Influence of the mucosal environment on the regulation of the local immune response in health and al

INFLUENCE OF THE MUCOSAL ENVIRONMENT ON THE REGULATION OF THE LOCAL IMMUNE RESPONSE IN HEALTH AND ALLERGIC DISEASE

Influence of the mucosal environment on the regulation of the local immune response in health and allergic disease

Joost van Tongeren

Joost van Tongeren

UM

P

© Copyright Joost van Tongeren, Amsterdam 2016

Production: Datawyse | Universitaire Pers Maastricht Layout: Tiny Wouters Cover: Datawyse | Universitaire Pers Maastricht

ISBN: 978 94 6159 618 5

Financial Support: ZonMw Agiko Stipendium 92003459 Financial Support for the publication of this thesis was provided by:

UNIVERSITAIRE

PERS MAASTRICHT

Influence of the mucosal environment on the regulation of the local immune response in health and allergic disease

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus prof. dr. ir. K.I.J. Maex ten overstaan van een door het College voor Promoties ingestelde commissie, in het openbaar te verdedigen in de Aula der Universiteit op woensdag 23 november 2016, te 13.00 uur door Joost van Tongeren geboren te Goirle

Promotiecommissie: Promotor:

Prof. dr. W.J. Fokkens

Universiteit van Amsterdam

Copromotor:

Dr. C.M. van Drunen

Universiteit van Amsterdam

Overige leden:

Prof. dr. H. Spits Prof. dr. J.P. Medema Prof. dr. B. Kremer Prof. dr. P. Hellings Prof. dr. E.C. de Jong

Universiteit van Amsterdam Universiteit van Amsterdam Universiteit Maastricht Katholieke Universiteit Leuven Universiteit van Amsterdam

Faculteit der Geneeskunde

Contents Chapter 1 Introduction: Interactions between epithelial cells and dendritic cells

in airway immune responses: lessons from allergic airway disease.

van Tongeren J, Reinartz SM, Fokkens WJ, de Jong EC, van Drunen CM.

7

Allergy. 2008;63(9):1124‐35.

Chapter 2 Scope and Aim of the thesis

29

Chapter 3

33

Expression profiling and functional analysis of Toll‐like receptors in primary healthy human nasal epithelial cells shows no correlation and a refractory LPS response. van Tongeren J, Röschmann KI, Reinartz SM, Luiten S, Fokkens WJ, de Jong EC, van Drunen CM. Clin Transl Allergy. 2015;5:42.

Chapter 4 Synergy between TLR‐2 and TLR‐3 signalling in primary human

nasal epithelial cells.

van Tongeren J, Golebski K, van Egmond D , de Groot EJ, Fokkens WJ, van Drunen CM. Immunobiology. 2015;220(4):445‐51

Chapter 5 Specific induction of TSLP by the viral RNA analogue Poly(I:C) in

primary epithelial cells derived from nasal polyps.

Golebski K, van Tongeren J, van Egmond D, de Groot EJ, Fokkens WJ,

81

Reinartz SM, van Tongeren J, van Egmond D, de Groot EJ, Fokkens WJ, van Drunen CM. J Allergy Clin Immunol. 2011 Oct;128(4):887‐90.

Chapter 7 Dendritic cell subsets in oral mucosa of allergic and healthy

subjects.

65

van Drunen CM. PLoS One. 2016;11(4):e0152808

Chapter 6 Dendritic cells in nasal mucosa of subjects with different

allergic sensitizations.

49

89

Reinartz SM, van Tongeren J, van Egmond D, de Groot EJJ, Fokkens WJ, van Drunen CM. PLoS One 2016;11(5): e0154409

Chapter 8 General Discussion

Appendices Summary

Samenvatting

Publications

Abbreviations

Dankwoord

Curriculum vitae

105 115 121 127 131 135 139

7

Chapter

1

Introduction Interactions between epithelial cells and Dendritic cells in airway immune responses; lessons from allergic airway disease

J. van Tongeren, S.M. Reinartz, W.J. Fokkens, E.C. de Jong, C.M. van Drunen Allergy. 2008;63(9):1124‐1135

Chapter 1

8

Abstract Micro‐organisms constantly invade the human body and may form a threat to our health.

Traditionally, concepts of defence mechanisms have included a protective outer layer of epithelia and a vigilant immune system searching for areas where the integrity of the outer layer may be compromised. Instead of considering these elements as two independent mechanisms, we should be treating them as a single integrated system.

This review will present and discuss the role of local immune‐competent cells and local epithelia in the recognition of potential pathogens, and how the interaction between the two components may affect the initiation of the airway immune response. A concept emerges where airway mucosal dendritic cells (DCs) act as integrators of both immunostimulatory and immuno‐ suppressive signals that act within actively‐involved mucosal tissue.

Introduction: Interactions between epithelial cells and Dendritic cells in airway immune responses

9

Introduction We are constantly exposed to environmental factors, viruses, and bacteria and some micro‐organisms may constitute a threat to our health. Traditionally, concepts of defence mechanisms for these threats have included a protective outer layer of epithelia and a vigilant immune system searching for areas where the integrity of the outer layer may have been compromised. There is a growing awareness that our views of these two defence mechanisms need refining. Instead of considering them as two relatively independent mechanisms, we should be treating them as a single integrated system.

This review presents and discusses the role of local immune‐competent cells and local epithelia in the recognition of potential pathogens, and how the interaction between both components may affect the initiation of the immune response. As these mucosal epithelia are the first to interact with, and respond to, many different environmental factors, these signals could affect the functional characteristics of local immune competent cells and could have consequences for the subsequent immune response. In order to clarify the complexity of the initiation of immune responses in the context of airway mucosa we provide an extensive description of the nature of the two main local components: dendritic cells (DCs) and epithelial cells.

The regulation events in the local mucosa can not be viewed in isolation. This review therefore opens with an introduction to the involved T‐helper cells that define the different types of basal immune responses. We will discuss the heterogeneity of human DCs, as well as the prevalence and potential functional specializations of local DCs in human and animal airways. Ultimately, the functional characteristics of airway epithelial cells and their direct and indirect interactions with mucosal DCs will result in a model of the mucosal immune response. In this model, DCs need to integrate signals from many different sources so that the correct immune response will be initiated.

The terminology describing the processes that act on DC can be highly confusing.

Different authors may use identical terms to mean different things or different terms to describe the same phenomenon. In order to avoid any confusion about the terminology used here, a brief description is warranted of the context we have in mind. When we refer to the regulation of the immune response we describe the outcome of signals acting on the DCs. This includes the stimulation, inhibition, or modulation of the immune response. The activation of DCs in the mucosa includes a multitude of processes that will allow immune responses to initiate. This process includes the maturation of DCs (i.e. up‐regulation of co‐stimulatory molecules) and the ability of the DCs to reach the lymphatic vessel in the local tissue (i.e. up‐regulation of chemokines receptors) in order to take the locally integrated signal away from the tissue to the draining lymph node. Differential expression levels of adhesion molecules and receptors for lymphatic chemo‐attractants contribute to the activation process of DCs in the local tissue and will have consequences for the overall outcome of the immune

Chapter 1

10

response. We will use the term modulation to describe how factors produced by these other cells influence the activation processes of DCs. The above implies a concept in which mucosal DCs act as integrators of both immunostimulatory and immunosuppressive signals originating directly from the environment and from actively‐involved mucosal tissue, acting collectively to regulate the local immune response.

The different T lymphocyte helper cells in the basal immune response One of the critically important cells in the immune system to contact any micro‐ organism is the DC. After the uptake of the micro‐organism, a DC leaves the local tissue and migrates to a draining lymph node where it induces the proliferation of antigen‐ specific T lymphocytes resulting in either a T‐helper 1 (Th1) cell, T‐helper 2 (Th2) cell, Regulatory T‐cell (Treg) or T‐helper 17 (Th17) cell response dependent on the modulation and activation status of the DC. Th1 cells evolve when the peripheral DC has been exposed to intracellular pathogens (virus, bacteria, and some protozoa) and are characterized by the production of Interferon (IFN)γ. Th2 cells develop when the DC has been exposed to an extra cellular parasite and are characterized by the production of interleukin (IL)‐4, IL‐5 and IL‐13.

Recently, another population of Th cells has been described. Th17 cells are characterized by the production of IL‐17, resulting in the recruitment of neutrophils into local tissues. This feature suggests a role in the immune response against extra cellular bacteria.1 Another type of Th cells is the Treg cell. Both Th1 and Th2 responses can be suppressed by adaptive Treg cells through contact‐dependent mechanisms and/or the production of IL‐10 and TGF‐β.2,3 Although this cell type is very important in controlling the activity of both Th1 and Th2 responses, we focus in this review on the role of epithelial cells in the initiation and modulation of a Th1 or Th2 response.

Although there is considerable knowledge about the signals expressed by DCs that guide the development of Th1 responses, less is known about the development of Th2 cells from naïve T cells. Moreover it is still unclear which signals are responsible for the initial instruction of the DC when it still resides in a local epithelium, and is surrounded by a multitude of micro‐organisms(whether pathogenic or not) or other antigenic triggers of the immune system as in, for instance, the mucosa of the gut or the upper and lower airways. This raises the interesting question of how the immune system deals with a barrage of potentially confusing signals, and how it not only makes sure that the response is appropriately Th1 or Th2, but even makes sure that such a response is required at all. In auto‐immune or allergic diseases this process breaks down. An inappropriate Th1 response against a host factor contributes to the pathogenic mechanism in auto‐immune diseases, whereas an inappropriate

Introduction: Interactions between epithelial cells and Dendritic cells in airway immune responses

11

Th2 response against an otherwise innocent environmental factor contributes to the pathogenic mechanism in allergic diseases.

Dendritic cell heterogeneity DCs constitute a heterogeneous class of specialized antigen presenting cells. There are several reasons for the complexity of the characterization of DC subtypes based on the expression of cell/cell‐surface molecules. The expression of cellular molecules may depend: (1) on the myeloid or lymphoid origin of the DC, (2) on their Th1‐, Th2‐, Th17‐ or regulatory T‐cell‐inducing potential after activation, and (3) on the tissue localization within the organism. The characterization of different DC subtypes is further complicated by the fact that some molecules are also found on cell types other than DCs, and by the use of different/unique subdivisions of DCs based on author’s own preferred molecules.

In human peripheral blood, we can discern at least four cell types of myeloid origin (Table 1.1). These mDCs develop from bone marrow‐derived monocytic precursors, express common myeloid surface markers (CD11c, CD13) and require granulocyte‐ macrophage colony‐stimulating factor (GM‐CSF) in vitro for their survival.4 Two myeloid DC subtypes can be distinguished depending on whether they express BDCA‐1/CD1c or BDCA‐3, markers that are initially found in a search for specific Blood Dendritic Cell Antigens.

Table 1.1 Characteristics of human DC subsets in nasal mucosa

Origin Markers

Growth and survival dependent In vitro

BDCA‐1+ mDC

BDCA‐3+ mDC

CD34+ myeloid progenitor CD11c+ BDCA‐1+ (CD1c) CD33+ CD13+

CD34+ myeloid progenitor CD11c+ BDCA‐3+

GM‐CSF

GM‐CSF

Langerhans cell (LC) CD34+ myeloid progenitor CD1a+ CD1c+ E‐cadherin Langerin Birbeck Granules TGF‐β

Plasmacytoid DC (pDC) lymphoid CD123+ BDCA‐2+ BDCA‐4+ IL‐3

A third type DC of myeloid origin can be present in certain tissues. The Langerhans cells (LCs) are a distinct population of DCs that are located in epithelial tissues such as the airway mucosa and the epidermis of the skin. LCs are characterized by the expression of CD1a, E‐cadherin, Langerin, and the presence of Birbeck granules.5 The origin of LCs is not fully understood. Reports indicate that they can originate from both a CD14‐ and a CD14+ myeloid precursor.4‐6 In addition to GM‐CSF, there is a crucial role for

Chapter 1

12

Transforming Growth Factor (TGF)‐β in the differentiation process of LCs. The fourth type of DC is the CD34+DC, which will not be discussed in this review.

The cellular origin of plasmacytoid DCs (pDCs) differs from that of mDCs. pDCs, as their name suggests, bear a morphological resemblance to plasma cells and are related to the lymphoid lineage.7 The growth and survival of pDC depends in vitro on IL‐3 which also explains the high level of expression of CD123 (IL‐3 receptor α‐chain) on these cells.

In addition to their differences in terms of identifying lineage markers, DC subsets are also distinguished on the basis of different expression profiles for pathogen/pattern recognition receptors, co‐stimulatory molecules, or differentiation/activation molecules. Putting aside their evolutionary origin, the expression of these molecules affect DC function, the distinctive responsiveness of DCs to pathogens, and the selective production of T‐cell polarizing molecules that drive the development of Th1, Th2 or regulatory T cells.8‐13 Distinct subtypes of DCs may have different functional properties. This functional specialization is, at least partly, controlled by Toll‐like receptors (TLRs), a group of transmembrane proteins that play a critical role as pattern‐recognition receptors (PRRs). PRRs include soluble and transmembrane molecules that bind micro‐organism‐ derived molecules and includes scavengers such as C‐reactive protein, scavenger receptors, Lectins, nucleotide‐binding oligomerization domain (NOD) molecules and TLRs. TLRs are under intensive investigation. They recognize pathogen associated molecular patterns (PAMP), the molecular signatures of microbial pathogens like bacteria and viruses.13,14 Classical blood derived myeloid DCs (CD11c+) express TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, and TLR7.13,14 Myeloid DC can therefore recognize several bacterial components via TLR1 as a heterodimer with TLR2 (PAM3CSK4 (Lipopeptide), TLR2 (e.g. Lipoteichoid acid, Peptidoglycan), TLR4 (LipoPolySacharide (LPS)), TLR5 (Flagellin) and TLR6, as a heterodimer with TLR2 (MALP‐2, lipoprotein), viral double‐stranded (ds) RNA via TLR3 and viral single‐stranded (ss) RNA via TLR7.15 Unlike mDCs, human pDCs express only TLR6, TLR7, TLR8, and TLR9. Through these receptors, pDCs selectively recognize DNA‐containing CpG motifs via TLR9 and ssRNA via TLR7 and TLR8,15 and appear to be of particular importance in innate immunity against several viral pathogens10 producing IFN‐α, a type I IFN.16 It has also been shown that pDCs are able to induce Th2 responses after CD40L stimulation,16,17 but the exact role of pDCs in the induction of specific immune responses is not fully clear yet.

To our knowledge there is no data about the TLR‐expression of mucosal LCs. Van der Aar et al. showed by using RT‐PCR that epidermal LCs express TLR1, TLR3, TLR6, and TLR7, and that the expression of TLR2, TLR4, TLR5, and TLR8 is weak or even absent.

Furthermore, skin derived LCs do not express TLR9 and TLR10.18 In contrast to this report a recent study showed, by using mAbs, that LCs from human skin express TLR1, ‐2, ‐5, ‐6, and ‐9, the cognate receptors for detection of specific bacteria‐derived molecules.19 Both studies show convincing data on TLR stimulation. Due to this,

Introduction: Interactions between epithelial cells and Dendritic cells in airway immune responses

13

discrepancies between studies could be searched in the preparation methods of LCs and the surgical specimens used.

The general opinion is that TLRs function mainly as inducers of inflammation through the production of IL‐6 and Tumor Necrosis Factor (TNF)‐α, and direct innate and adaptive immunity. Most TLR ligands stimulate APCs to produce Th1‐inducing cytokines such as IL‐12 and IL‐18 and support Th1‐skewed immune responses. TLR2 and TLR5 agonist provoke Th2 immune responses under certain conditions.20 In addition TLR2 ligation has been shown to induce Tregs.12 Low doses of LPS acting through TLR4 have been shown to induce Th2 responses.21,22 The molecular basis for Th1/Th2 polarization can be unexpectedly diverse as shown by the group of Kapsenberg and others. They found that both mDCs and pDCs are capable of inducing Th1‐ or Th2‐ cell responses depending on the interaction of the TLRs and other PRRs with different microbial ligands.23 The role of PAMPs, TLRs, and other Th‐cell polarizing factors in the induction of Th1‐cell responses seems well defined, but factors that promote Th2‐ or regulatory T‐cell responses are less well understood.

Whether these specific effects seen in vitro also occur in vivo and whether potential Th‐ cell polarizing factors produced by epithelial cells may also affect DC function remains under explored. Sporri and Reis e Sousa24 investigated whether inflammatory mediators produced in vivo can substitute for direct PAMP recognition, resulting in DC activation and priming. By comparing direct and indirect activation induced by microbial stimuli of TLR‐sufficient and TLR‐deficient DCs in an experimental animal model it was shown that direct recognition was crucial for priming of an appropriate T cell response. Indirectly activated DCs supported CD4+ T cell expansion, but failed to induce Th cell differentiation. In line with this observation Blander and Medzhitov25 showed that the generation of peptide‐MHC complexes is controlled by TLRs in a strictly phagosome‐autonomous manner, although others have contradicted this finding. These studies show that TLR mediated activation and TLR mediated MHC‐peptide presentation are critically important for the development of an appropriate T cell response.

Both the indirect and direct activation route can be found in the airway mucosa. The result of this double activation loop is still unexplored. It is also unknown whether antigen presentation is regulated differently in the various DC subtypes.

Dendritic cells in allergic airway disease in animals Animal studies using transgenic and inducible knock out mouse models suggest that mDCs and pDCs play a differential role in the pathogenesis of allergic disease.

Lambrecht’s group explored the role of mDCs in the allergic cellular immune response.

The injection of OVA‐pulsed mDCs in the airways of naïve mice resulted in the typical characteristics of asthma. mDCs were shown to migrate to the regional draining lymph nodes of the lung and induce Ag‐specific T‐cell activation resulting in sensitization to

Chapter 1

14

inhaled allergen.26,27 Once sensitization has been established, mDCs play a critical role in the maintenance of eosinophilic airway inflammation, as was shown using a Thymidine kinase (TK)‐transgenic based DC depleting mouse model.28 The depletion of mDCs during allergen challenge in sensitized mice stops Th2 cytokine production, IgE synthesis, and the infiltration of eosinophils. The same group provided additional evidence for the role of mDCs in the late phase allergic immune response. Relevant allergen challenge in OVA‐sensitized mice caused an almost 100‐fold increase in of myeloid DCs in the airways. This was accompanied by an increase in the bone marrow of early myeloid progenitors which may be related to a rise in serum eotaxin.29 Whether these observations are specific for mDC is unclear, since a similar set of experiments has not been conducted for pDC. Animal studies did show that pDCs were important for the maintenance of tolerance to inhaled harmless antigen.30 By depleting pDCs using a pDC‐specific antibody, inhalation to otherwise inert OVA led to the development of the typical histological features of asthma; goblet cell hyperplasia, airway hypereosinophilia, Th2 cytokine secretion, and IgE production. When allergen‐ pulsed pDCs were transferred prior to sensitization, it was no longer possible to induce these responses.

Dendritic cells in human airway mucosa Animal studies provide us with important data about the function of DCs in allergic airway inflammation, but for obvious reasons these animal studies cannot be repeated in humans. The exact function of the different human DC subsets in the sensitization and maintenance of allergic airway disease is therefore less clear. Instead of functional analysis, most human studies have focused on the dynamics of DC subsets.

Immunohistochemical stainings of human lung parenchyma and nasal mucosa by multiple authors have identified both mDCs (CD11c+HLA‐DR+), LCs (CD1a+), and pDCs (CD123+).31‐36 It is not fully clear whether these DC subsets reside in the human airway or enter after stimulation.

Recently, three lung DC subsets that are also present in the peripheral blood were described, together with some of their functional characteristics.33,37‐39 Single‐cell suspensions obtained from surgical resection specimens of normal human lung parenchyma identified the two myeloid DC subsets (CD11c+/BDCA‐1+ and CD11c+/BDCA‐3+), and one plasmacytoid DC subset (CD123+BDCA‐2+).33 The authors also showed that the majority of CD1c+DC also express CD1a and that there are small populations of CD1a+CD1c‐ DCs and CD1a‐CD1c+ DCs. Unfortunately, no data was presented on additional LC markers such as E‐cadherin, Langerin, or the presence of Birbeck granules, so that the identity of these cells could not be firmly established. This is relevant as it has been shown in human skin that CD1a and CD1c are both present on one homogenous population of LCs.40

Introduction: Interactions between epithelial cells and Dendritic cells in airway immune responses

15

Experiments with purified DC populations from surgical specimens have shown that both pulmonary myeloid DCs express mRNA TLR transcripts (TLR1, TLR2, TLR3, TLR4, TLR6, and TLR8) and that both cell types release pro inflammatory cytokines (TNF‐α, IL‐1β, IL‐6, and IL‐8) in response to TLR2 and TLR4 ligands. No expression of IL‐10 or IL‐12 has been detected. Although both cell types also express TLR3, specific ligands induce cytokine release in BDCA‐1+ pulmonary DCs, but not in BDCA‐3+ pulmonary DCs. In contrast, pDC express only TLR7 and TLR9 and these receptors seem functional.

Isolated pDCs release pro inflammatory cytokines in response to imiquimod (TLR7) and IFN‐α in response to CpG oligonucleotides (TLR9). In a mixed lymphocyte reaction pulmonary BDCA‐1+ DCs were shown to be strong inducers of T cell proliferation, while pDCs hardly induce any T cell proliferation. BDCA‐3+ pulmonary DCs have an intermediate T cell–stimulatory capacity.39 These results reveal potential divergent roles for the different human lung DC subsets.

Recently, Kleinjan showed that in symptomatic patients with perennial allergic rhinitis (PAR), the number of myeloid DCs (CD11c+/MHCII+) is higher in the epithelium and lamina propria of the nasal mucosa than in healthy control subjects.41 Moreover, these DCs had a more activated (CD86+) phenotype and were found in close proximity to T lymphocytes, although the implications of this last observation are not clear. The authors ascribe the differences in DC numbers between PAR patients and health controls to constant exposure to the relevant antigen, which is thought to induce a persistent inflammation. A similar picture emerges for BDCA‐1+ myeloid DC (BDCA‐ 1/CD1c+HLA‐DR+) in the lungs of asthmatic patients. Compared to baseline in asthmatic subjects, a rapid increase (within 4‐5 hours) in the number of BDCA‐1+ myeloid DC was observed in the lamina propria after allergen challenge.42 The rapid accumulation of these cells strongly suggests that they are directly recruited from peripheral blood and not formed locally from a resident precursor cell. There is also a dynamic influx of myeloid Langerhans cells after allergen exposure. Increased numbers of CD1a+ cells were found in the mucosa of symptomatic allergic patients with seasonal allergic rhinitis (SAR) after nasal allergen challenge43,44 and in patients with perennial rhinitis.41 As well as myeloid DCs, plasmacytoid DCs also exhibit a dynamic behaviour in allergic disease, although some inconsistencies have been observed for this cell type. Jahnsen et al. succeeded in showing changes in pDCs, whereas KleinJan et al. did not. Patients with SAR were challenged topically out of season with relevant allergen daily for 7 days.34 Biopsy specimens were obtained before and during such provocation and pDCs were identified in biopsy specimens through their high levels of CD123 expression. pDCs were present in low and variable numbers in normal nasal mucosa from unchallenged allergic, and non‐allergic, individuals, but cell numbers increased dramatically only after daily provocations for 7 days in allergic subjects and not after shorter exposures as compared to non‐allergic subjects. These observations contradict a study of the lower airways by the same authors, where no significant recruitment of pDCs was observed in the lung just 4‐5 hours after allergen challenge.42 Nor was any increase in the number of CD123+ cells detected at baseline in comparison of nasal

Chapter 1

16

biopsies from PAR patients and healthy individuals.41 Unfortunately, this study provided no data about the effect of allergen provocation, but the author’s assumption was that all subjects received maximum exposure to HDM as biopsies were taken during the winter when the house dust mite is most prevalent. It remains to be seen whether this assumption is correct since, in a house dust mite provocation model, nasal provocation can induce a clear exacerbation of nasal complaints.45 Other reasons for the discrepancies between the studies could be the different types (seasonal versus perennial) of allergic rhinitis patients. Perennial allergic rhinitis results in chronic nasal inflammation which may result in a different inflammatory microenvironment than that found in acutely‐induced inflammation seen in SAR patients. The second explanation may be the different time points at which the biopsies were taken by the different groups, since Jahnsen has shown that induction may need several days of constant (high) allergen exposure.

In summary, the above observations from animal studies complemented with data from human studies, suggest that myeloid and plasmacytoid DCs play a specific role in the allergic sensitization and the maintenance of allergic inflammation, both in asthma and allergic rhinitis. Less is known about the specific function of LCs in the human airway mucosa, but future functional research should not be restricted to the role of LCs in allergic airway disease since many open questions remain also remain to be answered with respect to the roles of mDCs and pDCs.

The airway epithelium Although airway DCs are believed to be the conductor of immunological response, there is a growing awareness that these cells are activated in the context of a mucosal environment where their function is likely to be influenced by the presence of local immunomodulatory signals. A substantial proportion of these signals originate in the airway epithelium. The outer lining of the mucosa not only plays a passive role as a physical barrier between the internal and external environment, it should also be seen as an active component of the mucosal defense system.

We are constantly exposed to air pollutants, airborne allergens, and (non)‐pathogenic micro‐organisms.46 The majority of these environmental factors are mechanically removed by the mucociliary system, which consists of mucus containing glycoproteins, lysozymes and ciliated epithelial cells. Even when particles are not removed they are not free to enter the local mucosal tissue as the mucosal epithelium forms a second physical barrier due to the presence of apically‐located tight junctions (TJs) between adjacent epithelial cells. In addition to their passive role as a barrier, the epithelial cells are also able to respond to the environmental factors by expressing specific receptors, resulting in the release of pro‐ and anti‐inflammatory cytokines and chemokines.

Airway epithelial cells express PRRs that recognize components of micro‐organisms (Toll‐like receptors) or protease activated receptors (PAR) that can interact with specific

Introduction: Interactions between epithelial cells and Dendritic cells in airway immune responses

17

components of allergens.47‐50 Airway epithelial cells express mRNA for the TLRs1‐647 and can respond to various stimuli such as viruses, bacteria and cytokines, resulting in the expression of different pro‐ and anti‐inflammatory cytokines and chemokines and the modulation of the immune response. Stimulation of TLR3 by poly(I:C) resulted in the increased secretion of IL‐6, IL‐8, TNF‐alpha, GM‐CSF, GRO‐alpha, TARC, MCP‐1, MIP‐ 3alpha, RANTES, IFN‐beta and IP‐10.47 It is not known at present to what degree different expression levels and triggering of PRRs influence the nature of the induction of an airway immune response. As mentioned earlier, TLR‐mediated activation and TLR‐mediated MHC‐peptide seems crucial for the induction of an antigen specific T‐cell response.24,25 This suggests that epithelial cells have a modulatory function in the airway immune response. Another interesting subject is the regulation of the expression of these receptors in epithelial cells and whether they are expressed differently in healthy and allergic subjects.

Epithelial cells also respond to stress conditions – for example, environmental pollutants such as Diesel Exhaust Particles (DEP), particulate matter (PM), and cigarette smoke ‐ by releasing a variety of cytokines.51,52 Studies have shown that epithelial cells stimulated with DEPs release cytokines such as IL‐6, IL‐8, GM‐CSF, and sICAM.51 The exposure of epithelial cells from allergic subjects to DEPs and tobacco contributed to a greater constitutive and pollutant‐induced release of pro‐inflammatory chemokines.53 Epithelial cells may therefore play an important role in mediating the effects of air pollutants on the inflammatory response in the airways. The precise mechanism of activation, however, has not been fully elucidated.

Airway epithelium therefore not only functions as a mechanical barrier. It can also respond to viral and bacterial pathogens or stress conditions by releasing chemokines and cytokines, and therefore playing an active role in the airway immune response.

Pathways of antigen uptake in the respiratory tract Even though it is clear that the concept of the epithelium as a physical barrier will have consequences for the entry of antigens, only a few studies have tried to address the question of allergen uptake by tissue‐resident DCs. As a consequence the exact mechanism of antigen uptake remains poorly understood. The classical concept was that the epithelial barrier needed to be disrupted for antigen to reach DCs. This would seem to hold true for the skin. However, in the case of mucosal surface, it was discovered that DCs can sample the environment without disrupting the epithelial barrier.54 This characteristic of DCs could reflect the daily exposition to numerous antigens and pathogens which pass the mucosal surface without the presence of a mucosal inflammation.

Several mechanisms have been proposed for antigens or allergens to reach DCs. Der p1, one of the major components of house dust mite (HDM) was shown to cleave the tight junction adhesion protein occludin by means of the allergen’s own proteolytic activity.

Chapter 1

18

TJ breakdown increases epithelial permeability nonspecifically, allowing Der p1 to cross the epithelial barrier. The transepithelial movement of Der p1 to DCs via the paracellular pathway may therefore be advanced by the allergen's own proteolytic activity.55 Takano demonstrated a different way for DCs to sample allergen without disrupting the TJs. In biopsies taken from human allergic subjects HLA‐DR+ and CD11c+ DCs expressed claudin‐1 and penetrated beyond occludin in the epithelium of the nasal mucosa.53 Interestingly, this process was only seen in allergic individuals, and not in healthy ones. This observation was also made in an experimental model. Using a gut epithelial cell line‐based in vitro co‐culture system, DCs were shown to extend their dendrites across the epithelial barrier by means of the inducible expression of the tight junction proteins occluding, claudin 1, and zonula occludens 1.54 Moreover, in mice an epithelial CD103 (alphaE)‐beta7 integrin‐positive DC population expressing high levels of the LC‐marker Langerin and the tight junction proteins Claudin‐1, Claudin‐7, and ZO‐ 2 was described.56 And finally, using a three dimensional reconstruction of immuno fluorescence staining of the airway mucosa of rats, 1‐5 % of all intra‐epithelial DCs were shown to project cellular extensions between epithelial cells to the apical surface.57 These in vitro and ex vivo data imply a strong physical connection between epithelial cell and DC; tight junctions are formed to maintain the integrity of the epithelial barrier, while DCs are allowed to sample antigen at the mucosal surface by extending dendrites to the apical lumen. It is unclear whether this sampling process occurs spontaneously, but there is some evidence that it requires the expression of the fractalkine receptor CX3CR1.58 This sampling of the exterior environment without disrupting epithelial integrity opens up a possible role for DCs in preparing for potential invasive pathogens prior to entry.

Airway DCs are therefore able to open the TJ between epithelial cells by extending their dendrites like a periscope to the lumen to sample the environment. These mechanisms proposed for the airway and gastro‐intestinal tract suggest an active role for epithelial cells in the uptake of antigen. It still remains to be determined whether the DC‐epithelial cell interactions in the uptake of antigen across the mucosal surface in the gastro‐intestinal tract also hold true for the respiratory tract. Whether, and to what extent, airway epithelial cells are actively involved in the antigen uptake by DCs in the airway are issues requiring further investigation, since they may yield important information about the development of an airway immune response.

Epithelial cells and DCs: direct interactions The discussion above looked at the formation of tight junctions as one example of what is believed to be mainly a structural epithelial cell‐DC interaction. However, DCs also interact with epithelial cells by expressing of adhesion molecules that not only anchor them strongly in the epithelium, but also have a possible effect on their function.

Introduction: Interactions between epithelial cells and Dendritic cells in airway immune responses

19

Intercellular adhesion molecule (ICAM) is expressed by epithelial cells and this molecule can bind leukocyte function associated molecule‐1 (LFA‐1) expressed by immature DCs.59 Epithelial cells in patients with allergic rhinitis and asthma express increased levels of ICAM.60 The expression of ICAM by epithelial cells is regulated indirectly by the inflammatory cytokines TNF‐α and IL‐161 or directly by interaction with bacteria and viruses.62 The same interaction between ICAM‐1/LFA‐1 is known to support adhesion between DC and T cells, where it is involved in the induction of Th1 responses.63,64 It is not known whether the ICAM‐1/LFA‐1 interaction between epithelial cells and DCs has a similar functional effect. Another adhesion molecule which could be important in DC‐ epithelial cell contact is E‐cadherin. E‐cadherin is expressed by bronchial epithelial cells and immature DCs.65 Importantly, E‐cadherin needs to be down regulated for DCs to leave the epithelium to transfer to the lymph node.66 Immature DCs expressing both LFA‐1 and E‐cadherin are therefore able to bind epithelial cells at the site of allergen entrance. No proof has been found to date that this binding takes place in airway mucosa. Nor is it known whether these interactions are purely structural or whether they have functional consequences for DC function. In addition to adhesion, ICAM/LFA‐1 interaction could also play an important role in the activation of tissue resident DCs by epithelial cells and contribution to the airway immune response.

Epithelial cells and DCs: DC recruitment by the production of epithelial chemokines The exposure of epithelial cells to environmental factors triggers the expression of chemokines involved in recruitment of inflammatory cells including DCs.67‐69 For instance, stimulation of epithelial cells with different allergen extracts results in the production of the chemokines IL‐8/CXCL8, RANTES/CCL5 (Regulated upon Activation T‐ cell derived and Secreted), and TARC/CCL17 (Thymus and Activation‐Regulated Chemokine). All these factors are critical in the chemotaxis of neutrophils, eosinophils, mast cells, and lymphocytes.67‐69 When we focus on DCs, there is increasing evidence that the production of chemokines by epithelial cells is also responsible for the recruitment of DCs from the peripheral circulation into the airway mucosa. The study of Reibman et al.70 shows that primary bronchial epithelial cell cultures secrete MIP3α/CCL20 after stimulation with pro‐ inflammatory cytokines and particulate matter (PM). As CCL20 is the unique ligand for CCR6 expressed by immature Langerhans’ cells (LC), this study hypothesized that airway epithelial cells are involved in the recruitment of immature DCs to the mucosal tissue.

In addition to CCL20, epithelial cells also produce other chemokines involved in DC recruitment. Pichavant and co‐workers showed allergen‐induced expression of CCL‐2 (MCP‐1), CCL5 (RANTES), and C‐X‐C chemokine ligand 10 (IP‐10) by BEAS‐2B (human bronchial epithelial cell line) and primary bronchial epithelial cells. The activity of these

Chapter 1

20

chemokines was reflected in the increased recruitment of monocyte‐derived DC precursors in the mucosa of both healthy and allergic individuals. This effect was also seen in vitro, where apical application of Der p1 to reconstituted polarized epithelium enhanced monocyte derived DC precursor migration into the epithelial layer.

Interestingly, the relative contribution of epithelium to DC recruitment depended on the DC subtype being investigated. Derp1 stimulation of bronchial epithelial cells from patients with asthma, but not from controls, increased the migration of LC precursors, which is mainly dependent on CCL20 secretion.71 Other factors produced by epithelium involved in the recruitment of DCs could be CCL13/ MCP‐4 or eotaxin but also neuropeptides and complement factors.29,72‐75 In summary, these data demonstrate the role of lung epithelial cells in the recruitment of immature DCs, and specifically the role of epithelial cells of allergic individuals, through the production and release of chemotactic chemokines. Research is required into the regulation and expression patterns of the specific receptors on DCs in the airway mucosa involved in this process.

Epithelial cells and DC: epithelial factors modulating DC function Cytokines are key regulators of the differentiation or activity of immuno‐competent cells and as such they play an important role in normal and pathological immune responses. Epithelial cells express at baseline or after exposure to environmental factors known to modulate the function of DCs. Over the years a substantial part of the research in this field has focussed on the classical factors GM‐CSF, TNF‐α, IL‐1, Prostaglandin E2 (PGE2), and TGF‐β. The combined exposure of LCs to TNF‐α and IL‐1 is an essential step in LC activation and LC migration out of the tissue toward the draining lymph nodes,77 while GM‐CSF and TGF‐ β are required for the differentiation of DCs from their precursors.6 PGE2 is not involved in the activation of DCs, but rather in the modulation of their function by down‐regulating the production of pro‐inflammatory cytokines, such as IL‐8, IL‐12, MCP‐1, and GM‐CSF.77‐79 Recently, TSLP has been put in the spotlight, as this factor is considered to be responsible for the Th2‐skewing of immune responses and the pathogenesis of allergic disease. TSLP will be discussed in more detail further on.

Bronchial alveolar and nasal lavages from patients with asthma and allergic rhinitis80 and primary bronchial epithelial cell cultures from asthmatics show increased levels of IL‐1, GM‐CSF, and TNF‐ α compared to healthy subjects. Through the expression of these cytokines epithelial cells are able to modulate DC function. The increased expression of these cytokines appears to be directly related to allergen exposure.

Airway epithelium can interact directly with allergen as shown by the release of IL‐8, eotaxin, and GM‐CSF after the stimulation of the proteinase‐activated receptor (PAR)‐2 by the house dust mite allergens Der p1, Der p3, and Der p9.48‐50 The increased PAR‐2

Introduction: Interactions between epithelial cells and Dendritic cells in airway immune responses

21

receptor expression in bronchial epithelium from asthmatics and the increased epithelial expression upon allergen exposure possibly accounts for the higher mediator levels seen in bronchial or nasal lavages.81‐83 The consequences of this epithelial cell activation for DC function remain to be determined.

A cytokine that has been spotlighted in the allergic immune response is TSLP. TSLP is a novel IL‐7 like cytokine which is produced by epithelial cells, keratinocytes, stromal cells, and mast cells.84 The interest in TSLP was triggered by its ability to activate human immature myeloid DCs, resulting in the induction of CD4+ T cell responses with a proallergic phenotype.85 High levels of TSLP are expressed by human keratinocytes of atopic dermatitis patients, but not in other, non‐allergic, types of skin inflammation.84 In situ hybridisation techniques have been used to show that higher levels of TSLP are expressed in the bronchial mucosa/sub mucosa of asthmatic patients compared to healthy controls.86 In Th1‐mediated pathology in inflammatory bowel diseases such as Crohn disease TSLP mRNA was undetectable, whereas epithelial cells isolated from human healthy colon expressed TSLP constitutively.87 These data suggest a role for TSLP in the induction of an allergic immune response via the stimulation of myeloid DCs. Even though TSLP has a broader spectrum of action in mice, in which it stimulates the growth and differentiation of pre‐B‐cells, peripheral CD4+T‐cells, and myeloid DCs, the studies in mice confirm the human data.88 In a murine, lung‐specific model, over‐expression of TSLP induced allergic airway inflammation that was characterized by infiltration of eosinophils and Th2 cells.89 In addition, it was demonstrated that TSLP induced pro‐allergic Th2 response from naïve precursors, whilst inhibiting Th1‐associated (IFN‐gamma) or Treg‐associated (IL‐10) cytokine production. Furthermore, an in vivo allergic inflammatory model revealed that TSLPR‐KO mice demonstrated a profound reduction of inflammation in the lungs after OVA‐sensitisation.90 Rescigno et al. suggested that the working spectrum of TSLP could be dose‐dependent.

By using MoDCs and medium from bacteria‐treated epithelial cells they showed that a narrow window of TSLP concentrations (0.07 ‐ 0.15 ng/ml) inhibits IL‐12 secretion (i.e. stimulate a Th2 response). When the concentrations were outside the window, DCs were able to promote IFN‐γ producing T‐cells (i.e. stimulate a Th1 response).89 Because expression of TSLP appears to be very important in the induction of a Th2 allergic immune response, the regulation of TSLP expression has been investigated recently. A role for retinoic acid signalling in the expression of TSLP was shown in epidermal keratinocytes of the mouse.91 In human airways the expression of TSLP is triggered by activation of TLR3 by dsRNA, by infection with rhinovirus, and by stimulation with Th2 cytokines.92 Regulation of TSLP expression involves NF‐kappaB and IFN regulatory factor 3 (IRF‐3) signalling via TLR3.93‐94 IL‐4 and dsRNA have a synergistic effect on the TSLP production and suggest an amplification of Th2 inflammation via the induction of TSLP in the asthmatic airway. This is a rather surprising observation as poly(I:C) stimulation and rhinovirus infection result in the induction of a Th1‐type immune response.

Chapter 1

22

Whether TSLP is a crucial epithelial factor in the development of allergic airway diseases like asthma and allergic rhinitis is an issue requiring further investigation. The immunohistochemical staining of biopsies from healthy and allergic subjects will give us an initial idea of whether expression levels of TSLP are related to allergic disease. It also will give us the opportunity to confirm the correlation observed between TSLP expression and disease severity in asthmatics.

In summary these data show that airway epithelial factors have an important modulating role in DC function, differentiation, and maturation. An area of study that has been poorly explored is the role of epithelial cells in the inhibition of DC function, even though it has been reported that epithelial cells produce the immuno‐repressive cytokines IL‐10 and TGF‐β. This role is suggested by the observation that a co‐culture of monocyte‐derived DC with Caco‐2 intestinal epithelial monolayers resulted in DC with reduced expression of MHC class II, CD86, and CD80, and poor T cell stimulatory capacity. Cytokine profiles showed reduced levels of inflammatory cytokine production, and co‐cultured DCs were less sensitive to stimulation via Toll‐like receptors (TLR2, TLR4, and TLR6) as a result of increased levels of autocrine TGF‐β production.95 Using a similar approach, commensal bacteria were also shown to mediate a tolerizing effect on the gut mucosal immune response.87,96 Future studies should aim to identify epithelial cell‐derived tolerizing factors and investigate the regulation of these factors both in healthy and allergic individuals.

Conclusion During the last years it has become clear that epithelial cells play an important role in the modulation of immune response in the airways (Figure 1.1). DCs can bind the epithelial cells through the expression of adhesion molecules and tight junction molecules which allow them to sample the mucosal surface without disrupting the mucosal integrity. The exact mechanism of antigen uptake by mucosal DCs across the epithelial barrier is not fully understood, but an active role for epithelial cells is proposed.

The activation of airway epithelial cells with different antigens/allergens not only induces the expression of chemokines resulting in the recruitment of immature DCs, but also creates an immunomodulatory micro‐environment in which immature DCs exert their function. In the last decade, the characterization of the different DC subsets in human nasal and lung mucosa has taught us more about the presence and kinetics of DC subpopulations. With the help of new specific blood DC (BDC) markers and others we will be able to characterize these specific subsets of DCs in further detail. To prevent difficulties in comparing studies, future research should aim to study both healthy and allergic subjects (seasonal or perennial) before and after the relevant allergen provocation. This will give us a detailed picture of the presence and function of

Introduction: Interactions between epithelial cells and Dendritic cells in airway immune responses

23

potential different subtypes of DCs in the way that previous experiments have done for peripheral blood.

Figure 1.1

Activation of airway epithelial cells with different antigens/allergens not only induces the expression of chemokines resulting in recruitment of immature DCs but also creates a immuno modulatory micro‐environment in which immature DCs take up antigen. A concept emerges where mucosal DCs act as integrators of both immuno stimulatory and immunosuppressive signals that act within an actively involved mucosal tissue.

The cytokine/chemokine milieu created by the airway epithelium should be considered as a co‐factor in the pathogenesis of allergic airway disease and as part of the normal airway immune responses. The interaction between airway epithelial cells and DCs deserves further attention. It is therefore crucial to study the contribution of epithelial cells and their role in the sensitization and maintenance of allergic airway disease is crucial. Emphasis should be placed on the use of primary tissue culture systems from healthy and allergic individuals to mimic the in vivo situation.

Chapter 1

24

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

Ye P, Rodriguez FH, Kanaly S, Stocking KL, Schurr J, Schwarzenberger P, Oliver P, Huang W, Zhang P, Zhang J, Shellito JE, Bagby GJ, Nelson S, Charrier K, Peschon JJ, Kolls JK. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony‐stimulating factor expression, neutrophil recruitment, and host defense. J Exp Med 2001;194:519‐527.

Weiner HL. Induction and mechanism of action of transforming growth factor‐beta‐secreting Th3 regulatory cells. Immunol Rev 2001;182:207‐214.

Roncarolo MG, Bacchetta R, Bordignon C, Narula S, Levings MK. Type 1 T regulatory cells. Immunol Rev 2001;182:68‐79.

Shortman K, Liu YJ. Mouse and human dendritic cell subtypes. Nat Rev Immunol 2002;2:151‐161.

Liu YJ. Dendritic cell subsets and lineages, and their functions in innate and adaptive immunity. Cell 2001;106:259‐262. del Hoyo GM, Martin P, Vargas HH, Ruiz S, Arias CF, Ardavin C. Characterization of a common precursor population for dendritic cells. Nature 2002;415:1043‐1047.

Spits H, Couwenberg F, Bakker AQ, Weijer K, Uittenbogaart CH. Id2 and Id3 inhibit development of CD34(+) stem cells into predendritic cell (pre‐DC)2 but not into pre‐DC1. Evidence for a lymphoid origin of pre‐DC2. J Exp Med 2000; 192:1775‐1784.

Kalinski, P., Hilkens, C. M., Wierenga, E. A. & Kapsenberg, M. L. T‐cell priming by type‐1 and type‐2 polarized dendritic cells: the concept of a third signal. Immunol Today 1999;20:561–567.

Jarrossay D, Napolitani G, Colonna M, Sallusto F, Lanzavecchia A. Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells. Eur J Immunol 2001; 31:3388‐3393.

Kadowaki, N., Antonenko, S., Lau, J. Y. & Liu, Y. J. Natural interferon α /β‐producing cells link innate and adaptive immunity. J Exp Med 2000;192:219–226.

Maldonado‐Lopez, R., Maliszewski, C., Urbain, J. & Moser, M. Cytokines regulate the capacity of CD8α+ and CD8α– dendritic cells to prime TH1/TH2 cells in vivo. J Immunol 2001;167:4345–4350. van der Kleij D, Latz E, Brouwers JF, Kruize YC, Schmitz M, Kurt‐Jones EA, Espevik T, de Jong EC, Kapsenberg ML, Golenbock DT, Tielens AG, Yazdanbakhsh M. A novel host‐parasite lipid cross‐talk.

Schistosomal lyso‐phosphatidylserine activates toll‐like receptor 2 and affects immune polarization. J Biol Chem 2002;277:48122‐48129.

Kadowaki N, Ho S, Antonenko S, Malefyt RW, Kastelein RA, Bazan F, Liu YJ. Subsets of human dendritic cell precursors express different toll‐like receptors and respond to different microbial antigens. J Exp Med 2001;194:863‐869.

Kaisho T, Akira S. Regulation of dendritic cell function through toll‐like receptors. Curr Mol Med 2003; 3:759‐771.

Heil F, Hemmi H, Hochrein H, Ampenberger F, Kirschning C, Akira S, Lipford G, Wagner H, Bauer S. Species‐specific recognition of single‐stranded RNA via toll‐like receptor 7 and 8. Science 2004;303:1526‐1529.

Cella M, Jarrossay D, Facchetti F, Alebardi O, Nakajima H, Lanzavecchia A, Colonna M. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med 1999;5:919‐923.

Gilliet M, Liu YJ. Generation of human CD8 T regulatory cells by CD40 ligand‐activated plasmacytoid dendritic cells. J Exp Med 2002;195:695‐704. van der Aar AM, Sylva‐Steenland RM, Bos JD, Kapsenberg ML, de Jong EC, Teunissen MB. Loss of TLR2, TLR4, and TLR5 on Langerhans cells abolishes bacterial recognition. J Immunol 2007;178:1986‐1990).

Peiser M, Koeck J, Kirschning CJ, Wittig B, Wanner R. Human Langerhans cells selectively activated via Toll‐like receptor 2 agonists acquire migratory and CD4+T cell stimulatory capacity. J Leukoc Biol 2008; 83(5):1118‐27.

Agrawal S, Agrawal A, Doughty B, Gerwitz A, Blenis J, Van Dyke T, Pulendran B. Cutting edge: different Toll‐like receptor agonists instruct dendritic cells to induce distinct Th responses via differential modulation of extracellular signal‐regulated kinase‐mitogen‐activated protein kinase and c‐Fos. J Immunol 2003;171:4984‐4989.

Introduction: Interactions between epithelial cells and Dendritic cells in airway immune responses

25

21. Didierlaurent A, Ferrero I, Otten LA, Dubois B, Reinhardt M, Carlsen H, Blomhoff R, Akira S, Kraehenbuhl JP, Sirard JC. Flagellin promotes myeloid differentiation factor 88‐dependent development of Th2‐type response. J Immunol 2004;172:6922‐6930.

22. Eisenbarth SC, Piggott DA, Huleatt JW, Visintin I, Herrick CA, Bottomly K. Lipopolysaccharide‐enhanced, toll‐like receptor 4‐dependent T helper cell type 2 responses to inhaled antigen. J Exp Med 2002;196:1645‐1651.

23. Kapsenberg ML. Dendritic‐cell control of pathogen‐driven T‐cell polarization. Nat Rev Immunol 2003;3: 984‐993.

24. Sporri R, Reis e Sousa C. Inflammatory mediators are insufficient for full dendritic cell activation and promote expansion of CD4+ T cell populations lacking helper function. Nat Immunol 2005;6:163‐170.

25. Blander JM, Medzhitov R. Toll‐dependent selection of microbial antigens for presentation by dendritic cells. Nature 2006;440:808‐812.

26. Lambrecht BN, Pauwels RA, Fazekas De St Groth B. Induction of rapid T cell activation, division, and recirculation by intratracheal injection of dendritic cells in a TCR transgenic model. J Immunol 2000;164:2937‐2946.

27. Lambrecht BN, De Veerman M, Coyle AJ, Gutierrez‐Ramos JC, Thielemans K, Pauwels RA. Myeloid dendritic cells induce Th2 responses to inhaled antigen, leading to eosinophilic airway inflammation. J Clin Invest 2000; 106:551‐559.

28. Lambrecht BN, Salomon B, Klatzmann D, Pauwels RA. Dendritic cells are required for the development of chronic eosinophilic airway inflammation in response to inhaled antigen in sensitized mice. J Immunol 1998;160:4090‐4097.

29. van Rijt LS, Prins JB, Leenen PJ, Thielemans K, de Vries VC, Hoogsteden HC, Lambrecht BN. Allergen‐ induced accumulation of airway dendritic cells is supported by an increase in CD31(hi)Ly‐6C(neg) bone marrow precursors in a mouse model of asthma. Blood 2002;100:3663‐3671.

30. de Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA, Hoogsteden HC, Lambrecht BN. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. J Exp Med 2004; 200:89‐98.

31. Sertl K, Takemura T, Tschachler E, Ferrans VJ, Kaliner MA, Shevach EM. Dendritic cells with antigen‐ presenting capability reside in airway epithelium, lung parenchyma, and visceral pleura. J Exp Med 1986;163:436‐451.

32. Fokkens WJ, Vroom TM, Rijntjes E, Mulder PG. CD‐1 (T6), HLA‐DR‐expressing cells, presumably Langerhans cells, in nasal mucosa. Allergy 1989;44:167‐172.

33. Demedts IK, Brusselle GG, Vermaelen KY, Pauwels RA. Identification and characterization of human pulmonary dendritic cells. Am J Respir Cell Mol Biol 2005;32:177‐184.

34. Jahnsen FL, Lund‐Johansen F, Dunne JF, Farkas L, Haye R, Brandtzaeg P. Experimentally induced recruitment of plasmacytoid (CD123high) dendritic cells in human nasal allergy. J Immunol 2000;165:4062‐4068.

35. Bellini A, Vittori E, Marini M, Ackerman V, Mattoli S. Intraepithelial dendritic cells and selective activation of Th2‐like lymphocytes in patients with atopic asthma. Chest 1993;103:997‐1005.

36. Valladeau J, Duvert‐Frances V, Pin JJ, Dezutter‐Dambuyant C, Vincent C, Massacrier C, Vincent J, Yoneda K, Banchereau J, Caux C, Davoust J, Saeland S. The monoclonal antibody DCGM4 recognizes Langerin, a protein specific of Langerhans cells, and is rapidly internalized from the cell surface. Eur J Immunol 1999;29:2695‐2704.

37. Dzionek A, Fuchs A, Schmidt P, Cremer S, Zysk M, Miltenyi S, Buck DW, Schmitz J. BDCA‐2, BDCA‐3, and BDCA‐4: three markers for distinct subsets of dendritic cells in human peripheral blood. J Immunol 2000;165:6037‐6046.

38. MacDonald KP, Munster DJ, Clark GJ, Dzionek A, Schmitz J, Hart DN. Characterization of human blood dendritic cell subsets. Blood 2002;100:4512‐4520.

39. Demedts IK, Bracke KR, Maes T, Joos GF, Brusselle GG. Different roles for human lung dendritic cell subsets in pulmonary immune defense mechanisms. Am J Respir Cell Mol Biol 2006;35:387‐393 40. Peiser M, Grützkau A, Wanner R, Kolde G. CD1a and CD1c cell sorting yields a homogeneous population of immature human Langerhans cells. J Immunol Methods 2003;279:41‐53.

41. KleinJan A, Willart M, van Rijt LS, Braunstahl GJ, Leman K, Jung S, Hoogsteden HC, Lambrecht BN. An essential role for dendritic cells in human and experimental allergic rhinitis. J Allergy Clin Immunol 2006;118:1117‐1125.

Chapter 1

26

42. Jahnsen FL, Moloney ED, Hogan T, Upham JW, Burke CM, Holt PG. Rapid dendritic cell recruitment to the bronchial mucosa of patients with atopic asthma in response to local allergen challenge. Thorax 2001;56:823‐826 43. Fokkens WJ, Broekhuis‐Fluitsma DM, Rijntjes E, Vroom TM, Hoefsmit EC. Langerhans cells in nasal mucosa of patients with grass pollen allergy. Immunobiology 1991;182:135‐142.

44. Godthelp T, Fokkens WJ, Kleinjan A, Holm AF, Mulder PG, Prens EP, Rijntes E. Antigen presenting cells in the nasal mucosa of patients with allergic rhinitis during allergen provocation. Clin Exp Allergy 1996;26:677‐688.

45. Oldenbeuving NB, KleinJan A, Mulder PG, Lumley P, de Groot EJ, van Drunen CM, Fokkens WJ. Evaluation of an intranasal house dust mite provocation model as a tool in clinical research. Allergy 2005;60:751‐759.

46. Folkerts G, Nijkamp FP. Airway epithelium: more than just a barrier! Trends Pharmacol Sci 1998;19: 334‐341.

47. Ritter M, Mennerich D, Weith A, Seither P. Characterization of Toll‐like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll‐like receptors, adaptor proteins and inflammatory response. J Inflamm (Lond) 2005;2:16.

48. Vliagoftis H, Befus AD, Hollenberg MD, Moqbel R. Airway epithelial cells release eosinophil survival‐ promoting factors (GM‐CSF) after stimulation of proteinase‐activated receptor 2. J Allergy Clin Immunol 2001;107:679‐685.

49. Asokananthan N, Graham PT, Stewart DJ, Bakker AJ, Eidne KA, Thompson PJ, Stewart GA. House dust mite allergens induce proinflammatory cytokines from respiratory epithelial cells: the cysteine protease allergen, Der p 1, activates protease‐activated receptor (PAR)‐2 and inactivates PAR‐1.J Immunol 2002;169:4572‐4578.

50. Sun G, Stacey MA, Schmidt M, Mori L, Mattoli S. Interaction of mite allergens Der p3 and Der p9 with protease‐activated receptor‐2 expressed by lung epithelial cells. J Immunol 2001;167:1014‐1021.

51. Terada N, Hamano N, Maesako KI, Hiruma K, Hohki G, Suzuki K, Ishikawa K, Konno A. Diesel exhaust particulates upregulate histamine receptor mRNA and increase histamine‐induced IL‐8 and GM‐CSF production in nasal epithelial cells and endothelial cells. Clin Exp Allergy 1999;29:52‐59.

52. Roberts JW, Dickey P. Exposure of children to pollutants in house dust and indoor air. Rev Environ Contam Toxicol 1995;143:59‐78.

53. Takano K, Kojima T, Go M, Murata M, Ichimiya S, Himi T, Sawada N. HLA‐DR‐ and CD11c‐positive dendritic cells penetrate beyond well‐developed epithelial tight junctions in human nasal mucosa of allergic rhinitis. J Histochem Cytochem 2005;53:611‐619 54. Rescigno M, Urbano M, Valzasina B, Francolini M, Rotta G, Bonasio R, Granucci F, Kraehenbuhl JP, Ricciardi‐Castagnoli P. Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nat Immunol 2001;2:361‐367.

55. Wan H, Winton HL, Soeller C, Tovey ER, Gruenert DC, Thompson PJ, Stewart GA, Taylor GW, Garrod DR, Cannell MB, Robinson C. Der p 1 facilitates transepithelial allergen delivery by disruption of tight junctions. J Clin Invest 1999;104:123‐133.

56. .Sung SS, Fu SM, Rose CE Jr, Gaskin F, Ju ST, Beaty SR. A major lung CD103 (alphaE)‐beta7 integrin‐ positive epithelial dendritic cell population expressing Langerin and tight junction proteins. J Immunol 2006;176:2161‐2172.

57. Jahnsen FL, Strickland DH, Thomas JA, Tobagus IT, Napoli S, Zosky GR, Turner DJ, Sly PD, Stumbles PA, Holt PG. Accelerated antigen sampling and transport by airway mucosal dendritic cells following inhalation of a bacterial stimulus. J Immunol 2006;177:5861‐5867.

58. Niess JH, Brand S, Gu X, Landsman L, Jung S, McCormick BA, Vyas JM, Boes M, Ploegh HL, Fox JG, Littman DR, Reinecker HC. CX3CR1‐mediated dendritic cell access to the intestinal lumen and bacterial clearance. Science 2005;307:254‐258.

59. Schneeberger EE, Vu Q, LeBlanc BW, Doerschuk CM. The accumulation of dendritic cells in the lung is impaired in CD18‐/‐ but not in ICAM‐1‐/‐ mutant mice. J Immunol 2000;164:2472‐2478.

60. Vignola AM, Campbell AM, Chanez P, Bousquet J, Paul‐Lacoste P, Michel FB, Godard P. HLA‐DR and ICAM‐1 expression on bronchial epithelial cells in asthma and chronic bronchitis. Am Rev Respir Dis 1993;148:689‐694.

Introduction: Interactions between epithelial cells and Dendritic cells in airway immune responses

27

61. Tosi MF, Stark JM, Smith CW, Hamedani A, Gruenert DC, Infeld MD. Induction of ICAM‐1 expression on human airway epithelial cells by inflammatory cytokines: effects on neutrophil‐epithelial cell adhesion.

Am J Respir Cell Mol Biol 1992;7:214‐221.

62. Frick AG, Joseph TD, Pang L, Rabe AM, St Geme JW 3rd, Look DC. Haemophilus influenzae stimulates ICAM‐1 expression on respiratory epithelial cells. J Immunol 2000;164:4185‐4196.

63. Smits HH, de Jong EC, Schuitemaker JH, Geijtenbeek TB, van Kooyk Y, Kapsenberg ML, Wierenga EA. Intercellular adhesion molecule‐1/LFA‐1 ligation favors human Th1 development. J Immunol 2002;168:1710‐1716.

64. Salomon B, Bluestone JA. LFA‐1 interaction with ICAM‐1 and ICAM‐2 regulates Th2 cytokine production.

J Immunol 1998;161:5138‐5142.

65. Carayol N, Campbell A, Vachier I, Mainprice B, Bousquet J, Godard P, Chanez P. Modulation of cadherin and catenins expression by tumor necrosis factor‐alpha and dexamethasone in human bronchial epithelial cells. Am J Respir Cell Mol Biol 2002;26:341‐347.

66. Jakob T, Udey MC. Regulation of E‐cadherin‐mediated adhesion in Langerhans cell‐like dendritic cells by inflammatory mediators that mobilize Langerhans cells in vivo J Immunol 1998;160:4067‐4073.

67. Terada N, Maesako K, Hamano N, Ikeda T, Sai M, Yamashita T, Fukuda S, Konno A. RANTES production in nasal epithelial cells and endothelial cells. J Allergy Clin Immunol 1996;98:S230‐237.

68. Sekiya T, Miyamasu M, Imanishi M, Yamada H, Nakajima T, Yamaguchi M, Fujisawa T, Pawankar R, Sano Y, Ohta K, Ishii A, Morita Y, Yamamoto K, Matsushima K, Yoshie O, Hirai K. Inducible expression of a Th2‐ type CC chemokine thymus‐ and activation‐regulated chemokine by human bronchial epithelial cells. J Immunol 2000;165:2205‐2213.

69. Tomee JF, van Weissenbruch R, de Monchy JG, Kauffman HF. Interactions between inhalant allergen extracts and airway epithelial cells: effect on cytokine production and cell detachment. J Allergy Clin Immunol 1998;102:75‐85.

70. Reibman J, Hsu Y, Chen LC, Bleck B, Gordon T. Airway epithelial cells release MIP‐3alpha/CCL20 in response to cytokines and ambient particulate matter. Am J Respir Cell Mol Biol 2003;28:648‐654.

71. Pichavant M, Charbonnier AS, Taront S, Brichet A, Wallaert B, Pestel J, Tonnel AB, Gosset P. Asthmatic bronchial epithelium activated by the proteolytic allergen Der p 1 increases selective dendritic cell recruitment. J Allergy Clin Immunol 2005;115:771‐778.

72. Vanbervliet B, Homey B, Durand I, Massacrier C, Ait‐Yahia S, de Bouteiller O, Vicari A, Caux C. Sequential involvement of CCR2 and CCR6 ligands for immature dendritic cell recruitment: possible role at inflamed epithelial surfaces. Eur J Immunol 2002;32:231‐242.

73. Hosoi J, Murphy GF, Egan CL, Lerner EA, Grabbe S, Asahina A, Granstein RD. Regulation of Langerhans cell function by nerves containing calcitonin gene‐related peptide. Nature 1993;363:159‐163.

74. Kradin R, MacLean J, Duckett S, Schneeberger EE, Waeber C, Pinto C: Pulmonary response to inhaled antigen: neuroimmune interactions promote the recruitment of dendritic cells to the lung and the cellular immune response to inhaled antigen. Am J Pathol 1997;150:1735‐1743.

75. Humbles AA, Lu B, Nilsson CA, Lilly C, Israel E, Fujiwara Y, Gerard NP, Gerard C. A role for the C3a anaphylatoxin receptor in the effector phase of asthma. Nature 2000;406:998‐1001.

76. Roake JA, Rao AS, Morris PJ, Larsen CP, Hankins DF, Austyn JM. Dendritic cell loss from nonlymphoid tissues after systemic administration of lipopolysaccharide, tumor necrosis factor, and interleukin 1. J Exp Med 1995; 181:2237‐2247.

77. van der Pouw Kraan TC, Boeije LC, Smeenk RJ, Wijdenes J, Aarden LA. Prostaglandin‐E2 is a potent inhibitor of human interleukin 12 production. J Exp Med 1995;181:775‐779.

78. Standiford TJ, Kunkel SL, Rolfe MW, Evanoff HL, Allen RM, Strieter RM. Regulation of human alveolar macrophage‐ and blood monocyte‐derived interleukin‐8 by prostaglandin E2 and dexamethasone. Am J Respir Cell Mol Biol 1992;6:75‐81.

79. Rolfe MW, Kunkel SL, Standiford TJ, Orringer MB, Phan SH, Evanoff HL, Burdick MD, Strieter RM. Expression and regulation of human pulmonary fibroblast‐derived monocyte chemotactic peptide‐1. Am J Physiol 1992;263:L536‐545.

80. Mattoli S, Marini M, Fasoli A. Expression of the potent inflammatory cytokines, GM‐CSF, IL6, and IL8, in bronchial epithelial cells of asthmatic patients. Chest 1992;101:27S‐29S. 81. Marini M, Vittori E, Hollemborg J, Mattoli S. Expression of the potent inflammatory cytokines, granulocyte‐macrophage‐colony‐stimulating factor and interleukin‐6 and interleukin‐8, in bronchial epithelial cells of patients with asthma. J Allergy Clin Immunol 1992;89:1001‐1009.

Chapter 1

28

82. Knight DA, Lim S, Scaffidi AK, Roche N, Chung KF, Stewart GA, Thompson PJ. Protease‐activated receptors in human airways: upregulation of PAR‐2 in respiratory epithelium from patients with asthma.

J Allergy Clin Immunol 2001;108:797‐803.

83. Lordan JL, Bucchieri F, Richter A, Konstantinidis A, Holloway JW, Thornber M, Puddicombe SM, Buchanan D, Wilson SJ, Djukanovic R, Holgate ST, Davies DE. Cooperative effects of Th2 cytokines and allergen on normal and asthmatic bronchial epithelial cells. J Immunol 2002;169:407‐414.

84. Soumelis V, Reche PA, Kanzler H, Yuan W, Edward G, Homey B, Gilliet M, Ho S, Antonenko S, Lauerma A, Smith K, Gorman D, Zurawski S, Abrams J, Menon S, McClanahan T, de Waal‐Malefyt Rd R, Bazan F, Kastelein RA, Liu YJ. Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP. Nat Immunol 2002;3:673‐680 85. Gilliet M, Soumelis V, Watanabe N, Hanabuchi S, Antonenko S, de Waal‐Malefyt R, Liu YJ. Human dendritic cells activated by TSLP and CD40L induce proallergic cytotoxic T cells. J Exp Med 2003;197: 1059‐1063.

86. Ying S, O'Connor B, Ratoff J, Meng Q, Mallett K, Cousins D, Robinson D, Zhang G, Zhao J, Lee TH, Corrigan C. Thymic stromal lymphopoietin expression is increased in asthmatic airways and correlates with expression of Th2‐attracting chemokines and disease severity. J Immunol 2005;174:8183‐8190.

87. Rimoldi M, Chieppa M, Salucci V, Avogadri F, Sonzogni A, Sampietro GM, Nespoli A, Viale G, Allavena P, Rescigno M. Intestinal immune homeostasis is regulated by the crosstalk between epithelial cells and dendritic cells. Nat Immunol 2005;6:507‐514.

88. Ziegler SF, Liu YJ. Thymic stromal lymphopoietin in normal and pathogenic T cell development and function. Nat Immunol 2006;7:709‐714.

89. Zhou B, Comeau MR, De Smedt T, Liggitt HD, Dahl ME, Lewis DB, Gyarmati D, Aye T, Campbell DJ, Ziegler SF. Thymic stromal lymphopoietin as a key initiator of allergic airway inflammation in mice. Nat Immunol 2005;6:1047‐1053.

90. Al‐Shami A, Spolski R, Kelly J, Keane‐Myers A, Leonard WJ. A role for TSLP in the development of inflammation in an asthma model. J Exp Med 2005; 02:829‐839.

91. Li M, Hener P, Zhang Z, Kato S, Metzger D, Chambon P. Topical vitamin D3 and low‐calcemic analogs induce thymic stromal lymphopoietin in mouse keratinocytes and trigger an atopic dermatitis. Proc Natl Acad Sci 2006;103:11736‐11741.

92. Kato A, Favoreto S Jr, Avila PC, Schleimer RP. TLR3‐ and Th2 cytokine‐dependent production of thymic stromal lymphopoietin in human airway epithelial cells. J Immunol 2007;179:1080‐1087.

93. Allakhverdi Z, Comeau MR, Jessup HK, Yoon BR, Brewer A, Chartier S, Paquette N, Ziegler SF, Sarfati M, Delespesse G. Thymic stromal lymphopoietin is released by human epithelial cells in response to microbes, trauma, or inflammation and potently activates mast cells. J Exp Med 2007;204:253‐258.

94. Lee HC, Ziegler SF. Inducible expression of the proallergic cytokine thymic stromal lymphopoietin in airway epithelial cells is controlled by NFkappaB. Proc Natl Acad Sci. 2007;104:914‐919.

95. Butler M, Ng CY, van Heel DA, Lombardi G, Lechler R, Playford RJ, Ghosh S. Modulation of dendritic cell phenotype and function in an in vitro model of the intestinal epithelium. Eur J Immunol 2006;36: 864‐874.

96. Rimoldi M, Chieppa M, Larghi P, Vulcano M, Allavena P, Rescigno M. Monocyte‐derived dendritic cells activated by bacteria or by bacteria‐stimulated epithelial cells are functionally different. Blood 2005;106:2818‐2826.

29

Chapter

2

Scope and Aim of the thesis

31

Scope and Aim of the thesis

Scope and Aim of the thesis In the first chapter I have described complexity of the local mucosal immune system and the lessons we have learned from allergic disease. The most important of these lessons is that we should realize that the immune system is a collection of different cell types working in unison and that the function of each of these cells types will be impacted by the environment. Ultimately we would like to understand the entire immune system, but in this thesis I would like to explore the potential impact of the complexity of the environment on the responses triggered in the local nasal mucosa and I would also like to explore if our recent observation that different allergic sensitizations affect the clinical response of these individuals, in some way is reflected in the cellular make‐up of local tissues.

The interplay between epithelial cells and dendritic cells is complex and still a number of important questions concerning of why and how some individuals become diseased are unresolved. A number of issues contribute to this complexity. Firstly, the disease state is likely to affect the functionality of components of the immune response.

Numerous experiments have shown that allergy has an impact on epithelial cells, dendritic cells, and T lymphocytes. However individual patients may have specific deficiencies in one or more of these cells, so that it would be hard to formulate a general interaction or functionality of this interaction between these cells. Secondly, we would like to study what goes wrong in the immune response at the moment an individual becomes allergic, but we most often study the patient when the disease has been established. Finding situations where we can study the onset of disease can be hard. Studying occupational allergies might offer some insight as allergies would develop over time in the workplace. However, we should also consider that individuals might be exposed to offending triggers during their training that could lead to a selection bias in those individuals that end up in a given profession. Alternatively, we could follow individuals from birth at considerable costs, but also here we would still need to consider hard to control environmental and genetic differences between individuals. Thirdly, we live in a complex real life environment with multiple triggers impacting our immune system either simultaneously or successively, yet most of the experimental data collected is on single triggers affecting single cell types. And finally, although we are aware that the genetic make‐up is different between individuals we know relative little about how these differences impact our response to environmental triggers or the course of an immune response.

Understanding what has gone wrong in a diseased individual should benefit from a better understanding of what happens in a healthy individual. The goal of studying the normal response of the immune response poses directly the question of the definition of what is normal. Is there a common denominator that defines the normal response or are differences in the genetic profile between healthy individuals relevant for the ultimate outcome of the immune response to some environmental trigger? Will some healthy individuals never develop allergic disease or does this co‐depend on what

Chapter 2

32

combination of environmental triggers such an individual encounter? We do know that in individual allergic patients’ symptoms differ greatly both in kind and severity and that furthermore patients may report the same dominating symptom independent of the specific allergen they are allergic to. So at the macro level one might define the normal allergic response as the display of symptoms after exposure to an allergen, but at the detailed molecular level this definition clearly does not hold. This brings up the issue of how to measure the normal response. When we would like a more detailed understanding of the immune response we will be forced to study the molecular interaction between cells of the immune system with each other and/or with environmental triggers. Ultimately, environmental triggers will need to interact with a cellular protein or specific receptor. So determining the expression level of these proteins would be one option to gain some understanding, however we must also consider that measuring expression levels at the mRNA level, or even at the protein level, may give some insight into the potential reaction that can be induced, but not necessarily into the actual reaction.

Given the importance of nasal epithelial cells as an interface with the outside (microbial) environment and their contribution to the regulation of local immune responses I have established the expression profile and functionality of the Toll‐like receptor family members in these cells (Chapter 3), investigated the interaction between multiple microbial triggers (Chapter 4), and discovered that a disease state may affect the functionality of some TLR receptors (Chapter 5). Downstream of the nasal epithelial cells also the composition of the influx of specialized dendritic cells to the nasal mucosa seems affected by the allergic state (Chapter 6) and the influx of dendritic cell subtypes in these disease states was different for the nasal and the oral mucosa (Chapter 7).

33

Chapter

3

Expression profiling and functional analysis of Toll‑like receptors in primary healthy human nasal epithelial cells shows no correlation and a refractory LPS response

J. van Tongeren*, K.I.L. Röschmann*, S.M. Reinartz, S. Luiten, W.J. Fokkens, E.C. de Jong, C.M. van Drunen Clin Transl Allergy 2015;5:42

*J. van Tongeren and K. I. L. Röschmann contributed equally to this work

Chapter 3

34

Abstract Background Innate immune recognition via Toll‐like receptors (TLRs) on barrier cells like epithelial cells has been shown to influence the regulation of local immune responses. Here we determine expression level variations and functionality of TLRs in nasal epithelial cells from healthy donors.

Methods Expression levels of the different TLRs on primary nasal epithelial cells from healthy donors derived from inferior turbinates was determined by RT‐PCR. Functionality of the TLRs was determined by stimulation with the respective ligand and evaluation of released mediators by Luminex ELISA.

Results Primary nasal epithelial cells express different levels of TLR1‐6 and TLR9. We were unable to detect mRNA of TLR7, TLR8 and TLR10. Stimulation with Poly(I:C) resulted in a significant increased secretion of IL‐4, IL‐6, RANTES, IP‐10, MIP‐1β, VEGF, FGF, IL‐1RA, IL‐2R and G‐CSF. Stimulation with PGN only resulted in significant increased production of IL‐6, VEGF and IL‐1RA. Although the expression of TLR4 and co‐stimulatory molecules could be confirmed, primary nasal epithelial cells appeared to be unresponsive to stimulation with LPS. Furthermore, we observed huge individual differences in TLR agonist‐induced mediator release, which did not correlate with the respective expression of TLRs.

Conclusion Our data suggest that nasal epithelium seems to have developed a delicate system of discrimination and recognition of microbial patterns. Hypo‐responsiveness to LPS could provide a mechanism to dampen the inflammatory response in the nasal mucosa in order to avoid a chronic inflammatory response. Individual, differential expression of TLRs on epithelial cells and functionality in terms of released mediators might be a crucial factor in explaining why some people develop allergies to common inhaled antigens, and others do not.

35

Toll‐like receptors in primary healthy human nasal epithelial cells

Background The mucosal barrier of the nose forms the first line of defence against air pollutants, airborne allergens, and (non‐) pathogenic microorganisms. Epithelial cells are the outer lining of the mucosa of the nasal airway and play, besides their role as passive physical barrier, an important role in orchestrating innate and adaptive immune responses.1‐3 Epithelium can trigger antimicrobial responses by recognizing pathogen‐associated molecular patterns (PAMPs) through the sentinel action of pattern recognition receptors (PRRs) like Toll‐like receptors (TLRs).

Toll‐like receptors are evolutionarily conserved pattern recognition receptors of the innate immune system.4 Until now, 13 mammalian TLRs have been characterized and for most of the TLRs, except TLR10, TLR12 and TLR13, specific ligands have been identified.5,6 The first group of receptors recognize bacterial products. TLR2 is activated by a variety of bacterial lipoproteins, peptidoglycans (PGN), and lipoteichoic acids (LTA), by forming a heterodimer with TLR1 or TLR6.7,8 TLR4 appears to form homodimers and under participation of adaptor molecules like MD‐2 and CD14 this TLR recognizes lipopolysaccharide (LPS) from the outer membrane of gram‐negative bacteria.

Originally thought to be a receptor only for LPS, TLR4 now emerges as a molecule responsible for signalling induced by a broad variety of molecules such as respiratory syncytial virus protein F,9 fungal components,10 or endogenous ligands like heat shock proteins, lung surfactant protein A, and beta‐defensin.11–13 Lastly, TLR5 recognizes bacterial Flagellin. Viral compounds trigger endosome‐associated receptors, such as TLR3 by double‐stranded (ds) RNA or its synthetic analogon polyinosinic polycytidylic acid (Poly I:C) and viral single stranded (ss) RNA signals via TLR7 and TLR8. DNA‐ containing CpG motifs are recognized via TLR9.14,15 Although TLRs can be involved in the initiation of adaptive immune responses through their presence on dendritic cells (DCs), they may also indirectly affect the adaptive immune response. Innate immune recognition via TLRs on barrier cells like epithelial cells has been shown to determine the functional properties of tissueresident DCs, thereby instructing the outcome of antigen‐specific immunity.16 The overall complexity of the contribution of TLRs on immune responses can be influenced by several factors like their relative abundance, their individual expression pattern, or the timing of exposure. For example, stimulation of TLR2 and TLR4 signalling pathways has been shown to both drive16,17 and inhibit18,19 the development of Th2‐mediated allergic inflammation in different experimental mouse models. Moreover, the impact of TLR4 stimulation on allergic inflammation is highly dependent upon the dose of the TLR4 agonist, with high LPS concentrations inducing Th1‐responses and low concentrations inducing Th2‐polarized inflammatory responses.20 The LPS‐induced pulmonary burden varies between different respiratory compartments and might therefore explain the functional differences between bronchial and alveolar epithelial cells with respect to LPS‐dependent cytokine release. It is widely believed that alveolar epithelial cells are unresponsive to LPS due to low or absent expression of TLR4 and/or CD14 or MD‐2.21 In

Chapter 3

36

contrast to this it has been reported that lung epithelial cells do express TLR 1–6, including adaptor molecules like CD14 and MD‐2, with bronchial epithelial cells showing CD14‐dependent activation of TLR4 and alveolar epithelial cells showing LPS‐binding protein (LBP)‐dependent inhibition of TLR4 signalling,22,23 confirming the relevance of co‐factors for a proper TLR signalling. Small airway epithelial cells have been shown to express mRNA for the TLRs 1–6 and can respond to various stimuli such as viruses or bacteria resulting in the release of different pro‐ and anti‐inflammatory cytokines and chemokines.24‐26 At present only limited data is available on the expression of TLRs by nasal epithelial cells. Claeys et al. Showed constant expression of TLR2 and TLR4 in tissue biopsies from patients with nasal polyposis or chronic rhinosinusitis and in healthy individuals.27 Isolated nasal epithelial cells from nasal polyps were shown to constitutively express mRNA of all 10 TLRs, with more pronounced expression of TLR 1–6.28 Primary nasal polyp epithelial cells express functional TLR3 and TLR4 and release high concentrations of proinflammatory chemokines and cytokines upon stimulation with dsRNA.29 Until only one study investigated the expression and function of some but not all TLRs on primary nasal epithelial cells from non‐allergic, non‐diseased individuals specifically.30 Given the role of TLRs expressed on epithelial cells within the induction of immune responses, the relatively limited knowledge on the expression of TLRs in nasal epithelium, and the protective effect of TLR polymorphism in childhood asthma,31 the aim of this study was to determine the expression and functionality of TLRs expressed in primary nasal epithelial cells from healthy donors.

Methods Patient characteristics Nasal tissue was obtained from 10 non‐allergic ENT patients (defined by negative skin prick test or radioallergosorbent test (RAST)) with septum deviations that required inferior turbinectomy. Patients were between 18 and 65 years of age, were nonsmokers, had not received topical corticosteroids for at least 4 weeks before surgery, and were free of any respiratory tract infections. The study was reviewed and approved by the medical ethical committee of the Academic Medical Center Amsterdam and all patients gave their informed consent.

Epithelial cell culture Primary nasal epithelial cells were obtained by digesting nasal turbinates of non‐allergic patients with 0.5 mg/ml collagenase 4 (Worthington Biochemical Corp.,Lakewood, NJ) for 1 h in Hanks’ balanced salt solution (HBSS; Sigma‐Aldrich, Zwijndrecht, The Netherlands).

37

Toll‐like receptors in primary healthy human nasal epithelial cells

Subsequently, epithelial cells were isolated by magnetic activated cell sorting (MACS), according to the manufacturers instruction (Miltenyi Biotec, Leiden, The Netherlands), resuspended in bronchial epithelial growth medium (BEGM) (Lonza Clonetics, Breda, The Netherlands), and seeded in a 75 ml flask. Culture medium was replaced every other day. Cells were grown to 80 % confluency in fully humidified air containing 5% CO2 at 37°C. NCI‐H292 human airway epithelial cells (American Type Culture Collection, Mannassas, VA, USA) were cultured in RPMI 1640 medium (Invitrogen, Breda, The Netherland) supplemented with 1.25 mM l‐glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin and 10% (v/v) fetal bovine serum (HyClone, Logan, UT, USA). Cells were grown in fully humidified air with 5% CO2 at 37°C and sub cultured weekly.

TLR stimulation experiment Cells were cultured up to a confluence of 80 % in a six wells plate and incubated for 24 h in IMDM without supplements. Culture medium was removed and cells were stimulated with different TLR‐agonists diluted in IMDM or with IMDM alone (control condition) for 24 h. Supernatants were removed after 1, 4, and 24 h and stored for further analysis; cells were used for RNA extraction. Each experiment was performed in triplicate. LPS (Escherichia coli), PGN (Staphylococcus aureus), and dsRNA (poly(deoxyinosinic‐deoxycytidylic acid)) were from Sigma‐Aldrich. ssRNA (LyoVec) and flagellin (Salmonella typhimurium) were from InvivoGen and the ligands were used at optimal concentrations as determined in a previous dose range finding experiment: PGN: 10 μg/ml, Poly(I:C): 20 μg/ml, LPS 1 μg/ml, Flagellin: 1 μg/ml, and CpG2216: 0.5 μM. As positive controls we used TNF‐α (25 ng/ml) and IL‐1β (10 ng/ml).

RNA extraction and Real‑time quantitative RT‑PCR analysis PCR was used to validate the differential expression of selected genes. Isolated mRNA (Kit from Macherey–Nagel, Düren, Germany) was transcribed into cDNA using the MBI Fermentas first strand cDNA kit. cDNA transcripts were quantified by real‐time quantitative PCR (iCycler iQ MultiColor Real‐Time PCR Detection System; Bio‐Rad) with specific primers32 and general SYBR green (Bio‐Rad) fluorescence detection. mRNA expression of each sample was normalized to GAPDH. All PCRs have been performed for all participants on 3 biological replicates. Expression changes are presented as 2−ΔCt indicating the difference in threshold cycle between the housekeeping gene GAPDH and the investigated TLR gene.

FACS analysis For flow cytometry analysis cells were stained with CD14‐PE‐Cy7 (1:20, BD Bioscience, Breda, the Netherland),TLR4‐APC (1:10, ebioscience, San Diego, USA) or left untreated.

Chapter 3

38

Cell numbers were quantified using the BD FACS Cantoll flowcytometer, histograms were generated using flowjo software version 7.6.2 (Treestar Inc, Ashland‐OR, USA. Determining cytokine and chemokine production by ELISA Cell free supernatants of stimulated and control treated cells were stored at ‐20°C until analysis. Cytokine levels in supernatant of cells were determined by ELISA (IL‐6 and IL8, BioSource International Camarillo‐CA, USA) or using the xMAP technology (Luminex Corporation, Austin‐TX, USA). A Bio‐Plex Human Cytokine 17‐Plex Panel kit (Bio‐Rad, Veenendaal, The Netherlands). Concentrations were calculated from a dilution series of standards using the Luminex software. Lower detection limits are indicated per cytokine.

Statistical analysis Assessment of statistical significance for Luminex data was performed using two‐tailed Student’s t tests with GraphPad Prism. P values <0.05 were considered significant.

Relationships between parameters were assessed using Pearson’s correlation analysis.

Results Baseline expression and functionality of TLR in human nasal epithelial cells As shown in Figures. 3.1 and 3.2, primary nasal epithelial cells from healthy donors express TLR1 to TLR6 and TLR9, but not TLR7 and TLR8, and TLR10. Interestingly, we observed a huge individual variability spanning several 10 log‐fold differences in the baseline expression of the TLRs to the extent that some healthy individuals do not express TLRs that are expressed by others.

In order to determine the functionality of the detected TLRs we stimulated primary nasal epithelial cells with their purified specific TLR ligands and used TNF‐α and IL‐1β as positive control to show the ability of our epithelial cells to respond to external triggers.

As shown in Figure 3.3, stimulation of primary healthy epithelial cells by PGN, Poly(I:C), and Flagellin resulted in increased release of IL‐6 and IL‐8 confirming the biological functionality of TLR2, TLR3, and TLR5 respectively. Remarkably, healthy primary nasal epithelial cells do not seem to respond to TLR4 ligation by LPS (Figure 3.3) despite expressing the TLR4 gene and the use of a biological active LPS, as seen by the positive response in the epithelial cell line H292 (Figure 3.4). Furthermore, we could show (Figures 3.5, 3.6) surface expression of TLR4 and CD14, and co‐expression of the adaptor MD‐2 that are indispensable for proper TLR4 signalling.33,34

Figure 3.1

Figure 3.2

39

Toll‐like receptors in primary healthy human nasal epithelial cells

Toll‐like Receptor (TLR) mRNA expression by primary nasal epithelial cells from 10 healthy patients undergoing turbinectomy (n=10). TLR 1‐10 mRNA expression was analyzed by quantitative RT‐PCR. Results were normalized using GAPDH as endogenous control. Expression changes are presented as 2−ΔCt × 105 indicating the difference in threshold cycle between the housekeeping gene GAPDH and the investigated TLR gene.

Toll‐like Receptor (TLR) mRNA expression by primary nasal epithelial cells from one representative patient. Expression of TLRs was analyzed by quantitative RT‐PCR. Products were visualized by agarose gel‐electrophoresis in a 2 % agarose gel.

In a next step we analyzed, which additional cytokines and chemokines are released from primary nasal epithelial cells in response to activation by different TLR ligands. As shown in Table 3.1 the multiplex ELISA showed that stimulation of primary nasal epithelial cells with Poly(I:C) resulted in a significant increased secretion of IL‐4, IL‐6, RANTES, IP‐10, MIP‐1β, VEGF, FGF, IL‐1RA, IL‐2R, and G‐CSF. Furthermore, stimulation with PGN resulted in significantly increased production of IL‐6, IL‐1RA, and VEGF. In contrast to stimulation of epithelial TLR2 and TLR3, and confirming our previous observations, stimulation with a high concentration of LPS did not result in increased secretion of any cytokines or chemokines.

Chapter 3

40

Figure 3.3

Primary nasal epithelial cells of non‐allergic individuals were stimulated for 24 h with different TLR ligands. IL‐6 and IL‐8 production was measured after 24 h by ELISA. Results from one representative patient are shown as fold induction compared to unstimulated cells.

Figure 3.4

Figure 3.5

NCI‐H292 cells were stimulated for 24 h with LPS (1 μg/ml) and TNF‐α (25 ng/ml) and IL‐1β (10 ng/ml). Cell free supernatants were analyzed for the release of IL‐6 and IL‐8 by ELISA

MD‐2 and CD14 mRNA expression by primary nasal epithelial cells from healthy patients (n = 9) and NCI‐H292 cells. MD‐2 and CD14 mRNA expression was analyzed by quantitative RT‐PCR. Results were normalized using GAPDH as endogenous control. Expression changes are presented as 2−ΔCt × 105 indicating the difference in threshold cycle between the housekeeping gene GAPDH and the investigated genes.

41

Table 3.1

IL‐1β IL1RA IL‐2 IL‐4 IL‐5 IL‐6 IL‐7 IL‐10 IL‐12 IL‐13 IL‐15 IL‐17 Eotaxin FGF basic G‐CSF GMCSF INF γ IP‐10 MCP 1 MIP1α MIP1β MIG RANTES TNFα VEGF EGF HGF IL‐2R IFNα

Toll‐like receptors in primary healthy human nasal epithelial cells

Primary nasal epithelial cells of 5 non‐allergic individuals were stimulated for 24 h with different TLR ligands.

Cut off Value

20 15 3 3 2 3 3 16 8 4 6 7 6 15 2 4 80 24 6 2 38 4 5 10 9 1 66 7 2

IMDM MEAN BD 198 BD BD BD 351 24 BD BD BD BD 17 BD BD 72 36 BD BD 219 8 BD 5 19 BD 191 BD BD 70 14

Poly(I:C) SD

151

331 36

19

95 74

111 16

11 23

163

52 21

MEAN 26 713** 13 13** BD 1793** 132 BD 46 BD 28 26 BD 40** 655** 58 BD 1982** 414 1122 930** 23 2120** 43 482** 5 31 632** 39

SD 28 487 15 12

1491 122

27

27 32

40 700 148 16 1666 456 2376 1321 22 1516 68 508 10 28 491 39

LPS MEAN BD 219 BD BD BD 264 34 BD BD BD BD 11 BD BD BD 18 BD BD 204 4 BD BD 18 BD 161 BD BD 65 10

PGN SD MEAN

BD 111 337**

BD

BD

BD 256 548** 35 45

BD

BD

BD

BD 17 10

BD

BD

132 47 20

BD

29 107 278 10 4

BD

BD 21 25

BD 142 262**

1

BD 36 99 18 22

SD

179

521 44

20

179 48

27 216 11

25

189 4

63 20

Cell free supernatants were analysed using a Luminex array. Concentrations are presented as average of triplicates of 5 different patients in pg/ml. The detection limits are shown as cut off value. SD Standard deviation, BD below detection level. ** P<0.05

No correlation between TLR expression levels and level of cytokine release Strikingly, our data also revealed large individual differences in cytokine expression patterns. To investigate the functional consequences of this variation we first determined the individual mediator levels of all donors after stimulation with Poly(I:C).

As shown in Figure 3.7, some individuals seemed to be high responders (individual 3 and 9), while nasal epithelial cells from others (e.g. individual 11) hardly produced any significant levels of the mediators included in the assay used. Furthermore, these induction levels were not related to the expression levels of TLR3 (data not shown).

Chapter 3

42

Figure 3.6

Expression of TLR4 and CD14. Surface expression of TLR4 and CD14 on primary nasal epithelial cells was assessed using flow cytometry. Histograms with solid lines represent controls, spotted lines display surface expression of TLR4 (upper graph) or CD14 (lower graph) under unstimulated conditions. Histograms with dashed lines illustrate TLR4 (upper graph) or CD14 (lower graph) expression upon stimulation with LPS (1 μg/ml, 24 h).

Figure 3.7

Cytokine and chemokine secretion by stimulated primary nasal epithelial cells. Primary nasal epithelial cells of 5 non‐allergic individuals were stimulated for 24 h with the TLR3 agonist Poly(I:C). Cell free supernatants were analysed using a Luminex array. Concentrations are presented as average of triplicates of 5 different patients.

Discussion Epithelial cells are uniquely positioned at the interface between inside and outside of the organism, which makes them perfect candidates for initiating and orchestrating

43

Toll‐like receptors in primary healthy human nasal epithelial cells

local immune responses. In addition to establishing which TLR receptors are expressed in primary nasal epithelial cells from healthy individuals, our data furthermore suggest that nasal epithelium has developed a delicate response system towards microbial exposures. Firstly, despite the presence of TLR4 and its prime costimulatory molecules CD14 and MD‐2, nasal epithelium from healthy individuals does not respond to LPS. As the nasal mucosa is constantly exposed to high concentrations of endotoxin, this unresponsiveness could provide a mechanism to dampen the inflammatory response in the nasal mucosa in order to avoid a chronic inflammatory response. Secondly, levels of TLR expression in individuals varies strongly, to the extent that some individuals not express TLRs that others do.

Thirdly, not only are the expression levels different between individuals, but independently of these differences, also the response induced by a specific TLR ligand varies strongly between individuals. And finally, the mediator response varies between different TLRs, even when they are thought to act through a common pathway. This complex level of variation in TLR signalling suggests that different healthy individuals may see different environments despite identical exposure. Although it should be noted that our sample size of 10 healthy individuals is relatively small, so that it would be difficult to generalize our conclusions for the general population The expression of TLRs within the lower respiratory tract has been investigated intensively,22,24,25,35 while data on TLR expression and functionality in nasal epithelial cells from healthy individuals is limited. Our experiments showed that primary nasal epithelial cells from most healthy donors express mRNA for TLR 1‐6 and TLR9 and mainly respond to the TLR3 ligand Poly(I:C) and to the TLR2 and TLR5 agonists. The expression of TLR2, 3, and 4 has been shown in nasal epithelial cells derived from nasal polyps, with poly(I:C) inducing the secretion of RANTES, IP‐10, IL‐8 and GMCSF.29 We were able to confirm this outcome and in addition show a consistent and statistically significant up‐regulation of IL‐2R, VEGF, MIP‐1β in all individuals.

Closer inspection of our data shows strong up‐regulation of other mediators as well (e.g. Mip‐1α, MCP1, IL‐7). However, as the induced expression of these mediators varies so strongly between individuals this up‐regulation does not reach statistical significance. These observations show that healthy individuals differ strongly in their response to external triggers, which will contribute to differences between the ability to fight off viral and bacterial infections. The absence of TLR7 and TLR10 mRNA expression differs from the previous observations of Renkonen36 and Tengroth.30 In both previous reports expression levels at the mRNA were low, so that differences in our detection technique (real time PCR) versus microarray36 or differences in growth conditions30,36 may help to explain the observed expression differences for TLR7 and TLR10. Allowing for the specificity of TLR antibodies both TLR7 and TLR10 could be detected by immuno‐histochemistry with moderate biological activity for the TLR7 agonist relative to TLR3 activation.30,36 The most striking discrepancy between TLR expression and responsiveness we observed for TLR4. Despite the presence of the receptor on the cell surface, the

Chapter 3

44

presence of key co‐stimulatory molecules (CD14 and MD‐2) and a seemingly intact downstream signaling cascade (the cells do response to other TLR stimulations), nasal epithelial cells do not respond to LPS. This unresponsiveness has also been observed in the epithelia of the gut where it was attributed to missing MD‐2 expression37 and in nasal epithelium from polyposis patients by Wang and co‐workers.29 Nasal polyposis epithelium showed a much weaker response to LPS than to polyIC stimulation, indicating that even in diseased tissue the nasal epithelial response to LPS is affected. In contrast, lung or renal epithelia are able to respond to LPS which suggests that the hypo‐responsiveness could be an adaptation in epithelia that are exposed to high concentrations of LPS, whereas epithelia that are relative sterile do show a response to LPS. The functional consequences of responding to TLR ligation are many. Expression of IP‐10, MIP‐1α, MIP‐1β, IL‐8 and G‐CSF after TLR3 activation contribute to the recruitment and activation of neutrophils or macrophages. Furthermore, IL‐8 and RANTES have been shown to be involved in the recruitment and survival of eosinophils.38 These findings imply a role for TLR3 in the nasal immune response not only in Th1‐mediated responses, but also in viral induced allergic exacerbations. This notion would also be in line with our recent observation that many aspects of TLR3 activation of nasal epithelial cells resemble that of activation by house dust mite allergen.39 The inflammatory features of dsRNA mediated by TLR3 are also thought to contribute to the exacerbation of CRS and nasal polyps during viral infection.40 TLR4 expression on lung epithelial cells has been shown to be required for DC activation in the lung and for priming of effector T helper response to HDM.16 In the absence of TLR ligation, lung DCs are minimally active. Binding with the TLR4 ligand LPS leads to enhanced motility and sampling behavior. This response strictly depends on neighboring epithelial cells being triggered by TLR4. In addition, responses to allergens are substantially altered when epithelial cells cannot detect the endotoxin in the allergen, indicating that TLR4 signaling in epithelial cells is critical for the initiation of Th2 responses to inhaled allergens.41

Conclusions Expression of TLRs on structural cells like epithelial cells and the respective functionality in terms of released mediators are important factors in the orchestration of local immune responses. We investigate the expression of all TLR receptors in primary nasal epithelial cells of healthy individuals and show an absence of TLR7 and TLR8 together with huge individual differences in mRNA expression level for TLR1‐6 and TLR9.

Although mRNA expression of TLRs of often taken as a measure of their activity we show that this is should be done with caution.

Specific TLR agonist‐induced mediator release in nasal epithelial cells is very variable between different individuals and does not correlate with the expression levels of the

45

Toll‐like receptors in primary healthy human nasal epithelial cells

respective TLRs, although we show this only for a relative small number of individuals.

Most notably we show that despite the presence of TLR4, CD14, and MD2 in nasal epithelial cells, stimulation with LPS does not induce any mediator response.

Supporting and strengthening previous observations in nasal polyposis patients that nasal epithelial cells seem to resemble gut e pithelial cells where a yet unidentified mechanism prevents epithelia routinely exposed to bacterial flora from fortuitous activation. Our data suggest that we should probably consider individual expression and activation levels better as this would affect how individuals see their microbial environment.

Chapter 3

46

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

Toppila‐Salmi S, van Drunen CM, Fokkens WJ, Golebski K, Mattila P, Joenvaara S, Renkonen J, Renkonen R. Molecular mechanisms of nasal epithelium in rhinitis and rhinosinusitis. Curr Allergy Asthma Rep 2015;15(2):495. van Tongeren J, Reinartz SM, Fokkens WJ, de Jong EC, van Drunen CM. Interactions between epithelial cells and dendritic cells in airway immune responses: lessons from allergic airway disease. Allergy 2008;63(9):1124‐1135.

Vroling AB, Fokkens WJ, van Drunen CM. How epithelial cells detect danger: aiding the immune response. Allergy 2008;63(9):1110‐1123.

Janeway CA Jr, Medzhitov R. Innate immune recognition. Annu Rev Immunol 2002;20:197–216.

Akira S, Takeda K, Kaisho T. Toll‐like receptors: critical proteins linking innate and acquired immunity.

Nat Immunol 2001;2(8):675‐680.

Kaisho T, Akira S. Toll‐like receptor function and signaling. J Allergy Clin Immunol 2006;117(5):979‐987.

Farhat K, Riekenberg S, Heine H, Debarry J, Lang R, Mages J, et al.Heterodimerization of TLR2 with TLR1 or TLR6 expands the ligand spectrum but does not lead to differential signaling. J Leukoc Biol 2008;83(3):692‐701.

Takeuchi O, Hoshino K, Akira S. Cutting edge: tLR2‐deficient and MyD88‐deficient mice are highly susceptible to Staphylococcus aureus infection. J Immunol 2000;165(10):5392‐5396.

Kurt‐Jones EA, Popova L, Kwinn L, Haynes LM, Jones LP, Tripp RA, et al. Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat Immunol 2000;1(5):398‐401.

Wang JE, Warris A, Ellingsen EA, Jorgensen PF, Flo TH, Espevik T, et al. Involvement of CD14 and toll‐like receptors in activation of human monocytes by Aspergillus fumigatus hyphae. Infect Immun 2001;69(4):2402‐2406.

Biragyn A, Ruffini PA, Leifer CA, Klyushnenkova E, Shakhov A, Chertov O, et al. Toll‐like receptor 4‐ dependent activation of dendritic cells by betadefensin2. Science 2002;298(5595):1025‐1029.

Guillot L, Balloy V, McCormack FX, Golenbock DT, Chignard M, Si‐Tahar M. Cutting edge: the immunostimulatory activity of the lung surfactant protein‐A involves Toll‐like receptor 4. J Immunol 2002;168(12):5989‐5992.

Vabulas RM, Ahmad‐Nejad P, Ghose S, Kirschning CJ, Issels RD, Wagner H. HSP70 as endogenous stimulus of the Toll/interleukin‐1 receptor signal pathway. J Biol Chem 2002;277(17):15107‐15112.

Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, et al. A Toll‐like receptor recognizes bacterial DNA. Nature 2000;408(6813):740‐745.

Hemmi H, Kaisho T, Takeuchi O, Sato S, Sanjo H, Hoshino K, et al. Small anti‐viral compounds activate immune cells via the TLR7 MyD88‐ dependent signaling pathway. Nat Immunol 2002;3(2):196‐200.

Hammad H, Chieppa M, Perros F, Willart MA, Germain RN, Lambrecht BN. House dust mite allergen induces asthma via Toll‐like receptor 4 triggering of airway structural cells. Nat Med 2009;15(4): 410‐416.

Redecke V, Hacker H, Datta SK, Fermin A, Pitha PM, Broide DH, et al. Cutting edge: activation of Toll‐like receptor 2 induces a Th2 immune response and promotes experimental asthma. J Immunol 2004;172(5):2739‐2743.

Hollingsworth JW, Whitehead GS, Lin KL, Nakano H, Gunn MD, Schwartz DA, et al. TLR4 signaling attenuates ongoing allergic inflammation. J Immunol 2006;176(10):5856‐5862.

Page K, Ledford JR, Zhou P, Wills‐Karp M. A TLR2 agonist in German cockroach frass activates MMP‐9 release and is protective against allergic inflammation in mice. J Immunol 2009;183(5):3400‐3408.

Eisenbarth SC, Piggott DA, Huleatt JW, Visintin I, Herrick CA, Bottomly K. Lipopolysaccharide‐enhanced, toll‐like receptor 4‐dependent T helper cell type 2 responses to inhaled antigen. J Exp Med 2002;196(12):1645‐1651.

Jia HP, Kline JN, Penisten A, Apicella MA, Gioannini TL, Weiss J, et al. Endotoxin responsiveness of human airway epithelia is limited by low expression of MD‐2. Am J Physiol Lung Cell Mol Physiol 2004;287(2):L428‐437.

Schulz C, Farkas L, Wolf K, Kratzel K, Eissner G, Pfeifer M. Differences in LPSinduced activation of bronchial epithelial cells (BEAS‐2B) and type II‐like pneumocytes (A‐549). Scand J Immunol 2002;56(3):294‐302.

47

Toll‐like receptors in primary healthy human nasal epithelial cells

23. Thorley AJ, Grandolfo D, Lim E, Goldstraw P, Young A, Tetley TD. Innate immune responses to bacterial ligands in the peripheral human lung— role of alveolar epithelial TLR expression and signalling. PLoS One 2011;6(7):e21827.

24. Muir A, Soong G, Sokol S, Reddy B, Gomez MI, Van HA, et al. Toll‐like receptors in normal and cystic fibrosis airway epithelial cells. Am J Respir Cell Mol Biol 2004;30(6):777‐783.

25. Ritter M, Mennerich D, Weith A, Seither P. Characterization of Toll‐like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll‐like receptors, adaptor proteins and inflammatory response. J Inflamm (Lond) 2005;29(2):16.

26. Uehara A, Fujimoto Y, Fukase K, Takada H. Various human epithelial cells express functional Toll‐like receptors, NOD1 and NOD2 to produce antimicrobial peptides, but not proinflammatory cytokines. Mol Immunol 2007;44(12):3100‐3111.

27. Claeys S, de BT, Holtappels G, Gevaert P, Verhasselt B, van CP, et al. Human beta‐defensins and toll‐like receptors in the upper airway. Allergy 2003;58(8):748‐753.

28. Lin CF, Tsai CH, Cheng CH, Chen YS, Tournier F, Yeh TH. Expression of Toll‐like receptors in cultured nasal epithelial cells. Acta Otolaryngol2007;127(4):395‐402.

29. Wang J, Matsukura S, Watanabe S, Adachi M, Suzaki H. Involvement of Toll‐like receptors in the immune response of nasal polyp epithelial cells. Clin Immunol 2007;124(3):345‐352.

30. Tengroth L, Millrud CR, Kvarnhammar AM, Kumlien Georén S, Latif L, Cardell LO. Functional effects of Toll‐like receptor (TLR)3, 7, 9, RIG‐I and MDA‐5 stimulation in nasalepithelial cells. PLoS One 2014;9(6):e98239.

31. Kormann MS, Depner M, Hartl D, Klopp N, Illig T, Adamski J, et al. Toll‐likereceptor heterodimer variants protect from childhood asthma. J Allergy Clin Immunol 2008;122(1):86‐92, 92.

32. Lebre MC, van der Aar AM, van BL, Van Capel TM, Schuitemaker JH, Kapsenberg ML, et al. Human keratinocytes express functional Toll‐like receptor 3, 4, 5, and 9. J Invest Dermatol 2007;127(2): 331‐341.

33. Hailman E, Lichenstein HS, Wurfel MM, Miller DS, Johnson DA, Kelley M, et al. Lipopolysaccharide (LPS)‐ binding protein accelerates the binding of LPS to CD14. J Exp Med 1994;179(1):269‐277.

34. Kennedy MN, Mullen GE, Leifer CA, Lee C, Mazzoni A, Dileepan KN, et al. A complex of soluble MD‐2 and lipopolysaccharide serves as an activating ligand for Toll‐like receptor 4. J Biol Chem 2004;279(33):34698‐34704.

35. Sha Q, Truong‐Tran AQ, Plitt JR, Beck LA, Schleimer RP. Activation of airway epithelial cells by toll‐like receptor agonists. Am J Respir Cell Mol Biol2004;31(3):358‐364.

36. Renkonen J, Toppila‐Salmi S, Joenväärä S, Mattila P, Parviainen V, Hagström J, et al. Expression of Toll‐ like receptors in nasal epithelium in allergic rhinitis. APMIS 2015;123(8):716725.

37. Lenoir C, Sapin C, Broquet AH, Jouniaux AM, Bardin S, Gasnereau I, et al. MD‐2 controls bacterial lipopolysaccharide hyporesponsiveness in human intestinal epithelial cells. Life Sci 2008;82(9‐10): 519‐528.

38. Lampinen M, Carlson M, Hakansson LD, Venge P. Cytokine‐regulated accumulation of eosinophils in inflammatory disease. Allergy 2004;59(8):793‐805.

39. Golebski K, Luiten S, van Egmond D, de Groot E, Röschmann KI, Fokkens WJ, van Drunen CM. High degree of overlap between responses to a virus and to the house dust mite allergen in airway epithelial cells. PLoS One 2014;9(2):e87768.

40. Fransson M, Adner M, Erjefalt J, Jansson L, Uddman R, Cardell LO. Upregulation of Toll‐like receptors 2, 3 and 4 in allergic rhinitis. Respir Res 2005;6:100.

41. Tan AM, Chen HC, Pochard P, Eisenbarth SC, Herrick CA, Bottomly HK. TLR4 signaling in stromal cells is critical for the initiation of allergic Th2 responses to inhaled antigen. J Immunol 2010;184(7):3535‐3544.

49

Chapter

4

Synergy between TLR‐2 and TLR‐3 signalling in primary human nasal epithelial cells

J. van Tongeren*, K. Golebski*, D. Van Egmond, E.J. de Groot, W.J. Fokkens, C.M. van Drunen * Both authors contributed equally Immunobiology 2015;220(4):445‐451

Chapter 4

50

Abstract Introduction Although we have a detailed understanding of how single microbial derived triggers activate specialized Toll‐like receptors (TLR) on airway epithelial cells, we know little of how these receptors react in a more complex environment. In everyday life, nasal epithelial cells are exposed to multiple TLR agonists, therefore we explored whether exposure to one trigger could affect the responsiveness to another TLR trigger.

Methods Primary nasal epithelium from healthy individuals and the bronchial epithelium cell line NCI‐H292 were exposed in vitro to different TLR specific agonists. The effect on the expression of different TLRs was determined using the q‐PCR. We also evaluated the effect of TLR‐3 stimulation on TLR‐2, functionally using ELISA to determine levels of secreted mediators .

Results Stimulation of airway epithelial cells with a specific TLR agonist affects gene expression of other TLRs. In primary nasal epithelium, poly(I:C) challenge results in an up‐regulation of the TLR‐1, TLR‐2, and TLR‐3 genes and reduction of expression of TLR‐5. Poly(I:C) induced activation of TLR‐2 contributes to stronger cell responses to a TLR‐2 agonist and regulation of these synergistic responses may take place at the mRNA level of IL‐6 and IL‐8. The effect of TLR‐3 stimulation on TLR‐2 functionality and most of the effects on the expression of other TLRs could be replicated in NCI‐H292. Poly(I:C) failed to up‐regulate TLR‐1 and showed an additional up‐regulation of TLR‐4.

Conclusion Our data suggest that to better understand TLR mediated innate responses we need to consider the impact of the presence of multiple triggers.

51

Synergy between TLR‐2 and TLR‐3 signalling in primary human nasal epithelial cells

Introduction The clinical and epidemiological observations that link upper airway diseases such as rhinitis or rhinosinusitis with lower airway diseases like asthma lead to the concept of the “united airways”.1,2 This link also applies to treatment where local medical treatment of upper airways or lower airways will also result in a reduction of symptoms at the other location. Moreover, experimental models have shown that a stimulus applied locally to one location will trigger signs and symptoms at the other location.2‐6 To what extent cell biological or functional similarities and differences between upper and lower airway epithelial cells contribute to the “united airways” concept is largely unexplored.

Airway epithelial cells not only function as a passive physical barrier for micro‐ organisms, but also play an important role in orchestrating innate and adaptive immune responses through the presence and activation of pattern recognition receptors (PRR).7 An important class of PRRs are the Toll‐like receptors (TLRs) where individual receptors recognize conserved motives associated with bacteria, fungi, or viruses.8,9 Most of the functional data on the TLR family in the airways has been collected in mice and in the lower airways of man, with the upper airways remaining unexplored in comparison.10‐14 Airway and especially nasal epithelium is constantly exposed to a variety of potentially immunogenic microorganisms, allergens or nanoparticles. Given the high microbial exposure levels in the upper airways, we wanted to explore the functionality of TLRs in nasal epithelial cells in more detail. Most of our knowledge on the activities of the TLR receptors comes from specific exposures or stimulation of a single TLR even though in everyday life we are exposed to a multitude of different triggers. This could have functional consequences as in bronchial epithelial cells it was shown that activation of TLR‐3 by the viral analogue poly(I:C) (polyinosinic:polycytidylic acid) affects the activity of a subsequent activation of TLR‐2 by the bacterial cell wall component PGN (peptidoglycan).13 Our research group has a strong focus on the contribution of airway epithelial cells to local immune regulation. Previously, we have investigated the interaction of allergens with primary nasal epithelial cells15 and of allergens with a model of lower airways epithelial cells, the cell line NCI‐H292.16,17 This approach has allowed us to identify processes that are potentially important in the response to allergens by focusing on those processes that are affected to a similar extent in primary nasal epithelial cells and in the cell line model.18 Previous studies have shown that immortalized human bronchial epithelium,12 human airway smooth muscle19 and small bronchial epithelial cells14 exposure to poly(I:C) leads to an up‐regulation of TLR‐2 expression. In this manuscript we explore the functional interaction between TLR‐3 and TLR‐2 in primary nasal epithelial cells and we seek whether the functional collaboration of TLRs can be extended to lower airways, in the lung epithelium NCI‐H292 cell line. We show that we could replicate some of the interactions between TLR family members that have been

Chapter 4

52

described in primary human bronchial epithelial cells, but also that some interactions seem specific for the human nasal epithelium.

Methods Patient characteristics Inferior turbinate tissue was obtained from patients who underwent corrective surgery for turbinate hypertrophy with or without septoplasty. The patients had no history of allergic disease and their non‐atopic status was confirmed with a negative Skin Prick Test for 18 of the most common aeroallergens.20,21 None of the subjects had a current respiratory tract infection, none of them suffered from asthma and none of them was treated with nasal corticosteroids or other nasal medication in the four weeks prior to inclusion. In addition, those patients that smoked were excluded. Under Dutch law, tissue removed during mandatory surgery (so not specifically removed for a research purposes) can be used for research when the origin cannot be traced back to the patient. Despite the fact that there is no legal obligation, patients were informed of the intention to use their waste material. If they objected, the material was not used.

Cell cultures Primary nasal epithelial cells were obtained by digesting nasal turbinates with 0.5 mg/ml collagenase 4 (Worthington Biochemical Corp., USA) for 1 hour in Hanks’ balanced salt solution (HBSS; Sigma‐Aldrich,NL) with a subsequent incubation with anti‐ EpCAM MicroBeads (Miltenyi Biotec, DE) and a positive selection on a magnetic column. Retained cells were grown in a 75 ml flasks in BEGM growth medium (Lonza Clonetics, NL). Culture medium was replaced every other day. Cells were grown in fully humidified air containing 5% CO2 at 37°C. NCI‐H292 human airway epithelial cells (American Type Culture Collection, USA) were cultured in RPMI 1640 medium (Invitrogen, NL) supplemented with 1.25 mM L‐glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin and 10% (v/v) fetal bovine serum (HyClone, Logan, USA). Cells were grown in fully humidified air containing 5% CO2 at 37°C and were sub‐cultured weekly.

TLR stimulation experiment NCI‐H292 or primary nasal epithelial cells were cultured to 80% confluence in 12‐well plates. 24 hours before the stimulation, culture medium was replaced with serum‐free RPMI 1640 medium containing 100 U/ml of penicillin and 100 µg/ml of streptomycin.

Cells were then stimulated with 10 μg/ml PGN (Sigma‐Aldrich, DE) and/or with 20 μg/ml poly(I:C) (Sigma‐Aldrich, DE). Supernatants were removed after 4, 8, 16, and 24 hours of stimulation and those of 8 and 24 hours were stored for further analysis;

53

Synergy between TLR‐2 and TLR‐3 signalling in primary human nasal epithelial cells

cells were used for RNA extraction. For the TLR‐2 ‐ TLR‐3 cross‐talk experiment, cells were initially exposed to poly(I:C) for 24 hours, then the stimulus was removed and the cells were subsequently exposed to PGN for additional 24 hours. During the stimulation with poly(I:C) ‐ 1, 4, and 24 hours after stimulation and with PGN ‐ 0.25, 0.5, 1, 2, 4, 8, 16, and 24 hours after stimulation supernatants were removed and those of 8 and 24 hours were stored for further analysis and cells were collected for RNA extraction.

Each experiment was performed at least three times with three biological replicates.

RNA extraction and Real‐time quantitative RT‐PCR analysis Quantitative polymerase chain reaction (qPCR) was used to determine the differential expression of selected genes. Extracted mRNA (Nucleospin RNA II kit, Machery‐Nagel, DE) was used for cDNA synthesis with the MBI Fermentas first strand cDNA kit (Thermo Scientific, NL). cDNA transcripts were quantified by real‐time quantitative PCR (iCycler iQ MultiColor Real‐Time PCR Detection System; Bio‐Rad, FR) with specific primers and IQTM SYBR Green Supermix (Bio‐Rad, FR). The following primers were used for the PCR reactions: GAPDH: 5’‐GAAGGTGAAGGTCGGAGTC‐3’ and 5’‐GAAGATGGTGATGGGATTTC‐ 3; IL‐6: 5’‐TGACAAACAAATTCGGTACATCCT‐3’ and 5’‐AGTGCCTCTTTGCTGCTTTCAC‐3’; IL‐8: 5’‐CCACACTGCGCCAACACAGAAATTATTG‐3’ and 5’‐GCCCTCTTCAAAAACTTCTCC ACAACCC‐3’; TLR‐1: 5’‐AAAAGAAGACCCTGAGGGCC‐3’ and 5’‐TCTGAAGTCCAGCTG ACCCT‐3’; TLR‐2: 5’‐AACCCTAGGGGAAACATCTCT‐3’ and 5’‐GGAATATGCAGCCTC CGGAT‐ 3’; TLR‐3: 5’‐AAATTGGGCAAGAACTCACAGG‐3’ and 5’‐GTGTTTCCAGAGCCGTG CTAA‐3’; TLR‐4: 5’‐TACAAAATCCCCGACAACCTC‐3’ and 5’‐AGCCACCAGCTTCTGTAAA CT‐3’; TLR‐5: 5’‐TGCATTAAGGGGACTAAGCCTC‐3’ and 5’‐AAAAGGGAGAACTTTAGGGA CT‐3’; TLR‐9: 5’‐GTGCCCCACTTCTCCATG‐3’ and 5’‐GGCACAGTCATGATGTTGTTG‐3’.

Expression levels of evaluated genes were calculated using the comparative ∆∆Ct method. Each value was corrected for the expression of the housekeeping gene GAPDH and compared to the control condition. Data were analyzed in the Bio‐Rad CFX Manager program (Bio‐Rad, FR).

Determination of cytokine and chemokine production by ELISA Measurements of secreted cytokines were performed by sandwich ELISA in 8 or 24‐hour cell‐free supernatants. The release IL‐6 and IL‐8 was detected using pairs of specific mAbs and recombinant standards obtained from BioSource International (Camarillo, USA).

Statistical analysis Data are expressed as mean ± SD. Assessment of statistical significance was performed using paired Student’s t tests with GraphPad. P values <0.05 were considered significant.

Chapter 4

54

Results Poly(I:C) stimulation affects expression levels of other TLRs in primary nasal epithelium Given the relevance of viral and bacterial exposure to the upper airways in man and a previously reported cross‐talk between different TLRs in human bronchial epithelium,12 we sought to investigate whether the TLR‐3 agonist poly(I:C) induces expression of other TLRs in nasal epithelium. We exposed primary nasal cells isolated from three healthy and non‐allergic individuals to poly(I:C) and evaluated the effect on the expression of TLRs over a 24‐hour time course. As shown in Figure 4.1, TLR‐3 activation by poly(I:C) in primary nasal epithelial cells affects the expression of a specific group of TLRs, although the absolute level of induction and the time point of maximal induction seems to vary between individuals. Figure 4.1B shows a strong and statistically significant up‐regulation of TLR‐2 mRNA expression (7.2 (±1.0) fold in individual A, 13.1 (±1.2) fold in individual B, and 5.5 (±0.5) fold in individual C, P<0.05), with maximum expression reached after 24, 8, or 16 hours respectively. Poly(I:C) stimulation reduced the expression of TLR‐5 (Figure 4.1E) by 4‐5 fold in individual A and C, while individual B responded even stronger with a 17.3 (±2.2) fold reduction of TLR‐5 expression (P<0.05).

Additionally, poly(I:C) provocation dramatically induced TLR‐3 expression, ranging from 5 fold to 130 fold (P<0.05, Figure 4.1C). TLR‐1 mRNA is present and up‐regulated after poly(I:C) stimulation in two individuals (Figure 4.1A, P<0.01), while for individual C we could not detect any TLR‐1. Moreover, poly(I:C) triggering did not affect TLR‐4 expression in any of the subjects.

Figure 4.1

Primary nasal epithelial cells modulate the expression of Toll‐like Receptors in response to TLR‐ 3 ligand poly(I:C): A) up‐regulation of TLR‐1; B) up‐regulation of TLR‐2; C) up‐regulation of TLR‐3; D) expression of TLR‐4; E) down‐regulation of TLR‐5; F) expression of TLR‐9. Statistical analysis (paired Student’s t test) is based on the average values calculated as a mean of the values for the three subjects and considered significant if P<0.05 (*).

55

Synergy between TLR‐2 and TLR‐3 signalling in primary human nasal epithelial cells

To analyze to what extent this observation is mirrored in a bronchial cell line, we exposed NCI‐H292 cells to poly(I:C) in a similar setup and evaluated the effect on the expression of the TLRs. Poly(I:C) led to a significant (P<0.001) induction of TLR‐2 expression with 12.1 (± 1.0) fold up‐regulation 4 hours after exposure and to a down‐ regulation of TLR‐5 by 4.0 (± 1.2) fold (P=0.01) which is in line with the observation in primary nasal cells (Figure 4.2B and 4.2E). However, expression profiles of TLR‐3, TLR‐4, and TLR‐9 in response to the viral analogue differ between the upper and lower airway epithelial cells. In the cell line, TLR‐3 expression was no longer affected by poly(I:C), whereas TLR‐4 showed a significant 4.5 (±1.0) fold up‐regulation (P=0.04) (Figure 4.2C and 4.2D). Additionally, in contrast to nasal epithelium, TLR‐9 expression was significantly down‐regulated by 4.2 (±1.0) fold (P=0.03) in the NCI‐H292 cell line (Figure 4.2F). Moreover, expression of TLR‐1 was not affected by poly(I:C) challenge.

Figure 4.2

The NCI‐H292 cell line was exposed to poly(I:C) and expression profiles of A) TLR‐1, B) TLR‐2, C) TLR‐3, D) TLR‐4, E) TLR‐5, and F) TLR‐9 over 24‐hour time courses were quantified by the real‐ time PCR. The experiment was performed three times with three biological replicates. Values in the graph represent a mean value of three with a standard deviation. Paired Student’s t test was used for the assessment of statistical significance and values P<0.05 were considered statistically significant (*).

Pre‐exposure to poly(I:C) enhances pro‐inflammatory responses of primary nasal epithelium to PGN The up‐regulation of TLR‐2 expression after poly(I:C) exposure suggests a collaborative interaction between the TLR‐2 and TLR‐3. However, this does not necessarily prove that the up‐regulation of TLR‐2 mRNA is functionally significant. In the next set of experiments we were able to show that stimulation of TLR‐2 with PGN after an initial

Chapter 4

56

pre‐stimulation of nasal epithelium with poly(I:C) led to a higher production of IL‐6 and IL‐8 than in the absence of this pre‐stimulation.

Table 4.1 summarizes the data to show that in four out of five individuals we tested a synergy was observed, so that the induction level for IL‐6 and IL‐8 by PGN after the poly(I:C) pre‐stimulation was significantly higher than after the both individual stimulations. As the baseline and induced levels of IL‐6 and IL‐8 were highly variable for each tested individual, we calculated the degree of the synergy separately and showed for the 8 hours PGN stimulation a synergy factor of between 2.0 (±0.2) and 3.7 (±0.7) fold for IL‐6 and between 2.8 (±0.7) and 6.3 (±1.4) fold increase for IL‐8. For the 24 hours PGN stimulation these synergy factors were between 1.6 (±0.3) and 5.2 (±0.7) for IL‐6 and between 1.4 (±0.2) and 2.5 (±0.7) for IL‐8 (P values are stated in the table).

Interestingly, one individual showed no synergy in response to PGN after poly(I:C) pre‐ exposure.

The observation of the synergy between responses to poly(I:C) and PGN in nasal epithelial cells could be replicated in the NCI‐H292 cell line. When a 24 hours exposure to poly(I:C) is followed by 8 hours of PGN stimulation the NCI‐H292 cell line produces 6,325 (±560) pg/ml of IL‐6 and 1,010 (±100) pg/ml of IL‐8, while in the absence of the poly(I:C) pre‐stimulation this is only 222 (±17) pg/ml of IL‐6 and 74 (±13) pg/ml of IL‐8 (Figure 4.3). Additionally, as a control condition we determined the effect of the poly(I:C) pre‐stimulation only and this yielded 1,598 (± 100) pg/ml of IL‐6 and 151 (±16) pg/ml of IL‐8. This shows that the increased levels of IL‐6 and IL‐8 induced by PGN after the initial poly(I:C) simulation cannot be explained by simple addition of the production levels from the only the poly(I:C) pre‐stimulation or the PGN stimulation without the poly(I:C) pre‐stimulation. When we divide the PGN‐induction levels after poly(I:C) pre‐stimulation (6,325 (±560) pg/ml for IL‐6 and 1,010 (±100) pg/ml for IL‐8) by the sum of both single stimulations (1,820 (±190) pg/ml for IL‐6 and 225 (±32) pg/ml for IL‐8) we can calculate a 3.5 (±0.5) fold synergy for IL‐6 (P=0.03) and 4.5 (±0.6) fold for IL‐8 (P=0.02). Additionally, we tested a prolonged 24 hours exposure to PGN after the initial 24 hours of cells stimulation with poly(I:C). The outcome mirrors the 8 hours PGN observation. Here, the poly(I:C) pre‐exposure followed by 24 hours PGN provocation leads to 17,920 (±400) pg/ml of IL‐6 and 1,350 (±200) ng/ml of IL‐8 production, versus just 9,720 (±900) pg/ml of IL‐6 (P=0.02) and 790 (±25) pg/ml of IL‐8 (P=0.03) for the cumulative expression levels in both the control conditions.

Table 4.1

Subject

A 1 2 3 4 5 B 1 2 3 4 5 C 1 2 3 4 5 D 1 2 3 4 5

57

Synergy between TLR‐2 and TLR‐3 signalling in primary human nasal epithelial cells

Production levels of IL‐6 and IL‐8 in primary nasal epithelial cells as a sum of stimulation with PGN or poly(I:C) alone and PGN with poly(I:C) pre‐exposure. A and B show IL‐6 and IL‐8 produced in response to 8 hours stimulation with PGN respectively, C and D – after 24 hours exposure to PGN, respectively. Synergy factors were obtained by dividing production levels of IL‐6 or IL‐8 in response to PGN with poly(I:C) pre‐stimulation by the sum of single trigger stimulations. Statistical significance was calculated by comparing the absolute production levels of IL‐6 or IL‐8 in response to PGN with poly(I:C) pre‐exposure by the sum of single trigger stimulations. Paired Student’s t test was used for the assessment of statistical significance. Each value represents a mean value of three biological replicates ± SD. Sum of PGN and poly(I:C) pg/ml SD

49.3 10.9 25.4 2.1 408.5 60.1 9.8 0 22.6 3

127.9 35.8 1086.5 581.2 4923.3 1546.9 2471.9 1117.5 563.3 112.4

59.7 3.6 78.7 6.9 975.1 242.5 59.5 7.6 52.4 17.2

1480.4 264.6 10,969.7 3505.3 24,047.0 2377.5 9110.6 1555.5 5422.2 1444

PGN after poly(I:C) pg/ml SD

137.5 13.4 74.8 25.5 1508.9 375.2 19.6 4.5 14.8 4.7

807.6 135.2 3091 529.2 20782 5046.6 6995.9 409.9 541.7 52.4

310.9 66.9 234.6 36 1560.6 137.6 116.2 12.1 56.6 6.5

2257.7 58.1 27,728.6 6707 42,183.8 6630.1 12,831.0 1126 5955.6 554.6

Synergy Factor

2.8 2.9 3.7 2 0.66

6.3 2.8 4.2 2.8 1

5.2 3 1.6 1.9 1.1

1.5 2.5 1.8 1.4 1.1

SD

0.4 0.6 0.7 0.2 0.1

1.4 1 1.2 0.7 0.1

0.7 0.4 0.3 0.2 0.2

0.2 0.7 0.2 0.2 0.2

P value

0.02 0.03 0.007 0.02 0.09

<0.0001 0.04 0.04 0.0006 0.66

0.003 0.002 0.047 0.006 0.62

0.02 0.03 0.002 0.044 0.14

Synergy between TLR‐2 and TLR‐3 triggering is regulated at mRNA level in primary nasal epithelium Increased level of IL‐6 and IL‐8 in the supernatants after ligation of TLR receptors could be due to enhanced transcription of the gene, increased translation of the mRNA or increased secretion of the protein. In a detailed time course of the expression profile in primary nasal epithelial cells we showed that the synergy between poly(I:C) pre‐ stimulation and PGN activation can already be detected at the mRNA level. Figures 4.4A (IL‐6) and 4.4B (IL‐8) show the absolute mRNA level after both single stimulations and after co‐stimulation in nasal epithelium of one representative individual. A significantly increased levels at the highest expression peaks of IL‐6 (2.3 (±0.2) fold higher, P<0.05) and IL‐8 (2.6 (±0.4) fold higher, P<0.05) were found and also the area under the expression profiling curves of three individuals revealed a significant enhancement of

Chapter 4

58

up‐regulation of the IL‐6 and IL‐8 gene expression with 1.68 (±0.4) fold (P=0.01) and 1.5 (±0.3) fold (P=0.05) respectively.

Figure 4.3

Production levels of IL‐6 and IL‐8 in the NCI‐H292 cell line. Cells were pre‐exposed to poly(I:C) for 24 hours and then stimulated with PGN for 8 (A and B) or 24 hours (C and D). Production levels from the sum of single trigger conditions were compared to subsequent poly(I:C) and PGN stimulation and P<0.05 values (paired Student’s t test) were considered significant and indicated by (*).

59

Figure 4.4

Synergy between TLR‐2 and TLR‐3 signalling in primary human nasal epithelial cells

Expression levels of IL‐6 and IL‐8 genes upon 24 hours stimulation with poly(I:C) followed by 24 hours exposure to PGN. Absolute levels of expression are shown after correction for the housekeeping gene GAPDH. Values in the graph represent an average value of three biological replicates with a standard deviation. Expression levels from the sum of single trigger stimulations were compared to subsequent poly(I:C) and PGN challenge and P<0.05 values (paired Student’s t test) were considered significant and indicated by (*).

Discussion In this manuscript we show that stimulation of airway epithelial cells with a specific agonist for one Toll‐like receptor may lead to the transcriptional deregulation of another TLR and that this deregulation can have functional consequences.

When primary nasal epithelial cells are exposed to poly(I:C), the activation of TLR‐3 leads to a significant up‐regulation of the TLR‐2 mRNA. Furthermore, this up‐regulation of TLR‐2 also translated into an increased functionality of TLR‐2 when this receptor is stimulated by PGN. In an extended time course that included pre‐stimulation of primary nasal epithelial cells with poly(I:C), we detected a higher expression and production of IL‐6 and IL‐8 upon PGN stimulation than in the absence of the poly(I:C) pre‐simulation. These levels of IL‐6 and IL‐8 are several fold higher even in comparison to the combined levels of these mediators due to the individual stimulation of cells by poly(I:C) and PGN. This functionality was previously also observed in bronchial epithelial cells12 pointing yet again to a conserved mechanism in both upper and lower airways that could contribute to the united airways concept.22 Also the bronchial epithelial cell line NCI‐H292 mimics this effect of TLR‐3 stimulation on TLR‐2 functionality strengthening the validity of this model with respect to the conserved airway epithelial processes. The same interaction between TLR‐3 and TLR‐2 has been previously observed in murine myeloid dendritic cells23 and human airway smooth muscle19 showing presence of this mechanism in other than airway epithelial cells. When we investigated the underlying mechanism of the effect of poly(I:C) on TLR‐2 activity, we could detect the same synergy at the RNA level of the mediators: the overall amount of the RNA produced (the area under de curve) was significantly higher in the poly(I:C) pre‐stimulated cells after PGN exposure than without this pre‐stimulation.

In this study, we used measurements of IL‐6 and IL‐8 as a functional readout of the collaborative interaction between the TLR‐3 and TLR‐2. A recent observation stressed

Chapter 4

60

the crucial role of IL‐6 in the effect of poly(I:C) on the increased TLR‐2 expression. This cytokine was demonstrated as a part of an autocrine loop where IL‐6 produced by epithelial cells after the poly(I:C)‐mediated TLR‐3 activation binds to the IL‐6 receptor on the secreting cell and through Stat3 and NF‐B dependent pathway leads to the induced expression of TLR‐2. Stat3 activation was necessary for the poly(I:C)‐induced up‐regulation of TLR2 suggesting that the functional synergistic interaction between TLR‐3 and TLR‐2 is possible only if the TLR‐3 and TLR‐2 agonists trigger the same cell.24 The detailed time course of the expression of other TLR family members after poly(I:C) stimulation in the primary nasal epithelial cells of the healthy individuals revealed some additional observations. We found an up‐regulation of TLR‐1 and TLR‐3 and a down‐ regulation of TLR‐5. This differed from our observations in the NCI‐H292 bronchial cell line, where activation of the TLR‐3 receptor by poly(I:C) has a strong impact on up‐ regulation of the TLR‐2 and TLR‐4 genes, but as clearly there is a significant down‐ regulation of the TLR‐5 and TLR‐9 genes, which is largely similar to the report of Ritter and that of Melkamu. However, there are also some differences between the three observations. Ritter could show no effect on TLR‐4, whereas Melkamu and us did show that TLR‐3 activation led to an up‐regulation of TLR‐4. We failed to detect a change in TLR‐1 in bronchial epithelium that was reported in both previous studies. It is not clear why these differences occur, but the most likely explanation is the precise nature of the cells under investigation. Only Ritter used real primary bronchial epithelial cells (from the small airways), whereas Melkamu used commercial primary bronchial cells that have been transfected with the catalytic subunit of the human telomerase gene to extend their life span, and we have used a bronchial cell line that has been derived from pulmonary squamous epithelial carcinoma. This suggests that although the NCI‐ H292 cell line does replicate important aspects of primary nasal and bronchial epithelial responses, it does not mirror all aspects of airway epithelial cells.

Our data demonstrate significant inter‐individual differences in primary cell responses to TLR agonists. One of the obvious explanations for this would include the variation in the expression levels of receptors and key downstream signaling molecules. Recent report of Lee and colleagues suggests that genetic variants of the STAT and IRF transcription factors may also contribute to the inter‐individual differences in host responses to pathogens.25 At the moment, we are still struggling with understanding how to determine the minimal cell response that is required for the ability to trigger proper inflammatory responses. Therefore, not only can we observe the inter‐ individual differences, but also we are unable to interpret how relevant the extent of these variations is A few aspects need to be considered when analyzing the functional interaction between the cell responses to a bacterial and viral trigger. First of all, although the focus of the mode of action of poly(I:C) is on TLR‐3, it is clear that also the RIG‐I and MDA5 receptors have been implicated in recognition of double‐stranded viral RNA and poly(I:C).26 The increased expression of IL‐6 and TLR‐2 after poly(I:C) stimulation could be blocked by an antibody for TLR‐3, but the increased production of RANTES could not

61

Synergy between TLR‐2 and TLR‐3 signalling in primary human nasal epithelial cells

be inhibited24 showing that the responsiveness of airway epithelial cell to poly(I:C) is more complex than just acting through TLR‐3. Secondly, stimulation or infection of cells by virus will not be identical to the effect of poly(I:C) we report on in this manuscript. A final aspect is whether in vivo an epithelial cell can or will be simultaneously exposed to both a viral and bacterial trigger that would allow synergy between the two responses.

Our data show that both stimuli do not need to target the same cell at the same time, but rather one stimuli (poly(I:C) followed by the other one (PGN), as an up‐regulation of TLR‐2 can still be detected 24 hours after exposure to poly(I:C) and so is the TLR‐2 activity.

Conclusions The present study demonstrated that exposure of primary nasal epithelial cells to poly(I:C) associated with viral infection resulted in a functional up‐regulation of the anti‐bacterial defense associated TLR‐2. These results suggest that the in vivo outcome of TLR activation in a context where we are exposed to multiple triggers may differ from what we have learned from in vitro studies where most often only single stimuli are considered. Moreover, the expression and activity profiles of the TLR family are likely to be different at a detailed level between different individuals and between the upper and lower airways. Although the detailed differences might not necessarily lead to a different response, it does remind us that the way we interact with the environment will depend on both the complexity of the environment and our individual genetic make‐up.

Observed in vitro TLR‐2/TLR‐3 functional cross‐talk in nasal epithelium may implicate in vivo consequences. In vivo exposure of the nasal cavity to a virus could potentially lead to long‐lasting activation of enhanced anti‐bacterial responses. It would be interesting to verify whether there is a link between the presence/absence of the TLR‐2/TLR‐3 synergistic responses and the possibility of acquiring a bacterial superinfection or bacterial biofilm formation.

Chapter 4

62

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

Vance G, Lloyd K, Scadding G, Walker S, Jewkes F, Williams L, Dixon L, O'Beirne C, Fletcher P, Brown T, Hughes J, Sohi D, Piddock C, Shields M, McKean M, Warner J. The 'unified airway': the RCPCH care pathway for children with asthma and/or rhinitis. Arch Dis Child 2011;96 Suppl 2:i10‐i14.

Braunstahl GJ, Fokkens W. Nasal involvement in allergic asthma. Allergy 2003;58:1235‐1243.

Reinartz SM, Overbeek SE, KleinJan A, van Drunen CM, Braunstahl GJ, Hoogsteden HC, Fokkens WJ. Desloratadine reduces systemic allergic inflammation following nasal provocation in allergic rhinitis and asthma patients. Allergy 2005;60:1301‐1307.

Brozek JL, Bousquet J, Baena‐Cagnani CE, Bonini S, Canonica GW, Casale TB, van Wijk RG, Ohta K, Zuberbier T, Schunemann HJ. Allergic Rhinitis and its Impact on Asthma (ARIA) guidelines: 2010 revision. J Allergy Clin Immunol 2010;126:466‐476.

Braunstahl GJ, Overbeek SE, Fokkens WJ, KleinJan A, McEuen AR, Walls AF, Hoogsteden HC, Prins JB. Segmental bronchoprovocation in allergic rhinitis patients affects mast cell and basophil numbers in nasal and bronchial mucosa. Am J Respir Crit Care Med 2001;164:858‐865.

Braunstahl GJ, Overbeek SE, KleinJan A, Prins JB, Hoogsteden HC, Fokkens WJ. Nasal allergen provocation induces adhesion molecule expression and tissue eosinophilia in upper and lower airways.

J Allergy Clin Immunol 2001;107:469‐476.

Golebski K, Roschmann KI, Toppila‐Salmi S, Hammad H, Lambrecht BN, Renkonen R, Fokkens WJ, van Drunen CM. The multi‐faceted role of allergen exposure to the local airway mucosa. Allergy 2013;68: 152‐160.

Vroling AB, Fokkens WJ, van Drunen CM. 2008. How epithelial cells detect danger: aiding the immune response. Allergy 2008;63:1110‐1123.

Tengroth L, Millrud CR, Kvarnhammar AM, Kumlien GS, Latif L, Cardell LO. Functional effects of Toll‐like receptor (TLR)3, 7, 9, RIG‐I and MDA‐5 stimulation in nasal epithelial cells. PLoS One 2014;9:e98239.

Heuking S, Rothen‐Rutishauser B, Raemy DO, Gehr P, Borchard G. Fate of TLR‐1/TLR‐2 agonist functionalised pDNA nanoparticles upon deposition at the human bronchial epithelium in vitro. J Nanobiotechnology 2013;11:29.

Mayer AK, Muehmer M, Mages J, Gueinzius K, Hess C, Heeg K, Bals R, Lang R, Dalpke AH. Differential recognition of TLR‐dependent microbial ligands in human bronchial epithelial cells. J Immunol 2007;178: 3134‐3142.

Melkamu T, Kita H, O'Grady SM. TLR3 activation evokes IL‐6 secretion, autocrine regulation of Stat3 signaling and TLR2 expression in human bronchial epithelial cells. J Cell Commun Signal 2013;7: 109‐118.

Ritter M, Mennerich D, Weith A, Seither P. Characterization of Toll‐like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll‐like receptors, adaptor proteins and inflammatory response. J Inflamm (Lond) 2005;2:16.

Schneberger D, Caldwell S, Kanthan R, Singh B. 2013. Expression of Toll‐like receptor 9 in mouse and human lungs. J Anat 2013;222:495‐503.

Vroling AB, Jonker MJ, Luiten S, Breit TM, Fokkens WJ, van Drunen CM. 2008. Primary nasal epithelium exposed to house dust mite extract shows activated expression in allergic individuals. Am. J. Respir. Cell Mol. Biol. 38: 293‐299.

Vroling AB, Duinsbergen D, Fokkens WJ, van Drunen CM. Allergen induced gene expression of airway epithelial cells shows a possible role for TNF‐alpha. Allergy 2007;62:1310‐1319.

Roschmann KI, Luiten S, Jonker MJ, Breit TM, Fokkens WJ, Petersen A, van Drunen CM. Timothy grass pollen extract‐induced gene expression and signalling pathways in airway epithelial cells. Clin Exp Allergy 2011;41:830‐841.

Vroling AB, Jonker MJ, Breit TM, Fokkens WJ, van Drunen CM. Comparison of expression profiles induced by dust mite in airway epithelia reveals a common pathway. Allergy 2008;63:461‐467.

Sukkar MB, Xie S, Khorasani NM, Kon OM, Stanbridge R, Issa R, Chung KF. Toll‐like receptor 2, 3, and 4 expression and function in human airway smooth muscle. J Allergy Clin Immunol 2006;118:641‐648.

Heinzerling L, Mari A, Bergmann KC, Bresciani M, Burbach G, Darsow U, Durham S, Fokkens W, Gjomarkaj M, Haahtela T, Bom AT, Wohrl S, Maibach H, Lockey R. The skin prick test ‐ European standards. Clin. Transl. Allergy 2013;3:3.

21.

22.

23.

24.

25.

26.

63

Synergy between TLR‐2 and TLR‐3 signalling in primary human nasal epithelial cells

Bousquet J, Heinzerling L, Bachert C, Papadopoulos NG, Bousquet PJ, Burney PG, Canonica GW, Carlsen KH, Cox L, Haahtela T, Lodrup Carlsen KC, Price D, Samolinski B, Simons FE, Wickman M, Annesi‐ Maesano I, Baena‐Cagnani CE, Bergmann KC, Bindslev‐Jensen C, Casale TB, Chiriac A, Cruz AA, Dubakiene R, Durham SR, Fokkens WJ, Gerth‐van‐Wijk R, Kalayci O, Kowalski ML, Mari A, Mullol J, Nazamova‐Baranova L, O'Hehir RE, Ohta K, Panzner P, Passalacqua G, Ring J, Rogala B, Romano A, Ryan D, Schmid‐Grendelmeier P, Todo‐Bom A, Valenta R, Woehrl S, Yusuf OM, Zuberbier T, Demoly P. Practical guide to skin prick tests in allergy to aeroallergens. Allergy 2012;67:18‐24.

Ciprandi G, Caimmi D, Miraglia Del GM, La RM, Salpietro C, Marseglia GL. Recent developments in United airways disease. Allergy Asthma Immunol Res 2012;4:171‐177.

Vanhoutte F, Paget C, Breuilh L, Fontaine J, Vendeville C, Goriely S, Ryffel B, Faveeuw C, Trottein F. Toll‐ like receptor (TLR)2 and TLR3 synergy and cross‐inhibition in murine myeloid dendritic cells. Immunol Lett 2008;116:86‐94.

Melkamu T, Squillace D, Kita H, O'Grady SM. Regulation of TLR2 expression and function in human airway epithelial cells. J Membr Biol 2009;229:101‐113.

Lee MN, Ye C, Villani AC, Raj T, Li W, Eisenhaure TM, Imboywa SH, Chipendo PI, Ran FA, Slowikowski K, Ward LD, Raddassi K, McCabe C, Lee MH, Frohlich IY, Hafler DA, Kellis M, Raychaudhuri S, Zhang F, Stranger BE, Benoist CO, De Jager PL, Regev A, Hacohen N. Common genetic variants modulate pathogen‐sensing responses in human dendritic cells. Science 2014;343:1246980.

Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, Uematsu S, Jung A, Kawai T, Ishii KJ, Yamaguchi O, Otsu K, Tsujimura T, Koh CS, Reis E Sousa, Matsuura Y, Fujita T, Akira S. Differential roles of MDA5 and RIG‐I helicases in the recognition of RNA viruses. Nature 2006;441:101‐105.

65

Chapter

5

Specific induction of TSLP by the viral RNA analogue poly(I:C) in primary epithelial cells derived from nasal polyps

K. Golebski*, J van Tongeren* , D Van Egmond, E.J. de Groot, W.J. Fokkens, C.M. van Drunen * Both authors contributed equally PLoS One 2016;11(4):e0152808

Chapter 5

66

Abstract Introduction Chronic rhinosinusitis with nasal polyposis is an inflammatory disease that, although not directly linked to allergy, often displays a Th2‐skewed inflammation characterized by elevated local IgE and IL‐5 levels. The nasal cavity is constantly exposed to bacteria and viruses that may trigger epithelial inflammatory responses. To gain more insight into mechanisms by which such a biased inflammation might arise, we have investigated the epithelial expression of the Th2 skewing mediators (TSLP, IL‐25, and IL‐33) in relationship to disease and microbial triggers.

Methods Epithelial cells were obtained from polyp tissues of nasal polyposis patients and from inferior turbinates of non‐diseased controls. Cells were exposed to various TLR‐specific triggers to study the effect on mRNA and protein expression level of TSLP, IL‐25, and IL‐33 and the potential regulatory mechanisms through the expression profile the transcription factors ATF‐3, DUSP‐1, EGR‐1, and NFKB‐1.

Results The TLR3 agonist and viral analogue poly(I:C) induced TSLP mRNA 13.0 ± 3.1 fold (P<0.05) and protein expression by 12.1 ± 2.3‐fold (P<0.05) higher in epithelium isolated from nasal polyposis patients than in epithelium form healthy controls. This enhanced induction of TSLP may be a consequence of a down‐regulated expression of DUSP‐1 in polyp epithelium.

Conclusion The TLR3 induced expression of TSLP introduces a mechanism by which the Th2‐skewed tissue environment might arise in nasal polyps and invites a further evaluation of the potential contribution of current or past viral infections to polyposis pathogenesis.

67

Specific induction of TSLP by the viral RNA analogue poly(I:C) in primary epithelial cells

Introduction Although the precise pathogenesis of chronic rhinosinusitis with nasal polyps (CRSwNP) still remains unclear, our recent observations have shown a possible important involvement of innate lymphoid cells type 2 (ILC2) in this disease.1 As differentiation and activation of ILC2 depends on the epithelial mediators TSLP, IL‐25, and IL‐33,2 in this manuscript we investigate environmental factors and epithelial regulatory mechanisms that could affect the expression of these key regulatory mediators in primary nasal epithelial cells.

Innate lymphoid cells are relatively new players in the immunological landscape. ILCs share a cellular lineage with T cells, but lack the T cell receptor, precluding any antigen specificity and emphasizing their innate immunological function.3 Despite this difference, ILCs have defined subtypes that resemble the T helper subtypes with the involvement of the same transcription factors and cytokine profiles. The activity and differentiation of ILC2, the innate equivalent of the type 2 lymphocytes is affected by TSLP, IL‐25, and IL‐33 in various mouse disease models.1,4‐6 More importantly, from a human disease perspective is that ILC2 are prevalent in CRSwNP1,2 and could therefore potentially explain the overall Th2‐skewed local environment prevalent in nasal polyps.7 Traditionally innate immune responses were linked to adaptive immune responses via dendritic cells with the adaptive Th1 response specific for endosomal pathogens and viruses, the Th2 response for parasite expulsion and allergen‐triggered inflammation, and the Th17/Th22 response specific for fungi and bacteria. Specific triggers play an important role in establishing these T helper subtypes. In the case of Th2 responses, a clear role for epithelial TSLP, IL‐25, and/or IL‐33 have been reported, although different allergic models seem to show differences in the relative contribution of these factors.6,8‐13 Toll‐like receptors are receptors that have been extensively studied in the context of microbiota – triggered local inflammatory responses. These receptors can recognize bacterial derived signals via the plasma membrane associated TLR1, TLR2, TLR4, TLR5, and TLR6, viral components via endosome associated TLR3, TLR7, TLR8, and TLR9, or fungal pathogens via TLR1, TLR2, and TLR4.14,15 Majority of these receptors are expressed by airway epithelium and have been characterized as functional and capable of triggering cell responses upon exposure to ligands.16 We have previously shown that the ATF‐3, EGR‐1, DUSP‐1, and NFKB‐1 transcription factors play an important role in poly(I:C) triggered inflammatory responses and that EGR‐1 and DUSP‐1 are responsible for a down‐regulation of virus‐induced inflammation in airway epithelium.17,18 In allergic disease we demonstrated that deregulated basal expression levels of the ATF‐3, EGR‐1, DUSP‐1, and NFKB1 genes were associated with differences in cytokine profile of nasal epithelial cells upon stimulation with an exogenous trigger.19 EGR‐1 and DUSP‐1 may also play a role in the ILC2 enrichment in CRSwNP as EGR‐1 has been shown to mediate the production of TSLP upon IL‐33 stimulation,20 while activation of DUSP‐1 was necessary for TSLP expression.21

Chapter 5

68

In this manuscript we explore the reactivity of epithelial cells isolated from nasal polyps and healthy controls to a broad range of TLR agonists in their ability to induce the expression and production of TSLP, IL‐25, and IL‐33. We also seek to investigate whether EGR‐1 and DUSP‐1, negative regulators of pro‐inflammatory responses, may play a role in regulating these responses. Our data show that epithelial cells from nasal polyps exposed to poly(I:C) produce a significantly higher amount of TSLP than the inferior turbinate epithelium from healthy individuals both at the mRNA and protein level. None of the other TLR agonists (flagellin, PAM, PGN, CpG, or R848) showed a similar effect. For IL‐33 we observed a clear induction by multiple TLR agonists, but the level of induction mostly did not differ between healthy or polyp epithelium, although we did see specific up‐regulation by the TLR8 agonist R848 in healthy epithelium. IL‐25 levels were below the detection limit of our assay for all the conditions we tested. The differences in TSLP expression upon poly(I:C) exposure could potentially be explained by the significantly lower basal expression of the DUSP‐1 gene in epithelium from nasal polyposis individuals, since knocking‐down of the DUSP‐1 gene resulted in a dramatic up‐regulation of TSLP expression and production.

Materials and methods Patient characteristics Inferior turbinate tissue from six healthy non‐diseased individuals was obtained from patients who underwent corrective surgery for turbinate hypertrophy with or without septoplasty. Nasal polyps were obtained from five patients undergoing Endoscopic Sinus Surgery (ESS). None of our subjects had a current respiratory tract infection, none of them suffered from asthma, and none of them was treated with nasal corticosteroids or other nasal medication in the four weeks prior to inclusion. Under Dutch law, tissue removed during mandatory surgery (so not specifically removed for a research purposes) can be used for research when the origin cannot be traced back to the patient. Despite the fact that there is no legal obligation, patients were informed of the intention to use their waste material.

Cell cultures Primary nasal epithelial cells were obtained by digesting nasal turbinates or polyps with 0.5 mg/ml collagenase IV (Worthington Biochemical Corp., USA) for 1 hour in Hanks’ balanced salt solution (HBSS; Sigma‐Aldrich, NL) followed by an incubation with anti‐ EpCAM MicroBeads (Miltenyi Biotec, DE) and a positive selection on a magnetic column. Epithelial cells were grown in 75 ml flasks in BEGM growth medium (Lonza Clonetics, NL). Culture medium was replaced every other day. Cells were grown in fully humidified air containing 5% CO2 at 37°C.

69

Specific induction of TSLP by the viral RNA analogue poly(I:C) in primary epithelial cells

The human airway epithelial cell line NCI‐H292 (ATCC, USA) was cultured in RPMI 1640 medium supplemented with 10% (v/v) fetal calf serum (HyClone, USA), 1.25 mM of glutamine, 100 U/ml of penicillin, and 100 µg/ml of streptomycin. Creation of the EGR‐1 and DUSP‐1 knock‐down mutants is described elsewhere.18 Experimental setup Primary nasal epithelial cells or NCI‐H292 cells were cultured to 80% confluence in 12‐well plates. 24 hours before the stimulation, culture medium was replaced with serum‐free RPMI 1640 medium containing 100 U/ml of penicillin and 100 µg/ml of streptomycin. Cells were then stimulated with the following TLR‐agonists: 10 μg/ml PGN (Sigma‐Aldrich, DE); 20 μg/ml poly(I:C) (poly(deoxyinosinic‐deoxycytidylic acid)) (Sigma‐Aldrich, DE); 1 μg/ml flagellin (InvivoGen, USA); 0.5 μM CpG ODN 2216 (InvivoGen, USA) and 5 μg/ml R848 (Sigma‐Aldrich, DE). NCI‐H292 cells were exposed to 20 μg/ml poly(I:C). Supernatants were removed after 1, 2, 4, and 8 hours of stimulation and cells were used for RNA extraction. For the chemokines/mediators measurements, cells were challenged for 24 hours and supernatants were stored at ‐20°C until analyzed. Each experiment was performed in biological triplicate.

RNA extraction and quantitative real‐time polymerase chain reaction analysis Quantitative polymerase chain reaction (qPCR) was used for the determination of the differential expression of selected genes. Extracted RNA (Nucleospin RNA II kit, Machery‐Nagel, DE) was used for cDNA synthesis with the MBI Fermentas first strand cDNA kit (Thermo Scientific, NL). cDNA transcripts were quantified by real‐time quantitative PCR (iCycler iQ MultiColor Real‐Time PCR Detection System; Bio‐Rad, FR) with specific primers and IQTM SYBR Green Supermix (Bio‐Rad, FR). The following primers were used for the PCR reactions: GAPDH: 5’‐GAAGGTGAAGGTCGGAGTC‐3’ and 5’‐GAAGATGGTGATGGGATTTC‐3; IL‐6: 5’‐ TGACAAACAAAT TCGGTACATCCT‐3’ and 5’‐AGTGCCTCTTTGCTGCTTTCAC‐3’; IL‐8: CCACACTGCGCCAACACAGAAATTATTG‐3’; 5’‐GCCCTCTTCAAAAACTTCTCCA CAACCC‐3’; IL‐33: 5’‐TGTGCTTAGAGAAGCAAGATAC TC‐3’ and 5’‐GCCTGTCAACA GCAGTCTACTG‐3; or with mRNA specific TaqMan gene expression assays (Applied Biosystems, NL) for the following genes: ATF‐3 (HS00231069_M1), EGR‐1 (HS00152928_M1), DUSP‐1 (HS00610257_G1), NFKB‐1 (HS00765730_M1), TSLP‐total (Hs00263639_m1); TSLP‐long form (Hs01572933_m1), and IL‐25 (Hs03044841).

Data was analyzed in the Bio‐Rad CFX Manager program (Bio‐Rad, NL) and fold changes of evaluated genes were calculated using the comparative ∆Ct or ∆∆Ct method. Each value was corrected for the expression of the housekeeping gene and compared to the control condition. Statistical significance (P<0.05) was determined by ANOVA and Student’s t‐test using SPSS.

Chapter 5

70

Determination of cytokine and chemokine production by ELISA Measurements of secreted cytokines were performed by sandwich ELISA in 24‐hour cell‐free supernatants. The release IL‐6, IL‐8, IL‐33, and TSLP was detected using pairs of specific mAbs and recombinant standards obtained from BioSource International (Camarillo, USA). Statistical significance (P<0.05) was determined by ANOVA and Student’s t test using SPSS.

Results Expression and activity of Toll‐like receptors in healthy and polyposis epithelium We have previously established the expression profile of TLR receptors in primary nasal epithelium from healthy controls in our experimental model and now we extend this profiling to epithelial cells isolated from nasal polyps. While Figure 5.1A recapitulates the expression of the various TLRs in healthy epithelium, Figure 5.1B shows a similar outcome for the TLR expression in nasal polyposis epithelium. Clear expression was observed for TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, and TLR9, while we failed to detect TLR8 and TLR10 in nasal epithelium from both healthy controls and nasal polyposis patients. Although we did show expression variations between individuals, none of the TLRs showed clearly significant differences between the two groups.

Furthermore, most of these expressed receptors were functionally active given the induced mRNA expression levels of IL‐6 and IL‐8 of ligation with the appropriate ligand (Table 5.1 and 5.2). Just like previously reported for primary healthy nasal epithelium, also here in epithelium of nasal polyps, despite the presence of TLR4 LPS did not induce IL‐6 or IL‐8.

A B

Figure 5.1

Baseline expression level of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and TLR10 in healthy (5 subjects) or polyp epithelium (5 subjects). Expression of each gene was corrected for the expression of the housekeeping gene.

Table 5.1

poly(I:C) flagellin PAM PGN CpG R848

Table 5.2

poly(I:C) flagellin PAM PGN CpG R848

71

Specific induction of TSLP by the viral RNA analogue poly(I:C) in primary epithelial cells

The fold change (FC) induced by different TLR agonists, calculated from the area under the curve for the IL6 gene expression in a time course over 8 hours in healthy and polyp derived airway epithelium. The value represents an average cumulative gene expression response to the TLR agonists in epithelial cells isolated from 6 healthy controls and 5 polyps with a standard deviation. Statistical significance comparing the differences in cumulative gene expression levels between normal or polyp epithelium is indicated as P value.

Healthy epithelium average st.dev.

19.72 1.70 13.05 1.53 15.57 1.70 30.37 7.57 2.38 0.25 2.87 0.75

Polyp epithelium average st.dev.

17.05 5.40 9.98 2.58 17.20 3.72 33.87 7.40 2.88 0.32 3.20 1.08

P values

0.74 0.55 0.55 0.59 0.79 0.56

The fold change (FC) induced by different TLR agonists, calculated from the area under the curve for the IL8 gene expression in a time course over 8 hours in healthy and polyp derived airway epithelium. The value represents an average cumulative gene expression response to the TLR agonists in epithelial cells isolated from 6 healthy controls and 5 polyps with a standard deviation. Statistical significance comparing the differences in cumulative gene expression levels between normal or polyp epithelium is indicated as P value.

Healthy epithelium average st.dev.

9.68 3.57 6.08 4.52 7.28 7.30 18.55 16.00 1.67 0.47 1.72 0.48

Polyp epithelium average st.dev.

11.25 9.17 4.82 3.48 13.27 5.92 27.82 14.63 1.65 0.33 1.77 0.27

P values

0.88 0.39 0.09 0.12 0.92 0.94

Expression and induction of IL‐25, IL‐33, and TSLP by bacterial TLR agonists in nasal epithelium We analysed the impact of microbial stimulation on the potential Th2‐skewing ability of nasal epithelium through measuring the basal expression and induction levels of IL‐25, IL‐33, and the long transcript version of TSLP as functional read‐outs (Table 5.3 and 5.4).

No significant differences in the baseline expression of IL‐33 between healthy control nasal epithelium or epithelium isolated from nasal polyps could be identified. The induction levels for IL‐33 (Table 5.3) are remarkably similar and range between 2.0 ± 0.2 (P<0.05) and 4.1 ± 2.35 (P<0.05) fold for most TLR agonists (flagellin, PAM, CpG, and PGN) acting on epithelial cells isolated from healthy nasal mucosa or nasal polyps. As for TSLP, a moderate induction (3.57 ± 1.45 to 3.78 ± 2.42 fold, P<0.05) is seen after CpG challenge, while it is much more strongly induced by flagellin (51.3 ± 55.6 and 227.8 ± 209.4 fold, P<0.05), PAM (23.4 ± 31.6 and 25.0 ± 20.1 fold, P<0.05), and PGN (103.3 ± 122.8 and 165.3 ± 163.3 fold, P<0.05) but without any significant differences between healthy epithelium and polyp epithelium (Table 5.4). In none of the baseline

Chapter 5

72

or induced conditions of primary healthy epithelium or epithelium isolated from nasal polyps could we detect any IL‐25 mRNA in our real time PCR set up, despite that our protocol was able to amplify IL‐25 mRNA from a positive control (data not shown).

Although this does not preclude the possibility of very low levels of IL‐25 expression we cannot evaluate this mediator in our current experiments.

Table 5.3

poly(I:C) flagellin PAM PGN CpG R848

Table 5.4

poly(I:C) flagellin PAM PGN CpG R848

The fold change (FC) induced by different TLR agonists, calculated from the area under the curve for IL33 in a time course over 8 hours in healthy and polyp derived airway epithelium. The value represents an average cumulative gene expression to the TLR agonists in epithelial cells isolated from 6 healthy controls and 5 polyps with a standard deviation. Statistical significance comparing the differences in cumulative gene expression levels between normal or polyp epithelium is indicated as P value.

Healthy epithelium average st.dev.

3.28 1.22 2.70 0.80 1.95 0.23 4.12 2.35 2.10 0.17 23.18 6.17

Polyp epithelium average st.dev.

2.33 0.58 2.08 0.40 2.08 0.58 3.00 1.25 1.98 0.35 1.57 0.38

P values

0.12 0.67 0.91 0.21 0.88 0.02

The fold change (FC) induced by different TLR agonists, calculated from the area under the curve for TSLP in a time course over 8 hours in healthy and polyp derived airway epithelium.

The value represents an average cumulative gene expression to the TLR agonists in epithelial cells isolated from 6 healthy controls and 5 polyps with a standard deviation. Statistical significance comparing the differences in cumulative gene expression levels between normal or polyp epithelium is indicated as P value.

Healthy epithelium average st.dev 37.55 7.82 227.78 209.42 23.42 31.62 103.30 122.85 3.57 1.45 3.32 1.48

Polyp epithelium average st.dev 487.80 72.20 51.28 55.58 25.00 20.09 165.33 163.28 3.78 2.42 6.62 3.22

P values

0.03 0.12 0.83 0.21 0.88 0.12

Induction and production of IL‐25, IL‐33, and TSLP by viral TLR agonists in nasal epithelium. To further investigate responses of polyposis epithelium to microbial triggers, we exposed nasal epithelial cells from nasal polyps and healthy controls to viral TLR agonists.

So far, a similar level of induction of IL‐6, IL‐8, and IL‐33 in the epithelia of healthy controls and nasal polyposis patients in responses to different bacterial TLR agonists was shown (Table 5.1, 5.2, and Table 5.3) with the viral analogue poly(I:C) (TLR‐3 agonist). However, the TLR7/8 agonist R848 triggers the induction of IL‐33 in healthy epithelium only (23.2 ± 6.17, P<0.05) and not nasal polyposis epithelium (1.57 ± 0.38), despite the IL‐6 and IL‐8 induction levels being similar between those two groups.

73

Specific induction of TSLP by the viral RNA analogue poly(I:C) in primary epithelial cells

The most striking observation is that TSLP expression in nasal polyp epithelium (487.8 ± 72.2 fold, P<0.05) is much more affected by the TLR3 agonist poly(I:C) than in epithelium from healthy individuals (37.5 ± 7.8 fold, P<0.05), despite no significant differences in IL‐6 or IL‐8 up‐regulation levels between both cell types. Moreover, significant differences, albeit smaller, in the induction levels of TSLP are seen in response to CpG stimulation (3.3 ± 1.48 to 6.6 ± 3.2 fold, P<0.05).

Enhanced production and secretion of TSLP in nasal polyp epithelium upon poly(I:C) challenge Quantification of the TSLP gene level revealed that certain TLR agonists enhance its expression. We sought to validate this observation at the protein level. Epithelial cell stimulated with poly(I:C), flagellin, or PGN produced and secreted TSLP (Table 5.5). In response to poly(I:C), polyp‐derived epithelial cells produce 13.0 ± 3.1 (P<0.05) fold more TSLP than the healthy epithelial cells. Cell stimulation with flagellin and PGN resulted in modest TSLP secretion, ranging from 7.3 ± 0.9 to 18.3 ± 10.0 pg/ml and showing no statistically significant differences between control and polyposis epithelium. The enhanced production rate of TSLP after poly(I:C) challenge is TSLP‐ specific, as we could not detect any statistical differences for IL‐8 in response to these (and other) triggers between polyp or healthy nasal epithelium (Table 5.6). Baseline production of TSLP could not be detected in medium collected after 24 hours mock induction. Other TLR agonists did not induce measurable amounts of TSLP despite the significant TSLP‐gene expression up‐regulation.

In the case of IL‐33, we could not detect any protein in our ELISA at baseline or after induction of both type of epithelia with any of the TLR agonists, showing that the production rates of IL‐33 are at best below the detection limit of the ELISA kit.

Table 5.5

poly(I:C) flagellin PAM PGN CpG R848

Production of TSLP protein in cell free supernatants by nasal healthy epithelium or nasal polyp epithelium in response to 24 hours exposure to TLR agonists. Values are shown in pg/ml as average production values from 6 healthy and 5 polyp subjects (b.d. = below detection limit of 1.9 pg/ml). Fold changes (FC) are calculated as a ratio between cytokine production levels in polyposis and healthy tissue.

Healthy Epithelium average st.dev.

5.8 0.9 13.6 3.5 b.d. ‐ 7.3 0.9 b.d. ‐ b.d. ‐

Polyp Epithelium average st.dev.

70.2 7.6 18.3 9.8 b.d. ‐ 9.6 6.9 b.d. ‐ b.d. ‐

FC

12.1 1.3 ‐ 1.3 ‐ ‐

st.dev.

2.3 0.8 ‐ 1.0 ‐ ‐

p values

0.02 0.33 ‐ 0.47 ‐ ‐

Chapter 5

74

Table 5.6

poly(I:C) flagellin PAM PGN CpG R848

Production of IL‐8 protein in cell free supernatants by nasal healthy epithelium or nasal polyp epithelium in response to 24 hours exposure to TLR agonists. Values are shown in pg/ml as average production values from 6 healthy and 5 polyp subjects (b.d. = below detection limit of 1.9 pg/ml). Fold changes (FC) are calculated as a ratio between cytokine production levels in polyposis and healthy tissue.

Healthy Epithelium average st.dev.

5008.4 3982.0 829.4 354.0 621.4 120.6 790.6 174.0 49.2 22.4 34.0 24.4

Polyp Epithelium average st.dev.

4367.3 3433.7 1178.7 842.6 675.4 135.7 1063.9 280.1 56.7 29.5 34.5 24.6

FC

0.9 1.4 1.1 1.4 1.2 1.0

st.dev.

1.0 1.2 0.3 0.5 0.8 1.0

P values

0.69 0.19 0.81 0.11 0.55 0.91

Lower baseline expression of inflammation inhibitors in nasal polyp epithelium We have previously demonstrated that the ATF‐3, EGR‐1, DUSP‐1, and NFKB1 are affected by the airway epithelium exposure to a virus.17 Moreover, EGR‐1 and DUSP‐1 play a critical role in down‐regulating the virus‐triggered inflammatory responses of epithelium.18 Therefore, we sought to investigate whether deregulation of the expression of these transcription factors could potentially be responsible for the enhancement of TSLP production in epithelium isolated from CRSwNP tissue.

DUSP‐1 baseline expression is almost three fold lower (P<0.05) in polyp‐derived epithelium than in healthy epithelium (0.00079 vs. 0.00195). Although not statistically significant, the average basal expression of EGR‐1 is almost two fold higher in nasal epithelium obtained from healthy tissue (0.00105 vs. 0.00063, P=0.065), whereas the average expression of ATF‐3 and NFKB1 had similar level for healthy and polyp epithelium (Figure 5.2). Figure 5.3 shows ATF‐3, EGR‐1, DUSP‐1, and NFKB1 gene expression profiles in healthy or polyp epithelial cells from two representative subjects in response to poly(I:C). Clear differences in the gene expression profiles of the DUSP‐1 and EGR‐1 transcription factors between healthy and polyp epithelium are observed.

Both in healthy and polyp epithelium, EGR‐1 is up‐regulated relatively early, reaching its maximal expression level 1 hour after induction in response to poly(I:C), while DUSP‐1 reaches its maximal expression level after 2 hours. The area under the expression profiling curves revealed a significant enhancement of up‐regulation of EGR‐1 and DUSP‐1 in healthy control epithelium (2.6 fold higher, P<0.05 and 1.7 fold, P<0.05 respectively). ATF‐3 and NFKB1 are both induced at the later time points, but none of the transcription factors showed any significant changes in the poly(I:C) timing or induction levels between healthy and polyps epithelium.

75

Specific induction of TSLP by the viral RNA analogue poly(I:C) in primary epithelial cells

Figure 5.2

Baseline levels expression comparison of ATF‐3, EGR‐1, DUSP‐1, and NFKB1 in healthy or polyp epithelium. Expression profiles were corrected for the expression of the housekeeping gene.

The experiment was performed in a biological triplicate. Statistical significant differences in baseline expression between healthy and polyposis epithelium is indicated (*) if P<0.05.

DUSP‐1 knock‐down results in an enhanced up‐regulation of TSLP Previous observations led us to hypothesize that the down‐regulated baseline expression of the EGR‐1 and/or DUSP‐1 transcription factors in nasal polyp epithelium cells may take a part in the enhanced TSLP production upon poly(I:C) exposure. To investigate this in more detail, we performed a targeted EGR‐1 or DUSP‐1 gene knock‐ down in NCI‐H292 cell that resulted in 92 ± 2% (P<0.0001) of EGR‐1 gene expression reduction and in 76 ± 6 % (P<0.0001) of DUSP‐1 reduction compared to expression levels in the control strain. Generated mutant strains were exposed to poly(I:C) in a time course over 24 hours and gene expression and production of TSLP and IL‐33 were analyzed. This exposure revealed an enhanced up‐regulation of the TSLP gene expression and production in the DUSP‐1 knock‐down cell line. 8 hours after stimulation, TSLP expression reached 170 ± 101 (P<0.05) fold up‐regulation in the control strain and 280.1 ± 105.5 (P 0.05) fold up‐regulation in the EGR‐1 knock‐down strain (control vs. EGR‐1 KD: P=0.059), while in the DUSP‐1 knock‐down strain a strong 2,030.4 ± 362.0 (P<0.05) and significantly higher than in the control strain (control vs.

DUSP‐1: P=0.02) fold TSLP induction (Figure 5.4a). Upon 24 hours stimulation with

Chapter 5

76

poly(I:C), TSLP production was significantly enhanced in the DUSP‐1 knock‐down cells only, resulting in 45.3 ± 6.3 pg/ml of TSLP release, while in the control and the EGR‐1 knock‐down strain, TSLP levels were below the detection limit of the kit (2.1 pg/ml). No significant differences in the IL‐33 expression or production between the three NCI‐ H292 strains could be observed (Figure 5.4b).

Figure 5.3

Comparison of expression profiles of A) ATF‐3, B) EGR‐1, C) DUSP‐1, and D) NFKB1 in a time course over eight‐hour stimulation with poly(I:C) of healthy or polyposis epithelial cells.

Expression profiles were normalized to the control condition with no stimuli and corrected for the expression of the housekeeping gene. The figure shows a result from one representative individual (healthy or CRSwNP) and the experiment was performed in a biological triplicate.

Figure 5.4

Comparison of expression profiles of A) TSLP and B) IL‐33 a time course over 24 hour stimulation with poly(I:C) of NCI‐H292 cells. Expression profiles were normalized to the control condition with no stimuli and corrected for the expression of the housekeeping gene. The experiment was performed with three biological replicates on three different occasions.

77

Specific induction of TSLP by the viral RNA analogue poly(I:C) in primary epithelial cells

Discussion In the approach to understand the pathological, often Th2 skewed, mechanisms underlying nasal polyposis, there is a strong emphasis on potential bacteriological contributions and little data to suggest viral involvement. Our data now show that there could be an additional role for viruses that through specific induction of TSLP in nasal polyposis epithelium would be able to contribute to a Th2‐skewed environment in polyps.

Nasal polyposis is not strongly linked to clinically defined allergy in the form of allergic rhinitis.7 However within polyps structures, local presence and production of IgE and prototypical Th2 cytokines can be observed.22‐24 Here we have shown a poly(I:C)‐ specific induction of TSLP in epithelium from nasal polyposis patients that is much stronger than the induction detected in epithelium from healthy controls. Poly(I:C)‐ induced expression of TSLP has been previously observed in primary human keratinocytes, conjunctival epithelium, as well as in primary human bronchial epithelial cells.25‐27 The nasal epithelial expression of TSLP does seem to differ significantly from the expression in these other epithelial surfaces. Similarly to keratinocytes, which produce TSLP in response to poly(I:C), flagellin (TLR5 agonist) or diacylated lipoprotein (TLR2/TLR6 agonist),28 also nasal epithelium secretes measurable amounts of TSLP after TLR3, TLR5, and TLR2/6 triggering.

In this manuscript we touch upon the specificity of TSLP induction in nasal epithelium.

At the protein level, we show that upon poly(I:C) challenge increased TSLP secretion is only seen in nasal polyposis epithelium and not in healthy epithelium. Moreover, we see only the increased TSLP induction and no increased induction of the other Th2‐ skewing mediators IL‐25 and IL‐33 in nasal polyposis epithelium. The gene expression level brings even more specificity. The increased TSLP mRNA induction was only seen for poly(I:C) and not for any of the other TLR agonists, although at the protein level we could detect a small increase in TSLP after PGN (TLR2/6) and flagellin (TLR5) induction.

Although TSLP, IL‐25, and IL‐33 have all been shown the contribute to the induction of Th2 responses, there seems to be a division of labour where each of the mediators can have a more prominent role depending on the allergy model under investigation.28,29 From this perspective we may conclude that TSLP can be a prominent factor in nasal polyposis associated Th2 skewing. However, we do not yet have a clear understanding whether baseline or induced levels of IL‐33 could have an additional effect via TSLP or whether TSLP would act independently or in conjunction with other Th2 inducing mechanisms. On the other hand, the induction of TSLP by the viral analogue poly(I:C) is perhaps easier to understand from a mechanistic point of view. At the clinical level there are already many parallels between viral infections and allergy ranging from the induction of allergic exacerbations by viral infections [30] to the slow clearance of virus in allergic individuals.31 Recently, we have shown that house dust mite allergen‐ and poly(I:C)‐induced responses share a common mechanism.17 Not only do they induce a similar mediator response, but they also share a common regulatory mechanism

Chapter 5

78

through the involvement of identical transcription factors that positively (NFKB‐1) or negatively (DUSP‐1, EGR‐1) affect the epithelial responses seen after allergen or poly(I:C) exposure. Against this light we can understand that a viral analogue can induce the Th2 skewing mediator TSLP. Although in itself the observation that a specific trigger poly(I:C) is able to induce a response in one type of epithelium (diseased polyp) and not in another type (healthy turbinate) seems straight forward, it is particular that this difference in response is seen for TSLP, but not for other outcome measures like IL‐6 or IL‐8. The 487‐fold induction seen for TSLP in nasal polyposis is much stronger that the induction seen for IL‐6 and IL‐8 in healthy epithelium and furthermore the induction of IL‐6 or IL‐8 is not affected by the diseased state. This could be partially explained by the relatively low baseline levels of TSLP mRNA, but it does suggest a specific regulatory mechanism for TSLP that is less important for other poly(I:C) induced genes.

We have previously shown that negative regulators of inflammation EGR‐1 and DUSP‐1 display different levels of specificity depending on what triggers or what outcome measures are measured. In those experiments focusing on inflammatory responses we could show that a knock‐down for EGR‐1 affected IL‐8 expression after house dust mite allergen (HDM) stimulation, but not after poly(I:C) induction, while a knock‐down for DUSP‐1 affected IL‐6 and IL‐8 after HDM or poly(I:C) stimulation.18 In the present study, we show that the baseline DUSP‐1 levels are lower in polyp epithelium than in healthy control group and that this may contribute to reduced polyp epithelial cell capability of tuning the viral‐induced pro‐Th2 inflammatory responses down. Indeed, knocking‐ down of the DUSP‐1 gene in the airway epithelial cell line resulted in a dramatic up‐ regulation of TSLP after cell exposure to poly(I:C). Interestingly, the level of TSLP enhancement between the control and the DUSP‐1 knock‐down strain was comparable to that between nasal polyp and healthy control epithelium. Involvement of DUSP‐1 in CRSwNP pathology does not come as a surprise since we have previously demonstrated the critical role of DUSP‐1 in abating the inflammatory responses upon dexamethasone challenge18 in airway epithelium. Intranasal administration of glucocorticosteroid is the first line treatment for CRSwNP.7 Since glucocorticoid challenge enhances the DUSP‐1 gene expression and reduces production of inflammatory mediators.18 It may perhaps explain the improvement of the quality of life scores for most CRSwNP individuals, especially those with low baseline expression of DUSP‐1.

In conclusion, we have shown that poly(I:C)‐induces expression of TSLP in primary nasal epithelial cells from polyposis patients only and that a deregulation of the expression of the DUSP‐1 transcription factor may play a role in this process. No other TLR agonists nor primary healthy epithelial cells show the induction of this Th2 skewing mediator.

These observations opens the way to explore the involvement of viral infections as a causative or contributing factor to the Th2‐skewed inflammatory environment in polyps or to the pathogenesis of nasal polyposis.

79

Specific induction of TSLP by the viral RNA analogue poly(I:C) in primary epithelial cells

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

Mjosberg J, Bernink J, Golebski K, Karrich JJ, Peters CP, Blom B, et al. The transcription factor GATA3 is essential for the function of human type 2 innate lymphoid cells. Immunity 2012;37(4):649‐659.

Mjosberg JM, Trifari S, Crellin NK, Peters CP, van Drunen CM, Piet B, et al. Human IL‐25‐ and IL‐33‐ responsive type 2 innate lymphoid cells are defined by expression of CRTH2 and CD161. Nat Immunol 2011;12(11):1055‐1062.

Walker JA, Barlow JL, McKenzie AN. Innate lymphoid cells‐‐how did we miss them? Nat Rev Immunol 2013;13(2):75‐87.

Barlow JL, Peel S, Fox J, Panova V, Hardman CS, Camelo A, et al. IL‐33 is more potent than IL‐25 in provoking IL‐13‐producing nuocytes (type 2 innate lymphoid cells) and airway contraction. J Allergy Clin Immunol. 2013;132(4):933‐941.

Imai Y, Yasuda K, Sakaguchi Y, Haneda T, Mizutani H, Yoshimoto T, et al. Skin‐specific expression of IL‐33 activates group 2 innate lymphoid cells and elicits atopic dermatitis‐like inflammation in mice. Proc Natl Acad Sci U S A. 2013;110(34):13921‐13926.

Kim BS, Siracusa MC, Saenz SA, Noti M, Monticelli LA, Sonnenberg GF, et al. TSLP elicits IL‐33‐ independent innate lymphoid cell responses to promote skin inflammation. Sci Transl Med 2013;5(170):170ra16.

Fokkens WJ, Lund VJ, Mullol J, Bachert C, Alobid I, Baroody F, et al. European Position Paper on Rhinosinusitis and Nasal Polyps 2012. Rhinol Suppl 2012;(23):3‐298.

Muto T, Fukuoka A, Kabashima K, Ziegler SF, Nakanishi K, Matsushita K, et al. The role of basophils and pro‐allergic cytokines, TSLP and IL‐33, in cutaneously‐sensitized food allergy. Int Immunol 2014; 26(10):539‐549.

Ashrin MN, Arakaki R, Yamada A, Kondo T, Kurosawa M, Kudo Y, et al. A critical role for thymic stromal lymphopoietin in nickel‐induced allergy in mice. J Immunol 2014;192(9):4025‐4031.

Jang S, Morris S, Lukacs NW. TSLP promotes induction of Th2 differentiation but is not necessary during established allergen‐induced pulmonary disease. PLoS One 2013;8(2):e56433.

Gregory LG, Jones CP, Walker SA, Sawant D, Gowers KH, Campbell GA, et al. IL‐25 drives remodelling in allergic airways disease induced by house dust mite. Thorax 2013;68(1):82‐90.

Chu DK, Llop‐Guevara A, Walker TD, Flader K, Goncharova S, Boudreau JE, et al. IL‐33, but not thymic stromal lymphopoietin or IL‐25, is central to mite and peanut allergic sensitization. J Allergy Clin Immunol 2013;131(1):187‐200.

Haenuki Y, Matsushita K, Futatsugi‐Yumikura S, Ishii KJ, Kawagoe T, Imoto Y, et al. A critical role of IL‐33 in experimental allergic rhinitis. J Allergy Clin Immunol 2012;130(1):184‐194.

Vroling AB, Fokkens WJ, van Drunen CM. How epithelial cells detect danger: aiding the immune response. Allergy 2008;63(9):1110‐1123..

McDermott AJ, Huffnagle GB. The microbiome and regulation of mucosal immunity. Immunology 2014;142(1):24‐31.

Lin CF, Tsai CH, Cheng CH, Chen YS, Tournier F, Yeh TH. Expression of Toll‐like receptors in cultured nasal epithelial cells. Acta Otolaryngol 2007;127(4):395‐402.

Golebski K, Luiten S, van ED, de GE, Roschmann KI, Fokkens WJ, et al. High Degree of Overlap between Responses to a Virus and to the House Dust Mite Allergen in Airway Epithelial Cells. PLoS One 2014;9(2):e87768.

Golebski K, van ED, de Groot EJ, Roschmann KI, Fokkens WJ, van Drunen CM. EGR‐1 and DUSP‐1 are important negative regulators of pro‐allergic responses in airway epithelium. Mol Immunol 2015;65(1):43‐50.

Vroling AB, Jonker MJ, Luiten S, Breit TM, Fokkens WJ, van Drunen CM. Primary nasal epithelium exposed to house dust mite extract shows activated expression in allergic individuals. Am J Respir Cell Mol Biol 2008;38(3):293‐299.

Ryu WI, Lee H, Kim JH, Bae HC, Ryu HJ, Son SW. IL‐33 induces Egr‐1‐dependent TSLP expression via the MAPK pathways in human keratinocytes. Exp Dermatol 2015;24(11):857‐863.

Bae CH, Choi YS, Song SY, Kim YD. Effect of thymic stromal lymphopoietin on MUC5B expression in human airway epithelial cells. Biochem Biophys Res Commun 2014;448(2):231‐235.

Chapter 5

80

22. Nagarkar DR, Poposki JA, Tan BK, Comeau MR, Peters AT, Hulse KE, et al. Thymic stromal lymphopoietin activity is increased in nasal polyps of patients with chronic rhinosinusitis. J Allergy Clin Immunol 2013;132(3):593‐600.

23. Xie Y, Takai T, Chen X, Okumura K, Ogawa H. Long TSLP transcript expression and release of TSLP induced by TLR ligands and cytokines in human keratinocytes. J Dermatol Sci 2012;66(3):233‐237.

24. Vu AT, Chen X, Xie Y, Kamijo S, Ushio H, Kawasaki J, et al. Extracellular double‐stranded RNA induces TSLP via an endosomal acidification‐ and NF‐kappaB‐dependent pathway in human keratinocytes. J Invest Dermatol 2011;131(11):2205‐2212.

25. Nagarkar DR, Poposki JA, Comeau MR, Biyasheva A, Avila PC, Schleimer RP, et al. Airway epithelial cells activate TH2 cytokine production in mast cells through IL‐1 and thymic stromal lymphopoietin. J Allergy Clin Immunol 2012;130(1):225‐232.

26. Ueta M, Mizushima K, Yokoi N, Naito Y, Kinoshita S. Gene‐expression analysis of polyI:C‐stimulated primary human conjunctival epithelial cells. Br J Ophthalmol 2010;94(11):1528‐1532.

27. Lee KH, Cho KA, Kim JY, Kim JY, Baek JH, Woo SY, et al. Filaggrin knockdown and Toll‐like receptor 3 (TLR3) stimulation enhanced the production of thymic stromal lymphopoietin (TSLP) from epidermal layers. Exp Dermatol 2011;20(2):149‐151.

28. Fort MM, Cheung J, Yen D, Li J, Zurawski SM, Lo S, et al. IL‐25 induces IL‐4, IL‐5, and IL‐13 and Th2‐ associated pathologies in vivo. Immunity 2001;15(6):985‐995.

29. Louten J, Rankin AL, Li Y, Murphy EE, Beaumont M, Moon C, et al. Endogenous IL‐33 enhances Th2 cytokine production and T‐cell responses during allergic airway inflammation. Int Immunol 2011;23(5):307‐315.

30. Papadopoulos NG, Christodoulou I, Rohde G, Agache I, Almqvist C, Bruno A, et al. Viruses and bacteria in acute asthma exacerbations‐‐a GA(2) LEN‐DARE systematic review. Allergy 2011;66(4):458‐468.

31. Copenhaver CC, Gern JE, Li Z, Shult PA, Rosenthal LA, Mikus LD, et al. Cytokine response patterns, exposure to viruses, and respiratory infections in the first year of life. Am J Respir Crit Care Med 2004;170(2):175‐180.

81

Chapter

6

Dendritic cells in nasal mucosa of subjects with different allergic sensitizations

S.M. Reinartz, J. van Tongeren, D Van Egmond, E.J.J. de Groot, C.M. van Drunen, W.J. Fokkens J Allergy Clin Immunol 2011;128(4):887‐890

83

Dendritic cells in nasal mucosa of subjects with different allergic sensitizations

To the Editor The extent of the clinical response to a nasal allergen provocation in allergic rhinitis patients can depend on existing co‐sensitizations. Previously we showed that a pollen provocation in patients mono‐sensitized for pollen induced more symptoms than in patients with a concomitant house dust mite (HDM) sensitization.1 This effect only occurred in mono‐pollen allergic individuals and not in mono‐HDM allergic individuals.

Levels of allergen‐specific IgE, IgG4, or the biological activity of IgE did not differ between groups.

Dendritic cells (DC) are not only essential in the pathogenesis of allergy, but also for expression of clinical symptoms.2 Multiple DC subtypes exist and these may functionally differ, with myeloid DC (mDC) thought to enhance and plasmacytoid DC (pDC) to inhibit immune responses.3 We hypothesized that differences between DCs could explain the differences in clinical symptoms. Outside of the Dutch pollen season, biopsies were taken at baseline and 24 hours after nasal provocation and stained for specific DC‐ markers CD1c (BDCA‐1), CD303 (BDCA‐2), CD141 (BDCA‐3), CD304 (BDCA‐4), and Langerhans (LH) cell‐markers CD1a, and CD207 (langerin). Because DC markers can also be expressed on other cells types we have used a common approach4,5 of also considering the morphology of DCs. Sixty‐six eligible subjects (42 female, median age 23.8 yrs; range 18‐62 yrs) were included in this study. Demographic characteristics were comparable for all groups; Monosens‐GP (n=14); Monosens‐HDM (n=9); Polysens (n=29); Controls (n=14).

Baseline nasal mucosal biopsies revealed all subtypes of dendritic cells, both in the epithelium and in the lamina propria (Figure 6.1 and Table 6.1). CD141 and CD304 antibodies also stained vascular structures and to avoid misidentification we only enumerated these markers in the epithelium. All DC subtypes were detected, albeit at different levels, with the highest levels for CD207 positive cells and the lowest levels for pDC markers CD303 and CD304. Collectively, the numbers did not differ between allergic and healthy individuals. At baseline, the mDC marker CD1c in the lamina propria tended (P=0.055) to be higher in mono‐pollen sensitized subjects (median 3.8; range 0.4‐8.9 cells/mm) than poly‐sensitized subjects (median 1.6; range 0‐8.1 cells/mm). Interestingly, numbers of the pDC marker CD303 were higher (P=0.039) in epithelial layer of mono‐HDM (median 0.2, range 0‐1.1) than in poly‐ sensitized subjects (median 0, range 0‐0.5). These differences were not observed for CD141 or CD304.

Chapter 6

84

Figure 6.1

Immunohistochemical staining with the specific DC markers; CD1c before (A) and 24 hours after (B) nasal challenge, CD303 before (C) and 24 hours after (D) nasal challenge, CD141 (E), CD304 (F), CD1a before (G) and 24 hours after (H) nasal challenge, and CD207 before (I) and 24 hours after (J) nasal challenge in nasal mucosal biopsy sections obtained from patients with allergic rhinitis.

Next we evaluated the effect of a nasal provocation (NP) on DC subtypes, after showing a significant eosinophilia in allergic individuals only, with no differences between the different allergic sensitizations. After NP, epithelial CD1c was significantly higher (P=0.010) in the HDM mono‐sensitized group (median 2.3; range 0‐5.2) than in healthy controls (median 0; range 0‐2.8), and in poly‐sensitized subjects challenged with HDM (median 0; range 0‐3.1 cells/mm BM; P=0.032). This effect was not seen for CD1c in the lamina propria, nor for CD141. For the plasmacytoid DC marker CD303 numbers

85

Dendritic cells in nasal mucosa of subjects with different allergic sensitizations

remained low in the poly‐sensitized subjects (median 0, range 0‐1.0), while increasing in mono‐sensitized HDM subjects (median 0.3; range 0‐1.6; P=0.049) and tending to be higher in mono‐pollen sensitized subjects (0.3; 0‐2.2 cells/mm BM; P=0.057). No significant changes were seen for CD304. We concluded that pDCs in poly‐sensitized subjects do not respond to a single dose allergen provocation. After NP, CD1a in the lamina propria was higher (P=0.039) in mono‐sensitized HDM subjects (median 8.0; range 0‐54.8) than in poly‐sensitized subjects (median 0; range 0‐70.0). Also langerin in mono‐sensitized HDM subjects increased (p = 0.015) from median 3.9 (range 0.2‐9.8) to 6.9 (range 0.3‐11.7). This number tended to decrease in the poly‐sensitized subjects (median 5.0; range 0‐11.6 cells/mm² at baseline versus 3.4; 0‐8.6 cells/mm² after NP; P=0.087).

Table 6.1

Number of dendritic cell subtypes, characterized by immunohistochemical staining, in healthy and allergic rhinitis subjects.

mDC CD1c

CD141 pDC CD303

CD304 LH CD1a CD207

Healthy subjects Epithelium* Lamina Propria** 0.1 (0‐1.7)

1.5 (0‐15.0) 0.4 (0‐11.2) ND (0‐1.2)

0.4 (0‐5.0) 0.0 (0‐2.7) ND 0.9 (0‐5.3)

1.3 (0‐16.2) 6.3 (0‐20.0) 5.8 (0‐18.9)

Allergic subjects Epithelium* Lamina Propria** 0.4 (0‐7.9)

2.4 (0‐17.4) 0.5 (0‐4.6) ND (0‐2.1)

0.8 (0‐9.0) 0.0 (0‐7.2) ND 1.1 (0‐17.0) 2.6 (0‐52.2) 8.6 (0‐20.7) 4.2 (0‐16.1) 2

* Number of cells/mm BM, presented as median (range). ** Number of cells/mm , presented as median (range).

Given the opposite functions of mDCs and pDCs we assessed the immune status through the median ratio of CD1c positive (mDC) over CD303 positive (pDC) cells (Table 6.2). This ratio dropped in the epithelium of healthy subjects after NP, and was significantly (P=0.006) different from allergic subjects. In the lamina propria the ratio in healthy subjects dropped as well, but this was mirrored in allergic subjects.

Interestingly, the ratio was different in the epithelium between mono‐sensitized and polysensitized subjects. In the mono‐sensitized subjects there was a marked increase in the ratio after allergen challenge, whereas polysensitized subjects had a higher ratio at baseline, which slightly decreased after NP, but that still was significantly higher than in the healthy controls.

For the first time, we demonstrate the presence of four previously unidentified DC subsets in human nasal mucosa: myeloid DCs characterized by CD1c and CD141, and plasmacytoid DCs characterized by CD303 and CD304. Moreover we found that numbers of DC‐subsets differ between subjects with different allergic sensitizations.

However, we must consider possible overlap of markers. Most CD303 positive cells in blood also express CD304,6 while in lung most CD1a positive DCs also express CD1c.5 We should note that the markers we have used to identify DCs in the nose may overlap within distinct DC subset so that the different stainings do not indicate more than the

Chapter 6

86

three distinct DC subtypes (pDC, mDC, and LH). Although the extend of this overlap and specificity cannot be fully established with our IHC protocols and could be further explored using FACS analysis of single cell preparations, the main conclusions on the presence of the different DC subtypes and the mDC/pDC should not be affected. The dynamics of several DC subsets after nasal allergen provocation were largest for HDM‐ monosensitized allergic subjects, while overall the dynamics were very limited for the polysensitized individuals. Elevated numbers of DCs in the nasal mucosa of allergic rhinitis subjects, as well as the response to nasal allergen challenge have been reported, with variable outcomes.7‐9 The differences we found between subjects with different sensitizations hint both to allergen‐specific differences in the immune response, and also to an interaction between different allergen sensitizations.

Table 6.2

Median mDC to pDC ratio; number of CD1c positive cells divided by the number of CD303 positive cells in the epithelium and lamina propria of allergic subjects and healthy controls.

epithelium

baseline 24h NP p (compared to controls) baseline 24h NP p (compared to controls)

LP

Controls

All allergic 1.01 1.00 0.006

Mono‐ HDM 1.00 5.96 0.002

Mono‐ GP 1.03 1.52 0.013

Poly‐prov HDM 1.80 1.00 0.014

Poly‐prov GP 1.30 1.00 0.015

1.00 0.51

3.55 2.17

2.98 1.92 NS

3.96 3.13 NS

3.97 2.07 NS

3.48 1.45 NS

1.51 2.36 NS

GP, Grass pollen; LP, lamina propria; Mono‐GP, subjects with monosensitization to grass pollen allergen and relevant symptoms; Mono‐HDM, Subjects with monosensitization to HDM allergen and relevant symptoms; NS, not significant; Poly‐prov GP, Subjects with polysensitization and relevant symptoms, who underwent allergen provocation with grass pollen allergen; Poly‐prov HDM, Subjects with polysensitization and relevant symptoms, who underwent allergen provocation with house dust mite allergen.

High baseline levels of mDCs in mono‐pollen allergic subjects could reflect ongoing minimal persistent inflammation outside of the pollen season,10 showing that pollen allergic individuals are not normal even when free of symptoms. Whether mDCs are responsible for maintaining allergic inflammation outside of the pollen season or for the increased response to nasal allergen provocation remains to be explored. It is not clear whether these differences are caused by the type of allergen, the number of sensitizations, or the duration of exposure. As we have not determined the activation state for different subclasses of DC by evaluating the expression levels of activation markers, we solely depend on changes in cell numbers to evaluate the status of the immune system.

The mDC/pDC ratio is equal for allergic and healthy subjects, however after NP the ratio in healthy subjects decreases, while remaining the same in allergic subjects. This suggests a lack of immunosuppression in the allergic subjects. Furthermore, in the

87

Dendritic cells in nasal mucosa of subjects with different allergic sensitizations

mono‐sensitized subjects the mDC/pDC ratio increased after NP compared to controls, whereas in poly‐sensitized subjects this ratio decreased only slightly. This may reflect the molecular mechanism of the less severe clinical response to grass pollen in polysensitized subjects.

Chapter 6

88

References 1.

Reinartz SM, van RR, Versteeg SA, Zuidmeer L, van Drunen CM, Fokkens WJ. Diminished response to grass pollen allergen challenge in subjects with concurrent house dust mite allergy. Rhinology 2009; 47(2):192‐198.

2. Hammad H, Lambrecht BN. Recent progress in the biology of airway dendritic cells and implications for understanding the regulation of asthmatic inflammation. J Allergy Clin Immunol 2006;118(2):331‐336.

3. van Tongeren J, Reinartz SM, Fokkens WJ, de Jong EC, van Drunen CM. Interactions between epithelial cells and dendritic cells in airway immune responses: lessons from allergic airway disease. Allergy 2008; 63(9):1124‐1135.

4. Demedts IK, Brusselle GG, Vermaelen KY, Pauwels RA. Identification and characterization of human pulmonary dendritic cells. Am J Respir Cell Mol Biol 2005;32(3):177‐184.

5. Van Pottelberge GR, Bracke KR, Demedts IK, De RK, Reinartz SM, van Drunen CM, et al. Selective accumulation of langerhans‐type dendritic cells in small airways of patients with COPD. Respir Res 2010;11:35.

6. Dzionek A, Fuchs A, Schmidt P, Cremer S, Zysk M, Miltenyi S, et al. BDCA‐2, BDCA‐3, and BDCA‐4: three markers for distinct subsets of dendritic cells in human peripheral blood. J Immunol 2000;165(11): 6037‐6046.

7. Jahnsen FL, Lund‐Johansen F, Dunne JF, Farkas L, Haye R, Brandtzaeg P. Experimentally induced recruitment of plasmacytoid (CD123high) dendritic cells in human nasal allergy. J Immunol 2000;165:4062‐4068 8. KleinJan A, Willart M, van Rijt LS et al. An essential role for dendritic cells in human and experimental allergic rhinitis. J Allergy Clin Immunol 2006;118:1117‐1125.

9. Ekman AK, Erjefält JS, Jansson L, Cardell LO. Allergen‐induced accumulation of CD68, CD123(+) dendritic cells in the nasal mucosa. Int Arch Allergy Immunol 2011;155(3):234‐242 10. Canonica GW, Compalati E. Minimal persistent inflammation in allergic rhinitis: implications for current treatment strategies. Clin Exp Immunol 2009;158(3):260‐271.

89

Chapter

7

Dendritic cell subsets in oral mucosa of allergic and healthy subjects

S.M. Reinartz, J. van Tongeren, D. Van Egmond, E.J.J. de Groot, W.J. Fokkens, C.M. van Drunen PLoS One 2016;11(5):e0154409

Chapter 7

90

Abstract Immunohistochemistry was used to identify, enumerate, and describe the tissue distribution of Langerhans type (CD1a and CD207), myeloid (CD1c and CD141), and plasmacytoid (CD303 and CD304) dendritic cell subsets in oral mucosa of allergic and non‐allergic individuals. Allergic individuals have more CD141+ myeloid cells in epithelium and more CD1a+ Langerhans cells in the lamina propria compared to healthy controls, but similar numbers for the other DC subtypes.

Our data are the first to describe the presence of CD303+ plasmacytoid DCs in human oral mucosa and a dense intraepithelial network of CD141+ DCs. The number of Langerhans type DCs (CD1a and CD207) and myeloid DCs (CD1c), was higher in the oral mucosa than in the nasal mucosa of the same individual independent of the atopic status.

91

Dendritic cell subsets in oral mucosa of allergic and healthy subjects

Introduction Antigen‐presenting dendritic cells (DCs) form a heterogeneous group of cells based on what cellular lineages they originate from and their stimulatory or suppressive contribution to immune responses. The DC population of upper and lower airway mucosa and of peripheral blood have been shown to comprise of Langerhans type, myeloid, and plasmacytoid DCs using immunohistochemical staining with specific cell markers.1‐4 The goal of our study was to identify and characterize dendritic cell subtypes in human oral mucosal biopsies by immunohistochemical staining in allergic and non‐allergic individuals. Furthermore, we performed a detailed comparison of oral and nasal mucosal DCs in the same individuals.

The interplay between the immune stimulatory or suppressive activities of DCs is important for both the induction of an immune response and the maintenance of local homeostasis. In respiratory mucosa, myeloid DCs (mDCs) play an essential role in sustaining a chronic eosinophilic airway inflammation,5 whereas plasmacytoid DCs (pDC) are important in maintaining tolerance to inhaled harmless antigen.6 Previously we have shown that the mDC/pDC ratio in nasal mucosa is similar for allergic and healthy subjects at baseline, but that after nasal allergen provocation this ratio in healthy subjects decreases while in allergic subjects this ratio remains unchanged. This not only suggested the induction of an immunosuppressive activity in healthy individuals upon allergen encounter, but even more importantly, that allergic individuals seem to lack this immunosuppressive activity.

For human oral mucosa, the interplay between different subtypes of DCs in relation to immune stimulatory or suppressive activities is less clear. This is due to only a few studies addressing these issues. In regards to the composition of DC subtypes in oral mucosa in mice three distinct subtypes of oral DCs were characterized: CD207+ Langerhans cells, CD11b +CD11c+/‐ myeloid DCs, and B220+120G8+ plasmacytoid DCs.7 The CD 207+ DCs may also express CD103, which is identified as the main migratory subtype able to cross‐present viral and self‐antigens, critical for the initiation of CD8+ T cell responses.8 In human oral mucosa also Langerhans type cells and myeloid DCs have been detected, with the Langerhans cells representing the predominating DC population.9 Contrary to the findings in mice, plasmacytoid DCs characterized by CD123+ could not be detected in the human oral mucosa of atopic and non‐atopic individuals.10‐12 In addition to differences in DC composition, also functional aspects of oral DC are potentially different to DC at other mucosal surfaces. Oral antigen‐ presenting cells have been considered to exhibit a partly tolerogenic phenotype, leading to suppression of local and systemic immune responses after orally administering antigens. This concept is also referred to as oral tolerance, and can be seen as a form of peripheral tolerance that could prevent harmful responses to harmless antigens, such as antigens from food or commensal bacteria. In mice studies some of these differences with respiratory DCs emerge where CD11b+CD11c‐ DCs only induced IFN‐gamma production by T‐cells, while oral CD11b+CD11c+ and B220+120G8+

Chapter 7

92

DCs induced IFN‐gamma and IL‐10 secreting T cells. Given that in none of these experiments any expression of the cytokine IL‐5 could be detected, it would seem that the immune system of the oral mucosa is more attuned to Th1 response (INF‐gamma) and immune suppressive responses (IL‐10) than to Th2 responses (IL‐5). Indeed also in human studies, the presence of immunosuppressive enhancing molecules (B7‐H2 and B7‐H3) on oral Langerhans cells7 and relative high mRNA levels of IL‐10 and TGF‐beta9,10 suggest such an immune suppressive environment. However, it is not clear how the immune system deals with the multitude of antigenic triggers from the environment, not only making sure that the response is appropriately Th1 or Th2, but even making sure that such a response is at all required. It may well be that the suggested lack of Th2 responses in oral mucosa could be related to or play a role in the effectiveness of sublingual immunotherapy (SLIT). Indeed, Langerhans type cells in human oral mucosa are thought to contribute to the effectiveness of SLIT. 9,10,13‐15 In order to get a better understanding of the local oral mucosal immune system, we have quantified the oral Langerhans type cells as well as oral myeloid and plasmacytoid DCs and studied their local tissue distribution. The subject population we have investigated in this manuscript is the same population where we have previously reported the dynamics of the local nasal mucosal DC populations.2 This also allows us to explore the relationship of oral DCs with the allergic state and the direct comparison of nasal and oral DC populations in single individuals.

Methods Subjects The subjects in this study were adults with allergic rhinitis (AR) with or without asthma (n=52) of which 14 subjects with seasonal AR symptoms and grass pollen mono‐ sensitization, 9 subjects with perennial rhinitis and house dust mite mono‐sensitization, and 29 subjects with perennial rhinitis with increasing symptoms during the pollen season and poly‐sensitization, including house dust mite and grass pollen. The diagnosis of AR was based on a history of rhinitis symptoms for at least two years and a positive skin prick test. At screening, all subjects were tested for a panel of 10 common inhalant allergens (ALK‐Abello BV, Nieuwegein, Netherlands). A skin prick test was considered positive when the wheal diameter was 3 mm larger than that produced by the negative control after 15 minutes. These allergic subjects were compared with healthy controls (n=14) without any rhinitis symptoms and a negative skin prick test. All subjects were non‐smokers and were clinically stable. Subjects were excluded if they suffered from a disorder likely to interfere with the test results. All medication for AR treatment was appropriately stopped before enrolment. Subjects with asthma were allowed to participate in the study if they were able to stop their asthma medication during the study. Thus, 66 eligible subjects (52 patients and 14 controls; 41 female, median age

93

Dendritic cell subsets in oral mucosa of allergic and healthy subjects

23.8 years; range 18‐62 years) were included in this study. Demographic characteristics were comparable between groups. All participants gave written informed consent to the study, which was approved by the medical ethics committee of the Academic Medical Center, Amsterdam, Netherlands under project number MEC03/201.

Study design Oral and nasal mucosal biopsies were taken from the same individuals at the same time point, and were stained with several DC‐markers to identify and enumerate different dendritic cell subsets. We compared the number of DCs per subset in the oral mucosa between allergic subjects and healthy controls, and compared the number of DCs per subset between nasal and oral mucosa.

Oral and nasal mucosal biopsies and immunohistochemical staining Oral mucosa biopsies were taken from the vestibular site of the oral mucosa, without anesthesia, by using a Fokkens forceps with a cup diameter of 2.5 mm. Nasal biopsies were taken under local anesthesia by placing a cotton‐wool carrier with 50‐100 mg of cocaine and three drops of epinephrine (1: 100,000) under the inferior turbinate, without touching the biopsy site. Then, a mucosal biopsy sample was obtained from the lower edge of the inferior turbinate about 2 cm posterior to the edge, using a Fokkens forceps with a cup diameter of 2.5 mm. All biopsies were taken by the same investigator (S.M.R.). The biopsies were embedded in Tissue‐ Tek II Optimal Cutting Temperature (OCT) compound (Sakura Finetek USA Inc., Torrance, CA, USA), frozen and stored at ‐80°C as previously described.16 Immunohistochemical stainings of frozen sections were performed for specific myeloid DC‐markers CD1c (BDCA‐1) and CD141 (BDCA‐3), plasmacytoid DC‐markers CD303 (BDCA‐2) and CD304 (BDCA‐4), and Langerhans cell‐markers CD1a, and CD207 (langerin). The BDCA markers can also be expressed on other cells like B cells so we also used the morphology of the cells to identify DCs.3,4,17 Immunohistochemical staining was performed as previously described.18 The following mouse‐anti‐human mAbs were used for immunohistochemical staining by link label staining protocol: CD1a (IgG2b, 50 μg/ml, SK9, BD Pharmingen, the Netherlands), and CD207 (IgG1, 200 μg/ml, DCGM4, BD Pharmingen, the Netherlands). The following mouse‐anti‐human mAbs were used for immunohistochemical staining by tyramide signal amplification staining protocol: CD1c (IgG2a, 100 μg/ml, AD5‐8E7, MACS, the Netherlands), CD141 (IgG1, 100 μg/ml, AD5‐14H12, MACS, the Netherlands), CD303 (IgG1, 100 μg/ml, AC144, MACS, the Netherlands), and CD304 (IgG1, 100 μg/ ml, AD5‐17F6, MACS, the Netherlands).

Chapter 7

94

Link label staining protocol.

The mAb stainings were developed with the supersensitive alkaline phosphatase (ss‐AP) method as previously described.19 Briefly, each tissue specimen was cut into serial 5‐μm‐thick sections, transferred onto slides, dried, and stored at ‐80°C. Before staining, slides were heated to room temperature and subsequently dried and fixed in acetone for 10 min. Slides were then rinsed in phosphate‐buffered saline (PBS; pH 7.4), and 10% normal goat serum (NGS) in block buffer was added for 10 min.

Subsequently, slides were incubated with mouse monoclonal antibody to CD1a, or CD207 for 60 min. Sections were rinsed with PBS, incubated with goat anti‐mouse immunoglobulin biotin‐labeled (1:50; Biogenex) + 10% normal human serum (NHS) for 30 min, and rinsed with PBS. Slides were then incubated for 30 min with Streptavidine‐ AP (1:50; Biogenex) in block buffer + 10% NHS, and again rinsed with PBS. Next, slides were rinsed with Tris buffer (0.1 M, pH 8.5), and incubated with New Fuchsin substrate for 20 min. Sections were then rinsed with PBS and with distilled water. Finally sections were counterstained with Gill's hematoxyline for 4 min, rinsed in water, dried, and mounted in Vectamount. Control sections, incubated with irrelevant mAbs of the same subclass and at the same protein concentration as the specific antibody, were negative.

Tyramide Signal Amplification staining protocol This staining method differed from the staining method described earlier in the inclusion of a tyramide signal amplification step (TSA; NEN Inc., Boston, MA). Briefly, tissue fixation was done in acetone for 10 min, followed by rinsing in PBS (pH 7.4), and blocking with 10% NGS in block buffer for 10 min. Subsequently, slides were incubated with mouse mAb to CD1c, CD141, CD303, or CD304 for 60 min and rinsed with PBS. Then slides were incubated with goat anti‐mouse immunoglobulin biotin‐labeled (1:50; Biogenex) + 10% NHS for 30 min. After rinsing in PBS, endogenous peroxidase was blocked with azide (0.3%), hydrogen peroxide (0.1%) and methanol (50%) in PBS. Slides were rinsed with PBS. This was followed by incubation with streptavidin‐HRP (1:100) in block buffer + 10% NHS for 30 min, rinsing with PBS, incubation with TSA (1:40,000) in TSA‐buffer for 10 min, rinsing with PBS, and incubation with AP‐conjugated goat antibiotin antibody + 10% NHS (Sigma) for 30 min. This was followed by rinsing with PBS, rinsing with Tris buffer (0.1 M, pH 8.5), and incubation for 20 min with New Fuchsin substrate. The sections were rinsed in PBS and then in distilled water, counterstained with Gill's hematoxyline for 4 min, and mounted in Vectamount. Control sections, incubated with irrelevant mAbs of the same subclass and at the same protein concentration as the specific antibody, were negative.

Analysis Positively stained inflammatory cells, localized in epithelium and subepithelium (area 100 μm into the lamina propria along the length of the epithelial basement membrane),

95

Dendritic cell subsets in oral mucosa of allergic and healthy subjects

were counted along the basement membrane (BM). Cell numbers were expressed as positively stained cells per mm BM epithelium or per mm2 of the lamina propria.

Immunohistochemical staining with CD141 in oral mucosa was assessed on a 3‐point scale with 0 meaning no staining, 1 some staining, and 2 extensive staining.

All data were analyzed by SPSS software. The Chi‐square test was used for analysis of CD141 staining, and the Mann‐Whitney U test and Kruskal‐Wallis test were used for between‐ group analysis and all other comparisons. A P value less than .05 was considered significant.

Results Identification of dendritic cell subsets in human oral mucosa We identified Langerhans type, myeloid, and plasmacytoid dendritic cells in human oral mucosal biopsies taken from allergic individuals, and healthy controls (Table 7.1, S7.1 and S7.2 files).

Table 7.1

Number of dendritic cell subtypes in human oral and nasal mucosa, characterized by immunohistochemical staining, in healthy and allergic subjects.

Controls Allergic

Nasal epi* Nasal LP** Oral Epi* Oral LP** Nasal epi* Nasal LP** Oral Epi* Oral LP** mDC CD1c 0.1 1.5 23.1 42.9 0.4 2.4 18.8 43.1 (0‐1.7) (0‐15.0) (0‐78) (5.5‐114) (0‐7.9) (0‐17.4) (0‐105) (0‐204) CD141 0.4 ND see ND 0.5 ND See ND (0‐11.2) table 7.2 (0‐4.6) table 7.2 pDC CD303 1.0 0.4 0.0 1.6 1.0 0.8 0.0 (0‐ 2.5 (0‐1.2) (0‐5.0) (0‐1.2) (0‐9.7) (0‐2.1) (0‐9.0) 4.0) (0‐40) CD304 0.0 ND 0 ND 0.0 ND 0 ND (0‐2.7) (0‐7.2) LH CD1a 0.9 1.3 12.3 6.4 1.1 2.6 13.1 13.7 (0‐5.3) (0‐16.2) (0‐157) (0‐32) (0‐17.0) (0‐52.2) (0‐210) (0‐80) CD207 6.3 5.8 30.1 14.7 8.6 4.2 48.4 20.5 (0‐20.0) (0‐18.9) (0‐108) (0‐60) (0‐20.7) (0‐16.1) (0‐165) (0‐116) * Epithelium, number of cells/mm BM, presented as median (range); ** Lamina propria, number of 2 cells/mm , presented as median (range).

To identify the Langerhans type cell subset we used the markers CD207 (Figure 7.1A) and CD1a (Figure 7.1B). Significant numbers of CD207+ cells where observed in both the epithelial layer and in the lamina propria (LP), but there were no significant differences between the allergic subjects (median 48.4; range 0‐165 cells/mm in the epithelium, and 20.5; 0‐116 cells/ mm² in the LP) and healthy controls (30.1; 0‐108 cells/mm in the epithelium, and 14.7; 0‐60 cells/mm² in the LP). Overall, the numbers for CD207+ and CD1a+ cells were similar. Again for the CD1a+ cells in the epithelium

Chapter 7

96

the numbers were not different for allergic subjects (median 13.1; range 0‐210 cells) or healthy controls (median 12.3; range 0‐157 cells/mm). In the lamina propria however, the number of CD1a+ cells was significantly higher (P=0.026) in the allergic subjects (median 13.7; range 0‐80 cells/mm² LP) compared to the healthy controls (median 6.4; 0‐32 cells/mm² LP).

A CD027 (langerin B CD1a C CD1c (BDCA‐1)

D CD141 (BDCA‐3) E CD303 (BDCA‐2) F CD304 (BDCA‐4)

Figure 7.1

Immunohistochemical staining of a section of human oral mucosa. Staining of dendritic cell subsets was performed with specific markers: A. CD207 (langerin), B. CD1a, C. CD1c (BDCA‐1), D. CD141 (BDCA‐3), E. CD303 (BDCA‐2), and F. CD304 (BDCA‐4). Counterstained with hematoxyline. Original magnification 100x.

To identify the myeloid DC subsets we used the markers CD1c (BDCA‐1) and CD141 (BDCA‐3) in combination with cell morphology. The number of CD1c cells (Figure 7.1C) in the allergic subjects was 18.8 cells/mm (median; range 0‐105) in the epithelium and 43.1 cells/mm2 (median; range 0‐204) in the LP, which was not significantly different from the healthy controls who had 23.1 cells/mm (median; range 0‐78) in the epithelium and 42.9 cells/mm2 (median; range 5‐114) in the LP. Immunohistochemical staining with CD141 in oral mucosa showed a confluent layer of staining, in which it was impossible to distinguish and count separate cells (Figure 7.1D). Therefore we decided to assess this with a categorical scale 0‐2 (Table 7.2 and S7.2 File.). The amount of CD141 staining was significantly higher in allergic subjects than in healthy controls (P=0.043).

The number of plasmacytoid DCs in the oral mucosa, as characterized by CD303 (BDCA‐2) positive cells (Figure 7.1E), was much lower than the number of Langerhans type and myeloid DCs in both allergic and healthy individuals (Table 7.1). In allergic

97

Dendritic cell subsets in oral mucosa of allergic and healthy subjects

subjects the number of CD303+ DCs in the epithelium was 0.0 cells/mm (median; range 0‐4.0), and in the lamina propria 2.5 cells/mm2 (median; range 0‐40). This was not significantly different from the healthy controls, which had 0.0 cells/mm (median; range 0‐1.2) in the epithelium, and 1.6 cells/mm2 (median; range 0‐9.7) in the LP. Immunohistochemical staining with CD304 (BDCA‐4; Figure 7.1F) was negative in the epithelium in both allergic and healthy individuals. Immunohistochemical staining with CD304 led to staining of vascular structures in the lamina propria, however no cells with dendritic cell morphology were identified.

Table 7.2 Categories 0 1 2 Total

Amount of CD141+ DCs in human oral epithelium in healthy and allergic subjects.

Number of subjects controls allergic 6 7 5 31 2 11 13 49

Total 13 36 13 62

Amount of CD141+ DCs in human oral epithelium in healthy and allergic subjects are categorized on a 3‐point scale: 0 = no staining, 1 = some staining, and 2 = extensive staining.

Oral versus nasal mucosal dendritic cells We compared the number of the distinct DC subsets between oral and nasal mucosa in matched samples from allergic subjects and in healthy controls (Table 7.1). Nasal mucosal biopsy specimens revealed all subtypes of DCs, both in the epithelium and in the lamina propria, albeit at different levels. We found highest levels for CD207+ cells and the lowest levels for the pDC markers CD303 and CD304. Collectively, cell numbers in the nasal mucosa did not differ between allergic and healthy subjects. The number of Langerhans type DCs, characterized by staining with CD1a and CD207, was significantly higher in the oral mucosa. Also the number of myeloid DCs, characterized by CD1c staining, was significantly higher in the oral mucosa, compared to nasal mucosa, both in healthy and allergic subjects. Staining with CD141 in the oral mucosa showed a confluent layer of stained cells, in which it was impossible to distinguish and count separate cells. However these were evidently more than the few CD141+ cells that we found in the nasal epithelium.

In contrast, the number of plasmacytoid DCs, characterized by CD303 (BDCA‐2), was comparable in the oral and nasal epithelium. The DC subset characterized by CD304 (BDCA‐4) was present in low numbers in the nasal epithelium, but completely absent in the oral epithelium both in healthy and allergic subjects.

Chapter 7

98

Discussion We demonstrated the presence of Langerhans type, myeloid, and plasmacytoid DCs, characterized by the specific DC markers CD1a and CD207, CD1c and CD141, and CD303 respectively, in human oral mucosa of allergic subjects and healthy controls.

Interestingly, the use of multiple markers for pDCs and mDCs revealed a different composition of pDC and mDC subsets in human oral mucosa than has been reported for nasal mucosa and in the circulation. Moreover the oral tissue distribution for CD141 (BDCA‐3) positive DCs is remarkably different than in the nasal mucosa. Furthermore, we found significantly more CD141+ myeloid DCs in epithelium and CD1a+ Langerhans cells in the lamina propria of allergic subjects compared to healthy controls. In contrast, the mDC population characterized by CD1c (BDCA‐1) was similar for both allergic and healthy individuals. In the direct comparison between oral and nasal DC subtypes, we showed that the number of Langerhans type and the CD141 (BDCA‐3) positive mDCs is overall much higher in oral mucosa compared to nasal mucosa. Especially the CD141 (BDCA‐3) positive oral mDCs seem to form a continuous intraepithelial layer, akin the distribution of Langerhans cells in mouse dermal sheets.20,21 It has been suggested that CD141+ DCs are the human counterpart of murine CD103+ DCs, and are the main cross‐ presenting DCs of human tissues.21,22 DCs have an important role in regulation of immune responses that mainly relies on the ligation of specific receptors that initiate and modulate DC maturation. This results in the development of functionally different effector DC subsets that selectively promote different pro‐inflammatory T helper subtypes or regulatory T cell responses.23 For instance, in skin, Langerhans cells in the epithelial layer seem more adapt to detect viruses than bacteria in the environment through the presence of Toll‐like receptors (TLRs) able to detect viral associated molecular patterns and the absence of TLRs able to detect bacterial associated molecular patterns. Furthermore, given that skin LCs through their poor capacity to process and present bacterial antigens are seen to induce a more tolerogenic response towards bacteria.24 Not only in the normal antimicrobial response there is functional specialization, but also in relation to allergic disease. In respiratory mucosa, myeloid DCs play an essential role in chronic eosinophilic airway inflammation,5 while plasmacytoid DCs are important in maintaining tolerance to inhaled harmless antigen.6 For this reason the ratio of mDCs to pDCs is often used to describe the overall immunogenic status.2,25‐27 Even though we have shown that in the nasal mucosa the mDC to pDC ratio would describe the clinical observations seen in the response to nasal allergen provocation,2 the mDC to pDC ratio is not adequate to describe the overall tolerogenic environment of the oral mucosa. As a consequence of the high number of mDCs, and the low number of pDCs in the oral mucosa the ratio of myeloid DCs over plasmacytoid DCs is much higher in the oral epithelium than in the nasal epithelium, which in contrast to clinical observations, would point to a more pro‐inflammatory oral environment.

99

Dendritic cell subsets in oral mucosa of allergic and healthy subjects

We found very low levels of plasmacytoid DCs in the oral mucosa, which suggests that pDCs overall do not play a significant role in oral tolerance, in contrast to nasal and bronchial mucosae. This led to several questions regarding other differences in response between nasal and oral mucosa with respect to the ability of DCs to induce tolerance. Given the difference in composition of DC subsets between the oral mucosa and the nasal mucosa, we consider that the oral DC subsets have different functional capacities from those in the nasal mucosa. A detailed mapping of the oral mucosa antigen‐presenting cells has been performed in mice; three distinct subtypes of oral DCs were characterized: CD207+ Langerhans cells located in the mucosa itself, CD11b+CD11c+ myeloid DCs located mainly along the lamina propria, and B220+120G8+ plasmacytoid DCs in submucosal tissues.7,28 Data on DC phenotype within human oral mucosa are limited. The Langerhans type (CD207+) cells were thought to represent the predominating DC population in human oral mucosa.9,10 The presence of myeloid DCs, characterized by CD1a, in human oral mucosa has also been shown,11 but plasmacytoid DCs, characterized by CD123+, could previously not be detected in atopic or nonatopic individuals.12 Our survey of the oral mucosa revealed abundant numbers of CD141+ myeloid dendritic cells, and CD207 and CD1a positive Langerhans cells. Given the postulated ability of (skin) Langerhans cells to induce tolerogenic responses towards bacteria these high numbers could be in line with the notion of the oral tolerogenic environment.

Possibly tolerogenic response towards bacteria could be extended towards the uptake and processing of allergens as well, based on similarities in molecular patterns. DCs in the human oral mucosa express the high‐ affinity receptor for IgE (FcεRI) in high amounts,9 in which context they differ from DCs in the nasal mucosa. Interestingly this is not only seen in atopic individuals, but also in non‐atopic individuals.29 Fc mediated uptake could therefore be involved in the direct uptake of allergens by DCs in the oral mucosa.30 The direct contact between DCs and T cells observed within the oral mucosa29 and the regulatory T cell inducing capacity of Langerhans cells could therefore be seen to contribute to a local immunosuppressive environment.

Another potentially important observation in our study is the dense intraepithelial network of CD141+ DCs in the oral mucosa of allergic subjects. As myeloid DCs are thought to be immunogenic the implication is that the pro‐inflammatory immune response to aero‐allergens could either be driven from the oral mucosa in allergic subjects, or represents a lack of tolerogenic properties in the oral mucosa in allergic subjects. This aspect is specific for oral mucosa, as in a previous study we did not find a significant difference in the number of CD141+ DCs in the nasal mucosa between allergic subjects and healthy controls.2 Moreover in a mouse model of bronchial asthma, CD141+ DCs were shown to be tolerogenic. They expressed lower levels of maturation markers, secreted more anti‐inflammatory cytokine IL‐10, and adoptive transfer of CD141+ DCs caused a reduction in BALF levels of eosinophils, IL‐5, IgE, and total protein.31

Chapter 7

100

In conclusion, we have shown the abundance of Langerhans cells and CD141+ myeloid dendritic cells in the oral mucosa of allergic and healthy individuals, and our work is the first report of CD303+ plasmacytoid dendritic cells in oral mucosa. The direct comparison between the distribution of these DC subtypes between oral and nasal mucosa in the same individuals revealed potentially important differences. These differences suggest that the suppression of immune responses could be regulated in distinct fashions at both mucosal surfaces. A better understanding of these mechanisms could lead to optimization of sublingual immunotherapy in particular.

101

Dendritic cell subsets in oral mucosa of allergic and healthy subjects

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

Dzionek A, Fuchs A, Schmidt P, Cremer S, Zysk M, Miltenyi S et al. BDCA‐2, BDCA‐3, and BDCA‐4: three markers for distinct subsets of dendritic cells in human peripheral blood. J Immunol 2000;165(11): 6037‐6046.

Reinartz SM, van Tongeren J, van Egmond D, de Groot EJ, Fokkens WJ, van Drunen CM. Dendritic cells in nasal mucosa of subjects with different allergic sensitizations. J Allergy Clin Immunol 2011;128(4): 887‐890.

Van Pottelberge GR, Bracke KR, Demedts IK, De Rijck K, Reinartz SM, van Drunen CM et al. Selective accumulation of langerhans‐type dendritic cells in small airways of patients with COPD. Respir Res 2010; 11:35.

Van Pottelberge GR, Bracke KR, Van den Broeck S, Reinartz SM, van Drunen CM, Wouters EF et al.

Plasmacytoid dendritic cells in pulmonary lymphoid follicles of patients with COPD. Eur Respir J 2010; 36(4):781‐791.

Lambrecht BN, Salomon B, Klatzmann D, Pauwels RA. Dendritic cells are required for the development of chronic eosinophilic airway inflammation in response to inhaled antigen in sensitized mice. J Immunol 1998;160(8):4090‐4097. de Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA et al. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. J Exp Med 2004; 200(1):89‐98.

Mascarell L, Lombardi V, Louise A, Saint‐Lu N, Chabre H, Moussu H et al. Oral dendritic cells mediate antigen‐specific tolerance by stimulating TH1 and regulatory CD4+ T cells. J Allergy Clin Immunol 2008; 122(3):603‐609.

Nudel I, Elnekave M, Furmanov K, Arizon M, Clausen BE, Wilensky A et al. Dendritic cells in distinct oral mucosal tissues engage different mechanisms to prime CD8+ T cells. J Immunol 2011;186(2):891‐900.

Allam JP, Novak N, Fuchs C, Asen S, Berge S, Appel T et al. Characterization of dendritic cells from human oral mucosa: a new Langerhans' cell type with high constitutive FcepsilonRI expression. J Allergy Clin Immunol 2003;112(1):141‐148.

Allam JP, Stojanovski G, Friedrichs N, Peng W, Bieber T, Wenzel J et al. Distribution of Langerhans cells and mast cells within the human oral mucosa: new application sites of allergens in sublingual immunotherapy? Allergy 2008;63(6):720‐727.

Novak N, Gros E, Bieber T, Allam JP. Human skin and oral mucosal dendritic cells as 'good guys' and 'bad guys' in allergic immune responses. Clin Exp Immunol 2010;161(1):28‐33.

Allam JP, Niederhagen B, Bucheler M, Appel T, Betten H, Bieber T et al. Comparative analysis of nasal and oral mucosa dendritic cells. Allergy 2006; 61(2):166‐172.

Allam JP, Peng WM, Appel T, Wenghoefer M, Niederhagen B, Bieber T et al. Toll‐like receptor 4 ligation enforces tolerogenic properties of oral mucosal Langerhans cells. J Allergy Clin Immunol 2008; 121(2):368‐374.

Allam JP, Duan Y, Winter J, Stojanovski G, Fronhoffs F, Wenghoefer M et al. Tolerogenic T cells, Th1/Th17 cytokines and TLR2/TLR4 expressing dendritic cells predominate the microenvironment within distinct oral mucosal sites. Allergy 2011; 66(4):532‐539.

Jonuleit H, Schmitt E, Schuler G, Knop J, Enk AH. Induction of interleukin 10‐producing, nonproliferating CD4(+) T cells with regulatory properties by repetitive stimulation with allogeneic immature human dendritic cells. J Exp Med 2000; 192(9):1213‐1222.

Godthelp T, Holm AF, Fokkens WJ, Doornenbal P, Mulder PG, Hoefsmit EC et al. Dynamics of nasal eosinophils in response to a nonnatural allergen challenge in patients with allergic rhinitis and control subjects: a biopsy and brush study. J Allergy Clin Immunol 1996; 97(3):800‐811.

Demedts IK, Brusselle GG, Vermaelen KY, Pauwels RA. Identification and characterization of human pulmonary dendritic cells. Am J Respir Cell Mol Biol 2005; 32(3):177‐184.

Braunstahl GJ, Overbeek SE, Fokkens WJ, KleinJan A, McEuen AR, Walls AF et al. Segmental bronchoprovocation in allergic rhinitis patients affects mast cell and basophil numbers in nasal and bronchial mucosa. Am J Respir Crit Care Med 2001; 164(5):858‐865.

Chapter 7

102

19. KleinJan A, Godthelp T, Blom HM, Fokkens WJ. Fixation with Carnoy's fluid reduces the number of chymase‐positive mast cells: not all chymase‐positive mast cells are also positive for tryptase. Allergy 1996; 51(9):614‐620.

20. Bedoui S, Whitney PG, Waithman J, Eidsmo L, Wakim L, Caminschi I et al. Cross‐presentation of viral and self antigens by skin‐derived CD103+ dendritic cells. Nat Immunol 2009; 10(5):488‐495.

21. Haniffa M, Shin A, Bigley V, McGovern N, Teo P, See P et al. Human tissues contain CD141hi cross‐ presenting dendritic cells with functional homology to mouse CD103+ nonlymphoid dendritic cells.

Immunity 2012; 37(1):60‐73.

22. Collin M, McGovern N, Haniffa M. Human dendritic cell subsets. Immunology 2013; 140(1):22‐30.

23. Kapsenberg ML. Dendritic‐cell control of pathogen‐driven T‐cell polarization. Nat Rev Immunol 2003; 3(12):984‐993.

24. van der Aar AM, Picavet DI, Muller FJ, de BL, van Capel TM, Zaat SA et al. Langerhans cells favor skin flora tolerance through limited presentation of bacterial antigens and induction of regulatory T cells. J Invest Dermatol 2013;133(5):1240‐1249.

25. Fukunaga T, Soejima H, Irie A, Fukushima R, Oe Y, Kawano H et al. High ratio of myeloid dendritic cells to plasmacytoid dendritic cells in blood of patients with acute coronary syndrome. Circ J 2009; 73(10):1914‐1919.

26. Kirsche H, Niederfuhr A, Deutschle T, Fuchs C, Riechelmann H. Ratio of myeloid and plasmacytoid dendritic cells and TH2 skew in CRS with nasal polyps. Allergy 2010;65(1):24‐31.

27. Ueda Y, Hagihara M, Okamoto A, Higuchi A, Tanabe A, Hirabayashi K et al. Frequencies of dendritic cells (myeloid DC and plasmacytoid DC) and their ratio reduced in pregnant women: comparison with umbilical cord blood and normal healthy adults. Hum Immunol 2003;64(12):1144‐1151.

28. Mascarell L, Lombardi V, Zimmer A, Louise A, Tourdot S, Van OL et al. Mapping of the lingual immune system reveals the presence of both regulatory and effector CD4+ T cells. Clin Exp Allergy 2009; 39(12):1910‐1919.

29. Novak N, Allam JP. Mucosal dendritic cells in allergy and immunotherapy. Allergy 2011;66 Suppl 95: 22‐24.

30. Novak N, Haberstok J, Bieber T, Allam JP. The immune privilege of the oral mucosa. Trends Mol Med 2008;14(5):191‐198.

31. Takagi T, Taguchi O, Toda M, Ruiz DB, Bernabe PG, D'Alessandro‐Gabazza CN et al. Inhibition of allergic bronchial asthma by thrombomodulin is mediated by dendritic cells. Am J Respir Crit Care Med 2011; 183(1):31‐42.

103

Chapter

8

General discussion

General discussion

105

General discussion The immunological debate “Genes or Environment” has resulted in many heated discussions at international forums, although the ultimate goal of the organisers has always been to strengthen the notion that we should consider “Genes and Environment”. The reason we should consider both is that environmental factors are only able to trigger or affect immune responses through genes/proteins whose function or activity are dependent on the presence of these specific environmental factors. This notion applies to a broad range of stimuli such as the presence of bacteria and viruses, or to changes in temperature or the exposure to strong odours. A complicating factor in this discussion that is not always taken into consideration is that to some degree we are all different and that the environment is complex with changing composition so that it could be hard, if at all impossible, to define how the human immune system would respond. In this thesis we have explored this interesting research field further by studying if differences between individuals may impact the response to well defined single environmental triggers. Furthermore, we have explored how one environmental trigger may affect the response to another environmental trigger, and how ultimately the effect of the interplay between environment and genes is handed down to affect the initiation or in the other case the regulation of immune responses. The experimental model used is the nasal immune response and more specifically the response that is triggered in primary nasal epithelial cells of a collection of healthy and diseased volunteers.

Nasal epithelium as a regulator of immune responses Much of the efforts of our research group have focussed on the contribution of nasal epithelium to the regulation of immune responses. In this area we have contributed to the notion that epithelium in general and nasal epithelium in particular is much more than just a passive barrier and that it actively contributes to the initiation and regulation of local immune responses.1‐5 Whereas in previous work we have focussed on the interaction of allergens with nasal epithelium and the impact of allergic disease,3‐5 in this thesis we have focussed on the interaction of nasal epithelium with microbial products. Specifically we have focussed on the expression and activity of toll‐ like receptors (TLRs) probably the most studied receptor family with the ability to react to a wide variety of bacterial, viral, or fungal associated factors.1,6 We showed expression of TLR1‐6 and TLR97 and mainly respond to the TLR3 ligand poly(I:C) and to a lesser extent to the TLR2 agonist PGN and TLR‐5 by flagellin, while we failed the detect the presence of TLR7, TLR8 and TLR10. This survey of the expression of TLRs is broader than some previous studies that looked at specific receptors only.

At present only limited data is available on the expression of TLRs by nasal epithelial cells. Claeys et al. showed constant expression of TLR2 and TLR4 in tissue biopsies from

Chapter 8

106

patients with nasal polyposis or chronic rhinosinusitis and in healthy individuals.8 Isolated nasal epithelial cells from nasal polyps were shown to constitutively express mRNA of all 10 TLRs, with more pronounced expression of TLR1 to 6.9 Primary nasal polyp epithelial cells express functional TLR3 and TLR4 and release high concentrations of proinflammatory chemokines and cytokines upon stimulation with dsRNA.10 Until now, only one study showed the expression of TLR3, TLR7 and TLR9 and function of TLR3 and TLR7 in primary nasal epithelial cells isolated from non‐allergic, non‐diseased individuals specifically.11 When we consider the overall expression and activity of TLR expression in our study it seems clear that healthy individuals show epithelial expression of TLR4, but that this receptor does not induce a response. Despite the presence of imported co‐stimulatory molecules like MD2 and CD14 nasal epithelial expressed TLR4 cannot be activated by its main ligand LPS at physiological concentrations. This raises important questions concerning experiments where only the presence of the receptors (either at the RNA level or protein level) is used to draw a conclusion about their functionality.8,9,12 Although it would be unlikely that the presence of a specific receptor would not predict the functional activity (in our studies it nearly always does), it does raise the possibility that in selective cases the presence might not predict its functionality. The case of nasal epithelial expressed TLR4 does not constitute a unique case. A similar observation that separated presence from functionality of TLR4 was seen in gut epithelium, albeit in in this instance the lack of activity of TLR4 was due to the absence of MD2 as co stimulatory factor as forced expression of MD2 restored TLR4 functionality.13,14 Given that the gut and nasal cavity are rich in bacteria the functional inactivity of TLR4 can be seen as a way of reducing the local inflammatory profile and maintaining homeostasis.

However, this does suggest that specific conditions might exist where TLR4 does show full functional activity. Indeed we showed that in nasal epithelium isolated from polyposis patients did respond to LPS with increasing levels of IL6 and IL8, indicating that the health state (or disease state, depending on the perspective) can have functional consequences. It remains to be explored whether or TLR4 is active or not in vivo. Most experiments on TLR functionality, and ours are no exception, have focussed on isolated epithelial cells (or on data collected from cell lines) and this may not true reflect the in vivo situation11,15‐19 as the differentiation state in vitro is different. In vivo undifferentiated stem‐like cells or basal epithelial cells co‐exist with ciliated epithelial cells, mucus producing goblet cells, and stem‐like basal cells that each might have a specific contribution to the overall TLR induced response. This situation is clearly different from submerged grown epithelium cell that would only reflect the more undifferentiated stem‐like cells. An air‐liquid interphase model of nasal epithelial cells would be one step closer to mimicking the in vivo situation.

General discussion

107

Immune responses and the complexity of the environment Experimental models that study the impact of the environment on local tissue often, if not uniquely, apply a single stimulus at the time. Indeed in this way we can learn about the concentration dependency and time course of a response in detail. However, such a model does hardly reflect our everyday exposure to the environment. Although it could apply to any setting, the nasal cavity in particular is a trigger rich environment. On one hand there are the bacteria that colonize the mucosal surface that would form a relative constant source of triggers, while on the other hand breathing through our nose provides ample opportunity for a wide variety of other airborne triggers to interact with the nasal mucosa. These triggers could be viruses or other bacteria, in which case we should not underestimate the impact of nose picking, volatile chemicals in our working environment, dust particles, air pollution, cigarette smoke, or airborne allergens.2,20‐22 In the latter case this exposure to allergens is not only relevant for allergic individuals, as one might easily assume, but also for otherwise healthy individuals. Indeed we have previously shown that the nasal epithelia from healthy individuals elicit a strong and broad response to allergens like house dust mite or grass pollen.4,5,23,24 A response that is stronger and broader than the same response in allergic individuals, albeit that this is largely due to a pre‐activated state in the epithelia from allergic individuals.4 Our data show that it is relevant to consider the complexity of our environment as exposure to one trigger affects the response to another trigger. Interestingly, both triggers do not need to be present at the same time. In our experiments a 24 hours pre‐ exposure with the TLR3 agonist poly(I:C) resulted in a functional up‐regulation of TLR2.

This could be partly due that it takes up to 8 hours to see the up‐regulation of the mRNA for TLR2. These induced mRNA levels linger for more than 32 to 40 hours by which time they have returned to baseline. The effect of TLR3 stimulation on TLR2 activation is only one aspect we have studied in detail. As TLR3 activation also results in an up‐regulation of TLR1, TLR2, and TLR3 itself a lot remains to be explored.

Interestingly, TLR5 reactive to flagellin, is strongly down‐regulated. However, like the effect of TLR stimuli other than poly(I:C) and their effects on other TLR‐family members, the functional consequences of these changes have not yet been documented.

With the TLR family of receptors sharing common downstream signalling molecules and all of these receptors being involved in detecting and responding to microorganisms, one might imagine that cross‐regulation could be restricted to members of a given family. However, this is unlikely to be the case as other observations from our group fussing on the response of poly(I:C) and allergen showed an interaction between the two triggers. Pre‐exposure of epithelial cells to house dust mite allergen reduced the cellular response to poly(I:C) stimulation at the mRNA and the protein level.2 Also here this could be due to an effect via the receptor as TLR3 is indeed down regulated upon house dust mite allergen exposure. Perhaps cross‐regulation of distinct triggers is more common that we think as ultimately the signalling mechanism of any trigger will

Chapter 8

108

converge on the promoter of a given response gene no matter how different the initial signalling cascade would be.

Immune responses and the effect of disease Understanding differences in immune responses between the health and the diseased state is dependent on many factors and it can be hard to discriminate whether any of these differences are the cause or the consequence of the disease. This applies to situations where the disease trigger is firmly established like in allergy, but should also apply to diseases where the initial trigger has not yet been identified.

When we would first consider allergy it is clear that allergic individuals produce allergen‐specific IgE that through binding to immune competent cells would create targets in the local tissue that are not present in the healthy state. Some of these are direct targets like antigen‐specific IgE that would allow allergen to trigger responses in mast cells, basophils, or other cells carrying IgE on their cell surface. In addition, as allergen is also able to trigger responses in for instance epithelial cells through proteinase dependent 4 or DCs through mannose dependent receptors25 any new cell type would provide a potential new target. Now this would present a problem when we would try to link differences in immune responses at the tissue level to the reason that someone had developed allergy or any other disease for that matter. These issues would be a smaller problem when we would try to understand to what degree a patient responds to medical or surgical treatment, or when we would try to predict the natural course of the disease. With these research questions any of the cellular or molecular differences between diseased individuals (rather than the differences between healthy and diseased individuals) could be involved in these clinical observations. In the former case it would make sense to investigate those cells or processes that would be present during the onset of the disease. In an ideal world it would be very useful to have a full molecular description of a group of individuals that would then be followed over time to see who will and who will not develop a particular disease. In the ENT field perhaps occupational allergy would be an interesting disease model as you would be able to sample individuals prior to employment. On a side note we might consider sampling individuals even sooner to compensate for exposure during training and/or schooling.

Given the notion that we would need to study intrinsic differences between cells that are present at the moment the disease develops, it would mean that we definitely would need to understand what the healthy response is and compare that the response triggered after the disease has been established. Growing and sub‐culturing primary nasal epithelial cells would potentially allow us to identify intrinsic differences.

However, we must not forget that the inflammation associated with the diseased state can induce epigenetic changes or auto‐regulatory feedback loops in a cell type that could potentially mask intrinsic difference that would be the cause of the disease.

General discussion

109

Transmission of the innate epithelial immune response to the adaptive immune response Although nasal epithelium is potentially the first cell type to come into contact with external triggers of disease, this does not imply that it would be due to the some defect in the epithelial response that disease would develop. Given the notion of immunological disease and a chain of events leading from the innate to the adaptive response at any of these stages a decision could go wrong and a disease may develop.

Our departmental research effort have focussed on the role of nasal epithelium and the work described in this thesis focusses specifically on the role of the anti‐microbial response. In many of the most common ENT diseases microbes are either the cause of the disease as with infectious rhinitis, or bacteria and viruses are thought to contribute to the symptomatology. Examples of the latter case for instance would be Staphylococcus aureus infection or bacterial biofilms affecting nasal polyposis and chronic rhinosinusitis or viruses inducing allergic exacerbations.26‐28 Traditionally, dendritic cells have been seen as the main protagonists responsible for linking the innate and adaptive immune response. Indeed, the studies reported on in this thesis do show that clear differences can be detected in the cellular makeup of dendritic cells that could be relevant for the disease state. Recently a new cell line has been identified that could perform a similar, but not identical role. These new cells resemble T cells as they are also of lymphoid origin, yet they lack the T cell receptor.29 Remarkably, these innate lymphoid cells (ILCs) come in the same flavours as dendritic cells where IL4 producing cells induce Th2 responses and INF‐gamma producing cells stimulate Th1 responses.30,31 In addition there are there also Th17 and Th22 skewing subtypes that like the other ILC subtypes share the transcription machinery that governs their differentiation status in dendritic cells. Moreover the ILC Th2 subtypes respond to the same key epithelial mediators that trigger Th2 responses (TSLP, IL25, and IL33) in dendritic cells. In the allergy field the role of ILCs could be to help to create a Th2 environment, but DCs still to seem to be essential for the allergen‐specificity of the reaction as they would be able to present allergenic epitopes where ILCs would not.

Furthermore as ILCs have no T cell receptor this also precludes them from acting downstream of dendritic cells. The role of ILCs could even be more important in nasal polyposis. Not only are nasal polyposis relative very rich in ILC2 compared to tissues in others diseases, but they may also offer an explanation that polyps are Th2‐skewed despite the absence of a clear link with the atopic status of nasal polyposis patients.32 Indeed it may then not come as a big surprise that we see increased levels of TSLP being secreted by nasal polyposis epithelial cells. This observation and the presence of ILCs would help to explain the Th2 skewed polyp environment, however the potential involvement of viruses does shine some new light on alternative pathogenic or pathophysiological mechanism. It would be interesting to note that some polyposis patients report their first awareness of the disease after experiencing a viral infection, but admittedly this could also be due that an average patients might find it hard to

Chapter 8

110

discriminate symptoms caused by virus from those caused by nasal polyposis. A viral hypothesis of the pathogenesis of nasal polyposis has been suggested before, but perhaps with our report of a potential mechanism this research avenue might deserve a second chance.33

Immune regulation and the complexity of the genetic makeup To a certain degree it makes sense to consider groups of individuals as representatives of a healthy or a diseased population. Even though we are all different, the diseased individuals at least share a particular disease and studying their commonalities should then teach us something about the disease. This approach does however assume that the patients suffer from the same disease. While at the clinical level this could be well established, it remains to be explored that if this is the case if than the same applies at the molecular level. In the case of allergic rhinitis patients will have symptoms only when exposed to the allergen they are allergic to and when exposed some symptoms will be more prevalent than others. Different level of symptoms would or could be triggered by different levels of a particular mediator or sets of mediators. When on top of this we consider that there could be high and/or low affinity receptors for these mediators, a complicated picture emerges where each diseased individual could be suffering from his or her own personal disease.

The diseases that face the ENT specialist they share many symptoms. Rhinorrhoea or nasal blockage, to mention only two, can be seen in allergic rhinitis, chronic rhinosinusitis, nasal polyposis, and basically all other forms of rhinitis, despite the most often clearly distinct aetiologies of these diseases. In regards to the molecular profiles that will surface from the study of these diseases we must assume that some of the molecular profiles in a given individual must be related to the specific aetiology of the disease, while other profiles somehow will reflect the symptom experienced by that individual. Although this may seem to further complicate our efforts to study a particular disease, at the same time it offers a great opportunity. The commonalities and differences between diseases (or between individuals for that matter) will provide us with the tools to tease apart these disease and symptom specific profiles.

Whereas diseased individuals at least share their common disease this does not apply for the control group of healthy individuals. Without the confounding factor of disease there would potentially be a broader range of expression patterns that could define the healthy state. The variation of expression of the TLRs in nasal epithelium ranges several orders of magnitude in healthy controls, however this is matched by a similar spread of expression in disease (nasal polyposis). The huge variation of TLR expression is not a new observation in our study, but in other older studies it may have been less obvious as it is often hidden in large standard deviations or reported ranges.8,10,11 This shows that the immune system is able to work, probably correctly, despite these huge variations. In the case of the TLRs we know that the ligands that trigger them are also

General discussion

111

able to trigger response of an alternative class of cytosolic receptors.34,35 Whether or not these other receptors have a specific function that is not covered by the TLRs is not known, adding to the growing complexity when we try to understand TLR contribution to immune responses. Not only the variation of expression we detect offers some clues to what can be considered normal, but also the mediator response that is triggered in healthy controls provides us with a glimpse of what can be considered normal. We tend to forget that when trying to understand the disease state is would be helpful to appreciate what is normal. In this respect we should also be careful when extrapolating results as a conclusion may strongly depend on what outcome measure was used to reach that conclusion. In our experiments we saw a strong increase in TSLP protein and mRNA expression after stimulation with poly(I:C) of polyposis epithelium and not of healthy epithelium. However, this increase reactivity towards poly(I:C) was not seen for IL6 or IL8. Evidently, TSLP has a different rate limiting step (or different induction mechanism) than IL6 or IL8 so that the differential effect of poly(I:C) signalling might never have been otherwise detected.

The variation in expressions we see at the mRNA level are not necessarily directly reflected at the protein level and also in our experiments the variations in protein level are often smaller than at the mRNA level. This can be understood as there will be an additional level of regulation that governs how efficiently mRNA will be translated.

Moreover when translation, instead of transcription, is the rate limiting step leading to the production of the protein, then increasing levels of mRNA will not automatically lead to higher proteins levels. That knowing the rate limiting step of a given process is an important, if not the most important, aspect in understanding the consequences of these changes is largely unacknowledged, mostly likely because we know so little about the complexity of the responses we are investigating. A more efficient translation induced by flagellin probably contributes to the increased production of TSLP we could detect in nasal polyposis epithelium, as this increased protein expression was not mirrored at the mRNA level.

Summary and future perspectives In this thesis we have tried to emphasise the notion that we are all different, either as a healthy or as a diseased individual. Although this genetic or molecular complexity results in additional challenges it also offers great opportunities. Comparing commonalities and differences between individuals; healthy, diseased, or suffering from another disease, would help us to understand the aetiology or pathogenesis of a disease and what would be required to keep us healthy. Moreover this notion is essential to the concept of personalized medicine, where each diseased individual is thought to suffer from a highly specific disease that would require a tailored treatment regime. Not only have we shown that we are all different, but we have also explored the impact of the complexity of our environment. Exposure to one trigger does affect

Chapter 8

112

Figure 8.1

Nasal Mucosa on a Chip.

the responsiveness to another trigger. In nasal epithelial cells the viral trigger induces a stronger reaction when the cells are next exposed to a bacterial trigger. This observation would tie in with the clinical observation of bacterial super‐infections occurring during an initial viral infection. Addressing the topic of viruses, we have developed the notion that viruses could play a role in the pathogenesis or pathophysiology of nasal polyposis. During these studies we have not only shown that the disease state in nasal polyposis affects the activity of TLRs, but also that as a consequence epithelial cells produce significant amounts of TSLP after viral exposure.

As TSLP is an important regulator of local Th2 responses this observation may go a long way towards explaining the overall Th2‐skewed micro‐environment seen in nasal polyps. A final thought would be that it would be interesting to develop “nasal tissue on a chip” –model where we have reconstituted the local nasal mucosa with its complex cellular make‐up. This would allow us not only to study the impact of the complexity of the environment, but also include the interaction of the local tissue with immune competent cells like dendritic cells are innate lymphoid cells that together constitutes and regulates the initiation and differentiation of our immune responses.

General discussion

113

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

Vroling AB, Fokkens WJ, van Drunen CM. How epithelial cells detect danger: aiding the immune response. Allergy 2008;63(9):1110‐1123.

Golebski K, Luiten S, van Egmond D, de Groot E, Röschmann KI, Fokkens WJ, van Drunen CM. High degree of overlap between responses to a virus and to the house dust mite allergen in airway epithelial cells. PLoS One 2014;9(2):e87768.

Muller B, de Groot EJ, Kortekaas IJ, Fokkens WJ, van Drunen CM. Nasal epithelial cells express IL‐10 at levels that negatively correlate with clinical symptoms in patients with house dust mite allergy. Allergy 2007;62(9):1014‐1022.

Vroling AB, Jonker MJ, Luiten S, Breit TM, Fokkens WJ, van Drunen CM. Primary nasal epithelium exposed to house dust mite extract shows activated expression in allergic individuals. Am J Respir Cell Mol Biol 2008;38(3):293‐299.

Vroling AB, Duinsbergen D, Fokkens WJ, van Drunen CM. Allergen induced gene expression of airway epithelial cells shows a possible role for TNF‐alpha. Allergy 2007;62(11):1310‐1319.

Akira S, Takeda K, Kaisho T. Toll‐like receptors: critical proteins linking innate and acquired immunity.

Nat Immunol 2001;2(8):675‐80. Review. van Tongeren J, Röschmann KI, Reinartz SM, Luiten S, Fokkens WJ, de Jong EC, van Drunen CM. Expression profiling and functional analysis of Toll‐like receptors in primary healthy human nasal epithelial cells shows no correlation and a refractory LPS response. Clin Transl Allergy 2015;5:42.

Claeys S, de Belder T, Holtappels G, Gevaert P, Verhasselt B, van Cauwenberge P, Bachert C. Human beta‐defensins and toll‐like receptors in the upper airway. Allergy 2003;58(8):748‐753.

Lin CF, Tsai CH, Cheng CH, Chen YS, Tournier F, Yeh TH. Expression of Toll‐like receptors in cultured nasal epithelial cells. Acta Otolaryngol 2007;127(4):395‐402.

Wang J, Matsukura S, Watanabe S, Adachi M, Suzaki H. Involvement of Toll‐like receptors in the immune response of nasal polyp epithelial cells. Clin Immunol 2007;124(3):345‐352.

Tengroth L, Millrud CR, Kvarnhammar AM, Kumlien Georén S, Latif L, Cardell LO. Functional effects of Toll‐like receptor (TLR)3, 7, 9, RIG‐I and MDA‐5 stimulation in nasal epithelial cells. PLoS One 2014;9(6):e98239.

Fransson M, Adner M, Erjefält J, Jansson L, Uddman R, Cardell LO. Up‐regulation of Toll‐like receptors 2, 3 and 4 in allergic rhinitis. Respir Res 2005;6:100.

Abreu MT, Vora P, Faure E, Thomas LS, Arnold ET, Arditi M. Decreased expression of Toll‐like receptor‐4 and MD‐2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopolysaccharide. J Immunol 2001;167(3):1609‐1616.

Lenoir C, Sapin C, Broquet AH, Jouniaux AM, Bardin S, Gasnereau I, Thomas G, Seksik P, Trugnan G, Masliah J, Bachelet M. MD‐2 controls bacterial lipopolysaccharide hyporesponsiveness in human intestinal epithelial cells. Life Sci 2008;82(9‐10):519‐528.

Melkamu T, Squillace D, Kita H, O'Grady SM. Regulation of TLR2 expression and function in human airway epithelial cells. J Membr Biol 2009;229(2):101‐113.

Melkamu T, Kita H, O'Grady SM. TLR3 activation evokes IL‐6 secretion, autocrine regulation of Stat3 signaling and TLR2 expression in human bronchial epithelial cells. J Cell Commun Signal 2013;7(2): 109‐118.

Ritter M, Mennerich D, Weith A, Seither P. Characterization of Toll‐like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll‐like receptors, adaptor proteins and inflammatory response. J Inflamm (Lond) 2005;2:16.

Schulz C, Farkas L, Wolf K, Kratzel K, Eissner G, Pfeifer M. Differences in LPS‐induced activation of bronchial epithelial cells (BEAS‐2B) and type II‐like pneumocytes (A‐549). Scand J Immunol 2002;56(3):294‐302.

Sha Q, Truong‐Tran AQ, Plitt JR, Beck LA, Schleimer RP. Activation of airway epithelial cells by toll‐like receptor agonists. Am J Respir Cell Mol Biol 2004;31(3):358‐364.

Terada N, Hamano N, Maesako KI, Hiruma K, Hohki G, Suzuki K, Ishikawa K, Konno A. Diesel exhaust particulates upregulate histamine receptor mRNA and increase histamine‐induced IL‐8 and GM‐CSF production in nasal epithelial cells and endothelial cells. Clin Exp Allergy 1999;29(1):52‐59.

Chapter 8

114

21. Roberts JW, Dickey P. Exposure of children to pollutants in house dust and indoor air. Rev Environ Contam Toxicol 1995;143:59‐78.

22. Folkerts G, Nijkamp FP. Airway epithelium: more than just a barrier! Trends Pharmacol Sci 1998;19(8):334‐341.

23. Röschmann KI, van Kuijen AM, Luiten S, Jonker MJ, Breit TM, Fokkens WJ, Petersen A, van Drunen CM. Purified Timothy grass pollen major allergen Phl p 1 may contribute to the modulation of allergic responses through a pleiotropic induction of cytokines and chemokines from airway epithelial cells. Clin Exp Immunol 2012;167(3):413‐421.

24. Röschmann KI, van Kuijen AM, Luiten S, Jonker MJ, Breit TM, Fokkens WJ, Petersen A, van Drunen CM. Comparison of Timothy grass pollen extract‐ and single major allergen‐induced gene expression and mediator release in airway epithelial cells: a meta‐analysis. Clin Exp Allergy 2012;42(10):1479‐1490.

25. Salazar F, Sewell HF, Shakib F, Ghaemmaghami AM. The role of lectins in allergic sensitization and allergic disease. J Allergy Clin Immunol 2013;132(1):27‐36.

26. You H, Zhuge P, Li D, Shao L, Shi H, Du H. Factors affecting bacterial biofilm expression in chronic rhinosinusitis and the influences on prognosis. Am J Otolaryngol 2011;32(6):583‐590.

27. Singhal D, Foreman A, Jervis‐Bardy J, Wormald PJ. Staphylococcus aureus biofilms: Nemesis of endoscopic sinus surgery. Laryngoscope 2011;121(7):1578‐1583.

28. Papadopoulos NG, Christodoulou I, Rohde G, Agache I, Almqvist C, Bruno A, Bonini S, Bont L, Bossios A, Bousquet J, Braido F, Brusselle G, Canonica GW, Carlsen KH, Chanez P, Fokkens WJ, Garcia‐Garcia M, Gjomarkaj M, Haahtela T, Holgate ST, Johnston SL, Konstantinou G, Kowalski M, Lewandowska‐Polak A, Lødrup‐Carlsen K, Mäkelä M, Malkusova I, Mullol J, Nieto A, Eller E, Ozdemir C, Panzner P, Popov T, Psarras S, Roumpedaki E, Rukhadze M, Stipic‐Markovic A, Todo Bom A, Toskala E, van Cauwenberge P, van Drunen C, Watelet JB, Xatzipsalti M, Xepapadaki P, Zuberbier T. Viruses and bacteria in acute asthma exacerbations‐‐a GA² LEN‐DARE systematic review. Allergy 2011;66(4):458‐68.

29. Spits H, Di Santo JP. The expanding family of innate lymphoid cells: regulators and effectors of immunity and tissue remodeling. Nat Immunol 2011;12(1):21‐27.

30. Mjösberg JM, Trifari S, Crellin NK, Peters CP, van Drunen CM, Piet B, Fokkens WJ, Cupedo T, Spits H. Human IL‐25‐ and IL‐33‐responsive type 2 innate lymphoid cells are defined by expression of CRTH2 and CD161. Nat Immunol 2011;12(11):1055‐1062.

31. Spits H, Artis D, Colonna M, Diefenbach A, Di Santo JP, Eberl G, Koyasu S, Locksley RM, McKenzie AN, Mebius RE, Powrie F, Vivier E. Innate lymphoid cells‐‐a proposal for uniform nomenclature. Nat Rev Immunol 2013;13(2):145‐149..

32. Mjösberg J, Bernink J, Golebski K, Karrich JJ, Peters CP, Blom B, te Velde AA, Fokkens WJ, van Drunen CM, Spits H. The transcription factor GATA3 is essential for the function of human type 2 innate lymphoid cells. Immunity 2012;37(4):649‐659.

33. Weille FL. Further experiments in the viral theory of nasal polyp etiology. Ann Allergy 1966;24(10): 549‐551 34. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, Uematsu S, Jung A, Kawai T, Ishii KJ, Yamaguchi O, Otsu K, Tsujimura T, Koh CS, Reis e Sousa C, Matsuura Y, Fujita T, Akira S. Differential roles of MDA5 and RIG‐I helicases in the recognition of RNA viruses. Nature 2006;441(7089):101‐105.

35. Opitz B, van Laak V, Eitel J, Suttorp N. Innate immune recognition in infectious and noninfectious diseases of the lung. Am J Respir Crit Care Med 2010;181(12):1294‐1309.

115

Summary

Summary

117

Summary To a certain degree our notion of the immune response has matured from a limited view of a successive action of dendritic cells, T lymphocytes and B lymphocytes into a complex view of cross‐talk between not only these dedicated immune competent cells but also other cells that form the local environment these cells are active in.

In this thesis we address the importance of nasal epithelial cells as an interactive interface with the (microbial) environment and their contribution to the regulation of local immune responses.

Chapter 1 provides an overview of our understanding of the intimate relationship between tissue resident dendritic cells (DC) and epithelial cells. It describes different subtypes of dendritic cells in relationship to cell surface markers that have initially been identified on DCs in the circulation. These blood dendritic cell antigen (BDCA) markers help to define three different cellular linages for DCs: BDCA1 and BDCA3 on two different subtypes of myeloid DCs and BDCA2 and BDCA4 on plasmacytoid DCs. Independent of the lineage of DCs, DCs are instrumental in defining the specific kind of immune response that after encounter of a potential threat needs to be triggered in local tissues. In one such scenario DC are able to instruct naïve T cells to become a T helper 2 (Th2) cell that under normal conditions would be required to fight off parasites. Unfortunately this same immune response is also responsible for allergic disease when this response is triggered by in essence harmless environmental factors like plant pollen. Especially the Th2 response highlights the notion that DCs are active within local tissues and that the epithelium helps to shape the immune response. In the case of the Th2 response it is epithelial express TSLP that affects the function of tissue resident DCs so that they will convert the naïve T cell into a Th2 helper cell. The review also stresses that we know relatively little about the cytokine/chemokine milieu created by the airway epithelium, which should be considered as a co‐factor in the pathogenesis of allergic airway disease and as part of the normal airway immune responses.

Chapter 3 describes the (functional) expression of toll‐like receptors (TLR) in nasal epithelium from healthy individuals. TLRs belong to an important class of receptors that help to orchestrate immune responses against potential thread in our environment by recognizing and responding to specific pathogen associated molecular patterns.

Primary nasal epithelial cells express different levels of TLR1‐6 and TLR9. We were unable to detect mRNA of TLR7, TLR8 and TLR10. Two observations seem important for a better understanding of the functionality of these receptors. Firstly, there is a huge variation between individuals at the mRNA level for single TLRs that can span several decades, and secondly, that expression of a TLR does not necessarily implies its functionality. Indeed despite the relative high levels of TLR4 mRNA, the presence of



118

TLR4 protein and its two main co‐receptors MD2 and CD14, the bacterial ligand LPS does not induce via TLR4.

Chapter 4 investigates the functional cross talks between the different toll‐like receptors on nasal epithelial cells. We explored whether exposure to one TLR trigger could affect the responsiveness to another TLR trigger. Stimulation of airway epithelial cells with a specific TLR agonist affects gene expression of other TLRs. In primary nasal epithelium, poly(I:C) challenge results in an up‐regulation of the TLR1, TLR2, and TLR3 genes and reduction of expression of TLR5. Poly(I:C) induced activation of TLR‐2 contributes to stronger cell responses to a TLR‐2 agonist and regulation of these synergistic responses may take place at the mRNA level of IL6 and IL8. The effect of TLR‐3 stimulation on TLR‐2 functionality and most of the effects on the expression of other TLRs could be replicated in NCI‐H292. Poly(I:C) failed to up‐regulate TLR1 and showed an additional up‐regulation of TLR4. Our data suggests that to better understand TLR mediated innate responses we need to consider the impact of the presence of multiple triggers.

Chapter 5 shows that the disease state affects the functionality of TLR signalling. We explored the reactivity of epithelial cells isolated from nasal polyps and healthy controls to a broad range of TLR agonists in their ability to induce TSLP, IL25, and IL33; mediators that play an important role in Th2 skewing of local immune responses through the classical DCs and/or the newly discovered ILCs. Our data show that epithelial cells from nasal polyps exposed to poly(I:C) produce a significantly higher amount of TSLP than the turbinate epithelium from healthy individuals both at the mRNA and protein level. We also quantified small, but significantly higher TSLP protein secretion in polyposis epithelium after flagellin and PGN challenge. For IL33 we observed a clear induction by multiple TLR agonists, but the level of induction mostly did not differ between healthy or polyp epithelium, although we did see specific up‐ regulation by the TLR8 agonist R848 in healthy epithelium. IL25 levels were below the detection limit of our assay for all the conditions we tested.

Chapter 6 investigates the role of nasal mucosal DCs in subjects with allergic rhinitis with different allergic sensitizations and compares this to healthy control subjects.

Using immunohistochemical stainings we demonstrate the presence of 4 previously unidentified DC subsets in human nasal mucosa: mDCs characterized by CD1c and CD141 and pDCs characterized by CD303 and CD304. Moreover, we found that numbers of DC subsets differ between subjects with different allergic sensitizations.

At baseline, cell numbers of the mDC marker CD1c in the lamina propria tended to be higher in pollen‐monosensitized subjects than in polysensitized subjects. These high baseline levels of mDCs in pollen mono‐allergic subjects could reflect ongoing minimal persistent inflammation outside of the pollen season.

Summary

119

The mDC/pDC ratio is equal for allergic and healthy subjects; however, after nasal provocation, the ratio in healthy subjects decreases while remaining the same in allergic subjects. This suggests a lack of immunosuppression in allergic subjects.

Chapter 7 describes the composition of human DC subtypes in the oral mucosa of allergic and non‐allergic individuals. We studied the tissue distribution of myeloid, plasmacytoid and Langerhans‐type DCs in the oral mucosa and compared these to nasal DCs in the same individuals, which were studied in Chapter 6. Significantly more CD141 positive mDCs in epithelium and CD1a positive Langerhans cells in the lamina propria in allergic individuals were found in comparison to healthy subjects. In both allergic and non‐allergic subjects very low numbers of CD303 positive Langerhans cells were expressed.

A general discussion and overall conclusions from the results obtained are presented in Chapter 8.

121

Samenvatting

Samenvatting

123

Samenvatting Tot op zekere hoogte heeft ons inzicht in de immuunrespons zich ontwikkeld vanuit een vereenvoudigd model van een opeenvolgende (inter)actie tussen dendritische cellen, T‐lymfocyten en B‐lymfocyten tot een meer complex model van interactie tussen niet alleen deze speciale immuun competente cellen, maar ook met andere cellen die lokale omgeving vormen en daar actief zijn.

In dit proefschrift richten we ons op de betekenis van nasale epitheelcellen als een interactieve interface met de (microbiële) omgeving en hun bijdrage aan de regeling van de regulering van de lokale immuunrespons.

Hoofdstuk 1 geeft een overzicht van ons begrip van de intieme relatie tussen in het weefsel aanwezige dendritische cellen (DC) en epitheelcellen. Het beschrijft verschillende subtypes van dendritische cellen op basis van oppervlakte markers die in eerste instantie zijn geïdentificeerd op DCs aanwezig in de bloedcirculatie. Deze “blood dendritic cell antigen” (BDCA) markers helpen om drie verschillende cellulaire lijnen te definiëren: BDCA1 en BDCA3 op twee verschillende subtypes van myeloïde DCs en BDCA2 en BDCA4 op plasmacytoïde DCs. Onafhankelijk van hun geslacht zijn DCs belangrijk bij het bepalen van de specifieke aard van de immuunrespons, die na het detecteren van een potentiële bedreiging wordt geactiveerd in de lokale weefsels. In een dergelijk scenario is de DC in staat om naïeve T‐cellen te activeren tot een T‐helper 2 (Th2) cellen, die onder normale omstandigheden noodzakelijk zijn voor de eliminatie van parasieten.

Helaas is dezelfde immuunreactie ook verantwoordelijk voor het ontstaan van allergie wanneer deze immuunreactie getriggerd wordt door in essentie onschadelijke omgevingsfactoren zoals bijvoorbeeld plantenpollen. Vooral de Th2 respons wijst op het idee dat DCs actief zijn in de lokale weefsels en dat het epitheel helpt om de immuunrespons vorm te geven. In het geval van de Th2 respons is het door het epitheel geproduceerde TSLP dat de functie van de in het weefsel aanwezige DCs beïnvloedt zodat zij de naïeve T‐cel zal activeren tot een Th2‐helpercel.

Het review maakt ook duidelijk dat we relatief weinig weten van het cytokine en chemokine milieu in het luchtwegepitheel, dat als cofactor moet worden overwogen in de pathogenese van allergische luchtwegaandoeningen en als onderdeel van de normale luchtwegen immuunreacties.

Hoofdstuk 3 beschrijft de (functionele) expressie van de Toll‐like receptoren (TLR) in nasale epitheelcellen van gezonde individuen. TLRs behoren tot een belangrijke klasse van receptoren die helpen immuunresponsen tegen potentiële bedreigingen in ons milieu te orkestreren door het herkennen van en reageren op specifieke pathogeen geassocieerde moleculaire patronen.



124

Primaire nasale epitheliale cellen brengen verschillende niveaus van TLR1‐6 en TLR9 tot expressie. We waren niet in staat om mRNA te detecteren van TLR7, TLR8 en TLR10.

Twee observaties lijken belangrijk voor een beter begrip van de functionaliteit van deze receptoren. Ten eerste is er een grote variatie tussen individuen op mRNA niveau van enkele TLRs dat tot enkele tientallen kan reiken, en ten tweede, expressie van TLR mRNA niet noodzakelijkerwijs de functionaliteit impliceert.

Ondanks de relatief hoge niveaus van TLR4 mRNA, de aanwezigheid van TLR4‐eiwit en de twee co‐receptoren CD14 en MD2, induceert de bacteriële LPS ligand niet via TLR4.

Hoofdstuk 4 onderzoekt de functionele intermodulatie tussen de verschillende toll‐like receptoren op nasale epitheelcellen. We onderzochten of blootstelling aan een TLR agonist invloed kan hebben op de respons op een andere TLR agonist. Stimulatie van epitheelcellen van de luchtwegen met een specifieke TLR agonist beïnvloedt genexpressie van andere TLRs. In primair nasaal epitheel, stimulatie met poly (I: C) resulteert in een up‐regulering van de TLR1, TLR2 en TLR3 genen en vermindering van de expressie van TLR5. Poly (I: C) activatie van TLR‐2 draagt bij aan een sterkere cel reactie met een TLR‐2 agonist en regulering van deze synergistische reacties zouden kunnen plaatsvinden op het mRNA‐niveau van IL6 en IL8. Het effect van TLR‐3 stimulering op TLR‐2 functionaliteit en de meeste effecten op de expressie van andere TLRs zien we terug in NCI‐H292. Poly (I: C) niet up‐reguleren TLR1 en liet een additionele upregulatie van TLR4 zien.

Onze uitkomsten suggereren dat we om beter inzicht in TLR gemedieerde “innate” responsen te krijgen, we de invloed van meerdere triggers dienen te overwegen.

Hoofdstuk 5 laat zien dat ziekte invloed heeft op de functionaliteit van TLR signalering.

We hebben de reactiviteit van epitheliale cellen, geïsoleerd uit neuspoliepen en gezonde individuen, onderzocht op een groot aantal TLR‐agonisten in hun vermogen om TSLP, IL25 en IL33 te induceren; mediatoren die een belangrijke rol spelen in Th2 ‘skewing’ van de lokale immuunrespons spelen via de klassieke DC en/of de nieuw ontdekte ILC. Onze gegevens tonen aan dat epitheelcellen van neuspoliepen blootgesteld aan poly (I: C) een aanzienlijk grotere hoeveelheid TSLP produceren dan concha inferior epitheel van gezonde individuen zowel op mRNA als op eiwitniveau.

We hebben ook een kleine, maar significant hogere TSLP eiwit secretie in polyposis epitheel gemeten na stimulatie met Flagellin en PGN. Voor IL33 zagen we een duidelijke inductie door meerdere TLR‐agonisten, maar het niveau van inductie verschilde meestal niet tussen gezond of poliep epitheel, hoewel we daar specifieke up‐regulering door de TLR8 agonist R848 in gezonde epitheel zagen. IL25 waarden waren lager dan de detectielimiet in onze analyse van alle voorwaarden die wij getest hebben.

Samenvatting

125

Hoofdstuk 6 onderzoekt de rol van DCs in het neusslijmvlies bij personen met allergische rhinitis met verschillende allergische sensibilisaties in vergelijking met gezonde proefpersonen. Met behulp van immunohistochemische kleuringen tonen we de aanwezigheid van 4 eerder geïdentificeerde DC subtypes aan in menselijk neusslijmvlies: mDC worden gekenmerkt door CD1c en CD141 en pDCs worden gekenmerkt door CD303 en CD304.

Daarnaast vonden we dat het aantal DC subtypes verschilt tussen allergische personen met verschillende allergische sensibilisaties. Op baseline was het aantal CD1c+ DC in de lamina propria het hoogste in graspollen mono‐gesensibiliseerde dan in poly‐ gesensibiliseerde proefpersonen. Deze hoge uitgangswaarden van mDC in graspollen mono‐gesensibiliseerde proefpersonen zouden kunnen duiden op aanhoudende inflammatie bij afwezigheid van graspollen allergeen buiten het seizoen.

De mDC/pDC‐ratio op baseline is gelijk bij allergische en gezonde personen; echter na allergeen provocatie neemt deze verhouding af in gezonde proefpersonen terwijl dit bij allergische patiënten niet veranderd. Dit wijst op een gebrek aan immunosuppressie bij allergische personen.

Hoofdstuk 7 beschrijft de verdeling van humane DC subtypes in het mondslijmvlies van allergische en niet‐allergische individuen. We bestudeerden de weefselverdeling van myeloïde, plasmacytoïde en Langerhans‐type DCs in het mondslijmvlies en vergeleken dit met nasale DCs in dezelfde individuen, die werden bestudeerd in Hoofdstuk 6.

Significant meer CD141 positieve mDC in epitheel en CD1a positieve Langerhans cellen in de lamina propria bij allergische personen bleken aanwezig in vergelijking met gezonde proefpersonen. In zowel allergische en niet‐allergische proefpersonen waren zeer lage aantallen CD303 positieve Langerhans cellen aanwezig.

Een algemene discussie en algemene conclusies uit de resultaten verkregen in dit proefschrift worden gepresenteerd in Hoofdstuk 8.

127

Publications

Publications

129

Publications Dendritic Cell Subsets in Oral Mucosa of Allergic and Healthy Subjects.

Reinartz SM, van Tongeren J, van Egmond D, de Groot EJ, Fokkens WJ, van Drunen CM. PLoS One. 2016;11(5):e0154409.

Specific Induction of TSLP by the Viral RNA Analogue Poly(I:C) in Primary Epithelial Cells Derived from Nasal Polyps.

Golebski K, van Tongeren J, van Egmond D, de Groot EJ, Fokkens WJ, van Drunen CM. PLoS One. 2016;11(4):e0152808.

Expression profiling and functional analysis of Toll‐like receptors in primary healthy human nasal epithelial cells shows no correlation and a refractory LPS response. van Tongeren J, Röschmann KI, Reinartz SM, Luiten S, Fokkens WJ, de Jong EC, van Drunen CM. Clin Transl Allergy. 2015;5:42.

Pediatric Idiopathic Intracranial Hypertension Presenting With Sensorineural Hearing Loss.

Reitsma S, Stokroos R, Weber JW, van Tongeren J. Ann Otol Rhinol Laryngol. 2015;124(12):996‐1001.

Tinnitus: pathofysiologie, diagnostiek en behandeling Joost van Tongeren, Rilana F.F. Cima, Joeri Buwalda, Rutger Hofman, Lucien J. Anteunis en Robert J. Stokroos. Ned Tijdschr Geneeskd. 2015;159:A8397

Synergy between TLR‐2 and TLR‐3 signaling in primary human nasal epithelial cells. van Tongeren J, Golebski K, Van Egmond D, de Groot EJ, Fokkens WJ, van Drunen CM. Immunobiology. 2015;220(4):445‐451

Multiple cranial nerve dysfunction caused by neurosarcoidosis.

Loor RG, van Tongeren J, Derks W. Am J Otolaryngol. 2012;33(4):484‐486.

Dendritic cells in nasal mucosa of subjects with different allergic sensitizations.

Reinartz SM, van Tongeren J, van Egmond D, de Groot EJ, Fokkens WJ, van Drunen CM. J Allergy Clin Immunol. 2011;128(4):887‐890.

Synchronous bilateral epithelial‐myoepithelial carcinoma of the parotid gland: case report and review of the literature. van Tongeren J, Creytens DH, Meulemans EV, de Bondt RB, de Jong J, Manni JJ. Eur Arch Otorhinolaryngol. 2009;266(9):1495‐1500.



130

Interactions between epithelial cells and dendritic cells in airway immune responses: lessons from allergic airway disease. van Tongeren J, Reinartz SM, Fokkens WJ, de Jong EC, van Drunen CM. Allergy. 2008;63(9):1124‐1135

Upper‐airway obstruction instigated by Sweet's syndrome.

Bouw J, Kater AP, van Tongeren J, Schultz MJ. Med Sci Monit. 2007;13(4):CS53‐CS55.

The tumor‐selective viral protein apoptin effectively kills human biliary tract cancer cells.

Pietersen AM, Rutjes SA, van Tongeren J, Vogels R, Wesseling JG, Noteborn MH. J Mol Med (Berl). 2004;82(1):56‐63.

Expression of the serpin serine protease inhibitor 6 protects dendritic cells from cytotoxic T lymphocyte‐induced apoptosis: differential modulation by T helper type 1 and type 2 cells.

Medema JP, Schuurhuis DH, Rea D, van Tongeren J, de Jong J, Bres SA, Laban S, Toes RE, Toebes M, Schumacher TN, Bladergroen BA, Ossendorp F, Kummer JA, Melief CJ, Offringa R. J Exp Med. 2001;194(5):657‐667.

Reliability and sensitivity to change of various measures of hand function in relation to treatment of synovitis of the metacarpophalangeal joint in rheumatoid arthritis.

Goossens PH, Heemskerk B, van Tongeren J, Zwinderman AH, Vliet Vlieland TP, Huizinga TW. Rheumatology (Oxford). 2000;39(8):909‐913.

131

Abbreviations

133

Abbreviations

Abbreviations AR BDCA BM COPD CpG DC DC‐SIGN ELISA FGF G‐CSF GP HBSS HDM HE HEV ICAM IL IP‐10 LDC LP LPS MACS mDC MIP‐1β Mono‐GP MONO‐HDM NHS NP oDC PAMP PBS pDC PGN Poly (I:C) Poly‐provGP

allergic rhinitis blood dendritic cell antigen basal membrane chronic obstructive pulmonary disease cytosine – phosphate ‐ guanine dendritic cells dendritic cell‐specific intercellular adhesion molecule‐3‐grabbing non‐ integrin enzyme‐linked immuno sorbent assay fibroblast growth factor granulocyte colony‐stimulating factor grass pollen hanks’ balanced salt solution house dust mite hematoxylin eosin high endothelial venules intercellular adhesion molecule interleukin interferon gamma‐induced protein 10 Langerhans type dendritic cell lamina propria lipopolysaccharide magnetic activated cell sorting myeloid dendritic cell macrophage inflammatory protein 1 beta subjects with mono‐sensitization to grass pollen allergen and relevant symptoms subjects with mono‐sensitization to house dust mite allergen and relevant symptoms normal human serum nasal allergen provocation oral dendritic cell pathogen‐associated molecular patterns phosphate buffered saline plasmacytoid dendritic cell peptidoglycan poly (deoxyinosinic‐deoxycytidylic) acid subject with poly‐sensitization and relevant symptoms, who underwent allergen provocation with grass pollen allergen



134

Poly‐prov HDM subject with poly‐sensitization and relevant symptoms, who underwent allergen provocation with house dust mite allergen PRR pattern recognition receptors qPCR quantitative polymerase chain reaction RANTES regulated upon Activation, Normal T‐cell Expressed, and Secreted RAST radioallergosorbent test RSV respiratory syncytial virus RT‐PCR realtime PCR SCIT subcutaneous allergen immunotherapy SLIT sublingual allergen immunotherapy TGF transforming Growth Factor Th T helper cell TLR toll‐like receptor TNF‐α tumor necrosis factor‐alpha TNSS total nasal symptom score VEGF vascular endothelial growth factor

135

Dankwoord

Dankwoord

137

Dankwoord Graag wil ik iedereen bedanken die heeft bijgedragen aan mijn persoonlijke ontwikkeling. Aan diegenen die hebben bijgedragen aan de totstandkoming van dit proefschrift, wil ik een persoonlijk woord van dank richten.

Professor dr. W.J. Fokkens, beste Wytske, je bent voor mijn een inspirerend persoon en ik heb dat ook vaak in onze gesprekken mogen ervaren. Het promotietraject heeft langer geduurd dan we beiden bij de start hadden kunnen bedenken. Het heeft pieken en dalen gekend en ik ben je ontzettend dankbaar dat ik na mijn opleiding op je steun en bereidheid heb mogen rekenen om het af te maken.

Dr. C.M. van Drunen, beste Kees, ik ben je dankbaar voor je kennis, kritische beschouwingen en onuitputtelijk enthousiasme voor de wetenschap. Zonder je inbreng en betrokkenheid was dit boekje er nooit gekomen.

Professor dr. J.P. Medema, beste Jan Paul, mijn eerste echte kennismaking met de basale wetenschap was in het lab van de Tumor Immunologie in het LUMC. Warme herinneringen heb ik aan mijn tijd met jou en Joan in Leiden en ik ben trots dat je van mijn promotiecommissie deel uit wil maken.

De overige leden van de promotiecommissie, Prof. dDr. H. Spits, Prof. dr. B. Kremer, Prof. dr. P. Hellings en Prof. dr. E.C. de Jong, hartelijk dank voor jullie bereidheid om kritisch en deskundig mijn proefschrift te beoordelen.

Collega’s van het KNO‐lab en Celbiologie lab (en dat waren er veel de afgelopen 12 jaar!) ontzettend veel dank voor jullie technische ondersteuning, zonder jullie was dit boekje nooit afgekomen.

Kornel, veel dank ben ik aan je verschuldigd voor de grote hoeveelheid werk die je hebt verricht die heeft geresulteerd in twee mooie gezamenlijke artikelen.

Mijn medeauteurs, ik wil jullie hartelijk danken voor jullie bijdrage aan het tot stand komen van de artikelen in dit proefschrift.

Al de assistenten KNO uit het AMC waarmee ik mijn opleidingstijd heb mogen delen, dank ik voor een mooie en bijzondere tijd. Ik heb mogen ervaren dat we als groep op elkaar mochten bouwen.



138

De stafleden van de afdeling KNO in het AMC en KNO‐artsen van het Flevo ziekenhuis en OLVG dank ik voor alles wat ik van jullie heb mogen leren, zowel op KNO‐gebied als op persoonlijk vlak. Speciale dank aan Freerk voor ons gesprek na het course diner van de FESS‐cursus; het gaf mij het inzicht en het vertrouwen om de stap naar het zuiden te maken.

Beste Robert, als fellow werd ik door jou en Janny aangenomen en vanaf dag 1 heb ik jullie vertrouwen en steun mogen ervaren. Dat beschouw ik als zeer bijzonder. Ik ben je dankbaar voor alles wat ik van je heb mogen leren en kijk ernaar uit om samen met jou en Janny de Neuro‐otologie verder te blijven ontwikkelen.

Beste Guido, bij alle belangrijke en minder belangrijke momenten in het leven, staan we naast elkaar. Of dit nu in de ontgroening, opleiding, onze bruiloften of promotie is, ik heb aan alle gelegenheden warme herinneringen. Ook al hebben we minder vaak de mogelijkheid om onze 'sjieke' Cognacs te proeven dan vroeger, ik weet dat onze vriendschap diepgeworteld zijn.

Lieve Janny, veel dank dat jij mij bij wil staan al paranimf. Vanaf de eerste dag in Maastricht mag ik je vertrouwen en Friese nuchterheid ervaren. Je relativeert en zet me van tijd tot tijd weer terug in de realiteit. Blijf dit vooral doen!

Lieve Hans en Nels, jullie hebben mij letterlijk en figuurlijk andere inzichten in de wereld gegeven. Begonnen op de KiliMANNIjaro en uiteindelijk vervolgd in Maastricht.

Ik dank jullie voor jullie onvoorwaardelijke steun en liefde voor ons gezin. Hans, ik mag in je voetsporen stappen zowel in Ethiopië als in Maastricht, ik dank je voor je reflecterend vermogen, je motiverende woorden en je luisterend oor tijdens mijn opleiding en daarna. Uniek dat we meerdere malen samen naar Ethiopië zijn geweest.

Wil je nog één keer met me mee gaan? Ik zal je KNO‐erfenis tot in lengte van dagen voortzetten!

Lieve pap en mam, diepe waardering heb ik voor wat jullie gecreëerd hebben om mij alle kansen in het leven te bieden; van persoonlijke ontwikkeling tot (top)sporten en studeren. Eerlijk zijn en trouw zijn aan jezelf heb ik van jullie geleerd, waarvoor ik jullie altijd dankbaar zal zijn.

Lieve Florien, Annemijn en Thijs, jullie zijn voor ons het belangrijkste in ons leven. Het is een genot om jullie te zien groeien op allerlei gebieden. Volg je hart.

Lieve Rije, er is niemand zoals jij bent voor mij!

139

Curriculum vitae

141

Curriculum vitae

Curriculum vitae Joost van Tongeren werd geboren op 19 september 1978 te Goirle. Na zijn eindexamen VWO op het Koning Willem II college te Tilburg in 1996 startte hij met de studie Biomedische Wetenschappen te Leiden. Hij studeerde hieraan af in 2001. In 2000 begon hij zijn studie Geneeskunde, eveneens aan de Universiteit Leiden. Zijn coschappen werden Cum Laude doorlopen en hij studeerde af in 2004.

Direct hierop aansluitend startte hij met het onderzoek dat beschreven wordt in deze thesis bij de afdeling Keel‐, Neus‐, en Oorheelkunde in het Academisch Centrum Amsterdam onder supervisie van Professor Dr. W.J. Fokkens.

In 2007 werd een AGIKO stipendium van het ZonMw verkregen en startte hij met zijn opleiding tot KNO‐arts welke in 2011 werd beëindigd.

Vanaf 2011 is hij werkzaam bij het MUMC+ te Maastricht waar hij een tweejarig fellowship Neurotologie doorliep onder supervisie van Prof. dr. R.J. Stokroos en Dr. J.H. Hof. Na afronding van het fellowship werkt hij als staflid met als aandachtsgebied Neurotologie en tinnitus.

Joost is getrouwd met Marije Manni en zij hebben drie kinderen, Florien, Annemijn en Thijs.

INFLUENCE OF THE MUCOSAL ENVIRONMENT ON THE REGULATION OF THE LOCAL IMMUNE RESPONSE IN HEALTH AND ALLERGIC DISEASE

Influence of the mucosal environment on the regulation of the local immune response in health and allergic disease

Joost van Tongeren

Joost van Tongeren