Download ebooks file Sawflies out of gondwana: phylogenetics and biogeography of argidae (hymenopter

Full download ebook at ebookmass.com

Sawflies out of Gondwana: phylogenetics and biogeography of Argidae (Hymenoptera) 1st Edition Leonardo A. Malagón-Aldana https://ebookmass.com/product/sawflies-out-of-gondwanaphylogenetics-and-biogeography-of-argidae-hymenoptera-1stedition-leonardo-a-malagon-aldana/

OR CLICK BUTTON DOWLOAD EBOOK

Download more ebook from https://ebookmass.com

More products digital (pdf, epub, mobi) instant download maybe you interests ...

Biogeography: An Integrative Approach of the Evolution of Living Eric Guilbert

https://ebookmass.com/product/biogeography-an-integrativeapproach-of-the-evolution-of-living-eric-guilbert/

Myxomycetes: biology, systematics, biogeography, and ecology Elsevier.

https://ebookmass.com/product/myxomycetes-biology-systematicsbiogeography-and-ecology-elsevier/

Trapped: Brides of the Kindred Book 29 Faith Anderson

https://ebookmass.com/product/trapped-brides-of-the-kindredbook-29-faith-anderson/

Out of Character (True Colors 2) 1st Edition Annabeth Albert

https://ebookmass.com/product/out-of-character-true-colors-2-1stedition-annabeth-albert/

Out of Smoke and Ashes Bree Wolf

https://ebookmass.com/product/out-of-smoke-and-ashes-bree-wolf/

Biogeography: An Ecological and Evolutionary Approach 9th Edition, (Ebook PDF)

https://ebookmass.com/product/biogeography-an-ecological-andevolutionary-approach-9th-edition-ebook-pdf/

Out of the Darkness Mckee

https://ebookmass.com/product/out-of-the-darkness-mckee/

Cognitive Psychology In and Out of the Laboratory

https://ebookmass.com/product/cognitive-psychology-in-and-out-ofthe-laboratory/

Out Of Her Depth Lizzy Barber

https://ebookmass.com/product/out-of-her-depth-lizzy-barber/

Systematic Entomology (2021), DOI: 10.1111/syen.12527

Sawflies out of Gondwana: phylogenetics and biogeography of Argidae (Hymenoptera) L E O N A R D O A . M A L A G Ó N- A L D A N A 1,2 , A R N R . J E N S E N 2,3 , D A V I D R . S M I T H 4 , A K I H I K O S H I N O H A R A 5 and L A R S V I L H E L M S E N2 1 Museo entomológico UNAB, Grupo Sistemática de Insectos Agronomía SIA, Facultad de Ciencias Agrarias, Universidad Nacional de Colombia, Bogotá, Colombia, 2 Natural History Museum of Denmark, Science, University of Copenhagen, Copenhagen, Denmark, 3 Department of Biology and Biotechnologies ‘Charles Darwin’, Sapienza University of Rome, Rome, Italy, 4 Systematic Entomology Laboratory, Agricultural Research Service, U. S. Department of Agriculture, c/o National Museum of Natural History, Smithsonian Institution, Washington, District of Columbia, U.S.A. and 5 Department of Zoology, National Museum of Nature and Science, Tsukuba, Japan

Abstract. We present the first phylogenetic hypothesis for the cosmopolitan family Argidae based on both molecular and morphological data. Furthermore, we present a biogeographic scenario based on a dated phylogeny and interpret the evolutionary history of the family. Information from sequences of eight genes is analysed to reconstruct the phylogeny of the Argidae based on maximum likelihood and Bayesian inference. Total evidence Bayesian analyses are also conducted, combining the molecular dataset with data from adult and larval morphology. For the historical biogeographic reconstruction, divergence times are estimated using node dating with uncorrelated relaxed-clock analysis, and ancestral biogeographical distributions are estimated applying a Dispersal Extinction Cladogenesis model and a Bayesian binary model. Argidae s.s. is retrieved as monophyletic in all analyses and the clade Zenargidae + (Argidae + Pergidae) is better supported when combining molecular and morphological characters, and when excluding the saturated third codon position in the molecular analysis.

Within Argidae, two large clades corresponding to the subfamilies Arginae and Sterictiphorinae sensu Benson are retrieved as monophyletic. The ancestral distribution of Arginae and Sterictiphorinae is estimated to be the Australian and Neotropical regions.

Divergence of Argidae-Pergidae and Arginae-Sterictiphorinae is estimated to occur in the middle-upper Jurassic before or during the east-west Gondwana breakup. Diversification of Argidae may be associated with the radiation of angiosperms in the Early Cretaceous, especially for the Neotropical Sterictiphorinae after the separation of South America and Africa. Arginae were probably introduced to the northern hemisphere by dispersal to Africa and/or India and subsequent continental collision with Eurasia in the Cenozoic. The occurrence of Sterictiphorinae in the northern hemisphere is more difficult to explain. Maternal care and brood guarding behaviour evolved independently in Argidae and Pergidae, with a single origin in a subclade (Dielocerini) of Sterictiphorinae.

Correspondence: Leonardo A. Malagon-Aldana, Museo entomológico UNAB, Grupo Sistemática de Insectos Agronomía SIA, Facultad de Ciencias Agrarias, Universidad Nacional de Colombia, Cra. 30 #45-03, Bogotá, D.C., Colombia. E-mail: landresmalagon@gmail.com

© 2021 The Royal Entomological Society

1

2 L. A. Malagon-Aldana et al.

Introduction Argidae is the second largest family in the Tenthredinoidea or true sawflies. The Tenthredinoidea in turn is the largest clade among the primarily herbivorous ‘Symphyta’, which are paraphyletic in relation to the predominantly carnivorous Apocrita (Vilhelmsen & Turrisi, 2011). Argidae are distributed worldwide, being absent only from Antarctica, Madagascar, Greenland and New Zealand. Unlike most other families of true sawflies, they have a strong representation in the southern hemisphere, especially in the Neotropics. The closely related Pergidae is almost exclusively Gondwanan in distribution, occurring mostly in Australia and South America, with only the genus Acordulecera extending into North America. Argidae + Pergidae have been placed as sister groups in virtually all comprehensive phylogenetic treatments of ‘Symphyta’ (Vilhelmsen, 1997, 2001; Schulmeister et al., 2002; Schulmeister, 2003a; Schulmeister, 2003b; Ronquist et al., 2012a; Malm & Nyman, 2015).

The split between Pergidae and Argidae has been estimated to have occurred at approx. 133 Ma (116–158 Ma), around the time of the Gondwana break up (Schmidt & Walter, 2014; Nyman et al., 2019). Until recently, no comprehensive phylogenetic hypothesis was available for Argidae and no biogeographical scenario in a cladistic framework has been proposed.

Malagón-Aldana et al. (2021a, 2021b) analysed comprehensive data sets of Argidae based on adult (all 56 extant genera represented) and larval morphology (21 genera included). Their main finding was that the monotypic Australian genus Zenarge (Fig. 1K) that was previously placed in Argidae did not group with the remainder of the family (Argidae s.s.), but instead was placed as either sister to Pergidae, or most frequently sister to (Argidae s.s. + Pergidae); regardless of its position, Zenarge was always in a monophylum with Argidae s.s. and Pergidae (the ZAP clade). Consequently, Malagón-Aldana et al. (2021a) placed Zenarge in a separate family, the Zenargidae. This contrasts with the results of the few previous molecular analyses of ‘Symphyta’ that included Zenarge in their taxon sample (Malm & Nyman, 2015), where the genus was retrieved as sister to Argidae s.s.; comparatively few exemplars of Argidae were included in these analyses. Malagón-Aldana et al. (2021a, 2021b) retrieved two major clades within Argidae s.s., corresponding to the subfamilies Arginae (Fig. 1A–J) and Sterictiphorinae (Fig. 2) as defined by Benson (1963) (Table 1). Other classification schemes for Argidae recognizing more subfamilies and tribes have been proposed (e.g., Smith, 1992; Taeger et al., 2010). Malagón-Aldana et al. (2021a) were unable to corroborate these, although some previously suggested tribes (e.g., Trichorhachini, Atomacerini, Dielocerini and Sterictiphorini) were retrieved as monophyletic. Revising the tribal classification of Argidae s.s. will require a denser taxon sampling than was obtained in Malagón-Aldana et al. (2021a).

The fossil record of Argidae includes only seven representatives (Nel, 2004), all of them relatively young and from the northern hemisphere: the compression fossil Sterictiphora konowi (Rohwer) from the Florissant formation of Colorado (37.2–33.9 Ma, upper Eocene – lower Oligocene); the Dominican amber fossils Didymia dominicana Smith, D. davisi Smith,

D. protera Smith, D. poinari Smith and D. ebena Smith (20.4–13.6 Ma, lower Miocene), and the compression fossil Mioarge azari Nel, from volcano-sedimentary maar of Mont-Charay in France (7.2–5.3 Ma, uppermost Miocene) (Rohwer et al., 1908; Smith & Poinar, 1992; Nel, 2004; Paleobiology database, fossilworks.org).

Some Neotropical genera of Argidae s.s. (Themos, Dielocerus, Pachylota, Digelasinus and Sericoceros) present a characteristic subsocial behaviour, where the females guard the eggs at least until they hatch, defending them from predators. The larvae stay together, feeding gregariously and make a mass cocoon when they pupate. However, this general behaviour includes variation within several traits among these genera (defence mechanisms of the female, host plant species, egg location and distribution on leaves, total period of guarding, mass cocoon structures, etc.)

(Benson, 1938; de Souza Dias, 1975; de Souza Dias, 1976; Smith, 1992; Ciesla, 2002; Smith & Janzen, 2003; Boraschi et al., 2005). A similar maternal guarding behaviour is also present in some Pergidae (Perga, Pseudoperga, Philomastix, Cladomacra and Syzygonia) (Benson, 1938; Shinohara, 1986; Schiff, 2004; Schmidt et al., 2006). Larvae of Argidae s.s. Feed on a diverse variety of angiosperms. Although the larvae of most argids remain unknown, they also present various degrees of gregariousness, chemical defence, feeding behaviour and morphological adaptations to their host plants (Smith, 1992; Schmidt et al., 2000; Boevé et al., 2018). Contrary to the known Pergidae and Argidae s.s., the larvae of Zenarge feed on gymnosperms, including the native Australian Callitris spp.

(Cupressaceae) (Moore, 1963a, 1963b).

Here we aim to reconstruct a phylogenetic hypothesis for the Argidae, based on molecular characters including mitochondrial, ribosomal and nuclear gene fragments, for the highest number of argid terminals sequenced so far. We also analyse the combined morphological (adults and larvae) and molecular data sets in a total evidence approach to further explore the phylogeny of Argidae, including node dating calibration of the phylogeny using available fossil information for the family and outgroup (other Tenthredinoidea families). Finally, we attempt to elucidate the biogeographical and ecological patterns (e.g., brood guarding behaviour) for Argidae.

Methods Specimens examined Adult and larval specimens of 45 species and 18 different genera of Argidae and five outgroup taxa of Tenthredinoidea (Pergidae, Tenthredinidae) were successfully extracted for DNA (Table S1). The majority of the specimens were preserved in 96% ethanol, while some of them were dry-pinned specimens. Exemplars were obtained from the following collections: Instituto de Investigaciones Biológicas Alexander von Humboldt, Colombia (IAvH); Colección de Zoología, Instituto de Ciencias Naturales ICN, Universidad Nacional de Colombia; Bogotá, D.C. (ICN-MHN); Museo Javeriano de Historia Natural, Colombia (MPUJ); Statens Naturhistoriske

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

Evolution of Argidae

A

B

3

C

D

E

F

G

H

I

J

K

Fig. 1. (A–C) Head, frontal view of males, subfamily Arginae. (A) Cibdela janthina. (B) Pampsilota dahomeyanus. (C) Spinarge fulvicornis.

(D–K) Lateral habitus of females. (D–J) Subfamily Arginae. (D) Antargidium dentivalve. (E) Scobina lepida. (F) Pampsilota afer. (G) Triarge nigra.

(H) Athermantus imperialis. (I) Tanyphatnidea microcephala. (J) Spinarge fulvicornis. (K) Family Zenargidae, Zenarge turneri.

Museum, University of Copenhagen, Denmark (NHMD); National Museum of Natural History, Smithsonian Institution, Washington D.C., U.S.A. (NMNH); National Museum of Nature and Science, Tsukuba, Japan (NMNS); Senckenberg Deutsches Entomologisches Institut, Müncheberg, Germany (SDEI); Museo entomológico UNAB Facultad de Ciencias Agrarias Bogota, Universidad Nacional de Colombia (UNAB).

DNA extraction, amplification and sequencing One hindleg (or piece of larval tissue) was removed from each specimen (Table S1), breaking it at the coxa and trying to include parts of the basal extrinsic muscles of the appendage. The dissection forceps were cleaned with bleach (10%) and ethanol (70%) prior to working with a new specimen. The samples were

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

4 L. A. Malagon-Aldana et al.

A

B

C

D

E

F

G

H

I

J

K

Fig. 2. Head, frontal view of males, subfamily Sterictiphorinae. (A) Trichorhachus nitidus. (B) Aproceros leucopoda. (C) Atomacera coerulescens.

Habitus of females of Argidae, subfamily Sterictiphorinae. (D) Trichorhachus nitidus. (E) Atomacera coerulescens. (F) Sterictiphora furcata. (G) Ptenos leucopodus. (H) Duckeana prodiga. (I) Pachylota audouinii. (J) Schizocerella pilicornis. (K) Didymia martini.

transferred to separate vials and then stored in 96% ethanol.

DNA extraction and amplification were carried out in the Geogenetics lab of the Globe Institute, University of Copenhagen, Denmark. Total DNA was extracted using the DNeasy® Blood and Tissue kits using spin columns manufactured by Qiagen (QIAGEN Aarhus, Denmark) with a slight modification

entailing soaking the samples overnight for around 12 h at 56∘ C with gentle agitation. To remove surface contamination from old dry-pinned specimens, the legs were removed and initially put in a tissue lysis buffer (ATL buffer + proteinase K) for 1 h at 56∘ C with gentle agitation. The lysis buffer was then discarded, and fresh lysis buffer was added. The samples where then incubated

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

Evolution of Argidae Table 1. List of taxa examined specimens of Argidae and Zenargidae taxa.

Examined species (or morphospecies) Family

Genus

Species

Molecular

Morphology

Argidae (Arginae)

†Mioarge Nel, 2005 Antargidium Morice, 1919 Arge Schrank, 1802 Asiarge Gussakovskij, 1935 Athermantus Kirby, 1882 Cibdela Konow, 1899 Kokujewia Konow, 1902 Pseudarge Gussakovskij, 1935 Pseudosinarge Saini, Thind & Kaur, 1998 Scobina Lepeletier & Serville, 1828 Sinarge Forsius, 1934 Sjoestedtia Konow, 1907 Spinarge Wei, 1998 Styphelarge Benson, 1938 Tanyphatnidea Rohwer, 1912 Triarge Forsius, 1931 Zhuhongfuna Wei & Nie, 1999 Acrogymnia Malaise, 1941 Acrogymnidia Malaise, 1955 Adurgoa Malaise, 1937 Aproceros Malaise, 1931 Aprosthema Konow, 1899 Atomacera Say, 1836 Brachyphatnus Konow, 1906 Brevisceniana Wei, 2005 Dacrogymnia Smith & Malagón-Aldana, 2020 Didymia Lepeletier & Serville, 1828 Dielocerus Curtis, 1844 Digelasinus Malaise, 1937 Duckeana Malaise, 1941 Durgoa Malaise, 1937 Eriglenum Konow, 1900 Mallerina Malaise, 1941 Manaos Rohwer, 1912 Neoptilia Ashmead, 1898 Neurogymnia Malaise, 1937 Ortasiceros Wei, 1997 Pachylota Westwood, 1841 Pampsilota Konow, 1899 Pseudaprosthema Gussakovskij, 1935 Ptenos Norton, 1872 Ptilia Lepeletier, 1823 Schizocerella Forsius, 1927 Sericoceros Konow, 1905 Sphacophilus Provancher, 1888 Sterectiphora Billberg, 1820 Subsymmia Malaise, 1955 Tanymeles Konow, 1906 Themos Norton, 1867 Topotrita Kirby, 1882 Trailia Cameron, 1878 Trichorhachus Kirby, 1882 Triptenus Malaise, 1937 Trochophora Konow, 1905 Yasumatsua Togashi, 1970 Zynzus Smith, 1992 Sterictiphorinae males, unknown genus Genus sp.

Zenarge Rohwer, 1918

1 6 395 3 2 14 3 6 1 56 1 2 13 1 2 9 1 11 4 4 10 58 35 3 1 5 26 6 2 4 4 4 1 12 10 7 6 2 12 3 32 7 5 21 52 45 2 23 13 3 2 4 2 2 3 19 1

0 3 a 23 0 a1 1 1 0 0 a5 0 0 a5 0 0 a1 0 0 0 0 a1 a4 a3 0 0 a1 a1 a1 0 0 0 0 0 a1 0 0 0 0 a1 0 a3 a2 2 1 a1 a4 0 a1 1 0 0 0 0 1 0 0 1 0 1

1 2 10 1 1 1 1 1 1 2 1 1 1 1 1 2 1 2 1 1 1 1 2 1 1 1 3 1 1 1 2 1 1 1 1 2 1 1 4 3 5 2 1 2 3 2 1 2 2 1 1 2 1 1 1 1 0 1 1

Argidae (Sterictiphorinae)

Zenargidae

a Genera with at least one molecular sequence produced in this study.

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

5

6 L. A. Malagon-Aldana et al.

Table 2. Primers and annealing temperature used for gene fragment amplification.

Gene

Primer Name

Primer sequence (5′ –3′ )

References

Annealing T∘ C

16S

A Hym (F) B Hym (R) D2F (F) D2Ra (R) 743 nF-ino (F) CAD hym 2F (Fi) 1028R-ino (R) COI fly-C1-J-1514 (F) sym-C1-J-1718 (Fi) A2590 (R) GLN 1F (F) GLN hym 2F (Fi) GLN 4R (R) PGD hym 3F (F) PGD hym intRb (R)

TRACTGTRCAAAGGTAGC TTAATTCAACATCGAGGTC CGGGTTGCTTGAGAGTGCAGC CTCCTTGGTCCGTGTTTC GGIGTIACIACIGCITGYTTYGARCC GGNAGYTCNATGAARAGYGTNGG TTRTTIGGIARYTGICCICCCAT CAAATCATAAAGATATTGG GGAGGATTTGGAAAYTGAYTAGTWCC GCTCCTATTGATARWACATARTGRAAATG GTNTAYTTYTGGCARGG GCNGGVAAYATGGGHTGGYTNAC CYCCANCCRTGRAARCAYTT TGGTRCACAAYGGMATHGARTAYGG ATRATRCANCCDCCYCKCCACAT

Schulmeister (2003b) Schulmeister (2003b) Schmidt & Walter (2014) Schmidt & Walter (2014) Johanson & Malm (2010) Malm & Nyman (2015) Johanson & Malm (2010) Farrell (2001); Malm & Nyman (2015) Nyman et al. (2006) Normark et al. (1999) Regier et al. (2008) Regier et al. (2008) Malm & Nyman (2015) Malm & Nyman (2015) Malm & Nyman (2015)

47–50 47–50 47 47 55–60 55–60 55–60 56 52 52–56 51 56 51–56 60 60

28S CAD

COI

GLN

PGD

Forward (F = external, Fi = internal) and Reverse (R) sequences.

overnight or over 2 days for around 12–48 h at 56∘ C with gentle agitation. DNA extracts were stored in a freezer at −20∘ C. DNA concentration of each sample was measured with a Qubit™ 4 Fluorometer and a Qubit dsDNA High Sensitivity Assay Kit. The following six gene regions were amplified: Mitochondrial ribosomal 16S, nuclear ribosomal 28S (Schulmeister, 2003b; Schmidt & Walter, 2014), mitochondrial cytochrome oxidase I (COI) and the nuclear protein-coding genes carbamoyl-phosphate synthetase (CAD), gelsolin (GLN) and phosphogluconate dehydrogenase (PGD) (Malm & Nyman, 2015). PCR was performed using 5× HOT FIREPol® Blend Master Mix (10 mM MgCl2 ) manufactured by Solis BioDyne (Tartu, Estonia), with a final volume of 25 μL, composed of: 17 μL of the HOT FIREPol® Blend Master Mix, 4 μL of molecular biology grade H2 O, 1 μL of Dimethyl sulfoxide DMSO, 0.5 μL of forward and reverse primer each and 1 μL of the sample DNA extract. PCR profiles and primer sequences for COI, CAD, PGD and GLN followed Malm & Nyman (2015) except that the number of cycles was increased to 50 and the annealing temperature for each gene was modified (Table 2).

In the case of two forward primers (external and internal) we used primarily the external (Table 2), while the internal primer was used only when the external did not work for the specific sample. For 16S and 28S we used the primers from Schmidt & Walter (2014) but modifying the PCR profile as follows: denaturation at 94∘ C for 1 min, followed by 40 (16S) or 30 (28S) cycles of denaturation at 94∘ C for 40 s, annealing for 40 s, and extension at 72∘ C for 1 min; the last cycle was followed by a final extension step at 72∘ C for 1 min. The PCR products were visualized under a UV chamber after separating the fragments with gel electrophoresis using 2% agarose with GelRed® (Merck Millipore, Darmstadt, Germany) and a 100 bp ladder. PCR products that showed sharp visualized bands were sent for purification and Sanger sequencing at Macrogen Europe (Amsterdam, Netherlands).

Additional sequences GenBank databases https://www.ncbi.nlm.nih.gov/genbank/ (Benson et al., 2017) and Barcode of Life Data System http://www.boldsystems.org/index.php/ (Ratnasingham & Hebert, 2007) were employed to obtain 216 additional sequences, including 83 Argidae (32 species, 17 genera) and 133 of outgroup taxa (33 species, 23 genera) (Table S1) for the six different markers we sequenced ourselves, as well as sequences of the genes TPI (triose-phosphate isomerase) and IDH (isocitrate dehydrogenase), which were suggested to be phylogenetically relevant by Malm & Nyman (2015) (Table S1).

The 83 downloaded Argidae sequences were distributed across genes as follows: COI (29), GLN (8), TPI (8), CAD (9), PGD (9), IDH (6), 16S (7) and 28S (7). These sequences were produced by Schulmeister et al. (2002), Schulmeister (2003b), Linnen & Farrell (2008), Heraty et al. (2011), Leppänen et al. (2012), Boevé et al. (2013), Klopfstein et al. (2013), Isaka & Sato (2014), Liston et al. (2014), Schmidt & Walter (2014), Malm & Nyman (2015), Schmidt et al. (2017), Shinohara et al. (2016), Endara et al. (2018), Smith et al. (2019) and Prous et al. (2019). The total number of Argidae species or morphospecies (i.e., produced in this work and obtained from databases) included in the molecular analyses were 70 in 25 genera, for a total of 72 terminals (Table S1, Fig. 3). For those outgroup terminals with several species represented in the sequence sample (chimeras), the combined terminal taxon was given as the genus name, e.g., Athalia spp.* consists of sequences from Athalia circularis (COI, GLN, IDH, and TPI) and A. scutellariae (28S, CAD and PGD).

Alignment and assembling of sequences The sequences produced were first submitted to the Basic Local Alignment Search Tool (BLAST®) on the GenBank

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

Evolution of Argidae

7

Fig. 3. Bayesian tree reconstruction of Argidae s.s. Based on the combined molecular information of first and second codon positions of protein codon genes using Maximum likelihood (ML) and Bayesian inference (BI) analyses. Capital letters followed by an asterisk show the five calibration points used in the combined morphological and molecular dataset based on the fossil species to the left. Asterisk after the name of a terminal (e.g., Athalia spp.) indicates that this taxon is a chimera, i.e., the molecular information from various markers was obtained from different species of the same genus.

PP = posterior probability, BR = Bootstrap resampling support.

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

8 L. A. Malagon-Aldana et al. website to cross-check the identifications and detect potential contaminations (family or genus level). Chromatograms of sequences were visualized using finchtv 1.5.0 where low-quality ends were trimmed. Forward and reverse trimmed sequence chromatograms of the same sample were aligned, edited and assembled using codoncode aligner software 9.0.1 (CodonCode Corporation). Low-quality sequences (forward, reverse, or both) were excluded and amplified again.

The assembled sequences of each gene per species were submitted to GenBank ® (Table S1). Sequences from the samples and the additional downloaded sequences (Table S1) were put together and first aligned for each gene in mega X for macOS (Stecher et al., 2020) using the integrated multiple sequence alignment algorithm clustalw (Larkin et al., 2007). For the protein-coding genes (COI, PGD, GLN, CAD), the amino acid alignments were also checked for stop codons. Introns were detected by eye as ambiguously aligned regions with several gaps or inconsistent translations and their start-end was assessed by a typical nucleotide pattern ‘AG/GT (start) – AG/CAG (stop)’ that signifies splicing sites (Klopfstein & Ronquist, 2013; Malm & Nyman, 2015). The identified introns were individualized and separated from the exons. Preliminary alignments of the protein-coding genes were realigned using mafft version 7 online service (Katoh et al., 2019) and an iterative refinement G-INS-i method with global homology. The 16S and 28S rDNA sequences were realigned using T-Coffee (Notredame et al., 2000), which combines a local and global pairwise alignment, improving the final alignment for those sequences with secondary structure information. All final gene-alignments were concatenated using sequencematrix 1.8.0 (Vaidya et al., 2011).

Saturation substitution rate The level of substitution saturation for the protein-coding genes was assessed for the first and second codon position together, and the third codon position separately using dambe7 (Xia & Xie, 2001). First, we visually inspected the plot of the p-distance in terms of transitions and transversions (observations/length of sequence) against the corrected genetic distance pairwise comparison using GTR substitution model (=GTR distance) (Salemi, 2009). In addition, for each gene we estimated the random saturation substitution index (Iss) and the corrected substitution index (Iss.c) (Xia et al., 2003).

Molecular phylogenetic inference The concatenated alignments were analysed under Maximum Likelihood (ML) and Bayesian Inference (BI) to reconstruct the phylogenetic hypotheses and examine topological congruence between the methods. Gaps were treated as missing data. The trees were rooted on Blasticotoma filiceti (Blasticotomidae) in all analyses, a family that has been recovered as sister group of all other Tenthredinoidea in most previous studies (Vilhelmsen, 2001; Schulmeister, 2003a; Schulmeister, 2003b; Malm & Nyman, 2015).

Data of the concatenated alignments were primarily partitioned per gene, i.e., 16S, 28S, CAD, GLN, TPI, COI, PGD and IDH. In addition, the protein-coding genes (CAD, GLN, TPI, IDH, COI and PGD) were partitioned by codon position: First and second codon position together and the third codon position separately. To compare the effect of the third codon position in the phylogenetic reconstructions, we ran all analyses including and excluding this codon position for the protein-coding genes. Similarly, we compared the influence of the addition or exclusion of the TPI and IDH (Table S1) in the reconstructed phylogeny.

ML trees were inferred using the Web interface of W-IQ-TREE (Nguyen et al., 2015; Trifinopoulos et al., 2016).

The best substitution and best partition scheme model for each partition was estimated in the same programme using the W-IQ-TREE Modelfinder algorithm (Chernomor et al., 2016; Kalyaanamoorthy et al., 2017) and selected according to the Bayesian information criterion scores (Schwarz, 1978), with an ‘edge unlinked’ partition model allowing a different set of branch lengths for each partition. Bootstrap resampling support (BR) was calculated with 100 standard nonparametric replicates. ML trees were visualized in the Interactive tree of life (ITOL) v4 portal (Letunic & Bork, 2019) and edited with corel photo-paint x7 (Corel Corporation).

For the BI, we ran the analyses in the CIPRES Science Gateway V. 3.3 (Miller et al., 2012) portal. The best substitutions models and best partition scheme for BI were estimated in Partition Finder2 (Lanfear et al., 2017) using the ‘greedy’ search algorithm, ‘unlinked branch lengths’ option (Lanfear et al., 2012) and were selected based on the corrected Aikaike Information Criterion. A BI tree for the combination of all genes was reconstructed using MrBayes 3.2.2 (Ronquist et al., 2012b), while the parameters of substitution model were set according to the Partition Finder2 estimation. Two runs with four Markov chains Monte Carlo (MCMC) chains (one cold and three heated) were run for 20 million generations; diagnostics were saved every 1000th generation and 25% of the samples were discarded (burn-in fraction) prior to the summary statistics. The summarized parameter results of each run were visualized and examined in tracer 1.7.1 plotting the log likelihood values against the generation time. Convergence of the Markov chains Monte Carlo chains within and among runs was considered sufficient by when there was a correct mixing behaviour in tracer plots, the potential scale reduction factor was close to 1, the average standard deviation of split frequencies was below 0.01 and the Effective Sample Sizes for all parameters was higher than 200. The majority rule consensus tree was visualized using figtree v1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/) and edited in corel photo-paint x7 (Corel Corporation).

Total evidence phylogenetic analysis: Molecules and morphology An additional total evidence approach using Bayesian tree inference was performed combining the data matrix of 223 adult anatomical characters (117 taxa) (Malagón-Aldana et al., 2021a)

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

Evolution of Argidae and 85 larval characters (48 taxa) (Malagón-Aldana et al., 2021b) with the molecular dataset. For the adult morphological character matrix, seven characters (41, 45, 87, 89, 161, 162 and 175) were treated as ordered in accordance with Malagón-Aldana et al. (2021a), and three additional characters (5, 27, 39) based on the result patterns of the larval morphology dataset (Malagón-Aldana et al., 2021b). The molecular and morphological datasets were assembled using mesquite 3.6 (Maddison & Maddison, 2019). For some genera represented by different species in the molecular and morphological datasets we composed a terminal taxon (taxon denoted as genus name + spp.*) if there was evidence for monophyly of the genus in previous studies (Malagón-Aldana et al., 2021a). Trees were rooted on B. filiceti (Blasticotomidae). The parameter settings for the molecular partition were identical with the above; for the morphological dataset a standard discrete model was used with coding set to ‘variable’ and rates to ‘gamma’. The BI analysis for the combined dataset was run using mrbayes 3.2.2 (Ronquist et al., 2012b) in the CIPRES Science Gateway V. 3.3 (Miller et al., 2012) portal. Two runs with four Markov chains Monte Carlo (one cold and three heated) were run for 20 million generations, and remaining parameters and test of convergence were identical to the above-described molecular BI analysis. The majority rule consensus tree was visualized using figtree v1.4.4 and edited in corel photo-paint x7 (Corel Corporation).

Molecular clock calibration and divergence dating To date the divergence times within Argidae and Pergidae, we used a node dating (tree calibration by employing priors on node ages based on the oldest known fossils for corresponding clades) approach (Ronquist et al., 2012a; Zhang, 2017).

Five calibration nodes were assigned (Fig. 3) based on fossil information on well supported nodes (PP = 90–100) and constrained as monophyletic. We used an offset exponential probability distribution as suggested by Ronquist et al. (2012a), with a mean age of 235 Ma (maximum oldest fossil age of Hymenoptera, Triassoxyela Rasnitsyn) and a minimum age for each selected node according to the fossil (Fig. 3): (A) For the root (=tree age) Pseudoxyelocerus bascharagensis Nel et al.

(183 Ma, oldest fossil of Tenthredinoidea); (B) for the node ZAP: Zenarge + (Argidae + Pergidae), Xyelotoma macroclada Gao et al. (164.7 Ma, oldest fossil closest to Argidae + Pergidae) (Ronquist et al., 2012a); (C) for the node Sterictiphora, the fossil S. konowi Rohwer (37.2 Ma) (Zhelochovtzev & Rasnitsyn, 1972); (D) for the node of ‘Neotropical Sterictiphorinae’ the fossil Didymia davisi Smith & Poinar (20.4 Ma) and (E) for the Arginae (except Antargidium and Scobina) the fossil Mioarge azari Nel (7.2 Ma) (Malagón-Aldana et al., 2021a).

For the node dating of the combined dataset, we used mrbayes 3.2.2 (Ronquist et al., 2012b). The analyses were run in CIPRES Science Gateway V. 3.3., with an IGR (independent gamma rate at each branch with mean 1.0) model (Ronquist et al., 2012a). The remaining parameters followed Ronquist et al. (2012a) for Hymenoptera: Lognormal (−7.08069, 1) and

9

prset igrvarpr = exp (37.12). We used two different priors to compare their effect on the age estimation, an uniform tree prior (clock:uniform) and a birth-death prior (clock:birth-death).

For the latter, the following settings were used: Speciation prior = exponential (10), extinction prior beta (1, 1) and extant sample proportion fixed to 0.1 (our sample of Argidae taxa was about 10% of all described species). Substitution models were assigned to each gene partition according to the models estimated previously with Partition Finder2. The analysis had two runs, four chains for 20 million generations and a majority rule consensus tree was estimated, with the same parameters and test of convergence and effective sample size used for the above-described Bayesian phylogenetic analysis (see Section 2.6).

Biogeographic reconstruction The geographic records of genera and species were obtained from the Electronic World Catalogue of Symphyta (Taeger et al., 2010, 2018), labels of the examined specimens, literature (Smith, 1992; Saini, 2009; Koch et al., 2015) and the WaspWeb (van Noort, 2020). World biogeographic regions were assigned according to the zoogeographic realms of Holt et al. (2013) with some modifications from Morrone (2015) (i.e., the Mediterranean and Africa north of Sahara were considered as parts of the Palearctic region; New Guinea considered part of the Australian region). The ancestral biogeographical states were reconstructed using rasp 10.15 (Yu et al., 2015) applying S-BGB (Statistical BioGeoBEARS) and BBM (Bayesian Binary MCMC) methods, estimated over the ultrametric calibrated consensus tree of the node dating analysis to compare directly with the divergence time estimations. Regarding S-BGB (Matzke, 2013a, 2013b, 2014), we used the Dispersal Extinction Cladogenesis (DEC) approach model that implements a Lagrange (Likelihood Analysis of Geographic Range Evolution) source code (Ree & Smith, 2008) and estimates likelihoods of ancestral states at cladogenesis events constraining dispersal multipliers between regions according to certain geological events (Brown & Lomolino, 1998; SanMartin & Ronquist, 2004; Hall & Sevastjanova, 2012; Müller et al., 2019) from 0 to 1 in a matrix (File S1). We used two dispersal rates, 0.1 and 1 (e.g., dispersal between Afrotropical and the Neotropical regions was set as 1 before their breakup, around 110 Ma and 0.1 after it). An additional sample of 1000 trees derived from the node dating Bayesian analysis was used for the S-BGB analysis.

The Bayesian Binary Analysis (BBM) (Ronquist & Huelsenbeck, 2003; Yu et al., 2015) was run with 10 chains and 500 000 generations, state sampling every 100 generations; and applying a F81 model with a site rate variation of gamma, which is the most complex model implemented in rasp 10.15. The maximum number of ancestral states was set to three in both analyses. Both S-BGB and BBM analyses accepted polytomies in the input consensus tree. For the composite Argidae terminal taxa = *genus + spp. (two species in the same genus from different datasets) the distribution state was assigned as a combination of both, e.g., Aprosthema tardum (Palearctic) + Aprosthema

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

10

L. A. Malagon-Aldana et al.

brunniventre (Nearctic) = Aprosthema spp.* (Palearctic and Nearctic).

and second position, it shows a linear growth and low saturation in all genes, including COI.

Results

Gene trees

Sequence assemblage and saturation of substitution rate

When analysing individual ML gene trees and all codon positions (Fig. S2), the monophyly of Argidae s.s. and Pergidae was recovered only for CAD, GLN, COI, PGD and IDH. The relationship (Zenarge + Argidae s.s.) was retrieved when analysing GLN; (Zenarge + Pergidae) for the individual analyses of COI, PGD and CAD. Zenarge + (Pergidae s.s. + Argidae s.s.) was recovered for IDH. The 16S gene tree did not recover the monophyly of any of these families, while for the gene 28S only the family Pergidae was retrieved as monophyletic and for TPI the family Argidae s.s. was retrieved as monophyletic (Fig. S2).

These families were generally not recovered when using only the first and second codon for each individual gene tree. An additional example of contrasting results between the phylogenetic reconstruction of individual genes was observed for the genus Atomacera, which was recovered either as being the sister group of Arginae for CAD, GLN and IDH, or as sister group of Sterictiphorinae for PGD and 28S (see below).

The final molecular assemblage of aligned sequences included 99 terminal taxa (72 sequences and 70 species of Argidae and 27 sequences of outgroup taxa) (Table S1, Fig. 3) and 5350 characters or total sites, including 2296 parsimony informative sites, 490 singletons and 2564 constant sites. The most completely sampled genes were COI (82%), 28S (69%) and 16S (61%), while TPI (27%) and IDH (19%) were the least sampled (Table 3), the latter two consisting exclusively of sequences from the GenBank database. There were 46% missing data.

Sixty sequences contained more than 50% gaps when including IDH and TPI. The successful amplification of mitochondrial and ribosomal DNA (COI, 16S and 28S) was higher than for the nuclear genes. rDNA 16S alignment was highly incongruent among the different alignment methods due to abundance of ambiguous sections in its structure. The lengths of the aligned gene regions were 1015 bp (COI), 711 bp (IDH), 513 bp (PGD), 834 bp (GLN), 783 bp (CAD), 453 bp (TPI), 397 bp (16S) and 644 bp (28S), respectively. For the protein-coding genes COI, IDH and PGD, no intron regions were detected, while for CAD, GLN and TPI, one or more introns were present and excluded. We were able to correct one erroneous identification from the GenBank database, the species Sericoceros nr. tannuus (KC975751.1, ZSM HYM AE086, Schmidt & Walter, 2014; Schmidt et al., 2017; Boevé et al., 2018) was recovered inside the genus Atomacera in all trees; after checking the photographs of the voucher specimen in the http://www.boldsystems.org/, we conclude that this specimen is an Atomacera sp. We provide the first known sequences for the Sterictiphorinae genera Manaos (28S, COI, and PGD), Dielocerus (16S, CAD, COI, GLN, PGD and TPI), Sphacophilus (16S, CAD, COI, GLN, PGD and TPI), Tanymeles (16S) and for the Arginae genera Athermantus (16S, COI), Pampsilota (16S, 28S, CAD and COI), Triarge (28S, 16S, and COI); as well as for several species (Table S1).

Among the protein-coding genes there was a clear difference in the variation of sites among the first and second codon positions relative to the third (Table 3), the third codon having a high proportion of unique and parsimony informative sites (>98%, >90%) and few invariant sites (= high variation) (<8%).

The rDNA genes were intermediately conserved in terms of unique and invariant sites, while first and second codon positions of coding genes were the most conserved partitions (Table 3).

The substitution saturation index (Iss) (Table 3) shows little saturation (Iss < Iss.c) in the first and second codon position of all genes, except for COI, which is saturated according to this index in all three codon positions. A similar pattern was observed in the graphics of the substitution’s saturation (Fig. S1). Here the asymptotic behaviour of the observed third codon of p-distance against the corrected genetic distance indicates that the substitution rate is saturated, while for the first

Combined molecular dataset The branch support was lower in all cases in the ML trees (BR) relative to the BI trees (posterior probability), even with similar topology (Fig. S3). The BI trees reconstructed with only the first and second codon position were less resolved and supported to species level (e.g., Arge) (Fig. 3), while the inclusion of the third codon position in the analyses improved the resolution and support (>50%) at this level. On the other hand, excluding the saturated third codon position improved the support of deep nodes (e.g., at the base of the ZAP clade, see below) (Fig. S3).

The ML and BI showed different topologies for Argidae s.s., Pergidae and Zenarge relationships, although in all cases they formed part of the same clade with high support (BR or posterior probability PP = 89–100) (Fig. S3). (Zenarge + Argidae s.s.) was retrieved when using ML and BI with all codon positions (Fig. S3: A, C). On the other hand, Zenarge + (Pergidae + Argidae s.s.) was obtained in both analyses when using only the first and second codon positions (Fig. S3: B, D).

Regarding the internal relationships of Argidae s.s., in the combined molecular data set using either all codon positions or only the first and second codon position we recovered two main clades that correspond to the subfamilies Arginae and Sterictiphorinae s. Benson (1963) (Fig. 3); the clades within each subfamily are also highly congruent with the morphological hypotheses (Malagón-Aldana et al., 2021a, 2021b). For Sterictiphorinae, Atomacera was retrieved as sister group of the remaining genera (Fig. 3). Other clades recovered within the Sterictiphorinae were the sister relationship between the Holarctic clade Sterictiphora + (Aproceros + Aprosthema) and a Neotropical clade comprising a number of genera but whose

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

Evolution of Argidae 11 Table 3. Descriptive parameters of aligned sequences with corresponding substitution model assigned (IQ-tree and partition finder).

Gene

Number sequences

Length (bp)

Unique sites (%)

Parsimony informative sites (%)

Invariant sites (%)

Substitution model IQ-tree

Substitution model PF

Iss

Iss.c

P-value

16s 28s COI12 COI3 IDH12 IDH3 PGD12 PGD3 TPI12 TPI3 CAD12 CAD3 GLN12 GLN3

61 69 83 83 20 20 45 45 29 29 54 54 48 48

397 644 677 338 474 237 342 171 302 151 522 261 556 278

70.5 62.3 48.9 97.6 29.3 98.7 40.1 98.8 43.0 99.3 50.6 99.2 45.7 98.2

44.1 39.3 26.0 89.1 15.6 93.7 19.0 92.4 19.5 95.4 18.4 93.9 14.2 89.9

41.8 46.4 63.8 4.4 77.0 3.0 73.4 7.6 64.2 3.3 71.5 5.7 71.9 4.7

GTR + F + I + G4 SYM + I + G4 TIM + F + I + G4 TIM + F + G4 TIM3 + F + I + G4 TNe + G4 SYM + I + G4 K2P + I + G4 K2P + I + G4 TPM3 + F + I + G4 TIM3 + F + I + G4 TPM2 + F + I + G4 GTR + F + I + G4 HKY + F + I + G4

GTR + I + G SYM + I + G GTR + I + G TIM + G GTR + I + G GTR + I + G GTR + I + G GTR + I + G SYM + I + G TRN + I + G GTR + I + G GTR + I + G GTR + I + G TRN + I + G

1.11 1.65 0.25 0.72 0.39 0.78 0.26 0.66 0.44 0.73 0.57 0.79

0.72 0.69 0.71 0.63 0.69 0.70 0.67 0.61 0.71 0.68 0.71 0.68

0.000 0.000 0.000 0.005 0.000 0.260 0.000 0.139 0.000 0.035 0.000 0.000

internal relationships were not resolved (Fig. 3). Concerning Arginae, the Australian genus Antargidium was recovered as the sister group of the remaining genera. The Neotropical genus Scobina is the sister group of the remaining Arginae, minus Antargidium.

Total evidence analysis and phylogenetic relationships The combined morphological and molecular dataset comprised 164 terminal taxa (52 genera of Argidae out of 55) and 5658 characters (File S2). The genera Pseudosinarge, Zhuhongfuna and Mioarge (fossil) were excluded from the morphological matrix and the analyses due to the low number of scored characters and their negative effect in the resolution of Arginae.

When combining molecular and morphological data using BI and all codon positions, we retrieved Zenarge + (Pergidae + Argidae s.s.) (Figs 4, 5). Pergidae and Argidae were recovered as monophyletic sister groups, both with high branch support (PP = 100). With regard to Pergidae (Fig. 5), the new world subfamily Acordulecerinae is retrieved as the sister group of the remaining genera, which in turn are divided in two main clades (Fig. 5). One clade includes Phylacteophaginae + (Perginae + Parasyzygoninae) (PP = 96), while the second clade has Loboceratinae (Aulacomerus) (PP = 89) as sister group of the remaining subfamilies: (Styracotechynae + Heteroperreyia) + ((Pterygophorinae + (Philomastiginae + (Euryinae + (Syzygoninae + Perreyinae)). Remarkably, the South American Perreyinae was recovered as paraphyletic, Heteroperreyia being outside the subfamily.

Inside Argidae, two main clades were retrieved for all the different reconstructed phylogenies. They correspond to the subfamilies Arginae (PP = 100) and Sterictiphorinae (PP = 66) (Figs 4, 5), as in the above molecular analyses and previous morphological phylogenetic hypotheses (Malagón-Aldana et al., 2021a, 2021b). For the subfamily Arginae (Fig. 4), the Australian genus Antargidium (Fig. 4, clade I) was retrieved

as the sister group of the rest, followed by the Neotropical Scobina (Fig. 4, clade II). Clade III (Fig. 4) comprises exclusively African taxa (PP = 100), i.e., the genus Triarge, Pampsilota and African Arge spp. In clade III, Pampsilota afra was recovered as sister group of the remaining taxa. Pampsilota is paraphyletic, P. afra being apart from the other species, P. dahomeyanus, which is in a clade with Arge congrua and A. fenestralis. Triarge is recovered as monophyletic and sister group of Arge montana and A. stuhlmanni.

Clade III includes two subclades, one consisting of Athermanthus + Sinarge (Oriental-Sino-japanese) and a second comprising Cibdela + (Tanyphatnidea + Sjoestedtia) (Oriental-African) (Fig. 4). Clade III was recovered as the sister group of the last major clade of the subfamily that comprises the majority of the ubiquitous genus Arge (Fig. 4, clade V), with a number of other genera embedded in the clade (Asiarge, Kokujewia, Brevisceniana, Pseudarge and Spinarge).

In Sterictiphorinae (Fig. 5), the Australian Trichorhachus + Styphelarge (clade VI) were retrieved as sister group of the remaining genera, followed by Atomacera (clade VII) from the Nearctic and Neotropical regions. A third clade includes the Holarctic genera (clade VIII), among them Sterictiphora was the sister group of the remaining genera Aprosthema + (Pseudaprosthema, Ortasiceros and Yasumatsua + Aproceros). Finally, the remainder of the Sterictiphorinae were placed in a large, predominantly Neotropical clade (clade IX) with males having the flagellum furcate, Brachyphatnus (southern South America) being the sister group of the remaining genera. The deeper relationships of the latter are poorly resolved, but some subclades have high support (PP ≥ 70) (Fig. 5). These subclades are: clade X, Ptenos (paraphyletic), Manaos and Zynzus; clade XI, Acrogymnidia + (Acrogymnia + Trailia); clade XII, the ‘Dielocerini s.l.’ clade (Smith, 1992) including Sericoceros, Subsymmia, Durgoa, Neoptilia, Themos, Mallerina, Topotrita, Pachylota, Dielocerus and Digelasinus and clade XIII, Schizocerella, Didymia, Ptilia, Trochophora, Triptenus and Neurogymnia + Eriglenum, where

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

12

L. A. Malagon-Aldana et al.

Fig. 4. Total evidence Bayesian tree of subfamily Arginae (Argidae) highlighting the current biogeographical distribution. Main clades are labelled with numbers in circles. Asterisk after the name of a terminal (e.g., Athalia spp.) indicates that this taxon is a chimera, i.e., the morphological and molecular information was obtained from different species of the same genus.

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

Evolution of Argidae 13

Fig. 5. Total evidence Bayesian tree of subfamily Sterictiphorinae (Argidae) highlighting the current geographical distribution. Main clades are labelled with numbers in circles. Asterisk after the name of a terminal (e.g., Athalia spp.) indicates that this taxon is a chimera, i.e., the morphological and molecular information was obtained from different species of the same genus. Colours of occurrence in Pergidae and Zenargidae (Neotropical, Australian and Nearctic region) are lighter than in legend to emphasize the distribution in Argidae s.s.

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

14

L. A. Malagon-Aldana et al.

the genus Didymia was not recovered monophyletic. We were unable to properly resolve the exact position of Sphacophilus.

Node dating and ancestral distribution (Figs 6, 7) The estimated mean age of the clades was slightly older when using the uniform tree prior than with the birth-death prior. In the same way the 95% highest posterior density (HPD interval) was wider for the uniform tree prior (Fig. 6; Table 4); here we describe the results using the shorter HPD interval. The age of the ZAP clade was estimated to be 177.1 Ma (164.7–215.8), e.g., early Jurassic; this agrees with the estimate of Ronquist et al. (2012a). The biogeographical reconstructions (both S-BGB/DEC and BBM) indicate an ancestral distribution of the ZAP ancestor in the Neotropics or Australia + Neotropics (Fig. 7). The divergence between Pergidae and Argidae s.s. occurred approx. 168.5 Ma (144.9–205.4). This interval of time overlaps with other estimates (Schmidt & Walter, 2014; Nyman et al., 2019) and is contemporary with the beginning of the breakup between west and east Gondwana. The first split within Argidae s.s. is dated from the middle to late Jurassic around 155.1 Ma (127.4–191.1 Ma). The age of the Sterictiphorinae crown group is estimated to be around 148.2 Ma (118.6–183.2 Ma) in the beginning of the Cretaceous, significantly older than crown group Arginae at approx. 123.3 Ma (92.1–159.5). The ancestral area of Argidae s.s. was inferred to be Australian/Neotropical (BBM) or Australian/African (S-BGB/DEC); for each subfamily the ancestral distribution was estimated also as Australian/Neotropical (BBM and S-BGB/DEC) (Fig. 7).

Discussion Although for many taxa the overall gene sampling was low (Table S1), especially for the nuclear protein-coding genes, the phylogenetic relationships retrieved with the available molecular data (Fig. 3) are highly congruent with previous hypotheses, e.g., monophyly of Argidae, Pergidae, Sterictiphorinae and Arginae. However, for more than half of the genera of Argidae, molecular information is still absent, and therefore the relationships of these taxa rely exclusively on morphological evidence.

Saturation of substitution rate, additional data and their phylogenetic effect Our results show how the type of data differentially affect the placement of taxa, with special effect on isolated taxa, e.g., Zenarge turneri (Zenargidae) (Fig. S3). The placement of Zenarge was highly influenced by the third codon position, and when excluding it, the phylogenetic position of Zenarge was more similar in the molecular and morphological trees (Malagón-Aldana et al., 2021a, 2021b), Zenarge being the sister group of Pergidae + Argidae s.s. However, for more distal nodes in the topology, e.g., within Arge, the resolution

decreased substantially when excluding the third codon position (Fig. 3). This indicates that while the third codon position might have achieved saturation for the deeper nodes, this may not be the case for the more distal nodes; a similar effect occurs in implied weights analyses, where different k-values might resolve some parts of the phylogeny better than others do. Using the highly saturated nucleotides in phylogenetic analyses is still controversial (Källersjö et al., 1999; Strimmer & von Haeseler, 2009; Breinholt & Kawahara, 2013). Malm & Nyman (2015) retrieved Zenarge + Argidae s.s. even if excluding the third codon position for most of the protein-coding genes they used, except for CAD and GLN. Additionally, when we combined the molecular and morphological datasets, including all codon positions, Zenarge was recovered as sister group of Argidae + Pergidae. This shows that morphological characters, in spite of their significantly lower number relative to molecular sites, can still influence the results of the combined analyses when using few genes. The sampling of additional fresh material of Zenarge (we relied on GenBank sequences), together with a phylogenomic approach would help to test its current placement. For now, based on the morphological (adult and larval stages) and molecular evidence analysed here, we uphold placing Zenarge in a separate family, the Zenargidae (Malagón-Aldana et al., 2021a).

Zenargidae The combined analysis supports the topology Zenargidae + (Argidae + Pergidae) or ZAP clade (Figs 4, 5). Zenarge turneri, the sole representative of Zenargidae, only occurs in New South Wales in Australia. It is the only taxon of the ZAP clade that feeds on gymnosperms, the endemic Cypress pine Callitris as well as the introduced Cupressus (Cupressaceae) (Moore, 1963a, 1963b; Smith, 1992). The position of Zenarge as sister to the rest of the ZAP clade and our estimation of the age of the split between Zenargidae and Argidae + Pergidae around 180 Ma in the early Jurassic, prior to the Gondwana breakup (Fig. 6), is apparently in conflict with the inference of Nyman et al. (2019) that the common ancestor of the ZAP clade (indeed, of all Tenthredinoidea) was feeding on angiosperms and the feeding habits of Zenarge a result of a secondary shift to gymnosperms. The origin of the Zenargidae is according to our estimates of similar age as the earliest putative angiosperm flower fossil (Nanjinganthus dendrostyla; Fu et al., 2018 of 174 Ma), older than the age estimate (120 Ma, i.e., Early Cretaceous) of the split between Zenarge and the remaining Argidae according to Nyman et al. (2019). Different lines of evidence support the pre-Cretaceous origin of angiosperm plants (Hochuli & Feist-Burkhardt, 2013; Fu et al., 2018); however, fossil evidence indicates that the major radiation of angiosperms did not take off until the Early Cretaceous (Silvestro et al., 2015; Herendeen et al., 2017; Nyman et al., 2019). The evolution of the Tenthredinoidea seems to display a similar pattern (Nyman et al., 2019) and they may still have co-evolved with angiosperms even if their common ancestor in the early Jurassic was feeding on gymnosperms. However, the estimated age of Callitris, the current

© 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

Evolution of Argidae 15

Fig. 6. Node dating chronogram of Argidae using the combined dataset (morphology and molecules). Horizontal bars show the 95% highest posterior density interval (HPD) of the estimated node age, in blue for the combined dataset and red for the molecular data. Vertical bars show relevant geological events in that transition period of time. Main clades are labelled with numbers in circles. © 2021 The Royal Entomological Society, Systematic Entomology, doi: 10.1111/syen.12527

Another random document with no related content on Scribd:

remain freely available for generations to come. In 2001, the Project Gutenberg Literary Archive Foundation was created to provide a secure and permanent future for Project Gutenberg™ and future generations. To learn more about the Project Gutenberg Literary Archive Foundation and how your efforts and donations can help, see Sections 3 and 4 and the Foundation information page at www.gutenberg.org.

Section 3. Information about the Project Gutenberg Literary Archive Foundation The Project Gutenberg Literary Archive Foundation is a non-profit 501(c)(3) educational corporation organized under the laws of the state of Mississippi and granted tax exempt status by the Internal Revenue Service. The Foundation’s EIN or federal tax identification number is 64-6221541. Contributions to the Project Gutenberg Literary Archive Foundation are tax deductible to the full extent permitted by U.S. federal laws and your state’s laws.

The Foundation’s business office is located at 809 North 1500 West, Salt Lake City, UT 84116, (801) 596-1887. Email contact links and up to date contact information can be found at the Foundation’s website and official page at www.gutenberg.org/contact

Section 4. Information about Donations to the Project Gutenberg Literary Archive Foundation Project Gutenberg™ depends upon and cannot survive without widespread public support and donations to carry out its mission of increasing the number of public domain and licensed works that can be freely distributed in machine-readable form accessible by the widest array of equipment including outdated equipment. Many

small donations ($1 to $5,000) are particularly important to maintaining tax exempt status with the IRS. The Foundation is committed to complying with the laws regulating charities and charitable donations in all 50 states of the United States. Compliance requirements are not uniform and it takes a considerable effort, much paperwork and many fees to meet and keep up with these requirements. We do not solicit donations in locations where we have not received written confirmation of compliance. To SEND DONATIONS or determine the status of compliance for any particular state visit www.gutenberg.org/donate.

While we cannot and do not solicit contributions from states where we have not met the solicitation requirements, we know of no prohibition against accepting unsolicited donations from donors in such states who approach us with offers to donate.

International donations are gratefully accepted, but we cannot make any statements concerning tax treatment of donations received from outside the United States. U.S. laws alone swamp our small staff.

Please check the Project Gutenberg web pages for current donation methods and addresses. Donations are accepted in a number of other ways including checks, online payments and credit card donations. To donate, please visit: www.gutenberg.org/donate.

Section 5. General Information About Project Gutenberg™ electronic works Professor Michael S. Hart was the originator of the Project Gutenberg™ concept of a library of electronic works that could be freely shared with anyone. For forty years, he produced and distributed Project Gutenberg™ eBooks with only a loose network of volunteer support.

Project Gutenberg™ eBooks are often created from several printed editions, all of which are confirmed as not protected by copyright in the U.S. unless a copyright notice is included. Thus, we do not necessarily keep eBooks in compliance with any particular paper edition.

Most people start at our website which has the main PG search facility: www.gutenberg.org.

This website includes information about Project Gutenberg™, including how to make donations to the Project Gutenberg Literary Archive Foundation, how to help produce our new eBooks, and how to subscribe to our email newsletter to hear about new eBooks.