PGR Student Conference 2022 | Poster Presentations Brochure

LSTM PGR Student Conference 2022

#lstmpgrconf2022

Postgraduate Research Degree

2022

Student Conference

Tuesday 21 June - Wednesday 22 June 09:00 - 17:00 (GMT)

Poster Presentations

Scan to visit our event website

Welcome Welcome to the LSTM PGR Student Conference digital poster presentation brochure for 2022 where you will find a collection of poster submissions for this year’s LSTM’s annual Postgraduate Research Student Conference.

2

We hope you enjoy viewing and welcome your feedback at pgr@lstmed.ac.uk

LSTM Postgraduate research students in the initial years of their studies have been challenged to produce an academic poster which promotes understanding of their research project to an academic audience outside of their own discipline.

Each poster has been submitted with an accompanying audio ‘poster pitch’ where you will hear a 3-minute audio clip from the student themselves introducing their research. Clicking the play button next to the student’s poster will open the audio file.

As this year’s virtual PGR Conference event on June 21st and 22nd there has been time allocated for viewing of the posters in our virtual exhibitor’s area on day 1 for students based off-site and in the exhibition hall of the Conference venue on day 2 where you will be able to interact with the students about their submissions and provide feedback. Prizes will be awarded for the best posters. Voting will be carried out by a panel of academic staff from each research department.

3

4

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Contents You may flick through the full brochure page-by-page to view all of the students’ academic posters or click on any name from the list below to head straight to a student’s page. Along with every poster you will be directed to listen to each student’s poster pitch by clicking on the button at the bottom of the left-hand page, which will open up a new tab in your browser.

6

Victor Akelo

52

Leonard Mvaya

8

John Archer

54

Ambayo Peter Otte Nyumbe

10

Hellen Barsosio

56

Ambrose Oruni

12

Keirah Bartlett

58

Lilian Otiso

14

Sara Begg

60

Manuela Parnoffi

16

Mohammad Badrul Bhuiyan

62

Joseph Phiri

18

Aaron Chirambo

64

Mphatso Phiri

20

Shahreen Chowdhury

66

Emma Reid

22

Faduma Farah

68

Nick Riches

24

Aidan Foo

70

Sara Rooney

26

Sarah Gallichan

72

Doreen Sakala

28

Katherine Gleave

74

Isabel Saldanha

30

Susan Gould

76

Yusupha Sanyang

32

Caitlin Greenland-Bews

78

Duncan Shikuku

34

Gracious Jamali

80

Lusako Sibale

36

Kostas Liatsikos

82

Lindiwe Sibiya

38

Galven Maringwa

84

Leticia Suwedi-Kapesa

40

Ellen Masters

86

Melissa Taylor

42

Primrose Matambanadzo

88

Caitlin Thompson

44

Agnes Matope

90

Chukwuebuka Ugwu

46

Hauwa Mohammed

92

Anna Wickenden

48

Mosepele Mosepele

94

Murielle Wondji

50

Betwel Msugupakulya

96

Xiaohan Xu 5

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Victor Akelo Adverse pregnancy outcomes associated with COVID-19 infection in Western Kenya

Background The COVID-19 pandemic has caused over 240 million infections and 5 million deaths. Little is known about the impact of COVID-19 on pregnancy outcomes in Sub-Saharan Africa. We followed a cohort of COVID-infected and uninfected pregnant women in Kenya until six weeks postpartum to assess the burden of COVID-19 and its association with poor maternal and neonatal outcomes.

Methods We conducted repeat SARS-COV-2 testing using polymerase chain reaction (PCR) on pregnant women enrolled in an antenatal COVID-19 cohort study (AnCOV).

Those infected were managed according to Kenya Ministry of Health COVID-19 clinical guidelines.

Adverse pregnancies outcomes were compared among SARS-CoV-2 infected and uninfected women using multivariate log-binomial generalized linear models.

Authors Victor Akelo1, Gregory Ouma2, Joyce Were2, Sammy Khagayi2, Dickson Gethi2, Richard Omore2, Feiko ter Kuile3, Marc Bulterys1, Dickens Onyango4, Beth A. Tippett Barr1 Author’s affiliation 1

S Centers for Disease U Control and Prevention, Kisumu and Nairobi Kenya

2

enya Medical Research K Institute, Kisumu, Kenya

3

iverpool School of L Tropical Medicine, 4County Health Department, Kisumu, Kenya

Results Between August 2020 and August 2021, 1688 pregnant women were enrolled; 998 completed pregnancy follow-up.

Of those, 259 (26.0%) had adverse outcomes, and 169 (22%) tested positive for SARS-CoV-2, of whom 93 (55%) were symptomatic. The most prevalent symptoms included cough (76.1%), headache (47.9%), anorexia (41%), anosmia (35.0%), fatigue (30.8%), joint pains (29.1%), fever (28.2%), runny nose (23.1%), chills (19.7%) and myalgia (12.8%). Fourteen COVID-19 pregnant women required hospitalization; none were admitted in ICU. Very low birthweight (<1500g) (adjusted relative risk (aRR) 4.78, 95% CI 1.11-20.49), very preterm birth (<34 weeks) (aRR=2.57, 1.34-4.90) and preterm birth (<37 weeks) (aRR=1.54, 1.03-2.29) were more common among women with COVID-19.

There were no significant associations between COVID-19 in pregnancy and hypertensive disorders of pregnancy, preeclampsia, stillbirths and perinatal deaths the precise findings of the study.

Conclusions SARS-CoV-2 infection increases the risk of very low birth weights and very preterm births in western Kenya.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 6

ADVERSE PREGNANCY OUTCOMES ASSOCIATED WITH COVID-19 INFECTION IN WESTERN KENYA Victor Akelo1, Gregory Ouma 2, Joyce Were2,, Sammy Khagayi2,, Dickson Gethi2,, Richard Omore2,, Feiko ter Kuile3, Marc Bulterys1,, Dickens Onyango4 Beth A. Tippett Barr1 1US Centers for Disease Control and Prevention, Kisumu and Nairobi Kenya, 2Kenya Medical Research Institute, Kisumu, Kenya, 3Liverpool School of Tropical Medicine, 4County Health Department, Kisumu, Kenya

BACKGROUND • The COVID-19 pandemic has caused over 240 million infections and 5 million deaths. Little is known about the impact of COVID-19 on pregnancy outcomes in Sub-Saharan Africa. We followed a cohort of COVID-infected and uninfected pregnant women in Kenya until six weeks postpartum to assess the burden of COVID-19 and its association with poor maternal and neonatal outcomes METHODS • We conducted repeat SARS-COV-2 testing using polymerase chain reaction (PCR) on pregnant women enrolled in an antenatal COVID-19 cohort study (AnCOV) • Those infected were managed according to Kenya Ministry of Health COVID-19 clinical guidelines • Adverse pregnancies outcomes were compared among SARS-CoV-2 infected and uninfected women using multivariate log-binomial generalized linear models SARS-CoV-2 infection increases the risk of very low birth weights and very preterm births even among pregnant women with mild to moderate COVID-19

RESULTS • Between August 2020 and August 2021, 1688 pregnant women were enrolled; 998 completed pregnancy follow-up • Of those, 259 (26.0%) had adverse outcomes, and 169 (22%) tested positive for SARS-CoV-2, of whom 93 (55%) were symptomatic. The most prevalent symptoms included cough (76.1%), headache (47.9%), anorexia (41%), anosmia (35.0%), fatigue (30.8%), joint pains (29.1%), fever (28.2%), runny nose (23.1%), chills (19.7%) and myalgia (12.8%). Fourteen COVID-19 pregnant women required hospitalization; none were admitted in ICU • Very low birthweight (<1500g) (adjusted relative risk (aRR) 4.78, 95% CI 1.11-20.49), very preterm birth (<34 weeks) (aRR=2.57, 1.34-4.90) and preterm birth (<37 weeks) (aRR=1.54, 1.03-2.29) were more common among women with COVID-19 • There were no significant associations between COVID-19 in pregnancy and hypertensive disorders of pregnancy, preeclampsia, stillbirths and perinatal deaths the precise findings of the study CONCLUSIONS • SARS-CoV-2 infection increases the risk of very low birth weights and very preterm births in western Kenya.

ADDITIONAL KEY INFORMATION Author Contact Information • Email: wsm4@cdc.gov • Phone: +254722205543 Acknowledgements: • Study participants • AnCOV Study team • KEMRI, US CDC, Kenya Ministry of Health • BMGF- study sponsor

Table 1: Pregnancy outcomes comparing COVID-19 infected and non-COVID-19 infected pregnant women enrolled in an antenatal, intrapartum and post-partum COVID-19 (AnCoV) prospective study in western Kenya, 2020-2021 Outcome

Total

Unadjusted Risk Ratio

Adjusted Risk Ratio

Hypertensive disorders of pregnancy

22 (2.0)

1.15 (0.26, 5.05)

pvalue 0.857

Preeclampsia

3 (0.3)

6.88 (0.43, 109.18)

0.172 6.99 (0.42, 116.88) 0.176

Preeclampsia or Eclampsia Fetus/Infant Outcomes Stillbirth

3 (0.3)

6.88 (0.43, 109.18)

0.172 6.99 (0.42, 116.88) 0.176

48 (4.8)

0.40 (0.05, 3.0)

0.368

Perinatal death

9 (0.9)

0.27 (0.04, 2.00)

0.197

0.28 (0.04, 2.08)

0.215

Very low birthweight (<1500g)

8 (1.0)

4.99 (1.13, 22.00)

0.034

4.78 (1.11, 20.49)

0.035

Low birthweight (<2500g)

63 (6.0)

1.63 (0.87, 3.05)

0.129

1.61 (0.86, 3.01)

0.138

Very preterm birth (<34 weeks)

88 (9.0)

1.23 (0.69, 2.20)

0.488

1.32 (0.74, 2.37)

0.345

222 (22.0)

1.02 (0.71, 1.46)

0.924

1.07 (0.75, 1.53)

0.714

83 (8.0)

2.44 (1.26, 4.69)

0.008

2.57 (1.34, 4.90)

0.004

212 (21.0)

1.49 (0.99, 2.24)

0.053

1.54 (1.03, 2.29)

0.036

Maternal

Outcomes1

Preterm birth (<37 weeks) Very preterm birth (<34 weeks) - COVID+ onset <34w Preterm birth (<37 weeks) - COVID+ onset <37w 1Adjusted 2No

n (%)

Unadjusted RR (95% CI)

for age (categorical; "underage 20" and "age 35 and older" as confounders) maternal deaths were documented during the course of the study

Adjusted RR2

1.17 (0.27, 5.17)

0.40 (0.05, 2.99)

pvalue 0.832

0.372

LSTM PGR Student Conference 2022 #lstmpgrconf2022

John Archer Hybridisation in UroGenital Schistosomiasis (HUGS): Pilot study findings upon parasitological surveys in Mangochi and Nsanje Districts, Malawi

Authors Archer, J., Juhàsz, A., Cunningham, L., Jones, S., Kayuni, S., Al-Harbi, M., Makaula, P., LaCourse, EJ., Musaya, J., Stothard, JR.

8

Abstract The HUGS (Hybridisation in UroGenital Schistosomiasis) study is a 4-year Wellcome Trust funded collaboration between the Liverpool School of Tropical Medicine and the Malawi-Liverpool-Wellcome Trust Clinical Research Centre. In November of 2021, a pilot parasitological survey was carried out in eight primary schools in Mangochi District, along the shoreline of Lake Malawi, and in Nsanje District, along the Lower Shire River. The primary purpose of these surveys was to assess the prevalence of urogenital schistosomiasis, caused by infection with Schistosoma haematobium and collect various samples for molecular identification of schistosomes, specifically human-infecting (e.g. S. haematobium) and animal-infecting (e.g. S. mattheei and bovis) worms. A collection was also made of their associated intermediate freshwater snail hosts. In addition, the prevalence of intestinal schistosomiasis, caused by infection with S. mansoni, was surveyed following a recent outbreak of intestinal schistosomiasis in Mangochi District. The intention of the pilot was to help in careful selection of two communities in each district for later in-depth disease surveillance, inclusive of assessments of giardiasis and malaria in each area. Here, we report on initial epidemiological findings from the pilot study, as well as outline planned future work with respect to additional parasitological surveys implementing molecular genotyping/diagnostics assays. Collectively, we will explore Schistosoma hybrids and their molecular epidemiology concurrent alongside preventive chemotherapy campaigns.

Hybridisation in UroGenital Schistosomiasis (HUGS): Pilot study findings upon parasitological surveys in Mangochi and Nsanje Districts, Malawi

@HUGS_LSTM

Archer, J1, Juhász, A1,2, Cunningham, L1, Jones, S1, Kayuni, S1,3,4, Al-Harbi, M1, Makaula, P3,4, LaCourse, EJ1, Musaya, J3,4, Stothard JR1 1 Department of Tropical Disease Biology, Liverpool School of Tropical Medicine (LSTM), Liverpool, UK; 2 Institute of Medical Microbiology, Semmelweis University, Budapest, Hungary; 3 Malawi Liverpool Wellcome Trust Programme of Clinical Tropical Research, Queen Elizabeth Central Hospital, College of Medicine, Blantyre, Malawi; 4 Department of Medical Sciences, College of Medicine, University of Malawi, Blantyre, Malawi

1. Summary

4. Results

The HUGS (Hybridisation in UroGenital Schistosomiasis) study is a 4-year Wellcome Trust funded collaboration between the Liverpool School of Tropical Medicine and the Malawi-Liverpool-Wellcome Trust Clinical Research Centre. In November of 2021, a pilot parasitological survey was carried out in eight primary schools in Mangochi District, along the shoreline of Lake Malawi, and in Nsanje District, along the Lower Shire River. Here, we report on initial epidemiological findings from the pilot study, as well as outline planned future work with respect to additional parasitological surveys implementing molecular genotyping/diagnostics assays.

Prevalence of infection with urogenital schistosomiasis (S. haematobium), intestinal schistosomiasis (S. mansoni), giardiasis (G. duodenalis) and malaria (Plasmodium spp.) can be seen in Table 1.

Table 1: Average prevalence (%) of urogenital schistosomiasis, intestinal schistosomiasis, giardiasis and malaria in Mangochi and Nsanje districts District [No. Participants]

Urogenital schistosomiasis (Urine-egg microscopy)

Intestinal schistosomiasis (CCA-RDT)

Giardiasis (QUIK-CHEK RDT)

Malaria (Plasmodium spp.)

Mangochi [364]

38% [15% – 80%]*

25% [0% - 48%]*

29% [26.4% - 33.9%]*

19% [17% - 22%]***

Nsanje [94]

34% [5% – 65%]*

5% [0% - 5%]**

Not assessed

Not assessed

2. Introduction These pilot surveys were carried out to assess the prevalence of urogenital schistosomiasis, caused by infection with S. haematobium, and collect various samples for molecular identification of schistosomes; specifically human-infecting (i.e., S. haematobium) and animal-infecting (e.g. S. mattheei & S. bovis) species. In addition, the prevalence of intestinal schistosomiasis, caused by infection with S. mansoni, was surveyed following a recent outbreak of intestinal schistosomiasis in Mangochi District1.

Schistosoma spp. intermediate freshwater snail hosts were also collected. The purpose of the pilot was to help in careful selection of two communities in each district for later indepth disease surveillance, inclusive of assessments of giardiasis and malaria in each area. Collectively, we will explore Schistosoma spp. hybrids2,3 and their molecular epidemiology concurrent alongside preventive chemotherapy campaigns.

3. Methods Parasitological surveys were carried out in four Mangochi District schools and four Njanje District schools (Figure 1).

Urine filtration/microscopy and Haemastix RDTs were used to diagnose infection with S. haematobium, whereas Kato-Katz stool microscopy and CCA-RDTs were used to diagnose infection with S. mansoni. In addition, G. duodenalis. QUIK-CHEK RDTs were used to screen for infection with giardiasis and malaria Ag P.f/Pan blood RDTs were used to screen for infection with Plasmodium spp.

Pathology data was collected via questionnaire and via faecal-occult blood RDTs. Malacological freshwater snail surveys were also carried out in both Mangochi and Nsanje Districts (Figure 1). Snails were collected and screened for infection with Schistosoma spp. using standard collection and shedding protocols.

Clinical samples (faeces and bloodspots) as well as parasite (Schistosoma eggs, miracidia and cercariae) and freshwater snail (Bulinus and Biomphalaria) material was also stored and transported back to the UK for molecular analyses.

A

C

* Prevalence (%) range between Samama, Mchoka, Syungusya and Malinde schools ** Prevalence (%) range between Mthawira, Mguda, Dinde and Phanga schools *** Prevalence (%) range between Samama and Mchoka schools

A

B

C

Figure 3: Collected urine and stool samples (A); S. mansoni egg found in urine sample (B); Bulinus and Biomphalaria freshwater snails undergoing shedding analyses

Bulinus spp. freshwater snails were collected at 16/25 (64%) sites surveyed in Mangochi, whereas Biomphalaria spp. freshwater snails were collected at 7/25 (28%) of these sites.

Here, many Bulinus were found to be actively shedding Schistosoma spp. cercariae, whereas no Biomphalaria were found to be shedding Schistosoma spp. cercariae.

Bulinus spp. freshwater snails were collected at 1/5 (20%) sites surveyed in Nsanje, whereas no Biomphalaria spp. freshwater snails were collected in this area. Here, no collected snails were found to be shedding Schistosoma spp. cercariae.

Of note: • Atypical S. haematobium eggs were often found in participants’ urine • Ectopic and potentially viable S. mansoni eggs were often found in participants’ urine • Non-P. falciparum malaria was detected in a small number (~2%) of cases • Bulinus forskalii, Bulinus nyassanus and Bulinus africanus were collected at various sites across Mangochi district (speciated based on shell morphology) • Many more Biomphalaria spp. freshwater snails were collected than found during previous snail surveys, suggesting population increase since 2019

5. Discussion and future work Urogenital and intestinal schistosomiasis, giardiasis and malaria are prevalent in Mangochi District. Urogenital schistosomiasis is also prevalent in Nsanje District.

Intestinal schistosomiasis was found to be prevalent in Nsanje District by CCA-RDT, however this requires confirmation by molecular diagnosis. Giardiasis and malaria were not surveyed in Nsanje District. Both Bulinus spp. and Biomphalaria spp. freshwater snails were found in Mangochi District, whereas only Bulinus spp. freshwater snails were found in Nsanje District.

B

D

Future molecular diagnosis and characterisation • Genotype S. haematobium eggs/miracidia/cercariae and screen for potential hybrids between human-infecting and non-human-infecting species (atypical eggs?)

• Ascertain the prevalence of infection with S. mansoni using highly-sensitive faecal realtime PCR • Genotype S. mansoni eggs/miracida/cercaria. S. mansoni has not yet been genotyped in this area • Genotype collected Bulinus spp. and Biomphalaria spp. specimens

Figure 1: Schools surveyed in Mangochi (A) and Nsanje (B) Districts; snail sites surveyed in Mangochi (C) and Nsanje (D) Districts

A

B

C

• Screen collected Bulinus spp. and Biomphalaria spp. freshwater snails for infection with Schistosoma spp. using highly-sensitive real-time PCR molecular xenomonitoring techniques4,5. This is especially important as no Biomphalaria freshwater snails were found to be actively shedding schistosomes • Genotype G. duodenalis assemblages A and B, and investigate any association between infection with either/both assemblages and pathology6 (e.g., diarrhea, fecal occult blood)

Figure 2: School diagnostic surveys (A); school questionnaires (B); Freshwater snail collection (C)

• Genotype P. falciparum and non-P. falciparum malaria infections, and screen for antigen-RDT ’diagnostic resistance’7

References: 1. Kayuni, et al., 2020. Infect. Dis. Pov. DOI: 10.1186/s40249-020-00736-w; 2. Webster, et al., 2019. Emerg. Infect. Dis. DOI: 10.3201/eid2506.190020; 3. Stothard, et al., 2020. PLoS NTDs. DOI: 10.1371/journal.pntd.0008201; 4. Pennance & Archer , et al., 2020. Molecules. DOI: 10.3390/molecules25174011; 5. Schols, et al., 2019. Trans. Roy. Soc. DOI: 10.1093/trstmh/trz067. 6. Zajaczkowski, et al., 2021. Cur. Res. Parasitol. Vec. Borne. Dis. DOI: 10.1016/j.crpvbd.2021.100055. 7. Gringard, et al., 2020. E. Bio. Med. DOI: 10.1016/j.ebiom.2020.102757.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Hellen Barsosio Targeted information transfer improves the use of intermittent preventive treatment with dihydroartemisinin-piperaquine to prevent malaria in pregnancy: a three-arm pragmatic cluster randomised trial in western Kenya Background Malaria in pregnancy has devastating consequences for the mother and foetus.

WHO recommends intermittent preventive treatment in pregnancy (IPTp) with sulphadoxine-pyrimethamine (SP) to prevent adverse birth outcomes, but highlevel SP resistance threatens its efficacy. Dihydroartemisinin-piperaquine (DP), the most promising candidate to either replace or be co-administered with SP for IPTp, is a multiday regimen unlike SP. We aimed to assess women’s adherence to, and the health system’s delivery effectiveness of IPTp-DP with or without targeted information transfer.

Authors Hellen C. Barsosio1,2, Jayne Webster3, Frederick Omiti2, Alloys K’Oloo2, Michael A. Ojuok2 , Dawn Odiwa2, Benson Omondi2, Elizabeth Okello2, Miriam Taegtmeyer1, Feiko O. ter Kuile1, Maia Lesosky1, Simon Kariuki2, Jenny Hill1 Author’s affiliation 1

iverpool School of L Tropical Medicine, UK

2

enya Medical Research K Institute, Center for Global Health Research, Kenya

3

ondon School of Hygiene L and Tropical Medicine, UK

Methods We conducted a three-arm open-label cRCT in 15 antenatal care clinics in western Kenya over 14-months involving a 10-month implementation phase (Nov 2019 to Sep 2020) and a 4-month evaluation phase (Sept-Dec 2020).

The IPTp-SP control arm delivered SP as a standard single-day dose; the IPTpDP arm delivered a standard weight-based 3-day dose; IPTp-DP-Plus arm delivered IPTp-DP alongside targeted information transfer. Health system’s delivery effectiveness was assessed using ANC exit interviews, and adherence was assessed on the 4th and 5th day post-dosing via home visits. We used generalised linear mixed models to assess outcomes.

Results In total, 1189 exit interviews were done. Adherence to DP was 18% higher in IPTp-DP-Plus arm relative to IPTp-DP arm (aRR 1.18 (1.05-1.33), p=0.005).

Compared to IPTp-SP arm, IPTp-DP arm delivery effectiveness was 15% lower (aRR 0.85 (0.76-0.95), p=0.003), but similar to IPTp-DP-Plus arm (aRR 0.97 (0.90-1.06), p= 0.540). The delivery effectiveness of IPTp-DP-Plus arm was 14% higher than IPTp-DP (aRR 1.14 (1.04-1.26), p=0.005).

Conclusion Targeted information transfer significantly boosts use of DP for of IPTp in routine healthcare settings.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 10

Targeted information transfer improves the use of intermittent preventive treatment with dihydroartemisinin-piperaquine to prevent malaria in pregnancy: a three-arm pragmatic cluster randomised trial in western Kenya Hellen Barsosio1,2

1.Kenya Medical Research Institute, Centre for Global Health Research, 2. Liverpool School of Tropical Medicine Kenya

1. Background

b) Antifolate resistance

a) Introduction •

Malaria in pregnancy increases the risks of adverse pregnancy outcomes including pregnancy loss, preterm delivery and low birth weight.

•

WHO recommends intermittent preventive treatment (IPTp) with sulphadoxine-pyrimethamine (SP) to prevent malaria infection during pregnancy as one of three core strategies for malaria prevention (Fig.1). a

b

c) Alternatives to SP in HIV-negative women

• However, high-level SP resistance threatens its efficacy in malaria-endemic eastern and southern Africa (Fig.2)

•

DP likely to either replace or be co-administered with SP as IPTp.

c

Figure 2: Prevalence of the quintuple K540E mutation (c) and sextuple A581G mutation (d) in Eastern and Southern Africa (Walker, Floyd et al. 2017)

• No suitable alternatives to IPTp-SP now; Dihydroartemisininpiperaquine (DP) is the most promising candidate in trials.

Figure 1: The other two malaria prevention strategies include use of insecticide treated bednets (a), screening and treatment of malaria (b,c) (Photo credit: EDCTP)

• IPTp-DP is effective against placental malaria and malaria infection during pregnancy compared to IPTp-SP (Fig.3)

Figure 3: Forest plot of the efficacy of IPTp-DP vs IPTp-SP for the prevention of malaria in pregnancy in sub-Saharan Africa in HIV negative women (Desai et al., 2018).

• •

DP is a multiday regimen unlike SP Targeted information transfer to both users and providers could improve use of new complex interventions within routine health care settings.

2. Methods d) Study sites

a) Objectives

• Primary: To assess adherence to completing preventive treatment in the home, and completing preventive treatment at the indicated time, in nontrial settings.

• Secondary: To assess the systems effectiveness of delivering IPTp-DP and IPTp-DP-plus (targeted information transfer intervention) through ANC compared to current policy (IPTp-SP) among HIV-uninfected pregnant women in the routine health system i.e. non-trial settings.

b) Study design

• A three-arm pragmatic cluster randomised trial • Initial 10-month implementation phase (Nov2019-Dec2020) and a 4-month end evaluation phase (Sept-Dec2020)

c) Study population

Key Inclusion criteria • HIV-negative pregnant women in 2nd and 3rd trimester • Obtained voluntary consent • Attending ANC clinic trial sites Key Exclusion criteria • HIV-positive or HIV-status unknown • Women in 1st trimester • Private or mission hospitals

Figure 4: Study sites- 15 antenatal clinics in government primary care facilities in Kisumu and Homa Bay Counties in western Kenya (Image credit: qGIS).

e) Sample size •

f) Arms •

• •

LINK: Kenya population adjusted malaria prevalence PAPfPR2-10 at 1 × 1 km spatial by subcounty (2015)

IPTp-SP: standard single-day three-tablet stat course 500mg/25mg of SP(standard of care) IPTp-DP arm: DP as a standard 3-day course of 3 to 5 tablets (40/320mg) per day based on body weight (Eurartesim®, Sigma Tau, Italy) IPTp-DP-Plus arm: IPTp-DP was delivered alongside targeted information transfer.

Between 1000 (750 contributors, 250 per arm) and 1400 (1,050 contributors, 350 per arm) women. A sample size of 250 per arm would detect a 65% adherence rate with 7.6% precision (DE=1.65), and a sample size of 350 per cluster would allow a precision of 6.9% (DE=1.91).

3.Outcomes a) Adherence (primary outcome): defined as women completing their multiday DP regimen, verified by pill count. Outcome assessed with home visit interviews and pill counts on the 4th and 5th day post-dosing in IPTp-DP and IPTp-DP-Plus arms only. b) Delivery effectiveness (secondary outcome): defined as women receiving the correct number of tablets per study arm and correctly repeating dosing instructions. Outcome assessed using ANC exit interviews in all arms.

• We used generalised linear mixed models to assess outcomes by arm.

4. Results a) Adherence: • 10% absolute difference in adherence between IPTp-DP-Plus and IPTp-DP (83.4% (266/319 vs 73.4% (196/297) vs) • 18% relative higher adherence in IPTp-DP-Plus compared to IPTp-DP (Table 1)

Adherence (IPTp-DP-Plus vs IPTp-DP) Arm

f) Targeted information transfer (IPTp-DP-Plus)

aRR, (95%CI)

IPTp-DP

1

IPTp-DP-Plus

1.18 (1.05-1.33)

p-value 0.005

Table 1: Generalized linear model regression analysis of adherence outcomes by arm

DP weight band 36-<60 kg: 3 tablets 60-<80 kg: 4 tablets >=80 kg: 5 tablets

b) Absolute delivery effectiveness:

c) • • •

Relative delivery effectiveness: IPTp-DP vs IPTp-SP: 15% lower delivery effectiveness IPTp-DP-Plus vs IPTp-SP: Delivery effectiveness similar IPTp-DP-Plus vs IPTp-DP: 14% higher delivery effectiveness

Arm IPTp-SP IPTp-DP IPTp-DP-Plus

Systems effectiveness IPTp-DP-Plus vs IPTp-DP IPTp-DP and IPTp-DP-Plus vs IPTp-SP aRR, (95%CI)) p-value aRR, (95%CI)) p-value 1 1 0.85 (0.75-0.95) 0.003 1.14 (1.04-1.26) 0.005 0.98 (0.90-1.06) 0.543

Table 2: Generalized linear model regression analysis of adherence outcomes by arm

5. Conclusion Figure 5: Tools and materials used for targeted information transfer: education to women by providers on malaria in pregnancy, importance of IPTp, handling side effects, and dosing instructions using flip charts, wall charts, and ANC book reminder stickers.

• Targeted information transfer significantly boosts adherence to and delivery effectiveness of DP for of IPTp in routine healthcare settings.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Keirah Bartlett Varespladib abrogates dermonecrotic pathology caused by black-necked spitting cobra venom and purified toxins in vivo

Abstract Snakebite envenoming is a medical emergency and a neglected tropical disease with a higher incidence and mortality than many other commonly recognised NTDs, such as dengue, yellow fever, leishmaniasis, and Japanese encephalitis.

Approximately three million envenomings and 140,000 deaths are believed to occur annually, with a further 500,000 victims left with permanent physical disability p.a. The highest case-fatality rate for snakebite is in Africa, where as many as 14,600 additional patients require limb amputation in response to local damage and necrosis caused by snakebite. This long-term morbidity often results from bites by snake species with cytotoxic venom, such as vipers and spitting cobras. Naja nigricollis (black-necked spitting cobra) is a medically important species, found throughout much of sub-Saharan Africa.

Three-finger toxins (3FTXs) and phospholipase A2s (PLA2s) were purified from Tanzanian N. nigricollis venom through gel filtration chromatography for use with in vitro cell cytotoxicity and in vivo murine necrosis models. HaCaT cells (immortalised human epidermal keratinocytes) were treated with crude venom or purified toxins (3FTXs, PLA2s, 3FTXs + PLA2s) and MTT assays were performed to measure cell viability at 24 h post-treatment in vitro. Mice were injected with one minimum necrotic dose of crude venom (63 μg) or proportional amounts of purified toxins, alone and with PLA2 inhibitor “varespladib” (19 μg). Mice were culled at 72 h post-injection, with lesions measured and biopsied. Both in vitro and in vivo results showed strong synergy between 3FTXs and PLA2s. Further, co-incubation of venom and toxins with varespladib neutralised dermonecrotic pathology in vivo.

12

Varespladib abrogates dermonecrotic pathology caused by black-necked spitting cobra venom and purified toxins in vivo Keirah Bartlett

INTRODUCTION

RESULTS

32,000 deaths and 14,000 amputations in Africa p.a. resulting from envenoming1.

Antivenom does not treat the local tissue damage and necrosis caused by cytotoxic venoms found in spitting cobras2.

3FTXs are responsible for in vitro cell cytotoxicity and display potentiate the effect of PLA2s.

IC50 values of venom and purified toxins in HaCaT cells IC50 values for PLA2s could not be determined;

Naja nigricollis venom is largely comprised of 3FTXs and PLA2s3.

* p<0.0001 (one-way ANOVA)

N. nigricollis venom and its purified toxins were tested in vitro and in vivo to identify which toxins are responsible for this cytotoxicity.

Co-incubation of varespladib (PLA2 inhibitor) with venom or purified toxins reduces dermonecrotic lesion size and severity in mice. (a)

(b)

METHODS In vitro cell cytotoxicity HaCaT cells treated with crude venom or purified toxins (3FTXs, PLA2s). MTT assays performed to measure cell viability.

In vivo murine necrosis Mice injected with 1 MND crude venom or proportional amounts of purified toxins (3FTXs, PLA2s). Blood and lesions collected 72 h post-injection.

(c)

Lesion sizes in mice given (a) venom/toxins-only or (b) venom/ toxins + varespladib; (c) representative lesions

KEY FINDINGS Disparity between in vitro and in vivo results: - 3FTXs cause cytotoxicity in vitro - PLA2s more important to in vivo pathology Likely synergy between these two toxin groups Varespladib neutralises dermonecrotic pathology

REFERENCES 1

Gutiérrez et al. (2017) Nature Reviews Disease Primers.

2

Liu et al. (2020) PLoS Neglected Tropical Diseases.

3

Petras et al. (2011) J. Proteome Res.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Sara Begg A Youth Participatory Action Research approach to addressing gendered health inequalities in Nepal

Background Adolescent girls in Nepal experience poorer health outcomes compared to their male peers, linked to gender-based violence, menstrual hygiene management and stigma, and sexual and reproductive health. This project mobilises Nepali youths’ experience, knowledge and passion to design, implement and evaluate interventions to address these health inequalities and their determinants, and produce evidence that is valued by policy makers in Nepal. The research will be embedded within the Nepal Cricket Foundations “Cricket for Equality” project, which aims to increase adolescent girls’ participation in cricket in Biratnagar, Dhankuta and Rajburaj.

Approach This project will engage a group of young leaders from within the “Cricket for Equality” programme to form 3 teams of “Cricket Changemakers”. The Cricket Changemakers will undergo a Participatory Action Research (PAR) cycle, where they will gather evidence from within their community to identify a specific challenge related to gendered health inequalities, plan action, undertake this action, evaluate its impact, and reflect on and disseminate these findings.

Methods The project will use a range of creative, active, and engaging methods to collect data throughout the PAR cycle. This will include game-facilitated focus group discussions, mapping activities, the use of photos to prompt discussion and reflection. Surveys will be used to benchmark pre and post intervention measures of like-skills, attitudes towards gender, and observed experiences of boys and girls. To ensure promote evidence uptake, interviews on evidence preferences will also be conducted with policymakers in Nepal.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 14

INTRODUCTION

A Youth Participatory Action Research approach to addressing gendered health inequalities in Nepal AIM & OBJECTIVES

BACKGROUND

AIM:

The Nepal Cricket Foundation Nepali NGO operating in Eastern Nepal.

‘Cricket for Equality’ programme specifically aims to increase adolescent girls' participation in cricket + engaging boys and girls in discussions about gender in Biratnagar, Dhankuta and Rajburaj.

Develop, implement and evaluate interventions that address gendered health inequalities and their determinants in Nepal OBJECTIVES: 1. Describe how adolescents experience gendered health inequalities and their determinants, 2. Evaluate the process of implementing YPAR in the context of a school and community sport programme including effect on members of the YPAR team 3. Evaluate the impact of interventions designed in collaboration with adolescents 4. Understand how evidence generated by YPAR projects can be aligned to the needs of policymakers

Adolescent girls in Nepal experience poorer health outcomes compared to their male peers, linked to genderbased violence, menstrual hygiene management and stigma, and sexual & reproductive health. This project seeks to mobilise Nepali youths' experience, knowledge and passion to design, implement and evaluate interventions to address these health inequalities and their determinants, and produce evidence that is valued by policy makers in Nepal.

Authors PhD student: Sara Begg [1] (correspondance: sara.begg@lstmed.ac.uk) Primary Supervisor: Dr Justin Pulford [1] Co-Supervisor: Prof. Padam Simkhada [2, 3, 4] Affiliations 1. Liverpool School of Tropical Medicine, UK 2. University of Huddersfield, UK 3. Manmohan Memorial Institute of Health Sciences (MMIHS), Nepal 4. Nobel College, Pokhara University, Nepal

Gender and health in Nepal Use this programme to intentionally address harmful gender norms Girls in Nepal experience poorer health outcomes related to: gender-based violence menstrual hygiene management & stigma sexual & reproductive health.

Sport "plus" Sports-based approaches have proven effective in gendertransformative approaches to reducing gender-based violence used in this way in community cricket with Indian adolescent boys shown that intervention during early adolescence particularly effective.

Girls in Biratnagar participate in evaluation activities for the "Cricket for Equality" programme in 2019

APPROACH

METHODS AND DATA COLLECTION

This project will engage a group of young leaders from within the Nepal Cricket Foundation’s “Cricket for Equality” programme to form 3 teams of “Cricket Changemakers”.

The project will use a range of creative, active, and engaging methods to collect data throughout the PAR cycle. This will include game-facilitated focus group discussions, mapping activities, the use of photos to prompt discussion and reflection.

The Cricket Changemakers will complete a Participatory Action Research cycle (PAR) where they will gather evidence from within their community to identify a specific challenge related to gendered health inequalities, plan action aligned either with community organising (campaigning on an issue) or community development (producing an identifiable service or activity) undertake this action, evaluate its impact, reflect on and disseminate these findings.

NGO PARTNERS:

To evaluate impact on the Cricket Changemakers and youth in schools, surveys will be used to benchmark pre and post intervention measures of like-skills, attitudes towards gender, and observed experiences of boys and girls.

To ensure that the evidence generated is shared in a way that could influence policy and practice in Nepal, interviews will also be conducted with policymakers in Nepal. These interviews will encompass a range of sectors (health, education, sports) at different levels (ward, district, and province levels).

KEY REFERENCES 1. Kafle, R.B., et al., Youth Health in Nepal: Levels, Trends, and Determinants, in DHS Further Analysis Reports. 2019: Rockville, Maryland, USA. 2. Santhya, K.G., et al., Transforming the attitudes of young men about gender roles and the acceptability of violence against women, Bihar. Culture, Health & Sexuality, 2019. 21(12): p. 1409-1424.

3. Baum, F., C. MacDougall, and D. Smith, Participatory action research. Journal of epidemiology and community health, 2006. 60(10): p. 854-857.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Mohammad Badrul Bhuiyan Exploration of Challenges and Facilitators to Improve Strategies for Childhood EPI Vaccinations in Hard-to-Reach Areas of Bangladesh Background and rationale World Health Organisation initiated Expanded Programme on Immunisation (EPI) in 1974, which was adopted by Bangladesh in 1979. Globally, 2-3 million childhood deaths can be prevented through full EPI vaccination coverage.

However, EPI coverage varies widely (44% to 96%) in different parts of Bangladesh and there is a scarcity of data regarding hindering factors for low EPI coverage in remote hard-to-reach areas of Bangladesh. This PhD project aims to identify challenges and to explore mitigating strategies to improve childhood EPI coverage and equitable vaccine uptake in hard-to-reach areas of Bangladesh.

Supervisors Professor Joseph Valadez, Professor Jahangir Khan

Methods This project will be a mixed-methods research containing systematic reviews, quantitative research, and qualitative research. Systematic reviews and metaanalysis will be conducted to identify and estimate the effects of the socioeconomic, demographic and health system factors on EPI coverage among children in Bangladesh and in the countries globally with similar settings.

Quantitative research will investigate the socio-economic and demographic factors associated with vaccination coverage and will estimate the socioeconomic inequity in hard-to-reach areas of Bangladesh. Qualitative research intends to identify the hindering factors accessing EPI services among the children in hard-to-reach areas of Bangladesh and to explore the mitigating strategies for overcoming such challenges.

Implications and conclusion This research has a great potential to provide a comprehensive understanding regarding determinants of EPI coverage, the challenges of immunisation and possible improvement strategies for childhood EPI coverage in hard-to-reach areas of Bangladesh. This study can be scaled-up in other similar settings globally and perhaps be relevant for COVID-19 vaccination efforts.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 16

Exploration of Challenges and Facilitators to Improve Strategies for Childhood EPI Vaccinations in Hard-to-Reach Areas of Bangladesh Dr Mohammad Badrul Alam Siddiq Bhuiyan 1*, Student of PhD in Global Health, LSTM Email *: 509353@lstmed.ac.uk Supervisors: Professor Joseph Valadez 1 & Professor Jahangir Khan 2

1

Liverpool School of Tropical Medicine (LSTM), United Kingdom. 2University of Gothenburg, Sweden.

Background and Rationale: World Health Organisation initiated Expanded Programme on Immunisation (EPI) in 1974, which was adopted by Bangladesh in 1979. Globally, 2-3 million childhood deaths can be prevented through full EPI vaccination coverage. However, EPI coverage varies widely (44% to 96%) in different parts of Bangladesh and there is a scarcity of data regarding hindering factors for low EPI coverage in remote hard-to-reach areas of Bangladesh. This PhD project aims to identify challenges and to explore mitigating strategies to improve childhood EPI coverage and equitable vaccine uptake in hard-to-reach areas of Bangladesh.

Objectives: 1. To identify and estimate the effects of the socio-economic, demographic and health system factors on EPI vaccination coverage among children in Bangladesh Photos of EPI and Hard-to-Reach areas of Bangladesh [Source: Google] and in the countries with similar global settings through a Systematic Review and meta-analysis 2. To investigate the factors associated with vaccination coverage in hard-to-reach areas of Bangladesh 3. To estimate and compare the inequity uptake of EPI coverage in hard-to-reach areas of Bangladesh 4. To identify the factors in health system and in community that hinder and facilitate accessing EPI services among the children in hard-to-reach areas of Bangladesh and to explore the mitigating strategies for overcoming such challenges.

Methods: This project will be a mixed-methods research containing systematic reviews, quantitative research, and qualitative research.

Systematic reviews and meta-analysis will be conducted to identify and estimate the effects of the socio-economic, demographic and health system factors on EPI coverage among children in Bangladesh and in the countries globally with similar settings.

Quantitative research will investigate the socio-economic and demographic factors associated with vaccination coverage and will estimate the socio-economic inequity in hard-to-reach areas of Bangladesh. Qualitative research intends to identify the hindering factors accessing EPI services among the children in hard-to-reach areas of Bangladesh and to explore the mitigating strategies for overcoming the challenges while vaccinating children.

Implications and Conclusion: This research has a great potential to provide a comprehensive understanding regarding determinants of EPI coverage, the challenges of immunisation and possible improvement strategies for childhood EPI coverage in hard-to-reach areas of Bangladesh. This study can be scaled-up in other similar settings globally and perhaps be relevant for COVID-19 vaccination efforts and this research will ultimately contribute to achieving universal health coverage (one of the sustainable development goals).

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Aaron Chirambo Polycytotoxic T lymphocytes in human Mycobacterium tuberculosis infection

Background Mycobacterium tuberculosis (Mtb) exposure generates heterogeneous outcomes, ranging from pathogen clearance to development of tuberculosis (TB) disease.

However, what determines the outcomes is not fully understood. Cytotoxic T lymphocytes (CTLs) have been shown to play a crucial role in Mtb infection by eliminating infected cells. CTLs exert their effector functions through cytokine production, death receptor engagement and production of cytotoxic granules containing perforin, granzymes and granulysin. Mtb-specific CTLs simultaneously producing the three granules have been termed polycytotoxic T lymphocytes (P-CTLs) and their frequency in blood correlates with control of progression from latent TB infection (LTBI) to TB disease. However, their frequency and function in the human lung, the primary site of infection, is not known. This study seeks to determine the frequency and role of lung P-CTLs in control of Mtb infection.

Authors Aaron Chirambo1,2, David Mhango1,2, Christine Mandalasi1, Elizabeth Chimbayo1,3, Cheusisime Kajanga1, Steven Mitini-Nkhoma1, Anstead Kankwatira1, Rose Malamba1, David Mzinza1, Marc Zumwinkel4, Kondwani Jambo1,2, Steffen Stenger4, Henry Mwandumba1,2 Author’s affiliation Malawi Liverpool Wellcome Programme, Blantyre, Malawi

1

Liverpool School of Tropical Medicine, Liverpool, United Kingdom

2

University of Glasgow, Glasgow, United Kingdom

3

University of Ulm, Germany

4

Methods We recruited healthy adults from Blantyre, Malawi and collected peripheral blood and bronchoalveolar lavage (BAL) fluid. Peripheral blood mononuclear cells (PBMCs) and BAL cells were isolated from peripheral blood and BAL, respectively and ex vivo stimulation assays were performed with Mtb proteins.

Flow cytometry was used to analyse the samples and data were analysed using FlowJo and Graphpad prism software.

Results Following stimulation with Mtb proteins, (ESAT-6, CFP-10 and Mtb lysate) we can detect Mtb specific P-CTLs in both BAL and PBMCs. These findings are a foundation to further explore the role of P-CTLs in Mtb infection by correlating the frequency of the P-CTLs with the Mtb and HIV infection status of study participants.

Way forward In addition to HIV-uninfected adults, we will recruit people living with HIV (antiretroviral therapy (ART)-naïve and those on ART) as well as pulmonary TB patients. This approach will allow us to determine the frequency and function of P-CTLs in health and different disease states.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 18

Polycytotoxic T lymphocytes in the human lung during Mycobacterium tuberculosis infection Aaron Chirambo 1,2, David Mhango1,2,Christine Mandalasi1 ,Elizabeth Chimbayo1,3, Cheusisime Kajanga1, Steven Mitini-Nkhoma1,2, Anstead Kankwatira1, Rose Malamba1, David Mzinza1, Marc Zumwinkel4, Kondwani Jambo1,2,Steffen Stenger4, Henry Mwandumba1,2 1. Malawi Liverpool Wellcome Programme, Blantyre, Malawi; 2. Liverpool School of Tropical Medicine, Liverpool, United Kingdom; 3. University of Glasgow, Glasgow, Scotland 4; University of Ulm, Ulm, Germany

Cytotoxic T lymphocytes in Mtb infection

Gating Strategy

A. CTL effector functions

B. CTLs in human tuberculosis infection

Representative flow cytometry plots (from PBMCs) used in the gating strategy for the identification of Mtb-specific P-CTLs. The gating strategy was used for both BAL and PBMCs. Cytotoxic T lymphocytes that simultaneously produce perforin, granzymes and granulysin have been termed polycytotoxic T lymphocytes (A) and their frequency in blood has been shown to correlate with progression to TB disease (B).

Mtb specific P-CTLs in BAL and PBMCs

Research Question What is the frequency and role of peripheral blood and alveolar Mtb-specific polycytotoxic T lymphocytes in human Mtb infection?

Methodology

Representative flow plots for the identification of Mtb specific P-CTLs in BAL and PBMCs and graphs showing the frequency of Mtb specific P-CTLs from HIV-uninfected individuals after ex vivo stimulation with Mtb proteins.

Conclusion and way forward BAL cells and PBMCs were isolated from BAL fluid and peripheral blood respectively. The cells were stimulated ex vivo with Mtb proteins.

Immunophenotyping and intracellular staining were performed and samples were run on a BD LSRFortessa flow cytometry machine.

• Mtb-specific P-CTLs are present in both the peripheral blood and airways of HIV-negative adults.

• Next step is to correlate the frequency of Mtb specific P-CTLs with the infection status of the participants (untreated and treated HIVinfection, latent TB infection and pulmonary TB disease).

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Shahreen Chowdhury Mainstreaming rights of people affected by psychosocial disabilities in health and social systems: Urban Case Studies in the Global South Background Mental health and disability inclusion are increasingly recognised as priority areas in the attainment of the sustainable development goals. However, people with psychosocial disabilities present a particularly marginalised and ignored group who face barriers in receiving appropriate and effective healthcare. These barriers are often reinforced by poverty, urbanisation, fragility and conflict.

There is limited research on psychosocial disabilities, particularly in LMICs. This research seeks to respond to this evidence gap by documenting experiences of people with psychosocial disabilities and their caregivers using three country case studies in Bangladesh, Liberia and Lebanon, where 14%, 16% and 10% of the population are thought to live with disabilities.

Methods A global policy context analysis and 15 key informant interviews with international and national policymakers, advocates, researchers, and implementers in the field of psychosocial disability will be conducted to understand perspectives on service delivery gaps. Three case studies across three different LMIC settings will be conducted to understand lived experiences at local level. Qualitative and creative participatory research methods will be used including: critical incident narratives, body mapping, photovoice and participatory video and visual vignettes with people with psychosocial disabilities and their caregivers.

Expected outcomes This PhD will prioritise the priorities of people with psychosocial disability to understand their lived experience, needs and priorities, particularly in fragile settings and how this varies by intersecting axes of inequity. This will be used to co-develop social accountability mechanisms to promote the inclusion of people with psychosocial disabilities within health and social support systems.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 20

Mainstreaming rights of people with psychosocial disabilities in health and social systems: Case Studies in Bangladesh, Liberia and Lebanon Shahreen Chowdhury

Contact: Shahreen.Chowdhury@lstmed.ac.uk

Background

:

“If disability is one of the great human rights challenges of this century, then within this, psychosocial disability remains one of the most challenging and misunderstood areas of disability.”

Paul Deany, Disability Rights Fund Program Officer 1 Mental health and disability inclusion are increasingly recognised as priority areas in the attainment of the sustainable development goals However, despite increasing attention to promoting good mental health and disability inclusion, people with psychosocial disabilities present a particularly marginalised and ignored group who face barriers in receiving appropriate and effective health care. 2-3 Stigma also is exacerbated by the invisibility and unique history of mental illness, disability and health. There is limited research on the experiences of people with psychosocial disabilities, particularly in LMICs. This research seeks to respond to this evidence gap by documenting experiences of people with psychosocial disabilities and their caregivers using three country case studies in Bangladesh, Liberia and Lebanon, where 14%, 16% and 10% of the population are thought to live with disabilities. 4-6

Aims and Objectives Aim: To understand the needs and priorities of people affected by psychosocial disability in fragile urban settings and how this varies by intersecting axes of inequity, and to identify strategies to promote the inclusion people with psychosocial disability within health and social support systems Objective 1 To understand current international and national programme and policy responses on psychosocial disabilities as well as views on its terminology (through a global policy context analysis and key informant interviews)

Co- Analysis with 2Peer Researchers in Abuja Objective To understand the lived experiences of people with psychosocial disabilities living in fragile urban settings in order to mainstream their views and priorities in the planning of health and social systems through 3 detailed country case studies

Objective 3 To recommend social accountability mechanisms that can promote the inclusion of people with psychosocial disability in health and social systems design and contribute toward improving health and wellbeing

Methods Participatory research approach Global policy context analysis and 15 key informant interviews with international and national policy makers, advocates, researchers and implementers in the field of psychosocial disability to understand perspectives on gaps in service delivery.

Three country case studies will be conducted to understand lived experiences at local level, using creative participatory methods with 8 adults with psychosocial disabilities and their caregivers in each setting: A global policy context analysis and 15 key informant international andof national policymakers, • Photovoice in Bangladesh to interviews explorewith experiences people with advocates, researchers, and implementers in the field of psychosocial disability will be conducted to understand perspectives on service delivery gaps. Three case studies across three different psychosocial disability within existingat forms community organisation LMIC settings will be conducted to understand lived experiences local level.of Qualitative and creative participatory research methods will be used including: critical incident narratives, body mapping, photovoice and participatory video and visual vignettes with people with psychosocial disabilities informal urban settlements to understand their meaningful inclusion and theirin caregivers.

within community processes

• Visual vignettes and storytelling in Liberia to explore the experiences of people with psychosocial disabilities to mainstream their views and priorities in the planning of health and social systems • Body mapping and critical incident narratives in Lebanon to explore the experiences of people with psychosocial disability both during and post the crisis period and identify key support priorities in the development of health systems

Analysis: Thematic and narrative analysis using NVivo software conducted with co-researchers.

Expected Outcomes

:

To prioritise the needs of people with psychosocial disabilities in fragile settings and how this varies by intersecting axes of inequity across contexts. The overall aim is to co-develop social accountability mechanisms to promote the inclusion people with psychosocial disability within health and social support systems design and contribute toward improving health and wellbeing.

References

Seek to understand existing and potential social movements led by persons with psychosocial disability Holistic understandings of psychosocial disability, health and participation References

Inclusive movement-building

: 1. Disability Rights Fund. Psychosocial Disability: one of the most misunderstood areas of disability [online] 2. Wijne, I., Goulding, L., Giatras, N., Abraham, E.,

Gillard, S., White, S., Edwards, C. and Hollins, S., 2014. The barriers to and enablers of providing reasonably adjusted health services to people with intellectual disabilities in acute hospitals: evidence from a mixed-methods study. BMJ open, 4(4).3. Courtenay, K., & Perera, B. (2020). COVID-19 and People with Intellectual Disability: impacts of a pandemic. Irish Journal of Psychological Medicine, 121.4. Baroud, M., & Mouheildine, O. (2018). Healthcare Needs and Barriers of Persons with Disabilities: An Exploratory Study Among Syrian Refugees, Palestine Refugees from Syria, and Lebanese.

Issam Fares Institute for Public Policy and International Affairs, American University of Beirut. 5. Liberia Institute of Statistics and Geo-Information Services (LISGIS). (2017). 2017 Population and Housing Census: Final Results. Monrovia.6. Baroud, M., & Mouheildine, O. (2018). Healthcare Needs and Barriers of Persons with Disabilities: An Exploratory Study Among Syrian Refugees, Palestine Refugees from Syria, and Lebanese. Issam Fares Institute for Public Policy and International Affairs, American University of Beirut.

Creating communities and practices of care.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Faduma Farah Identification of high risk areas and factors underlying the distribution of Soil Transmitted Helminths in Malawi post mass drug administration for Lymphatic Filariasis, using geostatistical modelling Introduction Soil transmitted helminths (STH), i.e., Ascaris lumbricoides, Trichuris trichiura and hookworms, are intestinal parasitic worms estimated to cause over 1 billion infections globally. They cause significant morbidity in children and women of reproductive age, costing an estimated 1.9 million disability-adjusted life years worldwide. The WHO recommended strategy is regular treatment of those risk groups with albendazole or mebendazole. STH have been treated passively by the Global Programme for the Elimination of Lymphatic Filariasis (GPELF) through community-wide mass drug administration (MDA) of ivermectin and albendazole, which was conducted in Malawi between 2008 and 2014. This study aims to map the distribution of STH throughout Malawi and to identify high-risk areas for STH infection post LF MDA. Methods Bayesian geostatistical models will be used to assess underlying factors for and predict nation-wide prevalence of STH per species, in Malawi, after the termination of LF MDA. Prevalence data in school-aged children, as well as STH and LF programme coverage data obtained from the national programme will be used. Remotely sensed environmental data, water and sanitation data, population numbers, and poverty indices will be obtained from open sources.

Results Nation-wide predicted prevalence by species after LF MDA will be estimated and mapped. Underlying factors including the respective role of environmental variables and treatment history in STH distribution will be determined.

Conclusion This study will allow to identify areas where STH have persisted or rebounded post LF MDA in Malawi, and what factors influence this.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 22

Identification of high risk areas and factors underlying the distribution of Soil Transmitted Helminths in Malawi post mass drug administration for Lymphatic Filariasis, using geostatistical modelling Faduma Farah, Dr Armelle Forrer, Prof Mark Taylor, Dr Claudio Fronterre Background The Global Programme to Eliminate Lymphatic Filariasis (GPELF) delivers mass drug administration (MDA) against Lymphatic Filariasis (LF)

Preliminary results – Observed STH prevalence in Malawi

Was conducted in Malawi from 2008 to 2014

34 locations before LF MDA (1998-2004) 346 locations during LF MDA (2012-2014) 687 locations after LF MDA (2015-2019)

Ivermectin and Albendazole

Soil transmitted helminth (STH) infections are also targeted using albendazole

Ascaris Hookworm lumbricoides (N.Americanus & A.duodenale)

Trichuris trichiura

Moderate to heavy STH infections cause significant morbidity in women and children, e.g. anaemia, malnutrition, stunted growth

1.9 million

o Higher A.lumbricoides prevalence locations cluster in a few districts o Variability in the prevalence observed increases after LF MDA

lost worldwide (Asfaw et.al.,

2020)

Aim: Map the distribution of STH in Malawi post MDA for LF and identify high risk areas and underlying factors influencing STH infection, using geostatistical modelling

Methods Bayesian geostatistical models, per STH species, will be utilised to: 1. Predict nation-wide prevalence 2. Identify risk factors for STH 3. Identify high risk areas for STH Data & risk factors to investigate o STH species prevalence in school-children from school surveys, 1998-2019 o MDA coverage (LF & STH) o Remotely sensed environmental data o Water & sanitation data o Poverty data o Population numbers

o Levels of observed hookworm are lower than A.lumbricoides after LF MDA o Higher hookworm prevalence locations cluster in a few districts o Variability in the prevalence observed increases after LF MDA

Conclusion o Each STH species prevalence appears to cluster after LF MDA o Variability of STH prevalence increases after LF MDA o A.lumbricoides appears to be most prevalent of the species after LF MDA To come: o Geostatistical models will be fit with factors of interest to predict prevalence at un-surveyed locations o Identification of factors behind distribution – what is contributing to the apparent clustering? o Which are the high risk areas and so where is intervention most needed?

o T.trichiura infections appear to be less prevalent than A.lumbricoides and hookworm

References: Asfaw MA, Zerdo Z, Churko C, Seife F, Yihune M, et al. (2020) Preventive chemotherapy coverage against soil-transmitted helminth infection among school age children: Implications from coverage validation survey in Ethiopia, 2019. PLOS ONE 15(6): e0235281. https://doi.org/10.1371/journal.pone.0235281

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Aidan Foo Microbial Insights Using Unmapped Reads (MINUUR): Application in Aedes aegypti

Abstract The microbiome is a collection of microbes that exist in symbiosis with a host.

Whole genome sequencing produces residual, non-specific reads, to the host in question, which can be used for metagenomic inference of a microbiome. This data is advantageous over barcoding methods since higher taxonomic resolution and functional predictions of microbes are possible. With the growing number of genomic sequencing data publicly available, comes opportunity to elucidate the residual reads pertaining to microbial symbionts. However, characterisation of these reads can be complex, with many steps required to perform a robust analysis. To address this, we developed MINUUR (Microbial INsights Using Unmapped Reads); a snakemake pipeline to characterise contaminant sequences from existing genomic data. We apply this pipeline to 10, publicly available, high coverage Aedes aegypti genomic samples. Using MINUUR, we describe species level microbial classifications; predict microbe associated genes and pathways and find bacterial metagenome assembled genomes (MAGs) associated to the Ae. aegypti microbiome. Of these MAGS, 19 are high-quality representatives with over 90% completeness and under 8% contamination. The result of this work is an in-depth analysis of residual reads from Ae. aegypti whole genome sequencing data within a reproducible and open-access pipeline.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 24

Microbial INsight Using Unmapped Reads Vector Biology Department, Liverpool School of Tropical Medicine, L3 5QA

Aidan Foo, Louise Cerdeira, Grant Hughes, Eva Heinz

Background: The microbiome is the collection of microbes that exist in symbiosis with a host. Whole genome sequencing of hosts produce non specific reads which can be used for metagenomic inference of a microbiome. This data is beneficial, since high resolution taxonomic classifications and genomic predictions of microbes are possible. To facilitate analysis of these reads, we developed MINUUR (Microbial INsights Using Unmapped Reads); a snakemake pipeline to characterise non-host reads from existing whole genome sequencing data. We applied this pipeline to 10, publicly available, mosquito (Ae. aegypti) genomic samples to produce an exploratory analysis of genus and species taxonomic classifications, functional profiles and high-quality draft metagenome assembled genomes. The result of this work is a metagenomic insight of the Ae. aegypti microbiome.

A

Read Number (log)

B

7.5 10.0 12.5 15.0

8

Xanthomonas Wolbachia Vibrio Streptomyces Stenotrophomonas Staphylococcus Sphingobacterium Salmonella Rhizobium Ralstonia Pseudomonas Phytobacter Pedobacter Paraburkholderia Pantoea Paenibacillus Metakosakonia Kosakonia Klebsiella Kaistella Homo Geminocystis Flavobacterium Escherichia Epilithonimonas Enterobacter Elizabethkingia Delftia Cupriavidus Comamonas Clostridium Citrobacter Chryseobacterium Cedecea Burkholderia Bradyrhizobium Bacteroides Bacillus Acinetobacter Acidovorax Achromobacter

6

Contamination

High Quality MAGS!

Genus

4

KRAKEN2 & BRACKEN

Database Preparation

UniRef Database

Data Preparation FASTQC

Quality Control

CutAdapt bowtie2

Host Separation

samtools samtools

Read Processing

BEDTools

10 Pooled Ae. aegypti Genomic Samples ENA Project No: PRJEB33044 Quality Controlled and Trimmed Ae. aegypti short reads

Alignment of QC’d reads against AaegL5.1 reference genome

Extract unmapped reads and convert from BAM to paired FASTQ files

100

KRAKEN2, BRACKEN & MetaPhlAn3 Classifications

Read Classification

75

100

Acinetobacter_seifertii

Chryseobacterium_sp_ISE14

Acinetobacter seifertii

Elizabethkingia anophelis

Klebsiella_A michiganensis

Pseudomonas_E protegens

Comamonas acidovorans

Enterobacter cloacae_M

Pseudomonas_E koreensis_B

Stenotrophomonas sp002192255

Delftia_acidovorans

Elizabethkingia_anophelis

Klebsiella_michiganensis

Klebsiella_oxytoca

Kluyvera_intestini

Wolbachia pipientis

Pseudomonas_moraviensis

GTDB−Tk FastANI Score (%)

65

63

50

Completeness

68

64

25

37

R3

ER

98

FAD−binding 9 siderophore−interacting domain protein ABC−type Fe3+−siderophore transport system TonB−dependent siderophore receptor (Fragment) Iron−siderophore ABC transporter substrate−binding protein Fe(3+)−siderophore ABC transporter permease ABC transporter (Iron.B12.siderophore.hemin) ABC−type cobalamin/Fe3+−siderophores transport system protein Catecholate siderophore receptor fiu OMR family iron−siderophore receptor siderophore−interacting protein Ferric siderophore ABC transporter substrate−binding protein Ferric alcaligin siderophore receptor Ferric siderophore transport system TonB−dependent siderophore receptor family protein Hydroxamate siderophore iron reductase FhuF Catechol siderophore synthase DhbF−like protein Exogenous ferric siderophore receptor NADPH−dependent ferric siderophore reductase TonB−dependent siderophore receptor ABC−type Fe3+−siderophore transport system, permease component 60

0

20

40

60

0

20

40

60

0

20

40

60

0

log Reads Per Kilobase (RPK)

20

40

Results - cont C: Functional profiles from HUMAnN3 were searched using MINUUR for “siderophore” related UniRef90 annotations. We show the TonB dependent siderophore receptor is commonly identified across seven MetaPhlAn3 microbial classifications. Other siderophore receptors and transporters are identified to give insight of iron acquisition mechanisms in Ae. aegypti symbionts.

D: Species classifications of each MAG using GTDB-Tk. Each MAG is classified against the Genome Taxonomy Data Base (GTDB), with average nucleotide identity (FastANI) scores given to its most closely related reference genome within the GTDB. We show each MAG is classified with a FastANI score >95% and below <90%, representing strain level differences to their closest related genome.

60

0

20

40

60

0

20

40

60

0

20

40

60

Binning

MetaBAT2 placement of assembled contigs into MAG bins

Quality Assurance

CheckM and QUAST MAG Assessment

De novo metagenome assembled genomes (MAGs)

se

ca

ife

e_

M

rtii

Microbial Functional Profiles

oa r cl

act er

cte ba

Aci ne tob

tero En

B

ns

s_

ge

nsi

rote

ree E ko

s_ Ep na

on as_

ud om o

s

lis

ran

he op

ovo

an om ud

cid sa

kin gia

na ma mo

Eliz ab eth

tis

sis

ien

en an

pip ach

ia

_A mic hig

Wo lb

ella bsi

Pse

40

Pse

20

Kle

0

Co

5 25 92 21 sp 00 as 60

tro ph om on

40

no

20

MEGAHIT Contig Assembly of Ae.aegypti unmapped reads

Species Level Microbial Classification

96

0

De novo Metagenome Assembly

97

Stenotrophomonas_maltophilia

Ste

61

62

68

68

68

68

37

37

37

R3

R3

R3

ER

Sample

ER

ER

58

59

60

68

37

37

R3

R3

ER

ER

56

68

68

68

68

37

37

R3

37

37

R3

R3

R3

ER

ER

ER

ER

57

0

Functional Insight from MetaPhlAn3 Classified Taxa

Functional Read Profiling

99

0

Indexed Host Genome Chocophlan Database

MetaPhlAn3 Database

D

2

C UniRef90 Gene Annotation

Results A: Taxonomic classifications of unmapped reads with KRAKEN2 identified common Ae. aegypti bacterial symbionts including Elizabethkingia, Chryseobacterium, Bacillus, Pseudomonas, Enterobacter and Actinetobacter. Elizabethkingia, Pseudomonas and Wolbachia are dominant members.

B: Ae. aegypti associated metagenome assembled genomes (MAGs) of bacterial symbionts acquired with MEGAHIT. We obtained 19 MAGs with completeness >90% and <8% contamination. These MAGs represent high-quality draft genomes of bacterial symbionts to be used for further analysis.

Each Dot is a MAG

Species Classification

Conclusions & Further Work This exploratory analysis shows how a metagenomic approach can be applied to existing whole genome sequencing data to gain genomic insight of mosquito-associated microbiomes and high resolution classifications of taxonomy. High-quality MAGs from this study will be annotated and used for further analysis. Specifically, we are interested in iron acquisition mechanisms of Ae. aegypti symbionts, including iron transporters, heme transporters, siderophore transporters and biosynthetic gene clusters encoding siderophores. Through the acquisition of more genomic sequences of Ae. aegypti bacterial symbionts, we can study the diversity of these genes. This information will be used to hypothesize community interactions in response to blood meals, and tested in vivo with a gnotobiotic model.

Method MINUUR is available from Github (QR code above). The pipeline intakes either raw or quality-controlled short read sequences.

1.Reads are aligned to a high quality reference genome of the users choice. We used the AaegL5.1 reference genome.

2.Unmapped reads are extracted from the resultant BAM file.

These reads are subsequently used for: • Taxonomic classification with KRAKEN2 and MetaPhlAn3 • Functional read profiling with HUMAnN3 • De novo metagenome assembly with MEGAHIT followed by quality assurance on resultant contigs with QUAST. • Contigs are placed into genomic bins with MetaBAT2, which are checked for completeness and contamination with CheckM.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Sarah Gallichan Comparison of commercial kits for the extraction of genomic DNA from Escherichia coli

Introduction Molecular diagnostics and DNA sequencing heavily relies on the extraction of high-quality genomic DNA from bacterial cultures to detect specific pathogens, such as Escherichia coli (E. coli), and antimicrobial resistance genes. Detection of E. coli in laboratory settings is challenging since standardized protocols have not been established. The wide range of commercially available DNA extraction kits makes it difficult for clinical microbiology laboratories to determine the most cost-effective kit with the best quality and quantity DNA yield for downstream diagnostic applications.

Method Here we compared four commercially available DNA extraction kits (DNeasy Blood & Tissue Kit, MasterPure Complete DNA and RNA Purification Kit, Wizard HMW DNA Extraction Kit, Monarch Genomic DNA Purification Kit) using four reference isolates of E. coli (NCTC12241, NCTC13476, NCTC13846, ATCC35218) and scored each based on the (i) cost per sample, (ii) ease of protocol, (iii) processing time, (iv) quantity and (v) quality of DNA. Results The MasterPure kit was the highest scoring for quantity and quality of DNA output, resulting in the overall highest score (81%). Followed by the Monarch (55%) and Wizard HMW (52%), that both produced lower output DNA quantity.

The DNeasy kit underperformed in both DNA quantity and quality, thus had the lowest score (26.5%).

Conclusion Overall, the MasterPure Complete DNA and RNA Purification Kit had the highest weighted score and the least variability between technical and biological replicates.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 26

Comparison of commercial kits for the extraction of genomic DNA from Escherichia coli Sarah Gallichan,1 Sally Forrest1, Joseph Lewis1, Eva Heinz1, Nicholas Feasey1, Fabrice Graf1 1Department

of Clinical Sciences, Liverpool School of Tropical Medicine, Liverpool, CB2 0QQ

Introduction Molecular diagnostics and DNA sequencing has become heavily reliant on the extraction of high-quality genomic DNA from bacterial cultures to detect specific pathogens, such as Escherichia coli (E. coli), and antimicrobial resistance genes. Detection of E. coli in laboratory settings is challenging since standardized protocols have not been established1,2. The wide range of commercially available DNA extraction kits makes it difficult for clinical microbiology laboratories to determine the most cost-effective kit with the best quality and quantity DNA yield for downstream diagnostic applications. Here we compared four commercially available DNA extraction kits using four reference isolates of E. coli and scored each kit based on the (i) cost per sample, (ii) ease of protocol, (iii) processing time, (iv) quantity and (v) quality of DNA.

Method

Results (A)

(B)

Four E.coli reference isolates

(1: NCTC12241, 2: NCTC13476, 3: NCTC13846, 4: ATCC35218)

Extracted Lucigen MasterPure Complete DNA and RNA Purification Kit

Figure 1 Absorbency ratios (A) 260/280 and (B) 260/ 230 measured spectrophotometrically on the Nanodrop that indicate the (A) DNA ‘purity’ and (B) the contamination of the four reference strain E. coli samples extracted using the four DNA extraction kits. The means of each replicate (n=9) are plotted with the standard deviations of each data set. The grey area indicates the ideal range for (A) ‘pure’ DNA and (B) minimal contamination.

Promega Wizard HMW DNA Extraction Kit

Qiagen DNeasy Blood & Tissue Kit NEB Monarch Genomic DNA Purification Kit

Choose your fighter…

Measured Nanodrop

Figure 2 DNA concentrations of DNA extracted from the four E. coli reference isolates using four different DNA extraction kits, measured fluorometrically on the Qubit.

Error bars indicate the standard deviation from the mean of each replicate (n=9) for each data set.

TapeStation Qubit

Extraction kits were scored on cost per sample, ease of protocol, delivery time, protocol time, DNA output yield and quality (Scores were weighted according to importance)

Conclusion Overall, the MasterPure Complete DNA and RNA Purification Kit had the highest weighted score and the least variability between technical and biological replicates. However, further optimization is needed to improve the quality of DNA output.

References: 1.

Rondinaud E et al. 2020 Screening methods for intestinal carriage of multidrug-resistant Enterobacterales: interest of enrichment broth. Diagnostic Microbiology and Infectious Disease.

2.

Nearing JT et al. 2021 Identifying biases and their potential solutions in human microbiome studies. Microbiome.

Table 1 A scoring matrix based on the assessment of various criteria used to compare four DNA extraction kits. Each score (from 0-10) was weighted based on the importance of criteria to laboratory processing of samples.

Time taken

DNA output

Cost

Ease

Delivery

Hands-on

Total

Yield

DNA quality

Final weighted score

MasterPure

8

9

8

2

2

10

8

81.0

Wizard

10

7

8

2

2

0

8

52.0

Monarch

9

10

8

10

1

0

6

55.5

DNeasy

3

8

4

5

5

0

2

26.5

20

10

5

10

5

25

25

100

Weighting (%)

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Katherine Gleave The effects of insecticide resistance and parasite infection on mosquito behaviour

Abstract Increased reliance on insecticides for insect-borne disease control has led to the rapid spread of insecticide resistance. In response, next-generation bed nets are now in widespread use across Africa to combat resistance and restore net effectiveness. It is crucial to understand how insecticide resistance, novel control methods and parasite infection may alter vector-specific disease transmission.

This thesis assessed the impact of insecticide resistance and parasite infection on mosquito behaviour and fitness, examining how alterations could impact vector control and vectorial capacity.

The results present data collated on the spatial distribution of insecticide resistance phenotypes and genotypes, which can be used to guide control programmes in resistance monitoring and consider changes in bed net distribution. The systematic review analysis showed that next-generation pyrethroid-PBO nets increase mosquito mortality, reduce blood-feeding success and lower clinical malaria incidence in areas with high insecticide resistance.

Room-scale video tracking of mosquitoes around next-generation nets enabled us to capture data showing strains of different pyrethroid susceptibility have remarkably consistent behaviour around different net treatments. Laboratory studies explained how insecticide selection impacted mosquito fitness in male and female mosquitoes, demonstrating trade-offs in life-history traits that could limit or enhance disease transmission. It was also demonstrated that mosquitoes exposed to parasitic infection show a dynamic, stage-specific and density-dependent change in behaviour to host cues, decreased flight ability and reduced energy resources. Incorporating all of this knowledge will lead to a more holistic understanding of the impact of new vector control tools on mosquitotransmitted diseases.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 28

The impact of insecticide resistance and parasite infection on mosquito behaviour Katherine Gleave1, PhD by publication

Department of Vector Biology, Liverpool School of Tropical Medicine

Vector control remains one of the most important methods for reducing insect-borne diseases across the globe (1). However, heavy reliance on insecticides has led to the rapid spread of insecticide resistance, threatening the operational success of control programmes (2). In response to concerns over the sustained efficacy of our current tool, novel insecticides and products are now in development and various next-generation bednets are now in widespread use cross Africa to combat resistance and restore ITN effectiveness (3).

Understanding how resistance and new control methods may alter vector-specific disease transmission parameters is crucial. While insecticide resistance and parasite infection rates are documented in many populations, their effect on mosquito life-history traits and behaviour is less understood.

Aims This thesis aimed to assess the impact of insecticide resistance and parasite infection on mosquito fitness and behaviour and how changes in either could impact the efficacy of new control tools and vectorial capacity.

1. Quantify and map insecticide resistance in Africa to document the spread of resistance and the role of different m = vector density in relation to host a = probability of host being bitten resistance mechanisms.

2 n 2. Evaluate next-generation ITNs for reducing malaria = ma x VC x P VC = vector competence Vectorial capacity prevalence.

-logeP 3. Measure the impact of insecticide resistance on mosquito n = extrinsic incubation period P = probability of daily survival behavioural responses to ITNs. 4. Study the impact of insecticide exposure and parasite infection on mosquito behaviour and longevity.

Methods and Results

Behavioural modes resting

VK7 IG2

bouncing

N'gousso IG2

visiting swooping

Kisumu IG2 Banfora P3

strain and net type

VK7 P3 N'gousso P3 Kisumu P3 Banfora OL VK7 OL N'gousso OL Kisumu OL Banfora UT VK7 UT N'gousso UT Kisumu UT 0

10000

20000

30000

total activity (seconds)

40000

50000

• Information for each insecticide class is highly clustered, indicating interpretation needs to consider any bias in location sampled • Resistance data compiled and released provides sufficient volumes of standardised values to support a range of analyses.

• Pyrethroid-PBO nets were more effective than standard PY only nets in reducing malaria incidence, killing mosquitoes and preventing blood feeding in areas of high insecticide resistance.

• First in-depth description of susceptible and resistant Anopheles gambiae behaviour around nextgeneration bed nets indicated that the range of effects of ITNs on behaviour is constant, with no major alterations in responses between resistance level or net type.

• Insecticide selection impacts fitness traits in male and female mosquitoes, with results suggesting that continued selection at the larval stage with temephos leads to shorter development time and increased longevity but reduced fecundity. However, switching to malathion at adult stage leads to better reproductive fitness.

• We observed a stage-specific and density-dependent change in Aedes aegypti behaviour after exposure to Brugia malayi. During filarial development mosquitoes exhibited reduced flight towards host cues compared to controls, however when infective stage larvae were present mosquitoes were five times more likely to fly towards the host.

• Infection affects flight ability and energy resources.

Conclusions

References : (1) Bhatt et al., 2015, (2) Ranson and Lissenden., 2016, (3) Pryce et al., 2018.

Incorporating knowledge on the spread of insecticide resistance, the effects of next-generation nets on mosquito mortality and behaviour, and the impacts of resistance and infection on mosquito physiology will lead to a more holistic understanding of the impact of new vector control tools on mosquito-transmitted diseases.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Susan Gould The aerobiology of SARS-CoV-2 in UK hospitals and the impact of aerosol generating procedures

Background SARS-CoV-2 nosocomial transmission to patients and healthcare workers (HCWs) has occurred throughout the COVID-19 pandemic. Aerosol generating procedures (AGPs) seemed particularly risky, and policies have restricted their use in all settings. We examined the prevalence of aerosolized SARS-CoV-2 in the rooms of COVID-19 patients requiring AGP or supplemental oxygen compared to those on room air.

Methods Samples were collected prospectively near to adults hospitalised with COVID-19 at two tertiary care hospitals in the UK from November 2020 – October 2021.

The Sartorius MD8 AirPort air sampler was used to collect air samples at a minimum distance of 1.5 meters from patients. RT-qPCR was used following overnight incubation of membranes in culture media and extraction.

Results We collected 219 samples from patients’ rooms: individuals on room air (n=67) , receiving oxygen (n=65) or AGP (n=67). Of these, 54 (24.6%) samples were positive for SARS-CoV-2 viral RNA. The highest prevalence was identified in the air around patients receiving oxygen (32.3%, n=21, CI95% 22.2 to 44.3%). For AGP viral prevalence was 20.7% (n=18, CI 95% 14.1 to 33.7%), similar to room air viral prevalence of 22.3% (n=15, CI95% 13.5 to 30.4%).

Conclusions SARS-CoV-2 viral RNA was detected in the air of hospital rooms of COVID-19 patients, and AGPs did not appear to impact the likelihood of viral RNA detection. Enhanced respiratory protection and appropriate infection prevention and control measures are required to be fully and carefully implemented for all COVID-19 patients to reduce risk of aerosol transmission.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 30

The aerobiology of SARS-CoV-2 in UK hospitals and the impact of aerosol generating procedures Susan Gould, Rachel L Byrne, Thomas Edwards, Ghaith Aljayyoussi, Dominic Wooding, Kate Buist, Konstantina Kontogianni, Allan Bennett, Barry Atkinson, Ginny Moore, Jake Dunning , Stacy Todd , Marie-Claire Hoyle, Lance Turtle, Tom Solomon, Richard Fitzgerald, Mike Beadsworth, Paul Garner, Emily R Adams and Tom Fletcher

BACKGROUND

METHODS

• SARS-CoV-2 nosocomial transmission to vulnerable patients and healthcare workers (HCWs) has occurred throughout the COVID-19 pandemic.

• The World Health Organisation (WHO) estimates 80 000-120 000 HCWs have died due to COVID-19. (1) • There has been significant international discussion regarding personal protective equipment guidance. (2) • Aerosol generating procedures (AGPs) seemed particularly risky based on observational studies during management of SARS CoV-1,(3) and policies have restricted their use in all settings.

• Previous air sampling studies have reported a wide range of frequency of PCR positivity (0-72%). (4,5) • This study examined the likelihood of recovering aerosolized SARS-CoV-2 in the rooms of COVID-19 patients requiring AGP or supplemental oxygen compared to those on room air.

The study was conducted in two large acute tertiary hospitals in Liverpool, UK from November 2020 to October 2021. Air samples were collected prospectively near to adult inpatients (in areas including intensive care, emergency department and general wards) and community ambulatory cases attending the clinical research unit for screening or treatment as part of an early phase trial. All individuals had a recent diagnosis of SARS CoV-2 infection. The dominant circulating variants in the UK during this period were B.1.1.7 Alpha (PANGO lineage B.1.1.7) and Delta (PANGO lineage B.1.617.2). (6) Samples were categorised as either 1) room samples; patients not undergoing any respiratory treatment 2) oxygen; patients undergoing oxygen at flow rates of less than 15L/min via nasal cannulae/mask or 3) AGP; patients undergoing an AGP. The Sartorius MD8 airport portable air sampler with gelatin membranes was used to collect air samples at a minimum distance of 1.5 meters from patients to ensure aerosols were collected. Membranes were immediately suspended in 10ml of Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine solution (FBS) and 50 units per ml of penicillin/streptomycin. RT-qPCR (TaqpathTM)was used following overnight incubation and extraction. Samples were considered positive if at least one target genomic region and the internal control were amplified. Cell culture was attempted on positive samples.

RESULTS • We collected 219 samples from 199 patients' rooms: individuals on room air only (n=67) , receiving oxygen (n=65) or undergoing AGP (n=87). (Some individuals were sampled at more than one timepoint).

• Fifty-four (24.6%) samples were positive for SARS-CoV-2 viral RNA. The highest prevalence was identified in the air around patients who were receiving oxygen (32.3%, n=21, CI95% 22.2 to 44.3%) with AGP and room air recording prevalence of (20.7%, n=18, CI95% 14.1 – 33.7%) and (22.3%, n=15, CI95% 13.5 – 30.4%) respectively.

• We did not detect a significant difference in the observed frequency of capturing viral RNA between interventions. (Figure 1) We did not detect a difference in Ct values for positive samples between procedure (p>0.05, one-way ANOVA), shown in figure 2. We observed a reduced detection of S gene, indicative of Alpha variant presence, compared to other RT-qPCR genomic targets (ORF1 and N gene).

• The median number of days since symptom onset was 7. No effect of sampling location e.g., emergency department or intensive treatment unit, or days of illness on frequency of detection of viral RNA or Ct values was identified (GLM, P> 0.05) < Figure 1: The percentage of samples PCR positive for SARS-CoV-2 viral RNA collected from the rooms of PCR positive patients in two Liverpool Hospitals.

There was no statistically significant difference between aerosol generating procedures (AGP), oxygen or room air and the likelihood of detecting viral RNA (GLM, p>0.05).

> Figure 2: The cycle threshold (Ct) value of SARS-CoV-2 positive samples for each procedure (aerosol generating procedure and oxygen) and room air. The PCR used utilize three distinct regions of the SARS-CoV-2 genome (ORF1, Nucleocapsid (N) gene and spike (S) gene). It is important to note that the alpha variant has significant mutations in the s gene is not detectable, resulting in fewer data points.

N.s. indicates no statistical difference between the three methods for each gene (oneway ANOVA, p>0.05).

Table 1: Procedures sampled, and frequency of positive results observed Aerosol Generating Procedures Procedure

percent positive (n/N)

CPAP hood or

19.2 (10/52)

mask BiPAP Hi Flow oxygen (mask or nasal)

0 (0/3) 14.3 (3/21)

Non-aerosol generating procedures percent positive (n/N) Room air Oxygen – Nasal cannulae Oxygen – Venturi mask

24.6 (17/69) 28.6 (8/28) 33.3 (9/ 27)

Intubation

100 (1/1)

Oxygen – NRB

20 (1/5)

Bronchoscopy

100 (2/2)

Other/Not known

75 (3/4)

Endoscopy

50 (1/2)

All

21 (17/81)

28.6 (38/133)

CPAP Continuous positive airway pressure. BiPAP Bilevel Positive Airway Pressure. NRB Non-rebreathe.

DISCUSSION • To improve understanding of nosocomial transmission and the risks around AGP we have undertaken a large air sampling study for SARS-Cov-2.

• SARS-CoV-2 viral RNA was detected in the air of hospital rooms of COVID-19 patients, and we did not demonstrate higher levels of SARS-CoV-2 viral RNA in rooms with patients undergoing AGPs. Our data supports the conclusions of other studies such as the RECOVERY RS trial in which in 30 subjects observed frequency of RNA detection was not significantly higher around AGPs.(7) • In line with previous reports, we found Ct values to be high (typically above 30), indicative of low viral loads present, and we were unable to isolate live virus in cell culture.

• Due to the nature of this study detailed patient level data was not available. It is acknowledged that multiple factors related to an infected person (symptoms, individual variation in expired particles, vaccination status) and location (ventilation, proximity to vulnerable individuals) affect likelihood and impact of infective aerosol distribution. These factors may be more significant than procedures such as CPAP or other AGPs when assessing risk.

• Enhanced respiratory protection and appropriate infection prevention and control measures are required to be fully and carefully implemented for all COVID-19 patients to reduce risk of aerosol transmission.

REFERENCES 1. World Health Organisation. Health and Care Worker Deaths during COVID-19. 2021. https://www.who.int/news/item/20-10-2021-health-and-care-worker-deaths-during-covid-19 (accessed Oct 21, 2021).

2. Thomas JP, Srinivasan A, Wickramarachchi CS, Dhesi PK, Hung YMA, Kamath A V. Evaluating the national PPE guidance for NHS healthcare workers during the COVID-19 pandemic. Clin Med J R Coll Physicians London 2020; 20: 242–7.

3. Judson SD, Munster VJ. Nosocomial transmission of emerging viruses via aerosol-generating medical procedures. Viruses. 2019; 11. DOI:10.3390/v11100940.

4. Li YH, Fan YZ, Jiang L, Wang HB. Aerosol and environmental surface monitoring for SARS-CoV-2 RNA in a designated hospital for severe COVID-19 patients. Epidemiol Infect 2020. DOI:10.1017/S0950268820001570 5. Ang AXY, Luhung I, Ahidjo BA, et al. Airborne SARS-CoV-2 surveillance in hospital environment using high-flowrate air samplers and its comparison to surface sampling. Indoor Air 2021; : 1–10.

6. Hadfield J, Megill C, Bell SM, et al. NextStrain: Real-time tracking of pathogen evolution. Bioinformatics 2018; 34: 4121–3.

7. Winslow RL, Zhou J, Windle EF, et al. SARS-CoV-2 environmental contamination from hospitalised patients with COVID-19 receiving aerosol-generating procedures. Thorax 2021; : thoraxjnl-2021-218035.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Caitlin Greenland-Bews Evaluation of Eight Lateral Flow Tests for the detection of anti-SARS-CoV-2 antibodies in a vaccinated population

Abstract With the distribution of COVID-19 vaccinations across the globe and the limited access in many countries, quick determination of an individual’s antibody status could be beneficial in allocating limited vaccine doses in low- and middle-income countries (LMIC). Antibody lateral flow tests (LFTs) have potential to address this need as a quick, point of care test, they also have a use case for identifying sero-negative individuals for novel therapeutics, and for epidemiology. Here we present a proof-of-concept evaluation of eight LFT brands using sera from 95 vaccinated individuals to determine sensitivity for detecting vaccination generated antibodies. All 95 (100%) participants tested positive for antispike antibodies by the chemiluminescent microparticle immunoassay (CMIA) reference standard post-dose two of their SARS-CoV-2 vaccine: BNT162b2 (Pfizer/BioNTech, n=60), AZD1222 (AstraZeneca, n=31), mRNA-1273 (Moderna, n=2) and Undeclared Vaccine Brand (n=2). Sensitivity increased from dose one to dose two in six out of eight LFTs with three tests achieving 100% sensitivity at dose two in detecting anti-spike antibodies. These tests are quick, low-cost point-of-care tools that can be used without prior training to establish antibody status and may prove valuable for allocating limited vaccine doses in LMICs to ensure those in at risk groups access the protection they need. Further investigation into their performance in vaccinated peoples is required before more widespread utilisation is considered.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 32

Evaluation of SARS-CoV-2 Antibody Lateral Flow Tests in Vaccinated Individuals

Introduction

Caitlin Greenland-Bews, Rachel. L. Byrne, Sophie. I. Owen, Rachel. L. Watkins, Daisy Bengey, Kate Buist, Karina Clerkin , Camille Escadafal, Lorna. S. Finch, Susan Gould , Emanuele Giorgi, Andy Hodgkinson, Larysa Mashenko, Darren Powell, Helen. R. Savage , Caitlin. R. Thompson, Lance Turtle, Jahanara Wardale, Dominic Wooding, Thomas Edwards, Ana Cubas Atienzar, Emily. R. Adams

Antibody Lateral Flow Tests (AbLFT) detect antibodies present in whole blood/serum specific to a target antigen of SARS-CoV-2 (either nucleocapsid, whole spike or spike-RBD). AbLFTs are quicker than an ELISA or similar methods however, there is limited data on AbLFT performance and their potential use in the COVID-19 pandemic is not clear.

In this study: We analysed the sensitivity of eight AbLFT brands in detecting SARS-CoV-2 anti-spike antibodies using sera from 95 individuals post-dose 1 and 2 of receiving a COVID-19 vaccine. Results were compared to a reference standard chemiluminescent microparticle assay (CMIA) that identified the presence of anti-spike and antinucleocapsid IgG antibodies.

Our Aim: To determine if AbLFTs could detect anti-spike antibodies generated in response to one of the COVID-19 vaccines.

Results: A binomial mixed effect model was designed to determine parameters for the calculation of the sensitivities and confidence intervals of each LFT at each dose. Sensitivity for dose 1 ranged from 4.38% [CI95% 1.24,8.40] for KHB to 95.43% [87.42, 97.42] for Fortress. For dose 2, sensitivities ranged from 20.15% [13.15,30.02] for KHB to 99.30% [96.46,99.73] for Fortress.

Conclusion

Results

AbLFT Brand

Sensitivity Post Dose 1 (%) [CI95%] 47.16 [36.79,58.20]

Sensitivity Post Dose 2 (%) [CI95%] 76.58 [66.19, 82.18]

Bionote Co., LTD.

86.58 [79.78,93.65] 95.43 [87.42,97.42] 76.24 [67.29, 85.08]

97.03 [92.46, 98.51] 99.30 [96.46, 99.73] 93.30 [86.68, 96.32]

Edinburgh Genetics

68.50 [58.01, 76.88]

89.79 [81.93, 93.24]

Shanghai Kehua Bio-Engineering Co., Ltd.

4.38 [1.24, 8.40]

20.15 [13.15, 30.02]

Qingdao HIGHTOP Biotech Co., Ltd.

69.33 [58.71, 78.19]

90.19 [82.70, 93.87]

PRIME4DIA Co., Ltd

45.05 [34.13, 54.97]

74.95 [66.93, 84.41]

Beijing Wantai Biological Pharmacy CTK Biotech Fortress Diagnostics LTd

• • • •

The AbLFTs tested can detect anti-spike-RBD antibodies in vaccinated individuals.

Sensitivity was improved following dose 2 of individuals SARS-CoV-2 vaccines.

Sensitivity was variable with Fortress being the highest performing test in our cohort.

Binomial mixed model analysis found that test results were not significantly impacted by day of sample collection (Day 21 or 42 post vaccine dose) and vaccine brand did not significantly impact test results.

• LFTs could have the potential to be a valuable point-of-care tool to aid in allocation of vaccines (First, second or booster vaccinations) and determining eligibility to life-saving monoclonal antibody therapies based on serostatus.

Future Work: Further investigation should focus on determining if a positive antibody LFT result correlates to neutralising capacity in vaccinated individuals and if an LFT result can be used to interpret ‘protection’ to SARS-CoV-2 and therefore inform vaccination schedules.

S

C

T

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Gracious Jamali Experiences of female sex workers participating in self-help groups to improve health outcomes: the case of Zimbabwe

Introduction/Background Studies have shown that self-help groups (SHGs) can empower people, thereby influencing change but little is known about their effectiveness in improving health outcomes and their sustainability among female sex workers (FSW). The burden of HIV remains high among FSW globally, more so, in Zimbabwe.

Methods A scoping review of reviews will be conducted to understand the nature and evidence of how SHGs can be a vehicle for influencing health outcomes, particularly HIV and SRH among FSWs. Qualitative and quantitative methods will be used to explore the sustainability of these groups among FSWs who participated in the AMETHIST Trial. I will explore the perceptions of FSWs on the benefits of taking part in SHGs. Supervisors Webster Mavhu, Fortunate Machingura, Frances M. Cowan, Joanna Busza

Expected outcomes This research project will produce empirical evidence on the effectiveness of SHGs in addressing HIV and SRH vulnerabilities of FSWs in Zimbabwe and how they can be effectively implemented to effect change. It will give recommendations on how SHGs can be made more sustainable, focusing mainly on HIV and SRH. This will be achieved by carefully assessing the factors that are associated with SHGs being more sustainable and those associated with them disintegrating. This research project will explore the perceptions of FSWs on benefits of taking part in SHGs to give insights on what they consider beneficial. Recommendations from this research will be useful in shaping future interventions targeted at FSWs that aim to impact on SRH and HIV.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 34

Experiences of female sex workers participating in self-help groups to improve health outcomes: the case of Zimbabwe Gracious Jamali (Dept. of International Public Health, Liverpool School of Tropical Medicine) Supervisors: Dr. Webster Mavhu, Dr. Fortunate Machingura, Prof. Frances Cowan, Prof. Joanna Busza

Introduction/Background • Globally, the burden of HIV remains disproportionately high among female sex workers

Map of Zimbabwe showing AMETHIST trial sites

(FSW); 58% prevalence in Zimbabwe • Self-help groups (SHGs) have been shown to improve health outcomes in other population groups • Preliminary findings from Zimbabwe suggest that SHGs can improve other aspects of FSW’s lives but their effectiveness in improving health outcomes, including HIV and sexual and

• This study hypothesises that SHGs for FSW run by sex worker peer ‘empowerment workers’ (EW) could positively impact their HIV and SRH outcomes by increasing uptake of health and social services and reducing acquisition and onward transmission of HIV

Research questions 1. How can SHGs improve HIV and sexual reproductive health related vulnerabilities among female sex workers in Africa?

2. What factors can contribute to the sustainability of SHGs?

3. How do FSWs define success in participating in SHGs?

AMETHIST Trial Theory of Change

reproductive health (SRH) is not known

Methods

Expected outcomes

• A scoping review of reviews will be conducted to understand the nature and evidence of how

• To produce empirical evidence on the effectiveness of SHGs in addressing HIV and

SHGs can be a vehicle for influencing health outcomes, particularly HIV and SRH among

SRH vulnerabilities of FSWs in Zimbabwe and how they can be effectively

FSWs

implemented to effect change

• This study is nested within the Adapted Microplanning to Eliminate Transmission of HIV in Sex Transactions (AMETHIST) Trial - a trial of a risk-differentiated intervention for FSW, centered around the implementation of microplanning and self-help groups • The AMETHIST Intervention was implemented in 11 of 22 sites in Zimbabwe after a pilot

• To give recommendations on how SHGs can be made more sustainable • To give insights on how FSWs define success • Recommendations from this research will be useful in shaping future interventions targeted at FSWs that aim to impact on health

study was conducted and it indicated that SHGs could be empowering to FSWs through fostering trust, solidarity and support

• 24 focus group discussions (FGDs) were conducted with FSWs taking part in SHGs as part of the AMETHIST trial process evaluation • 30 in depth interviews (IDIs) were conducted with both EWs and FSWs to explore challenges faced in the SHGs and sustainability

Preliminary results

• FGDs, IDIs and routine programme data (SHG registers that show size of groups, frequency of meetings, and participation rates) will be used to explore the sustainability of SHGs among

Acknowledgements

FSWs who participated in the AMETHIST Intervention

This research was funded in whole or in part, by the WELLCOME Trust 214280/Z/18/Z. •

I will explore the perceptions of FSWs on the benefits of taking part in SHGs using qualitative methods

•

A complementary Respondent Driven Survey (RDS) will give a broad perspective of the study

Picture of SHG women who participated in an FGD with their oven

Presented at the LSTM PGR Student Conference - June 2022

Gracious Jamali 531736@lstmed.ac.uk

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Kostas Liatsikos PREVENTING PNEUMOcoccal disease through vaccination

Introduction Despite widely available vaccinations, Streptococcus pneumoniae (SPN) remains a major cause of morbidity and mortality worldwide, causing communityacquired pneumonia, meningitis, otitis media, sinusitis, and bacteraemia. Here, we summarise a double-blind, randomised controlled trial investigating the effect of the 13-valent pneumococcal conjugate vaccine (PCV13) and the 23-valent pneumococcal polysaccharide vaccine (PPV23) on pneumococcal nasopharyngeal colonisation acquisition, density and duration using Experimental Human Pneumococcal Challenge (EHPC).

Authors Konstantinos Liatsikos1, Angela Hyder-Wright1,2, Sherin Pojar1, Tao Chen1,3, Duolao Wang1,3, Kelly Davies1, Christopher Myerscough1, Jesus Reine1, Ryan E. Robinson1,2, Britta Urban1, Elena Mitsi1, Carla Solórzano1, Stephen B. Gordon1,4, Angela Quinn5, Kaijie Pan5, Annaliesa S. Anderson6, Christian Theilacker5, Elizabeth Begier5, Bradford D. Gessner5, Andrea M Collins1,2*, Daniela M Ferreira1* & the PNEUMO 2 study group** Author’s affiliation Department of Clinical Sciences, Liverpool School of Tropical Medicine, Liverpool, UK

1

Method and analysis Healthy adult participants aged 18-50 years will be randomised to receive PCV13, PPV23 or placebo and then undergo one or two EHPCs involving intranasal administration of SPN at 1-month post-vaccination with serotype 3 (SPN3) and 6-months with serotype 6B (SPN6B). Participants randomised to PCV13 and placebo will also be randomised to one of two clinically relevant SPN3 strains from distinct lineages within clonal complex 180, clades Ia and II, creating five study groups. Following inoculation, participants will be seen on days 2, 7, 14 and 23. During follow-up, we will monitor safety, colonisation status, density and duration, immune responses and antigenuria. The study’s primary outcome is comparing the rate of SPN3 acquisition between the vaccinated (PCV13 or PPV23) and unvaccinated (placebo) groups as defined by culture. Density and duration of colonisation, comparison of acquisition rates using molecular methods and evaluation of the above measurements for individual SPN3 clades and SPN6B form the secondary objectives. We will explore immune responses associated with these vaccines, their effect on colonisation, and the relationship between colonisation and pneumococcal antigenuria.

Respiratory Research Group, Liverpool University Hospitals Foundation Trusts, Liverpool, UK

2

Global Health Trials Unit, Liverpool School of Tropical Medicine, Liverpool, UK

3

Malawi Liverpool Wellcome Trust Clinical Research Programme, Blantyre, Malawi

4

Pfizer vaccines, Collegeville, Pennsylvania, USA

5

Vaccines Research and Development, Pfizer Inc, Pearl River, New York, USA

6

36

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO

PREVENTING PNEUMOcoccal disease through vaccination (study 2) Konstantinos Liatsikos1, Angela Hyder-Wright1,2, Sherin Pojar1, Tao Chen1,3, Duolao Wang1,3, Kelly Davies1, Christopher Myerscough1, Jesus Reine1, Ryan E. Robinson1,2, Britta Urban1, Elena Mitsi1, Carla Solórzano1, Stephen B. Gordon1,4, Angela Quinn5, Kaijie Pan5, Annaliesa S. Anderson6, Christian Theilacker5, Elizabeth Begier5, Bradford D. Gessner5, Andrea M Collins1,2*, Daniela M Ferreira1* & the PNEUMO 2 study group (*Joint last authors) 1 2 Department of Clinical Sciences, Liverpool School of Tropical Medicine, Liverpool, UK Respiratory Research Group, Liverpool University Hospitals Foundation Trusts, Liverpool, UK 3 Global Health Trials Unit, Liverpool School of Tropical Medicine, 5 6 Pfizer vaccines, Collegeville, Pennsylvania, USA Vaccines Research and Development, Pfizer Inc, Pearl River, New York, USA Liverpool, UK 4 Malawi Liverpool Wellcome Trust Clinical Research Programme, Blantyre, Malawi

INTRODUCTION

•Streptococcus pneumoniae (SPN) remains a major cause of morbidity and mortality worldwide despite widely available vaccinations.

•Nasopharyngeal pneumococcal colonisation is common, with a prevalence of 40-95% in infants and 10-25% in adults1,2. Colonisation is considered a prerequisite for pneumococcal disease and the means of transmission in the community. Certain groups, such as children ≤5yrs, the immunosuppressed, or older adults, are at higher risk of developing symptomatic pneumococcal disease following colonisation.

•Our team has set up the Experimental Human Pneumococcal Challenge (EHPC). Healthy volunteers are given predefined SPN doses by nasal administration, with some becoming colonised. It enables the assessment of immunological responses and vaccine-induced correlates of protection against SPN. •Two vaccines are currently recommended in the UK, the 13-valent pneumococcal conjugate vaccine (PCV13) in children and the 23-valent pneumococcal polysaccharide vaccine (PPV23) in adults3. Since PCV13 was introduced in the UK childhood immunisation program, the prevalence of pneumococcal disease secondary to vaccine serotypes decreased significantly4.

•The main exception is SPN serotype 3 (SPN3), which is causing ~10% of invasive pneumococcal disease in the UK4, despite being included in both recommended vaccines.

•In this study, we will utilise our EHPC model to assess the effect of PCV13 and PPV23 against nasopharyngeal SPN3 colonisation. We are interested in two distinct SPN3 lineages, clade Ia and II. Clade Ia was the most prominent worldwide. As PCVs were introduced globally in childhood immunisation programs, clade II emerged, and is becoming increasingly prevalent5.

•Furthermore, we will assess the longer-term vaccine efficacy against pneumococcal colonisation. This assessment will be against SPN6B, a serotype that PCV13 has been shown to be effective against in the short term6. The consensus is that PPV23 has no effect on colonisation7.

METHODS

•Healthy adult participants aged 18-50 years will be randomised to receive PCV13, PPV23 or placebo and then undergo one or two EHPCs involving intranasal administration (inoculation) of SPN at 1-month post-vaccination with SPN3 and 6-months with SPN6B. Participants randomised to PCV13 and placebo will also be randomised to one of two clinically relevant SPN3 strains from distinct lineages within clonal complex 180, clades Ia and II, creating five study groups (see study timeline figure).

•Participants with health conditions that would increase their risk of infection following inoculation will be excluded. We will also exclude participants in regular close contact with children under the age of 5, immunosuppressed individuals, or clinically vulnerable. Participants allergic to penicillin or amoxicillin and those who have previously received a pneumococcal vaccine will also be excluded.

•Participants will be followed up at pre-defined time points with samples including nasal washes, nasal cells, blood and urine being collected.

•The inoculation doses used [80,000 Colony Forming Units (CFU) for all three strains] have been established to achieve 30-40% colonisation rates for SPN3 (Establishing SPN3 Challenge Model, PREVENTING PNEUMO 1, REC reference 19/NW/0238, unpublished data) and 40% for SPN6B, maintaining an acceptable safety profile6. All strains are confirmed to be amoxicillin sensitive.

•The primary outcome of the study is comparing the rate of SPN3 acquisition between the vaccinated [PCV13 (groups 1+2) or PPV23 (group 3)] and unvaccinated (placebo, groups 4+5) as defined by classical culture.

•Density and duration of colonisation, comparison of acquisition rates using molecular methods and evaluation of the above measurements for individual SPN3 clades and SPN6B form the secondary objectives.

•Furthermore, we will explore the immune responses associated with these vaccines, their effect on colonisation, and the relationship between colonisation and urinary pneumococcal antigen detection.

Get in touch or follow us if you want to learn more or would like to become a research volunteer!

STRENGTHS & LIMITATIONS

•The Experimental Human Pneumococcal Challenge (EHPC) model is a platform for evaluating vaccine efficacy against pneumococcal colonisation -a prerequisite for the development of pneumococcal disease- and requires significantly smaller numbers of participants than a field trial.

•This is the first time a study will compare the two most commonly used pneumococcal vaccines globally against placebo, using the same outcome measures, and aims to identify associated immunological parameters that potentially correlate with protection against pneumococcal colonisation.

•Our study will explore why Streptococcus pneumoniae serotype 3 (SPN3) remains a leading cause of pneumococcal disease globally despite its inclusion in PCV13 and PPV23 vaccines and PCV13’s documented efficacy against SPN3 invasive pneumococcal disease and non-bacteraemic pneumonia.

•As a decrease in colonisation density potentially translates to a decreased risk of disease and community transmission, we will be able to explore direct and indirect vaccine protection by measuring density against the defined EHPC timeline.

•This is an experimental model utilising one serotype at each challenge, at a fixed inoculum dose, which only approximates natural colonisation and therefore may not be fully generalisable.

Acknowledgements •We would like to acknowledge the contribution of the Royal Liverpool University Hospital (Liverpool University Hospitals Foundation Trust – LUHFT) respiratory consultants, for organising a rota and providing an out of hours emergency contact service for our participants.

•We would like to acknowledge the members of the Trial Steering Committee, Professors Chris Chiu (chair) and Jeffrey Weiser, Drs Jamie Rylance and Jane Metz, and Ms Denise Watson for offering their guidance when planning the study.

•We would like to acknowledge the members of the DSMC, Professors Robert Read (chair) and Neil French, and Dr Marc Henrion for their oversight and advice when planning the study.

•We would like to thank the Clinical Research Unit (CRU) team for offering support with visits, Rebecca Tangney, Lead Clinical Trials Pharmacist, and the pharmacy team at LUHFT for offering pharmacy oversight.

•We would like to acknowledge the Well Travelled Clinic (WTC) team for assisting with study vaccinations.

•We would like to acknowledge the support offered by the North West Coast Clinical Research Network (National Institute for Health Research) with staffing and recruitment.

•The PNEUMO 2 study group: Kelly Convey, James Court, Madlen Farrar, Fred Fyles, Josh Hamilton, Phoebe Hazenberg, Helen Hill, Lisa Hitchins, Ashleigh Howard, Tinashe K.Nyazika, Lauren Kerruish, Samuel Latham, Ben Morton, Annabel Murphy, Elissavet Nikolaou, Angelina Peterson, Hassan Burhan

References Trimble A, Connor V, Robinson RE, McLenaghan D, Hancock CA, Wang D, et al. Pneumococcal colonisation is an asymptomatic event in healthy adults using an experimental human colonisation model. PLoS ONE. 2020;15(3):e0229558

1

Arguedas A, Trzciński K, O’Brien KL, Ferreira DM, Wyllie AL, Weinberger D, et al. Upper respiratory tract colonization with Streptococcus pneumoniae in adults. Expert Rev Vaccines. 2020;19(4):353-66.

2

Immunisation JJCoVa. Interim JCVI statement on adult pneumococcal vaccination in the UK. 2015.

3

Amin-Chowdhury Z, Collins S, Sheppard C, Litt D, Fry NK, Andrews N, et al. Characteristics of Invasive Pneumococcal Disease Caused by Emerging Serotypes After the Introduction of the 13-Valent Pneumococcal Conjugate Vaccine in England: A Prospective Observational Cohort Study, 2014–2018. Clin Infect Dis. 2020;71(8):e235-e43.

4

Azarian T, Mitchell PK, Georgieva M, Thompson CM, Ghouila A, Pollard AJ, et al. Global emergence and population dynamics of divergent serotype 3 CC180 pneumococci. PLoS Pathog. 2018;14(11):e1007438.

5

Collins A, Wright A, Mitsi E, Gritzfeld J, Hancock C, Shaw D, et al. T4 Pneumococcal Conjugate Vaccine Reduces Rate, Density And Duration Of Experimental Human Pneumococcal Colonisation: First Human Challenge Testing Of A Pneumococcal Vaccine. Thorax. 2014;69(Suppl 2):A2-A.

6

Moberley S, Holden J, Tatham DP, Andrews RM. Vaccines for preventing pneumococcal infection in adults. Cochrane Database Syst Rev. 2013.

7

Study Timeline

Created with BioRender Poster Builder

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Galven Maringwa Characterising sexual partners and partnerships among female sex workers in Zimbabwe

Background To date, male sexual partners (clients and non-clients) of FSW have rarely been specifically targeted by HIV prevention despite being an “epidemiological bridging population” for sexually transmitted infections and HIV transmission.

Currently men are a group ‘left behind’ in terms of prevention and care.

Supervisors Frances M. Cowan, Elizabeth Fearon, James Hargreaves, Fortunate Machingura, Sanni Alli

Methods I plan to undertake a scoping review to understand the extent and type of evidence from Sub-Saharan Africa describing the socio-demographic characteristics, sexual behaviours, HIV and STI prevalence and engagement in HIV prevention and care of male partners and clients of FSW. In addition I will explore what is known about their population size and methods that have been used to estimate them. I will also undertake analyses of data collected using three distinct methodologies: Longitudinal coital diary study among FSW, a Respondent-Driven Sampling Survey among FSW and a Priorities for Local AIDS Control Efforts (PLACE) survey which will collect data from both FSW and high risk men in Zimbabwe.

Overall contribution The overarching aim of this research project is to better understand the risks, behaviours and HIV services engagement of sexual partners of FSW to inform prevention and care interventions for these high risk men. The project will estimate the population size of this group and inform our understanding of partnership typologies. This research will also contribute to better understand the HIV epidemic in Southern Africa, highlighting potential gaps for HIV control efforts.

Expected outcomes Inform Zimbabwe’s HIV prevention and care response among high risk men and likely also the response in Southern Africa more broadly.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 38

Characterising sexual partners and partnerships among female sex workers (FSW) in Zimbabwe Galven Maringwa (Dept. of Global Health, Liverpool School of Tropical Medicine) Supervisors: Prof. Frances Cowan, Dr. Elizabeth Fearon, Prof. James Hargreaves, Dr. Fortunate Machingura, Dr. Sanni Ali

Background • Female sex workers (FSW) and their sexual partners are at particularly high risk of HIV acquisition and transmission.

• To date, male sexual partners (clients and non-clients) of FSW have rarely been specifically targeted by HIV prevention despite being an “epidemiological bridging population” for sexually transmitted infections and HIV transmission. They have been assumed to be covered by general population programming • Currently men are a group ‘left behind’ in terms of prevention and care • Male sexual partners of FSW do not form a visible and coherent social grouping which makes it difficult to sample them and target them for interventions.

Research questions 1.What is known about the characteristics, population size, HIV prevalence and engagement in HIV prevention and care of the sexual partners of FSW in SSA? 2.What are the characteristics of partners and partnerships from 1) FSW perspectives from longitudinal diary studies and RDS surveys and 2) the sexual partners themselves from PLACE studies?

3.What is the population size of sexual partners of FSW in Zimbabwe: a multi-method comparison 4.What is the estimate of HIV prevalence and how engaged in HIV prevention and care are the sexual partners of FSW in Zimbabwe?

.

Methods 1. Scoping literature review 2.Analyses of data collected using three distinct methodologies: Longitudinal coital diary study among FSW (n=430), a Respondent-Driven Sampling Survey among FSW from 22 sites in Zimbabwe (n=4444) and a Priorities for Local AIDS Control Efforts (PLACE) survey which will collect data from both FSW and highrisk men in Zimbabwe (n=2400).

Data sources

Longitudinal coital diary

Respondent Driven Sampling survey

PLACE survey

Figure: Map of Zimbabwe

Research objectives 1. To describe the socio-demographic characteristics, sexual behaviours and engagement in HIV prevention and care of male sexual partners of FSW in Zimbabwe.

2. To understand the typologies of partners and partnerships of male partners and clients of FSW to inform prevention and care interventions for these high- risk men in Zimbabwe.

3. To estimate the population size and HIV/STI prevalence of male sexual partners of FSW in Zimbabwe.

Overall contribution of the project • • • • •

Characterise partners and partnerships Understand how male sexual partners perceive partnerships Describe patterns of risk behaviour within their partnerships Generate evidence- based results to improve understanding of the HIV epidemic Inform interventions to better engage high risk men into prevention and care

Conclusion • Informing Zimbabwe’s HIV prevention and care response among high-risk men and the response in Southern Africa more broadly

Acknowledgements • AMETHIST consortium for funding – Welcome Trust

4VIWIRXIH EX XLI 0781 4+6 7XYHIRX 'SRJIVIRGI .YRI

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Ellen Masters Mode of action of anti-Wolbachia drugs

Abstract Lymphatic filariasis and onchocerciasis are neglected tropical diseases caused by a family of filarial nematodes. Severe clinical manifestations are caused by both microfilariae (onchocerciasis) and adult worms (lymphatic filariasis). The available drugs are microfilaricidal, and so both diseases rely on mass drug administration programmes covering the reproductive lifespan of the female worms. Antibiotics that deplete the obligate intracellular endosymbiont of the nematodes, Wolbachia cause permanent sterility and slow death of the adult worm. These antibiotics were shown to induce autophagy in insect cells and Brugia malayi.

This project aims to determine the mode-of-action that leads to autophagy induction by these drugs, which is currently unknown.

Three antibiotics (doxycycline, minocycline, and tetracycline) and their analogues (epi-doxycyline, epi-minocycline, and anhydro-tetracycline) were assessed for their anti-Wolbachia activity. A Wolbachia-infected mosquito cell line was incubated in serial dilutions of each drug for 7 days before the Wolbachia were stained using Syto-11 and quantified using the Operetta. Dose-response curves were then fitted for an EC50 to be calculated. A clear shift to the right with a higher EC50 was seen for the epi-doxycyline and epi-minocycline compared to doxycycline and minocycline, respectively. Anhydro-tetracycline seems to have little to no effect on Wolbachia load.

C. elegans with GFP tagged autophagy-related proteins will be treated with the antibiotics and their analogues, to find a point at which the parent drug induces autophagy, and the analogue does not. RNA-seq can then be used to compare the treated worms to understand the processes involved in autophagy induction by these drugs.

40

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Primrose Matambanadzo Association of microplanning with prevention of acquisition and transmission of HIV among female sex workers

Introduction/background Differentiated peer outreach (microplanning) with female sex workers (FSW) improved engagement in HIV prevention and treatment services in India and Kenya. We scaled up microplanning with FSW in Zimbabwe across 11 sites of the national sex work programme between June 2019 and August 2021 within the AMETHIST randomized control trial and incorporated a six-criteria risk assessment matrix to better target peer support for increased engagement and retention in prevention and care cascades. FSW at highest risk of HIV acquisition or transmission were supported more intensively. A process evaluation collected qualitative data in three sites.

Methodology Through systematic review I will assess the association between microplanning and FSW’s engagement in HIV prevention and care services. I will explore whether risk assessment by microplanners predicts risk of HIV acquisition or transmission through comparison of programme data and end of trial Respondent Driven Sampling (RDS) survey data. The intensity of support required by microplanned FSW for optimal retention on PrEP and ART will be explored through analysis of programme data, RDS survey data, and qualitative process evaluation data. How microplanning can be optimised to better support FSW at highest risk will be addressed through analysis programme and process evaluation data.

Overall contribution The research project will characterise the association between risk differentiated peer support of FSW and engagement and retention in HIV prevention and treatment services and explore how this could be optimised to reach those most at risk and ensure they get the support they need.

42

Association of microplanning with prevention of acquisition and transmission of HIV among female sex workers Primrose Matambanadzo 1,2

1. Centre for Sexual Health and HIV/AIDS Research (CeSHHAR) Zimbabwe 2. Liverpool School of Tropical Medicine

Introduction Microplanning with FSW in Zimbabwe was scaled up across 11 sites of the national sex work programme between June 2019 and October 2021 within the Adapted Microplanning to Eliminate Transmission of HIV in Sex Transactions (AMETHIST) cluster randomized trial.

Cluster = female sex worker (FSW) population around a clinic.

22 clusters allocated using restricted randomisation to usual care or to the AMETHIST intervention.

11 Usual care clusters provided FSW-friendly services, HIV testing, PrEP or referral to government ART services, contraception, condoms, STI syndromic management and health education supported by peer educators.

11 AMETHIST intervention clusters provided usual care plus risk-differentiated HIV prevention, treatment and adherence support led by microplanners in addition to participatory self-help groups.

Study design and methods Explore how well does risk assessment by microplanners predicts risk of HIV acquisition or transmission through comparison of programme data and end of trial Respondent Driven Sampling (RDS) survey data.

Figure 1: CeSHHAR microplanners

Assess the intensity of support (tracking by risk profile) required by microplanned sex workers for optimal retention in PrEP, ART services, consistent condom use through analysis of programme data, qualitative process evaluation data, and RDS survey data comparing outcomes in sex workers receiving the frequency of contact as per protocol and those receiving lower frequency of contact than protocol.

Determine how can microplanning be optimised to better support FSW engagement and retention in HIV prevention and care through analysis of programme and process evaluation data to identify barriers and facilitators across sites that performed well and those that performed less well.

7000 FSW micoplanned

Assessed for risk every 3 months

36,356 risk assessments

Preliminary Results Figure 2: Frequency of individual risk factors by site

Figure 2: Microplanner's Risk Assessment Tool

Inconsistent condom use and high client numbers were the most common risk factors among FSW at each site who were assessed to be at risk by different criteria and violence was the least common (though not negligible at almost 15%).

Factors likely to predict risk of future HIV acquisition or transmission

Conclusion

The distribution of risk factors by site also illustrates a high correlation among risk factors evident across sites.

At Chipinge and Rusape high proportion of sisters are young and new to sex work and have high numbers of clients.

Inconsistent condom use not surprisingly is common among young and inexperienced sex workers with many clients, and is likely exacerbated by problematic drinking, drugs and violence.

The research project will characterise the association between risk differentiated peer support of FSW and engagement and retention in HIV prevention and treatment services and explore how this could be optimised to reach those most at risk and ensure they get the support they need.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Agnes Matope The Video Cone Test PLUS system: assessing the utility of using Anopheles gambiae behavioural responses to evaluate insecticide-treated bed net efficacy.

Abstract To combat increasing insecticide resistance in malaria vectors, insecticide-treated nets (ITNs) treated with co-formulations of pyrethroids and non-pyrethroid insecticides have been developed. The Video Cone Test (VCT) PLUS, an extension of the standard WHO cone test, is designed to characterise the effects of these co-formulations. This project aimed at assessing the reliability of the test for use in evaluating the bio-efficacy of co-formulated ITNs considering the inherent day-to-day variability observed in bioassays.

Authors Agnes Matope¹, Jeff Jones¹, Katherine Gleave¹, Mischa Emery¹, Keith Steen¹, Angela Hughes¹, Philip McCall¹, Hilary Ranson¹, Mafalda Viana2 and Geraldine Foster¹ Author’s affiliation 1

epartment of Vector D Biology, Liverpool School of Tropical Medicine

2

I nstitute of Biodiversity Animal Health & Comparative Medicine, University of Glasgow

Pyrethroid susceptible and resistant Anopheles gambiae mosquitoes were exposed to untreated net or ITNs: Interceptor® G2 (IG2), Olyset, PermaNet® 2.0 (P2), and PermaNet® 3.0 (P3). The proportion of mosquitoes contacting the net and total movement (quantified) within the cone were the outcomes.

The behavioural measurements within-day and between-days precision were assessed using five distinct coefficient of variation (CV) metrics to determine the suitable method for assessing variability. Within-day precision was assessed using the intra-class correlation coefficient (ICC) from the random-effects models.

Test precision varied with testing day, net treatment, and mosquito strain. The CVs/ICC for untreated nets met the acceptable criteria (CV below 30-40% or ICC above 0.60) except for the VK7 strain and VCT (ICC), revealing that the testing system is reliable. All the ITN CVs met the acceptable criteria except for IG2, OS, and P2 (VK7 strain), showing consistency of the test when an ITN is added.

Preliminary results show prospects of the VCT PLUS as a tool for characterising different ITN effects. Further investigation is currently underway in two external laboratories to validate the test.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 44

The Video Cone Test PLUS system: assessing the utility of using Anopheles gambiae behavioural responses to evaluate insecticide-treated bed net efficacy Agnes Matope¹, Jeff Jones¹, Katherine Gleave¹, Mischa Emery¹, Keith Steen¹, Angela Hughes¹, Philip McCall¹, Hilary Ranson¹, Mafalda Viana2 and Geraldine Foster¹

¹ Department of Vector Biology, Liverpool School of Tropical Medicine and 2 Institute of Biodiversity Animal Health & Comparative Medicine, University of Glasgow

Methods and Analysis

Introduction

To combat increasing insecticide resistance in malaria vectors, insecticide-treated nets (ITNs) treated with co-formulations of pyrethroids and non-pyrethroid insecticides have been developed. 1 The Video Cone Test (VCT) PLUS is designed to characterise the effects of these co-formulations. This project aimed at assessing the reliability of the test for use in evaluating the bio-efficacy of co-formulated ITNs considering the inherent day-to-day variability observed in bioassays.

VCT PLUS is an extension of the standard WHO cone test with modifications 1. Smartphone is used to record the mosquitoes’ activity 2. Operator’s forearm provides a host during the assay

Bioassay testing data were used, where pyrethroid susceptible (Kisumu and Ngousso) and resistant (Banfora and VK7) Anopheles gambiae mosquitoes were exposed to untreated or ITNs including Interceptor® G2 (IG2), Olyset, PermaNet® 2.0 (P2), and PermaNet® 3.0 (P3) nets. The tests were conducted with a host present or absent. The behavioural measurements assessed were ❖ Proportion of mosquitoes in contact with the net using scan sampling (SS) ❖ Total movement (within-cone) using the Video Cone Test Analyser (ViCTA) Test within-day and between-days precision was evaluated using 1. Coefficient of variation (CV) 2. Coefficient of quartile variation (CQV) 3. Geometric CV (GCV) 4. Interquartile range CV (CVIQR) 5. Median absolute deviation CV (CVMAD) 6. Intra-class correlation coefficient (ICC) using random-effects models Estimates 95% confidence intervals (CI) were constructed using bootstrap Reliability acceptance criteria: CV estimates < 30-40% and ICC > 0.60 ❖ UT and ITNs results were used to show the reliability of the testing system and consistency of the test when an ITN is added, respectively.

Figure 1. VCT apparatus

Results

Untreated results

Most of the within-day estimates satisfied the acceptability criteria (VCT CV < 30% and ViCTA <40%) except for VK7 ViCTA (Figure 2A, B), suggesting the reliability of the testing system.

Unlike VCT, some ViCTA estimates for Kisumu, Ngousso, and Banfora strains (Operator KG) are close to the less stringent 40% cutoff limit.

The between days precision concurs with the within-day CV results (CV < 40 except for ViCTA VK7, Operator KAS, and some estimates for Ngousso), suggesting that the system is repeatable over multiple testing days (Figure 3A, B).

For the ICC results, higher within-day repeatability was observed in ViCTA (ICC > 0.70) suggesting the reliability of the testing system based on total movement. All the VCT results were below the threshold (ICC < 0.60) suggesting the lack of within-day repeatability based on net contact (Table 1).

Test

Host Op. Days ICC [95% CI] present 8 0.56 [0.26, 0.75] No ME Yes ME 13 0.12 [0.00, 0.32]

VCT Figure 2. Test Within-days precision estimates.

CVs with an upper 95% CI > 150% excluded ViCTA Yes KAS 25 0.73 [0.52, 0.84] Higher precision (low CVs) was observed in VCT 4 0.87 [0.23, 0.97] Yes KG compared to ViCTA. Precision varied with treatment, Op. = Person conducting the experiment strain, operator, or host presence. There was low precision in VK7 compared to other strains, and in Table 1. Within-day precision random-effects operator KAS compared to KG (ViCTA) (Figure 2A, B). model estimates (UT results across strains)

Results (cont.)

ITNs results

Within-day and between days precision were within the acceptable threshold (CV < 30%) except for VK7 (ViCTA IG2, OS and P3 and VCT P2 host absent) (Figure 2, 3), suggesting the reliability of the test when an ITN is added to the test except for VK7. This might be attributed to the high resistance of the VK7 strain. 2 VCT results suggest that host presence during the test might improve the mosquitoes’ behaviour assessment outcomes precision when exposed to different net treatments (Figure 3A).

Most of the results suggest that CQV followed by CV are better methods for measuring precision in behavioural assays. Future work includes a formal assessment of these methods to determine the most suitable metric.

Figure 3. Test between-days precision estimates.

CVs with an upper 95% CI > 200% excluded

Conclusion Test precision varied with testing day, net treatment, mosquito strain, test operator, or host presence. Preliminary results show prospects of the VCT PLUS as a tool for characterising the effects of different ITNs. Further investigation is currently underway in two external laboratories in Africa to validate the test.

References

1. McCall, Ranson & Foster. 2020. Accelerating time to market of new vector control tools by strengthening the Phase I evaluation. Internal project final narrative. Unpublished.

2. Williams et al. 2019. Characterisation of Anopheles strains used for laboratory screening of new vector control products. Parasites & vectors. 12(1):1-4

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Hauwa Mohammed Improving the Effectiveness of Skilled Health Personnel in Nigeria: Study Protocol

Background Maternal Death (MD) is death of a woman during pregnancy, childbirth to a period up to 6 weeks after childbirth. Reducing number of MD has remained a global challenge especially in Sub-Saharan Africa (SSA) and South-East Asia where 86% of MD occur. Nigeria has the highest number of MD Worldwide.

To reduce MD there is need for Skilled Health Personnel (SHP) to manage childbirth; these SHP are competent professionals educated and regulated to provide and promote quality and dignified care to women, Identify, manage or refer women with complications. Worldwide there is shortage of 1.1 million SHP especially in SSA, the available few do not operate maximally from lack of knowledge or skills, lack of workplace support, ineffective policies.

Methods The study is in 3 Nigerian states in health facilities that provide maternity care.

Research question 1. What is the effect of work-related stress on SHP in Nigeria; what support systems are available?

• Health facility assessment • Cross-sectional survey • In-depth interview • Focus group discussion 2. Does a midwifery specific Continuous Professional Development (CPD) programme address the training needs of maternity workers in Kwara state Nigeria? And what are the perceived training needs of SHP in Nigeria?

• Evaluation of a midwifery specific CPD programme to adapt/redesign the programme 3. How effective is maternity care service provision by SHP in Nigeria?.

• Health worker observation (ANC) • Client exit questionnaire (ANC)

Results Quantitative data analysis with IBM SPSS statistics software version 25 for data summary and qualitative data analysis with NVIVO version 24, for thematic analysis.

Conclusion Dissemination workshop will be organised for managers of health services.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 46

Improving the Effectiveness of Skilled Health Personnel In Nigeria

By Hauwa Mohammed Supervisors: Charles Ameh1, Justin Pulford1 and Prof. Senol Dane2

Background

1. Liverpool School of Tropical Medicine, UK, 2. Nile University, Abuja Nigeria Map of Nigeria

Globally 300,000 women die annually from pregnancy and childbirth complications., mostly from avoidable causes.

Nigeria alone contributes 23% of global maternal deaths. (WHO, 2019). Current Maternal Mortality Ratio (MMR) in Nigeria is 512 per 100,000 live births (NDHS, 2018) which is higher than the global MMR of 211.

In northern Nigeria MMR is almost double that of the south in 2013 the value was 709 vs 365. (Meh, 2019).

Strategies for reducing maternal mortality include skilled attendance at birth (having a Skilled Health Personnel SHP managing childbirth) and availability of Emergency Obstetrics and New-born Care (EmONC) (right policies, equipment and supplies).

In Nigeria, only 43% of births are attended by a SHP, and more than 90% of SHP showed poor knowledge of EmONC . (Okonofua et al 2019).

Having a SHP attending to delivery alone does not guarantee survival due to poor performance influenced by lack of knowledge and skills, poor work environment, and work-related stress..

Currently Nurses and Midwives are trained in competency-based EmONC to earn 3 Continuous Professional Development (CPD) points to be used for licence renewal at the Centre of Excellence for Midwifery Education established in Kwara state in partnership with and the Nursing and Midwifery Council of Nigeria (NMCN).

This study will use quantitative and qualitative research approaches to evaluate factors that influence the effectiveness of SHP in northern regions of Nigeria and evaluate the CoE to adapt/redesign the system.

Research Aim: To improve the Effectiveness of Skilled Health Personnel in Nigeria Research Objectives

1. To conduct a systematic review of factors that influence the effectiveness of skilled health personnel in subSaharan Africa.

2. To determine the factors that influence skilled health personnel effectiveness in northern Nigeria, including the prevalence of work-related stress and availability of support systems 3. To determine the perceived training needs of SHP in Nigeria and to evaluate and re-design a system that addresses the training needs of skilled health personnel and systems in place to meet these needs.

4. To evaluate the effectiveness of maternity services provision by skilled health personnel using antenatal care services platform.

Skilled Health Personnel (SHP) are defined as: “Competent Maternal and Newborn (MNH) professionals educated, trained and regulated to national and international standards.

They are competent to: - Provide and promote evidence-based, human-rightsbased, quality, socio-culturally sensitive and dignified care to women and newborns; - Facilitate physiological processes during labour and delivery to ensure a clean and positive childbirth experience and; - Identify and manage or refer women and or newborns with complications.” (WHO, 2018)

Methodology Study Summary

Location: Northern Nigeria North-East – Bauchi state, North-West – Kaduna state, North-Central – Kwara state.

Health facilities: 1 secondary health center, 2 primary health care center and 2 private/ faith-based centers. From each Local Government Area (LGA) and 1 tertiary center (total 16 facilities).

Population: of study: SHP in Nigeria (Nurses, Midwives, Doctors, Community Health Workers) and Pregnant women attending Antenatal Care (ANC).

Ethics Ethics approval will be obtained from LSTM REC, Nigeria REC and permission from the state ministry of health and facilities before data collection.

Only consenting participants will be recruited in the study. All participants will sign/thumb print a consent form.

Data collection Quantitative data will be collected Electronically on SurveyCTO software (cross-sectional surveys, health facility assessment, observations and client exit questionnaire) Qualitative data will be recorded (key interviews and FGD) and transcribed.

Records for the EmONC training in the CoE (participant information, feedback forms, test results and post training follow up) will be evaluated.

Objective 1 Systematic Review Improving the Effectiveness of SHP in Sub-Saharan Africa - Protocol registered on PROSPERO. Health facility assessment Secondary data collection -Staff number and cadre -Infrastructure equipment and supplies.

-Maternal and newborn facility data (preceding month)

Objective 2 Cross-sectional survey For SHP working in maternity units through a self-administered questionnaire on: - Training Needs assessment - Work-Related stress Key informant interview with unit/facility heads.

Focus Group discussion (3 groups) -Nurse Midwives -Doctors -Community Health Workers

Objective 3 Center of Excellence Data 300 Nurses and midwives trained in EmONC in partnership with NMCN. For CPD. Secondary analysis of the training data for 168 participants (based on sample size calculation) will be selected for evaluation of test scores and information from feedback forms.

Post training follow up -Participants and -Their managers

Analysis

IBM SPSS statistics software version 25 for windows will be used for analysis of quantitative data.

The data will be analysed using distribution tables, frequency tables and charts for demographics characteristics and regression analysis to find associations.

Health worker observation will be compared with level of facility, type of health worker, availability of equipment, and workload using chi-squared test.

The data from the Center of Excellence for EmONC training will be exported to SPSS for analysis.

Qualitative data from In-depth interviews and FGD will be transcribed and coded. The information will be analysed using NVIVO version 24 qualitative software (QSR international). Thematic analysis will be employed to find common recurring themes from the data, all the data will be transferred to a spread sheet and arranged in a thematic framework

Dissemination of results

Workshops organised for managers of health services in the participating states.

Publication in peer reviewed journals.

Conference presentations in relevant local and international conferences.

Objective 4 Health Care worker observation check-list Observation of health care worker Antenatal care service provision Antenatal client exit questionnaire Women that have completed ANC will be asked questions about their experience with the ANC.

References 1. Alexander K.R. et al, How can we achieve and maintain high-quality performance of health workers in low resource setting? 2005

2. Meh C. et.al. (2019). Levels and determinants of maternal mortality in northern and southern Nigeria. Retrieved from BMC Pregnancy and Childbirth (2019) 19:417: https://doi.org/10.1186/s12884019-2471-8 3. NDHS. (2018). Nigeria Demographic and Health Survey. Retrieved October 2020, from https://dhsprogram.com/pubs/pdf/FR359/FR359.pdf 4. Okonofua F et al., 2019 Assessing the knowledge and skills on emergency obstetric care among health providers: Implications for health systems strengthening in Nigeria (2019). PLoS ONE https://doi.org/10.1371/journal.pone .

5. WHO. (2018a, June 13). Definition of skilled health personnel providing care during birth. Retrieved December 2020, from World Health Organisation: www. who. int/reproductive health/defining-competentmnh-professionals 6. WHO, UNICEF, UNFPA, AND THE WORLD BANK, 2019 Trends in maternal mortality 2000 to 2017. [Online] Available: https//www.WHO-RHR-19.23-eng.pdf

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Mosepele Mosepele Albuminuria is Common Among HIV-infected men on Antiretroviral Therapy in Botswana

Background Chronic HIV-disease is associated with a 5-fold increase in albuminuria in non-sub-Saharan Africa. Despite this strong association, very little is known about prevalence and factors associated with albuminuria among people living with HIV (PLWH) in sub-Saharan Africa.1,2,3

Methods Between January 2020 and January 2021, 1533, adults aged 21 years or older, receiving antiretroviral therapy (ART) and virally suppressed in Gaborone, Botswana, were invited to participate in the albuminuria study, during their regular HIV care visits. Albuminuria was defined using sex-based Albumin-Creatinine Ratio (ACR) of 25-355m/g for females and 17-250mg/g for males. Due to a large prevalence of albuminuria among the participants, we fitted a modified Poisson regression model to identify predictors of albuminuria in the entire cohort, and then by gender groups. We reported risk ratios, corresponding 95% confidence intervals and p-values. All p-values <0.05 were considered significant.

References 1. Falasca K, Di Nicola M, Porfilio I, Ucciferri C, Schiaroli E, Gabrielli C, et al. Predictive factors and prevalence of microalbuminuria in HIVinfected patients: a cross-sectional analysis.

BMC nephrology.

2017;18(1):255.

2. Tongma C, Shikuma CM, Nakamoto BK, Kallianpur KJ, Umaki TM, Barbour JD, et al. Albuminuria as a marker of cardiovascular risk in HIV-infected individuals receiving stable antiretroviral therapy.

Hawai’I journal of medicine & public health: a journal of Asia Pacific Medicine & Public Health. 2013;72(9 Suppl 4):34-8.

3. Choi AI, Li Y, Deeks SG, Grunfeld C, Volberding PA, Shlipak MG. Association between kidney function and albuminuria with cardiovascular events in HIV-infected persons. Circulation.

2010;121(5):651-8.

Results Among the 1533, 764 (49.7%) were female with mean age of 48.5 (SD 10.3) years. The overall prevalence of albuminuria was 318 (20.7% - (18.7%,22.8%)). Both older age [51 (SD 10.3) vs 47.8 (SD 10.2), P<0.001] years and male [193 (60.7%) vs 125 (39.3%), P<0.001] gender were associated with being categorized as having albuminuria. In a modified Poisson regression model including all, being male [1.80 (1.43, 2.28), P<0.001], having a larger waist hip ratio [1.35 (1.06, 1.72), P=0.016], having diabetes mellitus [1.81 (1.12, 2.93), P=0.016], having a higher diastolic blood pressure [1.02 (1.01, 1.04), P=0.010] and a longer duration on ART [2.64 (1.39, 5.03), P=0.003] were independently associated with albuminuria. Having diabetes mellitus [1.93 (1.07, 3.47), P= 0.028], a higher diastolic blood pressure [1.03 (1.01, 1.05), P=0.009] and a longer duration on ART [2.40 (1.17, 4.92), P=0.017] were associated with albuminuria among men only, while no clinical factor was associated with albuminuria among females after adjusting for confounding and multicollinearity. Moreover, no gender interaction term significantly predicted having albuminuria.

Conclusion The prevalence of albuminuria was relatively high among virally suppressed PLWH in Botswana, and the risk factors differed significantly by gender group. Larger longitudinal studies are required to evaluate impact of albuminuria among PLWH with particular emphasis on effect of gender on risk of albuminuria.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 48

Prevalence of Albuminuria Among Virally Suppressed Adults Living with HIV in Botswana Mosepele Mosepele1,2,6 Ponego Ponatshego1, Kesaosaba Molebatsi2, Christopher Williams1, Lucky Mokgatlhe2, Shabbar Jaffar3, Joseph Jarvis1,4, Shahin Lockman1,5, Nabila Youssouf1,4, Robert Gross6 1Botswana

Harvard AIDS Institute Partnership; 2University of Botswana; 3Liverpool School of Tropical Medicine; School of Hygiene and Tropical Medicine; 5TH Chan School of Public Health, Harvard University; 6Perelman School of Medicine, University of Pennsylvania

4London

Background Chronic HIV-disease is associated with a 5-fold increase in albuminuria in non-sub-Saharan African settings. Despite this strong association, very little is known about prevalence of albuminuria among people living with HIV (PLWH) in subSaharan Africa [1, 2, 3] Methods Between January 2020 and January 2021, 1533, adults aged 21 years or older, receiving antiretroviral therapy (ART) and virally suppressed in Gaborone, Botswana, were invited to participate in the albuminuria study, during their regular HIV care visits. Albuminuria was defined using sex-based Albumin-Creatinine Ratio (ACR) of 25-355m/g for females and 17-250mg/g for males. Due to a large prevalence of albuminuria among the participants, we fitted a modified Poisson regression model to identify predictors of albuminuria in the entire cohort, and then by gender groups. We reported risk ratios, corresponding 95% confidence intervals and p-values. All p-values <0.05 were considered significant.

Results (Prevalence) Among the 1533, 764 (49.7%) were female with mean age of 48.5 (SD 10.3) years. The overall prevalence of albuminuria was 318 (20.7% - (18.7%,22.8%)). Both older age [51 (SD 10.3) vs 47.8 (SD 10.2), P<0.001] years and male gender [193 (60.7%) vs 125 (39.3%), P<0.001] were associated with being categorized as having albuminuria.

Results (Predictors) In a modified Poisson regression model including all, being male [1.80 (1.43, 2.28), P<0.001], having a larger waist hip ratio [1.35 (1.06, 1.72), P=0.016], having diabetes mellitus [1.81 (1.12, 2.93), P=0.016], having a higher diastolic blood pressure [1.02 (1.01, 1.04), P=0.010] and a longer duration on ART [2.64 (1.39, 5.03), P=0.003] were independently associated with albuminuria. Having diabetes mellitus [1.93 (1.07, 3.47), P= 0.028], a higher diastolic blood pressure [1.03 (1.01, 1.05), P=0.009] and a longer duration on ART [2.40 (1.17, 4.92), P=0.017] were associated with albuminuria among men only, while no clinical factor was associated with albuminuria among females after adjusting for confounding and multicollinearity. Moreover, no gender interaction term significantly predicted having albuminuria.

Conclusion The prevalence of albuminuria was relatively high among virally suppressed PLWH in Botswana, and the risk factors differed significantly by gender group. Larger longitudinal studies are required to evaluate impact of albuminuria among PLWH with particular emphasis on effect of gender on risk of albuminuria.

References 1. Falasca K, Di Nicola M, Porfilio I, Ucciferri C, Schiaroli E, Gabrielli C, et al.

Predictive factors and prevalence of microalbuminuria in HIV-infected patients: a cross-sectional analysis. BMC nephrology. 2017;18(1):255.

2. Tongma C, Shikuma CM, Nakamoto BK, Kallianpur KJ, Umaki TM, Barbour JD, et al. Albuminuria as a marker of cardiovascular risk in HIV-infected individuals receiving stable antiretroviral therapy. Hawai'i journal of medicine & public health: a journal of Asia Pacific Medicine & Public Health. 2013;72(9 Suppl 4):34-8.

3. Choi AI, Li Y, Deeks SG, Grunfeld C, Volberding PA, Shlipak MG. Association between kidney function and albuminuria with cardiovascular events in HIVinfected persons. Circulation. 2010;121(5):651-8.

Funding acknowledgements

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Betwel Msugupakulya Investigating the opportunities for implementing larval source management for malaria control in rural Tanzania

Introduction Vector control tools including insecticide-treated nets have contributed to substantial declines in malaria in the past decades but are now facing multiple challenges such as insecticide resistance. This highlights the need for supplementary interventions, such as larval source management (LSM). While Tanzania has historically implemented LSM in some urban areas, it is not widely used in rural areas. This study will investigate opportunities for LSM in rural communities in south-eastern Tanzania.

Supervisors Prashanth Selvaraj, Fredros Okumu, Anne Wilson

Methods Entomological surveillance is being conducted in eight villages in Ulanga District in Tanzania, including twelve monthly mosquito collections indoors (using CDC light traps) and outdoors (using miniaturized double-net traps). The collected mosquitoes are sorted by taxa and tested for Plasmodium sporozoites, to estimate annual variations in densities and the differential importance of each vector species. Additionally, year-round surveys of aquatic habitats are done to identify, map and characterize all potential and confirmed habitats of different Anopheles species. This data will be used to estimate coverage and proportion of the habitats used by the dominant vector species, and the proportions suitable for larviciding, habitat manipulation or modification. The combined analysis and modelling using these datasets will enable a comprehensive assessment of the potential of targeted LSM (by larviciding, habitat manipulation or modification) for malaria control in these areas and the amount of resources necessary to achieve this goal.

Conclusion This research will generate evidence on the feasibility of LSM in rural areas, the use of which could lead to further reduction of malaria transmission in Tanzania and beyond.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 50

Investigating the opportunities for implementing larval source management for malaria control in rural Tanzania Betwel J. Msugupakulya*, Prashanth Selvaraj, Fredros Okumu, and Anne Wilson

Introduction • Control of malaria vectors is still reliant on indoor insecticide-based interventions i.e., ITNs and IRS • Following the success of larviciding in urban malaria control, Tanzania gained an interest in larviciding for malaria control • The country has made investments to implement larviciding in rural and urban areas despite its novelty in rural areas • Larviciding is discouraged in rural areas as it is perceived these areas have numerous and unstable mosquito aquatic habitat • This study aims to assess the feasibility of implementing LSM in rural areas

Key questions • Differential importance of different malaria vectors in rural areas • Coverage and distribution of aquatic habitats important to malaria transmission in rural areas

Sibling species identification

Plasmodium sporozoite detection

Fig 3. Adult mosquito collection methods and processing

Larval surveillance • Habitat search is conducted by walking around throughout each village • Each identified water-body is inspected to identify vector species sheltered in different water bodies • Each water body is geo-located, surface area of each habitat is estimated, and its physical and biological features characterized

• Potential methods for LSM in rural areas

Methods Eight villages were purposively selected for this study based of DHIS2 data

Fig 4. Larval collections and sorting

Outcome variables

Local village leaders were approached before the study had begun The study begun with two components: i) adult mosquito survey and ii) larval surveys

i.

Vector composition, densities, and proportion carrying with Plasmodium sporozoites

ii.

Malaria transmission intensity (entomological inoculation rate) and percent contribution of each vector species in malaria transmission

iii.

Identified and mapped aquatic habitats of Anopheles mosquitoes

Fig 1. study villages

Adult mosquito surveillance • From each village 37 randomly selected houses were recruited into the study • Mosquitoes are collected in one sentinel and 36 random houses

Conclusion • This research will generate valuable data on the feasibility of LSM: This will include: • Information on important vectors of malaria in rural areas of Tanzania • Proportion of important aquatic habitats in malaria transmission

Indoor collections

Outdoor collections

• Consolidating these will inform resources needs for rural LSM and in determining LSM methods for these areas.

Fig 2. Adult mosquito tools Other partners: Pan-African Mosquito Control Association, Institute for Disease Modeling, Valent Biosciences

More information *Author: Betwel J. Msugupakulya *Email : 437391@lstmed.ac.uk jbetwel@ihi.or.tz

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Leonard Mvaya Poor cytotoxic potential and differential localization of duodenal CD8+ T cells

Background The duodenal mucosa is a reservoir of HIV infection during suppressive antiretroviral therapy (ART) despite harbouring abundant resident CD8+ T cells.

I hypothesised that spatial segregation away from reservoir harbouring cells and poor cytotoxic function of resident CD8+ T cells are key factors that contribute to persistent HIV infection in the duodenum.

Methods Duodenal biopsy tissues and paired blood samples were collected from 33 individuals living with HIV (17 ART-; 16 ART+) and 18 HIV-uninfected adults.

Duodenal and peripheral blood mononuclear cells were isolated and analysis was done by flow cytometry. Formalin-fixed paraffin-embedded duodenal tissue samples were processed and stained for immunofluorescence microscopy imaging and analysis.

Results Phenotypic analysis identified abundant duodenal resident memory CD8+ T (Trm) cells defined as CD69+CD103hi (>75%) in HIV infected individuals and healthy controls. Most duodenal CD8+ Trm cells did not co-express pre-formed perforin and granzyme B (<1%). Immunofluorescence imaging revealed that bulk duodenal CD103+CD8+ T cells were localized in the intraepithelial region, while non-resident (CD103-CD8+ T cells) and CD4+ T cells were mostly localised in the lamina propria. On average, 99.99% (IQR 99.96-100) of HIV-specific CD8+ Trm cells detected in both ART- and ART+ individuals did not express perforin and granzyme B regardless of tissue localisation.

Conclusion These data indicate that duodenal CD8+ Trm cells rarely co-express perforin and granzyme B, and mostly occupy regions spatially separated from HIV-susceptible lamina propria CD4+ T cells, both of which possibly contribute to HIV persistence.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 52

Spatial localization and poor cytolytic potential of duodenal CD8+ T cells Leonard Mvaya

Supervisors: Dr Kondwani Jambo and Dr Zaza Ndhlovu

Introduction

B.

0.0002

HIVHIV+ARTHIV+ART+

10000

Density (/mm2)

<0.0001

15000

100 10 1

+

10 3

10 3 +

C D

C D

8

+

4 D

D C

8

8

4 D

D C

C

C

4

D

8

D

4

D

+

0.01

0

C

hypothesised that spatial separation away from reservoir harbouring cells and poor cytolytic function of resident CD8+ T cells are key factors that contribute to persistent of HIV in the gut mucosa.

C.

0.1

5000

D

Furthermore, it is still not clear whether anatomic localization of gut resident CD8+ T cells6 is associated with the potential of HIV to establish viral reservoirs.

0.0005

C

Systemic CD8+ T cells are known to contribute to anti-HIV immunemediated control through production and release of perforin and granzyme B which are proteins that kill HIV infected cells4.

However, the capacity of gut resident CD8+ T cells to carry out similar effector functions is not fully understood5

0.0156

1000 20000

C

•

Duodenal CD8+ T cells mostly localise away from HIV-susceptible CD4+ T cells

A.

C

•

The gut mucosa is a major site of HIV replication and is a site at which the virus can persist in the presence of long-term suppressive antiretroviral therapy (ART)1-3

CD103 median fluorescence intensity

•

Differential CD4+ and CD8+ T cell tissue localization

Figure 3. Analysis of CD103 expression of duodenal CD4+ and CD8+ T cells: CDO103 expression of the surface of cells promotes localization of these cells in the intraepithelial (IE) region of the gut mucosa, which is the region exposed to the external gut environment. Cells that exhibit low or no CD103 expression are more likely to reside in the lamina propria (LP), which is a region below the IE region. (A) Comparison of CD103 expression (median fluorescence intensity) between duodenal CD4+ and CD8+ T cells in all participant groups using flow cytometry (B) Comparison of the density of duodenal CD4+ and CD8+ T cells expressing CD103 using quantitative image analysis (C) Immunohistochemistry images showing localization of CD103+/- duodenal CD4+ and CD8+ T cells within the IE and LP regions

Methods

Duodenal CD8+ T cell functional heterogeneity Duodenal CD8+ T cells rarely co-express perforin and granzyme B irrespective of tissue localization

A.

<0.0001

<0.0001

0.0475

<0.0001

B.

Proportion of duodenal CD8+ T cells

100

Study participants HIV(n=18)

ART(n=17)

ART+ (n=16)

60 40 20 0

Duodenal endoscopy

Blood draw

80

CD69+ CD103-/lo

Duodenal biopsy tissue

Peripheral blood mononuclear cells

Duodenal mononuclear cells

CD69+ CD103-/lo

Trm

CD69+ CD103-/lo

+

+

+

GrzB

Peripheral blood

Trm

-

Perf

-

+

Trm

CD69+ CD103-/lo

Trm

-

D.

C.

Figure 4. Flow cytometry and image analysis of duodenal CD8+ T cell cytolytic potential: (A) Proportion of CD69+CD103-/lo (LP residing) and Trm (IE region residing) CD8+ T cells expressing different combinations of perforin and granzyme B in all study groups (B) Immunohistochemistry image of duodenal CD8+ T cell localization and expression of CD103 and granzyme B (C) Quantitave image analysis of duodenal tissue microenvironments. Using computational image analysis, cells identified within the original immunohistochemistry image (left) are clustered into four different microenvironments identified as color coded regions. Each region consists of a unique composition of CD8+ T cells expressing different combinations of granzyme B i.e. CD103- granzyme B+, CD103+ granzyme B-, CD103+ granzyme B+ and CD103- granzyme B- (D) Heat map showing the composition of CD8+ T cells expressing different combinations of CD103 and granzyme B (y-axis) within four microenvironments defined as regions 1-4 Formalin-fixed paraffin embedded tissue blocks

Duodenal HIV-specific CD8+ T cell responses

A.

C.

<0.0001

40 30 20 10

d

0 Bl oo

Duodenal CD8+ T cells are primarily tissue resident T cells

B. 50

D uo de nu m

Duodenal T cell phenotype

A.

Proportion of Perf+GrzB+ CD8+ T cells within the IFN-γ+ CD8+ T cell population

HIV-specific duodenal CD8+ T cells exhibit poor expression of the cytolytic molecule expression required to kill HIV-infected cells

Flow cytometry

Figure 1. Schematic representation of study design: Paired peripheral blood samples and duodenal biopsy tissue were obtained from HIV-uninfected individuals (HIV-) and from individuals living with HIV who were either ART naïve (ART-) or ART experienced (ART+). Isolated peripheral blood and duodenal mononuclear cells from the respective samples were analyzed using flow cytometry. Formalin-fixed paraffin-embedded Immunohistochemistry duodenal tissue samples were processed and stained for immunofluorescence microscopy imaging and analysis

Figure 3. Phenotypic analysis of duodenal HIV-specific CD8+ T cells: Isolated duodenal and peripheral blood cells were stimulated ex vivo with HIV peptides. Using flow cytometry, CD8+ T cells that produced the pro-inflammatory cytokine IFN-γ in response to stimulation were defined as HIV-specific. (A) Comparison between duodenal and peripheral blood proportions of Perforin+ Granzyme B+ IFN-γ+ HIV-specific CD8+ T cells. (B) UMAP and FlowSOM unsupervised dimensional reduction phenotypic analysis of IFN-γ producing CD8+ T cells within the duodenum and blood. Each color coded cluster represents a unique population of HIV-specifc CD8+ T cells defined by a specific phenotype based on expression of CD103,CD69, eomes, perforin and granzyme B (C) Heat map showing the expression of phenotypic and functional markers (x-axis) by HIV-specific CD8+ T cell clusters (y-axis) detected in the blood and duodenum

Discussion and conclusion • Duodenal CD8+ T cells are predominantly Trm CD8+ T cells and they primarily reside in the IE region where they are spatially segregated from HIV-susceptible CD4+ T cells.

CD69-CD103hi CD69+CD103hi

CD4+CD69-CD103+ CD4+CD69+CD103+ CD4+CD69+CD103CD4+CD69-CD103-

CD69+CD103-/lo CD69-CD103-/lo

Figure 2. Phenotypic analysis of duodenal T cell tissue residency profile: Tissue resident T cells are non-circulating cells found in tissue. They are commonly identified by the coexpression of the surface proteins CD69 and CD103 (A) Pie charts representing the median proportions of CD4+ and CD8+ T cells expressing different combinations of CD69 and CD103. Trm CD8+ T cells were defined as CD69+CD103hi (green).

• Duodenal CD8+ T cells rarely co-express perforin and granzyme B irrespective of tissue localization indicating they have limited cytolytic potential.

Conclusion: Limited co-expression of perforin and granzyme B and spatial separation of duodenal Trm CD8+ T cells from HIV-susceptible lamina propria CD4+ T cells may contribute to HIV persistence in the gut.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Ambayo Peter Otte Nyumbe Effective Financing Models for Maternal and Newborn Health Programmes in Low- and Middle-Income Countries: Systematic Review Protocol Introduction/background Health financing is a critical pillar of the health system intertwined within the other five pillar with the core function to raise sufficient funding for the healthcare system and protect the people from catastrophic out-of-pocket expenditure and ensure that the funds are used efficiently to achieve better health outcomes. However, upto date, the most effective financing model for maternal and newborn health services in low and middle-income countries has not been identified. The Millenium Development Goals (MDGS) implementation did not achieve Maternal and Newborn Health (MNH) targets in Low and Middle income Countries (LMICS), possibly due to the lack of an evidence-based financing model for improving MNH services. As countries move on with implementing the Sustainable Development Goal(SDGS) agenda 2030 and the rollout of the UHC plan, a more effective financing Model for MNH Programme for LMICS is critical to increase access to MNH services and improve health outcomes.

Methods Asystematic review will be conducted. The database to be searched in this systematic review will be CINAHL, MEDLINE, GLOBAL HEALTH, Cochrane, PubMed, Web Science, LSTM Papers, e-Journal and eBook. Using EPPI Reviewer web, all the identified articles will be screened for Title, abstract and full text. Data extraction,synthesis and analysis will be conducted. During the screening, a second reviewers will be assigned 10% of the articles and the level of agreement will be measured using the Cohens’ Keppa matrics before procceding to the metaanalyisis.

Results The review intends to establish how different financing models contributes to changes in mortality, morbidity,proportion of the household using out of pocket expenditure and experiencing catastrophic health expenditure, access to available health facilities according to policy guidelines, utilization rates for Antenatal care Four (ANC4+), Skilled Birth Attendant(SBA) and Post Natal care(PNC).

Conclusion This systematic review seeks to find out the most effective financing models for MNH health programmes for LMICS and recommend their use for increasing access to MNH services and improving health outcomes and providing a platform for the achievement of Universal Health Coverage (UHC) and SDGs goal number three.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 54

Effective Financing Models for MNH Programmes in LMICS: Systematic Review Protocol Ambayo Peter Otte Nyumbe, PhD-Global Health-Off-Site Student, Reg:00445746 Date; 21-22 June 2022 INTRODUCTION OF THE STUDY BACKGROUND OF STUDY

• The MDGs implementation did not achieve the MNH targets in LMICS, • Possibly, this could be due to the lack of evidencebased financing model for improving MNH services in LMICS. • Therefore, as countries move on with implementing the SDGs agenda 2030 and rolling out of the UHC plan, • A more effective financing Model for MNH Programme for LMICS is critical.

• Therefore, this systematic review seeks to find out; • The most effective financing models for MNH programmes for LMICS • Recommend its use for increasing access to MNH services • Provide a platform for the achievement of UHC and SDGs.

• Health financing is a critical pillar of the health system.

• The core function of health financing is to; • Raise sufficient funding for the healthcare system • Protects the people from catastrophic out of pocket expenditure • Ensures that the funds are used efficiently for better health outcomes.

• Various financing models for the financing of healthcare systems have been proposed to increase access to health services and improved health outcomes.

• Unfortunately, they have been proved working in developed countries..

• These financing models are currently adapted and used in most LMICS. • The most effective financing model for MNH services in LMICS has not been identified.

OBJECTIVES OF STUDY AND RESEARCH QUESTION Review Question: • What is the most effective financing models for MNH Programme in LMICS? Objective: • To conduct a systematic review on the most effective financing models for MNH programmes in LMICS The specific Objectives • To establish the most effective financing Mechanism for MNH in LMICS. • To analyse the funding intervention for MNH services in LMICS. • To establish the outcome of financing mechanism and funding intervention on MNH services in LMICS. • To formulate an evidence-based recommendation for the most effective financing model for MNH Programme in LMICS.

METHODOLOGY OF THE STUDY Search Strategy: • List of bibliographic Database to be searched will be CINAHL, MEDLINE, GLOBAL HEALTH, Cochrane, PubMed, Web Science, LSTM Papers, e-Journal and eBook • List of hand searching journals or websites that will be searched for relevant articles( Journals, Websites)

• Experts Or stakeholders to be contacted for additional grey literature or research: • References Searches (Forward or backward citation also known as a chain or snowball searching):

Systematic Review search strategy Concept 1

Concept2

Concept3

Key Concepts

‘’Effective health financing models.’’

‘’Maternal and newborn health programme.’’

‘’low- and middle-income countries.’’

Key Search Terms

“health insurance” OR “micro insurance” OR “universal coverage” OR “insurance coverage” OR “insurance status” OR “health* finance*” OR “social insurance” OR “private insurance” OR “out of pocket” OR “result* based finance*” OR “performance based finance*” OR “pay for performance finance*” OR “demand based finance*” OR “contracting out” OR “national health program*” OR “health expenditure*” OR “direct expenditure*” OR “indirect expenditure*” OR’’ Standard financing Model’’OR ‘’Bamako Initiative Model’’ OR’’Decentralised Govt Funding Model’’ OR’’Coordinated basket funding Model’’ OR’’Results based Financing Model’’

“maternal health” OR “newborn health” OR “neonatal health” OR “infant health” OR “maternal and newborn health” OR “reproductive health” OR “antenatal care” OR “postnatal care” OR “postpartum care” OR “skilled birth care” OR “baby health”

“low and middle income” OR “low to middle income” OR LMIC OR “low income” OR “middle income” OR “fragile state” OR “failed states” OR “underdeveloped countr*” OR “poor countr*” OR “least developed countr*” OR “developing countr*” OR Africa OR “Latin America” OR Asia

Subject Heading

Healthcare Financing OR Financing, Government OR Community-Based Health Insurance OR Universal Health Insurance OR Insurance Coverage OR Insurance, Health OR National Health Programs OR Health Expenditures OR Standard financing Model OR Bamako Initiative Model OR Decentralised Govt Funding Model OR Coordinated basket funding Model OR Results based Financing Model

Maternal Health Services OR Maternal Health OR Maternal-Child Health Services OR Infant Health OR Reproductive Health OR Reproductive Health Services OR Prenatal Care OR Postnatal Care OR Perinatal Care

Developing Countries OR Africa OR Latin America OR Asia OR Africa, South of the Sahara

Operationalization of PICOS PICOS

INCLUDE

EXCLUDE

Study Population

• Studies conducted in low- and middle-income countries

• Studies conducted in developed countries

• Interventions that measure financing objectives such as the quality of care, efficiency, equity in the utilization of maternal and newborn health and system goals such as social protection to families from catastrophic pocket expenditure, health gain, responsiveness, equity in health and health again • Studies focused on the Standard financing Model, Bamako Initiative financing Model, Decentralised Govt Funding Model, Coordinated basket funding Model, and Results-based Financing Model

• Studies that are not focused on financing models

• Studies where comparison models are the controls areas for each financing model study

• Studies where comparison models are not the controls areas for each financing model study

Studies that measure changes in MNH status in terms of; • mortality and morbidity • financial risk protection (in terms of proportion of the household using out of pocket expenditure and experiencing catastrophic health expenditure), • Access (in terms of available health facilities according to policy guidelines, number of ANC4+, Skilled birth attendants and postnatal care attendance) • Services utilization (in terms of the number of hospitalization and medical visit) • Equity (inequalities in health care access and treatment across the population) • Responsiveness (in terms of patients’ satisfaction and expectations from the health system) • Equality (in terms of hospital-acquired infections, medical errors and preventable adverse events), • Efficiency

• Studies that measure other outcomes

• Published after January 2010 • Original studies on financing maternal and newborn services • Experimental study designs (randomized control trials), quasi-experimental (interrupted time series), observational studies (cross-sectional, case-control, cohort studies)

• Published before January 2010 • Studies that focus on the entire package of the health system • Others

Intervention

Comparison

Outcome

Study

ELIGIBILITY CRITERIA •

•

•

•

•

An eligibility criterion developed before the literature search will screen all the references upon collecting enough literature.

All the titles and abstracts of retrieved articles will be uploaded in EPPI Reviewer 4 software and screened for the title, the abstract and the full text A second reviewer will be assigned 10% of the articles to review and compare for quality assurance purposes to reduce bias during data screen and extraction.

The level of the agreement will be measured using the Cohens’ Kappa matrices before proceeding to the meta-analysis.

A Prisma flow chart for databases and other registers will be used to describe how the articles screened, reviewed and finally systematically

QUALITY ASSURANCE ASSESSMENT •

•

During the review, quality assessment is embedded into the process. This is an integral part of the EPPI Reviewer web software.

The risk of bias throughout the study will be assessed by assigning 10% of the articles to be reviewed by a second reviewer using the collaboration theme of the EPPI reviewer web software.

The involvement of additional reviewers will resolve any potential disagreement.

DATA EXTRACTION

DATA SYNTHESIS

•

• •

•

•

After selecting the relevant literature, data extraction will be done with EPPI reviewer web online software.

Three people will be engaged in the data extraction process.

One person will conduct the entire data extraction, and a second person will be assigned 10% of the articles for extraction using the collaboration theme of the EPPI reviewer web software. The involvement of additional reviewers will resolve any potential disagreement.

The following are the primary data field to be extracted. o Basic Information about the article such as the author, year of publication of the article and the country o Administrative data such as the source of funding, conflict of interest and ethical approval. o If available, the study’s objectives, the research questions, and the theoretical framework. o The health system characteristics, the study participants and data sources o Financing models for the programmes. o Study design and analytical strategy. o Study comparator, outcome measures and reported effect size. o Overall findings, Key assumptions and limitations o Information relating to the risk of bias domains and study quality.

• • •

• • • •

Using the EPPI reviewer web, a meta-analysis will be conducted Meta-analysis will be carried out if the included studies are sufficiently homogeneous.

The risk or Odd ratio will be used to measure and determine the intervention effect on the dichotomous outcome. Mean differences will be used for continuous outcomes considering a 95% confidence interval.

If feasible and appropriate outcome data will be used to perform an effect meta-analysis in case heterogeneity is expected to be a priority.

When a substantial diversity of the population, research design, comparators and outcome measures is observed among selected studies, precluding quantitative synthesis, a systematic narrative synthesis will be employed to summarize and explain the characteristics and findings of the studies chosen.

Rationale and description will be provided for grouping studies for synthesis, aiming to minimize their methodological or conceptual diversity.

Established matrices will be used to measure the direction and magnitude of the intervention effect.

Summary tables, figures and structured narratives will be used to descriptively summarize and compare each included study and examine heterogeneity studies in a clear format.

The focus will be on the systematic review objective, which evaluates and synthesises evidence on the most effective financing model for low- and middle-income counties.

EXPECTED RESULTS AND CONCLUSION OF THE STUDY Results The review intends to establish how different financing models contributes to changes in mortality, morbidity,proportion of the household using out of pocket expenditure and experiencing catastrophic health expenditure, access to available health facilities according to policy guidelines, utilization rates for Antenatal care Four (ANC4+), Skilled Birth Attendant(SBA) and Post Natal care(PNC).

Conclusion This systematic review seeks to find out the most effective financing models for MNH health programmes for LMICS and recommend their use for increasing access to MNH services and improving health outcomes and providing a platform for the achievement of Universal Health Coverage (UHC) and SDGs goal number three.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Ambrose Oruni Unravelling mechanisms driving the escalation of insecticide resistance in An. funestus from Uganda and its impact on malaria control tools and parasite transmission Abstract The impact of insecticide resistance on malaria control is still a matter of intense debate. Whilst the magnitude of super-resistance (where a significant proportion of mosquitoes (<80% mortality) survive up to 10 times the diagnostic dose of insecticides) remains unknown, reports of loss of piperonyl butoxide (PBO) efficacy in laboratory and field studies as well as very high intensity of pyrethroid resistance1 is a worrying indicator.

References 1. Tchouakui, M. et al.

Pyrethroid Resistance Aggravation in Ugandan Malaria Vectors Is Reducing Bednet Efficacy. Pathogens 10, 415 (2021).

2. Weedall, G. D. et al.

A cytochrome P450 allele confers pyrethroid resistance on a major African malaria vector, reducing insecticide-treated bednet efficacy. Sci. Transl.

Med. 11, (2019).

3. Mugenzi, L. M. J. et al.

Cis-regulatory CYP6P9b P450 variants associated with loss of insecticidetreated bed net efficacy against Anopheles funestus.

Nat. Commun. 1–11 (2019).

The recent development of diagnostic tests for detection of the first P450mediated genetic markers in An. funestus.; CYP6P9a and CYP6P9b2,3 with others still in the pipeline including markers for reduced penetration, offers a unique opportunity to use entomological parameters to assess the impact of resistance on malaria control and its transmission in a major malaria vector and in a high transmission zone such us eastern Uganda. Recent studies have already successfully demonstrated the crucial role of these markers to assess the impact of resistance using experimental hut trials in west Africa2–4. However, the majority of the currently available markers were previously not present or at very low frequency in Uganda1 hence the need to keep monitoring their allele frequency which may help us understand the dynamics of gene flow and selection pressure.

In this study, we will address the urgent need to identify the mechanisms driving escalation of insecticide resistance especially to pyrethroids and find novel, reliable and informative markers for pyrethroid resistance in An. funestus from Uganda. The novel markers, together with the available markers, will then be used to assess impact of super resistance on malaria control tools (such as novel and current bednets in an experimental hut trial) and parasite transmission (by looking at the association with entomological indices of transmission).

4. Menze, B. D. et al.

An Experimental Hut Evaluation of PBO-Based and Pyrethroid-Only Nets against the Malaria Vector Anopheles funestus Reveals a Loss of Bed Nets E ffi cacy Associated with GSTe2 Metabolic Resistance.

(2020).

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 56

Escalation of insecticide resistance in An. funestus from Uganda (East Africa) amidst no current reliable markers to track the spread Oruni Ambrose1,2,3, Magellan Tchouakui1, Jonathan Kayondo2, Jack Hearn3, Charles S. Wondji1,3

Background Insecticide-based vector control tools need monitoring and evaluation for efficacy due to the constant threat of spread and escalation of insecticide resistance (IR) and this can be done by using reliable markers in tandem with field bioassays. As prelude to investigating the temporal evolution of IR and mechanisms driving its escalation in An. funestus from Uganda, we report the resistance pattern and frequency of current IR markers in 2021.

Overall Project Conceptual Frame work Objective 1a

Resistance markers Over expression of genes

RNA transcriptome

Whole genome sequence

Alive samples

Alive/Dead samples

Novel resistance markers

Mosquito

Objective 1a

Methods Blood-fed mosquitoes were collected from Mayuge district (Eastern Uganda) in October 2021 using prokopack electric aspirator, forced to oviposit and eggs reared to F1. Batches of 3-5-day-old F1 mosquitoes were exposed to all groups of insecticides and mortality recorded. Field mosquitoes were genotyped for the current IR markers to establish the underlying IR mechanisms.

Objective 1b

Objective 1b

Mosquito genetics

Objective 2

PBO-based nets Pyrethroid-only nets Novel LLINs

probing behavior

resistance

Alive/Dead by PBO-nets High/low infection rates

LLINs efficacy

mortality Mosquito

Super-resistance/

Mosquito population

Mosquito blood Objective 3

feeding behavior

Parasite infection

Sporozoite

Entomological Transmission indices

infection rates Longevity

Mortality (%)

Results

Intense resistance to pyrethroids particularly alpha-cypermethrin (ingredient in new nets) and deltamethrin, less evidence of escalation of resistance to permethrin at 10x.

Mortality (%)

Mortality (%)

\•

Major implication of P450s in pyrethroid resistance and not GSTs based on synergistic assays

•

No resistance or its escalation in organophosphates and PBO-based nets Emerging resistance to bendiocarb

•

Allele frequency

Mortality (%)

•

•

Susceptibility to neonicotinoids and pyrroles (newly rolled-out insecticides)

Conclusion: We have a super resistant population of An. funestus in Uganda and currently it is not clearly known what driving this resistance and its impact.

N/A

N/A

RR (homozygous resistant), RS (heterozygote), SS (homozygous susceptible), N/A (Not detected)

•

The observed allele frequency of the available current and new markers cannot explain the escalation in resistance and not informative in tracking its spread.

Next steps: • Perform RNAseq and pooled DNAseq on alpha-Cypermethrin and Permethrin samples at 1x, 5x and 10x.

• Continue with monitoring the temporal evolution of resistance until 2023.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Lilian Otiso DELAYED FIRST ANC VISITS: WHY PREGNANT ADOLESCENTS DELAY SEEKING MEDICAL CARE IN INFORMAL SETTLEMENTS IN NAIROBI Introduction Kenya has a high rate of teenage pregnancies with 25% of women aged 25-49 having given birth by age 18. The uptake of antenatal care (ANC) before 4 months of pregnancy is low and very few women attain the minimum of four visits. Teenage pregnancies are considered high-risk and are required to start ANC visits early.

We sought to explore the experiences of pregnant adolescents (15-19 years) in seeking and accessing health services.

Authors Lilian Otiso1,2, Inviolata Njoroge2, Rosie Steege3, Miriam Taegtmeyer1 Author’s affiliation 1

LSTM, Liverpool, UK

2

LVCT Health, Nairobi, Kenya

3

London School of Tropical Medicine and Hygiene

Methods The qualitative study was conducted in two informal urban settlements in Nairobi. We carried out FGDs and IDIs with women who had a history of teenage pregnancy, male partners and parents of pregnant adolescents, and community members. We explored the health-seeking behaviour of adolescents and factors that affected their uptake of health services. We analysed the data thematically.

Results Many participants reported that pregnant adolescents delayed seeking ANC services for individual and system reasons. At the individual level, the adolescents were ashamed of the pregnancy and preferred to hide from their parents and community. Lack of money to pay for the hospital fees delayed attendance. System reasons included negative health workers’ attitudes, lack of equipment and drugs in facilities and lack of youth-friendly services. Clinics that provided youth-friendly services and social health insurance increased the likelihood of visiting the facility early.

Conclusion Given the high risk that teenage pregnancies face, improving early ANC attendance is a priority. Understanding the barriers and facilitators of facility attendance can inform appropriate responses at the community, facility and system level.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 58

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Manuela Parnoffi Exploring associations between ethnicity, in-hospital complications and COVID-19 outcomes in the United Kingdom, Brazil and South Africa Introduction/background Previous studies have explored the association between COVID-19 and outcomes within ethnic minority groups, particularly with respect to admission to intensive care unit (ICU), need for invasive mechanical ventilation (IMV) and in-hospital mortality. Further analyses comparing diverse settings, however, have not yet been conducted. Moreover, the International Severe Acute Respiratory and emerging Infections Consortium (ISARIC) endorsed the harmonised collection of data worldwide. The ISARIC WHO Clinical Characterisation Protocol UK (CCPUK) developed and validated two pragmatic risk prognostic tools during the first two pandemic waves of hospitalisation in the UK, the 4C Deterioration model and the 4C Mortality Score.

Understanding the relevance of these tools and the role of ethnicity in ISARIC-associated cohorts outside of the UK is necessary.

Research aims This project aims to: 1. C ompare the similarities/differences of COVID-19 manifestations in patients hospitalised in Brazil and South Africa versus the UK. 2. E valuate whether risk factors associated with mortality and deterioration are consistent across countries and ethnicity through the validation of the 4C prognostic models adopting ISARIC databases.

Methods Retrospective evaluation using prospectively collected cohort data comprising confirmed/ suspected COVID-19 participants.

Objective 1 – descriptive statistics, logistic regression and survival models to determine association between demographics, comorbidities and complications (including ICU admission and need for IMV) with in-hospital mortality.

Objective 2 – discrimination and calibration of the 4C prognostic models.

Expected outcomes This study will improve our understanding of how COVID-19 manifestations vary with respect to diverse settings and different ethnicity. Also, a further validation of the prognostic models will contribute to improved triage and patient management.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 60

Exploring associations between ethnicity, in-hospital complications and COVID-19 outcomes in Supervisors: the United Kingdom, Brazil and South Africa Dr S. T. Jacob Manuela Parnoffi Prof C. A. Donnelly Prof M. G. Semple

503767@lstmed.ac.uk

Background • COVID-19 has led to over 455 million confirmed cases and caused over 6 million recorded deaths1.

• The International Severe Acute Respiratory and Emerging Infections Consortium (ISARIC) supported the standardised collection of data globally (Figure 1-2).

• Several studies2,3,4 have investigated the association between COVID-19 and outcomes within ethnic minority groups. Additional analyses comparing diverse settings are needed.

• The ISARIC WHO Clinical Characterisation Protocol UK (CCP-UK) developed two pragmatic risk stratification tools in the UK, the 4C Deterioration model and the 4C Mortality Score5,6.

• Validation in ISARIC-associated cohorts outside of the UK and evaluation of the role of ethnicity can enhance triage and management of COVID-19 patients across diverse settings.

Research Aims Comparing the similarities/differences of Objective COVID-19 manifestations 1 in patients in Brazil and South Africa versus the UK using ISARIC data

Objective 2

Evaluating whether risk factors associated with ethnicity, mortality and deterioration are consistent across countries and through the validation of the 4C prognostic models in other settings

Fig 1-2 Distribution of patients by region and country. From ISARIC Clinical Characterisation Group (2022)

Fig 1-2 Distribution of patients by region and country. From ISARIC Clinical Characterisation Group (2022)

Methods Retrospective evaluation using prospectively collected cohort data comprising confirmed/suspected COVID-19 participants.

Descriptive Statistics

Objective 1

Logistic Regression

Discrimination of the 4C Models

Objective 2

Calibration of the 4C Models

Survival Models

Expected Outcomes • Improved understanding of how COVID-19 manifestations vary with respect to diverse settings and different ethnicity.

• Further validation of the ISARIC prognostic models to augment triage and patient management across diverse settings.

References 1.

2.

3.

4.

5.

6.

WHO. Weekly epidemiological update on COVID-19 - 15 March 2022 Magesh S, Daniel ; Wei J;, Li T, Li Y, Mattingly-App; A, et al. Disparities in COVID-19 Outcomes by Race, Ethnicity, and Socioeconomic Status: A Systematic-Review and Meta-analysis. JAMA Netw Open 4(11):e2134147–e2134147.

Harrison EM, Docherty AB, Barr B, Buchan I, Carson G, Drake TM et al., Ethnicity and outcomes from COVID-19: the ISARIC CCP-UK prospective observational cohort study of hospitalised patients (5/31/2020). Available at SSRN: https://ssrn.com/abstract=3618215 Yates T, Zaccardi F, Islam N et al. Obesity, chronic disease, age, and in-hospital mortality in patients with covid-19: analysis of ISARIC clinical characterisation protocol UK cohort. BMC Infect Dis 21, 717 (2021).

Knight SR, Ho A, Pius R, Buchan I, Carson G, Drake TM et al. Risk stratification of patients admitted to hospital with covid-19 using the ISARIC WHO Clinical Characterisation Protocol: development and validation of the 4C Mortality Score. BMJ 2020;371:m4334 Gupta RK, Harrison EM, Ho A, Docherty AB, Knight SR, van Smeden M et al. Development and validation of the ISARIC 4C Deterioration model for adults hospitalised with COVID-19: a prospective cohort study. Lancet Respir Med. 2021 Apr 1;9(4):349–59.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Joseph Phiri Defining changes in nasal immunity that favours propensity for pneumococcal carriage in people living with HIV

Introduction Streptococcus pneumonia (Pneumococcus) carriage is a prerequisite for transmission and disease. PLHIV on ART have higher pneumococcal carriage prevalence than PLHIV not on ART or HIV-uninfected adults. Consequently, PLHIV on ART might inadvertently serve as a key reservoir for pneumococcal transmission in the community. This study aimed at investigating changes in nasal immunity and their association with pneumococcal carriage.

Methods Nasal cells and nasal lining fluid were collected from PLHIV on ART for > 1 year and HIV-uninfected counterparts. Flow cytometry based immunophenotyping was used to characterise the composition and phenotype of immune cells in the nasal mucosa, while ELISA was used to measure the concentration of myeloperoxidase (MPO)and Neutrophil extracellular traps (NETs) in nasal lining fluid.

Results PLHIV on ART > 1 year had an abundance of neutrophils in their nasal mucosa compared to HIV-uninfected adults (p=0.018), while the abundance of T cells (p=0.71) and monocytes (p=0.45) were similar. In addition, the expression of CD62L was lower in PLHIV on ART > 1 year compared with HIV-uninfected adults (p=0.017). Finally, the concentration of NETs (p=0.042) and MPO (p=0.066) were significantly higher in PLHIV on ART >1 year compared to HIV uninfected counterparts. Next, we assessed the association between pneumococcal carriage and nasal inflammation. The abundance of neutrophils was higher in those with pneumococcal carriage than without (p=0.04), while CD62L expression and concentration of NETs from adults with pneumococcal carriage were similar to those without (p=0.11).

However, the concentration of MPO (p=0.025) was higher in adults with pneumococcal carriage compared to those without. Collectively these results indicate that pneumococcal carriage is associated with neutrophil driven inflammation in the nasal mucosa.

Conclusion These results demonstrate that pneumococcal colonisation in PLHIV on ART is associated with neutrophil driven inflammation. This partly explains the high propensity for pneumococcal carriage in PLHIV on ART since inflammation is an important risk factor for pneumococcal colonisation.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 62

Defining changes in nasal immunity that favours propensity for pneumococcal carriage Joseph Phiri 1,2, Gloria Luhanga 1 , Thokozani Kayembe1,, Janet Zambezi1, Alice Kusakala 1, Mercy Khwiya1, Ndaona Mitole 1, Lusako Sibale 1,2, Gift Sagawa 1, Khumbo Mbale 1, Daniela Fereirra 2, Benjamin Kumwenda 3, Kondwani Jambo1,2 1. Malawi Liverpool Wellcome Programme, Blantyre, Malawi; 2. Liverpool School of Tropical Medicine, Liverpool, United Kingdom , 3. Kamuzu University of Health Sciences

Pneumococcal carriage in PLHIV in the era of Pneumococcal conjugate vaccine

Results 1

People Living with HIV have high pneumococcal carriage prevalence compared to HIV-uninfected or PLHIV not on ART. PLHIV on ART could represent an important reservoir for pneumococcal transmission in the community.

This undermines the public health herd immunity benefits of childhood pneumococcal immunisation strategies.

Research Question Why are PLHIV on long-term ART susceptible to pneumococcal carriage?

Representative gating strategy for the identification of immune cells in the nasal mucosa

Results II

Aim To investigate changes in nasal innate immunity and their association with pneumococcal carriage

Methodology Sampling schedule Month 4

Month 1

Key

Heightened nasal inflammation in PLHIV on ART > 1 year

Results III

Flow cytometry

ELISA

Neutrophil driven inflammation is associated with pneumococcal carriage in PLHIV on ART > 1 year

Conclusion and way forward

• Pneumococcal colonisation in PLHIV on ART is associated with neutrophil driven inflammation • Measure other markers of nasal inflammation including cytokines and chemokines • Measure nasal transcriptomic signature and associate with pneumococcal carriage dynamics in PLHIV

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Mphatso Phiri The potential epidemiological impact of increasing uptake of tuberculosis active case finding interventions among men and youth Introduction Tuberculosis (TB) causes >1 million deaths/year globally, but burden is gendered: 57% vs 32% of 10 million cases in 2018 were in men (>15 years) vs women. An estimated 3 million cases are not diagnosed or reported. Active case finding (ACF) can detect undiagnosed cases early, reduce transmission and accelerate progress towards EndTB strategy targets.

Objectives To evaluate the potential population-level epidemiological impact of increasing uptake of ACF among men, on TB burden among men, women and children.

Author Mphatso Dennis Phiri1,2 Supervisors Dr Peter MacPherson1,2,3, Dr Katherine Horton3, Dr Marc Henrion1,2 Author’s affiliation 1

alawi-LiverpoolM Wellcome Trust Clinical Research Programme, Blantyre, Malawi

2

Liverpool School of Tropical Medicine, Liverpool, UK

3

London School of Hygiene and Tropical Medicine, London, UK

Methods Study 1: A community-based, household survey to measure TB infection prevalence among adolescents (10-17 years) and adults (18-40 years) in urban Blantyre, Malawi. Sample size: 1,149 adolescents and 1,851 adults.

Primary outcome: prevalence of immunoreactivity, measured using QIAreach QFT-TB IGRA test. Statistical analysis: age-/sex-specific proportions of TB immunoreactivity, and associated risk factors.

Study 2: Transmission modelling of population-level epidemiological impact of computer-aided detection on chest X-ray for TB when used as an initial screening test in community-based ACF, using 2016 Kenya national TB prevalence survey data.

Study 3: Transmission modelling of population-level epidemiological impact of increasing uptake of ACF among men on TB burden among men, women, and children in Malawi.

Discussion TB infection risk, case notifications, prevalence and mortality are higher in men compared to women. Understanding age- and sex-differences in infection risk can inform targeting of interventions (drugs, vaccines, etc) to prevent infection or progression to disease. Mathematical modelling can inform optimal strategies for increasing ACF uptake among men and estimate potential epidemiological impact on TB burden among men, women and children.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 64

Modelling the potential epidemiological impact of increased uptake of tuberculosis active case finding interventions among men and youth in Malawi and Kenya Student: Mphatso Dennis Phiri1 Supervisors: Dr Peter MacPherson1,2, Dr Katherine Horton3, Dr Marc Henrion1,2

1Malawi-Liverpool-Wellcome

Introduction • Tuberculosis (TB) is the second leading single infectious killer globally, only to SAR-CoV-2: 1.4 million deaths globally in 2018 • However, >3 of 10 million estimated new cases in 2018 were not detected or reported • TB burden is gendered: men (>15 years old) have higher case notifications rates, prevalence of microbiologicallyconfirmed disease, and mortality compared to women and children • Men delay seeking care  sustained transmission in communities • Early case detection is an important pillar of the End TB targets to reduce incidence (80%) and mortality (90%) by 2030 vs 2015 levels • Novel strategies are urgently needed to detect and treat undiagnosed TB cases, especially among men, to reduce burden and transmission among men, women and children

Objective • To evaluate the potential epidemiological impact of increasing uptake of TB active case finding (ACF) among men, on TB incidence, prevalence and mortality among men, women and children using transmission dynamic modelling

Rationale • Community-based active case finding (ACF) detects TB early, therefore reducing time spent with untreated infectious TB • However, community-based ACF needs to target the right population (e.g. men), use accurate screening algorithms (e.g CAD-CXR), be delivered with sufficient coverage and intensity, for sufficiently long periods, to impact population-level TB epidemiology • Field studies of ACF are methodologically and logistically limited to demonstrate long-term population impact of community-based ACF • Transmission dynamic modelling mitigates against these challenges, and allows estimating of future direct and indirect impacts of optimal ACF strategies

Expected results and potential implications • Findings will highlight optimal strategies of increasing uptake of ACF among men and youth and estimated populationlevel epidemiological impact on TB incidence, prevalence and mortality among men, women and children.

• Findings from TB infection prevalence will inform age- and/or sex-targeted interventions to prevent infection or progression to disease among adolescents and young adults.

Trust Clinical Research Programme, Malawi; 2Liverpool School of Tropical Medicine, UK; 3London School of Hygiene and Tropical Medicine

Targeting men with community-based screening is needed to reduce burden and transmission among men, women and children, and to end the TB epidemic • Tuberculosis (TB) kills >1 million people each year • Only COVID-19 has killed more people per year than TB • Men have a higher burden of TB compared to women and children

Study 1: TB infection prevalence survey Study design: community-based, household survey` Study sites: 3 urban townships, Blantyre, Malawi Primary outcome: prevalence of TB immunoreactivity, measured QIAreach QFT-TB Sample size: 1149 adolescents (10-17 years), 1851 adults (18-40 years) Progress: protocol under ethics, targeting recruitment starting September 2022

Study participant recruitment and flow in TB infection prevalence survey (Study 1)

• Men account for >two-thirds of diagnosed/reported TB cases and deaths each year • Men account for >70% of undiagnosed infectious TB within communities, and delay TB care seeking • Men with undiagnosed, untreated TB continue to transmit TB to other men, women and children • Enhanced case finding to detect undiagnosed TB, especially among high-burden groups, is a key component of the End TB strategy • Therefore, ending the TB epidemic will not be possible without finding and treating undiagnosed men, to reduce TB burden among men and transmission among men, women and children • Community-based active case finding (ACF) can detect undiagnosed cases in communities, therefore reducing burden and transmission • However, evidence for the impact of communitybased ACF has been mixed • In this PhD, I’m using mathematical modelling to demonstrate that finding and treating men with undiagnosed TB in communities will reduce present and future TB burden among men, women and children • I am conducting 3 related sub-studies: a TB infection prevalence survey among adolescents and adults, and 2 modelling studies (see right) to show that finding

Study 2: Modelling the potential epidemiological impact of using computer-aided detection (CAD) on chest X-ray (CXR) for TB community-based ACF Study design: transmission dynamic modelling Modelling approach: age- and sex- stratified compartmental transmission dynamic model of TB transmission, fitted to Kenya Demographic and TB epidemiological data Intervention: CAD-CXR as an initial screening test in the 2016 Kenya national TB prevalence survey, compared to human CXR readers and/or symptom-based screening Primary outcome: TB incidence, prevalence and mortality reductions among men, women and children comparing CAD-CXR versus human reader scenarios Progress: conceptualising model structure, training in model coding in R

Study 3: Modelling the potential epidemiological impact of increasing uptake of ACF among men and youth on TB burden among men, women and children Study design: transmission dynamic modelling Modelling approach: age- and sex- stratified compartmental transmission dynamic model of TB transmission, fitted to Malawi demographic and TB epidemiological data Intervention: strategies that increase uptake of ACF among men and youth in Malawi, compared to historical trends

Mathematical modelling approach for studies 2 and 3: : model structure • Compartmental, transmission dynamic model • Age- and sex stratified • Fitted to country-specific demographic and TB epidemiological data • Intervention: community-based active finding strategies targeted at men • Adapted from Houben et al (2016) and Horton et. al (unpublished) Adapted from Houben et al (2016) and Horton et. al (unpublished)

Primary outcome: TB incidence, prevalence and mortality reductions among men, women and children comparing CADCXR versus human reader scenarios

Acknowledgements • Supervisors: Dr Peter MacPherson, Dr Katherine Horton, Dr M Henrion • LIGHT Consortium, UK Aid

References

WHO. Global TB report 2019 Horton et al. PLoS Medicine. 2016 WHO. End TB strategy. 2015 Burke et al. Lancet Public Health.

2021 Azman et al. BMC Medicine. 2014 Houben et al. BM Medicine. 2016

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Emma Reid Behavioural analysis of Anopheles gambiae with four types of LLIN across 3 time periods

Abstract To combat insecticide resistance, LLINs have been developed with the addition of PBO; a synergist that inhibits enzyme activity, temporarily reversing resistance, however mosquito behaviours to the net are not well understood. This study aims to highlight behavioural differences of Anopheles gambiae between different LLINs of different ages to evaluate avoidance behaviour and resistance. Resistant An. gambiae mosquitoes from Busia Uganda were analysed with modified cone assays where video footage was produced, and a human bait used. Using the footage movement patterns throughout the cone were detected to investigate resistance and avoidance behaviours. Nets tested were Permanet 2.0, Permanet 3.0, Olyset and Olyset Plus, aged; 0 months, 12 months, and 24 months all collected from a field trial in Uganda. It was hypothesised that mosquitoes exposed to permethrin would display greater repellency than deltamethrin due to results from previously published studies, however no difference was detected between insecticides when comparing time spent close to or furthest away from the net.

Deltamethrin was more effective against the vectors than permethrin, the addition of PBO also increased the knockdown and mortality. A positive correlation was found between overall activity in the cone and knockdown for all 4 net types and ages. In conclusion the addition of PBO is effective in restoring the efficacy of nets, moreover the toxic effect of insecticide will result in more movement of the vector.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 66

Behavioural analysis of Anopheles gambiae in response to contrasting types of insecticide-treated nets of different ages Emma Reid

Introduction

Methods

In 2020 Uganda accounted for 5.4% of all malaria cases worldwide and 3.5% of worldwide malaria deaths [1]. With pyrethroid resistance on the rise, PBO (piperonyl butoxide) is added to nets to improve effectiveness [2].

Whilst molecular resistance is a problem, behavioral avoidance may also limit the efficacy of LLINs as vectors will escape toxic surfaces [3]. There is currently a lack of data regarding behavioural resistance however with more behavioural methods being developed this will greatly improve this gap in the research.

3–5-day old unfed and starved Anopheles gambiae mosquitoes originating from Busia, reared in LSTM insectaries were used.

Top samples of the nets were attached to the cone testing board with the host arm placed underneath.

Video was recorded using an iPhone 7.

Shown in figure 1.

ViCTA software used to analyze movement.

Exposed for 3 minutes.

1 hour knockdown and 24-hour mortality detected.

For this study top sections from four different net types were used, PermaNet 3.0 (Deltamethrin plus PBO), PermaNet 2.0 (Deltamethrin), Olyset Plus (Permethrin plus PBO) and Olyset (Permethrin). All of which taken at 3 time points from a trial in Uganda, Baseline 12 months and 24 months. The data will add to work completed by Mechan et al [4].

The aims of this study are to highlight behavioral differences of resistant An. gambiae from Uganda, to different pyrethroid nets from a trial in Uganda. A comparison will be made of the nets at 3 time points.

Figure 1. Video cone test equipment set up

Results Knockdown and Mortality

Activity within Regions of the Cone

Activity Across the Whole Cone 5000

4

4500 4000

3

3500

2

3000

Activty

Shown in Table 1, nets which contained PBO had a higher mortality than nets without, even in older nets, highlighting the effectiveness of PBO on bed nets.

2500

1

2000

Table 1: Knockdown and 24-hour mortality results for the four net types.

1500

1 hr 24 hr Net Type Time Point Knockdown Mortality Baseline 100 100 PermaNet 12 Month 65.43 35.72 3.0 25 Month 87 43 Baseline 6.5 2 PermaNet 12 Month 18.57 2.57 2.0 25 Month 21.6 1.6 Baseline 76.5 44 Olyset 12 Month 22 6 Plus 25 Month 11.6 3.6 Baseline 10.67 7.33 12 Month 7.2 1.6 Olyset 25 Month 11 3

1000

Figure 4: Image of cone showing 4 regions

500 0

Baseline

12 25 Baseline 12 25 Baseline 12 25 Baseline 12 25 months months months months months months months months

Permanet 3.0

Permanet 2.0

Olyset Plus

Olyset

Untreated

Sample

Figure 2: Bar chart showing average activity for all net types for the 3 different ages.

Results for activity across the whole cone shown in figure 2, show high activity for baseline PBO nets.

Figure 3 shows images of activity in the different nets.

Here it is shown how the PBO net mosquitoes moved a lot more throughout the cone.

Deltamethrin nets were more effective than Permethrin nets.

Correlation found between knockdown and mortality for all nets.

The cone was split into regions as shown in figure 4 to show any repellency behaviour.

Figure 3: Images of activity across the whole cone for 4 net types, produced using ViCTA software.

Discussion

As displayed in figure 5, majority of net samples had higher activity in region 1, showing no evidence of repellency.

100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0%

Baseline

12 25 Baseline 12 25 Baseline 12 25 Baseline 12 25 months months months months months months months months

Permanet 3.0

Permanet 2.0 Region 1

Olyset Plus Region 2

Region 3

Olyset

Untreated

Region 4

Figure 5: Percentage of activity per region for all 4 net types and ages.

GLM results found an effect of age of net and average location of activity for PermaNet 3.0 (F2=5.39 P<0.01) and Permanet 2.0 (F2=12.84 P<0.01).

Discussion (cont.)

Results found Deltamethrin PBO nets to be the most effective, especially at baseline which is expected.

Further studies should include more than one host to correct for attractiveness.

Activity was higher than untreated nets for all net types and ages.

Angle of the camera was a limitation; an improvement would be to use a separate stand.

Lack of repellency could be explained by the presence of kdr mutations as they have been shown to reduce repellency [5].

Moreover, the addition of an arm as bait is hypothesized to cause the willingness to feed to overcome the repellency of the net.

References

[1] Organisation, T. W. H. (2021). World Malaria Report 2021 [Press release] [2] Ngufor, C., Fagbohoun, J., Agbevo, A., Ismail, H., Challenger, J. D., Churcher, T. S., & Rowland, M. (2022). Comparative efficacy of two pyrethroid-piperonyl butoxide nets (Olyset Plus and PermaNet 3.0) against pyrethroid resistant malaria vectors: a non-inferiority assessment. Malar J, 21(1), 20. doi:10.1186/s12936022-04041-9 [3] Roberts, D. R., Chareonviriyaphap, T., Harlan, H. H., & Hshieh, P. (1997). Methods of testing and analyzing excito-repellency responses of malaria vectors to insecticides. J Am Mosq Control Assoc, 13(1), 13-17.

[4] Mechan, F., Katureebe, A., Tuhaise, V., Mugote, M., Oruni, A., Onyige, I., . . . Lynd, A. (2022). LLIN Evaluation in Uganda Project (LLINEUP) – The durability of long-lasting insecticidal nets treated with and without piperonyl butoxide (PBO) in Uganda. bioRxiv, 2022.2002.2017.480046. doi:10.1101/2022.02.17.480046 [5] Kawada, H., Ohashi, K., Dida, G. O., Sonye, G., Njenga, S. M., Mwandawiro, C., & Minakawa, N. (2014). Insecticidal and repellent activities of pyrethroids to the three major pyrethroid-resistant malaria vectors in western Kenya. Parasites & Vectors, 7, 208-208. doi:10.1186/1756-3305-7-208

Acknowledgments: Dave Weetman, Janet Hemingway, Frank Mechan, Jeff Jones, Amy Lynd.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Nick Riches The Chiwindi study: community-based hepatitis B serosurvey in urban and rural Malawi

Background Hepatitis B is a leading cause of liver cirrhosis and hepatocellular carcinoma globally. The impact is greatest in low and middle-income settings, where the existence of a highly-effective vaccine and drug therapies to improve individual outcomes and prevent transmission fail to mitigate the burden adequately.

Ascertainment is a major problem in Malawi, where it is estimated that over 95% of people with chronic hepatitis B infection are unaware of their diagnosis.

Methods The “Chiwindi” (Liver) serosurvey will include 5,000 adult participants resident within rural (Southern Karonga District) and urban (Area 25, Lilongwe) demographic surveillance sites run by the Malawi Epidemiology and Intervention Research Unit. An age- and sex-stratified sample of participants in a large crosssectional study have consented to hepatitis B surface antigen (HBsAg) testing using a manual ELISA kit, with all results being shared with participants who are then being assessed in clinic to determine treatment eligibility.

Results Preliminary results from the rural Karonga site show 19 HBsAg-positive people identified from the first 431 participants (HBsAg seroprevalence 4.4%; 95% C.I. 2.8%-6.7%). There is a trend towards higher seroprevalence in men (5.7%; 95% C.I. 3.1-9.5%) than women (3.2%; 1.4-6.2%); OR 1.9 (95% C.I. 0.7–5.1). Significantly higher prevalence (OR 3.5; 95% C.I. 1.2-12.3) is seen in peri-urban, lakeshore areas (6.6%; 3.9-10.3%) than in rural areas (2.0%; 1.4-6.2%).

Conclusions Preliminary results indicate a substantial burden of undiagnosed hepatitis B infection. The next stage of the study will involve reviewing newly-diagnosed cases in clinic to determine treatment eligibility, and investigating risk factors for infection.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 68

The Chiwindi study: A community-based hepatitis B serosurvey in urban and rural Malawi

N. Riches1,2, A. Crampin2,3, A. Stockdale4, T. Ngawala2, N. Thom2, C. Mkandawire2, L. Banda2, P. MacPherson1 1. Liverpool School of Tropical Medicine; 2. Malawi Epidemiology and Intervention Research Unit; 3. University of Glasgow; 4. University of Liverpool

INTRODUCTION

Despite being a vaccine-preventable disease with effective therapeutics, hepatitis B virus (HBV) remains one of the leading risk factor for liver cirrhosis and hepatocellular carcinoma in African countries. HBV-related morbidity generally presents late, with catastrophic consequences. It is estimated that 95% of people living with HBV in this setting are unaware of their diagnosis. As such, there is an urgent need for interventions which can screen and treat high-risk populations for HBV. Karonga is a rural district in Northern Malawi which hosts a Health and Demographic Surveillance Site (HDSS). The HDSS covers an area of 135km2 split into geographical areas termed reporting groups and has an adult population of approximately 25,000. The HDSS is run by the Malawi Epidemiology and Intervention Research Unit (MEIRU) which is currently delivering a large cross-sectional study (Healthy Lives Malawi – Long-term Conditions; HLM-LTC), within which this serosurvey is nested. This serosurvey (estimated sample size, n = 3,500) will be the first community-based HBV surveillance study in the Northern Region of Malawi.

RESULTS 505 samples were tested for HBsAg up to May 10th 2022 (Fig. 1), comprising 246 men (48.7%) and 259 women (51.3%). 21 samples have tested positive (seroprevalence 4.2%; 95% C.I. 2.7-6.4%).

Preliminary results show (Fig. 2) increased rates in men (5.3%; 95% C.I. 3.02-9.1%) compared to women 3.1% (95% C.I. 1.4-6.2%).

Fig. 1. Age-sex distribution of current serosurvey sample

Age group

Male

Femal e

Total

18-29

58

63

121

30-39

65

67

132

40-49

57

63

120

50+

66

66

132

Total

246

259

505

The highest rates were seen in men aged 40-49 (12.0%; 95% C.I 5.5-24.3%).

Direct age-standardised prevalence was 3.6% (95% C.I. 2.1-5.6%).

Fig. 2

7/57 3/65

3/66

3/63

3/67

2/63

0/58

0/66

AIMS

1. To measure the prevalence of hepatitis B in a communitybased sample in the Karonga HDSS;

2. To measure risk factors associated with chronic hepatitis B infection; 3. To recruit a cohort of participants to be invited into the Chiwindi study clinic to be assessed for treatment eligibility.

Sampling has so far covered reporting group (RG) 6 (a peri-urban, lakeshore area) and RG20 (an isolated rural area). These early results show higher seroprevalence is in RG 6 (5.6%; 95% C.I. 3.4-9.0%) compared to RG20 (2.0%; 95% C.I. 0.6-5.3%); Figure 3.

Fig. 3

METHODS

Inclusion criteria - Resident of the Karonga HDSS - Stored bloods from the HLM-LTC study - Aged 18+; documented consent for hepatitis B testing.

7/72 3/67

4/85

2/47

2/48

3/78 0/54

0/53

Sampling and consent - An age and sex-stratified random sample was taken from participants recruited to the HLM-LTC study.

- Participants were consented to hepatitis B testing as part of the HLM-LTC consent processes.

Laboratory testing and result sharing - Stored HLM-LTC samples were defrosted and tested for hepatitis B surface antigen (HBsAg) using a manual ELISA test (Monolisa HBsAg-Ultra (Bio-Rad, France) - Borderline and positive results were repeated in duplicate.

- Results were linked to patient identifiers and trained MEIRU field workers share all results by phone or home visits as necessary.

Analysis - Laboratory results were imported into R (v4.1.2) and linked to HLM-LTC data using a unique study ID number.

- Ongoing descriptive analysis is being undertaken to look at emerging seroprevalence patterns with respect to risk factors include age, sex and geographical areas.

- Direct standardisation for age was done using the PHEindicatormethods package using Karonga HDSS census data as the standard population.

DISCUSSION

The trend towards higher HBV prevalence in men is consistent with previous evidence from Malawi. Seroprevalence is likely to be lower in the youngest age strata (18-29) due to the introduction of the infant hepatitis B vaccine in Malawi in 2002. Future analyses will measure the vaccine impact. Higher seroprevalence in the lakeshore areas are consistent with known HIV epidemiology. However, it is understood that the epidemiology of HIV and HBV acquisition are different in this setting and this will be investigated in future work.

A system of laboratory testing and result dissemination has been established which is integrated with other ongoing research activities within the Karonga HDSS. These are preliminary results which will be updated as the sample size increases. Once sampling targets are reached multivariate analyses will investigate clinical and demographic characteristics associated with prevalent HBV infection in Northern Malawi. These data will be shared with the Ministry of Health to inform its nascent viral hepatitis strategy.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Sara Rooney Wolbachia-based control of arboviruses in UK mosquito species

Abstract Globally, arboviruses are increasing in frequency and expanding their geographical ranges. The spread of viruses and their associated vector species means the introduction of mosquito-borne viruses to the UK is inevitable. New control methods are required to tackle this increasing and emerging threat to a country not familiar with large-scale arboviral outbreaks. Microbial control strategies, namely Wolbachia, have proven effective in tackling other arboviral diseases.

Much of the current research focusses on Aedes and Anopheline mosquitoes and their Wolbachia interactions, whilst Culex species remain relatively understudied.

This project characterises how native Wolbachia infections and non-native, transinfected Wolbachia, impact vector competence and viral dissemination in Culex pipiens s.l mosquitoes. The focus is on viruses which pose an emerging threat to the UK, namely West Nile virus, Usutu virus & Japanese encephalitis virus. Different strains of Wolbachia are transinfected into Culex pipiens cell lines by 2 methods. Either Wolbachia is purified from a Wolbachia-infected cell line, or it is introduced from ovaries of infected D. melanogaster. These cell lines will then be used to evaluate the effects of different Wolbachia strains on viral replication. The native Wolbachia (wPip) is cleared from mosquitoes via treatment with antibiotics, and the vector competence of the Wolbachia-free line can be compared to the wild-type mosquitoes. The Wolbachia-free mosquitoes can then be re-infected with Wolbachia via embryo injection to assess potential pathogenblocking.

These results will hopefully identify potential avenues for Wolbachia-based controls in UK mosquitoes and increase our understanding of their vector competence.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 70

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Doreen Sakala Investigating the role of social media as a form of social capital in transitions into and out of sex work in urban Blantyre, Malawi Introduction Globally, female sex workers (FSWs) have the highest HIV prevalence with potential to drive HIV transmission due to a myriad of individual, societal and national level challenges. FSWs face and negotiate various risks due to the nature of their work including abuse, inconsistent condom use, alcoholism, legal constraints, and male-female power dynamics. Social capital has been found to mitigate some of these risks. There is little literature regarding social media effect in the context of sex work in Africa. I aim to understand how social media as a form of social capital is being used in the context of sex work engagements and transitions, to contribute to identifying social media-based health interventions.

Methods A qualitative investigation using traditional and digital ethnography and In-depth interviews (IDIs). During traditional ethnography I will spend daily life with the participants while during digital ethnography I will explore the participants’ online interactions. Ultimately, I will establish the existent social networks and the ensuing social capital. IDIs will complement ethnography and collect data from FSWs and other players.

Expected findings By the end of the project, there will be complete understanding of the role of social media in female sex work in contemporary Malawi. Such understanding may lead to identification of potential interventions for impacting transitions in and out of female sex work.

Conclusion Understanding the role of social media as form of social capital in the context of female sex work is important to identify potential mitigating interventions.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 72

Investigating the role of social media as a form of social capital in transitions into and out of sex work in urban Blantyre, Malawi Doreen Sakala (Dept. of International Public Health, Liverpool School of Tropical Medicine) Supervisors: Dr Nicola Desmond, Dr Moses Kumwenda, Dr Wezzie Lora Introduction

Study design and methods

Female sex workers (FSW) have high HIV prevalence compared to the general population. Legal constraints, inconsistent condom use and stigma are some of the risks FSW face leading to vulnerability to contracting HIV.

A qualitative investigation using traditional and digital ethnography and InDepth Interviews (IDI)

60

Identify 4-5 key informants from AMETHIST study

50

Verbal Consent

%

40

Identify participants (Snowball sampling) Written/ Thumbprint consent

30 20 10 0

FSWs

Gen pop (15-49)

Men

Women

Evidence suggests that social capital has been used to mitigate some of the risks FSW face. There is little literature regarding the role of social media in the context of sex work in Malawi.

• Self and study introduction to gate keepers • Written consent

• Identify social media platforms used by FSW • Register social media accounts

• Immersion in the daily lives of participants • Observe and Participate in daily activities

• Self and study intro to group administrators • Written or thumb print consent

• Verbal consent throughout the year • Take field notes • IDI’s to be conducted based on findings coming out

• Online observations • Verbal consent throughout the observations • Taking screenshots and notes • IDI’s

Data management & analysis

Research objectives 1. To explore how social media impacts contemporary lives in Malawi 2. To understand the nature and pathways through which social media as a form of social capital promotes engagement in sex work 3. To investigate the potential of social media and digital approaches in promoting safe health behaviors in sex work engagements and sex work transitions.

Conceptual framework Transition into sex work

Field notes Field recordings Digital data collection

Transcription Translation

Data analysis Coding framework Coding

Expected findings By the end of the project, there will be complete understanding of the role of social media in female sex work in Malawi. Such understanding may lead to identification of potential interventions for impacting transitions in and out of female sex work.

Woman

Conclusions Understanding the role of social media as a form of social capital in the context of female sex work is important to identify potential mitigating interventions.

Acknowledgements AMETHIST consortium for funding Transition out sex work

Social capital is a resource for individuals as well as for societies. Trust and norms of reciprocity, two aspects of social capital, arise from networks. The existence of social capital permits actors to act in a more effective way to reach collective goals

Key references 1. MPHIA. Malawi Population Based HIV Impact Assessment. 2022.

2. Ruegsegger LM, Stockton M, Go VF, Piscalko H, Davis D, Hoffman IF, et al. Stigma, social support, and sexual behavior among female sex workers at risk for HIV in Malawi. AIDS Educ Prev. 2021;33(4):290–302 3. Thorogood JG& N. Qualitative Methods for Health Reseach. 4th Editio.

College) DS (Goldsmiths, editor. SAGE Publications Ltd; 2018. 173 p.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Isabel Saldanha Detection of Trypanosoma brucei DNA in faeces of experimentally-infected cattle

Authors Saldanha, I., Betson, M., Matthews, K.R., Paxton, E., Vrettou, C., Morrison, L.J., Torr, S.J. and Cunningham, L.J.

74

Abstract Species of Trypanosoma transmitted by the tsetse fly (Glossina) vector are responsible for clinically significant diseases in both human and animal populations. Although significant advances have been made in the control of human African trypanosomiasis (HAT), animal African trypanosomiasis (AAT) remains a disease of significant economic burden in sub-Saharan Africa. Current AAT surveillance tools suffer from poor sensitivity and specificity, with serological methods requiring animal restraint and blood collection by trained personnel.

Faecal sampling is a potential option for more accessible sample collection.

Therefore, this study set out to determine whether it is possible to detect DNA of an AAT aetiological agent (T. brucei) in the faeces of experimentally-infected cattle. Five Holstein-Friesian calves of post-weaning age were inoculated with T. brucei AnTat1.1 and the infection course was followed for a total of 68 days. A total of 146 faecal samples (12 pre-infection, 134 post-infection) were collected and screened using PCR and a novel probe-based qPCR assay targeting a Trypanozoon-specific region in kinetoplast DNA. Target DNA was successfully detected in 85% (n=114) of post-inoculation faecal samples by qPCR and 50% (n=67) by PCR. Target DNA was detected in samples collected between four days post-inoculation (dpi) to 66 dpi. Amplification of target DNA was confirmed

by Sanger sequencing of PCR products. These results confirm, for the first time, the ability to consistently detect Trypanosoma DNA from infected cattle faeces.

This shows the potential of faeces as an accessible sample to screen for active AAT infection in cattle and potentially wild mammalian hosts.

Detection of Trypanosoma brucei DNA in faeces of experimentally-infected cattle Saldanha, I.1, Betson, M.2, Matthews, K.R.3, Paxton, E., Vrettou, C.4, Morrison, L.J., Torr, S.J.1, Cunningham, L.J.5 Liverpool School of Tropical Medicine, Dept. Vector Biology; 2University of Surrey, School of Veterinary Medicine; 3University of Edinburgh, Institute of Immunology and infection; 4University of Edinburgh, Roslin Institute; 5Liverpool School of Tropical Medicine, Dept. Tropical Disease Biology

1

A Species of Trypanosoma transmitted by the tsetse fly (Glossina) vector are responsible for clinically significant diseases in both human and animal populations. Although significant advances have been made in the control of human African trypanosomiasis (HAT), with the disease targeted for elimination by 2030 1, animal African trypanosomiasis (AAT) remains a disease of significant economic burden in sub-Saharan Africa.

Current AAT surveillance tools suffer from poor sensitivity and specificity 2,3, with serological methods also requiring animal restraint and blood collection by trained personnel. Molecular tools have greatly improved the sensitivity and specificity of AAT surveillance, however high cost and limited field applicability remain a barrier for use in affected regions 2. Faecal sampling is an option for more accessible sample collection and screening.

Successful detection of blood-borne protozoan DNA in human and wildlife faeces has been demonstrated previously, including Plasmodium sp., Leishmania sp. and Trypanosoma sp. 4–9.

However detection of Trypanosoma DNA in livestock faeces has not yet been explored. Therefore, this proof-of-principle study set out to determine whether it is possible to detect DNA of an AAT pathogen (T. brucei) in the faeces of experimentally-infected cattle, and how these results compare to screening matched blood samples over the course of a ten-week longitudinal study.

B

Figure 3: A box plot chart displaying Cq values obtained from screening blood and faecal samples with TBR-qPCR over consecutive 4-day intervals. Error bars represent range.

Figure 4: Examples of TBR-qPCR normalised amplification plots obtained from screening 46 faecal samples (A) and 46 blood samples (B).

Positive control (T. brucei M249) in lime green.

Detection of T. brucei DNA in faecal and blood samples: Target DNA was detected in faecal samples collected between 4 days post-inoculation (dpi) to 66 dpi by both TBR-qPCR and TBR-PCR. In post-inoculation blood samples, target DNA was detected in 100% (n=138) of samples by TBR-qPCR. No amplification was recorded in pre-inoculation blood (n=10) or faecal (n=12) samples by PCR or qPCR. Quantification and relationship of T. brucei DNA in faecal and blood samples: Cq values obtained from faecal samples were consistently higher (mean=32.54, ±2.53 SD) than for blood samples (mean=21.54, ±2.36 SD)(Fig.3). Lowest Cq values (faecal=Cq 26.01, blood=Cq 12.75) were obtained from samples taken from the same calf at 5 dpi.

Confirmation of T. brucei DNA detection: BLAST™ analysis revealed significant homology (mean percentage identity of 91.59% ±2.834 SD) to T. brucei s-l minicircle DNA (accession number K00392.1).

TBR-qPCR assay analytical sensitivity and specificity: The ). Analytical specificity testing of the optimised TBR-qPCR assay revealed successful amplification in 9/9 target DNA samples (T. brucei M249, T. b. rhodesiense Z212, T. b. gambiense ELIANE). However low-level amplification was also recorded in 9/21 non-target Trypanosoma DNA samples (3/3 T. vivax, 3/3 T. godfreyi, 2/3 T. simiae and 1/3 T. congolense kalifi).

Figure 1: A flow diagram showing the experimental framework for the study.

Experimental Infections: Experimental infections were carried out at Roslin Institute (Home Office Project License number PE854F3FC, Roslin Institute Animal Welfare Ethical Review Board number L447) for the purposes of a separate project, however the opportunity was taken to collect environmental samples or utilise surplus sample material. The infection study and sample collection was carried out as indicated in Fig.1, with samples linked to individual calf ID where possible. A total of 146 faecal samples stored in RNALater™ (12 pre-inoculation, 134 post-inoculation) and 148 jugular blood samples (10 pre-inoculation, 138 post-inoculation) were collected and stored at -80oC. DNA Extraction: Faecal samples (150µg) were processed using Quick-DNA Fecal/Soil Microbe DNA Miniprep kit (Zymo Research). Blood samples (70µL) were processed using Dneasy 96 Blood and Tissue kits (QIAGEN).

PCR and qPCR: PCR reactions were carried out using MyTaq™ Red Mix (Meridian Bioscience) and Applied Biosystems™ Veriti™ thermal cycler (Life Technologies). All qPCR reactions were carried out using Bio-Rad SsoAdvanced Universal Probes Supermix (Bio-Rad Laboratories). Thermocycling, fluorescence detection and data capture was carried out using a Mic and micPCR v.2.9.0 software (Bio Molecular Systems). For qPCR, a novel hydrolysis probe-based assay was designed based on T. brucei s-l minicircle DNA (accession number K00392.1) using Primer3. The PCR and qPCR primers used are detailed in Table 1.

TBR-PCR Product Sequencing: Following gel electrophoresis, TBR-PCR target products (Fig.6) from 4 faecal samples were excised and purified using an Exo-CIP™ Rapid PCR Cleanup Kit (New England Biolabs). Sanger sequencing was performed by Source BioScience Ltd. Sequence clean-up and alignments were performed in BioEdit v7.2. Resultant sequences were subject to BLAST™ nucleotide analysis (National Centre for Biotechnology Information).

Oligo Name

Sequence (5’ - 3’)

TBR_

CGAATGAATATTAAACAATGCGCAGT

PCR_F TBR_

AGAACCATTTATTAGCTTTGTTGC

PCR_R TBR_

CGCAGTTAACGCTATTATACACA

QPCR_F TBR_

CATTAAACACTAAAGAACAGCGT

_QPCR_P

40 10

35

Y = -3.300*X + 24.94

30

R2= 0.9982 Efficiency = 1.01

25 This study

FAMTGTGCAACATTAAATACAAGTGTGTZEN

Table 1 (above): Primers used in the study

Figure 2 (right): Linear regression analysis on mean Cq values obtained from optimised TBR-qPCR assay against 10fold dilution series of 1ng/µL to 10fg/µL target DNA. Assays were performed in triplicate. Error bars = standard deviation.

Cq

QPCR_R TBR

Source

20 15 10 5 0

-2

-1

0

1

2

3

4

5

6

DNA Amount (5.16x10x genome equivalents/rxn)

Acknowledgements: Many thanks to Adrian Ritchie and Peter Tennant for their invaluable assistance in the collection of biological samples and clinical data from calves taking part in the infection study at Roslin Institute. Many thanks also to Wendy Gibson and Annette Macleod for providing Trypanosoma sp. DNA for use in specificity testing. Funding provided by Biotechnology and Biological Sciences Research Council (BBSRC) and Bill & Melinda Gates Foundation. Photographs provided by Liam Morrison and author’s own.

Figure 5: Linear regression analysis between individual calf matched blood and faecal Cq values (n=70).

Figure 6: An image displaying results of products resulting from TBR-PCR screening on DNA extracted from 25 post-inoculation cattle faecal samples.

LAD = 100bp molecular ladder, NTC = no-template control (nuclease-free water), NFC = negative faeces control. TBB = T. brucei M249 DNA 1ng/µL (positive control). A white arrow in the lower right corner indicates the position of diagnostic 173bp TBR-PCR target product, visible in positive control in addition to several samples.

• These results confirm, for the first time, the ability to consistently detect Trypanosoma DNA from the faeces of infected cattle over a 10-week infection period.

• There is a significant but weak association between quantity of T. brucei DNA in blood and faeces.

Although the method by which the DNA enters the faeces remains unknown, it may be linked to blood.

• Although highly sensitive, this TBR-qPCR assay may not suitable for field use due to cross-reactivity with DNA from other Trypanosoma sp. Other genetic targets should be explored for detection and identification of Trypanosoma DNA. • This study showcases interdisciplinary collaboration and being able to utilise in vivo research animals for several parallel studies, thereby reducing the number of animals used in research.

• With refinement of DNA extraction and molecular detection methods, this technique could be used as an AAT or HAT surveillance tool in both livestock and wildlife mammalian species.

References: 1Barrett, M. P. The elimination of human African trypanosomiasis is in sight: Report from the third WHO stakeholders meeting on elimination of gambiense human

African trypanosomiasis. PLoS Negl. Trop. Dis. 12, e0006925 (2018). 2Eshetu, E. & Begejo, B. The Current Situation and Diagnostic Approach of Nagana in Africa: A review. J. Nat. Sci. Res. 5, 117–124 (2015). 3Eisler, M. C., Dwinger, R. H., Majiwa, P. A. O. & Picozzi, K. Diagnosis and epidemiology of African animal trypanosomiasis. in The Trypanosomiases 253–267 (CABI, 2004). doi:10.1079/9780851994758.0253. 4Jirků, M. et al. Wild chimpanzees are infected by Trypanosoma brucei. Int. J. Parasitol. Parasites Wildl. 4, 277–282 (2015). 5Hamad, I. et al. Wild Gorillas as a Potential Reservoir of Leishmania major. J. Infect. Dis. 211, 267 (2015). 6de Assis, G. M. P. et al. Detection of Plasmodium in faeces of the New World primate Alouatta clamitans. Mem. Inst. Oswaldo Cruz 111, 570 (2016). 7Jirků, M. et al. Detection of Plasmodium spp. in Human Feces. Emerg. Infect. Dis. 18, 634 (2012). 8Al-Shehri, H. et al.

Non-invasive surveillance of Plasmodium infection by real-time PCR analysis of ethanol preserved faeces from Ugandan school children with intestinal schistosomiasis. Malar. J. 18, 1– 8 (2019). 9Votýpka, J. et al. An unexpected diversity of trypanosomatids in fecal samples of great apes. Int. J. Parasitol. Parasites Wildl. 7, 322 (2018). 10 Moser, D. et al. Detection of Trypanosoma congolense and Trypanosoma brucei subspecies by DNA amplification using the polymerase chain reaction. Parasitology 99 Pt 1, 57–66 (1989).

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Yusupha Sanyang Accessibility and Quality of Sexual and Reproductive Health Services for adolescents in The Gambia

Background The Gambia, like many Sub-Saharan African countries, continues to experience a high burden of sexual and reproductive health problems among adolescents.

These include HIV/AIDS, young adolescents’ pregnancy, an unmet need for family planning, female genital mutilation, and early marriage (Ministry of Health 2017; Tlaye et al.,2018). Improving access to quality Sexual and Reproductive Health (SRH) services is a key component to meeting adolescent SRH needs. This study aims to explore the SRH needs of adolescents and how the services are designed to meet these needs in The Gambia.

Supervisors Florence Mgawadere, Nicola Desmond, Mamady Cham

Methods This is a cross sectional mixed method study to be conducted in both rural and urban regions in the Gambia to answer key questions about the SRH needs, access and quality of SRH services for adolescents. Quantitative and qualitative data will be collected from adolescents aged 15-19, healthcare providers and stakeholders through Focus Group Discussions (FGDs), in-depth interviews, survey questionnaires and a review of policy documents, reports, guidelines, and patient registers. Qualitative data will be analysed using a thematic analysis and framework approach and quantitative data will be analysed using SPSS for both descriptive and inferential statistics.

Expected outcome This study will highlight the SRH needs of adolescents and to what extent services are designed to meet these needs. Drawing on key, established networks, this research is expected to contribute to policy and future interventions to improve the provision of appropriate and targeted SRH services for adolescents in the Gambia.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 76

Accessibility and Quality of sexual and reproductive health Services for Adolescents in The Gambia Yusupha Sanyang Supervisors: Florence Mgawadere1, Nicola Desmond1, Mamady Cham2 1. Liverpool School of Tropical Medicine; 2. Ministry of Health The Gambia.

The Gambia, like many Sub-Saharan African countries, continues to AIM: This study aims to explore the SRH needs of adolescents and to experience a high burden of sexual and reproductive health problems what extent the services are designed to meet these needs in The Gambia. among adolescents. These include HIV/AIDS, young adolescents' pregnancy, an unmet need for family planning, female genital Objectives mutilation, and early marriage (Ministry of Health 2017; Tlaye et 1.To explore the SRH needs of adolescents in urban and rural areas of the al.,2018) Table 1 Gambia This research is intended to improve the SRH services in order to meet 2.To map out sexual and reproductive health services available for the SRH needs of adolescents adolescents in the Gambia 3.To assess the quality and accessibility of sexual and reproductive health services for adolescents in urban and rural health facilities in the Gambia 4.To explore the views of key stakeholders on whether current services meets adolescents’ SRH needs.

5.To inform context-specific improvements in service quality for future implementation of SRH services (Sexual and Reproductive Health Services) for adolescents in the Gambia

Study Settings

Both urban and rural communities in the Gambia: Figure 2 Six major health facility providing SHR services to adolescents Settings selected to understand how geographical and social diversities will influence the SRH needs, access and quality of services for adolescents.

Qualitative method

Study approach

Conceptual framework

Methods

Parallel Mixed method design

The study design: Mixed method Participants: adolescents aged 15-19, healthcare providers and stakeholders Sampling: Purposive and Systematic Data Collection: FGDs, in-depth interviews, survey questionnaires and a desk review.

Data analysis: Thematic analysis using both deductive and inductive coding, quantitative analysis using SPSS for both descriptive Analysis of Variance (ANOVA)

Figure 2 Map of the Gambia

Will explore the SRH needs of adolescents and their perception towards access and quality of SRH services for adolescents in the Gambia

Quantitative method Cross-sectional study To assess the quality of SRH services in the health facilities in both urban and rural areas of The Gambia

Sample and sampling strategy Purposive sampling Target population Adolescents aged 1519 years Health service providers Stakeholders

Sampling Systematic sampling Target population Adolescent aged 1519 years Health facility Managers

Data collection Focus group discussions Semi-structured indepth interviews

Data collection Questionnaire Desk review : Policy documents, reports, guidelines, patient’s registers

Expected outcomes This study will highlight the sexual and reproductive needs of adolescents and how the services are designed to meet the SRH needs of adolescents in The Gambia.

Drawing on key, established networks, the research is expected to contribute to policy and future interventions to improve the provision of appropriate sexual and reproductive health services for adolescents in the Gambia.

References

Tilahun, T., Bekuma, T. T., Getachew, M. and Seme, A. (2021) 'Assessment of access and utilization of adolescent and youth sexual and reproductive health services in western Ethiopia', Reproductive Health, 18(1), pp. 1-9 The Gambia Bureau of Statistics and ICF, Statistics, T.G.B.o. (2021) The Gambia Demographic and Health Survey 2019-2020. The Gambia and Rockville, Maryland, USA: GBoS and ICF. Ministry of Health (2017) National Reproductive , Maternal, Neonatal, Child and Adolecent Health (RMNCAH) Policy (2017-2026). Banjul: Ministry of Health.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Duncan Shikuku Systematic review of national continuous professional development processes and systems for midwifery educators in LMICs Introduction Midwifery education and training in LMICs remains grossly under-invested with variation in the quality and content, insufficient/poorly trained educators, weak regulation and lack of opportunities for educators to update their knowledge or skills. Competently trained skilled health personnel is a critical strategy for achieving the SDG maternal health targets. This review describes the current approaches, content and effectiveness of midwifery educator CPD programs in LMICs.

Supervisors Dr. Charles Ameh, Dr. Carol Bedwell and Prof. Eunice Ndirangu

Methods A structured search through EBSCO Discovery Services of electronic databases (MEDLINE, CINAHL, Global Health, PubMed) and Google Scholar was performed.

Papers published in English, between 2000-2021 on CPD for midwifery educators in LMICs were reviewed. The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guided the reporting process. A narrative synthesis of the papers included was performed.

Results Twelve papers met inclusion criteria although many did not report on CPD directly but focused on capacity building initiatives. No formal CPD program managed by a national regulator or international midwifery body was identified. Common CPD delivery approaches identified were twinning (international collaborations employing the train-the-trainer approach) and informal program guided by an international medical body. Content included: curriculum design and review, teaching, learning and assessment; leadership in health; project management & evaluation; and education research training. Programs contributed to personal development, professional growth and health systems improvements in maternal newborn health.

Conclusion There is low evidence of effective midwifery educator capacity building initiatives. There is a need for designing regulator approved midwifery educator CPD programme to improve the quality of midwifery education and number of competent skilled health personnel in LMICs.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 78

Systematic review of national continuous professional development processes and systems for midwifery educators in LMICs Authors: Duncan Shikuku1, Hannah McCauley1, Carol Bedwell1, Eunice Ndirangu2, Sarah Bar-Zeev3 & Charles Ameh1 1 Liverpool School of Tropical Medicine; 2 Aga Khan University East Africa; 3 UNFPA

RESULTS

Countries covered –Nigeria, Kenya, Ethiopia, Zambia, Malawi, Tanzania, South Africa, Vietnam, India, Jordan, Phillipines, Macedonia, Romania & LMICs Results presented as follows: Approaches, Content & Effectiveness

o o

1. CPD Approaches

Midwives educated to international standards, licensed, and supported by interdisciplinary teams and work within an enabling environment, can deliver ~ 90% of essential sexual, reproductive, maternal, newborn and adolescent health interventions across the life course (1). Achieving universal coverage of midwifery delivered interventions including skilled attendance at birth, provision of emergency obstetrics and newborn care (EmONC) and family planning, by 2035 could save up to 4.5 million mothers and babies per year (2). However, midwifery education and training remains grossly under-invested with variation in the quality, content and duration of content between and within countries. Lack of/insufficient skilled midwifery educators and weak regulation affect the quality of graduates from midwifery programmes and evidence suggests that midwifery educators are more confident with theoretical classroom teaching than clinical teaching. To strengthen midwifery education/training and practice, WHO recommends that midwives and midwifery educators should participate in relevant accredited continuous professional development (CPD) programs for safe, competent and effective practice to achieve universal health coverage (UHC) & maternal and newborn health SDGs (3). However, only 16 (34.7%) WHO Afro region states have instituted CPD points as a mandatory measure to ensure up-to-date skilled, relevant practitioners (4). This demonstrates that more investments are required for relevant and effective CPD programs to improve the quality of midwifery education and training in developing countries.

2. Informal program guided by an international medical body (1 study) 3. Formal program guided by an international medical body (1 study) 4. Greenfield: Led by a national medical professional body. Collaborating with stakeholders, the concept of CPD, the competencies required by professionals in the field, curriculum, plan for required activities and implementation plan are developed (2 studies) 5. Directed by regulators: CPD program designed and implemented by regulatory bodies. CPD program meets regulatory requirements by definition (1 study)

2. CPD content CPD content vs number of studies/reports CPD content

BACKGROUND

1. Twinning: Engagement between international consultants (capacity builders) and national participants (capacity buildees) - twinning; master-trainer or train-the-trainer approaches/models involving key national educators (7 studies)

Project management & evaluation Education research and training Leadership in health Emergency obstetrics & newborn care…

Curriculum & Educational approaches 0

1

2

3

4

5

6

7

No. of studies/reports Reports

Studies

3. Effectiveness of CPD (assessed using Kirkpatrick’s evaluation framework)

Objective

The systematic review (SR) describes the o current approaches/systems/processes, o content and o effectiveness of midwifery educator CPD programs in LMICs

METHODS o o

Protocol: Developed and registered in PROSPERO at https://www.crd.york.ac.uk/prospero/display_record.php?ID=C RD42021283273 CPD definition: Means by which members of the profession maintain, improve and broaden their knowledge, expertise, and competence, and develop the personal and professional qualities required throughout their professional lives (Nursing and Midwifery Board of Australia, 2016)

Search strategy o

o o o o o o

o

Electronic databases – MEDLINE, CINAHL, Global Health, PubMed & Google Advance for websites/organisations (ICM, UNFPA, WHO, JHPIEGO and WCEA) & Citation searching Search terms: Free text or MeSH terms related to CPD/faculty development; midwifery educator; LMICs and approaches Inclusion: Research studies on midwifery educator CPD, in English, between 2000 – 2021 Reporting: based on PRISMA 2020 flow diagram Data abstraction/PRISMA: 301 papers & reports searched; included 10 papers and 6 reports Review of papers: Two authors plus third author in case of disagreement Appraisal of studies: Critical Appraisal Skills Programme (CASP) checklist for published papers & authority, accuracy, coverage, objectivity, date, significance (AACODS) checklist for grey literature/reports Analysis of findings: A narrative synthesis approach due to heterogeneity of the studies included in terms of methodology, type of CPD/faculty development)

Kirkpatrick level

Benefit/effectiveness

1 (Reaction) – 2 papers

Increased levels of self-confidence & positive to content

2 (Learning) Knowledge/Skills – 2 papers

Improvements in knowledge & skills on curriculum review, EmONC/post-abortal care (PAC),

3 (Behaviour) Personal & Professional development (5 papers)

Midwifery curricula reviewed; developed innovations in teaching & learning; Increase in exposure to theoretical teaching and clinical practice; Provision of EmONC services; Personal growth as researchers and academics; improvement in leadership, management and research skills; critical thinking and problem-solving skills

4 (Outcome) (Professional development & Health systems) (3 papers)

Improved student outcomes, contributing to a quality workforce; Educators gaining advanced qualifications, career progression, educational scholarship, increased peerreviewed publications, educational scholarship awards, research development and recognised research roles; improved women’s health

CONCLUSIONS o

o o

There is low evidence of effective midwifery educator capacity building initiatives There is low number of regulator accredited educator CPD programmes that have been evaluated There is a need for designing regulator approved midwifery educator CPD programmes to improve the quality of midwifery education and number of competent skilled health personnel in LMICs

References 1.

2.

3.

4.

WHO, UNFPA and ICM (2021). The State of the World’s Midwifery Nove, A., et al (2021). Potential impact of midwives in preventing and reducing maternal and neonatal mortality and stillbirths: a Lives Saved Tool modelling study. The Lancet Global Health, 9, e24-e32.

WHO. (2019). Strengthening quality midwifery education for Universal Health Coverage 2030: Framework for action Baloyi, O. B., & Jarvis, M. A. (2020). Continuing Professional Development status in the World Health Organisation, Afro-region member states. International Journal of Africa Nursing Sciences, 13, 100258.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Lusako Sibale Adults living with HIV on antiretroviral therapy exhibit prolonged high density pneumococcal carriage and shed antimicrobial resistant pneumococci Background Despite successful roll out of the pneumococcal conjugate vaccines, vaccine serotype (VT) carriage remains high among People Living with HIV (PLHIV) on antiretroviral therapy (ART). We investigated the impact of HIV infection on pneumococcal carriage duration, density, shedding and antimicrobial resistance (AMR).

Authors Lusako Sibale1,2, Newton Kalata1, Tinashe Nyazika2, Alice Kalirani1, Mercy Khwiya1, Gift Sagawa1, Todd D Swarthout3, Neil French4, Ken Malisita5, Arox Kamng’ona6, Robert S Heyderman3, Brenda Kwambana-Adams3, Kondwani Jambo1,2.

Author’s affiliation 1

alawi-LiverpoolM Wellcome Clinical Research Programme, University of Malawi College of Medicine, Blantyre, Malawi

2

Department of Clinical Sciences, Liverpool School of Tropical Medicine, Liverpool, UK

3

NIHR Global Health Research Unit on Mucosal Pathogens, Division of Infection and Immunity, University College London, WC1E 6JF, London, UK

4

Institute of Global Health, University of Liverpool, L69 3GE, Liverpool, UK

5

Lighthouse, QECH, P.O. Box 95, Blantyre, Malawi

6

amuzu University of K Health Sciences, Blantyre, Malawi

Methods In a prospective cohort study, we recruited 90 asymptomatic PLHIV on ART and 54 HIV-uninfected adults aged 18-45 years and followed them up at regular intervals for 12 months. Standard microbiological techniques were used to test for pneumococcal presence and density on nasopharyngeal swab and shedding specimens (cough, nose poke and facemask). Disk diffusion using oxacillin, tetracycline, erythromycin and co-trimoxazole was performed to screen AMR. Results PLHIV on ART had a longer duration of pneumococcal carriage (133 [95% CI 112140] vs. 49 [95% CI 26-66] days; p=0.0012) and higher pneumococcal carriage density (51088 [95% CI 27542-95499] vs. 7630 [95% CI 3467-16218] CFU/ml; p=0.0394) than HIV-uninfected adults. PLHIV on ART were more likely to shed pneumococcus than HIV-uninfected adults (46% vs 25%; p=0.002). Shed isolates were more often multidrug resistant (MDR) than the nasopharyngeal carriage isolates (57% vs. 36%; p=0.0015). A generalized linear mixed model demonstrated that being HIV-infected on ART (p=0.017) or having a higher carriage density (p=0.0002) were independently associated with increased pneumococcal shedding.

Conclusion We have demonstrated profoundly greater risks of pneumococcal carriage and shedding among PLHIV on ART compared to HIV-uninfected adults. These findings suggest that PLHIV on ART could be an important reservoir of pneumococcal transmission, including of AMR pneumococci.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 80

Adults living with HIV on antiretroviral therapy exhibit prolonged high density pneumococcal carriage and shed antimicrobial resistant pneumococci Lusako Sibale1,2, Newton Kalata1, Tinashe Nyazika2, Alice kalilani1, Mercy Khwiya1, Gift Sagawa1, Todd D Swarthout3, Neil French4, Ken Malisita5, Arox Kamng’ona6, Robert S Heyderman3, Brenda KwambanaAdams3, Kondwani Jambo1,2

1Malawi-Liverpool-Wellcome

Programme, Blantyre, Malawi; 2Liverpool School of Tropical Medicine, Liverpool, UK; 3NIHR Global Health Research Unit on Mucosa Pathogens, Division of Infection and Immunity, University College London, UK ; 4Institute of Global Health, University of Livrerpool,UK; 5Lighthouse, QECH, Blantyre, Malawi ; 6Kamuzu University of Health Sciences, Blantyre, Malawi.

RESULTS II

BACKGROUND People living with HIV (PLHIV) are at 30-40 times greater risk of pneumonia caused by Streptococcus pneumoniae (the pneumococcus). In addition, PLHIV have high persistent pneumococcal carriage.

Pneumococcal carriage precedes pneumococcal disease, transmission and emergence of antimicrobial resistance. However, it is still unclear whether antibiotic usage among PLHIV on antiretroviral therapy (ART) influences carriage and transmission of antimicrobial resistant pneumococci.

A.

B.

C.

D.

RESEARCH QUESTION Are PLHIV on ART more likely to carry and shed antimicrobial resistant (AMR) pneumococci?

Figure 2. A) Pneumococcal carriage prevalence. B) Pneumococcal carriage density. C) Pneumococcal carriage duration. D) Pneumococcal shedding

METHODS

RESULTS III Table 2. Carriage isolates from PLHIV are more resistant to cotrimoxazole Antibiotics

4.48 (2.13,9.41)

Oxacillin

0.79 (0.51,1.22)

0.3

Tetracycline

0.52 (0.22,1.25)

0.14

Erythromycin

0.56 (0.33,0.97)

0.037

MDR

1.36 (0.50,3.67)

0.5

Table 1. Baseline characteristics of the population HIV uninfected (n=54)

PLHIV on ART >1year (n=90)

p-value

20(37) 21(39) 13(24)

19(21) 35(39) 36(40)

0.0591

34 (63)

62 (69)

0.51

Median possession index (IQR)

6 (3-8)

5 (3-6)

0.142

No under5 children n(%) One Two Three

38(70) 13(24) 3(5.6)

78(87) 11(12) 1(1.1)

0.0391

786 (673 – 945)

560 (349 – 773)

<0.0012

1 Pearson

Chi-square test; 2 Wilcoxon rank sum test

PNS (%)

Cough (%)

p-value1

Cotrimoxazole

75(94)

53(95)

>0.9

Oxacillin

36(44)

38(68)

0.007

Tetracycline

22(28)

35(62)

<0.001

Erythromycin

25(31)

26(46)

0.072

MDR

26(32)

36(64)

<0.001

1 Pearson

Gender (Female) n(%)

CD4 count median (IQR)

Ratio, CI=Confidence Interval

Antibiotics

RESULTS I

18 to 25 26 to 35 36 t0 45

<0.001

Table 3. The prevalence of AMR is higher among shed isolates than carriage isolates

Figure 2. A) Pneumococcal prevalence Figure 1. Samplingcarriage strategy and Laboratory assays

Age median n(%)

p-value

Cotrimoxazole

1 OR=Odds

Characteristic

OR (95% CI) 1

Chi-square test

CONCLUSION We have demonstrated that PLHIV on ART experience longer durations, higher densities and more frequent shedding cotrimoxazole and macrolide resistance pneumococci during pneumococcal carriage episodes PLHIV on ART may be an important reservoir of AMR pneumococcal transmission in the community.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Lindiwe Sibiya Investigating the role of social capital and social cohesion in the creation of identity among young women who sell sex in rural KwaZulu Natal Introduction This project is embedded within the AMETHIST consortium in rural KwaZuluNatal which aims to investigate how readily AMETHIST can be translated to rural KwaZulu-Natal, setting with less established clinical services for FSWs and to understand the predicted impact on the HIV epidemic and cost-effectiveness.

Despite high poverty rates and long-standing acknowledgement of FSW enhanced risk, they continue to be largely neglected by HIV programmes in Africa. In South Africa delivering programmes is complicated by the fact that sex work is illegal, a factor contributing to reduced access to health care among FSW. Methods An Ethnography, using meta-synthesis systematic review, mapping, participant observations, in-depth interviews, and life narratives for qualitative data collection. AGYW will be sampled using purposive sampling from the DREAMS and AMETHIST Projects. This project uses conceptual framework.

Expected results Understanding different forms of social capital and social cohesion and their role in the creation of identity among young women, as well as identifying social behaviours to be promoted that will increase the uptake of HIV and SRH interventions available for sex workers. Lastly, for the findings to contribute to the development of future interventions for sex workers.

Conclusion No data collection has been conducted yet, hence the expected results. However, the findings will be used to improve future developments of interventions aimed at facilitating safe transitions into and out of sex work.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 82

Investigating the role of social capital and social cohesion in the creation of identity among young women who sell sex in rural KwaZulu-Natal Sibiya L1, 2, Shahmanesh M1, 3, Zuma T1, 2, 3 , Chimbindi N1, 2 , 3 , Desmond N1 School of Tropical Medicine, UK, 2Africa Health Research Institute, SA, 3University College London, UK

1Liverpool

1. Background

Ø 121,000-167,000 (0.8-1%) adult women are estimated to be engaged in sex work 30,000 in KZN

Overall aim of this PhD

Ø No sex work program until 2016 –still with limited extension into rural settings

Ø To investigate the role of “social” in social networks informing sex work and transitioning into and out of sex work in Southern Africa

Ø Resources, social structure and social networks impact on decisions to transition into and out of sex work (Desmond, 2009)

Ø To understand social behaviours to be promoted, that will influence the

Ø Identity theory self-discovery of who one is (Styler, 2016)

uptake of SRH services

Ø Social identity refers to how the society perceives one Goffman’s idea of front and backstage Ø This project is embedded within the AMETHIST consortium in South Africa “An

Sex Work occupation

in

which

participating

Transactional Sex “Noncommercial, nonmarital sexual

Specific Objectives

individuals engage in sexual intercourse in

relationships motivated by an implicit

designated places such as brothels, hotels,

assumption that sex will be exchanged

the street, inside vehicles, and so on

for material support ot other benefits”

“(Benoit & Shumka, 2015; Masvawure,

(Wamoyi et al., 2019)

Ø To investigate the impact of social capital and social cohesion in the creation of identity

Ø Understand factors that influence social capital and social cohesion in SUPPORTING the creation of identity

Clients (truck drivers, mine workers, tourists, men from the community, etc.)

COMPANY LOGOS

Ø To explore how social capital affects the dynamics of identity

2010; Tade & Adekoya, 2012)

Ø To investigate how the dynamics of identities, impact on one’s

Blessers, sugar daddies,

decision to transition into or out of sex work

friends with benefits,

Ø To co-create approaches to increase engagement with sex work

employers, service providers Table 1: Types of Sex Work & Transactional Sex

Fig 2: Sex Workers

2. Methods

interventions Social Capital “The relations between individuals form social networks,

Ø An Ethnography using qualitative data methods which includes a scoping review Ø Ethnographic data collection methods to be used include.

norms of reciprocity and trustworthiness” (Putnam 2001: 1819) Social Cohesion

Methodology

“Social Cohesion is the extent to which people are co-

Ø Data Collection

operative, within and across group boundaries, without

Ø Field Notes

coercion or purely self-interested motivation” (Wamoyi,

Ø Study sites mapping n=4

2020)

Ø Participant observations n=16 (following study participants)

Fig 3: Conceptual Framework

Ø Interviews Ø In-depth interviews with sex workers n=20 initial interviews, n=3 follow up interviews of the same participants, n=8 follow up interviews Ø In-depth interviews with relevant stake holders n=10 Ø Data Analysis Ø NVivo Software . Ø Inductive Theory Ø Secondary data analysis of 10 life narrative grids from the AMETHIST study

Fig 4: Study Setting Ø Africa Health Research Institute (AHRI) is situated in uMkhanyakude District, KZN, SA Ø Site is mostly rural and poor, with high unemployment and high HIV prevalence

3. Conclusion Contribution

Expected Results

Ø To the body of the existing limited literature on the role of social capital and social cohesion in creating identities especially in young women involved in sexual transactions

Ø Understanding the social contributors and the impact of identity dynamics in facilitating decisions to transition into and out of sex work

Ø Understanding on FSW accessing and utilizing sex worker, HIV and SRH interventions

Ø Identifying social behaviours to be promoted, that will improve the accessibility and uptake of HIV and SRH interventions for sex workers

Ø Identifying areas to focus on when developing interventions for sex workers

Ø Inform the development of future interventions aimed at promoting safe transitions into and mostly out of sex work

:

Kyegombe, N., Meiksin, R., Wamoyi, J., Heise, L., Stoebenau, K. and Buller, A.M., 2020. Sexual health of adolescent girls and young women in Central Uganda: exploring perceived coercive aspects of transactional sex. Sexual and reproductive health matters, 28(1), p.1700770.

References Mael, F. and Ashforth, B.E., 1992. Alumni and their alma mater: A partial test of the reformulated model of organizational identification. Journal of organizational Behavior, 13(2), pp.103-123.

Napierala, S., Desmond, N.A., Kumwenda, M.K., Tumushime, M., Sibanda, E.L., Indravudh, P., Hatzold, K., Johnson, C.C., Baggaley, R.C., Corbett, L. and Cowan, F.M., 2019. HIV self-testing services for female sex workers, Malawi and Zimbabwe. Bulletin of the World Health Organization, 97(11), p.764.

Putnam, R., 2001. Social capital: Measurement and consequences. Canadian journal of policy research, 2(1), pp.41-51.

Progress to date

Ø Application to LSTM Boards submitted, awaiting response Ø To submit amendment application to BREC Ø Working on a scoping review

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Leticia Suwedi-Kapesa Enhanced health systems to improve uptake of early infant diagnosis among post-partum women in primary health care in Blantyre District Malawi Background In many African countries, low utilisation of health services after birth contributes to significant gaps in HIV testing for HIV-exposed infants (HEIs). Initiatives to improve early infant diagnosis (EID) have emerged. However, implementation of evidence-based practices may not always be achieved. In our formative assessment of EID services in Blantyre in 2020, various factors contributed to low uptake of EID services. We therefore set out to evaluate the effectiveness and acceptability of an enhanced health system (EEHS) strategy among postnatal women in primary care clinics in Malawi to improve uptake of EID.

Method This is an embedded mixed-method, with a before and after design. Consultative sessions with stakeholders guided the EEHs intervention, which will be evaluated for effectiveness and acceptability. Here, we present the formative process of co-designing the Intervention. We had seven meetings with policy experts and Program Managers. A two-day consultation session guided by the Behaviour Change Wheel model, was conducted and included twenty primary and secondary stakeholders.

Results In preparation for the workshop, stakeholder mapping, networking, workshop logistics, planning for power dynamics, authorization and invitations for attendees were important. During the workshop, we discussed findings from our formative study and stakeholders’ experiences with EID services. The main problems identified were: inadequate coordination among HCWs and HEIs enrollment and HIV testing. The underlying reasons were: Insufficient team work among HCWs; failure to identify and track HEIs; and returning HEIs without HIV tests due to point of care equipment capacity limitations. The use of unique labels to identify HEIs, active screening, a booking system for point-of-care HIV testing and an equipped focal person were proposed as key components of the EEHs intervention.

Conclusion To establish context-appropriate interventions, extensive stakeholder consultation is required.

Stakeholder consultation helps to better understand the system and its context, which is necessary for co-designing appropriate interventions. The effectiveness and acceptability of EEHs intervention will be assessed.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 84

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Melissa Taylor Community views on mass drug administration for filariasis: a qualitative evidence synthesis

Background The World Health Organization (WHO) recommends mass drug administration (MDA), regular delivery of drugs to a whole population, as part of the strategy for several disease control programmes in low‐ and middle‐income countries.

MDA is currently WHO policy for areas endemic with lymphatic filariasis, which is a parasitic disease that can result in swollen limbs and disability. The success depends on communities adhering to the drugs given, and this will be influenced by the perception of the drug, the programme, and those delivering it.

Methods This review synthesized qualitative research and mixed‐methods studies exploring community experiences and perceptions towards MDA programmes for lymphatic filariasis, in any country, between 2000 and 2019. We conducted a thematic analysis and developed codes inductively using ATLAS.ti software. We examined codes for underlying ideas, connections, and interpretations and, from this, generated analytical themes.

Main results We synthesised 29 studies covering a broad range of countries in Africa, South‐East Asia, and South America. Four themes emerged: • • • •

People weigh up benefits and harms before participating Many people are suspicious of MDA programmes Programmes expect compliance, and this can become coercive and blaming Community distributors are often not respected or valued.

Conclusions Adherence is determined by individual, social, political and historical influences.

Fear of adverse effects was frequently described and this appears to be particularly important for communities. When views were negative, we were surprised by the strength of feeling expressed. Enthusiasm for these schemes as a strategy in global policy needs debate in the light of these findings.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 86

Community views on mass drug administration for filariasis BACKGROUND • Mass drug administration (MDA) involves the regular delivery of drugs to a whole population, and is part of the strategy for several disease control programmes in low- and middle-income countries.

Taylor M, Thomas R, Oliver S, Garner P. Community views on mass drug administration for filariasis: a qualitative evidence synthesis. Cochrane Database of Systematic Reviews 2022, Issue 2. Art. No.: CD013638. DOI: 10.1002/14651858.CD013638.pub2.

• MDA is currently WHO policy for areas endemic with lymphatic filariasis, which is a parasitic disease that can result in swollen limbs and disability.

• The success depends on communities adhering to the drugs given, and this will be influenced by the perception of the drug, the programme, and those delivering it.

STUDY AIM • In this synthesis of qualitative research, we aimed to explore people's views on MDA programmes for treating lymphatic filariasis in low- and middle-income countries.

METHODS INCLUSION CRITERIA • This review synthesized qualitative research and mixed-methods • studies exploring community experiences and perceptions towards MDA programmes for lymphatic filariasis, in any country, between 2000 and 2019. We identified 29 studies covering a broad range of countries in Africa, South-East Asia, and South America

QUALITATIVE SYNTHESIS METHODS We conducted a thematic analysis and developed codes inductively using ATLAS.ti software. We examined codes for underlying ideas, connections, and interpretations and, from this, generated analytical themes. We produced a conceptual model to display our findings.

RESULTS MANY PEOPLE ARE SUSPICIOUS OF MDA PROGRAMMES. When people lack a scientific explanation for the programme and their experiences of it, they often develop social explanations instead.

These are largely shaped on the historical backdrop and level of trust people have in relevant authority figures.

PROGRAMMES EXPECT COMPLIANCE, AND THIS CAN BECOME COERCIVE AND BLAMING. Health workers and community members stigmatize non-compliance, which can become coercive, so communities may appear to comply publicly, but privately reject treatment

HISTORICAL INFLUENCES POLITICAL INFLUENCES SOCIAL INFLUENCES

INDIVIDUAL EXPERIENCE

CONCLUSIONS •

This review describes some fundamental community concerns and suspicions, which likely provide substantive barriers to the effective delivery of MDA.

• It is likely these findings are relevant to other MDA programmes in low- to middle-income countries, including MDA for soil-transmitted helminths, schistosomiasis, onchocerciasis, or malaria and further research is urgently required.

COMMUNITY DISTRIBUTORS ARE OFTEN NOT RESPECTED OR VALUED. They have little authority, and the behaviour of some distributors damages the MDA programme's reputation. Some are not sufficiently informed, or skilled in answering community questions PEOPLE WEIGH UP BENEFITS AND HARMS BEFORE PARTICIPATING. People understand the potential benefits in terms of relief of suffering, stigma, and avoiding costs; however, these theoretical benefits do not always mesh with their experiences.

Adverse effects are frightening and unwelcome; and these effects are amplified through rumour and social media

REFERENCES Webster JP, Molyneux DH, Hotez PJ, Fenwick A. The contribution of mass drug administration to global health: past, present and future. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 2014;369(1645):20130434.

World Health Organization.Lymphatic filariasis: Global Programme to Eliminate Lymphatic Filariasis. www.who.int/news-room/fact-sheets/detail/lymphatic-filariasis (accessed 15 December 2019).

Allen T, Parker M. The 'other diseases' of the millennium development goals: rhetoric and reality of free drug distribution to cure the poor's parasites. Third World Quarterly 2011;32(1):91-117.

Melissa Taylor: melissa.taylor@lstmed.ac.uk

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Caitlin Thompson Development and evaluation of a lateral flow test for diagnosis of Crimean-Congo Haemorrhagic fever virus in humans

Introduction Crimean-Congo Haemorrhagic Fever (CCHF) is a tick-borne viral haemorrhagic fever found widespread through Africa, the Balkans, the Middle East and Asia. An estimated three billion people are at risk of infection globally with approximately 15,000 infections and 500 deaths occurring every year. CCHF is often found in rural areas that lack the infrastructure for complex nucleic acid-based testing or the high containment level required to process suspected samples. It is one of the World Health Organisation’s goals to develop and implement a point-of-care CCHF diagnostic test by 2023.

Methods Recombinant CCHF nucleoprotein was produced using a HEK293 expression system. This recombinant protein was used in a mouse model to generate antiCCHF nucleoprotein monoclonal antibodies (mAbs). Monoclonal antibodies were screened using a microarray-based surface plasmon resonance imager to obtain binding affinity and kinetics data to identify optimal anti-CCHF mAbs. Monoclonal antibodies were screened for their ability to bind to colloidal gold, the visualisation component of the lateral flow prototype. Analytical lower limit of detection was performed on the prototype lateral flow device produced.

Results/future work Forty-seven mAbs were produced from a mouse model. 1536 possible combinations of mAbs were analysed and two mAbs were identified for use in the lateral flow prototype. The analytical lower limit of detection of CCHF nucleoprotein was 1.6ng/mL. The next phase is to conduct a proof-of-concept evaluation of the CCHF lateral flow prototype in the national reference laboratory in Turkey using serum samples from patients with suspected CCHF viral infection to obtain sensitivity and specificity data.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 88

Development and evaluation of a lateral flow test for diagnosis of CrimeanCongo Haemorrhagic Fever Virus in humans Caitlin Thompson Supervisors – Dr Emily Adams, Dr Ana Cubas Atienzar, Dr Tom Fletcher

Introduction

Results

• Crimean-Congo Haemorrhagic Fever (CCHF) is a tick-borne viral haemorrhagic fever found widespread through Africa, the Balkans, the Middle East and Asia.

• CCHF is often found in rural areas that lack the infrastructure for nucleic acid-based testing or the high containment level required to process suspected samples [1].

• CCHF is considered a high priority pathogen according to the World Health Organisation’s R&D Blueprint and it is a strategic goal to develop and introduce rapid, point-of-care diagnostic tests to CCHF-affected countries by 2023.

• Rapid diagnostic tests such as lateral flow devices are an ideal screening method for field testing in low infrastructure settings and have been successfully used to screen and triage suspected high-risk cases of diseases such as Ebola and Dengue [2,3].

1. Recombinant CCHF nucleoprotein produced.

2. Generation of 47 monoclonal antibodies targeting the CCHF nucleoprotein.

kDa 198 98

62 49 38 28 17 14

Figure 1. A Western Blot experiment shows recombinant expression of CCHF nucleoprotein at ~54kDa produced from a HEK293 protein expression system.

Methods

Figure 2. Screening of 47 mouse-model produced monoclonal antibodies (mAbs) plus 1 commercial (NAC) monoclonal antibody (position D12) using a microarray-based surface plasmon resonance imager to obtain binding affinity and kinetics data of antiCCHF mAbs to CCHF nucleoprotein. Each graph corresponds to binding data of a single anti-CCHF nucleoprotein mAb to CCHF nucleoprotein over time.

3. Optimal anti-CCHF nucleoprotein monoclonal antibody pair chosen from 1584 possible combinations.

B A

1. Recombinant CCHF nucleoprotein antigen was produced using a Human Embryonic Kidney Expression System (HEK293).

2. A mouse model was used to generate an array of anti-CCHF nucleoprotein monoclonal antibodies (NP-mAbs).

3. Anti-CCHF NP-mAbs were screened using a microarray-based surface plasmon resonance imager to obtain binding affinity and kinetics data to identify optimal anti-CCHF NP-mAbs. 4. Optimal ‘pairs’ (mAbs with different CCHFnucleoprotein binding epitopes) were identified from binding affinity and kinetics data.

5. Analytical lower limit of detection was performed on the prototype lateral flow test produced.

6. An initial sensitivity experiment was conducted using CCHF RT-PCR positive and negative inactivated serum samples.

Bins

33

48

14

46

26

39

40

30

27

32

18

6

41

8

19

20

3

37

45

34

44

25

43

42

28

21

31

47

24

29

38

23

9

35

15

36

12

10

22

16

11

5

4

2

7

17

13

ID

1

Bins

30 716.30 699.04 697.08 687.07 685.05 678.25 673.75 668.43 660.50 655.66 652.08 649.23 628.28 617.92 616.66 615.75 597.07 595.45 591.79 589.38 589.04 583.26 563.63 562.49 552.97 546.36 537.29 535.32 524.62 510.94 505.05 502.78 466.52 386.65 369.09 351.98 304.21 297.48 292.34 284.24 283.62 282.29 280.38 279.27 271.42 266.75 244.06 237.58 43 714.47 665.66 654.72 648.79 689.14 635.23 627.71 585.94 623.71 595.64 401.32 622.30 537.87 542.85 528.66 528.10 498.34 484.96 353.84 482.37 469.28 352.42 537.68 519.97 324.65 318.98 510.64 310.03 477.37 297.32 453.69 460.27 396.36 343.17 555.70 451.48 551.09 493.19 457.81 459.88 448.73 431.74 437.35 449.93 401.60 371.66 194.07 210.03 41 634.54 566.07 559.54 564.22 608.56 547.57 555.07 535.94 532.79 520.46 535.71 529.00 473.60 498.87 464.98 493.54 466.41 451.33 467.99 459.10 437.53 460.86 431.95 429.32 424.28 415.10 416.00 396.17 395.63 367.94 375.32 367.30 329.50 273.49 428.10 280.00 426.67 244.25 235.54 228.48 235.24 229.58 225.74 315.39 215.47 227.07 170.35 176.94 47 589.87 437.71 433.10 437.47 617.94 588.19 429.37 415.96 414.03 408.67 584.86 412.18 378.51 399.51 377.77 398.07 379.19 375.57 514.38 372.77 362.51 543.41 522.77 530.51 477.74 488.20 513.63 461.51 490.51 458.50 468.03 345.87 364.74 327.83 527.39 512.58 517.42 502.23 490.27 481.25 475.26 472.08 474.33 449.86 451.78 356.70 221.08 222.01 10 526.91 514.80 515.99 488.24 508.83 477.10 470.42 459.15 486.23 482.41 312.49 475.59 460.76 420.73 450.20 401.24 399.38 419.87 293.37 389.57 417.32 291.56 428.14 426.12 279.32 274.15 416.66 269.75 400.64 261.37 386.69 339.90 314.00 270.47 417.13 393.70 410.96 390.38 384.34 377.80 371.96 370.59 376.08 366.95 356.85 291.88 176.65 176.43 21 502.87 560.65 551.92 569.50 448.14 337.78 558.47 545.64 514.41 507.23 548.63 503.71 457.76 496.17 449.24 506.02 461.40 441.23 453.80 454.00 425.92 460.01 223.09 227.42 424.02 409.45 224.53 387.29 206.58 386.08 198.01 373.14 312.17 262.67 249.37 431.18 247.68 423.62 400.58 394.03 388.49 373.84 373.37 369.51 349.93 263.56 154.00 163.10 42 484.03 458.87 451.96 442.78 464.07 417.81 425.83 399.16 426.54 412.11 286.92 423.44 377.74 377.14 369.68 361.64 343.28 341.90 252.61 337.66 333.11 251.06 353.87 347.15 231.17 227.74 339.82 220.38 318.61 211.43 303.59 300.17 261.96 223.70 367.04 307.55 364.05 328.62 310.34 310.00 302.35 291.83 294.47 299.82 271.48 241.68 130.53 139.20 26 473.94 460.64 459.68 452.68 447.95 478.67 442.05 438.49 429.96 423.14 426.68 422.48 408.71 400.81 404.01 405.36 388.94 381.63 375.33 382.56 380.27 377.26 374.62 361.31 351.80 345.19 353.06 333.42 336.45 331.99 327.13 361.16 319.74 263.33 206.95 325.60 205.08 360.98 344.13 339.16 185.59 260.46 316.92 185.04 268.79 171.66 149.11 148.53 18 459.35 398.10 391.33 393.18 436.26 364.23 385.64 365.38 365.59 357.46 371.09 360.61 323.41 343.86 316.81 338.88 317.32 307.33 319.82 311.14 301.53 310.74 284.44 283.51 291.04 280.06 274.44 266.19 260.41 249.63 247.33 234.89 205.10 153.05 278.78 188.59 276.88 164.33 156.12 154.58 163.24 146.60 144.44 231.16 137.97 165.69 109.07 117.45 38 451.07 276.31 258.03 304.20 456.86 395.29 306.23 261.78 240.89 218.86 328.11 253.34 175.09 232.08 171.91 254.60 194.77 160.35 198.57 187.13 151.26 194.26 223.14 196.96 147.43 141.13 204.90 136.81 163.80 129.54 149.04 230.04 155.57 146.53 309.16 161.28 319.27 225.33 172.94 179.75 172.14 144.44 145.08 171.18 124.73 175.57

66.34

71.64

29 421.97 253.23 226.49 324.53 399.94 322.08 316.23 249.98 220.11 190.71 173.96 246.15 113.28 209.57 110.42 224.60 149.12 101.07

29.05

40.38

97.73

142.55

87.23

106.48 150.16 116.77

51.88

26.02

126.72

52.15

87.83

59.88

74.72

223.52

91.27

85.89

244.49

73.02

261.46 153.02

92.09

106.26

99.35

71.15

71.48

103.87

55.00

129.88

7 417.20 288.00 279.60 300.68 434.82 418.86 297.10 277.13 261.65 248.75 404.27 267.59 211.14 252.70 209.33 267.30 226.33 201.17 283.99 221.40 187.89 301.09 308.01 288.28 240.50 239.82 288.55 213.89 248.54 227.29 230.97 330.81 221.77 206.23 368.15 253.07 373.36 311.45 262.78 268.42 256.96 231.50 234.61 254.46 207.19 231.84 100.82 111.14 34 396.06 417.72 408.37 429.38 348.72 265.13 424.19 401.82 375.23 373.63 407.80 368.37 333.20 366.00 325.51 371.80 330.25 319.00 326.37 325.53 311.89 330.65 158.83 161.58 299.08 286.17 159.94 269.42 146.34 268.49 139.50 253.55 216.05 172.56 182.49 296.00 180.13 292.68 276.42 272.58 268.42 254.74 253.32 246.17 237.46 186.33 104.07 107.44 31 369.32 383.32 391.73 355.87 355.86 323.63 335.63 340.24 358.51 374.55 246.52 345.85 375.26 319.90 362.45 298.67 314.82 351.95 334.32 308.25 365.69 253.41 317.90 333.87 251.53 248.64 316.88 327.22 322.91 235.60 313.97 226.99 239.05 200.78 295.96 333.20 286.32 305.39 312.68 302.69 294.61 311.70 314.07 288.86 304.23 204.04 148.86 140.85 19 343.32 364.84 368.97 358.66 328.76 377.49 350.36 358.26 347.63 354.78 319.22 345.65 361.99 333.32 366.31 335.05 327.19 351.53 308.73 324.53 349.72 314.85 320.46 317.53 302.83 308.85 300.48 305.39 299.68 300.47 288.48 335.46 299.81 131.18 316.62 364.63 311.83 305.72 320.48 308.29 315.60 308.85 308.29 309.93 303.38 237.88 138.18 131.78 11 332.23 255.15 257.57 249.33 342.17 318.76 245.69 236.96 238.90 237.74 312.34 232.57 226.51 226.57 220.38 223.05 213.46 216.69 282.42 215.33 218.91 292.58 273.44 278.14 261.59 256.52 267.87 252.01 260.86 249.92 251.98 186.94 184.67 164.42 268.68 278.88 262.47 258.59 259.63 253.24 251.46 251.73 252.99 232.27 244.63 179.86 119.78 114.05 5 269.88 186.52 180.34 194.67 272.42 243.91 190.95 176.43 166.35 158.18 238.11 170.76 133.91 160.51 132.29 169.55 142.52 123.74 161.82 138.97 119.52 168.04 164.06 155.12 139.72 135.09 156.84 120.69 133.92 128.73 123.75 185.38 114.98 104.33 203.59 141.49 206.64 166.34 140.77 143.05 137.40 125.83 124.80 134.26 111.23 123.68

53.98

58.94

36 256.48 190.44 187.82 193.61 266.43 271.60 192.04 185.80 177.34 170.43 299.29 181.92 150.88 173.43 150.34 177.76 154.53 145.79 193.47 155.27 139.04 244.60 221.14 217.96 218.31 213.92 214.23 172.51 196.71 200.23 186.60 137.55 164.78 152.66 247.12 217.81 243.88 222.26 206.95 206.99 203.83 191.35 193.23 195.97 180.63 161.70 44 232.43 165.87 153.28 195.68 220.85 187.00 187.35 147.81 127.97 111.32 111.99 138.32

80.16

88.91

76.00

85.09

69.50

43.76

40.62

73.86

39.29

56.66

50.80

50.17

144.49

50.19

54.38

141.68

41.28

71.94

24.92

25.80

4 205.49 211.60 207.74 214.07 188.95 151.80 210.91 200.54 191.61 189.03 197.98 190.47 169.46 186.52 166.50 190.95 169.26 158.66 163.24 168.23 155.03 159.44

81.32

70.51

147.59 138.47

81.21

132.30

69.93

131.73

70.38

127.63 105.04

90.33

102.54 149.99 102.29 142.96 135.43 135.71 136.15 125.94 125.67 127.42 116.84

99.15

54.74

57.87 59.25

87.22

118.24

83.54

141.07

94.58

73.73

59.08

91.37

72.80

53.37

154.34

88.68

60.35

66.48

62.77

49.55

50.73

63.34

13 190.19 142.00 141.89 142.24 191.47 184.95 141.57 135.31 133.95 132.20 188.33 131.81 121.69 126.81 120.59 128.15 120.33 117.55 143.55 116.55 115.55 163.07 149.74 148.72 150.15 148.82 149.17 128.56 138.00 141.79 132.89

94.67

112.38 106.66 159.99 156.20 159.13 149.17 142.15 139.95 139.10 134.80 135.85 134.13 129.16 104.44

57.96

17 180.95 118.30 113.15 126.06 176.41 162.67 124.41 108.55 101.03

95.30

147.55 107.82

79.33

99.08

77.42

108.05

83.22

70.53

83.64

83.18

69.33

92.24

95.49

86.00

74.71

72.94

89.02

59.83

73.67

67.96

67.91

86.64

73.32

72.61

131.26

77.73

134.20

99.39

78.23

81.55

78.60

67.60

67.20

79.12

59.47

74.76

26.84

35 144.67

94.40

89.39

99.92

142.97 138.67

98.60

87.62

81.81

76.64

130.59

84.58

68.10

79.93

67.17

86.47

66.29

58.25

73.76

65.84

60.99

86.03

82.90

77.56

72.30

69.42

77.87

58.03

68.88

64.96

63.34

72.98

64.62

65.68

112.30

72.83

118.15

83.96

70.39

74.38

72.09

62.89

63.57

72.54

57.60

63.14

27.03

25 125.32

89.49

82.82

99.54

102.76

69.37

100.50

76.77

65.96

58.76

63.54

66.87

61.46

75.73

51.87

31.46

47.92

22.89

17.25

21.01

73.74

25.45

22.51

36.43

41.21

34.87

25.76

24.85

24.86

23.76

28 124.44

91.47

87.71

98.07

101.92

66.68

96.22

75.94

68.15

60.68

61.93

70.25

62.64

75.26

52.86

31.85

51.33

22.83

19.52

21.34

70.99

24.45

22.66

33.80

38.97

32.52

26.74

25.42

24.20

24.17

37 103.91

76.53

71.95

84.14

85.90

58.75

83.59

65.10

56.00

50.91

54.46

58.79

53.63

65.74

44.25

63.28

21.07

18.69

29.66

34.00

28.86

24 94.06

71.12

70.57

71.22

94.52

93.97

69.08

64.10

66.53

62.16

95.50

65.60

58.42

60.66

56.95

62.94

56.16

53.07

67.98

56.38

55.52

77.38

70.42

69.46

68.53

67.16

68.59

60.08

63.35

62.61

59.99

47.89

52.19

50.40

78.06

68.17

79.41

70.80

63.88

64.71

63.18

60.24

61.18

60.87

55.73

49.97

30.45

28.29

14 93.14

99.51

103.67

87.43

87.27

77.68

85.04

82.05

85.00

86.71

77.30

83.00

88.05

79.74

85.20

78.87

76.39

80.66

73.27

74.43

83.96

67.11

55.04

55.74

70.10

65.78

54.20

63.53

54.15

62.67

51.23

55.06

48.08

32.31

32.94

12.49

33.84

36.66

52.59

54.79

28.56

5.72

34.51

29.22

7.81

28.37

28.14

25.57

15 83.38

65.10

65.33

63.65

81.56

77.83

61.23

58.76

58.08

57.84

77.85

58.22

54.35

55.68

53.79

57.50

51.68

51.31

62.48

50.96

51.49

65.00

58.76

58.25

57.00

56.34

58.09

50.79

52.08

52.92

50.27

62.27

43.53

42.41

64.10

60.30

65.77

57.29

54.97

53.54

53.67

51.79

50.78

49.19

48.50

39.59

25.99

23.40

23 82.75

66.04

67.82

62.90

83.64

82.62

61.33

61.05

61.34

58.44

89.08

59.63

58.21

56.84

56.79

57.59

54.09

54.27

67.67

55.37

57.33

78.55

68.95

68.45

72.26

71.12

67.59

64.06

63.59

67.20

63.07

44.40

50.47

50.56

72.57

72.05

75.55

66.06

65.47

66.71

65.62

63.84

62.66

61.24

59.47

45.24

31.63

28.91

40 58.45

44.05

30.45

22 57.34

45.20

29.75

30.26

29.81

53.80

61.97

24.83

26.07

25.66

26.66

23.41

23.91

27.24

22.91

17.90

9.33

8.79

3 33.34

15.24

14.20

61.25

56.77

31.41

14.87

18.88

26.41

31.21 29.93

11.61

20.40

38.77 41.14 19.96

17.52

58.37

35.48

18.73

13.95

37.20

15.46

16.90

13.51

10.80

29.07

15.27

24.30

27.34

28.00

25.95

25.51

25.42

24.49

25.29

21.96

25.17

22.01

12.22

17.63 26.85

26.87

32.35

29.15

32.96

Figure 3. Identification of anti-CCHF nucleoprotein monoclonal antibodies (mAbs) that have optimal binding capacity to different CCHF nucleoprotein epitopes. (A) A heat map of binding affinity and kinetics data of 1584 possible mAb pairings. Green is optimal, Red is suboptimal. (B) A network plot of anti-CCHF nucleoprotein mAbs. Lines between mAbs indicate suitable pairs.

4. Prototype lateral flow test developed with an analytical lower limit of CCHF 5. Initial sensitivity experiment on CCHF RT-PCR confirmed inactivated nucleoprotein detection of 1.6ng/mL. serum samples.

B

A

B

A

CCHF NP Lateral Flow Prototype. Mean±SD;n=2 300

250

C

200

Cube Units

CCHF Positive Inactive Serum Samples 10 150

9

Prototype 1

8

Prototype Test Line Value

7 100

50

6 5 4 3 2 1 0

0

0.01

0.1

1

10

100

20

22

24

26

28

Figure 4. Prototype development using 2 anti-CCHF nucleoprotein monoclonal antibodies in a lateral flow device. (A) A picture of prototype CCHF lateral flow tests for analytical lower limit of detection. Visual reading of a positive result is a single red line. From left to right, CCHF nucleoprotein in a 5 fold serial dilution from 1µg/mL to 0.06ng/mL and a negative (no CCHF nucleoprotein added). Experiment conducted in duplicate. (B) Standard curve of Mean±SD;n=2.

Next Steps

30

32

34

36

38

40

Ct Value

1000

[CCHF NP] ng/ml

Linear (Prototype 1)

Figure 5. Prototype tested on 20 inactivated CCHF positive serum samples and 10 CCHF negative serum samples as a negative control. (A) A picture of a selection of positive CCHF prototype devices. (B) A picture of a selection of negative CCHF prototype devices. (C) Scatter graph to show quantitative prototype test line value (0-10) plotted against CCHF positive RT-PCR Ct values.

References

1. Mazzola LT, Kelly-Cirino C. Diagnostic tests for Crimean-Congo haemorrhagic

1. Conduct a robust sensitivity experiment on inactivated CCHF positive serum samples available from UKHSA. 2. Conduct a proof-of-concept evaluation of the CCHF lateral flow prototype in the national reference laboratory in Turkey using serum samples from patients with suspected CCHF viral infection to obtain sensitivity and specificity data.

fever: a widespread tickborne disease. BMJ Glob Health 2019;4:e001114. doi:10.1136/ bmjgh-2018-001114

2. Shukla MK, Singh N, Sharma RK, Barde PV. Utility of dengue NS1 antigen rapid diagnostic test for use in difficult to reach areas and its comparison with dengue NS1 ELISA and qRT-PCR. J Med Virol. 2017 Jul;89(7):1146-1150. doi: 10.1002/jmv.24764.

Epub 2017 Feb 27. PMID: 28042883.

3. Boisen ML et al. Field Validation of the ReEBOV Antigen Rapid Test for Point-ofCare Diagnosis of Ebola Virus Infection. J Infect Dis. 2016 Oct 15;214(suppl 3):S203S209. doi: 10.1093/infdis/jiw261. Epub 2016 Aug 11. PMID: 27521365; PMCID: PMC5050478.

Correspondence - Caitlin.Thompson@lstmed.ac.uk

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Chukwuebuka Ugwu Development and evaluation of gender-sensitive TB interventions for Nigerian Communities

Introduction Up until the advent of the COVID-19 pandemic, Tuberculosis reigned as the most lethal single infectious agent globally accounting for 1.4 million deaths in 2019. Nigeria harbours the highest TB burden on the continent of Africa, and ranks 6th among the 8 countries that account for over two-thirds of all TB cases globally. Also, 70% of all newly occurring TB cases in the country missed out on treatment in 2020. Tb burden in Nigeria is also highly gendered: mean have twice the burden in women, suffer more delays in accessing care, and constitute two-thirds of the missing TB cases. Evidence on approaches to TB case finding that can overcome the gendered access is crucial but thin.

Supervisors Dr Tom Wingfield, Professor Bertie Squire and Dr John Bimba

Methods This research adopts a multi-methods approach ranging from a qualitative exploration of the gender-related factors affecting access, to conducting a scoping literature review to identify the gender-specific effects of TB interventions in LMICs, and Co-creation of a gender-sensitive TB intervention with stakeholders.

Finally, the intervention so-created will be trialed in an implementationeffectiveness hybrid trial to determine its usefulness for the context.

Results We hope to gain a richer understanding of the gender-related factors affecting access and how they interact in our context. Armed with this as well as findings from literature, we will co-create a bespoke gender-sensitive TB intervention and finally demonstrate its effectiveness in our setting.

Conclusion Unmitigated TB burden amongst men has implications for perpetuating TB transmission to women and children within the households. We hope that evidence from this research will contribute to local and global policy change and research uptake.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 90

Development and Evaluation of gender Sensitive TB Interventions for community settings in Nigeria (DESTINE) Title: Development and evaluation of gender-sensitive TB interventions for Nigerian Communities.

Author: Chukwuebuka Ugwu

Introduction Up until the advent of COVID-19, Tuberculosis reigned as the most lethal single infectious agent globally accounting for 1.4 million deaths in 2019.

Nigeria harbours the highest TB burden on the continent of Africa, and ranks 6th among the 8 countries that account for over two-thirds of all TB cases globally.

Exploring the gender-related factors affecting access to TB care – Qualitative research

Synthesize literature on the gender-specific effects of intervention – Scoping review

Co-creation of a gender sensitive contextual TB case finding intervention – Consensus building

Also, 70% of all newly occurring TB cases in the country missed out on treatment in 2020.

Evaluating the effectiveness of the gender-sensitive interventions in our setting – ImplementationEffectiveness Hybrid trial

TB burden in Nigeria is also highly gendered: • • •

Men have twice the burden in Women (57% vs 32%), suffer more delays in accessing care (PN 7.25 vs 4.63), and constitute two-thirds of the missing people with TB (2.21 vs 1).

Evidence on approaches to TB case finding that can overcome the gendered access is crucial but thin.

Results We hope to gain a richer understanding of the gender-related factors affecting access and how they interact in our context. Armed with this as well as findings from literature, we will co-create a bespoke gender-sensitive TB intervention and finally demonstrate its effectiveness in our setting.

Methods This research adopts a multi-methods approach ranging from a qualitative exploration of the gender-related factors affecting access to TB care, to conducting a scoping literature review to identify the gender-specific effects of TB interventions in LMICs, and Co-creation of a gender-sensitive TB intervention with stakeholders.

Finally, the intervention so-created will be trialed in an implementation-effectiveness hybrid trial to determine its usefulness for the context.

Conclusion Unmitigated TB burden amongst men has implications for perpetuating TB transmission to women and children within the households. We hope that evidence from this research will contribute to local and global policy change and research uptake.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Anna Wickenden The impact of the COVID-19 pandemic on public health programs in a fragile state: A case study analysis of the impact of COVID-19 on the implementation of the Integrated Neglected Tropical Disease Policy in Liberia

Introduction/background In 2019, the Liberia NTD Program was coming to the end of the first phase of implementation of an innovative model for NTD care. Concurrently, the COVID-19 pandemic was beginning to unfold globally with profound consequences for global health and access to routine health services. The aim of this study is to explore the impact of the COVID-19 pandemic on the implementation of the Integrated Neglected Tropical Disease Policy in Liberia.

Methods The study will use a single case study research design and will be an in-depth investigation into policy development and health system adaptation in its real-life context through the integrated NTD case management model in Liberia. We will use primary data from key informant interviews and participatory workshops and secondary data analysis. The study has three strands: a policy analysis of the Integrated NTD Policy; an analysis of the impact of COVID-19 and an empirical process to test the findings of the analysis in other West and Central African NTD Programs.

Results The results will describe the history and implementation of the Integrated NTD Policy in Liberia prior to COVID-19, explore how the implementation of the Integrated NTD Policy has been impacted by COVID-19 and test the relevance and generalisability of the case to other settings in West and Central Africa.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 92

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Murielle Wondji Investigation of the role of ATP Binding Cassette (ABC’s) transporters in insecticide resistance in a field population of Anopheles funestus from Cameroon Abstract Vector control remains the cornerstone in the fight against Malaria. Resistance to most classes of insecticides has been reported with the main mechanism described being increased metabolism or detoxification. In An. funestus, characterizing genes from Phase I (P450s) and Phase II (GSTs) metabolism enzymes has seen a boom, whereas little is known of the contribution of Phase III (ABC transporters) in resistance. We hypothesized they might play a role as linked to resistance due to over-expression.

Field collection of blood-feed female Anopheles was done in Elende locality in Cameroon. After being identified as An. funestus s.s., eggs were obtained from gravid female by force eggs lay. Hatched eggs reared for bioassays. Initial assessment of the toxicity was done for pyrethroids: Permethrin, Deltamethrin and Alphacypermethrin, synergists: Verapamil, Quinine and Quinidine, by exposing larvae to various concentrations. Synergists bioassays were then conducted using LC10 and LC20 for insecticides, with a minimum of 4 replicates of 25 L3/earlyL4 larvae. Adult bioassays were conducted according to WHO protocol with 0.5% concentration of the synergists.

No mortality was observed neither with the solvent nor the synergists. The best combination synergist-insecticide with more than 40% recovery was 0.025ppm of the synergist, with LC10 and LC20 calculated, of each insecticide. The population was found to be more resistant (45% mortality) to type 2 pyrethroids, and more than 85% with synergist.

Greater synergistic effect of the Verapamil was observed with type II pyrethroids notably, Deltamethrin and Alphacypermethrin in Elende, prompting the need for more investigation with transcriptomic studies.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 94

Investigation of the role of ATP Binding Cassette (ABC’s) transporters in insecticide resistance in a field population of Anopheles funestus from Cameroon

Murielle Wondji, Mark Paine, Suleiman Ibrahim

Introduction

Vector control remains the gold standard in the fight against Malaria in Africa. This relies on the use of insecticides for IRS and LLINs It is under threat of insecticide resistance

Problem statement

In An. funestus the role of Phase I (P450s) and Phase II metabolism ( GSTs) in resistance is well defined, but not ABC transporters

Phase I Phase II Phase III

FIG.1 Number of insecticide classes to which resistance was confirmed in at least one malaria vector in at least one monitoring site, 2010–2019 Source: national health institutes, national implementation partners, NMPs, research institutions and scientific publications (WHO,2020)

Rationale: Implicated in Phase III metabolism : efflux pumps link to xenobiotic transport. In multi drug resistance: detoxification as reduced intracellular accumulation of drugs

Objectives: 1: Investigate the role of ABC transporters in insecticides resistance in the field population of An. funestus 2: Assess changes in expression of ABC transporters in relation to pyrethroid resistance

Aim: To establish the contribution of ABC transporters in insecticide resistance in An. funestus.

3: Validation of the role of ABC transporters using in vivo (RNAi and GAL/UAS transgenesis) and in vitro (protein expression coupled with assays of activities) approaches.

Methodology

RNA-Seq Reanalysis

RNA Extraction

WHO larval and adult bioassays

qRT-PCR of candidate ABCs Functional Characterization of ABCs Amplification and sequences analysis of ABCs/genetic diversity across Africa Analysis of non-coding promoter region of ABCs

Preliminary Results • Field collection in Elende, locality near Yaoundé Cameroon, • blood fed females Anopheles funestus • Rear in the lab • Bioassays tests following the WHO protocol for larval and adults’ mosquitoes

4: Detect genetic variants associated with ABC transporter-based resistance to design DNA-based diagnostic tools

DNA Extraction

Species Identification

in vitro: protein expressions (Baculovirus) and activity assays: (i)membrane-vesicle transports assay (ii)ATPase assay: ATPase hydrolyzing activity of allelic variants of ABCs

i.

Resistance genes allelic variants

ABC transporters structure ATP powered , ubiquitous transporters

ii.

Resistance markers iii.

Creation of DNA diagnostic tests

in vivo: (i) transgenesis (GAL4-UAS): ABCs into Drosophila and screening of resistance with insecticides (ii) RNA interference: knocking down of ABCs in An. funestus and screening of resistance with insecticides

(Wu et al 2019)

2Trans-membranes Domains (TMD) 2 nucleotide binding Domains(NBD)

Future Work: RT-qPCR 100

Synergist bioassays

90

% Mortality

Study Site Field Collected Mosquitoes

100

80

90

70

80

60

70 60

50

50

40

40

30

30 20

20

10 0

10 Perm 0.75%

Crtl

Verap

Verap+ Perm

Quinin

Quinin + Perm Insecticide

Quinid

Quinid+ Perm

Delta

Verap + Delta

0

Synergist bioassays with adults mosquitoes for Deltamethrin and Alphacypermethrin

Permethrin 0.75% Verapamil +Perm 0.75% Alphacypermethrin 0.05% Permethrin + Quinine Permethrin + Quinidine Deltamethrin 0.05% Verapamil + Deltamethrin 0.05% Verapamil +Alphacypermethrin 0.05% Deltamethrin 0.05% + Quinine Alphacypermethrin 0.05% + quinine Deltamethrin 0.05 + quinidine Alphacypermethrin 0.05% + quinidine Alphacypermethrin 0.05% + verapamil

Selection of the more common differential expressed ABC’s was done by comparing Expression level , F and P-value from RNASeq analysis to move forward with transcriptional studies and subsequent validation steps

Mortalities significantly increased from 47% in 0.05% deltamethrin exposure to 85% in verapamil plus 0.05% deltamethrin exposure.

References : Bhatt, S., Weiss, D. J., Cameron, E., Bisanzio, D., Mappin, B., Dalrymple, U., & Gething, P. W. (2015). The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015. Nature, 526(7572), 207-211.

Mugenzi LMJ, Menze BD, Tchouakui M, et al. Cis-regulatory CYP6P9b P450 variants associated with loss of insecticide-treated bed net efficacy against Anopheles funestus. Nat Commun. 2019; 10(1):4652. Published 2019 Oct 11. doi: 10.1038/s41467-019-12686-5 World Health Organization. (2016). Test procedures for insecticide resistance monitoring in malaria vector mosquitoes.

LSTM PGR Student Conference 2022 #lstmpgrconf2022

Xiaohan Xu 2-h Postprandial Blood Glucose Lower Than Fasting Blood Glucose in China

Background Usually blood glucose levels found when someone has fasted (fasting blood glucose) are lower than blood glucose levels in the hours after eating a meal (postprandial blood glucose). However, postprandial blood glucose (PBG) levels less than fasting blood glucose (FBG) can be found in some cases.

Method It is a cross-sectional analysis of data collected from a multi-centre, multi-ethnic, noninterventional study in China [the National Key R&D Program of China (2016YFC1305700)].

Haematology tests, biochemistry examination, sociodemographic data and anthropometric data were evaluated in participants.

Continuous variables were described as means (± SD) or median (interquartile range) and categorical data are presented as numbers and percentages. Statistical differences in quantitative data were determined using Student’s t-test and Welch’s t-test. Qualitative data were compared using the chi-squared test or Fisher’s exact test. All statistical analyses were 2-sided and performed with SAS version 9.4 (SAS Institute Inc). Results were considered significant when the P-value was less than 0.05.

Results A total of 16,116 adults [mean age: 49.95±11.82 years old; 5,481 males(34.01%); mean BMI:25.07±3.86 kg/m2] were included. The prevalence of PBG≤FBG was 24.13% (n=3,889) and PBG>FBG was 75.87%(n=12,227).

Comparing participants in PBG>FBG group, participants in PBG≤FBG group have lower FBG (5.53±0.88 vs 5.70±1.28, P<0.000), PBG (4.64±0.91 vs 8.03±3.13, P<0.000) and HbA1c(5.33±0.52 vs 5.55±0.83, P<0.000).

In logistic regression analyses PBG≤FBG was associated with younger age, lower BMI, lower blood pressure, higher HDL cholesterol levels and lower triglycerides levels . People with PBG≤FBG were more likely to have impaired fasting glucose (FBG: 6.1-6.9mmol/L) compared with people with PBG>FBG (all P<0.05).

Conclusion PBG less than or equal to FBG is a phenomenon that is not readily apparent in clinical care as it has to be specifically tested for. The relationship between this phenomenon and progression to prediabetes or diabetes disease still needs to be explored.

To listen to the student’s accompanying poster pitch audio, click the button below which will open up a new browser tab:

POSTER PITCH AUDIO 96

2-h Postprandial Blood Glucose Lower Than Fasting Blood Glucose in China Xiaohan Xu 373006@lstmed.ac.uk Supervisor: Dr. Anupam Garrib; Prof. Shabbar Jaffar; Prof. Duolao Wang Clinical Sciences, Liverpool School of Tropical Medicine Introduction

Method

Background Usually blood glucose levels found when someone has fasted (fasting blood glucose) are lower than blood glucose levels in the hours after eating a meal (postprandial blood glucose). However, postprandial blood glucose (PBG) levels less than fasting blood glucose (FBG) can be found in some cases.

Aims This study aims to describe the prevalence, clinical characteristics, and contributing risk factors for PBG≤FBG.

A nationwide cohort study was conducted in China [the National Key R&D Program of China] aimed at determining optimal diagnostic cut-off points for type 2 diabetes in a multiethnic Chinese population.

Sociodemographic and anthropometric data, as well as blood haematology Fig 1. Provinces from which and biochemistry tests were collected. subjects were selected Continuous variables were described as means (± SD) or median (interquartile range) and categorical data are presented as numbers and percentages. Statistical differences in quantitative data were determined using Student’s t-test and Welch’s t-test.

Qualitative data were compared using the chi-squared test or Fisher’s exact test. All statistical analyses were 2-sided and performed with SAS version 9.4 (SAS Institute Inc). Results were considered significant when the P-value was less than 0.05.

Results A total of 16,116 adults [mean age: 49.95±11.82 years old; 10,635 females(65.99%); mean BMI:25.07±3.86 kg/m2] were included. The prevalence of PBG≤FBG was 24.13% (n=3,889) and PBG>FBG was 75.87%(n=12,227).

The participants were divided into two groups as determined by the 75-gram oral glucose tolerance test.

Compared to participants in PBG>FBG group, participants in PBG≤FBG group have lower FBG (5.53±0.88 vs 5.70±1.28, P<0.000), PBG (4.64±0.91 vs 8.03±3.13, P<0.000) and HbA1c(5.33±0.52 vs 5.55±0.83, P<0.000).

In logistic regression analyses PBG≤FBG was associated with younger age, lower BMI, lower blood pressure, higher HDL cholesterol levels and lower triglycerides levels. People with PBG≤FBG were more likely to have impaired fasting glucose (FBG: 6.1-6.9mmol/L) compared with people with PBG>FBG (all P<0.05).

Mean (SD)

All (n=16,116) Age(years) 49.95±11.82 Female; n(%) 10,635(65.99%) BMI(kg/m2) 25.07±3.86 FBG 5.66±1.20 PBG 7.21±3.12 HbA1c 5.50±0.77 Hypoglycaemia; n (%) 127(0.79%)

PBG≤FBG (n=3,889) 46.83±12.75 2,185(56.18%) 24.23±3.67 5.53±0.88 4.64±0.91 5.33±0.52 86(2.21%)

PBG>FBG (n=12,227) 50.93±11.33 8,450(69.11%) 25.34±3.88 5.70±1.28 8.03±3.13 5.55±0.83 41(0.34%)

P-value <0.000 <0.001 <0.000 <0.000 <0.000 <0.000 <0.001

Fig 2. The proportion of each status The proportion of each status was categorised by WHO diagnostic criteria(1999). The fasting blood glucose (FBG) of normoglycaemia people has been set at 3.9–6.1 mmol/L and the 2h-postprandial blood glucose at 7.8 mmol/L or less; Impaired fasting glucose(IFG) was defined as an FBG of equal or greater than 6.1 mmol/L and less than 7.0 mmol/L, and PBG at 120 min after oral glucose loading less than 7.8 mmol/L; Impaired glucose tolerance(IGT) was defined as an FBG of less than 6.1 mmol/L, and PBG at 120 min after oral glucose loading of equal or greater than 7.8 mmol/L and less than 11.1 mmol/L; Patients with typical symptoms of diabetes (polyuria, polydipsia and unexplained weight loss) who have arbitrary blood glucose≥11.1 mmol/L, FBG≥7.0 mmol/L or 2hpostprandial blood≥11.1 mmol/L, which means diabetes can be diagnosed; Diagnosed: according to participants self-report with history of diabetes. *P <0.05.

Conclusion PBG less than or equal to FBG is a phenomenon that is not readily apparent in clinical care as it has to be specifically tested for. The relationship between this phenomenon and progression to prediabetes or diabetes disease still needs to be explored.

LSTM PGR Student Conference 2022

Mailing address Liverpool School of Tropical Medicine Pembroke Place Liverpool L3 5QA Copyright © 2022, Liverpool School of Tropical Medicine. All rights reserved.