FALL 2012, Issue No. 28
UCLA
FROM THE DEAN
W
elcome to the new UCLA Engineer magazine. It has a fresh and inviting design that I think you will enjoy. While the look may be new, our emphasis on highlighting UCLA engineers at the leading edge of innovation has not changed. UCLA engineers are making a big impact. In fact, UCLA Engineering was fourth in the world in research impact over the past 10 years in recent rankings, based on citation index, by Microsoft Academic Search. Also, over the past few months, our faculty and students have received the most prestigious of recognitions, such as the ACM Turing Award; the EPA’s Presidential Green Chemistry Challenge Award; the Presidential Early Career Award for Scientists and Engineers (PECASE); and the Top Innovation of 2011 from The Scientist magazine, just to name a few. This issue of UCLA Engineer features stories on faculty and alumni who themselves are leading revolutionary changes in technology. Many of you may be familiar with the school’s namesake, Henry Samueli, Co-Founder, Chairman and CTO of
Broadcom, but you may not know much about how he got his start here at UCLA as a leader in the communications semiconductor industry. One of our young faculty members, Dino Di Carlo of Bioengineering, has been developing microfluidic technologies with great potential for applications in the medical and life sciences, such as diagnosing diseases earlier. The National Science Foundation awarded a highly competitive Engineering Research Center (ERC) to the school. The multi-million dollar ERC will usher in a paradigm shift in nanoscale electromagnetic devices. This is wonderful time to be a part of the UCLA Henry Samueli School of Engineering and Applied Science. Sincerely,
Vijay K. Dhir Dean
DEAN
DEPARTMENT CHAIRS
Jenn-Ming Yang
HauChee Chung
Vijay K. Dhir
Benjamin Wu
Materials Science and Engineering
Graphic Designer
Bioengineering
Tsu-Chin Tsao
Contributors
James C. Liao
Mechanical and Aerospace Engineering
Katharine Gammon Wileen Wong Kromhout Jennifer Marcus
ASSOCIATE DEANS
Richard D. Wesel Academic and Student Affairs
Jane P. Chang Research and Physical Resources ASSISTANT DEAN
Mary Okino Chief Financial Officer
Chemical and Biomolecular Engineering Civil and Environmental Engineering
EXTERNAL AFFAIRS COMMUNICATIONS
Jens Palsberg
Executive Director
Jonathan P. Stewart
Computer Science
M.C. Frank Chang Electrical Engineering
Sheila Bergman Matthew Chin Communications Manager and Writer
OFFICE OF EXTERNAL AFFAIRS
(310) 206-0678 www.engineer.ucla.edu uclaengineering@support.ucla.edu
UCLA FA LL 201 2 | Issue No. 28
02 | Demographics 03 | Year in Review 04 | Breakthroughs 20 | School news 24 | Alumni news 34 | 2011-2012 Report On the cover: Clockwise from top right Bahram Jalali, Electrical Engineering, conducts photonics research for biomedical applications. http://www.photonics.ucla.edu/ James Liao, Chemical and Biomolecular Engineering, develops next-generation biofuels. http://www.seas.ucla.edu/~liaoj/ John Wallace, Civil and Environmental Engineering, evaluates structural performance in earthquakes. http://nees.ucla.edu/wallace/ Yang Yang, Materials Science and Engineering, develops new classes of photovoltaic cells. http://yylab.seas.ucla.edu/index.aspx Mario Gerla, Computer Science, is developing vehicular networks. http://nrlweb.cs.ucla.edu/ Daniel Kamei, Bioengineering, explores new methods that deliver drugs to cells. http://kameilab.seas.ucla.edu/ Richard Wirz, Mechanical and Aerospace Engineering, investigates plasma processes in advanced space propulsion systems. http://www.wirz.seas.ucla.edu/
8 From Professor to Leader of Industry, With A Little Help From His Friends — Henry Samueli ’75, MS ’76, PhD ’80
12 Dean Dhir Boldly Leads the School — Vijay K. Dhir
16 High-Speed, High-Volume, High-Precision — Dino Di Carlo
ALUMNI
Demographics Total: 29,785 through Spring 2012
WA, OR, AK, ID, MT, WY 993 Northern CA 5,579
Southern CA 18,032
NV, AZ, UT, CO, NM 1,129
VT, NH, RI, MA, ME 264
ND, SD, MN, IA, WI, IL 273
TX,OK, KS, MO, NE, AR 583
PA, NY, NJ, CT 614 VA, MD, DC, WV, DE 507
MI, IN, OH, KY 268 MS, AL, TN, GA, FL, SC, NC, LA 608
HI 167
UCLA ENGINEER |
2
Canada 31 Europe 148
Asia 477 Middle East and Africa 57
South and Central America 51 Australia and New Zealand 4
UCLA Henry Samueli School of Engineering and Applied Science
YEAR IN REVIEW
30,454,342
$
GIFTS TO UCLA ENGINEERING
GIFTS BY PURPOSE Student Support Faculty
14%
4%
Program Research
Capital Projects Discretionary
22%
3,311 924 921 5,156
23%
Undergraduate
37%
Doctoral
Total
ENROLLMENT 2011-2012
157 24 PATENTS AWARDED
740 529 156 1,425 B.S. M.S. Ph.D. Total DEGREES AWARDED (2012 PROJECTIONS)
PUBLICATIONS UCLA Engineering faculty published 9 books, 33 chapters, 597 journal articles and 434 conference proceedings.
EDITORIAL POSITIONS UCLA Engineering faculty held 39 editorships, 62 associate editorships and 6 guest editorships.
RESEARCH EXPENDITURES
$93,281,730
UCLA ENGINEER |
3
FULL-TIME FACULTY
Master's
ULTRA-FAST CAMERA DETECTS ROGUE CANCER CELLS BAHRAM JALALI, Northrop Grumman Endowed Opto-Electronic Chair in Electrical Engineering DINO DI CARLO, Associate Professor of Bioengineering KEISUKE GODA, Professor of Physical Chemistry, University of Tokyo
T
he ability to distinguish and isolate rare cells from among a large population of assorted cells has become increasingly important for the early detection of disease and for monitoring disease treatments. An interdisciplinary research team with expertise in optics and high-speed electronics, microfluidics, and biotechnology, has developed a high-throughput flow-through optical microscope with the ability to detect rare cells with sensitivity of one part per million in real time. The new blood-screening technology boasts a throughput of 100,000 cells per second, approximately 100 times higher than conventional imaging-based blood analyzers.  n www.engineer.ucla.edu/cancer-detecting-camera
By Matthew Chin and Wileen Wong Kromhout
BREAKTHROUGHS
Free Layer Pinned Layer www.engineer.ucla.edu/nanoscale-oscillators
X
PEDRAM KHALILI, Project Manager, UCLA-DARPA research programs in STT-RAM and non-volatile logic
A
team of researchers has created the most powerful high-performance nanoscale microwave oscillators in the world, a development that could lead to cheaper, more energy-efficient mobile communication devices that deliver much better signal quality. Cell phones and WiFi–enabled tablets all use microwave oscillators, tiny devices that generate the electrical signals used in communications. In a cell phone, the transmitter and receiver circuits contain oscillators that produce radio-frequency signals, which are then converted by the phone’s antenna into incoming and outgoing electromagnetic waves. The UCLA-developed oscillators utilize the spin of an electron, as in the case of magnetism, and carry several orders-of-magnitude advantages over the oscillators in use today. n
ELEAZAR ESKIN, Associate Professor of Computer Science JOHN NOVEMBRE, Associate Professor of Ecology and Evolutionary Biology
U
nderstanding the genetic diversity within and between populations has important implications for studies of human disease and evolution. A team of researchers at UCLA and Israel’s Tel Aviv University has developed an innovative approach to the study of genetic diversity called spatial ancestry analysis (SPA), which allows for the modeling of genetic variation in two- or three-dimensional space. With SPA, researchers can model the spatial distribution of each genetic variant by assigning a genetic variant’s frequency as a continuous function in geographic space. By doing this, they show that the explicit modeling of the genetic variant frequency — the proportion of individuals who carry a specific variant — allows individuals to be localized on a world map on the basis of their genetic information alone. n
NEW GENETIC METHOD TO PINPOINT INDIVIDUALS’ GEOGRAPHIC ORIGIN
5
Hext
KANG L. WANG, Raytheon Professor of Electrical Engineering
www.engineer.ucla.edu/geographic-origin
UCLA ENGINEER |
WORLD’S MOST POWERFUL NANOSCALE MICROWAVE OSCILLATORS
BREAKTHROUGHS
HIGHLY TRANSPARENT SOLAR CELLS CREATED FOR WINDOWS THAT GENERATE ELECTRICITY YANG YANG, Carol and Lawrence E. Tannas, Jr., Endowed Chair in Engineering PAUL S. WEISS, Fred Kavli Chair in NanoSystems Sciences, CNSI Director, and Department of Chemistry and Biochemistry
UCLA
researchers have developed a new transparent solar cell that is an advance toward giving windows in homes and other buildings the ability to generate electricity while still allowing people to see outside. The new kind of polymer solar cell (PSC) produces energy by absorbing mainly infrared light, not visible light, making the cells nearly 70% transparent to the human eye. The device is made from a photoactive plastic that converts infrared light into an electrical current.  n www.engineer.ucla.edu/solar-window
GAME ON! USING ONLINE ELECTRICITY CAN CROWD-SOURCING TO GENERATE DIAGNOSE MALARIA ALTERNATIVE FUEL JAMES C. LIAO, Ralph M. Parsons Foundation Chair in Chemical Engineering
I
www.engineer.ucla.edu/malaria-gaming
AYDOGAN OZCAN, Associate Professor of Electrical Engineering and Bioengineering DR. KARIN NIELSEN, Professor of Infectious Diseases, Department of Pediatrics, Geffen School of Medicine
magine being able to use electricity to power your car — even if it’s not an electric vehicle. UCLA Engineering researchers have for the first time demonstrated a method for converting carbon dioxide into liquid fuel isobutanol using electricity. Today, electrical energy generated by various methods is still difficult to store efficiently. Chemical batteries, hydraulic pumping and water splitting suffer from low energydensity storage or incompatibility with current transportation infrastructure. The team reports a method for storing electrical energy as chemical energy in higher alcohols, which can be used as liquid transportation fuels. n
www.engineer.ucla.edu/electricity-fuel
UCLA ENGINEER |
orking on the assumption that large groups of public non-experts can be trained to recognize infectious diseases with the accuracy of trained pathologists, researchers from the Henry Samueli School of Engineering and Applied Science and the David Geffen School of Medicine at UCLA have created a crowd-sourced online gaming system in which players distinguish malaria-infected red blood cells from healthy ones by viewing digital images obtained from microscopes. The team found that a small group of non-experts playing the game was collectively able to diagnosis malariainfected red blood cells with an accuracy that was within 1.25 percent of the diagnostic decisions made by a trained medical professional. n
7
W
Photo: Walter Urie
8 UCLA ENGINEER |
0101010100001101001100010000010010000001000101011011100110011101101001011011100110010101100101011100100110100101101110
FROM PROFESSOR TO LEADER OF INDUSTRY, WITH A LITTLE HELP FROM HIS FRIENDS
By Katharine Gammon
“One of Henry’s strongest points is he could identify and invest in talent without wanting short-term returns.” PROFESSOR ASAD ABIDI
T
oday, Henry Samueli is a household name in Southern
California. But twenty years ago, he was a professor at UCLA working to forge a new kind of research collaboration with his colleagues. Together with three other professors,
of how UCLA Engineering research helped forge a new communications industry.
001100111001000000100100001100101011011100111001001111001001000000101001101100001
UCLA ENGINEER |
eventually became part of Broadcom. This is the story
9
Samueli embarked on exciting new research – which
Broadcom grew to be one of the leading semiconductor companies, and also supplies the WiFi+Bluetooth combo chip for Apple iPhone 3GS and iPod touch second generation.
H
UCLA ENGINEER |
10
p (top) Samueli received the Marconi Prize, awarded in June 2012. And he was awarded the prestigious UCLA Medal in 2010.
enry Samueli had an epiphany in engineering class. He was a senior at UCLA, studying electrical engineering and signed up for a course taught by Alan Willson – the first course ever at UCLA in digital signal processing in electrical engineering. “That class set me on the path of that field, and it was a major milestone in my educational career,” Samueli said with a smile. “I had to pick a focus, and when I took that class from Professor Willson I decided. It was a brand new field, and it just seemed to have so much potential.” When he finished his Ph.D. in 1980, Samueli went to work for TRW, Inc. in Redondo Beach. There, he worked to develop military satellite and radio communications systems, and in particular, a high-speed digital radio modem for the Army. He says the experience at TRW prepared him to work closely with people across different disciplines. Along the way, he had been teaching classes at different colleges, and in 1985, he was offered a full-time position back at UCLA. When he returned, he started talking to other young faculty colleagues about proposals for the Defense Advanced Research Projects Agency. “Faculty typically think of their narrow fields, it’s not until you get to industry that people think of putting all those parts together,” he says – but his colleagues were willing to collaborate on new technologies. Samueli’s colleagues Together with electrical engineering professors Greg Pottie, Asad say that he has great Abidi, and Yahya Rahmat-Samii, Samueli created a proposal to the first all-CMOS (complementary metal-oxide semi-conductor) radio with skills as a manager as both the analog and digital in CMOS on a single chip. The communicawell as a thinker. tions system research was revolutionary in a few different ways. The team Samueli assembled had unique talents: Samueli was in charge of the digital signal processing, Abidi focused on the analog portion, Rahmat-Samii took care of the antennas, and Pottie was in charge of the systems analysis. Outside of the unique talents of the team, the project was pushing boundaries. “No one thought it could be done in one chip,” says Pottie. “But Henry realized that if you made the analog portion low-power enough and structure it correctly, it could stay on one chip, radically reducing the cost.”
FACTS & FIGURES
99.98% 11,000 of Internet data traffic crosses a Broadcom chip.
— number of Broadcom employees in 15 countries
In 1995, Samueli took a leave from UCLA, however he still holds a faculty appointment in the Department of Electrical Engineering. Broadcom's first project was to design the world’s first chips for digital interactive cable television, followed by the world’s first single-chip cable modem. Samueli’s colleagues say that he is a skilled manager as well as a long-range thinker. “One of Henry’s strongest points is that he can identify and invest in talent without wanting short-term returns,” says Abidi. Broadcom grew to be one of the world’s leading semiconductor companies, and currently supplies the WiFi+Bluetooth combo chip for Apple’s iPhone, iPad and iPod Touch devices. Among the accolades Samueli has received is the Marconi Society Prize and Fellowship, awarded in June 2012. He was also elected a Fellow of the Institute of Electrical and Electronics Engineers in 2000, a member of the National Academy of Engineering in 2003, and a Fellow of the American Academy of Arts and Sciences in 2004. No matter how far the company goes, Samueli, with characteristic quiet coolness, gives credit back to the team effort at UCLA Engineering. “Our research was one of the more successful, early examples of broad collaborative multi-disciplinary work in the school, and it set a model for the future.” n
UCLA ENGINEER |
“We were merging analog and digital, which had traditionally hard lines between them,” recalls Abidi. “When we first proposed that we would build radios on the same chip as digital stuff, companies like Motorola laughed in our faces.” Despite the hurdles, the project proved to be a great success, and some interesting research was produced. “One of the most interesting outcomes was that we invented the concept of back-mounted antennas for handsets — not like typical monopoles that sticks out,” says Rahmat-Samii. Later on, those back-mounted antennas became internal, which are now the norm in any cell phone. As the project continued, research papers were published, and the laughter turned to curiosity. “We didn’t even worry about patents at that time, we just published our work and put it in the public domain. We were so far ahead of everyone else in the field,” says Samueli, who ended up publishing more than 100 research papers during his time in the department. “Out of those publications, we started getting a lot of inquiries from companies who loved our results and wanted us to commercialize the technology,” he says. Together with his graduate student Henry Nicholas, Samueli formed Broadcom in 1991. They first worked out of a spare bedroom in co-founder Henry Nicholas’s house, and then from 1,200-square-foot offices on Wilshire Boulevard.
11
SOURCE: Broadcom
Dean Dhir Boldly Leads
By Katharine Gammon
In addition to building a bigger and better engineering school, Dhir has looked beyond the traditional walls of the university to enhance learning and build a community.
I
n his nearly ten years as Dean, Vijay K. Dhir has tirelessly worked to improve the scale and scope of the UCLA Henry Samueli School of Engineering and Applied Science. He has raised funds, recruited superb faculty, and grown the school’s profile domestically and overseas – and he has done it all while continuing his own high-level research on boiling in space. A gentle smile covers the dean’s face when he talks about the engineering school, and it’s clear that Dean Dhir has as much love for his administrative job as he does for his research.
UCLA ENGINEER |
13
Photo: Walter Urie
V
ijay Dhir found his love for engineering in school in India, where he did his undergraduate and masters’ degrees. He first arrived at UCLA in 1974, after receiving a doctorate in mechanical engineering at the University of Kentucky. During the energy crisis, he worked on ways to convert coal into synthetic gas. Then, as a young UCLA assistant professor, Dhir did an energy-source switch and began researching nuclear safety. “It was brand-new, so I learned about nuclear engineering while I was teaching courses in it,” he says with a laugh. “Interestingly, I have been involved in the energy business my whole career.” Dhir has made a profound impact since taking the reins of UCLA Engineering in 2003. His first effort was to give “My most cherished dream the school a more multidisciplinary focus, and over is for the school to be ranked at the very top.” says Dhir. the past 10 years the school has won 10 competitive research centers from the federal government and private industry to spur research and development on emerging technologies. The centers also bring in millions of dollars in research funding each year. In addition to the funds, the physical space has also expanded under Dhir’s watch: the Engineering V building has opened, allowing space for the new Bioengineering Department and the Materials
Dean Dhir has inspired an entrepreneurial spirit within UCLA Engineering that is benefiting both the School and the University. — DWIGHT STREIT, ITA DIRECTOR
Science and Engineering Department; and Engineering VI is about to break ground. With the new physical space comes superb young faculty to fill it. Under Dhir’s leadership, 60 new faculty have been added, including some of the best junior faculty anywhere. “Under Dean Dhir's leadership, we have recruited a group of distinguished young faculty who have won wide and high recognitions both domestically and internationally,” said Frank Chang, chair of the Electrical Engineering Department. “The young faculty members have already become global leaders in each of their own research areas.” Dhir has also worked hard to raise the profile and resource base of the school. In 2003, when he became dean, US News and World Report ranked the graduate school 22nd in the nation. Last year it garnered the 16th spot (9th among public universities). The school’s extramural funding has swelled from $54.9 million per year in 2001-2002 to $105.8 million in 2010-2011. In Microsoft’s Academic Search H-index, which measures both the productivity and impact of published work, UCLA Engineering is currently ranked fourth in the world. “My most cherished dream for the school is to be ranked at the very top.” says Dhir. “We have accomplished a lot in the last ten years, but there is more we still need to do.” Dhir has taken strides to improve all levels of education, making curriculum changes that require students to broaden their experience and technical breadth by taking a three-course sequence in another engineering field outside their major. In addition to building a bigger and better engineering school, Dhir has looked beyond the traditional walls of the university to enhance learning, and build a community.
Under Dean Dhir's leadership, we have recruited a group of distinguished young faculty who have won wide and high recognitions both domestically and internationally.
and education, and recruiting faculty, Dhir continues to do research on the fundamental process of boiling. “I started as a researcher and teacher, so that’s my first love in some sense,” he said, adding that it’s still exciting to discover new information and knowledge. During his near-40 years at UCLA, he has published more than 300 papers and has advised more than 40 doctoral students and 50 master’s students. And, Dhir has continued his administrative and academic duties, he has continued to serve on a number of committees on behalf of the National Research Council. Dhir’s research has gone far – his lab’s experiment on heat transfer and boiling traveled to the International Space Station in 2011. As it turns out, bubbles behave very differently under microgravity conditions – something that will be important as manned missions venture further into space. A mission to Mars, which would take six months one-way, would need to use a nuclear reactor to power the ship. That reactor would need to boil water and condense it – and Dhir has researched the dynamics of bubbles on Earth and in microgravity. From space and back, Dean Vijay K. Dhir creates excellence wherever he goes. n
p Two bubble merger under microgravity conditions. The experiment on boiling heat transfer was carried aboard the International Space Station in 2011.
UCLA ENGINEER |
In 2007, he established the Institute for Technology Advancement – an off-campus organization to incubate new technologies that could be commercialized. According to Dhir, four companies already have come out of the ITA, and there are four more in the pipeline. Dwight Streit, the ITA’s director, says that Dhir was instrumental in creating the opportunities there. "Dean Dhir has inspired an entrepreneurial spirit within UCLA Engineering that is benefiting both the school and the university,” he said. The community-building effort goes beyond industry and into the next generation of engineers. “Dean Dhir has initiated a number of outreach efforts to attract a diverse range of students into engineering,” said mechanical and aerospace engineering professor Adrienne Lavine. In three separate newlycreated programs, UCLA engineering students tutor local high school students online, faculty host high school students in their research labs in the summer, and this summer a Tech Camp was launched in the school’s new Creativity Center. In addition, the school has created an online engineering masters’ program, with more than 250 students enrolled. Students can attend lectures, work with teaching assistants and discuss assignments all online. Dhir plans to take the program nationally and internationally in the future. Even while fundraising for the school, creating a vision for multi-disciplinary research
15
— PROFESSOR FRANK CHANG
GGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCGATGCGTCCACAACGCTACAAATGTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCG
Bioengineering professor Dino Di Carlo works to make the tools of biology and medicine faster, automated and more accurate.
High-Speed, High-Volume, High-Precision By Matthew Chin
I
t’s a common theme in science fiction – a scientist peers into a microscope
at the fluid-filled slide, adjusts the focus, moves the slide, slowly fine-tunes the focus until the targeted cell comes into view, and then… Eureka! They found what they were looking for, whether it was good, bad, or unexpected.
care will be done. These analyses will be automated at speeds of tens of thousands of cells per second, and with precision accurate enough to find the earliest signs of disease in just a few of those cells.
UCLA ENGINEER |
Photo: Walter Urie
way of the future. Or at least not how most biological analyses and health
17
Of course, while this makes for an excellent cinematic shot, it’s not the
on cells in a fluid environment. Those bulky table-top microscopes are now replaced by silicon wafers, with precisely etched channels that speed biological fluids through. High-speed cameras and tracking software monitor thousands of cells per second watching for outliers – cells whose outward signs may reveal deeper problems, such as cancer. In one recent publication, Di Carlo and his students in the Biomicrofluidics Laboratory developed a new instrument that slams cells against a wall of fluid. Knowing how those cells respond following impact helps them identify ones that could be cancerous or identify other cell states. This platform could replace current technologies that use expensive chemical tags. But more than just engineering scientific tools, Di Carlo has made several scientific discoveries. In 2010, he and a colleague found that particles will self-assemble in a fluid, following similar patterns in nature from phospholipids to spiral galaxies. And earlier this year, Di Carlo looked at ways to construct
u L to R: Henry Tse, a post-doctoral fellow, Dino Di Carlo and Mahdokht Masaeli, a Ph.D. student.
Photo: Walter Urie
UCLA ENGINEER |
18
Leading the way is Dino Di Carlo, a UCLA associate professor of bioengineering, who is exploiting the physical characteristics of the micro-cellular environment to create and develop miniaturized systems for biological research and medical diagnostics. “In general, I think most of what has created the biggest impacts on society can be considered methods of Most of what has created automation,” Di Carlo said. the biggest impacts on “For example, automating information processing with society can be considered computers, automating methods of automation. transportation with cars, trains, and airplanes, and even automating communication with phones and smart cell phones. In our research group, we apply unique microscale physical effects towards the automation of diagnostics, life science research, and cellular engineering.” Think of a product assembly line’s quality control steps. Di Carlo’s research themes follow a similar principle in action, only operating
Looking forward, Di Carlo has several other areas he’s exploring. One area is exploring how microfluidic technologies may help guide cellular evolution.
10
million
The number of cells probed and analyzed mechanically to date
100,000 The number of cells that can be imaged and analyzed per second in Di Carlo's platform
19
these micro-channels to help particles selfassemble, and then use assembled particles themselves to create constructive wakes in the fluid. Both have applications for future microfluidic diagnostic device design. The great potential in his research has led to several prestigious recognitions for Di Carlo, who received tenure earlier this summer with a promotion to associate professor. These include a Packard Fellowship for Science and Engineering, from the David and Lucile Packard Foundation; a Young Faculty Award from the Defense Advanced Research Projects Agency; an Early Career Development award from the National Science Foundation; and a Young Investigator Award from the Office of Naval Research.
FAC TS & FIGURE S
UCLA ENGINEER |
p Focused fluorescent particles are separated based on inertial fluid dynamic effects.
As a young faculty member, Di Carlo has also enjoyed much success as a teacher and mentor to outstanding graduate and undergraduate students. UCLA Engineering’s two most recent Outstanding Bachelor’s of Science awardees both conducted research in his lab. Earlier this year, a five-member team of bioengineering seniors under his advisement took their capstone project into a national competition sponsored by the National Institutes of Health, and won in the diagnostic device category. The team’s winning platform screened patients’ urine samples for transitional cell carcinoma (TCC), a common form of bladder cancer. And his first Ph.D. graduate, Soojung Claire Hur, is currently at Harvard University as a junior fellow at the Rowland Institute. Looking forward, Di Carlo has several other areas he’s exploring. One area is exploring how microfluidic technologies may help guide cellular evolution. Beyond just controlling cells, the idea would be to understand the molecular and genetic basis for how cells behave. For example, how do cells travel through the body, or what is their durability against physical and chemical changes. Research in this area could eventually lead to insights on how evolved cell populations may themselves have physical characteristics that make them potential candidates for therapeutic applications. n ➝ To find out more about Di Carlo’s research: www.biomicrofluidics.com/
SCHOOL
News
UCLA ENGINEER |
20
Building robots that navigate mazes, or fine-tuning electronic musical devices that work in harmony – for a group of high school students from the greater Los Angeles area, those were just a few of the projects they completed at UCLA Engineering’s new Summer High School Tech Camp. Two of the four-week camps were held during the summer at the school’s new Creativity Center, a 5,000-square foot facility on the second floor of Boelter Hall. The new technology sandbox is a space meant for students to explore their imaginations. “The United States needs to increase the number of students entering into science, technology, engineering and mathematics (STEM) fields,” said Dean Vijay K. Dhir. “At UCLA Engineering, we are strongly committed to doing our part to let young students, especially those from underrepresented backgrounds, have an excellent experience building and testing their creations. We think our Tech Camps will enhance the education they receive through their course work in math and sciences.” While summer is reserved for tech camps, during the school year the Creativity Center will be home to several of UCLA Engineering’s student groups, providing much-needed space and access to tools and equipment. n ➝ To find out more about the camps, visit: www.esc.seas.ucla.edu u Tech Camp students demonstrated their robot that navigates a maze and performs tasks. The camp was held at the new Creativity Center.
Photos: Matthew Chin
TECH CAMPS DEBUT AT NEW STUDENT CREATIVITY CENTER
A new NSF-funded Engineering Research Center and the debut of Tech Camps are a few of the highlights for the past few months.
UCLA ENGINEER |
A multidisciplinary team of researchers from UCLA and other universities is poised to help turn science fiction into reality — in the form of some of the world's tiniest electromagnetic devices — thanks to a major grant from the National Science Foundation's Engineering Research Center (ERC) program. The multi-million dollar grant will fund a new center p TANMS researchers have used an electric field to headquartered at UCLA's Henry Samueli School of turn a magnetic field on (left) and off (right). Engineering and Applied Science. It will focus on research Credit: Ray C. J. Hsu, Mechanical and Aerospace Engineering aimed at developing highly efficient and powerful electromagnetic systems roughly the size of a biological cell — systems that can power a range of devices, from miniaturized consumer electronics and technologies important for national security to as-yet unimagined machines, like nanoscale submarines that can navigate through the human blood stream. Employing a fundamentally new approach to electromagnetic power at the nanoscale, researchers at the NSF-funded TANMS center (Translational Applications of Nanoscale Multiferroic Systems) are working to replace traditional wire-based electronics with a revolutionary technique that couples electricity and magnetism by using multiferroic materials, which can be magnetically switched "on" and "off" by an electric field. UCLA's partners in the new center include UC Berkeley, Cornell University, Switzerland's ETH Zurich and California State University, Northridge. "We believe this is an opportunity for a truly revolutionary change in miniaturized electromagnetic devices," said Greg Carman, director of the new center and a UCLA professor of mechanical and aerospace engineering. "If you combine all three of our application areas — memory, antennas and motors — it really opens the possibilities of what new platforms may become possible.” n ➝ The complete story is available online at: www.engineer.ucla.edu/TANMS-research-center
21
NEW ENGINEERING RESEARCH CENTER TO REVOLUTIONIZE NANOSCALE ELECTROMAGNETIC DEVICES
SCHOOL
Photos: Grad Images
News
2 3
1
5 6
UCLA ENGINEER |
22
4
2012 COMMENCEMENT 1 Dr. Wanda Austin, president and CEO of The Aerospace Corporation, delivers the commencement address to the Class of 2012. She encouraged the graduates to change the world; advocate for STEM education; and be ethical role models.
2 Engineering graduates at the 2012 commencement.
4 New graduates enter Drake Stadium, which was filled with family and friends.
3 Student speaker Melissa Erickson ’12, reflected on the unique experiences of UCLA engineering students, and how they are now ready for life’s next steps.
5 Graduates try to find family. 6 Graduate degree candidates. To view remarks from Austin and from Erickson: www.engineer.ucla.edu/commencement-2012
Photos: Todd Cheney (7 and 8), Incite Photography (9)
8
7
7 The 2012 Senior Class Campaign Committee presents Dean Dhir with their contribution at the annual Senior Class Dinner. Owen Lutje ’10 was the emcee for the evening. All funds raised went to improve wireless capability within Boelter Hall.
8 The 2012 Engineering Graduate Student Association (EGSA) coordinated the first E-Grad Campaign, which raised money to support the building of Engineering VI. EGSA committee members celebrate here at the reception honoring their success.
9 Scholarship donors and recipients posed together at UCLA Engineering’s annual Scholarship Brunch honoring those who have funded undergraduate scholarships at the School.
UCLA ENGINEER |
SENIOR DINNER,E-GRAD CAMPAIGN RECEPTION and SCHOLARSHIP BRUNCH
23
9
ALUMNI
Notes
1960s
UCLA ENGINEER |
24
Howard Kornstein ’63 has retired this year after an active career in the European information technology industry. This included working for Computer Sciences Corporation; Data Applications International, which he co-founded; Intel; and Digital Research. In 1985, he co-founded QA Training Ltd where he later became managing director. The firm grew to be one of the UK’s most successful technical training companies. After QA was acquired, Kornstein took on a number of non-executive directorships in British high-tech startups. His retirement now allows him the luxury of returning to his engineering roots to potter about with computer technology. Tom Lazear MS ’63, chairman of California-based Archway Systems, received the inaugural Bentley Institute Lifetime Achievement Award from Bentley Systems, Incorporated, the leading company of comprehensive software solutions for sustaining infrastructure. Lazear was recognized for inspiring students, architects, and engineers to explore and apply computer technology in the service of design and engineering. Herbert Hecht PhD ’67, was recently honored with the Society of Automotive Engineers’ Elmer A. Sperry Award. The award recognizes the development and implemen-
tation of methods and tools that improve dependability and safety in transportation. Hecht founded SoHaR Incorporated in 1978, and served as its president until 1995, when he assumed his current role of chief engineer. His career has been focused on the design and verification of reliability and safety critical systems. He has headed the certification of flight control systems for helicopters and light aircraft, and participated in the certification of the electric power system for the mostly electric Global Express.
1970s Jim Breese MS ’70 has finally retired after 50 years as an engineer in the high-tech world. He has just released an e-book that attempts to teach new graduates what he learned about problem-solving during those years. Available for your kids (or maybe your grand-kids, if they are new grads) at Diesel e-books and other e-book outlets: Famous By Friday is the title. Van Schulz ’74 MS ’75 has been named the University of California Alumni-Regent Designate, and Immediate Past Chair, UCLA Alumni Association Board of Directors. The appointment was effective July 1, 2012. Armando Benavides MS ’77, a systems engineer for Boeing Satellite Systems in El Segundo, Calif. was recently awarded his third patent applicable to GPS satellites. The title of this patent is “System and method for accurate downlink power control of composite QPSK modulated signals”.
Share news about your career, personal life, honors, awards, and more!
Farid Emrani ’83 MS ’85 was unanimously appointed by the Logicube Board of Directors to become the President and CEO of Logicube. Emrani is currently the Executive Vice-President and COO. Logicube is the world’s leader in hard drive duplication and eForensics solutions. Emrani began his career at Logicube in 2005. Prior to joining the company he held various engineering, marketing and sales positions with Xerox Corporation, Lucent Technologies and Agere Systems. Gary Lee Moore ’85, City Engineer for the City of Los Angeles, was appointed by Mayor Antonio Villaraigosa, a UCLA alumnus in history, as interim general manager of the city’s Information Technology Agency. The ITA is responsible for the city’s computer networks, as well as implements new technology. As City Engineer, Moore oversees more than 800 engineers, architects, surveyors and technical support staff and is responsible for the
Ljiljana Trajkovic PhD ’86, a professor in the School of Engineering Science at Simon Fraser University, has been awarded the IEEE Circuits and Systems Society 2012 Meritorious Service Award. George A. Lesieutre PhD ’89, professor and head of Aerospace Engineering at Pennsylvania State University, presented a keynote address, “Adaptive Structures: The Journey to Flight,” at the 53rd Structures, Structural Dynamics, and Materials Conference of the American Institute of Aeronautics and Astronautics (AIAA) in April.
1990s Steven Hast, ENG ’90 was recently promoted to director of the Astrodynamics Department of The Aerospace Corporation in El Segundo, Calif. Hast manages an engineering team that performs a wide variety of orbit-related analyses, including orbit selection and satellite constellation design, orbit perturbations and lifetime estimation, space debris modeling and collision hazard assessment, optimal on-orbit maneuvers and relative motion studies.
25
1980s
planning, design and construction of all public facilities. Moore has more than 27 years of public service and has served as the city engineer since 2003.
UCLA ENGINEER |
Dan Stephenson ’79 won four gold medals at the Masters World Swimming Championships, held in Riccione, Italy in June 2012. Stephenson also recently published The Underwater Window, a novel about friendship and rivalry in the world of Olympic-level swimming. Stephenson was captain of the UCLA Men’s Swimming Team in 1978-79.
Thomas Piechota MS ’93 PhD ’97 was recently named interim vice president for research and dean of the Graduate College at the University of Nevada, Las Vegas. Piechota is a professor in the Department of Civil and Environmental Engineering. Most recently, he served as associate vice president for interdisciplinary research. In 2008, he became the UNLV principal investigator on a $15 million NSF grant to study of climate change in Nevada. Kinam Kim PhD ’94 was one of 10 foreign associates elected to the National Academy of Engineering , one of the most prestigious recognitions bestowed to an engineer. Kim is the CEO of Samsung Advanced Institute of Technology (SAIT), Samsung Electronics Company. He was recognized for his contributions to semiconductor technologies for DRAM and nonvolatile memories. Kim is a former student of electrical engineering professor Kang L. Wang.
2000s
UCLA ENGINEER |
26
Father Trung H. Pham ’00, was recently ordained as a priest in the Roman Catholic Church in the Society of Jesus (Jesuits). Pham was born in Vietnam and immigrated to Orange County, CA. with his family when he was a teenager. Pham, who taught drawing and painting at Santa Clara University also holds a master of fine arts degree from the the Pratt Institute in New York. Elizabeth M. Hagerman MS ’02 PhD ’07 has become Rose-Hulman Venture’s new vice president. Rose-Hulman Ventures offers a dynamic innovative space for students at the Rose-Hulman Institute of Technology to apply their studies to real-world issues. While at UCLA, Hagerman focused her studies in biomedical engineering on orthopedic biomaterials. Previously, Hagerman held leadership roles at Baxter Healthcare. Helen Jung ’02, MS ’05, PhD ’09, P.E., a faculty member in the Department of Civil Engineering at California Baptist University has finished her term as interim chair in 2010-2011 and is now the department chair.
Paul Medvedev ’02 recently became an assistant professor at Pennsylvania State University in the Department of Computer Science and Engineering, as well as in the Department of Biochemistry and Molecular Biology. His current focus is on DNA structural and copy-number variations – which play an important role in the development and progression of diseases. He was also named one of 2011’s “Tomorrow’s PIs” by Genome Technology magazine. Chad Rosen ’05 (B.A. Hebrew) and Sarah (Tobin) Rosen ’05 welcomed their second Bruin, Adam Samual (Class of ’34), to the family in late August. Adam, no doubt a future engineer, joins big sister Adena (UCLA class of ‘31). Matt Olsson ’07 has enrolled at the University of Chicago, Booth School of Business. Alex Kroll ’08, MS ’09 is currently serving as a 1st Lieutenant in the Untied States Air Force as a pilot of the B-52 bomber. Kroll was recently married. Julie Nichols MS ’09 represented the United States at the 2012 Olympic Games. She competed in the lightweight women’s double sculls with rowing partner Kristin Hedstrom.
2010s Thomas Cowan ’11 is currently working as an attitude control system engineer at Boeing’s Satellite Development Center in El Segundo, Calif. He has taken on various analysis and systems engineering tasks supporting Boeing’s 702 line of satellites. Cowan recently started an M.S. in Aerospace Engineering at UCLA.
AREAS (CS) Computer Science Computer Networking
Advanced Structural Materials Electronic Materials
The primary purpose of this program is to enable employed engineers and computer scientists to enhance their technical education beyond the Bachelor of Science level, and to enhance their value to the technical organizations in which they are employed.
(EE) Electrical Engineering Integrated Circuits Signal Processing & Communications
(MAE) Mechanical Engineering Aerospace Engineering Manufacturing and Design
(MSE) Materials Science
(EN) Systems Engineering
DISTINCTIVE FEATURES OF THE PROGRAM • Each course is fully equivalent to the corresponding on-campus course and taught by the faculty members who teach the on-campus course. • The online lectures are carefully prepared for the online student.
Additional information and online applications available at: msol.ucla.edu
Online Masters
UCLA ENGINEER |
UCLA Engineering New Faculty
28
News
WENTAI LIU Professor of Bioengineering Ph.D. – University of Michigan
W
entai Liu studies the neural implants dealing with nerves and muscles for retina, epilepsy, muscle, eyelids, spinal cord, and bladder. Liu has been leading the engineering efforts of the retinal prosthesis to restore vision, finally leading to successful implant trials in blind patients. Liu has received several notable honors for his research including a Popular Mechanics Breakthrough Award in 2010; an R&D 100 Award in 2009; the Alcoa Foundation's Distinguished Engineering Research Award, a NASA Group Achievement Award, and several outstanding paper awards from IEEE. Liu has also received an Outstanding Alumni Award from National Chiao-Tung University in Taiwan, where he received his bachelor’s degree Before joining UCLA Engineering in Winter 2012, Liu was a professor at the Jack Baskin School of Engineering at the University of California, Santa Cruz. Prior to that, Liu was a professor at North Carolina State University. n
CGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCGATGCGTCCACAACGCTACAAATGTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCGATGCGTCCAC
FACULTY
WEI WANG Professor of Computer Science Ph.D. – UCLA Henry Samueli School of Engineering and Applied Science
UCLA ENGINEER |
ei Wang’s research interests are in data mining, bioinformatics and computational biology, and databases. She has filed seven patents, and has published one monograph and more than 100 research papers in international journals and major peer-reviewed conference proceedings. Prior to joining UCLA Engineering, Wang spent 10 years as a faculty member in the Computer Science Department at the University of North Carolina, Chapel Hill. She was also a member of the Carolina Center for Genomic Sciences and the Lineberger Comprehensive Cancer Center. Wang was a research staff member at the IBM Thomas J. Watson Research Center before joining UNC. Wang’s honors include the NSF CAREER Award, IBM Invention Achievement Award (twice), and she was a Microsoft Research Faculty Fellow. She is currently an associate editor for ACM Transactions on Knowledge Discovery in Data, International Journal of Knowledge Discovery in Bioinformatics, and the International Journal of Data Mining and Bioinformatics. n
29
W
0101010101000011010011000100000100100000010001010110111001100111011010010110111001100101011001010111001001101001011011100110011100 1001000011001010110111001110010011110010010000001010011011000010110110101110101011001010110110001101001001000000101001101100011011
FACULTY
Honors and Awards
UCLA ENGINEER |
30
Judea Pearl wins ACM TURING AWARD for contributions that transformed artificial intelligence ACM, the Association for Computing Machinery, presented Judea Pearl, UCLA professor of computer science, with the 2011 ACM A.M. Turing Award for innovations that enabled remarkable advances in the partnership between humans and machines that is the foundation of Artificial Intelligence (AI). The ACM Turing Award, widely considered the “Nobel Prize in Computing,” carries a $250,000 prize, with financial support provided by Intel Corporation and Google Inc. It is named for the British mathematician Alan M. Turing, whose 100th anniversary was celebrated in June at the ACM 2012 Turing Centenary Celebration. Pearl pioneered developments in probabilistic and causal reasoning and their application to a broad range of problems and challenges. He created a computational foundation for processing information under uncertainty, a core problem faced by intelligent systems. He also developed
UCLA Engineering's distinguished faculty have won numerous accolades for their excellence in research, teaching and service.
graphical methods and symbolic calculus that enable machines to reason about actions and observations, and to assess cause-effect relationships from empirical findings. His work serves as the standard method for handling uncertainty in computer systems, with applications ranging from medical diagnosis, homeland security and genetic counseling to natural language understanding and mapping gene expression data. His influence extends beyond artificial intelligence and even computer science, to human reasoning and the philosophy of science. His work serves as the “Like Alan Turing himself, Pearl turned his thinking standard method for to constructing procedures that might be harnessed to perform tasks traditionally associated with human handling uncertainty in intelligence,” said Vint Cerf, chair of the ACM 2012 Turing computer systems. Centenary Celebration, and a former ACM Turing Award recipient. “His accomplishments over the last 30 years have provided the theoretical basis for progress in artificial intelligence and led to extraordinary achievements in machine learning, and they have redefined the term ‘thinking machine.’” Cerf pointed to Pearl’s innovation as a quantum leap from Turing’s “test” dating to the 1950s, when Turing set out to discover if machines could think. (from ACM) n
UCLA ENGINEER |
31
➝ www.engineer.ucla.edu/pearl-turing ➝ http://acm.org/pearl
Vaughan Receives UNITED STATES’ HIGHEST AWARD for Young Engineers and Scientists
UCLA ENGINEER |
32
ennifer Wortman Vaughan, an assistant professor of computer science, received the Presidential Early Career Award for Scientists and Engineers (PECASE), the highest honor given by the United States government to young engineers and scientists at the outset of their professional careers. Vaughan received the award in August at a special ceremony for the PECASE honorees in Washington, D.C. at the Smithsonian Institution’s National Museum of Natural History. John P. Holdren, Assistant to the President for Science and Technology and Director of the White House Office of Science and Technology Policy led the ceremony. The award winners then met with President Obama at the White House. "Discoveries in science and technology not A major goal of only strengthen our economy, they inspire us as Vaughan’s research is to a people,” President Obama said. “The impressive accomplishments of today’s awardees so early in bridge the gap between their careers promise even greater advances in theory and practice. the years ahead.” Vaughan’s research interests are in machine learning, algorithmic aspects of economics, and social computing. ”It is a huge thrill and an honor to receive this award,” said Vaughan, who holds the Symantec Term Chair in Computer Science. “It’s exciting to see such strong government support for basic research in science and engineering.” The growing popularity of the Internet including social networking sites like Facebook has led to the availability of novel sources of data on preferences, behaviors, and beliefs of massive populations of users. A major goal of Vaughan’s research is to bridge the gap between theory and practice by designing a new generation of machine learning models and algorithms to address and explain the issues commonly faced when attempting to aggregate local information across large online communities. n ➝ www.engineer.ucla.edu/vaughan-pecase
Photo: Sandy Schaeffer
J
By Wileen Wong Kromhout
Yi Tang receives PRESIDENTIAL GREEN CHEMISTRY CHALLENGE AWARD from EPA
➝ www.engineer.ucla.edu/ tang-green-chemistry
UCLA ENGINEER |
Photo: Kendra Greenberg
Y
i Tang, professor of chemical and biomolecular engineering, has been awarded the prestigious 2012 Presidential Green Chemistry Challenge Award from the U.S. Environmental Protection Agency. The annual award recognizes pioneering chemical technologies developed by leading researchers and industrial innovators who are making significant contributions to pollution prevention in the United States — including the design of safer and more sustainable chemicals, processes and products that will protect citizens from exposure to harmful materials. Tang's winning technology resulted in a new, less-hazardous manufacturing process for simvastatin, a leading cholesterollowering statin drug. Though the drug is manufactured from a natural product, the traditional synthesis was a wasteful, multi-step chemical process that used large amounts of hazardous reagents. Tang conceived of a synthesis that instead used an engineered enzyme and a practical, low-cost
feedstock. He partnered with Codexis Inc. — a developer of industrial enzymes that enable the cost-advantaged production of biofuels, bio-based chemicals and pharmaceutical intermediates — to optimize both the enzyme and the chemical process for commercial use. Codexis will also be presented with the EPA award Tang's winning technology as part of this resulted in a new, lesscollaboration. hazardous manufacturing "Receiving process for Simvastatin. this award shows the impact that can be made in a highly synergistic collaboration between academic and industrial research teams," Tang said. "The development and optimization of the process have been highly rewarding for my research group. Receiving this recognition from the EPA two years after my colleague James Liao received the same award is a strong testament to the quality and impact of the research that is being conducted in the Department of Chemical and Biomolecular Engineering at UCLA." Tang is also a professor of chemistry and biochemistry in the UCLA Division of Physical Sciences. n
33
By Wileen Wong Kromhout
UCL A ENGINEERING 2011-2012
FACULT Y AWARDS
UCLA ENGINEER |
34
The Association for Computing Machinery named Judea Pearl, computer science, the winner of the 2011 A.M. Turing Award, often called the Nobel Prize for computing. Pearl was recognized for innovations that enabled remarkable advances in artificial intelligence. Pearl also received the Harvey Prize from the Technion (Israel), for foundational work that influenced spheres of modern life. He was also named a Fellow of the American Academy of Arts & Sciences. Henry Samueli, chairman, co-founder and CTO of Broadcom Corporation and an electrical engineering professor, won the 2012 Marconi Society Prize and Fellowship. Samueli was selected for his pioneering advances in the development and commercialization of analog and mixed-signal circuits for modern communication systems, in particular the cable modem. Samueli also received the 2011 Dr. Morris Chang Exemplary Leadership Award from the Global Semiconductor Alliance.
Yi Tang, chemical and biomolecular engineering, received the prestigious 2012 Presidential Green Chemistry Challenge Award from the U.S. Environmental Protection Agency. The award recognizes pioneering chemical technologies that will make significant contributions to pollution prevention. Tang was also named a 2012 Arthur C. Cope Scholar by the American Chemical Society, for excellence in organic chemistry. Aydogan Ozcan, electrical engineering and bioengineering, received the Presidential Early Career Award for Scientists and Engineers (PECASE), the highest honor given by the United States government to engineers and scientists at the outset of their professional careers. Ozcan received several other notable honors in the previous year including: the 2011 Army Research Office Young Investigator Award, winning the Health Alliance’s Innovators Challenge; and seeing his cell-phone based microscope selected as the top innovation of 2011, from The Scientist magazine. Also, he and a colleague at Harvard received a Grainger
Foundation Frontiers of Engineering Grant for Advancement of Interdisciplinary Research from the National Academy of Engineering. Jennifer Wortman Vaughan, computer science, received the Presidential Early Career Award for Scientists and Engineers (PECASE), the highest honor given by the United States government to engineers and scientists at the outset of their professional careers. Vaughan holds the Symantec Term Chair in Computer Science. Dino Di Carlo, bioengineering, was awarded a Packard Fellowship for Science and Engineering, from the David and Lucile Packard Foundation. Di Carlo received several other notable honors in the previous year including: a Young Faculty Award from the Defense Advanced Research Projects Agency; a Faculty Early Career Development (CAREER) award from the National Science Foundation; and a 2012 Young Investigator Award from the Office of Naval Research. James C. Liao, chemical and biomolecular engineering, was honored by the White House as a
William W-G. Yeh, civil and environmental engineering, was named a Fellow of the American Association for the Advancement of Science, the world’s largest general scientific society and the publisher of the journal Science. Yeh holds the Richard G. Newman AECOM Chair in Civil Engineering. Yeh also received a Lifetime Achievement Award from the 2012 Environmental & Water Resources Institute, ASCE. Kuo-Nan Liou, atmospheric and oceanic sciences , electrical engineering, and mechanical and aerospace engineering, received the 2012 Quadrennial Gold Medal Award from the International Radiation Commission. He was recognized for “contributions of lasting significance to the field of radiation research.”
Russell Caflisch, mathematics, and materials science and engineering was among 220 distinguished scholars, scientists, authors, artists, and business and philanthropic leaders elected to the American Academy of Arts & Sciences. C. Kumar N. Patel, physics and astronomy, and electrical engineering, was inducted into the National Inventors Hall of Fame for his invention of the carbon dioxide laser in the early 1960s. Algirdas Avizienis, computer science, received the Jean-Claude Laprie Award, which recognizes outstanding papers published at least ten years ago that have significantly influenced dependable computing. Avizienis also received the 2012 ACM/IEEE EckertMauchly Award, considered the most prestigious award for computer architecture. Danijela Cabric, electrical engineering, received a Faculty Early Career Development (CAREER) award from the National Science Foundation.
It funds her research on an integrated physical and network layer approach for wireless spectrum sharing. Cabric also received an award for the UCLA Hellman Fellows program, which supports promising junior faculty. Robert Candler, electrical engineering, received a Young Investigator Award from the Army Research Office. The award funds research on fundamental mechanisms in which energy is dissipated in nanoscale vibrating structures. Jiun-Shyan Chen, civil and environmental engineering, mechanical and aerospace engineering, and mathematics, received the Computational Mechanics Award, from the International Association for Computational Mechanics. The award recognizes significant contributions to traditional and new areas of computational mechanics. Panagiotis D. Christofides, chemical and biomolecular engineering, was elected a Fellow of the International Federation of Automatic Control (IFAC), recognizing outstanding and extraordinary contributions in the fields of interest to IFAC. Jason Cong, computer science, received the 2012 ACM Transactions on Design Automation of Electronic Systems Best Paper Award, for the journal entitled “Behavior-Level Observability Analysis for Operation continued
35
Leonard Kleinrock, computer science, was honored by IEEE with its 2012 Alexander Graham Bell Medal, for pioneering contributions to modeling, analysis and design of packetswitching networks. Kleinrock was also named to the inaugural class for the Internet Hall of Fame, coinciding with the Internet Society’s 20th Anniversary.
M.C. Frank Chang, electrical engineering, was elected to the Academic Sinica, the highest academic honor in Taiwan. Election recognizes scholars with exemplary research achievements in the fields of mathematics and physical sciences, life sciences, or humanities and social sciences. Chang holds the Wintek Chair in Electrical Engineering.
UCLA ENGINEER |
Champion of Change, for his new ideas for a clean energy future. Liao holds the Parsons Chair in Chemical Engineering.
continued
Gating in Low-Power Behavioral Synthesis,” with co-authors from UCLA Bin Liu and professor Rupak Majumdar, and Zhiru Zhang from AutoESL Design Technologies, Inc. UCLA Engineering Dean Vijay K. Dhir, mechanical and aerospace engineering, was named an Honorary Member of ASME, reserved for a person who has made “distinctive contributions” to engineering, science, industry, research, public service, or other pursuits allied with and beneficial to the engineering profession. Dhir also received an honorary degree from his Ph.D. alma mater, the University of Kentucky. He also received a Lifetime Achievement Award from the International Conference on Computational & Experimental Engineering and Sciences.
UCLA ENGINEER |
36
Lara Dolecek, electrical engineering, received a Faculty Early Career Development (CAREER) award from the National Science Foundation. The award funds her research on improving the storage and processing of massive amounts of data by fundamentally rethinking the underlying data reliability metrics. Bruce Dunn, materials science and engineering, was elected as a Fellow of the Materials Research Society. Dunn was cited for “extraordinary contributions to development of new materials based on sol-gel chemistry;
synthesis, characterization, and development of electrochemical materials; design, materials, and fabrication processes for 3-D battery technology.” Dunn holds the Nippon Sheet Glass Chair in Materials Science. Rajit Gadh, mechanical and aerospace engineering, was elected a Fellow of the American Society of Mechanical Engineers (ASME) for his informationbased design and manufacturing. Warren Grundfest, bioengineering, has been appointed to the FDA Science Advisory Board, to serve on the Subcommittee for the Center for Devices & Radiological Health. This prestigious committee provides scientific advice and reviews regulatory science issues and programs of the FDA. Puneet Gupta, electrical engineering, received an IBM Faculty Award. Gupta’s lab focuses its research on electronic design automation and design for manufacturing, in particular, application-architecture-implementation-fabrication interfaces. Chih-Ming Ho, mechanical and aerospace engineering, and bioengineering, was appointed a visiting member of the Hong Kong University of Science and Technology’s Institute of Advanced Study, which champions collaborative projects across disciplines and institutions. Ho holds the Ben Rich Lockheed Martin Chair in Aeronautics. Ho also presented
the Yunchuan Aisinjioro-Soo Distinguished Lecture at the University of Illinois, Urbana-Champaign. Tatsuo Itoh, electrical engineering, received the College of Engineering Alumni Award for Distinguished Service from the University of Illinois, Urbana-Champaign. He was cited for “Seminal Contributions in Microwave and Millimeter-Wave Technology and Electrical Engineering Education.” Also, Itoh and graduate student Hanseung Lee received the Best Paper Award at the Asia Pacific Microwave Conference 2011. Itoh holds the Northrop Grumman Chair in Microwave Electronics. Bahram Jalali, electrical engineering has been elected a Fellow of the American Physical Society (APS) for his significant and innovative contribution to the application of physics in science and technology and advances in knowledge through research. Jalali holds the Northrop Grumman Chair in Opto-Electronics. Jiann-Wen “Woody” Ju, civil and environmental engineering, was the keynote speaker at the Symposium on “Fundamental Theory for the Performance Evolution and Sensing Control of Urban Metro Structures." Ju was also the Plenary Lecturer and Conference Co-Chairman of the First International Conference on Damage Mechanics.
Andrea M. Kasko, bioengineering, received a 2011 NIH Director’s New Innovator Award from the National Institutes for Health. The program supports exceptionally creative investigators at an early stage in their career. Chang-Jin (CJ) Kim, mechanical and aerospace engineering professor, was selected by the Korean newspaper Dong-A as one of “100 People Who Will Light Up Korea in Year 2020.” The selection noted his outstanding research in micro electro-mechanical systems (MEMS). Asad M. Madni, electrical engineering, received the 2012 IEEE Aerospace and Electronic Systems
Jens Palsberg, computer science, was honored by the Association for Computing Machinery (ACM) for services to the programming languages community. Alexander Sherstov, computer science, received a Faculty Early Career Development (CAREER) award from the National Science Foundation. The award funds Sherstov’s research on communication complexity. The UCLA Academic Senate awarded Jonathan P. Stewart, civil and environmental engineering, a Distinguished Teaching Award. Stewart was recognized for distinction in teaching at the graduate level. Paulo Tabuada, electrical engineering, and former student Adolfo Anta received the 2011 George S. Axelby Award at the 50th IEEE Conference on Decision and Control. The award recognizes the best paper published in the IEEE Transactions on Automatic Control in the previous two years. Benjamin Williams, electrical engineering, received a Faculty Early Career Development (CAREER) Award from the National Science Foundation. The award supports his research
on “widely tunable monolithic THz waveguides, lasers, and arrays.” Alan Willson, electrical engineering, received the 2012 Darlington Best Paper Award, from the IEEE Circuits and Systems Society. The award recognizes the best paper bridging the gap between theory and practice published in the “IEEE Transactions on Circuits and Systems.” Willson holds the Charles P. Reames Chair in Electrical Engineering. Gerard Wong, bioengineering, was elected a fellow of the American Physical Society for his contributions to the understanding of electrostatic interactions in biological systems. Ya-Hong Xie, materials science and engineering, received an Alexander von Humboldt Research Award from the Germany-based foundation. The award recognizes a researcher’s fundamental discoveries, new theories, or insights that have had a significant impact on their own discipline. The paper, “Systolic Arrays for Lattice Reduction Aided MIMO Detection,” authored by PhD student Ni-Chung Wang, Adjunct Professor Ezio Biglieri and Professor Kung Yao, published in October 2011 in IEEE Journal of Communications and Networks, received the Best Paper Award.
37
Ann Karagozian, mechanical and aerospace engineering, was appointed as a Member-at-Large of the U.S. National Committee on Theoretical and Applied Mechanics. On behalf of the National Academy of Sciences and the National Research Council, USNC/TAM is the official U.S. representative to the International Union of Theoretical and Applied Mechanics.
Society’s (AESS) Pioneer Award for the development and commercialization of aerospace and electronic systems. Madni also recently received an honorary doctorate from Technical University of Crete.
UCLA ENGINEER |
William Kaiser, electrical engineering, and alumnus Henrik Borgstrom, recently received a Best Paper award from the ASEE for a publication on their new hands-on instruction technology developed for the UCLA undergraduate curriculum.
Ph.D. ALUMNI NEW ACADEMIC APPOINTMENTS Chiao-En Chen, PhD ’09 Electrical Engineering/Communication Engineering National Chung Cheng University, Taiwan ADVISOR: Kung Yao
Shalabh Gupta, PhD ’09 Electrical Engineering Indian Institutes of Technology, Bombay, India ADVISOR: Bahram Jalali
Ting-Hsuan Chen, PhD ’12 Mechanical and Biomedical Engineering City University of Hong Kong ADVISOR: Chih-Ming Ho
Ping-Hsuan Hsieh, PhD ’09 Electrical Engineering National Tsing-Hua University, Taiwan ADVISOR: Chih-Kong “Ken” Yang
Sheng-Wei Chi, PhD ’10 Civil and Materials Engineering University of Illinois at Chicago ADVISOR: Jiun-Shyan (JS) Chen
38
Zhen Gu, PhD ’10 Biomedical Engineering North Carolina State University ADVISOR: Yi Tang
Kai Chen, PhD ’09 Materials Science Jiao Tung University, X’ian, China. ADVISOR: King-Ning Tu
Pei-Ling Chi, PhD ’11 Electrical Engineering National Chaio Tung University, Taiwan ADVISOR: Tatsuo Itoh
UCLA ENGINEER |
Marisa Eisenberg, PhD ’09 Epidemiology, Mathematics University of Michigan ADVISOR: Joseph DiStefano III
Yi-Chia Chou, PhD ’10 Materials Science and Engineering National Chiao Tung University, Hsinchu, Taiwan. ADVISOR: King-Ning Tu Wei-Ho Chung, PhD ’09 Research Center for Information Technology Innovation Academia Sinica, Taiwan ADVISOR: Kung Yao
Bryan Yu Hu, PhD ’09 Electrical and Computer Engineering University of Alberta, Alberta, Canada ADVISOR: Lei He Dohyun Kim, PhD ’08 Mechanical Engineering Myongji University, South Korea ADVISOR: Jack Judy Peter Bjorn Lillehoj, PhD ’11 Mechanical Engineering Michigan State University ADVISOR: Chih-Ming Ho Jenny Yi-Chun Liu, PhD ’11 Electrical Engineering National Tsing Hua University, Taiwan ADVISOR: M.C. Frank Chang
Jinfeng Liu, Phd ’11 Chemical Engineering and Materials Science University of Alberta, Canada ADVISOR: Panagiotis D. Christofides Nicholas Mastronarde, PhD ’11 Electrical Engineering The State University of New York at Buffalo ADVISOR: Mihaela van der Schaar Manuel Mazo,Jr., PhD ’12 Delft Center for Systems and Control Delft University of Technology, Netherlands ADVISOR: Paulo Tabuada Youngsuk Nam, PhD ’10 Mechanical Engineering Kyung Hee University, South Korea ADVISOR: Y. Sungtaek Ju Jaeok Park, PhD ’09 Economics Yonsei University, South Korea ADVISOR: Mihaela van der Schaar Bibhudatta Sahoo, PhD ’09 Electronics & Electrical Communication Engineering Indian Institute of Technology (IIT), Kharagpur, India ADVISOR: Behzad Razavi Thomas Schmid, PhD ’09 Electrical and Computer Engineering The University of Utah ADVISOR: Mani Srivastava
Vincent Tung, PhD ’09 Materials Science and Engineering UC Merced ADVISOR: Yang Yang Tak-Sing Wong, PhD ’09 Mechanical and Nuclear Engineering Pennsylvania State University Ph.D. and POST-ADVISOR: Chih-Ming Ho Judy P. Yang, PhD ’12 National Chiao Tung University, Taiwan ADVISOR: Jiun-Shyan (JS) Chen Lap Yeung, PhD ’10 Electronic Engineering Chinese University of Hong Kong ADVISOR: Yuanxun Ethan Wang Yan Yao, PhD ’08 Electrical and Computing Engineering University of Houston ADVISOR: Yang Yang Hao Yu, PhD ’07 Electrical and Electronic Engineering Nanyang Technological University, Singapore ADVISOR: Lei He
FACULTY ENDOWED CHAIR HOLDERS
Keisuke Goda Physical Chemistry University of Tokyo Post-doctoral advisor: Bahram Jalali
Ben Rich Lockheed Martin Chair in Advanced Aerospace Technologies Chih-Ming Ho
Xue Jin Edinburgh University, Scotland, United Kingdom Post-doctoral advisor: Eric M.V. Hoek Miuling Lam Creative Media City University of Hong Kong Post-doctoral Advisor: Chih-Ming Ho Arun Prakash Civil Engineering Purdue University Post-doctoral advisor: Ertugrul Taciroglu Guy Ramon Technion University, Israel Post-doctoral advisor: Eric M.V. Hoek
Carol and Lawrence E. Tannas, Jr., Endowed Chair in Engineering Yang Yang Charles P. Reames Endowed Chair in Electrical Engineering Alan Willson, Jr Edward K. and Linda L. Rice Endowed Term Chair in Civil Engineering Materials Gaurav Sant Jonathan B. Postel Chair in Computer Systems Lixia Zhang Jonathan B. Postel Chair in Networking Deborah Estrin Nippon Sheet Glass Company Chair Materials Science Bruce S. Dunn Norman E. Friedmann Chair in Knowledge Sciences Carlo Zaniolo Northrop Grumman Chair in Electrical Engineering/Electromagnetics Yahya Rahmat-Samii Northrop Grumman Chair in Electrical Engineering Tatsuo Itoh
39
James R. Springstead, PhD ’08 Paper Engineering, Chemical Engineering and Imaging Western Michigan University ADVISOR: Harold G. Monbouquette
POST-DOCTORAL SCHOLARS ACADEMIC APPOINTMENTS
UCLA ENGINEER |
Wenjiang Shen, PhD ’04 Mechanical Engineering Suzhou Institute of Nano-Tech and Nano-Bionics, China ADVISOR: Chang-Jin (CJ) Kim
Northrop Grumman Opto-Electronic Chair in Electrical Engineering Bahram Jalali Ralph M. Parsons Foundation Chair in Chemical Engineering James C. Liao Raytheon Chair in Electrical Engineering Kang L. Wang Richard G. Newman AECOM Endowed Chair in Civil Engineering William W-G. Yeh Rockwell International Chair in Engineering J. John Kim Symantec Term Chair in Computer Science Jennifer Wortman Vaughan William Frederick Seyer Endowed Chair in Materials Electrochemistry Jane P. Chang Wintek Endowed Chair in Electrical Engineering M.C. Frank Chang
Vacant Chairs Evalyn Knight Chair in Engineering
UCLA ENGINEER |
40
Leonard Kleinrock Term Chair in Computer Science Levi James Knight Jr. Chair in Engineering L.M.K. Boelter Chair in Engineering Ronald and Valerie Sugar Chair in Engineering
Raytheon Chair in Manufacturing Engineering Traugott and Dorothea Frederking Endowed Chair in Cryogenics William D. Van Vorst Chair in Chemical Engineering Education
Chancellor’s Professors Asad Abidi Jiun-Shyan (JS) Chen Jason Cong Yi Tang Demetri Terzopoulos Mihaela van der Schaar
Samueli Fellows
Lou Cornell, P.E. Vice President Southern California District Manager AECOM Lucien “Al” Couvillon, Jr. ’62, MS ’66 Retired Vice President for Corporate R&D Boston Scientific Corporation R. Paul Crawford Director of Health Research Intel Labs Richard A. Croxall Vice President and Chief Engineer (Retired) Northrop Grumman Corporation
Danijela Cabric Eric Hoek Yu Huang Benjamin Williams
Siddhartha Dalal Chief Technology Officer RAND Corporation
DEAN’S ADVISORY COUNCIL
Vijay K. Dhir Dean UCLA Henry Samueli School of Engineering and Applied Science
William F. Ballhaus, Jr. PhD CEO (Retired) The Aerospace Corporation Charles Bergan Vice President Engineering Research & Development Qualcomm Aaron S. Cohen ’58 Vice Chairman and Founder National Technical Systems Vinton G. Cerf MS ’70, PhD ’72 Chief Internet Evangelist Google
James L. Easton ’59 Chairman and President Jas D. Easton, Inc. Gary W. Ervin ’80 Corporate Vice President & President Aerospace Systems Northrop Grumman Corporation B. John Garrick MS ’62, PhD ’68 President & CEO (Retired) PLG, Inc. Sam F. Iacobellis MS ’63 Deputy Chairman (Retired) Rockwell International Corporation
William A. Jeffrey President and CEO HRL Laboratories, LLC
Henry Samueli ’75, MS ’76, PhD ’80 Chairman, co-founder and CTO Broadcom Corporation
FACULTY PATENTS AWARDED 2011-2012
Leslie M. Lackman Deputy Director, ITA UCLA Henry Samueli School of Engineering and Applied Science
Gerald Solomon Executive Director Samueli Foundation
M.C. Frank Chang, holder of the Wintek Endowed Chair in Electrical Engineering, Daquan Huang, and Tim LaRocca: Origami cascaded topology for analog and mixed-signal applications; Submillimeter-wave signal generation by linear superimposition of phase-shifted fundamental tone signals (two patents).
Rajeev Madhavan Chairman and CEO Magma Design Automation, Inc. Joanne M. Maguire MS ’78, CERT ’89 Executive Vice President Lockheed Martin Space Systems Pankaj Patel Senior Vice President and General Manager Cisco Systems, Inc. Rami R. Razouk ’75, MS ’75, PhD ’80 Senior Vice President Engineering and Technology The Aerospace Corporation Edward K. Rice Chairman CTS Cement Manufacturing Company Kevin Riley President Teledyne Scientific & Imaging, LLC
Lawrence E. Tannas, Jr. ’59, MS ’61 Electronics Consultant Tannas Electronics Murli Tolaney Chairman MWH Global, Inc. John J. Tracy, Ph.D CTO & SVP of Engineering, Operations & Technology The Boeing Company Stephen Trilling CERT ’00 Vice President Security Technology and Response Symantec Corporation Nicholas M. Uros ME ’84, CERT ’93 Vice President Advanced Concepts and Technology Raytheon Systems Company David A. Whelan MS ’78, PhD ’83 Vice President, General Manager, and Deputy to the President The Boeing Company
Chang, Huang and Willian Hant: Tunable artificial dielectrics. Chang, Qun Gu, Jenwei Ko, and Zhiwei Xu: Self-sychronized radio frequency interconnect for threedimensional circuit. Francis Chen, professor emeritus of electrical engineering, and Humberto Torreblanca: Helicon plasma source with permanent magnets. Wesley Chu, professor of electrical engineering, Jianming He, and Zhenyu Liu: System and methods for evaluating interferences of unknown attributes in a social network. Eric M.V. Hoek, associate professor of civil and environmental engineering, Asim Ghosh, and Jodie Nygaard: Micro and nanocomposite support structures for reserve osmosis thin film membranes.
41
Steven D. Liedle Project Manager Bechtel Power Corporation
Dwight C. Streit MS ’83, PhD ’86 Professor Director, Institute for Technology Advancement UCLA Henry Samueli School of Engineering and Applied Science
UCLA ENGINEER |
Jeff Lawrence ’79 President and CEO Clivia Systems
Mario Gerla, professor of computer science, and M. Yahya Sanadidi: TCP Westwood with priorities for quality of service differentiation at the transport layer.
Kang L. Wang, holder of the Raytheon Chair in Electrical Engineering, Fei Liu, and Siguang Ma: Carbon nanotube/nanowire thermophotovoltaic cell.
Tatsuo Itoh, holder of the Northrop Grumman Chair in Electrical Engineering, and Pei-Ling Chi: Compact dual-band metamaterialbased hybrid ring coupler.
Wang, Mary Eshaghian-Wilner and Alexander Khitun: Spin-wave architectures.
Itoh, Christophe Caloz, and Hsiang Lin: Composite right/left-handed (CRLH) couplers. CJ Kim, professor of mechanical and aerospace engineering, and De-Sheng Meng: Method and Apparatus for pumping liquids using direction growth with elimination of bubbles. Kim and Jane Tsai: Printing pins having selective wettability and method of making same. Kim, and Gaurav Jitendra Shah: Methods for using magnetic particles in droplet microfluidics.
UCLA ENGINEER |
42
Rafail Ostrovky, professor of computer science: Method for low distortion embedding of edit distance to hamming distance. Jacob Schmidt, associate professor of bioengineering, Tae Joon Jeon, Noah Malmstadt, and Jason Poulos: Formation and encapsulation of molecular bilayer and monolayer membranes.
Benjamin Wu, professor of bioengineering: Composition for promoting cartilage formation or repair comprising a NELL Gene produce and method of treating; Expression of NELL Peptide; NELL peptide expression systems and bone formation activity of NELL peptide; and NELL-1 enhanced bone mineralization (four patents). Yang Yang, holder of the Carol and Lawrence E. Tannas, Jr., Endowed Chair in Engineering, and Jinsong Huang: Polymer electronic devices by all-solution process. Ya Hong Xie, professor of materials science and engineering: Spin injection device having semiconductor-ferromagnetic-semiconductor structgure; Spin injector. (two patents).
THE 2012 BOELTER SOCIETY HONOR ROLL DEAN’S VISIONARIES The Dean’s Visionaries are individuals who have committed one million dollars or more, over the course of their lifetime or through their estate, to support the students and faculty of the UCLA Henry Samueli School of Engineering and Applied Science. Degrees listed include UCLA alumni and parents of engineering students. Robert B. Allan Trust Therese Kerze-Cheyovich Family Trust Aaron S. Cohen ’58 and Nancy D. Cohen Ralph E. Crump ’50 and Marjorie L. Crump ’46 James L. Easton ’59 and Phyllis F. Easton Rhodine R. Gifford and Jack Gifford* ’63 Kalosworks.org W. N. Lin, Parent ’11 Robert Nakich ’65, MS ’69 Trust Mukund Padmanabhan MS ’89, PhD ’92 Charles P. Reames MS ’80, ENG ’82, PhD ’85 and Deborah A. Reames Edward K. Rice and Linda L. Rice Henry Samueli ’75, MS ’76, PhD ’80 and Susan F. Samueli Patrick Soon-Shiong and Michele C. Soon-Shiong Ronald D. Sugar ’68, MS ’69, PhD ’71 and Valerie H. Sugar ’71 Lawrence E. Tannas, Jr. ’59, MS ’61 and Carol A. Tannas, Parents ’85 *Deceased
Terence Lim ’92 Robert P. Lin and Lily W. Lin W. N. Lin, Parent ’11 Fang Lu MS ’88, ENG ’89, PhD ’92 and Jui-Chuan Yeh MPH ’96 Daniel C. Lynch MA ’65 Asad M. Madni ’69, MS ’72 and Gowhartaj A. Madni, Parents ’08 Dennis Maynard ’69 Jonathan S. Min PhD ’95, MBA ’07 David Mong ’84 and Emmy Mong Richard Nesbit and Rose Marie Nesbit Henry T. Nicholas, III ’82, MS ’85, PhD ’98 Stacey E. Nicholas ’85, MS ’87 Tracy Nishikawa MS ’85, PhD ’88 and Gail K. Masutani Sallie Boyd O’Neill Marie A. Oberholtz Mukund Padmanabhan MS ’89, PhD ’92 Michael W. Phelps ’71, MS ’71 Richard W. Phillips Simon Ramo Charles P. Reames MS ’80, ENG ’82, PhD ’85 and Deborah A. Reames Edward K. Rice and Linda L. Rice Henry Samueli ’75, MS ’76, PhD ’80 and Susan F. Samueli Shioupyn Shen PhD ’91 and Waishan Wu Shiva Shivakumar ’94 Bernard Shyffer ’49, MS ’63 and Barbara W. Shyffer Richard G. Somers and Mary E. Bosak Alfred W. Sommer and Joyce Sommer Patrick Soon-Shiong and Michele C. Soon-Shiong
43
Sheldon G. Adelson and Miriam O. Adelson Balu Balakrishnan MS ’76 and Mohini Balakrishnan, Parents ’11 Harold S. Becker ME ’59 and Marilyn L. Becker Benton Bejach and Wanlyn Bejach Mark Berman MS ’92, PhD ’95 and Sharon B. Berman ’91 Bernard L. Beskind ’62, ME ’66 and Lois R. Beskind John Burnett Vinton G. Cerf MS ’70, PhD ’72 and Sigrid L. Thorstenberg Valerie Choudhury Josephine Cheng ’75, MS ’77 and Michael Y. Pong Brian L. Cochran ’54 and Nancy A. Cochran Aaron S. Cohen ’58 and Nancy D. Cohen Neal M. Cohen ’87 and Adrienne D. Cohen ’86 Robert N. Crane MS ’65, PhD ’70 Irina Cromwell Ralph E. Crump ’50 and Marjorie L. Crump ’46 Alan P. Cutter ’61, MBA ’64 Stanley A. Dashew Noel J. Deitrich ’67 James L. Doane ’68 and Jean M. Doane James L. Easton ’59 and Phyllis F. Easton Thelma Estrin
Christopher P. Ferguson ’86, PhD ’99 Barry J. Forman ’60 Dorothea H. Frederking Norman E. Friedmann ’50, MS ’52, PhD ’57 and Irene C. Kassorla ’63, MA ’65 B. John Garrick MS ’62, PhD ’68 and Amelia Garrick Richard L. Gay ’73, MS ’73, PhD ’76 Rhodine R. Gifford H. P. Gillis Bruce E. Gladstone ’57, MS ’62 and Beverly J. Gladstone ’59 Ms. Victoria F. Goldberg ’87 Hisayo Graham Armond Hairapetian ’87, MS ’88, PhD ’93, MFE ’09 and Elena Hairapetian ’96 Kevin G. Hall, Parent ’06 James N. Harger ’80 Ernest R. Harris ’49 Robert Hawley MS ’91, PhD ’97 Franklin J. Henderson and Doris B. Henderson P. Michael Henderson Jerome Hollander ’48 and Sonya Hollander Hyley Huang, Parent ’09 Jau-Hsiung Huang MS ’85, PhD ’88 and Hua J. Chang MBA ’88 Pearl Illg ’70 B. V. Jagadeesh Kalosworks.org James F. Kerswell ’66 and Elizabeth Szeliga-Kerswell Toshiko Kikuchi Elizabeth Argue Knesel Ryo Kokubu Jeff Lawrence ’79 and Diane E. Troth ’80, MS ’81
UCLA ENGINEER |
LIFETIME MEMBERS This honor roll gratefully acknowledges those who have given $100,000 or more over the course of their lifetime or through their estate.
Oscar M. Stafsudd, Jr. and Jacqueline Stafsudd Eugene P. Stein ’68 and Marilyn L. Stein Richard Stevenson and Kirsten L. Sommer ’60 David E. Storrs ’82, MS ’83
UCLA ENGINEER |
44
Ronald D. Sugar ’68, MS ’69, PhD ’71 and Valerie H. Sugar ’71 Lawrence E. Tannas, Jr. ’59, MS ’61 and Carol A. Tannas, Parents ’85 Raymond M. Taylor, Jr. ’62, MS ’66 Kathleen Tipton Spyros I. Tseregounis MS ’82, PhD ’84 and Linda P. B. Katehi MS ’81, PhD ’84 King-Ning Tu Sumermal Vardhan and Raj Kumari Vardhan, Parents ’92, ’98 V. M. Watanabe ’72 Robert K. Williamson ’62, MS ’64, PhD ’69 and Sandra Williamson Marc A. Wood ’69, ME ’85 Tien-Tsai Yang PhD ’68 and Jane J. Yang PhD ’71 William W. Yeh and Jennie P. Yeh PhD ’75 Norman L. Yeung ’77 Anonymous (7) DEAN’S LOYALTY CIRCLE The new Dean’s Loyalty Circle honors donors who make a gift to UCLA Engineering for three or more consecutive years at $2,500 or more. Members of the Dean’s Loyalty Circle are among UCLA Engineering’s most dedicated supporters, providing the school with a consistent source of vital funding. ¢
Dean’s Loyalty Circle donors
2011-2012 MEMBERS This honor roll gratefully acknowledges gifts made to the UCLA Henry Samueli School of Engineering and Applied Science from July 1, 2011 through June 30, 2012. Dean’s Ambassadors - $100,000 to $999,999 Balu Balakrishnan MS ’76 and Mohini Balakrishnan, Parents ’11 Josephine Cheng ’75, MS ’77 and Michael Y. Pong ¢ James N. Harger ’80 Hyley Huang, Parent ’09 Fang Lu MS ’88, ENG ’89, PhD ’92 and Jui-Chuan Yeh MPH ’96 ¢ David Mong ’84 and Emmy Mong Mukund Padmanabhan MS ’89, PhD ’92 ¢ Edward K. Rice and Linda L. Rice ¢ Lawrence E. Tannas, Jr. ’59, MS ’61 and Carol A. Tannas, Parents ’85 ¢ Dean’s Scholars - $50,000 - $99,999 Benton Bejach and Wanlyn Bejach Robin B. Joshi ’89, MS ’91, PhD ’95 and Celia Joshi ’89 ¢ Kalosworks.org Ryo Kokubu W. N. Lin, Parent ’11 John E. Rex ’74 Shioupyn Shen PhD ’91 and Waishan Wu Allen M. Yourman, Jr. ’76, MS ’78 and Kimberley E. Yourman ’73 ¢ Boelter Investors - $25,000 - $49,999 Aaron S. Cohen ’58 and Nancy D. Cohen ¢ Ralph E. Crump ’50 and Marjorie L. Crump ’46 ¢ B. John Garrick MS ’62, PhD ’68 and Amelia Garrick
Vincent S. Ho ’86, MS ’86, PhD ’90, MBA ’94 Charles Seim ’52 and Janet Y. Seim Eugene P. Stein ’68 and Marilyn L. Stein ¢ King-Ning Tu Boelter Fellows - $10,000 - $24,999 Beatrice D. Beggs ’63, MA ’67 Raymond S. Beggs ¢ Jiwen Cai MS ’12 Yen-Ju Chen ’88 and Fai-Long Kuo Youngsoo Cha and Jin Hee Choi, Parents ’15 Dorothea H. Frederking ¢ Marjorie R. Friedlander Andrew A. Holden, Parent ’13 Ronald E. Kent ’57 and Myra Kent ’55 Ajit K. Mal and Rosita N. Mal ¢ Waleed M. Namoos ’94 Jonathan M. Orszag and Rica Orszag ’93 ¢ Pankaj S. Patel, Parent ’06 ¢ Christopher S. Proctor ’82 and Julie A. Proctor ’82, Parents ’16 Andrew W. Pryor-Miller ’08 Thierry Sanglerat and Rita Y. Sanglerat, Parents ’13 ¢ Michael K. Stenstrom ¢ Vijayakumar Tella MS ’88 Spyros I. Tseregounis MS ’82, PhD ’84 and Linda P. B. Katehi MS ’81, PhD ’84 ¢ Yang Yang and Danmei Lee ¢ Anonymous Boelter Sponsors - $5,000 - $9,999 Andrew D. Africk ’88 and Jackie Africk ¢ David C. Banks ’80, MS ’81 and Judy Banks, Parents ’12 ¢
Alan P. Cutter ’61, MBA ’64 ¢ Hernan Pongan De Guzman ’85 and Suanne C. De Guzman, Parents ’14 Dennis J. Drag MS ’69, PhD ’82 and Leslie A. Drag ¢ James L. Easton ’59 and Phyllis F. Easton ¢ Bob English ’82 and Anna M. Zara ¢ Hsiou-Ling C. Hsiang, Parent ’13 Paul J. Jansen and Deborah K. Jansen, Parents ’13 Russell W. Krieger, Jr. ’70 and Linda M. Krieger Leslie M. Lackman and Marjorie M. Lackman ¢ Elaine C. Lewis-Hovind ’52 Kenneth H. Ma ’83, MS ’84 and Linda Ma ’84 ¢ Carol L. Massey, Parent ’13 ¢ Jerry Y. Ogawa ’69 ¢ Dodd R. Portman and Lucia Portman, Parents ’13 Simon Ramo Marvin Rubinstein ’53 ¢ George S. Stern ’58, MA ’59, PhD ’64 and Adele R. Stern ¢ Dwight C. Streit MS ’83, PhD ’86 and Deborah Streit Ghassan Toubia ’81 and Nina Toubia Ernst Volgenau PhD ’66 and Sara L. Volgenau Robert M. Webb ’57, MS ’63, PhD ’67 and Dorothy Webb
Fred J. Barker and Su Barker, Parents ’14 Robert J. Barker ’68, MBA ’70 and Ildiko V. Barker ¢ Gary H. Burdorf ’87, MS ’89, PhD ’93 and Sherry L. Burdorf ’86, MBA ’90 ¢ Jone Chen Kaiwen Cheng Douglas Corbett ’73 and Lisa L. Corbett ¢ Michael Deutsch ’78, MS ’80 and Elena Deutsch Vijay K. Dhir and Komal Dhir ¢ Navin H. Doshi and Pratima Doshi Kenneth I. Friedman ’61 ¢ Norman A. Futami and Jean K. Futami MBA ’87, Parents ’13 Hisayo Graham MS ’60, PhD ’69 Robert A. Green ’72, JD ’75 and Judy A. Green, Parents ’03 Gene C. Gritton ’63, MS ’65, PhD ’67 and Gwendolyn O. Gritton ¢ Ernest R. Harris ’49 ¢ John M. Haworth Jeffrey A. Houck and Monica C. Houck, Parents ’13 ¢ Henry G. Jung ’87 David B. Kennedy ’83 and Ruth A. Holly, Parents ’15 David W. Kim ’98, MS ’01 Francis H. Kishi ’53, MS ’58, PhD ’63 Jeff Lawrence ’79 and Diane E. Troth ’80, MS ’81 Sanboh Lee
Keith R. Leonard, Jr. ’84, MBA ’95 and Nanette L. Leonard ’84 ¢ Ralph C. Levin ’51 Craig R. Moles MS ’89 and Nancy L. Moles ¢ James Murray ’70, MS ’71 and Carol L. Donald Carey S. Nachenberg ’95, MS ’95 ¢ Daniel C. Pappone ’77 and Syndie B. Meyer Kenneth W. Privitt ’77, MS ’80 and Nancy G. Privitt ’78 Alfonso Fred Ratcliffe ’51, MS ’63, PhD ’70 and Dolores C. Ratcliffe Joseph J. Rice ’88 and Monica Rice Glenn M. Sakamoto ’82, MS ’84 Peter B. Sender and Haya S. Sender, Parents ’09 ¢ Durwin L. Sharp ’70, MBA ’74, PhD ’79 and Christianne Melanson Akira Shinoda ’67 ¢ Steve J. Shire and Maria Yang, Parents ’13 Chet M. Thaker ’74 and Julie Dobson Brian J. Thompson and Janet L. Thompson, Parents ’15 David K. Triolo ’80 ¢ Sarah M. Vasquez ’08 Benjamin C. Wang ’90 and Diana Tran Wang ¢ Feng C. Wang MA ’65 and Yung H. Wang* MBA ’70 ¢ Benjamin M. Wu and Betty Wu ¢ Russell G. Yee and Anne C. Wang Yee ’89 ¢ Guo-Feng Yuan Boelter Contributors - $1,000 - $2,499 Arlene G. Adams John S. Adams ’62
45
Tien-Tsai Yang PhD ’68 and Jane J. Yang PhD ’71 ¢ Boelter Associates - $2,500 - $4,999 Jacqueline N. Anderson ’06 William Ballhaus, Jr. and Jane K. Ballhaus ¢
UCLA ENGINEER |
James D. Barrie ’83, MS ’85, PhD ’88 and Leslie A. Momoda ’85, MS ’87, PhD ’90 ¢ Mark Berman MS ’92, PhD ’95 and Sharon B. Berman ’91 Ming-Li Chai
46 UCLA ENGINEER |
Darren Aghabeg ’89 and Angela Aghabeg Song-Haur An MS ’81, ENG ’83, PhD ’86 and Agnes An James Edward Anhalt, III ’92 and Lisa Anhalt
Leang-Kai Chang and Li-Chu Wu, Parents ’13 Stanley E. Charles ’56, MS ’68 and Mary Louise Charles ’60 Eddie C. Chau ’89 Francis F. Chen and Edna L. Chen
James L. Doane ’68 and Jean M. Doane ’70 Joe Donahoo and Luisa Tam Wayne Dunlap ’68 and Elise G. Dunlap Mordecai N. Dunst ’75 and Karen R. Dunst, Parents ’13
Richard E. Arnell and Cynthia A. Arnell, Parents ’13 Ethan Aronoff PhD ’71 and Barbara Aronoff Lawrence K. Au ’04, MS ’07, PhD ’11 and Gigi K. Lau ’04 Rajive L. Bagrodia and Anju Bagrodia Lisa L. Barker ’84 John R. Barr MS ’70, PhD ’78 and Mary E. Barr Richard S. Baty PhD ’70 and Linda S. Baty Paul T. Bent ’73 and Barbara J. Bent Erik C. Berg ’89, ENG ’95 and Phyllis Fang ’90 Stevan A. Birnbaum ’65 Brian K. Blockhus and Terese C. Blockhus, Parents ’15 Heather B. Blockhus ’15 Glen Boe ’60 and Jean E. Boe Michael Bruner ’80 and Judy Bruner ’80 Henry W. Burgess MS ’75 and Cindy Burgess Barak H. Bussel MS ’93 MBA ’95 and Helen Liu MS ’04 Scott G. Campbell ’04 Paul H. Chandler MS ’74 and Kathleen R. Chandler Benny C. Chang ’70, MS ’72 and Janet B. Chang ’77 Chia-Ming Chang MS ’07, PhD ’07 Frank M. Chang and Shelly Chang, Parents ’02
Tong-Chen Cheng and Jennifer Jan, Parents ’12 Ken C. Cheng MS ’92, PhD ’95 and Tiffany C. King Louis T. Cheng MS ’71 and Geraldine F. Cheng Steve Chiou and Patricia Lee, Parents ’15 Loren A. Chow PhD ’99 and Jenny Ko JD ’97 Wesley W. Chu and Julia Chu Christopher A. Clark, Jr. ’08 Neal M. Cohen ’87 and Adrienne D. Cohen ’86 Joseph L. Coleman and Kathleen Y. Coleman JD ’84, Parents ’14 John D. Cosgrove ME ’67 and Shirley M. Cosgrove Karal D. Cottrell ’60 and Ann R. Cottrell Lucien Alfred Couvillon, Jr. ’62, MS ’66 and Mary L. Couvillon Benjamin F. Cowan ’67, MD ’75 and Lettie M. Burgett Eric A. Cullenward and Laurie A. Cullenward, Parents ’12 Curtis L. Dahlberg ’73 Hans J. Dall and Carolyn R. Dall, Parents ’14 Robert A. Dell-Imagine MS ’60, PhD ’65 and Helen R. Dell-Imagine ’60, CRED ’61 Patrick W. Dennis ’76, MS ’78, MBA ’82, JD ’82 and Nancy L. Dennis ’79 Prithviraj Dharmaraja and Nirmala Dharmaraja, Parents ’11
Paul L. Dutra ’96 and Holly H. Liu ’99 Charles H. Eldredge and Melissa M. Eldredge, Parents ’13 Thomas E. Ellis and Donna Mae Ellis, Parents ’13 Augustine Moses O. Esogbue ’64 Mark F. Flores ’08 Gregory A. Fountain and Annette C. Fountain, Parents ’14 R. E. Frederking David G. Frostad ’59 and Peggy J. Frostad ’59 Terry N. Gardner PhD ’75 and Shifra Gardner Arnold J. Gaunt ’86 Rodney C. Gibson MS ’66, PhD ’69 and Nancy P. Gibson, Parents ’92 Vanessa Ozuna Ginzton ’97 and Matthew D. Ginzton Albert J. Glassman PhD ’71 Thomas P. Goebel PhD ’69 Anthony T. Gomez ’69 William R. Goodin MS ’71, PhD ’75, ME ’82 and Caroline Dockrell Gagandeep S. Grewal ’93 and Ramanjit K. Grewal Arnold Hackett ’87 William Hant PhD ’70 and Myrna A. Hant ’64, PhD ’87, Parents ’96 Frank J. Hanzel, Jr. ’79, MS ’81 Adam David Harmetz ’05 and Helen Harmetz ’04 Correta K. Harris ’83
Howard S. Nussbaum ’71, MS ’72, PhD ’76 and Deborah M. Nussbaum Lincoln D. Odell ’56 Sallie B. O’Neill Robert Oshiro ’81 William Overman ’73, PhD ’81 and Rita Overman Steven N. Pappas ’87, MBA ’91 and Christine M. Pappas ’87, MBA ’92 Sanjay K. Parikh and Asha S. Parikh, Parents ’09 Chan K. Park ’91 and Cindy S. Park Christopher G. Peak and Jacquelyn J. Weber, Parents ’12 John B. Peller MS ’66, PhD ’68 and Pat Peller Daniel J. Peterson ’80 and Lisa J. Peterson ’81 Martin Posner ’56 and Thao Posner, Parents ’14 Steven D. Powell ’00, MBA ’10 Jacob J. Rael MS ’95, PhD ’07 and Elia L. Perez ’93, MSN ’00 Rami R. Razouk ’75, MS ’75, PhD ’80 and Deborah D. Downs PhD ’80 Paul B. Ricci MS ’80 and Valeria W. Ricci Christopher A. Rimer ’91 and Christine Rimer ’93 Peter B. Robertson and Diana L. Robertson, Parents ’15 Rhonda M. Sakaida ’81, MS ’84 Roy R. Sakaida ’53 and Dorothy W. Sakaida ’55, Parents ’83, ’84, ’86, ’86 John P. Schauerman ’79 and Claudia H. Schauerman Christopher Peter Schlies and Christine C. Schlies, Parents ’12 Van N. Schultz ’74, MS ’75 and Susan R. Schultz ’75, Parents ’04
47
Wai K. Ho ’78, MS ’79 and Sou K. Ho Frederick Hans Hoffman and Stella Ann Hoffman, Parents ’11 Yasukazu Hoshino MS ’94, PhD ’02 Donald R. Howard ’58 and Edwina Howard Kenneth F. Hsiang ’13 Kevin Hsiang Linden Hsu ’91 Terry Huang and Cindy Huang, Parents ’13 Ryan Hundley Reginald Jue MS ’80 and Kathryn Cooperman Jue Reynold S. Kagiwada ’60, MS ’63, PhD ’66 and Harriet Kagiwada Josephine Y. Kao ’96 Ann Renee Karagozian ’78 and Theodore Aram Sarafian Andrew E. Katz ’69, JD ’72 and Denise L. Katz Dr. Paul Kazimiroff and M. Renee McReynolds, Parents ’13 James J. Killackey ’57 and Cynthia M. Killackey Seon Myung Kim PhD ’90 Yong U. Kim MS ’83, PhD ’87 and Elizabeth Kim Kerry H. Kokubun, Parent ’12 Kevin Michael Kolnowski and Shirley M. Kolnowski, Parents ’12, ’12 Rosalie K. Kuhlmann ’91 Rodney A. Kurihara and Peggy S. Kurihara, Parents ’13
Robert C. Leamy ’70 and Patricia Watts Leamy ’70 Francis P. Lee and Christine S. Yip, Parents ’14 John M. Lee MBA ’86 and Lily T. Lee, Parents ’13 Peter S. Lee ’70 Sai Cheong Lee and Chung Ping Lee Lue, Parents ’12 Shawmo E. Lin and Grace Lin, Parents ’13 William H. Lingle, IV ’80 Yuk C. Lo ’84 Howard Khanh Luu ’92 and My T. Luu Gary E. MacDougal ’58 and Charlene MacDougal Asad M. Madni ’69, MS ’72 and Gowhartaj A. Madni, Parents ’08 Brian W. Marbach ’77 and Phyllis Rafferty Marbach MS ’84 Donald R. Martin PhD ’76 and Melissa C. Martin MS ’75 Juan V. Martinez ’81 Roxann M. Marumoto ’85, MS ’87 and David H. Julifs Brian N. Mc Innis ’95 Scott Mishima ’87 Harold G. Monbouquette and Jeannette Monbouquette Roger Murry ’73, MS ’76 and Catherine B. Murry Don S. Myers ’64 and Deborah K. Myers Mas Nagami ’53 and Dorothy Nagami Kenneth W. Nam and Elena Nam, Parents ’13 Fabiola Navarro Andrew Kenneth Newman MS ’95, PhD ’05 and Amy Lam ’94 William E. Nicolai, Jr. ’50 and Mary L. Nicolai
UCLA ENGINEER |
Jonathan K. Hart MS ’84, ENG ’85, PhD ’88 and Kirsten E. Hart Jan C. Harzan ’76 and Annette Harzan Barbara C. Heiller ’69 and Larry Heiller Jerre A. Hitz ’58, MS ’61 and Nancy K. Hitz ’60
Helene Terris Chantal Toporow ’78, MS ’81, PhD ’86 Che M. Tsai ’88 and Josan C. Chen Frank C. Tung PhD ’68 and Roberta T. Tung Brad Vartan and Vestoria Vartan
Barak H. Bussel MS ’93 MBA ’95 and Helen Liu MS ’04 Jiwen Cai MS ’12 Scott G. Campbell ’04 Chia-Ming Chang MS ’07, PhD ’07 Calvin C. Chong ’12
Efren Vasquez ’07 Jonathan A. Walcott ’02 Kang Wang and Edith S. Wang Raymond Wang and Shirley C. Wang, Parents ’10 Sherman S. Wang ’04 Jeffrey S. Way ’76 and Linda K. Way, Parents ’12 Gershon Weltman ’58, MS ’60, PhD ’62 and Tova Weltman ’61 Leland Z. Wiesner ’87 Charles E. Wilcoxson ’85, MBA ’94 and Jeanine W. Wilcoxson John Suihon Wong ’74 and Ruth Manling Wong Kim Fan Wong and Christine F. Ng, Parents ’13 Kin Wah Wong PhD ’77 Tao Wu MS ’09, PhD ’11 Shigeru Yoshida Farouk Youssef and Laila Hanna, Parents ’11 Stanley S. Yue ’80, MS ’84 and Alice Law ’81, MS ’83 Tongyi Zhang Anonymous
Victor K. Chu ’05 Christopher A. Clark, Jr. ’08 Harris C. Crozier ’12 Gregory Z. Ferl MS ’03, PhD ’05 Mark F. Flores ’08 Rajindra S. Handapangoda ’05, MS ’06 Adam David Harmetz ’05 and Helen Harmetz ’04 Terence Foster Heinrich ’08, MS ’11 and Julie Lanier Heinrich ’07 Bradley S. Hirasuna ’02, MS ’04 Daniel P. Ithurburn ’09 Joshua L. Laheru MS ’11 and Joanna Chen Owen A. Lutje ’10 Jamal A. Madni MS ’08 Ryan Martin ’03, PhD ’08 Olaleke O. Owolabi ’10 Angela Renae Pinley ’07 Andrew W. Pryor-Miller ’08 Eric K. Sender ’09, MS ’12 Harpreet Singh ’04 Julia S. Sizto ’10 Efren Vasquez ’07 Sarah M. Vasquez ’08 Vishal Vaswani ’10 Jonathan A. Walcott ’02 Taikang Martin Wan ’09 Sherman S. Wang ’04 Andrew J. Winther ’03 Tao Wu MS ’09, PhD ’11 Qiyue Zou, PhD ’08
Young Professional Boelter Society Jacqueline N. Anderson ’06 Lawrence K. Au ’04, MS ’07, PhD ’11 and Gigi K. Lau ’04 Laura C. Basualdo ’08 Aidan S. Begg ’08 Heather B. Blockhus ’15
We have made every effort to ensure the completeness and accuracy of this Honor Roll. If you discover an error, please contact the Office of External Affairs at (310) 206-0678 or email hsseasgiving@support.ucla.edu.
Printed on recycled paper
48 UCLA ENGINEER |
Hermann D. Schurr ’82, MS ’85 and Juliet N. Schurr ’82, MS ’86, Parents ’12 David E. Schwab MS ’67 and Gretchen A. Burton ’66 Stephen S. Schwartz, Parent ’13 William M. Scott and Jill Baran Scott, Parents ’13 Shara Nicole Senior ’01 Michelle A. Sequerth ’03 George M. Shannon, Jr. and Linda A. Shannon ’76 Phillip M. Shigemura ’69, MS ’71 and Joyce M. Shigemura Takashi Shiozaki ’69 and Leslie E. Shiozaki Michael W. Sievers ’73, MS ’75, PhD ’80 and Charlene M. Sievers Yet M. Siu ’53 and Marion L. Siu, Parents ’75, ’77, ’78 Ning C. Sizto and Minda S. Sizto, Parents ’10 Bruce J. Smith ’65 and Cynthia C. Smith David P. Smith MS ’68 William R. Snow and Judy S. Snow, Parents ’12 Craig W. Somerton ’76, MS ’79, PhD ’82 Alfred W. Sommer and Joyce Sommer Alex Spataru ’70, MBA ’79 and Anne-Marie Spataru MBA ’78 Ronald S. Squires and Sherri L. Squires, Parents ’13 V. V. Srinivasan and Padmini Srinivasan, Parents ’13 Frederik N. Staal MS ’87 and Dara J. Staal Oscar M. Stafsudd, Jr. ’59, MS ’61, PhD ’67 and Jacqueline Stafsudd ’69 David W. Stephens MS ’89 Jeremy L. Switzer ’98, MBA ’07 and Midco K. Switzer Norito R. Takamoto ’56 and Takaye Takamoto
What does the future hold? Thanks to the UCLA Henry Samueli School of Engineering and Applied Science, the future is bright. UCLA Engineers are conducting research that will create better sources of clean and renewable energy, improve the ability to detect and cure cancer, enhance cyber security, and make infrastructure stronger and safer. Bruin Engineers like you, who support the UCLA Engineering Fund, are enabling UCLA Engineering’s faculty and students to make a real and critical impact on our world.
You can Fund the Future. MAKE A GIFT TO THE UCLA ENGINEERING FUND TODAY. Make your gift online at www.engineer.ucla.edu/ give or by calling 310-206-0678.
THE UCLA ENGINEERING FUND | Enhancing Engineering Excellence
NON-PROFIT ORG. U.S. POSTAGE PAID UCLA 405 Hilgard Avenue Boelter Hall Suite 7256 Box 951600 Los Angeles, CA 90095-1600
UPCOMING EVENTS Engineering VI Building Groundbreaking Ceremony and Reception OCTOBER 26, 2012
Parents’ Weekend NOVEMBER 2-4, 2012
Engineering Awards Dinner NOVEMBER 2, 2012
Tech Forum MARCH 2013