Page 1

SPRING 2014, Issue No. 31

ONLINE MASTER’S PROGRAM RANKS 2nd IN U.S.


FROM THE DEAN

E

ngineering education is changing, and the UCLA Henry Samueli School of Engineering and Applied Science is leading the way. Earlier this year, our Master of Science in Engineering Online Program (MSOL), founded in 2007, was ranked the No. 2 online engineering program in the country by U.S. News & World Report. Online education is becoming an increasingly important tool around the world, and is especially so for working engineers looking for ways to enhance their skills and advance their careers. The UCLA Engineering MSOL Program earned the high ranking by requiring the same rigorous coursework demanded of on-campus students, and by relying on the instructional skills of our world-class faculty, more than 50 of whom deliver online lectures, offer office hours for MSOL students and encourage students who may not meet in person to work together to achieve their goals. Meanwhile, our commitment to the traditional, hands-on engineering

UCLA ENGINEERING DEAN

Vijay K. Dhir

ASSOCIATE DEANS

Richard D. Wesel

Academic and Student Affairs

Jenn-Ming Yang

DEPARTMENT CHAIRS

Dwight C. Streit

Bioengineering

Tsu-Chin Tsao

Benjamin Wu James C. Liao

Chemical and Biomolecular Engineering

International Initiatives and Online Programs

Jonathan P. Stewart

Research and Physical Resources

Jens Palsberg

ASSISTANT DEAN

M.C. Frank Chang

Jane P. Chang

Mary Okino

Chief Financial Officer

Civil and Environmental Engineering Computer Science

Electrical Engineering

education UCLA has offered for nearly 70 years is as strong as ever. Engineering VI, our 150,000-squarefoot anchor for innovation, is rising in the heart of the UCLA campus. We look forward to opening the first phase of the building, with state-of-the-art labs and research facilities, in the fall of 2015. A key to Engineering VI has been the generous support of our alumni. Whether providing major gifts or making contributions through our Alumni Legacy Campaign, alumni are helping the school prepare for the next generations of UCLA engineers. I thank those who have contributed, and encourage others to show their support by helping us create a facility that will play a vital role in fostering innovation to improve our world and in educating tomorrow’s engineering leaders. Sincerely,

Vijay K. Dhir Dean

Materials Science and Engineering

Matthew Chin

Communications Manager and Writer

Mechanical and Aerospace Engineering

HauChee Chung

EXTERNAL AFFAIRS COMMUNICATIONS

OFFICE OF EXTERNAL AFFAIRS

Sheila Bergman

Executive Director

Bill Kisliuk

Media Relations and Marketing Director

Designer

7256 Boelter Hall, Box 951600 Los Angeles, CA 90095-1600 (310) 206-0678 www.engineer.ucla.edu uclaengineering@support.ucla.edu


S PR I NG 2 01 4  |   Issue No. 31

02 | By the Numbers 04 | Breakthroughs 18 | New Faculty 20 | School News 26 | Alumni News

6

ONLINE MASTER’S

UCLA’s Master of Science in Engineering Online Program wins accolades.

8

INSPIRED BY NATURE

Researchers find the sources for innovation in the natural world.

On the cover: Associate Professor Suneel Kodambaka in a lecturerecording studio at the UCLA Master of Science in Engineering Online Program. Photo by Joanne Leung

14

ENTERING THE ACADEMY Two professors are elected to

NAE, bringing the membership from UCLA Engineering to 28.


UCLA ENGINEERING

— by the numbers —

120 16,800 4.44 658 2,140 160 scholarships were awarded in the 2013-14 school year.

The median weighted GPA of those enrolled is

Nearly

students applied for freshman admission for Fall 2013.

and median SAT score is

were enrolled.

out of 2,400.

students received their Ph.D. in 2012-13.


28

affiliated faculty are members of the National Academy of Engineering.

10

th

The school is ranked

in the world by the Times Higher

Education World University Rankings.

4

th

The school is ranked

in the world by Microsoft Academic

Search over the past 10 years for scientific influence based on the number of papers

published and the number of times

The UCLA Engineering online

master’s degree program is ranked

in the country by U.S. News & World Report.

UCLA ENGINEER  | 

2

nd

3

published papers are cited by others.


BREAKTHROUGHS

Synthesizing

BETTER BIOFUELS JAMES C. LIAO

Ralph M. Parsons Foundation Professor of Chemical Engineering

I

mproving the production of non-polluting biofuels, engineering

researchers have developed a method to break down glucose with 50

percent greater efficiency than had been done previously. In glycolysis,

the process that nearly all organisms use to convert sugars into energy,

four of the six carbon atoms found in glucose are used while two are

lost as carbon dioxide. The UCLA team's synthetic process converts all six

glucose carbon atoms – the precursor for biofuels such as ethanol and butanol – without losing any as carbon dioxide.   n

p Pollution solution: Professor James Liao and

his team synthesized an efficient path to convert glucose to fuel.

FASTER, COOLER Computer Processing

KANG L. WANG, Raytheon Professor of Electrical Engineering PEDRAM KHALILI, Assistant Adjunct Professor in Electrical Engineering

P

owering up processors faster while reducing their use of electricity,

UCLA ENGINEER  | 

4

p

Multiferroic magnetic materials can reduce the amount of electricity used – and wasted – by processors.

UCLA researchers have demonstrated that using multiferroic materials

could increase the power efficiency of processors by up to 1,000 times. Currently, microprocessors use electric current to power computer

processing functions. A new class of multiferroic magnetic materials – which can be switched on or off by applying alternating voltage

and which carry power through the spin of electrons, rather than

current – reduce the amount of power consumed and heat wasted by logic devices.   n


A Nanoscale Solution for

BLOOD CLOTS

q A

thin layer of carbon on implanted medical devices can spur production of an anticoagulant.

YU HUANG, Associate Professor of Materials Science and Engineering

W

orking at the intersection of biochemistry and nanomaterials, UCLA

and University of Michigan researchers have developed an ultra-thin

material to reduce the risk of blood clots caused by catheters and other implanted medical devices. The risk of blood clots rises if implants

cut off the flow of nitric oxide, a clot-preventing agent generated in

blood vessels. The team used a layer of carbon that coats the devices,

integrating glucose oxidase and haemin to catalyze production of

nitroxyl, which mimics the function of nitric oxide.  n

GOOGLE GLASS, M.D. AYDOGAN OZCAN

Chancellor's Professor of Electrical Engineering and Bioengineering

T

he medical lab is coming to you, via your wearable computer. UCLA

researchers developed an app and server platform allowing Google Glass

users to get detailed results of diagnostic tests in as little as eight seconds.

The computer’s hands-free camera

captures images of the test strips. The

eye can, then displays the results. The technology could improve public

health monitoring in disaster-relief

areas or quarantine zones.   n

p A Google Glass app reads and quickly

relays sophisticated information from diagnostic medical tests.

UCLA ENGINEER  | 

5

UCLA technology reads the results

in far greater detail than the naked


Mastering the Art of

Online Education While earning his graduate degree in engineering from UCLA, Miko Wade has been on duty in Africa, in training in Maryland and at work in Ventura County. One place he hasn’t had to be is on the UCLA campus. Wade, 43, is one of hundreds of working engineers who have earned their master’s degrees from UCLA’s Master of Science in Engineering Online (MSOL) Program. The program is recognized as one of the best. In January, U.S. News & World Report ranked it the No. 2 online graduate program in engineering in the country, giving it high marks for faculty q Miko Wade, a lieutenant

in the Navy Reserve and systems engineer who earned his master’s degree in engineering through UCLA’s MSOL program.

credentials, technology, student engagement and admissions selectivity. The MSOL program will grow and improve in the coming years. Possibilities include offering degrees and certificates in several specific engineering disciplines, as well as creating a hybrid online/on-campus program with university partners in Asia. Christopher Lynch, a mechanical and aerospace engineering professor who led the MSOL program from 2008 to 2013, said the program is tailored for working engineers. “Students can watch lectures during lunch breaks and evenings, do homework in their off hours, and take exams on Saturdays,” he said. “This flexibility is critical to employed students.” A master’s degree can unlock doors, according to Jenn-Ming Yang, UCLA Engineering’s associate dean for international initiatives and online programs. “It’s at the M.S. level that engineers have the opportunity to learn a specialization in depth and update their knowledge of rapidly changing

UCLA ENGINEER  | 

6

technologies,” Yang said. Photo courtesy Miko Wade

Wade, who earned a bachelor’s degree in


computer science from California Lutheran University, enrolled in the MSOL program in 2007. But the lieutenant in the Navy Reserve was redirected by a call to active duty as an aerospace maintenance duty officer. That responsibility took him to various locations in the U.S. for training and then East Africa to track pirates in the coastal waters. After nearly three years, he returned to school. He said his studies helped him with both his military work and in his civilian role as a systems engineer for TASC, Inc. The physical distance did not diminish the connections he made with his fellow students, his faculty advisor – electrical engineering professor Mihaela van der Schaar – and others. “The professors were all excellent,” said Wade, who graduated in 2013. “I had unique experiences with each of them that made me appreciate

Photo: Joanne Leung

UCLA ENGINEER  | 

Professor Ertugrul Taciroglu in a studio at the UCLA u Master of Science in Engineering Online Program.

7

every one.”  n


Nature-Inspired ENGINEERING LOCOMOTION CONTROL

From a manta ray gliding

through the ocean depths

t A swimming

fin in Tetsuya Iwasaki’s lab.

to a snake slithering along the ground, the animal kingdom has provided move around in changing environments. Tetsuya Iwasaki, professor of mechanical and aerospace engineering, and researchers in his lab are exploring the neuronal control mechanisms underlying animal locomotion, their optimality and resonance, and applications for the design of dynamic feedback systems. Recent studies include fish and ray biology and robotic prototypes.  n

UCLA ENGINEER  | 

8

http://www.seas.ucla.edu/~iwasaki/

“We aim to establish a control theory for coordinated oscillations by translating biological knowledge to engineering principles. The fundamental research will have a broad range of potential applications, including robotic vehicles, assistive devices, neural prostheses, locomotor rehabilitation, and brain-state control. ” – Tetsuya Iwasaki

Photo: Joanne Leung

many examples of how to adapt to and


For several UCLA Engineering faculty members, a primary research focus is exploring the elegant

solutions nature has already devised to solve problems,

and adapting those solutions for new technologies

Photo courtesy Professors Pruvost and Legrand, University of Nantes, CNRS.

and products.

“We are investigating the interaction between light and photosynthetic microorganisms and developing tools and strategies to maximize their lipid production.” – Laurent Pilon p Photobioreactors are

MICROALGAE ALTERNATIVE

Biofuels – in particular those produced by photosynthetic microorganisms such as microalgae – may prove to be powerful

alternatives to fossil fuels in addressing climate change and energy security concerns. Microalgae, found in oceans and freshwater, need sunlight, carbon dioxide, water and nutrients to grow and produce lipids that can be converted into biodiesel. Laurent Pilon, professor of mechanical and aerospace engineering, and his research group are exploring several applications for sustainable energy, including how microalgae grown in photobioreactors can most efficiently utilize and convert incoming light energy.  n www.seas.ucla.edu/~pilon/

used to grow microalgae and help create renewable biofuels.


Image Courtesy of J. Eldredge

“To achieve their remarkable abilities, airborne and aquatic creatures exploit the mechanics of their medium in intricate ways. We are developing novel tools to distill and model the essential mechanics of locomotion, so that engineered vehicles and systems can be more robust and agile or extract more energy from their environment.” – Jeff Eldredge

t A model of vortices

BIO-INSPIRED MICRO AERIAL VEHICLES

Think of a hummingbird, or a dragonfly. Much like those masters of flight, small but highly maneuverable aircraft that

can stop on a dime and change direction hold great promise

UCLA ENGINEER  | 

10

for aviation and aerospace exploration. Jeff Eldredge, associate professor of mechanical and aerospace engineering, leads the Simulations of Flow Physics and Acoustics Laboratory, which specializes in studying unsteady flows – for example, air around a flapping wing. The lab’s projects include modeling aerodynamics of agile bio-inspired micro air vehicles, as well as fluid flows around flexible structures (like the water around an undulating fish).  n http://kefalari.seas.ucla.edu/~jeff/SOFIA/

produced by a three-link swimmer (fish).


100 PERCENT ALL NATURAL

One of the most important breakthroughs of the 20th century was the discovery that penicillin, produced by a common mold, has

antibiotic properties. Yi Tang, professor of chemical and biomolecular engineering, sees enormous potential for the discovery of more bioactive natural products – chemical compounds produced in nature with beneficial pharmacological or biological effects. A major research area of his lab is the discovery of these products and understanding their properties, with a current focus on using a diverse set of fungal species.  n http://www.seas.ucla.edu/~yitang/

p Researchers are using

fungi to identify natural products with potential pharmacological or other benefits.

“Natural product discovery has been based on what organisms produce in culture. But we don’t know how good nature truly is, and our lab is exploring the full capabilities of those organisms.” – Yi Tang


UCLA ENGINEERING ON THE RISE …

Alumni Are Playing a Critical Role in Building a New Anchor for Innovation

L

ooking to expand upon its role as one of the world’s preeminent centers for engineering

Center, a technology-enabled 250-seat hall n The

Engineering and Applied Science is building

n Offices

Engineering VI. Construction on the first phase of the

Lawrence and Carol Tannas Alumni Suite and laboratories for research in

information science, information technology and computation n Externally

funded centers of excellence

150,000-square-foot building is under way in the

awarded to UCLA Engineering for research

heart of the UCLA campus, and will be completed

on nanoelectronics, nanotechnology and

early in 2015. Construction on the second and final phase of the six-story building is scheduled

green energy n The

Institute for Technology Advancement (ITA),

to start in the spring of 2015 and be completed

which helps launch companies based on UCLA

in 2017.

Engineering innovations

UCLA Engineering Alumni are playing a critical role in this exciting development by contributing to the Alumni Legacy Campaign for Engineering VI. Through the campaign – in which alumni who donate at least $1,000 over a

n Conference

and meeting rooms for graduate

student researchers n LEED

Gold certification for sustainable design

and use of materials Engineering VI will be a showcase for the

three-year period will be honored in the lobby of

university and the region, spurring innovation

the building – the school has gained momentum

and helping to educate generations of UCLA

towards reaching its goals.

Engineering leaders.  n

But additional funds are needed to complete Engineering VI, which will host:

12

Dr. William M.W. Mong Memorial Learning

education, the UCLA Henry Samueli School of a state-of-the-art anchor for innovation,

UCLA ENGINEER  | 

n The

Phase I of Engineering VI, UCLA Engineering’s new anchor u for innovation, under construction in February 2014.

TO DONATE, FIND OUT ABOUT EMPLOYER GIFT-MATCHING OPPORTUNITIES OR LEARN MORE ABOUT THE ALUMNI LEGACY CAMPAIGN: CALL: 310.206.0678 EMAIL: uclaengineering@support.ucla.edu VISIT: https://giving.ucla.edu/EngineeringAlumniLegacyCampaign


UCLA ENGINEER  | 

13


FACULTY

Photos: Joanne Leung

Honors and Awards

CHANDRASHEKHAR JOSHI Distinguished Professor of Electrical Engineering

C

handrashekhar Joshi was recognized for “contribu-

tions to the development of laser and beam-driven

plasma accelerators.” Joshi is known as the founder of the experimental field of plasma accelerators and has made significant contributions in nonlinear optics of plasmas, laser fusion and basic plasma physics. His UCLA group remains at the forefront of its field, and the lab has nurtured many students and researchers

UCLA ENGINEER  | 

14

who have gone on to form their own research teams. The ultimate goal of his research is to provide a paradigmchanging technology for building particle accelerators for fundamental research, as well as for medical and industrial applications. Joshi joined UCLA as a researcher in 1980, and previously has been honored by the American Physical Society, IEEE and the Engineers’ Council, among others.   n


Two faculty members have been elected to the prestigious National Academy of Engineering

ALAN N. WILLSON, JR. Distinguished Professor Emeritus of Electrical Engineering

A

lan N. Willson Jr. was recognized for "contributions to the

theory and applications of digital signal processing." Willson, the Charles P. Reames Chair in Electrical Engineering, has played

an important role in the field of circuits and systems. He and his students have been responsible for cutting-edge research in theory and application of digital signal processing (including very large scale integration, or VLSI, implementations), digital filter design and nonlinear circuit theory. He worked for IBM and Bell Laboratories before joining the UCLA faculty in 1973. He also has served as the engineering school's assistant dean for graduate studies and as associate dean. Willson retired from full-time teaching in 2013 but is continuing his affiliation with UCLA through a three-year

among others.  n

UCLA ENGINEER  | 

IEEE and the American Society for Engineering Education,

15

appointment as research professor. He has been honored by


Photo: Matthew Chin

Recipient of the 2013 Presidential Early Career Award for Scientists and Engineers

MONA JARRAHI Associate Professor of Electrical Engineering

M

ona Jarrahi has been honored with a Presidential

Early Career Award for Scientists and Engineers (PECASE) by President Barack Obama. The award is the highest honor bestowed by the U.S. government on science and

engineering researchers in the early stages of their careers. Jarrahi focuses on developing next-generation devices and integrated systems for terahertz/millimeter-wave sensing, imaging, computing and communication systems. She is working to develop ultrafast optoelectronic technol-

UCLA ENGINEER  | 

16

ogies for use in medical imaging and diagnostics, remote sensing for biological and atmospheric applications, pharmaceutical quality control and security screening. She has received many honors, including the National Academy of Engineering’s Grainger Foundation Frontiers of Engineering Award.  n


What does the future hold? Thanks to the UCLA Henry Samueli School of Engineering and Applied Science, the future is bright. UCLA Engineers are conducting research that will create better sources of renewable energy, improve the ability to detect and cure cancer, enhance cybersecurity, and make our physical infrastructure stronger and safer. Bruin Engineers who support the UCLA Engineering Fund are enabling faculty and students at UCLA Engineering to make a positive impact on our world.

You Can Fund the Future. MAKE A GIFT TO THE UCLA ENGINEERING FUND TODAY. Make your gift by calling 310.206.0678 or visiting www.engineer.ucla.edu/giving.

THE UCLA ENGINEERING FUND | Enhancing Engineering Excellence


FACULTY

UCLA Engineering New Faculty

UCLA ENGINEER  | 

18

News

STEPHANIE SEIDLITS Assistant Professor of Bioengineering Ph.D. – University of Texas at Austin, Cockrell School of Engineering

S

tephanie Seidlits’ research is at the

neuroscience techniques to enable discoveries

interface of engineering, neuroscience and

and the ability to precisely manipulate

medicine. In the spinal cord, disease and

the spinal cord microenvironment to

injury invoke inflammatory responses that

promote repair.

transform the local tissue environment

Most recently, Seidlits was a post-doctoral

into one that inhibits repair. Seidlits aims

fellow in chemical and biological engineering

to develop innovative therapies to restore

at Northwestern University’s Robert R.

spinal cord function by simultaneously

McCormick School of Engineering and

addressing multiple aspects of this inhibitory

Applied Science. Her honors include the Ruth

environment. To accomplish this, she

L. Kirchstein National Research Service Award

combines modular design of bioengineered

for Post-Doctoral Training from the National

microenvironments with quantitative

Institutes of Health.  n


DENNIS HONG Professor of Mechanical and Aerospace Engineering Ph.D. – Purdue University

D

ennis Hong’s research focuses on robot locomotion

and manipulation, autonomous vehicles and humanoid robots. He is the inventor of a number of novel robots and mechanisms, including “whole skin locomotion” for mobile robots, inspired by how amoeba move; a unique threelegged waking robot, STriDER; an air-powered robotic hand, RAPHaEL; and the world's first car that can be driven by the blind. Hong led teams that won top prizes at various highprofile robotics competitions, including the autonomous robot soccer competition RoboCup (world champions

2011, 2012, 2013), the autonomous vehicle competition DARPA Urban Challenge (third place, $500,000, 2007) and the disaster relief robotics competition DARPA Robotics Challenge (2013.) Hong’s honors include the National Science Foundation's CAREER award, SAE International's Young Investigator Award. He was named to Popular Science's "Brilliant 10" in 2009 and presented his work at the TED 2011 conference. Prior to joining UCLA, Hong was on the mechanical engineering faculty at Virginia Tech.  n

Photo courtesy Dennis Hong

Ralph R. Teetor Award, and the ASME Freudenstein/GM


News u

2013 bioengineering students Derek Go and Jaideep Dudani, center, with Bioengineering Medical Society President Gilda Barabino, right, and a representative from the National Collegiate Inventors and Innovators Alliance.

Bioengineering Students Win Awards AND PAY IT FORWARD

A

By Matthew Chin

team of UCLA bioengineering students was honored

with two awards for engineering in 2013. Team members turned around and donated part of their winnings to

won this highly competitive challenge.

research excellence.

2013 National Collegiate Inventors and Innovators Alliance’s

initiate a new scholarship to recognize undergraduate The award-winning device design is called P-MED,

for personalized monitoring of enzyme dynamics. P-MED

could be used as a preliminary analysis tool to screen out

which drugs – such as those used to treat cancer – may be

20

ineffective or may even cause harm to a patient.

UCLA ENGINEER  | 

DEBUT Challenge in the diagnostic design category.

This is the second year in a row that a UCLA team has

The team included co-leaders Jaideep Dudani and

Derek Go, as well as Ankit Gupta, Gayane Kocharyan,

Roxanne Loo and Nova Wang. All were students in the 2013 Bioengineering senior capstone design sequence, where the project got its start.

Their device won top honors in the 2013 National

Institute of Biomedical Imaging and Bioengineering’s

The UCLA P-MED team also took second place in the

BMEStart Biomedical Design Competition.

The NIBIB award netted the group $10,000. Second

place at the inventor’s contest brought in another $5,000.

The team members voted to donate a significant part of

their winnings to start a new scholarship for UCLA bioengi-

neering majors.

“I think we benefitted an incredible amount from the

department and wanted to show our appreciation,” said Dudani, now in his first year of graduate school at MIT.

“Since all the professors and other staff do so much, this is how we can do our part as alumni.”  n

GGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCGATGCGTCCACAACGCTACAAATGTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCG

SCHOOL


An Early Start on ENGINEERING Giving tomorrow’s engineers a head start, the UCLA Henry Samueli School of Engineering and Applied Science hosts several programs for youth through its Engineering Science Corps.

High School Summer Tech Camp allows teens to work on a design

engineering project and get a taste of college life under the guidance of UCLA Engineering faculty and undergraduate mentors. The camp is held at the Creativity Center, a 5,000-square-foot technology sandbox on campus.

The High School Summer Research Program is designed for high school

juniors preparing to pursue an engineering education. In this eight-week

program, participants work alongside faculty and students in UCLA Engineering labs, attend faculty presentations and meet with the dean of the school.

UCLA Engineering also offers an Online Tutoring and Mentoring Program

to high school students taking STEM (science, technology, engineering and

math) courses. Mentors visit high school campuses and host the twice-annual UCLA Engineering Day.

UCLA ENGINEER  | 

21

For more information, visit https://esc.seas.ucla.edu


“No other club does professional networking like we do.” – Jessica Leung, SWE

SWE:

WOMEN ENGINEERING SUCCESS for STUDENTS By Bill Kisliuk

A

rich engineering education takes students

beyond the classroom with hands-on experience and networking opportunities.

UCLA Engineering is home to nearly 40

student-run engineering clubs, and none are

more active than the Society of Women Engineers. Founded in 1972, UCLA’s SWE chapter connects its members to each other, alumni and key industry

contacts through a steady stream of gatherings. SWE’s annual Evening With Industry –

which started 37 years ago as a potluck – in 2014 drew 300 people to UCLA’s Palisades Ballroom

UCLA ENGINEER  | 

22

for an elegant sit-down dinner and a keynote

address by Lorraine Fesq MS ’90, PhD ’93, chief

SWE’s Jessica Leung and Rajani Bansal at Evening With Industry.

technologist at Jet Propulsion Laboratory’s

Systems Engineering and Formulation Division. Attendees had one-on-one opportunities

to talk with representatives of roughly 30

companies – from AECOM to Xerox Corp. –


Photos courtesy SWE SWE participates in Wow! That’s Engineering!, which brings Girl Scouts onto campus for hands-on engineering education. SWE networking events, including Evening With Industry, connect students to a variety of industry partners.

and some students were offered

internships before the event ended.

“We’re here to reach out and help

students connect with companies and connect with each other,” said Rajani

Evening With Industry and a chemical engineering student.

plus many of their parents, to UCLA’s Court of Sciences.

together to bring opportunities to students.”

engineering path, while younger participants worked

Fesq said her support of SWE stems in part from

the common challenges that women face in science and

engineering.

“Girls are sometimes bumped off of the math-science-

engineering path for reasons that have nothing to do with their aptitude,” she said. “The women who have entered

college in these fields are members of a sisterhood who

have consciously chosen a technical field in spite of cultural

or social barriers.”

This academic year, SWE added a graduate student

arm, GradSWE, to advocate for women graduate engineers on issues such as professional development and work-life balance.

SWE, along with other student groups and volunteers,

also encourages the next generation of engineers through an event called Wow! That’s Engineering!

In February, Wow! brought more than 100 Girl Scouts,

Parents learned how to place their children on an together on science and engineering projects.

SWE also participates in Team Tech, in which multidis-

ciplinary groups of SWE members, supervised by industry

mentors, work on design-and-build projects and get a taste of what engineering life might be like after graduation. “One of the few things UCLA doesn’t teach is

networking,” said Jessica Leung, SWE-UCLA’s internal co-chair for Evening With Industry and a mechanical

engineering student. “No other club does professional

networking like we do.”

Amy Lin, the president of UCLA’s SWE chapter and

a student in computer science, said SWE is constantly

looking to expand its offerings and its reach – and not

just to women. “We definitely push to make sure women

engineers gain skills and opportunities,” she said. “But we

also encourage men to participate and see there are a lot of women engineers who are their peers.”  n

23

“We try to create this atmosphere where everyone works

UCLA ENGINEER  | 

Bansal, SWE’s external co-chair for the


Showcase Features DARPA Leader, Latest UCLA Research

t Clockwise from bottom: Tech Forum

2014 feature a keynote address by DARPA Director Arati Prabhakar, a poster display featuring the work of more than 100 UCLA Engineering students and an expert panel on aerospace and military research.


and computing and biotechnology breakthroughs – to

UCLA Engineering researchers were among the 400-plus people at Tech Forum 2014,

the largest gathering yet for the school’s annual showcase.

serve security and commercial applications.

Emphasizing that the era of seemingly limitless

investment in research and development has passed, she

said the cost of technological advances must come down. “It will require the deep innovation the technology

A

community provides to flip that cost equation,”

was followed by a panel of industry and faculty experts

technology strategy at The Boeing Co.; Timothy Frei, vice

rati Prabhakar, director of the Defense Advanced

Research Projects Agency, offered a keynote address

Prabhakar said.

The experts addressing aerospace and military

outlining the past, present and future of DARPA. She

research included Allen Adler, vice president of enterprise

discussing the state of aerospace and defense research.

president of communication systems in the Space Systems

In the afternoon, attendees talked with students

and viewed more than 100 posters illustrating UCLA

Engineering research. Later, faculty members offered

presentations on cutting-edge work in healthcare and energy technologies, cybersecurity and sustainable manufacturing.

Tech Forum 2014 was held Feb. 6 at UCLA’s Covel

division at Northrop Grumman Corp.; Neil Kacena, vice

president of technology innovation and strategic pursuits

for Raytheon Space and Airborne Systems; Mechanical and

Aerospace Professor Ann Karagozian; and Computer Science Professor Rafail Ostrovsky. The panel was moderated by Electrical Engineering Professor Robert Candler.

Frei and Adler both said university-industry partner-

Commons and was sponsored by Raytheon Co. Lockheed

ships are critical for advances in applied technology, and

afternoon parallel sessions were supported by The

technology is stable and reliable is of utmost importance

Martin Corp. sponsored the poster session, and the Aerospace Corp. and Cislo & Thomas.

Prabhakar emphasized that the most valuable products

emphasized that ensuring that new software and other to industry end-users.

UCLA Engineering Dean Vijay K. Dhir offered

of UCLA and other universities are the students prepared to

Excellence in Corporate Philanthropy Awards to three firms

technologies – including new materials, satellite systems,

Corp., Microsoft Corp. and Northrop Grumman.  n

take on the world’s challenges. She said DARPA is developing

Photos: Roberto Ysais

Leading figures in technology and top

with a long history of supporting the school – Broadcom

TECH FORUM POSTER SESSION COMPETITION WINNERS 2014 OVERALL: Ryan Conversano, Mechanical and Aerospace Engineering

POSTER DESIGN: Dan Wilkinson, Materials Science and Engineering SCIENCE: Scott Strutner, Mechanical and Aerospace Engineering VERBAL PRESENTATION: Garrett Mosley, Bioengineering

UCLA ENGINEER  | 

ENGINEERING: Yue Chen, Mechanical and Aerospace Engineering

25

APPLICATION: Kari Moses, Chemical and Biomolecular Engineering


ALUMNI

News A POSITIVE CHARGE FOR Electrical Engineering Alumnus Has Donated $1.5 million for EE Fellowships Deepening his commitment to the UCLA Henry Samueli School of Engineering and Applied Science, Mukund Padmanabhan MS ’89, PhD ’92 has brought his support for students in the Electrical Engineering Department to $1.5 million. In December, Padmanabhan made his third gift of $500,000 to support the Guru Krupa Foundation Fellowship in Electrical Engineering. Padmanbhan started the foundation, which seeks to assist impoverished families and provide opportunities in higher education to those who could not otherwise afford it, among other goals. Padmanabhan’s own experience inspired the fellowships. He received a bachelor’s degree in engineering from the Indian Institute of Technology in Kharagpur before applying for

Electrical engineering graduate students Anirudh Raju and Mihir Laghate, recipients of the Guru Krupa Foundation Fellowship.

graduate studies at UCLA. “My education at UCLA has served me very well. But it almost didn’t happen,” said Padmanabhan, a former researcher at IBM who now works for hedge fund management firm Renaissance Technologies. “It was only because of a last-minute award of a fellowship that I was able to attend UCLA.”

UCLA ENGINEER  | 

26

The first two Guru Krupa Foundation gifts were directed toward students working in the areas of Padmanabhan’s studies – integrated circuits and signals and systems. Students in any electrical engineering discipline are eligible for the new fellowship. “I set up the first two fellowships because I wanted to increase the odds of someone in my situation in India having the same opportunity I had,” Padmanabhan said. “Since then, I’ve had an opportunity to see the working of the process and meet with some of the fellowship recipients, and I feel that the fellowships are having the intended impact.” Mukund Padmanabhan

n


The Hon. Heidi Shyu, MS ’81, ENG ’82, has a big assignment: Equip the U.S. Army for tomorrow. In 2012 Shyu was named assistant secretary of the Army for acquisition, logistics and technology, making key decisions on the Army’s investments across 12 portfolios including aviation, weapon systems, ground vehicles, surveillance, communications, science and technology.

Photo courtesy Hon. Heidi Shyu/U.S. Army

Heidi Shyu Takes Command

Shyu came to the post after serving as a top

executive at Raytheon Co.’s Space and Airborne Systems. She got her start at Hughes Aircraft Co., which offered

her a fellowship to seek a master’s degree in engineering from the school of her choice.

“I naturally chose to go to UCLA,” said Shyu, who

spent part of her youth in Los Angeles. “It was a dream come true for me.”

Her UCLA studies continue to serve her well.

“An engineering education teaches you to think

through a problem analytically and logically. It also

taught me that there may be more than one solution –

each has pros and cons that require tradeoffs,” she said. The Army, she added, deals with “very complex

issues that have many tradeoffs and implications, presenting complex optimization problems with variables that don’t stay constant.”

Shyu said the engineer – and engineering school –

that transcends disciplines is vital for the Army and other end-users of emerging technologies.

we haven't even thought of today will be critical for the Army of the future.”   n

UCLA ENGINEER  | 

delivering information,” she said. “New disciplines that

27

“There are ideas being nurtured today in universities

that will create brand new ways of using products or


ALUMNI

Notes

1945 1946 1947 1948 1949 1950 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978

1950s

KEN BONDY ’63, MS ’64 was elected to honorary

FRANK W. FEILER ’50, MBA’64 P.E., has been a consultant

for 20 years with Executive Service Corps of Southern

California, a non-profit organization providing pro-bono

consulting and leadership development to the non-profit community. Feiler retired in 1990 as vice president and

controller of an aerospace division at Rockwell International after 40 years with the firm.

membership in the American Concrete Institute. This is

ACI’s highest honor.

ROBERT E. ENGLEKIRK MS ’65,

PhD ’70 was an inaugural recipient

of the UCLA Civil Engineering

Distinguished Alumnus Award. Englekirk is an internationally

MEL BREUER ’59 MS ’61 is entering his 50th year as a

recognized expert in structural

School of Engineering. He has served as the electrical

and constructible design of reinforced concrete. His present

several awards including 2011

which he founded in 1969. Englekirk recently published a

professor of electrical engineering at the USC Viterbi engineering department chair, and recently received

John J. Guarrera Engineering

Educator of the Year Award and

engineering, known for his innovative

position is chairman emeritus of Englekirk Institutional,

historical novel, “Dawn or Dusk,” available through Amazon

and other outlets.

the 2011 IEEE Computer Society

SCOTT JACKSON MS ’66, author of

Test Technology Technical Council

the 1997 book “Systems Engineering

Lifetime Achievement Award.

for Commercial Aircraft,” published

1960s

by Ashgate Publishing Limited in the U.K., will have his book translated

into Chinese and published by China

ANDREW POWELL PhD ’61 has spent many years traveling

Aviation Industry Press.

worldwide and retired to produce the website www.

UCLA ENGINEER  | 

28

inoviagroup.org. Under the name DAHL, he has composed

symphonies and music of many genres

LEONARD ALLEN ’63 retired in 2007 following a 32-year

MICHAEL LINEBERRY ’67 spent 33 years at Argonne

National Laboratory, working on nuclear energy

development. In 2005, He joined Idaho State University,

career as a geotechnical engineer in Orange County. Since

and is the interim chair of the Nuclear Engineering and

He is currently treasurer of the Orange County Society of

program prepared me to compete at high levels in the

going on cruises with his wife of 42 years.

grateful,” he wrote.

then, he has pursued a long-time interest in archaeology. the Archeological Institute of America. Allen also enjoys

Health Physics Department. “The UCLA Engineering

U.S. nuclear energy enterprise, and for that I am forever


Share news about your personal life, career, honors, awards and more! Send to: uclaengineering@support.ucla.edu 1979 1980 1981 1982 1983 1984 1985 1986 1987 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013

and other projects. Kass and her late husband Barry have

two children, Barry II, who married in 2013, and Christina, a

UCLA alumna and an attorney. Kass now spends her time

with her two granddaughters, as well as traveling, playing

bridge and participating in church activities.

ASAD M. MADNI ‘69, MS ‘72, a UCLA adjunct professor of electrical engineering, was named the inaugural

recipient of the Electrical

Engineering Department’s

Distinguished Alumnus Award for visionary leadership and

pioneering contributions to the electrical sciences and

engineering. Madni was the 2004 UCLA Engineering Alumnus of the Year.

EDGAR WILD ’69, systems and software quality assurance

manager of the Space Systems Division at Northrop

Grumman Aerospace Systems, and his wife, Nena Wild,

eagerly anticipate the birth of their second granddaughter in May 2014. Their first grandchild, Lena Elisabeth Koenig,

just celebrated her second birthday. The proud parents of

both girls are Dr. Yvette Wild, who completed her residency

in pediatrics at UCLA in 2011, and Dr. Stefan Koenig.

JEFF DROBMAN ’70, MS ’73, PhD ’80 is running for

California Secretary of State. Drobman said his priorities include developing more secure voting systems and

databases, enhancing the voter experience and reducing the costs to run an election.

WILLIAM R. GOODIN MS ’71, PhD 75, ENG ’82 retired from UCLA in

January after 28 years as a director of engineering and computer

programs at UCLA Extension and two years in alumni relations for the UCLA Henry Samueli School

of Engineering and Applied Science. Goodin continues to

be extremely active as a volunteer for engineering student

groups and the UCLA Engineering Alumni Association, where he served as president from 1998 to 2002.

SOROOSH SOROOSHIAN MS ’73 ENG ’77, PhD ’78

is an inaugural recipient of the UCLA Civil Engineering Distinguished Alumnus Award. Sorooshian, a

distinguished professor of civil and environmental engineering at the

UC Irvine Henry Samueli School of Engineering, is an internationally

recognized expert in the field of water resources engineering.

29

spent 30 years at the company, working on the B-1 bomber

1970s

UCLA ENGINEER  | 

MARY ANN KASS (NEE RANIA) ’68 retired in 2009 from

her post as a logistics manager at Northrop Grumman. She


DARIUSH DIVSALAR MS ’75, ENG ’77, PhD ’78 will receive

POLLY LOW, ’85 was appointed

IEEE’s Alexander Graham Bell Medal, which recognizes

mayor of Rosemead, Calif., in 2013.

nications sciences and engineering.” Divsalar, a principal

council since 2007, has worked in the

“exceptional contributions to the advancement of commu-

Low, who has served on the city

scientist at NASA’s Jet Propulsion Laboratory and a UCLA

aerospace industry for more than 20

adjunct professor in electrical

years and is a software engineering

engineering, will be recognized

later this year “for fundamental

contributions to the theory and

practice of channel codes that

forms of wireless communications.”

faculty of the University of Chicago

KEVIN D. CONWAY ’76 P.E. retired as a principal from

Greeley and Hansen, LLC, a full service water consulting

and was recently appointed to the

Graham School’s graduate program in analytics. The part-time evening

program began its charter in

engineering firm, on Dec. 31, 2013.

January 2014.

DANIEL MENASCE PhD ’78, a professor of computer

LJILJANA TRAJKOVIC PhD ’86

science at the Volgenau School of Engineering at George

serves as 2014-2015 president of the

tions to research and education

Society. She has been awarded

computer systems.”

Cybernetics Society Outstanding

Mason University, was named a fellow of IEEE for “contribuin performance evaluation of

IEEE Systems, Man, and Cybernetics the 2013 IEEE Systems, Man, and

Contribution Award.

1980s

ERIC NELSON ’82 was

1990s

commercial engines and helicopter programs at Dallas-

PhD ’00 was elected as a fellow of IEEE. Pan, a professor

promoted to vice president of

based Aviall Inc., a wholly-owned Boeing subsidiary

providing aftermarket supply-chain management services for the aerospace and defense industries.

RICH WATERMAN ’83 was

appointed mayor of Campbell,

30

MARK BENNETT PhD ’86 is director in risk technology

at Bank of America-Merrill Lynch

transformed deep space and other

UCLA ENGINEER  | 

manager at Raytheon Co.

Calif., in 2013. Waterman switched

careers from technology, earning

his master’s degree in accounting from San Jose State University

and starting his own business as a certified public accountant.

DAVID Z. PAN MS ’94 (Atmospheric Sciences), MS ’98,

of electrical and computer engineering at the University of Texas at Austin’s Cockrell School of Engineering, also

received the 2013 Semiconductor Research Corporation (SRC)

Technical Excellence Award. He

was cited for fundamental work

in “nanometer integrated circuit

design for manufacturability.”


2000s

HEIDY MUÑOZ ’01 has been appointed Region 2 vice

president for the Society of Hispanic Engineers. Region

2 includes Southern California and Arizona. Muñoz is

currently a sales engineer at Aggreko, LLC, working on

temporary utility and electrical distribution solutions.

KARI S. SANDERS MS ’01 is a principal mission systems

engineer at Ball Aerospace & Technologies Corp. and is

working on a spacecraft in its design phase. She is also

close to finishing her MBA in Strategic Management from

as chief executive of Water Planet Engineering, a water

treatment solutions provider focused on the world’s most

challenging desalination and water reuse problems.

REAGAN WOOLF MS ’02, an aircraft

performance technical expert for the

412th Test Wing of 773rd Test Squadron at Edwards Air Force Base, was

PETER HWANG ’96, MS ’98 has joined information

recognized for his contributions with

of greater China, and is responsible for developing and

from the Society of Flight Test Engineers.

management firm Iron Mountain Inc. as managing director growing the business in that region. Iron Mountain is a NYSE-listed, S&P 500 company.

the international Kelly Johnson Award

PARUL GUPTA MS ’03 was awarded the Distinguished

Service Award by her other alma mater – Indian Institute of

ERIC FIGUEROA ’98 was recently promoted to senior

Technology, Bombay. She is the first woman to receive that

intellectual property law firm in Westlake Village, Calif.

Review’s Innovators Under 35 in 2013.

associate attorney at Koppel, Patrick, Heybl & Philpott, an After graduating from UCLA, Figueroa worked as a radio

frequency engineer at Nextel Communications. He received

his J.D. in 2008 from Southwestern Law School and he’s

been with the firm since 2007, when he started as an intern.

award. Gupta was also chosen as one of MIT Technology

LAWRENCE AU ’04, MS ’07, PhD ‘11 and GIGI LAU ’04

were married on Nov. 2, 2013. Au is a senior engineer

at Qualcomm Inc. and Lau is an engineering program manager at Apple Inc.

31

child in 2013. Hoek, a UCLA professor of civil and environ-

mental engineering, has been on leave from the faculty

Regis University, and plans to use her two degrees to lead

engineering and technology development projects.

UCLA ENGINEER  | 

ERIC HOEK MS ’96 and his wife Kathy had their second


CARA HOPE ’04 (Political Science), MS ’13 is working as a

ARJUN MEHTA

dynamics engineer for United Launch Alliance in Denver. ULA is set to launch about 15 vehicles from Vandenberg

’12 won

Air Force Base and Cape Canaveral in 2014.

Makerbot’s

3D Printing

OTÁVIO DALAROSSA ’09 MS ’10 left Wilshire Private

Competition

Markets to start and serve as chief executive of Nvestly Co.

in October.

(StartupUCLA 2012). The company’s mission is to empower

He is also a part of the founding team of a startup,

to securely share real investment information with

medium-sized businesses to build their own websites.

people to become better investors and it allows investors each other.

HotDoodle.com, which aims to make it easy for small and

SARAH WARREN ROSE PhD ’12

2010s

TAMMY CHANG ’12

was selected

to receive the

2013 Alton

B. Zerby and

Carl T. Koerner

Outstanding Student Award from IEEE-HKN. The national

(previously Sarah

Elizabeth Warren)

married in the

summer of 2013.

She also was

promoted to lead mechatronics engineer at

Interorbital Systems, a rocket manufacturer in Mojave,

Calif. Rose was awarded the 2013 Promise Award from the Society of Satellite Professionals International in

award, established in 1965, “recognizes outstanding

recognition of being a future industry leader.

with demonstrated exemplary service to classmates,

CELINE SIN MS ’12 has received a Marie Curie grant from

scholastic excellence and high moral character, coupled university, community and country.” Chang, who received the Russell R. O’Neill Service Award at the 2012 UCLA

Engineering commencement for leading a new peer

mentoring program, is currently a graduate student at

the European Commission to pursue a Ph.D. at the

Max Planck Institute for Colloids and Interfaces in Potsdam,

Germany. Sin writes that she enjoys Europe, but misses UCLA.

Stanford University.

REID DAMMANN MS ’12 is an intellectual

property partner at Musick Peeler LLP. He

UCLA ENGINEER  | 

32

mainly practices patent law, but also works in copyright and trademark law.

Please send the latest news and photos regarding your career, personal life, awards and more to: uclaengineering@support.ucla.edu


UCLA ENGINEERING FACULTY

— IN MEMORIAM — ANDREW CHARWAT (1925-2013)

A

ndrew Charwat, professor emeritus of mechanical and aerospace engineering who served the school for more than 50 years, passed away on July 5, 2013. He was 88.

Charwat earned his Ph.D. from UC Berkeley. He joined the UCLA Engineering faculty in 1955 and led the school’s aerodynamics laboratory for many years. In 1974 he earned a

distinguished teaching award from the Engineering Society of the University of California. A Fulbright and Guggenheim fellow, Charwat retired in 1991, but continued to teach until the 2009-10 academic year.

THELMA ESTRIN (1924-2014)

T

helma Estrin, professor emerita of computer science, biomedical engineering trailblazer

and champion of women in science, passed away on Feb. 15, 2014. She was 89. Born Thelma

Austern, she earned her Ph.D. from the University of Wisconsin. She joined UCLA’s Brain

Research Institute in 1961, and was director from 1970 to 1980. In 1982, she served as director of the National Science Foundation’s Division of Electrical, Computing and System

Engineering. A fellow of IEEE and AAAS, and a member of the Women in Technology Hall of Fame, she retired in 1991.

MICHEL MELKANOFF (1923-2013)

M

ichel Melkanoff, professor emeritus and the first chairman of the Computer Science Department, passed away on Sept. 9, 2013. He was 90. Born in Russia, Melkanoff MS

’50 PhD ’55 (Physics) was a founding member of the Computer Science Department when he joined the UCLA Engineering faculty in 1962, and was the department’s chairman from 1969

to 1972. He also led the Institute for Manufacturing and Automation Research, a collaborative

effort with government, industry and university partners to spur American industrial competitiveness and efficiency. A fellow of IEEE, he retired in 1991.

ALFRED YUE (1918-2014)

A

lfred Yue, professor emeritus of materials science and engineering, passed away on Feb. 4, 2014. He was 95. Born in China, he earned his Ph.D. from Purdue University.

Yue joined UCLA Engineering in 1969 and was known for his work in solidification science

and for processing and characterization of semiconductor eutectics for solar cell applications. In the mid-1970s, he devised experiments for NASA’s Skylab program. Yue demonstrated a life-long passion for helping international students gain the opportunity to come to U.S. for higher education. He retired in 1991.


NON-PROFIT ORG. U.S. POSTAGE PAID UCLA 405 Hilgard Avenue Boelter Hall Suite 7256 Box 951600 Los Angeles, CA 90095-1600

UPCOMING EVENTS Bruin Day April 19, 2014

UCLA Engineering Commencement June 14, 2014

UCLA Engineer Spring 2014  

UCLA Online Master’s Degree Program Ranked #2 in Nation. Nature-Inspired Engineering Takes Hold. Two More Faculty Named to NAE.

Read more
Read more
Similar to
Popular now
Just for you