ITJEMAST @13(5)2022 Research Articles

ISSN 2228-9860 eISSN 1906-9642

CODEN: ITJEA8 http://TuEngr.com

LC/MS Profiling of Shilajit Extract for Antimicrobial & Antifungal and Cytotoxic Activities

Microorganisms Cultures Screening with High Proteolytic Properties and Capable Fix Atmospheric Nitrogen to Speed up the Poultry Manure Biodegradation

Some Legal Issues About Fintech in Payment Activities in Vietnam

Privacy Regulations in the Middle East: Challenges & Solutions

The Relationship between Physical Self-Concept and Job Satisfaction among Physiotherapists in Saudi Arabia

Large-Scale Laboratory Modeling of the Performance of the Stone Column Group in Improving the Behavior of Sandy Soils

Impact of Applying Artificial Intelligence on Decision-Making Quality:A Descriptive Study in Saudi Arabian Private Sector Organizations

Measuring New Normal Strategy of Brands on Digital Branding during Covid-19

Method of Improving Designs of Built Local Schools According to Iraqi and International Criteria

An Experimental Based Approach Using Artificial Intelligence Algorithm for Determining the Surface Roughness by Milling Process

Accounting Disclosures of Related Parties Transactions and Investment Risks Tackling the Pandemic: A Knowledge Management Perspective

Roles of Variation in Architectural Programming Approaches in Architectural Designs

School Travel Behavior Research Milestone (1979-2021): A Bibliometric Review Analysis

The Effect of Consumption Values on Customer Satisfaction of Living Room Furniture in Saudi Arabia

Effects of Polypropylene Fibres on the Properties of Reinforced Structural Lightweight Concrete Made With Expanded Clay Aggregates

A Survey on STEAM Education in Saudi Arabia: Early Childhood Russian Experience of Export Regulation of Food Flows

Modelling and Design of Deep Drawing Tools with Using Logopress

Bird Droppings Biodegradation and Its Use as Fertilizer for Tomato Cultivation

Human Resource Management through an Islamic Len: A Systematic Review & Research Agenda and Practical Implications

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies

http://TuEngr.com

International Editorial Board

Editor in Chief

Ahmad Sanusi Hassan, PhD Professor Universiti Sains Malaysia, MALAYSIA

Editorial Board:

Executive Editor Boonsap Witchayangkoon, PhD Associate Professor Thammasat University, THAILAND

Assoc. Prof. Dr. Mohamed Gadi (University of Nottingham, UNITED KINGDOM)

Professor Dr.Hitoshi YAMADA (Yokohama National University, JAPAN)

Professor Dr. Chuen Sheng Cheng (Yuan Ze University, TAIWAN )

Professor Dr.Mikio SATOMURA (Shizuoka University, JAPAN)

Professor Dr.Chuen-Sheng Cheng (Yuan Ze University, TAIWAN)

Emeritus Professor Dr.Mike Jenks (Oxford Brookes University, UNITED KINGDOM )

Professor Dr.I Nyoman Pujawan (Sepuluh Nopember Institute of Technology, INDONESIA)

Professor Dr.Toshio YOSHII (EHIME University, JAPAN)

Professor Dr.Neven Duić (University of Zagreb, CROATIA)

Professor Dr.Dewan Muhammad Nuruzzaman (University Malaysia Pahang MALAYSIA)

Professor Dr.Masato SAITOH (Saitama University, JAPAN)

Professor Dr.Sergei Shlykov (Stavropol State Agrarian University, R USSIA)

Scientific and Technical Committee & Editorial Review Board on Engineering, Technologies, and Applied Sciences:

Professor Dr.CH V K N S N Moorthy (Vasavi College of Engineering, INDIA)

Associate Prof. Dr. Paulo Cesar Lima Segantine (University of São Paulo, BRASIL)

Associate Prof. Dr. Kurt B. Wurm (New Mexico State University, USA)

Associate Prof. Dr. Truong V.B. Giang (Vietnam National University, Hanoi, VIETNAM)

Associate Prof. Dr. Fatemeh Khozaei (Islamic Azad University Kerman Branch, IRAN)

Associate Prof. Dr Ahmad Abdulwahid Dhannoon (University of Mosul, IRAQ)

Assistant Prof.Dr. Zoe D. Ziaka (International Hellenic University, GREECE)

Associate Prof.Dr. Junji SHIKATA (Yokohama National University, JAPAN)

Associate Prof.Dr. Sillapaporn Srijunpetch (Thammasat University, THAILAND)

Assistant Prof.Dr. Akeel Noori Abdul Hameed (University of Sharjah, UAE)

Assistant Prof.Dr. Rohit Srivastava (Indian Institute of Technology Bombay, INDIA)

Assistant Prof. Dr.Muhammad Yar Khan (COMSATS University, PAKISTAN )

Assistant Prof. Dr. David Kuria (Kimathi University College of Technology, KENYA)

Dr. Mazran bin Ismail (Universiti Sains Malaysia, MALAYSIA)

Dr. Salahaddin Yasin Baper (Salahaddin University - Hawler, IRAQ)

Dr. Foong Swee Yeok (Universiti Sains Malaysia, MALAYSIA)

Dr.Azusa FUKUSHIMA (Kobe Gakuin University, JAPAN)

Dr.Yasser Arab ( Dhofar University, OMAN )

Dr.Arslan Khalid (Shandong University, CHINA )

Dr.Viktor S. Kukhar (Ural State Agrarian University, Yekaterinburg, RUSSIA)

Human Resource Management through an Islamic Len: A Systematic Review & Research Agenda and Practical Implications

13A5M

LC/MS Profiling of Shilajit Extract for Antimicrobial & Antifungal and Cytotoxic Activities 13A5N

Microorganisms Cultures Screening with High Proteolytic Properties and Capable Fix Atmospheric Nitrogen to Speed up the Poultry Manure Biodegradation 13A5O

Some Legal Issues About Fintech in Payment Activities in Vietnam 13A5P

Privacy Regulations in the Middle East: Challenges & Solutions 13A5Q

The Relationship between Physical Self-Concept and Job Satisfaction among Physiotherapists in Saudi Arabia 13A5R

Large-Scale Laboratory Modeling of the Performance of the Stone Column Group in Improving the Behavior of Sandy Soils 13A5S

Impact of Applying Artificial Intelligence on Decision Making Quality:A Descriptive Study in Saudi Arabian Private Sector Organizations 13A5T

Measuring New Normal Strategy of Brands on Digital Branding during Covid 19 13A5U

Contact s: Professor Dr.Ahmad Sanusi Hassan (Editor-in- Chief), School of Housing, Building and Planning, UNIVERSITI SAINS MALAYSIA , 11800 Minden, Penang, MALAYSIA. Tel: +60-4- 653-2835 Fax : +60-4- 657 6523, Sanusi @ usm.my , Editor @ TuEngr.com

Associate Professor Dr.Boonsap Witchayangkoon (Executive Editor) , Thammasat School of Engineering, THAMMASAT UNIVERSITY, Klong Luang, Pathumtani, 12120, THAILAND. Tel: +66-2-5643005 Ext 3101. Fax: +66-25643022 DrBoonsap @ gmail.com, Editor @ TuEngr.com

Managing Office

TUENGR Group, 88/244 Moo 3, Moo Baan Saransiri, Klong#2, KlongLuang, Pathumtani, 12120, THAILAND. Tel/WhatsApp: +66 995535450. Postal Paid in MALAYSIA/THAILAND. Side image s are Rose s

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

Method of Improving Designs of Built Local Schools According to Iraqi and International Criteria

Asma H. Al Dabbagh1*, Muthanna

A. Mahmood1

1Department of Architecture, University of Mosul, IRAQ. *Corresponding Author (Tel: +964 7721280936. Email: asma.dabbagh @uomosul.edu.iq).

Paper ID: 13A5A

Volume 13 Issue 5

Received 24 October 2021

Received in revised form 26 March 2022

Accepted 07 April 2022 Available online 16 April 2022

Keywords: Schools design; Functional performance; Iraqi criteria; International criteria; Functional components; Educational spaces; Social spaces; Cultural spaces; Sport spaces; Supportive spaces; Administration spaces

Abstract

Local schools in Iraq suffer from low functional performance caused by several reasons, including; increasing the number of students, changing curriculum, and the developing methods of learning, as well as high economic consequences of demolition for these schools, which cast a shadow on the functional performance of these schools. Therefore, their design needs to be improved to match these changing factors. This paper tries to study this problem by following two steps; Firstly, delineation of built types of local schools, delineation of functional components with the area, then comparing these functional components and their areas with that in Iraqi and International standards, to discover the shortage quantitatively and, to satisfy the needed necessities, secondly, the step of preparation (design alternatives) for each type, by using mechanisms as addition, subtraction, and substitution . The research was able to put forward possible alternatives to built types of local schools, the adoption of design solutions to address the shortage for each type and try to come up with multiple alternatives, then choose the best alternative of them, and by using evaluation criteria qualitatively, the best alternative selected. Hence, the Double Courts alternative in primary schools seems to be the best one, depending on five criteria; a ratio of satisfying necessities, orientation as an environmental request, financial economy, ratio of modification, and design flexibility.

performance. Further in, the economic consequences of replacing the existing school buildings (which represent a large number of school buildings as a repetitive model all over Iraq) with others, was a motive for this research. Previous studies did not state design strategies to develop the buildings of the local school, another motive, is to satisfy the needed necessities quantitatively and qualitatively, and to achieve the client goals from an economic, functional, and environmental point of view. Our objective is to identify design strategies to meet the existing shortage in local schools and meet future needs and requirements, to provide a flexible school building that encounters the rapid developments in teaching methods and curriculum (Al Masoudi., 2019; Valkiria, 2008). Initially, the shortage in the local schools was determined through comparisons between the functional components of those existing schools, on the one hand, and international and Iraqi standards on the other, to determine the scale of the problem, and then give accurate strategies to solve t hese problems.

To achieve this objective, by following the next methodology: Define the international and Iraqi area standards for the primary school buildings and define their different types and sizes to determine the local reality of primary school buildings and diagnose defects in them. make a comparison between the functional components in local schools and that within the international and local standards and determine the nature of the shortage. Giving design alternatives and then choosing the best one according to several criteria.

2 Lite rature Review

Nasser and Shaayi (2018) exhibited the capacity of the class are 30 students for primary schools, and 25 students for secondary schools, with the provision of a cafe’, waiting for space for students and parents, and sports spaces (basket, flying, and ping pong), also stated 2.5m² per student as the minimum area for primary schools, 10m² per student for secondary schools.

Al Etabi (2011) focused on local schools by making the outer spaces more sustainable, by proposing design solutions for them, such as changing their forms and their furniture, because of their role in education and social interaction.

Moore (2013) addressed the relationship between educational outputs and the architectural design of educational social and support spaces, and the impact of a physical characteristic of primary schools upon educational performance, such as class size, school size, and the number of students. Also, they pointed out that small schools offer an opportunity for student gathering and this enhances interactive education, also indicated the importance of the small classes and the relatively low density in enhancing interactive education and educational results outputs

Al Masoudi (2019) provided a set of solutions to address the reality of technological development and changing teaching methods in school buildings, by correcting disadvantages in the functional program and space organization and giving solutions to the complementary educational spaces. Moreover, the study identified indicators for the design of attractive and flexible spaces that correspond to the changing in educational curriculum, as well as responding to

rapid developments in information technologies, through minor modifications to the old spaces, as the design of multi use spaces to meet the functional requirements of the educational process (Heritor, Jose, 2008, Zhang, 2015; Mohammed, 2020).

Heritor & Jose (2009) concerned with developing the plans of existing schools in Portugal by the change in the educational curriculum and laws, also classified the school spaces functionally; the educational spaces used during official hours; social spaces such as a library, meeting rooms, theatres that can be used out of official working hours; and support spaces such as service spaces, administration spaces, and others.

Finn and Achilles (2016) referred to the educational environment, its appropriate scale, and its role in enhancing the educational outdoor education, by dividing it into parts proportionated to the human dimension of children, also indicated the importance of social spaces to increase social interaction, which improves the educational process.

These studies stated the dif ferent kinds of spaces in the school, which are devoted to many purposes, and addressed some affecting characteristics, such as school and class sizes according to student number (Finn, 2016).

3 Method

Investigation Step s 3.1

1 Selection of samples from (built types of local schools) in Mosul city, the sample was tested based on the most prevalent sample after holding a questionnaire at the Nineveh Education Directorate. (Figure 1)

2 Analysis of this sample (primary schools) to determine the functional shortage in the school’s components quantitatively and qualitatively. The space allocated to each student in each classroom was calculated according to the number of students occupying the educational space and social spaces, and according to the function allocated to each space, it was also clear that there is no space allocated for cultural Spaces in schools that are executed. Calculating the total area of administrative spaces and percentages of the total area of movement spaces, storerooms, and construction structures, showing the extent of the problem by comparing to the school buildings around the world according to local and international standards. (See Table 1)

3 Analysis of international examples of schools, which meet the modern trends in International learning methods, to identify its components quantitatively and qualitatively.

4 Classify local and international standards specialized in schools. Where Table (2) clarifies the quantitative deficiency by comparing the spaces allocated to each student with what is being implemented in international schools to keep pace wit h the development in educational methods and advanced education curricula and finding the qualitative shortages at local schools and calculating the spaces allocated to them. The sum represents a quantitative deficiency in building spaces. (See Table 2)

5 Make a comparison to determine the shortage in local schools in terms of functional components (quantity and quality). Table (3) represents a comparison of the spaces and functions available in local schools with the average of the International and local standards ((quantitively and qualitatively)) to diagnose the real deficiency in those schools, which in turn affects the educational process. The areas allocated to each student in educational spaces or recreational Spaces or other supportive activities in comparison to a minimum international and local standards .as shown in Table 3.

(a)Site plan

(b) Ground Floor (c) First Floor

Figure 1: Chosen sample plan for the most prevalent pattern for primary schools in the city.

Treatment Step 3.2

Identify the design strategies to fulfill the shortage of built types of local schools, using the “addition, subtraction, and substitution” mechanisms to generate several design alternatives. Figures 2, 3, 4 , and 5 show the design alternatives.

4 Result and Discussion

Analyzing a Sample 4.1

Analyzing a sample of the built type of local school (quantitatively and qualitatively), and calculating the area allocated to each student, the total area of the chosen samples is equal to 1650 m. (see Table 1).

Table 1: Analyzing a sample of a local school to determine functional components quantitatively and qualitatively.

4.2

Type of spaces

Sub Type of spaces Area (m2)/ Student Educational spaces Classrooms 1.6 Scientific Laboratories 1.6 Art Studio 1.4 Social spaces Courtyards 1.1 Open spaces 4.1 Cultural spaces 0.0 Sport spaces Open sport spaces 20 Supportive spaces Circulation spaces 15% Structure 15% Stores 0.5 % Administration spaces Administer room 15 Assistant room 15 Teachers’ rooms 20

Mechanisms to Treat the Shortage

The architects used many mechanisms to produce many new solutions (alternatives), that differ from their original forms, these mechanisms are Addition, Subtraction and Addition, Repetition, Division, Rotation, Displacement, and Internal modification. Applying treatment mechanisms to the (built types of local schools), to produce four alternatives according to probable orientation.

Table 2: ‘Identifying components in internati onal schools quantitatively and qualitatively

Type of spaces Sub Type spaces

Mohammad Al durra school

Mean according to international standards (m2)

Number of students Shortage within standards (m2) Total Shortage (m2)

Educational spaces Classrooms 1.6 2.4 360 students 0.8 288 Scientific Lab. 1.6 2.5 60 to two classes 0.9 54

Laboratories 0.0 2.3 60 to two classes 2.3 138

Open classrooms 0.0 2.4 60 to two classes 2.4 144

Art Studio 1.4 3.2 60 to two classes 1.8 108

Social spaces Courtyards 1.1 3 90 students 1.9 171

Open spaces 4.1 4.2 360 students 0.1 36

Café & Restaurant 0.0 1.7 360 students 1.7 612

Waiting Halls 0.0 0.3 180 students 0.3 54

Interior Halls 0.0 2.3 90 students 2.3 207

Cultural spaces Library 0.0 2.4 60 students 2.4 144

Poetry Club 0.0 2.5 30 to one class 2.5 75

Painting Studio 0.0 3.8 30 to one class 3.8 144

Music Studio 0.0 0.95 30 to one class 0.95 144

Acting Studio 0.0 0.95 30 to one class 0.95 144

Dancing Studio 0.0 0.95 30 to one class 0.95 144

Sport spaces Open sport spaces 20 24 60 students 4.0 240

Close sport spaces 0.0 13.9 60 students 13.9 834

Open swim. Pool 0.0 0.0 0 0.0 0.0 Close swim. Pool 0.0 0.0 0 0.0 0.0

Supportive spaces

Multi purpose hall 0.0 2.35 220 persons 2.35 517 Theater 0.0 2.2 220 persons 2.20 484

Bathroom 1.2 1.3 20 persons 0.1 2

Circulation 15% 25 % 10% 10% Structure 15 % 22.5% 7.5% 7.5% Parking 0 % 12.5% 12.5% 12.5% Stores 0.5 % 8.5% 8% 8%

Administratio n Spaces

Manager room 15 28 1 person 13 13 Assistant room 15 23 2 room 8 16 Teachers rooms 40 50 3 room 10 110 Advisor rooms 0.0 15 2 room 15 30 Offices 0.0 20 2 room 20 40

Total area Shortage 6752 m 2

Criteria for evaluation of alternatives:

Functional: Ratio of achieved area, the achieved area / the required area.

Functional: The future expansion, in means of horizontal one only, where vertical expansion has excluded since it is equal in all alternatives.

Economic: Ratio of subtracted areas to add other spaces / total areas.

Economic: Ratio of added areas / total areas.

Environmental: Orientation, a ratio of classrooms at good orientation, a ratio of classrooms at acceptable orientation, a ratio of classrooms at non acceptable orientation.

To state the relative priorities between previous criteria, a questionnaire was held for the Architects at (the office of Education in the governorate of Nineveh) and discovered that the sequence (Economic criteria, then Functional, then Environmental) represents the Office’s priorities according to many reasons ( see Table 4) The ratio of achieving the area, The ratio of classrooms in good orientation, Accessibility in terms of movement, The ratio of added areas (minimum costs), The ratio of subtracted areas to add other spaces, and the future expansion.

Table 3: Finding quantitative and qualitative shortages compared to international standards of schools

Type of spaces

Educational spaces

Sub Type spaces Mohammad Al durra school Minimum built area

Mean of the area according to standards

Minimum area

Classrooms 1.6 m2 35 m 2 2.0 m2 60 m2

Scientific Lab. 1.6 m2 51 m2 2.2 m2 75 80 m2

Laboratories 0.0 0.0 2.3 m2 70 80 m2 Open classrooms 0.0 0.0 2.0 m2 60 70 m2

Art Studio 1.4 m2 35 m2 3.5 m2 90 100 m2

Social spaces Courtyards 1.1 m2 350 m2 2.1 m2 600 700 m2

Open spaces 4.1 m2 Not designed 4.2 m2 designed

Café & Restaurant 1.2 m2 150 200 m2

Waiting Halls …… …… 0.5 m2 150 m2 Interior Halls …… …… 2.0 m2 200 m2

Cultural spaces Library 2.4 m2 200 m2

Poetry Club 2.5 m2 50 m2

Painting Studio 3.8 m2 70 m2

Music Studio 3.8 m2 70 m2

Acting Studio 3.8 m2 70 m2

Dancing Studio 3.8 m2 70 m2

Sport spaces Open sport spaces 20 m2 600 m2 24 m2 700 m2

Close sport spaces 13.9 m2 400 m2 Open swim. pool Close swim. pool …… …… …… ……

Supportive spaces Multi purpose hall …… …… 2.35 with a size of 225 person 517 m2 Theater Bathroom Each25 student=1 w.c Number 15 Each 20 students=1 w.c Number 18=25

Circulation 15% …… 22 % 12.5% Structure 15% 12.5% 22 % Parking Number 23 460 m2 Stores 0.5 % 1.6 % 1.6%

Administration Spaces Manager room 15 m2 15 m2 Number 1=28 28 m2 Assistant room 15 m2 15 m2 Number 2=23 46 m2 Teachers rooms 40 m2 40 m2 Number 5=30 150 m2 Advisor rooms Number 2=15 30 m2 Offices Number 2=20 40 m2

(a) Ground Floor

(b) First Floor (c) Second Floor Figure 2: Design Alternative#1.

(a) Ground Floor

(b) First Floor (c) Second Floor Figure 3: Design Alternative#2.

(a) Ground Floor (b) First Floor (c) Second Floor Figure 4: Design Alternative#3.

(a) Ground Floor

5 Conclusion

(b) First Floor

Figure 5: Design Alternative#4.

(c) Second Floor

The research stated many strategies with its mechanisms to improve the designs of local schools, satisfy the needed necessities, and cover the shortage. The research stated many alternatives deferent in their attitudes, functionally, environmentally, and economically speaking. The client emphasizes economic then functional then environmental criteria, therefore the Architect can orient the designing process according to the initial objectives. The research offered the potential to manipulate the design according to dif ferent attitudes. The “Double Courts” alternative in “Primary schools” seems to be the best one, depending on five criteria. This methodology can help to improve other local school types, in the di fferent attitudes.

6 Acknowledgment

The authors appreciate the scientific and financial support from Mosul University We can only extend our thanks and appreciation to the Nineveh Education Directorate and the members responsible for managing the school buildings and their employees for their untiring efforts in enriching us with sufficient information to make the research successful. As we especially thank and appreciate the administrator of the primary schools, for their action legging assistance in standing up to the reality of the situation of those schools, determining the capacity of the student’s momentum, and providing us with the data required to complete the research.

7 References

Nasser, A., Shaayi, H. (2018). Evaluation of breeding facilities according to the foundations and strategic criteria and its impact on the urban development of the city of Nasiriyah. DhiQar University Journal of Engineering Science , 9(1), 50 52.

Moore, T ., Lockney, A. (2013). School Design for Educational Performance and Design Applications Center for Architecture and Urban Planning Research : An International Journal, 5(2) 95 99.

Al Masoudi, A. (2019). The Reality of School Buildings and Their Impact on the Educational Reality of The Holy City of Karbala according to the Comprehensive Quality Standards College of Basic Education for Educational and Human Sciences, 43(2), 2034 2038.

Heritor, T., J ose, S (2009). Portugal secondary school modernization programmer.

Finn , J ., Achilles , C . (2016). Answers and Questions About Class Size: A Statewide Experiment. American Educational Research: An International Journal.27(3), 557 577.

Valkiria, N. (2008). School Building Condition for School Attendance and Academic Achievement. Journal of Environmental Psychology: An International Journal 43(2), 2034 2038.

Zhang, Y. (2015). Clever Classrooms. Report on HEAD Project. 14(1), 74 81.

Mohammed, A. (2020). Creative unconventional solutions to develop educational buildings. https://albenaamag.com

Dr.Asma H.Al Dabbagh is an Assistant Professor at the Department of Architecture College of Engineering, University of Mosul, Iraq. She got a Doctoral degree in Architecture and Theory of Architecture, Iraq. Her research is devoted to Architectural Theory and Building Type

Eng Muthanna A Mahmood is a master's candidate at the Department of Architecture College of Engineering, University of Mosul, Iraq. He got his Bachelor’ s degree in Architecture Engineering from the Mosul University of Iraq. His research focuses on the Architectural Design of Educational Buildings

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

An Experimental Based Approach Using Artificial Intelligence Algorithm for Determining the Surface Roughness by Milling Process

Afrim Gjelaj1, Besart Berisha1*, Wojciech Sitek2

1 Faculty of Mechanical Engineering, University of Prishtina, Prishtina, KOSOVA.

2Faculty of Mechanical Engineering, Silesian University of Technology, Gliwice, POLAND. *Corresponding Author (Tel: +383 49 135 073, Email: besart.berisha@uni pr.edu).

Paper ID: 13A5B

Volume 13 Issue 5

Received 14 January 2022

Received in revised form 19 March 2022

Accepted 29 March 2022 Available online 16 April 2022

Keywords: Milling; Surface roughness model; Testing of material; Optimization; Artificial intelligence

Abstract

Surface roughness plays an important role in the machining area. This work aims to investigate surface roughness with the use of main machining parameters. Steel C35 is used as workpiece material while performing experimental work with twenty one experiments, and coolant is taken as constant. The experimental model considers two ways to analyze the surface roughness using Artificial Intelligence. The firs t is the measurement of surface roughness after machining, and the second is to compare the measurement in a theoretical way.

Disciplinary: Mechanical Engineering.

©2022 INT TRANS J ENG MANAG SCI TECH.

Cite This Article: Gjelaj, A., Berisha, B., Sitek, W. (2022). An Experimental Based Approach Using Artificial Intelligence Algorithm for Determining the Surface Roughness by Milling Process. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5B, 1 11 http://TUENGR.COM/V13/13A5B.pdf DOI: 10.14456/ITJEMAST.2022.86

1 Introduction

The purpose of the experiment is to verify the coefficients and exponents based on the Taylor expression, for the surface roughness during the milling process in universal milling machines. In this way, it is possible to determine the optimal main machining parameters for conducting the experiment. The workpiece material for the case of our research will be investigated for steel C35.

The most influential factors in the research of surface roughness for prismatic workpieces are: v cutting speed, f working step and a cutting depth, as influencing factors of the process . Other factors such as the refrigerant, the geometry of the metal cutting tool, and the rigidity of the

processing system, and so these parameters in this paper are kept at a constant level because they are not the subject of their research [1 4].

Two models are developed for surface roughness depending on main machining parameters where one of the models is based on the regression model while the other model was developed with the help of artificial intelligence such as Neural Network and error of validations for this case are obtained with values 4.01% [5]. The authors present the predictive models for surface roughness Ra during the ball end milling process which were developed using RSM, GA, and GWO algorithms . After that the validity of the model was confirmed using ANOVA methods, so the model accuracy for surface roughness was around 10% due to the setup of the experiments [6].

The authors have developed the predictive models for surface roughness both for metal and aluminum using high speed milling operation [7], also other research has used artificial intelligence to predict the surface roughness into deep drilling for some steel components [8].

Effect of Various Microstructures Obtained from Heat Treatment on Machinability Behavior of Ti 6Al 4V Alloy, by drilling process [9]. This study investigates the surface roughness properties of specimens that were machined mechanically in a different way before the measuring in order to achieve a different roughness. Workpiece materials and research methods by milling machining are determined to cho ose the milling tool, main machining parameters, positioning of the workpiece, analytical model to compare the results and to predict the best surface roughness Ra with utilize of Neural Network.

2 M ethods and Material

The realization of the experiment procedure is described as follows step by step as seen in Figures 1 and 2. These experiments are included the type of material, equipment for testing the hardness of the material, saw machine, milling machine, the main machining parameters, the equipment for measuring the surface roughness, as well as Matlab software for comparing theoretical and practical results and validation of the experiment. The dimensions of the workpiece are bxhxl (62x16x200) mm, the type of material is C35, it is also determined through the device SADT Hartip 300 as in Figure 1.

Table 1 shows the chemical composition of steel C35.

Figure 1: Portable hardness tester HARTIP 3000

Table 1: chemical composition of workpiece material C35.

Elements Symbols Percent [%]

1 C 0.32 0.39

2 Si Max 0.4 3 Mn 0.5 0.8 4 Ni Max 0.4

5 P Max 0.045 6 S Max 0.045 7 Cr Max 0.4 8 Mo Max 0.1

During the experimental approach of milling process emulsion , it is used as coolant regarding in the experiment setup. The setup experiment of surface roughens is presented step by step as follow s (see Figure 2).

Figure 2: Setup experiment for surface roughness

The type of milling tool is staggered tooth side milling cutters HSSECo5, with dimensions 80x5x27 (mm), and 32 cutting teeth. These cutting tools are utilized for slot milling and parting off, or when only the sides of the workpiece are to be machined in straddle setups, which are described in their characteristics in Table 2 [11, 12].

Table 2: Cutting tool characteristics.

Type N

Milling cutter design standard DIN 1834

Cutting tool material HSSE Co5

Cutting edge diameter 80 [mm]

Number of teeth Nz 32

Bore diameter 27 [mm]

Width of cutting edge 5 [mm]

Artificial intelligence such as Neural networks is used for our experiment to determine the surface roughness for the milling process based on the main machining parameters (cutting speed v, feed rate f , and depth of cutting a). The diagram of surface roughness using Artificial Intelligence AI, based on the number of inputs, hidden layers, and till output functions for our case Ra (see Figure 3).

Figure 3: Diagram of surface roughness Ra, using

AI .

Matrix plan for the realization of the experimental part based on the main machining parameters, universal milling machine, metal cutting tool, etc. Table 3 are showed the matrix plan with main machining parameters and experimental plan. Also, are presented the measurement values of surface roughness after the cutting process regarding the experiment, and the measurement value is calculated to compare the practical part of the experiment with the theoretical part.

Table 3: The level of main machining parameters for realization of experiment.

Inputs Cutting speed (V=X1) Feed rate (f=X2) Depth of cut (a=X3)

1 X1max = 255 X2max = 0.3 X3max = 1.5

2 X1mid = 160 X1mid = 0.2 X1mid = 1.0

3 X1min =100 X1min = 0.13 X1min =0.5

Determining the surface roughness function and selecting the level of input sizes as well as determining the mathematical model for the surface roughness of the milling process as output function is given by the expressions as

�������� = ���� ���� ����1 ���� ����2 ��������3 (1).

The expression can take the f orm as follow:

�������� = ���� · ����1 ^����1 · ����2 ^����2 · ����3 ^����3 (2).

In Table 4, V is showed the tensile strength for nominal thickness like our experiment with dimension 200x62x16mm, and measurement of hardness with mid value HB=166, as showed in Table 4, as well as from a theoretical aspect it is read the value of tensile strength Rm as in Table 4, with value 550 Mpa.

Table 4: the tensil e strength RM.

Nominal thickness [mm] To 16 16 100 100 250 250 500

Rm [Mpa] 550 520 500 470

3 Results and Discussion

In the following steps are presented the results for testing material and surface roughness. Using the device HARTIP 3000, it makes nine measurement s and after that is automatically calculated the middle value and is compared with Vickers hardness (HV), hardness Brinell (HB) and Rock well hardness HRB. Measurement of hardness Brinell (HB), by a plate with a nominal thickness of 16 mm, after nine measurements have been achieved the average value of nine measurements HB = 166, based on Figure 1, when determining the type of steel as C35. Hardness measurements for the material selected for the surface roughness analysis, then the nominal D values of the hardness measurements are given below and also compared to HV, HB and HRB as in Table 4

Table 4: Hardness measurement for nominal value D and HV, HB, HRB.

Test nr. D HV HB HRB

1 662 169 166 85.6

2 682 191 188 90.7

3 671 179 176 88.0

4 620 127 126 71.6

5 656 162 160 83.9

6 682 191 188 90.7

7 630 136 135 75.5

8 670 181 178 88.5 9 683 192 189 90.9

Mid value 662 169 166 85.6

This work measures surface roughness Ra, Rt and Rq, whereas we have the choice to present and analyze surface roughness Ra. As a device for measurement of surface roughness it utilizes the measuring tool from the company Mitutoyo type SurfTest SJ 301, also some input data are determined into the device as Standard ISO 1197, range AUTO, profile R, N = 5, Cut off = 2.5, filter Gauss [10].

Scientists and engineers mainly collect the data in order to determine the nature of a relationship between theoretical and practical experiments. The experiment thus generates various data that could be denoted (x1, xn, . . . , xi+1), based on the machining parameters. The equation can be used for many purposes in the field of manufacturing such as surface roughness, measurement of temperature, cutting force, etc [15].

After some calculation of regression coefficient (B = 1.085; β1 = 0.096; β2 = 0.022; β3 = 0.011) and combination of value for main machining parameters the expression is obtained, �������� = 1 085 · ����1 ^0 096 · ����2 ^0 022 · ����3 ^0 011 (3).

The investigation of the measured profile and R Profile of surface roughness is presented with values Ra11 = 1.50 µm, Rz11 = 9.0 µm and Rq11 = 1.86 µm. Completely based on the input data of

the Mitutoyo measuring device such as Profile R, cut off 2.5 mm, filter gauss and range AUTO as seen in the output of measurements in Figure 4.

Figure 4 : Measurement of surface roughness with Mitutoyo device.

Table 5 presents an experimental measurement of surface roughness Ra, Rq and Rt.

Table 5: Measurement of surface roughness Ra, Rq and Rt Nr. Exper. Spindle speed n [rpm] Feed rate f [mm/min] Depth of cut [mm] Ra [µ m] Rq [µ m] Rt [µ m]

1 100 13 0.5 1.03 1.30 6.41 2 100 13 1 1.26 1.58 7.73 3 100 13 1.5 1.69 2.07 8.13 4 160 13 1.5 1.78 2.28 12.66 5 160 13 1 1.43 1.73 7.77 6 160 13 0.5 1.59 2.03 9.92 7 255 21 0.5 1.41 1.89 11.07 8 255 21 1 1.70 2.06 8.91 9 255 21 1.5 1.84 2.26 10.69 10 160 21 1.5 1.79 2.12 9.93 11 160 21 1 1.50 1.86 9.00 12 160 21 1 1.18 1.51 6.86 13 160 21 1 1.71 2.06 9.98 14 160 21 1 1.42 1.87 10.41 15 100 33 0.5 1.91 2.33 10.33 16 100 33 1 1.42 1.72 7.98 17 160 13 0.5 1.75 2.23 11.53 18 160 33 1 1.69 1.99 8.43 19 255 13 0.5 1.29 1.63 7.97 20 255 21 1.5 1.16 1.37 6.72 21 255 33 1.5 1.20 1.56 8.35

The model is significant when it fulfilled the conditions, and whe n the surface roughness prediction error is taken with five (5) percent as a value for orientation Ft = 10.01 and calculation of Fr, wit h value 2.406, as �������� < �������� (4).

After the calculation, the results are achieved as 2 406 < 10 01 (5).

Table 6 showed the matrix plan and results of the natural logarithm of measurement surface roughness only for parameter Ra.

Table 5: Measurement of surface roughness Ra, Rq and Rt. Nr. Exper. X1 X2 X3 Measurement value Ra [µ m] Natural algorithm Y = lnRa Theoretical value Ra [µ m]

1 1 1 1 1.03 0.03 1.401

2 1 1 0 1.26 0.231 1.41

3 1 1 1 1.69 0.525 1.419 4 0 1 1 1.78 0.577 1.484 5 0 1 0 1.43 0.358 1.475 6 0 1 1 1.59 0.464 1.466

7 1 0 1 1.41 0.344 1.549

8 1 0 0 1.70 0.531 1.558 9 1 0 1 1.84 0.61 1.568 10 1 1 1 1.79 0.582 1.584 11 0 0 0 1.50 0.405 1.49 12 0 0 0 1.18 0.166 1.49 13 0 0 0 1.71 0.536 1.49 14 0 0 0 1.42 0.351 1.49 15 1 1 1 1.91 0.647 1.431 16 1 1 0 1.42 0.351 1.44 17 0 1 1 1.75 0.56 1.466 18 0 1 0 1.69 0.525 1.506 19 1 1 1 1.29 0.255 1.533 20 1 0 1 1.16 0.148 1.568 21 1 1 1 1.20 0.182 1.584

Table 6 presents the analysis of relative errors, squares validation, mean squared and absolute errors using the Matlab software, such as the neural network.

Table 6: Analysis of relative errors.

Analysis of errors and squares Values

Relative mean error (RME) 1.8093

R squared validation 28.24

Mean squared (MSE) 3.2737

Mean absolute errors (MAE) 0.47333

A new method of measurement of surface roughness is presented based on a color distribution statistical matrix, also as an optimal selection of machining parameters for the milling process is described [16, 17].

Figure 5 shows the 21 experiments of surface roughness that are generated in depend on measurement data, where blue points presented the practical measurement and yellow points are a predicted model in a theoretical way.

Figure 5: Comparison of the surface roughness value Ra for theoretical and practical.

Results are explained in Figure 6 for four measurements and their comparison from practical to theoretical way. Figure 6(a) show s the measurement of surface roughness ��������1 which depended on the measurement of surface roughness in a practical way ��������1���� =1.03 µm, regarding the theoretical value of surface roughness ��������1���� =1.401 µm. Also, the diagram of Figure 6 is obtained depending on the main machining parameter as cutting speed (Vc m/min), depth of cut (mm) , and feed rate (f mm/min) in this case is constant.

Figure 6(b) presents also surface roughness ��������2 , in the function of cutting speed and depth of cut, where feed rate is taken as constant.

Figure 6(c) shows the measurement of surface roughness for experiment number Ra11, where the main machining parameter (cutting speed = 40 m/min, feed rate = 0.20 mm/min, and depth of cut = 1mm), are get for this case with a middle value. With these parameters are realized four experiment ��������11 = 1.50 µm, ��������12 = 1.18 µm, ��������13 = 1.71 µm and ��������14 = 1.42 µm. Whereas, the theoretical value for these experiments will be as follows ��������11 = ��������12 =��������13 = ��������14 = 1.49 µm.

a) b) c) d)

Figure 6: (a) Measurement of surface roughness ��������1 = 1.401 µm (where cutting speed, feed rate, and depth of cut are taken by minimum level); (b) Surface roughness by experiment ��������2 = 1.41 µm (where cutting speed and feed rate is taken as minimum level afterward depth of cut is taken at middle level); (c) Obtained results of surface roughness ��������11 = 1.49 µm, where three level s of main machining parameters are taken as the middle level ; (d) Surface roughness by experiment ��������17 = 1.466 µm (where cutting speed is taken as middle level, afterward feed rate and depth of cut are taken by minimum level).

However, practical values are almost never the same and their comparison with theoretical ones is variable. Figure 6(c) showed the diagram in the function of cutting speed Vc (m/min) and feed rate f (mm/min) as follow s.

The measurement of surface roughness Ra17 is presented in the func tion of cutting speed (V) and feed rate (f) Figure 6(d).

Also the expression for calculation of surface roughness for the case of ��������1 , ��������2 , ��������11 and ��������17 is shown as follow s, regarding Tables 4 and 5.

The calculation of ��������1 with level code (X1 min, X2 min and X3 min) , ��������1 = 1 085 · ����1������������ ^0 096 · ����2������������ ^0 022 · ����3������������ ^0 011 = 1 401 [�������� ] (6). The calculation of ��������2 , based on the level code of the table (X1 mid , X 2min and X3 mid) ��������2 = 1.085 · ����1������������ ^0 096 · ����2������������ ^0 022 · ����3������������ ^0 011 = 1.41 [�������� ] (7).

The calculation of surface roughness with utilize of level code, ��������11 = 1 085 · ����1������������ ^0 096 · ����2������������ ^0 022 · ����3������������ ^0 011 = 1 49 [�������� ] (8).

Utilize of calculation for case of level code based on Table 5 (X1mid, X2min and X3min) ,

��������17 = 1 085 · ����1������������ ^0 096 · ����2������������ ^0 022 · ����3������������ ^0 011 = 1 466 [�������� ] (9).

Mathematical modeling and multi response optimization is used for improving machinability with using of artificial intelligence [18].

Figure 6 shows the 3D diagrams regarding the measurement and calculations based on the Equations above.

4 Conclusion

The paper mainly is focused on analyzing surface roughness also and another problem is measurements of the hardness of steel C35. Measurement of surface roughness with device Mitutoyo for the case of a milling operation is presented. T his work performs twenty one measurements depending on the main machining parameters. Where are taken maximal, middle and minimal values for cutting speed, feed rate, and depth of cutting, also are combined and for experiments Ra11,…, Ra14 are taking the middle value for three machining of parameters. Measurement of hardness steel for material C45 is obtained through device Hard tip Tester 3000, with value HB = 166. The measurement of value for nominal hardness is compared from practical to the theoretical way such as Hardness Brinell (HB), Hardness Vickers (HV) and HRB. The best value of surface roughness is for case one Ra1 = 1.03 µm. Afterward are presented diagrams for four experiments Ra1 , Ra2, Ra11 , Ra15 and Ra17, which are depending on the main machining parameters.

5 Availability o f Data And Material

Data can be made available by contacting the corresponding author

6 References

[1] Hanief M, Wani MF. Effect of surface roughness on wear rate during running in of En31 steel: Model and experime ntal validation. Materials Letters. 2016;176:91 3. DOI: 10.1016/j.matlet.2016.04.087

[2] Pfeifer T, Kurokawa S, Meyer S. Derivation of parameters of global form deviations for 3 dimensional surfaces in actual manufacturing processes. Measurement. 2001;29(3):179 200. DOI: 10.1016/S0263 2241(00)00038 5

[3] Altintaş Y, Budak E. Analytical prediction of stability lobes in milling. CIRP annals. 1995;44(1):357 62. DOI: 10.1016/S0007 8506(07)62342 7

[4] Simunovic G, Simunovic K, Saric T. Modelling and simulation of surface roughness in face milling. International Journal of Simulation Modelling. 2013;12(3):141 53. DOI:10.2507/IJSIMM12(3)1.219

[5] Sekulic M, Pejic V, Brezocnik M, Gostimirović M, Hadzistevic M. Prediction of surface roughne ss in the ball end milling process using response surface methodology, genetic algorithms, and grey wolf optimizer algorithm. Advances in Production Engineering & Management. 2018;13(1):18 30. DOI: 10.14743/apem2018.1.270

[6] Stephenson DA, Agapiou JS. Metal cutting theory and practice. CRC Press; 2018. DOI: 10.1201/9781315373119

[7] Flores V, Keith B. Gradient boosted trees predictive models for surface roughness in high speed milling in the steel and aluminum metalworking industry. Complexity. 2019. DOI:10.1155/2019/1536716

[8] Bustillo A, Correa M. Using artificial intelligence to predict surface roughness in deep drilling of steel components. Journal of Intelligent Manufacturing. 2012;23(5):1893 902. DOI: 10.1007/s10845 011 0506 8

[9] Noghani, M, Bayat, O, Mo ghadam, O, Mehrizi, V. Effect of Various Microstructures Obtained from Heat Treatment on Machinability Behavior of Ti-6Al -4V Alloy International Journal of Engineering 2022;35(1):184 190. DOI: 10.5829/ije.2022.35.01A.11

[10] Mitutoyo. Europen Metrology Solutions from Mitutoyo. 2022. https://mitutoyo.eu/en_us (accessed January 2022).

[11] Kibbe, R, Meyer, R, Stenerson, J, Curran, K. Machine tool practices 11th Ed.; Pearson, Boston, 2020:497 558.

[12] Orion. Narrow disc milling cutter HSSE Co 5 : Type N 2017. https://media.witglobal.net/stmedia/hahnkolb/documents/LANG_en/HK 14103365.pdf

[13] Matras A. Research and Optimization of Surface Roughness in Milling of SLM Semi Finished Parts Manufactured by Using the Different Laser Scanning Speed. Materials. 2019;13(1):9. DOI: 10.3390/ma13010009

[14] Wang Y, Wang Y, Zheng L, Zhou J. Online Surface Roughness Prediction for Assembly Interfaces of Vertical Tail Integrating Tool Wear under Variable Cutting Parameters. Sensors. 2022; 22(5):1991. DOI: 10.3390/s22051991

[15] Navidi WC. Statistics for Engineers and sciences. 3rd Ed. , McGraw Hill, 2014:592 658.

[16] Liu J, Lu E, Yi H, Wang M, Ao P. A new surface roughness measurement method based on a color distribution statistical matrix. Measurement. 2017;103:165 78. DOI: 10.1016/j.measur ement.2017.02.036

[17] Narooei, KD , Ramli, R. Optimal Selection of Cutting Parameters for Surface Roughness in Milling Machining of AA6061 T6 International Journal of Engineering 2022;35(6):1170 1177. DOI: 10.5829/ije.2022.35.06c.08

Dr. Afrim Gjelaj is an Assistant Professor at the Department of Manufacturing and Automation. He got his Doctoral degree (Dr.Sc) in the field of Manufacturing and Automation frm the University of Maribor, Faculty of Mechanical Engineering, Maribor, Slovenia. His researches are Machining Processes, Modern Manufacturing, Reverse Engineering, CAD/CAM, CNC and additive Technology.

Dr. Wojciech Sitek, is an Associate Professor at the Department of Fundamentals of Machinery Design, at Faculty of Mechanical Engineering, Silesian University of Technology, Gliwice, Poland His researches are Mechanical Materials, Artificial Intelligence, Composite Materials, Manufacturing Processes, and Modelling

MSc. Besart Berisha (Ph.D student) is a Teaching Assistant at the Department of Manufacturing and Automation, Univers ity of Prishtina, Kosova. He got his Bachelor’s and Master’s degrees from the Faculty of Mechanical Engineering, University of Prishtina, Kosova. His research focuses on the Manufacturing and Design of Products, Hydraulics and Pneumatics.

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

Accounting Disclosures of Related Parties’ Transactions and Investment Risks

Elneel Adow1*

Abstract

Accounting disclosure information; Investment risk, Support investment decision; Regular investment risk; Irregular investment risk; Competitive advantage; Impact of accounting disclosure.

The company provides accounting information by various mandated and different means. These accounting disclosures are compulsory by the national legislation, government regulations, accounting GAAPs, and international financial reporting standards (IFRS) with the objectives of financial reporting. However, ‘Accounting disclosures’ are the primary sources of providing information to the stakeholders and Investors. It helps the users in decision making to achieve the best possible allocation of available economic resources, investment of funds, and ac cessing investment risks. This study examines the impacts of accounting disclosure of related parties’ transactions on the regular investment risks and irregular investment risks and also the competitive advantage. The result indicates that there is a posi tive correlation between the disclosure of the related parties as an independent variable, regular investment risks, and irregular investment risk as a dependent variable. Disciplinary: Management Science (Investment and Finance Management). ©2022 INT TRANS J ENG MANAG SCI TECH.

1 Introduction

Accounting disclosure is sharing accounting information and financial data for clear and reliable reporting to the investors and stakeholders. For making transparency, and complete reporting, accounting disclosures are necessary. It is also necessary for the investors and other stakeholders to interpret the accounting data and analyze risk and forecast future profit on investment. T he International Accounting Standards (IAS) 24 focuses on ensuring that the financial statements of a company include the disclosures required to emphasize the fact that “its financial position and profit or loss could have been affected by the existence of related parties and by transactions and outstanding balances, including liabilities, with related parties”.

However, Accountants are the gatekeepers of the financial markets (Wallman, 1995). 'Accounting Disclosures' gives information about the financial policies of a business. It is useful for both the present investors and also for potential investors. The accounting disclosure includes balance sheets, income statements, cash flow statements, changes in equity statements, and notes. According to International Financial Reporting Standards (IFRS), all the accounting policies are to be publicized. It allows transparency in the system and helps investors access the risk before the investment. Accounting disclosure is an effective way of exchanging information between management and external users, considering the separation of ownership from control. The consequence of information asymmetry and agency issues between management and investors is the need for accounting disclosure (Healy and Palepu, 2001).

2 Literature Review

Lambert et al. (2007) examined the relationship between accounting information and the cost of capital. The researchers are developing a model compatible with the pricing model for capital assets and multiple securities. The model shows that both directly and indirectly, the consistency of accounting information influences the cost of capital. Whereas, The relationship between the environmental influences selected (the degree of economic growth, the shape of the economy, the size of the equity market, the operation of the equity market, and the dispersion of equity ownership in the equity market) and the disclosure criteria for 35 stock exchanges in various countries. The overall results show that stock exchange disclosure criteria relate to the environmental factors selected in different countries (Adhikari & Tondkar, 1992). The real effect of accounting measures and disclosure on real decisions focuses on a firm's investment efficiency, derivative transactions, and assets portfolios. The results concluded that accounting standards and empirical study are necessary to find the real effects of accounting measures to generate sharper and novel insights. (Kanodia & Sapra, 2016).

On the other hand, the research on the impact of accounting disclosure on value significance in multiple levels of the firm life cycle was being investigated on 101 companies listed on the Tehran Stock Exchange (Iran) between the years 2005 to 2011 were chosen as samples. In the business life cycle, the sample firms were classified as Introduction, growth, maturity, and Shake Out (decline) in four phases by taking advantage of the cash flow trend as a proxy for the business cycle (Mashayekhi et al., 2013). Similarly, the disclosure practices of corporate annual reports in the five ASEAN countries. The study aimed to reveal that the accounting disclosures are conducive to accounting harmonization in the ASEAN region. The result indicates that the public companies in ASEAN thought likely to benefit from operating the business (Craig & Diga, 1998). Cooke (1998) reviewed a variety of improvements, including the protocol for Rank Regression. Due to the inherent properties of ranks and their use in regression analysis, an extension is proposed, providing an alternative mapping that replaces the data with their standard scores. The usual approach to scores retains the benefits of using ranks, however, particularly in testing hypotheses, it has other desirable features. Regressions based on untransformed data, the log odds ratio of the

dependent variable, and the ranks and regressions using standard ratings are applied to information disclosure data in the annual reports of companies in Japan and Saudi Arabia. Regression using usual scores has several benefits over ranks, which partially depend on the data structure. ( Cooke, 1998).

Pavlopoulos et al. (2019) examined the association between the quality of integrated reporting disclosure and a firm's valuation. The study found a positive relation between firm performance and integrated disclosures. In addition, the researchers concluded that there is a positive association between earning quality and integrated reporting. Ahmed et al. (2011) discussed the disclosure or reporting practices of accounting changes in the annual report of a listed finance company on the Dhaka ( Bangladesh) stock exchange (DSE). The study examined the practices of DSE listed companies on accounting change flow for the period of one decade (1999 to 2008). The study also discussed reporting accounting changes, changes in equity, earnings per share, firm size, and audit firm. The study found a significant relationship between disclosure and audit firms. Hossain (2008) did an empirical analysis of the degree to which the listed banking companies in India have both mandatory and voluntary disclosure. The results of the relationship between company specific attributes and complete disclosure of the sample firms, i.e., compulsory and voluntary, are also published. However, the study indicated that when disclosing mandatory items, the mean score is 88, while the average score for voluntary disclosure is 25. The findings also indicate that scale, profitability, board composition, and market discipline variables are relevant, and other factors such as age, business maturity, and asset in place are negligible to explain the degree of disclosure.

The research aims to study the concept and impact of the accounting disclosure of related parties' transactions and regular investment risks and irregular investment risks. This study also investigates the impacts of accounting disclosure on related party transactions and the competitive advantage. Thus, thi s study evaluates to test the validity of the hypotheses:

H#1: There is a relationship between the disclosure of related parties and regular investment risks. H#2: There is a disclosure of related parties and irregular investment risks.

Accounting Disclosure Independent Variable

Investement Risk

Competitive Advantage

Dependent Variable

Figure 1: Conceptual Model of Variables and Hypothesis

3 Research Methodology

The study follows the deductive approach in formulating the problem, hypotheses, and study dimensions. The inductive approach was applied in testing the study's hypotheses, whereas the descriptive analytical approach was applied in the field study.

3.1 Data collection

For the research, primary data were collected through the questionnaire from various banks placed in Khartoum city during 2019, while the secondary data sources were books, references, periodicals, and university thesis. The study population includes accountants in Sudanese commercial banks in Khartoum city,165 questionnaires were distributed, and 150 questionnaires were retrieved, with a 91% recovery rate.

4 Results

4.1 Reliability Test

Alpha Cronbach coefficient test was used to measure the stability of questionnaire questions, and simple linear regression was used to test the study hypotheses.

The value of the Cronbach's rat for all the study axes is greater than (80%), which means a high degree of "internal stability" for all the questionnaire hypotheses, whether this is for each axis separately or for all the axes of the questionnaire. This confirms that the study's measures enjoy internal stability for their phrases, which enables us to rely on these answers in achieving the study's goals and analyzing its results.

4.2 Regression Analysis

The formulated hypothesis for the given study has been tested by using a regression model through SPSS software. In this study, hypotheses have been formulated and analyzed to meet the research objectives. To validate H#1, a simple linear regression is used in constructing the model where the disclosure of the related party as an independent variable (X), and the regular investment risks (Y) as a dependent variable, and Table 1 shows .

Table 1: Simple linear regression analysis results for the first hypothesis Statistical significance Sig. T test Regression Coefficients

Significance 0.000 7.032 2.083 Significance 0.000 7.075 0.492 0.507 (R) 0.457 ( ) 100.058 (F) test Y1= 2.083 + 0.492x

The result of Table 1 shows a direct correlation between the disclosure of related parties as an independent variable and regular investment risks as a dependent variable, where the values of the simple correlation coefficient (0.507). The coefficient of determination value reached (0.457),

and this value indicates that the disclosure of related parties (independent variable) impacts (45.7%) of regular investment risks (dependent variable). Whereas, the simple regression model was significant, as test value (F) reached (100.058), which is a function of significance level (0.000) at β=2.083. Average regular investment risks when disclosure of related party is zero at β 1 =0.492. In case of increased disclosure of related parties by one unit, the competitive advantage will increase by 49.2%. From the above, it is clear thatH#1 has been validated ( sig. <0.05).

To validate H#2, a simple linear regression is used in constructing the model where the disclosure of related parties independent variable (X), and irregular investment risks (Y2) as a dependent variable, and Table 2 illustrates this.

Table 2: Simple Linear Regression Analysis results for H02

Statistical significance Sig T test Regression Coefficients

0

ˆ β 1

ˆ β 2 R

Significance 0.000 7.544 2.051 Significance 0.001 7.793 0.498 0.485 (R) 0.354 ( ) 119.727 (F) test Y2= 2.051 + 0.498x

Table 2 indicates a direct correlation between the disclosure of related parties as an independent variable and irregular investment risks as a dependent variable, where the values of the simple correlation coefficient (0.485). The coefficient of determination value reached (0.354), and this value indicates that the disclosure of related parties (independent variable) impacts (35.4%) of irregular investment risks (dependent variable). The simple regression model was significant, as the test value (F) reached (119.727), which is a function of significance level (0.001) at β=2.051. The average irregular investment risks when disclosure of related party zero at β1=0.498: Increased disclosure of related party, one unit, which increases the irregular investment risks by 49.8. The result indicates that H#2 has been validated (sig. < 0.05).

5 Conclusion

The present study has evolved the view on accounting disclosures of related parties in regular and irregular investment risks. The study is concerned with the stakeholder's accounting disclosures and their impact on the investment risks. The result of the study proves that average regular and irregular investment risks have a positive relationship. In other words, the accounting disclosure of the related party increases the irregular investment risk by 49.8 on one unit and the regular income effect by 49.2 on a single unit. However, this research has many limitations. In the study on 150 Sudanese commercial banks in Khartoum city chosen disclosure items are the report's subject. In addition, the choice of things does not reflect the degree of significance perceived by users of financial statements, and the coding strategy is subject to coder bias. The study is confined only to the Sudan country in banking companies and economies. Therefore, the findings and

conclusions' implications should be interpreted with caution despite these possible limitations. Future research should discuss the disclosure of investments risk in other developed countries and examine both the quality and quantity of the disclosure of investments risk.

6 Availability o f Data and Material

Data can be made available by contacting the corresponding authors

7 Acknowledgments

This research is supported by the Deanship of Scientific Research at Prince Sattam bin Abdulaziz University Alkharj under the Project No. 18260/02/2021

8 Referen ces

Adhikari, A., & Tondkar, R. H. (1992). Environmental factors influencing accounting disclosure requirements of global stock exchanges. Journal of International Financial Management & Accounting , 4(2), 75 105.

Ahmed, A. A. A., Wahiduzzaman, K., and Shakawat, H. M. (2011). Reporting Practice of Accounting Disclosure on Changes in Listed Companies of Bangladesh ASA University Review, 5(1), 83 96.

Cooke, T. E. (1998). Regression analysis in accounting disclosure studies. Accounting and business research , 28(3), 209 224.

Craig, R., & Diga, J. (1998). Corporate accounting disclosure in ASEAN. Journal of International Financial Management & Accounting , 9(3), 246 274.

Healy, P. & Palepu, K. (2001). Information Asymmetry, Corporate Disclosure, and the Capital Markets: A Review of Empirical Disclosure Literature. Journal of Accounting and Economics, 31, 485 520

Hossain, M. (2008) The Extent of Disclosure in Annual Reports of Banking Companies: The Case of India European Journal of Scientific Research , 23 (4), 660 681

Ka nodia, C., & Sapra, H. (2016). A real effects perspective to accounting measurement and disclosure: Implications and insights for future research. Journal of Accounting Research , 54(2), 623 676.

Lambert, R., Leuz, C., & Verrecchia, R. E. (2007). Accounting information, disclosure, and the cost of capital. Journal of accounting research , 45(2), 385 420.

Mashayekhi, B., Faraji, O., Tahriri, A. (2013). Accounting Disclosure, Value Relevance and Firm Life Cycle: Evidence from Iran. International Journal of Economic Behavior and Organization , 1(6), 69 77. DOI: 10.11648/j.ijebo.20130106.1

Pavlopoulos, A., Magnis, C., & Iatridis, G. E. (2019). Integrated reporting: An accounting disclosure tool for high quality financial reporting. International Business and Finance , 49, 13 40.

Wallman, S. M. (1995). The future of accounting and disclosure in an evolving world: The need for dramatic change. Accounting Horizons, 9(3), 81.

Dr.Anass Hamad Elneel Adow is a Lecturer at Prince Sattam Bin Abdulaziz University, Al Kharj, Saudi Arabia. He holds a PhD from Alzaiem Alazhari University, Sudan. His research areas are Accounting and Finance, Business Administration and Economics.

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

Tackling the Pandemic: A Knowledge Management Perspective

Fallatah1*

Abstract

The current coronavirus pandemic represents a huge challenge for nations and organizations around the world. The present paper discusses how knowledge management could be applied to guide organizations during such a traumatic event. Specifically, building upon Mitroff’s model of crisis management, the paper asserts that the acquisition, creation, sharing, utilization, and storing of knowledge are essential for organizations as they deal with the pandemic. The paper suggests some required organizational, team, and individual requirements that, when appropriately available, should help organizations in their knowledge management efforts. Disciplinary: Management, Knowledge Management, Crisis Management, Technology and Innovation ©2022 INT TRANS J ENG MANAG SCI TECH. Cite This Article: Fallatah, M. I., (2022). Tackling The Pandemic: A Knowledge Management Perspective. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5D, 1 10. http://TUENGR.COM/V13/13A5D.pdf DOI: 10.14456/ITJEMAST.2022.88

COVID 19; Knowledge sharing; Knowledge creation; Knowledge acquisition; Crisis management.

1 Introduction

The coronavirus pandemic (Covid 19) and its subsequent variants represent a once in a lifetime crisis that organizations of all kinds need to overcome. It has unfolded with an extreme speed and is characterized by a high level of uncertainty that increases the already huge challenges usually associated with crises (Baker et al, 2020). In the business world, many organizations of all sizes have been struggling. Some have been closed, and others have been forced to mass layoffs (Alfaro et al, 2020; Bartik et al, 2020). To survive, leaders around the world must have the self awareness to react quickly and have a solid system in their organizations to cope with such traumatic events (Carmeli & Schauboerck, 2008; Dwivedi, 2020; Garcia, 2006; He et al., 2021). In the current paper, knowing the importance of knowledge as a source of competitive advantage and the role of organizations to integrate specialized knowledge (Grant, 1996), I discuss

the role of knowledge management in managing traumatic crises. Knowledge management, defined as the organizational process of acquiring, creating, sharing, and storing knowledge (Alavi & Leidner, 2001; Darroch, 2003), has been growing rapidly as a field of study (Serenko & Dumay, 2017). Specifically, its impact on managing crise s has been much discussed in the literature (e.g. Wang & Belardo, 2005).

The Mitroff crisis management model is used to illustrate the phases that organizations go through in crises (Mitroff, 1994). The role of several knowledge management activities in managing crises is explained in the extant paper to act as a guideline for organizations.

2 Lit e rature Review

2.1 Crisis Management in Organizations

An organizational crisis is defined as a low probability, high impact event that threatens the viability of an organization, which suggests a swift decision (Pearson & Clair, 1998). According to the literature, two conditions surround crises (Pauchant & Mitroff, 1992). First, they disturb the entire system, and the manager's assumptions are challenged. Second, they cause a serious threat to the survival of the organization. The coronavirus pandemic is, indeed, a crisis that threatens organizations and requires quick decisions. Therefore, managing such a crisis effectively is essential for organizations to survive (Mitroff et al., 1987). Pearson and Clair (1998) define crisis management as “ a systematic attempt by organizational members with external stakeholders to avert crises or to effectively manage those that do occur.” It is impossible to prevent all crises, but organizations can build a systematic way to manage them effectively (Mitroff et al, 1987).

Learning 4.Recovery

Figure 1: Mitroff’s Five Phases of Crisis Management

The literature suggests that crisis management goes through five phases: signal detection, preparation and prevention, damage containment, recovery, and learning (Mitroff, 1994; Pearson & Mitroff , 1993). Figure 1 depicts the five phases of crisis management.

the organization. Next, in the third phase, Damage Containment is a phase after the crisis already has occurred. It involves making sure the crisis is contained and as many areas of the organization are safe. The fourth phase is Recovery , which emphasizes returning to normal operations as soon as possible. Lastly, after recovering from the crisis, Learning is the final phase, where the crisis should be reviewed and analyzed so the organization can improve its crisis management skills for future events.

During crises, organizations need to act quickly to mitigate the damages. Making timely decisions requires having the right knowledge at the right place and time. Hence, knowledge management is key in crisis management.

2.2 Knowledge Management in Organizations

The knowledge based theory of the firm asserts that knowledge is o ne of the most valuable resources and that firms are repositories of knowledge that needs to be integrated (Kogut & Zander, 1996; Grant, 1996). Knowledge could be acquired from the environment or created by the organization internally.

The literature informs us that knowledge resides within individuals (Polanyi, 1962; 1966), and that creation of new knowledge comes about through interactions among individuals (Fleming, 2001; Nonaka, 1994; Nelson & Winter, 1982; Polanyi, 1966; Rosenkopf & Nerkar, 2001; Schu mpeter, 1934). Such interactions lead to the exchange of diverse information that each individual holds (McFadyen & Cannella, 2004; Nahapiet & Ghoshal, 1998; Zack et al., 2009). At the firm level, knowledge based theories assert that the main role of firms when it comes to knowledge management is to combine, coordinate, and integrate individual knowledge to form a cumulative firm knowledge (Grant, 1996; Nelson & Winter, 1982, Kogut & Zander, 1996; Roos et al., 1997). That being said, firms are not equal in their abilities to manage knowledge, and the literature suggests that some critical resources are behind such differences. Those resources are related to the three dimensions of knowledge: human, relational, and structural (firm) knowledge (Bontis et al. , 2000; Edvinsson & Malone, 1997; Sveiby, 1997)

First, as stated earlier, knowledge resides within individuals (Polanyi, 1962; 1966). It follows that human capital, defined as the stock of knowledge that individuals within the firm possess, is paramount for organizations (Bontis et al, 2000; DeCarolis & Deeds, 1999; Smith, Collins, & Clark, 2005). It is based on the quantity and quality of individual knowledge that firms are able to find basic knowledge to combine or integrate in order to have an overall firm knowledge. Hence, firm knowledge is influenced, at least partially, by the stock of knowledge of their employees.

Second, the relationships that employees have among each other within the firm also represent an integral resource for organizational knowledge. While the relational capital in the knowledge management literature focuses, for the most part, on the knowledge that organizations receive from external stakeholders (Roos et al, 1997), employees could gain knowledge from each other, whether from other employees from the same functional unit or other units within the organization. In the network literature, such relationships are depicted as ego networks, defined as

the set of alters to which each employee is directly tied (Nahapiet & Ghoshal, 1998). Networks are critical for knowledge acquisition, sharing, and creation because they represent a key element for knowledge exchange (Bouty, 2000; McFadyen et al., 2009; Nahapiet & Ghoshal, 1998; Wang, 2016). Specifically, networks facilitate the process of knowledge flow among employees and provide a mechanism through which employees can share their distinctive knowledge. Accordingly, firms in which employees are well connected and have effective relationships to exchange information tend to be more likely t o acquire, share, and create knowledge.

Third, structural capital refers to organizational knowledge that is embedded in its routines, processes, and systems (Bontis et al, 2000; Roos et al, 1997). Hence, it is an essential capital that enables firms to manage knowledge. Firm routines are integral not only in facilitating knowledge flow among individuals but also in storing and organizing the employees’ collective knowledge to form organizational knowledge (Hargadon & Fanelli, 2002). Importantly, when employees, especially knowledge workers, leave an organization, their tacit knowledge is typically lost (Fallatah, 2020). Yet, firm routines and processes tend to mitigate the effect of such a loss, because each individual’s knowledge is embedded within those routines (Nelson & Winter, 1982; Roos et al, 1997). This is better articulated by resource based theory (Barney, 1991), which states that the resources that each firm possesses are the main drivers of their performances. Thus, the routines that each firm goes through in the knowledge management process are firm specific and, as a firm resource, are influential in the effectiveness of firms’ knowledge management.

2.3 Knowledge Management During Crisis

Crises have different phases, and managing knowledge requires different types of knowledge management activities in each phase. Table 1 illustrates the roles of various knowledge management activities during the crisis management phases.

Table 1: The Role of Knowledge Management in Crisis Management

KM Activity Definition

Knowledge Acquisition

Knowledge Creation

an organization’s ability to identify and acquire externally generated knowledge that it needs the generation of new knowledge that did not exist before

Knowledge Sharing the provision of know how to help others and collaborate with others to solve problems

Knowledge Utilization

Knowledge Storing

Organizational Requirement Phases

Potential absorptive capacity in all phases

Flexible structure

Social capital

Appropriate structure for SECI Solid knowledge base

Supportive organizational culture

Supportive management Adequate technology

Appropriate team, interpersonal, and individual characteristics

All phases

Preparation/Prevention

Damage Containment

Turning existing knowledge into beneficial ends and putting it into an operational context where it becomes meaningful Recording knowledge in the organizational memory

Effective KMS

Supportive Organizational culture and routine

Organizational memory

Damage Containment Recovery Learning SECI = Socialization, Externalization, Combination, and Internalization

First, in the signal detection phase, organizations need to acquire relevant knowledge to detect any useful signal of a potential crisis. In the preparation and prevention phase, organizations still need to look for knowledge about risk factors and other relevant knowledge that might be needed to prepare for the crisis. Additionally, creating valuable knowledge becomes necessary to inform prevention decisions. The third phase, damage containment, is a phase where organizations still need to create knowledge, but also need to share timely knowledge amongst their different departments and individuals. The last two phases, Recovery and Learning, require monitoring what has been transcribed in the aftermath of the crisis and storing relevant knowledge in organizational memory (Al Hashem et al., 2021). Below is a brief overview of the different knowledge management activities and a discussion on how they could be used effectively in crisis management.

2.3.1 Knowledge Acquisition

Knowledge acquisition refers to an organization’s ability to identify and acquire externally generated knowledge that it needs (Zahra & George, 2002). As a valuable resource, and especially throughout the coronavirus pandemic and similar crises, knowledge should be continuously sought after by organizations. During health related pandemics like the coronavirus, firms must seek knowledge from health associations at the local, national, and international levels. It is also key to acquire external business related knowledge about their products and the technology required to produce them. Generally, all related knowledge that could help the decision making process is essential to acquire during a pandemic.

While all organizations would like to have knowledge at their disposal, some organizations are better equipped to acquire it than others. Absorptive capacity (Cohen & Levinthal, 1990), especially potential absorptive capacity (Lane & Lubatkin, 1998; Zahra & George, 2002), is essential for organizations in their effort to identify and acquire external knowledge (Pan et al. , 2020). Another important element for organizations to improve their knowledge acquisition capabilities is having a flexible structure that enables employees to receive and process new external stimuli (Lyles & Baird, 1994; Lyles & Salk, 1996). Research has also emphasized the role of social capital in acquiring external knowledge (Kogut & Zander, 1992; Robertson et al., 2019). Social capital facilitates the exchange of knowledge amongst partners through frequent interactions (Nahapiet & Ghoshal, 1998), given that partners are willing to share and exchange knowledge (Cohen & Levinthal, 1990; Dyer & Singh, 1998).

Overall, starting from detecting signals of a potential crisis, to receiving update d knowledge throughout the crisis, organizations need the capacity to identify and acquire new external knowledge. Such capacity requires a high level of potential absorptive capacity, flexible structure, and a high level of social capital.

2.3.2 Knowledge Creation

The importance of creating knowledge for firms is well established in the literature (Grant,

1996; Nonaka, 1994; Fallatah, 2018). During crises where informed decisions are needed promptly , the importance of creating knowledge increases. While knowledg e acquisition is a continuous process that lives throughout the pandemic and beyond, knowledge creation is another important activity that organizations need during the probing and prevention, and the damage consignment phases.

Knowledge creation refers to the generation of new knowledge that did not exist before (Nonaka, 1994). The literature suggests that knowledge resides within individuals (Polanyi, 1966), and that creation of new knowledge comes about via exchanging diverse information in frequent interactions (Nahapiet & Ghoshal, 1998; Nonaka, 1994; Nelson & Winter, 1982; Polanyi, 1966). At the organizational level, knowledge based theories assert that the role of firms is to combine, coordinate and integrate individual knowledge to form overall firm knowledge (Grant, 1996; Kogut & Zander, 1996). That being said, organizations differ in their ability to create new knowledge, and the literature suggests that certain critical resources are behind such differences. Those resources are based on the three dimensions of knowledge: human, relational, and structural (firm) knowledge (Bontis et al., 2000).

Nonaka and Takeuchi (1995) introduced the knowledge creation model, in which they described how the two types of knowledge, explicit and tacit, are converted into organizational knowledge. Tacit knowledge, defined as intangible knowledge that cannot be codified, could be converted into other tacit knowledge via Socialization , and into explicit knowledge, defined as tangible and codified knowledge, via Externali zation. On the other hand, explicit knowledge could be converted into other explicit knowledge via Combination , and into tacit knowledge via Internalization.

Therefore, it is paramount for organizations to have a structure and a system that allows individuals to socialize, externalize, internalize, and combine in order to create new knowledge. Additionally, since new knowledge is a byproduct of existing knowledge, it is concluded that organizations with more existing knowledge are more likely to create a new one (Nonaka & Takeuchi, 1995). It is also important to note that knowledge is not equally valuable and that more valuable knowledge leads to higher performance (Fallatah, 2018).

2.3.3 Knowledge Sharing

Knowledge sharing refers to the provision of know how to help others and collaborate with others to solve problems (Wang & Noe, 2010). During a pandemic, I argue that knowledge sharing is paramount throughout the pandemic, especially in the first three phases. Organizations need to share knowledge amongst their various units (Abdolshah & Abdolshah, 2011). For example, to make a critical decision about shutting down a business or relying on e commerce only, health related information about the severity of the disease and whether employees could be easily infected, should be shared with the Human Resources (HR) and marketing departments to examine the possibility of laying off some employees and to make sales projections, respectively.

To have an effective knowledge sharing mechanism, research suggests that organizational culture that supports knowledge sharing along with management and technological support is key (Carmeli & Schauboerck, 2008; Wang & Noe, 2010). Also, several team and interpersonal characteristics are found to be necessary for a smooth knowledge sharing process. For example, gender diversity and the structure of social networks within the organization are positively related to effective knowledge sharing (Sipior, 2020; Wang & Noe, 2010). At the individual level, especially knowing that knowledge resides within individuals (Polanyi (1966), employees play a critical role in the success of the organizational knowledge management system. For example, it has been found that employees who are open to experience (Cabrera & Cabrera, 2006) and those with higher education and longer work experience are more likely to share knowledge with their colleagues (Constant et al. , 1994).

Thus, during a crisis such as a coronavirus pandemic, organizations should focus on exploiting a culture that encourage s knowledge sharing among employees (Hendryadi et al., 2019) , allowing for a quick and trusted knowledge sharing process. Additionally, organizations with the right individuals who are characterized by knowledge sharing traits, and those organizations with a structure that supports team diversity, are more likely to handle knowledge management in a crisis.

2.3.4 Knowledge Utilization

In the knowledge management literature, knowledge utilization has been defined as turning existing knowledge into beneficial ends and putting it into an operational context where it becomes meaningful (Oluikpe, 2015). During a traumatic crisis such as the coronavirus pandemic, acquiring, creating, and sharing knowledge should equip managers with utilizable knowledge to make informed decisions. For organizations, Knowledge is expected to be utilized mainly in the probing and preventing phase, and the damage containment phase.

The effectiveness of knowledge utilization depends mostly on the knowledge value (Fallatah, 2018), the quality and reliability of the knowledge management system (Alavi & Leidner, 2001), and the organizations’ culture and routine that enables easy and quick knowledge sharing.

2.3.5 Knowledge Storing

It is critical for organizations to store all acquired and created knowledge. Essential to storing knowledge is organizational memory, a construct that is composed of the structure of its retention facility, the knowledge contained in it, and the process of knowledge acquisition and retrieval (Walsh & Ungson, 1991). Organizations should store knowledge routinely in their memory and retrieve it when needed (Al Hashem et al, 2021; Huber, 1991). Such knowledge includes operational knowledge on how to do things, as well as the knowledge required for reporting purposes. Importantly, tacit knowled ge that is considered a source of competitive advantage should be stored to avoid losing it when key knowledge workers leave the organization.

In crises, storing knowledge in organizational memory is vital during the later phases. During the recovery phase, organizations deal with the outcomes of their decisions. In this phase, it

is important to take notes of what went right and what went wrong. Storing such information in the organizational memory is essential for learning, the last phase of crisis management. An organizational memory with all knowledge acquired, created, shared, and stored in the current crisis, with the right culture and a reliable KMS, should be retrieved easily in future crises.

3 Conclusion

Knowledge management plays a vital role in managing crises such as the coronavirus pandemic (Wang & Belardo, 2005). Acquiring relevant and updated knowledge during the life of the crisis, especially early on, should help in detecting signals of a potential crisis. Additionally, building on existing knowledge, organizations should strive to create a new one. All acquired and created knowledge would not be useful enough without a system that enables knowledge sharing. During the peak of the crisis in the probing and prevention, and the damage containment phases, effective knowledge creation and sharing are of utmost importance. Equally important is having an organizational memory where knowledge is stored and then retrieved by managers to utilize them and make informed and timely decisions. Organizational memory is also useful for organizations to retrieve knowledge for future cases.

4 Availability o f Data and Material

Data can be made available by contacting the corresponding author.

5 References

Abdolshah, M., & Abdolshah, S. (2011). Barriers to the implementation of knowledge management in Iranian institutions. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 2(2), 173 182.

Alavi, M., & Leidner, D. E. (2001). Knowledge management and knowledge management systems, Conceptual foundations and research issues. MIS Quarterly , 25(1), 107 136.

Alfaro, L., Chari, A., Greenland, A. N., & Schott, P. K. (2020). Aggregate and firm level stock returns during pandemics, in real time (No. w26950). National Bureau of Economic Research.

Al Hashem, A.O., Almasri, A., Abu Orabi, T. (2021). The mediation role of the organizational memory in the relationship between knowledge capturing and learning organization. Cogent Business & Management, 8 (1), (1924933.

Baker, S. R., Bloom, N., Davis, S. J., & Terry, S. J. (20200. Covid induced economic uncertainty (No. w26983). National Bureau of Economic Research.

Barney, J. (1991). Firm resources and sustained competitive advantage. Journal of Management, 17 , 99 120.

Bartik, A. W., Bertrand, M., Cullen, Z. B., Glaeser, E. L., Luca, M., & Stanton, C. T. (2020). How are small businesses adjusting to covid 19? early evidence from a survey (No. w26989). National Bureau of Economic Research.

Bontis, N., Keow, W. C. C., & Richardson, S. (2000). Intellectual capital and business performance in Malaysian industries. Journal of Intellectual Capital, 1 (1), 85 100.

Bouty, I. (2000). Interpersonal and interaction influences on informal resource exchanges between R&D

researchers across organizational boundaries. Academy of Management Journal, 43, 50 65.

Cabrera, E. F., & Cabrera, A. (2005). Fostering knowledge sharing through people management practices. The international Journal of Human Resource Management, 16(5), 720 735.

Carmeli, A., & Schaubroeck, J. (2008). Organisational crisis preparedness, The importance of learning from failures. Long Range Planning , 41 (2), 177 196.

Cohen, W. M., & Levinthal, D. A. (1990). Absorptive capacity, A new perspective on learning and innovation. Administrative Science Quarterly, 35 (1), 128 152.

Constant, D., Kiesler, S., & Sproull, L. (1994). What's mine is ours, or is it? A study of attitudes about information sharing. Information Systems Research , 5 (4), 400 421.

Darroch, J. (2003). Developing a measure of knowledge management behaviors and practices. Journal of Knowledge Management, 7(5), 41-54.

Dwivedi, Y. K., Hughes, D. L., Coombs, C., Constantiou, I., Duan, Y., Edwards, J. S., ... & Upadhyay, N. (2020). Impact of COVID 19 pandemic on information management research and practice, Transforming education, work and life. International Journal of Information Management, 55 , 102211.

Dyer, J. H., & Singh, H. (1998). The relational view, Cooperative strategy and sources of interorganizational competitive advantage. Academy of Management Review, 23 (4), 660 679.

Edvinsson, L., & Malone, M. S. (1997). Intellectual Capital, Realizing Your Company\'s True Value by Finding Its Hidden Brainpower. Harper Business, New York, NY.

Fallatah, M. I. (2018). Does value matter? An examination of the impact of knowledge value on firm performance and the moderating role of knowledge breadth. Journal of Knowledge Management, 22 (3), 678 695.

Fallatah, M. I. (2020). Networks, knowledge, and knowledge workers’ mobility, evidence from the National Basketball Association. Journal of Knowledge Management, 25 (5), 1387 1405.

Fleming, L. (2001). Recombinant uncertainty in technological search. Management Science , 47 , 117 132.

Garcia, H. F. (2006). Effective leadership response to crisis. Strategy & Leadership , 34 (1), 4 10.

Grant, R. M. (1996). Toward a knowledge‐based theory of the firm. Strategic Management Journal, 17 (S2), 109 122.

He, W., Zhang, Z. J., & Li, W. (2021). Information technology solutions, challenges, and suggestions for tackling the COVID 19 pandemic. International Journal of Information Management, 57 , 102287.

Hendryadi, Suratna, Suryani, & Purwanto, B. (2019). Bureaucratic culture, empowering leader ship, affective commitment, and knowledge sharing behavior in Indonesian government public services. Cogent Business & Management, 6 (1), 1680099.

Huber, G. P. (1991). Organizational learning, The contributing processes and the literatures. Organization Science, 2 (1), 88 115.

Kogut, B., & Zander, U. (1996). What firms do? Coordination, identity, and learning. Organization Science , 7 (5), 502 518.

Lane, P. J., & Lubatkin, M. (1998). Relative absorptive capacity and interorganizational learning. Strategic Management Journal, 19(5), 461 477.

McFadyen, M. A., & Cannella Jr, A. A. (2004). Social capital and knowledge creation, Diminishing returns of the number and strength of exchange relationships. Academy of Management Journal, 47 , 735 746.

Mitroff, I. I. (1994). Crisis management and environmentalism, A natural fit. California Management Review, 36 (2), 101 113.

Mitroff, I. I., Shrivastava, P., & Udwadia, F. E. (1987). Effective crisis management. Academy of Management Perspectives, 1 (4), 283 292.

Nahapiet , J., & Ghoshal, S. (1998). Social capital, intellectual capital, and the organizational advantage. Academy of Management Review, 23 (2), 242 266.

Nelson, R., & Winter, S. (1982). An evolutionary theory of economic change. Cambridge, MA, Belknap.

Nonaka, I. (1994). A dynamic theory of organizational knowledge’. Organization Science , 5 (1), 14 37.

Nonaka, I., & Takeuchi, H. (1995). The knowledge creating company, How Japanese companies create the dynamics of innovation. Oxford University Press, New York.

Oluikpe, P. I. (2015). Knowledge creation and utilization in project teams. Journal of Knowledge Management, (19(2), 351 371.

Pan, S. L., Cui, M., & Qian, J. (2020). Information resource orchestration during the COVID 19 pandemic, A study of community lock downs in China. International Journal of Information Management, 54 , 102143.

Pauchant, T. C., & Mitroff, I. I. (1992) Transforming the crisis prone organization, Preventing individual, organizational, and environmental tragedies. Jossey Bass, San Fransisco.

Pearson, C. M., & Mitroff, I. I. (1993). From crisis prone to crisis prepared, A framework for crisis management. Academy of Management Perspectives, 7 (1), 48 59.

Pearson, C. M., & Clair, J. A. (1998). Reframing crisis management. Academy of Management Review, 23 (1), 59 76.

Polanyi, M. (1962). Tacit knowing, Its bearing on some problems of philosophy. Reviews of Modern Physics, 34 (4), 601.

Polanyi, M. (1966) The tacit dimension. Garden City, NY, Doubleday.

Robertson, J., McCarthy, I. P., & Pitt, L. (201 9). Leveraging social capital in university industry knowledge transfer strategies, a comparative positioning framework. Knowledge Management Research & Practice, 17 (4), 461 472.

Roos, J., Edvinsson, L., & Dragonetti, N. C. (1997). Intellectual capital, Navigating the new business landscape. Springer, UK.

Rosenkopf, L., & Nerkar, A. (2001). Beyond local search, boundary‐spanning, exploration, and impact in the optical disk industry. Strategic Management Journal, 22 (4), 287 306.

Schumpeter, J. A. (1934) The Theory of Economic Development. Cambridge, MA, Harvard University Press. Serenko, A., & Dumay, J. (2017). Citation classics published in knowledge management journals. Part III , author survey. Journal of Knowledge Management, 21 (2), 330 354.

Sipior, J. C. (2020). Considerations for development and use of AI in response to COVID 19. International

Journal of Information Management, 55 , 102170.

Sveiby, K. E. (1997). The new organizational wealth, Managing & measuring knowledge based assets. Berrett Koehl er Publishers, San Francisco, CA.

Wang, W. T., & Belardo, S. (2005). Strategic integration, A knowledge management approach to crisis management. In Proceedings of the 38th Annual Hawaii International Conference on System Sciences (pp. 252a 252a). IEEE.

Walsh, J. P., & Ungson, G. R. (1991). Organizational memory. Academy of Management Review, 16 (1), 57 91.

Wang, J. (2016). Knowledge creation in collaboration networks, Effects of tie configuration. Research Policy, 45 , 68 80.

Wang, S., & Noe, R. A. (2010) Knowledge sharing, A review and directions for future research. Human Resource Management Review, 20(2), 115 131.

Zack, M., McKeen, J., & Singh, S. (2009). Knowledge management and organizational performance, an exploratory analysis. Journal of Knowledge Management, 13 , 392 409.

Zahra, S. A., & George, G. (2002). Absorptive capacity, A review, reconceptualization, and extension. Academy of Management Review, 27 (2), 185 203.

Dr.Mahmoud Fallatah is an Associate Professor of Strategy and Innovation at Umm Al Qura University, Saudi Arabia. He earned his Ph.D. from The University of Texas at Arlington. His research interests lie in the areas of Innovation, Knowledge Creation, Networks and Social Capital

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

Roles of Variation in Architectural Programming Approaches in Architectural Designs

Ferdous F. AL Shalche1,2, Asma H. Al Dabbagh1*

1Department of Architecture, University of Mosul, IRAQ.

2Department of Projects, Municipalities of Nineveh, IRAQ.

*Corresponding Author (Tel: +964 7721280936, Email: asma.dabbagh@uomosul.edu.)

Paper ID: 13A5E

Volume 13 Issue 5

Received 24 November 2021

Received in revised form 09 March 2022

Accepted 06 April 2022 Available online 19 April 2022

Keywords: Architecture approach; Value based approach; Agreement based approach; Physical fact; Knowledge based approach; Caudill Rowlett Scott (CRS).

Abstract

Architectural programming is the process of gathering, organizing, evaluating information, and making decisions that identify problems, and different architectural programming approaches. First, the knowledge based approach, Agreement based approach, Value based approach, and Participate approach. This paper focused on revealing the nature of applying two approaches and comparing them in specific aspects. The application consists of examining the programming process within functionally similar real examples to identify the advantage of each approach of architectural programming and its role in the design. So, the results revealed the similarity (between the applications of Agreement based and Value based approaches) in employing specific knowledge based on research and physical facts. Most importantly, the results revealed the difference in considering functions as a start point and a limited sequence of stages and depending on the importance of the facts in decision making within the Agreement based approach, which produces a non integrated relationship with the designer. The value based approach depends on the most important value and varied sequence of stages depending on the situation, which produces an integrated relationship with the designer, by spiral development, the possibility of developing the client. The ability to invest potentialities of the designer and rely on the most important values in decision making.

Disciplinary: Architecture.

©2022 INT TRANS J ENG MANAG SCI TECH.

Cite This Article:

Shalche, F.F.A., Dabbagh, A.H.A. (2022). Roles of Variation in Architectural Programming Approaches in Architectural Designs International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5E, 1 12. http://TUENGR.COM/V13/13A5E.pdf DOI: 10.14456/ITJEMAST.2022.89

1 Introduction

The term architectural programming (Briefing) appeared in information extracti on in Germany, as for the term (Architectural programming) . It has become common in America as it

expresses methods of collecting, analyzing and synthetic the required data in the design process for decision making (Kelly et al., 2006).

Also, the architectural designer initially used the intuitive. The importance of architectural programming appears when the complexity of information increases in the sixties of the twentieth century, especially after World War 2. With the development of technology, the need arose to find a way to reduce and evaluate information to reduce its processing (Edith, 1999; Hasnain & Thaheem, 2016; Hershberger, 2017). As well as being a key factor in reducing costs compared to the cost required by the programming process, where the cost of programming is 1.5% of the total cost, and this is considered small if compared to the cost that can be reduced to 80% if you use programming (Al Dabbagh , 2014; Faatz, 2009). Different architectural programming approaches (with many steps) emerged. Firstly, the knowledge based architectural programming approach. Secondly, the (Agreement Based Architectural programming) and (participator) approaches . The value based approach and the participator approach each with steps (Al Dakheel, 2006). Then in the sixties of the twentieth century, the Knowledge Based programming appeared by social and behavioral scientists who be careful with the built environment, so an (environmental sociology approach emerged), followed by Agreement Based architectural programming), which is followed one of the most important American programming companies (the Caudill Rowlett Scott ( CRS)) , and Pena the most famous programmers, and's participator approach (Edith, 1999), The value based approach that emerged and became popular in Britain as a result of the community's need, then developed by Hershberger who pay attention to contemporary values (Hershberger, 2017).

The research will compare programmers' dependence on the two main approaches in influencing the architectural output. The research will uncover this role by analyzing architectural examples that mention programming literature relying on these two approaches. The analysis will be according to the vocabulary that has been identified (the nature of knowledge, the stages of programming, development, and decision making), and then drawing the results and discussing them to conclude.

2 Literature Review

2.1 Knowledge Based Programming Approach

Sociologists developed it , including Edward Hall 1966 and Sommer, who presented personal space and studies on privacy and special needs . It appeared in the sixties by the trend of behavioral and (environmental sociology) drew their attention to the built environment within the organization (EDRA) and its steps: Determine goals based on research and interviews, and make questionnaires to determine the social requirements

The data are collected, statistically analyzed, and sum marized in the program document (Hershberger, 2017)

The disadvantage of the knowledge based approach:

• Neglecting designer related problems knowledge approach

• The time spends in holistic thinking time that takes all kinds of facts and analyzes them. The advantage of the knowledge based approach

• Helpful in developing new knowledge.

• Provides all necessary information following spiral thinking (Edith, 1999).

2.2 Agreement based Programming Approach

CRS follows it under the guidance of Williams Pena (seeking the problem), where the mission was to complete a matrix of physical information that includes five stages on the assumption that each problem falls within four determinants (functional, formal, economical , and time), (Alomari et al., 2013; Edith, 1999) taken from the sessions with the customer, then he determines the pragmatic ideas that pertain to the building and facilities, then the design requirements (Pena, 1977)as well as the possibility of discovering and adding facts extra and pragmatic ways to deal with problems he puts a fifth column that represents the comments of the design team representative to ensure that the customer and the engineer understand the problem (Alomari et al., 2013)

The role of the programmer is first to define the goal within the four determinants by testing the size of the most significant information that relates to it (Peña & Steven, 2012), so the knowledge adopts a linear thinking style that reduces the possibility of feedback and thus the development of the client and the designer, and in this way, it is he emphasizes the separation between the programming and design process (Edith, 1999; Hershberger, 2017), and he does not take all the samples as he emphasized that programming is an analysis of information and the installation process is within the design stage and as William Pena said "programming is an analysis and design is synthesis" (Edith, 1999)

Third, value based programming approach: developed by programmer Robert Hershberger, as he expanded the circle of values and linked them to a set of contemporary facts and the approach tries to collect and develop the information related to the most important value of the goals (the highest value at the lowest cost), (Hasnain & Thahee m, 2016), but the values are variable according to the evolution of time and change of place, the most famous of which is the eight values that Duerk used, it tries to discover and analyze the most important value of the project and translate it into design facilities by completing a matrix, that begins by defining the goals and then collecting facts related to the most important value and then defining the design requirements either for the client or designer, where he tries to meets the users, he discovers the most important values (Hershberger, 2017), as for the phases of the curriculum, the value approach emphasized the integration between programming and design by combining valuable ideas with physical design ideas, the programmer extracts information from the client through the interview, in order to define goals, budget, site analysis, climate and external influences, this enables him to define the project issue in the early stages of programming in an attempt to search for the purposes for which

facilities originate. Also, this approach adopts spiral thinking methods that allow feedback and then develop client and designer information (Edith, 1999); as for the decision making mechanism, it is based on values and priorities considered to assess and reduce information.

2.3 Value based Programming Approach

It is adopted by Durek and developed by programmer Robert Hershberger, as he expanded the circle of values and linked them to a set of contemporary facts (Hershberger, 2017). The approach tries to collect and develop the information related to the most important value of the goals. Thus it reduces the detailed wasted information (the highest value at the lowest cost (Hasnain et al., 2016), but the values are variable according to the evolution of time and change of place T he most famous of which is the eight values that Duerk used, it tries to discover and analyze the project and translate it into design facilities by completing a matrix, that begins by defining the goals and then collecting facts related to the most crucial value and then defining the design requirements either for the client or designer, where he tries to meets the users, the value approach emphasized the integration between programming and design by combining valuable ideas with physical design ideas T he programmer extracts information from the client through the interview to define goals, budget, site analysis, climate , and external influences; this enables him to define the project issue in the early stages of programming to search for the purposes for which facilities originate. Value based programming may adopt knowledge based methodological measures at some stages. Also, this approach adopts spiral thinking methods that allow feedback and then develop client and designer information ( Cherry, 2009); as for the decision making mechanism, it is based on values and priorities considered as means of assessing and reducing information.

2.4 Participator - Based Programming Approach

It is a development of the Agreement Based Architectural programming approach, and one of's most widely adopted approaches is to use pragmatic analyses. T he types of knowledge collected are the physical and social facts that can be obtained from building, analysis, site, and client. T he aggregate approach is based on six phases, the first being research on the project pattern. T hen defining the goal and issue of the project, defining strategies, calculating quantitative requirements, and completing the program (Edith, 1999; Kelly et al., 2006) thinking patterns within the inductive and deductive approaches (Cherry, 1999) and emphasizes that programming must continue to the design stage (Edith, 1999). The process of evaluating depends on social and physical information and defining the most important goals and issues (function, form, economical , time) (Faatz, 2009).

2.5 Differences between the Value - based Approach and the Agreement based Approach

Comparing the value based approach and the agreement based approach, the differences are

1. (resource of knowledge). It is possible to combine the values of the designer and the client in one matrix within the value based approach, while in the Agreement Based approach, it is difficult to combine the values of the designers and clients in one matrix.

2. (Development). The Agreement Based approach establishes a list of goals, facts, and concepts, and the appropriate needs for each consideration, followed by a summary of the problem However, the value approach avoids developing programmatic concepts, presents the problem in a scalable way and assist s in developing the design and client information.

3. (kind of knowledge). The kinds of facts obtained in the Agreement based approach are physical, but in the value approach are valuable information. The value based approach uses the two modes of linear and total T hinking, a helical thinking approach

4. (Decision making). The programmer must define the most important variables, as in the Knowledge based approach. The Agreement based approach defines the most important variables within four considerations. The Participatory Based approach tried to reduce information by collecting social variables and translating them into considerations. The value based approach reveals the most important values and translates them into the design facilities.

5. (Relationship with the designer). The Agreement Based approach is segregated to design, where the programming process separates between programming and design and follows linear thinking methods that do not allow the feedback process and do not include all information. In contrast, the value based approach is an integrative approach to design and uses helical Thinking that includes all the information(Edith, 1999).

Linearity

The nature of development Development  

Not possible

Helical  

The possibility of developing the client   Possible  

Not possible

Investing the designer 's capabilities in creativity  Possible 

Depending on the most important values Evaluation Decision making   

Depending on the size of the facts

Delineation of the main vocabularies that define each approach by observing its variables and its defined values and collecting them in a checklist table to hold a comparison between them; (Table 1).

Choosing two approaches; "Agreement based" and "Value based" approaches.

Analyzing architectural case studies that programming literature mentions their relying on these two approaches. According to the matrix of each approach and its measuring, the semantic analysis will be according to the vocabularies identified (nature of knowledge, stages of programming, development, and decision making). These case studies are functionally similar to exclude the functional impact on results.

Drawing the results and discussin g them to draw conclusions, which identify the advantages of each approach of architectural programming and its role in the design.

4 Result and Discussion

The observing vocabulary and variables from the approaches' literature review are shown in table No1, and the case studies analysis according to its matrices is shown in Tables 2 and 3.

Table 2: Analysis of case studies according to the Agreement based approach matrix (based on (Edith, 1999))

"State record centre" Museum Project title

function

form

Project activities, , So it needs Functional Analysis and review of standers, and the archive is the most important space (Edith, 1999)

The site is narrow and long, So it needs analysis of the possibility of vertical design more than the horizontal

the analysis is sufficient to cover operating costs economi c

time

The possibility of future internal and external expansion is weak

The expansion of university classes and laboratories Harley Motor Factory and Gallery Fish gallery (Aquarium)

Events include the organizational purpose of the project and afunctional analysis of the activities, which includes a pyramid drawing, and the exhibition spaces

The biological movement system of the park, so Design facilities should impress visitors and gives the flexibility to view, and analyze the design pattern

The spaces, volumes, and budget needed and capable of growth The operating cost is high and can be increased

It is not possible to divide the project into phases, and The building must be able to grow

The work stages are determined by the activities of manufacturing and displaying.

Flexibility to change depending on the surroundings, site Impact Analysis This reduces the impact of the entrance, and classification according to the mental image

Analysis of the necessary costs for each space

Technologies must express sophistication and modernity. The work can be divided into stages

Facts about the site and vacant space files, an analysis of the ease and clarity of movement, and The possibility of expansion

Express a coherent entity despite expansion it needs Analysis of the regional style (the university's regional style)

The solution should be economical, and Funding is currently unavailable

The construction period is not limited due to a lack of financing.

Table 3: T he analysis of case studies according to the "Value based" approach matrix

values facts goals project name

"Lincoln Museum" (Hershberger, 2017)

Humanity Symbolic Function Watch the statues freely Expression of the Lincoln era and compatibility with contemporary context

The direction of project development design requirements

Analysis of the Lincoln era reign (Expressing the reign of King Lincoln while respecting the contemporary context of the site)

The formal aspects embodied in it

High building Writing the words of King Lincoln on the walls Easy movement system

"The American Pavilion at the Montreal World " (Hershberger, 2017, p. 125)

"University of Arizona Krivantos Old Man Building" (Hershberger, 2017, p. 140)

The desire of the designer To distinguish the internal gallery from the closed structure

Returning to traditions as a reaction to glass usage, which led to an increase in the operating costs of adapting to climate by benefiting from traditions

Systems

Technologi

cal

Analysis of the capabilities of structural systems to express designer goals

Contempor ary Sustainability

Analysis of the traditional means of adaptation and the possibility

Use lightweight steel joists to build the famous geodesic dome

Tilted roofs, shaded arcades, the central courtyard, lofts, and traditional building materials, high windows and pavements

Add the College of Aviation Engineering

Adding a new building within the context of the site while expressing the contemporary

Permanence

Contempor ary

Analysis of the possibility of expansion and the context of the surrounding buildings

A vertical and horizontal motion system that can be expanded and modern structure

"A fertilizer plant in Northern California" (Hershberger, 2017, p76)

Humanity Symbolic Function Providing spaces that express the stages of production, expressing the shape of mountains

Building activity analysis

Customer requirements analysis

Segmented formation

Each part looks like a mountain

Moreover, the study measures the variables in the case studies shown in Tables 5 and 6. Then it made a comparison between the approaches according to the tables' results (Table 6), (Table 7). Finally, it makes another comparison between Case studies within the same function (Table 8).

Museum" State record centre" (Edith, 1999, p. 250)

"The expansion of university classes and laboratories " (Edith, 1999, p. 264) Fish gallery" An Aquarium" (Edith, 1999, p. 230)

Table 4: Measurement of variables in the case studies of the "Agreement based" approach matrix" the Agreement Based approach

"Harley's Motor Show Factory and Gallery" (Edith, 1999, p. 252)

Measured values Vocabulary Variable

Comprehensiveness

Its resource

The programmer's duty to determine information by comparing it with environmental, physical facts and relationships between facilities, for example, in administrative buildings, reflects information about growth, movement, and project activities(Edith, 1999)

Volumes are calculated by reviewing the functional program that depending on the users' need to determine the most influential space (Edith, 1999)

specific

The nature of knowledge Research and standards

Starting point Programming stages

Sequence of considerations

Nature of development Development

Make the decision

The physical analysis includes building analysis in terms of location, dimensions, interior projection, structural system, mechanical system, operational cost, and architectural pattern (Edith, 1999)

The functional goals analysis was the starting point which proved that the archive is the space that requires focus on it (Edith, 1999)

Physical facts

It is kind function

Specific The CRS methodology maintains the sequence of the four categories (Function, form, budget, time) (Hershberger, 2017)

Relationship with the design linearity Difficult to go back and adjust information (Edith, 1999)

Investing the designer 's capabilities in creativity

Evaluation

The programming process does not continue to the design stage) (Hershberger, 2017)

It is difficult to combine the values and requirements of designers and customers in one CRS programming matrix ) (Hershberger, 2017)

The amount of information related to a consideration determines the most important consideration (William_ Pena, 1977)

Table 5: Measuring the variables in the case studies of the "Value based" approach

"Lincoln Museum" (Hershberger, 2017, p76).

"The American Pavilion at the Montreal World Exposition " (Hershberger, 2017, p125) "University of Arizona Krivantos Old Man Building & Add the College of Aviation Engineering" (Hershberger, 2017, p104) "North California Fertilizer Factory" (Hershberger, 2017, p76)

vocabulary variable

The nature of knowledge

Comprehensiveness

Its resource

Not integrative

Not possible

Depending on the size of the facts

The value based approach

Measurem ent values

Specific The programmer has to define the most important information using the value system criteria (Edith, 1999). In some issues, the symbolic functional issue was deemed to need development (Hershberger, 2017)

Values and levels related to the client and designer The functional program can be obtained from the user and similar buildings, but there are kinds of values we need to obtain from the designer (Edith, 1999; Hershberger, 2017)

Science research

it i s kind

Starting point Programming stages

Sequence of considerations

Relationship with the design

The nature of development Development

Investing the designer 's capabilities in creativity

Evaluation Make the decision

Physical and human analyzes that relate to the number of users, their activities, their behavior, and their human values and determine the architectural style (Edith, 1999)

Knowledg e is physical and valuable

Function Linear Thinking is a step by step way of Thinking that is fixed in direction and has a point of direction and has been adopted by Western Americans (Edith, 1999)

Priorities affect the most important issue identification, so the sequence of considerations is not specified (Edith, 1999)

The programming process continues to the design stage (Hershberger, 2017)

The approach has the possibility of returning and modifying information (Edith, 1999)

The ability to combine the values and requirements of designers and customers into one matrix (Hershberger, 2017)

The value system determines the most important information and determines the quality of the building (Edith, 1999)

Not specific

Integrativ e

Helical

possible

Dependin g on the most important values

Possible values variable vocabulary

Table 6: Results of Measuring the variables of Architectural Programming studies of the "Agreement based" approach

Case studies of the "Values based" approach

expansion of the university's Classrooms and laboratories Gallery of Fish an d Aquarium Factory and Gallery of Harley Motor Museum of " State record cent re." Lincoln Museum The American Pavilion at the Montreal World Exposition Expansion of the University of Arizona Factory of , North California Fertilizer

Table 7: "R esults of the comparison between Case studies within the same function"

Starting point Programming stage

Function

The important value Social consideration

Specific Sequence of considerations

Relationship with the design

According to the issue

Antigravity

Not antigravity

Linear The nature of development Development

Not possible The possibility of developing the client

Table

8: The desiccation of the results of the comparison between Case studies within the same function

Case studies follow the Agreement Based approach

Case studies follow the Agreement Based approach follows the values based approach

The conclusion

Fish gallery and Aquarium

The conclusion

expansion of the university's classrooms and laboratories

University of Arizona Krivantos Old Man Building Add the College of Aviation Engineering

The conclusion

Factory of, North California Fertilizer

The conclusion

The issues

In the Agreement Based approach, the programme r decided to solve the problem of the movement system, then the form expressed by the most important areas, volumes, economics, and work stages, As for the value approach, when determining the most important value extracted from the analysis of the client's desires, the building was expressing the King Lincoln era model.

It turns out that the analysis carried out by the Agreement Based approach programmer was a traditional functional analysis. In contrast, the client's values (value) analysis produced an interest in the symbolic aspects.

In the Agreement Based approach, the programmer decided to solve the problem 0f the movement system, then the form.

As for the value based approach, when determining the most important value extracted from analyses of the client's desires to distinguish between the interior hall, the designer tried to take advantage of the technological development of construction systems and thus used two structural systems as a solution.

It turns out that the analysis carried out by the (compromise) programmer was a traditional functional analysis. In contrast, the analysis of the client's (value) desires led the designer to adopt a hybrid construction system, which gave a different solution.

In the Agreement Based approach, when the programmer decided to solve the desired problem to expand the university, he analyzed (the movement system), then the form,

As for the value approaches, when determining the most important value extracted from analyzes of the client's desires in addition to functional and character analyses or character and structural traditions, the designer took advantage of traditions to achieve sustainability, such as the use of patios, ponds, and corridors. , As well as express the context of the local climate of Arizona and contemporary desert using the modern structural structure

It turns out that the analysis was done by the In the Agreement Based approach, the programmer was a traditional functional analysis, and the solution to the expansion problem was carried out within narrow limits.

It turns out that determining the most important value led to the adoption of contemporary values such as sustainability and the modernity of the structural structure, which allowed expansion in both directions.

In the Agreement Based approach, when the programmer decided to solve the problem, which is the factory activities, he analyzed (the movement system) and the necessary equipment, and he determined the form.

As for the value approach, when determining the most important value extracted from analyzes of client desires in addition to functional analyzes, the result was a building that reflects the stages of production.

Despite the results’ similarity of programming in both approaches (Agreement and value) in the formality appropriate to the job. The question of the relationship with the surrounding context (value) has emerged

Lincoln Museum Scroll Museum of Manuscripts

The American Pavilion at the Montreal World Exposition

Harley Motor Factory and Gallery

Conclusion

The "Agreement based" approach adopted the traditional analysis specific to the function, as physical facts, drawn from studies and research, which excluded the role of the client, and negatively affected the possibility of its development, by excluding the advantages of the designer's creative capabilities, given the fact that the process is linear.

On the other hand, the "Value based" approach distinguished the programming of function, structural systems, the relationship with the context, and searching for contemporary values and symbolic aspects . As the most important value taken from the client and given that the process is a spiral and includes customer development, this allows reliability with the designer and the possibility of investing his creative capabilities.

Analysis of case studies within the two approaches (Agreement based and Value based) confirmed the previous programming literature about the advantages and disadvantages of both, making it easier for programmers to choose the appropriate approach and facilitating its application to obtain the best results.

6 Availability of Data and Material

Data can be available by contacting the corresponding author.

7 References

Al Dabbagh, A., & Alhayale, M. M. (2014). Delineation of Programming Goals for Sustainable\The app for architectural projects Norman Foster. First International Scientific Conference, 78 92.

Al Dakheel, R. M. (2006). Improving Architectural Programming Teaching Methods (Case Study at King Saud University). Studies, Engineering Sciences, 33(2), 93 104.

Al omari, H. R., Al Sheikh, S., & Younis, G. M. (2013). Architecture Programming Approaches in Practical Research of Fifth year Thesis specialists of Local Architecture Department. Procedia Social and Behavioral Sciences, 102, 368 385. DOI: 10.1016/j.sbspro.2013.10.752

Edith, C. (1999). Programming for design from theory to practice 10th Ed , John Wiley.

Faatz, S. (2009). Architectural programming: providing essential knowledge of project participants' needs in the pre design phase. Organization, Technology & Management in Construction , 1(2), 80 85.

Hasnain, M., Jamaluddin, T., & Muhammad. (2016). Best Value Procurement in Construction and its Evolution in the 21st Century: A Systematic Review. Journal for the Advancement of Performance Information and Value , 8(1), 11 25. DOI: 10.37265/japiv.v8i1.44

Hasnain, M., & Thaheem, M. J. (2016). Best Value Procurement in Construction and its Evolution in the 21 st Century : A Systematic Review. Journal for the Advancement of Performance Information and Value , 8(1):11 25, 1 21.

Hershberger, R. (2017). Architectural programming and predesign manager. In Architectural Programming and Predesign Manager. Routledge. DOI: 10.4324/9781315645728

Kelly, J., Morledge, R., & Wilkinson, S. (2006). Best Value in Construction . Black Well Sciences.

Pena, W. (1977). Problem Seeking: An Architectural Programming Primer 1st Ed

Peña, W., & Steven, P. (2012). Problem Seeking: An Architectural Programming Primer . 5th Ed., John Wiley & Sons

Ferdous F.AL Shalche is a student at the Department of Architectural Engineering, College of Engineering, University of Mosul, Mosul 41002, IRAQ. She got her Bachelor's degree in Architecture

Dr.Asma H. Al Dabbagh is an Assistant Professor at the Department of Architectural Engineering, College of Engineering, University of Mosul, Mosul 41002, IRAQ. She got her Doctor's degree in Theory of Architecture from the University of Technology, Baghdad, Iraq Her research focuses on the Theory of Architecture and Buildings types

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

School Travel Behavior Research Milestone (19792021): A Bibliometric Review Analysis

1 Research Centre, Faculty of Engineering & Built Environment, Universiti Kebangsaan Malaysia, MALAYSIA.

2 Smart and Sustainable Township Research Centre, Faculty of Engineering & Built Environment, Universiti Kebangsaan Malaysia, MALAYSIA

3 Department of Civil Engineering, Faculty of Engineering, Universitas Bina Darma, INDONESIA

*Corresponding Author (Tel: +62 811 787 1022, Email: p91991@siswa.ukm.edu.my)

Paper ID: 13A5F

Volume 13 Issue 5

Received 15 January 2022

Received in revised form 05 April 2022

Accepted 14 April 2022 Available online 20 April 2022

Keywords: School travel; Mode choice; Bibliometric; science mapping; PRISMA bibliometric analysis; Publication trend; Citation trend; Research trend.

Abstract

The expansion of automobiles in the field of transport has fundamentally changed the travel patterns of mankind throughout the world. Disruption in the rhythm likewise impacts school travel, floating concerns of transportation, and child issues. This article aims to map and cluster c urrent knowledge concerning school travel behavior topics by utilizing metadata from prior publications, using The Bibliometrix R package instrument to perform bibliometric analysis on 513 metadata of scientific documents from Scopus and Web of Science databases between 1979 and 2021. The PRISMA criterion diagram is employed for the metadata searching and validating procedure. The study revealed a plethora of scientific documents and citations, particularly in the recent decade, and the countries from the western hemisphere continue to prime state of the art research on this topic.

Disciplinary: Transportation Engineering (Modelling, Behavior) .

©2022 INT TRANS J ENG MANAG SCI TECH.

Cite This Article: Bastam, M.N., Mat Yazid, M.R., and Borhan, M.N. (2022). School Travel Behavior Research Milestone (1979 2021): A Bibliometric Review Analysis. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5F, 1 16. http://TUENGR.COM/V13/13A5F.pdf DOI: 10.14456/ITJEMAST.2022.90

1 Introduction

Since the emergence of the motorized vehicle in the 18th century, transportation has seen dramatic revolutions. The active travel pattern shifted to a more passive one through the escalation of motorized vehicles. Di sruption in grown up travel behavior involved children worldwide, particularly school travel behavior. Currently, children are extra prospective to commute to school using passive mode (motorized vehicles) than active mode (walking and cycling). Meanwhile,

Mukhlis Nahriri Bastam1,3*, Muhamad Razuhanafi Mat Yazid2, Muhamad Nazri Borhan2

parents have various concerns about authorizing their children to travel independently. This fact raises the issues of transportation (sustainability) and children (health and well being).

To the author's knowledge, numerous review analyses on travel behavior have been conducted previously. However, there are only a few bibliometric analysis documents explicitly on school travel behavior. The first article (author's claim) performing a bibliometric analysis of this topic presents 343 metadata of scientific documents between 2001 and 2021 from Web of Science and PubMed databases (Jing et al., 2021). This article attempts to map and cluster knowledge from a different perspective. Analyzing the metadata of documents on school travel behavior published between 1979 and 2021 from Scopus and Web of Science databases using the Bibliometrix R Packages tool to present a comprehensive sight of school travel behavior.

2 Lit e rature Review

Children's travel behavior is distinct from adults' (Lin & Chang, 2010; Mackett, 2013; McMillan, 2005; Milne, 2009; Yarlagadda & Srinivasan, 2008). Elders make their transport modes, whereas children, particularly on their journey to school, are encouraged by their parents or other elder family members. Adolescents have begun to make transportation choices independently, while parents typically provide those for their younger children (He & Giuliano, 2017; Johansson et al., 2012; Singh & Vasudevan, 2018).

School travel significantly impacts overall urban travel patterns (Müller et al., 2020; Singh & Vasudevan, 2018; Xiong et al., 2019). The total traffic volume will increase during the hours of entering or leaving school. The expanding use of private vehicles for school travel in both developed and developing countries, as well as the decline in active mode use, contribute to urban traffic concerns (Ermagun & Samimi, 2018; He & Giuliano, 2018; Mehdizadeh et al., 2017; Nordfjrn & Zavareh, 2017). Worldwide, parents are increasingly escorting their children to school due to concerns regarding travel safety and a hostile travel environment (Muller et al., 2020; Zhang et al., 2017). Children's mobility independence has a consequence on their level of physical activity. Physical activity is critical for the health and well being of children (Wilson et al., 2018). School travels are performed by individuals with fragile and complicated traits, which piques the curiosity of policymakers, planners, traffic engineers, researchers, parents, and school authorities interested in studying them (Agyeman & Cheng, 2020; Distefano et al., 2019; Hao et al., 2019). Adult travel behavior is the subject of most research on travel behavior, while children's travel behavior receives insufficient attention (Jing et al., 2018).

3 Method

For comprehensive performance, the author applied a five stage standard of science mapping (bibliometrics) approach (Zupic & Cater, 2014): 1. Study Design; 2. Data Collection; 3. Data Analysis; 4. Data Visualization; and the last, 5. Interpretation.

3.1 Study Design

The authors generate the following research questions for this analysis: 1. What basic details

are available (annual production; document type; most prominent countries, authors, sources, affiliated institutions, and most cited documents)? 2. How is this topic's conceptual framework and research paradigm analyzed?.

The Bibliometrix R Package is used to conduct the analysis, following a systematic procedure based on Aria and Cuccurullo's paradigm (Aria & Cuccurullo, 2017). Aria and Cuccurullo created Bibliometrix as an open source application for comprehensive science mapping analysis.

3.2 Data Collection

This research was conducted using the Scopus database (http://www.scopus.com) and the Web of Science Core Collection (http://www.webofknowledge.com). Authors collected, filtered, and evaluated the feasibility of metadata of publications using the PRISMA (Preferred Reporting Items for Systematic Reviews and Meta Analyses) criteria table, as seen in Figure 1. Table 1 illustrates an advanced search with numerous cri teria for inclusion and exclusion. The search timeframe is 1979 2021, with database access beginning on December 7, 2021, to obtain a complete picture of this study issue. Additionally, authors collect English language publications primarily for the sake o f readability. Authors perform advanced level searches by categorizing phrases into four categories: population, behavior, travel destination, and mode of transportation (see Table 2). The metadata search uses standard Boolean operators ("OR" and "AND") to connect each term into a search string. The database's search function uses the title, keywords, and abstract fields for each page (Savoy, 2005).

Table 1: Inclusion and exclusion criterion Criterion Inclusion Exclusion

Source database in Scopus and Web of Science Core Collection all other databases

Types of Literature the phenomenon's relevant studies/literature

Subjects' Characteristics student, pupil, child, teen, youth, young adolescence, juvenile, kid, parent university, college, and academy students

Year of Publishing 1979 until 7 December 2021 all after 7 December 2021

Language of Literature English all other languages Intriguing Phenomenon mode choice for school a travel activity all other activities

Table 2: Search string for data collection Database Search String

Scopus and Web of Science Core Collection

Population : (student* OR pupil* OR child* OR teen* OR youth* OR young* OR adolescen* OR juvenile* OR kid* OR parent*) AND Behavior : (“mod* choice*” OR “ choice* of mod*” OR “transport* mod*” OR “ mod* of transport” OR “trip mod*” OR “mod* of trip” OR “travel mod*” OR “mod* of travel” OR “commut* mod*” OR “mod* of commut*” OR “mobility mod*” OR “ mod* of mobility” OR “journey mod*” OR “mod* of journey”) AND Travel Destination : (“school transport*” OR “school trip” OR “school travel” OR “school commut*” OR “school mobility” OR “school journey” OR “transport* to school” OR “trip to school” OR “travel to school” OR “commut* to school” OR “mobility to school” OR “journey to school”) AND Mode of Travel : (walk* OR cycl* OR bik* OR cycl* OR bicycl* OR bus* OR train* OR car* OR motorcyl* OR scooter* OR taxi* OR rapid* OR transit* OR “ride hailing transport*” OR "ride sharing transport*” OR “car* pool*” OR “on demand transport*” OR “transport* app*” OR escort* OR accompan* OR chauffeur* OR independent OR unaccompan* OR “self determine*”)

Identification Screening Eligibility Included

Records retrieved using databases (Scopus n = 442) (Web of Science n = 436 ) ∑n = 878 Records excluded due to published in non english (n = 17)

Total records after Screened (n = 861 )

Duplicates records are removed (n = 316 )

Full text records assessed for eligibility (n = 545 ) Full text records exluded, with reason (n = 32)

Articles included (n =513 )

The first phase is identification; a database search generates 878 metadata, containing 442 from Scopus and 436 from Web of Science. The screening process (second phase) deleted 17 metadata in non English and 316 duplicate metadata, the remaining 545 for the next phase. The third phase is an assessment of the metadata's feasibility. Thirty two sets of metadata linked to students at the university level and equivalent were discarded due to their incompatibility with the criteria. After this stage, 513 metadata are generated for inclusion in the bibliometric analysis.

3.3 D ata Analysis and Interpretation

Data analysis involves descriptive statistical analysis and network analysis. Bibliometrix R Packages (http://www.bibliometrix.org) were employed to analyze the data attained in the previous step. This application provides a tool for quantitative analysis in bibliometrics and scientometrics.

In Figure 2, the systematic working order of Bibliometrix is described. After the metadata collection process from the database is complete, the following process is to load and combine the metadata collection into bibliometrix and convert it into a file extension supported by the application for analysis.

Figure 1: PRISMA flowchart for bibliometric analysis of school travel behavi or research

The Bibliometrix R Package provides nonprogrammers with data analysis capabilities. The procedure begins automatically once the metadata file is loaded into the application without being knowledgeable in programming languages. The primary operations are descriptive statistical analysis and network extraction. As a result, a descriptive data matrix and network visualization are produced.

Figure 2: Bibliometrix workflow diagram (Aria & Cuccurullo, 2017)

4 Result a nd Discussion

4.1 Overview Main At t ributes

Table 3 shows general information about the attributes in the metadata collection. After the documents were combined and duplicate titles were eliminated, there were 513 metadata from 172 sources from 1979 to 2021. See Figure 3; these documents are divided into eight types, namely, articles 445 or 87.74%; proceedings 37 or 7.21%; reviews 20 or 3.90%; book chapter 7 or 1.36%; note, erratum, correction, and early access each amounted to 1 or 0.19%. Authors related to these documents are 1324 authors with an average number of 2.58 and 0.387 documents per author

Table 3: Descriptive analysis: Primary attributes of the collection Description Interval 1979 2021 Sources 172 Records 513

Average years from publication 5.94

Average citations per records 28.24 Authors 1324

Author Appearances 2103

Authors of single authored records 29

Authors of multi authored records 1295 Records per Author 0.387

Authors per Records 2.58

Co Authors per Records 4.1

Collaboration Index 2.7

4.2 Publication and Citation Trend of School Travel Behavior Research

Since the first article (Rigby, 1979) was cataloged in the search database, additional articles were cataloged in 1999 or two decades later. The school travel behavior research publishing trend began to increase progressively after that. Between 2001 and 2010, a total of 83 documents were published.

The analysis of school travel behavior over the next decade (2011 2021) reveals a rising tendency in the following decade. That period saw the publication of 427 documents. Annual growth rates of 18.64% are shown in Figure 4 for the annual publications on school travel behavior.

Figure 5 shows the total number of citations per year (TCPY) for 42 year old documents. The total number of citations ranges from 14,488 to 513 documents, with a trend toward increasing total citations per year (TCPY), an average of 28,24 citations per doc ument. These two graphs demonstrate an upward tendency in the mode of school travel study.

The study's exploration is still in its infancy, particularly in geography, where developed countries in the western hemisphere dominate. Understanding the factors that influence school travel behavior in developing countries remains a challenge.

Figure 3: Record type in school travel behavior (1979 2021)

Figure 4: Publications per year on school travel behavior (1979 2021).

Figure 5: Citations per year in school travel behavior (1979 2020).

Prominent Authors, Institutions, and Countries

This section assesses the most prominent authors, institutions, and countries in school travel behavior research based on publication production. In Figure 6, Ron Buliung from the University of Toronto, Canada, is the most prominent author with 25 documents on this topic. These documents were cited 1331 times during 2009 2021. The document entitled "Active school transportation in the Greater Toronto Area, Canada: An exploration of trends in space and time (1986 2006)" was the most cited, namely 209 times, in 2021. The point of the study is to examine spatially and temporally changes in mobility for school trips in the Greater Toronto Area, Canada's populous city region. Buliung discovered a decline in active modes of transport to and from schools between 1986 and 2006. The order of the ten most prominent authors based on publication production after Ron Buliung is Guy Faulkner (University of British Columbia, Canada) with 23 documents, Palma Chillón (University of Granada, Spain) with 19 documents, Ashley R Cooper (University of Bristol, UK), Sandra Mandic (University of Otago, New Zealand), Raktim Mitra (Ryerson University, Canada), Esther van Sluijs (University of Cambridge School of Clinical Medicine) with 12 documents each, Alireza Ermagun (Mississippi State University, US), Richard Larouche (University of Lethbridge, Canada), Emilio Villa González (University of Granada, Spain) each with 11 documents. All authors on the theme of school travel behavior come from developed countries in Europe, North America, and Oceania. Their studies mainly highlight active school transportation due to the declining use of this mode of transportation locally and globally.

Figure 6: Descriptive analysis: The list of top 10 most prominent authors

Figure 7: Descriptive analysis: The list of the top 10 most prominent countries

Following that, a list of countries that contribute the most to document production in school travel behavior research is provided in Figure 7. Eight of the ten countries named are developed countries (the United States, Canada, England, New Zealand, Australia, Spain, Netherlands, and Germany). Additionally, two emerging economies (China and Iran) (United Nations , 2016). The United States, with 138 documents or 17.6% of the total number of documents, is the most prominent country in producing school travel behavior documents. Canada is next with 132 documents or 16.8%, Next is United Kingdom with 73 documents or 9 .3%, New Zealand 56

documents or 7.1%, Australia 44 documents or 5.6%, Spain 34 documents or 4 .3%, China 31 documents or 4.0%, Netherlands 22 documents or 2.8%, Iran 21 documents or 2.7%, and Germany 20 documents or 2.6%. Of the total number of school travel behavior documents, two countries from North America (the US and Canada) contributed 34.4%, four countries from Europe (UK, Spain, Netherlands, and Germany) 19%, two countries from Oceania ( Australia and New Zealand) 12.7%, and two countries from Asia (China and Iran) 6.7%. Most school travel behavior documents are produced from the western hemisphere. Based on the metadata collected, the first article on this study came from the United Kingdom titled “A Review Of Research On School Travel Patterns And Problems” (Rigby, 1979).

Figure 8: Worldwide records distribution in school travel behavior (1979 2021)

Figure 9: Descriptive analysis: The list of the top 10 most prominent institution

In a scientific article, the institution is the author's affiliation. school travel behavior is a field of study to which numerous developed countries have made significant contributions. The ten most prominent institutions that contributed to the study are listed in Figure 9. To begin with 67 contributing documents, the University of Toronto in Canada became the most notable institution.

The University of Granada in Spain 45 documents; Auckland University of Technology in New Zealand and the University of Otago in New Zealand 32 documents each; the University of Bristol in the United Kingdom 25 documents; the University of British Columbia in Canada 22 documents; the University of California in the United States, the University of Southern Denmark in Denmark, and the University of Minnesota in the United States 16 documents each; Ghent University in Belgium 15 documents.

4.4 Influential Articles and Sources

Table 4 shows the ten most influential articles in the School travel behavior research. The article cited the most was working (McDonald, 2007), with 461 citations in 2021. The work discussed trends in active transportation use among students in the United States. Next is the work (McMillan, 2007) on the factors of urban structure in the United States on the mode of children's travel to school, cited 384 times. (Cooper et al., 2003) analyzing the relationship between walking to school and the level of physical activity in children in the UK has been cited 324 times. Still (Cooper et al., 2005) compared the level of physical activity in Danish children who walked, cycled, and were sent by car to a school that had been cited 297 times. (Schlossberg et al., 2006) revealed that urban structure and distance to the choice of transportation to school in the United States were cited 295 times. (Tudor Locke et al., 2001) identified sources of physical activity in American children, one of which was active trips to school citations 275 times. Still, in the United States (Ewing et al., 2004), the focus on school location as a determinant of the choice of mode of transportation to school has been cited 273 times. A similar work (McDonald, 2008) also discussed the influence of school location and distance in the United States as determinants of 214 citations. The article from Buliung et al. (2009) highlighting the trend of active travel in Canada over a while, was cited 209 times. Moreover, finally, from the UK (Panter et al., 2010) attitudes, social support, and perceptions of the environment as predictors of school trips have been cited 183 times.

Table 4: Descriptive analysis: The list of top 10 most prominent records

Author Source

TC TC per Year

American Journal of Preventive Medicine 461 30.73 McMillan (2007) Transportation Research Part A: Policy and Practice 384 25.60

McDonald (2007)

Cooper et al. (2003) American Journal of Preventive Medicine 324 17.05

Cooper et al. (2005) American Journal of Preventive Medicine 297 17.47

Schlossberg et al. (2006) Journal of The American Planning Association 295 18.44

Tudor Locke et al. (2001) Sports Medicine 275 13.10

Ewing et al. (2004) Transportation Research Record 273 15.17

McDonald (2008) Transportation 214 15.29

Buliung et al. (2009) Preventive Medicine 209 16.08

Panter et al. (2010) Journal of Epidemiology and Community Health 183 15.25

From 172 sources containing school travel behavior documents, Table 5 lists the ten most prominent sources based on the number of documents on that topic. The first order, the Journal of Transport and Health (JIF = 2.80), published 53 articles or 10.3% of 513 documents. Then the Journal of Transport Geography (JIF = 4.99) with 28 articles or 5.5%. The International Journal of

Behavioral Nutrition and Physical Activity (JIF = 6.46) and the International Journal of Environmental Research and Public Health (JIF = 3.39) each had 24 articles or 4.7%. Transportation Research Record (JIF = 1.56), 20 articles or 3.9%. Preventive Medicine (JIF = 4.02) with 18 documents or 3.5%. Transporta tion (JIF = 5.19) 17 documents or 3.3%. BMC Public Health (JIF = 3.30) and Transport Policy (JIF = 4.67) each had 16 documents or 3.1%. Finally, Transportation Research Part A: Policy and Practice (JIF = 5.59) with 12 documents or 2.3%.

Table 5: Descripti ve analysis: The list of top 10 most prominent sources

Sources No. of Records % of records JIF

Journal of Transport and Health 53 10.3 2.80

Journal of Transport Geography 28 5.5 4.99

IJBNPA 24 4.7 6.46

IJERPH 24 4.7 3.39

Transportation Research Record 20 3.9 1.56

Preventive Medicine 18 3.5 4.02

Transportation 17 3.3 5.19 BMC Public Health 16 3.1 3.30

Transport Policy 16 3.1 4.67

Transportation Research Part A 12 2.3 5.59

4.5 Cluster Analysis and Thematic Mapping

This section describes concepts often used in school travel behavior studies from 1979 to 2001. The concept analysis was carried out using 973 keywords from 513 records. Bibliometrix R package provides analysis output in the form of a co occurrence network, such as the visualization of Figure 10. The network describes the clustering of concepts most frequently discussed in school travel behavior research throughout the search period. The larger the circle in the image, the more often the concept appears in the document. The lines in the figure show the relationships between concepts. Colors indicate the division of concepts in the cluster. Table 6 shows the division of clusters and the items contained in them. This cluster can help researchers, especially novice researchers, determine their research position within the more extensive research network. Researchers can also see items related to the research topic. Cluster 1 relates to school travel behavior, namely the choice of school travel mode and its determinants. Cluster 2 emphasizes walking and cycling as an active modes of schooling. Cluster 3 discusses children and adolescents' physical activity and health related to active school trips. Cluster 4 discusses the factors that support and hinder an active school journey.

Table 6: Cluster and concept items

Cluster Concept items No.items color

1 Children; school travel; mode choice; active transportation; bicycling; school trips; neighborhood; travel behavior; gender; attitudes; school transportation; travel 12 Red

2 Walking; cycling; built environment; active travel; active school travel; safety; walkability; safe routes to school; gis; students; commuting; school children; active school transportation

3 Physical activity; active commuting; transportation; child; youth; schools; adolescent; active; commuting to school; environment; health; obesity; exercise; adolescence; fitness; public health; accelerometer

13 Blue

16 Green

4 Active transport; school; adolescents; transport; distance; parents; barriers; independent mobility 8 Purple

Figure 10: Co occurrence network by author’s keywords

Figure 11: Thematic map

The upper right quadrant is the motor theme. This quadrant is characterized by high density and centrality. "school travel" is a growing theme and has become the main focus. This theme

relates to other concepts, such as "environment", "gender", "perceptions", "active travel to school", "walk", "bike", "car choice", "built", and "children independent mobility". . In addition, there is the theme of "neighborhood" which is connected to the concepts of "public health", "risk perception", "behavior change", "community", "parent attitudes", "spatial behavior", and "urban design". Furthermore, the theme of "school transportation" is connected with the concepts of "space syntax", "global positioning system", "multinomial logit model", "school choice", and "weather".

The upper left quadrant is the niche theme. This quadrant shows high density but with low centrality. The significance of the field is low compared to the previous theme. The theme with the closest significance is the theme of “public transport,” which is connected with the concepts of “travel behavior”, “urbanization”, “theory”, “mode share”, “models”, and “lifecycles”, and “cohort”. Next is the “active” theme, which is connected to the concept of “travel modes”. “primary school” and “escorting” are themes with lower significance in this quadrant.

The lower left quadrant is emerging or declining themes with low density and centrality. There are two possibilities, whether the theme is emerging or, on the contrary, declining. The theme of “evaluation” is in this quadrant. Evaluation of school travel behavior metadata includes the evaluation of programs or policies (Baslington, 2010; Hinckson & Badland, 2011; Hoelscher et al., 2016; Johnston et al., 2006; Kipping et al., 2008; Levantis, 2010; Perez Martin et al., 2018; Rodriguez et al., 2019), measurement tools or instruments (Pocock et al., 2020; Sersli et al., 2019; Stewart et al., 2015), group of population(Mendoza et al., 2014), effects on children non physical health (Ramanathan et al., 2014), school status (Yan et al., 2019), routes (Spallek et al., 2006) (Woods & Nelson, 2014), barriers (Fallah Zavareh et al., 2020), data reliability and validity (McDonald et al., 2011).

The lower right quadrant is the basic theme fundamental, and interdisciplinary subjects. These themes span several research areas and include a broad range of subjects. Some basic concepts related to the theme of "school travel" include the concepts of "children", "walking", "mode choice", "active transport", synonyms "active commuting to school", "walkability", and "safety".

5 Con clusion

School travel behavior research has increased in the last decade. This trend is shown by the increasing annual production and citation of scientific documents. The western hemisphere still dominates the state of of the the art contribution in this field, from productions, authors, institutions, and cited documents.

The limitations of this review are a challenge for future researchers. This bibliometric analysis only reveals general information about descriptive attributes in metadata and conceptual structures (co occurrence network and thematic map) in the school travel behavior research. Future research can analyze intellectual structures (co citation networks and historiography ) and social structures (collaboration networks and maps).

6 Availability o f Data and Material

Data can be made available by contacting the corresponding author.

7 References

Agyeman, S., & Cheng, L. (2020). Analysis of barriers to perceived service quality in Ghana: Students’ perspectives on bus mobility attributes. Transport Policy, 99(May), 63 85. DOI: 10.1016/j.tranpol.2020.08.015

Aria, M., & Cuccurullo, C. (2017). bibliometrix: An R tool for comprehensive science mapping analysis. Journal of Informetrics, 11(4), 959 975. DOI: 10.1016/j.joi.2017.08.007

Baslington, H. (2010). Evaluating school travel initiatives and promoting “healthy travel” through PSHCE. Education, 38(2), 117 135. DOI: 10.1080/03004270903099850

Buliung, R. N., Mitra, R., & Faulkner, G. (2009). Active school transportation in the Greater Toronto Area, Canada: An exploration of trends in space and time (1986 2006). Preventive Medicine, 48(6), 507 512. DOI: 10.1016/j.ypmed.2009.03.01

Cooper, A. R., Andersen, L. B., Wedderkopp, N., Page, A. S., & Froberg, K. (2005). Physical activity levels of children who walk, cycle, or are driven to school. American Journal of Preventive Medicine, 29(3), 179 184. DOI: 10.1016/j.amepre.2005.05.009

Cooper, A. R., Page, A. S., Foster, L. J., & Qahwaji, D. (2003). Commuting to school: Are children who walk more physically active? American Journal of Preventive Medicine, 25(4), 273 276. DOI: 10.1016/S0749 3797(03)00205 8

Distefano, N., Leonardi, S., & Pulvirenti, G. (2019). Home school travel: Analysis of factors affecting italian parents’ mode choice. Civil Engineering and Architecture, 7(3), 75 87. DOI: 10.13189/cea.2019.070302

Ermagun, A., & Samimi, A. (2018). Mode choice and travel distance joint models in school trips. Transportation, 45(6), 1755 1781. DOI: 10.1007/s11116 017 9794 y

Ewing, R., Schroeer, W., & Greene, W. (2004). School location and student travel: Analysis of factors affecting mode choice. Transportation Research Record, 1895, 55 63. DOI: 10.3141/1895 08

Hao, J., Zhang, L., Ji, X., & Tang, J. (2020). Modeling and analyzing of family intention for the customized student routes: A case study in China. Physica A: Statistical Mechanics and Its Applications, 542(C). DOI: 10.1016/j.physa.2019.1233

He, S. Y., & Giuliano, G. (2017). Factors affecting children’s journeys to school: a joint escort mode choice model. Transportation, 44(1), 199 224. DOI: 10.1007/s11116 015 9634 x

He, S. Y., & Giuliano, G. (2018). School choice: understanding the trade off between travel distance and school quality. Transportation, 45(5), 1475 1498. DOI: 10.1007/s11116 017 9773 3

Hinckson, E. A., & Badland, H. M. (2011). School travel plans: Preliminary evidence for changing school related travel patterns in elementary school children. American Journal of Health Promotion, 25(6), 368 371. DOI: 10.4278/ajhp.090706 ARB 217

Hoelscher, D., Ory, M., Dowdy, D., Miao, J., Atteberry, H., Nichols, D., Evans, A., Menendez, T., Lee, C., & Wang, S. (2016). Effects of Funding Allocation for Safe Routes to School Programs on Active Commuting to School and Related Behavioral, Knowledge, and Psychosocial Outcomes: Results From the Texas Childhood Obesity Prevention Policy Evaluation (T COPPE) Study. Environment and Behavior, 48(1), 210 229. DOI: 10.1177/0013916515613541

Jing, P., Pan, K., Yuan, D., Jiang, C., Wang, W., Chen, Y., Shi, Y., & Xie, J. (2021). Using bibliometric analysis techniques to understand the recent progress in sc hool travel research, 2001 2021. Journal of Transport

and Health, 23. DOI: 10.1016/j.jth.2021.101265

Jing, P., You, Q., & Chen, L. (2018). Agent based simulation of children’s school travel mode with parental escort decisions. Information (Switzerland), 9(3). DOI: 10.3390/info9030050

Johansson, K., Laflamme, L., & Hasselberg, M. (2012). Active commuting to and from school among Swedish children a national and regional study. European Journal of Public Health, 22(2), 209 214. DOI: 10.1093/eurpub/ckr042

Johnston, B. D., Mendoza, J., Rafton, S., Gonzalez Walker, D., & Levinger, D. (2006). Promoting physical activity and reducing child pedestrian risk: Early evaluation of a walking school bus program in central Seattle. Journal of Trauma Injury, Infection and Critical Care, 60(6), 1388 1389. DOI: 10.1097/00005373 200606000 00051

Kipping, R. R., Payne, C., & Lawlor, D. A. (2008). Randomised controlled trial adapting US school obesity prevention to England. Archives of Disease in Childhood, 93(6), 469 473. DOI: 10.1136/adc.2007.116970

Levantis, S. (2010). A framework for evaluating safer routes to schools. Traffic Engineering and Control, 51(7), 267 270.

Lin, J. J., & Chang, H. Te. (2010). Built environment effects on children’s school travel in Taipai: Independence and travel mode. Urban Studies, 47(4), 867 889. DOI: 10.1177/0042098009351938

Mackett, R. L. (2013). Children’s travel behavior and its health implications. Transport Policy, 26, 66 72. DOI: 10.1016/j.tranpol.2012.01.002

McDonald, N. C. (2007). Active Transportation to School. Trends Among U.S. Schoolchildren, 1969 2001. American Journal of Preventive Medicine, 32(6), 509 516. DOI: 10.1016/j.amepre.2007.02.022

McDonald, N. C. (2008). Children’s mode choice for the school trip: The role of distance and school location in walking to school. Transportation, 35(1), 23 35. DOI: 10.1007/s11116 007 9135 7

McDonald, N. C., Dwelley, A. E., Combs, T. S., Evenson, K. R., & Winters, R. H. (2011). Reliability and validity of the Safe Ro utes to school parent and student surveys. International Journal of Behavioral Nutrition and Physical Activity, 8. DOI: 10.1186/1479 5868 8 56

McMillan, T. E. (2005). Urban Form and a Child’s Trip to School: The Current Literature and a Framework for Future Research. Journal of Planning Literature, 19(4), 440 456. DOI: 10.1177/0885412204274173

McMillan, T. E. (2007). The relative influence of urban form on a child’s travel mode to school. Transportation Research Part A: Policy and Practice, 41(1), 69 79. DOI: 10.1016/j.tra.2006.05.011

Mehdizadeh, M., Nordfjaern, T., Mamdoohi, A. R., & Shariat Mohaymany, A. (2017). The role of parental risk judgements, transport safety attitudes, transport priorities and accident experiences on pupils’ walking to school. Accident Analysis and Prevention, 102, 60 71. DOI: 10.1016/j.aap.2017.02.020

Mendoza, J. A., Cowan, D., & Liu, Y. (2014). Predictors of children’s active commuting to school: An observational evaluation in 5 U.S. communities. Journal of Physical Activity and Health, 11(4), 729 733. DOI: 10.1123/jpah.2012 0322

Milne, S. (2009). Moving Into and Through the Public World: Children’s Perspectives on their Encounters with Adults. Mobilities, 4(1), 103 118. DOI: 10.1080/17450100802657988

Muller, S., Mejia Dorantes, L., & Kersten, E. (2020). Analysis of active school transportation in hilly urban environments: A case study of Dresden. Journal of Transport Geography, 88. DOI: 10.1016/j.jtrangeo.2020.102872

Nordfjærn, T., & Zavareh, M. F. (2017). Does the value belief nor m theory predict acceptance of disincentives to

driving and active mode choice preferences for children’s school travels among Chinese parents? Journal of Environmental Psychology, 53, 31 39. DOI: 10.1016/j.jenvp.2017.06.005

Panter, J. R., Jones, A. P., Va n Sluijs, E. M. F., & Griffin, S. J. (2010). Attitudes, social support and environmental perceptions as predictors of active commuting behavior in school children. Journal of Epidemiology and Community Health, 64(1), 41 48. DOI: 10.1136/jech.2009.086918

Perez Martin, P., Pedros, G., Martinez Jimenez, P., & Varo Martinez, M. (2018). Evaluation of a walking school bus service as an intervention for a modal shift at a primary school in Spain. Transport Policy, 64, 1 9. DOI: 10.1016/j.tranpol.2018.01.005

Pocock, T., Moore, A., Molina García, J., Queralt, A., & Mandic, S. (2020). School neighbourhood built environment assessment for adolescents’ active transport to school: Modification of an environmental audit tool and protocol (MAPS global SN). International J ournal of Environmental Research and Public Health, 17(7), DOI: 10.3390/ijerph17072194

Ramanathan, S., O’Brien, C., Faulkner, G., & Stone, M. (2014). Happiness in motion: Emotions, well being, and active school travel. Journal of School Health, 84(8), 516 523. DOI: 10.1111/josh.12172

Rigby, J. P. (1979). Review of Research on School Travel Patterns and Problems. TRRL Supplementary Report. https://trid.trb.org/view/142762

Rodriguez, N. M., Arce, A., Kawaguchi, A., Hua, J., Broderick, B., Winter, S. J., & Ki ng, A. C. (2019). Enhancing safe routes to school programs through community engaged citizen science: Two pilot investigations in lower density areas of Santa Clara County, California, USA. BMC Public Health, 19(1), 1 11. DOI: 10.1186/s12889 019 6563 1

Savoy, J. (2005). Bibliographic database access using free text and controlled vocabulary : an evaluation. Information Processing and Management, 41, 873 890. DOI: 10.1016/j.ipm.2004.01.004

Schlossberg, M., Greene, J., Phillips, P. P., Johnson, B., & Parker, B. (2006). School trips: Effects of urban form and distance on travel mode. Journal of the American Planning Association, 72(3), 337 346. DOI: 10.1080/01944360608976755

Sersli, S., Rothman, L., & Winters, M. (2019). Getting at Mode Share: Comparing 3 Methods of Travel Mode Measurement for School Travel Research. Journal of School Health, 89(5), 365 372. DOI: 10.1111/josh.12743

Singh, N., & Vasudevan, V. (2018). Understanding school trip mode choice The case of Kanpur (India). Journal of Transport Geography, 66, 283 290. DOI: 10.1016/j.jtrangeo.2017.12.007

Spallek, M., Turner, C., Spinks, A., Bain, C., & McClure, R. (2006). Walking to school: Distribution by age, sex, and socio economic status. Health Promotion Journal of Australia, 17(2), 134 138. DOI: 10.1071/he06134

Stewart, T., Duncan, S., Chaix, B., Kestens, Y., Schipperijn, J., & Schofield, G. (2015). A novel assessment of adolescent mobility: A pilot study. International Journal of Behavioral Nutrition and Physical Activity, 12(1). DOI: 10.1186/s12966 015 0176 6

Tudor Locke, C., Ainsworth, B. E., & Popkin, B. M. (2001). Active commuting to school: An overlooked source of childrens’ physical activity?. Sports Medicine, 31(5), 309 313. DOI: 10.2165/00007256 200131050 00001

United Nations. (2016). World Economic Situation & Prospects: Report 2021 https://www.un.org/development/desa/dpad/publication/world economic situation and prospects 2019/

Wilson, K., Clark, A. F., & Gilliland, J. A. (2018). Understanding child and parent perceptions of barriers influencing children’s active school travel. BMC Public Health, 18(1), 1053. DOI: 10.1186/s12889 018 5874 y

Woods, C. B., & Nelson, N. M. (2014). An evaluation of distance estimation accuracy and its relationship to transport mode for the home to school journey by adolescents. Journal of Transport and Health, 1(4), 274 278. DOI: 10.1016/j.jth.2014.07.001

Xiong, H., Ma, L., Wei, C., Yan, X., Srinivasan, S., & Chen, J. (2019). Exploring Behavioral Heterogeneities of Elementary School Student’s Commute Mode Choices Through the Urban Travel Big Data of Beijing, China. IEEE Access, 7, 22235 22245. DOI: 10.1109/ACCESS.2019.2897890

Yan, Y., Burke, M., & Leung, A. (2019). Travel behavior differences between private and public school students in South East Queensland. In Proceedings of Australasian Transport Research Forum, ATRF 2019 https://api.elsevier.com/content/abstract/scopus_id/85078989882

Yarlagadda, A. K., & Srinivasan, S. (2008). Modeling children’s school travel mode and parental escort decisions. Transportation, 35(2), 201 218. DOI: 10.1007/s11116 007 9144 6

Zhang, R., Yao, E., & Liu, Z. (2017). School travel mode choice in Beijing, China. Journal of Transport Geography, 62(June), 98 110. DOI: 10.1016/j.jtrangeo.2017.06.001

Zupic, I., & Čater, T. (2014). Biblio metric Methods in Management and Organization. Organizational Research Methods, 18(3), 429 472. DOI: 10.1177/1094428114562629

Zavareh, M. F., Abolhasannejad, V., Mamdoohi, A. R., & Nordfjærn, T. (2020). Barriers to children’s walking to school in Iranian a nd Chinese samples. Transportation Research Part F: Traffic Psychology and Behavior, 73, 399 414. DOI: 10.1016/j.trf.2020.07.008

Mukhlis Nahriri Bastam is a Ph.D. student at the Civil Engineering Programme, University Kebangsaan Malaysia. His research areas are Transportation Engineering, Transportation Modelling, Transport Behavior.

Muhamad Razuhanafi Mat Yazid is a Senior Lecturer at the Department of Civil Engineering, Faculty of Engineering & Built Environment. His research areas are in Transportation, Transportation Planning, Transportation Systems, Public Transport

Muhamad Nazri Borhan is a Senior Lecturer at the Department of Civil Engineering, Faculty of Engineering & Built Environment. His research areas are in Structural Equation Modeling, Physical Properties, Tensile Strength, Injury Prevention, Civil Engineering, Safety Engineering, Public Transport

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

The Effect of Consumption Values on Customer Satisfaction of Living Room Furniture in Saudi Arabia

1Department of Resource Management and Consumer Studies, Faculty of Human Ecology, Universiti Putra Malaysia, Selangor, MALAYSIA.

2Department of Home Economics, Universiti of Bisha, Bisha, SAUDI ARABIA

*Corresponding Author (Tel: +601111762599, Email: fattwo.makkawi1437 @gmail.com).

Paper ID: 13A5G

Volume 13 Issue 5

Received 20 December 2021

Received in revised form 7 April 2022

Accepted 14 April 2022

Available online 21 April 2022

Keywords: Functional value; Public organisations; Behavior Intention; Jeddah; Apartment furnishing; Purchasing apartment; Working women’s satisfaction; Living room; Furniture Satisfaction; Conditional value; Epistemic value ; Emotional value; Social value; Functional value; Aesthetic furniture.

Abstract

The living room in Saudi Arabia context is the centre of the house and makes up the main space, and is the most used room by Saudi women. Hence, satisfaction with furniture is crucial for working women as they carry on doing activities as they return from work. This paper investigates the factors that affect a working woman when purchasing furniture for the living room in Jeddah, Saudi Arabia. Multistage sampling was employed, in which 350 women working in three government sectors in Jeddah: schools, universities, and health sectors were selected for this study. The respondents received the questionnaire through emails, and reliability and normality tests were applied. The multiple regression test examined the consumpti on values predictors on furniture satisfaction. The results revealed that conditional, functional, and emotional values significantly correlated with the satisfaction of working women with the furniture in the living room. Conversely, epistemic and social values had an insignificant relationship. This paper provides a clearer insight into the prominent consumption values variables that significantly affect the furniture satisfaction of working women in their living rooms. Therefore, this study can exhibit and enhance the lifestyle of more working women and help them achieve work life balance using living room furniture by acquiring better knowledge and understanding of consumption values.

Disciplinary: Consumer Studies, Economics, Human Ecology.

©2022 INT TRANS J ENG MANAG SCI TECH.

Cite This Article:

Makkawi, F. A. Hashim, A. H., and Lau, J. L. (2022). The Effect of Consumption Values on Customer Satisfaction of Living Room Furniture in Saudi Arabia. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5G, 1 12 http://TUENGR.COM/V13/13A5G.pdf DOI: 10.14456/ITJEMAST.202 2.91

Fattwo AbdulRahman Makkawi1,2*, Ahmad Hariza Hashim1, Jasmine Leby Lau1

Introduction

The main space and the centre of every house is t he living room, and it is considered a crucial space within the Saudi household in the decision making process to select and purchase home furniture (Sahab, 2019) since the family finds family gathering value because the family members can meet and share their time and activities. Typically, it has more than one use. It can be used for entertaining purposes, relaxing, and as a play space for children. This space is the most used room by Saudi women for their daily home duties (Shatwan, 2018), in which the furniture is often used for relaxation , some for formal sitting and other pieces of furniture are used only for decoration (Hareri, 2018). The furniture needs to be multifunctional in the living room since more flexibility is required Several activities day and night occur in the living room (Garip et al., 2019) For example, the furniture units for sitting in the living room can be used as seats , sofa, coffee table and sometimes as a bed by only displacing them and reconfiguring the modules and components so that the arrangement of furniture and spatial comp onents in the living room affect the satisfaction with the room in terms of efficiency for enhancing usage in daily life activities (Lee et al., 2017). The social and cultural background also strongly influences the choice and arrangement of furniture in a living room. Therefore, Saudi working women are interested in all design details , and luxurious furniture is positioned in the women' s zones to reflect the family's socio economic status (Alharkan, 2017). A study conducted by Hareri (2018) established that a substantial fraction of the housewives was satisfied with the living rooms and furniture design, but others would choose to renovate because the existing layout and furniture were boring due to overuse. Ergüden (2012) argues that careful and wise selection of furniture is among the most critical factors in attaining a comfortable and relaxed sitting room. Each furnishing should thus be selected to be compatible with the other and coordinated in various ways (Mashhour, 2011). Similarly, Öztop et al. (2008) showed that the most critical factors in women' s choice of living room furniture are the aesthetics and functionality of the furniture and usability. Thus, this paper aims t o study the consumption value factors that affect living room furniture satisfaction among Saudi working women.

Figure 1: The study's theoretical framework.

According to Sheth et al. (1991), a theoretical framework was proposed, as illustrated in Figure 1. "Theory of Consumption Values" developed as a better "fit" for home furnishings was considered the theoretical framework for the study. This theory supposes that multiple and independent consumption values influence choice behaviour, focusing on these five elements: conditional values, functional values, emotional values, social values, and epistemic values, where each value contributes differently to different selection situations (Burnsed & Hodges, 2014). Thus , it is an essential factor in women's evaluation of their satisfaction with living room furniture.

2 Rese arch Method

This paper aimed to determine the consumption values that influence the satisfaction with living room furniture among Saudi working women in all public organisations for education and health in Jeddah, Saudi Arabia. Based on this, the underlying values of consumption were (conditional value, functional value, emotional value, epistemic value, and social value). Accordingly, the survey questionnaire was developed with closed ended questions to achieve research objectives . Moreover, to select study participants, a multistage sampling method was used in which a process of steps was carried out to select study participants (Taherdoost, 2016).

2.1 Sample Size and Techniques

The sample type and size need to represent the general population, allowing generalising the study findings to a broader population (Mohajan, 2020). The working women in Jeddah, Saudi Arabia, were the population for this research. Random sample selection is an essential aspect of quantitative research, especially when generalisati on is needed of the results on the community (Apuke, 2017; Gravetter & Wallnau, 2013). This study adopted the multistage sampling technique in selecting its respondents, in which a process is implemented in selection through several stages. It is crucial to have a larger sample to represent the study population. According to Mohamed and Daud (2018), sampling sizes are from 30 and less than 500, which is suitable for most of the research. To calculate the sampling size of this study, the researcher uses the criterion formula used in calculating the minimum requirement for sample for a particular survey design (Bartlett et al., 2001). The resulted samples size was 384. The confidence level utilised in the study is 95%, which correlates to the standard normal distribution of 1.96 (Bartlett et al., 2001). Also, similarly predicted or probable studies are assumed to be 50% because the data set is categorical, while the maximum allowable deviation or estimation error is assumed to be ±5% for categorical data, accor ding to Altman and Bland (2005). Taherdoost (2016) added that, when sending surveys by mail, the sample size will increase from about 40% to 50%, which helps to account for non responding and mail errors. In this regard, 45% of the determined sample size was added. Thus, 557 questionnaires were distributed through email, larger than the recommended sample.

2.2 Sampling Procedure

Due to the difficulty in data collection, this research adopts a multistage sampling technique because of the population's dispersed nature. The sampled unit was split into secondary units (Ni ),

and another sample wa s also randomly chosen. Ni has to be less than N in multistage sampling. Moreover, when an exhaustive listing of the target population cannot be compiled, multistage sampling is recommended (Sedgwick, 2015). For example, the working women listed in the schools , universities, and hospitals combined in Jeddah, Saudi Arabia, do not exist, but a list of the universities, schools and hospitals exists.

Table 1: Number of employment cluster s for women in Jeddah Region

Employment Cluster Northern Region Eastern Region Southern Region Middle Region Total Schools 190 183 182 147 702 Hospitals 4 2 2 6 14 Universities 1 0 0 1 2

Since there is no information about the number of working women in the target population, the researcher identified the list of the schools, hospitals, and universities in Jeddah region, see Table 1. Since the targeted population sample is homogeneous, this research adopts a purposive random sampling based on a homogenous sampling technique (Palinkas et al., 2015) Furthermore, the two stage sample method was applied in this research. A sample of schools , hospitals, and universities was selected from the total of combined organisations in Jeddah. This comprises the first stage of the multistage sampling procedure. Consequently, a random sample of schools, hospitals, and universities was obtained in the second stage About 185 forms were distributed to working women in each employment cluster in Jeddah, Saudi Arabia, at the final phase. The distributed and returned questionnaires number and the response rate are illustrated in Figure 2.

Figure 2: The distribut ed and r eturned questionnaires and response rate

2.3 Construct Measure

The survey questionnaire was divided into three parts (the information about demographical characteristics, consumption values, and living room furniture satisfaction) . It was adapted from (Gan and Wang 2017; Chai et al. 2018). The five point Likert scale was used to measure the independent and dependent variables, ranging from " strongly disagree" (1) to "strongly agree" (5) to respondents' accurate perception of exact questions (Hoe et al. 2018).

2.4 Data Analysis Method

A descriptive analysis using SPSS software was implemented to determine the correlation between the tested variables and analyse multiple linear regression analyses to identify the degree to which consumption values affected the satisfaction of Saudi working women with the living room furniture. Moreover, the distributed data normality and the equality of variances of the variables were checked with normality plots and scatter plots.

2.5 Reliability Analysis

This study assesses the internal scale consistency using Cronbach's alpha reliability test since this test is widely accepted as an indicator of reliability (Chen et al., 2017). Moreover, the reliability coefficient ranges from 0 to 1, and the minimum acceptable reliability is 0.70 (Mohajan 2017). Table 2 revealed that the constructs' reliability values are between 0.805 and 0.901. Hence, all reliability values (Cronbach' s alpha) for consumption values (conditional, epistemic, emotional, social , and functional value) and living room furniture satisfaction were greater than the recommended values of 0.70.

Table 2: The results of the reliability test

Test Variable Number of Items

The score of Cronbach 's Alpha

Living room Furniture Satisfaction 4 0.901 Conditional Value 5 5 point Likert scale

0.899 Epistemic Value 6 0.805 Emotional Value 7 0.872 Social Value 8 0.814 Functional Value 10 0.883 Overall Consumption Values 40 0.887

3 Results Analysis and Discussion

The sample study was the working women in public organisations in Jeddah Region, Saudi Arabia. Statistical data on a range of demographic characteristics were provided by the frequency descriptive analysis, including age, level of education, marital status, years of marriage, employment sector, number of family members, house rooms number and average monthly income. The study found that 38.3% of the working women surveyed were aged 34 41 years old. Women with a bachelor' s degree comprise the majority, holding 60.6% of educational degrees. This indicates the increasing interest of women in pursuing a university degree.

Regarding the respondents ' marital status, married women constitute the majority (58.3%). Most working women have been married for eight years or longer (46%), and becoming a wife and mother are their most important priorities. The findin gs show an almost equal distribution among the three employment sectors, with 34.9% of respondents working in general education, 33.1% working in higher education, and 32% working in the health sector. Most respondents (63.7%) have five rooms in their houses , and 35.4% have four or five family members, where the size of the family is directly correlated with the number of rooms in the house. It was revealed that 55.7% of respondents earned 6000 Riyals or more per month, approximately $1600.

3.1 Descriptive Analysis

According to Bell et al. (2018), descriptive analysis is used to describe data sets' basic characteristics, and it is often used to summarise and inspect large amounts of data. Table 3 indicates that working women are satisfied with their living room furniture. The mean statistic of living room furniture satisfaction is the highest (M = 4.44; SD = 0.52). The conditional value has the second highest mean value (4.23), while the social value has the smallest mean value (3.66). This implies that social value is the least element associated with furniture satisfaction.

Table

3

: Descriptive Statistics results

Variables Code N Max. Min. Mean SD

Conditional Value CV 350 5.00 2.20 4.23 0.60

Emotional Value EV 350 5.00 2.14 3.95 0.63

Epistemic Value EPV 350 5.00 1.17 3.68 0.70

Functional Value FV 350 5.00 2.50 4.22 0.52 Social Value SV 350 5.00 1.50 3.66 0.67

Living room Furniture Satisfaction LFS 350 5.00 2.25 4.44 0.52

3.2 Correlation Test Analysis

The correlation between independent and dependent variables was examined using Pearson's correlation test According to Table 4 results, the relationship between all independent variables (CV, EPV, FV, and SV) is significant except for the emotional value variable (EV). The conditional value (0.791) and satisfaction with the furniture were significantly correlated. Therefore, if the correlation analysis shows a positive coefficient, a direct relationship exists between the independent and dependent variables.

Table 4: The results Correlation test between the variables of consumption value and furniture satisfaction in the l iving room

Variables LFS FV EV SV EPV CV

Living room Furniture Satisfaction (LFS) 1

Functional Value (FV) .538 ** 1

Emotional Value (EV) .022 .100 1 Social Value (SV) .198 ** .206** .017 1

Epistemic Value (EPV) .207 ** .184** .064 .689** 1 Conditional Value (CV) .791 ** .435** .052 .285** .311** 1 **. Significant correlation at 0.01 level (2 tailed).

3.3 Normality Test

The normal distribution is the most widely used a mong statistical distributions (Alasmri et al., 2019). The normal distribution shape depends on the results of standard deviation and mean. The standard deviation results in Figure 3 with a value of about 0.993 are considered closed.

3.4 Linearity

Linearity refers to how closely the correlation between the dependent variable change and the change in independent variables (Betemariam & Mesfin, 2018). Figure 4 shows that the collected data exhibits a normal distribution of residuals around a mean of zero since each point lies near or along the regression line. Though, a slight misalignment can be seen at the mid point and top right points, which are still within the tolerance range.

Frequency

Mean = 9.11E 15 SD = 0.993 N = 350

Regression Standardised Residual

Normal P -P Plot of Regression Standardised Residual Dependent Variable: Living room furniture satisfaction Expected Cum Prob

Observed Cum Prob

Figure 3: Regression standardi sed residuals plot (Dependent Variable: Living room Furniture Satisfaction). Figure 4: Regression standardi sed residuals results for living room Furniture Satisfaction

3.5 Test of Multicollinearity

Table 5 shows the tolerance and VIF for the latent variables. The diagnostic test for multiple collinearities did not indicate significant collinearities between the study variables, as all values of tolerance are between 0.509 and 0.986 and greater than 0.10. Also, all values of VIF are between 1.015 and 1.966 and less than 10 (Sekaran, 2003).

Table 5: The results of T olerance and VIF for Variables

Variables Collinearity Statistics Code Tolerance VIF

Functional Value FV 0.797 1.255

Emotional Value EV 0.986 1.015 Social Value SV 0.515 1.941

Epistemic Value EPV 0.509 1.966

Conditional Value CV 0.752 1.329

a. Dependent Variable: Living room Furniture Satisfaction (LFS)

3.6 Multiple Linear Regression Analysis

Cohen et al. (2003) explain that multiple regression is the sample squared correlation coefficient between the response variable and the predicted value of the regression model. Gujarati (2004) states that the value of the R square should be a minimum of 60% for all variables. For significant F, the results should be between 0.01 and 0.05 (Blackwell, 2008). The value of Durbin

Watson should be between 2.5 and 1.5 (Bakon & Hassan, 2013). Table 6 shows that the model result of the adjusted R2 is 0.677, and the R2 value is 0.681, which indicates 68% of the influence on living room satisfaction.

Another 32% of the space is unspecified using the current model with the current independent variables including functional, conditional, emotional, social, and epistemic values . Therefore, other important variables in explaining furniture satisfaction have yet to be considered in this research. It is suitable for the model with the F of [F (5, 344) = 146.989] and a p value of less than 0.001; the independent variables describe the dependent variables very well. Using Durbin Watson, the autocorrelation for the sample of respondents picked for this study is 1.780, which should be between 1.5 and 2.5. Hence, all independent variables investigated in this study are strongly correlated with the dependent variable, and they are the factors affecting the satisfaction with living room furniture among working women, as presented in Table 6.

Table 6: Results of Linear Regression Analysis

Model R R Square Adjusted R Square Standard Error of the Estimate Change Statistics Durbin Watson R Square Change F Change df1 df2 Sig. F Change

1 0.825a 0.681 0.677 0.29681 0.681 146.989 5 344 0.000 1.780

Predictors: (Constant), Conditional Value, Functional Value, Social Value, Emotional Value, and Epistemic Value b. Dependent Variable: Living room Furniture Satisfaction (LFS)

3.7 Multiple Regression Coefficients Analysis

The Multiple Regression Coefficient Beta was employed to define the independent variable's predictive ability on the dependent variables. According to Green and Salkind (2005) and Lee (2010), each individual or condition in multiple regression analysis contains scores of the multiple independent and dependent variables. Therefore, independent variables of the multiple linear regression equations are the consumption values; namely, functional value (FV), emotional value (EV), social value (SV), epistemic value (EPV), conditional value (CV), and the dependent variable of the multiple linear regression equation s is living room furniture satisfaction (LFS). A s shown in Table 7, the collinearity statistics analysis has the VIF value range of 1.015 to 1.966 and a tolerance range of 0.50 to 0.98. Accordingly, the VIF and tolerance values indicate no serious multicollinearity problem with this analysis.

Based on Table 7, the results of the regression analysis referred to the conditional value (B = 0.615, p< 0.05), the functional value (B = 0.253, p < 0.01), and the emotional value (B = 0.067, p < 0.05), which only has a significant influence on working women’s satisfaction with living room furniture. However, working women’s satisfaction with living room furniture was not significantly affected by the two other consumption values, epistemic value (B = 0.024, p > 0.05) and social value (B = 0.024, p > 0.05). The women stated that the furniture's aesthetics and functionality in the living room are two important values. They also emphasis ed the importance of having appropriate furniture in the living room and enough numbers for their family members. Previous

studies have similar findings (Öztop et al. 2008; Saruwono et al. 2012; Lee et al. 2017; Hareri 2018; Esen and Uysal 2019).

Table 7: The results of multivariate regression coefficients with the Livingroom Furniture Satisfaction variable

Model

Unstandardised Coefficients Standardised Coefficients t Sig.

Collinearity Statistics B Std. Error Beta Tolerance VIF

1 (Constant) 0.681 .192 3.553 .000

Conditional Value 0.615 .031 .704 20.061 .000 0.752 1.329

Functional Value 0.253 .034 .252 7.378 .000 0.797 1.255

Epistemic Value .024 .032 .032 .747 .456 0.509 1.966

Emotional Value .067 .025 .081 2.634 .009 0.986 1.015 Social Value .024 .033 .031 .729 .466 0.515 1.941

Dependent Variable: Living room Furniture Satisfaction (HFS)

Generally, the regression analysis results revealed that conditional value, emotional value, and functional value significantly influence the satisfaction of working women with living room furniture. Conversely, epistemic value and social value have an insignificant influence on the satisfaction of working women with the furniture in the living room.

4 Conclusion

The living room is the centre of the house and makes up the central space within a Saudi household in the furniture purchasing decision making process. The study reveals that the basic arrangement of furniture is highly controlled by the restricted area of the living room. Due to the minimal space provided , working women need to consider the sizes and types of furniture they choose because it should consider their individuality and reflect their daily lifestyle. The study was conducted to bridge the gap between consumption values and working women's satisfaction with living room furniture. These results reinforce the role of the Theory of Consumption Values in determining living room furniture satisfaction among working women. The study provides insight into working women by investigating values that can influence their satisfaction, such as conditional, functional, and emotional values. Therefore, Saudi women are the key decision makers in determining the style, shape, design, and colour of the living room furniture to ensure the proper distribution of every piece according to the size and function. The research findings have practical implications in that Saudi working women, in general, can now clearly identify the significant factors that can significantly affect their satisfaction with furniture in the living room. Thus, this study can provide knowledge of consumption values and consequently allow them to improve and display more women's lifestyles and effectively balance work and home activities. This research can be applied to policymaking with the help of research based decision making and to develop and implement pr ograms that help working women choose furniture for their homes that best suits their lifestyle and activities at home. Additionally, this study can help professionals interested in designing and marketing furniture (furniture companies, retailers, and designers) by creating markets targeted at increasing furniture sales and women's satisfaction with furniture quality

5 Availability o f Data and Material

Data can be made available by contacting the corresponding author.

6 References

Akbar, S. (1998). Home and furniture: Use and meaning of domestic space, Jeddah, Saudi Arabia. Newcastle University.

Alasmri, M., Onn, W. C., & Hin, H. S. (2019). Social networking framework for learning motivation. Journal of Southwest Jiaotong University, 54(6), 1 14.

Alharkan, L. S. (2017). Housing Morphology, Gender, and Family Relationships in Jeddah, KSA (1940 2017). University of Cincinnati, Cincinnati, OH.

Alsusi, R. (2015). The effect of design flexibility on housing utilisation efficiency in the Gaza Strip: with reference to multifunctional interior spaces. Islamic University, Gaza.

Altman, D. G., & Bland, J. M. (2005). Standard deviations and standard errors. BMJ, 331(7521), 903.

Apuke, O. D. (2017). Quantitative research methods: A synopsis approach. Kuwait Chapter of Arabian Journal of Business and Management Review, 33(5471), 1 8.

Bakon, K. A., & Hassan, Z. (2013). Perceived value of smartphone and its impact on deviant behaviour: An investigation on higher education students in Malaysia. International Journal of Information System & Engineering, 1(1), 38 55.

Bartlett, J. E., Kotrlik, J. W., & Higgins, C. C. (2001). Organi sational research: Determining appropriate sample size in survey research. Information Technology, Learning, and Performance Journal, 19(1), 43 50.

Bell, E., Bryman, A., & Harley, B. (2018). Business research methods 5th Ed , Oxford: Oxford university press.

Betemariam, T., & Mesfin, T. (2018). Factors Affecting Consumers' Buying Decision for Home Furniture Materials In the case of Customers at Jemo Condominium Site. Addis Ababa University, Addis Ababa.

Blackwell, M. (2008). Multiple hypothesis testing: The F test. In Matt Blackwell Research. Oxford.

Burnsed, K. A., & Hodges, N. J. (2014). Home furnishings consumption choices: a qualitative analysis. Qualitative Market Research: An International Journal, 17(1), 24 42.

Chai, K. Y. S., Li, Y. Y., Lim, W. L., & Ong, S. P. (2018). Factors influencing consumer satisfaction in online shopping. Universiti Tunku Abdul Rahman (UTAR), Kampar, Perak.

Chen, L. L., Basit, A., & Hassan, Z. (2017). The Impact Of Customer Percei ved Value On Customer Satisfaction: A Study On Malaysian Automobile Industry. International Journal of Accounting & Business Management, 5(1), 93 110.

Cohen, J., Cohen, P., West, S. G., & Aiken, L. S. (2003). Applied multiple regression/correlation analysis for the behavioural sciences (3rd ed.). Mahwah, NJ: Erlbaum.

Ergüden, T. (2012). The Importance of Soft Furnishings in Interior Spaces. Pilot Study Living Spaces. Eastern Mediterranean University (EMU), Famagusta.

Esen, R., & Uysal, B. (2019). The analysis of living room furniture and room spaces used by families relation of West Black Sea Region in Turkey. Engineering Science and Technology, an International Journal, 22(2), 692 696.

Gan, C., & Wang, W. (2017). The influence of perceived value on purchase intention in social commerce context. Internet Research, 27(4), 772 785.

Garip, S. B., Onay, N. S., Garip, E., & Güzelci, O. (2019). Flexible and Modular Furniture Design for Changing Living Environments. In C. Söğütlü (Ed.), The XXIX International Conference Research for Furniture Industry (pp. 547 554). Ankara: Gazi University.

Gravetter, F. J., & Wallnau, L. B. (2013). Introduction to the t statistic. In F. J. Gravetter & L. B. Wallnau (Eds.), Essentials of Statistics for the Behavioral Sciences (8th ed., pp. 249 278). Boston, MA: Cengage Learning.

Green, S. B., & Salkind, N. J. (2005). Using SPSS for Windows and Macintosh: analysing and understanding data. In Upper Saddle River 4th Ed , Upper Saddle River, NJ: Pearson Prentice Hall.

Gujarati, D. N. (2004). Basic Econometrics 4th Ed , New York: McGraw Hill Companies.

Hamenda, A. (2018). An integrated model of service quality, price fairness, ethical practice and customer perceived values for customer satisfaction of sharing economy platform. International Journal of Business & Society, 19(3), 709 724.

Hareri, R. H. (2018). Contemporary home environment in Jeddah City: women and the design of living spaces University of Edinburgh, Edinburgh.

Hoe, J., Dastane, O., & Selvaraj, K. (2018). Predicting consumer perception and its impact on purchase intention for residential property market. Journal of Technology Management and Business, 5(2), 59 77.

Lee, A. S. (2010). A Study on Predicting Consumers' Satisfaction Based on The Features of Furniture Product Designs. International Journal of Organizational Innovation, 2(3), 138 160.

Lee, S., Alzoubi, H. H., & Kim, S. (2017). The effect of interior design elements and lighting layouts on prospective occupants' perceptions of amenity and efficiency in living rooms. Sustainability, 9(7), 1119.

Marshall, E. (2016). The statistics tutor's quick guide to commonly used statistical tests. Loughborough: Statstutor Community Project.

Mashhour, A. (2011). The Positive effects of Interior Design for Human Psychological Health (Helwan University). Helwan University, Helwan. https://doi.org/10.13140/RG.2.1.2936.2168

Mohajan, H. K. (2017). Two criteria for good measurements in research: Validity and reliability. Annals of Spiru Haret University, 17(4), 59 82.

Mohajan, H. K. (2020). Quantitative research: A successful investigation in natural and social sciences. Journal of Economic Development, Environment and People, 9(4), 50 79.

Mohamed, I. S., & Daud, N. M. (2018). Examining Moderating Role of E Commerce Experience On Usage Performance Relationship. Asia Pacific Journal of Advanced Business and Social Studies, 4(2), 16 27.

Öztop, H., Erkal, S., & Gunay, G. (2008). Factors influential in consumers' furniture selection and their preferences regarding product features. The International Journal of Interdisciplinary Social Sciences, 3(6), 23 34.

Palinkas, L. A., Horwitz, S. M., Green, C. A., Wisdom, J. P., Duan, N., & Hoagwood, K. (2015). Purposeful sampling for qualitative data collection and analysis in mixed method implementation research. Administration and Policy in Mental Health and Mental Health Services Research, 42(5), 533 544.

Sahab, S. (2019). An Investigation of Sustainable Consumption Behaviour in Relation to Indoor Domestic Soft Furniture Consumption in The Context of Riyadh, Kingdom of Saudi Arabia. The University of Manchester, Manc hester.

Saruwono, M., Zulkiflin, N. F., & Mohammad, N. M. N. (2012). Living in living rooms: furniture arrangement in apartment type family housing. Procedia Social and Behavioral Sciences, 50, 909 919.

Sedgwick, P. (2015). Multistage sampling. British Medical Journal, 351, 4110 4155. https://doi.org/10.1136/bmj.h4155

Sekaran, U. (2003). Research Methods for Business: A Skill Building Approach (4th ed.). New York: Wiley.

Shatwan, A. M. (2018). Domestic window design and interior daylight in Jeddah: designing for Saudi women. University of Hertfordshire, Hertfordshire.

Sheth, J. N., Newman, B. I., & Gross, B. L. (1991a). Consumption Values and Marketing Choices. Cincinnati, OH: South Western Pub.

Sheth, J. N., Newman, B. I., & Gross, B. L. (1991b). Why we buy what we buy: A theory of consumption values. Journal of Business Research, 22(2), 159 170.

Taherdoost, H. (2016). Validity and Reliability of the Research Instrument; How to Test the Validation of a Questionnaire/Survey in a Research. International Journal of Academic Research in Management (IJARM), 5(3), 28 36.

Walsh, G., Shiu, E., & Hassan, L. M. (2014). Replicating, validating, and reducing the length of the consumer perceived value scale. Journal of Business Research, 67(3), 260 267.

Fattwo AbdulRahman Makkawi is a master's student at the Faculty of Human Ecology, Universiti Putra Malaysia. She obtained a bachelor's degree in General Home Economics from the Education and Home Economics Faculty, Umm Al Qura University. Her research areas include Economics & Management, Interior Design, and Sustainable Consumption

Professor Dr Ahmad Hariza Hashim is a Professor in Housing and Environment at the Faculty of Human Ecology, Universiti Putra Malaysia. Currently, he is the Dean of Post Graduate Studies, Industry and Community Relations. His research focuses on Housing, Environmental Psychology, Sustainable Consumption, Consumer Education.

Dr. Jasmine Lau Leby is a Senior Lecturer in the Department of Resource Management and Consumer Studies, University Putra Malaysia. She got her Ph.D. degree in Housing from Universiti Putra Malaysia, Malaysia. Her primary research interest involves Housing, Management & Organisation, and Environmental Psychology.

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

http://TuEngr.com

Effects of Polypropylene Fibres on the Properties of Reinforced Structural Lightweight Concrete Made With Expanded Clay Aggregates

K.K. Gaayathri1*. K. Suguna1, P.N. Raghunath1

1 Department of Civil and Structural Engineering, Annamalai University, INDIA.

*Corresponding Author (Email: gaayathrikk14 @gmail.com)

Paper ID: 13A5H

Volume 13 Issue 5

Received 14 January 2021 Received in revised form 8 April 2022 Accepted 15 April 2022 Available online 22 April 2022

Keywords:

Compressive strength; Expanded Clay Aggregate (ECA); Flexural strength; Lightweight concrete; Modulus of elasticity; Modulus of rupture; Polypropylene fibres.

Abstract

All efforts are being made to tailor the properties of concrete by replacing binder and filler with appropriate materials based on the environmental conditions. Many prospective players came into vogue for the purpose. Expanded clay showed promise for use in structural lightweight concrete. The addition of discontinuous discrete fibres proved to be beneficial in further improving the performance of structural lightweight concrete. A comprehensive laboratory investigation has been carried out to assess the influence of polypropylene fibres on the properties of expanded clay based structural lightweight concrete. Expanded clay aggregates (ECA) have been used in varying percentages of 10%, 20%, 30%, 40% to replace coarse aggregates. Polypropylene fibres have been used in volume fractions of 0.1%, 0.2%, 0.3% and 0,4%. Based on trials, the optimum dosage of expanded clay aggregates for meeting the workability and strength requirements has been obtained. The laboratory results showed that the inclusion of polypropylene fibres improved the properties of structural lightweight concrete appreciably.

Disciplinary: Civil Engineering & Technology (Structural & Construction Materials).

©2022 INT TRANS J ENG MANAG SCI TECH.

Cite This Article:

Gaayathri, K.K., Suguna, K., Raghunath, P.N. (2022). Effects of Polypropylene Fibres on the Properties of Reinforced Structural Lightweight Concrete Made With Expanded Clay Aggregates International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5H, 1 11 http://TUENGR.COM/V13/13A5H.pdf DOI: 10.14456/ITJEMAST.2022 92

1 Introduction

Structural lightweight concrete is finding its place in many applications such as buildings, bridges, floors and partitions. The inherent characteristics of structural lightweight concrete that make it preferable include lower density, higher specific strength, good thermal insulation and better durability. The density of concrete is of primary concern in the context of the self weight of

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies

structural members. In many structures , self weight forms an appreciable proportion of the total load. Reduced density of structural lightweight con crete results in reduced self weight of structural members which is quite important in seismic resistant design. It is relatively understandable that the addition of micro reinforcement enhances the overall performance in general. The improved mechanical properties of struct ural lightweight concrete as a result of the inclusion of micro reinforcement makes it fit for use in load bearing structural members also.

The addition of steel fibre to high strength lightweight concrete is extremely effective in improving the strength and fracture toughness (Jianming Gao et al. 1997). The longitudinal tensile reinforcement ratio compatible with flexural ductility is somewhat lower for LWAC beams when compared to NWAC (Bernardo et al. 2016). The methods contained in the American code of p ractice (ACI 318 2005 and ACI 213 2003) for LWAC can predict the cracking and ultimate strength quite accurately (Lim et al., 2006). The optimal HPPFs content t of 1.1% and SFs content of 2.0% improved the flexural toughness of plain concrete (Li et al. 2017). The addition of 1.5% polypropylene fibre increased the compressive and split tensile strength. (Sohaib et al., 2018). The use of industrial waste steel wires can be used as micro reinforcement for improving the mechanical properties of lightweight concrete. (Aghaee et al., 2014).

In this study, efforts have been made to study the behaviour of expanded clay based structural lightweight concrete with the inclusion of polypropylene fibres in varying volume fractions.

In building systems, the dead load is of greater concern. Attempts need to be made to reduce the dead load as much as practicable. In this context, structural lightweight concrete gains importance (Sakthivel and Saravanan, 2022; Thongjub et al., 2022). The introduction of fibres into lightweig ht concrete enhances its flexural strength, compressive strength and deformation capacity appreciably. The sizes of member sections also get reduced leading to an economical solution. Further the serviceability of member sections also improves through reduced crack widths. Hence an attempt has been made to realise the impact of including polypropylene fibres on the properties of expanded clay based structural lightweight concrete.

2 E xperimental Programme

2.1 Materials

2.1.1 Cement

Ordinary Portland Cement of grade 53 conforming to IS 12269: 2013 was used in this investigation. The properties of cement used are given in Table 1.

Table 1: Properties of Cement Property Value

Specific gravity 3.15 Standard consistency 33%

Initial setting time 55 minutes

Final setting time 380 minutes

2.1.2 Coarse Aggregate

The coarse aggregate used was crushed granite of a maximum particle size of 20mm and conforming to IS 383:2016. Expanded Clay Aggregate (ECA) (Figure2) was used to partially replace coarse aggregate.

Table 2: Properties of Coarse Aggregate Property Crushed Granite Aggregate Expanded Clay Aggregate

Specific gravity 2.68 0.57 Water absorption 0.7 15.5% Shape Angular Rounded Bulk density 1600 kg/����3 600 kg/����3

2.1.3 Fine Aggregate

A combination of natural river sand (R sand) conforming to IS383: 2016 and manufactured sand (M sand) was used as fine aggregate in this study. Trials were made to arrive at the combination of R sand to M sand. R sand 55% and M sand 45% combined were found to be beneficial. The specific gravity of the combine was found to be 2.66.

2.1.4 Polypropylene Fibre

Commercially available Recron 3S fibres (Figure3) were used in this study. The fibres are compatible with all admixtures used in concrete which conform to ASTM C1116.

Table 3: Properties of Polypropylene Fibres Property Value Length 12mm Shape Triangular Effective Diameter 40 micron Specific Gravity 0.91 Tensile Strength 4 GPa Elongation 90% Elasticity Modulus 4000 MPa Alkaline Stability Very good

2.1.5 Super Plasticizer

An SNF based high range water reducing admixture Conplast SP430 (Figure1) was used to satisfy the workability demand of each mix. The product Conplast SP430 conforms to ASTM C494. The dosage for all the mixes was arrived at through trials.

Table 4: Properties of Super Plasticizer

Property Value Appearance Liquid Colour Brown Specific gravity 1.18 Chloride content Nil

Figure 1: Super Plasticizer

2.2 Control Specimens

Cube Specimens (3 cubes for each mix) of size 150 X 150 X 150 mm were cast and tested for determining the compressive strength of concrete.

Cylinder Specimens (3 cylinders for each mix) of size 150 X 300 mm were cast and tested for determining the compressive strength of concrete.

Cylinder Specimens (3 cylinders for each mix) of size 150 X 300 mm were cast and tested for determining the elasticity modulus of concrete

Prism Specimens (3 prisms for each mix) of size 100 X 100 X 500 mm were cast and tested for determining the flexural strength of concrete.

2.2.1 Preparation of Control Specimens

The ingredients were first mixed in a dry state and then fibres were added in smaller quantities to avoid balling of fibres. The prepared wet (water plus SP) concrete was placed in equal layers in the moulds and thoroughly compacted. The specimens were removed after 24 hours from the moulds and then cured continuously for 28 days in a tank. After drying, the specimens were tested for compressive strength, elasticity modulus and flexural strength respectively. The details of control specimens are given in Table 5.

Table 5: Details of Control Specimens

Expanded Clay Aggregate (kg)

River Sand (kg)

M Sand (kg)

Fibre Volume %

1 EC0 0.5 175 350 995.8 52.17 377.85 309.15 0 2 EC1 0.5 175 350 995.8 52.17 377.85 309.15 0.1 3 EC2 0.5 175 350 995.8 52.17 377.85 309.15 0.2 4 EC3 0.5 175 350 995.8 52.17 377.85 309.15 0.3 5 EC4 0.5 175 350 995.8 52.17 377.85 309.15 0.4

2.3 Experimental Methods

2.3.1 Slump Test

The concrete mix has been designed as per IS 10262:2019. The workability test has been conducted for all the five mixes as per IS 1199:2008. The SP dosage used and the slump obtained for

Figure 2: Expanded Clay Aggregates

Figure 3: Polypropylene Fibres

each mix are presented in Table 6. A standard mould of 300mm height, 200mm base diameter and 100mm top diameter was used. The fresh concrete was filled into the mould in equal layers and well compacted. The subsidence was measured after the removal of the cone.

Table 6: S lump Test Results

Sl No Designation SP % used Slump(mm)

1 EC0 0.45 60 2 EC1 0.60 57 3 EC2 0.67 58 4 EC3 0.82 56 5 EC4 1.05 57

2.3.2 Compressive Strength Test

A total of 18cubes of size 150×150×150mm (control, with 20 % ECA, with 20% ECA plus 0.1% PPF, with 20% ECA plus 0.2% PPF, with 20% ECA plus 0.3% PPF and with 20% ECA plus 0.4% PPF) were tested as per IS516: 1999 in a standard Compression Testing Machine. Each value represents the average result of three specimens in the same group.

A total of 18 cylinders of size 150×300 mm (control, with 20 % ECA, with 20% ECA plus 0.1% PPF, with 20% ECA plus 0.2% PPF, with 20% ECA plus 0.3% PPF and with 20% ECA plus 0.4% PPF) were tested as per IS 516: 1999 in a standard Compression Testing Machine. Each value represents the average result of three specimens in the same group.

2.3.3 Elasticity Modulus Test

A total of 18 cylinders of size 150×300 mm (control, with 20 % ECA, with 20% ECA plus 0.1% PPF, with 20% ECA plus 0.2% PPF, with 20% ECA plus 0.3% PPF and with 20% ECA plus 0.4% PPF) were tested as per IS 516: 1999 in a standard Compression Testing Machine. The test set up with appropriate instrumentation for this experiment is shown in Figure 4. Each value represents the average result of three specimens in the same group.

2.3.4 Flexural Strength Test

A total of 18 prisms of size 100× 100 X 500 mm (control, with 20 % ECA, with 20% ECA plus 0.1% PPF, with 20% ECA plus 0.2% PPF, with 20% ECA plus 0.3% PPF and with 20% ECA plus 0.4% PPF) were tested as per IS 516: 1999 in a standard loading frame. Figure 5 shows the test. Each value represents the average result of three specimens in the same group

Figure 4: Elasticity Modulus Test on Cylinder

3 Results and Discussion

3.1 Compressive Strength

The compressive strength of expanded clay based structural lightweight concrete with varying fibre volume fractions of polypropylene fibre is presented in Table 7. The average compressive strength of the expanded clay based structural lightweight concrete specimens was 23.55 MPa which confirms ASTM 213R 03. There was an increase in compressive strength by 3.77 % and 10.40 % with the inclusion of 0.1% and 0.2% volume fraction of polypropylene fibres respectively. The compressive strength of concrete with 0.3% volume fraction of polypropylene fibres increased appreciably reaching a peak value of 28.22 N/m ���� 2 . The increase in cube strength may be due to the strong bond between the PP fibres and the matrix. However, the compressive strength of concrete with 0.4% volume fraction of polypropylene fibres got decreased. It is apparent that the decrease in compressive strength for this fibre content may be due to difficulty in dispersing the fibres in the concrete. The percentage gain in cube and cylinder compressive strength is shown in Figure 6 and Figure 7.

Table 7: Compressive Strength Test Results

Designation

Cube Compressive Strength (MPa)

% Gain in Cube Compressive Strength Cylinder Compressive Strength(MPa)

EC0 23.55 18.84

% Gain in Cylinder Compressive Strength

EC1 24.44 3.77 19.58 3.93

EC2 26.00 10.40 20.94 11.15

EC3 28.22 19.83 22.64 20.17 EC4 25.42 7.94 20.37 8.12

Figure 5: Flexure Test on Prism

3.1.1 Failure Pattern

The cube specimens were tested in a compression testing machine of 1000 kN capacity The failure pattern of polypropylene fibre based lightweight concrete cube specimens with expanded clay aggregate is shown in Figure 8. In the early stages, the cracks were concentrated on the surface only. With the increase in axial stress level, the cracks formed earlier propagated towards the interior of the cube specimens. Further, Concrete spalling also occurred at this stage. With the inclusion of polypropylene fibres, the failure pattern of cube specimens changed distinctly. The propagation of crack was found retarded. This is because the internally included polypropylene fibres created a confinement mechanism preventing the tendency of concrete to crack and spall. The volume fraction of polypropylene fibres have been found to influence the failure pattern of cube specimens significantly.

3.2 Modulus of Elasticity

The elasticity modulus of expanded clay based structural lightweight concrete with varying fibre volume fractions of polypropylene fibre is presented in Table 8. The results exhibit an increase of 0.86% in fibre reinforced lightweight concrete when compared to non fibre reinforced concrete. With the further addition of polypropylene fibres, the elasticity modulus increased. The addition of polypropylene fibres by 0.3% increases the elasticity modulus by 10.17%. Similarly, a 0.4% volume fraction of polypropylene fibre increases the elasticity modulus by11.78%. The modulus of elasticity was found to increase with the increase in polypropylene fibre content due to the fibre bridging a ffecting the percentage gain in modulus of elasticity are shown in Figure 9.

Figure 6: Cube Compressive Strength

Figure 7: Cylinder Compressive Strength

Figure 8: Failure Pattern of Cube specimens

Table 8: Elasticity Modulus Test Results

Designation Elasticity Modulus (GPa) % Gain in Elasticity Modulus

EC0 24.39 EC1 24.60 0.86 EC2 25.50 4.55 EC3 26.87 10.17 EC4 27.26 11.78

Figure 9: Modulus of Elasticity of Test Specimens

3.2.1 Failure Pattern

The cylinder specimens were tested in a compression testing machine of 1000 kN capacity. The failure pattern of polypropylene fibre based lightweight concrete cylinder specimens with expanded clay aggregate is shown in Figure 10. In the early stages, a major macro crack was observed over the height of the cylinder specimen. With an increase in axial compressive stress, more longitudinal cracks formed on the specimen surface. With the inclusion of polypropylene fibres, the failure pattern of cylinder specimens changed differently. The crack propagation was found retarded. There was also an increase in crack density. The polypropylene fibres caused a confinement mechanism preventing the tendency of concrete to crack and spall. The volume fraction of polypropylene fibres has been found to significantly influence the failure pattern of cylinder speci mens.

Figure 10: Failure Pattern of Cylinder Specimens

3.3 Modulus of Rupture

The flexural strength test results of different mixes are presented in Table 9. Each test value is the mean value recorded from three test specimens. The flexural strength was found to increase from 4.7 N/m ���� 2 to 7.4 N/m ���� 2 with an increase in fibre volume fraction from 0% to 0.4%. The rate of increase of flexural strength was 10.64% to 54.45% based on the fibre volume fraction attempted. The increase in flexural strength with an increase in fibre volume fraction may be due to the fact

that, after matrix cracking, the polypropylene fibres continue to share the load. The fracture process consisted of progressive fibre debonding during which crack propagation occurred slowly. The final failure occurred due to unstable crack propagation when the fibres pulled out. Figure11 illustrates the modulus of Rupture of expanded clay based polypropylene fibre reinforced concrete.

Table 9: Modulus of Rupture Test Results Designation Modulus of Rupture (MPa) % Gain in Modulus of Rupure

EC0 4.7 EC1 5.2 10.64 EC2 5.8 23.40 EC3 6.5 38.29 EC4 7.4 57.45

3.3.1 Failure Pattern

Figure 11: Modulus of Rupture of Test Specimens

The prism specimens were tested under four point bending in a standard loading frame. The failure pattern of polypropylene fibre based lightweight concrete prism specimens with expanded clay aggregate is shown in Figure12. The pattern of failure was found to be the same in the specimens with and without polypropylene fibres except that the time of formation of crack as well as the width of crack was less. The increase in flexural strength with an increase in fibre volume fraction may be due to the restraint to crack growth caused by the PP fibre addition.

Figure 17: Failure Pattern of Prism Specimens

Conclusion

From this study, t he expanded clay based structural lightweight aggregate concrete showed a maximum of 19.83% increase in compressive strength with the inclusion of 0.3% volume fraction of polypropylene fibre., which may be due to the cracking resistance offered by the fibre reinforcement. The a ddition of polypropylene fibres is very effective in improving the flexural strength of structural lightweight concrete. A maximum increase of 57.45% has been obtained with 0.4% volume fraction of polypropylene fibres. The modulus of elasticity increased at the rate of 0.86% to 11.78% as the fibre volume fraction increased from 0.1% to 0.4%. The incorporation of polypropylene fibres not only improves the overall performance of structural lightweight concrete but also helps in preventing the brittle failure of the material.

5 Avai lability o f Data and Material

Data can be made available by contacting the corresponding author.

6 References

Aghaee, K., Yazdi, M. A., & Tsavdaridis, K. D. (2015). Investigation into the mechanical properties of structural lightweight concrete reinforced with waste steel wires. Magazine of Concrete research , 67(4), 197 205.

Bernardo, L. F., Nepomuceno, M. C., & Pinto, H. A. (2016). Flexural ductility of lightweight -aggregate concrete beams. Journal of Civil Engineering and Management, 22(5), 622 633.

Chowdary, A , Chaithra, N, Chethan, K (2017). A Study on Impact of Polypropylene (Recron 3S) Fibers on Compressive and Tensile Strength of Concrete. International Journal for Innovative Research , 4(3), 13 22.

Gao, J., Sun, W., & Morino, K. (1997). Mechanical properties of steel fiber reinforced, high strength, lightweight concrete. Cement and Concrete Composites, 19(4), 307 313.

Li, J., Niu, J., Wan, C., Liu, X., & Jin, Z. (2017). Comparison of flexural property between high performance polypropylene fiber reinforced lightweight aggregate concrete and steel fiber reinforced lightweight aggregate concrete. Construction and Building Materials, 157 , 729 736.

Lim, H. S., Wee, T. H., Mansur, M. A., & Kong, K. H. (2006, September). Flexural behavior of reinforced lightweight aggregate concrete beams. In Proceedings of the 6th Asia Pacific Structural Engineering and Construction Conference (APSEC 2006) (pp. 5 6).

Sakthivel, S.K., Saravanan, J. (2022). Experimental Assessment over Theoretical Prediction & Analytical Studies on Flexure Behavior of RC Beams with Recycled Coarse Aggregate. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13 (3), 13A3I, 1-11. http://T uEngr com/V13/13A3I.pdf DOI: 10.14456/ITJEMAST.2022.51

Sohaib, N., Seemab, F., Sana, G., & Mamoon, R. (2018). Using Polypropylene Fibers in Concrete to achieve maximum strength. In Proc. of the Eighth International Conference on Advances in Civil and Structural Engineering (pp. 36 42).

Thongjub, P., Nuakong, P., Jongvivatsakul, P., Raksuntorn, N., Witchayangkoon, B., Raksuntorn, W., Sirimontree, S. (2022). Effect of Crumb Rubber on Properties of High Calcium Fly Ash Geopolymer Mortars. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13 (2), 13A2A, 1 10. http://T uEngr com/V13/13A2A.pdf DOI: 10.14456/ITJEMAST.2022.22

K.K.Gaayathri is a Research Scholar at the Department of Civil and Structural Engineering, Annamalai University, Annamalainagar, Tamil Nadu. She got her Master’s Degree in Structural Engineering from Annamalai University. Annamalainagar 608001, Tamil Nadu. Her research is based on the Structural Light Weight Concrete with various percentages of Micro Reinforcements.

Dr.K.Suguna is a Professor at the Department of Civil and Structural Engineering, Annamalai University, Annamalainagar 608001,Tamil Nadu. She got her Master’s and PhD degrees in Structural Engineering, Annamalai University, Annamalainagar 608001,Tamil Nadu. Her research focuses on FRP laminates and fibre reinforced concrete.

Dr.P.N.Raghunath is a Professor at the Department of Civil and Structural Engineering, Annamalai University, Annamalainagar 608001,Tamil Nadu. He got his Master’s and PhD degrees in Structural Engineering, Annamalai University, Annamalainagar 608001,Tamil Nadu. His research focuses on FRP Laminates and Fibre Reinforced Concrete.

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

A Survey on STEAM Education in Saudi Arabia: Early Childhood

Marwan Albahar1*, Abdullah Alammari2

1 Department of Science, Umm Al Qura University, PO Box 715, Mecca, Saudi Arabia.

2 Faculty of Education, Curriculums and Teaching Department, Umm Al Qura University, Makkah, Saudi Arabia *Corresponding Author (Corresponding Author mabahar@uqu.edu.sa)

Paper ID: 13A5I

Volume 13 Issue 5

Received 15 January 2022 Received in revised form 09 April 2022

Accepted 19 April 2022 Available online 23 April 2022

Keywords: STEAM education; Teachers' beliefs ; Early childhood ; Saudi Arabia

Abstract

The purpose of this study is to conduct a survey of recent work related to the perspectives of teachers working in early childhood education settings on STEAM education. In an attempt to reform education, Saudi Arabia has adopted STEAM education as a fundamental reform principle. As a result of the top down nature of these initiatives, however, little is known about STEAM education in schools and informal settings. This paper examined the general education landscape and shared the findings of a study on the perspectives of early childhood educators in Saudi Arabia on STEAM education. Finally, we discussed the results and made some recommendations for the future.

Discipline: Information Technology in Education ©2022 INT TRANS J ENG MANAG SCI TECH.

Cite This Article: Albahar, M., and Alammari, A (2022). A Survey on STEAM Education in Saudi Arabia: Early Childhood. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5I, 1 6. http://TUENGR.COM/V13/13A5I.pdf DOI: 10.14456/ITJEMAST.2022.93

1 Introduction

The number of students majoring in STEM related fields continues to increase in both developing and developed countries [1]. STEM education is defined in numerous ways. This study seeks to elucidate the perspectives of Saudi educators on incorporating STEAM and how it can be implemented in the classroom. It aims to shift the paradigm of education away from traditional lecture based methods and toward more interdisciplinary approaches that facilitate meaningful learning experiences to meet the rising demand for skilled and creative individuals. This can facilitate students' acquisition of 21st century skills [2]. Students in grades K 12 are typically taught using STEAM education, which is a science based, multidisciplinary approach to education. STEAM stands for science, technology,

engineering, mathematics, and the arts. Children's natural curiosity and excitement for exploration and discovery are fostered by integrating these five critical disciplines into STEAM education. Simultaneously, students taught in this manner must demonstrate the capacity for critical and creative thinking in order to lay the groundwork for future academic success. To prepare today's children for a successful life and future, educators must adopt a new approach that integrates multiple content areas. Children in the twenty first century require increased critical thinking training in order to overcome the obstacles they will face. Despite increasing global competitiveness, education is under increasing pressure to prepare students to address recent global issues. Concerns about a shortage of well prepared students entering STEM related careers in the United States prompted the establishment of STEAM [3 5]. Despite the numerous studies that have been conducted on STEAM in early childhood education, there is still a lack of research on the various aspects of integrated STEM. This review aims to provide a comprehensive analysis of the current state of research on this subject. It also explores the level of progress that has been made in the field over the past few years.

2 Lit e rature Review

Saudi Arabia's efforts to modernize its educational system have been hampered by globalization. Saudi Arabia has made significant efforts over the last two decades to reform its educational system. King Abdullah bin Abdul Aziz’s Public Education Development Project (KAAPEDP) was launched in 2007 in response to the country's extensive economic and social development [6]. Tatweer, an Arabic term for development, was intended to supplant traditional Saudi education with a more innovative and technologically advanced model. This project placed a premium on technology enhanced learning environments and the qualifications of classroom instructors [7]. In 2015, with the aid of the National Association for the Education of Young Children (NAEYC), the Saudi Ministry of Education produced the Saudi Early Learning Standards (SELS) [8] addressed preschool aged children (ages 3 6) with the goal of providing educators, parents, and other caregivers with the most up to date information on best practices for that age group. Seven standards for children's learning at all ages were outlined in the document. Teaching measurement and geo metry concepts place a premium on spatial awareness and form dimension. The following subthemes within cognition and general knowledge have a clear connection to STEAM content [9]. (See Table 1).

Table 1: STEAM content and its connection to cognition and general knowledge. subtheme General and cognition knowledge

Science & Mathematics

Creative Arts & Technology

Students are introduced to topics such as biology and physics in the science curriculum. In mathematics, students will learn numbers, geometry, measurements, and quantity.

The goal of the creative arts program is to give kids a safe place where they can work on improving their bodies, minds, and actions.

In the technology section, the objective is to introduce students to the world of technology and develop their proficiency with interactive and multimedia equipment. There are several age appropriate behaviors included in the SELS statement's cognition and general knowledge requirements. Additionally, these activities assist kids in acquiring a strong

foundation in science, technology, engineering, the arts, and mathematics by fostering critical thinking and problem solving skills. However, these conceptions express the primary domains of scientific thought as developing activities. It doesn't offer any guidance to educators on how to categorize content integration as a STEAM investigation [9].

1 Contribution & Methodology

The goal of this study is to shed light on recent studies conducted on the topic related to Saudi teachers' perspectives on STEAM's role in early childhood education in light of substantial changes to the Saudi educational system's policy and philosophy in recent years. There is a dearth of research on STEAM in early childhood education in Saudi Arabia, despite the fact that multiple studies on Saudi teachers and their perceptions of critical STEAM content have been undertaken [10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22]. The goal of this review is to provide comprehensive knowledge of the various aspects of STEAM education. It also explores the level of advancement that has occurred in the field over the past few years.

2 Method

The sources included studies in which all peer reviewed and published journal articles in English between the years 2018 and 2022 were chosen for eligibility. To be declared eligible for the study, it was found imperative to provide empirical research findings regarding the learning outcomes. The populations studied in the study were all related to STEAM education. The studies where the subjects were not related to STEAM education were dismissed. However, excluding such articles proved to be a limitation of this study. The articles that focused on STEAM education practice rather than the learning outcomes of the curriculum were also excluded. This also included the articles that emphasized the design methodology based on STEAM education to provide enhancement in early childhood settings.

3 Gathering and examining information

The resulting Endnote files were then sent to Rayyan. Rayyan is a web application designed specifically to facilitate the process of systematic literature reviews. With the aid of Rayyan's blind review tool, the remaining articles were scrutinized by two authors using the inclusion criteria as a guide. After using the blind review tool to screen the candidate's articles, it was determined that 15 articles were accepted and included by both reviewers, whereas 30 articles were rejected or disregarded and excluded. This indicates that 30 of the 66 articles were not included. In addition, there were further disagreements, which led to the labeling of four more arti cles as "possible." Two of these four articles were included by the other reviewer, while the remaining two were excluded. It was determined that 86.5% agreement existed between the two reviewers. If the "maybe" articles were included with the "included" articles, the inter rater agreement would reach 93.8%. The paper was rejected because of a thorough examination of the articles that could not be classified. After proper population and study type analysis, only three "maybe" articles were included among these. In the final stage of the reviewing process, only 19 articles were categorized (See figure 1).

Figure 1: Flowchart Presentation for Selection Process

4 Results

The survey revealed that a number of studies focused [12,13,15,17,18,20] on enhancing the STEAM education related perspectives of Saudi teachers. Additionally, these studies demonstrated that STEAM education enhances the cognitive development and learning capacity of young children. In addition, Saudi Arabian educators had modest views regarding the incorporation of STEAM subjects into the classroom and the planning and execution of lessons at a reasonable rate. This survey found that instructors lacked STEM knowledge, which was one of its key findings [12,13,14]. Several studies found [11,12,14,15,19,20,21] that there were constraints to incorporating STEAM activities and basic STEAM principles into the curriculum. In fact, according to [10,11,12,13], instructors were familiar with the acronym STEAM, but few knew how to implement it or what skills were necessary. Moreover, a previous study noticed that the majority of educators required additional training and professional development in order to integrate STEAM subjects effectively into their curriculum [11,12,13]. Our survey revealed that teachers lacked the knowledge necessary to implement STEAM principles in the classroom. The teachers' limited knowledge of STEAM's multidisciplinary nature [17] hinders their understanding of the acronym. Several studies showed [9, 11,12,13] that teachers who do not know all STEAM subjects must know at least two STEAM courses to aid the cognitive development of young children. To teach cross idea STEM integration, emphasis must be placed on theoretical foundations, visual models, and practical integration skills [18, 23]. To teach STEAM related topics, instructors must integrate multiple disciplines holistically and cognitively [9,11,12]. According to [9,11,1223], STEAM courses must integrate multiple disciplines and permit natural crossovers. STEAM concepts can be taught using interdisciplinarity, multidisciplinarity, and transdisciplinarity. Transdisciplinarity entails combining domains and the space between them to produce novel concepts. This method assists students in establishing connections between seemin gly unrelated concepts. However, the lack of familiarity with STEAM education and its procedures hinders progress.

Conclusion

According to the findings of this review, many exciting opportunities exist for integrating STEAM education experiences with children and educators. In moving forward, we suggested that this has a greater bearing on early childhood learning and experiences. To empathize more, we reiterated the importance of the arts and play in assisting children to comprehend, explore, and represent their developing STEAM knowledge. The literature acknowledged that young children engage in STEAM experiences and learn through both everyday and planned activities. There is a need for educators to recognize these opportunities and have the aptitude and inclination to seek out, support, and cultivate STEAM education in young children. This review drew several significant conclusions, one of which was that training and professional development are extremely important to the STEAM education experience, prompting further consideration of how STEAM is conceptualized and defined.

6 References

Donohue, C. Foreword. (2019). In STEM in Early Childhood Education: How Science, Technology and [1] Engineering and Mathematics Strengthen Learning; Cohen, L., Waite Stupiansky, S., Eds.; Taylor & Francis: Abingdon, UK.

Clerkin, A.; Gilligan, K. Preschool (2018). Numeracy plays as a predictor of children’s attitudes towards [2] math at age 10. J. Early Child. Res, 16, 319 334.

Bybee, R. W. (2013). The case for STEM education: Challenges and opportunities. National Science [3] Teachers Association.

Chen, J.; Hynes Berry, M.; Abel, B.; Sims, C.; Ginet, L. (2017). Nurturing mathematical thinkers from [4] birth: The why, what and how. Zero Three J., 37, 23 26.

DeJarnette, N. K. (2018). Implementi ng STEAM in the early childhood classroom. European Journal of [5] STEM Education, 3(3), 18. https://doi.org/10.20897/ejsteme/3878

Alnahdi, G. H. (2014). Educational change in Saudi Arabia. Journal of International Education Research [6] (JIER), 10(1), 1 6. https://doi.org/10.19030/jier.v10i1.8342

Alyami, R. H. (2014). Educational reform in the Kingdom of Saudi Arabia: Tatweer schools as a unit of [7] development. Literacy Information and Computer Education Journal, 5(2), 1515 1524. https://doi.org/10.20533/licej.2040.2589.2014.0202

Ministry of Education (MOE). (2015). Saudi early learning standards (SELS): Children 3 to 6 years old. [8] National Association for the Education of Young Children, Tatweer Company for Educational Services. Alghamdi, A.A. (2022). Exploring Early Childhood Teachers’ Beliefs About STEAM Education in Saudi [9] Arabia. Early Childhood Educ J.

Jia, Y.; Zhou, B.; Zeng, X. (2021) A curriculum integrating STEAM and maker education promotes [10] pupils’ learning motivation, self efficacy, and interdisciplinary knowledge acquisition. Front. Psychol, 8, 3652.

Aldahmash, A. H., Alamri, N. M., Aljallal, M. A., & Bevins, S. (2019). Saudi Arabian science and [11] mathematics teachers’ attitudes toward integrating STEM in teaching before and after participating in a professional development program. Cogent Education, 6(1), 1580852. https://doi.org/10.1080/2331186x2019.1580852

Alghamdi, A. K. H., & Al Salouli, M. S. (2013). Saudi elementary school science teachers’ beliefs: [12] Teaching science in the new millennium. International Journal of Science and Mathematics Education,

11(2), 501 525. https://doi.org/10.1007/s10763 012 9353 0

Sulaymani, O.; Fleer, M.; Chapman, D. (2018). Understanding children’s motives when using iPads in [13] Saudi classrooms: Is it for play or for learning? Int. J. Early Years Educ, 26, 340 35

Çetin, M.; Demircan, H.Ö. (2020). Empowering technology and engineering for STEM education [14] through programming robots: A systematic literature review. Early Child Dev. Care, 190, 1323 1335.

Sulaymani, O.; Fleer, M.; Chapman, D. (2018). Understanding children’s motives when using iPads in [15] Saudi classrooms: Is it for play or for learning? Int. J. Early Years Educ, 26, 340 353

Jia, Y.; Zhou, B.; Zeng, X. (2021) A curriculum integrating STEAM and maker education promotes [16] pupils’ learning motivation, self efficacy, and interdisciplinary knowledge acquisition. Front. Psychol, 8, 3652

Çetin, M.; Demircan, H.Ö. (2020). Empowering technology and engineering for STEM education [17] through programming robots: A systematic literature review. Early Child Dev. Care, 190, 1323 133554

Quigley, C. F., Herro, D., & Jamil, F. M. (2017). Developing a conceptual model of STEAM teaching [18] practices. School Science and Mathematics, 117(1 2), 1 12. https://doi.org/10.1111/ssm.1220

Simoncini, K., & Lasen, M. (2018). Ideas about STEM among Australian early childhood [19] professionals: How important is STEM in early childhood education? International Journal of Early Childhood, 50(3), 353 369. https://doi.org/10.1007/s13158 018 0229 5

Strawhacker, A.; Verish, C.; Shaer, O.; Bers, M.U. (2020). Designing with genes in early childhood: [20] An exploratory user study of the tangible CRISPEE technology. Int. J. Child Comput. Interact, 26, 100212.

Kewalramani, S.; Palaiologou, I.; Dardanou, M. (2020). Children's engineering design thinking [21] processes: The magic of the ROBOTS and the power of BLOCKS (electronics). Eurasia J. Math. Sci. Technol. Educ, 16, em1830

Marsh, J.; Wood, E.; Chesworth, L.; Nisha, B.; Nutborown, B.; Olney, B. (2019). Makerspaces in early [22] childhood education: Principles of pedadogy and practice. Mind Cult. Act, 26, 221 233.

Roehrig, G.H., Dare, E.A., Ellis, J.A. Whalen, E. (2021). Beyond the basics: a detailed conceptual [23] framework of integrated STEM. Discip Interdscip Sci Educ Res 3, 11.

Dr. Marwan Ali Albahar received his B.S. in Computer Science from King Faisal University, Saudi Arabia, and his M.Sc. in Computer Science with Honors from Frostburg State University, USA. Dr. Albahar received his Ph.D. from the University of Eastern Finland. Dr. Albahar a Senior Information Security, Privacy, and Risk Management Professional with a solid technical background and a highly analytical mind. He has been involved in the information security field for the last 3+. His main areas of research are Computer Networks Security, Cybersecurity, and Artificial Intelligence

Dr. Abdullah Alammari is an Associate Professor of Information Technology in e Learning. Abdullah is Chair of Academic Tracks of Educational Technology, e Learning, and Computer Teaching Methods at the Faculty of Education Umm Al Qura University, Makkah, Saudi Arabia

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies

http://TuEngr.com

Russian Experience of Export Regulation of Food Flows

Boris A. Kheyfets1,2, Veronika Yu. Chernova3* , and Natalia N. Shurakova2

1Institute of Economics of the Russian Academy of Sciences, RUSSIAN FEDERATION.

2Financial University under the Government of the Russian Federation, RUSSIAN FEDERATION.

3People’s Friendships University of Russia, RUSSIAN FEDERATION.

*Corresponding Author (Tel: +7 4954335029, Email: veronica.urievna@mail.ru)

Paper ID: 13A5J

Volume 13 Issue 5

Received 30 December 2021

Received in revised form 7 April 2022

Accepted 15 April 2022 Available online 23 April 2022

Keywords: food security; food self sufficiency; food balance; export regulation; sustainable food markets.

Abstract

In the paper, we discuss wheat export restrictions in Russia in terms of food security. Russia's position in the global grain market and considerable growth in the wheat output generate paradoxes regarding the validity and efficiency of export restrictions. Explanation of emerging phenomena is a goal of our research. To achieve this, we redefine the framework that we use to evaluate food self sufficiency. We also reveal the relationship between export prices for Russian grain in the foreign market and national wholesale prices. We find that the growth in national retail prices for processed cereal products makes foods less affordable for the population. According to our estimates, in 2020, the volume of grain exported to t he global market was significantly lower than the maximum rated level, the overrun of which could damage self sufficiency. Therefore, we conclude that export restrictions introduced in the grain market do not have true potential for food inflation regulati on. Promotion measures in the agri food sector and currency movements have a larger effect on price movements in the food market. In terms of economy, to bridge such gaps we need to justify scales of export regulation as well as the development of alternatives for control of food flows.

Disciplinary: International Economic Relations, Food Trade.

©2022 INT TRANS J ENG MANAG SCI TECH.

Cite This Article:

Kheyfets, B.A.., Chernova, V. Y., and Shurakova, N.N. (2022). Russian Experience of Export Regulation of Food Flows. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5J, 1 13. http://TUENGR.COM/V13/13A5J.pdf DOI: 10.14456/ITJEMAST.2022.94

1 Introduction

Total or partial compensation for the influence of extreme conditions in world markets on the welfare of the population in an exporting country is the main objective of the export restriction

policy. In response to the COVID 19 pandemic, many countries introduced temporary restrictions on exports of certain goods, including grain (20 measures) and products of the flour grinding sector (16 measures) to reduce potential shortages in national markets (Casey & Cimino Isaacs, 2021). Of 133 COVID 19 specific trade measures, in G20 countries since the beginning of the pandemic, 37% are restrictive in nature and cover trade in G20 countries to the amount of USD111 billion (WTO, 2020).

From January 2020 June 2021, countries introduced 324+ measures. This includes Germany and the United States (181 meas ures each), Russia 168, Japan 160, South Korea 156, and France 153 (Global Trade Alert, 2021). Measures prohibit or restrict exports of certain goods for COVID 19 related reasons. Most export restrictions are temporary in nature. Their introduction was at the beginning of the pandemic while cancellation was on 1 April 2021. Their objective is to reduce the dependence of national markets on the unfavorable international situation.

Past supply crises (such as the volatility of global food prices in 2007 2008) show that governments are not only ready to use commercial policy tools to maximize the national supply of basic goods, but also do so without a proper analysis of the efficiency of such measures for (inter)national markets or discuss indirect ef fects (Hoekman, Fiorini, & Yildirim, 2020). The growth in wheat prices in past periods (the gap between the global supply and demand) was 30% due to export restrictions. As for the rice, the influence reached 45% (Martin & Anderson, 2012). Although the situation in food markets at the beginning of the 2020 pandemic differed significantly from that in 2007 with a higher level of production, lower prices (Espitia et al., 2020) and the high size of stocks exceeding the level of availability as of the end of 2009 2010 (70 100% excess) (Voegele, 2020). In April 2021, the FAO food price index averaged 120.9 points, which is 30.8% higher than in the same period of 2020. The cereal price index had a 26% rise compared to the level of April 2020 (FAO, 2021), which we can compare to 2007 when food prices had a 27% rise (FAO, 2009).

In 2020, Russia announced the introduction of a quota for grain exports and export duty (Interfax, 2021). At the same time, over the past 20 years, Russia has nearly doubled its wheat production, and from an importing country in the past, it turned into the largest exporter reaching a share of 20% of global supply (Durisin & Fedorinova, 2021). Over the past decade, Russia has repeatedly introduced measures to restrict grain exports in cases of growing global prices in the food crisis of 2007 2008, crop failure because of the severe drought in 2010 (Fellmann, Helaine, & Nekhay, 2014), and sudden rouble devaluation in 2015.

On the grain market, the export restrictions that Russia introduce d did not have a significant influence on the stabilization of consumer prices in the national market. This brings up the question of whether there is a threat to food security.

These reasons predetermine the research goal , which we state as clarifying the reasons and consequences of restrictions on Russian grain exports in terms of food self sufficiency and the development of the evaluation framework for food security threats. The objectives of the research are as follows: develop the framework for evaluation of food security threats, evaluate food security

2 Literature Review

Self sufficiency and stable food prices are a starting point in the food security analysis (Enriquez, 2020; Clapp, 2017; Fellmann et al., 2014; Kuzmin, 2015, 2016). The drive of states toward food self suf ficiency lies in their desire to reduce the vulnerability of national food markets to impacts of macroeconomic and geopolitical shocks, as well as the need for an increase in employment and a decrease in unemployment (Kheifets & Chernov a, 2019). In practice, countries often seek to increase national food output in relation to total consumption, but they do so in different ways and rarely completely abandon international commerce. Likewise, few countries ignore national output and only rely on international commerce to meet all their food needs (Clapp, 2017). However, despite the growth in world food output, the average food self sufficiency of countries has been in a steady decline over the past decades (Schramski, Woodson, Steck, et al ., 2019).

The problem of insufficient food security is aggravating because of rapid development in the biofuel industry around the world (Kurowska et al., 2020). Over the past ten years, we have seen a clear increase in biofuel production. This has led to higher demand for non food applications of agricultural raw materials (Advanced biofuels summit, 2021). In this regard, we have grave concerns about rising food prices and the impact of increased biofuel production on food security (Brinkman et al., 2020).

Target achievement of food self sufficiency is usually a reason for introducing export restrictions against the background of price instability in world markets (Beckman et al., 2018). Other reasons for the use of export restrictions relating to the following: co st advantages to local processors of raw materials compared to international competitors (Liefert & Westcott, 2015), increase food output available for consumption in a national market and price reduction (Fellmann et al., 2014), etc. But empirical research show s that export restrictions do not always achieve expected goals and, in many cases, exacerbate food price shocks (Estrades et al., 2017). Moreover, such measures are often ineffective for the whole society (Wright, 2011). Export restrictions narrow international supplies, and if a country is large enough, this leads to higher world prices (Espitia et al., 2020). The c onsequences of export restrictions are clear in the countries that show heavy dependence on imports (Deuss, 2017).

Losses caused by restrictions of various types largely depend on the price elasticity of demand and supply (Siddhartha & Tim, 2009). The impact of export restrictions on the national market leads to changes in prices, output, consumption, and trade, as well as the welfare of producers and consumers (Aragie et al. , 2018).

The literature review shows that economists mostly regard export restrictions as costly and dangerous tools that are a threat to long term targets in food security. Most contemporary

threats in Russia due to increased grain exports that higher world prices cause, detect the dependence of national grain prices on export prices, and explore implications of export restrictions for participants in the grain food chain.

researchers focus on the consequences of introduced export restrictions in countries that import agricultural products. The influence of rising food prices in an exporting country (if it applies export restrictions) requires more attention. Export controls can also higher prices for these goods, make them less economically affordable for the population, and depress food security. In this regard, a need arises to find a volume of unregulated exports that would not harm food security in an exporting country.

3 Method

According to the 1999 FAO vision, food self sufficiency depends on the ability to meet food needs from its own national output (FAO, 1999). However, no country would fully provide itself with all the food. Countries import some foods, which is normal (FAO, 2015).

Food self sufficient countries might specialize their food production to some extent and import some foods. Based on this understanding of food self sufficiency, we calculate the food self sufficiency rate (FSSR) as the ratio of national producti on (DP) to the number of foods available for consumption (DS):

(1)

At the same time, the number of foods available for consumption, or the total volume of their supply might calculate in different ways: (a) sum of national output, imports, and stock reduction (Puma et al., 2015); (b) sum of national output, imports, and stock changes; (c) sum of national output, imports, changes in stocks minus exports (Clapp, 2017).

Food independence is a key indicator of Russian food security. It refers to food self sufficiency and lies in the ratio of the agri food national output to its national consumption volume (Decree of the President of the Russian Federation, 2020). This causes an incorrect evaluation of self sufficiency (Kulistikova, 2020). First, this interpretation of food security ignores foreign trade in agribusiness. This prevents us from identifying the relationship between export and food self sufficiency. Second, food self sufficiency ignores the fact that growing food self sufficiency might be not because of the output growth, but because of lower consumption.

100%. DP FSSR DS =× ( ) 100, F DP FSSR DPLEISt = × −−++∆ St∆

We admit that the volume of agri food national output available to consumers (national supply) is the difference between national output minus losses and exports: (2) where FSSRF is the food self sufficiency rate at the actual consumption level, DP is the national output of agri food, L is the level of losses of agri food that appears from problems in harvesting, food processing, storage, packaging, or transportation, and E is the volume of exports of agri food products, I is the volume of its imports; is difference between stocks of agri foods products at the beginning and end of the year.

According to the framework within which we make balances of food resources, the change in agri food stocks over a period is the difference between national output minus agri food losses, national consumption, and exports: (3) where is the total national consumption of an agri food product, which includes industrial consumption volume (PrC ), the volume of agri food product processing (P ), and individual consumption ( PsC).

Upon transformation, we receive the following: (4)

To find the volume of exports that will not damage food security, we admit that the self sufficiency rate is equal to the self sufficiency threshold and from equation (4) we obtain the equation to calculate the maximum volume of exports at actual consumption : (5)

The maximum rated volume of exports is a part of the national output of agri food products that remains when the existing volume of product losses that does not damage national food security meet national needs. When people consume foods at reasonable rates, the total consumption of agri food products will look like the following: (6) where is the total national consumption of this type of agri food product with reasonable consumption, PrC is industrial consumption volume, P is the volume of agri food product processing, PsC is individual consumption volume, and is the degree of achievement of reasonable norms.

We calculate the degree of achievement of reasonable norms as the ratio of food consumption per capita (kg per year) to the recommended rate of reasonable consumption (kg per year): (7) where FCpC is food consumption by main food groups per capita (kg per year); PN is the reasonable norm of food consumption.

Using transformations, we get the maximum rated volume of exports with reasonable consumption ( ):

(8)

The involvement of the indicator “degree of achievement of reasonable norms” in the calculation of self sufficiency makes it possible to level the lack of the approach to food self sufficiency and consider consumption decrease due to the changed purchasing power of the population.

In the research, we calculate the maximum permissible export limit based on the data that Rosstat collected. To do this, we also take into account the actual consumption level and wise consumption.

4 Result a nd Discussion

Russia is the largest exporter of some agri food products. A share of national exports (cereals) in certain periods approached 50%, while for fish it is over 60% of the total fish catch and production of other water resources (Rosstat, 2021a). The gross grain harvest in Russia since 2000, except for 2003 and 2010, has been higher than national consumption. From 2013 to 2020, this excess was 1.43 1.74 times (Figure 1).

Figure 1: Dynamics of Russian Output, Exports, and National Consumption of Cereals in 1990 2020, Million Tons. Source: Rosstat (2021b).

Consumption of grain crops in the national market over the past five years has shown a 1 2% increase. At the same time, in 2020, national consumption was almost 40% less than in 1990. Against the background of the weak growth in national consumption, exports of Russian grain in 2000 2020 increased by 48+ times, the export was 62% of the national consumption volume.

To evaluate threats to food security, we calculate the maximum rated volume of exports at the actual consumption and maximum rated exports with reasonable consumption and in accordance with the healthy eating standards (Figure 2).

Export maximum-rated at actual consumption

act

threshold at reasonable consumption

Figure 2: Maximum rated and Actual Volume of Exported Russian Grain in 1990 2020, Million Tons. In 2018, there was a threat to food security related to grain supplies in Russia, when the actual volume of exports (54.8 million tons) was over the maximum rated volume of exports with the actual consumption of 53.1 million tons. In 2020, foods actually exported from the country (48.7 million tons) were less than the volume that could threaten food security (62.67 million tons) and much less than the volume of exports that would reduce reasonable consumption of grain products in the country. The quota for grain exports in the amount of 17.5 million tons is significantly less than the maximum export volume. With the volume of Russian supplies in the world market at the level of 20%, export prices of Russian wheat cannot but influence world prices and vice versa. Our research shows that the dependence of the w heat national wholesale price (y ) on the export price (x ) correlates to 0.8176. This means that there is high price interdependence (Figure 3).

wheat price, USD/kg Export wheat price, USD/kg

Figure 3: Graph of Dependence of the National Wholesale Wheat Price on Export Price Sources: FAO. FPMA (2021a); FAO. FPMA (2021b).

Introduced export duties and other price regulation measures (in terms of very close dependence of national wholesale prices on export prices) will inevitably lead to higher national wholesale prices.

On the one hand, non regulated grain exports with high world prices might cause excess grain exports compared to a maximum rated volume and might damage food security. On the other hand, a food grain chain does not only include end links (farmers manufacturers and consumers) but also many intermediate links (elevators, flour mills, grain traders, etc.), export regulation with no control over intermediaries’ prices, and internal retail prices do not give an expected effect of price reductions for consumers. Thus, the 9% decrease in the wholesale price in December 2020 February 2021 was available together with the increase in retail prices for flour and bread, which, in USD, showed 9.6% and 8.6% increases respectively (Table 1).

Table 1: National Retail and Wholesale Prices for Bread Products and Export Wheat Price

Date

Retail prices

Wholesale price

Nominal, RUB/kg Realistic price, RUB/kg USD/kg USD/kg bread flour bread flour bread flour flour

12.2019 50.67 36.29 27.81 19.92 0.81 0.58 0.20 01.2020 51.31 36.55 28.05 19.98 0.83 0.59 0.20 02.2020 51.89 36.60 28.27 19.94 0.81 0.57 0.20 03.2020 52.02 36.72 28.19 19.90 0.71 0.50 0.18 04.2020 52.36 38.20 28.14 20.53 0.70 0.51 0.19 05.2020 52.58 38.99 28.18 20.90 0.72 0.54 0.20 06.2020 53.01 39.26 28.35 21.00 0.77 0.57 0.22 07.2020 53.34 39.67 28.43 21.14 0.75 0.56 0.19 08.2020 53.65 39.84 28.60 21.24 0.73 0.54 0.18 09.2020 54.05 39.85 28.84 21.26 0.71 0.53 0.18 10.2020 54.40 40.13 28.90 21.32 0.70 0.52 0.20 11.2020 55.02 40.61 29.02 21.42 0.71 0.53 0.22 12.2020 55 70 41.41 29.14 21.66 0.75 0.56 0.23 01.2021 56.04 41.94 29.12 21.79 0.76 0.57 0.22 02.2021 56.21 42.44 28.98 21.88 0.76 0.57 0.21 03.2021 56.35 42.49 28.92 21.81 0.76 0.57 0.20 04.2021 56.85 43.00 28.98 21.92 0.75 0.56 0.20

Sources: FAO. FPMA (2021a); FAO. FPMA (2021b).

The population's medium term demand for cereals and their processed products (2 3 years) is inelastic: the population’s consumption volume for bread and pasta, calculated as flour, for flour, cereals, and legumes was at the level of 119 kg with various price levels in 2011 2012. In 2013 2015, it was 118 kg. In 2016 2017, it was 117 kg, and in 2018 2020, it was 116 kg with various price levels (Rosstat, 2021a). This means that the Russian s have more concerns about healthy eating and gradually cut back on excessive consumption of bread products. On the other hand, this suggests that with a changed price and the same consumption, the consumers' gain will only depend on the price difference. This means that consumers’ welfare worsens because of export regulation.

The decline in grain purchase prices (from farmers), which followed the announcement of introduced export restrictions, caused a partial loss of their income. Thus, we might understan d the introduction of the export duty as an additional tax for farmers.

The export growth rates higher than the growth rates of national consumption suggest that export is indeed a catalyst for the development of the grain economy. Reduced incomes of farmers from grain exports to international markets will inevitably reduce the volume of investments in the sector’s modernization and technological development.

Recently, Russia has established export regulation practices. In the framework of it, people consi der export a kind of reserve, which in crisis times we use to ensure food security. Its achievement and preservation are key strategic priorities of the government (Ksenofontov, Polzikov, & Urus, 2019). The introduction of export restrictions against the background of export growth as a strategic goal and large scale investments in the development of export grain infrastructure established by the Russian government is only reasonable if export becomes excessive and threatens food security. The food security index in 2020 confirmed that there are no real threats to Russian food security. The index was, as The Economist estimates (The Global Food Security Index, 2021), 73.7 points, i.e. 3.4 points higher than in the previous year.

Export restrictions, if economically reasonable, undermine Russia's image as a reliable supplier, hit the competitiveness of Russian grain, narrow Russia's presence in the global market, and worsen investment opportunities in the grain sector (Vorotnikov, 2021). The negative impact of imposed and unwarranted export restrictions with the aim of better food security is a deterrent to investments in agricultural production and export opportunities. This also seriously cuts farmers' income (Clapp, 2017).

In Fellmann et al. (2014), researchers show that wheat exports if reduced by three large exporters (Russia, Kazakhstan, and Ukraine) might lead to a 23% increase in prices on the world market. Althoug h, in the short term, the rise in world prices provides an increase in the incomes of exporters from other countries. For instance, in Canada, wheat exports from 31 March 2020 to 31 March 2021 grew by 28.9% (Cross, 2021). The consequence of this is worse consumers’ welfare and security in the markets of importing countries.

The efficiency of export restrictions for the normalization of national prices of agri food products and foods is questionable (World Bank, 2018). These measures do not solve the problem that we state as economic and physical affordability of agri food products for national consumers. Previous export restrictions in Russia have not resulted in noticeable price damping effects for consumers. When in the spring of 2008, Russia introduced the export duty, the decline in wheat prices did not cause a corresponding decrease in flour prices. G ö tz, Djuric, and Glauben (2015) show that the 50% decrease in wheat prices in the Central Region of Russia leads to the 5% decrease in bread prices in Moscow only. Thus, the 20% growth in grain prices for flour mills, for instance, all other things being equal, should not lead to higher retail bread prices (not more than a 3% rise).

Like in the cases of other large exporters, wheat price in the national market directly relates to global prices (Baquedano & Liefert, 2014). In the second half of 2020, the growth in global wheat prices, as in Russia, caused higher national wheat prices. At the same time, this growth was not over the price level of 2019. We can explain wheat production at lower real prices, when wheat

price growth rates are behind inflation, by sustainable better performance in the grain sector owing to technological and technical improvements.

Agents’ strategic behaviors influence fluctuation s in national prices. In anticipation of a price rise, grain traders might prefer stock accumulati on instead of sales (G ö tz, Koester, & Glauben, 2015). Such behaviors of grain market participants reduce a constraining effect of export restrictions on national prices and cause higher growth in national prices for some time (Fellmann et al., 2014). Welton (2011) says that in 2010 2011, the prohibition of exports in Russia did not lead to an expected decline in national food prices.

Thus, the introduction of export restrictions in the grain market has no huge potential for food inflation regulation. Measures to stimulate the agri food sector and currency movements have a significantly larger effect on the dynamics of prices in the food market.

The consumer subsidy program might be an alternative to export restrictions (Liefert & Westcott, 2015). Another alternative that deserves attention is the establishment of a quota for mandatory supplies of products to the national market at predetermined prices in the amount not lower than the required self sufficiency level as well as permission to sell any volume of products (more than quotas allow) to the international market at world prices.

5 Conclusion

The research on the causes and consequences of Russian grain export restrictions regarding food self sufficiency shows that in 2020, the Russian economy had no real threat in terms of worsened grain self sufficiency. At the year end, the export volume was significantly lower than the maximum rated one, the overrun of which would damage grain self sufficiency. At the same time, the growing national retail prices for processed cereal products (bread, flour, and pasta) make foods less affordable for the population, and, consequen tly, worsen food security. From this perspective, we find reasonable those price regulation measures that the government introduced. However, as the food grain chain includes many intermediary elements, in the absence of control over agents’ prices and national retail prices, export regulation does not lead to expected lower prices for consumers.

6 Availability o f Data and Material

Data can be made available by contacting the corresponding author.

7 Acknowledgement

The RUDN University’s Strategic Academic Leadership Program supported this study.

8 References

Advanced biofuels summit 2021. (2021). https://www.worldbioenergy.org/uploads/210324%20Advanced%20Biofuels%20Summit.pdf

Aragie, Е., Pauw, К., Pernechele, V. (2018). Achieving food security and industrial development in Malawi: Are export restrictions the solution? World Development, 108, 1 15. DOI: 10.1016/j.worlddev.2018.03.020

Baquedano, F.G., & Liefert, W.M. (2014). Market integration and price transmission in consumer markets of developing countries. Food Policy, 44, 103 114. DOI: 10.1016/j.foodpol.2013.11.001

Beckman, J., Estrades, С., Flores, М., & Aguiar А. (2018). The impacts of export taxes on agricultural trade (NBER Working Papers 24894). National Bureau of Economic Research, Inc. DOI: 10.3386/w24894

Bloomberg. (2021). Putin Thrusts Global Food Markets into Russian Politics https://www.bloomberg.com/news/articles/2021 01 25/putin thrusts global food markets into russian politics

Brinkman, М., Levin Koopman, J., Wicke, B., Shutes, L., Kuiper, М., Faaij, А., & van der Hilst, F. (2020). The distribution of food security impacts of biofuels, a Ghana case study. Biomass and Bioenergy, 141, 105695. DOI: 10.1016/j.biombioe.2020.105695

Casey, C.A., & Cimino Isaacs, C.D. (2021). Export restrictions in r esponse to the COVID 19 pandemic (IF11551). https://crsreports.congress.gov/product/pdf/IF/IF11551

Clapp, J. (2017). Food self sufficiency: Making sense of it, and when it makes sense. Food Policy, 66, 88 96. DOI: 10.1016/j.foodpol.2016.12.001

Cross, B. (2021). Brisk exports cut into grain, oilseed stocks. https://www.producer.com/markets/brisk exports cut into grain oilseed stocks 2/?module=author bio recent&pgtype=article&i= Deuss, A. (2017). Impact of agricultural export restrictions on prices in importing countries (OECD Food, Agriculture and Fisheries Papers, No. 105). OECD Publishing, Paris. DOI: 10.1787/1eeeb292 en Durisin, М., & Fedorinova, Y. (2021). Putin thrusts global food markets into Russian politics. (Bloomberg, 25 January). https://www.bloomberg.com/news/articles/2021 01 25/putin thrusts global food markets into russian politics

EIU. (2021). The Global Food Security Index https://foodsecurityindex.eiu.com

Enriquez, J.P. (2020). Food self sufficiency: Opportunities and challenges for the current food system. Biomed J Sci & Tech Res, 31, BJSTR. MS.ID.005061. DOI: 10.26717/BJSTR.2020.31.005061

Espitia, A., Rocha, N., & Ruta, M. (2020). COVID 19 and food protectionism: The impact of the pandemic and export restrictions on world food markets (Policy Research Working Paper; No. 9253). World Bank, Washington, DC. DOI: 10.1596/1813 9450 9253

Estrades, C., Flores, M., & Lezama, G. (2017). The role of export restrictions in agricultural trade (Documentos de Trabajo working papers 0417). Department of Economics dECON.

FAO. (1999). Implications of economic policy for food security: a training manual. http://www.fao.org/docrep/004/x3936e/x3936e03.htm

FAO. (2009). The state of agricultural commodity markets 2009. High food prices and the food crisis experiences and lessons learned. http://www.fao.org/3/i0854e/i0854e.pdf

FAO. (2015). The Democratic People’s Republic of Korea: outlook for food supply and demand in 2014/15 (GIEWS Update, 3 February). http://www.fao.org/giews/english/shortnews/20150203DPRK.pdf

FAO. (2021). Food price index. The FAO food price index continues to rise unabated. http://www.fao.org/worldfoodsituation/foodpricesindex/en/

FAO. FPMA. (2021b). Food prices. International prices. https://fpma.apps.fao.org/giews/food prices/tool/public/#/dataset/international

FAO. FPMA. (2021b). Food prices. International prices. https://fpma.apps.fao.org/giews/food prices/tool/public/#/dataset/international

FAO. FPMA. (2021а). Food prices. Domestic prices. https://fpma.apps.fao.org/giews/food prices/tool/public/#/dataset/domestic

FAO. FPMA. (2021а). Food prices. Domestic prices. https://fpma.apps.fao.org/giews/food prices/tool/public/#/dataset/domestic

Fellmann, T., Helaine, S., & Nekhay, O. (2014). Harvest failures, temporary export restrictions and global food security: the example of limited grain exports from Russia, Ukraine, and Kazakhstan. Food Security, 6(5), 727 742. DOI: 10.1007/s12571 014 0372 2

Global Trade Alert. (2021). Global dynamics https://www.globaltradealert.org/global_dynamics/area_goods/year from_2020/flow_export

Götz, L., Djuric, I., & Glauben, T. (2015). Wheat export restrictions in Kazakhstan, Russia, and Ukraine: Impact on prices along the wheat to bread supply chain. In: A. Schmitz & W.H. Meyers (Eds.), The emerging role of KRU in global agricultural markets: Promise and concern. Commonwealth Agricultural Bureaux International.

Hoekman, B.M., Fiorini, M., & Yildirim, A. (2020). Export restrictions: a negative sum policy response to the COVID 19 crisis (EUI RSCAS, 2020/23, Global Governance Programme 389, [Global Economics]). Cadmus, European University Institute Research Repository. http://hdl.handle.net/1814/66828

Interfax. (2021). RF introduces a grain export quota and a wheat duty (February 15th). https://www.interfax.ru/business/750900

Kheifets, B.A., & Chernova, V.Yu. (2019). Impact of foreign trade on the economic availability of food products in Russia. Society and Economy, 10, 62 75. DOI: 10.31857/S020736760007150 4

Ksenofontov, M.Yu., Polzikov, D.A., & Urus, A.V. (2019). Regulation of the grain sector in the context of the task s of ensuring food security in Russia. Problems of Forecasting, 6, 22 31.

Kulistikova, T. (2020). Security will be provided in a new way. Can a new food security doctrine promote the development of the agro industrial complex? https://www.agroinvestor.ru/markets/article/33321 bezopasnost obespechat po novomu mozhet li sposobstvovat razvitiyu apk novaya doktrina prodovolstven/

Kurowska, К., Marks Bielska, R., Bielski, S., Kryszk, H., & Jasinskas, А. (2020). Food security in the context of liquid biofuels production. Energies, 13, 6247. http://doi.org/10.3390/en13236247

Kuzmin, E. A. (2015). Food security modelling. Biosciences Biotechnology Research Asia, 12, 773 781. DOI: 10.13005/bbra/2095

Kuzmin, E. A. (2016). Sustainable food security: Floating balance of markets. International Journal of Economics and Financial Issues, 6(1), 37 44.

Liefert, W.M., & Westcott, P.C. (2015). Alternative policies to agricultural export taxes that are less market distorting (ERR 187, U.S. Department of Agriculture, Economic Research Service, June 2015).

Martin, W., & Anderson, K. (2012). Export restrictions and price insulation during commodity price booms. American Journal of Agricultural Economics, 94(2), 422 427. DOI: 10.1093/ajae/aar105

Puma, M.J., Bose, S., Chon, S.Y., & Cook, B.I. (2015). Assessing the evolving fragility of the global food system. Environmental Research Letters, 10(2), 024007. DOI: 10.1088/1748 9326/10/2/024007

Rosstat. (2021a). Official statistics. http://www.gks.ru

Rosstat. (2021b). Official statistics. https://rosstat.gov.ru/folder/10705

RussGov. (2020). Decree of the President of the Russian Federation of January 21, 2020 No. 20 On Approval of the Food Security Doctrine of the Russian Federation. https://www.consultant.ru/cons/cgi/onli ne.cgi?req=doc&base=LAW&n=343386&dst=1000000001%2C0# 09263595395042915

Schramski, J.R., Woodson, C.B., Steck, G., et al. (2019). Declining country level food self sufficiency suggests future food insecurities. Biophys Econ Resour Qual, 4, 12. DOI: 10.1007/s41247 019 0060 0

Siddhartha, M., & Tim, J. (2009). Agricultural export restrictions: Welfare implications and trade disciplines. IPC Position Paper. https://clck.ru/YdNY7

Voegele, J. (2020). Three imperatives to keep food moving in a time of fear and confusion. World Bank Voices (April 3, 2020). https://blogs.worldbank.org/voices/three imperatives keep food moving time fear and confusion

Vorotnikov, V. (2021). Grain export restrictions taking toll. https://www.world grain.com/articles/15108 grain export restrictions taking toll

Welton, G. (2011). The impact of Russia’s 2010 grain export ban (Oxfam. Research Report, June 2011). Oxfam International, Oxfam.

World Bank. (2018). The impacts of the El Niño and La Niña on large grain producing countries in ECA: yield, poverty and policy response. World Bank, Washington, DC. https://openknowledge.worldbank.org/handle/10986/30191

Wright, B. (2011). The economics of grain price volatility. Applied Economic Perspectives and Policy, 33, 32 58. DOI: 10.1093/aepp/ppq033

WTO. (2020). WTO report shows slowdown in G20 trade restrictions as COVID 19 impacts world economy. https://www.wto.org/english/news_e/news20_e/trdev_18nov20_e.htm

Professor Dr. Boris A. KHEYFETS is a Professor, Chief Researcher, Institute of Economics of the Russian Academy of Sciences (Moscow, Russia); Financial University under the Government of the Russian Federation (Moscow, Russia). His professional interests are Economic Globalization, Risks, International Relations, Import substitution, TNCs, development Strategies, World Economy, Credit Policy, Competitiveness, Economic Partnerships, Industrial Policy

Dr. Veronika Yu. CHERNOVA is an Associate Professor at the People’s Friendships University of Russia, Department of International Economic Relations. Her interests are World Economy, Marketing of Transnational Companies, Import Substitution,

Natalia N. SHURAKOVA is a researcher, at Financial University under the Government of the Russian Federation (Moscow, Russia). Her professional interests are Food Security, Agro industrial Complex, World Food System. ORCID ID: orcid.org/0000 0001 7425 5362

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

http://TuEngr.com

Modelling and Design of Deep Drawing Tools Using Logopress

Besart Berisha1, Afrim Gjelaj1*

1 Faculty of Mechanical Engineering, University of Prishtina, Prishtina, KOSOVA. *Afrim Gjelaj (Tel: +383 44 150 859, Email: afrim.gjelaj@uni pr.edu).

Paper ID: 13A5K

Volume 13 Issue 5

Received 20 January 2022 Received in revised form 10 April 2022

Accepted 17 April 2022 Available online 25 April 2022

Keywords: Solidwork; DC03 material; theoretical calculation; simulation of mesh; strain analysis.

Abstract

This work will present the analysing of the deep drawing process. For the design of the part , we used Solidwork package software. The design of part for deep drawing is described step by step. Material of part is get ting for this case DC03, which will be going into the deep drawing process. All required dimensions of the part are given to analyse the problem step by step. The t heoretical calculation for deep drawing it is presented for centre of gravity, tolerances for up and down tool s, working space of deep drawing, and percentage for a variety of materials. Also, analysing of strain, mesh, stamping force as well as stripper force for deep drawing and will be treated into Logopress software which is compatible with Solidwork. Disciplinary: Mechanical Engineering (Modelling & Drawing) ©2022 INT TRANS J ENG MANAG SCI TECH.

Cite This Article:

Berisha, B, Gjelaj, A. (2022). Modelling and Design of Deep Drawing Tools Using Logopress. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5K, 1 13. http://TUENGR.COM/V13/13A5K.pdf DOI: 10.14456/ITJEMAST.2022.95

1 Introduction

Forming processing represents the oldest metalworking method. This is the method of processing where the workpiece is given the desired shape without chip removal, the material is loaded on the limit of elasticity and deformation will be sustained, polystyrene (non elastic). By deformation , we understand the size and shape of the body or part. The material of part for our investigation is DC03, which includes design, theoretical calculation and simulation into the software Logopress.

At the end of the 19th century, forming processing had great development and for this reason, became a research topic. Some of the ancestors who were taken in this field were Besmer, Parkers, Adamson and Erichsen. Wrinkles, crevices and poor quality in the picture set a boundary in which the deformation process can be realized.

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies

Özdilli, et al. (2018) have made the comparison of four different steel sheet materials that are mostly used by deep drawing such as DC01, DC04 and for cold forming they have used DD13, DD14 to analyze the coefficient of friction, using the finite element method, to see which material is more significant.

Focused of their paper is by hydraulics press with double action is an article, a deep drawing process using a double action hydraulic press to examine the ability of machine for the shape deformation of a fuel filter cup from sheet metal SPCC steel (The Thanh et al., 2019), also they have made a comparison with theoretical and practical experiments, and have achieved that the die shoulder radius is one t he more important parameter to realize the cup of the deep drawing process.

This work showed the evaluation of forming process for different kinds of sheet materials regarding the deep drawing process. And to see the effects for different sheets and die/blank holder angle on deep drawing process, for analyzing sheet metal with thickness 0.8mm of SS304 and Brass and 0.9 mm thickness for aluminum material. Where the experiments are presented step by step from designing the deep drawing tools such as die, blank holder, and punch ( Reddy et al., 2016).

Amir M. et al. (2013) explained and investigated the effect of a new pulsating blank holder system to improve the forming process of aluminium alloy material 1050. Where simulation of deep drawing have make into environments of ABAQUS6.7 software.

Informing the process of Deep Drawing is very important due to the complexity of the part and the parameters of sheet materials of aluminium alloys (Dwivedi, R. D., et al. 2017).

Zaid (2016) explained the effect of geometry parameters, the radius of punch, which indicates directly the maximum deep drawing force.

The authors have presented an experimental Deep drawing process where a metal blank for radially drawn into a deformation process. Also, their focus was to analyze and control the spring back by deep drawing process, due to some parameters such as speed of punch, lubrication , nose radius of die, and blank holding force where are achieved some results of their studies (Said et al. , 2020).

2 Materials and Methods

The problem of designing and manufacturing the tool for forming process is quite complicated. This requires the commitment of the staff with superior qualifications and material resources. With the continued growth of production volume with deformation processing, manufacturers of these types of tools are added to numerous req uests, such as dependence on quality, the productivity of the economy, and time of production.

Designing new details or existing details where minor modifications are required are made on the basis of the technology experience and with the help of trial and error experiments. This way the design engineers enable a solution but in most cases far from optimal. Costs that are carried out during the design and testing of the tool are relatively high.

In order to reduce the possibility of working the tool without errors and in this case also decrease the possibility of lowering the tool constructing expenditure is used different strategies based on computer programs where the product of this case and tools followed during all design stages (CAD, CAM, CAP, CAE).

The process of deep drawing enters the group of sheet metal deformation operations, during which the acquired pieces of flat cylindrical details (or non cylindrical) at the end, which may be crowned or without. Part of deep drawing earned details with walls of flatforms, which generally do not require additional processing.

Depending on the form and the technological qualities of empty walled parts, the deep drawing is divided into:

o Deep drawing for symmetrical rotating bodies.

o Deep drawing Capturing bodies in tin form.

o Deep drawing of bodies in an irregular geometric shape.

Depending on the deformation character, the deep drawing can be divided into:

o Deep drawing without reducing the thickness of the walls.

o Deep drawing with reducing the thickness of the material, ie with the dilution of the walls. The scheme of Deep drawing process without and with sheet metal clamps (holder) is presented in Figure 1. The section without sheet metal clamping is used for the production the cutting of details with low height (shallow) and with large thickness (Lange K. 1985).

a) b)

Figure 1: a) Deep drawing without the holder of the sheet, 1 Die, 2 Sheet metal, 3 Punch; b) Deep drawing with the holder of the sheet, 1 Die, 2 Sheet metal, 3 Punch, 4 Holder of the sheet.

Deep drawing with a holder of sheet metal, is used for the production of parts with greater depth and for the smaller thickness of the material sheet metal. The deep drawing operation is performed on presses, which can be ordinary (single) or double action and triple action.

The process of production of sheets is done in machines, presses with double action, respectively in hydraulic presses and presses with a single action.

In addition, presses for deep drawing based on their constructive properties are classified into:

o One positional (one phase).

o Progressive with horizontal order of operations.

From Table 1 we can read the value of coefficient “c”, for different types of sheet materials to determine working space by deep drawing.

Table 1: Value of coefficient “c” in depend of steel material.

Sheet material factor [c] Steel 0.07 Aluminium 0.02 Other non ferrous metals 0.04

Calculation of working elements of deep drawing and cutting tool , as well as working space, is presented in Figure 3 (Whereas in Figure 3 left are showed working elements, in the right side is presented working space for deep drawing) (Tschaetsch, 2006).

Figure 2: Working elements and working space by deep drawing

The working space between the upper part of the tool and the lower part is calculated with the equation as follow s: �������� = (���� + ∆′′ ∙ ℎ) �������� = (���� + 0 2 ∙ ∆)�������� (1), �������� = (���� + 0 2 ∆′′ + 2 ���� )+�������� (2).

The material of the workpiece for our case is DC03, which has wide application for deep drawing, with thickens s = 0.5 [mm]. For our case Solidworks , it designed the part with dimension , as shown in Figures 4, the 2D and 3D design drawing s. For this part will be shown the mesh and strain with software logopress and at the same time will be presented the results of the theoretical calculations.

a) b)

Figure 3: a) Design of part into 2D sketch and b) 3D view

Then with the command to close the sketch (Close sketch) as in Figure 3 a), we close the sketch. Detail created with the help of the Revolved Boss / Base command. Then with the Revolved Boss / Base command the 3D view of the cut part is realized as in Figure 3 b)

3 Result a nd Discussion

Before starting with the software Logopress, it is presented the drawing of parts for the calculation of center gravity. In this paper, research methods will be used based on the analysis and synthesis of various tools mainly from different sources, mathematical methods for calculation. Modeling and simulating the tool for specific details is accomplished with the help of SolidWorks software and is it integrated to Logopress3.

Figure 4: Dimensioning of center gravity

Calculation of center of gravity is given through the expressions as follow s: This is example 1:

�������� = ����1 ����1 +����2 ����2+����3 ����3 ����1 +����2 +����3 = 23 5 π 47+74 25 49 5+99 1 π∙47+49.5+1 = 36 58 [��������] (3), �������� = ����1 ����1 +����2 ����2+����3 ����3 ����1 +����2 = 26 49 5+26 5 1 50.5 = 26 [��������] (4),

Based on Figure 2, expression (1) and (2) and Table 1, for steel of sheet metal DC03 working space is presented with expression as follow:

���� = ���� + ���� √10 ∙ ���� = 0.5 + 0.07√10 ∙ 0.5 = 0.65 [��������] (5),

a)

b) Figure 5: a) Material selection (DC03) and b) Logopress round drawn part.

All versions of Logopress are well integrated into the Solidworks program, and many engineers around the world use logopress for designing tools within the forming process. Working with the Logopress software can start from a detail designed in the SOLIDWORKS program, or from a part imported from another CAD system. For a quarter of a century, Logopress's main goal has

been the development of software for designing tools in the field of forming processe s. The Logopress3 software is currently used in many countries around the world.

With just five simple clicks of the cursor, you can see the workflow and then look at and define the intermediate stages during the job descriptions process. The software Logopress module also provides the ability to determine how many operations can be performed. Where through this two software, we have a shortened time in designing the buyout tool, if they were to be counted manually then they would take several hours or even a few days, and with Logopress's help, this could be done for a few minutes.

In Figure 5, we select the material DC03 which it is seen on the right side in the open window the properties of the material DC03.

After completing the 3D workflow in Solidworks, we move to Logopress, which is integrated in Solidworks with the help of this, we can see the stages of the development process from the initial dimensions of the workflow to the final, rounded, semifinal, the reduction factor for the first operation and for the subsequent operations, the type of material is assigned, the material thickness and the shrinkage ratio determined depending on the operation operations.

Figure 6: a) Step/stage of deep drawing, b) Stage 1 and stage 2 of deep drawing.

After clicking with the command “Round drawn part” as in Figure 6, where are presented the number of operation s of deep drawing, for our case deep drawing , is done with two operations . Also, is presented the display for “Round Draw Part”, wherein this step is choosing the main parameters during deep drawing, in the beginning, it is selected ‘Deep Drawing Sheet Steel’, at the same time in an automatic way are choice the value of factor K1 and factor KN.

Where:

o K1 reducing factor after the first operation,

o KN reducing factor in a subsequent operation.

In Figure 6 rights are shown stages of deep drawing: the force for the first stage of deep drawing is achieved F = 812 [daN] and the force for the second stage during deep drawing is obtained with a value F = 953 [daN].

In Figure 7 shows the creation of the strip for cutting, where it is performed initially by clicking on the command "create / edit a strip layout".

Figure 7: Creating the sheet.

Figure 8 shows the bar, where after clicking on the above commands we have the creation of the bar. During the creation of the tape we have achieved the utilization of the material with a value of 75.46%, and only 24.54% loss of the material, as seen in the Figure 8.

Figure 8: Bar of deep drawing.

By setting the parameter "The entire entity" the uninterrupted force of the sheet metal clamp is achieved, the surface turns red and remains fixed , and click to "The entire entity" command. Figure 9 a), is presented the determination of the size of the mesh where for the first case we took it for the number 4000. Also, are set the material of part DC03, thickness 0.5 mm, c = 0.07 mm, for 3D shape.

Show simulation of how the cut off part is formed from the starting material in a circle. Command "2D BLANK" we have the scope of the material. Clicking on the "Play" command then begins the simulation of the duplicated part where from the initial material in the form of a circle, where the duplicated part is formed. Also, in Figure 9 b) , the command "Mesh" is presented, when we select the command "Mesh" can be seen the grid formed inside the material.

a)

b) Figure 9: a) determining the mesh parameters, b) simulation of command “Mesh”

Figure 10 shows the calculation of those parameters which were defined in the figures above by clicking on the "Compute" command. Also, we can show the simulation of how the cut off part is formed from the initial material in a circle. Command "2D BLANK" we have the scope of the material. Clicking on the "Play" command then begins the simulation of the copied part where from the initial material in the form of a circle as seen in Figure 10, where the copied part is formed.

Figure 10: Calculation of strain.

In Figure 11, the largest strains in the force transmission area of the copied part are shown. Also, is obtained the stress as shown below by clicking on the "Stress" command and it can be seen that even the largest stresses are in the area of force transmission.

At the same time Figure 11 b), presented thickness variation of sheet metal parts, during the deep drawing process.

Below are performed the calculation of the variation in sheet metal depending on thickness in the percentages shown in the Figure above where we can see below the calculated values ∆s.

For 80% the equation gives this form:

∆���� = 0.5�������� ∙ 80% 100% = 0.4 (5),

For 60% the equation gives this form:

∆���� = 0.5�������� ∙ 60% 100% = 0.3 (6),

For 40% the equation gives this form:

∆���� = 0.5�������� ∙ 40% 100% = 0.2 (7),

For 20% the equation gives this form:

∆���� = 0 5�������� 20% 100% = 0 05 (8),

For 19% the equation gives this form:

a) b) Figure 11: a) Analyzing of stress, b) variation of thickness material

∆���� = 0.5�������� ∙ 19% 100% = 0.05 (9),

For 39% the equation give this form:

∆���� = 0.5�������� ∙ 39% 100% = 0.195 (10),

For 59% the equation give this form:

∆���� = 0.5�������� ∙ 59% 100% = 0.295 (11),

For 79% the equation give this form:

∆���� = 0 5�������� 79% 100% = 0 395 (12),

For 99% the equation give this form:

∆���� = 0.5�������� ∙ 99% 100% = 0.495 (9),

Conclusion

The main goal of this paper is focused on developing a model of the deep drawing process which includes modeling stages, calculations and simulations of the deep drawing tool. The calculation with expression and simulation with software (Solidwork, Logopress) for our problem has been studied and the results have been obtained.

In the framework of this paper, the process of machining by cutting without sheet metal clamps is treated, and the geometric and physical parameters of the tool are analyzed (w orking space f, material thickness s, coefficient for type of material c, properties of the base material, etc.). Also presented are most types of cutting such as sheet metal thickness reduction cutting, deep hydro mechanical cutting, conical, reversible cutting where most tools for these types of processes of coupons are modelled with SolidWorks software.

With the help of Solidworks software, the design of the tool was realized step by step, starting from the geometric shapes in 2D, then the design in 3D. The advantage of the software is that it enables the integration of Loggopress, where after designing the tool and the geometry of the part to be cut, we can analyze any errors with the help of simulation. Within the Solidwork Loggopress3 software, the real parameters of the coupling coefficients are given, then it is achieved with how many operations the detail to be coupled can be realized. Also, for the part with diameter d = 47.50 [mm], thickness s = 0.5 [mm] , inside radius r = 6.5 mm and outside radius r = 2.35 mm and the type of material DC03, are obtained results for stress and forming process. The results and the change in the thickness of the part walls during the cutting process with the help of Loggopress are also presented. At the same time the structural mesh (Mesh), is achieved as well as the progressive tool simulation.

5 References

Dwivedi, R. D., Agnihotri, G. (2017). Study of Deep Drawing Process Parameters. Materials Today: Proceedings 4, 820 826.

Lange, K. (1985). Handbook of Metal Forming . McGraw Hill .

Mostafapur, A., Ahangar, S., & Dadkhah, R. (2013). Numerical and experimental investigation of pulsating blankholder effect on drawing of cylindrical part of aluminum alloy in deep drawing process. International Journal of Advanced Manufacturing Technology , 69 (5), 1113 1121.

Özdilli, Ö., Erdin, M.E. (2018). Comparison of Common Deep Drawing Steel Sheets in terms of Blank Holder Force and Friction Conditions. International Journal of Automotive Science & Technology , 36 41.

Reddy, P.V., Ramulu, P.J., Madhuri, G.S., Govardhan, D., Prasad, P.V.S.R. 2016. Design and Analysis of Deep Drawing Process on angular Deep Drawing Dies for Different Anisotropic Materials. IOP Conference Series: Materials Science and Engineering 149, 012142.

Said, R., Mehrabi, M. (2020). Parametric Study of Spring Back Effects in Deep Drawing by Design of Experiment. SAE Technical Paper Series.

The Thanh, L., Tien Long, B., The Van, T., Nguye Duc Toan, N. (2019). A study on a deep drawing process with two shaping states for a fuel filter cup using combined simulation and experiment. Advances in Mechanical Engineering 11, 168781401987267.

Tschaetsch, H. (2006)., Metal Forming Practise Springer Verlag Berlin.

Zaid, A.I.O. (2016). Deep drawing mechanism, parameters, defects and recent results: state of the art. IOP Conference Series: Materials Science and Engineering 146, 012009.

MSc. Besart Berisha (Ph.D student) is a teaching assistant at Department of Manufacturing and Automation, University of Prishtina, Kosova. He got his Bachelor's and Master’s degrees in the Faculty of Mechanical Engineering, at the University of Prishtina, Kosova. His research focuses on the manufacturing and design of products, hydraulics and pneumatics.

Dr. Afrim Gjelaj, is an Assistant Professor at the Department of Manufacturing and Automation. He got his Doctoral degree (Dr.sc.) in field of Manufacturing and Automation at the University of Maribor, Faculty of Mechanical Engineering, Maribor, Slovenia. His researches are machining processes, Modern manufacturing, reverse engineering, CAD/CAM, CNC and additive Technology.

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

Bird Droppings Biodegradation and Its Use as Fertilizer for Tomato Cultivation

Albina Luneva1*, Yury Lysenko2, Anna Gneush2, Aleksandr Lysenko3, Nadezhda Machneva2, Maria Aniskina2

1Department of Parasitology, Veterinary Sanitary Expertise and Animal Hygiene, Kuban State Agrarian University named after I. T. Trubilin, RUSSIA.

2Department of Biotechnology, Biochemistry and Biophysics, Kuban State Agrarian University named after I. T. Trubilin, RUSSIA.

3Department of Therapy and Pharmacology, Kuban State Agrarian University named after I. T. Trubilin, RUSSIA.

*Corresponding Author (Tel: +7 918 8834561, Email: yuraduban45 @mail.ru).

Paper ID: 13A5L

Volume 13 Issue 5

Received 20 December 2021 Received in revised form 10 April 2022

Accepted 17 April 2022 Available online 25 April 2022

Keywords:

Pseudomonas putida 90 biovar a (171); Azotobacter chroococcum 31/8R strains; Manure processing; Decreasing ammonia nitrogen emitting; Organic fertilizer.

Article:

Abstract

This article presents the results of studying the effect of a microbial biological product based on Pseudomonas putida 90 biovar A (171) and Azotobacter chroococcum 31/8 R strains on the process of biodegradation of native litter of broiler chickens and quails. An assessment of the physicochemical and sanitary bacteriological characteristics of the processed manure showed an improvement in safety indicators. There had noticed that the experimental samples of processed litter, were decreasing ammonia nitrogen emitting and unpleasant odor significant reduction. Also, there had studied the effectiveness of processed manure as an organic fertilizer in tomato cultivation. Agrotechnological experiments have shown that the fruits in the experimental group had increased productivity and better accumulation of sugars and ascorbic acid in their composition. Disciplinary: Sustainable Agriculture (Soil and Fertilizer) , Poultry Science, Horticulture ©2022 INT TRANS J ENG MANAG SCI TECH.

1 Introduction

Organic fertilizers are a necessary element of crop cultivation technologies, because of their wide effect on the soil microorganisms plant system. They are an important source of mineral nutrients for plants and soil microorganisms, increasing the efficiency of applied mineral fertilizers by 20 30%. In addition, the applied organic fertilizers make it possible to re engage part of the

nutrients taken out with the harvest into the cycle (Chew et al., 2019; Daadi and Latacz Lohmann, 2021).

Organic fertilizers, to some extent, neutralize the negative effects of the use of mineral fertilizers and plant protection products. They contribute to the utilization of pesticide residues, heavy metals , and radioactive substances into compounds inaccessible to plants. Physiologically active substances that activate growth and production processes enter the soil with organic fertilizers (Grenon et al., 2021; Grzyb et al., 2021).

One type of organic fertilizer is bird droppings a biologically active product containing all the macro and microelements necessary for plants in large quantities. Microelements released as organic matter decomposes are available to plants for a longer time than microelements of mineral additives (Imas, 2000). There had revealed that bird droppings are a fast acting organic fertilizer with high nutrient content. Its phosphorus is better absorbed than mineral fertilizer pho sphorus (Akhtar et al., 2007; Li et al., 2011).

The major limiting factor in using poultry manure as a fertilizer is the need to ensure compliance with sanitary safety standards (Chastain et al., 2010; Katsura et al., 2021; Muola et al., 2021).

Thus, the u se of organic fertilizers based on bird droppings is promising, and the search for means to speed up its natural decomposition process is an urgent direction.

The purpose of the research work is to study the effect of organic fertilizers from a processed litter of broiler chickens and quails on the growth, development, yield, and quality of vegetable fruits, using the example of an open ground tomato.

2 Materials and Methods

For bird droppings processing in Krasnodar Region farming, had used a developed 2 co mponent bioutilizer comprising a mixture of Pseudomonas putida 90 biovar A (171) and Azotobacter chroococcum 31/8 R cultures.

Table 1: Scheme of a field scientific and economic experiment on tomatoes Group Type of processed manure Dose of applying processed manure applied to the soil, kg/m2 Control

1st experience from broiler chickens

1.5

2nd experience from broiler chickens 3.0

3rd experience from broiler chickens 4.5

4th experience from quails 1.0

5th experience from quails 1.5

6th experience from quails 2.0

Manure processing was on isolated farm sites equipped with a manure storage facility. There had processed four tons of broiler and quail manure. The research, carried out the physical chemical and sanitary bacteriological control of the initial bird droppings and the final product by GOST 31461 2012. Also, studied the ammonia nitrogen level and the total microbial number of the experimental samples (Britt et al., 2002; Kim and Patterson, 2003; Williams et al., 1999).

There had been studied the impact of the processed manure of broiler chickens and quails on the growth, development, yield, and quality of tomato cultivation. The test organic fertilizer was applied to the area allotted for laying the field experiment on tomatoes, according to the experimental schemes (Table 1).

Shallow plowing to a depth of 10 15cm was introduced into the soil with the applied fertilizers. The accounting area of the plots was 5m 2, the repetition was four times. Seedlings at 60 days from germination had been planted in the open ground according to the scheme 70×50cm.

All activities for the care of plants (loosening of row spacings, watering, weed control, harvesting) were done manually. Soil moisture was supported at the level of 75% of the lowest moisture capacity.

The selection of plants to determine growth parameters (plant height, number of branches and leaves, total leaf surface, biomass , and dry mass of aboveground organs) was at the beginning of fruit formation. Fruits harvested were every 3 4 days as they reached biological ripeness with simultaneous structural analysis (determination of the diameter and weight of each fruit). During the period of mass harvesting of fruits, the content of total sugars and vitamin C in them was determined. The yield was determined by the sum of fruits harvested from the accounting area.

As a vegetable crop were tomatoes of the variety «Dar Zavolzh'ya». The «Dar Zavolzh'ya» is a mid early variety of tomatoes , usually from 103 to 109 days pass from the moment of seed germination to the fruiting period. It 's cultivated by seedlings and intended for planting in open ground. An adult plant reaches a height of only 50 70cm. Tomato "Dar of the Volga" is not susceptible to diseases of septoria and alternariosis. The fruits have a rounded shape, the col or is red orange, and the weight of one fruit is on average 80 100g. The fruits have an excellent taste and have good resistance to long term transportation. On average, the variety's yield is between 4 and 5kg/m2 .

3 Results and Discussion

3.1 Soil and climatic conditions during experiments

Soil type leached chernozem. The thickness of the humus horizon exceeds 150cm. I n the upper horizon, the soils are rich in phosphorus with a concentration of 0.18%. The main part of phosphorus contains mineral compounds (in the upper horizons by 55 65%, in the lower horizons over 90% of the gross amount). Organic phosphorites are in the amount of 43% in the upper and 8 10% in the lower horizons. Chernozems have a high water holding capacity but have a low range of active moisture. Of the total amount of soil moisture, less than 50% belongs to the category of active or productive moisture. Climate the area of the experiment (Krasnodar), belongs to the unstable humid zone. Moisture coefficient 0.25 0.30, 500 600 mm of precipitation falls per year. Air temperature transition in spring over + 5°C is in the second half of March early April. A distinctive feature of the spring period of the zone is the rapid temperature rise.

The weather during the growing season of the studied culture (Table 2) was formed for its growth and fruiting in different ways.

Table

2: Weather during the tomato growing season, 2021

Month Air temperature, °С Precipitation, mm Relative humidity, % average long term during the growing season average long term during the growing season average long term during the growing season April 10.9 11.1 48.0 85.4 69.0 82.0 May 16.8 18.0 57.0 64.7 67.0 71.0 June 20.4 21.7 67.0 36.1 65.7 76.3 July 23.2 25.1 58.0 16.0 64.3 68.0

The optimal temperature and moisture supply during the planting of seedlings (for tomatoes on 12 April 2021) activated the rooting of seedlings and provided a high start for growth processes and fruit formation. However, prolonged high temperatures and air drought (June July) reduced the initial effect and adversely affected the production process, yield , and fruit quality.

3.2 Compliance of Processed Poultry Manure with Indicators of Regulatory Documentation

The results of studies during the processing of native litter got from broiler chickens and quails with the developed biological product are in Tables 3 and 4.

Table

3: Physico chemical and sanitary biological parameters of broiler chickens' manure

Indicator

Type of manure Requirements according to GOST 31461 2012 Droppings from young broiler chickens Duration of studies, days 0 15 original manure without processing processed physical and chemical indicators

Consistency (phase state), visual inspection viscous Viscous viscous flowing viscous flowing

Mass fraction of moisture, g/kg 664 668 501 no more 550

Mass fraction of organic matter, g/kg 341 340 375 no more 350 Mass fraction of ash, g/kg 84 85 113 no more 100 рНKCI 7.3 7.4 7.3 6,8 8,0

Nitrogen total, g/kg 12 12 19 at least 15 Phosphorus total, g/kg 14 15 9 no more 10

Potassium total, g/kg 9 9 4 no more 4

Lead, mg/kg dry matter 73.2 72.6 38.2 no more 130*

Arsenic, mg/kg dry matter 11.2 11.4 5.1 no more 10*

Copper, mg/kg dry matter 124.9 124.3 69.3 no more 132*

Cadmium, mg/kg dry matter 1.76 1.74 0.76 no more 2*

Nickel, mg/kg dry matter 62.7 61.5 26.7 no more 80* Zinc, mg/kg dry matter 253.7 250.3 147.0 no more 220*

Ammonia nitrogen, mg/m3 74 76 19 not standardized Sanitary and biological indicators

Index coli group bacteria 4 4 2 3

Enterococcus index 4 4 2 3

Index of pathogenic microorganisms Missing Missing Missing Missing Eggs and larvae of helminths (ind./g) 4 4 Missing Missing Cysts of intestinal pathogenic protozoa (ind./100 g) 1 1 Missing Missing

TMC index, cells/g 4 4 10 not standardized *According to SanPiN 1.2.3685 21

Table 4: Physico chemical and sanitary biological parameters of quails' manure

Indicator

Type of manure Requirements according to GOST 31461 2012 Droppings from young quails Duration of studies, days 0 15 original litter without processing processed physical and chemical indicators

Consistency (phase state), visual inspection viscous viscous viscous flowing viscous flowing

Mass fraction of moisture, g/kg 615 612 537 no more 550

Mass fraction of organic matter, g/kg 368 360 391 no more 350

Mass fraction of ash, g/kg 121 120 142 no more 100

рНKCI 7,5 7,4 7,4 6,8 8,0

Nitrogen total, g/kg 14 14 21 at least 15

Phosphorus total, g/kg 14 13 10 no more 10

Potassium total, g/kg 6 6 3 no more 4

Lead, mg/kg dry matter 47.7 46.8 25.1 no more 130*

Arsenic, mg/kg dry matter 9.7 9.6 3.7 no more 10*

Copper, mg/kg dry matter 69.6 69.1 43.8 no more 132*

Cadmium, mg/kg dry matter 1.54 1.50 1.15 no more 2*

Nickel, mg/kg dry matter 37.4 36.8 23.9 no more 80*

Zinc, mg/kg dry matter 187.5 185.3 102.1 no more 220*

Ammonia nitrogen, mg/m3 67 66 13 not standardized Sanitary and biological indicators

Index coli group bacteria 4 4 1 3

Enterococcus index 4 4 3 3 Index of pathogenic microorganisms Missing Missing Missing Missing Eggs and larvae of helminths (ind./g) Missing Missing Missing Missing Cysts of intestinal pathogenic protozoa (ind./100 g) Missing Missing Missing Missing

TMC index, cells/g 4 4 10 not standardized *According to SanPiN 1.2.3685 21

The bird droppings treated with a 2 component bio utilizer evanesced their color and state of aggregation during visual observation. Through, a versatile gas analyzer, there had been discovering decreasing ammonia in the ambient environment. Regardless of the type of bird droppings, the experimental batches treated with the biol ogical product met the requirements of GOST 31461 2012. Native litter from broiler chickens and quails, not treated with a biological product, in all experiments during the study did not show results that would meet the regulatory document. The content of ammonia nitrogen in the external environment was 2 3 times higher than in the experimental batches and was above the level of the permissible concentration limit. The total microbial count in the untreated litter on the 15th day remained the same as in the original by product. Bird droppings, not treated with the proposed biological product, did not undergo significant changes in performance while retaining a pungent, unpleasant ammonia odor. Also, in the studies (on the 15th day), had been studying the haz ard class of treated and untreated bird droppings (Antonov et al., 2021; Modak et al., 2019; Pokrant et al., 2021). The calculation method had established the danger indicator of untreated broiler chickens’ manure 26.57, of quails’ manure 22.72, which belongs to the III class of danger (moderately dangerous). The risk index of manure treated with a 2 component biological product got of broiler chickens was 9.45, and of quails 8.68, which belongs to the IV hazard class (low dangerous).

Thus, native manure treated with a bio utilizer from a mixture of Pseudomonas putida 90 biovar A (171) and Azotobacter chroococcum 31/8 R cultures improves the physicochemical and sanitary bacteriological characteristics of the final product. There is also a stimulation o f the growth of specific microflora, which ensures its biodegradation and a decrease in the level of ammonia nitrogen in the environment. Together, this reduces the hazard class, which makes it possible to use this by product of poultry farming as an organic raw material used in the production of fertilizers.

3.3 The Effect of Processed Poultry Manure on the Growth , Development , and Yield of Tomato es

Vegetables a source of vitamins, a balanced complex of minerals, fiber, and organic acids play an important role in human nutrition. Tomato fruits contain pectin and nitrogenous substances, sugar 4%, organic acids 0.4 0.9% (citric, malic, oxalic, tartaric), fats and essential oils 0.2%, various mineral salts (especially much potassium and magnesium) , and vitamins (B1, B2, B6, K, PP, C 25 45 mg%). High productivity, good taste, and a variety of uses have made tomato a vegetable crop common in Russia (Kuzmitskaya and Kuliakina, 2020).

Vegetable crops consume a lot of nutrients. To get a high and high quality yield , they need large amounts of macronutrients (N, P, K, Ca, Mg, S), and small amounts of microelements (B, Mn, Zn, Co, Cu, Mo). It manifested especially prime requirements for the nutritional regime when growing tomatoes through seedlings with an underdeveloped root system (Hidayat et al., 2021; Palumbo et al., 2020; Widyastuti et al., 2019). Using the tested bird droppings as the main fertilizer provided a constant level of nutrition, better seedling establishment, and optimal conditions for the growth of to mato plants (Table 5).

Table 5: Influence of the use of processed poultry manure in tomato cultivation technology on plant growth Group Plant height, cm Number per plant, pcs. Leaf area, dm2/plant Mass of aboveground organs, g/plant branches leaves raw dry

Control 46.9 4.0 14.1 12.01 54.12 8.94

1st experience 51.1 4.3 16.7 12.72 60.44 10.58

2nd experience 53.5 4.6 18.4 13.11 66.08 11.70

3rd experience 52.0 4.5 17.6 12.98 64.35 11.26

4th experience 52.8 4.4 17.3 12.92 62.78 11.11

5th experience 56.7 4.8 20.0 14.22 69.06 12.36

6th experience 54.6 4.7 18.9 13.48 67.24 11.89 НСР05 * 2.2 0.2 0.8 0.59 2.77 0.49 * Least significant difference

In the experiment had been discovering that all the experimental variants of tomato plants grew most tall (51.1 56.7cm, in control 46.9cm), leafier (number of leaves 16.7 20.0 pieces, in control 14.1 pieces; the total area of leaves 12.72 14.22 and 12.01 dm2 /plant, respectively). The influence of organic fertilizer had been activating not only growth but also intensifying the assimilation processes. This led to an increase in biomass (60.44 69.06g/plant, in control 54.12g/plant) and dry weight of aboveground organs (10.58 12.36g/plant, in control 8.94g/plant).

However, it had been noticed that the strength of the effect of the tested organic fertilizers on plant growth largely depended on the type of bird droppings (broiler chickens or quails) and the applied dose. The maximum absolute growth rates were by using processed broiler chicken manure at a dose of 3.0kg/m2 and processed quail manure at a dose of 1.5kg/m2. Obviously, in these options, the ratio of the nutrients included in the tested fertilizers is optimal, and the content and demand for them for plants suffices to activate growth and production processes to get a high quality crop.

Table 6: Effect of tested fertilizers on the fruit formation of tomato plants Option Number of tomatoes, pieces/bush Weight of tomatoes, kg/bush Tomatoes parameters diameter, cm mass, g Control 13.1 0.824 4.0 62.88

1st experience 13.8 0.906 4.3 65.67

2nd experience 15.2 1.014 4.5 66.70 3rd experience 14.6 0.966 4.4 66.14 4th experience 13.9 0.915 4.4 65.82 5th experience 15.6 1.052 4.7 67.44 6th experience 15.1 1.005 4.6 66.53 НСР05 0.6 0.039 0.2 0.039

The data in Table 6 shows that the tested bird droppings stimulated the process of fruit formation. A greater number of tomatoes was growing in the experimental variants (13.8 15.6pcs/plant, in the control 13.1pcs/plant). They were larger (4.3 4.7 and 4.0cm diameter) and with weights (65.67 67.44 and 62.88g). The formation of the bush in the experimental variants of a larger number of larger fruits and their total mass contributed to an increase in the yield and quality of tomato fruits (Table 7).

Table 7: Yield and quality of tomato fruits depending on the use of processed poultry manure in its cultivation technology

Option Productivity, kg/m2 Control Gain Content in tomatoes kg/m2 % sugars, % vitamin C, mg % Control 2.390 3.3 35.2 1st experience 2.627 0.237 9.9 3.5 37.6 2nd experience 2.941 0.551 23.1 3.8 39.4 3rd experience 2.801 0.411 17.2 3.6 38.8 4th experience 2.654 0.264 11.1 3.6 37.9 5th experience 3.051 0.661 27.7 3.9 40.7 6th experience 2.915 0.525 22.0 3.7 39.2 НСР05 0.122

The research results showed that, in the experimental variants, the tomato yield increased significantly (2.627 3.051kg/m2, in the control 2.390kg/m2, HCP05 0.122kg/m2). The maximum yield increase in tomato cultivation technology was 23.1 and 27.7%. It had been in variants with the use of processed broiler chicken manure at a dose of 3.0kg/m2 and quail manure at a dose of 1.5kg/m2. In these variants, the content of total sugars and vitamin C in tomato fruits was maximum (3.8% and 39.4 mg%, 3.9% and 40.7 mg%, respectively, in the control 3.3% and 35.2 mg%).

Conclusion

Thus, native manure got from young broiler chickens and quails, treated with a microbial biological product from a mixture of Pseudomonas putida 90 biovar A (171) and Azotobacter chroococcum 31/8 R cultures, improves the physicochemical and sanitary and microbiological characteristics of the final product. There is a stimulation of the growth of specific microflora of the litter, which ensures its biodegradation, as well as a decrease in the level of ammonia nitrogen in the environment. Together, this reduces the hazard class, which makes it possible to use this by product of poultry farming as organic raw material. The agrotechnological methods carried out have shown that the high biological efficiency of the tested organic fertilizers (processed litter of broiler chickens and quails) on the studied crop is because of the high yield of high quality tomato fruits. With a yield in tomato control of 2.390kg/m2, the maximum gains of 23.1 and 27.7% were in variants with introducing processed broiler chicken manure into the soil at a dose of 3.0kg/m 2 and processed manure a week before planting seedlings into the soil , quails at a dose of 1.5kg/m 2. Also in these options were the tomatoes of the highest quality.

5 Availability o f Data and Material

Data can be made available by contacting the corresponding author.

6 Acknowledgement

The research was carried out with the financial support of the Kuban Science Foundation and the Organization in the framework of the scientific project № MFI P 20.1/4.

7 References

Akhtar MS, Oki Y, Adachi T, Murata Yand Khan MHR . Relative phosphorus utilization efficiency, growth response, and phosphorus uptake kinetics of brassica cultivars under a phosphorus stress environment. Communications in Soil Science and Plant Analysis 2007;38(7 8): 1061 1085. DOI: 10.1080/00103620701280266

Antonov A, Ivanov G and Pastukhova N. Quail Droppings Utilization System. In IOP Conference Series: Earth and Environmental Science. 2021;666(2):022073. DOI: 10.1088/1755 1315/666/2/022073

Britt C, Bullard M, Hickman G, Johnson P, King J, Nicholson F, Nixon P and Smith N. Bioenergy Crops and Bioremediation A Review. Crops. 2002.

Chastain JP, Camberato JJ and Skewes P. Poultry Manure Production and Nutrient Content. Production. 2014.

Chew KW, Chia SR, Yen HW, Nomanbhay S, Ho YC and Show PL (2019). Transformation of biomass waste into sustainable organic fertilizers. Sustainability (Switzerland). 2019;11(8):2266. DOI: 10.3390/su11082266

Daadi BE and Latacz Lohmann U Organic fertilizer use by smallholder farmers: Typology of management approaches in nor thern Ghana. Renewable Agriculture and Food Systems 2021;36(2): 192 206. DOI: 10.1017/S1742170520000228

GOST 31461 2012. Poultry dung. Raw material for the manufacture of organic fertilizers. https://docs.cntd.ru/document/1200096492

Grenon G, Singh B, de Sena A, Madramootoo CA, von Sperber C, Goyal MK and Zhang T Phosphorus fate, transport and management on subsurface drained agricultural organic soils: A review. Environmental Research Letters 2021;16(1). DOI: 10.1088/1748 9326/abce81

Grzyb A, Wolna Maru wka A and Niewiadomska A. The significance of microbial transformation of nitrogen compounds in the light of integrated crop management. Agronomy 2021;11(7):1415. DOI: 10.3390/agronomy11071415

Hidayat H, Rostyanesia and Kurniati YS. Identification of lactic acid bacteria from tomato fruit extract and antibacterial activity test against Klebsiella pneumoniae. In AIP Conference Proceedings. 2021;2370:070001. DOI: 10.1063/5.0062681

Imas P (2000). Integrated Nutrient Management for Sustaining Crop Yields in Calcareous Soils.

Katsura H, Koseki K, Bito T, Takenaka S and Watanabe F. Characterization of vitamin B12 compounds in fermented poultry manure fertilizers. Agriculture (Switzerland) 2021;11(7):627. DOI: 10.3390/agriculture11070627

Kim WK and Patterson PH. Effect of minerals on activity of microbial uricase to reduce ammonia volatilization in poultry manure. Poultry Science. 2003;82(2):223 231. DOI: 10.1093/ps/82.2.223

Kuzmit skaya GA and Kuliakina NV. A comprehensive assessment of tomato collection varieti es by yield and parameters of adaptability in monsoon climate conditions. In IOP Conference Series: Earth and Environmental Science. 2020;547:012018. DOI: 10.1088/1755 1315/547/1/012018

Li SX, Wang ZH and Stewart BA (2011). Differences of Some Leguminous and Nonleguminous Crops in Utilization of Soil Phosphorus and Responses to Phosphate Fertilizers. Advances in Agronomy 2011;110:125 249. DOI: 10.1016/B978 0 12 385531 2.00003 7

Modak M, Chowdhury EH, Rahman MS and Sattar MN. Waste management practices and profitability analysis of poultry farming in Mymensingh district: A socioeconomic study. Journal of the Bangladesh Agricultural University 2019;17(1):50 57. DOI: 10.3329/jbau.v17i1.40663

Muola A, Fuchs B, Laihonen M, Rainio K, Heikkonen L, Ruuskanen S, Saikkonen K and Helander M. Risk in the circular food economy: Glyphosate based herbicide residues in manure fertilizers decrease crop yield. Science of the Total Environment, 2021;750:141422. DOI: 10.1016/j.scitotenv.2020.141422

Palumbo G, Carfagna S, Stoleru V, Torino V, Romano PM, Letizia F and Di Martino C. Environmental sustainability fruit quality and production in mycorrhizal tomato plants without p fertilizing. Agronomy Research 2020;18(4):2535 2549. DOI: 10.15159/AR.20.204

Pokrant E, Yévenes K, Trincado L, Terraza G, Galarce N, Maddaleno A, San Martín B, Lapierre L and Cornejo J. Evaluation of antibiotic dissemination into the environment and untreated animals, by analysis of oxytetracycline in poultry droppings and litter. Animals. 2021;11(3):853. DOI: 10.3390/ani11030853

SanPiN 1.2.3685 21. Sanitary rules and norms: Hygienic standards and requirements for ensuring the safety and (or) harmlessness of environmental factors for humans. https://docs.cntd.ru/document/573500115

Widyastuti S, Geraldine BAFD, Sunarwidhi AL, Ariyana MD, Prasedya ES, and Sunarpi H. The use of brown algae extract to extend shelf life and improve post harvest quality of tomato fruit. In AIP Conference Proceedings. 2019;2199:070008. DOI: 10.1063/1.5141322

Williams CM, Barker JC, and Sims JT Management and utilization of poultry wastes. Reviews of Environmental Contamination and Toxicology 1999;162:105 157. DOI: 10.1007/978 1 4612 1528

Albina Luneva is a Candidate of Biological Sciences, at the Department of Parasitology, Veterinary Sanitary Expertise and Animal Hygiene, Kuban State Agrarian University named after I. T. Trubilin, Russia. Her research encompasses Improving Methods for Diagnosing, Treating and Preventing Invasive Diseases and Productivity of Domestic and Wild Animals and Birds

Dr.Yury Lysenko is at the Department of Biotechnology, Biochemistry and Biophysics, Kuban State Agrarian University named after I. T. Trubilin, Russia. He holds a Doctor of Biological Sciences His research encompasses the Development of End to end Agro food Bio Nanotechnologies, Functional eco products based on Plant, Animal Raw Materials and By products of Processing in the conditions of organic industrial development.

Anna Gneush is a Candidate of Agricultural Sciences at the Department of Biotechnology, Biochemistry and Biophysics, Kuban State Agrarian University named after I. T. Trubilin, Russia. Her research focuses on the Development of end to end Agro food Bio Nanotechnologies, getting Functional Eco products based on Plant, Animal Raw Materials and by Products of Processing in the Conditions of Organic Industrial Development.

Dr.Aleksandr Lysenko is a Professor at the Department of Therapy and Pharmacology, Kuban State Agra rian University named after I. T. Trubilin, Russia. He holds a Doctor of Veterinary Sciences. His research is related to Internal Non communicable Diseases of Farm Animals

Nadezhda Machneva is a Candidate of Biological Sciences at the Department of Biotechnology, Biochemistry and Biophysics, Kuban State Agrarian University named after I. T. Trubilin, Russia. Her researches are the development of end to end Agro food Bio nanotechnologies, Functional Eco products based on Plant, Animal Raw Materials and By products of Processing in the Conditions of Organic Industrial Development

Maria Aniskina is a Candidate of Agricultural Sciences at the Department of Biotechnology, Biochemistry and Biophysics, Kuban State Agrarian University named after I. T. Trubilin, Russia. Her research is re lated to the Development of End to end Agro food Bio nanotechnologies, getting Functional Eco products based on Plant, Animal Raw Materials and By products of processing in the Conditions of Organic Industrial Development

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

Human Resource Management through an Islamic Len: A Systematic Review & Research Agenda and Practical Implications

Ahmed M. Asfahani1

1 Department of Human Resources Management, College of Business Administration, University of Business and Technology, Jeddah, SAUDI ARABIA.

*Corresponding Authors (Email: a.asfahani @ubt.edu.sa).

Paper ID: 13A5M

Abstract

Volume 13 Issue 5

Received 24 December 2021 Received in revised form 12 April 2022

Accepted 19 April 2022 Available online 26 April 2022

Keywords: Human Resource Management (HRM); Islamic values; Systematic review; Research agenda; Practical implications; Islamic HRM practices; Employee satisfaction; Islamic based HRM; Quran based HRM

Islamic HRM values are numerous centuries old, but they are still applicable in the modern business world due to their flexibility. The values are about respecting humanity in terms of equality, honesty, fairness in decision making, and accountability in leadership and followership. A systematic literature review has been presented in this paper that shows that if these principles are practiced in business today, there is a positive influence on employee satisfaction, the trust relationship between employer and employees, job commitment, and overall organizational performance. The employees and managers view themselves that Islamic HRM practices are the right way of managing systems within the working place as they are righteous. However, there are different opinions from the Western world that cause resistance against Islamic HR practices. Islamic HRM must face current business challenges when it comes to its practical implications. Disciplinary: Management Sciences (Business Development, Business Management). ©2022 INT TRANS J ENG MANAG SCI TECH. Cite This Article: Asfahani, A (2022). Human Resource Management through an Islamic Len: A Systematic Review & Research Agenda and Practical Implications. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5M, 1 9. http://TUENGR.COM/V13/13A5M.pdf DOI: 10.14456/ITJEMAST.2022 97

1 Introduction

With the advent of globalization, an amalgamation of working practices in business is witnessed where Muslims and the West come together under one roof for business matters. When two different cultures are present, there is a difference in attitudes towards business perspectives and how business matters occur in each culture. The nature and contents of management are distinct for the two cultures and have to be managed effectively so that these differences do not

affect the employees and their performance. The following paper would present a systematic review of human resource management through an Islamic lens to provide a research plan and practical implications for the modern world. The basic Islamic understanding of the HRM practices that would be useful for today’s modern business systems would be reflected in this review. The systematic review’s objective is to evaluate human resource management through an Islamic lens so that management practices could be scrutinized in the context of Islamic culture to be applied in today’s world. Since collaboration among different cultures is the requirement of current times for innovation purposes, diversity across cultures has become a concern. Hence, Islamic human resource management’s role would be appraised through this systematic review of previous studies to view these principles’ workings in Muslim and non Muslim contexts.

2 Method

A systematic review of several databases was conducted between 17 December to 22 December 2020. All the aspects of human resource management and Islamic culture were included so that different authors’ perspectives in different years could be overviewed. A careful selection of studies was made so that identical ones could be excluded. The reason for excluding the identical ones is to keep the data precise and free of repetition.

2.1 Eligibility Criteria

Study eligibility would be based on the inclusion of research no older than the year 2000. Also, the included studies were published in English. The studies were also included based on the selected keyword search. Those studies that were excluded were off topic and did not match the results of the keywords. The selected studies had to be matched with the relevance to the objective of the study.

2.2 Data Sources

The research articles were taken from several data sources such as three articles from Personnel Review, two articles from International Review of Management and Marketing, and the rest were taken from African Journal of Business and Management, Journal of Islamic Business and Economic Review, Journal of Islamic Accounting and Business Research, International Journal of Human Resource Management, Bangladesh Journal of Islamic Thought, Journal of International Management Studies, International Journal of Academic Research In Business and Social Sciences, International Journal of Islamic Business and Management, Asia Pacific Journal of Business Administration, University of Haripur Journal of Management, The Dialogue, Research Gate, European Journal of Business and Social Sciences, Qudus International Journal of Islamic Studies, Journal of Industrial Engineering and Management, Purushartha: A Journal of Management, Ethics and Spirituality, International Journal of Development Research, Research Journal Al Basirah, Al Idah, Business and Economic Review, Asian Social Sciences, Journal of Entrepreneur Education, Advances In Economics, Business and Management Research, and Journal of Managerial Sciences. Also, extended research was conducted, which means the cited articles at the end of selected

research were also reached for gaining an extended view of the opinions. Many of the articles were selected through this approach as they turned out to be relevant for this research paper.

2.3 Risk of Bias in Studies and Its Removal

The selected studies’ possible bias for the systematic review was removed by omitting the identical research and older than the year 2000. It was considered that studies older than this year would be outdated and might not present the views that are related to today’s notions and viewpoints of the business world and Islamic human resources. Hence, this bias of personal thoughts of the authors older than the year 2000’s studies was likely removed.

2.4 Data Collection Process

The data was collected with a keyword search. The keywords used were ‘Islam and human resource,’ ‘Islam and a human resource management, ‘Islamic human resource,’ ‘Islamic human resource management, ‘Islamic culture and a human resource management, ‘teachings of Islam and HRM,’ ‘Islamic HRM and modern business culture,’ ‘Quran based HRM’ and ‘Western culture and Islamic human resource management.

2.5 Data Analysis

Data analysis was done by formulating a table and narrative summaries of the selected research. The systematic review of the findings was done in a narrative synthesis manner.

3 Result a nd Discussion

The search from all the databases yielded 578 research articles. The articles that occurred the same were excluded, and those older than the year 2000 were also not considered. Those relevant are presented below in the form of a table, chronologically so that the overview of the Islamic HRM perspectives with time is demonstrated well for a deeper understanding. Further detailed discussion on the extracted themes and discernment from this systematic review would be presented subsequently.

Table 1: Analyzed result

Authors Year Study purpose

Hashim 2008 To recognize the salient features of Islamic HRM for better HR management of non Muslim managers

Key findings

The quantitative study’s findings revealed that Islamic parameters were highly correlated with increased job satisfaction and commitment among the employees. This information could be useful for non Muslim managers for their Muslim employees working in MNCs.

Abbasi et al. 2010 To understand the Islamic model of management The results revealed that Islam provides a complete guideline package for today’s businesses as the model and can be adopted by any kind of business model

Ali 2010 To interpret whether the Islamic HR angles are enough to manage/evolve human resources in the present world

Branine et al. 2010 Exploring the nature and contents of Islamic practices in management and their direct implications on the human resource management in Arab countries.

The article takes examples from other religions such as Judaism and Christianity and elaborates on their Islamic HR perceptions. Challenges are outlined that need further research and practical steps to eliminate them.

Islam is misunderstood, and its unnecessary negative impact is seen in the business world as well. MNCs need to understand that Islam gives importance to friends, family, and kinship. Islam is not against their religion and is looking to resolve issues that are causing friction among different cultures other than Islam in the workplace.

Authors Year Study purpose

Khan et al. 2010 To understand the modern day human resource practices following Islam.

Noufal 2012 To reveal Islamic aspects of management that would be sustained in modern world business HR areas like reward, benefits, employee engagement, thriving culture for obligation and accountability

Nik Ab. Rahman et al. 2013 To evaluate the role of theoretical frameworks of Islamic human resource management practices and their effect on levels of trust within an organization

Zaman, et al. 2013 To highlight the Islamic features that are ingrained in Islamic HRM and are proved successful in today’s world in a distinct way comparable to modern HRM

Malik et al. 2014 To implement the Quran based HRM practices in Islamic banking along with justice to improve employee job satisfaction with the aid of organizational justice

Sulaiman et al. 2014 To measure the impact of Islamic HRM on the Islamic managers’ organization

Azmi, IAG. 2015 To investigate the effect of Islamic HRM practices in a developing country

Balla et al. 2016 To gauge Islamic HRM’s implementation on the employees’ organizational knowledge, presentation, faith, obligation, and devotion to the group’s supervisor.

Khan 2016 To scrutinize the effect of Islamic values on human resource management in the modern world and the resolving the contemporary issues in the workplace

Mahesar et al. 2016 To analyze the effect of Islamic HRM on employee outcomes and engagement in Pakistani Islamic banks

Saleem et al. 2016 To highlight the fundamental Islamic principles regarding HRM for employing better policies for an effective management system.

Siddique et al. 2016 To compare the role of religion and culture on the HR practices of Saudi Arabia and Iran

Berher et al. 2017 The role of Muslim employees in White HRM and contribution to religious diversity in workplaces

Key findings

The secondary research article mentioned that Islam promotes peaceful co habiting of different cultures with equality and justice. These and other Islamic teachings could be seen in today’s business HRM practices so that the firm culture could be nonviolent and sincere.

The secondary research article revealed that Islam is based on unity, purpose, responsibility, autonomy, an all inclusive decision making process, trust, dialogue, cost and time efficiency, honesty, expertise, and keenness to learn. Leadership should also be held accountable and must only be for the welfare of the followers.

The cross sectional research showed that Islamic HRM strongly influenced trust within the firm, but the appraisal system did not show any significant relationship.

The secondary research article revealed that Islam HRM directions do not teach materialistic approaches that are quite evident in modern HRM as Islamic HRM builds employee e mployer trust relation, which is a positive sign for organizational commitment and performance

The research’s quantitative results indicated that Islamic HRM practices do not directly increase job satisfaction but do through the path of organizational justice. Justice and honesty are ingrained within the Islamic teachings, and thus, Muslim employees have inherited these features in their nature and infused them in their work.

The qualitative study findings revealed that Muslim managers were well aware of Islamic HRM practices and have employed them in their organizations. Also, they have seen positive results in the overall firm workings.

The study’s quantitative analysis revealed that one Islamic HRM practice is significantly related to organizational performance, which is training and development despite Islamic recruitment and selection to a large extent.

The mixed qualitative and quantitative research has revealed that Islam provides values incorporated in HRM practices for better organizational results performance wise.

The article indicates that human r esource management’s Islamic way with its ingrained faith, such as integrity, equal rights, obligatory emphasis, justice, and loyalty, provides positive employee motivation results. Organizational success and harmony are guaranteed if Islamic principles ar e observed within organizational HRM practices.

The study’s quantitative analysis showed that Islamic HRM has a highly significant relationship with employee outcomes and is beneficial for engagement.

The extensive literature review study found that Islam gives high significance to its basic principles. If instilled within the HR practices of today’s businesses, employee commitment levels are sure to increase, which is conducive to better organizational performance based on equal rights and a reward system.

The results indicated that the religious culture directly affects the policymaking within that country’s businesses, either in Iran or Saudi Arabia. Islamic influence was seen more in Saudi Arabia, and thus its effects were seen in business workings, social relations, and employee employer interactions.

The qualitative study revealed that Muslim employees in Netherlands organizations have to face religious friction. The HRM policy in such firms has to be designed, so that religious diversity is appropriately managed across different cultures.

Authors Year Study purpose

Islam & Barghouthi 2017 To observe the practical implications of Islam in contemporary HRM.

Khan 2017 To examine the role of Islamic HRM practices in terms of employees, employers, and customers ' points of view

Nadvi & bin Junaid 2017 To compare the Islamic HRM practices and their impact on organizational commitment in terms of employees’ perception

Razimi et al. 2017 To assess the practices of Islamic human resources for increasing work motivation among employees and overall organizational performance

Rahman 2018 To interpret the Islamic approaches and context for human resource management in organizations today.

Sabir & Bhutta 2018 To comprehend the Islamic way of recruitment and selection in the modern business world under the light of HRM practices

Uyun & Muafi 2018 To measure the influence of Islamic HRM practices on organizational learning and an overall impact on social, environmental, and religious performance

Abbazi & Zarqan 2019 To understand the relationship between Islamic teachings and HRM to face today’s human resources’ current challenges.

Chowdhury et al. 2019 To evaluate the role of Islamic HRM practices as an important strategic tool for the organizational effectiveness

Hadjri et al. 2019 To assess the effect of Islamic human resource management on organizational commitment and employee performance

Wiryanto 2019 To assess if there is a need for increased knowledge of Islamic management principles for today’s businesses’ problem solving strategies

Hossin & Sentosa 2020 Reviewing and discussing the role of Islamic human resource management practices and their requirement in the banking firm

Javed et al. 2020 Evaluating the role of Islamic ethics relevant to the leadership styles and their impact on managerial effectiveness.

Key findings

The article disclosed with examples from various verses of the Holy Quran that Islam has taught all the important HRM aspects, such as hierarchy, gender, leadership, etc., that are practiced today in the business world.

The secondary research article revealed that the previous literature has corroborated that Islamic work ethics are strongly related to job satisfaction. Compensation and salaries based on justice are more respected among the employees and employers that work better in creating organizational harmony.

A survey approach was adopted to collect results that stated that Islamic HRM had different organizational outcomes and implications in this world than modern HRM. The results were stated in terms of the employee’s perception of their organization where Islamic HRM is being practiced.

Islam teaches certain values to its followers inculcated in Islamic human resource management, such as kindness, treating everyone equally, and giving respect. Consequently, the human resource practices are refreshed in an Islamic way, leading to increased work motivation and overall firm performance

The secondary research article concluded that Islamic organizations are under Western culture’s influence despite following Islamic religious parameters even in Islamic countries.

The secondary research article mentioned no difference between the Islamic teachings of recruitment based on proficiency, justice, honesty, humbleness, patience, and contemporary HRM practices.

The quantitative research article showed statistical results that Islamic principles positively impact organizational learning and social, environmental, and religious engagement.

The findings’ statistical results displayed that all the basic HR aspects if followed Islamically, would yield better results in terms of job satisfaction and organizational trust among the workers. There is a positive relationship between trust and the reward system of the firm.

The results indicated that if proper knowledge of Islamic practices, successful organizational outcomes are indispensable. Undoubtedly, Islamic HRM practices positively influence recruitment, selection, performance evaluation, training, development, etc.

Islamic recruitment and selection criteria strongly influenced organizational commitment and employee performance extracted from Indonesian bank employees’ quantitative study.

The results showed that when the comparison between Western and Islamic concepts is made, there is a dire need for more awareness for the Western world to incorporate Islamic HR values for better problem solving

The secondary research article indicated that nine principles of Islamic HRM pose a positive effect on four systems: recruitment, training, development, performance appraisal, and compensation.

Statistical analyses showed that transformational and transactional leadership styles were positively related to managerial effectiveness; however, Islamic ethics intervention did not show any results.

The conceptual framework or model of the findings is shown in Figure 1. The conceptual model shows that Islamic teachings are rooted in HR practices, mainly in Muslim countries. The fundamental Islamic values are trust, equality, justice, responsibility, accountability of leadership and the followers, unity, obligation, fairness in decision making, learning, co existence of different

cultures and respecting them, and friendship among diverse kinds of people. These values instill a positive sense of belonging to the organization where they are practiced. When Islamic aspects like equality and fairness are ingrained in HR practices like recruitment, payment, compensation, and reward system, the employees develop. It does not matter whether the company is Muslim or non Muslim; however, it does matter when the firm is multinational and has diverse employees, including Muslims. The Muslim employees respect such non Muslim CEOs more and show higher job satisfaction, low turnover, strengthened employee employer relationships, and better organizational performance. It has been researched that Muslim employees' and managers’ perceptions were positive when Quran based HRM practices were followed within their Muslim firms. Similarly, it has further been researched that the Muslim employees working in a non Muslim firm where Islamic HRM practices like equality and trust were followed, such employees’ perceptions were heightened.

Has friction in acceptability in the Western world. Different perceptions in Christianity and Judaism

Has the ability to be adapted in modern world business due to its flexibility

Has the ability to face the current HR challenges in Muslin and non Muslim firms in globalized context

Islamic or Quran based HRM Islamic values such as trust, equality, justice, accountability, honesty, responsibility, unity, obligation, fairness in decision making, keenness to learn, co existence, friendship and kinship

Own perceptions of Muslim managers and employees are positive related to their own firm HR.

Positive impact on HR practices like recruitment, training, pay compensation, and reward system etc.

Positive influence on employee satisfaction, commitment, turnover, employee employer relation, organizational trust and overall performance

Figure 1: conceptual framework/ model of the findings

The systematic review also elaborates that Islamic HRM can be adapted in the modern world, even in multinationals in a globalized world. Multinational companies have a diversified workforce, and Muslims are part of it. The needs of such employees have to be considered if the firm has to prosper. Therefore, Islamic values like justice and unity have to be implanted in the global firms as the Islamic system has flexibility. However, it has been observed that the Western world is not welcoming of these values, and there is some resistance to accepting the Islamic HRM practices in the Western world. Religions like Christianity and Judaism are not supported, and Islamic HRM has to face challenges regarding the West’s different mindsets.

4 Conclusion

Islam has all the salient features within its teachings applicable to this world, even if it is the business world. Since humans run businesses, and religion is for humankind's betterment, if the fundamental teachings of Islam are incorporated in the enterprises’ human resource planning, the people working for either Muslim or non Muslim firms would be content. They would know that they are respected, treated with kindness, given just and fair compensations for their struggles and hard work, and their leadership and the followers are accountable for their deeds. No one person would be held responsible illegally for the acts that they do not commit. All of the employees would work under one roof as a family, which is the soul of the Quran’s teachings. If such remains the state of working space, no possibility could hinder the firms from thriving in a globalized arena with tough competition.

5 Availability o f Data and Material

Data can be made available by contacting the corresponding author.

6 References

Abbasi, A.S. , Rehman, K. & Bibi, A. (2010). Islamic management model. African Journal of Business Management , 4(9), 1873 1882.

Abbazi, U. & Zarqan, I.A. (2019). Islamic pedagogy on human resource management based on Islamic references. Journal of Islamic Business & Economic Review , 2(1), 34 42.

Ali, A.J. (2010). Islamic challenges to HR in modern organizations. Personnel Review , 39(6), 692 711. DOI 10.1108/00483481011075567

Azmi, IAG (2015). Islamic human resource practices and organizational performance: Some findings in a developing country. Journal of Islamic Accounting & Business Research, 6(1), 1 14. DOI: 10.1108/JIABR 02 2012 0010

Balla, Z.I., Alias, R., Isa, A.A.M., Zaroog, O.S. & Osman, Y. (2016). Impact of Islamic value as strength of human resources management practice on the organization commitment: Conceptual framework. International Review of Management & Marketing , 6(S8), 306 309.

Bergher, L.J., Essers, C. & Himi, A. (2017). Muslim employees within ‘white’ organizations: The case of Moroccan workers in the Netherlands. International Journal of Human Resource Management , 28(8), 1119 1139. DOI: 10.1080/09585192.2016.1166785

Branine, M. & Pollard, D. (2010). Human resource management with Islamic management principles: A dialect for a reverse diffusion in management. Personnel Review, 39(6). DOI: 10.1108/00483481011075576

Chowdhury, A.H., Hoque, N. & Mawla, M.M. (2019). Human resource management from Islamic perspective. Bangladesh Journal of Islamic Thought , 7(10), 19 35.

Hadjri, M.I., Perizade, B., Marwa, T. & Hanafi, A. (2019).Islamic human resource management, organizational commitment and employee performance: A case study on sharia bank in South Sumatera. International Review of Management & Marketing, 9(1), 123 128.

Hashim, J. (2008). The Quran based human resource management and its effect on Organizational justice, job satisfaction, and turnover intention. Journal of International Management Studies , 3(2), 148 159.

Hossin, M.S., Ali, I. & Sentosa, I. (2020). Human resource management practices from Islamic perspective: A study on Bangladesh context. International Journal of Academic Research in Business & Social Science , 10(6), 391 405.

Islam, K.M.A. & Barghouthi, O.A. (2017). Human resource management: An Islamic perspective. International Journal of Islamic Business Management, 1(1), 10 13.

Javed, S., Malik, A. & Alharbi, M.M.H. (2020). The relevance of leadership styles and Islamic work ethics in managerial effectiveness. Personnel Reviews, 4(3), 189 207.

Khan, B.M., Farooq, A. & Hussain, Z. (2010). Human resource management: An Islamic perspective. Asia Pacific Journal of Business Administration , 2(1), 17 34. DOI: 10.1108/17574321011037558

Khan, M.T. (2017). ‘Islamic work ethics’ of HR management applied to business organizations. (a literature review). University of Haripur Journal, 2(1), 145 158.

Khan, S. (2016). Islamic perspective of human resource management: Some salient features. The Dialogue , 11(1), 83 106.

Mahesar, H. A., Chaudhry, N. I., Ansari, M. A., & Nisar, Q. A. (2016). Do Isla mic HRM Practices Influence Employee Outcomes: Mediating Role of Employee Engagement. International Research Journal of Art & Humanities, 44(44).

Malik, M., Malang East, I. & Java Indonesia. (2014). Improving competitiveness of Islamic banking human resources through implementation of Quran based HRM practices. European Journal of Business & Social Science , 3(3), 1 13.

Nadvi, M.J. & bin Juanid, Z. (2017). Comparison of modern and Islamic HRM: Impact of IHRM on organizational commitment. Qudus Journal of Islamic Studies , 5(2), 63 84.

Nik Ab. Rahman, N.M., Alias, M.A., Shahid, S., Hamid, M.A. & Alam, S.S. (2013). Relationship between Islamic human resource management practices and trust: An empirical study. Journal of Industrial Engineering and Management, 6(4), 1105 1123. http://dx.doi.org/10.3926/jiem.794

Noufal, P.K. (2012). Sustainable model of organizational management in the perspectives of Islam: A study based on Jamaat e Islami Hind. Purushartha: Journal of Management Ethics & Spirituality, 5(1), 110 124.

Rahman, F.N. (2018). Islamic approaches to human resource management in organizations. International Journal of Development Research , 8(10), 23542 23546.

Razimi, M.S.H., Romle, A.R. & Pakinathan, M.I. (2017). Islamic human resource practices in enhancing work motivation and organizational performance. Asian Journal of Business Management , 8(1), 4 8.

Sabir, S. & Bhutta, Z.M. (2018). A study on the Islamic perspective of recruitment and selection process. Research Journal Al Basirah , 7(2), 1 12.

Saleem, Z., Malik, M.T. & Khattak, S.R. (2016). Principles of effective management according to Quran and Sunnah. Al Idah, 33(2), 102 110.

Siddique, M., Khan, A. & Zia, K. (2016). The influence of religion and culture on HR practices: A comparative study of Saudi Arabia and Iran. Business and Economic Review , 8(2), 35 54.

Sulaiman, M., Sabian, N.A.A. & Othman, A.K. (2014). The understanding of Islamic management practices among Muslim managers in Malaysia. Asian Social Science, 10(1), 189 199.

Uyun, Q. & Muafi. (2018). The influence of Islamic HRM practices on organizational learning and its impact on environmental, social, and religious performance. Journal of Entrepreneur Education, 21(1S).

Wiryanto, W. (2019). The difference of human resource management textbook between Western and Islamic perspectives. Advances in Economics, Business & Management Research , 101, 174 178.

Zaman, G., Afridi, F.K. & Saleem, M. (2013). Islam and management principles: Evidence from literature. Journal of Managerial Science, 7(2), 207 212.

Dr. Asfahani is an Assistant Professor within the CBA at the University of Business and Technology (UBT). Dr. Asfahani has extensive academic and professional practices in the areas of organizational dynamics, institutional conflict resolution systems, human resource principles, internal relations, environmental resource and ecosystem management, negotiation, and training, ga ined in highly competitive environments. Successfully designed conflict solutions systems and provided analysis and recommendations to entities that have been utilized in both Saudi Arabia, and the United States of America. In addition, Dr. Asfahani is a freelance Strategic HR & Business Consultant, who obtained many experiences in different projects and developed his versions of HR and business Models.

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

http://TuEngr.com

LC/MS Profiling of Shilajit Extract for Antimicrobial & Antifungal and Cytotoxic Activities

Fawzia AlShubaily1* and Ebtihaj Jambi1,2

1 Department of Biochemistry, Faculty of Science, King Abdulaziz University, P.O. Box 9515, Jeddah, 21589, SAUDI ARABIA.

2 Biomedical Physics Center, King Fahd Medical Research Center, Box 80216, King Abdulaziz University, Jeddah, 21589, SAUDI ARABIA.

*Corresponding Author (Tel: +966559198333, Email: falshibli@kau.edu.sa).

Paper ID: 13A5N

Volume 13 Issue 5

Received 14 December 2021

Received in revised form 09 April 2022

Accepted 23 April 2022

Available online 28 April 2022

Keywords:

LC HRESIMS; Shilajit bioactive compounds; Antimicrobial ; Cytotoxicity; LC/MS; Bioactive compounds; Hep G2; Candida albicans; Staphylococcus aureus; DMSO; Microbial strain; Herbal traditional medicine

Abstract

Enormous amounts of bioactive compounds incorporated in the shilajit extracts are accountable for many therapeutic properties. However, little is acknowledged concerning the chemical content and its correlation to the antimicrobial and cytotoxic properties of shilajit extract. Therefore, the current experiment aime d at the profiling of shilajit bioactive compounds with the aid of LC HRESIMS technology, and assessing the antimicrobial and cytotoxic properties of in vitro and in vivo models. This method allowed the identification of a variety of bioactive compounds, which include fulvic acid, gallic acid, ferulic acid, naphsilajitone, fraxin, 3,8 dihydroxydibenzo α pyrone, and pregnane. The results confirmed significant antifungal activity against Staphylococcus aureus at a concentration of 100 µg disc 1, and Candida albicans at concentrations down to 25 µg disc 1 and gave inhibition zones of 13±0.3 and 12±0.3 mm diameter, respectively. There was low inhibition detected at a concentration beneath 25µg disc 1 , and null activity of shilajit crude extract in opposition to all the different microbes at the distinct concentrations used in the current study. Cytotoxic percentage inhibition of applied cell lines was elevated via increasing extract concentration and significant percent inhibition (IC50: 19 µg mL 1) of the investigated test extract was revealed by the applied cell line Hep G2. These statistics supply a molecular foundation to explain at least a section of the advisable therapeutic properties of shilajit extract.

Disciplinary: Biochemistry and Biochemical Engineering.

©2022 INT TRANS J ENG MANAG SCI TECH. Cite This Article:

AlShubaily, F. and Jambi, E. (2022). LC/MS Profiling of Shilajit Extract for Antimicrobial & Antifungal and Cytotoxic Activities. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5N, 1 13 http://TUENGR.COM/V13/13A5N.pdf DOI: 10.14456/ITJEMAST.2022.98

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies

Nomenclature and Symbols

LC HRESIMS: liquid chromatography high resolution electrospray ionization mass spectrometry,

CFU: colony forming units, DMSO: dimethyl sulfoxide, MIC: minimal inhibitory concentration, MFC: minimal fungicidal concentration, LTQ: linear trap quadrupole, HPLC: high performance liquid chromatography, PTFE: polytetrafluoroethylene, LC/MS: liquid chromatography mass spectrum, PDA: photodiode array, MeOH: methanol, DMEM: Dulbecco's Modified Eagle Medium, FBS: fetal bovine serum, MCF 7: Homo sapiens adenocarcinoma epithelial breast mammary gland cell line, T 47D: Homo sapiens ductal carcinoma epithelial mammary gland cell line, Hep G2: Homo sapiens hepatocellular carcinoma liver cell line, SKOV 3: ovarian carcinoma, ATCC: American type culture collection, MTT: tetrazolium dye (3 (4,5 dimethylthiazol 2 yl) 2,5 diphenyltetrazolium bromide), SDS: sodium dodecyl sulfate, ANOVA: analysis of variance, SEM: standard error of the mean, [M+H]+: the ions observed by mass spectrometry may be quasi molecular ions created by the addition of a hydrogen cation.

1. Introduction

Shilajit, Asphaltum punjabianum is a natural black greasy substance formed by the degradation of plant materials from species such as Euphorbia royleana and Trifolium repens in the high altitude mountains [1, 2]. This vegetation has undergone compression and high temperature for many years underneath several mountains’ rocky layers to be transformed into its greasy perfusion from the rock of the mountains [1]. Shilajit is used as a traditional medicine for the remediation to cure many diseases.

Traditional medicine had been an essential part of health care in many middle eastern areas such as Yemen and Saudi Arabia, and in many Asian countries such as China and India for thousands of years [1]. Therefore, significant conformational testimony was intended to document the mode of action for herbo medicinal extracts [1]. Shilajit has potential uses such as anti

inflammatory, anti fungal, anti ulcerogenic, anxiolytic activity, anti allergic, analgesic, anti diabetic, memory enhancer, and antioxidant [3 6] .

Various studies have evaluated the properties of shilajit extracts obtained from different countries [7, 8]. The ecological nature of the mountain’s rocks, variation in local humidity and temperature, and speciation of plants impact the chemical composition of shilajit [9] for which the organic compounds, fulvic acid, 3,4 benzocoumarins, hippuric acid, resin, benzoic acid, fatty acids, ellagic acid, amino acids, and certain alkaloids are the main bioactive constituents. Abundant organic compounds of the shilajit extract exist in varied ratios corresponding to different countries, which affect the physical properties and chemical composition [10]. Studies had found that in India, Pakistan, and Russia, the ratios of shilajit’s fulvic acid were 21.4%, 15.5%, and 19%, respectively [1] Therefore, the local source of the shilajit extract is significant and directly correlated to its therapeutic impact [1, 2].

There are increasing awareness and interest in using traditional herbo medicine like shilajit because of its efficient therapeutic impact on the treatment of common diseases such as anemia, chronic pain, diabetes, osteoporosis, and digestive disorders. The effects of several environmental and economic factors such as the plant source, temperature, transport, and storage have influenced the chemical composition and efficacy of the commercial shilajit. Therefore, the present study was performed to investigate the chemical composition of commercial shilajit extract using liquid chromatography high resolution electrospray ionization mass spectrometry (LC HRESIMS) analysis and determine its antimicrobial and cytotoxic potential using in vitro and in vivo models. There were limited studies and published information regarding the investigation of commercial shilajit specifically in providing the concentrations of shilajit that need to be utilized. Therefore, different concentrations of local commercial shilajit were tested to identify the highest non toxic concentration that could be used in the in vivo studies on human carcinogen cell lines. These statistics supply a molecular foundation to explain at least a section of the advisable therapeutic properties of shilajit extract.

2. Methods

2.1 Microbial Strains and Growth Media

Bacterial species, Staphylococcus aureus (NCIMB 6571), Pseudomonas aeruginosa (NCIMB 6750), Escherichia coli (NCIMB 10214), and fungal species, Aspergillus niger (IMI 51433), and Candida albicans (NCPF 3255) were obtained from purchased from the American Type Culture Collection (ATCC). The specified fungal and bacterial cultures were kept at 4°C on Sabouraud dextrose and Mueller Hinton agar media. The antifungal and antibacterial properties were analyzed by Sabouraud dextrose and Mueller Hinton agar and broth, respectively. All media were obtained from Oxoid Ltd, Basingstoke, Hampshire, UK. The fungi and bacteria cultures were grown for 24 hours and the standard MacFarland turbidity of 10 6 colony forming units (CFU) mL 1 was achieved by mixing with sterile physiological saline. A quantity of 100 µL of each microbial suspension was

added into 25 mL of (40 ⁰C) Sabouraud dextrose and Muller Hinton sterile broth media for fungi and bacteria respectively.

2.2 Disk Diffusion Method

Shilajit was purchased from Amazon India. The antimicrobial property of shilajit extract was assessed by the disc diffusion method [11, 12]. The crude methanolic extract of shilajit was dissolved in a sterile 10% dimethyl sulfoxide (DMSO) to make a 50 mg mL 1 stock solution before being tested for antimicrobial activity. Using a sterile cotton swab, 100 µL of (24 72 hrs) isolate inoculums were spread evenly on the surface of solid media plates. Blank 6mm diameter disks were saturated with dilutions of the stock shilajit crude extract to make concentrations of 200, 100, 50, 25, and 12.5 µg disc 1 and were placed on the surface of the agar plates and then incubated 24 48 hrs at 37 ° C and 28 °C for bacteria and fungi, respectively. The inhibition zone’s diameters were measured in milliliters from the disc margin to the inner edge of the encircled pathogens . A disc impregnated with 10% DMSO was used as a negative control and positive controls were assessed with standards nystatin and amoxicillin drugs (Sigma Che mical Co., St. Louis, MO, USA) which were dissolved in DMSO 10% (10 µg disc 1 ) and served as positive antifungal and antibacterial controls; respectively. Duplicate repeats were conducted for each experiment

2.3 Broth Micro - Dilution Method

Antimicrobial analysis and assessment of the minimal inhibitory concentration (MIC) of the extract against different bacterial and fungal strains were achieved using the broth micro dilution method. As only S. aureus and C. Albicans have shown inhibitory effects down to 100 mg mL 1 and 12.5 mg mL 1, respectively, MIC was calculated for these species only. To determine the MIC of the shilajit crude extract, 5 dilutions for each concentration of 100 mg mL 1 and 12.5 mg mL 1 were prepared in 5% DMSO. A quantity of 100 µL of the microbial suspensions was inoculated into the prepared dilution tubes and incubated at 28 and 37°C for 48 hrs for the fungi and bacteria strains respectively. The tubes comprising only the substrate with either diluted extract or microbial suspension were designated as negative and positive controls, respectively. The least concentration of each extract representing a clear inhibition was reported as the MIC concentration. To verify the presence or absence of growth turbidity, samples were also measured spectrophotometrically after 48 hrs at 540 nm. The determination of minimal fungicidal concentration (MFC) values for the fungi were evaluated as the highest dilutions (lowest concentrations) at which no growth occurred on the plates. All serial dilutions of the shilajit were performed in duplicates.

2.4 LC - HRESIMS Analysis

The liquid chromatography high resolution electrospray ionization mass spectrometry (LC HRESIMS) was assessed to determine the bioactive compounds in the examined ex tract. A quantity of 100 mg of shilajit crude extract was dissolved in 100 mL of 10% methanol. This mixture was filtered through a 0.2 µm PTFE filter, and a quantity of 1ml was placed into LC/MS vials. High resolution mass spectrometric data were obtained using a Thermo LTQ Orbitrap coupled to an

HPLC system (PDA detector, PDA autosampler, and pump). The following conditions were used: capillary voltage of 45 V, capillary temperature of 260 °C, auxiliary gas flow rate of 10−20 arbitrary units, sheath gas fl ow rate of 40−50 arbitrary units, spray voltage of 4.5 kV, and mass range of 100−2000 amu (maximal resolution of 30000). For LC/MS, a Sunfire C18 analytical HPLC column (5 µm, 4.6 mm × 150 mm) was used with a mobile phase of 0 to 100% MeOH over 30 min at a flow rate of 1 mL/ min −1 . Analysis of data was performed using Xcalibur 3.0 and dereplication using a dictionary of natural products database V. 23.1 on DVD.

2.5 In vitro Cytotoxicity Assay

Cell lines of MCF 7, T 47D, and Hep G2 were purchased from the American Type Culture Collection (ATCC, USA). The cells were nurtured in DMEM culture media containing antibiotics (100 U mL 1 of penicillin and 100 µg mL 1 of streptomycin) and 10% FBS (Gibco) at 37°C in a CO2 incubator (5% CO2 and 95% relative humidity). The inhibitors were tested for their cytotoxicity properties against MCF 7, T 47D, and Hep G2 cells [13]. The analysis comprised distributing the cell aliquots for MCF 7, T 47D cells (3.6×105 cells mL 1 , 3.5×105 cells mL 1, and 3.8×105 cells mL 1 , 95µL) in 96 well plates. The 96 well plates were aliquoted with the prepared inhibitor stock solutions in DMSO (150µL, 5µL) and incubated for 24 hrs. (37ºC, 5% CO2 ). The control samples were the wells that contain the cells and only DMSO (5µL). The tested plate was incubated with the MTT solution (final concentration 0.5mg mL 1 , 10 µL) at 37 ºC in 5% CO2 for 180 min. A solution of SDS (10% in 0.01M HCl, 100 µL) was added to each well of the 96 well plates and further incubated overnight (37ºC, 5%CO2 ). The percent toxici ty was assessed by measuring the optical density at 570 nm using a Biotek Lx800 microplate reader.

3. Statistical Analysis

The statistical analysis had been performed using a one way ANOVA and t test. The results were calculated as means ± S.D. to indicate the experimental variations. The difference is considered significant when * P value ≤ 0.05.

4. Results

The antimicrobial activity of shilajit extract against the microorganisms considered in the present study was assessed by evaluating the presence of inhibition zones, as shown in Table 1. The crude extract showed significant antibacterial activity against Staphylococcus aureus NCIMB 6571 at a concentration of 200 µg disc 1 and gave inhibition zones of 13±0.3 mm diameter, and antifungal activity against Candida albicans NCPF 3255 at concentrations of 200, 100, 50, and 25 µg disc 1 and gave inhibition zones of 29±0.3, 18±0.3, 15±0.3 and 12±0.3 mm diameter, respectively. There was negative antimicrobial inhibition detection at a concentration below 25 µg disc 1, and null activity of shilajit extract against all the other microbes at the specified concentrations used in the current study. The results obtained from amoxicillin and nystatin exhibited resistance to all selected microbial strains representing inhibition zones ranging from 10 to 22 µg disc 1. As the extract was diluted, its antifungal activity level decreased markedly. It is feasible; therefore that elevation of

the antifungal property may be detected if the separated pure bioactive constituents of the extract were assessed [14]. The antifungal property of the herbo medicinal extracts is mostly associated with their chemical compound structure and functional groups. Synergistic interactions between the molecular compositions of the herbo medicinal extract could plausibly affect the antimicrobial activity [15].

The assessment of the minimal inhibitory concentration (MIC) task relies on the incidence that the lower the MIC value, the more efficient the herbo medicinal extract as a potential disease remedy. Many studies speculated the prospected that diminished toxicity and side effects would be the results output of the low doses of herbo medicinal extract needed to acquire a therapeutic response [16]. Table 2 summarizes the results of the antimicrobial activity of shilajit as MIC and MFC using the broth micro dilution method. Results showed inhibitory antibacterial effects ˃ 50 mg mL 1 and a fungicidal effect was the plant extract (MIC: 12.5 mg mL 1 and MFC:50 mg mL 1) was found on C. Albicans and null activity against all the other microbes. The inhibitory action of the extract on C. ssssssss growth could be attributed to the presence of active compounds such as fulvic, gallic, and ferulic acids.

Table 1 Antimicrobial activities of shilajit crude extract, nystatin, and amoxicillin standards against microbial isolates mean ± SD of measured inhibition zone (mm) in experimental groups (n = 2 in each group).

Microbial Isolate

Mean Diameter of Inhibition Zone of inhibition (mm) ± SEM* Nystatin Amoxicillin 200 µg disc 1 100 µg disc 1 50 µg disc 1 25 µg disc 1 12.5 µg disc 1 10 µg disc 1 10 µg disc 1

Staphylococcus aureus NCIMB 6571 13± 0.3 22 ± 0.2

Pseudomonas aeruginosa NCIMB 6750 10 ± 0.3 Escherichia coli NCIMB 10214 12 ± 0.3

Aspergillus niger IMI 51433 15 ± 0.3 Candida albicans NCPF 3255 29 ± 0.3 18 ± 0.3 15 ± 0.3 12 ± 0.3 22 ± 0.2

*SEM, standard error of the mean. Mean ± SEM in each column with no common superscript differ significantly (* P ≤ 0.05). ( ): not detected activity at this amount of shilajit or standards.

Table 2 Minimal inhibitory concentration (MIC) of the shilajit extract, nystatin, and amoxicillin against microbial isolates.

Microbial Isolate

Shilajit (mg mL 1 ) MIC MFC

Staphylococcus aureus NCIMB 6571 50.0

Pseudomonas aeruginosa NCIMB 6750 Escherichia coli NCIMB 10214

Aspergillus niger IMI 51433 Candida albicans NCPF 3255 12.5 25

Mean ± standard error of the mean with no common superscript differ significantly (* P ≤ 0.05) ( ): not detected activity at this amount of shilajit or standards.

The liquid chromatography high resolution electrospray ionization mass spectrometry (LC HRESIMS) analysis of shilajit crude extract revealed the presence of 17 bioactive compounds explicated with their calculated mass spectrum m/z, retention time, and frequencies as shown in

Table 3. This technology allocated the recognition of distinct classes comprising phenolic acids, organic acids, alkaloids, tri terpenoids, and flavonoids. Figure 1 showed the chromatogram of the shilajit with major peaks at the retention times (min.) of 0.99, 1.36, 4.97, 5.21, 11.6, 16.59, and 31.25 of fulvic acid, gallic acid, ferulic acid, naphsilajitone, fraxin, 3,8 dihydroxydibenzo α pyrone, and pregnane, respectively (Table 3). The utilization of the shilajit extract in traditional medicine was consistent with the results of the antifungal properties of several crude extracts. A wide range spectrum of antibiotics can be obtained from the roots and shoot parts of plants. Bauer and Tittel [17] and Springfield, Eagles [18] indicated in their studies that chemical characterization is best achieved throughout HPLC spectrum analysis technology. Therefore, the plant extract’s bioactive constituents that can act as antibacterial, antifungal, anti inflammatory, and antioxidant in the current experiment were identified using LC/MS fingerprint. Phenolic acids exhibited various pharmacological properties such as ferulic acid with an antibacterial [19], antifungal [20] and anti inflammatory properties [21]; gallic acid has anti inflammatory [22], caffeic acid showed antibacterial, antifungal [19] and anti inflammatory [21].

Figure 1: The liquid chromatography high resolution electrospray ionization mass spectrometry (LC HRESIMS) chromatogram of bioactive compounds in shilajit.

The MTT [3 (4,5 dimethylthiazol 2 yl) 2,5 diphenyltetrazolium bromide] assay was conducted to evaluate cell proliferation of shilajit crude extract on cell lines of Hep G2, MCF 7 and T 47D, A549. As shown in Figure 2, significant (*P<0.05 ) percent inhibition (IC50: 19 µg mL 1) of the investigated test extract is revealed by the applied cell line Hep G2. The shilajit extract showed an increased though non significant ( P>0.05) proliferation inhibition percentages for MCF 7 and T 47D cell lines for all the administered concentrations in the present study.

Table 3 The liquid chromatography high resolution electrospray ionization mass spectrometry (LC HRESIMS) analysis of shilajit extract.

Ret. (min.) Accurate Mass Molecular Formula * Tentative Identification **

0.99 639.1190 C27H26O18

Fulvic acid

1.36 171.0290 C7H6O5 Gallic acid

1.82 181.0497 C9H8O4 Caffeic acid

4.97 195.0650 C10H10O4 Ferulic acid

5.21 201.0544 C12H8O3

7.16 249.1696 C12H24O5

Naphsilajitone

Shilajityl acetate

7.85 193.1224 C12H16O2 Shilacatechol

11.60 371.0996 C16H18O10 Fraxin coumarin

16.58 229.0497 C13H8O4 3,8 dihydroxydibenzo α pyrone

16.61 213.0545 C13H8O3 3 hydroxydibenzo α pyrone

18.04 311.0552 C17H10O6 Shilaxanthone

19.34 311.1268 C19H18O4 6 methoxy 2 [2 (3 methoxyphenyl)ethyl]chromone

21.08 309.0759 C18H12O5 Shilanthralin

21.99 179.1430 C12H18O Shilajitol

23.28 231.0769 C17H10O No natural hits 31.09 237.1858 C15H24O2 Geranyl tiglate

31.25 289.2892 C21H36 Pregnane

* Based on the quasimolecular ion [M+H]+ ** Based on Dictionary of Natural Products Database ver. 23.1 and Reaxys online database.

50

5. Discussion

40

30

20

IC 50 (µg mL 1 ) Cell Line

Shilajit Tamoxifen

10

* 0

60 T-47D MCF-7 Hep G2

Figure 2: The effects of shilajit extract on the proliferation of MCF 7, T 47D, and Hep G2 cell lines. Cells were incubated with increasi ng concentrations of tested extract in a culture medium, and the proliferative response was then assessed by MTT assay. Data presented are the mean of three independent experiments (*P>0.05 ).

The LC HRESIMS analysis of shilajit extract revealed the presence of 17 bioactive compounds, including fulvic acid, gallic acid, ferulic acid, naphsilajitone, fraxin, 3,8 dihydroxydibenzo α pyrone, and pregnane. Previous researches have demonstrated that the shilajit extracts therapeutic effect against diseases was correlated to their bioactive phytochemical constituents [23 26]. Herbal extracts constitute various bioactive compounds, and it is crucial to perceive their mechanism of action on diverse targets for cure and disease remedy. Researchers have studied the chemical structure and

biological properties of many of these bioactive compounds. Shilajit is considered a distinct phytocomplex because it contains various significant bioactive compounds such as aromatic carboxylic acids, phenolic lipid, latex, sterols, gums, albumins, ellagic acid, 3,4 benzocumarins, triterpenes, amino acids, fulvic acid, some fatty acids, resins and polyphenols [27]. The technology of HPLC ha s attributed to the immense pharmacological activities of phenolic acids such as ferulic acid with anti inflammatory [28] and antifungal [29]; gallic acid having anti inflammatory [22], antibacterial [28]; tannic acid with astringent and antioxidant property [30, 31] and caffeic acid with anti inflammatory properties [28]. Many biological and medicinal properties were attributed to fulvic acid, the main organic c onstituent of shilajit extract [32, 33] . Fulvic acid is efficient in the cure of diseases such as stomach ulcers, gastritis, diabetes mellitus, diarrhea, colitis and dysentery [1, 33] and induction of immunity role in lymphocytes and neutrophils [34, 35].

Efficient In vitro antimicrobial activities against phytopathogenic fungi have been observed with various medicinal plant extracts [36]. The results of the current study showed that the crude extract of shilajit had an antimicrobial effect on the tested Staphylococcus aureus NCIMB 6571 (˃ 50 mg mL 1) and Candida albicans NCPF 3255 (MIC: ˃ 12.5 mg mL 1 and MFC: ˃ 50 mg mL 1 ). A previous study indicated that the MIC of Russian shilajit for Staphylococcus Aureus is 125 µg mL 1 , Bacillus Subtilis is 1000 µg mL 1 and for both Escherichia Coli and Candida Albicans 62.5 µg mL 1 , while no MIC for both Pseudomonas Aeruginosa within diluted concentrations [37]. Spore inhibitory activity of 95% against Alternaria cajani had been observed with the methanolic extract of shilajit at the concentration of 5000 µg mL 1 [38]. The varying concentration and antimicrobial impact of fulvic acidic attributed to the antimicrobial effects of the studied shilajit sample. A significant inhibition zone of 50 mm was observed in a strain of Candida albicans, among other examined microbes [39]. Most of the literature has confirmed the particularly antifungal activity of shilajit extracts. Rachana [38] has verified the inhibitory properties of shilajit against phytopathogenic fungi. Shakirov [40] has documented the antimicrobial activities of various prevalent pyogenic microbial strains such as coliform bacteria , staphylococci, Proteus, enterococci , and streptococci , as well as Muratova and Shakirov [41] who appointed the utilization of shilajit extract for the cure of suppurative wounds. Van Rensburg, Van Straten [42] reported the correlation of the antimicrobial activities with the shilajit extract constituents, fulvic, and benzoic acids. Variation in herbs and plants regional species and cli mate change lead to a difference in the discrepancy of its antimicrobial and antiulcer properties. Therefore, markedly diverse physiological activities of shilajit samples could be attributed to their source regions in the world based on their major organic constituents, as reported by many authors [9, 43]. Broad antimicrobial spectrum had been confirmed with major shilajit component, fulvic acid on various microbial strains of S. mutant P. gingivalis, S. mitis , E. faecalis, A. actinomycetemcomitans, F. nucleatum, and also possesses an anticancer cytotoxic effect in vivo [44] In the current study, shilajit extract’s cytotoxic activity revealed a significant increase in inhibition percentage for the concentrations of 19 µg mL 1 on cell lines of Hep G2 (hepatocellular carcinoma). Similarly, another study confirmed inhibitory anticancer properties of mineral pitch on

four cancerous cell lines with concentrations ranging from 25 250 µg mL 1 [45] . The 50% effective concentration (ED50 ) are 89, 96, 225, and 286 µg mL 1 for A549 (lung cancer), HepG2 (liver cancer), MDA MB 231 (human breast cancer), and SKOV 3 (ovarian carcinoma), respectively [45]. As indicated previously that the chemical constituents of shilajit extract exist in diverse ratios among different sources, which influenced their physical and chemical properties [10, 43]. Previous research studies reported that commercial shilajit purchased from different sources had varying cytotoxic impacts. Therefore, all traditional shilajit samples substantially demanded cytotoxicity assessment. A previous study revealed that the concentration of 1.6 mg mL 1 was the highest non toxic level of shilajit conferring to the WST 1 analysis , w hereas, a lower concentration of 19 µg mL 1 was obtained in the present experiment. This concentration was the 50% effective inhibitory concentration percentage of cell proliferation/viability compared to the control sample.

6. Conclusion

This study provides new scientific information about the commercial extract of shilajit based on its chemical profiling, antimicrobial, and cytotoxic potentials, which were attributed to the various phytochemical constituents present in the crude extract. The further purification process of the shilajit chemical components may have even more potency concerning inhibition of microbes and cytotoxic efficacy and encourage the develop ment of a novel broad spectrum antimicrobial and cytotoxic herbal formulation in the future.

7. Availability of Data and Materials

Data sharing does not apply as all information has been included in this study.

8. Acknowledgment

This project was funded by the Deanship of Scientific Research (DSR), King Abdulaziz University, Jeddah, under grant no. (G 617 247 1439). The authors, therefore, acknowledge with thanks to DSR for technical and financial support.

9. Authors’ Contributions

Fawzia Alshubaily: study design, acquisition of data, analysis and interpretation of data , drafting of the manuscript.

Ebtihaj Jambi: study design, analysis and interpretation of data , writing and critical revision of the manuscript. All authors read and approved the final manuscript.

10. Ethics Approval and Consent to Participate

Not applicable

11. Competing Interests

The authors declare that they have no competing interests.

12. References

[1] Agarwal SP, et al. Shilajit: a review. Phytotherapy research: PTR. 2007;21(5):401 405.

[2] Carrasco Gallardo C, Guzmán L, and Maccioni RB. Shilajit: a natural phytocomplex with potential procognitive activity. Internati onal Journal of Alzheimer’s disease. 2012.

[3] Bhattacharya SK. Shilajit attenuates streptozotocin induced diabetes mellitus and decrease in pancreatic islet superoxide dismutase activity in rats. PTR Phytotherapy Research. 1995;9(1):41 44.

[4] Ghosal S. Chemistry of shilajit, an immunomodulatory Ayurvedic rasayan. Pure and Applied Chemistry. 1990;62(7):1285 1288.

[5] Acharya, SB, et al. Pharmacological actions of Shilajit. Indian journal of experimental biology, 1988. 26(10):775 7.

[6] Jaiswal, AK, and Bhattacharya, S. E ffects of Shilajit on memory, anxiety and brain monoamines in rats. Indian J Pharmacol. 1992;24(1):12 7.

[7] Ghosal, S. Shilajit in Perspective, Alpha Science International Limited. 2006, Oxford, United Kingdom.

[8] Wilson, E, et al. Review on shilajit used in traditional Indian medicine. Journal of ethnopharmacology. 2011;136(1):1 9.

[9] Ghosal S, Lal J, and Singh SK. The core structure of Shilajit humus. Soil Biology and Biochemistry, 1991;23(7):673 80.

[10] Schepetkin IA, et al. Complement fixing activity of fulvic acid from Shilajit and other natural sources. Phytotherapy research: PTR. 2009;23(3):373 84.

[11] Ferraro MJ. Performance standards for antimicrobial disk susceptibility tests. 2000: NCCLS.

[12] Tepe B, et al. Screening of the antioxidative and antimicrobial properties of the essential oils of Pimpinella anisetum and Pimpinella flabellifolia from Turkey. Food Chemistry. 2006;97(4):719 24.

[13] Denizot F, and Lang R. Rapid colorimetric assay for cell growth and survival: modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. Journal of immunological methods. 1986;89(2):271 7.

[14] Dellavalle PD, et al. Antifungal activity of medicinal plant extracts against phytopathogenic fungus Alternaria spp. Chilean J. Agric. Res. Chilean J ournal of Agricultural Research. 2011;71(2):231 9.

[15] Naeini A, et al. Anti Candida albicans activity of some Iranian plants used in traditional medicine. Journal de Mycologie Médicale Journal de Mycologie Médicale. 2009;19(3):168 72.

[16] Srivastava G, et al. Antimicrobial activity of the methanolic extract, fractions and isolated compounds from citrullus colocynthis (l.) schrad. Intl. J. Pharma Bio Sci. International Journal of Pharma and Bio Sciences. 2013;4(3):B825 33.

[17] Bauer R , and Tittel G. Quality assessment of herbal preparations as a precondition of pharmacological and clinical studies. Phytomedicine. International journal of phytotherapy and phytopharmacology, 1996;2(3):193 8.

[18] Springfield EP, Eagles PKF, and Scott G. Quality assessment of South African herbal medicines by means of HPLC fingerprinting. Journal of Ethnopharmacology Journal of Ethnopharmacology. 2005;101(1 3):75 83.

[19] Ravn H, et al., Caffeic acid esters as in vitro inhibitors of plant pathogenic bacteria and fungi. Biochemical Systematics and Ecology Biochemical Systematics and Ecology. 1989;17(3):175 84.

[20] Tawata S, et al. Synthesis and Antifungal Activity of Cinnamic Acid Esters. Bioscience, Biotechnology, and Biochemistry Bioscience, Biotechnology, and Biochemistry. 1996;60(5):909 10.

[21] Fernandez MA, Saenz MT, and Garcia MD. Anti inflammatory activity in rats and mice of phenolic acids isolated from Scrophularia frutescens. Journal of pharmacy and pharmacology. 1998;50(10):1183.

[22] Kroes BH, et al. Anti inflammatory a ctivity of gallic acid. Planta medica. 1992.58(6):499 504.

[23] Mutalik S, et al. Effect of Dianex, a herbal formulation on experimentally induced diabetes mellitus. Phytotherapy Research: An International Journal Devoted to Pharmacological and Toxicological Evaluation of Natural Product Derivatives. 2005;19(5):409 15.

[24] Pillai GKG, et al. Antidiabetic potential of polyherbal formulation DB14201: Preclinical development, safety and efficacy studies. Journal of ethnopharmacology. 2017;197:218 30.

[25] Yadav D, et al. In vitro toxicity and antidiabetic activity of a newly developed polyherbal formulation (MAC ST/001) in streptozotocin induced diabetic Wistar rats. Protoplasma. 2013;250(3):741 49.

[26] Yuan H, et al. How can synergism of traditional medicines benefit from network pharmacology? Molecules. 2017;22(7):1135.

[27] Chopra R, et al. Indigenous drugs of India, UN Dhur and sons Pvt. Ltd., Calcutta, 1958;289:665.

[28] Binutu OA, Cordell GA. Gallic acid derivatives from Mezoneuron benthamianum leaves. Pharmaceutical Biology. 2000;38(4):284 6.

[29] Mehrotra R. Defense mechanism in plants. Plant pathology. Tata McGrew Hil, New Delhi, 1997:544p.

[30] Khan NS, Ahmad A, and Hadi S. Anti oxidant, pro oxidant properties of tannic acid and its binding to DNA. Chemico Biological Interactions. 2000. 125(3):177 89.

[31] Windholz, M., et al., The Merck Index. Rahway, NJ: Merck & Co. Inc, 1983. 82:1417 9.

[32] Ghosal, S., et al., Anti ulcerogenic activity of fulvic acids and 4′ methoxy 6 carbomethoxybiphenyl isolated from shilajit. Phytotherapy Research, 1988. 2(4):187 91.

[33] Schepetkin, I., A. Khlebnikov, and B.S. Kwon, Medical drugs from humus matter: Focus on mumie. DDR Drug Development Research. 2002. 57(3):140 59.

[34] Joone, G.K., J. Dekker, and C.E.J. van Rensburg, Investigation of the Immunostimulatory Properties of Oxihumate. ZEITSCHRIFT FUR NATURFORSCHUNG C. 2003. 58:263 7.

[35] Schepetkin, I.A., et al., Characterization and Biological Activities of Humic Substances from Mumie. J. Agric. Food Chem. Journal of Agricultural and Food Chemistry. 2003. 51(18):5245 54.

[36] Basha, S.A., et al., Effect of Berberine and (+/ ) Bicuculline Isolated from Corydalis chaerophylla on Spore Germination of Some Fungi. FOLIA MICROBIOLOGICA PRAGUE . 2002. 47:161 6.

[37] Kotb El Sayed, M.k., H. Amin, and A. Al kaf, Anti Microbial, anti oxidant and anti ulcerogenic effects of Shilajit on gastric ulcer in rats. Am. J of Biochem Biotech. 2011. 8(1):26 39.

[38] Rachana, S., Antifungal activity screening and HPLC analysis of crude extract from Tectona grandis, Shilajit, Valeriana wallachi. Electronic Journal of Environmental, Agricultural and Food Chemistry.

2009;8(4):218 29.

[39] Hayat, A., Antimicrobial Activity of Shilajit. RADS Journal of Biological Research & Applied Sciences. 2013;4(2):10 2.

[40] Shakirov, D., Experimental treatment of infected wounds with mumie asil'. Eksperimental'naia khirurgiia i anesteziologiia, 1969;14(6):36 9.

[41] Muratova, K. and D. Shakirov, Clinical treatment of suppurative wounds with Mumie. Khirurgiia, 1968;44(9):122 4.

[42] Van Rensbur g C, Van Straten A, and Dekker J. An in vitro investigation of the antimicrobial activity of oxifulvic acid. Journal of Antimicrobial Chemotherapy. 2000; 46(5):853 4.

[43] Galimov E, et al., Geochemistry of mummiyo. Geochemistry. 1986;1494 505.

[44] Leighann S, et al. Investigating the biological properties of carbohydrate derived fulvic acid (CHD FA) as a potential novel therapy for the management of oral biofilm infections. BMC Oral Health. 2013;13(1):47.

[45] Phaechamud T, et al. Some Biological Activities and Safety of Mineral Pitch. Science, Engineering and Health Studies. Silpakorn University Science and Technology Journal. 2008;2(2):7 17.

Dr.Fawzia A. Alshubaily is an Associate Professor of Protein Structural Bioinformatics, Biochemistry Department, Faculty of Science, King Abdulaziz University, Jeddah, Saudi Arabia.

Dr.Ebtihaj J. Jambi is an Associate Professor of Pharmacy and Biotechnology (Fermentation Technology), Biochemistry Department, Faculty of Science, King Abdulaziz University, Jeddah, Saudi Arabia She is interested in the Bioprocessing Engineering

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

Microorganisms Cultures Screening with High Proteolytic Properties and Capable Fix Atmospheric Nitrogen to Speed up the Poultry Manure Biodegradation

1Department of Parasitology, Veterinary Sanitary Expertise and Animal Hygiene, Kuban State Agrarian University named after I. T. Trubilin, RUSSIA.

2Department of Biotechnology, Biochemistry and Biophysics, Kuban State Agrarian University named after I. T. Trubilin, RUSSIA.

*Corresponding Author (Tel: +7 918 8834561, Email: yuraduban45@mail.ru)

Abstract

Keywords:

Microorganism screening; Azotobacter; Pseudomonas; chicken manure; biodegradation; proteolytic activity; nitrogen fixing capacity; ammonium nitrogen

In this work, we studied screening strains of microorganisms that exhibit high proteolytic properties and can fix atmospheric nitrogen to speed up the process of biodegradation of bird droppings. There had been established that the Pseudomonasputida 90 biovar A (171) strain exhibits the highest enzymatic ability. Its addition to chicken manure contributed to an increase in the microflora titer from 104 CFU/ml to 1011 CFU/ml after 15 20days. The study of strains capable of utilizing atmospheric nitrogen showed the best property of the culture Azotobacterchroococcum 31/8R. Treatment of bird droppings with the studied strain reduced the level of ammonia in the environment from 93mg/m3 to 14mg/m3 . In the structure of the total DNA of this strain, it identified genes encoding all the enzymes responsible for the process of nitrogen fixation. The combined use of selected cultures of microorganisms can be the basis for the development of a biological product that speeds up the process of natural decomposition of bird droppings.

Disciplinary: Veterinary, Sustainability.

©2022 INT TRANS J ENG MANAG SCI TECH. Cite This Article:

Luneva, A., Koshchaev, A., Lysenko, Y., Gneush, A., Shantyz, A. and Machneva N. (2022). Microorganisms Cultures Screening with High Proteolytic Properties and Capable Fix Atmospheric Nitrogen to Speed up the Poultry Manure Biodegradation International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5O, 1 11. http://TUENGR.COM/V13/13A5O.pdf DOI: 10.14456/ITJEMAST.2022.99

Albina Luneva1*, Andrey Koshchaev2, Yury Lysenko2, Anna Gneush2, Azamat Shantyz2 , Nadezhda Machneva2

Introduction

Industrial poultry farming is the most important branch of agriculture, both in the Russian Federation and in the world. In recent years, this industry has been actively developing and innovative technologies are being introduced into its structure that increases the profitability of production (Neverova et al., 2021; Rozhkova and Stepanova, 2021). This is all because of the high level of consumption of poultry products, which shows the prospects of this industry in the coming years (Micciche et al., 2019; Mir et al., 2017; Shepon et al., 2016).

Today, in the poultry industry, there are problems associated with the processing and use of poultry manure because of the long period of natural biodegradation. The problem of the disposal of bird droppings is relevant since it used a significant amount of arable land for its storage. These storages are a source of a fetid odor that spreads over extensive areas. In 2002, the Ministry of Natural Resources of the Russian Federation approved the "Federal Classification Catalog of Waste", which included chicken manure with its assignment to the third and fourth hazard classes. It introduced penalties for the disposal of third class waste (in particular, bird droppings), which led to significant financial costs (Bamire and Amujoyegbe, 2021; Logan et al., 2021; Muhammad et al., 2020; Subedi and Dhakal, 2018; Tian et al., 2021)

A promising direction for the use of bird droppings is its processing for further use as an organic fertilizer (Ulimbashev et al., 2019; Luneva et al., 2022)

Thus, the purpose of the research is the selection of strains of microorganisms for effective biodegradation of chicken manure.

2 Materials And Methods

The research was at the Scientific and Testing Center for Toxic and Pharmacological Research and Development of Veterinary Medicines, Feed Additives and Disinfectants (Research Center for Veterinary Farmbiocenter). Part of the work was in the laboratories of the Kuban State Agrarian University named after I.T. Trubilin.

For microorganisms screening, there had studied strains with the ability to fix atmospheric nitrogen (representatives of the genus Azotobacter) and strains synthesizing proteolytic enzymes (producing complex proteases three strains, alkaline proteases two strains, neutral proteases three strains). There had also studied two strains of aromatic compounds destructor (Anokhina et al., 2019). (Table 1).

There had selected cultures based on previous experience, their thermotolerance and purpose. Each of the involved groups of microorganisms solves a specific problem: the destruction of complex substances to easily accessible substrates; decomposition of organic matter with the release of ammonium nitrogen for its subsequent conversion into a form available to plants; suppression of the development of pathogenic microflora, conservation of nutrients in the resulting compost, etc.

Table 1: Natural and collection strains of microorganisms used in research work

Scope of the strain/synthesized product

Atmospheric Nitrogen Fixer

Strain Source Collection KubanSAU All Russian Collection of Industrial Microorganisms (RCIM) Natural

Azotobacterchroococcum 31/8 R Azotobacter sp._21 Azotobacterchroococcum B 8739 Azotobacter sp._25

Azotobacterchroococcum B 35

Aromatic Destructor Pseudomonasputida ATCC 12633

Protease neutral

Azotobacter vinelandii B 932

Pseudomonasputida 90 biovar А (171)

Bacillusmegaterium BM 11 Bacillussubtilis 203 Bacillussubtilis 103

Protease alkaline Bacillus subtilis 310 Bacillussubtilis «Research Institute of Genetics 90»

Bacilluslicheniformis L 34

Proteolytic Enzymes

Azotobacter sp._26

Azotobacter sp._28

Azotobacter sp._G1 Azotobacter sp._G2

Bacillusmesentericus B 2466 Bacillussubtilis «Research Institute of Genetics 45»

When selecting a strain with the best litter biodegradation properties, the study of proteolytic activity was according to GOST 20264.2 88. In the experiments, the total microbial number was determined and analyzed by seeding on meat peptone agar (CFU/ml) and the content of ammonium nitrogen.

For choosing the best microbial nitrogen fixer from the genus Azotobacter, there had studied the content of ammonia nitrogen in the atmospheric air over experimental batches of litter, using a universal gas analyzer UG 2.

In studies of bird droppings, the number of viable fly larvae was determined according to Guidelines 3.5.2.1759 03 and helminthological contamination of bird droppings according to Guidelines 4.2.796 99. The results of sanitary and biological studies of the litter were according to GOST 31461 2012. The calculation of the hazard class of by products of poultry farming was according to Sanitary rules 2.1.7.1386 03 and «Criteria for attributing waste to I V hazard classes according to the negative impact on the environment».

Confirmation of the species belonging to the selected microbial cultures was carried out by conventional molecular genetic methods (method of 16S rRNA sequence sequencing).

3 Result a nd Discussion

Selection of cultures with enzymatic activity

The first stage of research was assessing the proteolytic activity of the selected strains of microorganisms. The research results are in Table 2.

The results of the study of enzymatic activity showed that all strains have proteolytic properties since they produced proteases to one degree or another. Of the strains that demonstrated high proteolytic activity, Pseudomonasputida 90 biovar A (171), Pseudomonasputida ATCC 12633, Bacilluslicheniformis L 34 and Bacillusmesentericus B 2466 should be distinguished.

However, the Pseudomonasputida 90 biovar A (171) strain demonstrated the highest proteolytic activity, which amounted to 74.6 U/g.

Table 2: Proteolytic activity of experimental strains

Producer strain

Proteolytic activity, units/g

Pseudomonasputida ATCC 12633 58 2±2 2

Pseudomonasputida 90 biovar А (171) 74 6±3 1

Bacillusmegaterium BM 11 20 2±0 8

Bacillussubtilis 203 39.4±1.7

Bacillussubtilis 103 45 7±1 9

Bacillus subtilis 310 49 3±1 9

Bacillussubtilis «Research Institute of Genetics 90» 40 4±1 6

Bacilluslicheniformis L 34 61 7±2 8

Bacillusmesentericus B 2466 55 2±2 3

Bacillussubtilis «Research Institute of Genetics 45» 43 3±2 1

The study of the molecular genetic properties of the strains was also carried out by the polymerase chain reaction method for the presence of genes encoding proteases of various groups. Express analysis determined the presence of genes similar to the sequences of seven important groups of proteolytic enzymes (serine, aspartate, threonine, glutamine, cysteine, metalloproteases and asparagine) using specific primers.

The conducted studies revealed positive signals for all analyzed cultures of microorganisms, but to varying degrees:

Pseudomonasputida ATCC 12633 serine , aspartate , glutamine , cysteine and metalloprotease like genes;

Pseudomonasputida 90 biovar А (171) serine , aspartate , threonine , glutamine , cysteine , metalloprotease and asparagine like genes;

Bacillusmegaterium BM 11 threonine and cysteine like genes;

Bacillussubtilis 203 serine , aspartate , and glutamine like genes;

Bacillussubtilis 103 serine , aspartate , and glutamine like genes; Bacillussubtilis 310 serine , aspartate , glutamine and cysteine like genes;

Bacillussubtilis «Research Institute of Genetics 90» serine , glutamine and cysteine like genes;

Bacilluslicheniformis L 34 serine , aspartate , threonine , glutamine , cysteine , and asparagine like genes;

Bacillusmesentericus B 2466 serine , aspartate , threonine , glutamine and cysteine like genes;

Bacillussubtilis «Research Institute of Genetics 45» serine , aspartate , glutamine and cysteine like genes.

These results show a greater preference for using Pseudomonasputida 90 biovar A (171) as a decomposer strain. Because there had been discovered seven different genes encoding proteases in the structure of its total DNA.

The obtained results indicate a greater preference for using Pseudomonasputida 90 biovar A (171) as a decomposer strain since the genes encoding proteases of seven different groups were identified in the structure of its total DNA.

The effect of cultures of the studied microorganisms on the biodegradation of chicken manure without litter had been studied for 30 days Every five days, as analyzed indicators, had been recording the total microbial number (TMC) and the content of ammonium nitrogen. There had used an active microbial culture of the studied strains with a cell titer of at least 109 CFU/ml for this research. The dose of introducing strains producers for screening was 10.0% by weight of the by product. It presented the dependence of the bioconversion of chicken manure on the processing time and the culture of the microorganism used in Table 3.

Table 3: Dependence of chicken manure bioconversion on treatment time and microorganism culture

Research time, days 0 5 10 15 20 25 30

Producer strain

Analyzed indicator

TMC, cells/g Ammon nitrogen, mg/l TMC, cells/g Ammon nitrogen, mg/l TMC, cells/g Ammon nitrogen, mg/l TMC, cells/g Ammon nitrogen, mg/l TMC, cells/g Ammon nitrogen, mg/l TMC, cells/g Ammon nitrogen, mg/l TMC, cells/g Ammon nitrogen, mg/l

Pseudomonas putida ATCC 12633 104 340 105 302 106 264 109 174 109 169 109 170 108 172 Pseudomonas putida 90 biovar А (171) 104 340 106 281 108 228 1011 132 1011 130 1011 134 1010 129 Bacillus megaterium

BM 11 104 340 104 334 104 323 105 307 105 303 105 304 105 301 Bacillus subtilis 203 104 340 104 321 104 304 105 304 105 296 105 289 105 294 Bacillussubtilis 103 104 340 104 326 104 305 105 305 105 304 105 298 105 302 Bacillus subtilis 310 104 340 104 317 105 297 106 288 106 283 106 290 106 289

Bacillussubtilis Research Institute of Genetics 90 104 340 104 330 104 320 105 320 105 314 105 310 105 312 Bacillus licheniformis

L 34 104 340 105 311 106 295 106 295 107 273 106 261 105 254 Bacillus mesentericus

B 2466 104 340 104 319 105 298 106 298 107 276 106 271 106 268 Bacillussubtilis Research Institute of Genetics 45 104 340 104 326 105 312 105 312 105 305 105 301 105 297 Litter without processing 104 340 104 341 104 339 104 338 104 341 104 338 104 335

It achieved the highest number of microbial cells in bird droppings using the microbial culture Pseudomonasputida 90 biovar A (171). At the beginning of the study, the microbial count was 104 CFU/ml. By the 15th day, the microbial count was 1011 CFU/ml, and then the mi croflora titer

stopped increasing in all cases. Most likely, this is because of the termination of the action of the enzyme complex of proteolytic microorganisms. Analyzing the content of ammonium nitrogen in chicken manure, the maximum decrease in the stu died indicator was on 15 20th day from the start of treatment. This data correlates with the dynamics of an increase in the total number of microorganisms. The lowest level of ammonium nitrogen had discovered by treatment of its microbial culture Pseudomonasputida 90 biovar A (171). This indicator decreased from 340 mg/l from the beginning of treatment to 132 and 130 mg/l at the end of the experiment.

The analyzed indicators of chicken manure untreated with microbial culture did not change significantly during the experiment.

3.1 Selection of Crops with Nitrogen - fixing Ability

Microorganisms of the genus Azotobacter are often used to increase soil fertility, biological remediation of soils, and enrich it with nitrogen compounds. However, in the presence of ammonia, the process of nitrogen fixation stops and the microbial culture of the genus Azotobacter uses free ammonia, which gives a high deodorizing effect (Aasfar et al., 2021; Din et al., 2019; Hindersah et al., 2018, 2021; Nosrati et al., 2014; Sumbul et al., 2020).

At the next stage of research, it screened bacteria of the genus Azotobacter of collection and natural strains. There was analysis of the content of ammonia nitrogen in the environment over experimental batches of chicken manure treated with experimental cultures (Figure 1).

Figure 1: Introduction of microbial culture of the genus Azotobacter into chicken manure and analysis of ammonia nitrogen using a gas analyzer UG 2

For analyzing ammonia nitrogen in the environment, had used a universal gas analyzer UG 2. Gas analyzer UG 2 measures mass concentrations of harmful substances in the air, including industrial emissions. The device comprises an air intake device and a set of indicator tubes. The principle of operation of the gas analyzer UG 2 is based on the change in color of the indicator powder layer in the indicator tube after passing the test air through it. The length of the colored column of indicator powder in the tube is proportional to it measured by the mass concentration of the harmful substance in the air and on a graduated scale in mg/m3. The research results are in Table 4.

Table 4: Dependence of the content of ammonia nitrogen in the environment at the time of treatment for chicken manure and the microbial culture.

Microbial culture

Research time, days 0 5 10 15 20 25 30 Analyzed indicator Ammonia nitrogen, mg/m3

Azotobacter chroococcum B 35 93 74 65 57 55 52 50

Azotobacter chroococcum B 8739 93 80 71 66 62 59 60

Azotobacter chroococcum 31/8 R 93 63 38 14 12 12 11

Azotobacter vinelandii B 932 93 82 75 68 65 66 63

Azotobacter sp._21 93 90 91 90 87 83 84

Azotobacter sp._25 93 92 90 87 85 82 82

Azotobacter sp._26 93 86 89 88 85 84 83

Azotobacter sp._28 93 90 93 91 87 86 85

Azotobacter sp._G1 93 86 85 87 90 83 83

Azotobacter sp._G2 93 88 87 86 86 85 85 Litter without processing 93 93 93 92 91 92 90

On the first day of the experiment, the gas content over fresh chicken manure was 93mg/m3 , which is above the limit of permissible concentration (LPC 20mg/m3 ). During the experiments, it had revealed that the isolated natural strains of the genus Azotobacter had an insignificant effect on the content of ammonia nitrogen in the environment over the experimental batches of chicken manure. Only one strain, Azotobacterchroococcum 31/8 R, demonstrated the best fixing ability of atmospheric nitrogen. There had found that on the 15th day of the experiment, the ammonia level over chicken manure treated with Azotobacterchroococcum 31/8 R decreased to 14mg/m 3, which is below the LPC level. On the 20th, 25th and 30th day of the study, the content of ammonia nitrogen in this group changed slightly. There were no changes in the rest of the remaining study options. However, in none of the experimental batches, the content of ammonia nitrogen was lower than the LPC value. For selecting the most suitable strain, it studied genes encoding a complex of enzymes involved in the process of nitrogen fixation. Using express analysis detected DNA of genes similar to the sequences of important enzymes ferredoxins, hydrogenases and the nitrogenase complex (Mo Fe nitrogenase, V nitrogenase and Fe nitrogenase).

The conducted studies revealed positive signals for all analyzed cultures of microorganisms, but to varying degrees:

Azotobacterchroococcu m B 35 ferredoxin , hydrogenase , and Mo Fe nitrogenase like genes;

Azotobacterchroococcum B 8739 and Azotobactervinelandii B 932 ferredoxin , hydrogenase and Fe nitrogenase like genes;

Azotobacterchroococcum 31/8 R ferredoxin , hydrogenase , Mo Fe nitrogenase , V nitrogenase and Fe nitrogenase like genes;

Azotobacter sp._21, Azotobacter sp._25, Azotobacter sp._26, Azotobacter sp._28, Azotobacter sp._G1 and Azotobacter sp._G2 Fe nitrogenase like genes.

These results showed that the most promising strains are the nitrogen fixing culture Azotobacterchroococcum 31/8R. In the structure of total DNA, it identified genes encoding all the studied enzymes responsible for the process of nitrogen fixation.

Molecular genetic identification of selected microbial cultures

For confirmation of the species affiliation of the selected microbial cultures (Pseudomonasputida , Azotobacterchroococcum ), conventional molecular genetic methods identified them. The DNA of bacterial strains was isolated by freezing.

PCR was performed using the standard primers 27f and 1495r for identifying the 16S rRNA gene (Table 5).

Table 5: Primers used in the work Name Subsequence 27f 5´ GAGAGTTTGATCCTGGCTCAG 3´ 1495r 5´ CTACGGCTACCTTGTTACGA 3´

DNA amplification was performed using a Bio RadT100 apparatus (Bio Rad, USA).

After PCR, there had checked TAE agarose the amplification results of the fragments. Further, these fragments had isolated from the gel and purified using the ColGen kit from Synthol. The sequencing of the isolated PCR fragments, according to Sanger, was on an ABI Prism 3130 sequencer. The volume of the mixture was 6 ml with a concentration of 50ng/ml. Here, sequencing was using forward and reverse primers to bring the two sequences together later. The resulting D NA sequences were compared using the NCBIBLAST service, after reflecting the reverse sequences using the web version of the Reverse Complement tool. Both sequences after that were connected. Next, the online program aligned with each other the samples Clustal Omega (Figure 2).

Figure 2 shows the sequenced of the 16S rRNA gene of the Azotobacterchroococcum strain and Pseudomonasputida strain. As expected, there had revealed differences in the structure of these sequences between the species.

After comparison with each other, the DNA sequences of the presented strains were deposited with the US National Center for Biotechnology Information (NCBI) under the numbers

Azotobacterchroococcum KA (MZ411408.1) and Pseudomonasputida AA (MZ411409.1).

Figure 2: Alignment of DNA sequences of 16S rRNA genes of the studied strains

Thus, the conducted modern molecular genetic analysis confirmed the species affiliation of the selected strains.

4 Conclusion

The conducted studies have shown that the culture of Pseudomonasputida 90 biovar A (171) has a high proteolytic ability. Introducing this strain into chicken manure leads to its biodegradation. This is indicated by a decrease in ammonium nitrogen and an increase in the total microbial number, which speed up the decomposition process of poultry waste. It was also found that the best ability to fix atmospheric nitrogen is the Azotobacterchroococcum 31/8 R strain since its use helped to reduce the level of ammonia produced by chicken manure in the environment. Thus, the combined use of selected cultures of microorganisms can be the basis for the development of a biological product that speeds up the process of natural decomposition of bird droppings.

5 Availability o f Data and Material

Data can be made available by contacting the corresponding author.

6 Acknowledgement

The research was carried out with the financial support of the Kuban Science Foundation and the Organization in the framework of the scientific project No. MFI P 20.1/4.

7 References

Aasfar A, Bargaz A, Yaakoubi K, Hilali A, Bennis I, Zeroual Y, Meftah Kadmiri I, 2021. Nitrogen Fixing Azotobacter Species as Potential Soil Biological Enhancers for Crop Nutrition and Yield Stability.

Frontiers in Microbiology. DOI: 10.3389/fmicb.2021.628379

Anokhina T, Esikova T, Polivtse va V, Iminova L, Solyanikova I, 2019. Rhizospheric Bacteria, Destructors of Toxic Aromatic Compounds. Advances in Biological Sciences Research 7: 11 15. DOI: 10.2991/isils 19.2019.3

Bamire AS, Amujoyegbe J, 2003. Economics of poultry manure utilization in land quality improvement among integrated poultry maize farmers in South western Nigeria. Nigerian Journal of Animal Production 30(1): 93 100. DOI: 10.51791/njap.v30i1.1831

Criteria for attributing waste to I V hazard classes according to the degree of negative impact on the environment, 2016. Moscow, Russia. https://docs.cntd.ru/document/420240163

Din M, Nelofer R, Salman M, Abdullah, Khan FH, Khan A, Ahmad M, Jalil F, Ud Din J, Khan M, 2019. Production of nitrogen fixing Azotobacter (SR 4) and phosphorus solubilizing Aspergillus niger and their evaluation on Lagenaria siceraria and Abelmoschus esculentus. Biotechnology Reports 22. DOI: 10.1016/j.btre.2019.e00323

GOST 20264.2 88, 1989. Enzyme preparations. Methods for determination of proteolytic activity, Moscow, Russia, 11 p. https://docs.cntd.ru/document/1200023426

GOST 31461 2012, 2012. Poultry dung. Raw material for manufacture of organic fertilizers. Specifications, Moscow, Russia, 68 p. https://docs.cntd.ru/document/1200096492

Guidelines 3.5.2.1759 03, 2004. Methods for determining the effectiveness of insecticides, acaricides, growth regulators and repellents used in medical pest control, Moscow, Russia, 64 p. https://docs.cntd.ru/document/1200036862

Guidelines 4.2.2661 10, 2010. Methods of sanitary parasitological research. Methodical instructions, Moscow, Russia, 68 p. https://meganorm.ru/Data2/1/4293776/4293776901.htm

Hindersah R, Handyman Z, Indriani FN, Suryatmana P, Nurlaeny N, 2018. Azotobacter population, soil nitrogen and groundnut growth in mercury contaminated tailing inoculated with Azotobacter. Journal of Degraded and Mining Lands Management 5(53): 1269 1274. DOI: 10.15243/jdmlm.2018.053.1269

Hindersah R, Kamaluddin NN, Samanta S, Banerjee S, Sarkar S, 2020. Role and perspective of Azotobacter in crops production. Sains Tanah Journal of Soil Science and Agroclimatology 17(2): 170 179. DOI: 10.20961/STJSSA.V17I2.45130

Logan LAP, Latty T, Roberts TH, 2021. Effective bioconversion of farmed chicken products by black soldier fly larvae at commercially relevant growth temperatures. Journal of Applied Entomology 145: 621 628. DOI: 10.1111/jen.12878

Luneva A, Lysenko Y, Gneush A, Lysenko A, Machneva N, and Aniskina M, 2022. Bird Droppings Biodegradation and Its Use as Fertilizer for Tomato Cultivation. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies 13(5), 13A5L, 1 10. DOI: 10.14456/ITJEMAST.2022.96

Micciche A, Rothrock MJ, Yang Y, Ricke SC, 2019. Essential oils as an intervention strategy to reduce Campylobacter in poultry production: A review. Frontiers in Microbiology 10: 1058. DOI: 10.3389/fmicb.2019.01058

Mir NA, Rafiq A, Kumar F, Singh V, Shukla V, 2017. Determinants of broiler chicken meat quality and factors affecting them: a review. Journal of Food Science and Technology 54(10): 2997 3009. DOI: 10.1007/s13197 017 2789 z

Muhammad J, Khan S, Su JQ, Hesham AEL, Ditta A, Nawab J, Ali A, 2020. Antibiotics in poultry manure and their associated health issues: a systematic review. Journal of Soils and Sediments 20(1): 486 497. DOI: 10.1007/s11368 019 02360 0

Neverova O, Gorelik O, Lopaeva N, 2021. Topical issues of raising breeding roosters of the Hisex Brown cross. Agrarian Bulletin of The, 14. DOI: 10.32417/1997 4868 2021 14 49 55

Nosrati R, Owlia P, Saderi H, Rasooli I, Malboobi MA, 2014. Phosphate solubilization characteristics of efficient nitrogen fixing soil Azotobacter strains. Iranian Journal of Microbiology, 6(4): 285 95.

Rozhkova A and Stepanova E, 2021. Improving the Competitiveness of Poultry Farms in the Krasnoyarsk Region of Russia. In E3S Web of Conferences Vol. 247. DOI: 10.1051/e3sconf/202124701026

Sanitary rules 2.1.7.1386 03, 2010. Sanitary rules for determining the hazard class of toxic production and consumption wastes, Moscow, Russia, 5 p. https://base.garant.ru/4179350/

Shepon A, Eshel G, Noor E, Milo R, 2016. Energy and protein feed to food conversion efficiencies in the US and potential food security gains from dietary changes. Environmental Research Letters 11(10): 105002. DOI: 10.1088/1748 9326/11/10/105002

Subedi S and Dhakal D, 2015. Economics of poultry manure as an alternative to chemical fertilizer for agricultural production in Nepal. Journal of the Institute of Agriculture and Animal Science 33 34: 259 268. DOI: 10.3126/jiaas.v33i0.20713

Sumbul A, Ansari RA, Rizvi R, Mahmood I, 2020. Azotobacter: A potential bio fertilizer for soil and plant health management. Saudi Journal of Biological Sciences 27(12): 3634 3640. DOI: 10.1016/j.sjbs.2020.08.004

Tian M, He X, Feng Y, Wang W, Chen H, Gong M, Liu D, Clarke JL, Van Eerde A, 2021. Pollution by antibiotics and antimicrobial resistance in live stock and poultry manure in china, and countermeasures. Antibiotics 10(5): 539. DOI: 10.3390/antibiotics10050539

Ulimbashev MB, Temmoev MI, Konik NV, Koshchaev AG, Luneva AV, Neverova OP, Saleeva IP, 2019. A new method of biological disposal of poultry droppings. International Journal of Engineering and Advanced Technology 9(1): 4953 4956. DOI: 10.35940/ijeat.A2107.109119

Dr.Albina Luneva, a Candidate of Biological Sciences, is an Associate Professor in the Department of Parasitology, Veterinary Sanitary Expertise and Animal Hygiene, Kuban State Agrarian University named after I. T. Trubilin, Russia. Her research encompasses Improving Methods for Diagnosing, Treating and Preventing Invasive Diseases and Ways to Increase the Productivity of Domestic and Wild Animals and Birds

Professor Dr.Andrey Koshchaev, a Doctor of Biological Sciences, is Professor of the Department of Biotechnology, Biochemistry and Biophysics, Kuban State Agrarian University named after I. T. Trubilin, Russia. His scientific interests are related to the study of Biochemistry and Biotechnology in the Processing of Agricultural Raw Materials

Professor Dr.Yury Lysenko, Doctor of Biological Sciences, is a Professor of Department of Biotechnology, Biochemistry and Biophysics, Kuban State Agrarian University named after I. T. Trubilin, Russia. His researches are the development of end to end Agro food Bio nanotechnologies, getting Functional Eco products based on Plant, Animal Raw Materials and By products of Processing in the Conditions of Organic Industrial Development

Dr.Anna Gneush, a Candidate of Agricultural Sciences, is an Associate Professor, Head of Department of Biotechnology, Biochemistry and Biophysics, Kuban State Agrarian University named after I. T. Trubilin, Russia. Her research includes the Development of end to end Agro food Bio nanotechnologies, getting Functional Eco products based on plant, animal raw materials and By products of Processing in the Conditions of Organic Industrial Development

Professor Dr.Azamat Shantyz, a Doctor of Veterinary Sciences, is a Professor of the Department of Biotechnology, Biochemistry and Biophysics, Kuban State Agrarian University named after I. T. Trubilin, Russia. His scientific interests are related to the development of biotechnologies for the production of pharmaceuticals for veterinary medicine.

Dr.Nadezhda Machneva, a Candidate of Biological Sciences, is an Associate Professor in the Department of Biotechnology, Biochemistry and Biophysics, Kuban State Agrarian University named after I. T. Trubilin, Russia. Her researches are development of End to end Agro food Bio nanotechnologies, getting Functional Eco products based on Plant, Animal Raw Materials and By Products of Processing in the Conditions of Organic Industrial Development

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies

http://TuEngr.com

Some Legal Issues About Fintech in Payment Activities in Vietnam

Nguyen Minh Hang1*, Luong

Thi Linh Chi2

1Faculty of Economic Law, Hanoi Law University, VIETNAM.

2Faculty of Law, Hanoi Open University, VIETNAM.

*Corresponding Author (Tel: +84 904 177 211, Email: nguyenminhhang246@gmail.com)

Paper ID: 13A5P

Volume 13 Issue 5

Received 22 December 2021 Received in revised form 15 April 2022 Accepted 22 April 2022 Available online 29 April 2022

Keywords: Financial technology (Fintech); E payment; Banking payment activity ; Ewallet; Anti money laundering law; Digital transaction; Modern retail payment, Online payment

Abstract

The term Financial technology (Fintech) is the combination of finance and technology to create new services and products in the banking sector based on information and telecommunication technology platforms. The reality in Vietnam shows that in the past few years, Fintech companies have been operating in the provision of digital financial products such as mobile wallets, peer to peer transfer, mobile payment, mobile banking, peer to peer lending, etc. Accordingly, they have been licensed to carry out payment activities and some will provide banks with technological support for modern and efficient payment services. The authors have given two main groups of solutions: Completing regulations on operation conditions of Fintech companies; and Building and developing advanced and modern retail payment infrastructure. Inclu ding some basic solutions for the development and operation of Fintech companies in Vietnam.

Disciplinary: Business & Economic Management, Economic Law (Digital Transaction & Law). ©2022 INT TRANS J ENG MANAG SCI TECH. Cite This Article:

Hang, N. M., Chi, L. T. L. (2022). Some Legal Issues About Fintech in Payment Activities in Vietnam. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5P, 1 15. http://TUENGR.COM/V13/13A5P.pdf DOI: 10.14456/ITJEMAST.2022.100

1 Introd u ction

In recent years, the use of digital technology has become an inevitable trend and has been the target and destination of financial and banking activities [1, 2]. Accordingly, the cooperation between fintech companies and banks has become more and more important and necessary. In 2020, Fintech Vietnam received many good signals due to connecting with service providers, applying technology, creating many digital transaction platforms and, above all, receiving direct support from the g overnment [3,7,8,22]. Especially, according to the report on Fintech in Asia the Pacific region of IDC Financial Insights, there are 5 representatives from Vietnam in Fintech Fast

101 group (Top 101 Fintech firms with the best growth rate in 2020) including Payoo and 4 major e wallets, accounting for 92% of Vietnam's e wallet market share, namely MoMo, Moca, Tima and ZaloPay [23]. The rapid development of technology and the explosion of these Fintech companies requires the construction and completion of a suitable legal framework for the Fintech system in general and payment activities in particular in Vietnam [4.6,9,10].

2 Literature Review

Fintech, standing for financial technology, is a broad term referring to all companies that use information and telecommunication technology to provide financial services [11]. They are penetrating nearly every section of financial services, promoting banking and financial activities, especially in the field of non cash payments [12,16,17] With innovative solutions, Fintech companies have provided new and modern payment solutions for customers to replace traditional payment services that require payment accounts at banks [13,14,15]. These payment services can be built based on the mobile phone system or the Internet such as E money, mobile payment, payment via QR code or Peer to peer payment. The two markets that Fintech companies focus on developing include: (i) Payment for individual customers and retailers; (ii) Payments to businesses and retailers. Retail payment includes mobile wallets, mobile payments, peer to peer (P2P) real time payments, foreign currency and remittances, and digital currency solutions [18].

Vietnam's banking payment activities are mainly handled through: (i) Payment systems organized, managed and operated by the State Bank (Paper/Electronic Clearing System; inter bank electronic payment system) (ii) Switching and credit card clearing systems; (iii) Securities clearing and settlement systems; and (iv) Internal and Bilateral payment systems organized by banks, managed and operated by some credit institutions. International payment transactions are mainly handled by the International Money Transfer Service via the SWIFT system and the Western Union Money Transfer Service (WU) directly negotiated, signed, and cooperated by domestic credit institutions with international organizations [19,20,21]. With the advantages of technology advancements, Fintech companies have shown rapid growth in the field of payment intermediaries with diverse products and services such as electronic payment gateways, collection and payment support, and especially e wallets. In addition, the trend of cooperation in providing intermediary payment services has supported commercial banks to expand their customer service range, contributing to promoting commercial payments in Vietnam.

3 Method

The descriptive and analytical methodology of this paper is supported by primary and secondary sources of research data: official documentation, books, independent reports, newspapers, and private stakeholders' analysis. Moreover, the field experiences of senior civil servants and eminent professionals have also been taken into consideration to reach conclu sions and provide useful infor mation.

Result and Discussion

Regarding the legal mechanism, Vietnam currently has not had a legal framework for Fintech companies, although the Government has issued many documents to regulate some contents on Fintech such as Law on Electronic transactions, Law on Cybersecurity, Scheme for payment of non cash payments in Vietnam during 2016 2020; Scheme for Completing the legal framework for the handling and management of virtual assets, virtual money, electronic money; establishment of a Steering Committee in the field of financial technology. The technological intermediary payment services such as e wallets, QR codes , and Mobile money, basically have a legal framework to ensure the legitimacy of the payment intermediary service providers, which are specified in documents such as Circular of the State Bank No. 39/2014 (Circular No. 39/2014) guiding payment intermediary services and have been amended and supplemented many times at the Circular No. 39/2014/TT NHN (Circular of the State Bank 20/2016; Circular of the State Bank 30/2016), Circular of the State Bank 23/2019 has amended and supplemented a number of articles of Circular No. 39/2014 that concretize management and supervision requirements for e wallet services; it has also mentioned some contents regulating the operation of Fintech companies in Vietnam.

4.1 The Law on Payment Activities of Fintech

4.1.1

Operating Conditions of Fintech Companies in Payment Activities

Decree 101/2012 dated 22/11/2012 of the Government on non cash payment (hereinafter referred to as Decree 101/2012) is the precondition for intermediary payment activities; The amended and supplemented documents only provide a few contents regulating the operation of E wallets a popular type of payment intermediary that Fintech companies in Vietnam are providing in operation. Therefore, the legal framework for the model of Fintech companies operating as payment intermediaries is only mentioned much about the conditions, and operating regulations to ensure the safety of e wallets, specifically:

Article 15, Clause 2 of Decree No. 101/2012 stipulates that the conditions for establishing a payment intermediary are “Having an establishment license or business registration issued by a competent state agency, in which providing intermediary payment services is one of the main business activities of the organization”. Legally, this regulation has ensured the legitimacy of the organization that wants to participate in payment service activities.

In addition, Article 15, Clause 2 of Decree No. 101/2012 stipulates personnel conditions: “The legal representative, the General Director of the organization applying for the permit must have professional qualifications or practical experience in business administration of their in charge field. The staff performing intermediary payment services must be professionally qualified for their operation”. This is an unclear condition in terms of management objectives and does not seem to be really in line with the objectives in business conditions specified in Article 7 of the Law on Investment. If this regulation is to ensure the operational efficiency of the enterprise, it is not

necessary because this is the need of the enterprise itself. In fact, payment intermediary service providers have been operating effectively for many years without a legal representative and/or key personnel to meet the mentioned conditions.

In addition, this document stipulates professional conditions and technical, including technical infrastructure physical foundation, facilities meeting the requirements of the provision of payment intermediary services the State Bank’s regulations; intermediary services to assure safety; a backup technical system independent from the main system to assure the safe and uninterrupted provision of services when the main system breaks down; technical and professional processes in the provision of payment confidentiality and compliance with the law on e transactions; internal examination and control processes for payment intermediary services in e transactions. This regulation is quite general, it is difficult to quantify (which facilities are supposed to meet the requirements of the payment intermediary service operation?) This will cause difficulties for businesses in practice and give more powers of presumption to enforcement officers.

In addition, Decree No. 101/2012 stipulates operating conditions for e wallets: “E wallet is a service that provides customers with an identi fied electronic account on information carriers (such as computers, mobile phone sims, electronic chips...) created by a payment intermediary service providers, enables to store a monetary value secured by money value deposit equivalent to the amount transferred from the customer's payment account at the bank to the secured payment account of the e wallet service provider at the ratio of 1:1". Thus, an e wallet is understood as an electronic account identified by the information carrier to store a monetary value that is equivalent to the value of the deposit transferred from the customer's payment account into the secured account of the e wallet service provider. An E wallet or digital wallet is simply an electronic account integrated into mobile applications or used via a website as a wallet to help users store money from bank accounts functioning online payment and transactions with electronic websites or internet fees that are linked and allowed payment by e wallets. These service providers will cooperate with banks to manage users' funds and through this connection, the banks will reduce their management of payment transactions from customer cards because these will be done by e wallet providers.

In addition, Circular No. 39/2014 dated 11/12/2014 of the Government guiding payment intermediary services (hereinafter referred to as Circular 39/2014) stipulates: “The deposit into or withdrawing money from the customer's e wallet must be done through the customer's payment account at banks" (Clause 3, Article 8). According to the provisions of Circular No. 16/2014 of the State Bank in Vietnam dated August 1, 2014 guiding the use of foreign currency accounts and Vietnam dong accounts at authorized banks of residents and non residents, there are no regulations regarding the use of foreign currency accounts to deposit into E Wallets.

In practice, according to current management regulations, an e wallet service provider may not: (i) issue more than one e wallet for a customer's payment account at banks; (ii) grant credit to customers using E Wallets, pay interest on E Wallet balances, or any actions that may increase the

currency value on E Wallets. Organizations providing e wallet services must have tools for the State Bank to monitor and check in real time the total amount of customers' money on e wallets and the total amount of the secured payment accounts of e wallet service providers at banks. The deposit into and withdrawal from the customer's E wallet must be done through the customer's payment account at banks. Thus, Fintech companies providing payment services in the form of e wallets are mostly linked to customers' bank accounts, and customers rarely deposit money directly into e wallets or into Fintech company accounts; Therefore, it is important to have a clear legal framework to control the activities of Fintech companies in payment operations, especially in non cash electronic transactions.

4.1.2 Regulations to Ensure the Safety of Payment Transactions

Payment intermediary service providers, including Fintech companies, are responsible for keeping confidential information related to customers in accordance with the law (specified in Decree No. 101/2012 and the Law on Cyber Information Security). At the same time, they must also comply with risk management principles in e banking activities; comply with requirements to ensure security and safety of regulations and information technology systems on safety and security for the provision of banking services on the Internet (Circular No. 39/2014/TT NHNN, Circular No. 39/2014, Circular No. 18/2018, Circular No. 35/2016 of the State Bank of Vietnam ).

In addition, Points b and c, Clause 1, Article 17 of the Law on Cyber Information Security stipulate: Organizations are responsible for only using the collected personal information for purposes other than the original one after having the consent of the personal information owner; they must not distribute the information collected or provide, share, accessed or controlled to third parties, except with the consent of the owner or at the request of the competent state agency. In addition, payment intermediary organizations, including Fintech companies, must ensure the security and safety of payment intermediary activities as prescribed in Article 7 of Circular N o. 39/2014 of the State Bank of Vietnam; Accordingly, it requires payment intermediaries to develop and comply with the State Bank's regulations on e banking activities have risk management principles, with current laws on prevention and combat of money laundering, with requirements on ensuring safety and security of information technology systems, with regulations on security and safety for the provision of e banking services according to regulations of the State Bank and other relevant regulations.

In addition, Circular 23/2019 of the State Bank of Vietnam guiding payment intermediary services stipulates many other solutions to protect the interests of customers using payment intermediaries Fintech companies, including e wallets as follow s:

(i) Point c, Clause 6, Article 9 of Circular 23/2019 of the State Bank of Vietnam prescribes: Total transaction limit via personal e wallet of 1 user at 1 e wallet service provider is up to 100 (one hundred) million dong per month. This regulation is to better manage E wallet activities, avoid the widespread and impractical e wallet registration of users, and be in line with the current development of the e wallet market in Vietnam. Circular 23/2019 of has not stipulated transaction

limits via e wallets for user organizations because these are normally used for various purposes such as paying salaries for company employees, and managing internal revenues and expenditures, if a certain limit is specified, it will cause difficulties for organizations/enterprises to apply for payment via e wallets in practice.

(ii) Regulations on e wallet activities include Dossier to open e wallet, personal information verification of the user, connection between e wallet and a domestic payment account/debit card of the user. These regulations are due to the fact that the payment intermediary service acts as an intermediary that connects, transmits and processes electronic data of payment transactions between payment service users and payment service providers. Therefore, the intermediary payment services operations of Fintech companies (including e wallet services) must be provided to customers who already have accounts at banks. The e wallet service needs to ensure the users’ identity and must connect to their payment accounts at banks.

(iii) The State Bank supervises the activities of Fintech companies when they provide payment services;

(iv) Fintech companies providing payment services must stipulate and inform the terms and conditions of service used to customers, guide them to use the service and the regulations on the handling of checks or complaints.

In addition, Circular 23/2019 of the State Bank of Vietnam has regulations on the following prohibited activities: Using e wallets to conduct transactions for terrorist financing, money laundering, fraudulent, cheating and other law breaking purposes; renting, leasing, borrowing, lending e wallets or buying and selling e wallet information; E wallet service providers are not allowed to grant credit to e wallet users, to pay interest on e wallet balances or any actions that may increase the currency value on e wallets compared to the value of money deposited

In addition to the above provisions, Fintech companies providing e wallet services must provide tools for the State Bank to supervise the provision of e wallet services in the followings:

First, monitoring the total number of e wallets (issued, activated and active), the total e wallet balances of all customers at the time of accessing the monitoring tool;

Second , monitoring the total balances of payment assurance accounts for e wallet services, information of each secured payment account for e wallet services opened at cooperating banks, including account name, account number, balance at the time of accessing the monitoring tool;

Third , exploiting data in the monthly reports (from the 1st to the last day of the month) on the 5th day of the following month at the latest (Including the total number and total balances of e wallets (issued, activated and active) at the end of the last day of the reporting period; the total number and total value of deposits, withdrawals, payments and other transactions of the e wallets are reported on each day of the month; the total number and the total value of transactions on Debit side, the total number and the total value of transactions on the Credit side of the secured payment account guarantee for e wallet services reported on each day of the month).

Moreover, for the 10 e wallets with the highest number of transactions per object, Fintech companies must provide information to the State Bank of Vietnam (the units accepting payment; individual customers, and institutional customers but excluding individuals and organizations that accept payment). The information must include opening balance, ending balance; total amount and the total value of deposit and withdrawal transactions according to each affiliated bank; total amount and the total value of payment transactions, money transfer s.

4.2 Practices of Fintechs in the Field of Payment

4.2.1 Achievements of Fintechs in the Payment Segment

Statistics show that the number of Fintech companies providing services in the Vietnamese market has increased rapidly, in 2016 with about 40 companies, and by April 2021, about 200 units have been licensed by the State to operate. motion. The main fields of activity of Fintechs are payment intermediaries, including financial switching, electronic clearing, payment gateways, support for foreign currency transfer, revenue/expenditure support, and e wallets[31]. Statistics show that Fintechs are operating in the following segments in Vietnam: providing payment tools such as Moca, Payoo, VinaPay, Momo... or providing POS/mPOS4 digital payment solutions such as Hottab, SoftPay; some companies provide fundraising platforms such as FundStart, Comicola, Betado or FirstSetp…; provide online loans such as LoanVi, Timal; personal financial management such as BankGo, Moneylover, Mobivi; data management such as Trusting, Social, Circle Bii; money transfer like Matchmovie, Cash2vn; Blockchain like Bitcoin Vietnam, VBTC Bitcoin [32]. Thereby, it shows that the number of Fintech companies in Vietnam increases yearly and most of them are in the payment field, as shown in the following chart from 2017 2020.

There is a quick and convenient form of top up and payment, including website and mobile application, anytime, anywhere with just a few simple steps and confirmation of transaction password.;

Reducing users' working and traveling time, making payment transactions quicker and easier. At the same time, users can query account information anytime, anywhere, especially without having to carry cash, reducing the risk of losing money or being stolen;

Enhancing security of transactions, allowing payment of small fees, easy to use and popular (since it may not need to connect with a bank account during the payment process) and wide range of uses. In addition, the e wallet can be used for ordinary daily payments and other applications such as smart card s or Internet payments.

According to research and survey by the Institute of Banking Technology Research and Development under the Vietnam National University, Ho Chi Minh City (VNUHCM IBT), there are about 200 Fintech companies in Vietnam in fields such as payments (37 companies)) is the most popular Fintech in Vietnam market wi th popular types are Mobile Wallet, Mobile Payment, Mobile Banking; loans (25 companies); Blockchain, Cryptocurrencies and Remittances (22 companies).

Figure 2: Number of mobile phone users with Internet connection in Vietnam ( million users).

In addition, the development of technology and the trend of cashless payment in Vietnam shows the increasing number of consumers who have adopted payment applications of Fintech companies such as e wallets. According to statistics from the State Bank of Vietnam, by the end of 2013, there were about 1.84 million e wallet users with a total transaction volume of USD 1.1 billion. By 2016 this number reached 3 million and it is expected to exceed 10 million users in 2020 (Fintech development in the payment field in Vietnam).

Figure 3: Number of e wallet users in Vietnam 2013 2020f ( million users)

In fact, in recent years, Fintech companies in the Vietnam market have competed fiercely for this lucrative market share to launc h a series of e wallet brands such as Momo, ZaloPay, Bankplus, Samsung Pay, Payoo, eDong, 1Pay, Bao Kim, Vimo, VTC Pay, Mobivi, eMonkey, Pay365, FPT Wallet, TopPay, Ngan Luong, AirPay, etc . With the strength of convenience and diverse ecosystem, MoMo e wallet of Online Mobile Services Joint Stock Company has quickly been connected by banks. The excitement and attractiveness of e wallets have attracted commercial banks as well as large technology companies and corporations to gradually penetrate the market (Figure 3). Up to now , many banks have developed electronic payment systems. Regarding the popularity, from subscriber data and market share announced by e wallet businesses, MoMo is currently the largest and most popular market share in Vietnam. Besides Momo, there are also many brand names from domestic and foreign investors such as Airpay, Moca, Payoo, Zalopay, VinIDPay (Figure 4).

80%

70%

60%

50%

40%

30%

20%

10%

69% 9% 8% 4% 3% 1% 1% 1% 1% 1% 0%

1

Momo Airpay Zalopay Grab by Moca VinID Pay Ngân lượng Vimo VTC Pay

Payoo Appota

Figure 4: Popular and favorite e wallets in Vietnam today

Figure 3 shows that Vietnam is one of the potentially fastest growing markets in the region for the application of technology payments through Fintechs such as e wallets. It has a strong impact on promoting the growth of electronic payment. In addition, there are other advantages as followings: The Government encourages the development of non cash payment; businesses give priority to using modern payment technology; types of e commerce, business, consumption activities, commerce, shopping, services, and domestic tourism have developed rapidly; This has also had great impacts to the development of Fintech companies in Vietnam in the field of payment.

4.2.2 Difficulties and Limitations for Payment Activities of Fintech Companies

In providing payment services, including e wallets , Fintech companies have encountered some difficulties and limitations. These come from several reasons as follows:

First, there is no clear legal corridor for the operation of e wallets, without specific regulations and guidelines; The new regulations focus mainly on conditions, dossiers , procedures, licensing procedures, the definition of e wallet service, secured payment account s for e wallet service, rights , and responsibilities of users , of related parties. The e wallet services in Vietnam are still in the early stage, attracting much attention from the information technology community and the participation of domestic start ups. In addition, E wallet service providers must comply with the law on the prevention and combat of money laundering, h owever, the reporting subjects currently specified in the Law on Anti Money Laundering do not include payment intermediary service providers, which causes Fintech companies providing e wallets difficulties in implementing and complying with the regulations; t herefore, in the coming time, it is necessary to have guiding document s, uniformly adjust regulations on subjects to be applied and comply with regulations on prevention and combat of money laundering.

Second , Fintech companies providing payment services still have difficulties in developing services, especially providing for those who do not have bank accounts, and who live in rural and remote areas. For services like e wallets, specific regulations on classification and application of bank accounts/e wallet accounts by level (with classification criteria such as basic account , transaction limit; transaction function, the purpose of usage and level of providing customer identified information) should be studied and applied in practice to facilitate the development of e wallet services.

Third, the operation of Fintech companies providing e wallet services in Vietnam now is a new field, it is quite complicated and challenging for inspection and supervision. Some Fintech companies have not yet fully complied with legal regulations such as allowing the opening and activating e wallets that are not attached to customers' payment accounts at banks, attaching and recharging e wallets from the customer's credit cards or by other means. An electronic payment gateway service is a service that provides the technical infrastructure to make the connection between banks and payment acceptors in order to support customers to make payments in e commerce. In addition, with the role of providing the payment infrastructure of the system, some financial switching service providers have cooperated with unlicensed electronic payment gateway providers resulting in unintentionally abetted gambling and money laundering in the market. In addition, some international organizations have already provide d payment services in Vietnam but have not yet registered their business and had a commercial presence in Vietnam. This will lead to risks in operation, liquidity, and being induced to join illegal activities, and difficulties in management. Therefore, there have been legal loopholes that create huge pressure in managing the activities of organizations licensed to provide intermediary payment services.

4.3 Results and Recommendations

Currently, about 150 Fintech companies are operating in many different fields, of which the majority of Fintech companies (nearly 72%) are cooperating with commercial banks under the

business cooperation model. In fact, payment activities account for the largest proportion of Fintech companies’ operations in the Vietnam market (60.5% of all fields of Fintech companies) [23]. Besides, Fintech in Vietnam has been attracting the special attention of large technology companies to participate in the market through both direct and indirect forms such as investing in the formation of Fintech companies, establishing investment funds, and incubators to support Fintech start ups, etc. Besides favorable conditions from the attention of the Government and the State Bank in the context of technology 4.0, the development of Fintechs in the payment field in Vietnam is facing the following main challenges: (i) the habit of cash payment is still popular, worries about new financial services based on technology, (ii) cashless payments remain limited in the public sector; (iii) the legal framework has not kept pace w ith the rapid development of technology, (iv) the fee for cross border payment services is still high, the cross border payment service is a big challenge, (v) customer’s knowledge and customer training are limited. In Vietnam, the financial and banking sector has many potential risks, so it is being regulated by state documents on the operation of traditional credit institutions such as the Law on Credit Institutions (2010), the Law on Credit Institutions and the Law on Credit Institutions. agreement instruments (2005), Ordinance on Foreign Exchange (2005), Law on Anti Money Laundering (2012), Law on Deposit Insurance (2012), Ordinance amending and supplementing a number of articles of the Ordinance on Foreign Exchange (2012). 2013) ... However, there is no synchronous system to regulate the activities of Fintech companies. Therefore, the author proposes some recommendations on the development and improvement of regulations.

4.3.1 Completing Regulations on Operation Conditions of Fintech Companies

First, maintaining the operating license of Fintech companies providing payment services: Payment intermediary services, including e wallets, which relate to mobilizing money from organizations and individuals, may arise operational, liquidity and service risks to engage in illegal transactions. Therefore, it is necessary to continue to maintain licensing for Fintech companies providing payment services to meet market requirements and to create conditions for them to operate in accordance with the law, under the management of competent agencies and have a safe and sustainable operation.

Second , issuing regulations related to electronic money: Electronic money in Vietnam is currently is in the form of prepaid cards provided by banks and e wallets. Cryptocurrencies are not a new one, but a type of fiat currency in the form of a payment instrument or means of payment to perform transactions and are guaranteed at a rate of 1:1 of fiat currency. Therefore, it is necessary to carry out additional research on cryptocurrency regulations to clarify the concept, nature, form of expression of electronic money and issues related to this in legal documents, licensing authority, and conditions for electronic money supply; management and risk control process to ensure safety and security of customer's transaction information, as well as compliance with regulations on anti money laundering; to ensure the protection of customers' interests, rights and responsibilities of related parties, so as to better meet the requirements of state management, catching up the

development trend of technology and in accordance with international practices. At the same time, determine the scopes and object s of the electronic money supply to issue appropriate management regulations. The identification of electronic money as a means of payment will help state management agencies have more effective management and supervision measures to prevent illegal tools in currency transactions.

Third , researching and issuing several management regulations for the operation of Fintech companies providing payment services, ensuring that their performance is safe, effective, and substantial, minimizing risks, and preventing the abuses of Fintech companies in illegal acts … which includes:

(i) Maintaining the regulations on the payment through Fintech companies connected with the customer's bank account and the deposit/withdrawal money from Fintech companies including e wallets must be done through the customer's bank account at bank s;

(ii) Setting payment transaction limit through e wallets and of Fintech companies in accordance with Vietnam market practice.

Fourth, regulating on expansion and flexibility in the deposit/withdrawal from various payment service providers of Fintech companies such as depositing/withdrawing money from e wallets to facilitate service users, which helps service providers to expand utilities, improve experience and attractiveness to users, such as: (i) Allowing the recharge by receiving money from other e wallets (either opened by the same or by another provider); (ii) Allowing the transfer from E wallets to E wallets (opened by the same or by another provider); allowing payment for legitimate goods and services; withdrawing money from the E Wallet to the customer's payment account or debit card linked to the E Wallet; (iii) Setting no limit to the number of payment accounts/debit cards of customers linked to the E Wallet; E wallet owners can choose accounts and cards to link with e wallets, creating flexibility and favorable conditions for customers in using e wallets; (iv) Supplementing specific regulations on opening e wallets of customers (wallet opening dossier, necessary information and documents, measures to authenticate customer information, linking e wallets to accounts); payment (or debit card) at bank s.

Fifth, the payment intermediary services of Fintech companies in Vietnam have mainly served customers with bank accounts in urban areas because of some strict requirements from the State Bank. Therefore, they should consider providing services to customers in rural areas, and to the ones who do not have a bank account in order to promote financial inclusion.

Sixth , supplementing and clarifying the roles and responsibilities of Fintech companies providing intermediary payment services, banks and related parties, especially in the management of payment acceptance units, in the connection model between e wallet providers and parties, to strengthen the responsibility of service providers and banks when developing payment services for payment acceptors, limiting risks from units accepting fake payments or providing goods/services out of the law.

Building and Developing Advanced and Modern Retail Payment Infrastructure

First, connecting the payment infrastructure of banks and Fintech companies to perform payment transactions quickly and efficiently, saving costs and resources for banks and Fintech s when connecting services to a focal point instead of each bank, Fintech makes separate connections.

Fintech companies can exploit the customer network, data and capital of the bank to provide their products and services to meet market demand. Accordingly, Fintech companies need to diversify payment services in customers' lives to meet their needs of customers, for example, customers can pay for online orders, for electricity, water, internet bills, recharge mobile phones , etc. Besides, for mobile payment wallets, customers who want to use them must link with a bank card in advance, this also means the cooperation of the bank in this digital form of payment.

Second, promoting the research and application of blockchain technology, distributed ledger technology to quickly apply in the field of finance banking and other fields due to the huge benefits of these technologies. Along with the technology factor, it is necessary to improve the quality of human resources for the capture and management of FinTech technology. In addition, it is necessary to set up a specialized regulatory agency in the field of construction, development and management of a nationwide digital payment system, to issue guidelines on how to develop management for suppliers and how to use it with consumers.

5 Conclusion

Fintech companies have been penetrating nearly every segment of financial services, promoting banking and financial activities, especially the growing field of non cash payments. This is currently one of the main areas of Fintech companies in many countries, especially in those with a low rate of accessing financial, banking , or payment services of people With the high demand for utility in the context of rapid growth society now, Fintech companies need to build a payment ecosystem in different forms, these payment services can be built based on the mobile phone system or the Internet such as electronic money, mobile payment, payment via QR code or Peer to peer payment. Accordingly, the completion and application of regulations for Fintechs in payment services is necessary and should be learned from experience. There should also be a mechanism for testing and evaluating their effectiveness in the most comprehensive way.

6 Availability of Data and Material

All information is included in this study.

7 Acknowledgement

The authors thank the support and facilitation of the School of Law, Vietnam National University, Hanoi, Vietnam and The Vietnam Women's Academy gave the authors time to complete the research.

References

[1] BankN etVN, (2014) Current situation of payment intermediary services Proceedings of the Scientific Conference on Solutions for developing and managing payment intermediary services in Vietnam, Dan Tri Publishing House: Hanoi.

[2] Karakas, C., Stamegn, C. (2017) Financial technology (FinTech): Prospects and challenges for the EU https://www.europarl.europa.eu/RegData/etudes/BRIE/2017/599348/EPRS_BRI(2017)599348_EN.pdf

[3] SVB. (2022). Creating a favorable legal foundation for Fintechs’ activities https://www.sbv.gov.i’n/webcenter/portal/vi/menu/tranqchu/hdk/cntt/clptcntt/clptcntt

[4] Dang Cong Thuc. (2017). Fintech trends in banking sector and early movements in Vietnam. Banking Magazine, No. 19, October 2017.

[5] 1MF (2018), Financial access surveys 2018 http://data.imf.org/’?sk=EñDCAB7E ACCA 4592 AREA S 9hB5463A34C

[6] FFIEC (2004). Handbook of Retail Payment Systems Federal Financial Institutions Examninati on Council, The Bank of Viet Nam.

[7] SBV. (2018) A Report on Completing Vietnam Fintech Ecosystem Fintech Steering Committee, State Bank of Vietnam

[8] SBV. (2019) A Report on Operation Plan of Vietnam Fintech Steering Committee Fintech Steering Committee, State Bank of Vietnam.

[9] Le Huyen Ngoc (2018) Fintech's impact on banking activities and some proposals for banks and Fintech to develop together in Vietnam. Proceedings of the conference on Future of Fintech and Banking: Development and Renew, 147 156

[10] Mal Lan (2018) Will the Fintech wave and the 4.0 Industrial Revolution make it difficult for the banking industry? Business Forum Newspaper

[11] Nguyen Ha. (2017). Fintech The new development or temporary trend in Vietnam. https://techinsiqht.com.i’n/fintechhuonq phat trien moi hay xu huonq nhat thoi tai viet nam/

[12] Nguyen Ha. (2018). Comments on the future of Fintech. http s://doimoisanqtao.x’n/news/20 I h/9/27/nhn nh v tnelai ca fintech

[13] Nguyen Thl Hoa. (2017). Overview of financial inclusion, the role of digital technology in promoting financial inclusion in Vietnam Vietnam Banking Conference 2017

[14] Nguyen Thl Thanh Nhan (2018) Fintech business models in the world and suggestions for Vietnam. Banking Magazine, 9(May)

[15] Nguyen Mlnh Ngoc, Ngu Yen Le Thao Huong, Chu Nhat Anh (2019) Building and analyzing financial inclusion indicators Banking Science and Training Journal

[16] PWC. (2016). FinTech 2020 and Beyond: Embracing Disruption

[17] PWC. (2020). Financial Services Technology 2020 and Beyond: Embracing Disruption. https://www.pwc.com/qx/en/financial services/assets/pdf/technoloqv2020 and beyond.pdf

[18] PWC (2017) Global Fintech Report https://www.pwc.corn/gx/en/industries/ financial services/assets/pwc global fintech report 2017.pdf

[19] Trlnh Ngoc Lan (2019) Fintech ecosystem development: lessons learned and recommendations towards sustainable development in Vietnam http://thitruonftaichinhtiente.i’n/phat trien he sinh thai fintech bai hrc kinh nfhiem va de xuatnham huonq toi phat trien ben vunq tai viet nam 23949.html

[20] Masoffer. (2020). True Money: Vietnam Fintech Market Report 2017. https://fintech.masoffer.com/vi/bao cao thi truong fintech viet nam 2020/7814

[21] Sanlcola, L. (201 6). Will Fintech help or hurt traditional advisors? CN BC. http://www.cnbc.corn/2016/ 05/25/will Fintech help or hurttraditional advisors.html

[22] SBV. (2020). Financial technology and Industrial Revolution 4.0: Electronic Information Portal of the State Bank of Vietnam. Vietnam Fintech Landscape 2020. https://finfan.vn/news/bao cao fintech viet nam 2020 1382.

[23] Vn. (2019). V ietnam’s Top 500 largest enterprises in 2019 Vietnam Report. A Seminar on Future of FINTECH and Banking, Development and 1nnovation http://sob.ueh.edu.vn/thong tin/ky yeu hoi thao khoa hoc tuong lai cua fintech va ngan hang phat trien va doi moi.html

Ms. Nguyen Minh Hang is Head of Banking and Finance Law Department, Faculty of Economic Law, Hanoi Law University

Ms. Luong Thi Linh Chi is a Lecturer at the Faculty of Law, Hanoi Open University

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

http://TuEngr.com

Privacy Regulations in the Middle East: Challenges & Solutions

Marwan Albahar1, Mohammed Thanoon1

1Department of Science, Umm Al Qura University, PO Box 715, Mecca, SAUDI ARABIA *Corresponding Author (Email: mabahar@uqu.edu.sa).

Abstract

Keywords: Data privacy; Middle East; GDPR; Privacy regulation solution; Cyber security; Right to privacy; Privacy policy; Privacy challenge; Personal Data Protection Law (PDPL); PDPPL; Data privacy issue; Sensitive information.

There is a dearth of privacy regulations in the Middle Eas t, which is becoming a real time issue for businesses in the region. Countries like Bahrain, Qatar, Oman, Saudi Arabia, and the UAE require data privacy regulations as they have faced phishing and malware attacks in recent times. Despite some institutions, such as Dubai International Financial Centre (DIFC) and Abu Dhabi Global Market (ADGM), having their own privacy regulations, the existing data regulations in the Middle East are still in their infancy phase. Considering this in view, the study aims to hi ghlight the challenges of privacy regulations in the Middle East and the solutions provided by these regulations. For this purpose, the study employed a thematic analysis approach and used 16 sources published between 2015 and 2022. It has been identified that the Middle East’s data regulations have also offered a secure and safe zone with financial penalties for any organization that violates the law.

Disciplinary: Computer Science and Computer Engineering (Data Privacy & Information Security) , Information & Privacy Law.

©2022 INT TRANS J ENG MANAG SCI TECH.

Cite This Article:

Albahar, M., Thanoon M. (2022). Privacy Regulations in the Middle East: Challenges & Solutions International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5Q, 1 11 http://TUENGR.COM/V13/13A5Q.pdf DOI: 10.14456/ITJEMAST.2022 101

1 Introduction

Privacy regulation is a term referring to the "right to privacy" of individuals, groups, and organizations [1]. Privacy regulations are important for a state to ensure that all its people and businesses are working in a safe zone with no threat from external sources that could cause data damage, data leakage, or manipulation. According to [2], data privacy is becomin g more than a mere security or regulation issue for companies in the Middle Eastern region. Organizations must consider both legal and ethical aspects when using data for professional use. This means that customers, users, and stakeholders may have a lot of SMS marketing messages or numerous emails

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies

that demand personal data sharing. This does not imply that asking for personal data for business use is forbidden under privacy and security regulations. However, it indicates that companies must ensure personal data sharing is conducted through transparency and on fairgrounds of accountability. On the other hand, organizations have shown their concerns about cyber security threats, mainly in the Middle Eastern region [3]. By 2030, the Middle Eastern market is expected to increase as the population grows to 580 million people. The Middle East already owns the largest repository of oil and gas on the globe. It is among the top ten holders of US treasuries and is now viewed for its cultural fame as well as its econo mic prospects [3]. Middle Eastern countries own the economic prestige of the European region and many other parts of the world. Since the data privacy challenges in Middle Eastern countries are gaining a lot of popularity, companies like LVMH, Hermes, Rolex, and financial institutions have made heavy investments in the Middle Eastern market. [4] claims that the Middle East has been increasingly facing security issues since the start of the pandemic. According to Kaspersky, there are 68 investigative reports in the Middle East, including 29 cyber gangs that are actively targeting Middle Eastern companies. Different countries are working on threat intelligence reports, such as the UAE (49 reports), Saudi Arabia (39 reports), Egypt (30 reports), Kuwait (21 reports), Oman (21 reports), and Jordan (20 reports). On the other hand, Iraq, Qatar, and Bahrain are dealing with less than 20 reports each to address cybersecurity issues. According to [5], there is no federal law in the Gulf Cooperation Council (GCC) that addresses data protection and cybersecurity. ADGM has established its own data protection regulation since 2015. It also launched the Office of Data Protection (ODP) in December 2017 and worked on enforcing regulations. On the other hand, [6] claims that Qatar, Saudi Arabia, and the UAE have recently started focusing on data protection laws and regulations. Qatar has Law No. 13 of 2016 concerning Privacy and Protection of Personal Data (PDPPL) and participated in the first Arab Regional Forum on the Protecti on of Personal Data. Likewise, Saudi Arabia has published the Personal Data Protection Law (PDPL) in Umm Al Qura (the official gazette) to develop the first step of its data development [6]. Owing to these challenges, this paper presents the privacy regulations in the Middle East and highlights the challenges and solutions that they offer in the complex contemporary landscape. Therefore, it is important to investigate the challenges and solutions that privacy regulations in the Middle East bring to companies. Such research can be useful for Middle Eastern countries in forming effective policies, enforcing laws, and ensuring that future cyberattacks are responded to with proactive approaches.

This paper highlight s the following research questions:

• What are the challenges of privacy regulations in the Middle East?

• What are the solutions provided by the privacy regulations in the Middle East?

There have been few developments and enhancements to the Middle East's existing data protection laws and regulations [7]. This is a growing concern as privacy concerns for businesses grow, resulting in trust issues and debates over how to overcome obstacles. Since data regulation in Middle Eastern countries is still in its infancy, there is little to no research addressing both the

challenges and solutions associated with data privacy in the region. This article combines both data privacy challenges and their solutions for addressing cybersecurity challenges.

2 Methodology

2.1 Context of the Study

Middle Eastern countries are having issues responding to malware, phishing attacks and challenges in social engineering [8]. One such case is the Dubai International Financial Centre, a government body that has enforced its own privacy policy, but since Dubai’s law is not as stron g as GDPR (EU General Data Protection Regulation ), the companies in Dubai that are also working in Europe must face challenges when complying with the EU regulations. Likewise, [9] claims that most of the Gulf countries have been using sharia’s principles to protect the data of their users and ensure cyber security. According to [13], the data protection legislation and regulations in the Middle East are in their infancy stage and remain a low priority in the region, where either the data protection laws are very weak or nearly non existent. However, a lot of Middle Eastern countries, such as KSA and Qatar, are working hard to introduce relevant proposals for the use of technology for data protection. According to [14], almost 71 % of the population in the Middle Eastern region went online in 2019, as compared to 39 % of the population that went digital in 2012. This brings the attention of policymakers, governmental agencies, and administrative authorities to ensure that data protection and privacy regulations are there to protect people from any unlawful or unethical activity that can damage the data recorded. In recent years, data privacy issues and related concerns have increased over time, as illustrated in Figure 1.

Figure 1: Consumer view on online privacy across the world (courtesy of [14]).

Middle Eastern region has experienced a spike in the number of security incidents (almost 133.3 %) which resulted in 2910 % of files being compromised due to no data protection [15]. At the international level, these surges contribute to 0.7 % breaches of the Middle East. Likewise, [8] reveals that UAE faced three major cyberattacks in 2016, whereas the CERT ae highlights that the UAE was victimized by malware and phishing attacks in recent years. Thus, the demand for strong and effective data protection regulations automatically emerged in the Middle East to respond to

such security issues. According to [16], both DIFC and the Qatar Financial Centre have developed their own data protection laws and regulations. These data protection laws are quite consistent with EU Data Protection Directive 95/46/EC and even the UK Data Protection Act (1998). However, both Oman and Qatar have more laws related to e commerce data protection. These include Oman’s Electronic Transactions Law (Royal Decree 69/2008) and Qatar’s Electronic Commerce and Transactions Law (Law No.16 of 2020). Both laws are based on UN Model Laws pertaining to e commerce as well as e signatures. On the other hand, [17] claims that the private companies located in DIFC are following laws enforced by a DPA. Under the DIFC law, the personal information of the individual/group is processed. The information is not shared with any international agencies or a company that does not have compliance with the laws. Exceptional cases such as any protection required from foreign agencies may necessitate sharing of information. In particular, [4] reveals that Middle East’s privacy and breach notification regulations are less strict and detailed as compared to those mentioned in GDPR.

2.2 Research Method

The present research employs a qualitative research approach as it undergoes an in depth analysis of the available privacy regulations that the Middle Eastern region is using and highlights its challenges and solutions. According to [10], the qualitative research approach is useful when study objectives are not based on scientific evidence and statistical data. Since the challenges and solutions are difficult to quantify, a qualitative study approach is used. Moreover, [11] claims that qualitative secondary research may be useful for studies where primary data is either insufficient or difficult to gather. Since gathering primary data from different countries in the Middle East is challenging, the present paper has gathered information through secondary resources. According to [12], a thematic review comprises key themes based on the study objectives. This research employs two key themes: (i) challenges of the privacy regulations in the Middle East and (ii) solutions provided by the privacy regulations in the Middle East. The main sources of data include databases such as Google Scholar, websites including Jstor, Web of Knowledge, and newspapers such as The Guardian, CNBC, The New York Times, Al Jazeera, and BBC. 15 sources that have been published in the last 7 years (2015 onwards) are used in this research paper.

3 Literature Review

Various studies have highlighted data regulation challenges that Middle Eastern countries are facing. The study by [7] claims that one of the prominent challenges Middle Eastern countries are facing is the absence of a national data protection law that could provide constitutional rights to the individuals and co mpanies working in the region. Expectations from the Middle Eastern region are high, owing to the region's growing economic importance. In another study [18], it was argued that contact tracking apps that comprise a large amount of personal data of the user, such as location, health and fitness records, are creating concerns for individuals in the Middle East.

Individuals who were aware that the regions lacked national data privacy regulations expressed dissatisfaction and concerns when using contact tracking apps during the pandemic.[19] claims that since the Covid 19 applications share data with various stakeholders such as state authorities, health ministries, and other institutions, In the absence of strict data protection laws, individuals are not comfortable sharing their information using apps [20]. This necessitates those digital solutions must be established so that they can address privacy and data security concerns. In another study by [21], it was revealed that the pandemic had increased the cybersecurity and privacy threats for the Qatar 2022 FIFA World Cup. The study by [22] also supports the fact that after the pandemic, cybersecurity threats have increased in the Middle Eastern region, which is giving rise to cyber preparedness measures prior to hosting events such as the Qatar 2020 FIFA World Cup. [23] have conducted an in depth analysis to figure out a study to identify and consider cybersecurity threats during Qatar's 2022 FIFA World Cup. The study found that Qatar is taking a proactive approach to addressing emerging cybersecurity issues. Recently, in 2021, Qatar updated these laws, including the Personal Data Privacy Protection Law [24]. The study has also revealed that Qatar is the first Middle Eastern country that has formed a policy related to data protection. Therefore, it is working at the frontline to address cybersecurity issues in the region. In [25], it was revealed that one of the issues that Middle Eastern countries such as Qatar are facing is the interference of security and privacy. Under the smart city regulation, Qatar has already shown its wider interest in overcoming data privacy challenges and regulations. On the other hand, [26] claims that Kuwait has formed a data privacy protection regulation on its official website of the Communication and Information Technology Regulatory Authority ("CITRA") to support the privacy regulation in public and private sectors. Kuwait is struggling to form a unique data protection tool that could effectively regulate the privacy and security concerns in the region

The work [27] claims that the EU’s General Data Protection Regulation (GDPR) came into action on 25 May 2018. Primarily, it replaced the EU’s legal framework that was formed in 1995 and provided a regulatory approach with new compliance obligations. GDPR follows an "omnibus approach," implying that it applies to all public and private sector organizations. In contrast to the US legal framework that provides different rules for public and private sector organizations, GDPR

Figure 2: AIG Cyber Claims Report 2018; AIG Europe, Middle East, Africa (Courtesy of [29]).

provides a comprehensive data regulation and privacy approach. [28] claims that GDPR offers applicability to companies in the Middle Eastern region without the restriction of having branches or subsidiaries in the European market. The primary reason for introducing GDPR to the Middle Eastern market is to address cyberattacks since there has been significant growth in cybercrimes (Figure 2).

The work [30] claims the regulation applies to all EU citizens and residents, even if they do not reside in the EU. There is a heavy penalty for anyone violating GDPR up to €20 million or 4% of global revenue. According to [31], the UAE has published its first federal data protection law, which incorporates the majority of the GDPR principles and regulations. The personal data, processing, and controlling techniques have all been extracted from the GDPR regulations for the UAE. According to [32], it is a common perception that GDPR is a more enforceable and effective regulation that, in comparison to the Data Protection Directive, has been robust and applicable since 2018. The Data Protection Directive in the Middle East demands compliance by companies that have a physical presence in the European Union market, such as even a small processing center or server company. However, GDPR does not restrict companies by imposing such limitations and helps businesses show compliance even if they do not have a physical presence in the European Union market. Therefore, GDPR is significant, popular, and applicable in comparison to other privacy laws that the Middle East has formed. Moreover, GDPR protects the personal data of all living beings who have a physical presence in the EU. This includes a person's personal images, contact lists, and even IP addresses [32]. Since GDPR covers such a wide range of personal information for the individual, it is extremely important and effective in protecting the individual’s right to freedom and liberty. Therefore, GDRP is popularly known as one of the leading data privacy regulations that are helping companies overcome the challenges of cybersecurity.

4 Results

In light of the literature reviews, the two key themes fulfil the research objectives and depict the following insights.

4.1 Challenges of the Privacy Regulations in the Middle East

The largest obstacle to privacy regulations in the Middle East region is that these laws offer compliance challenges to businesses. Complying with the data regulations could be a challenge for many enterprises and firms that are not yet ready for such a change. Developing a bond of trustworthiness with the clients and customers, as well as getting consent to fulfill the rights of data subjects, proves to be quite difficult for Middle Eastern companies [33]. These data regulations are still in their infancy, which implies that the systems and procedures, along with responses from firms against any actions taken by the relevant authorities (in the case of violating the laws), are still under process. In this regard, [8] has also highlighted that demonstrating the ability of enterprises to manage their data and even provide it to the concerned authorities for protection is a challenging process. It is mainly because the Middle Eastern data regulations mainly have EU GDPR

standards that demand businesses increase their investment in data protection. Likewise, managing to report breach incidents within 72 hours and deciding the leading roles for data protection and privacy are major challenges that companies in the Middle East are facing when complying with data regulations. Furthermore, there is a lack of awareness and skillset required for data regulations and data privacy among companies operating across the Middle East region [16]. In this regard, a similar perspective has been provided by [8], claiming that Middle Eastern companies must ensure compliance with the GDPR by either re engineering their information systems or developing an adequate privacy assessment and compliance procedure. Thus, this makes the information handling and management procedures quite a complex and sophisticated process that requires a high skill set from the employers.

4.2 Solutions Provided by the Privacy Regulations in the Middle East

According to [34], the Middle Eastern region is expanding business across the world, which results in data privacy issues. Most of the companies in the Middle East also have branches in other parts of the world, such as the USA and the European market. However, with the data regulations introduced by the Dubai International Financial Centre, almost 88 fines have been recorded when companies and groups violated the regulations. These regulations were effective in late 2020, and six new privacy laws were initially enforced in Dubai. These regulations were useful as they included certain extraterritorial laws, including the EU General Data Protection Regulation, and they also had an impac t on global and multi national companies. On the other hand, [33] claims that data regulations have offered countries a critical and crucial opportunity to invest in the Middle Eastern region. The compliance and relevance of certain data regulation laws (KSA and UAE) with the GDPR of the EU is offering a new solution for minimizing issues. These laws provide informational rights, corrective rights, and restrictive rights to businesses. However, the privacy impact assessment, along with assessing privacy risks, is another area that is now given importance due to the new data protection laws in the Middle East. It implies that the data regulations have given businesses and experts in the region the opportunity to consider the aspects when considering GDPR compliance [8] .

5 Discussion

The literature review and the key findings of the study reveal that data privacy and regulations are more than just the security and protection of a company’s personnel data. Data regulation can even be more complex and may require customers to provide relevant information to the company so that the data can be protected and regulated. From unwanted SMS marketing messages to share customers’ personal information with third parties, data privacy may or may not need the consent of the customer. The same is true for clients and business partners, where companies must be completely transparent to ensure that no unethical practices are carried out while data privacy regulations are in effect [35]. Although the key purpose of data privacy is to minimize cyber attacks, malware and phishing attacks, any violation of data privacy regulations may lead to financial penalties for business groups or individuals. This puts the company’s

operations, regulators, and customers at risk since any unethical data sharing activity is reported publicly. The Middle East has seen a rise in business activities and operations that reflect that any company having a wide network of third parties, customers, clients, and business partners may need data security. Typically, the UAE uses DIFC laws, and the Qatar Financial Centre has its own data protection laws [17]. Likewise, ADGM developed its own data protection regulations and even launched the ODP in December 2017. Additionally, Qatar has a Privacy and Protection of Personal Data Law (PDPPL), and Saudi Arabia enforces the PDPL for data protection. This indicates that data privacy regulations and laws are still in their infancy in the Middle East. At such a preliminary level, most of the Middle East laws comply with the EU GDPR jurisdictions [5, 6]. This creates a complex and sophisticated mechanism where companies in the Middle East must develop skill sets and roles that can compete with the GDPR rules. The data regulations have given rise to both challenges and solutions for companies and policymakers in the Middle East. One prominent trend highlighted as the challenge is personal data and information sharing with and without the consent of the customer or client. [17] claims that customers' privacy and right to freedom are threatened when companies share their personal information with third parties, especially during marketing activities. As a result, the bond of trustworthiness that is built between the customer and the client is badly affected [33]. Another challenge is investing time, money, and resources for the data regulations to be effectively enforced in the Middle East. Data regulations continue to be ineffective, from finding suitable leadership roles such as CISO, data protection officer, and senior management to developing these leaders' specific skill sets [8]. In other words, the efficiency of data regulations in the Middle East is compromised when the leaders do not have the required skillset, investment, and awareness to enforce and regulate these laws. Despite having compliance that is less strict and complex than EU GDPR, the data regulations in the Middle East can only be implemented when businesses either re engineer the information systems or develop an adequate privacy assessment and compliance procedure. [34] also highlights that the ADGM, DIFC, Qatari, and Bahraini laws for data regulation all demand data protection officers to ensure the processing and transferring of sensitive data in the region. It implies that any random employee or organization cannot be appointed to such a leading role. Thus, the leadership should have certain DPO characteristics and skillset s. Therefore, despite having data regulations in the Middle East, companies face challenges when dealing with data privacy issues. On the flip side, the data regulations have also provided an opportunity and solutions to many data privacy concerns. This includes a secure and safe business environment where the companies can conduct their international operations from the Middle East. [33] claims that with the advancement of data regulations in the Middle East, companies are thinking of using AI to act as "privacy concierges" and ensure safe data management and control. Such a system ensures that all unauthorized data transactions are automatically restricted, which saves time and resources in the data protection process. Thus, the data regulations in the Middle East have dragged the attention of policymakers,

business leaders, and experts towards new solutions and opportunities to develop strong and secure data and information handling across the region.

6 Conclusion

In light of the above findings and a review of the literature, it can be stated that the Middle East has been facing data privacy issues mainly because business has expanded in the region. The data regulations in the Middle East are still in their infancy stage, and this has created numerous challenges and opportunities for policymakers, business leaders, and experts. The key challenges that companies face when complying with data regulations in the Middle East are a high investment in terms of money, resources, and time, selecting an appropriate data protection officer with relevant skillset and expertise and ensuring that sensitive information of customers and clients is not unethically shared across various zones. On the other hand, the Middle East’s data regulations have also offered a secure and safe zone with financial penalties for any organization that violates the law. Since the Middle East data regulations are less strict than GDPR, companies can accelerate the data handling process by using AI in information handling. Thus, the privacy landscape in the Middle East is quite complex since it complies with the EU GDPR.

7 Availability of Data and Material

All information is included in this study.

8 References

[1] Data Protection Law: An overview congress. https://crsreports.congress.gov/product/pdf/R/R45631

[2] PricewaterhouseCoopers, “Navigating data privacy regulations,” PwC. https://www.pwc.com/m1/en/services/consulting/technology/cyber security/navigating data privacy regulations.html

[3] The Middle East is a growing marketplace, not just a war zone, Atlantic Council, 23 Sep 2020. https://www.atlanticcouncil.org/blogs/menasource/the middle east is a growing marketplace not just a warzone

[4] Person, “Middle East faced wave of cybersecurity threats since start of pandemic,” Arab News, 24 Oct 2021. https://www.arabnews.com/node/1953826/middle east.

[5] A. Coos, “Data Protection Regulations in the Middle East,” Endpoint Protector Blog, 09 Dec 2020. https://www.endpointprotector.com/blog/data protection regulations middle east

[6] Middle East data protection update Taylor Wessing’s Global Data Hub, Home Taylor Wessing’s Global Data Hub https://globaldatahub.taylorwessing.com/article/middle east data protection update

[7] N. Pfeiffer, C. Stead, and D. Rosu, “The rise of data protection compliance as a risk what executives in the Middle East Need to know,” White Label Consultancy, 08 Nov 2021. https://whitelabelconsultancy.com/2021/06/the rise of data protection compliance as a risk what executives in the middle east need to know

[8] G. Nandikotkur and R. Ross, “GDPR compliance in the Middle East: The challenges,” Bank Information Security https://www.bankinfo security.asia/gdpr compliance in middle east challenges a 9640.

[9] P. S. Report2020 04 28T16:19:00+01:00, “Privacy landscape in the Middle East,” GRC World Forums, 28 Apr 2020. https://www.grcworldforums.com/privacy intelligence/privacy landscape in the middle east/90.article.

[10] M. J. Coy, “Research methodologies: Increasing understanding of the world,” International Journal of Scientific Research Publications, vol. 9, no. 1, 2019.

[11] Halim, “Ranjit Kumar Research Methodology a step by step G,” Investigación Bibliotecológica: archivonomía, bibliotecología e información, 22 Jul 2017. https://www.academia.edu/33999877/Ranjit_Kumar_Researc h_Methodology_A_Step_by_Step_G.

[12] L. Lawson, S. Clegg, B. Czarniawska, G. Addidle, S. Danb y, M. C. A. Lewis, M. H. Allison, D. M. McEachern, M. S. Murray, and M. S. Figgins, “Qualitative research,” SAGE Publications Ltd, 18 Mar 2022. https://uk.sagepub.com/en gb/eur/qualitative research/book245489.

[13] Exposed and exploited: Data protection in the Middle East ...” https://gisf.ngo/wp content/uploads/2021/02/Access Now MENA data protection report.pdf

[14] Regional briefing: Consumer privacy and data protection in Middle East and North Africa https://www.consumersinternational.org/media/314598/privacy mena briefing dec2019.pdf

[15] Breach level index report privacy italia. https://www.privacyitalia.eu/wp content/uploads/2018/10/breach level index report h1 2018.pdf

[16] Data Protection and privacy issues in the Middle East, Al Tamimi & Company https://www.tamimi.com/law update articles/data protection and privacy issues in the middle east

[17] Privacy and security law report Morrison & forester. https://media2.mofo.com/documents/140428privacylawsinafricaandthemiddleeast.pdf

[18] J. Vitak and M. Zimmer, “More than just privacy: Using contextual integrity to evaluate the long term risks from covid 19 Surveillance Technologies,” social media society, vol. 6, no. 3, 2020.

[19] T. Hendl, R. Chung, and V. Wild, “Pandemic surveillance and racialized subpopulations: Mitigating vulnerabilities in covid 19 apps journal of bioethical inquiry,” SpringerLink, 2021.

[20] Peer Review #2 of ‘Data Privacy during pandemics: A systematic literature review of covid 19 smartphone applications (v0.2). 2022.

[21] H. S. Lallie, L. A. Shepherd, J. R. C. Nurse, A. Erola, G. Epiphaniou, C. Maple, and X. Bellekens, “Cyber security in the age of covid 19: A timeline and analysis of cyber crime and cyber attacks during the pandemic,” Computers & Security, 03 Mar 2021.

[22] Towards 2022 knowledge hub.” https://knowledgehub.josoorinstitute.qa/category/towards 2022

[23] N. A. L. D. Khalifa, “Identification and prevention of expected cybersecurity threats during 2022 FIFA World Cup in Qatar,” Journal of Poverty, Investment & Development, vol. 5, no. 1, pp.49 84, 2020.

[24] D. Wilkinson and M. Ooijevaar, “Data Protection, Privacy & Big Data 1,” Drone Law & Policy, pp.183 212, 2021.

[25] A. Badran, “Developing smart cities: Regulatory and policy implications for the state of Qatar,” International Journal of Public Administration, pp. 1 14, 2021.

[26] S. M. Jr, “Data protection in the Middle East 2021 regulatory round up part 4: Kuwait,” LMI Advisors, LLC Serving the unique needs of the global satellite industry., 29 Jan 2022. https://www.lmiadvisors.com/data protection in the middle east 2021 regulatory round up part 4 kuwait

[27] M. C. F. M. C; “The EU’s General Data Protection Regulation (GDPR) in a research context,” National Center for Biotechnology Information. https://pub med.ncbi.nlm.nih.gov/31314241

[28] PricewaterhouseCoopers, “EU General Data Protection Regulation: Applicability to the Middle East,” PwC. https://www.pwc.com/m1/en/publications/gdpr applicability to middle east.html

[29] Aig Care & AIG care. https://www.aig.ae/content/dam/aig/emea/uae/documents/uae documents/aig care brochure.pdf

[30] What is GDPR, the EU’s new Data Protection Law? GDPR.eu, 13 Feb 2019. https://gdpr.eu/what is gdpr

[31] UAE First Federal Data Protection Law, Global Privacy & Security Compliance Law Blog, 14 Dec 2021. https://www.globalprivacyblog.com/legislative regulatory developments/uae publishes first federal data protection law

[32] How does GDPR affect the education sector in the Middle East?, Al Tamimi & Company, 05 Jul 2020. https://www.tamimi.com/law update articles/how does gdpr affect the education sector in t he middle east

[33] S. Team, “Impact of modern privacy regulations in Middle East: 10xDS,” Exponential Digital Solutions, 20 Jan 2022. https://10xds.com/blog/modern privacy regulations in middle east

[34] B. Crew, Amid evolving privacy regulation in the Middle East, stalling on compliance is not an option, 23 Aug 2021. https://iapp.org/news/a/amid evolving privacy regulation in the middle east stalling on compliance is no longer an option

[35] PricewaterhouseCoopers, “Navigating data privacy regulations,” PwC https://www.pwc.com/m1/en/services/consulting/technology/cyber security/navigating data privacy regulations.html

Dr. Marwan Ali Albahar received his B.S. in computer science from King Faisal University, Saudi Arabia, and his M.Sc. in Computer Science with Honors from Frostburg State University, USA. Dr. Albahar received his Ph.D. from the University of Eastern Finland. Dr. Albahar a senior Information Security, Privacy, and Risk Management Professional w ith a solid technical background and a highly analytical mind. He has been involved in the information security field for the last 3+. His main areas of research are computer network security, cybersecurity, and artificial intelligence.

Dr. Mohammed Thanoon has taught several subjects in Computer Science and Computer Engineering at Umm Al Qura University and Tennessee State University. His academic research interests involve the areas of human and machine teaming, data fusion, decision making, intelligent control systems, artificial intelligence, machine learning, deep learning, federated learning, edge computing, medical image processing, computer vision, robotics, and IoT. He is certified as a "MathWorks Certified MATLAB Associate."

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

The Relationship between Physical Self-Concept and Job Satisfaction among Physiotherapists in Saudi Arabia

1King Fahad Central Hospital, Jazan, SAUDI ARABIA.

2Umm Al Qura University, Mekka, SAUDI ARABIA

3East Jeddah Hospital, Jeddah, SAUDI ARABIA

4Comprehensive Rehabilitation Center, Jeddah, SAUDI ARABIA.

*Corresponding Author (Email: Hakamy.ahmad @gmail.com).

Paper ID: 13A5R

Volume 13 Issue 5

Received 02 December 2021

Received in revised form 15 April 2022 Accepted 23 April 2022 Available online 30 April 2022

Keywords:

Job satisfaction; Physical self concept; Physiotherapist ; Job stress; Physiotherapy; Physical Self Perception Profile (PSPP); Minnesota satisfaction questionnaire (MSQ).

Abstract

Work satisfaction can be seen as a proxy for emotional or physiological health a s p hysiotherapists (PTs) were facing high levels of occupational stress which are associated with excessive exertion that physiotherapists endure in their daily work. The purpose of this study was to determine the relationship between Physical Self Concept wi th the job satisfaction among physiotherapists working in Saudi Arabia. The convenient, descriptive correlation type of study design was used. Online questionnaires Physical Self Perception Profile (PSPP) and the short form of the Minnesota satisfaction questionnaire (MSQ) were conducted through Google Form. The responses were organized in Excel and analyzed using SPSS. Demographic data (gender, age, last educational degree, total working experience, the region in which they work, and duration of working on the current job) were descriptively summarized and analyzed. Surveying 189 PTs were about their level of PSPP score (M= 65.05 and SD= 16.4) and their MSQ score (M= 69.3 and SD= 14.7). The relationship was positive, weak in strength, and statistically significant (r = 0.34, Sig < 0.05). There was a highly significant relationship between physiotherapists’ physical self concept and job satisfaction. And their job satisfaction was raised as their PSC raised moreover both male and female physiotherapists’ job satisfaction was influenced by their physical self concept.

Disciplinary: Psychology, Management

©2022 INT TRANS J ENG MANAG SCI TECH.

Cite This Article:

Hakamy, A. H. S., Kulaybi, Y. A., Salem, M. M. I., Fallatah, A. A., Alghamdi, M. A. (2022). The Relationship between Physical Self Concept and Job Satisfaction among Physiotherapists in Saudi Arabia.

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5R, 1 10 http://TUENGR.COM/V13/13A5R.pdf DOI: 10.14456/ITJEMAST.2022 102

Ahmad Hassan Sultan Hakamy1*, Yahya Abdu Kulaybi1, Mohamed Mohamed Ibrahi m Salem2, Amr Ahmad Fallatah3, Majed Abdulrahman Alghamdi4

1 Introduction

The important attribute that strongly affects competitive decisions among human s is the degree of confidence in one’s abilities. T he biases in self confidence including overconfidence can greatly affect indivi duals’ empowerment and position in society moreover eventually impacting society in different aspects. In recent years, an increase in performance has been the foundation need of what is dreamed by all people to stand out in their respective fields. Physical therapy involves evaluating, diagnosing, and treating a range of diseases, disorders, and disabilities using physical aspects. Employment opportunities for physiotherapists (PTs) are tremendous as it is a career where the demand exceeds supply. Physiotherapy is a profession that can be highly stressful with personal and/or work related factors adding to the pressure and influencing job satisfaction among physiotherapists [10].

Saudi Arabia (SA) is one of the fastest growing economies in the world over the past few decades and has witnessed enormous growth and change, with diseases of civilization, road traffic accidents, and increasing age, growing the demand for physiotherapists will provide services. Physical therapy has been identified as the most important branch of the health care profession in Saudi Arabia. Moreover, it constitutes the maximum number of staff working in the rehabilitation sector, out of which around 80% are employed by the government in hospitals [4]

The study aims to determine the relationship between the PSC and the job satisfaction among PTs working in Saudi Arabia and the daily work of PTs puts considerable strain on the articular, skeletal, and muscular syste ms, which are associated with excessive exertion that PTs endure in their daily work. PTs as autonomous practitioners, often working in a multidisciplinary health care environment, also encounter unique and complex ethical challenges like incompatibility o f available resources and patient needs [24] and unethical behavior of PTs or other professionals, and realization of patients’ self governance [27]. Also, a close physical and emotional correlation between the patient and PTs creates specific ethical issues [30], such as how to maintain however, the high level of professional competence among these professionals does not translate into an adequate salary. The lack of a well defi ned range of responsibilities contributes to PTs less frequently declaring sati sfaction with their work. [33].

PSC is a person’s perceptions of himself/herself formed through experience with and interpretations of his/her environment related to his/her physical domain [32] or it can be defined as self perceptions about one’s physical self and considered a significant antecedent of motivation, behavioral engagement and mental health outcomes in exercise . settings. PSC is deemed essential for realizing human potential [12] and develops by internalizing experiences in one’s social environment [29].

Much of the self concept literature has reported developments within the realm of academics. However, it is important to explore the non academic facets of self concept as well. For this study, in particular, the relationship between self concept and work related involvement is

important. It has been proven that as an individual develops, facets of self concept become increasingly independent [28].

Job satisfaction and morale among medical practitioners are a current concern worldwide [23]. It is one of the central variables in work and organizational psychology and is seen as an important indicator of working life quality [15]. Behavioral and social science research suggests that job satisfaction and job performance are positively correlated [7]. Satisfied employees tend to be more productive and creative. Job demands and job control have been reported to have several interactive effects on employee wellbeing and health in specific occupational groups [14]. Job satisfaction is defined as the degree to which individuals feel positive or negative about their jobs [31]. It is a multidimensional response toward the work and workplace environment and improves positive energy and performance [6] moreover Job sati sfaction can affect the behavior of employees that, in turn, affects organizational functioning [5]. As per Aldermen. et al humans have three sets of basic needs includ ing existence, relatedness, and growth. If attempts to satisfy needs with high priority are not fruitful, then the individual will focus on his demands that initially had a lower priority, which can lead to frustration and dissatisfaction. A few factors like autonomy, pay, task demands, and organizational policies are also known to have a significant effect on job satisfaction [19]. Satisfaction at work is also inversely associated with absenteeism, turnover in an organization, level of stress, and eventual exhaustion that ultimately improves productivity [1] A review of existing literature provides the relationship between self concept in sports and academics. Up to our knowledge, the prevalence of PSC in PTs and its relation to job satisfaction needs to be determined. Therefore, this study tried to explore the relationship of PSC with the job satisfaction in PTs working in SA If the results indicate that there is any relationship between the PSC and job satisfaction among PTs, then this study will obtain some useful information being assisted for all officials, managers and seniors regarding PSC and the degree of job satisfaction among PTs. The purpose of this study was to determine the relationship between PSC and job satisfaction among PTs working in SA. This study showed that there was a correlation between PSC and job satisfaction among PTs working in SA.

2 Methodology

A convenient, descriptive correlation type of study design was used in this study to test expected relationships among variables. This design aims to provide a sufficiently complete description of what is happening at a particular time. A non probability sample of the different hospitals and clinics working physiotherapist s (20 25 years) in Saudi Arabia were recruited to fulfill the required sample size is 189. The eligible candidates were given the consent form through mail or social media in the form of a Google Form. All descriptive variables of all subjects were recorded.

Inclusion Criteria

Sex: Healthy male/female PTs of ages 25 to 50 years. PTs working in SA.

A Subject who will agree to fill the informed consent.

Exclusion Criteria

A Subject who will not be agreeing to fill the informed consent. PTs work for different professionals.

2.1 Tools and Measuring Method

The ques tionnaire of PSC (Physical Self Perception Profile] (PSPP] and Job satisfaction questionnaire (Short form of Minnesota satisfaction questionnaire] (MSQ] with 20 item were applied to gather the related data. Both of these questionnaires and informed consent were mailed to PTs working in different hospitals and clinics in SA. The filled forms were collected for data analysis.

2.2 Physical Self Perception Profile (PSP P)

PSPP is a multidimensional 30 item self report instrument measuring an individual’s PSC. It features 4 domain specific subscales assessing perceived spor t competence (SPORT ), body attractiveness (BODY) , physical condition (CONDITION ), and physical strength (STRENGTH ), and one subscale that asses ses a global perception of overall physical self worth (PSW ). A 4 choice structured alternative item format is used with 6 items per subscale. [18]

3 Results and Discussion

Statistical analyses will provide an explanation of the relationship between demographic characteristics of the patient as well as the Physical Self Concept and Job Satisfaction All statistical analyses were conducted by using IBM SPSS Statistics version 21. Data will be presented as descriptive analysis; frequencies, percentages and mean ± standard deviation. It is expected that the result of this study will add a base of body knowledge regarding Physical Self Concept and Job Satisfaction among physiotherapists in SA.

Table

Table 3: frequency and distribution of duration of present job

Duration of present job No 5 ≤ 92 6 to 1o 65 10 ≥ 32

Table 4: frequency and distribution of region Region No. North 14 East 11 West 32 South 117 Middle 15

NORTH EAST WEST SOUTH MIDDLE

Figure 3: Duration of present job

Table 5: frequency and distribution on total work experience

Total work experience No. ≤ 5 113 6 to 10 61 ≥ 10 15

Figure 4: Region.

Table 6: frequency and distribution on post Post No. Senior 107 Junior 82

Figure 5: Total work experiences.

Figure 6: Post

Table 7: frequency and distribution on age of therapist Age No. 25 30 79 31 35 68 36 40 35 40+ 7

Figure 7: Age of therapist.

Table 8: Mean and SD of PSPP score and MSQ Scores.

PSPP Score in % MSQ Score in % Mean SD Mean SD

Female (28) 67.2 ±19.0 69.5 ±17.4

Male (161) 62.9 ±15.8 69.1 ±14.2

Total (189) 65.05 ±16.4 69.3 ±14.7

Tables 1 7 and Figures 1 7 show details of PTs who participated in this study. Some researchers support the relationship between self concept and performance in sports. Results of the present study showed a significant positive correlation between PSC and job satisfaction among the PTs working in SA. Positive levels of self confidence led to higher subsequent levels of PTs’ performance. In other words, because PTs understand their body, psychological factors such as self esteem and sense of achievement are high. It is similar to the study of [11]. PSC includes the persons’ attitude toward their body dimensions and lack of proper perception of the PSC has been linked to physical, mental, and social disorders. Tabiee et al. [35] found that athletic performance improves the physical self esteem and self esteem of students. Therefore, health system policymakers can promote the necessary facilities for expanding the culture of physiotherapy activities and also create an environment with sufficient facilities in the different physiotherapy departments.

PSC is generally regarded as a feminine feature. The relationship between physical appearance and self esteem shows extremely robust across both gender and age [22] the current study showed that female PTs have high PSPP scores than that male PTs. [16]and both males and females have almost the same score in self concept.

PTs are exposed to physical strains in their profession. Working in a forward bending posture and repetitive hand movements involving physical effort represent typical strains on PTs. As confirmed by [19] these appear to have been provoked by awkward body postures: 55% of PTs surveyed stated that they often had worked in the position of forwarding bending and also torso at an angle of 45° to 90°, which can lead to musculoskeletal problems in the posterior part.[13] , found that 17% of PTs changed their specialism or even their profession on account of musculoskeletal diseases. Stress will lead to people’s psyches and satisfaction with life [21] ad can lead to work related musculoskeletal diseases or to a change in the workplace [9]. The results of this study show that nearly 70% of PTs surveyed were satisfied with their jobs as a whole. This is a good percentage and agreed with the findings of other studies that also found a high level of job satisfaction among PTs [34]. the PTs tend to belong to the group of active workers. This is an important factor for a high level of job satisfaction. The demands on PTs have to work quickly, unevenly distributed work that mounts up because sometimes less than 15 minutes were needed to complete all tasks which include documentation. This can also be a reason for less job satisfaction.

A relaxed and collegial work climate makes a substantial contribution to employees’ health. Professionals discussing their ideas with colleagues about difficult cases or new techniques also help in solving stressful problems and one’s self esteem in respect of one’s own professional

competence Setbacks can also affect the self esteem and self belief of PTs. In some, it can be a catalyst encouraging them to do better and better. While in others, it can start to affect their performance. Psychological strength is an important factor for PTs, but psychological weakness can also determine how PT performs on the day. Being under prepared can affect their ability and cause stress or anxiety, and further, it can lead to poor job satisfaction. Mental strength is not enough to compensate for lack of skill, but if physical skills are matched, PTs with the strongest control over their own mind will usually be the winner. Previous researchers in self concept theory suggest that a positive self concept has self enhancing effects including increases in future motivation [17]. The overall mean and SD of PSPP Score statistics show that female PTs have more scores as compared to that male PSPP Score and total PSPP Score. The overall mean and SD of MSQ Score statistics show that both male and female PTs have almost the same score.189 PTs were surveyed about their Level of PSPP score (M= 65.05, SD= ±16.4] and their MSQ score (M= 69.3, SD= ±14.7 ]. The relationship was positive, weak in strength, and statistically significant (r = 0.34, p< 0.05). A complete list of correlations is presented in Table 9.

Table 9: Correlation between PSPP Score and MSQ Score

MSQ Score in %

PSPP Score in % Pearson Correlation 0.34 Sig. (2 tailed) 0.000* N 189 Correlation is significant at the 0.05 level (2 tailed).

A similar study can be conducted on a large sample for better generalization of findings and can be choosing a different kind of diagnosis seeking physiotherapy. Health organizations must develop job satisfaction strategies to combat this . Most of the reviewed literature pointed to the importance of ensuring an adequate level. For future research, different measuring instrumentation may be necessary. There are several alternative methods for measuring the current study’s variables. PSPP is one way of many ways that PSC can be measured. Although the scale’s reliability and validity are well established, there was one issue of concern throughout the study. The questionnaire is a 4 choice structured alternative item format. This was a cause of confusion to a majority of the subjects and required the researcher to administer additional verbal instruction. While this scale was chosen for its length (only 30 items), a questionnaire with a Likert scale response format might produce less confusion for the participants.

4 Conclusion

This study’s findings indicate significant links between PSC, and job satisfaction among PTs. However, the research techniques used in this study are only an initial step for the research in this field. Alterations should be considered to find more specific and expounding results. The result of the present study showed more significance and it indicate s there was a relationship between PTs’ PSC and job satisfaction.

5 Availability o f Data and Material

Data can be made available by contacting the corresponding author.

6 Acknowledgement

We are great full to ALLAH , for being the kindest and most merciful in helping me to achieve this work and we would like to extend our gratitude to Umm Al Qura University and our supervisor for his commitment and support in the succession of this research. Through his supervision, guidance , and encouragement we could always accomplish my research goal. We appreciated your insights and contributions that lead to the completion of the work. Also, we would like to extend our gratitude to all the hospitals and clinics in Saudi Arabia for providing permission to complete the research

7 References

[1] Aazami, S., Shamsuddin, K., Akmal, S., & Azami, G. (2015). The relationship between job satisfaction and psychological/physical health among Malaysian working women. The Malaysian journal of medical sciences MJMS, 22(4), 40.

[2] Al Maghraby, M. A., & Alshami, A. M. (2013). Learning style and teaching method preferences of Saudi students of physical therapy. Journal of family & community medicine , 20(3), 192.

[3] Alderfer, C. P. (1972). Existence, relatedness, and growth: Human needs in organizational settings. New York: Free Press.

[4] Alghahtani, A.; Barhameen, A.; AbuAbat, A. (2007). Saudi Strategic Plan for Rehabilitation Services; Saudi Ministry of Health: Riyadh, Saudi Arabia, pp.54 55.

[5] Bakotic, D. (2016). Relationship between job satisfaction and organisational performance. Economic research Ekonomska istraživanja , 29(1), 118 130.

[6] Bhatnagar, K., & Srivastava, K. (2012). Job satisfaction in health care organizations. Industrial psychiatry journal, 21(1), 75.

[7] Bowron, J. S., & Todd, K. H. (1999). Job stressors and job satisfaction in a major metropolitan public EMS service. Prehospital and disaster medicine , 14(4), 32 35.

[8] Campo, M., & Darragh, A. R. (2010). Impact of work related pain on physical therapists and occupational therapists. Physical therapy, 90(6), 905 920.

[9] Campo, M., Weiser, S., Koenig, K. L., & Nordin, M. (2008). Work related musculoskeletal disorders in physical therapists: a prospective cohort study with 1 year follow up. Physical therapy , 88(5), 608 619.

[10] Campo, M. A., Weiser, S., & Koenig, K. L. (2009). Job strain in physical therapists. Physical therapy, 89(9), 946 956.

[11] Chomitz, V. R., Slining, M. M., McGowan, R. J., Mitchell, S. E., Dawson, G. F., & Hacker, K. A. (2009). Is there a relationship between physical fitness and academic achievement? Positive results from public school children in the northeastern United States. Journal of School Health , 79(1), 30 37.

[12] Craven, R. G., & Marsh, H. W. (2008). The centrality of the self concept construct for psychological wellbeing and unlocking human potential: Implications for child and educational psychologists. Educational and Child Psychology , 25(2), 104 118.

[13] Cromie, J. E., Robertson, V. J., & Best, M. O. (2000). Work related musculoskeletal disorders in physical therapists: prevalence, severity, risks, and responses. Physical therapy, 80(4), 336 351.

[14] De Jonge, J., Bosma, H., Peter, R., & Siegrist, J. (2000). Job strain, effort reward imbalance and employee well being: a large scale cross sectional study. Social science & medicine, 50(9), 1317 1327.

[15] Dormann, C., & Zapf, D. (2001). Job satisfaction: A meta analysis of stabilities. Journal of Organizational Behavior, 22(5), 483 504.

[16] Fahim T, Saharan AK, Mahajan R et.al. (2020). The relationship of physical self concept with competition anxiety of young wrestlers. Int J Health Sci Res, 10(6):46 51.

[17] Ferla, J., Valcke, M., & Cai, Y. (2009). Academic self efficacy and academic self concept: Reconsidering structural relationships. Learning and individual differences, 19(4), 499 505.

[18] Fox, K. R., & Corbin, C. B. (1989). The physical self perception profile: Devlopment and preliminary validation. Journal of sport and Exercise Psychology , 11(4), 408 430.

[19] Gautam, M., Mandal, K., & Dalal , R. S. (2006). Job satisfaction of faculty members of veterinary sciences: an analysis. Age, 36(5.91), 0 92.

[20] Andreas, G. W. J., Wernstedt, P., & Campo, M. (2011). Work related musculoskeletal disorders in female Swedish physical therapists with more than 15 years of job experience: prevalence and associations with work exposures. Physiotherapy theory and practice , 27(3), 213 222.

[21] Harris, L. M., Cumming, S. R., & Campbell, A. J. (2006). Stress and psychological well being among allied health professionals. Journal of allied health , 35 (4), 198 207.

[22] Hart, E. A., Leary, M. R., & Rejeski, W. J. (1989). Tie measurement of social physique anxiety. Journal of Sport and Exercise Psychology, 11(1), 94 104.

[23] Huby, G., Gerry, M., McKinstry, B., Porter, M., Shaw, J., & W rate, R. (2002). Morale among general practitioners: qualitative study exploring relations between partnership arrangements, personal style, and workload. Bmj, 325(7356), 140.

[24] Hudon, A., Drolet, M. J., & Williams Jones, B. (2015). Ethical issues raised by private practice physiotherapy are more diverse than first meets the eye: recommendations from a literature review. Physiotherapy Canada , 67(2), 124 132.

[25] Karasek Jr, R. A. (1979). Job demands, job decision latitude, and mental strain: Implications for job redesign. Administrative science quarterly, 285 308

[26] Kelly, L.H, (2004). The relationship between physical self concept, body image dissatisfaction and competitive anxiety in female “Aesthetic” and “non aesthetic” collegiate athletic. MA Dissertation in edu cational psychology and learning systems. United states: Florida state university. http://etd.lib.fsu.edu/theses/available/etd 04072004 162144.

[27] Kulju, K., Suhonen, R., & Leino Kilpi, H. (2013). Ethical problems and moral sensitivity in physiotherapy: a descriptive study. Nursing Ethics, 20(5), 568 577.

[28] Marsh, H. W., & Shavelson, R. (1985). Self concept: Its multifaceted, hierarchical structure. Educational psychologist, 20(3), 107 123.

[29] Marsh, H. W., Martin, A. J., & Jackson, S. (2010). Introducing a short v ersion of the physical self description questionnaire: new strategies, short form evaluative criteria, and applications of factor analyses. Journal of Sport and Exercise Psychology , 32(4), 438 482.

[30] Poulis, I. (2007). Bioethics and physiotherapy. J Med Ethics; 33, 435 436.

[31] Schermerhorn, JR (2010). Organizational Behavior. 11th Ed , New York, Wiley, 672p.

[32] Shavelson, R. J., Hubner, J. J., & Stanton, G. C. (1976). Self concept: Validation of construct interpretations. Review of educational research , 46(3), 407 441.

[33] Śliwi ń ski, Z., Starczyń ska, M., Kotela, I., Kowalski, T., Kryś Noszczyk, K., Lietz Kijak, D., & Makara Studzi ń ska, M. (2014). Burnout among physiotherapists and length of service. International journal of occupational medicine and environmental health , 27(2), 224 235.

[34] Speakman, H. G., Pleasant, J. M., & Sutton, G. B. (1996). The job satisfaction of physical therapists. Physiotherapy Research International, 1(4), 247 254.

[35] Tabiee, S., Vagharseyyedin, S. A., Salmani Mud, M., & Hosseini, M. (2018). Relationship of physical self concept and athletic performance in male medical students in Birjand University of Medical Sciences. Journal of Birjand University of Medical Sciences, 25(01).

[36] Takeuchi R, O’Brien M, Ormond K, Brown S, Maly M. (2008). “Moving Forward”: Success from a physiotherapist’s point of view. Physiotherapy Canada , 60(1):19 29.

[37] Van Maele, D., & Van Houtte, M. (2011). The quality of school life: Teacher student trust relationships and the organizational school context Social indicators research , 100(1), 85 100.

[38] Weiss, D.J., Dawis, R.V., England, G.W., &amp; Lofquist, L.H. (1967). Manual for the Minnesota Satisfaction Questionnaire . Minnesota Studies in Vocational Rehabilitation,22.

Ahmad Hassan Sultan Hakamy is a Senior Physiotherapist working at the Medical Rehabilitation Center in King Fahad Central Hospital of Jazan. Saudia Arabia, He is interested in the continuous development of related to Medical Rehabilitation and Scientific research for Orthopedic cases.

Yahya Abdu Kulaybi is a Senior Physiotherapist working at the Medical Rehabilitation Center in King Fahad Central Hospital of Jazan. Saudia Arabia is interested in the continuous development of related to Medical Rehabilitation and Scientific research for Orthopedic cases.

Dr.Mohamed Mohamed Ibrahim Salem is Professor, Colle ge of Applied Medical Sciences, Um m Al Qura and professor in Colle ge of Physical Therapy, Cairo University He is interested in Sports Injuries and Orthopedic Diseases with special focus on Shoulder and Knee Region io Develop new Diagnosticoolsn Order Tools and interested in understanding the Biomechanics and Pathomechanics of Different Body Regions

Amr Fallatah is a Senior Physical Therapy Specialist in the Department of Physical Therapy at East Jeddah General Hospital. Fallatah’s researches focus on the field of Musculoskeletal and Sports Medicine.

Majed

Alghamdi is a Senior Physical Therapy Specialist at Comprehensive Rehabilitation Center in Jeddah.

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

Large-Scale Laboratory Modeling of the Performance of the Stone Column Group in Improving the Behavior of Sandy Soils

Reza Naderi1 , Ali Yousefi Samangani2*

1Faculty of Civil & Architectural Engineering, Shahrood University of Technology, Shahrood, IRAN.

2Civil Geotechnics Group, Shahrud Industrial University, IRAN.

*Corresponding Author (Email: r_naderi@shahroodut.ac.ir).

Paper ID: 13A5S

Volume 13 Issue 5

Received 24 December 2021 Received in revised form 15 April 2022

Accepted 25 April 2022 Available online 02 May 2022

Keywords: Stone column group; Sandy soil; Load carrying capacity; Soil load settlement behavior; Geometric arrangement; Single stone column.

Abstract

One of the efficient methods to improve soil behavior is the use of stone columns. Due to the high volume of studies on the performance of single Stone columns, in this study, we will seek to investigate the performance of group Stone columns in improving the behavior of sandy soils. Sandy soils, especially in coastal areas, due to the lean mechanical properties of the soil, have always been considered an unsuitable soil sample in the design and the need for improvement in this type of soil is urgently needed. Therefore, in this article, by using stone columns as a group, we will seek to improve the behavior of sandy soil. How to arrange the stone columns (square, triangular arrangement) and the diameter of the stone columns (60, 80 and 120 mm) are the main variables in this article. In all models, the length to diameter ratio is considered equal to 5. The load carrying capacity and soil settlement have been investigated for different modes of stone column arrangement in the laboratory environment as superimposed load. The results obtained from the article show that the arrangement of the stone column in a triangular and square shape can increase the soil load carrying capacity by 31.8 and 37.5%, respectively. This incremental trend is more noticeable in the square arrangement. Also, based on other results of this article, it was observed that by increasing the diameter column parameter and increasing the diameter equivalent of the stone column group, we will see an improvement in the performance of t he stone column group in increasing the sandy soil load carrying capacity.

Disciplinary: Civil Engineering (Geotechnical Engineering)

©2022 INT TRANS J ENG MANAG SCI TECH.

Cite

This Article:

Naderi, R., Samangani, A.Y. (2022). Large Scale Laboratory Modeling of the Performance of the Stone Column Group in Improving the Behavior of Sandy Soils. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5S, 1 13. http://TUENGR.COM/V13/13A5S.pdf DOI: 10.14456/ITJEMAST.2022 103

Introduction

Soil improvement is a process in which an increase in soil quality is observed. In other words, in the process of soil improvement, mechanical and resistance parameters, the soil increases. In different conditions, according to the characteristics of the earth for the construction of the structure and also according to the time and economic factors, the optimal method for improving feeble soil can be selected. Currently, the stone column method is implemented in a wide range of soil types, especially feeble soils. As a simple and complete definition of a stone column, it can be said that the replacement of a part of feeble soil by compacted vertical columns consisting of aggregate in a regular and completely permeable set in the soil layers is called stone or sand columns. Stone columns, as one of the suitable options, to improve the load carrying capacity of loose, cohesive and aggregate soils, which in addition to reducing soil settlement , is an effective, economical and environment friendly method in structures built on Soil is also considered. Due to the actual damage and casualty caused by the construction of various buildings on feeble soils, the importance of developing improved methods i n feeble and unsuitable soils is essential. Moreover, sandy soils are always considered as an example of unsuitable soil in design. The use of stone columns as an environmentally friendly method is one of the most common methods of soil improvement in cohe sive and non cohesive soils . In this method, the stone column replaces part of the feeble soil. This method is based on replacing 15 to 35% of feeble soil volume , which is done by shaft sinkings with a certain diameter, depth and distance from each other and filling the wells with sand or gravel. Accordingly, group stone columns are mainly Square arrangements or Triangle arrangements (Figure 1).

Figure 1: Display the square and Triangle arrangement of stone columns in the present article

In a triangular arrangement, the number of stone columns in a fixed surface area is more than in the square arrangement In triangular and square arrangements, the loading surface of each column (A) will be regular and square hexagons, respectively [1]. From the point of view of seismic geophysical engineering, stone columns are mainly used for reduction and lateral expansion effects in granular soils [2]. It is necessary to pay attention to the fact that the main application of stone columns is in fine grained soils with a high fine grained percentage. In non cohesive soils, the presence of stone columns increases the soil loading capacity. Also, in conditions where the soil mass is considered, the presence of a stone column, due to the reduction of soil porosity, will

reduce the soil liquefaction. In general, stone columns can increase load carrying capacity, reduce settlement, increase effective soil stress and create drainage conditions. Laboratory studies and numerical loadings have shown that the main reason for improving the soil behavior reinforced with stone columns is the higher stiffness of the stone column compared to the stiffness of the surrounding soil [3]. In saturated and non cohesive soils, the pore water pressure increases rapidly and may be such that the particles are suspended separately from each other and for a moment the strength and stiffness of the soil are completely lost. The most effective way to deal with displacement and settlement in saturated sands is to use stone columns.

2 Review

The stone column was first proposed by Wei Hu [4] in 1995. In this study, the behavior of a reinforced soft clay soil sample with a set of stone columns is studied and tested and the collapse real mechanism and collapse of stone columns with a rigid circular base and by performing a series of controlled experiments, vertical loading has been investigated in vitro. Based on the results of this article, the length to diameter ratio of about 6 is introduced as the critical length of the stone column in the design [4]. Bae et al. [5] reviewed a laboratory model of a group of stone columns and while comparing the results with the results of the numerical finite element model, reported the coordination and agreement between the results.

Andrew and Papadopoulos [6] studied the effect of load carrying capacity, area ratio, internal friction angle and undrained shearing strength on the horizontal displacement of a stone column in cohesive soil. The column was subjected to extensive loading through a rigid foundation and was modeled using the single cell concept. They use an axial symmetric finite element analysis while using the Mohr Coulomb criterion for columns and soil, they examined the effect of the variables on the improved ground. Jahromi et al. [7] evaluated the loading indicators of soft ground s improved with the stone column group. In this study, various factors such as stone column area ratio, material strength and resistance and mechanical specification of the stone column and soil at the group scale have been studied and evaluated to determine the impact of these factors on the design and improvement of soft grounds. The results of this study clearly show that factors such as modulus of elasticity and internal friction angle of the stone column material as well as the Poisson’s ratio of soil around the stone column, have a significant impact on increasing the load carrying capacity of soil improved by the method presented in this study. Castro [8] studied a series of two dimensional and three dimensional finite element analyses to evaluate the performance of a group of stone columns under a rigid foundation.The results of this research showed that the number and arrangement of stone columns have the least effect on changes in the load settlement curve.He also showed that in order to estimate the reduction of settlement and the critical length of stone columns, the group of stone columns located under the foundation can be replaced with a stone column with an equivalent surface in the center of the foundation. Meshkin Ghalam et al. [9] studied a numerical investigation of the impact of stone columns. The results of this study showed that by increasing the distance from the center to the center of the columns, the effect of the group

in reducing the overpressure of the pore water pressure. At a certain number, as the distance between the columns decreases, the soil swelling increases. For the distance from the center to the center of the columns 2.5 to 3.5 times the column diameter, the column group performs better in reducing settlement. By applying a superimposed load, in the model with the column group in a circular range with an approximate radius equal to the distance from the center to the center of the columns, the settlement is significantly reduced compared to the column less mode. Haji Azizi and Nasiri [10] conducted a laboratory study on the effect of bond area on the earthen sustaining slopes with stone columns. Laboratory results and numerical analysis obtained from this study showed that 5% of cohesive fine grained soil has a great effect on increasing the slope stabilization of reinforced stone columns . The results obtained from numerical analyzes show good coordination with laboratory modeling. Lajevardi et al. [11] conducted a laboratory study of singular and group stone columns confined in geotextiles. In this study, single and group stone columns in two normal modes with geotextile coating were studied in the laboratory. Singular stone columns with a diameter of 63 and 80 mm with a length to diameter ratio of 5 have been loaded. The results show that the load carrying capacity of the column is increased by placing a geotextile coating around it. In the following, the stone columns with a diameter of 63 mm were tested in groups in different arrangements and their load carrying capacity was compared with each other.The results of this study show, that with increasing the diameter of a singular stone column, its load carrying capacity has decreased and in loading on singular and group stone columns, the placement of adjacent columns has increased the load carrying capacity of the samples by 6.3% and 8%, respectively. Also, based on the results of this study, it was found that the load carrying capacity of group columns with two triangular and square arrangements has a difference of 5% from each other. Dinarvand and Ardakani 2018 [12] in a study to investigate the behavior of granular columns enclosed with geosynthetics in silty sand soil under a direct shear test. In this study, the effect of factors such as fine grained soils, normal stress , the effect of the granular column group and the granular of the column material on the passive resistance of the soil and granular column set has been investigated. In the present study, large scale laboratory studies have been performed to evaluate the performance of stone column groups in improving sandy soil behavior. In this regard, the effect of the presence of stone columns, the effect of the type of triangular or square arrangement of stone columns and the effect of the diameter of the stone column on the load carrying capacity of sandy soil have been investigated. Therefore, after making the test box, the various modes studied were performed in the laboratory environment and the samples were exposed to lateral loading.

3 Laboratory Studies

3.1 Testing ( Box ) Machine

Due to the fact that in this research, large scale laboratory modeling is considered, it is necessary to make the dimensions of the experiment clear. Therefore, in order to perform

experiments on group stone columns with the desired arrangement, it is necessary to make the necessary equipment to perform the experiment. For this purpose, equipment including a large metal box was made as a simulated earthen bed with dimensions of 111 * 111 * 95. It should be noted that after making the device with the desired dimensions and considering that the wedge created under the foundation is spread to a distance of about 2 to 2.5 times the width of the foundation from the center of the foundation to the surrounding area, the border conditions on The results of large scale experiments will not be effective. Figure 2 shows the built in test box. Other equipment required for laboratory studies including a loading plate, displacement sensors, dynamometer and the hydraulic jack can be seen in Figure (3). In this study, in order to apply load on group stone columns, a circular steel loading plate has been used. A hydraulic jack with a maximum capacity of 3 tons is applied to the center of the loading plate and two displacement sensors record the amount of displacement recorded on the steel plate. Also, by installing a dynamometer sensor, at the point of contact of the jack with the steel plate, the amount of force applied to the steel plate can be controlled and measured

3.2 Construction of Stone Columns

There are different methods for making stone columns. In this study, a plastic sheath (thin walled pipe) with diameters of 60, 80 and 120 mm was used to make stone columns. During the construction of the model, at each stage, according to the specific gravity of the column, the required sand was poured into the pod and compacted. At this stage, the sand was granulated. Figures 3 and 4 show the sand granulation curve and the details of the stone column construction, respectively. Specific gravity, internal friction angle, modulus of elasticity and specific gravity of sand used to make stone columns are 16 kN / m2, 41°, 100 MPa and 2. 6 kg/m3 , respectively. It should be noted that after the installation of each of the stone column pipes, the soil inside the stone columns is removed by Oger and the space inside the pipes is filled with sand

Material

The soil studied in this study is sandy. Therefore, the stone columns surrounded by sand have been installed and tested. The characteristics of the studied sand can be seen in Table (1).

Table 1: introduce properties of sandy soil used in this study Parameters Value

Dry specific weight 16 kN/m2

Saturated specific weight 18 kN/m2

Dry internal friction angle 40 degree Saturated internal friction angle 36 degree Adhesion 0

Elasticity module 40 Mpa

Specific density 2.65 Poisson’s ratio 0.3 Max porosity ratio 0.6 Min porosity ratio 0.3

3.4 Introduction of Studied Laboratory Models

The models studied in this study are classified and named based on the studied variables. Therefore, the models are introduced based on the arrangement and diameter of the stone columns, according to Table (3). The main variables in this study are : Diameter of stone columns (d): The diameter of stone columns has been used as one of the variables in three values of 60,80 and 120 mm

Length to diameter ratio of stone column (L / d): This parameter is considered 5. According to the proposed diameters, the length of the stone columns will be in the form of a table (2).

Layout of stone columns: Stone columns have been studied and evaluated as a group in two categories of 3 (with triangular arrangement) and 4 (with square arrangement) .

Table 2: stone column length L/d=5 D (mm) 300 60 400 80 600 120

According to the introduced variables, 6 different modeling modes (1 * 2 * 3modes) have been studied, which are introduced in Table (3). It should be noted that the loading on the samples continued until the soil settles to the extent of 50 mm. All tests were performed under controlled displacement and at a constant rate of 2 mm/ min. To ensure the accuracy of the results, all experiments were performed twice and the results were compared with each other .

Table 3: Introducing the studied modes

Row Abbreviation Stone column diameter (mm) Stone column length (mm) Geometric of arrangement

1 SC60 300 3 60 300 Triple 2 SC60 300 4 60 300 Square 3 SC80 400 3 80 400 Triple 4 SC80 400 4 80 400 Square 5 SC120 600 3 120 600 Triple 6 SC120 600 4 120 600 square

Experimental Results

The effect of stone columns in single and group mode with two triangular and square layouts on soil loading capacity has been evaluated and analyzed. Therefore, the settling load curve for sandy soil without stone columns, sandy soil improved using a single stone column, san dy soil improved by using three stone columns in a triangular arrangement, and sandy soil improved by using four columns A stone is obtained in a square arrangement. Also, in order to investigate the effect of the diameter of stone columns on soil loading capacity, the results for stone columns with three diameters of 60, 80, and 120mm in both triangular and square layouts have been analyzed. In the following, we will examine the effect of the presence of the stone column, the diameter of the stone column and the geometric arrangement of the stone column on the loading capacity of sandy soil

4.1 The Effect of Stone Columns on the Loading Capacity of Sandy Soil

According to Figure 5, the presence of stone columns in sandy soils has increased the loading capaci ty of the soil. In a way, the use of a single stone column has increased the loading capacity of sandy soil by 29.7% compared to the case of not using a stone column. Also, the comparison of the performance of the group of three stone pillars in comparison with the single stone pillar shows that the use of three stone pillars with a diameter of 60 mm has increased the loading capacity of the soil by 318%. Figure (6) shows the effect of the arrangement of a group of 4 stone columns on the settlement load curve of sandy soil. In this figure, it is observed that the use of the arrangement of 4 stone columns with a diameter of 60 mm, has increased the loading capacity of sandy soil by 37.5% compared to the case of using a single stone column. It can be seen that the presence of stone columns in the sandy soil bed has increased the loading capacity of the soil. This upward trend is more noticeable with the increase in the number of stone columns participating in the group of stone columns.

Figure 6: Comparison of load settlement behavior of sandy soil with various stone column arrangements.

Figure 7: Comparison of load settlement behavior of stone column with single and square arrangements.

4.2 Effect of Stone Column Diameter on Sandy Soil Loading Capacity

To investigate the effect of the diameter of stone columns on the loading capacity of sandy soil, a group of stone columns consisting of single stone columns with diameters of 60,80 and 120 mm with two triangular (triple) and square (quadruple) arrangements was tested. Figure (7 ) shows the load settlement curve of the group of stone columns with a triangular arrangement with three different diameters. It can be seen that increasing the diameter of the stone column has increased the final loading capacity of the sandy soil. So that the use of stone columns with a diameter of 80 and 120 mm, compared to a diameter of 60 mm in a triangular arrangement has increased the soil loading capacity by 15.4 % and 24.1%, respectively. Also, in Figure (8) the effect of changes in the diameter of stone columns on the loading capacity of sandy soil with a square arrangement is investigated. The results show that the use of the square arrangement of stone columns with a diameter of 80 and 120 mm compared to stone columns with a diameter of 60 mm, respectively, increased the loading capacity of sandy soil by 22.5% and 30%, respectively.

Figure 8: Effect loading capacity of sandy soil with triangle arrangement

Figure 9: Effect square arrangement

4.3 The Effect of Geometric Arrangement of Group of Stone Columns on the Loading Capacity of Sandy Soil

To investigate the effect of the geometric arrangement of the group of stone columns (with fixed column diameters), the settlement load diagram for three diameters in two triangular and square layouts was examined. According to Figures 9 to 11, the effect of the geometric arrangement of the stone column group on the loading capacity of sandy soil can be evaluated. It can be seen that in the case of stone columns with a diameter of 60mm, changing the geometric arrangement of the stone column groups from triangular to square shape has increased the loading capacity of sandy soil by 8.3% Also, if the diameter of the stone column is equal to 80 and 120 mm, this increasing trend has increased the loading capacity of the soil by 19% and 15.09% respectively, by changing the arrangement from triangular to square. Therefore, it can be concluded that with increasing the diameter of stone columns and increasing the equivalent diameter in the group of stone columns, the loading capacity of sandy soil has an upward trend

Figure 10: effect of loading capacity of sandy soil with 60 mm diameters.

Figure 11: effect of stone column arrangement on loading capacity of sandy soil with 80 mm diameters.

Figure 12: effect of stone column 120 mm diameters. 5 Conclusion

In this study, a number of experiments were performed on stone columns in both single and group modes with two different arrangements to evaluate the effect of some parameters affecting the loading capacity of sandy soil. Therefore, stone columns with three diameters of 60, 80 and 120 mm singularly and in groups in two modes of triangular arrangement (with three single columns) and square arrangement (with four single columns) with a length to diameter ratio of 5 in the experiment box was evaluated and tested on a large scale. According to the experiments, the results obtained are as follows:

The presence of stone columns in sandy soils has increased the loading capacity of the soil. The use of a single stone column has increased the loading capacity of sandy soil by 26.7% Also, the comparison of the performance of the group of stone columns with the triangular arrangement in comparison with the single stone column shows that the use of the triangular arrangement of stone columns with a diameter of 60 mm increases 31.8% and the use of the arrangement of 4 stone

columns with a diameter of 60 mm with arrangement Square, 37.5% have increased the loading capacity of sandy soil compared to the use of a single stone column

Increasing the diameter of the stone column has increased the final loading capacity of the sandy soil. So that the use of stone columns with a diameter of 80 and 120 mm, compared to the diameter of 60 mm, in a triangular arrangement has increased 15.4% and 24.1% soil load capacity, respectively. Also, the use of the square arrangement of stone columns with a diameter of 80 and 120 mm in comparison with stone columns with a diameter of 60 mm, has increased the loading capacity of sandy soil by 22.5 % and 30.4%, respectively.

Changing the geometric arrangement of the stone column groups from triangular to square has increased the loading capacity of sandy soil by 8.3%. If the diameter of the stone column is 80 and 120 mm, this increasing trend increases the loading capacity of the soil by 19% and 15,9%, respectively, by changing the arrangement from triangular to square. It can be concluded that by increasing the diameter of stone columns and increasing the equivalent diameter in the group of stone columns, soil loading capacity can be increased .

6 Availability of Data and Material

Data can be available by contacting the corresponding author.

7 References

Pulko, B. and Majes, B. (2006). Analytical method for the analysis of stone columns according to the Rowe Dilatancy theory. Acta Geotechnica Slovenica, 3 (1), 37 45.

Krishna, M. and Madhav, M.R. (2009). Engineering of ground for liquefaction mitigation using granular columnar inclusions: recent developments. American Journal of Engineering and Applied Sciences, 2 (3), 526 536.

Ambily, A. P. and Gandhi. S. R.. (2007). Behavior of Stone Columns Based on Experimental and FEM Analysis. Geotechnical and Geoenvironmental Engineering , 133.

Hu, W.. (1995). Physical Modeling of Group Behavior of Stone Column Foundations. Ph.D. dissertation, Univ. of Glasgow, U.K.

Bae, W., Bang, W. and Byung, C.. (2002). Behavior of Foundation System Improved with Stone Columns, Proc. 12th Int. Offshore and Polar Engineering Conf., Int. Society of Offshore and Polar Engineers, Cupertino, CA.

Andreou, P. and Papadopoulos, V.. (2006). Modelling Stone Columns in Soft Clay. Proc. 6th European Conf. on Numerical Methods in Geotechnical Engineering , Graz, 777 780.

Castro J. (2014). Numerical modelling of st one columns beneath a rigid footing. Computers and Geotechnics, 60, 77 87.

Ghalam, M., et al. (2020). Numerical study of the effect of ston e columns. Journal of Civil & Environmental Engineering , 49(2).

Azizi, M.H. and, Massoud, N. (2017). Laboratory study of the effect of adhesion on the stability of earthen slopes reinforced with stone columns. Journal of Modares Civil Engineering , 17(1).

Lajevardi, S.H., Enami, Shamsi, S.H.R., Hamidi, M. (2019) Experimental study of single and groups of stone columns encased by geotextiles. Amirkabir J. Civil Eng , 50(6).

Dinarvand, R and Ardakani, A. (2019) Behavior of geosynthetically enclosed grain columns in sandy loam soil under direct shear testing. Journal of Civil Engineering Amirkabir, 50(5).

Dr.Reza Naderi is an Associate Professor at the Shahrood University of Technology in IRAN He is Assistant Professor Faculty of Civil & Architectural Engineering. He holds a PhD in Geotechnical Engineering. His research encompasses Numerical Methods in Geotechnical Engineering Soil Mechanics Rock Mechanic

Ali Yousefi Samangani is a Ph.D student in the Civil Geotechnics Group at Shahrud Industrial University in IRAN.

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

Impacts of Applying Artificial Intelligence on Decision-Making Quality: A Descriptive Study in Saudi Arabian Private Sector Organizations

Nermeen Bakheet Aljohani1, Saja Albliwi2*

1Business Administration Department, College of Business Administration, Albaha University, Albaha, SAUDI ARABIA.

2Business Administration Department, Faculty of Economics and Administration, King Abdulaziz University, Jeddah, SAUDI ARABIA.

*Corresponding Author (Email: salbliwi@kau.edu.sa).

Paper ID: 13A5T

Volume 13 Issue 5

Received 08 January 2022

Received in revised form 19 April 2022

Accepted 26 April 2022 Available online 03 May 2022

Keywords: Artificial intelligence; decision making quality; private sector organizations; Saudi Arabia.

Abstract

Artificial intelligence (AI) is a leading future strategic technology. AI is more advanced as it is integrated into the decision making (DM) process. Saudi Arabia (SA) is diversifying its economy with the Vision 2030 Initiative. Vision 2030 recognizes digital transformation as an important goal to boost the business sector, support private sector companies, and ultimately reduce the country's reliance on oil revenues through economic diversification. Therefore, this study aims to examine the impacts of applying AI on DM quality in the private sector organizations in SA. The quantitative method was adopted, and the data was collected using the questionnaire distributed to the study subjects (n=170 employees). The findings showed that there was a significant impact of using AI applications in its three dimensions (training and development, appropriateness, and effectiveness) on the DM quality in its three dimensions (the speed of decision making, the quality of the decision, accepting the decision) in the private sector organizations in SA. Therefore, it could be recommended that private sector organizations should continue to employ AI applications in their businesses, keep abreast of developments, and establish partnerships between the Saudi data AI authority (SDAIA) and international companies to support AI research. Further analysis of different domains of AI in the organizations in SA in both the private and public sectors should be done.

Disciplinary: Business Management .

©2022 INT TRANS J ENG MANAG SCI TECH.

Cite This Article:

Aljohani, N.B., Albliwi, S. (2022). Impacts of Applying Artificial Intelligence on Decision Making Quality:A Descriptive Study in Saudi Arabian Private Sector Organizations. International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies, 13(5), 13A5T, 1 14. http://TUENGR.COM/V13/13A5T.pdf DOI: 10.14456/ITJEMAST.2022.104

Introduction

Artificial intelligence (AI) is a term first used in 1956 by computer scientist John McCarthy widely. He defined AI as "the science and engineering of making intelligent machines" (Gherhe ș & Obrad, 2018). AI researchers, such as Marvin Minsky, Herbert Simon, and Allen Newell, predicted in the early 1960 that the machine would be able to carry out human actions (Giri et al., 2019). During 1990, AI programs were more widely used in many fields, such as medical, logistical, data processing, and many other fields (Kadi & Hida, 2020). Also, AI means " a computer program that can think and learn, and it can perform tasks or thinking processes associated with intelligence in human beings" (Bruun & Duka, 2018). AI is a topic that has a worldwide impact; plentiful has been published about AI in the general media and academic research literature. Despite the plenty of writing on the topic, researchers are always in a challenge with AI, especially considering the current conditions in which the use of AI techniques is increasing. AI is an approach to creating intelligent entities that can match or exceed human intelligence and rationality (Hassan, 2020). As the AI applications continue to increase rapidly, its techniques have begun to contribute greatly to sensitive processes such as decision making (DM) in various organizations, DM means " the study of identifying and choosing alternatives based on the values and preferences of the decision maker" (Matsa & Gullamajji, 2019).

The decisions that are made in any organization have important implications for organizational performance. T his requires resorting to smart systems to assist in DM, known as AI with all its domains, such as expert systems, neural networks, fuzzy logic, etc (Nayak and Dash, 2020). AI, especially machine learning algorithms, enables the creation of new information and future predictions from existing data, promising quick, precise, and low cost decisions. It has a sufficient understanding of its strengths and weaknesses and reacts to information the same way a human would. Researchers predict that AI will surpass humans in many activities in the next ten years, and there is a 50% chance of AI surpassing humans in all tasks in 45 years and automating all human jobs in 120 years (Grace et al., 2018).

DM is the most potent skill to shape the future of any organization, and making good decisions is the key to success. AI techniques could bring new opportunities to make high quality decisions as humans act and maybe better. Recent advances in AI are creating the possibility t o experience the interaction in humans with AI to help in DM (Fast & Schroeder, 2020). Organizations are already building AI driven techniques with human like capacities, and they have the potential to become widely used in improving task completion (Spetzler et al., 2016).

AI applications play an important role in making decisions, including identifying complex problems and solving them through an accurate and deep understanding of these problems and providing the best results. They can simulate human intelligence. They have become applied in many fields, for instance, computer science applications, software, medicine, human resources, biology, digital marketing, education, etc. (Nayak and Dash, 2020).

SA government has conducted long term plans to support using AI in future projects. They established a government institute called the Saudi Data and Artificial Intelligence Authority (SDAIA) to raise awareness about AI. In addition, SA is building a smart city called NEOM as a part of its "Vision 2030" program to reduce the country's dependence on oil revenues and turn it into a technology hub. AI driven companies grow yearly in SA (Ashehri, 2019; Hassan, 2020).

The scope will almost certainly increase after 2030 when AI affects the economy and society. AI in SA will contribute over USD 135.2.2 billion to the economy by 2030. The Kingdom is currently working on establishing all future projects and its cities based on AI technologies and aims to invest in this promising field full of opportunities that will generate high profits. AI was applied to several models, forecasts, decision support, and control systems in such diverse fields in SA as engineering, economics, manufacturing, education, and medicine (Ashehri, 2019). Therefore, this study aims to examine the impact of applying AI on DM quality in the private sector organizations in SA.

Research hypotheses are

Hmain: "AI has a positive impact on DM quality in the private sector organizations in SA".

H1: "There is an effective relationship between training and development and DM quality in the private sector organizations in SA".

H2: "There is an effective relationship between the appropriateness and DM quality in the private sector organizations in SA".

H3: "There is an effective relationship between the effectiveness of AI and DM quality in the private sector organizations in SA".

2 Methodology

A descriptive research design, which aims to provide a picture of a situation as it naturally happens, was adopted for this study (Burns & Grove, 2003). Also, the deductive approach, called the "top down" approach, develops hypotheses based on existing theories and focuses on verifying theories (Burney & Saleem, 2008). The quantitative strategy was followed to emphasize the quantification measurement and determine the relationship between variables.

All employees in the private sector organizations in SA who applied AI techniques in DM are the target population to collect primary data. This study employed a simple random sampling technique to select the study subjects (Mugenda & Mugenda, 2012).

The primary data was obtained for research purposes through questionnaires inanition to secondary data. The data was collected through a questionnaire. A hand to hand questionnaire and an online based questionnaire through Google Forms were distributed by sharing the link on the internet via social media applications (LinkedIn, WhatsApp, Twitter, Telegram, and E mails). In the first stage, the questionnaire was distributed to selected individuals for piloting the questionnaire. After verifying the validity and reliability of the tool, the questionnaire was distributed to a large group of targeted participants community. After three weeks of data collection, a total of (193) responses were received, of which the valid ones were (170) responses, with a ratio of (88%).

2.1 Research Instruments

After literature reviews on the impact of AI on DM quality, a questionnaire consisting of four parts was constructed. Part I consists of demographic information (gender, age, education level) , and Part II consists of functional information (administrative level, experience, reliance on AI techniques at work, duration of training received to use AI). Part III deals with the first variable of AI applications independent variable which has three dimensions, training and development, appropriateness, and effectiveness, with 18 statements. Part 4 of the questionnaire deals with the second variable DM the dependent variable, which contains three dimensions, the speed of DM, the quality of the decision, and accepting the decision with 14 statements.

All statements in six dimensions are included in the ordinal scale. Six Likert scale measurements are used to check the respondent's opinion about the subject of this research : strongly disagree =1, disagree =2, neutral =3, agree =4, strongly agree=5, and not applicable = 6.

The validity of the questionnaire was tested on several levels. Pilot testing of the questionnaire was performed to test validity, where 15 participants were recruited to investigate the ability of the respondents to complete the questionnaire and assess the clarity of the questions and the need to add or delete. To check the construct validity of the questionnaire, P erson correlation coefficients were constructed between dimensions and the grand total of the questionnaire. The results showed that all Person correlations are statistically significant at level (α=0.01), and all dimensions correlated with a grand total of the questionnaire. Person correlation coefficients ranged between 0.8 0.94, which means the tool validity is satisfied in this research. For testing reliability, reliability was calculated for each dimension through the Cronbach's Alpha test to estimate the reliability of the questionnaire. The results revealed that the overall reliability is 0.97, which is sufficient to guarantee the reliability of the questionnaire.

2.2 Statistical Analysis

Analysis was achieved through the IBM SPSS software to analyze the data collected to answer the research questions and test the research hypotheses. Means and standard deviations, Cronbach's Alpha test to measure reliability, Pearson's correlation coefficient to measure internal consistency and the relationship between independent and dependent variables, simple linear regression, and ANOVA, analysis of variance were used.

3 Results and Discussion

This study included 170 employees in the private sector organizations in SA who applied AI technique s in DM in their organizations. The highest percentage was male 77.6%, while the rest were females, 22.4%. Category 31 40 years old was the highest percentage of participants (54.1%), while the 51 years and above" was the lowest percentage of the participant (2.9%). Regarding the education level, the bachelor's degree was the highest percentage (62.4%), while the other was the lowest percentage (0.6%).

Concerning the administrative level variable, an employee has the highest percentage

(39.4%), while o ther has the lowest percentage (4.7%). Regarding their experience, from 11 to 15 years has the highest percentage (27.6%), while less than 5 years has the lowest percentage (21.8%). According to the variable of reliance on AI techniques at work, participants' percentage of less than 10% on using AI techniques at work is the highest (41.8%), while participants' percentage of more than 90% on using AI techniques at work is the lowest (7.6%). Finally, the variable of training that employees received to use AI technique, participants` case that never has the training to use AI technique at work is the highest (45.9%), while participants' percentage who got 6 months of training to use AI technique at work is the lowest (10%) (Table 1).

Table 1: The study participants’ demographic and functional information Percent (%) Frequency (n=170) Characteristics

Gender

Less than 30 years 31 40 41 50 More than 50 years

77.6 22.4 132 38 Male Female Age 23.5 54.1 19.5 2.9

40 92 33 5

Education level 1.18 1.18 62.4 34.7 0.58

2 2 106 59 1

High school or less Diploma Bachelor's degree Postgraduate degree Others Administrative level 11.2 14.1 30.6 39.4 4.7

19 24 52 67 8

General Manager Branch Manager Department Head An employee Other Experience 21.8 26.5 27.6 24.1

Less than 5 years From 5 to 10 years From 11 to 15 years More than 15 years Reliance on AI 41.8 32.9 17.6 7.6

Less than 10% 10 40% 50 80% More than 90%

One month 3 months 6 months More than 6 months Never

37 46 47 41

71 56 30 13

Training to use AI techniques at work

28 28 17 19 78

3.1 AI Applications ( Independent Variable )

16.5 16.5 10.0 11.2 45.9

AI Applications as an independent variable have three dimensions training and development, appropriateness, and effectiveness with 18 statements.

3.2

Training and Development

Table 2 shows the rank of training and development statements. The statement "The organization has modern technological devices" comes first with a mean of 4.21±0.998/strongly

agree. In contrast, the statement "Staff s are constantly trained to keep pace with recent technological developments" comes last with a mean of 3.64±1.229/agree. The overall mean for training and development is 3.91± 0.836/ agree.

Table 2: Training and development statements Statement

The organization has modern technological devices

Mean SD Scale

4.21 0.998 Strongly a gree

The organization constantly updates the systems 3.98 1.161 Agree Staff performance is constantly evaluated to ensure the quality of work 3.96 1.087 Agree Staff have the ability to use existing modern technologies 3.93 1.058 Agree The organization provides many experts for the development of information systems 3.89 1.112 Agree

The organization uses modern and advanced technological software to improve the quality of decisions 3.76 1.164 Agree

Staff are constantly trained to keep pace with recent technological developments 3.64 1.229 Agree Training and development 3.91 0.836 Agree

Dimensions ranked descending according to their mean

3.3 Appropriateness

Table 3 shows the rank of appropriateness statements . T he statement "the applications used are modern and suited to the requirements of the work" comes first with a mean (3.86 ±1.066/ agree). In contrast, the statement "The information provided by AI applications is appropriate to the user's needs" comes last with a mean (3.79±1.251 /agree). The appropriateness overall mean is (3.82 ± 0.991/ agree).

Table 3: Appropriateness statements Statement

Mean SD Scale

3.86 1.066 Agree AI applications provide the necessary information that serves the decision making process 3.81 1.211 Agree The information that helps decision makers to make correct decisions is accurate 3.80 1.097 Agree The information provided by AI applications is appropriate to the user's need 3.79 1.251 Agree Appropriateness 3.82 0.991 Agree

The applications used are modern and suited to the requirements of the work

Dimensions ranked descending according to their mean

3.4 Effectiveness

Table 4 shows the rank of effectiveness statements. The statement "AI applications are modern means to improve and develop decisions and evaluate their effectiveness" comes first with a mean of 4.16±0.977/agree. In contrast, the statement "These systems can predict problems and risks" comes last with a mean of 3.74 ±1.063/agree. Effectiveness overall mean is 3.96± 0.886/agree.

Table 4: Effectiveness statements Statement

Mean SD Scale

AI applications are a modern means to improve and develop decisions and evaluate their effectiveness 4.16 0.977 Agree These applications achieve the amount of success for the organization due to the effectiveness of the decisions it takes 4.03 1.034 Agree

Customer transactions are achieved as quickly and accurately as possible due to the superior ability of the technological devices and technologies in the organization

3.98 1.196 Agree These systems are an excellent tool that helps in achieving correct, accurate, and high quality results 3.95 1.022 Agree These applications have a superior ability in identifying and diagnosing problems, developing alternatives for solutions, evaluating them, and proposing

3.95 0.962 Agree AI applications provide the necessary information that serves the decision making process 3.92 1.096 Agree These systems have the ability to predict problems and risks 3.74 1.063 Agree Effectiveness 3.96 0.886 Agree

Dimensions ranked descending according to their mean

3.5 DM Quality ( Dependent Variable )

DM quality dependent variable, which also contains three dimensions the speed of decision, the quality of the decision, and accepting the decision with (14) statements.

3.6 The s peed of Decision

Table 5 shows the rank of t he speed of decision statements. The statement "AI applications have enabled to shorten the time and reduce effort" comes first with a mean (4.30 ±1.082/ strongly agree), while the statement " The time that AI applications take to process data is relatively adequate" comes last with a mean (3.96 ± 1.168/ agree). The speed of the decision overall mean is (4.10 ± 0.962/ agree).

Table 5: The speed of decision statements Statement

AI applications have enabled to shorten the time and reduce the effort

Mean SD Scale

4.30 1.082 Strongly a gree

The Information is stored and retrieved quickly 4.24 1.016 Strongly a gree

These applications contributed to the time and planned decision making 4.03 1.138 Agree

The required information is passed on to the decision maker as soon as it is requested 3.98 1.151 Agree

The time that AI applications take to process data is relatively adequate 3.96 1.168 Agree

The speed of decision 4.10 0.962 Agree

Dimensions ranked descending according to their mean

3.7 The Quality of the Decision

Table 6 shows the rank of the quality of the decision statements. T he statement "AI applications ensure that decisions are made based on accurate information" comes first with a mean (3.95 ±1.051/ agree). In contrast , the statement "The ability of AI technology to make accurate decisions is only in the certainty environment" comes last with a mean (3.21±1.212 /agree). The quality of the decision overall mean is (3.61± 0.876/ agree).

Table 6: The quality of the decision statements Statement

Mean Std. Deviation Scale

Decisions made by AI applications achieve the desired goals 3.74 1.018 Agree The ability of AI applications to make decisions in the risky or uncertain environment 3.55 1.136 Agree

The ability of AI technology to make accurate decisions is only in the certainty environment 3.21 1.212 Neutral The quality of the decision 3.61 0.876 Agree

Dimensions ranked descending according to their mean

3.8 Accepting the Decision

Table 7 shows the rank of accepting the decision statements. T he statement "the decisions made by AI technology are rational and realistic" comes first with a mean of (3.64 ±1.035 / agree). In contrast, the statement "decisions made by AI technology often conform to the personal guesswork of the decision maker" comes last with a mean of (3.48 ± 1.163/ agree). Accepting the decision overall mean is (3.58 ± 0.943/ agree).

Table 7: Accepting the decision statements

Statement

The decisions made by AI technology are rational and realistic

Mean SD Scale

3.64 1.035 Agree

3.63 1.070 Agree Decisions are widely accepted and highly reliable 3.59 1.086 Agree

The results of the decisions taken are often met with satisfaction

The results of decisions obtained from implementing AI technology are often positive 3.56 1.109 Agree Decisions made by AI technology often conform to the personal guesswork of decision maker 3.48 1.163 Agree

Accepting the decision

3.58 0.943 Agree

Dimensions ranked descending according to their mean

3.9 AI Applications ( I ndependent V ariable )

Table 8 shows the rank of AI application statements . T he statement "the organization has modern technological devices" comes first with a mean (4.21 ± 0.998/ strongly agree), while the statement "staff is constantly trained to keep pace with recent technological developments" comes last with a mean (3.64 ±1.229 /agree). AI application' s overall mean is (3.91± 0.728/agree).

Table 8: AI applications statements

Statement

Mean SD Scale

The organization has modern technological devices 4.21 0.998 Strongly a gree AI applications are a modern means to improve and develop decisions and evaluate their effectiveness 4.16 0.977 Agree

These applications achieve the amount of success for the organization due to the effectiveness of the decisions it takes 4.03 1.034 Agree Customer transactions are achieved as quickly and accurately as possible due to the superior ability of the technological devices and technologies in the organization 3.98 1.196 Agree

The organization constantly updates the systems 3.98 1.161 Agree Staff performance is constantly evaluated to ensure the quality of work 3.96 1.087 Agree These systems are an excellent tool that helps in achieving correct, accurate and high quality results 3.95 1.022 Agree

These applications have a superior ability in identifying and diagnosing problems, developing alternatives for solutions, evaluating them, and proposing 3.95 0.962 Agree Staff have the ability to use existing modern technologies 3.93 1.058 Agree AI applications provide the necessary information that serves the decision making process 3.92 1.096 Agree

The organization provides many experts for the development of information systems 3.89 1.112 Agree

The applications used are modern and suited to the requirements of the work 3.86 1.066 Agree AI applications provide the necessary information that serves the decision making process 3.81 1.211 Agree

The information that helps decision makers to make correct decisions is accurate 3.80 1.097 Agree The information provided by AI applications is appropriate to the user's need 3.79 1.251 Agree

The organization uses modern and advanced technological software to improve the quality of decisions 3.76 1.164 Agree

These systems have the ability to predict problems and risks

3.74 1.063 Agree Staff are constantly trained to keep pace with recent technological developments 3.64 1.229 Agree

AI applications 3.91 0.724 Agree

Dimensions ranked descending according to their mean

3.10 Decision Making Quality ( Dependent Variable )

Table 9 shows the rank of " decision making quality" statements, the statement "AI applications have enabled to shorten the time and reduce effort" comes first with a mean (4.3± / strongly agree) and the standard deviation is (1.082). In contrast, the statement "The ability of AI technology to make accurate decisions is only in the certainty environment" comes last with a mean (3.21± 1.212/ neutral). DM quality overall mean is (3.77 ± 0.868/ agree).

Table 9: DM quality statements

Statement

Mean SD Scale

4.30 1.082 Strongly a gree The Information is stored and retrieved quickly 4.24 1.016 Strongly a gree These applications contributed to the time and planned decision making 4.03 1.138 Agree

AI applications have enabled to shorten the time and reduce the effort

The required information is passed on to the decision maker as soon as it is requested 3.98 1.151 Agree

The time that AI applications take to process data is relatively adequate 3.96 1.168 Agree AI applications ensure that decisions are made based on accurate information 3.95 1.051 Agree Decisions made by AI applications achieve the desired goals 3.74 1.018 Agree

The decisions made by AI technology are rational and realistic 3.64 1.035 Agree

The results of the decisions taken are often met with satisfaction 3.63 1.070 Agree Decisions are widely accepted and highly reliable 3.59 1.086 Agree

The results of decisions obtained from implementing AI technology are often positive 3.56 1.109 Agree

The ability of AI applications to make decisions under risk or uncertain environment 3.55 1.136 Agree Decisions made by AI technology often conform to the personal guesswork of decision maker 3.48 1.163 Agree

The ability of AI technology to make accurate decisions is only in the certainty environment 3.21 1.212 Neutral DM quality 3.77 0.868 Agree

Dimensions ranked descending according to their mean

3.11 Overall Questionnaire Dimensions

From Table 10, "The speed of decision" comes first with a mean of (4.10 ± 0.962/ a gree), while the dimension "Accepting the decision" comes last with a mean of (3.58 ± 0.943/agree). DM quality's dependent variable has a mean (3.77 ± 0.868/ agree). The overall questionnaire mean is (3.85 ± 0.742/ agree).

Table 10: Overall questionnaire dimensions statements

Dimension Mean Std. Deviation Scale

The speed of decision making 4.10 0.962 Agree

Effectiveness 3.96 0.884 Agree

Training and development 3.91 0.836 Agree

Appropriateness 3.82 0.991 Agree

The quality of the decision 3.61 0.876 Agree Accepting the decision 3.58 0.943 Agree

DM quality 3.77 0.868 Agree Overall questionnaire 3.85 0.742 Agree

Dimensions ranked descending according to their mean

3.12 Relations between AI Applications and the DM Quality

Pearson correlation analysis was used f or testing the relations between the independent variable " AI applications" with its factors (training and development, appropriateness, and effectiveness) against the dependent variable " DM quality" with its factors (the speed of decision making, the quality of the decision, accepting the decision). Table 11 shows a statistically positive correlation between all independent variables and all dependent variables. Pearson correlation coefficients (r) range (0.60 0.85). All these coefficients have positive and good correlations between independent and dependent variables.

3.13

Table 11: Pearson correlations between AI applications and DM quality (n=170)

Independent variables

Training and development

Dependent Variables

The speed of decision making The quality of the decision Accepting the decision Decision making quality

Pearson correlation 0.62 ** 0.60 ** 0.62 ** 0.64 ** Sig. (2 tailed) 0.000 0.000 0.000 0.000

Appropriateness Pearson correlation 0.72 ** 0.70 ** 0.73 ** 0.64 **

Sig. (2 tailed) 0.000 0.000 0.000 0.000

Effectiveness Pearson correlation 0.79 ** 0.72 ** 0.75 ** 0.81 ** Sig. (2 tailed) 0.000 0.000 0.000 0.000

AI applications Pearson correlation 0.77 ** 0.69 ** 0.71 ** 0.85 ** Sig. (2 tailed) 0.000 0.000 0.000 0.000 **Correlation is significant at the 0.01 level (2 tailed).

Linear Regression Analysis for DM Quality with the Independent Variable of AI

Table 12 shows that training and development, appropriateness, and effectiveness interpret about 0.41, 0.41, and 0.66 of the dependent variable DM quality variances, with adjusted R2 = 0.408, 0.41, and 0.658, respectively. AI three factors interpret about 0.72 of the dependent variable DM quality variances, with adjusted R2 = 0.711.

Table 12: Multipl e linear regression analysis for DM quality with the independent variable of AI Model R R2 Adjusted R2

Training and development 0.64 & 0.41 0.408 Appropriateness 0.64& 0.41 0.411 Effectiveness 0.81& 0.66 0.658 AI applications 0.85 # 0.72 0.711 & Simple linear regression analysis. # Multiple linear regression analysis.

3.14 Correlation for DM Quality with the Independent Variable of AI Table 13 shows a statistically significant influence of training and development factor s , appropriateness effectiveness , and AI applications on DM quality (p=0.000).

Table 13: Correlation between DM quality and independent variable of AI. Model Sum of Squares df Mean Square F p value Training and development 23.717 1 23.717 38.452 0.000 Appropriateness 52.726 1 52.726 118.717 0.000 Effectiveness 84.046 1 84.046 326.138 0.000 AI applications 91.134 3 30.378 139.28 0.000 Regression model using ANOVA.

3.15 Testing of R esearch H ypothesis

From Table 8, AI has a mean (3.91±0.724/ agree). Also, Table 12 shows a meaningful positive correlation between AI and DM quality since (r=0.85). AI applications interpret about (0.72) of the changes in DM quality. Besides , Table 13 confirms a statistically significant influence of AI applications on DM quality. Therefore, this proves that AI positively impacts DM quality in the

private sector organizations in SA, thus Hmain is accepted. This result is in line with Kadi & Hida (2020).

On the other hand, Nadikattu (2021) revealed that AI has great importance in the sports industry, where it has a significant effect in ensuring evolves of the sports sector from traditional to modern ways, the sport s businesses are growing fast with the awareness created through this technology.

Moreover, Abuzaid (2017) study aimed to identify the role of expert systems in the quality of senior management decisions in the Palestinian Ministry of Health in southern governorates. T he results showed that expert systems at the Palestinian Ministry of Health were high, and the quality DM senior management was high. Also, the study results showed that there was a positive relationship between expert systems and the quality of DM in senior management in the Palestinian Ministry of Health.

: "There is an effective relationship between training and development and DM quality in the private sector organizations in SA".

Table 10 shows that training and development has a mean (3.91± 0.836 /agree). Also, Table 12 shows a meaningful positive correlation between training and development and DM quality since (r=0.64), the training and development factor interprets about (0.41) of the changes in DM quality. Table 13 confirms a statistically significant influence of training and development on DM quality. Therefore, H1 is accepted indicating an effective relationship between the use of training and development and DM quality in the private sector organizations in SA. The results straight forward with Alshawabkeh (2017).

From Table 10, appropriateness has a mean (3.82± 0.991/agree). Also, Table 12 shows a meaningful positive correlation between appropriateness and DM quality since (r=0.64), the appropriateness factor interprets about 0.41 of the change in DM quality. Also, Table 13 confirms a statistically significant influence of appropriateness on DM quality. Thus, H2 is accepted proving an effective relationship between appropriateness and DM quality in the private sector organizations in SA. This study’s findings are straightforward with Raqeeq (2015).

From Table 10, effectiveness has a mean (3.96± 0.884/ agree). Also, Table 12 shows a meaningful positive correlation between effectiveness and DM quality since (r=0.81), the effectiveness factor interprets about 0.66% of the change in DM quality. Additionally, Table 13 confirms a statistically significant influence on the effectiveness of (DM quality). Therefore, H 3 is accepted showing an effective relationship between the effectiveness of using AI and DM quality in the private sector organizations in SA. This agrees with Nayak and Dash (2020).

Therefore, an effective relationship has been assumed between the use of training and development, the appropriateness, and the effectiveness of DM quality in the private sector organizations in SA. According to the findings of the current study, the results indicated that AI applications and effectiveness have the highest impact with 0.72, and 0.77, respectively, on DM

quality, as in the case, both training and development and appropriateness have a moderate impact (0.41) on DM quality, see Figure 1.

AI Applications

T raining and development

0.41

Appropriateness 0.41 0.77

0.72

DM Quality

Effectiveness

Figure 1: Summary of the relationship between AI applications (training and development, appropriateness, and effectiveness) and DM quality

4 Conclusion

The current study highlights the impact of applying AI on DM quality in the private sector organizations in SA. Data for the present study were collected using a questionnaire distributed to a random sample of 170 employees of private sector organizations in SA that use AI applications. The current study results showed that AI applications have a 0.72 impact on DM quality in the private sector organizations in SA. There is an effective positive relationship between training and development and appropriateness with 0.41 on DM quality. While an effective relationship with an influence of 0.77 between the effectiveness and DM quality in the SA private sector organizations.

Based on the findings of this study, it could be recommended that private sector organizations should continue to apply AI applications in their businesses. Besides, keep abreast of developments, directing the attention of researchers to conduct more studies on this topic by expanding the subject's size to achieve more accurate results. The researcher also recommended establishing partnerships between the SDAIA and a group of international companies to support this aspect in the private and public sector organizations. Moreover, it encourages cooperation between SADIA and organizations in training programs and improves expertise to obtain globally competitive AI applications that effectively support DM in education, health, finance, and social affairs. SADIA should support AI research with experts and financial support to launch specialized research.

This research includes actual data and real examples of private sector organizations in SA that are currently using AI techniques. AI applications have improved the speed of response in DM and improved the quality of the private sector business organizations. In addition, it increased the organization's awareness of the need to move forward and rely on advanced technologies, depart

from the traditional way of making decisions, and resort to everything modern to advance the national economy in general and the private sectors.

5 Availability o f Data and Material

Data can be made available by contacting the corresponding author.

6 References

Abuzaid, A. (2017). The role of expert systems in the quality of decision making of senior management in the Palestinian Ministry of Health . Academy of Management and Politics for Graduate Studies. MS.c Thesis.

Alshawabkeh, A. (2017). The role of AI applications as "expert systems" on decision making in Saudi banks in the Taif governorate. Taif University Journal for Human Sciences, 4, 15.

Ashehri, R. (2019). Governance of artificial intelligence in KSA (Neom as model). International Journal of Advanced Studies, 9(1), 64 81.

Bruun, E. P., & Duka, A. (2018). Artificial intelligence, jobs and the future of work: Racing with the machines. Basic Income Studies, 13(2):1 16.

Burney, S.M.A. & Saleem, H., (2008) Inductive & Deductive Research Approach Lecture delivered on 06 03 2008 at Auditorium of Faculty of Arts and Science, University of Karachi, Karachi, Pakistan.

Burns, N., & Grove, S. (2003). Understanding nursing research. 3 rd Ed. Philadelphia, W.B. Saunders Company.

Fast, N. J. & Schroeder, J. (2020). Power and decision making: new directions for research in the age of artificial intelligence. Current Opinion in Psychology , 33, 172 176.

Gherheș, V., & Obrad, C. (2018). Technical and humanities students' perspectives on the development and sustainability of artificial intelligence (AI). Sustainability, 10(9), 3066.

Giri, A., Chatterjee, S., Paul, P. & Chakraborty, S. (2019). Determining the Impact of Artificial Intelligence on 'Developing Marketing Strategies' in Organized Retail Sector of West Bengal, India. International Journal of Engineering and Advanced Technology , 8, 3031 3036.

Grace, K., Salvatier, J., Dafoe, A., Zhang, B., & Evans, O. (2018). When will AI exceed human performance? Evidence from AI experts. Journal of Artificial Intelligence Research , 62, 729-754.

Hassan, O. (2020). Artificial intelligence, neom and Saudi Arabia's economic diversification from oil and gas. The Political Quarterly, 91(1), 222 227.

Kadi, S. & Hida, S. (2020). The use of artificial intelligence applications in improving the decision making process in the Economic Corporation (Adrar Electricity and Gas Production Company). MS c Thesis, Université Ahmed Draia.

Matsa, P. and Gullamajji, K. (2019). To study impact of artificial intelligence on human resource management. International Research Journal of Engineering and Technology . 6 (08): 1229 1238.

Mugenda, O., & Mugenda, A. (2012). Research methods dictionary. Nairobi: Applied Research and training services.

Nadikattu, R.R. (2020). Implementation of new ways of artificial intelligence in sports. Journal of Xidian University. 14(5): 5983 5997.

Nayak, M.M. & Dash S.K. (2020). Role of artificial intelligence in market decision making: knowledge based framework. International Journal of Advanced Research in Engineering and Technology . 11(11): 1926 1933.

Raqeeq, A. (2015). The use of artificial intelligence applications in managing the activities of the institution, a case study of a group of economic institutions. Master’s Thesis, Oum El Bouaghi University.

Spetzler , C., Winter, H., & Meyer, J. (2016). Decision quality: Value creation from better business decisions. John Wiley & Sons.

Nermeen Bakheet Aljohani is a lecturer at Al Baha University, Faculty of Business Administration, Department of Business Administration. She holds a Master’s degree in Business Administration from the Faculty of Economics & Administration, King Abdulaziz University Nermeen’s areas of research are Decision Making, Quality, and Applications of Artificial Intelligence

Dr.Saja Ahmed Albliwi is an Assistant Professor in the field of Lean Six Sigma at King Abdulaziz University, Faculty of Economics & Administration, Department of Business Administration. EFQM assessor. She received a Ph.D. degree from the School of Social Sciences, Heriot Watt University, UK and a Masters's degree in 2012 from the School of Management and Languages, Heriot Watt University

ISSN 2228 9860 eISSN 1906 9642 CODEN: ITJEA8

International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies http://TuEngr.com

Measuring New Normal Strategy of Brands on Digital Branding during Covid-19

1Department of Business Administration, Faculty of Economics and Administration, King Abdulaziz University, SAUDI ARABIA

2Department of Marketing, Faculty of Economics and Administration, King Abdulaziz University, SAUDI ARABIA. *Corresponding author (Email: 2101221 @stu.kau.edu.sa).

Paper ID: 13A5U

Volume 13 Issue 5

Received 28 December 2021 Received in revised form 19 April 2022

Accepted 26 April 2022 Available online 03 May 2022

Keywords: Digital Branding; Social Media; Strategy; Covid 19; and SMEs

Abstract

The research addresses the role of digital marketing solutions in creating a synergy of SMEs and the influence of customer perception in building strong branding during COVID 19. The researcher has taken the communication through social media (SCM) as an independent variable, whereas the market shares (MS), brand loyalty (BL), and general feedback from customers (GF) as dependent variables. The information is collected from 100 managers and owners of SMEs from different locations in Saudi Arabia. The correlation analysis of communication through digital media with the market share, brand loyalty, and general feedback of customers is 0.79, 0.75, and 0.84, where there is a strengthening relationship between dependent and independent variables. The significance F value is below 0.05, and the p value of all three variables is below 0.05, which means that the null hypothesis is rejected as there is a strong relationship between dependent and independent variables. The results show a strong relationship between variables, and organizations need to emphasize adopting digital media. Disciplinary: Management (Marketing & Digital Branding, Marketing Research) .

1 Introduction

The recent outbreak of COVID 19 globally shifted paradigms for traditional business and marketing communication practices from the core (Aleksandra et al., 2021). The increased time spent on digital media has allowed brands to interact with their audience in a new way on multiple channels and touch points simultaneously, reaching out to a broader consumer base while

Ola Mohammed Ibrahem Amer1*, Asma Zaheer2

serving as their one stop information hub (Brand et al., 2020). It is now a reality that customer experience is equally important offline and online, so focusing on digital development is essential (Baker & Judge, 2021). Businesses operating on conventional mediums, namely bricks and mortar strategies, are most likely to experience a downfall in market share and return on investments (ROI) (Vis conti, 2021). Today, most businesses have shifted to digital platforms and e commerce channels to reach the target audiences (Shi et al., 2020). The researcher is interested in emphasizing the role of digital branding during COVID 19 and how their business profitability is improved.

Digital Branding is a multidisciplinary management consulting practice that incorporates many fields, disciplines, and disciplines within its practice (Young et al., 2020). The trend of digital branding has gained massive popularity during COVID 19 in areas as strategic management, innovation, innovation management, new product development, design thinking, qualitative and quantitative assessment, and much more (Guo et al., 2020). Understanding how consumer purchase decisions are affected by digital technology is fundamental to successfully positioning any brand in this environment (Sobreira et al., 2020).

Researchers said that digital presence directly impact sales and overall return on investment results. The digital presence influences every potential consumer's interaction with the brand (Sharma, 2020). All it takes is a single comment to bring a brand down or trigger outrage that leads to business failure. Therefore, businesses must use every platform to create a strong digital brand to overcome the after effects of the Pandemic (Priambodo et al., 2021; Wang & Cheng, 2020). Successful brands are creating rapid transitions in marketing strategies by integrating digital solutions in the communication process controls (Reardon et al., 2021). This research investigates the emerging role of digital branding during the COVID 19 business environment.

This research would address if the digital marketing solutions were the new normal for the progressing brands operating worldwide with a diversified product and service portfolio, customer segments, and cultural exposures, considering a change in the communication practices. The research objectives are:

• Understanding how digital branding creates synergy for SMEs while acquiring maximum market share during COVID 19.

• Analyzing the role of digital branding as an effective tool to SMEs to influence customer perception to build solid digital branding during COVID 19

• Evaluating how small scale brands invest in digital marketing to create a contemporary brand image among customers during COVID 19.

• Analyzing how digital branding creates customer loyalty, having a limited attention span during COVID -19.

Literature Review

Digital branding is one of the most critical aspects of today's businesses, particularly after the COVID 19 Pandemic. As social media presence, email marketing, and online newsletters have become increasingly popular, brands need to create a strong image through consistent content that engages consumers. Digital branding has allowe d businesses to establish their company as experts in their field during the Pandemic. It helps consumers find brands when they search for products or services offered online (Aleksandra et al., 2021). It can be said that digital branding is the future of marketing as businesses have to be aware of this changing landscape or risk losing out on their target audience. The digital era has brought about new opportunities for businesses that can harness their power effectively.

2.1 Digital Branding

The internet is nothing if not a testament to the power of where people are looking. As the leading source of information, these websites and apps help make digital branding easier than ever (Almeida et al., 2020). Understanding how digital branding works is vital for businesses to be successful online. Digital branding is the process of using the internet to create a presence that's unique to businesses (Baker & Judge, 2020). Branding techniques exist outside the digital world, but they are still essential parts of any successful marketing strategy. A company can create its unique moniker or use traditional logos and slogans (Cinelli et al., 2021). The key aspects are making sure that the business name is memorable and easily identifiable by potential customers. The internet has completely altered how businesses think about branding. It is no longer enough to make sure the name is easy to remember; they also need to be visible on every search engine possible online. It is achieved through digital branding to consider the mobile space (Das, 2021). The rise of smart phones has altered how people search for products and services. A company's mobile strategy needs to take shape for them to be successful online (Alshaketheep et al., 2020). The number of searches is constantly increasing, which leads to an even larger pool of potential customers for companies to reach.

Digital branding is the best way for companies with a presence on the internet to differentiate themselves from their competitors in a competitive marketplace (He & Harris, 2020). Even without proper implementation, digital branding can help businesses thrive in the 21st century economy because so many people are using it whenever they are searching for anything on their computer or phone (Davies, 2020).

The benefits of digital branding can easily outweigh the costs, but it is essential to be aware of the cost. Time is one of the most significant factors in implementing a robust digital brand strategy (Ketter & Avraham, 2021) as businesses begin to put together the brand by keeping time in mind. It takes time to plan and execute strategies so businesses can simultaneously take on multiple projects (Redjeki &Affandi, 2020). A thorough branding plan can help many businesses avoid taking on too much debt or making poor bu siness decisions that could potentially harm their brand image.

2.2 The Impact of COVID 19 on Digital Branding

COVID 19 is an emerging virus that is capable of spreading quickly. This phenomenon has led to the necessity of digital transformation strategies for the marketing industry. Marketing strategies are no longer limited to traditional methods; instead, they have become more innovative and strategic in light of current circumstances (Antúnez et al., 2021). Almost half (47%) of marketers say that their organization's website is the first place to recommend COVID 19 patients go for information (Wachyuni & Kusumaningrum (2020). Organizations recommend their websites first because it offers more comprehensive resources on the topic, which increases trustworthiness among visitors since there are no outside links or content to distract them from what they set out to share (Brand et al., 2020).

With the recent development of artificial intelligence, many companies have used it to optimize their content for various types of visitors. A study by Hasanat et al. (2020) stated that over 50% of e businesses would abandon a website if it took more than 3 seconds to load. It is also attributed to ad blockers installed on 40% of phones globally. Before investing in new domains and platforms, marketers should consider changing existing web pages (Villa & Monzon, 2021). Due to the decrease in customers, businesses are attempting to increase engagement. It can be primarily attributed to the rise of social media marketing which offers brands an additional platform to engage with customers (Guo et al., 2020).

Sobreira et al. (2020) said that with organizations almost to develop a website of usability smart phone half, so users relying customers can find mobile what phones they to identify looking COVID 19 for, symptoms, while marketers also have begun accessible to on change all how devices.

According to Naumovska & Zajac (2021), providing millennials more (aged localized 18 34) information spend. It is twice seen long by on the mobile increase websites in than number none of millennials smart phone. Shi et al. (2020) said their behaviors were over rising in identifying COVID 19 symptoms. Thus, marketers are moving away from traditional methods of marketing where they are only concerned about making sales; instead, they are now shifting strategies towards providing value and education through new media.

Due to the recent outbreaks, grocery retailers see an increase of 15% in the sales of hand sanitizers (Quyen, 2020). Some grocery stores install hand sanitizer dispensers, which will only dispense sanitizer if the customer uses a loyalty card or mobile app. It shows that customers are not only concerned about how to stop the virus, but they are also concerned about their health and how to protect themselves (Obeidat & Alomari, 2020; Priambodo et al., 2021). Thus, marketers should provide customers with information relevant to their search.

Further research has investigated a transformation to boost the market share by utilizing communication tools like digital media. Priambodo et al. (2021) stated that brands from Indonesia have an efficient communication strategy to reach the target audience and utilize word of mouth marketing to strengthen the brand image. Sharma (2020) and Reardon et al. (2021) claimed that brands rely on vital social media tools to reach customers quickly and influence their purchasing

behaviors. Even the concept of digital marketing improved during COVID 19, where most businesses had to be online to sell their products and services. According to Antunez et al. (2020), the digital channels and search engine optimization improve the digital channels during the COVID 19 outbreak. Prihadini (2020) said that digital marketing and branding strategies must influence customer perception and immediately create product needs. Communication channels like Instagram, Facebook, and YouTube improve the exchange of information and feedback worldwide.

Redjeki & Affandi (2020), with their focus on MSME players in Indonesia, have found that brands are adapting their marketing approach to a newly developed set of habits among customers. Aleksandra et al. (2021) agree with these findings and add that the digital branding ami d COVID signifies an ongoing endeavor to learn how to live with the changed scenario rather than trying to circumvent it. Rahman (2016) said it is worth mentioning that the CSR strategy of brands, which is supposed to contribute to their brand image, is leaning towards precautionary advice, such as staying at home and keeping a social distance. Ketter & Avraham (2021) said that the brands strive to align to the paradigm shift and treat the pandemic era as 'new normal.'

2.3 Theoretical Framework

The study has one independent variable (IV) and three dependent variables (DV) taken: increased market share, brand loyalty among customers, and the satisfaction level of businesses chosen.

The independent variable is digital branding during COVID 19. Digital branding is a term that describes the process of using digital and online methods to promote and market a company, product, or service. Digital branding can be used as an overall marketing strategy or stand alone practice. Digital branding is a strategy that combines brand management tactics and communication elements to create customer loyalty on internet channels in the long run. Branding has been a part of the advertising industry for decades. A brand is a set of promises a company makes to its customers and is demonstrated in everything they do. It is easier than ever to create a successful brand strategy in today's digital marketplace. The digital age has revolutionized the way brands communicate with consumers, but it has not changed the basic principles of branding: build (Visconti, 2020).

Market share will be analyzed to see whether the business profitability and sales have improved during COVID 19 after implementing the digital media platforms. It is a framework of how an organization communicates with its various publics through multiple channels. Digital branding can increase sales, gain market share, or inform target audiences about existing products and services offered by the company. It is a strategy to engage with customers and align products with the marketing trends. The essential marketing communication like public relations and digital marketing improves brand exposure and stays ahead of competitors (Das, 2021).

Social Media is a digital platform that provides brands with an opportunity to share and exchange information with a specific target audience by creating virtual communities. As social

media marketing continues to grow and evolve, so does the need for creative social media marketers.

Brand loyalty among customers refers to the people's perceptions of the brand. It is the second dependent variable of the research. Digital presence reflects a brand where businesses search for a specific brand on the internet or digital channels. There is no doubt that nowadays, creating and managing a digital presence is a must for every company. Every business needs to be online to reach its target audience. However, the internet landscape has changed drastically since the days of MySpace and face book, meaning that businesses need to adapt to stay relevant and attract customers to gain brand loyalty. There is a shift in the way we interact with brands and companies. This shift brings about a fundamental change to marketing and how businesses look at their customers. In this new era, consumers are taking control and driving the conversation, thereby creating an expectation for brands to be proactive in engaging them to gain loyalty (Moncey & Baskaran, 2020).

Satisfaction levels of businesses are the third dependent variable. COVID 19 Pandemic has entirely changed how businesses used to conduct their businesses. It is believed that the Pandemic has given rise to businesses innovatively and attracting customers through diverse platforms (Baker & Judge, 2020). This variable would be discussed to understand the impact of digital branding on businesses' satisfaction levels.

Increa sed Market share

Digital branding

Brand loyalty among customers

Satisfaction levels of businesses

Figure 1: Theoretical Framework and Key Variables of the Study.

3 Research Methodology

The researcher has relied on primary research to collect first hand information from the respondents in Saudi Arabia. The researcher has used quantitative research where the researcher has chosen an explicit independent variable and three dependent variables to analyze how digital branding has contributed to SMEs' performance during COVID 19. The questionnaire approach is used to achieve the objectives of quantitative research, where the researcher has prepared and distributed questionnaires to owners and managers from small and medium enterprises. The researcher has asked the respondents whether their company has adopted the digital branding approaches during COVID 19 and whether the market share, brand loyalty, and satisfaction level of business is improved or not. Digital branding is used as an independent variable, and market share, brand loyalty, and satisfaction level of business are used as dependent variables. Furthermore, the

researcher approaches only SMEs because they can tell better how their business has transformed after adopting digital media strategy and was it helpful for them to improve their financial performance during COVID 19. The researcher has approached over 120 respondents to improve the research generalize ability, and 100 surveys were selected for analysis. The research sample is not small because the researcher wants to achieve the research objectives. It is not too large because the researcher lacks time t o access a large group of respondents.

3.1 Research Analysis

The research analysis uses Microsoft Excel to find the relationship between dependent and independent variables. The researcher has used demographic analysis to find the proportion of different sampled respondents. The demographic analysis is presented in tabular and graphical form to improve the research readability (Rahman, 2016). The demographic analysis allows the company to reach the ideal respondent base.

The second analysis is conducted throu gh correlation analysis. The correlation analysis is a statistical approach to measure the strength of the linear relationship between independent and dependent variables. High correlation analysis shows a strong relationship between the variables, whereas a low correlation shows a weak relation (Davies, 2020).

The third analysis is conducted by using regression analysis. Regression analysis is a statistical process to estimate the relationship between variables by analyzing p value and ANOVA. It will be analyzed whether the results are significant and the value of p is below 0.05 (Davies, 2020).

4 Data Analysis

The report analyzes the data collected from the respondents in terms of demographic and variable analysis. The data is analyzed using percentage, correlation, regression, and graphical approaches to make the results understandable. The analysis is beneficial in finding how digital branding creates synergy for SMEs while acquiring maximum market share during COVID 19.

4.1

Demographic Questions

4.1.1 Type of Business

The analysis shows 37% of the respondents from the food business and restaurants; 9% from the IT business, 10% from the retail businesses, 16% from the service advisory businesses, and 28% from others.

Table 1: Type of Organizations

Type of Organization

Food business/ restaurants 37 IT business 9 Others 28 Retail business 10 Service advisory business 16 Others 28 Total 100

4.1.2

Duration of the Organization

The duration of the organization in figure 1 shows that 5% of the organizations are working less than one year. 13% of the organizations are 1 to 3 years old, 25% from 3 to 6 years old, and 57% are more than six years old.

Total, More than 6 years, 57 1 to 3 years 3 to 6 years

Less than one year More than 6 years

Total, 3 to 6 years, 25

Total, 1 to 3 years, 13

4.1.3 Current Location

Total, Less than one year, 5

Figure 2: Duration of the Organization

The current location of the respondent is analyzed in Figure 2. Respondents 60% are from Jeddah, 6% from Makkah, 19% from Riyad, 1% from Dammam, and 14% from other regions.

Figure 3: Current Location

4.2 Variable Questionnaire

4.2.1

Increase in Digital Media During COVID 19 Pandemic

The analysis shows that 94% of the respondents stated that their businesses had improved their dependence on digital marketing tools to attract customers.

Table 2: Digital Marketing Tools during COVID 19 Digital Marketing Tools during COVID 19 Disagree 1

Strongly Disagree 1

Neutral 4 Agree 18 Strongly Agree 76 Total 100

4.2.2 Averages of Dependent and Independent Variables

CSM is the communication through social Media taken as an independent variable. Market share (MS), brand loyalty (BL), and general feedback (GF) are dependent variables. The average CSM is 4.68, which means that the businesses are moving toward a powerful communication tool through social media. The average market share is 4.66, which is closer to the strongly agree. Similarly, the brand loyalty and general feedback are averaged at 4.63 and 4.74, which is closer to the strongly agree.

Table 3: Average of Dependent and Independent Variables

Average CSM Average MS Average BL Average GF

Mean 4.68 4.66 4.63 4.74 SD 0.56 0.59 0.63 0.54

4.3 Correlation Analysis

The correlation analysis strengthens the relationship between dependent and independent variables. The value ranges from 1 to +1 to analyze the strength between two variables. If the correlation value is below 0.3, it is weak, and above 0.7, it is strong. Communication through social media is the independent variable that has a strong relationship with the market share, brand loyalty, and general feedback of customers. The relationship with these dependent variables is 0.79, 0.75, and 0.84, where the values are closer to 1. In this way, it can be stated that there is a positive relationship between independent variables and dependent variables.

Table 4: Correlation

CSM MS BL GF CSM 1 MS 0.79 1 BL 0.75 0.83 1 GF 0.84 0.82 0.77 1

4.4 Regression Analysis

The regression analysis understands the relationship between a set of dependent and independent variables. The results are presented in Table 5.

The analysis in Table 5 states that the correlation among variables is 0.86, which is a strong relationship among variables. The significance F value is below 0.05, which means that the results generated are statistically significant. The relationship among variables is linked to the p value to determine whether a significant relationship occurs among variables. The p value of all three variables is below 0.05, which means that the null hypothesis is rejected as there is a strong relationship between dependent and independent variables. The t stat is also higher than the p value,strengthening our claim that communication through digital channels substantially impacts the market share, strengthens the customers' loyalty, and gets positive feedback from respondents.

Regression

Statistics

Multiple R 0.862 R Square 0.742

Adjusted R Square 0.734 Standard Error 0.288

Observations 100 ANOVA

Df SS MS F Significance F

Regression 3 23.000 7.667 92.214 3.7E 28 Residual 96 7.982 0.083 Total 99 30.982

Coefficients Standard Error t Stat P value

Intercept 0.442 0.257 1.720 0.088 MS 0.218 0.103 2.103 0.03 BL 0.134 0.085 1.575 0.018 GF 0.550 0.098 5.636 1.7E 07

5 Discussion

The results show that digital marketing has a vital role in strengthening customer relationships and improving the market share. The respondents in our sample size understand the importance of digital marketing and their role in improving brand loyalty in Saudi Arabia during COVID 19. These results are similar to Baker & Judge (2020), who states that digital marketing has been positive during the COVID 19 Pandemic as it assisted businesses improve their brand presence and reach a broad customer base, which was not possible before the pandemic situation. According to Guo et al. (2020), the small businesses during the Pandemic benefitted more as they understood the importance of digital media to spread the brand message region wide. Businesses that showed reluctance to be modernized suffered more during the Pandemic. Digital media has given rise to several new businesses that grab the opportunity of surviving and initiating new ideas. Similarly, Reardon et al.'s (2021) result also supports our research results and concludes that the COVID 19 has given rise to the excessive use of e commerce, particularly in developing countries. These regions were slow in adopting the new business trends and ways to conduct the business; however, the Pandemic has provided them with an opportunity to think out of the box to expand their business roots. It ultimately strengthens businesses' abilities to grab more customers and make a meaningful influence on the brand and the community. These results align with our research that digital marketing ultimately boosts brand loyalty, consumers' perspective toward the brand, and ultimately the market share.

6 Conclusion

The unprecedented spread of COVID 19, its mortality rate, and its contagion potential have presented several new problems for global markets. Digital technologies are powerful tools for alleviating anxiety and depressive symptoms, which will keep customers engaged in a meaningful life during this period of high uncertainty. It has been demonstrated that digital media can enhance

and benefit companies through advertising revenue. They have also shown that there are areas where this effect does not exist. A study was conducted in Saudi Arabia to examine whether this positive relationship would still be seen if we examined only for those areas where a website was displayed and what it would take to gain that exposure.

The research considers the changing role of digital marketing and online advertising as organizations use new media technologies to facilitate interactions with customers and respond to market demands. Specifically, we develop a framework for understanding how businesses adopt new media technologies, analyze their decision making processes, and demonstrate how these are linked to firms' objectives and behavior (Brand et al., 2020). New media technologies can improve market performance by providing additional sources of customer feedback, enabling quick access to consumer needs, improving a firm's flexibility, and potentially facilitating innovation. They can also enhance brand equity by offering ways to connect with existing and potential customers. However, they may lead to over control and distraction from daily tasks. These conclusions guide future research on new media technologies in business contexts.

The information was collected through secondary resources to trigger the innovation decisions by utilizing digital media. Businesses need to emphasize daily production, where the reliance is on maximizing the profit of an organization. The extensive use of social me dia platforms enhances performance without implementing modern marketing methods (Cinelli et al., 2021). Digital media could lead to better customer loyalty, market share, and good customer feedback. The results are collected from 100 Saudi Arabian enterprises to determine the role of digital media in improving performance. The results demonstrate that digital media has positively impacted all sectors and utilizes external and internal knowledge to strengthen innovation.

Digital Media is used as a digital platform to maintain the connection and affect the business's performance. The social media platforms like Facebook and Instagram lead to professional networking like blogging. Social media needs to develop brand communities by improving customer interacti on and understanding their viewpoints. The business created a platform and strengthened the innovative capacity for customers (He & Harris, 2020). The businesses that have adopted modern methods during the Pandemic are more inclined to sustain a competitive advantage. Emphasizing digital media needs to strengthen the relationship between digital media and organizational performance. Digital media platforms put valuable insights into the consumers' decisions and transform innovative ideas into new technology . Social media and digital tools encourage innovation's openness to reach the end customers and play an existential role in attracting a strengthening target market. In Saudi Arabia, enterprises had an opportunity to interact with stakeholders and consumers to improve organizations' performance and market share.

7 Availability of Data and Material

Data can be made available by contacting the corresponding author.

References

Aleksandra, K., Ivona, V. R., &Antonija, P. (2021). Strategic and digital marketing in cultural institutions and the impact of the COVID 19 Pandemic A comparative analysis of two case studies Interdisciplinary Description of Complex Systems, 19(2), 257 280. DOI: 10.7906/indecs.19.2.6

Almeida, F., Santos, J. D. & Monteiro, J. A. (2020). The challenges and opportunities in the digitalization of companies in a post COVID 19 world. IEEE Engineering Management Review, 48(3), 97 103. DOI: 10.1109/EMR.2020.3013206

Alshaketheep, K. I., Salah, A. A., Alomari, K. M., Khaled, A. &Jray, A. (2020). Digital marketing during COVID 19: Consumer's perspective. WSEAS Transactions on Business Economics, 17, 831 841. DOI: 10.37394/23207.2020.17.81

Antúnez, L., Alcaire, F., Brunet, G., Bove, I. & Ares, G. (2021). COVID washing of ultra processed products: the content of digital marketing on Facebook during the COVID 19 Pandemic in Uruguay. Public Health Nutrition, 24(5), 1142 1152 DOI: 10.1017/S1368980021000306

Baker, T. & Judge, K. (2020). How to help small businesses survive COVID 19? Law & Economic Studies Working Paper No, 620, 1 12. https://scholarship.law.columbia.edu/faculty_scholarship/2639

Brand, C., Schwanen, T. &Anable, J. (2020). 'Online Omnivores' or 'Willing but struggling'? Identifying online grocery shopping behavior segments using attit ude theory. Journal of Retailing and Consumer Services , 57. DOI: 10.1016/j.jretconser.2020.102195

Cinelli, M., Morales, G. D. F., Galeazzi, A., Quattrociocchi, W. &Starnini, M. (2021). The echo chamber effect on social media. Proceedings of the National Academy of Sciences , 118(9), 1 8. DOI: 10.1073/pnas.2023301118

Das, S. (2021). A Systematic Study of integrated marketing communication and content management system for millennial consumers. Innovations in Digital Branding and Content Marketing, 91 112. DOI: 10.4018/978 1 7998 4420 4.ch005

Davies, C. (2020). A quick guide to quantitative research in the social sciences. Wales Academy of Professional Practice and Applied Research, 1 27 https://repository.uwtsd.ac.uk/id/eprint/1540/18/A%20quick%20guide%20to%20quantitative%20research %20in%20the%20social%20sciences.pdf

Guo, H., Liu, Y., Shi, X. & Chen, K. Z. (2020). The role of e commerce in the urban food system under COVID 19: Lessons from China. China Agricultural Economic Review, 13(2), 436 455. DOI: 10.1108/CAER 06 2020 0146.

Hasanat, M. W., Hoque, A., Shikha, F. A., Anwar, M., Hamid, A. B. A. H. & Tat, H. H. (2020). The impact of Coronavirus (Covid 19) on e business in Malaysia. Asian Journal of Multidisciplinary Study, 3(1), 85 90. He, H., & Harris, L. (2020). The impact of COVID 19 Pandemic on corporate social responsibility and marketing philosophy. Journal of Business Research, 116, 176 182. DOI: 10.1016/j.jbusres.2020.05.030

Ketter, E., & Avraham, E. (2021). #StayHome today so we can #TravelTomorrow: Tourism destinations' digital marketing strategies during the COVID 19 Pandemic. Journal of Travel & Tourism Marketing, 1 14. DOI: 10.1080/10548408.2021.1921670

Moncey, A. A. &Baskaran, K. (2020). Digital marketing analytics: Building brand awareness and loyalty in UAE. 2020 IEEE International Conference on Technology Management, Operations and Decisions (ICTMOD), DOI: 10.1109/ICTMOD49425.2020.9380579

Naumovska, I. &Zajac, E. J. (2021). How inductive and deductive generalization shape the guilt by association phenomenon among firms: Theory and evidence. Organizational Science, 1 20. DOI: 10.1287/orsc.2021.1440

Obeidat, M. M. &Alomari, M. A. (2020). The effect of inductive and deductive teaching on EFL undergraduates' achievement in grammar at the Hashemite University in Jordan. International Journal of Higher Education, 9(2), 280 288. DOI: 10.5430/ijhe.v9n2p280

Priambodo, I. T., Sasmoko, S., Abdinagoro, S. B. &Bandur, A. (2021). E commerce readiness of the Creative industry during the COVID 19 Pandemic in Indonesia. Journal of Asian Finance, Economics & Business, 8(3), 865 873.

Quyen, T. H. (2020). The relationship between green procurement practices and organizational performance in the manufacturing industry of Vietnam. Journal of Business Management & Accounting, 4(1), 1 16.

Rahman, M. D. (2016). The advantages and disadvantages of using qualitative and quantitative approaches and methods in language "testing and assessment" research: A literature review. Journal of Education and Learning, 6(1), 102 112.

Reardon, T., Heiman, A., Lu, L., Nuthalapati, C. S. R., Vos, R. &Zilberman, D. (2021). "Pivoting" by food industry firms to cope with COVID 19 in developing regions: E commerce and "copfivoting" delivery intermediaries. Agricultural Economics, 17, 1 17. DOI: 10.1111/agec.12631

Redjeki, F., &Affandi, A. (2020). Utilization of Digital Marketing for MSME Players as Value Creation for Customers during the COVID 19 Pandemic. International Journal of Science Society, 3(1), 40 55.

Sharma, K. (2020). A surge in e commerce market in India after Covid 19 Pandemic. Global Journal of Social Science, 3(4), 54 57.

Shi, S., Wang, Y., Chen, X. & Zhang, Q. (2020). Conceptualization of omnichannel customer experience and its impact on shopping intention: A mixed method approach. International Journal of Information Management, 50, 325 336. DOI: 10.1016/j.ijinfomgt.2019.09.001

Sobreira, D., de Oliveira, D. S. & Garcia Penalvo, F. J. (2020). The use of Instagram as a digital marketing tool by the Brazilian Library Councils in times of Covid 19. Eighth International Conference on Technological Ecosystems for Enhancing Multiculturality (TEEM'20), 1 6. DOI: 10.1145/3434780.3436599

Villa, R. &Monzon, A. (2021). Mobility restrictions and e commerce: Holistic balance in Madrid Ce ntre during COVID 19 lockdown. Economics, 9, 57 75. DOI: 10.3390/economies9020057.

Visconti, R. M. (2020). The valuation of trademarks and digital branding. The Valuation of Digital Intangibles Journal, 237 266. DOI: 10.1007/978 3 030 36918 7_9

Wachyuni, S. S. &Kusumaningrum, D. A. (2020). The Effect of COVID 19 Pandemic: How is the future tourist behavior? Journal of Education, Society and Behavioural Science, 33(4), 67 76. http://www.sdiarticle4.com/review history/57217

Wang, X. & Cheng, Z. (2020). Cross sectional studies: Strengths, weaknesses, and recommendations. Chest, 158(1), 65 71. DOI: 10.1016/j.chest.2020.03.012

Young, M., Varpio, L., Uijtdehaage, S. and Paradis, E. (2020). The spectrum of inductive and deductive research approaches using q uantitative and qualitative data. Academic Medicine, 95(7), 1122.

Ola Amer is a digital marketing manager at Eskelah. Her work focuses specifically on digital marketing strategies and planning.

Dr. Asma Zaheer is an Associate Professor at the Department of Marketing, King Abdulaziz University, Jeddah, Saudi Arabia

:: International Transaction Journal of Engineering, Management, & Applied Sciences & Technologies

http://TuEngr.com

Call for Papers:

ITJEMAST invites you to submit high quality papers for full peer review and possible publication in areas pertaining to our scope including engineering, science, management and technology, especially interdisciplinary/cross disciplinary/multidisciplinary subjects.