Issue 2
June 2014
40 TL
ISSN 1300-7777
Volume 31
Review Article Recommendations for the Treatment of Invasive Fungal Infections in Hematological Malignancies: A Critical Review of Evidence and Expert Opinion (TEO-1) Hamdi Akan, et al.; Ankara, İstanbul, Bursa, Edirne, Turkey
Research Articles sEPCR Levels in Chronic Myeloproliferative Diseases and Their Association with Thromboembolic Events: A Case-Control Study Figen Atalay, et al.; İstanbul, Ankara, Turkey
Prognostic Significance of the Lymphoblastic Leukemia-Derived Sequence 1 (LYL1) Gene Expression in Egyptian Patients with Acute Myeloid Leukemia Nadia El-Menshawy, et al.; Mansoura, Egypt
Local Renin-Angiotensin System in Normal Hematopoietic and Multiple Myeloma-Related Progenitor Cells Burak Uz, et al.; Ankara, İstanbul, Turkey
Wilms Tumor 1 Gene Mutations in Patients with Cytogenetically Normal Acute Myeloid Leukemia Salah Aref, et al.; Mansoura, Egypt
Assessment of Cytokine Expression Profile in Acute Myeloid Leukemia Patients Before and After Chemotherapy Zargham Sepehrizadeh, et al.; Tehran, Iran
Investigation of Epstein-Barr Virus and Parvovirus B19 DNA in Allogeneic Stem Cell Transplant Patients Altay Atalay, et al; Kayseri, Turkey
Determination of Rate and Causes of Wastage of Blood and Blood Products in Iranian Hospitals Rafat Mohebbi Far, et al; Qazvin, Iran
The Functional Significance of the Rho/Rho-Kinase Pathway in Human Erythrocytes R. Nalan Tiftik, et al; Mersin, İstanbul, Gaziantep, Turkey
Cover Picture: Hale Ören Uzungöl, Trabzon
2
Editor-in-Chief
International Review Board
Aytemiz Gürgey
Nejat Akar Görgün Akpek Serhan Alkan Çiğdem Altay Koen van Besien Ayhan Çavdar M.Sıraç Dilber Ahmet Doğan Peter Dreger Thierry Facon Jawed Fareed Gösta Gahrton Dieter Hoelzer Marilyn Manco-Johnson Andreas Josting Emin Kansu Winfried Kern Nigel Key Korgün Koral Abdullah Kutlar Luca Malcovati Robert Marcus Jean Pierre Marie Ghulam Mufti Gerassimos A. Pangalis Antonio Piga Ananda Prasad Jacob M. Rowe Jens-Ulrich Rüffer Norbert Schmitz Orhan Sezer Anna Sureda Ayalew Tefferi Nükhet Tüzüner Catherine Verfaillie Srdan Verstovsek Claudio Viscoli
TOBB Economy Technical University Hospital, Ankara, Turkey Maryland School of Medicine, Baltimore, USA Cedars-Sinai Medical Center, USA Ankara, Turkey Chicago Medical Center University, Chicago, USA Ankara, Turkey Karolinska University, Stockholm, Sweden Mayo Clinic Saint Marys Hospital, USA Heidelberg University, Heidelberg, Germany Lille University, Lille, France Loyola University, Maywood, USA Karolinska University Hospital, Stockholm, Sweden Frankfurt University, Frankfurt, Germany Colorado Health Sciences University, USA University Hospital Cologne, Cologne, Germany Hacettepe University, Ankara, Turkey Albert Ludwigs University, Germany University of North Carolina School of Medicine, NC, USA Southwestern Medical Center, Texas, USA Georgia Health Sciences University, Augusta, USA Pavia Medical School University, Pavia, Italy Kings College Hospital, London, UK Pierre et Marie Curie University, Paris, France King’s Hospital, London, UK Athens University, Athens, Greece Torino University, Torino, Italy Wayne State University School of Medicine, Detroit, USA Rambam Medical Center, Haifa, Israel University of Köln, Germany AK St Georg, Hamburg, Germany Memorial Şişli Hospital, İstanbul, Turkey Santa Creu i Sant Pau Hospital, Barcelona, Spain Mayo Clinic, Rochester, Minnesota, USA Istanbul Cerrahpaşa University, İstanbul, Turkey University of Minnesota, Minnesota, USA The University of Texas MD Anderson Cancer Center, Houston, USA San Martino University, Genoa, Italy
Past Editors Erich Frank Orhan Ulutin Hamdi Akan
Language Editor Leslie Demir
Ankara, Turkey
Associate Editors Ayşegül Ünüvar İstanbul University, İstanbul, Turkey
Celalettin Üstün University of Minnesota, Minnesota, USA
Cem Ar İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey
Cengiz Beyan Gulhane Military Medical Academy, Ankara, Turkey
Hale Ören Dokuz Eylül University, İzmir, Turkey
İbrahim Haznedaroğlu Hacettepe University, Ankara, Turkey
İlknur Kozanoğlu Başkent University, Adana, Turkey
Mehmet Ertem Ankara University, Ankara, Turkey
A. Muzaffer Demir Trakya University, Edirne, Turkey
Reyhan Diz Küçükkaya İstanbul Bilim University, İstanbul, Turkey
Assistant Editors A. Emre Eşkazan İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey
Ali İrfan Emre Tekgündüz Dr. A. Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey
İnci Alacacıoğlu Dokuz Eylul University, Ankara, Turkey
Nil Güler On Dokuz Mayıs University, Samsun, Turkey
Olga Meltem Akay Osmangazi University, Eskişehir, Turkey
Selami Koçak Toprak Ankara University, Ankara, Turkey
Şule Ünal Hacettepe University, Ankara, Turkey
Veysel Sabri Hançer
Statistic Editor Hülya Ellidokuz
Senior Advisory Board Yücel Tangün Osman İlhan Muhit Özcan
İstanbul Bilim University, İstanbul, Turkey
Zühre Kaya Gazi University, Ankara, Turkey
A-I
Publishing Services
Editorial Office İpek Durusu Bengü Timoçin
GALENOS PUBLISHER Molla Gürani Mah. Kaçamak Sk. No: 21, Fındıkzade-İstanbul, Türkiye Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr
Contact Information Editorial Correspondence should be addressed to Dr. Aytemiz Gürgey Editor-in-Chief Address: 725. Sok. Görkem Sitesi Yıldızevler No: 39/2, 06550 Çankaya, Ankara / Turkey Phone : +90 312 438 14 60 E-mail : agurgey@hacettepe.edu.tr
All other inquiries should be adressed to TURKISH JOURNAL OF HEMATOLOGY Address: İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550 Çankaya, Ankara / Turkey Phone : +90 312 490 98 97 Fax : +90 312 490 98 68 E-mail : info@tjh.com.tr ISSN: 1300-7777
Turkish Society of Hematology
Publishing Manager Sorumlu Yazı İşleri Müdürü
Teoman Soysal, President A. Muzaffer Demir, General Secretary Hale Ören, Vice President İbrahim Haznedaroğlu, Research Secretary Fahir Özkalemkaş, Treasurer Zahit Bolaman, Member Mehmet Sönmez, Member
A. Muzaffer Demir
Management Address Yayın İdare Adresi
Türk Hematoloji Derneği İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550 Çankaya, Ankara / Turkey
Publishing House / Yayınevi
Online Manuscript Submission
Molla Gürani Mah. Kaçamak Sk. No: 21, 34093 Fındıkzade, İstanbul, Turkey Tel: +90 212 621 99 25 Faks: +90 212 621 99 27 E-posta: info@galenos.com.tr Baskı: Senk Ofset Matbaacılık Reklam Promosyon ve Tan. Hiz. San. Dış. Tic. Ltd. Şti. Tel.: +90 212 493 26 26 Topkapı Litros yolu, No: 24, Zeytinburnu, İstanbul, Turkey
http://mc.manuscriptcentral.com/tjh
Web page www.tjh.com.tr
Owner on behalf of the Turkish Society of Hematology Türk Hematoloji Derneği adına yayın sahibi Teoman Soysal
Printing Date / Basım Tarihi 25.05.2014
Cover Picture
Hale Ören was born in 1962, Turkey. She is currently working at Dokuz Eylül University, Department of Pediatric Hematology, İzmir, Turkey Üç ayda bir yayımlanan İngilizce süreli yayındır. International scientific journal published quarterly. Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish Journal of Hematology’nin Türk Hematoloji Derneği İktisadi İşletmesi tarafından yayınlanmasına karar vermiştir.
A-II
AIMS AND SCOPE The Turkish Journal of Hematology is published quarterly (March, June, September, and December) by the Turkish Society of Hematology. It is an independent, non-profit peer-reviewed international English-language periodical encompassing subjects relevant to hematology. The Editorial Board of The Turkish Journal of Hematology adheres to the principles of the World Association of Medical Editors (WAME), International Council of Medical Journal Editors (ICMJE), Committee on Publication Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and Strengthening the Reporting of Observational Studies in Epidemiology (STROBE). The aim of The Turkish Journal Hematology is to publish original hematological research of the highest scientific quality and clinical relevance. Additionally, educational material, reviews on basic developments, editorial short notes, case reports, images in hematology, and letters from hematology specialists and clinicians covering their experience and comments on hematology and related medical fields as well as social subjects are published. General practitioners interested in hematology and internal medicine specialists are among our target audience, and The Turkish Journal of Hematology aims to publish according to their needs. The Turkish Journal of Hematology is indexed, as follows: - PUBMED Central - Science Citation Index Expanded - EMBASE - Scopus - CINAHL - Gale/Cengage Learning - EBSCO - DOAJ - ProQuest - Index Copernicus - Tübitak/Ulakbim Turkish Medical Database - Turk Medline
Impact Factor: 0.494 Subscription Information
The Turkish Journal of Hematology is sent free-of-charge to members of Turkish Society of Hematology and libraries in Turkey and abroad. Hematologists, other medical specialists that are interested in hematology, and academicians could subscribe for only 40 $ per printed issue. All published volumes are available in full text free-ofcharge online at www.tjh.com.tr. Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh Web page: www.tjh.com.tr E-mail: info@tjh.com.tr
A-III
Permissions
Requests for permission to reproduce published material should be sent to the editorial office. Editor: Professor Dr. Aytemiz Gürgey Adress: Ilkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh Web page: www.tjh.com.tr E-mail: info@tjh.com.tr Publisher Galenos Yayinevi Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul Telephone : 0212 621 99 25 Fax : 0212 621 99 27 info@galenos.com.tr
Instructions for Authors Instructions for authors are published in the journal and at www. tjh.com.tr
Material Disclaimer Authors are responsible for the manuscripts they publish in The Turkish Journal of Hematology. The editor, editorial board, and publisher do not accept any responsibility for published manuscripts. The journal is printed on acid-free paper.
Editorial Policy Following receipt of each manuscript, a checklist is completed by the Editorial Assistant. The Editorial Assistant checks that each manuscript contains all required components and adheres to the author guidelines, after which time it will be forwarded to the Editor in Chief. Following the Editor in Chief’s evaluation, each manuscript is forwarded to the Associate Editor, who in turn assigns reviewers. Generally, all manuscripts will be reviewed by at least three reviewers selected by the Associate Editor, based on their relevant expertise. Associate editor could be assigned as a reviewer along with the reviewers. After the reviewing process, all manuscripts are evaluated in the Editorial Board Meeting. Turkish Journal of Hematology’s editor and Editorial Board members are active researchers. It is possible that they would desire to submit their manuscript to the Turkish Journal of Hematology. This may be creating a conflict of interest. These manuscripts will not be evaluated by the submitting editor(s). The review process will be managed and decisions made by editor-in-chief who will act independently. In some situation, this process will be overseen by an outside independent expert in reviewing submissions from editors.
TURKISH JOURNAL OF HEMATOLOGY INSTRUCTIONS TO AUTHORS The Turkish Journal of Hematology accepts invited review articles, research articles, brief reports, case reports, letters to the editor, and hematological images that are relevant to the scope of hematology, on the condition that they have not been previously published elsewhere. Basic science manuscripts, such as randomized, cohort, cross-sectional, and case control studies, are given preference. All manuscripts are subject to editorial revision to ensure they conform to the style adopted by the journal. There is a single blind kind of reviewing system. Manuscripts should be prepared according to ICMJE guidelines (http://www.icmje.org/). Original manuscripts require a structured abstract. Label each section of the structured abstract with the appropriate subheading (Objective, Materials and Methods, Results, and Conclusion). Case reports require short unstructured abstracts. Letters to the editor do not require an abstract. Research or project support should be acknowledged as a footnote on the title page. Technical and other assistance should be provided on the title page.
Conflict-of-Interest Statement: To prevent potential conflicts of interest from being overlooked, this statement must be included in each manuscript. In case there are conflicts of interest, every author should complete the ICMJE general declaration form, which can be obtained at: http://www.icmje.org/coi_disclose.pdf. Abstract and Keywords: The second page should include an abstract that does not exceed 300 words. For manuscripts sent by authors in Turkey, a title and abstract in Turkish are also required. As most readers read the abstract first, it is critically important. Moreover, as various electronic databases integrate only abstracts into their index, important findings should be presented in the abstract. Objective: The abstract should state the objective (the purpose of the study and hypothesis) and summarize the rationale for the study. Materials and Methods: Important methods should be written respectively. Results: Important findings and results should be provided here. Conclusion: The study’s new and important findings should be highlighted and interpreted.
Original Manuscripts Title Page Title: The title should provide important information regarding the manuscript’s content. The title must specify that the study is a cohort study, cross-sectional study, case control study, or randomized study (i.e. Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability of ferrous succinate tablet formulations without correction for baseline circadian changes in iron concentration in healthy Chinese male subjects: A single-dose, randomized, 2-period crossover study. Clin Ther. 2011; 33: 2054-2059). The title page should include the authors’ names, degrees, and institutional/professional affiliations, a short title, abbreviations, keywords, financial disclosure statement, and conflict of interest statement. If a manuscript includes authors from more than one institution, each author’s name should be followed by a superscript number that corresponds to their institution, which is listed separately. Please provide contact information for the corresponding author, including name, e-mail address, and telephone and fax numbers. Running Head: The running head should not be more than 40 characters, including spaces, and should be located at the bottom of the title page. Word Count: A word count for the manuscript, excluding abstract, acknowledgments, figure and table legends, and references, should be provided not exceed 2500 words. The word count for an abstract should be not exceed 300 words.
A-IV
Other types of manuscripts, such as case reports, reviews, perspectives, and editorials, will be published according to uniform requirements. Provide 3-10 keywords below the abstract to assist indexers. Use terms from the Index Medicus Medical Subject Headings List (for randomized studies a CONSORT abstract should be provided (http://www.consort-statement.org). Introduction: The introduction should include an overview of the relevant literature presented in summary form (one page), and what ever remains interesting, unique, problematic, relevant, or unknown about the topic must be specified. The introduction should conclude with the rationale for the study, its design, and its objective(s). Materials and Methods: Clearly describe the selection of observational or experimental participants, such as patients, laboratory animals, and controls, including inclusion and exclusion criteria and a description of the source population. Identify the methods and procedures in sufficient detail to allow other researchers to reproduce your results. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for using them and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. The section should include only information that was available at the time the plan or protocol for the study was devised (http://www.strobe-statement.org/fileadmin/ Strobe/uploads/checklists/STROBE_checklist_v4_combined.pdf).
Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported results. Statistically important data should be given in the text, tables and figures. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present your results in logical sequence in the text, tables, and figures. Do not present all the data provided in the tables and/or figures in the text; emphasize and/or summarize only important findings, results, and observations in the text. For clinical studies provide the number of samples, cases, and controls included in the study. Discrepancies between the planned number and obtained number of participants should be explained. Comparisons, and statistically important values (i.e. P value and confidence interval) should be provided. Discussion: This section should include a discussion of the data. New and important findings/results, and the conclusions they lead to should be emphasized. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by the data. Do not repeat the findings/results in detail; important findings/results should be compared with those of similar studies in the literature, along with a summarization. In other words, similarities or differences in the obtained findings/results with those previously reported should be discussed. Limitations of the study should be detailed. In addition, an evaluation of the implications of the obtained findings/results for future research should be outlined.
4. Book Chapter Perutz MF. Molecular anatomy and physiology of hemoglobin. In: Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin: Genetics, Pathophysiology, Clinical Management. New York, Cambridge University Press, 2000. 5.Abstract Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract). 6.Letter to the Editor Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further definition of 20q deletion in myeloid leukemia using fluorescence in situ hybridization. Blood 1994;84:2821-2823. 7. Supplement Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant. 2005;9(Suppl 7):81-86
Brief Reports
Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow transplantation from unrelated donors for patients with aplastic anemia after failure immunosuppressive therapy. Blood 2006;108:1485-1491.
Abstract length: Not to exceed 300 words. Article length: Not to exceed 1200 words. Introduction: State the purpose and summarize the rationale for the study. Materials and Methods: Clearly describe the selection of the observational or experimental participants. Identify the methods and procedures in sufficient detail. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for their use and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported findings/results. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present the findings/results in a logical sequence in the text, tables, and figures. Do not repeat all the findings/results in the tables and figures in the text; emphasize and/or summarize only those that are most important. Discussion: Highlight the new and important findings/results of the study and the conclusions they lead to. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by your data.
2.Organization as author
Case Reports
Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of syngeneic bone marrow graft without preconditioning in posthepatitis marrow aplasia. Lancet 1977;2:742-744.
Abstract length: Not to exceed 300 words. Article length: Not to exceed 1200 words.
3.Book
Abstract
References Cite references in the text, tables, and figures with numbers in parentheses. Number references consecutively according to the order in which they first appear in the text. Journal titles should be abbreviated according to the style used in Index Medicus (consult List of Journals Indexed in Index Medicus). Include among the references any paper accepted, but not yet published, designating the journal and followed by, in press.
Examples of References: 1. List all authors.
Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.
A-V
Case reports should be structured as follows: An unstructured abstract that summarizes the case.
Introduction: A brief introduction (recommended length: 1-2 paragraphs). Case Presentation: This section describes the case in detail, including the initial diagnosis and outcome. Discussion:This section should include a brief review of the relevant literature and how the presented case furthers our understanding to the disease process.
Invited Review Articles Abstract length: Not to exceed 300 words. Article length: Not to exceed 4000 words. Review articles should not include more than 100 references. Reviews should include a conclusion, in which a new hypothesis or study about the subject may be posited. Do not publish methods for literature search or level of evidence. Authors who will prepare review articles should already have published research articles on therel evant subject. The study’s new and important findings should be highlighted and interpreted in the Conclusion section. There should be a maximum of two authors for review articles.
Images in Hematology Article length: Not exceed 200 words. Authors can submit for consideration an illustration and photos that is interesting, instructive, and visually attractive, along with a few lines of explanatory text and references. Images in Hematology can include no more than 200 words of text, 5 references, and 3 figure or table. No abstract, discussion or conclusion are required but please include a brief title.
Authorship Each author should have participated sufficiently in the work to assume public responsibility for the content. Any portion of a manuscript that is critical to its main conclusions must be the responsibility of at least 1 author.
Contributor’s Statement All submissions should contain a contributor’s statement page. Each manuscript should contain substantial contributions to idea and design, acquisition of data, or analysis and interpretation of findings. All persons designated as an author should qualify for authorship, and all those that qualify should be listed. Each author should have participated sufficiently in the work to take responsibility for appropriate portions of the text.
Acknowledgments Acknowledge support received from individuals, organizations, grants, corporations, and any other source. For work involving a biomedical product or potential product partially or wholly supported by corporate funding, a note stating, “This study was financially supported (in part) with funds provided by (company name) to (authors’ initials)”, must be included. Grant support, if received, needs to be stated and the specific granting institutions’ names and grant numbers provided when applicable. Authors are expected to disclose on the title page any commercial or other associations that might pose a conflict of interest in connection with the submitted manuscript. All funding sources that supported the work and the institutional and/or corporate affiliations of the authors should be acknowledged on the title page.
Ethics
Letters to the Editor Article length: Not to exceed 500 words. Letters can include no more than 500 words of text, 5-10 references, and 1 figure or table. No abstract is required, but please include a brief title.
Tables Supply each table on a separate file. Number tables according to the order in which they appear in the text, and supply a brief caption for each. Give each column a short or abbreviated heading. Write explanatory statistical measures of variation, such as standard deviation or standard error of mean. Be sure that each table is cited in the text.
Figures Figures should be professionally drawn and/or photographed. Authors should number figures according to the order in which they appear in the text. Figures include graphs, charts, photographs, and illustrations. Each figure should be accompanied by a legend that does not exceed 50 words. Use abbreviations only if they have been introduced in the text. Authors are also required to provide the level of magnification for histological slides. Explain the internal scale and identify the staining method used. Figures should be submitted as separate files, not in the text file. High-resolution image files are not preferred for initial submission as the file sizes may be too large. The total file size of the PDF for peer review should not exceed 5 MB.
A-VI
When reporting experiments conducted with humans indicate that the procedures were in accordance with ethical standards set forth by the committee that oversees human experimentation. Approval of research protocols by the relevant ethics committee, in accordance with international agreements (Helsinki Declaration of 1975, revised 2002 available at http://www.wma.net/e/policy/b3.htm, “Guide for the Care and use of Laboratory Animals” www.nap.edu/catalog/5140. html/), is required for all experimental, clinical, and drug studies. Patient names, initials, and hospital identification numbers should not be used. Manuscripts reporting the results of experimental investigations conducted with humans must state that the study protocol received institutional review board approval and that the participants provided informed consent. Non-compliance with scientific accuracy is not in accord with scientific ethics. Plagiarism: To re-publish-whole or in part-the contents of another author’s publication as one’s own without providing a reference. Fabrication: To publish data and findings/results that do not exist. Duplication: Use of data from another publication, which includes re-publishing a manuscript in different languages. Salamisation: To create more than one publication by dividing the results of a study preternaturally.
We disapprove of such unethical practices as plagiarism, fabrication, duplication, and salamisation, as well as efforts to influence the review process with such practices as gifting authorship, inappropriate acknowledgements, and references. Additionally, authors must respect participant right to privacy. On the other hand, short abstracts published in congress books that do not exceed 400 words and present data of preliminary research, and those that are presented in an electronic environment are not accepted pre-published work. Authors in such situation must declare this status on the first page of the manuscript and in the cover letter. (The COPE flowchart is available at: http://publicationethics.org) We use iThenticate to screen all submissions for plagiarism before publication. Turkish Journal of Hematology uses plagiarism screening service to verify the originality of content submitted before publication.
Conditions of Publication All authors are required to affirm the following statements before their manuscript is considered: 1. The manuscript is being submitted only to The Turkish Journal of Hematology; 2. The manuscript will not be submitted elsewhere while under consideration by The Turkish Journal of Hematology; 3. The manuscript has not been published elsewhere, and should it be published in The Turkish Journal of Hematology it will not be published elsewhere without the permission of the editors (these restrictions do not apply to abstracts or to press reports for presentations at scientific meetings); 4. All authors are responsible for the manuscript’s content; 5. All authors participated in the study concept and design, analysis and interpretation of the data, drafting or revising of the manuscript, and have approved the manuscript as submitted. In addition, all authors are required to disclose any professional affiliation, financial agreement, or other involvement with any company whose product figures prominently in the submitted manuscript. Authors of accepted manuscripts will receive electronic page proofs and are responsible for proofreading and checking the entire article within two days. Failure to return the proof in two days will delay publication. If the authors cannot be reached by email or telephone within two weeks, the manuscript will be rejected and will not be published in the journal.
Copyright At the time of submission all authors will receive instructions for submitting an online copyright form. No manuscript will be considered for review until all authors have completed their copyright form. Please note, it is our practice not to accept copyright forms via fax, e-mail, or postal service unless there is a problem with the online author accounts that cannot be resolved. Every effort should be made to use the online copyright system. Corresponding authors can log in to the submission system at any time to check the status of any co-author’s copyright form. All accepted manuscripts become the permanent property of The Turkish Journal of Hematology and may not be published elsewhere-in whole or in part-without written permission. Note: We cannot accept any copyright that has been altered, revised, amended, or otherwise changed. Our original copyright form must be used as is.
A-VII
Units of Measurement Measurements should be reported using the metric system, according to the International System of Units (SI). Consult the SI Unit Conversion Guide, New England Journal of Medicine Books, 1992. An extensive list of conversion factors can be found at http://www. unc.edu/~rowlett/units/scales/clinical_data.html. For more details, see http://www.amamanualofstyle.com/oso/public/jama/si_conversion_ table.html . Example for CBC.
Hematology component
SI units
RBC
6.7-11 x 1012/L
WBC
5.5-19.5 x109/L
Hemoglobin
116-168 g/L
PCV
0.31-0.46 L/L
MCV
39-53 fL
MCHC
300-360 g/L
MCH
19.5-25 pg
Platelets
300-700 x 109/L
Source: http://www.vetstream.com/felis/Corporate/993fhtm/ha-mat.htm
Abbreviations and Symbols Use only standard abbreviations. Avoid abbreviations in the title and abstract. The full term for an abbreviation should precede its first use in the text, unless it is a standard abbreviation. All acronyms used in the text should be expanded at first mention, followed by the abbreviation in parentheses; thereafter the acronym only should appear in the text. Acronyms may be used in the abstract if they occur 3 or more times therein, but must be reintroduced in the body of the text. Generally, abbreviations should be limited to those defined in the AMA Manual of Style, current edition. A list of each abbreviation (and the corresponding full term) used in the manuscript must be provided on the title page.
Online Manuscript Submission Process The Turkish Journal of Hematology uses submission software powered by ScholarOne Manuscripts. The website for submissions to The Turkish Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This system is quick and convenient, both for authors and reviewers.
Setting up an account New users to the submission site will need to register and enter their account details before they can submit a manuscript. Log in, or click the “Create Account” button if you are a first-time user. To create a new account: After clicking the “Create Account” button, enter your name and e-mail address, and then click the “Next” button. Your
e-mail address is very important. Enter your institution and address information, as appropriate, and then click the “Next” Button. Enter a user ID and password of your choice, select your area of expertise, and then click the “Finish” button. If you have an account, but have forgotten your log-in details, go to “Password Help” on the journal’s online submission system and enter your e-mail address. The system will send you an automatic user ID and a new temporary password. Full instructions and support are available on the site, and a user ID and password can be obtained during your first visit. Full support for authors is provided. Each page has a “Get Help Now” icon that connects directly to the online support system. Contact the journal administrator with any questions about submitting your manuscript to the journal (info@tjh.com.tr). For ScholarOne Manuscripts customer support, click on the “Get Help Now” link on the top right hand corner of every page on the site.
The Electronic Submission Process Log in to your author center. Once you have logged in, click the “Submit a Manuscript” link in the menu bar. Enter the appropriate data and answer the questions. You may copy and paste directly from your manuscript. Click the “Next” button on each screen to save your work and advance to the next screen.
Upload Files Click on the “Browse” button and locate the file on your computer. Select the appropriate designation for each file in the drop-down menu next to the “Browse” button. When you have selected all the files you want to upload, click the “Upload Files” button. Review your submission before sending to the journal. Click the “Submit” button when you are finished reviewing. You can use ScholarOne Manuscripts at any time to check the status of your submission. The journal’s editorial office will inform you by e-mail once a decision has been made. After your manuscript has been submitted, a checklist will then be completed by the Editorial Assistant. The Editorial Assistant will check that the manuscript contains all required components and adheres to the author guidelines. Once the Editorial Assistant is satisfied with the manuscript it will be forwarded to the Senior Editor, who will assign an editor and reviewers.
The Review Process Each manuscript submitted to The Turkish Journal of Hematology is subject to an initial review by the editorial office in order to determine if it is aligned with the journal’s aims and scope, and complies with essential requirements. Manuscripts sent for peer review will be assigned to one of the journal’s associate editors that has expertise relevant to the manuscript’s content. All manuscripts are single-blind peer reviewed. All accepted manuscripts are sent to a statistical and English language editor before publishing. Once papers have been reviewed, the reviewers’ comments are sent to the Editor, who will then make a preliminary decision on the paper. At this stage, based on the feedback from reviewers, manuscripts can be accepted, rejected, or revisions can be recommended. Following initial peer-review, articles
A-VIII
judged worthy of further consideration often require revision. Revised manuscripts generally must be received within 3 months of the date of the initial decision. Extensions must be requested from the Associate Editor at least 2 weeks before the 3-month revision deadline expires; The Turkish Journal of Hematology will reject manuscripts that are not received within the 3-month revision deadline. Manuscripts with extensive revision recommendations will be sent for further review (usually by the same reviewers) upon their re-submission. When a manuscript is finally accepted for publication, the Technical Editor undertakes a final edit and a marked-up copy will be e-mailed to the corresponding author for review and to make any final adjustments.
Submission of Revised Papers When revising a manuscript based on the reviewers’ and Editor’s feedback, please insert all changed text in red. Please do not use track changes, as this feature can make reading difficult. To submit revised manuscripts, please log into your author center at ScholarOne Manuscripts. Your manuscript will be stored under “Manuscripts with Decisions”. Please click on the “Create a Revision” link located to the right of the manuscript title. A revised manuscript number will be created for you; you will then need to click on the “Continue Submission” button. You will then be guided through a submission process very similar to that for new manuscripts. You will be able to amend any details you wish. At stage 6 (“File Upload”), please delete the file for your original manuscript and upload the revised version. Additionally, please upload an anonymous cover letter, preferably in table format, including a point-by-point response to the reviews’ revision recommendations. You will then need to review your paper as a PDF and click the “Submit” button. Your revised manuscript will have the same ID number as the original version, but with the addition of an R and a number at the end, for example, TJH-2011-0001 for an original and TJH-2011-0001.R1, indicating a first revision; subsequent revisions will end with R2, R3, and so on. Please do not submit a revised manuscript as a new paper, as revised manuscripts are processed differently. If you click on the “Create a Revision” button and receive a message stating that the revision option has expired, please contact the Editorial Assistant at info@tjh.com.tr to reactivate the option.
English Language Editing All manuscripts are professionally edited by an English language editor prior to publication.
Online Early The Turkish Journal of Hematology publishes abstracts of accepted manuscripts online in advance of their publication in print. Once an accepted manuscript has been edited, the authors have submitted any final corrections, and all changes have been incorporated, the manuscript will be published online. At that time the manuscript will receive a Digital Object Identifier (DOI) number. Both forms can be found at www.tjh.com.tr. Authors of accepted manuscripts will receive electronic page proofs directly from the printer, and are responsible for proofreading and checking the entire manuscript, including tables, figures, and references. Page proofs must be returned within 48 hours to avoid delays in publication.
CONTENTS
Review Article
111
Recommendations for the Treatment of Invasive Fungal Infections in Hematological Malignancies: A Critical Review of Evidence and Expert Opinion (TEO-1) Hamdi Akan, Şeniz Öngören Aydın, Neşe Saltoğlu, Atahan Çağata, Halis Akalın, Mutlu Arat, Rıdvan Ali, Sevgi Kalayoğlu-Beşışık, A. Muzaffer Demir
121
Research Articles
128
Prognostic Significance of the Lymphoblastic Leukemia-Derived Sequence 1 (LYL1) Gene Expression in Egyptian Patients with Acute Myeloid Leukemia Nadia El-Menshawy, Doaa Shahin, Hayam Fathi Ghazi
136
Local Renin-Angiotensin System in Normal Hematopoietic and Multiple Myeloma-Related Progenitor Cells Burak Uz, Suzin Çatal Tatonyan, Müge Sayitoğlu, Yücel Erbilgin, Özden Hatırnaz, Salih Aksu, Yahya Büyükaşık, Nilgün Sayınalp, Hakan Göker, Osman İ. Özcebe, Uğur Özbek, İbrahim C. Haznedaroğlu
143
Wilms Tumor 1 Gene Mutations in Patients with Cytogenetically Normal Acute Myeloid Leukemia Salah Aref, Solafa El Sharawy, Mohamed Sabry, Emad Azmy, Dalia Abdel Raouf, Nadia El Menshawy
149
Assessment of Cytokine Expression Profile in Acute Myeloid Leukemia Patients Before and After Chemotherapy Zargham Sepehrizadeh, Mohammad Mohammadi, Amirhossein Emami, Mojtaba Tabatabaei Yazdi, Saeed Hashemi Bozchlou, Mohammad Reza Khorramizadeh, Mina Bahrololoumi Shapourabadi, Elham Jaberi, Naghmeh Rajaei, Neda Setayesh
155
Investigation of Epstein-Barr Virus and Parvovirus B19 DNA in Allogeneic Stem Cell Transplant Patients Altay Atalay, Selma Gökahmetoğlu, Süleyman Durmaz, İdris Kandemir, Derya Sağlam, Leylagül Kaynar, Bülent Eser, Mustafa Çetin, Hüseyin Kılıç
161
Determination of Rate and Causes of Wastage of Blood and Blood Products in Iranian Hospitals Rafat Mohebbi Far, Fatemeh Samiee Rad, Zahra Abdolazimi, Mohamad Mehdi Daneshi Kohan
168
The Functional Significance of the Rho/Rho-Kinase Pathway in Human Erythrocytes R. Nalan Tiftik, Oğuz K. Başkurt, Seval Kul, Kansu Büyükafşar
Case Reports
175
Gelatinous Marrow Transformation: A Series of 11 Cases from a Tertiary Care Centre in South India Sreeya Das, Pritinanda Mishra, Rakhee Kar, Debdatta Basu
180
Use of MSCs to Modulate Immune Suppression and Immune Reconstruction in a Patient with Aplastic Anemia Complicated by Invasive Sino-Orbital Aspergillosis Hakan Özdoğu, Mahmut Yeral, Can Boğa, İlknur Kozanoğlu
184
A Case Associated with Comorbidities Among Cerebral Infarction, Idiopathic Thrombocytopenic Purpura, and Triple X Syndrome Hanjun Kim, Sang Sun Hwang, Young Uh, Juwon Kim, Kap Jun Yoon, Ji-Yong Lee
sEPCR Levels in Chronic Myeloproliferative Diseases and Their Association with Thromboembolic Events: A Case-Control Study Figen Atalay, Selami Koçak Toprak, Ebru Koca, Sema Karakuş
A-IX
188
Primary Adrenal Lymphoma Karima Kacem, Sami Zriba, Raihane Ben Lakhal, Walid Bouteraa, Lamia Aissaoui, Ramzi Ben Amor, Yosr Ben Abdennebi, Zaher Belhadj Ali, Hela Ben Abid, Balkis Meddeb
192
Letters to the Editor
194
The Treatment of Acquired Hemophilia with Combination Therapy of Immunosuppressives and Immunoadsorption Aynur Uğur Bilgin, Muhit Özcan, Erol Ayyıldız, Osman İlhan
197
The Role of Radiotherapy Among the Therapeutic Options for Castleman’s Disease Feryal Karaca, Çiğdem Usul Afşar, Erkut Erkurt, Hasan Suat Arslantaş, Elif Çalış, Berna Totan Ateş, Emine Bağır, Melek Ergin, Semra Paydaş
199
The Relationship Between Hematological Findings and Coronary Artery Aneurysm in Kawasaki Disease Burçin Beken, Şule Ünal, Mualla Çetin, Fatma Gümrük
201
An Unusual Cause of Thigh Swelling: Extramedullary Myeloid Tumor Memiş Hilmi Atay, Engin Kelkitli, Piltan Büyükkaya, Kubilay Ekiz, Levent Yıldız, Mehmet Turgut
203
Isolated Breast Relapse Mimicking Breast Cancer in Elderly Patient with Acute Lymphoblastic Leukemia Ajay Gogia, Prashant Mehta, Raja Pramanik, Rajive Kumar
205
Bilateral Primary Adrenal Non-Hodgkin Lymphoma Vehbi Erçolak, Oğuz Kara, Meral Günaldı, Çiğdem Usul Afşar, Berna Bozkurt Duman, Arbil Açıkalın, Melek Ergin, Şeyda Erdoğan
207
A Case of Cutaneous Diffuse Large B-cell Lymphoma Bülent Çetin, Ahmet Özet, Bülent Orhan, Tülay Tecimer
209
Images in Hematology
211
Bone Marrow Involvement of Rhabdomyosarcoma from Unknown Origin Begüm Şirin Koç, Serap Karaman, Ayşegül Ünüvar, Ezgi Uysalol, Zeynep Karakaş, Ömer Devecioğlu, Sema Anak
213
Aleukemic Leukemia Cutis: An Unusual Rash in a Child Didem Atay, Emine Türkkan, Kübra Bölük
Bone and Bone Marrow Involvement in Sarcoidosis Gökhan Sargın, İrfan Yavaşoğlu, Gürhan Kadıköylü, Zahit Bolaman
Lysosomal Vesicles, Giant Granules, and Erythrophagocytosis in Chédiak-Higashi Syndrome Burçin Beken, Şule Ünal, Fatma Gümrük
A-X
Advisory Board of This Issue (June 2014) Abdullah Demiryürek, Turkey Ahmet Emre Eşkazan, Turkey Ahmet Koç, Turkey Ahmet Muzaffer Demir, Turkey Akif Yeşilipek, Turkey Ali İrfan Emre Tekgündüz, Turkey Ayşegül Ünüvar, Turkey Aytemiz Gürgey, Turkey Bülent Eser, Turkey Bülent Kantarcıoğlu, Turkey Burhan Turgut, Turkey Cafer Adıgüzel, Turkey Cengiz Beyan, Turkey Davut Albayrak, Turkey Ebru Koca, Turkey Elif Ünal, Turkey Fahir Özkalemkaş, Turkey
Ferit Avcu, Turkey Hakan Özdoğu, Turkey Hayri Özsan, Turkey İnci Alacacıoğlu, Turkey İsmail Sarı, Turkey Iulia Ursuleac, Romania Mahmut Bayık, Turkey Mehmet Ali Özcan, Turkey Mehmet Ertem, Turkey Mine Hekimgil, Turkey Mualla Çetin, Turkey Muhlis Cem Ar, Turkey Murat Akova, Turkey Musfata Unubol, Turkey Mustafa Benekli, Turkey Mustafa Pehlivan, Turkey Nazan Özsan, Turkey
Nilgün Sayınalp, Turkey Nükhet Tüzüner, Turkey Özlem Şahin Balçık, Turkey Reyhan Diz Küçükkaya, Turkey Rukiye Ömeroğlu, Turkey Sabri Barutça, Turkey Selami Koçak Toprak, Turkey Sema Karakuş, Turkey Semra Paydaş, Turkey Sibel Göksel, Turkey Tanju Atamer, Turkey Tuğba Belgemen, Turkey Veysel Sabri Hançer, Turkey Yehuda Shoenfeld, Israel Yossef Al Tonbary, Egypt Yusuf Baran, Turkey
Review Article
DOI: 10.4274/tjh.2014.0103
Recommendations for the Treatment of Invasive Fungal Infections in Hematological Malignancies: A Critical Review of Evidence and Turkish Expert Opinion (TEO-1) Hematolojik Malignitelerde Invazif Fungal Infeksiyonların Tedavisi: Kanıtlara Eleştirel Bakış ve Türk Uzman Görüşleri (TUG-1) Hamdi Akan1, Şeniz Öngören Aydın2, Neşe Saltoğlu3, Atahan Çağatay4, Halis Akalın5, Mutlu Arat6, Rıdvan Ali7, Sevgi Kalayoğlu-Beşışık2, A. Muzaffer Demir8 1Ankara
University Faculty of Medicine Cebeci Campus, Department of Hematology, Ankara, Turkey
2İstanbul
University Cerrahpaşa Faculty of Medicine, Department of Hematology, İstanbul, Turkey
3İstanbul
University Cerrahpaşa Faculty of Medicine, Department of Infectious Diseases, İstanbul, Turkey
4İstanbul
University Istanbul Faculty of Medicine, Department of Infectious Diseases and Clinical Microbiology, İstanbul, Turkey
5Uludağ
University Faculty of Medicine, Department of Infectious Diseases and Clinical Microbiology, Bursa, Turkey
6Florence
Nightingale Hospital, Hematology Unit, İstanbul, Turkey
7Uludağ
University Faculty of Medicine, Department of Hematology, Bursa, Turkey
8Trakya
University Faculty of Medicine, Department of Hematology, Edirne, Turkey
Abstract: The introduction of novel antifungal agents for the treatment of invasive fungal disease in hematological malignancies and also changing treatment strategies have had a great impact in managing affected patients. The medical literature includes some important clinical studies that are being used as evidence for guidelines. The problem with these studies and the guidelines is that they are not very easy to interpret, they include controversial issues, and they are not easy to apply to every patient or country. This paper was designed to critically show the main problems associated with these approaches and provide important information that will help Turkish doctors to adopt them in daily clinical practice. Key Words: Invasive fungal infection, Antifungal treatment, Evidence, Hematological malignancies
Özet: Hematolojik malignitelerde yeni antifungal ajanların invazif fungal infeksiyonların tedavisine sunulması ve tedavi stratejilerindeki değişmeler, bu hastaların tedavisini önemli şekilde etkilemiştir. Tıp literatüründe halen kılavuzlara kaynak olan bazı önemli klinik çalışmalar vardır. Ancak gerek bu çalışmalar gerekse kılavuzların en önemli sorunları günlük tıp pratiğine uyarlamadaki güçlükler, tartışmalı konular içermeleri ve her hasta ya da ülkeye uyarlama güçlüğü olmasıdır. Bu yazıda bu yaklaşımlarla ilgili önemli sorunlar eleştirel bir bakış açısı ile gözden geçirilmiş ve Türkiyede doktorların günlük tıp pratiklerine uyarlamaları konusunda bilgiler verilmiştir. Anahtar Sözcükler: İnvazif fungal infeksiyonlar, Antifungal tedavi, Kanıt, Hematolojik malignansi Address for Correspondence: Hamdi Akan, M.D., Ankara University Faculty of Medicine Cebeci Campus, Department of Hematology, Ankara, Turkey Phone: +90 532 424 26 40 E-mail: hamdiakan@gmail.com Received/Geliş tarihi : March 5, 2014 Accepted/Kabul tarihi : May 12, 2014
111
Akan H, et al: Treatment of Invasive Fungal Infections
Turk J Hematol 2014;31:111-120
Introduction Invasive fungal infections (IFIs) have emerged as a serious problem affecting morbidity and mortality in the management of patients with hematological malignancies. The continuous introduction of novel approaches and medications in this area influences the clinical behavior of physicians. In order to arrive at a consensus decision, various guidelines have been published and updated. These guidelines make recommendations based on evidence from certain important published articles. However, discordance between clinical research and medical practice comes into question and the implementation of these guidelines or the adaptation of them according to the local regulations of different countries may be troublesome. From this point of view, a critical review of evidence was undertaken by the experts on IFI management in Turkey. We performed a critical appraisal of some studies that have been unconditionally accepted, the results of which have been implemented until today. This paper includes appraisals of 7 key articles on IFI. These articles have been divided into 2 groups according to their subjects. The first group, i.e. the first 3 studies, is generally called the “Walsh studies” [1,2,3] and the efficacies of various antifungal agents used in empirical treatment are compared in these studies. As a standard approach, empirical antifungal treatment is given for the early treatment of fungal infections in neutropenic patients with persistent fever without clinical findings. Although the main aim in these studies is to determine the differences in efficacy of antifungal agents used in empirical treatment, the differences in side effects come to the forefront. The 4 studies in the second group are strategy studies [4,5,6,7]. The use of “prolonged fever/febrile neutropenia” as the sole evidence for fungal infection in empirical treatment has begun to be questioned and the requirement of using diagnostic tools such as high-resolution computed tomography (HRCT) and galactomannan (GM) revealed the probability of the substitution of the empirical approach with new strategies like preemptive treatment or diagnostic-driven treatment. These 4 studies investigate and compare the benefits of empirical versus preemptive approaches as early treatment strategies for IFIs. Outlines of the clinical trials included in this review are found in Table 1.
First Study: “Liposomal amphotericin B for empirical therapy in patients with persistent fever and neutropenia” by Walsh et al. [1] Author: Şeniz Öngören Aydın, Associate Professor, MD Previously, 2 randomized placebo-controlled studies on empirical antifungal treatment showed that treatment with conventional amphotericin B deoxycholate decreased the frequency of proven IFIs [8,9]. The newly developed lipid formulations of amphotericin B led to a decrease in doselimiting nephrotoxicity and infusion-related acute toxic effects. Both preclinical and open-label phase 1 and 2 studies demonstrated that liposomal amphotericin B (LAmB) is more efficient and less nephrotoxic than conventional amphotericin B in the treatment of invasive fungal infections (disseminated candidiasis and invasive pulmonary aspergillosis) [10,11,12,13,14,15]. Critical Review of the Study This study comparing empirical LAmB with conventional amphotericin B in neutropenic patients with persistent fever is one of the studies that is cited the most among the papers on antifungal treatment in febrile neutropenic patients. The use of masking is the most important strength of this study. There were 4 important studies that compared LAmB with conventional amphotericin B in the empirical treatment of febrile neutropenic patients [1,16,17,18]. The results of these studies are similar to the results obtained in the Walsh study. The most important contribution of this study in the follow-up and evaluation of febrile neutropenic patients is the defining of the composite score for determining the success of antifungal treatment used. Fever can occur for many reasons other than infection, and treatment success was not based on the sole use of resolution of fever in this study, an aspect of critical importance also acknowledged by the guidelines. Table 1. Number of citations of the articles (31 December 2013). Authors
Number of citations
Efficacy Studies
Walsh et al., 1999 [1]
638
In the 3 studies in the first group, Walsh and his colleagues used treatment success as the primary endpoint [1,2,3]. They defined a composite score involving 5 criteria: 7-day survival after the initiation of the studied drug, resolution of fever during the neutropenic period, successful treatment of baseline fungal infection, absence of breakthrough fungal infections while receiving the studied drug or within 7 days after treatment, and no early withdrawal of the studied drug due to toxicity or lack of efficacy.
Walsh et al., 2002 [2]
517
Walsh et al., 2004 [3]
441
Maertens et al., 2005 [4]
256
Cordonnier et al., 2009 [5]
111
Girmenia et al., 2010 [6]
25
Pagano et al., 2011 [7]
13
112
Akan H, et al: Treatment of Invasive Fungal Infections
Regarding statistical significance, the sample size calculated before the study was attained in both groups. However, inclusion and analysis of pediatric and adult patients together (age range: 2-80 years) constitutes one of the weak points of the study. Regarding risk categories, the groups were quite heterogeneous, neutropenia duration was not taken into consideration, patients with allogeneic stem cell transplantation (alloSCT) and autologous stem cell transplantation (ASCT) were classified in the same risk group, and, although there were patients who underwent alloSCT, the duration of neutropenia being short for the development of deep fungal infections was intriguing. Additionally, although the patients who underwent stem cell transplantation were considered as high-risk patients, the total number of patients in the high-risk group was low (i.e. inconsistency in the number of patients with high risk). Although it was mentioned that the groups were comparable regarding antibacterial, antifungal, and antiviral treatment at baseline, the onset of antifungal treatment and time of antibiotic modification/addition (glycopeptides) was not mentioned. Additionally, there is no information on the outcome of patients with candidemia, who were of equal number in both groups at the beginning of the study. Although aggressive interventions (blood culture, bronchoalveolar lavage, percutaneous needle aspiration, and biopsy) were carried out to identify the etiology of fungal infections, most patients were diagnosed to have suspected fungal pneumonia, as in daily practice. The frequency of infusion-related toxicities was lower in patients using LAmB; data showing the results of >7000 infusions support the statistical power of the study. In 2002, Cagnoni reanalyzed the 103 patients who underwent alloSCT who were included in the study of Walsh [19]. Nephrotoxicity (p<0.001), breakthrough infections (p<0.05), and dose reduction requirements (p<0.001) were lower in the LAmB group. From the pharmacoeconomic point of view, although the drug was cheap, the prolonged hospital stays, dialysis requirements, and other supportive treatments of patients with nephrotoxicity led to a significant increase in cost in the conventional amphotericin B group (p<0.001). Second Study: “Voriconazole compared with liposomal amphotericin B for empirical antifungal therapy in patients with neutropenia and persistent fever” by Walsh et al. [2] Author: Neşe Saltoğlu, Professor, MD This prospective, randomized, international multicenter, open-label study was based on the hypothesis that voriconazole is as efficacious and safe as LAmB in empirical antifungal treatment.
Turk J Hematol 2014;31:111-120
The US Food and Drug Administration (FDA) reviewed the study and some issues were pointed out. Although the authors stated that they would present the overall stratified rate of response in terms of a 5-part composite end score, they presented an unstratified analysis in their report. As the patients were stratified according to the degree of risk of fungal infection and antifungal prophylaxis at randomization, stratified analysis rather than composite analysis would have been better in analyzing the data. The study did not meet the predefined primary endpoint. Additionally, multiple statistical comparisons were undertaken that might have increased the risk of false positive results. Therefore, the FDA recommended setting the statistical significance level at p<0.001 rather than at p<0.05 [20]. Marr wrote a letter to the editor in response and indicated that the inclusion of patients with renal insufficiency, but not those with hepatic failure, might have led to negative results regarding LAmB. Additionally, it was stated that the use of a composite endpoint in the evaluation was not suitable and analysis of each component individually would have been better [21]. Additionally, Petrikkos and Skiada suggested that the use of a composite endpoint score might have masked the individual controversial results related to safety and efficacy [22]. Critical Review of the Study Regarding the 5-part composite score, except for voriconazole providing more beneficial results regarding the development of breakthrough infections, the effects of voriconazole were similar to or lower than those of LAmB. Additionally, there was no important difference between the 2 groups regarding the rate of breakthrough infections (98% versus 95%). As the data were analyzed by composite analysis, it is not possible to interpret the results clearly. Both drugs had similar side effects; however, voriconazole was associated with a lower rate of infusion-related toxicity and nephrotoxicity. In conclusion, the interpretation of study results according to risk groups defined at the beginning of the study would have allowed a better evaluation in this randomized controlled study comparing the effects of voriconazole with LAmB. Although breakthrough infections were observed at a lower rate in patients using voriconazole, the design of the analysis led to controversial results. Third Study: “Caspofungin versus liposomal amphotericin B for empirical antifungal therapy in patients with persistent fever and neutropenia” by Walsh et al. [3] Author: Atahan Çağatay, Professor, MD Side effects, unpredictable pharmacokinetics, and limited activity may become important clinical problems while using amphotericin B and triazoles. Therefore, the efficacy of a new class of antifungal agents in empirical treatment, echinocandins, was evaluated. Caspofungin, an 113
114 Randomized, international multicenter, open-label study
Randomized, international multicenter, double-blind stratified study
Walsh et al.
Walsh et al.
Voriconazole compared with liposomal amphotericin B for empirical antifungal therapy in patients with neutropenia and persistent fever. N Engl J Med 2002;346:225-234.
Caspofungin versus liposomal amphotericin B for empirical antifungal therapy in patients with persistent fever and neutropenia. N Engl J Med 2004;351:1391-1402.
Randomized, international, double-blind, multicenter study
Walsh et al.
Liposomal amphotericin for empirical therapy in patients with persistent fever and neutropenia. N Engl J Med 1999;340:764-771.
Study design
Authors
Article
Composite analysis is not convenient for evaluating the results, the study being an open label study is a weakness, and clinician decision is a subjective measure. There are errors in the design of the study.
The results obtained with liposomal amphotericin B are quite different from those of the previous studies. Selection of the patient group? The dose of liposomal amphotericin B is debated (3 vs. 5 mg/kg). Caspofungin fulfilled the â&#x20AC;&#x2DC;noninferiorityâ&#x20AC;&#x2122; criteria. Caspofungin is borderline better regarding survival. Caspofungin is better in terms of safety. Efficiency 1095 Caspofungin study (ITT) versus liposomal (556/539) amphotericin B
No risk discrimination, wide age limit, neutropenia duration was not taken into consideration.
Criticisms
Voriconazole could not achieve statistical significance level for empirical treatment; breakthrough fungal infection rates are lower in the voriconazole group. Nephrotoxicity and infusionrelated toxicity are lower and visual toxicity is higher in voriconazole group.
Liposomal amphotericin B is as effective as the conventional form, and toxicity and breakthrough fungal infections are significantly lower.
Outcome
Efficiency 837 Voriconazole study (415/422) versus liposomal amphotericin B
Liposomal amphotericin B versus conventional amphotericin B
Number of Drugs or appatients/ proach episodes
Efficiency 687 study
Study type
Table 2. General characteristics of pivotal studies in the treatment of invasive fungal infections in hematological malignancies.
Turk J Hematol 2014;31:111-120
Akan H, et al: Treatment of Invasive Fungal Infections
Nonrandomized pilot study
Comparative nonrandomized study
Galactomannan and Maertens computed tomography-based et al. preemptive antifungal therapy in neutropenic patients at high risk for invasive fungal infection: a prospective feasibility study. Clin Infect Dis 2005;41:1242-1250. Empirical versus preemptive antifungal therapy for highrisk, febrile, neutropenic patients: a randomized, controlled trial. Clin Infect Dis 2009;48:1042-1051.
Girmenia et al.
Pagano et al. Observational study
Clinically driven diagnostic antifungal approach in neutropenic patients: a prospective feasibility study. J Clin Oncol 2010;28:667-674.
The use and efficacy of empirical versus pre-emptive therapy in the management of fungal infections: the HEMA e-Chart Project. Clin Infect Dis 2005;41:1242-1250.
Strategy study
Strategy study
Strategy study
397
159
88/136
Comparison of empirical treatment with preemptive treatment
Comparison of empirical treatment with clinically driven treatment
Preemptive treatment
Nonrandomized, limited patient number, GM testing in bronchoalveolar lavage was not used in diagnosis.
Empirical approach Risk groups are not is more advantageous defined. Prophylaxis regarding mortality. effect is unclear. The high mortality may be due to the use of preemptive treatment in real IFI cases.
Clinically driven treatment is more advantageous than empirical and preemptive treatment.
Preemptive treatment leads to a reduction in antifungal drug use (from 35% to 7.7%).
Akan H, et al: Treatment of Invasive Fungal Infections Turk J Hematol 2014;31:111-120
115
Turk J Hematol 2014;31:111-120
echinocandin, is known to be effective against Candida and Aspergillus species and has been approved to be used for esophageal candidiasis, candidemia, and other Candida infections and in patients intolerant to other antifungal treatments or in treatment for refractory Aspergillus infections. Therefore, the efficacy and safety of LAmB and caspofungin in the empirical treatment of patients with neutropenia and persistent fever was compared in this study. Critical Review of the Study The most striking result obtained in this study was the significant rate of unexpected findings in patients with baseline Aspergillus spp. infection. The response rate of 8.3% reported in this study is the lowest response rate recorded for LAmB in Aspergillus infections. This situation raises the question of whether there was a problem in the distribution of patient groups. Again, the rate of resolution of baseline fungal infection was found to be lower in the LAmB group (25.9%), while the corresponding rate was 66.7% when comparing LAmB with voriconazole and 81.8% when comparing conventional amphotericin B with LAmB. Although it was a ‘noninferiority’ study, the general survival rate of patients with baseline fungal infection (mostly invasive aspergillosis) was lower and the results were worse among patients treated with LAmB. The starting dose of LAmB was 3 mg/kg in the study; in the case of no clinical response, the treatment dose was increased to 5 mg/ kg/day after 5 days. In clinical practice, LAmB can be used at 5 mg/kg/day in the treatment of invasive aspergillosis. In this study, it was stated that a suboptimal preloading dose (3 mg/ kg instead of 5 mg/kg) might have led to efficacy problems in patients with baseline invasive aspergillosis. Therefore, it was thought that estimation of the general survival rate with Kaplan–Meier analysis, after excluding patients with baseline fungal infections, would give clearer results. The importance of initiating early antifungal treatment was stressed elsewhere related to this study [23]. The predominance of fungal pathogens with natural resistance is intriguing [24,25,26,27,28]. B. Strategy Studies Fourth Study: “Galactomannan and computed tomography-based preemptive antifungal therapy in neutropenic patients at high risk for invasive fungal infection: a prospective feasibility study” by Maertens et al. [4] Author: Halis Akalın, Professor, MD Initiation of empirical antifungal treatment in neutropenic patients with fever persisting for 5-7 days and IFI risk despite wide-spectrum antibiotic treatment has been part of standard care. However, the fact that fever is unrelated to fungal infection in the majority of these patients has started debates about the use of unnecessary antifungal treatment in some of these patients. On the other hand, new 116
Akan H, et al: Treatment of Invasive Fungal Infections
methods that can be used in IFI diagnosis, such as GM, β-Dglucan, and HRCT, have been introduced. This study performed by Maertens et al. evaluated the applicability of a preemptive approach based on the assessment of serum GM and computed chest tomography in high-risk neutropenic patients, the change in the number of patients receiving antifungal treatment, and the advantages and disadvantages of this approach to empirical antifungal treatment regarding prognosis. A letter to the editor by de Pauw was published in Clinical Infectious Diseases [29]. As the value of the conventional empirical strategy against Aspergillus spp. is controversial and may lead to everlasting debates on the antifungal agent that should be chosen, de Pauw found it inconvenient to perform randomized comparative studies on this topic. He stated that a well-defined and autopsy-controlled study would be more beneficial in answering many questions regarding the reliability of diagnostic tests and whether it is possible to use a preemptive approach in nonneutropenic patients. He emphasized that starting antifungal treatment in neutropenic patients who show no response to antibiotic treatment is no longer valid, and there are various risk factors besides neutropenia. He also highlighted that the success of preemptive strategies is associated with meticulously close follow-up of the patient as well as the use of timely and repeatable reliable diagnostic tests. He stated that preemptive treatment can alter antifungal treatment approach in immunosuppressed patients. Critical Review of the Study This study opened a door to a new approach that could reduce the use of unnecessary antifungal treatment in patients with febrile neutropenia. With this study, fever persisting despite wide-spectrum antibiotic treatment being the sole reason for antifungal treatment is questioned in real terms. Beyond a doubt, novel diagnostic tests and advances in radiology have had important roles in reaching this point. This study, from another point of view, showed that earlier diagnosis of patients with invasive pulmonary aspergillosis without fever or fever with other causes is possible by using GM. Although the study not being a randomized comparative trial, having a small sample size, and lacking an assessment of GM in bronchoalveolar lavage can be considered as weak points, this study is a key publication to generate further hypotheses. Fifth Study: “Empirical versus preemptive antifungal therapy for high-risk, febrile, neutropenic patients: a randomized, controlled trial” by Cordonnier et al. [5] Author: Mutlu Arat, Professor, MD In this study, the researchers compared the empirical and preemptive strategies in the treatment of probable IFI cases in febrile neutropenia patients with persistent fever.
Akan H, et al: Treatment of Invasive Fungal Infections
de Pauw and Donnely wrote a detailed editorial about this study [30]. Although they criticized the philosophy of targeting overall survival and other factors, they shared the opinion that this study clearly underlined the importance of using the right treatment at the correct time. In particular, they cited studies that used GM antigenemia and thoracic computerized tomography more widely and more efficiently, and they stated that lack of autopsy findings is a limitation of the study. Although the study made an overwhelming impression in the infection world, it was destined to fall 2-3 years behind regarding its timing. In a letter to the editor written by Marr et al., antifungal prophylaxis not being standard and, particularly, the development of IFI in 5 patients who did not receive prophylaxis in the induction group were stated to support azole prophylaxis [31]. They underlined that the clinical indicators in the preemptive treatment group were not early but rather late findings, and this was stated as the reason for observing more frequent IFIs in this group. They highlighted that sensitive tests are required for prediction, and that the currently used tests reveal existence rather than nonexistence more precisely; they also put forward the idea of de-escalation treatment. Another critique came from Stefani et al. [32]. They criticized the inclusion of patients with ASCT and lymphoma in the study group and they stated that they were stunned by the exclusion of alloSCT cases. While prophylaxis weakness was verbalized, the requirement of closer microbiological follow-up was stressed, and the inclusion of a patient in shock was found to be questionable from an ethical point of view. The safety of the environment was not reported. Critical Review of the Study The study was criticized both by the authors of the study and by authors writing letters to the editor. Considering survival as the aim of the study was deemed challenging and the nonhomogeneity of the comparison groups was criticized. Inclusion of ASCT and lymphoma cases with rare IFI frequency and exclusion of alloSCT cases with a high probability of IFI was intriguing. Toxicity, iatrogenic immunosuppression, and the probability of graft-versus-host disease in alloSCT cases might have intimidated the authors. Another common subject of criticism is the standardization of prophylaxis and close microbiological follow-up policy. Despite all these points, except for induction and probable alloSCT cases, the preemptive approach could be a more rational and cost-effective treatment with close follow-up, along with the evolving serological and imaging techniques The point that I consider crucial in all febrile neutropenia studies is putting emphasis on the duration of neutropenia while failing to emphasize the kinetics of neutropenia. For clinicians and transplant physicians, the most important factor in fever control is neutrophil recovery. However, in the presently discussed study, although deep neutropenia
Turk J Hematol 2014;31:111-120
seems to suggest a high risk, there is a borderline risk group with absolute neutropenia with a median duration of 10-12 days in the consolidation and ASCT group, and an induction group with absolute neutropenia with a median duration of 26 days. Considering the mean as 18 days and treating this patient population as a homogeneous group and classifying them into the same risk group is not a rational approach. In both ablative and nonablative transplantation, the course of transplant and survival is poor in febrile neutropenic attacks associated with the development of pneumonia and IFI in the first week. Apart from the depth of neutropenia at the time of febrile neutropenia, a second definition of “neutropenia duration after fever” should also be established. The following 3 intervals should be defined clearly and shared in the statistics of further studies: the time between the development of fever to the time to neutrophil recovery to >0.5x109/L, the time from the onset of antifungal treatment to the recovery of neutrophils, and the time between resolution of fever and neutrophil recovery (this datum may be categorically “positive or negative”). In this regard, data on febrile neutropenia can be interpreted more clearly, and not only the depth and duration of neutropenia but also the impact of febrile neutropenia in the kinetics of neutrophil recovery will be exactly underlined. My belief is that, according to the timing of febrile neutropenia attack within the intervals mentioned above, the empirical or the preemptive approach can be used, especially for patients receiving induction chemotherapy and alloSCT. However, as kinetic data are not available in detail, it is not possible to deduce the implication of this for our current treatment schemes. Sixth Study: “Clinically driven diagnostic antifungal approach in neutropenic patients: a prospective feasibility study” by Girmenia et al. [6] Author: Rıdvan Ali, Professor, MD Besides being an expensive method, serum GM screening (as a preemptive strategy) in neutropenic patients is time-consuming and not easy to interpret. This study was performed to determine the feasibility of a clinically driven diagnostic strategy with late GM screening. Critical Review of the Study This study is valuable in that the same diagnostic criteria and tools were used in all study centers. Due to the difficulties of using GM in diagnosis, a first evaluation was made without using GM and HRCT; in comparison, clinically driven GM and HRCT use was found to be more efficient. Controversial results have been obtained in studies that compared the empirical approach with the diagnosticdriven approach, and this study contributed to the literature in favor of the diagnostic-driven approach. However, although the empirical approach was efficient in high-risk patients, and especially in the study of Cordonnier et al. [5], no such difference was noted in this study. The lack of 117
Turk J Hematol 2014;31:111-120
autopsy-proven fungal infections is a limitation of the study; besides, a patient with mucormycosis died before treatment initiation by this approach. Nevertheless, this study suggests that the clinically driven diagnostic approach, supported primarily by radiological evaluation and subsequent GM results, can be efficient. Seventh Study: “The use and efficacy of empirical versus pre-emptive therapy in the management of fungal infections: the HEMA e-Chart Project” by Pagano et al. [7] Author: Sevgi Kalayoğlu-Beşışık, Professor, MD This study was an observational study that included various acute or chronic hematological malignancies. They were managed by using a standard diagnostic approach in different centers. The efficacy of preemptive treatment versus empirical treatment was compared. The authors stated that although the empirical approach can lead to overtreatment, in specific patient groups (acute myeloid leukemia [AML] remission induction) it could decrease mortality. Critical Review of the Study This study included Hodgkin lymphoma, non-Hodgkin lymphoma, multiple myeloma, and myelodysplastic syndrome patients with different risk factors (severity and duration of mucositis, duration and severity of neutropenia, etc.). Efficacy of treatment (clinical course) was not reported clearly. In a study including patients who receive antifungal treatment, the choice of the antifungal agents that will be used in the empirical or preemptive treatment will depend on the type of antifungal prophylaxis. The death rate being high in the preemptive treatment group can be associated with the more common use of this method in probable or real IFI cases rather than delayed treatment [33,34]. Experts’ Opinion Based on the Evidence In consideration of these studies together, the most important problem is the difficulty in comparing them because of different designs, methodologies, approaches, and patient selection criteria. As the Walsh studies included in this paper used the same methodology, they are more comparable; however, they were criticized because of methodological errors (selection of composite endpoints) and problems in patient inclusion criteria. Nevertheless, the results of these studies demonstrate that using LAmB and echinocandin (caspofungin) is a valid approach in empirical treatment. However, voriconazole was not approved for empirical use as it cannot reach the expected target. Although there was evidence supporting preemptive treatment in previous studies that evaluated treatment approaches, subsequent studies indicated that the empirical treatment approach still remains valid, especially in highrisk patients like those undergoing induction chemotherapy for AML. 118
Akan H, et al: Treatment of Invasive Fungal Infections
Certain points stand out in the adaptation of these studies to Turkey: 1. The efficacy data presented here are not in favor of conventional amphotericin B in empirical antifungal treatment. Additionally, a large randomized trial comparing voriconazole with conventional amphotericin B in invasive aspergillosis also showed that conventional amphotericin B is inferior in this setting [35]. Based on these studies, conventional amphotericin B is not recommended in the guidelines. Therefore, the scientific validity of the recommendations of the Healthcare Implementation Notification (Turkish: Sağlık Uygulama Tebliği) is questionable. In particular, patients at high risk for nephrotoxicity, such as those undergoing stem cell transplantation, should not use conventional amphotericin B. 2. In Turkey, drug choice in routine medical practice and drug licenses are aligned with the existing scientific data and it can be concluded that there is no major problem in this respect. 3. In empirical treatment, the use of LAmB is the valid approach, and caspofungin can be an alternative in first-line treatment. 4. Voriconazole is the drug of choice in suspected or documented Aspergillus infections; however, LAmB can also be used. 5. The preemptive treatment approach is more convenient in Turkey for several reasons, including the reduction of antifungal drug use, toxicity, and the costs of care. However, as timely and appropriate access to diagnostic tools is limited in most centers, the application of preemptive therapy is far from being as broad as that in the publications and radiological modalities generally come into prominence. In addition, the demonstration of increased mortality in certain risk groups with preemptive treatment raises some concerns about this approach. Therefore, unless new evidence emerges, initiation of treatment with the empirical approach, especially in patients in high-risk groups like those with acute leukemia induction, and modification of treatment according to the information obtained from diagnostic testing will be more reliable and valid for Turkey. The review of these papers by Turkish experts showed us that, although there has been major progress in this area, the globalization and generalization of these approaches still need more study, and glocalization (globalization + localization) remains a valid approach in different countries. References 1. Walsh TJ, Finberg RW, Arndt C, Hiemenz J, Schwartz C, Bodensteiner D, Pappas P, Seibel N, Greenberg RN, Dummer S, Schuster M, Holcenberg JS. Liposomal amphotericin B for empirical therapy in patients with persistent fever and neutropenia. National Institute of Allergy and Infectious Diseases Mycoses Study Group. N Engl J Med 1999;340:764771.
Akan H, et al: Treatment of Invasive Fungal Infections
2. Walsh TJ, Pappas P, Winston DJ, Lazarus HM, Petersen F, Raffalli J, Yanovich S, Stiff P, Greenberg R, Donowitz G, Schuster M, Reboli A, Wingard J, Arndt C, Reinhardt J, Hadley S, Finberg R, Laverdière M, Perfect J, Garber G, Fioritoni G, Anaissie E, Lee J; National Institute of Allergy and Infectious Diseases Mycoses Study Group. National Institute of Allergy and Infectious Diseases Mycoses Study Group. Voriconazole compared with liposomal amphotericin B for empirical antifungal therapy in patients with neutropenia and persistent fever. N Engl J Med 2002;346:225-234. 3. Walsh TJ, Teppler H, Donowitz GR, Maertens JA, Baden LR, Dmoszynska A, Cornely OA, Bourque MR, Lupinacci RJ, Sable CA, dePauw BE. Caspofungin versus liposomal amphotericin B for empirical antifungal therapy in patients with persistent fever and neutropenia. N Engl J Med 2004;351:1391-1402. 4. Maertens J, Theunissen K, Verhoef G, Verschakelen J, Lagrou K, Verbeken E, Wilmer A, Verhaegen J, Boogaerts M, Van Eldere J. Galactomannan and computed tomography-based preemptive antifungal therapy in neutropenic patients at high risk for invasive fungal infection: a prospective feasibility study. Clin Infect Dis 2005;41:1242-1250. 5. Cordonnier C, Pautas C, Maury S, Vekhoff A, Farhat H, Suarez F, Dhedin N, Isnard F, Ades L, Kuhnowski F, Foulet F, Kuentz M, Maison P, Bretagne S, Schwarzinger M. Empirical versus preemptive antifungal therapy for high-risk, febrile, neutropenic patients: a randomized, controlled trial. Clin Infect Dis 2009;48:1042-1051. 6. Girmenia C, Micozzi A, Gentile G, Santilli S, Arleo E, Cardarelli L, Capria S, Minotti C, Cartoni C, Brocchieri S, Guerrisi V, Meloni G, Foa R, Martino P. Clinically driven diagnostic antifungal approach in neutropenic patients: a prospective feasibility study. Clin Oncol 2010;28:667-674. 7. Pagano L, Caira M, Nosari A, Cattaneo C, Fanci R, Bonini A, Vianelli N, Garzia MG, Mancinelli M, Tosti ME, Tumberallo M, Viale P, Aversa F, Rossi G; HEMA e-Chart Group. The use and efficacy of empirical versus pre-emptive therapy in the management of fungal infections: the HEMA e-Chart Project. Haematologica 2011;96:1366-1370. 8. Pizzo PA, Robichaud KJ, Gill FA, Witebsky FG. Empiric antibiotic and antifungal therapy for cancer patients with prolonged fever and granulocytopenia. Am J Med 1982;72:101-111. 9. Empiric antifungal therapy in febrile granulocytopenic patients. EORTC International Antimicrobial Therapy Cooperative Group. Am J Med 1989;86:668-672. 10. Francis P, Lee JW, Hoffman A, Peter J, Francesconi A, Bacher J, Shelhamer J, Pizzo PA, Walsh TJ. Efficacy of unilamellar liposomal amphotericin B in treatment of pulmonary aspergillosis in persistently granulocytopenic rabbits: the potential role of bronchoalveolar lavage D-mannitol and serum galactomannan as markers of infection. J Infect Dis 1994;169:356-368.
Turk J Hematol 2014;31:111-120
11. Meunier F, Prentice HG, Ringden O. Liposomal amphotericin B (AmBisome): safety data from a phase II/III clinical trial. J Antimicrob Chemother 1991;28(Suppl B):83-91. 12. Walsh TJ, Yeldandi V, McEvoy M, Gonzalez C, Chanock S, Freifeld A, Seibel NI, Whitcomb PO, Jarosinski P, Boswell G, Bekersky I, Alak A, Buell D, Barret J, Wilson W. Safety, tolerance, and pharmacokinetics of a small unilamellar liposomal formulation of amphotericin B (AmBisome) in neutropenic patients. Antimicrob Agents Chemother 1998;42:2391-2398. 13. Mills W, Chopra R, Linch DC, Goldstone AH. Liposomal amphotericin B in the treatment of fungal infections in neutropenic patients: a single-centre experience of 133 episodes in 116 patients. Br J Haematol 1994;86:754-760. 14. Ng TTC, Denning DW. Liposomal amphotericin B (AmBisome) therapy in invasive fungal infections: evaluation of United Kingdom compassionate use data. Arch Intern Med 1995;155:1093-1098. 15. Ringden O, Meunier F, Tollemar J, Ricci P, Tura S, Kuse E, Viviani MA, Gorin NC, Klastersky J, Fenaux P. Efficacy of amphotericin B encapsulated in liposomes (AmBisome) in the treatment of invasive fungal infections in immunocompromised patients. J Antimicrob Chemother 1991;28(Suppl B):73-82. 16. Prentice HG, Hann IM, Herbrecht R, Aoun M, Kvaloy S, Catovsky D, Pinkerton CR, Schey SA, Jacobs F, Oakhill A, Stevens RF, Darbyshire PJ, Gibson BE. A randomized comparison of liposomal versus conventional amphotericin B for the treatment of pyrexia of unknown origin in neutropenic patients. Br J Haematol 1997;98:711-718. 17. White MH, Bowden RA, Sandler ES, Graham ML, Noskin GA, Wingard JR, Goldman M, van Burik JA, McCabe A, Lin JS, Gurwith M, Miller CB. Randomized, double-blind clinical trial of amphotericin B colloidal dispersion vs. amphotericin B in the empirical treatment of fever and neutropenia. Clin Infect Dis 1998;27:296-302. 18. Wingard JR, White MH, Anaissie E, Raffalli J, Goodman J, Arrieta A; L Amph/ABLC Collaborative Study Group. A randomized, double-blind comparative trial evaluating the safety of liposomal amphotericin B versus amphotericin B lipid complex in the empirical treatment of febrile neutropenia. Clin Infect Dis 2000;31:1155-1163. 19. Cagnoni P. Liposomal amphotericin B versus conventional amphotericin B in the empirical treatment of persistently febrile neutropenic patients. J Antimicrob Chemother 2002;49(Suppl S1):81-86. 20. Powers JH, Dixon CH, Goldberger MJ. Comment on: Voriconazole versus liposomal amphotericin B in patients with neutropenia and persistent fever. N Engl J Med 2002;346:289-290. 119
Turk J Hematol 2014;31:111-120
21. Marr KA. Empirical antifungal therapy-new options, new tradeoffs. Comment on: Voriconazole versus liposomal amphotericin B in patients with neutropenia and persistent fever. N Engl J Med 2002;346:278-280. 22. Petrikkos G, Skiada A. Recent advances in antifungal chemotherapy. Int J Antimicrob Agents 2007;30:108-117. 23. Jones BL, McLintock LA. Caspofungin versus liposomal amphotericin B for empirical therapy. N Engl J Med 2005;352:410-414; author reply 410-414. 24. Kontoyiannis DP, Lewis RE. Comment on: Caspofungin versus liposomal amphotericin B for empirical therapy. N Engl J Med 2005;352:410-414; author reply 410-414. 25. Tattevin P, Bareau B, Camus C. Comment on: Caspofungin versus liposomal amphotericin B for empirical therapy. N Engl J Med 2005;352:410-414; author reply 410-414. 26. Marty FM, Lowry CM. Comment on: Caspofungin versus liposomal amphotericin B for empirical therapy. N Engl J Med 2005;352:410-414; author reply 410-414. 27. Danaher PJ. Comment on: Caspofungin versus liposomal amphotericin B for empirical therapy. N Engl J Med 2005;352:410-414; author reply 410-414. 28. Schneemann M, Imhof A. Comment on: Caspofungin versus liposomal amphotericin B for empirical therapy. N Engl J Med 2005;352:410-414; author reply 410-414. 29. de Pauw BE. Between over and undertreatment of invasive fungal disease. Clin Infect Dis 2005;41:1251-1253.
120
Akan H, et al: Treatment of Invasive Fungal Infections
30. de Pauw BE, Donnelly JP. Timely intervention for invasive fungal disease: should the road now lead to the laboratory instead of the pharmacy? Clin Infect Dis 2009;48:10521054. 31. Marr KA, Leisenring W, Bow E. Empirical versus preemptive antifungal therapy for fever during neutropenia. Clin Infect Dis 2009;49:1138-1139; author reply 1139-1140. 32. Stefani PM, Salvadori U, Gottardi M, Rigoli R, Scotton P, Gherlinzoni F. What does preemptive antifungal treatment really mean? Clin Infect Dis 2010;50:1201-1202; author reply 1202. 33. Aguilar-Guisado M, MartĂn-Pena A, Espigado I, Ruiz Perez de Pipaon M, Falantes J, de la Cruz F, Cisneros JM. Universal antifungal therapy is not needed in persistent febrile neutropenia: a tailored diagnostic and therapeutic approach. Haematologica 2012;97:464-471. 34. Castagnola E, Haupt R. Empirical versus pre-emptive antifungal therapy for persistent febrile neutropenia. Haematologica 2012;97:e1. 35. Herbrecht R, Denning DW, Patterson TF, Bennett JE, Greene RE, Oestmann JW, Kern WV, Marr KA, Ribaud P, Lortholary O, Sylvester R, Rubin RH, Wingard JR, Stark P, Durand C, Caillot D, Thiel E, Chandrasekar PH, Hodges MR, Schlamm HT, Troke PF, de Pauw B; Invasive Fungal Infections Group of the European Organisation for Research and Treatment of Cancer and the Global Aspergillus Study Group. Voriconazole versus amphotericin B for primary therapy of invasive aspergillosis. N Engl J Med 2002;347:408-415.
Research Article
DOI: 10.4274/tjh.2012.0150
sEPCR Levels in Chronic Myeloproliferative Diseases and Their Association with Thromboembolic Events: A Case-Control Study Kronik Miyeloproliferatif Hastalıklarda sEPCR Düzeyleri ile Tromboembolizm Arasındaki İlişki: Bir Olgu Kontrol Çalışması Figen Atalay1, Selami Koçak Toprak2, Ebru Koca2, Sema Karakuş2 1Başkent
University Faculty of Medicine, Department of Hematology, İstanbul, Turkey
2Başkent
University Faculty of Medicine, Department of Hematology, Ankara, Turkey
Abstract: Objective: Venous, arterial, and microcirculatory events are frequently encountered in the clinical course of essential thrombocytosis and polycythemia vera. We aimed to investigate the levels of soluble endothelial protein C receptor (sEPCR) in myeloproliferative diseases to see whether there was a difference between the patients with and without history of thromboembolism. Materials and Methods: The study included patients with polycythemia vera (n=12), patients with essential thrombocytosis (n=13), and controls (n=29). In all groups, we measured proteins C and S, antithrombin and sEPCR levels, and plasma concentrations of thrombin-antithrombin complex, prothrombin fragments 1+2, and D-dimer.
Results: Comparing the patients with and without history of thromboembolic attack, statistically significant differences were not observed in terms of sEPCR, D-dimer, thrombin-antithrombin complex, prothrombin fragments 1+2, and hematocrit levels (p=0.318, 0.722, 0.743, 0.324, and 0.065, respectively). Conclusion: Significant increase in the parameters that reflect activation of coagulation, such as sEPCR, thrombinantithrombin complex, prothrombin fragments 1+2, and D-dimer, reflects the presence of a basal condition that leads to a tendency toward thrombosis development in ET and PV when compared to healthy controls. Key Words: Myeloproliferative disorders, Endothelial cell protein C receptor, Thrombosis Özet: Amaç: Esansiyel trombositemi (ET) ve polisitemi vera (PV)’nin klinik seyrinde venöz, arteriyel ve mikrosirkülatuar trombotik olaylara sık olarak rastlanmaktadır. Biz, tromboembolik olay öyküsü olan ve olmayan hastalardaki çözünür endotelyal protein C reseptörü (sEPCR) düzeyleri açısından bir fark olup olmadığını araştırmayı amaçladık.
Address for Correspondence: Figen Atalay, M.D., Başkent University Faculty of Medicine, Department of Hematology, İstanbul, Turkey E-mail: f_noyan@yahoo.com Phone: +90 216 554 15 00 Received/Geliş tarihi : October 10, 2012 Accepted/Kabul tarihi : August 22, 2013
121
Turk J Hematol 2014;31:121-127
Atalay F, et al: sEPCR Levels and Thromboembolism in CMPD
Gereç ve Yöntemler: Çalışmaya polisitemia vera (12) ve esansiyel trombositozu (13) toplam 25 hasta ile kontrol grubunu oluşturmak üzere 29 sağlıklı kişi alındı. Her iki grupta da, protein C, S, antitrombin ve sEPCR ile düzeyleri ile trombinantitrombin kompleks (TAT), protrombin fragmanı 1+2 ve D-Dimer plazma konsantrasyonları ölçülmüştür.
Bulgular: Tromboembolik atak öyküsü olan ve olmayan hastalar karşılaştırıldığında sEPCR, D-dimer, TAT, protrombin fragman 1 +2 (F1+2) ve hematokrit düzeyleri açısından istatistiksel olarak anlamlı fark gözlenmemiştir (sırasıyla p=0,318; 0,722; 0,743; 0,324; 0,065).
Sonuç: sEPCR, TAT, F1+2 ve D-Dimer gibi pıhtılaşma aktivasyonunu yansıtan parametrelerinde anlamlı artış görülmesi, parametrelerde literatür ile uyumlu olarark kontrol grubuna göre anlamlı artış gösterilmiş olması ET ve PV hastalarında tromboza eğilim oluşturan bazal bir durumun varlığına işaret etmektedir.
Anahtar Sözcükler: Miyeloproliferatif hastalıklar, Endotelyal protein C reseptörü, Tromboz
Introduction Protein C is a vitamin K-dependent anticoagulant synthesized largely in the liver that plays an important role in the coagulation system [1]. Activation of protein C is catalyzed by the thrombin-antithrombin (TAT) complex [2]. Activated protein C (aPC), combined with its cofactor, protein S, acts as an anticoagulant, inactivating factor Va and factor VIIIa [3]. In recent years studies have shown that, in addition to its important role in the coagulation system, protein C also has cell protection functions such as maintenance of the vascular barrier (continuity of its integrity), inhibition of apoptosis, and inflammation control [2,4]. The endothelial protein C receptor (EPCR), which is a type of transmembrane glycoprotein found in the endothelium that was first defined by Fukudome and Esmon in 1994, also enables activation of protein C [5]. EPCR augments the activation of protein C by approximately 10 times by binding to protein C on the cell surface [4,6]. The activation of protein C is increased by binding to the EPCR via the TAT complex [7]. EPCR is found on the surface of all vessels, particularly large vessels. Thrombin and inflammatory cytokines induce metalloprotease activity on the cell surface and lead to the production of soluble EPCR (sEPCR). Soluble EPCR is the ligand-binding type of EPCR and can be detected in plasma [4]. Anti-sEPCR has recently been discovered in human plasma [3]. sEPCR inhibits the anticoagulant effect of aPC by inhibiting the attachment of the protein to phospholipids and inactivating factor Va. This tends to lead to the development of thrombosis [1]. Essential thrombocytosis (ET) and polycythemia vera (PV) are chronic myeloproliferative diseases (CMPDs). These are clonal hematopoietic stem-cell diseases characterized by an increase in leukocyte, erythrocyte, and platelet production [8]. Venous and arterial thrombosis and microcirculatory events are frequently encountered in the clinical course of ET and PV.
122
The tendency to develop thrombosis is enhanced in these diseases due to hyperviscosity, qualitative and quantitative abnormalities in blood cells, increased production of thromboxane A2, leukocyte activation, and endothelial damage [9]. Hereditary and acquired thrombophilic states (factor V Leiden mutation analysis, homocysteine levels, presence of antiphospholipid antibodies) have been investigated in patients with CMPDs [10]. In this study, we aimed to investigated the sEPCR levels in CMPDs and to determine potential differences between patients with and without a history of thromboembolism. Only one study to date appears to have investigated the role of levels of natural anticoagulants (protein C, protein S, and antithrombin) in the etiology of thromboembolism in CMPDs; this study detected low levels in patients who had experienced a thrombotic attack [9]. In our study, we to investigated the association of protein C, protein S, antithrombin levels, plasma concentrations of the TAT complex, prothrombin fragments 1+2 (F1+2), D-dimer and sEPCR levels with development of thrombosis in ET and PV patients. Materials and Methods Study Group The study included patients with PV (n=12) and ET (n=13) who were over 18 years of age, had been followed in the hematology clinic of Başkent University Medical Faculty for 5 years, and had agreed to participate in the study, as well as 29 healthy volunteers. Nine milliliters of venous blood was collected by venipuncture in tubes containing sodium citrate from all patients and controls. Plasma was obtained by centrifugation at 2300 x g for 10 min at room temperature and immediately stored at -80 °C until use. Soluble EPCR levels were determined in plasma with sEPCR Asserachrom enzyme-linked immunosorbent assay (ELISA) kits (Asserachrom® sEPCR, Diagnostica Stago) according to the manufacturer’s instructions.
Atalay F, et al: sEPCR Levels and Thromboembolism in CMPD
Regular C-reactive protein (CRP) levels were studied simultaneously to exclude inflammation. The TAT complex, F1+2, and D-dimer, were analyzed using an ELISA kit (Enzygnost F1+2, Enzygnost TAT, Dade Behring; D-dimer: Asserachrom, Roche Diagnostics). Levels of antithrombin and protein C, which are natural anticoagulants, were quantitatively measured by the colorimetric method (STA, Stachrom Analyzer); total protein S was measured quantitatively by the immunoturbidimetric method (STA, Stachrom Liatest). Informed consent was obtained from all patients and healthy volunteers. The study was started after obtaining the approval of the local ethics committee. Statistical SPSS 15.0 for Windows was used for statistical analysis. Categorical variables are represented in frequency tables, whereas numerical variables are represented as descriptive statistics [mean, standard deviation (SD), minimum, and maximum]. Cross-table statistics are given for the categorical comparison of the groups, and the chi-square test was used to identify the significance level. Analysis of variance was used for the comparison of more than 2 groups with normally distributed data, and the Kruskal-Wallis test was used for data not distributed normally. The level of statistical significance was considered to be a p-value of less than 0.05. Results The study included 25 patients with PV and ET and 29 healthy controls. In the patient group, 48% (n=12) had PV and 52% (n=13) had ET. The mean age ± SD of the patients with PV and ET and of the members of the control group was 64.4±10.4, 68.4±12.1, and 49.5±10.7, respectively (p<0.001). The mean hematocrit level was statistically significantly higher in the control group, whereas the mean platelet, creatinine, CRP, D-dimer, TAT, F1+2, and sEPCR levels were statistically significantly higher in the patient group (Figures 1, 2, and 3). There was no correlation in the statistical comparisons of the protein C, protein S, and antithrombin levels between the patient and the control groups (p=0.821, p=0.984, and p=0.360, respectively). There was a positive correlation between protein C and S levels in patients with ET, whereas there was a negative correlation between protein S and antithrombin levels in the same group (Table 1). There was, however, no association between these levels in patients with PV. A statistically significant difference was identified between the groups in hematocrit, platelet, creatinine, CRP, D-dimer, TAT, F1+2, and sEPCR levels and in hypertension (HT) and coronary arterial disease (CAD) rates. The mean hematocrit level was higher, whereas CRP and D-dimer levels were lower, in the control group compared to the ET group. The mean platelet, TAT, F1+2, and sEPCR levels were lower in the control group, but the mean creatinine level was higher compared to the ET and PV groups (Table 1).
Turk J Hematol 2014;31:121-127
Levels of sEPCR in patients with PV were not correlated with TAT, D-dimer, or F1+2 levels (p=0.656, p=0.137, and p=0.095, respectively). The sEPCR levels in patients with ET were also not correlated with those of TAT, D-dimer, or F1+2 (p=0.946, p=0.852, and p=0.691, respectively) (Table 1). In this study, 92% (n=23) of the patients had been receiving antiaggregant therapy and 12% (n=3) had been receiving anticoagulant therapy. Seventy-two percent of the patients had been receiving hydroxyurea. Phlebotomy was performed in 41.7% (n=5) of the patients with PV, whereas the remainder had been receiving either hydroxyurea or interferon therapy. Of the patients with ET, 46.2% (n=6) had been receiving anagrelide and 76.9% (n=10) had been receiving hydroxyurea. Among all patients, the prevalence
Figure 1. Mean sEPCR levels in PV, ET, and control groups and 95% CI.
Figure 2. Mean TAT levels in PV, ET, and control groups and 95% CI.
Figure 3. Mean prothrombin fragment 1+2 levels in PV, ET, and control groups and 95% CI. 123
Atalay F, et al: sEPCR Levels and Thromboembolism in CMPD
Turk J Hematol 2014;31:121-127
of cerebrovascular incidents was 12% (n=3) and the prevalence of thromboembolic incidents was 44% (n=11). Arterial thromboses were detected in the majority of the patients (32%, n=8) who developed thrombosis. Most of these were cerebral (24%, n=6) or involved the lower extremities (8%, n=2), abdomen (8%, n=2), or coronary artery (4%, n=1). Four (16%) of the patients who had been receiving antiaggregant therapy developed a second attack, mostly in the form of a cranial thromboembolic event (Table 2). In terms of thromboembolic episodes and the number, location, and type of thromboses, there was no statistically significant difference between patients with ET and PV. Erythromelalgia was found in 2 of the patients with ET, and signs of hyperviscosity were observed in 5
of the patients with ET. Hypermetabolic symptoms were present in 38.5% of the patients. There was no statistically significant difference between the patients with ET and PV in terms of the history of and the number of thromboembolic attacks, or in the type and localization of thrombosis (Table 2). Comparing the patients with and without a history of thromboembolic attack, no statistically significant difference was observed in the sEPCR, D-dimer, TAT, F1+2, and hematocrit levels (p=0.318, p=0.722, p=0.743, p=0.324, and p=0.065, respectively). However, the difference in the leukocyte and platelet counts was statistically significant (p=0.010 and p=0.027, respectively) (Table 3).
Table 1. Laboratory parameters in disease control groups.
PV
ET
Control
Female, (n,%)
7 (58.3)
10 (76.9)
12 (41.4)
Male, (n,%)
5 (41.7)
3 (23.1)
17 (58.6)
Age (years)
64.4±10.4
68.4±12.1
49.5±10.7
<0.001
Hematocrit, %
41.7±4.5
38.7±8.4$
45.2±5.0#
0.020
White blood cells, /µL
9675.8±3827
7350.8±5357.9
6640.8±1662.8
0.053
Platelets, /µL
328333.3±138333$
498000±322802$
231069±42885#
<0.001
AST, U/L
23.3±13.2
24.8±8.7
20.7±8.4
0.506
ALT, U/L
21.7±15.1
22.5±11.9
22±8.1
0.455
Creatinine, mg/dL
1.1±0.4$
1±0.2$
0.7±0.2*#
0.001
CRP, mg/L
3.2±2.4$
3.7±2.6$
1.7±2.1*#
0.008
D-dimer, ng/mL
0.2±0.2
0.3±0.2$
0.2±0.2#
0.027
ProteinC, %
84.7±38.1
94.3±21.4
103±23.2
0.251
ProteinS, %
87.3±34.8
77.1±22.8
94.1±30.5
0.239
Antithrombin, %
106.3±19.8
110.3±19.5
106.3±22.2
0.285
TAT, ng/mL
199.0±103.7$
218.5±104.3$
2.5±5.1*#
<0.001
Prothrombin fragment 1+2 level, nmol/L
1091.6±294$
1285.9±145$
543.4±246#
<0.001
sEPCR, ng/mL
788.8±184#$
1039.5±403$*
524.5±272*#
<0.001
HT, (n,%)
8 (66.7)
11 (84.6)
0 (.0)
<0.001
CAD, (n,%)
1 (8.3)
3 (23.1)
0 (.0)
0.025
Smoking , (n,%)
3 (25)
3 (23.1)
13 (44.8)
0.339
Data are presented as mean±standard deviation. *Different from PV #Different from ET $Different from the control group (AT: antithrombin, CAD: coronary artery disease, CRP: C-reactiveprotein, ET: essential thrombocytosis, HT: hypertension, PV: polycytemia vera, sEPCR: soluble endothelial protein C receptor, TAT: thrombin-antithrombin complex)
124
p 0.096
Turk J Hematol 2014;31:121-127
Atalay F, et al: sEPCR Levels and Thromboembolism in CMPD
Discussion To the best of our knowledge, this is the first study to evaluate levels of sEPCR in ET and PV patients. The mean sEPCR was 524±272 ng/µL in the control group versus 788.8±184 ng/µL in the ET group and 1039.5±403 ng/µL in the PV group. The sEPCR level was statistically significantly higher in the ET and PV patients compared to the control group (p<0.001). Elevated levels of sEPCR reflect a high possibility of a prothrombotic state. However, there was no statistically significant difference between the patients with and without thrombosis in terms of the sEPCR levels (p=0.318). In this study, levels of coagulation activation factors TAT, D-dimer, and F1+2 were also higher in the ET and PV patients compared to the control group (p<0.001, p=0.027, and p<0.001, respectively). These results confirmed enhanced coagulation activation. Unexpectedly, no correlation was seen between levels of sEPCR and these coagulation markers in the ET and PV patient groups. This situation may be attributed to the small number of patients in the trial.
In general, sEPCR has a procoagulant character. It is known that hereditary defects in the protein C system lead to an increase in the propensity to develop venous thromboembolism [11]. It has been reported that the attachment of A23 bp changes the function of EPCR, leading to sequential protein synthesis, which is not expressed on the epithelial surface. However, the role of this mutation in thrombosis is difficult to detect because of its low allele frequency [7,12]. An elevated level of sEPCR also impairs EPCR-mediated coagulation. Studies with healthy subjects demonstrated that the plasma sEPCR level shows a bimodal distribution with age [4,13]. Orhon et al. conducted a study with healthy children and adults and detected an increase in levels of the sEPCR in 20% of children and 10% of adults. The physiological basis of this bimodal distribution is unclear. Genetic factors such as sex and polymorphisms, as well as environmental factors such as smoking and dietary habits, have been considered responsible [13]. The Paris Thrombosis Study investigated genetic risk factors that facilitate venous thromboembolism and compared 338
Table 2. Clinical features of patient groups.
PV
ET
p
Erythromelalgia, n (%)
0 (0)
2 (15.4)
N/S
Hyperviscosity, n (%)
1 (8.3)
5 (38.5)
N/S
TIA, n (%)
1 (8.3)
2 (15.4)
N/S
Hemorrhage, n (%)
0 (0)
1 (7.7)
N/S
Thromboembolic episodes n (%)
5 (41.7)
6 (46.2)
N/S
Arterial thrombosis, n (%)
2.0 (16.7)
6.0 (46.2)
N/S
Venous thrombosis, n (%)
3.0 (12)
0 (0)
N/S
TIA: Transient ischemic attack, N/S: not specified
Table 3. Laboratory values of history with and without thromboembolic event in patients.
Thromboembolic event (+) (n=11)
Thromboembolic event (-) (n=14)
p
sEPCR, ng/mL
841.6±337.1
980.1±336.1
0.318
D-dimer, ng/mL TAT, ng/ml Prothrombin fragment
0.3±0.2 226.3±113.7
0.3±0.2 195.7±94.5
0.722 0.743
1253.5±123.4
1144.8±306.1
0.324
Hematocrit, % White blood cells, /µL
37.3±7.2 6131.8±3239
42.4±5.9 10301.4±5017.8
0.065 0.01
Platelets, /μL
278636.4±129429
524928.6±290802.2
0.027
F1+2 level, nmol/L
125
Turk J Hematol 2014;31:121-127
patients with thrombosis (deep venous thrombosis and/or pulmonary embolus) and a control group comprising an equal number of subjects. The study found that carrying the A3 haplotype is associated with an increase in the level of sEPCR and an increase in the risk for thrombosis [14]. Another study found that the plasma sEPCR level was no lower than 100 ng/mL in pediatric stroke patients with the A3 haplotype, and that the sEPCR level was higher in a stroke group compared to a control group. Based on these results, the authors concluded that the sEPCR level is higher than normal in those with the A3 haplotype, and that this might be associated with a tendency to develop thrombosis [15]. In an analysis of plasma sEPCR levels in 82 patients with retinal venous occlusion, it was observed that the sEPCR level was statistically significantly higher in those with central venous occlusion compared to a control group. The same study failed to detect a statistically significant difference between the time to thrombosis development and the sEPCR level [16]. In another prospective study published recently, the authors concluded that the sEPCR level was high in CAD patients, but there was no significant difference in sEPCR levels between individuals with or without future cardiovascular event [17]. Essential thrombocytosis and PV are clonal hematopoietic stem cell-originated CMPDs associated with an increase in leukocyte, platelet, and erythrocyte production [18,19]. In these patients, thromboembolic complications are the second most frequent cause of mortality after hematological transformation [20]. In the present study, the prevalence of thromboembolic events was 41.7% in the ET patients and 46.2% in the PV patients. These findings are consistent with the literature. Thromboembolic events were mostly cerebral in the PV patients, and lower extremity thrombosis was more common in the ET patients. Although arterial thrombosis was more prevalent in the PV patients, the prevalence of arterial thrombosis and venous thrombosis was the same in the ET patients. None of the patients had been receiving treatment at the time of their first thromboembolic event because they had no known myeloproliferative diseases. All 4 patients who had had a second thrombosis had been receiving treatment. Only 1 patient developed coronary arterial thrombosis during follow-up while receiving treatment. In the literature, the prevalence of thrombosis at the time of diagnosis was 11%-25% in ET patients and 12%-39% in PV patients [21]. Two prospective studies (ECLAP and MRC-PT1) with large patient series reported an annual risk for cardiovascular events for each patient of 2.5%-5% in PV patients and 1.9%-3% in ET patients [22,23]. Although major arterial events (acute myocardial infarction, ischemic stroke, peripheral arterial obstruction, etc.) are more prominent in PV patients, microcirculatory events (erythromelalgia, transient ischemic attack, visual and auditory defects, recurrent headaches, etc.) are encountered more frequently in ET patients. Venous events such as deep venous thrombosis of the lower extremities and pulmonary embolus are frequent in both patient groups [19]. In the ECLAP study, which included 1630 patients with PV, 39% 126
Atalay F, et al: sEPCR Levels and Thromboembolism in CMPD
of the patients had a history of thrombosis, and this was the most important cause of mortality (41%). Although an age of over 60 years and a history of previous thrombosis have been considered as the main factors that increase the risk for thrombosis, multivariable analyses have demonstrated that smoking, hypertension, and congestive heart failure might also be associated with an increased risk of thrombosis. The same study demonstrated no relation between the platelet count and thrombosis [22]. Another study demonstrated that acquired aPC resistance occurred in CMPD patients. Decreased levels of protein S and protein C are the probable cause of the prothrombotic state [9,24]. We detected no difference among the PV and ET patients and control group members in terms of levels of protein C, protein S, and antithrombin (p=0.251, p=0.239, p=0.285, respectively). This situation is attributed to the small number of patients in our study. Leukocytosis was shown to be associated with thrombosis in patients with PV and ET [25]. The mechanism was considered to be an aggregation of platelets and neutrophils after leukocyte activation. On the contrary, in our study leukocyte and platelet counts were found to be significantly lower in patients with thromboembolic attack than in patients without it. This could be secondary to the use of hydroxyurea. Three metaanalyses were published. In these studies, JAK2V617F positivity is associated with increased thrombotic attacks [26,27,28]. At the time of our study, JAK2V617F mutation analysis was not used routinely in our laboratories. It was thus not applied to our patient group. In conclusion, the lack of a statistically significant difference in the sEPCR levels of the ET and PV patients with and without thrombosis is attributed to the small number of patients in this trial. The significant increases in sEPCR, TAT, F1+2, and D-dimer levels reflect the activation of coagulation and point to the presence of a basal condition that leads to a tendency to develop thrombosis. Large-scale studies with more patients are needed to determine the predictive importance of high levels of sEPCR in the development of thrombotic events in patients with PV and ET. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Liaw PC, Neuenchwander PF, Smirnov MD, Esmon CT. Mechanisms by which soluble endothelial cell protein C receptor modulates protein C and activated protein C function. J Biol Chem 2000;275:5447-5452. 2. Fukodome K, Esmon CT. Identification, cloning and regulation of a novel endothelial cell protein C/activated protein C receptor. J Biol Chem 1994;269:26486-26491.
Atalay F, et al: sEPCR Levels and Thromboembolism in CMPD
3. Castellino FJ, Ploplis VA. The protein C pathway and pathological processes. J Thromb Haemost 2009;7 (Suppl 1):140-145. 4. Stearns-Kurosawa DJ, Swindle K, D’Angelo A, Della Valle P, Fattorini A, Caron N, Grimaux M, Woodhams B, Kurosawa S. Plasma levels of endothelial protein C receptor respond to anticoagulant treatment. Blood 2002;99:526-530. 5. van Hylckama Vlieg A, Montes R, Rosendaal FR, Hermida J. Autoantibodies against endothelial protein C receptor and the risk of a first deep vein thrombosis. J Thromb Haemost 2007;5:1449-1454. 6. Stearns-Kurosawa DJ, Burgin C, Parker D, Comp P, Kurosawa S. Bimodal distribution of soluble endothelial protein C receptor levels in healthy populations. J Thromb Haemost 2003;1:855-856. 7. Akar N, Özel D, Gökdemir R, Akar E. Endothelial cell protein C receptor (EPCR) gene exon III, 23 bp insertion mutation in the Turkish pediatric thrombotic patients. Thromb Haemost 2002;88:1068-1069. 8. Tefferi A, Thiele J, Orazi A, Kvasnicka HM, Barbui T, Hanson CA, Barosi G, Verstovsek S, Birgegard G, Mesa R, Reilly JT, Gisslinger H, Vannucchi AM, Cervantes F, Finazzi G, Hoffman R, Gilliland DG, Bloomfield CD, Vardiman JW. Proposals and rationale for revision of the World Health Organization diagnostic criteria for polycythemia vera, essential thrombocythemia, and primary myelofibrosis: recommendations from an ad hoc international expert panel. Blood 2007;110:1092-1097. 9. Bucalossi A, Marotta G, Bigazzi C, Galieni P, Dispensa E. Reduction of antithrombin III, protein C, and protein S levels and activated protein C resistance in polycythemia vera and essential thrombocythemia patients with thrombosis. Am J Hematol 1996;52:14-20. 10. Ruggeri M, Gisslinger H, Tosetto A, Rintelen C, Mannhalter C, Pabinger I, Heis N, Castaman G, Missiaglia E, Lechner K, Rodeghiero F. Factor V Leiden mutation carriership and venous thromboembolism in polycythemia vera and essential thrombocythemia. Am J Hematol 2002;71:1-6. 11. Dahlback B. The protein C anticoagulant system: inherited defects as basis for venous thrombosis. Thromb Res 1995;77:1-43. 12. von Depka M, Czwalinna A, Eisert R, Wermes C, Scharrer I, Ganser A, Ehrenforth S. Prevalence of a 23 bp insertion in exon 3 of the endothelial cell protein C receptor gene in venous thrombophilia. Thromb Haemost 2001;86:1360-1362. 13. Orhon FS, Ergun H, Egin Y, Ulukol B, Baksan S, Akar N. Soluble endothelial protein C receptor levels in healthy population. J Thromb Thrombolysis 2010;29:46-51. 14. Saposnik B, Reny JL, Gaussem P, Emmerich J, Aiach M, Gandrille S. A haplotype of the EPCR gene is associated with increased plasma levels of sEPCR and is a candidate risk factor for thrombosis. Blood 2004;103:1311-1318. 15. Ulu A, Gunal D, Tiras S, Egin Y, Deda G, Akar N. EPCR gene A3 haplotype and elevated soluble endothelial protein C receptor (sEPCR) levels in Turkish pediatric stroke patients. Thromb Res 2007;120:47-52.
Turk J Hematol 2014;31:121-127
16. Gumus K, Kadayifcilar S, Eldem B, Saracbasi O, Ozcebe O, Dundar S, Kirazli S. Is elevated level of soluble endothelial protein C receptor a new risk factor for retinal vein occlusion? Clin Experiment Ophthalmol 2006;34:305-311. 17. Kallel C, Cohen W, Saut N, Blankenberg S, Schnabel R, Rupprecht HJ, Bickel C, Munzel T, Tregouet DA, Morange PE. Association of soluble endothelial protein C receptor plasma levels and PROCR rs867186 with cardiovascular risk factors and cardiovascular events in coronary artery disease patients: the Athero Gene study. BMC Med Genet 2012;13:103. 18. Spivak JL, Barosi G, Tognoni G, Barbui T, Finazzi G, Marchioli R, Marchetti M. Chronic myeloproliferative disorders. Hematology Am Soc Hematol Educ Program 2003:200-224. 19. Elliott MA, Tefferi A. Thrombosis and haemorrhage in polycythaemia vera and essential thrombocythaemia. Br J Haematol 2005;128:275-290. 20. Marchioli R, Finazzi G, Landolfi R, Kutti J, Gisslinger H, Patrono C, Marilus R, Villegas A, Tognoni G, Barbui T. Vascular and neoplastic risk in a large cohort of patients with polycythemia vera. J Clin Oncol 2005;23:2224-2232. 21. Jensen MK, de Nully Brown P, Nielsen OJ, Hasselbalch HC. Incidence, clinical features and outcome of essential thrombocythaemia in a well defined geographical area. Eur J Haematol 2000;65:132-139. 22. Finazzi G; Low-Dose Aspirin in Polycythemia (ECLAP). A prospective analysis of thrombotic events in the European collaboration study on low-dose aspirin in polycythemia (ECLAP). Pathol Biol (Paris) 2004;52:285-288. 23. Falanga A, Marchetti M. Thrombotic disease in the myeloproliferative neoplasms. Hematology Am Soc Hematol Educ Program 2012;2012:571-581. 24. Marchetti M, Castoldi E, Spronk HM, van Oerle R, Balducci D, Barbui T, Rosing J, Ten Cate H, Falanga A. Thrombin generation and activated protein C resistance in patients with essential thrombocythemia and polycythemia vera. Blood 2008;112:4061-4068. 25. Falanga A, Marchetti M, Vignoli A, Balducci D, Barbui T. Leukocyte-platelet interaction in patients with essential thrombocythemia and polycythemia vera. Exp Hematol 2005;33:523-530. 26. Ziakas PD. Effect of JAK2 V617F on thrombotic risk in patients with essential thrombocythemia: measuring the uncertain. Haematologica 2008;93:1412-1414. 27. Dahabreh IJ, Zoi K, Giannouli S, Zoi C, Loukopoulos D, Voulgarelis M. Is JAK2 V617F mutation more than a diagnostic index? A meta-analysis of clinical outcomes in essential thrombocythemia. Leuk Res 2009;33:67-73. 28. Lussana F, Caberlon S, Pagani C, Kamphuisen PW, Büller HR, Cattaneo M. Association of V617F Jak2 mutation with the risk of thrombosis among patients with essential thrombocythaemia or idiopathic myelofibrosis: a systematic review. Thromb Res 2009;124:409-417.
127
Research Article
DOI: 10.4274/tjh.2012.0063
Prognostic Significance of the Lymphoblastic Leukemia-Derived Sequence 1 (LYL1) Gene Expression in Egyptian Patients with Acute Myeloid Leukemia Mısırlı Akut Miyeloid Lösemi Hastalarında Lenfoblastik Lösemi Kökenli Dizi 1 (LYL1) Sunumunun Prognostik Önemi Nadia El-Menshawy1, Doaa Shahin1, Hayam Fathi Ghazi2 1Mansoura
University Faculty of Medicine, Department of Clinical Pathology, Mansoura, Egypt
2Mansoura
University Faculty of Medicine, Department of Oncology Medicine, Mansoura, Egypt
Abstract: Objective: Aberrant activation of transcription factor genes is the most frequent target of genetic alteration in lymphoid malignancies. The lymphoblastic leukemia-derived sequence 1 (LYL1) gene, which encodes a basic helix-loop helix, was first identified with human T-cell acute leukemia. Recent studies suggest its involvement in myeloid malignancies. We aimed to study the expression percent of oncogene LYL1 in primary and secondary high-risk myeloid leukemia and the impact on prognostic significance in those patients. Materials and Methods: Using quantitative real-time polymerase chain reaction for detection of LYL1 oncogenes, our study was carried out on 39 myeloid leukemia patients including de novo cases, myelodysplastic syndrome (MDS) with transformation, and chronic myelogenous leukemia (CML) in accelerated and blast crisis, in addition to 10 healthy individuals as the reference control.
Results: LYL1 expression was increased at least 2 times compared to the controls. The highest expression of this transcription factor was observed in the MDS cases transformed to acute leukemia at 7.3±3.1, p=0.0011. LYL1 expression was found in 68.2%, 75%, and 77.8% of cases of acute myeloid leukemia, CML crisis, and MDS, respectively. Significant correlation of LYL1 overexpression with some subtypes of French-American-British classification was found. There was, for the first time, significant correlation between the blood count at diagnosis and LYL1 expression (p=0.023, 0.002, and 0.031 for white blood cells, hemoglobin, and platelets, respectively). The rate of complete remission was lower with very high levels of LYL1 expression and the risk of relapse increased with higher levels of LYL1 expression, suggesting an unfavorable prognosis for cases with enhanced expression.
Address for Correspondence: Doaa Shahİn, M.D., Mansoura University Faculty of Medicine, Department of Clinical Pathology, Mansoura, Egypt Phone: +2 0124180067 Received/Geliş tarihi : May 15, 2012 Accepted/Kabul tarihi : November 21, 2012
128
El-Menshawy N, et al: Clinical Significance of LYL1 Gene Expression
Turk J Hematol 2014;31:128-135
Conclusion: Overexpression of LYL1 is highly associated with acute myeloid leukemia and shows more expression in MDS with unfavorable prognosis in response to induction chemotherapy. These observations could signal a promising tool for a therapeutic target to basic helix–loop helix protein related to transcription factors, which may improve patient outcome in acute myeloid leukemia, MDS, and CML in blast crisis. Key Words: LYL1 gene, Acute myeloid leukemia, Myelodysplastic syndrome, Chronic myelogenous leukemia in blast and accelerated phases, Real-time polymerase chain reaction Özet: Amaç: Lenfoid malignitelerdeki genetik değişikliğin en sık hedefi transkripsiyon faktör genlerindeki anormal aktivasyondur.
Lenfoblastik Lösemi Kökenli Dizi 1 (LYL1) temel bir sarmal-ilmek-sarmal proteini kodlar ve ilk olarak T-hücreli akut lösemili bir insanda tespit edilmiştir. Son yapılan çalışmalar miyeloid malignitelerle olan ilişkisini göstermektedir. Bu çalışmada yüksek riskli birincil ve ikincil akut miyeloid lösemi hastalarında LYL1 onkogeninin ifade edilme yüzdesi ve bunun prognoza olan etkisini göstermeyi amaçladık.
Gereç ve Yöntemler: Çalışmamıza; miyelodisplastik sendromdan (MDS) dönüşmüş veya de novo akut miyeloid lösemili
veya akselere/blastik evrede kronik miyeloid lösemili (KML) olmak üzere toplam 39 hasta ve kontrol amaçlı 10 sağlıklı kişi dahil edilmiştir. LYL1 gen ifadesi kantitatif gerçek-zamanlı polimeraz zincir reaksiyonu kullanılarak ölçüldü. Bulgular: LYL1 gen ifadesinin kontrollere göre en az 2 kat arttığı görüldü. En yüksek LYL1 gen ifade oranları MDS’den akut lösemiye dönüşen olgularda gözlendi (7,3±3,1; p=0,0011). LYL1 gen ifade oranları akut miyeloid lösemi, KML blastik kriz ve MDS hastalarında sırasıyla %68,2, %75 ve %77,8 bulundu. LYL1 aşırı gen ifadesi ile Fransız-Amerikan-İngiliz (FAB) sınıflaması bazı alt tipleri arasında anlamlı korelasyon bulundu. Literatürde ilk kez, tanı anındaki kan sayımı ve LYL1 gen ifadesi ile lökosit sayısı, hemoglobin düzeyi ve trombosit sayısı arasında anlamlı korelasyon bulunmuştur (sırasıyla, p=0,023, 0,002, ve 0,031). Yüksek LYL1 ifadesinin saptandığı olgularda tam yanıt oranının düşük ve relaps riskinin artmış saptanması, artmış gen ifadesinin olumsuz prognostik özellikte olduğunu düşündürmektedir. Sonuç: LYL1 aşırı ifadesi akut miyeloid lösemi ile yüksek derecede bağlantılıdır. Olumsuz prognostik özellik gösteren MDS hastalarında aşırı LYL1 gen ifadesinin indüksiyon tedavisine ilişkili olduğu görülmektedir. Bu gözlemler transkripsiyon faktörleri ile ilişkili sarmal-ilmek-sarmal yapısındaki proteinlerin birer terapötik hedef olarak gelec vaad ettiğini ve AML, MDS ve blastik krizdeki KML hastalarında prognozu olumlu etkileyebileceğini düşündürmektedir.
Anahtar Sözcükler: LYL1 geni, Akut miyeloid lösemi, Miyelodisplastik sendrom, Akselere ve blastik evre kronik miyeloid lösemi, Gerçek-zamanlı polimeraz zincir reaksiyonu
Introduction Transcription factors play an important role in the normal developmental process of hematopoietic cells. However, expression of transcription factors and their implications in various human leukemia types are not well understood [1]. Recent research has focused on these oncogenic transcription factors and their role in leukemogenesis. The lymphoblastic leukemia-derived sequence 1 (LYL1) gene encodes a basic helix-loop helix (bHLH) protein with 267 amino acids and a molecular weight of 28.628 Da. It was originally identified in some cases of T-cell acute lymphoblastic leukemia (T-ALL) at the breakpoint region of the chromosomal translocation t (7;19) (q35; p13) [2]. The translocation is in head-to-head juxtaposition with the T-cell antigen receptor beta (TCR-beta) gene, resulting in truncation of the LYL1 gene and production of abnormalsized RNAs. This brings the LYL1 gene under the regulatory control of the TCR-beta gene, resulting in ectopic expression of LYL1 [3]. However, overexpression of LYL1 has also been reported in cases of T-ALL without apparent chromosome aberration. Interestingly, another study by Kuo et al. showed
that LYL1 was expressed in most B-lineage cells but was downregulated during terminal differentiation, whereas most of the T-lineage cells did not express LYL1 [4]. Furthermore, LYL1 mRNA expression has been shown to occur in the developing cardiovascular and hematopoietic system cells, but not in developing nerve cells [5]. LYL1 forms heterodimeric complexes with E2A and p105, the precursor of nuclear factor-kappaB1 p50, and functions as an inhibitor that prevents the activation of E2A-responsive tumor suppressor genes, leading to differential arrest and cell transformation [6]. Some transcription factors, such as TAL1, LYL1, and LMO1/2, are tissue-specific bHLHs that bind to DNA as heterodimers with HEB or one of the E2A proteins and form a multiprotein complex [7]. They are transcribed in immature hematopoietic cells, where they are essential for normal development, but not in the T-lymphoid lineage [8,9]. The bHLH region of LYL1 and TAL1/SCL proteins shows 82% amino acid identity, suggesting that these 2 proteins share at least some target genes and biological functions [10]. 129
Turk J Hematol 2014;31:128-135
El-Menshawy N, et al: Clinical Significance of LYL1 Gene Expression
Chambers et al. found that LYL1 is not essential for embryonic development; however, deletion of LYL1 together with its paralog, the stem-cell leukemia (SCL) gene, causes rapid apoptosis of hematopoietic progenitors in adult mice [11]. The upregulation of LYL1 has been linked to a subtype of T-ALL defined by a stem-like phenotype and an unfavorable prognosis [12]. Excess LYL1 blocked the dimerizations of E2A and thus inhibited the regulatory activity of E2A on the CD4 promoter, leading to increased proliferation and suppressed apoptosis of the progenitor cells [13]. Furthermore, overexpression of LYL1 in mouse bone marrow causes expansion of the hematopoietic progenitors and the mature T-cells. These effects were most likely due to the anti-apoptotic and proliferative roles of the LYL1 overexpression in the hematopoietic system [14]. Ferrando et al. found that expression of LYL1 was increased in immature T cell precursor cells and was associated with unfavorable prognosis in T-ALL cases [15]. Zhong et al. studied the effect of LYL1 in transgenic mice and observed that a significant proportion of the mice developed B and T cell lymphoma after an average latent period of 1 year [16]. However, few studies have looked for the LYL1 expression of leukemic cell lines and clinical cases of myeloid leukemia.
The aim of the present study was to investigate the expression rate of the oncogene LYL1 in primary and high-risk myeloid leukemia and to assess its impact on prognosis. Materials and Methods Patients Thirty-nine patients with primary or secondary acute myeloid leukemia (AML) being followed at the medical oncology center of Mansoura University and 10 healthy individuals were included in this case-control study. Twentytwo patients were diagnosed with de novo AML (Group I), 8 patients were in the accelerated and myeloid blast phases of chronic myeloid leukemia (CML) (Group II), and 9 patients had AML transformed from myelodysplastic syndrome (MDS) (Group III). The control group consisted of 10 healthy individuals with normal peripheral blood counts and morphology. Peripheral blood and bone marrow (BM) samples were obtained from healthy controls and patients in accordance with the protocols of the local institutional ethics committee. All patients were subjected to complete clinical examination. Diagnosis was based on complete blood count, BM examination, and immunohistochemical, morphological,
Table 1. Patient characteristics and LYL1 expression levels.
Groups
I (n=22)
II (n=8)
III (n=9)
IV (n=10)
Age (years)
33.8±12.2
51.5±9.5
52.0±8.1
30.6±10.1
Sex (n, female/male) Female Male
8/14 36.4% 63.6%
3/5 37.5% 62.5%
3/6 33.4% 66.6%
4/6 40.0% 60.0%
Splenomegaly (n, +ve/-ve) +ve: improve as positive -ve: improve as negative
15/7 69.2% 30.8%
8/0 100% 00.0%
0/0 00.0% 00.0%
0/10 00.0% 100%
Lymphadenopathy (n, +ve/-ve)
14/8
2/6
0/9
0/10
+ve: improve as positive -ve: improve as negative
63.6% 36.4%
25.0% 75.0%
00.0% 100.0%
00.0% 100.0%
WBCs (x109/L)
61.9±45.0
55.5±47.4
40.2±76.4
6.9±1.4
Hemoglobin (g/dL)
7.5±1.3
8.7±1.7
7.0±1.3
14.5±1.2
Platelets (x109/L)
27.5±23.2
83.0±61.9
48.9±62.1
269.0±79.1
Blasts in PB
20.4±14.9
6.8±5.0
7.6±3.9
0.0±0.00
Blasts in BM
54.7±16.9
17.8±7.3
15.3±2.1
0.9±1.1
LYL1 expression
4.6±2.9
6.8±2.1
7.3±3.1
0.018±0.106
Abbreviations; BM: bone marrow, PB: peripheral blood, WBCs: white blood cells. Data are represented as mean ± standard deviation.
130
Turk J Hematol 2014;31:128-135
El-Menshawy N, et al: Clinical Significance of LYL1 Gene Expression
and immunophenotyping studies of the marrow samples to confirm the specific clonality and correlation with morphological French-American-British (FAB) classification. Patient characteristics are given in Table 1. Analysis of LYL1 Expression by Real-Time Polymerase Chain Reaction Sample Collection
Spearman’s correlation coefficient and linear regression analysis. A 2-sided p value of less than 0.05 was considered significant. Qualitative data are presented as numbers and percentages. Quantitative data are presented as mean ± standard deviation or median (minimum-maximum) where appropriate. Results
BM aspirates and venous blood samples were collected from each patient with completely aseptic techniques and under mild conscious sedation. Ten peripheral venous blood samples were obtained from the healthy controls to determine the reference level of LYL1. Analysis RNA was extracted from the blood or marrow cells using a commercial RNA isolation kit (QIAamp RNA Blood Mini Kit, QIAGEN, Hilden, Germany; Cat. No. 52304) according to the manufacturer instructions. The specificity of the LYL1 amplification was confirmed by the observation of a unimolecular dissociation curve and a single band on 3% agarose gel following electrophoresis. RNA was reverse transcribed from 1 µg of total RNA in a final volume of 20 µL containing reverse transcriptionpolymerase chain reaction (RT-PCR) buffer (1 mM each dNTP, 3 mM MgCl2, 75 mM KCl, 50 mM Tris-HCL, pH 8.3), 10 U RNA (Promega, Madison, WI, USA), 100 mM dithiothreitol, 100 U superscript II (Gibco-BRL, Cergy-Pontoise, France), and 25 µM random hexamers. The expression levels of various target PCRs were quantified relative to the expression level of the endogenous housekeeping gene, glyceraldehyde3-phosphate dehydrogenase (GAPDH), by real time RT-PCR in a Step-One 7000 (PE Applied Biosystems, Foster City, CA, USA) as described previously [9]. For detection of LYL1 expression levels, the forward primer 5`- TCA CCC CTT CCT CAA CAG TGT- 3` and reverse primer 5`- CGG GCC ACC TTC TGG G- 3` were used in combination with the probe 5`- (FAM)- CCT TCA CAC GCC TGC AGA TC- (TAMRA) -3`. Each sample had internal endogenous controls of GAPDH forward primer 5`GAA GGT GAA GGT CGG AGT C -3` and GAPDH reverse primer 5`- GAA GAT GGT GAT GGG ATT TC -3`.
Expression of LYL1 was studied in 22 de novo and 17 high-risk AML patients. LYL1 expression levels of the 4 study groups are presented in Table 1. LYL1 expression was significantly higher in comparison to controls in all 3 groups with mean values of 4.6±2.9, 6.8±2.1, and 7.3±3.1 for Groups I, II, and III, respectively (related p values were 0.008, 0.003, and 0.0011, respectively). The highest expression level was detected in MDS transformed leukemia patients (Figure 1). An increase in expression of at least 2 times the normal control was considered positive for LYL1 expression. Accordingly, positive LYL1 expression was found in 15/22 (68.2%), 6/8 (75%), and 7/9 (77.8%) cases in Groups I, II, and III, respectively (Table 2, Figure 2) No significant correlation between the expression of LYL1 and the hemoglobin concentration, leukocyte count,
Figure 1. Interaction box plot representing expression level of LYL1 in different patient groups (p=0.000).
The cDNA was amplified for 40 cycles of 15 s at 95 °C (denaturation) and 1 min at 60 °C (annealing and extension). The relative copy numbers of gene expression were quantified using the comparative threshold cycle (ct) method as shown in Figure 2. Statistical The data collected were statistically analyzed using SPSS 16 (SPSS Inc., Chicago, IL, USA). The Student t-test, the Mann-Whitney U test, and one-way ANOVA (t-test) were used when making comparisons between groups. Correlations among variables were found by using
Figure 2. Representing positive LYL1 and positive GAPDH internal control. 131
Turk J Hematol 2014;31:128-135
El-Menshawy N, et al: Clinical Significance of LYL1 Gene Expression
platelet count, or number of blasts in the peripheral blood and in the BM could be demonstrated, as shown in Table 3. We also examined whether there was an increased tendency for clustering in a certain FAB subtype in patients with enhanced LYL1 expression (Table 4). In this regard, we observed that patients with increased levels of expression tended to be of the M2, M3, and M6 subtypes more frequently; however, the numbers were too small to present this as a significant relationship. Furthermore, we tested whether BM LYL1 expression at diagnosis could predict the response to induction chemotherapy or the achievement of complete remission. We found that 71.4% of patients negative for LYL1 expression achieved complete remission, while 60% of those positive for LYL1 expression reached complete remission (p=0.065). The mean LYL1 expression was higher in the relapsed patients, at 5.7±3.2 (p=0.032). The relapse rate was almost one-third higher in patients with increased LYL1 expression (Table 5).
Correlations of LYL1 expression with clinical and laboratory parameters were studied. LYL1 was not found to be correlated with splenomegaly, lymphadenopathy, or level of peripheral blood or BM blasts at presentation. There was a significant positive correlation between the LYL1 expression and the leukocyte number as well as the age at diagnosis. LYL1 expression was shown to be significantly negatively correlated with the levels of hemoglobin and platelets on admission and the rate of complete remission achievement (Table 6). Discussion The LYL1 gene codes for a bHLH transcription factor [16]. The basic region facilitates DNA interactions, while the helix-loop helix domain enhances protein dimerizations and prevents activation of E2A-responsive tumor suppressor genes, leading to differential arrest and cell proliferation [17]. LYL1 has an important role in hematopoietic stem cell biology and normal hematopoiesis, while its expression has been associated with the development of leukemia [18,19].
Table 2. Distribution of LYL1 expression among studied groups.
Many researchers have focused on the expression of LYL1 levels in acute lymphoblastic leukemia, while only a few studies on expression of this factor in AML are available. LYL1 LYL1 -ve LYL1 +ve Total Our present study aimed to assess the expression of LYL1 expression in myeloid malignancy, either de novo AML or secondary Group I to MDS or CML. We found increased levels of expression of this transcription factor by at least 2 times that of the n 7 15 22 controls in the AML group at 68.2%, the MDS group at % 31.8 68.2 100.00 77.8%, and the CML group at 75%, while it was expressed at Group II very low levels in the normal control group. Similar results n 2 6 8 were reported by Meng et al. [20], who observed enhanced % 25 75 100.00 expression of LYL1 in 79.2% (19/24) of AML cases and Group III 81.8% of MDS cases (9/11). In another study [21], Meng n 2 7 9 et al. recently reported a slightly lower overexpression % 22.5 77.8 100.00 rate of this transcription factor, at 62.2%. This variation of expression may be related to the methodology of different Total techniques used in the studies or to characteristic features n 11 28 39 of the study populations. Geographical or racial factors that % 28.2 71.8 100.00 differ from one population to another may also underlie p value 0.001 the different expression frequencies. Furthermore, the expression of LYL1 might be associated with coexpression LYL1 expression significant at p<0.005. of other transcription factors, making it difficult to assess. Table 3. Comparison of hematological data according to positive and negative LYL1 expression.
-ve (n=11)
+ve (n=28)
WBCs (x103 µL)
46.7±9.1
52.05±2
0.431
0.669
Hemoglobin (g/dL)
7.1±3.1
7.89±2.55
0.246
0.964
Platelets (x103 µL)
43.3±37.9
25.5±45.9
1.690
0.099
Blasts in PB
11.9±12.4
12.6±13.2
0.061
0.983
Blasts in BM
29.16±5.6
30.51±25.6
0.11
0.912
t-test
p
Abbreviations; BM: bone marrow, PB: peripheral blood, WBCs: white blood cells, -ve: negative, +ve: positive. Data are represented as mean ± standard deviation.
132
El-Menshawy N, et al: Clinical Significance of LYL1 Gene Expression
Table 4. Distribution of patients with AML according to FAB classification and LYL1 expression.
LYL1 expression
-ve (n=7)
+ve (n=15)
FAB subtype M1
No.
%
No.
%
2
28.57
2
13.3
M2
0
0
4
26.6
M3
2
28.57
4
26.6
M4
1
14.28
1
6.66
M5
2
28.57
0
0
M6
0
0
3
20
M7
0
0
1
6.66
Table 5. Comparison between % expression of LYL1 and response to induction therapy in AML group.
LYL1 expression
-ve (n=7)
+ve (n=15)
No.
%
No.
%
CR
5
71.4
9
60
Relapse
2
28.6
6
40
Abbreviations; CR: complete remission, +ve: positive, -ve: negative. Data are represented as %.
Table 6. Correlation between LYL1 expression and clinical and laboratory parameters.
Parameter
r
p
Age
0.495
0.000
Sex
-0.019
0.448
Spleen
-0.160
0.137
Lymph nodes
-0.013
0.464
WBCs (x103 µL)
0.286
0.023
Hemoglobin (g/dL)
-0.397
0.002
Platelets (x103 µL)
-0.269
0.031
Blasts in PB
0.007
0.481
Blasts in BM
-0.083
0.286
FAB
0.202
0.184
Complete remission
-0.316
0.025
Abbreviations: BM: bone marrow, FAB: French-American-British, PB: peripheral blood, WBCs: white blood cells. Significant when p<0.05.
Turk J Hematol 2014;31:128-135
The mechanism by which LYL1 is highly expressed in AML is not known, while in T-ALL, it has been explained by its upregulation related to a translocation. However, recent studies revealed that it could also occur without the presence of particular translocations. There are multiple mechanisms responsible for LYL1 upregulation in AML. Chan et al. [22] reported that elongation transcriptions and GATA factors regulate LYL1 transcription. Post-translational processing and degradation are the main regulatory mechanisms controlling protein expression and function. San-Marina et al. [23] concluded that the cAMP regulatory elementbinding protein (CREB1), a widely expressed transcription factor and a suspected oncogene in AML, was a binding partner for LYL1. The interaction between LYL1 and CREB1 occurs at the N-terminal domain of LYL1 and the Q2 and KID domains of CREB1. The histone acetyltransferase p300 and the core-binding protein are recruited to these complexes, leading to Ser 133 phosphorylation and direct transcriptional activation. The ability of LYL1 to modulate promoter responses to CREB1 suggests that it might play a role in the malignant phenotype. Lukov et al. proposed in their study that post-translational mechanisms for upregulation of LYL1 might contribute to its oncogenic role [24]. We observed higher overexpression of LYL1 in MDS compared to de novo AML cases. This suggests that involution chromosomal abnormalities may contribute to oncogenic pathogenesis in MDS patients. These findings confirmed the aberrant expression of LYL1 in AML and MDS, first by increased expression in the stem population and then by persistent expression in the downstream progeny. Meng et al. observed that CD34-enriched AML cells had a slightly higher level of LYL1 expression in the AML population. This indicated that LYL1 was highly expressed in the stem cell fraction, while Lukov et al. [25] found increased proliferation and suppressed apoptosis of progenitor cells and presented substantial evidence supporting the pro-leukemic effect of LYL1 in early hematopoietic progenitors with the potential to cause expansion of malignant cells with a stem cell/early progenitorlike phenotype. Therefore, deregulated transcription and its consequence on key development pathways seems to play a major role in the molecular pathogenesis of lymphoid malignancy, as concluded by O’Neil and Look [26]. However, further research is required to explain this finding in myeloid malignancies, especially MDS. In regard to our observation of increased expression of LYL1 in M2, M3, and M6 subtypes of AML, the higher levels of LYL1 expression are likely to be associated with the malignant behavior of primary AML cells. This finding is in agreement with the study by Meng et al. on leukemic cell lines, which detected LYL1 expression to increase the growth rate and plating efficiency of the cell lines with differential potential of leukemic cells and showed overexpression of LYL1 in U937 cells to block the all-trans retinoic acid (ATRA)-induced monocytic differentiation. Furthermore, this study demonstrated increased LYL1 133
Turk J Hematol 2014;31:128-135
expression in erythroid cell populations and suggested that LYL1 might act as a regulator of erythroid differentiation. A study by Capron et al. [27] investigated the effect of LYL1 deficiency in mice and showed increased SCL/TAL1 and GATA1 transcripts in spleen but not in BM-derived erythroblasts with increased hypersensitivity to erythropoietin through increased phenyl hydrazine. It has been shown that LYL1 overexpression can lead to marked inhibition of the ATRA-induced expression of the monocytic marker CD14 in leukemic cell lines, and that forced expression of LYL1 in K562 cells enhanced spontaneous and hemin-induced erythroid differentiation but blocked spontaneous as well as phorbol myristate acetateinduced megakaryocytic differentiations. Furthermore, increased expression of LYL1 has been reported to enhance resistance to cytarabine in cell lines. Our study shows for the first time that there is a significant correlation between the blood counts at diagnosis and overexpression of LYL1. No previous studies gave an idea about this correlation. However, our suggestion may reflect the value of this expression on the degree of maturation of myeloid cells, erythroid cells, and megakaryopoiesis (hematopoietic lineage), and may be explained by the proleukemic effect of LYL1 in early hematopoietic progenitors as observed in a study by Lukov et al. Further research on large groups of AML cases is required to clarify this finding. Furthermore, we tested whether the LYL1 expression of BM samples at diagnosis could predict the response to induction chemotherapy or the achievement of complete remission. We observed in our study that the rate of complete remission was lower with very high levels of LYL1 expression and that the risk of relapse increased with higher levels of LYL1 expression, suggesting an unfavorable prognosis for cases with enhanced expression. This finding is in line with the results of a study by Meng et al. [28] which revealed that downregulation of LYL1 expression in AML resulted in an increased complete remission rate. Downregulation of endogenous expression of LYL1 in K562 cells by a combination of 3 specific siRNAs could inhibit cellular growth and clonogenicity to some extent, as concluded in the study by Meng et al. It was also postulated in that study that aberrant expression of LYL1 in MDS and AML played a role in the development and phenotype of the diseases by altering the differentiation potential of the cells, increasing the growth rate and plating efficiency of AML cells, and reducing the drug sensitivity. In line with other limited studies, our work points to the value of LYL1 and presents this transcription factor as a new target for therapeutic inhibition in hematological malignancies. These observations could foreshadow a promising tool for a therapeutic target to bHLH protein related to transcription factor as RNA interference targeting specific oncogenes may improve patient outcome in AML, MDS, and CML in blast crisis and will improve the efficacy of chemotherapy and increase the survival rate of those patients. Further work on homogeneous populations with higher numbers of patients 134
El-Menshawy N, et al: Clinical Significance of LYL1 Gene Expression
and prolonged follow-up is required to clarify the impact of LYL1 overexpression on the prognosis of patients with AML and MDS. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Tenen DG. Disruption of differentiation in human cancer: AML shows the way. Nat Rev Cancer 2003;3:89-101. 2. Cleary ML, Mellentin JD, Spies J, Smith SD. Chromosomal translocation involving the beta T cell receptor gene in acute leukemia. J Exp Med 1988;167:682-687. 3. Mellentin JD, Smith SD, Cleary ML. lyl-1, a novel gene altered by chromosomal translocation in T cell leukemia, codes for a protein with a helix-loop-helix DNA binding motif. Cell 1989;58:77-83. 4. Kuo SS, Mellentin JD, Copeland NG, Gilbert DJ, Jenkins NA, Cleary ML. Structure, chromosome mapping, and expression of the mouse Lyl-1 gene. Oncogene 1991;6:961968. 5. Giroux S, Kaushik AL, Capron C, Jalil A, Kelaidi C, Sablitzky F, Dumenil D, Albagli O, Godin I. lyl-1 and tal-1/scl, two genes encoding closely related bHLH transcription factors, display highly overlapping expression patterns during cardiovascular and hematopoietic ontogeny. Gene Expr Patterns 2007;7:215-226. 6. Ferrier R, Nougarede R, Doucet S, Kahn-Perles B, Imbert J, Mathieu-Mahul D. Physical interaction of the bHLH LYL1 protein and NF-kappaB1 p105. Oncogene 1999;18:9951005. 7. Baer R. TAL1, TAL2 and LYL1: a family of basic helix-loophelix proteins implicated in T cell acute leukaemia. Semin Cancer Biol 1993;4:341-347. 8. Rabbitts TH. Chromosomal translocation master genes, mouse models and experimental therapeutics. Oncogene 2001;20:5763-5777. 9. Beillard E, Pallisgaard N, van der Velden VH, Bi W, Dee R, van der Schoot E, Delabesse E, Macintyre E, Gottardi E, Saglio G, Watzinger F, Lion T, van Dongen JJ, Hokland P, Gabert J. Evaluation of candidate control genes for diagnosis and residual disease detection in leukemic patients using â&#x20AC;&#x153;real-timeâ&#x20AC;? quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR) - A Europe Against Cancer program. Leukemia 2003;17:2474-2486. 10. Miyamoto A, Cui X, Naumovski L, Cleary ML. Helixloop-helix proteins LYL1 and E2a form heterodimeric complexes with distinctive DNA-binding properties in hematolymphoid cells. Mol Cell Biol 1996;16:2394-2401.
El-Menshawy N, et al: Clinical Significance of LYL1 Gene Expression
11. Chambers SM, Boles NC, Lin KY, Tierney MP, Bowman TV, Bradfute SB, Chen AJ, Merchant AA, Sirin O, Weksberg DC, Merchant MG, Fisk CJ, Shaw CA, Goodell MA. Hematopoietic fingerprints: an expression database of stem cells and their progeny. Cell Stem Cell 2007;1:578-591. 12. Visvader J, Begley CG, Adams JM. Differential expression of the LYL, SCL and E2A helix-loop-helix genes within the hemopoietic system. Oncogene 1991;6:187-194. 13. Capron C, Lecluse Y, Kaushik AL, Foudi A, Lacout C, Sekkai D, Godin I, Albagli O, Poullion I, Svinartchouk F, Schanze E, Vainchenker W, Sablitzky F, Bennaceur-Griscelli A, Dumenil D. The SCL relative LYL-1 is required for fetal and adult hematopoietic stem cell function and B-cell differentiation. Blood 2006;107:4678-4686. 14. Asnafi V, Beldjord K, Libura M, Villarese P, Millien C, Ballerini P, Kuhlein E, Lafage-Pochitaloff M, Delabesse E, Bernard O, Macintyre E. Age-related phenotypic and oncogenic differences in T-cell acute lymphoblastic leukemias may reflect thymic atrophy. Blood 2004;104:4173-4180. 15. Ferrando AA, Neuberg DS, Staunton J, Loh ML, Huard C, Raimondi SC, Behm FG, Pui CH, Downing JR, Gilliland DG, Lander ES, Golub TR, Look AT. Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell 2002;1:75-87. 16. Zhong Y, Jiang L, Hiai H, Toyokuni S, Yamada Y. Overexpression of a transcription factor LYL1 induces Tand B-cell lymphoma in mice. Oncogene 2007;26:69376947. 17. Souroullas GP, Salmon JM, Sablitzky F, Curtis DJ, Goodell MA. Adult hematopoietic stem and progenitor cells require either Lyl1 or Scl for survival. Cell Stem Cell 2009;4:180186. 18. Mellentin JD, Smith SD, Cleary ML. lyl-1, a novel gene altered by chromosomal translocation in T cell leukemia, codes for a protein with a helix-loop-helix DNA binding motif. Cell 1989;58:77-83. 19. Garrell J, Campuzano S. The helix-loop-helix domain: a common motif for bristles, muscles and sex. Bioessays 1991;13:493-498.
Turk J Hematol 2014;31:128-135
20. Meng YS, Khoury H, Dick JE, Minden MD. Oncogenic potential of the transcription factor LYL1 in acute myeloblastic leukemia. Leukemia 2005;19:1941-1947. 21. Meng YS, Wei R, Ai GW, Meng XQ, Zhang YX. Abnormal expression of transcription factors LYL1 and LMO2 and interaction between them in myeloid leukemia. Zhonghua Yi Xue Za Zhi 2009;89:890-893. 22. Chan WY, Follows GA, Lacaud G, Pimanda JE, Landry JR, Kinston S, Knezevic K, Piltz S, Donaldson IJ, Gambardella L, Sablitzky F, Green AR, Kouskoff V, Göttgens B. The paralogous hematopoietic regulators Lyl1 and Scl are coregulated by Ets and GATA factors, but Lyl1 cannot rescue the early Scl−/− phenotype. Blood 2007;109:19081916. 23. San-Marina S, Han Y, Suarez Saiz F, Trus MR, Minden MD. Lyl1 interacts with CREB1 and alters expression of CREB1 target genes. Biochim Biophys Acta 2008;1783:503-517. 24. Lukov GL, Goodell MA. LYL1 degradation by the proteasome is directed by a N-terminal PEST rich site in a phosphorylation-independent manner. PLoS One 22010;5:e12692. 25. Lukov GL, Rossi L, Souroullas GP, Mao R, Goodell MA. The expansion of T-cells and hematopoietic progenitors as a result of overexpression of the lymphoblastic leukemia gene, LYL1 can support leukemia formation. Leuk Res 2011;35:405-412. 26. O’Neil J, Look AT. Mechanisms of transcription factor deregulation in lymphoid cell transformation. Oncogene 2007;26:6838-6849. 27. Capron C, Lacout C, Lecluse Y, Wagner-Ballon O, Kaushik AL, Cramer-Borde E, Sablitzky F, Dumenil D, Vainchenker W. LYL-1 deficiency induces a stress erythropoiesis. Exp Hematol 2011;39:629-642. 28. Meng YS, Zhang XY, Ai GW, Meng XQ, Liu W, Jiang W. Expression of transcription factor LYL1 in leukemia and its possible role in leukemogenesis. Zhonghua Xue Ye Xue Za Zhi 2008;29:749-752.
135
Research Article
DOI: 10.4274/tjh.2013.0011
Local Renin-Angiotensin System in Normal Hematopoietic and Multiple Myeloma-Related Progenitor Cells Normal Hematopoetik ve Multipl Myelom İlişkili Progenitor Hücrelerde Lokal Renin-Anjiotensin Sistemi Burak Uz1, Suzin Çatal Tatonyan2, Müge Sayitoğlu2, Yücel Erbilgin2, Özden Hatırnaz2, Salih Aksu1, Yahya Büyükaşık1, Nilgün Sayınalp1, Hakan Göker1, Osman İ. Özcebe1, Uğur Özbek2, İbrahim C. Haznedaroğlu1 1Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey 2İstanbul University, Institute for Experimental Medicine Research, Department of Genetics, İstanbul, Turkey
Abstract: Objective: The prominent functions of the local renin-angiotensin system (RAS) in primitive hematopoiesis further support the
hypothesis that local autocrine bone marrow RAS could also be active in neoplastic hematopoiesis. The aim of this study is to examine critical RAS elements in normal CD34+ hematopoietic stem cells and multiple myeloma (MM)-related progenitor cells. Materials and Methods: The study group comprised the total bone marrow cells (CBM) of 10 hematologically normal people, the CD34+ stem cell samples (CD34+CBM) of 9 healthy donors for allogeneic peripheral stem cell transplantation, and the CD34+ stem cell samples (CD34+MM) of 9 MM patients undergoing autologous peripheral stem cell transplantation. We searched for the gene expression of the major RAS components in healthy hematopoietic cells and myeloma cells by quantitative real-time polymerase chain reaction analysis. Results: RENIN, angiotensinogen (ANGTS), and angiotensin converting enzyme-I (ACE I) mRNA expression levels of CBM were significantly higher than those in myeloma patients (p=0.03, p=0.002, and p=0.0008, respectively). Moreover, RENIN and ANGTS mRNA expression levels were significantly higher in CD34+ stem cell samples of healthy allogeneic donors compared to those in myeloma patients (p=0.001 and p=0.01). However, ACE I expression levels were similar in CD34+CBM and CD34+MM hematopoietic cells (p=0.89). Conclusion: Although found to be lower than in the CBM and CD34+CBM hematopoietic cells, the local RAS components were also expressed in CD34+MM hematopoietic cells. This point should be kept in mind while focusing on the immunobiology of MM and the processing of autologous cells during the formation of transplantation treatment protocols. Key Words: Renin-angiotensin system, Multiple myeloma, Progenitor cell, CD34+
Özet: Amaç: Lokal renin-anjiotensin sisteminin (RAS) primitif hematopoezde önemli fonksiyonlara sahip olması, lokal otokrin
kemik iliği (Kİ) RAS’ının da neoplastik hematopoezde aktif olabileceği hipotezini desteklemektedir. Bu çalışmanın amacı normal CD34+ hematopoetik kök hücreler ve multipl miyelom (MM) ilişkili progenitor hücrelerde kritik RAS elemanlarını araştırmaktır.
Address for Correspondence: Burak Uz, M.D., Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey Phone: +90 312 305 15 43 E-mail: burakuz78@gmail.com Received/Geliş tarihi : January 11, 2013 Accepted/Kabul tarihi : April 17, 2013
136
Turk J Hematol 2014;31:136-142
Uz B, et al: Local Renin-Angiotensin System in Multiple Myeloma
Gereç ve Yöntemler: Çalışma grupları; hematolojik açıdan normal insanların toplam Kİ hücreleri (CBM) (n=10), allojeneik periferik kök hücre transplantasyonu için sağlıklı donörlerin CD34+ kök hücre örnekleri (CD34+CBM) (n=9), ve otolog periferik kök hücre transplantasyonu uygulanan MM hastalarının CD34+ kök hücre örnekleri (CD34+MM) (n=9) tarafından oluşturuldu. Bu örneklerde ana RAS elemanlarının gen ekspresyonları qRT-PCR yöntemiyle araştırıldı. Bulgular: CBM grubunun RENIN, anjiotensinojen (ANGTS), ve anjiotensin dönüştürücü enzim-I (ACE I) mRNA ekspresyon düzeyleri miyelom hastalarından anlamlı olarak yüksek idi (sırasıyla, p=0,03, p=0,002, ve p=0,0008). Sağlıklı allojeneik donörlerin CD34+ kök hücre örneklerindeki RENIN ve ANGTS mRNA ekspresyon düzeyleri myelom hastalarının kök hücre örneklerinden anlamlı derecede yüksek bulundu (p=0,001 and p=0,01). Bununla birlikte, CD34+CBM ve CD34+MM hematopoetik hücrelerde ACE I ekspresyon düzeyleri arasında anlamlı fark gözlenmedi (p=0,89). Sonuç: Lokal RAS elemanları, CBM ve CD34+CBM hematopoetik hücrelerinden daha az olmak kaydıyla, CD34+MM hematopoetik hücrelerinden de eksprese edilmektedir. Bu nokta MM’nin immünobiyolojisine odaklanmada ve transplantasyon tedavi protokollerinin oluşturulması sırasında otolog hücrelerin hazırlanmasında akılda tutulmalıdır. Anahtar Sözcükler: Renin-anjiotensin sistemi, Multipl miyelom, Progenitör hücre, CD34+
Introduction The local hematopoietic renin-angiotensin system (RAS) affects the essential steps of hematopoiesis in the bone marrow (BM) microenvironment [1,2,3,4]. Myelopoiesis, erythropoiesis, thrombopoiesis, and other cellular lineages are influenced by the actions of the local BM RAS [3]. Besides those cellular effects, the local RAS [4,5] is also active in the BM stromal niche for the crucial governing of hematopoietic functions [6,7]. The local BM RAS affects hematopoiesis via both altering the internal signals of transcription factors regulating gene expressions and mediating the external signals from the growth factors secreted from the BM microenvironmental hematopoietic and stromal cells [8,9,10,11]. The RAS affects numerous biological events that are important for the formation and function of blood cells. Apoptosis, cellular proliferation, intracellular signaling, mobilization, angiogenesis, fibrosis within the cytokine network, and many other essential pathobiological events are affected by the critical RAS molecules [3,4,5,12,13]. Malignant blood cells, including multiple myeloma (MM) cells, are derived from the clonal neoplastic stem cells within a complex series of pathological proliferative steps. The local BM RAS could affect neoplastic tumoral blood cell production [14,15,16,17,18,19,20,21,22]. The local RAS is effective even in embryonic hematopoiesis [23,24,25,26]. The prominent functions of the local RAS in primitive hematopoiesis further support the hypothesis that the local autocrine BM RAS could also be active in neoplastic hematopoiesis [3]. The aim of this study is to examine critical RAS elements in normal CD34+ hematopoietic stem cells and MM-related progenitor cells. For this purpose, CD34+ hematopoietic cells obtained from healthy peripheral allogeneic hematopoietic stem cell transplantation donors and from MM patients undergoing peripheral autologous stem cell
transplantation were analyzed via quantitative real-time polymerase chain reaction analysis (qRT-PCR). Normal BM cells obtained from hematologically normal people were also studied to detect the impact of precursor cell compartments on RAS expressions. Elucidation of the status of the local RAS molecules in early and neoplastic hematopoiesis represents a clinically relevant basic research area for better understanding of the biology of the diseases [4,5]. Materials and Methods Study Population The study group comprised the total bone marrow cells (CBM) of 10 normal people, the CD34+ stem cell samples (CD34+CBM) of 9 healthy donors for allogeneic peripheral stem cell transplantation, and the CD34+ stem cell samples (CD34+MM) of 9 MM patients undergoing autologous peripheral stem cell transplantation. The diagnoses of MM were reached based on the criteria of the International Myeloma Working Group [27]. At the time of the sample collection, all of the patients were in good health and well hydrated. Written informed consent was obtained from all participants and the study protocol was approved by the local ethics committee of Hacettepe University. Isolation of RNA and Synthesis of cDNA Stem cell samples were collected in 2 mL ethylenediaminetetraacetic acid tubes. Total RNA was isolated according to the manufacturer’s instructions (QIAGEN, Germany). RNA quality was measured by spectrophotometer (ND-1000, NanoDrop Technologies, Inc., USA), and 1 µg of total RNA was used. Random primers (20 µM, Roche Diagnostics, Germany), 10 mM dNTP set (Fermentas UAB, Lithuania), RiboLock RNase Inhibitor (20 U/µL, Fermentas) and Moloney murine leukemia virus reverse transcriptase (200 U/µL, Fermentas) were used for cDNA synthesis. cDNA samples were stored at -20 °C. 137
Uz B, et al: Local Renin-Angiotensin System in Multiple Myeloma
Quantitative Real-Time Polymerase Chain Reaction Analysis We searched for the gene expression of the major RAS components including RENIN, angiotensinogen (ANGTS), angiotensin converting enzyme-I (ACE I), ACE II, angiotensin receptor-I (AGTR I), and AGTR II in healthy hematopoietic cells and myeloma cells by qRT-PCR. Previously designed primer-probes were used [28]. mRNA levels were normalized to CYPA and B-ACTIN genes. The qRT-PCR analyses were performed using a LightCycler 480 instrument (Roche Diagnostics). Real-time amplification was performed with a final reaction mixture of 20 µL containing 5 µM of each primer, 0.5 µM of each probe, LightCycler 480 Probe Master Mix, and 100 ng/µL of cDNA. Each sample was studied in duplicate and all runs were repeated twice. The PCR protocol was as follows: initial denaturation at 95 °C for 7 min, and amplification segment at 5 s at 95 °C, 10 s at 60 °C, and 10 s at 72 °C for 45 cycles. The 2-Ct method was used to calculate relative expression levels determined from the qRT-PCR experiments [29] and results were given as percentages.
Turk J Hematol 2014;31:136-142
I genes in CD34+MM cells compared to CD34+CBM cells are given in Table 1. Other RAS pathway members’ (ACE II, AGTR I, and AGTR II) expressions were also examined and were not found to be at detectable levels, and no significant differences were determined between any groups. Discussion In the present study, RENIN and ANGTS mRNA expressions were significantly higher in CD34+ hematopoietic stem cells of healthy allogeneic donors in comparison to myeloma-related progenitor cells. Likewise, RENIN, ANGTS, and ACE I mRNA expression levels of CBM were significantly higher than those in the myeloma patients. However, ACE I expression levels were similar in CD34+CBM and CD34+MM hematopoietic cells. These findings support our original hypothesis that there is a biologically active local RAS in the hematopoietic system in normal and pathological states [1,2]. Strawn et al. previously verified in rats that all of the main RAS components, including renin, ANGTS, ACE,
Statistical SPSS 15.0 (SPSS Inc., USA) was used for all statistical analyses. The results were given as mean ± standard error for the data with normal distribution, as median (min-max) for the data without a normal distribution, and as ratio for the nominal data. Data distribution was tested with the Kolmogorov-Smirnov test. Homogeneities of variances were evaluated with Levene’s test. Nonparametric tests were used since the sample sizes of the groups were small. Differences between 2 groups were assessed by the Mann-Whitney U test. A p-value of ≤0.05 was considered statistically significant. Results Patient Characteristics Five female and 4 male myeloma patients with a median age of 52 (40-62) years were recruited. Based on the International Staging System, 4 had stage I, 2 had stage II, and 2 had stage III disease. One patient could not be evaluated due to the lack of initial data. Relative mRNA Expressions of the RAS Components in the Studied Cellular Samples RENIN, ANGTS, and ACE I mRNA expression levels of CBM were significantly higher than those in myeloma patients (p=0.03, p=0.002, and p=0.0008, respectively; Figures 1, 2, 3). Moreover, RENIN and ANGTS mRNA expression levels were significantly higher in CD34+ stem cell samples of healthy allogeneic donors compared to those in myeloma patients (p=0.001 and p=0.01; Figures 1 and 2). However, ACE I expression levels were similar in the CD34+CBM and CD34+MM groups (p=0.89; Figure 3). Relative expression levels of RENIN, ANGTS, and ACE 138
Figure 1. Relative RENIN mRNA expression levels (%) of total bone marrow cells of hematologically normal people (CBM), CD34+ stem cells of healthy allogeneic donors (CD34+CBM), and CD34+ stem cells of myeloma patients (CD34+MM). Table 1. Relative expression levels of RENIN, ANGTS, and ACE I genes compared to CD34+ control bone marrow cells.
CD34+MM RENIN 0.029±0.01
CD34+CBM p-value 4.84±2.90
0.03
ANGTS 0.000096±0.00063 0.0036±0.0084
0.01
ACE I
0.89
0.013±0.003
0.011±0.0024
Turk J Hematol 2014;31:136-142
Uz B, et al: Local Renin-Angiotensin System in Multiple Myeloma
Figure 2. Relative ANGTS mRNA expression levels (%) of the total bone marrow cells of hematologically normal people (CBM), CD34+ stem cells of healthy allogeneic donors (CD34+CBM), and CD34+ stem cells of myeloma patients (CD34+MM).
Figure 3. Relative ACE I mRNA expression levels (%) of the total bone marrow cells of hematologically normal people (CBM), CD34+ stem cells of healthy allogeneic donors (CD34+CBM), and CD34+ stem cells of myeloma patients (CD34+MM).
and AGTR I, are detectable in the normal rat BM cellular compartment and rat microenvironmental stroma at the molecular and protein levels [6]. In the present study, we have found RENIN, ANGTS, and ACE I mRNA expressions in CD34+ stem cell samples of normal human subjects. ACE/CD143 was implicated in enhancing the recruitment of primitive stem cells into the S-phase by degrading AcSDKP [9,30,31,32,33]. ACE, converting Ang-I into Ang-II, is an important peptide for almost all aspects of hematopoiesis [23,31,34,35,36]. Myelopoietic effects of ACE and Ang-II are evident at the hematopoietic stem cell level, extending to the committed myeloid and erythroid lineages [35]. Hence, the local hematopoietic RAS seems to be effective in all species for cellular development. Hematopoiesis [37], myelopoiesis [35], erythropoiesis [38], thrombopoiesis [9], and other cellular lineages [37,39,40,41] are regulated by the actions of the peptides of the local BM RAS. The local BM RAS mediates those complicated networks of BM hematopoiesis in an autocrine/paracrine/intracrine fashion. The growth, production, proliferation and differentiation of the blood cells are affected by the hematopoietic RAS [1,4,5].
presenting cells in myelin-oligodendrocyte glycoproteininduced experimental autoimmune diseases [42]. In this study, CD34+MM hematopoietic cells also locally expressed RENIN, ANGTS, and ACE I mRNA, indicating the activity of RAS in myeloma-related progenitor cells. ACE activity was also linked to MM [43,44]. BM AGTR I expression levels of myeloma patients showed a positive correlation with their BM infiltration pattern and tumor load, indicated by serum β2 microglobulin levels [44]. Our results about myelomarelated progenitors in this study provide an additional clue for the local RAS effects in the pathobiology of MM.
The local RAS is also expressed in the cellular compartment of the immunohematological system. The RAS is active in the production and function of distinct blood cell lineages such as dendritic cells, mast cells, T lymphocytes, monocytes, macrophages, and antigen-presenting cells [4,5]. For instance, ACE degrades substance P present in the BM microenvironment, lymphoblasts, and lymphocytes by cleaving a C-terminal dipeptide or tripeptide [41]. Stegbauer et al. reported the up-regulation of renin, ACE, and AGTR I in the immune system, including antigen-
Recent studies [23,24,25,26] focused on the status of ACE within the context of the local RAS, the earliest human embryonic hematopoietic stem cells [45], and the developmental sequence underlying the ontogeny of human blood cells. The local RAS regulates the genesis and function of the hematopoietic system starting from embryonic life [25]. Human embryonic stem cell-derived ACE+CD45-CD34+/- cells are the common yolk sac-like progenitors for not only the endothelium, but also for both primitive and definitive human lymphohematopoietic stem cells [26]. Human angiohematopoiesis initiates from an ACE-hemangioblastic progenitor of primitive and definitive hematopoiesis under the functional activities of the local RAS [26]. Sinka et al. [24] searched for the presence of ACE in the earliest pre-aorta-gonad-mesonephros stages of human intraembryonic angiohematopoiesis. At the earliest stages of human development, hematopoietic potential in the splanchnopleura is restricted to emerging CD34-ACE+ precursors. ACE expression has functions 139
Uz B, et al: Local Renin-Angiotensin System in Multiple Myeloma
in the maintenance of embryonic hematopoiesis [24]. The results of the present study show that the main RAS components are present in early hematopoietic stem cells and progenitors as well as BM stem, progenitor, and precursor cells. Therefore, manipulation of RAS action could be an important strategy for the expansion of multipotent hematopoietic progenitors during hematopoietic stem cell-related management procedures [46]. The development of MM depends upon deregulation in a complex series of neoplastic pathobiological events. The local tissue RAS influences tumor growth and metastases in an autocrine and paracrine fashion, via the modulation of numerous carcinogenic events such as angiogenesis, apoptosis, cellular proliferation, immune responses, cell signaling, and extracellular matrix formation. Potential manipulation of the local RAS with many enzymes, peptides, and feedback mechanisms can even represent a therapeutic target for the clinical management of cancer [34,47,48]. Our findings about the CD34+MM hematopoietic cells, which locally express critical RAS components in the myeloma-related progenitor cells, could be a starting point for future studies functions on the immunobiology of MM and processing of autologous cells during the formation of transplantation treatment protocols. Future experimental and clinical studies are needed to elucidate the puzzling functions of local tissue RASs, including the local BM RAS. These efforts should focus on dissecting local RAS interactions with the complicated pathobiological characteristics of neoplastic disorders and on manipulating autocrine-paracrine-intracrine systems for better clinical management of patients with hematological neoplastic disorders. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Haznedaroğlu IC, Tuncer S, Gürsoy M. A local renin -angiotensin system in the bone marrow. Med Hypotheses 1996;46:507-510. 2. Haznedaroglu IC. A local renin-angiotensin system in the bone marrow still awaits its Christopher Columbus. Exp Hematol 1998;26:279. 3. Haznedaroglu IC, Beyazit Y. Local bone marrow renin– angiotensin system in primitive, definitive and neoplastic haematopoiesis. Clin Sci (Lond) 2013;124:307-323. 4. Haznedaroglu IC, Beyazit Y. Pathobiological aspects of the local bone marrow renin-angiotensin system: a review. J Renin Angiotensin Aldosterone Syst 2010;11:205-213. 140
Turk J Hematol 2014;31:136-142
5. Haznedaroglu IC, Öztürk MA. Towards the understanding of the local hematopoietic bone marrow renin-angiotensin system. Int J Biochem Cell Biol 2003;35:867-880. 6. Strawn WB, Richmond RS, Tallant EA, Gallagher PE, Ferrario CM. Renin-angiotensin system expression in rat bone marrow haematopoietic and stromal cells. Br J Haematol 2004;126:120-126. 7. Huang YL, Kuang J, Hu YZ, Song YB, Qiu RF, Mai WY. Bone marrow stromal cell transplantation combined with angiotensin-converting enzyme inhibitor treatment in rat with acute myocardial infarction and the role of insulin-like growth factor-1. Cytotherapy 2012;14:563-569. 8. Haznedaroğlu IC, Arici M, Büyükaşik Y. A unifying hypothesis for the renin-angiotensin system and hematopoiesis: sticking the pieces together with the JAKSTAT pathway. Med Hypotheses 2000;54:80-83. 9. Kwiatkowski BA, Richard RE. Angiotensin II receptorassociated protein (AGTRAP) synergizes with Mpl signaling to promote survival and to increase proliferation rate of hematopoietic cells. ASH Annual Meeting Abstracts 2009;114:3606. 10. Öztürk MA, Güven GS, Haznedaroglu IC. How hematopoietic stem cells know and act in cardiac microenvironment for stem cell plasticity? Impact of local renin-angiotensin systems. Med Hypotheses 2004;63:866-874. 11. Vrsalovic MM, Pejsa V, Veic TS, Kolonic SO, Ajdukovic R, Haris V, Jaksic O, Kusec R. Bone marrow renin-angiotensin system expression in polycythemia vera and essential thrombocythemia depends on JAK2 mutational status. Cancer Biol Ther 2007;6:1434-1436. 12. Durik M, Seva Pessoa B, Roks AJ. The renin-angiotensin system, bone marrow and progenitor cells. Clin Sci (Lond) 2012;123:205-223. 13. Heringer-Walther S, Eckert K, Schumacher SM, Uharek L, Wulf-Goldenberg A, Gembardt F, Fichtner I, Schultheiss HP, Rodgers K, Walther T. Angiotensin-(1-7) stimulates hematopoietic progenitor cells in vitro and in vivo. Haematologica 2009;94:857-860. 14. Abali H, Haznedaroğlu IC, Goker H, Çelik I, Özatlı D, Koray Z, Çağlar M. Circulating and local bone marrow reninangiotensin system in leukemic hematopoiesis: preliminary evidences. Hematology 2002;7:75-82. 15. Aksu S, Beyazit Y, Haznedaroglu IC, Canpinar H, Kekilli M, Uner A, Sayinalp N, Büyükaşik Y, Goker H, Ozcebe OI. Over-expression of angiotensin-converting enzyme (CD 143) on leukemic blasts as a clue for the activated local bone marrow RAS in AML. Leuk Lymphoma 2006;47:891-896. 16. Aksu S, Beyazit Y, Haznedaroglu IC, Kekilli M, Canpinar H, Misirlioğlu M, Uner A, Tuncer S, Sayinalp N, Büyükaşik Y, Goker H, Ozcebe OI. Enhanced expression of the local haematopoietic bone marrow renin-angiotensin system in polycythemia rubra vera. J Int Med Res 2005;33:661-667.
Turk J Hematol 2014;31:136-142
17. Beyazit Y, Aksu S, Haznedaroglu IC, Kekilli M, Misirlioglu M, Tuncer S, Karakaya J, Koca E, Buyukasik Y, Sayinalp N, Goker H. Overexpression of the local bone marrow reninangiotensin system in acute myeloid leukemia. J Natl Med Assoc 2007;99:57-63. 18. Casares MTG, De la Iglesia S, Perera M, Lemes A, Campo C, Gonzalez San Miguel JD, Bosch JM, Suarez A, Guerra L, Rodriguez-Peréz JC, Molero T. Renin expression in hematological malignancies and its role in the regulation of hematopoiesis. Leuk Lymphoma 2002;43:2377-2381. 19. Inigo SDL, Casares MTG, Jorge CEL, Leiza SM, Santana GS, Bravo de Laguna SJ, San Miguel JD, Caballero A, Alvarez Mdel M, Castellano AL, Henríquez HL, Labarta TM. Relevance of renin expression by real-time PCR in acute myeloid leukemia. Leuk Lymphoma 2006;47:409416. 20. Khodunova EE, Parovichnikova EN, Gal’tseva IV, Kulikov SM, Isaev VG, Savchenko VG. Dynamic study of Bcl-2, Bax, p53, and ACE expression in CD34+ cells of peripheral blood and bone marrow in acute leukemia patients in the course of induction chemotherapy. Ter Arkh 2011;83:32-37. 21. Wulf GG, Jahns-Streubel G, Nobiling R, Strutz F, Hemmerlein B, Hiddemann W, Wörmann B. Renin in acute myeloid leukaemia blasts. Br J Haematol 1998;100:335-337. 22. Koca E, Haznedaroglu IC, Acar K, Beyazit Y, Aksu S, Misirlioglu M, Tuncer S, Sayinalp N, Ozcebe OI, Uner A. Renin-angiotensin system expression in the K562 human erythroleukaemic cell line. J Renin Angiotensin Aldosterone Syst 2007;8:145-147.
Uz B, et al: Local Renin-Angiotensin System in Multiple Myeloma
28. Uz B, Catal Tatonyan S, Sayitoglu M, Erbilgin Y, Hatirnaz Ng O, Buyukasik Y, Sayinalp N, Aksu S, Goker H, Ozcebe OI, Ozbek U, Haznedaroglu IC. Local hematopoietic renin-angiotensin system in myeloid versus lymphoid hematological neoplastic disorders. J Renin Angiotensin Aldosterone Syst 2013;14:308-314. 29. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-408. 30. Comte L, Lorgeot V, Bignon J, Volkov L, Dupuis F, Wdzieczak-Bakala J, Praloran V. In vivo modifications of AcSDKP metabolism and haematopoiesis in mice treated with 5-fluorouracil and Goralatide. Eur J Clin Invest 1998;28:856-863. 31. Comte L, Lorgeot V, Volkov L, Allegraud A, Aldigier JC, Praloran V. Effects of the angiotensin-converting enzyme inhibitor enalapril on blood haematopoietic progenitors and acetyl-N-Ser-Asp-Lys-Pro concentrations. Eur J Clin Invest 1997;27:788-790. 32. Li J, Volkov L, Comte L, Herve P, Praloran V, Charbord P. Production and consumption of the tetrapeptide AcSDKP, a negative regulator of hematopoietic stem cells, by hematopoietic microenvironmental cells. Exp Hematol 1997;25:140-146. 33. Oliveira CR, Paredes-Gamero EJ, Barbosa CM, Nascimento FD, Batista EC, Reis FC, Martins AH, Ferreira AT, Carmona AK, Pesquero JB, Tersariol IL, Araújo RC, Bincoletto C. Myelopoiesis modulation by ACE hyperfunction in kinin B1 receptor knockout mice: relationship with AcSDKP levels. Chem Biol Interact 2010;184:388-395.
23. Jokubaitis VJ, Sinka L, Driessen R, Whitty G, Haylock DN, Bertoncello I, Smith I, Péault B, Tavian M, Simmons PJ. Angiotensin-converting enzyme (CD143) marks hematopoietic stem cells in human embryonic, fetal, and adult hematopoietic tissues. Blood 2008;111:4055-4063.
34. Abali H, Güllü IH, Engin H, Haznedaroğlu IC, Erman M, Tekuzman G. Old antihypertensives as novel antineoplastics: angiotensin-I-converting enzyme inhibitors and angiotensin II type 1 receptor antagonists. Med Hypotheses 2002;59:344-348.
24. Sinka L, Biasch K, Khazaal I, Peault B, Tavian M. Angiotensinconverting enzyme (CD143) specifies emerging lymphohematopoietic progenitors in the human embryo. Blood 2012;119:3712-3723.
35. Lin C, Datta V, Okwan-Duodu D, Chen X, Fuchs S, Alsabeh R, Billet S, Bernstein KE, Shen XZ. Angiotensin-converting enzyme is required for normal myelopoiesis. FASEB J 2010;25:1145-1155.
25. Tavian M, Biasch K, Sinka L, Vallet J, Peault B. Embryonic origin of human hematopoiesis. Int J Dev Biol 2010;54:10611065.
36. Marusic-Vrsalovic M, Dominis M, Jaksic B, Kusec R. Angiotensin I-converting enzyme is expressed by erythropoietic cells of normal and myeloproliferative bone marrow. Br J Haematol 2003;123:539-541.
26. Zambidis ET, Soon Park T, Yu W, Tam A, Levine M, Yuan X, Pryzhkova M, Péault B. Expression of angiotensinconverting enzyme (CD143) identifies and regulates primitive hemangioblasts derived from human pluripotent stem cells. Blood 2008;112:3601-3614. 27. International Myeloma Working Group. Criteria for the classification of monoclonal gammopathies, multiple myeloma and related disorders: a report of the International Myeloma Working Group. Br J Haematol 2003;121:749757.
37. Hubert C, Savary K, Gasc JM, Corvol P. The hematopoietic system: a new niche for the renin-angiotensin system. Nat Clin Pract Cardiovasc Med 2006;3:80-85. 38. Kato H, Ishida J, Imagawa S, Saito T, Suzuki N, Matsuoka T, Sugaya T, Tanimoto K, Yokoo T, Ohneda O, Sugiyama F, Yagami K, Fujita T, Yamamoto M, Nangaku M, Fukamizu A. Enhanced erythropoiesis mediated by activation of the renin-angiotensin system via angiotensin II type 1a receptor. FASEB J 2005;19:2023-2025. 141
Uz B, et al: Local Renin-Angiotensin System in Multiple Myeloma
39. Hara M, Ono K, Wada H, Sasayama S, Matsumori A. Preformed angiotensin II is present in human mast cells. Cardiovasc Drugs Ther 2004;18:415-420. 40. Park TS, Zambidis ET. A role for the renin-angiotensin system in hematopoiesis. Haematologica 2009;94:745-747. 41. Shen XZ, Bernstein KE. The peptide network regulated by angiotensin converting enzyme (ACE) in hematopoiesis. Cell Cycle 2011;10:1363-1369. 42. Stegbauer J, Lee DH, Seubert S, Ellrichmann G, Manzel A, Kvakan H, Muller DN, Gaupp S, Rump LC, Gold R, Linker RA. Role of the renin-angiotensin system in autoimmune inflammation of the central nervous system. Proc Natl Acad Sci U S A 2009;106:14942-14947. 43. Albayrak M, Celebi H, Albayrak A, Sayilir A, Yesil Y, Balcik OS, Yokus O, Celik T. Elevated serum angiotensin converting enzyme levels as a reflection of bone marrow renin-angiotensin system activation in multiple myeloma. J Renin Angiotensin Aldosterone Syst 2012;13:259-264.
142
Turk J Hematol 2014;31:136-142
44. Saka B, Dogan O, Tascioglu C, Besisik SK, Karan MA, Sayitoglu S, Erten N, Genc S. Bone marrow renin-angiotensin system in multiple myeloma. Clin Lymphoma Myeloma Leuk 2009;9:S10. 45. Tavian M, Peault B. The changing cellular environments of hematopoiesis in human development in utero. Exp Hematol 2005;33:1062-1069. 46. Peters A, Burridge PW, Pryzhkova MV, Levine MA, Park TS, Roxbury C, Yuan X, PĂŠault B, Zambidis ET. Challenges and strategies for generating therapeutic patient-specific hemangioblasts and hematopoietic stem cells from human pluripotent stem cells. Int J Dev Biol 2010;54:965-990. 47. Ager EI, Neo J, Christophi C. The renin-angiotensin system and malignancy. Carcinogenesis 2008;29:1675-1684. 48. George AJ, Thomas WG, Hannan RD. The renin-angiotensin system and cancer: old dog, new tricks. Nat Rev Cancer 2010;10:745-759.
Research Article
DOI: 10.4274/tjh.2012.0210
Wilms Tumor 1 Gene Mutations in Patients with Cytogenetically Normal Acute Myeloid Leukemia Normal Sitogenetiğe Sahip Akut Miyeloid Lösemi Hastalarında Wilms Tümör 1 Geni Mutasyonları Salah Aref1, Solafa El Sharawy1, Mohamed Sabry1, Emad Azmy2, Dalia Abdel Raouf1, Nadia El Menshawy1 1Mansoura University Faculty of Medicine, Department of Clinical Pathology, Hematology Unit, Mansoura, Egypt 2Mansoura University Faculty of Medicine, Mansoura Cancer Institute, Clinical Hematology Unit, Mansoura, Egypt
Abstract: Objective: This study aimed to assess the prognostic impact of Wilms tumor 1 (WT1) mutations in cytogenetically normal acute myeloid leukemia (CN-AML) among Egyptian patients.
Materials and Methods: Exons 1, 2, 3, 7, 8, and 9 of WT1 were screened for mutations in samples from 82 CNAML patients out of 203 newly diagnosed AML patients, of age ranging from 21 to 74 years, using high-resolution capillary electrophoresis. Results: Eleven patients out of 82 (13.41%) harbored WT1 mutations. Mutations were detected in exon 7 (n=7), exon 9 (n=2), exon 8 (n=1), and exon 3 (n=1), but not in exons 1 or 2. There was no statistically significant difference between the WT1 mutants and wild types as regards age, sex, French-American-British subtypes, and the prevalence of success of induction remission therapy (p=0.966; 28.6% vs. 29.3%). Patients with WT1 mutations had overall survival lower than patients with the wild type (HR=1.38; 95% CI 4.79-6.86; p=0.004).
Conclusion: CN-AML patients with WT1 mutations have poor clinical outcome. We recommend molecular testing for WT1 mutations in patients with CN-AML at diagnosis in order to improve risk stratification of those patients.
Key Words: Acute myeloid leukemia, Cytogenetically normal, Mutations, Prognosis, Wilms tumor 1 gene Özet: Amaç: Bu çalışma sitogenetiği normal akut miyeloid lösemi (SN-AML) tanısı olan Mısırlı hastalarda Wilms tümör 1 (WT1) mutasyonlarının prognoz üzerine etkilerini incelemeyi amaçlamaktadır.
Gereç ve Yöntemler: İki yüz üç yeni tanılı AML hastası arasından yaşları 21 ile 74 arasında değişen 82 SN-AML hastasına ait örneklerde exon 1, 2, 3, 7, 8 ve 9 WT1’e ait mutasyonlar açısından yüksek çözünürlüklü kapiller elektroforez kullanılarak tarandı.
Bulgular: Seksen iki hastanın 11’i (%13,41) WT1 mutasyonlarını taşımaktaydı. Mutasyonlar exon 7 (n=7), exon 9 (n=2), exon 8 (n=1) ve exon 3’te (n=1) tespit edildi, ancak exon 1 veya 2’de tespit edilmedi. WT1 mutasyonunu taşıyanlar ile taşımayanlar arasında yaş, cinsiyet, French-American-British (FAB) alt tipleri ve indüksiyon tedavisindeki başarı açısından Address for Correspondence: Salah Aref, M.D., Mansoura University Faculty of Medicine, Department of Clinical Pathology, Hematology Unit, Mansoura, Egypt E-mail: salaharef@yahoo.com Received/Geliş tarihi : December 28, 2012 Accepted/Kabul tarihi : April 2, 2013
143
Turk J Hematol 2014;31:143-148
Aref S, et al: Impact of WT1 Mutations in Cytogenetically Normal AML
istatistiksel anlamlı farklılık saptanmadı (p=0.966; 2%8.6 vs. %29.3). WT1 mutasyonu olan hastalarda genel sağkalım mutasyonu olmayanlara göre daha düşük bulundu (HR=1.38; %95 CI 4.79-6.86; p=0.004).
Sonuç: WT1 mutasyonu olan SN-AML hastalarında klinik gidiş kötüdür. SN-AML hastalarında tanı anında daha iyi bir risk sınıflaması yapmak için WT1 mutasyonlarının moleküler testlerle araştırılmasını önermekteyiz. Anahtar Sözcükler: Akut miyeloid lösemi, Sitogenetiği normal, Mutasyonlar, Prognoz, Wilms tümör 1 geni
Materials and Methods
Introduction Acute myeloid leukemia (AML) is a clinically and genetically heterogeneous disease that accounts for 20% and 70% of acute leukemia in children and adults, respectively. The cytogenetic finding is considered as the cardinal marker for AML risk stratification. Cytogenetically normal AML (CN-AML) is a large cytogenetic subgroup of AML, representing approximately 45% of adult patients with AML who are younger than 60 years. During the last decade, the prognostic stratification of CN-AML was based on several molecular markers including the nucleophosmin 1 gene, the fms-related tyrosine kinase 3 gene, the CCAAT/enhancerbinding protein alpha gene, the myeloid-lymphoid or mixed-lineage leukemia gene, the neuroblastoma RAS viral oncogene homolog gene, the runt-related transcription factor 1 gene, and the Wilms tumor 1 gene (WT1) [1,2]. WT1 was identified as a tumor suppressor gene, located at chromosome 11p and encoding a transcription factor with an N-terminal transcriptional regulatory domain (exons 1 to 6) and a C-terminal 4-Cys2His2 zinc finger domain (exons 7 to 10) [3,4]. WT1 expression occurs primarily in cells of the developing genitourinary and hematopoietic systems and is inversely correlated with the degree of differentiation in both systems. In hematopoiesis, expression occurs in CD34 progenitor cells but is absent in mature leukocytes. The precise role of WT1 in normal and malignant hematopoiesis remains controversial [5,6]. It has been implicated in regulation of cell survival, proliferation, and differentiation, and it may function as an oncogene. However, this diversity may reflect both tissue specificity of downstream targets and expression of different isoforms, given that alternatively spliced isoforms and post-transcriptional modifications are thought to control the cellular and functional properties of the protein [7,8]. WT1 mutations have been found in about 10%-15% of cases of AML and 20% of cases of biphenotypic leukemia, but mutations are rare in acute lymphoblastic leukemia (ALL) [2]. In AML, the WT1 mutations cluster mainly in exons 7 and 9, and less frequently in exons 1, 2, 3, and 8 [9,10]. The aim of this study was to evaluate the incidence and clinical impact of WT1 mutations in adult patients with CNAML. 144
Subjects and Treatment Protocols The present study was carried out on 82 adult patients (21-74 years) from the hematology unit of the Mansoura Cancer Institute between June 2009 and January 2011, after patients provided written consent. The diagnosis of AML was based on the presence of blast cells at ≥20% in bone marrow (BM) smears. Eighty patients had de novo AML and 2 had secondary AML (5 M1, 18 M2, 30 M4, 23 M5, 6 M6). The diagnosis and French-American-British subtypes were confirmed by immunophenotyping using a Coulter Epics XL Flowcytometer (PN 42372238 B, Coulter Corporation, Miami, FL, USA) to confirm diagnosis with Cyt. MPO, CD13, CD33, and CD117 as a primary panel for myeloid lineage; CD14, CD36, and CD11b for M4 and M5; CD61 and glycophorin A for M6; and CD41 and CD42 for M7. The patients were observed for 12 months or until death. History taking and clinical examination for organomegaly were done for all patients. All patients gave informed consent for both treatment and genetic analysis. All patients received intensive induction therapy (cytarabine, 100 mg/m2/day for 7 days of i. v. continuous infusion, and daunorubicin, 45 mg/m2/day for 3 days i. v.) and consolidation therapy (cytarabine, 3 g/ m2/12 h for 3 days repeated for 3-6 cycles). Methods Cytogenetic and Molecular Genetic Analysis Pretreatment blood samples from all patients were studied by chromosome banding analysis to improve the accuracy of cytogenetic diagnosis and to exclude cytogenetically abnormal AML. The specimens were also analyzed by fluorescence in situ hybridization for the presence of t (8;21) (q22;q22) for M2, t (15;17) (q22;q12) for M3, inv (16) (p13q22) for M4E, or 11q23 for M5. Determination of Mutation Status in CN-AML WT1 exons 1, 2, 3, 7, 8, and 9 were amplified using polymerase chain reaction (PCR) with approximately 50 ng of genomic DNA, 1X QIAGEN Multiplex PCR Master Mix, and 10 pmol of primers (6` FAM end-labeled forward primers) designed to flank intronic regions. For exon 1, due to the long size and some difficulties in fragment amplification, 3 different primer pairs were used: 1F (5`-AGCCAGAGCAGCAGGGAGT -3`) and 1R (5`-
Turk J Hematol 2014;31:143-148
Aref S, et al: Impact of WT1 Mutations in Cytogenetically Normal AML
ACGACCCGTAAGCCGAAGC -3`), annealing temperature was 64 °C; 1F (5`- ATGGGCTCCGACGTGC -3`) and 1R (5`ATGAAGGAGTGAGGCGG -3`), annealing temperature was 54 °C; 1F (5`- TTCGGCTTACGGGTCGTTGG -3`) and 1R (5`CAAAAGGGGTAGGAGAGGGG -3`), annealing temperature was 62 °C. For exon 2, 2F (5`- CCGTCTTGCGAGAGCACC -3`) and 2R (5`- CTAATTTGCTGTGGGTTAGG -3`) were used with an annealing temperature of 58 °C; for exon 3, 3F (5`- GCTCAGGATCTCGTGTCTCC -3`) and 3R (5`GCCTCCAAGACCCAGCAT -3`), annealing temperature was 64 °C; for exon 7, 7F (5`- GACCTACGTGAATGTTCACATG -3`) and 7R (5`- ACCAACA CCTGGATCAGACCT -3`), annealing temperature was 60 °C; for exon 8, 8F (5`- GAGATCCCCTTTTCCAG -3`) and 8R (5`CACAGCTGCCAGCAATG -3`), annealing temperature was 56 °C; and for exon 9, 9F (5′- CTCACTGTGCCCACATTG -3′) and 9R 5’- CAATTTCATTCCACAATAG -3’), annealing temperature was 58 °C (Applied Biosystems, Foster City, CA, USA). Thirty-five cycles of amplification were performed. PCR products were then analyzed by fragment analysis using high-resolution capillary electrophoresis on an ABI 310 Genetic Analyzer (PE Applied Biosystems, Foster City, CA, USA). The wild-type amplicon was 348 bp. For samples with additional peaks representing mutant amplicons, the relative mutant level was calculated from the area under the curve and expressed as a percentage of total WT1 alleles (mutant/[wild type + mutant(s)] x 100). Statistical The statistical analysis of data was done using Excel and SPSS 16. Qualitative data were described in the form of numbers and percentages. Quantitative data were described in the form of mean ± standard deviation (SD). Statistical analysis was done by comparison between groups using the chi-square test regarding qualitative data, while quantitative nonparametric data comparison was performed using oneway ANOVA and the paired samples t-test. The probability of results being explained by chance (p-value) was calculated for all parameters (significance at p≤0.05 with 95% confidence interval). Overall survival (OS) was defined as the time from diagnosis to the last follow-up or death from any cause. The probabilities of OS were estimated by the Kaplan-Meier method, and differences between 2 survival distributions were compared with the log-rank test. Results Prevalence of WT1 Mutations WT1 mutations were identified in 11 out of 82 (13.41%) patients. Mutations were detected in exon 7 (n=7), exon 9 (n=2), exon 3 (n=1), and exon 8 (n=1) but were not detected in exons 1 and 2. Detection was performed on diagnostic DNA samples from 82 adult CN-AML patients by using high-resolution capillary electrophoresis. The mutation levels ranged from 6% to 51% in the form of additional peaks at 355, 360, 373, and 390 bp (Figure 1).
Patient Characteristics in Relation to WT1 Mutation Status Characteristics of the WT1 mutant and wild-type cases are shown in Table 1. There was no difference between the 2 groups in terms of age, sex, type of leukemia (de novo or secondary), French-American-British subtypes, and complete blood count at presentation. However, there was a significant difference between the 2 groups regarding the bone marrow blast cell percentage (p=0.038). Response to Therapy and Clinical Outcome in WT1 Mutant-Positive Patients In univariate analysis, there was no difference in the rates of complete remission (CR) (18.2% vs. 49.2%) between WT1mutant and WT1 wild-type patients, respectively (Table 2). On the other hand, the patients with WT1 mutations had shorter OS than patients with wild-type WT1 (HR=1.38; 95% CI 4.79-6.86; p=0.004). The percentage of living wildtype patients was 37.3% versus 14.2% in the mutant-type patients at 6 months and 32% versus 0.0% at 12 months, respectively (Figure 2). Discussion In a previous study of AML, the WT1 mutations predominantly clustered in exon 7 (mostly frameshift mutations resulting from insertions or deletions) and less frequently in exon 9 (mostly substitutions), whereas in patients with Denys-Drash syndrome or Frasier syndrome, the majority of WT1 mutations were point mutations located either in Zn fingers 2 and 3 (exons 8 and 9) or, in cases of Frasier syndrome, in intron 9 [2]. WT1 mutations were identified in 11 cases out of the 82 adult CN-AML patients (13.41%) in the present study. This figure is slightly higher than those reported by Virappane et al. [8] of 10% and by Paschka et al. [11] of 10.7%, but is in accordance with that reported by Gaidzik et al. [2]. The difference may be explained by the fact that, in our study, the entire WT1 coding sequence was analyzed, and mutations other than those in exons 7 or 9 were identified. In the current study, there was no significant difference between the WT1 mutant and wild type as regards age, sex, WBC count, hemoglobin concentration, platelet count, and French-American-British subtypes. Similar findings were reported by Virappane et al. [8]. On the other hand, Paschka et al. [11] and Gaidzik et al. [2] demonstrated a significant difference between the WT1 mutant and wild type as regards WBC counts. In our study, a significant association between the WT1 mutation and high BM blast counts was detected. This finding is in agreement with those of Virappane et al. [8], Paschka et al. [11], and Gaidzik et al. [2], who stated that the WT1 mutation might induce high proliferation capacity of blast cells. 145
Turk J Hematol 2014;31:143-148
Aref S, et al: Impact of WT1 Mutations in Cytogenetically Normal AML
The results in this study revealed that there was a nonsignificant difference between the WT1 mutant and wild type in rate of induction remission (IR). This agrees with the finding of Paschka et al. [11] and Gaidzik et al. [2], who did not find a relation between WT1 mutations and achievement of IR. On the other hand, Virappane et al. [8] found that patients with WT1 mutations had an inferior response to induction chemotherapy, with a low CR rate and higher induction death rate.
In the present study, CN-AML patients with WT1 mutation had short OS (2.7 months) as compared to patients with the wild type (5.8 months). The difference was statistically significant (p=0.004). This result is in agreement with those of Paschka et al. [11] and Virappane et al. [8], who found that mutations in the WT1 gene were independent predictors for worse disease-free survival and OS in CN-AML. On the other hand, Gaidzik et al. [2] reported no correlation between the presence of WT1
Table 1. Clinical and demographic characteristics of the 82 CN-AML patients studied.
WT1 wild type No. %
WT1 mutant type No. %
De novo AML Secondary AML
69 2
86.2 100
11 0
13.8 0
FAB type M1 M2 M4 M5 M6
4 16 25 20 6
80 88.9 83.3 86.9 100
1 2 5 3 0
20 11.1 16.7 13.1 0
0.344
Age 20-29 30-39 40-49 50-59 >60
16 10 9 17 19
84.2 90.0 81.8 89.5 86.3
3 1 2 2 3
15.8 10.0 18.2 10.5 16.7
0.252
Sex Female Male
41 30
89.1 83.3
5 6
10.9 16.7
0.108
WBC, x109/L <10 10-49.9 50-99.9 >100
10 30 17 14
90.0 85.7 85.0 87.5
1 5 3 2
10.0 14.3 15 12.5
0.434
% BM blasts <20-30 30-49 50-79 >80
5 5 31 30
100 100 77.5 93.8
0 0 9 2
0 0 12.5 6.2
0.038
Organomegaly Splenomegaly Hepatomegaly
37 34
88.9 85.0
5 6
11.1 15.0
0.126 0.127
Hemoglobin, g/dL Mean ± SD
7.78±1.55
8.5±0.16
0.23
Platelets, x109/L Mean ± SD
52.3±40.5
43.8±22.7
0.587
146
p-value
Turk J Hematol 2014;31:143-148
Aref S, et al: Impact of WT1 Mutations in Cytogenetically Normal AML
Table 2. Response to therapy in WT1 mutant and wild-type patients.
WT1 mutant WT1 wild Total type (n=11) type (n=71) Remission
Not Remission
Total
No.
9
36
45
%
81.8
50.8
54.9
No.
2
35
37
%
18.2
49.2
45.1
No.
11
71
82
%
100.0
100.0
100.0
a
b
Figure 1. Capillary electrophoresis of WT1 exon 7: a) wildtype peak at 348 bp; B) wild-type peak at 348 bp and mutant peaks at 355 bp.
p-value
Odds ratio
0.966
1.038
ERG and BAALC more frequently than do patients with unmutated WT1 [13]. Over-expression of both the ERG and the BAALC genes has been associated with an adverse prognosis. Moreover, WT1 mutations would be expected to abolish, impair, or change the DNA-binding ability of the WT1 protein to its target genes, including those that encode proteins involved in the regulation of normal hematopoiesis (RARA, CSF1), apoptosis (BCL2, BCL2A1, BAK1), cell cycle (CCNE1, CDKN1A), gene transcription (MYC, PAX2, MYB, EGR1), and cell proliferation (TGFB1, PDGFA) [11,14]. In conclusion, CN-AML patients with WT1 mutation have poor clinical outcome. We recommend molecular testing for WT1 mutations in patients with CN-AML at diagnosis in order to improve risk stratifications of those patients. As a limitation of this study, the number of patients enrolled was relatively small, and during statistical analysis we found that there was a need to sub-classify the AML patients into those harboring mutations of WT1 and those with the wild type. This led to a decrease in the statistical power of some analyses. We therefore suggest that future studies include larger groups. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included. References
Figure 2. Overall survival in CN-AML patients according to the mutational status of WT1. The overall survival time was significantly shorter in the group of CN-AML patients harboring WT1 mutations as compared to those with the wild type (p=0.004). mutations and OS. Moreover, in childhood ALL, Özgen et al. [12] stated that the degree of WT1 expression had no impact on patients’ survival. The effect of WT1 mutation on a patient’s survival could be explained on the basis that patients with mutated WT1 have high expressions of
1. Brown P. Adding WT1 to childhood AML alphabet soup. Blood 2009;113:5696-5697. 2. Gaidzik VI, Schlenk RF, Moschny S, Becker A, Bullinger L, Corbacioglu A, Krauter J, Schlegelberger B, Ganser A, Döhner H, Döhner K; German-Austrian AML Study Group. Prognostic impact of WT1 mutations in cytogenetically normal acute myeloid leukemia: a study of the German-Austrian AML study group. Blood 2009;113:4505-4511. 3. Scott R, Stiller C, Walker L. Syndromes and constitutional chromosomal abnormalities associated with Wilms tumour. J Med Genet 2006;43:705-715. 147
Aref S, et al: Impact of WT1 Mutations in Cytogenetically Normal AML
4. Mrózek K, Marcucci G, Paschka P, Whitman S, Bloomfield C. Clinical relevance of mutations and gene-expression changes in adult acute myeloid leukemia with normal cytogenetics: are we ready for a prognostically prioritized molecular classification? Blood 2007;109:431-448. 5. Hohenstein P, Hastie N. The many facets of the Wilms’ tumour gene, WT1. Hum Mol Genet 2006;15:R196-201. 6. Yang L, Han Y, Suarez Saiz F, Minden M. A tumor suppressor and oncogene: the WT1 story. Leukemia 2007;21:868-876. 7. Ariyaratana S, Loeb D. The role of the Wilms tumour gene (WT1) in normal and malignant haematopoiesis. Expert Rev Mol Med 2007;9:1-17. 8. Virappane P, Gale G, Hills R, Kakkas I, Summers S, Stevens J, Allen C, Green C, Quentmeier H, Drexler H, Burnett A, Linch D, Bonnet D, Lister TA, Fitzgibbon J. Mutation of the Wilms’ tumor 1 gene is a poor prognostic factor associated with chemotherapy resistance in normal karyotype acute myeloid leukemia: The United Kingdom Medical Research Council Adult Leukaemia Working Party. J Clin Oncol 2008;26:5429-5435. 9. Wagner K, Patek C, Cunningham A, Taylor A, Hooper M, Ansell J. C-terminal truncation of WT1 delays but does not abolish hematopoiesis in embryoid bodies. Blood Cells Mol Dis 2002;28:428-435. 10. Owen C, Fitzgibbon J, Paschka P. The clinical relevance of Wilms Tumour 1 (WT1) gene mutations in acute leukaemia. Hematol Oncol 2010;28:13-19.
148
Turk J Hematol 2014;31:143-148
11. Paschka P, Marcucci G, Ruppert A, Whitman S, Mrózek K, Maharry K, Langer C, Baldus C, Zhao W, Powell B, Baer M, Carroll A, Caligiuri M, Kolitz J, Larson R, Bloomfield C. Wilms tumor 1 gene mutations independently predict poor outcome in adults with cytogenetically normal acute myeloid leukemia: a Cancer and Leukemia Group B study. J Clin Oncol 2008;26:4595-4602. 12. Özgen Ü, Anak S, Özbek U, Sarper N, Eryılmaz E, Ağaoğlu L, Devecioğlu Ö, Yalman N, Gedikoğlu G. Prognostic significance of Wilms tumor 1 gene in childhood acute lymphoblastic leukemia. Turk J Hematol 2000;17:183-188. 13. Baldus C, Thiede C, Soucek S, Bloomfield C, Thiel E, Ehninger G. BAALC expression and FLT3 internal tandem duplication mutations in acute myeloid leukemia patients with normal cytogenetics: prognostic implications. J Clin Oncol 2006;24:790-797. 14. Marcucci G, Maharry K, Whitman S, Vukosavljevic T, Paschka P, Langer C, Mrózek K, Baldus C, Carroll A, Powell B, Kolitz J, Larson R, Bloomfield C; Cancer and Leukemia Group B Study. High expression levels of the ETS-related gene, ERG, predict adverse outcome and improve molecular risk-based classification of cytogenetically normal acute myeloid leukemia: A Cancer and Leukemia Group B study. J Clin Oncol 2007;25:3337-3343.
Research Article
DOI: 10.4274/tjh.2012.0164
Assessment of Cytokine Expression Profile in Acute Myeloid Leukemia Patients Before and After Chemotherapy Akut Myeloid Lösemi Hastalarında Kemoterapi Öncesi ve Sonrası Dönemdeki Sitokin Ekspresyon Profilinin Değerlendirilmesi Zargham Sepehrizadeh1,2, Mohammad Mohammadi3, Amirhossein Emami3, Mojtaba Tabatabaei Yazdi1, Saeed Hashemi Bozchlou1, Mohammad Reza Khorramizadeh2,4, Mina Bahrololoumi Shapourabadi1, Elham Jaberi1, Naghmeh Rajaei1, Neda Setayesh1 1Tehran University of Medical Sciences Faculty of Pharmacy, Department of Pharmaceutical Biotechnology, Tehran, Iran 2Tehran University of Medical Sciences, Biotechnology Research Center, Tehran, Iran 3Tehran University of Medical Sciences Fa culty of Medicine, Department of Hematology and Oncology, Tehran, Iran 4Tehran University of Medical Sciences Faculty of Public Health, Department of Pathobiology, Tehran, Iran
Abstract: Objective: One of the major goals of cancer treatment is the monitoring of chemotherapeutic protocols. Quantitative and comparative cytokine expression profiling could be reliable to be used for biomarkers in deadly and fast-growing cancers such as acute myeloid leukemia (AML). The present study aims to assess and further validate cytokines with probable effects on proliferation and maturation of blood cells in AML.
Materials and Methods: Gene expression levels of IL-1β, IL-10, IL-8, TNF-α, and IFN-γ were analyzed before and after chemotherapy and after granulocyte colony-stimulating factor (G-CSF) therapy in 46 AML patients by an in-house quantitative comparative RT-PCR method.
Results: Our findings indicated that although the gene expression level of TNF-α was almost constant in all 3 samples, IL-1β, IL-8, and IL-10 expression levels showed a decrease after chemotherapy and an increase after G-CSF therapy. On the other hand, the expression level of IFN-γ had a different pattern with an increase after chemotherapy and a decrease after G-CSF therapy. Conclusion: Taken together, the results of this study are in support of the idea that the analyzed cytokines could be useful biomarkers for AML treatment monitoring. However, further molecular epidemiological investigations are suggested to elaborate more cancer monitoring biomarkers.
Key Words: Acute myeloid leukemia, Cytokines, Granulocyte colony-stimulating factor, RT-PCR
Address for Correspondence: Neda Setayesh, M.D., Tehran University of Medical Sciences Faculty of Pharmacy, Department of Pharmaceutical Biotechnology, Tehran, Iran Phone: +982164121306 E-mail: nsetayesh@tums.ac.ir Received/Geliş tarihi Accepted/Kabul tarihi
: October 28, 2012 : March 14, 2013
149
Turk J Hematol 2014;31:149-154
Sepehrizadeh Z, et al: Cytokine Gene Profile in AML Patients
Özet: Amaç: Kanser tedavisinin en önemli hedeflerinden bir tanesi de kemoterapi protokollerinin monitörizasyonudur. Niceliksel ve karşılaştırılabilir sitokin ekspresyon profili, akut myeloid lösemi (AML) gibi hızlı ilerleyen ve ölümcül kanserlerde biyobelirteç olarak kullanılmaya uygun görünmektedir. Bu çalışmada, sitokinlerin AML’deki kan hücrelerinin çoğalma ve olgunlaşması üzerine olası etkilerinin değerlendirilmesi ve daha da ötesi doğrulanması amaçlanmıştır.
Gereç ve Yöntemler: Hastanede yatan 46 AML hastasında, kemoterapi öncesi, sonrası ve granülosit koloni sitimüle edici faktör (G-CSF) uygulaması sonrası olacak şekilde, niceliksel karşılaştırmalı RT-PCR yöntemi ile IL-1β, IL-10, IL-8, TNF-α ve IFN-γ’nin gen ekspresyon düzeyleri analiz edildi. Bulgular: Sonuçlarımız, TNF-α gen ekspresyon düzeyinin her üç durumda da sabit kalmasına karşın, IL-1β, IL-8 ve IL-10 ekspresyon düzeylerinin kemoterapi uygulamasından sonra düşerken, G-CSF tedavisinin ardından ise yükseldiğini ortaya koydu. Diğer yandan; IFN-γ ekspresyon düzeyleri ise, kemoterapiden sonra yükselip, G-CSF tedavisinin ardından düşerek tamamen farklı bir paterne sahip olduğunu gösterdi.
Sonuç: Birlikte ele alındığında, AML tedavisinin monitörizasyonunda sitokin ekspresyon analizinin yararlı bir biyobelirteç olduğu düşüncesi bu çalışma sonuçları ile destek bulmuştur. Bununla birlikte, gelecek epidemiyolojik moleküler çalışmaların çok daha fazla kanser takip biyobelirtecinin belirlenmesinde yol gösterici olacağı aşikardır. Anahtar Sözcükler: Akut myeloid lösemi, Sitokinler, Granülosit koloni büyüme etkeni, RT-PCR
Introduction Acute myeloid leukemia (AML) is a heterogeneous group of diseases with respect to biology and clinical course. It is characterized by the rapid proliferation of abnormal cells that accumulate in the bone marrow and interfere with the production of normal blood cells. The majority of patients are above 60 years of age, and they usually receive less intensive chemotherapy due to a high risk of treatmentrelated mortality [1,2]. Mechanisms enabling malignant cells in AML to escape physiologic growth restrictions are largely unknown. The presence of some cytokines can significantly affect the primary result of cytokine action in the processes of diseases [3,4,5]. The cytokines are soluble proteins that form a network that plays a key role in the immunoregulation of lymphocyte function [6,7]. A number of reports suggest that the growth of AML cells is controlled by cytokines produced by the leukemic cells in an autocrine or paracrine way. Unlike normal hematopoietic cells, leukemic blasts from many patients with AML constitutively express cytokines like IL-1, GM-CSF, G-CSF, IL-6, IL-8, TNF-α, and SCF [8,9,10,11]. IL-1β is a proinflammatory cytokine with a broad spectrum of local and systematic activities. It stimulates T helper cells and promotes the proliferation of B cells and lymphocytes. In the case of leukemic blast cells, it is suggested that the proliferation and generation of myeloid progenitor cells is an indirect effect of IL-1β via increasing of the colony-stimulating factor [12,13,14,15]. TNF-α is another proinflammatory cytokine with a wide spectrum of biological activities from the induction of cytological aspects to modulation of the production of other cytokines. In the progenitor lymphocytes, TNF-α stimulates the production 150
of colony-stimulating factors. IFN-γ is an immunomodulator and cell proliferation inhibitor factor. An abnormal level of TNF-α in a patient with AML is probably attributed to the pathogenesis of AML [16]. It can affect AML cell proliferation both when cells are cultured alone and in the presence of nonleukemic stromal cells [17]. IL-8 is an antiinflammatory factor that acts as a chemoattractant for neutrophils in inflammation. IL-10 is an inhibitor of the production of proinflammatory cytokines. Is has been postulated that cytokines are working in a broad network; they modulate the expression of each other and have different and complex biological aspects. Granulocyte colony-stimulating factor (G-CSF) stimulates the proliferation and differentiation of neutrophils and granulocytes. Clinically, G-CSF is used for recovery and the increasing of the neutrophil counts of patients after chemotherapy courses to overcome febrile neutropenia [18]. The expression of cytokines could be considered as a criterion for evaluation of disease and treatment. The expression of some cytokines has been studied in vitro or in vivo in the literature and, surprisingly, there are different and even controversial reports in this field. In this study, we evaluated the expression of IL-1β, IL-10, IL-8, TNF-α, and IFN-γ cytokines in Iranian AML patients before and after chemotherapy and after G-CSF to validate the biomarker monitoring role of these cytokines in AML. Materials and Methods Sample Collection Blood samples were obtained from 46 consenting patients with AML at 3 intervals: before and after chemotherapy and after G-CSF therapy. Control samples were obtained
Turk J Hematol 2014;31:149-154
Sepehrizadeh Z, et al: Cytokine Gene Profile in AML Patients
from normal, healthy people of the same age and sex. All procedures were approved by an ethics committee and the consent of the participants was obtained. RNA Extraction For total RNA extraction, 3-mL blood samples were collected in sterile polypropylene tubes containing 4 mL of guanidine isothiocyanate (5.4 M) solution. The samples were mixed well and were subjected to total RNA extraction with the Roche High Pure RNA extraction kit according to the manufacturer’s instructions (Roche, Germany). The quality of extracted RNA was checked by denatured agarose gel electrophoresis and its quantity was calculated by biophotometer (Eppendorf, Germany) at 260 nm. Reverse Transcription Polymerase Chain Reaction Reverse transcription (RT) was performed using 1 µg of total RNA, 1 U of M-MuLV reverse transcriptase (Expand Reverse Transcriptase, Roche), 20 pmol of oligo(dT)18, 1 µL of dNTPs (10 mmol each), 2 µL of dithiothreitol, and 4 µL of reaction buffer (5X) in a total volume of 20 µL at 42 °C for 60 min.
Results Twenty-nine of 46 patients were female and 17 were male. The mean age of patients was 35 years. The minimum age of patients was 15 and the maximum age was 63. Thirteen of 46 patients were diagnosed with AML type m2 and 9 with m4, respectively (Tables 2, 3, 4). Our findings showed that gene expression of cytokines such as TNF-α, IL-1β, IL-8, INF-γ, and IL-10 in AML patients were lower than in normal controls (Figure 1). Mean gene expression for TNF-α before chemotherapy was 0.2931±0.061, after chemotherapy was 0.3140±0.070, and after G-CSF was 0.3148±0.0926; for normal controls it was 0.5195±0.07 (Figure 2). Mean gene expression for IL-1β before chemotherapy was 0.8696±0.1570, after chemotherapy was 0.6978±0.1460, and after G-CSF was 1.0291±0.2528; for normal controls it was 1.3326±0.08 (Figure 2).
Polymerase chain reaction (PCR; 25 cycles) was performed using 2 µL of synthesized cDNA, 2.5 U of SuperTaq DNA polymerase (ABgene, UK), 0.5 µL of dNTPs (10 mmol each), 2.5 µL of reaction buffer (10X), 1.5 mmol MgCl2, and 20 pmol of specific primers for each cytokine as represented in Table 1 in a total volume of 25 µL. PCR Product Analysis PCR products were analyzed by 1% agarose gel electrophoresis. The density of resultant bands was calculated with UVIdoc software (Geldoc, UVItec, UK). The results for each sample were normalized by β-actin gene expression level and the relative gene expression was calculated. The calculated densitometric results for relative gene expression analyses were depicted as arbitrary units.
Figure 1. Gene expression levels of target genes in normal controls and patients.
Table 1. Specific primers for target genes with respective reference.
Target
Primer
Reference
TNF-α
Forward: 5’-CGAGTGACAAGCCTGTAGCC-3’ Reverse: 5’-GTTGACCTTGGTCTGGTAGG-3’
[20]
IL-1β
Forward: 5’-GGAGCAACAAGTGGTGTTCTC-3’ Reverse: 5’-TTGGGATCTACACTCTCCAGC-3’
This work
IL-10
Forward: 5’-AATAAGGTTTCTCAAGGGGCT-3’ Reverse: 5’-AGAACCAAGACCCAGACATCAA-3’
[21]
IL-8
Forward: 5’-TGCCAAGGAGTGCTAAAGAAC-3’ Reverse: 5’-TCTCCACAACCCTCTGCACC-3’
This work
IFN-γ
Forward: 5’-GCATCGTTTTGGGTTCTC-3’ Reverse: 5’-CATGTCTTCCTTGATGGTCTCC-3’
This work
β-actin
Forward: 5’-GTCCTCTCCCAAGTCCACAC-3’ Reverse: 5’-GTGCACTTTTATTCAACTGGT C-3’
This work
151
Turk J Hematol 2014;31:149-154
Sepehrizadeh Z, et al: Cytokine Gene Profile in AML Patients
Relative gene expression (arbitrary units)
Mean gene expression for IFN-γ before chemotherapy was 0.0809±0.0235, after chemotherapy was 0.3032±0.2089, and after G-CSF was 0.0253±0.0168; for normal controls it was 0.2831±0.06 (Figure 3). Mean gene expression for IL-10 before chemotherapy was 0.0836±0.0353, after chemotherapy was 0.0416±0.0182, and after G-CSF was 0.0817±0.0808; for normal controls it was 0.9435±0.07 (Figure 3). Mean gene expression for IL-8 before chemotherapy was 0.0744±0.0256, after chemotherapy was 0.0272±0.0134, and after G-CSF was 0.0596±0.0384; for normal controls it was 0.2358±0.04 (Figure 3).
Before chemotherapy After chemotherapy After G-CSF
Figure 2. Expression level of TNF-α, IL-1β, and IFN-γ before and after chemotherapy and after G-CSF.
Table 2. Patients’ standard clinical typing: type determination, frequency, and percentage of the studied patients.
FAB type
Frequency
Percentage
Valid percentage
Cumulative percentage
Valid*
13
28.3
28.3
28.3
M1
3
6.5
6.5
34.8
M2
13
28.3
28.3
63.0
M3
4
8.7
8.7
71.7
M4
9
19.6
19.6
91.3
M5
1
2.2
2.2
93.5
M6
3
6.5
6.5
100.0
Total
46
100.0
100.0
*Valid: unclassified AML.
Table 3. Patients’ chemotherapy protocols.
Frequency Percentage
Valid percentage Cumulative percentage
Valid*
5
10.9
10.9
109
5+2
1
2.2
2.2
13
7+3
31
67.4
67.4
80.4
7+3 ATRA
1
2.2
2.2
82.6
ATRA+Idarubicin
3
6.5
6.5
89.1
Conventional**
1
2.2
2.2
91.3
Cytosar–Fludarabine–Novantrone
1
2.2
2.2
93.5
HiDAC
2
4.3
4.3
97.8
Low-dose Ara
1
2.2
2.2
100
Total
46
100
100
*Valid: Patient with no standard treatment protocol. **Conventional: 7+3 regimen followed by HiDAC consolidation. 5+2 (Cytosar continuous infusion IV days 1 to 5 and Idarubicin single dose IV days 1 and 2) 7+3 (Cytosar continuous infusion IV days 1 to 7, Idarubicin single dose IV days 1, 2 and 3)
152
Turk J Hematol 2014;31:149-154
Sepehrizadeh Z, et al: Cytokine Gene Profile in AML Patients
Table 4. Patients’ chemotherapy outcome.
Frequency
Percentage
Valid percentage
Cumulative percentage
Unknown
6
13
13
13
Complete remission
24
52.2
52.2
65.2
Expired
10
21.7
21.7
87
No remission
5
10.9
10.9
97.8
No treatment
1
2.2
2.2
100
Total
46
100
100
Clinical criteria for complete remission: bone marrow blasts of <20%, no blasts in blood smear, no extramedullary disease, hemoglobin of >10 g/dL, platelets of >100,000, absolute neutrophil count of >1500. Relative gene expression (arbitrary units)
blood, or it could be associated with abnormal Th1 to Th2 subpopulation shifting and, hence, activity.
Before chemotherapy After chemotherapy After G-CSF
Figure 3. Expression level of IL-10 and IL-8 before and after chemotherapy and after G-CSF. Discussion There exist numerous studies in the literature that have investigated the gene expression profile of cytokines in patients suffering from AML and other diseases [19,20]. The most significant result of these studies is the great difference of gene expression profiles of leukemic cells in vivo and in vitro. In vitro studies overall show a high expression level of cytokines in cultured leukemic cells due to their maturation and cytokine production in culture medium, but in vivo studies report controversial results. The different in vivo results could stem from the different genotypes in patients or the complexity of the illness from the molecular point of view. For example, Reddy et al. reported a low level of expression for IFN-γ and TNF-α but a high level of expression of IL-8 in AML patients in comparison to healthy controls [21], but Gao et al. reported the highlevel expression of TNF-α and IL-1β in AML patients [22]. Our findings showed that the mean gene expression levels of IL-1β (1.5-fold), TNF-α (1.8-fold), IL-8 (3-fold), IL-10 (11-fold), and IFN-γ (3.5-fold) in healthy normal controls were higher than in the AML patients at a steady state before chemotherapy. The low-level expression of cytokines in patients may be due to the depression of the immune system in AML patients and accumulation of immature cells in the
The results of this study showed that after chemotherapy, the gene expression level of TNF-α does not have any significant increase compared to before chemotherapy, but there is a significant increase in the expression level of IFN-γ after chemotherapy while the expression of IL-1β, IL-10, and IL-8 is decreased after chemotherapy as compared to the state before chemotherapy. The decrease of gene expression level of the mentioned cytokines is probably associated with the cytotoxic effect of chemotherapy on the blood cells, but this could not explain the increase of IFN-γ. The gene expression levels of IL-1β, TNF-α, IL-8, and IL-10 were increased after G-CSF, which could be due to the effect of G-CSF in recovery of the immune system and the stimulation and release of cytokines. The increase of IL-8 and IL-10 reached the same level as before chemotherapy, but in the case of IL-1β, the level increased to higher than the levels before chemotherapy. The expression level of IFN-γ decreased after chemotherapy, probably due to the complex effect of other cytokines on IFN-γ production. Taken together, it could be concluded that the expression level of TNF-α in all 3 samples (before and after chemotherapy and after G-CSF) remains almost constant without any significant change. In the case of IL-1β, IL-8, and IL-10, gene expression decreased after chemotherapy and increased after G-CSF therapy, leading to consideration of these cytokines as potentially useful means for AML chemotherapy monitoring. IFN-γ shows a different pattern of gene expression, increased after chemotherapy and decreased after G-CSF treatment. Considering the complexity and plurality of cytokines’ gene expression profiles in cancer processes, our findings in AML patients show the promising monitoring biomarker potentials of some cytokines. However, further molecular epidemiological investigations on cytokine gene expression patterns in various therapeutic protocols are suggested to elaborate more cancer monitoring biomarkers. 153
Turk J Hematol 2014;31:149-154
Sepehrizadeh Z, et al: Cytokine Gene Profile in AML Patients
Acknowledgment This study was financially sponsored by a research project registered by the Deputy of Research, Tehran University of Medical Sciences, Tehran, Iran. The authors would also like to acknowledge the technical assistance kindly offered by A. Araghi from Imam Khomeini Hospital, Tehran University of Medical Sciences, Tehran, Iran. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included. References 1. Smith M, Barnett M, Bassan R, Gatta G, Tondini C, Kern W. Adult acute myeloid leukemia. Crit Rev Oncol Hematol 2004;50:197-222. 2. Ersvær E, Hampson P, Hatfield K, Ulvestad E, Wendelbo Ø, Lord JM, Gjertsen BT, Bruserud Ø. T cells remaining after intensive chemotherapy for acute myelogenous leukemia show a broad cytokine release profile including high levels of interferon-γ that can be further increased by a novel protein kinase C agonist PEP005. Cancer Immunol Immunother 2006;56:913-925. 3. Baraldi-Junkines CA, Beek AC, Rothstein G. Hematopoiesis and cytokines. Hematol Oncol Clin Amer 2000;14:45-61. 4. Stevens DL. Cytokines: an updated compendium. Current Opin Inf Dis 1995;8:175-180. 5. Ihle JN. Cytokine receptor signaling. Nature 1994;377:591594. 6. Bellanti JA, Kadlec JV, Escobar-Gutierrez A. Cytokines and the immune response. Pediatr Clin North Am 1994;41:597621. 7. Borish L, Rossenwasser LJ. Update on cytokines. J Allergy Clin Immunol 1996;97:719-734. 8. Young D, Griffin J. Autocrine secretion of GM-CSF in acute myeloblastic leukemia. Blood 1986;68:1178-1181. 9. Bradbury D, Bowen G, Kozlowski R, Reilly I, Russell N. Endogenous interleukin-1 can regulate the autonomous growth of the blast cells of acute myeloblastic leukemia by inducing autocrine secretion of GM-CSF. Leukemia 1990;4:44-47. 10. Oster W, Cicco NA, Klein H, Hirano T, Kishimoto T, Lindemann A, Mertelsmann RH, Herrmann F. Participation of the cytokines interleukin 6, tumor necrosis factor-alpha, and interleukin 1-beta secreted by acute myelogenous leukemia blasts in autocrine and paracrine leukemia growth control. J Clin Invest 1989;8:451-457.
154
11. Tobler A, Moser B, Dewald B, Geiser T, Studer H, Baggiolini M, Fey MF. Constitutive expression of interleukin-8 and its receptor in human myeloid and lymphoid leukemia. Blood 1993;82:2517-2525. 12. Heinrich PC, Behrmann I, Haan S, Hermanns HM, MullerNewen G, Schaper F. Principles of interleukin (IL)-6- type cytokine signaling and its regulation. Biochem J 2003;374:120. 13. Houssiau FA, Schandene L, Stevens M, Cambiaso C, Goldman M, Van Snick J, Renauld JC. A cascade of cytokines is responsible for IL-9 expression in human T cell. Involvement of IL-2, IL-4 and IL-10. J Immunol 1995;154:2624-2630. 14. Tan J, Deleuran B, Gesser B, Maare H, Deleuran M, Larsen CG, Thestrup-Pedersen K. Regulation of human T lymphocytes chemotaxis in vitro by T cell derived cytokines IL-2, IFN-γ, IL-4, IL-10, and IL-13. J Immunol 1995;154:3742-3752. 15. Billiau A. Interferon-gamma: biology and role in pathogenesis. Adv Immunol 1996;62:61-130. 16. Bach EA, Aguet M, Schreiber RD. The IFNγ receptor: a paradigm for cytokine receptor signaling. Annu Rev Immunol 1997;15:563-591. 17. Kishimoto T, Taga T, Akira S. Cytokine signal transduction. Cell 1994;76:253-262. 18. Ezaki K. Cytokine therapy for hematological malignancies. Int J Hematol 1996;65:17-29. 19. Bates RC, Mercurio AM. Tumor necrosis factor-α stimulates the epithelial-to-mesenchymal transition of human colonic organoids. Mol Biol Cell 2003;14:1790-1800. 20. Leifeld L, Cheng S, Ramakers J, Dumoulin FL, Trautwein C, Sauerbruch T, Spengler U. Imbalanced intrahepatic expression of interleukin 12, interferon γ, and interleukin 10 in fulminant hepatitis B. Hepatology 2002;36:1001-1008. 21. Reddy VB, Oelschlager DK, Nolan JS, Taylor KL, Post J, Grizzle WE, Manne U. Cytokine expression profiles of patients with acute myelogenous leukemia (AML) and nonHodgkin lymphoma (NHL) detected by multiplex assay. J Clin Oncol ASCO Annual Meeting Proceedings (PostMeeting Edition) 2007;25:18530. 22. Gao XZ, Bi S, Copra H, Devemy E, Venugopal P, Li B, Hsu WT, Loew J, Galvez A, Gregory S, Yang J, Horvath E, Preisler HD. Cytokine gene activity in AML cells in vivo in patients. Leuk Res 1998;22:429-438.
Research Article
DOI: 10.4274/tjh.2012.0042
Investigation of Epstein-Barr Virus and Parvovirus B19 DNA in Allogeneic Stem Cell Transplant Patients Allojenik Kök Hücre Transplantasyonu Yapılan Hastalarda Epstein-Barr Virus ve Parvovirus B19 DNA Araştırılması Altay Atalay1, Selma Gökahmetoğlu1, Süleyman Durmaz1, İdris Kandemir1, Derya Sağlam1, Leylagül Kaynar2, Bülent Eser2, Mustafa Çetin2, Hüseyin Kılıç1 1Erciyes 2Erciyes
University Faculty of Medicine, Department of Clinical Microbiology, Kayseri, Turkey University Faculty of Medicine, Department of Hematology, Kayseri, Turkey
Abstract: Objective: We aimed to investigate posttransplant Epstein-Barr virus (EBV) and parvovirus B19 DNA in allogeneic stem cell transplant patients between 2009 and 2010.
Materials and Methods: Forty-five adult patients in whom allogeneic stem cell transplantation was performed between April 2009 and November 2010 in the Erciyes University Faculty of Medicine, Department of Internal Medicine, Division of Hematology and Oncology, were included in the study. EBV and parvovirus B19 DNA positivity was investigated by using realtime polymerase chain reaction technique in 135 plasma samples obtained after transplantation at between 1 and 6 months. Pretransplant serological markers of EBV and parvovirus B19 were provided from patient files.
Results: In 32 (71.1%) of the patients, EBV antibodies in the pretransplantation period were as follows: anti-EBNA-1 IgG (+), VCA IgM (-), and VCA IgG (+). In 2 patients (4.45%), these antibodies were as follows: anti-EBNA-1 IgG (+), VCA IgM (-), and VCA IgG (-). In 1 patient (2.2%), they were as follows: anti-EBNA-1 IgG (-), VCA IgM (-), and VCA IgG (+). EBV serological markers were negative in 2 (2.2%) out of 45 patients before transplantation. There was low DNA positivity (<600 copies/mL) in 4 patients (8.9%), and VCA IgM was negative and VCA IgG was positive in these same 4 patients. In spite of low viral load, there were no symptoms related to EBV, and posttransplant lymphoproliferative disorder (PTLD) did not occur. While in 44 (99.7%) of 45 patients parvovirus B19 IgM was negative and IgG was positive, parvovirus B19 IgM was positive and IgG was negative in 1 (2.3%) patient. Parvovirus B19 DNA was not identified in any of the samples obtained from these 45 patients. Conclusion: In this study, EBV and parvovirus B19 DNA were investigated in allogeneic stem cell transplant patients. None of the patients developed PTLD and parvovirus B19 DNA positivity was not detected. However, this issue needs to be further evaluated in prospective, multicenter studies with larger series of patients. Key Words: Epstein-Barr virus, Parvovirus B19, Allogeneic stem cell transplantation, Real-time PCR Özet: Amaç: Bu çalışmada, 2009-2010 yılları arasında allojenik kök hücre transplantasyonu (AKHT) yapılan hastalarda transplantasyon sonrası EBV ve parvovirus B19 DNA araştırılması amaçlandı. Address for Correspondence: Altay ATALAY, M.D., Erciyes University Faculty of Medicine, Department of Clinical Microbiology, Kayseri, Turkey Phone: +90 352 207 66 66-23385 E-mail: altayatalay@gmail.com Received/Geliş tarihi : March 27, 2012 Accepted/Kabul tarihi : March 22, 2013
155
Atalay A, et al: EBV and PV B19 After the ASCT
Turk J Hematol 2014;31:155-160
Gereç ve Yöntemler: Bu çalışmaya Erciyes Üniversitesi Tıp Fakültesi İç Hastalıkları Anabilim Dalı HematolojiOnkoloji Bilim Dalı’nda Nisan 2009-Kasım 2010 tarihleri arasında AKHT yapılmış 45 erişkin hasta dahil edildi. Hastaların transplantasyon sonrası 1-6. aylar arasında alınan toplam 135 plazma örneğinde EBV ve parvovirus B19 DNA varlığı gerçek zamanlı PCR yöntemi ile araştırıldı. Hastalara ait transplantasyon öncesi EBV ve parvovirus B19 serolojik göstergeleri hasta dosyalarından temin edildi.
Bulgular: AKHT öncesi serolojik göstergelerde, 45 hastanın 32’sinde (%71,1) EBNA-1 IgG (+), VCA IgM (-) ve VCA IgG (+) idi. İki hastada (%4,45) EBNA-1 IgG (+), VCA IgM (-) ve VCA IgG (-), bir hastada (%2,2) EBNA-1 IgG (-), VCA IgM (-) ve VCA IgG (+) ve 2 (%4,45) hastada tüm serolojik göstergeler negatifti. Transplantasyon sonrası düşük EBV DNA pozitifliği (<600 kopya/mL) 4 (%8,9) hastada saptandı, bu hastaların hepsinde VCA IgM negatif, VCA IgG pozitif bulundu. Düşük viral yüke rağmen bu hastalarda EBV ilişkili semptom görülmemiş ve PTLD gelişmemiştir. Kırk beş hastanın 44’ünde (%97,7) parvovirus B19 IgM negatif, IgG pozitif iken sadece bir hastada (%2,3) parvovirus B19 IgM pozitif, IgG negatifti. Kırk beş hastadan elde edilen örneklerin hiçbirinde parvovirus B19 DNA saptanmadı.
Sonuç: Bu çalışmada AKHT hastalarında EBV ve parvovirus B19 DNA araştırıldı. Hastaların hiçbirinde PTLD gelişmezken parvovirus B19 DNA pozitifliği de saptanmadı. Ancak bu konunun aydınlatılmasında daha geniş hasta serileri ile yapılan, prospektif, çok merkezli ileri çalışmalara ihtiyaç vardır.
Anahtar Sözcükler: Epstein-Barr virüs, Parvovirus B19, Allojenik kök hücre transplantasyonu, Gerçek zamanlı PCR
Introduction Allogeneic stem cell transplantation (ASCT) has been applied as a treatment option in an ever-increasing manner in various malignancies and hematological disorders for 40 years [1]. Posttreatment infections and graft-versushost disease are the most common problems in ASCT [2]. Cytomegalovirus (CMV) is still the most important virus that infects hematopoietic stem cell and solid organ transplant recipients. However, the list of viruses that infect these patients and cause severe morbidity and mortality gets longer each day [3]. The Epstein-Barr virus (EBV) is a member of the family Herpesviridae. EBV infects almost all of the adult population in the world and stays persistent throughout life, as do all the other herpes viruses. Bone marrow transplant recipients carry a 4- to 7- fold increased risk of cancer compared to the normal population. Severe immune deficiency is observed within the first year after transplantation. Posttransplant lymphoproliferative disorder (PTLD) mostly appears in this period, and especially in the first 5 months. The mean PTLD incidence is 1% in allogeneic SCT recipients [4,5]. Human parvovirus (PV) B19 is the smallest DNA virus known so far, a nonenveloped microorganism of 18-26 nm in size [6]. Chronic PV B19 infections are described in many patients following stem cell transplantation. The infections encountered during chemotherapy in this patient group may mimic leukopenic relapses or therapy-induced cytopenias, and thus may cause misdiagnoses, unnecessary blood transfusions, and premature abortion of treatment [7,8]. Therefore, rapid diagnosis and treatment of PV B19 infections is very important in this patient group. The aim of this study was to investigate the occurrence of EBV-DNAemia after ASCT and its duration and magnitude, and to correlate these results with the appearance of 156
EBV-driven PTLD. At the same time, another aim was to investigate the occurrence, duration, and magnitude of PV B19-DNAemia after ASCT. Materials and Methods Forty-five adult patients who underwent ASCT at the Erciyes University Medical Faculty, Department of Internal Medicine, Division of Hematology and Oncology, between April 2009 and November 2010 were included in the study. The presence of EBV and PV B19 DNA were investigated in a total of 135 plasma samples via real-time polymerase chain reaction (PCR) in the posttransplantation period (3 samples from each patient for EBV between the first and sixth months; 3 samples for each patient for PV B19 in the first, second, and third months). Two milliliters of blood samples with ethylenediaminetetraacetic acid was taken from all patients for the investigations of EBV and PV B19 DNAs. Plasma was separated following centrifugation and kept at -70 °C until analyses. DNA extraction from blood plasma was performed by the recommendations of the manufacturer using the EZ1 advanced virus kit (QIAGEN, Germany). DNAs were analyzed via real-time PCR using the EBV RG PCR kit (QIAGEN) for EBV and PV B19 RG PCR kit (QIAGEN) for PV B19. Extracted DNA (10 µL) was added to the plaques containing 15 µL of reaction mixture. An internal control of approximately 0.25 µL was added to the reaction mixture. PCR was conducted for 10 min at 95 °C, and then 45 cycles were repeated as follows: 1 cycle was composed of 15 s at 95 °C, 30 s at 55 °C, and 20 s at 72 °C. Amplification was performed in a Rotor-Gene 6000 instrument (Corbett Research, Australia). The quantitation range of the realtime PCR test for EBV was 600-600.000 copies/mL, and the analytic sensitivity was 157 copies/mL. For PV B19, the quantitation range was 1500-15.000.000 copies/mL and the analytic sensitivity was 30 copies/mL. The serological EBV
Turk J Hematol 2014;31:155-160
Atalay A, et al: EBV and PV B19 After the ASCT
and PV B19 indicators of patients were obtained from the patient files. The ethics committee approved this study. Statistical Statistical analysis was performed using SPSS 13.0. Categorical variables are presented as numbers and percentages, and continuous variables are presented as mean ± SD or median. Results The demographical characteristics of patients included in the study are shown in Table 1. HLA-matching status for ASCT was full-match in 35 patients and all of the allogeneic transplant donors were related. According to the pre-ASCT serological indicators of the patient files, 32 of 45 patients (71.1%) were EBNA-1 IgG (+), VCA IgM (-), and VCA IgG (+). Two patients (4.45%) were EBNA-1 IgG (+), VCA IgM (-), and VCA IgG (-); 1 patient (2.2%) was EBNA-1 IgG (-), VCA IgM (-), and VCA IgG (+); and 2 patients (4.45%) were serologically negative for all indicators. EBNA-1 IgG results could not be obtained for 8 (17.8%) patients. Six of these 8 patients (75%) were VCA IgM (-) and VCA IgG (+), whereas 2 (25%) were VCA IgM (-) and VCA IgG (-). EBV-specific antibody EA was negative in 34 patients (75.5%) and positive in 1 patient (2.2%). The EA-positive patient was VCA IgM (-), VCA IgG (+), and EBNA-1 IgG (+). EA results could not be obtained for 10 patients (22.3%). EBV DNA was positive (<600 copies/mL) in 4 patients (8.9%), and they were all VCA IgM (-) and VCA IgG (+). EBV DNA positivity of these patients belonged to the posttransplantation third month in 2 patients, fifth month in 1 patient, and sixth month in 1 patient (Table 2). No EBV-related symptom or PTLD was observed in these patients despite the low viral load. We wanted to follow the results of all 4 patients that had low EBV viral load, but 1 of
them died and 1 went to another hospital for treatment. We were able to check the results of the other 2 patients, and EBV DNA was found to be negative. In 44 (97.7%) of 45 patients, PV B19 IgM was negative and IgG was positive, whereas in only 1 patient (2.3%), PV B19 IgM was positive and IgG was negative. No PV B19 DNA was observed in the samples obtained from these 45 patients. EBV and PV B19 serology of the donors and patients included in the study are shown in Table 3. Discussion Determining a patient’s risk factors concerning posttransplantation viral infection development may be possible by detecting the virological situations of both the Table 1. Demographic characteristics of patients.
Patient characteristics
n±SD
Age (years)
33.3±11.3
Sex
n (%)
Female
20 (44.4)
Male
25 (55.6)
Pre-ASCT diagnosis
n (%)
Acute myeloid leukemia
21 (46.8)
Aplastic anemia
12 (26.7)
Myelofibrosis
3 (6.7)
Chronic myeloid leukemia
2 (4.4)
Paroxysmal nocturnal hemoglobinuria
2 (4.4)
Non-Hodgkin lymphoma
1 (2.2)
Hodgkin lymphoma
1 (2.2)
Multiple myeloma
1 (2.2)
Table 2. Demographic characteristics, serological indicators, and positivity times of patients with positive EBV DNA.
Patient’s age/sex/diagnosis
EBV-specific antibodies
Posttransplantation EBV DNA positivity time (months)
EA
EBNA
VCA IgM
VCA IgG
32/F/ALL
-
+
-
+
5
23/F/ALL
-
+
-
+
6
23/F/AML
-
+
-
+
3
53/F/AML
-
+
-
+
3
F: Female, EA: early antigen, EBNA: Epstein-Barr nuclear antigen, VCA: viral capsid antigen, ALL: acute lymphocytic leukemia, AML: acute myeloid leukemia
157
Turk J Hematol 2014;31:155-160
Atalay A, et al: EBV and PV B19 After the ASCT
Table 3. EBV and PV B19 serology of the donors and patients.
EBV-specific antibodies
Parvovirus B19-specific antibodies
D EA
P D P EA EBNA EBNA
D VCA IgM
P VCA IgM
D VCA IgG
P VCA IgG
D IgM
P IgM
D IgG
P IgG
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44
NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA -
NA NA NA NA NA + NA NA NA NA -
NA NA + + + + + + + NA + + NA + + NA + NA NA + + + + + + + + + + NA NA NA + + + NA + NA NA NA NA +
NA NA + + + + + NA + + + + + + + + + + + + + + + + NA + + + + NA + + + + NA + + NA NA + +
NA NA NA NA NA NA NA -
-
NA + + + + + + + + + NA + + NA + + NA + NA + + + + + + + + + + + + + NA + + + + + + + NA +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
NA NA NA NA NA NA NA NA NA -
+ -
+ + + + + + + + + + NA + + NA + + + + + + + + + + + + + + + + + NA NA NA + + + NA + NA NA + NA +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + v + + + + + + + + +
45
NA
NA
NA
+
-
-
+
+
NA
-
NA
+
Patient no.
D: Donor, P: Patient, EA: Early antigen, EBNA: Epstein-Barr nuclear antigen, VCA: Viral capsid antigen, NA: Not available.
158
Turk J Hematol 2014;31:155-160
Atalay A, et al: EBV and PV B19 After the ASCT
donor and the recipient just before transplantation. However, this detection alone is not enough; the recipients should be followed regularly after the transplantation and tested in respect to possible viral infections [9]. The viral infections of the posttransplantation period may vary according to the type of the transplant. In patients with stem cell or bone marrow transplantation, polyoma, herpes simplex (HSV), and respiratory and enteric viral infections are common in the first month following the transplantation. In solid organ transplantation recipients, HSV infections are common in the first month following transplantation. In both groups, CMV, EBV, and varicella zoster virus infections may be seen after the second month. Periodic follow-up for viruses other than CMV is suggested in the posttransplantation period. However, no standardization has been provided yet [10]. The serological status of EBV in transplant recipients should be certain before the transplantation since seronegativity is a risk factor. Serology is limited since the severe immunosuppression of transplant recipients after the transplantation procedure inhibits the production of sufficient antibodies. Follow-up of the viral load by nucleic acid amplification tests is the preferred method [11]. Sometimes EBV may infect T/NK cells and cause persistent EBV infection. As a result, a high viral load and EBV-related T/NK cell lymphoproliferative disease follow. Therefore, the quantitation of EBV viral load is important, and the most common method used for this purpose is real-time PCR [12]. PCR-based tests are useful not only in prediction and diagnosis of PTLD, but also in monitoring the response to the treatment [13]. In ASCT patients with PTLD, EBV DNA load is generally higher than that of ASCT patients without PTLD. However, no consensus has been reached concerning which EBV DNA load threshold values cause high risk for EBV-related disease or PTLD development [14]. On the other hand, patients with immunodeficiency may not manifest EBV-related symptoms despite the detectable EBV DNA in their serum or plasma samples [15]. In our study, EBV-related symptoms or PTLD was not present in any of the patients who were detected to be positive for EBV DNA via real-time PCR. Agbalika et al. [16] mentioned that EBV EA-IgG presence in pre-ASCT patients increased the incidence of early PTLD development in the first year following transplantation. In this study, EBV DNA positivity was detected in 4 posttransplantation patients, and the positivity times were as follows: third month in 2 patients, fifth month in 1 patient, and sixth month in 1 patient. EAIgG was negative in 34 (75.5%) patients and positive in 1 (2.2%) patient. EA-IgG results could not be obtained in 10 cases (22.3%). No EA-IgG positivity was detected before transplantation in any of the 4 patients with EBV DNA positivity. PV B19 infections may be met in immunosuppression situations such as congenital or acquired immune deficiency syndrome, organ or bone marrow transplantation, lymphoproliferative disorders, malignancies, and
chemotherapy [17]. In immunosuppressed patients, the clinical findings of PV B19 infection are severe, and viral eradication is late or inadequate. That may cause an aplastic crisis in patients with chronic hemolytic anemia [18]. Plentz et al. [19] detected PV B19 DNA in 21 (1%) of 2123 tested blood samples that were going to be transplanted to patients with hematological cancer [18]. In the posttransplantation period of patients with ASCT, primary or recurrent PV B19 incidence is found to be 1%-2% when sensitive diagnostic methods are used [8,19]. As PV B19 cannot proliferate in continuous cell cultures and serological diagnosis is not reliable in immunosuppressed patients, viral particle- or viral DNA-detecting methods such as PCR and nucleic acid hybridization are needed for diagnosis [20,21]. Manaresi et al. [22] demonstrated that PV B19 DNA could be detected by PCR even if the samples were IgM- and IgGnegative. They also noted the importance of real-time PCR in laboratory diagnosis of PV B19 infections by pointing out that real-time PCR is 5-fold faster than PCR-ELISA and has a high specificity/sensitivity and low contamination risk, and quantitation is possible. Harder et al. [23] emphasized the usefulness of quantitation of viremia by real-time PCR in immunosuppressed, reinfected children for the planning of their treatment. In our study, no PV B19 DNA was detected in any of the posttransplantation patients, 44 of whom were detected to be PV IgM (-) and IgG (+), and 1 of whom was IgM (+) and IgG (-) before ASCT. As a conclusion, in this study investigating EBV and PV B19 DNAs in ASCT patients, no PTLD development or PV B19 DNA positivity was observed. However, further prospective, multicenter studies with wider patient series should be conducted in order to better clarify the subject. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Rieger CT, Rieger H, Kolb HJ, Peterson L, Huppmann S, Fiegl M, Ostermann H. Infectious complications after allogeneic stem cell transplantation: incidence in matched-related and matched-unrelated transplant settings. Transpl Infect Dis 2009;11:220-226. 2. Gratwohl A, Brand R, Frassoni F, Rocha V, Niederwieser D, Reusser P, Einsele H, Cordonnier C ;Acute and Chronic Leukemia Working Parties; Infectious Diseases Working Party of the European Group for Blood and Marrow Transplantation. Cause of death after allogeneic haematopoietic stem cell transplantation (HSCT) in early leukamias: an EBMT analysis of lethal infectious complications and changes over calender time. Bone Marrow Transplant 2005;36:757-769. 3. Fischer SA. Emerging viruses in transplantation: there is 159
Turk J Hematol 2014;31:155-160
more to infection after transplant than CMV and EBV. Transplantation 2008;86:1327-1339. 4. Epstein MA, Crawford DH. Gammaherpesviruses: EpsteinBarr virus. In: Mahy BWJ, Volker TM (eds). Topley and Wilson’s Microbiology and Microbial Infections, Virology Volume 1. 10th ed. London, UK, Hodder Education, 2005. 5. Wagner HJ, Rooney CM, Heslop HE. Diagnosis and treatment of posttransplantation lymphoproliferative disease after hematopoietic stem cell transplantation. Biol Blood Marrow Transplant 2002;8:1-8. 6. Zerbini M, Musiani M. Human parvoviruses. In: Murray PR, Baron EJ, Jorgensen JH, Pfaller MA, Yolken RH (eds). Manual of Clinical Microbiology. 8th ed. Washington, DC, USA, ASM Press, 2003. 7. Lackner H, Sovinz P, Benesch M, Aberle SW, Schwinger W, Schmidt S, Strenger V, Pliemitscher S, Urban C. The spectrum of parvovirus B19 infection in a pediatric hematooncologic ward. Pediatr Infect Dis J 2011;30:440-442. 8. Broliden K. Parvovirus B19 infection in pediatric solidorgan and bone marrow transplantation. Pediatr Transplant 2001;5:320-330. 9. Ljungman P. Risk assessment in haematopoietic stem cell transplantation: viral status. Best Pract Res Clin Haematol 2007;20:209-217. 10. Çolak D. Transplant alıcılarında virolojik ve immünolojik monitörizasyon. Ustaçelebi Ş, Abacıoğlu H, Badur S (eds). III. Ulusal Viroloji Kongresi, Konferanslar ve Bildiriler Kitabı. Ankara, Turkey, Öncü Basımevi, 2007 (in Turkish). 11. Rowe DT, Webber S, Schauer M, Reyes J, Green M. EpsteinBarr virus load monitoring: its role in the prevention and management of post-transplant lymphoproliferative disease. Transpl Infect Dis 2001;3:79-87. 12. Yamashita N, Kimura H, Morishima T. Virological aspects of Epstein-Barr virus infections. Acta Med Okayama 2005;59:239-246. 13. Wagner HJ, Rooney CM, Heslop HE. Diagnosis and treatment of posttransplantation lymphoproliferative disease after hematopoietic stem cell transplantation. Biol Blood Marrow Transplant 2002;8:1-8. 14. Styczynski J, Einsele H, Gil L, Ljungman P. Outcome of
160
Atalay A, et al: EBV and PV B19 After the ASCT
treatment of Epstein-Barr virus-related post-transplant lymphoproliferative disorder in hematopoietic stem cell recipients: a comprehensive review of reported cases. Transpl Infect Dis 2009;11;383-392. 15. Linde A. Epstein-Barr virus. In: Murray PR, Baron EJ, Jorgensen JH, Pfaller MA, Yolken RH (eds). Manual of Clinical Microbiology. 8th ed. Washington, DC, USA, ASM Press, 2003. 16. Agbalika F, Larghero J, Esperou H, Marais D, Robin M, Fois E, de Latour RP, Gluckman E, Rocha V, Benbunan M, Socie G, Marolleau JP. Epstein-Barr virus early-antigen antibodies before allogeneic haematopoietic stem cell transplantation as a marker of risk of post-transplant lymphoproliferative disorders. Br J Haematol 2007;136:305-308. 17. Kuo SH, Lin LI, Chang CJ, Liu YR, Lin KS, Cheng AL. Increased risk of parvovirus B19 infection in young adult cancer patients receiving multiple courses of chemotherapy. J Clin Microbiol 2002;40:3909-3912. 18. Plentz A, Hahn J, Knoll A, Holler E, Jilg W, Modrow S. Exposure of hematologic patients to parvovirus B19 as a contaminant of blood cell preparations and blood products. Transfusion 2005;45:1811-1815. 19. Hayes-Lattin B, Seipel TJ, Gatter K, Heinrich MC, Maziarz RT. Pure red cell aplasia associated with parvovirus B19 infection occurring late after allogeneic bone marrow transplantation. Am J Hematol 2004;75:142-145. 20. Yetgin S, Elmas SA. Parvovirus-B19 and hematologic disorders. Turk J Hematol 2010;27:224-233. 21. Cavallo R, Merlino C, Re D, Bolero C, Bergalla M, Lembo D, Musso T, Leonardi G, Segoloni GP, Ponzi AN. B19 virus infection in renal transplant recipients. J Clin Virol 2003;26:361-368. 22. Manaresi E, Gallinella G, Zuffi E, Bonvicini F, Zerbini M, Musiani M. Diagnosis and quantitative evaluation of parvovirus B19 infections by real-time PCR in the clinical laboratory. J Med Virol 2002;67:275-281. 23. Harder TC, Hufnagel M, Zahn K, Beutel K, Schmitt HJ, Ullmann U, Rautenberg P. New LightCycler PCR for rapid and sensitive quantification of parvovirus B19 DNA guides therapeutic decision-making in relapsing infections. J Clin Microbiol 2001;39:4413-4419.
Research Article
DOI: 10.4274/tjh.2012.0105
Determination of Rate and Causes of Wastage of Blood and Blood Products in Iranian Hospitals İran Hastanelerinde Kan ve Kan Ürünleri İsrafının Oran ve Nedenlerinin Belirlenmesi Rafat Mohebbi Far1, Fatemeh Samiee Rad2, Zahra Abdolazimi3, Mohamad Mehdi Daneshi Kohan4 1Qazvin
University of Medical Sciences, Department of Health Management, Qazvin, Iran
2Qazvin
University of Medical Sciences, Metabolic Research Center, Department of Pathology, Qazvin, Iran
3Master
of Health Management
4Qazvin
University of Medical Sciences, Department of Laboratory, Qazvin, Iran
Abstract: Objective: The purpose of this study was to determine the rate and causes of wastage of blood and blood products (packed red cells, plasma, platelets, and cryoprecipitate) in Qazvin hospitals.
Materials and Methods: The study was conducted in all hospitals in Qazvin, including 5 teaching hospitals, 2 social welfare hospitals, 3 private hospitals, 1 charity hospital, and 1 military hospital. This descriptive study was based on available data from hospital blood banks in the province of Qazvin. The research instrument was a 2-part questionnaire. The first part was related to demographic characteristics of hospitals and the second part elicited information about blood and blood component wastage. The collected data were then analyzed using descriptive statistic methods and SPSS 11.5.
Results: Blood wastage may occur for a number of reasons, including time expiry, wasted imports, blood medically or surgically ordered but not used, stock time expired, hemolysis, or miscellaneous reasons. Data indicated that approximately 77.9% of wasted pack cell units were wasted for the reason of time expiry. Pack cell wastage in hospitals is reported to range from 1.93% to 30.7%. Wastage at all hospitals averaged 9.8% among 30.913 issued blood products. Overall blood and blood product (packed red cells, plasma, platelets, and cryoprecipitate) wastage was 3048 units and average total wastage per participant hospital for all blood groups was 254 units per year. Conclusion: Blood transfusion is an essential part of patient care. The blood transfusion system has made significant advancements in areas such as donor management, storage of blood, cross-matching, rational use of blood, and distribution. In order to improve the standards of blood banks and the blood transfusion services in Iran, comprehensive standards have been formulated to ensure better quality control in collection, storage, testing, and distribution of blood and its components for the identified major factors affecting blood product wastage. Key Words: Blood, Blood component, Wastage, Transfusion, Blood bank
Address for Correspondence: Zahra Abdolazİmİ, M.D., Master of Health Management Phone: +98-935-458-9196 E-mail: abdolazimi88@gmail.com Received/Geliş tarihi : February 15, 2013 Accepted/Kabul tarihi : July 02, 2013
161
Turk J Hematol 2014;31:161-167
Mohebbi Far R, et al: Blood Component
Özet: Amaç: Bu çalışmanın amacı, Qazvin hastanelerinde kan ve kan ürünleri (eritrosit süspansiyonu, plazma, trombosit ve kriyopresipitat) israfının oran ve nedenlerinin belirlenmesiydi.
Gereç ve Yöntemler: Bu çalışma, 5 eğitim hastanesi, 2 sosyal yardım hastanesi, 3 özel hastane, 1 hayır kurumu hastanesi ve 1
askeri hastaneyi içerecek şekilde Qazvin’in tüm hastanelerinde yürütüldü. Çalışmada, Qazvin sınırları dahilindeki hastanelerin kan bankalarından elde edilen veriler temel alındı. Araştırma materyali, iki bölümden oluşan bir anket formuydu. İlk bölüm, hastanelerin demografik özellikleriyle alakalıyken, diğer bölümde ise hastanelerde israf edilen kan ve kan ürünleri hakkında aydınlatıcı bilgiler irdelenmekteydi. Elde edilen veriler, tanımlayıcı istatistiki yöntem ve SPSS 11.5 kullanılarak analiz edildi.
Bulgular: Kan israfı, son kullanma tarihinin dolması, cerrahi ya da diğer kliniklerden istem yapılmasına karşın kullanılmaması, raf ömrünün dolması, hemoliz ve çeşitli başka nedenler dahil olmak üzere pek çok nedenden ötürü olabilmektedir. Verilere göre, israf edilen eritrosit süspansiyonlarının %77,9’u son kullanma tarihinin geçmesi nedeniyle kullanılamamıştır. Kan ürünlerinin israfı, hastane verilerine göre %1,93 ile %30,7 arasında değişmektedir. Tüm hastanelerdeki 30,913 kan ürünü için ortalama kan ürünü israfı %9,8 olmuştur. Toplam kan ve kan ürünü (eritrosit süspansiyonu, plazma, trombosit ve kriyopresipitat) israfının 3048 unite, tüm kan grupları için hastane başına yıllık ortalamanın ise 254 ünite olduğu saptanmıştır. Sonuç: Kan transfüzyonu hasta bakımının yaşamsal bir parçasıdır. Kan transfüzyonu disiplini ise verici yönetimi, kan depolanması, cross-match, kanın akılcı kullanımı ve ayrımı gibi alanlar başta olmak üzere pek çok alanda belirgin ilerlemeler kaydetmiştir. İran’daki kan transfüzyonu yapılan servislerin ve kan bankalarının standartlarının geliştirilmesi için, kan ürünleri israfını etkileyen en önemli nedenleri göz önünde tutacak şekilde kan ve kan ürünlerinin toplanması, depolanması, test edilmesi ve dağıtılmasında yüksek kalite kontrolün elde edilmesine yönelik olarak geniş kapsamlı standartlar oturtulmaktadır. Anahtar Sözcükler: Kan, Kan ürünü, İsraf, Nakil, Kan bankası Introduction There has been a continuing need for blood transfusion in recent years. Several factors are involved, including the increase of life expectancy and advances in medical technology [1]. The industrial world and its ever increasing health incidents increase the use of blood and its products. All of these issues have been causing concern over the adequacy of the blood obtained from human sources to meet increasing demands, doubling the importance of consumption management to prevent the loss of such resources [2]. It should be noted that today a very small number of countries have utilized the necessary structures and resources to improve blood transfusion centers [3]. The key elements of success are the use of financial and material resources, preparation and implementation of a realistic plan of action based on actual description, and analysis of the existing conditions in each country, availability of blood, proper and standard storage conditions, proper clinical use of blood in treatments, and compliance with rules and regulations for prescription of blood and its products [4]. However, the number of blood donors during the past few years has been steadily declining. Reasons include the increase of donors’ age, which causes morbidity, or increased and stricter parameters for the acceptance of donors in terms of their health and infectious agents associated with blood transfusion [5]. Greinacher et al. analyzed the effects of demographic changes on the blood supply in eastern Germany as a model region for Europe and found that a decrease of the young donor population will decrease the number of donors by 27.5%-32.6% in 2015. The increasing 162
size of the elderly population will also increase the number of blood transfusions by 11.8%-13.9% due to morbidity increase [6]. A general decline in the number of donors is being seen for the first time and the increasing age of the population limits the number of donors being attracted and retained [7]. To solve this problem, we need to implement a rigorous scientific protocol on blood reserves and proper and timely use of blood products. It seems we can overcome these problems considerably through accurately describing a protocol and creating more coordination, preventing the loss of blood products and energy, human, and financial resources [8]. There has even been talk about blood overuse since 1937, when Fantus wrote: “In this hospital, blood is overly used” [9]. A 1953 study revealed that 50 out of 290 cases of blood transfusion were unnecessary and proposed a training program about the proper use of blood for physicians [10]. In 1961, the Joint Commission on Accreditation of Health Organizations decided to approve hospitals by reviewing their use of blood [11]. In 1991, the AABB declared reviewing of blood used by its blood transfusion committee as mandatory for the first time [12]. In October 1995, the World Health Organization held its first preparatory meeting for the formation of a workgroup of international cooperation for blood safety in Geneva, and it published its recommendations for the creation of national guidelines and policies for the clinical use of blood in 1998 [13]. Today, the importance of blood transfusion medicine is well established, but procuring healthy blood only ensures a part of its safety. The other part is the proper shipping, storage, and use of blood in hospitals (Table 1). Therefore, excessive and inappropriate use of blood products is also
Turk J Hematol 2014;31:161-167
Mohebbi Far R, et al: Blood Component
among the factors cited; this requires public commitment to ensure that healthy blood and its products are available at reasonable prices, are used properly with minimum losses, and are produced within a consistent health monitoring system [14]. Four main processes that are implemented during blood transfusions in hospitals of Qazvin Province, one of the central provinces of Iran, are: the requests for blood and its products by physicians form the organization of blood transfusions; these products are stored in blood banks of hospitals; compatibility tests are conducted before the injection; and the injection process and its side effects are monitored. Meanwhile, blood wastes occur by various causes that are the focus of this study (Table 2). This study was designed to investigate the amount and causes of waste of blood and its products (packed red cells, plasma, platelets, and cryoprecipitate) in hospitals of Qazvin Province. This study may provide experience-based information to various groups and act as a helpful guideline for optimum use of blood and reduction of its wastes. Materials and Methods This was a cross-sectional, analytical-descriptive study based on the statistical data available from hospitalsâ&#x20AC;&#x2122; blood banks. Data about blood and blood component wastage for the year 2010 were obtained from 12 hospitals, including 5 teaching hospitals, 3 private hospitals, 2 social welfare hospitals, 1 charity hospital, and 1 military hospital. The hospitals were divided into wards according to type and complexity of activities undertaken: for teaching hospitals, emergency, neonatal intensive care unit, thalassemia, surgery, and gynecology and obstetrics; for private hospitals, gynecology and obstetrics, coronary care unit, pediatrics, internal, and surgery; for social welfare hospitals, gynecology and obstetrics, surgery, internal, and intensive care unit; for the charity hospital, orthopedics, neonatal intensive care unit, gynecology and obstetrics, and surgery; and for the military hospital, surgery and internal. For all hospitals and wards, clinical use of blood and blood components and amount of discarded blood components were calculated. Blood wastage may occur for a number of reasons: time expiry (the expiry date on the unit has passed), wasted import (unit imported with patient but not used for storage condition reasons or poor practice at ward level and product discarded prior to the expiry date), blood medically or surgically ordered but not used (unit ordered for medical procedure but not necessary for treatment), no need for patient (nonmedical reasons such as death of patient, patient discharged, or no consent), leakage (damage to or fault in the blood bag), lack of cord blood (with unnecessary cross-matching for every medical procedure is thus impossible to re-do and blood is not used), hemolytic reasons, or miscellaneous reasons (any other reason for which the unit is wasted) (Table 2). The research instrument was a 2-part questionnaire. The first part was related to demographic characteristics of the
hospitals and the second part elicited information about blood and blood component wastage; the data were taken from detailed forms of unused blood and blood components, categorized into 6 sections: type of blood product, blood groups, the number of requested units, the number of blood transfusion units, the number of wasted blood units, and the reason for wastage. Thus, the evaluation was retrospective. In order to complete the questionnaire, data were gathered by contacting the blood banks of the hospitals under study, conducting interviews with the people in charge of those departments, and studying the patientsâ&#x20AC;&#x2122; documents. The collected data were then analyzed using descriptive statistical methods and SPSS 11.5. Results Out of a total of 30.913 units of blood received in all the hospitals of Qazvin Province, 58.6% were in the form of packed red cells, 0.3% in the form of whole blood, 15.8% in the form of plasma, 21.6% in the form of platelets, and 3.5% in the form of cryoprecipitate. Out of 3048 units of blood wasted, 59.4% were in the form of packed red cells, 22% in the form of plasma, 16% in the form of platelets, and 2.4% in the form of cryoprecipitate (Figures 1 and 2). The distribution frequency of blood and blood product wastage in the hospitals of this study showed that out of a total of 3048 discarded units in all hospitals, 58.3% was
Figure 1. Total blood and blood product units transfused and discarded in hospitals.
Figure 2. Total units transfused by type of blood and blood product in hospitals. 163
Turk J Hematol 2014;31:161-167
Mohebbi Far R, et al: Blood Component
wasted in teaching hospitals, 19.9% was wasted in private hospitals, 15.8% was wasted in social welfare hospitals, 3.2% was wasted in the charity hospital, and 1.9% was wasted in the military hospital. Teaching hospitals had the highest percentage of total blood and blood product waste, while private hospitals ranked second (Table 3). Results of packed red cell distribution frequency in different wards of teaching, private, social welfare, charity, and military hospitals indicated that the thalassemia ward had the highest use of packed red cells among different wards of teaching hospitals. The surgery ward had the highest use of packed red cells in the private and social welfare hospitals of Qazvin Province, while it was the gynecology and obstetrics ward that had the highest packed red cell use in the charity hospital. It should also be noted that the blood bank of the military hospital was not active and only 4 units out of its 62 packed red cell units were used in its internal medicine ward. Results of studying the packed red cell wastes in these hospitals showed that out of a total of 3048 discarded units in all hospitals, 1790 units belonged to teaching hospitals and 57.3% of these units were packed red cells, with the B+ blood type as the most often discarded one. Out of a total of
613 wasted units in private hospitals, 63.1% of waste also comprised packed red cells, while this was 56.5% of a total of 486 wasted units in social welfare hospitals, 64% of a total of 100 wasted units in the charity hospital, and 100% in the military hospital. Results of investigating the common causes of blood and blood product wastage in the hospitals of this study showed that blood and blood product wastes were highly associated with 3 common causes, including the expiration of the usability period, the patient’s lack of need for these products, and their non-use in hospital wards (Table 2). Discussion While the blood supply is seriously limited, blood use increases every year. Many of the blood transfusion cases are being done improperly. Proper clinical use of blood is an important and critical issue, especially in regions that are facing limitations in the number of blood units. Out of a total of 30.913 units received in all the hospitals of Qazvin Province in this study, 18.123 (58.6%) were in the form of packed red cells, 100 (0.3%) were in the form of whole blood, 4913 (15.8%) were in the form of plasma, 6695 (21.6%)
Table 1. Requirements for storage and transport, expiration, and indications of blood and blood components.
Components
Storage
Transport
Expiry
Indications
Whole blood
In a blood bank refrigerator at 2 °C to 6 °C
Can be transported for the next 24 h if maintained at 1 °C to 10 °C during transport
35 days in a closed system, 24 h in an open system
Acute blood loss Exchange transfusion Massive transfusion
Packed red cells
In a blood bank refrigerator at 2 °C to 6 °C
Can be transported for the next 24 h if maintained at 1 °C to 10 °C during transport
35 days in a closed system, 24 h in an open system
Chronic, symptomatic anemia Acute blood loss
Fresh frozen plasma
In a plasma freezer at below -30 °C
Transported in frozen state
1 year
Multiple factor deficiencies Severe liver disease Warfarin reversal
Platelet concentrate
In a platelet incubator with agitator at 20 °C to 24 °C with continuous gentle agitation
20 °C to 24 °C
5 days in a closed system, 4 h in an open system
Bleeding due to low platelet count or impaired function
Cryoprecipitate
In a freezer at below -30 °C
Below -30 °C
1 year
164
Fibrinogen deficiency Dysfibrinogenemia Trauma Disseminated intravascular coagulation
Turk J Hematol 2014;31:161-167
Mohebbi Far R, et al: Blood Component
Table 2. Percentage of wastage per cause of discard in total hospitals.
Wastage
Time Expiry
Clot Wasted Leakage Medically No need Without Import Ordered for cord Not Used patient
Miscellaneous
Packed red cells
46.2
0.9
1.5
0.5
1.5
5.4
2.2
0.8
Plasma
5.7
0
4.5
1.0
3.5
6.1
0
0.9
Platelet
3.7
0
3.5
0.4
3.0
4.8
0
0.4
Cryoprecipitate 0.5
0
0.4
0.1
0.3
0.6
0
0.2
Reason / Products
Table 3. Percentage of wastage by type of blood and blood product in hospitals.
Lood Components Wastage
Packed red cells
Plasma
Platelets
Cryoprecipitate
Teaching hospitals
33.4
13.4
9.7
1.8
Private hospitals
12.6
5.2
2.1
0
Social welfare hospitals
9
3
3.2
0.6
Charity hospital
2
0.2
0.8
0
Military hospital
1.9
0
0
0
/
Hospital
were in the form of platelets, and 1082 (3.5%) were in the form of cryoprecipitate. The number of plasma units received during another study was 595 [15]. In another study on the use of fresh frozen plasma products at a children’s medical center, 1262 plasma units were received [16]. The current study saw a greater number of received units of blood and blood products from a larger study population. This study investigated the causes and the amount of blood wastes in all hospitals of Qazvin Province. It showed that blood and blood product wastes were highly associated with 3 common causes, including the expiration of the usability period, the patient’s lack of need for these products, and their non-use in hospital wards. There are a few reports about the average amount of expired blood units in blood banks or blood transfusion centers. In this study, 1410 (77.9%) out of a total of 1811 discarded packed red cell units were wasted due to the expiration of their usability period. In another study of decrease of blood waste using the sigma method, investigation of packed red cell wastes in hospitals showed that 87% of these wastes occurred outside the blood bank due to improper shipping and storage temperatures. Other factors involved were the personnel’s lack of knowledge and training, improper management of shipping temperature and other temperature indices, and the lack of supervision and responsibility [17]. The current study investigated the
wastage of blood and blood products by hospitals of Qazvin Province. Results showed that the wastes were in the form of packed red cells (59.4%), plasma (22%), platelets (16%), and cryoprecipitate (2.4%) according to type of blood product, and out of a total of 3048 blood and blood product units wasted, 58.7% of them were returned by teaching hospitals, 20.1% by private hospitals, 15.9% by social welfare hospitals, 3.2% by the charity hospital, and 1.9% by the military hospital. A study reviewing blood transfusion and wastes in the teaching hospitals of Semnan University of Medical Sciences reported that 759 (65.9%) out of 1152 packed red cell units delivered to these hospitals were discarded and only 393 (34.1%) were transfused [18]. There are no reports that compare these amounts based on the type of hospitals. In another study of the use of blood and its products at Imam Reza Hospital, out of a total of 12.436 units of blood received by the blood bank, 2950 (23.8%) were discarded [19]. Results of studying the packed red cell wastes in the hospitals of the current study showed that out of a total of 3048 discarded units in all hospitals, 1790 units belonged to teaching hospitals and 57.3% of these units were packed red cells, with the B+ blood type as the most often discarded one. There are no similar studies that review cases of blood and blood product wastes based on different blood types. The thalassemia ward had the highest use of packed red cells among various wards of 165
Turk J Hematol 2014;31:161-167
teaching hospitals in this study, while the emergency ward ranked second. In another study of unnecessary transfusion of blood and its products in hospitalized patients at Dr. Fatemi Hospital in Ardabil, 60 cases (40%) of blood transfusions occurred in the intensive care unit [20]. Blood transfusion and the supplying of healthy blood are among the more expensive medical services and most developing countries are not able to offer such services. Developing the proper culture for the optimum use of blood products in such countries is therefore of utmost importance. The current study recommends the following of some necessary policies for supervision and management of blood use and reduction of blood wastes, including monitoring consumers’ access to the supply of products, supervising the quality of new guidelines, investigating the reports received from hospitals regarding issues related to blood transfusion, inspecting the method of use of blood or its products in hospital wards, controlling the method of shipping from delivery to the hospitals until distribution among wards, and checking the hospital’s stock of blood and plasma in terms of numbers, dates, method of storage, and the time of keeping blood for cross-matching. The hemovigilance system is being used in 2 teaching hospitals of Qazvin Province to reduce blood wastes and it allows the possibility of promoting the blood transfusion chain (from the time of blood collection until the time of its injection into the recipient) and monitoring the quality of blood and its products’ use, better so than before. According to the recommendations of the World Health Organization, blood transfusion should be prescribed only in situations where other methods cannot effectively prevent or control mortality. Decisions about the prescription of blood must be done based on the most reliable clinical guidelines available, which are modified according to the needs of patients. Blood products have a limited half-life, so the approach to blood transfusion must apply accurate strategies for blood reserves in order to prevent loss and reduce wastes as much as possible [21]. In overall evaluation of hospitals, considering the ratio of waste to usage, it should be noted that teaching hospitals had the best practice and military hospital had the worst practice. This study addresses one of the research priorities of Iran’s blood transfusion system. The advantages of this research are that it included all the hospitals in Qazvin Province and that a large number of reasons for blood and blood product wastage were considered. Of course, it is the first comprehensive study that was done in Iran, while other studies regarding these issues were not as comprehensive as this research as they did not include all the hospitals and only considered 1 or 2 blood products. It is hoped that this research will help to decrease the amount of blood wastage, as blood is an important and rare resource. Acknowledgments This article was extracted from a thesis that was supported financially by the School of Health, Qazvin University of Medical Sciences. We thank all who assisted us 166
Mohebbi Far R, et al: Blood Component
in the process of developing this study, with special thanks to the blood banks of the hospitals and personnel in charge of these departments for their strong support and high commitment during the preparation of this survey. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Price TH, editor. Standards for Blood Banks and Transfusion Services, 26th ed. Bethesda, MD, USA, AABB, 2009. 2. Sack DJ. Spotlight BSMS, Blood Stocks Management Scheme. Merthyr Tydfil, UK, Prince Charles Hospital, 2010. 3. World Health Organization. Developing a National Policy and Guidelines on the Clinical Use of Blood. Recommendations. Geneva, WHO, 2009. 4. World Health Organization. Safe Blood and Blood Products. Guidelines and Principles for Safe Blood Transfusion Practice. Geneva, WHO, 2003. 5. Murphy MF, Wilkinson J, Lowe D, Pearson M. National audit of the blood transfusion process in the UK. Transfus Med 2005;11:363-370. 6. Greinacher A, Hebert D. Improved storage of erythrocytes by prior leukodepletion: flow cytometric evaluation of stored erythrocytes. 2003. 7. American Society of Anesthesiologists Task Force on Perioperative Blood Transfusion and Adjuvant Therapies. Practice guidelines for perioperative blood transfusion and adjuvant therapies: an updated report by the American Society of Anesthesiologists Task Force on Perioperative Blood Transfusion and Adjuvant Therapies. Anesthesiology 2006;105:198-208. 8. National AIDS Control Organisation. Standards For Blood Banks & Blood Transfusion Services. New Delhi, Ministry of Health and Family Welfare, Government of India, 2007. 9. Rossi E, Simon T. Principles of Transfusion Medicine, 2nd ed. Philadelphia, Williams & Wilkins, 1996. 10. Clark JA, Ayoub MM. Blood and component wastage report. A quality assurance function of the hospital transfusion committee. Transfusion 1989;29:139-142. 11. Sparrow RL, Patton KA. Supernatant from stored red blood cell primes inflammatory cells: influence of prestorage white cell reduction. Transfusion 2004;44:722-730. 12. Murphy MF, Pamphilon DH. Practical Transfusion Medicine. Hoboken, NJ, USA, Wiley-Blackwell, 2006. 13. World Health Organization. Develop Toolkit for Monitoring and Quality Assurance of Safe Blood Transfusion. Directorate General of Health Services, Dhaka, 2008.
Mohebbi Far R, et al: Blood Component
14. Zaman B, Radmehr M, Sahraian A, Sohrabi P. Determination of the ratio and causes of unused blood ordered from blood bank in elective surgery in Rasoul-e-Akram hospital. Sci J Iran Blood Transfus 2009;6:141-146. 15. Chaudhary R, Singh H, Verma A, Ray V. Evaluation of FFP usage at tertiary care hospital in north India. ANZ J Surg 2005;75:573-576. 16. Ashtianai MT, Makki N, Izadyar M, Forougi F, Monajemzadeh M. Evaluation of fresh frozen plasma consumption in Children Medical Center. Sci J Blood Transfus Organ 2010;7:178-182.
Turk J Hematol 2014;31:161-167
18. Forouzesh F. Study of proper indications for blood transfusion in teaching hospital of Semnan University of Medical Sciences. 2010. 19. Keramati M. Use of blood and blood products in Imam Reza hospital Mashhad University of Medical Sciences. 2007. 20. Entezariasl M, Azami A, Amani F, Khorasani S. Unnecessary blood and blood products transfusion to patients admitted to Ardabil Dr Fatemi Hospital, 2003. J Ardabil Univ Med Sci 2007;6:345-350. 21. World Health Organization. Albanian Strategy for Safe Blood Transfusion. Tirana, WHO, 2010.
17. Heitmiller ES, Hill RB, Marshall CE, Parsons BJ, Berkow LC, Barrasso CA, Zink EK, Ness PM. Blood wastage reduction using Lean Sigma methodology. Transfusion 2010;50:18871896.
167
Research Article
DOI: 10.4274/tjh.2013.0115
The Functional Significance of the Rho/Rho-Kinase Pathway in Human Erythrocytes İnsan Eritrositlerinde Rho/Rho-Kinaz Yolağının Fonksiyonel Önemi R. Nalan Tiftik1, Oğuz K. Başkurt2, Seval Kul3, Kansu Büyükafşar1 1Mersin 2Koç
University Faculty of Medicine, Department of Pharmacology, Mersin, Turkey
University Faculty of Medicine, İstanbul, Turkey
3Gaziantep
University Faculty of Medicine, Department of Biostatistics, Gaziantep, Turkey
Abstract: Objective: Erythrocyte deformability, which can be influenced by various intracellular signaling mechanisms, such as nitric oxide, cAMP, cGMP, and protein kinases, is the most important physiological factor providing the blood flow in microcirculation. However, the functional significance of the Rho/Rho-kinase pathway, which contributes cell shape changes and the reorganization of the actin cytoskeleton, has yet to be explored in erythrocytes. Therefore, we examined the influence of several activators and inhibitors of Rho/Rho-kinase signaling on human erythrocyte deformability. Materials and Methods: RhoA and ROCK-2 proteins were studied by western blotting. Influences of 2 Rho-kinase inhibitors, fasudil and Y-27632 (both 10-7 to 10-4 M), on erythrocyte deformability was determined by ektacytometer at various shear stresses (0-30 Pa) in the presence or absence of a known Rho activator, lysophosphatidic acid (LPA, 10-5 to 5x10-5 M, 1-15 min). Results: LPA incubation reduced deformability with concomitant RhoA-GTP inhibition. Y-27632 and fasudil also decreased deformability, but had no effect on LPA-induced reduction of deformability. Rho inhibitor C3 had no effect on RhoA activation. Reduction in RhoA activation was induced by sub-hemolytic mechanical stress. Conclusion: Our findings may indicate that the Rho/Rho-kinase pathway could contribute to the regulation of deformability of human erythrocytes. Key Words: Erythrocyte deformability, RhoA, Rho-kinase, Y-27632, Fasudil, Lysophosphatidic acid, C3 Özet: Amaç: Nitrik oksid, sAMP, sGMP ve protein kinazların rol oynadığı çok çeşitli hücre içi sinyal mekanizmasının etkileyebildiği
eritrosit deformabilitesi mikrosirkülasyonun devamlılığında rol oynayan en önemli fizyolojik faktördür. Ancak, hücre şekil değişiklikleri ve aktin hücre iskeleti reorganizasyonu gibi hücresel olaylara aracılık eden Rho/Rho-kinaz yolağının eritrositlerdeki fonksiyonel önemi henüz tam olarak ortaya konulmamıştır. Bu yüzden, söz konusu sinyal ileti mekanizmasının çeşitli aktivatör ve inhibitörlerinin eritrosit deformabilitesi üzerine etkisini inceledik. Gereç ve Yöntemler: Eritrositlerde RhoA ve ROCK-2 proteinleri Western-Blot yöntemi ile gösterildi. Her iki Rho-kinaz inhibitörü fasudil ve Y-27632’nin (10-7-10-4 M) eritrosit deformabilitesi üzerine etkisi çeşitli sıvı kayma kuvvetlerinde (0-30 Pa) bilinen bir Rho aktivatörü olan lizofosfatidik asit (LPA, 10-5- 5x10-5 M, 1-15 dakika) varlığında ve yokluğunda incelendi. Address for Correspondence: R. Nalan Tİftİk, M.D., Mersin University Faculty of Medicine, Department of Pharmacology, Mersin, Turkey Phone: +90 324 341 28 15/1005 E-mail: nalantiftik@yahoo.com.tr Received/Geliş tarihi : April 01, 2013 Accepted/Kabul tarihi : July 19, 2013
168
Turk J Hematol 2014;31:168-174
Tiftik NR, et al: Rho/ROCK and Erythrocytes
Bulgular: LPA inkübasyonu Rho-GTP inhibisyonu ile eşzamanlı olarak deformabiliteyi azalttı. Y-27632 ve fasudil de tek başlarına deformabiliteyi azalttı ancak LPA ile indüklenen deformabilite azalmasını etkilemedi. Rho inhibitörü C3 ekzoenzim RhoA aktivasyonunu etkilemedi. Öte yandan subhemolitik mekanik stress uygulaması RhoA aktivasyonunu azalttı. Sonuç: Sonuç olarak bulgularımız Rho/Rho-kinaz yolağının insan eritrositlerinde deformabilitenin düzenlenmesine katkı yapabileceğine işaret edebilir. Anahtar Sözcükler: Eritrosit deformabilitesi, RhoA, Rho-kinaz, Y-27632, Fasudil, Lizofosfatidik asit, C3
Introduction The maintenance of normal deformability and mechanical stability is critical for human erythrocytes, which undergo extensive deformations in the microvasculature, to perform their function of oxygen delivery during their lifespan [1]. Enzymes associated with the erythrocyte membrane are known to have important roles in regulating erythrocyte shape and deformability [2]. Moreover, the L-arginine-NO pathway; membrane proteins such as actin, α- and β-spectrin, adducin, and dematin; ion pumps like Na+-K+ ATPase and Ca2+-Mg2+ ATPase; and second messengers like cAMP and cGMP provide direct/indirect contributions to the regulation of erythrocyte deformability [3,4,5,6]. The Rho/Rho-kinase (ROCK) pathway, one of the most widely studied cell signaling pathways recently, takes part in smooth muscle cell contraction via a phenomenon called Ca+2 sensitization [7,8,9,10,11,12,13] and mediates fundamental cellular functions in non-muscle cells [14]. These functions include stress fiber formation, membrane ruffling, cytokinesis and cell migration, actin cytoskeleton reorganization, proliferation, hypertrophy, cell shape changes, platelet aggregation, and lymphocyte and fibroblast adhesion [14,15,16]. Furthermore, the Rho/ROCK pathway is involved in some physiological and/or pathological processes such as vasoconstriction, hypertension, coronary artery spasm, and ischemia-reperfusion injury of the heart [17,18,19,20]. With regard to blood cells, Rho signaling mediates several cellular events in platelets, neutrophils, and lymphocytes, such as chemotaxis, cell shape changes, and the secretion functions [21,22,23,24]. The Rho protein has been detected in both cytosol and membrane fractions of erythrocytes and was found to bind to the cytoplasmic surface of the cell membrane with high affinity [25]. In addition, PRK1/PKN, a cytosolic serine/ threonine kinase, which was previously described as one of the RhoA effectors, is localized in the erythrocyte plasma membrane [26]. However, the possible contribution of Rho/ROCK signaling to the physiological control of erythrocyte deformability has yet to be investigated in human erythrocytes.
Therefore, in this study we aimed to examine the influence of 2 Rho-kinase inhibitors, fasudil and Y-27632, and Rho activator lysophosphatidic acid (LPA) on erythrocyte mechanical properties. This was done using an ektacytometer, which is currently the most widely used and most reliable approach to the measurement of erythrocyte deformability [27]. Materials and Methods This study was approved by the Mersin University Clinical Research Ethics Committee. Blood Sampling Blood was drawn by venipuncture into heparinized (15 IU/mL) syringes from healthy adult male volunteers aged between 18 and 45 years. Erythrocytes were isolated from whole blood by centrifugation (3000 rpm, 10 min) followed by 3 washing steps in phosphate-buffered saline (PBS) to remove leukocytes. Thereafter, the washed erythrocytes were resuspended in autologous plasma at a hematocrit level of 40%. The samples were studied within 4-6 h after the venipuncture. Erythrocytes used for western blotting were prepared by the same procedure. Chemicals (+)-(R)-trans-4-(1-Aminoethyl)-N-(4-pyridyl) cyclohexanecarboxamide dihydrochloride monohydrate (Y27632), fasudil (HA-1077), and oleoyl-L-lysophosphatidic acid sodium salt (LPA) were obtained from Sigma (St. Louis, MO, USA). Y-27632 and fasudil were dissolved in saline. LPA was diluted in PBS. Western Blot Analysis Isolated erythrocytes were lysed in equal volumes of hypotonic lysis buffer solution (composed of 10 mM Tris, pH 7.6; 1 mM EDTA; and 20 µg/mL phenylmethylsulfonyl fluoride) as described previously [28]. Membranes were recovered by centrifugation at 38.000 x g for 90 min. The supernatant was preserved as the cytosolic fraction. Both the pellet containing the membranous fraction and the supernatant were separately collected and preserved at -20 °C until being used for protein analysis by the Bradford method and western blot analysis. Equal amounts of protein were loaded into wells, separated by electrophoresis on 10% polyacrylamide-sodium dodecyl sulfate gel, and then 169
Turk J Hematol 2014;31:168-174
transferred to a nitrocellulose membrane. Thereafter, the membranes were blocked with fatless milk powder in Trisbuffered solution containing 0.05% Tween-20 for 1 h. They were then probed with primary antibodies raised against RhoA (mouse monoclonal, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) at 1:500 dilution and ROCK-2 (polyclonal IgG, Santa Cruz Biotechnology Inc.) at 1:2000 dilution, followed by horse radish peroxidase-conjugated secondary antibody (goat anti-mouse and donkey anti-goat, 1:2000, Santa Cruz Biotechnology Inc.). The blots were then assayed with an enhanced chemiluminescence detection kit (ECL Plus, Amersham Biosciences, Freiburg, Germany) and visualized on a commercial X-ray film. Effects of Rho/ROCK Activators and Inhibitors on Erythrocyte Deformability LPA (10-5 M, 2x10-5 M, 5x10-5 M) was added to the erythrocyte suspensions and incubated for various periods of time (1, 2, 5, 10, and 15 min) at room temperature, and erythrocyte deformability was measured afterwards. In another series of experiments, the erythrocyte suspensions were preincubated with 10-5 to 10-4 M Y-27632 or fasudil for 45 min before incubation with LPA (10-5 M for 10 min). In another group, erythrocytes were treated with exoenzyme C3 transferase from Clostridium botulinum (3 µg/mL for 4 h; CT04-B, Cytoskeleton, Denver, CO, USA). All control suspensions were incubated with their own vehicles. Erythrocyte deformability was determined at various fluid shear stresses by laser diffraction analysis using an ektacytometer (LORCA, RR Mechatronics, Hoorn, the Netherlands). Following the incubation processes as described above, erythrocyte suspensions were diluted in 6% polyvinylpyrrolidone (MW: 360.000; Sigma, St. Louis, MO, USA) solution prepared in PBS at a ratio of 1:200. The details of the measurement system have been described elsewhere [29]. One milliliter of this suspension was sheared in a Couette system composed of a glass cup and a precisely fitting bob, with a gap of 0.3 mm between the cylinders. A laser beam was directed through the sheared sample, and the diffraction pattern produced by the deformed cells was analyzed by a microcomputer. On the basis of the geometry of the elliptical diffraction pattern, an elongation index (EI) was calculated: EI= (L–W) / (L+W), where L and W are the length and width of the diffraction pattern, respectively. EI values were determined for 9 shear stresses between 0.3 and 30 Pa. All measurements were carried out at 37 °C. Additionally, the shear stress required for half-maximal deformation (SS1/2) and maximum elongation index (EImax) were calculated from the data set for each measurement by using a Lineweaver-Burk analysis procedure [29]. ROCK Inhibitors and Erythrocyte Mechanical Damage Erythrocytes pretreated with Y-27632 (10-5 to 10-4 M) or fasudil (10-5 to 10-4 M) for 1 h in autologous plasma 170
Tiftik NR, et al: Rho/ROCK and Erythrocytes
were exposed to sub-hemolytic mechanical stress of 120 Pa for 30 s. Erythrocyte suspensions were diluted in 25% dextran 40 (40.6 kDa, Sigma Chemical Co.) solution, with 19.5 mPas viscosity at 37 °C, measured by a cone-plate viscometer (Wells-Brookfield, Brookfield Engineering Labs, Middleboro, MA, USA). Erythrocyte suspensions were loaded into the Couette shearing system described above (LORCA) and the outer cylinder was rotated at a rotational speed calculated to obtain 120 Pa of shear stress. The details of the mechanical shearing procedure were described elsewhere [30]. Erythrocyte suspensions in the viscous medium were exposed to shear stress for 30 s at 37 °C. Following the shearing period, the erythrocyte suspensions were directly used for erythrocyte deformability testing as described above. Control samples were not exposed to the 120 Pa of shear stress; instead, they were suspended in the 25% dextran 40 solution and kept in the solution for as long as the corresponding sheared samples before being used in the deformability measurements. RhoA Activation Assay The active Rho GTP levels of erythrocytes incubated with LPA (10-5 M for 1, 2, 5, 10, and 15 min), exposed to mechanical stress (120 Pa, 30 s) and treated with exoenzyme C3 transferase from Clostridium botulinum (3 µg/mL for 4 h), were evaluated by colorimetric G-LISA activation assay kit (BK124, Cytoskeleton). Statistics All data are represented as mean±standard error (SE) of the mean. Statistical comparisons were done by paired t-test or Wilcoxon signed-rank test after the Kolmogorov-Smirnov test was used for normality of results. In addition, a onesample t-test was used for % RhoA activation in LPA series. P-values of less than 0.05 were considered significant. Results The Expression of RhoA and ROCK Proteins in Erythrocytes Western blotting analysis revealed that both RhoA and ROCK-2 proteins were expressed in human erythrocytes. There were RhoA expressions in both membranous and cytosolic fractions (Figures 1A and 1B). Effects of LPA and ROCK Inhibitors, Y-27632 and Fasudil, on Erythrocyte Deformability LPA (10-5 to 5x10-5 M, incubated for 1-15 min) decreased erythrocyte deformability, as indicated by increased SS1/2 values evaluated at different time points (Figures 2A2C). Similarly, ROCK inhibitors Y-27632 (10-5 to 10-4 M) and fasudil (10-5) also increased SS1/2 values, thus demonstrating decreased deformability. However, neither Y-27632 (10-5 to 10-4 M, Figure 3A) nor fasudil (10-4 M, Figure 3B) in combination with LPA had additional effects on deformability reduction.
Tiftik NR, et al: Rho/ROCK and Erythrocytes
Effects of Y-27632 and Fasudil on Mechanical StressInduced Deformability Changes Mechanical stress (120 Pa, 30 s) deteriorated erythrocyte deformability, but neither Y-27632 nor fasudil (10-4 to 10-5 M) had effects on the impaired deformability (data not shown). Rho-GTP Levels of the Erythrocytes Exposed to Mechanical Stress, LPA, or Clostridium botulinum Exoenzyme C3 Transferase A well-known Rho activator, LPA (10-5) surprisingly reduced the Rho-GTP levels in erythrocytes at 5 min of incubation (Figure 4). To ensure this inhibitor effect of LPA on RhoA activation, we tentatively evaluated the activation of RhoA in exoenzyme C3 transferase-treated red blood cells by colorimetric G-LISA activation assay kit, and C3 tended to increase RhoA activation (Figure 5). In the erythrocytes under mechanical stress (120 Pa, 30 s), Rho-GTP levels significantly decreased (Figure 6A) and deformability was also impaired (Figure 6B).
Turk J Hematol 2014;31:168-174
G protein GÎą12/13 in cells such as smooth muscle cells and neuronal cells [33,34]. LPA is a widespread tool that is used for exploring the consequences of RhoA activation in most studies to understand the possible contribution of the Rho/ Rho-kinase pathway to cell functions in non-muscle cells. Surprisingly enough, LPA inhibited RhoA activation in erythrocytes in our study. The reason why it reduced RhoA translocation might be because its receptors present on human erythrocytes could be coupled with RhoA inhibition, in contrast to those in other cells. LPA may also activate protein kinase C [35], which can increase intracellular Ca2+ concentration [Ca2+i]. If the fact that LPA attenuates RhoA activation and concomitantly reduces deformability is the case, this may be physiologically important as LPA is naturally present in cell membranes [36]. Maintenance of the [Ca2+i] of erythrocytes is of essential importance
Discussion RhoA protein was demonstrated to be expressed both in cytosolic and membranous fractions of erythrocytes, and cytosolic fraction is known to translocate to the plasma membrane [25,31]. Moreover, it has also been reported that ROCK-1 enzyme-dependent myosin-mediated contractions are necessary for caspase activation of phorbol ester-induced apoptosis in an erythrocyte precursor, the TF-1 cell line [32]. We also demonstrated RhoA protein both in the cytosol and membrane of erythrocytes, confirming the results of the above studies. In addition to this, we further demonstrated ROCK-2 protein expression in human erythrocytes by western blotting. A membrane phospholipid, LPA is known to activate Rho proteins [33] through specific receptors coupled with heterotrimeric G proteins that mediate several biological signals. LPA has 5 different receptors identified so far (LPA1LPA5) and is known to have a role in cell shape changes and contractility via LPA1 and LPA2 receptors by activating the downstream Rho through the activation of heterotrimeric
Figure 1. Western blotting for RhoA (A) and Rho-kinase (ROCK-2) (B) in human erythrocytes. Both cytosolic and membranous fractions for RhoA (MW: 24 kDa) and cytosolic fraction for ROCK-2 (MW: 160 kDa) were studied. A, B, and C are erythrocytes isolated from different volunteers.
Figure 2. Effect of lysophosphatidic acid (10-5, 2x10-5, 5x10-5 M) on shear stress for half-maximal deformation (SS1/2) at different time periods. Data are mean Âą SE, n=8. Statistical analyses were done by Wilcoxon signed ranks test (*: p<0.05, difference from control). 171
Turk J Hematol 2014;31:168-174
Tiftik NR, et al: Rho/ROCK and Erythrocytes
Figure 5. Rho-GTP level in erythrocytes treated with exoenzyme C3 transferase (3 µg/mL). Rho-GTP levels were measured with G-LISA activation assay kit and expressed as % RhoA activation. Data are mean ± SE, n=5. Statistical analysis was done by one-sample t-test (p=0.0526).
Figure 3. The potential effect of Y-27632 (A) and fasudil (B) on LPA-induced deformability. Data are mean ± SE, n=9. Statistical analysis was done by Wilcoxon signed ranks test (*: p<0.05, difference from control; +: p<0.05, difference from LPA).
Figure 4. Effect of lysophosphatidic acid (10-5 M) on RhoA activation of erythrocytes. Rho-GTP levels were measured with G-LISA activation assay kit and expressed as % RhoA activation. Data are mean ± SE, n=8. Statistical analysis was done by one-sample t-test (*: p<0.05, difference from control). since any tiny oscillation in [Ca2+i] may result in dramatic deformability changes [37]. Thus, calcium sensitizing pathways such as Rho/ROCK and protein kinase C seem to be especially important in erythrocyte physiology. In addition to the detection of Rho expression in human erythrocytes, we also demonstrated ROCK expression and tested the effects of inhibitors of this protein on erythrocyte mechanical properties, namely Y-27632 and fasudil. Y-27632 and fasudil did not produce an additional effect on LPA-induced impairment of deformability. However, the 172
Figure 6. A) Rho-GTP level in erythrocytes exposed to mechanical stress (120 Pa, 30 s). Rho-GTP levels were measured with G-LISA activation assay kit and expressed as % RhoA activation. Data are mean ± SE, n=4. Statistical analyses were done by one-sample t-test (**: p<0.01, difference from control). B) Mechanical stress induced deterioration of deformability. Data are mean ± SE, n=8. Statistical analysis was done by paired t-test (*: p<0.05, difference from control). ROCK inhibitors decreased deformability on their own. This finding could indicate the functional importance of this pathway in erythrocyte deformability. However, the recent report of Thuet et al. (2011) had opposite findings, such that ROCK inhibition may improve erythrocyte deformability. This contradiction might be due to the usage of different methods; Thuet et al. measured erythrocyte deformability by using a blood filtrometer. Currently, the ektacytometer is the more widely used and more reliable technique for the measurement of erythrocyte deformability as compared to blood filtration methods [27]. Erythrocyte filterability can be seriously affected by various cellular properties of erythrocytes apart from deformability, e.g., mean corpuscular
Turk J Hematol 2014;31:168-174
volume [38] and the presence of leukocytes and platelet aggregates in samples [39]. Ektacytometry is not influenced by such artifacts and is much more sensitive to changes in erythrocyte deformability [27]. On the other hand, sub-hemolytic mechanical trauma leads to changes in cellular metabolism, membrane organization, ion transport, and cell membrane rheological properties in erythrocytes [40]. Therefore, in our study, we also tested the possible role of the Rho/ROCK pathway in the deformability impairment induced by mechanical stress (120 Pa for 30 s). This mechanical stress application was previously shown to cause a deterioration of deformability of the erythrocytes [30]. Interestingly, in the present study the mechanical stress not only impaired the deformability but also diminished RhoA protein activation. We also evaluated RhoA activation after C3 incubation and, surprisingly, RhoA activation tended to increase. This was absolutely unexpected since C3 is widely known as a Rho inhibitor. These observations need to be confirmed by further studies, to clarify if RhoA activation rather than inhibition is specific to erythrocytes. In conclusion, we had 4 consistent findings in favor of Rho/ROCK signaling as a factor affecting erythrocyte deformability: 1) LPA decreased RhoA activation while it impaired erythrocyte deformability; 2) erythrocyte deformability was also impaired under the influence of ROCK inhibitors, whereby Y-27632 and fasudil decreased deformability; 3) botulinum toxin C3 tended to increase the activation of RhoA; 4) mechanical stress, which decreased deformability, also caused Rho inhibition. The Rho/ROCK signaling cascade could play an important role in the regulation of human erythrocyte deformability. These findings contribute to the understanding of the intracellular signaling pathways of active regulation of erythrocyte deformability, with potential implications for the erythrocyte-centered regulation of microcirculatory blood flow. Acknowledgments This study was carried out as part of a PhD thesis by R. Nalan Tiftik, presented to the Mersin University Health Sciences Institute. This study was supported by Mersin University (BAP-SBE-FB (RNT) 2007-2DR). The authors are indebted to Murat Uyuklu and Pınar Ülker from the Department of Physiology, Faculty of Medicine, Akdeniz University, and Özge Güldalı-Dutlu from the Department of Medical Pharmacology, Faculty of Medicine, Mersin University, for their help. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.
Tiftik NR, et al: Rho/ROCK and Erythrocytes
References 1. Mohandas N, Chasis JA. Red blood cell deformability, membrane material properties and shape: regulation by transmembrane, skeletal and cytosolic proteins and lipids. Semin Hematol 1993;30:171-192. 2. Telen MJ, Kaufman RE. The mature erythrocyte. In: Greer JP, Foerster J, Lukens JN, Rodgers GM, Paraskevas F, Blader B (eds). Wintrobe’s Clinical Hematology. Philadelphia, Lippincott Williams & Wilkins, 2003. 3. Bor-Kucukatay M, Wenby RB, Meiselman HJ, Baskurt OK. Effects of nitric oxide on red blood cell deformability. Am J Physiol Heart Circ Physiol 2003;284:H1577-H1584. 4. Husain-Chishti A, Faquin W, Wu CC, Branton D. Purification of erythrocyte dematin (protein 4.9) reveals an endogenous protein kinase that modulates actin-bundling activity. J Biol Chem 1989;264:8985-8991. 5. Lijnen P, Petrov V. Cholesterol modulation of transmembrane cation transport systems in human erythrocytes. Biochem Mol Med 1995;56:52-62. 6. Mohandas N, Shohet SB. The role membrane associated enzymes in regulation of erythrocyte shape and deformability. Clin Hematol 1981;10:223-237. 7. Büyükafşar K, Akça T, Tiftik RN, Sahan-Fırat S, Aydın S. Contribution of Rho-kinase in human gallbladder contractions. Eur J Pharmacol 2006;540:162-167. 8. Büyükafşar K, Levent A, Ark M. Expression of Rho-kinase and its functional role in the contractile activity of the mouse vas deferens. Br J Pharmacol 2003;140:743-749. 9. Büyükafşar K, Levent A. Involvement of Rho/Rho-kinase signalling in the contractile activity and acetylcholine release in the mouse gastric fundus. Biochem Biophys Res Commun 2003;303:777-781. 10. Levent A, Büyükafşar K. Expression of Rho-kinase (ROCK1 and ROCK-2) and its substantial role in the contractile activity of the sheep ureter. Br J Pharmacol 2004;143:431437. 11. Sahan-Fırat S, Tiftik RN, Nacak M, Büyükafşar K. Rhokinase expression and its central role in ovine gallbladder contractions elicited by a variety of excitatory stimuli. Eur J Pharmacol 2005;528:169-175. 12. Somlyo AP, Somlyo AV. Signal transduction and regulation in smooth muscle. Nature 1994;372:231-236. 13. Sward K, Dreja K, Susnjar M, Hellstrand P, Hartshorne DJ, Walsh MP. Inhibition of Rho-associated kinase blocks agonistinduced Ca2+ sensitization of myosin phosphorylation and force in guinea-pig ileum. J Physiol 2000;522:33-49. 14. Fukata Y, Amano M, Kaubuchi K. Rho–Rho-kinase pathway in smooth muscle contraction and cytoskeletal reorganization of non-muscle cells. Trends Pharmacol Sci 2001;22:32-39. 173
Turk J Hematol 2014;31:168-174
Tiftik NR, et al: Rho/ROCK and Erythrocytes
15. Liao JK, Seto M, Noma K. Rho kinase (ROCK) inhibitors. J Cardiovasc Pharmacol 2007;50:17-24.
28. Govekar RB, Zingde SM. Protein kinase C isoforms in human erythrocytes. Ann Hematol 2001;80:531-534.
16. Takai Y, Sasaki T, Matazaki T. Small GTP-binding proteins. Physiol Rev 2001;81:153-208.
29. Baskurt OK, Hardeman MR, Uyuklu M, Ulker P, Cengiz M, Nemeth N, Alexy T, Shin S, Meiselman HJ. Technical Report: Comparison of three commercially available ektacytometers with different shearing geometries. Biorheology 2009;46:251-264.
17. Bao W, Hu E, Tao L, Boyce R, Mirabile R, Thudium DT, Ma XL, Willette RN, Yue TL. Inhibition of Rho-kinase protects the heart against ischemia/reperfusion injury. Cardiovasc Res 2004;61:548-558. 18. Büyükafşar K, Arıkan O, Ark M, Seçilmiş A, Ün İ, Şingirik E. Rho-kinase expression and its contribution to the control of perfusion pressure in the isolated rat mesenteric vascular bed. Eur J Pharmacol 2004;485:263-268. 19. Kandabashi T, Shimokawa H, Miyata K, Kunihiro I, Kawano Y, Fukata Y, Higo T, Egashira K, Takahashi S, Kaibuchi K, Takeshita A. Inhibition of myosin phosphatase by upregulated Rho-kinase plays a key role for coronary artery spasm in a porcine model with interleukin-1β. Circulation 2000;101:1319-1323. 20. Uehata M, Ishizaki T, Satoh H, Ono T, Kawahara T, Morishita T, Tamakawa H, Yamagami K, Inui J, Maekawa M, Narumiya S. Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 1997;389:990-994. 21. Kawaguchi A, Ohmori M, Harada K, Tsuruoka S, Sugimoto K, Fujimura A. The effect of a Rho-kinase inhibitor Y-27632 on superoxide production, aggregation and adhesion, in human polymorphonuclear leukocytes. Eur J Pharmacol 2000;403:203-208. 22. Klages B, Brandt U, Simon MI, Schultz G, Offermans S. Activation of G12/13 results in shape change and Rho/Rhokinase-mediated myosin light chain phosphorylation in mouse platelets. J Cell Biol 1999;144:745-754. 23. Lou Z, Billadeau DD, Savoy DN, Schoon RA, Leibson PJ. A role for a RhoA/ROCK/LIM kinase pathway in the regulation of cytotoxic lymphocytes. J Immunol 2001;167:5749-5757. 24. Sullivan R, Prince LS, Koffer A. Rho controls cortical F-actin disassembly in addition to, but independently of, secretion in mast cells. J Biol Chem 1999;274:38140-38146. 25. Boukharov AA, Cohen CM. Guanine nucleotide-dependent translocation of RhoA from cytosol to high affinity membrane binding sites in human erythrocytes. Biochem J 1998;330:1391-1398. 26. Zhu Y, Stolz DB, Guo F, Ross MA, Watkins SC, Tan BJ, Qi RZ, Manser E, Li QT, Bay BH, Teo TS, Duan W. Signaling via a novel integral plasma membrane pool of a serine/ threonine protein kinase PRK1 in mammalian cells. FASEB J 2004;18:1722-1724. 27. Baskurt OK, Boynard M, Cokelet GC, Connes P, Cooke BM, Forconi S, Liao F, Hardeman MR, Jung F, Meiselman HJ, Nash G, Nemeth N, Neu B, Sandhagen B, Shin S, Thurston G, Wautier JL. New guidelines for hemorheological laboratory techniques. Clin Hemorheol Microcirc 2009;42:75-97. 174
30. Baskurt OK, Uyuklu M, Meiselman HJ. Protection of erythrocytes from sub-hemolytic mechanical damage by nitric oxide mediated inhibition of potassium leakage. Biorheology 2004;41:79-89. 31. Thuet KM, Bowles EA, Ellsworth ML, Sprague RS, Stephenson AH. The Rho kinase inhibitor Y27632 increases erythrocyte deformability and low oxygen tension-induced ATP release. Am J Physiol Heart Circ Physiol 2011;301:H1891-H1896. 32. Lai JM, Hsieh CL, Chang ZF. Caspase activation during phorbol ester-induced apoptosis requires ROCK-dependent myosin mediated contraction. J Cell Sci 2003;116:34913501. 33. Contos JA, Ishii I, Chun J. Lysophosphatidic acid receptors. Mol Pharmacol 2000;58:1188-1196. 34. Moolenaar WH, van Meeteren LA, Giepmans BNG. The ins and outs of lysophosphatidic acid signaling. BioEssays 2004;26:870-881. 35. Radeff-Huang J, Seasholtz TM, Matteo RG, Brown JH. G protein mediated signaling pathways in lysophospholipid induced cell proliferation and survival. J Cell Biochem 2004;92:949-966. 36. Neidlinger NA, Larkin SK, Bhagat A, Victorino GP, Kuypers FA. Hydrolysis of phosphatidylserine-exposing red blood cells by secretory phospholipase A2 generates lysophosphatidic acid and results in vascular dysfunction. J Biol Chem 2006;281:775-781. 37. Barvitenko NN, Adragna NC, Weber RE. Erythrocyte signal transduction pathways, their oxygenation dependence and functional significance. Cell Physiol Biochem. 2005;15:118. 38. Baskurt OK, Fisher TC, Meiselman HJ. Sensitivity of the cell transit analyzer (CTA) to alterations of red blood cell deformability: role of cell size-pore size ratio and sample preparation. Clin Hemorheol 1996;16:753-765. 39. Pieragalli D, Acciavatti A, Galigani C, Messa G.L, Blardi P, Guerrini M, Forconi S, Di Perri T. Interrelationship between whole blood and washed red cell filterability. Clin Hemorheol 1987;7:273-276. 40. Kameneva MV, Antaki JF, Borovetz HS, Griffith BP, Butler KC, Yeleswarapu KK, Watach MJ, Kormos RL. Mechanisms of red blood cell trauma in assisted circulation. Rheologic similarities of red blood cell transformations due to natural aging and mechanical stress. ASAIO J 1995;41:457-460.
Case Report
DOI: 10.4274/Tjh.2012.0151
Gelatinous Marrow Transformation: A Series of 11 Cases from a Tertiary Care Centre in South India Jelatinöz Kemik İliği Transformasyonu: Güney Hindistan’da Üçüncü Basamak Bir Merkezden 11 Olguluk Bir Seri Sreeya Das, Pritinanda Mishra, Rakhee Kar, Debdatta Basu Jawaharlal Institute of Postgraduate Medical Education and Research (JIPMER), Department of Pathology, Puducherry, India
Abstract: Gelatinous marrow transformation (GMT) or serous atrophy of bone marrow (BM) is a rare disease characterised by focal marrow hypoplasia, fat atrophy, and accumulation of extracellular mucopolysaccharides abundant in hyaluronic acid. This study reviews 11 cases of GMT from South India. Clinical and haematological parameters, BM aspirate, and biopsies of all patients diagnosed with GMT over a period of 7 years were studied. GMT was diagnosed in BM biopsy based on characteristic morphological appearance and was confirmed by alcian blue positive staining pattern at pH levels of 2.5 and 0.5. Eleven patients were diagnosed with GMT. All were males within the age range of 15 to 50 years. The underlying clinical diagnosis was human immunodeficiency virus positivity in 5 cases, 2 with coexistent disseminated tuberculosis, 1 with cryptococcal meningitis, and 1 with oral candidiasis; disseminated tuberculosis in 1 case; pyrexia of unknown origin in 2 cases; Hodgkin’s lymphoma in 1 case; acute lymphoblastic lymphoma with maintenance chemotherapy in 1 case; and alcoholic pancreatitis in 1 case. BM aspirates showed gelatinous metachromatic seromucinous material in 3 cases. BM biopsies were hypocellular in 7 and normocellular in 4 cases and showed focal GMT in 5 and diffuse GMT in 6 cases. Reactive changes were seen in 4 cases and haemophagocytosis in addition to GMT in 1 case. GMT is a relatively uncommon condition and an indicator of severe illness. It should be differentiated from myelonecrosis, amyloidosis, and marrow oedema. A high index of suspicion is required to diagnose this condition. Key Words: Gelatinous transformation, Bone marrow Özet: Jelatinöz kemik iliği transformasyonu (JKİT) veya kemik iliğinin (Kİ) seröz atrofisi fokal ilik hipoplazisi, yağ atrofisi ve hyalürinik asitten zengin ekstrasellüler mukopolisakkarit birikimi ile karakterize nadir bir hastalıktır. Bu çalışma Güney Hindistan’dan 11 JKİT olgusunu gözden geçirmektedir. Yedi yıllık periyot boyunca JKİT tanısı alan tüm hastaların klinik ve hematolojik parametreler, Kİ aspirasyon ve biyopsileri incelendi. JKİT tanısı Kİ biyopsisinde karakteristik morfolojik görünüm temel alınarak konuldu, 2,5 ve 0,5 pH düzeyinde pozitif alcian mavi ile boyanarak doğrulandı. On iki hasta JKİT tanısı aldı. Tümü 15-50 yaş aralığında olan erkeklerdi. Altta yatan klinik tanı; 5 olguda insan bağışık yetmezlik virüs pozitifliği olup iki olguda eşlik eden dissemine tüberküloz, bir olguda kriptokokal menenjit ve bir olguda oral kandidiyazis saptandı. Bir olgu dissemine tüberküloz; iki olgu sebebi bilinmeyen yüksek ateş; bir olgu Hodgkin lenfoma; bir olgu idame tedavisi alan akut lenfoblastik lenfoma; ve bir olguda alkolik pankreatit idi. Kİ aspiratları 3 olguda jelatinöz metakromatik seromüsinöz yapı gösterdi. Kİ biyopsileri 7 olguda hiposellüler ve 4 olguda normosellüler idi. Beş olguda fokal JKİT, 6 olguda diffüz JKİT saptandı. Dört olguda reaktif değişiklikler ve bir olguda JKİT’ye ek olarak hemofagositoz izlendi. JKİT nispeten nadir bir durumdur ve ciddi bir hastalığın habercisidir. Miyelonekroz, amiloidoz, ve ilik ödem ile ayırıcı tanısı yapılmalıdır. Tanı için söz konusu durumdan şüphelenilmiş olması gerekir. Anahtar Sözcükler: Jelatinöz transformasyon, Kemik iliği Address for Correspondence: Rakhee Kar, M.D., Jawaharlal Institute of Postgraduate Medical Education and Research (JIPMER), Department of Pathology, Puducherry, India Phone: 91-9487896560 E-mail: rakhee_kar@rediffmail.com Received/Geliş tarihi : October 11, 2012 Accepted/Kabul tarihi : May 6, 2013
175
Turk J Hematol 2014;31:175-179
Das S, et al: Gelatinous Marrow Transformation
Introduction Gelatinous marrow transformation (GMT) or serous atrophy of bone marrow (BM) is a rare disease characterised by focal marrow hypoplasia, fat atrophy, and accumulation of extracellular gelatinous substances [1]. In the 1970s, the gelatinous substances were identified as hyaluronic acid mucopolysaccharides [2]. GMT is not a specific disease of the BM but, like a symptom, it is a morphologic sign of generalised severe illness of a patient. It has been reported to occur in a variety of chronic disorders including prolonged starvation, anorexia nervosa, malabsorption, alcoholism, malignant disease, and human immunodeficiency virus (HIV) infection [1,3,4]. The deposition of gelatinous material and the subsequent alteration in the marrow microenvironment is detrimental to haematopoiesis, which may lead to peripheral haematological abnormalities [5]. We report 11 such cases of GMT. Materials and Methods Eleven cases of GMT, diagnosed at a single tertiary care centre in South India over a 7-year period (January 2005 to September 2011), were retrieved from departmental archives. Clinical information including age, sex, presenting symptoms, physical findings, underlying diseases, treatment history, and HIV status were recorded. Haematological parameters, BM aspiration (BMA), and BM biopsy (BMB) slides were studied. GMT was diagnosed from BMB based on characteristic morphological appearance and was confirmed by alcian blue positive staining pattern at pH levels of 2.5 and 0.5. Informed consent was obtained. Results Clinical Details All 11 patients were males with ages ranging from 15 to 50 years and a mean age of 30.6 years. The presenting complaints were fever in 4 cases, fever with lymphadenopathy in 4 cases, fever with bleeding manifestation in 2 cases, and abdominal distension in 1 case. History of significant weight loss was present in 6 cases. The clinical and haematological profiles of the cases are given in Table 1. The underlying clinical diagnosis was HIV positivity in 5 cases, 2 with coexistent disseminated tuberculosis (TB), 1 with cryptococcal meningitis, and 1 with oral candidiasis; disseminated TB in 1 case; pyrexia of unknown origin (PUO) in 2 cases; Hodgkinâ&#x20AC;&#x2122;s lymphoma (HD) in 1 case; acute lymphoblastic lymphoma (ALL) with maintenance chemotherapy in 1 case; and alcoholic pancreatitis in 1 case. Lymphadenopathy was present in 4 cases and mild splenomegaly was present in 1 case. Fine-needle aspiration cytology of lymph nodes was suggestive of lymphoma in 1 case and tuberculous lymphadenitis in 3 cases, of which 2 cases (HIV-positive) showed many acid-fast bacilli (AFB). 176
One patient (HIV-negative) was on antituberculous therapy (ATT) and only 1 HIV-positive patient was on antiretroviral therapy (ART) prior to BM examination. The rest of the patients were diagnosed during the course of hospitalisation. The ALL patient was on chemotherapy. One patient who was alcoholic had repeated episodes of pancreatitis and had history of some unknown drug intake. The other patients had no history of any drug intake prior to BM examination. In-patient details were available in the latter cases (patients 7-9). A patient with bleeding manifestation (patient 7) received supportive therapy; his symptoms were controlled and he was discharged on request. Patient 9 started ATT during hospitalisation, tolerated it well, and was discharged in stable condition. Patient 10 was started on ART, received antibiotics and antifungal treatment for a palatal ulcer, and was discharged. Patient 11 was scheduled for surgery, which was then deferred due to low counts. He was on conservative therapy and discharged on request. Patient 8, suspected of lymphoma as diagnosed upon fineneedle aspiration cytology, expired during hospitalisation; we subsequently received his postmortem (PM) lymph node and BM biopsies. However, most of the patients were lost to subsequent follow-up. Haematological Parameters Anaemia was present in all cases with haemoglobin values ranging from 4 g/dL to 10.8 g/dL (mean: 6.9 mg/dL). Five patients in addition had leucopenia. Thrombocytopenia was seen in 6 patients, of whom 3 had a platelet count of less than 40.000/dL. Peripheral smear showed pancytopenia in 2 cases, pancytopenia with iron deficiency anaemia in 1 case, bicytopenia in 2 cases, and eosinophilia in 1 case. BMA and BMB were done in 10 cases, and in 1 case only PM biopsy was done. Clinical indications for BM were PUO with cytopenia (2 cases), suspected lymphoma (2 cases), bicytopenia (2 cases), pancytopenia (2 cases), neutropenia (1 case), disseminated TB (1 case), and PM BM biopsy (1 case). The PM case was suspected as lymphoma clinically and was confirmed to be classical HD (lymphocyte-depleted variant) upon PM lymph node biopsy (Figure 1b, inset). BMA was unsatisfactory in 7 cases and in 3 cases there was reactive marrow. In 3 cases, gelatinous metachromatic seromucinous material was seen focally, with a few entrapped haematopoietic cells (Figure 2a). BMBs were hypocellular in 7 cases and normocellular in 4 cases; they showed focal GMT in 5 cases (Figures 1a and 1b) and diffuse GMT in 6 cases (Figure 2b). Under lowpower examination, GMT appeared as amorphous, finely granular, light blue to pale pink material, which was stained by alcian blue at pH 2.5 (Figure 1c). A variable degree of atrophy of fat cells was seen. Reactive changes in the form of plasmacytosis, histiocytic prominence, lymphoid aggregate (Figure 2c), and secondary dysplasia were seen in 4 cases. The PM case showed evidence of haemophagocytosis in addition to GMT (Figure 1d).
Das S, et al: Gelatinous Marrow Transformation
Turk J Hematol 2014;31:175-179
GMT has a male predominance and is usually rare in children. Only rare case reports are available showing GMT in children [8]. In our study, all patients were males and the youngest was 15 years of age. In a large series conducted by Bohm [1] on 158 patients, GMT was found in all age groups except children. On the other hand, in a study from India, Jain et al. [9] observed GMT in 14 children (total cases: 43), the youngest being a child of 6 months old with cholestatic jaundice.
Figure 1. A) Bone marrow biopsy (patient 8) showing focal GMT (H&E, 100x). B) Higher magnification of the same showing gelatinous material, which is pale blue in colour (H&E, 400x); inset: lymph node biopsy of the same patient showing Reed-Sternberg cells and mummified cells (H&E, 400x). C) The seromucinous material is positive with alcian blue (400x). D) Bone marrow biopsy also showing haemophagocytosis (H&E, 1000x).
Figure 2. A) Bone marrow aspirate showing metachromatic seromucinous material with a few entrapped fat spaces (Giemsa, 100x). B) Bone marrow biopsy showing diffuse GMT (H&E, 100x). C) Bone marrow biopsy from HIVpositive patient (patient 10) showing a reactive lymphoid nodule with focal GMT (H&E, 100x).
Discussion GMT has also been termed as ‘starvation marrow’ or serous (fat) atrophy. Chronic malnutrition may be the source of GMT because it is very commonly seen in anorexia, starvation, and other malnourished states [6]. Wang et al. [7] described a case of GMT in a patient with a starch-free diet, which was reversible after restoration of a normal diet. Hyaluronic acid, a ubiquitous component of the extracellular matrix, plays an important role in repairing damaged tissue. It is suggested that hyaluronic acid may be a substance to replace fat cells in the marrow that are used in catabolic states of disease. However, since most patients with chronic wasting disease do not show GMT, additional factors besides fat cell mobilisation may be necessary for the development of GMT [1].
The spectrum of underlying disease in GMT is heterogeneous. The most common clinical association in our series was HIV positivity (5 cases), followed by PUO (2 cases), which is similar to the findings in previous studies [1,5]. Four previously published cases of GMT in patients with HIV positivity [10] were also included in this study. However, in a larger case series of 43 cases from North India [9], none of the cases were associated with HIV infection. In another study by Sen et al. [3] of 65 cases, GMT was most commonly associated with infections. Bohm [1] found association with 1 disease in most cases, but in 27 (17%) cases, 2 or 3 diseases capable of inducing GMT were present. Similarly, in our study, in 2 cases the underlying pathology was HIV with disseminated TB. GMT has also been described in association with malignancies like leukaemia, lymphoma, metastatic deposits, and multiple myeloma, with or without chemotherapy [1,3,6]. Recently it was described with imatinib therapy [11]. In our study, 1 ALL patient was on chemotherapy and 1 HD patient was not on therapy. It has been suggested that some malignant cells might produce or stimulate the production of hyaluronic acid, leading to GMT [12]. GMT is almost always associated with anaemia. In the study by Jain et al. [9], all patients had moderate to severe anaemia. In Bohm’s study [1], 82% of patients were anaemic and 78% had severe weight loss or cachexia. However, the degree of anaemia did not correlate with the extent of GMT in the marrow. Similarly, all our patients had moderate to severe anaemia, but the degree of anaemia did not correlate with the extent of GMT. Five patients had leucopenia and 6 patients had thrombocytopenia, which did not show any correlation with the degree of GMT. This is similar to the findings of previous studies [1]. Most of the GMT lesions could be diagnosed from BMB sections with haematoxylin and eosin (H&E) staining. BM aspirate was diluted in 7 cases and 3 cases showed cellular reactive marrow; however, those 3 cases showed focal GMT in the BMB. Gelatinous seromucinous material was seen only in 3 cases in BMA. In a large series of cases, Bohm [1] diagnosed GMT in all cases (158) from BMB sections. In another series of cases, however, 24 out of 43 cases were diagnosed with BMA, 17 cases with both BMA and BMB, and 2 cases with only with BMB [9]. Under low-power examination, GMT appears as a hypocellular area with mild to marked hypoplasia of 177
178
+
+
+
-
+
+
+
+
+
+
2
3
4
5
6
7
8
9
10
11
-
-
+
+
+
-
-
+
+
+
+
-
-
-
-
+
+
-
-
-
-
-
-
-
TB, AFB-
s/o lymphoma
-
-
-
TB, AFB+
-
-
TB, AFB+
-ve
+ve
-ve
-ve
-ve
-ve
-ve
+ve
+ve
+ve
+ve
HIV serology
Treatment history
Clinical diagnosis
Unknown drug
ART
ATT
-
-
-
Chemotherapy
-
-
-
-
Alcoholic pancreatitis
HIV
Disseminated TB
Hodgkinâ&#x20AC;&#x2122;s lymphoma
PUO
PUO
ALL
HIV/TB
HIV/oral candidiasis
HIV/cryptococcal meningitis
HIV/TB
10.8
9.9
7.3
-
4.1
4
5
6.5
8.6
5.2
8.3
1.7
4.0
2.9
-
4.9
4.5
1.8
7.5
2.2
2.8
4.2
301
195
102
20.0
70.0
40.0
20.0
165.0
82.0
198.0
185.0
Reactive, gelatinous material+
Reactive
Reactive, gelatinous material+
Not done
Unsatisfactory
Unsatisfactory
Unsatisfactory
Unsatisfactory
Unsatisfactory, gelatinous material+
Unsatisfactory
Unsatisfactory
Normocellular, lymphoid nodule plasmacytosis, dysmegakaryopoiesis Hypocellular, myeloid suppression
Focal
Normocellular, plasmacytosis
Focal
Focal
Hypocellular, haemophagocytosis
Hypocellular
Hypocellular
Hypocellular
Focal
Diffuse
Diffuse
Diffuse
Normocellular, plasmacytosis
Hypocellular
Diffuse
Focal
Hypocellular
Hypocellular
Other findings
Diffuse
Diffuse
GMT
BMB
Abbreviations; +: Present, -: Absent, wt.: Weight, LN: lymph node, FNAC: Fine-needle aspiration cytology, TB: Tuberculosis, AFB: Acid fast bacilli, s/o: Suggestive of, +ve: positive, -ve: negative, ATT: Antituberculous therapy, ART: Antiretroviral therapy, ALL: Acute lymphoblastic lymphoma, PUO: Pyrexia of unknown origin, Hb: Haemoglobin, TLC: Total leucocyte count, Plt: Platelet, BMA: Bone marrow aspiration, BMB: Bone marrow biopsy.
+
LN (FNAC)
Hb TLC Plt. BMA (g/dL) (x109/L) count (x109)
Bleeding manifestation
Fever
Wt. loss
Haematological parameters
Clinical parameters
1
Case no.
Table 1. Clinico-haematological profile of all patients.
Turk J Hematol 2014;31:175-179
Das S, et al: Gelatinous Marrow Transformation
Das S, et al: Gelatinous Marrow Transformation
ematopoietic cells. There is atrophy of fat cells, which are both reduced in number and of variable size. Both fat and haematopoietic cells are replaced by amorphous material, which has a light blue to pale pink and finely granular appearance. This is stained by alcian blue at pH 2.5. The gelatinous material must be differentiated from marrow necrosis, oedema, and amyloidosis [9]. Necrosis is granular and may be associated with necrosis of the adjacent bone. Oedema is differentiated by absence of fat cell atrophy. Amyloidosis is homogeneous and can be excluded by Congo red staining. However, none of the conditions stain positively with alcian blue. One patient was diagnosed with HD in a PM biopsy, and the BM showed evidence of haemophagocytosis along with focal GMT. GMT can be associated with HD [9]. Similarly, haemophagocytosis is also known to occur in association with HD [13]. All these changes are described individually in association with HIV [14]. However, in this patient, HIV status was negative. Coexistence of both GMT and haemophagocytosis in an HIV-negative patient with HD with a fatal course has not been reported before, to the best of our knowledge. Conclusion GMT is a relatively uncommon condition and an indicator of severe illness. It should be differentiated from myelonecrosis, amyloidosis, and marrow oedema. A high index of suspicion is required to diagnose this condition. Conflict of Interest Statement
Turk J Hematol 2014;31:175-179
3. Sen R, Singh S, Singh H, Gupta A, Sen J. Clinical profile in gelatinous bone marrow transformation. J Assoc Physicians India 2003;51:585-588. 4. Chen SH, Hung IJ, Jaing TH, Sun CF. Gelatinous degeneration of the bone marrow in anorexia nervosa. Chang Gung Med J 2004;27:845-849. 5. Meheta K, Gascon P, Robboy S. The gelatinous bone marrow (serous atrophy) in patients with acquired immunodeficiency syndrome. Evidence of excess sulfated glycosaminoglycan. Arch Pathol Lab Med 1992;116:504-508. 6. Seaman JP, Kjeldsberg CR, Linker A. Gelatinous transformation of the bone marrow. Hum Pathol 1978;9:685-692. 7. Wang C, Amato D, Fernandes B. Gelatinous transformation of bone marrow from a starch-free diet. Am J Hematol 2001;68:58-59. 8. Basu S, Mitra S, Marwaha RK, Garewal G. Gelatinous transformation of bone marrow. Indian J Pathol Microbiol 1997;40:383-384. 9. Jain R, Singh ZN, Khurana N, Singh T. Gelatinous transformation of bone marrow: a study of 43 cases. Indian J Pathol Macrobiol 2005;48:1-3. 10. Murugan P, Chandrakumar S, Basu D, Hamide A. Gelatinous transformation of bone marrow in acquired immunodeficiency syndrome. Pathology 2007;39:287-288. 11. Hong FS, Mitchell CA, Zantomio D. Gelatinous transformation of bone marrow as a late morphological change in imatinib mesylate treated chronic myeloid leukemia. Pathology 2010;42:84-85.
The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.
12. Ifrah N, Saint-André JP, de Gentile L, Foussard C, Chevailler A, Flandrin G, Boasson M. Gelatinous transformation of the bone marrow: manifestation of an acute leukemia? Acta Hematol 1989;82:165-168.
References
13. Ménard F, Besson C, Rincé P, Lambotte O, Lazure T, Canioni D, Hermine O, Brousset P, Martin A, Gaulard P, Raphaël M, Larroche C. Hodgkin lymphoma-associated hemophagocytic syndrome: a disorder strongly correlated with Epstein-Barr virus. Clin Infect Dis 2008;47:531-534.
1. Bohm J. Gelatinous transformation of the bone marrow: the spectrum of underlying disease. Am J Surg Pathol 2000;24:56-65. 2. Cornbleet PJ, Moir RC, Wolf PL. A histochemical study of bone marrow hypoplasia in anorexia nervosa. Virchows Arch (Pathol Anat) 1977;374:239-247.
14. Tripathy AK, Mishra R, Kalra P, Gupta N, Ahmad R. Bone marrow abnormality in HIV disease. J Assoc Physicians India 2005;53:705-710.
179
Case Report
DOI: 10.4274/tjh.2013.0041
Use of Mesenchymal Cells to Modulate Immune Suppression and Immune Reconstruction in a Patient with Aplastic Anemia Complicated by Invasive Sino-Orbital Aspergillosis Sino-Orbital Aspergillozisi Olan Aplastik Anemili Olguda İmmun Sistemin Baskılanması ve Yeniden Yapılanmasını Sağlamak Amacı ile Mezenkimal Hücrelerin Kullanımı Hakan Özdoğu1, Mahmut Yeral1, Can Boğa1, İlknur Kozanoğlu1,2 1Başkent University Adana Adult Bone Marrow Transplantation and Stem Cell Therapy Center, Department of Hematology, Adana, Turkey 2Başkent University Adana Adult Bone Marrow Transplantation and Stem Cell Therapy Center, Department of Physiology, Ankara, Turkey
Abstract: Cultured human bone marrow mesenchymal cells (MSCs) have immunomodulatory and tissue regenerative properties. This report summarizes the result of post-transplant treatment with MSCs of a 26-year-old patient with aplastic anemia complicated by invasive sino-orbital aspergillosis. The patient was treated with MSCs to benefit from the dual effects of MSCs in immune reconstitution: suppression against alloreactive T cells and facilitation of the re-engraftment process. The patient did not develop acute or chronic graft-versus-host disease. The aspergillus infection healed completely. The engraftment failure was also ended without any complications. During his last visit in his fourth year after transplantation, the patient was in hematological remission. Human bone marrow-derived MSCs seem to have an important role in preventing or overcoming immunological complications in patients who undergo stem cell transplantation. Key Words: Mesenchymal stem cell, Immune recovery, Aplastic anemia, Allogeneic stem cell transplantation Özet: Kemik iliği kaynaklı mezenkimal kök hücrelerin (MKH) immun düzenleyici ve doku tamir edici özellikleri vardır. Bu yazıda komplike invaziv sino-orbital aspergillozu olan 26 yaşındaki aplastik anemili olguda post transplant MKH uygulanması rapor edilmiştir. MKH ile tedavi edilen hastada MKH’lerin immun yeniden yapılanma üzerine çift yönlü etkisinden faydalanılarak; alloreaktif T hücreleri suprese edilmesi ve yamalanmanın kolaylaştırılması amaçlanmıştır. Komplike hastada akut ve kronik graft versus host hastalığı gelişmedi. Aspergilloz enfeksiyonu ve engraftmant yetmezliği komplikasyonsuz düzeldi. Takip eden visitlerinde hasta dördüncü yılında hematolojik remisyondadır. Kök hücre transplantasyonu yapılan hastalarda insan kemik iliği kaynaklı MKH’lerin uygulanması immunolojik komplikasyonlardan korunma ve önlenmesinde önemli role sahiptir. Anahtar Sözcükler: Mezenkimal kök hücreler, İmmün yeniden yapılanma, Aplastik anemi, Allogenik kök hücre nakli Address for Correspondence: İlknur Kozanoğlu, M.D., Başkent University Adana Adult Bone Marrow Transplantation and Stem Cell Therapy Center, Department of Physiology, Ankara, Turkey E-mail: ipamuk5@hotmail.com Received/Geliş tarihi : February 6, 2013 Accepted/Kabul tarihi : March 29, 2013
180
Özdoğu H, et al: MSCs, Immune Supression and Immune Reconstruction
Introduction The infectious complications and immune dysfunction after human hematopoietic stem cell transplantation (HSCT) can activate acute graft-versus-host disease (GvHD) among patients undergoing HSCT [1]. The restoration of immune function is critical in effective treatment of invasive fungal infection and prevention of acute GvHD in these patients [2]. Mesenchymal stem cells (MSCs) are capable of regulating immune function and supporting marrow stroma [1,2,3,4,5]. Here we present a patient with very severe aplastic anemia and invasive aspergillosis who was successfully treated with hemopoietic stem cells from a sibling donor and MSCs from original and third-party donors. Case Presentation A 26-year-old male patient with aplastic anemia was admitted to our center with fever, periorbital swelling, periorbital pain, and bloody nasal discharge. The patient had been diagnosed with severe aplastic anemia 10 days before, when the bone marrow examination (aspiration and biopsy) was compatible with severe idiopathic aplastic anemia (bone marrow cellularity of <10%). Empirical ceftazidime initiated for infection control was ineffective. Nasal and right periorbital erythema had developed 3 days before admission. On physical examination, fever of 38.5 °C, nasal and right periorbital erythema, and right periorbital swelling were detected. Ecchymosis and petechial lesions over the lower limbs were also present. Examination of the eyes was normal and no neurological abnormalities were detected. His hematological test revealed pancytopenia (WBC: 0.33x109/L, Hb:7 g/L, Plt:19x109/L). The percentages of lymphocytes, neutrophils, and eosinophils in the peripheral blood were 91%, 1.9%, and 2.4% of total nuclear cells, respectively. The percentage of reticulocytes in the peripheral blood was 0.13% of erythrocytes. Peripheral blood smear revealed normochromic and normocytic erythrocytes and decreased leukocytes (mostly lymphocytes) and platelets. Serologic tests for antibodies to hepatitis B and C virus, cytomegalovirus, Epstein-Barr virus, and human immunodeficiency viruses 1 and 2; serological tests for antinuclear antibodies; and a direct Coombs’ test were all negative. Biochemical tests revealed normal vitamin B12, folic acid, and serum iron. Computed tomography of the paranasal sinuses demonstrated a spaceoccupying lesion of the right maxillary and ethmoid sinus region. Histopathology showed numerous PAS-stained Aspergillus hyphae without tissue invasion. Tissue culture revealed Aspergillus fumigatus. The patient was a student. At the time of admission, he reported that he had not used any drugs or been exposed to any known chemicals recently. Voriconazole administration was started with limited clinical benefit (12 mg/kg/day). However, 20 days later, the patient developed fever and flare of nasal discharge.
Turk J Hematol 2014;31:181-183
The First Transplant A human leukocyte antigen (HLA)-compatible sibling bone marrow donor was available for transplantation. Hence, the patient underwent non-myeloablative allogeneic peripheral HSCT with a conditioning regimen including antithymocyte globulin (5 mg/kg/day for 3 days) and cyclophosphamide (50 mg/kg/day for 4 days). Five million cells per kilogram of CD34 cells were infused from the HLAmatched sibling donor. Prophylaxis against GvHD was given with cyclosporine and methotrexate. Naturally, the patient was at high risk of GvHD because of the active fungal infection. For use prior to the possible onset of acute GvHD, human bone marrow MSCs, cultured ex vivo, were obtained from his original donor under good manufacturing practice conditions (Thanks to Prof. Dr. Ercüment Ovalı). Following peripheral HSCT, neutrophil engraftment occurred on day +16. However, platelet recovery was not complete until day +32. Culture-expanded MSCs were infused on day +32 to the patient for hematopoietic support and their immunosuppressive effect to prevent acute GvHD. The MSC dose used was 1x106/kg. Platelets engrafted within 10 days following MSC infusion. On day +60, complete peripheral blood count revealed the following: Hb, 8 g/L; WBC, 2.2x109/L (30% neutrophils, 68% lymphocytes, 2% monocytes); Plt, 70x109/L. A chimerism study revealed 100% donor T-cell chimerism in the peripheral blood. He had no cytopenia or evidence of acute GvHD on days +90 and +180. No early or late adverse events were demonstrated after MSC infusion. There was no improvement of the patient’s fungal infection after MSC infusion. Second Transplant The patient developed late donor-type engraftment failure in the eighth month. The use of immunosuppressive therapy including corticosteroids and cyclosporine for control of engraftment failure was ineffective. The patient therefore underwent a second transplant from the original donor using the same conditioning protocol. Human MSCs were obtained from an HLA-mismatched unrelated donor. This time, to promote engraftment, MSCs were given 4 h before stem cell infusion. The doses of MSCs and CD34 cells were 0.8x106/kg and 6.43x106/kg, respectively. No lymphocyte depletion was performed because of absence of GvHD. Times to reach an absolute neutrophil count greater than 0.5x109/L and a platelet count greater than 50x109/L were 7 days and 9 days, respectively. Graft function was normal on day +100 of the second transplant. No early or late adverse events were demonstrated after MSC infusions. Informed consent was obtained from the patient for the applied procedures. Approval of the MSC infusion was also received from the National Regulatory Authorities. We are now following this patient as an outpatient in the post-transplant fourth year. Discussion Acute GvHD and graft failure/graft rejection remain the main clinical challenges in allogeneic HSCT. As an 181
Turk J Hematol 2014;31:181-183
important risk factor, active infections may influence the probability of incidence and severity of GvHD [1]. Post-transplant immunosuppressive therapy (mostly cyclosporine A and methotrexate) for prevention of GvHD may not be effective, especially in high-risk patients [1]. In addition, delayed engraftment or graft rejection may also be associated with severe infections [6]. McCann et al. [7] reported the poor outcome of graft failure patients (actuarial survival of 17%), where infection was an important contributory factor. Human bone marrow MSCs are pluripotent cells that are able to home to damaged tissues and differentiate into various cell lineages such as adipocytes, fibrocytes, neural cells, and osteocytes [5]. They may also support the growth of bone marrow cells [3,4,5]. Several reports have shown the suppressive effects of MSCs on T cells, B cells, dendritic cells, and natural killer cell proliferation in vitro and in vivo [5]. For this reason, there has recently been great interest in the use of MSCs for the treatment of acute GvHD, but there is very little knowledge on prevention of GvHD with the use of MSCs [8,9,10,11]. In recent studies, MSCs have been shown to exert beneficial effects on hemopoietic recovery, prevention of graft rejection, and prevention or control of GvHD following allogeneic HSCT [12,13]. Fast engraftment was vital for our patient with active infection while he was undergoing transplantation. Thus, we decided to culture MSCs from the original donor, although we were not able to co-infuse MSCs with stem cells due to technical reasons during the first HSCT. We did MSC infusion on day +32 in order to at least prevent acute GVHD. Engraftment occurred as we wanted, with no GVHD, and the patient recovered quickly. A second marrow transplant is the treatment of choice for aplastic anemia patients with no engraftment or graft rejection unresponsive to immunosuppressive therapy after HSCT [7]. We observed severe destruction of engrafted bone marrow cells, unresponsive to filgrastim and efficient immunosuppressive treatment, in the eighth month. Therefore, we decided to give the patient a second HSCT. To accelerate engraftment of the second allograft, co-infusion of a second dose of MSCs was planned [8]. This time, to prevent delay in infusion of MSCs, bone marrow MSCs from an HLA-mismatched unrelated donor were used based on the literature knowledge on this issue [9,10]. Successful and sustained engraftment occurred without any complications. Although a definitive conclusion cannot be made for MSCs’ usage, we think that MSCs allowed us to obtain a positive outcome from the point of view of the literature knowledge as discussed below. It has been reported that MSC infusion together with allogeneic hematopoietic stem cells resulted in fast engraftment of neutrophils and platelets [11]. Further support for the enhancement of hematopoietic 182
Özdoğu H, et al: MSCs, Immune Supression and Immune Reconstruction
recovery was presented by Le Blanc et al. [8]. They showed that MSCs promoted donor cell engraftment in patients with primary or secondary graft failure. It was also reported that MSC treatment suppressed acute GvHD in transplanted patients, who had better overall survival than patients in the control group [12]. Other investigators supported this observation [9,10]. MSCs seem to be a promising treatment option for stem cell recipients who need fast hematopoietic recovery owing to co-morbidity. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Goker H, Haznedaroglu IC, Chao NJ. Acute graft-vs-host disease: pathobiology and management. Exp Hematol 2001;29:259-277. 2. Damodar S. Allogeneic stem cell transplant in a patient with aplastic anemia with bacteremia and candidemia. Turk J Hematol 2008;25:209-210. 3. Koç ON, Gerson SL, Cooper BW, Dyhouse SM, Haynesworth SE, Caplan AI, Lazarus HM. Rapid hematopoietic recovery after coinfusion of autologous-blood stem cells and cultureexpanded marrow mesenchymal stem cells in advanced breast cancer patients receiving high-dose chemotherapy. J Clin Oncol 2000;18:307-316. 4. Meuleman N, Tondreau T, Ahmad I, Kwan J, Crokaert F, Delforge A, Dorval C, Martiat P, Lewalle P, Lagneaux L, Bron D. Infusion of mesenchymal stromal cells can aid hematopoietic recovery following allogeneic hematopoietic stem cell myeloablative transplant: a pilot study. Stem Cells Dev 2009;18:1247-1252. 5. Dazzi F, Ramasamy R, Glennie S, Jones SP, Roberts I. The role of mesenchymal stem cells in haemopoiesis. Blood Rev 2006;20:161-171. 6. Mikulska M, Raiola AM, Bruno B, Furfaro E, Van Lint MT, Bregante S, Ibatici A, Del Bono V, Bacigalupo A, Viscoli C. Risk factors for invasive aspergillosis and related mortality in recipients of allogeneic SCT from alternative donors: an analysis of 306 patients. Bone Marrow Transplant 2009;44:361-370. 7. McCann SR, Bacigalupo A, Gluckman E, Hinterberger W, Hows J, Ljungman P, Marin P, Nissen C, van’t Veer Kerthof E, Raghavachar A, Socie G, Frickhofen N, Locasciulli A, Schrezenmeier H. Graft rejection and second bone marrow transplants for acquired aplastic anemia: a report from the Aplastic Anemia Working Party of the European Bone Marrow Transplant Group. Bone Marrow Transplant 1994;13:233-237.
Özdoğu H, et al: MSCs, Immune Supression and Immune Reconstruction
8. Le Blanc K, Samuelsson H, Gustafsson B, Remberger M, Sundberg B, Arvidson J, Ljungman P, Lönnies H, Nava S, Ringdén O. Transplantation of mesenchymal stem cells to enhance engraftment of hematopoietic stem cells. Leukemia 2007;21:1733-1738. 9. Le Blanc K, Rasmusson I, Sundberg B, Götherström C, Hassan M, Uzunel M, Ringdén O. Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 2004;363:1439-1441. 10. Ringdén O, Uzunel M, Rasmusson I, Remberger M, Sundberg B, Lönnies H, Marschall HU, Dlugosz A, Szakos A, Hassan Z, Omazic B, Aschan J, Barkholt L, Le Blanc K. Mesenchymal stem cells for treatment of therapy-resistant graft-versus host disease. Transplantation 2006;81:1390-1397.
Turk J Hematol 2014;31:181-183
12. Zhang X, Jiao C, Zhao S. Role of mesenchymal stem cells in immunological rejection of organ transplantation. Stem Cell Rev 2009;5:402-409. 13. Le Blanc K, Frassoni F, Ball L, Locatelli F, Roelofs H, Lewis I, Lanino E, Sundberg B, Bernardo ME, Remberger M, Dini G, Egeler RM, Bacigalupo A, Fibbe W, Ringdén O; Developmental Committee of the European Group for Blood and Marrow Transplantation. Mesenchymal stem cells for treatment of steroid-resistant severe, acute graft-versus-host disease: a phase II study. Lancet 2008;371:1579-1586.
11. Ball LM, Bernardo ME, Roelofs H, Lankester A, Cometa A, Egeler RM, Locatelli F, Fibbe WE. Cotransplantation of ex vivo expanded mesenchymal stem cells failure accelerates lymphocyte recovery and may reduce the risk of graft failure in haploidentical hematopoietic stem-cell transplantation. Blood 2007;110:2764-2767.
183
Case Report
DOI: 10.4274/tjh.2013.0064
A Case Associated with Comorbidities Among Cerebral Infarction, Idiopathic Thrombocytopenic Purpura, and Triple X Syndrome Serebral Enfarkt, İdyopatik Trombositopenik Purpura Komorbiditelerinin Birlikte Bulunduğu Bir Triple X Sendromu Olgusu Hanjun Kim1, Sang Sun Hwang1, Young Uh1, Juwon Kim1, Kap Jun Yoon1, Ji-Yong Lee2 1Yonsei
University Wonju College of Medicine, Department of Laboratory Medicine, Wonju, Korea
2Yonsei
University Wonju College of Medicine, Department of Neurology, Wonju, Korea
Abstract: A 46-year-old female presented to the emergency room due to the chief complaint of left-sided weakness. By imaging study, she was diagnosed with cerebral infarction. Thrombolytic and antiplatelet agents were not considered due to the “golden hour” for treatment having passed and a low platelet count. The peripheral blood smear, bone marrow biopsy, and aspirate findings were consistent with immune thrombocytopenic purpura. The chromosome analysis revealed the 47,XXX karyotype. To the best of our knowledge, this is the first case report associated with the comorbidities of cerebral infarction, idiopathic thrombocytopenic purpura, and triple X syndrome.
Key Words: Cerebral infarction, Idiopathic thrombocytopenic purpura, Triple X syndrome Özet: Kırk altı yaşındaki kadın hasta başlıca şikayeti sol tarafındaki zayıflık olarak acil servise başvurdu. Görüntüleme çalışmaları sonucu serebral enfarktüs tanısı kondu. Tedavi için değerli “altın saatler”in geçmiş olması ve düşük trombosit değerleri sebebiyle trombolitik tedavi ve antiagregan tedavi başlanmadı. Hastanın çevre kanı yayması, kemik iliği biyopsisi ve aspirasyonu immün trombositopenik purpura ile uyumluydu. Kromozom incelemesinde 47,XXX karyotip tayin edildi. Bilgilerimize göre, bu olgu serebral enfarkt, idyopatik trombositopenik purpura komorbiditelerinin birlikte bulunduğu ilk triple X sendromudur.
Anahtar Sözcükler: Serebral enfarkt, İdyopatik trombositopenik purpura, Triple X sendromu
Address for Correspondence: Young Uh, M.D., Yonsei University Wonju College of Medicine, Department of Laboratory Medicine, Wonju, Korea GSM: +82-33-741-1592 E-mail: u931018@yonsei.ac.kr Received/Geliş tarihi : February 21, 2013 Accepted/Kabul tarihi : June 4, 2013
184
Kim H, et al: Triple X with ITP
Introduction Triple X syndrome, also known as trisomy X (47,XXX karyotype), was first described in 1959 by Jacobs et al. [1]. It is relatively common as it occurs in about 1/1000 live female births. The cause of the disease is nondisjunction during the meiotic period and it is connected to advanced maternal age [2]. Idiopathic thrombocytopenic purpura (ITP) has a similar incidence of approximately 6/100.000 a year in the United States and United Kingdom. Pathophysiology of the disease is thought to be the destruction and impaired production of platelets by autoantibodies [3]. Recent studies indicate that genes located on the X chromosome play a major and unique role in autoimmunity [4]. The number of X chromosomes and the consequently altered X-linked gene dosage are critical for the maintenance or the loss of immune tolerance [5]. ITP is usually associated with bleeding tendency, but it also has thrombotic complications, which have been reported at rare intervals [3,6,7]. According to a recent large retrospective analysis, the incidence of thromboembolic events was 6.9% in ITP patients [3].
Turk J Hematol 2014;31:184-187
passed by 3 h, she was treated with aspirin to prevent recurrence of cerebral infarction, and antiplatelet agents were withheld due to a low platelet count. The initial complete blood count was as follows: hemoglobin 11.7 g/L; WBC count 10.0x109/L with a differential count of 70% neutrophils, 23% lymphocytes, and 3.6% monocytes; and platelet count 20x109/L. To identify the cause of the low platelet count, a peripheral blood smear was done. It revealed normocytic anemia and thrombocytopenia. Bone marrow biopsy and aspiration findings were compatible with ITP, showing no evidence of malignancy but slightly increased megakaryocytes with some atypical forms. Antiplatelet antibody was positive. She was diagnosed with ITP and acute cerebral infarction. Chromosome analysis of the peripheral blood and bone marrow demonstrated a nonmosaic 47,XXX karyotype (Figure 3). Because of positive lupus anticoagulant, antiphospholipid syndrome (APS) was also considered, but her conditions did not meet the diagnostic criteria for APS because the lupus anticoagulant
Recently, we experienced a case of cerebral infarction in a female ITP patient, and her karyotype revealed trisomy X. To the best of our knowledge, this is the first case presentation concerning comorbidities among triple disease entities: cerebral infarction, idiopathic thrombocytopenic purpura, and triple X syndrome. Case Presentation A 46-year-old female was admitted to the emergency room due to the chief complaint of left-sided weakness that lasted for 10 h. She was a heavy lifelong drinker and smoker, but had no other medical history of note. On physical examination, all her vital signs were stable. She complained of dysarthria, facial weakness, headache, leftsided weakness, and visual field defect. By conducting a neurologic examination, right-sided gaze preponderance was seen, and visual field defect, facial weakness, and sensory change were detected on the left side. The motor function grades of the left-upper and left-lower extremities were also weakened to 2 and 4, respectively. The Babinski sign was positive on the left side. Contrast brain computed tomography and diffusion-weighted brain magnetic resonance imaging demonstrated recent infarction in the right middle cerebral artery territory (Figure 1). Contrastenhanced magnetic resonance angiography was also done (Figure 2). Transesophageal echocardiography showed mitral regurgitation. Pelvic ultrasound showed no abnormal findings. Informed consent was obtained. Since administration of thrombolytic agents was not considered due to the â&#x20AC;&#x153;golden hourâ&#x20AC;? for treatment having
Figure 1. Large recent infarction involving right middle cerebral artery territory of frontoparietotemporal area and right striatocapsular area with mass effect and vascular enhancement.
Figure 2. Right middle cerebral artery occlusion, stenoocclusive lesion involving right vertebral artery at v3-v4 segment. 185
Turk J Hematol 2014;31:184-187
Kim H, et al: Triple X with ITP
Figure 3. Chromosome analysis by G-banding technique revealed 47,XXX karyotype. became negative upon follow-up laboratory assessment. Activity of factor VIII and antithrombin III, and protein C and protein S antigen levels and homocysteine level, were within the reference ranges. Protein factor VIII antibody was not detected. The aspirin therapy was discontinued when her platelet count recovered to above 50.000/ÂľL, and intravenous dexamethasone (20 mg, twice daily) was started. About 1 month after admission, her general condition, including the neurologic symptoms, improved significantly and she was discharged from the hospital. Discussion Triple X patients generally experience normal pubertal development, but they can also suffer from mild developmental delays, behavioral problems, and learning disabilities [2]. In the present case, the patient and her 3 children did not experience mental or physical problems. It is supposed that most affected women are not identified but that cases are often diagnosed incidentally due to the low detection rate of triple X fetuses in prenatal ultrasounds, as well as the mild and variable phenotypic expression of the disease [2,8,9]. Concerning this karyotype, various functional and structural genitourinary abnormalities have been reported. They include bilateral polycystic kidney, hydronephrosis due to ureteral stricture, menstrual irregularity, and ovarian dysgenesis with urinary tract malformation in stillborn trisomy X fetuses [2,10,11]. Other abnormalities have also been mentioned: auditory defect, bilateral optic atrophy, brain anomaly, chorioretinitis, craniofacial dysmorphy, duodenal atresia, epileptic seizure, heart defect, jejunal atresia, and skeletal system anomalies [11]. Meanwhile, there are some reports on trisomy X associated with autoimmunity: 1 case with increased antinuclear antibody (ANA) and microsomal antithyroid 186
antibody titers, 2 cases with systemic lupus erythematosus (SLE), 1 case with positive rheumatoid factor, and 1 ITP case with positive ANA and anticardiolipin antibody [2]. The higher prevalence of autoimmune diseases in women compared to men could be due to effects of ovarian hormones, pregnancy, and the presence of a second X chromosome [12]. One of the 2 X chromosomes in females undergoes inactivation during embryonic development. An inactivated X chromosome (XCI) may escape presentation of X-linked self-antigens in the thymus or in other peripheral sites that are involved in tolerance induction [13]. XCI may also be skewed during thymic development, resulting in predominant expression of only one set of X-chromosomeencoded self-antigens [12,14]. This may lead to inadequate thymic deletion of autoreactive T lymphocytes, which in turn leads to impaired self-antigen recognition and tolerance [13], thus triggering an autoimmune response in target cells. It is also possible that portions of the XCI can reactivate. According to recent studies, several X-chromosome-located microRNAs have important functions in immunity and thus possibly contribute to sex-specific immune responses [12,15]. Dai et al. [16] reported that 13 microRNAs had the same expression patterns in both SLE and ITP, which might generally be associated with autoimmune diseases. Additionally, 6 microRNAs that were only downregulated in ITP might be correlated with the organ-specific destruction of thrombocytes. Although there was no apparent causal connection between trisomy X and ITP, we hypothesize that as the number of X chromosomes increases, frequencies of escaping and/or skewing of XCI, and the expression level of microRNAs related to ITP, will increase. Further studies are necessary to confirm our hypothesis. An earlier study showed evidence that thrombotic events are related to antiphospholipid antibodies [7]. In this case, we could assume such a relationship due to positive lupus anticoagulant. Destructed platelets release humoral factors and platelet microparticles (PMPs) by an immunologic mechanism [7]. These PMPs induce activation of coagulation factors [17]. In other words, PMPs act as procoagulants and may protect against bleeding and promote thrombotic events in immunological thrombocytopenic patients [18]. Although it remains unclear whether these diseases had incidentally occurred or were predisposed by the additional X chromosome, we can hypothesize that the additional X chromosome may play an important role in autoimmunity. However, we could not clarify why the thrombus of the patient and ITP were associated with each other because hereditary thrombotic risk factors including the molecular studies of MTHFR, prothrombin, and factor V Leiden genes were not evaluated due to losing the patient to follow-up. Though therapy for ischemic stroke in ITP patients is still controversial, it would be better to manage patients according to the individualized pathophysiological mechanisms of the disease [6]. In a case similar to ours, successful results were
Kim H, et al: Triple X with ITP
Turk J Hematol 2014;31:184-187
made possible by improving platelet levels with steroids and intravenous immunoglobulin in the beginning, followed by treatment with antiplatelet agents [3]. As far as we know, this is the first case report associated with comorbidities among cerebral infarction, idiopathic thrombocytopenic purpura, and Triple X syndrome. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Jacobs PA, Baikie AG, Brown WM, Macgregor TN, Maclean N, Harnden DG. Evidence for the existence of the human â&#x20AC;&#x153;super femaleâ&#x20AC;?. Lancet 1959;2:423-425. 2. Holland CM. 47,XXX in an adolescent with premature ovarian failure and autoimmune disease. J Pediatr Adolesc Gynecol 2001;14:77-80. 3. Mahawish K, Pocock N, Mangarai S, Sharma A. Cerebral infarction in idiopathic thrombocytopenic purpura: a case report. BMJ Case Rep 2009;2009. pii:bcr04.2009.1748. 4. Invernizzi P, Pasini S, Selmi C, Gershwin ME, Podda M. Female predominance and X chromosome defects in autoimmune diseases. J Autoimmun 2009;33:12-16. 5. Libert C, Dejager L, Pinheiro I. The X chromosome in immune functions: when a chromosome makes the difference. Nat Rev Immunol 2010;10:594-604. 6. Rhee HY, Choi HY, Kim SB, Shin WC. Recurrent ischemic stroke in a patient with idiopathic thrombocytopenic purpura. J Thromb Thrombolysis 2010;30:229-232. 7. Theeler BJ, Ney JP. A patient with idiopathic thrombocytopenic purpura presenting with an acute ischemic stroke. J Stroke Cerebrovasc Dis 2008;17:244-245. 8. Khoury-Collado F, Wehbeh A, Fisher A, Bombard A, Weiner Z. Prenatal diagnosis of 47,XXX. Am J Obstet Gynecol 2005;192:1469-1471.
9. Ben Hamouda H, Mkacher N, Elghezal H, Bannour H, Kamoun M, Soua H, Saad A, Souissi MM, Sfar MT. Prenatal diagnosis and prognosis of triple X syndrome: 47,XXX. J Gynecol Obstet Biol Reprod (Paris) 2009;38:599-603. 10. Hoang MP, Wilson KS, Schneider NR, Timmons CF. Case report of a 22-week fetus with 47,XXX karyotype and multiple lower mesodermal defects. Pediatr Dev Pathol 1999;2:58-61. 11. Tinsa F, Karboul L, Chekib J, Hamouda S, Ben Jemaa L, Boussetta K, Bousnina S. Marfan syndrome in a Triple-X girl: a new association? Tunis Med 2010;88:203-206. 12. Bakalov VK, Gutin L, Cheng CM, Zhou J, Sheth P, Shah K, Arepalli S, Vanderhoof V, Nelson LM, Bondy CA. Autoimmune disorders in women with turner syndrome and women with karyotypically normal primary ovarian insufficiency. J Autoimmun 2012;38:315-321. 13. Chitnis S, Monteiro J, Glass D, Apatoff B, Salmon J, Concannon P, Gregersen PK. The role of X-chromosome inactivation in female predisposition to autoimmunity. Arthritis Res 2000;2:399-406. 14. Selmi C, Brunetta E, Raimondo MG, Meroni PL. The X chromosome and the sex ratio of autoimmunity. Autoimmun Rev 2012;11:A531-537. 15. Iborra M, Bernuzzi F, Invernizzi P, Danese S. MicroRNAs in autoimmunity and inflammatory bowel disease: crucial regulators in immune response. Autoimmun Rev 2012;11:305-314. 16. Dai Y, Huang YS, Tang M, Lv TY, Hu CX, Tan YH, Xu ZM, Yin YB. Microarray analysis of microRNA expression in peripheral blood cells of systemic lupus erythematosus patients. Lupus 2007;16:939-946. 17. Lee YJ, Jy W, Horstman LL, Janania J, Reyes Y, Kelley RE, Ahn YS. Elevated platelet microparticles in transient ischemic attacks, lacunar infarcts, and multiinfarct dementias. Thromb Res 1993;72:295-304. 18. Ahn YS, Horstman LL, Jy W, Jimenez JJ, Bowen B. Vascular dementia in patients with immune thrombocytopenic purpura. Thromb Res 2002;107:337-344.
187
DOI: 10.4274/tjh.2012.0125
Case Report
Primary Adrenal Lymphoma Primer Adrenal Lenfoma Karima Kacem1, Sami Zriba2, Raihane Ben Lakhal1, Walid Bouteraa1, Lamia Aissaoui1, Ramzi Ben Amor1, Yosr Ben Abdennebi1, Zaher Belhadj Ali1, Hela Ben Abid1, Balkis Meddeb1 1Tunis El Manar University Faculty of Medicine, Aziza Othmana Hospital, Department of Hematology, Tunis, Tunisia 2Tunis El Manar University Faculty of Medicine, Military Hospital, Department of Internal Medicine, Tunis, Tunisia
Abstract: Primary non-Hodgkin’s lymphoma of the adrenal gland is rare. We report the case of a 56-year-old patient suffering from B symptoms. The CT scan showed a bilateral adrenal mass without any lymph nodes. Scan-guided biopsies led to the diagnosis of diffuse large B-cell lymphoma. The medullar biopsy eliminated a secondary lymphoma. The patient was treated by immunochemotherapy with a complete response before autologous stem cell transplantation.
Key Words: Lymphoma, Adrenal glands, Addisonian crisis Özet: Adrenal bezin Hodgkin dışı lenfoması nadirdir. Burada B semptomları ile başvuran 56 yaşında bir olgu bildirilmektedir. Bilgisayarlı tomografide bilateral adrenal kütle saptandı. Eşlik eden patolojik büyüklükte lenfadenopati görülmedi. Görüntüleme eşliğinde yapılan biyopsiler ile diffüz büyük B hücreli lenfoma tanısı kondu. Kemik iliği biyopsisi sekonder lenfoma tanısını dışladı. Hastada immunokemoterapi uygulaması ile otolog kök hücre nakli öncesinde tam yanıt sağlandı.
Anahtar Sözcükler: Lenfoma, Adrenal bez, Addison krizi
Introduction Primary adrenal lymphoma (PAL) is a rare extranodal non-Hodgkin’s lymphoma and seems to have very poor prognosis. Case Presentation A 56-year-old man presented with a 2-month history of fever, night sweats, abdominal pains, and weight loss.
Clinical examination found a body temperature of 37 °C and normal blood pressure, heart rate, and respiratory rate. There was no superficial lymphadenopathy. Laboratory findings showed a normal blood cell count, normal serum sodium, potassium of 5.82 mg/L, normal phosphorus, calcium of 2.82 mmol/L, and creatinine of 117.5 µmol/L. Blood urea nitrogen was 13.75 mmol/L. Lactate dehydrogenase was 5210 UI/L (10 times the normal upper limit).
Address for Correspondence: Karima Kacem M.D., Tunis El Manar University Faculty of Medicine, Aziza Othmana Hospital, Department of Hematology, Tunis, Tunisia E-mail: karima-kacem@voila.fr Received/Geliş tarihi : September 8, 2012 Accepted/Kabul tarihi : January 18, 2013
188
Kacem K, et al: Primary Adrenal Lymphoma
An ultrasound scan disclosed a retroperitoneal tumor. Abdominal computed tomography (CT) scanning demonstrated bilateral adrenal tumors measuring 145x90 mm without any lymphadenopathy (Figure 1). Positron emission tomography with 18F-fluorodeoxyglucose (FDG-PET) was not available in our country. Informed consent was obtained. Histological examination of the percutaneous CT-guided biopsy specimen from the adrenal tumor revealed CD20positive diffuse large B-cell non-Hodgkin’s lymphoma (DLBCL) (Figures 2 and 3). The bone marrow biopsy specimen was normal. Chest CT scan was normal. Primary bilateral adrenal lymphoma was diagnosed. The disease was staged as IV according to the Ann Arbor system, and it was high-grade according to the International Prognostic Index (IPI). In accordance with Tunisian protocol, this young patient (<60 years) received
Turk J Hematol 2014;31:188-191
a CHOP-like regimen followed by autologous stem cell transplantation (ASCT). The patient was treated by 6 cycles of immunochemotherapy type R-CHOP14 (a combination of cyclophosphamide at 750 mg/m2 on day 1, vincristine at 2 mg on day 1, adriamycin at 50 mg/m2 on day 1, and oral prednisolone at 60 mg/m2 daily for 5 days) with antiCD20 at 375 mg/m2 on day 1. He also received intrathecal chemotherapy (methotrexate, 15 mg and hydrocortisone, 15 mg) for central nervous system prophylaxis on day 1 of the 4 cycles of chemotherapy. A complete endocrine work-up was performed before R-CHOP14 and showed normal plasma adrenocorticotropic hormone at 08:00 hours of 42 ng/L, normal serum cortisol at 08:00 hours of 693 mmol/L, low serum aldosterone of 10 pg/mL, low dehydroepiandrosterone sulfate of 15.4 µg/mL, and elevated serum renin of 26 ng/L. The patient started adrenal hormone replacement with glucocorticoid and mineralocorticoid therapy before initiating the R-CHOP chemotherapy regimen. The clinical outcome after 4 cycles of R-CHOP was poor, with hematologic toxicities (grade IV of the WHO scale), malnutrition, adrenal crisis, Karnofsky index of 30%, and muscular atrophy. He required metabolic, nutritional resuscitation and motor rehabilitation for 1.5 months. An abdominal CT scan after the fourth cycle of chemotherapy showed a 55% regression of the adrenal tumor (Figure 4). Mobilization was done with an R-CHOP regimen and granulocyte colony-stimulating factor following the fifth cycle with collection of peripheral stem cells of 3.90x106 CD34/kg. The follow-up abdominal scan after 6 cycles of chemotherapy revealed no evidence of tumor (Figure 5).
Figure 1. Postcontrast CT scan showed bilateral adrenal tumors (Ò).
Figure 2. DLBCL: malignant lymphoid cells, hematoxylin & eosin stain.
The patient received ASCT after a BEAM conditioning regimen. The patient is still alive in complete response 24 months after ASCT.
Figure 3. DLBCL: malignant lymphoid cells, CD20 immunostain. 189
Kacem K, et al: Primary Adrenal Lymphoma
Turk J Hematol 2014;31:188-191
Figure 4. CT scan after 4 cycles of chemotherapy showed partial response.
Figure 5. CT scan at the end of treatment showed a complete response. Discussion PAL is a rare extranodal non-Hodgkinâ&#x20AC;&#x2122;s lymphoma [1]. Malignant lymphoma arising in the endocrine glands represents only 3% of extranodal malignant lymphomas and is usually confined to the thyroid gland [2,3]. PAL occurs predominantly in males, with a male to female ratio of about 7:1 [3]. Our patient was a male subject. The average age is 70 years old (range=39-87) according to the existing literature [4,5]. These lymphomas are usually present with large, bilateral adrenal masses with or without lymphadenopathy [3]. Between 50% and 70% of patients with bilateral PAL have clinical or biochemical evidence of primary adrenal insufficiency (PAI) [5]. Since Addisonian crises have led to severe life-threatening consequences, immediate substitution therapy must be considered if PAI is suspected. 190
PAI was found in our patient with clinical symptoms: fatigue, anorexia, weight loss, and pigmentation of skin, in addition to laboratory findings. PAI is due to infiltration and complete destruction of the adrenal glands by lymphoid cells. However, Dutta et al. suggested that there was no correlation between the size of the tumor and PAI. The bilateral adrenal lymphoma could develop because of lymphatic tissues existing in both adrenal glands [3]. The etiology of PAL is not clear; the most common hypothesis involves hematopoietic tissue akin to adrenal myelolipoma resting in the adrenal glands [6]. Ellis and Read [7] thought that the adrenal glands in humans do not contain lymphoid tissue and the follicle center cell origin of PAL suggests that the tumor may have arisen on a background of previous autoimmune adrenalitis consistent with the finding of primary adrenal insufficiency. Bilateral enlargement of the adrenal glands should raise the suspicion of lymphoma [5,6,7,8]. A diagnosis of PAL is made in the case of a patient presenting with bilateral adrenal masses without nodal involvement and absence of involvement of other organs [5]. PAL is usually discovered in postmortem examination [7,8,9]. PAL usually presents with bilateral adrenal masses (73%) with variable enlargement sizes ranging from 4 to 17 cm2. Density on CT scan is variable, and on magnetic resonance imaging lymphoma was described to be of low signal intensity on T1 and high signal intensity with areas of mixed signal intensity on T2 weighted imaging [5]. PAL should be differentiated from tuberculosis, nonfunctioning adenoma, pheochromocytoma, adrenal carcinoma, and metastases of the lung, breast, kidney, pancreas, and melanomas [8]. PAL is called an â&#x20AC;&#x153;incidentalomaâ&#x20AC;? because it is surprisingly found on radiological investigations conducted with increasing rates for abdominal pain [9,10]. The diagnosis of PAL is confirmed by histology study. Surgical biopsy or ultrasound- or CT-guided core biopsy is required. DLBCL is the most common type of PAL (70%), followed by mixed large and small cell, small noncleaved cell, and the undifferentiated type. On immunostaining, the majority of this entity is seen to have originated from B cells [8,9,10,11]. At presentation, the involvement of other sites outside the adrenals is rare, but during the course of the disease PAL exhibits a propensity for generalized involvement of multiple extranodal regions such as the liver, stomach, and central nervous system. Different modalities are used for the treatment of PAL: surgery with bilateral adrenalectomy, multiagent chemotherapy, radiotherapy, or a combination of these. For PAI, replacement therapy is necessary. PAL seems to have very poor prognosis; overall, 34% of the treated patients survived disease-free for at least 6 months. Because of limited data and the limited follow-up period in most case reports, it is not possible to calculate overall survival and disease-free survival.
Kacem K, et al: Primary Adrenal Lymphoma
Our patient is in complete response at 24 months after ASCT. ASCT was recommended in upfront consolidation therapy in our protocol for aggressive lymphoma with an IPI score of ≥2 in young patients. This decision was based on the results of study LNH87-2 of the Adult Lymphoma Study Group (French: Groupe d’Etudes des Lymphomes de l’Adulte) before the rituximab era [12]. In the literature, about 70 cases were published with rare complete or partial responses, with an overall survival of 4 months [10,11,12,13]. Kim et al. reported recent data about 14 PAL patients treated with an R-CHOP regimen. Results were encouraging and they demonstrated that achieving complete response after R-CHOP is predictive of survival. They also proposed a modified staging system for PAL in which early stages (I, II) significantly correlate with longer overall survival and progression-free survival [14]. At present, it is unclear whether the adjunction of rituximab to CHOP can cure patients with high-risk, aggressive lymphoma without ASCT. In our patient, it is further unknown whether prolonged complete response was due to R-CHOP alone or to the additional ASCT. It is necessary to emphasize that early diagnosis of PAL, before adrenal insufficiency appears, contributes to decreasing the patient’s morbidity and mortality. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Lim KH, Chiou TY, Lin CJ, Hsieh RK. Rituximab in the treatment of primary bilateral adrenal lymphoma with adrenal crisis. Med Oncol 2008;25:107-109. 2. Nishiuchi T, Imachi H, Fujiwara M, Murao K, Onishi H, Kiguchi T, Takimoto H, Kushida Y, Haba R, Ishida T. A case of non-Hodgkin’s lymphoma primary arising in both adrenal glands associated with adrenal failure. Endocrine 2009;35:34-37. 3. Lee KS, Chung YS, Park KH, Kim HS, Kim HM. A case of primary bilateral adrenal lymphoma with partial adrenal insufficiency. Yonsei Med J 1999;40:297-300. 4. Dahami Z, Debbagh A, Dakir M, Hafiani M, Joual A, Bennani S, el Mrini M, Benjelloun S. Lymphome primitif de la surrénale de phénotype B, diagnostiqué à la ponctionbiopsie percutanée. Ann Urol (Paris) 2001;35:22-25.
Turk J Hematol 2014;31:188-191
5. Wang JP, Sun HR, Li YJ, Bai RJ, Gao S. Imaging features of primary adrenal lymphoma. Chin Med J (Engl) 2009;122:2516-2520. 6. Dutta P, Bhansali A, Venkatesan R, Mittal BR, Kumar V. Primary adrenal lymphoma. Endocrinologist 2005;15:340342. 7. Ellis RD, Read D. Bilateral adrenal non-Hodgkin’s lymphoma with adrenal insufficiency. Postgrad Med J 2000;76:508509. 8. Mantzios G, Tsirigotis P, Veliou F, Boutsikakis I, Petraki L, Kolovos J, Papageorgiou S, Robos Y. Primary adrenal lymphoma presenting as Addison’s disease: case report and review of the literature. Ann Hematol 2004;83:460-463. 9. Tazi K, Achour A, Koutani A, Ibn Attya A, Hachimi M, Lakrissa A. Localisation primitive d’un lymphome malin non hodgkinien de la surrénale: A propos d’un cas. Revue de la littérature. Prog Urol 1999;9:1102-1105. 10. Schreiber CSO, Sakon JR, Simiao FPC, Tomarchio MP, Huayllas M, Pereira LCMM, Stella LC, Santomauro AS Jr, Bueno SSS, Fraige FF. Primary adrenal lymphoma: a case series study. Ann Haematol 2008;87:859-861. 11. Tomoyose T, Nagasaki A, Uchihara JN, Kinjo S, Sugaya K, Onaga T, Ohshima K, Masuda M, Takasu N. Primary adrenal adult T-cell leukemia / lymphoma: a case report and review of the literature. Am J Hematol 2007;82:748-752. 12. Haioun C, Lepage E, Gisselbrecht C, Bastion Y, Coiffier B, Brice P, Bosly A, Dupriez B, Nouvel C, Tilly H, Lederlin P, Biron P, Brière J, Gaulard P, Reyes F. Benefit of autologous bone marrow transplantation over sequential chemotherapy in poor-risk aggressive non-Hodgkin’s Lymphoma. Updated results of the prospective study LNH87-2. Groupe d’Etude des Lymphomes de l’Adulte. J Clin Oncol 1997;15:11311137. 13. Benchekroun A, Qarro A, Kasmaoui H, Iken A, Marzouk M, Faik M. Le lymphome malin non hodgkinien bilatéral et primitif de la surrénale (à propos d’une observation avec revue de la littérature). Ann Chir 2003;128:557-560. 14. Kim YR, Kim JS, Min YH, Hyunyoon D, Shin HJ, Mun YC, Park Y, Do YR, Jeong SH, Park JS, Oh SY, Lee S, Park EK, Jang JS, Lee WS, Lee HW, Eom H, Ahn JS, Jeong JH, Baek SK, Kim SJ, Kim WS, Suh C. Prognostic factors in primary diffuse large B-cell lymphoma of adrenal gland treated with rituximab-CHOP chemotherapy from the Consortium for Improving Survival of Lymphoma (CISL). J Hematol Oncol 2012;5:49.
191
DOI: 10.4274/tjh.2013.0255
Letter to the Editor
Bone and Bone Marrow Involvement in Sarcoidosis Sarkoidozda Kemik ve Kemik İliği Tutulumu Gökhan Sargın1, İrfan Yavaşoğlu2, Gürhan Kadıköylü2, Zahit Bolaman2 1Adnan
Menderes University Faculty of Medicine, Department of Internal Medicine, Aydın, Turkey
2Adnan
Menderes University Faculty of Medicine, Department of Hematology, Aydın, Turkey
To the Editor, We report a 52-year-old male patient with bone marrow and skeletal system involvement of sarcoidosis. In sarcoidosis, while bone involvement occurs at a rate of 10%-15%, iliac bone and bone marrow involvement is less common [1,2]. A 52-year-old male patient was admitted to our clinic with increased lower back pain with activity for the last 2 months. The patient occasionally coughed up white sputum. He had a 20-year medical history of sarcoidosis, but had received no treatment for the last 5 years. There were bilateral crackles in the middle and lower zones of the lungs. The sacroiliac tension test was positive. Erythrocyte sedimentation rate was 42 mm/h, hemoglobin 14.5 g/dL, hematocrit 43.8%, leukocyte count 7100/mm3, platelet count 376,000/mm3, serum calcium 9.6 mg/dL, total prostate-specific antigen 2.7 ng/mL, total protein 6.8 g/dL, and albumin 3.3 g/dL; the serum alkaline phosphatase level was normal. The tuberculin skin test result was 8 mm and sputum smear examinations for acid-resistant bacilli were negative for 5 times. Polyclonal gammopathy was detected in protein electrophoresis. While in hip radiography increased cortical thickness was observed in the bone pelvis and femur, in cervical and cranial radiography, bone structures and soft tissues were normal. Posteroanterior chest radiography revealed diffuse reticular infiltration. Thoracic computed tomography was consistent with stage 4 sarcoidosis. Technetium-99m bone scintigraphy revealed dense and diffuse increased osteoblastic activity in the cranium; all pelvic and sacroiliac joints; C7, T12, and T11 vertebrae of the vertebral column; and both proximal femurs (Figure 1). There were no pathological or radiological findings upon magnetic resonance imaging
Figure 1. Dense and diffuse increased osteoblastic activity in the cranium; all pelvic and sacroiliac joints; the C7, T12, and T11 vertebrae of the vertebral column; and both proximal femurs on technetium-99m bone scintigraphy. of the lumbosacral region. These findings were found to be concordant with skeletal system involvement of sarcoidosis. Bone marrow biopsy was performed due to increased osteoblastic activity on technetium-99m bone scintigraphy and noncaseating granulomatous inflammation was detected (Figure 2). A distinct feature of sarcoidosis is the local accumulation of inflammatory cells. Based on bone marrow biopsy and imaging results of technetium-99m bone scintigraphy, the patient was diagnosed with vertebral, iliac bone, and bone marrow involvement of sarcoidosis, and
Address for Correspondence: Gökhan Sargın, M.D., Adnan Menderes University Faculty of Medicine, Department of Internal Medicine, Aydın, Turkey Phone: +90 256 212 00 20 E-mail: gokhan_sargin@hotmail.com Received/Geliş tarihi : July 20, 2013 Accepted/Kabul tarihi : October 30, 2013
192
Turk J Hematol 2014;31:192-193
Sargın G, et al: Bone and Bone Marrow Involvement in Sarcoidosis
any symptoms. Informed consent was obtained. In sarcoidosis, bone and bone marrow involvement should be kept in mind in patients with lower back pain. Acknowledgments For their contributions to the images, we thank Füruzan Döger (Adnan Menderes University Faculty of Medicine, Department of Pathology) and Yakup Yürekli (Adnan Menderes University Faculty of Medicine, Department of Nuclear Medicine). Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Figure 2. Noncaseating granulomatous inflammation in the bone marrow biopsy (hematoxylin & eosin, 100x). treatment with 1 mg/kg/day methylprednisolone was started. Systemic corticosteroids remain the mainstay of treatment. However, clinicians should be careful with methotrexate due to its cytotoxic effects on bone marrow. We could not reevaluate the response to treatment with technetium bone scintigraphy. The patient is still under our follow-up without
Key Words: Sarcoidosis, Bone, Bone marrow Anahtar Sözcükler: Sarkoidoz, Kemik, Kemik iliği References 1. Awada H, Abi-Karam G, Fayad F. Musculoskeletal and other extrapulmonary disorders in sarcoidosis. Best Pract Res Clin Rheumatol 2003;17:971-987. 2. Wilcox A, Bharadwaj P, Sharma OP. Bone sarcoidosis. Curr Opin Rheumatol 2000;12:321-330.
193
DOI: 10.4274/tjh.2013.0178
Letter to Editor
The Treatment of Acquired Hemophilia with Combination Therapy of Immunosuppressives and Immunoadsorption Kazanılmış Hemofilinin Immunsupresif ve Immunadsorbsiyon Kombinasyonu ile Tedavisi Aynur Uğur Bilgin1, Muhit Özcan2, Erol Ayyıldız2, Osman İlhan2 1Necmettin 2Ankara
Erbakan Universty Meram Faculty of Medicine, Department of Hematology, Konya, Turkey
University Faculty of Medicine, Department of Hematology, Ankara, Turkey
To the Editor, Acquired hemophilia A (AHA) is an uncommon entity caused by autoantibodies against blood clotting factor VIII, which neutralize its procoagulant activity. The incidence of AHA is approximately 1 to 4 per million/year [1] and the underlying pathological conditions of the disease are still unknown. Although the majority of patients with acquired hemophilia are idiopathic (up to 50%), there are possible associated illnesses such as autoimmune disease, solid tumors, lymphoproliferative malignancies, skin disorders, drugs, infections, and chronic graft-versus-host disease, and AHA occurs most commonly in the elderly [2]. We report here an AHA patient who was successfully treated with a combination therapy of immunosuppression and immunoadsorption. A 78-year-old male patient, who had symptoms including epistaxis, spontaneous ecchymosis, and hematomas on the back and hip, referred to our hospital in March 2010. His medical history included chronic obstructive pulmonary disease and he had no history of preexisting autoimmune disease or inherited hemorrhagic disorders. On physical examination, multiple ecchymosis and hematomas were present on his left shoulder, arm, and thigh. When auscultating the lungs of the patient, wheezes were bilaterally
heard over the lower lung fields. No other abnormality was noticed on physical examination. The initial laboratory findings showed a white blood cell count of 12.3x109/L (normal range: 4.5-11x109/L) with neutrophils at 84%, hemoglobin of 7.3 g/dL (normal range: 12.6-17.4 g/dL), hematocrit of 22.1% (normal range: 37%-51%), and platelets of 430x109/L (normal range: 150-400x109/L). Biochemical parameters were normal; however, coagulation studies showed that the normal prothrombin time and international normalized ratio, which were 12.6 s and 1.09, respectively, and prolonged activated partial thromboplastin time [aPTT: 157 s (normal range: 22-36 s)] were not corrected by a 1:1 mixture with normal fresh plasma after a 2-h incubation period. Informed consent was obtained. The anticoagulant effect of the patient was not corrected by dilution, suggesting the presence of an inhibitor directed against one of the coagulation factors. Additionally, the factor VIII:C level and its inhibitor titer were determined as 3.9% and 9.6 BU, respectively. The patient was diagnosed with AHA. Etiological diagnostic workup including autoimmune and tumor markers was negative. Thorax and abdominopelvic computed tomography revealed no pathological findings. Following the transfusion of erythrocyte suspensions, the patient was treated with
Address for Correspondence: Aynur Uğur Bİlgİn M.D., Necmettin Erbakan Universty Meram Faculty of Medicine, Department of Hematology, Konya, Turkey Phone: +90 505 450 73 16 Received/Geliş tarihi Accepted/Kabul tarihi
194
: May 22, 2013 : October 21, 2013
Bilgin UA, et al: Acquired Hemophilia
recombinant FVIIa (rFVIIa Novo Seven®) at a dosage of 90 µg/kg (3 times) to control the Hemorrhagic syndrome. After the recombinant FVIIa treatment, bleeding was controlled. Although there was a slight improvement in his laboratory values, aPTT never returned to the normal range. The factor VIII:C level and its inhibitor titer reached a value of 0.4% and 44 BU, respectively, 1 month later. Cyclophosphamide at 50 mg/day plus methyl-prednisolone (MP) at 1 µm/kg/ day was initiated as immunosuppressive therapy. However, there was no improvement in factor VIII:C level and its inhibitor titer (2% and 52.8 BU, respectively) after 1 month from the beginning of immunosuppressive drugs, and his complaints about nose bleeding and spontaneous ecchymoses on multiple areas of his body began again. In order to stop bleeding complications, recombinant activated factor VII (rFVIIa) at a dose of 90 µg/kg (3 times) was given again. We decided to administer a modified BonnMalmö Protocol [large-volume immunoadsorption on days 1-5, intravenous immunoglobulin 0.3 g/kg/day on days 5-7, cyclophosphamide 1 mg/kg/day orally, MP 1 mg/ kg/day orally from day 1 until remission (dose reduction) as immunosuppressive therapy, and factor VIII 100 IU/ kg every 6 h (dose reduced when 50%-80% FVIII activity was achieved)] as described before [2]. After 5 courses of immunoadsorption procedure, laboratory findings showed aPTT of 31.3 s, factor VIII:C level of 81.7%, and factor inhibitor of 0. As a result, cyclophosphamide was not given anymore, and MP was tapered toward an end. The patient was discharged with MP alone as immunosuppressive therapy. One month after the therapy, laboratory results of the patient were normal and no bleeding complications occurred. Unfortunately, we learned from the patient’s relatives that he died due to acute exacerbations of chronic obstructive pulmonary disease at 6 months. AHA is a rare but potentially fatal condition that can lead to life-threatening hemorrhage. The bleeding phenotype is heterogeneous, but rather different from congenital hemophilia. Soft tissue hematoma, muscle bleeding, hematuria, gastrointestinal bleeding, and postpartum hemorrhages are typical clinical manifestations, as opposed to congenital hemophilia where hemarthroses are predominant [3]. The mortality rate of AHA ranges between 16% and 22% depending on age, underlying diseases, the levels of inhibitors, and individual response to therapy. Because of the low incidence of AHA, therapeutic options of this condition are still discussed controversially and are not clearly standardized. Due to the high risk of life-threatening bleeding, an aggressive therapeutic approach is recommended in these patients. Currently 2 important therapeutic strategies are the treatments of acute bleeding: high doses of factor VIII concentrates and/ or factor VIII bypassing agents (activated prothrombin complex concentrate or recombinant factor VIIa) and the eradication of the factor VIII autoantibodies from
Turk J Hematol 2014;31:194-196
plasma [by immunosuppressive drugs (the combination of steroids and cyclophosphamide) and/or plasmapheresis or immunoadsorption] [1,2,3]. Immunoadsorption is a treatment that can be performed with diverse extracorporeal systems and it depletes the IgG fraction from the plasma of patient. Compared to plasmapheresis, larger volumes of plasma are processed and the procedure is more efficient in immunoadsorption. There are some case series that demonstrate the efficacy of immunoadsorption in acquired hemophilia [4,5,6,7]. Xu et al. presented a 58-year-old man with AHA treated with a combination of low-dose rituximab and recombinant human FVIIa, and they suggested that rituximab therapy should be considered for inhibitor eradication treatment of AHA [8]. In our case, immunosuppressive treatment, consisting of MP and cyclophosphamide, was administered as the firstline therapy. However, neither a clinical nor a laboratory response was observed. We thus made a decision to apply a modified Bonn-Malmö Protocol [1] to the patient. Immediately after applying this protocol, from the fifth day on, the patient’s laboratory results returned to normal and clinical bleeding ended. Therefore, this case showed that immunoadsorption procedure added to immunosuppressive medication is an efficient treatment modality for AHA. In conclusion, the application of a modified Bonn-Malmö Protocol is easy, reliable, and safe, and it can be considered as the first line of treatment, especially in elderly patients. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Key Words: Factor Immunosuppressive
VIII
deficiency,
Acquired,
Anahtar Sözcükler: Faktör VIII eksikliği, Kazanılmış, Immunsupresif References 1. Franchini M, Lippi G. Acquired factor VIII inhibitors. Blood 2008;112:250-255. 2. Zeitler H, Ulrich-Merzenich G, Hess L, Konsek E, Unkrig C, Walger P, Veter H, Brackmann HH. Treatment of acquired hemophilia by the Bonn-Malmö Protocol: documentation of an in vivo immunmodulating concept. Blood 2005;105:2287-2293. 3. Ma AD, Carrizosa D. Acquired factor VIII inhibitors: pathophysiology and treatment. Hematology Am Soc Hematol Educ Program 2006;432-437. 4. Brzoska M, Krause M, Geiger H, Betz C. Immunoadsorption with single-use columns for the management of bleeding in acquired hemophilia A: a series of nine cases. J Clin Apher 2007;22:233-240. 195
Turk J Hematol 2014;31:194-196
Bilgin UA, et al: Acquired Hemophilia
5. Zeitler H, Ulrich-Merzenich G, Panek D, Goldmann G, Vidovic N, Brackmann H, Oldenburg J. Immunoadsorption in the treatment of acquired hemophilia. Atheroscler Suppl 2009;10:122-125.
7. Freiburghaus C, Berntrop E, Ekman M, Gunnarsson M, Kjellberg BM, Nilsson IM. Immunoadsorption for removal of inhibitors: update on treatments in Malmรถ-Lund between 1980 and 1995. Haemophilia 1998;4:16-20.
6. Jansen M, Schmaldienst S, Banyai S, Quehenberger P, Pabinger I, Derfler K, Hรถrl WH, Knรถbl P. Treatment of coagulation inhibitors with extracorporeal immunoadsorption (IgTherasorb). Br J Haematol 2001;112:91-97.
8. Xu Y, Zhang X, Zhao Y, Zhao L, Qiu H, Wu D. Successful treatment of a patient with acquired hemophilia A with a combination of a low-dose rituximab and recombinant human FVIIa. Hemophilia 2013;19:95-96.
196
DOI: 10.4274/tjh.2013.0164
Letter to the Editor
The Role of Radiotherapy Among the Therapeutic Options for Castleman’s Disease Castleman Hastalığının Tedavi Seçenekleri Arasında Radyoterapinin Rolü Feryal Karaca1, Çiğdem Usul Afşar2, Erkut Erkurt1, Hasan Suat Arslantaş1, Elif Çalış3, Berna Totan Ateş3, Emine Bağır3, Melek Ergin3, Semra Paydaş2 1Çukurova
University Faculty of Medicine, Department of Radiation Oncology, Adana, Turkey
2Çukurova
University Faculty of Medicine, Department of Medical Oncology, Adana, Turkey
3Çukurova
University Faculty of Medicine, Department of Pathology, Adana, Turkey
To the Editor, Castleman’s disease, also known as giant lymph node hyperplasia or angiofollicular lymph node hyperplasia, was first defined in 1956 by Castleman and his colleagues. It usually appears as a mediastinal, cervical, mesenteric, or retroperitoneal mass [1]. Castleman’s disease is divided into 2 different types, hyaline vascular or plasma cell, based on histopathological features [2]. Cases with mixed histological features have also been reported [3,4]. There are 2 clinical types: localized or multicentric [3]. There is also another form associated with HIV positivity. Castleman’s disease may be accompanied by malignant lymphoma, vascular neoplasm, follicular dendritic cell tumor, or Kaposi’s sarcoma [5,6,7]. The localized form is usually asymptomatic; surgical removal of the lesion is curative and it does not progress to lymphoma or other diseases. However, the multicentric form usually appears as the plasma cell type, leads to systemic complaints, and is treated medically [8,9]. Multicentric Castleman’s disease is quite aggressive and may progress to non-Hodgkin’s lymphoma. The localized hyaline vascular type is the most common and it clinically presents with abdominal, mediastinal, and cervical masses. We present here a 15-year-old female patient with a neck mass for 6 months who presented with enlargement of the mass for the last 2 months and shortness of breath at
night. On physical examination, palpation revealed a hard, fixed, and indeterminably circumscribed mass extending to the mediastinum. Laboratory tests showed no cytopenia. Upon magnetic resonance imaging of the soft tissue of the neck and thorax, a soft mass of 9x5x6 cm was detected. The patient underwent lymph node excision for diagnostic purposes. The pathological report revealed hyaline vasculartype Castleman’s disease (Figure 1). The patient was considered to be inoperable since the mass was large and
Figure 1. Appearance under light microscope with H&E staining and 20x magnification.
Address for Correspondence: Çiğdem Usul Afşar, M.D., Çukurova University Faculty of Medicine, Department of Medical Oncology, Adana, Turkey Phone: +90 322 338 60 60/3142 E-mail: cigdemusul@yahoo.com Received/Geliş tarihi : May 9, 2013 Accepted/Kabul tarihi : December 30, 2013
197
Karaca F, et al: Radiotherapy and Castleman’s Disease
Turk J Hematol 2014;31:197-198
fixed to the surrounding tissues. After giving a total dose of 3060 cGy external radiotherapy (RT) to the left neck and supraclavicular lymph nodes in 17 fractions of 180 cGy, a total dose of 4500 cGy curative RT was given by boost to the involved lymph nodes. On the control computed tomography examination, in comparison to the previous imaging, partial regression was observed and the mass was 5 cm in the axial plane. The patient has been followed for 18 months and the disease is still stable. Systemic inquiry of the patient revealed no symptoms. In Castleman’s disease of the localized form, prognosis is excellent with surgical resection of well-circumscribed neck masses [3]. However, the present patient had no chance of surgery. Adjuvant therapy is needed for the cases in which resection is not available or incomplete [10]. A study performed at the MD Anderson Cancer Center, including 22 patients, investigated the role of RT in unicentric and multicentric disease. The paper reported that RT provided clinical response and cure in the selected patients [11]. Cure has been achieved after resection in all cases in the literature [12]. Unlike the localized form, there is no consensus on the treatment of the multicentric form. Chemotherapy and corticosteroid therapy are given in addition to surgery; however, response is variable and prognosis is poor. In conclusion, Castleman’s disease should be considered in the front line of possibilities in the differential diagnosis of mediastinal masses. Complete resection by surgery results in excellent early and late outcomes. As in the present case, RT is an appropriate option for masses that cannot be resected by surgery. RT can be a definitive treatment modality of unicentric Castleman’s disease with a good control rate and few complications, as seen in a review of the literature [13]. Three-dimensional conformal RT and intensity modulated radiation therapy can also be used in unresectable unicentric cases [14]. The overall response rate in localized Castleman’s disease is about 70% (complete response rate is about 44% and partial response rate is 29%), and almost all responding patients sustain stable or remission status. Only a few cases show no response to RT. As the techniques of RT have developed, it is possible to deliver high-dose radiation to target tumors with minimal complications [13]. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Key Words: Unicentric
Castleman’s
disease,
Radiotherapy,
Anahtar Sözcükler: Castleman hastalığı, Radyoterapi, Unisentrik
198
References 1. Frizzera G. Castleman’s disease and related disorders. Semin Diagn Pathol 1988;5:346-364. 2. Keller AR, Hochholzer L, Castleman B. Hyaline-vascular and plasma-cell types of giant lymph node hyperplasia of the mediastinum and other locations. Cancer 1972;29:670683. 3. Herrada J, Cabanillas F, Rice L, Maning J, Puph W. The clinical behavior of localized and multicentric Castleman disease. Ann Intern Med 1998;128:657-662. 4. Weysenburger DD, Nathwany BN, Wynberg CD, Rappaport H. Multicentric angiofollicular lymph node hyperplasia: a clinicopathologic study of 16 cases. Hum Pathol 1985;16:162-172. 5. Chan JKL, Tsang WYW. Follicular dendritic cell tumor and vascular neoplasm complicating hyaline-vascular Castleman’s disease. Am J Surg Pathol 1994;18:517-525. 6. Gerald W, Kostianovsky M, Rosai J. Development of vascular neoplasia in Castleman’s disease. Report of seven cases. Am J Surg Pathol 1990;14:603-614. 7. Dickson D, Ben-Ezra JM, Reed J, Flax H, Janis R. Multicentric giant lymph node hyperplasia, Kaposi’s sarcoma, and lymphoma. Arch Pathol Lab Med 1985;109:1013-1018. 8. Hsu SM, Waldron JA, Xie SS, Barlogie B. Expression of interleukin-6 in Castleman’s disease. Hum Pathol 1993;24:833-839. 9. Herbelin C, Roux-Lombard P, Herbelin A, Peuchmaur M, De Groote D, Griscelli C, Dayer JM, Prieur AM. Inflammation: “a natural experiment” for the systemic pathogenicity of cytokines. Eur Cytokine Netw 1998;9:57-60. 10. Ozkan H, Tolunay S, Gozu O, Ozer ZG. Giant lymphoid hamartoma of mediastinum (Castleman’s disease). Thorac Cardiovasc Surg 1990;38:321-323. 11. Chronowski GM, Ha CS, Wilder RB, Cabanillas F, Manning J, Cox JD. Treatment of unicentric and multicentric Castleman disease and the role of radiotherapy. Cancer 2001;92:670676. 12. Li YM, Liu PH, Zhang YH, Xia HS, Li LL, Qu YM, Wu Y, Han SY, Liao GQ, Pu YD. Radiotherapy of unicentric mediastinal Castleman’s disease. Chin J Cancer 2011;30:351-356. 13. Noh OK, Lee SW, Lee JW, Kim SY, Kim CS, Choi EK, Kim JH, Ahn SD. Cases report of unicentric Castleman’s disease: revisit of radiotherapy role. Radiat Oncol J 2013;31:48-54. 14. Matthiesen C, Ramgopol R, Seavey J, Ahmad S, Herman T. Intensity modulated radiationtherapy (IMRT) for the treatment of unicentric Castlemans disease: a case report and review of the use of radiotherapy in the literature. Radiol Oncol 2012;46:265-270.
DOI: 10.4274/tjh.2013.0241
Letter to the Editor
The Relationship Between Hematological Findings and Coronary Artery Aneurysm in Kawasaki Disease Kawasaki Hastalığında Hematolojik Bulgular ile Koroner Arter Anevrizması Arasındaki İlişki Burçin Beken, Şule Ünal, Mualla Çetin, Fatma Gümrük
Hacettepe University Faculty of Medicine, Department of Pediatric Hematology, Ankara, Turkey
To the Editor, Kawasaki disease (KD) is a self-limited systemic vasculitis that occurs predominantly in children. It is diagnosed by using a clinical case definition that requires fever (≥5 days) together with 4 of 5 principal clinical criteria including changes in extremities, polymorphous exanthem, bilateral bulbar conjunctival injection without exudate, changes in lips and oral cavity, and cervical lymphadenopathy [1,2,3]. Patients with KD are known to have a number of common hematological abnormalities including leukocytosis and thrombocytosis. Thrombocytosis is usually seen during the acute phase of the disease, whereas thrombocytopenia is seen rarely in the acute stage and the presence of thrombocytopenia has been reported to be a risk factor for coronary aneurysm development [4,5,6]. Thirty-seven patients who were diagnosed with KD between June 2007 and January 2013 in the Hacettepe University İhsan Doğramacı Children’s Hospital were retrospectively evaluated for the hematological findings at presentation, and the hematological parameters were further analyzed for the predictivity of coronary aneurysm development. Hematological parameters of these patients are shown in Table 1. Of these patients, 18 (48.6%) had thrombocytosis. Seventeen (45.9%) patients had normal thrombocyte levels and 2 patients (5.4%) had thrombocytopenia in the acute phase of the disease. In total, 15 (40%) patients had
coronary artery aneurysm at diagnosis, including both of the 2 thrombocytopenic patients. The patients with aneurysm (Group 1) had lower hemoglobin and hematocrit levels and higher WBC counts than the patients without aneurysm (Group 2). Patients with WBC counts above 15.85x109/L were found to have increased coronary artery aneurysm risk of up to 6.6-fold (95% CI: 1.5-29.6), with a sensitivity of 71.4% and a specificity of 27.3%. Hemoglobin levels under 10.6 g/dL at presentation were found to increase the coronary artery aneurysm risk by up to 4.5-fold (95% CI: 1.0-19.4) with a sensitivity of 57.1% and a specificity of 23.8% , while hematocrit levels under 30.2 g/dL increased the coronary artery aneurysm risk 4.2-fold (95% CI: 0.919.2) with a sensitivity of 50% and a specificity of 19%. In the past, thrombocytosis was thought to be essential for the diagnosis of KD, and in the presence of thrombocytopenia, investigation of another diagnosis was recommended. However, in the past few years, this view has changed. Thrombocytopenia can be seen as a rare finding in KD and may be reported to be present in the acute phase of the disease, usually on days 5-12, disappearing within 3-4 days [4]. Niwa et al. reported 10 patients with thrombocytopenia among 303 patients with KD [6]. Six of 10 patients with thrombocytopenia (60%) developed aneurysms. In some reports, thrombocytopenia was found to be associated with acetylsalicylic acid [5]. Another suspected theory for the mechanism of thrombocytopenia is immune
Address for Correspondence: Burçin Beken, M.D., Hacettepe University Faculty of Medicine, Department of Pediatric Hematology, Ankara, Turkey Phone: +90 312 305 11 70 E-mail: burcinbeken@gmail.com Received/Geliş tarihi : July 10, 2013 Accepted/Kabul tarihi : December 12, 2013
199
Turk J Hematol 2014;31:199-200
Beken B, et al: Thrombocytopenia in Kawasaki Disease
Table 1. Comparison of hemogram findings of KD patients with (Group 1) or without (Group 2) coronary artery aneurysm.
Hemoglobin (g/dL)1 Hematocrit (%)1 WBC (x109/L)2 Platelets (x109/L)2 MCV (fL)1 MPV (fL)1
Total group (n=37)
Group 1 (n=15)
Group 2 (n=22)
10.8±1.3 (8.0-13.6) 31.5±3.8 (23.2-37.9) 15.4 (3.8-31.4) 427 (109-910) 76.1±5.2 (62.5-85.1) 7.1±0.86 (5.3-8.9)
10.2±1.4 (8.0-12.4) 29.8±4.3 (23.2-35.1) 17.4 (6.9-31.4) 445 (109-662) 75.6 ±4.2 (67.8-82.2) 7.0±0.8 (5.3-8.5)
11.2±1.1 (8.9-13.6) 32.7±2.9 (26.5-37.9) 12.6 (3.8-28.7) 447 (186- ) 76.4±5.9 (62.5-85.1) 7.2±0.8 (5.7-8.9)
p 0.030 0.045 0.044 0.399 0.677 0.536
Values are given as mean ± standard deviation (range).
1
Values are given as median (range).
2
thrombocytopenic purpura during the course of KD [7,8]. Krowchuk et al. suggested that thrombocytopenia is related to the destruction of thrombocytes by immunoglobulins or non-immune mechanisms [9]. The rate of thrombocytopenia association in KD has been reported as 1%-2% [5]. Turkish patients with KD have been previously reported to develop earlier aneurysm and desquamation [10]; herein, we also report a higher rate (5.4%) of thrombocytopenia association in these patients at presentation, which may also indicate earlier aneurysm development in thrombocytopenic patients. In conclusion, thrombocytopenia can also be seen as a presenting feature in KD instead of thrombocytosis. Anemia, leukocytosis, and thrombocytopenia should alert the clinician of severe disease and coronary artery aneurysm development, and closer follow-up with more frequent echocardiographic examinations may be a safer approach in these patients. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Key Words: Thrombocytopenia, Kawasaki disease, Aneurysm Anahtar Sözcükler: Trombositopeni, Kawasaki hastalığı, Anevrizma References 1. Daniels SR. Vascular effects of Kawasaki disease. J Pediatr 2013;163:929-931. 2. Bayers S, Shulman ST, Paller AS. Kawasaki disease: Part I. Diagnosis, clinical features, and pathogenesis. J Am Acad Dermatol 2013;69:501.e1-11. 200
3. Bayers S, Shulman ST, Paller AS. Kawasaki disease: Part II. Complications and treatment. J Am Acad Dermatol 2013;69:513.e1-8. 4. Newburger JW, Takahashi M, Gerber MA, Gewitz MH, Tani LY, Burns JC, Shulman ST, Bolger AF, Ferrieri P, Baltimore RS, Wilson WR, Baddour LM, Levison ME, Pallasch TJ, Falace DA, Taubert KA; Committee on Rheumatic Fever, Endocarditis and Kawasaki Disease; Council on Cardiovascular Disease in the Young; American Heart Association; American Academy of Pediatrics. Diagnosis, treatment, and long-term management of Kawasaki disease: a statement for health professionals from the Committee on Rheumatic Fever, Endocarditis, and Kawasaki Disease, Council on Cardiovascular Disease in the Young, American Heart Association. Pediatrics 2004;114:1708-1733. 5. Nofech-Mozes Y, Garty BZ. Thrombocytopenia in Kawasaki disease: a risk factor for the development of coronary artery aneurysms. Pediatr Hematol Oncol 2003;20:597-601. 6. Niwa K, Aotsuka H, Hamada H, Uchishiba M, Terai M, Niimi H. Thrombocytopenia: a risk factor for acute myocardial infarction during the acute phase of Kawasaki disease. Coron Artery Dis 1995;6:857-864. 7. Ishiguro N, Takahashi Y. Kawasaki disease associated with idiopathic thrombocytopenic purpura. Eur J Pediatr 1989;148:379. 8. Lipnick RN, Luban NL. Kawasaki disease with thrombocytosis followed by thrombocytopenia purpura in the same patient. Am J Dis Child 1989;143:139-140. 9. Krowchuk DP, Kumar ML, Vielhaber MM, Danish EH. Kawasaki disease presenting with thrombocytopenia. Am J Dis Child 1990;144:19-20. 10. Gülhan B, Kesici S, Beken S, Çilsal E, Kale G, Alehan D, Kara A, Özen S. Varying clinical features of Turkish Kawasaki disease patients. Turk J Pediatr 2012;54:1-6.
DOI: 10.4274/tjh.2013.0280
Letter to the Editor
An Unusual Cause of Thigh Swelling: Extramedullary Myeloid Tumor Uylukta Şişliğin Nadir Rastlanan Bir Sebebi: Ekstramedullar Myeloid Tümör Memiş Hilmi Atay1, Engin Kelkitli2, Piltan Büyükkaya3, Kubilay Ekiz4, Levent Yıldız5, Mehmet Turgut3 1Van
Training and Research Hospital, Department of Internal Medicine, Division of Hematology, Van, Turkey Training and Research Hospital, Department of Internal Medicine, Division of Hematology, Erzurum, Turkey 3Ondokuz Mayıs University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Samsun, Turkey 4Ondokuz Mayıs University Faculty of Medicine, Department of Internal Medicine, Samsun, Turkey 5Ondokuz Mayıs University Faculty of Medicine, Department of Pathology, Samsun, Turkey 2Erzurum
To the Editor, Extramedullary myeloid tumor (EMMT) is a rare neoplasm of immature myeloid cells that arises at an extramedullary site [1]. The most common sites of EMMT are the bone, lymph nodes, skin, and soft tissue [2]. EMMT rarely infiltrates the lower extremities. A 47-year-old male patient was admitted to the orthopedics clinic because of swelling and pain in the right thigh for 1 month. His past medical history was unremarkable. Physical examination indicated a 10 cm-long solid soft tissue lesion in the anterior and lateral parts of the right thigh. Complete blood count results were as follows: white blood cell count of 15.1x109/L, hemoglobin level of 11.9 g/dL, and platelet count of 94x109/L. Magnetic resonance imaging (MRI) of the right thigh demonstrated a heterogeneous mass extending towards the distal part in the anterolateral section of the right femoral neck, completely involving the vastus lateralis and intermedius muscles (Figure 1). The patient underwent Tru-Cut biopsy of the right thigh. Pathology of the TruCut biopsy showed large blastic cells infiltrating the soft tissue with hyperchromatic nuclei stained positively with CD117, CD34, and myeloperoxidase (Figure 2). After the Tru-Cut biopsy, blood count results were: white blood cells, 21.5x109/L, hemoglobin, 11.5 g/dL, and platelets, 74x109/L. Bone marrow aspiration showed 60% blasts, which were intensely positive for myeloperoxidase. Flow cytometry
performed on the bone marrow revealed a blast population that expressed CD34, CD117, CD33, CD15, CD13, CD19, and HLA-DR. As a result of cytogenetic testing, a new complex karyotype related to chromosomes 8, 10, and 21 and trisomy 8 were detected. The patient was started on an acute myeloid leukemia (AML) induction chemotherapy regimen consisting of idarubicin (12 mg/m2, daily for 3 days) and cytosine arabinoside (ara-C; 200 mg/m2 continuous infusion for 7 days). After 4 weeks, the control bone marrow aspiration was completely normal. The lesion had also disappeared completely in the control MRI of the thigh. The patient was administered a high-maintenance dose of ara-C at 3 g/m2 for 6 days for consolidation. Treatment is ongoing. A
B
Figure 1. A) Metaphysodiaphyseal paracortical heterogeneous enhancement of the proximal femur in the post-contrast T1-weighted coronal image. B) Paracortical minimal signal increase is seen in the proximal femoral metaphysodiaphyseal part in coronal T2-weighted fat-suppressed image.
Address for Correspondence: Memiş Hilmi Atay, M.D., Van Training and Research Hospital, Department of Internal Medicine, Division of Hematology, Van, Turkey Phone: +90 432 215 76 00 E-mail: dr.atay@mynet.com Received/Geliş tarihi : August 19, 2013 Accepted/Kabul tarihi : November 16, 2013
201
Turk J Hematol 2014;31:201-202
Atay HM, et al: Extramedullary Myeloid Tumor of the Extremities
Figure 2. A) Selected cytoplasm, large hyperchromatic nuclei, and tumor infiltration of cells showing marked pleomorphism (H&E, 40x). B) Diffuse strong membranous/cytoplasmic staining for CD34 in tumor cells and associated vascular structures (H&E, 40x). C) Membranous/cytoplasmic staining strong in some places and moderate in some places in tumor cells (CD117, 40x). EMMTs are composed of myeloid blasts. They can easily be confused with lymphomas or soft tissue sarcomas [3,4]. EMMTs may accompany AML in 35% of patients at presentation, 38% of patients following diagnosis of AML, and 27% of patients without diagnosis of AML [5]. Cytogenetic abnormalities like translocation (8;22) or inversion 16 and 11q23 were reported in EMMT [6]. An optimal treatment approach does not exist due to the lack of randomized studies. Intensive chemotherapy regimens containing idarubicin plus ara-C are usually administered in the treatment of EMMT. According to the risk factors (age; molecular and cytogenetic study results), allogenic stem cell transplantation may also be considered. In the case of residual infiltration as shown by imaging, radiotherapy should be considered [7]. Consequently, EMMT might be taken into consideration in the differential diagnosis of venous thromboembolism and soft tissue malignancies in the case of swollen thighs. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Key Words: Acute myeloblastic leukemia, Granulocytes, acute leukemia, Hemophagocytic lymphohistiocytosis Anahtar Sözcükler: Akut miyeloblastik lösemi, Granülositler, Akut lösemi, Hemofagositik lenfohistiositoz References 1. Khan MY, Hussein KK, Walter MG, Hasan MK, Kern W, Kharfan-Dabaja MA. Granulocytic sarcoma presenting with malignant anasarca in a patient with secondary acute myeloid leukemia. Int J Hematol 2004;79:250-252.
202
2. Breccia M, Mandelli F, Petti MC, D’Andrea M, Pescarmona E, Pileri SA, Carmosino I, Russo E, De Fabritiis P, Alimena G. Clinico-pathological characteristics of myeloid sarcoma at diagnosis and during follow-up: report of 12 cases from a single institution. Leuk Res 2004;28:1165-1169. 3. Scheipl S, Leithner A, Radl R, Beham-Schmid C, Ranner G, Linkesch W, Windhager R. Myeloid sarcoma presenting in muscle-tissue of the lower limb: unusual origin of a compartment-syndrome. Am J Clin Oncol 2007;30:658659. 4. Seyahi A, Atalar AC, Soyhan O, Berkman M. An unusual cause of hip pain: pelvic granulocytic sarcoma. Acta Orthop Traumatol Turc 2006;40:403-406. 5. Pileri SA, Ascani S, Cox MC, Campidelli C, Bacci F, Piccioli M, Piccaluga PP, Agostinelli C, Asioli S, Novero D, Bisceglia M, Ponzoni M, Gentile A, Rinaldi P, Franco V, Vincelli D, Pileri A Jr, Gasbarra R, Falini B, Zinzani PL, Baccarani M. Myeloid sarcoma: clinico-pathologic, phenotypic and cytogenetic analysis of 92 adult patients. Leukemia 2007;21:340-350. 6. Bakst RL, Tallman MS, Douer D, Yahalom J. How I treat extramedullary acute myeloid leukemia. Blood 2011;118:3785-3793. 7. Byrd JC, Weiss RB, Arthur DC, Lawrence D, Baer MR, Davey F, Trikha ES, Carroll AJ, Tantravahi R, Qumsiyeh M, Patil SR, Moore JO, Mayer RJ, Schiffer CA, Bloomfield CD. Extramedullary leukemia adversely affects hematologic complete remission rate and overall survival in patients with t(8;21) (q22;q22): results from Cancer and Leukemia Group B 8461. J Clin Oncol 1997;15:465-475.
DOI: 10.4274/tjh.2013.0270
Letter to the Editor
Isolated Breast Relapse Mimicking Breast Cancer in Elderly Patient with Acute Lymphoblastic Leukemia Akut Lenfoblastik Lösemi Tanısı Olan İleri Yaş Hastada Meme Kanserini Taklit Eden İzole Meme Nüksü Ajay Gogia1, Prashant Mehta1, Raja Pramanik1, Rajive Kumar2 1Dr.
B.R.A. Institute Rotary Cancer Hospital All India Institute of Medical Sciences, Department of Medical Oncology, New Delhi, India
2Dr.
B.R.A. Institute Rotary Cancer Hospital All India Institute of Medical Sciences, Lab of Oncology, New Delhi, India
To the Editor, Acute lymphoblastic leukemia (ALL) in adults is associated with high relapse rates. Isolated extramedullary relapse other than in the central nervous system is rare in adult females with ALL. We present a case of isolated breast relapse in a 65-year-old female with ALL, mimicking breast cancer. A 65-year old female presented with a 2-month history of fever and generalized lymphadenopathy in December 2006. Physical examination revealed generalized lymphadenopathy and hepatosplenomegaly. Her hemoglobin was 11.9 g/dL, total leukocyte count 9.2x109/L, and platelet count 106x109/L. Peripheral blood smear showed 5% myeloperoxidase-negative blast cells and the bone marrow revealed near total replacement with lymphoblasts (Figures 1A and 1B), which on flow cytometry were positive for CD19 and CD22 and negative for CD10, CD5, and CD7. The cerebrospinal fluid was uninvolved. She was diagnosed with pre-B ALL and received induction as per the MCP-841 protocol [1]. Remission was achieved at the end of induction chemotherapy. Thereafter, she completed intensification, followed by oral maintenance for 1.5 years. Twenty-four months later, she presented with a lump in the left breast. On clinical examination, she had a large, non-tender mass in her left breast with a 1-cm mobile axillary lymph node on the same side. Systemic examination was normal. We considered a diagnosis of breast cancer in view of the classical
presentation, supported by a mammogram finding suggestive of Breast Imaging Reporting and Data System Score V (Figures 1C and 1D). Blood counts, peripheral blood smear, and bone
Figure 1. Peripheral blood smear and bone marrow aspirate (A&B) show lymphoblasts with coarse chromatin and high nuclear cytoplasmic ratio (Jenner-Giemsa stain, 1000x). Mediolateral oblique and cranio-caudal views of the mammogram show homogeneous mass with architectural distortion and microcalcification (C&D). Fine-needle aspiration shows immature lymphoid cell with duct (400X) (E).
Address for Correspondence: Ajay Gogİa, M.D., Dr. B.R.A. Institute Rotary Cancer Hospital All India Institute of Medical Sciences, Department of Medical Oncology, New Delhi, India Received/Geliş tarihi : August 7, 2013 Accepted/Kabul tarihi : November 5, 2013
203
Turk J Hematol 2014;31:203-204
Gogia A, et al: Isolated Breast Relapse in ALL
Table 1. Cases of isolated breast relapse in adult ALL.
Reference
Age (years) at presentation
Sex
Treatment-free Total interval leukocyte count
Type of ALL
Outcome
Sagar et al. [4]
35
Female
2.5 years
100x109/L
Not available
Chim et al. [5]
23
Male
1.5 years
260x109/L
Not available T-cell
Basara et al. [6]
32
Female
4 years
Not available
Pre-B
KarbasianEsfahani et al. [7] Present case
30
Female
1 year
400x109/L
65
Female
2 years
9.2x109/L
Not available Pre-B
marrow were unremarkable. Fine-needle aspiration of the breast lump and axillary lymph node showed a monomorphic population of immature cells with a high nuclear/cytoplasmic ratio and prominent nucleoli, suggestive of leukemic blasts (Figure 1E). The blasts were positive for CD45, CD19, and CD22 and negative for CD3, CD5, CD7, CD10, and MPO on flow cytometry. A diagnosis of ALL relapse was made. Further investigations failed to reveal any other extramedullary site of involvement. She was given reinduction using the same treatment protocol. Response assessment done at the end of induction therapy showed complete resolution of the breast lump. The patient has been asymptomatic and disease-free for the last 2 years. Informed consent was obtained. The most common sites of relapse in ALL are the marrow, the central nervous system, and occasionally the ovaries. Breast involvement is not so rare in ALL but is usually seen in teenagers and is generally associated with the disease at other extramedullary sites as well as the bone marrow [2]. The published literature revealed a total of 14 cases of isolated breast relapse in ALL. The median age in those patients was 16 years [3]. Four cases with similar presentation of adult ALL have been published (Table 1) [4,5,6,7]. Sagar et al. reported a similar occurrence in a 35-year-old female, but details on immunophenotyping, response, remission status, and outcome were not available [4]. Chim et al. reported a similar case in a 23-year-old male with previous diagnosis of T-cell ALL who died of progressive disease after 7 months of relapse [5]. Two other cases with similar presentation have been reported [6,7]. All patients reported with adult ALL were between the ages of 23 and 35 years. Our patient was 69 years old at the time of relapse, and her clinical findings closely resembled breast cancer, a malignancy more common for her age. It is important that clinicians be aware that the breast may be a site of relapse in adult females with ALL and hence include breast examination during follow-up. 204
Died 7 months after diagnosis Died during induction Alive and disease-free Alive and disease-free
Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Key Words: Acute lymphoblastic leukemia, Isolated breast relapse Anahtar Sözcükler: Akut lenfoblastik lösemi, İzole meme nüksü References 1. Vaidya SJ, Advani SH, Pai SK, Nair CN, Kurkure PA, Saikia TK, Gopal R, Pai VR, Nadkarni KS, Parikh PM. Survival of childhood acute lymphoblastic leukemia: results of therapy at Tata Memorial Hospital, Bombay, India. Leuk Lymphoma 1996;20:311-315. 2. Todo K, Morimoto A, Osone S, Nukina S, Ohtsuka T, Ishida H, Yoshihara T, Todo S. Isolated relapse of acute lymphoblastic leukemia in the breast of a young female. Pediatr Hematol Oncol 2008;25:607-613. 3. Farah RA, Timmons CF, Aquino VM. Relapsed childhood acute lymphoblastic leukemia presenting as an isolated breast mass. Clin Pediatr (Phila) 1999;38:545-546. 4. Sagar TG, Maitreyan V, Majhi U, Shanta V. Breast involvement in acute lymphoblastic leukaemia. J Assoc Physicians India 1989;37:718-719. 5. Chim CS, Shek TW, Liang R. Isolated relapse of acute lymphoblastic leukemia in the breast masquerading as gynecomastia. Am J Med 2000;108:677-679. 6. Basara I, Orguc SJ. Giant breast involvement in acute lymphoblastic leukemia: MRI findings. J Breast Cancer 2012;15:258-260. 7. Karbasian-Esfahani M, Wiernik PH, Yeddu M, Abebe L. Leukemic infiltration of the breast in acute lymphocytic leukemia (ALL). Hematology 2008;13:101-106.
DOI: 10.4274/tjh.2013.0195
Letter to the Editor
Bilateral Primary Adrenal Non-Hodgkin Lymphoma Bilateral Primer Adrenal Non-Hodgkin Lenfoma Vehbi Erçolak1, Oğuz Kara2, Meral Günaldı2, Çiğdem Usul Afşar2, Berna Bozkurt Duman3, Arbil Açıkalın4, Melek Ergin4, Şeyda Erdoğan4 1Harran
University Faculty of Medicine, Department of Medical Oncology, Şanlıurfa, Turkey
2Çukurova 3Adana
University Faculty of Medicine, Department of Medical Oncology Adana, Turkey
Training and Research Hospital, Department of Medical Oncology, Adana, Turkey
4Çukurova
University Faculty of Medicine, Department of Pathology, Adana, Turkey
To the Editor, Non-Hodgkin lymphoma (NHL) is found in the adrenal gland secondarily at a rate of 25% [1]. Primary adrenal lymphoma (PAL) is found in fewer than 1% of NHL cases [2]. Secondary adrenal gland involvement is usually unilateral, while PALs are usually bilateral [3,4]. Primary adrenal gland lymphomas are usually diffuse large B-cell lymphomas (DLBCL) [1,5]. Most cases are of B-cell origin [4]. A 62-year-old male admitted to our hospital with abdominal pain in the left lumbar region persisting for 4 months without B-symptoms. Abdominal and thorax computed tomography (CT) scanning was performed and revealed a mass of 93x60 mm on the left adrenal gland and a 58-mm mass on the right adrenal gland. The mass was nonfunctional according to hormone test results. The patient underwent left adrenalectomy. The pathology specimen revealed NHL, DLBCL, leukocyte common antigen (+), CD20 (+), CD3 (-) (Figures-1A,1B). In positron emission tomography (PET)CT, there was an advanced level of hypermetabolic mass with metastatic lymphadenopathy in the left mesenteric region and retrocrural regions (Figure-1C). There was no malignancy in PET-CT after performing 4 cycles of R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone) chemotherapy (Figure-1D). Chemotherapy was completed in 6 doses, and 5 months after chemotherapy, the patient had no signs of clinical, laboratory, or radiological progression. Written informed consent was optained from the patient.
PAL are rare, generally occurring among patients of advanced age (mean: 68 years) and dominantly in males (M/F: 2.2/1) [1,6]. Cases are majorly found bilaterally
Figure 1. Atypical lymphoid cells of middle-large diameter with oval-round, prominent vesiculated nuclei and diffusely invading adrenal tissue (A), lymphoid cells were diffusely CD20-positive and normal adrenocortical cells were found smashed in between them (B), before treatment (C), after 4 cycles of chemotherapy (D).
Address for Correspondence: Vehbi Erçolak, M.D., Harran University Faculty of Medicine, Department of Medical Oncology, Şanlıurfa, Turkey Phone: +90 322 338 60 60 E-mail: vehbiercolak@hotmail.com Received/Geliş tarihi : June 6, 2013 Accepted/Kabul tarihi : August 12, 2013
205
Turk J Hematol 2014;31:205-206
(approximately 70%) [1,7]. Bulky disease is more common [4,7]. Clinical symptoms of PAL include local symptoms, systemic symptoms compatible with adrenal insufficiency [4,5]. Adrenocortical insufficiency is observed in 50% of patients and there is no correlation with tumor size [1,2]. Adrenocortical insufficiency occurs when there is more than 90% destruction in the adrenal parenchyma [5]. Nonspecific clinical presentation and imaging results make it very hard to diagnose before surgery [5]. In CT and MRI, PAL is seen as a complex mass with variable density [1]. The diagnosis of PAL is confirmed only with pathological evaluation [5]. Prognosis is usually poor. Poor prognostic factors are advanced age, large tumor size, bilateral involvement, high LDH levels, involvement of other organs, and adrenal insufficiency at admission [1,3,5,7,8]. Nongerminal B-cell phenotype and Bcl-6 rearrangement is associated with poor prognosis, as represented in the literature [2]. Patients with 3 or more risk factors (international prognostic index (IPI) scores) are accepted poor prognoses [4]. Treatment includes surgery, combination chemotherapy and radiotherapy, but bilateral adrenalectomy with adjuvant radiotherapy is still controversial [7]. Commonly used chemotherapy regimens are CHOP [8]. Response rates are relatively low and permanent remission is rare. In a review of 83 patients, the 1-year survival rate was 17.5% [4]. Full or partial treatment response is seen in only 1/3 of cases [9]. Surgical resection when used alone is related to poor prognosis in tumors with aggressive histopathological subtypes. Radiotherapy is usually not a part of treatment in the beginning, but it could be used in low-grade lymphomas and incomplete surgical excision or after chemotherapy with positive functional tumors in radiographic imaging in residual disease [4]. In conclusion, this rare disease should be kept in mind in patients with adrenal masses even in the absence of other malignancies, without nodal or extranodal involvement, or in patients with adrenal insufficiency. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.
206
Erçolak V, et al: Adrenal Non-Hodgkin Lymphoma
Key Words: Non-Hodgkin lymphoma, Lymphoid cells neoplasms, B-Cell neoplasms Anahtar Sözcükler: Non-Hodgkin lenfoma, Lenfoid hücreler tümörler, B-Hücre tümörleri References 1. Wang J, Sun NC, Renslo R, Chuang CC, Tabbarah HJ, Barajas L, French SW. Clinically silent primary adrenal lymphoma: a case report and review of the literature. Am J Hematol 1998;58:130-136. 2. Mozos A, Ye H, Chuang WY, Chu JS, Huang WT, Chen HK, Hsu YH, Bacon CM, Du MQ, Campo E, Chuang SS. Most primary adrenal lymphomas are diffuse large B-cell lymphomas with non-germinal center B-cell phenotype, BCL6 gene rearrangement and poor prognosis. Mod Pathol 2009;22:1210-1217. 3. Hsu CW, Ho CL, Sheu WH, Harn HJ, Chao TY. Adrenal insufficiency caused by primary aggressive NHL lymphoma of bilateral adrenal glands: report of a case and literature review. Ann Hematol 1999;78:151-154. 4. Grigg AP, Connors JM. Primary adrenal lymphoma. Clin Lymphoma 2003;4:154-160. 5. Ezer A, Parlakgümüş A, Kocer NE, Çolakoğlu T, Nursal GN, Yıldırım S. Primary adrenal non-Hodgkin’s lymphoma: report of two cases. Turk J Gastroenterol 2011;22:643-647. 6. Kumar R, Xiu Y, Mavi A, El-Haddad G, Zhuang H, Alavi A. FDG-PET imaging in primary bilateral adrenal lymphoma: a case report and review of the literature. Clin Nucl Med 2005;30:222-230. 7. Aziz SA, Laway BA, Rangreze I, Lone MI, Ahmad SN. Primary adrenal lymphoma: differential involvement with varying adrenal function. Indian J Endocrinol Metab 2011;15:220223. 8. Kim KM, Yoon DH, Lee SG, Lim SN, Sug LJ, Huh J, Suh C. A case of primary adrenal diffuse large B-cell lymphoma achieving complete remission with rituximab-CHOP chemotherapy. J Korean Med Sci 2009;24:525-528. 9. Yang Y, Li Q, Pan Y. Bilateral primary adrenal lymphoma. Br J Haematol 2010;150:250.
DOI: 10.4274/tjh.2013.0200
Letter to the Editor
A Case of Cutaneous Diffuse Large B-cell Lymphoma Kutanöz Diffüz Büyük B-Hücreli Lenfoma Olgusu Bülent Çetin1, Ahmet Özet1, Bülent Orhan2, Tülay Tecimer3 1Gazi
University Faculty of Medicine, Department of Internal Medicine, Division of Medical Oncology, Ankara, Turkey University Faculty of Medicine, Department of Internal Medicine, Division of Medical Oncology, Bursa, Turkey 3Acıbadem University Faculty of Medicine, Department of Pathology, Bursa, Turkey 2Acıbadem
To the Editor, We report the clinical findings of a 55-year-old woman who presented with purple-reddish nodules on her face diagnosed as primary cutaneous diffuse large B-cell lymphoma (PCLBCL), which is very rarely seen in this area. A 55-year-old woman applied to our oncology department after a brief episode of fever, general weakness, and erythematous patches and plaques in the facial area (Figure 1). Other associated symptoms and signs were general malaise and weight loss of 5 kg in 1 month. She had previously been well. A diagnostic biopsy showed an infiltration of large lymphoid cells staining positively for CD20, BCL-6, BCL-2, and PAX5, suggesting a diagnosis of diffuse large B-cell lymphoma (Figure 2). The cells were negative for CD5 and CD10. Renal and liver functions were normal. Bone marrow aspiration and biopsy showed no evidence of lymphoma. There was no other systemic organ involvement. The patient began receiving systemic chemotherapy with rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone. After 3 cycles of treatment, the large tumor showed no gradual improvement; this was suggestive of a lack of response. Rituximab plus ifosfamide, carboplatin, and etoposide chemotherapy (R-ICE) were therefore initiated. The patient was treated with 3 cycles of R-ICE chemotherapy. The patient declined additional treatment because her condition remained progressive despite the treatment, and she died soon after. Infomed consent was obtained.
PCLBCL is a rare primary cutaneous lymphoma characterized by a diffuse proliferation of large B cells consisting of centroblasts and immunoblasts, occurring most commonly on the legs [1]. PCLBCL affects elderly population with a female predominance. This type of lymphomas tend to develop on the lower limbs, predominantly as large dermal nodules or tumors, which are either solitary or multifocal and rapidly enlarging [1]. PCLBCL can also rarely occur at other cutaneous sites [2]. The prognosis of PCLBCL is poor, with a 5-year survival of 41%-58%
Figure 1. Patient with nodules and lumps of PCLBCL observed on the face and neck.
Address for Correspondence: Bülent Çetİn, M.D., Gazi University Faculty of Medicine, Department of Internal Medicine, Division of Medical Oncology, Ankara, Turkey Phone: +90 312 202 58 34 E-mail: caretta06@hotmail.com Received/Geliş tarihi : June 10, 2013 Accepted/Kabul tarihi : September 4, 2013
207
Turk J Hematol 2014;31:207-208
Çetin B, et al: Cutaneous Aggressive Lymphoma
2. Willemze R, Jaffe ES, Burg G, Cerroni L, Berti E, Swerdlow SH, Ralfkiaer E, Chimenti S, Diaz-Perez JL, Duncan LM, Grange F, Harris NL, Kempf W, Kerl H, Kurrer M, Knobler R, Pimpinelli N, Sander C, Santucci M, Sterry W, Vermeer MH, Wechsler J, Whittaker S, Meijer CJ. WHOEORTC classification for cutaneous lymphomas. Blood 2005;105:3768-3785. Figure 2. A) Neoplasm formed of large lymphoid cells developed in a diffuse pattern (H&E, 400x). B) Nuclear immunoreactivity by PAX5 in neoplastic cells (400x). [1,2,3,4]. The pathogenesis of PCLBCL is unknown. This tumor is composed of large monomorphic B cells that infiltrate the dermis. Tumor cells are usually strongly Bcl-2 positive [5], and Bcl-6 is also expressed in most cases with evidence of Bcl-6 gene mutations [5]. CD10 expression is only rarely detected in PCLBCL [5]. MUM-1 and FOX-P1 are invariably expressed by tumor cells in PCLBCL in contrast to primary cutaneous follicle center lymphoma [6]. PCLBCL often involves the leg area, while the face is unusual for presentation [4,7]. PCLBCL usually presents with a red or bluish-red tumor over the legs [3]. Clinically, patients present with cutaneous nodules, tumor-like lesions, or deeply infiltrated plaques [7]. Anthracycline-containing chemotherapy with rituximab should be considered for initial therapy. The incorporation of rituximab improves the response rates and overall survival [4,7]. In conclusion, we report an unusual clinical picture of PCLBCL on the face and trunk, a lymphoma that is generally localized on the legs. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Key Words: Non-Hodgkin lymphoma, B Cell neoplasms, Pharmacotherapeutics Anahtar Söcükler: Non-Hodgkin lenfoma, B hücreli lenfoma, farmakoterapötikler References 1. Vermeer MH, Geelen FA, van Haselen CW, van Voorst Vader PC, Geerts ML, van Vloten WA, Willemze R. Primary cutaneous large B cell lymphomas of the legs. Arch Dermatol 1996;132:1304-1308.
208
3. Grange F, Bekkenk M, Wechsler J, Meijer CJ, Cerroni L, Bernengo M, Bosq J, Hedelin G, Fink Puches R, van Vloten WA, Joly P, Bagot M, Willemze R. Prognostic factors in primary cutaneous large B-cell lymphomas: a European multicenter study. J Clin Oncol 2001;19:3602-3610. 4. Grange F, Beylot-Barry M, Courville P, Maubec E, Bagot M, Vergier B, Souteyrand P, Machet L, Dalac S, Esteve E, Templier I, Delaporte E, Avril MF, Robert C, Dalle S, Laroche L, Grange F, Beylot-Barry M, Courville P, Maubec E, Bagot M, Vergier B, Souteyrand P, Machet L, Dalac S, Esteve E, Templier I, Delaporte E, Avril MF, Robert C, Dalle S, Laroche L, Delaunay M, Joly P, Wechsler J, Petrella T. Primary cutaneous diffuse large B-cell lymphoma, leg type. Arch Dermatol 2007;143:1144-1150. 5. Yang B, Tubbs R, Finn W, Carlson A, Pettay J, Hsi ED. Clinicopathologic reassessment of primary cutaneous B-cell lymphomas with immunophenotypic and molecular genetic characterization. Am J Surg Pathol 2000;24:694-702. 6. Kodama K, Massone C, Chott A, Metze D, Kerl H, Cerroni L. Primary cutaneous large B-cell lymphomas: clinicopathologic features, classification, and prognostic factors in a large series of patients. Blood 2005;106:24912497. 7. Senff NJ, Noordijk EM, Kim YH, Bagot M, Berti E, Cerroni L, Dummer R, Duvic M, Hoppe RT, Pimpinelli N, Rosen ST, Vermeer MH, Whittaker S, Willemze R; European Organization for Research and Treatment of Cancer; International Society for Cutaneous Lymphoma. European Organisation for Research and Treatment of Cancer and International Society for Cutaneous Lymphoma consensus recommendations for the management of cutaneous B-cell lymphomas. Blood 2008;112:1600-1609.
Images in Hematology
DOI: 10.4274/tjh.2013.0210
1. Quiz in Hematology A 3-year-old boy presented with recurrent infections. Physical examination revealed hepatosplenomegaly, bilateral cervical lymphadenopathy, silvery gray hair, and bilateral nystagmus. Giant granules in lymphocytes, monocytes, and granulocytes were seen on blood smear (Figure A). Bone marrow aspirate exhibited erythrophagocytosis and numerous giant granules of predominantly myeloid lineage (Figure B). Examination of the hair showed an irregular distribution of large and small pigment clumps (Figure C).
Figure A) Blood smear exhibiting giant granules in granulocytes and lymphocytes. Figure B) Bone marrow aspirate smears showing giant lysosomal granules within myeloid precursors (red arrows) and hemophagocytosis (black arrow). Figure C) 1) Normal dark hair, 2) normal blonde hair, 3) patientâ&#x20AC;&#x2122;s hair.
209
Turk J Hematol 2014;31:209-210
Quiz in Hematology
Lysosomal Vesicles, Giant Granules, and Erythrophagocytosis in Chédiak-Higashi Syndrome Chediak-Higashi Sendromunda Lizozomal Veziküller, Dev Granüller ve Eritrofagositoz Chédiak-Higashi syndrome (CHS) is a rare autosomal recessive disorder characterized by partial oculocutaneous albinism, recurrent infections, and mild bleeding tendency [1]. Mutations in the lysosomal trafficking regulator gene (LYST) localized to chromosome 1q42-q44 are responsible for the disease [2]. Lysosomes of hematopoietic cells, particularly granulocytes and monocytes, are enlarged to form vesicles [3]. Giant inclusions in hematopoietic cells are the most reliable diagnostic clinical criterion for CHS. The main differential diagnosis is Griscelli syndrome, a rare autosomal recessive disorder caused by mutations in the MYO5A or RAB27A genes. This syndrome also manifests with partial albinism and immunodeficiency and it progresses towards the accelerated phase as in CHS, but it differs from CHS in view of the absence of giant intracytoplasmic granules in the leukocytes or by genetic analysis [4,5]. Approximately 85% of CHS patients develop a lymphoproliferative infiltration called “accelerated phase” compatible with hemophagocytic lymphohistiocytosis [1]. Key Words: Chediak-Higashi syndrome, Giant granules, Erytrophagocytosis Anahtar Sözcükler: Chediak-Higashi sendromu, Dev granüller, Eritrofagositoz Burçin Beken, Şule Ünal, Fatma Gümrük Hacettepe University Faculty of Medicine, Department of Pediatrics, Ankara, Turkey Phone: +90 90312 215 01 89 E-mail: burcinbeken@gmail.com Received/Geliş tarihi
: June 18, 2013
Accepted/Kabul tarihi
: June 20, 2013
References 1. Introne WJ, Westbroek W, Golas GA, Adams D. ChediakHigashi syndrome. In: Pagon RA, Bird TD, Dolan CR, Stephens K, Adam MP, editors. GeneReviews™ [Internet]. Seattle, University of Washington, 1993-2014.
4. Mancini AJ, Chan LS, Paller AS. Partial albinism with immunodeficiency: Griscelli syndrome: report of a case and review of the literature. J Am Acad Dermatol 1998;38:295300.
2. Barbosa MD, Barrat FJ, Tchernev VT, Nguyen QA, Mishra VS, Colman SD, Pastural E, Dufourcq-Lagelouse R, Fischer A, Holcombe RF, Wallace MR, Brandt SJ, de Saint Basile G, Kingsmore SF. Identification of mutations in two major mRNA isoforms of the Chediak-Higashi syndrome gene in human and mouse. Hum Mol Genet 1997;6:1091-1098.
5. Ménasché G, Pastural E, Feldmann J, Certain S, Ersoy F, Dupuis S, Wulffraat N, Bianchi D, Fischer A, Le Deist F, de Saint Basile G. Mutations in RAB27A cause Griscelli syndrome associated with hemophagocytic syndrome. Nat Genet 2000;25:173-176.
3. Introne W, Boissy RE, Gahl WA. Clinical, molecular, and cell biological aspects of Chediak-Higashi syndrome. Mol Genet Metab 1999;68:283-303.
210
DOI: 10.4274/tjh.2013.0155
2. Morphology in Hematology Bone Marrow Involvement of Rhabdomyosarcoma from Unknown Origin Orjini Bilinmeyen Rabdomyosarkomda Kemik Ä°liÄ&#x;i Tutulumu
Figure 1. Bone marrow aspiration specimen from the patient with RMS.
A 16-year-old girl was admitted to the hospital suffering from severe back pain, night sweats, and weight loss for 3 weeks. On physical examination, she had multiple lymphadenopathies in the cervical, axillary, and inguinal regions. There was no organomegaly. Laboratory examination revealed the following: Hb, 10.7 g/dL; Hct, 27%; leukocytes, 15.5x109/L; neutrophils, 12.2x109/L; platelets, 337x109/L. Peripheral blood smear revealed no blasts or atypical cells. The erythrocyte sedimentation rate was 102 mm/h. All biochemical test results were within normal ranges, except
for elevated lactate dehydrogenase enzyme and C-reactive protein. The bone marrow aspirate smear showed immature cells with vacuole and blue cytoplasm; these immature cells were considered as metastasis of a solid tumor (Figure 1). Excisional biopsy of the axillary lymphadenopathy was performed and the histopathological diagnosis was the alveolar type of rhabdomyosarcoma (RMS). Work-up of the primary site of the disease was performed with whole body imaging. Cranial, neck, abdominal, and pelvic MRI results were in normal range. Thorax CT showed metastatic nodules in the 211
Turk J Hematol 2014;31:211-212
Morphology in Hematology
both lung; furthermore, multiple solid masses were detected in both breasts (Figure 2). The metastatic disease encompassed the bone marrow, thorax, and lymph nodes. Distant metastasis was present at diagnosis in this case but we could not find the primary site of the disease. We think that the bilateral breast masses may be the primary sites.
Figure 2. Lung and breast metastasis.
Key Words: Hematologic manifestations of systemic diseases, Lymphoid cells neoplasms, Bone marrow failure Anahtar Sözcükler: Sistemik hastalıkların hematolojik belirtileri, Lenfoid hücreler tümörleri, Kemik iliği yetmezliği Begüm Şirin Koç, Serap Karaman, Ayşegül Ünüvar, Ezgi Uysalol, Zeynep Karakaş, Ömer Devecioğlu, Sema Anak İstanbul University İstanbul Faculty of Medicine, Department of Pediatric Hematology&Oncology, İstanbul, Turkey Tel: +90 505 906 27 91 E-mail: begumsirins@hotmail.com Received/Geliş tarihi
: May 02, 2013
Accepted/Kabul tarihi
: May 13, 2013
212
Images in Hematology
DOI: 10.4274/Tjh.2013.0019
3. Clinical Picture in Hematology Aleukemic Leukemia Cutis: An Unusual Rash in a Child Çocukta Nadir Döküntü Nedeni Olarak Alösemik Leukemia Cutis
Figure 1.Erythematous macules on the abdomen.
213
Turk J Hematol 2014;31:213-215
Figure 2. Tumor with no signs of inflammation on brow area.
Clinical Picture in Hematology
Figure 3. Regression of the soft tissue tumor.
A previously healthy 2-year-old girl presented with a rash of erythematous macules on the abdomen (Figure 1). In 2 weeks the rash spread to her back and brows and became violaceous. She had a firm, non-fluctuant, non-tender, and smooth-surfaced tumor with no signs of inflammation on her brow area (Figure 2). She had no signs or symptoms except for a mild fever for 10 days. A complete blood count and peripheral blood smear did not show significant findings. Lactate dehydrogenase was elevated to 873 U/L. The skin lesions were treated with a combination of antihistamines and topical steroids without response. A skin biopsy performed 4 weeks after the onset of rash showed leukemic blast cells (B-cell lymphoblastic lymphoma/leukemia). A bone marrow aspirate confirmed precursor B-cell acute lymphoblastic leukemia with 30% blast cells. Upon immunohistochemical analysis, the neoplastic cells were positive for CD10, CD19, CD22, HLA-DR, and terminal deoxynucleotidyl transferase (TdT). Cytogenetic studies showed normal 46XX karyotype and ALL chromosomal translocations were negative. Magnetic resonance examination of the cranium revealed enlargement of the frontal soft tissue in the brow area, without evidence of bone involvement. Induction therapy was started immediately using protocol ALL IC BFM 2009. On the 10th day of induction chemotherapy, the soft tissue and skin lesions had almost completely regressed (Figure 3). Leukemia cutis is an infiltration of the skin by neoplastic leukocytes. Although leukemia cutis tends to present with other features of leukemia, it can occasionally precede the development of blast cells in the marrow and blood (aleukemic leukemia cutis) [1]. In childhood, it is seen more commonly in congenital leukemia and acute myelogenous leukemia (10%) than in pediatric acute lymphoblastic leukemia (1%). It is generally treated with ALL-type regimens, which are associated with a favorable outcome in more than 70% of cases when started early [2,3,4]. In conclusion, it is important to know that the disease must be treated as a diagnostic and therapeutic emergency.
214
Clinical Picture in Hematology
English Keywords: Leukemia cutis, Aleukemic leukemia, Persistent Anahtar Sözcükler: Lösemi kutis, Aleukemic lösemi, Persistan Didem Atay, Emine Türkkan, Kübra Bölük Okmeydanı Education and Research Hospital, Department of Pediatric Hematology and Oncology, İstanbul, Turkey Didem Atay Tel: +90 505 373 74 47 E-mail: didematay@hotmail.com Received/Geliş tarihi : January 18, 2013 Accepted/Kabul tarihi : April 8, 2013 References
Turk J Hematol 2014;31:213-215
2. Kahwash SB, Qualman SJ. Cutaneous lymphoblastic lymphoma in children: report of six cases with precursor B-cell lineage. Pediatr Dev Pathol 2002;5:45-53. 3. Boccara O, Laloum-Grynberg E, Jeudy G, Aubriot-Lorton MH, Vabres P, de Prost Y, Pacquement H, Brousse N, Fraitag S, Bodemer C. Cutaneous B-cell lymphoblastic lymphoma in children: a rare diagnosis. J Am Acad Dermatol 2012;66:5157. 4. Millot F, Robert A, Bertrand Y, Mechinaud F, Laureys G, Ferster A, Brock P, Rohrlich P, Mazingue F, Plantaz D, Plouvier E, Pacquement H, Behar C, Rialland X, Chantraine JM, Guilhot F, Otten J. Cutaneous involvement in children with acute lymphoblastic leukemia or lymphoblastic lymphoma. The Children’s Leukemia Cooperative Group of the European Organization of Research and Treatment of Cancer (EORTC). Pediatrics 1997;100:60-64.
1. Cho-Vega JH, Medeiros LJ, Prieto VG, Vega F. Leukemia cutis. Am J Clin Pathol 2008;129:130-142.
215