimioatrayentes y, por lo tanto, aseguran una toma de alimento y un crecimiento adecuado. Los quimiorreceptores están situados en los apéndices de movilidad y

en partes de la boca, y actúan a modo de sentidos efectivos del tacto, el gusto y el olfato que compensan la visión deficiente de los camarones. Los compuestos solubles y de bajo peso molecular, aminoácidos libres, nucleótidos, nucleósidos, compuestos de amonio cuaternario, fosfolípidos, aminas biogénicas y los monosacáridos se han identificado como vitales en la alimentación ya que mejoran la atractabilidad y la palatabilidad de las dietas. Una mayor atractabilidad de las dietas reduce el tiempo de respuesta de la toma de alimento y, por lo tanto, limita la lixiviación de nutrientes y el desperdicio de alimento. Esto no solo ayuda en los problemas de estanques sobrecargados de nutrientes, sino que también reduce la energía que un camarón tiene que gastar para encontrar el alimento y supone una reducción del costo del pienso que puede representar hasta el 50% de los costos totales del cultivo. En el cultivo intensivo del camarón se ha utilizado con frecuencia la harina de pescado por su composición de nutrientes y su alta capacidad de atracción, pero la baja disponibilidad y el aumento de los precios han conducido al uso de fuentes de proteínas alternativas tales como plantas y subproductos animales [3]. Si bien estos cambios tienen la ventaja de reducir los costos y aumentar la sostenibilidad de la acuicultura, [4, 5] también pueden afectar gravemente al crecimiento del camarón. Las motivos pueden ser la falta de nutrientes

34

esenciales, atractabilidad y palatabilidad menores y factores antinutricionales que pueden suprimir el estímulo alimentario y reducir la biodisponibilidad de los nutrientes [6]. Un buen atrayente alimenticio puede ayudar a superar estos problemas, pero puede haber diferencias en la efectividad cuando se comparan diferentes fuentes como peces, krill, moluscos, camarones o calamares.

El krill antártico, fuente atrayentes alimenticios

de

La harina de krill está hecha de krill antártico (Euphausia superba), que es un crustáceo emparentado con los camarones. A diferencia de los camarones que viven en el fondo del océano, el krill forma cardúmenes de hasta veinte kilómetros de largo y se mueve hacia arriba y hacia abajo dentro de una columna de agua. Hay 85 especies diferentes de krill en todo el mundo; el krill antártico vive en el Océano Austral, alrededor del continente helado de la Antártida. El krill es transparente, con algunas coloraciones rojas y verdes. El rojo es debido a manchas de pigmentación de astaxantina, que pueden cambiar en tamaño e intensidad [7]. La capacidad de cambiar la pigmentación es importante para adoptar una coloración más oscura como protección UV, cuando el krill está en la superficie, o bien una mayor transparencia con fines de camuflaje. El color verde se puede ver en su sistema digestivo y es el resultado de las algas que comen. El krill puede comer hasta un 20% de su peso corporal por día, pero también


NUTRICIÓN

- DICIEMBRE 2019 tiene la capacidad de encogerse cuando pasa hambre y puede sobrevivir sin comida durante 200 días. El krill adulto puede alcanzar una longitud de 6 cm y tiene manchas corporales azules emisoras de luz, que se cree que tienen una función en el apareamiento, la formación de cardumen o el camuflaje cuando el sol brilla sobre ellos. Sorprendentemente, el genoma del krill es aproximadamente 12 veces el tamaño del genoma humano. El krill antártico se cosecha en la naturaleza, y el krill entero cocido, seco y molido da una harina de color marrón-naranja rico en proteínas, fosfolípidos, ácidos grasos omega-3 y astaxantina.

Comparación de los diferentes atrayentes alimenticios marinos

Un estudio realizado por Nunes et al. en 2019, comparó la preferencia de alimento y la respuesta de crecimiento de L. vannamei con respecto a diferentes quimioatrayentes marinos [8]. Una dieta con un 3% de harina de pescado se complementó con un 3% de uno de estos ingredientes: harina de krill, harina de calamar, harina de cabeza de camarón, harina de camarón, harina de hígado de calamar, harina de salmón (control positivo), concentrado de proteína de soja (control negativo) o un 5% de hidrolizado de sardina líquida. Los resultados demostraron que después de 74 días, el peso corporal final fue mayor para los camarones alimentados con la dieta rica en harina de krill (11.97 ± 0.93 g), seguido del control positivo (11.11 ± 0.77 g) y la harina de calamar (11.01 ± 1.17 g). Las dietas ricas en harina de cabeza de camarón, harina de camarón, harina de hígado de calamar y el control negativo mostraron un menor peso corporal en comparación con los camarones alimentados con la dieta control positivo, pero no hubo una diferencia estadística entre ellos. Los camarones alimentados con la dieta de hidrolizado de sardina alcanzaron el peso corporal más bajo (10.06 ± 1.02 g). En la recolección, la supervivencia del camarón fue alta, alcanzando una media de 93.3 ± 5.8 % y no se vio afectada por las diferentes materias primas. El mayor rendimiento se obtuvo con las dietas que contenían harina de krill y harina de salmón.

35


NUTRICIÓN No se observaron diferencias estadísticas en el rendimiento del camarón entre las otras dietas. La tasa de conversión de alimento (FCR) más baja se obtuvo con los camarones alimentados con harina de krill (1.31 ± 0.05) en comparación con los alimentados con dietas de harina de cabeza de camarón (1.47 ± 0.05), hidrolizado de sardina (1.47 ± 0.07) y harina de hígado de calamar (1.45 ± 0.17). La preferencia sobre el pienso se evaluó alimentando simultaneamente los camarones ad libitum dos veces al día durante 10 días en cincuenta tanques de 0.5 m3. Los resultados muestran una preferencia por las dietas ricas en harina de krill y harina de cabeza de camarón (la harina de calamar y la harina de hígado de calamar mostraron la misma tendencia, pero sin obtener diferencias significativas). Curiosamente, el estudio demostró que la atractividad por el pienso por sí sola no asegura un mejor rendimiento de crecimiento del L. vannamei. Cuando la harina de cabeza de camarón se comparó con la harina de krill, el camarón mostró una mayor preferencia por la harina de cabeza de camarón. Sin

- DICIEMBRE 2019 embargo, las preferencias de alimentación observadas no se reflejaron en el peso final en el estudio de crecimiento. Tras 74 días de cultivo, el peso final de los camarones alimentados con la dieta rica en harina de cabeza de camarón no incrementó más allá de las dietas control negativo y de harina de krill. Una razón podría ser la presencia de cadaverina, putrescina y tiramina en la harina de cabeza de camarón y la harina de hígado de calamar. La presencia de estas aminas biogénicas puede haber provocado una mayor toma de alimento, pero comprometió la calidad de los nutrientes del alimento. La mejora de crecimiento observada con la dieta rica en harina de krill parece ser el resultado de un mayor atractivo y estimulación de la toma de alimento y el suministro de nutrientes esenciales frescos. De manera similar, estudios previos realizados tanto en P. monodon como en L. vannamei han demostrado la capacidad de la harina de krill para estimular la toma de alimento y el rendimiento del crecimiento [4, 5, 9, 10].

36

Conclusión Los resultados indicaron que la harina de krill actúa como un potente estimulante de la alimentación y promotor del crecimiento en dietas con baja inclusión de harina de pescado para los camarones. La dieta rica en harina de krill fue la más efectiva para el aumento del peso final y la producción de camarones, y en la reducción de la FCR en L. vannamei en comparación con otros atrayentes alimenticios marinos. La mayor tasa de crecimiento obtenida en camarones alimentados con harina de krill mejora la eficiencia de la producción al reducir los costos de la granja y la ingesta de alimento. Las cosechas tempranas y una mayor rotación de cultivos aumentan los rendimientos anuales y reducen el riesgo de aparición de enfermedades●

Este es un extracto del artículo original, para mayor información escriba a: lena.burri@akerbiomarine.com


NUTRICIÓN

- DICIEMBRE 2019

Microalgas de agua dulce (Schizochytrium sp.) como sustituto de aceite de pescado para balanceado de camarón Autores: Kristy M.Allen¹, Habte-Michael Habte-Tsion¹, Kenneth R.Thompson¹, Keith Filer², James H.Tidwell ¹ & Vikas Kumar ¹,³ ¹División de Acuicultura, Facultad de Agricultura, Ciencia de Alimentos y Sistemas Sostenibles, Kentucky State University, 103 Athletic Dr, Frankfort, KY, 40601, EE. UU. ² Centro de Investigación de Acuicultura, Alltech, 3031 Catnip Hill Road, Nicholasville, KY, 40356, EE. UU. ³Instituto de Investigación en Acuicultura, Departamento de Ciencia Animal y Veterinaria, Universidad de Idaho, 2000 W Sixth Street, Moscú, ID, 83844, EE. UU. vikaskumar@uidaho.edu

L

as microalgas, Schizochytrium sp., son una rica fuente de ácido docosahexaenoico, DHA (66% de lípidos con 27% -DHA). Se formularon ocho dietas nutricionalmente equilibradas: la dieta 1 (control) consistía solo en aceite de pescado (FO); las dietas 2 y 3 tenían cantidades crecientes de harina de algas y aceite de soya (SBO) a expensas de FO; la dieta 4 consistió en una combinación de harina de algas (37 -g/kg), SBO (21 -g/kg) y aceite de linaza (LSO) a 4 -g/kg cada; la dieta 5 tenía harina de microalgas a 50 -g/kg y cantidades iguales de LSO y SBO a 8 -g/kg; las dietas 6 y 7 contenía cantidades iguales de harina de alga a 62 -g/kg, pero con LSO o SBO añadido a 8 -mg/g, respectivamente; la dieta 8 contenía solo harina de algas a 75 -mg/g. La eficiencia del crecimiento y alimentación de L. vannamei no fue significativamente diferente entre los tratamientos. La composición del ácido graso del músculo generalmente refleja el tipo de dieta. La cantidad de tejido adiposo subepidérmico muscular fue significativamente mayor para el camarón alimentado con las dietas 3 y 7, mientras que la lipasa intestinal fue significativamente mayor en camarón alimentado con las dietas 7 y 8. La peroxidación lipídica del músculo no se vio afectada por los tratamientos dietéticos, aunque las actividades antioxidantes fueron significativamente más altas en la dieta 7 dada al camarón, en comparación con los alimentados con la dieta 1. En general, la harina de algas puede reemplazar al aceite de pescado en la alimentación para camarón.

37

La acuicultura está creciendo actualmente un 10% más rápido que la pesca generando USD $160.2 billones en ventas en 20151. Actualmente, el mundo produce casi 44 millones de toneladas de productos pesqueros y casi 3 millones de toneladas de crustáceos que cultivados en granjas en tierra (Organización de las Naciones Unidas para la Agricultura y la Alimentación, FAO)1. Entre los crustáceos producidos en acuicultura, el camarón blanco del Pacífico (Litopenaeus vannamei) es el que más se produce hasta ahora, por lo que se le puede atribuir debido a su rápido crecimiento, alto valor en el mercado y mayor resistencia a la enfermedades2. A medida que el cultivo de camarón ha aumentado, la demanda de ingredientes derivados del mar, como el aceite de pescado (FO), también ha aumentado. Sin embargo, este recurso se está volviendo más costoso, lo que está generando investigaciones para identificar alternativas adecuadas sin poner en peligro la salud de peces y crustáceos3,4. Entre las posibles alternativas para FO, han sido reconocidos los aceites de microalgas de Thraustochytridos, como Crypthecodinium sp. y Schizochytrium sp., ya que tienen ingredientes prometedores como alimento para acuicultura, debido a sus ácidos grasos poliinsaturados de cadena larga (LC-PUFA) y por el hecho de que resultan tener un rendimiento de crecimiento similar o mejor, en comparación con el aceite de pescado (FO) en varios animales acuáticos5–10. Por ejemplo, las dietas de alimento del pez gato de canal (Ictalurus punctatus) con cantidades


NUTRICIÓN crecientes de harina seca de Schizochytrium (0 a 20 g/kg), en comparación a las del aceite de vísceras de bagre, tuvo un significativo aumento de peso cuando se lo alimentó a 10 o 15 g/kg8. De manera similar, cuando se usó Schizochytrium como sustituto de FO para el salmón del Atlántico (Salmo salar), el crecimiento no se vio comprometido y el aceite de microalgas fue tan digerible como el FO7. La inclusión de aceites de microalgas en dietas para el camarón blanco del Pacífico también ha mostrado ser muy prometedora6,10–13. El reemplazo completo de FO con diferentes combinaciones de aceite de Schizochytrium, aceite de Mortierella, aceite de soya (SBO), y el aceite de linaza en dietas a base de proteína vegetal, dio como resultado un crecimiento y supervivencia similar a dietas comerciales (control)6. Un siguiente estudio mostró que una combinación de Schizochytrium y aceite de Mortierella en la dieta mejoró ligeramente el crecimiento de L. vannamei, en comparación con una dieta basada en FO11. Del mismo modo, el uso exclusivo de una dieta de harina de Schizochytrium resultó en un crecimiento similar en L. vannamei como con FO, sin comprometer la supervivencia o la digestión intestinal y actividad enzimática hepatopancreática10,12. Además, Nonwachai et al.13 encontraron que la dieta de harina de Schizochytrium mejoraba la respuesta inmunológica innata en L. vannamei, incluida la actividad fagocítica, enzima antioxidante y recuento total de hemocitos, así como su resistencia al patógeno marino, Vibrio harveyi. Estos hallazgos, junto con la data, sugieren que la harina de microalgas a menudo conduce a un alto contenido de LCPUFA en L. vannamei alimentado tanto con dietas de origen de aceites vegetales o FO10,11, indicando que este recurso sostenible rico en ácidos grasos omega-3 puede proporcionar más beneficios tanto para el consumidor humano, como para el pez.

- DICIEMBRE 2019 Schizochytrium o en combinación con SBO y/o LSO sobre la supervivencia, crecimiento, composición de ácidos grasos en músculo, estado antioxidante muscular y actividad de lipasa intestinal en el camarón blanco del Pacífico, L. vannamei.

Materiales y métodos Preparación de la harina de algas y dietas experimentales. Las algas fermentadas, Schizochytrium sp., fueron utilizadas en este estudio (Fuente: Alltech Lexington, KY, EE. UU.). Las algas fermentadas se centrifugaron continuamente (5,000 g) para obtener un sólido que luego se secó por pulverización, produciendo un polvo de algas finas. Se usó un secador de spray Kochiwa [usando atomización centrífuga (4,500 g) a una temperatura de entrada (140–150°C), cámara central (130–135°C) y temperatura de salida (80–85°C)], para preparar el polvo secado por pulverización.

Se necesitaron entre 6 y 8 segundos para formar el polvo de algas después de la inyección. La composición proximal se midió de acuerdo con los estándares de la Asociación Oficial de Métodos de Química Analítica14, que mostraron que este alimento contenía un contenido de lípidos del 66%. La composición proximal de ingredientes como SBM, harina de trigo y gluten de trigo, se midió de manera similar. Un total de ocho dietas isonitrogenadas (que contienen 40% de proteína) e isoenergéticas (9.0% de lípidos), fueron formuladas para contener cantidades crecientes de harina de algas (que contenía 660 g/kg de lípidos extraíbles; Tabla 1). Independientemente de la dieta, la harina de pescado (FM) y la harina de soya (SBM) fueron las fuentes de proteínas dominantes y se agregaron a todas las dietas experimentales

Tabla 1. Ingrediente y composición proximal (g/kg) de las dietas experimentales. aPorciones por kg de dieta: 3000 UI de acetato de retinilo (vitamina A); 2400 UI colecalciferol (vitamina D); 60 UI α-tocoferol acetato (vitamina E); 1.2 mg bisulfito sódico de menadiona vitamina K); 120 mg monofosfato de ácido ascórbico (49% de ácido ascórbico, vitamina C); 0.024 mg cianocobalamina (vitamina B12); 0.168 mg de d-biotina; 1200 mg de cloruro de colina; 1.2 mg ácido fólico; 12 mg niacina; 26 mg d-pantotenato de calcio; piridoxina, HCl, 6 mg; 7.2 mg ribofavina,; tiamina HCl, 1.2mg. bPorciones por kg de dieta: cloruro de sodio (NaCL, 3% Na, 61% CL), 3077mg; sulfato de hierro (FeSO4·7H2O, 20% Fe), 65 mg; sulfato de manganeso (MnSO4, 36% Mn), 89 mg; sulfato de zinc (ZnSO4·7H2O, 40% Zn), 150 mg; sulfato de cobre (CuSO4.5H2O, 25% Cu), 28 mg; yoduro de potasio (KI, 24% K, 76% I), 11 mg; celite AW521 (sílice de tierra de diatomeas lavada con ácido, 1000 mg).

Actualmente, las implicaciones del uso de harina de microalgas en parámetros asociados con el metabolismo de lípidos tales como la actividad de la lipasa, el colesterol total y el tejido adiposo subepidérmico, permanecen sin explorar. El objetivo de este estudio fue evaluar los efectos de reemplazar una dieta con FO, con uno de solo harina de

38


NUTRICIÓN

- DICIEMBRE 2019 a 250 y 397 g/kg, respectivamente. La cantidad de proteína cruda, lípidos, vitaminas y minerales se formuló para cumplir los requisitos del camarón peneido 15. Además, el colesterol, el cloruro de colina y la lecitina se incluyeron en todas las dietas para satisfacer los requisitos de L. vannamei16,17. La dieta control (dieta 1) tenía 6% de FO como la principal fuente de lípidos, que es similar a la cantidad utilizada en dietas comerciales (Tabla 1). Las dietas 2 y 3 tenían cantidades crecientes de harina de algas y SBO a expensas de FO. El aceite de pescado (FO) fue completamente reemplazado en la dieta 4 con una combinación de harina de algas, SBO, y LSO. Las dietas 5-8 tampoco contenían FO, pero tenían diferentes combinaciones de lípidos: la dieta 5 tenía cantidades iguales de LSO y SBO a 8 g/ kg; las dietas 6 y 7 contenían cantidades iguales de harina de algas, pero con LSO o SBO añadidas a 8 g/kg, respectivamente; la dieta 8 contenía solo harina de algas como la única fuente de lípidos añadida, con la mayor inclusión a 75 g/kg. La harina de trigo se ajustó en las dietas experimentales para compensar la pequeña cantidad de proteína cruda en la harina de algas (Tabla 1). Mientras que la harina de Schizochytrium es baja en EPA, pero puede ser sintetizada por algunos animales acuaticos del precursor, ALA. Por lo tanto, se agregó LSO, que es alto en ALA, en las dietas 4-6 para determinar si esto podría resultar en altos niveles de EPA en el camarón. Los ingredientes secos se molieron completamente y se mezclaron en una batidora (Hobart A200, Hobart, Troy, OH, EE. UU.) para preparar las dietas para camarón. Se adicionó agua tibia para mantener el 35% de humedad y mezclar durante otros 10min. Esta masa de cada dieta se pasó a través de un peletizador de alimentos (picadora de carne, Glen Mills Inc., Clifon, NJ, EE. UU.) con un troquel de 2 mm seguido del secado al aire durante 24 horas. Se pulverizaron largas cadenas de dietas con molinillo (Glen Mills Inc., Clifon, NJ, EE. UU.) obteniendo pellets de 2 mm de tamaño mediante un tamiz. Después del tamizado, se agregaron manualmente las cantidades apropiadas de LSO, SBO y FO para inhibir el daño de los ácidos grasos altamente insaturados durante peletizado. Después de que las dietas se secaron, se determinó

la composición química incluyendo ácidos grasos de las dietas14 (Tabla 1). Animales experimentales y sistema experimental. Postlarvas de camarón blanco del Pacífico (Litopenaeus vannamei) se compraron en el laboratorio privado de camarón (Shrimp Improvement Systems, LLC, Islamorada, FL, EE. UU.), y se aclimataron gradualmente a un sistema de precría de camarones en el departamento de acuicultura, Universidad Estatal de Kentucky, Frankfort, KY, EE. UU. Un tanque de cultivo de 1,000 L (utilizado como un sistema de recirculación de precría) conectado a un tanque de sedimentación y un filtro biológico (Red-Ewald, Karnes City, TX, EE. UU.) para mantener el agua en óptimas condiciones y parámetros para las larvas de camarón. El agua de mar artificial se hizo mezclando la mezcla de sal de Crystal Sea Marine (Marine Enterprises International, LLC, Baltimore, MD) con agua declorada a una salinidad de 34 partes por mil (ppt). Los tanques de cultivo recibieron aireación suave (difusores de cerámica). Gradualmente la salinidad se redujo a 27-28 ppt mediante la adición de agua dulce durante un período de aclimatación de dos semanas y se alimentó con balanceado comercial para camarón disponible (Zeigler Brothers Inc.). Se pesaron individualmente 600 camarones juveniles (3.15 ± 0.08 g), divididos en 24 grupos que consistían en 25 camarones cada uno, y se colocaron en acuarios de vidrio de 110 L. Después de sembrar el camarón, las ocho dietas tratamiento se asignaron al azar, por triplicado. Los acuarios se conectaron a un sistema de filtración con hélice mecánica y biológica de 2000 L (Red-Ewald, Karnes City, TX, EE. UU.) con una salinidad de 27 a 28 ppt. Cada acuario fue suministrado con agua de mar a una tasa de 4.0 L/min y se proporcionó aireación óptima mediante difusores de aire individuales de 12 pulgadas de Rotron blower (Ametek, Kent, OH, EE. UU.). Durante todo el experimento, el camarón fue alimentado diariamente con el 5% de su peso corporal total, lo que fue igualmente dividido y suministrado a las 08:00, 11:30, 15:30 y 18:00 h. La cantidad de alimento suministrada fue revisada y reajustada cada cuatro semanas en base a evaluaciones de biomasa después de medir el peso total

39

de camarón en cada tanque; se observó la cantidad de alimento suministrado cada día por acuario. Los camarones fueron alimentados con un total de ocho dietas (1 control y 7 dietas experimentales) por un período de 12 semanas. Durante la prueba de alimentación, la temperatura del agua se mantuvo en aproximadamente 29 °C por inmersión de un calentador. La salinidad se mantuvo agregando agua fresca para reemplazar la pérdida de agua por evaporación, o sal adicional para reemplazar las pérdidas debido a la descarga del filtro. El pH, la temperatura, la salinidad y el oxígeno disuelto se midieron una vez por día usando un medidor Hydrolab Quanta (Hydrolab Corporation, Loveland, CO). Los camarones fueron sometidos a un fotoperíodo de ciclos de 12h:12h luz:oscuro con luces de techo fuorescentes. Por las mañanas y por la tarde, todos los acuarios fueron sifoneados diariamente para eliminar el alimento no consumido y heces. Las concentraciones de nitrógeno de amoníaco total (TAN) y nitrito-N (NO2-N) se midieron una vez por semana con un espectrofotómetro Hach DR 3800 de acuerdo con las instrucciones del fabricante (Hach, EE. UU.). Si el TAN o NO2-N excedía 0.5mg/L, se realizaba un intercambio parcial de agua. Muestreo y análisis Después de 12 semanas, se cosecharon camarones de cada acuario; pesados a granel y contados para calcular tasa de crecimiento, eficiencia de alimentación y supervivencia utilizando las siguientes ecuaciones: Ganancia de masa corporal (BMG; %) [= (Masa corporal final - masa corporal inicial) / Masa corporal inicial] × 100 Factor de conversión alimenticia (FCR) = alimento seco suministrado en g / ganancia de masa corporal en g Tasa de eficiencia proteica (PER) = ganancia de masa corporal en g/proteína cruda suministrada en g Valor productivo de la proteína (PPV, %) = [(g de proteína final del cuerpo del camarón proteína inicial del cuerpo del camarón en g) / proteína total consumida en g] x 100


NUTRICIÓN Valor productivo de lípidos (LPV; %) = [(lípido corporal final en g lípido corporal inicial en g) / lípido bruto total consumido en g] x 100

- DICIEMBRE 2019 Tabla 2. Composición de ácidos grasos (% de lípidos totales) de las dietas experimentales. SFA, ácidos grasos saturados = suma C8 a C24. MUFA, ácidos grasos monoinsaturados = C16: 1n-7 + C18: 1n-9 + C20: 1n-9. n-6 PUFA, ácidos grasos poliinsaturados = C18: 2n-6. n-3 PUFA, ácidos grasos poliinsaturados = C18: 3n-3 + C20: 3n-3 + C20: 5n-3 + C22: 6n-3. LC-PUFA, ácidos grasos poliinsaturados de cadena larga = C20: 3n-3 + C20: 5n-3 + C22: 6n-3.

Después de pesar y contar, los camarones se anestesiaron en un baño de hielo (0–4 °C) y se recogieron muestras y se almacenaron a -20 °C para su posterior análisis. Se usaron cinco camarones de cada acuario para la composición proximal del cuerpo según AOAC14. Se recogieron muestras de hepatopáncreas, intestino y músculo de la cola de los camarones restantes, para luego almacenarlos congelados (-80 °C) hasta nuevos análisis. Composición lipídica de dietas y músculos, y enzimas de degradación muscular antioxidante y lipídica. Dietas (Tabla 2) y muestras de músculo de cinco camarones en cada tanque fueron analizadas para determinar su composición de ácidos grasos por cromatografía de gases cuantitativa (utilizando C23:0 como patrón interno). El colesterol total del músculo era analizado utilizando un kit de ensayo de colesterol total colorimétrico, de acuerdo con las instrucciones del fabricante (Cell Biolabs Inc., San Diego, CA). La absorbancia se leyó en un lector multimodo Synergy HTX (BioTek, Instruments, Inc., Winooski, VT). Las muestras de músculos (con digesta) de seis camarones en cada réplica se almacenaron inmediatamente en −80°C. Para el análisis, las muestras se descongelaron en un baño de hielo y se homogeneizaron utilizando un procesador ultrasónico. (Cole Parmer Scientifc Experts, Vernon Hills, IL, EE. UU.), durante 5 minutos en un baño de hielo. Luego las muestras se colocaron en un tubo de microcentrífuga de 1.5 ml (Eppendorf, Hamburgo, Alemania) con solución salina tamponada con fosfato (PBS; Fisher Biorreactivos, Fair Lawn, NJ, EE. UU.) y solución de lisis celular (Promega Corporation, Madison, WI, EE. UU.). Se analizaron las actividades de lipasa, catalasa (CAT), superóxido dismutasa (SOD), y el contenido de peróxido lipídico y la adipogénesis, utilizando un lector multimodo Synergy HTX (BioTek, Instruments, Inc., Winooski, VT, EE. UU.). La actividad de la lipasa intestinal se midió usando un kit de ensayo de lipasa QuantiChrom (DLPS100; BioAssay Systems, Hayward, CA, EE.

UU.), de acuerdo a las instrucciones del fabricante; la absorbancia se leyó a 412 nm. Las actividades de CAT y SOD en el músculo de la cola se midieron usando kits de prueba comerciales (Cayman Chemical, Ann Arbor, MI, EE. UU.); la absorbancia se leyó a 540 nm y 460 nm, respectivamente. El peróxido lipídico en el músculo de la cola se midió mediante análisis del nivel de malondialdehído (MDA) usando un kit de ensayo colorimétrico/fuorométrico (BioVision Incorporated, Milpitas, CA, EE. UU.) según las instrucciones del fabricante; la absorbancia se leyó a 532 nm. La adipogénesis fue medida cuantificando la acumulación de triglicéridos en el tejido muscular. Las

40

muestras de tejido adiposo subepidérmico se analizaron usando un kit de ensayo de adipogénesis (Abnova, ciudad de Taipei, Taiwán); la absorbancia se leyó a 570 nm. Análisis estadístico Todos los datos fueron observados por análisis de varianza unidireccional (ANOVA) utilizando el software SAS/STAT (SAS, 1988). Si se detectaban diferencias significativas (p < 0.05), las medias de las variables dependientes se compararon mediante una prueba de diferencia de Tukey (HSD). Nuestra data fue representada como media ± SEM.


NUTRICIÓN

- DICIEMBRE 2019

Tabla 3. Desempeño de crecimiento y eficiencia alimenticia del camarón*. * Los valores son la media ± SE de tres replicas por grupo. Las medias en la misma fila con superíndices diferentes son significativamente diferentes (p < 0.05)

Tabla 4. Composición proximal (g/kg) de toda la carcasa de camarón*. *Los valores son medias ± SE de tres réplicas por grupo. Las medias en la misma fila con superíndices diferentes son significativamente diferentes (p < 0.05).

Resultados Rendimiento de crecimiento, utilización de nutrientes y composición proximal de la carcasa del camarón. Los parámetros de rendimiento de crecimiento no fueron significativamente diferentes (p > 0.05) entre los tratamientos, aunque FBW fue numéricamente mayor en el camarón alimentado con las dietas 4, 6, 7 y 8 en comparación con las otras dietas (Tabla 3). De manera similar, las eficiencias de alimentación, incluyendo FCR, PER, PPV y LPV tampoco fueron significativamente diferentes entre los tratamientos. Las diferencias en la tasa de supervivencia entre los tratamientos no fueron significativas (Tabla 3). El contenido de humedad y ceniza fue significativamente mayor (p < 0.05) para los camarones alimentados con la dieta control (dieta 1), en comparación con todos los otros tratamientos (Tabla 4). El contenido de proteína cruda fue significativamente mayor (p <0.05) en esos camarones alimentados con las dietas 4 y 5, que todas las demás excepto los camarones alimentados con la dieta 7. Mientras tanto, los lípidos crudos no fueron significativamente diferente (p > 0.05) entre los tratamientos, pero fue ligeramente menor para los camarones alimentados con la dieta control.

Composición de ácidos grasos musculares de cola. La composición de ácidos grasos del músculo de la cola se muestra en la Tabla 5. Entre los ácidos grasos saturados (SFA), el ácido palmítico (C16) fue significativamente mayor en los camarones alimentados con las dietas 6-8 que aquellos alimentados con las dietas 1-4, mientras que los camarones alimentados con las dietas 5-8 tenían niveles significativamente más bajos de ácido lignocérico (C24) que aquellos alimentados con dietas 1-3. No hubo diferencia significativa para el nivel total de SFA entre los tratamientos. Entre los ácidos grasos monoinsaturados (MUFA), C16: 1n-7 fue menor (p <0.05) camarones alimentados con la dieta 4 que los alimentados con las dietas 1, 6, 7 u 8, mientras que el ácido oleico (C18: 1n-9) en el músculo fue mayor (p <0.05) en camarones alimentados con la dieta 1 que en todos los demás, excepto en camarones alimentados con la dieta 2. Mientras tanto, los camarones alimentados con la dieta 1 tenían un ácido gondóico significativamente mayor (p <0.05) (C20: 1n-9) que los alimentados con todas las otras dietas; la cantidad más baja fue en los camarones alimentados con las dietas 5, 6, 7 y 8.

41

Los camarones alimentados con las dietas 1, 6 u 8 tuvieron una LA significativamente menor (p < 0.05) que todas las demás (Fig. 1A), mientras que αALA fue mayor (p < 0.05) en camarones alimentados con dietas 5 y 6 que todos los demás tratamientos (Fig. 1B). Hubo una influencia significativa de los tratamientos dietéticos en el nivel total de MUFA, y el nivel más alto se observó en el grupo alimentado con la dieta 1 seguido de las dietas 2 y 3. respectivamente. Los tratamientos 2–5 mostraron un nivel más alto de PUFA n-6 total en comparación con el control (aceite de pescado) y los grupos 6–8. El nivel total de PUFA n-3 no se vio afectado por las dietas experimentales (Tabla 5). Entre los LC-PUFAs, EPA disminuyó con cantidades crecientes de harina de microalgas en las dietas (Fig. 1C), mientras que DHA aumentó significativamente con mayores inclusiones dietéticas de harina de algas (Fig. 1D). El nivel total de LC-PUFA no se vio afectado. Los camarones alimentados con las dietas 6, 8 y 1 mostraron una proporción más alta de n-3 y n-6 en comparación con aquellos alimentados con otras dietas, respectivamente (Tabla 5). Tejido adiposo subepidérmico del músculo de la cola y contenido de colesterol total, actividad de lipasa intestinal, peroxidación lipídica y


NUTRICIÓN

- DICIEMBRE 2019

Tabla 5. Ácidos grasos (% de lípidos totales) del músculo de la cola de camarones *. *Los valores son la media ± SE de tres réplicas por grupo. Las medias en la misma fila con superíndices diferentes son significativamente diferentes (p < 0.05).

Figura 1. Composiciones (% de lípidos totales) de ácido linoleico (A), ácido linolénico (B), EPA (C) y DHA (D) en el músculo de la cola de camarones. Los valores son la media ± SE de tres repeticiones por grupo. Las diferentes letras sobre cada barra indican diferencias significativas (p < 0.05).

42


NUTRICIÓN

- DICIEMBRE 2019 actividades de enzimas antioxidantes. El recuento total de adipocitos en el músculo de la cola fue significativamente mayor en camarón alimentado con las dietas 3 y 7 en comparación con los alimentados con las dietas 1, 2, 5 y 6; el camarón alimentado con la dieta 1 tuvo el menor recuento de adipocitos (Fig. 2A). Los niveles de colesterol total del camarón no fueron afectados por el tratamiento dietético (Fig. 2B). La actividad de la lipasa intestinal fue más baja para los camarones alimentados con las dietas 1, 4 y 5, y significativamente menor que los camarones alimentados con las dietas 7 u 8 (Fig. 2C). La cantidad de MDA no se vio afectada entre los diferentes tratamientos (Fig. 3A). La actividad de SOD en camarones alimentados con la dieta 7 fue significativamente mayor que la de aquellos alimentados con dietas 1, 2 o 3 (Fig. 3B). Del mismo modo, la actividad de CAT fue significativamente mayor en los camarones alimentados con la dieta 7 que, en todas las otras dietas, excepto la dieta 4 (Fig. 3C).

Discusión Los resultados de este estudio indicaron que la harina de Schizochytrium suministrada a diferentes niveles o en combinaciones con SBO y/o LSO como un sustituto de FO, no causó una diferencia significativa en el crecimiento o la eficiencia alimenticia del camarón. De hecho, no hubo indicios de rechazo de alimento cuando los camarones fueron alimentados con dietas sin FO y el camarón parecía sano durante todo el experimento de alimentación. De hecho, los camarones alimentados con dietas con la mayor cantidad de la harina de microalgas, tendieron a tener un crecimiento ligeramente mayor en comparación a los alimentados con la dieta de control con solo FO como fuente de lípido añadido, aunque las diferencias no fueron estadísticamente significativas. Además, la composición de ácidos grasos del músculo de la cola tenía cantidades significativamente mayores de LC-PUFA en comparación con los camarones alimentados con la dieta control. El FO puede ser completamente reemplazado con SBO y LSO en la dieta de L. vannamei al equilibrar las relaciones omega-3/omega-618 Recientemente, Kumar et al. 19 utilizado la harina de algas (Schizochytrium sp.) como un sustituto de aceite de pescado en dietas libres de harina de pescado para camarón,

Figura 2. Recuentos totales de adipocitos (A) y contenido total de colesterol en el músculo de la cola (B) y actividad de lipasa intestinal (C) del camarón. Los valores son la media ± SE de tres repeticiones por grupo. Las diferentes letras sobre cada barra indican diferencias significativas (p < 0.05).

sin embargo, en este estudio hemos utilizado la harina de algas como un sustituto del aceite de pescado, pero nuestras dietas experimentales fueron dietas basadas en harina de pescado (25% de harina de pescado). Kumar y et al. 19 observaron que el reemplazo de aceite de pescado con harina de algas y aceite vegetal aumentaron el peso del camarón y el valor nutricional del músculo del camarón (n-3 PUFA y LC-PUFA aumentaron significativamente). La harina de algas combinada con aceite vegetal podría reemplazar el 75% de aceite de pescado en dietas de camarón. Recientemente, una combinación de SBO, LSO y sebo de res condujo a un crecimiento significativamente mejor en L. vannamei en comparación con FO solamente20. Sin embargo, el uso de aceites de base terrestre reduce sustancialmente el contenido de LCPUFA20,21, que es menos saludable para el consumidor humano.

43

El uso de harina de algas, incluyendo Schizochytrium sp. y Mortierella sp., son un reemplazo viable para FO en las dietas de L. vannamei, que mantienen o incluso mejorando el contenido de LC-PUFA6,10–13. Esto se atribuye al alto contenido de LC-PUFA en harina de microalgas utilizadas, pero el aceite de Schizochytrium sp. tenía niveles relativamente altos y bajos de DHA y EPA, respectivamente. Un desequilibrio en estos ácidos grasos en otras harinas de microalgas estaba implicada como una razón potencial para un menor crecimiento en el camarón Litopenaeus schmitti22. Esto es consistente con el concepto de que un monocultivo de microalgas es inferior en comparación al uso de mezclas de microalgas cuando se compensan las posibles deficiencias nutricionales a varios animales acuáticos 23,24. En este estudio, L. vannamei pareció utilizar Schizochytrium sp. bien a pesar del mucho mayor nivel de DHA


NUTRICIÓN

- DICIEMBRE 2019

relativo a EPA. Debido a los niveles más bajos de EPA en Schizochytrium sp., las dietas 4–6 se formularon con LSO, que contiene relativamente altas cantidades de ALA, que es un precursor de la síntesis de EPA. Esto se hizo desde que L. vannamei mostrara algunas capacidades de alargamiento y desaturación, aunque esta capacidad se deprime cuando el camarón se alimenta con altos niveles de ALA o LA20. Se cree que esto se debe a un mecanismo de retroalimentación20. De hecho, en este estudio, la LSO dietética no tuvo ningún efecto sobre el contenido de EPA muscular en el camarón. De manera general, este hallazgo coincide con otros estudios que muestra la composición de ácidos grasos de L. vannamei reflejados en la dieta18,21,25,26. Además, en este estudio, los tratamientos dietéticos influyeron significativamente en la mayoría de ácidos grasos del músculo de la cola (MUFA total, PUFA n-6 y relación de n-3/n-6) del camarón blanco del Pacífico. Un estudio anterior sugirió que para la producción de camarón blanco del Pacifico se puede usar una gama de fuentes de lípidos para su crecimiento, pero de una fuente de lípidos con altos niveles de n-3 HUFA y proporciones altas n-3/n-6 para camarón para consumo humano18. En este estudio, el camarón fue alimentado con las dietas 6 y 8 seguido de la dieta 1, mostrando proporciones más altas de n-3/n-6 en el músculo de la cola, en comparación con las otras dietas. Por lo tanto, nuestros resultados indican que la harina de Schizochytrium sp. podría usarse como una mejor fuente que el aceite de pescado para el alimento de camarón ya que proporciona un mejor producto y camarón más saludable para el consumo humano. Los ácidos grasos con un alto grado de saturación son más propensos a la peroxidación lipídica. A pesar de las diferencias de la composición de ácidos grasos en los camarones, con el contenido más bajo y más alto de LC-PUFA en camarones alimentados con las dietas 2 y 8, respectivamente; la cantidad de MDA en el músculo de la cola no se vio afectada por las dietas. Esto puede deberse al hecho de que las actividades SOD y CAT no fueron

Figura 3. Contenido de malondialdehído (MDA) (A) y actividades de superóxido dismutasa (SOD) (B) y catalasa (CAT) (C) en el músculo de la cola de camarón. Los valores son la media ± SE de tres réplicas por grupo. Las letras diferentes encima de cada barra, indican diferencias significativas (p < 0.05).

interrumpidas, ya que estas enzimas son las principales responsables de proteger al animal del estrés oxidativo27. De hecho, la SOD fue significativamente más alta solo para los camarones alimentados con la dieta 7, que correspondió a la mayor actividad de CAT. Se observó un hallazgo similar de mejora en la actividad enzimática antioxidante en L. vannamei, que aquellos alimentados con Schizochytrium sp., junto con una mejor inmunidad innata y resistencia a V. harveyi13. Por lo tanto, las actividades de mayor SOD muscular y CAT en este estudio, también pueden indicar una mejora en el estado antioxidante de los camarones

44

en lugar de una respuesta al estrés. Esto también parece ser compatible en base al hecho de que los parámetros de hemolinfa del camarón (incluyendo albúmina, glucosa, proteína total y globulina), que pueden indicar estrés28, no se vieron afectados en este estudio (data no reportada). Cuando la harina de microalgas era incluida en el nivel más alto (lo probamos) y era la única fuente de aceite, no se encontraron mejoras en SOD y CAT. Esto puede indicar que los niveles utilizados fueron excesivos, pero requieren más investigación. Una de las posibles formas de determinar


NUTRICIÓN

- DICIEMBRE 2019 el estado nutricional de los animales es la composición proximal del animal, incluyendo el conteo de adipocitos, que es una medida del contenido de grasa. Se dispone de información limitada sobre la medición de adipocitos en animales acuáticos, pero el conteo de adipocitos mostró un patrón similar al de los lípidos crudos contenidos de la carcasa del camarón. Sin embargo, solo el conteo de adipocitos se vio afectado por dieta (con un significativo aumento en el conteo de alimento para camarón con las dietas 3 y 7). Un aumento en el conteo de adipocitos podría deberse a una mejora de reservas de energía o la disminución de digestión lipídica. En base a este último, la digestión de ácidos grasos está muy influenciada por la longitud de carbono y el grado de saturación en el camarón tigre negro, Penaeus monodon29. Generalmente, la LC-PUFA tiende a tener una digestibilidad más baja que SFA y MUFA, lo que disminuye aún más al aumentar la longitud del carbono29. Sin embargo, los conteos altos de adipocitos encontrados en la dieta 3 suministrada a camarones, no mostraron ningún patrón relacionado con la longitud del carbono, saturación, o cualquier tipo, grupo o relación de ácidos grasos únicos. Además, para los camarones alimentados con la dieta 3, el mayor número de tejido adiposo subepidérmico no estaba relacionado con el crecimiento. Se requieren investigaciones adicionales para dilucidar la causa de un mayor conteo de adipocitos en la dieta 3. Alternativamente, el alto contenido de DHA en los camarones alimentados con las dietas 7 y 8 puede haber llevado a una digestibilidad más baja. y, por lo tanto, una acumulación de lípidos. Una disminución en la digestibilidad es consistente con la alta actividad de la lipasa intestinal encontrada en camarones alimentados con estas dos dietas, pero particularmente en camarones alimentados con la dieta 8, que contenía la mayor cantidad de DHA. Los crustáceos tienen la capacidad de modificar sus enzimas digestivas, como lo demuestra la langosta, Cherax quadricarinatus30 y L. vannamei31. Por ejemplo, la inclusión de ingredientes dietéticos de origen vegetal, como ya que

el sorgo, la harina de canola, la levadura de cerveza, harina de soya o la harina de lupino, han demostrado una mayor actividad de la lipasa en el hepatopáncreas e intestino medio de C. quadricarinatus30, mientras que la actividad de la lipasa disminuyó en L. vannamei alimentado con niveles crecientes de extracto de levadura31. Sin embargo, aumentar la harina de Schizochytrium a expensas del FO, no tuvo efecto sobre la actividad de leucina aminopeptidasa intestinal/ hepatopancreática o la actividad de fosfatasa alcalina, o sobre actividad de tripsina o amilasa hepatopancreática en larvas de L. vannamei, lo que puede interpretarse como si las microalgas no tuvieran efectos adversos en su estado nutricional10. Además de los camarones que tienden a tener un mayor contenido de lípidos en dietas con niveles más altos de harina de Schizochytrium, todos los camarones alimentados con una dieta que contenía alguna harina de microalgas tenían un contenido significativamente menor de humedad y cenizas que aquellos alimentados con la dieta control. Este hallazgo podría indicar una mejora en la osmorregulación; ya que, a elevadas salinidades, los camarones necesitan eliminar el exceso de minerales. De hecho, el uso de altos niveles de LC-PUFA en dietas, mejora la osmoregulación en salinidades bajas y altas en varios crustáceos32,33, incluido L. vannamei34. Algunos de los posibles mecanismos por los cuales esto puede ocurrir incluyen una membrana celular más fluida que mejoraría las actividades enzimáticas, una mayor área de superficie branquial y posiblemente un mejor estado nutricional general34. Esto merece más investigación ya que L. vannamei se puede cultivar en varias condiciones de salinidad, aunque un enfoque particular en aguas de baja salinidad, serían beneficiosas ya que la producción de camarón en tierra (aguas de baja salinidad) se ha convertido en una industria emergente en todo el mundo20. También es importante tener en cuenta que la harina de microalgas contiene no

45

solo aceite, sino también otros compuestos bioactivos, que incluye aminoácidos esenciales, vitaminas, pigmentos, fenólicos, poliaminas, etc.35. Por lo tanto, es posible que las respuestas fisiológicas de los camarones en este estudio, incluido el crecimiento, la actividad enzimática, la peroxidación lipídica y la composición proximal, también pueden estar influenciadas por alguno o todos estos factores y requiere de un estudio molecular específico.

Conclusión

En conclusión, la harina de Schizochytrium sp. se puede usar para reemplazar completamente el FO sin comprometer el crecimiento. Entre las dietas probadas en este estudio, la dieta que contiene el segundo nivel más alto de harina de microalgas combinado con SBO proporcionó los mejores beneficios en términos de un ligero crecimiento mejorado y una actividad enzimática antioxidante significativamente más alta, actividad de lipasa y contenido de LC-PUFA, así como indicios de más energía disponible. Por otra parte, el camarón blanco del Pacífico mostró mayores proporciones de n-3/n-6 en el tratamiento 6 (harina de algas y dieta basada en LSO) y 8 (solo dieta basada en harina de algas como fuente de lípidos) en el músculo de la cola, que hace al marisco más saludable y preferido para consumo humano. Este estudio, por lo tanto, demuestra que la harina de Schizochytrium sp. puede ser superior al ingrediente tradicional, FO, en dietas de L. vannamei, proporcionando una mejor calidad del camarón como alimento más saludable. Considerando el costo relativamente alto de la harina de Schizochytrium sp., se podría investigar más sobre las proporciones óptimas con SBO para mejorar la rentabilidad de balanceados●

Este artículo es un extracto del original, para mayor información tomar contacto con: vikaskumar@uidaho.edu


PRODUCCIÓN

- DICIEMBRE 2019

Baja de Hsp70 reduce la tolerancia al pH bajo y salinidad en postlarvas de Litopenaeus vannamei Autores: Kou Aishia,b , Saranya Sinnasamyb , Thomas H. MacRaed , Tengku Sifzizul Tengku Muhammadb, Aijun Lva , Jinfeng Suna , Shuaijun Chena , Hongyue Shia, Tan Min Paub,c, Muhd Danish-Daniel Abdullahb,c , Yeong Yik Sunga,b,* Laboratorio de Tianjin de Aqua-Ecología y Acuacultura, Escuela de Pesquerías, Universidad Agrícola de Tianjin, Tianjin 300384, China a

Instituto de Biotecnología Marina, Universidad de Malasia Terengganu (UMT), 21030 Kuala Nerus, Terengganu, Malasia b

Escuela de Ciencias de Pesca y Acuicultura, Universidad de Malasia Terengganu (UMT), 21030 Kuala Nerus, Terengganu, Malasia c

Departamento de Biología, Universidad de Dalhousie, Halifax, NS B3H 4R2, Canadá d

yeong@umt.edu.my

E

l camarón blanco Litopenaeus vannamei es una especie importante en acuicultura (Zhou et al., 2012). Debido a su tolerancia a la salinidad que van de 0.5 a 50 mg/l, el cultivo de L. vannamei en aguas salinas, es una industria emergente (Saoud et al., 2003). Aunque el cultivo de L. vannamei ha tenido éxito, existen varios problemas en la producción comercial. Por ejemplo, el crecimiento y el desarrollo pueden ser negativamente afectados cuando el camarón se cría en condiciones no óptimas (Chao et al., 2007). El camarón con inmunidad comprometida como resultado del estrés abiótico es más susceptible a enfermedades e infecciones, lo que lleva a la mortalidad en masa (PoncePalafox et al., 1997; Chao et al., 2007, 2008). Como ejemplo, la Enfermedad de Necrosis Hepatopancreática Aguda (AHPND, por sus siglas en inglés), conocida como Síndrome de Mortalidad Temprana (EMS), es causada por una cepa única de Vibrio parahaemolyticus y ha causado mortalidades masivas de camarón en todo el mundo (FAO, 2014, 2016). La investigación de los factores de riesgo responsables del brote y la propagación de la enfermedad reveló que la gravedad de la AHPND, además de los reproductores, calidad de postlarvas y manejo de la granja, está correlacionada con las fluctuaciones del pH, el amoníaco y la salinidad (Putth y Polchana, 2016). Al manejar estos factores, la producción de camarón aumenta como resultado de una mejora general en la salud.

48

El choque térmico de proteína 70 (Hsp70), para la cual varias subfamilias o isoformas existen, juega un papel importante en la protección de los peces, camarón y moluscos contra el estrés biótico y abiótico (Sung y MacRae, 2011; Sung et al., 2011). Un choque térmico no letal (NLHS) es utilizado para inducir la síntesis de Hsp70 y, por lo tanto, preparar a los organismos acuáticos para resistir varios tipos de estrés, normalmente letales. Como ejemplos, la inducción de Hsp70 mejora la termotolerancia en peces (Kampinga et al., 1995; Sung et al., 2012), confiere resistencia al estrés letal de amoníaco en la carpa común, Cyprinus carpio (Linn), el camarón de salmuera Artemia (Clegg et al., 2000; Iryani et al., 2017) y bivalvos (Clegg et al., 1998; Aleng et al., 2015) y protege a L. vannamei contra metales pesados ​​(Sung et al., 2018). Hsp70 claramente funciona en la tolerancia al estrés, y aunque el mecanismo no se entiende completamente, es probable que esté relacionado con la homeostasis celular que incluye el plegamiento adecuado, localización y degradación de proteínas. La interferencia de ARN (ARNi) permite la eliminación de proteínas específicas en células (Ketting et al., 2001; Hannon, 2002; He y Hannon, 2004) y se ha aplicado al estudio de la función de Hsp70 durante la exposición de organismos acuáticos a estrés abiótico y biótico. Como un ejemplo, el uso de ARNi reveló el rol de Hsp70 en la tolerancia al calor y la resistencia a Vibrio en nauplios del camarón de salmuera, Artemia franciscana


PRODUCCIÓN

- DICIEMBRE 2019 (Iryani et al., 2017). La caída o baja de Hsp70 no afecta ni el desarrollo embrionario ni la viabilidad de nauplios A. franciscana, pero la supervivencia de nauplios que carecen de Hsp70 es reducido a un 41% por estrés de calor y 34% por infección por Vibrio campbellii, en comparación con los animales que contienen Hsp70 (Iryani et al., 2017). En este estudio, los ARNds de Hsp70 y Hsc70 que se administraron mediante microinyección a las postlarvas de L. vannamei se mostraron mediante electroforesis SDS con gel de poliacrilamida e inmunoprobing de Western blots para suprimir a Hsp70 y Hsc70, respectivamente. Se examinaron luego, los efectos de la reducción de Hsp70/Hsc70 en postlarvas de L. vannamei en su tolerancia a pH bajo y salinidad.

Materiales y métodos

Mantenimiento de L. vannamei Postlarvas, etapa donde el camarón blanco L. vannamei está completamente desarrollado y mide aproximadamente 1 cm de longitud, se aclimataron en el laboratorio de la Universidad Malaysia Terengganu durante 1 semana antes de su uso en experimentos. Dos individuos por litro de agua de mar fueron mantenidos en tanques de 500 l de fibra de vidrio a 28 °C ± 1 °C, pH 7.8–8.0 y salinidad de 32‰. Las postlarvas se sembraron a una densidad de 2000 individuos/l y se alimentaron a saciedad con nauplios de Artemia viva dos veces al día. Preparación de ARNds Hsc70 y Hsp70 El ARN se extrajo de tejidos caudales de L. vannamei con el reactivo (Bioline) TRIsure ™ y los ADNc se sintetizaron usando un Kit de síntesis de ADNc Tetro (Bioline). El ADNc de Hsp70 se amplificó usando el primer delantero(5′-TAATACGACTCACTATA GGCTCCTGCGTGGGTGTGTT-3′) y el primer reversa(5′-TAATACGACTCACTATAGGGCG GCGTCACCAATCAGA-3‘), mientras que el ADNc de Hsc70 se amplificó utilizando el primer (5′-TAATACGACTCACTATAG GCATCGTAGATCATTCCGC-3′) y el primer reversa (5′-TAATACGACTCACTATA GGGGTCTGGAATGGTTTACTGA-3′), cada uno con el promotor T7, TAATACGACTCACTATAGG, en el extremo 5’ (Bioline). Los primers se construyeron sobre la base de secuencias de nucleótidos de Hsp70 y Hsc70 de L.

vannamei disponibles en la base de datos del NCBI Genebank con el número de acceso AY645906.1 y EF495128.1 (Fig. 1). Las secuencias que se usaron para hacer el los ARNds de Hsp70 y Hsc70 se especifican en las Fig. 1A y B. Se realizó PCR con MyTaq Mix (Bioline) según las instrucciones del fabricante como se detalla a continuación: 2 min a 95 °C seguido de 35 ciclos a 95 °C por 30 s, 55 °C por 30 s y 72 °C durante 2 min, seguido de 10 min a 72 °C. El producto de la PCR se resolvió en gel de agarosa al 1% (p/v) en 1 × TBE (20 mM TRIS, 10 mM ácido acético, 0.5 mM EDTA, pH 8.5) a 90 V durante 45 min y teñido con bromuro de etidio (Sigma Aldrich) de acuerdo con las recomendaciones del fabricante previo a la visualización con un Gel Doc™ XR + con Software Image Lab™ (BioRad). Se observó en los geles de agarosa, bandas fuertes de tamaños esperados para los ADNc, los mismos que eran 120 pares de bases para Hsp70 y 98 pares de bases para Hsc70. Los productos de la PCR se usaron como plantillas para generar ARNds usando el kit ARNi MEGAscript® (Ambion Applied Biosystems). La reacción mezcla se incubó a 37 °C durante 4 h seguido de 5 min a 75 °C y enfriándose a temperatura ambiente. El ARNds se trató con nucleasa para eliminar el ADN residual y el ARN monocatenario, seguido de purificación (Ambion Applied Biosystems). El ARNds se visualizó en el sistema de documentación de gel después de electroforesis en gel de agarosa y tinción con bromuro de etidio, revelando bandas fuertes del tamaño esperado. El ARNds específico para Hsc70 se generó utilizando el primer (5′- TAATACGACTCACTATA GGCATCGTAGATCATTCCGC-3′) y primer de reversa (5′- TAATACGACTCACTATAG GGGTCTGGAATGGTTTACTGA-3’) mientras el ARNds específico para Hsp70 se generó utilizando el primer delantero (5′TAATACGACTCACTATAGGCTCCTGCGTGGGTG TGTT-3′) y primer de reversa(5′-TAATACG ACTCACTATAGGGCGGCGTCACCAATC AGA3’), con condiciones de PCR como se describe anteriormente (Qian et al., 2012). Inyección de ARNds Hsc70 y Hsp70 a L. vannamei Las postlarvas fueron inmovilizadas en agar frío al 3% (p/v) (King y MacRae, 2012) y

49

colocadas en un microscopio estereoscópico Olympus SZ61. Para la inyección de ARNds específicos para Hsp70 y Hsc70, se mezclaron por separado en una relación 1:1 (v/v) con 0.5% (p/v) de solución salina tamponada rojo fenol en fosfato de Dulbecco (DPBS) (SigmaAldrich) (King y MacRae, 2012). Luego 1 μl de solución que contiene aproximadamente 80 ng de Hsc70 o ARNds Hsp70 fue inyectada en el 4º segmento abdominal de L. vannamei con un micromanipulador (sistema de microinyector Eppendorf TransferMan® NK 2, Alemania) conectado a un microscopio Olympus® IX 71 (Alemania). Las postlarvas que recibieron ambas ARNds Hsc70 y Hsp70 fueron inyectadas con 0.5 μl de solución que contenía aproximadamente 40 ng de Hsc70 y 40 ng de ARNds Hsp70. Las postlarvas inyectadas, fueron monitoreadas durante al menos 2 h y aquellas que exhibían un comportamiento normal de natación fueron seleccionadas para su uso en experimentos. Verificación de quiebre de Hsc70 y Hsp70 Se tomaron muestras de tejidos de camarón del área caudal 48 h después de la inyección de ARNds y se homogenizaron en tampón frío K (10 ml de agua estéril, 0.27 g sorbitol, 0.16 g de gluconato de potasio, 0.07 g de MgCl2, 7 mg de NaH2PO4, 95 mg de cóctel de HEPES compuesto por un inhibidor de proteasa (Calbiochem, EE. UU.), a una ratio de 1:10 con respecto al tampón K (Sung et al., 2008). Los tejidos fueron homogeneizados durante 5 minutos en hielo y los tubos se centrifugaron a 2000 × g durante 5 minutos. Los sobrenadantes que contenían proteínas se almacenaron a -80 °C. Electroforesis SDS en gel de poliacrilamida y prueba de western blots Alícuotas de homogeneizado se combinaron con volúmenes iguales de 2 veces el buffer muestra con dodecil sulfato de sodio (SDS) (Laemmli, 1970), agitado en vórtex, calentado a 95 °C durante 5 min, enfriado y centrifugado durante 30 s. Se cargó quince microlitros de muestra que contenía 50 μg de proteína por carril de geles de poliacrilamida SDS al 10% y electroforesis a 120 V por 15 min seguidos de 150 V durante 45 min. Se corrieron dos geles simultáneamente uno de los cuales se tiñó con Coomassie Biosafe (Laboratorios Bio-Rad) y el otro se transfirió a una membrana de fluoruro de polivinilideno


PRODUCCIÓN

- DICIEMBRE 2019

(Bio-Rad Immun-Blot PVDF). Las membranas fueron incubadas en un buffer de bloqueo (50 ml de solución salina tamponada con fosfato que contiene 0.2% (v/v) de Tween-20 y albúmina de suero bovino al 5% (p/v) durante 60 min a 25 °C y se lavó con 0.1 M Tris-HCL (pH 7.6) durante 15 min. Las membranas lavadas se incubaron en anticuerpo primario durante 2 ha 4 °C, lavadas con 0.1 M Tris-HCL (pH 7.6) durante 15 min, incubadas en anticuerpo secundario durante 2 h a 4 °C y se lavó nuevamente con Tris-HCL 0.1 M (pH 7,6) durante 15 min. Se utilizó un anticuerpo monoclonal (Thermo Scientific MA3-006) diluido 1:5000 en TrisHCL para detectar Hsp70 y Hsc70. El conjugado HRP y el anticuerpo IgG de cabra antiratón F(ab)2 (Bioreagents-SAB100 J), diluido 1:2000 en Tris-HCL se utilizó como anticuerpo secundario. Para detección, tetrahidrocloruro de diaminobencidina (DAB) fue utilizado como sustrato en asociación con 0.01% (v/v) de H2O2 en 0.1 M TrisHCL (pH 7.6) (Sung et al., 2007; Sung et al., 2008). Densitometría Las manchas se escanearon con un densitómetro calibrado GS-800 (BioRad Laboratories, EE. UU.) y la cuantificación se realizó midiendo las densidades de banda con el software Quantity One (Laboratorios BioRad, EE. UU.). Las cantidades de proteínas inmunorreactivas en los tejidos de camarón se presentaron como densidad reflectante/ mm2, valor generado por el software Quantity One. Experimento de pH Se realizó un ensayo estático a corto plazo sin recambio de agua para determinar el pH medio-letal en 24 y 48 h en postlarvas (Sung et al., 2018). El agua de mar con un pH de 3.5, 3.8 y 4.0 fue preparada agregando 40% de HCl a 30 mg/l de agua de mar. Se incubaron veinte postlarvas en estas soluciones, con temperatura, salinidad del agua y OD respectivamente mantenidas a 28 °C, 30 (± 0.1) mg/l y 6.5 (± 0.1) mg/l. Los camarones control se mantuvieron a un pH 8.0 y se determinó la mortalidad después de 24 y 48 h de incubación. Los camarones moribundos se contaron como muertos y el porcentaje de supervivencia se calculó como (Número de camarones vivos/Total número

Fig. 1. Secuencia de L. vannamei (A) Hsp70 y (B) Hsc70. El subrayado marrón y rojo muestra las regiones del gen utilizado para generar ARNds Hsp70 y Hsc70 respectivamente de 120 y 94 pares de bases. (Para la interpretación de las referencias al color en esta leyenda de la figura, se remite al lector a la versión web de este artículo).

50


PRODUCCIÓN

- DICIEMBRE 2019 de camarones × 100). Los tratamientos que causaron 50-60% de mortalidad a las 24 h produjeron un pH medio letal 24 h. Los experimentos se realizaron en triplicado. Se determinó que el pH medio letal de 24 h era 3.8 y esto se usó en las pruebas de experimentación de pH de postlarvas tras la eliminación de Hsp70 por ARNi. Las pruebas se realizaron en dos experimentos separados y el porcentaje de supervivencia determinado como se describe. Prueba de salinidad Se realizó un ensayo estático a corto plazo sin recambio de agua para determinar la concentración mediana-letal de 24 y 48 h de salinidad para postlarvas (Sung et al., 2018). Se preparó agua de mar con una salinidad de 0 ppt, 0,5 ppt, 1 ppt, 1,5 ppt, 2 ppt y 3 ppt mezclando agua de mar con agua dulce clorada. Se incubaron veinte postlarvas en estas soluciones, manteniendo la temperatura, el pH del agua y el OD respectivamente a 28 °C, 8.0 y 6.5 (± 0.1) mg/l. El grupo control se mantuvo a 30 mg/l y la mortalidad se determinó después de 24 y 48 h. Los camarones moribundos se contaron como muertos y se calculó la supervivencia como (Número de camarones vivos/ Número total de camarones × 100). Las concentraciones salinas que causaron 5060% de mortalidad después de 24 h se denominaron concentraciones letal mediana de 24 h. Los experimentos se realizaron por triplicado. La concentración mediana letal de 24 h fue 1.0 ppt y esta condición se usó en las pruebas de experimentos de salinidad con postlarvas. Las pruebas se realizaron en dos experimentos separados y el porcentaje de supervivencia determinado como se acaba de describir. Recolección de data y análisis estadístico Los valores de supervivencia de las postlarvas fueron puestas en arcsin (inverso de la función seno), para satisfacer la normalidad y los requisitos de homocedasticidad siempre que sean necesarios. Se investigaron diferencias significativas en términos de supervivencia realizando ANOVA de un solo sentido, seguido de la prueba de Tukey a un nivel de significancia de 0.05. Todo el análisis fue realizado con el software de análisis estadístico versión SPSS® 20.0 para Windows®.

Fig. 2. Microinyección de ARNds en el cuarto segmento abdominal de postlarvas de L. vannamei. Los ARNds se mezclaron con una solución salina tamponada de rojo fenol en fosfato de Dulbecco (DPBS) (Sigma-Aldrich) en una proporción 1:1 (v/v). (A) Postlarvas colocadas en agar enfriado antes de la inyección; (B) Postlarvas 2 h después de la inyección de ARNds.

Resultados La inyección de ARNds Hsc70 y Hsp70 no afectó la supervivencia de postlarvas Las postlarvas inyectadas con ARNds (Fig. 2A) mostraron coloración roja en todo el cuerpo (Fig. 2B) y esto indicó que el ARNds era retenido y disperso dentro del organismo. Todos los animales que mostraron comportamiento de natación normal y sobrevivieron al menos 48 h después de la inyección, fueron utilizados en experimentos. La microinyección de ARNds redujo la cantidad de Hsc70 y Hsp70 en postlarvas La inyección de postlarvas por separado con ARNds Hsc70 y Hs70 redujo respectivamente Hscp70 y Hsp70 en aproximadamente 56.8% y 39.4%. El inmunoprobing de Western blots (Fig. 3A y B) reveló que la inyección de postlarvas con Hsp70 y ARNds Hsc70 redujeron la cantidad de Hsp70/Hsc70 en aproximadamente 85.9%, 48 h después de la inyección.

51

La caída de Hsc70 y Hsp70 redujo la tolerancia de postlarvas a estrés de pH La exposición al pH 3.8 mató aproximadamente al 50-60% de postlarvas dentro de las 24 h (Fig. 4A) y 48 h (Fig. 4B) y este pH fue considerado por lo tanto, como el pH medio-letal para postlarvas. Después de 24 y 48 h la supervivencia de las postlarvas con la caída de su Hsp70 y Hsc70 fue aproximadamente de 30% y 10% respectivamente, que es un 20% menos que los animales que contienen Hsp70/Hsc70. La caída de Hsc70 y Hsp70 redujo la tolerancia de postlarvas al estrés de salinidad La exposición a 1 ppt de salinidad mató aproximadamente al 48% y 60% de las postlarvas dentro de las 24 h (Fig. 5A) y 48 h (Fig. 5B) respectivamente, por lo tanto, esta concentración se consideró como la concentración de salinidad mediana-letal de 24 h. Después de 24 y 48 h la supervivencia de las postlarvas con la caída de su Hsp70 y Hsc70 fue aproximadamente del 25%, que


PRODUCCIÓN

- DICIEMBRE 2019

es respectivamente 25% y 15% menos que los animales que contienen Hsp70/Hsc70.

Discusión

Los L. vannamei que carecían de Hsp70 y Hsc70 fueron evaluados por su capacidad de sobrellevar el estrés del pH y salinidad. La inyección de ARNds Hsp70 y Hsc70 en el cuerpo no causó mortalidad, lo que indica que estos ARNds no fueron perjudiciales para el camarón, hallazgo similar a los observados para Artemia inyectada con ARNds Hsp70 (Iryani et al., 2017). Aunque la microinyección de ARNds redujo la cantidad de Hsp70, fue crucial para determinar la cantidad de ARNds que no mata postlarvas por optimizar la concentración de ARNds utilizada previo a los experimentos. Además, se probó el sitio para inyectar ARNds en tejidos de camarón para una eliminación efectiva. El segmento 4 del abdomen del camarón fue el adecuado para la inyección de ARNds. El camarón retuvo fenol rojo 24 h después de la inyección, lo que indica que el ARNds se administró con éxito y fue distribuido por todo el cuerpo del camarón, similar a lo observado en Artemia (King y MacRae, 2012; Iryani et al., 2017).

Fig. 3. Hsp70 en postlarvas L. vannamei 48 h después de la inyección de ARNds. (A) Extractos de proteína se resolvieron en geles de SDS poliacrilamida y se tiñeron con Coomassie Biosafe. Se puso aproximadamente 50 μg de proteína en cada carril. (B) Extractos de proteína resueltos en geles se transfirieron a membranas de PVDF y se incubaron con un anticuerpo contra Hsp70. El control, postlarvas inyectadas con solución salina; Hsc70, postlarvas inyectadas con 80 ng de ARNds Hsc70; Hsp70, post larvas inyectadas con 80 ng ARNds Hsp70; Ambas, postlarvas inyectadas con 80 ng de ARNds Hsc70 y Hsp70. M, patrones de masa molecular en kDa. La figura es representativa de los resultados de dos experimentos separados.

Según lo revelado por el inmunoprobing de wester bots, el Hsp70 y Hsc70 se redujeron aproximadamente 80%, 48 h después de la inyección con 80 ng de cada ARNds de Hsc70 y ARNds Hsp70. Estos resultados demostraron que las construcciones de ARNds fueron efectivas para reducir Hsp70 en postlarvas, resultados similares a los obtenidos con la etapa adulta de L. vannamei (Junprung y Supungul, 2017). En Artemia, el Hsp70 se eliminó cuando se administraron cantidades similares de ARNds en la bolsa ventral de hembras adultas, lo que resultó en la producción de quistes y nauplios sin Hsp70 (Iryani et al., 2017). En otro estudio, la inyección con 80 ng de ARNds p26 efectivamente disminuyó p26 en quistes de Artemia, lo que dio como resultado una liberación de quistes tardía en hembras, terminación espontánea de diapausia después de una incubación prolongada de quistes en agua de mar y reducida resistencia a estrés (King y MacRae, 2012). Tomados en

Fig. 4. pH medio-letal para postlarvas de L. vannamei. Postlarvas aclimatadas a pH 8.0 se expusieron a pH 3.5, 3.8 y 4.0, con la supervivencia determinada después 24 h (A) y 48 h (B) contando los animales que nadan. La data presentada corresponde a ± desviaciones estándar medias y las barras de error representan la SD correspondiente de 3 réplicas. El experimento se realizó por triplicado.

52


PRODUCCIÓN

- DICIEMBRE 2019 conjunto, los resultados muestran que ARNi es una técnica efectiva para noquear Hsp70 en camarón y otros artrópodos, incluidos los insectos (Sim y Denlinger, 2009). La caída de Hsp70/Hsc70 redujo significativamente la supervivencia del camarón sobre el estrés de pH y salinidad, lo que demuestra que estos chaperones moleculares se requieren para protección contra estas tensiones abióticas. Varios estudios han revelado la importancia de Hsp70 en respuesta al estrés abiótico en camarón. Como un ejemplo, la acumulación de elementos constitutivos y Hsp70s inducible, concomitantemente con Hsp60 y Hsp90 con estrés de pH, protege L. vannamei contra el estrés oxidativo inducido por el pH (Qian et al., 2012). Un choque térmico no letal (NLHS) a 38 °C durante 30 min con 8 h de recuperación a temperatura ambiente, induce la síntesis de Hsp70 y promueve la tolerancia contra estresores abióticos y bióticos en postlarvas de L. vannamei (Sung et al., 2018). La mejora de Hsp70 en tejidos de camarón los protege contra estrés abiótico, aumentando la supervivencia de las postlarvas al 65% tras 1 h de exposición a 14.2 mg/l de NH3, concentración letal (LC) para esta especie. NLHS también mejoró la tolerancia de larvas de L. vannamei a metales pesados, con la supervivencia de animales enriquecidos con Hsp70 aumentando de 5 a 15% sobre los controles sin choque térmico en una prueba de LC50 Cu y Zn de 24 h. NLHS indujo termotolerancia en postlarvas de L. vannamei, aumentando la supervivencia de 36% al 84%, un aumento de dos veces tras la exposición al calor a 40 °C, la temperatura letal de 1 h (LT50) (Sung et al., 2018). El NLHS agudo y crónico protege a L. vannamei contra una cepa causante de AHPND de V. parahaemolyticus, con aumento de la supervivencia 30% más que los controles no calentados en el día 3 después de la recuperación. El NLHS crónico, a diferencia del NLHS agudo, prolongó la protección hasta el día 30 después de la recuperación, el período experimental más largo realizado en el estudio.

Fig. 5. Salinidad mediana-letal para postlarvas de L. vannamei. Postlarvas aclimatadas a una salinidad de 30 ppt fueron expuestas a 0, 0.5, 1.0, 2.0 y 3.0 ppt con supervivencia determinada después de 24 h (A) y 48 h (B) contando los animales nadadores. La data presentada corresponde a ± desviaciones estándar medias y las barras de error representan la SD correspondiente de 3 réplicas. El experimento se realizó por triplicado.

La supresión de los genes Hsp70 y Hsp90 disminuyó la actividad de PO y eliminó la tolerancia a V. parahaemolyticus, lo que sugiere que estos dos grupos de proteínas de estrés juegan un papel importante en los mecanismos de defensa bacteriana de camarón Peneido (Junprung y Supungul, 2017). Cómo Hsp70 protege al camarón contra el estrés abiótico y biótico es incierto, pero es probable que Hsp70 evite la desnaturalización de proteínas, asegurando la degradación de proteínas con daños irreversibles (García et al., 2001; Arieli et al., 2003; Sejerkilde et al., 2003; Malyutina et al., 2005; Banti et al., 2008; Shiber y Ravid, 2014; Craig, 2018). El mantenimiento de la homeostasis celular durante las perturbaciones ambientales es vital para garantizar la supervivencia de organismos acuáticos, incluido el camarón (Sung, 2014; Sung et al., 2018).

53

Conclusiones Los resultados de este estudio demostraron que se requiere de Hsp70 para salvaguardar L. vannamei contra el estrés de la salinidad y del pH. Es necesario trabajos futuros para definir el rol mecánico del camarón Hsp70 durante el estrés ya que comprendiendo cómo funciona Hsp70 se puede ayudar en el desarrollo de métodos no invasivos para aumentar la tolerancia al estrés durante alguna perturbación ambiental, una causa común de mortalidad de camarón en todo el mundo●

Este artículo es un extracto del original, para mayor información tomar contacto con: yeong@umt.edu.my


PRODUCCIÓN

- DICIEMBRE 2019

La importancia de la salinidad en la acuacultura Autor: Claude E. Boyd School of Fisheries, Aquaculture and Aquatic Sciences Auburn University boydce1@auburn.edu

Varias definiciones describen la salinidad como un factor ambiental importante.

En entornos acuícolas, la salinidad del agua del estanque se mide rutinariamente con un refractómetro de salinidad portátil. Foto de Fernando Huerta.

A

quellos involucrados en el cultivo de camarones y otros tipos de acuacultura costera reconocen la salinidad como un factor ambiental de importancia. La mayoría de los acuacultores saben que la salinidad representa la concentración total de sales disueltas en el agua expresada más comúnmente en partes por mil (1 ppt = 1 gramo/litro = 1,000 mg/litro = 1,000 ppm). Recientemente, en un manuscrito sobre el cultivo de camarones para un libro de la serie Oxford University Press sobre crustáceos, me dieron instrucciones de cambiar el uso de parte por mil de salinidad a unidades prácticas de salinidad. Esta experiencia resultó en un estudio rápido de la definición y medición de la salinidad de acuerdo con la literatura oceanográfica. Fue una revelación de cómo los científicos a menudo se preocupan mucho por cuestiones de poca o ninguna preocupación en el uso práctico de los conceptos científicos.

Varias definiciones La salinidad se define comúnmente como la concentración (g/L o ppt) de sales disueltas. La salinidad del agua de mar se definió originalmente alrededor de 1901 por el científico danés Martin Knudsen. La definición se basó en la clorinidad promedio del agua del océano, y se aplica la siguiente ecuación: Salinidad = 0.030 + 1.805 Cl– con Cl– y salinidad expresada en g/L. Esta definición fue modificada a lo largo de los

55

años, y en 1967 por acuerdo internacional, la ecuación de Knudsen se convirtió en: Salinidad = 1.80655 Cl–. En 1978, el Panel Conjunto de Tablas y Estándares Oceanográficos recomendó definir la salinidad en unidades prácticas de salinidad (psu). El psu es una variable sin unidades. Se encontró que una solución de KCl de la misma conductividad eléctrica tenía 32.4256 g de KCl/L de agua destilada, y se suponía que las aguas de la misma conductividad tenían la misma salinidad. El agua de mar estándar (35 ppt) tiene una relación de conductividad con el estándar de KCl de 1.00. Esta relación se puede utilizar para obtener salinidades prácticas de aguas de otros valores de conductividad eléctrica. La diferencia en la salinidad común y las concentraciones prácticas de salinidad en la mayoría de las aguas no será superior al 0,01 por ciento. En 1985, la Comisión Oceanográfica Intergubernamental de la Organización de las Naciones Unidas para la Educación, la Ciencia y la Cultura definió la salinidad absoluta como la relación entre las sales disueltas en el agua de mar y la masa total de agua de mar (kg de sales disueltas/kg de agua de mar). La salinidad absoluta es muy similar a la salinidad práctica en la misma agua, pero un poco menos que la salinidad común. Esto se debe a que la salinidad común se


PRODUCCIÓN informa en g/L, y 1 litro de agua de mar pesa un poco más de 1 kg en el que se basan las concentraciones de salinidad prácticas y absolutas. Por ejemplo, 35 g/kg de salinidad absoluta están a 28 grados-C es 35.8 g/L de salinidad común. Los puntos importantes para tener en cuenta son que después de abandonar la salinidad común, la atención se ha centrado en la definición de la salinidad del agua del océano y la relación de la conductividad eléctrica con la salinidad. La saga de salinidad continuó y F.J. Millero de la Universidad de Miami y algunos colegas desarrollaron la escala de salinidad de composición de referencia, y la Comisión Oceanográfica Internacional la adoptó rápidamente como la nueva definición de salinidad del agua de mar.

- DICIEMBRE 2019 Tabla 1. Salinidad para aguas a diferentes concentraciones de salinidad comunes versus resultados para otras definiciones de salinidad a 28 grados-C.

Método de salinidad Valores de salinidad Común (ppt) 10 20 30 40 Práctico (sin unidades) 9.999 19.98 29.997 39.996 Absoluto (mg / kg) 9.96 19.78 29.46 38.98 Composición de referencia (mg / kg) 10.05 20.07 30.14 40.18 Tabla 2. Densidad del agua (g/L o kg/m3) a diferentes temperaturas y salinidades.

Grados Celsius 10 ppt 20 ppt 30 ppt 40 ppt 10 1,007.53 1,015.30 1,023.08 1,030.89 15 1,006.81 1,014.47 1,022.15 1,029.86 20 1,005.82 1,013.39 1,020.98 1,028.61 25 1,004.58 1,012.08 1,019.60 1,027.15 30 1,003.12 1,010.55 1,018.01 1,025.51 35 1,001.46 1,008.84 1,016.24 1,023.69 40 999.60 1,006.94 1,014.30 1,021.70

La salinidad de la composición de referencia es difícil de visualizar, pero es básicamente un ajuste de la salinidad absoluta y está relacionada con la salinidad práctica mediante la ecuación: Salinidad de composición de referencia = salinidad práctica x 1.004715.

Relevancia para la acuacultura Por lo tanto, veamos las definiciones de salinidad ya que afectan las mediciones de salinidad. Las concentraciones de salinidad comunes de 10, 20, 30, 40 ppt se ajustaron a otros métodos de definición y reporte de salinidad basados ​​en la discusión anterior (Tabla 1). No parece haber diferencias apreciables. La salinidad común y la salinidad práctica son casi idénticas. La salinidad absoluta es un poco más baja que la salinidad común, porque la densidad del agua aumenta con una mayor salinidad (Tabla 2). La salinidad de la composición de referencia es una pequeña cantidad mayor que la salinidad común. En lo que respecta a la acuacultura, no importa cuál de estos métodos de expresión de salinidad se utilice. Si no le importa estar asociado con un antiguo punto de vista sobre la definición de agua de mar, los oceanógrafos sin duda no tendrán ninguna preocupación sobre que lo haga. Por supuesto, las pequeñas diferencias en la notificación de

la salinidad son probablemente importantes para los oceanógrafos en sus muchos modelos de procesos en el océano, y no se pretende criticarlos. El resultado es que la salinidad se puede medir muy fácilmente con un refractómetro de salinidad portátil en las unidades de salinidad comunes de mg/L o ppm, y los valores resultantes son una estimación cercana de la salinidad (suponiendo que el refractómetro esté funcionando correctamente).

Los organismos acuáticos en los estanques tienen una tolerancia a un rango de salinidad, y las diferencias en la salinidad medida y verdadera de décimas de partes por mil pueden tolerarse fácilmente● Esta es la primera parte del artículo salinidad en acuicultura, en la próxima edición le presentaremos la segunda entrega. Este es un extracto del artículo original, para mayor información escriba a: boydce1@auburn.edu

56


PRODUCCIÓN

- DICIEMBRE 2019

Silencio transcripcional de la hormona inhibidora de vitelogénesis (VIH) del subtipo I en el camarón blanco, Litopenaeus vannamei Autores: Bong Jung Kang, Sun-Hye Bae, Tomoya Suzuki, Shuhei Niitsu, Marcy N. Wilder * Centro Internacional de Investigación de Japón para Ciencias Agrícolas, 1-1 Ohwashi, Tsukuba, Ibaraki 305-8686, Japón marwil@jircas.affrc.go.jp

L

a ablación del pedúnculo ocular es un método para eliminar la fuente de la hormona inhibidora de vitelogénesis (VIH), y se usa frecuentemente en la especie de camarón Litopenaeus vannamei con el fin de estimular la maduración ovárica y el desove en cautiverio. En este estudio, evaluamos los efectos del silenciamiento vih usando ARN bicatenario (dsRNA) en hembras de L. vannamei. Se analizaron los niveles de expresión relativa de vitelogenina (vg) y vih en el ovario y pedúnculo ocular, respectivamente y se cuantificaron los niveles de Vg y VIH en la hemolinfa a los 10 y 20 días después de inyectar proteína fluorescente verde de VIH-dsRNA (GFP) - dsRNA (un dsRNA no relacionado con el VIH), o tampón Tris-EDTA (TE). La expresión de vih en pedúnculos oculares se suprimió significativamente a los 10 y 20 días después de la inyección de VIH-dsRNA. Los niveles de hemolinfa VIH aumentaron significativamente a los 10 días después de la inyección de VIH-dsRNA, y luego disminuyeron a los niveles iniciales. Sin embargo, no hubo diferencias significativas en los niveles de Vg en la hemolinfa o vg ARNm en el ovario. En los crustáceos decápodos, el control de la maduración de hembras en cautiverio sigue siendo un problema difícil que actualmente se está abordando en la industria acuícola. Panouse (1943) informó por primera vez, hace más de 70 años, que la remoción de pedúnculos oculares promueve la maduración ovárica en los

58

crustáceos decápodos. Por esa razón, se ha considerado generalmente que un factor supresor se produce en los pedúnculos oculares, denominado hormona inhibidora de vitelogénesis (VIH). Actualmente se encuentra disponible muchos informes sobre la identificación y caracterización de moléculas del VIH en decápodos (por ejemplo, Keller, 1992; Subramoniam, 2011; Tsutsui et al., 2007). El VIH es una hormona peptídica que se manifiesta y sintetiza en el complejo del órgano-X de la glándula sinusal en los pedúnculos oculares, que luego se secreta a la hemolinfa. El órgano-X de la glándula sinusal también sintetiza la hormona hiperglucémica en crustáceos (CHH), la hormona inhibidora de la muda (MIH) y la hormona inhibidora de órganos mandibulares (MOIH), todos los cuales son miembros de la familia CHH. Los péptidos maduros de la familia CHH tienen una estructura similar que comprende 7278 residuos de aminoácidos que exhiben seis posiciones de cisteína conservadas. Los péptidos de la familia CHH también se dividen en dos subtipos: los que tienen en el péptido maduro un residuo de glicina en la posición 12 (subtipo-II), y los que no (subtipo-I). Durante la última década, la producción de camarón en todo el mundo ha aumentado año tras año, con una producción de camarón marino y agua salobre superando los 4 millones de toneladas en 2015 (FAO, 2017). La especie de camarón más importante de cultivo en todo el mundo


PRODUCCIÓN

- DICIEMBRE 2019 es el camarón blanco, L. vannamei, que representa más del 75% de la producción anual (FAO, 2017). Para apoyar esta gran industria, es esencial que los laboratorios de camarón produzcan grandes cantidades de nauplios y postlarvas. Por lo tanto, la ablación del pedúnculo ocular se realiza de manera rutinaria porque este procedimiento garantiza la eliminación de la fuente del VIH y permite que continúe la maduración ovárica. Sin embargo, actualmente se buscan alternativas a la ablación del pedúnculo ocular, porque la ablación tiene efectos adversos en el animal y con el tiempo, provoca una reducción de la fecundidad, una disminución de la calidad del huevo y una menor supervivencia de las larvas (Browdy, 1998; Palacios et al., 1999). Además, el procedimiento también es indeseable desde el punto de vista del bienestar animal, cuya conciencia está aumentando entre el público en general (Animals Australia, 2017). Recientemente, se ha reportado mucha investigación base enfocada en los mecanismos reproductivos en una variedad de especies de camarón, y se están intentando varios enfoques nuevos a base de un funcionamiento biológico, como alternativas a la ablación del pedúnculo ocular (Feijó et al., 2016; Tiu y Chan, 2007; Treerattrakool et al., 2008, 2014). Por ejemplo, se informa que la producción de Vg puede acelerarse agregando factores putativos que estimulan la síntesis de Vg (Chen et al., 2018; Makkapan et al., 2011; Sarojini et al., 1995; Vaca y Alfaro, 2000) o eliminando los efectos del VIH mediante ARN de interferencia (RNAI), o el uso de anticuerpos (Feijó et al., 2016; Treerattrakool et al., 2008; Treerattrakool et al., 2014). Nuestro grupo fue el primero en identificar múltiples péptidos de la familia CHH con actividad de VIH en L. vannamei; demostrando que tenían características de subtipo I (Tsutsui et al., 2007). Posteriormente, en Chen et al. (2014) encontraron un VIH clasificado como subtipo-II que tiene una secuencia de aminoácidos deducido que difiere de la del subtipo-I VIH anterior. Feijó et al. (2016) reportaron la supresión de la expresión del subtipo I de VIH usando RNAi lo que llevo a un aumento de la transcripción vg. En este estudio, examinamos la eliminación de VIH del subtipo I más predominante en

L. vannamei (mencionado en Tsutsui et al. (2007), como péptido de la glándula sinusal (SGP) -G) mediante la administración de ARN bicatenario (dsRNA), y se evaluó su uso para inducir la maduración ovárica. Con el fin de brindar más luz sobre el funcionamiento del VIH, también medimos los niveles de transcripción génica de vg en el ovario y vih en pedúnculos oculares, así como sus concentraciones en la hemolinfa después de la inhibición de la expresión de vih usando ARNi. Se considera que este estudio será útil para desarrollar una alternativa factible a la ablación de pedúnculos.

Materiales y métodos Animales Se compraron (hembras adultas) de Litopenaeus vannamei en el laboratorio de Saikaew (Phang Nga, Tailandia) y se mantuvieron en tanques de 600 L con agua de mar natural recirculada (salinidad de 3133 ppt) a 28 °C y un fotoperíodo de 13 h claro/11 h oscuro. Todos los organismos fueron alimentados con una dieta comercial (Goldprawn; Higashimaru Co., Kagoshima, Japón) a una tasa del 3% del peso corporal por día hasta su uso. Antes de su uso, se permitió que los camarones se aclimataran a las condiciones anteriormente descritas durante dos semanas. Para los experimentos, seleccionamos al azar hembras con pesos corporales >35g. Los rangos de peso corporal en cada grupo fueron los siguientes: grupo inicial (grupo no inyectado), 52 a 70 g (58.0 ±3.4 g [promedio±SEM], n = 6); grupo control del vehículo, 44 ​​a 61 g (10 días después de recibir la inyección de tampón TE, 51.0 ± 3.2 g [promedio±SEM]), n = 5) y 44 a 76 g (20 días después, 59.5±5.3 g [promedio±SEM], n = 5); grupo de control negativo, 48 a 56 g (10 días después de recibir la inyección de GFP-dsRNA, 51.6±1.5 g [promedio±SEM], n = 5) y 47 a 72 g (20 días después, 59.4±4.4 g [promedio±SEM], n = 5); y grupo experimental, 46 a 57 g (10 días después de recibir la inyección de VIH-dsRNA, 50.0±2.0g [promedio±SEM], n = 5) y 45 a 59 g (20 días después, 54.7±2.5 g [promedio±SEM], n = 5). El tratamiento de todos los camarones cumplió con las regulaciones del instituto y la política japonesa sobre el uso de animales

59

(Kurosawa, 2007), y los experimentos se llevaron a cabo de acuerdo con las directrices ARRIVE (https: // www.nc3rs.org.uk/arriveguidelines ). Preparación del dsRNA para VIH y GFP La región del marco de lectura abierta (ORF) de vih (SGP-G: el VIH predominante en L. vannamei) se ha amplificado y clonado en estudios previos (Kang et al., 2018; Tsutsui et al., 2013) y el plásmido SGP-G se utilizó como plantilla en la PCR para preparar ADN lineal para la síntesis de dsRNA. El ADN lineal unido al promotor T7 para vih que codificaba péptidos maduros, se amplificó por PCR usando primers específicos del gen unidos al promotor T7, es decir, T7-VIH-L (5′-TAATACGACTCACTATAGGGAGAAAGCGAG CAAACTTCGAC-3′) y T7-VIH-R (5′-TAATACGACTCACTATAGGGAG ACTACTTGCCCACCGTCTG-3′) para vih. Las condiciones iniciales de PCR fueron 94 °C durante 2 min; 40 ciclos de 94 °C por 30 s, 58 °C por 30 s y 72 °C por 30 s; y un final de 72 °C por 3 min. Los fragmentos de ADN amplificados ligados al promotor T7 se purificaron con un kit de purificación de productos de PCR de alta pureza (Roche, Basel, Suiza), de acuerdo con el protocolo del fabricante, luego se usaron como plantillas para la síntesis de dsRNA con el kit MEGAscript RNAi (Ambion, Austin, TX, EE. UU.) según el protocolo del fabricante. Brevemente, los fragmentos de ADN unidos al promotor T7 (0,5-1 µg) se mezclaron con los reactivos de transcripción del kit, incluido el ARN polimerasa T7, y se incubaron a 37 °C durante la noche. El dsRNA sintetizado para vih (VIH-dsRNA) se purificó a través de un cartucho suministrado con el kit anterior de acuerdo con el protocolo del fabricante, finalmente se eluyó con tampón Tris-EDTA (TE) (10 mM de Tris-HCl [pH 7], 1 mM de EDTA) y luego almacenado a -20 °C hasta su uso. Para fines de un control negativo, en este estudio se usó dsRNA correspondiente al gen de la proteína verde fluorescente (GFP). El ADN parcial unido a promotor T7 para GFP se amplificó por PCR usando el plásmido pvasaGFP como molde y primers específicos de gen unidos al promotor T7, es decir, T7-EGFP2L (5′-TAATACGACTCACTATAGGGAGAGCATC GACTTCAAGGAGGAC-3′) and T7-EGFP-2R


PRODUCCIÓN (5′-TAATACGACTCACTAT AGGGAGATGGGTGCTCAGGTAGTGGTT-3′). El plásmido pvasa-GFP (Yoshizaki et al., 2000) fue proporcionado generosamente por el profesor Goro Yoshizaki de la Universidad de Tokio de Ciencia y Tecnología Marina. Para la síntesis de dsRNA para GFP (GPFdsRNA), realizamos el mismo protocolo que el descrito anteriormente para VIH-dsRNA. El diseño experimental y toma de tejido El VIH-dsRNA y GFP-dsRNA sintetizados como anteriormente se detalló, se diluyeron con tampón de elución (tampón TE) para formular una concentración de 1 µg µL-1. Los camarones hembras seleccionados al azar se pesaron y se inyectaron con VIH-dsRNA (grupo experimental) o GFP-dsRNA (grupo de control negativo) a una concentración final de 3 µgg -1 del peso corporal. Como grupo control vehicular, se inyectaron a las hembras con tampón TE a 3 µL por gramo de peso corporal. Todos los especímenes fueron inyectados vía intraperitoneal en el primer segmento abdominal usando una jeringa de insulina ultrafina BD (0.3 mL 29G x 12.7 mm; BD Biosciences, Tokio, Japón). El tejido para el análisis se recogió a los 10 y 20 días después de la inyección de cinco a seis individuos de cada grupo; los individuos no inyectados también se muestrearon como el grupo inicial. Se tomó una muestra de hemolinfa con una jeringa de la esternita abdominal, se transfirió a un tubo de 1.5 ml y se congeló inmediatamente en nitrógeno líquido y se almacenó a -80 °C hasta su uso para la cuantificación de Vg y VIH. Para la purificación total de ARN, se cortó el pedúnculo ocular derecho y el exoesqueleto se eliminó inmediatamente bajo tampón salino (26.30 g L-1 NaCl; 0.75 g L-1 KCI; 2.38 g L-1 HEPES), luego, el tejido se limpió paños delicados (KimWipes; Nippon Paper Crecia Co., Tokio, Japón), se transfirió a un reactivo de estabilización de ARN (RNAlater; Qiagen, Tokio, Japón) y se mantuvo a 4 °C durante la noche antes de almacenar a -80 °C hasta su uso. El ovario y el hepatopáncreas se diseccionaron, pesaron, se cortaron en trozos pequeños en un tampón salino, y se transfirieron al reactivo de estabilización de

- DICIEMBRE 2019 ARN (Qiagen) para la purificación total de ARN, o a la solución de fijación de Davidson (220 mlL-1 formalina; 330 mL L-1 EtOH al 95%; 115 mLL -1 de ácido acético), para análisis histológico. El cuarto par de lóbulos ováricos se seleccionó para el análisis de los niveles de expresión de vg (lóbulo derecho) o el análisis histológico del desarrollo de ovocitos (lóbulo izquierdo). El índice gonadosomático (GSI) se calculó como el peso del ovario (g) / peso corporal (g) x 100%. Examen de expresión del gen vih en pedúnculos oculares usando PCR de punto final El ARN total del pedúnculo derecho se purificó usando un kit RNeasy Mini con digestión DNasa I, de acuerdo con el protocolo del fabricante (Qiagen). Al purificar el ARN total del pedúnculo ocular, el color púrpura que se cree se produce a partir de compuestos pigmentados en el ojo, permaneció en varias de las muestras de ARN total purificadas. Por lo tanto, el ARN total se purificó nuevamente con un kit de limpieza RNeasy MinElute (Qiagen) según el protocolo del fabricante. El ARN total purificado dos veces, independientemente de si el color permaneció o no, se usó para la síntesis de ADNc, usando un kit de ARN a ADNc de alta capacidad (Applied Biosystems, Thermo Fisher Scientific, Tokio, Japón) de acuerdo con el protocolo del fabricante. Para examinar estos efectos de los diversos tratamientos en la expresión del gen vih (SGP-G), se realizó una PCR con ADNc del pedúnculo ocular como plantilla usando polimerasa Takara Ex Taq (Takara Bio Inc., Tokio, Japón). Como control interno, la betaactina (actb) también se amplificó según los mismos métodos. La PCR se realizó en una mezcla de reacción de 20 µl que contenía 2 µl de ADNc del pedúnculo ocular (equivalente a 50 ng de ARN total), 2.5 mM de dNTP, 0.2 µM de cada primer, 0.5 unidades de polimerasa Ex Taq (Takara Bio), y se realizó a 94 °C durante 2 min, seguido de 30 ciclos de 94 °C durante 30 s, 62 °C durante 30 s, y 72 °C por 30 s con primers específicos de genes para qPCR, y luego visualizados en gel de agarosa. Para la amplificación de vih y actb, se utilizaron los siguientes primers de genes específicos: LvsgpGFw (5´-CGGAGTGCAGGAGCAACTG-3´) y

60

LvsgpG-R3 (5´-CCTCTCTGTGTCTTCTG GCCGTTGG-3´) para vih; y Lvact_FO1 (5´-CGACCTCACAGACTACCTGATGAAGAT-3´) y Lvact_R02 (5’-GTG GTCATCTCCTGCTCGAAGT-3´) para actb (Kang et al., 2018). PCR en tiempo real (qPCR) cuantitativa para vih Los niveles de expresión de vih en el pedúnculo ocular se cuantificaron mediante RT-PCR en tiempo real de dos pasos, como se informó anteriormente (Kang et al., 2018). Seguido, el ADNc sintetizado a partir de los pedúnculos oculares (descrito anteriormente en la Sección 2.4) se utilizó como plantilla y se realizó qPCR con TaqMan Fast Universal PCR Master Mix (2x, No AmpErase UNG; Thermo Fisher Scientific) en un Sistema de PCR Fast Real-Time 7500 (Applied Biosystems, Foster City, CA, EE. UU.). Los niveles de expresión de vih y actb se amplificaron en 12 µL de mezcla de reacción que contenía 6 µL de TaqMan Fast Universal PCR Master Mix, 200 nM de primers, 125 nM de sonda y ADNc (equivalente a 50 ng de ARN total). Las condiciones de qPCR fue en un inicio, de una temperatura de 95 °C durante 2 minutos, seguidas de 40 ciclos de 95 °C durante 10 segundos y 60 °C durante 30 segundos para ambos genes. Para la expresión vih y actb, los primers y sondas específicas del gen se usaron de la siguiente manera: el par de primers LvsgpG-Fw y LvsgpG-R3 (ver sección 2.4) y la sonda TaqMan LvsgpG-Prb (5´-TCTACAACCCCGTGTTCG-TCCAGTGC-3´) para vih; y los primers Lvact F01 y Lvact_R02 y la sonda TaqMan Lvact_Prb (5´-CGACCACCGCCGAGCGAG AAATCGTTCGT-3´) para actb. Para trazar curvas estándar para vih y actb, una biblioteca de ADNc de pedúnculo ocular o testículo (Kang et al., 2018) se diluyó en serie a través de una serie de 5 diluciones para obtener seis puntos de data. Las curvas estándar fueron lineales en cinco órdenes de magnitud, basadas en la biblioteca pedundular para vih (asignando valores arbitrarios de 37,000,000 a 11,840) y la biblioteca de ADNc de testículos para actb (asignando valores arbitrarios de 10,000,000 a 3200). Los niveles de expresión de vih se normalizaron a los de actb. Esto se debe a que se ha observado que los niveles de expresión de actb son


PRODUCCIÓN

- DICIEMBRE 2019 estables en los testículos, lo que hace que este tejido sea adecuado para trazar curvas estándar. qPCR para vg Los niveles de expresión de vg en el ovario y el hepatopáncreas se cuantificaron mediante RT-PCR en tiempo real de un solo paso utilizando un kit QuantiFast Probe RTPCR ROX (Qiagen). El ARN total se purificó usando un kit RNeasy Mini con digestión DNasa I (Qiagen) de acuerdo con el protocolo del fabricante, y se usó como plantilla para RT-PCR en tiempo real de un paso. La RTPCR cuantitativa se realizó con 25 ng de ARN total, 0.2 µM de primers y 0,1 µM de sonda, usando el sistema de PCR Fast Real-Time 7500 (Applied Biosystems). El ARNm de Vg y actb se amplificó con el mismo método que el utilizado en nuestros informes anteriores (Kang et al., 2014), usando los siguientes primers y sondas específicas de genes: vg-qF01 (5´-CAGAGAGTCATCGACTACACCATGT-3´), y primers vg-qRO1 (5´-GAATGAG GCGAACGACCTTT-3´), y la sonda TaqMan vgPrb (5´-TTCCA TTCGGAACGAGCATTTGCT-3´) para los primers vg; y primers Lvact_F01 y Lvact_R02 y la sonda TaqMan Lvact Prb para actb como se describe para qPCR para vih (sección 2.5). Las condiciones de PCR fueron 50 °C durante 10 min, 95 °C durante 5 min, y luego 40 ciclos de 95 °C durante 10s y 61 °C durante 30 s para vg o 60 °C durante 30 s para actb.

centrifugación, se recogió el sobrenadante (fracción líquida de hemolinfa) y se usó en la medición por TR-FIA tanto para Vg como para VIH. Para la cuantificación de Vg, se diluyó 1 µL de cada muestra de hemolinfa directamente a 1:2000 con tampón de carbonato (CB) 0.1 M (pH 9.6), y se dispensaron 100 µL en los pocillos del 96-well plate (DELFIA Yellow; Perkin Elmer, Waltham, MA, EE. UU.). Para la cuantificación del VIH, se mezclaron 200 µl de hemolinfa de un solo individuo con un volumen equivalente de acetonitrilo, centrifugado (4 °C, 20,000 x g, 20 min), concentrado por evaporación centrífuga (2000 x rpm, 40 min, 0.08 MPa) a presión reducida para eliminar el acetonitrilo y luego mezclado con 100 µL de ácido tricloroacético al 30%. Después de centrifugar una vez más (4 °C, 20,000 x g, 20 min), el sobrenadante se recogió y se congeló seco. Las muestras pretratadas se disolvieron en 0.4 ml. CB y se dispensaron 200 µl de esta en los pocillos por duplicado (es decir, dos pocillos para cada muestra). En cuanto a las especificaciones de las curvas estándar, la vitelina purificada de L. vannamei varió de 50.1 a 0.0977 ng por pocillo para el ensayo TR-FIA Vg, mientras que el SGP-G recombinante (rSGP-G) varió de 10.0 a 0.0195 ng mL-1 para el ensayo TR-FIA VIH. Para ambos tipos de ensayos, se incubaron muestras y estándares en los pocillos del 96-well plates a 4 °C durante la noche como una etapa de recubrimiento de muestra y luego los pocillos se bloquearon

con tampón de ensayo BSA 1% (Perkin Elmer) para Vg o en tampón de ensayo para VIH. Como anticuerpo primario, el antisuero vitelino de M. japonicus (anti-PjVn) se diluyó a 1:10,000 en ensayo de tampón para el ensayo de TR-FIA Vg, y los anticuerpos policlonales generados contra rSGP-G en L. vannamei se diluyeron a 2µg mL-1 en el ensayo tampón para el ensayo TR-FIA de VIH. El anticuerpo secundario fue marcado como anticuerpo DELFIA Eu-N1 anti-conejo (Perkin Elmer) después de la dilución a 1: 2000 en ensayo de tampón. La incubación en cada paso fue durante 2 horas a 24 °C y los pocillos se lavaron cinco veces durante 3 min a la vez con 0.3 mL de tampón de lavado (50 mM de Tris-HCl, pH 7.8, 150 mM de NaCl, Tween 20 al 0,05%) en una lavadora de microplacas ImmunoWash 1575 (Bio-Rad), durante cada intervalo entre los pasos. Finalmente, se añadió solución de mejora (Perkin Elmer) a la placa y se midió la fluorescencia de Eu a 615 nm mediante un fluorómetro con resolución temporal (Wallac 1420 ARVOSX-d; Perkin Elmer). Análisis histológico El cuarto lóbulo izquierdo del ovario, se fijó en 1 ml de solución de Davidson durante la noche a 4 °C, y se mantuvo en etanol al 70% a temperatura ambiente hasta su uso. Pequeños trozos de ovario se incrustaron en parafina después de la deshidratación a través de una serie graduada de etanol y lemosol. Luego los tejidos fueron seccionados a un espesor de 5 µm, se

Las curvas estándar para vg y actb fueron lineales en cinco órdenes de magnitud para el ARN total diluido en serie del ovario maduro con concentraciones que varían de 1 µg a 10 pg (asignando valores arbitrarios de 100,000 a 1). Todas las muestras se analizaron por duplicado, y el nivel de expresión (media de la cantidad) de vg se normalizó al de actb. Medición de las concentraciones de Vg y VIH en la hemolinfa Las concentraciones de Vg y VIH en la hemolinfa se midieron mediante un fluoroinmunoensayo con resolución temporal (TR-FIA) siguiendo la metodología de un informe previo (Kang et al., 2014). Brevemente, las muestras de hemolinfa congeladas no tratadas se descongelaron, homogeneizaron y se centrifugaron (4 °C, 15,000 x g, 20min). Después de la

Fig. 1. La expresión de vih en los pedúnculos oculares de L. vannamei después de la inyección de tampón Tris-EDTA (TE) o de la proteína fluorescente verde (GFP) -dsRNA o de la hormona inhibidora de la vitelogénesis (VIH) -dsRNA y en el grupo inicial no inyectado. La transcripción de vih se evaluó a los 10 días y a los 20 días mediante PCR de punto final mostrado junto con la del control interno beta-actina (actb). Los asteriscos indican individuos para los cuales el control interno (actb) no pudieron amplificarse. (Para interpretación de las referencias a color en esta figura, el lector debe remitirse a la versión web de este artículo).

61


PRODUCCIÓN hidrataron gradualmente con etanol, se tiñeron con hematoxilina y eosina, y se deshidrataron gradualmente con una serie de etanol y xileno. Se observó el desarrollo de ovocitos bajo un microscopio óptico, de acuerdo a informes anteriores que (Kang et al., 2014). Estadísticas Todos los resultados se expresan como el promedio ±SEM. Se evaluó la significancia de los niveles de expresión y las concentraciones de Vg y VIH en todos los grupos mediante ANOVA unidireccional utilizando el software SigmaPlot 11 (Hulinks Inc., Tokio, Japón). Se probaron diferencias significativas entre el grupo inicial (grupo no tratado) como grupo control versus comparaciones múltiples (cada grupo inyectado), utilizando el método de Dunnett (P < .05) y el método de Dunn (P < .01).

- DICIEMBRE 2019 inyectado con VIH-dsRNA, la transcripción vih no estaba presente en cinco de los cinco individuos, ya sea 10 o 20 días después de la inyección; el actb se amplificó en todos los individuos. Estos resultados indican que, en el camarón en condiciones no tratadas, existen diversos grados de expresión de vih y ofrecen pruebas de que la eliminación completa de la expresión de vih, se logra mediante la inyección de VIH-dsRNA. Dinámica de la expresión y concentración de vih en la realización del tratamiento experimental Para cuantificar los niveles de expresión de vih en pedúnculos oculares, se realizó qPCR y el nivel de expresión de vih se normalizó al de actb (Fig. 2A). Como se describe en la sección 3.1, dos individuos en el grupo tampón TE a los 10 días, para los cuales no

se obtuvo la transcripción de actb, fueron excluidos de los resultados para el análisis de qPCR (Fig. 2A). En el grupo inicial, se demostró que los niveles de expresión de vih eran altos, y no hubo diferencias significativas con el grupo de tampón TE o el de GFP-dsRNA. Sin embargo, la expresión de vih disminuyó significativamente 10 y 20 días después de la inyección de VIH-dsRNA (Fig. 2A). La concentración de VIH en la hemolinfa fue de 84.13 ± 26.62 ng ml-1en el grupo inicial, y las concentraciones no se modificaron significativamente en el tampón TE o los grupos GFP-dsRNA. En el grupo VIH-dsRNA, la concentración de VIH en la hemolinfa fue aumentando significativamente a los 10 días (404 ± 2 203.8 ng mL-1), y luego disminuyó a los 20 días (18.64± 4.106 ng mL-1) (Fig. 2B).

Resultados Efectos del tratamiento experimental sobre la expresión de vih y la evaluación de la eliminación de genes La expresión de vih en el pedúnculo ocular se analizó en todos los individuos mediante PCR de punto final (Fig. 1). Se detectó vih parcial de alrededor de 180 pb en cuatro de los seis individuos del grupo inicial; se observó una transcripción extremadamente baja o nula en los dos individuos restantes. En el grupo inyectado con tampón TE, se detectó la transcripción de vih en dos de cada tres individuos después de 10 días, y en cuatro de cinco individuos después de 20 días. No se observó transcripción para el individuo restante en el grupo de 10 días y para el individuo restante en el grupo de 20 días (nota: en dos individuos a los 10 días en el grupo de tampón TE, tanto el ADNc para vih como para el control interno (actb), no se pudo amplificar por razones desconocidas; esto se indica con asteriscos y se excluyen del análisis anterior). En el grupo inyectado con GFP-dsRNA, se detectó la transcripción de vih en tres de cinco individuos después de 10 días, y en tres de cinco individuos después de 20 días. Se observó una transcripción extremadamente baja o nula para los dos individuos restantes en el grupo de 10 días, y para los dos individuos restantes en el grupo de 20 días. Por otro lado, en el grupo

Fig. 2. Efectos de la inyección de dsRNA sobre los niveles de la hormona inhibidora de la vitelogénesis (VIH). (A) expresión de vih en los pedúnculos oculares. (B) Concentraciones de VIH en la hemolinfa. Los resultados se expresan como la media ± SEM. La data fue analizada mediante ANOVA unidireccional seguido del método de Dunnett (P < .05) y el método de Dunn (P < .01). Las diferencias significativas entre el grupo inicial y el grupo inyectado se indican como (P < .05) o ** (P < .01). Los números entre paréntesis sobre las barras indican el número de individuos analizados.

62


PRODUCCIÓN

- DICIEMBRE 2019 Índice gonadosomático (GSI) y la dinámica de la expresión la concentración de vg después del tratamiento experimental El índice gonadosomático (GSI) aumentó ligeramente de 10 días a 20 días en todos los grupos inyectados; sin embargo, la única diferencia significativa en comparación con el grupo inicial, fue observada en el grupo GFPdsRNA a los 20 días después de la inyección (3.37 ± 0.79%) (Fig. 3A). Los individuos con ovocitos bien desarrollados a los 20 días después de la inyección (definidos aquí como aquellos con GSI 3%) fueron: tampón TE (1 de 5 individuos), VIH-dsRNA (1 de 5 individuos), GFP-dsRNA (3 de 5 individuos) y grupo inicial (sin inyección, 1 de 6 individuos). Expresión de mRNA de vg en el ovario mostró un patrón similar al del GSI, pero no hubo un aumento significativo en ninguno de los grupos inyectados, en comparación con el grupo inicial no inyectado. Aunque los niveles de expresión de vg fueron más altos a los 20 días después de la inyección de GFP-dsRNA, las diferencias no fueron significativas debido a la alta varianza entre las muestras examinadas (Fig. 3B). Los niveles de Vg en la hemolinfa fueron más bajos 10 días después de la inyección TE buffer (22.60 ±11.43 μg mL−1), y luego aumentó a los 20 días después de la inyección de TE buffer (Fig. 3C); sin embargo, ningún grupo difirió significativamente del grupo inicial (426.7±211.9 µg ml-1). En los grupos inyectados con GFP-dsRNA o VIHdsRNA, los niveles de hemolinfa Vg tendieron a aumentar a partir de 10 días hasta 20 días; sin embargo, no se observaron diferencias significativas. De esta manera, se observó una gran variación entre todos los grupos experimentales (Fig. 3C). Los niveles de expresión de ARNm vg en el hepatopáncreas mostraron una alta variación, y con la excepción del grupo GFPARNds (a los 20 días), la manifestación del ARNm en el hepatopáncreas fue insignificante en la mayoría de los individuos. Esto se debe a que se encontró un alto nivel de expresión de vg en algunos individuos en cada grupo, lo que hace que el SEM sea grande (Fig. 4). Desarrollo de ovocitos En el grupo inicial, la extensión del desarrollo

Fig. 3. Efectos de la inyección de dsRNA sobre los niveles de vitelogenina (Vg). (A) Cambios en el índice gonadosomático (GSI). (B) Expresión de vg ARNm en ovarios. (C) Concentraciones de Vg en la hemolinfa. Los resultados se expresan como la media SEM. La data se analizó utilizando ANOVA unidireccional seguido del método de Dunnett y el número de individuos analizados se muestra entre paréntesis sobre las barras. Los asteriscos indican una diferencia significativa (P < 5) entre los grupos inicial e inyectado.

63


PRODUCCIÓN

- DICIEMBRE 2019

ovárico se correlacionó principalmente con la etapa previtelogénesis que comprende principalmente ovogonia y ovocitos previtelogénicos (3 de 6 camarones, Fig. 5A; GSI = 1.0%). Sin embargo, los individuos en la etapa de vitelogénesis primaria (2 de 6 camarones, Fig. 5B; GSI = 1.7%), que exhiben principalmente ovocitos vitelogénicos endógenos y aquellos en la etapa de vitelogénesis secundaria (1 de 6 camarones) se observaron albergando ovocitos vitelogénicos en su mayoría exógenos. En los grupos tampones TE, los ovarios a los 10 días después de la inyección estaban en la etapa de previtelogénesis en todos los camarones (5 de 5 camarones, Fig. 5C; GSI = 1.5%). A los 20 días después de la inyección, los ovarios contenían principalmente ovocitos revertidos ​​y ovocitos previtelogénicos (4 de 5 camarones, Fig. 5D; GSI = 3.6%) y también se observaron ovocitos vitelogénicos exógenos (1 de 5 camarones). En los grupos de GFP-dsRNA, los ovarios a los 10 días después de la inyección, se encontraban principalmente en la etapa previa a la vitelogénesis (4 de 5 camarones, Fig. 5E; GSI = 1.3%) o en la etapa de vitelogénesis primaria (1 de 5 camarones). Sin embargo, a los 20 días después de la inyección, los ovarios se encontraban principalmente en la etapa secundaria de vitelogénesis (4 de 5 camarones, Fig. 5F; GSI = 3.8%) o en la etapa previa a la vitelogénesis (1 de 5 camarones). En los grupos VIH-dsRNA, los ovarios a los 10 días después de la inyección estaban en la etapa previa a la vitelogénesis (3 de 5 camarones, Fig. 5G; GSI = 1.2%) o en la etapa primaria de vitelogénesis (2 de 5 camarones). A los 20 días después de la inyección, los ovarios se encontraban en la etapa previa a la vitelogénesis (2 de 5 camarones), en la etapa secundaria de vitelogénesis (2 de 5 camarones, Fig. 5H; GSI = 3.5%), o en la etapa de regresión (1 de 5 camarones).

Discusión La investigación basada en RNAi que emplea la administración de dsRNA en crustáceos han ido en aumento, especialmente en los últimos diez años después del trabajo pionero del silenciamiento génico en el

Fig. 4. Niveles de expresión del mRNA de vitelogenina (vg) en el hepatopáncreas después de la inyección de dsRNA. Los resultados se expresan como promedio±SEM. nemátodo Caenorhabditis elegans (Fire et al., 1998). En este estudio, nos enfocamos en el VIH subtipo I (SGP-G), el VIH predominante de L. vannamei, e investigamos los efectos fisiológicos de la administración de dsRNA y la posterior inhibición de la expresión de vih. En L. vannamei, nuestro grupo identificó previamente siete péptidos de la familia CHH en las glándulas sinusales, entre estos péptidos, seis péptidos (SGP-A, -B, -C, -E, -F y -G) mostraron un efecto inhibitorio sobre la expresión de vg en fragmentos de ovario cultivados (Tsutsui et al., 2007). En el estudio actual, demostramos de manera concluyente que la expresión de vih en el pedúnculo ocular, fue suprimida por la administración de dsRNA correspondiente a la secuencia de una forma madura de VIH. Los niveles de transcripción de vih se redujeron solo después de la inyección de VIH-dsRNA, pero no por ningún otro tipo de inyección, incluida la de dsRNA para GFP. Además, sus efectos persistieron durante 20 días después de una inyección única (3 µg de ARN de ds-ARN por gramo de peso corporal), como se observó en geles de agarosa (Fig. 1). Cuando se cuantificaron los niveles de expresión de vih, se observó que se logró una supresión del 99%. Estos resultados sobre la inhibición de vih por la inyección de VIH-dsRNA coincidieron bien con informes anteriores. Por ejemplo, también en L. vannamei, el VIH subtipo-II se clonó de los pedúnculos oculares y se demostró que se

64

expresaba predominantemente tanto en el cerebro como en pedúnculos (Chen et al., 2014). La eliminación de la expresión génica de VIH subtipo-II fue reportado por Feijó et al. (2016) y el VIH subtipo-II se describió como una hormona inhibidora de gónadas (GIH; un nombre alternativo para VIH). Feijó et al. (2016) encontraron que la inhibición de la expresión de gih en los pedúnculos oculares persistió durante 37 días después de la inyección de GIH-dsRNA y los niveles de transcripción de gih se suprimieron entre 67% y 73% en los pedúnculos oculares después de la inyección de GIH-dsRNA. En Penaeus monodon, se reporta que la GIH (VIH subtipoII) se expresa en varios tejidos, incluidos los tallos oculares y el cerebro (Treerattrakool et al., 2008). La inhibición de la expresión de gih mediante el uso de RNAi en P. monodon demostró claramente la caída de gih en los pedúnculos oculares, que persistió durante 30 días después de la inyección de GIHdsRNA (Treerattrakool et al., 2011); también se confirmó que la administración de GIHdsRNA por alimentación oral es efectiva para suprimir la expresión de gih (Treerattrakool et al., 2013). El estudio actual es el primero en medir los cambios en los niveles de VIH en la hemolinfa después de una inyección de VIHdsRNA. Curiosamente, los niveles de VIH en la hemolinfa aumentaron significativamente 10 días después de la inyección de VIHdsRNA, pero regresaron a los niveles iniciales


PRODUCCIÓN

- DICIEMBRE 2019 a los 20 días después de la inyección de VIH-dsRNA. Este patrón fluctuante de los niveles de VIH coincide con el de la ablación unilateral de los pedúnculos oculares en hembras adultas. En nuestro informe anterior, se demostró que los niveles de VIH de hemolinfa fluctúan significativamente durante la muda y después de la ablación peduncular. En las hembras adultas, los niveles de VIH de hemolinfa aumentaron a los 10 días después de la ablación unilateral de pedúnculo ocular y luego disminuyeron a los 20 días (Kang et al., 2014). Sin embargo, la expresión del gen vih en pedúnculos oculares de hembras adultas no cambió significativamente en relación con la muda o después de la ablación unilateral peduncular (Kang et al., 2018). Lo anterior sugiere que la expresión basal de VIH ocurre en camarones en condiciones naturales (no tratadas), pero que algunos individuos a veces pueden exhibir niveles de expresión disminuidos, tal vez debido a tener niveles suficientes de almacenamiento de VIH en la glándula sinusal. Estos resultados sugieren fuertemente que una reducción en los niveles de expresión de vih puede provocar la liberación de VIH en la hemolinfa, y que un aumento en los niveles de VIH en la hemolinfa puede ser el resultado de una mayor secreción de VIH de las glándulas sinusales. Nuestros resultados indican la posibilidad de que la supresión de las transcripciones de vih conduzca al mismo efecto que el logrado por la ablación peduncular. Sin embargo, no hubo un aumento significativo en los niveles de Vg después de la inyección de VIH-dsRNA, ya sea en términos de expresión en el ovario, o concentración en hemolinfa. En el P. monodon, se demostró que los niveles de expresión de vg en el ovario aumentan a los 5 días después de la inyección de GIHdsRNA (Treerattrakool et al., 2008); estos autores descubrieron que los animales desovaron después del tratamiento, pero la tasa de desove fue solo un cuarto de la que ocurrió después de la ablación del pedúnculo ocular. Sin embargo, era el doble que el vehículo control (Treerattrakool et al., 2011). En el estudio realizado por Feijó et al. (2016) en L. vannamei, un aumento en el nivel de expresión de vg en el ovario y un aumento en el diámetro de los ovocitos se mostró solo a los 37 días después de la

Fig. 5. Análisis histológico de ovarios teñidos con hematoxilina y eosina. Se expone una muestra representativa de cada grupo. (A) Individuo no inyectado (grupo inicial) con índice gonadosomático (GSI) = 1.0% y (B) GSI = 1.7%. (C) Individuo inyectado con tampón Tris-EDTA (TE) después de 10 días, GSI = 1.5% y (D) después de 20 días, GSI = 3.6%. (E) proteína verde fluorescente (GFP)-dsRNA inyectada en forma individual después de 10 días, GSI = 1.3% y (F) 20 días, GSI = 3.8%. (G) individuo inyectado con ARNd de la hormona inhibidora de vitelogénesis (VIH) después de 10 días, GSI = 1.2% y (H) 20 días, GSI = 3.5%. Las características de desarrollo de los ovocitos se indican como oogonio (OO); ovocitos previtelogénicos (PR); ovocitos vitelogénicos endógenos (EN); ovocitos vitelogénicos exógenos (EX); y regresión de ovocitos (R). Barras = 100um. (Para la interpretación de las referencias a color en esta leyenda de la figura, se remite al lector a la versión web de este artículo).

65


PRODUCCIÓN inyección de GIH-dsRNA; los animales no desovaron. En nuestro estudio, los niveles de Vg no aumentaron significativamente, ya sea en términos de expresión en el ovario o concentraciones en hemolinfa, incluso 20 días después de la inyección de VIHdsRNA. Además, los ovocitos que mostraron características de vitelogénesis secundaria se observaron en los ovarios a los 20 días en todos los grupos, lo que sugiere que esto no es causado específicamente por los diversos tratamientos. El análisis histológico del desarrollo ovárico también mostró regresión de los ovocitos (o reabsorción de vitelina) en los ovarios a los 20 días después de la inyección con tampón TE o VIH-dsRNA (Fig. 5). Esto indica que incluso cuando el camarón exhibe valores GSI similares, el estado de los ovocitos (desarrollo o absorción) puede diferir mucho en las hembras tratadas. De esta manera, el examen histológico ofrece información adicional sobre los efectos de la inyección de VIH-dsRNA. Se mostró un aumento significativo en GSI solo 20 días después de la inyección de GFP-dsRNA y no se observó un desarrollo ovárico significativo después de la inyección de VIH-dsRNA. Esperábamos que un aumento en el peso corporal hubiera influido en los niveles de Vg y el desarrollo de los ovocitos. En las hembras adultas, los niveles de Vg y el desarrollo ovárico fluctúan según el ciclo de muda, y aumentan en la etapa de ecdesis. Por lo tanto, nuestros resultados sugieren que más allá de muchos más días, los períodos experimentales son necesarios para promover el desarrollo ovárico después

- DICIEMBRE 2019 de la inyección de VIH-dsRNA y también que puede ser necesario considerar el timing de las inyecciones de VIH-dsRNA en relación con la etapa de muda o fase ovárica. Por lo tanto, se sugiere que la supresión de la expresión de vih puede servir como un medio para inducir la maduración ovárica, pero no en la medida en que lo hace la ablación peduncular. Por lo tanto, en L. vannamei, no solo se requiere la eliminación del VIH, sino también la participación de factores estimuladores para acelerar la maduración ovárica de una manera que sería deseable en un laboratorio. En camarón, se ha postulado la existencia de la hormona estimulante de la vitelogénesis (VSH) en el sistema nervioso central (Wilder et al., 2010), aunque hasta la fecha, aún no se ha identificado claramente un VSH viable. Se han reportado factores involucrados en la liberación de VSH o que hacen actuar como VSH en varias especies (Chen et al., 2018; Makkapan et al., 2011; Sarojini et al., 1995; Tiu y Chan, 2007). Por ejemplo, se demostró que la serotonina (5-hidroxitriptamina: 5-HT) y la hormona concentrada de pigmento rojo (RPCH), tienen efectos estimulantes sobre el crecimiento ovárico en el cangrejo rojo del pantano (Procambarus clarkii) y en L. vannamei (Chen et al., 2018; Sarojini et al., 1995; Vaca y Alfaro, 2000). La eficacia de la inyección de 5-HT o RPCH en la maduración ovárica es limitada en comparación con la de la ablación del pedúnculo ocular, porque el VIH aún permanece en el pedúnculo. Sugerimos que una inyección de VIH-dsRNA combinada con un factor estimulante como 5-HT o RPCH,

66

puede ser más efectivo para inducir la maduración ovárica en un entorno artificial. Quizás la aceleración de la maduración ovárica sea posible mediante la inhibición de múltiples genes vih, y no solo la de SGP-G. Se necesitan más estudios al respecto, a fin de lograr una tecnología viable para estimular la maduración ovárica. En conclusión, la expresión del vih subtipo-I de L. vannamei fue suprimida por una inyección de VIH-dsRNA; sin embargo, la inyección de VIH-dsRNA no cambió significativamente los niveles de Vg, ni en términos de expresión génica ni de síntesis de proteínas. Los niveles de VIH en la hemolinfa aumentaron significativamente a los 10 días después de la inyección de VIH-dsRNA. En nuestro informe anterior, los niveles de Vg alcanzaron su punto máximo después del aumento de los niveles de VIH en la hemolinfa y los niveles de VIH se incrementaron a los 10 días después de la ablación unilateral del pedúnculo ocular (Kang et al., 2014). Por lo tanto, sugerimos que la inyección de VIH-dsRNA facilita la maduración ovárica en el camarón, pero no es suficiente para lograr ovarios completamente maduros que conduzcan a un desove. En última instancia, se espera que los hallazgos de este estudio sean de utilidad en la industria acuícola, al proporcionar una alternativa a la ablación del pedúnculo ocular● Este artículo es un extracto del original, para mayor información tomar contacto con: marwil@jircas.affrc.go.jp


GENÉTICA

- DICIEMBRE 2019

Evaluación de parámetros genéticos para rasgos reproductivos y tasa de crecimiento en el camarón blanco del Pacífico Litopenaeus vannamei cultivado en agua salobre Autores: Jian Tana,b, Sheng Luana,b,, Baoxiang Caoa,b, Kun Luoa,b,, Xianhong Menga,b, Jie Konga,b,* Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 106 Nanjing Road, Qingdao 266071, China a

Laboratory for Marine Fisheries and Food Production Processes, National Laboratory for Marine and Technology, 1 Wenhai Road, 266237, China b

mengxianhong@ysfri.ac.cn luokun@ysfri.ac.cn luansheng@ysfri.ac.cn

Science Qingdao Science Qingdao

E

l camarón blanco del Pacífico (Litopenaeus vannamei, también conocido como Penaeus vannamei) es una de las especies de camarón más importantes cultivadas del mundo. L. vannamei se distribuye en el Océano Pacífico Oriental desde el norte del Perú a través del Ecuador hasta México (Rendon et al., 2007).

selectiva de L. vannamei en China ha hecho grandes progresos y se ha desarrollado un sistema adaptado a las condiciones agrícolas chinas. En 2011, el Instituto de Investigación de Pesca del Mar Amarillo, Shandong, China, lanzó un programa de reproducción selectiva para mejorar la supervivencia de la cosecha en estanques y el peso corporal de L. vannamei cultivado (Sui et al., 2016).

La producción más alta se observa para el camarón peneido, que comprende aproximadamente el 80% de la producción total de camarón en el mundo (Thanasak y Soottawat, 2019). L. vannamei se introdujo por primera vez en China en 1988 (Ruan et al., 2013); y ahora, después de 30 años de cultivo, se ha convertido en la especie dominante en China. L. vannamei utiliza el 70% del área total y proporciona el 80% del rendimiento del camarón de cultivo; la producción de L. vannamei fue de 1,672,287 t en 2017, y el 35% de la producción se cultivó en agua de baja salinidad en China (anuario estadístico de pesca de China, 2018).

Los programas de reproducción genética para el cultivo de camarón y de reproductores generalmente se llevan a cabo a alta salinidad, como el agua oceánica, pero no en agua dulce o baja salinidad (como el agua salobre). Sin embargo, L. vannamei es una especie de agua salada con amplia distribución que se ha adaptado para vivir bajo diferentes salinidades (de 1 a 50‰) (Menz y Blake, 1980 Ponce-Palafox et al., 1997). Recientemente, las enfermedades de camarón han aumentado como resultado de la expansión de la escala de su cultivo en las zonas costeras.

El programa de mejora genética selectiva de L. vannamei comenzó en el Instituto Oceánico, Oahu, Hawai, en 1984. Los L. vannamei seleccionados pueden adaptarse mejor a entornos artificiales, y algunos de sus rasgos económicos, como su tasa de crecimiento y resistencia a enfermedades, mejorar (Gjedrem y Fimlano, 1995). En los últimos 30 años, el programa de reproducción

Aunque algunos métodos de tratamiento de agua pueden matar los patógenos en el agua, el aire es otra forma de propagación de enfermedades. Es difícil evitar esta vía de transmisión de patógenos, lo que es un desafío para el cultivo de reproductores de camarón específicos libres de patógenos (SPF). Los sistemas de cultivo de salinidad reducida para reproductores de camarón

69


GENÉTICA marino, que se utilizan para el intercambio de agua salobre, se pueden instalar en granjas alejadas del agua oceánica potencialmente contaminada (Parnes et al., 2004). Por lo tanto, una solución propuesta para los problemas de producción de reproductores L. vannamei es el uso de agua con salinidad menor que el agua oceánica (Araneda et al., 2008). Aunque la reproducción genética de reproductores en agua salobre o de baja salinidad aún no se han estudiado, es muy común cultivar L. vannamei en agua salobre o en condiciones de baja salinidad. La producción acuícola de L. vannamei en agua con baja salinidad ha representado el 35% de la producción total de camarón en China (anuario estadístico de pesca de China, 2018). Actualmente, la producción de semillas desalinizadas generalmente usa camarón cultivado en agua con alto contenido de sales como reproductores; nauplios crecidos en agua de mar, que también se utiliza para cultivar postlarvas. Los camarones se desalinizan para acortar el ciclo de incubación, generalmente mediante el método de reducción rápida de sal, y la salinidad se puede reducir en 5–8‰ por día. Usando este proceso surgen problemas inevitables, como una baja tasa de supervivencia, mala calidad del camarón y la interacción del genotipo y el medio ambiente se incrementa. Las postlarvas de L. vannamei no son tolerantes a grandes fluctuaciones de salinidad cuando son muy jóvenes (Saoud et al., 2003). Por ejemplo, tanto McGraw et al. (2002) y Saoud et al. (2003) reportaron un aumento en la tasa de supervivencia a medida que los organismos alcanzaron los 15 días de edad con una salinidad mayor a 4 ppt cuando se evaluó la supervivencia de postlarvas. Van-Wyk et al. (1999) reportaron que usando agua con 0.5 ppt de salinidad, las tasas de crecimiento y la supervivencia están por debajo de las de agua de mar. Por lo tanto, los problemas de interacción entre el genotipo y el ambiente pueden ocurrir porque los reproductores no se domestican bajo condiciones de desalinización. Usamos camarones cultivados en desalinización como reproductores para que su prole lleve el gen que regula la adaptabilidad de la

- DICIEMBRE 2019 desalinización. Por lo tanto, es necesario realizar una selección de camarón reproductor para la tasa de crecimiento y rasgos reproductivos en condiciones de baja salinidad. La dependencia actual de reproductores de aguas oceánicas es arriesgada y es necesario seleccionar reproductores de aguas salobres a través de una selección (Andriantahina et al., 2013). En este estudio, puede ser ventajoso reproducir una nueva variedad en agua de baja salinidad y mejorar la calidad del germoplasma. Para lograr este objetivo, es necesario determinar los parámetros genéticos de la tasa de crecimiento y los rasgos reproductivos de los camarones reproductores desalinizados. La tasa de crecimiento es uno de los principales rasgos económicos en la producción de camarón. Ordinariamente, el peso corporal muestra una alta variación fenotípica en muchas especies acuícolas (Gjedrem, 1983); debido al alto potencial reproductivo de los individuos, es posible producir una intensa alta selección. Por lo tanto, incluso en condiciones de baja heredabilidad, el potencial para la mejora genética en la tasa de crecimiento a través de la selección de reproductores para efectos de genes aditivos es prometedor. En L. vannamei, Tan et al. (2016) encontraron que los niveles de herencia para el peso corporal son 0.43 y 0.44 a baja y alta densidad, respectivamente, lo que indica un nivel moderado. Sui et al. (2016) reportaron que los niveles de heredabilidad para el peso corporal son 0.28 ± 0.136 y 0.423 ± 0.065 respectivamente. Castillo-Juárez et al. (2007) estimaron que los niveles de heredabilidad del peso corporal varían de 0.24 a 0.45 para diferentes modelos. La tasa de crecimiento se considera un rasgo de gran importancia económica para muchas especies acuícolas. El rápido crecimiento acelera la rotación de cultivos (producción) y, por lo general, los animales más grandes alcanzan un precio más alto por unidad de peso en comparación con los más pequeños. La tasa de crecimiento también es fácil de medir mediante la medición de la longitud o el peso corporal (Gjerde, 1986). La eficiencia reproductiva es otro rasgo económicamente importante

70

en la producción comercial de larvas, especialmente para los laboratorios que producen huevos fertilizados. La mayoría de los estudios de rasgos reproductivos y su relación con el peso corporal se derivan de data registrada en poblaciones naturales o de individuos cultivados en diferentes ambientes. Por lo tanto, los componentes de variación ambiental y genética a menudo se confunden, y el peso corporal se confunde a menudo con la edad del individuo en consideración. Debido a esta razón, el estudio disponible sobre la variación genética en rasgos reproductivos y su relación con la tasa de crecimiento es muy raro (Gjerde, 1986). En consecuencia, la heredabilidad y las correlaciones genéticas entre la tasa de crecimiento y los rasgos reproductivos pueden tener implicaciones importantes en el diseño de programas de mejoramiento para optimizar la tasa de crecimiento y la eficiencia reproductiva. Los resultados de varias especies han demostrado que las cepas con altas tasas de crecimiento tuvieron menor fecundidad y que las cepas con alta fecundidad tuvieron bajas tasas de crecimiento. Sin embargo, ningún informe ha descrito la relación entre la tasa de crecimiento y los rasgos reproductivos en L. vannamei. Debe enfatizarse que al planificar un programa de mejoramiento genético que incluya solo un rasgo, es suficiente saber si la heredabilidad es baja, media o alta, siempre que la estimación sea confiable. Sin embargo, en aras de optimizar un programa de mejoramiento genético, que incluya múltiples rasgos, se necesitan estimaciones más precisas de los niveles de heredabilidad y correlaciones genéticas entre los rasgos incluidos en el programa (Gjerde, 1986). L. vannamei generalmente se cultiva durante 4–5 meses, usualmente se cosecha alrededor de 15 g en China, que es la razón principal de nuestra evaluación genética de la tasa de crecimiento de 0 a 4 meses. L. vannamei es una especie introducida, y el camarón es de hasta 300 RMB por par. L. vannamei puede desovar varias veces, por lo que la cantidad de desoves, el promedio de intervalo de desove y la edad del primer desove son muy importantes para la fase de preengorde. Si la hembra puede desovar


GENÉTICA

- DICIEMBRE 2019 varias veces, y el ciclo de ovulación es corto, la edad de desove es temprana y el período de desove es largo, por lo que un camarón puede obtener el mayor beneficio económico en el preengorde. Por lo tanto, si los rasgos reproductivos son importantes comercialmente, se debe seleccionar. En este estudio, se resumen las estimaciones de la variación genética aditiva para la tasa de crecimiento y los rasgos de reproducción de camarón cultivado en agua salobre, y también se revisa la relación entre el crecimiento y la reproducción. La selección de reproductores de alto rendimiento que utilizan rasgos asociados con un rápido crecimiento podría ser una estrategia importante para mejorar la producción de nauplios y camarón, suponiendo que estos rasgos sean heredables y que las correlaciones genéticas de los rasgos sean positivas (Wyban y Sweeney, 1991; Ibarra et al., 1997; Racotta et al., 2003). Por lo tanto, este experimento probó la tasa de crecimiento y los rasgos reproductivos en agua salobre para verificar la relación genética entre la tasa de crecimiento y los rasgos reproductivos. Las estimaciones confiables de las correlaciones genéticas entre el crecimiento y las características reproductivas en el agua salobre son un requisito previo para planificar los programas de mejoramiento. Este estudio es de gran importancia para determinar la estrategia de mejoramiento genético de los rasgos reproductivos y de crecimiento en aguas salobres. Puede ser factible reproducir una nueva variedad en agua de baja salinidad y mejorar la calidad del germoplasma.

Materiales y métodos Antecedentes históricos y establecimiento de familias de medio hermanos/hermanos completos El programa de mejoramiento se llevó a cabo en el Instituto de Investigación de Pesca del Mar Amarillo, Centro de Mejoramiento Genético Marino del Ministerio de Agricultura, China. En junio y julio de 2012, se introdujeron reproductores de América y Singapur (G0). Se evaluó la presencia de reproductores con diferentes cepas de virus (WSSV, TSV, IHHNV, YHV) utilizando RT-PCR, y solo se usaron reproductores libres de virus. Cada

reproductor fue marcado individualmente colocando anillos numerados en un pedúnculo ocular después del aislamiento y conservación. Después de un mes de cultivo temporal, se eligieron reproductores con una gónada madura y una apariencia saludable. Las generaciones G1 a G6 se produjeron utilizando un diseño de cópula de medio hermano/hermano completo. Cultivo de camarones juveniles El ensayo se llevó a cabo en Xinhai Aqua Biotechnology Co. Ltd., Huanghua, Hebei, China (N38° 37‘, E117° 33’). Después de la eclosión, se seleccionaron al azar alrededor de 10,000 nauplios de cada familia de medio hermano/hermano completo para un entrenamiento por separado con un manejo uniforme. Se utilizó Chlorella como alimento, seguido de Artemia y Rotifera. En total, se cultivaron 1500 camarones (PL5) de cada familia bajo la condición de una disminución de la salinidad de diez partes por mil. Un total de 600 camarones juveniles se seleccionaron al azar de cada familia cuando habían crecido hasta la etapa PL20 y se aislaron para el cultivo en una jaula de 40 × 40 × 100 cm en un tanque de 100 m2. Se inyectó a cada camarón un implante de elastómero fluorescente visible (VIE) para identificar a las familias hasta que el camarón alcanzó aproximadamente 2 meses. Esta identificación de marcado permitió que las familias se mezclaran en tanques para la evaluación de su desempeño. Se suministró alimento artificial durante el período de crecimiento, y el régimen de alimentación en todos los tanques consistió en pellet comercial que contenía 33% de proteína. La temperatura del agua varió de 26 a 28 °C, y la salinidad fue de 10 ± 0.5 ppt. Ciento quince familias (con 111 presas y 97 padrotes) de generaciones G6 fueron seleccionadas como camarones experimentales. Prueba de rasgos de crecimiento de L. vannamei Se marcaron y pesaron un total de 50 camarones por familia. Obtuvimos el peso promedio de cada familia después de 2 meses (M2BW). La identificación de marcado permitió que las familias se mezclaran en un tanque para la evaluación del desempeño. A los 60 días de crecimiento en agua salobre (4 meses de edad), se midió cada

71

miembro de la familia (3264 individuos) para determinar el peso corporal (M4BW). La tasa de crecimiento se calculó desde la fecha de nacimiento hasta la medición de M4BW (G1R). G1R (g/d) = M4BW Días de crecimiento Prueba reproductiva de L. vannamei El cultivo mixto en agua salobre continuó cuando se completó la prueba del rasgo de crecimiento. Cuando el camarón creció hasta los 8 meses, las hembras fueron sometidas a una ablación unilateral del pedúnculo ocular y se colocó un anillo codificado con un número en el pedúnculo restante. Al mismo tiempo, se registró el peso corporal individual a los 8 meses (M8BW). Se seleccionaron machos y hembras de cada familia para incrementar a una salinidad mejorada de 30 ppt. Después de un período de aclimatación, se inició la prueba del rasgo reproductivo. La dieta comprendía 40% de calamar y 60% de poliquetos nereis, se dividió en cuatro raciones diarias iguales que representaban un suministro diario total de 20% de biomasa de peso húmedo, y se ajustó diariamente. La prueba se llevó a cabo en varios tanques de 25 m2 con una densidad de 12 camarones/m2. Se colocaron camarones hembras maduras sexualmente en el tanque de camarones macho para el apareamiento natural a las 8h00 todos los días (registrando el código del anillo de la hembra). Las hembras se recolectaron a las 18h00, los camarones hembras apareados se colocaron en el tanque de desove (registrando el número del anillo codificado), y las hembras no apareadas se devolvieron al tanque original. El registro principal de la frecuencia de puesta de huevos de la hembra durante la prueba (ELF), el promedio de intervalo de desove (ASI), la edad del primer desove (FSA), el peso corporal de la hembra al final de la prueba reproductiva (11 meses, M11BW). La tasa de crecimiento fue calculada desde el comienzo de la prueba de reproducción hasta la medición M11BW (G2R). G2R (g/d) =        M11BW - M8BW días de prueba reproductiva* Análisis estadístico La varianza de los componentes de los rasgos de crecimiento según las diferentes etapas


GENÉTICA de crecimiento y los rasgos reproductivos, se estimaron utilizando el método REML de información promedio en ASReml 4.1 (Gilmour et al., 2009). En esta investigación, se utilizó la información completa de pedigrí utilizada en los modelos para animales de 2012 a 2017 para proporcionar la matriz A (matriz de relación genética aditiva). El rasgo ELF se analizó utilizando un modelo mixto lineal generalizado (GLMM) con una distribución multinomial y una función de enlace logit. El modelo GLMM es una extensión del modelo lineal generalizado desarrollado por McCullagh y Nelder (1989). En el modelo GLMM, el efecto combinado de los efectos fijos y aleatorios en la escala subyacente se expresa como el predictor lineal (η). La relación entre el predictor lineal y el vector de observaciones en un GLMM se describe como y|u ~ (h (η), R), que especifica que la distribución condicional de y dada u con una media h (η) y una varianza R. La relación entre el predictor lineal (η) y la media condicional (μ) del rasgo se modela a través de una función de enlace (inversa) (μ = hη). La selección de funciones de enlace inverso generalmente se basa en la distribución de errores (Kachman, 2008). Se estimó la heredabilidad para ELF al considerarlo un fenotipo categórico (ej., 1–15 desove). yijl = μ + BWj + al + eijl (Modelo 1) donde yijl es el predictor lineal en la escala logit, μ es la media general y BWj es el efecto fijo del peso corporal jth; al es el efecto genético aditivo del camarón lth y eijl es el error residual aleatorio del individuo ith, que se fija en π2/ 3 ≈ 3.28987 bajo la escala logit, de acuerdo con el Manual del usuario de ASReml 4.1 (Gilmour et al., 2009). El efecto del entorno común fue excluido de este modelo. La heredabilidad se calculó como:

donde h2 es la estimación de heredabilidad de las familias, σ² es la varianza genética aditiva entre los individuos de las familias, y σ2 es la varianza residual entre los individuos de las familias.

- DICIEMBRE 2019 Los modelos de animales utilizados para la estimación de parámetros genéticos de otros rasgos son los siguientes: yijl = μ + Sj + al + eijl (Modelo 2) donde yijl es el valor de los rasgos fenotípicos (M4BW, M8BW, M11BW, G1R, G2R, ASI y FSA) del camarón ith, μ es la media general, Sj es el efecto fijo del individuo jth, al es el efecto aditivo genético del camarón lth, y eijl es el error residual aleatorio del individuo ith. El efecto ambiental común se excluyó de este modelo porque el cultivo por separado es muy corto (el camarón se cultivó en un mismo ambiente acuático cuando era PL20). La heredabilidad se calculó como:

donde h2 es la estimación de heredabilidad de las familias, σ2 es la varianza genética aditiva entre los individuos de las familias, y σ2 es la varianza residual entre los individuos de las familias. Las correlaciones genéticas se calcularon como: raij= σaij /( σaii · σajj) donde raij es la estimación de correlación genética de las familias, σaij es la covarianza genética de las familias, y σaii · σajj es la varianza genética aditiva entre los individuos de las familias.

Resultados Análisis estadístico fenotípico de la tasa de crecimiento y rasgos reproductivos de L. vannamei El análisis estadístico del tamaño de la muestra, la media, el máximo, el mínimo, la desviación estándar y la variación del coeficiente para la tasa de crecimiento y los rasgos reproductivos se presentan en la Tabla 1. El promedio de la tasa de crecimiento durante el período inicial de L. vannamei fue de 0.10 g/d, y la tasa de crecimiento promedio durante el período reproductivo fue de 0.29 g/d porque la temporada reproductiva usó principalmente alimento fresco, que tiene un alto valor nutricional. La edad del primer desove varió de 226 a 303 días, con una media de 258.39 días. La frecuencia de puesta de huevos fue entre 1 y 15 veces, y el coeficiente de variación alcanzó el 49.83%, lo que indica diferencias significativas entre diferentes familias e individuos. El promedio de intervalo de desove fue entre 2.5 y 60 días, lo que refleja el rendimiento reproductivo de diferentes hembras después del desove. El coeficiente de variación fue tan alto como 75.59%. La data refleja la diferencia extrema de los rasgos reproductivos en diferentes familias o individuos y que son necesarios para la reproducción genética y el rendimiento reproductivo.

Tabla 1. Estadística descriptiva de la tasa de crecimiento y rasgos reproductivos de L. vannamei.

M2BW: peso corporal familiar a los 2 meses; M4BW: peso corporal a los 4 meses; G1R: tasa de crecimiento antes de los 4 meses; M8BW: peso corporal a los 8 meses; M11BW: peso corporal a los 11 meses; G2R: tasa de crecimiento entre 8 meses y 11 meses; FSA: edad del primer desove; ELF: frecuencia de puesta de huevos; ASI: promedio de intervalo de desove; N: tamaño de muestra; Max, Min, Mean, SD y CV representan el máximo, mínimo, media, desviación estándar y coeficiente de variación.

72


GENÉTICA

- DICIEMBRE 2019 Componente de varianza y heredabilidad de la tasa de crecimiento y rasgos reproductivos de L. vannamei Los componentes de varianza y la estimación de heredabilidad para cada rasgo de crecimiento y reproducción se muestran en la Tabla 2. Los niveles de heredabilidad de M4BW, M8BW y M11BW fueron 0.32 ± 0.05, 0.58 ± 0.08, y 0.52 ± 0.08, respectivamente, los cuales mostraron una heredabilidad media-alta, indicando que los rasgos de crecimiento se ven más afectados por la herencia. Los niveles de heredabilidad de los rasgos reproductivos como ELF y ASI fueron 0.07 ± 0.02 y 0.10 ± 0.03, respectivamente, lo que indica baja heredabilidad. Además, los rasgos reproductivos se vieron relativamente menos afectados por la herencia. Los niveles de heredabilidad de la FSA y G1R fueron 0.92 ± 0.08 y 0.53 ± 0.06, respectivamente, que fueron niveles de heredabilidad medioalto, lo que indica que la edad del primer desove y la tasa de crecimiento temprano se vieron afectados principalmente por factores genéticos. El G2R estaba en un nivel bajo, solo 0.03 ± 0.03, lo que indica que la tasa de crecimiento durante el período reproductivo se ve muy afectada por otros factores, y el efecto genético es mínimo. Correlación genética de la tasa de crecimiento y rasgos reproductivos de L. vannamei La correlación genética y la estimación de heredabilidad para los rasgos de crecimiento y reproducción se muestran en la Tabla 3. Las correlaciones genéticas entre los rasgos de peso corporal en diferentes períodos muestran una alta correlación, que varía de 0.63 ± 0.10 a 0.99 ± 0.01, y la correlación del rasgo de peso corporal fue mayor durante cada período. La correlación genética entre la edad del primer desove (FSA) y el peso corporal en cada período osciló entre 0.34 ± 0.11 a 0.67 ± 0.10. La correlación genética entre el promedio de intervalo de desove (ASI) y el peso corporal en cada el período varió de −0.21 ± 0.20 a −0.04 ± 0.21. La correlación genética entre el G1R y el promedio de intervalo de tiempo de desove (ASI) fue −0.30 ± 0.18, lo que indica que la tasa de crecimiento temprano del camarón hembra fue más rápida y el intervalo de tiempo de redesove de hembras eran más cortos. Por lo tanto, la frecuencia

Tabla 2. Componentes de varianza y heredabilidad de la tasa de crecimiento y rasgos reproductivos de L. vannamei

M4BW: peso corporal a los 4 meses; M8BW: peso corporal a los 8 meses; M11BW: peso corporal a los 11 meses; G1R: tasa de crecimiento antes de los 4 meses; G2R: tasa de crecimiento entre 8 meses y 11 meses; FSA: edad del primer desove; ELF: frecuencia de puesta de huevos; ASI: promedio de intervalo de desove.

de desove de la hembra es mayor durante el período reproductivo, lo que refleja la mayor fertilidad. Sin embargo, la correlación genética entre el G2R y el tiempo promedio de intervalo de desove (ASI) fue de 0.93 ± 0.10, indicando que la tasa de crecimiento de la hembra durante el período reproductivo fue más rápida y que el intervalo de tiempo de desove del camarón hembra fue más largo. Además, la frecuencia de desove de la hembra fue menor durante el período reproductivo, lo que refleja una reducida fertilidad. La relación genética entre la tasa de crecimiento y los rasgos reproductivos fueron diferentes según la etapa de crecimiento. En la temprana etapa de crecimiento de L. vannamei, la tasa de crecimiento temprano y los rasgos reproductivos no fueron compensados. Hay una clara compensación entre la tasa de crecimiento y los rasgos reproductivos durante la época de reproducción. Las estimaciones de los parámetros genéticos indican que estos rasgos se pueden seleccionar para mejorar la eficiencia reproductiva de las hembras.

Discusión Este estudio se realizó con la prueba de rasgos de crecimiento y reproducción de L. vannamei que se cultivaron por ocho meses en agua salobre, y evaluó la heredabilidad y la correlación genética de L. vannamei. La heredabilidad y correlaciones genéticas entre la tasa de crecimiento y los rasgos productivos pueden tener implicaciones importantes para el diseño de programas

73

de mejoramiento de la tasa de crecimiento y eficiencia de reproducción en agua salobre. En este estudio, el entorno común el efecto fue excluido de este modelo porque el cultivo separado fue muy corto (el camarón fue cultivado en un mismo ambiente acuático cuando estaba en PL20, solo 20 días), para lo cual, efectos ambientales comunes son difíciles de dilucidar. De hecho, los organismos PL20 inicial, se cultivaron en un estanque ambiental para que los efectos ambientales comunes sean muy pequeños. Sonesson y col. (2013) intentaron analizar los efectos ambientales comunes y estimaciones de parámetros genéticos del peso corporal. Sin embargo, les resultó difícil separar los efectos ambientales comunes en el modelo. Estos autores finalmente excluyeron los efectos ambientales comunes del modelo. Luan et al., 2015 encontraron que el efecto ambiental común de nuestra población de L. vannamei es solo 0.07 ± 0.06 cuando el camarón tiene 7 g (aproximadamente 90 días). Kong, 2018 descubrió que el efecto ambiental común es mínimo en el cultivo comunal en una etapa temprana (el cultivo comunal comienza en PL20) para nuestra población de L. vannamei, cercana a cero (0.0016). El efecto ambiental común es 0.073 ± 0.112 en el cultivo por separado en etapas iniciales (el cultivo comunal comienza en PL100) para nuestra población de L. vannamei. Además, el peso corporal en el etiquetado en lugar de la edad fue ajustado como el efecto fijo para reducir el impacto del efecto del medio ambiente común en el Modelo 1.


GENÉTICA

- DICIEMBRE 2019

Tabla 3. Heredabilidad y correlación genética entre la tasa de crecimiento y los rasgos reproductivos de L. vannamei.

M4BW: peso corporal a los 4 meses; M8BW: peso corporal a los 8 meses; M11BW: peso corporal a los 11 meses; G1R: tasa de crecimiento antes de los 4 meses; G2R: tasa de crecimiento entre 8 meses y 11 meses; FSA: edad del primer desove; ELF: frecuencia de puesta de huevos; ASI: promedio de intervalo de desove.

La heredabilidad es un parámetro crucial para estimar la respuesta a la selección de un rasgo potencial en una población reproductora (Falconer y Mackay, 1996; Lynch y Walsh, 1998; Kruuk, 2004). La estimación de la heredabilidad de rasgos potenciales en una población reproductora es una metodología necesaria para evaluar la sostenibilidad de los reproductores y lograr un progreso genético. La evaluación de los parámetros genéticos para los rasgos de crecimiento ha sido ampliamente reportada. En agua salada, la mayoría de los niveles de heredabilidad reportados en algunos estudios de L. vannamei fueron entre 0.17 ± 0.04 y 0.44 ± 0.05 (Pérez-Rostro e Ibarra, 2003a, 2003b; Gitterle et al., 2005a, 2005b Tan et al., 2016). En agua salobre, Kong et al. (2017) informaron que la heredabilidad del peso corporal de L. vannamei fue de 0.3 ± 0.07. Los resultados de nuestro estudio mostraron que los niveles de heredabilidad del peso corporal de la cosecha obtenida de L. vannamei fue de moderado a alto en diferentes etapas de crecimiento, y el rango de variación de los niveles de heredabilidad no fue grande en diferentes etapas de crecimiento (0.32 ± 0.05, 0.58 ± 0.08, 0.52 ± 0.08). Sin embargo, la heredabilidad del peso corporal muestra una tendencia a disminuir durante el período reproductivo. Los resultados de nuestro estudio son ligeramente más altos que resultados de otras investigaciones. Esto puede ser porque nuestros resultados no pueden explicar los efectos ambientales comunes en el modelo, lo que lleva a cierta confusión entre la variación genética aditiva y variación ambiental común en la data (Thodesen et al., 2011; Bentsen et al., 2012) y a una mayor estimación de la

heredabilidad que la actual. De hecho, los camarones fueron cultivados en un estanque 2 meses para que los efectos ambientales comunes fueran muy pequeños. Por lo tanto, diferentes métodos de estimación o población pueden conducir a diferencias en las estimaciones de heredabilidad. Además, las intervenciones del medio ambiente que involucran algunos efectos genéticos impredecibles pueden afectar la estimación de heredabilidad. En nuestro estudio, el coeficiente de variación del peso corporal y la heredabilidad estimada indican que la variación genética de L. vannamei es mayor y que tiene un gran potencial para la selección genética. El conocimiento de parámetros genéticos para rasgos reproductivos puede ayudar en la decisión sobre el incluir estos rasgos en los programas de reproductores dirigidos al crecimiento, resistencia a enfermedades o supervivencia, en donde el posible efecto negativo en la reproducción que puede ser causado ​​ por selección genética para el crecimiento. Solo unos pocos informes tienen estimaciones escritas de parámetros genéticos para reproducción y rasgos de peso corporal. En estudios anteriores, los niveles de heredabilidad de frecuencia de puesta de huevos y el número de huevos fue 0.06 ± 0.06 y 0.12 ± 0.08, respectivamente, los cuales fueron niveles de heredabilidad más bajos (Tan et al., 2017) CaballeroZamora et al. (2015) y Arcos et al. (2004) reportaron que los niveles de heredabilidad del número de huevos de L. vannamei eran 0.17 ± 0.24 y 0.13 ± 0.04, respectivamente. En Oreochromis niloticus, Trong et al. (2013) reportaron que las estimaciones de

74

heredabilidad para éxito en el desove fue de 0.14 a 0.18 para el modelo logit y de 0.20 a 0.22 para el modelo lineal. Arcos y et al. (2004) demostraron una importante correlación genética y fenotípica entre el peso corporal y el número de óvulos de hembra L. vannamei, con valores de −0.13 y 0.34, respectivamente. Caballero-Zamora et al. (2015) obtuvieron una correlación genética negativa entre el peso corporal y el número de huevos de L. vannamei hembra, con un valor de −0.21 ± 0.19. En otras especies acuícolas, la correlación genética entre el peso corporal y rasgos reproductivos han sido estimadas en un rango de 0.33 a 0.69 (Gall, 1975; Gall y Neira, 2004; Su et al., 1997), mostrando una asociación favorable. Sin embargo, no fue reportado en reproductores de agua salobre. La heredabilidad de la frecuencia de puesta de huevos y el intervalo medio de desove obtenido en este estudio fue de 0.07 ± 0.02 y 0.10 ± 0.03, respectivamente. Estos resultados son como los otros hallazgos, indicando que los rasgos de reproducción fueron relativamente menos afectados por la herencia y que los rasgos reproductivos pueden verse más afectados por el medio ambiente, la nutrición de hembras y la maduración, camarones machos, y otros factores. Por lo tanto, para la selección de rasgos reproductivos, se deben seleccionar varias generaciones para obtener suficiente mejora genética. Sin embargo, los estudios que investigan la heredabilidad y la correlación genética entre los rasgos reproductivos y los relacionados con la tasa de crecimiento, siguen siendo escasos en L. vannamei cultivado en agua salobre. La relación entre la tasa de crecimiento y la reproducción es fundamental para la teoría de historia de la vida animal. En


GENÉTICA

- DICIEMBRE 2019 general, la selección artificial puede conducir a compensaciones (Wootton, 1977; Reznick, 1983; Morgan y Metcalfe, 2001; Robinson y Wardrop, 2002) porque las poblaciones naturales están sujetas a variación de crecimiento y alimentación individual, pudiendo enmascarar la representación de una compensación (Roff, 1992). Los resultados de algunas especies mostraron que las cepas con una alta tasa de crecimiento tuvieron menor fecundidad, y aquellos con alta fecundidad tuvieron una menor tasa de crecimiento. Por lo tanto, la relación entre la tasa de crecimiento y la fertilidad son dignas de preocupación. Tsikliras y et al. (2007) informaron que la tasa de crecimiento específico individual de Sardinella aurita en el período de desove estaba negativamente relacionado con su fecundidad. Sin embargo, contrariamente a la teoría de la compensación, Schultz y Warner (1991) refirieron una relación positiva entre los rasgos de reproducción y crecimiento. La relación entre crecimiento y reproducción no ha sido discutida para L. vannamei. En este trabajo, estudiamos la relación entre la tasa de crecimiento y la reproducción en dos etapas diferentes. Los resultados tienen implicaciones importantes para el diseño de programas de reproductores para mejorar la tasa de crecimiento y la eficiencia reproductiva. En este estudio, la población utilizada se basó en familias genéticamente seleccionadas para rasgos de crecimiento. Por lo tanto, las conclusiones preliminares

del estudio se pueden extraer de la relación genética entre la tasa de crecimiento y el rendimiento reproductivo bajo selección artificial a presión. La correlación genética entre el G1R y el promedio de intervalo de tiempo de desove (ASI) fue −0.30 ± 0.18, lo que indica que la tasa de crecimiento temprana del camarón hembra fue más rápida y la recuperación del intervalo de tiempo de desove fue más corto. Por lo tanto, la frecuencia de desove de las hembras fue mayor durante el período de reproducción, reflejando una mayor fertilidad. En la etapa temprana de crecimiento de L. vannamei, la tasa de crecimiento temprano y los rasgos reproductivos no eran compensados. Sin embargo, la correlación genética entre el G2R y el promedio de intervalo de desove (ASI) fue de 0.93 ± 0.10, lo que indica que la tasa de crecimiento del camarón hembra fue más rápida y el intervalo de tiempo de redesove del camarón hembra fue más largo. Por lo tanto, la frecuencia de desove de las hembras fue menor durante el período reproductivo, reflejando baja fertilidad. Existe una clara compensación entre la tasa de crecimiento y los rasgos reproductivos durante la temporada de reproducción, que es probable porque la energía se usa principalmente para la regulación reproductiva durante la temporada de reproducción, y el intercambio de distribución de energía conduce a una correlación negativa entre la tasa de crecimiento y la reproducción. Se encontró una relación genética entre la tasa de crecimiento y la fecundidad diferente según la etapa de

75

crecimiento. Por lo tanto, en la práctica de programas de reproducción, podemos elegir camarones con una tasa de crecimiento rápida de 0 a 4 meses para lograr el propósito de la reproducción indirecta de rasgos productivos (promedio de intervalo de desove), para obtener hembras con más tiempos de desove. Este programa de reproducción es un ganar-ganar tanto para productores, como para laboratorios.

Conclusión

En resumen, aunque L. vannamei se ha cultivado en agua salobre durante 8 meses, los niveles de heredabilidad estimados para peso corporal y rasgos reproductivos son similares a los reportados por otros en el agua de mar. Por lo tanto, el cultivo de camarones reproductores puede llevarse a cabo en agua salobre. La relación genética entre los rasgos reproductivos y la tasa de crecimiento durante la temporada de reproducción de L. vannamei bajo selección artificial a presión, es una compensación y una tasa de crecimiento más rápida de L. vannamei tiene un impacto negativo en el rendimiento reproductivo. Sin embargo, una tasa de crecimiento temprana y los rasgos reproductivos no son una compensación. Por lo tanto, el programa de reproductores genético basado en la tasa de crecimiento de 0 a 4 meses no causa una selección negativa para rasgos reproductivos● Este artículo es un extracto del original, para mayor información tomar contacto con: mengxianhong@ysfri.ac.cn


ESTADÍSTICAS

- DICIEMBRE 2019

COMERCIO EXTERIOR

EXPORTACIONES DE CAMARÓN ECUATORIANO (TONELADAS MÉTRICAS VS DÓLARES) 2010 - 2018

Fuente: Banco Central del Ecuador

EXPORTACIONES DE CAMARÓN ECUATORIANO: COMPARATIVO MENSUAL (LIBRAS) Enero 2016 hasta Octubre 2019

Fuente: Cámara Nacional de Acuacultura

78


ESTADÍSTICAS

- DICIEMBRE 2019

COMERCIO EXTERIOR

EVOLUCIÓN DEL PRECIO DEL CAMARÓN ECUATORIANO: PROMEDIO ANUAL (LIBRA) 2013 - 2018

EVOLUCIÓN DEL PRECIO DEL CAMARÓN ECUATORIANO: PROMEDIO MENSUAL (LIBRA) Octubre 2017 hasta Octubre 2019

PORCENTAJE DE PARTICIPACIÓN DE MERCADO DEL CAMARÓN ECUATORIANO (LIBRAS) Enero a Octubre 2018 vs Enero a Octubre 2019

Fuente: Cámara Nacional de Acuacultura

79


URNER BARRY

- DICIEMBRE 2019

Importaciones de Estados Unidos Importaciones de Estados Unidos: Todos los tipos, por tipo Las importaciones de septiembre muestran una disminución del 1.1 por ciento en el volumen total, pero el total de nueve meses sigue siendo 1.1 por ciento de eneroseptiembre 2019. De nuestros siete principales socios comerciales, India (+ 11.4%), Indonesia (+ 5.6%), Vietnam (+ 8.2%) y México (+ 72.9%) enviaron más. Mientras tanto, Ecuador (-2.4%), Tailandia (-11.1%) y China (-70.4%) enviaron menos camarón a los EE.UU. En términos de forma de producto, EE. UU. continuó importando más camarón sin cabeza con cáscara, que incluye pelado fácil, (+ 1.1%) y pelado (+ 3.6%); pero continúan importando menos los cocidos (-22.6%) y empanizados (-13.1%). Importaciones de camarón de EE.UU. por país (todos los tipos) India: La relevancia de India continúa ampliándose a medida que su participación en la importación total de camarón en septiembre se amplió a más del 43 por ciento de las importaciones totales del mes. Enviaron un 11.4 por ciento adicional en comparación con el mismo momento del año pasado, y a medida que aumentan las ganancias año tras año, un nuevo récord está al alcance. De hecho, las importaciones del año hasta la fecha en 2019, aumentaron un 13 por ciento. Las importaciones procedentes de la India están en camino de superar 600 millones de libras. Indonesia: por quinto mes consecutivo, las importaciones de Indonesia avanzaron (+5.6%) desde el año pasado, reduciendo la cifra anual, que todavía está ligeramente por debajo de 2018. Indonesia representó casi el 17 por ciento del total mensual, un buen marco de referencia para ver cómo se acumulan los importadores número uno y dos. Ecuador: las importaciones de Ecuador

continuaron disminuyendo en comparación con el año pasado. El producto traído de este país fue 2.4 por ciento más bajo. Tanto el camarón con cáscara (-5.1%) como el pelado (-7.5%) fueron menores. Tailandia y Vietnam: las importaciones mensuales de septiembre fueron más altas para Vietnam (+ 8.2%) y más bajas para Tailandia (-11.1%). China también experimentó un fuerte descenso (70.4%). Esto fue impulsado por las compras relacionadas con ASF en la región. Importaciones de camarón con cáscara, por ciclo y tamaño Importaciones de camarón con cáscara sin cabeza, que incluye pelado fácil 1.1% más alto en septiembre que en el mismo mes del año pasado. Las ganancias en u/ 15, 21-25, 26-30, 31-40 y o/70 superaron las pérdidas en los otros tamaños. Los valores de reemplazo (importación $/lb.) del camarón HLSO continuaron al alza ya que los precios en el extranjero han experimentado aumentos significativos. Con China como un gran comprador de todas las proteínas, esto se está convirtiendo en un tema común en el mercado. El promedio del mes fue de $ 3.80 por libra, un aumento de $ 0.04 por libra con respecto al mes pasado y $ 0.18 por libra por encima del año pasado.

80

Importaciones de camarón pelado, como valor agregado Los camarones pelados y desvenados continuaron encontrando apoyo entre los compradores. Las importaciones en el mes de septiembre fueron 3.6 por ciento más altas que el año pasado a pesar de la caída mes a mes. Los valores de reemplazo (importación $/lb.) para camarón pelado también aumentó a $ 4.05 para septiembre, otros $ 0.09 por libra. Las importaciones del cocido (agua tibia) continuaron presionándose a la baja. Las cifras de septiembre disminuyeron un 22.6 por ciento con respecto al año pasado, con pérdidas de base amplia. India fue el único país positivo. Las importaciones de empanizado también fueron menores, llegando a 13.1 por ciento por debajo de las cifras de 2018. Importaciones de camarón cocido, empanizado y otros Algunos de los productos de valor agregado están comenzando a ver algún interés inicial por las festividades. El valor promedio de todas las importaciones de camarón en el mes de septiembre volvió a aumentar a $ 3.96 por libra. Línea de tiempo del mercado del camarón; anuncios minoristas Venta minorista: ahora que el calendario ha cambiado, hay un mayor enfoque


URNER BARRY

- DICIEMBRE 2019 en el camarón de venta minorista. Las oportunidades de compra aumentaron casi un 16 por ciento desde agosto, y más del 21 por ciento desde el año pasado. El precio promedio también aumentó a $7.56 por libra. Suministro de camarón en los Estados Unidos y situación en el Golfo Los precios han sido bastante dispersos y reflejan en gran medida la posición de una empresa individual en el mercado, pero los promedios generalmente sugieren fortaleza y, por lo tanto, los premiums han surgido en todo el complejo. Los suministros son limitados y los precios de reemplazo aumentan. Los desembarques mensuales en la costa del Golfo continuaron sin alcanzar las cifras del año anterior. El Servicio Nacional de Pesca Marina reportó desembarques de septiembre de 2019 (todas las especies, sin cabeza) de 9.041 millones de libras en comparación con 10.322 millones en septiembre de 2018. Lo que se coloca ahora es 57.4 millones de libras frente a 71.1 millones de libras en 2018.

Exportación de camarón ecuatoriano Camarón blanco cultivado: Si bien hubo algunas situaciones competitivas, ha ayudado un mayor precio en el extranjero junto con un mejor período de compra. El producto parece más estable que el mes pasado.

81

Camarón tigre negro cultivado: El camarón tigre negro permanece firme y deseado, otros tamaños en su mayoría estables.


NOTICIAS

- DICIEMBRE 2019

Ferias internacionales Conxemar En Vigo, España, del 1 al 3 de Octubre de 2019 se desarrolló la feria Internacional de Productos del Mar Congelados (CONXEMAR), que es un importante referente comercial para el mercado europeo. Se realizó en una superficie de exposición de 31,500 m² y participaron las exportadoras ecuatorianas: Edpacif, Expalsa, Omarsa y Songa.

China Fisheries & Seafood Expo Ecuador First Class Shrimp estuvo presente en la feria comercial de productos del mar más importante de Asia, la misma que representa para el sector exportador una gran oportunidad de negocios para ampliar la comercialización a ese destino. La cita comercial se desarrolló en Qingdao, China del 30 de octubre al 1 de noviembre de 2019. Las empresas ecuatorianas participantes fueron: Alimesa, Cofimar, Edpacif, Expalsa, Exportquilsa, Nirsa, Omarsa, Proexpo, Promarosa, Santa Priscila y Songa. Sustainable Shrimp Partnership también estuvo presente en este importante encuentro de negocios.

82


NOTICIAS

- DICIEMBRE 2019

Sustainable Shrimp Partnership y la escuela de los Chefs El 25 de octubre en el Centro de Convenciones de Guayaquil se desarrolló el Master Class, junto a profesionales nutricionistas y chefs, en el marco del trabajo conjunto entre Sustainable Shrimp Partnership y la escuela de los Chefs. En el encuentro se realizó una presentación donde se evidenció el compromiso de SSP en alcanzar y promover los más altos estándares ambientales y sociales, enfatizando en los estrictos criterios del producto, que todos los miembros deben cumplir para ser parte de esta iniciativa como: el cero uso de antibióticos, neutro impacto en el agua, completa trazabilidad, indicó Pamela Nath, Directora de SSP. Desde abril de 2019 SSP y la Escuela de los Chefs están en la elaboración de una guía técnica de camarón. El objetivo es, que a través del trabajo de investigación del instituto culinario, se pueda determinar las mejores técnicas para que el camarón sea el protagonista en el plato, resaltando su sabor y propiedades nutricionales de “El mejor camarón del mundo”.

84


NOTICIAS

- DICIEMBRE 2019

ECOS DE AQUA EXPO Skretting dictó conferencia de sostenibilidad en Aquaexpo 2019

(De izquierda a derecha): Alexandra Vásconez, Gerente de Marketing & Comunicaciones Skretting Latam, Alex Obach, Director Innovación ARC (Centro de Investigación en Acuicultura) Skretting global, José Villalón, Director de Sostenibilidad de Nutreco-Skretting, Carlos Miranda, Gerente General Skretting Latam.

En octubre, Skretting participó en Aquaexpo 2019, evento que acogió a grandes representantes locales e internacionales del sector entre ellos a José Villalón, Director Corporativo de Sostenibilidad de Skretting, quien participó en la conferencia de Tendencias y oportunidades en la acuicultura sostenible, en la que desarrolló temas como el suministro de materias primas para los alimentos

(especialmente proteína marina), la extensión de la frontera acuícola, los impactos ambientales en materias primas y el comportamiento de los mercados y la exigencia de los consumidores (en términos de sostenibilidad y certificaciones).

Cargill presente en Congreso Mundial de Acuacultura 2019

De izquierda a derecha: César Suárez, Gerente de Ventas Cargill, David Arévalo, Gerente de Distribución; Arturo Lomeli, Líder regional SMT; Eduardo Arosemena, Gerente Regional Early nutrition; y Juan Enríque Rosales, Director global de tecnología.

Con el objetivo de continuar trabajando en el posicionamiento de socio estratégico del productor camaronero, la empresa Cargill participó en el Congreso camaronero más importante del continente. Luis Alejandro Daqui, Líder Global de Tecnología de Cargill participó

85

como conferencista con el tema: “Impacto de los cambios estacionales en la producción de camarones”, ofreciendo un importante aporte en conocimientos y experiencias en el ámbito de la acuacultura, específicamente en el cultivo de camarón.


AQUACULTURA #132  

Revista especializada de la Cámara Nacional de Acuacultura.

AQUACULTURA #132  

Revista especializada de la Cámara Nacional de Acuacultura.