Page 1


Revista Científica de la Universidad Nacional de Loja Centro de Biotecnología Vol. 4 Nro. 1. 2015 ISSN: 1390-7573 Loja - Ecuador Diciembre 2015

Revista científica sobre temas de biotecnología de plantas, animales y microorganismos, cuyo objetivo es dar un enfoque multidisciplinario en los campos de la Biología, Bioquímica, Genética, Física, Química, Agronomía, Ecología, Medicina, Veterinaria, Farmacia, entre otros, con el fin de aportar soluciones inmediatas en procesos de estas ciencias. “Centro de Biotecnología” publica trabajos originales, bajo la responsabilidad de sus autores de temas académicos y de investigación científica. Es un espacio para la difusión y transferencia de resultados de conocimiento e innovación, cuya cobertura temática va dirigida a profesionales y estudiantes que gustan de estas ciencias. Editada anualmente por el Centro de Biotecnología y la Dirección de Investigación de la Universidad Nacional de Loja, Ecuador.


2

Centro de Biotecnología, Vol. 4 Nro. 1. 2015

Consejo de Arbitraje Consejo Editorial

Director General Dr. Tito Ramiro Muñoz Guarnizo ÁREA AGROPECUARIA Y DE RECURSOS NATURALES RENOVABLES UNIVERSIDAD NACIONAL DE LOJA Ecuador Editor Responsable Ph.D. Roldán Torres Gutiérrez CENTRO DE BIOTECNOLOGÍA UNIVERSIDAD NACIONAL DE LOJA Ecuador Coordinadora Editorial Dra. Cecilia Ruiz Toledo, Mg.Sc. COMUNICACIÓN E IMAGEN INSTITUCIONAL Editor Ejecutivo Ing. Iván Granda Mora CENTRO DE BIOTECNOLOGÍA, UNIVERSIDAD NACIONAL DE LOJA - ECUADOR Ph.D. Masao Nishikawa AGENCIA DE COOPERACIÓN INTERNACIONAL DEL JAPÓN (JICA). JAPÓN Ph.D. Raúl López Sánchez CENTRO DE ESTUDIOS DE BIOTECNOLOGÍA VEGETAL, UNIVERSIDAD DE GRANMA, CUBA.

Evaluadores internos PhD. Roldán Torres Gutiérez Universidad Nacional de Loja PhD. Nikolay Aguirre Mendoza Universidad Nacional de Loja PhD. Zhofre Aguirre Mendoza Universidad Nacional de Loja Dr. Miguel Marín Gómez Universidad Nacional de Loja Dr. Luis Alberto Morocho Yaguana Universidad Nacional de Loja Dr. Yovany Salazar Estrada Universidad Nacional de Loja Evaluadores externos PhD. Carla Snoeck. Instituto de Biotecnología Flamenca, Bélgica PhD. Bettina Eichler-Loebermann Universidad de Rostock, Alemania Ph.D. Aminael Sánchez Rodríguez Universidad Técnica Particular de Loja, Ecuador PhD. María Caridad Nápoles García Instituo Nacional de Ciencias Agrícolas, Cuba Ph.D. Joaquín Machado de Armas Universidad Central de Las Villas, Cuba Ph.D. Catalina Rey Valeirón Universidad de La Habana, Cuba Foto de Portada: César Rodríguez Diseño y Diagramación GraficPLUS 07 2565588 Loja - Ecuador

Los artículos originales recibidos para publicación, serán evaluaudos por nuestros pares académicos internos y externos y se aplicará el sistema doble a ciegas.

Institución Editora: Universidad Nacional de Loja

ISSN: 1390-7573

Código Postal: Casilla letra “S”

Tiraje: 300 ejemplares

Calles: Av. Pío Jaramillo A. y Reinaldo Espinosa, La Argelia.

Url: unl.edu.ec/investigacion/inicio-investigacion

E-mail: comunicacioninstitucional@unl.edu.ec Teléfono convencional: (593) 07-2547252 ext. 154 Celular: 0990027270

Esta obra esta sujeta a la licencia Reconocimiento - No Comercial - Sin Obra Derivada 4.0 Internacional de Creative Commons. Para ver una copia de esta licencia, visite http://creativecommons.org//licencias/by-nc-nd/4.0/.


Centro de Biotecnología, Vol. 4 Nro. 1. 2015

EDITORIAL

Con mucho beneplácito, ofrecemos a ustedes el cuarto volumen de nuestra revista científica “Centro de Biotecnología”, en el cual hacemos constar especialmente el fruto del esfuerzo de nuestros investigadores, conseguido en la ardua tarea de generar conocimientos útiles a la sociedad en el campo de la biotecnología. La Universidad Nacional de Loja, ha emprendido en una denodada lucha por dar calidad a sus investigaciones; es así que ha logrado consolidar un Centro de Biotecnología acorde a las actuales demandas de desarrollo científico y tecnológico en el mencionado campo; esto sumado al nivel de formación y capacitación de sus investigadores. La biotecnología es una ciencia desarrollada con enfoque multidisciplinario, que involucra disciplinas y ciencias como la biología, bioquímica, genética, microbiología, física, química, agronomía, ecología, medicina, veterinaria, farmacia, entre otras; siendo usada ampliamente en cada uno de estos campos, con la finalidad de aportar soluciones inmediatas en procesos médicos, agrícolas, industriales, etc. Nuestro Centro, como parte integrante de la Función Investigación en la Universidad Nacional de Loja, ha sido el sustento fundamental, tanto en gestión como en ejecución de importantes proyectos científicos planteados por equipos de investigadores en los campos de la agricultura, la ganadería, salud humana, animal y vegetal; desde luego, respaldados por científicos extranjeros, que ya sea en calidad de “Prometeos”, asesores o voluntarios, han dado aportes importantes y han mejorado significativamente la calidad de los productos de investigación que a través de este medio informativo hemos venido difundiendo desde el lanzamiento del primer volumen. Hoy, al hacer la entrega de este nuevo número, queremos invitar a investigadores de otras latitudes a nivel nacional o internacional, a participar en la difusión de sus experiencias científicas, a través de este medio, que pretendemos convertirlo en una herramienta propagadora de la gestión universitaria en una de sus funciones más delicadas como es la investigación científica.

3


4

Centro de Biotecnología, Vol. 4 Nro. 1. 2015

Contenido ARTÍCULOS DE INVESTIGACIÓN Presencia o ausencia de maíz modificado genéticamente en las especies que se cultivan en Loja Masao Nishikawa, Klever Iván Granda Mora y Angel Rolando Robles Carrión

6

Caracterización de rizobacterias y estimulación de parámetros morfológicos y biomasa en maíz (Zea mays) Klever I. Granda Mora, Rafael González González, Yelenys Alvarado Capó, Angel Rolando Robles Carrión y Roldán Torres-Gutiérrez

Estudio descriptivo de factores potenciales para la presencia de Anaplasma marginale en el ganado bovino de la provincia de Zamora Chinchipe, Ecuador Tito Ramiro Muñoz Guarnizo y Patricia Ayora Fernández

Implementación del método de compostaje Takakura para el reciclaje de desechos en la ciudad de Loja, Ecuador Raquel Verónica Hernández Ocampo, Roldán Torres-Gutiérrez y Yhonel Bolivar Ramirez Armijos

Evalaución in vitro de aislados fúngicos y bacterianos con potencial antagonista frente a Fusarium spp. Raquel Espinosa Buele, Roldán Torres-Gutiérrez, Klever Ivan Granda Mora y Angel Rolando Robles Carrión

Aborto espontáneo incompleto no complicado hasta las 13 semanas de gestación tratado con Misoprostol Karina Yesenia Calva Jirón y Leonardo Paul Armijos Carrión

14

23

36

42

48

Potencial actividad del Amaranthus hybridus como inmunomodulador Miguel Marín Gómez, Carmen Pineda-Rojas, Consuelo Medina-Armijos, Luis Morocho-Yaguana, Segundo Marín Gómez, Miguel Barría Maldonado y Massao Nishikawa

56

Detección del virus de Newcastle en gallinas criollas en la provincia de Loja Janeth E. Armijos Montaño, Augusto Luzuriaga Neira, Fredy Cueva Castillo, Galo Escudero Sánchez, Loidy Zamora Gutiérrez y Gustavo Villacís Rivas

Transmisión Vectorial de Trypanosoma Cruzi en pobladores del barrio “La Extensa”, Catamayo Patricia Alexandra Guerrero Ochoa, Ángel Eduardo Chimbo Torres, Tito Goberth Carrión Dávila

Instrucciones a los autores Información para subscriptores

61

66 72 75


Centro de Biotecnología, Vol. 4 Nro. 1. 2015

5

Contentent RESEARCH ARTICLES Presence or absence of genetically modified corn in several species cultivated in Loja Masao Nishikawa, Klever Iván Granda Mora y Angel Rolando Robles Carrión

6

Characterization of rizobacteria and stimulation of morphological paramneters and biomass in corn (Zea mays) Klever I. Granda Mora, Rafael González González, Yelenys Alvarado Capó, Angel Rolando Robles Carrión y Roldán Torres Gutiérrez

Descriptive study of potential factors for the presence of Anaplasma marginale in cattle in Zamora Chinchipe, Ecuador Tito Ramiro Muñoz Guarnizo y Patricia Ayora Fernández

Implementing Takakura composting method for waste recycling in Loja city, Ecuador Raquel Verónica Hernández Ocampo, Roldán Torres-Gutiérrez y Yhonel Bolivar Ramirez Armijos

In vitro assessment of fungal and bacterial isolates with potential antagonist against Fusarium spp. Raquel Espinosa Buele, Roldán Torres-Gutiérrez, Klever Ivan Granda Mora y Angel Rolando Robles Carrión

Uncomplicated spontaneous incomplete abortion up to 13 weeks of gestation treated with Misoprostol Karina Yesenia Calva Jirón y Leonardo Paul Armijos Carrión

14

23

36

42

48

Evaluation of inmunoestimulant effect of Amaranthus hybridus L. extract and components in lymphoid cell activation Miguel Marín Gómez, Carmen Pineda-Rojas, Consuelo Medina-Armijos, Luis Morocho-Yaguana, Segundo Marín Gómez, Miguel Barría Maldonado y Massao Nishikawa

56

Detection of Newcastle Disease Virus in native hens in Loja province Janeth E. Armijos Montaño, Augusto Luzuriaga Neira, Fredy Cueva Castillo, Galo Escudero Sánchez, Loidy Zamora Gutiérrez y Gustavo Villacís Rivas

Vectorial transmission of Trypanosoma Cruzi in residents of neighborhood “La Extensa”, Catamayo

61

Patricia Alexandra Guerrero Ochoa, Ángel Eduardo Chimbo Torres, Tito Goberth Carrión Dávila

66

Author instructions

72

Subscription information

75


6

Centro de Biotecnología, Vol. 4 Nro. 1. 2015

PRESENCIA O AUSENCIA DE MAÍZ MODIFICADO GENETICAMENTE EN LAS ESPECIES QUE SE CULTIVAN EN LOJA

PRESENCE OR ABSENCE OF GENETICALLY MODIFIED CORN IN SEVERAL SPECIES CULTIVATED IN LOJA 1

Masao Nishikawa1* Klever Iván Granda Mora2 Ángel Rolando Robles Carrión2

Voluntario de la Agencia de Cooperación Internacional del Japón (JICA). Centro de Biotecnología, Universidad Nacional de Loja, Ciudadela Universitaria Guillermo Falconí Espinosa “La Argelia” – PBX: 072547252 – Casilla Letra “S”, Loja-ECUADOR. masaonishikawa061748@gmail.com

Centro de Biotecnología, Universidad Nacional de Loja, Ciudadela Universitaria Guillermo Falconí Espinosa “La Argelia” – PBX: 072547252 – Casilla Letra “S”, Loja - ECUADOR. ivagg100@gmail.com; aroblescarrion@gmail.com 2

* Autor para correspondencia

Resumen Con el fin de detectar genotipos de maíz modificado genéticamente, se colectaron semillas de 15 especies que han sido cultivadas cerca de ciudad de Loja, Ecuador o comercializadas en el mercado de Loja. Se extrajo el ADN genómico utilizando el método modificado CTAB a partir de las plántulas sembradas. Con el uso de primers certificados en el método de inspección para detectar el maíz modificado genéticamente, la detección de cultivos modificados genéticamente en estas 15 especies se llevó a cabo mediante la amplificación por PCR. Como resultado, no se identificó la secuencia del punto de mutación y no se detectaron secuencias introducidas. Por lo tanto, se concluyo que el maíz modificado genéticamente no se ha cultivado en terrenos aledaños a la ciudad de Loja.

Palabras claves: Organismo Genéticamente Modificado (OGM), método CTAB, PCR, insecto resistente, resistente a herbicida.

Abstract In order to detect genotypes of genetically modified maize, seeds of 15 species that have been cultivated near Loja province, Ecuador or sold in the market were collected. Genomic DNA using the modified CTAB method from the planted seedlings was extracted. Using certificates primers in the inspection method for detecting genetically modified maize, the detection of genetically modified crops in these 15 species was performed by PCR amplification. As a result, the sequence of the point mutation was identified and not introduced sequences were detected. Therefore, it was concluded that the genetically modified maize has not been cultivated on lands adjacent to the city of Loja.

Keywords: Genetically Modified Organism (GMO), CTAB method, PCR, insect resistant, herbicide resistant.

Recibido: marzo 06 de 2015

Aprobado: julio 15 de 2015


Centro de Biotecnología, Vol. 4 Nro. 1. 2015

7

Nishikawa et al. (2015); PRESENCIA O AUSENCIA DE MAÍZ MODIFICADO GENETICAMENTE EN LAS ESPECIES QUE SE CULTIVAN EN LOJA

Introducción Los últimos años han visto grandes avances en biotecnología de los alimentos, incluyendo el mejoramiento de cultivos transgénicos y las modificaciones genéticas de los organismos utilizados en la producción de alimentos. Acre de los cultivos modificados genéticamente (GM) se ha incrementado año tras año. Los datos de la Asociación Internacional de Agro-Biotecnología del Japón en 2013 mostraron que áreas cultivadas de soja transgénica y maíz transgénica fueron de 79% y 32%, respectivamente (Figura 1).

3. Diferencias de los componentes son poco observadas entre los de tipo salvaje y las variedades del GMO (Venneria et al., 2008). Por otro lado, hay muchos informes que emiten una advertencia contra el uso del GMO en base a los siguientes resultados, es decir, la duración de la vida, crías y tasa de crecimiento de los animales (ratones y ratas) criados con alimentos que contienen GMO grano se vieron afectados significativamente cuando en comparación con las que se cultivan en los alimentos sin GMO granos (Ferrini et al., 2007) (Seralini et al., 2007) (Finamore et al., 2008) (Seralini et al., 2012). Desde este punto de vista, se realizó un análisis de genes con el fin de determinar si el maíz modificado genéticamente, que es el alimento de uso común en la vida cotidiana y tiene una gran superficie de cultivo (Figura 1), se vende o se cultiva en la ciudad de Loja o en el campo de la región de Loja.

Materiales y Métodos Genotipos de maíz utilizados Semillas del maíz se obtuvieron del campo cerca de la ciudad de Loja y del mercado central en Loja. Las semillas obtenidas fueron 15 tipos en total (Cuadro 1). Hay los pros y los contras de la utilización de los alimentos modificados genéticamente. Los informes de investigación a ser ningún problema, son los siguientes: 1. La seguridad de organismo modificado genéticamente (GMO) que incorpora un factor de insecticida es mayor en vez de la de tipo salvaje, debido a la baja tasa de penetración del molde a través de las heridas por los insectos y la baja abundancia de micotoxinas (Betz et al., 2000). 2. Resultados de la verificación de diversos biomarcadores indicaron que no hubo efectos de las ingestión del GMO (Tutelian et al., 2009) (Tutelian et al., 2010). ISSN: 1390-7573

Extracción del ADN genómico El ADN genómico (ADN total) se extrajo de las semillas germinadas (plántulas) del maíz obtenidas de acuerdo con el método CTAB modificado por Irfan et al. (Irfan et al., 2013) (Mazzara et al., 2005). Las relaciones de 260/280 y 260/230 se encontraron entre 1.9 y 1.7 respectivamente, lo cual demostró la pureza para las reacciones de PCR. Condiciónes para la PCR La reacción en cadena de la enzima polimerasa (PCR) se llevó a cabo bajo las siguients condiciones: Centro de Biotecnología pp 06 – 13


8

Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Nishikawa et al. (2015); PRESENCIA O AUSENCIA DE MAÍZ MODIFICADO GENETICAMENTE EN LAS ESPECIES QUE SE CULTIVAN EN LOJA

fotografió con ENDURO Gel Documentation Systems (Labnet International Inc.).

Resultados y Discusión Primers

para la detección de maíz modificado

geneticamente

El volumen de reacción de 25 µl contenía 75 ng de ADN genómico, 0,3 µM de cada primer (Fw and Rv), 1,5 mM MgCl2, 0,2 mM dNTPs y 1,0 unidad de ADN polimerasa GoTaq (Promega). Las reacciones fueron amortiguadas por la adición del tampón GoTaq Flexi (Promega). La amplificación se realizó en un termociclador MultiGene (Labnet International Inc.) de acuerdo con el siguiente programa para la amplificación: Pre-incubación a 95 oC durante 5 minutos; 35 ciclos de denanaturalización a 95oC durante 30 segundos, hibridación a 60oC durante 30 segundos y extensión a 72oC durante 30 segundos; seguido de una extensión final a 72oC durante 10 minutos (Matsuoka et al., 2001). Electroforesis en gel de agarosa Del producto del PCR se tomaron de 3,5 - 4 µl de cada mezcla de reacción para la realziacion de la electroforesis a un voltaje constante de 120 V en un gel de agarose al 1,5 % suplementado con SyberSafe (Invitrogen) a una concentración recomendada por el fabricante de 0,5x TBE tampon (445 mM Tris base, 445 mM ácido bórico y 10 mM EDTA). El gel se Centro de Biotecnología pp 06 – 13

El objetivo principal de la modificación genética en plantas es (i) la simplificación del trabajo en el campo debido a la reducción de la tarea de deshierbe y desinfección y (ii) la reducción de la cantidad de insecticida y herbicida. En el primer caso se realiza la introducción del gen resistente a los herbicidas. Un método consiste en introducir una mutación puntual en 5-enolpiruvil-shikimato-3-fosfato sintasa (EPSPS), la proteína diana para la acción de los herbicidas, para producir la planta resistente a herbicidas. La enzima EPSPS sólo existe en la célula vegetal, y participa en la biosíntesis de aminoácidos aromáticos. Cuando la enzima es inactivada, la deficiencia de aminoácidos aromáticos se introduce en el cuerpo de la planta, y las plantas muestran eventualmente síntomas de transformación (Steinrucken and Amrhein, 1980) (Malik et al., 1989). La otra es la introducción de un gen (pat) para inactivar los herbicidas. El gen pat derivado de la bacteria del suelo, Streptomyces viridochromogenesis, expresa una enzima que inactiva el herbicida (Thompson et al., 1987) (Wehrmann et al., 1996) (Gonzalez-Moro et al., 2000). En el segundo caso, el gen se introduce para expresar la proteína Cry. Ya se sabe que Cry es la endotoxina de la bacteria del suelo Bacillus thuringiensis, y tiene la actividad insecticida contra los parásitos y bacterias parasitarias de los cereales. Por lo tanto, Bacillus thuringiensis que expresan “toxina Cry”, comúnmente se ha utilizado como plaguicida biológico contra las polillas, etc en campos (Dinon et al., 2011). La tolerancia a herbicidas, resistencia a las plagas o los dos de ellos se han introducido en el maíz, así como legumens como la soja (Figura 3). Por ejemplo, en MON que es el maíz resistente a insectos, cryIA y hsp70 (exISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015

9

Nishikawa et al. (2015); PRESENCIA O AUSENCIA DE MAÍZ MODIFICADO GENETICAMENTE EN LAS ESPECIES QUE SE CULTIVAN EN LOJA

presante de proteína de choque térmico 70) se han integrado en la corriente abajo de la 35S promotor del coliflor mosaico virus (P-35S) (Goda et al., 2002) (Matsuoka et al., 2000) (Matsuoka et al., 2001). En Evento (resistente a los insectos), cryIA (b) se ha insertado en la corriente abajo de la fosfoenolpiruvato carboxilasa (PEPC) y la proteína quinasa (CDPK) promotor (Matsuoka et al., 2000) (Matsuoka et al., 2001), y el bar también ha sido insertado en la corriente abajo de P-35S (Wehrmann et al., 1996) (Matsuoka et al., 2000) (Matsuoka et al., 2001). En GA21 y T25 (tolerantes a herbicidas maíces), punto de mutación en la enzima EPSPS endógeno y pat se insertan, respectivamente (Matsuoka et al., 2001). En

CBH y Bt serie de maíz, que son resistentes o tolerantes contra tanto las plagas como herbicidas, cry9C, cryIA (b) y pat están integrados en la corriente abajo de P-35S (Matsuoka et al., 2000) (Matsuoka et al., 2001) (Matsuoka, 2001). Se establece método para detectar y amplificar la región introducida por PCR, y los primers para detección válidos han sido reportados. Basándose en estos informes, los cebadores usados en este experimento se determinaron (Cuadro 2). Ze1 es una proteína endógena expresada en el maíz, el primer # 2 para amplificar ze1 se utilizó como control positivo de la reacción de PCR (Matsuoka et al., 2000) (Cuadro 2 y Figura 2).

Figura 2. Diagramas esquemáticos de unidades introducidas en GM-maíz.

Otros detalles son los siguientes: P-35S; 35S región promotora del virus del mosaico de la coliflor, int.; intròn, NOS; nopalina syntasa de Agrobacterium tumefaciens, T; terminador, ISSN: 1390-7573

cry; Gen que expresa la Toxina Bt (el factor de resistencia a los insectos), bar; Gen derivado de Streptomyces expresa la Fosfinotricina Acetiltransferasa (PAT). Centro de Biotecnología pp 06 – 13


10 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Nishikawa et al. (2015); PRESENCIA O AUSENCIA DE MAÍZ MODIFICADO GENETICAMENTE EN LAS ESPECIES QUE SE CULTIVAN EN LOJA

Figura 2. Diagramas esquemáticos de unidades introducidas en GM-maíz.

Amplificación de las unidades introducidos por PCR El par de primer # 2 para el maíz gen intrínseca Zein (Ze1) se utilizó como control positivo para la reacción de PCR. Al utilizar el ADN genómico a partir de diversos genmotipos de maíz y el primer # 2, somos capaces de amplificar específicamente la hebra de ADN del tamaño esperado (326 bp) por PCR como se muestra en la Figura 4. En todas las muestras, el gen Ze1 intrínseco fue detectado por el par de primer # 2, y se obtuvieron los productos de amplificación esperados. Así, la presente Centro de Biotecnología pp 06 – 13

condición de la PCR tiene suficiente sensibilidad para probar. Además, se confirmó la presencia de ADN de maíz amplificable. Estos datos demostraron claramente que la extracción de ADN mediante el CTAB método modificado proporcionado la calidad suficiente de ADN para la amplificación por PCR. Bajo estas condiciones de PCR, tratamos de detectar la secuencia específica que se ha integrado en el maíz modificado genéticamente. Como se muestra a la Figura 4, el gen cryIA (b) (# 3) en el maíz CBH, el gen cry34, -35Ab1 (4 #) en el maíz DAS, el gen epsps mutado (# ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 11 Nishikawa et al. (2015); PRESENCIA O AUSENCIA DE MAÍZ MODIFICADO GENETICAMENTE EN LAS ESPECIES QUE SE CULTIVAN EN LOJA

5) en el maíz GA21, el gen pat (# 6) en el maíz Bt11, el gen cryIA (b) (# 7) en el maíz Evento, el gen cryIA (b) (# 8) en el maíz MON y el gen pat (# 9) en el maíz T25 no se detectaron en todo el maíz utilizado en estos experimentos. De este resultado, se demostró que el maíz modificado genéticamente no se cultiva en por lo menos cerca de la ciudad de Loja. En este experimento, nos hemos centrado en el maíz comestible, pero sería sospechoso considerar maíz utilizado para producir productos de confitería, ellos importados, en particular, y el maíz se utiliza como alimento para el ganado en el futuro.

El gen (Ze1) intrínseco de maíz y los rasgos resistentes a insectos o herbicidas fueron amplificados por PCR a partir de maíz Nº 1 - Nº 6 en (A), maíz No 7 - No 11 en (B) y maíz No 12 - No 15 en (C) usando primres específicas (# 1 - # 9). Primers # 1 - # 9 fueron diseñados para detectar GM-maíz CBH, el gen intrínseco de maíz (Ze1), GM-maíz Bt10, GM-maíz GA21, GM-maíz DAS, GM-maíz Bt11, GMmaíz Evento, GM-maíz MON y GM-maíz T25, respectivamente. Ver en Materiales y Métodos o Textos para obtener más detalles.

Figura 3. Electroforesis en gel de agarosa de productos amplificados por PCR a partir de maíz usando primers específicos como se muestran en la Cuadro 2.

Conclusiones Utilizando el método CTAB modificado, se extrajo el ADN genómico de genotipos de maíz de diferentes zonas agroecológicas de la provincia de Loja. ISSN: 1390-7573

Se detectaron los genes específicos que se introdujo para expresar resistencia a las plagas y tolerancia a herbicidas. El gen intrínseco del maíz Ze1 se detectó en todos los ADN usados. Por lo tanto, el ADN extraído y las condiciones de PCR eran adecuadas para Centro de Biotecnología pp 06 – 13


12 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Nishikawa et al. (2015); PRESENCIA O AUSENCIA DE MAÍZ MODIFICADO GENETICAMENTE EN LAS ESPECIES QUE SE CULTIVAN EN LOJA

llevar a cabo esta serie de experimentos. Sin embargo, cryIA (b) para la resistencia a las plagas, epsps mutada puntal y pat para la tolerancia a herbicidas o cry9C tanto resistencia a las plagas y tolerancia a herbicidas no se detectaron. En consecuencia, se hizo evidente que ninguno del maíz modificado genéticamente como la serie del MON, la serie del Evento, la serie del GA21, la serie del T25, la serie del CBH y la serie del Bt actualmente se cultiva en Loja.

Agradecimientos La presente investigación se desarrolló con el apoyo institucional y financiero de la Agencia Inetrnacional de Cooperación Japonesa (JICA). Se agradece la colaboración de el Dr. Rómulo Chávez Ph.D., Director del Centro de Investigación, Dr. Tito Muñoz Guarnizo, Mg. Sc., Director del Centro de Biotecnología y el personal del Centro de Investigación y el Centro de Biotecnología. Agradecemos a la Profesora Rosa Ortega Malla, Mg. Sc. Por la recolección de maíz, Ing. Anival Ruiz-Sánchez, Ing. Franco Loján-Labanda y Dr. Alexander Bome por proporcionar el laboratorio para el experimento de germinación.

Referencias bibliográficas Betz, F.S., Hammond, B.G. and Fuchs, R.L. 2000. Safety and advantages of Bacillus thuringiensis-protected plants to control insect pests. Regul Toxicol Pharmacol, 32: 156-173. Dinon, A.Z., Prins, T.W., van Dijk, J.P., Arisi, A.C., Scholtens, I.M. and Kok, E.J. 2011. Development and validation of real-time PCR screening methods for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms. Anal Bioanal Chem 400: 1433-1442.

Centro de Biotecnología pp 06 – 13

Ferrini, A.M., Mannoni, V., Pontieri, E. and Pourshaban, M. 2007. Longer resistance of some DNA traits from BT176 maize to gastric juice from gastrointestinal affected patients. Int J Immunopathol Pharmacol 20: 111-118. Finamore, A., Roselli, M., Britti, S., Monastra, G., Ambra, R., Turrini, A. and Mengheri, E. 2008. Intestinal and peripheral immune response to MON810 maize ingestion in weaning and old mice. J Agric Food Chem 56: 11533-11539. Goda, Y., Kakihara, Y., Akiyama, H., Matsuoka, T., Hino, A. and Toyoda, M. 2002. Detection of Unexpected Recombinant DNA in Maize Grain. J Food Hyg Soc Japan 43: 74-79. Gonzalez-Moro, M.B., Iriberri, N., Dunabeitia, M.K., Loureiro-Beldarraini, I. and GonzalezMurua, C. 2000. Effect of phosphinothricin herbicide on nitrogen metabolism in Pinus radiata and Laccaria bicolor. Phyton (Horn, Austria) 40: 71-77. Irfan, M., Ting, Z.T., Yang, W., Chunyu, Z., Qing, M., Lijun, Z. and Feng, L. 2013. Modification of CTAB protocol for maize genomic DNA extraction. Research Journal of Biotechnology 8: 41-45. Malik, J., Barry, G. and Kishore, G. 1989. The herbicide glyphosate. Biofactors, 2, 17-25. Matsuoka, T., Kawashima, Y., Akiyama, H., Miura, H., Goda, Y., Kusakabe, Y., Isshiki, K., Toyoda, M. and Hino, A. 2000. A Method of Detecting Recombinant DNAs from Four Lines of Genetically Modified Maize. J Food Hyg Soc Japan, 41: 137-143. ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 13 Nishikawa et al. (2015); PRESENCIA O AUSENCIA DE MAÍZ MODIFICADO GENETICAMENTE EN LAS ESPECIES QUE SE CULTIVAN EN LOJA

Matsuoka, T., Kuribara, H., Akiyama, H., Miura, H., Goda, Y., Kusakabe, Y., Isshiki, K., Toyoda, M. and Hino, A. 2001. A Multiplex PCR Method of Detecting Recombinant DNAs from Five Lines of Genetically Modified Maize. J Food Hyg Soc Japan 42: 24-32. Matsuoka, T., Kuribara, H., Suefuji, S., Miura, H., Kusakabe, Y., Akiyama, H., Goda, Y., Isshiki, K., Toyoda, M., Hino, A. 2001. A Detection Method for Recombinant DNA from Genetically Modified Maize CBH351. J Food Hyg Soc Japan 42: 197-201. Mazzara, M., Foti, N., Maretti, M., Savini, C. and Van den Eede, G. 2005. Report on the In-House Validation of an event-specific Detection Method for Event Bt 10 using a qualitative PCR assay and verification by restriction analysis. In-house validation and reporting, Joint Research Cetre - European Commision Biotechnology & GMOs Uint, Protocol V3: 1-15. Seralini, G.E., Cellier, D. and de Vendomois, J.S. 2007. New analysis of a rat feeding study with a genetically modified maize reveals signs of hepatorenal toxicity. Arch Environ Contam Toxicol 52: 596-602. Seralini, G.E., Clair, E., Mesnage, R., Gress, S., Defarge, N., Malatesta, M., Hennequin, D. and de Vendomois, J.S. 2012. Long term toxicity of a Roundup herbicide and a Roundup-tolerant genetically modified maize. Food Chem Toxicol 50. 4221-4231. Steinrucken, H.C. and Amrhein, N. 1980. The herbicide glyphosate is a potent inhibitor of 5-enolpyruvyl-shikimic acid-3-phosphate synthase. Biochem Biophys Res Commun ISSN: 1390-7573

94: 1207-1212. Thompson, C.J., Movva, N.R., Tizard, R., Crameri, R., Davies, J.E., Lauwereys, M. and Botterman, J. 1987. Characterization of the herbicide-resistance gene bar from Streptomyces hygroscopicus. Embo J 6: 2519-2523. Tutelian, V.A., Gapparov, M.G., Avreneva, L.I., Aksiuk, I.N., Guseva, G.V., Kravchenko, L.V., Lvova, L.S., Saprykin, V.P., Tyshko, N.V. and Chernysheva, O.N. 2010. Medical and biological safety assessment of genetically modified soybean event MON 89788. Report 1. Toxicologo-hygienic examinations. Vopr Pitan 79: 4-12. Tutelian, V.A., Gapparov, M.M., Avreneva, L.I., Aksiuk, I.N., Guseva, G.V., Kravchenko, L.V., Lvova, L.S., Saprykin, V.P., Tyshko, N.V. and Chernysheva, O.N. 2009. Medical and biological safety assessment of genetically modified maize strain MIR604. Vopr Pitan, 78: 24-32. Venneria, E., Fanasca, S., Monastra, G., Finotti, E., Ambra, R., Azzini, E., Durazzo, A., Foddai, M.S. and Maiani, G. 2008. Assessment of the nutritional values of genetically modified wheat, corn, and tomato crops. J Agric Food Chem 56: 9206-9214. Wehrmann, A., Van Vliet, A., Opsomer, C., Botterman, J. and Schulz, A. 1996. The similarities of bar and pat gene products make them equally applicable for plant engineers. Nat Biotechnol 14: 1274-1278.

Centro de Biotecnología pp 06 – 13


14 Centro de Biotecnología, Vol. 4 Nro. 1. 2015

CARACTERIZACIÓN DE RIZOBACTERIAS Y ESTIMULACIÓN DE PARÁMETROS MORFOLÓGICOS Y BIOMASA EN MAÍZ (Zea Mays) CHARACTERIZATION OF RHIZOBACTERIA AND STIMULATION OF MORPHOLOGICAL PARAMETERS AND BIOMASS IN CORN (Zea mays) 1

Klever Iván Granda Mora1 Rafael González González2 Yelenys Alvarado Capó3 Ángel Rolando Robles Carrión1 Roldán Torres Gutiérrez1*

Centro de Biotecnología, Universidad Nacional de Loja. Ciudadela Guillermo Falconi. “La Argelia”- PBX: 072547252 - Casilla Letra “S”, Loja, Ecuador. ivang100@gmail.com - roldan.torres@unl.edu.ec

Carrera de Ingeniería Agronómica. Universidad Nacional de Loja. Ciudadela Guillermo falconi. “La Argelia”- PBX: 072547252, Loja, Ecuador. ra-fico89@hotmail.com 2

3

Instituto de Biotecnología de las Plantas, Universidad Marta Abreu de las Villas. Carretera a Camajuani km 5.5. Santa Clara, Cuba. yelenys@ibp.co.cu * Autor para correspondencia

Resumen El presente trabajo de investigación tuvo como objetivo caracterizar e identificar bacterias diazotróficas aisladas de suelos agrícolas del sur del Ecuador. La determinación de los aislados bacterianos se realizó mediante la caracterización morfológica de las colonias, donde se evaluó la tinción al Gram, crecimiento, color, producción de polisacáridos, bordes y elevación. La caracterización fisiológica consistió en la cuantificación de cada aislado en la producción de ácido-3- indól acético (AIA) y solubilización de fosforo inorgánico (P). La identificación genética de los aislados resultantes de la caracterización morfológica y fisiológica se realizó mediante la secuenciación parcial de los genes 16S ARNr. Se evaluaron las mejores cepas obtenidas más un control absoluto y fertilización en el crecimiento y desarrollo de maíz bajo invernadero. De un total de 14 aislados iniciales se identificaron cinco géneros bacterianos, Rhizobium, Azotobacter, Stenotrophomonas, Sphingomonas y Beijerinckia. Todos los aislados fueron capaces de producir AIA y no así solubilizar fosforo. Los mejores resultados con respecto a los demás tratamientos, tanto en los parámetros morfológicos a los 30, 60, y 90 y parámetros de biomasa se obtuvieron con la inoculación de los aislados C3 y Pin2, ambos clasificados para el género Azotobacter.

Palabras claves: Aislados bacterianos, 16S rRNA, ácido indol-3-acético, inoculación, máiz.

Abstract This research aimed to characterize and identify diazotrophic bacteria isolated from agricultural soils of southern Ecuador. The determination of bacterial isolates was performed by the morphological characterization of the colonies, where the Gram staining was evaluated, growth, color, polysaccharide production, and elevated edges. Physiological characterization consists of quantification of each isolated in the production of 3-indole acetic acid (IAA) and solubilization of inorganic phosphorus (P). The genetic identification of isolates resulting from the morphological and physiological characterization was done by partial sequencing of the 16S rRNA genes. The best strains obtained more complete control and fertilization in the growth and development of corn were evaluated under greenhouse. Of a total of 14 initial five bacterial genera isolated, Rhizobium, Azotobacter, Stenotrophomonas, Sphingomonas and Beijerinckia identified. All isolates were able to produce AIA and not solubilize phosphorus. The best results with respect to other treatments, both morphological 30, 60 parameters and 90 parameters and biomass were obtained with the inoculation of the isolated C3 and Pin2, both qualified for the genus Azotobacter.

Keywords: Bacterial isolates, 16S rRNA, acid indole-3-acetic, inoculation, maize. Recibido: abril 14 de 2014

Aprobado: junio 25 de 2014


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 15 Granda et al. (2015); CARACTERIZACIÓN DE RIZOBACTERIAS Y ESTIMULACIÓN DE PARÁMETROS MORFOLÓGICOS Y BIOMASA EN MAÍZ (Zea Mays)

Introducción En la región sur del Ecuador, especialmente en la provincia de Loja, uno de los principales cultivos es el maíz, puesto que constituye una de las principales fuentes de alimento, debido fundamentalmente a sus altos contenidos en carbohidratos y proteínas. De este cultivo, más de 40 mil hectáreas son sembradas cada año y como promedio se destinan alrededor de 16 millones de dólares en la compra de fertilizantes químicos para satisfacer sus exigencias nutricionales, siendo los abonos nitrogenados los de mayor exigencia debido a su sistemático uso con el fin de obtener los rendimientos deseados (MAGAP, 2013). Desde el año 2000 a 2013 el maíz ha tenido un repunte importante, no solo en la superficie sembrada, sino en su productividad. En el año 2000 se produjeron 423 mil toneladas y para el 2012 se incrementó a 1.22 millones de toneladas, registrando una tasa de crecimiento promedio anual de 12,06% (ESPAC, 2013). Los reportes de producción para maíz son satisfactorios, sin embargo, estos se ven afectados por los altos costos de producción finales que realiza el productor, sobre todo destinando grandes cantidades de recursos financieros para la compra de fertilizantes, los cuales se reportan entre $400 y 500 USD ha-1, haciendo que esto no genere utilidades para el agricultor (MAGAP, 2013). Según proyecciones recientes para el año 2020, el consumo anual de fertilizantes a nivel mundial llegará a 208 millones de toneladas, siendo el nitrógeno el principal elemento a incorporar a los cultivos (INIFAP, 2012). Teniendo en cuenta estas proyecciones, unido a la cada vez más creciente demanda de alimentos, se hace evidente que es preciso cambiar el paradigma de producción agrícola y la búsqueda de alternativas que contribuyan a reducir la producción y aplicación de fertilizantes sintéticos y a la vez sanear nuestras producciones agrícolas. Desde esta perspectiva, la fijación biológica del nitrógeno (FBN) realizada por los organismos procariotas como las bacterias diazotróficas que capturan N2 y mediante procesos ISSN: 1390-7573

enzimáticos transforman este recurso biológico a NH4+ para que las plantas puedan tomar fácilmente este mineral, constituye una alternativa validad para suplir las necesidades nutricionales de los cultivos y a la par mejorar la calidad de suelo y la reducción paulatina de fertilizantes nitrogenados (Montañez, 2012). La FBN es una fuente eficiente de N, las entradas anuales de N en la tierra oscilan entre 139 y 175 millones de toneladas de N, de este total cerca del 30 % (45 millones de toneladas de N) se lleva a cabo mediante interacciones asociativas planta-bacteria (Dixon, 2004). Como se aprecia las cantidades de nitrógeno fijadas son elevadas y suficientes para satisfacer las necesidades nutricionales de los cultivos y dentro de ellos el maíz, dentro de este contexto a nivel local y nacional, estudios con estos organismos fijadores de nitrógeno que mejoren la promoción y desarrollo de este cultivo son nulos o escasos. Por ello en el presente estudio tuvo como objetivo principal, identificar y caracterizar bacterias rizosféricas asociadas al maíz y evaluar el efecto de estos organismos diazotróficos en la estimulación de parámetros morfológicos y biomasa para este cultivo bajo invernadero. Materiales y Métodos Se colectaron muestras de suelo y raíces del cultivo de maíz en diferentes localidades de la provincia de Loja, Ecuador. Estos puntos de muestreo se ubicaron según las zonas más productoras de esta gramínea (Cuadro 1). Los sitios de colecta fueron geo-referenciados mediante la utilización del Sistema de Posicionamiento Global (GPS). Obtenidas las muestras estas se acondicionaron en bolsas ziploc y puestas en refrigeración y luego trasladas al laboratorio de microbiología vegetal para su procesamiento respectivo. Aislamiento de las bacterias Para el aislamiento de las bacterias procedentes de las raíces de maíz, estás se lavaron con agua destilada y luego fragmentadas en segmentos de 1 a 1.5 cm Centro de Biotecnología pp 14 – 22


16 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Granda et al. (2015); CARACTERIZACIÓN DE RIZOBACTERIAS Y ESTIMULACIÓN DE PARÁMETROS MORFOLÓGICOS Y BIOMASA EN MAÍZ (Zea Mays)

de longitud, luego se realizó la desinfección superficial con una solución a base de etanol (70%) e hipoclorito de sodio (NaClO) al 3% por diez minutos y enjuagues regulares con agua destilada estéril por cinco minutos (RangelLucio, 2011). Para las muestras de suelos y raíces se hicieron disoluciones seriadas de hasta 10-7 y tanto los aislados obtenidos a partir de raíces y suelo se sembraron en medios semiespecíficos NFb, JNFb, LGI (Döbereiner et al., 1995) y Ashby (Goodfellow, 2012) e incubando a 30 °C durante 96 horas para observar sus características morfoculturales. Caracterización morfocultural y fisiológica Todos los aislados obtenidos mediante el proceso de aislamiento se caracterizaron morfológicamente mediante la diferenciación de las colonias respecto a: tinción al Gram, tipo de crecimiento, color, producción de polisacáridos, bordes y elevación de las colonias (Texeira et al., 2005). En la caracterización fisiológica se llevaron a cabo pruebas de producción de ácido indól acético (AIA) y solubilización de fósforo de cada cepa aislada. La producción de AIA se realizó por método colorimétrico usándose el reactivo Salkowski (12 g L-1 de FeCl3 en 7,9 M de H2SO4) (Glickman y Dessaux, 1995). Se inocularon cada una de las cepas aisladas en medio liquido caldo nutriente suplementado con 2.5 g L-1 de triptófano durante 24 y 48 h a una temperatura de 30°C. Se tomaron 1 ml del cultivo crecido y se transfirió a tubos eppendorf de 1.5 ml, y se centrifugó a 10.000 rmp durante 5 min, luego se tomó 0.5 ml del sobrenadante y se transfirió a un nuevo tubo y se añadió 0.5 ml de reactivo Salkowski, dejándose a la oscuridad durante 30 min a temperatura ambiente. Luego del tiempo transcurrido, 1 ml de la solución mezclada se trasfirió a micro cubetas del espectrofotómetro para medir la absorbancia a 530 nm. Para verificar la capacidad de las cepas aisladas de solubilizar fosfatos inorgánicos, estas se inocularon por punteado con tres replicas en medio de cultivo Pikovskaya (Zaidi et al., 2009). Centro de Biotecnología pp 14 – 22

Identificación genética La extracción de ADN genómico de las bacterias se realizó usando el kit de extracción de ADN ChargeSwitch® gDNA Mini Bacteria Kit (InvitrogenTM, USA), acorde las instrucciones del fabricante. La calidad del ADN extraído se cuantificó en Nanodrop (Nanodrop 2000, Thermo Scientific, USA) y por medio de electroforesis al 1% (1 g agarosa en 100 ml TBE buffer). La amplificación de los genes de la subregión 16S rRNA se realizó mediante PCR, utilizándose los primers universales: 5’ TGGCTCAGAGAACGAACGCTGGCGGC’ (Y1) y 5’TACCTTCTTACGACTTCACCCCAGTC’ (Y2 (Borda-Molina et al., 2009). El producto de PCR se analizó posteriormente mediante electroforesis en gel de agarosa 1% (1 g de agarosa en 150 ml de bufer TAE 1X) a 110 V durante 45 min. La secuenciación se realizó en MACROGEN-USA. Las secuencias obtenidas se analizaron mediante el programa FASTA y la homología con las secuencias depositadas en la base de datos de nucleótidos internacional GeneBank de NCBI. Ensayo en condiciones de invernadero Se realizó un experimento en condiciones controladas utilizando un diseño experimental totalmente aleatorizado con diez replicas por cada tratamiento. El sustrato utilizado para el crecimiento vegetal se colocó en macetas de 2 kg de capacidad, en una relación 2:1:1 (tierra, arena, turba) el cuál se esterilizó en estufa a 125 °C por dos horas. Los tratamientos evaluados fueron la resultante de los mejores aislados identificados morfológica, fisiológica y genéticamente por cada una de las zonas de muestreo, así como un tratamiento con fertilización nitrogenada y un control absoluto. Para el inoculo todos los aislados bacterianos se sembraron en Erlenmeyer de 250 ml, conteniendo medio de cultivo caldo nutriente, se ajustó el pH a 7 y se incubó durante 72 horas a 30 °C en incubadora giratoria (TECHNE TS1500, USA) a 250 rpm. Transcurrido el tiempo necesario para el crecimiento de las bacterias se realizó ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 17 Granda et al. (2015); CARACTERIZACIÓN DE RIZOBACTERIAS Y ESTIMULACIÓN DE PARÁMETROS MORFOLÓGICOS Y BIOMASA EN MAÍZ (Zea Mays)

el conteo bacteriano por espectrofotometría UV/VIS a 595 nm (JENWAY 6505 UV/VIS, UK) y se ajustaron los cultivos a títulos de 108 UFC ml-1 para la realización de la inoculación en las semillas de maíz. La inoculación de las cepas bacterianas consistió en aplicar 3 ml de inóculo por cada replica y tratamiento. Evaluaciones y análisis estadístico A partir de los 7 días de la siembra se evaluó la altura (cm) y el número de hojas de las plantas. Estas evaluaciones se continuaron a los 15, 21, 30, 60 y 90 días respectivamente y a los 30, 60 y 90 días se evaluaron los parámetros de biomasa. Para los análisis se dispuso de diez muestras por cada tratamiento. Los datos obtenidos se procesaron utilizándose el paquete estadístico SPSS v.21 IBM. Previamente

se realizaron análisis de normalidad de datos y homogeneidad de varianzas para posteriormente determinar las diferencias estadísticas entre los tratamientos, mediante un análisis de varianza simple (One Way ANOVA), utilizándose la prueba de Tukey HSD.

Resultados Aislamiento,

caracterización

morfocultural,

fisiológica y genética de los aislados

Se muestrearon las zonas más productoras de maíz, tal como se describen en la (Cuadro 1), con la finalidad de obtener la mayor cantidad de bacterias diazotróficas con alturas que correspondieron entre los 185 hasta 800 msnm.

Aislado

Latitud (S)

Longitud (W)

Altura (msnm)

Pin

04°07´06´´

80°06´32´´

Cas

04°09´34´´

Sab

Procedencia Cantón

Localidad

800

Pindal

Pindal

80°07´21´´

716

Pindal

Cascajal

04°11´59´´

80°08´42´´

667

Pindal

Sabanilla

LC

04°24´20´´

80°17´79´´

162

Zapotillo

La Ceiba

Guas

04°25´27´´

80°18´58´´

185

Zapotillo

Guácimo

Cuadro 1. Zonas de muestreo en diferentes localidades de la provincia de Loja

En el Cuadro 2, se presentan las características morfológicas de los aislados bacterianos, en total se obtuvieron 12 aislados luego del procesamiento de las muestras. De los cuales el 4% presentan crecimiento moderado y el 58 % ligero, en cuanto al color el 56% de los aislados presentan color translucido, el 34

% opaco, y 10 % color crema. El 100% de los aislados presentaron mucosidad ligera, al igual que borde liso y elevación plana. En todos los casos se observaron bacterias Gram negativas de morfología coco bacilo (42%), bacilo largo (45%) y el resto bacilos cortos.

Aislado

Crecimiento

Color

Mucosidad Bordes

Elevación

Gram

Morfología

Cas2

++

4

+

1

+

-

CB

Cas3

+

5

+

1

+

-

BL

Cas4

+

2

+

1

+

-

CB

Cas5

++

2

+

1

+

-

BC

LC11

+

2

+

1

+

-

BL

LC14

+

2

+

1

+

-

BL

ISSN: 1390-7573

Centro de Biotecnología pp 14 – 22


18 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Granda et al. (2015); CARACTERIZACIÓN DE RIZOBACTERIAS Y ESTIMULACIÓN DE PARÁMETROS MORFOLÓGICOS Y BIOMASA EN MAÍZ (Zea Mays)

Pin1

++

4

+

1

+

-

CB

Pin2

+

2

+

1

+

-

BL

Pin3

++

4

+

1

+

-

BL

Pin5

+

2

+

1

+

-

BC

Pin6

++

4

+

1

+

-

CB

Pin7

+

2

+

1

+

-

CB

Crecimiento: (+) ligero, (++) moderado; (+++) abundante; Color: (2) traslucido, (3) opaco, (4) blanco opaco, (5) crema; Mucosidad: (+) ligero, (++) moderado, (+++) abundante; Bordes: (1) liso, (2) ondulado, (3) lobulado; Elevación: (+) plana, (++) elevado; Gram: (-) negativo, positivo (+); Morfología: BC (bacilo corto), BL (bacilo largo), CB (coco-bacilo). Abreviaturas: Cascajal: Cas2; Cas3; Cas4; Cas5; La Ceiba: LC11; LC14; Pindal: Pin1; Pin2; Pin3; Pin5; Pin6; Pin7.

Cuadro 2. Caracterización morfológica de los aislados bacterianos

Ninguno de los aislados presentaron halo de solubilización de fosforo alrededor de la colonia bacteriana, mientras que todos los aislados produjeron ácido indól acético (AIA). A las 24 horas de evaluación, los aislados de Cas3 y Pin7 presentan los mejores resultados

de AIA producido con 137,49 y 137,19 ug ml-1 respectivamente y a las 48 horas se destacan los aislados de Pin5 y Pin7, siendo este último aislado el de mejores resultados en las dos evaluaciones realizadas (ver figura 1).

Figura 1. Producción de AIA por cada aislado. Abreviaturas: Cascajal: Cas2; Cas3; Cas4; Cas5; La Ceiba: LC11; LC14; Pindal: Pin1; Pin2; Pin3; Pin5; Pin6; Pin7. Letras desiguales en las columnas difieren para p < 0,05 Tukey.

De un total de 12 secuencias analizadas se identificaron cinco géneros bacterianos, Rhizobium, Azotobacter, Stenotrophomonas, Sphingomonas y Beijerinckia (Cuadro 3). Del total de secuencias analizadas se Centro de Biotecnología pp 14 – 22

identificaron dos especies diferentes para el género Rhizobium (etli y sp.) y Sphingomonas (sanxanigenens y sp.) y una especie para el resto de géneros bacterianos. ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 19 Granda et al. (2015); CARACTERIZACIÓN DE RIZOBACTERIAS Y ESTIMULACIÓN DE PARÁMETROS MORFOLÓGICOS Y BIOMASA EN MAÍZ (Zea Mays)

Aislado

Sitio de muestreo

Cas2

Cascajal

Cas3

Organismo

(%) homología

Accesión

Rhizobium etli isolate B11

98

EF506199.1

Cascajal

Azotobacter vinelandii CA

99

CP005094

Cas4

Cascajal

Stenotrophomonas maltophilia st 13637

100

CP008838.1

Cas5

Cascajal

Azotobacter vinelandii CA

99

CP005094

LC11

La Ceiba

Sphingomonas sp.

99

FN377699.1

LC14

La Ceiba

Sphingomonas sanxanigenens

99

NR-121736.1

Pin1

Pindal

Rhizobium sp. IRBG74

98

HG518323.1

Pin2

Pindal

Azotobacter vinelandii CA6

100

CP005095

Pin3

Pindal

Rhizobium sp. IRBG74

98

HG518323.1

Pin5

Pindal

Rhizobium sp. IRBG74

99

HG518323.1

Pin6

Pindal

Beijerinckia fluminensis st. UQM 1685

99

NR-116306.1

Pin7

Pindal

Beijerinckia fluminensis st. UQM 1685

99

NR-116306.1

Cuadro 3. Identificación genética de los aislados basado en las secuenciación de los genes 16S ADNr

En el Cuadro 4, se muestran los resultados correspondientes a altura de planta (AP), y número de hojas (NH), esto a los 15, 21, 30, 60 y 90 días después de la siembra (DDS). Los resultados correspondientes a la altura de la planta a los 15, 60 y 90 DDS, se evidencia diferencia significativas en el crecimiento de las plantas, siendo el aislado de Cas3 (Azotobacter vinelandii) el que influye positivamente en la AP. A los 21 DDS, el tratamiento (Fertilización) presenta los mejores resultados, seguido de Cas3 15 DDS Tratamiento

21 DDS

(Azotobacter vinelandii) y Pin7 (Beijerinckia fluminensis), no así a los 30 DDS, donde no se evidencia diferencia significativa entre los tratamientos. En cuanto al número de hojas a los 15 y 21 DDS no existen diferencia significativas entre tratamientos. A los 30, 60 y 90 DDS, la inoculación con los aislados de Cas3 y Pin2 ambos clasificados para (Azotobacter vinelandii) afectan positivamente el NH. Mientras que Pin7 (Beijerinckia fluminensis) y el Control son los tratamientos de menores resultados. 30 DDS

60 DDS

90 DDS

AP (cm)

NH

AP (cm)

NH

AP (cm)

NH

AP (cm)

NH

AP (cm)

NH

Pin2

13.30ab

3.8

20.35c

4.2

32.71

4.6ab

88.20ab

8.2a

175.7ab

10.6

Cas5

12.85ab

3.9

19.5c

4.4

32.10

4.9ab

82.41bc

7.1ab

156.4ab

8.7

Pin7

13.00ab

4.0

21.40bc

4.2

31.10

4.6ab

80.22bc

7.0ab

152.3ab

8.5

Cas3

14.60a

4.0

24.45ab

4.8

33.72

5.2a

96.30a

8.8a

189.6a

11.1

Control

12.90ab

3.9

20.35c

4.3

30.23

4.4c

70.71c

6.7ab

140.0b

8.0

Fertilización

12.15c

3.9

25.90a

4.3

31.32

5.0ab

86.30ab

8.0a

166.0ab

8.0

0.74

0.08

0.23

0.21

0.11

0.27

0.78

0.74

0.161

0.14

Error Estándar

Abreviaturas: Altura de la Planta (AP); Numero de Hojas (NH). Tratamientos: Pin2 (Azotobacter vinelandii), Cas5 (Azotobacter vinelandii), Pin7 (Beijerinckia fluminensis), Cas3 (Azotobacter vinelandii), Control y Fertilización. Letras desiguales en las columnas difieren para p<0,05 Tukey. Cuadro 4. Altura y número de hojas de los aislados ISSN: 1390-7573

Centro de Biotecnología pp 14 – 22


20 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Granda et al. (2015); CARACTERIZACIÓN DE RIZOBACTERIAS Y ESTIMULACIÓN DE PARÁMETROS MORFOLÓGICOS Y BIOMASA EN MAÍZ (Zea Mays)

Los resultados de peso fresco de raíz (PFR) y peso fresco de follaje (PFF) se muestran en la figura 4. Para la variable PFR y PFF los mejores resultados se obtienen con

los aislados de Cas3 y Pin2 (Azotobacter vinelandii) y el tratamiento Fertilización, los cuales difieren significativamente con el Control en 43, 26 y 18 % respectivamente.

Figura 4. Peso fresco del follaje (PFF) y peso fresco de raíz (PFR) del cultivo de maíz. Tratamientos: Pin2 (Azotobacter vinelandii), Cas5 (Azotobacter vinelandii), Pin7 (Beijerinckia fluminensis), Cas3 (Azotobacter vinelandii), Control y Fertilización. Letras desiguales en las columnas difieren para p<0,05 Tukey.

En la figura 5, se muestran los resultados de peso seco de raíz (PSR) y peso seco de follaje (PSF). Para el PSR y PSF, el tratamiento C3 (Azotobacter vinelandii) presenta los mejores resultados, afectando positivamente la masa

seca de las plantas, lo cual se supone un incremento significativo de N en las plantas, seguido de Pin2 (Azotobacter vinelandii) y Fertilización. En todos los casos el tratamiento Control presentó los valores más bajos.

Figura 5. Peso seco del follaje (PFF) y peso seco de raíz (PFR) del cultivo de maíz. Tratamientos: Pin2 (Azotobacter vinelandii), Cas5 (Azotobacter vinelandii), Pin7 (Beijerinckia fluminensis), Cas3 (Azotobacter vinelandii), Control y Fertilización. Letras desiguales en las columnas difieren para p<0,05 Tukey. Centro de Biotecnología pp 14 – 22

ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 21 Granda et al. (2015); CARACTERIZACIÓN DE RIZOBACTERIAS Y ESTIMULACIÓN DE PARÁMETROS MORFOLÓGICOS Y BIOMASA EN MAÍZ (Zea Mays)

Discusión Son nulos los estudios que dan cuenta de la diversidad de microorganismos diazotróficos asociados a la rizosfera del cultivo de maíz en Ecuador. Es de singular importancia la obtención de cinco géneros bacterianos (Rhizobium, Azotobacter, Stenotrophomonas, Sphingomonas y Beijerinckia) asociados a este cultivo, siendo este el primer reporte de la variabilidad de estos géneros bacterianos en la región sur del Ecuador. Lo que pone de manifiesto la importancia de estos microorganismos para futuras investigaciones como potenciales fijadores de N y promotores del crecimiento vegetal para estos cultivos. El 100% de los aislados bacterianos no presentaron halo alrededor de la colonia bacteriana, lo cual indica que no tuvieron la capacidad de solubilizar el fosforo inorgánico en medio de cultivo Pikovskaya. De igual manera, Borda et al., (2009) inocularon cepas de Azotobacter sp., en medio Pikovskaya modificado demostrando la acidificación del medio, pero no los halos de solubilización. Todos los aislados identificados fueron capaces de producir AIA, siendo los aislados de Cas3 (Azotobacter vinelandii), Pin7 (Beijerinckia fluminensis), P5 (Rhizobium sp) los de mejores resultados. Los aislados de Pin7 y Pin5 a pesar de la misma localidad y no de la misma especie estos difirieron con medias de 173,01 y 166,31 ug ml-1 respectivamente. Resultados similares reporta Rodríguez, A. (2011) que todos los aislamientos bacterianos pertenecientes a los géneros Enterobacter, Pseudonamoas, Raoultella y Azotobacter produjeron AIA en medio de cultivo TY suplementado con triptófano en cantidades que fueron desde 1.77 hasta 185 μg ml-1. Los aislados de Cas3 y Pin2 ambos identificados para (Azotobacter vinelandii) en todos los casos ejercieron un efecto positivo en la estimulación fenotípica de los parámetros morfológicos y biomasa del cultivo de maíz. A pesar de una buena producción de AIA por parte de Pin7 (Beijerinckia fluminensis) este no afectó positivamente los parámetros evaluados. A diISSN: 1390-7573

ferencia de Pin2 con menos cantidad de AIA producido fue el tratamiento de mejores resultados. Lo que queda claro, que no siempre una buena producción de este metabolito la cepa es capaz de estimular la promoción de biomasa y fijación de N en los cultivos, sino de una eficaz asociación con la planta huésped (Mrkovacki et al., 2001). Conclusiones En la rizosfera del cultivo de maíz existe gran variabilidad de microorganismos, destacándose la presencia de bacterias diazotróficas, específicamente del genero Azotobacter. La estimulación fenotípica en maíz fue significativa mediante la inoculación con los aislados de Cas3 y Pin2 ambos identificados para (Azotobacter vinelandii), así como la producción de AIA satisfactorios. Referencias bibliográficas Borda-Molina, D., Pardo-García, J. M., Martínez-Salgado, M. M., & MontañaLara, J. S. 2009. Producción de un biofertilizante a partir de un aislamiento de Azotobacter nigricans obtenido en un cultivo de Stevia rebaudiana Bert. Universitas Scientiarum 14(1): 71-78. Dixon, R., & Kahn, D. 2004. Genetic regulation of biological nitrogen fixation. Nature Reviews Microbiology 2(8): 621631. Döbereiner, J., Baldani, V. L. D., & Baldani, J. I. 1995. Como isolar e identificar bactérias diazotróficas de plantas nãoleguminosas. Embrapa SPI. ESPAC. Estadísticas Agropecuarias del Ecuador. 2013. Disponible on line: http://www.inec.gob. Centro de Biotecnología pp 14 – 22


22 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Granda et al. (2015); CARACTERIZACIÓN DE RIZOBACTERIAS Y ESTIMULACIÓN DE PARÁMETROS MORFOLÓGICOS Y BIOMASA EN MAÍZ (Zea Mays)

ec /estadistic as/?option=c om _ content&view=article&id=103&Itemid=75.

useful in agricultural application. Annals of Microbiology 51(2): 145-158.

Goodfellow, M., Kämpfer, P., Busse, H. J., Trujillo, M. E., Suzuki, K. I., Ludwig, W., & Whitman, W. B. (Eds.). 2012. Bergey’s manual of systematic bacteriology. Springer New York.

Rodríguez, A. J., Rojas, M. M., Trujillo, I. D., Manzano, J., & Heydrich, M. 2003. Caracterización de la comunidad microbiana endófita de la caña de azúcar. Memorias. V Taller Internacional sobre Recursos Fitogenéticos FITOGEN.

Glickmann, E., & Dessaux, Y. 1995. A critical examination of the specificity of the salkowski reagent for indolic compounds produced by phytopathogenic bacteria. Applied and environmental microbiology 61(2): 793-796. INIFAP. Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. 2012. Introducción al Uso y Manejo de los Biofertilizantes en la Agricultura. Instituto Nacional de Investigaciones Agropecuarias. Guanajuato, México. 315 p.

Teixeira, M. A., & VIEIRA, R. 2005. Diversidade de bactérias endofíticas na cultura da mandioca. Embrapa Meio Ambiente. Boletim de Pesquisa e Desenvolvimento. Zaidi, A., Khan, M., Ahemad, M., & Oves, M. 2009. Plant growth promotion by phosphate solubilizing bacteria. Acta microbiológica et Immunológica Hungarica 56(3): 263-284.

J. Z., Ramírez-Gama, R. M., & AlvaradoBárcenas, E. 2011. Afinidad y efecto de Azospirillum sp. en maíz. Agronomía Mesoamericana, 22(2): 269-279 MAGAG. Ministerio de Agricultura, Ganadería, Acuacultura y Pesca. 2013 Montañez, A., Blanco, A. R., Barlocco, C., Beracochea, M., & Sicardi, M. 2012. Characterization of cultivable putative endophytic plant growth promoting bacteria associated with maize cultivars (Zea mays L.) and their inoculation effects in vitro. Applied soil Ecology 58: 21-28. Mrkovacki, N., & Milic, V. 2001. Use of Azotobacter chroococcum as potentially Centro de Biotecnología pp 14 – 22

ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 23

ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR DESCRIPTIVE STUDY OF POTENTIAL FACTORS FOR THE PRESENCE OF Anaplasma marginale IN CATTLE IN ZAMORA CHINCHIPE PROVINCE, ECUADOR 1.

Tito Ramiro Muñoz Guarnizo1* Patricia Ayora Fernandez2

Centro de Biotecnología, Universidad Nacional de Loja. Ciudadela Guillermo Falconi. “La Argelia”- PBX: 072547252 tito.munoz@unl.edu.ec 2.

Carrera de Medicina Veterinaria. Universidad Nacional de Loja. Ciudadela Guillermo Falconi. “La Argelia”- PBX: 072547252 * Autor para correspondencia

Resumen Con la finalidad de analizar los factores epidemiológicos asociados a la presencia de Anaplasma marginale en la provincia de Zamora Chinchipe, mediante un sistema de muestreo por conglomerados, se seleccionaron 100 fincas de la región pertenecientes a los cuatro sectores (norte, sur, este y oeste), preestablecidos para el efecto; correspondiendo a cada sector un número determinado de fincas de acuerdo al total que se encuentran enlistadas en el registro del Ministerio de Agricultura, Ganadería, Acuicultura y Pesca (MAGAP) de la mencionada provincia. De acuerdo al factor de muestreo al sector norte le correspondieron 53, al sur 9, al este 10 y al oeste 28 fincas. Para poder extraer la información se aplicó una entrevista a los ganaderos de las granjas seleccionadas, tomando en consideración el sistema de producción, el tipo de explotación, conocimiento y presencia de la enfermedad, cuarentena, vías de contagio, tratamiento y control; cuyos datos revelan que estos factores, están estrechamente relacionados con la presencia del patógeno, constituyéndose las garrapatas y la acción iatrogénica del ganadero en los principales mecanismos de transmisión.

Palabras claves: Rickettsias, anaplasmosis, ganado bovino, Zamora Chinchipe.

Abstract In order to analyze the epidemiological factors associated with the presence of Anaplasma marginale in the province of Zamora Chinchipe, through a system of cluster sampling, 100 farms in the region belonging to the four selected areas (north, south, east and west), presets for the effect. Each sector corresponding to a number of farms according to the total that are listed in the register of the Ministry of Agriculture, Livestock, Aquaculture and Fisheries (MAGAP) from the said province. According to the sampling factor 53 farms corresponded to the northern sector 9 to the southern, 10 to the east and 28 to the west farms. In order to extract the information an interview was applied to farmers of selected farms, taking into account the production system, the type of exploitation, knowledge and presence of the disease, quarantine, modes of transmission, treatment and control; whose data indicate that these factors are closely related to the presence of the pathogen, becoming ticks and livestock iatrogenic action on the main mechanisms of transmission.

Keywords: Rickettsias, anaplasmosis, bovine, Zamora Chinchipe. Recibido: marzo 17 de 2015

Aprobado: junio 04 de 2015


24 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

Introducción Anaplasmosis, tradicionalmente conocida como enfermedad de la vesícula, se refiere a una enfermedad de los rumiantes causada por bacterias intraeritrocíticas obligadas del género Anaplasma. Es una enfermedad infecciosa pero no contagiosa, se transmite por las picaduras de garrapatas o la transferencia mecánica de los eritrocitos frescos de moscas que pican o equipos quirúrgicos, tales como agujas, descornado, castración o equipo de tatuaje (Aubry y Geale, 2010). Se han señalado como factores predisponentes para su prevalencia el clima, los sistemas de pastoreo, la presencia de vectores biológicos y mecánicos (Vilma, 2005) Anaplasma marginale, microrganismo que produce la anaplasmosis, se clasifica en el género Anaplasma perteneciente a la familia Anaplasmataceae del orden Rickettsiales. Anaplasma centrale, menos patógeno, se utiliza como una vacuna viva para el ganado en Israel, Sudáfrica, América del Sur y Australia (de la Fuente et al., 2005b). Anaplasma centrale nunca ha sido reportado en América del Norte. Además, Anaplasma ovis, el agente de la anaplasmosis ovina, puede variar de leve a grave enfermedad en las ovejas, ciervos y cabras, pero no es contagiosa para el ganado. A. marginale no causa enfermedad en humanos (Aubry y Geale, 2010). A. marginale es una Rickettsia del genogrupo II de las Ehrlichias, que parasita los eritrocitos maduros del ganado bovino y causa severas pérdidas económicas fundamentalmente en las zonas tropicales y subtropicales (Palmer y et al., 1999). Este microorganismo presenta múltiple variabilidad antigénica, de morfología, virulencia, transmisibilidad por garrapatas y habilidad para inducir protección cruzada contra aislamientos heterólogos (Palmer y McElwain, 1995). Esta enfermedad se detectó en Suiza, en una explotación ganadera en dos sitios diferentes, con un 8.2 % de muestras positivas por ELISA (Kinhm, 2002). En South África se reportó un 50-75 % de prevalencia de infección (MaCentro de Biotecnología pp 23 – 35

sika y col., 1997). En Venezuela se observó una muy alta incidencia de la enfermedad (Meléndez y Forlano, 1997) y en el estado de Paraná, en Brasil, se reportaron valores de 87.6 % de animales positivos en una región donde la anaplasmosis es endémica. En Ecuador desde el año de 1968, se ha realizado investigaciones en bovinos con el propósito de demostrar la prevalencia de anaplasmosis utilizando diferentes métodos de diagnóstico (Soto, 2010). Es así que utilizando la técnica de frotis sanguíneo y la coloración de Giemsa, se encontró una prevalencia de anaplasmosis de 17,5 % en el cantón Lomas de Sargentillo de la provincia de Guayas (Villafuerte, 2001); mediante la técnica de Wright en el cantón Jama de la provincia de Manabí, se determinó una prevalencia de 43 % (Benítez, 2003); en el cantón Antonio Elizalde de la provincia de Guayas, empleando la técnica de Giemsa, se encontró una prevalencia de 9 % (Arreaga, 2004); mientras que con la misma técnica en el cantón Chone de la provincia de Manabí, se encontró una prevalencia de 65,20% (Villamil, 2005); y en Quito, a nivel de matadero utilizando las técnicas de Giemsa, ELISA y PCR, se hallaron prevalencias de 28,18 %, 91,16 % y 91,71 % respectivamente (Soto, 2010). La Anaplasmosis bovina es una enfermedad que posiblemente esté ocasionando grandes pérdidas económicas en las ganaderías bovinas de la provincia de Zamora Chinchipe, ya que las condiciones climáticas son ideales para la presencia de vectores; la alimentación de los animales se realiza pastoreo libre o al sogueo, especialmente en base a pastos de gramíneas (GADPZCH, 2011); y, existen elevadas prevalencias en sectores donde se han realizado diagnósticos por el método de Giemsa. Chamba J. (2011), encontró una prevalencia de enfermedades hematozoáricas (anaplasmosis y piroplasmosis) de 93 % en el cantón Centinela del Cóndor; Chamba S. (2012), encontró una prevalencia de 82,5 %, en el cantón Yantzaza; en donde Boophilus sp., se convierte en el principal vector de la enfermedad ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 25 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

Materiales y Métodos

Resultados y Discusión

Se realizó un muestro por conglomerados atendiendo a cuatro sectores ganaderos de la provincia de Zamora Chinchipe. Tomando en consideración el número de granjas registradas en el MAGAP de la provincia, se calculó la fracción de muestreo, seleccionándose 100 fincas, a cuyos propietarios se les aplicó un entrevista relacionada a los potenciales factores asociados a la prevalencia de Anaplasma marginale. De las 100 fincas seleccionadas, 53 correspondieron al norte, 9 al sur, 10 al este y 28 al oeste. Se tabularon los datos de la entrevista y los resultados se llevaron a cálculo de porcentajes y proporciones, utilizando para el análisis estadístico la prueba de χ2. Sector Norte Sur Este Oeste Total

Libre 52 9 9 28 98

Sistemas de Pastoreo El 98 % de las fincas realizan pastoreo libre; apenas el 2 % lo hacen de manera semiestabulada, sin existir fincas totalmente estabuladas (Cuadro 1). El pastoreo se constituye en un factor determinante en la prevalencia de la Anaplasmosis, toda vez que es en el suelo de la pradera donde las garrapatas hacen su ovoposición, luego en calidad de larvas apenas imperceptibles trepan hierbas y arbustos, desde donde lo infestan al bovino (Hernández, 2013). Al análisis estadístico, existe diferencia entre los sectores sobre este criterio (p<0,05).

Sistemas de Pastoreo % Semiestabulado 98 1 100 0 90 1 100 0 98 2

% 2 0 10 0 2

Cuadro 1. Sistemas de pastoreo existentes en la provincia de Zamora Chinchipe (%)

Tipo de Explotación Ganadera En la provincia de Zamora Chinchipe pese a poseer un clima tropical que favorece la producción de carne, predomina la ganadería tipo leche (57 %); mientras que la ganadería doble propósito representa el 34 %; y la de tipo carne, apenas un 9 % (Cuadro 2); existiendo en el sector sur una ligera variante en donde el ganado de doble propósito tiene predominio sobre los demás; encontrándose diferencia estadística entre los sectores (p<0,05) en lo referente a esta interrogante. Sector Norte Sur Este Oeste Total

Carne 3 1 4 1 9

(%) 6 11 40 4 9

Se considera que el tipo de explotación ganadera, también es determinante en la prevalencia de A. marginale, pues la raza es un factor importante en la infección con hemoparásitos, los bovinos destinados a la explotación de leche y sus cruces son genéticamente más susceptibles que las razas de carne, debido a una mayor resistencia natural de este ganado a las garrapatas vectores (Gugliemone, 1995).

Tipo de ganadería leche (%) Doble Propósito 30 57 20 3 33 5 5 50 1 19 68 8 57 57 34

(%) 38 56 10 29 34

Cuadro 2. Tipo de explotaciones bovinas, presentes en la provincia de Zamora Chinchipe (%) ISSN: 1390-7573

Centro de Biotecnología pp 23 – 35


26 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

Procedencia del ganado La mayoría del ganado bovino de la provincia procede de la misma finca (100 %), aunque hay también un considerable porcentaje que procede de fincas vecinas (19 %), de otras provincias (18 %) y del Perú (4 %); como es el caso del sector sur, que se encuentra en plena línea de frontera con el país vecino (Cuadro 3). La provincia de Zamora Chinchipe colinda Sector

al Sur y al Este con la vecina república del Perú, en donde la Amazonía peruana con características climatológicas muy similares a la Amazonía ecuatoriana, constituye el 70 % del territorio total de ese país. En esta región, Boophilus microplus (garrapata que activa durante todo el año), es considerada el principal vector de la babesiosis y anaplasmosis (Casas y col., 2009); constituyendo la procedencia del ganado un factor importante en la prevalencia de la enfermedad. Procedencia

Propia Finca

Fincas Vecinas

Otras provincias

Perú

Norte

100

9

13

0

Sur

100

78

56

44

Este

100

40

60

0

Oeste

100

11

0

0

Total

100

19

18

4

Cuadro 3. Procedencia del ganado que se explota en las ganaderías de provincia (%)

Práctica de cuarentena El 92 % de los ganaderos encuestados manifiestan que no practican la cuarentena cuando ingresan animales procedentes de otros lugares a su ganadería (Figura 1). Al análisis estadístico, existe diferencia estadística entre los criterios de los diferentes sectores (p>0,05).

El 95 % aseguran tener la enfermedad en su finca, hecho que ha sido corroborado por diagnósticos realizados en frotis sanguíneo teñido por Giemsa en algunos cantones de la provincia de Zamora Chinchipe (Chamba J.,2011), cuya prevalencia ha sido elevada; al análisis estadístico, no se evidencia diferencia entre los criterios de los sectores (p>0,05).

Camargo y col. (1974), señalan que la babesiosis y anaplasmosis son enfermedades de fuerte impacto que se constituyen en un grande problema para el asentamiento del ganado proveniente de otras latitudes, y que es requerido ejecutar trabajos de cuarentena tendientes a su control.

Este hecho predispone al ganadero a realizar actividades preventivas y curativas de la misma, aunque con poca asistencia profesional, conforme se lo señala más adelante en las medidas de control y tratamiento de la enfermedad.

Conocimiento y presencia de la enfermedad La mayoría de los ganaderos de la provincia de Zamora Chinchipe (89 %), tiene conocimiento de la anaplasmosis, tristeza bovina o fiebre de garrapata, especialmente en los sectores norte, este y oeste; existiendo diferencia estadística en cuanto a la interrogante entre los sectores (p<0,05). Centro de Biotecnología pp 23 – 35

Época del año en que aparece la enfermedad De acuerdo a la información proporcionada por los ganaderos (figura 1), la enfermedad aparece con mayor frecuencia en verano (87 %); observándose también en bajo porcentaje durante el invierno (10 %) o en cualquier época del año (3 %). Al análisis estadístico se encontró diferencia entre los criterios de los ganaderos en los diferentes sectores de la provincia (p<0,05). ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 27 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

García y col. (1992), señala que los aspectos eco-epidemiológicos, donde se ha observado que a pesar de existir condiciones adversas para el desarrollo de los vectores, su número aumenta en esta época de mínima precipitación, debido a la disminución de la inmunidad de los bovinos que se hace evidente como

consecuencia de los factores ambientales y nutricionales de esta época del año, lo que conlleva al resurgimiento del proceso infeccioso en los animales. Por lo tanto, la época del año es un factor importante dentro de la prevalencia de la enfermedad.

Figura 1. Época del año en que aparece con mayor frecuencia la anaplasmosis bovina en Zamora Chinchipe (%).

Síntomas de la enfermedad El 100 % de los ganaderos señala que el principal síntoma es la fiebre, el 87 % la tristeza, un 27 % manifiesta que hay postración; un 26 % también señala la orina con sangre; el 16 Síntomas

% indica como síntoma la renguera; el 13 % también señala la inapetencia, el 6 % ha observado diarrea y el 2 % estreñimiento (Cuadro 4). Sectores % Este

Norte

%

Sur

%

Oeste

%

Tristeza

40

75

9

100

10

100

28

100

Fiebre

53

100

9

100

10

100

28

100

Postración

4

8

1

11

3

30

19

68

Orina con sangre

4

8

3

33

0

0

19

68

Renguera

7

13

7

78

2

20

0

0

Inapetencia

6

11

0

0

7

70

0

0

Estreñimiento

2

4

0

0

0

0

0

0

Diarrea

2

4

3

33

1

10

0

0

Cuadro 4. Principales Síntomas observados por los ganaderos en la fiebre de garrapata (%)

León (1991), al hacer una descripción de la enfermedad, señala que durante la fase aguda, los síntomas clínicos más significantes son: fiebre, anemia, aislamiento del animal, debilidad, disminución de la producción, pérdida de apetito, deshidratación, respiración dificultosa, constipación, temblor muscular e ictericia en los casos muy avanzados. Las vacas enISSN: 1390-7573

fermas con preñez avanzada, frecuentemente abortan. Estos síntomas coinciden plenamente con los reportados por los ganaderos de Zamora Chinchipe. Olguín (2013), añade que los valores de la temperatura están en 41,5 ºC, a más de la frecuencia cardíaca elevada y la bilirrubinemia. Centro de Biotecnología pp 23 – 35


28 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

Utilización de servicios profesionales El 59 % de los ganaderos de la provincia utiliza los servicios profesionales veterinarios para el tratamiento y control de la enfermedad. Un elevado porcentaje (41 %), no utiliza estos servicios pese a la existencia de agencias de servicios agropecuarios (AGROCALIDAD), instaladas a lo largo y ancho de todo el país. Al análisis estadístico existe diferencia de criterios entre los diferentes sectores al respecto (p<0,0). No cabe duda de que la sanidad animal constituye un elemento crítico que tiene una gran repercusión en el estado sanitario y de bienestar de los animales. Hoy día como complemento a la pericia del profesional veterinario, existe en el mercado una amplia gama de productos que contribuyen a mantener un buen estado de salud de los animales, primero con el diagnóstico precoz de las enfermedades, pasando por la prevención de las mismas y si ésta no ha sido posible, con el tratamiento adecuado (VETMASI, 2013). Diagnóstico de laboratorio El 95 % de los ganaderos de la provincia no utilizan los servicios de laboratorio para el diagnóstico de la enfermedad, apenas el 50 % de los ganaderos encuestados en el sector este de la provincia, dicen haber hecho uso de este medio para garantizar el diagnóstico y el control de la enfermedad; encontrándose diferencia estadística entre los criterios de los sectores (p<0,05).

León (1991); señala que el diagnóstico de la enfermedad, las muestras a tomar y los criterios a seguir, variarán según las situaciones que se enfrenten; manifiesta que puede hacerse diagnóstico en animales vivos, recién muertos, muertos en descomposición y en animales en recuperación. Estas actividades encierran la participación insoslayable del profesional médico veterinario y del laboratorista; constituyendo su ausencia, un factor preponderante en la prevalencia de la enfermedad en esta provincia. Edad a la que enferman los animales El 36 % de los ganaderos encuestados señalan que la enfermedad aparece con más frecuencia entre uno y 2 años de edad; mientras que el 32 % manifiesta que enfermedad está presente antes del año o en más de dos años de edad (figura 2). Rhades (2005); manifiesta que todos los bovinos, independientemente de la edad, se enferman de tristeza. Los animales jóvenes son más resistentes, pero por causas estresantes ligadas al manejo, deficiencias nutricionales, enfermedades, excesiva carga de garrapatas, pueden contraer la enfermedad. Animales jóvenes, entre 6 y 9 meses de edad, ya no poseen la resistencia conferida por el calostro y son propensos a la infección; ya que un animal infectado no presenta signos clínicos al inicio de la infección o solo cuando más del 15 % de sus eritrocitos han sido invadidos por la rickettsia (Sierra, 2013).

Figura 2. Edad en la que con mayor frecuencia enferman los bovinos con anaplasmosis en la provincia de Zamora Chinchipe (%). Centro de Biotecnología pp 23 – 35

ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 29 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

Morbilidad anual El 44 % de los ganaderos señala que la morbilidad alcanza entre 1 y 2 % de su población ganadera; mientras que el 29 % indica que enferman entre el 2 y 4 %; el 15 % manifiesta que la morbilidad alcanza valores superiores al 4 %; y, el 12 % informa que no se enferman los animales (figura 3). Olguín (2013), señala que en la anaplasmosis la morbilidad es alta y la mortalidad depende de la receptividad y susceptibilidad del ganado y puede ser de hasta el 30 %. De acuerdo

al presente reporte, estos índices son bajos, dando a entender que la estabilidad enzoótica de la enfermedad, ejerce un control natural de la misma, reduciendo significativamente los casos de anplasmosis clínica en el ganado del sector. El cuadro clínico agudo ocurre únicamente en animales adultos susceptibles cuando se transportan a regiones endémicas (Sierra, 2013). En sistemas intensivos de áreas no endémicas (Rossanigo y col, 2000), encontraron valores de 2,5 % de morbilidad y una mortalidad del 0,8 %.

Figura 3. Porcentajes de morbilidad de morbilidad de anaplasmosis bovina en la provincia de Zamora Chinchipe.

Mortalidad anual El 59 % de los ganaderos no reporta mortalidad, mientras que 36 % indica que hay una mortalidad que va de 1 al 2%; y, el 5 % de ganaderos señala mortalidades superiores al 2 % (figura 4). Quiroz (1990), señala que la frecuencia, incidencia, prevalencia, de la morbilidad y mortalidad varían de acuerdo con la edad. En

general los becerros muestran mayor grado de resistencia que los adultos y que algunas veces se presentan brotes en animales jóvenes; manifiesta que en general, se considera a las razas europeas más susceptibles que las cebuínas, debido al hecho de que éstas tienen menor cantidad de garrapatas y por tanto, reducen las posibilidades de infección; sin embargo, en las mismas condiciones, son igualmente susceptibles.

Figura 4. Porcentajes de mortalidad a causa de anaplasmosis bovina en la provincia de Zamora Chinchipe

ISSN: 1390-7573

Centro de Biotecnología pp 23 – 35


30 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

Control de la enfermedad Uso de vacunas El 100 % de los ganaderos dice no aplicar ningún tipo de vacuna, lo cual favorece el estudio de la enfermedad y permite un diagnóstico más efectivo de la misma.

Tratamiento antibiótico El 57 % de los ganaderos encuestados usa para el tratamiento de la enfermedad Tetraciclinas; el 39 %, utiliza combinaciones de Tetraciclinas + Diminazeno y el 4 %, utiliza otros productos farmacológicos (figura 5).

Al ser Zamora Chinchipe una zona bastante aislada de la influencia del comercio de productos biológicos especialmente de origen colombiano, no se ha logrado introducir hasta el momento ningún tipo de vacuna comercial para la prevención de la enfermedad. Olguín (2013), manifiesta que las vacunas utilizadas de manera adecuada y tomando las medidas de precaución debidas, pueden llegar a ser una opción.

Los tratamientos más eficaces se han logrado con tetraciclinas a dosis de 10 mg/kg de peso de 1 a 3 días; siendo el Imidocarb otra droga de utilidad para el tratamiento de la infección a dosis de 2,5 a 3,5 mg/kg de peso (Sierra, 2013); sin embargo, Olguín (2013), señala que la dosis de tetraciclina debe ser de 20 mg/kg de peso de 2 a 3 días, incluyendo cardiotónicos y transfusiones sanguíneas en anemias intensas. El diminaceno no es una droga anaplasmicida, pero se combina siempre con tetraciclinas para tratar infecciones asociadas a protozoarios hematozoarios como Babesia sp., y Tripanosoma sp.; enfermedades que comúnmente pueden coexistir en la región.

La existencia de inmunidad previa, la velocidad de transmisión y la edad a la que ocurre el primer contacto con el parásito (primoinfección), determinan el efecto clínico que causa este contacto entre el huésped y el parásito (Sierra, 2013).

Figura 5. Tratamientos más comunes contra anaplasmosis bovina en las ganaderías de la provincia de Zamora Chinchipe.

Presencia de garrapatas El 92 % de ganaderos reporta la presencia de garrapatas en su finca; lo cual convierte a este parásito en uno de los principales vectores de la enfermedad. Al análisis estadístico, existe diferencia entre los criterios de los diferentes sectores respecto a la presencia de este vector (p<0,05). Las condiciones ecológicas del trópico sudamericano proveen un hábitat adecuado para la multiplicación de artrópodos vectores (garrapatas, moscas, tábanos y mosquitos) de una serie de enfermedades tropicales, dentro Centro de Biotecnología pp 23 – 35

de las cuales está la anplasmosis (Benavides, 2008). Las garrapatas son parásitos hematófagos que se fijan firmemente al hospedero, son altamente resistentes al ambiente, relativamente libres de enemigos naturales, con poca especificidad en cuanto a hospederos y alto potencial biótico; cuya capacidad de vector patógeno se conoció recién afines del siglo XIX, cuando se descubrió que ellas transmitían la babesiosis al ganado vacuno (Del Río y col., 2010). De las estimadas 1,000 millones de cabezas de ganado vacuno en el mundo, entre 70 y 80 ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 31 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

% vive en países tropicales y subtropicales en los que la garrapata es activa durante todo el año. La pérdida de peso de un bovino parasitado por garrapatas Boophilus spp., se calcula en 0.26 kg/garrapata/año y por Amblyomma spp., hasta 1.09 kg/garrapata/ año. Esto ocasiona pérdidas de varios miles de millones de dólares en la economía pecuaria mundial (Hernández, 2013). Grado de infestación El grado de infestación se determinó en base a la encuesta y a la observación directa del ganado por parte del encuestador; asumien-

do los tres niveles que se remiten en los resultados (Álvarez y Hernández, 2010). El 40 % de los ganaderos dice tener un grado alto de infestación, mientras que el 37 % señala que el grado de infestación es medio; y, el 23 % indica que la infestación por garrapatas es baja (figura 6). Existe diferencia estadística entre los criterios de los diferentes sectores (p<0,05). Este reporte permite considerar al grado de infestación como un factor determinante en la elevada prevalencia de la anaplasmosis bovina en la provincia de Zamora Chinchipe.

Figura 6. Niveles de infestación por garrapatas en las ganaderías de la provincia de Zamora Chinchipe (%).

Control de garrapatas El 67 % de las ganaderías utiliza amitraz para el control de las garrapatas, el 13% hace uso de avermectinas; el 12 % utiliza piretroides y el 8 %, usa organofosforados (figura 7). Como puede observarse, todos los ganaderos encuestados realizan control químico de la garrapata en la provincia de Zamora de Chinchipe, utilizando diferentes principios activos pertenecientes a grupos de sustancias con efecto acaricida entre los que destacan

las amidinas, piretroides, organofosforados y avermectinas con efecto endectocida. El método más utilizado para la aplicación de estos productos a excepción de la avermectinas, es el baño por aspersión, utilizando bomba mochila. Rodríguez y col. (2006), señala que el método más eficiente para el control de garrapatas es la utilización de productos químicos a una frecuencia de tratamientos variables dependiendo del nivel de infestación de los animales.

Figura 7. Sustancias activas utilizadas para el control de garrapatas en las ganaderías bovinas de la provincia de Zamora Chinchipe (%). ISSN: 1390-7573

Centro de Biotecnología pp 23 – 35


32 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

Frecuencia de control de garrapatas El 42 % de los ganaderos realiza el control cada 30 días; el 27 % lo practica cada 90 días; el 20 % lo hace cada 15 días; y, el 11 % manifiesta hacerlo cada 180 días; esto está relacionado directamente con el uso de productos como las avermectinas que son sustancias de aplicación parenteral con períodos de permanencia largos (figura 8). Al ser la región amazónica ideal para la repro-

ducción de la garrapata, los controles deben realizarse con determinada frecuencia y asociados a sustancias fijadoras para evitar el lavado con la lluvia. Esta actividad laboriosa ha cambiado drásticamente desde el aparecimiento de la avermectinas, que las aplican generalmente en lapsos de 90 días. Los tratamientos contra Boophilus spp., se realizan a intervalos de 14 a 21 días y contra Amblyomma spp., cada 7 a 10 días en las épocas de alta infestación (Hernández, 2013).

Figura 8. Frecuencia con la que se realizan los controles garrapaticidas en la provincia de Zamora Chinchipe (%).

Actualmente, la concepción del enfoque de control de garrapatas ha cambiado. Con el propósito de retardar el problema de resistencia a los garrapaticidas, es necesario desestimular la recomendación de aquellas estrategias de control que promuevan la extrema reducción de las poblaciones de garrapatas en el hospedero y el “refugio” (garrapatas que se encuentran en el ambiente que no han recibido tratamiento con garrapaticidas) a través de tratamiento sistemático del garrapaticida. Se ha demostrado que los ranchos que utilizan garrapatacidas para el control de garrapatas más de 6 veces al año tienen más probabilidad esta población de garrapatas de generar resistencia (Rodríguez y col., 2006). Alternabilidad de productos para el control El 55 % de los ganaderos no realiza alternabilidad de productos, generando probablemente mecanismos de resistencia en las garrapatas, lo cual favorece indudablemente una elevada prevalencia de la enfermedad. Al análisis estadístico, se observa diferencia entre los criterios de los ganaderos de los diferentes sectores (p<0,05). Centro de Biotecnología pp 23 – 35

Cuando la resistencia está presente no tiene sentido seguir utilizando la misma droga e incluso el mismo grupo químico en el caso de los Piretroides y Amidinas; sin embargo, en el caso de los organofosforados, puede existir resistencia al diazinón y las garrapatas pueden ser controladas por un corto período mediante el uso de coumafos, clorfenvinfos o clorpirifos (Rodríguez y col., 2006). Mecanismos de Transmisión Conocimiento de los medios de transmisión de la enfermedad El 80 % de los ganaderos asegura conocer los mecanismos de transmisión de la enfermedad, pero asimismo es poco cauteloso con las medidas preventivas. Existe diferencia estadística entre los sectores respecto de este factor (p<0,05). Las vías más importantes de transmisión de la enfermedad son: la mecánica en la que se introducen directamente los eritrocitos infectados, ya sea por inoculación natural a través de picaduras de artrópodos hematófagos parasitados o artificialmente con objetos punISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 33 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

zantes contaminados (Richey y Palmer, 1990, y Kokan y col., 2003) y la transmisión vertical de tipo placenta-feto, cuando la madre sufre anaplasmosis aguda (Zaugg, 1990). Este autor demostró que A. marginale, podía, en el segundo y tercer trimestre de gestación, atravesar la barrera placentaria e infectar al feto y que probablemente esto no sucedía dentro de los eritrocitos, sino que era una fase extraeritrocitaria del parásito. Según Rey y col., (2003), la vía de transmisión transplacentaria debe ser tomada en cuenta como factor de riesgo en zonas donde la anaplasmosis es endémica.

tomáticos y algunos rumiantes silvestres, fungen como reservorios naturales y son los responsables de preservar el agente etiológico en la naturaleza (Ristic, 1980).

Presencia de Tábano El 96 % de los ganaderos reporta la presencia de tábano en su ganadería, lo cual es un indicador de que este insecto juega también un papel importante como medio de transmisión mecánica de la enfermedad; existiendo diferencia estadística entre los sectores respecto de esta interrogante (p<0,05).

Esta acción presupone la transmisión mecánico - iatrógenica más común y efectiva en las ganaderías de la provincia de Zamora Chinchipe. Aunque la transmisión mecánica por medio de moscas, tábanos y el hombre (material quirúrgico, agujas), es sumamente importante en la difusión de la enfermedad (Olguín, 2013). Rodríguez y col. (2003), al respecto señala que la transmisión mecánica también está dada por manipulaciones como castraciones, descornes y vacunaciones en las que los utensilios no han sido esterilizados adecuadamente. (kokan y col., 2003), manifiesta que la transmisión mecánica se produce con frecuencia a través de fómites contaminados con sangre, incluyendo agujas, sierras de descornamiento, mochetas, instrumentos de tatuaje, dispositivos de oído-etiquetado, y los instrumentos de castración. Esta forma de transmisión mecánica se considera que es la principal vía de difusión de A. marginale en áreas de Centro y Sur América y África

Según Junquera (2013), los tábanos constituyen una gran familia de más de 3500 especies a nivel mundial (Tabanus spp., Hematopota spp.,Chrysops spp., etc.). Atacan al ganado bovino, ovino, caprino, porcino y a todo tipo de mamíferos domésticos y salvajes, incluido el hombre y también a perros y gatos. Señala que su importancia radica en que la producción de vacas lecheras en pastoreo puede verse reducida de hasta el 25 %, además de la transmisión de enfermedades como anaplasmosis, tripanosomiasis y otras; pero, de ordinario no son los vectores más importantes de estas enfermedades.

Esterilización de material quirúrgico e hipodérmico

El 83 % de los ganaderos, no esteriliza el material quirúrgico o jeringas hipodérmicas utilizadas en la prevención o el tratamiento de las enfermedades del ganado. Siendo estadísticamente diferentes los criterios de los ganaderos al respecto, en los diferentes sectores (P<0,05).

Contacto con animales silvestres El 71 % de los ganaderos no reporta contacto de su ganado con animales silvestres, a excepción de los sectores norte y sur donde un gran porcentaje de ganaderos aseguran que sus animales tienen contacto con animales silvestres considerados fuente importante de infección.

Conclusiones

Se piensa que los portadores crónicos asin-

La mayoría de explotaciones ganaderas en

ISSN: 1390-7573

Los sistemas de alimentación son factores determinantes en la presencia de A. marginale en la provincia de Zamora Chinchipe; el clima y la humedad favorece la recuperación rápida de los pastizales y el retorno de los animales antes de que se rompan ciclos evolutivos de la garrapata.

Centro de Biotecnología pp 23 – 35


34 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

la provincia de Zamora Chinchipe son de tipo lechero donde predomina la raza Holstein Friesian (Bos taurus), ganado genéticamente más sensible a la garrapata que el tipo de carne de origen Bos indicus. La mayoría del ganado bovino que circula en la provincia proviene de fincas aledañas con características climáticas y meteorológicas similares, esto obliga al ganadero de la zona a prescindir de la cuarentena que podría ser un gran auxiliar en la prevención de ésta y otras enfermedades. Agradecimientos A las Asociaciones de Ganaderos de la provincia de Zamora Chinchipe y a sus socios, por la invalorable colaboración y paciencia en la entrega de la información requerida; a los técnicos de AGROCALIDAD, por su apoyo logístico en procura de datos importantes para la presente investigación.

Bibliografía Álvarez V. y Hernández V. Diagnóstico de Resistencia a Organofosforados, Piretroides Sintéticos, Amidinas e Ivermectinas en la Garrapata Rhipicephalus microplus en Fincas de productores de leche de Costa Rica, 2010. Revista FAVE, Ciencias Veterinarias 9 (2): 11-18. Benavides E.; Consideraciones sobre epidemiología de Anaplasmosis y babesiosis de los bovinos, efecto de la estabilidad enzoótica de los hatos. 2008; disponible en: http://www.slideshare. n et / E V B e n av i d e s /e p i d e m i o l o g i a anaplasmosis-y-babesiosis Camargo A., Serrate H., y Saavedra A.. 1974. II Reunión Nacional de Investigadores en Ganadería, Bolivia. 147pp Casas E., Tigreros A., Chávez A., Tang J., Ruiz F. 2009. Tratamiento y control de Centro de Biotecnología pp 23 – 35

garrapata Boophilus microplus, a través de la combinación de Fluzuron/fipronil pour on,en bovinos de trópico, Pucallpa, Perú. Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Marcos de Lima, Perú; Chamba J., Estudio de los ectoparásitos en el ganado bovino del cantón Centinela del Cóndor de la provincia de Zamora Chinchipe. 2011. Tesis de Grado. Carrera de Medicina Veterinaria y Zootecnia de la Universidad Nacional de Loja. Chamba S. 2012. Determinación de la Prevalencia de la Anaplasmosis Bovina en el Cantón Yantzaza de la provincia de Zamora Chinchipe. Tesis de Grado, Carrera de Medicina Veterinaria y Zootecnia de la Universidad Nacional de Loja. Del Río M., Del Río N. y Rodríguez J. Garrapatas, 2010. Disponible en : http:// www.slideshare.net/MYRIAM_DELRIO/ garrapatas-5586181?from_search=1 Guglielmone, A. A. 1995. Epidemiology of babesiosis and anaplasmosis in South and Central America. Vet. Parasitol. 57:109119. Hernández M. 2013. Manual Bayer de la Garrapata. Bayer México S.A.; División Animal. Jiménez J. 2013. Determinación de la Prevalencia de la Anaplasmosis Bovina en el Cantón Zamora de la provincia de Zamora Chinchipe. Tesis de Grado, Carrera de Medicina Veterinaria y Zootecnia de la Universidad Nacional de Loja. Junquera P. 2013. Tábanos en el ganado. Disponible en: http://parasitipedia. net / index.php?opt i on= c om _ content&view=article&id=128&Itemid=95

ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 35 Muñoz et al. (2015); ESTUDIO DESCRIPTIVO DE FACTORES POTENCIALES PARA LA PRESENCIA DE Anaplasma marginale EN EL GANADO BOVINO DE LA PROVINCIA DE ZAMORA CHINCHIPE, ECUADOR

Kocan K., De la Fuente J., Guglielmone A. y Meléndez R. 2003. Antígenos y Alternativas para el Control de Anaplasma marginale infección en el ganado bovino, Disponible en: http://www.ncbi.nlm.nih.gov/ pmc/articles/PMC207124/

Manual Técnico para el Control de Garrapatas en el ganado Bovino. Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias, Centro Nacional de Investigaciones en Parasitología Veterinaria. Jiutepec, Morelos, México.

Miles F. 2013. Determinación de la Prevalencia de la Anaplasmosis Bovina en el Cantón Nangaritza de la provincia de Zamora Chinchipe. Tesis de Grado, Carrera de Medicina Veterinaria y Zootecnia de la Universidad Nacional de Loja.

Rossanigo C. E., Sager R. L., Ferrero G. y Toselli J. 2000. Anaplasmosis en Sistemas Intensivos de áreas no endémicas, 2000. 24° Congreso Argentino de Producción Animal.

Olguín A. 2013. Anaplasmosis. Universidad Nacional Autónoma de México; Facultad de Medicina veterinaria y Zootecnia. Disponible en: http://www.slideshare.net/ cuencamvz24/anaplasmosis-16600480 Quiroz R. 1990. Parasitología y enfermedades Parasitarias de Animales Domésticos. Editorial Limusa. México. Rey, C.; Aso, P. M. y Coronado, A. 2003. Homologous and heterologous immune reactions betwewn Venezuelan geographic isolates of Anaplasma marginale. Ann. NY. Acad. Sci. 916: 658-661. Rhades L. 2005. Trsiteza Bovina: Babesiosis – Anaplasmosis Bovina. Agencia INTA Cambio Rural San Salvador. Disponible en: http://www.vet-uy.com/articulos/ bovinos/100/0052/bov052.htm

Sierra J. 2013. Slideshare.

Anaplasmosis

Bovina.

VETMASI. 2013. La sanidad Animal. Disponible en: http://www.vetmasi.es/ plataforma-tecnologica-espanola-desanidad-animal/espanol/la-sanidadanimal_20_1_ap.html Villamagua C. 2013. Determinación de la Prevalencia de la Anaplasmosis Bovina en el Cantón Chinchipe de la provincia de Zamora Chinchipe. Tesis de Grado, Carrera de Medicina Veterinaria y Zootecnia de la Universidad Nacional de Loja. Zaugg, J. L. 1990. Seasonally of natural transmission of bovine anaplasmosis under desert mountain range conditions. Jauma. 196: 1106-1109.

Richey, E. J. y Palmer, G. H. 1990. Bovine Anaplasmosis. The Compendium Food Animal. 12: 1661-1669. Ristic, M. 1980. Anaplasmosis. In: Bovine Medicine and Surgery ed. by H.I. Amstutz, Am. Veterinary PubliCations, Inc. 2nd Ed. Vol. 1 Sta Barbara, Cal. 324-348 pp. Rodríguez R., Rosado A., Basto G., Sotero Z., Rosario R. y Fragoso H. 2006. ISSN: 1390-7573

Centro de Biotecnología pp 23 – 35


36 Centro de Biotecnología, Vol. 4 Nro. 1. 2015

IMPLEMENTACIÓN DEL METODO DE COMPOSTAJE TAKAKURA PARA EL RECICLAJE DE DESECHOS EN LA CIUDAD DE LOJA, ECUADOR

IMPLEMENTING TAKAKURA COMPOSTING METHOD FOR WASTE RECYCLING IN LOJA CITY, ECUADOR Facultad de Ciencias Administrativas y Económicas. Universidad Internacional del Ecuador, Sede Loja. Av. Manuel Agustín Aguirre 12-75 y Maximiliano Rodríguez. Loja-ECUADOR. raqverho4@yahoo.es 2 Centro de Biotecnología, Universidad Nacional de Loja. Ciudadela Guillermo Falconi. “La Argelia” - PBX: 072547252 - Casilla Letra “S”, Loja, Ecuador. roldan.torres@unl.edu.ec 3 Relleno Sanitario. Municipio de Loja. Loja, Ecuador. yramirez@loja.gob.ec * Autor para correspondencia 1

Raquel Verónica Hernández Ocampo1* Roldán Torres-Gutiérrez2 Yhonel Bolívar Ramírez Armijos3

Resumen La presente investigación se llevó a cabo con el objetivo de implementar una nueva técnica de compostaje que puede ser utilizada para la descomposición de residuos de manera rápida, económica y ambientalmente amigable. La aplicación del método Takakura fue probado en el Centro Integral de Residuos Sólidos de la ciudad de Loja. La obtención del abono orgánico se obtiene a partir del reciclaje de residuos biodegradables, que en mucho de los casos son arrojados sin ningún tratamiento. Por lo que el método consistió en descomponer con la ayuda de microorganismos la materia orgánica, los resultados obtenidos de esta técnica se constituye en una alternativa para aprovechar los residuos sólidos biodegradables e incluso los líquidos como el aceite de cocina, ya que permite que los microorganismos los descompongan obteniendo un abono de adecuada calidad, el cual se puede utilizar para mejorar el contenido de materia orgánica en suelos agrícolas, áreas verdes y jardines. Palabras claves: Compost, residuos biodegradables, microorganismos, relleno sanitario-Loja

Abstract This research was carried out with the aim of implementing a new composting technique that can be used to decompose residuals in a quick, economic and environmentally friendly way. The application of the Takura Method was tested in the Integral Center of Solid Residuals in Loja. The organic compost is obtained from recycling biodegradable residuals that are discarded, in some cases without adequate handling techniques. This method used microorganism to break down the organic matter. The results obtained with this technique become an alternative in order to take advantage of the solid biodegradable residuals and even fluids like kitchen oil, because it allows microorganisms to decompose, obtaining good quality compost, which can be used to improve the organic matter in agricultural soils, green areas and gardens.

Keywords: Compost, biodegradable residuals, microorganisms, landfill-Loja. Recibido: agosto 17 de 2015

Aprobado: septiembre 28 de 2015


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 37 Hernández et al. (2015); IMPLEMENTACIÓN DEL METODO DE COMPOSTAJE TAKAKURA PARA EL RECICLAJE DE DESECHOS EN LA CIUDAD DE LOJA, ECUADOR

Introducción Uno de los problemas con los que actualmente se enfrentan los habitantes de las ciudades, es el inadecuado manejo de los desechos sólidos y líquidos, que se generan de las diversas actividades productivas y de servicios, que los seres humanos realizan cotidianamente. En la ciudad de Loja en el año 1997 se implementó el Relleno Sanitario, proyecto que hasta el momento es una opción para disponer los residuos sólidos. Anteriormente a esta fecha sin ningún estudio ni control o tratamiento previo los desechos sólidos se los disponían en sitios inadecuados, improvisados y con incipiente manejo. En la actualidad, el Programa de Gestión Integral de Residuos Sólidos en la ciudad de Loja, lo gestiona la Dirección de Higiene, que cuenta con la respectiva unidad técnica. (Jefatura de Higiene, 2014) Esta unidad técnica ejecuta un tratamiento de los desechos sólidos que se lo cumple en las siguientes fases: clasificación domiciliaria (separación de lo biodegradable y lo no degradable), recolección alternada de los recipientes de desechos degradables y no degradables, transporte, recuperación o reciclaje y disposición final. Estas fases se las complementa con el barrido y recolección de desechos o aseo público y limpieza de calles y con la producción de abono orgánico en la planta de compostaje. La producción per cápita de desechos sólidos está en el orden de 0,70 Kg/Hab/día, lo que arroja un valor promedio de 135 toneladas diarias, de estos desechos un porcentaje de 60 % corresponde a basura orgánica y el 40 % a inorgánica. Con los procesos de gestión referidos; se recupera el 20 % de lo orgánico y 15 % de lo inorgánico. (Jefatura de Higiene, 2014). En la actualidad en el Centro Integral de Manejo de Desechos Sólidos del Municipio de Loja, se vienen desarrollando diversas actividades para reciclar, reducir, reparar, reutilizar y rechazar los residuos sólidos biodegradables y no biodegradables. En el interés de mejorar ISSN: 1390-7573

dichas actividades, se utilizó nuevas técnicas que permitan degradar la materia orgánica en menor en tiempo y sirva como abono orgánico; éstas se orientan a procurar un ambiente saludable y libre de contaminación, la aplicación del método Takakura es utilizado como herramienta de responsabilidad ambiental. El método Takakura, es un procedimiento que contribuye a la obtención de compost, para ello requiere como precondición el uso de microorganismos que descomponen los residuos orgánicos y lo hacen en un corto tiempo (por ejemplo los residuos de comida pueden ser descompuestos en 48 horas). Esta alternativa reduce la cantidad de desechos orgánicos que se producen en los hogares de la ciudad y podría aprovechar los subproductos orgánicos que se genera en las labores agrícolas en el campo. (Honobe, 2013). Este método, utiliza todo tipo de desechos, incluso aceite residual de cocina, ya que provoca una rápida descomposición de los residuos sólidos y líquidos lo que a su vez evita se conviertan en contaminantes. La obtención de compost o materia orgánica con nutrientes aprovechables, podrá ser utilizada en los jardines e inclusive se podrá comercializar para mejorar la fertilidad de los suelos agrícolas en el mediano plazo, que de acuerdo a lo que afirma (Iñiguez, M. 2006) este proceso requiere de dos a tres años. Este método es una herramienta para reducir residuos orgánicos y mejorar la fertilidad del suelo. De acuerdo con estimaciones hechas por la FAO (2006), debido a la desertificación, cada año dejan de ser productivas de seis a siete millones de hectáreas en el mundo y a este ritmo, en menos de 200 años el ser humano habrá agotado todos los suelos productivos del planeta (Becerra, 1998).

Materiales y métodos La implementación del método Takakura, se lo realizó en la Planta de Compostaje que se encuentra en el Centro Integral de Manejo de Desechos Sólidos de la ciudad de Loja, ubiCentro de Biotecnología pp 36 – 41


38 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Hernández et al. (2015); IMPLEMENTACIÓN DEL METODO DE COMPOSTAJE TAKAKURA PARA EL RECICLAJE DE DESECHOS EN LA CIUDAD DE LOJA, ECUADOR

cado en el área urbana de la ciudad de Loja, cantón y provincia de Loja, en la parte sur-occidental de la ciudad. El método Takakura requiere se inicie elaborando dos soluciones una salada en la que se incluye sal, residuos de las ferias libres y se mezcla con agua, simultáneamente se elabora la solución dulce en la que se coloca levadura, yogurt, melaza y agua. Estas dos soluciones se las dejó reposar durante 8 días con relación al recipiente de la solución dulce no se ajusta la tapa del envase, porque la fermentación produce gases que puede provocar que esta explote. Para crear la semilla del compost, se colocó la base del compost (cascarilla de arroz) y se mezcló con la harina, para que los microorganismos eficaces puedan alimentarse y desarrollarse de mejor manera. Además, se agregó hojarasca, hongos y moho, recolectados en el bosque al que se colocó las soluciones de sal y de dulce, que actuaron durante ocho días, propiciando la destrucción de microorganismos patógenos y la multiplicación de microorganismos benéficos encargados de la descomposición de los residuos. Según Campitelli, P. (2014), cuando se trabaja con residuos orgánicos con el propósito de obtener enmiendas para el suelo, el proceso de compostaje tiene como objetivo la destrucción o eliminación de microorganismos patógenos, así como la eliminación de sustancias orgánicas que puedan ser tóxicas para las plantas que se encuentran en el material de partida o que se generan en las primeras etapas del proceso. Luego de realizada la mezcla de todos los componentes, se ajustó el nivel de humedad recomendado en el Método Takakura, esto es entre el 40 y 60% y que de forma práctica se lo hace apretando la semilla con la mano, si esta se mantiene compacta significa que tiene la humedad adecuada. Con esta semilla se realizó una pila y se la cubrió con tela con la finalidad de que las moscas no depositen sus huevos y contaminen Centro de Biotecnología pp 36 – 41

el compost, luego se lo dejo reposar durante siete días. Esta pila se recomienda que deba estar ubicada en un lugar en la que pueda respirar. Durante los siete días se mezcló de manera diaria la semilla; cuando se la encontró que estaba seca, se añadió agua, verificando de manera permanente el estado de la semilla. Se mezcló los residuos sólidos orgánicos de las ferias libres y mercados con la semilla de compost y se mezcló cada 2 días durante 4 semanas, dando un seguimiento permanente a la semilla de compost. Además se colocó 20 litros de aceite residual de los puestos de cocina del mercado La Tebaida, sobre la pila del compost con la finalidad de probar como los microorganismos lo descomponen y lo convierten en materia orgánica. Al obtener el compost maduro y luego de cinco días, se envió una muestra al Laboratorio de Suelos de la Universidad Nacional de Loja, en la que se realizaron los análisis químicos para la obtención de parámetros que permitan verificar la calidad del compost.

Resultados Para obtener el compost a través de la aplicación del método Takakura, se inició con la elaboración de las soluciones, mismas que fueron mezcladas con la cascarilla de arroz, harina y hojarasca para crear la semilla de compostaje. La semilla fue mezclada con los residuos orgánicos de las ferias libres y luego de dos meses, se obtuvo el compostaje de la cual se separó la mitad dejándolo reposar dos semanas, la otra mitad queda como base para seguir elaborando el compost; el tiempo para obtenerlo fue de dos meses. Si se disminuye el tiempo se ahorra jornales o días/hombre, por lo que bajan significativamente los costos de producción del abono – aporte económico, además de reducir los desechos antes de su llegada a la disposición final. ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 39 Hernández et al. (2015); IMPLEMENTACIÓN DEL METODO DE COMPOSTAJE TAKAKURA PARA EL RECICLAJE DE DESECHOS EN LA CIUDAD DE LOJA, ECUADOR

Estos datos se obtuvieron en el Centro Integral de Residuos Sólidos de la ciudad de Loja, permitiendo ahorrar tiempo y optimizando el aporte del trabajo y de los recursos económicos asignados por la municipalidad del cantón Loja.

Para determinar la calidad del compost que se obtiene por la aplicación del método Takakura, se realizó el análisis de suelos, en el laboratorio de la Universidad Nacional de Loja (ver cuadro 1).

PARÁMETROS DE ANÁLISIS

Muestra

pH

M.O %

N ppm

P2O5 ppm

K 2O ppm

9,1

37,3

135,52

503,54

69,2

Alcalino

Muy alto

Alto

Muy alto

Bajo

Leyenda: Potencial de hidrogeno (pH), Materia orgánica (M.O.), Nitrógeno (N), Óxido de fósforo (P2O5) y Óxido de potasio (K2O). Cuadro 1. Análisis químico del compost obtenido por el método Takakura.

Los abonos orgánicos resultan de la mezcla de restos vegetales y animales con el propósito de acelerar el proceso de descomposición natural de los desechos orgánicos por una variedad de microorganismos en un medio húmedo, caliente y aireado que da como resultado un fertilizante de alta calidad. Cuando los desechos son inoculados con microorganismos efectivos (EM), acelera el compostaje por medio de un proceso de fermentación, acelerando significativamente la obtención del abono orgánico.

Discusión Al hablar de la prevalencia total, se puede El objetivo de la solución salada es capturar los microorganismos que viven en las superficies de las verduras, hortalizas y frutas, en las que existe ácido láctico y levaduras. Estas bacterias eficaces tienen resistencia contra la sal, en cambio los microorganismos patógenos no resisten la alta concentración de sal debido a que se altera la actividad fisiológica, obstruye la capacidad metabólica y disminuye los procesos de reproducción de hongos, bacterias y moluscos, por lo que esta solución permite cultivar solo los microorganismos eficaces. El objetivo de la solución dulce es capturar los ISSN: 1390-7573

microorganismos que viven en los alimentos fermentados. En los alimentos como queso, yogurt, levadura, ya contiene una alta cantidad de microorganismos eficaces y al colocar azúcar se genera un ambiente apto para cultivar más microorganismos. Con las soluciones se captura el Aspergillus oryzae, bacteria constitutiva del ácido láctico y levadura que tienen como objeto reproducir masivamente los virus filamentosos y las bacterias de alta seguridad, descomponen la sacarosa, proteínas, grasas y aminoácidos. De acuerdo a lo que señala Campos, E., Elías Castells, X., & Flotats, X. (2012) “Las bacterias actinomicetes y hongos trabajan de forma simultánea o consecutiva, descomponen los constituyentes de la materia orgánica, hidratos de carbono, proteínas y lípidos estableciéndose relaciones de sinergia en algunos casos y de competencia por el sustrato en otros. En medio aerobio las relaciones son exotérmicas de manera que si se dan las condiciones físicas adecuadas, se produce un aumento de la temperatura de la masa en descomposición, pudiendo llegar a superar los 70 °C en un día. Este aumento de la temperatura favorece el crecimiento de microorganismos termófilos y si esta se mantiene durante el tiempo suficiente, se consigue la destrucción de semillas de malas hierbas, huevos y larvas de insectos Centro de Biotecnología pp 36 – 41


40 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Hernández et al. (2015); IMPLEMENTACIÓN DEL METODO DE COMPOSTAJE TAKAKURA PARA EL RECICLAJE DE DESECHOS EN LA CIUDAD DE LOJA, ECUADOR

y de microorganismos patógenos”. El nivel de humedad es importante, por lo que se debe ajustar constantemente la cantidad de agua. Para ello se debe comprobar apretando la semilla con la mano, si esta se mantiene compacta, el nivel de humedad es el adecuado. “La humedad condiciona la porosidad del medio. Un medio muy húmedo no permite la circulación del oxígeno y por lo tanto se pueden crear condiciones anaerobias; en cambio un medio muy seco no permite la solubilización de la materia orgánica y por tanto se disminuye la actividad de los microorganismos”. (Campos et al. 2012) En relación al cuadro 1 según los análisis de laboratorio el pH del compost es de 9,1 alcalino y el contenido de materia orgánica es de 37,3%, lo que corresponde a una disponibilidad de materia orgánica muy alta. Otro elemento importante en el suelo, es el fósforo según el resultado del laboratorio este se encuentra como óxido de fósforo y corresponde a un contenido de 503,54 ppm siendo un valor muy alto, el mismo que es importante en la maduración de flores, semillas y frutos e interviene en la formación y desarrollo de las raíces. El nitrógeno tuvo un valor alto de 135,52 ppm, el mismo que varía su proporción en el compost en función del grado de madurez, de manera que el compost fresco es pobre en nitrógeno, mientras que la concentración crece a medida que el compost madura. El potasio es decisivo en el desarrollo de la planta, posibilita que las raíces y los tallos sean fuertes, colabora en la circulación de los otros nutrientes alrededor de la planta y regula las funciones vegetales. En el compost de acuerdo al resultado se encuentra con un valor bajo de 69,2 ppm, en forma de óxido de potasio (K2O), este valor puede corregirse al incluir más residuos orgánicos como cascaras de banano, esto permitirá mejorar el parámetro. El compostaje como proceso microbiológico, se basa en la conversión de la materia orgáCentro de Biotecnología pp 36 – 41

nica biodegradable en un compuesto estable gracias a la flora nativa, incluyendo bacterias, hongos, inoculantes biológicos, etc., los que están distribuidos ampliamente en todo el material. Sin embargo, existen factores selectivos tales como el contenido de humedad, disponibilidad de oxígeno, pH, temperatura y la relación de carbono/nitrógeno, los cuales determinan la prevalencia y sucesión de la población microbiana. Conclusiones El compostaje que se practica es un proceso aerobio que no genera malos olores hasta obtener un producto estable y de alto valor nutritivo. Para obtener el compost producto de la aplicación del método Takakura, se requiere tan solo un tiempo de dos meses optimizando recursos económicos y humanos. Este método es más eficaz que el de la lombricultura utilizado en el Centro Integral de Manejo de Desechos Sólidos de la ciudad de Loja, en el que se obtiene el humus entre los 4 a 6 meses. La aplicación de esta técnica permite que se replique y sirva de muestra para que los municipios, instituciones y unidades educativas apliquen para disminuir los residuos sólidos biodegradables de manera rápida y segura. Los altos niveles de óxido de fósforo y el pH alcalino del compost, aplicados en suelos ácidos como los de la hoya de Loja puede coadyuvar a enmendarlos. Agradecimientos Los autores agradecen al personal obrero y administrativo del relleno sanitario de la ciudad de Loja por el soporte material y logístico para la realización de la investigación, así como a la Universidad Internacional del Ecuador, Sede Loja por los aportes realizados.

ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 41 Hernández et al. (2015); IMPLEMENTACIÓN DEL METODO DE COMPOSTAJE TAKAKURA PARA EL RECICLAJE DE DESECHOS EN LA CIUDAD DE LOJA, ECUADOR

Referencias bibliográficas

Basanta, R., García Delgado, M. A., Cervantes Martínez, J. E., Mata Vázquez, H., & Bustos Vázquez, G. 2007. Sostenibilidad del reciclaje de residuos de la agroindustria azucarera: una revisión. Ciencia y Tecnología Alimentaria. Becerra, M. A. 1998. Conservación del suelo y desarrollo sustentable, ¿Utopía o posibilidad en México? Departamento de suelos. Universidad Autónoma Chapingo. México: 1-7. Campitelli, P. Compostaje. 2014. Obtención de abonos de calidad para las plantas. Argentina: Editorial Brujas. Campos, E., Elías Castells, X., & Flotats, X. 2012. Procesos biológicos: la digestión anaerobia y el compostaje. España: Ediciones Díaz de Santos. Compostaje de residuos orgánicos y seguridad medioambiental. 2011. España: Editorial Universidad de Burgos. Costa, F., García, C., Hernández, T., & Polo, A. 1995. Residuos orgánicos urbanos. Manejo y utilización. C.S.I.C., España. FAO (Food and Agricultural Organization) 2006. Base referencial mundial del recurso suelo. Roma. Hernández, O., Ojeda, D., López, J., & Arras, Y. 2010. Abonos orgánicos y su efecto en las propiedades físicas, químicas y biológicas del suelo. Revista Tecnociencia Vol. IV, N° 1 – Enero abril. Honobe, Y. 2013. Manual para reducir desechos orgánicos. Fondo para la ISSN: 1390-7573

protección del agua – FONAG. Iñiguez, M. 2007. Fertilidad, fertilizante y fertilización del suelo. Editorial Universitaria. Loja, Ecuador: 395. López, M. J. D., A. Díaz E., E. Martínez R. D., & Valdez C. 2001. Abonos orgánicos y su efecto en propiedades físicas y químicas del suelo y rendimiento en maíz. Universidad Autónoma de Chapingo. TERRA Latinoamericana 19 (4):25-36 Moreno Casco, J., & Moral Herrero, R. 2008. Compostaje. España: Mundi-Prensa. Moreno, J., Moral, R., García, J.L., Pascual, J.A., & Bernal, M.P. 2014. De residuo a recurso. El camino hacia la sostenibilidad. Ediciones Mundi-Presa. México. Ramírez, Y. 2014. Jefatura de Higiene. Informe del estado actual del Centro Integral de Residuos Sólidos de la ciudad de Loja. Romero, L. M. 2004. Agricultura orgánica, elaboración y aplicación de abonos orgánicos. Memoria III Curso Teóricopráctico. Lombricultura técnica mexicana. SOMELAO. Guadalajara, Jal. Sillero Moreno, Francisco. 2012. Tratamiento de residuos urbanos o municipales: gestión de residuos urbanos e industriales (UF0285). España: IC Editorial. Widman Aguayo F. et al. 2005. El uso de composta proveniente de residuos sólidos municipales como mejorador de suelos para cultivos en Yucatán. Estudios preliminares. Yucantan, México

Centro de Biotecnología pp 36 – 41


42 Centro de Biotecnología, Vol. 4 Nro. 1. 2015

EVALUACIÓN IN VITRO DE AISLADOS FÚNGICOS Y BACTERIANOS CON POTENCIAL ANTAGONISTA FRENTE A Fusarium spp.

IN VITRO ASSESSMENT OF FUNGAL AND BACTERIAL ISOLATES WITH POTENTIAL ANTAGONIST AGAINST Fusarium spp. Raquel Espinosa Buele1, Roldán Torres-Gutiérrez2 Klever Ivan Granda Mora2 Angel Rolando Robles-Carrión2*

Carrera de Ingeniería Agronómica. Universidad Nacional de Loja-ECUADOR Centro de Biotecnología, Universidad Nacional de Loja. Ciudad Universitaria Guillermo Falconí Espinosa “La Argelia” - PBX: 072547252 - Casilla Letra “S”. Loja-ECUADOR. aroblescarrion@gmail.com * Autor para correspondencia 1

2

Resumen En el Ecuador, el control de enfermedades fúngicas se ha realizado tradicionalmente mediante la aplicación de grandes cantidades de productos químicos, es por ello que las investigaciones encaminadas a lograr el biocontrol de agentes fitopatológicos en el territorio nacional, se hace cada vez más necesario. Nuestra investigación se centra en la determinación de microorganismos antagonistas frente Fusarium spp., agente causal de la enfermedad Marchitez Vascular del Babaco (Vasconcellea heibornii var. Pentagona). Para los ensayos de biocontrol se utilizaron microorganismos aislados de la rizosfera del Babaco, a los cuales se evaluó su potencial biocontrolador de la enfermedad en condiciones in vitro. Se realizó el ensayo de enfrentamiento dual para hongos (Trichoderma y Fusarium) y la siembra en medio sólido y crecimiento radial de Fusarium para el análisis del biocontrol por bacterias. Los ensayos se realizaron por triplicado, para los que se dispuso de un diseño experimental completamente aleatoriado con diez réplicas. La inhibición del crecimiento micelial del agente causal se determinó mediante la formula de Abott. La cinética del crecimiento de los microorganisoms demostró que la inoculación con Trichoderma coi-inculado con las rizobacterias en enfrentamiento dual, arrojó los mejores resultados estadísticos en comparación con los demás tratamientos analizados. Se hizo evidente que las bacterias inoculadas en solitario no son capaces de controlar la enfermedad. Estos resultados preliminares permiten dilucidar el efecto controlador de diferentes combinaciones microbianas para establecer una estrategia de biocontrol en el cultivo del Babaco.

Palabras claves: biocontrol, Babaco, Fuarium, Marchitez Vascular. Abstract In Ecuador, control of fungal disease has traditionally been performed by applying large amounts of chemicals, therefore the research to achieve plant disease biocontrol in the country, becomes increasingly necessary. Our research focuses on the determination of antagonistic microorganisms against Fusarium spp., causal agent of Vascular wilt Babaco (Vasconcellea heibornii var. Pentagona) disease. For biocontrol assays microorganisms from Babaco rhizosphere were isolated, to which their biocontrol potential was assessed under in vitro conditions. Dual confrontation assay for fungi (Trichoderma and Fusarium) and radial growth of Fusarium on agar plate for analysis of bacteria biocontrol was performed. Assays were performed by triplicate, with a completetly randomized experimental design with ten replicas for each one. Inhibition of mycelial growth of causal agent was determined by Abbott formula. The microorganism growth kinetics demonstrated that inoculation with Trichoderma co-inoculated with rhizobacteria by dual confrontation, threw the best statistical results compared to the other treatments tested. It became clear that the bacteria inoculated alone are not able to control the disease. These preliminary results obtained allow dilucidate the effect of different microbial combinations to establish a biocontrol strategy in Babaco.

Keywords: biocontrol, Babaco, Fuarium, Vascular Wilt . Recibido: marzo 21 de 2014

Aprobado: junio 12 de 2014


Centro de Biotecnología, Vol. 3 Nro. 1. 2014 43 Espinosa et al. (2015); EVALUACIÓN IN VITRO DE AISLADOS FÚNGICOS Y BACTERIANOS CON POTENCIAL ANTAGONISTA FRENTE A Fusarium spp.

Introducción La amplia biodiversidad agrícola en el Ecuador, es la base para la seguridad alimentaria global y ayuda a asegurar la subsistencia y los hábitats de las personas mediante el sostenimiento de los agroecosistemas funcionales y es el resultado de la selección natural y la intervención humana durante miles de años. Así tenemos que, la zona andina ha sido en lugar donde se encuentra una gran diversidad de cultivos agrícolas nativos como el Babaco, cultivo no tradicional de amplia aceptación en el mercado internacional (Kyndt, 2005; Uzcátegui, 2007). La enfermedad más importante del Babaco es la Marchitez Vascular (MVB), causada por Fusarium oxysporum, reportada por primera vez en el Ecuador por Ochoa y Fonseca (2000). La MVB provoca la defoliación total y la muerte prematura de la planta por marchitamiento, al que también se asocia la obstrucción de los vasos vasculares y xilémicos (Agrios, 2005). Esta enfermedad, se encuentra distribuida a lo largo y ancho del territorio ecuatoriano, sin embargo, tiene gran incidencia en el sur del país. Estudios realizados en los últimos años, han demostrado que la MVB es ocasionada por una comunidad microbiana de cuatro especies diferentes de Fusarium (Robles, 2014). Además, la especie de F. oxysporum se la ha encontrado causando marchitez vascular en otros cultivos como la naranjilla (Solanun quitoense) (Argotti y Cazar, 2011). El método de control más utilizado para combatir Fusarium spp., en Babaco, se ha centrado en el uso de agroquímicos, los cuales contribuyen a la acumulación de residuos tóxicos en las cosechas y en el ambiente, con serias consecuencias para la salud humana (Fabara et al., 1985; Burgess y Bryden, 2006). Además, los pesticidas no permiten un control efectivo de muchas enfermedades producidas por fitopatógenos del suelo por no ser selectivos. Una alternativa de control ha sido basada en el control biológico, entendido como la reducción de la densidad o de las actividades productoras de enfermedades de ISSN: 1390-7573

un patógeno o parásito, en su estado activo o durmiente, lograda de manera natural o a través de la manipulación del ambiente, del hospedero o de antagonistas del patógeno o plaga que se quiere controlar (López, 2011; González-Cárdenas et al., 2005). En adición, el control biológico de enfermedades en plantas se ha practicado mediante la inoculación de estos microorganismos en la rizósfera con el fin de mejorar la sanidad y la productividad de los cultivos. Entre los sintetizados biológicos producidos por estos organismos se encuentran los psideroforos, ácido cianhídrico y antibióticos, destacando a las bacterias y hongos, como los dos grupos más importantes antagónicos a fitopatógenos (Pérez, 2004), por lo que su utilización de manera conjunta posiblemente integren una serie de mecanismos beneficiosos de defensa que repercutirán en la sanidad vegetal de las plantas, por lo que este tipo de interacciones microbiológicas pueden ser objetivos principales a abordar en el campo de la investigación agrícola (Rodríguez y Matin, 2009; Paredes-Escalante et al., 2009). Es por ello que el control biológico surge como una alternativa ante la necesidad de reducir los productos químicos, conservando la sanidad de los cultivos. Además, el componente más significativo del suelo que afecta la supervivencia del hongo parece ser el biológico; entre los cuales se encuentran más de 30 especies de hongos y bacterias señaladas como antagonistas (Mukherjee et al., 2012; Mukherjee et al., 2014). Basándose en este hecho donde las interacciones entre microorganismos benéficos del suelo pueden potencializar su acción protegiendo a las plantas contra Fusarium spp., En nuestra investigación nos basamos en la evaluación del efecto antagónico de microorganismos antagonistas frente a Fusarium spp, causante de la Marchitez Vascular en Babaco (Vasconcellea heilbornii var. pentagona) bajo condiciones in vitro.

Centro de Biotecnología pp 42 – 47


44 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Espinosa et al. (2015); EVALUACIÓN IN VITRO DE AISLADOS FÚNGICOS Y BACTERIANOS CON POTENCIAL ANTAGONISTA FRENTE A Fusarium spp.

Materiales y Métodos Microorganismos antagonistas empleados El estudio se realizó en el Laboratorio de Microbiología Vegetal del Centro de Biotecnología de la Universidad Nacional de Loja, Ecuador. Se utilizaron aislados de Trichoderma spp, y bacterias de los géneros: Enterobacter amnigenus, Lelliottia amnigena y Kluyvera intermedia, aisladas de la rizósfera del Babaco y posiblemente antagonistas de Fusarium spp. Todos los aislados de Trichoderma spp., y de las bacterias, fueron reactivados en agar nutriente para comprobar si crecimiento y viabilidad para realizar el ensayo. Hongos fitopatógenos La colección de Fusarium spp., causantes de MVB se encontraban conservados en aceite mineral más PDA (Papa-Dextrosa-Agar) en el laboratorio de Microbiología Vegetal del Centro de Biotecnología de la Universidad Nacional de Loja. Se utilizó uno de los aislados más patogénicos de Fusarium (F. oxysporum) caracterizados morfológica, patogénica y molecularmente (Robles et al., 2013; Robles et al., 2014), igual que los microorganismos antagonistas; este aislado fue reactivado en agar nutriente, para comprobar su crecimiento y viabilidad. Pruebas de antagonismo in vitro Cada uno de los aislamientos de Trichoderma spp., bacteria y el fitopatógeno se evaluó según la metodología descrita a continuación. En una caja de Petri con agar nutriente, se siembra cada una de la bacteria mediante la técnica de la siembra masiva mediante el uso de un hisopo estéril. Seguidamente, a 1cm del borde izquierdo de la placa de Petri se coloca un disco de 3 mm de diámetro del hongo fitopatógeno activo (Fusarium), para que inicie su crecimiento micelial. A continuación, en el lado opuesto, a una distancia de 1 cm, coloca un disco de 3 mm de diámetro del hongo antagonista (Trichoderma spp.). Los tratamientos utilizados fueron: T0 = Fusarium sp; T1 = Fusarium sp. + Trichoderma spp. + Centro de Biotecnología pp 42 – 47

Enterobacter amnigenus; T2 = Fusarium sp. + Trichoderma spp. + Lelliottia amnigena; T3 = Fusarium sp. + Trichoderma spp. + Kluyvera intermedia; T4 = Enterobacter amnigenus; T5 = Lelliottia amnigena; T6 = Kluyvera intermedia. Se realizaron 10 réplicas por tratamiento, en total se realizaron 70 unidades experimentales (UE), todas las unidades experimentales se las incubaron a ± 30°C. Evaluación del ensayo Se realizó la evaluación de competencia por nutrientes después y espacio a las 24 horas de la implementación del ensayo, la cual se obtuvo con los radios de crecimiento del patógeno y antagonistas en cultivo dual, en presencia de cada una de las bacterias, junto con sus respectivos testigos, utilizando un calibrador automático “Pie de rey”, Finalmente, se procedió a realizar el cálculo del porcentaje de inhibición (PI %) con la fórmula utilizada por Ru y Di. (2014):

Dónde: R1 = Es el crecimiento radial de la colonia del patógeno (Tratamiento testigo) y R2 = Es el crecimiento radial del patógeno en cultivo dual con el tratamiento Análisis estadístico Para determinar diferencias en el efecto de la cepa de Trichoderma y de cada una de las bacterias sobre la inhibición del radio micelial del patógeno (P≤0,05), se realizaron la normalidad de datos y la homogeneidad de variancia y para detectar diferencias entre tratamiento se aplicó la prueba de Tukey (P≤0,05), en los que determina cuales de los tratamientos presenta mayor grado de inhibición. Todo el análisis estadístico se realizó con el paquete estadístico IBM-SPSS versión 22 para Windows, a través de un experimental completamente al azar con 10 repeticiones. ISSN: 1390-7573


Centro de Biotecnología, Vol. 3 Nro. 1. 2014 45 Espinosa et al. (2015); EVALUACIÓN IN VITRO DE AISLADOS FÚNGICOS Y BACTERIANOS CON POTENCIAL ANTAGONISTA FRENTE A Fusarium spp.

Resultados Los resultados obtenidos en cultivo dual, mostraron que los tratamientos con E. amnigenus, L. amnigena y K. intermedia, no ejercieron ningún biocontrol sobre el fitopatógeno de F. oxysporum sp. En cambio, los tres tratamientos con Trichoderma spp., más cada una de las siguientes bacterias: E. amnigenus, L. amnigena y K. intermedia. Ejercieron un biocontrol de 26,84 a 52, 63%. Como se puede observar, el tratamiento con Fusarium sp. + Trichoderma spp. + L. amnigena, en el día cuatro de evaluación, tiene un porcentaje de 26, 84%; de acuerdo a los resultados observados, hace suponer que las bacterias encontradas en las raíces del Ba-

baco no pueden ser utilizadas como biocontroladores de F. oxysporum, exceptuando el tratamiento con E. amnigenus que se podría realizar un estudio más profundo para validar los resultados obtenidos en esta investigación. Las especies de bacterias (E. amnigenus, L. amnigena y K. intermedia), son bacterias gran negativas y comúnmente son patógenas de seres humanos y animales (Brooks et al., 2010). No obstante, muchas especies de bacterias del género Enterobacter spp., se han encontrado promotoras de crecimiento en trigo, albaricoque y maíz y también como patógena en Eucalipto y cebolla (Brady et al., 2009; Madhaiyan et al., 2010; Morales-García et al., 2011).

Figura 1. Porcentaje de inhibición del crecimiento radial de 6 tratamientos de microorganismos antagonistas, correspondientes a cultivos duales frente a aislados de F. oxysporum. Letras diferentes indican diferencias significativas para Tukey = 0,05. Leyenda: T1 = Fusarium sp. + Trichoderma spp. + Enterobacter amnigenus; T2 = Fusarium sp. + Trichoderma spp. + Lelliottia amnigena; T3 = Fusarium sp. + Trichoderma spp. + Kluyvera intermedia; T4 = Enterobacter amnigenus; T5 = Lelliottia amnigena; T6 = Kluyvera intermedia

El buen desempeño de Trichoderma en los todos los tratamientos es un indicador de la alta actividad de los mecanismos de biocontrol disponibles por parte de esta cepa. En la prueba in vitro se obtuvo evidencia de los procesos de competencia por nutrientes y la desISSN: 1390-7573

trucción del patógeno (F. oxysporum). El en que los afecta también está en función de la estructura celular propia de F. oxysporum que permite accionar el biocontrolador (Mukherjee et al., 2012; Kumar et al., 2015). Centro de Biotecnología pp 42 – 47


46 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Espinosa et al. (2015); EVALUACIÓN IN VITRO DE AISLADOS FÚNGICOS Y BACTERIANOS CON POTENCIAL ANTAGONISTA FRENTE A Fusarium spp.

Conclusiones Los resultados obtenidos indican que las cepas estudiadas de Trichoderma spp., puede utilizarse como antagonista frente a la enfermedad de la Marchitez Vascular del Babaco. No así el uso de L. amnigena y K. intermedia, pues las cepas aisladas no lograron controlar a F. oxysporum.

Referencias bibliográficas Agrios, G. 2005. Plant Pathology. Editorial Elsevier. 5 ed. United States of America. 948 p.

Argotti, E.; Cazar, M.; Motte, E.; Cedeño, V. 2011. Análisis molecular de la región ITS de Fusarium spp., agente causal de la marchitez vascular de Vasconcellea heilbornii y Solanum quiotense en Ecuador. Revista ESPE Ciencia y Tecnología. 3(1): 25 – 36.

Brady C., Venter S., Cleenwerck I., Engelbeen K., de Vos P., Wingfield M., Telechea N. y Coutinho T. 2009. Isolation of Enterobacter cowanii from Eucalyptus showing symptoms of bacterial blight and dieback in Uruguay. Revista: Applied Microbiology. 49. 461 – 465 pp.

Burgess L., Bryden W. 2012. Fusarium: a ubiquitous fungus of global significance. Revista Microbiology Australia. 22 – 25

Fabara J., Bermeo Nelly, Barberán C. 1985. Manual del cultivo del Babaco Editorial Universidad Técnica de Ambato. Ambato, Ecuador. 105 p.

Julio César González-Cárdenas J., Maruri-García J., González-Acosta Centro de Biotecnología pp 42 – 47

A. 2005. Evaluación de diferentes concentraciones de Trichoderma spp. contra Fusarium oxysporum agente causal de la pudrición de plántulas en papaya (Carica papaya L.) en Tuxpan, Veracruz, México. Revista UDO Agricola. (5)1 45 – 47

Kumar V., Shahid M., Srivastava M., Singh A., Pandey S. y Kumar M. 2015 Screening of Trichoderma species for virulence efficacy on seven most predominant phytopathogens. Revista: African Journals of Microbiology Research. 9(11) 793 – 799 pp.

Kyndt T. 2005: Molecular Genetic Analysis of the Genera Carica L. and Vasconcellea Saint Hilaire (Caricaceae). Tesis de PhD. Universidad de Gante. Gante, Bélgica. 2008 p

López R. 2011. Detección y Cuantificación de Trichoderma harzianum, y Evaluación de su Actividad Biocontrol frente a la Fusariosis Vascular del Melón mediante la Aplicación de Herramientas Moleculares. Tesis de Doctorado. Universidad de Alicante. Alicante, España. 162 p.

Madhaiyan M., Poonguzhali S., JungSook L., Sivaraj V., Keun-Chul Lee y Santhanakrishnan P. 2010. Enterobacter arachidis sp. nov., a plant-growth promoting diazotrophic bacterium isolated from rhizosphere soil of groundnut. Revista: International Journal of Systematic and Evolutionary Microbiology. 60 1559 – 1564 pp.

Mukherjee A., Kranthi S., Sampath A., y Mukherjee P. 2014. Biocontrol potential of three novel Trichoderma strains. Revista: 3 Biotech. 4. 275 – 281 pp. ISSN: 1390-7573


Centro de Biotecnología, Vol. 3 Nro. 1. 2014 47 Espinosa et al. (2015); EVALUACIÓN IN VITRO DE AISLADOS FÚNGICOS Y BACTERIANOS CON POTENCIAL ANTAGONISTA FRENTE A Fusarium spp.

Mukherjee M. Horwitz B., Berg G. Mukherjee P., Zachow C., Zeilinger Susanne 2012. Trichoderma–Plant– Pathogen Interactions: Advances in Genetics of Biological Control. Revista: Indian J Microbiol. 52(4) 522 – 529 pp.

Ochoa, J.; Fonseca, G. 2000. First Report of Fusarium Wilt of Babaco (Carica × heilbornii var. pentagona) in Ecuador. Revista Plant Disease. 84(2): 190.

Paredes Escalante J., Carrillo Fasio J. García Estrada R. Allende Molar R., Sañudo Josefa Barajas y Valdez Torres J. 2009. Microorganismos Antagonistas para el Control del Complejo de Hongos Causantes de la Rabia del Garbanzo (Cicer arietinum L.) en el Estado de Sinaloa, México. Revista, Mexicana de Fitopatología, 27(1). 27-35 pp.

Pérez Consuegra Nilda 2004. Manejo Ecológico de Plagas. La Habana, Cuba. Editorial Centro de Estudios de Desarrollo Agrario y Rural. 127 – 284 pp.

en Loja, Ecuador. Revista del Centro de Biotecnología. 3(1): 34 – 44 pp.

Rodríguez C., Martín Hernández María. 2009. Aislamiento y selección de rizobacterias promotoras de crecimiento vegetal en cultivos de uchuva (Physalis peruviana L.) con capacidad antagónica frente a Fusarium sp. Tesis presentada en opción a los Títulos Académicos de Microbiólogo Agrícola- Veterinario y Microbiólogo Industrial. Pontificia Universidad Javeriana. Bogotá, Colombia. 61 pp.

Ru Z., Di W. 2012. Trichoderma spp. from rhizosphere soil and their antagonism against Fusarium sambucinum Revista: African Journal of Biotechnology. 11(18) pp. 4180-4186

Uzcátegui. 2007. Estudio de factibilidad para la implementación de una empresa dedicada a la industrialización del Babaco. Tesis de Ingeniería Empresarial. Escuela Politécnica Nacional, Ecuador. 185 p.

Robles-Carrión A., Gómez-Criollo R., Macas-Rojas F., Sánchez-Rodríguez A., Torres-Gutiérrez R. 2014. Estudio de la patogenicidad de aislados de fusarium spp., asociados a la Marchitez Vascular del Babaco (Vasconcellea heilbornii var. pentagona) en Loja- Ecuador. Revista del Centro de Biotecnología. 3(1): 61 – 72.

Robles-Carrión A., Salinas-Serrano D., Armijo-Armijos W., Sánchez-Rodríguez A., Torres-Gutiérrez R. 2013. Estudio de la Variabilidad Morfológica en aislados fúngicos asociados con la enfermedad de la Marchitez Vascular del Babaco (Vasconcellea heilbornii var. pentagona) ISSN: 1390-7573

Centro de Biotecnología pp 42 – 47


48 Centro de Biotecnología, Vol. 4 Nro. 1. 2015

ABORTO ESPONTÁNEO INCOMPLETO NO COMPLICADO HASTA LAS 13 SEMANAS DE GESTACIÓN TRATADO CON MISOPROSTOL

UNCOMPLICATED SPONTANEOUS INCOMPLETE ABORTION UP TO 13 WEEKS OF GESTATION TREATED WITH MISOPROSTO 1

Karina Yesenia Calva Jirón * 1

Leonardo Paul Armijos Carrión2

Area de la Salud. Universidad Nacional de Loja. Loja-Ecuador. Av. Pío Jaramillo Alvarado S/N. La Argelia. Loja-ECUADOR calvajironk@yahoo.es 2

Médico residente Hospital Isidro Ayora. Loja-Ecuador *Autor para correspondencia

Resumen Con la finalidad de evaluar la efectividad del Misoprostol vía oral en el tratamiento del aborto espontáneo incompleto a las 13 semanas de edad gestacional, se realizó un estudio cuasi experimental de ensayo clínico controlado con dos grupos de pacientes en el Área de Emergencia de Ginecología y Obstetricia del “Hospital Isidro Ayora” de Loja desde noviembre del 2011 hasta abril 2012. El Grupo Estudio (A) de 60 pacientes, se administró 600 mcg de Misoprostol vía oral monodosis y al Grupo Control (B) de 60 pacientes se les practicó legrado instrumental. Todas las pacientes tenían entre 4 y 13 semanas de gestación con un promedio de 6 semanas para el Grupo A y de 11 semanas para el Grupo B. El 78,3% de las pacientes del Grupo A expulsaron los anexos fetales a los 3 días y el 100% lo hizo en un periodo de 9 días. El grosor del endometrio en el Grupo Estudio (A) encontrado fue de 11- 15 mm con un 58,3% (35 casos) y mayor de 21 mm con el 6,7%; en cuanto a la regresión del endometrio el 78,3% de las pacientes a los tres días tenía un endometrio menor a 10 mm. En el grupo Control (B) hubo 1 caso de retención de restos post-legrado. No existe diferencia significativa en los cambios del nivel del hematocrito al inicio y final del tratamiento en ambos grupos. Y para finalizar se demostró que el tratamiento médico tiene menos riesgo, es eficaz y un costo reducido.

Palabras claves: Tratamiento médico, aborto incompleto.

Abstract In order to evaluate the effectiveness of oral misoprostol in treatment of incomplete at 13 weeks’ gestation spontaneous abortion, a quasi-experimental study controlled clinical trial with two groups of patients in the emergency area of Gynecology and Obstetrics was conducted the “Hospital Isidro Ayora” Loja from November 2011 to April 2012. The Study Group (A) of 60 patients, 600 mcg of misoprostol was administered via oral single dose and the control group (B) of 60 patients underwent instrumental curettage. All patients were between 4 and 13 weeks of gestation with an average of 6 weeks for 11 Group A and Group B. weeks for 78.3% of the patients in Group A fetal annexes drove 3 days and 100% did so in a period of 9 days. Endometrial thickness in the Study Group (A) was found 11- 15 mm with 58.3% (35 cases) and over 21 mm with 6.7%; about the regression of endometrial 78.3% of patients after three days was lower than 10 mm endometrium. In the control group (B) there was 1 case of post-curettage retention remains. There is no significant difference in hematocrit level changes at the beginning and end of treatment in both groups. And finally it demonstrated that medical treatment has less risk, effective and low cost.

Keywords: medial treatment, incomplete abortion. Recibido: agosto 28 de 2015

Aprobado: octubre 08 de 2015


Centro de Biotecnología, Vol. 3 Nro. 1. 2014 49 Calva et al. (2015); ABORTO ESPONTÁNEO INCOMPLETO NO COMPLICADO HASTA LAS 13 SEMANAS DE GESTACIÓN TRATADO CON MISOPROSTOL

Introducción El aborto espontáneo se presenta en 50 a 70% de los embarazos, la mayoría de estas pérdidas son tempranas, 80% ocurren en las primeras 13 semanas y el 20% restante de la semana 13 hasta la semana 20. (Velázquez, 2006). Después del parto normal, el aborto es la segunda causa de hospitalización de mujeres en edad fértil en los servicios de ginecología y obstetricia (HRIA, 2010). La expresión más trágica de la alta incidencia del aborto es la elevada proporción que ocupa el aborto dentro de las causas de mortalidad materna (18%). (Gonzales, 2008). En los Estados Unidos existe una estimación anual de 100000 legrados practicados anualmente por aborto incompleto no complicado que arrojan un costo promedio de más de 100 millones de dólares. En Colombia y Chile se realizaron estudios para estimar los costos que produce la hospitalización de pacientes con aborto incompleto espontaneo e inducidos y concluyeron que estos eran mayores que los intervenidos en la prevención del embarazo y el tratamiento de pacientes hospitalizados con aborto (Aucotts E, 2007) En el año 2010, en la Ciudad de Loja en Ecuador, y específicamente en el servicio de Gineco-Obstetricia del Hospital Regional Isidro Ayora, el aborto en general se encuentra dentro de las diez primeras causas de morbilidad, el aborto incompleto ocupa el tercer lugar con un total de 593 casos, cuyo único tratamiento practicado fue el legrado instrumental. Según la evidencia científica disponible, el tratamiento recomendado para el aborto incompleto es la aspiración manual endouterina (AMEU), un procedimiento rápido, con bajo riesgo de complicaciones que se puede realizar con anestesia local y manejo conductual del dolor. Históricamente se ha utilizado el legrado uterino instrumental bajo anestesia que implica mayor posibilidad de complicaciones como la perforación uterina y lesiones cervicales y que además implica altos costos económicos. Ciertamente un grupo de pacientes con aborto incompleto deben ser sometidas ISSN: 1390-7573

al legrado uterino en forma inmediata, sobre todas aquellas mujeres con sangrado excesivo, signos vitales inestables e infección (Tavara Orozco, 2008). En la última década se ha empezado a aplicar el manejo expectante (no tratar a la mujer inmediatamente y esperar que el aborto se resuelva solo) y el uso de técnicas no invasivas como alternativas al tratamiento quirúrgico. Hoy en día el manejo del aborto incompleto con Misoprostol está siendo adoptado gradualmente por equipos de salud por la facilidad de su utilización, su conveniencia y bajo costo (SEGO, 2010). En abril de 2009 la Organización Mundial de la Salud incluyó el Misoprostol en la Lista Modelo de Medicamentos Esenciales por haberse demostrado su eficacia y seguridad para el tratamiento del aborto incompleto y del aborto espontáneo (OMS, 2009). El Misoprostol posibilita la evacuación del aborto incompleto mediante un tratamiento exclusivamente farmacológico. Además de ser un procedimiento seguro, eficaz y aceptable tiene la potencialidad de facilitar ampliamente el acceso al tratamiento en el primer y segundo nivel de atención descomprimiendo los ya sobrecargados servicios terciarios. Asimismo permite que la mujer no se separe de su familia y evita el riesgo de complicaciones del tratamiento quirúrgico (Sanchez-Lopez, 2008.). Por tal razón, la presente investigación tiene como objetivo general demostrar la eficacia del Misoprostol administrado vía oral a pacientes con diagnóstico de aborto espontaneo incompleto no complicado hasta las 13 semanas de edad gestacional y como objetivos específicos analizar y comparar las características epidemiológicas: edad gestacional, edad y paridad de las pacientes en ambos grupos; determinar el tiempo en el cual se produce la expulsión total de los restos y corroborar ecográficamente el diámetro anteroposterior de los restos intrauterinos en el inicio del estudio, así como su regresión en un lapso menor a 9 días en pacientes tratadas con Misoprostol; evaluar los efectos secundarios producidos Centro de Biotecnología pp 48 – 55


50 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Calva et al. (2015); ABORTO ESPONTÁNEO INCOMPLETO NO COMPLICADO HASTA LAS 13 SEMANAS DE GESTACIÓN TRATADO CON MISOPROSTOL

por la droga y las complicaciones y comparar los cambios en los niveles de hematocrito al inicio y al final de la administración de Misoprostol. Materiales y Métodos Se realizó un estudio descriptivo, cuasi experimental de ensayo clínico controlado, de casos y controles para evaluar la efectividad del tratamiento médico con Misoprostol vía oral en el aborto espontáneo incompleto no complicado hasta las 13 semanas de edad gestacional en el Área de Emergencia de Ginecología y Obstetricia del Hospital Isidro Ayora en el periodo comprendido entre noviembre del 2011 hasta abril del 2012. La población estuvo constituida por todas las pacientes embarazadas que acudieron al Área de Emergencia de Ginecología y Obstetricia del Hospital Isidro Ayora desde noviembre del 2011 hasta abril del 2012. La muestra aleatoria simple estuvo conformada por 120 pacientes a quienes se le diagnosticó aborto espontáneo incompleto hasta las 13 semanas de edad gestacional, que acudieron al Área de Emergencia de Ginecología y Obstetricia del Hospital Isidro Ayora durante el periodo comprendido desde noviembre del 2011 hasta abril del 2012. Existieron 60 pacientes de estudio (Grupo A) y 60 pacientes de Control (Grupo B). Previa la autorización del Área de Emergencia de Gineco-Obstetricia del Hospital Regional Isidro Ayora para realizar la investigación, se procedió a solicitar la colaboración del servicio de laboratorio para procesar las muestras de sangre para determinar Hematología, Plaquetas, Tiempo de Protrombina y Gonadotrofina Coriónica en sangre. Toda paciente que acudió a la admisión de Emergencia con clínica de sangrado genital y/o dolor abdominal y prueba de gonadotrofina coriónica positiva se les practicó una ecosonografía transvaginal. Una vez diagnosticado el aborto incompleto con un endometrio, cuyo diámetro anteroposterior era mayor a 10 mm la paciente era pate del estudio. Seleccionadas las pacientes se Centro de Biotecnología pp 48 – 55

dividieron en 2 grupos: Grupo Estudio (A) Y Grupo Control (B). A las pacientes del Grupo Estudio se le administró 600 mcg de Misoprostol vía oral una sola dosis, y se le daba de alta con las siguientes indicaciones: Ampicilina / Sulbactán 500 mg cada/8horas por 7 días. Acetaminofén 500 mg cada 8 horas por 3 días, si hay dolor pélvico. Vigilar características de los loquios, si son fétidos, acudir al hospital. Y vigilar la cantidad del sangrado genital y anotar si era menor, igual o mayor al sangrado menstrual, si este es abundante acudir inmediatamente al hospital. Se citaron las pacientes, los días tres, seis y nueve después de la administración del Misoprostol para evaluación clínica, paraclínica (hemograma, plaquetas y tiempo de coagulación) y ecográficamente. Si la ecografía demostró un diámetro anteroposterior menor a 10 milímetros será considerada como resultado satisfactorio. Si al día 9 ecográficamente aún persistía la retención de tejido intrauterino con un diámetro igual o mayor de 15 milímetros, se interpretará como resultado no satisfactorio y se tratará bajo las normas del servicio en estudio. Las pacientes del Grupo Control (B) se les realizó el legrado instrumental cumpliendo las pautas del servicio, y se revaluaron los días 3, 6, 9; además se observaron parámetros a comparar con las pacientes del Grupo Estudio (A). Los criterios de inclusión a consideran fueron los siguientes: • Diagnóstico clínico, ecográfico y hormonal (HCG) de Aborto espontaneo incompleto. • Tener 13 semanas o menos de edad gestacional, contados a partir de la fecha de la última menstruación. • No tener enfermedades de base: Hipertensión arterial, Diabetes Mellitus, Asma bronquial u otros trastornos Endocrinos, Enfermedad Renal o trastornos de la Coagulación. • Niveles de hemoglobina de 10 o más gramos y pruebas de coagulación normal. ISSN: 1390-7573


Centro de Biotecnología, Vol. 3 Nro. 1. 2014 51 Calva et al. (2015); ABORTO ESPONTÁNEO INCOMPLETO NO COMPLICADO HASTA LAS 13 SEMANAS DE GESTACIÓN TRATADO CON MISOPROSTOL

• Ausencia de signos y síntomas de infección • Aceptación de la paciente • No tener antecedentes de alergia al misoprostol. Los criterios de exclusión fueron: • Abortos incompletos complicados: hemorragia, anemia e infección • Alergias a las prostaglandinas

• Sospecha de embarazo ectópico • Antecedentes de trastornos de la coagulación, o que estén tomando anti-coagulantes Resultados En relación con la edad de las pacientes el 76,7% de las pacientes de aborto incompleto del Grupo Estudio (A) y el 71,7 del Grupo Control (B), eran menor de 28 años de edad de vida.

Figura 1. Edad de las pacientes con diagnóstico de aborto incompleto.

Figura 2. Edad gestacional de las pacientes con diagnóstico de aborto incompleto.

En el Grupo Estudio (A), el 18,3% de las pacientes tenían 6 semanas de edad gestacional, el 16,7% corresponde a 5 y 7 semanas de edad gestacional. En el Grupo Control (B), tenemos el 18,2% de las pacientes tenían 11 semanas de edad gestacional, seguido del 16,7% para la edad gestacional de 7 y 8 semanas. ISSN: 1390-7573

El mayor porcentaje de pacientes con aborto espontaneo incompleto del Grupo Estudio eran nulíparas 51,7% y el 30% tenían entre I – II gestaciones. En el Grupo Control el 35% tenían entre I – II gestas y el 33,3% entre III – IV. El 53,3% de las pacientes de aborto espontaneo incompleto del Grupo Estudio expulsaron los restos al tercer día, el 40% de las pacienCentro de Biotecnología pp 48 – 55


52 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Calva et al. (2015); ABORTO ESPONTÁNEO INCOMPLETO NO COMPLICADO HASTA LAS 13 SEMANAS DE GESTACIÓN TRATADO CON MISOPROSTOL

Figura 3. Antecedentes de gestas en las pacientes tratadas con diagnóstico de aborto incompleto.

Figura 4. Tiempo de expulsión de los anexos fetales con diagnóstico de aborto incompleto.

tes eliminaron en 6 días y el 6,7 % en nueve días. Las pacientes diagnosticadas de aborto espontaneo incompleto con un diámetro de

endometrio entre 11 – 15 mm expulsaron los restos en 3 días y en 6 días. Las pacientes con un endometrio entre 21 – 25 mm, el 3,3% eliminaron los restos en 3 días y 9 días.

Figura 5. Tiempo de expulsión de los anexos fetales con diagnóstico de aborto incompleto y su relación con el endometrio.

En el Grupo Estudio (A), se presentaron 7 complicaciones, 4 casos de nauseas, 1 caso de diarrea y 2 pacientes presentaron dolor Centro de Biotecnología pp 48 – 55

abdominal leve. En el Grupo Control (B) solo se presentó una complicación que fue retención de restos post-legrado. ISSN: 1390-7573


Centro de Biotecnología, Vol. 3 Nro. 1. 2014 53 Calva et al. (2015); ABORTO ESPONTÁNEO INCOMPLETO NO COMPLICADO HASTA LAS 13 SEMANAS DE GESTACIÓN TRATADO CON MISOPROSTOL

Figura 6. Efectos secundarios del Misoprostol y complicaciones del legrado.

Figura 7. Hematocrito en los dos grupos antes y después del estudio

En el Grupo Estudio (A), las pacientes tuvieron un promedio de hematocrito antes de la toma del Misoprostol de 36,01 y después de 35,02 con una diferencia de 0,99. En el Grupo Control (B) antes del legrado un promedio de 37,2 y después de 36,2 con una diferencia de 1. Discusión En la presente investigación la edad promedio de las pacientes del grupo estudio A tratadas con Misoprostol es de 14-18 años, parámetro que coincide con las pacientes que se les practicó el legrado. Nielsen, en su investigación compara las dos formas de tratamiento del aborto incompleto no complicado en pacientes con edad gestacional que osciló entre 6 y 12 semanas y en un promedio de 9 semanas en ambos grupos. La edad gestacional de las pacientes tratadas con Misoprostol fue ISSN: 1390-7573

de 6 semanas, con 11 casos; y de 11 semanas para las pacientes legradas con 11 casos. Al analizar el antecedente de las gestas en las pacientes se encontró que el 51,7% de las pacientes del Grupo Estudio (A) eran nulíparas, y el 35% del Grupo Control (B) eran entre I - II gestas con 21 casos. Estos datos se relacionan con los encontrados en Venezuela, en donde las nulíparas representan el con 28,4% en el grupo uno y 21,7 % en el grupo dos (Silvestre, 2003). En relación al tiempo que se produce la expulsión de los anexos fetales en pacientes tratadas con Misoprostol vía oral, Nielsen, al estudiar 103 pacientes, el 79% (81 casos) expulsaron los restos el tercer día post-tratamiento (Silvestre, 2003). Hinestroza en un estudio donde uso Misoprostol vía oral a 600 mcg en el tratamiento del embarazo anembrionado encontró que en el 100% de las pacientes a las Centro de Biotecnología pp 48 – 55


54 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Calva et al. (2015); ABORTO ESPONTÁNEO INCOMPLETO NO COMPLICADO HASTA LAS 13 SEMANAS DE GESTACIÓN TRATADO CON MISOPROSTOL

20 horas post-tratamiento ya se había ocurrido la expulsión (Cunningham, 2006). En este estudio el 78,3% de las pacientes del Grupo Estudio (A) expulsó los anexos fetales al tercer día post- tratamiento y en el noveno día eliminaron los restos el 100% de las pacientes. Una investigación realizada en Suecia para evaluar el manejo expectante del aborto incompleto no complicado a las 13 semanas de edad gestacional, cuando el endometrio oscilaba entre 15 – 50 mm medidos ecográficamente en el diámetro anteroposterior del útero demostró la efectividad de esta conducta en comparación al legrado uterino (Jijón Letort, 2008). El grosor del endometrio en el Grupo Estudio (A) encontrados fue entre 11- 15 mm con 58,3% (35 casos), con un 35% (21 casos) al endometrio entre 16 – 20 mm y por último el 6,7% con 4 casos al endometrio mayor de 21 mmm, coincidiendo con los resultados obtenidos por Loureiro (2004), Marzullo (2005), lo que no fue impedimento para la expulsión de los anexos fetales en el tiempo esperado menor o igual a 9 días. En cuanto a la regresión del endometrio, en el 78,3% de las pacientes se encontró a los tres días un endometrio menor a 10 mm, se relaciona con el trabajo investigativo realizado por Beucher en el 2007; quien consigue efectividad del 94% en el primer día de tratamiento con 800 mcg de Misoprostol. En esta investigación se encontró en el Grupo Estudio (A) 7 efectos adverso en los 60 pacientes: 4 casos de nauseas, 2 de dolor abdominal y 1 caso de diarrea; y en el Grupo Control (B) solo hubo 1 caso de retención de restos post-legrado que ameritó un nuevo legrado. En relación a los cambios de hematocrito al inicio y al final del estudio en ambos grupos se encontró que no hay diferencia entre los dos métodos de tratamientos al analizar los promedio y desviación estándar, resultados que concuerdan con los expresado por Winikoff et al en un estudio Multicéntrico. Considerando lo anteriormente expuesto y consiguiendo que existen datos similares e iguales a estudios realizados en Literatura InternacioCentro de Biotecnología pp 48 – 55

nal, podemos finalizar que el manejo quirúrgico de un aborto incompleto, no está exento de complicaciones y fracasos y además consume importantes insumos hospitalarios, con un alto costo económico para el sector público, además de costo indirecto, social, familiar y laboral de las pacientes. Por todos estos motivos se hace necesaria la ejecución de un Tratamiento Médico, con menores riesgos, con costo reducido, con la misma eficiencia y mayor conforto para la mujer. Conclusiones La edad promedio de las pacientes fue entre 14-18 años, para el Grupo Estudio (A) y para el Grupo Control (B); la edad gestacional de las pacientes fue de 6 semanas con el para el Grupo Estudio y de 11 semanas de edad gestacional para el Grupo Control; y en cuanto al antecedente de las gestas en el Grupo Estudio (A) no han tenido gestas previas y en el Grupo Control (B)se encuentran las pacientes con antecedente de I - II gestas. Se demostró que de las pacientes con diagnóstico de Aborto espontáneo Incompleto tratadas con Misoprostol, expulsaron los anexos fetales en tres días, el resto lo hizo en 6 días y nueve días y el diámetro máximo de endometrio encontrado fue de 21 mm. Las reacciones adversas encontradas en las pacientes que se les administró el Misoprostol (Grupo Estudio A) fueron náuseas, dolor abdominal, diarrea. En las pacientes a quienes se les practicó el legrado Instrumental (Grupo Control B) se presentó la presencia de anexos fetales como complicación después de haberle realizado el legrado. No existe diferencia del hematocrito en ambos grupos de estudio.

Referencias bibliográficas ACOG. 2009. The American College of Obstetricians and Gynecologists ISSN: 1390-7573


Centro de Biotecnología, Vol. 3 Nro. 1. 2014 55 Calva et al. (2015); ABORTO ESPONTÁNEO INCOMPLETO NO COMPLICADO HASTA LAS 13 SEMANAS DE GESTACIÓN TRATADO CON MISOPROSTOL

Misoprostol for Postabortion. Opinion Nº 427 . Arias F. 2006. Guìa Pràctica para el Embarazo y Parto de Alto Riesgo (Vol. Segunda Ediciòn). Mosby. Aucotts E. 2007. Curettage Needed for Uncomplicated Incomplete Spontaneous Abortion. Publicación periódica- New York, 179. FLASOG. 2007. Uso de Misoprostol en Obstetricia y Ginecologìa. Gary C. 2006. Williams Obstetricia Interamericana 22: 231 - 252. Gomez R. 2009. Misoprostol: su uso para el aborto no punible. /www.flasog.org/ images/misoprostol.pdf(11). Gonzales, O. 2008. Aborto. Obtetricia, 282-9. Hinestroza 2005. Efectividad del Misoprostol en la Evacuación Uterina del Embarazo Anembrionario. Venezuela: Barquisimeto Hospital Universitario Antonio Maria Pineda. HRIA, L. 2010. Archivos del Departamento de Estadistica del Hospital Isidro Ayora. Loja. Blum, Y. 2009. Uso del Misoprostol para el tratamiento del Aborto Incompleto.

OMS. 2009. sta modelo de medicamentos esenciales de la Organización Mundial de la Salud. 16ª edición(http://www.who.int/ selection_medicines/). Peloggia, N. 2008. Tratamiento expectante versus tratamiento quirùrgico del aborto espontaneo. Revisòn Cochrane traducida. Perez, L. -H. 2007. Tratamiento de Aborto: Concepto y clasisificaciòn, etiologìa, anatomia patològica, clìnica y tratamiento . Madrid: SEGO. Sanchez-Lopez, M. 2008. Prostaglandinas y función reproductiva. Clase de residentes., 54. SEGO. 2010. Aborto Espontaneo. Silvestre, N. 2003. Voluntare Interruption Pregnancy with Mefepristone and Prostaglandin Analogue. Ginebra. Switzerland. 2009. Unedited Draft Report of the 17th Expert Committeen on the Selection and Essential Medicines. Távara Orozco, L. S. 2008. Disponibilidad y uso obstétrico del misoprostol en los países de América Latina y el Caribe. Revista Peruana de Ginecología y Obstetricia,. Segunda Edición. 253-263.

Jijon Letotr, A. 2008. Alto Riesgo Obstètrico. Quito - Ecuador.

Velázquez, M. J. 2006. El manejo del aborto espontáneo y de sus complicaciones. Gaceta Médica de México, 47.

MSP. (2008). Componente Materno. (pp:106 - 170).

Normativo

Vickey. 2007. Bioètica y Derechos Reeproductivos . Pro familia. pp:11- 23.

MSP. 2010. Dirección Provincial del Guayas. Informe de Estadisticas, Guayas.

Winikoff. 2002. Safety Efficacy and Acceptability Medical Abortion en China, Cuba and China Vol. 2. London Castle.

NIELSEN. 2008. Expectant Managementof First Trimester Spontaneous Abortion. NOVAK. 2008. Ginecologia Vol. 14º Edición. Interamericana. ISSN: 1390-7573

Zamberlin, N. 2009. Misoprostol para tratamiento del aborto incompleto en el contexto Argentino.

Centro de Biotecnología pp 48 – 55


56 Centro de Biotecnología, Vol. 4 Nro. 1. 2015

POTENCIAL ACTIVIDAD DEL Amaranthus hybridus COMO INMUNOMODULADOR

POTENTIAL ACTIVITY OF Amaranthus hybridus AS IMMUNOMODULATOR

. Centro de Biotecnología. Universidad Nacional de Loja (UNL), ECUADOR. mimarin007@hotmail.com 2 . Unidad de Fitoquímica. Laboratorio de Análisis Químico. Universidad Nacional de Loja. Av, Pío Jaramillo Alvarado S/N. Loja-ECUADOR. luismorocho02@gmail.com 3 . Secretaria Nacional del Agua. Loja, ECUADOR. segundo248@hotmail.com 4 . Facultad de Medicina. Universidad Austral de Chile. Chile. mbarriam@uach.cl 5 . Agencia de Cooperación Internacional Japonesa (JICA) JAPON. masaonishikawa061748@gmail.com * Autor para correspondencia 1

Miguel Marín-Gómez

1*

Carmen Pineda-Rojas1 Consuelo Medina-Armijos1 Luis Morocho-Yaguana2 Segundo Marín-Gómez3 Miguel Barría-Maldonado4 Masao Nishikawa5

Resumen Hay mucho interés por conocer los efectos de las plantas y su influencia en la salud humana basadas en conocimientos ancestrales. El estudio de los extractos de plantas y sus principios activos (los polifenoles y saponinas, etc) como inmunomoduladores tiene gran relevancia. El efecto inmunomodulador de los productos vegetales está bien probado y documentado, sin embargo, no existe estudios concretos sobre la capacidad inmunomoduladora del Amaranthus hybridus. En esta revisión bibliográfica del tipo exploratoria, nos proponemos analizar el estado actual acerca de una actividad potencial del Amaranthus hybridus como inmunoestimulante y dar a conocer los avances de nuestra investigación en relación a esta planta. Los efectos de los extractos del Amaranthus hybridus fue evaluado por RT-PCR e Inmunocitoquímica (ICQ) usando células de ratón. La investigación que nos encontramos realizando (resultados parciales) indican que el Amaranthus hybridus si tiene actividad inmunoestimulante, ya que se observa un aumento en la producción de IFN-gamma producido por los linfocitos Th1, actividad que es muy similar a la del control positivo. No tiene efectos en la producción de IFN tipo I (IFN-alfa/beta). El Amaranthus hybridus además de elemento nutritivo, tiene efectos terapéuticos contra diferentes patologías. En base a nuestro estudio, podemos manifestar que el Amaranthus hybridus no actúa por la vía de la inmunidad humoral ya que no estimula la producción de anticuerpos, sino por la vía de la inmunidad celular evidenciándose la producción de citoquinas como el IFN-gamma que interviene en el crecimiento y diferenciación celular. Palabras claves: Plantas Inmunoestimulantes, IFN-gamma.

Abstract There is much interest in knowing the effects of plant extracts and their influences on human health based on ancestral knowledge. The study of plant extracts and active ingredients (polyphenols and saponins, etc.) as immunomodulators has great relevance. The immunomodulatory effect of plant products is well tested and documented, however, no specific studies on the immunomodulatory capacity of Amaranthus hybridus. In this literature review the exploratory type, we analyze the current status of a potential activity of Amaranthus hybridus as immunostimulant and publicize the progress of our investigation in relation to this plant. The effects of Amaranthus hybridus extracts was assessed by RT-PCR and immunocytochemistry (ICQ) using mouse cells. The research result that we are doing (partial results) indicated that Amaranthus hybridus had immunostimulating activity for Th1, because of an increase in the production of IFN-gamma produced by Th1 cells with closely related to the effect of positive control. On the other hand, the extract had no effects on the production of IFN type I (IFN-alpha / beta) for Th2 immunity. Based on our study, we could hypothesize that the Amaranthus hybridus acts through the enhancement of cellular immunity rather than the amplification of humoral immunity, and the plant, the addition of nutrient, would have the therapeutic effects against various diseases.

Keywords: Immunostimulants plants, IFN-gamma. Recibido: julio 08 de 2015

Aprobado: septiembre 27 de 2015


Centro de Biotecnología, Vol. 3 Nro. 1. 2014 57 Marín et al. (2015); POTENCIAL ACTIVIDAD DEL Amaranthus hybridus COMO INMUNOMODULADOR

Introducción Actualmente hay un interés cada vez mayor en todo el mundo acerca del conocimiento de las hierbas medicinales acompañados por un aumento de laboratorios de investigación dedicados a descubrir las propiedades farmacológicas de los ingredientes bioactivos y su capacidad para el tratamiento de diversas enfermedades. Varias drogas han entrado el mercado internacional a través de la exploración de la etnofarmacología y la medicina tradicional. Aunque muchos estudios científicos se llevan a cabo en un gran número de plantas, un número menor de drogas comercializables han entrado en base a la evidencia terapéutica. En este contexto, el estudio de extractos de las plantas y sus principios activos como inmunomoduladores tiene gran relevancia. Los principios activos, de los cuales los más importantes desde el punto de vista de la salud, son los aceites esenciales, alcaloides, glucósidos o heterósidos, mucílagos, gomas y taninos, existen otros relevantes denominados nutrientes esenciales, como las vitaminas, minerales, aminoácidos, carbohidratos y fibras, azúcares diversos, ácidos orgánicos, lípidos y antibióticos. Los principios activos se clasifican, según su estructura química en productos resultantes del metabolismo primario (procesos químicos que intervienen en forma directa en la supervivencia, crecimiento y reproducción): glúcidos, lípidos, derivados de aminoácidos y los productos derivados del metabolismo secundario (no son esenciales para el metabolismo, sino que son sintetizadas como defensa y adaptación). En muchos productos vegetales ha sido posible encontrar actividad inmunomoduladora, algunos de estos productos contienen proteínas, lectinas, flavonoides, saponinas, polifenoles, polisacáridos entre otras sustancias. En plantas como el Panax ginseng, Viscum album, Tinospora cordifolia, Boerhaavia diffusa, Withania somnifera, Ocimum sanctum y Orhcioides curculigo su efecto inmunomodulador están bien probados y documentados (1,2). Sin embargo, no existe estudios concretos sobre la capacidad inmuISSN: 1390-7573

nomoduladora del Amaranthus hybridus. Amaranthus

hybridus y su potencial actividad

como inmunomodulador

El A. hybridus es una especie vegetal perteneciente a la familia Amaranthaceae, que ha tenido relevancia desde tiempos ancestrales para los pueblos originarios de América, desde México hasta Perú, también en África occidental, principalmente por su consumo como una fuente alimenticia rica en proteínas, así como por sus diferentes propiedades medicinales que se la han atribuido, entre los usos medicinales, se encuentra su uso en el tratamiento de la disentería, úlceras y hemorragia del intestino por su actividad astringente, también se ha descrito que sus hojas poseen un efecto antibacteriano y antiinflamatorio (3,4,5). Los estudios fitoquímicos realizados para los diferentes extractos, dan cuenta de los componentes principales, entre ellos tenemos polifenoles, saponinas, entre otros. Por otra parte, es conocido el alto contenido proteico de A. hybridus, lo que puede dar origen a péptidos bioactivos, que pueden tener efecto en el hombre al alcanzar el torrente sanguíneo, posterior al consumo de esta fuente proteica (6,7). Si bien no se han reportado estudios sobre el efecto de los extractos de sobre la inmunidad, creemos que de acuerdo a la naturaleza de los componentes de los extractos de Amaranthus hybridus, esto es polifenoles, saponinas, péptidos, entre otros, es importante analizar el potencial que tienen estos compuestos en la inmunidad, tanto como potenciales adyuvantes naturales o por su potencial en la modulación de inmunidad frente a patologías, autoinmunes, cáncer, enfermedades infecciosas (6,7). Mecanismo de inmunomodulación La inmunomodulación es el proceso que altera el sistema inmune del huésped dando como resultado ya sea inmunoestimulación o inmunosupresión. Por lo tanto, los inmunomoduladores son modificadores de la respuesta, Centro de Biotecnología pp 56 – 60


58 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Marín et al. (2015); POTENCIAL ACTIVIDAD DEL Amaranthus hybridus COMO INMUNOMODULADOR

mejoran el mecanismo de defensa del huésped contra las enfermedades para lograr un equilibrio entre células reguladoras y efectoras. El uso de estos mediadores biológicos obtenidos de las plantas, son formulaciones alternativas para tratar diversas enfermedades donde se activan los mecanismos de defensa, por ejemplo, en caso de deterioro de la respuesta inmune o puede suprimir selectivamente en condiciones como trastornos autoinmunes e hipersensibilidad. Por ello, las propiedades inmunomoduladoras de diversas plantas medicinales proporcionan una alternativa a la terapia de droga sintética convencional, que comúnmente provoca efectos secundarios, reacciones alérgicas, la tolerancia a las drogas y aumento de la resistencia de los microorganismos a antibióticos (8,9). Los mecanismos de control de la inmunidad, pasan principalmente por los componentes de la inmunidad innata, en el cual los receptores de reconocimiento de patrones moleculares asociados a patógenos (PAMPS) tienen un rol fundamental, entre estos receptores tenemos a los Toll-like receptor (TLR), los cuales están ampliamente expresados en células de la inmunidad innata y son el puente con la activación de la inmunidad adaptativa, donde los linfocitos juegan un rol central. Los linfocitos T helper se activan cuando se encuentran con antígenos (Ag) acoplados a moléculas de histocompatibilidad (MHC) clase II, que son expresados en la superficie de las células presentadoras de antígenos (APCs), tales como macrófagos, células dendríticas y células B. Una vez activados, se dividen rápidamente y secretan citoquinas que regulan la respuesta inmunitaria. Los linfocitos T helper pueden diferenciarse en los dos subtipos principales Th1 y Th2. Los linfocitos Th1 son activadores de la inmunidad contra patógenos intracelulares, mediada por macrófagos, linfocitos T CD8 +, los que son activados por interferón (IFN) gamma secretado por las células Th1. Por otra parte, los linfocitos Th2, producen interleucinas IL-4 e IL-5, entre otras citoquinas, las que son capaces de activar la producción de inmunoglobulinas, induciendo un switch Centro de Biotecnología pp 56 – 60

de cambio de clase en los linfocitos, por tanto están involucradas en la inmunidad contra patógenos extracelulares. Por otra parte, más recientemente se ha puesto en evidencia el rol regulador de los linfocitos Treg y de la subpoblación de linfocitos Th17, los primeros funcionan inhibiendo la respuesta inmune mientras que los linfocitos Th17 están involucrados en la respuesta autoinmune (10). Modulación de la respuesta inmune innata Los macrófagos son la primera línea de defensa del huésped contra la infección bacteriana y también en el control del crecimiento del cáncer, jugando un papel importante en la iniciación de la respuesta inmune adaptativa. Los macrófagos pueden ser estimulados por productos bacterianos incluyendo lipopolisacáridos (LPS) o muramildipéptido y liberar varias citoquinas inflamatorias, tales como interleuquina-1 (IL-1), IL-6, IL-8, factor de necrosis tumoral alfa (TNF alfa) y óxido nítrico (NO), todos los cuales pueden ejercer actividad tumoricida o actividad inflamatoria (10). La IL-1 tiene actividad citostática directa in vitro; la IL-6 también se considera como un importante mediador inmune e inflamatorio; la IL-12 producida por los linfocitos T helper, aumenta la capacidad de respuesta de los macrófagos. Estas tres citoquinas anteriormente mencionadas se relacionan entre sí en que su liberación es coordinada de los macrófagos activados, y que la IL-1 puede inducir IL-6. Sin embargo, IL-6 no induce IL-1, sino más bien suprime su producción por los macrófagos. Principios activos del amaranthus hybridus y su efecto sobre la inmunidad

Si bien los extractos de A. hybridus no han sido reportados directamente como agentes inmunomoduladores; sin embargo, sus componentes individuales tales como polifenoles, saponinas y péptidos tienen potentes efectos directos o indirectos sobre el sistema inmune, incluso usados como adyuvantes naturales (6,12).

ISSN: 1390-7573


Centro de Biotecnología, Vol. 3 Nro. 1. 2014 59 Marín et al. (2015); POTENCIAL ACTIVIDAD DEL Amaranthus hybridus COMO INMUNOMODULADOR

Polifenoles El sistema inmune ha evolucionado para defender a las personas contra patógenos y parásitos. Sin embargo, el montaje de una respuesta inmune es energéticamente costoso y tiene un impacto negativo en el crecimiento, éxito reproductivo e incluso en la supervivencia. El ataque por parte de un patógeno consta primero de una respuesta inmune innata durante el cual los fluidos, moléculas y células del sistema inmune tales como los fagocitos llegan al tejido afectado. Los fagocitos liberan especies altamente reactivas para matar patógenos, estas especies reactivas son agentes antimicrobianos eficaces, pero ellos no discriminan entre los agentes patógenos y células huésped y, por lo tanto, puede generar estrés oxidativo en los tejidos del huésped. Para contrarrestar los efectos tóxicos de especies reactivas el organismo dispone un sistema antioxidante complejo que incluye enzimas, minerales y vitaminas. Por ello, los antioxidantes son de suma importancia, considerando que estos compuestos no pueden ser sintetizados por los animales y, por lo tanto, tienen que ser adquirido con la dieta, lo cual tiene su relevancia puesto que, los estudios fitoquímicos de A. hybridus revelan un importante contenido de polifenoles (6). Los polifenoles de las plantas son un grupo de sustancias químicas derivadas del ácido shikímico que tienen uno o más anillos de fenol asociados. Se encuentran en las uvas, manzanas, bayas, té, café y en otras frutas y verduras que representan una parte importante de la dieta humana.

Las estructuras de los polifenoles naturales varían a partir de moléculas simples a compuestos altamente polimerizados, tales como taninos ISSN: 1390-7573

condensados. Estos compuestos contienen hidroxilos suficientes en grupos adecuados tales como carboxilos para formar complejos fuertes con proteínas y otras macromoléculas. Algunos investigadores han informado de que el alto consumo de polifenoles tiene efectos protectores contra el cáncer y enfermedades inflamatorias. El efecto anti-inflamatorio de los polifenoles se ha atribuido principalmente a su actividad antioxidante, ya que eran conocidos para secuestrar y prevenir la formación de oxígeno reactivo (ROS) y especies de nitrógeno, que son características distintivas importantes de la inflamación (13,14). Las saponinas como sustancias adyuvantes. Entre los componentes obtenidos de extractos del A. hybridus también se ha encontrado una cantidad importante de saponinas, si bien éstas no han sido estudiadas en relación a su efecto sobre el sistema inmune, se han estudiado en diferentes especies de plantas. Las saponinas son una clase de triterpenoides de origen natural y glucósidos esteroides que se encuentran en una amplia variedad de plantas. Adyuvantes basados en saponinas tienen la capacidad de modular la inmunidad celular, así como para mejorar la producción de anticuerpos y tienen la ventaja que sólo se necesita una dosis baja para la actividad adyuvante (15). Las saponinas inducen un fuerte efecto adyuvante a antígenos T-dependientes y T-independientes. Estos compuestos también inducen fuerte respuestas de los linfocitos citotóxicos CD8 + y potencian la respuesta a los antígenos de la mucosa (16). Sin embargo, las saponinas son agentes activos de superficie y pueden causar hemólisis de los glóbulos rojos, la hemólisis no parece estar correlacionado con actividad adyuvante (15,16). Las saponinas se han utilizado ampliamente como adyuvantes durante muchos años y se han incluido en varias vacunas veterinarias. Las saponinas no sólo tienen efectos estimulantes sobre los componentes de la inmunidad específica, sino también regulan algunas reacciones inmunes no específicos tales como la inflamación y la proliferación de monocitos. (17,18). Centro de Biotecnología pp 56 – 60


60 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Marín et al. (2015); POTENCIAL ACTIVIDAD DEL Amaranthus hybridus COMO INMUNOMODULADOR

Perspectivas del estudio del amaranthus hybridus como inmunomodulador

El grupo de investigación ha obtenido resultados preliminares que dan cuenta de una muy baja toxicidad del extracto acuoso y etanólico del A. hybridus, sobre leucocitos de sangre periférica humana y sobre células linfoides de ratón, este hecho es muy relevante ya que como se sabe, estos compuestos son de consumo humano, incluso en la actualidad se comercializa como extracto natural. Cuando estos extractos fueron utilizados “in vivo” para estudiar la inmunidad celular, en un modelo de inmunización de ratones con ovoalbúmina en presencia o no de extracto de A. hybridus, encontramos que no hay cambios en los niveles de anticuerpos anti-OVA. Sin embargo, estudios “in vitro” en que medimos la expresión de mRNA para algunas citoquinas, involucradas en la inmunidad celular, encontramos que los extractos de A. hybridus son capaces de aumentar la expresión de IFN-gamma, una citoquina de tipo TH1, tanto en las células de médula ósea y bazo de ratón y células mononucleares de sangre periférica humana.

Referencias bibliográficas

Bodhankar S, Makare N, Rangari V. 2001. Immunomodulatory activity of alcoholic extract of Mangifera indica in mice. J Ethnopharmacol 78: 133–137. Mishra SH, Bafna AR. 2006. Immunostimulatory effects of methanol extract of Curculigo orchioides on immunosuppressed mice. J Ethnopharmacol 104: 1–4. Pieroni A, Houlihan L, Ansari N, Hussain B, Aslam S. 2007. Medicinal perceptions of vegetables traditionally consumed by south- Asian migrants living in Bradford, Northern England. J Ethnopharmacol 113: 100-110. Medoua GN, Oldewage-Theron WH. 2014. Effect of drying and cooking on nutritional value and antioxidant capacity of morogo (Amaranthus hybridus) a traditional leafy vegetable grown in South Africa. J Food Sci Technol 51:736-42. Adewale A, Olorunju AE. 2013. Modulatory of effect

Centro de Biotecnología pp 56 – 60

of fresh Amaranthus caudatus and Amaranthus hybridus aqueous leaf extracts on detoxify enzymes and micronuclei formation after exposure to sodium arsenite. Pharmacognosy Res 5:300-5. Nana FW, Hilou A, Millogo JF, Nacoulma OG. 2012. Phytochemical Composition, Antioxidant and Xanthine Oxidase Inhibitory Activities of Amaranthus cruentus L. and Amaranthus hybridus L. Extracts. Pharmaceuticals (Basel). 5:613-28. Singh S, Sheoran SS. 2011. Evaluation of the antinociceptive activity of Amaranthus hybridus Linn. root extracts. Acta Pol Pharm 68: 255-9. Shizuo A. 2011. Innate immunity and adjuvants. Phil. Trans. R. Soc. B 366, 2748–2755. Liu, G, Zhang L and Zhao Y. 2013. Modulation of immune responses through direct activation of Toll-like receptors to T cell. Clinical and Experimental Immunology, 160: 168–175. Anwei C, Haiqing Y, Caijing H, Wenliang W, Yaoqi T, Xiangyan C. 2014. Polyphenols from blueberries modulate inflammation cytokines in LPS-induced RAW264.7 macrophages. International Journal of Biological Macromolecules 69: 382–387. Maureen A y Prieto EA 1999. Plantas que contienen polifenoles. antioxidantes dentro del estilo de vida. Rev Cubana Invest Biomed 18 (1): 12-14. Jung-Min H, Ji-Yeon Y, Young-Oh J, Beom-Tae K, Ki-Jun H, Young-Mi J, Jeong-Chae L. 2010. A phenolic acid phenethyl urea compound inhibits lipopolysaccharide-induced production of nitric oxide and pro-inflammatory cytokines in cell culture. International Immunopharmacology 10: 526–532. Oda K, Matsuda H, Murakami T, Katayama S, Ohgitani T, Yoshikawa M. 2000. Adjuvant and haemolytic activities of 47 saponins derived from medicinal and food plants. Biol. Chem 381(1):6774. Kensil CR. 1996. Saponins as vaccine adjuvants. Crit. Rev. Ther. Drug Carrier Syst 13 (1-2):1-55. de Oliveira CAC, Perez AC, Merino G, Prieto JG, Alvarez AI. 2001. Protective effects of Panax ginseng on muscle injury and inflammation after eccentric exercise. Comp. Biochem. Physiol. 130 (3):369-377. Rajput ZI, Song-hua HU, Chen-Wen X, Arijo AG. 2007. Adjuvant effects of saponins on animal immune responses. Journal of Zhejiang University Science B. 8 (3):153-161 ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 61

DETECCIÓN DEL VIRUS DE NEWCASTLE EN GALLINAS CRIOLLAS EN LA PROVINCIA DE LOJA DETECTION OF NEWCASTLE DISEASE VIRUS IN NATIVE HENS IN LOJA PROVINCE Janeth E. Armijos Montaño1 Agusto Luzuriaga Neira2 Fredy Cueva Castillo3 Galo Escudero Sánchez4 Loidy Zamora Gutierrez2 Gustavo Villacís Rivas1*

1. Carrera de Medicina Veterinaria. Universidad Nacional de Loja. Ciudadela Guillermo Falconi “La Argelia”- PBX 072547252 – Casilla Letras ¨S¨, Loja-Ecuador 2. Universidad de Porto. Porto-Portugal. 3. Agrocalidad. Ministerio de Agricultura, Ganaderia, Acuacultura y Pesca. Loja. chazo1970@hotmail.com 4. Centro de Biotecnología. Universidad Nacional de Loja. Ciudadela Guillermo Falconi ¨La Argelia¨- PBX 072547252 – Casilla Letras ¨S¨, Loja-Ecuador. loydizamorag@gmail.com * Autor para correspondencia

Resumen La enfermedad de Newcastle es causada por cepas virulentas de paramixovirus tipo1 (PMVA-I). El objetivo de este estudio fue determinar la presencia del virus en las parroquias de Cazaderos, Garza Real, Mangahurco, Paletillas y Bolaspamba en el cantón Zapotillo en la provincia de Loja. Se tomaron 350 muestras de suero sanguíneo y 140 muestras de hisopados cloacales, provenientes de aves aparentemente sanas y que presentaron signos clínicos de la enfermedad. Las muestras de suero fueron analizadas Kit de ELISA IDEXX, de las cuales un 49,7 % de las mismas resultaron positivas. A partir de los hisopados se realizó el aislamiento viral en huevos embrionados de 9 a 11 días de desarrollo libres de patógenos específicos (LPE). Se realizó hemoaglutinación en el fluido alantoideo para comprobar la presencia del virus. A partir del líquido alantoideo se extrajo ARN y posteriormente se les realizó una RT-PCR con cebadores específicos, donde se obtuvo productos de 362 pb. La presencia viral se comprobó en 10,71% de las muestras. Para realizar la identificación de cepas patogénicas se realizó una segunda RT-PCR en un solo paso con cebadores específicos, donde se obtuvo amplificaciones de 254. Este es el primer estudio de la detección molecular del virus Newcastle en el Ecuador, lo que contribuye al manejo de la enfermedad.

Palabras claves: Virus de Newcastle, ELISA, aislamiento viral, RT-PCR. Abstract The Newcastle Disease is causing by virulent strains of paramyxoviruses type 1(PMVA-I). The aim of this study was to determine the presence of the virus in the Loja province. The places survey were Cazaderos, Garza Real, Mangahurco, Paletillas and Bolaspamba. 350 serum and 140 cloacael swabs samples were taken, from apparently healthy birds and showed disease clinical signs. Serum samples were analyzed by IDEXX ELISA kit, which 49.7 % of them were positive. From the swabs it was performed virus isolation in eggs specific pathogen free (SPF) of 9-11 days of development. The Hemagglutination probe was performed in the allantoic fluid for determined virus presence. From allantoic fluid RNA was extracted and subsequently RT-PCR was made with specific primers, products of 362 bp were obtained. Viral presence was found in 10.71% of the samples. To make identification of pathogenic strains a second RT-PCR was performed in a single step with specific primers, where amplifications of 254 bp were obtained. This is the first study of the molecular detection of Newcastle virus in Ecuador, contributing to disease management.

Keywords: Newcastle virus disease, ELISA, viral isolation, RT-PCR. Recibido: febrero 08 de 2015

Aprobado: mayo 27 de 2015


62 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Armijos et al. (2015); DETECCIÓN DEL VIRUS DE NEWCASTLE EN GALLINAS CRIOLLAS EN LA PROVINCIA DE LOJA

Introducción La industria avícola en el Ecuador aporta aproximadamente el 23% del valor de la producción agropecuaria nacional. Constituye un componente básico en la seguridad alimentaria. En el catón Zapotillo de la provincia de Loja existen pequeños productores que crían aves en sus propiedades bajo un sistema tradicional (traspatio). Donde el control sanitario es carente, así como la existencia de programas de bioseguridad. Estos constituyen factores de riesgo para el desarrollo de enfermedades (Villacís et al., 2014). Una de las enfermedades más importantes que afecta al sector avícola en el cantón Zapotillo es la Enfermedad de Newcastle (EN) causada por Newcastle disease virus (NDV) que es uno de los patógenos de mayor importancia social y económica en la industria avícola (Villacís et al., 2014). Este virus produce una elevada morbilidad y mortalidad, presenta un amplio rango de hospedero, afectando a más de 240 especies aviares (OIE, 2012). Newcastle disease virus pertenece a la familia Paramyxoviridae, del género Aluvavirus (ICTV, 2014). Existen tres tipos de cepas: lentogénica o leve, mesogénica o moderada, y velogénica o muy virulenta. Las cepas lentogénicas cursan con signos respiratorios leves y caída de la postura en las aves más sensibles. Las cepas mesogénicas dan lugar a formas clínicas agudas, cursando con sintomatología respiratoria y las alteraciones nerviosas no son frecuentes. Las cepas velogénicas dan lugar a formas clínicas sobreagudas, la morbilidad puede llegar a alcanzar valores del 100% y la mortalidad puede superar el 50% en aves adultas y el 90% en aves jóvenes. El cuadro clínico es de corta duración, aparece bruscamente y se propaga con rapidez (OIE, 2012). Como medida de control de la enfermedad se ha establecido la vacunación rutinaria contra el virus de Newcastle en todas las aves comerciales, sin embargo, las aves de traspatio no son sometidas a este procedimiento por razones socio-culturales y económicas. Se Centro de Biotecnología pp 61 – 65

ha descrito la aparente resistencia de estas aves a la enfermedad, pero se reconoce que actúan como importantes portadores y fuentes de infección para la avicultura comercial (Senne, 2004). El objetivo de este estudio fue determinar la presencia del virus en las parroquias de Cazaderos, Garza Real, Mangahurco, Paletillas y Bolaspamba en el cantón Zapotillo en la provincia de Loja. Lo que posibilitará establecer un control epidemiológico a través de planes de prevención. Esto contribuirá a evitar la diseminación de la enfermedad a otros sectores, favoreciendo a la sanidad animal y a la economía de los productores. Materiales y métodos Se tomaron 140 muestras de hisopados cloacales y 350 muestras de suero sanguíneo de gallinas criollas aparentemente sanas y con signos de la enfermedad en el cantón Zapotillo. El catón está ubicado en la parte occidental de la provincia de Loja, a 240 km aproximadamente, a 835 metros de altura sobre el nivel del mar en la zona alta y a 182 metros de altura sobre el nivel del mar en la zona baja. Se recolectaron muestras de las parroquias: Cazaderos, Garza Real, Limones Paletillas, Bolaspamba y Mangahurco. Las muestras se tomaron en etapas sucesivas, para lo cual se utilizó como guía el III Censo Nacional Agropecuario realizado en el 2000, en el que existen 2266 Unión de Pequeños Agricultores. Detección de anticuerpos La detección de anticuerpos en las muestras de suero sanguíneo se realizó mediante ELISA con el Kit Newcastle Disease Virus Antibody (IDEXX). En la cual se reportó como muestras seropositivas a todas las aves con títulos superiores a 396 según las indicaciones del fabricante. Se realizó la prueba x2 para determinar si existen diferencias significativas entre positivos y negativos utilizando el paquete estadístico Infostat (Di Rienzo et al., 2011). ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 63 Armijos et al. (2015); DETECCIÓN DEL VIRUS DE NEWCASTLE EN GALLINAS CRIOLLAS EN LA PROVINCIA DE LOJA

Aislamiento

del virus a partir de hisopados

cloacales

Los hisopados cloacales se inocularon en embriones de pollo de 9-11 días de desarrollo, libre de patógenos específicos (LPE). Se utilizaron a razón de 10 embriones por muestra y se inocularon por la vía de la cavidad alantoidea con volumen de 0.25 mL por embrión. Los embriones fueron incubados a 370C y diariamente se chequeó su viabilidad. A las 72 horas post-inoculación, se cosechó el líquido alantoideo y se realizaron dos pases ciegos en embrión de pollo. Posteriormente a partir del líquido alantoideo se realizó la prueba de hemaglutinación (OIE, 2012). Extracción de ARN Técnica Reacción en Cadena de la Polimerasa – Reverso Transcriptasa La extracción de ARN se realizó mediante el Ki Viral RNA/DNA mini Kit (Invitrogen). Se realizó la cuantificación del ARN viral en un equipo Nano Drop (2000). La RT-PCR se llevada a cabo con SuperScript® III One-Step RT-PCR System with Platinum® Taq DNA Polymerase (Invitrogen). Los cebadores utilizados para determinar la presencia de NDV fueron ALLs

y Alle, mientras que para cepas virulentas del virus se utilizó ALLs y AVLe (Wang et al., 2001). Las reacciones de PCR se llevaron a cabo con los mismos cebadores siguiendo las condiciones descritas por Wang et al., 2001. Los productos de PCR fueron visualizados en geles de agarosa 1,5%.

Resultados Detección de anticuerpos Un total de 174 muestras fueron seropositivas mediante el método de ELISA, lo que representa un porcentaje del 49,7%, mientras que 176 resultaron seronegativas lo que representa el 50,3% de las muestras colectadas. En la figura 1 se puede observar que la parroquia con mayor presencia de anticuerpos fue Paletillas, así como la de menor presencia fue la parroquia Bolaspamba. En el Cuadro 1 se muestran los resultados de la prueba x2 donde se observa que solamente existen diferencias significativas en la Parroquia Paletillas entre el número de muestras positivas y negativas.

Figura 1. Presencia de anticuerpos contra el Virus de Newcastle en gallinas criollas en parroquias del cantón Zapotillo.

Aislamiento cloacales

ISSN: 1390-7573

del virus a partir de hisopados

Los resultados del aislamiento viral después de 3 pases sucesivos realizados en embrión de pollo revelaron que en 15 de las muestras Centro de Biotecnología pp 61 – 65


64 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Armijos et al. (2015); DETECCIÓN DEL VIRUS DE NEWCASTLE EN GALLINAS CRIOLLAS EN LA PROVINCIA DE LOJA

Parroquias

Positivos

Negativos

X2

p-value 0,05

Garza Real

37

35

0.067

0.7958

Limones

23

37

2.6578

0.103

Cazaderos

22

26

0.2544

0.614

Mangahurco

26

31

0.3297

0.5658

Bolaspamba

21

32

1.877

0.1707

Paletillas

45

15

13.1606

0.0002

Cuadro 1. Comparación de los casos positivos y negativos por en las parroquias del cantón Zapotillo mediante prueba x2.

evaluadas se evidencia multiplicación viral, lo que fue determinado por mortalidad embrionaria con lesiones similares a las producidas por NDV. Dichas muestras resultaron positivas para la prueba de hemaglutinación. Determinación

Newcastle disease virus mediante técnica Reacción en Cadena de la Polimerasa – Reverso Transcriptasa de la presencia

Se confirmaron 15 muestras positivas mediante la RT-PCR con cebadores específicos para Newcastle disease virus lo que representa 10,71%. Donde se obtuvo productos de amplificación 362 (bp) en las parroquias de Cazaderos, Garza Real, Mangahurco, Paletillas y Bolaspamba. La RT-PCR para determinar cepas patogénicas arrojó que 5 de las muestras son virulentas con cebadores específicos, en las parroquias Cazaderos, Garza Real, Paletillas y Bolaspamba.

Discusión Las aves que presentaron títulos mayores a 396 se consideran valores altos lo que Centro de Biotecnología pp 61 – 65

sugiere una hipótesis de circulación viral en estas aves con clínica compatible. Esto puede atribuirse a factores como el sistema de manejo de producción tradicional, porque tienen pocas medidas sanitarias las cuales favorecen la diseminación del virus; la continua exposición a aves silvestres; las deficiencias de la nutrición; la ausencia de control de la enfermedad a través de la vacunación y el contacto de aves no infectadas con aves portadoras de patógenos. En la parroquia Paletillas se presentan diferencias significativas entre el número de seropositivos y seronegativos, siendo el porcentaje de positivos de 12,8%. Esta parroquia es un lugar muy comercial, en donde campesinos de las distintas cercanías e incluso de Perú, acuden a este lugar a vender sus animales, siendo estas aves de dudosa procedencia que pueden ser portadores de la enfermedad (Villacís et al., 20014). Otra de las parroquias en las que se encontró alta sero-prevalencia fue Garza Real (10,5%). En cambio este lugar es preferido por aves ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 65 Armijos et al. (2015); DETECCIÓN DEL VIRUS DE NEWCASTLE EN GALLINAS CRIOLLAS EN LA PROVINCIA DE LOJA

la migratorias como garzas las cuales han sido informadas como una de las especies silvestres portadoras del virus. Las aves domésticas pueden ser infectadas a través del contacto con las heces fecales de las aves migratorias (Severino, 2007). Mediante la técnica de RT-PCR se logró determinar la presencia del virus de Newcastle a partir de muestras de campo, previo aislamiento viral donde se evidencian amplificaciones de la talla esperada según los descrito por Wang et al., 2001. La ventaja de disponer de una herramienta de diagnóstico como RT-PCR permite revelar de forma rápida y específica pequeñas concentraciones de ARN viral, independientemente de la viabilidad del mismo. El hecho de poder conocer si la cepa circulante es patogénica o no es de gran importancia, lo que está relacionado con lo descrito por diversos autores quienes proponen la detección específica y simultánea de las diferentes cepas virales (Tiwari et al., 2004; Zhang et al., 2010; Miller et al., 2010). Este es el primer estudio de la detección molecular del virus Newcastle en el Ecuador, lo que contribuye de manera positiva al manejo de la enfermedad. Conclusiones

virulentas del virus. Referencias bibliográficas Di Rienzo, J.A., Casanoves, F., Balzarini, M. G., Gonzalez, L., Tablada y M., Robledo, C. W. 2011. Grupo InfoStat, FCA, Universidad Nacional de Córdoba, Argentina. URL http:// www. infostat. com. ar. International Committee on Taxonomy of Viruses (ICTV). 2014. http://ictvonline.org/ virustaxonomy.asp Miller, P.J., Decanini, E.L. y Afonso, C.L. 2010. Newcastle disease: evolution of genotypes and the related diagnostic challenges. Infect Genet Evol. 10: 26-35. Organización Mundial de Sanidad Animal (OIE). 2012. Manual Terrestre de la OIE. Enfermedad de Newcastle Severino J. 2007. Migracao de aves: Influenza aviaria e a doenca de Newcastle no Brasil. En: Conferencia APINCO 2007 de Ciencia e Tecnologia Avicola. Porto Alegre, Brasil. Senne, D. A., King, D. J. y Kapczynski, D. R. 2004. Control of Newcastle disease by vaccination. Dev Biol (Basel).119:165-70. Tiwaria, A. K., Katariaa, R. S., Nanthakumara, T., Dashb, B. B. y Desa, G. 2004. Differential detection of Newcastle disease virus strains by degenerate primers based RT-PCR. Comparative Immunology, Microbiology & Infectious Diseases. 27: 163–169.

La parroquia con mayor sero-prevalencia en el cantón Zapotillo es Paletillas.

Villacís, G., Escudero, G., Cueva, F. y Luzuriaga, A. 2014. Aislamiento del virus de la enfermedad de Newcastle en zonas rurales del sur del Ecuador. CEDAMAZ. 4: 86-90.

Se determinó la presencia del virus de Newcastle en las parroquias de Cazaderos, Garza Real, Mangahurco, Paletillas y Bolaspamba en el cantón Zapotillo en la provincia de Loja.

Wang, Z., Vreede, F. T., Mitchell, J. O. y Viljoen, G. J. 2001. Rapid detection and differentiation of Newcastle disease virus isolates by a triple one-step RT-PCR. Onderstepoort J Vet Res. 68:131-4.

Se obtuvo el aislamiento de quince cepas del virus de Newcastle, cinco de las cuales son patogénicas. Se optimizó la técnica RT-PCR con cebadores específicos para la detección de cepas ISSN: 1390-7573

Centro de Biotecnología pp 61 – 65


66 Centro de Biotecnología, Vol. 4 Nro. 1. 2015

TRANSMISIÓN VECTORIAL DE Trypanosoma cruzi EN POBLADORES DEL BARRIO “LA EXTENSA”, CATAMAYO

VECTORIAL TRANSMISSION OF Trypanosoma cruzi IN RESIDENTS OF NEIGHBORHOOD “LA EXTENSA”, CATAMAYO Patricia Alexandra Guerrero Ochoa1 Ángel Eduardo Chimbo Torres1 Tito Goberth Carrión Dávila1*

1. Área de la Salud. Universidad Nacional de Loja. Loja-Ecuador. Av. Pío Jaramillo Alvarado S/N. La Argelia. Loja-Ecuador * Autor para correspondencia: tigocada@yahoo.es

Resumen Tripanosomiasis americana, enfermedad conocida como Chagas, es una zoonosis vectorial de carácter crónico en inmunocompetentes; y, oportunista en inmunodeprimidos. Dada su evolución esta enfermedad cursa hacia la cronicidad y atraviesa tres etapas: aguda, indeterminada y crónica.El objetivo general fue identificar anticuerpos contra Tripanosoma cruzi y los factores de riesgo para su transmisión vectorial. La técnica usada para detectar anticuerpos contra Tripanosoma cruzi fue ELISA. Los factores de riesgo para la propagación de vectores triatóminos en las zonas intradomiciliar y peridomiciliar; así como los factores de riesgo para la transmisión del parásito, se establecieron mediante observación directa y encuesta. Este estudio es de tipo descriptivo, de corte transversal. Se seleccionó una muestra de 123 personas del barrio La Extensa, del cantón Catamayo. Se determinó que una persona presentó DO elevada dos desviaciones estándar sobre los controles para anticuerpos IgG, lo cual correspondió a 0,8% de la muestra. Los factores de riesgo más frecuentes asociados a la exposición al vector fueron: techo de teja, en 90% de los casos; piso de tierra, en 55% de los casos; paredes de adobe, en 28% de los casos y paredes de construcción mixta, en 24% de los casos. La acción preventiva para evitar la picadura por triatominos más usada, fue el uso del toldo para dormir en 69% de los casos. Finalmente, no se estableció una relación estadística significativa entre los anticuerpos séricos y los factores de riesgo de transmisión vectorial.

Palabras claves: Enfermedad de Chagas, anticuerpos, factores de riesgo, vectores, triatominos, ELISA. Abstract American trypanosomiasis, known as Chagas disease, is a chronic zoonosis vector in immunocompetent; and opportunistic in immunocompromised. Given this, disease presents its evolution towards chronicity and goes through three stages: acute, indeterminate and chronic. The overall objective was to identify antibodies to Trypanosoma cruzi and risk factors for vector transmission. The technique used to detect antibodies to Trypanosoma cruzi was ELISA. It were established by direct observation and survey, the risk factors for the spread of triatomine vectors in the intradomiciliar and peridomiciliary areas; as well as risk factors for the transmission of the parasite. This is a descriptive study, of cross section. A sample of 123 people from the neighborhood “La Extensa”, from Catamayo was selected. It was determined that a person presented high DO two standard deviations above the controls for IgG, which corresponds to 0.8% of the sample. The most common risk factors associated with exposure to vector tile roof were in 90% of cases, floor in 55% of cases, adobe walls in 28% of cases and mixed construction walls 24% cases. Preventive action to avoid getting bitten by triatomine most used was the use of the awning to sleep in 69% of cases. Finally, no significant statistical relationship between serum antibodies and risk factors of vector transmission was established.

Keywords: Chagas disease, antibodies, risk factors, vector, triatomines, ELISA. Recibido: septiembre 14 de 2015

Aprobado: octubre 12 de 2015


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 67 Guerrero et al. (2015); TRANSMISIÓN VECTORIAL DE Trypanosoma cruzi EN POBLADORES DEL BARRIO “LA EXTENSA”, CATAMAYO

Introducción La Enfermedad de Chagas o tripanosomiasis americana es una infección endémica presente en muchos países de América. La Organización Mundial de la Salud (OMS), en 2012, calculó que cerca de 100 millones de personas están en riesgo de infectarse, que hay cerca de 8 millones contagiadas, y 56.000 nuevos casos anuales, lo que da como consecuencia 12.000 muertes al año, y una incidencia anual de 41.000 casos en la Región de las Américas. Se prevé que alrededor de 100 millones de personas están en riesgo de contraer esta enfermedad (2,3). En Ecuador, por ejemplo, se estima que la prevalencia de anticuerpos anti-T. cruzi está en alrededor del 1.38 % de la población total; es decir, que hay una presencia de aproximadamente 176.400 seropositivos. Las zonas de riesgo en este país abarcan 20 provincias y alrededor de 3.5 millones de habitantes son vulnerables debido a las características rudimentarias de sus viviendas, y otros factores (4). Este mal producido por Trypanosoma cruzi, parásito hemoflagelado que es transmitido al hombre y a otros mamíferos por insectos triatominos hematófagos de la familia Reduvidae. Los parásitos infectantes salen en las deyecciones del vector y pueden introducirse al organismo a través del orificio de la picadura, heridas o excoriaciones de la piel o atravesando directamente la mucosa ocular, nasal o bucal. Existen unas formas flageladas en la sangre, conocidas como tripomastigotes sanguíneos y otras sin flagelos dentro de las células de ciertos tejidos, denominadas amastigotes. La enfermedad se caracteriza clínicamente por la existencia de tres fases: aguda, indeterminada o latente y crónica; esta última puede producir miocarditis severa (5).

Siendo el Ecuador un país que cuenta con el vector del T. cruzi, se justifica plenamente el estudio de la transmisión del parásito en poblaciones donde los factores de riesgo de picadura y, por lo tanto de transmisión de la enfermedad. Se pretende determinar qué tan expuesta está la población a ser infectada por el parásito, siendo que se ha evidenciado el vector en zonas peridomiciliarias e intradomiciliarias. Además, la difusión a la población de la información acerca del parásito y de las condiciones de las viviendas que incrementan el riesgo de transmisión, es una contribución importante para disminuir la transmisión de la enfermedad de Chagas. Materiales y Métodos De las 123 personas que participaron en el presente estudio investigativo, el 1% comprende a edades entre 1 - 5 años; el 19%, edades entre 6 - 10 años; el 28%, edades entre 11 - 19 años; 18%, edades entre 20 - 29 años; 10%, edades entre 30 - 39 años; 9%, edades entre 40 - 49 años; 6%, edades entre 50 - 59 años; y, mayores de 60 años con el 9%. Se extrajo sangre periférica y se centrifugó. Se aplicó un protocolo de la técnica para la Identificación de Anticuerpos contra Tripanosoma cruzi CHAGAS ELISA IgG + IgM Vircell Microbiologists labs, mediante lector de Microelisa Rayto Rt-2100c. Los resultados fueron analizados. Para la presentación de resultados se utilizó el programa Microsoft Excel 2010 mediante la elaboración de tablas y gráficas correspondientes a cada parámetro; además del programa Graphpad prism 6.0 para el análisis estadístico. Resultados

Cuadro 1. Características de las construcciones de las casas y materiales

Paredes

Frecuencia

%

Adobe

12

28

Ladrillo

20

Mixtas Total ISSN: 1390-7573

Techo

Frecuencia

%

Piso

Frecuencia

%

Hormigón

0

0

Tierra

23

55

48

Zinc

4

10

Tablado

0

0

10

24

Teja

38

90

Cemento

19

45

42

100

Total

42

100

Total

42

100

Centro de Biotecnología pp 66 – 71


68 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Guerrero et al. (2015); TRANSMISIÓN VECTORIAL DE Trypanosoma cruzi EN POBLADORES DEL BARRIO “LA EXTENSA”, CATAMAYO Cuadro 2. Crianza de animales de corral

Animales de corral

Cuadro 3. Cría de animales domésticos

Frecuencia

%

Frecuencia

%

SI

38

90

Gallinas

37

76

NO

4

10

Cuyes

5

10

Total

42

100

Chivos

2

4

Cerdos

5

10

Total

42

100

Tipo de animal doméstico

Cuadro 4. Lugar de crianza de los animales

Cuadro 5. Higiene del lugar de crianza

Aseo

Frecuencia

%

Lugar de crianza

Frecuencia

%

Dentro de su vivienda

2

5

Diario

10

26

Alrededor de su vivienda

27

71

Semanal

13

34

Alejado de su vivienda

9

24

Quincenal

5

13

Total

38

100

Mensual

4

11

Nunca

6

16

Total

38

100

Cuadro 6. Protecciónde la población, incidencia de vectores y pruebas anti-Tripanosoma

Uso de toldos

Frecuencia

%

Picaduras Frecuencia

SI

29

69

Positivo

1

0.8

SI

3

2

NO

13

31

Negativo

122

99.2

NO

120

98

Total

42

100

Total

123

100

Total

123

100

De las correlaciones que se hicieron entre las muestras analizadas y los factores de riesgo de picadura, todas presentaron una asociación nula, con un p value mayor a 0,05; sin embargo, en el caso de la asociación entre

%

IgG e IgM

Frecuencia

%

los niveles altos de IgG e IgM antiTripanosoma cruzi y la picadura por triatomo, se encontró una asociación baja, que resultó significativa a pesar de obtener un r2 bajo de 0,3279 y un p value de 0,0001.

Cuadro 7. Correlación de niveles séricos de anticuerpos antiT-cruzi y factores de riesgo de transmisión

PARÁMETRO EDAD PAREDES PISO TECHO ANIMALES TIPO DE ANIMAL LUGAR DE CRIANZA ASEO DEL LUGAR TOLDO Centro de Biotecnología pp 66 – 71

p Value 0.5834 0,4101 0.4498 0.6067 0.6067 0.6067 0.6067 0.0988 0.5807 ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 69 Guerrero et al. (2015); TRANSMISIÓN VECTORIAL DE Trypanosoma cruzi EN POBLADORES DEL BARRIO “LA EXTENSA”, CATAMAYO

Discusión La Enfermedad de Chagas es una de las enfermedades parasitarias con mayor grado de mortalidad en Latinoamérica. En el presente estudio se encontró 0.8 % de casos positivos, en contraste con Amunárriz, M. (2010), quien en un estudio realizado en la Amazonía, de 2033 muestras de suero analizadas, reportó que 73 fueron positivas para Chagas (3,6%) las cuales presentaron anticuerpos con reactividad contra T. cruzi, utilizando la técnica CHAGATEST/ELISA recombinante v.3.0 (anticuerpos recombinantes de tripomastigotes de T. cruzi). (6) Esos resultados están en relación a la forma de vida de los pobladores amazónicos, es decir, de usar poca ropa y dormir en lugares abiertos, lo cual eleva el riesgo de picaduras de triatominos. En el presente estudio no se encontraron pacientes con manifestaciones clínicas compatibles con la enfermedad aguda. Según la Organización Mundial de la Salud, en 2012, 8 millones padecieron este mal, y anualmente se registran 56.000 nuevos casos, lo que da como consecuencia 12.000 muertes al año, y una incidencia anual de 41.000 casos en América Latina. Se pronostica, y esto no es nada alentador, que 100 millones de personas, a nivel mundial, podrían contraer este mal (2). En Ecuador, por ejemplo, se estima que la prevalencia de anticuerpos anti-T. cruzi está en alrededor del 1.38 % de la población total; es decir, que hay una presencia de 176.400 seropositivos. Las zonas de riesgo en este país abarcan 20 provincias, y alrededor de 3.5 millones de habitantes son vulnerables debido a las características rudimentarias de sus viviendas, y otros factores (3). El estudio de Soto y su grupo (2014), en Colombia, determinaron que los cambios producidos por la invasión de seres humanos en el ambiente natural del vector de Chagas, produce un impacto en el comportamiento del vector; este reporte indica que se puede dar transmisión oral de los alimentos contaminados con heces del vector portador de T. cruzi (7) siendo el reporte más documentado el de Brasil (8,9,10) . En concordancia con el trabaISSN: 1390-7573

jo de Soto, el estudio de Breniere S. (2012) plantea la misma problemática del incremento de la transmisión de la enfermedad de Chagas en comunidades que se asientan en territorios altamente infestados con poblaciones silvestres de T. infestans (12). Estos resultados deben alertar a las autoridades sobre el incremento del riesgo de transmisión de la enfermedad; investigaciones que podrían realizarse también en nuestro territorio. Una pequeña parte de los pobladores del barrio La Extensa, 2% (3 personas), reportaron haber sufrido picaduras producidas por el vector Triatomino en algún momento de su vida; el suero positivo para IgG anti-T. cruzi fue de un paciente que reportó una picadura reciente por el Triatomino, esto asociado a que la vivienda en la cual habita este paciente positivo posee factores de riesgo como: pared de adobe, piso de tierra, techo de tejas , tiene acúmulos de madera en su interior y sus ventanas no estaban protegidas con mosquitero. Cabe mencionar que por el clima cálido de su residencia esta persona dormía con poca ropa y aunque reporta uso de toldo, el espaldar de su cama estaba (se observó durante la encuesta) en contacto con el muro de adobe; acorde con Black, quien reportó que en comparación con paredes de cemento; las paredes de caña y adobe en las regiones costeras y las tierras altas de Ecuador, se asociaron a un mayor riesgo de seropositividad de T. cruzi, ya que los muros de adobe son propensos al agrietamiento y proporcionar escondites y lugares de reproducción de los insectos vectores Triatominos (12). De los factores de riesgo que se estudiaron en esta investigación, se pudo establecer que un gran número de las viviendas tiene características propicias para servir de hábitat al vector, ya que los valores encontrados son: el techo de teja con 90% (38 casas), el piso de tierra 55% (23 casas), paredes de adobe 28% (12 casas) y paredes de construcción mixta (ladrillo y adobe) 24% (10 casas), de un total de 42 viviendas del sector. Similares hallazgos fueron publicados por Black acerca de los factores más predisponentes para una Centro de Biotecnología pp 66 – 71


70 Centro de Biotecnología, Vol. 4 Nro. 1. 2015 Guerrero et al. (2015); TRANSMISIÓN VECTORIAL DE Trypanosoma cruzi EN POBLADORES DEL BARRIO “LA EXTENSA”, CATAMAYO

propagación vectorial del parasito T. cruzi en la provincia de Loja: techo de teja 92.7%, paredes de adobe 77.8%, y pisos de tierra 81.3% (12). En este contexto, se requiere acciones tendientes a la difusión en la población, sobre las condiciones adecuadas que debe reunir una vivienda para ser segura respecto del alojamiento del Triatomino en la estructura de las casas y otras medidas preventivas lo cual puede ser motivo de un estudio sobre el impacto de la intervención en la población de vectores en la zona. Cabe recalcar también la necesidad de determinar si es que los Triatomos de la zona son portadores de T. cruzi, lo que sería una información de interés relevante en el estudio epidemiológico del Chagas, aún de mayor relevancia que cualquier factor de riesgo por obvias razones. Cerca de 15 especies de triatominos (Reduviidae) vectores que producen la enfermedad de Chagas- se han registrado en 17 de 22 provincias del Ecuador, lo que nos convierte en un país endémico. Es alarmante saber que gran presencia de especies de triatominos se han detectado solo en la provincia de Loja, estos casos se hallan en comunidades como “Pindo Alto” y “Jacapo”, pertenecientes al cantón Calvas; y, Bramaderos, Playas y Naranjo Dulce, del cantón Paltas. Aquí las viviendas están construidas con paredes de adobe y techos de teja, ambiente propicio para que este vector prolifere y se expanda peligrosamente. En una sola casa puede existir una tasa de infestación de 35%; de esta ocupan (0,7%) Panstrongylus chinai, (0,7%) Panstrongylus rufotuberculatus, (27%) Rhodnius ecuadoriensis y (7%) Triatoma carrioni. Los insectos adultos y las ninfas de R. ecuadoriensis y T. carrioni, se encuentran en las zonas intra y peridomiciliar (13,14,15). Uno de los factores que podría estar protegiendo a esta comunidad es el uso de toldo al dormir, el cual predomina en un 69% de las viviendas. El manual de prevención y control de enfermedades transmitidas por vectores ETV (2009), narra que “para llegar al hombre dormido el insecto suele demostrar mucha astucia; por eso cuando se procure proteger Centro de Biotecnología pp 66 – 71

de su ataque con mosquitero, conviene meter los extremos de este debajo del colchón, pues el insecto procurará encontrar cualquier lugar descuidado para penetrar. Además el mosquitero deberá colocarse de tal manera que al dormir, los brazos y las piernas no se pongan en contacto con el tul, a través de la cual saben picar” (16). Respecto al análisis estadístico de los diferentes parámetros se encontró correlación estadística entre la picadura previa por un Triatomo y los niveles séricos elevados de IgM e IgG anti-T. cruzi p Value 0.0001 y un r2 de 0.3279 que a pesar de ser bajo, es significativo. Además, el suero positivo, provino de un paciente cuya vivienda presentaba un gran número de factores de riesgo para picaduras, como ya se mencionó anteriormente. Resta decir que se requiere desarrollar estudios serios en los que participe un número significativo de habitantes, este trabajo tiene que tener el apoyo de instituciones gubernamentales como el Instituto Nacional de Salud Pública, INSPI; para plantear medidas preventivas y diagnosticar el real impacto del mal de Chagas en la población lojana. Conclusiones De los resultados obtenidos en la identificación de anticuerpos contra Tripanosoma cruzi mediante la técnica de ELISA a los pobladores del Barrio “La Extensa”, cantón Catamayo, se determinó positividad en un 0.8% del total de 123 muestras recolectadas. Entre los factores de riesgo encontrados tenemos que un 28% (12 casas) de esta comunidad posee paredes de adobe, el techo de teja un 90% (38 casas), el piso de tierra 55% (23 casas), el 31% de las personas (13 casas) no duerme con toldo, alrededor de un 2% (3 personas) afirman que en algún momento de sus vidas han evidenciado picaduras por parte de este vector. De todas las correlaciones que se hicieron entre los pacientes que presentaron niveles ISSN: 1390-7573


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 71 Guerrero et al. (2015); TRANSMISIÓN VECTORIAL DE Trypanosoma cruzi EN POBLADORES DEL BARRIO “LA EXTENSA”, CATAMAYO

altos de IgG e IgM antiTripanosoma cruzi, todas las asociaciones estadísticas fueron no significantes, excepto la correlación entre niveles altos de Inmunoglobulinas y picaduras previas por alguna especie de Triatomino. Referencias Bibliográficas Amunárriz, M. 2010. Seroprevalencia de la enfermedad de Chagas en el cantón Aguarico, Amazonía ecuatoriana. Rev Panam Salud Publica, 28 (1): 26. Black, C. Ocaña, S. Riner. Costales, J. Lascano, M. Grijalva, J. 2007. Household risk factors for Trypanosoma cruzi seropositivity in two Geographic regions of Ecuador. J. Parasitol., 93 (1): 13. Brenière, S. F., Salas, R., Buitrago, R., Brémond, P., Sosa, V., Bosseno, M.-F., Barnabé, C. 2013. Wild Populations of Triatoma infestans are Highly Connected to Intra-Peridomestic Conspecific Populations in the Bolivian Andes. PLoS ONE, 8(11), e80786. doi:10.1371/journal. pone.0080786 Chang, C. 2008. Equidad para Atención de la Salud: Enfermedades Postergadas en Poblaciones Olvidadas. OPS- RIMSA 15 (6.11): 7. Coura J., Junqueira, A., Fernándes O., Valente A., Miles M. 2002. Emerging Chagas Disease in the Amazonian Brazil, Trend. Parasitol 18: 171-6. Grijalva, M. 2009. High Household Infestation Rates by Synanthropic Vectors of Chagas Disease in Southern Ecuador. Journal Medicine Entomologic 42 (1): 68. Manual de prevención y control de enfermedades transmitidas por vectores ETV. 2009. Programa de saneamiento ambiental y zoonosis. Publicación Nº2. 80 pp.

de la Enfermedad de Chagas. Santiago-Chile. p. 7. Ministerio de Salud Pública de la Argentina. Revista Argentina de Salud Pública. 2012. Jornada Científica por el 50º Aniversario del Programa Nacional de Chagas e Instituto Nacional de Parasitología ¨Dr. Mario Fatala Chaben¨. Argentina. pp. 13. Miranda, L. 2011. Miocarditis Linfocítica por Tripanosoma: reporte de un caso. Rev. MedLeg 29 (1): 120-121. Nóbrega A., García M., Tatto E., Obara M., Costa E., Sobel J. 2009. Oral Transmission in Chagas Disease by consumption of acai palm fruit, Brazil Emerg.Infect. Dis.; 15: 653. Ocaña, S. 2010. Sex subdivision, and Domestic Dispersal of Trypanosoma cruzi Lineage I in Southern Ecuador. PLoS Negl Trop Rev, 4 (12): 3. Ocaña, S. 2011. La transmisión de la enfermedad de Chagas en Loja: la respuesta escondida en la genética de T. cruzi. Rev. Nuestra Ciencia, 13 (1): 25. República de Honduras Secretaría de Salud, Programa Nacional de Chagas. 2010. La prevención y control de la enfermedad de Chagas es responsabilidad de todos y todas. pp. 6-7. Reyes M. 2011 ¿Qué ha pasado en Venezuela cuando el ambiente urbano invade el hábitat natural de los triatominos vectores de la Enfermedad de Chagas?, VITAE Academia biomedica digital, Facultad de MedicinaUniversidad Central de Venezuela, Nº47: 1-8. Toso, A. 2011. Transmisión de la enfermedad de Chagas por vía oral. Rev Med Chile, 139 (8): 264.

Ministerio de Salud Pública de Chile. 2010. Guía de Diagnóstico, Tratamiento y Prevención ISSN: 1390-7573

Centro de Biotecnología pp 66 – 71


72 Centro de Biotecnología, Vol. 4 Nro. 1. 2015

INSTRUCCIONES PARA LOS AUTORES Los manuscritos originales serán enviados, vía correo electrónico al Editor Responsable de la Revista Centro de Biotecnología (titoflaco@yahoo.com). El formato para la escritura de los artículos será en el editor de texto Microsoft Word, letra Arial 12 puntos normal e interlineado 1.15 y párrafos justificados. La extensión de los artículos será de 15 páginas para artículos de investigación y 20 páginas para los artículos de revisión, informes y reportes, incluyendo imágenes, cuadros y figuras. Una vez recibido el manuscrito se realizará acuse de recibo vía electrónica por parte del Editor Responsable. El arbitraje se basará en el sistema doble a ciegas, el cual consiste en la evaluación del manuscrito por dos árbitros nacionales o extranjeros altamente calificados. Terminado el proceso de arbitraje se dará a conocer a los autores el resultado de la valoración del manuscrito. Estructura de los manuscritos Título: Debe identificar al trabajo que se presenta en forma precisa, breve y reflejar el contenido del artículo en un máximo de 15 palabras. No debe contener abreviaturas, formulas, jerga ni siglas. Autor (es) y afiliación: Se escribirán los nombres y apellidos de los autores completos, excluyéndose los grados académicos o científicos. Si hay dos o más autores, se separan por “,” y el nombre del segundo o del último autor, respectivamente, debe estar separado por la letra “y”. Debe mencionarse la institución, país y dirección electrónica de todos los autores. Se debe marcar el autor para correspondencia con el símbolo “*”, indicando después de los autores el respectivo superíndice. Resumen y Abstract: Cada artículo contará con un resumen en idioma español y un Abastract en idioma inglés. Estos deben hacerse en forma de bloque y No deben exceder las 250 palabras. Palabras claves y Keywords: Al final del Resumen y del Abstract, seguido de un espacio, debe indicarse las Palabras Claves o Keywords respectivamente. Estas no deben exceder de 7 palabras únicas, evitando que estén contenidas en el título. Se dispondrán alfabéticamente. Las partes del manuscrito para artículos de investigación estarán conformadas por: Introducción, Materiales y métodos, Resultados, Discusión o Resultados y discusión, Conclusiones, Agradecimientos y Referencias bibliográficas. Para artículos de revisión, informes y reportes estarán conformadas por: Introducción y encabezados definidos y organizados por los autores de acuerdo a los objetivos y contenidos del trabajo. Requisitos a tener en cuenta para redactar las Referencias bibliográficas Las Referencias bibliográficas es la lista de publicaciones a las cuales se hace referencia por medio de citas en el texto del manuscrito. Se utilizará el estilo APA 16th de los gestores de referencias bibliográficas EndNote,


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 73

Mendeley, RefWorks o Zotero o del editor de texto Microsoft Word. Se recomienda cotejar todas las partes de cada referencia contra la publicación original antes de someter el manuscrito a arbitraje. Todas las referencias deben estar ubicadas alfabéticamente. Usar únicamente obras importantes y publicadas; las referencias a datos no publicados, obras en prensa, resúmenes, tesis y otros materiales de importancia secundaria no se debe abarrotar la sección de literatura citada. A continuación, se relacionan las normas y ejemplos para la ubicación de diferentes referencias bibliográficas según los tipos de publicaciones. a) Referencias de artículos en revistas. Los nombres de revistas deben indicarse siempre completos, con cada palabra del nombre comenzando con una letra mayúscula, y mencionando el volumen (y el número entre paréntesis) y rango de páginas para cada referencia. Para revistas no indexadas es necesario agregar el país de publicación en paréntesis antes del volumen. Aguirre Z., R. Linares y LP. Kvist. 2006. Especies leñosas y formaciones vegetales en los bosques secos estacionalmente secos de Ecuador y Perú. Arnoldoa 13(2): 324-346. Boy J., C Valarezo and W. Wilcke. 2008. Water flow paths in soil control element exports in an Andean tropical montane forest. European Journal of Soil Science 59, 1209 – 1227. Aguirre N., S. Günter y B. Stimm. 2007. Mejoramiento de la propagación de especies forestales nativas del bosque montano en el Sur del Ecuador. Revista Universitaria (Ecuador) Vol 8:57 - 66. b) Referencias de libros. Los libros, capítulos de libro y tesis deben incluir la ciudad de publicación y el país. Ulloa C. y P.M. Jørgensen. 1995. Árboles y arbustos de los andes del Ecuador. Editorial Abya-Ayala. Quito, Ecuador. 264 p. Van Voss O., N. Aguirre y R. Hofstede. 2001. Sistemas Forestales Integrales para la sierra del Ecuador. Proyecto EcoPar-Universidad de Ámsterdam. Quito, Ecuador. 120 p. c) Referencias de capítulos de libros. Aguirre N. 2002. La Luma (Pouterialucuma) potencial producto forestal no maderable de los Andes ecuatorianos. Pp. 239-349. En: Aguirre Z., E. Madsen, H. Cotton y H. Balslev (Eds) Botánica Austroecuatoriana: Estudios sobre los recursos vegetales en las provincias de El Oro, Loja y Zamora Chinchipe. Loja, Ecuador. d) Referencias de tesis. Eguiguren P. y T. Ojeda. 2009. Línea base de la diversidad florística del Parque Nacional Podocarpus. Tesis Ing. Forestal. Carrera de Ingeniería Forestal, Universidad Nacional de Loja. Ecuador. 120 p.


74 Centro de Biotecnología, Vol. 4 Nro. 1. 2015

e) Referencias de artículos en prensa. Aronson J., N. Aguirre y J. Muñoz (en prensa). Teaching Ecological Restoration in Ecuador. Restoration Ecology. f) Referencias de revistas electrónicas. Al final de la referencia incluir “en línea” u “online” para manuscritos en español e inglés, respectivamente, el URL completo y la fecha de acceso entre paréntesis. Cortez R. 2004. La dinámica de fluidos y su rol en el estudio de fenómenos biológicos. Ciencia al Día Internacional 5: 14 pp. (en línea) URL: http://www.ciencia.cl/CienciaAlDia/ volumen5/numero2/articulos/articulo2.html (consultado febrero 2, 2009). Devall M. 2009. Efectos del cambio climático mundial en los árboles y arbustos raros. Revista UNASYLVA 60: 15 pp. (en línea) URL: http://www.fao.org (Consultado julio 1, 2009). (g) Referencias de URLs para documentos o información electrónica. Tratar de utilizar únicamente URLs oficiales mantenidos por organizaciones reconocidas y con contenidos relevantes de naturaleza científica y académica. IUCN (2008) The IUCN red list of threatened species 2008. International Union for Conservation of Nature and Natural Resources. Disponible en: http://www.iucnredlist.org/ (accessed June 8, 2009). Gómez A., J. Torres 2008. Adaptación al cambio climático: De los fríos y los calores en los Andes. Lima, Perú. 154 p. Disponible en: www.crid.org.cr (Consultado junio 17, 2009).


Centro de Biotecnología, Vol. 4 Nro. 1. 2015 75

SUSCRIPCIONES Para hacer efectiva su suscripción a la Revista Centro de Biotecnología, debe comunicarse a:

Comunicación Institucional Universidad Nacional de Loja Ciudad Universitaria. Pío Jaramillo Alvarado, Sector La Argelia Teléfono: (593) 07 2547252 ext. 154 Email: revistabiotecnologia@unl.edu.ec Luego de enviar sus datos y realizar el pago, envíe el siguiente cupón a la Dirección anterior por correo postal. Cupón de suscripción

Favor de remitir a vuelta de correo postal los números: De la Revista Centro de Biotecnología del año: Nombre del registro inscrito:

Dirección del registro inscrito para envío de correspondencia:

Para lo cual envío el valor del:______________ solicitado para la suscripción Mediante: Cheque_______ Efectivo_______ Otros_______ Firma del suscriptor___________________________

Fecha________________


Revista de Biotecnologia  

Revista científica sobre temas de biotencología de plantas, animales y microorganismos, cuyo objetivo es dar un enfoque multidisciplinario e...

Revista de Biotecnologia  

Revista científica sobre temas de biotencología de plantas, animales y microorganismos, cuyo objetivo es dar un enfoque multidisciplinario e...

Advertisement