Veterinaria Italiana, Volume 50 (4), October-December 2014

ISSN 0505-401X

Volume 50 (4)

Ottobre-Dicembre October-December

2014

Rivista trimestrale di Sanità Pubblica Veterinaria, edita dall’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” A quarterly journal devoted to veterinary public health, veterinary science and medicine, published by the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ in Teramo, Italy

Volume 50 (4), 2014

Barend Cornelis Koekkoek (Middelburg, 1803 - Kleve, 1862) Italiaans landschap, Paesaggio italiano, Italian landscape, 1848 Olio su tela/Oil on canvas, cm 53 x 63 Rijksmuseum, Amsterdam Su un sentiero di montagna, sotto alcuni alberi, un pastore e un uomo a cavallo si fermano a parlare.

A sinistra un ruscello, in lontananza il profilo di una montagna e un castello.

A shepherd and a man on horseback are talking, under some trees, on a mountain trail. On the left-hand side there is a brook and in the background one can see a mountain and a castle.

Si ringrazia il Rijksmuseum di Amsterdam per l’immagine di copertina.

We would like to express our gratitude to the Rijksmuseum in Amsterdam for the cover image. www.rijksmuseum.nl

Questa rivista è nata nel 1950 con il nome di Croce Azzurra.

Dal 1954 si chiamerà Veterinaria Italiana.

Comitato direttivo Managing Scientific Board Romano Marabelli Fernando Arnolfo

Direttore Editor-in-Chief Giovanni Savini

Membri onorari Honorary Members Hassan Abdel Aziz Aidaros – Egypt Ayayi Justin Akakpo – Senegal Nicola T. Belev – Bulgaria Louis Blajan – France Stuart C. MacDiarmid – New Zealand J. Gardner Murray – Australia Yoshihiro Ozawa – Japan Alexander N. Panin – Russia

Victor E. Saraiva – Brazil Aristarhos M. Seimenis – Greece Arnon Shimshony – Israel Samba Sidibé – Mali James H. Steele – United States of America Gavin R. Thomson – South Africa Carlo Turilli – Italy Norman G. Willis – Canada

Comitato di redazione Editorial Board Maria Cesarina Abete – Italy Marina Bagni – Italy Gioia Capelli – Italy Pierfrancesco Catarci – Italy Giovanni Cattoli – Italy Annamaria Conte – Italy Paolo Cordioli† – Italy Esterina De Carlo – Italy Antonio Fasanella – Italy Rosario Fico – Italy Adriana Ianieri – Italy

Valerio Giaccone – Italy Ciriaco Ligios – Italy N. James MacLachlan – United States of America Paola Nicolussi – Italy Janusz Paweska – South Africa Giovanni Pezzotti – Italy Roberto Piro – Italy Giuseppe Ru – Italy Fabrizio Vitale – Italy Stéphan Zientara – France

Comitato scientifico Scientific Advisory Board L. Garry Adams – United States of America Menachem Banai – Israel Elie K. Barbour – Lebanon A.C. David Bayvel – New Zealand Giorgio Battelli – Italy Roy G. Bengis – South Africa Ingrid E. Bergmann – Argentina Peter F. Billingsley – United States of America Silvio Borrello – Italy Canio Buonavoglia – Italy Mike Brown – United Kingdom Gideon Brücknerr – South Africa Giovanni Cattoli – Italy Bernadette Connolly – United Kingdom Julio De Freitas – Brazil Piergiuseppe Facelli – Italy Gianluca Fiore – Italy Cesidio Flammini – Italy Riccardo Forletta – Italy Bruno Garin-Bastuji – France Giorgio Giorgetti – Italy Rob Gregory – New Zealand

Anwar Hassan – Malaysia Barry J. Hill – United Kingdom Katsuyuki Kadoi – Japan Bruce Kaplan – United States of America R. Paul Kitching – Canada Corinne I. Lasmézas – France Salvatore Magazzù – Italy Franco Mutinelli – Italy Klaus Nielsen – Canada Lisa Oakley – New Zealand Massimo Palmarini – United Kingdom Attilio Pini – Italy Santino Prosperi – Italy Franco M. Ruggeri – Italy Domenico Rutili – Italy Paul Sutmoller – The Netherlands Peter M. Thornber – Australia Silvio Arruda Vasconcellos – Brazil Patrick Wall – Ireland Alexander I. Wandeler – Canada Kazuya Yamanouchi – Japan Cristóbal Zepeda – United States of America

Segreteria di redazione Associate Editors Monica Bucciarelli, Guido Mosca, Mariarosaria Taddeo, Carlo Turilli Recensioni Book reviews Manuel Graziani Progetto grafico e web Graphic and web design Paola Di Giuseppe Amministrazione Administration Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia veterinariaitaliana@izs.it Stampa Printer Giservice srl, Teramo, Italia http://www.izs.it/vet_italiana/index.html © 2014 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia

ISSN 0505-401X Formato elettronico Electronic format ISSN 1828-1427 Stampato su carta ecologica TCF Printed on 50% recycled, 100% chlorine- and acid-free environmentally friendly paper Aut. Trib. Teramo n. 299 del 16/05/1990 Sped. in Abb. Post. Art. 2 comma 20/c L. 66/96 DCB/DC Abruzzo Pescara

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 TERAMO, Italia telefono +39 0861 3321, fax +39 0861 332251 www.izs.it

Volume 50 (4), 2014 Aurelio Muttini, Michele Abate, Nicola Bernabò, Francesco Cavani, Rossella Mingozzi, Umberto Tosi, Matteo Cadossi, Stefania Setti, Sandro Giannini, Rocco Leone & Luca Valbonetti Effect of electric current stimulation in combination with external fixator on bone healing in a sheep fracture model........... 249-257 Thomson Reuters Science Journal Citation Reports® database (JCR/Science Edition®) Journal impact factor 2013: 0.675

Effetto della stimolazione elettrica associata a fissatore esterno nella guarigione ossea in un modello di frattura nella pecora (riassunto)............................. 249

• National Library of Medicine’s MEDLINE/ PubMed system

Miloš Petrović, Silvio Špičić, Aleksandar Potkonjak, Branislav Lako, Miloš Kostov & Željko Cvetnić First evidence of Brucella ovis infection in rams in the Pirot Municipality, Serbia ........................................................ 259-268

• Thomson Reuters Science Citation Index Expanded™ (SciSearch®) • CABI’s Full-Text Repository • Directory of Open Access Journals (DOAJ) • Elsevier’s SciVerse Scopus

Le pubblicazioni dell’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” (IZSAM) sono protette dalla legge internazionale sul copyright. Gli estratti possono essere letti, scaricati, copiati, distribuiti, stampati, recuperati; è consentito inoltre il collegamento ai file pdf di Veterinaria Italiana.

Informazioni per fini commerciali devono essere richieste all’IZSAM. Le traduzioni a stampa e gli adattamenti sono consentiti previa autorizzazione scritta da parte dell’IZSAM. Le opinioni espresse negli articoli pubblicati sono esclusivamente sotto la responsabilità degli autori. L’eventuale citazione di specifiche Ditte o prodotti, siano essi brevettati o meno, non implica che essi siano stati consigliati dall’IZSAM e vengano preferiti ad altri di simile natura non menzionati nei testi.

Publications of the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ (IZSAM) are protected by international copyright law. Users are permitted to read, download, copy, distribute, print, search abstracts; besides they can link to Veterinaria Italiana full pdf files. Should information be required for commercial purposes, prior written permission must be sought from the IZSAM. Published translations and adaptations also require prior written approval from the IZSAM. The views expressed in signed articles are solely the responsibility of the authors. The mention of specific companies or products of manufacturers, whether or not patented, does not imply that these have been endorsed or recommended by the IZSAM in preference to others of a similar nature that are not mentioned.

Infezione da Brucella ovis in arieti del distretto di Pirot in Serbia meridionale (riassunto)...................................................................................................... 259

Abdelfattah M. Selim, Mahmoud M. Elhaig & Wolfgang Gaede Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus .................................................................. 269-275 Sviluppo di un test multiplex real-time PCR per il rilevamento di Brucella spp., Leptospira spp. e Campylobacter foetus (riassunto)................................... 269

Gokben Ozbey & Bulent Tasdemir Seasonality and antibiotic resistance of Campylobacter in Turkish chicken meat ....................................... 277-283 Variazioni stagionali e resistenza ad antibiotici del Campylobacter in campioni di carne di pollame in Turchia (riassunto)................................................................ 277

Elena Andreoli, Enrico Radaelli, Irene Bertoletti, Alessandro Bianchi, Eugenio Scanziani, Silvia Tagliabue & Silvana Mattiello Leptospira spp. infection in wild ruminants: a survey in Central Italian Alps........................................................... 285-291 Infezione da Leptospira spp. in ruminanti selvatici: indagine nelle Alpi Centrali italiane (riassunto)............................................................................. 285

Tea Meloni, Piera A. Martino, Valeria Grieco, Maria C. Pisu, Barbara Banco, Alessandro Rota & Maria C. Veronesi A survey on bacterial involvement in neonatal mortality in dogs............................................................. 293-299 Studio del ruolo delle infezioni batteriche nella mortalità neonatale dei cani (riassunto)............................................................................... 293

Volume 50 (4), 2014 CASE REPORT Anna Rita D’Angelo, Gabriella Di Francesco, Gina Rosaria Quaglione & Giuseppe Marruchella Sclerosing peritoneal mesothelioma in a dog: histopathological, histochemical and immunohistochemical investigations ....................................... 301-305 Mesotelioma sclerosante peritoneale in un cane: indagini istopatologiche, istochimiche e immunoistochimiche (riassunto).......................... 301

SHORT COMMUNICATION Daniela Salvatore, Sara Aureli, Raffaella Baldelli, Antonietta Di Francesco, Maria Paola Tampieri & Roberta Galuppi Molecular evidence of Leishmania infantum in Ixodes ricinus ticks from dogs and cats, in Italy............................. 307-312 Analisi molecolare di Leishmania infantum in zecche Ixodes ricinus da cani e gatti in Italia (riassunto)....................................................... 307

SHORT COMMUNICATION Antonietta Di Francesco, Mauro Delogu, Federica Giacometti, Laura Stancampiano, Ester Grilli, Ilaria Guarniero & Andrea Serraino First detection of Arcobacter sp. in Eurasian collared doves (Streptopelia decaocto).......................... 313-315 Prima evidenziazione di Arcobacter sp. in tortore dal collare (Streptopelia decaocto) (riassunto)......................................................... 313

LIBRI/Book reviews Marta Avanzi Procedure cliniche e terapeutiche negli animali esotici .................................317 Attilio Pini Un veterinario a spasso per il mondo tra guerre, colonialismo e apartheid ........................................................................319

Effect of electric current stimulation in combination with external fixator on bone healing in a sheep fracture model Aurelio Muttini1*, Michele Abate2, Nicola Bernabò1, Francesco Cavani3, Rossella Mingozzi4, Umberto Tosi1, Matteo Cadossi5, Stefania Setti6, Sandro Giannini5, Rocco Leone7 & Luca Valbonetti1 Department of Compared Biomedical Sciences University of Teramo, Italy.

Department of Medicine and Sciences of Aging, University “G. d ’Annunzio” Chieti-Pescara, Italy.

3 Department of Biomedical, Metabolic and Neural Sciences, University of Modena and Reggio Emilia, Italy.

4 CITIEFFE s.r.l., Calderara di Reno (Bologna), Italy.

5 Department of Orthopaedic Surgery Rizzoli, Orthopaedic Institute, University of Bologna, Italy.

6 IGEA, Clinical Biophysics, Carpi (Modena), Italy.

7 Practitioner.

1

2

* Corresponding author at: Clinica Chirurgica Veterinaria, Università degli Studi di Teramo, Piazza A. Moro 45, 64100 Teramo, Italy.

Tel.: +39 0861 266034, Fax: +39 0861 266558, e-mail: amuttini@unite.it.

Veterinaria Italiana 2014, 50 (4), 249-257. doi: 10.12834/VetIt.271.963.2 Accepted: 14.09.2014 | Available on line: 29.12.2014

Keywords Biophysical stimulation, Bone healing, Electricity, External fixator, Orthopedic treatment

Summary Biophysical stimulations with electric and electromagnetic fields have been demonstrated to accelerate the bone-healing rate. This study has been designed to investigate the effects of electricity directly connected with the central pins of an external fixator in an experimental osteotomy model in sheep. Thirty mg/kg of tetracycline chloride were administered on the 30th and on the 45th day after surgery for histomorphometric studies. Plain radiographs were obtained in standard projections every 15 days after surgery and were analyzed with a software program (Corel Photo-Paint Pro X2, Corel Corporation, Ottawa, Canada). The specimens obtained after 60 days were examined with histological analysis. The results show that biophysical treatment with alternating electricity in combination with external fixator enhances new-bone formation. The translational value of this study, due to the similarities between ovine and human species, suggests that this treatment could be useful in speeding the bone-healing rate both in animals and humans.

Effetto della stimolazione elettrica associata a fissatore esterno nella guarigione ossea in un modello di frattura nella pecora Parole chiave Corrente elettrica, Fissatore esterno, Guarigione ossea, Stimolazione biofisica, Trattamento ortopedico.

Riassunto La stimolazione biofisica con campi elettrici ed elettromagnetici è efficace nell'accelerare la guarigione del tessuto osseo. Scopo del presente studio è stato quello di investigare gli effetti dei campi elettrici in un sistema direttamente collegato alla vite del fissatore esterno in un modello sperimentale animale (pecora) di osteotomia. Dopo 30 e 45 giorni dall'intervento sono stati somministrati trenta mg/kg di tetraciclina per eseguire studi di istomorfometria e sono state eseguiti esami radiografici secondo modalità standard ogni 15 giorni, poi valutati mediante ad hoc software. Infine i campioni ottenuti dopo 60 giorni sono stati esaminati mediante esame istologico. I nostri risultati indicano che il trattamento biofisico con correnti elettriche alternate e l'utilizzo di un fissatore esterno, favorendo la formazione di nuovo tessuto osseo, accelera il processo di guarigione tissutale. Il valore traslazionale di questo studio suggerisce che questo trattamento possa essere utilizzato con successo in medicina umana.

249

Muttini et al.

Electric current stimulation in sheep bone healing

Introduction A long-standing interest exists about the use of various forms of biophysical stimulation that could positively affect the growth, strength and remodeling of tissues. Since Fukada and Yasuda (1957) first reported electrical phenomena in bone, many reports have been published about the effects of electricity on bone and cartilage (Akai and Hayashi 2002, Massari et al. 2007). It has been stated that, as the stimulation modalities are different in their physics and biochemistry, each modality produces a variety of biological responses in a wide range of animal models (Black 1985). Early references showed that various modalities of direct and pulsatile currents are effective enhancers of bone healing (Hassler et al. 1977). More recently it has been demonstrated that electric and electromagnetic fields can increase gene expression for - and synthesis of - growth factors, including several bone morphogenetic proteins (BMPs) and transforming growth factors (TGF), mainly TGF-ß1 (Aaron et al. 2004), which may enhance endochondral bone formation. Biophysical stimulation techniques, including Capacitively Coupled Electric Field (CCEF) and Pulsed Electro Magnetic Field (PEMF), have been used in clinical trials to treat fresh fractures and osteotomies, spine fusions, and delayed and non-union fractures (Aaron et al. 2004). Capacitively Coupled Electric Field has also been demonstrated to accelerate osteoblast like cells proliferation and to increase bone extracellular matrix (Hartig et al. 2000). Although an experimental comparative (untreated controls) trial in dogs suggests that CCEF can delay the recovery of bone strength during distraction osteogenesis (Pepper et al. 1996), several experimental and clinical studies indicate that CCEF can accelerate the bone-healing rate in various situations including stress fractures (Brighton et al. 1985 and 1989, Beck et al. 2008, Benazzo et al. 1995), lumbar spinal fusions (Goodwin et al. 1999) and non‑union (Brighton and Pollack 1985, Impagliazzo et al. 2006, Scott and King 1994).

In 2008, a novel external fixator coupled with an alternating electric current stimulation device has been developed for the treatment of distal radius fractures (Itoh et al. 2008). This system exploits a capacitive setting since the fixation pins are utilized as electrodes. However, the fracture location was in a non-weight bearing bone and the stability of the device was not a challenge factor. Various methods have been described to evaluate the newly formed bone in experimentally stimulated tissue, including radiographic analysis, biomechanical testing (Hantes et al. 2004, Malizos et al. 2006), quantitative computerized tomography, and ultrasound system, histological (Canè et al. 1991) and biochemical analysis (Lorich et al. 1998). To our knowledge, there has been no previous attempt to conduct an experimental study evaluating the effects of CCEF on

250

an osteotomy gap in a large animal model using an histological analysis. On the basis of these premises, the present study has been designed to determine the efficacy of an alternating electric current derived from a CCEF stimulator directly connected with the pins of an external fixation device in the healing of a large osteotomy created in the tibial midshaft of adult sheep.

Materials and methods Animals The study was conducted in compliance with the Italian Animal Welfare guidelines1. It was performed on 8 adults, 2-year old, appenninica breed sheep, 62‑70 kg of weight. The sheep were bred according to the European community guidelines2. To investigate the efficacy of an alternating electricity derived from a CCEF stimulator on fracture healing, animals were randomly divided in 2 groups: the stimulation group (SG) and the control group (CG).

External fixator The device for external fixation was custom made and was developed by Citieffe s.r.l. (Calderara di Reno, Bologna Italy). Briefly, in the configuration used for this study, it is composed of 6 transcortical stainless steel bone screws, a radiolucent rod, and 6 clamps (for pin/rod connection). The radiolucent rod, made up in polyether ether ketone (PEEK), measured 12 mm in diameter and 160 mm in length and allowed radiographic examinations. The bone screws came with a self-drilling and self-tapping tip and do not require pre-drilling, except in case of extremely hard bone cortex. Besides the bone screws have a 2 diameter profile, which allows for better balancing stress distribution. They are made of AISI 316L stainless steel and are 5/6 mm in diameter and 120 mm in length. The clamps, made of in Avional 2024, allow for the insertion, for each segment of the rod, of 2 screws in parallel position and a third one with an angle of about 30°.

Surgical procedure After 2 weeks of animal quarantine, surgical procedures were conducted in an authorized equest of authorisation - Prot. n. 407 on 24.09.2008. European R Commission (EC). 1986. Council Directive 86/609/EEC on the approximation of laws, regulations and administrative provisions of the Member States regarding the protection of animals used for experimental and other scientific purposes. Off J, L 358, 18/12/1986.

2 D ecreto Legislativo 27 January 1992 n. 116. Attuazione della direttiva n. 86/609/CEE in materia di protezione degli animali utilizzati a fini sperimentali o ad altri fini scientifici. Off J, 40, 18.02.1992 (Suppl Ordinario n. 33).

1

Veterinaria Italiana 2014, 50 (4), 249-257. doi: 10.12834/VetIt.271.963.2

Muttini et al.

veterinary hospital. Animals did not receive food for 12 hours prior to surgery. Anaesthesia was accomplished as follows: sedation with xylazine (0.2 mg/ kg i.m; Rompun®; Bayer), diazepam (0.2 mg/ kg i.v.; Diazepam® 0.5; Intervet), and atropine sulfate (6 mg i.m.; atropine sulfate; Fort Dodge); induction with ketamine (10 mg/kg i.m.; Ketavet® 100; Intervet) and, after endotracheal intubation, maintenance by inhalation of 2.5 % halothane (Halotane®; Merial) in oxygen. Saline was also administered intravenously throughout the procedure. A gastric tube was inserted and maintained for the entire procedure. The left pelvic limb was prepared under sterile conditions.

As previously described for experimental sheep osteotomy models (Malizos et al. 2006), an unilateral, 1-plane external fixation device was implanted on the lateral surface of the tibia, followed by a midshaft osteotomy on the medial side. Four pins were inserted, through stab incisions of the skin, in the proximal and distal third of the tibia (approximately 30 mm distal to the knee and 30 mm proximal to the tarsus) on its antero‑lateral surface. Rarely, when the bone cortex was too hard to drill through, the insertion of the pin was preceded by a pre-drilling with a 3.5 mm drill bit under constant cooling with sterile saline. A suture stitch with non-absorbable suture tape was applied, when indicated, to prevent the incoming of infection. To increase the stability, 1 pin was then inserted between the 2 pins of the proximal pair and 1 pin was inserted between the 2 pins of the distal pair, obtaining a unilateral 2-plane configuration (Figure 1). The pins were firmly secured to the rod by the clamps. The limb was then elevated and the osteotomy was realized on the medial side of the tibia. Briefly, a skin incision was made between the 2 central

Electric current stimulation in sheep bone healing

pins through a 3.5 cm-long straight longitudinal incision. The fascia was incised and the periosteum incised and carefully stripped medially and laterally. A complete transverse osteotomy was then performed. With the help of Homan levers soft tissues were divaricated and some 3.5 mm holes were drilled circumferentially in the tibial diaphisis; each hole encompassed proximal and distal bone cortex. The drillings were cooled with sterile saline to avoid heating of the bone tissue.

When necessary, the osteotomy was completed with an osteotome. Immediately after the completion of the osteotomy a visible gap formed between the bony fragments. Fascia and skin were routinely closed. A soft well padded bandage was finally applied encompassing the external fixator and leaving the extremities of the pins uncovered for electric stimulator connection. The animals were allowed unrestricted activity in the in sheep pen after the recovery from the anaesthesia, and were observed daily for fitness, wound-healing, and development of pin-track infection. The pins and the skin around the penetration points were daily cleaned and treated with povidone iodine (Betadine® 10% Gel, Mundipharma Basilea, Switzerland). Animals were euthanized at 60 days after surgery.

Technical development Electrical stimulation was delivered through a portable medical device. It was a properly modified CCEF stimulator for bone growth (OsteoBit BS1, IGEA, Carpi, Italy); the generator was able to deliver an alternating electricity of 1500µA in the region of interest. The electric signal consists of electrical pulses of 12.5 Hz with a duty cycle of 50% (40 msec).

The active part of the burst is a sine wave at 60kHz with an amplitude adjusted by a microprocessor according to the impedance of the body interposed between the electrodes. The stimulation device has been used in conjunction with the Citieffe external fixator and it was attached to it with a dedicated adapter. The central pins of external fixator were employed as electrodes to deliver the alternating current in the fracture site.

Electrical stimulation

Figure 1. Unilateral, two-plane configuration of the external fixator assembled on the antero-lateral suface of the left tibia of 1 of the on 8 adults, 2-year old, appenninica breed sheep considered in this study.

Veterinaria Italiana 2014, 50 (4), 249-257. doi: 10.12834/VetIt.271.963.2

Four animals were randomly selected and assigned to SG, while 4 animals were assigned to CG. On the second post-operative day (POD), the stimulation device was connected to the central pins (proximal and distal, nearest to the osteotomy), by means of electric leads connected to the stimulator that was secured to the sheep thorax with an elastic bandage (caudal to the elbow to allow free movements and avoiding

251

Muttini et al.

Electric current stimulation in sheep bone healing

Figure 2. Radiological study performed by comparing 2 identical sampling areas at the level of the osteotomy and normal cortical bone of the 8 adults, 2-year old, appenninica breed sheep.

Halfway longitudinal section of the tibial diaphysis

Osteotomy line

Microtome sectioned area for histological analysis

Newly formed trabecular bone around osteotomy line. The bone tissue is labeled with tetracycline chloride

Figure 3. Schematic representation of the specimen cut for histological analysis. stimulator dislodgement). Electrical stimulation was delivered to SG for 12 hours daily (from 8 am to 8 pm). The sheep of CG had the same assembly but the stimulator was always switched off.

Rx examination Radiological evaluation was carried out at POD 1, 15, 30, 45 and 60. The radiographs have been obtained with a Computer Radiography System (AGFA Solo CR Digitizer, Agfa HealthCare NVB-2640 Mortsel, Belgium). All the images have been taken in standard conditions to objectively compare analysed parameters, as previously described (Petrizzi et al. 2007). Briefly, data were expressed as ratio between radiodensity of normal cortical bone and radiodensity of a tract of bone including osteotomy site. A sampling area of 1560 pixel (image at 300 dpi resolution) was calculated on the mean value (lateral and medial) in normal cortical bone, and an identical sampling area was evaluated at the level of the osteotomy (Figure 2). By this way each bone segment, including the osteotomy site,

252

was compared with a normal segment of the same animal, thus avoiding experimental error due to the difference in physiological bone radiodensity among different animals. For each area, the number of pixels with each of the 256 levels of grey, ranging from white (255) to black (0), was measured and the ratio was calculated as follows: ratio = mean levels of grey of treated bone/mean levels of grey of normal bone.

Bone tissue labeling, histology and histomorphometry To perform dynamic histomorphometry, sheep were given an intravenous injection of 30 mg/kg of tetracycline chloride at 30 and 45 POD (Tam and Anderson 1980). Euthanasia was performed according to European Guidelines on POD 60 (range from 62 to 65 days). Left tibiae were carefully harvested and stripped of soft tissues. The external fixator was removed, and the specimens were collected. The bone segments comprising the osteotomy site were removed and fixed in 4% buffered paraformaldehyde for 72 hours, dehydrated in a graded series of ethanol and embedded in poly-methylmetacrilate (Sigma Aldrich, Milan, Italy). The specimens were then cut in half according to a longitudinal plane as shown in Figure 3. Longitudinal serial 200-μm thick sections were then obtained by means of a Leica SP 1600 microtome (Leica, Wetzlar, Germany), from each half specimen. Four of these sections were randomly selected, glued to a methacrylate support and cut with a Reichert-Jung Autocut 1150 microtome (Microsystems, Nussloch, Germany) to obtain a series of 7-μm thick sections. These sections were analysed with a UV light microscope (Zeiss Axiophot; Jena, Germany) equipped with an image analysis system (Nikon DS-5Mc camera connected to a personal computer – NIS Elements AR 2.20 Nikon software).

Histomorphometric evaluations were performed only in the newly formed bone around, or within, the

Veterinaria Italiana 2014, 50 (4), 249-257. doi: 10.12834/VetIt.271.963.2

Muttini et al.

Electric current stimulation in sheep bone healing

osteotomy line where osteon‑like structures were recognizable and 2 parallel tetracycline labels were present. The interlabel distance was measured at regular intervals and averaged to calculate the Mineral Apposition Rate (MAR) (Parfitt et al. 1987, Schilling et al.

1992), MAR values have been obtained by dividing the distance (in micron) between the tetracycline chloride labels (Figure 4) for the time interval between the 2 tetracycline chloride administrations (15 days in this study). The mineral apposition rate has been determined to evaluate the bone deposition due to osteoblasts activity both in SG and in CG.

Statistical analysis The data were assessed for normalcy by using the D’Agostino and Pearson omnibus normality test and were compared by a 2-way ANOVA model (the

variables considered were time and treatment) for repeated measures (radiograph evaluation) or by one-way ANOVA (histological data). The data were considered different for p<0.05, and were reported as mean ± standard deviation.

Results Clinical results Surgical procedure was well tolerated by all animals and standing position was resumed 2-5 hours after surgery. A severe lameness was evident for some days, then all sheep progressively resumed the use of the operated limb. At 45 POD all animals recovered the almost complete use of the left pelvic limb. They never showed any sign of discomfort for the activation of the electrical stimulation. In some cases a light discharge was noted around the pin entrance that was easily controlled by daily dressing.

Rx examination Statistical analysis of radiodensity showed that the values differ as a function of time after surgery (p=0.0008, 3.96% of total variance) and in control versus treated animals (p<0.0001, 87.24% of total variance); interestingly it was found that the interaction between the 2 analysed variables (time and treatment) has a statistically significant effect (p<0.0043, 5.36% of total variance), see Figure 5.

Figure 4. Histomorphometry evaluation. Tetracycline chloride labeled bone tissue (arrows) of the 8 adults, 2-year old, appenninica breed sheep.

45 40

CG = Control Group

1.00

SG = Stimulated Group

35

0.98

30

0.96 0.94

MAR

Ratio

0.92 0.90

20

0.88 0.86

15

0.84 0.82 0.80

25

10 0

20

40

60

80

Time (days PO)

Figure 5. Graph showing the values of radiodensity (ratio treated bone gray level/normal bone gray level). Different superscript denote statistically difference among data sets (p<0.05). The different superscripts denote the statistical difference between control and treated samples. For difference among different time, and for interaction of time and treatment refer to the text.

Veterinaria Italiana 2014, 50 (4), 249-257. doi: 10.12834/VetIt.271.963.2

5 0

CG

SG

Figure 6. Graph showing the interlabel distance (micron) values of control (CG) and stimulated (SG) samples, different superscripts denote statistically significative difference between the groups (p<0.05).

253

Muttini et al.

Electric current stimulation in sheep bone healing

Histology and histomorphometry Mean values of the interlabel distance in 4 sections in each animal of both groups are summarized in Figure 6. Statistical analysis displays a significant difference (p<0.001) between control and treated samples. Moreover the mean value of MAR in SG is 2.54 ± 0.09 micron/day, while it is 2.02 ± 0.14 micron/ day in CG. On the basis of these data, MAR has been increased by 25.73% in SG in comparison to CG.

Discussion Although limited to a small number of animals, this study demonstrates that biophysical stimulation with alternating electricity in combination with external fixator can increase the rate of callus maturation. Our results are in agreement with those observed in the clinical study by Itoh and colleagues (Itoh et al. 2008) for distal radius in human and add new finding supporting the thesis that positive effects are not impaired or modified by the weight bearing that started to act approximately 30 days after surgery. The evaluation of bone formation in this investigation was carried out by radiography and MAR; the latter is a dynamic histomorphometric index and can be defined as the distance between the midpoints or between the corresponding edges of 2 consecutive tissue

labels, divided by the time of the labelling period (Parfitt et al. 1987). It is commonly used for the characterization of bone formation (Schilling et al.

1992). In the past, this system was effectively used in similar experimental studies in horses to evaluate the effects of pulsed electromagnetic field on bone repair (Canè et al. 1992). Our data demonstrate that, in treated animals, the bone healing is improved in the window of time between 30 and 45 POD. In particular, it is evident that the bone radiodensity increases more in treated animal than in control ones, and that the effect of biophysical stimulation is the most important variable in determining bone healing (about 87% of total variance is due to the treatment, and the interaction of treatment with time has a well detectable statistic effect on data). Besides, the method used for the radiographic study, based on the ratio between the bone segment subjected to the osteotomy and a segment of intact bone of identical dimensions, can be considered extremely objective since the comparison is between different tracts of bone in the same animal, thus avoiding the differences between different subjects (Figure 7). The statistical analysis of obtained data confirms the increase of radiodensity of SG versus CG at the level of osteotomy gap at 30 and 45 POD. Since previous investigation, using identical experimental setting, showed that during the time range between 30 and 45 POD, the bone callus formation reached the

CG

SG

1

15

30

45

60

Figure 7. Radiographic study showing the comparison between a sheep of Stimulated Group (SG) and a sheep of Control Group (CG) of the 8 adults, 2-year old, appenninica breed sheep considered in this study at different time (1, 15, 30, 45 and 60 POD).

254

Veterinaria Italiana 2014, 50 (4), 249-257. doi: 10.12834/VetIt.271.963.2

Muttini et al.

highest level, the bone labelling was conducted at 30 and 45 POD (data not showed). Accordingly, this window of time is characterized by a significant increase of new bone formation, as showed by MAR that is higher in SG than in CG. When dealing with external fixation, device acceleration of bone formation is of paramount importance, since it might counteract the decrease of stability due to pin alisteresis. Another important problem to address, when dealing with bone callus formation, is the selection of an appropriate method to deliver the correct amount of electricity at the fracture/ pathological site. In fact, it is well known that the field applied by plate capacitors can determine a voltage drop across the insulating layers so that only weak electric fields are active in the selected site (Hartig et al. 2000). To avoid this, the stimulation device used in this study was able to detect the body impedance and to adapt the voltage delivered to the electrodes, during the whole period of bone healing process. Moreover, in complex situations, i.e. severely comminuted and/or contaminated fractures, the possibility to couple an effective method to enhance callus formation with an external fixation to stabilize bone fragments would represent an effective strategy of treatment. In fact, as reported by Frost (Frost 1989), in 50% of cases pseudoarthrosis is due to a mechanical failure, 20% is due to a biological failure; while in the remaining 30% of cases the failed union is accounted for by combined problems of mechanical and biological order. It is well known that CCEF is able to achieve healing of non-union fractures only in presence of mechanical stability, fracture alignment and bone loss (less than half of the diameter of the treated bone) (Impagliazzo et al. 2006). Even if the results of this study lack the confirmation of biomechanical testing, due to the limited number of animals, the obtained data are in agreement with the results reported in a similar experimental model, with low intensity pulsed ultrasound (Hantes et al.

2004). Thus, it is possible to hypothesize that the enhancement of callus formation could be achieved irrespective of the kind of energy supplied. There are various mechanisms of action by which osteogenesis is enhanced through application of biophysical stimuli (Brighton et al. 2001). It has been claimed that fracture (bone) repair must be considered a regenerative process rather than a healing process, because the discontinuity is replaced by the formation of new bone tissue instead of scar tissue (Mora et al. 2006). Indeed the stimulation of bone progenitor cells is crucial in the

Veterinaria Italiana 2014, 50 (4), 249-257. doi: 10.12834/VetIt.271.963.2

Electric current stimulation in sheep bone healing

treatment of bone discontinuity. Thus, it is quite obvious that every method for the stimulation of bone callus formation without any adverse effect, would offer a useful strategy of treatment both in normal situations and in case of particular fractures (i.e. stress fracture) or callus disorders. In the extant literature, there are mainly 4 methods to enhance new bone formation: electrical current directly applied to the fracture site, pulsed electromagnetic fields, capacitive coupling electric fields, and the use of ultrasound to produce mechanical stimulation.

Nevertheless, it is uncontroversial that alternating electric current stimulation may accelerate the maturation of a callus with increase of the volume of callus itself (Kawamoto et al. 2005).

In vitro studies demonstrated that CCEF enhances the proliferation maturation and extracellular matrix protein synthesis of osteoblasts (Hartig et al. 2000).

In particular, cell proliferation results from CCEF induced increase in TGF-Ă&#x;1mRNA in osteoblastic cells by a mechanism involving the cytosolic Ca2+/ calmodulin pathway (Brighton et al. 2001, Carl et al.

2001). Additionally, electric currents act promoting the differentiation of mesenchymal cells within the callus (Itoh et al. 2008).

In conclusion, since the treatment of experimental osteotomy was conducted only with external fixation without the insertion of cells and/or growth factors, this study confirms that electrical stimulation applied to a long bone fracture model accelerate callus formation presumably stimulating resident osteogenic cells. The number of animals for this study has been limited to 8 subjects, since economic and ethical reasons prevent the use of larger numbers (Ferdowsian and Beck 2011). Further studies, investigating biomechanical properties of stimulated callus versus non stimulated ones would add relevant information concerning the mechanical properties of developing callus. The present study suggests that trans-osseous application of electric current, derived from a properly modified CCEF device, and delivered through the central pin of the external fixator, enhances the formation of bone tissue al the level of the experimental osteotomy site.

This method also demonstrated to be simple and devoid of complications. The translational value of these observations can be emphasized considering that sheep is recognized as an optimal experimental model for in vivo studies on bone tissue due to the similarities with humans in terms of weight, bone structure and regeneration (Sakar et al. 2001, Nuss et al. 2006).

255

Electric current stimulation in sheep bone healing

Muttini et al.

References Aaron R.K., Boyan B.D., Ciombor D.M., Schwartz Z. & Simon B.J. 2004. Stimulation of growth factor synthesis by electric and electromagnetic fields. Clin Orthop Relat Res, 419, 30-37.

Akai M. & Hayashi K. 2002. Effect of electrical stimulation on musculoskeletal systems; a meta-analysis of controlled clinical trials. Bioelectromagnetics, 23, 132-143.

Beck B.R., Matheson G.O., Bergman G., Norling T., Fredericson M., Hoffman A.R. & Marcus R. 2008. Do capacitively coupled electric fields accelerate tibial stress fracture healing? A Randomized Controlled Trial.

Am J Sports Med, 36, 545-553.

Benazzo F., Mosconi M., Beccarisi G. & Galli U. 1995. Use of capacitive coupled electric fields in stress fractures in athletes. Clinical Orthopaedics and Related Research, 310, 145-149.

Black J. 1985. Electrical stimulation of hard and soft tissues in animal models. Clin Plast Surg, 12, 243-257.

Brighton C.T. & Pollack S.R. 1985. Treatment of recalcitrant non-union with a capacitively coupled electrical field.

A preliminary report. J Bone Joint Surg Am, 67, 577-585.

Brighton C.T., Hozack J., Brager M.D., Windsor R.E., Pollack S.R., Vreslovic E.J. & Kotwick J.E. 1985. Fracture healing in the rabbit fibula when subjected to various capacitively coupled electrical fields. J Orthop Res, 3, 331-340.

Brighton C.T., Luessenhop C.P., Pollack S.R., Steinberg D.R., Petrik M.E. & Kaplan F.S. 1989. Treatment of castrationinduced osteoporosis by a capacitively coupled electrical signal in rat vertebrae. J Bone Joint Surg Am, 71, 228-236.

Brighton C.T., Wang W., Seldes R., Zhang G. & Pollack S.R. 2001. Signal transduction in electrically stimulated bone cells. J Bone Joint Surg Am, 83, 1514-1523.

Canè V., Botti P. & Soana S. 1993. Pulsed magnetic fields improve osteoblast activity during the repair of an experimental osseous defect. J Orthop Res, 11, 664-670.

Canè V., Botti P., Farneti D. & Soana S. 1991. Electromagnetic stimulation of bone reapir: a histomorphometric study.

J Orthop Res, 9, 908-917.

Carl T.B., Wei W., Richard S., Guihong Z. & Solomon R.P. 2001.

Signal transduction in electrically stimulated bone cells.

Journal of Bone and Joint Surgery, 83, 1514-1523.

Ferdowsian H.R. & Beck N. 2011. Ethical and scientific considerations regarding animal testing and research.

PLoS One, 6, e24059.

Frost M. 1989. The biology of the fracture healing: an overview for clinicians. Clin Orthop Relat Res, 248, 293-309.

Fukada E. & Yasuda I. 1957. On the piezoelectric effect of bone. J Physical Society of Japan, 12, 1158-1162.

Goodwin C.B., Brighton C.T., Guyer R.D., Johnson J.R., Light K.I. & Yuan H.A. 1999. A double-blind study of capacitively coupled electrical stimulation as an adjunct to lumbar spinal fusions. Spine, 24, 1349-1356.

Hantes M.E., Mavrodontidis A.N., Zalavras C.G., Karantanas A.H., Arachalios T. & Malizos K.N. 2004. Low-intensity

256

transosseous ultrasound accelerates osteotomy healing in a sheep fracture model. J Bone Joint Surg Am, 86, 2275-2282.

Hartig M., Joos U. & Wiesman H.P. 2000. Capacitively coupled electric fields accelerate proliferation of osteoblast-like primary cells and increase bone extracellular matrix formation in vitro. Eur Biophys J, 29, 499-506.

Hassler C.R., Rybicki E.F., Diegle R.B.G. & Clark L.C. 1977.

Studies of enhanced bone healing via electrical stimuli.

Clin Orthop Relat Res, 124, 9-19.

Impagliazzo A., Mattei A., Spurio Pompili G.F., Setti S. & Cadossi R. 2006. Treatment of nonunited fractures with capacitively coupled electric fields. J Orthoped Traumatol, 7, 16-22.

Itoh S., Ohta T., Sekino Y., Yukawa Y. & Shinomiya K. 2008.

Treatment of distal radius fractures with a wrist-bridging external fixation: the value of alternating electric current stimulation. J Hand Surg Eur, 33, 605-608.

Kawamoto K., Kim W.C., Tsuchida Y., Tsuji Y., Fujioka M., Horii M., Mikami Y., Tokunaga D. & Kubo T. 2005.

Effects of alternating current electrical stimulation on lengthening callus. J Pediatr Orthop, 14, 299-302.

Lorich D.G., Brighton C.T., Gupta R., Corsetti J.R., Levine S.E., Gelb I.D., Seldes R. & Pollack S.R. 1998.

Biochemical pathway mediating the response of bone cells to capacitive coupling. Clin Orthop Related Res, 350, 246-256.

Malizos K.N., Papachristos A.A., Protopappas V.C. & Fotiadis D.I. 2006. Transosseous application of low-intensity ultrasound for the enhancement and monitoring of fracture healing process in a sheep osteotomy model.

Bone, 38, 530-539.

Massari L., Benazzo F., De Mattei M., Setti S. & Fini M. 2007. Effects of electrical physical stimuli on articular cartilage. J Bone Joint Surg Am, 89, 152-161.

Mora R., Pedrotti L. & Tuvo G. 2006. Diaphyseal fracture repair. In Non union of the long bones: diagnosis and treatment with compression-distraction techniques.

(Mora R. ed). Springer-Verlag Italia, Milano, 3-13.

Nuss K.M.R., Auer J.A., Boos A. & von Rechenberg B. 2006.

An animal model in sheep for biocompatibility testing of biomaterials in cancellous bones. BMC Musculoskelet Disord, 7, 67.

Parfitt A.M., Drezner M.K., Glorieux F.H., Kanis J.A., Malluche H., Meunier P.J., Ott S.M. & Recker R.R. 1987. Bone Histomorphometry: standardization of nomenclature, symbols, and units. J Bone Miner Res, 2, 595-610.

Pepper J.R., Herbert M.A., Anderson J.R. & Bobechko W.P. 1996. Effect of capacitive coupled electrical stimulation on regenerate bone. J Orthop Res, 14, 296-302.

Petrizzi L., Mariscoli M., Valbonetti L., Varasano V., Langhoff J.D. & Von Rechenberg B. 2007. Preliminary study on the effect of parenteral naloxone, alone and in association with calcium gluconate, on bone healing in an ovine "drill hole" model system. BMC Musculoskeletal Disorders, 8, 43.

Veterinaria Italiana 2014, 50 (4), 249-257. doi: 10.12834/VetIt.271.963.2

Muttini et al.

Electric current stimulation in sheep bone healing

Sakar M., Wachter N., Patka P. & Kinzi L. 2001. First histological observations on the incorporation of a novel calcium phosphate bone substitute material in human cancellous bone. J Biomed Mat Res, 58, 329-334.

Scott G. & King J.B. 1994. A prospective, double-blind trial of electrical capacitive coupling in the treatment of non-union of long bones. J Bone Joint Surg Am, 76, 820-826.

Schilling T., Mueller M., Minne H.W. & Ziegler R. 1992.

Mineral apposition rate in rat cortical bone: physiologic differences in different sites of the same tibia. J Bone Miner Res, 7, 429-432.

Tam C.S. & Anderson W. 1980. Tetracycline labeling of bone in vivo. Calcif Tissue Int, 30, 121-125.

Veterinaria Italiana 2014, 50 (4), 249-257. doi: 10.12834/VetIt.271.963.2

257

First evidence of Brucella ovis infection in rams in the Pirot Municipality, Serbia Miloš Petrović1, Silvio Špičić2, Aleksandar Potkonjak3, Branislav Lako3, Miloš Kostov4 & Željko Cvetnić2* 1 Veterinary Specialist Institute, Niš, Serbia.

Croatian Veterinary Institute, Zagreb, Croatia.

3 Faculty of Agriculture, University of Novi Sad, Novi Sad, Serbia.

4 Department of Pathology, Military Hospital, Niš, Serbia.

2

* Corresponding author at: Croatian Veterinary Institute, Zagreb, Croatia.

Tel.: +38 516123602, e-mail: cvetnic@veinst.hr.

Veterinaria Italiana 2014, 50 (4), 259-268. doi: 10.12834/VetIt.1305.09.11 Accepted: 26.08.2014 | Available on line: 29.12.2014

Keywords Brucella ovis, Epididymitis, Pirot, Rams, Serbia.

Summary This paper describes a research on Brucella ovis infection in rams in the Pirot Municipality of South Serbia. A positive result with indirect immunoenzyme test (i-ELISA) was confirmed in 67 (29.8%) and suspicious in 31 (13.8%) out of 225 tested rams. Complement fixation test (CFT) was used as a confirmation test on 67 ELISA positive sera and gave positive reaction in 41 (61.2%) ram serum samples. Rams originated from 113 flocks with 4751 sheep, from 28 villages in the Pirot Municipality of southern Serbia. Clinical examination was performed on epididymis and testes of 12 rams from 7 seropositive flocks by inspection and palpation.

The examination showed scrotum asymmetry and unilateral increase of the epididymistail in 5 (41.7%) out of 12 seropositive rams. Pathomorphological examination of testes and epididymis confirmed pathological changes in 7 (58.3%) of the 12 examined rams. Onesided epididymitis with pronounced hypertrophy of the epididymitis was also confirmed.

Twelve rams were tested for the presence of bacteria, i.e. 21 epididymis, testes and lymph nodes samples. We isolated 20 Brucella strains from 11 (91.7%) of the 12 examined animals. All isolates were identified with bacteriological and molecular techniques as B. ovis. This is the first evidence of ovine epididymitis (B. ovis) in Republic of Serbia.

Infezione da Brucella ovis in arieti del distretto di Pirot in Serbia meridionale Parole chiave Ariete, Brucella ovis, Brucellosi, Epididimite, Serbia

Riassunto In questo lavoro sono riportati i risultati dell’indagine sulla diffusione dell'infezione da Brucella ovis in arieti del distretto di Pirot in Serbia meridionale. I campioni di siero prelevati da 225 arieti, appartenenti a 113 greggi (4751 pecore) distribuite nel territorio di 28 villaggi, sono stati analizzati utilizzando il test ELISA indiretto per identificare la presenza di anticorpi Brucella ovis. Su 225 campioni, 67 (29,8%) sono risultati positivi e 31 (13,8 %) sospetti. I 67 campioni positivi sono stati testati di nuovo utilizzando il test di fissazione del complemento, di questi 41 campioni (61,2%) sono risultati positivi. L'esame clinico ha permesso di rilevare in 5 (41,7%) dei 12 arieti sieropositivi l’asimmetria dello scroto e l’aumento unilaterale della coda dell'epididimo. Le alterazioni patologiche a carico di testicoli ed epididimi, tipiche dell’infezione, sono state confermate all’esame macroscopico in 7 (58,3%) dei 12 arieti sieropositivi. In questi 7 campioni è stata rilevata epididimite unilaterale con marcata ipertrofia della coda, del corpo e della testa dell'epididimo. L’analisi batteriologica è stata condotta su 21 campioni di tessuto dell'epididimo, dei testicoli e dei linfonodi dei 12 arieti. Dai campioni di 11 (91,7%) arieti sono stati identificati, con metodi batteriologici e molecolari, 20 isolati appartenenti alla specie Brucella ovis. Lo studio è la prima segnalazione della presenza dell’infezione da Brucella ovis negli arieti del distretto di Pirot, in Serbia.

259

Brucella ovis infection in Serbia

Introduction Brucella ovis infection is considered the most significant infective cause of reproductive disorders in sheep worldwide (Afzal and Kimberling 1986, Bulgin and Anderson 1983, Burgess 1982, Kalinovski et al. 1995). It was first reported in sheep in 1953 in Australia and New Zealand (Bulgin and Anderson 1983), currently it is present in South and North America, Australia, New Zealand, South Africa and Southern Europe (OIE Terrestrial Manual 2009, Bagley et al. 1985). In France, the number of infected flocks has increased after Brucella melitensis Rev-1 vaccination although it helped stoping B. melitensis infection in 2008 (Serpe et al. 1999).

The disease has so far been confirmed in other countries, i.e. in Romania (Denes and Glavitz 1994), Croatia (Corbel et al. 1983, Sancho et al.

1985) and Slovenia (Kirćanski 2009).

Brucella ovis is the causative agent of ovine epididymitis, a contagious infectious disease of rams and ewes. Chain-like mode of spreading, chronic course and poorly pronounced clinical symptoms, which largely hinder its timely discovery, control and eradication, characterise the disease. Scrotum asymmetry, epididymitis and orchitis in rams, miscarriages in ewes, stillbirths and disvital lambs, increased perinatal mortality or fewer births in comparison to previous years are symptoms of a possible B. ovis infection. The conclusive diagnosis can only be made using laboratory tests. The causative agent can also be isolated from seronegative and clinically normal rams (Alton et al. 1988, Blasco et al. 1983, Bulgin 1990).

In recent decades in the Republic of Serbia and Macedonia, B. ovis seropositive animals have been confirmed, though the causative agent was usually never isolated and identified (Krt 1992). In Serbian municipalities of Presevo and Bujanovac, indirect enzyme-linked immunosorbent assay (i-ELISA) on samples from 2,273 rams and ewes showed a B. ovis infection seroprevalence of 4.53% (29). ELISA, complement fixation (CFT ) and agar gel immunodiffusion tests (AGID) on 200 tested sheep showed a B. ovis infection prevalence of 7.5% (Kimberling and Schweitzer 1989).

The objective of this study was to test flocks in Pirot Municipality of the Serbian Republic in order to confirm the presence of ovine epididymitis.

Infection in rams was confirmed by serological testing, possible pathomorphological changes on testes, and isolation and identification of the causative agent using bacteriological and molecular methods.

260

Petrović et al.

Materials and methods Serological tests Serum samples Pirot municipality is situated in Southern Serbia, between 22°36' East longitude and 43°09' North latitude, covers an area of 1,232 km2 and altitude between 368 and 2,169 meters above sea level.

According to 2011 data, the municipality consists of 71 villages with 1,564 flocks, 15,566 sheep and 500 rams. In 28 villages, the owners of flocks, with mostly intensive farming, agreed to participate in the investigation. A village represents the smallest territory unit with its own authority. Semi-extensive and extensive sheep flock management with joint pasturing characterise Pirot. Previous investigations on sheep brucellosis (B. melitensis) in this region always gave negative results. In order to get an insight into presence of B. ovis infection, from 2010 to 2011 we tested 225 ram sera samples. The rams originated from 113 flocks, with a total of 4,751 sheep, and they were of the Pramenka breed. Five to 10 ml of blood were collected from the rams’ jugular vein. Blood samples were then centrifuged in the laboratory at 1,500 rpm and the obtained sera stored at -20°C until analysis.

Serological testing In Veterinary Specialists Institute Nis (Serbia) ELISA (CHEKIT – Brucella ovis, IDEXX, Bern, Switzerland) kit was used to prove the presence of B. ovis antibodies. A complement fixation test (CFT) was used as a confirmation test. The ELISA test was performed according to manufacturer's instructions and the results were read on Tecan Sunrise (Tecan Austria Gesellschaft M.B.H., Salzburg, Austria) spectrophotometer at 450 nm and interpreted according to manufacturer's instructions. Only positive results were retested with a more specific test, CFT, in order to exclude possible cross-reactions with antibodies to other environmentally present pathogens in the tested area. Complement fixation test (CFT) was conducted in Croatian Veterinary Institute Zagreb (Croatia) on microtitration plates (micromethod) according to OIE recommendations (Schopf and Khaschabi 1997). The rough-LPS B. ovis antigen (Veterinary Laboratory Agency, VLA, Waybridge, UK), CFT amboceptor and CFT complement (Simens, Marburg, Germany) and 2% sheep erythrocytes (Croatian Veterinary Institute, Zagreb, Croatia) were used in the test according to manufacturer’s instructions. Titre of more than

Veterinaria Italiana 2014, 50 (4), 259-268. doi: 10.12834/VetIt.1305.09.11

Petrović et al.

Brucella ovis infection in Serbia

50 ICFTU/ml was considered as positive (Dobrean et al. 2002, Schopf and Khaschabi 1997).

Rams which resulted positive to ELISA and CFT were selected for castration and further gross pathology examination and bacteriological testing were performed. Clinical examination, castration or culling were conducted in only 6 of the seropositive 14 villages i.e. 7 out of 23 seropositive sheep flocks because some owners did not agree to further testing (Figure 1, Table I).

Clinical examination, pathomorphological and bacteriological testing Samples At the time of examination, the number of seropositive rams was reduced due to death or elimination from the flock. The majority of rams' owners eliminated animals with swollen testes from

HUNGARY

Topli Do

Šugrin Bazovik

Zaskovci

ROMANIA CROATIA

Rudinje

Cerova

Pokrevenik Temska

Ragodeš Crvenčevo

Stančenje

Gostuša

S36

Lukanjske pojate Lalinske pojate Sopot S46 Dobri Do Pakleštica Nišor S64 Rsovci

PIROT

S57 S58

Ponor

Basara Iavor

SERBIA

BOSNIA AND HERZEGOVINA

PIROT

S63 Rosomač S74 Slavinja MONTENEGRO

Krupac

KOSOVO BULGARIA

Prisjan

Petrovac

ALBANIA MACEDONIA

Kamik

Figure 1. Pirot Municipality, Republic of Serbia. The villages included in this study between 2010 and 2011, the blue dot indicates the villages where serologic tests have been conducted, the red dot indicate the villages where seropositive flocks have been reported: S 36, S 46, S 57, S 58, S 63, S 64 and S 74- seropositive flocks with carried clinical, pathomorfological and bacteriological testing.

Table I. Bacteriological and clinical findings in seropositive rams in the Pirot Municipality, Republic of Serbia, 2010-2011.

Village name

Flock ID

Velika Lukanja

S 36

Nišor

S 46 S 57

Ponor

*

S 58

Rosomač

S 63

Rsovci

S 64

Slavinja

S 74

Castrated rams;

**

Ram ID

6150254* 6629594** 4337349** 4412845** 4412829** 2452058** 1448438** 9413681** 6414294* 9332931** 5412026* 5625496**

Serological testing Ram age in years ELISA CFT 2 3 3 2,5 3,5 4,5 2,5 2,5 5 2,5 2,5 2,5

+ + + + + + + + + + + +

+ + + + + + + + + + +

Clinical examination

Bacteriology testing

Sample/ID Unilateral Bilateral Brucella Sample/ID Brucella epididymis epididymitis epididymitis ovis lymph node ovis and testes 0 0 ET 8 + 0 0 ET 11 + LČ 11 + 1 0 ET 12 + LČ 12 + 0 0 ET 4 + LČ 4 + 1 0 ET 2 + LČ 2 + 1 0 ET 6 + LČ 6 + 1 0 ET 3 + LČ 3 + 0 0 ET 10 + LČ 10 + 1 0 ET 9 + 0 0 ET 7 + LČ 7 + 0 0 ET 1 Not carried due contamination 0 0 ET 5 + LČ 5 +

Culled rams.

Veterinaria Italiana 2014, 50 (4), 259-268. doi: 10.12834/VetIt.1305.09.11

261

Brucella ovis infection in Serbia

the flock by slaughter as a routine procedure over the year. The clinical examination was performed on epididymis and testes of 12 rams from 7 seropositive flocks in 6 villages by inspection and palpation. Pathomorphological testing of testes and epididymis and sampling for bacteriological testing were carried out after castration of 3 rams out of 3 flocks. In cases where owners allowed ram slaughter, testes, epididymis and lymph nodes (ln. inguinalis, ln. ilicimedialesand ln. lumbalesaortici) were sampled from 9 rams out of 6 flocks (Table I).

Bacteriological testing Bacteriological testing was conducted in Croatian Veterinary Institute Zagreb (Croatia) on 21 epididymis, testes and lymph nodes samples from 12 rams originating from 7 flocks in 6 villages (Table I). Around 25-50 grams of material (testes and lymph nodes) were processed, and approximately 1 ml of homogenate inoculated on each plate with blood agar, Brucella agar and modified semi-selective agar according to Thayer-Martin (Alton et al. 1988)1. Plates were then incubated at 37°C in the presence of 10% CO2. Colony growth was observed on daily basis over 10 days.

Petrović et al.

Molecular identification Twenty isolates originating from 11 rams were examined using the polymerase chain reaction (PCR) test. Loop full of bacterial culture was mixed in 100 μl of distilled water (UltraPure™ DNase⁄RNase-Free Distilled Water, Invitrogen, Paisley, Scotland, UK), boiled at 95ºC for 20 minutes, and centrifuged at 14,000 g for 1 minute. The supernatant was used in the PCR reaction. The controls used in molecular investigations were standard Brucella strains: Brucella abortus 544, Brucella suis 1330, B. melitensis 16M, B. ovis 63/290. We used a PCR based on replication of the part of the genome that codes the synthesis of the protein BCSP-31, characteristic for the genus Brucella in order to identify isolates as Brucellae. The expected replication product size was approximately 440 bp (Praud et al. 2012). A multiplex PCR (Bruce‑ladder) was used to identify the Brucella species (Garcia-Yoldi et al. 2006). The expected size of the PCR products

Identification of isolates Morphological characteristics Isolates were identified on the basis of colony morphology, growth in the presence of 5-10% CO2, production of H2S, growth in presence of 20 µg/ml thionine and basic fucsin, and agglutination with antisera A, M and R (Alton et al. 1988, Clapp et al.

1962, Schopf and Khaschabi 1997).

1

L amb Epididymitis. http://www.optimalag.com/cleonscorner/Article 002. aspx.

Figure 2. Asymmetry of the scrotum in rams infected with the species B. ovis, in the Pirot Municipality, Republic of Serbia, 2010-2011.

262

Figure 3. Testes with membranes removed; testicle with normal structure (above) and an atrophic testicle and enlarged epididymis, with nodular changes, an altered anatomical structure, displaying ribbon-like growths (below) of rams from the Pirot Municipality, Republic of Serbia, 2010-2011.

Figure 4. Chronic inflammation caused by the species B. ovis is characterised by granulomatomic region in the epididymis of rams from the Pirot Municipality, Republic of Serbia, 2010-2011.

Veterinaria Italiana 2014, 50 (4), 259-268. doi: 10.12834/VetIt.1305.09.11

Petrović et al.

were 1072, 794, 587, 450 and 152 base pairs (bp) for B. ovis; 1682, 794, 587, 450 and 152 bp for B. abortus; 1682, 1072, 794, 587, 450 and 152 bp for B. melitensis and 1682, 1072, 794, 587, 450, 272 and 152 bp for B. suis (Farina et al. 1995). The replication products were analysed using a QIAxcel capillary electrophoresis system (Qiagen, Hilden, Germany).

Results Results of the serological testing The indirect ELISA confirmed a positive reaction in 67 (29.8%), and a suspicious reaction in 31 (13.8%) out of 225 tested ram serum samples. The seropositive rams originated from 16 out of 28 villages and 34 out of 113 flocks.

The complement fixation test confirmed a positive reaction in 41 out of 67 examined rams. Seropositive rams originated from 14 out of 16 tested villages and from 23 flocks out of 34 tested flocks in the same region.

Results of the clinical examinations The clinical examination, by adspection and palpation of epididymis and testes of 12 rams from

Brucella ovis infection in Serbia

7 seropositive flocks in 6 villages confirmed scrotum asymmetry (Figure 2) and an unilateral increase in epididymis tail in 5 (41.7%) seropositive rams.

Sensitivity and pain in epididymis was confirmed in 4 (80%) of 5 rams exhibiting changes. This manifested in ram’s resistance and pulling away during palpation. The region temperature was not established. Testes were mobile in scrotum.

Results of pathomorphological testing Macroscopic examination of epididymis and testes was performed after castration or culling.

Pathological changes indicating infection were confirmed in 7 (58.3%) of the 12 examined ram testes.

Various degrees of damage, characteristic for acute and chronic stages of this disease, were established.

In the acute case, changes were of necrotic character, while in the chronic case, granulomas, fibrosis and testes and epididymis atrophy were observed.

A characteristic macroscopic finding was unilateral epididymitis in 7 (58.3%) of 12 examined rams (Figures 3 and 4). All 7 rams with enlarged epididymis had marked hypertrophy of the tail, 4 (33.3%) had hypertrophy of the body and 2 (16.7%) had hypertrophy of the head of epididymis. In 2 (16.7%) rams, spermatoceles were found in the epididymis

Figure 5. Molecular identification Brucella genus for isolates from the epididymis and testicle tissues from rams in the Pirot Municipality, Republic of Serbia, 2010-2011.

M = marker with replication product, sizes 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000 and 3000 base pairs; NK = negative control; ET2 - ET12 = Isolates of Brucella from tissue of the epididymis and testes of rams; B.a = B. abortus 544; B.m = B. melitensis 16M; B.o = B. ovis 63/290; B.s = B. suis 1330.

Veterinaria Italiana 2014, 50 (4), 259-268. doi: 10.12834/VetIt.1305.09.11

263

Brucella ovis infection in Serbia

Petrović et al.

Figure 6. Molecular identification Brucella genus for isolates from the lymph nodes from rams in the Pirot Municipality, Republic of Serbia, 2010-2011.

M = markers with replication products of sizes 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000 and 3000 base pairs; NK = negative control; Lč2 - Lč7 and Lč10 Lč12 = Isolates of Brucella from the ram lymph nodes; B.a = B. abortus 544; B.m = B. melitensis 16M; B.o = B. ovis 63/290, B.s = B. suis 1330.

Figure 7. Molecular typing of Brucella isolates from epididymis and testicle tissues of rams in the Pirot Municipality, Republic of Serbia, 2010-2011 tested by multiplex PCR (Bruce-ladder).

M = markers with replication products with sizes 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000 and 3000 base pairs; NK = negative control; ET2 - ET12- Brucella isolates from epididymis and testicle tissues; B.a = B. abortus 544; B.m = B. melitensis 16M; B.o = B. ovis 63/290; B.s = B. suis 1330.

264

Veterinaria Italiana 2014, 50 (4), 259-268. doi: 10.12834/VetIt.1305.09.11

Petrović et al.

Brucella ovis infection in Serbia

Figure 8. Molecular typing of Brucella isolates from lymph nodes tissue of rams in the Pirot Municipality, Republic of Serbia, 2010-2011tested by multiplex PCR (Bruce-ladder).

M = markers with replication products with sizes 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000 and 3000 base pairs; NK = negative control; Lč2-Lč7 and Lč10Lč12 = Brucella isolates from lymph node tissue; B.a = B. abortus 544; B.m = B. melitensis 16M; B.o = B. ovis 63/290; B.s = B. suis.

tail. Changes in the size of epididymis head ranged from 5 to 12 mm and epididymis body and tail from 2 to 6 mm. The size of spermatoceles was up to 32 mm. Examination of lymph nodes established no macroscopic changes.

Results of the molecular testing

Results of bacteriological testing

Brucella isolates typing was conducted using a multiplex PCR method called Bruce-ladder. All 20 Brucellae isolates were identified as Brucella ovis. The PCR profile of the isolates corresponds to the profile of the standard referential B. ovis 63/290 strain: 1071, 794, 587, 450 and 152 base pairs (Figures 7 and 8).

Bacteriological testing was conducted on 21 samples of epididymis, testes and lymph nodes from 12 rams.

We were not able to conduct the testing on 1 sample because of too much contamination. We identified a total of 20 isolates from 11 (91.7%) out of 12 tested rams: 11 isolates were selected from epididymis and testicle tissue, and 9 isolates from lymph node tissue.

Colonies were visible on selective agars incubated in atmosphere with addition of 10% CO2 at 37°C on the third and fourth day. All isolated colonies were rough (R growth phase), round, convex with straight and full edges. The microscopic smears of 24h old cultures were Gram stained. Bacteria were Gram negative. The agglutination test with monospecific antisera A, M and R gave a visible agglutination with R monospecific antiserum in all isolates. Testing with monospecific antisera A and M resulted in no agglutination.

Veterinaria Italiana 2014, 50 (4), 259-268. doi: 10.12834/VetIt.1305.09.11

Twenty isolates and standard referential strains B. abortus 544, B. melitensis 16M, B. ovis 63/290 and B. suis 1330 were identified as Brucellae according to the presence of 440 bp long replication product (Figures 5 and 6).

Discussion Ovine epididymitis is characterised by a chainlike way of spreading, chronic course and poorly pronounced clinical symptoms, which largely hinder its timely discovery, control and eradication. Final diagnosis can only be made by laboratory tests, and the causative agent can also be isolated from seronegative and clinically normal rams (Alton et al.

1988, Blasco et al. 1983, Bulgin 1990).

Sheep farming is a significant branch of livestock production in Serbia. According to the data,

265

Brucella ovis infection in Serbia

1,460,295 sheep populated Serbia in 2011. In recent decades, B. ovis seropositive animals have been confirmed in Serbia, though the causative agent was not isolated and identified (Krt 1992). In Serbian municipalities of Presevo and Bujanovac, indirect immunoenzyme testing of sera from 2,273 rams and ewes identified a seroprevalence of B. ovis infection of 4.53% (Marín et al. 1989). The ELISA, CFT and AGID tests performed on samples from 200 sheep showed a prevalence of B. ovis infection of 7.5% (Kimberling and Schweitzer 1989). In neighboring Croatia, in 2008, the disease was present in 12 out of 20 counties (Špičić et al. 2010). However, regardless of the results of performed serological investigations, ovine epididymitis control is still not officially conducted in Serbia.

Due to more simple execution, we started this study testing animals by ELISA (Dobrean et al.

2002, Serpe et al. 1999). The i-ELISA kit used proved slightly more sensitive but less specific than the CFT (Serpe et al. 1999). In countries where prevalence of the disease is high (10% or greater), this test would be very good and inexpensive in comparison to AGID and CFT (Dobrean et al. 2002, Gall et al. 2003).

However, prevalence of B. ovis infection in Pirot was unknown but considered very high so we also used CFT to increase the specificity of the analysis (Serpe et al. 1999).

The present study used indirect ELISA testing to confirm a positive reaction in 67 (29.8%) and suspicious in 31 (13.8%) of the 225 tested ram serum samples. The seropositive rams originated from 16 villages (57.1% of the surveyed villages in the Pirot municipality) and 34 flocks (30.1% of surveyed flocks in the Pirot municipality).

The complement fixation test confirmed a positive reaction in 41 out of 67 tested rams. Seropositive rams originated from 14 villages (50% of the surveyed villages in the Pirot municipality) and 23 flocks (20.4% of the surveyed flocks in the Pirot municipality). Although the research was not conducted on all flocks in the Pirot Municipality i.e.

Serbia, identified prevalence is comparable to those of neighbouring countries. In Republic of Croatia and Bosnia and Herzegovina, studies showed that 21.7% of flocks were infected with B. ovis (Corbel et al. 1983). In southern France, in areas where the disease is endemic, in 2008, the prevalence was 22% (Serpe et al. 1999). The infection seroprevalence in rams and sheep in Croatia in 2002 was 7% and 3.9% in 2003 (Sancho et al. 1985). After introduction of disease eradication program, based on castration of seropositive rams, in 2008, seroprevalence was 2% (Špičić et al. 2010).

At the time of examination, the number of seropositive rams was reduced due to death or elimination from the flock. The majority of owners

266

Petrović et al.

eliminated rams with enlarged testes by slaughter.

Owners used their own rams for breeding and before mating season noticed scrotum asymmetry and enlargement of epididymis and testes. According to owners observations, about 30% of rams had scrotum asymmetry with unilateral enlargement and after mating about 25% of ewes were not fertilized.

Miscarriages were seen in 5% of ewes, with the flock maximum being around 10%. The average birthing was 0.74 lambs per ewe (from 0.5 to 0.95), with 7.78% of lambs (maximum 29.09%) dying within the first month. It was proven that newly B. ovis infected flocks experienced 30% reduced lambing, opposed to 15-20% in flocks were the disease was endemic (Bulgin 1990). It was established that after B. ovis infection, number of live births can be reduced by 25%; 16% of lambs die within 6 weeks and 20% of ewes remain infertile (Kirćanski 2009).

Sheep owners are aware of these problems and remove potentially infected rams with changes in scrotum from flocks themselves. Our clinical research conducted on 12 seropositive rams found scrotum asymmetry and unilateral increase of epididymis tail in 5 (41.7%) rams.

The clinical detection of the disease is difficult because other bacteria, such as Actinobacillusseminis, Histophilusovis, Haemophilus spp., Corynebacterium pseudotuberculosis ovis, Chlamydophila abortus or B. melitensis cause similar symptoms and more than 50% of B. ovis infected animals do not show any palpable epididymitis lesions (OIE Terrestrial Manual 2009). Further pathomorphological testing found unilateral epididymitis in 7 (58.3%) out of 12 tested rams. All 7 rams showing enlarged epididymis had pronounced hypertrophy of the tail, 4 (33.3%) had hypertrophy of the body and 2 (16.7%) of the head of epididymis. Spermatoceles in epididymis tail were confirmed in 2 (16.7%) rams. The analysis of lymph nodes did not identify any macroscopic changes.

Based on results of bacteriological and molecular testing of material from rams, all the isolates were identified as Brucellae, i.e. B. ovis. A total of 20 B. ovis isolates were bacteriologically isolated from 11 (91.7%) of the 12 seropositive rams. Eleven isolates were selected from epididymis and testicle tissue, and 9 isolates from lymph node tissue. The material belonging to 1 ram was inappropriate for bacteriological testing. All isolates in the present study were identified as B. ovis with the identical PCR profile as the referential strain B. ovis 63/290.

On a sample of the 12 seropositive rams, we found a different diagnostic value of clinical examination (5, 41.7%), histopathological changes (7, 58.3%) and bacteriological examination (11, 91.7%). To prevent damage caused by the disease it is not enough just to clinically study rams in flocks.

According to our findings, any eradication program

Veterinaria Italiana 2014, 50 (4), 259-268. doi: 10.12834/VetIt.1305.09.11

Petrović et al.

of this economically important disease in the region or across the country should be preceded by serologically testing of all rams in order to identify the extent of disease spread. Cost-benefit analysis should follow after which the most appropriate program should be chosen (Carpenter et al. 1987).

In order to eradicate the disease it is necessary to conduct controls on both male and female animals (Serpe et al. 1999, Špičić et al. 2009).

This study is the first evidence of the presence of

Brucella ovis infection in Serbia

B. ovis infection in sheep in Pirot municipality and in Serbia.

Acknowledgements We would like to thank Dr Maja Zdelar-Tuk, Dr Miroslav Benić, Dr Ivana Račić, Dr Sanja Duvnjak and Anja Vujnović, DVM from Croatian Veterinary Institute in Zagreb for their critical reviewing and help with preparation of this article.

References Afzal M. & Kimberling C.V. 1986. How to control Brucella ovis-induced epididymitis in rams. Vet Med, 81(4), 364-370.

Alton G.G., Jones L.M., Angus R.D. & Verger J.M. 1988.

Techniques for the brucellosis laboratory. Inra, Paris.

Bagley C.V., Paskett M.E., Matthews N.J. & Stequist N.J. 1985. Prevalence and causes of ram epididymitis in Utah. J Am Vet Med Assoc, 186(8), 798-801.

Blasco J. M. & Marin C.M. 1990. Brucelosis ovina: Etiologia, diagnostico bacteriologico. Ovis, 8, 15-22.

Blasco J.M., Buen L., Estrada J., Garcia J., Llena J. &Ortilles A. 1983. Alteracionestesticulares v brucelosis en moruecos de la region aragonesa. Noticias Neosan, 211, 147.

Bulgin M.S. 1990. Brucella ovis excretion in semen of seronegative, clinically normal breeding rams. J Am Vet Med Assoc, 196, 313-315.

Bulgin M.S. & Anderson B.C. 1983. Association of sexual experience with isolation of various bacteria in cases of ovine epididymitis. J Am Vet Med Assoc, 182, 372-374.

Burgess G.W. 1982. Ovine contagious epididymitis: a review. Vet Microbiol, 7, 551- 575.

Carpenter T.E., Berry S.L. & Glenn J.S. 1987. Economics of Brucella ovis control in sheep: computerized decisiontree analysis. J Am Vet Med Assoc, 190(8), 983-987.

Clapp K.H., Keogh J. & Richards M.H. 1962. Epidemiology of ovine brucellosis in South Australia. Aust Vet J, 38, 482-486.

Gall D., Nielsen K., Vigliocco A., Smith P., Perez B., Rojas X. & Robles C. 2003. Evaluation of an indirect enzymelinked immunoassay for presumptive serodiagnosis of Brucella ovis in sheep. Small Rum Res, 48, 73-179.

García-Yoldi D., Marín C.M., de Miguel P.M., Muñoz P.M., Vizmanos J.L. & López-Goñi I. 2006. Multiplex PCR assay for the identification and differentiation of all Brucella species and the vaccine strains Brucella abortus S19 and RB51 and Brucella melitensis Rev1. Clin Chem, 52, 779-781.

Kalinovskiǐ A.I, Repina L.P. & Innokenťeva T.I. 1995.

Brucellosis in Siberia and the Far East. Med Parazitol (Mosk), 4, 42-45.

Kimberling C.V. & Schweitzer D. 1989. Brucella ovis infection and its management in ovine reproduction.

Agri-Practice, 10, 36-39.

Kirćanski J. 2009. The use of different tests in the diagnosis of ovine brucellosis causedby Brucella ovis and characterization of prepared antigen. Master's thesis, Faculty of Veterinary Medicine, University of Belgrade, Belgrade, Serbia.

Krt B. 1992. Evaluation of similar serological methods for the diagnosis of ovine brucellosis - infection with Brucella ovis. Master's thesis, Faculty of Veterinary Medicine, University of Ljubljana, Ljubljana, Slovenia.

Marín C.M., Jiménez de Bagüés M.P., Blasco J.M., Gamaso C., Moriyon I. & Diaz R. 1989. Comparison of tree serological tests for Brucella ovis infection of rams using different antigenic extracts. Vet Rec, 125, 504-508.

Corbel M.J., Gill K.P.W., Thomas E.L. & Hendry D.M. 1983.

Methods for identification of Brucella. Ministry of Agriculture, Fisheries and Food, Alnwick, UK.

Praud A., Champion J-L., Yannick C., Drapeau A., Laurence M. & Garin-Bastuji B. 2012. Assessment of the diagnostic sensitivity and specificity of an indirect ELISA kit for thediagnosis of Brucella ovis infection in rams. BMC Vet Res ,8, 68.

Denes B. & Glavitz R. 1994. Bacteriologically confirmed cases of ovine epididymo-orchitis caused by Brucella ovis in Sub-Carpathia. Acta Vet Hung, 42, 25-33.

Sancho F., Marin C.M. & Blasco J.M. 1985. Evolucion de la brucelosis ovina en unaagrupación de defensa sanitaria. Inf Tecn Econ Agraria, 5, 431-435.

Dobrean V., Opris A. & Daraban S. 2002. An epidemiological and surveillance overview of brucellosis in Romania.

Vet Microbiol, 90, 157-163.

Schopf K. & Khaschabi D. 1997. Experiences in the eradication of Brucella ovis infectionsin sheep in Tyrol.

Tierarztl Prax Ausg G Grosstiere Nutztiere, 5, 413-416.

Farina R., Cerri D., Andreani A., Renzoni G., Gaudachini P.F. & Lombardi G. 1995. Epididimite dei montoni: Prima segnalazione sulla presenza di Brucella ovis in Italia.

Selezione Veterinaria, 36, 285-291.

Serpe L., Gallo P., Fidanza N., Scaramuzzo A. & Fenizia D. 1999. Single-step method for rapid detection of Brucella spp. in soft cheese by gene-specifc polymerase chain reaction. J Dairy Res, 66, 313-317.

Veterinaria Italiana 2014, 50 (4), 259-268. doi: 10.12834/VetIt.1305.09.11

267

Brucella ovis infection in Serbia

Špičić S., Marjanović S., Zdelar-Tuk M. & Cvetnić Z. 2009.

First evidence of Brucella ovis infection in Republic of Croatia. Dtsch Tierarztl Wochenschr, 116, 209-213. Špičić S., Zdelar-Tuk M., Račić I., Duvnjak S. & Cvetnić Ž. 2010. Serological, bacteriological, and molecular diagnosis of brucellosis in domestic animals in Croatia.

Croat Med J, 51(4), 320-326.

268

Petrović et al.

World Organisation for Animal Health (OIE). 2009.

Ovine epididymitis (Brucella ovis). In Terrestrial Manual. Chapter 2.7.9. Paris, France. http://www. oie.int/fileadmin/Home/eng/Health_standards/ tahm/2.07.09_OVINE_EPID.pdf.

Veterinaria Italiana 2014, 50 (4), 259-268. doi: 10.12834/VetIt.1305.09.11

Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus Abdelfattah M. Selim1*, Mahmoud M. Elhaig2 & Wolfgang Gaede3 Department of Animal Medicine (Infectious Diseases), Faculty of Veterinary Medicine, Benha University, P.O. Box 13736, Toukh, Egypt.

2 Department of Animal Medicine (Infectious Diseases), Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522, Egypt.

3 State Institute for Consumer Protection of Saxony-Anhalt, Department of Veterinary Medicine, Stendal, Germany.

1

* Corresponding author at: Department of Animal Medicine (Infectious Diseases), Faculty of Veterinary Medicine, Benha University, P.O. Box 13736, Toukh, Egypt.

Tel.: +20 1005646329, e-mail: Abdelfattah.selim@fvtm.bu.edu.eg.

Veterinaria Italiana 2014, 50 (4), 269-275. doi: 10.12834/VetIt.222.702.3 Accepted: 11.04.2014 | Available on line: 29.12.2014

Keywords Abortion, Cattle, Brucella spp., Leptospira spp., Campylobacter foetus, Multiplex real-time PCR.

Summary Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR) to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens.

This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

Sviluppo di un test multiplex real-time PCR per il rilevamento di Brucella spp., Leptospira spp. e Campylobacter foetus Parole chiave Aborto, Bovini, Brucella spp., Leptospira spp., Campylobacter foetus, Multiplex real-time PCR.

Riassunto L’aborto è una delle principali cause di danno economico per l’allevamento di bovini.

Questo articolo descrive l’uso di 1-step multiplex real-time PCR (polymerase chain reactions) per l’identificazione di Brucella spp., Leptospira spp. e Campylobacter foetus, tre batteri comunemente associati all’aborto nei bovini. Il rinvenimento di ß-actina come controllo interno nello stesso esame PCR dimostra la validità di questo test. In questo studio, il detection limit per il multiplex real-time PCR condotto usando DNA purificato ottenuto da organismi da cultura è stato fissato a 5 fg per Leptospira spp. e C. foetus e a 50 fg per Brucella spp. Il test non ha prodotto alcuna amplificazione non specifica quando è stato usato con diversi ceppi dei 3 patogeni. Il multiplex real-time PCR usato in questo studio si è rivelato uno strumento utile per la diagnosi e per il rilevamento simultaneo e rapido dei 3 patogeni.

Introduction Infectious abortion is a significant cause of reproductive failure and significant economic losses for the cattle industry (De Vries 2009). Under optimal laboratory conditions, etiologic diagnosis is achieved in 23.3 to 45.5% of the cases (Anderson 2007). The risk of abortion depends on several factors, ranging from

infectious, toxic, endocrine, physical to nutritional causes, a variety of infectious agents have also been reported to cause bovine abortion throughout the world, agents such as Brucella abortus, Leptospira spp., Campylobacter foetus, Hammondia heydorni, Neospora caninum, Toxoplasma gondi, Coxiella burnetti, Chlamydophila psittaci, Mycoplasma bovis, Mycoplasma bovigenitalium, Ureaplasma diversum,

269

Multiplex real-time PCR assay for Brucella spp., Leptospira spp. and Campylobacter foetus Selim et al.

Bovine viral diarrhoea virus and Bovine herpesvirus-1 (Tramuta et al. 2011). Brucellosis, Leptospirosis and Campylobacteriosis, in particular, are serious diseases causing abortion in cattle. They have been reported worldwide and affect both wild and domestic animals (Henegariu et al. 1997, Iraola et al.

2012, Skirrow et al. 1994). The importance of these diseases is increasing due to several reasons: fast spreading, difficulty of control and prevention, time consuming, and the cost of the treatment. These diseases have also critical consequences on the trading of livestock and animal products, as such they also inhibit social and economic development of breeders (Dieffenbach and Dveksler 1995).

for identification of infectious agents in aborted bovine foetuses, including Brucella abortus (Baily et al.

1992, Bricker et al. 2003), Leptospira spp. (Heinemann et al. 1999, Richtzenhain et al. 2002), and C. foetus (Van der Graaf-van Bloois et al. 2013). Unfortunately, these PCR methods have either been questioned with regards to their sensitivity and/or specificity and for using more laborious intensive and less sensitive gel-based assays (Reisberg et al. 2013).

Brucellosis causes abortions in the second half of gestation (usually about the seventh month) and 80% of incidence on unvaccinated cattle. The organisms enter via mucous membranes and invade the udder, lymph nodes, and uterus, causing a placentitis, which may be acute or chronic (Smith and Ficht 1990).

The purpose of this study was to develop multiplex real-time PCR for detection of 3 pathogens in a single reaction with high sensitivity and specificity using a DNA template extracted directly from tissue samples. The specificity and sensitivity of the multiplex real-time PCR were tested and the results were compared with those of single PCR detection.

Laboratory detection of Brucella spp. is mainly based on cultural isolation, a labor intensive process which has been associated with a high risk of laboratory acquired infections (Miller et al. 1997).

Material and methods

Leptospirosis is identified as 1 of the emerging infectious disease and affects virtually all mammals, including humans (Palaniapann et al. 2005). Up to 30% of a dairy herd may abort during an outbreak of Leptospirosis. The incidence of Leptospirosis is highest during Summer, being it facilitated by heavy rain and floods. The microscopic agglutination test (MAT) is considered the gold standard seromethod for detection of Leptospirosis, but it does not permit early diagnosis and has low sensitivity (Xue et al. 2008).

Bacterial strains

Campylobacter foetus may be found in the genital tract and may cause sporadic abortion in cattle.

It is an infectious venereal disease, which leads to reproductive complications, such as infertility, lowered pregnancy rate, and abortion. Bacteriological analyses, such as culture isolation and biochemical tests are useful for evaluating different samples, even those with low bacterial counts (Iraola et al. 2012).

Although these methods are well standardized and extensively used, they are laborious and time consuming, thus making them disadvantageous when processing large scale samples or delivering a fast diagnosis (Van der Graaf-van Bloois et al. 2013).

In addition, C. foetus is labile and requires special techniques to be isolated, with a low percentage of success rate (Skirrow et al. 1994).

Genomic DNA extraction

Efficient diagnosis requires a complete diagnostic protocol associated with submission of appropriate specimens and clinical history.

Several PCR protocols have been recently developed

270

However, the multiplex real-time PCR method is advantageous for detecting more than 1 target DNA sequences in a single reaction. This direct method is generally applied for the detection of specific bacteria from the hosts (Dieffenbach and Dveksler 1995).

The reference strains of Brucella spp. and C. foetus spp. were obtained from Friedrich-Loeffler-Institute (FLI, Jena, Germany). The Leptospira spp. strains were obtained from the strain collection of the Veterinary Laboratories agency (VLA, Berlin, Germany). The Leptospira spp. strains also included the 10 strains used in routine MAT testing for diagnosis of Leptospirosis (Table I).

Total DNA was extracted from both tissue specimens and different bacterial isolates using High pure PCR Template Preparation Kit (Roche, Mannheim, Germany) according to manufacture’s protocol. The extracted DNA was stored at -20 °C for further use.

DNA concentration of stock solutions was measured by spectrophotometer (DU640 Photometer, Beckman Coulter GmbH, Krefeld, Germany) at 260 and 280 nm.

Primers and probes of multiplex real‑time PCR The primers and probes used for the multiplex assay are shown in Table II. For Brucella spp. identification, the primers and probe target the bcsp31 gene was used as described by Probert and colleagues (Probert et al. 2004). Previously described primers and probes were used for Leptospira spp. target LipL32 gene

Veterinaria Italiana 2014, 50 (4), 269-275. doi: 10.12834/VetIt.222.702.3

Selim et al.

Multiplex real-time PCR assay for Brucella spp., Leptospira spp. and Campylobacter foetus

Table I. Reference strains of Brucella spp., Leptospira spp. and Campylobacter foetus, the strains have been obtained from Friedrich-Loeffler-Institute (FLI, Jena, Germany), the Veterinary Laboratories agency (VLA, Berlin, Germany).

Multiplex real-time PCR

Serovar

Strain

Brucella spp.

Leptospira spp.

C. foetus

Leptospira borgpetersenii serovar ballum

Mus 127

No Cq

Positive

No Cq

Leptospira interrogans serovar icterohemorrhagia

RGA (ref. strain, FLI)

No Cq

Positive

No Cq

Leptospira interrogans serovar bataviae

Swart

No Cq

Positive

No Cq

Leptospira interrogans serovar bratislava

Jez Bratislava

No Cq

Positive

No Cq

Leptospira interrogans serovar canicola

Hond Utrecht

No Cq

Positive

No Cq

Leptospira interrogans serovar copenhageni

M 20

No Cq

Positive

No Cq

Leptospira kirschneri serovar grippotyphosa

Moskva 5

No Cq

Positive

No Cq

Leptospira interrogans serovar hardjo

Hardjoprajitno

No Cq

Positive

No Cq

Leptospira interrogans serovar pomona

Pomona

No Cq

Positive

No Cq

Leptospira interrogans serovar saxkoebing

Perepelitsin

No Cq

Positive

No Cq

Leptospira borgpetersenii serovar sejroe

M 84

No Cq

Positive

No Cq

Leptospira australis

PK 8/12

No Cq

Positive

No Cq

Leptospira copenhageni

PK 9/12

No Cq

Positive

No Cq

Leptospira rerassovi

PK13/12

No Cq

Positive

No Cq

Leptospira hardjo

PK 11/12

No Cq

Positive

No Cq

Leptospira grippotyphosa

PK 10/12

No Cq

Positive

No Cq

Leptospira pomona

PK 12/12

No Cq

Positive

No Cq

Brucella suis

CS (2013), swine

Positive

No Cq

No Cq

Brucella microti

Ref strain CCM4915

Positive

No Cq

No Cq

Brucella ceti

Ref strain NCTC 12891

Positive

No Cq

No Cq

Brucella pinnipedialis

Ref strain NCTC 12890

Positive

No Cq

No Cq

Brucella abortus

Cs (2013), cattle

Positive

No Cq

No Cq

13CS0045 (ref. strain, FLI)

No Cq

No Cq

Positive

13CS0046 (ref. strain, FLI)

No Cq

No Cq

Positive

13CS0047 (ref. strain, FLI)

No Cq

No Cq

Positive

13CS0048 (ref. strain, FLI)

No Cq

No Cq

Positive

13CS0049 (ref. strain, FLI)

No Cq

No Cq

Positive

13CS0050 (ref. strain, FLI)

No Cq

No Cq

Positive

13CS0051 (ref. strain, FLI)

No Cq

No Cq

Positive

NCTC010354

No Cq

No Cq

Positive

12CS0290 (ref. strain, FLI)

No Cq

No Cq

Positive

12CS0291 (ref. strain, FLI)

No Cq

No Cq

Positive

11CS0001 (ref. strain, FLI)

No Cq

No Cq

Positive

Campylobacter foetus ssp. veneralis

Campylobacter foetus ssp. foetus

DSMZ 5361

No Cq

No Cq

Positive

Chlamydia abortus

Cs 26 (2004), sheep, abortion

No Cq

No Cq

No Cq

Coxiella burnetti

Cs 1928 (2008), sheep, spleen

No Cq

No Cq

No Cq

Escherichia coli

Ref- DNA, JLU Giessen (1996)

No Cq

No Cq

No Cq

Listeria monocytogenes

Field isolate(1998), sheep

No Cq

No Cq

No Cq

Mycoplasma bovis

Cs 3654/79 (2005), cattle, milk

No Cq

No Cq

No Cq

Neospora caninum

Cs 472/06 (2006), cattle, abortion

No Cq

No Cq

No Cq

Pasteurella multocida

Cs 500/1 (2001), cattle, lung

No Cq

No Cq

No Cq

FLI = Friedrich-Loeffler-Institute; JLU= Justus-Liebig University; Cs = Clinical samples; Cq = quantification cycle; DSMZ = designation of type and reference strains of the German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany; NCTC = National collection of type culture.

Veterinaria Italiana 2014, 50 (4), 269-275. doi: 10.12834/VetIt.222.702.3

271

Multiplex real-time PCR assay for Brucella spp., Leptospira spp. and Campylobacter foetus Selim et al.

(Stoddard et al. 2009) and C. foetus target nahE gene (Van der Graaf-van Bloois et al. 2013), respectively. To monitor the conditions and to detect PCR inhibitors, an internal control based on the housekeeping gene beta-actin (Wernike et al. 2011) was integrated into the multiplex real-time PCR.

Multiplex real-time PCR conditions Multiplex real-time PCR was conducted in 25 µl reaction volume. For a single reaction, the PCR mastermix contained 2.0 µl of each primer-probe mix (100 pmol/µl), 2.0 µl of each primer-probe mix of ß-actin (100 pmol/µl), 0.5 µl RNase-free water and 12.5 µl of QuantiTect Multiplex No Rox MasterMix (Qiagen, Hilden, Germany); finally 4.0 µl template was added. All primers were delivered by Biotez (Berlin, Germany) and probes by Eurogentec (Serating, Belgium).

The PCR reaction was performed on Stratagene Mx3005 with the following protocol: initial denaturation and activation of Taq-polymerase for 15 minutes at 95°C, followed by 45 cycles of 1 minute at 94°C, 90 seconds minutes at 60°C and finally 30 seconds at 40 °C for cooling.

Evaluation of multiplex real-time PCR The detection limit of the multiplex real-time PCR was evaluated by 10-fold serial dilution of a DNA of the reference strain (Brucella abortus 544, Leptospira interrogans serovar icterohemorrhagiae and Campylobacter foetus subsp. veneralis 13CS0047).

Serial dilutions were freshly prepared from stock solutions with sterile water in a broad range from 5 ng to 5 fg/µl. These dilutions were examined 3-fold with the following calculation of mean values and standard deviation (SD).

To determine the specificity of the optimized multiplex real-time PCR, 16 Leptospira spp. strains, 5 Brucella spp. strains and 12 C. foetus spp. strains and other closely related bacteria were used as shown in Table I. To study the diagnostic sensitivity of multiplex real-time PCR protocol, 29 positive-Brucella and 12 positive-Leptospira samples of an aborted foetus and placenta were tested. These samples have also been examined by conventional PCR (Baily et al.

1992) and nested PCR (Lester and LeFebvre 2003) by State Agency of Agriculture, Food Safety Institute, Rostock, Germany.

Results Integrity of clinical samples A ß-actin signal was detected in all the clinical samples tested via multiplex real-time PCR, indicating no evidence of extraction failure or PCR inhibition.

Detection limit of multiplex real-time PCR The detection limit of multiplex real-time PCR was determined by using a 10-fold serial dilution of the DNA of a reference strain ranging from 5 ng to 5 fg/ µl. The reproducible detection limits were set at 50 fg for in Brucella-PCR, while the detection limits for the Leptospira spp. and C. foetus spp. were set at 5 fg of DNA were detected. The SDs of the cycle threshold (CT) values ranged between 0.1 and 0.5 (Brucella spp.), 0.3 and 1.8 (Leptospira spp.), 0.1 and 0.4 (C. foetus spp.), as shown in Table III. The detection limit of the multiplex real-time PCR was compared with single-target PCR for Brucella spp., Leptospira spp. and C. foetus spp. based on the same serial dilution of the DNA of

Table II. Oligonucleotide sequences of the primers and probes used in this study.

Target Brucella

Leptospira

Campylobacter foetus

ß-actin

272

Oligo name Brucc sp-F Brucc spp-R Probe LipL32-45F LipL32-Rb LipL32-189P nahE-F nahE-R Probe ACT-1005-F ACT-1035-R ACT-1081

Sequences 5`-GCT CGG TTG CCA ATA TCA ATG C-3´ 5`-GGG TAA AGC GTC GCC AGA A-3´ FAM 5`-AAA TCT TCC ACC TTG CCC TTG CCA TCA-Rox AAGCATTACCGCTTGTGGTG GAACTCCCATTTCAGCGAT FAM - AAAGCCAGGACAAGCGCCG – Cy5 5´-TGT TAT GGT GAT CAA AAT AGC TGT TG -3´ 5´-GAG CTG TTT TTA TGG CTA CTC TTT TTT TA -3` Hex - AAAGCCAGGACAAGCGCCG – MGB 5´- CAG CAC AAT GAA GAT CAA GAT CAT C-3´ 5´- CGG ACT CAT CGT ACT CCT GCT T-3´ FAM- TCG CTG TCC ACC TTC CAG CAG ATG T-BHQ1

Reference Probert et al. 2004

Stoddard et al. 2009

Van der Graaf-van Bloois et al. 2013

Wernike et al. 2011

Veterinaria Italiana 2014, 50 (4), 269-275. doi: 10.12834/VetIt.222.702.3

Selim et al.

Multiplex real-time PCR assay for Brucella spp., Leptospira spp. and Campylobacter foetus

the 3 reference pathogens. The detection limits of single real-time PCR of the pathogens were lower than in muliplex real-time PCR as 500 fg DNA with Brucella spp. was detected and 50 fg DNA in the case of Leptospira spp. and C. foetus, as shown in Figure 1.

Specificity of multiplex real-time PCR The performance of the multiplex real-time PCR with different reference strains of the 3 pathogens demonstrated neither non-specific reactions nor any inter-assay cross amplification. The result showed positive amplification only with the integrated strains in multiplex real-time PCR, as shown in Table I.

vaccinated animals with high levels of circulating antibodies can be misdiagnosed as active infections.

There are, however, several single and multiplex PCR studies that have been conducted so to detect some of these pathogens (Vasconcellos et al. 2002, Van der Graaf-van Bloois et al. 2013).

Previous studies have also demonstrated the successful application of single PCR using specific primer pairs for the detection of Brucella spp. in bacterial culture or blood samples (Baily et al. 1992),

A

45

The performance of the multiplex real-time PCR assay in clinical samples was evaluated on different positive organs material obtained from aborted animals. The results showed detectable ct-values with all positive 29 Brucella and 12 Leptospira clinical samples. Consequently, the optimized multiplex real-time PCR was able to simultaneously detect all 3 pathogens in 1 reaction.

Mean of ct-values

40

Analysis of clinical samples

35 30 25 20 15 10 5 0

5 ng

500 pg

50 pg

5 pg

500 fg

50 fg

Serial dilution of DNA

B

Discussion

45 40 35

Mean of ct-values

Abortion in cattle is a multifactorial disease, often caused by different infectious agents. In most cases, traditional methods are not sufficient to detect the cause of the abortion, as they are often inconclusive and time consuming. Furthermore, each agent may be identified by a specific technique, such as isolation, immunohistochemistry or immunofluorescence and serology (Anderson 2007). At the same time, antigen-antibody interactions can be complicated by non-specific interactions, and false positive from

30 25 20 15 10 5 0

5 ng

500 pg

50 pg

5 pg

500 fg

50 fg

5 fg

50 fg

5 fg

Serial dilution of DNA

C

45

DNA per PCR reaction

Brucella spp.

Campylobacter Leptospira spp. foetus mean SD mean SD

mean

SD

5 ng

20.5

0.1

19.5

1.6

19.3

0.3

500 pg

24.3

0.3

22.5

1.8

22.3

0.4

50 pg

28

0.3

25.2

1.3

25.5

0.4

5 pg

32

0.1

28.5

0.3

28.7

0.4

500 fg

35

0.3

32.11

0.8

32.1

0.1

50 fg

39.3

0.5

35

0.8

36.7

0.4

5 fg

No Ct

38.6

0.5

38.8

0.2

Veterinaria Italiana 2014, 50 (4), 269-275. doi: 10.12834/VetIt.222.702.3

Mean of ct-values

40

Table III. Analytical sensitivity of multiplex real-time PCR with quantified DNA of the three strains (Brucella spp., Leptospira spp., Campylobacter foetus) obtained from Friedrich-Loeffler-Institute (FLI, Jena, Germany), the Veterinary Laboratories agency (VLA, Berlin, Germany).

35 30 25 20 15 10 5 0

5 ng

500 pg

50 pg

5 pg

500 fg

Serial dilution of DNA Mean ct-value of multiplex

Mean ct-value of single

Figure 1. Comparison of the standard curves of the single and multiplex real-time PCR assay for the detection of (A) Brucella spp., (B) Leptospira spp. and (C) Campylobacter foetus using strains obtained from the from Friedrich-Loeffler-Institute (FLI, Jena, Germany), the Veterinary Laboratories agency (VLA, Berlin, Germany).

273

Multiplex real-time PCR assay for Brucella spp., Leptospira spp. and Campylobacter foetus Selim et al.

the detection of Leptospira spp. in clinical samples (Merien et al. 1992), and the detection of C. foetus spp. (Van der Graaf-van Bloois et al. 2013).

Nonetheless, single PCR only allows for the detection of nucleic acid from 1 specific pathogen at time. Recent attempts to use individual PCR for the simultaneous detection of the 3 abortive pathogens in bovine described in this study have proved to be relatively costly and time-consuming.

The multiplex PCR has the advantage of simultaneous detection of different pathogens and has been proven to be sensitive, specific and cost effective. It can also be useful in diagnosis, screening and surveillance of flocks (Henegariu et al. 1997).

The detection limit of the multiplex and single PCR assays was evaluated by testing 10-fold serial dilutions of reference strains of the 3 pathogens.

The efficiency and the detection limit of the PCR were not affected by multiplexing the reaction. The reproducible detection limit was 5 fg for Leptospira spp. and C. foetus spp., while the detection limit for Brucella spp. was 50 fg. The detection limit of single PCR (500 fg for Brucella spp. and 50 fg for Leptospira spp., and C. foetus), was lower than multiplex realtime PCR limit (Figure 1).

In general, the multiplex real-time was better than triplex real-time PCR, which has been used in a multiplex format for rapid confirmation of Brucella species to detect 150 pg of DNA (Probert et al. 2004).

In addition, multiplex conventional PCR for detection of C. foetus spp. capable of detecting 5 ng/µl (Iraola et al. 2012) and for pathogenic leptospires targeting LipL32 capable of detecting as low as 2.5 pg have already been reported in the literature (Bhure et al.

2003). Previous studies also report multiplex PCR for detection of Leptospira spp. and Brucella spp. capable of detecting 100 fg for Brucella and 1 pg for Leptospira spp. (Kim et al. 2006) and 17 pg for both pathogens (Bhure et al. 2003).

274

Two or more target sequences present in different amount in the same foetal tissue may cause false negative results when concerning the less prevalent agent. Such problem can potentially affect all multiplexes targeting molecular assays. However, the data obtained in this study by using the set of multiplex PCR assays were in perfect accordance with those observed by the same PCR assay run in simplex, thus demonstrating the high reliability and sensitivity of the proposed panel.

According to previous studies (Probert et al. 2004, Stoddard et al. 2009, Van der Graaf-van Bloois et al.

2013), the primers and probe used in multiplex real‑time PCR were specific for Brucella spp., Leptospira spp. and C. foetus spp. and were applicable for all species and subspecies among those 3 bacterial genera. The results of multiplex real-time PCR with different reference strains of 3 pathogens showed 100% specificity for the 3 bacteria and no crossing reaction between them.

The inhibition of PCR can be a puzzling factor, because unknown inhibitors may be released from tissue in DNA extraction. The presence of inhibitors could be affecting the sensitivity of PCR especially for various tissue samples (Lester and LaFebvre 2003, Navarro et al. 2002).

The results of multiplex real time PCR from previous examined positive field samples for Brucella and Leptospira were positive in all samples. Furthermore, a ß-actin signal was detected in all clinical samples tested via the multiplex real-time PCR indicating no evidence of extraction failure or PCR inhibition.

In conclusion, the set of multiplex real-time PCR assays described in this study showed a way of simultaneously detecting the 3 important infectious agents associated with abortion in cattle.

Application of this panel of multiplex real-time PCR is simpler, less expensive, and faster than the use of single PCR assays.

Veterinaria Italiana 2014, 50 (4), 269-275. doi: 10.12834/VetIt.222.702.3

Selim et al.

Multiplex real-time PCR assay for Brucella spp., Leptospira spp. and Campylobacter foetus

References Andreson M.L. 2007. Infectious causes of bovine abortion during mid- to late-gestation. Theriogenology, 68, 474-486.

Baily G.G., Krahn J.B., Drasar B.S. & Stoker NG. 1992.

Detection of Brucella melitensis and Brucella abortus by DNA amplification. J Trop Med Hyg, 95, 271-275.

Bhure S.K., Chandan S., Amachawadi R.G., Patil S.S., Shome R., Gangadhar N.L., Gajendragad M.R. & Prabhudas K. 2003. Development of a novel multiplex PCR for detection of Brucella, Leptospira and Bovine herpesvirus-1. Indian J Anim Sci, 82, 1285-1289.

Bricker B.J., Ewalt D.R., Olsen S.C. & Jensen A.E. 2003.

Evaluation of the Brucella abortus species specific polymerase chain reaction assay, an improved version of the Brucella AMOS polymerase chain reaction assay for cattle. J Vet Diagn Invest, 15, 374-378.

Dieffenbach C.W. & Dveksler G.S. 1995. PCR Primer: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York, 714 pp.

De Vries A. 2009. Economic value of pregnancy in dairy cattle. J Dairy Sci, 89, 3876-3885.

Heinemann M.B., Garcia J.F., Nunes C.M., Higa Z.M.M., Vasconcellos S.A. & Richtzenhain L.J. 1999. Detection of Leptospira spp. from pure cultures and from experimentally contaminated bovine semen by polymerase chain reaction. Braz J Vet Res Anim Sci, 36, 1. http://www. scielo.br/scielo.php?script=sci_arttext&pid=S141395961999000100002&lng=en&nrm=iso.

Henegariu O., Heerema N.A., Dlouhy S.R., Vance G.H. & Vogt P.H. 1997. Multiplex PCR: Critical parameters and step by step protocol. Biotechniques, 23, 504-511.

Iraola G., Hernandez M., Calleros L., Paolocchi F., Silveyra S., Velilla A., Carretto L., Rodriguez E. & Perez R. 2012.

Application of a multiplex PCR assay for Campylobacter foetus detection and subspecies differentiation in uncultured samples of aborted bovine foetuses. J Vet Sci, 13, 371-376.

Kim S., Lee D.S., Suzuki H. & Watarai M. 2006. Detection of Brucella canis and Leptospira interrogans in canine semen by multiplex nested PCR. J Vet Med Sci, 68, 615-618.

Lam T.Q., Yoon B. & Hahn T. 2012. Development of multiplex PCR to identify Salmonella, Leptospira and Brucella species in tissue samples. Korean J Vet Res, 52, 75-82.

Lester J.W. & LeFebvre R.B. 2003. Detection of Leptospira interrogans. Methods Mol Biol, 216, 193-200.

Merien F., Amouriaux P., Perolat P., Baranton G & Saint Girons I. 1992. Polymerase chain reaction for detection of Leptospira spp. in clinical samples. J Clin Microbiol, 30, 2219-2224.

Miller C.D., Songer J.R. & Sullivan J.F. 1997. A twenty-five year review of laboratory acquired human infections at the National Animal Disease Center. Am Ind Hyg Assoc J, 48, 271-275.

Navarro E., Escribano J., Fernandoz J.A. & Solera J. 2002.

Comparison of the three different PCR methods for detection of Brucella spp. in human blood samples.

Immunol Med Microbiol, 34, 147-151.

Veterinaria Italiana 2014, 50 (4), 269-275. doi: 10.12834/VetIt.222.702.3

Palaniappan R.U., Chang Y.F., Chang C.F., Pan M.J., Yang C.W., Harpending P., McDonough S.P., Dubovi E., Divers T., Qu J. & Roe B. 2005. Evaluation of lig-based conventional and real time PCR for the detection of pathogenic leptospires. Mol Cell Probes, 19, 111-117.

Probert W.S., Schrader K.N., Khuong N.Y., Bystrom S.L. & Graves M.H. 2004. Real-time multiplex PCR assay for detection of Brucella spp., B. abortus, and B. melitensis. J Clin Microbiol, 42, 1290-1293.

Reisberg K., Selim A. & Gaede W. 2013. Simultaneous detection of Chlamydia spp., Coxiella burnetii, and Neospora caninum in abortion material of ruminants by multiplex real-time polymerase chain reaction. J Vet Diagn Invest, 25, 614-619.

Richtzenhain L.J., Cortez A., Heinemann M.B., Soares R.M., Sakamoto S.M., Vasconcellos S.A., Higa Z.M., Scarcelli E. & Genovez M.E. 2002. A multiplex PCR for the detection of Brucella spp. and Leptospira spp. DNA from aborted bovine foetuses. Vet Microbiol, 87, 139-147.

Skirrow M.B. 1994. Disease due to Campylobacter, Helicobacter and related bacteria. J Comp Pathol, 111, 113-149.

Smith L.D. & Ficht T.A. 1990. Pathogenesis of Brucella. Crit Rev Microbiol, 17, 209-230.

Stoddard R.A., Gee J.E., Wilkins P.P., McCaustland K. & Hoffmaster A.R. 2009. Detection of pathogenic Leptospira spp. through TaqMan polymerase chain reaction targeting the LipL32 gene. Diagn Microbiol Infect Dis, 64, 247-255.

Tramuta C., Lacerenza D., Zoppi S., Goria M., Dondo A., Ferroglio E., Nebbia P. & Rosati S. 2011. Development of a set of multiplex standard polymerase chain reaction assays for the identification of infectious agents from aborted bovine clinical samples. J Vet Diagn Invest, 23, 657-664.

Van der Graaf-van Bloois L., van Bergen M.A., van der Wal F.J., de Boer A.G., Duim B., Schmidt T. & Wagenaar J.A. 2013. Evaluation of molecular assays for identification Campylobacter foetus species and subspecies and development of C. foetus specific real time PCR assay.

JÂ Microbiol Methods, 95, 93-97.

Vargas A.C., Costa M.M., Vainstein M.H., Kreutz L.C. & Neves J.P. 2003. Phenotypic and molecular characterization of bovine Campylobacter foetus strains isolated in Brazil.

Vet Microbiol, 93, 121-132.

Vasconcellos S.A., Higa Z.M.M., Scarcell E. & Genovez M.E. 2002. Multiplex PCR for the detection of Brucella spp. and Leptospira spp. DNA from aborted bovine foetuses.

Vet Microbiol, 87,139-147.

Wernike K., Hoffmann B., Kalthoff D., KĂśnig P. & Beer M. 2011. Development and validation of a triplex real-time PCR assay for the rapid detection and differentiation of wild-type and glycoprotein E-deleted vaccine strains of Bovine herpesvirus type 1. J Virol Methods, 174, 77-84.

Xue F., Yan J. & Picardeau M. 2008. Evolution and Pathogenesis of Leptospira spp: lessons learned from the genomes. Microbes Infect, 11, 328-333.

275

Seasonality and antibiotic resistance of Campylobacter in Turkish chicken meat Gokben Ozbey1* & Bulent Tasdemir2 1

Vocational School of Health Services, Firat University, 23119 Elazig, Turkey.

2 Veterinary Control and Research Institute, 23120 Elazig, Turkey.

* Corresponding author at: Vocational School of Health Services, Firat University, 23119 Elazig, Turkey.

Tel.: +90 424 2370079, e-mail: gokben.ozbey@yahoo.com.

Veterinaria Italiana 2014, 50 (4), 277-283. doi: 10.12834/VetIt.170.2543.1 Accepted: 23.10.2014 | Available on line: 29.12.2014

Keywords Antimicrobial resistance, Chicken meat, Campylobacter coli, Campylobacter jejuni, Seasonal prevalence.

Summary This study investigated the seasonal prevalence and the antimicrobial susceptibility of Campylobacter jejuni and Campylobacter coli in 264 samples of chicken meat. The samples encompassed wings (n=88), breasts (n=79) and thighs (n=97) and were purchased from different butcheries and markets in Elazig province, in Eastern Turkey, between December 2009 and November 2010. The meat samples were tested for Campylobacter presence and the collected isolates were identified as Campylobacter jejuni and Campylobacter coli using polymerase chain reaction (PCR). Resistance rates to 7 antimicrobials were investigated by the disk diffusion method. Campylobacter jejuni was found at a higher prevalence (41.7%) than C. coli (14.4%); C. jejuni was isolated most frequently from breast samples (53.2%) than from thighs (40.2%) and wings (32.9%) samples. The prevalence of C. jejuni and C. coli peaked during the Summer (June-August), with the highest peak occurring in July (77.3%).

The lowest prevalence (30%) was detected in February. The prevalence in the Summer (June‑August) was significantly higher (71.2%) than the one reported during the Winter (December‑February) (39.4%, P < 0.05). The highest resistance rate among C. jejuni isolates was observed to tetracycline (38.2%), nalidixic acid (29.1%), and ciprofloxacin (24.5%).

Campylobacter coli also showed a high resistance to these antibiotics, although in slightly different proportions: tetracycline (42.1%), ciprofloxacin (31.6%), and nalidixic acid (26.3%).

None of the C. jejuni or C. coli isolates was resistant to gentamicin.

Variazioni stagionali e resistenza ad antibiotici del Campylobacter in campioni di carne di pollame in Turchia Parole chiave Campylobacter coli, Campylobacter jejuni, Carne di pollo, Prevalenza stagionale, Resistenza antimicrobica.

Riassunto Nel presente studio si analizza la variazione stagionale della prevalenza e la resistenza antimicrobica di Campylobacter jejuni e Campylobacter coli in 264 campioni di carne di pollo, mensilmente prelevati dai mercati e dalle macellerie della della provincia di Elazig, nella Turchia orientale tra dicembre 2009 e novembre 2010. I campioni di ali (n=88), petti (n=79) e cosce (n=97) sono stati testati per verificare la presenza di Campylobacter, mediante polymerase chain reaction (PCR). Sono stati identificati isolati di C. jejuni e C. coli ed è stato analizzato il livello di resistenza a 7 antimicrobici mediante disco-diffusione. Campylobacter jejuni è stato rilevato in una percentuale più alta (41.7%) rispetto al C. coli (14.4%); C. jejuni è stato isolato più frequentemente nei campioni di petti di pollo (53.2%) che nei campioni prelevati dalle cosce (40.2%) e dalle ali (32.9%). Inoltre, è stato riscontrato che prevalenza di C. jejuni e C. coli raggiunge livelli superiori durante i mesi estivi (giugno-agosto), con un picco nel mese di luglio (77.3%), mentre la percentuale più bassa di prevalenza è stata registrata nel mese di febbraio (30%). La prevalenza ha livelli più alti nei mesi estivi (71.2%) rispetto a quelli invernali (39.4%, P < 0.05). Tra gli isolati di C. jejuni il tasso più alto di resistenza è stato osservato per la tetraciclina (38.2%), seguito da acido nalidixico (29.1%), e ciprofloxacina (24.5%). Anche C. coli ha mostrato un’alta resistenza agli stessi antibiotici, seppure con diverse percentuali: tetraciclina (42.1%), ciprofloxacina (31.6%), e acido nalidixico (26.3%). Gli isolati di C. jejuni e C. coli non hanno mostrato resistenza alla gentamicina.

277

Seasonality and antibiotic resistance of Campylobacter

Introduction Campylobacter is the major bacterial cause of human gastroenteritis worldwide (Coker et al. 2002, Friedman et al. 2000, World Health Organization 2010). Campylobacter jejuni and Campylobacter coli account for approximately 90% and 10% of human infections, respectively (Friedman et al. 2000).

Other Campylobacter species are occasionally isolated from clinical cases but at much lower proportions (Frost et al. 1998, Leatherbarrow et al.

2004). It has been proved that handling of raw poultry and consuming undercooked chicken meat are important sources of campylobacterosis in humans (Dufrenne et al. 2001, Michaud et al. 2004).

The incidence of campylobacteriosis in humans generally peaks during the Summer (Tauxe 1992).

In Turkey, the incidence of campylobacteriosis in humans has peaked during March, May, July and August suggesting seasonality (Gurol et al. 2013).

Campylobacter jejuni and C. coli are phylogenetically closely related, the differentiation between the two species has been performed using biochemical assays, such as the hippurate hydrolysis test (Dedieu et al. 2004). However, speciation using biochemical techniques sometimes disagrees with genetic based methods such as the polymerase chain reaction (PCR) (Dedieu et al. 2004, Rönner and Lindmark 2007). The identification by PCR is the most common and reliable method to rapidly differentiate between Campylobacter species (Bolton et al. 2002, Zaidi et al. 2012). Different PCR strategies including various genetic targets such as ceuE (Gonzalez et al. 1997), aspartokinase (asp), hippuricase gene (hipO) (Lawson et al. 1998), cadF (Englen and Fedorka‑Cray 2002), and 16S rRNA (Bang et al. 2002) have been used to identify C. coli and C. jejuni and Campylobacter species.

Campylobacteriosis is often self-limiting and generally does not require antimicrobial treatment (Allos 2001, Corcoran et al. 2006), except in immunocompromised patients such as the very young or elderly people (Bardon et al. 2011, Wieczorek et al. 2012). Recently, the number of Campylobacter strains resistant to fluoroquinolones has increased worldwide (Alfredson and Korolic 2007, European Food Safety Authority 2012b, Quinn et al. 2007, Wieczorek et al. 2012). In Turkey, the increasing of antibiotic resistance has become a major public health problem (Yucel and Erguler 2008). Of human Campylobacter isolates in Turkey, 59% and 7% were resistant to quinolone and erythromycin, respectively (Gurol et al. 2013, Ongen et al. 2007), the percentage of resistance varying depending on the antibiotics tested. It has been reported that 79.5% of Campylobacter isolates were resistant to nalidixic acid, 75.6% to levofloxacin, 73.9% to ciprofloxacin, 24% to

278

Ozbey & Tasdemir

tetracycline and 6.3% to erythromycin (Kayman et al. 2013).

The aim of this study was to analyse the seasonal differences in the prevalence of C. jejuni and C. coli in retail chicken meats collected in Elazig province in Eastern Turkey and to measure the antibiotic resistance of the isolates.

Materials and methods Collection of chicken samples A total of 264 samples of chicken meat (with skin) were collected monthly between December 2009 and November 2010 from different butchers’ shops and markets in the Elazig province, in Eastern Turkey.

Samples included wings (n=88), breasts (n=79) and thighs (n=97). Meat samples were individually bagged, and immediately transported to the laboratory on ice, refrigerated and processed within 24 hours from collection.

Culture of Campylobacter spp.

The detection of Campylobacter spp. was conducted according to the ISO 10272-1:2006 standards1. Each chicken piece (e.g. a single wing, thigh or breast) was analysed individually. Slices were cut aseptically from each pack. For all samples, 25 gr were added to 225 mL of supplemented Bolton Broth (Oxoid CM 983, SR 183, SR 48, Basingstoke, UK) and incubated under microaerophilic conditions obtained by the CampyGen gas-generating kit (Oxoid, Lot: 13L08-C25-14, Basingstoke, UK) at 35°C for 4 hours prior to transfer to 41.5°C for 48 hours. Following enrichment, 10 μl of broth were spread onto modified Charcoal Cefoperazone Deoxycholate Agar (mCCDA) (Oxoid CM 739, SR 155, Basingstoke, UK) and incubated at 41.5 ºC for 24-48 hours microaerobically. At the end of the incubation period, the plates were evaluated for the presence of suspected Campylobacter colonies. Five presumptive colonies were selected, plated on sheep blood agar and incubated at 41.5ºC microaerobically for 24‑48 hours.

The suspect Campylobacter colonies were accepted as C. jejuni and C. coli by examination of morphology, gram staining and biochemical tests for oxidase, catalase, hippurate and indoxyl acetate hydrolysis2.

International Organization for Standardization (ISO). 2006. Microbiology of food and animal feeding stuffs – horizontal method for detection and enumeration of thermotolerant Campylobacter spp. Part 1: detection method. ISO 10272-1:2006.

2 H ealth Protection Agency (HPA). 2005. Detection of Campylobacter species. National Standard Method F 21, Issue 2. http://www.hemltd. ru/export/sites/HemLtd/publications/sections/Normativ/foreign/ Infections/medicine/NHS019/article.pdf.

1

Veterinaria Italiana 2014, 50 (4), 277-283. doi: 10.12834/VetIt.170.2543.1

Seasonality and antibiotic resistance of Campylobacter

Ozbey & Tasdemir

The isolates were preserved in brain heart infusion broth (BHIB) with 15% (v/v) glycerol at – 80°C for subsequent analysis.

DNA extraction and PCR The isolation of genomic DNA from C. jejuni and C. coli isolates was performed using the QIAamp DNA mini kit (Qiagen, Hidelberg, Germany) as instructed by the manufacturer. The amplification was conducted in a reaction mixture containing 2 X PCR Master Mix kit (# K01071, Fermentas, Lithuania) using C. jejuni and C. coli specific primers and thermal cycling conditions as previously established

by Misawa and colleagues (Misawa et al. 2002). Ten microliters of the amplified PCR products were mixed with 2 μl of loading buffer and electrophoresed on a 1.5% agarose gel and visualized using a UV transilluminator. The PCR amplification product of the putative oxidoreductase and aspartokinase genes provided band sizes of 159 bp and 502 bp for C. jejuni and C. coli isolates, respectively.

Characterized C. jejuni and C. coli isolates previously recovered from chicken faecal samples were used as positive controls (Ozbey et al. 2012) and distilled water was used as negative control in each PCR reaction.

Antimicrobial resistance testing Antimicrobial susceptibility was conducted using the disc diffusion method on Muller Hinton agar (MHA) (Oxoid CM 337, Basingstoke, UK) containing 5% defibrinated sheep blood as described by the National Committee for Clinical Laboratory Standards3. Using antimicrobial susceptibility testing discs, 110 C. jejuni and 38 C. coli isolates were investigated for resistance to antibiotics including ciprofloxacin (5 μg), nalidixic acid (30 μg), enrofloxacin (5 μg), tetracycline (30 μg), gentamicin (10 μg), erythromycin (15 μg), and chloramphenicol (30 μg) (Oxoid, Basingstoke, UK). The inhibition zone sizes around the discs were measured using callipers and interpreted as resistant (R) or susceptible (S) according to National Committee for Clinical Laboratory Standards.

Results Campylobacter jejuni and C. coli were obtained from 110 (41.7%) and 38 (14.4%) of the 264 chicken samples, respectively. The percentage of chicken testing positive for C. jejuni differed among the chicken product types and was highest on breast samples (53.2%), followed by thighs (40.2%) and lowest in wings (32.9%). Using the Fisher’s exact test, no significant difference was noted between chicken parts. Campylobacter coli differed by having the highest number of positive samples on thigh pieces (23.7%), followed by breasts (11.4%) and, similarly to C. jejuni, was lowest in wings (6.8%).

Again, chicken pieces did not significantly differ for C. coli prevalence.

Table I shows the seasonal and monthly changes in the percentage of C. jejuni and C. coli isolated from raw chicken. Campylobacter spp. (C. jejuni and C. coli) was detected throughout the period of this study, with the most frequent isolation of Campylobacter spp. observed in July (77.3%), followed by June (70%) and August (66.7%). The lowest percentage prevalence was detected in February (30%). Using the Fisher’s exact test, the percentage of chicken samples testing positive during the Summer (June-August) (71.2%) was significantly higher than the percentage of the samples testing positive during the Winter season (December-February) (39.4%) (P < 0.05).

The percentage of the antibiotic resistance of C. jejuni and C. coli isolates are summarized in Table II. The antibiotic with the highest number of Table I. The seasonal changes in the prevalence of C. jejuni and C. coli from the samples of retail poultry collected between December 2009 and November 2010 in the Elazig province, Eastern Turkey.

Seasons

Winter

Number of C. jejuni C. coli samples n (%) n (%) tested (n) December 24 8 (33.3) 4 (16.7) Months

22

February

20

March

21

10 (47.6) 3 (14.3) 13 (61.9)

April

20

10 (50)

May

22

11 (50)

June

20

13 (65)

1 (5)

14 (70)

July

22

16 (72.7)

1 (4.6)

17 (77.3)

August

24

13 (54.2) 3 (12.5) 16 (66.7)

September

22

9 (40.9)

5 (22.7) 14 (63.6)

October

25

5 (20)

8 (32)

November

22

4 (18.2) 110 (41.7)

6 (27.3) 10 (45.5) 38 148 (14.4) (56.1)

Spring

3

N ational Committee for Clinical Laboratory Standards (NCCLS). 2003: Performance standards for antimicrobial disk susceptibility tests. 8th ed.

Approved standard NCCLS document M2-A8. NCCLS, Wayne, PA.

Veterinaria Italiana 2014, 50 (4), 277-283. doi: 10.12834/VetIt.170.2543.1

Summer

Autumn

12 (50)

January

Statistical analysis Both Fisher’s exact test and the Chi squared test (χ2) were used to compare chicken pieces (wings, thighs and breasts) for C. jejuni and C. coli; for the seasonal differences in the prevalence of Campylobacter, a P value of < 0.05 was accepted as significant.

Total n (%)

Total

264

6 (27.3)

2 (9.1)

8 (36.4)

5 (25)

1 (5)

6 (30)

1 (5)

11 (55)

3 (13.6) 14 (63.6)

13 (52)

279

Seasonality and antibiotic resistance of Campylobacter

Ozbey & Tasdemir

Table II. Antimicrobial resistance rates of C. jejuni and C. coli isolated from the samples of retail poultry meat collected between December 2009 and November 2010 in the Elazig province, Eastern Turkey.

Ciprofloxacin

Number of resistant isolates (%) C. jejunin C. coli Total (110) n (38) n (148) 27 (24.5) 12 (31.6) 39 (26.4)

Nalidixic acid

32 (29.1)

10 (26.3)

42 (28.4)

Tetracycline

42 (38.2)

16 (42.1)

58 (39.2)

Chloramphenicol

3 (2.7)

2 (5.3)

5 (3.4)

Enrofloxacin

21 (19.1)

5 (13.2)

26 (17.6)

Erythromycin

1 (0.9)

0

1 (0.7)

Gentamicin

0

0

0

Antibiotics

resistant C. jejuni and C. coli isolates was tetracycline (38.2% and 42.1%), followed by nalidixic acid (29.1% and 26.3%) and ciprofloxacin (24.5% and 31.6%).

Campylobacter jejuni showed a low resistance to chloramphenicol (2.7%) and erythromycin (0.9%).

None of the C. coli isolates were found to be resistant to erythromycin. In addition, all of the isolates (C. jejuni and C. coli) were susceptible to gentamicin.

Discussion Prior to this study, data on the seasonal changes in the prevalence of C. jejuni and C. coli in raw chicken meats and the antibiotic resistance of the isolates from Eastern Turkey were limited.

Campylobacter prevalence in chicken meats varies between areas and countries. In this respect it is noteworthy that Campylobacter prevalence been reported to be 90% in both South Australia and New South Wales (Pointon et al. 2008), 32% in South Africa (van Nierop et al. 2005), 29% in Belgium (Wieczorek et al. 2012), approximately 50% in Ireland (Whyte et al. 2004, Wilson 2002), 76% in France (Denis et al.

2001), 80% in Holland (Dufrenne et al. 2001), and 83.8% in Turkey (Savasci and Ozdemir 2006). The overall Campylobacter prevalence (56.1%) reported in this study is consistent with some international and national studies.

This study also confirmed that C. jejuni is the predominant species in chicken meat in Turkey.

This data agrees with the other findings focusing on Turkey and other countries as well (European Food Safety Authority 2012a, Bardonet et al. 2011, Bostan et al. 2009, Kang et al. 2006, Yucel and Erguler 2008).

Conversely, other authors have reported that C. coli was identified at a higher percentage than C. jejuni from raw poultry meat (Kudirkienė et al.

2013, Wieczorek et al. 2012). However, research performed on chicken meats in Turkey indicated

280

that the prevalence of C. jejuni varied between 65.9% (149/226) (Bostan et al. 2009) and 74.8% (95/127) (Savasci and Ozdemir 2006). The current study showed a relatively low prevalence of C. jejuni at 41.7% (110/264) and C. coli at 14.4% (38/264) when compared to other studies. The prevalence of C. coli in Turkey has been reported to be 17% (51/300) and 25.2% (57/226) (Bostan et al. 2009, Yucel and Erguler 2008). The variability in the Campylobacter prevalence in retail chicken meat may be due to geographic differences, variation in hygiene practices during slaughtering and processing, and variation in the methods used to culture and identify Campylobacter species.

It has previously been reported that the concentration and prevalence of Campylobacter on chicken meat differs significantly between different producers (Kudirkienė et al. 2013). Similar to this study, in Turkey chicken breast samples were more contaminated with C. jejuni at 45.7% (21/46) and 86% (37/43) than the other parts of the bird (Bostan et al. 2009, Savasci and Ozdemir 2006). This may be explained with the attachment characteristics of the bacteria and the larger surface and follicule structure on breast meat (Kotula and Pandya 1995, Savasci and Ozdemir 2006).

The highest isolation rate of Campylobacter from chicken meat was detected during the Summer (71.2%), while the lowest rate was during the Winter (39.4%), this is consistent with literature that reports a peak in the isolation of Campylobacter from chicken meat during the warmer months (Peterson et al.

2001, Willis and Murray 1997). A study conducted in Iran also reported that the prevalence of Campylobacter spp. in chicken meat was the highest during July (87.5%), followed by June (81.8%), September (76.7%) and August (68.8%). Similarly, the lowest prevalence was recorded in February (20.7%) (Rahimi and Saljoughian Esfahani 2010).

Seasonal variability in the proportion of species isolated has also been reported where C. jejuni was detected more often during the warmer months (April-October), and C. coli was more common during the colder periods (November-March) (Kudirkienė et al. 2010). This data support the results of the current research. In contrast, only 1 study conducted in Turkey reported no seasonal variability in the Campylobacter detection rates from chicken (Bostan et al. 2009).

The susceptibility of C. jejuni and C. coli to 7 antimicrobials showed that the highest resistance was to tetracycline, nalidixic acid and ciprofloxacin; this may be due to the widespread and overuse of antibiotics in animal agriculture. The European Commission discourages the use of antibiotics as a preventative measure and encourages prudent use of antimicrobials by enhancing on farm biosecurity

Veterinaria Italiana 2014, 50 (4), 277-283. doi: 10.12834/VetIt.170.2543.1

Ozbey & Tasdemir

practices to reduce zoonotic and symptomatic infections in poultry production4. However, there are considerable differences in legislation regulating the use of antibiotics in poultry production across Europe5. This may partially account for the large disparities in antimicrobial resistance among European countries, with some having stricter regulations than others6. According to the EFSA report (European Food Safety Authority 2012b), resistance to nalidixic acid and ciprofloxacin is common among Campylobacter isolates from chicken meat in many European States, but it is low in Nordic countries (Andersen et al. 2006, Bardon et al. 2011).

Campylobacter jejuni isolates from chickens had a ciprofloxacin resistance of 19% in the USA (Gupta et al. 2004) and 14.9% in Europe (Bywater et al. 2004).

It is noteworthy that the resistance to ciprofloxacin tended to be much higher in Turkey at 25% and 74.2% (Cokal et al. 2004, Yucel and Erguler 2008).

In Europe, 39.6% of C. coli isolates from chicken were resistant to ciprofloxacin (Bywater et al. 2004, Dufrenne et al. 2001). Again, this tended to be much higher in Turkey, with C. coli ciprofloxacin resistance being at 51% and 78.1% (Savasan et al. 2004, Yucel and Erguler 2008). In the current study, ciprofloxacin resistant C. jejuni at 24.5% is one of the highest percentages reported in Europe and the lowest percentage reported in Turkey. Furthermore, the prevalence of ciprofloxacin resistant C. coli at 31.6% is lower than the previously reported values in both Turkey and Europe.

The tetracycline resistance was 34.5% in European countries (Bywater et al. 2004) and 43% in the USA (Gupta et al. 2004). Two studies conducted in Turkey, reported tetracycline resistance to be 42% and 76.3% for C. jejuni and 58.1% and 55.2% for C. coli isolated from broilers (Cokal et al. 2009, Yildirim et al.

2005). Another study conducted in Turkey showed lower tetracycline resistance at 15.3% and 24.2%

Seasonality and antibiotic resistance of Campylobacter

for C. jejuni and C. coli, respectively (Erdeger and Diker 1995). In the current study the percentages of C. jejuni and C. coli isolates resistant to tetracycline were 38.2% and 42.1%, respectively.

Earlier studies reported that the number of Campylobacter isolates resistant to macrolides was low and did not exceed 1% (Andersen et al. 2006, Wieczorek et al. 2012), supporting the present findings. These lower resistance rates are probably due to the fact that macrolides are not used in veterinary medicine in Turkey (Yucel and Erguler 2008). Contrary to our results, studies carried out in Belgium and in the Netherlands showed a relatively high resistance to erythromycin: in Belgium, 4% of C. jejuni and 18% of C. coli isolates were resistant to erythromycin; whereas, in the Netherlands resistance was observed in 39% of the Campylobacter isolates (European Food Safety Authority 2012b). Similar to the current study no gentamicin resistance was exhibited in any other study (Rahimi et al. 2010, Wieczorek et al. 2012).

Education to raise consumers’ awareness and highlighting the methods for the safe preparation of chicken is needed to reduce the human incidence of Campylobacter. Intervention strategies at farm and during processing can also aid in the reduction of human Campylobacter infections.

Acknowledgements Many thanks to Dr Allen Byrd, Agricultural Research Service, U.S. Department of Agriculture; Dr Angela Cook, C-EnterNet Surveillance Laboratory for Foodborne Zoonoses, Public Health Agency of Canada, Guelph, Ontario. The authors’ gratitude also goes to Dr Emma Sproston, Bureau of Microbial Hazards, Health Canada, Ottawa, Canada and Dr Mussaret Zaidi Microbiology Research Laboratory, Hospital General O Horan Merida, Yucatan, Mexico for their valuable comments on this work.

E uropean Commission (EC). 2011. Communication from the Commission to the European Parliament and the Council: Action plan against the rising threats from Antimicrobial Resistance. COM (2011) 748. Brussels, 15/11/2011. http://ec.europa.eu/dgs/health_consumer/docs/communication_amr_2011_748_ en.pdf.

5 E uropean Food Safety Authority (EFSA). 2004. Opinion of the Scientific Panel on Biological Hazards on a request from the Commission related to the use of antimicrobial for the control of Salmonella in poultry. EFSA J, 115, 76 pp. http://www.efsa.europa.eu/en/efsajournal/doc/115.pdf.

6 E uropean Food Safety Authority (EFSA) & European Centre for Disease Prevention and Control (ECDC). 2014. The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2012. EFSA J, 12 (3), 3590, 336 pp. http://www.efsa.europa. eu/en/efsajournal/doc/3590.pdf 4

Veterinaria Italiana 2014, 50 (4), 277-283. doi: 10.12834/VetIt.170.2543.1

281

Seasonality and antibiotic resistance of Campylobacter

Ozbey & Tasdemir

References Alfredson D.A. & Korolic V. 2007. Antibiotic resistance and resistance mechanisms in Campylobacter jejuni and Campylobacter coli. FEMS Microbiol Lett, 277, 123-132.

contamination of chicken and chicken products in The Netherlands with Salmonella and Campylobacter.

J Food Prot, 64, 538-541.

Allos B.M. 2001. Campylobacter jejuni infections: update on emerging issues and trends. Clin Infect Dis, 32, 1201‑1206.

EFSA Panel on Biological Hazards (BIOHAZ). 2010.

Scientific opinion on quantification of the risk posed by broiler meat to human Campylobacteriosis in the EU. EFSA J, 8, 1-89.

Andersen S.R., Saadbye P., Shukri N.M., Rosenquist H., Nielsen N.L. & Boel J. 2006. Antimicrobial resistance among Campylobacter jejuni isolated from raw poultry meat at retail level in Denmark. Int J Food Microbiol, 107, 250-255.

Bang D.D., Wedderkopp A., Pedersen K. & Madsen M. 2002.

Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hip O) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples.

Mol Cell Probes, 16, 359-369.

Bardon J., Kolar M., Karpiskova R. & Hricova K. 2011.

Prevalence of thermotolerant Campylobacter spp. in broilers at retail in the Czech Republic and their antibiotic resistance. Food Control, 22, 328-332.

Bolton F.J., Sails A.D., Fox A.J., Wareing D.R.A. & Greenway D.L.A. 2002. Detection of Campylobacter jejuni and Campylobacter coli in food by enrichment culture and polymerase chain reaction enzyme-linked immunosorbent assay. J Food Protect, 65, 760-767.

Bostan K., Aydin A. & Ang M.K. 2009. Prevalence and antibiotic susceptibility of thermophilic Campylobacter species on beef, mutton, and chicken carcasses in Istanbul, Turkey. Microbial Drug Resist, 15, 143-149.

Bywater R., Deluyker H., Deroover E., de Jong A., Marion H., McConville M., Rowan T., Shryock T., Shuster D., Thomas V., Valle M. & Walters J. 2004. A European survey of antimicrobial susceptibility among zoonotic and commensal bacteria isolated from food-producing animals. J Antimicrob Chemother, 54, 744-754.

Cokal Y., Caner V., Sen A., Cetin C. & Karagenc N. 2009.

Campylobacter spp. and their antimicrobial resistance patterns in poultry: an epidemiological survey study in Turkey. Zoonoses Public Health, 56, 105-110.

Coker A.O., Isokpehi, R.D. Thomas B.N., Amisu K.O. & Obi C.L. 2002. Human campylobacteriosis in developing countries. Emerg Infect Dis, 8, 237-244.

Corcoran D., Quinn T., Cotter L., Whyte P. & Fanning S. 2006.

Antimicrobial resistance profiling and fla-typing of Irish thermophillic Campylobacter spp. of human and poultry origin. Lett Appl Microbiol, 43, 560-565.

Dedieu L., Page’s J.M. & Bolla J.M. 2004. Use of omp50 gene for identification of Campylobacter species by PCR. J Clin Microbiol, 42, 2301-2305.

Denis M., Refregier-Petton J., Laisney M.J., Ermel G. & Salvat G. 2001. Campylobacter contamination in French chicken production from farm to consumers.

Use of a PCR assay for detection and identification of Campylobacter jejuni and Campylobacter coli. J Appl Microbiol, 91, 255-267.

Dufrenne J., Ritmeester W., Delfgou-van Asch E., van Leusden F. & de Jonge R. 2001. Quantification of the

282

Englen M.D. & Fedorka-Cray P.J. 2002. Evaluation of a commercial diagnostic PCR for the identification of Campylobacter jejuni and Campylobacter coli. Lett Appl Microbiol, 35, 353-356.

Erdeger J. & Diker K.S. 1995. Multiple antibiotic resistance in poultry isolates of C Campylobacter. Ankara University Veterinary Faculty Derg, 42, 543-546.

European Food Safety Authority (EFSA) & European Centre for Disease Prevention and Control (ECDC). 2012a.

The European Union Summary Report on trends and sources of zoonoses, zoonotic agents and foodborne outbreaks in 2010. EFSA J, 10 (3), 2597, 442 pp. doi:10.2903/j.efsa.2012.

European Food Safety Authority (EFSA) & European Centre for Disease Prevention and Control (ECDC). 2012b. The European Union Summary Report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2010. EFSA J, 10 (3), 2598, 233 pp. doi:10.2903/j.efsa.2012.2598.

Friedman C.R., Neimann J., Wegner H.C. & Tauxe R.V. 2000.

Epidemiology of Campylobacter jejuni infections in the United States and other industrialized nations.

In Campylobacter (Nachamkin I. & Blaser M.J., eds).

Washington, American Society for Microbiology, 121‑138.

Frost J.A., Oza A.N., Thwaites R.T. & Rowe B. 1998.

Serotyping scheme for Campylobacter jejuni and Campylobacter coli based on direct agglutination of heat-stable antigens. J Clin Microbiol, 36, 335-339.

Gonzalez I., Grant K.A., Richardson P.T., Park, S.F. & Collins M.D. 1997. Specific identification of the enteropathogens Campylobacter jejuni and Campylobacter coli by using a PCR test based on the ceuE gene encoding a putative virulence determinant. J Clin Microbiol, 35, 759-763.

Gupta A., Nelson J.M., Barrett T.J., Tauxe R.V., Rossiter S.P., Friedman C.R., Joyce K.W., Smith K.E., Jones T.F., Hawkins M.A., Shiferaw B., Beebe J.L., Vugia D.J., Rabatsky-Her T., Benson J.A., Root T.P. & Angulo F.J. 2004. Antimicrobial resistance among Campylobacter strains, United States, 1997-2001. Emerg Infect Dis, 10, 1102-1109.

Gurol Y., Kipritçi Z., Biçer S., Acuner I.C., Vitrinel A. & Celik G. 2013. Campylobacter data from a Turkish University hospital laboratory. Acta Gastroenterol Belg, 76, 266‑267.

Kang Y.S., Cho Y.S., Yoon S.K., Yu M.A., Kim C.M., Lee J.O. & Pyun Y.R. 2006. Prevalence and antimicrobial resistance of Campylobacter jejuni and Campylobacter coli isolated from raw chicken meat and human stools in Korea. J Food Protect, 69, 2915-2923.

Kayman T., Abay S. & Hızlisoy H. 2013. Identification of Campylobacter spp. isolates with phenotypic methods

Veterinaria Italiana 2014, 50 (4), 277-283. doi: 10.12834/VetIt.170.2543.1

Ozbey & Tasdemir

and multiplex polymerase chain reaction and their antibiotic susceptibilities. Mikrobiyol Bul, 47, 230-239.

Kotula K.L. & Pandya Y. 1995. Bacterial contamination of broiler chickens before scalding. J Food Prot, 58, 1326‑1329.

Kudirkienė E., Bunevičienė J., Sernienė L., Ramonaitė S., Olsen J.E. & Malakauskas M. 2013. Importance of the producer on retail broiler meat product contamination with Campylobacter spp. J Sci Food Agric, 93, 2293-2298.

Lawson A.J., Shafi M.S., Pathak K. & Stanley J. 1998.

Detection of Campylobacter in gastroenteritis: comparison of direct PCR assay of faecal samples with selective culture. Epidemiol Infect, 121, 547-553.

Leatherbarrow A.J., Hart C.A., Kemp R., Williams N.J., Ridley A., Sharma M., Diggle P.J., Wright E.J., Sutherst J. & French N.P. 2004. Genotypic and antibiotic susceptibility characteristics of a Campylobacter coli population isolated from dairy farmland in the United Kingdom. Appl Environ Microbiol, 70, 822-380.

Michaud S., Menard S. & Arbeit R.D. 2004.

Campylobacteriosis, Eastern Townships, Quebec.

Emerg Infect Dis, 10, 1844-1847.

Misawa N., Kawashima K., Kawamoto H. & Kondo F. 2002. Development of a combined filtrationenrichment culture followed by a one-step duplex PCR technique for the rapid detection of Campylobacter jejuni and C. coli in human faecal samples. J Med Microbiol, 51, 86-89.

Ongen B., Nazik H. & Kaya I. 2007. Identification and antibiotic susceptibilities of Campylobacter strains isolated from routine stool culture: evaluation of five year results. ANKEM Derg, 21, 37-41. http:// www.ankemdernegi.org.tr/ANKEMJOURNALPDF/ ANKEM_21_1_37_41.pdf.

Ozbey G., Tasdemir B., Acik M.N., Muz A., Ertas H.B., Saki C.E. & Kalender H. 2012. FlaA - typing and isolation of Campylobacter jejuni and Campylobacter coli from chickens and flies in Eastern Turkey. Rev Med Vet, 163, 254-260.

Peterson L., Nielsen E.M., Engberg J., On S.L.W. & Dietz H.H. 2001. Comparison of genotypes and serotypes of Campylobacter jejuni isolated from Danish wild mammals and birds and from broiler folks and humans.

Appl Environ Microbiol, 67, 3115-3121.

Pointon A., Sexton M., Dowsett P., Saputra T., Kiermeier A., Lorimer M., Holds G., Arnold G., Davos D., Combs B., Fabiansson S., Raven G., McKenzie H., Chapman A. & Sumner J. 2008. A baseline survey of the microbiological quality of chicken portions and carcasses at retail in two Australian states (2005 to 2006). J Food Prot, 71, 1123-1134.

Seasonality and antibiotic resistance of Campylobacter

Rahimi E. & Saljoughian Esfahani M.H. 2010. Seasonal prevalence of Campylobacter jejuni and Campylobacter coli in raw chicken meat using PCR assay. Middle East J Sci Res, 6, 329-332.

Rönner A.C. & Lindmark H. 2007. Quantitative detection of Campylobacter jejuni on fresh chicken carcasses by realtime PCR. J Food Protect, 70, 1373-1378.

Savasan S., Ciftci A. & Diker K.S. 2004. Emergence of quinolone resistance among chicken isolates of Campylobacter in Turkey. Turk J Vet Anim Sci, 28, 391‑397.

Savasci M. & Ozdemir H. 2006. Prevalence of thermophilic Campylobacter spp. in retail chicken meat in Ankara. J Food Safety, 26, 244-250.

Tauxe R.V. 1992. Epidemiology of Campylobacter jejuni infections in the United States and other industrialized countries. In Campylobacter jejuni: current status and future trends (Nachamkir I., Blaser M.J. & Tompkins L.S. eds) Washington, American Society for Microbiology, 9-19.

Uyttendaele M.R., Debevere J.M., Lips R.M. & Neyts K.D. 1998. Prevalence of Salmonella in poultry carcasses and their products in Belgium. Int J Food Microbiol, 40, 1-8. van Nierop W., Duse A.G., Marais E., Aithma N., Thothobolo N., Kassel M., Stewart R., Potgieter A., Fernandes B., Galpin J.S. & Bloomfield S.F. 2005. Contamination of chicken carcasses in Gauteng, South Africa, by Salmonella, Listeria monocytogenes, and Campylobacter.

Int J Food Microbiol, 99, 1-6.

Whyte P., McGill K., Cowley D., Madden R.H., Moran L., Scates P., Carroll C., O’Leary A., Fanning S., Collins J.D., McNamara E., Moore J.E. & Cormican M. 2004.

Occurrence of Campylobacter in retail foods in Ireland.

Int J Food Microbiol, 95, 111-118.

Wieczorek K., Szewczyk R. & Osek J. 2012. Prevalence, antimicrobial resistance, and moleculer characterization of Campylobacter jejuni and C. coli isolated from 29, retail raw meat in Poland. Vet Med Czech, 57, 293-299.

Willis W.L. & Murray C. 1997. Campylobacter jejuni seasonal recovery observations of retail market broilers. Poult Sci, 76, 314-317.

Wilson I.G. 2002. Salmonella and Campylobacter contamination of raw retail chickens from different producers: a six-year survey. Epidemiol Infect, 129, 635‑645.

World Health Organization (WHO). 2010. Campylobacter. http://www.who.int/mediacentre/factsheets/fs255/en/.

Yildirim M., Istanbulluoglu E. & Ayvali B. 2005. Prevalence and antibiotic susceptibility of thermophilic Campylobacter species in broiler chickens. Turk J Vet Anim Sci, 29, 655‑660.

Quinn T., Bolla J.M., Pagès J.M. & Fanning S. 2007.

Antibiotic-resistant Campylobacter: could efflux pump inhibitors control infection? J Antimicrob Chemother, 59, 1230-1236.

Yucel N. & Erguler O. 2008. Prevalence and resistance to antibiotics of Campylobacter spp. isolated from chicken meat in the central area of Turkey. Arch Lebensmittelhyg, 59, 170-174.

Rahimi E., Momtaz H., Ameri M., Ghasemian-Safaei H. & Ali-Kasemi M. 2010. Prevalence and antimicrobial resistance of Campylobacter species isolated from chicken carcasses during processing in Iran. Poult Sci, 89, 1015-1020.

Zaidi M.B., McDermott P.F., Campos F.D., Chim R., Leon M., Vazquez G., Figueroa G., Lopez E., Contreras J. & Estrada-Garcia T. 2012. Antimicrobial-resistant Campylobacter in the food chain in Mexico.

Foodborne Pathog Dis, 9, 841-847.

Veterinaria Italiana 2014, 50 (4), 277-283. doi: 10.12834/VetIt.170.2543.1

283

Leptospira spp. infection in wild ruminants: a survey in Central Italian Alps Elena Andreoli1*, Enrico Radaelli1, Irene Bertoletti2, Alessandro Bianchi2, Eugenio Scanziani1, Silvia Tagliabue3 & Silvana Mattiello1 Università degli Studi di Milano, Dipartimento di Scienze Veterinarie e Sanità Pubblica, Via Celoria 10, 20133 Milano, Italy.

2 Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna ‘Bruno Ubertini’, Sezione Diagnostica di Sondrio, Via Bormio 30, 23100 Sondrio, Italy.

3 Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna ‘Bruno Ubertini’, Dipartimento di Sanità e Benessere Animale, Via Bianchi 7/9, 25124 Brescia, Italy.

1

* Corresponding author at: Università degli Studi di Milano, Dipartimento di Scienze Veterinarie e Sanità Pubblica, Via Celoria 10, 20133 Milano, Italy.

Tel.: +39 02 503 18041, e-mail: Elena.Andreoli@unimi.it.

Veterinaria Italiana 2014, 50 (4), 285-291. doi: 10.12834/VetIt.1309.06

Accepted: 05.10.2014 | Available on line: 29.12.2014

Keywords Central Italian Alps, Leptospira spp. infection, Red deer, Renal lesion, Serology, Wild ruminants.

Summary Leptospirosis is an important zoonotic disease diffused worldwide, and wildlife species are commonly considered to be important epidemiological carriers. Four-hundred and forty‑one serological and 198 renal samples from red deer, roe deer and chamois collected in the Province of Sondrio were analysed using the microscopic agglutination test and histopathologic examination. Positive serological findings were found only in 15 red deer and 19 positive serologic reactions were recorded. The most frequent serovars were Bratislava and Grippotyphosa, followed by Pomona, Hardjo and Copenhagheni.

Twenty-two per cent of renal samples from seropositive red deer were affected by mild to moderate multifocal chronic lymphoplasmacytic and fibrosing tubulo-interstitial nephritis, mainly involving the cortical parenchyma. In this study, antibodies to Leptospira spp. were infrequent in wild ruminants, and only red deer seemed to be sensitive to the infection. Given the low presence and the fact that there was no record of Leptospira spp. infections in cattle, sheep, goats and also hunters in area during the study period, wild ruminants in Alpine environments cannot be considered as reservoirs or important sources of Leptospira spp. infection for humans or domestic animals.

Infezione da Leptospira spp. in ruminanti selvatici: indagine nelle Alpi Centrali italiane Parole chiave Alpi Centrali italiane, Cervo, Infezione da Leptospira spp., Lesioni renali, Ruminanti selvatici, Sierologia.

Riassunto La leptospirosi è un’importante zoonosi presente in tutto il mondo e gli animali selvatici sono considerati importanti vettori epidemiologici. Per indagare la presenza dell’infezione Leptospira spp. nei ruminanti allo stato brado delle Alpi Centrali Italiane, in provincia di Sondrio sono stati prelevati 441 campioni sierologici e 198 campioni renali da cervi, caprioli e camosci analizzati, rispettivamente, con il test di agglutinazione microscopica e l'esame istopatologico. Sono state riscontrate 19 reazioni sierologiche positive in 15 cervi. I sierotipi più frequenti sono risultati Bratislava e Grippotyphosa, seguiti da Pomona, Hardjo e Copenhagheni. Nel 22% dei campioni renali appartenenti ai cervi risultati sieropositivi è stata riscontrata una nefrite tubulo-intersiziale multifocale cronica linfoplasmacitica e fibrotica da lieve a moderata. Nel presente studio, gli anticorpi per Leptospira spp. sono risultati infrequenti nei ruminanti selvatici e solo il cervo sembra essere sensibile all’infezione da Leptospira spp. Data la contenuta sieroprevalenza e il fatto che non sono state segnalate infezioni da Leptospira spp. in bovini, ovini, caprini e cacciatori nella area di studio durante il periodo di indagine, i ruminanti selvatici in ambiente alpino non possono essere considerati come reservoirs o importante fonte di infezione da Leptospira spp. per l'uomo o gli animali domestici.

285

Leptospira spp. infection in wild ruminants

Introduction Leptospirosis is an important zoonotic disease diffused worldwide (Bharti et al. 2003) and is considered by the OIE as one of the most important re-emerging human health hazards (Bengis et al.

2004). In Italy, the disease is included in the Official Regulation of Animal Health1, and the infection in domestic animals (such as cattle, sheep and goats) and humans is subject to mandatory reporting to the competent authorities2, although there are no detailed control plans at the present moment.

Leptospirosis is caused by infection with more than 250 Leptospira serovars (Higgins 2004), each tending to be maintained by a host group, which carries and spreads the disease (reservoir or maintenance host) (Adler and de la Peña Moctezuma 2004). Several species of water plants contaminated by leptospiras are the main sources of all serogroups (Mailloux 1980); the primary reservoirs for infection are microtine rodents (Aguirre et al. 1995, Treml et al. Z. 2002, Koizumi et al. 2008) and various game species (Gillespie & Ryno 1963, Mailloux 1980, Bondarenko et al. 2002, Koizumi et al. 2008).

Wildlife species are commonly considered to be important epidemiological carriers, mainly because of their frequent reactivity to Leptospira serovars native to their habitat (Lins et al. 2008, Espí et al.

2010). So far, few serologic studies have evaluated the incidence of the infection in wild ruminants in Italy (Corradini and Pecorari 1981, Lanfranchi et al.

1985, Tolari 1991, Tagliabue and Farina 1995), where the infection in wild ruminants mostly occurs when these species are in contact with domestic cattle.

This study reports the results of a serological and histological survey among various wild ruminant species in the Central Italian Alps, in order to provide updated epizootiological data on Leptospira spp. infection in wild ruminant species in this area and to ascertain whether wild ruminants are a source of Leptospira spp. infection in humans or domestic animals in Alpine environments.

Materials and Methods Study area Data were collected over a 7-year period (2001‑2007) in the Province of Sondrio (surface area 3,212 km2, E 9°14’ - 10°37’; N 45°47’ - 46°22’), in the Central Italian Alps. The Province of Sondrio is divided D ecreto Ministeriale of December the 1st 1990. “Sistema informativo delle malattie infettive e diffusive”. Off J, 6, 08.01.1991.

2 D ecreto del Presidente della Repubblica of February the 8th 1954, n. 320.

“Regolamento di polizia veterinaria”. Off J, 142, 24.06.1954.

1

286

Andreoli et al.

into 5 Hunting Management Districts, where wild ungulate and domestic species may share the same areas during Summer.

The study area contains 3,619 red deer (Cervus elaphus, Linnaeus, 1758), 7,996 chamois (Rupicapra rupicapra, Linnaeus, 1758), 2,570 roe deer (Capreolus capreolus, Linnaeus, 1758) and 1,507 ibex (Capra ibex, Linnaeus, 1758). The estimated pre-reproductive densities of red deer, chamois and roe deer are respectively 2.15 head /100 hectares, 3.85 head/100 hectares and 2.56 head/100 hectares of suitable surface area. Wild boars (Sus scrofa, Linnaeus, 1758) were illegally introduced into some areas in 2006, but no information is available about their number and/or density (Ferloni 2007). In addition to wild ungulates, about 11,000 cattle (Bos taurus, Linnaeus, 1758), 17,000 sheep (Ovis sp., Linnaeus, 1758) and goats (Capra spp., Linnaeus, 1758), and 600 horses (Equus caballus, Linnaeus, 1758) and donkeys (E. asinus, Linnaeus, 1758) were present in the mountain ranges during Summer.

Sample collection Blood and kidney samples came from hunted and found carcasses of red deer, roe deer and chamois. A total of 441 serological samples (237 red deer, 66 roe deer, 138 chamois) were collected, together with 198 renal samples (120 red deer, 16 roe deer, 62 chamois).

Dead animals were collected in collaboration with field veterinarians, forest guards and hunters over a 7-year period (2001-2007) and were delivered to the control centre of the Hunting Management District of Sondrio (Italy). For found carcasses, blood samples were collected by cardiac puncture at the centre. In shot animals, samples were collected by hunters immediately after death. All samples were later centrifuged at 2000 rpm for 10 minutes and sera were stored at -20°C. When at least 1 kidney was present in the carcass, representative renal samples of both cortical and medullary portions were also collected and fixed in 10% buffered formalin.

Hunters sometimes delivered carcasses completely eviscerated, resulting in a lower number of renal than serologic samples.

Laboratory tests The microagglutination test (MAT) (OIE 2013) was used to verify the presence of antibodies against 8 serovars of Leptospira currently used in Italy to check for infection in animals: Canicola, Pomona, Ballum, Hardjo, Copenhagheni, Bratislava, Tarassovi and Grippotyphosa. Minimum serum dilution was 1:100. A titer of 100, usually considered as evidence of past exposure (Levett 2001), was set as the endpoint value. Titration with a geometric dilution serial from 1:100 to 1:6400 was performed.

Veterinaria Italiana 2014, 50 (4), 285-291. doi: 10.12834/VetIt.1309.06

Andreoli et al.

Leptospira spp. infection in wild ruminants

analyses were performed by Istituto Zooprofilattico Sperimentale dell’Emilia e della Romagna, Diagnostic Section of Sondrio, Italy and histological analyses by the Dipartimento di Scienze Veterinarie e Sanità Pubblica of University of Milan, Italy.

For histopathologic examination, fixed renal samples were progressively dehydrated in graded alcohols and xylene and embedded in paraffin blocks. Four-µm serial sections were then stained with hematoxylin‑eosin and examined under a light microscope. Renal lesions were classified histopathologically according to Maxie and Newman (Maxie and Newman 2007). An identification number matched each sample to its carcass.

Results

To avoid any influence of serologic results on histological analysis (and vice versa), tests were carried out in 2 laboratories and results were compared at the end of the analysis. Serologic

Serology Of the total number of 441 serological samples (237 red deer, 66 roe deer, 138 chamois), positive findings were ascertained only in red deer. Of the 237 samples, 15 (6.33%) red deer were found to be positive, with 19 serologic reactions, including 5 Leptospira serovars (Bratislava, Grippotyphosa, Pomona, Hardjo, Copenhagheni). Three animals were positive to more than 1 serovar (20% of crossreactions between differing leptospiral serovars). No positive serologic reactions were found for Leptospira serovars Ballum, Canicola or Tarassovi in any species.

Of the samples that showed positive serological reactions 5 samples had reciprocal antibody titers of 100 (26.3%), 8 of 200 (42.1%), 2 of 400 (10.5%), 1 of 800 (5.3%), 1 of 1600 (5.3%), and 2 of 3200 (10.5%).

The most frequent serovars were Bratislava (9/19, 47.4%) and Grippotyphosa (5/19, 26.3%), followed

by Pomona (2/19, 10.5%), Hardjo (2/19, 10.5%) and Copenhagheni (1/19, 5.3%).

Figure 1. Chronic tubulo-interstitial nephritis characterized by dense nodular infiltrate of lymphocytes and plasma cells replacing renal tubules,100x, as showed by one of the samples collected from red deer between 2001-2007 in the Province of Sondrio, Italy.

Leptospiral antibodies were not found in the sera of roe deer or chamois.

Table I. Results of MAT to Leptospira serovars and presence of histopathologic renal lesions in red deer, samples collected from red deer between 2001‑2007 in the Province of Sondrio, Italy.

Sample ID

Bratislava

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

100 200 200 3200

Grippotyphosa

Hardjo

Pomona

Copenhageni

100 100 200 400

200 400

200

100 3200 1600 100 200 200

200

800

Renal lesions n.a. n.a. n.a. no no no n.a. yes n.a. no no n.a. no no yes

n.a. = renal sample not available.

Veterinaria Italiana 2014, 50 (4), 285-291. doi: 10.12834/VetIt.1309.06

287

Leptospira spp. infection in wild ruminants

Histology Histopathologic examination of renal samples was performed in 9 of the 15 seropositive and in 111 of the 222 seronegative red deer, 16 of 66 seronegative roe deer, and 62 of 138 seronegative chamois. Two of the 9 seropositive animals examined (22.2%) were affected by mild to moderate multifocal chronic lymphoplasmacytic and fibrosing tubulo-interstitial nephritis, mainly involving the cortical parenchyma (Figure 1). No renal lesions were recorded in seronegative animals.

Details of serovars, antibody titers and renal lesions are listed in Table I.

Discussion In this study, only red deer had positive titers to Leptospira spp. infection and revealed renal lesions.

This may be the consequence of some behavioural traits typical of this species. One type of behaviour that may contribute to the spread of infection within this species is the habit of wallowing in mud or water pools during hot weather, to get rid of external parasites and, in the case of adult males, to mark their territory during the mating season (Clutton-Brock et al. 1982). Since the infection can be transmitted via contaminated water (Johnson et al.

2004), wallowing may also facilitate transmission in red deer. In addition, during the summer grazing period, red deer share the same feeding areas with domestic species (cattle, sheep, goats, horses, dogs), which may carry the bacteria and infect watercourses and pools; red deer may even interact directly with the above animals (Mattiello et al. 2002).

In the present study, roe deer seemed to be resistant to infection. This finding matches the results of Hausle (1987), who did not find any positive reaction in roe deer in Germany. However, there is evidence that this species is sensitive to leptospiral infection.

Weber and Christoph (1981) and Witt and colleagues (Witt et al. 1988) reported 1.8% and 2% of positive serologic responses to Leptospira spp. in roe deer in Germany, and Slavica and colleagues (Slavica et al.

2008) found 6.07% positive roe deer in Croatia. The present negative results are probably due to the low level of infection in the study area and to the habits of roe deer, a solitary and territorial species. Mothers with kids or subadults are usually small and do not share their habitat with other species, either wild or domestic (Boitani et al. 2003).

Like roe deer, chamois had neither positive MAT titers nor did they show renal lesions. To our knowledge, leptospiral infection in this species has never been reported, and the only study on chamois in the Italian Gran Paradiso National Park produced negative results (Tolari 1991), suggesting that

288

Andreoli et al.

chamois are not sensitive. However, negative results may also be due to the habitat preferences of this mountain-dwelling species, such as areas with low environmental temperatures, low vegetation, little water, and few other domestic and/or wild animals.

These conditions do not allow for leptospiral survival. This hypothesis is supported by the fact that either the infection has not been recorded, or has only been recorded with low prevalence in other ungulate species living in similar mountain habitats, such as the alpine ibex (Ibex ibex) in Italy (no seropositive animals; Tolari 1991) and Switzerland (7.9% seropositive animals; Marreros et al. 2011) and the mouflon (Ovis musimon) in Germany and Croatia (no seropositive animals in either study; Weber and Christoph 1981, Slavica et al. 2008).

During the study period, the most prevalent serovars in red deer were Bratislava (47.4%) and Grippotyphosa (26.3%), followed by Pomona (10.5%), Hardjo (10.5%) and Copenhagheni (5.3%).

Past serological studies in various parts of Italy show diverse situations: Corradini and colleagues (Corradini and Pecorari 1981) did not find any positive results in the red deer population of Bosco della Mesola (Ferrara, Italy). In â&#x20AC;&#x2DC;La Mandriaâ&#x20AC;&#x2122; Park (Turin, Italy) Lanfranchi and colleagues (Lanfranchi et al. 1985) found a low seroprevalence of sv. Hardjo (8.4%) in red deer sharing the same habitat with a herd of cattle with an endemic leptospiral infection due to the same serovar (81.9% of the herd); sv.

Bratislava and Copenhagheni were also recorded at low prevalence. Five deer positive to sv. Bratislava were found in a deer farm in Tuscany (5.1% of the herd) (Tolari 1991); serogroup Australis has been reported as the most prevalent in red deer (88.2%) (Tagliabue and Farina 1995), followed by Ballum (5.9%) and Icterohaemorrhagiae (5.9%).

Serovar Bratislava is the most prevalent serovar in horses in Italy (Andreani et al. 1993, Tagliabue and Farina 1995). In our study area, during the Summer grazing period, horses may share the same mountain habitat with deer and contribute toward spreading the infection to red deer, although the number of horses is very low and their role in the epidemiology of the disease is probably less important than that of wild species such as hedgehogs (Erinaceus europaeus), muroids, badgers (Meles meles) and foxes (Vulpes vulpes), common in the area and sharing the same habitat with red deer (Ferloni 2007). Isolation of leptospiras belonging to the Australis group from these wild species has in fact been reported frequently (Farina and Andreani 1970, Tolari 1991).

The above results represent the first report of Sv. Grippotyphosa MAT reactions in red deer in Italy.

The reservoir of this serovar is the common vole (Microtus arvalis) and the infection seems to be more common in dogs and horses (Tagliabue and

Veterinaria Italiana 2014, 50 (4), 285-291. doi: 10.12834/VetIt.1309.06

Andreoli et al.

Farina 1995, Tengelsen et al. 1997, Barr et al. 2005), which roam the area during summer grazing. Serovar Grippotyphosa has also been found in white-tailed deer (Odoicoileus virginianus; Michigan DNR 2007) and Iberian red deer (Cervus elaphus hispanicus; Espí et al. 2010). No information is available about the presence of this serovar in species (wild or domestic) other than red deer in our study area, and no data are available about pathogenicity for deer.

Although, Leptospira spp. is known to cause severe infections, with clinical signs of illness in cattle (Özdemir and Erol 2002), we found no renal lesions, even at titers of 3200. Pomona and Hardjo, the most important serovars in New Zealand deer farms (Ayenegui‑Alcerreca et al. 2007), appear occasionally in wild red deer, and the infection is probably due to the use of the same area by domestic animals, mostly cattle (Lanfranchi et al. 1985, Aguirre et al.

1995, Cantu et al. 2008).

Red deer also appear to be accidental hosts of sv.

Copenhagheni, whose the is the Norway rat (Rattus norvegicus), uncommon in Italian mountain habitats.

While renal histopathology in seronegative red deer was unremarkable, 22.2% of the seropositive animals (2 of the 9 examined) were affected by chronic tubulo-interstitial nephritis. Although too few cases were examined to draw final conclusions, these observations indicate that leptospirosis is a probable cause of chronic-progressive renal inflammation in red deer in Northern Italy. This hypothesis is further supported by previous studies demonstrating that chronic nephritic changes in red deer often result from subclinical or silent infections caused by sv.

Pomona and Hardjo (Ayenegui-Alcerreca et al. 2007).

We only found 2 red deer with renal lesions and, although the possibility of leptospiruria (Prescott 2007) cannot be excluded, this aspect needs further investigation.

In this study, antibodies to Leptospira spp. were infrequent in wild ruminants, and only red deer seemed to be susceptible to Leptospira spp.

Veterinaria Italiana 2014, 50 (4), 285-291. doi: 10.12834/VetIt.1309.06

Leptospira spp. infection in wild ruminants

infection, indicating that these species do not play an important role in the epizootiology of these pathogens. Leptospira spp. infection in wild red deer appears occasionally and may occur when other infected species share the same area. In view of the infrequent findings and the fact that in the study area no mandatory reporting of infection by Leptospira spp. in domestic animals (cattle, sheep, goats) or hunters has been notified to the competent authorities during the study period, it is assumed that wild ruminants in Alpine environments cannot be considered as reservoirs or important sources of Leptospira spp. infection for humans or domestic animals. In any case, to complete data on the epizootiology of Leptospira spp. infection in the study area, the occurrence of this infection in humans, farmed animals and other wild species needs to be investigated in greater detail in the future.

Acknowledgments We are grateful to all the hunters and students who were actively involved in sample collection. We wish to thank Dr Maria Ferloni, of the Province of Sondrio, and Dr Fabio Orsi, of the Official Veterinary Service of Sondrio (ASL), for their kind collaboration and for providing data on the local wild and domestic populations. Our gratitude also goes to Prof. Diane Frank and Ms. Gabriel Walton for assistance with the English language.

Grant support This research was partially funded by the Sondrio Hunting Management Committee and by the Lombardy Region within the project ‘Piano di monitoraggio sanitario della fauna selvatica dell’arco alpino lombardo e presenza di agenti zoonosici su carcasse conferite alle Sezioni Diagnostiche IZSLER delle province di Bergamo, Brescia, Como-Varese e Sondrio-Lecco’.

289

Leptospira spp. infection in wild ruminants

Andreoli et al.

References Adler B. & de la Peña Moctezuma A. 2004. Leptospira. In Pathogenesis of bacterial infections of animals (C. Gyles, J. Prescott, G. Songer & C. Thoen, eds). Blackwell Publishing, Iowa, 385-396.

Adler H., Vonstein S., Deplazes P., Steiger C. & Frei R. 2002.

Prevalence of Leptospira spp. in various species of small mammals in an inner-city area in Switzerland. Epidemiol Infect,128, 107-109.

Aguirre A.A., Hansen D.E., Starkey E.E. & McLean R.G. 1995.

Serologic survey of wild cervids for potential disease agents in selected national parks in the United States.

Prev Vet Med, 21, 313-322.

Andreani E., Pedrini A. & Cerri D. 1993. Leptospirosi equina.

Con particolare riguardo all’aborto nella cavalla.

Obiettivi e Documenti Veterinari, 14, 19-23.

Ayenegui-Alcerreca M.A., Wilson P.R., Mackintosh C.G., Collins-Emerson J.M., Heuer C., Midwinter A.C. & Castillo-Alcala F. 2007. Leptospirosis in farmed deer in New Zealand: a review. N Z Vet J, 55, 102-108.

Barr S.C., McDonough P.L., Scipioni-Ball R.L. & Starr J.K. 2005. Serologic responses of dogs given a commercial vaccine against Leptospira interrogans serovar pomona and Leptospira kirschneri serovar grippotyphosa. Am J Vet Res, 66, 1780-1784.

Ferloni M. 2007. Piano Faunistico Venatorio della Provincia di Sondrio (Provincia di Sondrio, ed). Sondrio, Italy, 33-34.

Gillespie R.W.H. & Ryno J. 1963. Epidemiology of leptospirosis. Am J Public Health, 53, 950-959.

Hausle R. 1987. Hygienic status of roe deer in the northeastern county of Raversburg. Thesis Dissertation, Tierarztliche Fakultat der Ludwig-MaximiliansUniversitat, Munchen, German Federal Republic, 92 pp.

Higgins R. 2004. Emerging or re-emerging bacterial zoonotic diseases: bartonellosis, leptospirosis, Lyme borreliosis, plague. Revue Scientifique et Technique OIE, 23, 569-581.

Johnson M., Smith H., Joseph P., Gilman R., Bautista C., Campos K., Cespedes M., Klatsky P., Vidal C., Terry H., Calderon M., Coral C., Cabrera L., Parmar P. & Vinetz J. 2004. Environmental exposure and leptospirosis, Peru.

Emerg Infect Diseases, 10, 1016-1022.

Koizumi N., Muto M., Yamada A. & Wanatabe H. 2009.

Prevalence of Leptospira spp. in the kidneys of wild boars and deer in Japan. J Vet Med Sci, 71, 797-799.

Bengis R.G., Leighton F.A., Fischer J.R., Artois M., Mörner T. & Tate, C.M. 2004. The role of wildlife in emerging and re-emerging zoonoses. Revue Scientifique et Technique OIE, 23, 497-511

Koizumi N., Muto M., Yamamoto S., Baba Y., Kudo M., Tamae Y., Shimomura K., Takatori I., Iwakiri A., Ishikawa K., Soma H. & Wanatabe H. 2008. Investigation of reservoir animals of Leptospira in northern part of Miyazaki Prefecture. Jpn J Infect Dis, 61, 465-468.

Bharti A.R., Nally J.E., Ricaldi J.N., Matthias M.A., Diaz M.M., Lovett M.A., Levett P.N., Gilman R.H., Willig M.R., Gotuzzo E. & Vinetz J.M. 2003. Leptospirosis: a zoonotic disease of global importance. Lancet Infect Dis, 3, 757-771.

Lanfranchi P., Tolari F., Forlett R., Meneguz P.G. & Rossi L. 1985. The red deer as reservoir of parasitic and infectious pathogens for cattle. Annali della Facoltà di Medicina Veterinaria di Torino, 30, 3-17.

Boitani L., Lovari S. & Vigna Taglianti A. 2003. Fauna d’Italia, Vol. 38, Mammalia III. Carnivora – Artiodactyla (L. Boitani, S. Lovari & A. Vigna Taglianti, eds). Officine Grafiche Calderini, Ozzano dell'Emilia, Italy, 314-323.

Levett P.N. 2001. Leptospirosis. Clin Microbiol Rev, 14, 296-326.

Bondarenko A.L., Utenkova E.O., Russkikh G.A. & Khmeleveskaia N.S. 2002. Epidemiology of leptospirosis in the Kirov region. Zh Mikrobiol Epidemiol Immunobiol, 3, 27-30.

Mailloux M. 1980. Leptospiroses et environnement. Rev Epidemiol Sante Publique, 28, 323-327.

Cantu A., Ortega-S J.A., Mosqueda, J. Garcia-Vazquez Z., Henke S.E. & George J.E. 2008. Prevalence of infectious agents in free-ranging white-tail deer in north-eastern Mexico. J Wildl Dis, 44, 1002-1007.

Clutton-Brock T.H., Guinness F.E. & Albon S.D. 1982. Red deer: behaviour and ecology of two sexes. (T.H. CluttonBrock, F.E. Guinness & S.D. Albon, eds). Edinburgh University Press, Edinburgh, UK. Corradini L. & Pecorari S. 1981. Ricerche sierologiche per brucellosi, leptospirosi, listeriosi, febbre Q, toxoplasmosi e tularemia sugli ungulati (Cervus elaphus e Dama dama) del boscone della Mesola. Atti della Società Italiana delle Scienze Veterinarie, 35, 706-707.

Espí A., Prieto J.M. & Alzaga V. 2010. Leptospiral antibodies in Iberian red deer (Cervus elaphus hispanicus), fallow deer (Dama dama) and European wild boar (Sus scrofa) in Asturias, Northern Spain. Vet J, 183, 226-227.

290

Farina R. & Andreani E. 1970. Leptospirosi degli animali selvatici in Italia. Archivio Veterinario Italiano, 21, 127-141.

Lins Z.C. & Lopes M.L. 1984. Isolation of Leptospira from wild forest animals in Amazonian Brazil. Trans R Soc Trop Med Hyg, 78, 124-126.

Marreros N., Hussy D., Albini S., Frey C.F., Abril C., Vogt H.R., Holzwarth N., Wirz-Dittus S., Friess M., Engels M., Borel N., Willisch C.S., Signer C., Hoelzle L.E. & Ryser-Degiorgis M.P. 2011. Epizootiologic investigations of selected abortive agents in free-ranging Alpine ibex (Capra ibex ibex) in Switzerland. J Wildl Dis, 47, 530-543.

Mattiello S., Redaelli W., Carenzi C. & Crimella C. 2002. Effect of dairy cattle husbandry on behavioural patterns of red deer (Cervus elaphus) in the Italian Alps. Appl Anim Behav Sci, 79, 299-310.

Maxie M.G. & Newman S.J. 2007. Kidney. In Jubb, Kennedy & Palmer's Pathology of Domestic Animals, Vol. 2, 5 Ed. (M.G. Maxie, ed). Saunders Elsevier, Philadelphia, 426-503.

Michigan DNR 2007. Leptospirosis (http://www.michigan. gov/dnr/0,1607,7-153-10370_12150_12220-26943-,00.html accessed on 05.09.2007). Özdemir V. & Erol E. 2002. Leptospirosis in Turkey. Vet Rec, 150, 248-249.

Veterinaria Italiana 2014, 50 (4), 285-291. doi: 10.12834/VetIt.1309.06

Andreoli et al.

Leptospira spp. infection in wild ruminants

Prescott J.F. 2007. Leptospirosis. In Jubb, Kennedy & Palmer's Pathology of Domestic Animals, Vol. 2, 5 Ed. (M.G. Maxie, ed). Saunders Elsevier, Philadelphia, 481-490.

Patrimonio Faunistico, Brescia 1989-1990. Istituto per la qualificazione e l’aggiornamento tecnico-professionale in agricoltura, Brescia, 213-215.

Slavica A., Cvetnić Ž., Milas Z., Janicki Z., Turk N., Konjević D., Severin K., Tončić J. & Lipej Z. 2008. Incidence of leptospiral antibodies in different game species over a 10-year period (1996-2005) in Croatia. Eur J Wildlife Res, 54, 305-311.

Treml F., Pejcoch M. & Holesovska Z. 2002. Small mammals - natural reservoirs of pathogenic leptospiroses. Vet Med-Czec, 47, 309-311.

Tagliabue S. & Farina R. 1995. Inchiesta sieroepidemiologica sulla diffusione delle leptospirosi tra gli animali domestici ed alcune specie selvatiche. Selezione Veterinaria, 36, 941-952.

Tengelsen L.A., Yamini B., Mullaney T.P., Bell T.G., Render J.A., Patterson J.S., Steficek B.A., Fitzgerald S.D., Kennedy F.A., Slanker M.R. & Ramos-Vara J.A. 1997. A 12-year retrospective study of equine abortion in Michigan. J Vet Diagn Invest, 9, 303-306.

Tolari F. 1991. Ruolo degli animali selvatici nell’epidemiologia della leptospirosi. In Atti del I e II Corso di Aggiornamento in Gestione e Protezione del

Veterinaria Italiana 2014, 50 (4), 285-291. doi: 10.12834/VetIt.1309.06

Weber A. & Christoph H. 1981. Seroepidemiological investigations on the incidence of leptospirosis in cloven-hoofed game in the Federal Republic of Germany. Z Jagdwiss, 27, 283-287.

Witt W., Dedek J. & Loepelmann H. 1988. Occurrence of Leptospira antibodies in red, roe and fallow deer and mouflon. Monatsh Veterinarmed, 43, 65-68.

World Organisation for Animal Health (OIE). 2013.

Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 2.1.9: 251-264. Office International des Epizooties, Paris, France. (http://www.oie.int/en/ international-standard-setting/terrestrial-manual/ access-online/ accessed on 22.03.2014).

291

A survey on bacterial involvement in neonatal mortality in dogs Tea Meloni1, Piera A. Martino2, Valeria Grieco2 *, Maria C. Pisu3, Barbara Banco2, Alessandro Rota4 & Maria C. Veronesi1 1

Department of Health, Animal Science and Food Safety, Faculty of Veterinary Medicine, Università degli Studi di Milano, via G. Celoria 10, 20133 Milano, Italy.

2 Department of Veterinary Science and Public Health, Faculty of Veterinary Medicine, Università degli Studi di Milano, via G. Celoria 10, 20133 Milano, Italy.

3 VRC Centro di Referenza Veterinario, corso Francia 19, 10138 Torino, Italy.

4 Ambulatorio Veterinario Associato Dr. Pellegrini-Rota, via Ungaretti 69, 24030 Almenno San Bartolomeo, Bergamo, Italy.

* Corresponding author at: Department of Veterinary Science and Public Health, Faculty of Veterinary Medicine, Università degli Studi di Milano, via G. Celoria 10, 20133 Milano, Italy.

Tel.: +39 02 503 18111, e-mail: valeria.grieco@unimi.it.

Veterinaria Italiana 2014, 50 (4), 293-299. doi: 10.12834/VetIt.45.2244.2 Accepted: 04.09.2014 | Available on line: 29.12.2014

Keywords Antimicrobial susceptibility testing, Bacteriological examination, Dog, Histology, Mortality, Newborn puppies.

Summary Bacterial infections represent the second cause of neonatal morbidity and mortality in dogs, so the present study aimed to investigate the bacterial involvement in canine neonatal mortality and to evaluate the antibiotic susceptibility of the isolated bacteria. Fifty-one newborn purebred puppies, born dead or dead within 28 days of age, belonging to 36 different litters, were enrolled and the following procedures were performed on their fresh dead bodies: necropsy, collection of swabs by liver, kidney, lung, small bowel, and possible thoracic and/ or abdominal effusion, for both bacteriological examination and antimicrobial susceptibility testing, and collection of samples by the same organs for histology. About 47% of total swabs were positive at bacteriology (pure bacterial culture or bacterial association). In 65% of the newborn puppies the mortality could be attributed to a bacterial infection. Although the high multidrug resistance, the most effective antimicrobials were third generation cephalosporins and fluorquinolones. In case of neonatal mortality, bacterial culture and antimicrobial susceptibility testing become essential for a targeted therapy in surviving littermates and for the management of following pregnancies in bitches with recurrent neonatal loss.

Studio del ruolo delle infezioni batteriche nella mortalità neonatale dei cani Parole chiave Antibiogramma, Esami batteriologici, Cane, Istologia, Mortalità, Cucciolo.

Riassunto Le infezioni batteriche sono la seconda causa di morbilità e mortalità neonatale nel cane. Lo studio si è proposto di indagare il reale coinvolgimento batterico nella mortalità neonatale canina e di valutare la sensibilità delle specie batteriche isolate agli antibiotici. Sono stati studiati 51 cuccioli neonati di razza pura, nati morti o deceduti entro i 28 giorni di età, appartenenti a 36 differenti cucciolate. I cadaveri freschi sono stati soggetti alle seguenti procedure: a) necroscopia; b) tamponi di fegato, rene, polmone, piccolo intestino ed eventuale versamento toracico e/o addominale per l’esame batteriologico e l’antibiogramma; c) raccolta di campioni dagli stessi organi per l’esame istologico. Circa il 47% dei tamponi totali è risultato positivo all’esame batteriologico (coltura batterica pura o associazione batterica).

Nel 65% dei cuccioli neonati la mortalità è sembrata attribuibile a un’infezione batterica.

Nonostante l’elevata multiresistenza agli antibiotici, le cefalosporine di terza generazione e i fluorochinoloni si sono rivelati quelli maggiormente efficaci. In caso di mortalità neonatale, l’esame batteriologico e l’antibiogramma risultano fondamentali sia per instaurare una terapia mirata nei cuccioli superstiti sia per gestire le successive gravidanze in cagne con perdite neonatali ricorrenti.

293

Meloni et al.

Bacterial involvement in neonatal mortality in dogs

Introduction Neonatal mortality rate in canine species ranges from 9 to 34% (Davidson 2003, Johnson 2006, Mosier 1981, Veronesi 2013), with a greatest risk during the first week of age (Davidson 2003, Mosier 1981, Münnich 2008, Peterson 2011). Beyond dystocia (Moon et al. 2000, Moon-Massat and Erb 2002, Münnich et al. 1996), bacterial infection was identified as the second main cause of neonatal death in dogs. Indeed, the consequent septicaemia is thought to be the most common cause responsible for puppies mortality within the first 21 days of age (Daniels and Spencer 2011, Münnich et al. 1995, Van der Beek et al. 1999, Veronesi 2013).

Bacterial infection often spreads from mother to foetus during pregnancy, delivery or, after whelping, through infected maternal secretions, as vaginal and oronasal discharges, faeces, and milk (Münnich and Lübke-Becker 2004, Schäfer-Somi et al. 2003).

Bacterial translocation is also recognized as a cause of neonatal systemic disease (Dahlinger et al. 1997, Go et al. 1994).

The microbial organisms most frequently associated with neonatal death are Escherichia coli (Askaa et al. 1978, Hoskins 2001), Staphylococcus aureus and Staphylococcus pseudintermedius (Münnich et al.

1995, Sager and Remmers 1990), Streptococcus canis, Streptococcus dysgalactiae subsp equisimilis, Streptococcus equi subsp zooepidemicus (Greene and Prescott 1998, Lamm et al. 2010), and Klebsiella pneumoniae (Davidson 2003, Münnich 2008). Proteus mirabilis and Pseudomonas aeruginosa have also been isolated in cases of neonatal loss (Münnich 2008).

Septicaemia may have a hyperacute evolution, with sudden death of the neonates (Askaa et al. 1978, Daniels and Spencer 2011, Davidson 2003, Veronesi 2013), or a subacute course (Indrebø et al. 2007, Johnston et al. 2001, Veronesi 2013). The clinical management of septicaemic newborn puppy is very difficult because of the sudden onset of unspecific symptoms and the fast disease course. Thus, treatment is usually delayed and unsuccessful, and the prognosis is poor.

Post-mortem examination, including necropsy and additional investigations (Johnson 2006, Veronesi 2013), could be helpful to identify the possible cause of neonatal mortality. The detection of involved bacteria allows for performing the subsequent antimicrobial susceptibility testing (AST), essential to choose the most appropriate therapy of surviving littermates and for a better management of following pregnancies in the same bitch.

For all these reasons, the aims of the present study were the investigation of the bacterial involvement in puppies neonatal mortality and the evaluation of the antibiotic susceptibility of the isolated bacteria.

294

Materials and methods Animals The study was performed in Northern Italy, between January 2012 and May 2013, on 51 full term newborn puppies, belonging to 36 litters of 17 breeds. All these puppies were stillborn or dead during the neonatal period, considered as the first 28 days of age (Davidson 2003, Veronesi 2013). The 36 bitches, 2-8 year old, 20 primiparous and 16 pluriparous, were healthy before mating, regularly submitted to a vaccination program, and correctly dewormed.

Among these, 7 female dogs revealed previous isolated or recurrent, not investigated, neonatal losses. In all the bitches the last gestation showed a normal clinical course.

Necropsy and sampling Only fresh dead puppies (stored at 4°C for an elapsing time from death to necropsy of maximum 4 hours) underwent the necropsy, that was mainly focused to a correct bacteriological investigation. For each newborn, body size, maturity, sex, and weight were recorded; gross malformations, when present, were detected. After the careful opening of the abdominal cavity, swabs were collected from liver, kidney, and small bowel, avoiding any possible contamination, and from abdominal effusion, if present. Afterwards, the same organs were also sampled for histology and the specimens were immediately fixed in 10% buffered formalin solution. Finally, the thoracic cavity was opened; lung and possible thoracic effusion were sampled as reported for the abdomen. Only 1 specimen was collected for each organ.

Bacteriological examination and antimicrobial susceptibility testing The swabs were immediately plated on Petri plates with first isolation medium (TSA with 5% sheep blood, Oxoid, Milan, Italy), by streaking technique, to obtain the growth of bacterial colonies. Plates were incubated at 37°C for 24 hours under aerobic conditions; swabs collected from lung and effusions were also incubated in modified atmosphere in a candle jar (5% CO2). After the first incubation, all the plates that were bacteriological negative underwent a second incubation at 37°C for 24 hours; the plates were considered sterile, when bacterial colonies were not observed after the second incubation.

Isolated bacteria were identified by using different techniques: the macroscopic observation of colonies morphology on blood-agar plates, Gram‑stain reaction, cellular morphology, and biochemical tests, particularly catalase and oxidase tests (Oxichrome Reagent, Remel-Oxoid, Milan, Italy).

Veterinaria Italiana 2014, 50 (4), 293-299. doi: 10.12834/VetIt.45.2244.2

Meloni et al.

For the identification of Gram-negative bacteria (Enterobacteriaceae) the growth on selective and differential medium Mc Conkey (Oxoid, Milan, Italy) was evaluated. Moreover, commercially available specific miniaturized methods (‘API-20E’®, ‘API‑20NE’®, ‘API-20STAPH’®, Bio-Mériéux, Craponne, France) as well as selective and differential media, such as Mannitol Salt Agar (Oxoid, Milan, Italy) and Brilliant Green Agar (Oxoid, Milan, Italy), were carried out to achieve the biochemical characterization of bacteria (Carter and Wise 2004).

For each cultured bacterial species, susceptibility to the most common antimicrobial drugs was investigated according to CLSI guidelines1. Ampicillin, amoxicillin and clavulanic acid, cephalexin, ceftriaxone, enrofloxacin, metronidazole, spiramycin, polymyxins, and trimethoprim-sulfamethoxazole were tested. All the bacteria were classified as being susceptible, intermediate or resistant to antibiotics.

Histology Samples were evaluated for possible inflammatory lesions, bacterial emboli within the blood vessels or internal organs, and bacterial growth within the deep tissues.

Four-micrometer-thick serial sections were obtained from each paraffin block and stained with hematoxylin-eosin (H&E).

Results Clinical findings Out of the 51 newborn purebred puppies (32 born by euthocic delivery and 19 by dystocic delivery), 9 were born dead and 42 died within 28 days after birth.

Among the latter ones, 4 newborns died suddenly, 20 displayed noticeable symptoms within 48 hours from birth, whereas the other 18 showed clinical signs after 2 days of age. In 26 of 36 litters, more than 1 newborn puppy was affected by the same symptoms. Clinical signs were always unspecific, sometimes associated, and distributed as follows: lethargy (54.9%), loss of sucking reflex (41.2%), abnormal vocalizations (21.6%), diarrhea (17.6%), failed weight gain (13.7%), hypothermia (5.9%), dermatitis (5.9%), conjunctivitis (5.9%), rigidity (5.9%), dyspnoea (2%), convulsions (2%), jaundice/ regurgitation (2%), and heart murmur (2%). Clinical course was fast in 35 puppies, with death within 48 hours since the onset of clinical signs.

1

C linical and Laboratory Standards Institute. 2012. M02-A11, Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard, 11th Edition.

Veterinaria Italiana 2014, 50 (4), 293-299. doi: 10.12834/VetIt.45.2244.2

Bacterial involvement in neonatal mortality in dogs

Necropsy Necropsy evidenced that all the newborns were well developed, mature, and of the correct size for the belonging breed. Gross malformations were never detected. Thoracic effusion was found in 6 puppies, whereas abdominal effusion in 4 subjects. In most cases, gross organic lesions were not present, although areas of lung atelectasis were observed in 16 puppies.

A total of 214 swabs were collected. In all the 51 subjects the following organs were sampled for both bacteriology and histology: liver, kidney, lung, and small bowel. Swabs were taken also from thoracic effusion and abdominal effusion in 6 and 4 cases, respectively.

Bacteriology and antimicrobial susceptibility test From a total of 214 swabs, 101 (47.2%) were bacteriological positive, whereas 113 (52.8%) were bacteriological negative. For 39 of 51 (76.5%) newborn puppies, at least 1 organ resulted positive at bacteriological examination. In 87 of 101 positive swabs (86.1%) the following bacteria were isolated in pure culture: E. coli, Enterococcus faecalis, Staphylococcus aureus, haemolytic Escherichia coli, Proteus mirabilis, β-haemolytic streptococci, Klebsiella pneumoniae, Staphylococcus pseudintermedius, Bacillus, and Streptococcus faecalis. Their distribution in the organic swabs is reported in Table I. In the other 14 positive samples (13.9%) different bacterial association were found, as showed in Table II. On the basis of these results, it is reasonable to suppose that 27 of 51 subjects (52.9%) died because of a localized or systemic single bacterial infection.

Interestingly, E. coli was involved in 15 cases and haemolytic E. coli in 4 newborn puppies, β-haemolytic streptococci were isolated in 3 subjects, E. faecalis was found in 2 cases, whereas in 3 newborn puppies were detected P. mirabilis, K. pneumoniae, and S. aureus, respectively.

In 6 of 51 subjects (11.8%) the death was probably due to a bacterial co-infection. In the first newborn puppy the association between E. coli and K. pneumoniae was isolated in the kidney, liver, and small bowel, in addition to Aerococcus viridans in the lung and thoracic effusion, whereas in the second subject E. coli and K. pneumoniae were identified in the kidney, liver, and abdominal effusion. In the third neonate, the lethal association was represented

by K. pneumoniae in the kidney and E. coli in the lung, whereas in the fourth subject death might be attributed to P. mirabilis in the kidney, liver, and small bowel, P. aeruginosa in the small bowel, and S. aureus in the lung. In the fifth case the newborn puppy

295

Meloni et al.

Bacterial involvement in neonatal mortality in dogs

Table I. Organic distribution of bacterial strain isolated in pure culture in 87 samples collected from full term newborn puppies in Northern Italy, between January 2012 and May 2013.

a

Bacteria

Liver

Kidney

Lung

Small bowel

E. coli Haemolytic E. coli S. aureus β-haemolytic S. K. pneumoniae P. mirabilis S. pseudintermedius E. faecalis Bacillus S. faecalis A. viridans

12 1 2 1 -

10 2 2 1 1 2 -

14 1 2 3 1 1 1 1 1

13 2 1 1 6 1 1 -

Abdominal effusion 1 -

Thoracic effusion 1 1

Total samples 50 5 7 3 2 5 1 10 1 1 2a

A. viridans was isolated in lung and thoracic effusion samples belonging to the same subject.

Table II. Organic distribution of bacterial association isolated in 14 samples, collected from full term newborn puppies in Northern Italy, between January 2012 and May 2013.

Bacterial association

Liver

Kidney

Lung

E. coli + K. pneumoniae E. coli + E. faecalis Haemolytic E. coli + E. faecalis P. mirabilis + E. coli + P. aeruginosa P. mirabilis + E. coli E. coli + haemolytic E. coli

2 1 -

2 -

1 -

probably died because of E. coli in all organic samples and abdominal effusion, in addition to E. faecalis in the liver, whereas in the sixth newborn the mortality could be due to haemolytic E. coli in the kidney, lung, and small bowel, and E. faecalis in the lung.

Of the 51 newborn puppies, 6 (11.8%) revealed only physiologic bacteria in the small bowel, and 12 (23.5%) were characterized by having all the organic samples negative at bacteriological examination.

The AST was performed in 33 cases: the most effective drugs were third generation cephalosporins (25 cases, 75.7%) and fluorquinolones (20 cases, 60.6%). In 29 cases (87.9%), a multidrug resistance (resistance to at least 4 antibiotics) of the bacterial strains was noted, whereas in 2 cases (6.1%) the isolated bacteria were resistant to all the tested antibiotics.

Histology Histological examination evidenced a multi-organ morphology characterized by typical findings of an on-going maturation process. Despite gross

296

Small bowel 2 1 1 1 1 1

Abdominal effusion 1 -

Thoracic effusion -

Total samples 7 2 2 1 1 1

lesions were detected during necropsy in only 8 of 51 puppies, noteworthy histological findings were found in 16 cases (31.4%). The most affected organ was the lung (12 cases, 75%) and the lesions included fibrino-purulent, purulent and necrotizing bronchopneumonia or pneumonia (5), necrosis (3), and oedema (6). In particular, 3 newborn puppies showed more than 1 of these pulmonary alterations simultaneously. In 4 subjects (25%) only, or also, the kidney was affected by some lesions, such as cortical or tubular necrosis (3) and acute infarctions (1).

Furthermore, in 2 newborn puppies (12.5%) the liver was characterized by multifocal necrosis.

However, bacterial aggregates were never detected.

Hyperemia was found in all the samples belonging to 9 of the 51 puppies (17.6%).

Discussion Despite the high percentage of neonatal death rate in dog, in the last decades few studies investigated the role of bacterial infections in newborn puppies mortality (Daniels and Spencer 2011,

Veterinaria Italiana 2014, 50 (4), 293-299. doi: 10.12834/VetIt.45.2244.2

Meloni et al.

Münnichet al. 1995, Poffenbarger et al. 1991, Sager and Remmers 1990, Veronesi 2013).

Neonatal mortality is underestimated by bouth owners and breeders, as proved by the about 20% of bitches which have experienced neonatal loss, whose causes have not been investigated. In over 70% of cases, multiple puppies in the same litter were affected by neonatal diseases, showing that the breeders should consider with great attention also the first sign of sickness even in a single newborn. In agreement with extant literature, also in the present study, clinical signs, when present, were not specific, abrupt, and were followed by fast and fatal clinical course, not allowing for a possible patient treatment (Davidson 2003, Johnston et al. 2001, Veronesi 2013).

Post-mortem examination confirmed the limited value of necropsy alone; indeed, in most cases gross organic lesions were not or minimally detectable, as previously reported (Daniels and Spencer 2011, Lamm et al. 2010, Schäfer-Somi et al. 2003, Veronesi 2013). The usefulness of necropsy is to allow the collection of samples for bacteriology, AST, and, at a less extent, histology.

On a total of 214 collected swabs, more than 47% was bacteriological positive. It is reasonable to believe that in 65% of puppies bacterial infection might have been involved in neonatal death, confirming that bacteria could play an important role in canine neonatal mortality (Lamm et al. 2010, Schäfer-Somi et al. 2003). In about 23% of newborns all the swabs were bacteriological negative, whereas in about 12% of cases only physiological bacteria were isolated in the small bowel.

Literature reports that the bacterial organisms most frequently responsible for neonatal mortality in dogs are E. coli, staphylococci, streptococci, and Klebsiella spp. However, P. mirabilis and P. aeruginosa can be also isolated (Bjurström 1993, Daniels and Spencer 2011, Davidson 2003, Greene and Prescott 1998, Johnston et al. 2011, Mosier 1981, Münnich 2008, Sager and Remmers 1990, Schäfer-Somi et al.

2003, Veronesi 2013). The results of the present study confirmed that the just mentioned bacteria, alone or in association, are often involved in neonatal death in dogs, above all E. coli (19 of 51 cases).

The newborn puppy enteric epithelium is more permeable to E. coli than the adult one (Young et al.

1983) and the most important infection sources are represented by mother (Bjurström 1993, Bjurström and Linde‑Forsberg 1992, Münnich and LübkeBecker 2004), or other subjects living in the kennel, as well as the environment (Münnich 2008). Among staphylococci, the principal pathogenic species are thought to be S. aureus and S. pseudintermedius.

Despite the former usually being described as frequent cause of neonatal septicaemia (Münnich et al. 1995, Sager and Remmers 1990), in the

Veterinaria Italiana 2014, 50 (4), 293-299. doi: 10.12834/VetIt.45.2244.2

Bacterial involvement in neonatal mortality in dogs

present study S. aureus was probably responsible for neonatal death in only 1 case. Streptococcal septicaemia is another common cause of miscarriage or neonatal loss in the dog (Greene and Prescott 1998, Kornblatt et al. 1982, Kornblatt et al. 1983, Münnich 2008), nevertheless in this research only 3 newborn puppies died because of β-haemolytic Streptococcus infection. Also streptococci often have a maternal origin (Bjurström 1993, Bjurström and Linde-Forsberg 1992, Vela et al. 2006); the consumption of contamined milk represents another possible, but unusual, source of infection (Schäfer-Somi et al. 2003). Regarding K. pneumoniae, it was likely responsible for neonatal loss in only 1 case, as well as P. mirabilis. The use of antibiotics that reduce resistance to colonization, nutrition with commercial formulas, and iatrogenic transmission seem to predispose the newborn puppies to K. pneumoniae infection.

In 4 puppies it was supposed that less frequent, but potentially, pathogenic bacteria, such as E. faecalis (2), A. viridans (1), and P. aeruginosa (1), contributed to the neonatal death. Enterococcus faecalis is a bacterium belonging to the normal endogenous flora of humans and animals but its intestinal excess or systemic diffusion represent a real problem, above all in the newborn. Aerococcus viridans is a Gram‑positive coccus rarely found as human pathogen (Leite et al. 2010), but in literature it has been reported that, in vulnerable patients, this organism could have a clinically significant role in systemic infections (Uh et al. 2002); this fact might happen also in canine species. Pseudomonas aeruginosa is frequently involved in diseases caused primarily by other bacteria; immunosuppressive or too long antibiotic therapies are predisposing factors for the infection.

In 14 of 101 positive samples, bacterial associations were isolated, as already reported by other authors (Schäfer-Somi et al. 2003), and in 6 out of 51 newborn puppies death was probably due to the bacterial co‑infection.

Obviously, other possible causes of mortality should be considered in those cases in which all the swabs were bacteriological negative (12) or only physiological bacteria were isolated in the small bowel (6).

Beyond bacterial detection, the present study was also aimed to assess antibiotic sensitivity of isolated bacteria. In 33 cases the antimicrobial susceptibility was tested: the most effective drugs were third generation cephalosporins, in agreement with data reported by other authors (Daniels and Spencer 2011, Davidson 2003, Johnston et al. 2001, Münnich 2008, Veronesi 2013), and fluoroquinolones. In 88% of cases the bacterial strains showed a multidrug resistance, and in 6% of cases the bacteria were

297

Bacterial involvement in neonatal mortality in dogs

resistant to all the tested antibiotics. It has been already demonstrated that bacterial antimicrobial resistance and multiresistance represent an emerging problem (Guardabassi et al. 2004). The spread use of antibiotics by many breeders to reduce the neonatal mortality might be responsible for the dam vagina colonization by opportunistic pathogens and the selection of resistant bacteria, which may cause septicaemia in newborn puppies (Milani et al. 2012). Therefore, the AST should be strongly recommended after bacterial detection, to optimize the efficacy of therapy and to avoid dangerous bacterial resistance (Daniels and Spencer 2011, Davidson 2003, Veronesi 2013).

Histology, reported as a useful tool for septicaemia diagnosis, was of limited value in the present study.

Indeed, bacterial emboli within the blood vessels or internal organs, or bacterial growth within the

Meloni et al.

deep tissues (Daniels and Spencer 2011, Farstad 2003) were never seen, in contrast to what reported by other authors (Lamm et al. 2010, Vela et al.2006).

A possible explanation for this finding could be the fast course of bacterial infection in newborn puppies, so that the neonates died before the establishment of the typical histological changes (Morris et al. 2007).

The present study demonstrates the involvement of bacterial infections in neonatal mortality in canine species and the alarming antibiotic resistance of the isolated bacterial strains.

Neonatal loss should not be underestimated by owners and breeders, and necropsy, coupled to bacteriological examination and AST, should be always suggested in even isolated neonatal mortality occurrence.

References Askaa J., Jacobsen K.B. & Soerensen M. 1978. Neonatal infections in puppies caused by Escherichia coli serogroups 04 and 025. Nord Vet Med, 30, 486-488.

Bjurström L. 1993. Aerobic bacteria occurring in the vagina of bitches with reproductive disorders. Acta Vet Scand, 34(1), 29-34.

Bjurström L. & Linde-Forsberg C. 1992. Long-term study of aerobic bacteria of the genital tract in breeding bitches.

Am J Vet Res, 53(5), 665-669.

Carter G.R. & Wise D.J. 2004. Diagnostic veterinary bacteriology and micology: an overview. In Essentials of veterinary bacteriology and micology (G.R. Carter & D.J. Wise, eds). 6th Ed, Iowa State Press, Blackwell, USA, 93-96.

Guardabassi L., Schwarz S. & Lloyd D.H. 2004. Pet animals as reservoirs of antimicrobial-resistant bacteria. J Antimicrob Chemother, 54, 321-332.

Hoskins J.D. 2001. Puppy and kitten losses. In Veterinary Pediatrics Dogs and Cats from Birth to Six Months (J.D. Hoskins, ed). 3rd Ed, W.B. Saunders, Philadelphia, 57-61.

Indrebø A., Trangerud C. & Moe L. 2007. Canine neonatal mortality in four large breeds. Acta Vet Scand, 49 (Suppl I), S2. doi:10.1186/1751-0147-49-S1-S2.

Dahlinger J., Marks S.L. & Hirsh D.C. 1997. Prevalence and identity of translocating bacteria in healthy dogs. J Vet Intern Med, 11(6), 319-322.

Johnson C.A. 2006. Falsa gravidanza, patologie della gravidanza, parto e periodo postpartum. In Medicina interna del cane e del gatto (R.W. Nelson & C.G. Couto, eds). 3rd Ed, Elsevier, Milano, 905-924.

Daniels J. & Spencer E. 2011. Bacterial infections. In Small Animal Pediatrics. The first 12 month of life (M.E. Peterson & M.A. Kutzler, eds). Elsevier Saunders, Missouri, 113-118.

Johnston S.D., Root Kustritz M. & Olson P.N.S. 2001. The neonate - From Birth to weaning. In Canine and feline theriogenology (S.D. Johnston, M. Root Kustritz, P.N.S. Olson, eds). Saunders, Philadelphia, 146-167.

Davidson A.P. 2003. Approaches to reducing neonatal mortality in dogs. In Recent Advances in Small Animal Reproduction (P.W. Concannon, G. England, J. Verstegen & C. Linde-Forsberg, eds). Ithaca, NY, USA, International Veterinary Information Service.

Kornblatt A.N., Adams R.L. & Barthold S.W. 1982. Canine neonatal deaths associated with group B streptococcal septicaemia. Lab Anim Sci, 32, 428.

Farstad W. 2003. Infectious diseases of the neonate-a review. In Proc. 2nd Course Reproduction in Companion, Exotic and Laboratory Animals, 22-27 September 2003, Hannover, Germany, 20.1-20.7.

Go L.L., Ford H.R., Watkins S.C., Healey P.J., Albanese C.T., Donhalek A., Simmons R.L. & Rowe M.I. 1994.

Quantitative and morphologic analysis of bacterial translocation in neonates. Arch Surg, 129, 1184-1190.

298

Greene C.E. & Prescott J.F. 1998. Streptococcal and other Gram-positive bacterial infections. In Infectious diseases of the dog and cat (C.E. Greene, ed). 2nd Ed, W.B. Saunders, Philadelphia, 205-214.

Kornblatt A.N., Adams R.L., Barthold S.W. & Cameron G.A. 1983. Canine neonatal deaths associated with group B streptococcal septicaemia. J Am Vet Med Assoc, 183, 700-701.

Lamm C.G., Ferguson A.C., Lehenbauer T.W. & Love B.C. 2010. Streptococcal infection in dogs: A retrospective study of 393 cases. Vet Pathol, 47(3), 387-395. doi: 10.1177/0300985809359601.

Leite A., Vinhas-Da-Silva A., Felício L., Vilarinho A.C. & Ferreira G. 2010. Aerococcus viridans urinary tract

Veterinaria Italiana 2014, 50 (4), 293-299. doi: 10.12834/VetIt.45.2244.2

Meloni et al.

Bacterial involvement in neonatal mortality in dogs

infection in a pediatric patient with secondary pseudohypoaldosteronism. Rev Argent Microbiol, 42 (4), 269-270.

Peterson M.E. 2011. Neonatal mortality. In Small Animal Pediatrics. The first 12 month of life (M.E. Peterson & M.A. Kutzler, eds). Elsevier Saunders, Missouri, 82-87.

Milani C., Corrò M., Drigo M. & Rota A. 2012. Antimicrobial resistance in bacteria from breeding dogs housed in kennels with differing neonatal mortality and use of antibiotics. Theriogenology, 78, 1321-1328.

Poffenbarger E.M., Olson N.P., Ralston S.L. & Chandler M.L. 1991. Canine neonatology. Part II. Disorders of the neonate. Comp Small Anim, 13, 25-37.

Moon P.F., Erb H.N., Ludders J.W., Gleed R.D. & Pascoe P.J. 2000. Perioperative risk factors for puppies delivered by cesarean section in the United States and Canada. J Am Anim Hosp Assoc, 36, 359-368.

Moon-Massat P.F. & Erb H.N. 2002. Perioperative factors associated with puppy vigor after delivery by cesarean section. J Am Anim Hosp Assoc, 38, 90-96.

Morris A., Harrison L.M & Partridge S.M. 2007. Practical and theoretical aspects of postmortem bacteriology.

Current Diagnostic Pathology, 13, 65-74.

Mosier J.E. 1981. Canine Pediatrics. The neonate. In Proc.

48th American Animal Hospital Association annual meeting, 4-10 April 1981, Atlanta, Georgia.

Münnich A. 2008. The pathological newborn in small animals: the neonate is not a small adult. Vet Res Commun, 32 (Suppl I), S81-S85.

Münnich A., Grüssel T. & Leopold T. 1995. Experiences in diagnosis and therapy of puppy diseases in the first days of life. Tierarztl Prax, 23(5), 497-501.

Münnich A., Grüssel T. & Oelzner J. 1996. Disease in newborn puppies-the influence of parturition and maternal health. In Proc. 3rd International Symposium on Reproduction of Dogs, Cats and Exotic carnivores, 12-14 September 1996, Veldhoven, The Netherlands, 69.

Münnich A. & Lübke-Becker A. 2004. Escherichia coli infections in newborn puppies-clinical and epidemiological investigation. Theriogenology, 62, 562-575.

Veterinaria Italiana 2014, 50 (4), 293-299. doi: 10.12834/VetIt.45.2244.2

Sager M. & Remmers C. 1990. Ein Beitrag zur perinatalen Welpensterblichkeit beim Hund. Tierarztl Prax, 18 (4), 415-419.

Schäfer-Somi S., Spergser J., Breitenfellner J. & Aurich J.E. 2003. Bacteriological status of canine milk and septicaemia in neonatal puppies-a retrospective study.

J Vet Med B Infect Dis Vet Public Health, 50 (7), 343-346.

Uh Y., Son J.S., Jang I.H., Yoon K.J. & Hong S.K. 2002.

Penicillin-resistant Aerococcus viridans bacteremia associated with granulocytopenia. J Korean Med Sci, 17 (1), 113-115.

Van der Beek S., Nielen A.L., Schukken Y.H. & Brascamp E.W. 1999. Evaluation of genetic, common-litter, and withinlitter effects on preweaning mortality in a birth cohort of puppies. Am J Vet Res, 60 (9), 1106-1110.

Vela A.I., Falsen E., Simarro I., Rollan E., Collins M.D., Domínguez L. & Fernandez-Garayzabal J.F. 2006.

Neonatal mortality in puppies due to bacteremia by Streptococcus dysgalactiae subsp. dysgalactiae. J Clin Microbiol, 44 (2), 666-668. doi: 10.1128/JCM.44.2.666668.2006.

Veronesi M.C. 2013. Patologie neonatali. In Neonatologia veterinaria (M.C. Veronesi, C. Castagnetti & M.A.M. Taverne, eds). EdiSES, Napoli, 93-144.

Young R.S.K., Yagel S.K. & Towfighi J. 1983. Systemic and neuropathologic effects of E. coli endotoxin in neonatal dogs. Pediatr Res, 17, 349-353.

299

CASE REPORT Sclerosing peritoneal mesothelioma in a dog: histopathological, histochemical and immunohistochemical investigations Anna Rita D’Angelo1, Gabriella Di Francesco1, Gina Rosaria Quaglione2 & Giuseppe Marruchella1* 1

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.

2 Pathology Unit, 'G. Mazzini' Hospital, Piazza Italia 1, 64100 Teramo, Italy. * Corresponding author at: Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.

Tel.: +39 0861 332420, Fax: +39 0861 332251, e-mail: g.marruchella@izs.it.

Veterinaria Italiana 2014, 50 (4), 301-305. doi: 10.12834/VetIt.20.1309.130 Accepted: 12.07.2014 | Available on line: 24.11.2014

Keywords Comparative pathology, Dog, Differential diagnosis, Mesothelioma.

Summary Mesotheliomas are rare neoplasm affecting on rare occasions both animals and humans and which arise from the mesothelial cells lining the coelomic cavities. We report herein the histopathological, histochemical and immunohistochemical findings in a dog affected by sclerosing peritoneal mesothelioma, a rare variant of canine mesothelioma, and submitted to laparotomy in December 2012 (Teramo, Italy). Our data confirm that mesothelioma still represents a diagnostic challenge and that immunohistochemistry can be extremely useful as supportive diagnostic technique.

Mesotelioma sclerosante peritoneale in un cane: indagini istopatologiche, istochimiche e immunoistochimiche Parole chiave Cane, Diagnosi differenziale, Mesotelioma, Patologia comparata.

Riassunto I mesoteliomi sono patologie neoplastiche raramente osservate in animali e uomo.

Traggono origine da cellule mesoteliali che rivestono le cavità celomatiche. In questo articolo si riportano le caratteristiche istopatologiche, istochimiche e immunoistochimiche di un mesotelioma sclerosante peritoneale, rara variante di mesotelioma canino, riscontrato nel dicembre 2012 in un cane sottoposto a laparotomia (Teramo, Italia). I dati confermano che la diagnosi di mesotelioma è complessa e che le indagini immunoistochimiche possono essere estremamente utili al tal fine.

Introduction Mesotheliomas are rare neoplasms emerging from mesothelial cells, which normally form a continuous monolayer on the serosal surfaces (i.e. pleura, peritoneum, pericardium and tunica vaginalis testis) (Brown et al. 2007, Head et al. 2002, Merlo and Rosciani 2012, Vascellari et al. 2011). Mesotheliomas occur seldom in domestic animals, affecting mainly cattle and dogs (Merlo and Rosciani 2012).

Canine mesotheliomas represent about the 0.2% of all tumors reported in this species (Wilson and Dungworth 2002), when present they concern more frequently the pleura of adult dogs, with no evident breed and sex predilection. However, all coelomic cavities can be involved, separately or simultaneously

(Head et al. 2002, Vascellari et al. 2011). In humans, mesotheliomas represent a relevant health concern because of their striking relationship with the exposure to asbestos (Husain 2010).

Mesotheliomas are still classified as benign or malignant, although many pathologists consider that all mesotheliomas are potentially malignant (Head et al. 2002, Merlo and Rosciani 2012). Grossly, they appear as focal, mutifocal or diffuse proliferative lesions. Three major histological types are distinguished: (a) ‘epithelioid’, the most common one in humans and animals, predominantly composed of epithelioid cells arranged as tubules or papillae which closely resemble adenocarcinomas; (b) ‘fibrous’, predominantly composed of spindle cells, resembling a fibrosarcoma; (c) ‘biphasic’ or ‘mixed’ composed of

301

D'Angelo et al.

Sclerosing peritoneal mesothelioma in a dog

both epithelioid and sarcomatoid cells (Head et al.

2003, Husain 2010, Merlo and Rosciani 2012).

Additional subtypes of canine mesotheliomas have been also reported: peritoneal deciduoid mesothelioma (Morini et al. 2006), cardiac mesothelioma with granular cell morphology (Reggeti et al. 2005), pleural lipid-rich mesothelioma (Avakian et al. 2008), peritoneal cystic mesothelioma (Di Pinto et al. 1995, Gumber et al. 2011), and peritoneal sclerosing mesothelioma (Dubielzig 1977).

This case report describes the histopathological, histochemical and immunohistochemical findings related to a canine peritoneal mesothelioma in a dog submitted to laparotomy in December 2012 in Teramo, Italy.

Materials and methods On December 2012, a small size (body weight = 12 Kgs), 6 year old male mongrel dog was submitted

to laparotomy at the veterinary clinic ‘La Fenice’ (Alba Adriatica, Teramo, Italy) after showing chronic and worsening clinical signs: apathy, weight loss, vomiting and peritoneal effusion. At laparotomy, a number of peritoneal adhesions and proliferative lesions were observed. Bioptic samples, including the entire gut wall, were then collected, fixed in 10% neutral buffered formalin, embedded in paraffin and routinely processed for histopathology (hematoxylin and eosin stain, H&E).

The following histochemical investigations were conducted on selected tissue sections: periodic acid‑Schiff's reagent (PAS reaction), Masson's trichrome staining.

Finally, in-depth immunohistochemical investigations were performed in order to characterize the neoplastic cells. Appropriate positive controls were included in each immunohistochemical run, while negative controls were carried out by omitting the primary antibody (Table I ).

Table I. Immunohistochemical investigations: methods and results.

Primary antibody*

Antigen retrieval

Immunoreactive cells and diagnostic use of primary antibodies**

Positive control

Immunoreactivity of neoplastic ‘ganglion-like’ cells

PanCytokeratin

Heat treatment at 121°C x 8 min in citrate buffer pH 6.0

Keratinized and corneal epidermis, stratified squamous epithelia, hyperproliferative keratinocytes and simple epithelia. Carcinomas.

Canine intestinal mucosa

Strongly positive

Mesothelioma, epithelial basal cells in prostate and tonsil.

Human mesothelioma

Negative

Human breast cancer

Negative

Cytokeratin 5/6 Heat treatment at 96°C x 45 min in citrate buffer pH 6.0 Cytokeratin 7

Normal and neoplastic epithelia, including many ductal and Heat treatment at 96°C x 45 glandular epithelia. Identification of adenocarcinomas of the min in citrate buffer pH 6.0 lung, breast and endometrium, thyroid gland and ovary, as well as chromophobe renal cell carcinomas.

Adenocarcinomas of the colon, mucinous ovarian tumors, treatment at 96°C x 45 transitional-cell Cytokeratin 20 Heat Merkel-cell carcinomas, and frequently min in citrate buffer pH 6.0 adenocarcinomasand of the stomach, byle system and pancreas. treatment at 96°C x 45 Hematopoietic stem cells, melanocytes, mast cells, Cajal cells, c-Kit (CD117) Heat min in citrate buffer pH 6.0 germ cells, basal cells of the skin, mammary ductal epithelia. treatment at 121°C x 8 Synaptophysin Heat Neuroendocrine cells and neuroendocrine neoplasms. min in citrate buffer pH 6.0 Epithelial and blastemal components of Wilms’ tumors, the Wilms’ Tumor Heat treatment at 96°C x 45 majority of malignant mesotheliomas as well as the majority (WT1) min in citrate buffer pH 6.0 of acute leukemias.

Calretinin CD34 Ki-67 S-100 Vimentin

and peripheral neural tissues, particularly retina and Heat treatment at 96°C x 45 Central neurons of the sensory pathways. Normal and neoplastic min in citrate buffer pH 6.0 mesothelial cells.

Heat treatment at 96°C x 45 min in citrate buffer pH 6.0 Heat treatment at 96°C x 45 min in citrate buffer pH 6.0

Human transitional cell carcinoma Canine intestinal wall Canine intestinal wall

Negative Negative

Human mesothelioma

Weakly positive

Human mesothelioma

Negative

Canine intestinal wall Canine lymph Expressed during all active phases of the cell cycle. node Canine Heat treatment at 96°C x 45 Malignant melanoma, chondroblastoma, and schwannoma. malignant min in citrate buffer pH 6.0 Tumors of histiocytic/dendritic cell type. melanoma Heat treatment at 121°C x 8 Canine intestinal Cells of mesenchimal origin. min in citrate buffer pH 6.0 wall Vascular and lymphatic tumors.

Negative

Negative Negative Negative Strongly positive

* All primary antibodies were from Dako (Denmark) and were incubated overnight at 4° C at the final dilution suggested by the producer; ** As specified by the producer in the data sheets of primary antibodies.

302

Veterinaria Italiana 2014, 50 (4), 301-305. doi: 10.12834/VetIt.20.1309.130

D'Angelo et al.

Sclerosing peritoneal mesothelioma in a dog

The dog under study spontaneously died few weeks later, but unfortunately it was not submitted to necropsy and additional diagnostic investigations.

Immunohistochemical results are summarised in Table I. Remarkably, ganglion-like cells showed a strong and specific immunoreactivity for pan cytokeratin (Figure 2) and vimentin (Figure 3), while being weakly immunoreactive for WT1 and constantly negative against all additional markers.

Results

On the basis of the histopathological and immunohistochemical findings, a sclerosing peritoneal mesothelioma was diagnosed.

Microscopically, a neoplastic lesion was noticed affecting the serosal surface and the smooth muscle layer of the gut, being locally close to the myenteric plexuses of the enteric nervous system. The neoplasm consisted of 2 intermingled components: (1) abundant fibrous connective tissue, providing the stromal support for neoplastic cells; (2) neoplastic large epithelioid (‘ganglion-like’) cells, interspersed within the connective tissue and often arranged as small clusters, bundles and whorls (Figure 1a-b).

The extracellular matrix contained large amounts of collagen fibres, as further demonstrated by Masson’s trichrome staining.

Discussion Dogs and human beings often share the same environment, and dogs have been proposed as useful ‘environmental sentinels’ for cancer risk (De Nardo 1996, Marruchella et al. 2002). In this respect, canine mesotheliomas could also represent an interesting model in comparative pathology, although the etiologic role of asbestos is questionable in dogs (Glickman et al. 1983, Harbison and Godleski 1983, Lopez 2007).

Epithelioid cells showed marked anisocytosis and anisokaryiosis, they were round to oval in shape and showed occasionally microvillous borders and intercellular junctions. Nuclei were round to oval in shape, containing prominent nucleoli, and were usually located at the periphery of the neoplastic cells. The cytoplasm was abundant, eosinophilic and occasionally vacuolated (Figure 1a-b). Bi-nucleated cells were also observed, while mitotic figures were absent. Ganglion-like cells were constantly PAS-negative. No evidence of neoplastic emboli was demonstrated within blood or lymphatic vessel.

Sclerosing mesothelioma is considered a rare epithelioid variant of malignant canine mesothelioma, which is characterized by the presence of excessive fibrous stroma (Dubielzig 1977).

So far, about 10 canine sclerosing mesotheliomas have been reported in scientific literature, mainly in German shepherd dogs (Dubielzig 1977, Geninet et al. 2003, Gumber et al. 2011, Loupal 1987, Schoning et al. 1992). Distant metastases rarely occur in malignant mesotheliomas; however, Gumber and colleagues (Gumber et al. 2011) recently observed metastases to the brain, adrenal glands, lymph nodes and lungs in a German shepherd affected by sclerosing peritoneal mesothelioma.

Taking into account the aforementioned findings, the following differential diagnoses were firstly considered: mesothelioma, peritoneal spreading of abdominal primary carcinoma, neoplasms arising from the enteric nervous system.

a

The diagnosis of mesothelioma represents a challenge for pathologists and usually needs

b

Figure 1. Peritoneum of a dog submitted to laparotomy (December 2012, Alba Adriatica, Teramo, Italy). (a) Large, occasionally vacuolated ‘ganglion‑like’ cells are seen embedded within abundant fibrous tissue. (b) Small clusters of epithelioid cells provided with intercellular junctions and a bi-nucleated cell are also observed. H&E. Final magnification x400.

Veterinaria Italiana 2014, 50 (4), 301-305. doi: 10.12834/VetIt.20.1309.130

303

D'Angelo et al.

Sclerosing peritoneal mesothelioma in a dog

Figure 2. Peritoneum of a dog submitted to laparotomy (December 2012, Alba Adriatica, Teramo, Italy). Immunohistochemistry for pan cytokeratin. Scattered immunostained cells are seen interspersed within the connective tissue. The microvillous border of the immunoreactive cells can be easily appreciated. On the contrary, spindle cells appear constantly negative. Mayerâ&#x20AC;&#x2122;s hematoxylin counterstain. Final magnification: x400. detailed laboratory investigations, such as immunohistochemistry and/or electron microscopy (Brown et al. 2007, Headet et al. 2002, Merlo and Rosciani 2012). In particular, the differential diagnosis of sclerosing mesothelioma could be very difficult, because of its rare occurrence and its similarities with other neoplastic (e.g. fibrosarcoma) and non-neoplastic (e.g. chronic peritonitis) disorders (Schoning et al. 1992). In the present case report, the diagnosis of mesothelioma was strongly supported by the consistent feature of mesothelial cells to co-express epithelial (pan cytokeratin) and mesenchimal (vimentin) markers (Head et al.

2002, Merlo and Rosciani 2012). It has to be further remarked that only epithelioid cells were positive for pan cytokeratin, unlike what observed in the biphasic variant of mesothelioma (Sato et al. 2005).

As reported in the relevant literature, additional

304

Figure 3. Peritoneum of a dog submitted to laparotomy (December 2012, Alba Adriatica, Teramo, Italy). Immunohistochemistry for vimentin. Both fibroblasts and ganglion-like cells exhibit a strong and specific immunoreactivity. Mayerâ&#x20AC;&#x2122;s hematoxylin counterstain. Final magnification: x400. markers of mesothelioma (e.g. cytokeratin 5/6, calretinin, WT1) did not prove to be useful for canine mesothelioma, this is also the case in human pathology (Geninet et al. 2003).

In conclusion, this case report, and in particular the immunohistochemical data reported herein, offer a valuable aid for differential diagnosis of mesothelioma, which is a very much-needed preâ&#x20AC;&#x2018;requisite for a careful monitoring of tumors in domestic animals.

Acknowledgements We are gratefully to Alessandro Forcellese (D.V.M.) and Alessandra Galli (D.V.M.) for kindly providing us with the clinical case described in this report, and to Dr Marina Baffoni (University of Teramo) for her outstanding technical assistance.

Veterinaria Italiana 2014, 50 (4), 301-305. doi: 10.12834/VetIt.20.1309.130

D'Angelo et al.

Sclerosing peritoneal mesothelioma in a dog

References Avakian A., Alroy J., Rozanski E., Keating J. & Rosenberg A. 2008. Lipid-rich pleural mesotelioma in a dog. J Vet Diagn Invest, 20, 665-667.

Brown C.C., Baker D.C., Barker I.K. 2007. Alimentary system.

In Jubb, Kennedy and Palmer’s pathology of domestic animals (M. Maxie, ed). Elsevier, New York, 296 pp.

De Nardo P. 1996. Il mesotelioma pleurico del cane come indicatore di esposizione ambientale ad amianto.

Rapporti ISTISAN, 96/38, 1-27.

Di Pinto M.N., Dunstan R.W. & Lee C. 1995. Cystic, peritoneal mesothelioma in a dog. J Am Anim Hosp Assoc, 31(5), 385-389.

Dubielzig R.R. 1977. Sclerosing mesothelioma in five dogs.

J Am Anim Hosp Assoc, 15, 745-748.

Geninet C., Bernex F., Rakotovao F., Crespeau F.L., Parodi A.L. & Fontaine J.J. 2003. Sclerosing peritoneal mesothelioma in a dog - a case report. J Vet Med A Physiol Pathol Clin Med, 50(8), 402-405.

Glickman L.T., Domanski L.M., Maguire T.G., Dubielzig R.R. & Churg A. 1983. Mesothelioma in pet dogs associated with exposure to their owners to asbestos. Environ Res, 32, 305-313.

Gumber S., Fowlkes N. & Cho D.Y. 2011. Disseminated sclerosing peritoneal mesothelioma in a dog. J Vet Diagn Invest, 23(5), 1046-1050.

Harbison M. & Godleski J. 1983. Malignant mesothelioma in urban dogs. Vet Pathol, 20, 531-540.

Head K.W., Else R.W. & Dubielzig R.R. 2002. Tumors of serosal surfaces. In Tumors in Domestic Animals (D.J. Meuten, ed). Iowa State Press, Ames, 477-478.

Head K.W., Cullen J.M., Dubielzig R.R., Else R., Misdorp W., Patnaik A, Tateyama S. & van der Gaag I. 2003. Tumors of serosal surfaces (pleura, pericardium, peritoneum and tunica vaginalis). In Histological classification of tumors of the alimentary system of domestic animals (F.Y. Schulman, ed). Armed Forces Institute of Pathology, Washington, DC, USA, 144-147.

Husain A.N. 2010. The lung. In Robbins and Cotran pathologic basis of disease (R. Kumar, A. Abbas,

Veterinaria Italiana 2014, 50 (4), 301-305. doi: 10.12834/VetIt.20.1309.130

A. DeLacey, E. Malone, eds) Saunders Elsevier, Philadelphia, PA, USA, 677-737.

Lopez A. 2007. Respiratory system. In Pathologic basis of veterinary disease (M.D. McGavin & J.F. Zachary, eds).

Mosby Elsevier, St. Louis, 463-558.

Loupal G. 1987. Sclerosing mesotelioma in the dog.

Zentralbl Veterinarmed, 34, 405-414.

Marruchella G., Di Guardo G., Albano M. & Della Salda L. 2002. Animali domestici come indicatori di rischio oncogeno per l’uomo. O&DV, 12, 55-62.

Merlo W.A. & Rosciani A.S. 2012. Mesothelioma in domestic animals: cytological and anatomopathological aspects. In Mesotheliomas – synonyms and definition, epidemiology, etiology, pathogenesis, cyto-histopathological features, clinic, diagnosis, treatment, prognosis (A. Zubritsky, ed). Intech Europe and China, 87-96.

Morini M., Bettini G., Morandi F., Burdisso R. & Marcato P.S. 2006. Deciduoid peritoneal mesothelioma in a dog. Vet Pathol, 43(2), 198-201.

Reggeti F., Brisson B., Ruotsalo K., Southorn E & Bienzle D. 2005. Invasive epithelial mesotelioma in a dog. Vet Pathol, 42, 77-81.

Sato T., Miyoshi T., Shibuya H., Fujikura J., Koie H. & Miyazaki Y. 2005. Peritoneal biphasic mesothelioma in a dog. J Vet Med A Physiol Pathol Clin Med, 52(1), 22-25.

Schoning P., Layton C.E., Fortney W.D., Willard L.H. & Cook J.E. 1992. Sclerosing peritoneal mesothelioma in a dog evaluated by electron microscopy and immunoperoxidase techniques. J Vet Diagn Invest, 4(2), 217-220.

Vascellari M., Carminato A., Camali G., Melchiotti E. & Mutinelli F. 2011. Malignant mesothelioma of the tunica vaginalis testis in a dog: histological and immunohistochemical characterization. J Vet Diagn Invest, 23(1), 135-139.

Wilson D. & Dungworth D. 2002. Tumors of the respiratory tract. In Tumors in domestic animals (D.J. Meuten, ed).

Iowa State Press, Ames, IA, USA, 365-399.

305

SHORT COMMUNICATION Molecular evidence of Leishmania infantum in Ixodes ricinus ticks from dogs and cats, in Italy Daniela Salvatore*, Sara Aureli, Raffaella Baldelli, Antonietta Di Francesco, Maria Paola Tampieri & Roberta Galuppi Department of Veterinary Medical Sciences, Alma Mater Studiorum-University of Bologna, Via Tolara di Sopra 50, 40064 Ozzano dell’Emilia (BO), Italy. * Corresponding author at: Laboratory of Serology, Department of Veterinary Medical Sciences, Alma Mater Studiorum-University of Bologna, Via Tolara di Sopra 50, 40064 Ozzano dell’Emilia (BO), Italy.

Tel.: +39 051 2097054, e-mail: daniela.salvatore2@unibo.it.

Veterinaria Italiana 2014, 50 (4), 307-312. doi: 10.12834/VetIt.83.1222.2 Accepted: 04.08.2014 | Available on line: 29.12.2014

Keywords Cat, Dog, Ixodes ricinus, Leishmania infantum, Polymerase chain reaction (PCR), Ticks.

Summary Leishmaniosis, caused by Leishmania infantum, is an endemic zoonosis in the Mediterranean basin. To date, phlebotomine sand flies are the only accepted biological vectors of Leishmania parasites to dogs and humans. The absence of the primary vector in autochthonous Leishmania outbreaks suggests a possible role of fleas or ticks as alternative vectors. In this study, 119 ticks were collected between August 2007-June 2008 and between March 2010-October 2010 from various animal species and humans living in Italian areas where canine leishmaniosis is endemic (i.e. rural areas of the North) and were tested for the presence of L. infantum DNA. Nine (7.5%) out of 119 ticks resulted PCR positive. All ticks were morphologically identified as Ixodes ricinus ticks, 3 from 1 cat, 6 from 4 dogs. To our knowledge, this is the first evidence of L. infantum DNA in ticks from cat, suggesting that the debate about the epidemiological role of ticks in canine leishmaniosis might be extended to feline leishmaniosis.

Analisi molecolare di Leishmania infantum in zecche Ixodes ricinus da cani e gatti in Italia Parole chiave Cane, Gatto, Ixodes ricinus, Leishmania infantum, Polymerase chain reaction (PCR), Zecche.

Riassunto La leishmaniosi sostenuta da Leishmania infantum è una zoonosi endemica nel bacino del Mediterraneo. Allo stato attuale delle conoscenze i flebotomi sono gli unici vettori riconosciuti per la trasmissione del microrganismo a cane e uomo. Tuttavia, il mancato rilevamento del vettore all’interno di focolai autoctoni di infezione ha indotto ad indagare sul possibile coinvolgimento di zecche o pulci come vettori alternativi. In questo studio, 119 zecche sono state prelevate in Italia settentrionale e centrale, tra agosto-giugno 2008 e marzo-ottobre 2010, in diverse specie animali e uomo. Le zecche sono state successivamente testate per la presenza di DNA di Leishmania infantum. Nove zecche (7,5%), risultate positive a PCR, sono state identificate morfologicamente come Ixodes ricinus. Tali parassiti sono risultati provenire da animali (gatto e cane) presenti in aree endemiche per leishmaniosi. Lo studio sembra essere la prima segnalazione di DNA di Leishmania infantum da zecche rimosse da gatto.

Tale riscontro sembra suggerire che il dibattito sul ruolo delle zecche nell’epidemiologia della leishmaniosi nel cane possa essere esteso anche a quella del gatto.

Leishmaniosis, caused by Leishmania infantum, is an endemic zoonosis in the Mediterranean basin. Dogs are the primary domestic reservoir hosts; however in areas where visceral leishmaniosis is endemic, other, both domestic and wild, animal species have been found infected (Gramiccia 2011, Molina et al. 2012, Antoniou et al. 2013, Pennisi et al. 2013).

To date, phlebotomine sand flies (Diptera: Psychodidae) are the only accepted biological vectors of Leishmania parasites to dogs and humans, in nature (Killick-Kendrick 1999).

However, in recent years, autochthonous cases of canine leishmaniosis have been reported in areas where the presence of the primary vector has not

307

Leishmania infantum in ticks from dog and cat

been determined (Dantas-Torres et al. 2005). This finding posed the need to explore alternative ways of parasite transmission, suggesting also a possible role of fleas or ticks as alternative L. infantum vectors (Coutinho et al. 2005, Coutinho and Linardi 2007, Ferreira et al.2009, Silva de Morais et al. 2013).

In this study, ticks were collected from various animal species and humans living in Italian areas where canine leishmaniosis is endemic; the ticks were tested for the presence of L. infantum DNA. One hundred and nineteen ticks were collected in 2 periods (August 2007-June 2008 and March 2010-October 2010) in 14 rural areas of the Northern and Central Italy, for purposes other than L. infantum investigation. Eighty-four ticks were removed from 14 dogs, 28 from 6 horses, 3 from 1 cat, 3 from 2 humans and 1 from a bovine.

Ticks were placed in vials containing 70% ethanol and morphologically identified using proper taxonomic keys (Halos et al. 2004, Mancianti et al.

2004, Varani et al. 2013). After identification, DNA was extracted from individual ticks using a commercial kit according to Aureli et al. (2012) The efficiency of tick DNA extraction was evaluated by amplification of the tick mitochondrial 16S rRNA, according to Halos et al. (2004).

A conventional PCR amplifying a kinetoplast fragment of 145 bp was performed, using primers RV1 (5’-CTTTTCTGGTCCCGCGGGTAGG-3’) and RV2 (5’-CCACCTGGCCTATTTTACACCA-3’), according to Lachaud and colleagues (Lachaud et al. 2002).

The reaction was conducted in a 50 μl final volume containing 50 mM KCl, 1,5 mM MgCl2, 10 mM Tris‑HCl (pH 8.3), 200 μM of each deoxynucleoside triphosphate, 50 pmol of each primer, 1.25 U of Taq DNA polymerase (Qiagen, Hilden, Germany) and 5 μl of the DNA sample. The conditions for the polymerase chain reaction (PCR) were as follows: initial denaturation at 94°C (4 min), 40 cycles each consisting of denaturation at 94°C (1 min), annealing at 58°C (1 min), extension at 72°C (1 min). A final elongation step of 10 minutes at 72°C completed the reaction. Both the DNA from a L. infantum reference strain (MHOM/TN/80/IPT1) and a sample without L. infantum DNA were included in each PCR reaction as positive and negative control, respectively. PCR products were visualized on a 2% agarose gel in 1× TAE buffer with ethidium bromide staining. PCR products were purified using a commercial kit (QIAquick PCR purification kit, Roche, Basel, Switzerland) and sequenced in both directions (Bio-Fab Research, Rome, Italy). Sequences were compared with those available in GenBank database using NCBI BLAST1.

1

308

h tpp://blast.ncbi.nlm.nih.gov/Blast.cgi.

Salvatore et al.

Morphological identification as well as molecular results are shown in Table I. Tick mitochondrial 16S rRNA gene was detected in all the samples. Nine (7.5%) out of 119 ticks tested positive to the PCR, showing 95-98% sequence similarity with L. infantum kDNA sequences available in GenBank database (accession numbers: EU370899.1; EU370893.1; Z35292.1; HQ585883.1; EU370895.1).

All the 9 ticks were morphologically identified as Ixodes ricinus ticks: 6 were adult engorged females, 3 adult males.

Three out of the 9 ticks were removed from a cat living in Montecatone area (Bologna province, Italy), 4 from 2 dogs living in the Gessi Bolognesi e Calanchi dell’Abbadessa Regional Park (Bologna Province, Italy) and 2 from 2 dogs in Forlì area (Forlì-Cesena province, Italy).

With regard to the animals from which PCR positive ticks were removed, no anamnestic data were available about dogs, while the anamnesis of the cat reported that the animal was apparently healthy.

The results of this study show the Leishmania kDNA presence in ticks removed from 4 dogs and 1 cat living in areas where canine leishmaniosis is endemic. Montecatone is near to territories of the Bologna province, where the infection has been reported both in humans and dogs (Pampiglione et al. 1974, Mollicone et al. 2003, Varani et al. 2013).

It is noteworthy that Gessi Bolognesi-Calanchi dell’Abbadessa Regional Park is located in a territory bordering a stable focus of canine leishmaniosis in another area of Bologna province (Mollicone et al.

2003); in the Forlì province, autochthonous cases in dogs have also been reported (Baldelli, personal communication).

The finding of Leishmania DNA in ticks from dogs is not surprising, according to previous studies showing L. infantum DNA in Ripichephalus sanguineus ticks removed from Leishmania seropositive and seronegative dogs (Coutinho et al. 2005, Dantas‑Torres et al. 2010a, Fontes Paz et al. 2010, Solano‑Gallego et al. 2012), as well as in Ixodes ricinus ticks from a Leishmania naturally infected dog living in Central Italy (Trotta et al. 2012).

However to our knowledge, this is the first evidence of L. infantum DNA in ticks from cats.

No anamnestic data were available about the PCR positive cat, except the lack of clinical signs. This data do not exclude Leishmania infection, since feline leishmaniosis is often associated to mild clinical signs, limited to the inoculation site (Mancianti et al. 2004).

In this respect, a previous study showed no statistical association between positive Leishmania PCR results and clinical status of cats (Sherry et al. 2011).

Veterinaria Italiana 2014, 50 (4), 307-312. doi: 10.12834/VetIt.83.1222.2

Salvatore et al.

Leishmania infantum in ticks from dog and cat

Table I. Sources and molecular results to Leishmania infantum in ticks collected in Northen and Central Italy between August 2007-June 2008 and between March 2010-October 2010.

Localization of samples sites

Geographical coordinates

N. ticks/ Tick Animal sources sources

Ticks species

Developmental stage and sex of ticks Molecular results Engorged Female female Male Nynph (n)

Bologna Province cat

3

I. ricinus (a)

5

R. sanguineus

1

R. bursa

3

7

R. turanicus H. detritum scupense (e) R. turanicus H. detritum detritum (f) H. marginatum marginatum (g) R. turanicus

dog

1

I. ricinus

dog

17

dog horse Montecatone

44°21’12’’N 11°42’5’’E horse

horse Gessi Bolognesi e Calanchi 44°26’32’’N 11°26’30’’E dell'Abbadessa Park

1 9 1 1

3 (b)

2

positive (3) 3

negative

1

(c) (d)

negative

1

2

3

2

negative

1

negative

4

negative

1

negative

1

negative

3

4

negative

1 1

5

positive 11

positive (3)

2

negative

Castel de Britti

44°28’0”N 11°24’0”E

horse

2

Pianoro

44°23’0’’N 11°20’0’’E

horse

1

I. ricinus H. marginatum marginatum I. ricinus

2

R. turanicus

dog

1

I. ricinus

dog

3

I. ricinus

1

dog

14

R. sanguineus

5

4

dog

19

R. sanguineus

10

9

negative

1

positive (1)

2

negative

Ozzano dell'Emilia

San Giovanni in Persiceto

44°27’0’’N, 11°29’0’’E

44°38’27’’N 11°11’6’’E

human

1

negative 1

negative

1

I. ricinus

negative

1

negative 2

negative

5

negative

Forlì-Cesena Province Forlì Mercato Saraceno

44°13’21’’N 12°2’27’’E 43°57’0’’N 12°12’0’’E

dog

2

I. ricinus

1

dog

2

R. sanguineus

dog

2

I. ricinus

2

positive (1)

horse

3

I. ricinus

3

negative

Modena Province Polinago

44°21’0’’N 10°43’0’’E

human

1

I. ricinus

1

negative

Ravenna Province Casola Valsenio

44°13’0’’N 11°37’0’’E

bovine

1

R. bursa

1

negative

Lido di Savio

44°18’10’’N 12°20’45’’E

dog

1

R. turanicus

1

negative

Lugo

44°25’0’’N 11°55’0’’E

dog

6

R. sanguineus

1

negative

5

Pesaro-Urbino Province Montecchio

43°49’37’’N 12°48’8’’E

dog

1

1

negative

R. sanguineus

1

negative

I. ricinus

8

negative

I. acuminatus (h)

Republic of San Marino Republic of San Marino

43°46’N 12°25’E

dog

9

(a) = Ixodes ricinus; (b) = Rhipicephalus sanguineus; (c) = Rhipicephalus bursa; (d) = Rhipicephalus turanicus; (e) = Hyalomma detritum scupense; (f) = Hyalomma detritum detritum; (g) = Hyalomma marginatum marginatum; (h) = Ixodes acuminatus.

Veterinaria Italiana 2014, 50 (4), 307-312. doi: 10.12834/VetIt.83.1222.2

309

Leishmania infantum in ticks from dog and cat

The in vitro model proposed by Prima et al. (2007) showed that Leishmania kDNA is rapidly degraded following amastigote death, thus its detection might suggest the viability of the parasite. Nevertheless, as highlighted by other authors (Otranto and Dantas‑Torres 2010, Dantas-Torres et al. 2010b), the retrieval of L. infantum DNA in ticks does not confirm their vector competence.

Feline leishmaniosis has been described in several countries, mostly in areas where the infection is endemic, such as Spain, Italy, France, Portugal, Brazil (Dunan et al. 1989, Costa Durao et al. 1994, Pennisi et al. 2004, Martin-Sanchez et al. 2007, Magno da Silva et al. 2010).

The epidemiological role of the cat in Leishmania maintenance and spread has been long discussed, suggesting that cat may represent a secondary host reservoir rather than an accidental host (Gramiccia 2011). The evidence of the parasite transmission from naturally infected cats to phlebotomine vectors in Italy (Maroli et al. 2007)

310

Salvatore et al.

and in Brazil (Magno da Silva et al. 2010) suggested a sand fly-transmission of feline leishmaniosis.

Our results seem to indicate that the debate about the epidemiological role of ticks in canine leishmaniosis might be extended to feline leishmaniosis. To our knowledge, this is the first report of L. infantum DNA in ticks removed from cats. Nevertheless, the present study presents some strong limits, first of all that the ticks were collected for purposes other than Leishmania investigation, so concurrent serological or molecular analysis for L. infantum from the animals parasitized were not performed. Moreover, the animals previously tested were untraced to perform additional tests. Taking in account these considerations, the results of the present study should be considered preliminary to further and more focused investigations including a larger number of ectoparasitized cats, with the aim to assess the prevalence of L. infantum in ticks from cats and the possible correlation of pathogens detected in vectors and status of infection in animals.

Veterinaria Italiana 2014, 50 (4), 307-312. doi: 10.12834/VetIt.83.1222.2

Salvatore et al.

Leishmania infantum in ticks from dog and cat

References Antoniou M., Gramiccia M., Molina R., Dvorak V. & Volf P. 2013. The role of indigenous phlebotomine sandflies and mammals in the spreading of leishmaniasis agents in the Mediterranean region. Euro Surveill, 18 (30), 54-61.

Aureli S., Foley J.E., Galuppi R., Rejmanek D., Bonoli C. & Tampieri M.P. 2012. Anaplasma phagocytophilum in ticks from parks in the Emilia-Romagna region of northern Italy. Vet Ital, 48 (2), 413-423.

Costa Durao J.F., Rebel, E., Peleteiro M.C., Correia J.J. & Simoes G. 1994. Primeiro caso de leishmaniose em gato domestico (Felis catus domesticus) detectado em Portugal (Concelho de Sesimbra) Nota Preliminar. Revista Portuguesa de Ciências Veterinárias, 89, 140-144.

Coutinho M.T., Bueno L.L., Sterzik A., Fujiwara R.T., Botelho J.R., De Maria M., Genaro O. & Linardi P.M. 2005. Participation of Rhipicephalus sanguineus (Acari: Ixodidae) in the epidemiology of canine visceral leishmaniasis. Vet Parasitol, 128 (1-2), 149-155.

Coutinho M.T. & Linardi P.M. 2007. Can fleas from dogs infected with canine visceral leishmaniasis transfer the infection to other mammals? Vet Parasitol, 147, 320-325.

Dantas-Torres F., Faustino M.A.G., Lima O.C.C. & Acioli R.V. 2005. Epidemiologic surveillance of canine visceral leishmaniasis in the municipality of Refice Pernambuco.

Rev Soc Bras Med Trop, 38, 444-445.

Dantas-Torres F., Lorusso V., Testini G., de Paiva-Cavalcanti M., Figueredo L.A., Stanneck D., Mencke N., BrandãoFilho S.P., Alves L.C. & Otranto D. 2010a. Detection of Leishmania infantum in Rhipicephalus sanguineus ticks from Brazil and Italy. Parasitol Res, 106, 857-860.

Dantas-Torres F., Martins T.F., de Paiva-Cavalcanti M., Figueredo L.A., Lima B.S. & Brandão-Filh, S.P. 2010b.

Transovarial passage of Leishmania infantum kDNA in artificially infected Rhipicephalus sanguineus. Exp Parasitol, 125 (2), 184-185.

Dunan S., Mary C., Garbe L., Breton Y., Olivon B., Ferrey P. & Cabassus J.P. 1989. A propos d’un cas de leishmaniose chez un chat de la region mersiellaise. Bull Soc Fr Parasitol, 7, 17-20.

Ferreira M.G., Fattori K.R., Souza F. & Lima V.M. 2009.

Potential role for dog fleas in the cycle of Leishmania spp. Vet Parasitol, 165, 150-154.

Fontes Paz G., Barbosa Ribeiro M.F., Monteiro Michalsky E., da Roca Lima A., França-Silva J.C., Andrade Barata R., Fortes-Dias C. & Santos Dias E. 2010. Evaluation of the vectorial capacity of Rhipicephalus sanguineus (Acari: Ixodidae) in the transmission of canine visceral leishmaniasis. Parasitol Res, 106, 523-528.

Gramiccia M. 2011. Recent advances in leishmaniasis in pet aminals: Epidemiology, diagnostics and anti-vectorial prophylaxis. Vet Parasitol, 181 (1), 23-30.

Halos L., Jamal T., Vial L., Maillard R., Suau A., Le Menach A., Boulouis H.J. & Vayssier-Taussat M. 2004. Determination of an efficient and reliable method for DNA extraction from ticks. Vet Res, 35 (6), 709-713.

Killick-Kendrick R. 1999. The biology and control of

Veterinaria Italiana 2014, 50 (4), 307-312. doi: 10.12834/VetIt.83.1222.2

phlebotomine sand flies. Clinics in Dermatology, 17 (3), 279-289.

Lachaud L., Marchergui-Hammami S., Chabbert E., Dereure J., Dedet J.P. & Bastien P. 2002. Comparison of six PCR methods using peripheral blood for detection of canine visceral leishmaniasis. J Clin Microbiol, 40 (1), 210-215.

Magno da Silva S., Rabelo P., de Figueiredo Gontijo N., Ribeiro R., Melo M., Ribeiro V. & Michalick M. 2010.

First report of infection of Lutzomyia longipalpis by Leishmania (Leishmania) infantum from a naturally infected cat of Brazil. Vet Parasitol, 174, 150-154.

Mancianti F., Mortarino M., Pieri S. & Franceschi A. 2004.

Detection of Leishmania DNA in the blood of cats from endemic foci of canine leishmaniasis by means of PCR: preliminary report. Parassitologia, 46 (1), 180.

Maroli M., Pennisi M.G., Di Muccio T., Khoury C., Gradoni L. & Gramiccia M. 2007. Infection of sandflies by a cat naturally infected with Leishmania infantum. Vet Parasitol, 145, 357-360.

Martin-Sanchez J., Acebo C., Muñoz-Perez M., Pesson B., Marchal O. & Morillas-Marquez F. 2007. Infection by Leishmania infantum in cats: epidemiological study in Spain. Vet Parasitol, 145, 267-273.

Molina R., Jimenez M.I., Cruz I., Iriso A., Martin-Martin I., Sevillano O., Melero S. & Bernal J. 2012. The hare (Lepus granatensis) as potential sylvatic reservoir of Leishmania infantum in Spain. Vet Parasitol, 190 (1-2), 268-271.

Mollicone E., Battelli G., Gramiccia M., Maroli M. & Baldelli R. 2003. A stable focus of canine leishmaniosis in the Bologna Province, Italy. Parassitologia, 45, 85-88.

Otranto D. & Dantas-Torres F. 2010. Fleas and ticks as vectors of Leishmania spp. to dogs: caution is needed.

Vet Parasitol, 168, 173-174.

Pampiglione S., La Placa M. & Schlick G. 1974. Studies on mediterranean leishmaniasis. An outbreak of visceral leishmaniasis in Northern Italy. T Roy Soc Trop Med H, 68 (5), 349-359.

Pennisi M.G., Venza M., Reale S., Vitale F. & Lo Giudice S. 2004. Case report of Leishmaniasis in four cats. Vet Res Commun, 28 (1), 363-366.

Pennisi M.G., Hartmann K., Lloret A., Addie D.,Belak S., Boucraut-Baralon C., Egberinl H., Frymus T., GruffyddJones T., Hosie M.J., Lutz H., Marsilio F., Möstl K., Radford A.D., Thiry E., Truyen U. & Horzinek M.C. 2013.

Leishmaniosis in cats: ABCD guidelines on prevention and management. J Feline Med Surg, 15, 638-642.

Prina E., Roux E., Mattei D. & Milon G. 2007. Leishmania DNA is rapidly degraded following parasite death: an analysis by microscopy and real-time PCR. Microbes Infect, 9, 1307-1315.

Silva de Morais R.C., da Cunha Gonçalves S., Costa P.L., Gaudencio da Silva K., da Silva F.J., Pessoa e Silva R., de Brito M.E.F., Brandão-Filho S.P., Dantas-Torres F. & de Paiva-Cavalcanti M. 2013. Detection of Leishmania infantum in animals and their ectoparasites by conventional PCR and real time PCR. Exp Appl Acarol, 59, 473-481.

311

Leishmania infantum in ticks from dog and cat

Solano-Gallego L., Rossi L., Scroccaro A.M., Montarsi F., Caldin M., Furlanello T. & Trotta M. 2012. Detection of Leishmania infantum DNA mainly in Rhipicephalus sanguineus male ticks removed from dogs living in endemic areas of canine leishmaniosis. Parasit Vectors, 5 (98), doi: 10.1186/1756-3305-5-98.

Sherry K., Mir贸 G., Trotta M., Miranda C., Montoya A., Espinosa C., Ribas F., Furlanello T. & Solano-Gallego L. 2011. A serological and molecular study of Leishmania infantum infection in cats from the Island of Ibiza (Spain). Vector Borne Zoonotic Dis, 11 (3), 239-245.

312

Salvatore et al.

Trotta M., Nicetto M., Fogliazza A., Montarsi F., Caldin M., Furlanello T. & Solano-Gallego L. 2012. Detection of Leishmania infantum, Babesia canis, and rickettsiae in ticks removed from dogs living in Italy. Ticks Tick Borne Dis, 3 (5-6), 294-297.

Varani S., Cagarelli R., Melchionda F., Attard L., Salvadori C., Finarelli A., Gentilomi G., Tigani R., Rangoni R., Todeschini R., Scalone A., Di Muccio T., Gramiccia M., Gradoni L., Viale P. & Landini M. 2013. Ongoing outbreak of visceral leishmaniasis in Bologna Province, Italy, November 2012 to May 2013. Euro Surveill, 18 (29), 3-6.

Veterinaria Italiana 2014, 50 (4), 307-312. doi: 10.12834/VetIt.83.1222.2

SHORT COMMUNICATION First detection of Arcobacter sp. in Eurasian collared doves (Streptopelia decaocto) Antonietta Di Francesco*, Mauro Delogu, Federica Giacometti, Laura Stancampiano, Ester Grilli, Ilaria Guarniero & Andrea Serraino Department of Veterinary Medical Sciences, Alma Mater Studiorum-University of Bologna, Via Tolara di Sopra 50, 40064 Ozzano dell’Emilia (BO), Italy. * Corresponding author at: Department of Veterinary Medical Sciences, Alma Mater Studiorum-University of Bologna, Via Tolara di Sopra 50, 40064 Ozzano dell’Emilia (BO), Italy.

Tel.: +39 051 2097063, e-mail: antoniet.difrancesco@unibo.it.

Veterinaria Italiana 2014, 50 (4), 313-315. doi: 10.12834/VetIt.75.2520.1 Accepted: 03.08.2014 | Available on line: 29.11.2014

Keywords Arcobacter, Collared dove, Italy, Polymerase Chain Reaction (PCR), Streptopelia decaocto.

Summary Data about the presence of Arcobacter in wild birds are currently lacking. In this study cloacal swabs from 95 collared doves (Streptopelia decaocto), submitted to the Department of Veterinary Medical Sciences (Bologna, Italy) between 2011 and 2013 from various urban and suburban areas of the Emilia-Romagna region (Northern Italy), were tested for the presence of Arcobacter sp. by a rRNA 23S nested Polymerase Chain Reaction (PCR). Eighteen out of 95 (19%) samples showed the expected PCR product. Further cultural and molecular studies are needed to assess the Arcobacter prevalence in wild birds and elucidate their potential epidemiological role as source of animal and human infections.

Prima evidenziazione di Arcobacter sp. in tortore dal collare (Streptopelia decaocto) Parole chiave Arcobacter, Italia, Polymerase Chain Reaction (PCR), Streptopelia decaocto, Tortora dal collare.

Riassunto Nel presente studio sono riportati i risultati di un’indagine condotta su 95 tortore dal collare (Streptopelia decaocto) conferite al Dipartimento di Scienze Mediche Veterinarie dell’Università degli Studi di Bologna tra il 2011 e il 2013. Gli animali sono stati testati per la presenza di Arcobacter sp. Il DNA estratto da tamponi cloacali è stato analizzato mediante rRNA 23S nested PCR. Diciotto dei 95 campioni (19%) sono risultati positivi. Ulteriori indagini colturali e molecolari su più specie di volatili consentirebbero di approfondire la prevalenza dell’infezione da Arcobacter nei volatili selvatici e il loro potenziale ruolo epidemiologico nelle infezioni dell'uomo e degli animali.

The genus Arcobacter was proposed in 1991 (Vandamme et al. 1991), to accommodate organisms that displayed campylobacter-like motility and morphology, but differed from Campylobacter spp. for their aerotolerance and their ability to grow at lower temperatures.

At the present, the genus Arcobacter includes 18 species (Sasi Jyothsna et al. 2013). In animals, arcobacters have been associated to abortion, mastitis and gastrointestinal disorders, they have also been detected from clinically healthy farm animals (Collado and Figueras 2011). In humans, Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii have been isolated from stool samples of patients with gastroenteritis (Jiang et al. 2010, Patyal et al. 2011, Vandenberg et al. 2004, Wybo et al. 2004)

and less frequently from faecal specimens of healthy humans (Houf and Stephan 2007, Vandenberg et al.

2004). Arcobacter butzleri has been classified as a serious hazard to human health1 and as an important foodborne zoonotic pathogen (Cardoen et al. 2009).

However, the incidence of Arcobacter spp. infections could be underestimated, because of inappropriate detection and inadequate identification procedures are available so far (Vandenberg et al. 2004).

Transmission of arcobacters to humans probably occurs through untreated drinking water,

1

I nternational Commission on Microbiological Specifications for Foods (ICMSF). 2002. Microorganisms in foods 7: Microbiological testing in food safety management. International Commission on Microbiological Specifications for Foods. Kluwer Academic/Plenum, New York, USA.

313

Arcobacter sp. in Eurasian collared doves

faecally contaminated as well as manipulation or consumption of contaminated raw and undercooked meat products (Lehner et al. 2005). The highest prevalence of Arcobacter spp. in foods of animal origin has been detected for poultry, followed by pork, beef and lamb (Rivas et al. 2004). A recent study reported Arcobacter spp. contamination in fresh vegetables (González and Ferrús 2011). At the same time, close contacts inter-humans (Vandamme et al. 1992, Vandamme et al. 2003) or with pets (Fera et al. 2009, Houf et al. 2008) are also potential source of Arcobacter spp. infection.

Data about the presence of Arcobacter spp. in wild birds are presently scanty (Collado and Figueras 2011). Eurasian collared dove (Streptopelia decaocto) is a Columbiformes species originally native to the India. It is capable of phenomenal range expansion and its spread and colonization are closely related to human activities (Romagosa and Labisky 2000).

European invasion of collared doves from Asia began in the mid-20th century, extending from India to the Middle East, the Western Europe and, more recently, the Mediterranean countries such as Italy and Spain (Rocha-Camarero and Hidalgo De Trucios 2002, Sorace and Gustin 2008). Once they arrived, farmyards full of fallen grain and plentiful animal feed were the springboard for a rapid population expansion into rural, suburban and urban areas. This study aimed to evaluate the presence of Arcobacter in cloacal swabs of S. decaocto, in Italy.

Ninety-five adult collared doves (50 males, 45 females), submitted to the Department of Veterinary Medical Sciences (Bologna, Italy) between 2011 and 2013 from various urban and suburban areas of the Emilia-Romagna region (Northern Italy) and stored frozen, were tested for the presence of Arcobacter. DNA was extracted from cloacal swabs by a commercial kit (QIAamp DNA Stool Mini Kit, Qiagen, Hilden, Germany). A 23S rRNA nested-PCR was developed. The primary Polymerase Chain Reaction (PCR) amplifying a 383 bp fragment of 23S rRNA gene was performed using the following forward and reverse oligonucleotide primers: ARCO A (5’-TTCGGAGGAGATGGAGAA-3’) and ARCO B (5’-AGTTACGGCCGCCGTTTA-3’). Cycling conditions were as follows: 5 minutes of denaturation at 95° C and 35 cycles each consisting of denaturation at 94° C for 1 minute, annealing at 54° C for 1 minute and extension at 72° C for 1 minute. A final elongation

2

314

Di Francesco et al.

step of 5 minutes at 72° C completed the reaction. In the secondary PCR amplifying a 316 bp fragment, primers ARCO 1 (5’-GTCGTGCCAAGAAAAGCCA-3’) and ARCO 2 (5’-TTCGCTTGCGCTGACAT-3’) (Bastyns et al. 1995), were used: 1 μl of product from the first PCR step was added to a final volume of 50 μl.

PCR conditions were as described above, except for the annealing temperature (52 °C) and the number of cycles (n. 25). A distilled water negative control was included in both PCRs. The amplified products were visualized after electrophoresis in 1.5% agarose gel by ethidium bromide staining under UV light. The secondary PCR products were purified by using a QIAquick PCR purification kit (Qiagen, Hilden, Germany) and both strands were sequenced (Bio‑Fab Research, Rome, Italy). The nucleotide sequences were compared with those available in Genbank by using the BLAST server from the National Center for Biotechnology Information2.

Preliminary tests were performed on A. butzleri ATCC 49616T, A. cryaerophilus ATCC 43158T and A. skirrowii ATCC 51132T reference strains.

Eighteen out of 95 (19%) samples showed the expected PCR product, identified as Arcobacter sp. by the sequencing. In view of the high density of collared doves in various environments (kindergartens, schools, farms, food companies), their faeces could represent a source of contamination to animals and humans. Workers in wildlife centres should also be informed about the potential risk of infection. The results of the present study should be considered preliminary to more comprehensive investigations taking in account that: i. only 1 wild avian species has been considered; ii. the samples examined were not suitable to microbial isolation attempts; iii. as the samples were not collected from a focused sampling, the potential links between the positivity to Arcobacter in examined collared doves and the Arcobacter presence in origin geographical areas could not be evaluated.

Further cultural and molecular studies on larger number of samples from more species of birds living in rural and urban areas are needed to assess the Arcobacter prevalence in wild birds and elucidate their potential epidemiological role as source of animal and human infections.

h ttp://blast.ncbi.nlm.nih.gov/Blast.cgi.

Veterinaria Italiana 2014, 50 (4), 313-315. doi: 10.12834/VetIt.75.2520.1

Di Francesco et al.

Arcobacter sp. in Eurasian collared doves

References Bastyns K., Cartuyvels D., Chapelle S., Vandamme P., Goossens H. & De Wachter R. 1995. A variable 23S rDNA region is a useful discriminating target for genusspecific and species-specific PCR amplification in Arcobacter species. Syst Appl Microbiol, 18, 353-356.

Collado L. & Figueras M.J. 2011. Taxonomy, epidemiology, and clinical relevance of the genus Arcobacter. Clin Microbiol Rev, 24, 174-192.

Cardoen S., Van Huffel X., Berkvens D., Quoilin S., Ducoffre G., Saegerman C., Speybroeck N., Imberechts H., Herman L., Ducatelle R. & Dierick K. 2009.

Evidence-based semiquantitative methodology for prioritization of foodborne zoonoses. Foodborne Pathog Dis, 6,1083-1096.

Fera M.T., La Camera E., Carbone M., Malara D. & Pennisi M.G. 2009. Pet cats as carriers of Arcobacter spp. in Southern Italy. J Appl Microbiol, 106, 1661-1666.

GonzĂĄlez A. & FerrĂşs M.A. 2011. Study of Arcobacter spp. contamination in fresh lettuces detected by different cultural and molecular methods. Int J Food Microbiol, 145, 311-314.

Houf K. & Stephan R. 2007. Isolation and characterization of the emerging foodborn pathogen Arcobacter from human stool. J Microbiol Methods, 68, 408-413.

Houf K., De Smet S., Bare J. & Daminet S. 2008. Dogs as carriers of the emerging pathogen Arcobacter. Vet Microbiol, 130, 208-213.

Jiang Z., Dupont H.L., Brown E.L., Nandy R.K., Ramamurthy T., Sinha A., Ghosh S., Guin S., Gurleen K., Rodrigues S., Chen J.J., McKenzie R. & Steffen R. 2010. Microbial etiology of travelers' diarrhea in Mexico, Guatemala, and India: importance of enterotoxigenic Bacteroides fragilis and Arcobacter species. J Clin Microbiol, 48,1417-1419.

Lehner A., Tasara T. & Stephan R. 2005. Relevant aspects of Arcobacter spp. as potential foodborne pathogen. Int J Food Microbiol, 102, 127-135.

Patyal A., Rathore R.S., Mohan H.V., Dhama K. & Kumar A. 2011. Prevalence of Arcobacter spp. in humans, animals and foods of animal origin including sea food from India. Transboundary Emerg Dis, 58, 402-410.

Veterinaria Italiana 2014, 50 (4), 313-315. doi: 10.12834/VetIt.75.2520.1

Rivas L., Fegan N. & Vanderlinde P. 2004. Isolation and characterization of Arcobacter butzleri from meat. Int J Food Microbiol, 91, 31-41.

Rocha-Camarero G. & Hidalgo De Trucios S.J. 2002. The spread of the Collared Dove Streptopelia decaocto in Europe: colonization patterns in the west of the Iberian Peninsula. Bird Study, 49, 11-16.

Romagosa C.M. & Labisky R.F. 2000. Establishment and dispersal of the Eurasian Collared-dove in Florida. J Field Ornithol, 71, 159-166.

Sasi Jyothsna T.S., Rahul K., Ramaprasad E.V., Sasikala Ch. & Ramana Ch.V. 2013. Arcobacter anaerophilus sp. nov., isolated from an estuarine sediment and emended description of the genus Arcobacter. Int J Syst Evol Microbiol, 63, 4619-4625.

Sorace A. & Gustin M. 2008. Homogenisation processes and local effects on avifaunal composition in Italian towns. Acta Oecologica, 33, 15-26.

Vandamme P., Falsen E., Rossau R., Hoste B., Segers P., Tytgat R. & De Ley J. 1991. Revision of Campylobacter, Helicobacter, and Wolinella taxonomy: emendation of generic descriptions and proposal of Arcobacter gen. nov. Int J Syst Bacteriol, 41, 88-103.

Vandamme P., Pugina P., Benzi G., Van Etterijck R., Viaes L., Kersters K., Butzler J.-P., Lior H. & Lauwers S. 1992.

Outbreak of recurrent abdominal cramps associated with Arcobacter butzleri in an Italian school. J Clin Microbiol, 30, 2335-2337.

Vandamme P., Giesendorf B.A., van Belkum A., Pierard D., Lauwers S., Kersters K., Butzler J.P., Goossens H. & Quint W.G. 1993. Discrimination of epidemic and sporadic isolates of Arcobacter butzleri by polymerase chain reaction-mediated DNA fingerprinting. J Clin Microbiol, 31, 3317-3319.

Vandenberg O., Dediste A., Houf K., Ibekwem S., Souayah H., Cadranel S., Douat N., Zissis G., Butzler J.P. & Vandamme P. 2004. Arcobacter species in humans.

Emerg Infect Dis, 10, 1863-1867.

Wybo I., Breynaert J., Lauwers S., Lindenburg F. & Houf K. 2004. Isolation of Arcobacter skirrowii from a patient with chronic diarrhea. J Clin Microbiol, 42, 1851-1852.

315

a cura di Manuel Graziani

LIBRI/Book reviews

Marta Avanzi

Procedure cliniche e terapeutiche negli animali esotici (Edra, pp. 290, € 69,00) www.edizioniedra.it

Negli ultimi anni è in costante aumento il numero degli animali da compagnia, con la diretta conseguenza che negli ambulatori veterinari arrivano sempre più pet diversi dal cane e dal gatto. Per dare loro cure di qualità non è sufficiente conoscere soltanto la fisiologia e la patologia ma c’è bisogno di saper maneggiare correttamente questi animali non convenzionali, oltre che conoscere le procedure per arrivare a una diagnosi e quindi ad una terapia appropriata. Procedure cliniche e terapeutiche negli animali esotici di Marta Avanzi risponde al bisogno di conoscenza in un settore in cui la formazione accademica è ancora scarsa, a fronte di un aumento della richiesta di cure da parte dei proprietari.

Come scrive l’autrice nella prefazione: “Non sempre il professionista ha la possibilità di seguire un periodo di tirocinio pratico presso colleghi più esperti e spesso è la mancanza di esperienza che scoraggia il neofita ad ampliare il range di specie a cui dedicarsi. Il libro nasce proprio dall’esigenza di colmare questa lacuna, rispondendo al bisogno crescente di formazione nel campo della cura e del trattamento degli animali esotici da compagnia”.

Il manuale della dott.ssa Avanzi illustra con chiarezza le procedure diagnostiche, anestesiologiche, terapeutiche indispensabili per la pratica clinica. Per questo è rivolto principalmente ai medici veterinari che si occupano degli animali esotici da compagnia quali furetti, conigli, roditori, uccelli e rettili, di cui vengono illustrate le tecniche fondamentali per maneggiarli e contenerli con competenza e sicurezza.

Il volume, pubblicato nel grande formato 19,5x26,5 cm, contiene più di mille fotografie a colori, comprese quelle delle attrezzature specifiche per i vari casi. Un’iconografia ricchissima che ha la funzione di descrivere passo dopo passo le manovre e le procedure per trattare questi particolari pazienti. I capitoli sono 14 e descrivono circa 150 procedure, dalla dermatologia all’oftalmologia, dall’apparato respiratorio all’apparato gastrointestinale e genitourinario. Tutte le procedure sono strutturate con il medesimo schema che prevede indicazioni, controindicazioni e avvertenze, complicazioni, anatomia speciale, attrezzatura, tecnica, posizionamento e contenzione.

317

a cura di Manuel Graziani

LIBRI/Book reviews

Attilio Pini

Un veterinario a spasso per il mondo tra guerre, colonialismo e apartheid (Palumbi, pp. 118, € 8,00) www.edizionipalumbi.it

Attilio Pini, classe 1930, dai tre ai sedici anni ha vissuto in Somalia dove la sua famiglia si trasferì a seguito della malattia della madre Anna. Rientrato in Italia si è laureato in Medicina Veterinaria all’Università di Torino, città nella quale era stato mandato a finire il Liceo. È stato per un po’ all’IZS del Piemonte ma poco dopo ha abbandonato la comodità del posto fisso e nel 1962 è tornato in Africa per andare a lavorare al Veterinary Research Laboratory di Kabete, in Kenya, dove è nata nel 1967 la sua a prima figlia Barbara. Si è poi spostato in Sudafrica, dove nel 1971 è nato il secondo figlio Stefano, all’Onderstepoort Veterinary Research Institute di Pretoria di cui è diventato in seguito vice direttore. A causa delle tensioni politiche e razziali, spinto anche dalla moglie Ilaria (da cui si separerà poco dopo) decise di rientrare in Italia, a Ventimiglia, ritrovandosi suo malgrado a cambiare completamente vita e finire a gestire un campeggio. Sarà il prof. Adriano Mantovani a recuperarlo alla professione convincendolo ad andare in Zambia per lavorare a un progetto di cooperazione finanziato dal Ministero degli Affari Esteri. Dopo quell’esperienza seguiranno altre missioni in Bangladesh, ancora in Zambia, in Salvador ed Eritrea. Sul finire degli anni ’80 Attilio Pini è tornato definitivamente in Italia dove ha collaborato con l’Istituto Superiore di Sanità, si è risposato con Nadia e, nel 1989, ha iniziato a lavorare per l’IZS di Teramo dove tuttora presta servizio.

In questo agile libro è racchiusa l’avvincente storia di un “uomo senza radici e senza consuetudini” narrata in prima persona, senza filtri, con una capacità di sintesi rara. Tanti gli aneddoti sulla sua famiglia della media borghesia che aveva “la tipica servitù dei paesi coloniali”: la figura dell’amata madre che “non aveva molta simpatia per i fascisti”, del padre Ugo, Capo di Stato Maggiore in Somalia ma anch’egli molto critico verso il regime fascista, del fratello maggiore Tebaldo come il padre militare di carriera e poi veterinario. E ancora, le prime docce con l’acqua di mare, la “festa delle bastonate” (una vera battaglia tra somali con finalità propiziatorie di fertilità), fino al viaggio in nave con Filippo Tommaso Marinetti che pare si fosse invaghito della madre Anna.

Quello del dott. Pini è un libro ben scritto, dallo stile lineare, fatto di parole pesate col misurino, a volte anche musicali (“Non c’era più il fascio, ma si assisteva all’inizio dello sfascio”) e argute (si legga pag. 35 sugli italiani “popolo plaudente”) che rendono la lettura assai godibile. Nonostante l’autore si schernisca dicendo di non aver ereditato nessuna delle doti paterne, evidentemente ha ereditato eccome la verve narrativa dal padre Ugo autore, tra l’altro, del libro di memorie Sotto le ceneri dell'impero. Dalle rive del Giuba alle falde del monte Kenya, edito nel 1967 e ancora oggi nel catalogo dell’Editore Mursia.

319