Archives of Medical Science 1/2023

Regions

EDITOR’S CHOICE:

Central Latin America

Central Sub-Saharan Africa

East Asia

Eastern Europe

Eastern Sub-Saharan Africa

Worldwide burden attributable to diet high in red meat from 1990 to 2019 Dan Liu, Qingyang Shi, Gaiping Cheng, Qiaorong Huang, Sheyu Li

Global High-income Asia Pacific High-income North America North Africa and Middle East Oceania

South Asia

Southeast Asia

Southern Latin America Southern Sub-Saharan Africa Tropical Latin America

Western Europe Western Sub-Saharan Africa

1. Worldwide burden attributable to diet high in red meat from 1990 to 2019

2. Implications of the 2021 ESC cardiovascular risk classification among 283,000 European immigrants living in a low-risk region: a population-based analysis in Catalonia

3. Not as black as it is painted? The impact of the first wave of COVID-19 pandemic on surgical treatment of urological cancer patients in Poland – a cross-country experience

4. Evaluation of methods of surfactant administration in the delivery suite?

dardized DALY rates attributable to a diet high in red meat decreased by 30.3% (95% UI: –35.8% to –22.8%) and 23.5% (95% UI: –30.0% to –13.3%), respectively (Figures 2 A–D). Among the GBD level 2 risk factors, diet high in red meat ranked higher for DALY in 2019 (23rd place) than it did in 1990 (27th). It ranked stably in the 20th place for death from 1990 to 2019. Also, diet high in red meat ranked 5th in the GBD dietary risk factors for attributable DALYs in 1990 and 2019 [22].

5. The effect of PCSK9 immunization on the hepatic level of microRNAs associated with the PCSK9/LDLR pathway

Figures 3 A and B suggest that the age-specific rates of death and DALY attributable to a diet high in red meat increased over age. Death and DALY rates were higher in males than in females among all age groups. Absolute death numbers peaked in the age group ≥ 80 years in both sexes.

www.archivesofmedicalscience.com

The DALY numbers peaked at the 60–64 age group

years in females. Decreasing trends were detected in age-standardized death and DALY rates’ EAPCs for males and females (death: –1.1% and –1.7%; DALY: –0.8% and –1.3%, respectively) (Tables II and III). Age-specific absolute deaths and DALYs along with corresponding rates in different SDI levels are shown in Supplementary Figures 1 A–J. Among the 21 regions, East Asia showed the highest numbers of deaths (0.1 million in 1990 and 0.3 million in 2019) and DALYs (3.6 million in 1990 and 9.0 million in 2019) attributable to a diet high in red meat, followed by Western Europe, East Europe and High-income North America. The region with the highest age-standardized death and DALY rates changed from Eastern Europe in 1990 to Central Asia in 2019. From 1990 to 2019, the region with the largest percentage

Termedia Publishing House

Editorial Board

George Bakris (Chicago, USa)

Jeroen J. Bax (Leiden, The Netherlands)

andrzej Bednarek (Lodz, Poland)

Hans G. Beger (Ulm, Germany)

ariela Benigni (Bergamo, italy)

Joseph J. Biederman (Boston, USa)

Natan Bornstein (Tel aviv, israel)

dirk L. Brutsaert (antwerp, Belgium)

Hugh Calkins (maryland, USa)

John Camm (London, UK)

andrew J.S. Coats (Sydney, australia)

antonio Colombo (milan, italy)

mark Crowther (Ontario, Canada)

Bjorn dahlof (New York, USa)

Undurti N. das (Shaker Heights, OH, USa)

Kenneth dickstein (Stavanger, Norway)

Steven m donn (ann arbor, mi, USa)

Joachim W. dudenhausen (Berlin, Germany)

adam dziki (Lodz, Poland)

moses elisaf (ioannina, Greece)

N. a mark estes iii (Boston, USa)

Gerasimos Filippatos (athens, Greece)

Guillermo Garcia-manero (Houston, USa)

mario Gaudino (rome, italy)

andrea r. Genazzani (Pisa, italy)

Bernard J. Gersh (rochester, USa) m eric Gershwin (davis, USa)

Charles H. Hennekens (Washington, USa)

Gerd Heusch (essen, Germany)

Walter H. Hörl (Vienna, austria)

Stein Kaasa (Trondheim, Norway)

Vijay V. Kakkar (London, UK)

Norman m. Kaplan (dallas, USa)

Sverre e. Kjeldsen (Oslo, Norway) marek L. Kowalski (Lodz, Poland) Harlan m. Krumholz (New Haven, USa)

Piotr Kuna (Lodz, Poland)

Norbert Lameire (Ghent, Belgium)

Carlo La Vecchia (milan, italy)

Krista Lentine (St. Louis, mO, USa) amir Lerman (rochester, USa)

Paweł Liberski (Lodz, Poland)

Gregory Y.H. Lip (Liverpool, UK)

Jolanta małyszko (Warsaw, Poland)

Joann e manson (Boston, USa) maurie markman (Houston, USa) Uwe mehlhorn (Cologne, Germany) dimitri P. mikhailidis (London, UK) Naoyuki miura (Hamamatsu, Japan) Joanna Narbutt (Lodz, Poland) Keiji Naruse (Okayama, Japan) eva Negri (milan, italy)

Grzegorz Opolski (Warsaw, Poland)

Jose m. Ordovas (Boston, USa) Jean-Paul Ortonne (Nice, France) Kapil Parakh (Baltimore, USa) Hendri H. Pas (Groningen, Netherlands)

Fausto J. Pinto (Lisbon, Portugal) Herman m. van Praag (maastricht, Netherlands) mahendra rao (Carlsbad, USa) Kausik K. ray (London, UK)

Giuseppe remuzzi (Bergamo, italy) robert roberts (Ottawa, Canada)

Bernardo rodriguez-iturbe (maracaibo, Venezuela) denis roy (montreal, Canada)

Brian m. Salzberg (Pennsylvania, USa) Ola didrik Saugstad (Oslo, Norway) Jochen d. Schipke (duesseldorf, Germany) Yehuda Y. Shoenfeld (Tel-aviv, israel) alain Simon (Paris, France)

Helmut Sinzinger (Vienna, austria)

Vincent Soriano (madrid, Spain) michał Stachowiak (Buffalo, USa)

Nicholas J. Talley (Jacksonville, USa) Lip-Bun Tan (Leeds, UK) eric J. Topol (La Jolla, USa) anetta Undas (Cracow, Poland) Tetsumei Urano (Hamamatsu, Japan) Panos e. Vardas (Heraklion, Greece)

Jacob Vinten-Johansen (atlanta, USa) Francesco Visioli (milan, italy) david Vlahov (New York, USa) avi a. Weinbroum (Tel aviv, israel) Wojciech Zareba (New York, USa) marian Zembala (Zabrze, Poland) douglas P. Zipes (indianapolis, USa) Carmine Zoccali (reggio Calabria, italy) Joseph B. Zwischenberger (Galveston, USa)

Editor-in-Chief

Maciej Banach, MD, Prof. (Lodz, Poland)

Managing Editor

Marco Proietti, MD, Prof. (Rome, Italy)

Karel Allegaert (Rotterdam, Belgium)

Henedina Antunes (Portugal)

Majid Assadi (Bushehr, Iran)

Kengo Ayabe (Los Angeles, United States)

Dimitros Bogdanos (London, United Kingdom)

Claudia Regina Bonini-Domingos (São José do Rio Preto, Spain)

Alexandru Burlacu (Iasi, Romania)

Ali Cadili (Edmonton, Kanada)

Gunadi (Yogyakarta, Indonesia)

Ayse Cakir Gungor (Canakkale, Turkey)

Erwin Chiquete (Mexico City, Mexico) Adrian Covic (Iasi, Romania)

Undurti Das (Federal Way, United States)

Anupam Dhasmana (McAllen, United States)

Jolanta Dorszewska (Poznan, Poland)

Sagar Dugani (United States)

Theodosios Filippatos (Greece)

Georgia Gerolouka-Kostopanagiotou (Athens, Greece)

Mojgan_Gharipour (Isfahan, Iran)

Souvik Ghosh (Sapporo, Japan)

Katja Goričar (Ljubljana, Slovenia)

Shinya Goto (Isehara, Japan)

Shafiul Haque (Jazan, Saudi Arabia)

Martin Horvath (Czech Republic)

Ahmed Idbaih (Paris, France)

Aleksandra Jezela-Stanek (Katowice, Poland)

Jacek Jóźwiak (Poland)

Mine Kanat-Pektas (Afyonkarahisar, Turkey)

Niki Katsiki (Thessaloniki, Greece)

Editor-in-Chief

Co-Editors

Wilbert S. Aronow, MD, Prof. (New York, United States) Amirhossein Sahebkar, PharmD, PhD (Mashhad, Iran)

Statistics Editor

Małgorzata Misztal, PhD (Lodz, Poland)

Section Editors

Haseeb A. Khan (Riyadh, Saudi Arabia)

Veronika Kralj-Iglič (Ljubljana, Slovenia)

Martina Krüger (Dusseldorf, Germany)

Metka Lenassi (Slovenia)

Fenge Li (Texas, USA)

Ana Lleo (Rozzano, Italy)

Marios Lukas (St. George, Grenada)

Saurav Mallik (Boston, United States)

Giovanni Mariscalco (Varese, Italy)

Fleur Mason (Göttingen, Germany)

Michail Matalliotakis (Crete, Greece)

Colm McAlinden (United Kingdom)

Muhammad Miftahussurur (Surabaya, Indonesia)

Irina Milisav (Ljubljana, Slovenia)

Peter Müller (Munich, Germany)

Seyed Mohammad Nabavi (Teheran, Iran)

Thomas Niethammer (Germany)

Dragana Nikolic (Italy)

Ionut Nistor (Romania)

Demostenes Panagiotakos (Kalithea, Athens, Greece)

Nikolaos Papanas (Greece) Narasimha Reddy Parine (Riyadh, Saudi Arabia)

Panagiotis Peitsidis (Southend, United Kingdom)

Leonard Peruski (Guatemala, Guatemala)

Antonio Picardi (Rome, Italy)

Gabriele Piffaretti (Varese, Italy) Adam Reich (Rzeszów, Poland)

Kannan RR Rengasamy (Seoul, South Korea)

Language Editor

Addresses

Prof. Maciej Banach, MD, PhD

Polish Mother’s Memorial Hospital Research Institute (PMMHRI)

Rzgowska 281/289, 93-338 Lodz, Poland Fax: +48 42 271 11 24

ArchivesofMedicalScience

Lucie Riedlbauchova (Czech Republic)

Manfredi Rizzo (Palermo, Italy)

Lisa Qia Rong (New York, United States)

Paweł Rzymski (Poznan, Poland)

Piotr Rzymski (Poland)

Khaled Saad (Assiut, Egypt)

Pierre Sabouret (Paris, France)

Kamal Kant Sahu (Worcester, USA)

Motoaki Sano (Japan)

Alessandra Scaparrotta (Chieti, Italy)

Consolato Maria Sergi (Alberta and Ontario, Canada)

Eduard Shantsila (Birmingham, United Kingdom)

Bartosz Simonides (Warsaw, Poland)

Stanislaw Surma (Katowice, Poland)

Zheng Zachory Wei (Atlanta, USA)

Jelena Vekic (Serbia)

Josef Veselka (Prague, Czech Republic)

Jean-Louis Vincent (Brussels, Belgium)

Niels Voigt (Göttingen, Germany)

Stephan von Haehling (Göttingen, Germany)

Chengming Wang (Auburn, USA)

Jiexiong Xie (Merelbeke, Belgium)

İlhan Yaylim (Istanbul, Turkey)

Christos Zavos (Thessaloniki, Greece)

Hongliang Zhang (Beijing, China) Lvyun Zhu (Hunan, China)

Natalya Zinkevich (Waukesha, United States) Dorota Zozulińska-Ziółkiewicz (Poznan, Poland)

Managing Editor

Prof. Marco Proietti Department of Clinical Sciences and Community Health University of Milan Via della Commenda 19,20122, Milan, Italy

E-mail: marco.proietti@unimi.it

AMS is indexed in ISI Master Journal List, ISI Science Citation Index Expanded/ISI Web of Science, PubMed Central/PubMed, EMBASE, Chemical Abstracts CAS, CAB Abstracts, Scopus, Index Copernicus (IC), National Library of Medicine (NML), Directory of Open Access Journals (DOAJ), Academic Journals Database, Global Health Databases, MNISW, J-Gate, OpenMED and Polish Medical Library (GBL). Impact Factor 2021: 3.707 , IC Valued: 176.07 pts, MEiN Value: 100 pts, Google Index H5: 37, CiteScore 2021: 5.3

Termedia Publishing House

Kleeberga 2, 61-615 Poznań, Poland

Phone/fax: +48 61 822 77 81 E-mail: termedia@termedia.pl www.termedia.pl www.ams.termedia.pl

Contact E-mail: s.sekula@termedia.pl Circulation of 1000 copies

President of the Management Board of the Termedia Publishing House Janusz Michalak

Production Editor

Marzena Demska E-mail: m.demska@termedia.pl

Marketing and Advertising Department

Anita Jóźwiak

Phone: +48 61 822 77 81 ext. 500 E-mail: a.jozwiak@termedia.pl

Distribution Subscription Department

Phone: +48 61 656 22 02

Archives of Medical Science was founded by Prof. Maciej Banach & Termedia Publishing House. Archives of Medical Science is supported and published by Termedia Publishing House. Copyright: © 2023 Termedia & Banach. This is an Open Access journal, all articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license. The advertisers shall be liable for the contents of advertisement placed in Archives of Medical Science. Advertisements of prescription drugs are intended only for physicians licensed to prescribe them.

Richard Ashcroft (Oxford, UK)

Clinical research

Atherosclerosis

1

Worldwide burden attributable to diet high in red meat from 1990 to 2019 D. Liu, Q. Shi, G. Cheng, Q. Huang and S. Li (China)

16 Positron emission tomographic studies of the association between atherogenesis and aortitis among psoriatic patients L. Li, Y. Ge, X. Wan, K. Wu and D. Liu (China)

Obesity

25 Is COVID-19 another case of the obesity paradox? Results from an international ecological study on behalf of the REPROGRAM Consortium Obesity study group S. Bhaskar, S. Jovanovic, A. Katyal, N.K. Namboodiri, D. Chatzis and M. Banach (Australia, Canada, India, Cyprus, Poland)

Cardiology

35

Implications of the 2021 ESC cardiovascular risk classification among 283,000 European immigrants living in a low-risk region: a population-based analysis in Catalonia E. Vela, M. Cleries, U. Bilal, M. Banach, J.W. McEvoy, M. Bødtker Mortensen, M.J. Blaha, K. Nasir, J. Comin-Colet J. Mauri and M. Cainzos-Achirica (Spain, USA, Poland, Ireland, Denmark)

46

57

Circulating exosomal lncRNAs in patients with chronic coronary syndromes M. Zheng, R. Han, W. Yuan, H. Chi, Y. Zhang, K. Sun, J. Zhong, X. Liu and X. Yang (China)

Compositional and functional properties of high-density lipoproteins in relation to coronary in-stent restenosis S. Ganjali, E. Mahdipour, S. Hamid Aghaee-Bakhtiari, M. Ghayour-Mobarhan, S. Saffar Soflaei, M. Banach, A. Kontush and A. Sahebkar (Iran, Poland, France, Australia)

73 Automatic daily remote monitoring in heart failure patients implanted with a cardiac resynchronisation therapy-defibrillator: a single-centre observational pilot study P. Ezer, N. Farkas, I. Szokodi and A. Kónyi (Hungary)

Oncology

86 Appraisal of lung cancer survival in patients with end-stage renal disease M.S. Lu, M.F. Chen, Y.H. Yang, C.P. Lee, C.C. Lin, Y.H. Tseng and Y.H. Tsai (Taiwan)

Rheumatology

94 Predictors of disability in patients with chronic low back pain E. Sirbu, R.R. Onofrei, S. Szasz and M. Susan (Romania)

Dermatology

101 Clinical study on prevention of atopic dermatitis by oral administration of probiotics in infants J.H. He, X.G. Zhao, F. Sun, W.Q. Peng, H.Y. Li and H. Li (China)

Urology

107 Not as black as it is painted? The impact of the first wave of COVID-19 pandemic on surgical treatment of urological cancer patients in Poland – a cross-country experience P. Zapała, A. Ślusarczyk, P. Rajwa, M. Przydacz, W. Krajewski, B. Dybowski, P. Kubik, B. Kuffel, M. Przudzik, R. Osiecki, R. Stamirowski, Ł. Zapała, M. Kozikowski, D. Chorągwicki, M. Szymańska, P. Kiełb, B. Małkiewicz, J. Zostawa, M. Roslan, J. Zajączkowska, M. Jarzemski, B. Brzoszczyk, P. Petrasz, P. Jarzemski, R. Zdrojowy, J. Dobruch, A. Paradysz, T. Drewa, P. Chłosta and P. Radziszewski (Poland)

Arch Med Sci 1, 1st January / 2023

State of the art papers

Neonatology

116 Evaluation of methods of surfactant administration in the delivery suite? H. Ambulkar, T. Dassios and A. Greenough (UK)

Oncology

122 Magnetic marker localisation in breast cancer surgery J. Žatecký, O. Kubala, P. Jelínek, M. Lerch, P. Ihnát, M. Peteja and R. Brát (Czech Republic)

Systematic review/Meta-analysis

Oncology

128 A systematic review and meta-analysis of the association between HOTAIR polymorphisms and susceptibility to breast cancer B. Wang, F. Yuan, F. Zhang, Z. Miao and D. Jiang (China)

Basic research

Diabetology

138 High glucose promotes apoptosis and autophagy of MC3T3-E1 osteoblasts P. Zhang, J. Liao, X. Wang and Z. Feng (China)

Oncology

151 MiR-1286 inhibits lung cancer growth through aerobic glycolysis by targeting PKM2 H. Li, X. Lin, C. Li, J. Li, X. Xu, D. Meng and S. Zheng (China)

160 Increased IL-1a expression is correlated with bladder cancer malignant progression S.J. Yao, H.S. Ma, G.M. Liu, Y. Gao and W. Wang (China)

171 Prognostic role of CD11b+ myeloid-derived suppressor cells in oral squamous cell carcinoma Y. Jiang, C. Wang, Y. Wang, W. Zhang, L. Liu and J. Cheng (China)

Atherosclerosis

180 Long non-coding RNA SENCR alleviates endothelial-to-mesenchymal transition via targeting miR-126a C. Lou and T. Li (China)

Microbiology and Virology

189 Activity of vancomycin combined with linezolid against clinical vancomycin-resistant Enterococcus strains G. Aktas (Turkey)

Vascular Surgery

194 Time-dependent effects of cellulose and gelatin-based hemostats on cellular processes of wound healing M.U. Wagenhäuser, W. Garabet, M. van Bonn, W. Ibing, J. Mulorz, Y.H. Rhee, J.M. Spin, C. Dimopoulos, A. Oberhuber, H. Schelzig and F. Simon (Germany, USA)

Experimental research

Dyslipidemia

203 The effect of PCSK9 immunization on the hepatic level of microRNAs associated with the PCSK9/LDLR pathway S. Ataei, S. Ganjali, M. Banach, E. Karimi and A. Sahebkar (Iran, Poland, Australia)

Diabetology

209

Thymoquinone activates imidazoline receptor to enhance glucagon-like peptide-1 secretion in diabetic rats

S.P. Lee, F.Y. Kuo, J.T. Cheng and M.C. Wu (Taiwan)

Cardiology

216 The direct effect of lipopolysaccharide on an isolated heart is different from the effect on cardiac myocytes in vitro

F.Y. Kuo, S.P. Lee, J.T. Cheng and M.C. Wu (Taiwan)

Oncology

229

An experimental study of buckwheat polysaccharide in adjuvant therapy for S180 sarcoma mice

D.J. Fan, P. Sun and S.Y. Han (China)

Research letters

Cardiology

237 Continuous positive airway pressure may improve hypertension in patients with obstructive sleep apnea-hypopnea syndrome by inhibiting inflammation and oxidative stress

X. Wang, L. Guan, C. Wu, Y. Zhao and G. Zhao (China)

242 Efficacy and safety of bivalirudin bridging enoxaparin versus fondaparinux in patients with acute myocardial infarction undergoing primary percutaneous coronary intervention: evidence from a single-center study

Y. Guo, J. Wang, Z. Wang, L. Li and J. An (China)

Genetics

250 Extended application of BACs-on-Beads technique in prenatal diagnosis S. Sun, Z. Zhang, J. Zhao and X. Lan (China)

Osteoporosis

258 Moxibustion treatment increases the survival rate of lung infection of patients bed-ridden due to osteoporotic fracture of the spine via regulation of the inflammatory responses

Y. Cheng, Q. Chen, R. Huang, C. Lao and W. Fu (China)

Oncology

264 Deep learning survival model for colorectal cancer patients (DeepCRC) with Asian clinical data compared with different theories

W. Li, S. Lin, Y. He, J. Wang and Y. Pan (China)

Urology

270 POWER: an open, single-arm, post-market clinical trial using the TENA SmartCare Change Indicator in a home environment

F. Agholme, A. Lamparski and P. Radziszewski (Sweden, Poland)

Letters to the Editor

Thrombosis and Hemostasis

274 Soluble P-selectin level in patients with cancer-associated venous and artery thromboembolism: a systematic review and meta-analysis

X. Zhang, C. Zhang, Z. Ma and Y. Zhang (China)

Arch Med Sci 1, 1st January / 2023

Hepatology

283 Early thrombolysis combined with anticoagulation and antibiotics for acute portal venous system thrombosis secondary to intra-abdominal infection F. Gao, R. Wang, L. Han, R. Zhang and X. Qi (China)

Infectious Diseases

288 Cold chain-affiliated associated SARS-CoV-2 omicron BA.2 infections, Qingdao, Shandong, China, 2022 F. Zhang, R. Sun, C. Qu, X. Ma and C. Zhang (China)

Intensive Care Medicine

292 The construction and practice of a standardized nursing service system based on the designated hospital for the treatment of COVID-19 in China A. Pan, Y. Zhao, W. Yu, L. Chen, X. Wu, J. Liu, Y. Zhao, Y. Wang, J. Wang and L. Zhang (China)

Otolaryngology

298 Cough syncope due to laryngeal herpes zoster successfully managed by pregabalin Y. Song, J. Hong, Z. Bao, J. Ye, X. Zheng and S. Zou (China)

Hematology

302

Hemophagocytic lymphohistiocytosis in a 26-year-old male A. Pilśniak, A. Jarosińska, A. Janoska-Gawrońska, G. Helbig and M. Holecki (Poland)

Worldwide burden attributable to diet high in red meat from 1990 to 2019

1Department of Endocrinology and Metabolism, Division of Guideline and Rapid Recommendation, Cochrane China Center, MAGIC China Center, Chinese EvidenceBased Medicine Center, West China Hospital, Sichuan University, China

2Department of Clinical Nutrition, West China Hospital, Sichuan University, Chengdu, Sichuan, China

3Laboratory of Stem Cell Biology West China Hospital, Sichuan University, Chengdu, Sichuan, China

Submitted: 17 September 2022; Accepted: 24 October 2022 Online publication: 28 October 2022

Arch Med Sci 2023; 19 (1): 1–15

DOI: https://doi.org/10.5114/aoms/156017

Copyright © 2022 Termedia & Banach

Abstract

Introduction: Red meat overconsumption is an unhealthy behavior, while its attributed burden and epidemiological pattern remain unclear. This study aimed to describe the status and trend of how the diet high in red meat burdens the world.

Material and methods: We accessed the data of summary exposure values (SEVs), deaths, and disability-adjusted life years (DALYs) with their age-standardized rates in each country from the Global Burden of Disease (GBD) Collaborative Network from 1990 to 2019. We calculated estimated annual percentage changes (EAPCs) to evaluate the trends of the disease burden.

Results: The age-standardized SEV rates increased in most of the 21 GBD regions, mainly in the low-middle and middle socio-demographic index (SDI) quantiles from 1990 to 2019, while East Asia increased the most rapidly. In 2019, a diet high in red meat was responsible for 0.9 million (95% uncertainty interval (UI) 0.5 to 1.3 million) deaths and 23.9 million (95% UI 15.6 to 32.0 million) DALYs worldwide. From 1990 to 2019, the total deaths and DALYs attributable to a diet high in red meat increased by over 50%. However, the age-standardized death and DALY rates decreased by 30.3% and 23.5%, respectively, during the study period. The age-standardized death and DALY rates in the middle SDI regions surpassed those in the high SDI regions from 2002. Ischemic heart disease, diabetes mellitus, and colorectal cancer were the main causes of diet high in red meat-related deaths and DALYs. Conclusions: Increasing consumption of red meat remains a global challenge, especially in the low-middle and middle SDI countries.

Key words: epidemiology, burden, DALY, death, red meat.

Introduction

Red meat, in contrast to white meat (including poultry and fishes), is of mammalian origin and includes beef, pork, lamb, and goat [1]. For centuries, red meat has been an important source of dietary protein for human beings. It was scarce until modern techniques for the livestock industry facilitated increasing consumption of red meat in all economic classes among most countries [2]. On a global scale, meat consumption per capita has increased by nearly 20 kg since 1961, and the average

Corresponding author: Prof. Sheyu Li Department of Endocrinology and Metabolism Division of Guideline and Rapid Recommendation

Cochrane China Center MAGIC China Center Chinese Evidence-Based Medicine Center West China Hospital Sichuan University Chengdu, China E-mail: lisheyu@gmail.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Dan Liu1, Qingyang Shi1, Gaiping Cheng2, Qiaorong Huang3, Sheyu Li1

meat intake reached 43 kg in 2014 while red and processed meat contributed to approximately two-thirds of meat consumption (about 540 g/ week of red and processed meat) [3].

Accumulated evidence suggests that a diet high in red meat rather than white meat is linked to a series of health problems [4–6], including increased risks of cancer, type 2 diabetes, ischemic heart disease, and early death [3, 7–14]. The red meat-related health consequences cost an estimated 285 billion U.S. dollars globally in 2020, which accounted for 0.3% of the whole health expenditure estimated for that year [15]. In 2015, the International Agency for Research on Cancer (IARC) of the World Health Organization (WHO) labeled red meat as a Group 2A carcinogen, meaning an agent that probably causes cancer in humans [16]. Recent guidelines recommend a restricted daily intake of red meat in the general population [17]. Moreover, the overdeveloped livestock industry meeting the increasing need for red meat may contribute to greenhouse gas emissions with a potential environmental impact [18].

With both positive and negative health, economic, social, and environmental impacts from red meat consumption, the literature knows little about the exposure strength or burden that may be attributed to a diet high in red meat. Such uncertainty makes it a controversial topic how health policymakers and stakeholders can respond to the increasing consumption of red meat in the aspect of public health. Based on the 2019 Global Burden Disease (GBD) data [19], the current study evaluates the worldwide health burden attributable to a diet high in red meat in 204 countries and territories to facilitate understanding how daily intake of red meat impacts global health.

Material and methods

Data source

Data on the burden attributable to a diet high in red meat, including deaths, disability-adjusted life of years (DALYs), summary exposure value (SEV) and their respective age-standardized rates (ASRs) in 21 regions and 204 countries from 1990 to 2019, were obtained from the Global Burden of Disease Collaborative Network [20]. Detailed methods used for the GBD 2019 have been described elsewhere [19]. Since the current study was based on the GBD database using de-identified and aggregated data, the requirement of informed consent was reviewed and waived by the University of Washington institutional review board [19]. This study adhered to the Guidelines for Accurate and Transparent Health Estimates Reporting (GATHER), and the checklist is attached (Supplementary Material 1) [21].

Definitions

Diet high in red meat was defined as mean daily red meat (beef, pork, lamb, and goat, but not poultry, fish, eggs, and all processed meats) intake more than the optional level of 23 g (18–27) per day [1]. Detailed information about the inclusion and exclusion criteria was described previously [19]. Deaths and DALYs related to diet high in red meat were retrieved by age, sex, regions, and countries/territories from 1990 to 2019. The age and sociodemographic index (SDI) stratifications along with other definitions are summarized in Supplementary Material 2.

Statistical analysis

All estimates were reported as absolute numbers, ASRs per 100,000 person-years and percentage changes. Estimated annual percentage changes (EAPCs) with 95% uncertainty intervals (UI) were used to estimate the changing patterns of age-standardized death, DALY, and SEV rates (Supplementary Material 2). The association between the SDI and ASRs of DALY, death, and SEV for 30 years was investigated with a non-linear regression model via the locally estimated scatterplot smoothing (LOESS) method. A two-sided p-value < 0.05 or the 95% UI not crossing 0 suggests statistical significance. All statistical analyses were conducted by R software (Version 4.0.3).

Results

Summary exposure values of diet high in red meat worldwide

As shown in Table I, the age-standardized SEV rate attributable to a diet high in red meat increased by 8.5% (95% UI: 4.3% to 14.5%) globally, from 40.5 (95% UI: 33.7 to 47.1) in 1990 to 43.9 (95% UI: 38.0 to 49.6) in 2019. In 2019, the region with the highest age-standardized SEV rate was Australasia, followed by Southern Latin America and Tropical Latin America (age-standardized SEV rate: 98.5, 91.3 and 86.5, respectively). From 1990 to 2019, the age-standardized SEV rates increased in most of the 21 GBD regions (including East Asia and Southeast Asia) except for four – Eastern Europe, Oceania, Western Europe and High-income North America – with EAPCs of SEV being –1.0%, –0.5%, –0.2% and –0.1%, respectively. The age-standardized SEV rate increased most rapidly in East Asia, followed by Southeast Asia and High-income Asia Pacific, with EAPCs of SEV being 1.9%, 1.4% and 1.2%, respectively. At the country/ territory level, the age-standardized SEV rate increased the most rapidly in Myanmar, followed by Maldives and Viet Nam with EAPCs of SEV being 3.1%, 2.4% and 2.3%, respectively (Figures 1 A–C).

Dan Liu, Qingyang Shi, Gaiping Cheng, Qiaorong Huang, Sheyu Li

Worldwide burden attributable to diet high in red meat from 1990 to 2019

Table I. Age-standardized summary exposure values for diet high in red meat in different geographic regions, with percentage change and EAPC from 1990 to 2019

Characteristics

1990 age-standardized SEV rate (95% UI)

2019 age-standardized SEV rate (95% UI)

1990–2019 EAPC % (95% UI) Percentage change in age-standardized SEV rates, 1990–2019

Overall 40.5 (33.7, 47.1) 43.9 (38.0, 49.6) 0.3% (0.3%, 0.3%) 8.5% (4.3%, 14.5%)

Sex: Female 41.1 (34.3, 47.5) 43.9 (37.9, 49.6) 0.2% (0.2%, 0.2%) 7.0% (1.9%, 13.5%)

Male 39.8 (33.1, 46.7) 44.0 (38.2, 49.5) 0.3% (0.3%, 0.4%) 10.3% (4.8%, 17.7%)

Socio-demographic index:

High SDI 69.6 (63.4, 75.1) 69.1 (62.6, 75.0) 0.0% (–0.1%, 0.0%) –0.7% (–2.9%, 1.3%)

High-middle SDI 54.5 (46.5, 62.1) 61.9 (55.0, 67.9) 0.5% (0.5%, 0.5%) 13.5% (7.9%, 21.3%)

Middle SDI 28.1 (20.5, 36.0) 38.2 (31.5, 44.6) 1.0% (0.9%, 1.1%) 35.9% (22.6%, 59.1%)

Low-middle SDI 15.3 (11.1, 19.9) 20.6 (16.3, 25.2) 1.0% (0.9%, 1.1%) 34.7% (26.3%, 47.6%)

Low SDI 15.4 (9.8, 20.8) 16.3 (10.6, 22.0) 0.2% (0.2%, 0.2%) 5.8% (3.4%, 9.0%)

Geographic regions:

Andean Latin America 26.2 (17.8, 34.4) 34.3 (25.7, 43.2) 0.9% (0.9%, 1.0%) 31.2% (21.7%, 48.6%)

Australasia 99.2 (98.8, 99.6) 98.5 (97.5, 99.3) 0.0% (0.0%, 0.0%) –0.7% (–1.6%, 0.0%)

Caribbean 27.5 (18.5, 36.2) 28.4 (19.5, 37.5) 0.1% (0.1%, 0.1%) 3.5% (–0.1%, 8.6%)

Central Asia 55.4 (47.2, 63.2) 58.7 (50.7, 66.4) 0.2% (0.0%, 0.3%) 6.0% (2.7%, 9.8%)

Central Europe 59.4 (50.5, 67.5) 69.0 (61.1, 75.9) 0.5% (0.5%, 0.5%) 16.1% (11.3%, 22.6%)

Central Latin America 41.5 (31.9, 51.1) 44.8 (35.2, 54.1) 0.2% (0.2%, 0.3%) 7.8% (3.5%, 14.4%)

Central Sub-Saharan Africa 14.9 (9.8, 20.1) 14.7 (9.9, 19.4) 0.0% (–0.1%, 0.0%) –1.5% (–5.7%, 4.5%)

East Asia 40.2 (29.6, 50.7) 70.0 (61.3, 77.3) 1.9% (1.8%, 1.9%) 74.1% (46.6%, 120.3%)

Eastern Europe 69.6 (61.8, 76.6) 53.5 (43.7, 62.4) –1.0% (–1.1%, –0.9%) –23.2% (–30.7%, –17.0%)

Eastern Sub-Saharan Africa 17.9 (11.1, 24.7) 18.8 (11.6, 25.9) 0.1% (0.1%, 0.2%) 4.7% (0.2%, 9.2%)

High-income Asia Pacific 31.5 (21.5, 41.2) 45.7 (36.7, 54.1) 1.2% (1.1%, 1.3%) 45.1% (29.0%, 76.1%)

High-income North America 80.1 (74.0, 85.5) 77.3 (70.0, 83.3) –0.1% (–0.1%, –0.1%) –3.5% (–8.0%, 0.8%)

North Africa and Middle East 23.7 (15.2, 32.0) 23.6 (15.1, 31.8) 0.0% (–0.1%, 0.1%) –0.4% (–2.6%, 1.7%)

Oceania 33.7 (24.0, 44.2) 29.8 (20.3, 39.5) –0.5% (–0.5%, –0.4%) –11.7% (–22.3%, –2.9%)

South Asia 7.4 (4.9, 10.3) 7.8 (5.1, 10.8) 0.1% (0.1%, 0.2%) 4.5% (0.3%, 8.6%)

Southeast Asia 15.3 (9.3, 21.3) 23.6 (16.6, 30.6) 1.4% (1.3%, 1.5%) 53.7% (37.6%, 82.7%)

Southern Latin America 85.8 (82.6, 88.9) 91.3 (87.8, 94.2) 0.2% (0.2%, 0.2%) 6.3% (3.8%, 9.0%)

Southern Sub-Saharan Africa 38.5 (28.9, 48.2) 43.5 (33.3, 53.1) 0.4% (0.4%, 0.4%) 12.8% (6.1%, 22.8%)

Tropical Latin America 54.7 (44.8, 63.8) 86.5 (81.2, 90.7) 1.2% (0.8%, 1.5%) 58.1% (40.6%, 86.5%)

Western Europe 82.5 (77.6, 87.0) 78.7 (73.0, 84.0) –0.2% (–0.2%, –0.2%) –4.6% (–6.8%, –2.8%)

Western Sub-Saharan Africa 17.4 (10.8, 24.1) 19.3 (12.0, 26.5) 0.3% (0.3%, 0.4%) 10.8% (7.3%, 15.1%)

Deaths and DALY attributable to diet high in red meat

Table II shows the overall and sex-specific trends of global deaths attributable to a diet high in red meat from 1990 to 2019, and Table III shows those of global DALYs. Over the 30 years,

global absolute numbers of deaths and DALYs attributable to a diet high in red meat increased by over 50%. In 2019, a diet high in red meat was responsible for 0.9 million (95% UI: 0.5 to 1.3 million) deaths and 23.9 million (95% UI: 15.6 to 32.0 million) DALYs globally. Nevertheless, the worldwide age-standardized death rates and age-stan-

EAPC – estimated annual percentage change, SDI – socio-demographic index, SEV – summary exposure value, UI – uncertainty interval.

Regions

Central Latin America

Central Sub-Saharan Africa

East Asia

Eastern Europe

Eastern Sub-Saharan Africa

Global High-income Asia Pacific High-income North America North Africa and Middle East Oceania

South Asia Southeast Asia Southern Latin America Southern Sub-Saharan Africa Tropical Latin America

dardized DALY rates attributable to a diet high in red meat decreased by 30.3% (95% UI: –35.8% to –22.8%) and 23.5% (95% UI: –30.0% to –13.3%), respectively (Figures 2 A–D). Among the GBD level 2 risk factors, diet high in red meat ranked higher for DALY in 2019 (23rd place) than it did in 1990 (27th). It ranked stably in the 20th place for death from 1990 to 2019. Also, diet high in red meat ranked 5th in the GBD dietary risk factors for attributable DALYs in 1990 and 2019 [22].

Figures 3 A and B suggest that the age-specific rates of death and DALY attributable to a diet high in red meat increased over age. Death and DALY rates were higher in males than in females among all age groups. Absolute death numbers peaked in the age group ≥ 80 years in both sexes. The DALY numbers peaked at the 60–64 age group in males, whereas it peaked in the age group ≥ 80

Western Europe

Western Sub-Saharan Africa

years in females. Decreasing trends were detected in age-standardized death and DALY rates’ EAPCs for males and females (death: –1.1% and –1.7%; DALY: –0.8% and –1.3%, respectively) (Tables II and III). Age-specific absolute deaths and DALYs along with corresponding rates in different SDI levels are shown in Supplementary Figures 1 A–J.

Among the 21 regions, East Asia showed the highest numbers of deaths (0.1 million in 1990 and 0.3 million in 2019) and DALYs (3.6 million in 1990 and 9.0 million in 2019) attributable to a diet high in red meat, followed by Western Europe, East Europe and High-income North America. The region with the highest age-standardized death and DALY rates changed from Eastern Europe in 1990 to Central Asia in 2019. From 1990 to 2019, the region with the largest percentage decline in the age-standardized death and DALY

Percentage change in ASDR, 1990–2019

1990–2019 EAPC % (95% UI)

2019 ASDR per 100,000 people (95% UI)

2019 no. of deaths (95% UI)

1990 ASDR per 100,000 people (95% UI)

1990 no. of deaths (95% UI)

–27.5% (–36.0%, –12.9%)

–1.1% (–1.3%, –1.0%)

9.4 (3.4, 15.6)

37913.3 (13683.4, 63148.1)

13.0 (4.2, 21.5)

20772.5 (6607.2, 34511.1)

–0.3% (–19.5%, 21.8%)

–0.2% (–0.2%, –0.1%)

19.7 (9.3, 30.5)

1376.3 (641.7, 2185.6)

–10.0% (–23.7%, 4.8%)

–0.5% (–0.6%, –0.4%)

3.2 (1.4, 5.0)

42096.4 (18343.7, 65679.7)

19.7 (9.7, 29.9)

3.6 (1.6, 5.5)

582.4 (284.2, 885.3)

35.3% (13.7%, 73.0%)

1.3% (1.1%, 1.4%)

8.6 (4.6, 12.6)

50048.6 (25629.8, 73141.6)

6.4 (2.9, 9.7)

17251.0 (7340.9, 27037.1)

15151.0 (6599.9, 23156.3)

Table II. Cont. Characteristics

–45.5% (–50.2%, –39.0%)

–2.2% (–2.4%, –2.0%)

17.1 (12.6, 22.0)

14390.6 (10513.7, 18462.2)

31.5 (21.8, 40.8)

13778.0 (9639.2, 17706.4)

North Africa and Middle East

15.7% (0.9%, 37.1%)

0.8% (0.4%, 1.2%)

13.2 (8.0, 18.2)

6751.6 (4191.7, 9256.1)

11.4 (6.5, 16.3)

3031.8 (1746.1, 4310.6)

–19.8% (–32.6%, 3.3%)

–0.7% (–1.0%, –0.5%)

17.1 (12.1, 21.8)

40891.5 (29038.4, 52154.6)

21.3 (12.8, 29.9)

18452.0 (11334.1, 25592.3)

–56.5% (–60.0%, –51.8%)

–3.2% (–3.3%, –3.0%)

8.8 (5.6, 12.1)

89562.1 (56054.3, 125286.8)

20.2 (12.2, 28.1)

115860.4 (69624.3, 161109.7)

Oceania

1.0% (–16.6%, 20.0%)

0.1% (0.1%, 0.2%)

6.4 (2.9, 9.8)

Percentage change in age-standardized DALY rates, 1990–2019

1990–2019 EAPC %. (95% UI)

–1.1% (–1.1%, –1.0%) –23.5% (–30.0%, –13.3%)

10868.6 (4711.3, 16677.9)

6.3 (2.6, 9.9)

5081.2 (2050.2, 8086.2)

South Asia

–28.3% (–35.2%, 18.1%)

–1.3% (–1.4%, –1.3%)

–19.3% (–28.5%, –6.2%)

–0.8% (–0.9%, –0.8%)

–2.0% (–2.2%, –1.8%) –41.6% (–47.5%, –31.1%)

–1.7% (–1.9%, –1.5%) –31.5% (–37.8%, –22.8%)

Southeast Asia

Southern Latin America

Southern Sub-Saharan Africa

Tropical Latin America

Western Europe

Western Sub-Saharan Africa

ASDR –age-standardized death rate, EAPC –estimated annual percentage change, SDI –socio-demographic index, UI –uncertainty interval.

Table III. Trends of DALYs and corresponding age-standardized rates attributable to diet high in red meat in 1990 and 2019

2019 age-standardized DALY rate per 100,000 people (95% UI)

2019 DALY no. (95%UI)

1990 age-standardized DALY rate per 100,000 people (95% UI)

1990 DALY no. (95% UI)

289.8 (189.0, 388.9)

23861073.8 (15599234.1, 32020022.1)

378.6 (224.7, 523.4)

15241217.2 (9084278.3, 20978213.4)

Characteristics

Overall

234.4 (157.1, 307.5)

10164451.6 (6816205.8, 13348860.5)

327.1 (208.2, 440.9)

6951145.4 (4433978.6, 9353746.8)

348.5 (219.4, 478.1)

13696622.1 (8669245.5, 18725223.2)

432.1 (242.5, 608.8)

8290071.8 (4664611.5, 11697466.0)

249.9 (172.0, 324.2)

380.6 (255.7, 510.1)

4201900.4 (2865474.0, 5527812.3)

427.8 (265.2, 585.8)

7591916.5 (5098889.9, 10192780.8)

555.6 (341.5, 759.3)

4317261.1 (2664429.6, 5919848.6)

5952590.0 (3671896.4, 8120186.5)

Sex: Female

Male

Socio-demographic index: High SDI

High-middle SDI

Death rate [1.8, 5.1] [5.1, 7.0] [7.0, 8.6] [8.6, 9.8] [9.8, 12.1] [12.1, 15.3] [15.3, 20.5] [20.5, 73.7] NA

B D

DALY rate [43.6, 142.9] [142.9, 182.9] [182.9, 222.1] [222.1, 259.8] [259.8, 318.1] [318.1, 372.7] [372.7, 523.8] [523.9, 1730.6] NA

EAPC of death rate [–4.500, –2.394] [–2.394, –1.208] [–1.208, –0.472] [–0.472, 0.182] [0.182, 2.950] NA

EAPC of DALY rate [–4.380, –2.142] [–2.142, –1.134] [–1.134, –0.402] [–0.402, 0.188] [0.188, 3.430] NA

Figure 2. ASR of diet high in red meat-related deaths and DALYs in 2019, and the EAPC of age-standardized death and DALY rates from 1990 to 2019 in 204 countries and territories. A – ASR of diet high in red meat-related deaths in 2019; B – ASR of diet high in red meat-related DALYs in 2019; C – EAPC of age-standardized death rates from 1990 to 2019; D – EAPC of age-standardized DALY rates from 1990 to 2019 ASR – age-standardized rate, DALY – disability-adjusted life year, EAPC – estimated annual percentage change, NA – not available.

A B

Number of deaths Number of DALYs Death rate (per 100 000 people) DALY rate (per 100 000 people) 250 000

200 000 150 000 100 000 50 000 0 2 500 000 2 000 000 1 500 000 1 000 000 500 000 0 1200 800 400 0 25 000 20 000 15 000 10 000 5 000 0 Age [years]

II and III). We also summarized the top three countries/territories by different estimates (Table IV and Supplementary Table SI).

Table IV. Top 3 countries/territories of death, DALYs and summary exposure values in different scales (absolute number, percentage changes of age-standardized rates from 1990 to 2019, changes in EAPC of age-standardized rates from 1990 to 2019)

Parameter Ranks 1 2 3

Number of deaths in 2019 (number, 95% UI) China 323380.4 (204050.3, 456381.2)

DALY number in 2019 (number, 95% UI) China 8749511.7 (6073753.9, 11756943.0)

SEV rate in 2019 (95% UI) Mongolia 99.8 (99.5, 100.0)

Increase in age-standardized death rate from 1990 to 2019 (%, 95% UI)

Increase in age-standardized DALY rate from 1990 to 2019 (%, 95% UI)

Increase in age-standardized SEV rate from 1990 to 2019 (%, 95% UI)

Increase in EAPC of agestandardized death rate from 1990 to 2019 (%, 95% UI)

Increase in EAPC of agestandardized DALY rate from 1990 to 2019 (%, 95% UI)

Increase in EAPC of agestandardized SEV rate from 1990 to 2019 (%, 95% UI)

Decrease in age-standardized death rate from 1990 to 2019 (%, 95% UI)

Decrease in age-standardized DALY rate from 1990 to 2019 (%, 95% UI)

Decrease in age-standardized SEV rate from 1990 to 2019 (%, 95% UI)

Decrease in EAPC of agestandardized death rate from 1990 to 2019 (%, 95% UI)

Decrease in EAPC of agestandardized DALY rate from 1990 to 2019 (%, 95% UI)

Decrease in EAPC of agestandardized SEV rate from 1990 to 2019 (%, 95% UI)

Uzbekistan 99.3% (59.5, 136.4%)

Philippines 125.4% (67.2%, 188.3%)

Myanmar 159.5% (100.9%, 251.4%)

Philippines 3.0% (2.4%, 3.5%)

Philippines 3.4% (2.8%, 4.1%)

Myanmar 3.1% (2.8%, 3.4%)

Estonia –64.8% (–74.3%, –53.0%)

Estonia –62.7% (–70.9%, –52.2%)

United Arab Emirates –49.6% (–62.4%, –38.0%)

Estonia –4.5% (–4.9%, –4.2%)

Estonia –4.4% (–4.7%, –4.0%)

United Arab Emirates –2.6% (–2.9%, –2.3%)

Impact of diet high in red meat on diseases

In 2019, ischemic heart disease, diabetes, and colorectal cancer were the three leading diseases attributable to a diet high in red meat, which accounted for 54.3% of diet high in red meat-related deaths (39.2%, 9.2%, and 5.9% respectively)

United States of America 65652.5 (37013.5, 94390.8)

United States of America 1753972.2 (1169791.2, 2319937.9)

Argentina 98.8 (97.7, 99.6)

Philippines 94.4% (47.0%, 150.7%)

Viet Nam 81.2% (25.4%, 192.2%)

Republic of Korea 123.2% (77.8%, 213.3%)

Uzbekistan 2.5% (2.0%, 3.0%)

Viet Nam 2.6% (2.3%, 2.9%)

Maldives 2.4% (2.0%, 2.8%)

United Kingdom –63.9% (–68.4%, –56.4%)

Denmark –59.0% (–65.3%, –46.8%)

Libya –32.8% (–43.8%, –23.3%)

United Kingdom –4.0% (–4.3%, –3.7%)

Denmark –3.6% (–3.8%, –3.4%)

Libya –1.4% (–1.5%, –1.3%)

Russian Federation 51879.1 (25366.6, 81222.8)

Brazil 1180345.8 (868005.1, 1467241.2)

Australia 98.8 (97.7, 99.5)

Viet Nam 74.2% (24.0%, 168.7%)

Uzbekistan 76.1% (45.5%, 111.5%)

Viet Nam 111.0% (70.1%, 194.6%)

Myanmar 2.4% (2.2%, 2.7%)

Lesotho 2.5% (2.2%, 2.8%)

Viet Nam 2.3% (2.0%, 2.6%)

Luxembourg –63.7% (–69.5%, –56.6%)

United Arab Emirates –59.0% (–73.6%, –45.9%)

Madagascar –31.3% (–41.5%, –22.9%)

Luxembourg –3.9% (–4.0%, –3.7%)

Austria –3.5% (–3.8%, –3.2%)

Afghanistan –1.4% (–1.6%, –1.1%)

in total. A similar pattern was found for DALYs. In 2019, diet high in red meat-related age-standardized death rates of ischemic heart disease, diabetes and colorectal cancer were 4.5, 1.0 and 0.7 per 100,000 people, respectively, and DALY rates were 94.6, 49.8 and 14.9 per 100,000 people, respectively (Supplementary Tables SII–SIV).

Dan Liu, Qingyang Shi, Gaiping Cheng, Qiaorong Huang, Sheyu Li

DALY – disability-adjusted life year, EAPC – estimated annual percentage change, SEV – summary exposure value, UI – uncertainty interval.

Worldwide, the age-standardized death and DALY rates for ischemic heart disease associated with diet high in red meat decreased from 1990 to 2019, while those for diabetes increased and

those for colorectal cancer kept stable (Figure 4, Supplementary Tables SII–SIV). However, disparities still existed in different SDI quintiles for the age-standardized death and DALY rates for isch-

Figure 4. Fraction of ischemic heart disease, diabetes mellitus and colorectal cancer age-standardized death and DALY rates attributable to diet high in red meat by SDI over 30 years. A – Fraction of age-standardized death rates of each disease by SDI over 30 years; B – Fraction of age-standardized DALY rates of each disease by SDI over 30 years

DALY – disability-adjusted life year, SDI – socio-demographic index.

Regions

Central Latin America

Central Sub-Saharan Africa

East Asia

Eastern Europe

Eastern Sub-Saharan Africa

Global High-income Asia Pacific High-income North America North Africa and Middle East Oceania

South Asia Southeast Asia Southern Latin America

Southern Sub-Saharan Africa Tropical Latin America

Western Europe Western Sub-Saharan Africa

ASR – age-standardized rate, DALY – disability-adjusted life year, SDI – socio-demographic index, SEV – summary exposure value.

emic heart disease and colorectal cancer (Figures 4 A, B). The age-standardized death and DALY rates of ischemic heart disease and colorectal cancer showed a decreasing trend in the high and high-middle SDI quintiles, while those for the middle and low-middle SDI were increasing. Notably, the age-standardized DALY rates of diabetes were rising in all SDI quantiles.

Burden attributable to diet high in red meat in countries or territories with different SDI

Figure 5 illustrates the trend of age-standardized SEV, death, and DALY rates of diet high in red meat in countries or territories with different SDI. The high SDI quintile has always held the highest age-standardized SEV rate attributable to a diet high in red meat, while the age-standardized SEV rate remained the lowest in the low SDI quintile. The age-standardized SEV rates of middle and low-middle SDI quintiles increased the most rapidly (EAPC 1.0%, 95% UI: 0.9% to 1.1.%) and went up by more than 30% over the 30 years (Figure 5 A, Table I). From 1990 to 2019, diet high in red meat-related death and DALY numbers increased in all SDI quintiles except for the high SDI quintile (Tables II and III). The high-middle SDI quintile had the highest number of deaths attributable to a diet high in red meat (0.2 million in 1990 and 0.3 million in 2019) (Table II). The district with the highest DALYs changed from the high-middle SDI quintile in 1990 to the middle SDI quintile in 2019 (Table III). The age-standardized death and DALY rates decreased significantly in the high and high-middle SDI quintiles, whereas the changes leveled off in other SDI quintiles during the past 30 years (Figures 5 B and C, Tables II and III).

The age-standardized death and DALY rates showed a similar correlation with SDI during the study period. Of the 6 regions with the highest SDI, five showed an obvious decrease in age-standardized death and DALY rates, whereas those in Eastern Europe first saw an obvious increase then a sharp drop between 1990 and 2019. In addition, compared with the six regions with the highest SDI, all the other regions with lower SDI exhibited a mild-to-moderate decline or remained stable in the age-standardized death and DALY rates except for East Asia and Southeast Asia, where the age-standardized death and DALY rates gradually increased from 1990 to 2019 (Figures 5 D, E).

Discussion

This study comprehensively summarized the patterns and trends of epidemiology and burden of diet high in red meat and identified an 8.3% increase of the age-standardized SEV rate of diet

high in red meat from 1990 to 2019, and it is among the highest burdensome dietary factors worldwide. The total deaths and DALYs attributable to a diet high in red meat grew by 50% globally from 1990 to 2019, while the age-standardized death and DALY rates decreased by 30.3% and 23.5%, respectively. The main factor contributing to the decrease of age-standardized burden was ischemic heart disease in high or high-middle SDI countries. It calls for advanced healthcare services for risk factors of ischemic heart diseases including blood pressure, cholesterol, glucose and obesity based on recent guidelines [23–31].

Some countries, especially those with middle or low-middle SDI, however, have been facing increasing age-standardized death and DALY rates in the past 30 years. Economic growth, undoubtedly, brought more affordable red meat and shifted the pattern of disease burden in low to middle-income countries from communicable, maternal, neonatal, and nutritional diseases to noncommunicable chronic diseases [32, 33]. Both the burden from ischemic heart disease and colorectal cancer increased in these countries. Since 2002, the age-standardized death and DALY rates in countries with middle SDI have surpassed those with high SDI.

The disparities across countries with different SDIs reflected the effectiveness of proper public health policies in controlling the disease burden attributable to a diet high in red meat and call for attention from stakeholders in countries which may face such policy reformation. Over the past few decades, the decreasing trend of red meat consumption in those high-income countries/territories is largely due to a growing awareness of the negative health effects of red meat and greater compliance with the dietary recommendations [34–36]. People in the high SDI regions are more willing to pay for healthier food such as white meat, poultry or plant-based alternatives replacing red meat [37, 38]. Meanwhile, systemic primary care facilities and medical insurance in these countries support effective prevention and treatment of diseases associated with excessive red meat consumption (especially ischemic heart disease), diminishing deaths and DALY attributable to a diet high in red meat. In addition, other factors such as skilled care services, extensive health education, and low-cost healthcare benefits further contribute to the decrease of burden [39, 40]. With the rising burden attributable to a diet high in red meat, countries in the middle or low-middle SDI quantile warrant urgent reformation and regulation of their current health care systems.

Of note, both the consumption of red meat and attributed disease burden kept stably low in countries with low SDI over the past 30 years. It does

not mean that people in these countries will not face such challenges. With persistent economic development but not health policy reformation, overconsumption of red meat will one day bring a burden in these countries, as has happened in other countries in the past few decades. Stakeholders from countries with currently low SDI should always keep this dietary risk factor and others in mind together with the algorithm to develop the economics.

Ischemic heart disease, diabetes and colorectal cancer are major causes of death and disability that are related to overconsumption of red meat [4]. Although the disease burden of ischemic heart disease has been well controlled in countries with high SDI, the age-standardized DALY rates of diabetes attributable to a diet high in red meat continue to increase in most countries or territories. It calls for novel advanced strategies to prevent diabetes as well as its complications without affecting living conditions in other aspects [41].

When interpreting the results in practice, stakeholders should understand the limitations of this study, which was based on the country/ region-level data from the GBD website. The lack of individual patient data does not allow us to perform analyses in detail and further explore the factors as well as the dose-response manner. Also, the retrospective ecological design restricted any causal inference, and we are unable to test the effectiveness of a particular health policy.

In conclusion, the increasing consumption of red meat remains a challenge for the world health system, especially in the low-middle or middle SDI countries. Stakeholders should urgently take action in controlling the burden attributable to a diet high in red meat, especially those at risk.

Acknowledgments

We thank the Global Burden of Disease Study Collaborators for their work.

Conflict of interest

The authors declare no conflict of interest.

References

1. GBD 2017 Diet Collaborators. Health effects of dietary risks in 195 countries, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet 2019; 393: 1958-72.

2. Ritchie H, Roser M. Meat and Dairy Production. Our World in Data; 2019. Available from: https://ourworldindata.org/meat-production. Accessed August 2, 2022.

3. Mattiuzzi C, Lippi G. Epidemiologic burden of red and processed meat intake on colorectal cancer mortality. Nutr Cancer 2021; 73: 562-7.

4. Wolk A. Potential health hazards of eating red meat. J Intern Med 2017; 281: 106-22.

5. Ekmekcioglu C, Wallner P, Kundi M, Weisz U, Haas W, Hutter HP. Red meat, diseases, and healthy alternatives: a critical review. Crit Rev Food Sci Nutr 2018; 58: 247-61.

6. Qian F, Riddle MC, Wylie-Rosett J, Hu FB. Red and processed meats and health risks: how strong is the evidence? Diabetes Care 2020; 43: 265-71.

7. Abete I, Romaguera D, Vieira AR, Lopez de Munain A, Norat T. Association between total, processed, red and white meat consumption and all-cause, CVD and IHD mortality: a meta-analysis of cohort studies. Br J Nutr 2014; 112: 762-75.

8. Zhong VW, Van Horn L, Greenland P, et al. Associations of processed meat, unprocessed red meat, poultry, or fish intake with incident cardiovascular disease and allcause mortality. JAMA Intern Med 2020; 180: 503-12.

9. Bendinelli B, Palli D, Masala G, et al. Association between dietary meat consumption and incident type 2 diabetes: the EPIC-InterAct study. Diabetologia 2013; 56: 47-59.

10. Farvid MS, Sidahmed E, Spence ND, Mante Angua K, Rosner BA, Barnett JB. Consumption of red meat and processed meat and cancer incidence: a systematic review and meta-analysis of prospective studies. Eur J Epidemiol 2021; 36: 937-51.

11. De Oliveira Mota J, Boué G, Guillou S, Pierre F, Membré JM. Estimation of the burden of disease attributable to red meat consumption in France: influence on colorectal cancer and cardiovascular diseases. Food Chem Toxicol 2019; 130: 174-86.

12. Papier K, Knuppel A, Syam N, Jebb SA, Key TJ. Meat consumption and risk of ischemic heart disease: a systematic review and meta-analysis. Crit Rev Food Sci Nutr 2021; 20: 1-12.

13. Feskens EJ, Sluik D, van Woudenbergh GJ. Meat consumption, diabetes, and its complications. Curr Diab Rep 2013; 13: 298-306.

14. Micha R, Wallace SK, Mozaffarian D. Red and processed meat consumption and risk of incident coronary heart disease, stroke, and diabetes mellitus: a systematic review and meta-analysis. Circulation 2010; 121: 2271-83.

15. Springmann M, Mason-D’Croz D. Health-motivated taxes on red and processed meat: a modelling study on optimal tax levels and associated health impacts. PLoS One 2018; 13: e0204139.

16. Bouvard V, Loomis D, Guyton KZ, et al. Carcinogenicity of consumption of red and processed meat. Lancet Oncol 2015; 16: 1599-600.

17. 2015–2020 Dietary Guidelines for Americans. 8th Edition; 2015. Available from: https://health.gov/our-work/ food-nutrition/previous-dietary-guidelines/2015. Accessed August 2, 2022.

18. Davison TM, Black JL, Moss JF. Red meat-an essential partner to reduce global greenhouse gas emissions. Anim Front 2020; 10: 14-21.

19. GBD 2019 Risk Factors Collaborators. Global burden of 87 risk factors in 204 countries and territories, 19902019: a systematic analysis for the Global Burden of Disease Study 2019. Lancet 2020; 396: 1223-49.

20. Global Burden of Disease Collaborative Network. Global Burden of Disease Study 2019 (GBD 2019) Results; 2020. Available from: http://ghdx.healthdata.org/gbdresults-tool. Accessed May 2, 2022.

21. Stevens GA, Alkema L, Black RE, et al. Guidelines for accurate and transparent health estimates reporting: the GATHER statement. Lancet 2016; 388: e19-23.

22. Global Burden of Disease Collaborative Network. Diet high in red meat – Level 3 risk; 2019. Available from:

Dan Liu, Qingyang Shi, Gaiping Cheng, Qiaorong Huang, Sheyu Li

Worldwide burden attributable to diet high in red meat from 1990 to 2019

http://www.healthdata.org/results/gbd_summaries/2019/diet-high-in-red-meat-level-3-risk. Accessed August 2, 2022.

23. Unger T, Borghi C, Charchar F, et al. 2020 International Society of Hypertension Global Hypertension Practice Guidelines. Hypertension 2020; 75: 1334-57.

24. Zhubi-Bakija F, Bajraktari G, Bytyci I, et al. The impact of type of dietary protein, animal versus vegetable, in modifying cardiometabolic risk factors: a position paper from the International Lipid Expert Panel (ILEP). Clin Nutr 2021; 40: 255-76.

25. Hao Q, Aertgeerts B, Guyatt G, et al. PCSK9 inhibitors and ezetimibe for the reduction of cardiovascular events: a clinical practice guideline with risk-stratified recommendations. BMJ 2022; 377: e069066.

26. Khan SU, Yedlapati SH, Lone AN, et al. PCSK9 inhibitors and ezetimibe with or without statin therapy for cardiovascular risk reduction: a systematic review and network meta-analysis. BMJ 2022; 377: e069116.

27. Du H, Li X, Su N, et al. Proprotein convertase subtilisin/ kexin 9 inhibitors in reducing cardiovascular outcomes: a systematic review and meta-analysis. Heart 2019; 105: 1149-59.

28. Li J, Du H, Wang Y, et al. Safety of proprotein convertase subtilisin/kexin 9 inhibitors: a systematic review and meta-analysis. Heart 2022; 108: 1296-302.

29. Li S, Vandvik PO, Lytvyn L, et al. SGLT-2 inhibitors, or GLP-1 receptor agonists for adults with type 2 diabetes: a clinical practice guideline. BMJ 2021; 373: n1091.

30. Shi Q, Wang Y, Hao Q, et al. Pharmacotherapy for adults with overweight and obesity: a systematic review and network meta-analysis of randomised controlled trials. Lancet 2022; 399: 259-69.

31. Li J, Shi Q, Gao Q, et al. Obesity pandemic in China: epidemiology, burden, challenges, and opportunities. Chin Med J 2022; 135: 1328-30.

32. GBD 2019 Diseases and Injuries Collaborators. Global burden of 369 diseases and injuries in 204 countries and territories, 1990-2019: a systematic analysis for the Global Burden of Disease Study 2019. Lancet 2020; 396: 1204-22.

33. Lippi L, Mattiuzzi C. The global burden of pancreatic cancer. Arch Med Sci 2020; 16: 820-4.

34. Zeng L, Ruan M, Liu J, et al. Trends in processed meat, unprocessed red meat, poultry, and fish consumption in the United States, 1999-2016. J Acad Nutr Diet 2019; 119: 1085-98.e12.

35. Stewart C, Piernas C, Cook B, Jebb SA. Trends in UK meat consumption: analysis of data from years 1-11 (200809 to 2018-19) of the National Diet and Nutrition Survey rolling programme. Lancet Planet Health 2021; 5: e699-708.

36. Clonan A, Roberts KE, Holdsworth M. Socioeconomic and demographic drivers of red and processed meat consumption: implications for health and environmental sustainability. Proc Nutr Soc 2016; 75: 367-73.

37. Daniel CR, Cross AJ, Koebnick C, Sinha R. Trends in meat consumption in the USA. Public Health Nutr 2011; 14: 575-83.

38. Dibb S, Fitzpatrick I. Let’s talk about meat: changing dietary behaviour for the 21st century; 2014. Available from: http://www.eatingbetter.org/uploads/Documents/ Let’sTalkAboutMeat.pdf. Accessed August 2, 2022.

39. Habicht T, Reinap M, Kasekamp K, Sikkut R, Aaben L, van Ginneken E. Estonia: health system review. Health Syst Transit 2018; 20: 1-189.

40. OECD. OECD reviews of health care quality: United Kingdom 2016: Raising standards. OECD Publishing, Paris 2016.

41. Jankowska A, Golicki D. Self-reported diabetes and quality of life: findings from a general population survey with the Short Form-12 (SF-12) Health Survey. Arch Med Sci 2021; 18: 1157-68.

Positron emission tomographic studies of the association between atherogenesis and aortitis among psoriatic patients

Lin

1Department of Radiology, Liaocheng People’s Hospital, Liaocheng City, Shandong Province, China

2Department of Radiology, The Second People’s Hospital of Liaocheng, Shandong Province, China

Submitted: 8 May 2019; Accepted: 16 July 2019 Online publication: 7 May 2020

Arch Med Sci 2023; 19 (1): 16–24

DOI: https://doi.org/10.5114/aoms.2020.94983

Copyright © 2020 Termedia & Banach

Abstract

Introduction: There is increased interest in the use of positron emission tomography (PET) in psoriatic patients. We used PET induced with tracer fluorine-18 ( 18F) fluorodeoxyglucose (FDG) to study the association between the process of early-atherogenesis (eAg) and aortitis by quantifying enhanced aortic vascular inflammation along with calculation of total coronary plaque load (TCPL) and non-calcified atherosclerotic plaque load (NcAPL). In order to study the utility of aortitis in capturing eAg, we also assessed luminal stenosis atherosclerosis (LSA) and high-risk coronary plaques (HrCP). Material and methods: The study was conducted at our hospital between 1 April 2014 and 31 December 2017, and the analysis was done in July 2018. We recruited 180 consecutive psoriatic patients and subjected them to 18F-FDG PET. However, in order to characterise eAg, 160 out of 180 patients were also subjected to coronary angiographic computed tomographic studies (CACTS). Results: Among 180 psoriatic patients (76 women, 42%) (mean [SD] age, 51.1 [13.2] years), greater prevalence values of LSA (odd ratio [OR], 3.71; 95% confidence interval [CI], 1.84–7.89; p = 0.001) and HrCP (OR, 3.11; 95% CI: 1.54–6.51; p = 0.003) along with enhanced TCPL (standardised β  = 0.44; p  < 0.001) were observed in patients with enhanced aortitis. However, the association between aortitis and HrCP was controlled by low-attenuation plaque (LAP), while the same between aortitis and TCPL was controlled by NcAPL ( β = 0.45; p < 0.001).

Conclusions: Association between aortitis and broad coronary angiographic indices was achieved and hence predicted the possibility of a surrogate role of aortitis in eAg.

Key words: positron emission tomography, aortitis, psoriasis, atherosclerotic, angiography.

Introduction

The hallmark of early atherogenesis (eAg), atherosclerosis, is a disease responsible for the contribution to macrophage cholesterol accumulation, and it leads to oxidation of low-density lipoproteins and hence is responsible for cellular accumulation of cholesterol and oxysterols. However, the driving force of atherosclerosis is thought to be inflammation [1, 2]. The reduction in cardiovascular events is directly proportional to the re-

Corresponding author: Daliang Liu Department of Radiology Liaocheng People’s Hospital Liaocheng City, Shandong Province 252000, China E-mail: davisvictoria215@yahoo.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Li1, Yinglin Ge2, Xianghui Wan1, Kunpeng Wu1, Daliang Liu1

duction of inflammation due to the respective reduction in high-sensitive C-reactive protein [3, 4]. Thus, the importance of the role of residual inflammation risk in atherosclerosis has been established.

It is a well-established fact that association of enhanced aortitis, enhanced cardiovascular risk, and enhanced incidence of early cardiovascular events with psoriasis, a chronic inflammatory skin disorder, plays an essential role in the study of eAg [5–8]. Hence the activity and importance of chronic inflammation in eAg in vivo can be studied with the help of psoriatic patients.

Aortitis is considered as a pathological term that refers to the presence of modification in inflammation with respect to the aortic wall. The infectious and non-infectious causes can be easily distinguished by the pattern of aortic involvement and imaging. Inflammatory aortic diseases have been evaluated by various imaging modalities and resulted in the terms of aortic lumen evaluation or aortic wall modifications. Besides, aortitis may occur idiopathically [9] as well as in a number of rare rheumatological and infectious diseases, and in atherosclerosis. However, as per clinical criteria, almost 15% of the aorta may be affected during the process [10].

Traditionally, angiography has been used for imaging purpose for the detection of luminal abnormalities, but its usage has several limitations, which is why multidetector computed tomography is considered as a replacement for conventional angiography. In this background, aortitis studies by 18F fluorodeoxyglucose positron emission tomography (18F-FDG PET) came into action, and so far it has not been explored up to the mark in the last decade [11, 12]. Recently, usage of 18F-FDG PET/CT has been explored in the field of rheumatology [13]. Association of aortitis with activity of pro-inflammatory CD-68 macrophages within the arterial wall has been previously demonstrated by 18F-FDG PET [14]. In this way, there is association between aortitis and improvement in cardiovascular risk prediction [15] along with its responsive nature for risk-modifying agents like statins and anti-inflammatory therapies [16–19]. Association between aortitis and coronary artery disease has been demonstrated in terms of association between aortitis and high-risk coronary plaque (HrCP) morphology [20].

Coronary angiographic computed tomographic study (CACTS) is an essential imaging instrument for the analysis of plaques of coronary arteries [21] because it can quantify even the load of coronary artery disease [22–25]. Non-calcified atherosclerotic plaque load (NcAPL) assessed by CACTS has been demonstrated to affiliate with thin cap fibroatheroma [26] and is enhanced in psoriatic pa-

tients [24]. Recently, association between non-alcoholic fatty liver disease with cardiovascular disease and subclinical atherosclerosis has been established [27]. As per our knowledge, association of aortitis with coronary plaque characteristics has not been demonstrated so far. Herein, we used a cohort study of patients with psoriasis using 18F-FDG PET and CACTS so that we could analyse the association between aortitis and CACTSbased assessments of coronary angiographic indices like total coronary plaque load (TCPL) and NcAPL, luminal stenosis atherosclerosis (LSA), and HrCP features.

Material and methods Study design

The institutional review board of our hospital reviewed and approved our study (IRB Grant No: 2019-104). Written, informed consent was obtained from each of the enrolled participants before their inclusion in our study. A study cohort of consecutive psoriatic patients (n = 180) was designed in such a way that those subjects were recruited between 1 April 2014 and 31 December 2017 for 18F-FDG PET analysis. All participants were older than 18 years. Psoriatic patients underwent formal diagnosis of plaque psoriasis before inclusion in the study. The severity of psoriasis was assessed for all the patients and measured as psoriasis area severity index (PASI) score. Two characteristics of patients, such as pregnancy and lactation in female patients, were taken as exclusion criteria. Out of these subjects, 20 subjects were unable to appear on specific visit dates and hence could not participate in CACTS. Thus, a total of 160 patients were subjected to CACTS (Figure 1). Furthermore, a total of 153 scans (459 arteries) out of these 160 subjects were found to be explicable and hence were included in the final quantitative analysis of plaque loads. Additionally, for LSA and HrCP analyses, respectively, 144 patients (432 arteries) and 142 patients (426 arteries) were available.

Analysis of aortitis by 18FDG PET

All patients (after an overnight fast) were subjected to 18FDG PET scans followed by their reading blindly with respect to patient characteristics and imaging time point. As per previous reports [8, 27], we used a devoted PET analysis program (Extended Brilliance Workspace; Phillips Healthcare) for the analysis of obtained images so that we could quantify aortitis in terms of target-to-background ratio (TBR). We followed a common protocol as we took images 60 min after administration of 10 mCi 18FDG. Similarly, we scanned each patient cranially to caudally and from the vertex to the toes after

Positron emission tomographic studies of the association between atherogenesis and aortitis among psoriatic patients

Psoriasis patients recruited consecutively for our cohort study using 18F-FDG PET scans during 1st April, 2014 to 31st December, 2017 (n = 180)

Patients agreed for CACTS for analysis of aortitis at baseline (n = 160)

Patients discarded due to unavailability of scanner (n = 20)

Figure 1. Schematic representation of our cohort study

keeping standard bed positions of three minutes. Uptake of  18FDG in the aortic wall was measured by taking 1.5 mm thick axial slices of aorta. A PET 64-slice scanner (Siemens Medical Solutions USA, Malvern, PA, USA) was used for recording the images. We took two measures of required features by keeping areas of interest in the entire aorta. For background purposes, we placed similar regions of interest on 10 contiguous superior vena cava slices and took the mean. For each aortic slice the maximal standardised uptake value was divided by the average venous mean standardised uptake value and then the average was taken and it was used as the target-to-background ratio.

Assessment of coronary angiographic indices

We performed additional scans for coronary angiography (320-detector row volumetric scanner, Aquilion ONE ViSION or Genesis) for only those psoriatic patients who were interested in doing so. Scans were performed with a 100–120 kV tube voltage with tube current keeping a gantry rotation time of 275 ms. If the heart rate was greater than 70 beats per minute, then an oral beta-blocker was administered. We kept a slice thickness of 0.5 mm (with slice interval of 0.25 mm) for image acquisition. As in the previous report [23], we used dedicated software QAngio CT (Medis) and evaluated TCPL across three major epicardial coronary arteries. Each of the major coronary arteries was subjected to semi-automated segmentation. Transverse reconstructed cross-sections were assessed at increments of 0.5 mm whenever manual calibration was required for review. Indices with respect to CACTS, i.e. TCPL and NcAPL were evaluated by division of total plaque volume with total length and hence were given in units of mm2. Furthermore, for LSA analysis,

I – Quantitative association analyses of TCPL (n = 153; 459 arteries)

II – Quantitative association analyses of LSA (presence and severity) (n = 144; 432 arteries)

III – Quantitative association analyses of HrCP (n = 142; 426 arteries)

clinical reading outcomes were used. Stenosis severity was categorised as per previous reports’ guidelines [28–30]. A condition such as a plaque with positive remodelling (positively remodelled plaque (PRP)) (index > 1.1) and/or the presence of LAP (< 30 units), which resulted during analyses of all the coronary segments, was considered as the presence of HrCP [31]. Both the aforementioned conditions were scored for each artery according to its presence in that particular artery. We added LAP and PRP scores to yield an HrCP score. However, the addition of both the scores leads to a high-risk plaque score. All the scores were further verified by intra-class and inter-class correlation analyses, and 95% and 94% coefficient values, respectively, were found.

Assessment of traditional cardiovascular factors

Analysis of several traditional cardiovascular factors such as high- and low-density lipoprotein cholesterol, along with other clinical features (as shown in Table I), were performed for all the patients. As per previous reports [32, 33], homeostasis model assessment of insulin resistance as well as Framingham 10-year risk score were calculated. A survey-based questionnaire with respect to several demographic parameters and history (as shown in Table I) and previously established diagnoses of hypertension and diabetes was also performed for each patient.

Statistical analysis

The association between aortitis and eAg was examined by performing multivariable linear regressions on CACTS indices scores. For this purpose, continuous data were reported as mean ± SD for parametric variables and as median with interquartile range for the created patient groups.

Lin Li, Yinglin Ge, Xianghui Wan, Kunpeng Wu, Daliang Liu

18F-FDG PET – fluorine-18 fluorodeoxyglucose positron emission tomography, CACTS – coronary angiographic computed tomographic studies, TCPL – total coronary plaque load, LSA – luminal stenosis atherosclerosis, HrCP – high-risk coronary plaques.

Table

I.

Baseline characteristics of the patients with respect to severity of aortitis

Parameters Mean (SD) P -value

Total ( n  = 180) TBR ≥ Median ( n  = 92) < Median ( n  = 88)

Demographics and history:

Age [years] 51.1 (13.2) 51.7 (11.9) 50.5 (14.5) 0.1 Women (%) 76 (42) 32 (23) 44 (50) 0.001

Body mass index [kg/m2] 30.0 (6.3) 33.1 (6.4) 26.9 (4.1) < 0.001

Lipid treatment (%) 56 (31) 29 (31) 27 (31) 0.84

Current tobacco use (%) 14 (8) 9 (10) 5 (6) 0.49

Type 2 diabetes (%) 16 (9) 12 (13) 4 (5) 0.18

Hyperlipidaemia (%) 92 (51) 47 (51) 43 (49) 0.44

Hypertension (%) 50 (28) 29 (32) 20 (23) 0.12

Clinical features:

LDL cholesterol [mg/dl] 101.9 (30.9) 103.1 (29.4) 100.7 (34.2) 0.44 HDL cholesterol [mg/dl] 56.7 (18.2) 50.2 (14.1) 63.1 (18.8) < 0.001

Total cholesterol [mg/dl] 179.0 (38.1) 179.5 (36.9) 176.5 (41.5) 0.62

SBP [mm Hg] 121.9 (14.7) 124.3 (15.9) 119.5 (12.9) 0.01

Triglycerides [mg/dl] 100 (78–138) 111 (81–188) 91 (71–120) < 0.001 eAg 2.3 (0.8–5.8) 3.7 (1.8–8.1) 1.8 (0.9–4.1) < 0.001 HOMA-IR 3.1 (1.8–4.9) 4.2 (2.6–6.8) 2.2 (1.5–3.3) < 0.001 HSCRP [mg/l] 2.1 (0.8–4.6) 2.7 (1.1–7.0) 1.7 (0.7–3.6) 0.01

Psoriasis features: Disease duration [years]) 20 (9–30) 20 (10–30) 19 (9–30) 0.40 PASI score 5.4 (3–10) 6.1 (3.1–11.4) 4.5 (2.7–8.1) 0.03

SD – standard deviation, TBR – target-to-background ratio, LDL – low-density lipoprotein, HDL – high-density lipoprotein, SBP – systolic blood pressure, eAg – early atherogenesis, HOMA-IR – homeostasis model assessment of insulin resistance, HSCRP – high-sensitivity C-reactive protein, PASI – psoriasis area severity index.

Student’s t-tests were used for comparisons between stratified groups for parametric continuous data, and for non-parametric data we used Mann-Whitney U-tests. For comparison of categorical variables we used Pearson’s c2 tests. The association between aortitis by 18FDG PETderived target-to-background ratios (TBR) and TCPL and NcAPL, calibrating for confounding covariates, was then evaluated on the basis of multivariable linear regression analyses. These analyses were reported in terms of standardised β-values, defined as change in SD in the outcome variables (i.e. TCPL and NcAPL) divided by change in SD in the input exposure (aortitis) and in p-values. Also, association between aortitis and LSA as well as HrCP were examined by performing multivariable logistic regressions, while association between aortitis and LSA severity was examined by performing ordered logistic regressions. Brant and likelihood-ratio tests were used as post-estima-

tion tests. For all logistic regression analyses, we reported only those odds ratios (ORs) which have 95% confidence intervals. For all statistical analyses we used STATA version 12 (StataCorp, College Station, TX, USA), p < 0.05.

Results

Study population characteristics

The characteristics of our study population at baseline are summarised in Table I. We included 180 middle-aged psoriatic patients (76 women, 42%) (mean [SD] age, 51.1 [13.2] years) having moderate skin disease severity (index) PASI score (interquartile range [IQR], 3–10; median, 5.4). We kept the median psoriasis duration at exactly two decades. The mean (SD) body mass index (BMI) was 30.0 ([6.3]), which indicated the overweight profiles of the psoriatic patients. We had near-normal lipid profiles for the patients, but still we got

Positron emission tomographic studies of the association between atherogenesis and aortitis among psoriatic patients

Table II. Baseline coronary angiographic computed tomographic studies characteristics of our study cohort stratified by median value of early atherogenesis

Parameter

TBR, mean (SD) P -value ≥ Median ( n  = 88) < Median ( n  = 92)

Aortitis TBR 1.92 (0.25) 1.56 (0.11) < 0.001

CACTS-based LSA (No./arteries) 69/207 75/225 –

LSA: Presence 40 (58) 27 (36) < 0.001 Severity: None (0–24%) 140 (57) 195 (71.5) 0.002 Mild (25–49%) 84 (32) 53 (20) Moderate (50–69%) 8 (4) 3 (2) Severe ( ≥ 70%) 2 (1) 2 (1)

TCPL: Dense-calcified 0.03 (0.10) 0.03 (0.07) 0.62 Non-calcified 1.26 (0.45) 0.89 (0.35) < 0.001 Total 1.29 (0.46) 0.95 (0.36) < 0.001

HrCP (No./arteries) 70/210 72/216 –HrCP presence (%) 31 (44) 17 (24) 0.02

PRP scores: 0 230 (90.6) 241 (91.8) 0.71 1 18 (8) 18 (6.9) 2 1 (0.5) 1 (0.5) ≥ 3 3 (2) 1 (0.5)

LAP scores: 0 204.5 (82) 218 (83.9) 0.03 1 32.5 (14) 40.5 (15) 2 7.5 (3) 2 (1.5) ≥ 3 5 (1.5) 0 (0)

HrCP scores: 0 185.5 (73.5) 208 (79.5) 0.02 1 47.5 (19.5) 39.5 (15) 2 8.5 (3) 10.5 (4) ≥ 3 8 (2.5) 1.5 (0.5)

CACTS – coronary angiographic computed tomographic studies, TBR – target-to-background ratio, SD – standard deviation, LSA – luminal stenosis atherosclerosis, TCPL – total coronary plaque load, HrCP – high-risk coronary plaques, PRP – positively remodelled plaque, LAP –low-attenuation plaque.

a high prevalence of dyslipidaemia (51%), having total cholesterol of 179 (38.1) mg/dl and low-density lipoprotein cholesterol of 101.9 (30.9) mg/dl. Hence around 29% of patients in our study population (52 patients) were receiving lipid-lowering therapy at baseline. Despite of low prevalence

of type 2 diabetes (9%) enhancement in insulin resistance in psoriatic patients was observed, and it was reported in terms of homeostatic model assessment insulin resistance (IQR, 1.8–4.9; median 3.1). Risk for cardiovascular disease due to eAg was very low in these psoriatic patients (10-year

Lin Li, Yinglin Ge, Xianghui Wan, Kunpeng Wu, Daliang Liu

risk; IQR, 0.8–5.8; median, 2.3). Moreover, aortitis was high in these patients at baseline (TBR, 1.69 [0.25]; mean [SD]). The NcAPL (mean [SD], 1.12 [0.47] mm2) composed the TCPL (mean [SD], 1.16 [0.45] mm2). More than 26% LSA was observed in 69 patients (207 arteries) of 144 (432 arteries) evaluated. Also, prevalent HrCP was observed in at least one major artery in 48 patients of 142 evaluated.

Association between aortitis and coronary angiographic indices

In order to assess whether coronary results were congruent to the TBR, we observed psoriatic patients with TBR at the median or higher value, with those with TBR at less than the median value. Interestingly, both lower-than-median (mean [SD], 1.56 [0.11]) and higher-than-median (mean [SD], 1.92 [0.25]) TBRs had similar age but were less dominated with female composition (44 of 88 [50%] vs. 32 of 92 [35%], respectively; p = 0.001) (Table I). However, they had lower high-density lipoprotein cholesterol (mean [SD], 63.1 [18.8] mg/dl vs. 50.2 [14.1] mg/dl; p < 0.001) and greater BMI value (mean [SD], 26.9 [4.1] vs. 33.1 [6.4]; p < 0.001). They had low eAg 10-year risk, but even then, the greater TBR value group had enhanced eAg risk in comparison to the lower TBR subgroup (3.7; IQR, 1.8–8.1 vs. 1.8; IQR, 0.9–4.1; p < 0.001). Greater TBR value patients had enhanced high-sensitivity C-reactive protein concomitant levels, insulin resistance levels, and psoriasis severity, in spite of having similar psoriatic duration.

Comparison of coronary angiographic computed tomographic studies-based features

The greater TBR value group (mean [SD], 1.29 [0.46] vs. 0.95 [0.36]; p < 0.001) had enhanced TCPL values but appeared secondary to enhanced NcAPL (mean [SD], 1.26 [0.45] vs. 0.89 [0.35]; p < 0.001) (Table II). There was no significant difference in dense-calcified load values for these groups (mean [SD], 0.03 [0.10] vs. 0.03 [0.07]; p = 0.62). In comparison to patients with TBR lower than median, patients with greater TBR values had enhanced number of LSA with at least one major artery (40 of 69 [58%] vs. 27 of 75 [36%], respectively; p < 0.001). Patients with greater TBR value had significantly worse LSA severity (p = 0.002). Moreover, greater HrCP prevalence was observed in patients with greater TBR value (44% vs. 24%, p = 0.02). PRP scores for the two subgroups were essentially similar, while difference in LAP scores resulted in significantly different HrCP scores (Table II). When similar anal-

yses were performed for TBR we found that patients with LSA as well as with HrCP had enhanced TBR in comparison to those without LSA and HrCP (Table III).

Association between aortitis and non-calcified atherosclerotic plaque load, luminal stenosis atherosclerosis, and high-risk coronary plaque features

We found that TCPL (p = 0.46; p < 0.001) and NcAPL (p = 0.47; p < 0.001) both were associated with aortitis and were unaffected by any calibration in other features like age, sex, BMI, etc. (TCPL, β = 0.23; p < 0.001 and NcAPL, β = 0.24; p < 0.001). However, dense-calcified load resulted no such association (detailed data not shown). We found a 20% enhancement in un-calibrated analyses and 10% enhancement in fully calibrated analyses of NcAPL when we enhanced aortitis by just one SD unit. Furthermore, we observed direct association between aortitis and LSA in both un-calibrated (OR = 3.71; 95% CI: 1.84–7.89; p = 0.001) and fully calibrated (OR = 3.38; 95% CI: 1.38–8.19; p = 0.007) analyses (Table IV). However, in the case of LSA severity, we observed analogous results for both the un-calibrated (OR = 4.11; 95% CI: 1.88–8.49; p < 0.001) and fully-calibrated (OR = 3.41; 95% CI: 1.39–7.98; p = 0.006) analyses. We also observed association between enhancement of prevalence of LSA (un-calibrated, 1.36; calibrated, 1.34) and severe LSA (un-calibrated, 1.40; calibrated, 1.34) with unit enhancement of respective SD in both the analyses. Aortitis was also associated with HrCP prevalence (OR = 3.11; 95% CI: 1.51–6.32; p = 0.002), which was retained even after fully calibrated analysis (OR = 2.69; 95% CI: 1.11–6.89; p = 0.03) (Table IV), and with HrCP score in both the analyses (un-calibrated OR = 3.09; 95% CI: 1.54–6.51; p = 0.004 and fully calibrated OR = 2.92; 95% CI: 1.19–7.21; p = 0.02). Finally, we also observed association between aortitis and LAP score (un-calibrated OR = 5.75; 95% CI: 1.88–15.95; p = 0.001 and fully-calibrated OR = 6.29; 95% CI: 1.91–21.32; p = 0.003). On the other hand, PRP score did not show any association with aortitis in both the analyses (un-calibrated OR = 1.51; 95% CI: 0.64–3.58; p = 0.70). Interestingly, HrCP prevalence was enhanced 1.32 times in un-calibrated and 1.29 times in second analyses when we enhance the SD by one unit.

Discussion

We successfully analysed aortitis by 18F-FDG PET and coronary angiographic indices by CACTS, and demonstrated that enhancement in TCPL is predominantly controlled by NcAPL while variation in degrees of aortitis could not affect dense-calci-

Positron emission tomographic studies of the association between atherogenesis and aortitis among psoriatic patients

Table III. Baseline characteristics of our study cohort stratified by luminal stenosis atherosclerosis and high-risk

coronary plaques

Parameters

Demographics and history:

LSA HrCP Absence ( n  = 75) Presence ( n  = 69)

P -value Absence ( n  = 94) Presence ( n  = 48) P -value

Age [years] 45.8 ±11.8 55.9 ±11.0 < 0.001 47.1 ±10.9 58.8 ±10.7 < 0.001

Women (%) 38 (51) 18 (26) 0.002 45 (48) 11 (23) 0.002

Body mass index [kg/m2] 29.9 ±4.9 27.7 ±5.5 0.074 28.8 ±5.9 28.6 ±4.8 0.81

Lipid treatment (%) 16 (21) 30 (44) 0.001 23 (25) 25 (52) < 0.001

Current tobacco use (%) 4 (5) 4 (6) 0.85 8 (9) 4 (8) 0.81

Type 2 diabetes (%) 5 (7) 8 (11) 0.31 7 (7) 7 (14) 0.11

Hyperlipidaemia (%) 32 (42) 37 (54) 0.10 42 (45) 29 (60) 0.04 Hypertension (%) 13 (17) 26 (38) 0.001 20 (21) 22 (38) 0.04

Clinical features:

LDL cholesterol [mg/dl] 102.9 ±29.2 99.9 ±31.3 0.29 102.8 ±28.7 96.8 ±30.8 0.22

HDL cholesterol [mg/dl] 55.8 ±16.5 54.3 ±17.8 0.31 54.6 ±16.8 53.6 ±15.9 0.69

Total cholesterol [mg/dl] 179.8 ±39.8 183.7 ±31.8 0.22 182.9 ±33.2 174.8 ±40.0 0.17

SBP [mm Hg] 119.8 ±12.8 125.5 ±14.7 0.005 120.9 ±12.8 125.9 ±16.9 0.04

Triglycerides [mg/dl] 100 (72–138) 101 (78–136) 0.95 102 (72–140) 99 (76–138) 0.94 eAg 1.2 (0.4–2.3) 4.8 (2.2–8.8) < 0.001 1.6 (0.5–3.4) 5.4 (2.7–10.2) < 0.001

HOMA-IR 2.7 (1.8–4.5) 2.9 (1.7–5.3) 0.36 2.8 (1.8–5.3) 3.2 (1.9–4.4) 0.82 HSCRP [mg/l] 2.5 (1.1–4.1) 1.3 (0.8–4.2) 0.08 2.5 (1.1–5.1) 1.1 (0.7–2.5) 0.002

Psoriasis features:

Disease duration [years] 18 (8–29) 19 (9–32) 0.27 18 (8–29) 19 (9–32) 0.27

Severity index score 5.7 (2.9–9.0) 8.9 (5.4–17.9) 0.001 5.9 (3.1–10.3) 8.1 (4.2–17.9) 0.01

Aortitis TBR 1.61 ±0.19 1.78 ±0.30 0.006 1.61 ±0.19 1.74 ±0.29 0.005

LSA – luminal stenosis atherosclerosis, HrCP – high-risk coronary plaques, LDL – low-density lipoprotein, HDL – high-density lipoprotein, SBP – systolic blood pressure, eAg – early atherogenesis (10-year risk), HOMA-IR – homeostasis model assessment of insulin resistance, HSCRP – high-sensitivity C-reactive protein, TBR – target-to-background ratio.

fied load. We also found that the extent of coronary angiographic indices, prevalence of LSA and HrCP, more severe LSA, along with quantitative total coronary angiographic load were greater in those with elevated aortitis. Besides, there was strong association between aortitis by 18F-FDG PET and coronary angiographic indices derived from CACTS. Hence, our study will be supporting information for the potential surrogate role of aortitis in eAg.

In spite of well-established usage of  18F-FDG PET as a tool to analyse aortitis, comprehensive evaluation of coronary angiographic indices along with the assessment of eAg and its morphological features are still done by CACTS [21, 25]. Essential prognostic information can be achieved by CACTSbased analysis of LSA [34–36], and CACTS can be

utilised in the assessment of future risk of major adverse cardiovascular events by quantification of coronary artery plaques [23]. In recent studies, CACTS has helped scientists to achieve significant prognostic implications by imaging vulnerable coronary plaques [21]. We demonstrated the association between aortitis and TCPL, as well as between aortitis and NcAPL, and found that both were retained even after calibration of traditional risk factors. However, the fact that aortitis may be a marker of early vascular disease [11] is supported by our outcome in which dense-calcified coronary plaque load did not show any association with aortitis.

Additionally, we also established a direct association between aortitis and LSA (in both presence and severity parameters) in major epicardial cor-

Lin Li, Yinglin Ge, Xianghui Wan, Kunpeng Wu, Daliang Liu

Table IV. Associations between aortitis and luminal stenosis atherosclerosis as well as between aortitis and highrisk coronary plaques (HrCP) and various HrCP scores using coronary angiographic computed tomographic studies

Model/Values

Un-calibrated:

LSA HrCP

Various HrCP scores

Presence Severity Presence HrCP LAP PRP

OR (95% CI) 3.71 (1.84–7.89) 4.11 (1.88–8.49) 3.11 (1.51–6.32) 3.09 (1.54–6.51) 5.75 (1.88–15.95) 1.53 (0.69–3.62)

P -value 0.001 < 0.001 0.002 0.004 0.001 0.39

Δ OR! 1.36 1.40 1.32 1.35 1.55 1.12

Calibrated*:

OR (95% CI) 3.38 (1.38–8.19) 3.41 (1.39–7.98) 2.69 (1.11–6.89) 2.92 (1.19–7.21) 6.29 (1.91–21.32) 1.19 (0.51–3.28)

P -value 0.007 0.006 0.03 0.02 0.003 0.6

Δ OR! 1.34 1.34 1.29 1.34 1.59 1.07

LSA – luminal stenosis atherosclerosis, HrCP – high-risk coronary plaques, CACTS – coronary angiographic computed tomographic studies, LAP – low-attenuation plaque, PRP – positively-remodelled plaque, OR – odds ratio, CI – confidence interval, ΔOR! – change in odd ratios per unit standard deviation enhancement in target-to-background ratio. *For age, sex, body mass index, diabetes, hypertension, hyperlipidaemia, smoking, high-sensitivity C-reactive protein, statins.

onary arteries, and this finally led us to the conclusion that aortitis is a clinically reliable indicator of eAg. Furthermore, direct association between aortitis and HrCP (in prevalence and score) was demonstrated in psoriatic patients. This result was supported by the association between aortitis and LAP. However, association between aortitis and PRP was statistically non-significant. Due to the small absolute value of PRP, interpretation of this result should be made very carefully, and then anyone can get this biologically interesting finding. Thus, association between aortitis and broad coronary angiographic indices was achieved, which predicted the possibility of a surrogate role of aortitis in eAg. Lack of hard cardiovascular outcomes is one major limitation of our work. Also, our study is susceptible to unmeasured confounding as well as to the establishment of casualty due to our small sample size. Furthermore, there are several technical difficulties that need to be taken into account during assessment of coronary inflammation by PET.

We extended our work from a previous but far less novel work in which only aortic arch was used up to entire aorta, along with providing further evidence for an association between aortitis and TCPL, NcAPL, HrCP prevalence, and HrCP subtypes. Our results can be generalised to other inflammatory diseases also, but in the case of longitudinal studies it needs also to be demonstrated in non-inflammatory states.

We can conclude our findings by saying that we established an association between aortitis and broad coronary angiographic indices as well as CACTS-assessed HrCP along with various HrCP scores. In this way, it was shown that the study

of aortitis and eAg using 18F-FDG PET by assessing TBR and other cardiovascular risk factors might be a favourable support for the potential surrogate role of aortitis in eAg. These associations should be assessed over longer periods of time and including comparatively large numbers of patients.

Conflict of interest

The authors declare no conflict of interest.

References

1. Hansson GK. Inflammation and atherosclerosis: the end of a controversy. Circulation 2017; 136: 1875-77.

2. Everett BM, Pradhan AD, Solomon DH, et al. Rationale and design of the Cardiovascular Inflammation Reduction Trial: a test of the inflammatory hypothesis of atherothrombosis. Am Heart J 2013; 166: 199-207.

3. Ridker PM, MacFadyen JG, Thuren T, et al. Effect of interleukin-1β inhibition with canakinumab on incident lung cancer in patients with atherosclerosis: exploratory results from a randomised, double-blind, placebo-controlled trial. Lancet 2017; 390: 1833-42.

4. Ridker PM, MacFadyen JG, Everett BM, et al. Relationship of C-reactive protein reduction to cardiovascular event reduction following treatment with canakinumab: a secondary analysis from the CANTOS randomised controlled trial. Lancet 2018; 391: 319-28.

5. Neimann AL, Shin DB, Wang X, Margolis DJ, Troxel AB, Gelfand JM. Prevalence of cardiovascular risk factors in patients with psoriasis. J Am Acad Dermatol 2006; 55: 829-35.

6. Mehta NN, Azfar RS, Shin DB, Neimann AL, Troxel AB, Gelfand JM. Patients with severe psoriasis are at increased risk of cardiovascular mortality: cohort study using the General Practice Research Database. Eur Heart J 2010; 31: 1000-6.

7. Rose S, Dave J, Millo C, Naik HB, Siegel EL, Mehta NN. Psoriatic arthritis and sacroiliitis are associated with

Positron emission tomographic studies of the association between atherogenesis and aortitis among psoriatic patients

increased vascular inflammation by 18-fluorodeoxyglucose positron emission tomography computed tomography: baseline report from the Psoriasis Atherosclerosis and Cardiometabolic Disease Initiative. Arthritis Res Ther 2014; 16: R161.

8. Naik HB, Natarajan B, Stansky E, et al. Severity of psoriasis associates with aortic vascular inflammation detected by FDG PET/CT and neutrophil activation in a prospective observational study. Arterioscier Thromb Vasc Biol 2015; 35: 2667-76.

9. Parums DV, Dunn DC, Dixon AK, Mitchinson MJ. Characterization of inflammatory cells in a patient with chronic periaortitis. Am J Cardiovasc Pathol 1990; 3: 121-9.

10. Klein RG, Hunder GG, Stanson AW, Sheps SG. Large artery involvement in giant cell (temporal) arteritis. Ann Intern Med 1975; 83: 806-12.

11. Teague HL, Ahlman MA, Alavi A. Unraveling vascular inflammation: from immunology to imaging. J Am Coll Cardiol 2017; 70: 1403-12.

12. Hetterich H, Rominger A, Walter L, et al. Natural history of atherosclerotic disease progression as assessed by (18) F-FDG PET/CT. Int J Cardiovasc Imaging 2016; 32: 49-59.

13. Sargin G, Senturk, T, Sahin O. 18F-FDG PET/CT in the diagnosis of Takayasu’s arteritis. Arch Med Sci 2018; 14: 1173-4.

14. Figueroa AL, Subramanian SS, Cury RC, et al. Distribution of inflammation within carotid atherosclerotic plaques with high-risk morphological features: a comparison between positron emission tomography activity, plaque morphology, and histopathology. Circ Cardiovasc Imaging 2012; 5: 69-77.

15. Figueroa AL, Abdelbaky A, Truong QA, et al. Measurement of arterial activity on routine FDG PET/CT images improves prediction of risk of future CV events. JACC Cardiovasc Imaging 2013; 6: 1250-9.

16. Dilsizian V, Jadvar H. Science to practice: does FDG differentiate morphologically unstable from stable atherosclerotic plaque? Radiology 2017; 283: 1-3.

17. Rosenbaum D, Millon A, Fayad ZA. Molecular imaging in atherosclerosis: FDG PET. Curr Atheroscler Rep 2012; 14: 429-37.

18. Tawakol A, Fayad ZA, Mogg R, et al. Intensification of statin therapy results in a rapid reduction in atherosclerotic inflammation: results of a multicenter fluorodeoxyglucose-positron emission tomography/computed tomography feasibility study. J Am Coll Cardiol 2013; 62: 909-91.

19. Dey AK, Joshi AA, Chaturvedi A, et al. Association between skin and aorticvascular inflammation in patients with psoriasis: a case-cohort study using positron emission tomography/computed tomography. JAMA Cardiol 2017; 2: 1013-8.

20. Tawakol A, Lo J, Zanni MV, et al. Increased arterial inflammation relates to high-risk coronary plaque morphology in HIV-infected patients. J Acquirimmune Defic Syndr 2014; 66: 164-71.

21. Maurovich-Horvat P, Ferencik M, Voros S, Merkely B, Hoffmann U. Comprehensive plaque assessment by coronary CT angiography. Nat Rev Cardiol 2014; 11: 390-402.

22. Salahuddin T, Natarajan B, Playford MP, et al. Cholesterol efflux capacity in humans with psoriasis is inversely related to non-calcified burden of coronary atherosclerosis. Eur Heart J 2015; 36: 2662-5.

23. Kwan AC, May HT, Cater G, et al. Coronary artery plaque volume and obesity in patients with diabetes: the factor64 study. Radiology 2014; 272: 690-9.

24. Lerman JB, Joshi AA, Chaturvedi A, et al. Coronary plaque characterization in psoriasis reveals high-risk features

that improve after treatment in a prospective observational study. Circulation 2017; 136: 263-76.

25. Ramjattan NA, Makaryus AN. Coronary CT angiography. Stat Pearls [Internet]. Treasure Island (FL): Stat Pearls Publishing 2018.

26. Nakazato R, Otake H, Konishi A, et al. Atherosclerotic plaque characterization by CT angiography for identification of high-risk coronary artery lesions: a comparison to optical coherence tomography. Eur Heart J Cardiovasc Imaging 2015; 16: 373-9.

27. Sao R, Aronow WS. Association of non-alcoholic fatty liver disease with cardiovascular disease and subclinical atherosclerosis. Arch Med Sci 2018; 14: 1233-44.

28. Mehta NN, Torigian DA, Gelfand JM, Saboury B, Alavi A. Quantification of atherosclerotic plaque activity and vascular inflammation using [18-F] fluorodeoxyglucose positron emission tomography/computed tomography (FDG- PET/CT). J Vis Exp 2012; 63: e3777.

29. Cury RC, Abbara S, Achenbach S, et al. CAD-RADS™: Coronary Artery Disease – Reporting and Data System: an expert consensus document of the Society of Cardiovascular Computed Tomography (SCCT), the American College of Radiology (ACR) and the North American Society for Cardiovascular Imaging (NASCI). Endorsed by the American College of Cardiology. J Am Coll Radiol 2016; 13 (12 Pt A): 1458-66.

30. Austen WG, Edwards JE, Frye RL, et al. A reporting system on patients evaluated for coronary artery disease. Report of the Ad Hoc Committee for Grading of Coronary Artery Disease, Council on Cardiovascular Surgery, American Heart Association. Circulation 1975; 51 (4 Suppl): 5-40.

31. Sato A, Hoshi T, Kakefuda Y, et al. In vivo evaluation of fibrous cap thickness by optical coherence tomography for positive remodeling and low-attenuation plaques assessed by computed tomography angiography. Int J Cardiol 2015; 182: 419-25.

32. Vasan RS, Sullivan LM, Wilson PW, et al. Relative importance of borderline and elevated levels of coronary heart disease risk factors. Ann Intern Med 2005; 142: 393-402.

33. Gayoso-Diz P, Otero-Gonzalez A, Rodriguez-Alvarez MX, et al. Insulin resistance (HOMA-IR) cut-off values and the metabolic syndrome in a general adult population: effect of gender and age: EPIRCE cross-sectional study. BMC Endocr Disord 2013; 13: 47-57.

34. Budoff MJ, Li D, Kazerooni EA, Thomas GS, Mieres JH, Shaw LJ. Diagnostic accuracy of noninvasive 64-row computed tomographic coronary angiography (CCTA) compared with myocardial perfusion imaging (MPI): the PICTURE Study, a prospective multicenter trial. Acad Radiol 2017; 24: 22-9.

35. Takx RA, Blomberg BA, El Aidi H, et al. Diagnostic accuracy of stress myocardial perfusion imaging compared to invasive coronary angiography with fractional flow reserve meta-analysis. Circ Cardiovasc Imaging 2015; 8: pii: e002666.

36. Kueh SH, Naoum C. Update on the clinical utility of coronary computed tomographic angiography instable angina pectoris. Minerva Cardioangiol 2017; 65: 201-3.

Lin Li, Yinglin Ge, Xianghui Wan, Kunpeng Wu, Daliang Liu

COVID-19 another case of the obesity paradox? Results from an international ecological study on behalf

the REPROGRAM Consortium Obesity study group

Sonu Bhaskar1,2,3, Sanja Jovanovic1,4, Anubhav Katyal1,5,6, Narayanan K. Namboodiri1,7, Dimitrios Chatzis1,8, Maciej Banach1,9,10,11

1Pandemic Health System REsilience PROGRAM (REPROGRAM) Global Consortium, Obesity REPROGRAM Study Group, Sydney, Australia

2Department of Neurology & Neurophysiology, Liverpool Hospital & South West Sydney Local Health District (SWSLHD), Liverpool, Australia

3NSW Brain Clot Bank, NSW Health Pathology and Neurovascular Imaging Laboratory, Clinical Sciences Stream, Ingham Institute for Applied Medical Research, Sydney, Australia

4Kwantlen Polytechnic University, Office of Research Services, Surrey, British Columbia, Canada

5Neurovascular Imaging Laboratory, Clinical Sciences Stream, Ingham Institute for Applied Medical Research, Sydney, Australia

6University of New South Wales (UNSW), South Western Sydney Clinical School, Sydney, Australia

7Sree Chitra Institute for Medical Sciences and Technology (SCTIMST), Department of Cardiology, Trivandrum, Kerala, India

8Medical School, European University Cyprus, Nicosia, Cyprus

9Polish Mother’s Memorial Hospital Research Institute (PMMHRI), Lodz, Poland

10Cardiovascular Research Centre, University of Zielona Gora, Zielona Gora, Poland

11Department of Hypertension, Medical University of Lodz, Lodz, Poland

Submitted: 25 April 2021; Accepted: 6 May 2021

Online publication: 10 May 2021

Arch Med Sci 2023; 19 (1): 25–34

DOI: https//doi.org/10.5114/aoms/136447

Copyright © 2021 Termedia & Banach

Abstract

Introduction: Obesity has emerged as one of the major risk factors of severe morbidity and cause-specific mortality among severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infected individuals. Patients with obesity also have overlapping cardiovascular diseases and diabetes, which make them increasingly vulnerable. This novel ecological study examines the impact of obesity and/or body mass index (BMI) on rates of population-adjusted cases and deaths due to coronavirus disease 2019 (COVID-19).

Material and methods: Publicly available datasets were used to obtain relevant data on COVID-19, obesity and ecological variables. Group-wise comparisons and multivariate logistic regression analyses were performed. The receiver operating characteristic curve (ROC) was plotted to compute the area under the curve.

Results: We found that male BMI is an independent predictor of cause-specific (COVID-19) mortality, and not of the caseload per million population. Countries with obesity rates of 20–30% had a significantly higher (approximately double) number of deaths per million population to both those in < 20% and > 30% slabs. We postulate that there may be a U-shaped paradoxical relationship between obesity and COVID-19 with the cause-specific mortality burden more pronounced in the countries with 20–30% obesity rates. These findings are novel along with the methodological approach of doing ecological analyses on country-wide data from publicly available sources.

Corresponding author: Sonu Bhaskar MD PhD Liverpool Hospital South West Sydney Local Health District (SWSLHD) Department of Neurology and Neurophysiology Liverpool, Australia NSW Brain Clot Bank NSW Health Pathology and Neurovascular Imaging Laboratory Clinical Sciences Stream Ingham Institute for Applied Medical Research Sydney, Australia E-mail: smmb@ globalhealthneurolab.org

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Is

of

Conclusions: We anticipate, in light of our findings, that appropriate targeted public health approaches or campaigns could be developed to minimize the risk and cause-specific morbidity burden due to COVID-19 in countries with nationwide obesity rates of 20–30%.

Key words: coronavirus 2019 (COVID-19), obesity, metabolic disease, non-communicable diseases (NCDs), demographics.

Introduction

The ongoing coronavirus diseases 2019 (COVID-19) pandemic, caused by the severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) viral infection, is a global health crisis of a scale reminiscent of the Spanish flu pandemic almost a century ago [1]. Studies have shown that elderly patients and those with pre-existing comorbidities such as cardiovascular disease, hypertension, obesity and diabetes are at increased risk of COVID-19 associated hospitalization, critical illness and mortality [2–7]. Several studies have demonstrated that obesity is associated with an increased risk of COVID-19 associated hospitalization and/or critical illness [4, 6, 8–17]. A recent meta-analysis found a strong association between obesity and adverse outcomes in COVID-19 patients [18], indicating the role of higher body mass index (BMI) in prognostication [19, 20]. A study from a French hospital on 124 intensive care patients found an association between the need for invasive mechanical ventilation and severe obesity [16]. Another recent study on 393 cases from New York found higher rates of obesity in patients receiving mechanical ventilation [9]. It was also found that obese individuals younger than 50 are more likely to die due to COVID-19 than those who are not obese [21].

Studies have also demonstrated the association of visceral adiposity with COVID-19 severity or critical illness [22–24]. Obesity, and especially diabetes, might also be predictors of long-COVID complications, including myocarditis, arrhythmias, thromboembolism, and heart failure, as indicated in the preliminary results of the Late-COVID study [5, 25]. The impact of obesity on population demography during COVID-19 and their link to reported COVID-19 case and death rates have not been reported so far.

The current study aims to assess the association between the gender stratified average BMI, life expectancy and gross domestic product (GDP) per capita with the population-adjusted COVID-19 case rate and death rate.

Material and methods

Data sources

We used data from the Worldometer, a realtime tracking website (www.worldinfometers.

info), to extract data on country-wise COVID-19 confirmed cases including population-adjusted cases and mortality rates (data accessed on 29th June 2020). Our World in Data was used to acquire data on GDP per capita, life expectancy data, average male – and female – BMI, and nationwide obesity rates. The data on Our World in Data is sourced from the official government websites or social media accounts. Based on the unanimous expert decision, only countries with a minimum of 15,000 total COVID-19 cases, as of 29th June 2020, were included in our analysis [26]. This was done to ensure that a minimum sample size within each country was reached to improve the reliability of the results and minimize any crowding due to a disproportionate number of countries with relatively lower case counts. All data procured and analyzed were sourced from publicly available databases and are available in Supplementary Table SI.

Statistical analysis

All statistical analyses were performed using STATA software (Version 11, 2001; College Station, TX, USA). The data used in this study are publicly available. The curated dataset used in this study is provided in the Supplementary Table SI. COVID-19 confirmed cases and deaths per million population (total number of COVID-19 associated deaths divided by each respective region’s population) and 95% confidence intervals (CIs) were calculated. Groupwise comparison was performed using STATA version 13 to demonstrate the distribution of baseline characteristics between countries based on the nationwide obesity rates (subgroups: < 20% vs. 20–30% vs. > 30%) and between average BMI subgroups of < 25 kg/m2 vs. > 25 kg/m2 for males and females. Subsequently, univariate and multivariate logistic regression analyses were performed to determine the association between average male and female BMI, life expectancy and GDP per capita with the population-adjusted COVID-19 case rates (for cases: ≥ 3000, ≥ 4000, ≥ 5000 per 1 million population) and death rates (for deaths: ≥ 100, ≥ 150 and ≥ 200 per 1 million population). The thresholds for various groups of caseloads per million were used based on the closest approximation of median cases/million for the 20–30% nationwide obesity rate group. This translates to 3000 cases per million. Given that

Sonu Bhaskar, Sanja Jovanovic, Anubhav Katyal, Narayanan K. Namboodiri, Dimitrios Chatzis, Maciej Banach

Is COVID-19 another case of the obesity

the majority of countries belong to the 20–30% obese group (n = 33), the threshold was chosen to reflect the overall spread. We also selected the caseloads of 4000 and 5000 to investigate any putative linear relationship. For deaths per million population, we chose the mortality threshold based on the nearest median for the 20–30% obesity rate group – which translated to 100 deaths per million. We also chose two more points, 150 and 200, to investigate linear trends in mortality. The receiver operating characteristic curve (ROC) for the final multivariate regression model (obtained by backwards regression with variables p < 0.1) was plotted and the area under the curve computed to evaluate the predictive ability of the regression model.

Results

A correlation matrix of the investigated variables is shown in Figure 1. Male BMI shows a strong correlation with the female BMI (0.6274; p ≤ 0.0001), obesity rate (0.72; p < 0.00001), GDP per capita (0.486; p = 0.0001), and life expectancy (0.49; p = 0.0001). Though weaker, male BMI was also significantly correlated with the total number of COVID-19 associated deaths per million (R2 = 0.3261; p = 0.0125) and the total number of cases per million (0.3757; p = 0.0037). Female

BMI was not correlated with deaths per million (–0.0276; p = 0.8370), whereas the correlation of female BMI with the total number of cases per million was significant (0.3191; p = 0.0146). There was a strong correlation of female BMI with nationwide obesity rate (0.8405; p ≤ 0.000001). Female BMI was not correlated with GDP per capita (0.1756; p = 0.1874) or life expectancy (–0.0492; p = 0.7136).

Group-wise comparison of various metrics stratified by countries with obesity rates of < 20%, 20–30% and > 30% are shown in Table I. The highest caseload is demonstrated in the >30% group. The highest mortality was demonstrated in the 20–30% group, while it was the least pronounced in the > 30% group. GDP per capita in the > 30% obesity rate group is more than twice as high as the GDP per capita in the 20–30% group. There is a statistically significant difference in the median population-adjusted COVID-19 cases, COVID-19 deaths, average male BMI, average female BMI, GDP per capita and prevalence of obesity between at least two of the three groups. From the data, although countries with a higher prevalence of obesity have more COVID-19 cases, the mortality is bell-shaped with the greatest mortality being in the 20-30% obesity rate group. A paired t-test revealed a statistically significant difference

paradox? Results from an international ecological study on behalf of the REPROGRAM Consortium Obesity study group

Table I. Description of ecological variables stratified by nationwide obesity rates of < 20%, 20–30% and > 30%

Variable Data Overall ( n = 58) < 20% obesity rate ( n = 17)

20–30% obesity rate ( n = 33)

> 30% obesity rate ( n = 8)

Kruskal-Wallis test ( p -value)

Cases per 1 million population Mean (SD) 4173.76 (5144.65) 2156.53 (2605.47) 4215.73 (3454.92) 8287.25 (10780) 0.0082*

Median (IQR) 2676 (1129–5289) 837 (324–3653) 2736 (1826–6328) 5038 (1734–9246)

Deaths per 1 million population Mean (SD) 147.76 (189.71) 93.59 (157.17) 189.76 (210.44) 89.63 (121.80) 0.0035*

Median (IQR) 60.5 (27–226) 12 (8–131) 87 (41–271) 44.5 (35.5–71)

Male BMI Mean (SD) 25.99 (2.20) 24.24 (1.96) 26.32 (1.88) 28.33 (0.66) 0.0001*

Median (IQR) 26.48 (25.39–27.48) 23.68 (22.65–26.37) 26.49 (25.99–27.45) 28.16 (27.94–28.97)

Female BMI Mean (SD) 26.56 (2.22) 24.60 (2.06) 26.74 (1.21) 29.98 (0.91) 0.0001*

Median (IQR) 26.84 (24.86–27.85) 24.03 (23.59–25.39) 26.91 (26.01–27.49) 29.79 (29.29–30.52)

GDP per capita ($) Mean (SD) 27319.67 (23884.66) 17600.47 (20265.77) 26145.12 (14353.04) 52818 (42259.32) 0.0023*

Life expectancy (years)

Median (IQR) 18848.50 (10536–39733) 10511 (5323–15296) 23064 (14088–39162) 50244.50 (16380–69041)

Mean (SD) 76.22 (5.86) 73.37 (8.10) 77.74 (4.38) 76.00 (3.36) 0.1396

Median (IQR) 76.71 (72.59–81.33) 72.59 (69.66–77.01) 77.29 (75.05–81.63) 76.59 (73.56–78.42)

Nationwide obesity rate (%) Mean (SD) 21.59 (7.73) 11.12 (6.72) 24.01 (3.13) 33.85 (2.64) 0.0001*

Median (IQR) 22.2 (19.9–27.8) 8.6 (6.1–19.5) 23.1 (21.4–27) 33.6 (31.85–35.8)

between average male and female BMIs in these countries overall (p = 0.0130) (Table II).

Population-adjusted case rate univariate and multivariate logistic regression

The univariate associations with population-adjusted COVID-19 cases per 1 million population were examined for average male BMI, average female BMI, life expectancy, GDP per capita, and nationwide obesity rate. COVID-19 cases per 1 million population were further stratified into ≥ 3000 per million, ≥ 4000 per million, and ≥ 5000 per million.

In population-adjusted case rate univariate logistic regression, all variables except average female BMI were significantly associated with each of the COVID-19 cases per 1 million population group (Table III). Average male BMI, GDP per capita, life expectancy, and nationwide obesity rate were included in the multivariate logistic regression model; however, no variable was a significant predictor in the multivariate model. The analyzed variables provided a poor predictive model for

COVID-19 cases per 1 million population (area under the ROC curve for each stratum: 0.7867, 0.7614, and 0.7547, respectively) (Table IV).

Population-adjusted mortality rate univariate and multivariate logistic regression

The univariate associations with population-adjusted COVID-19 deaths per 1 million population were examined for average male BMI, average female BMI, life expectancy, GDP per capita, and nationwide obesity rate. COVID-19 deaths per 1 million population were stratified into ≥ 100 per 1 million, ≥ 150 per 1 million, and ≥ 200 per 1 million (Table V). Only average male BMI and life expectancy were found to be statistically significant in the univariate regression analysis for each of the COVID-19 deaths per 1 million population group. Average male BMI and life expectancy were thus included in the multivariate logistic regression model. While not found to be statistically significant in the univariate logistic regression analysis, we included GDP per capita in the mul-

Sonu Bhaskar, Sanja Jovanovic, Anubhav Katyal, Narayanan K. Namboodiri, Dimitrios Chatzis, Maciej Banach

Table IV. Multivariate logistic regression for association with case load per million population

Variable Cases ≥ 3000 per 1 million population Cases ≥ 4000 per 1 million population Cases ≥ 5000 per 1 million population OR P -value OR P -value OR P -value

Average male BMI 1.41 (0.90–2.22) 0.137 1.42 (0.91–2.23) 0.127 1.31 (0.82–2.08) 0.261

Life expectancy 1.04 (0.87–1.24) 0.650 0.99 (0.84–1.17) 0.888 1.04 (0.87–1.23) 0.689 GDP per capita 1.00 (1.00–1.00) 0.129 1.00 (1.00–1.00) 0.199 1.00 (1.00–1.00) 0.164

ROC of the multivariate regression model 0.7867** 0.7614** 0.7547**

**n = 58 countries. Average male BMI, life expectancy and GDP per capita provide a poor predictive model for cases per 1 million population (each variable is non-significant in multivariate analysis). OR – odds ratio, BMI – body mass index, GDP – gross domestic product, ROC – receiver operating characteristic curve.

tivariate logistic regression model as a socially important variable (Table VI). In the multivariate analysis, average male BMI (odds ratio (OR) 1.99, 95% CI: 1.02–3.88, p = 0.043; OR = 2.67, 95% CI: 1.16–6.15, p = 0.021; and OR = 2.60, 95% CI: 1.14–5.91, p = 0.022) and life expectancy (OR = 1.62, 95% CI: 1.21–2.15, p = 0.001; OR = 1.85, 95% CI: 1.28–2.67, p = 0.001; and OR = 1.71, 95% CI: 1.23–2.36, p = 0.001) were found to have significant associations in each of the stratified groups.

The model showed that GDP per capita was significantly associated with COVID-19 deaths but only in the deaths ≥ 100 per 1 million group. Importantly, the model demonstrated an excellent predictive ability (area under ROC curve ROC 0.8788, 0.9168, and 0.9033 across the analyzed

group; Table VI). The model showed the best predictive ability in the deaths ≥ 150 per 1 million strata (sensitivity 70.6%; specificity 87.9%; positive predictive value 70.6%; negative predictive value 87.8%; correctly classified 82.76%). The final model consisting of average male BMI, life expectancy and GDP per capita predicted population-adjusted COVID-19 death rates globally (using a threshold of 150 deaths per million population) (Figure 2).

Discussion

The current study might have major public health implications with novel findings regarding the associations between COVID-19 and obesity.

Table V. Univariate logistic regression for association with population-adjusted cause-specific death rates due to COVID-19

Variable Cause-specific deaths ≥ 100 per 1 million population Cause-specific deaths ≥ 150 per 1 million population Cause-specific deaths ≥ 200 per 1 million population OR P -value OR P -value OR P -value

Average male BMI 1.56 (1.07–2.27) 0.02* 1.67 (1.08–2.60) 0.022* 1.72 (1.08–2.74) 0.021*

Average female BMI 1.01 (0.795–1.29) 0.922 0.96 (0.74–1.24) 0.762 0.99 (0.76–1.28) 0.888

GDP per capita 1.00 (1.00–1.00) 0.317 1.00 (1.00–1.00) 0.147 1.00 (1.00–1.00) 0.143

Life expectancy 1.33 (1.13–1.56) 0.001* 1.44 (1.17–1.76) < 0.0001* 1.40 (1.15–1.70) 0.001*

Nationwide obesity rate 1.04 (0.98–1.11) 0.208 1.00 (1.00–1.00) 0.325 1.00 (1.00–1.00) 0.315

OR – odds ratio, BMI – body mass index, GDP – gross domestic product.

Table VI. Multivariate logistic regression for association with population-adjusted mortality rates due to COVID-19

Variable Cause-specific deaths

≥ 100 per 1 million population

Cause-specific deaths ≥ 150 per 1 million population

Cause-specific deaths ≥ 200 per 1 million population

OR P -value OR P -value OR P -value

Average male BMI 1.99 (1.02–3.88) 0.043* 2.67 (1.16–6.15) 0.021* 2.60 (1.14–5.91) 0.022*

Life expectancy 1.62 (1.21–2.15) 0.001* 1.85 (1.28–2.67) 0.001* 1.71 (1.23–2.36) 0.001*

GDP per capita 0.9999369 (0.9998788–0.999995)

0.033* 0.9999379 (0.9998717–1.000004)

0.066 0.9999495 (0.9998923–1.000007)

ROC of the multivariate regression model 0.8788** 0.9168** 0.9033**

0.083

**n = 58 countries. OR – odds ratio, BMI – body mass index, GDP – gross domestic product, ROC – receiver operating characteristic curve.

Sonu Bhaskar, Sanja Jovanovic, Anubhav Katyal, Narayanan K. Namboodiri, Dimitrios Chatzis, Maciej Banach

Is COVID-19 another case of the

This builds on our previous work where we provided recommendations based on Intensive Care National Audit and Research Centre (ICNARC) United Kingdom (UK) data on COVID-19 critical care patients – that the BMI ≥ 30 was a significant predictor of mortality in this population [2], hence raising the need for targeted algorithm and riskbased management/triage approach [2, 27–29].

We found that male BMI and life expectancy were independent predictors of COVID-19 mortality and not the COVID-19 confirmed cases per million population.

Countries with a nationwide obesity rate of 20–30% (e.g., Brazil, Russia, the UK, Iran, Spain) [30] had a significantly higher (approximately double) number of deaths per million population compared to both those in < 20% and > 30% obesity rate slabs. We postulate that there may be a U-shaped paradoxical relationship between obesity and COVID-19 mortality burden more pronounced in the countries with 20–30% obesity rates. Our findings are relevant especially in the light of the recently released Public Health England (PHE) report on excess weight and COVID-19 [31]. The increased prevalence and disease burden due to excess weight in general, and obesity in particular, is a public health concern globally, with the burden being higher in western countries [32]. The PHE report highlights that the people belonging to Black, Asian and Minority Ethnic (BAME) communities, those living in deprived areas, and those aged 55–74 years are disproportionately affected by excess weight [31]. Moreover, it is well known that the health risks related to excess weight are more prevalent in BAME communities, even at a lower BMI than in those from Caucasian backgrounds. Given the disproportionate impact of COVID-19 on vulnerable communities [33], such as racial/ethnic minority groups, which are particularly vulnerable to increased prevalence and incidence of obesity and diabetes [34], targeted multilevel interventions against obesity may provide protection [35], and hence mitigate the impact of COVID-19.

Notably, the obesity paradox, i.e. the association of higher BMI with lower mortality, longer hospital stays and longer ventilation period, in ICU patients requiring mechanical ventilation, has also been a subject of debate [36, 37]. However, the hypothesis has been challenged [38]. The protective role of obesity, as proposed in this hypothesis, in reduced mortality may be due to lack of adjustment for comorbidities or potential confounders including a history of smoking, disease severity and socioeconomic variables [38]. Moreover, it has been suggested that BMI does not account for body composition, adiposity, and their variations due to gender and ethnicity [39]. It also fails to detect “normal obese subjects” [38]. Last, but

Sensitivity

1.00 0.75 0.50 0.25 0

Area under ROC curve = 0.9168

0 0.25 0.50 0.75 1.00

1 – Specificity

Figure 2. Receiver operating characteristic curve corresponding to the final multivariate logistic regression model for association with cause-specific deaths ≥ 150 per 1 million population due to COVID-19

not least, since severe infections in general and more specifically COVID-19 represent catabolic and high energy-consuming situations, obese patients may have a more favorable prognosis due to their augmented metabolic reserve [40]. This hypothesis holds also true in heart failure (HF) as the well-known catabolic state in which it seems that patients who are obese have better clinical outcomes compared to their leaner counterparts [40, 41]. Our findings are distinct, as it takes a population or systems-level approach to address the impact of COVID-19 on obese patients. We have included ecological variables such as GDP which are often not considered or adjusted for in clinical trials or case-controlled studies.

We hypothesized that countries with a nationwide obesity rate of > 30% may have better-developed health systems delivering a higher quality of care including tailored treatment options and/or have well-coordinated health services targeted toward obese people embedded within the system. One of the obesity programs’ strategies may have been strongly advising obese people to adhere to physical distancing and wearing masks whenever distancing of 6 feet cannot be ensured [31]. Better treatments and/or well-organized support programs for obese people are likely associated with higher GDP per capita as well. The values of GDP per capita are indeed much higher for countries with a nationwide obesity rate >30%: twice as high GDP per capita in countries with obesity rates of 20–30% (mean $52,818 (SD 42259.32); median $50,244.50 (IQR 16380–69041)) vs. mean $26,145.12 (SD14353.04); median $23,064 (IQR 14088–39162). Five countries in the > 30% stratum are countries with high GDP per capita, i.e. the US, Saudi Arabia, the UAE, Kuwait, and Qatar, presenting 62.5% of the population of the group. While GDP per capita in the > 30% obesity rate group is even higher compared to the < 20% group ($17,600.47 (SD 20265.77); median: $10,511

obesity paradox? Results from an international ecological study on behalf of the REPROGRAM Consortium Obesity study group

(IQR 5323–15296)), the latter has a significantly smaller proportion of obese people, which may be responsible for higher mortality being observed in both < 20% and > 30% obesity rate groups compared to the 20–30% group. The countries with nationwide obesity rates > 30% have significantly higher case rates (mean 8287.25 (SD 10780); median 5038 (IQR 1734–9246)) vs. < 20% obesity rate group with mean 2156.53 (SD2605.47); median 837 (IQR 324–3653) and 20-30% obesity rate group (mean 4215.73 (SD 3454.92); median 2736 (IQR 1826–6328)). The countries with higher GDP per capita may be testing more for COVID-19 and thus timely identifying the higher proportion of COVID-19 positive obese people who then receive appropriate care in a timelier manner.

Various mechanisms have been proposed to explain the association between obesity and increased disease severity in COVID-19 hospitalized patients. It is recognized that SARS-CoV-2 has a strong affinity for human angiotensin-converting enzyme 2 (ACE-2) [5]. Adipose tissue also has increased expression of ACE-2 receptors [42]. Moreover, obesity also exacerbates the hyper-inflammatory response (cytokine storm) causing deteriorating lung function capacity and increased need for mechanical ventilation [29]. Telemedicine could be a great enabler in implementing effective prophylactic strategies to reduce the morbidity and mortality burden in this subgroup of patients [43–45].

Our multivariate regression model did not account for cardiovascular disease and diabetes or other comorbidities associated with obesity. However, we believe that, since obesity and other comorbidities have a significant overlap, introducing these variables would introduce multicollinearity effects in the multivariate logistic regression model. BMI as a marker of obesity has been widely contested and is supposedly sub-optimal in elderly patients [46]. Despite the limited accuracy of BMI, it remains one of the most widely used tools to characterize excess weight or obesity around the world [47].

In conclusion, the findings reported in this study are novel, as is the methodological approach of conducting ecological analyses on country-wide data from publicly available sources. Our findings should be interpreted within the context of study design. We anticipate, in light of our findings, that appropriate targeted public health approaches or campaigns could be developed to minimize the risk of infection and morbidity burden due to COVID-19 in countries with a nationwide obesity rate of 20-30%, especially males, who may be more vulnerable to mortality due to COVID-19.

Author notes

The COVID-19 pandemic is causing an unprecedented public health crisis impacting healthcare

systems, healthcare workers and communities. The COVID-19 Pandemic Health System REsilience PROGRAM (REPROGRAM) is a not-for-profit consortium of international healthcare physicians, researchers and policymakers formed to champion the safety of healthcare workers, policy development and advocacy for global pandemic preparedness and action.

Acknowledgments

We would like to acknowledge the REPROGRAM consortium members who have worked tirelessly over the last days in contributing to various guidelines, recommendations, policy briefs, and ongoing discussions during these unprecedented and challenging times despite the incredibly short timeframe. We would like to dedicate this work to our healthcare workers who have died due to COVID-19 while serving the patients at the frontline and to those who continue to serve during these challenging times despite the lack of personal protective equipment.

Conflict of interest

The authors declare no conflict of interest.

References

1. Jones DS. History in a crisis – lessons for Covid-19. N Engl J Med 2020; 382: 1681-3.

2. Bhaskar S, Rastogi A, Chattu VK, et al. Key strategies for clinical management and improvement of healthcare services for cardiovascular disease and diabetes patients in the coronavirus (COVID-19) settings: recommendations from the REPROGRAM consortium. Front Cardiovasc Med 2020; 7: 112.

3. Zhou F, Yu T, Du R, et al. Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study. Lancet 2020; 395: 1054-62.

4. Cai Q, Chen F, Wang T, et al. Obesity and COVID-19 severity in a designated hospital in Shenzhen, China. Diabetes Care 2020; 43: 1392-8.

5. Katsiki N, Banach M, Mikhailidis DP. Lipid-lowering therapy and renin-angiotensin-aldosterone system inhibitors in the era of the COVID-19 pandemic. Arch Med Sci 2020; 16: 485-9.

6. Monteiro AC, Suri R, Emeruwa IO, et al. Obesity and smoking as risk factors for invasive mechanical ventilation in COVID-19: a retrospective, observational cohort study. PLoS One 2020; 15: e0238552.

7. Azzolino D, Cesari M. Obesity and COVID-19. Front Endocrinol 2020; 11: 581356.

8. Caussy C, Pattou F, Wallet F, et al. Prevalence of obesity among adult inpatients with COVID-19 in France. Lancet Diabetes Endocrinol 2020; 8: 562-4.

9. Goyal P, Choi JJ, Pinheiro LC, et al. Clinical characteristics of Covid-19 in New York City. N Engl J Med 2020; 382: 2372-4.

10. Hamer M, Kivimäki M, Gale CR, Batty GD. Lifestyle risk factors, inflammatory mechanisms, and COVID-19 hospitalization: a community-based cohort study of 387,109 adults in UK. Brain Behav Immun 2020; 87: 184-7.

Sonu Bhaskar, Sanja Jovanovic, Anubhav Katyal, Narayanan K. Namboodiri, Dimitrios Chatzis, Maciej Banach

Is COVID-19 another case of the obesity paradox? Results from an international ecological study on behalf of the REPROGRAM Consortium Obesity study group

11. Klang E, Kassim G, Soffer S, Freeman R, Levin MA, Reich DL. Morbid obesity as an independent risk factor for COVID-19 mortality in hospitalized patients younger than 50. Obesity 2020; 28: 1595-9.

12. Lighter J, Phillips M, Hochman S, et al. Obesity in patients younger than 60 years is a risk factor for Covid-19 hospital admission. Clin Infect Dis 2020; 71: 896-7.

13. Petrilli CM, Jones SA, Yang J, et al. Factors associated with hospital admission and critical illness among 5279 people with coronavirus disease 2019 in New York City: prospective cohort study. BMJ 2020; 369: m1966-m.

14. Richardson S, Hirsch JS, Narasimhan M, et al. Presenting characteristics, comorbidities, and outcomes among 5700 patients hospitalized with COVID-19 in the New York City Area. JAMA 2020; 323: 2052-9.

15. Rottoli M, Bernante P, Belvedere A, et al. How important is obesity as a risk factor for respiratory failure, intensive care admission and death in hospitalised COVID-19 patients? Results from a single Italian centre. Eur J Endocrinol 2020; 183: 389-97.

16. Simonnet A, Chetboun M, Poissy J, et al. High prevalence of obesity in severe acute respiratory syndrome Coronavirus-2 (SARS-CoV-2) requiring invasive mechanical ventilation. Obesity 2020; 28: 1195-9.

17. Yang Y, Ding L, Zou X, et al. Visceral adiposity and high intramuscular fat deposition independently predict critical illness in patients with SARS-CoV-2. Obesity 2020; 28: 2040-8.

18. Malik P, Patel U, Patel K, et al. Obesity a predictor of outcomes of COVID-19 hospitalized patients – a systematic review and meta-analysis. J Med Virol 2020; 93: 1188-93.

19. Tamara A, Tahapary DL. Obesity as a predictor for a poor prognosis of COVID-19: a systematic review. Diabetes Metab Syndr 2020; 14: 655-9.

20. Al Heialy S, Yaseen Hachim M, Yaseen Hachim I, et al. Combination of obesity and co-morbidities leads to unfavorable outcomes in COVID-19 patients. Saudi J Biol Sci 2021; 28: 1445-50.

21. Klang E, Kassim G, Soffer S, Freeman R, Levin MA, Reich DL. Morbid obesity as an independent risk factor for COVID-19 mortality in hospitalized patients younger than 50. Obesity 2020; 28: 1595-9.

22. Yang Y, Ding L, Zou X, et al. Visceral adiposity and high intramuscular fat deposition independently predict critical illness in patients with SARS-CoV-2. Obesity 2020; 28: 2040-8.

23. Battisti S, Pedone C, Napoli N, et al. Computed tomography highlights increased visceral adiposity associated with critical illness in COVID-19. Diabetes Care 2020; 43: e129-30.

24. Petersen A, Bressem K, Albrecht J, et al. The role of visceral adiposity in the severity of COVID-19: highlights from a unicenter cross-sectional pilot study in Germany. Metabolism 2020; 110: 154317.

25. Lewek J, Jatczak-Pawlik I, Maciejewski M, Jankowski P, Banach M. COVID-19 and cardiovascular complications – the preliminary results of the LATE-COVID study. Arch Med Sci 2021; 17: 818-22.

26. COVID-19 Models, Scenarios and Thresholds Canada: Alberta Health Services 2020. Available from: https:// www.albertahealthservices.ca/assets/info/ppih/if-ppihcovid-19-sag-models-scenarios-and-thresholds-rapidreview.pdf

27. Bhaskar S, Bradley S, Israeli-Korn S, et al. Chronic neurology in COVID-19 era: clinical considerations and recommendations from the REPROGRAM Consortium. Front Neurol 2020; 11: 664.

28. Bhaskar S, Sharma D, Walker AH, et al. Acute neurological care in the COVID-19 era: the Pandemic Health System REsilience PROGRAM (REPROGRAM) Consortium Pathway. Front Neurol 2020; 11: 579.

29. Bhaskar S, Sinha A, Banach M, et al. Cytokine storm in COVID-19 – immunopathological mechanisms, clinical considerations, and therapeutic approaches: the REPROGRAM Consortium Position Paper. Front Immunol 2020; 11: 1648.

30. Abarca-Gómez L, Abdeen ZA, Hamid ZA, et al. Worldwide trends in body-mass index, underweight, overweight, and obesity from 1975 to 2016: a pooled analysis of 2416 population-based measurement studies in 128.9 million children, adolescents, and adults. Lancet 2017; 390: 2627-42.

31. PHE. Excess weight and COVID-19: insights from new evidence. Public Health England, London 2020.

32. Collaboration  NCDRF. Rising rural body-mass index is the main driver of the global obesity epidemic in adults. Nature 2019; 569: 260-4.

33. Bhaskar S, Rastogi A, Menon KV, Kunheri B, Balakrishnan S, Howick J. Call for action to address equity and justice divide during COVID-19. Front Psychiatry 2020; 11: 559905.

34. Candib LM. Obesity and diabetes in vulnerable populations: reflection on proximal and distal causes. Ann Fam Med 2007; 5: 547-56.

35. Stevens J, Pratt C, Boyington J, et al. Multilevel interventions targeting obesity: research recommendations for vulnerable populations. Am J Prev Med 2017; 52: 115-24.

36. Zhao Y, Li Z, Yang T, Wang M, Xi X. Is body mass index associated with outcomes of mechanically ventilated adult patients in intensive critical units? A systematic review and meta-analysis. PLoS One 2018; 13: e0198669.

37. Mukhopadhyay A, Kowitlawakul Y, Henry J, Ong V, Leong CS, Tai BC. Higher BMI is associated with reduced mortality but longer hospital stays following ICU discharge in critically ill Asian patients. Clin Nutr ESPEN 2018; 28: 165-70.

38. Donini LM, Pinto A, Giusti AM, Lenzi A, Poggiogalle E. Obesity or BMI paradox? Beneath the tip of the iceberg. Front Nutrition 2020; 7: 53.

39. Di Renzo L, Del Gobbo V, Bigioni M, Premrov MG, Cianci R, De Lorenzo A. Body composition analyses in normal weight obese women. Eur Rev Med Pharmacol Sci 2006; 10: 191-6.

40. Oga EA, Eseyin OR. The Obesity paradox and heart failure: a systematic review of a decade of evidence. J Obes 2016; 2016: 9040248.

41. Alagiakrishnan K, Banach M, Ahmed A, Aronow WS. Complex relationship of obesity and obesity paradox in heart failure – higher risk of developing heart failure and better outcomes in established heart failure. Ann Med 2016; 48: 603-13.

42. Jia X, Yin C, Lu S, et al. Two things about COVID-19 might need attention. Preprints.org; 2020.

43. Bhaskar S, Bradley S, Chattu VK, et al. Telemedicine as the new outpatient clinic gone digital: position paper from the Pandemic Health System REsilience PROGRAM (REPROGRAM) International Consortium (Part 2). Front Public Health 2020; 8: 410.

44. Bhaskar S, Bradley S, Chattu VK, et al. Telemedicine across the globe-position paper from the COVID-19 Pandemic Health System Resilience PROGRAM (REPROGRAM) International Consortium (Part 1). Front Public Health 2020; 8: 556720.

45. Bhaskar S, Nurtazina A, Mittoo S, Banach M, Weissert R. Editorial: telemedicine during and beyond COVID-19. Front Public Health 2021; 9: 662617.

46. Batsis JA, Mackenzie TA, Bartels SJ, Sahakyan KR, Somers VK, Lopez-Jimenez F. Diagnostic accuracy of body mass index to identify obesity in older adults: NHANES 1999-2004. Int J Obes 2016; 40: 761-7.

47. Nuttall FQ. Body mass index: obesity, BMI, and health: a critical review. Nutr Today 2015; 50: 117-28.

Sonu Bhaskar, Sanja Jovanovic, Anubhav Katyal, Narayanan K. Namboodiri, Dimitrios Chatzis, Maciej Banach

Emili Vela1,2, Montse Cleries1,2, Usama Bilal3, Maciej Banach4, John W. McEvoy5,6, Martin Bødtker Mortensen7,8, Michael Joseph Blaha8,9, Khurram Nasir8,10,11, Josep Comin-Colet12,13,14, Josepa Mauri14,15, Miguel Cainzos-Achirica8,10,14

1Healthcare Information and Knowledge Unit, Catalan Health Service, Barcelona, Spain

2Digitalization for the Sustainability of the Healthcare System (DS3), Sistema de Salut de Catalunya, Barcelona, Spain

3Urban Health Collaborative, Drexel Dornsife School of Public Health, Philadelphia (PA), USA

4Department of Hypertension, Chair of Nephrology and Hypertension, Medical University of Lodz (MUL), Lodz, Poland

5National University of Ireland and National Institute for Preventive Cardiology, Galway, Ireland

6Division of Cardiology, Department of Medicine, Saolta University Healthcare Group, University College Hospital Galway, Galway, Ireland

7Department of Cardiology, Aarhus University Hospital, Aarhus, Denmark

8Ciccarone Center for the Prevention of Cardiovascular Disease, Division of Cardiology, Johns Hopkins University School of Medicine, Baltimore (MD), USA

9Welch Center for Prevention, Epidemiology, and Clinical Research, Johns Hopkins University, Baltimore (MD), USA

10Division of Cardiovascular Prevention and Wellness, Department of Cardiology, Houston Methodist DeBakey Heart & Vascular Center, Houston (TX), USA

11Center for Outcomes Research, Houston Methodist, Houston (TX), USA

12Department of Cardiology, Bellvitge University Hospital, L’Hospitalet de Llobregat, Barcelona, Spain

13Bellvitge Biomedical Research Institute (IDIBELL), L’Hospitalet de Llobregat, Barcelona, Spain

14Pla Director de Malalties Cardiovasculars, Health Department of the Government of Catalonia, Catalonia, Spain

15Department of Cardiology, Hospital Universitari Germans Trias i Pujol, Badalona, Spain, Spain

Submitted: 5 December 2021; Accepted: 7 December 2021

Online publication: 7 December 2021

Arch Med Sci 2023; 19 (1): 35–45

DOI: https//doi.org/10.5114/aoms/144631

Copyright © 2021 Termedia & Banach

Abstract

Introduction: The ESC recently classified European countries into 4 cardiovascular risk regions. However, whether Europeans from higher-risk countries living in lower-risk regions may benefit from intensive cardiovascular prevention efforts is unknown. We described the burden of risk factors and cardiovascular disease (CVD) among European-born immigrants living in Catalonia, a low-risk region.

Material and methods: A retrospective cohort study of 5.6 million adults of European origin living in Catalonia in 2019, including 282,789 European-born immigrants, was performed. We used the regionwide healthcare database and classified participants into 5 groups: low-, moderate-, high-, and very high-risk, and local-born. Age-standardized prevalence was estimated as of December 31 st, 2019 and incidence was computed during 2019 among at-risk individuals.

Corresponding author: Miguel Cainzos-Achirica MD, MPH, PhD Division of Cardiovascular Prevention and Wellness Department of Cardiology Houston Methodist DeBakey Heart & Vascular Center Houston (TX), USA Ciccarone Center for the Prevention of Cardiovascular Disease Division of Cardiology Johns Hopkins University School of Medicine Baltimore (MD), USA Pla Director de Malalties Cardiovasculars Health Department of the Government of Catalonia Catalonia, Spain E-mail: mcainzosachirica@ houstonmethodist.org

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Implications of the 2021 ESC cardiovascular risk classification among 283,000 European immigrants living in a low-risk region: a population-based analysis in Catalonia

Results: The very high-risk group was the largest immigrant group ( N = 136,910; 48.4%), while the high-risk group was the smallest ( N = 15,739; 5.6%). These two had the highest burden of coronary heart disease across all groups evaluated, in both men and women. The very high-risk group also had the highest prevalence of hypertension and obesity at young-to-middle age, and the burden of risk factors newly diagnosed during 2019 was highest in high- and very high-risk participants. The mean age at first diagnosis of risk factors and CVD was lower in these groups.

Conclusions: In Catalonia, residents born in high- and very-high-risk European countries are at increased risk of coronary heart disease and newly diagnosed risk factors. Low-risk European countries may consider tailored prevention efforts, early screening of risk factors, and adequate healthcare resource planning to better address the health needs of men and women from higher-risk countries.

Key words: cardiovascular disease, coronary heart disease, Eastern Europe, European, guidelines, hypertension, obesity, risk factors.

Introduction

The European Society of Cardiology (ESC) recently classified European countries into 4 cardiovascular risk regions: low, moderate, high, and very high risk [1, 2]. This classification is based on age-standardized country-level cardiovascular disease (CVD) mortality rates reported by the World Health Organization (WHO) [1], and is intended to enhance the calibration of risk estimations accounting for region-level differences in CVD risk and mortality.

In a given country, cardiovascular mortality rates are the result of a combination of factors, including country-level socioeconomic determinants of health, culture, risk factor burden, breadth of screening efforts, management of risk factors once detected, and access to and quality of care among individuals with established CVD [3, 4]. Because many of these factors are contextual, it is unknown whether the ESC risk classification should have implications for the risk assessment and management of Europeans born in higher-risk areas who move to lower-risk countries. Establishing the cardiovascular prevention needs of these groups is important, because in many European nations some of the largest immigration fluxes come from other, typically higher-risk, European countries. In the United Kingdom (UK) there currently live large communities of Romanian and Polish residents [5]; in Germany, individuals of Polish, Russian, and Turkish origin represent the largest immigrant groups [6]; in Spain, people born in Romania comprise the second largest immigrant group [7, 8]; and in Italy, Romania and Albania rank first and second, respectively, as countries of origin among the immigrant population [9].

Catalonia is home to more than 280,000 Europeans born outside of Spain [10]. Availability of exhaustive regionwide healthcare databases allows for a detailed evaluation of the burden of cardiovascular risk factors and CVD in relevant population subgroups, and this information can be used to inform targeted public health interventions, enhanced personalized preventive care, and the allocation of adequate healthcare resources.

The aim of this study was to evaluate the burden of cardiovascular risk factors and CVD among European-born residents living in Catalonia, stratified according to the ESC 2021 regional risk classification [1, 2].

Material and methods

Setting and data source

The study was conducted in Catalonia, a region in Northeastern Spain with a population of 7.8 million as of year 2020, a strong public healthcare system, and universal healthcare coverage for all residents [11–13]. We used the Catalan Health Surveillance System (CHSS) database, which is the regionwide, automated healthcare database used by the Health Department of the Government of Catalonia for administrative, resource allocation, benchmarking, and other purposes. The database is exhaustive, undergoes frequent quality control checks, and captures data for all residents living in Catalonia, including undocumented immigrants (who also have access to the health system by law). It includes sociodemographic data, information on public healthcare system use, medical diagnoses, and prescribed medications. Medical diagnoses are coded using the International Classification of Diseases, 9th Edition, Clinical Modification (ICD 9-CM), and medications are coded using the Anatomical Therapeutic Chemical system. The CHSS can be linked to other relevant databases, such as the local Census to ascertain country of birth. Our group has previously used the CCHS to study the burden of disease in Asian populations living in Catalonia, and our findings were highly consistent with those from well-established research databases in the UK, such as QResearch and the UK Biobank [14–16].

Study design and population

This was a retrospective cohort study. We included all adult individuals (i.e., 18 years of age or older as of December 31st, 2019) from the CHSS who were born in a European country. We clas-

Emili Vela, Montse Cleries, Usama Bilal, Maciej Banach, John W. McEvoy, Martin Bødtker Mortensen, Michael Joseph Blaha, Khurram Nasir, Josep Comin-Colet, Josepa Mauri, Miguel Cainzos-Achirica

sified participants into 5 mutually exclusive geographic regions of birth: low-risk, moderate-risk, high-risk, and very high-risk European countries, as defined by the ESC [1, 2]; and local-born (individuals born in Catalonia or elsewhere in Spain; from now on, “locals”). The list of countries included in each group together with the number of individuals from each country is presented in Supplementary Table SI. Although Spain is considered a low-risk country by the ESC [1, 2], the “local” group (N = 5.3 million) was evaluated separately so that it could serve as a reference group and did not drive the results for the low-risk stratum.

Outcomes

We were interested in evaluating the burden of 5 major traditional cardiovascular risk factors and 4 CVDs: diabetes, hypertension, hyperlipidemia, obesity, tobacco use, coronary heart disease (CHD), cerebrovascular disease, atrial fibrillation (AF), and heart failure (HF). Supplementary Table SII presents the specific ICD codes used to identify each of these risk factors and conditions, which were consistent with the definitions previously used by our group and others [14].

Other variables

The following socioeconomic variables recorded in the CHSS were also used for this analysis: yearly income, receipt of welfare support from the Government, and employment status. These data are updated annually. In the CHSS database income is classified for medication co-payment purposes using four categories: high (annual income > 100,000€), moderate (annual income 18,000–100,000€), low (annual income < 18,000€ but not receiving welfare support), and very low (individuals receiving welfare support from the government) [17]. Employment status was classified as employed or unemployed, the latter also including retired individuals.

Statistical analysis

We used population pyramids to describe the age and sex distribution of the study population by region of origin, and computed summary statistics of mean age and sex distribution for each group. We also described the distribution of income and employment status.

Prevalence calculations used all historical information about medical diagnoses available in the CHSS database for each participant as of December 31st, 2019. We computed the age-standardized prevalence (in %) of the 5 risk factors and 4 CVDs of interest, stratified by sex, for each group. The WHO 2000–2025 world standard population was used for this purpose [18]. We also displayed

graphically the prevalence of each risk factor and condition for each group, stratified by age and sex, using the following age intervals: 18–30, 30–39, 40–49, 50–59, 60–69, and 70+ years. These results were expressed in number of cases per 1,000.

We also calculated the frequency of newly recorded diagnoses of each of the risk factors and CVDs of interest between January 1st, 2019 and December 31st, 2019. This was conducted as a proxy of incidence calculations, was restricted to individuals at risk of each condition as of January 1st, and was aimed at providing additional information besides the prevalence calculations. Incidence was computed as the number of new cases per 1,000 individuals at risk and was also age-standardized. Analyses of crude incidence stratified by age and sex were also displayed graphically.

We also described the mean age at the time of the first recorded diagnosis of each risk factor and CVD, and this was done both for prevalent and incident conditions. All data management and statistical analyses were conducted using R software.

Research ethics

The data used for the present analysis had already been collected as part of the standard data collection procedures of the Government of Catalonia and the CHSS database. Only the data scientists in the Healthcare Information and Knowledge Unit of the Catalan Health Service (E.V., M.C.) had access to the raw de-identified data, and generated summary tables for the other investigators. For these reasons, the requirement for informed consent was waived.

Results

Study participants

Our analysis included 5,593,753 European-born adults living in Catalonia as of December 31st, 2019: 5,310,964 locals, and 282,789 born in other European countries (Table I and Supplementary Figure S1). The largest non-local group was the very high-risk stratum (N = 136,910; 48.4%), followed by the moderate- and low-risk groups, whereas the high-risk group was the smallest one (N = 15,739; 5.6%). Individuals from Romania (N = 73,839), Ukraine (N = 18,460), and the Russian Federation (N = 15,149) comprised the majority of very high-risk participants. Other countries of origin with a large number of individuals included in the study (> 10,000 people each) were Italy, France, the United Kingdom, Germany, and Portugal (Supplementary Table SI).

Sociodemographic characteristics

The local population had the highest mean age (51.8 years; Table I), followed by the low-risk

Implications of the 2021 ESC cardiovascular risk classification among 283,000 European immigrants living in a low-risk region: a population-based analysis in Catalonia

Table I. Sociodemographic characteristics of the study participants

Parameter Local Low risk Moderate risk High risk Very high risk Number 5,310,964 53,054 77,086 15,739 136,910 Mean age [years] 51.8 (18.6) 46.4 (16.3) 41.9 (13.8) 38.9 (10.7) 40.9 (12.5)

Women (%) 2,756,660 (51.9%) 26,052 (49.1%) 36,083 (46.8%) 9,435 (59.9%) 76,402 (55.8%)

Income:

High 65,923 (1.2%) 1,859 (3.5%) 1,581 (2.1%) 90 (0.6%) 187 (0.1%)

Moderate 2,056,568 (38.7%) 19,717 (37.2%) 22,370 (29.0%) 3,662 (23.3%) 16,768 (12.2%)

Low 3,027,107 (57.0%) 30,721 (57.9%) 51,417 (66.7%) 11,413 (72.5%) 113,172 (82.7%)

Very low 161,366 (3.0%) 757 (1.4%) 1,718 (2.2%) 574 (3.7%) 6,783 (5.0%)

Employment status: Employed 2,792,803 (52.6%) 25,381 (47.8%) 41,047 (53.2%) 7,732 (49.1%) 62,355 (45.5%) Unemployed 345,547 (6.5%) 3,781 (7.1%) 7,203 (9.3%) 2,065 (13.1%) 18,581 (13.6%)

Results are presented as either mean (standard deviation) or number (percentage). All p-values for differences between groups < 0.001.

group, whereas the moderate-, high-, and very high-risk groups were the youngest (mean ages of 41.9, 38.9, and 40.9 years, respectively). Women were the majority in the local population as well as in the high- and very high-risk groups. The higher the risk of the group, the lower was the average income and the higher was the frequency of unemployment status, with 88% of participants in the very high-risk group having either low or very low income, and 14% being unemployed. The pop-

ulation pyramids for each of the 5 study groups are presented in Supplementary Figure S2.

Cardiovascular risk factors

The results for risk factors are summarized in Tables II and III, Figures 1 and 2, and Supplementary Figures S3–S8. In analyses of prevalence, the local population had the highest burden of all 5 cardiovascular risk factors in both men and

Table II. Age-standardized prevalence of cardiovascular risk factors and diseases, by sex and area of origin

Parameter

Men:

Local Low risk Moderate risk High risk Very high risk

Diabetes 7.0 3.9 5.0 5.3 5.2

Hypertension 17.0 12.2 14.3 16.9 16.7

Hyperlipidemia 15.3 10.2 12.1 11.9 12.5 Obesity 14.3 5.9 8.5 8.2 12.9 Tobacco use 23.4 12.9 15.4 18.5 19.7

Coronary heart disease 3.3 2.9 3.3 4.5 3.6

Cerebrovascular disease 2.6 1.6 2.1 1.7 2.2

Atrial fibrillation 2.1 2.0 2.0 2.2 2.1 Heart failure 1.3 0.8 1.1 1.3 1.1

Women:

Diabetes 4.6 2.5 3.1 3.6 3.9

Hypertension 14.0 9.9 11.6 14.9 15.4

Hyperlipidemia 13.1 8.8 10.0 9.5 11.0 Obesity 16.2 6.0 8.7 9.2 14.4 Tobacco use 18.6 12.5 12.4 16.2 15.4

Coronary heart disease 1.3 1.1 1.2 1.9 2.1

Cerebrovascular disease 2.1 1.4 1.7 1.8 1.8

Atrial fibrillation 1.3 1.1 1.2 1.5 1.3 Heart failure 1.0 0.6 0.7 0.9 0.8

Results are presented as age-standardized prevalence, as of December 31st 2019, in %. All groups were standardized to the World Health Organization world population for 2000–2025. Cells shaded in grey represent the group with the highest age-standardized prevalence for each risk factor or disease.

Emili Vela, Montse Cleries, Usama Bilal, Maciej Banach, John W. McEvoy, Martin Bødtker Mortensen, Michael Joseph Blaha, Khurram Nasir, Josep Comin-Colet, Josepa Mauri, Miguel Cainzos-Achirica

Table III. Age-standardized incidence of cardiovascular risk factors and diseases, by sex and area of origin

Parameter Local Low risk Moderate risk High risk Very high risk

Men:

Diabetes 0.6 0.5 0.6 0.8 0.7

Hypertension 1.7 1.8 2.1 2.7 2.7

Hyperlipidemia 1.3 1.1 1.3 1.4 1.3

Obesity 1.3 0.8 1.1 0.9 1.8 Tobacco use 1.6 1.5 1.8 2.3 2.2

Coronary heart disease 0.3 0.4 0.4 0.8 0.5

Cerebrovascular disease 0.4 0.3 0.3 0.1 0.3

Atrial fibrillation 0.3 0.3 0.3 0.3 0.4

Heart failure 0.3 0.2 0.3 0.2 0.2

Women:

Diabetes 0.4 0.3 0.4 0.3 0.6

Hypertension 1.3 1.2 1.7 1.9 2.8

Hyperlipidemia 1.0 0.9 1.2 0.7 1.2 Obesity 1.3 0.7 1.0 1.3 2.0

Tobacco use 1.0 1.0 1.1 1.3 1.3

Coronary heart disease 0.1 0.1 0.1 0.2 0.3

Cerebrovascular disease 0.3 0.3 0.2 0.5 0.3

Atrial fibrillation 0.2 0.2 0.2 0.2 0.3 Heart failure 0.2 0.1 0.2 0.1 0.2

Results are presented as age-standardized incidence, during the year 2019, in %. All groups were standardized to the World Health Organization world population for 2000–2025. Cells shaded in grey represent the group with the highest age-standardized incidence for each risk factor or disease.

women, except for hypertension among women, the prevalence of which was highest in the very high-risk group (15.4%; Table II). Focusing on the 4 immigrant groups evaluated, either the high- or the very high-risk groups had the highest burden of all risk factors evaluated in both men and women, while the low-risk group consistently had the lowest prevalence, except for tobacco use among women. In analyses stratified by age, the very high-risk group had the highest prevalence of hypertension between ages 30 and 60 years among men (ages 40–60 for obesity) and between ages 40 and 70 years among women (ages 50–70 for obesity) (Figure 1).

In analyses of incidence, the high-risk and very high-risk groups had the highest burden of all 5 risk factors in both men and women, even higher than the local group (Table III). The age-adjusted incidence of hypertension in women from the very high-risk group was 2.8%, compared with 1.3% in the local-born population.

CVD

The results for CVD are summarized in Tables II and III, Figure 3, and Supplementary Figures S9–S14. For CHD, men from the high-risk group ranked highest both in terms of prevalence and incidence,

followed by the very high-risk group. Among women, the very high-risk group ranked highest, followed by the high-risk group. For instance, the age-adjusted prevalence of CHD among women from the very high-risk group was 2.1%, compared with 1.3% in local-born women; and this was 0.3% vs. 0.1% for incident CHD. In analyses stratified by age, in both men and women differences between groups were larger the older the age (Figure 3).

For example, among women ≥ 70 years of age, the prevalence of CHD in the very high-risk group was 140 per 1,000, 144 per 1,000 in the high-risk group, and 97 per 1,000 in the local-born group.

For the other cardiovascular conditions, differences between groups were smaller, with the low-risk group consistently having the lowest burden of all CVDs.

Mean age at first recorded diagnosis

The high-risk group consistently had the lowest mean age at the time of the first CHSS-recorded diagnosis for all prevalent and incident cardiovascular risk factors and conditions, except for prevalent tobacco use and incident diabetes (Supplementary Table SIII). The very high-risk group ranked second youngest in 16 out of 18 diagnoses evaluated (or first otherwise) and was remarkably

Implications of the 2021 ESC cardiovascular risk classification among 283,000 European immigrants living in a low-risk region: a population-based analysis in Catalonia

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group

Local Low Moderate High Very high

Figure 1. Prevalence of hypertension and obesity by sex, age, and geographic origin, as of December 31st, 2019. A – Hypertension, B – obesity

younger at the time of the first recorded diagnosis than the moderate-risk group, despite a similar mean age (40.9 vs. 41.9 years) and a higher proportion of women in the very high-risk group. For instance, compared with individuals in the moderate-risk group, very high-risk participants were on average 6 years younger at the time of the first recording of a prevalent CHD diagnosis, 10 years younger at the time of the first prevalent cerebrovascular disease diagnosis, and 12 years younger at the time of the first HF diagnosis.

Discussion

Our study followed the publication of the 2021 ESC cardiovascular risk regional classification, and used data for 283,000 European immigrants born outside of Spain and living in Catalonia, as well

as for 5.3 million local-born men and women. Our findings have important implications for understanding the cardiovascular health and prevention needs of individuals born in high- and very highrisk European countries who live in lower-risk regions, such as Catalonia. Several European nations have increasingly multi-national, multi-ethnic populations [5–10], and the ESC 2021 prevention guidelines recommended taking into consideration both regional differences within Europe and ethnicity for a more accurate cardiovascular risk assessment [2]. In this context, our findings can help inform more effective cardiovascular public health strategies in countries with large European immigrant communities, and more tailored cardiovascular risk screening, assessment, and management approaches.

Emili Vela, Montse Cleries, Usama Bilal, Maciej Banach, John W. McEvoy, Martin Bødtker Mortensen, Michael Joseph Blaha, Khurram Nasir, Josep Comin-Colet, Josepa Mauri, Miguel Cainzos-Achirica

Number per 1,000 Number per 1,000

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group

Number per 1,000 Number per 1,000

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group

Local Low Moderate High Very high

Figure 2. Incidence of hypertension and obesity by sex, age, and geographic origin, January 1st to December 31st, 2019. A – Hypertension, B – obesity

Differences between the local-born population and the moderate-risk group were small. Potential explanations of this include: 1) the already modest differences in CVD mortality between the lowand moderate-risk regions defined by the ESC [1, 2], 2) the healthy worker selection often associated with migration [19], and 3) acculturation to a Mediterranean lifestyle among individuals born in non-Mediterranean moderate-risk countries (e.g., from Scandinavian countries and Germany) [20, 21]. It is also possible that a less frequent use of the public healthcare system among certain immigrant groups [22], the limited cumulative historical information in the CHSS database among immigrants compared with local-borns, and the resulting under-detection/under-recording of conditions may have resulted in the underestimation

of prevalent risk factors and CVD. However, this would be expected to be less of an issue for incidence estimations of severe acute conditions, such as myocardial infarctions and strokes; and differences between local-borns and the moderate-risk group were also small for these. Our findings suggest that standard cardiovascular prevention approaches and care in low-risk regions such as Catalonia should suffice when caring for European immigrants born in moderate-risk countries who move to lower-risk regions, with no compelling evidence of specific additional needs in this group. The same is true for individuals born in other low-risk European countries.

In contrast, individuals from high- and very high-risk European countries had a higher burden of CHD than the local population and the other

Implications of the 2021 ESC cardiovascular risk classification among 283,000 European immigrants living in a low-risk region: a population-based analysis in Catalonia

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group

Local Low Moderate High Very high

18–30 30–39 40–49 50–59 60–69 ≥ 70 Age group Figure 3. Prevalence of coronary heart disease as of December 31st, 2019 and incidence between January 1st and December 31st, 2019; by sex, age, and geographic origin. A – Prevalence, B – incidence

immigrant groups. Relative differences were larger among women, in the context of local women having a very low burden of CHD. Moreover, the highand very high-risk groups ranked highest in newly recorded diagnoses during 2019, not only for CHD but also for all risk factors evaluated. Furthermore, the age at first recording of a CHD diagnosis in the CHSS database was remarkably lower among individuals from high- and very high-risk European countries than in the other groups, and the same was true for all risk factors and all other CVDs evaluated. Importantly, this trend was also present in comparisons with the moderate-risk group, which had a similar mean age to the very high-risk group and a significantly higher proportion of men.

The high- and very high-risk groups comprised Eastern Europe, the Balkan peninsula, the Baltic

countries, and Turkey (54% of all non-local study participants) [1, 2]. In our study population, most of these participants were born in Romania, Ukraine, and the Russian Federation. An intuitive explanation for the higher burden of CHD in these groups is the higher rates of cardiovascular risk factors such as hypertension, obesity, diabetes, and hyperlipidemia, or tobacco use reported in Eastern compared with Western European countries [23–26]. While our observations for prevalent risk factors were not consistent with this (except for hypertension among women), under-detection and under-recording may have contributed to the lower burden observed in all immigrant groups compared with the local population. Nonetheless, individuals from high- and very high-risk European countries had the highest burden of prev-

Emili Vela, Montse Cleries, Usama Bilal, Maciej Banach, John W. McEvoy, Martin Bødtker Mortensen, Michael Joseph Blaha, Khurram Nasir, Josep Comin-Colet, Josepa Mauri, Miguel Cainzos-Achirica

alent risk factors across the 4 immigrant groups evaluated, and the results for newly recorded risk factors during 2019 are compelling, and overall qualitatively consistent with the findings from multi-national studies [1, 2, 23–26].

The upstream causes leading to a higher burden and earlier presentation of CHD among individuals born in high- and very high-risk European countries are likely multifactorial. Many socioeconomic indicators associated with higher CHD burden tend to be more adverse in Eastern countries and the Balkans than in Central, Northern, and Western Europe [3, 27]. Also, immigrants from high- and very high-risk countries often face adverse work and life conditions in their new home country. Our observations for average income levels and employment status are consistent with this notion. The healthcare systems of Romania and Ukraine rank relatively low in several indices [12, 28], and this may have implications for risk factor detection and management, including among individuals who later move to other countries. In terms of lifestyles, according to the WHO the proportion of adults with sufficient levels of physical activity is lower in Romania than in Spain or the United Kingdom [29]. With regards to diets, in the recent Health, Alcohol and Psychosocial factors in Eastern Europe (HAPIEE) study conducted in Russia, Poland, and the Czech Republic, greater adherence to the traditional Eastern European dietary pattern was associated with higher CVD mortality in analyses adjusted for various socioeconomic factors [30]. Dairy products, eggs, potatoes, and lard were typical components of this dietary pattern and had the strongest associations with CVD death [30].

Alcohol intake is also believed to be an important upstream lifestyle cardiovascular risk factor in Eastern Europe [31, 32]. Unfortunately, detailed information on alcohol intake was not available in our database. Finally, meteorological and geomagnetic factors are also considered to play a role in CVD occurrence in countries such as Russia, although these are thought to be more relevant triggering strokes than CHD events [33], and their importance would be expected to be smaller among Russians who move to other regions. More research is needed to better define the upstream factors affecting the burden of CHD among men and women from high- and very high-risk areas who live elsewhere.

Our study has important public health implications. Men and women born in countries such as Romania, Ukraine, and Russia represent some of the largest immigrant groups not only in Catalonia, but also in other Spanish regions [7, 8], and in other European countries such as the UK [5], Germany [6], or Italy [9]. In those countries,

development of tailored, culturally adapted public health and individual-level preventive interventions adapted to their needs and specific risk profile can help forestall the development of risk factors such as hypertension and obesity, and ultimately of CHD, in these groups. Importantly, recent primordial and primary prevention interventions such as introduction of healthier diets have proven effective in reducing CHD rates in countries such as Poland [34], and similar interventions could be tested among higher-risk groups living in low-risk regions.

Study limitations

The potential challenges of using a database such as the CHSS when evaluating the health of immigrant groups have been discussed extensively, both above and elsewhere [14, 35]. Despite these challenges, our analysis was able to confirm a higher burden of CHD in participants from the high- and very high-risk groups, with important implications moving forward. We have also provided reassurance regarding the fact that the number of undocumented immigrants who would not be detected in the CHSS database is expected to be low in Catalonia given universal healthcare coverage, including for undocumented immigrants [14, 22, 35].

The generalizability of our findings to other countries is unknown. Nevertheless, recent analyses in Catalonia using the CHSS database focused on Asian populations yielded remarkably consistent findings with those observed in the UK [14–16]. This provides further reassurance with regards to the internal and external validity of our findings. Finally, information on length of stay in Catalonia was not available, which precluded accounting for this variable in the analyses, as well as evaluating the extent and effect of Mediterranean acculturation. Further research is needed in this field.

In conclusion, in Catalonia, residents born in high- and very high-risk European countries have a higher burden of CHD than the local-born population. This is particularly evident among women in the context of local-born women being at very low risk for CHD. Hypertension and obesity are frequent risk factors among participants from high- and very high-risk European countries, and often develop at young ages. Our findings provide further support for the cardiovascular risk classification used in the 2021 ESC guidelines, and have implications for lower-risk areas receiving large influxes of men and women from high- and very high-risk European countries. Specifically, our study may be used to inform tailored cardiovascular public health campaigns, adapted early screening of risk factors, and healthcare resource planning.

Implications of the 2021 ESC cardiovascular risk classification among 283,000 European immigrants living in a low-risk region: a population-based analysis in Catalonia

Acknowledgments

This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors. U.B. received support from the National Institute of Health under grant DP5OD26429.

Conflict of interest

The authors declare no conflict of interest.

References

1. SCORE2 working group and ESC Cardiovascular risk collaboration. SCORE2 risk prediction algorithms: new models to estimate 10-year risk of cardiovascular disease in Europe. Eur Heart J 2021; 42: 2439-54.

2. Visseren FLJ, Mach F, Smulders YM, et al.; ESC Scientific Document Group. 2021 ESC Guidelines on cardiovascular disease prevention in clinical practice. Eur Heart J 2021; 42: 3227-337.

3. Rose G. The strategy of preventive medicine. Oxford University Press, Oxford 1992.

4. Patel SA, Winkel M, Ali MK, Narayan KM, Mehta NK. Cardiovascular mortality associated with 5 leading risk factors: national and state preventable fractions estimated from survey data. Ann Intern Med 2015; 163: 245-53.

5. Office for National Statistics. Statistical bulletin: Migration Statistics Quarterly Report: August 2020. https:// www.ons.gov.uk/peoplepopulationandcommunity/populationandmigration/internationalmigration/bulletins/ migrationstatisticsquarterlyreport/august2020 (20 September 2021).

6. Statistisches Bundesamt. Bevölkerung und Erwerbstätigkeit. https://www.destatis.de/DE/Publikationen/ Thematisch/Bevoelkerung/MigrationIntegration/Migrationshintergrund2010220157004.pdf?__blob=publicationFile (20 September 2021).

7. Encuesta de Población Activa. Rumanos en España. Padrón municipal 2021, cifras de población. https://epa.com. es/padron/rumanos-en-espana/ (20 September 2021).

8. Instituto Nacional de Estadística. Estadística del Padrón Continuo. Datos provisionales a 1 de Enero de 2021. Comunidades autónomas y provincias. Población extranjera por nacionalidad y sexo. https://www.ine.es/jaxi/ Datos.htm?path=/t20/e245/p04/provi/l0/&file=0ccaa002.px (20 September 2021).

9. Comuni-Italiani.it. Stranieri per Nazionalità. http:// www.comuni-italiani.it/statistiche/stranieri/ (20 September 2021).

10. Generalitat de Catalunya. La immigració en xifres. http:// treballiaferssocials.gencat.cat/web/.content/03ambits_ tematics/05immigracio_refugi/dades_immigracio/immigracio_en_xifres/La_immigracio_en_xifres_01-General.pdf (20 September 2021).

11. Instituto Nacional de Estadistica. Cifras oficiales de población resultantes de la revisión del Padrón municipal a 1 de enero. Población por comunidades y ciudades autónomas y tamaño de los municipios. https://www. ine.es/jaxiT3/Datos.htm?t=2915 (20 September 2021).

12. Tandon A, Murray CJL, Lauer JA, Evans DB. World Health Organization. Measuring Overall Health System Performance For 191 Countries. https://www.who.int/healthinfo/paper30.pdf (20 September 2021).

13. Agencia Estatal Boletin Oficial del Estado. Ley 9/2017, de 27 de junio, de universalización de la asistencia san-

itaria con cargo a fondos públicos mediante el Servicio Catalán de la Salud. https://www.boe.es/buscar/act. php?id=BOE-A-2017-8524 (20 September 2021).

14. Satish P, Vela E, Bilal U, et al. Burden of cardiovascular risk factors and disease in five Asian groups in Catalonia: a disaggregated, population-based analysis of 121 000 first-generation Asian immigrants. Eur J Prev Cardiol 2022; 29: 916-24.

15. Hippisley-Cox J, Coupland C, Brindle P. Development and validation of QRISK3 risk prediction algorithms to estimate future risk of cardiovascular disease: prospective cohort study. BMJ 2017; 357: j2099.

16. Patel AP, Wang M, Kartoun U, Ng K, Khera AV. Quantifying and understanding the higher risk of atherosclerotic cardiovascular disease among south asian individuals: results from the UK Biobank Prospective Cohort Study. Circulation 2021; 144: 410-22.

17. Bilal U, Cainzos-Achirica M, Cleries M, et al. Socioeconomic status, life expectancy and mortality in a universal healthcare setting: an individual-level analysis of > 6 million Catalan residents. Prev Med 2019; 123: 91-4.

18. NIH. National Cancer Institute. World (WHO 2000-2025) Standard. https://seer.cancer.gov/stdpopulations/world. who.html (20 September 2021).

19. Picciotto S, Hertz-Picciotto I. Commentary: healthy worker survivor bias: a still-evolving concept. Epidemiology 2015; 26: 213-5.

20. Estruch R, Ros E, Salas-Salvadó J, et al.; PREDIMED Study Investigators. Primary prevention of cardiovascular disease with a mediterranean diet supplemented with extra-virgin olive oil or nuts. N Engl J Med 2018; 378: e34.

21. Martínez-González MA, Gea A, Ruiz-Canela M. The Mediterranean diet and cardiovascular health. Circ Res 2019; 124: 779-98.

22. Dalmau-Bueno A, García-Altés A, Vela E, Clèries M, Pérez CV, Argimon JM. Frequency of health-care service use and severity of illness in undocumented migrants in Catalonia, Spain: a population-based, cross-sectional study. Lancet Planet Health 2021; 5: e286-96.

23. Ginter E. The epidemic of cardiovascular disease in Eastern Europe. N Engl J Med 1997; 336: 1915-6.

24. GBD 2016 Lifetime Risk of Stroke Collaborators, Feigin VL, Nguyen G, Cercy K, et al. Global, regional, and country-specific lifetime risks of stroke, 1990 and 2016. N Engl J Med 2018; 379: 2429-37.

25. Dyrbuś K, Osadnik T, Desperak P, Desperak A, Gąsior M, Banach M. Evaluation of dyslipidaemia and the impact of hypolipidemic therapy on prognosis in high and very high risk patients through the Hyperlipidaemia Therapy in tERtiary Cardiological cEnTer (TERCET) Registry. Pharmacol Res 2018; 132: 204-10.

26. Deckert A, Winkler V, Paltiel A, Razum O, Becher H. Time trends in cardiovascular disease mortality in Russia and Germany from 1980 to 2007 – are there migration effects? BMC Public Health 2010; 10: 488.

27. Wikipedia. List of sovereign states in Europe by GDP (PPP) per capita. https://en.wikipedia.org/wiki/List_of_ sovereign_states_in_Europe_by_GDP_(PPP)_per_capita (20 September 2021).

28. World Population Review. Best Healthcare In The World 2021. https://worldpopulationreview.com/country-rankings/best-healthcare-in-the-world#dataTable (20 September 2021).

29. World Health Organization. Regional Office for Europe. Physical Activity Factsheets For The 28 European Union Member States Of The Who European Region https://www.euro.who.int/__data/assets/pdf_

Emili Vela, Montse Cleries, Usama Bilal, Maciej Banach, John W. McEvoy, Martin Bødtker Mortensen, Michael Joseph Blaha, Khurram Nasir, Josep Comin-Colet, Josepa Mauri, Miguel Cainzos-Achirica

Implications of the 2021 ESC cardiovascular risk classification among 283,000 European immigrants living in a low-risk region: a population-based analysis in Catalonia

file/0005/382334/28fs-physical-activity-euro-rep-eng. pdf (20 September 2021).

30. Stefler D, Brett D, Sarkadi-Nagy E, et al. Traditional Eastern European diet and mortality: prospective evidence from the HAPIEE study. Eur J Nutr 2021; 60: 1091-100.

31. McKee M, Shkolnikov V, Leon DA. Alcohol is implicated in the fluctuations in cardiovascular disease in Russia since the 1980s. Ann Epidemiol 2001; 11: 1-6.

32. GBD 2016 Alcohol Collaborators. Alcohol use and burden for 195 countries and territories, 1990-2016: a systematic analysis for the Global Burden of Disease Study 2016. Lancet 2018; 392: 1015-35.

33. Shaposhnikov D, Revich B, Gurfinkel Y, Naumova E. The influence of meteorological and geomagnetic factors on acute myocardial infarction and brain stroke in Moscow, Russia. Int J Biometeorol 2014; 58: 799-808.

34. Zatonski WA, Willett W. Changes in dietary fat and declining coronary heart disease in Poland: population based study. BMJ 2005; 331: 187-8.

35. Cainzos-Achirica M, Vela E, Cleries M, et al. Cardiovascular risk factors and disease among non-European immigrants living in Catalonia. Heart 2019; 105: 1168-74.

Circulating exosomal lncRNAs in patients with chronic coronary syndromes

Meili Zheng1,2, Ruijuan Han3, Wen Yuan4, Hongjie Chi1,2, Yeping Zhang1,2, Kai Sun5, Jiuchang Zhong1,2,4, Xiaoyan Liu1,2,4, Xinchun Yang1,2

1Heart Center, Beijing Chao-Yang Hospital, Capital Medical University, Beijing, China

2Beijing Key Laboratory of Hypertension Research, Beijing Chao-Yang Hospital, Capital Medical University, Beijing, China

3Department of Radiology, State Key Laboratory of Cardiovascular Disease, Fu Wai Hospital, National Center for Cardiovascular Diseases, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, China

4Medical Research Center, Beijing Chao-Yang Hospital, Capital Medical University, Beijing, China

5Department of Radiology, Fuwai Hospital Chinese Academy of Medical Sciences, Shenzhen, China

Submitted: 3 July 2020; Accepted: 1 October 2020

Online publication: 8 January 2021

Arch Med Sci 2023; 19 (1): 46–56

DOI: https://doi.org/10.5114/aoms/128014

Copyright © 2020 Termedia & Banach

Abstract

Introduction: The concept of chronic coronary syndrome (CCS) was first presented at the European Society of Cardiology Meeting in 2019. However, the roles of exosomal lncRNAs in CCS remain largely unclear.

Material and methods: A case-control study was performed with a total of 218 participants (137 males and 81 females), including 15 CCS patients and 15 controls for sequencing profiles, 20 CCS patients and 20 controls for the first validation, and 100 CCS patients and 48 controls for the second validation. Exosomes were isolated from the plasma of CCS patients and controls, and exosomal lncRNAs were identified by sequencing profiles and verified twice by qRT-PCR analysis. Receiver operating characteristic (ROC) curve analysis was performed to evaluate the diagnostic value of exosomal lncRNAs for CCS patients. Results: A total of 152 significantly differentially expressed lncRNAs with over two-fold changes were detected in plasma exosomes of CCS patients, including 90 upregulated and 62 downregulated lncRNAs. Importantly, 6 upregulated lncRNAs with the top fold changes were selected for validations. Exosomal lncRNAs ENST00000424615.2 and ENST00000560769.1 were significantly elevated in CCS patients in both validations compared with controls. The areas under the ROC of lncRNAs ENST00000424615.2 and ENST00000560769.1 were 0.654 and 0.722, respectively. Additionally, exosomal lncRNA ENST00000560769.1 was significantly higher in the CCS patients with more diseased vessels (p = 0.028). Conclusions: Exosomal lncRNA ENST00000424615.2 and ENST00000560769.1 were identified as novel diagnosis biomarkers for patients with CCS. Moreover, exosomal lncRNA ENST00000560769.1 was significantly higher in the CCS patients with more diseased vessels, and might be associated with a poor prognosis.

Key words: exosomal lncRNAs, chronic coronary syndrome, coronary artery disease, biomarkers.

Introduction

Coronary artery disease (CAD) is a pathological process characterized by obstructive or non-obstructive atherosclerotic plaque accumulation in

Corresponding authors: Prof. Xinchun Yang, Dr. Xiaoyan Liu, and Prof. Jiuchang Zhong Beijing Chao-Yang Hospital Capital Medical University 8# Gong-Ti South Road Beijing, China Phone: 86-10-85231066 Fax: 86-10-65951064 E-mails: yangxc99@gmail.com (X. Yang); lxy-213@163.com (X. Liu); jczhong@sina.com (J. Zhong)

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

the epicardial arteries. The disease can have long, stable periods but can also become unstable at any time, typically due to an acute atherothrombotic event caused by plaque rupture or erosion, which can present clinically as either chronic coronary syndrome (CCS) or acute coronary syndrome (ACS) [1]. Acute coronary syndrome is a medical emergency requiring immediate intervention; CCS also needs to be taken seriously since CAD is often progressive even in apparently clinically silent periods.

In the development and progression of CAD, emerging evidence suggests that exosomes have played crucial roles [2]. Exosomes are small membrane microvesicles (30–120 nm), produced by almost all cell types, that deliver their cargoes (proteins, DNA, and non-coding RNAs) to be involved in intercellular communication [3]. Recent studies have shown that exosomes might play important roles in cardiovascular diseases, and exosomal cargoes emerged as biomarkers or for use in therapeutic approaches [4–6]. Exosomal miRNAs have been reported to be potential biomarkers in ACS [7]; and exosomal lncRNAs may be involved in atherosclerosis progression [8–10], which is the key prerequisite for CCS. Several studies have investigated the role of lncRNAs serving as biomarkers to diagnose CAD [11–14], however, scarce research has been performed on the role of exosomal lncRNAs in CCS patients.

In the present study, we compared the expression of circulating exosomal lncRNAs in CCS patients and control subjects, and investigated the relationship between exosomal lncRNAs and the clinical parameters in CCS patients. Our findings indicate a potential role of circulating exosomal lncRNAs in CCS.

Material and methods Study subjects

This is a case-control study. All CCS cases and control subjects were consecutively enrolled from Beijing Chao-Yang Hospital (Capital Medical University, Beijing, China) between January and December 2017. All the participants in this investigation had been informed and had given written consent. The study was conducted in accordance with the Declaration of Helsinki, and the research protocol was approved by the Ethics Committee of Beijing Chao-Yang Hospital (Capital Medical University, Beijing, China).

Chronic coronary syndrome was defined according to the European Society of Cardiology (ESC) Clinical Practice Guidelines in 2019 [1]. Six subcategories of CCS were included: suspected CAD with stable anginal symptoms and or dyspnea (anginal equivalent); new onset heart failure or left ventricular dysfunction and suspected coronary artery disease; asymptomatic and symptomatic patients with stabilized symptoms occurring

less than 1 year after an acute coronary syndrome or patients with recent revascularization; asymptomatic and symptomatic patient more than 1 year after initial diagnosis or revascularization; patients with angina and suspected microvascular disease or vasospastic angina; and asymptomatic persons in whom CAD was detected at screening. All CCS patients included in the present study were those with coronary vessel stenosis ≥ 50% on coronarography. The control subjects were non-coronary chest pain patients (NCCP), with chest pain, normal cardiac biomarkers and most importantly, no coronary stenosis as confirmed by coronarography.

The following exclusion criteria were applied: malignant diseases, severe organ failure, thyroid dysfunction, autoimmune diseases, and various acute or chronic infectious diseases, and pregnancy.

A total of 218 participants (137 males and 81 females) were included in the present study, and all the study subjects were divided into three groups: a sequencing group (subjects’ blood samples for exosomal RNA sequencing), including 15 CCS and 15 controls (for sequencing profiles, the blood samples of every five subjects were pooled into one collective sample, and thus “3 CCS” and “3 control” samples were profiled); the first validation group (samples for exosomal RNA validation were taken for the first time), including 20 CCS and 20 controls; the second validation group (samples for the second validation were collected), including 100 CCS and 48 controls.

Exosome experiments

Exosomal isolation and identification were performed. Exosomal isolation was done following the instructions of the commercial kit used (Qiagen Inc., Dusseldorf, Germany). Isolated exosomes were identified by transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA), and Western blotting (WB) of the exosomal marker protein CD63 (Abcam, Cambridge, UK) and HSP70 (Abcam, Cambridge, UK) as described previously [15–17].

Exosomal RNA experiments

Exosomal RNA experiments included exosomal RNA extraction, sequencing, and validation by quantitative RT-PCR (qRT-PCR). Exosomal RNA extraction was carried out according to the protocol of the commercial kit utilized (Qiagen Inc., Dusseldorf, Germany). RNA sequencing was done as described in the methods section of our previous study [18]. The relative expression levels of lncRNA were quantified using ViiA 7 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) based on standard methods. The forward and reverse primers used are listed in Table I (the lncRNA IDs were searched in Ensembl Human GRCh37.p13).

Circulating exosomal lncRNAs in patients with chronic coronary syndromes

Table I. Forward and reverse primers

lncRNA ID (Ensembl Human GRCh37.p13)

Forward primer (5 ʹ –3 ʹ )

Reverse primer (5 ʹ –3 ʹ )

CTCTGAAAGAACTCTCACATGGACC GTCCTCTCCTTTGATGGACTCC NR_037611.1 CCAGTCCTACCCTGGAACCTT CCAGTAGAATCCCAACAGGCA ENST00000528983.1 GTGAGCAAGGTGCCGTTTT CCAGCCTCCACACTGCATTAA ENST00000560453.1 CCCAGTTGGCTGACGAAGA GCAGGTGTAGGTGGTAGTTGAAG ENST00000593793.1 AAAGCGGAGTCCATCAAAGG CGGTCTGAACGGTGTGTTATCT ENST00000560769.1 AAGGACTTGCTGGGTGTGCT CCAAAGACGGGTTTCATTAGGT Hsa-18S CATTCGAACGTCTGCCCTAT GCCTTCCTTGGATGTGGTAG

ENST00000424615.2

Laboratory measurements, echocardiography, and coronary artery angiography

Peripheral venous blood samples were collected after overnight fasting in the first 24 h after admission before coronary artery angiography (CAG) to measure a range of parameters, including lipids, glucose, and creatinine. Blood samples with a volume of 8 ml (collected into EDTA-containing tubes) were retained to obtain plasma for exosome isolation, and were then stored at –80°C until further use. Echocardiography was performed to measure routine parameters, such as the left ventricular end diastolic diameter (LVEDD), left ventricular ejection fraction (LVEF), etc. CAG was performed within 72 h after admission in both CCS patients and control subjects.

Statistical analysis

Statistical analysis was performed using SPSS 24.0 software (IBM, Armonk, NY, USA). All statistical analyses were two-tailed, and p-values < 0.05 were considered statistically significant. Continuous variables with normal distribution were expressed as mean ± standard deviation (SD), and compared by Student’s t-test, whereas those with non-normal distribution were expressed as quartiles and compared by the Mann-Whitney U-test. Categorical variables were expressed as percentages and numbers, and compared using the c2 test. Spearman correlation was used to calculate the correlation between exosomal lncRNAs and clinical parameters. Receiver operating characteristic curves and areas under the curve (AUCs) were computed to estimate the effectiveness of exosomal lncRNAs for prediction.

Results

Sequence profiling of circulating exosomal lncRNA

The present study included 15 CCS patients and 15 control subjects, whose clinical characteristics are summarized in Table II. No significant differences were detected in the subject characteristics between

the two groups; they were well balanced with regard to the main clinical and laboratory characteristics.

Before sequence profiling of circulating exosomal lncRNA, exosomes from the plasma were identified by TEM analyses and NTA and WB experiments (Supplementary Figure S1). TEM showed that the exosomes had a spherical shape with a bilayer membrane vesicle structure. The diameter of each of the exosome established by NTA was approximately 100 nm. The results of WB experiments suggested that specific proteins, CD63 and HSP70, were positively expressed in the exosomes in both groups.

By sequence profiling, we detected a total number of 152 significantly differentially expressed lncRNAs ( p  < 0.05; fold change > 2) in the plasma exosomes of the two groups, including 90 upregulated and 62 downregulated. Of the 90 upregulated lncRNA identified, we selected six highly expressed lncRNAs with the top fold change (lncRNA ENST00000424-615.2, lncRNA NR_037611.1, lncRNA ENST0000052-8983.1, lncRNA ENST00000560453.1, lncRNA ENST00000593793.1, and lncRNA ENST0000056-0769.1) to perform the subsequent first validation (Figure 1).

First validation of circulating exosomal lncRNA

The first validation was performed in 20 CCS patients and 20 control subjects, whose clinical characteristics are presented in Table III. The results of the first validation of the six selected circulating exosomal lncRNAs (ENST00000424615.2, NR_037611.1, ENST00000528983.1, ENST00000560453.1, ENST00000593793.1, and ENST00000560769.1) showed that lncRNA ENST00000424615.2 ( p  < 0.001, fold change = 2.49) and lncRNA ENST00000560769.1 (p < 0.001, fold change = 3.17) were significantly upregulated in AMI patients in the first validation. On the other hand, lncRNA NR_037611.1 (p = 0.990, fold change = 1.67), lncRNA ENST00000528983.1 (p = 0.050, fold change = 1.99), lncRNA ENST00000560453.1 (p = 0.560, fold change = 4.50), and lncRNA

Meili Zheng, Ruijuan Han, Wen Yuan, Hongjie Chi, Yeping Zhang, Kai Sun, Jiuchang Zhong, Xiaoyan Liu, Xinchun Yang

Circulating exosomal lncRNAs in patients with chronic coronary syndromes

Table II. Clinical characteristics of sequencing samples

Parameter

Control, n  = 15 CCS, n  = 15 P -value

Age [years] 55.4 ±9.9 60.9 ±8.0 0.105

Male, n (%) 8 (53.3) 10 (66.6) 0.711

Hypertension, n (%) 7 (46.7) 11 (73.3) 0.265

Diabetes, n (%) 1 (6.7) 0 (0.0) 0.996

Current smoker, n (%) 5 (33.3) 4 (26.7)  0.997

Current drinker, n (%) 4 (26.7) 2 (13.3) 0.645

Family history, n (%) 4 (26.7) 3 (13.3) 0.645

Heart rate [beats/min] 68.0 (60.0–77.0) 66.0 (57.0–78.0) 0.274

Systolic blood pressure [mm Hg] 123.1 ±34.7 138.9 ±17.6 0.127

Diastolic blood pressure [mm Hg] 74.7 ±8.1 82.0 ±10.8 0.072

Body mass index [kg/m 2] 26.3 ±4.9 24.7 ±2.4 0.266

Total cholesterol [mmol/l] 4.10 (3.63–5.22) 4.48 (3.50–5.25) 0.838

HDL-C [mmol/l] 1.10 (1.00–1.59) 1.10 (0.90–1.54) 0.870

LDL-C [mmol/l] 2.70 (1.95–3.00) 2.30 (2.10–3.20) 0.935

Triglycerides [mmol/l] 1.12 (0.89–1.70) 1.43 (1.25–2.02) 0.074

Fast glucose [mmol/l] 4.84 (4.39–4.98) 5.04 (4.63-5.33) 0.174

AMI – acute myocardial infarction, HDL-C – high-density lipoprotein cholesterol, LDL-C – low-density lipoprotein cholesterol.

Table III. Clinical characteristics of subjects in the first and second validations

Parameter

First validation Second validation Control ( n  = 20) CCS ( n  = 20) P -value Control ( n  = 48) CCS ( n  = 100) P -value

Age [years] 55.9 ±11.1 61.1 ±6.2 0.080 56.6 ±10.8 60.2 ±8.2 0.044

Male, n (%) 9 (45.0) 10 (50.0) 0.752 27 (56.3) 73 (73.0) 0.042

Current smoker, n (%) 8 (40.0) 6 (30.0) 0.765 4 (8.3) 49 (49.0) < 0.001

Current drinker, n (%) 3 (15.0) 3 (15.0) 1.000 11 (22.9) 30 (30.0) 0.181

Hospital time [days] 3.5 (3.0–6.0) 4.0 (2.0–5.0) 0.327 4.0 (3.0–6.0) 4.0 (3.0–6.0) 0.899

LVEDD [mm] 45.0 (44.0–49.0) 45.0 (42.5–49.5) 0.812 46.0 (43.0–50.0) 48.0 (45.0–50.0) 0.046

LVEF (%) 71.0 (66.5–72.5) 69.0 (68.0–72.0) 0.786 67.0 (66.0–73.0) 68.0 (65.0–72.3) 0.850

Physical data:

Heart rate [beats/min] 72.0 (65.0–73.0) 68.5 (63.3–77.0) 0.529 71.0 (63.8–79.8) 70.0 (62.3–78.0) 0.411

Systolic blood pressure [mm Hg] 129.5 (119.5–136.0) 131.0 (111.3–144.3) 0.947 128.5 (120.3–140.0) 133.0 (120.0–144.5) 0.338

Diastolic blood pressure [mm Hg] 72.5 (66.3–81.3) 74.5 (63.5–80.8) 0.738 77.5 (70.0–84.8) 78.5 (69.0–84.0) 0.878

Body mass index [kg/m2] 24.7 ±4.2 24.8 ±3.9 0.966 26.1 ±3.5 26.4 ±3.4 0.691

Historical data:

Hypertension, n (%) 7 (35.0) 12 (60.0) 0.113 19 (39.6) 71 (71.0) < 0.001 Diabetes, n (%) 0 (0.0) 0 (0.0) 1.000 5 (10.4) 11 (11.0) 0.915

Family history, n (%) 3 (15.0) 6 (30.0) 0.449 13 (27.1) 26 (26.0) 0.889

Parameter

First validation

Second validation Control ( n  = 20) CCS ( n  = 20) P -value Control ( n  = 48) CCS ( n  = 100)

P -value

C-reactive protein [mg/l] 1.51 (0.82–2.24) 1.65 (0.68–4.24) 0.084 1.10 (0.59–2.57) 1.29 (0.42–2.43) 0.966

ESR [mm/h]  3.00 (2.00–6.00) 6.00 (2.00–10.00) 0.100 5.00 (2.00–10.50) 4.00 (2.00–7.25) 0.197

Leukocytes [×109/l] 5.95 (5.46–7.17) 7.26 (6.38–7.86) 0.035 5.90 (5.33–7.25) 6.89 (5.58–8.25) 0.011

Neutrophils [×109/l] 3.40 (2.89–4.25) 4.52 (3.72–5.03) 0.033 3.73 (3.12–4.52) 4.01 (3.21–5.41) 0.086

Lymphocytes [×109/l] 2.00 (1.65–2.30) 1.93 (1.57–2.56) 0.799 1.67 (1.47–2.07) 1.99 (1.56–2.35) 0.039

Hemoglobin [g/l] 124.0 (117.5–137.0) 129.0 (123.0–138.3) 0.547 134.5 (124.3–147.8) 139.0 (129.0–146.0) 0.233

Platelets [×109/l] 246.0 (209.5–266.5) 210.5 (188.0–273.8) 0.231 213.0 (185.5–259.0) 216.0 (181.0–247.0) 0.874

AST [U/l] 18.0 (16.0–22.8) 19.0 (17.0–21.8) 0.620 19.0 (17.0–22.5) 19.0 (17.0–25.5) 0.182

ALT [U/l] 15.5 (12.0–23.3) 20.0 (13.0–24.8) 0.461 16.5 (12.0–22.0) 20.0 (16.0–29.5) 0.003

Total cholesterol [mmol/l] 4.28 (3.53–4.42) 4.09 (3.48–5.10) 0.698 4.22 (3.58–5.18) 3.87 (3.12–4.56) 0.072

HDL-C [mmol/l] 1.15 (0.93–1.58) 1.10 (0.90–1.38) 0.620 1.10 (0.95–1.30) 1.00 (0.80–1.20) 0.004

LDL-C [mmol/l] 2.25 (1.90–2.73) 2.50 (1.83–3.25) 0.461 2.70 (1.95–3.20) 2.00 (1.50–2.60) 0.002

Triglycerides [mmol/l] 1.28 (0.79–1.75) 0.93 (0.79–1.81) 0.841 1.25 (0.99–1.80) 1.47 (1.04–1.92) 0.134

Fast glucose [mmol/l] 5.06 (4.62–5.32) 4.68 (4.30–5.29) 0.265 4.83 (4.35–5.22) 4.78 (4.35–5.42) 0.723

HbA1c (%) 5.60 (5.28–5.93) 5.70 (5.60–5.90) 0.327 5.65 (5.38–5.93) 5.90 (5.50–6.20) 0.006

BUN [mmol/l] 4.14 (3.70–5.64) 4.73 (4.21–6.48) 0.127 5.16 (4.68–5.92) 5.40 (4.48–6.30) 0.649

Serum creatinine [μmol/l] 62.8 (53.3–72.6) 60.5 (54.2–78.6) 0.841 65.6 (57.8–74.4) 68.0 (58.5–79.1) 0.326

Uric acid [μmol/l] 350.0 (292.5–396.3) 295.0 (247.3–401.8) 0.231 331.5 (271.0–373.0) 347.0 (277.3–417.5) 0.230

Na+ [mmol/l] 141.5 (139.9–142.7) 141.1 (140.2–142.9) 0.841 142.0 (140.1–142.6) 141.1 (139.4–142.5) 0.077

K+ [mmol/l] 4.00 (3.73–4.25) 3.90 (3.80–4.18) 0.968 3.80 (3.70–4.10) 4.00 (3.80–4.30) 0.012

Serum albumin [g/l] 39.5 (38.1–43.2) 39.3 (37.7–42.0) 0.841 39.4 (36.9–41.4) 40.1 (38.3–42.3) 0.076

Free triiodothyronine [pg/ml] 2.79 (2.64–3.01) 2.80 (2.56–3.03) 0.923 2.95 (2.70–3.12) 2.93 (2.78–3.13) 0.529

Free tetraiodothyronine [ng/dl] 1.06 (0.98–1.16) 1.11 (1.02–1.20) 0.411 1.12 (1.02–1.25) 1.11 (1.04–1.22) 0.779

STSH [μIU/ml] 1.85 (1.12–2.41) 2.48 (1.76–4.55) 0.057 2.05 (1.25–3.25) 1.83 (1.28–3.15) 0.875

Fibrinogen [mg/dl] 254.0 (237.5–293.5) 278.3 (252.6–309.2) 0.112 240.3 (206.4–299.4) 249.7 (221.8–294.0) 0.251

NT-BNP [pg/ml] 54.4 (16.0–109.9) 43.6 (22.6–117.9) 0.872 45.1 (26.7–89.3) 60.8 (33.4–115.2) 0.201

Meili Zheng, Ruijuan Han, Wen Yuan, Hongjie Chi, Yeping Zhang, Kai Sun, Jiuchang Zhong, Xiaoyan Liu, Xinchun Yang

Circulating exosomal lncRNAs in patients with chronic coronary syndromes

Parameter

First validation

Second validation Control ( n  = 20) CCS ( n  = 20) P -value Control ( n  = 48) CCS ( n  = 100) P -value

Aspirin, n (%) 6 (30.0) 19 (95.0) < 0.001 24 (50.0) 94 (94.0) < 0.001 Clopidogrel, n (%) 3 (15.0) 15 (75.0) < 0.001 4 (8.3) 69 (69.0) < 0.001

Ticagrelor, n (%) 0 (0.0) 0 (0.0) 1.000 0 (0.0) 10 (10.0) 0.055 ACEI/ARB, n (%) 4 (20.0) 5 (25.0) 0.705 10 (20.8) 36 (36.0) 0.062 Statin, n (%) 12 (60.0) 19 (95.0) 0.023 33 (68.8) 95 (95.0) < 0.001

β -blocker 4 (20.0) 6 (30.0) 0.465 14 (29.2) 62 (62.0) < 0.001 CCB, n (%) 6 (30.0) 7 (35.0) 0.736 11 (22.9) 38 (38.0) 0.068

CCS – chronic coronary syndrome, ESR – erythrocyte sedimentation rate, AST – aspartate aminotransferase, ALT – alanine aminotransferase, HDL-C – high-density lipoprotein cholesterol, LDL-C – low-density lipoprotein cholesterol, HbA1c – glycosylated hemoglobin, BUN – blood urea nitrogen, sTSH – thyroid stimulating hormone, CKMB – creatine kinase MB, ACEI/ARB – angiotensin-converting enzyme inhibitors/ angiotensin receptor blockers, CCB – calcium antagonist, LVEDD – left ventricular end diastolic diameter, LVEF – left ventricular ejection fraction, NT-BNP – N-terminal proB-type natriuretic peptide.

A CCS

B Control

2 1 0 –1 –2

ENST00000560769.1 ENST00000593793.1 ENST00000560453.1 ENST00000528983.1 NR_037611.1 ENST00000424615.2

0 20 40 60

Control CCS RPKM

Figure 1. Circulating exosomal lncRNA sequencing in chronic coronary syndrome (CCS). A – Hierarchical clustering of substantially differentially expressed (p < 0.05; fold change > 2) lncRNAs in control and CCS. B – Six upregulated lncRNAs in CCS were selected for the first validation

ENST-00000593793.1 (p = 0.442, fold change = 1.29) were not (Figure 2). Therefore, the circulating exosomal lncRNAs ENST00000424615.2 and ENST000005-60769.1 were selected for the second validation.

Second validation of circulating exosomal lncRNA

The second validation was performed in 100 CCS patients and 48 controls, whose clinical characteristics are displayed in Table III.

In the second validation, circulating exosomal lncRNA ENST00000424615.2 (p = 0.063, fold change = 2.39) and lncRNA ENST00000560769.1 (p = 0.003, fold change = 3.07) were both significantly upregulated in CCS patients compared with control subjects (Figure 3).

ROC curve analysis showed, for circulating exosomal lncRNA ENST00000424615.2, AUC = 0.654 ±0.047 (95% CI: 0.562–0.746, p = 0.002); for lncRNA ENST00000560769.1, AUC = 0.722 ±0.048 (95% CI: 0.627–0.817, p < 0.001) (Figure 3)

Figure 2. qRT-PCR analysis of expression of the six circulating exosomal lncRNAs (ENST00000424615.2, NR_037611.1, ENST00000528983.1, ENST00000560453.1, ENST00000593793.1, and ENST00000560769.1) that were selected in the first validation

Association between circulating exosomal lncRNA and clinical parameters

In the second validation, circulating exosomal lncRNAs ENST00000424615.2 and ENST00000560769.1 showed significant relationships with certain parameters in CCS patients. More specifically, exosomal lncRNA ENST00000424615.2 was positively associated with diastolic blood pressure (r = 0.191, p = 0.020), and negatively associated with alanine aminotransferase (ALT) (r = –0.224, p = 0.028) (Table IV).

Exosomal lncRNA ENST00000560769.1 was significantly lower in the current drinker group (p = 0.042), but higher in the CCS patients with more diseased vessels (p = 0.028) (Table V).

Discussion

In the present study, we obtained interesting findings indicating that circulating exosomal lncRNAs ENST00000424615.2 and ENST00000560769.1 might act as potential biomarkers for CCS. Furthermore, exosomal lncRNA

Meili Zheng, Ruijuan Han, Wen Yuan, Hongjie Chi, Yeping Zhang, Kai Sun, Jiuchang Zhong, Xiaoyan Liu, Xinchun Yang

Circulating exosomal lncRNAs in patients with chronic coronary syndromes

Table IV. Associations of circulating exosomal lncRNA ENST00000424615.2 and ENST00000560769.1 with clinical parameters of chronic coronary syndrome patients in the second validation  Parameter ENST00000424615.2 ENST00000560769.1

r P -value

r P -value

Age –0.077 0.448 –0.024 0.813

Hospital time 0.143 0.156 –0.154 0.125

LVEDD 0.100 0.362 –0.033 0.765

LVEF –0.082 0.453 –0.039 0.720

Heart rate 0.002 0.978 –0.048 0.563

Systolic blood pressure 0.055 0.504 0.025 0.759

Diastolic blood pressure 0.191 0.020 –0.023 0.781

Body mass index –0.043 0.670 –0.034 0.740

C-reactive protein –0.166 0.111 –0.151 0.146

ESR –0.010 0.926 0.098 0.348

Leukocyte 0.007 0.943 –0.134 0.186

Neutrophil 0.013 0.899 –0.107 0.291

Lymphocyte 0.045 0.655 –0.103 0.311

Hemoglobin 0.027 0.792 0.000 0.996

Platelets –0.019 0.848 –0.161 0.111

AST –0.098 0.339 0.004 0.970

ALT –0.224 0.028 –0.085 0.409

Total cholesterol 0.086 0.407 –0.004 0.973

HDL-C –0.080 0.443 –0.004 0.968

LDL-C 0.114 0.271 –0.052 0.618

Triglycerides 0.005 0.097 0.048 0.642

Fast glucose –0.171 0.206 0.108 0.205

HbA 1c –0.113 0.274 0.142 0.169

BUN –0.073 0.479 –0.093 0.367

Serum creatinine 0.152 0.139 0.059 0.570

Uric acid 0.152 0.139 –0.061 0.556

Na+ 0.197 0.054 –0.019 0.857

K+ 0.164 0.110 0.158 0.124

Serum albumin –0.003 0.977 0.059 0.570

Free triiodothyronine –0.005 0.965 –0.157 0.133

Free tetraiodothyronine –0.139 0.183 –0.170 0.102

sTSH –0.124 0.238 0.055 0.603

Fibrinogen –0.034 0.738 –0.089 0.381

NT-BNP 0.102 0.423 0.090 0.481

LVEDD – left ventricular end diastolic diameter, LVEF – left ventricular ejection fraction, ESR – erythrocyte sedimentation rate, AST –aspartate aminotransferase, ALT – alanine aminotransferase, HDL-C – high-density lipoprotein cholesterol, LDL-C – low-density lipoprotein cholesterol, HbA1c – glycosylated hemoglobin, BUN – blood urea nitrogen, sTSH – thyroid stimulating hormone, NT-BNP – N-terminal proBtype natriuretic peptide.

Table V. Comparison of expression of circulating exosomal lncRNA ENST00000424615.2 and ENST00000560769.1 between different groups of clinical parameters in chronic coronary syndrome patients in the second validation Parameter

ENST00000424615.2 ENST00000560769.1

Median (25th–75th) P -value Median (25th–75th) P -value

Gender: 0.239 0.159

Male 5.90 (2.07–14.53) 19.84 (10.30–36.15) Female 2.97 (0.83–19.56) 13.36 (5.94–28.05)

Hypertension: 0.468 0.327 No 4.92 (2.30–14.60) 19.83 (10.93–34.54) Yes 4.89 (1.04–15.89) 16.00 (8.34–37.53)

Diabetes: 0.261 0.381 No 5.90 (1.79–16.11) 16.80 (9.04–34.66) Yes 2.97 (1.04–5.39) 23.75 (12.64–45.57)

Current smoker: 0.063 0.652 No 3.58 (1.04–13.18) 15.35 (8.69–49.87) Yes 6.96 (2.88–17.15) 18.25 (10.23–34.66)

Current drinker:  0.315 0.042 No 5.96 (1.88–16.00) 20.69 (10.54–42.84) Yes 3.85 (0.96–14.11) 12.68 (7.01–25.07)

Diseased vessel: 0.637 0.028 < 3 3.81 (1.46–17.66) 12.91 (7.02–24.38) 3 or combined diseased LM 5.90 (1.65–14.53) 20.53 (11.01–45.19)

ENST00000560769.1 might be associated with CCS severity, as it was significantly higher in the CCS patients with more diseased vessels.

Increasing evidence has revealed that noncoding RNAs participate in various physiological and pathological processes, playing important roles in human diseases [19–21]. LncRNAs are noncoding RNAs longer than 200 nucleotides, which regulate gene expression at the transcriptional, post-transcriptional, and translational levels. Previous studies have proved that lncRNAs were involved in regulating pathophysiological conditions, such as cancer [22–24], autoimmune diseases [25], and others [26]. In CAD, lncRNAs were found to be differently expressed in atherosclerotic coronary artery plaques [27], and were proved to serve as biomarkers to diagnose CAD [11–14]. Several studies also reported that lncRNAs might be used for the prediction of ACS outcomes [28].

The lncRNA packaged in the exosomes are highly stable due to their lipid bilayers that protect them from enzymatic degradation by RNA enzymes in the bodily fluids. Thus, due to that high stability, exosomal lncRNAs are more suitable to be biomarkers. Previous studies showed

that exosomal lncRNAs were potential biomarkers for various diseases [29–31]. In CAD, exosomal lncRNAs were reported to be involved in atherosclerosis progression [8–10], and they might serve as a valuable therapeutic tool for neovascularization [32].

Here, through sequencing profiles and double qRT-PCR validations, we established that circulating exosomal lncRNAs ENST00000424615.2 and ENST00000560769.1 were significantly upregulated in CCS patients. ENST00000424615.2, also named as RP11-38L15.2-001 (Ensembl Human GRCh37. p13), is a lincRNA, and a product of the gene ENSG00000229227.4, located in chromosome 10: 46,937,463-46,947,262 reverse strand. (Ensembl Human GRCh37. p13). ENST00000560769.1, also named as CTD-2033D15.1-001 (Ensembl Human GRCh37. p13), is an antisense lncRNA, and a product of the gene ENSG00000259279.1, located in chromosome 15: 39,885,781-39,886,432 reverse strand (Ensembl Human GRCh37. p13). These two lncRNAs are novel transcripts, on which no relevant research has been performed. In the present study, we found that circulating exosomal lncRNAs ENST00000424615.2 and ENST00000560769.1 were

Meili Zheng, Ruijuan Han, Wen Yuan, Hongjie Chi, Yeping Zhang, Kai Sun, Jiuchang Zhong, Xiaoyan Liu, Xinchun Yang

A 10 8 6 4 2 0

ENST00000424615.2 Fold change Control CCS

p = 0.063

Sensitivity (%)

B 100 50 0

ROC curve of ENST00000424615.2

0 50 100

1 – Specificity (%)

ROC curve of ENST00000560769.1

ENST00000560769.1 Fold change Control CCS

p = 0.003

Sensitivity (%)

AUC = 0.654 ±0.047 (95% CI: 0.562–0.746, p = 0.002) C 150 100 50 0

D 100 50 0

AUC = 0.722 ±0.048 (95% CI: 0.627–0.817, p < 0.01)

1 – Specificity (%)

Figure 3. Circulating exosomal lncRNAs ENST00000424615.2 and ENST00000560769.1, selected in the second validation. A – qRT-PCR analysis of expression of ENST00000424615.2 and ENST00000560769.1. B – Receiver operating characteristic (ROC) curves analyses of ENST00000424615.2 and ENST00000560769.1 for chronic coronary syndrome

elevated in patients with CCS, and might serve as potential biomarkers for CCS. Moreover, exosomal lncRNA ENST00000560769.1 was significantly higher in the CCS patients with more diseased vessels, and might be associated with a poor prognosis.

Our results suggested that circulating exosomal lncRNAs may serve as potential biomarkers for CCS and even be associated with the severity of CCS. However, the present study also has some limitations: this study was a clinical observation, the mechanism by which circulating exosomal lncRNAs regulate CCS was not elucidated, and further research is needed to clarify these regulatory mechanisms; this study had a small sample size and lacked follow-up after discharge; thus the relationship between exosomal lncRNAs and prognosis was not evaluated, and a further large sample size study with long-term follow-up should be conducted.

In conclusion, our data showed that circulating exosomal lncRNAs ENST00000424615.2 and ENST00000560769.1 were elevated in patients with CCS, and might serve as potential biomarkers for CCS. Moreover, exosomal lncRNA ENST00000560769.1 was significantly higher in the CCS patients with more diseased vessels, and might be associated with a poor prognosis.

Acknowledgments

Meili Zheng, Ruijuan Han and Wen Yuan contributed equally to this work.

This research was supported by the National Natural Science Foundation of China (81800304, 81500038, 81770253), the National Major Research Plan Training Program of China (91849111), and the Open Foundation from Beijing Key Laboratory of Hypertension Research (2019GXY-KFKT-03, 2019GXY-KFKT-02).

Conflict of interest

The authors declare no conflict of interest.

References

1. Knuuti J, Wijns W, Saraste A, et al. 2019 ESC guidelines for the diagnosis and management of chronic coronary syndromes. Eur Heart J 2020; 41: 407-77.

2. Gao XF, Wang ZM, Wang F, Gu Y, Zhang JJ, Chen SL. Exosomes in coronary artery disease. Int J Biol Sci 2019; 15: 2461-70.

3. Coumans FAW, Brisson AR, Buzas EI, et al. Methodological guidelines to study extracellular vesicles. Circ Res 2017; 120: 1632-48.

4. Sluijter JPG, Davidson SM, Boulanger CM, et al. Extracellular vesicles in diagnostics and therapy of the ischae-

mic heart: position paper from the Working Group on Cellular Biology of the heart of the European Society of Cardiology. Cardiovasc Res 2018; 114: 19-34.

5. Ghafarian F, Pashirzad M, Khazaei M, et al. The clinical impact of exosomes in cardiovascular disorders: from basic science to clinical application. J Cell Physiol 2019; 234: 12226-36.

6. Bellin G, Gardin C, Ferroni L, et al. Exosome in cardiovascular diseases: a complex world full of hope. Cells 2019; 8: 166.

7. Su J, Li J, Yu Q, et al. Exosomal miRNAs as potential biomarkers for acute myocardial infarction. IUBMB Life 2020; 72: 384-400.

8. Huang C, Han J, Wu Y, et al. Exosomal MALAT1 derived from oxidized low-density lipoprotein-treated endothelial cells promotes M2 macrophage polarization. Mol Med Rep 2018; 18: 509-15.

9. Chen L, Yang W, Guo Y, et al. Exosomal lncRNA GAS5 regulates the apoptosis of macrophages and vascular endothelial cells in atherosclerosis. PLoS One 2017; 12: e0185406.

10. Wang Y, Liang J, Xu J, et al. Circulating exosomes and exosomal lncRNA HIF1A-AS1 in atherosclerosis. Int J Clin Exp Pathol 2017; 10: 8383-8.

11. Zhang Z, Gao W, Long QQ, et al. Increased plasma levels of lncRNA H19 and LIPCAR are associated with increased risk of coronary artery disease in a Chinese population. Sci Rep 2017; 7: 7491.

12. Yin Q, Wu A, Liu M. Plasma long non-coding RNA (lncRNA) GAS5 is a new biomarker for coronary artery disease. Med Sci Monit 2017; 23: 6042-8.

13. Cai Y, Yang Y, Chen X, et al. Circulating ‘lncRNA OTTHUMT00000387022’ from monocytes as a novel biomarker for coronary artery disease. Cardiovasc Res 2016; 112: 714-24.

14. Li L, Wang L, Li H, et al. Characterization of lncRNA expression profile and identification of novel lncRNA biomarkers to diagnose coronary artery disease. Atherosclerosis 2018; 275: 359-67.

15. Li L, Li C, Wang S, et al. Exosomes derived from hypoxic oral squamous cell carcinoma cells deliver MIR-21 to normoxic cells to elicit a prometastatic phenotype. Cancer Res 2016; 76: 1770-80.

16. Zhang L, Li H, Yuan M, Li D, Sun C, Wang G. Serum exosomal microRNAs as potential circulating biomarkers for endometriosis. Dis Markers 2020; 2020: 2456340.

17. Zhang L, Zhang S, Yao J, et al. Microenvironmentinduced PTEN loss by exosomal microRNA primes brain metastasis outgrowth. Nature 2015; 527: 100-4.

18. Zheng M, Zhao L, Yang X. Expression profiles of long noncoding RNA and mRNA in epicardial adipose tissue in patients with heart failure. Biomed Res Int 2019; 2019: 3945475.

19. Yu P, Guo J, Li J, Chen W, Zhao T. Co-expression network analysis revealing the key lncRNAs in diabetic foot ulcers. Arch Med Sci 2019; 15: 1123-32.

20. Zhou JZ, Hu MR, Diao HL, Wang QW, Huang Q, Ge BJ. Comprehensive analysis of differentially expressed circRNAs revealed a ceRNA network in pancreatic ductaladenocarcinoma. Arch Med Sci 2019; 15: 979-91.

21. El-Ahwany EGE, Mourad L, Zoheiry MMK, et al. MicroRNA-122a as a non-invasive biomarker for HCV genotype 4-related hepatocellular carcinoma in Egyptian patients. Arch Med Sci 2019; 15: 1454-61.

22. Shao S, Tian J, Zhang H, Wang S. LncRNA myocardial infarction-associated transcript promotes cell proliferation and inhibits cell apoptosis by targeting MIR-330-5p

in epithelial ovarian cancer cells. Arch Med Sci 2018; 14: 1263-70.

23. Zhang S, Song X. Long non-coding RNA SNHG1 promotes cell proliferation and invasion of hepatocellular carcinoma by acting as a molecular sponge to modulate MIR-195. Arch Med Sci 2020; 16: 386-94.

24. Liu H, Liu J, Zhao G. Long non-coding RNA HOTAIR regulates proliferation, migration and invasion of human cervical cancer cells by modulating expression of MAPK1. Arch Med Sci 2020; 16: 1158-65.

25. Zhang Q, Liang Y, Yuan H, et al. Integrated analysis of lncRNA, miRNA and mRNA expression profiling in patients with systemic lupus erythematosus. Arch Med Sci 2019; 15: 872-9.

26. Yang M, Zhang L, Wang X, Zhou Y, Wu S. Down-regulation of MIR-203a by lncRNA PVT1 in multiple myeloma promotes cell proliferation. Arch Med Sci 2018; 14: 1333-9.

27. Arslan S, Berkan O, Lalem T, et al. Long non-coding RNAs in the atherosclerotic plaque. Atherosclerosis 2017; 266: 176-81.

28. Vausort M, Wagner DR, Devaux Y. Long noncoding RNAs in patients with acute myocardial infarction. Circ Res 2014; 115: 668-77.

29. Zhao Y, Xu J. Synovial fluid-derived exosomal lncRNA PCGEM1 as biomarker for the different stages of osteoarthritis. Int Orthop 2018; 42: 2865-72.

30. Lee YR, Kim G, Tak WY, et al. Circulating exosomal noncoding RNAs as prognostic biomarkers in human hepatocellular carcinoma. Int J Cancer 2019; 144: 1444-52.

31. Zhao R, Zhang Y, Zhang X, et al. Exosomal long noncoding RNA HOTTIP as potential novel diagnostic and prognostic biomarker test for gastric cancer. Mol Cancer 2018; 17: 68.

32. Shyu KG, Wang BW, Pan CM, Fang WJ, Lin CM. Hyperbaric oxygen boosts long noncoding RNA MALAT1 exosome secretion to suppress microRNA-92a expression in therapeutic angiogenesis. Int J Cardiol 2019; 274: 271-8.

Meili Zheng, Ruijuan Han, Wen Yuan, Hongjie Chi, Yeping Zhang, Kai Sun, Jiuchang Zhong, Xiaoyan Liu, Xinchun Yang

Compositional

and functional properties of high-density lipoproteins in relation to coronary in-stent restenosis

Shiva Ganjali1, Elahe Mahdipour1, Seyed Hamid Aghaee-Bakhtiari2, Majid Ghayour-Mobarhan3, Sara Saffar Soflaei3, Maciej Banach4,5, Anatol Kontush6, Amirhossein Sahebkar7,8,9,10

1Department of Medical Biotechnology and Nanotechnology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

2Bioinformatics Research Group, Mashhad University of Medical Sciences, Mashhad, Iran

3Department of Modern Science and Technology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran & UNESCO Higher Center, Nutrition Department, Mashhad University of Medical Sciences, Mashhad, Iran

4Department of Preventive Cardiology and Lipidology, Medical University of Lodz, Lodz, Poland

5Cardiovascular Research Centre, University of Zielona Gora, Zielona Gora, Poland

6National Institute for Health and Medical Research (INSERM), Research Unit 1166, Faculty of Medicine Pitié–Salpêtrière, Sorbonne University, Paris, France

7Biotechnology Research Center, Pharmaceutical Technology Institute, Mashhad University of Medical Sciences, Mashhad, Iran

8Applied Biomedical Research Center, Mashhad University of Medical Sciences, Mashhad, Iran

9School of Medicine, The University of Western Australia, Perth, Australia

10School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran

Submitted: 25 July 2021; Accepted: 2 August 2021 Online publication: 2 August 2021

Arch Med Sci 2023; 19 (1): 57–72

DOI: https://doi.org/10.5114/aoms/140728

Copyright © 2021 Termedia & Banach

Abstract

Introduction: In-stent restenosis (ISR) is an unfavorable outcome that occurs in patients after coronary stenting. Use of drugs such as statins as well as drug-eluting stents has only been partially effective in reducing the rate of ISR. Since low high-density lipoprotein cholesterol (HDL-C) concentration is a pivotal cardiovascular disease risk factor, this study aimed to evaluate the compositional and functional alterations of HDL in individuals with ISR. Material and methods: This case-control study included 21 ISR, 26 non-ISR (NISR), 16 angiography-negative, and 18 healthy subjects. Serum HDL2 (d: 1.063–1.125 g/ml) and HDL3 (d: 1.125–1.210 g/ml) subfractions were extracted from each subject using sequential ultracentrifugation. The capacity of HDL to efflux cellular cholesterol from lipid-loaded macrophages as well as to take up free cholesterol (FC) from triglyceride-rich lipoproteins (TGRLs) during lipolysis was assessed.

Results: No difference was found in the HDL2 and HDL3 content of free cholesterol and total protein among the groups. The NISR group showed lower triglyceride content in HDL2 and higher phospholipid content in HDL3 relative to healthy subjects. Strong positive correlations were found between the cholesterol efflux capacity (CEC) of HDL2 and its phospholipid content in the healthy ( r = 0.50), angiography-negative ( r = 0.55) and ISR ( r = 0.52) groups. The capacity of apolipoprotein B (apoB)-depleted serum to take up free cholesterol was not different among the groups.

Conclusions: Despite some compositional alterations, the capacity of HDL to efflux cholesterol from lipid-loaded macrophages as well as to take up free cholesterol from TGRLs during lipolysis was not associated with ISR in this study.

Key words: high-density lipoprotein, cholesterol efflux capacity, reverse remnant cholesterol transport, restenosis, coronary artery disease.

Corresponding authors: Amirhossein Sahebkar Department of Medical Biotechnology School of Medicine Mashhad University of Medical Sciences Mashhad, Iran P.O. Box: +91779-48564 Phone: +985138002288 Fax: +985138002287 E-mail: sahebkara@mums. ac.ir; amir_saheb2000@ yahoo.com

Anatol Kontush National Institute for Health and Medical Research (INSERM) Research Unit 1166 Faculty of Medicine Pitié–Salpêtrière Sorbonne University Paris, France E-mail: anatol.kontush@ sorbonne-universite.fr

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Introduction

Coronary artery disease (CAD) is a major cause of death worldwide [1]. Stent placement following percutaneous coronary intervention (PCI) is a typical treatment for chronic heart disease (CHD), while in-stent restenosis (ISR) after PCI is a major clinical problem occurring in these patients [2, 3]. The use of drug-eluting stents (DES) and drugs such as statins, antiplatelet agents, and calcium channel blockers has only been partially effective in reducing ISR in patients who have undergone stent implantation [2–4]. Since the number of such patients continues to increase, it is crucially important to distinguish patients who are at elevated risk of ISR. Furthermore, recognition of markers of ISR could be helpful for choosing a proper strategy in order to treat each patient [2].

Complex pathophysiological mechanisms including lipid deposition, dysfunction of endothelial, chronic vascular inflammation, and vascular smooth muscle cell proliferation causing intimal hyperplasia are involved in the progression of restenosis [5, 6]. The inverse association between the risk of restenosis following vascular intervention and high-density lipoprotein cholesterol (HDL-C) concentration, a pivotal cardiovascular disease (CVD) risk factor, has been reported [6, 7]. However, recent studies have indicated that HDL-C concentration alone is insufficient to correctly assess the risk of CVD [8–10]. Considering the complexity of HDL particles, alterations of their composition and function have been suggested to be more informative than HDL-C levels [11–13]. The principal anti-atherosclerotic effect of HDL is thought to be related to cellular cholesterol efflux through which accumulated cholesterol is transported to HDL or its major protein component, apolipoprotein (apo) A-I, from macrophages and arterial wall cells in an early step of reverse cholesterol transport (RCT) [6]. In addition, HDL, by virtue of cholesterol acquirement from atherogenic triglyceride-rich lipoprotein (TGRL) remnants upon their lipolysis, is involved in reverse remnant-cholesterol transport (RRT) and thereby linked to TG metabolism [10, 14].

There are limited data regarding the contribution of compositional changes and impaired function of HDL (such as its role in RCT and RRT pathways) in coronary ISR, and to our knowledge, the relationship between alterations of HDL composition and function with ISR has not previously been assessed in a case-control study. Therefore, this study was undertaken to explore the compositional characteristics of HDL as well as the capacity of HDL to efflux cholesterol from lipid-loaded macrophages and to take up free

cholesterol (FC) upon lipolysis of TGRL in patients with ISR.

Material and methods Study populations

This is a case-control study (December 2014 and April 2017), and 47 Iranian subjects (18–75 years old) were included with a history of coronary stent implantation at least 30 days earlier and thereafter due to chest pain or equivalent symptoms they were referred for re-angiography. According to the angiographic results, patients with more and less than 50% stenosis within the stent were divided into the in-stent restenosis (ISR; N = 21) and non-ISR (NISR; N = 26) groups, respectively. Furthermore, angiography-negative patients (N = 16), whose first angiographic results showed stenosis < 50%, and healthy subjects (N = 18) were considered as controls. The Ethics Committee of the Mashhad University of Medical Sciences gave approval of the study protocol and all participants provided written informed consent. Demographic data were collected from medical records. The exclusion criteria were positive troponin, autoimmune disease, restenosis occurring within one month after angioplasty due to thrombosis, chronic kidney disease or thrombophilia, and active cancer. A blood sample was collected in a tube with no anticoagulant just before starting the angiographic procedure. Serum was separated following centrifugation at a relative centrifugal force of 1000 (recommended by the manufacturer) for 20 min and then stored at –80°C prior to analysis.

Reagents

Phosphate-buffered saline (PBS, 10X, including KCl (10 g), KH2PO4 (10 g), Na2HPO4 × 2 H2O (71.7 g), NaCl (400 g) (VWR, France); TopFluor cholesterol (TopF) (Avanti Polar Lipids, USA); lipoprotein lipase (LPL) from Pseudomonas sp. (Sigma, France), phosphotungstic acid (Merck, VWR) , MgCl2 (VWR, France), deionized water, potassium bromide (KBr; 99+%, ACS reagent, Thermo Fisher Scientific, USA), D-(+)-Glucose (Sigma, France), bovine serum albumin (BSA; Merck, USA), ([1,2-3H(N)] (3H-cholesterol) (PerkinElmer, USA), RPMI 1640 (Sigma, France), PBS (Sigma. France), fetal bovine serum (FBS; Sigma. France), phorbol 12-myristate 13-acetate (PMA; Sigma, France).

Fasting blood glucose (FBG), triglycerides (TG), total cholesterol (TC), and HDL-C were analyzed by Pars Azmoon kits (Iran) on a BT-3000 auto-analyzer (Italy). Low-density lipoprotein cholesterol (LDL-C) was calculated using the Friedewald formula. TC, phospholipid (PL), FC, and TG were mea-

Shiva Ganjali, Elahe Mahdipour, Seyed Hamid Aghaee-Bakhtiari, Majid Ghayour-Mobarhan, Sara Saffar Soflaei, Maciej Banach, Anatol Kontush, Amirhossein Sahebkar

sured in HDL subfractions by microplate reader (DYNEX Technologies, USA).

Preparation of density solutions

For isolation and subfractionation of HDL density solutions (d: 1.006, 1.21, and 1.24 g/ml) were prepared. At first, a solution (A; d 1.006 g/ml) containing 8.76 g of NaCl in 1 l of water and a solution of NaCl/KBr (B; d 1.357 g/ml) containing 354 g KBr and 153 g of NaCl in 1 l of water were prepared, then, from these two, solutions of a desired density were prepared, according to the formula: dX = ((VA × dA) + (VB × dB))/(VA+ VB), where dX = desired density, dA = density of solution A, dB = density of solution B, VA = volume of solution A, VB = volume of solution B.

The densities of solutions were checked by measuring with a Digital Density Meter (DMA 45; Mettler/Paar, Austria) at 15°C [10, 15].

Isolation of HDL subfractions

Two subfractions of HDL (HDL2 (d: 1.063–1.125 g/ml) and HDL3 (d: 1.125–1.210 g/ml)) were isolated by sequential ultracentrifugation from 800 μl of serum [10, 16]. Separation was achieved after a three-step ultracentrifugation using a TLA120 rotor at 120,000 rpm in an Optima MAX-TL ultracentrifuge (Beckman Coulter, USA) at 15°C, with two NaCl/KBr solutions (d: 1.21 g/ml and 1.24 g/ ml). First, by adjusting the serum density to 1.063 g/ml with 260 ml of a d = 1.24 g/ml solution, very low-density lipoproteins (VLDL), intermediate density lipoproteins (IDL) and LDL were separated after 3 h. Then, the density of the bottom fraction containing HDL was adjusted to 1.125 g/ml with 270 ml of a d: 1.24 g/ml solution, and HDL2 was collected from the top after 4 h ultracentrifugation. In the final step, by adjusting the bottom density to 1.21 g/ml with 240 ml of the d: 1.24 g/ml and 200 ml of d: 1.21 g/ml solutions, HDL3 was collected from the top after 5 h ultracentrifugation.

Thereafter, HDL subfractions (HDL2 and HDL3) were largely dialyzed in PBS 1X (pH: 7.4) using SERVAPOR dialysis tubing (MWCO 12000–14000 RC, 6 mm, Germany) in the dark at 4°C.

Compositional analysis of HDL subfractions

HDL2 and HDL3 subfractions were assessed for the quantity of main HDL lipid ingredients, such as PL, TC, TG, and FC, via commercially enzymatic colorimetric kits (Diasys, France). Cholesteryl ester (CE) content was computed by multiplying the difference between TC and FC by 1.67 (15). Total protein (TP) was quantified in subfractions of HDL via the bicinchoninic acid (BCA) assay. Total lipoprotein mass was calculated as the sum of PL, TG, FC, CE, and TP.

Cholesterol efflux assay

The capacity of HDL subfractions in cellular cholesterol efflux (CEC) was evaluated in a human THP-1 monocytic cell system (ATCC) at 30 μg HDL protein/ml according to the Rached et al. protocol [17]. Briefly, cells were cultured on 24-well plates (Perkin Elmer, USA) in RPMI 1640 media with FBS (10%) and 50 ng/ml of PMA for differentiation of monocytes to macrophage-like cells. After 48 h of incubation, the cells were loaded with [3H] cholesterol-labeled acetylated LDL (1 μCi/ml) in RGGB media containing serum-free RPMI 1640, 2 mM glutamine, 50 mM glucose, 0.2% BSA, and 100 μg/ml antibiotic for 24 h for equilibration of cell cholesterol pools. The efflux of cellular cholesterol to subfractions of HDL was evaluated after 4 h incubation of cells in serum-free media. Finally, the CEC% was computed through the following calculation: CEC% = (Medium cpm/(medium cpm + cell cpm)) × 100.

Specific CEC% was characterized by subtracting nonspecific CEC% that occurs in the cells without cholesterol acceptors.

ApoB precipitation

Phosphotungstic acid/MgCl2 precipitation was used to remove apoB-containing lipoproteins from fasted serum for the cholesterol transfer assay. Phosphotungstic acid/MgCl2 (pH: 6.2; 5 μl) was added to serum samples (50 μl) at a ratio of 1 : 10 by volume, incubated for 10 min at room temperature (RT) and centrifuged at 13,000 rpm at 4°C for 30 min (5415 R, Eppendorf, USA) (10).

TopF transfer to HDL

For the evaluation of HDL capacity to take up FC through LPL-mediated TGRL lipolysis, TGRLs (d < 1.019 g/ml) were obtained from a reference healthy normolipidemic subject with a single-step ultracentrifugation (40,000 rpm, 24 h, 15°C) and dialyzed against PBS (pH: 7.4) using a SERVAPOR dialysis tube (MWCO 12000-14000 RC, 29 mm, Germany) at 4°C in the dark, and labelled with TopFluor cholesterol (TopF). For labelling, lipoprotein-deficient plasma (LPDP) was added to the TGRL at a 1/100 ratio (LPDP/TGRL) by volume and thereafter was filtered using a 0.8 μm filter and a chloroformic solution of TopF was added at a TopF/TGRL PL ratio of 1/13 by mass; the mixture was incubated overnight at 37°C under gentle stirring. Then unbound fluorescent lipid was separated from labelled TGRL by filtration through a PD10 Sephadex column (GE Healthcare, Sephadex G-25M, USA). Purified labelled TGRL was assessed for TG concentration by photometry, and, to verify the labelling, TopF fluorescence was recorded at 500/525 nm (Ex/Em) using a microplate read-

Compositional and functional properties of high-density lipoproteins in relation to coronary in-stent restenosis

er (Gemini, Molecular Devices, USA). To evaluate the TopF transfer, 30 mg TG/dl of TopF-labelled TGRL, Tris buffer (0.4 M) (pH: 8), final dilution of HDL (as apoB-depleted serum) 30-fold v/v, and LPL (7600 U/l) was mixed on ice and in order to start lipolysis incubated at 37°C. After 2 h, the reaction mixture was placed on ice and an apoB precipitant reagent (phosphotungstic acid/MgCl2) was added and the mixture incubated for 10 min at RT, followed by centrifugation at 4°C for 10 min at a maximal speed (5415 R, Eppendorf). At the end, the extracted supernatant containing HDL was filtered (0.45 μm) and transferred to a black microplate (Corning, USA) to read the fluorescence. The fluorescence measured in HDL was represented as a percentage of fluorescence in the standard sample containing TGRL (30 mg TG/dl), Tris buffer, and PBS alone.

In addition, all values were normalized to that detected in the reference serum obtained from the healthy normolipidemic control subjects [10].

Statistical analysis

For statistical analysis, SPSS software, version 11.5 (Chicago, IL, USA) was used. P-values less than 0.05 were considered statistically significant. Normal distributed variables are shown as mean ± SE and differences in variables were evaluated by one-way analysis of variance (ANOVA) tests across 4 groups (healthy, angiography-negative, NISR and ISR) or a  t-test for independent samples between 2 groups (ISR and NISR). Categorical variables are presented as percentages and between-group differences in variables were evaluated by a  c2 analysis or Fisher’s exact test.

The association of CEC with HDL composition was evaluated using Pearson’s correlation coefficients. Binary logistic regression was used to estimate the association between CEC and TopF transfer to HDL with ISR after adjustment for age, sex, DM, dyslipidemia, hypertension (HTN), stent type, hs-CRP, use of statins, aspirin and clopidogrel.

Results

Baseline characteristics and patient disposition

Of the total of 81 unrelated Iranian participants, 21, 26, 16, and 18 were categorized into ISR, NISR, angiography-negative, and healthy groups, respectively (Table I). The healthy group included younger subjects than the ISR and NISR groups. The number of diabetic, dyslipidemic, and hypertensive patients revealed significant differences between the groups. Moreover, the groups were significantly different in terms of medications used such as diabetic drugs, statin, aspirin and clopidogrel. In addition, TC, HDL-C, and LDL-C were significantly higher in healthy subjects than in other groups. TG

concentration was higher in the ISR group than in the angiography-negative group. Furthermore, FBS level was higher in the ISR group compared with the healthy and angiography-negative groups (Table I). Finally, the percentage of patients who had DES was significantly greater in the NISR group in comparison with the ISR group (Table II).

Compositional characterization of HDL subfractions

There were no differences in the content of FC and TP, either in HDL2 or in HDL3, among the studied groups. However, the HDL2 subfraction revealed TG enrichment in healthy subjects compared to NISR and angiography-negative patients, while its PL content was lower in the healthy group compared to ISR, NISR and angiography-negative patients. Moreover, high CE content was observed in HDL2 of healthy subjects when compared to the ISR and NISR groups (Figure 1). In addition, TG enrichment was also observed in HDL3 of healthy individuals when compared to NISR and angiography-negative patients, and the PL content of the HDL3 subfraction was statistically significantly lower in the healthy group compared to the NISR group (Figure 1).

The PL/TP ratio in HDL2 was significantly lower in healthy subjects relative to the ISR and NISR groups, while the TC/TP ratio in HDL2 was significantly higher in healthy subjects relative to the ISR group (Table I).

Cellular cholesterol efflux to HDL subfractions

There were no differences in the capacity of HDL2 and HDL3 subfractions to efflux cellular cholesterol from lipid-loaded macrophages between the studied groups (Table III). However, when CEC was normalized to HDL-C levels, significantly higher CEC/HDL-C ratios were found for both HDL2 and HDL3 in the NISR group in comparison with healthy subjects. Moreover, significantly higher HDL2 CEC/HDL-C ratios were found in the ISR and angiography-negative groups in comparison with healthy subjects (Table III). In addition, subgroup analysis revealed that subjects with diabetes in the ISR group displayed a lower HDL2 CEC/HDL-C ratio compared to those in the NISR group (Figure 2 C). Moreover, individuals with age above 50 had a higher CEC/HDL-C ratio of HDL2 and HDL3 in the NISR group when compared with that in the healthy group (Figure 2 C).

Furthermore, significant positive correlations were detected between CEC of HDL2 and its PL content in the healthy (r = 0.50), angiography-negative (r = 0.55) and ISR (r = 0.52) groups (Figure 3) as well as in the whole study population (r = 0.48; Figure 4). Similarly, HDL2 CEC was correlated with

Shiva Ganjali, Elahe Mahdipour, Seyed Hamid Aghaee-Bakhtiari, Majid Ghayour-Mobarhan, Sara Saffar Soflaei, Maciej Banach, Anatol Kontush, Amirhossein Sahebkar

Compositional and functional properties of high-density lipoproteins in relation to coronary in-stent restenosis

Table I. Baseline characteristics of study groups

Variables ISR ( n = 21) NISR ( n = 26) Angiographynegative ( n = 16)

Sex %:

Healthy ( n = 18) P -value

Male 52.4 50.0 31.3 50.0 0.573 Female 47.6 50.0 68.8 50.0

Age [years] 59.5 ±2.6 60.4 ±2.1 54.1 ±2.8 48.5 ±2.1a,b 0.003

Height [cm] 161.5 ± 2.6 162.8 ± 2.0 158.3 ± 2.2 168.1 ± 2.2c 0.037*

Weight [kg] 69.9 ± 2.8 73.2 ± 3.5 66.7 ± 3.1 74.6 ± 2.7 0.341

BMI [kg/m2] 27.0 ± 0.9 27.5 ± 1.0 26.8 ± 1.0 26.5 ± 0.9 0.891

BMI %:

Normal 33.3 32.0 37.5 38.9 0.999

Overweight 38.9 44.0 37.5 38.9 Obese 27.8 24.0 25.0 22.2

Smoker % 5.9 23.1 14.3 22.2 0.489

Dyslipidemia % 71.4 46.2 37.5 0.0 < 0.001

DM % 61.9 46.2 12.5 0.0 < 0.001*

HTN % 71.4 65.4 50.0 0.0 < 0.001*

Drug consumption %:

Statin 100.0 88.0 56.3 0.0 < 0.001* Aspirin 90.5 84.0 68.8 11.1 < 0.001 Clopidogrel 68.4 92.0 12.5 0.0 < 0.001* Insulin 19.0 19.2 0.0 0 0.001*

Oral diabetic drugs 38.1 19.2 12.5 0

FBS [mg/dl] 155.6 ± 16.9 138.9 ± 15.7 98.2 ± 9.1a 90.4 ± 2.0a 0.003*

TC [mg/dl] 145.6 ± 7.9 124.4 ± 8.7 140.2 ± 6.9 190.7 ± 7.2a,b,c < 0.001

TG [mg/dl] 144.8 ± 21.2 97.3 ± 11.8 86.2 ± 8.6a 117.8 ± 13.5 0.042*

HDL-C [mg/dl] 36.6 ± 1.6 34.1 ± 2.2 38.3 ± 3.1 51.1 ± 3.0a,b,c < 0.001

LDL-C [mg/dl] 81.7 ± 6.7 70.8 ± 6.4 84.7 ± 5.9 116.0 ± 4.8a,b,c < 0.001*

SBP [mm Hg] 125.7 ± 3.6 121.8 ± 2.9 117.3 ± 3.6 114.4 ± 3.6 0.111 DBP [mm Hg] 78.1 ± 2.4 74.8 ± 1.6 73.3 ± 2.7 75.7 ± 2.1 0.482

HDL2:

PL/TP 0.70 ± 0.03 0.73 ± 0.03 0.70 ± 0.03 0.60 ± 0.02a,b 0.004

TC/TP 0.30 ± 0.02 0.40 ± 0.02 0.40 ± 0.02 0.40 ± 0.01a 0.011*

Total mass 95.6 ± 7.2 91.8 ± 6.3 101.4 ± 4.8 96.6 ± 7.2 0.794

HDL3:

PL/TP 0.50 ± 0.03 0.50 ± 0.02 0.50 ± 0.03 0.43 ± 0.02 0.084

TC/TP 0.20 ± 0.01 0.30 ± 0.01 0.30 ± 0.02 0.30 ± 0.02 0.325

Total mass 43.3 ± 2.9 46.0 ± 2.9 48.6 ± 3.8 45.3 ± 3.3 0.731

HDL2/HDL3 2.4 ± 0.3 2.1 ± 0.2 2.2 ± 0.2 2.3 ± 0.2 0.731

Data are expressed as mean ± SE or percentage; statistically significant (p < 0.05); ap < 0.05 in comparison with ISR; bp < 0.05 in comparison with NISR; cp < 0.05 in comparison with angiography-negative. SBP – systolic blood pressure, DBP – diastolic blood pressure.

its FC content in the NISR group (r = 0.5; Figure 3). A significant positive correlation of HDL3 CEC with its FC content was also observed in the ISR (r = 0.63) and NISR (r = 0.627) groups (Figure 3) as well as in the whole study population (r = 0.42; Figure 4). Similarly, HDL3 CEC was correlated with its TG content in the angiography-negative group

(r = 0.52; Figure 3). In addition, TP content of HDL2 and FC content of HDL3 showed negative and positive correlations with CEC, respectively, in the whole study population (Figure 4).

The results of binary logistic regression also failed to show any association of HDL2 and HDL3 CEC with the risk of ISR in this study (Table IV).

Table II. Clinical characteristics of ISR and NISR groups

Variables

Stent type %:

ISR ( n = 21) NISR ( n = 26) P -value

Bare 50.0 11.1 0.015*

Drug 50.0 88.9

Stent number %: 1 66.7 65.4 0.927 > 1 33.3 34.6

De novo stenosis % 57.1 60.9 0.802

Duration of stent implantation [months] 32.8 ± 5.9 22.4 ± 5.4 0.200

Ejection fraction (%) 46.2 ± 2.9 45.2 ± 2.5 0.806

Serum apoA-I [mg/dl] 125.3 ± 3.9 108.4 ± 7.2 0.057 hs-CRP [mg/l] 3.90 ± 0.80 4.62 ± 0.80 0.509

HDL2 CEC/apoA-I 0.030 ± 0.01 0.044 ± 0.01 0.054

HDL3 CEC/apoA-I 0.04 ± 0.01 0.05 ± 0.01 0.058 TopF transfer/apoA-I 0.80 ± 0.03 0.93 ± 0.10 0.136 Data are expressed as mean ± SE or percentage; statistically significant (p < 0.05). ApoA-I – apolipoprotein A-I, CEC – cholesterol efflux capacity, HDL – high-density lipoprotein, Hs-CRP – high-sensitivity C-reactive protein.

Table III. Comparison of CEC and TopF transfer to HDL between groups of study

Variables ISR ( n = 21) NISR ( n = 26) Angiographynegative ( n = 16)

Healthy ( n = 18) P -value

HDL2 CEC (%) 3.6 ± 0.3 4.5 ± 0.4 3.7 ± 0.4 3.4 ± 0.2 0.137 HDL3 CEC (%) 4.8 ± 0.4 5.2 ± 0.4 4.9 ± 0.3 4.3 ± 0.2 0.213

TopF transfer to HDL (%) 98.6 ± 3.4 99.6 ± 6.5 90.4 ± 3.8 93.9 ± 4.6 0.548

HDL2 CEC/HDL-C 0.10 ± 0.01 0.13 ± 0.01 0.10 ± 0.01 0.10 ± 0.01b 0.002*

HDL3 CEC/HDL-C 0.14 ± 0.01 0.20 ± 0.02 0.14 ± 0.01 0.10 ± 0.01a,b,c < 0.001*

TopF transfer/HDL-C 2.8 ± 0.12 3.1 ± 0.34 2.6 ± 0.2 1.9 ± 0.11a,b 0.003*

Data are expressed as mean ± SE; statistically significant (p < 0.05); asignificant in comparison with ISR; bsignificant in comparison with NISR; CEC – cholesterol efflux capacity, HDL-C – high-density lipoprotein cholesterol.

TopF transfer to HDL

No significant difference in the capacity of apoB-depleted serum to take up FC from TGRL upon LPL lipolysis was found among the studied

groups. However, when TopF transfer to HDL was normalized to HDL-C levels, significantly higher TopF transfer/HDL-C ratios were observed in the ISR and NISR groups in comparison with healthy subjects (Table III). In addition, subgroup analysis

Shiva Ganjali, Elahe Mahdipour, Seyed Hamid Aghaee-Bakhtiari, Majid Ghayour-Mobarhan, Sara Saffar Soflaei, Maciej Banach, Anatol Kontush, Amirhossein Sahebkar

A

r = –0.167, p = 0.495 r = 0.251, p = 0.315

6 5 4 3 2 1 9 8 7 6 5 4 3 2

10 12 14 16 18 20 22 24 26 28 CE%, HDL2 8

CEC%, HDL2 CEC%, HDL3

16 18 20 22 24 CE%, HDL3

10 12 14

r = –0.263, p = 0.277 r = –0.289, p = 0.245

36 38 40 42 44 46 48 50 52 TP%, HDL2 44 46 48 50 52 54 56 58 60 62 TP%, HDL3

6 5 4 3 2 1 9 8 7 6 5 4 3 2

CEC%, HDL2 CEC%, HDL3

r = 0.518, p < 0.05

35

r = 0.058, p = 0.819

30

25

20

6 5 4 3 2 1 9 8 7 6 5 4 3 2

40 PL%, HDL2 18 20 22 24 26 28 30 32 34 36 PL%, HDL3

15

CEC%, HDL2 CEC%, HDL3

r = –0.262, p = 0.278 r = –0.227, p = 0.364

8

6

4

2

0

6 5 4 3 2 1 9 8 7 6 5 4 3 2

CEC%, HDL2 CEC%, HDL3

r = –0.124, p = 0.614 r = 0.634, p < 0.01

6 5 4 3 2 1 9 8 7 6 5 4 3 2

Arch Med Sci 1, 1st January / 2023

7

6

5

4

3

8 TG%, HDL3

2

1

10 TG%, HDL2 0

1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 FC%, HDL2 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 FC%, HDL3

CEC%, HDL2 CEC%, HDL3

Figure 3. Correlations between CEC of HDL subfractions and composition of HDL2 and HDL3 in ISR ( A ), NISR ( B ), angiography-negative ( C ) and healthy groups ( D )

r = –0.307, p = 0.188

10 9 8 7 6 5 4 3 2

r = –0.009, p = 0.971

10 9 8 7 6 5 4 3 2

r = 0.216, p = 0.360

16 18 20 22 24 CE%, HDL3

10 12 14

8

40 42 44 46 48 50 52 54 56 58 60 TP%, HDL3

CEC%, HDL3

10 9 8 7 6 5 4 3 2

r = –0.073, p = 0.761

10 9 8 7 6 5 4 3 2

r = 0.627, p < 0.01

CEC%, HDL3

18 20 22 24 26 28 30 32 34 PL%, HDL3

CEC%, HDL3

10 9 8 7 6 5 4 3 2

CEC%, HDL3

6

5

4

3

7 TG%, HDL3

2

1

0

4

3

2

CEC%, HDL3 0

5 FC%, HDL3

1

Figure 3. Cont.

r = –0.348, p = 0.204

10 12 14 16 18 20 22 24 26 28 CE%, HDL3

r = 0.107, p = 0.704

7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0

r = 0.053, p = 0.852

7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0

r = 0.524, p < 0.05

CEC%, HDL3

40 42 44 46 48 50 52 54 56 58 60 TP%, HDL3

CEC%, HDL3

7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0

r = 0.151, p = 0.591

CEC%, HDL3

7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 CEC%, HDL3

7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0

30

28

26

24

32 PL%, HDL3

22

20

5

4

3

2

6 TG%, HDL3

1

0

CEC%, HDL3 0

0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 FC%, HDL3

Figure 3. Cont.

r = –0.087, p = 0.715

10 9 8 7 6 5 4 3 2

r = –0.138, p = 0.562

10 9 8 7 6 5 4 3 2

r = 0.236, p = 0.316

10 9 8 7 6 5 4 3 2

r = 0.105, p = 0.659

CEC%, HDL3

30

25

20

35 CE%, HDL3

15

10

r = 0.162, p = 0.496

CEC%, HDL3

10 9 8 7 6 5 4 3 2

CEC%, HDL3

10 9 8 7 6 5 4 3 2

CEC%, HDL3

60

55

50

65 TP%, HDL3

45

40

16 18 20 22 24 26 28 30 32 PL%, HDL3

6

5

4

3

7 TG%, HDL3

2

1

5

4

3

2

CEC%, HDL3 0

6 FC%, HDL3

1

Compositional and functional properties of high-density lipoproteins in relation to coronary in-stent restenosis

r = –0.107, p = 0.367

10 9 8 7 6 5 4 3 2

r = –0.113, p = 0.343

10 9 8 7 6 5 4 3 2

30

25

20

15

10

5

8

8

8

r = 0.167, p = 0.158

10 9 8 7 6 5 4 3 2

r = –0.055, p = 0.642

10 9 8 7 6 5 4 3 2

60

55

50

65 TP%, HDL3

45

40

CEC%, HDL3

8 10 9 8 7 6 5 4 3 2

16 18 20 22 24 26 28 30 32 34 36 PL%, HDL3

CEC%, HDL3

CEC%, HDL3

CEC%, HDL3

6

5

4

7 8 TG%, HDL3

2 3

1

0

5

4

3

2

35 40 CE%, HDL3 r = 0.415, p < 0.01

CEC%, HDL3 0

6 FC%, HDL3

1

Figure 4. Correlations between CEC of HDL subfractions and composition of HDL2 and HDL3 in the whole study population

Table IV. Binary logistic regression for CEC and TopF transfer to HDL in relation with ISR (Ref: NISR)

Variables

Unadjusted Adjusted# OR (95% CI) P -value OR (95% CI) P -value

HDL2 CEC (%) 0.70 (0.43–1.13) 0.138 0.268 (0.013–5.713) 0.399

HDL3 CEC (%) 0.83 (0.60–1.30) 0.372 0.567 (0.095–3.397) 0.535

TopF transfer to HDL (%) 1.00 (0.97–1.03) 0.894 1.094 (0.953–1.255) 0.201

#Adjusted for age, sex, DM, dyslipidemia, HTN, stent type, hs-CRP, use of statin, aspirin and clopidogrel.

revealed that diabetes, dyslipidemia, HTN, and age > 50 did not influence either TopF transfer to HDL or TopF transfer/HDL-C ratio in the studied groups (Figure 2).

The results of binary logistic regression failed to show any association of TopF transfer to HDL with the risk of ISR in this study (Table IV).

Discussion

HDL as a protein-lipid particle has been traditionally characterized by its cholesterol concentration (HDL-C). However, the inverse association between HDL-C and CV events has been questioned by the observation of a U-shaped association in large epidemiological studies [18–21]. Hence, the use of more precise indices of HDL composition and function has been proposed [22]

In this case-control study, the compositional and functional alterations of HDL in patients with ISR were investigated for the first time. The results illustrated that both patients with ISR and the NISR group displayed some compositional alterations of both HDL2 and HDL3, including lower CE and higher PL content in HDL2 as well as lower TG content in HDL3 in comparison to healthy subjects. Moreover, the NISR group showed lower TG content of HDL2 and higher PL content of HDL3 relative to healthy subjects. A strong positive correlation between HDL2, PL% and CEC was found in the studied groups. Nevertheless, despite the increased PL% of HDL2 in ISR and NISR patients, the capacity of HDL2 to efflux cellular cholesterol from lipid-loaded macrophages was not statistically significantly different between the studied groups. Although a strong inverse association of CEC with the risk of incident CVD was reported previously [23, 24], one study reported that in a cohort of generally healthy men, CEC ability to predict CHD may not be independent of HDL-C [25], and it was found that low HDL-C (< 40 mg/dl) was related to dysfunctional HDL particles [26]. Furthermore, in patients with very high HDL-C, transport of cholesterol through the RCT pathway is unlikely to be impaired [14]. Therefore, CEC was normalized with HDL-C level (CEC/HDL-C ratio) and it was observed that the HDL2, CEC/HDL-C and HDL3 CEC/ HDL-C ratios were significantly greater in the NISR group in comparison with healthy subjects and

there were significantly higher HDL2 CEC/HDL-C ratios in the ISR and angiography-negative groups in comparison with healthy subjects, which might reflect elevated levels of HDL-C in healthy subjects, or increased CEC in the ISR, NISR and angiography-negative groups. Li et al. also found an association between raised CEC and elevated CVD over follow-up (3 years) even after adjustment for multiple parameters, including HDL-C levels [27]. In prospective longitudinal studies in relatively healthy subjects, samples were provided prior to the CHD event and HDL values might be more functional than those obtained in cross-sectional studies, but lipid profile alterations and plaque development could influence CEC over time in longitudinal studies [25]. Hence, reverse causation can occur in cross-sectional studies. Indeed, a cross-sectional study illustrated an inverse association of HDL CEC with prevalent carotid intima-media thickness [9].

Diabetes, dyslipidemia, and hypertension are three major CVD risk factors. In this regard, subpopulation analysis revealed that individuals with diabetes in the ISR group featured a notably lower HDL2 CEC/HDL-C ratio compared to those in the NISR group. In addition, diminished HDL2 CEC/HDL-C and HDL3 CEC/HDL-C ratios were also found in healthy subjects aged over 50 relative to those in the NISR group. Posadas-Sánchez et al. reported that dyslipidemic subjects are characterized by decreased CEC in statin-treated male coronary patients [26]).

Although efflux of cholesterol from macrophages, a key step of RCT, is considered as a primary function of HDL, other functions may also play a part in cardioprotection [28]. The capacity of HDL to take up FC from TGRLs upon lipolysis in the RRT pathway is another function of HDL that was proposed to describe the U-shape relationship between HDL-C and CVD and to predict CVD better than HDL-C [10, 14]. In this study, the rate of transfer of FC to HDL from TGRLs upon lipolysis was not statistically significantly different among the studied groups. After normalization of TopF transfer to HDL-C levels, the TopF transfer/HDL-C ratio was significantly higher in both NISR and ISR groups in comparison with healthy subjects, probably reflecting the low HDL-C in the patients. FC-enriched HDL particles reportedly possess a re-

Shiva Ganjali, Elahe Mahdipour, Seyed Hamid Aghaee-Bakhtiari, Majid Ghayour-Mobarhan, Sara Saffar Soflaei, Maciej Banach, Anatol Kontush, Amirhossein Sahebkar

duced capacity to acquire FC upon lipolysis of TGRLs [10, 29]. In this study, no difference was found in the FC content of HDL subfractions across the studied groups, which is consistent with the lack of differences in TopF transfer to HDL in the study. Moreover, both cholesteryl ester transfer protein and lecithin-cholesterol acyltransferase play important roles in cholesterol accumulation in HDL upon lipolysis [10, 30]; their activities were however not evaluated in this study.

The results of binary logistic regression failed to show any association of HDL2 and HDL3 CEC, as well as TopF transfer to HDL, with the risk of ISR in this study even after adjustment for CVD risk factors including sex, age, diabetes, hypertension, dyslipidemia, hs-CRP, and use of statin, aspirin and clopidogrel as well as stent type, which showed significant differences between ISR and NISR groups (Table IV). Cahill et al. similarly found that CEC could not predict CHD risk even after adjustment for HDL-C [25].

This study showed for the first time that the assessment of HDL function in combination with HDL-C levels and other important cardiovascular risk factors including diabetes, hypertension, and dyslipidemia could not predict ISR risk after stenting. This observation might be due to the small sample size in our study. In addition, restenosis in more than one stent and de novo stenosis in other vessels were not considered in this study. Finally, while CEC is an important index of HDL functionality, it remains unclear whether other indices of HDL function are associated with ISR risk.

In conclusion, the current study revealed that despite compositional alterations in HDL, HDL capacity to efflux cellular cholesterol from lipid-loaded macrophages, as well as to take up FC from TGRLs upon lipolysis, could not predict ISR risk in patients who experienced stent implantation. Nevertheless, further confirmation of these findings in future large-scale studies is warranted.

Acknowledgments

Anatol Kontush and Amirhossein Sahebkar equally contributed to this work.

This project was supported by the Mashhad University of Medical Sciences Research Council (Mashhad, Iran). We gratefully acknowledge support by a grant from the National Institute for Medical Research Development (NIMAD), Tehran, Iran (Grant no: 964334), as well as by INSERM (Paris, France) and Sorbonne University (Paris, France). The first author was also supported by the WaelAlmahmeed & IAS research training grant.

Conflict of interest

The authors declare no conflict of interest.

References

1. Bonow RO, Mann DL, Zipes DP, Libby P. Braunwald’s heart disease e-book: a textbook of cardiovascular medicine. Elsevier Health Sciences 2011.

2. Imaizumi S, Miura SI, Takata K, et al. Association between cholesterol efflux capacity and coronary restenosis after successful stent implantation. Heart Vessels 2016; 31: 1257-65.

3. Liu J, Li M, Lu H, et al. Effects of probucol on restenosis after percutaneous coronary intervention: a systematic review and meta-analysis. PLoS One 2015; 10: e0124021.

4. Baktashian M, Soflaei SS, Kosari N, et al. Association of high level of Hs-CRP with in-stent restenosis: a case-control study. Cardiovasc Revasc Med 2019; 20: 583-7.

5. Welt FG, Rogers C. Inflammation and restenosis in the stent era. Arterioscler Thromb Vasc Biol 2002; 22: 1769-76.

6. Yin K, Agrawal DK. High-density lipoprotein: a novel target for antirestenosis therapy. Clin Transl Sci 2014; 7: 500-11.

7. Pantović S, Božović D, Nikolić G, et al. Markers of inflammation and antioxidant enzyme activities in restenosis following percutaneous coronary intervention. J Serbian Chem Soc 2015; 80: 143-57.

8. Cybulska B, Kłosiewicz-Latoszek L. The HDL paradox: what does it mean and how to manage low serum HDL cholesterol level? Kardiol Pol 2014; 72: 681-6.

9. Khera AV, Cuchel M, de la Llera-Moya M, et al. Cholesterol efflux capacity, high-density lipoprotein function, and atherosclerosis. N Engl J Med 2011; 364: 127-35.

10. Feng M, Darabi M, Tubeuf E, et al. Free cholesterol transfer to high-density lipoprotein (HDL) upon triglyceride lipolysis underlies the U-shape relationship between HDL-cholesterol and cardiovascular disease. Eur J Prev Cardiol 2020; 27: 1606-16.

11. Kontush A, Chapman MJ. High-density Lipoproteins: Structure, Metabolism, Function and Therapeutics. John Wiley & Sons 2011.

12. Bacchetti T, Ferretti G, Carbone F, et al. Dysfunctional high-density lipoprotein: the role of myeloperoxidase and paraoxonase-1. Curr Med Chem 2021; 28: 2842-50.

13. Ganjali S, Watts GF, Banach M, Reiner Ž, Nachtigal P, Sahebkar A. The Yin and Yang of high-density lipoprotein and atherosclerotic cardiovascular disease: focusing on functionality and cholesterol efflux to reframe the HDL hypothesis. Curr Med Chem 2021; 28: 6066-81.

14. Kontush A. HDL and reverse remnant-cholesterol transport (RRT): relevance to cardiovascular disease. Trends Mol Med 2020; 26: 1086-100.

15. McPherson PA, Young IS, McKibben B, McEneny J. High density lipoprotein subfractions: isolation, composition, and their duplicitous role in oxidation. J Lipid Res 2007; 48: 86-95.

16. Rosenson RS, Brewer Jr HB, Chapman MJ, et al. HDL measures, particle heterogeneity, proposed nomenclature, and relation to atherosclerotic cardiovascular events. Clin Chem 2011; 57: 392-410.

17. Rached F, Santos RD, Camont L, et al. Defective functionality of HDL particles in familial apoA-I deficiency: relevance of alterations in HDL lipidome and proteome. J Lipid Res 2014; 55: 2509-20.

18. Ko DT, Alter DA, Guo H, et al. High-density lipoprotein cholesterol and cause-specific mortality in individuals without previous cardiovascular conditions. J Am Coll Cardiol 2016; 68: 2073.

Compositional and functional properties of high-density lipoproteins in relation to coronary in-stent restenosis

19. Bowe B, Xie Y, Xian H, Balasubramanian S, Zayed MA, AlAly Z. High density lipoprotein cholesterol and the risk of all-cause mortality among US veterans. Clin J Am Soc Nephrol 2016; 11: 1784-93.

20. Madsen CM, Varbo A, Nordestgaard BG. Extreme high high-density lipoprotein cholesterol is paradoxically associated with high mortality in men and women: two prospective cohort studies. Eur Heart J 2017; 38: 2478-86.

21. Hirata A, Sugiyama D, Watanabe M, et al. Association of extremely high levels of high-density lipoprotein cholesterol with cardiovascular mortality in a pooled analysis of 9 cohort studies including 43,407 individuals: The EPOCH–JAPAN study. J Clin Lipidol 2018; 12: 674-84.e5.

22. Riggs KA, Rohatgi A. HDL and reverse cholesterol transport biomarkers. Methodist Debakey Cardiovasc J 2019; 15: 39-46.

23. Saleheen D, Scott R, Javad S, et al. Association of HDL cholesterol efflux capacity with incident coronary heart disease events: a prospective case-control study. Lancet Diabetes Endocrinol 2015; 3: 507-13.

24. Rohatgi A, Khera A, Berry JD, et al. HDL cholesterol efflux capacity and incident cardiovascular events. N Engl J Med 2014; 371: 2383-93.

25. Cahill LE, Sacks FM, Rimm EB, Jensen MK. Cholesterol efflux capacity, HDL cholesterol, and risk of coronary heart disease: a nested case-control study in men. J Lipid Res 2019; 60: 1457-64.

26. Posadas-Sánchez R, Posadas-Romero C, Mendoza-Pérez E, et al. Cholesterol efflux and metabolic abnormalities associated with low high-density-lipoprotein-cholesterol and high triglycerides in statin-treated coronary men with low-density lipoprotein-cholesterol <70 mg/ dl. Am J Cardiol 2012; 109: 636-41.

27. Li XM, Tang WH, Mosior MK, et al. Paradoxical association of enhanced cholesterol efflux with increased incident cardiovascular risks. Arterioscler Thromb Vasc Biol 2013; 33: 1696-705.

28. Rosenson RS, Brewer Jr HB, Davidson WS, et al. Cholesterol efflux and atheroprotection: advancing the concept of reverse cholesterol transport. Circulation 2012; 125: 1905-19.

29. Camont L, Lhomme M, Rached F, et al. Small, dense high-density lipoprotein-3 particles are enriched in negatively charged phospholipids: relevance to cellular cholesterol efflux, antioxidative, antithrombotic, anti-inflammatory, and antiapoptotic functionalities. Arterioscler Thromb Vasc Biol 2013; 33: 2715-23.

30. Schwartz CC, VandenBroek JM, Cooper PS. Lipoprotein cholesteryl ester production, transfer, and output in vivo in humans. J Lipid Res 2004; 45: 1594-607.

Shiva Ganjali, Elahe Mahdipour, Seyed Hamid Aghaee-Bakhtiari, Majid Ghayour-Mobarhan, Sara Saffar Soflaei, Maciej Banach, Anatol Kontush, Amirhossein Sahebkar

Peter Ezer1, Nelli Farkas2, István Szokodi1,3, Attila Kónyi1

1Heart Institute, University of Pécs, Medical School, Foreign Medical Sciences, Hungary

2Bioanalytical Institute, University of Pécs, Medical School, Pecs, Hungary

3Szentagothai Research Centre, University of Pécs, Pecs, Hungary

Submitted: 11 September 2020; Accepted: 26 December 2020

Online publication: 25 March 2021

Arch Med Sci 2023; 19 (1): 73–85

DOI: https://doi.org/10.5114/aoms/131958

Copyright © 2021 Termedia & Banach

Abstract

Introduction: The impact of remote monitoring (RM) on clinical outcomes in heart failure (HF) patients with cardiac resynchronisation therapy-defibrillator (CRT-D) implantation is controversial. This study sought to evaluate the performance of an RM follow-up protocol using modified criteria of the PARTNERS HF trial in comparison with a conventional follow-up scheme.

Material and methods: We compared cardiovascular (CV) mortality (primary endpoint) and hospitalisation events for decompensated HF, and the number of ambulatory in-office visits (secondary endpoint) in CRT-D implanted patients with automatic RM utilising daily transmissions (RM group, n = 45) and conventional follow-up (CFU group, n = 43) in a single-centre observational study.

Results: After a median follow-up of 25 months, a significant advantage was seen in the RM group in terms of CV mortality (1 vs. 6 death event, p = 0.04), although RM follow-up was not an independent predictor for CV mortality (HR = 0.882; 95% CI: 0.25–3.09; p = 0.845). Patient CV mortality was independently influenced by hospitalisation events for decompensated HF (HR = 3.24; 95% CI: 8–84; p = 0.022) during follow-up. We observed significantly fewer hospitalisation events for decompensated HF (8 vs. 29 events, p = 0.046) in the RM group. Furthermore, a decreased number of total (161 vs. 263, p < 0.01) and unnecessary ambulatory in-office visits (6 vs. 19, p = 0.012) were seen in the RM group as compared to the CFU group. Conclusions: Follow-up of CRT-D patients using automatic RM with daily transmissions based on modified PARTNERS HF criteria enabled more effective ambulatory interventions leading indirectly to improved CV survival. Moreover, RM directly decreased the number of HF hospitalizations and ambulatory follow-up burden compared to CRT-D patients with conventional follow-up.

Key words: survival, follow-up, heart failure, cardiac resynchronisation therapy, remote monitoring.

Introduction

Cardiac resynchronisation therapy (CRT) provides an evidence-level treatment manner in a well selected subgroup of patients with advanced systolic heart failure and functional dyssynchrony. Cardiac resynchronisa-

Corresponding author: Kónyi Attila Heart Institute University of Pécs Medical School 13 Ifjusag St 7602, Pécs, Hungary E-mail: konyi.attila@pte.hu

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Automatic daily remote monitoring in heart failure patients implanted with a cardiac resynchronisation therapy-defibrillator: a single-centre observational pilot study

tion therapy is a proven method to reduce symptoms, morbidity (hospitalisations), and mortality in heart failure patients responding or super-responding to therapy [1, 2]. Remote monitoring of patients with cardiac implantable devices (CIED) in heart failure has an established recommendation according to the currently available heart failure guidelines of the European Society of Cardiology (ESC) [3]. Cardiac resynchronisation therapy-defibrillators (CRT-D), capable of remote monitoring (RM) function, transmit numerous measurable patient- and device-related data on a predetermined time basis or even immediately if a critical event is observed by the implanted device. Detection alerts and transmission algorithms depend on the manufacturer of the system.

It has been shown that RM is a safe and reliable method in the follow-up of patients with advanced heart failure and implantable cardiac defibrillators (ICD) [4–8]. The detection times of major adverse clinical events such as arrhythmia events, silent atrial fibrillation, inappropriate ventricular shocks, and even device-related malfunction and impending heart failure events are significantly shorter than with conventional in-office follow-up [7–10].

The PARTNERS HF study investigated 694 CRT defibrillator patients with remote monitoring and continuous multi-parameter monitoring for heart failure. Monthly review of monitored parameters and patients with positive combined heart failure diagnostics of long-lasting atrial fibrillation and/or high ventricular rate, low biventricular pacing ratio, abnormal autonomic signs (elevated resting heart rate, low heart rate variability), decreased patient activity, and high thoracic fluid index had a 5.5-fold increase in the risk for heart failure hospitalisations within the subsequent month. Evaluation of heart failure device diagnostics more frequent than 1 week improved the ability to risk stratify patients for subsequent heart failure events [11].

Although previous result are well proven, the exact alerting thresholds for each detection parameter are still debated, and a novel heart failure detection algorithm and effective intervention are highly warranted to prevent worsening heart failure-related hospitalisation and death.

Remote monitored heart failure patients implanted with cardiac implantable devices (CIEDS) show contradicting outcome results regarding survival, hospitalisation, and institutional ambulatory burden in prospective randomised studies and meta-analyses [12–16].

Nevertheless, several trials proved an equivocal decrease in institutional ambulatory burden and cost effectiveness in the care of remote monitored patients [17–22].

In this study, we tested our institutional RM heart failure detection algorithm protocol using

adapted and refined PARTNERS HF criteria for an automated daily transmission enabling RM system (Biotronik Home Monitoring™). We assumed that refined RM detection criteria and early interventions aiming at prevention of decompensated heart failure events can decrease heart failure-related hospitalisations and increase survival compared to a conventional ‘ambulatory-only’followed patient group, without increasing hospital ambulatory burden or the number of unscheduled in-office patient evaluations in an RM-followed patient group of CRT-D-implanted patients.

Material and methods Study design

This investigation was a single-centre retrospective observational pilot study involving 2 parallel cohorts consisting of heart failure patients. All patients were implanted with Biotronik Iforia™ CRT-D devices from 2014 January to 2017 December in our university referral hospital. Patients received a de novo implanted CRT-D device in accordance with the current ESC guidelines for heart failure therapy [3]. All implanted CRT-D devices were eligible for remote monitoring. Cardiomessenger™ remote transmission devices were provided by the manufacturer, and the availability was not continuous during the implantation period. The opportunity for remote monitoring and device remote follow-up was offered to every patient before implantation if an RM eligible Iforia device and Cardiomessenger device were available at the same time. Remote transmission device availability was the main selection criterion, whether a patient was followed with remote monitoring or not.

Conventionally followed patients received an Iforia CRT-D device capable of RM function, as well. Only 1 of 44 patients in the conventionally followed (CFU) group refused remote monitoring follow-up; this patient was excluded from the study. The other 43 patients in the CFU group had no possibility to receive a remote transmission device at the time of implantation.

Patients were non-randomised is this study, but it should be noted that no significant differences were observed in the most important baseline characteristics between the 2 patient groups.

All patients signed a written informed consent form. All CRT-D devices and the automatic daily basis tele-monitoring system (Home Monitoring) were provided by Biotronik (Biotronik SE & Co., KG, Berlin, Germany). Biotronik devices with a Home Monitoring remote monitoring system were chosen for the retrospective analysis because the system provides daily transmission based automatic remote monitoring, and the specific device was

Peter Ezer, Nelli Farkas, István Szokodi, Attila Kónyi

the most available in our institute at the time of device implantations.

Follow-up data of 88 de novo CRT-D-implanted patients were collected and analysed. The remote monitored CRT-D-implanted patients (RM group, n = 45) were followed with automatic daily transmission-based continuous remote monitoring, and remote interrogation of the device was performed every 3 months. At least one scheduled yearly in-office follow-up visit was agreed with these patients. Alerts were received based on Home Monitoring’s intrinsic alert algorithm. Remote transmissions, including alerts, were observed daily by a competent nurse staff, and all the relevant transmissions were immediately forwarded to a device/heart failure specialist.

CRT-D-implanted patients with conventional follow-up (CFU group, n = 43) had a scheduled in-clinic ambulatory appointment every 3–6 months during follow-up, depending on the treating cardiologist/ device specialist. Table I presents the parameters that were assessed at remote interrogation and/or in-office ambulatory follow-up events.

Data regarding CV mortality, cardiovascular hospitalisations, institutional admissions for decompensated heart failure, ambulatory patient flow, baseline characteristics, medications, and comorbidities were collected from patient files, remote interrogations of the device, and from an integrated patient care information system of University of Pécs. Data collection was performed in accordance with international regulations regarding the protection of personal information and data. All subjects gave their informed consent for inclusion before they participated in the study. The study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by the Ethics Committee of the University of Pécs (6600/2020).

Study endpoints

The primary objective of this study was to compare the CV mortality of remote-monitored patients

with patients on a conventional follow-up scheme. Survival was assessed as the time from CRT-D implantation to a CV mortality event. Secondary endpoints were the number of cardiovascular hospitalisations, expressively the number of hospitalisations for decompensated heart failure. Further secondary endpoints were the total number of ambulatory visits, and the ratio of unnecessary ambulatory visits in each patient group during follow-up.

Novel detection algorithm for worsening heart failure in the remote monitoring group

Several parameters served as additional accessible information for the heart failure status of the patient in the RM group during follow-up. The PARTNERS HF prospective multi-centre observational study [11] published a combined heart failure device algorithm for predicting an upcoming heart failure event. The algorithm consisted of long atrial fibrillation duration (> 6 h/day for at least 1 day, without persistent AF), rapid ventricular rate (daily average above 90/min for at least 7 days), high thoracic fluid index (above 60 Ohms), low patient activity below 1 h/ day over 7 days, high nocturnal ventricular rate (> 85/min for 7 consecutive days), low heart rate variability (< 60 ms for 7 days), low biventricular pacing ratio (< 90% for 5 of 7 days), or at least 1 ventricular shock event. The algorithm was considered positive if a patient had 2 positive criteria during a 1-month period. Vamos et al. [23] investigated thoracic fluid index alerts in a prospective observational study and refined the PARTNERS HF algorithm to a modified version, increasing the algorithms specificity to 86.5% and sensitivity to 93.8% in predicting an upcoming heat failure event [24]. In our study, the automated daily continuous remote monitoring method allowed assessment of patient activity level, ventricular heart rate at rest, heart rate variability, intrathoracic impedance tendency, biventricular pacing ratio, and all

Table I. Parameters assessed at remote interrogation and in-office follow-up

Parameter type

Current rhythm diagnosis and pacemaker dependency Therapy given for sustained ventricular arrhythmia (anti-tachycardia pacing, ventricular shock)*

Mean ventricular heart rate* Biventricular pacing ratio*

Battery lifetime expectancy Inappropriate ventricular shock events*

Lead impedance/shock lead impedances

Pacing thresholds for different electrodes

Sensing signal amplitude threshold for different electrodes

All arrhythmia events (atrial arrhythmia burden, ventricular extrasystoles, and other arrhythmia events)*

*Parameters influencing heart failure status management.

Review of device-triggered alert events*

Patient activity level*

Heart rate variability*

Intrathoracic impedance status*

Automatic daily remote monitoring in heart failure patients implanted with a cardiac resynchronisation therapy-defibrillator: a single-centre observational pilot study

arrhythmia and anti-tachycardia therapy events. In the CFU group, these data were only available every 3–6 months at in-office follow-ups. Table II compares refined PARTNERS HF criteria and our institutional remote monitoring criteria for an upcoming decompensated heart failure event.

In our criteria system the major predictors for a heart failure event were sustained ventricular arrhythmia, ventricular appropriate or even inappropriate shock or anti-tachycardia pacing events, and new-onset atrial fibrillation burden exceeding 6 h for at least one day. Upon detection of even 1 major criterion, patients were called in for an unscheduled visit. Minor criteria were a decrease of thoracic impedance of at least 20% in the last 7 days, a decrease of biventricular pacing ratio below 90% in the last 7 days, a marked decrease (< 1 h a day) of patient activity level in the last 7 days, a marked decrease in heart rate variability (< 60 ms) in a week, or an increased resting ventricular heart rate for 7 days (> 90/min). If no major but at least 2 minor RM criteria for worsening heart failure state were positive at remote interrogation, an immediate direct telephone consultation was made with the patient and even minor symptoms associated with an impending cardio-circulatory decompensation were interrogated. If the patient’s symptoms were positive, an unscheduled urgent in-office visit was arranged. Unscheduled ambulatory visits had the aim for a pre-emptive medical- or device-mediated intervention, thus preventing patients from further deterioration and hospitalisation for decompensated heart failure. Our institutional criteria-protocol for screening remote monitored

patients with impeding status for decompensated heart failure is shown in Figure 1.

Ambulatory visit definitions

Patient flow at our institute was assessed with respect to all ambulatory visits in both patient groups, divided into scheduled, unscheduled necessary, and unscheduled unnecessary ambulatory visit events. Scheduled ambulatory visits were always in the form of a prearranged ambulatory appointment at least once a year in the RM group and every 3 to 6 months in the CFU group. Unscheduled ambulatory in-office visits only occurred in the RM group if at least 1 major RM criteria for heart failure or at least 2 minor criteria with even modest heart failure symptoms at patient interrogation occurred. These patients were urgently contacted, and a pre-emptive unscheduled ambulatory visit was arranged. Patients in the CFU group were checked at scheduled visits; unscheduled visits were only set up based on general physician referral, emergency physician referral, or severe patient complaints. Unscheduled ambulatory visits qualified as unnecessary inoffice visits were visit events where no CRT-D device programme modifications, no new cardiovascular drug administration or dose modification, and no subsequent therapy or cardiovascular hospitalisation were performed (Figure 1).

Statistical analysis

All follow-up variables were divided to categorical or continuous variables. Data are presented as mean ± standard deviation for normally dis-

Table II. Comparison of refined PARTNERS HF [22] and remote monitoring criteria for predicting decompensated heart failure events in our institute

Device parameter Refined PARTNERS HF criteria [22] Remote monitoring criteria for decompensated heart failure event

Thoracic fluid index alert Elevated thoracic fluid index (> 60 Ohm) > 20% decrease in thoracic impedance value for 7 days

New onset AF episode AF > 6 h on at least one day without persistent AF New onset AF at least 6 h a day without persistent AF

Ventricular rate during AF AF > 24 h and daily average ventricular rate during AF > 90/min Not used

Average daily ventricular heart rate Not used > 90/min for 7 consecutive days

Patient activity level Lower average activity in the past 5 days Lower average activity in the past 7 days

Nocturnal heart rate Average night rate > 85/min, or elevated with 20 over the past 5 days

Not used

Heart rate variability < 60 ms every day for 1 week < 60 ms every day for 1 week

Biventricular pacing ratio < 90% in the past 5 days < 90% in the past 7 days

Ventricular arrhythmias

AF – atrial fibrillation.

Ventricular shock or anti-tachycardia pacing events

Ventricular shock, anti-tachycardia pacing events, or sustained ventricular arrhythmias without therapy

Peter Ezer, Nelli Farkas, István Szokodi, Attila Kónyi

tributed continuous variables, median (25th and 75th percentiles) for non-normally distributed variables, or percentages for binary variables. Missing data were not replaced; all available data were used for sample distribution evaluation. Normality was checked with the Kolmogorov-Smirnov test. For normally distributed data Student’s t-test was used. The Mann-Whitney test was used for inter-individual comparisons of continuous variables when normality was rejected. Categorical variables were compared with the c2 or Fisher’s exact test. For cardiovascular survival analysis we applied Kaplan-Meier survival curve estimation with log rank test and Cox’s regression with forward selection. Statistical analysis was performed using IBM SPSS statistical software version 25.0. (Armonk, NY, IBM Corp.). Post hoc power analysis was performed for the primary endpoint outcome (cardiovascular mortality) based on Kaplan-Meier survival analysis using Stata version 15 (StataCorp. 2017. Stata Statistical Software: Release 15. College, TX: StataCorp LLC.). The level of significancy was defined as p < 0.05.

Results

Patient populations

Total of 88 CRT-D recipients were included in the study. Patient baseline characteristics are summarised in Table III. Despite patients being non-randomised in this study, RM and CFU patient groups did not differ significantly in most baseline features. There were no significant differences regarding patient age (59.7 vs. 69.6; p = 0.2), female gender (12 vs. 7; p = 0.23), baseline left ventricular ejection fraction (29.49 vs. 30.27;

Early detection of decompensated heart failure

– Sustained ventricular arrhytmia event*

– Ventricular shock or antitachycardia pacing event*

– New onset atrial fibrillation burden at least 6 h a day*

– > 20% decrease in thoracic impedance in 14 days

– Decrease of biventricular pace ratio below 90% in 7 days

– Marked decrease in patient activity level (1 h over past 7 days)

– Marked decrease in heart rate variability in 7 days (< 60 ms)

– Increased average resting ventricular heart rate (> 90/ min for 7 days)

At least 2 predictors present

OR 1 major predictor*

Direct phone contact to the patient interrogation of complaints

p = 0.47), New York Heart Association (NYHA) functional class (2.82 vs. 2.88; p = 0.202), or number of patients with left bundle branch block (LBBB) morphology (42 vs. 40; p = 0.95) at the time of device implantation. The 2 patient populations showed no significant differences with respect to anamnestic cardiovascular comorbidities, number of ischaemic cardiomyopathies (25 vs. 25; p = 0.86), paroxysmal or permanent atrial fibrillations (11 vs. 11; p = 0.9), chronic obstructive pulmonary disease (9 vs. 9; p = 0.499), chronic kidney disease (CKD) stage 3 defined as glomerular filtration ratio (GFR) between 60 ml/min and 30 ml/min (2 vs. 3; p = 0.673). Patients with a GFR below 30 ml/min were not included in this study. No significant differences were seen at baseline cardiovascular medical regime except for higher statin usage in the RM group (23 vs. 13; p = 0.008), no difference in point of baseline heart failure medication like ACE inhibitor/angiotensin receptor inhibitor (37 vs. 37; p = 0.59), β receptor blocker (41 vs. 39; p = 1.0), mineralocorticoid receptor antagonist (31 vs. 24; p = 0.31), diuretics (40 vs. 39; p = 1.0), and amiodarone (14 vs. 9; p = 0.377) usage. Anticoagulant (20 vs. 26; p = 0.12) and antiplatelet agent usage (22 vs. 20; p = 0.991) were also comparable at baseline in the RM and CFU groups.

Improved cardiovascular survival and less hospitalisation for heart failure in the remote monitoring group

Significantly lower CV mortality was observed (1 vs. 6; p = 0.04) in the RM group during follow-up (Figure 2). The Kaplan-Meier estimate of 1-year CV mortality was 1.45% in the RM group and 6.92%

– Marked decrease in physical activity tolerance

– Shortness of breath on exertion/at rest

– Increased body weight (> 3 kg/week)

– Signs of circulatory congestion

Unscheduled in-office follow-up

At least 1 complaint present OR major predictor present

Necessary visit:

– diuretic medication

– cardiovascular drug dose modification/administration

– CRT programme modification

– subsequent hospitalisation

Unnecessary visit:

– no new cardiovascular drug administration or dose modification

– no CRT programme modification

– no subsequent hospitalisation

Figure 1. Institutional remote monitoring protocol for early detection of decompensated heart failure in cardiac resynchronisation therapy-defibrillator-implanted heart failure patients. Major predictors for impeding heart failure event were marked as *. At least two minor criteria positivity resulted in direct patient contact

Automatic daily remote monitoring in heart failure patients implanted with a cardiac resynchronisation therapy-defibrillator: a single-centre observational pilot study

Table III. Comparison of baseline patient characteristics

Characteristic

RM group ( n = 45) CFU group ( n = 43) P -value

Age [years], mean (SD) 59.7 (10.6) 62.6 (10.5) 0.200

Female, n (%) 12 (26.7) 7 (16.3) 0.230

Left ventricular ejection fraction (%), mean (SD) 29.49 (5.1) 30.27 (4.4) 0.471

NYHA class, mean (SD): 2.82 (0.71) 2.88 (1.41) 0.202 II, n (%) 15 (33.3) 9 (20.9) III, n (%) 23 (51.1) 30 (69.8)

IV, n (%) 7 (15.6) 4 (9.3)

Left bundle branch block, n (%) 42 (93.3) 40 (93.0) 0.950

Ischemic aetiology, n (%) 25 (55.5) 25 (58.1) 0.860

Hypertension, n (%) 35 (77.8) 35 (81.4) 0.674

Diabetes, n (%) 17 (37.8) 13 (30.2) 0.821

Hyperlipidaemia, n (%) 11 (24.4) 8 (18.6) 0.543

COPD, n (%) 6 (13.3) 8 (18.6) 0.499

Chronic kidney disease, n (%) 2 (4.4) 3 (6.9) 0.673

Atrial fibrillation, n (%) 11 (24.4) 11 (25.6) 0.900

Medications at the time of implantation:

β -receptor blockers, n (%) 41 (91.1) 39 (90.7) 1.000 ACEi/ARB, n (%) 37 (82.2) 37 (86.0) 0.590 MRA, n (%) 31 (68.9) 24 (55.8) 0.310 Diuretics, n (%) 40 (88.9) 39 (90.7) 1.000 Amiodarone, n (%) 14 (31.1) 9 (20.9) 0.377

Anticoagulants, n (%) 20 (44.4) 26 (60.5) 0.120 Antiplatelet agent, n (%) 22 (48.9) 20 (46.5) 0.991 Statin, n (%) 27 (60.0) 13 (30.2) 0.008

NYHA class – New York Heart Association class, COPD – chronic obstructive pulmonary disease, ACEi – angiotensin-converting-enzyme inhibitor, ARB – angiotensin-receptor blocker, MRA – mineralocorticoid-receptor-antagonist.

in the CFU group. Notably, post hoc power analysis with a 2-sided a of 5% and a statistical power of 88% was obtained for CV survival outcome.

Potential parameters for predicting CV mortality were divided into 3 parameter subgroups. Relevant patient baseline characteristics, follow-up parameters, and medication factors were analysed for predicting CV mortality in our patient cohort. Cox-regression analysis showed that, among baseline characteristics, NYHA class (HR = 2.69; 95% CI: 0.01–7.17; p = 0.047) was an independent predictor. Among follow-up factors, only the occurrence of a hospitalisation event for decompensated heart failure (HR = 3.24; 95% CI: 1.19–8.84; p = 0.022) was a significant, independent predictor for CV mortality. Other clinically relevant factors like female sex, ischaemic heart

failure aetiology, baseline left ventricular ejection fraction, relevant cardiovascular comorbidities, ventricular shock events, unscheduled ambulatory visit events, baseline medical regime, or even remote monitoring follow-up method were not independent predictors of CV mortality in our patient cohorts (Figure 3).

Although cardiovascular hospitalisations (37 vs. 46; p = 0.076) or the number of in-hospital spent days did not differ significantly (245 vs. 346; p = 0.35), in terms of hospitalisation events for decompensated heart failure we noted a significant difference, with the RM group performing better (8 vs. 29; p = 0.046).

Echocardiographic control for evaluation of left ventricular function was reassessed 6–12 months after device implantation. No differences were

Peter Ezer, Nelli Farkas, István Szokodi, Attila Kónyi

seen in control of left ventricular ejection fraction between the 2 observed groups (33.1 vs. 32.2; p = 0.91) (Table IV).

Hospitalisation, arrhythmias, and defibrillator therapy

Institutional admissions for novel or high-ventricular rate atrial fibrillation treatment, cumulative ventricular arrhythmias/ventricular shocks, or general check-up prior to heart transplantation were registered in both groups. We noted a trend for higher count in the RM group in atrioventricular node ablation procedures and other device-related operative procedures: 4 pacing electrode change/repositioning and 4 pocket haematoma evacuations were performed in the RM group, whereas 2 pacing electrode change/repositioning and 1 pocket haematoma evacuation in the CFU group were performed (Figure 4).

Comparable results were seen between the 2 groups regarding incidence of ventricular arrhythmias (243 vs. 205; p = 0.067) or ICD therapeutic response to arrhythmia (anti-tachycardia pacing (114 vs. 81; p = 0.876), appropriate ventricular shocks (100 vs. 88; p = 0.23)) respectively; even the count of inappropriate ventricular shocks (11 vs. 13; p = 0.83) or patient number affected by inappropriate shocks (4 vs. 3; p = 0.74) did not differ markedly (Table IV).

Effectivity of institutional ambulatory care

During median 30 months of follow-up 38,521 daily remote transmissions were made, and 93% of remote transmissions were successful in the RM group. Detection algorithm positivity for major/minor predictors of an upcoming decompensated heart failure event were assessed weekly with the help of competent nursing staff and an onsite device/heart failure specialist.

Significant results were seen in connection with ambulatory patient flow. During a 2-year follow-up period, there were significantly fewer (as much as 39% lower) total ambulatory in-office visits (161 vs. 263; p < 0.01) in the RM group as compared to the CFU group. A numerically higher number was observable with respect to unscheduled ambulatory visit events in RM group (36 vs. 22; p = 0.167), but this difference was not statistically significant. The number of unscheduled unnecessary ambulatory visits was significantly lower in the RM group (6 vs. 19; p = 0.012). Figure 5 shows the improved efficacy of ambulatory patient flow in the remote monitoring group.

In the RM arm, of those 30 unscheduled necessary ambulatory visits, 27 in-office patient evaluations were arranged because of worsening heart failure alert positivity seen during remote trans-

Cumulative survival

Pts. at risk

Log rank: p = 0.04

Estimated survival time (mean (CI)): RM group: 23.75 (23.27–24.23) CFU group: 21.45 (19.54–23.37)

1.0 0.9 0.8 0.7 0.6 0.5 0.4 0 5 10 15 20 25

Time [months] CFU group RM group

RM 45 45 45 39 35 31 CFU 43 37 36 35 33 32

Figure 2. Kaplan-Meier estimation of cardiovascular mortality. Significantly better cardiovascular survival (1 vs. 6 cases; p = 0.04) was observed in the remote monitoring patient group after 25 months of investigation

RM group – remote monitoring group, CFU group –conventional follow-up group

missions using our institutional algorithm. Twenty of 27 patients required higher diuretic dose because of circulatory congestion and/or meaningful decrease in thoracic impedance value, but only 8 patients required hospitalisation for decompensated heart failure, severe dyspnoea, cardio-respiratory failure, or severe congestion signs.

Eighteen patients required further cardiovascular medication modification, and only 4 required significant CRT device program modifications in ambulatory settings.

Six patients had novel atrial fibrillation burden exceeding 6 h with rapid ventricular rate and low biventricular pacing ratio. All the 6 patients required hospitalisation, and 3 patients required further hospitalisation for atrioventricular node ablation procedure as a consequence of medically refractory high ventricular rate atrial fibrillation. All patients required hospitalisation with major ventricular sustained arrhythmia and > 1 inappropriate/appropriate ventricular shocks.

Discussion

This study sought to evaluate the impact of a novel remote monitoring heart failure detection algorithm, designed for an automated daily transmission-based remote monitoring system.

Our RM detection algorithm seems to show efficacy at improving advanced heart failure patient survival, decreasing heart failure-related hospitalisations and institutional ambulatory patient burden beneath more effective in-office patient care even in our pilot study with moderate patient cohorts.

Automatic daily remote monitoring in heart failure patients implanted with a cardiac resynchronisation therapy-defibrillator: a single-centre observational pilot study

Follow-up factors

OR 95% CI P-value

Remote monitoring 0.882 0.251–3.095 0.845

Successful ventricular shock 1.012 0.819–1.25 0.915

Inappropriate ventricular shock 0.340 0.029–3.985 0.39

Hospitalisation for heart failure 3.238 1.186–8.844 0.022

Unsceduled ambulatory visit 1.310 0.362–4.741 0.681

Baseline characteristics

OR 95% CI P-value

Age 0.932 0.645–1.234 0.985

Female sex 1.896 0.556–6.463 0.307

LVEF 1.035 0.926–1.157 0.543

Ischemic etiology 1.438 0.407–5.082 0.573

NYHA class 2.697 1.014–7.179 0.047

Hypertension 2.632 0.578–11.979 0.211

Diabetes mellitus 0.907 0.279–2.946 0.871

Dyslipidaemia 0.317 0.034–2.989 0.316

COPD 0.540 0.113–2.574 0.439

Chronic kidney disease 2.773 0.298–25.777 0.370

Medications OR 95% CI P-value

ACEi/ARB 1.909 0.23–15.868 0.549 BB 1.192 0.096–14.851 0.891

MRA 0.459 0.137–1.54 0.207

Amiodarone 0.243 0.03–1.934 0.181

Anticoagulant 2.921 0.829–10.30 0.095 Statin 0.853 0.285–2.559 0.777

Antiplatelet agent 2.683 0.727–9.901 0.138

0.010 0.100 1.000 10.000 0.100 1.000 10.000 0.010 0.100 1.000 10.000

Figure 3. Variable regression analysis for predictors of mortality in 3 parameter groups (follow-up parameters (A), baseline characteristics (B), medications (C)). Analysis for cardiovascular mortality predictors was performed in 3 different parameter groups (A, B, C). New York Heart Association class (p = 0.047) and hospitalisation event for decompensated heart failure (p = 0.022) were significant predictors of cardiovascular mortality in our patient cohorts LVEF – left ventricular ejection fraction, NYHA – New York Heart Association, COPD – chronic obstructive pulmonary disease, ACEi – angiotensin-converting-enzyme inhibitor, ARB – angiotensin-receptor-antagonist, BB – β-receptor blocker, MRA – mineralocorticoid-receptor-antagonist.

The daily data transmission-based algorithm seems important in improving patient outcomes, because tele-monitoring algorithms, typically with weekly data transmission (MORE CARE study), failed to prove the benefit of remote monitoring in heart failure patients [14].

Implant-based automatic daily multi-parameter tele-monitoring of CIED patients with heart failure (IN-TIME study) first showed survival benefit in the remote monitoring arm in a patient group consisting of dual-chamber ICD- or CRT-D-implanted patients. The RM system transmitted data on

Peter Ezer, Nelli Farkas, István Szokodi, Attila Kónyi

Table IV. Follow-up-related results

Characteristic

RM group ( n = 45) CFU group ( n = 43) P -value

Follow-up time [months], median (IQR) 30 (20-39) 24 (16-33) 0.06

Cardiovascular mortality, n (%) 1 (2.2) 6 (13.9) 0.04

Cardiovascular hospitalisation events, n 37 46 0.76 Days spent for cardiovascular hospitalisations, n 245 346 0.35

Hospitalisation events for decompensated heart failure, n 8 29 0.046

Total ambulatory visits, n 161 263 < 0.01

Unscheduled ambulatory visits, n 36 22 0.167

Unscheduled unnecessary ambulatory visits, n 6 19 0.012

Sustained ventricular arrhythmias, n 243 205 0.067

Anti-tachycardia pacing events, n 114 81 0.876

Appropriate, successful ventricular shocks, n 100 88 0.23

Inappropriate ventricular shocks, n 11 13 0.83

Patients with inappropriate ventricular shocks, n (%) 4 (8.8%) 3 (6.9%) 0.74

Biventricular pace ratio (%), mean (± SD) 98.9 (8.0) 98.7 (6.6) 0.93

Control left ventricular ejection fraction (%), mean (± SD) 33.1 (9.69) 32.2 (11.1) 0.91

daily basis; thus, the opportunity for closer heart failure status monitoring and management was given as compared to conventional care. The RM was associated with a 60% relative decrease in 1-year CV mortality in the IN-TIME trial; however, the RM group and the control group did not differ significantly for the number of hospital admissions for worsening heart failure [13].

Number of hospitalisation

30 25 20 15 10 5 0

Hospita- Hospita- Hospita- Atrio- CRT Managelisation lisation lisation ventri- device ment for for atrial for cular related for decom- fibrillat- cumulated node operative heart pensated ion ventri- ablation proce- transheart failure event cular proce- dure plantation arrhytmia/ dure shock event

Remote monitoring group 8 6 5 3 8 2

Conventional followed group 29 7 6 1 3 2

Figure 4. Distribution of cardiovascular hospitalisation events during follow-up. Higher number of hospitalisations for worsening heart failure is observable in the CFU group (8 vs. 29, p = 0.046). There were no significant differences regarding other cardiac or device-related hospitalisation events

In a recent meta-analysis by Klersy et al., RM follow-up failed to show a decrease in the total number of cardiovascular hospitalisations, but RM was associated with a reduction in total ambulatory visit count [15]. In another meta-analysis, Parthiban et al. demonstrated comparable allcause mortality, cardiovascular mortality, and hospitalisation outcomes in ICD patients with RM or

Number of ambulatory visit

300 250 200 150 100 50 0

Remote monitoring Conventional followed group group

Unscheduled unnecessary ambulatory visit 6 19

Unscheduled necessary ambulatory visit 30 3

Scheduled ambulatory visit 125 241

Figure 5. Ambulatory follow-up burden in the 2 patient cohorts. Ambulatory patient flow graph shows a total 39% (161 vs. 263) reduction of ambulatory admissions between the 2 patient groups (p < 0.01). A significantly lower (6 vs. 19; p = 0.012) number of unnecessary ambulatory patient admissions was also observed

Automatic daily remote monitoring in heart failure patients implanted with a cardiac resynchronisation therapy-defibrillator: a single-centre observational pilot study

conventional follow-up. However, a decrease in allcause mortality was observed in those trials using RM systems with daily data transmission [16].

The latest meta-analysis consisting of 3 large trials (TRUST, ECOST, IN-TIME) all with automated daily transmission-based remote monitoring in heart failure CIED patients showed a reduced composite endpoint of worsening heart failure hospitalisations and cardiovascular death; however, unscheduled in-office visit numbers were not lower in the RM-followed group [25]. None of the above-mentioned trials and meta-analyses reported improved cardiovascular patient survival, decreased hospitalisation rate for heart failure, or decreased institutional ambulatory burden with improved efficacy of the ambulatory care in the same remote-monitored advanced heart failure CIED patient population.

Nowadays, in spite of advanced multi-parameter RM techniques, evidence is still lacking regarding optimisation of early detection and fast intervention of CIED patients with higher risk of an impeding heart failure event, but previous literature has applicable data on several monitored parameters. Modern devices capable of measuring the patient’s intrathoracic fluid status accelerate the early detection of patients with impending decompensated heart failure status. Thoracic impedance value change is the most widely studied factor, but evidence is lacking regarding optimal intervention thresholds for different device manufacturers. Intrathoracic fluid status is measured continuously by the implanted device in the form of intrathoracic impedance. As intrathoracic fluid accumulates, the intrathoracic impedance value decreases [25–29]. Although the predictive value of this parameter is well established in the literature, a single heart failure parameter alone seems to be too weak in daily practice to enable early and effective clinical intervention. PARTNERS HF [11] and modified PARTNERS HF criteria [23] both use a multi-parameter monitoring algorithm with monthly review to define patients with higher risk for heart failure decompensation. In these studies, a decrease in thoracic impedance value defines a higher risk patient group for an upcoming heart failure event. Furthermore, additional lower patient activity level, increased nocturnal ventricular heart rate, and suboptimal biventricular pacing ratio seemed to be the best independent predictors for heart failure events in patients with elevated intrathoracic fluid status [23]. We adapted modified PARTNERS HF criteria to Biotronik CRT defibrillators capable of daily remote transmission and refined the prediction criteria based on well-documented previous literature and clinical experience.

Major predictors were sustained ventricular arrhythmia and ventricular shock events. More

than one ventricular arrhythmia and/or ventricular shock event independently and strongly affected patient survival of advanced systolic heart failure patients with ICD; thus, urgent unscheduled in-office patient evaluation seems substantial in this clinical situation [30, 31]. New-onset atrial fibrillation burden exceeding 6 h and higher ventricular rate are often the cause of lower biventricular pace ratio, functional worsening, and deterioration of heart failure status in CRT implanted patients [13].

Minor detection criteria prediction thresholds were optimised to have adequate sensitivity for the detection of impeding decompensation events. In the case of at least 2 minor criteria positivity and fast consultation and interrogation of even minor patient complaints seemed to improve the ability for pre-emptive adequate HF therapy in these patients. Minor criteria like elevated resting ventricular heart rate and sudden decrease in heart rate variability are important markers of autonomic response in advanced heart failure, and both parameters correlate with worse clinical outcomes, increased count of heart failure events, and cardiovascular death [32–34]. According to current guidelines for cardiac resynchronisation therapy, the biventricular pacing ratio of patients should be optimally as close to 100% as possible. Markedly decreased biventricular pacing ratio (e.g. < 80% for 48 h in IN-TIME study) was one of the main findings for an upcoming heart failure event in different trials [13, 23, 35].

It should be noted that besides well-defined parameter thresholds in the case of decreased patient activity, heart rate variability, and increased resting ventricular heart rate, it is almost impossible to define the exact intervention threshold, and a patient-individualised clinical decision should be proposed.

In our RM cohort, the remote monitoring followup method was not an independent predictor for patient cardiovascular mortality in our investigation; however can be assumed that the lower count of hospitalisation for decompensated heart failure observed in the RM group may directly and independently play an important role in lower cardiovascular mortality compared to conventionally followed patients.

Several national and international studies have dealt with the cost-effectiveness of remote monitoring. These studies revealed a significant reduction in costs for the health care system, primarily via the reduction in the costs of institutional ambulatory burden and in-office care services [18–22, 36]. As seen in the MORE CARE study [14], during a median 25-month follow-up, a clearly significant 41% decrease in expected ambulatory patient flow was observable at the health care institution, and the RM group had a significantly higher num-

Peter Ezer, Nelli Farkas, István Szokodi, Attila Kónyi

ber of unscheduled ambulatory in-office patient evaluations. In spite of the above findings, with the use of our remote monitoring detection algorithm a significant (nearly 39%) reduction in total ambulatory flow in the RM group was observed, and there was a numerically higher but not significantly increased number of unscheduled visits in the RM group (36 vs. 22; p = 0.167), but unscheduled in-office visits had a higher ratio of clinically necessary patient evaluations (30 vs. 3 events), mainly driven by pre-emptive medical and device-related ambulatory interventions preventing patients from further worsening of heart failure status and subsequent hospitalisation. These findings suggest that unscheduled unnecessary visits have been minimised during RM follow-up, and it is mostly due to higher sensitivity for clinically relevant events. These results let us conclude that there is an increased effectiveness of institutional ambulatory care in this patient group. Furthermore, this novel RM-based follow-up algorithm seems to have the ability to replace most routine ambulatory visits that would not require any intervention.

We should note that RM requires good patient adherence to follow-up and therapy. Improving adherence in this patient group is important to improve clinical outcomes and quality of life [37]. COVID-19 (corona virus disease 2019) accelerated the need for eligible heart failure patient monitoring systems for patients with or without a cardiac implanted device. Achieving appropriate social distancing during lockdowns but still the possibility for close heart failure monitoring became essential for these patients. Tele-monitoring and “virtual visit” events have gained in importance in the last months of the pandemic. Several HF management-guiding principles have been recommended from experts in the field recently [38, 39]. Remote monitoring-mediated follow-up became more prominent in the last few months, and it will potentially play a valuable role in the follow-up of advanced heart failure CIED patients in the near future.

There are some limitations to address in our pilot study. Our 2 patient cohorts were selected retrospectively from our single university institute centre in Hungary. Patient cohorts consisted of 45 vs. 43 patients, and further patient enrolment to increase the sample size and statistical power was limited. However, it should be emphasised that post hoc power analysis of the primary outcome revealed 88% power and for secondary endpoint outcome – 99% with a 5% value of a This investigation was a non-randomised observational study. Remote transmission device availability and patient’s decision for remote monitoring follow-up should be taken into consideration

when we assess outcomes. Allocation to the RM follow-up arm of the study could improve patient adherence to medication and health improvement targets. These factors might improve outcomes in the RM group, although the 2 selected patient groups did not differ significantly in the most important clinical baseline features.

In conclusion, a novel heart failure detection algorithm based on modified PARTNERS HF criteria adapted to automated, daily data transmission-based remote monitoring-mediated follow-up, early patient contact, and intervention before an impeding heart failure event seemed to be associated with a lower number of heart failure hospitalisations as well as decreased institutional in-office follow-up burden and more efficient ambulatory care.

In our pilot study, remote monitoring-mediated follow-up played a role in the improvement of cardiovascular mortality outcomes compared to conventionally followed CRT-D patients. Further randomised trials with major patient populations are needed to confirm the results observed in our study.

Acknowledgments

This research was funded by the National Research, Development, and Innovation Office of Hungary (NKFIH K120536).

Conflict of interest

The authors declare no conflict of interest.

References

1. Cleland CJ, Abraham WT, Linde C, et al. An individual patient meta-analysis of five randomized trials assessing the effects of cardiac resynchronization therapy on morbidity and mortality in patients with symptomatic heart failure. Eur Heart J 2013; 34: 3547-56.

2. Rickard J, Kumbhani DJ, Popovic Z, et al. Characterization of super-response to cardiac resynchronization therapy. Heart Rhythm 2010; 7: 885-9.

3. Ponikowski P, Voors AA, Anker SD, et al. 2016 ESC Guidelines for the diagnosis and treatment of acute and chronic heart failure: The Task Force for the diagnosis and treatment of acute and chronic heart failure of the European Society of Cardiology (ESC) developed with the special contribution of the Heart Failure Association (HFA) of the ESC. Eur Heart J 2016; 37: 2129-200.

4. Guédon-Moreau L, Lacroix D, Sadoul N, et al. A randomized study of remote follow-up of implantable cardioverter defibrillators: safety and efficacy report of the ECOST trial. Eur Heart J 2013; 34: 605-14.

5. Ammannaya G. Implantable cardioverter defibrillators –the past, present and future. Arch Med Sci Atheroscler Dis 2020; 5: 163-70.

6. Sack S, Wende CM, Nägele H, et al. Potential value of automated daily screening of cardiac resynchronization therapy defibrillator diagnostics for prediction of major cardiovascular events: results from Home-CARE

Automatic daily remote monitoring in heart failure patients implanted with a cardiac resynchronisation therapy-defibrillator: a single-centre observational pilot study

(Home Monitoring in Cardiac Resynchronization Therapy) study. Eur J Heart Fail 2011; 13: 1019-27.

7. Hernández-Madrid A, Lewalter T, Proclemer A, et al. Remote monitoring of cardiac implantable electronic devices in Europe: results of the European Heart Rhythm Association survey. Europace 2014; 16: 129-32.

8. Wetze U, Geller JC, Kautzner J, et al. Remote follow-up for ICD-therapy in patients meeting MADIT II criteria –the REFORM trial. Eur Heart J 2009; 6 (5 Suppl 1): 418.

9. Zanaboni P, Landolina M, Marzegalli M, et al. Cost-utility analysis of the EVOLVO study on remote monitoring for heart failure patients with implantable defibrillators: Randomized controlled trial. J Med Internet Res 2013; 15: e106.

10. Lazarus A. Remote, wireless, ambulatory monitoring of implantable pacemakers, cardioverter defibrillators, and cardiac resynchronization therapy systems: analysis of a worldwide database. Pacing Clin Electrophysiol 2007; 30 Suppl 1: S2-S12.

11. Whellan DJ, Ousdigian KT, Al-Khatib SM, et al.; PARTNERS Study Investigators. Combined heart failure device diagnostics identify patients at higher risk of subsequent heart failure hospitalizations. J Am Coll Cardiol 2010; 55: 1803-10.

12. Tajstra M, Sokal A, Gadula-Gacek E, et al. Remote Supervision to Decrease Hospitalization Rate (RESULT) study in patients with implanted cardioverter-defibrillator. Europace 2020; 22: 769-76.

13. Hindricks G, Taborsky M, Glikson M, et al. Implant-based multiparameter telemonitoring of patients with heart failure (IN-TIME): a randomized controlled trial. Lancet 2014; 384: 583-90.

14. Boriani G, Quesada A, Ricci RP, et al. Effects of remote monitoring on clinical outcomes and use of healthcare resources in heart failure patients with biventricular defibrillators: results of the MORE-CARE multicenter randomized controlled trial. Eur J Heart Fail 2017; 19: 416-25.

15. Klersy C, Boriani G, De Silvestri A, et al. Effect of telemonitoring of cardiac implantable electronic devices on healthcare utilization: a meta-analysis of randomized controlled trials in patients with heart failure. Eur J Heart Fail 2016; 18: 195-204.

16. Parthiban N, Esterman A, Mahajan R, et al. Remote monitoring of implantable cardioverter-defibrillators: a systematic review and meta-analysis of clinical outcomes. J Am Coll Cardiol 2015; 65: 2591-600.

17. Varma N, Epstein AE, Schweikert R, Michalski J, Love CJ. Role of automatic wireless remote monitoring immediately following ICD Implant: the Lumos-T Reduces Routine Office Device Follow-Up Study (TRUST) trial. J Cardiovasc Electrophysiol 2016; 27: 321-6.

18. Eisner CH, Sommer P, Piorkowski C, et al. A prospective multicenter comparison trial of home monitoring against regular follow-up in MADIT II patients: additional visits and cost impact. Comput Cardiol 2006; 33: 241-4.

19. Varma N, Michalski J, Epstein AE, Schweikert R. Automatic remote monitoring of implantable cardioverter-defibrillator lead and generator performance the lumos-T safely reduces routine office device follow-up (TRUST) Trial. Circ Arrhythmia Electrophysiol 2010; 3: 428-36.

20. Guiédon-Moreau L, Lacroix D, Sadoul N, et al. Costs of remote monitoring vs. ambulatory follow-ups of implanted cardioverter defibrillators in the randomized ECOST study. Europace 2014; 16: 1181-8.

21. Burri H, Sticherling C, Wright D, et al. Cost-consequence analysis of daily continuous remote monitoring of implantable cardiac defibrillator and resynchronization devices in the UK. Europace 2013; 15: 1601-8.

22. Boriani G, Auricchio A, Klersy C, et al. Healthcare personnel resource burden related to in-clinic follow-up of cardiovascular implantable electronic devices: a European Heart Rhythm Association and Eucomed joint survey. Europace 2011; 13: 1166-73.

23. Vamos M, Nyolczas N, Bari Zs, et al. Refined heart failure detection algorithm for improved clinical reliability of OptiVol alerts in CRT-D recipients. Cardiol J 2018; 25: 236-44.

24. Hindricks G, Varma N, Kacet S, et al. Daily remote monitoring of implantable cardioverter-defibrillators: insights from the pooled patient – level data from three randomized controlled trials (IN-TIME, ECOST, TRUST). Eur Heart J 2017; 38: 1749-55.

25. Sasaki S, Ishida Y, Kinjo T, et al. Telediagnosis of heart failure with continuous intrathoracic impedance monitoring by Medtronic CareLink Network: importance of the elevation pattern of OptiVol Fluid Index. J Arrhythmia 2013; 29: 347-52.

26. Bohm M, Drexler H, Oswald H, et al. Fluid status telemedicine alerts for heart failure: a randomized controlled trial. Eur Heart J 2016; 37: 3154-63.

27. Luthje L, Vollmann D, Seegers J, et al. A randomized study of remote monitoring and fluid monitoring for the management of patients with implanted cardiac arrhythmia devices. Europace 2015; 17: 1276-81.

28. Conraads VM, Tavazzi L, Santitini M, et al. Sensitivity, and positive predictive value of implantable intrathoracic impedance monitoring as predictor of heart failure hospitalizations: the SENSE-HF trial. Eur Heart J 2011; 32: 2266-73.

29. Heist EK, Herre JM, Binkley PF, et al. Analysis of different device-based intrathoracic impedance vectors for detection of heart failure status events (from the Detect Fluid Early from Intrathoracic Impedance Monitoring study). Am J Cardiol 2014; 114: 1249-56.

30. MacIntyre CJ, Sapp JL, Abdelwahab A, et al. The effect of shock burden on heart failure and mortality. CJC Open 2019; 1: 161-7.

31. Poole JE, Johnson GW, Hellkamp AS, et al. Prognostic importance of defibrillator shocks in patients with heart failure. N Engl J Med 2008; 359: 1009-17.

32. Fox K, Ford I, Steg PhG, et al. Relationship between ivabradine treatment and cardiovascular outcomes in patients with stable coronary artery disese and left ventricular systolic dysfunction with limiting angina: a subgroup anlysis of randomized controlled BEAUTIFUL trial. Eur Heart J 2009; 30: 2337-45.

33. Böhm M, Swedberg K, Komajda M, et al. Herat rate as risk factor in chronic heart failure (SHIFT): the association between heart rate and outcomes in a randomized placebo-controlled trial. Lancet 2010; 376: 866-94.

34. Adamson PB, Smith AL, Abraham WT, et al. Continuous autonomic assessment in patients with symptomatic heart failure: prognostic value of heart rate variability measured by an implanted cardiac resynchronization device. Circulation 2004; 110: 2389-94.

35. Hayes DL, Boehmer JP, Day JD, et al. Cardiac resynchronization therapy and the relationship of percent biventricular pacing to symptoms and survival. Heart Rhythm 2011; 8: 1469-75.

36. Landolina M, Perego GB, Lunati M, et al. Remote monitoring reduces healthcare use and improves quality of

Peter Ezer, Nelli Farkas, István Szokodi, Attila Kónyi

Automatic daily remote monitoring in heart failure patients implanted with a cardiac resynchronisation therapy-defibrillator: a single-centre observational pilot study

care in heart failure patients with implantable defibrillators: the evolution of management strategies of heart failure patients with implantable defibrillators (EVOLVO) study. Circulation 2012; 125: 2985-92.

37. Polikandrioti M, Koutelekos I, Panoutsopoulos G, et al. Hospitalized patients with heart failure: the impact of anxiety, fatigue, and therapy adherence on quality of life. Arch Med Sci Atheroscler Dis 2019; 4: 268-79.

38. Abraham WT, Fiuzat M, Psotka MA, O’Connor CM, et al. Heart failure collaborator statement on remote monitoring and social distancing in the landscape of the COVID-19. JACC Heart Fail 2020; 8: 692-4.

39. Cleland GF, Clark RA, Pellicori P, Inglis SC. Caring for people with heart failure and many other medical problems through and beyond the COVID-19 pandemic: the advantages of universal access to home telemonitoring. Eur J Heart Fail 2020; 22: 995-8.

Clinical research Oncology

Appraisal of lung cancer survival in patients with end-stage renal disease

Ming-Shian Lu1, Miao-Fen Chen2, Yao-Hsu Yang3, Chuan-Pin Lee3, Chien-Chao Lin1, Yuan-Hsi Tseng1, Ying-Huang Tsai4,5

1Division of Thoracic and Cardiovascular Surgery, Chang Gung Memorial Hospital, ChiaYi, Taiwan

2Department of Radiation Oncology, Chang Gung Memorial Hospital, Taiwan and Chang Gung University, College of Medicine, ChiaYi, Taiwan

3Center of Excellence for Chang Gung Research Datalink, Chang Gung Memorial Hospital, ChiaYi, Taiwan

4Division of Pulmonary and Critical Care Medicine, Chang Gung Memorial Hospital, ChiaYi, Taiwan

5Department of Respiratory Therapy, Chang Gung University, Taiwan

Submitted: 17 March 2019; Accepted: 4 July 2019 Online publication: 22 July 2019

Arch Med Sci 2023; 19 (1): 86–93

DOI: https://doi.org/10.5114/aoms.2019.86783

Copyright © 2019 Termedia & Banach

Abstract

Introduction: The survival outcome of lung cancer patients with end-stage renal disease has been poorly studied in the literature. In this study, we evaluated the effect of end-stage renal disease on lung cancer survival. Material and methods: A retrospective, multicenter, matched-cohort study of lung cancer patients with end-stage renal disease under renal replacement therapy (WITH-ESRD) and without end-stage renal disease (WITHOUT-ESRD) was performed. One WITH-ESRD patient was matched to four WITHOUT-ESRD patients.

Results: Baseline clinical characteristics did not differ statistically significantly after matching between the WITH-ESRD and WITHOUT-ESRD groups. WITH-ESRD included 133 patients and WITHOUT-ESRD included 532 patients. Kaplan-Meier survival analysis demonstrated no significant difference in median overall survival between WITH-ESRD patients and WITHOUT-ESRD patients (7.36 months versus 12.25 months, respectively, p = 0.133). Lung cancer WITH-ESRD patients receiving medical treatment had a median overall survival of 5.98 months (95% CI: 4.34–11.76) compared to 14.13 months (95% CI: 11.30–16.43) for WITHOUT-ESRD patients, p = 0.019. Although patients receiving surgical treatment compared to those receiving medical treatment had an improvement of survival by 46% (HR = 0.54, 95% CI: 0.19–1.53, p = 0.243), the difference did not reach statistical significance. Cox regression analysis revealed that male gender and stage IIIA-IV were independent factors associated with poor outcome for WITH-ESRD patients.

Conclusions: In our limited experience, the survival for lung cancer with ESRD is not inferior to lung cancer patients without ESRD. The reasons for poor survival for the WITH-ESRD medical treatment group and late diagnosis despite frequent medical visits merit further investigation.

Key words: lung cancer, survival, end-stage renal disease.

Introduction

Medical and technological progress has allowed for longer life expectancy. By 2030, there is a probability of more than 50% that female life ex-

Corresponding author: Ying-Huang Tsai Division of Pulmonary and Critical Care Medicine

Chang Gung Memorial Hospital ChiaYi, Taiwan E-mail: cs60632001@yahoo. com.tw

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

pectancy will break the 90 years barrier [1]. Longer life span implies an increasing incidence of chronic medical conditions such as cancer and chronic kidney disease. Renal replacement therapy, such as hemodialysis, has allowed a significant number of patients suffering from the most severe form of chronic kidney disease to live an acceptable life span. The risk for the development of malignancy in patients suffering from end-stage renal disease differs among different cancers; previous studies have reported an increased risk for developing urinary tract cancer, liver cancer, and breast cancer [2–4]. However, some authors have found a higher incidence of lung cancer [5], while others found no difference [6–8] or even a lower incidence of lung cancer in patients receiving dialysis [2, 9]. The literature regarding the clinical outcome of lung cancer with chronic kidney disease under renal replacement therapy (hemodialysis) is scarce [4, 10]. Possible reasons include the hesitant medical attitude toward these patients given their shortened life expectancy, the increased mortality related to cardiovascular conditions, and the problematic drug dosage adjustment or simply therapeutic abstention. Population-based survival analysis has demonstrated contradictory results for lung cancer with end-stage renal disease patients (WITHESRD) compared to lung cancer without end-stage renal disease patients (WITHOUT-ESRD) [4, 10].

This study aims to determine the clinical outcome of lung cancer with end-stage renal disease through a matched-control study.

Material and methods

The institutional review board of Chang Gung Memorial Hospital has approved this retrospective study. Using the Chang Gung Memorial Hospital Cancer Registry and Death registration (CGRD), all adult patients (older than 18 years) diagnosed with end-stage renal disease (International Classification of Diseases (ICD-9) code 585) and coexisting diagnosis of lung cancer (International Classification of Diseases (ICD-9) code 162) from January 2001 to December 2014 were included in this study. Lung cancer patients with coexisting end-stage renal disease were matched 1 : 4 to patients with lung cancer without end-stage renal disease based on age, gender, cancer histology, cancer stage, and treatment type. CGRD is a high-quality cancer registry and provides information regarding specific demographics, disease staging, histology type, and primary treatment details. The 7th edition of the TNM staging system for lung cancer served for lung cancer staging [11]. We excluded cases with an incomplete medical record or the absence of a pathology report reconfirmed by our in-house pathologist. Overall survival was determined from the day of pathol-

ogy confirmation until the last follow-up or at the end of 2015, whatever comes first. Patients lost to follow-up were contacted by telephone by the cancer center case manager, and those not reachable by telephone were presumed dead if withdrawn from the National Health Insurance. The National Health Insurance offers universal coverage to more than 99% of the Taiwanese population. Those patients excluded are usually from death, missing premium payments > 6 months, emigration or change of nationality. The Health Promotion Administration, Ministry of Health and Welfare, Taiwan, releases an annual death report of all cancer cases registered back to each cancer center for the status update.

Statistical analysis

We presented continuous data as the median plus standard deviation and categorical data as percentages. We used Pearson’s c2 test to compare categorical variables and the Mann-Whitney U test for continuous variables. We categorized continuous variables into a categorical variable using median values as the cut-off point. We divided the clinical stage into stage I–IIIA versus stage IIIB–IV, and treatment modality into supportive treatment, surgical treatment (excluding diagnostic/staging procedure) and medical treatment group. We used the Kaplan-Meier method for survival analysis (overall survival), and the difference in survival was calculated using the logrank test. Cox proportional hazard analysis was used to estimate the level of significance and the relative risks with 95% confidence interval. A p-value of less than 0.05 was considered significant. All the analysis was conducted using SAS statistical software (version 9.4; SAS Institute, Cary, NC, USA).

Results

Patient selection

After the exclusion of 1355 patients with a previous second malignancy and 37 patients with incomplete clinical data, we included 20854 lung cancer patients from the cancer registry. There were 20695 WITHOUT-ESRD patients and 159 WITH-ESRD patients. WITHOUT-ESRD patients matched WITH-ESRD patients in a 1-to-4 ratio based on age, gender, cancer histology type, cancer stage, and treatment type. Figure 1 shows the matching process.

Survival outcome of patients with lung cancer without and with end-stage renal disease

There was no statistically significant difference in baseline clinical characteristics after the

Appraisal of lung cancer survival in patients with end-stage renal disease

22,245 patients of lung, cancer in cancer registry data of CGRD, 2001–2014

Exclusion: – Previous malignancy history (n = 1, 355) – Missing data (n = 37)

20,854 patients with primary lung cancer

20,695 patients without ESRD 159 patients with ESRD

1 : 4 individual matching by age, gender, cancer histology, cancer stage, treatment type

matching process. Table I presents the clinical characteristics of the cohort. Survival analysis revealed no survival difference for WITH-ESRD and WITHOUT-ESRD patients (Figure 2). The median overall survival for WITH-ESRD patients was 7.36 months (95% CI: 5.19–11.10) compared to 12.25 months (95% CI: 10.81–14.65) for WITHOUT-ESRD patients, p = 0.133 (Table II). There was a marginal significant difference in survival by gender. The median survival for male WITH-ESRD patients was 6.31 months (95% CI: 3.71–8.51) compared to 11.56 months (95% CI: 8.77–14.19) for WITHOUT-ESRD patients, p = 0.059, while the difference was not significant for female patients. The median overall survival differed significantly for patients with advanced stage lung cancer and patients with medical treatment. For advanced stage lung cancer (stage IIIB/IV), the median overall survival for WITH-ESRD patients was 5.19 months (95% CI: 3.71–5.76) compared to 9.63 months (95% CI: 7.85–11.27) for WITHOUT-ESRD patients, p = 0.022. For the medical treatment group, the median overall survival for WITH-ESRD patients was 5.98 months (95% CI: 4.34–11.76) compared to 14.13 months (95% CI: 11.30–16.43) for WITHOUT-ESRD patients, p = 0.019. Table II presents the median survival according to different clinical characteristics.

Cox regression analysis revealed that male gender and stage IIIB–IV were independent factors associated with a poor outcome for WITH-ESRD patients (Table III). Although patients with surgical treatment compared to those with medical treatment had an improvement of survival by 46% (HR = 0.54, 95% CI: 0.19–1.53, p = 0.243), the difference did not reach statistical significance.

Discussion

Patients with cancer are usually older in general, with a higher prevalence of comorbidities, such as chronic kidney disease. The prevalence of chronic kidney disease is exceptionally high in the elderly, affecting > 40% of people over the age of 70 years [12]. According to the 2007–2010 National Health and Nutrition Examination Surveys, the prevalence of chronic kidney disease in the United States was 14% (48.3% at stage 3 and 4.7% at stage 4–5) [13]. The estimated prevalence of CKD in Taiwanese patients according to a recent report by Tsai et al. was 15.46% for CKD stage 1–5 and 9.06% for CKD stage 3–5 [14]. End-stage renal disease requiring hemodialysis is the most severe form of chronic kidney disease. The survival of ESRD patients has improved in the last few years, but has not kept pace with that seen in the general population [15]. Only 57% of hemodialysis patients remain alive at 3 years, according to the recent 2017 USRDS annual data report [16].

Taiwan presents with the highest incidence of treated ESRD in the world (476/million) [16]. High 5-year cumulative incidence of any cancer for ESRD patients (9.48%) suggests that patients with ESRD are at risk of developing cancer while receiving hemodialysis [3]. The interface of lung cancer in end-stage renal disease is contradictory in the literature. Population-based studies from Asia for patients receiving chronic dialysis have demonstrated that the risk for developing lung cancer is not increased or even lower [2, 8, 9, 17]; however, reports from western countries have found higher risk for developing lung cancer [3, 5]. A meta-analysis performed by Shang et al. [18] demonstrated no higher risk of developing lung cancer risk among patients receiving dialysis with a pooled standardized incidence ratio of 0.98 (95% CI: 0.77–1.24). Ethnic differences in cancer risk could be attributed to genetic differences [17]. In Singapore, the highest smoking prevalence is observed in Malay males, but they present with a lower age-standardized lung cancer rate compared to Chinese males [17]. The differences of deletion rate of the enzyme cytochrome P450 2A6 (CYP2A6), an enzyme involved in the metabolism of tobacco carcinogens, is high among Malays (35.2%) followed by Chinese (18.3%) and Indians (7.1%) [19]. Using real-world data from Poland, Brzozowska et al. confirmed the clinical efficacy of tyrosine-kinase inhibitors (TKIs), but the survival results are lower compared to clinical studies from Asian populations [20].

The US Preventive Services Task Force recommends annual low-dose computed tomography (LDCT) screening for persons aged 55 to 80 years with a 30 pack-year smoking history, either currently smoking or having quit within

Ming-Shian Lu, Miao-Fen Chen, Yao-Hsu Yang, Chuan-Pin Lee, Chien-Chao Lin, Yuan-Hsi Tseng, Ying-Huang Tsai

Figure 1. Patient recruitment and matching process

Appraisal of lung cancer survival in patients with end-stage renal disease

Table I. Cohort and matched-cohort demographic characteristics of patients Characteristics

Cohort Matched cohort Non-ESRD n (%) ESRD n (%) P -value* Non-ESRD n (%) ESRD n (%) P -value*

Number of patients 20,695 (100.0%) 159 (100.0%) 532 (100.0%) 133 (100.0%)

Age [years]: 0.164 1.000

Mean (SD) 65.9 (12.4) 67.7 (10.3) 67.9 (9.3) 67.9 (9.3)

Median 68.0 70.0 70.0 70.0

Gender: 0.466 1.000 Female 7,237 (35.0%) 60 (37.7%) 192 (36.1%) 48 (36.1%)

Male 13,458 (65.0%) 99 (62.3%) 340 (63.9%) 85 (63.9%)

Histology: 0.839 1.000

SCLC 4,068 (19.7%) 36 (22.6%) 116 (21.8%) 29 (21.8%)

NSCLC: 16,627 (80.3%) 123 (77.4%) 416 (78.2%) 104 (78.2%)

Adenocarcinoma 10,200 (49.3%) 80 (50.3%) 261 (49.1%) 68 (51.1%)

Adenosquamous cell carcinoma 290 (1.4%) 2 (1.3%) 7 (1.3%) 2 (1.5%)

Large cell carcinoma 216 (1.0%) 2 (1.3%) 10 (1.9%) 1 (0.8%)

Sarcomatoid carcinoma 103 (0.5%) 0 (0.0%) 2 (0.4%) 0 (0.0%)

Small cell carcinoma 1,938 (9.4%) 11 (6.9%) 47 (8.8%) 9 (6.8%)

Others 3,880 (18.7%) 28 (17.6%) 89 (16.7%) 24 (18.0%)

Stage: 0.160 1.000

Unknown 2,493 (12.0%) 19 (11.9%) 52 (9.8%) 13 (9.8%)

I–IIIA 3,513 (17.0%) 36 (22.6%) 108 (20.3%) 27 (20.3%)

IIIB–IV 14,689 (71.0%) 104 (65.4%) 372 (69.9%) 93 (69.9%)

Treatment modality (within 3 months): 0.005 1.000

No treatment/supportive care 8,299 (40.1%) 72 (45.3%) 236 (44.4%) 59 (44.4%)

Medical treatment: 10,026 (48.4%) 59 (37.1%) 220 (41.4%) 55 (41.4%)

CT 4,872 (23.5%) 27 (17.0%) 91 (17.1%) 26 (19.5%)

RT 1,660 (8.0%) 9 (5.7%) 31 (5.8%) 7 (5.3%)

CT + RT 1,923 (9.3%) 8 (5.0%) 42 (7.9%) 8 (6.0%)

CT + TKI 1,127 (5.4%) 11 (6.9%) 33 (6.2%) 10 (7.5%)

RT + TKI 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) TKI 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%)

CT + RT + TKI 434 (2.1%) 4 (2.5%) 23 (4.3%) 4 (3.0%)

Surgical treatment: 2,370 (7.3%) 28 (17.6%) 76 (14.3%) 19 (14.3%)

OP 1,516 (7.3%) 26 (16.4%) 52 (9.8%) 18 (13.5%)

OP + CT 650 (3.1%) 1 (0.6%) 20 (3.8%) 0 (0.0%)

OP + RT 97 (0.5%)` 1 (0.6%) 3 (0.6%) 1 (0.8%)

OP + CT + RT 107 (0.5%) 0 (0.0%) 1 (0.2%) 0 (0.0%)

ESRD – end-stage renal disease, CT – chemotherapy, NSCLC – non-small cell lung cancer, OP – surgical resection, RT – radiotherapy, SCLC – small cell lung cancer, Target – target therapy.

0 Log-rank test: p = 0.133

0 24 48 72 96 120

Number at risk

Follow-up time [months]

Lung cancer patients

Without ESRD With ESRD

Without 532 134 51 26 16 7

ESRD

With 133 31 14 9 5 1 ESRD

Figure 2. Survival curve for lung cancer WITHESRD and WITHOUT-ESRD. For WITH-ESRD patients, the median overall survival was 7.36 months (95% CI: 5.19–11.10) compared to 12.25 months (95% CI: 10.81–14.65) for patients WITHOUT-ESRD, p = 0.133

15 years [21]. The usefulness of lung cancer screening with low dose computed tomography is well established; however, the high false positive rate, the cost, and the irradiation risk still need to be addressed [22]. Unfortunately, because of the reduced life for ESRD patients to the general population, preventive cancer screening is not recommended [23]. However, the frequent medical visits by ESRD patients, in theory, should have allowed for earlier detection of malignancies. The conventional dialysis schedule for a typical ESRD patient is usually three times per week. Despite this high medical visit rate, nearly 70% of patients in our cohort presented with advanced stage lung cancer upon diagnosis. Although the likelihood of non-localized stage lung cancer for a patient receiving hemodialysis at diagnosis was not significantly different from the general population [24], the high medical visit rate did not translate into earlier detection of cancer. The reason for the delay in diagnosis merits further studies.

The survival of lung cancer with end-stage renal disease patients has conflicting results in the literature. In this study, we found that the median overall survival for WITH-ESRD patients was 7.36 months (95% CI: 5.19–11.10) compared to 12.25 months (95% CI: 10.81–14.65) for WITHOUTESRD patients, p = 0.133. Our result concurs with Cheung et al. [10] where the overall survival of lung cancer patients with ESRD did not differ sig-

nificantly from patients without ESRD. In contrast, in a report that included only ESRD patients without a general population for comparison, Chien et al. [4] found a decreased survival rate in lung cancer-ESRD patients with a 5-year survival rate of 8% for male lung cancer-ESRD patients and 4% for female lung cancer-ESRD patients (p = 0.422), which is much lower than previously reported 16.3% at 5 years for lung cancer in Taiwan [25].

Gender survival analysis of our cohort is in agreement with previous reports on gender survival difference in lung cancer, which revealed consistently improved survival for female patients [26–30]. In this study, the median overall survival for female patients with ESRD is 12.25 months (95% CI: 5.78–17.45) comparable to the 14.13 months (95% CI: 11.07–16.43) for female patients without ESRD, p = 0.996. However, a marginally significant median survival difference was noted for male patients without ESRD 11.56 months (95% CI: 8.77–14.19) compared to 6.31 months (3.71–8.51) for male patients with ESRD (p = 0.059).

Among different treatment modalities, surgical resection is currently the treatment that offers the best chance for long-term survival. Using a population-based cancer registry for lung cancer in Taiwan, Wang et al. [31] reported a surgical resection rate of 16.4%. In this report, the resection rate for WITH-ESRD patient was 14.3%, and it concurred with the previous report. The surgical outcome of lung resection for patients under dialysis reported in several small clinical series demonstrated acceptable surgical risk and long-term outcome [32–35]. In a series of 24 dialysis patients from Japan (lobectomies: 22, wedge resection: 1 and segmentectomy: 1), 54 months median survival was reported [32]. In this report, the median overall survival for surgically treated WITH-ESRD patients was 62 months (95% CI: 15.97–84.63) compared to 50.23 months (95% CI: 29.47–96.30) for WITHOUT-ESRD patients, p = 0.781.

In our cohort, 36.1% of WITH-ESRD patients received some form of chemotherapy with poor median survival. For the medical treatment group, the median survival for WITH-ESRD patients was 5.98 months (95% CI: 4.34–11.76) compared to 14.13 months (95% CI: 11.30–16.43) for WITHOUT-ESRD patients, p = 0.019. We found that the median survival for WITH-ESRD patients receiving medical treatment was very similar to the median survival of no treatment/supportive treatment for WITHOUT-ESRD patients (5.98 months vs. 6.51 months). The poor median survival for WITH-ESRD patients receiving medical treatment could be the effect of the toxicity at higher doses, and the lack of efficacy at sub-therapeutic doses. In the CANDY study [36], only 28% of the cancer patients with dialysis received anticancer drugs; among them,

Ming-Shian Lu, Miao-Fen Chen, Yao-Hsu Yang, Chuan-Pin Lee, Chien-Chao Lin, Yuan-Hsi Tseng, Ying-Huang Tsai

Table II. Kaplan-Meier survival analysis for WITHOUT-ESRD and WITH-ESRD group

Parameter

WITHOUT-ESRD WITH-ESRD P -value

Median [months] 95% CI Median [months] 95% CI

Overall 12.25 10.81 14.65 7.36 5.19 11.10 0.133

Age:

≤ Median 13.83 11.27 16.46 8.05 4.93 13.83 0.164

> Median 10.84 7.95 14.19 6.57 3.58 12.32 0.488

Gender: Female 14.13 11.07 16.43 12.25 5.78 17.45 0.996 Male 11.56 8.77 14.19 6.31 3.71 8.51 0.059

Stage:

I–IIIA 34.76 24.71 50.23 34.30 8.44 78.82 0.711 IIIB–IV 9.63 7.85 11.27 5.19 3.71 7.56 0.022

Histology:

SCLC 10.58 8.48 16.00 6.57 3.35 16.82 0.587 NSCLC 13.01 11.07 15.01 7.54 5.19 11.96 0.133

Treatment: No treatment/supportive care 6.51 4.70 8.15 4.73 1.97 8.77 0.914 Medical treatment 14.13 11.30 16.43 5.98 4.34 11.76 0.019 Surgical treatment 50.23 29.47 96.30 55.62 15.97 84.63 0.781

The overall survival was not statistically significantly different between the WITHOUT-ESRD and WITH-ESRD group. Survival for male WITHOUT-ESRD patients is nearly double the survival for male WITH-ESRD patients (median survival of 11.56 months versus 6.31 months respectively, p = 0.059). There is a significant survival difference between WITH-ESRD and WITHOUT-ESRD groups for cancer stage IIIB–IV patients (median survival of 5.19 months compared to 9.63 months), p = 0.022. NSCLC – non-small cell lung cancer. SCLC – small cell lung cancer.

Table III. Adjusted Cox proportional hazard analysis for WITH-ESRD group

Parameter WITH-ESRD

Adjusted hazard ratio 95% CI P -value

Age: ≤ Median Ref.

> Median 1.29 0.86 1.92 0.214 Gender: Female Ref. Male 1.80 1.16 2.78 0.009

Stage: I–IIIA Ref. IIIB–IV 2.47 1.01 6.09 0.049

Histology: NSCLC Ref. SCLC 0.93 0.53 1.65 0.811

Treatment: No treatment/supportive care 1.38 0.90 2.10 0.136 Medical Ref. Surgical 0.54 0.19 1.53 0.243

Female gender and cancer stage I–IIIA were associated with improved survival. Although patients receiving surgical treatment showed improved survival of 46% (HR = 0.54, 95% CI: 0.19–1.53), it did not reach statistical significance (p = 0.243). NSCLC – non-small cell lung cancer, SCLC – small cell lung cancer.

Appraisal of lung cancer survival in patients with end-stage renal disease Arch Med Sci 1, 1st January / 2023

44% of the treated patients developed iatrogenic toxicity. Since clinical trials usually exclude patients on dialysis, the clinical profile and safety of a standard regimen are uncertain as well as lacking evidence of a benefit.

Radiotherapy plays an essential role in the treatment of lung cancer, from the treatment of medically inoperable early-stage lung cancer to palliative treatment for metastatic disease. In cases of brain metastasis, the combination of tyrosine-kinase inhibitors plus radiotherapy has shown greater efficacy than radiotherapy plus chemotherapy for the management of lung cancer with brain metastasis [37, 38]. However, the timing and the sequence to start the treatment are not clear. Wang et al. [39] demonstrated that the intracranial progression-free survival (iPFS) differed significantly according to the timing of using radiotherapy in combination with tyrosine-kinase inhibitors. Patients receiving concurrent TKI-radiotherapy or TKI after first-line radiotherapy had an iPFS of 11.1 months and 11.3 months compared to 8.1 months for radiotherapy after TKI failure (p = 0.032). The timing and sequence of combined modality treatment deserve further evaluation.

There are several limitations of this study, such as the retrospective design, lack of smoking status, histology grading, molecular abnormalities, absence of treatment details (possible reduction in chemotherapy dose, toxicity events), and the completion rate of the treatment plan, which may have influenced the clinical outcome. This cohort of patients was composed entirely of Chinese descendants; extrapolation of the results to other ethnic groups needs caution.

In conclusion, in our limited experience, the survival for lung cancer with ESRD is not inferior to lung cancer patients without ESRD. For physically fit patients, surgical resection provides acceptable long-term survival. The reasons for poor survival in patients with medical treatment and the late-stage diagnosis in this group of patients with frequent medical visits merit further investigation.

Acknowledgments

This study was supported by a research grant from Chang Gung Memorial Hospital (CORPG6D0181).

The authors thank all the members of the Cancer Center at Linkou Chang Gung Hospital, Kaohsiung Chang Gung Hospital, Chang Gung Memorial Hospital at Keelung, and Chang Gung Memorial Hospital at Chiayi for their invaluable help.

The authors thank the Health and Epidemiology Laboratory of Chang Gung Memorial Hospital, Chia-Yi Branch for their comments and assistance in data analysis.

Conflict of interest

The authors declare no conflict of interest.

References

1. Kontis V, Bennett JE, Mathers CD, Li G, Foreman K, Ezzati M. Future life expectancy in 35 industrialized countries: projections with a Bayesian model ensemble. Lancet 2017; 389: 1323-35.

2. Liang JA, Sun LM, Yeh JJ, Sung FC, Chang SN, Kao CH. The association between malignancy and end-stage renal disease in Taiwan. Jpn J Clin Oncol 2011; 41: 752-7.

3. Butler AM, Olshan AF, Kshirsagar AV, et al. Cancer incidence among US Medicare ESRD patients receiving hemodialysis, 1996-2009. Am J Kidney Dis 2015; 65: 763-72.

4. Chien CC, Han MM, Chiu YH, et al. Epidemiology of cancer in end-stage renal disease dialysis patients: a national cohort study in Taiwan. J Cancer 2017; 8: 9-18.

5. Shebl FM, Warren JL, Eggers PW, Engels EA. Cancer risk among elderly persons with end-stage renal disease: a population-based case-control study. BMC Nephrology 2012; 13: 65.

6. Yoo KD, Lee JP, Lee SM, et al. Cancer in Korean patient with end-stage renal disease: a 7-year follow-up. PLoS One 2017; 12: e0178649.

7. Maisonneuve P, Agodoa L, Gellert R, et al. Cancer in patients on dialysis for end-stage renal disease: an international collaborative study. Lancet 1999; 354: 93-9.

8. Lin MY, Kuo MC, Hung CC, et al. Association of dialysis with the risk of cancers. PLoS One 2015; 10: e0122856.

9. Lin HF, Li YH, Wang CH, Chou CL, Kuo DJ, Fang TC. Increased risk of cancer in chronic dialysis patients: a population-based cohort study in Taiwan. Nephrol Dial Transplant 2012; 27: 1585-90.

10. Cheung CY, Chan GCW, Chan SK, et al. Cancer incidence and mortality in chronic dialysis population: a multicenter cohort study. Am J Nephrol 2016; 43: 153-9.

11. Goldstraw P, Crowley J, Chansky KJ, et al. The IASLC Lung Cancer Staging Project: proposal for the revision of the TNM stage groupings in the forthcoming (seventh) edition of the TNM Classification of malignant tumours. J Thorac Oncol 2007; 2: 706-14.

12. Levey AS, de Jong PE, Coresh J, et al. The definition, classification, and prognosis of chronic kidney disease: a KDIGO Controversies Conference Report. Kidney Int 2011; 80: 17-28.

13. Stauffer ME, Fan T. Prevalence of anemia in chronic kidney disease in the United States. PLoS One 2014; 9: e84943.

14. Tsai MH, Hsu CY, Lin MY, et al. Incidence, prevalence, and duration of chronic kidney disease in Taiwan: results from a community-based screening program of 106,094 individuals. Nephron 2018; 140: 175-84.

15. van Walraven C, Manuel DG, Knoll G. Survival trend in ESRD patients compared with the general population in the United States. Am J Kidney Dis 2014; 63: 491-9.

16. Saran R, Robinson B, Abbott KC, et al. US Renal Data System 2017 Annual Data Report: epidemiology of kidney disease in the United States. Am J Kidney Dis 2018; 71 (Suppl 1): S1-672.

17. Loy EY, Choong HL, Chow KY. Cancer among end-stage renal disease patients on dialysis. Ann Acad Med Singapore 2013; 42: 640-5.

18. Shang W, Huang L, Li L, et al. Cancer risk in patients receiving renal replacement therapy: a meta-analysis of cohort studies. Mol Clin Oncol 2016; 5: 315-25.

Ming-Shian Lu, Miao-Fen Chen, Yao-Hsu Yang, Chuan-Pin Lee, Chien-Chao Lin, Yuan-Hsi Tseng, Ying-Huang Tsai

Appraisal of lung cancer survival in patients with end-stage renal disease

19. Ku CX, Pawitan Y, Sim X, et al. Genomic copy number variations in three Southeast Asian populations. Hum Mutat 2010; 31: 851-7.

20. Brzozowska M, Wierzba W, Szafraniec-Burylo S, et al. Overall survival of patients with EGFR mutation-positive non-small cell lung cancer treated with erlotinib, gefitinib or afatinib under drug programmes in Poland-real-world data. Arch Med Sci 2021; 17: 1618-27.

21. Hoffman RM, Sanchez R. Lung cancer screening. Med Clin North Am 2017; 101: 769-85.

22. Sharma D, Newman TG, Aronow WS. Lung cancer screening: history, current perspectives, and future directions. Arch Med Sci 2015; 11: 1033-43.

23. Holley JL. Screening, diagnosis, and treatment of cancer in long-term dialysis patients. Clin J Am Soc Nephrol 2007; 2: 604-10.

24. Taneja S, Mandayam S, Kayani ZZ, Kuo YF, Shahinian VB. Comparison of stage at diagnosis of cancer in patients who are on dialysis versus the general population. Clin J Am Soc Nephrol 2007; 2: 1008-13.

25. Chiang CJ, Lo WC, Yang YW, You SL, Chen CJ, Lai MH. Incidence and survival of adult cancer patients in Taiwan, 2002-2012. J Formos Med Assoc 2016; 115: 1076-88.

26. Radzikowska E, Glaz P, Roszkowski K. Lung cancer in women: age, smoking, histology, performance status, stage, initial treatment and survival-population based study of 20.561 cases. Ann Oncol 2002; 13: 1087-93.

27. Wisnivesky JP, Halm EA. Sex differences in lung cancer survival: do tumor behave differently in elderly women? J Clin Oncol 2007; 25: 1705-12.

28. Kinoshita FL, Yuri I, Morishima T, Miyashiro I, Nakayama T. Sex differences in lung cancer survival: long-term trends using population-based cancer registry data in Osaka, Japan. Jpn J Clin Oncol 2017; 47: 863-9.

29. Ock M, Choi WJ, Jo MW. Trend analysis of major cancer statistics according to sex and severity levels in Korea. PLoS One 2018; 13: e0203110.

30. Sagerup CM, Småstuen M, Johannesen TB, Helland A, Brustugun OT. Sex-specific trends in lung cancer incidence and survival: a population study of 40 118 cases. Thorax 2011; 66: 301-7.

31. Wang BY, Huang JY, Cheng CY, Lin CH, Ko JL, Liaw YP. Lung cancer and prognosis in Taiwan: a population-based cancer registry. J Thorac Oncol 2013; 8: 1128-35.

32. Takahama M, Yamamoto R, Nakajima R, Tsukioka T, Tada H. Pulmonary resection for lung cancer patients on chronic hemodialysis: clinical outcome and long term results after operation. Interact Cardiovasc Thorac Surg 2010; 11: 150-3.

33. Obuchi T, Hamanaka W, Yoshida Y, et al. Clinical outcome after pulmonary resection for lung cancer patients on hemodialysis. Ann Thorac Surg 2009; 88: 1745-8.

34. Ciriaco O, Casiraghi M, Melloni G, et al. Pulmonary resection for non-small-cell lung cancer patients on hemodialysis: clinical outcome and long-term results. World J Surg 2005; 29: 1516-9.

35. Tsuchida M, Yamato Y, Aoki T, et al. Complications associated with pulmonary resection in lung cancer patients on dialysis. Ann Thorac Surg 2001; 71: 435-8.

36. Janus N, Launay-Vacher V, Thyss A, et al. Management of anticancer treatment in patients under chronic dialysis: results of the multicentric CANDY (CANcer and DialYsis) study. Ann Oncol 2013; 24: 501-7.

37. Cai L, Zhu JF, Zhang XW, et al. A comparative analysis of EGFR mutation status in association with the efficacy of TKI in combination with WBRT/SRS/surgery plus che-

motherapy in brain metastasis from non-small cell lung cancer. J Neurooncol 2014; 120: 423-30.

38. Wang X, Xu Y, Tang W, Liu L. Efficacy and safety of radiotherapy plus EGFR-TKIs in NSCLC patients with brain metastases: a meta-analysis of published data. Transl Oncol 2018; 11: 1119-27.

39. Wang W, Song Z. Zhang Y. Efficacy of brain radiotherapy plus EGFR-TKI for EGFR-mutated NSCLC patients who develop brain metastasis. Arch Med Sci 2018; 14: 1298-307.

Clinical research Rheumatology

Predictors of disability in patients with chronic low back pain

1Department of Physical Therapy and Special Motility, West University of Timişoara, Timişoara, Romania

2Department of Rehabilitation, Physical Medicine and Rheumatology, “Victor Babes” University of Medicine and Pharmacy Timisoara, Romania

3Department of Rheumatology, The University of Medicine and Pharmacy Tg Mures, Romania

4Department of Internal Medicine I, “Victor Babes” University of Medicine and Pharmacy Timisoara, Romania

Submitted: 10 October 2019; Accepted: 12 December 2019 Online publication: 8 July 2020

Arch Med Sci 2023; 19 (1): 94–100 DOI: https://doi.org/10.5114/aoms.2020.97057

Copyright © 2020 Termedia & Banach

Abstract

Introduction: Chronic low back pain (CLBP) is a common and disabling health problem. In this study, we aimed to assess the relationship between pain intensity, the components of catastrophizing, depression and disability in patients with chronic low back pain.

Material and methods: Seventy-six patients diagnosed with CLBP (age range 25–77 years; 73.7% female) participated in the study. Participants’ sociodemographic data were collected: age, gender, height, weight, and work status (employed or retired). All participants were asked to complete the Pain Catastrophizing Scale (PCS), the visual analogue scale (VAS), the Oswestry Disability Questionnaire (ODQ), and the Beck Depression Inventory (BDI). Results: The mean group scores revealed moderate CLBP complaints (VAS – 4 [3–6]), mild depression (BDI – 10 [5–16]), a moderate level of catastrophizing (PCS total score 20.5 [10–34]) and moderate disability (Oswestry Disability Index [ODI] – 31 [14–38]). Positive significant correlations were found between ODI and age, residence, work status, VAS, PCS-rumination, PCS-magnification, PCS-helplessness and BDI, and also between PCS subscales and VAS. Our multivariate linear regression analysis showed that age, pain intensity, PCS-helplessness and depression can predict disability in patients with CLBP, explaining 84% of the variance of disability ( R 2 = 0.851, adjusted R 2 = 0.843).

Conclusions: A multidisciplinary approach is needed for patients with CLBP and should include physical, mental and social evaluation in order to offer an optimal treatment.

Key words: chronic low back pain, catastrophizing, depression, disability.

Introduction

Chronic low back pain (CLBP) is defined as low back pain lasting more than 12 weeks, affecting more than 50% of the general population. It is estimated that more than 70% of the population experience at least one episode of lower lumbar pain, in a certain moment of life. Prevalence is higher among young people, being the second cause of absence from the workplace and one of the main reasons for consulting a doctor. Back

Corresponding author: Roxana Ramona Onofrei Department of Rehabilitation, Physical Medicine and Rheumatology “Victor Babes” University of Medicine and Pharmacy Timisoara 2 Eftimie Murgu Square, 300041 Timisoara, Romania E-mail: onofrei.roxana@umft.ro

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Elena Sirbu1, Roxana Ramona Onofrei2, Simona Szasz3, Monica Susan4

pain typically occurs between the ages of 30 and 50, due to the ageing processes but also secondary to a sedentary lifestyle. Approximately 10– 40% of low back pain complaints are chronic, of which 85% are nonspecific [1].

Data from the European Health surveys show a wide variation in the prevalence of self-reported low back pain. This ranges from less than 12% of respondents reporting ever having doctor-diagnosed low back pain in France to nearly 33% in Austria reporting ever having had this condition. Among the European countries, the highest proportion of people reporting ever having had low back pain (including not diagnosed by a doctor) is in Slovenia (40.7%) [2]. In Romania the prevalence of low back pain in adults is high (62%), second only to headaches (79%) in the ranking of painful disorders [3].

This condition may negatively impact the patient’s quality of life, and may influence activity for long periods of time, leading to absenteeism in the workplace. Apart from pain and disability the patients can present depression, due to chronic pain, and increased prescription drugs consumption [4]. Patients with chronic pain are more likely to develop depression and even higher levels of pain and worse health-related quality of life [5– 12].

Increased attention has recently been given to the concept of pain catastrophizing, often encountered in patients with chronic conditions. This term was introduced to describe an inappropriately cognitive style used by patients with anxiety and depressive disorders. Catastrophic thinking with regard to pain involves a set of exaggerated and negative cognitive and emotional feelings related to actual or anticipated painful stimulation [13]. Some patients define catastrophizing as a tendency to magnify or exaggerate the value or seriousness of pain sensations, while others emphasized pain-related worry and fear, associated with the inability to divert the attention away from pain [14]. According to Sullivan et al., the catastrophic thinking incorporates magnification of pain-related symptoms, rumination about pain, helplessness, and pessimism about the underlying disease [15]. Previous studies demonstrated the association of catastrophizing and sensitization with increased clinical pain among patients with chronic low back pain and myofascial pain [16–18]. Central sensitization seems to mediate the relation between psychological factors (anxiety, depression, catastrophic thinking) and pain intensity [19, 20].

In this study, we aimed to assess the relationship between pain intensity, the components of catastrophizing, depression and disability in patients with chronic low back pain.

Material and methods

Subjects

A total of 100 consecutive patients who were seeking help for their low back pain in a rehabilitation medicine clinic in the period from December 2018 to February 2019 were selected.

Inclusion criteria were chronic low back pain, defined as pain in the back, located between the last rib and the gluteal fold, with mechanical characteristics lasting more than 3 months. Subjects with sciatica, history of back surgery, spinal tumor, spinal fracture, spinal stenosis or radiculopathy, fibromyalgia, inflammatory and infectious spinal diseases were excluded. Chronic pain relief drug users were also excluded from this study.

This study conformed to the principles outlined in the Helsinki Declaration and was approved by the local Ethics Committee (approval no. 198/2018). Participation in the study was voluntary. All subjects who met the inclusion criteria read and signed the informed consent.

Assessment

Participants’ socio-demographic data were collected – age, gender, height, weight, and work status (employed or retired). The main anthropometric parameters measured were weight, height and body mass index of the participants. All participants were asked to complete the Pain Catastrophizing Scale (PCS), the visual analogue scale (VAS), the Oswestry Disability Questionnaire (ODQ), and the Beck Depression Inventory (BDI).

The PCS was used to measure the degree of catastrophic thinking about pain. The scale has 13 items and three dimensions of pain catastrophizing: rumination, magnification, and helplessness. All items are scored through a 5-point Likert scale ranging from 0 (not at all) to 4 (all the time), relating to the past painful experience. Separate subscores for the three dimensions can be calculated. For example, rumination is the sum of items 8, 9, 10 and 11; magnification is the sum of items 6, 7 and 13; and helplessness is the sum of items 1, 2, 3, 4, 5 and 12. A total score ranging from 0 to 52 points can be calculated for the PCS. Higher scores denote a higher degree of catastrophizing. Patients were categorized as high or low catastrophizers based on a median split of PCS scores [15].

Pain intensity was self-completed by each patient on a single-item scale (Visual Analog Scale). This scale is most commonly anchored by “no pain” (score of 0) and “pain as bad as it could be” or “worst imaginable pain” (score of 10). Respondents were asked to report “current” pain intensity or pain intensity “in the last 24 hours”.

The ODQ scale was used to measure the limitation in everyday life activities. It is based on

Predictors of disability in patients with chronic low back pain

Table I. Patients socio-demographic data

Characteristics Value

Sex, n (%):

Male 20 (26.3)

Female 56 (73.7)

Age [years], mean ± SD 53.79 ±13.82

Weight [kg], mean ± SD 76.11 ±12.5

Height [cm], mean ± SD 167.35 ±9.17

BMI [kg/m2], mean ± SD 27.19 ±3.75

Residence, n (%):

Rural 20 (26.3) Urban 56 (73.7)

Work status, n (%): Employed 51 (67.1) Retired 25 (32.9)

Table II. Summary of scores

Variables

Median [IQR]

Pain Catastrophizing Scale: PCS total 20.5 [10–34]

Rumination 7 [4–12]

Magnification 4.5 [3–7]

Helplessness 9 [3–17] VAS 4 [3–6]

Oswestry Disability Index 31 [14–38] Beck Depression Index 10 [5–16]

10 sections with six levels each, assessing the limitation of various activities of daily living [21, 22]. The values range from 0 (the best health state) to 100 (the worst health state). For each section of the questionnaire, the total possible score is 5. The first statement was scored 0, and consecutive statements were scored from 1 to 5. The total score was then divided by the total possible score and expressed as a percentage to produce the Oswestry Disability Index (ODI). The ODI is interpreted as follows: 0– 20%, minimal disability; 21– 40%, moderate disability; 41– 60%, severe disability; 61– 80%, crippled; 81– 100%, patients are either bed-bound or exaggerate their symptoms [21, 22].

The Beck Depression Inventory (BDI) is a 21-item, self-report rating inventory that measures the intensity of depression [23]. Each question had a set of four possible responses, ranging in intensity, and a score of 0 to 3 is assigned for each answer. The sum of the 21 scored questions gives the total score. A score of 0 to 9 indicates minimal depression; 10 to 18 indicates mild depression; 19 to 29 indicates moderate depression; 30 to 63 indicates

severe depression. Higher total scores indicate more severe depressive symptoms.

Statistical analysis

The statistical analysis was performed using MedCalc Statistical Software version 19 (MedCalc Software bvba, Ostend, Belgium). All data were tested for normality with Shapiro-Wilk’s test. Descriptive statistics were calculated for patients’ characteristics (mean and standard deviations) and for VAS, PCS, ODI and BDI (median and interquartile range). Correlation (Spearman’s rank correlation coefficient) and multivariate linear regression with a stepwise procedure were conducted to examine the relationship between ODI and the other variables (gender, age, BMI, work status, pain intensity (VAS), rumination, magnification, helplessness and BDI). The criterion for entry into the regression model was p < 0.05 and for removal from the regression was p > 0.1. The significance level was set at p < 0.05 for all tests.

In order to calculate the required sample size for a multiple regression analysis, the G*Power 3.1 software was used. Using up to 8 variables in the regression analysis, at a large effect size 0f 0.35, at an alpha level of 0.05 and a power of 0.8, a minimum sample of 52 participants was required [24].

Results

Of the 100 patients recruited for this study, only 76 (aged ranged 25– 77 years; 73.7% female) agreed to participate, signed the informed consent and answered the questionnaires. Table I outlines the patients’ socio-demographic data.

The responses of the VAS, PCS scores, ODI and BDI are presented in Table II. None of the variables showed a normal distribution. The mean group scores revealed moderate CLBP complaints (VAS –4 [3– 6]), mild depression (BDI – 10 [5– 16]), a moderate level of catastrophizing (PCS total score 20.5 [10–34]) and moderate disability (ODI – 31 [14–38]). The majority of the patients (55.26%) were low catastrophizers (PCS total < 24), with a VAS of 4 [2–4], a BDI of 7 [2–11] and an ODI of 18 [12–28]. The high catastrophizers (44.74%) had significantly higher scores (VAS – 7 [5–7]), BDI – 16 [11–30] and ODI – 38 [34–52]). Twenty-four patients (31.58%) were scored as having minimal disability, 36 patients (47.37%) moderate disability, and 16 patients (21.05%) severe disability.

There were positive weak significant correlations between socio-demographic data (age, residence, work status) and pain, PCS subscales, depression and disability. Positive significant correlations were found between ODI and age, residence, work status, VAS, PCS total, PCS-rumination, PCS-magnification, PCS-helplessness and

Elena Sirbu, Roxana Ramona Onofrei, Simona Szasz, Monica Susan

Sex

Table III. Correlation among measured variables

Sex Age Residence Work status BMI VAS ODI PCS total PCS-R PCS-M PCS-H BDI

Age 0.30*

Residence –0.19 –0.06

Work status 0.22 0.80* 0.15

BMI 0.03 0.05 0.05 0.02

VAS 0.08 0.29* 0.30* 0.46* –0.15

ODI 0.15 0.63* 0.31* 0.61* 0.10 0.72*

PCS total 0.11 0.56* 0.32* 0.57* 0.06 0.75* 0.85*

PCS-R 0.08 0.44* 0.30* 0.48* 0.07 0.67* 0.74* 0.94*

PCS-M 0.0 0.48* 0.29* 0.51* 0.06 0.71* 0.80* 0.95* 0.91*

PCS-H 0.18 0.58* 0.28* 0.56* 0.10* 0.74* 0.87* 0.96* 0.85* 0.88*

BDI 0.06 0.44* 0.26* 0.47* 0.08 0.66* 0.77* 0.76* 0.69* 0.74* 0.75*

Spearman rank correlation coefficient. *P < 0.05. BMI – body mass index, VAS – visual analague scale for pain, ODI – Oswestry Disability Index, PCS-R – Pain Catastrophizing Scale-Rumination, PCS – Pain catastrophizing Scale-Magnification, PCS-H – Pain catastrophizing Scale-Helplessness, BDI – Beck Depression Index.

Table IV. Summary of stepwise regression analysis of disability (ODI)

Predictors B β t P -value R2 Adjusted R2

Age 0.216 0.193 3.320 0.001 0.851 0.843

VAS 1.779 0.223 3.164 0.002 PCS-helplessness 0.651 0.302 3.235 0.002 BDI 0.511 0.365 4.808 < 0.0001

BDI, and also between PCS total score, PCS subscales and VAS (Table III).

A multivariate linear regression with a stepwise procedure was conducted to examine the relationship between ODI and the other variables. Only those variables that were significant in the correlation analysis were entered into the regression. A significant model emerged (F(4.71) = 101.38, p < 0.0001), explaining 84% of the variance of disability (R2 = 0.851, adjusted R2 = 0.843). Age, VAS, PCS-helplessness and BDI contributed significantly in this model. The excluded variables from this regression model were residence, work status, PCS-rumination and PCS-magnification. The regression coefficients of the predictors are shown in Table IV.

Discussion

This study investigated whether socio-demographic data, catastrophizing, pain intensity and depression would predict disability in patients with chronic low back pain. In our regression model, age, pain intensity, helplessness and depression explained the variance of disability in patients with nonspecific CLBP.

Socio-demographic (e.g. age, sex, work status, BMI), pain characteristics (intensity, duration, localization, causes) and psychological factors (fear-avoidance beliefs, catastrophizing, anxiety, depression) are reported as predictors of disability not only in patients with chronic pain, but also in patients with CLBP [25–29].

Our results showed that age, residence and work status were significantly correlated with the disability, but only age contributed significantly in the prediction of disability in CLBP patients, similar to previous studies [30–32].

Consistent with previous research, we found that pain intensity was correlated with disability and was one of the independent variables which significantly influenced the disability in our CLBP patients. Significant correlations between CLBP intensity and disability have also been reported in the literature [33–36]. Pain intensity was proved to be a strong predictor of disability in populations with non-specific low back pain in previous studies [37–39].

Catastrophizing has been defined as exaggerated negative emotions regarding pain experience and stimuli [15, 40]. It was reported that catastrophizing could predict pain intensity, disability and psychological distress, and that it has a detrimen-

Predictors of disability in patients with chronic low back pain

tal effect on general health perception, functional status, medical consumption and quality of life [41–43]. There are a lot of studies in the literature regarding the role of pain catastrophizing in the prognosis and disability of patients with low back pain. Catastrophizing was strongly correlated with disability and the impact on daily living in populations with low back pain [33, 34, 38, 44, 45]. In contrast, there are contradicting studies which report that catastrophizing does not explain the unique variance in disability when assessed alongside factors such as pain-related fear or coping styles [35, 46, 47].

Our study revealed that helplessness was the only component of catastrophizing that significantly predicted disability in patients with NCLBP. One explanation for this situation could be the strong correlations observed between the three PCS subscales. It is possible for some patients to identify so much with pain and to pay more attention to it so that they develop in time helplessness phenomena and implicitly pain-related disability. Similar results were reported by Rosenstiel and Keefe, who found that helplessness (assessed with the Coping Strategy Questionnaire) was associated with greater disability [48]. Sullivan et al. found that helplessness was the strongest predictor of pain-related disability in the group of patients off work for more than 4 years [49]. In the same study they observed that for patients who had been off work for 2– 4 years rumination was the only component that predicted disability. Vienneau et al observed in their study that helplessness was the best predictor of disability in patients with CLBP [50]. Our results are not in accordance with other studies. Sullivan et al. reported that rumination was the component of catastrophizing that was strongly associated with disability in patients with soft-tissue injuries [51]. Ogunlana et al. found that the magnification and rumination components of pain catastrophizing explained 22.6% of the variance of disability in patients with NLBP [34].

It is known that depression is the most frequent emotional condition in individuals with chronic pain or chronic conditions [52, 53]. In our study the correlation between disability and depression was positive and significant, suggesting that the greater the disability related to chronic back pain is, the greater is the possibility of depression-related symptoms. Depression contributed significantly in our model for predicting CLBP-related disability. It is common for depressed patients to avoid activities they used to do, such as housework, sports, social interaction, etc., which leads to disability-related symptoms. Our findings are in accordance with previous research. Hung et al reported that depression was the most powerful factor associated with disability in their studied populations with CLBP [54].

Another interesting study focused on mechanisms that might be involved in the development of depression and disability. The authors suggest that a potential mechanism is the individual’s health locus of control (HLoC). In psychology, health locus of control refers to people’s beliefs that they have control over different events in their lives (internal locus of control) or that their own actions are a result of external factors beyond their control (external locus of control). The primary outcome of this study is that peoples with low control over their health (internal HLoC) report high levels of depression resulting from pain and pain interference, but moderate levels of disability [55].

There are a number of limitations of our study that should be considered. We did not take into account the stage of chronicity of low back pain or the use of medication. We also did not evaluate the fear avoidance beliefs and the coping strategies that could interfere with catastrophizing and depression in our study sample.

Our findings can contribute to a better understanding of the predictive factors of disability in patients with CLBP, such as age, pain intensity, catastrophizing pain and depression. The need to assess the abovementioned variables is an essential element in the complex approach of the patient with CLBP. Moreover, the knowledge of these factors can provide support for health professionals to choose more effective therapeutic approaches.

Acknowledgments

Elena Sirbu and Simona Szasz have contributed equally to the study.

Conflict of interest

The authors declare no conflict of interest.

References

1. Key J. The problem of back pain. In: Key J, editor. Back Pain – A Movement Problem: A clinical approach incorporating relevant research and practice. Edinburgh: Churchill Livingstone; 2010; 3-10.

2. eumusc.net. Musculoskeletal Health in Europe Report v5.0. Available at: http://www.eumusc.net/myUploadData/files/Musculoskeletal Health in Europe Report v5.pdf.

3. Busse R, Schreyögg J, Smith PC. Variability in healthcare treatment costs amongst nine EU countries – results from theHealthBASKET project. Health Econ 2008; 17: S1-8.

4. Sathya P, Ramakrishnan KS, Shah PP. Prevalence of depression, anxiety and stress in patients with mechanical low back pain. Int J Ther Rehabil Res 2015; 4: 67-72.

5. Hiyama A, Watanabe M, Katoh H, Sato M, Sakai D, Mochida J. Effect of depression and neuropathic pain using questionnaires on quality of life in patients with low back pain; cross-sectional retrospective study. Eur Spine J 2016; 25: 2750-60.

6. Manchikanti L, Fellows B, Pampati V, Beyer C, Damron K, Barnhill RC. Comparison of the psychological status of

Elena Sirbu, Roxana Ramona Onofrei, Simona Szasz, Monica Susan

chronic pain patients and the general population. Pain Physician 2002; 5: 40-8.

7. Tsuji T, Matsudaira K, Sato H, Vietri J. The impact of depression among chronic low back pain patients in Japan. BMC Musculoskelet Disord 2016; 17: 447.

8. López-López D, Vilar-Fernández JM, Calvo-Lobo C, LosaIglesias ME, Rodriguez-Sanz D, Becerro-de-BengoaVallejo R. Evaluation of depression in subacute low back pain: a case control study. Pain Physician 2017; 20: E499-E506.

9. López-López D, Becerro-de-Bengoa-Vallejo R, LosaIglesias ME, Rodríguez-Sanz D, Palomo-López P, CalvoLobo C. Relationship between depression scores and degree of skin perspiration: a novel cross-sectional study. Int Wound J 2019; 16: 139-43.

10. Calvo-Lobo CC, Vilar-Fernández JM, Losa-Iglesias ME, et al. Depression symptoms among older adults with and without subacute low back pain. Rehabil Nurs 2019; 44: 47-51.

11. Baskan E, Yagci N, Cavlak U. Factors affecting body awareness in older adults with chronic musculoskeletal pain. Arch Med Sci 2021; 17: 934-9.

12. Kusztal M, Trafidło E, Madziarska K, et al. Depressive symptoms but not chronic pain have an impact on the survival of patients undergoing maintenance hemodialysis. Arch Med Sci 2018; 14: 265-275.

13. Leung L. Pain catastrophizing: an updated review. Indian J Psychol Med 2012; 34: 204-17.

14. Craner JR, Sperry JA, Evans MM. The relationship between pain catastrophizing and outcomes of a 3-week comprehensive pain rehabilitation program. Pain Med 2016; 17: 2026-35.

15. Sullivan MJL, Bishop SR, Pivik J. The pain catastrophizing scale: development and validation. Psychol Assess 1996; 7: 524-32.

16. Meints SM, Mawla I, Napadow V, et al. The relationship between catastrophizing and altered pain sensitivity in patients with chronic low-back pain. Pain 2019; 160: 833-43.

17. San-Antolín M, Rodríguez-Sanz D, Becerro-de-BengoaVallejo R, et al. Central sensitization and catastrophism symptoms are associated with chronic myofascial pain in the gastrocnemius of athletes. Pain Med 2020; 21: 1616-25.

18. Huysmans E, Ickmans K, Van Dyck D, et al. Association between symptoms of central sensitization and cognitive behavioral factors in people with chronic nonspecific low back pain: a cross-sectional study. J Manipulative Physiol Ther 2018; 41: 92-101.

19. Shigetoh H, Tanaka Y, Koga M, Osumi M, Morioka S. The mediating effect of central sensitization on the relation between pain intensity and psychological factors: a cross-sectional study with mediation analysis. Pain Res Manag 2019; 2019: 3916135.

20. Aoyagi K, He J, Nicol AL, et al. A subgroup of chronic low back pain patients with central sensitization. Clin J Pain 2019; 35: 869-79.

21. Davidson M, Keating JL. A Comparison of Five Low Back Disability Questionnaires: reliability and responsiveness. Phys Ther 2002; 82: 8-24.

22. Copay AG, Glassman SD, Subach BR, Berven S, Schuler TC, Carreon LY. Minimum clinically important difference in lumbar spine surgery patients: a choice of methods using the Oswestry Disability Index, Medical Outcomes Study Questionnaire Short Form 36, and Pain Scales. Spine J 2008; 8: 968-74.

23. Beck AT, Ward CH, Mendelson M, Mock J, Erbaugh J. An inventory for measuring depression. Arch Gen Psychiatry 1961; 4: 561-71.

Predictors of disability in patients with chronic low back pain

24. Faul F, Erdfelder ER, Lang AG, Buchner A. G*Power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav Res Methods 2007; 39: 175-91.

25. Heapy A, LaChappelle K, Higgins D, et al. Demographic, psychological, and clinical predictors of Roland Morris Disability Questionnaire score among patients with chronic low back pain. J Pain 2016; 17: S4-5.

26. Raftery MN, Sarma K, Murphy AW, De la Harpe D, Normand C, McGuire BE. Chronic pain in the Republic of Ireland – community prevalence, psychosocial profile and predictors of pain-related disability: results from the Prevalence, Impact and Cost of Chronic Pain (PRIME) study, Part 1. Pain 2011; 152: 1096-103.

27. McIntyre A, Alibrahim F, Mehta S, et al. Predictors of pain disability among individuals who use opioids attending a chronic pain clinic. Arch Phys Med Rehabil 2018; 99: e64.

28. Crowell A, Younger J, Lobato R, et al. Demographic and psychosocial predictors of disability due to pain. J Pain 2007; 8: S76.

29. Lötters F, Franche RL, Hogg-Johnson S, Burdorf A, Pole JD. The prognostic value of depressive symptoms, fear-avoidance, and self-efficacy for duration of lost-time benefits in workers with musculoskeletal disorders. Occup Environ Med 2006; 63: 794-801.

30. Häuser W, Schmutzer G, Brähler E, Schiltenwolf M, Hilbert A. The impact of body weight and depression on low back pain in a representative population sample. Pain Med 2014; 15: 1316-27.

31. Schmidt CO, Raspe H, Pfingsten M, et al. Back pain in the german adult population: prevalence, severity, and sociodemographic correlates in a multiregional survey. Spine 2007; 32: 2005-11.

32. Webb R, Brammah T, Lunt M, Urwin M, Allison T, Symmons D. Prevalence and predictors of intense, chronic, and disabling neck and back pain in the UK general population. Spine 2003; 28: 1195-202.

33. Thomas EN, Pers YM, Mercier G, et al. The importance of fear, beliefs, catastrophizing and kinesiophobia in chronic low back pain rehabilitation. Ann Phys Rehabil Med 2010; 53: 3-14.

34. Ogunlana MO, Odole AC, Adejumo A, Odunaiya N. Catastrophising, pain, and disability in patients with nonspecific low back pain. Hong Kong Physiother J 2015; 33: 73-9.

35. Woby SR, Watson PJ, Roach NK, Urmston M. Are changes in fear-avoidance beliefs, catastrophizing, and appraisals of control, predictive of changes in chronic low back pain and disability? Eur J Pain 2004; 8: 201-10.

36. Jensen MP, Romano JM, Turner JA, Good AB, Wald LH. Patient beliefs predict patient functioning: further support for a cognitive-behavioural model of chronic pain. Pain 1999; 81: 95-104.

37. Peters ML, Vlaeyen JWS, Weber WEJ. The joint contribution of physical pathology, pain-related fear and catastrophizing to chronic back pain disability. Pain 2005; 113: 45-50.

38. van den Hout JHC, van den Vlaeyen JWS, Heuts PHTG, Sillen WJT. Functional disability in nonspecific low back pain: the role of pain-related fear and problem-solving skills. Int J Behav Med 2001; 8: 134-48.

39. Mannion AF, Junge A, Taimela S, Müntener M, Lorenzo K, Dvorak J. Active therapy for chronic low back pain: part 3. Factors influencing self-rated disability and its change following therapy. Spine 2001; 26: 920-9.

40. Chaves JF, Brown JM. Spontaneous cognitive strategies for the control of clinical pain and stress. J Behav Med 1987; 10: 263-76.

Med Sci 1, 1st January / 2023 99

41. de Boer MJ, Struys MMRF, Versteegen GJ. Pain-related catastrophizing in pain patients and people with pain in the general population. Eur J Pain 2012; 16: 1044-52.

42. Severeijns R, Vlaeyen JWS, van den Hout MA, Weber WEJ. Pain catastrophizing predicts pain intensity, disability, and psychological distress independent of the level of physical impairment. Clin J Pain 2001; 17: 165-72.

43. Severeijns R, van den Hout MA, Vlaeyen JWS, Picavet HSJ. Pain catastrophizing and general health status in a large Dutch community sample. Pain 2002; 99: 367-76.

44. Ramírez-Maestre C, Esteve R, Ruiz-Párraga G, GómezPérez L, López-Martínez AE. The key role of pain catastrophizing in the disability of patients with acute back pain. Int J Behav Med 2017; 24: 239-48.

45. Picavet HSJ, Vlaeyen JWS, Schouten JSAG. Pain catastrophizing and kinesiophobia: predictors of chronic low back pain. Am J Epidemiol 2002; 156: 1028-34.

46. Woby SR, Urmston M, Watson PJ. Self-efficacy mediates the relation between pain-related fear and outcome in chronic low back pain patients. Eur J Pain 2007; 11: 711-8.

47. Turner JA, Jensen MP, Romano JM. Do beliefs, coping, and catastrophizing independently predict functioning in patients with chronic pain? Pain 2000; 85: 115-25.

48. Rosenstiel AK, Keefe FJ. The use of coping strategies in chronic low back pain patients: relationship to patient characteristics and current adjustment. Pain 1983; 17: 33-44.

49. Sullivan MJL, Sullivan ME, Adams HM. Stage of chronicity and cognitive correlates of pain-related disability. Cogn Behav Ther 2002; 31: 111-8.

50. Vienneau TL, Clark AJ, Lynch ME, Sullivan MJL. Catastrophizing, functional disability and pain reports in adults with chronic low back pain. Pain Res Manag 1999; 4: 93-6.

51. Sullivan MJL, Stanish W, Waite H, Sullivan M, Tripp DA. Catastrophizing, pain, and disability in patients with soft-tissue injuries. Pain 1998; 77: 253-60.

52. Amaricai E, Poenaru DV. The post-stroke depression and its impact on functioning in young and adult stroke patients of a rehabilitation unit. J Ment Health 2016; 25: 137-41.

53. Ericsson M, Poston WSC, Linder J, Taylor JE, Haddock CK, Foreyt JP. Depression predicts disability in long-term chronic pain patients. Disabil Rehabil 2002; 24: 334-40.

54. Hung CI, Liu CY, Fu TS. Depression: an important factor associated with disability among patients with chronic low back pain. Int J Psychiatry Med 2015; 49: 187-98.

55. Campbell P, Hope K, Dunn KM. The pain, depression, disability pathway in those with low back pain: a moderation analysis of health locus of control. J Pain Res 2017; 10: 2331-9.

Elena Sirbu, Roxana Ramona Onofrei, Simona Szasz, Monica Susan

Clinical study on prevention of atopic dermatitis by oral administration of probiotics in infants

1Department of Dermatology, First Affiliated Hospital of Dalian Medical University, Dalian, Liaoning, China

2Department of Taian, The 960 Hospital of the PLA, Taian, Shandong, China

Submitted: 17 June 2020; Accepted: 9 September 2020

Online publication: 5 November 2020

Arch Med Sci 2023; 19 (1): 101–106

DOI: https://doi.org/10.5114/aoms.2020.100639

Copyright © 2020 Termedia & Banach

Abstract

Introduction: This study aimed to investigate the preventive effects of oral administration of probiotics on the incidence and severity of atopic dermatitis (AD) in infants.

Material and methods: A total of 396 full-term infants were enrolled in this study. Of these, 132 newborns without a family history of AD were assigned to group A, and the other 264 newborns were randomly divided into groups B and C. Infants in groups A and B were solely breastfed, while probiotics were administered to those in group C as well as breastfeeding. The information of all subjects was recorded, and the incidence of AD was followed up. The levels of serum IgE and IL-4 were measured at the age of 3 years.

Results: The incidence of AD in infants in group B was higher than that in group A at 3 months, 4–6 months, and 7–36 months after birth, together with increased symptom scores. For infants in group C, the incidence of AD at 4–6 months and 7–36 months after birth and the SCORAD scores at 0–3 months and 4–6 months after birth were lower than those in group B. The levels of IgE and IL-4 in group B were higher than those in groups A and C at 36 months old.

Conclusions: Adding probiotics could favor the establishment of the intestinal microecological balance in the neonatal period, thereby reducing the incidence of AD, decreasing the levels of serum immune indexes and alleviating the severity of the disease.

Key words: atopic dermatitis, probiotics, neonatal period, SCORAD scores, breastfeeding.

Introduction

As one of the most concerning diseases in dermatology, atopic dermatitis (AD) is a common chronic, recurrent and inflammatory dermatosis that is often seen in children, and which is accompanied by a food allergy, allergic rhinitis, and allergic asthma. The patients have severe itching, which seriously affects their quality of life [1–3]. Approximately 45% of the patients developed the disease, which was characterized by pruritus, pleomorphism, and a tendency of exudation, within 6 months after birth.

In the past 30 years, the incidence of AD has increased yearly, reaching 15–30% in children and 2–10% in adults [4, 5]. Because the pathogenesis of AD has not been fully elucidated, there are still difficulties in the treatment of AD. It has been suggested that vascular endothelial

Corresponding author: Hui Li

Department of Taian The 960 Hospital of the PLA, 271 Huanshan St Taishan District Taian 271000, China Phone: 05388839479 E-mail: lihui523600@163.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Jia-Huan He1, Xin-Guo Zhao2, Feng Sun2, Wen-Qi Peng2, Huan-Yun Li2, Hui Li2

growth factor (VEGF) and cell adhesion molecules correlate well with inflammation, favoring infiltration of the target tissue by mononuclear cells and thus causing the initiation and progression of the disease [6, 7]. Free radicals such as O2−•, cytokines such as tumor necrosis factor a (TNF-a), adhesion molecules, dyslipidemia, and innate and adaptive immune responses may favor the vascular damage [8]. Thus, it is necessary to explore the pathogenesis and methods of prevention of AD.

The present study aimed to analyze the incidence of AD, together with the immune status of infants with AD and a family history of atopic disease, by adding probiotics to food and exploring the preventive effect of oral probiotics on the incidence and severity of AD in infants.

Material and methods

Study subjects

In the present study, 396 full-term infants were admitted as the main subjects. Of these, 132 newborns without a family history were allocated to group A, and 264 newborns with a family history of atopic disease were randomly divided into groups B and C. Infants in group A and group B were solely breastfed, while probiotics were fed to infants in group C in addition to breastfeeding. A family history of atopic disease refers to any member of the family who has AD, allergic asthma or allergic rhinitis, or other allergic diseases. The present study was in accordance with the Declaration of Helsinki of the World Medical Association and had been approved by the Ethics Committee of the hospital. The parents of all the infants signed their informed consent.

Inclusion and exclusion criteria

The inclusion criteria were as follows: 1) infants with 37 weeks ≤ gestational age (GA) < 42 weeks and 2,500 g ≤ birth weight < 4,000 g; 2) infants without a history of intracranial hemorrhage, suffocation, rescue, infection, and congenital diseases, with the Apgar score > 7 points; 3) no history of special medication, drug or alcohol abuse, or radiation exposure during pregnancy. Parents provided informed consent and accepted the breastfeeding plan without supplementary food for 6 months.

The exclusion criteria were as follows: 1) maternal complications during pregnancy; 2) small for gestational age; 3) infants being bottle-fed; and 4) infants whose mothers had chronic basic primary diseases such as diabetes, hyperthyroidism, and other endocrine diseases, chronic cardiopulmonary diseases, rheumatism, rheumatoid arthritis, chronic infectious diseases, or neurological and mental diseases.

Methods

All the newborns were breastfed. Infants in group A and group B were given no supplements, while infants in group C received Clostridium caseinate live powder produced by Qingdao Donghai pharmaceutical (Clostridium butyricum powder, 500 mg in each bag, 1.5 × 107 CFU/g of Clostridium butyricum in each bag) within 1–2 weeks after birth. The powder was administered a half bag at a time and twice daily, delivered with warm boiled water for ten days. The incidence of AD was followed up, and the serum levels of IgE and IL-4 were measured when the children reached the age of three.

Observation indexes and detection

AD could be diagnosed if three or more of the following five items were met: 1) history of skin involvement on the flexion side, including the elbow, popliteal fossa, anterior malleolus, or neck; 2) with a history or family history of other atopic diseases; 3) dryness of the skin; 4) existence of flexural eczema; and 5) with the onset of the disease before 2 years old. In the present study, since the participants were all infants with AD, the subjective symptom description was not accurate. Therefore, the SCORAD scoring method was used: i.e., A/5 + 7B/2, where A represents the area of skin lesions, with the scores ranging between 0 and 100 points; and B represents the severity of skin lesions, including six aspects: erythema, edema, desquamation, bryogenesis, exudation, and dryness, with 0–3 points allocated for each aspect, giving 0–18 points in total. Serum immunoglobulin E (IgE) and interleukin-4 (IL-4) were determined by the double-antibody sandwich ELISA. The unit of IgE was IU/ml, and that of IL-4 was pg/ml.

Infants’ information collection

The children’s electronic website was established, and the health files for all subjects were set. The probiotics treatment was completed within two to three weeks after birth. Physical examination was carried out 42 days, 3 months, 6 months, 9 months, 12 months, 18 months, 24 months, 30 months, and 36 months after birth. The infants were observed and followed up to collect data, so as to investigate the feeding condition, the existence of the disease, drug administration, and to guide treatment and nursing.

Statistical analysis

SPSS 20.0 software was used for statistical analysis. The measurement data were expressed as means ± standard deviations (x ± SD) and counting data in percentage (%). The P-P chart method was used to test the normality, and Lev-

Jia-Huan He, Xin-Guo Zhao, Feng Sun, Wen-Qi Peng, Huan-Yun Li, Hui Li

Table I. Comparison of general conditions (x ± SD)

Variable Male Female Complete Fall off Gestational age [week]

Birth weight [kg] Body length [cm] Type/effect

Group A 68 64 116 16 38.6 ±0.83 3.43 ±0.37 50.67 ±1.42 Normal

Group B 67 65 114 18 38.5 ±0.86 3.42 ±0.39 50.65 ±1.38 Normal

Group C 66 66 111 21 38.7 ±0.81 3.44 ±0.45 50.66 ±1.40 Normal

Value (F or c 2) 0.0611 0.8021 1.6182 0.0692 0.0062 8/23 Frameshift variant

P -value 0.970 0.670 0.251 0.934 0.994 8/23 Normal

1c2 value; 2F value.

ene’s test was used to test the homogeneity of variance. Univariate analysis of variance was used for multi-group comparison, and LSD was used for the post-test. A nonparametric test was used for comparison between groups that did not conform to the normal distribution. The counting data were expressed in frequency or rate, and the Pearson c2 test was used to compare the differences between groups. P-value < 0.05 was considered statistically significant.

Results

General characteristics

A total of 396 newborns who met the inclusion criteria were included in the present study. Of these, 132 newborns without a family history of AD were allocated to group A, and 264 newborns with a family history of AD were randomly divided into groups B and C. During the followup, 55 cases exited the study. The main reasons were the changes in residence, the poor compliance of family members, and the changes in feeding methods. There was no significant difference in the drop-out rate in each group. There was no significant difference in the living environment or the climate environment of the newborns and their parents. There was no significant difference in gender, birth weight, body length, age, and gestational age between groups (p > 0.05) (Table I).

Incidence and severity of AD

Incidence and severity of AD at 3 months after birth

The incidence of AD in group B was significantly higher than that in group A at 3 months after birth, and the difference was statistically significant (p < 0.05). The SCORAD score at 3 months after birth in infants in group B was significantly higher than that in group A, and the difference was statistically significant (p < 0.05). The SCORAD score at 3 months after birth in infants in group C was significantly lower than that in group B, and the

Table II. Comparison of incidence of AD in 0–3 months (x ± SD)

Variable Total number Incidence of AD (%) SCORAD scores

Group A 116 24 (20.68) 12.72 ±2.21

Group B 114 41 (35.96)* 34.26 ±2.98*

Group C 111 34 (30.63) 27.51 ±1.51*# Value (F or c 2) – 6.715a 2600.494b

P -value – 0.035 < 0.001

ac2 value, bF value; pair-wise comparison,*compared with group A, p < 0.05; #compared with group B, p < 0.05.

Table III. Comparison of incidence of AD in 3–6 months

Variable Total number Incidence of AD (%) SCORAD scores

Group A 116 31 (26.72) 22.97 ±4.95

Group B 114 78 (68.42)* 45.06 ±5.16*

Group C 111 41 (36.94)# 26.91 ±5.01*#

Value (F or c 2) – 43.893a 624.518b

P -value – < 0.001 < 0.001

ac2 value, bF value; pair-wise comparison,*compared with group A, p < 0.05; #compared with group B, p < 0.05.

difference was statistically significant (p < 0.05) (Table II).

Incidence and severity of AD at 4–6 months after birth

As shown in Table III, the incidence of AD in group B was significantly higher than that in group A at 4–6 months after birth, and the difference was statistically significant (p < 0.05). The symptom score at 4–6 months after birth in infants in group B was significantly higher than that in group A, and the difference was statistically significant (p < 0.05). The incidence of AD and the SCORAD score at 4–6 months after birth in infants

Clinical study on prevention of atopic dermatitis by oral administration of probiotics in infants

Table IV. Comparison of incidence of AD in 6–36 months

Group Total number Incidence of AD(%)

A 116 2 (1.72)

B 114 26 (22.81)*

C 111 11 (8.27)*#

Fisher’s precise test showed that c2 = 25.610, p < 0.001; pair-wise comparison, *compared with group A, p < 0.05; #compared with group B, p < 0.05.

Table V. Comparison of serum indicators at

36 months

Variable TIgE [IU/ml] IL-4 [pg/ml]

Group A 15.18 ±8.15 2.18 ±1.56

Group B 147.21 ±52.66* 9.11 ±2.97*

Group C 85.19 ±40.25*# 5.09 ±2.12*#

F value 339.834 265.460

P -value < 0.001 < 0.001

F-test was used for uneven variance; pair-wise comparison, *compared with group A, p < 0.05; #compared with group B, p < 0.05.

in group C was significantly lower than those in group B, and the difference was statistically significant (p < 0.05).

Incidence and severity of AD at 7–36 months after birth

The incidence of AD in group B was significantly higher than in group A at 7–36 months after birth, and the difference was statistically significant (p < 0.05). The incidence of AD in group C was significantly lower than that in group B at 7–36 months after birth, and the difference was statistically significant (p < 0.05) (Table IV).

Comparison of levels of IgE and IL-4 at 36 months old

The levels of TIgE and IL-4 in infants in group B were significantly higher than those in group A at 36 months old, and the difference was statistically significant (p < 0.05). The levels of TIgE and IL-4 in infants in group C were significantly lower than those in group B at 36 months old, and the difference was statistically significant (p < 0.05) (Table V).

Discussion

Many researchers have investigated AD and believe that the underdevelopment of skin barrier, metabolism, and gastrointestinal function, together with the family history, conditions during

pregnancy, postnatal lifestyle, and environment, were closely correlated with the occurrence of AD [9–12]. The symbiotic microbial ecosystem formed by the intestinal flora is directly involved in human digestion, absorption, energy supply, immune regulation, fat metabolism, and many other aspects. It was previously reported in the literature that probiotics suppress the Th2 response and production of IL-4, IL-5, and IL-13 cytokines, and increase IL-10 and TGF-β levels by inducing Treg cell function [13–15]. In the intestines, probiotics can stimulate the body to establish a perfect immune system. They then activate T lymphocytes, promote the proliferation of T lymphocytes, and play a positive role in the construction of the immune system in newborns [16–18].

At birth, the intestinal tract is sterile, and the immune system has not yet developed. During the process of growth, the intestinal flora begins to colonize and gradually reaches a stable state around the age of two. Under normal circumstances, the intestinal flora creates the immune response, putting the health of the host into a balanced state. The human body’s microbial ecosystem is in dynamic balance with the health of the body, the surrounding environment, and diet throughout life. Studies [19–22] have shown that, in the early stage of life, if the exposure of microorganisms is reduced, the immune system of the body will be out of balance, leading to the occurrence of allergy-related atopic diseases. Thus, the “hygiene hypothesis” was proposed that early exposure to probiotics might promote the immune response, restore immune balance, and exert effects in the prevention and treatment of allergic atopic diseases [23–25].

The main atopic disease is generally anaphylaxis, in which the IgE antibody is the main factor of anaphylaxis, and IL-4 is the cytokine derived from T helper lymphocyte, which can promote the synthesis of IgE. IgE-related intestinal flora disorder in AD was revealed through high throughput sequencing technology by foreign researchers [26]. In the present study, it was found that the incidence of AD in infants with a family history was higher than in those without a family history, and the symptom score increased significantly in the former group, suggesting that the development of the disease was closely correlated with genetic factors. After taking prophylactic treatments, the incidence of AD at 3–6 months and 24–36 months after birth, and the SCORAD scores at 0–3 months and 3–6 months in infants with a family history, were lower. These indicated that the application of probiotics in early life might reduce the incidence of disease. At 36 months, the levels of TIgE and IL-436 in group B were higher than those in group A, while the levels decreased significantly in group C. Thus, it could

Jia-Huan He, Xin-Guo Zhao, Feng Sun, Wen-Qi Peng, Huan-Yun Li, Hui Li

be postulated that the addition of probiotics in the neonatal period might reduce the incidence and severity of AD in infants with a family history, and the mechanism might be correlated with the improvement of serum immune indexes.

We found that the oral administration of probiotics could reduce the incidence of AD in infants with a family history of atopic disease, as well as relieving the symptoms and significantly improving the levels of IgE and IL-4, which were regarded as important serum indexes of transient hypersensitivity. These observations suggest that probiotics could inhibit the high sensitivity state of the body and reduce the tendency of AD to occur, which means that probiotics might play a preventive role in the occurrence of other diseases such as allergic rhinitis and allergic asthma. The application of probiotics in early life, to intervene and improve the immune system of the newborn, is of great significance for the primary prevention of certain atopic diseases. The mechanism might be related to the regulation of the expression of inflammatory factors. Therefore, we recommend that in newborns with a family history of atopic diseases, the administration of appropriate probiotics might favor the formation of intestinal microecology and the establishment of microecology balance, and further improve the immune system.

There were some limitations to the present study. First, the sample size included in the present study was small, and it is necessary to increase the sample size and carry out multi-center clinical research. Second, the observation duration of the present study was short, and a long-term followup study is still needed.

In conclusion, adding probiotics could favor the establishment of the intestinal microecological balance in the neonatal period, thereby reducing the incidence of AD, decreasing the levels of serum immune indexes, and alleviating the severity of the disease.

Acknowledgments

Jia-huan He and Xin-guo Zhao are co-first authors.

We would like to acknowledge the hard and dedicated work of all the staff who implemented the intervention and evaluation components of the study.

Conflict of interest

The authors declare no conflict of interest.

3. Jhamnani RD, Levin S, Rasooly M, et al. Impact of food allergy on the growth of children with moderate-severe atopic dermatitis. J Allergy Clin Immunol 2018; 141: 1526-9.

4. Gabes M, Chamlin SL, Lai JS, Cella D, Mancini AJ, Apfelbacher CJ. A study looking at changes in scores over time when using the childhood atopic dermatitis impact scale. Br J Dermatol 2020; 182: e67.

5. Ramadan M, Solyman S, Yones M, Abdallah Y, Halaby H, Hanora A. Skin microbiome differences in atopic dermatitis and healthy controls in Egyptian children and adults, and association with serum immunoglobulin E. OMICS 2019; 23: 247-60.

6. Murdaca G, Spanò F, Miglino M, Puppo F. Effects of TNF-alpha inhibitors upon the mechanisms of action of VEGF. Immunotherapy 2013; 5: 113-5.

7. Murdaca G, Colombo BM, Cagnati P, Gulli R, Spanò F, Puppo F. Endothelial dysfunction in rheumatic autoimmune diseases. Atherosclerosis 2012; 224: 309-17.

8. Murdaca G, Spanò F, Cagnati P, Puppo F. Free radicals and endothelial dysfunction: potential positive effects of TNF-alpha inhibitors. Redox Report 2013; 18: 95-9.

9. Huang T, Chen Y, Lin S, et al. Treatment of atopic dermatitis with dupilumab in Taiwan: dynamic changes of IgE levels as a potential response biomarker. Eur J Dermatol 2019; 29: 658-9.

10. Qin G, Huang J, Pan Y, et al. Topical ozone application: an innovative therapy for infantile atopic dermatitis. Zhong Nan Da Xue Xue Bao Yi Xue Ban 2018; 43: 163-7.

11. Brunner PM, Israel A, Zhang N, et al. Early-onset pediatric atopic dermatitis is characterized by t h 2/t h 17/t h 22-centered inflammation and lipid alterations. J Allergy Clin Immunol 2018; 141: 2094-106.

12. Sorokman TV, Sokolnyk SV, Babiy OR, Lozyik IY. Immunological parameters and cortisol levels in children with atopic dermatitis. Arch Balkan Med Union 2018; 53: 210-6.

13. Marschan E, Kuitunen M, Kukkonen K, et al. Probiotics in infancy induce protective immune profiles that are characteristic for chronic low-grade inflammation. Clin Exp Allergy 2008; 38: 611-8.

14. Soh SE, Aw M, Gerez I, et al. Probiotic supplementation in the first 6 months of life in at risk Asian infants – effects on eczema and atopic sensitization at the age of 1 year. Clin Exp Allergy 2009; 39: 571-8.

15. Yao F, Jia R, Huang H, et al. Effect of Lactobacillus paracasei N1115 and fructooligosaccharides in nonalcoholic fatty liver disease. Hepatology 2019; 15: 1336-44.

16. Klinnert MD, Booster G, Copeland M, et al. Role of behavioral health in management of pediatric atopic dermatitis. Ann Allergy Asthma Immunol 2018; 120: 42-8.

17. Kim BE, Leung DYM. Significance of skin barrier dysfunction in atopic dermatitis. Allergy Asthma Immunol Res 2018; 10: 207-15.

18. Shinohara M, Matsumoto K. Atopic dermatitis and environmental factors associated with skin responses during infancy. J Allergy Clin Immunol 2019; 143: ab158.

19. Savilahti EM, Kukkonen AK, Haahtela T, Tuure T, Kuitunen M, Savilahti E. Intestinal defensin secretion in infancy is associated with the emergence of sensitization and atopic dermatitis. Clin Exp Allergy 2012; 42: 405-11.

References

1. Lucia B. Atopic dermatitis. Nat Rev Dis Primers 2018; 4: 2.

2. Dinakar C, Fineman SM, Tilles SA. Recent advances in atopic dermatitis. Ann Allergy Asthma Immunol 2018; 120: 8-9.

20. Takahata Y, Sugita T, Kato H, Nishikawa A, Hiruma M, Muto M. Cutaneous malassezia flora in atopic dermatitis differs between adults and children. Br J Dermatol 2008; 157: 1178-82.

21. Bisgaard H, Li N, Bonnelykke K, et al. Reduced diversity of the intestinal microbiota during infancy is associated with increased risk of allergic disease at school age. J Allergy Clin Immunol 2011; 128: 646-52.e5.

Clinical study on prevention of atopic dermatitis by oral administration of probiotics in infants

22. Sarkar S. Probiotic therapy for gastro-intestinal allergenic infants: a preliminary review. Br Food J 2007; 109: 481-92.

23. Flohr C, Pascoe D, Williams HC. Atopic dermatitis and the ‘hygiene hypothesis’: too clean to be true? Br J Dermatol 2005; 152: 202-16.

24. Enomoto T, Sowa M, Nishimori K, et al. Clinical effects of probiotic Bifidobacterium breve supplementation in adult patients with atopic dermatitis. Yonago Acta Medica 2010; 53: 37-45.

25. Prescott SL, Dunstan JA, Hale J, et al. Clinical effects of probiotics are associated with increased interferon-gamma responses in very young children with atopic dermatitis. Clin Exp Allergy 2006; 35: 1557-64.

26. Kasperkiewicz M, Schmidt E, Ludwig RJ, Zillikens D. Targeting IgE antibodies by immunoadsorption in atopic dermatitis. Front Immunol 2018; 9: 254.

Jia-Huan He, Xin-Guo Zhao, Feng Sun, Wen-Qi Peng, Huan-Yun Li, Hui Li

Piotr Zapała1, Aleksander Ślusarczyk1, Paweł Rajwa2, Mikołaj Przydacz3, Wojciech Krajewski4, Bartosz Dybowski5, Przemysław Kubik6, Błażej Kuffel6, Maciej Przudzik7, Rafał Osiecki8, Remigiusz Stamirowski9, Łukasz Zapała1, Mieszko Kozikowski8, Dominik Chorągwicki3, Magdalena Szymańska6, Paweł Kiełb4, Bartosz Małkiewicz4, Jacek Zostawa2, Marek Roslan7, Joanna Zajączkowska9, Marcin Jarzemski10, Bartosz Brzoszczyk10, Piotr Petrasz9, Piotr Jarzemski10, Romuald Zdrojowy4, Jakub Dobruch8, Andrzej Paradysz2, Tomasz Drewa6, Piotr Chłosta3, Piotr Radziszewski1

1Department of General, Oncological and Functional Urology, Medical University of Warsaw, Warsaw, Poland

2Department of Urology, Medical University of Silesia, Katowice, Poland

3Department of Urology, Jagiellonian University Medical College, Krakow, Poland

4Department of Urology and Oncologic Urology, Wroclaw Medical University, Wroclaw, Poland

5Department of Urology, Roefler Memorial Hospital, Pruszkow, Poland

6Department of General and Oncologic Urology, Antoni Jurasz University Hospital No. 1, Bydgoszcz, Poland

7Department of Urology, Faculty of Medicine, University of Warmia and Mazury, Olsztyn, Poland

8Department of Urology, Centre of Postgraduate Medical Education, Professor W. Orłowski Independent Public Teaching Hospital, Warsaw, Poland

9Department of Urology and Urooncology, Multispecialty Regional Hospital, Gorzow Wielkopolski, Poland

10Department of Urology, Jan Biziel University Hospital, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Torun, Poland

Submitted: 9 October 2020; Accepted: 27 November 2020

Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 107–115

DOI: https://doi.org/10.5114/aoms/130927

Copyright © 2020 Termedia & Banach

Abstract

Introduction: In the majority of Western European countries, the coronavirus disease (COVID-19) pandemic has led to a dramatic reduction in urooncological surgeries. Our objective was to evaluate the impact of the pandemic on volume and patterns of urooncological surgery in Poland.

Material and methods: This is a retrospective analysis of 10 urologic centres in Poland. Data regarding major oncological procedures performed after the COVID-19 pandemic outbreak (March 15, 2020 – May 31, 2020) were evaluated and compared with data from the respective period in 2019.

Results: Between March 15, 2020 and May 31, 2020, a total of 968 oncological procedures were performed in participating centres. When compared to the respective period in 2019 (1063 procedures) the overall number of surgeries declined by 8.9%. The reduction was observed for transurethral resection of bladder tumour (TURBT) (20.1%) and partial nephrectomies (PN) (16.5%). Surgical activity considering radical nephrectomy (RN), nephroureterectomy (NU), and radical prostatectomy (RP) remained relatively un -

Corresponding author: Aleksander Ślusarczyk MD Department of General, Oncological and Functional Urology Medical University of Warsaw Warsaw, Poland E-mail: slusarczyk. aleksander@gmail.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Not as black as it is painted? The impact of the first wave of COVID-19 pandemic on surgical treatment of urological cancer patients in Poland – a cross-country experience

P. Zapała, A. Ślusarczyk, P. Rajwa, M. Przydacz, W. Krajewski, B. Dybowski, P. Kubik, B. Kuffel, M. Przudzik, R. Osiecki, R. Stamirowski, Ł. Zapała, M. Kozikowski, D. Chorągwicki, M. Szymańska, P. Kiełb, B. Małkiewicz, J. Zostawa, M. Roslan, J. Zajączkowska, M. Jarzemski, B. Brzoszczyk, P. Petrasz, P. Jarzemski, R. Zdrojowy, J. Dobruch, A. Paradysz, T. Drewa, P. Chłosta, P. Radziszewski

changed, whereas radical cystectomy (RC) burden showed a significant increase (90.9%). Characteristics of patients treated with TURBT, RC, NU, PN, and RN did not differ significantly between the compared periods, whereas RP in the COVID-19 period was performed more frequently in patients with a higher grade group ( p = 0.028) and positive digital rectal examination ( p = 0.007).

Conclusions: Surgical activity for urological cancers in Poland has been maintained during the first wave of the COVID-19 pandemic. The Polish strategy in the initial period of the COVID-19 crisis mirrors the scenario of hard initial lockdown followed by adaptive lockdown, during which oncological care remained undisrupted and did not require particular priority triage.

Key words: coronavirus, urological cancer, COVID-19, SARS-CoV-2, urooncological surgery.

Introduction

In late December 2019, an outbreak of unexplained cases of pneumonia was reported in Wuhan, China [1]. After determining the aetiological pathogen as a novel Betacoronavirus and clinical presentation of infection similar to Severe Acute Respiratory Syndrome (SARS), the virus has been officially named SARS-CoV-2 (Severe Acute Respiratory Syndrome Coronavirus 2) [2]. The rapid spread of SARS-CoV-2 reported globally in the preceding weeks led to the coronavirus disease 2019 (COVID-19) being declared a public health emergency of international concern [3]. During February 2020 Europe witnessed a massive outbreak in Italy starting in the Lombardy region. Over the following weeks, rapid pandemic spread was observed, at first in the northern, more polluted provinces [4], reaching eventually a total of 97,869 confirmed cases and 10,779 deaths by the end of March in the whole of Italy [5]. The shift of focus towards critically ill individuals with SARS-CoV-2, presenting commonly as complex cases with comorbidities [6], led to a dramatic shortage of access to urgent urological care [7] as well as a huge drop in planned urological surgeries [8]. The disruption in planned surgeries in Italy caused a 35.9% decrease in urooncological surgical activity during four consecutive weeks starting from February 24 [8]. In Paris, the relative reduction of urooncological procedures was estimated at 44% [9]. When considering routine clinical practice, the rapid reorganisation of healthcare led to the increasing prevalence of burnout and physical exhaustion among practising urologists [10]. According to the global survey performed by the UroSoMe group, the COVID-19 outbreak caused a delay of more than 8 weeks in an average of 31% of surgeries, with personnel shortage (27%) being the most common reason for cut-down [11]. To maintain access to the most substantial urological services and to limit clinical harm of delays, the Rapid Reaction Group of the European Association of Urology (EAU) introduced guidelines prioritising diagnosis, surgical treatment, and follow-up during the COVID-19 outbreak [12]. Although EAU guidance adapted previ-

ous recommendations to the current situation and delivered crucial support to overloaded healthcare, the timing and extent of the implementation of the guidelines in various regions remained unclear. The absolute necessity of implementing priorities has been successfully contested by Martini Klinik [13], where screening and extensive protective measures facilitated maintaining the volume of radical prostatectomy at pre-pandemic levels without compromising epidemiological safety.

At the time of writing, in Poland, since the first confirmed patient, as reported on March 4, 60,281 COVID-19 cases have been detected, including 1938 COVID-19-related deaths (5) (August 21). The spread of COVID-19 in Poland has been classified early by the World Health Organisation as community transmission, but the national healthcare infrastructure was impacted by the pandemic significantly less than in the majority of Western European countries. Although the Polish National Health Fund recommended postponing elective procedures and a significant number of hospitals were transformed into COVID-19 dedicated centres, a vast majority of caregivers have neither experienced imperative indications of urooncological service disruption nor required prioritising triage of oncological patients.

In this multicentre cross-country study, we aim to determine the impact of the first wave of the COVID-19 pandemic on the surgical treatment of urological cancer patients in Poland.

Material and methods

This nationwide study involved 10 urologic centres in Poland. Data regarding oncological surgeries performed after the outbreak of the first wave of the pandemic in 2020 (March 15, 2020 – May 31, 2020; COVID period) and in the reference period in 2019 (March 15, 2019 – May 31, 2019; pre-COVID period) were retrospectively collected. In all included centres, routine SARS-CoV-2 polymerase chain reaction (PCR) testing was implemented at admission (since April). The analysis included transurethral resection of bladder tumour (TURBT), radical nephrectomy (RN), partial nephrectomy (PN), nephroureterectomy (NU), rad-

Not as black as it is painted? The impact of the first wave of COVID-19 pandemic on surgical treatment of urological cancer patients in Poland – a cross-country experience

ical cystectomy (RC), and radical prostatectomy (RP). The number of surgeries performed, preoperative patient characteristics that could facilitate prioritising procedures, and perioperative track in the pre-COVID and COVID period were compared. The total decline in surgical activity was measured by dividing the number of procedures performed in the COVID period by the number of procedures performed in the pre-COVID period. If the number of procedures in the COVID period exceeded the number of procedures performed in the pre-COVID period, the calculation was performed inversely to obtain the rate of increase.

Research involving human participants

All procedures performed during the study were in accordance with the ethical standards of the institutional and national research committee and with the 1964 Helsinki declaration and its later amendments.

Statistical analysis

Continuous data are shown as mean values supplemented with interquartile ranges (IQR), and categorical data are presented as absolute values and percentages. Data were analysed using non-parametric methods. Differences between median values in compared periods were evaluated using Mann-Whitney U test. Associations between categorical variables were assessed using Fisher’s exact test. For all statistical analyses, a two-sided p-value < 0.05 was considered statistically significant. Statistical analyses were performed using SAS 9.4 software.

Results

Ten urological centres with an availability of 270 beds in 7 out of 16 Polish regions participated in the study (Supplementary Table SI). A total of 1063 and 968 urooncological procedures were reported in the surveyed centres during the preCOVID and COVID periods, respectively. The most common procedure performed was TURBT (626 surgeries in the pre-COVID period and 500 surgeries in the COVID period), followed by RP (190 and 199 surgeries, respectively), RN (91 and 85 surgeries, respectively), PN (97 and 81 surgeries, respectively), RC (44 and 84 surgeries, respectively), and NU (15 and 19 surgeries, respectively).

The overall number of urooncological procedures declined by 8.9%. A two-week interval timetrend comparison between both periods regarding the performed procedures is depicted in Figure 1. The highest reduction was observed in TURBT (20.1%) and PN (16.5%). The number of RP and RN remained similar in the COVID period (4.7% and 6.6% change, respectively), whereas the num-

ber of RC and NU increased by 90.9% and 26.7%, respectively.

Preoperative characteristics and length of hospitalisation (LOH) of evaluated cohorts are presented in Table I (surgeries for urothelial cancer), Table II (surgeries for renal cell cancer), and Table III (radical prostatectomy).

Discussion

This is the first nationwide analysis of urooncological treatment conducted in a country where early, strict lockdown suppressed the SARS-CoV-2 surge during the first weeks of the pandemic. Although subsequent softening of the restrictions resulted in the increasing burden of COVID-19 cases, Poland avoided overloading of the healthcare system during the first wave of the pandemic.

The evolution of a pandemic in Poland during the first months of the COVID-19 crisis differed substantially from its dramatic spread in Spain (386,054 cases – August 21), France (271,905 cases – August 21), or Italy (257,065 cases – August 21), where the COVID-19 outbreak forced rapid reorganisation of national health systems [5]. By August 21 a total of 60,281 COVID-19 cases had been detected in Poland, with 1938 related fatalities [5]. Although the Polish government introduced a national lockdown, the shift of personnel and resources in Poland remained limited, and the decline in crucial specialist medical services was less pronounced than in Western Europe. Our multi-institutional collaborative team previously reported a 22.5% decrease in urgent urologic admissions and an 11.9% decrease in urologic emergency visits during the COVID-19 pandemic in Poland [14]. Although bothersome, the decrease in emergency cases in Poland remained considerably lower than reported in Italian and Portuguese studies where observed declines exceeded 50% [7, 15].

In the present study, we report an overall reduction of planned oncological procedures by 8.9%. This modest decline cannot be compared with the healthcare crisis in Italy, where the estimated procedure reduction during the first phase of the pandemic varied from 35.9% (declared in the multicentre survey) [8] to 67% (Department of Urology in Bergamo Hospital) [16]. Although reports from Italy can be interpreted as being confounded by the particular harm this country initially experienced, the global survey conducted by the UroSoMe Working Group confirmed that Italian observations are relevant worldwide [11]. Responses of 1004 survey participants (mostly Asia, Europe, North America, and South America) revealed 20–53% cut-downs on urooncological surgeries depending on the cancer type. The recent EAU survey showed that 82% of European referral centres declared themsleves to be “much” or “very much”

P. Zapała, A. Ślusarczyk, P. Rajwa, M. Przydacz, W. Krajewski, B. Dybowski, P. Kubik, B. Kuffel, M. Przudzik, R. Osiecki, R. Stamirowski, Ł. Zapała, M. Kozikowski, D. Chorągwicki, M. Szymańska, P. Kiełb, B. Małkiewicz, J. Zostawa, M. Roslan, J. Zajączkowska, M. Jarzemski, B. Brzoszczyk, P. Petrasz, P. Jarzemski, R. Zdrojowy, J. Dobruch, A. Paradysz, T. Drewa, P. Chłosta, P. Radziszewski

TURBT

Number of procedures

Radical cystectomy

Number of procedures

Number of procedures

160 140 120 100 80 40 30 20 10 0 6 4 2 0

Radical nephrectomy

Nephroureterectomy

2 4 6 8 10 12 Time [weeks] 2 4 6 8 10 12 Time [weeks] 2 4 6 8 10 12 Time [weeks]

Number of procedures Number of procedures Number of procedures

25 20 15 10 5 0 60 40 20 0 30 20 10 0

PreCOVID COVID

affected by COVID-19 pandemic during the first wave (March 2020), reporting 53%, 41%, 53%, and 52% drops in radical prostatectomies, radical cystectomies, radical/partial nephrectomies, and nephroureterectomies, respectively [17]. Polish observations revealed a different scenario. After stratifying our cohort by procedure, a significant reduction in surgical activity was confirmed only for TURBT (20.1% decline) and PN (16.5% decline), with other major procedures being performed without significant decline (RN, RP), or even with an increase (NU, RC).

2 4 6 8 10 12 Time [weeks] 2 4 6 8 10 12 Time [weeks] 2 4 6 8 10 12 Time [weeks]

Radical prostatectomy Partial nephrectomy

Figure 1. Surgical activity in consecutive weeks* after 15 March, 2020 (COVID) and in the corresponding period in 2019 (pre-COVID). No. – number; TURBT – transurethral resection of bladder tumour; *Time trends are presented for 2-week intervals

The substantial decrease in TURBT might be attributed to the limited inflow of patients from outpatients due to disrupted cystoscopy follow-up as well as postponed haematuria investigations. Given the huge drop in outpatient cystoscopy (77%) after the COVID-19 outbreak revealed in the UroSoMe survey [11], the detection of primary and recurrent urothelial cancer was likely to be altered also in Poland. Considering inpatients, on the other hand, a drop in haematuria cases presenting as urological emergencies could at that moment be as high as 25% [14].

Not as black as it is painted? The impact of the first wave of COVID-19 pandemic on surgical treatment of urological cancer patients in Poland – a cross-country experience

Table I. Characteristics of patients who underwent surgical treatment for urothelial cancer (transurethral resection of bladder tumour, cystectomy, or nephroureterectomy) in pre-COVID and COVID period

Variable Overall n (%)/mean (IQR)

TURBT:

Pre-COVID n (%)/mean (IQR)

COVID n (%)/mean (IQR)

P -value

Age 69.3 (14) 69.7 (15) 68.9 (13) 0.33 Male 836 (74.2%) 459 (73.3%) 377 (75.4%) 0.45

ASA: 1 119 (10.6%) 66 (10.5%) 53 (10.6%) 0.91 2 647 (57.5%) 360 (57.5%) 287 (57.5%) 3 352 (31.3%) 195 (31.2%) 157 (31.5%) ≥ 4 7 (0.6%) 5 (0.8%) 2 (0.4%)

Hgb [g/dl] 13.4 (2.3) 13.5 (2.2) 13.3 (2.3) 0.22

Primary tumour 476 (42.3%) 266 (42.6%) 210 (42.1%) 0.90

HG tumour 384 (34.4%) 214 (34.5%) 170 (34.4%) 1 Haematuria 344 (31%) 192 (30.7%) 152 (31.3%) 0.84

reTURBT 224 (19.9%) 116 (18.5%) 108 (21.6%) 0.20

LOH 2.8 (1) 2.8 (1) 2.9 (1) 0.56

Cystectomy:

Age 68.8 (10) 69.1 (9) 68.6 (11) 0.90 Male 107 (83.6%) 37 (84.1%) 70 (83.3%) 1

ASA: 1 3 (2.3%) 0 (0%) 3 (3.6%) 0.25

2 54 (42.2%) 22 (50%) 32 (38.1%)

3 71 (55.5%) 22 (50%) 49 (58.3%)

Hgb [g/dl] 11.8 (3) 12.1 (3.2) 11.7(11.8) 0.56

Laparoscopy 58 (45.3%) 20 (45.5%) 38 (45.2%) 1

TURBT pathology: High-risk NMIBC 45 (35.4%) 15 (34.1%) 30 (36.1%) 0.93

MIBC 79 (62.2%) 28 (63.6%) 51 (61.5%)

cN: N0 95 (74.2%) 35 (79.6%) 60 (71.4%) 0.21

N1 16 (12.5%) 5 (11.4%) 11 (13.1%)

N2 7 (5.5%) 3 (6.8%) 4 (4.8%)

N3 2 (1.6%) 1 (2.3%) 1 (1.2%)

Nx 8 (6.3%) 8 (9.5%) 0 (0%)

cT:

≤ T1 22 (17.2%) 10 (22.7%) 12 (14.3%) 0.41

T2 51 (39.8%) 18 (40.9%) 33 (39.3%)

T3 39 (30.5%) 13 (29.6%) 26 (31%)

T4 16 (12.5%) 3 (6.8%) 13 (15.5%)

Hydronephrosis 43 (33.6%) 10 (22.7%) 33(39.3%) 0.077

Tumour diameter [mm] 38.4 (39) 33.2 (41) 40.7 (40.5) 0.098

Haematuria 68 (53.1%) 21 (47.7%) 47 (60.3%) 0.19

LOH 13.8 (6) 14 (6) 13.6 (6) 0.59

Nephroureterectomy:

Age 69.3 (9) 68.5 (10) 69.9 (10) 0.78

Male 18 (52.9%) 9 (60%) 9 (47.4%) 0.51

ASA: 1 1 (2.9%) 1 (6.7%) 0 (0%) 0.72

2 17 (50%) 7 (46.7%) 10 (52.6%)

3 16 (47.1%) 7 (46.7%) 9 (47.4%)

Hgb [g/dl] 12.6 (1.5) 13.2 (2.9) 12.2 (1.5) 0.35

Laparoscopy 22 (64.7%) 10 (66.7%) 12 (63.2%) 1

P. Zapała, A. Ślusarczyk, P. Rajwa, M. Przydacz, W. Krajewski, B. Dybowski, P. Kubik, B. Kuffel, M. Przudzik, R. Osiecki, R. Stamirowski, Ł. Zapała, M. Kozikowski, D. Chorągwicki, M. Szymańska, P. Kiełb, B. Małkiewicz, J. Zostawa, M. Roslan, J. Zajączkowska, M. Jarzemski, B. Brzoszczyk, P. Petrasz, P. Jarzemski, R. Zdrojowy, J. Dobruch, A. Paradysz, T. Drewa, P. Chłosta, P. Radziszewski

Variable

Overall n (%)/mean (IQR)

Pre-COVID n (%)/mean (IQR)

COVID n (%)/mean (IQR)

P -value

Multifocality 8 (23.5%) 4 (26.7%) 4 (21.1%) 1 Location: Pelvis 19 (57.6%) 8 (53.3%) 11 (61.1%) 0.85 Calyx 1 (3%) 1 (6.7%) 0 (0%) Ureter 13 (39.4%) 6 (40%) 7 (38.9%)

Tumour diameter [mm] 36.2 (21) 34.7 (16) 37 (26.5) 0.82 HG pathology (URS) 9 (52.9%) 5 (62.5%) 4 (44.4%) 0.64 Hydronephrosis 24 (75%) 8 (61.5%) 16 (84.2%) 0.22 LOH 8.9 (4) 9.1 (4) 8.7 (4) 0.48

ASA – American Society of Anesthesiologists score, Hgb – haemoglobin, HG – high-grade, reTURBT – restaging transurethral resection of bladder tumour, NMIBC – non-muscle-invasive bladder cancer, MIBC - muscle-invasive bladder cancer, cN – clinical nodal staging, cT – clinical local staging, URS – ureterorenoscopy, LOH – length of hospitalisation.

Table II. Characteristics of patients who underwent surgery for renal cell cancer (partial nephrectomy or radical nephrectomy) in pre-COVID and COVID period

Variable Overall n (%)/mean (IQR) Pre-COVID n (%)/mean (IQR) COVID n (%)/mean (IQR) P -value

Partial nephrectomy: Age 61.5 (15) 61.2 (15) 61.9 (14) 0.70 Male 113 (63.5%) 58 (59.8%) 55 (67.9%) 0.28 ASA: 1 14 (7.9%) 6 (6.2%) 8 (9.9%) 0.30 2 105 (59%) 63 (65%) 42 (51.9%) 3 54 (30.3%) 25 (25.8%) 29 (35.8%) ≥ 4 5 (2.8%) 3 (3.1%) 2 (2.5%)

Hgb [g/dl] 13.9 (20 13.8 (1.9) 14.1 (1.7) 0.15 Laparoscopy 97 (55.4%) 53 (56.4%) 44 (54.3%) 0.88 Tumour diameter [mm] 34.8 (18) 33.8 (18) 36.1 (20) 0.94 Imperative indication 27 (15.2%) 9 (9.3%) 18 (22.2%) 0.021 LOH 6.7 (3) 6.7 (3) 6.6 (3) 0.99

Radical nephrectomy:

Age 62.7 (14) 63.9 (13) 61.3 (14) 0.10 Male 121 (68.8%) 62 (68.1%) 59 (69.4%) 0.87

ASA: 1 14 (8%) 6 (6.6%) 8 (9.4%) 0.89 2 86 (48.9%) 44 (48.4%) 42 (49.4%) 3 71 (40.3%) 38 (41.8%) 33 (38.8%)

≥ 4 5 (2.8%) 3 (3.3%) 2 (2.4%)

Hgb [g/dl] 12.8 (3.3) 12.7 (3.4) 12.8 (3.3) 0.83 Laparoscopy 69 (39.2%) 37 (41.1%) 32 (37.7%) 0.65

Tumour diameter [mm] 69.2 (39) 65.5 (40) 73.1 (40) 0.28

cT: T1 81 (52.3%) 44 (53.7%) 37 (50.7%) 0.26

T2 35 (22.6%) 18 (22%) 17 (23.3%)

T3 28 (18.1%) 16 (19.5%) 12 (16.4%)

T4 9 (5.8%) 2 (2.4%) 7 (9.6%)

Cytoreduction 30 (17%) 15 (16.5%) 15 (17.7%) 0.84

LOH 6.9 (4) 7.3 (4) 6.5 (3) 0.028

ASA – American Society of Anesthesiologists score, Hgb – haemoglobin, LOH – length of hospitalisation, cT – clinical local staging.

Not as black as it is painted? The impact of the first wave of COVID-19 pandemic on surgical treatment of urological cancer patients in Poland – a cross-country experience

Table III. Characteristics of patients who underwent surgical treatment for prostate cancer (radical prostatectomy) in pre-COVID and COVID period

Variable Overall n (%)/mean (IQR)

Pre-COVID n (%)/mean (IQR) COVID n (%)/mean (IQR) P -value

Age 65.1 (8) 65.3 (8) 64.9 (8) 0.59

ASA: 1 35 (9%) 20 (10.1%) 15 (7.9%) 0.73 2 284 (73%) 142 (71.4%) 142 (74.7%) 3 69 (17.7%) 36 (18.1%) 33 (17.4%) ≥ 4 1 (0.3%) 1 (0.5%) 0 (0%)

Hgb [g/dl] 14.5 (1.6) 14.6 (1.6) 14.5 (1.6) 0.76

Laparoscopy 307 (78.9%) 158 (83.2%) 149 (74.9%) 0.048

eLND 201 (48.3%) 102 (53.7%) 99 (49.8%) 0.48

PSA [ng/ml] 12.3 (8.1) 12.2 (7) 12.4 (9.3) 0.81

Grade group: I 157 (41.3%) 86 (46%) 71 (36.7%) 0.028

II 107 (28.2%) 56 (30%) 51 (26.4%)

III 62 (16.3%) 24 (12.8%) 38 (19.7%)

IV 43 (11.3%) 14 (7.5%) 29 (15%)

V 11 (2.9%) 7 (3.7%) 4 (2.1%)

DRE (+) 207 (54.5%) 90 (47.4%) 117 (61.6%) 0.007

cT: cT1 140 (36%) 77 (40.5%) 63 (31.2%) 0.13

cT2 206 (53%) 91 (47.9%) 115 (57.8%)

≥ cT3 43 (11.1%) 22 (11.6%) 21 (10.6%)

LOH 5.8 (2) 5.7 (3) 5.8 (3) 0.084

ASA – American Society of Anesthesiologists score, Hgb – haemoglobin, eLND- extended lymph node dissection, PSA – prostate-specific antigen, DRE – digital rectal examination, cT – clinical local staging, LOH – length of hospitalisation.

When compared to the 35% mean decrease in surgeries for RCC declared by responders of the UroSoMe survey [11] or the 53% decline reported in the recent EAU survey [17], the 11.7% reduction observed in our study cannot be considered more than moderate. The relative reduction of PN might be attributed to the higher number of lowest-risk kidney tumours being postponed from surgery or proposed active surveillance, as has been suggested by the rapid reaction EAU working group [12, 18].

In Italy, RP and radiotherapy were estimated to decline by 63.6% and 84.6%, respectively, until the end of March [19]. In Poland the volume of RP performed after the COVID-19 outbreak did not decrease. We also failed to validate the UroSoMe survey outcomes, which revealed mean global cut-down on radical prostatectomy exceeding 50% [11]. Given that prostate cancer (PC) is the most deferrable among urological cancers, the question on the risk-benefit ratio of RP during the COVID-19 crisis seems valid as never before.

According to the EAU recommendations for the COVID-19 pandemic [12, 18], most prostatectomies for organ-confined intermediate – and highrisk PC can be deferred for 3–6 months without harm, whereas patients with low-risk should be offered active surveillance. The high proportion of patients with grade group (GG) I in biopsy (overall 41.3%) in our study suggests a significant burden

of overtreatment in Poland, which is however observed constitutively in Polish series [20, 21]. Nevertheless, RP was the only oncological procedure that presented differences between corresponding periods that can be attributed to oncological triage. Prostatectomy in the COVID period was significantly more likely to be performed in patients with an abnormal digital rectal examination (DRE) (61.6% vs. 47.4%) and/or GG ≥ II patients (63.4% vs. 54%). Of note, abnormal DRE has been recently proposed by the Rapid Reaction Group as one of the major triggers to drive decisions on performing biopsy without delay [12] and might contribute to higher biopsy grading, which constitutes another prioritising factor. Although a trend towards prioritising high-risk PC patients can be noticed, oncological triage in Polish centres presents some similarities with the Martini Klinik, where the implementation of precautions facilitated maintaining PC care at baseline level without compromising epidemic safety [13]. Finally, the COVID-19 outbreak brought a remarkable change in utilising a laparoscopic approach in RP (74.9% vs. 83.2% in COVID and pre-COVID, respectively), which possibly reflects previous concerns about an increased risk of aerosolisation during desufflation [22, 23].

Surprisingly, NU and RC were performed more frequently in the COVID period than in 2019. For nephroureterectomy remaining uncommon

P. Zapała, A. Ślusarczyk, P. Rajwa, M. Przydacz, W. Krajewski, B. Dybowski, P. Kubik, B. Kuffel, M. Przudzik, R. Osiecki, R. Stamirowski, Ł. Zapała, M. Kozikowski, D. Chorągwicki, M. Szymańska, P. Kiełb, B. Małkiewicz, J. Zostawa, M. Roslan, J. Zajączkowska, M. Jarzemski, B. Brzoszczyk, P. Petrasz, P. Jarzemski, R. Zdrojowy, J. Dobruch, A. Paradysz, T. Drewa, P. Chłosta, P. Radziszewski

procedure mild increase in the number of surgeries suggests rather maintaining the baseline activity. The noted increase in radical cystectomies (90.9%) is a remarkable observation. Given that more than a quarter of muscle-invasive bladder cancer (MIBC) patients fail to be treated within 12 weeks in Poland [24], cystectomy timing seems to contextualise this phenomenon. A considerable load of RC contributes to prolonging oncological waiting lists, whereas this surgery has been recently identified with the highest (36.2%) burden of high-priority patients [25]. Because the prevalence of the pT1 category in Polish patients presenting with primary non-muscle-invasive bladder cancer (NMIBC) is more common than in the available series (49.2% vs. 39%), this burden can be even higher in Poland [26, 27]. We speculate that the Polish National Health Fund recommendation on postponing elective procedures except for oncological treatment might have unloaded waiting lists of RC candidates. Although not statistically significant, the presence of hydronephrosis (39.3% in the COVID period vs. 22.7% in the pre-COVID period) and lesion diameter (mean 40.7 mm vs. 33.2 mm) could have been among the main triggers for surgery during the pandemic.

Despite recent advancements in COVID-19 management and vaccine development, still no clear results and future perspectives can be drawn [28]. European urology is forecasted to face a significant workload requiring maintaining prioritising strategies [17, 29]. Epidemic models suggest that regarding the number of casualties and shorter duration of the lockdown, the most efficient approach would be an initially intensive but further adaptive lockdown strategy [30]. According to this model, mortality would increase linearly with time, even after the first year, but would not overtake the mortality of different models (like continuous lockdown or intermittent lockdown) for a long time. In Poland, the initial “hard” lockdown during the first wave allowed for smooth, gradual inflow of COVID-19 patients without significant influence on urooncological services. Nevertheless, the second wave of the pandemic, which is currently sweeping through Europe, is predicted to have a substantially greater impact on urooncology.

In conclusion, in this study, we report the limited impact of the first wave of the COVID-19 pandemic on urooncological care in Poland. Deployment of staff and limited access to resources during the COVID period have not affected the proceeding of surgical treatment in patients with urological cancers. Simultaneously, it seems that during the initial pandemic period, oncological triage has not been required in the majority of centres, or its impact is yet to be observed. At

the moment of publishing data from the first wave of the pandemic, the epidemiological situation is evolving rapidly. Because the second wave of the pandemic in Poland has already presented a dramatically different course, alteration of urooncological service seems unavoidable.

The limitations of our study can be attributed to its retrospective design and the limited period of time that was analysed. Observation times might be too short to determine whether recommendations for urologists during the COVID-19 pandemic have been applied and to what extent. The two periods compared are separated by 1 year, which was chosen to avoid particular confounders (season influence), but it could be a source of other ones (time-dependent changes in surgical services).

Acknowledgments

There was no grant support made available for this research.

Conflict of interest

The authors declare no conflict of interest.

References

1. Guan W, Ni Z, Hu Y, et al. Clinical characteristics of coronavirus disease 2019 in China. N Engl J Med 2020; 382: 1708-20.

2. Zhu N, Zhang D, Wang W, et al. A novel coronavirus from patients with pneumonia in China, 2019. N Engl J Med 2020; 382: 727-33.

3. Sohrabi C, Alsafi Z, O’Neill N, et al. World Health Organization declares global emergency: a review of the 2019 novel coronavirus (COVID-19). Int J Surg 2020; 76: 71-6.

4. Bianconi V, Bronzo P, Banach M, Sahebkar A, Mannarino M, Pirro M. Particulate matter pollution and the COVID-19 outbreak: results from Italian regions and provinces. Arch Med Sci 2020; 16: 985-92.

5. COVID-19 Map [Internet]. Johns Hopkins Coronavirus Resource Center. [cited 2020 Aug 5]. Available from: https://coronavirus.jhu.edu/map.html

6. Papazafiropoulou A, Antonopoulos S. The COVID-19 pandemic and diabetes mellitus. Arch Med Sci Atheroscler Dis 2020; 5: 200-5.

7. Porreca A, Colicchia M, D’Agostino D, et al. Urology in the time of coronavirus: reduced access to urgent and emergent urological care during the coronavirus disease 2019 outbreak in Italy. Urol Int 2020; 104: 631-6.

8. Rocco B, Sighinolfi MC, Sandri M, et al. The dramatic COVID-19 outbreak in italy is responsible of a huge drop in urological surgical activity: a multicenter observational study. BJU Int 2021; 127: 56-63.

9. Pinar U, Anract J, Duquesne I, et al. Impact of the COVID-19 pandemic on surgical activity within academic urological departments in Paris. Progres En Urol J Assoc Francaise Urol Soc Francaise Urol 2020; 30: 439-47.

10. Dimitriu MCT, Pantea-Stoian A, Smaranda AC, et al. Burnout syndrome in Romanian medical residents in time of the COVID-19 pandemic. Med Hypotheses 2020; 144: 109972.

Not as black as it is painted? The impact of the first wave of COVID-19 pandemic on surgical treatment of urological cancer patients in Poland – a cross-country experience

11. Teoh JYC, Ong WLK, Gonzalez-Padilla D, et al. A global survey on the impact of COVID-19 on urological services. Eur Urol 2020; 78: 265-75.

12. Professionals S-O. COVID-19 Recommendations [Internet]. Uroweb. [cited 2020 Aug 6]. Available from: https:// uroweb.org/guideline/covid-19-recommendations/

13. Würnschimmel C, Maurer T, Knipper S, et al. Martini‐Klinik experience on prostate cancer surgery during the early phase of COVID-19. Bju Int [Internet]. 2020 May 18 [cited 2020 Aug 6]; Available from: https://www.ncbi. nlm.nih.gov/pmc/articles/PMC7276763/

14. Rajwa P, Przydacz M, Krajewski W, et al. Changing patterns of urologic emergency visits and admissions during the COVID-19 pandemic: a retrospective, multicenter, nationwide study. Arch Med Sci 2021; 17: 1262-76.

15. Madanelo M, Ferreira C, Nunes-Carneiro D, et al. The impact of the coronavirus disease 2019 pandemic on the utilisation of emergency urological services. BJU Int 2020; 126: 256-8.

16. Roscigno M, Naspro R, Piccichè A, et al. A Snapshot from the Department of Urology in Bergamo evaluating the timeline of the SARS-CoV-2 outbreak: which patients are we missing? Eur Urol Focus 2020; 6: 1120-3.

17. Oderda M, Roupret M, Marra G, et al. The impact of COVID-19 outbreak on uro-oncological practice across Europe: which burden of activity are we facing ahead? Eur Urol 2020; 78: 124-6.

18. Wallis CJD, Novara G, Marandino L, et al. Risks from deferring treatment for genitourinary cancers: a collaborative review to aid triage and management during the COVID-19 pandemic. Eur Urol 2020; 78: 29-42.

19. Sciarra A, Salciccia S, Maggi M, et al. Elective procedures for prostate cancer in the time of Covid-19: a multidisciplinary team experience. Prostate Cancer Prostatic Dis 2020; 23: 407-9.

20. Zapała P, Dybowski B, Bres-Niewada E, et al. Predicting side-specific prostate cancer extracapsular extension: a simple decision rule of PSA, biopsy, and MRI parameters. Int Urol Nephrol 2019; 51: 1545-52.

21. Kozikowski M, Powroźnik J, Malewski W, et al. 3.0-T multiparametric magnetic resonance imaging modifies the template of endoscopic, conventional radical prostatectomy in all cancer risk categories. Arch Med Sci 2018; 14: 1387-93.

22. SAGES and EAES Recommendations Regarding Surgical Response to COVID-19 Crisis [Internet]. SAGES. 2020 [cited 2020 Aug 21]. Available from: https://www.sages. org/recommendations-surgical-response-covid-19/

23. sitecore\esme.martin. Updated Intercollegiate General Surgery Guidance on COVID-19 [Internet]. Royal College of Surgeons. [cited 2020 Aug 21]. Available from: https://www.rcseng.ac.uk/coronavirus/joint-guidancefor-surgeons-v2/

24. Poletajew S, Braticevici B, Brisuda A, et al. Timing of radical cystectomy in Central Europe – multicenter study on factors influencing the time from diagnosis to radical treatment of bladder cancer patients. Cent Eur J Urol 2015; 68: 9-14.

25. Campi R, Amparore D, Capitanio U, et al. Assessing the burden of nondeferrable major uro-oncologic surgery to guide prioritisation strategies during the COVID-19 pandemic: insights from three Italian high-volume referral centres. Eur Urol 2020; 78: 11-5.

26. Poletajew S, Biernacki R, Buraczynski P, et al. Stage of bladder cancer in Central Europe – Polish perspective. Neoplasma 2016; 63: 642-7.

27. Rink M, Furberg H, Zabor EC, et al. Impact of smoking and smoking cessation on oncologic outcomes in primary non-muscle-invasive bladder cancer. Eur Urol 2013; 63: 724-32.

28. Borgio JF, Alsuwat HS, Otaibi WMA, et al. State-of-theart tools unveil potent drug targets amongst clinically approved drugs to inhibit helicase in SARS-CoV-2. Arch Med Sci 2020; 16: 508-18.

29. Amparore D, Campi R, Checcucci E, et al. Forecasting the future of urology practice: a comprehensive review of the recommendations by International and European Associations on priority procedures during the COVID-19 pandemic. Eur Urol Focus 2020; 6: 1032-48.

30. Westerhoff HV, Kolodkin AN. Advice from a systems-biology model of the corona epidemics. NPJ Syst Biol Appl 2020; 6: 18.

Evaluation of methods of surfactant administration in the delivery suite?

Hemant Ambulkar, Theodore Dassios, Anne Greenough

King’s College London, United Kingdom

Submitted: 7 February 2020; Accepted: 20 May 2020

Online publication: 8 January 2021

Arch Med Sci 2023; 19 (1): 116–121 DOI: http://doi.org/10.5114/aoms/122644

Copyright © 2021 Termedia & Banach

Abstract

Surfactant administered in the delivery suite might prevent or reduce the severity of subsequent respiratory distress syndrome. This review describes the evidence for surfactant delivery methods with relationship to their relevance in the delivery suite. The techniques include delivery using a thin catheter with the first breath, by the intubation-surfactant extubation procedure, less invasive surfactant administration (LISA) technique, using a laryngeal mask airway (LMA), or by nebulisation. There have been few randomised trials that have evaluated outcomes using these techniques in the delivery suite, and these were early trials. Currently, practitioners favour use of nasal continuous positive airway pressure with early rescue surfactant. Whether prophylactic surfactant given by the LISA technique or other techniques, such as via a LMA in the delivery suite, is more beneficial merits testing. This will require appropriately designed randomised trials with long-term outcomes.

Key words: nebulisation, intubation, laryngeal mask, less invasive surfactant administration.

Introduction

Delivery of exogenous surfactant to preterm infants for the treatment of respiratory distress syndrome (RDS) was first described in 1980 [1]. A Cochrane review from 2001 included eight randomised controlled trials (RCTs) and compared the effects of prophylactic surfactant administration to surfactant treatment of infants with established RDS. In a secondary analysis of the results of infants born at less than 30 weeks of gestational age, prophylactic surfactant resulted in a decreased risk of pneumothorax, pulmonary interstitial emphysema (PIE), and mortality, with no significant untoward effects [2]. In contrast, a subsequent Cochrane review that included large trials, greater utilisation of maternal corticosteroids, and routine stabilisation of infants on nasal continuous positive airway pressure (nCPAP) did not demonstrate greater benefits of prophylactic surfactant [3]. The increased use of non-invasive respiratory support techniques has meant that fewer infants are receiving prophylactic surfactant. There are now, however, new modes of administration of surfactant available, particularly those that are less invasive or non-invasive. Such techniques could be applicable in the delivery suite. The aim of this review is to assess the efficacy of methods of surfactant administration in the delivery suite set in the context of what we

Corresponding author: Anne Greenough King’s College London, United Kingdom E-mail: anne.greenough@kcl.ac.uk

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

have learned regarding the efficacy of surfactant administration techniques in other delivery suite settings.

Nasopharyngeal administration

One of the earliest randomised trials assessing surfactant administration investigated the use of artificial lung expanding compound (ALEC) in the delivery suite delivered as close as possible to the first breath. Artificial lung expanding compound was delivered as a liquid to the pharynx of preterm infants born between 25 and 29 weeks of gestational age. The controls received normal saline. Three more doses could be given if the infant remained intubated in the first 24 h. The researchers hypothesised that the surfactant so administered would be spread as lung fluid was absorbed from the airway. The trial demonstrated that surfactant administered in such a way was associated with a reduction in RDS severity, mortality, and intracerebral haemorrhage [4]. In another study in the delivery suite [5], the nasopharynxes of 23 infants born between 27 and 30 weeks of gestational age were suctioned as their head appeared on the perineum or at operative caesarean section incision. Surfactant was instilled into the posterior pharynx before the first breath, and then CPAP was administered for 48 h. Thirteen of 15 infants delivered vaginally weaned quickly to room air and required no further dose of surfactant or endotracheal intubation. Five of the eight infants delivered by caesarean section required subsequent endotracheal intubation soon after birth, and two received further surfactant via the endotracheal tube. A Cochrane review, however, did not find any RCTs or quasi RCTs that evaluated the effect of this method of surfactant administration. The authors of the Cochrane review, however, commented that evidence from animal and observational human studies suggested that this method was potentially safe, feasible, and may be effective, and that well designed trials were needed [6].

Insure

Surfactant given by transient intubation was first described in 1990 [7]. The IN-SUR-E technique is Intubation followed by SURfactant administration and extubation as early as possible. A Cochrane review reported the findings of six RCTs that compared INSURE to late selective surfactant. The former technique was associated with a lower incidence of mechanical ventilation, air leak syndrome, and BPD. A larger proportion of infants in the early surfactant group received surfactant and received more doses of surfactant [8]. The failure rate of the INSURE method of surfactant admini-

stration has been variably reported from 19% to 69%. A systematic review demonstrated that in 15 studies, the predictors for INSURE failure were lower gestational age and greater RDS severity [9].

In a study of 208 infants born between 25 and 28 weeks of gestational age, there was no significant difference in the primary outcome (mechanical ventilation in the first 5 days) between those given prophylactic surfactant and then extubation to CPAP as soon as possible and selective surfactant according to CPAP failure [10]. In the multicentre, Surfactant, Positive Pressure, and Pulse Oximetry Randomised (SUPPORT) Trial of 1316 infants born between 24 and 27 weeks of gestation, nasal CPAP was compared to intubation and surfactant treatment initiated in the delivery room. The rates of death or BPD did not differ significantly between the two groups, but infants treated with nCPAP required less intubation or postnatal corticosteroids for BPD (p < 0.001), required fewer days of mechanical ventilation (p = 0.03), and were more likely to be alive and free from the need for mechanical ventilation at 7 days after birth (p = 0.01) [11].

Intra-tracheal administration of budesonide-surfactant

A systematic review of two trials of intra-tracheal administration of budesonide-surfactant demonstrated a 43% reduced risk of BPD and a 40% reduced risk of the composite outcome of death/BPD in very low birth weight infants [12]. None of the infants appeared to have received the treatment in the delivery suite. Whether these results can be replicated in a large multi-centre trial needs investigating.

Laryngeal mask airway

There are a number of adverse effects associated with tracheal intubation of surfactant such as hypoxia and bradycardia and delivery when the tracheal tube is malpositioned. Those risks can be minimised with the use of a laryngeal mask airway (LMA) [13]. In a randomised, multicentre trial, 103 infants between 28 and 35 weeks of gestation ≤ 36 h old on CPAP were randomised to receive surfactant through an LMA, then placed back on CPAP with no surfactant administered. Surfactant administration through an LMA significantly decreased the rate of intubation and mechanical ventilation (38% vs. 64%) (p = 0.006). There were no serious adverse effects associated with the placement of the LMA or surfactant administration [13]. Although LMAs are typically used for infants with a weight greater than 2 kg [14], a feasibility study found that LMA could be used to deliver surfactant to premature babies born un-

Evaluation of methods of surfactant administration in the delivery suite?

der 35 weeks of gestational age with birth weight above 800 g [15].

A laryngeal mask airway has the advantage of ease of technique of insertion without the need for a laryngoscope and rapidity of the procedure with minimal side effects [16]. In a multicentre RCT, videotape of LMA placement was reviewed to determine total procedures, and the time and number of attempts to place the device. The average time to place the device in 36 infants was 88 s, and successful placement was achieved on the first attempt in 69% of cases. As compared to baseline, heart rate and oxygen saturation increased on average of 1 pbm and decreased on average by 6%, respectively [16]. Thus, use of LMA may be useful in resource-limited settings or for use during transport with personnel with limited expertise in airway management [17–19]. Surfactant administration through LMA fitted with a Y-piece has the advantage over catheter methods of surfactant administration that PEEP can be maintained during delivery of the surfactant, which will keep the alveoli recruited. There can, however, be leakage of surfactant around the LMA cuff; in one study 18% of infants had more than 50% of the dose administered recovered from the gastric aspirate [20]. Nevertheless, the authors concluded that surfactant must have reached the lungs in the majority of cases because there was improvement in the fraction of inspired oxygen – more than half of the neonates in the study were weaned to air within 30 min of receiving the surfactant [13].

There have been case reports of administration of surfactant through the LMA and an RCT in infants, with moderately preterm infants receiving nCPAP with fraction of inspired oxygen (FiO2) of 0.30 to 0.60, which demonstrated that delivery of surfactant via an LMA decreased the need for mechanical ventilation as compared to surfactant administration by endotracheal intubation [21]. The Cochrane review concluded that surfactant administration by LMA resulted in a reduction in the mean FiO2 required to maintain the oxygen saturation between 88% and 92% for 12 h after the intervention. No significant difference, however, was reported in the need for subsequent mechanical ventilation and endotracheal surfactant administration, pneumothorax, days on intermittent positive pressure ventilation, or supplementary oxygen [22]. To date, however, there have been no studies determining whether this is an efficacious method of delivering surfactant in the delivery suite.

Less invasive surfactant administration

Administration of surfactant via a thin catheter placed in the trachea was first described in 1992 [23].

Less invasive surfactant administration (LISA) is widely practiced in neonatal units in Europe [24]. The gestational age criteria for using LISA is variable, ranging from 23 to 34 weeks of gestation [25–29]. There are variations in the technique including using a feeding tube being guided with or without Magill’s forceps [26, 28, 30], a rigid vascular catheter [25, 27, 29], or a specially made catheter (Chiesi Farmaceutici S.p.A). The dose of surfactant to be used for LISA varies from 100 mg/kg to 200 mg/kg. When the higher dose of surfactant is used, it results in more pronounced and persistent improvement in oxygenation [31] and less need for re-dosing [32, 33]. European consensus guidelines on the management of RDS have recommended the dose of 200 mg/kg surfactant [32]. Nasal intermittent positive pressure ventilation (NIPPV) can also be used as support during LISA. A randomised controlled trial compared the use of nCPAP to NIPPV as the initial respiratory support, and using LISA if the infant required an FiO2 of more than 0.4 to maintain the target oxygen saturation level between 90 and 95%. There was also reduced need for surfactant in the NIPPV compared to the nCPAP group (OR = 0.32, p = 0.002), but no significant difference in the incidence of moderate to severe BPD between the two groups [34].

Adverse effects of LISA include coughing, vomiting, surfactant reflux, bradycardia, apnoea, and desaturation. Bradycardia and desaturation may cease, however, if the procedure is temporarily suspended, and a longer duration of administration may prevent those adverse effects. Non-pharmacological interventions such as wrapping/ swaddling the infant have been used with the LISA technique to keep the infant calm. Others have used oral sucrose or medications such as atropine, ketamine, propofol, morphine, and fentanyl [35–38]. Morphine has the disadvantage of having a long half-life, and propofol use can be associated with significant hypotension [39]. Remifentanil is a synthetic opioid with a short duration of action; using that agent in a pilot study of 21 infants with a gestational age of 29 to 32 weeks, none of the infants had significant bradycardia, hypotension, or chest wall rigidity [40]. In a Nordic survey, approximately half the clinicians preferred giving pre-medications before the procedure [41]. In a UK nationwide survey, 49% of units used no medication with LISA and most commonly opioids were used (31% of respondents) [35]. In an RCT, 78 infants were randomised to receive either low dose sedation (1 mg/kg propofol intravenous) or no premedication. Low-dose sedation was associated with an increased comfort score, but the need for transient non-invasive ventilation was increased [42]. A catheter inserted too deep can result in unilateral surfactant deposition leading to pneumotho-

Hemant Ambulkar, Theodore Dassios, Anne Greenough

rax and PIE secondary to unilateral lung hyperinflation, but this has not been seen as a major problem in studies to date [43]. There are other possible adverse effects of LISA. In an animal model, the surfactant distribution was lower following LISA compared to surfactant delivered via an endotracheal tube; nevertheless, the “LISA” lambs had better oxygenation [44]. In an  in vitro study, CPAP transmission was significantly and variably reduced during LISA [45]. A retrospective observational study showed that the failure rates of LISA were around 30%. This may relate to the poorer respiratory drive in more immature infants [46].

A meta-analysis showed a reduction in the composite outcome of death or BPD at 36 weeks (RR = 0.75, p = 0.01), occurrence of BPD at 36 weeks (RR = 0.72, p = 0.03), and the need for ventilation when compared to the standard method of surfactant delivery [47]. Whether LISA used in the delivery suite is of benefit or harm has not been tested in RCTs.

In a large observational, cohort study from the German Neonatal Network including 7533 VLBW infants, LISA was associated with improved outcomes, but in infants less than 26 weeks of gestational age there was an increase in focal intestinal perforations [48]. Future RCTs should integrate safety analyses in this particular sub-group.

Nebulisation

Instillation of a surfactant “bolus” into the trachea can cause transient airway obstruction, which may lead to hypoxia and hypotension. This complication is avoided by nebulisation or aerosolisation of the surfactant, which can result in a more homogenous distribution in the lungs. There can, however, be a lag period in the response to surfactant when administered via nebuliser [49]. The particle size of aerosol droplets should be between 1 to 5 μm to be best delivered to the lungs [50]. The aerosol particles should be small enough to bypass the nasopharynx, but also large enough not to be exhaled. Vibrating mesh nebulisers have been found to be most effective in delivering medications to the lungs [51]. The disadvantage of nebulisation is that it leads to loss of surfactant in the upper airways and oesophagus, with less than 10% delivered to the lower airways [52]. Even with this lower deposition in the lungs, nebulised surfactant improved ventilation and lung mechanics in animal models [53]. Surfactant by aerosolisation has been shown to be delivered effectively to infants on non-invasive respiratory support such as high-flow nasal cannula, CPAP, and synchronised inspiratory positive airway pressure [54]. Animal studies have shown that it is possible to deliver aerosols with highfrequency oscillatory ventilation (HFOV) [55].

In a randomised trial nebulised surfactant in combination with nasal CPAP was compared to nasal CPAP alone in 360 neonates of 29–31 + 6 or 32–33 + 6 weeks gestational age with mild to moderate respiratory distress (a fraction of inspired oxygen of 0.22–0.30). The infants were all less than 4 h of age, had clinical signs suggestive of evolving mild to moderate RDS, and required nCPAP of 5 to 8 cmH2O and supplemental fractional inspired oxygen (FiO2) of 0.22 to 0.30 to maintain an oxygen saturation between 86% and 94%. Surfactant was given at a dose of 200 mg/kg by a vibrating membrane nebuliser soon after randomisation and repeated 12 h after for persistent respiratory distress or oxygen requirement. There was a reduction in mechanical ventilation in the 32–33 + 6 weeks of gestation infants who received surfactant nebulisation with CPAP [45]. In another study, there was a significant reduction in the clinical manifestations of severe RDS as demonstrated by the Silverman score, alveolar-arterial oxygen [(A-a) O2] gradient, and the PaCO2 levels when comparing aerosolised surfactant with CPAP to CPAP alone [56].

Comparison of techniques

A systematic review compared seven different respiratory strategies in 5598 infants born before 33 weeks of gestational age: nCPAP alone, LISA, INSURE, nebulised surfactant while receiving CPAP, NIPPV, surfactant given by LMA followed by CPAP and mechanical ventilation [57]. The report used network meta-analyses or multiple treatment comparison meta-analyses to provide a framework for analysing and interpretating more than two interventions to understand the evidence of network of multiple interventions as a whole. Compared with mechanical ventilation, it was reported that LISA had lower odds of primary outcome (death or BPD at 36 weeks PMA, odds ratio (OR = 0.49), BPD (OR = 0.53), and severe intraventricular haemorrhage (OR = 0.44)). Compared with nasal CPAP alone, it was reported that LISA had lower odds of primary outcome (OR = 0.58) and air leak (OR = 0.24). Ranking probabilities indicated that LISA was the best strategy with a surface under the cumulative ranking curve of 0.85 to 0.94. However, when limited to high-quality evidence, some significant findings for LISA compared to other strategies became non-significant and the lower likelihood of death associated with LISA was not robust. Furthermore, there was no direct RCT comparing LISA to LMA, LMA to aerosolisation, or LISA to aerosolisation. Furthermore, the studies performed and analysed used different surfactants, although both LMA and LISA and some of INSURE trials mostly used Curosurf, while aerosolised surfactant studies have used several

Evaluation of methods of surfactant administration in the delivery suite?

surfactants. Thus, no definitive conclusions can be drawn. Direct comparisons are required.

Conclusions

Other than the widely used administration via the endotracheal tube, a number of other methods have emerged in recent years as alternatives for surfactant administration in prematurely born infants. Administration of surfactant via a laryngeal mask is safe and efficient but has not been adequately tested in very prematurely born infants. Less invasive surfactant administration is also feasible and efficient, but a number of questions remain unanswered regarding the choice of sedation, equipment, administration in the delivery unit or the neonatal unit, and dosing regimens. It has also not been proven whether the most immature infants who have poor respiratory drive are suitable candidates for less invasive administration. The efficacy of other methods such as surfactant nebulisation or the combined intratracheal administration of budesonide and surfactant will require more conclusive studies before their routine application in clinical care is recommended.

Conflict of interest

The authors declare no conflict of interest.

References

1. Fujiwara T, Maeta H, Chida S, Morita T, Watabe Y, Abe T. Artifical surfactant therapy in hyaline membrane disease. Lancet 1980; 1: 55-9.

2. Soll R. Prophylactic synthetic surfactant for preventing morbidity and mortality in preterm infants. Cochrane Database Syst Rev 2003; 1: CD001079.

3. Rojas-Reyes MX, Morley CJ, Soll R. Prophylactic versus selective use of surfactant in preventing morbidity and mortality in preterm infants. Cochrane Database Syst Rev 2012; 3: CD000510.

4. Morley CJ, Greenough A, Miller NG, et al. Randomized trial of artificial surfactant (ALEC) given at birth to babies from 23 to 34 weeks gestation. Early Hum Dev 1988; 17: 41-54.

5. Kattwinkel J, Robinson M, Bloom BT, Delmore P, Ferguson JE. Technique for intrapartum administration of surfactant without requirement for an endotracheal tube. J Perinat 2004; 24: 360-5.

6. Abdel-Latif ME, Osborn DA. Pharyngeal instillation of surfactant before the first breath for prevention of morbidity and mortality in preterm infants at risk of respiratory distress syndrome. Cochrane Database Syst Rev 2011; 3: CD008311.

7. Victorin LH, Deverajan LV, Curstedt T, Robertson B. Surfactant replacement in spontaneously breathing babies with hyaline membrane disease – a pilot study. Biol Neonate 1990; 58: 121-6.

8. Stevens TP, Blennow M, Myers EH, Soll R. Early surfactant adminsitration with brief ventilation vs selective surfactant and continued mechanical ventilation for preterm infants with or at risk for respiratory distress syndrome. Cochrane Database Syst Rev 2007; 4: CD003063.

9. De Bisschop B, Peeters L, Sonnaert M. Early predictors for Intubation-SURfactant-SURfactant-Extubation failure in preterm infants with neonatal respiratory distress syndrome: a systematic review. Neonatology 2019; 22: 1-13.

10. Sandri F, Plavka R, Ancora G, et al. Prophylactic or early selective surfactant combined with nCPAP in very preterm infants. Pediatrics 2010; 125: e1402-9.

11. Finer N, Carlo W, Walsh M, et al.; Support Study Group of the Eunice Kennedy Shriver NICHD Neonatal Research Network. Early CPAP versus surfactant in extremely preterm infants. N Engl J Med 2010; 362: 1970-9.

12. Venkataraman R, Kamaluddeen M, Hasan SU, Robertson HL, Lodha A. Intratracheal administration of budesonide-surfactant in prevention of bronchopulmonary dysplasia in very low birth weight infants: a systematic review and meta-analysis. Pediatr Pulmonol 2017; 52: 968-75.

13. Roberts KC, Brown R, Lampland AL, et al. Laryngeal mask airway for surfactant administration in neonates: a randomized, controlled trial. J Pediatr 2018; 193: 40-6.

14. Wyllie J, Bruinenberg J, Roehr CC, Rüdiger M, Trevisanuto D, Urlesberger B. European Resuscitation Council Guidelines for Resuscitation 2015. Section 7. Resuscitation and support of transition of babies at birth. Resuscitation 2015; 95: 249-63.

15. Trevisanuto D, Grazzina N, Ferrarese P, Micaglio M, Verghese C, Zanardo V. Laryngeal mask airway used as a delivery conduit for the administration of surfactant to preterm infants with respiratory distress syndrome. Biol Neonate 2005; 87: 217-20.

16. Wanous AA, Wey A, Rudser KD, Roberts KD. Feasibility of laryngeal mask airway device placement in neonates. Neonatology 2017; 111: 222-7.

17. Trevisanuto D. Laryngeal mask airway for the interhospital transport of neonates. Pediatrics 2005; 115: e109-11.

18. Trevisanuto D. The laryngeal mask airway: potential applications in neonates. Arch Dis Child Fetal Neonatal Ed 2004; 89: F485-9.

19. Nematova RI, Guthrie SO. The introduction of the laryngeal mask airway for surfactant administration in neonates with respiratory distress in Azerbaijan. Eur J Clin Sci 2019; 2: 63-7.

20. Roberts KD, Brown R, Lampland AL, et al. Laryngeal mask airway for surfactant administration in neonates: a randomized, controlled trial. J Pediatr 2018; 193: 40-46.e1.

21. Pinheiro JM, Santana-Rivas Q, Pezzano C. Randomized trial of laryngeal mask airway versus endotracheal intubation for surfactant delivery. J Perinatol 2016; 36: 196-201.

22. Dani C, Corsini I, Poggi C. Risk factors for Intubation-Surfactant-Extubation (INSURE) Failure and Multiple INSURE Strategy in preterm infants. Early Hum Dev 2012; 88 Suppl 1: S3-4.

23. Verder H, Agertoft L, Albertsen P, et al. Surfactant treatment of newborn infants with respiratory distress syndrome primarily treated with nasal continuous positive air pressure. A pilot study. Ugeskr Laeger 1992; 154: 2136-9.

24. Kurepa D, Perveen S, Lipener Y, Kakkilaya V. The use of less invasive surfactant administration (LISA) in the United States with review of the literature. J Perinatol 2019; 39: 426-32.

25. Göpel W, Kribs A, Ziegler A, et al. Avoidance of mechanical ventilation by surfactant treatment of spontaneously breathing preterm infants (AMV): an open-label, randomised, controlled trial. Lancet 2011; 378: 1627-34.

26. Heidarzadeh M, Mirnia K, Bagher Hoseini M, et al. Surfactant administration via thin catheter during sponta-

Hemant Ambulkar, Theodore Dassios, Anne Greenough

Evaluation of methods of surfactant administration in the delivery suite?

neous breathing: randomized controlled trial in Alzahra Hospital. Iranian J Neonatol 2013; 4: 5-9.

27. Bao Y, Zhang G, Wu M, Ma L, Zhu J. A pilot study of less invasive surfactant administration in very preterm infants in a Chinese Tertiary Center. BMC Pediatr 2015; 15: 21.

28. Mohammadizadeh M, Sadeghnia A, Ardestani A. Early administration of surfactant via a thin intratracheal catheter in preterm infants with respiratory distress syndrome: feasibility and outcome. J Res Pharm Pract 2015; 4: 31-6.

29. Kribs A, Roll C, Göpel W, et al. Nonintubated surfactant application vs conventional therapy in extremely preterm infants: a randomized clinical trial. JAMA Pediatr 2015; 169: 723-30.

30. Kribs A, Hummler H. Ancillary therapies to enhance success of non-invasive modes of respiratory support –approaches to delivery room use of surfactant and caffeine? Sem Fetal Neonatal Med 2016; 21: 212-8.

31. Dargaville P, Aiyappan A, De Paoli AG, et al. Minimally-invasive surfactant therapy in preterm infants on continuous positive airway pressure. Arch Dis Child Fetal Neonatal Ed 2013; 98: 122-6.

32. Sweet DG, Carnielli V, Greisen G, et al. European consensus guidelines on the management of respiratory distress syndrome – 2019 update. Neonatology 2019; 115: 432-50.

33. Singh N, Halliday HL, Stevens TP, Suresh G, Soll R, RojasReyes MX. Comparison of animal-derived surfactants for the prevention and treatment of respiratory distress syndrome in preterm infants. Cochrane Database Syst Rev 2015; 12: CD010249.

34. Oncel MY, Arayici S, Uras N, et al. Nasal continuous positive airway pressure versus nasal intermittent positive-pressure ventilation within the minimally invasive surfactant therapy approach in preterm infants: a randomised controlled trial. Arch Dis Child Fetal Neonatal Ed 2016; 101: F323-8.

35. Jeffreys E, Hunt K, Dassios T, Greenough A. UK survey of less invasive surfactant administration. Arch Dis Child Fetal Neonatal Ed 2019; 104: F567.

36. Klotz D, Porcaro U, Fleck T, Fuchs H. European perspective on less invasive surfactant administration – a survey. Eur J Pediatr 2017; 176: 147-54.

37. Descamps CS, Sophie C, Chevallier M, et al. Propofol for sedation during less invasive surfactant administration in preterm infants. Arch Dis Childhood Fetal Neonatal Ed 2017; 102: F465.

38. Shim GH. Update of minimally invasive surfactant therapy. Korean J Pediatr 2017; 60: 273-81.

39. Welzing L, Kribs A, Eifinger F, Huenseler C, Oberthuer A, Roth B. Propofol as an induction agent for endotracheal intubation can cause significant arterial hypotension in preterm neonates. Paediatr Anaesth 2010; 20: 605-11.

40. Audil L, Kribs A, Huenseler C, Eifinger F, Mehler K, Roth B. Remifentanil for INSURE in preterm infants: a pilot study for evaluation of efficacy and safety aspects. Acta Paediatr 2009; 98: 1416-20.

41. Heiring C, Jonsson B, Andersson S, Björklund LJ. Survey shows large differences between the nordic countries in the use of less invasive surfactant administration. Acta Paediatr 2017; 106: 382-6.

42. Dekker J, Lopriore E, van Zanten HA, Tan RNGB, Hooper SB, Te Pas AB. Sedation during minimal invasive surfactant therapy: a randomised controlled trial. Arch Dis Child Fetal Neonatal Ed 2019; 104: F378-83.

43. Wu W, Shi Y, Li F, Wen Z, Liu H. Surfactant administration via a thin endotracheal catheter during spontaneous

breathing in preterm infants. Pediatr Pulmonol 2017; 52: 844-54.

44. Berggren E, Liljedahl M, Winbladh B, et al. Pilot study of nebulized surfactant therapy for neonatal respiratory distress syndrome. Acta Paediatr 2000; 89: 460-5.

45. Minocchieri S, Berry CA, Pillow J. Nebulised surfactant to reduce severity of respiratory distress: a blinded, parallel, randomised controlled trial. Arch Dis Child Fetal Neonatal Ed 2019; 104: F313-9.

46. Janssen LC, Van Der Spil J,van Kaam AH, et al. Minimally invasive surfactant therapy failure: risk factors and outcome. Arch Dis Child Fetal Neonatal Ed 2019; 104: F636-42.

47. Aldana-Aguirre JC, Pinto M, Featherstone RM, Kumar M. Less invasive surfactant administration versus intubation for surfactant delivery in preterm infants with respiratory distress syndrome: a systematic review and meta-analysis. Arch Dis Child Fetal Neonatal Ed 2017; 102: F17-23.

48. Hartel C, Paul P, Hanke K, et al. Less invasive surfactant administration and complications of preterm birth. Sci Rep 2018; 8: 8333.

49. Willson DF. Aerosolized surfactants, anti-inflammatory drugs, and analgesics. Respir Care 2015; 60: 774-93.

50. Barkhuff WD, Soll RF. Novel surfactant administration techniques: will they change outcome? Neonatology 2019; 115: 411-22.

51. Ehrmann S. Vibrating mesh nebulisers – can greater drug delivery to the airways and lungs improve respiratory outcomes? Eur Respir Pulmonol Dis 2018; 4: 33-43.

52. Pillow J, Minocchieri S. Innovation in surfactant therapy II: surfactant administration by aerosolization. Neonatology 2012; 101: 337-44.

53. Lewis JF, Ikegami M, Jobe AH, Absolom D. Physiologic responses and distribution of aerosolized surfactant (Survanta®) in a nonuniform pattern of lung injury. Am Rev Respir Dis 1993; 147: 1364-70.

54. Sunbul FS, Fink JB, Harwood R, Sheard M, Zimmerman RD, Ari A. Comparison of HFNC, bubble CPAP and SIPAP on aerosol delivery in neonates: an in-vitro study. Pediatr Pulmonol 2015; 50: 1099-106.

55. Sood BG, Shen Y, Latif Z, Galli B, Dawe EJ, Haacke ME. Effective aerosol delivery during high-frequency ventilation in neonatal pigs. Respirology 2010; 15: 551-5.

56. Jorch G, Hartl H, Roth B, et al. Surfactant aerosol treatment of respiratory distress syndrome in spontaneously breathing premature infants. Pediatr Pulmonol 1997; 24: 222-4.

57. Isayama T, Iwami H, McDonald S, Beyene J. Association of noninvasive ventilation strategies with mortality and bronchopulmonary dysplasia among preterm infants: a systematic review and meta-analysis. JAMA 2016; 316: 611-24.

Magnetic marker localisation in breast cancer surgery

Jan Žatecký, Otakar Kubala, Petr Jelínek, Milan Lerch, Peter Ihnát, Matúš Peteja, Radim Brát

Department of Surgical Studies, Faculty of Medicine, University of Ostrava, Ostrava, Czech Republic

Submitted: 26 April 2019; Accepted: 12 July 2019 Online publication: 14 March 2020

Arch Med Sci 2023; 19 (1): 122–127

DOI: https://doi.org/10.5114/aoms.2020.93673

Copyright © 2020 Termedia & Banach

Abstract

Since mammographic screening programmes were initiated, the spectrum of breast cancer has changed in terms of impalpable tumours, thus causing the development of new localisation methods, including magnetic markers. We offer herein an up-to-date review focused on two magnetic markers (Magseed, MaMaLoc) currently used in breast cancer surgery for the localisation of breast tumours or pathological axillary nodes. Magnetic marker localisation presents a safe and reliable method for breast tumour marking. Four currently available prospective studies demonstrate that the Magseed system has a negative margin rate and a successful localisation rate, both of which are comparable to standard marking systems used in breast cancer surgery. The main benefits of magnetic markers are that they require no radiation safety measures, and they offer the possibility of longer deployment times, thus simplifying surgery scheduling. The most important drawbacks are cost of the system, depth limitation and need for frequent probe recalibration.

Key words: breast cancer surgery, magnetic marker, impalpable breast tumour, Magseed, MaMaLoc.

Introduction

Breast cancer is the most common worldwide malignancy in women, and its incidence is increasing due to the success of mammography screening programmes, which enable the detection of small and often non-palpable tumours [1]. At present, 25–35% of diagnosed breast cancer tumours are non-palpable [2]. As a result, techniques using markers for precise localisation of the tumour have been developed, with markers being introduced by a radiologist into the centre or to the periphery of the tumour, thus simplifying its detection during surgery.

Targeted axillary dissection (TAD) presents another important option in breast cancer surgery, where the employment of reliable markers is of paramount importance. Targeted axillary dissection consists of a sentinel lymph node biopsy (SLNB) and the excision of the pathological lymph node, which has been marked before neoadjuvant therapy. If metastasis is found in the sentinel lymph node or in a marked pathological node, axillary dissection (AD) levels I and II are performed. Targeted axillary dissection seems to be more accurate (by virtue of the false-negativity rate) than SLNB only, especially in women after neoadjuvant therapy with initially node-positive axillary status [3], although it is dependent on the reliability of the used marker.

Corresponding author: Jan Žatecký 233 Slezská St Neplachovice, 747 74 Czech Republic E-mail: janzatecky.jz@gmail.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Table I. Summary of magnetic localisation methods

Method Size Number of prospective cohorts Magnetic resonance imaging compatibility

Detectable up to Commercially available

Megseed 1 × 5 mm 4 Yes (bloom effect up to 4–6 cm) 30 mm Yes

MaMaLoc 1.5 × 3.5 mm 1 No 35 mm No

Apart from standard markers in breast cancer surgery (such as wire localisation or metal clips), magnetic markers present a promising new option for breast tumour localisation. A literature search revealed that published data on the topic are highly insufficient, and so the aim of the present paper is to offer an up-to-date review focused on magnetic marker localisation in breast cancer surgery.

Non-magnetic markers

Many techniques are used nowadays for localising non-palpable breast tumours. Wire-guided localisation (WGL) is a widely used method, and it was first reported in 1965 [4]. The most commonly published disadvantages of WGL are patient discomfort, wire migration or transection, limitations to surgical incisions because of wire placement, vaso-vagal episodes and complications regarding surgery scheduling (WGL must be performed on the same day as surgery) [4–7].

Implanted tissue marker clips are markers without a specific detection system, and therefore preoperative localisation by WGL or a specimen radiograph (after excision of the lesion for confirmation that the clip is included) is necessary. Clip migration and problematic clip localisation present the main difficulties of the technique [8].

Carbon marking is a cheap marking technique that creates a tattoo in place of an injection, but it can imitate malignancy as a result of foreign-body giant-cell reaction [7, 9, 10].

Radioactive seed localisation (RSL) using iodine-125 (125I) seeds was first described in 1999 by Dauway et al. [11]. Since then, authors of several studies have demonstrated the non-inferiority of RSL compared to WGL [12–14]. The main advantage of RSL is that the seed can be put in place many days or even weeks before surgery, which allows for much easier surgery scheduling. The main RSL disadvantage rests in radiation safety regulations.

In the last few years, several new and non-radioactive non-wire localisation methods have appeared. SAVI SCOUT uses infrared light and radar technology, whereby the marker (12 × 4 mm with two 4 mm-long antennas) is detected by a handpiece and console system [5, 6]. Available data suggest that SAVI SCOUT is comparable to WGL in terms of both the negative margin and the re-

Figure 1. Magseed – 1 × 5 mm stainless steel magnetic localisation seed (with permission of Sysmex CZ Ltd)

Figure 2. Sterile introducer and Magseed (with permission of Sysmex CZ Ltd)

excision rates. However, its main limitations are cost, nickel content relating to the risk of allergy reaction, device failure by interaction with electrocautery and high directionality of the system [5, 6].

Radiofrequency identification tags (RFIDs) are based on radio wave transmission and contain a microprocessor in which information can be stored [7]. It has a history of usage as an identification device, e.g. for pets, but the first clinical data about intraoperative use are very promising, with one advantage over other localisation technologies – the probe can detect distance from the tag [15, 16].

Magnetic markers

At present, there are two markers that use magnetic susceptibility to localise tumours in breast cancer surgery – Magseed and MaMaLoc (Table I).

Magseed (Endomagnetics, Inc.) was approved by the FDA for breast lesion localisation in 2016 [6]. The method utilises 1 × 5 mm stainless steel magnetic seeds (Figure 1) implanted by an 18 G sterile introducer (Figure 2) under mammography or ultrasound guidance (Figure 3). After Magseed implantation, the marker position cannot be changed, which is similar to other nonwire markers [4]. During surgery, the seed is de-

Magnetic marker localisation in breast cancer surgery

tected by a handheld magnetometer, SentiMag (Endomagnetics, Inc.) (Figure 4) at a distance up to 30 mm away [17, 18]. If the Magseed is placed deeper than 30 mm, it may not be detectable, but using palpation with a probe, which means tissue compression, deeper Magseeds are possible to detect. The Magseed may be implanted safely up to 30 days before surgery, but ongoing clinical trials are currently investigating a longer implantation

Patients after NAC

Malignant tumors

Range time to operation [days]

Detection failure

Positive margins

Placement failure

Seed migration

Figure 3. Mammogram with Magseed implementation at the site of the breast tumour (University Hospital Ostrava)

Number of patients

Number of implanted seeds

No

Yes

29/29 (100%)

58/73 (79%)

1–15

0–40

Table II. Review of articles –Magseed system

Figure 4. Handheld Sentimag magnetometer (with permission of Sysmex CZ Ltd)

Study design

Year of publication

Investigators

0/29 (0%)

0/29 (0%)

0/29 (0%)

0/29 (0%)

0/73 (0%)

9/73 (12%)

0/73 (0%)

Unlisted

28

64

29

73

Prospective

Prospective

2018

2018

Harvey et al .

Price et al .

Yes

9/10 (90%)

32/32 (100%)

0

0/10 (0%)

0/10 (0%)

0/10 (0%)

0/10 (0%)

Unlisted

Unlisted

0–25

Unlisted

Unlisted

0/32 (0%)

0/32 (0%)

0/32 (0%)

0/32 (0%)

Unlisted

Unlisted

0/10 (0%)

1/10 (10%)

Unlisted

Unlisted

1/7 (14%)

Unlisted

10

32

Unlisted

Unlisted

10

Unlisted

10

32

10

7

Prospective

Prospective

2018

2018

Conference abstract

Conference abstract

2018

2018

Pohlodek et al

Yes Hersi et al .

Lake et al

Micha et al .

Unlisted

Unlisted

Unlisted

Unlisted

Unlisted

0/9 (0%)

Unlisted

0/20 (0%)

0/20 (0%)

Unlisted

Unlisted

0/9 (0%)

9

0/20 (0%)

Unlisted

9

20

Conference abstract

Conference abstract

2017

2018

Harvey et al

Unlisted Harvey et al .

Jan Žatecký, Otakar Kubala, Petr Jelínek, Milan Lerch, Peter Ihnát, Matúš Peteja, Radim Brát

period, which could be crucial in breast tumours or positive axillary lymph node localisation in patients after neoadjuvant therapy (NAC), which usually lasts 3–4 months. The main limitation of the Magseed system is noted when magnetic resonance imaging (MRI) is part of the treatment protocol, e.g. restaging after NAC. Although the Magseed is MRI-compatible, it has a bloom effect of up to 4–6 cm [5, 7], which renders radiological evaluation of the tumour in breast tissue unfeasible.

To date, there are only four prospective studies and four conference abstracts offering clinical data regarding Magseed magnetic markers (Table II). The highest number of implanted seeds (73 seeds in 64 patients) was published by Price et al. [18], but data regarding Magseed migration are unfortunately lacking in this study. The other three prospective studies, working with 10, 29 and 32 implanted Magseeds, reported 0% seed migration. Moreover, the authors of all four studies reported 100% successful placement and detection of the seed in patients with various breast volumes [17–20]. Harvey et al. reported a correlation between breast size and the ease of detecting the Magseed, in that the detection time was shorter in smaller breasts, and the initial count on the SentiMag probe was higher [17]. Dorsal tumour localisation in large breasts may cause problems in detecting the Magseed, but the palpation of the seed may help with initial localisation. Unsuccessful detection of the Magseed has not been described in the literature to date.

Positive/negative resection margins present an extremely important criterion of localisation method reliability in breast cancer surgery. Negative margins are defined as clear margins without tumour cells or at a distance 1 or 2 mm away from the breast tumour, according to various authors [21, 22]. Markers are usually implanted into the centre of the tumour. Marker implantation and detection accuracy contribute to achievement of negative margins. Three prospective studies presented 0% positive margins in all patients with Magseed localisation [17, 19, 20]. The main limitation of these outcomes is a low number of included patients (10, 28 and 32 patients). Price et al., for instance, reported a positive resection margin in 12% of 64 patients with 73 seeds [18]. In comparison with other localisation methods, WGL has a negative margin rate of 70–88% [9], RSL 73.5–96.7% [5], clip markers 90–92% [23] and SAVI SCOUT 85.1–92.6% [5]. According to these first results, Magseed localisation seems to be comparable with other breast localisation markers in terms of oncosurgical radicality. A prospective comparative study between Magseed and other markers is currently lacking.

The Magseed system can be used to localise multiple lesions in the same breast. The limitation is the proximity of lesions under 2 cm, which may result in the inability of the magnetometer to separate signals [18]. However, it is questionable whether it is actually necessary to separate signals emanating from two close lesions during breast-conserving surgery, because for negative margin achievement, surgeons need to excise a sufficient amount of the surrounding tissue.

The interference of the Magseed signal with electrocautery or paramagnetic surgical instruments is another very important limitation of magnetic marker localisation techniques [4, 6, 9, 24]. Non-conductive instruments (i.e. polymer or carbon fibre) need to be used while scanning with a Sentimag probe [5], but it is not necessary to use non-conductive instruments during the entire surgical procedure. In case of interference with magnetic instruments, the Sentimag probe needs to be recalibrated [6]. The frequent need for recalibration is one of the biggest drawbacks of the Sentimag system.

The localisation of pathological axillary nodes for targeted axillary dissection (TAD) by means of a Magseed system presents another very promising option in breast cancer surgery [17]. According to NCCN guidelines, TAD is a possible option in staging axillary status after neoadjuvant treatment in patients with initially metastatic axillary nodes. Using only SLNB, the false-negativity rate stands at over 10% in this group of patients, which is unacceptable, especially when one recognises that, in comparison, TAD has a false-negativity rate of 2% [3]. Marking of the pathological node in axilla is dependent on a safe and reliable marker and its localisation system. According to the literature, various localisation methods are used – RSL [3], clip markers [25] or carbon marking [26], each with its own advantages and disadvantages as discussed above. Magseed properties such as no marker migration and intuitive detection [17, 19] could be crucial in this area, but no clinical study has been published on this topic in the field of breast cancer surgery, although two prospective open-label studies are currently ongoing at the M.D. Anderson Cancer Center (NCT03038152) [27], (NCT03796559) [28].

Two prospective studies (Pohlodek et al. 2018, Hersi et al. 2018) have investigated the simultaneous use of Magseed and SLNB with the magnetic tracer Sienna (Endomagnetics, Inc.) [19, 20], which is a solution containing superparamagnetic iron oxide nanoparticles that are injected into the breast pre-operatively and accumulate in the sentinel lymph node through lymphatics, before detection by a Sentimag probe [19]. The au-

Magnetic marker localisation in breast cancer surgery

5.

thors found no interference between these two magnetic methods – Magseed for breast lesion localisation or Sienna for SLNB – when using the same Sentimag probe for detection [19, 20], and so they concluded that a combination of Magseed and Sienna should reduce the use of radioactive methods in breast cancer surgery [19, 20]. The successful separate usage of Sienna for SLNB has been reported in prospective studies since 2014 [29–31]; moreover, in 2016, the first metaanalysis was done by Karakatsanis et al., indicating that the effectiveness of the Sienna system is comparable to standard techniques using a radioactive tracer [32].

The main drawback of Magseed is the cost of the system, in that the price of the Sentimag probe and each implanted magnetic seed is much higher in comparison to wire-guided localisation [17, 20]. Harvey et al. proposed that a full cost analysis (considering factors such as faster scheduling in the operating theatre, reduced restrictions due to radiation safety policy and patient satisfaction) could balance out the higher Magseed price [17].

The MaMaLoc (magnetic marker localisation) system, which is another magnetic marker used for breast tumour localisation, was developed at The Netherlands Cancer Institute [33]. The only prospective single-centre study regarding the MaMaLoc system (Figure 5), for which 15 female patients with non-palpable breast cancer tumours for surgical therapy without NAC were recruited, was published in 2017 [33]. All MaMaLoc markers were placed successfully 5–30 days before surgery, and a radioactive 125I seed reference marker was also placed in each patient. MaMaLoc migration ranged from 0 mm to 0.5 mm, which is clinically irrelevant, because it does not change the site of operation. MaMaLoc detection was provided by a Sentimag probe (Endomagnetics, Inc.). The identification rate for the marker

during breast-conserving surgery was 100%, and all tumours were excised. The study does not provide evidence about positive/negative resection margins of excised tumours, but these criteria are scheduled for assessment in an ongoing MaMaLoc-2 trial (NTR6767) [34].

MaMaLoc is not compatible with MRI. Because the Sentimag probe is used, there is a recommendation as in Magseed to use non-conductive tools during the surgery whilst detecting magnetic markers. MaMaLoc technology is not currently commercially available, but The Netherlands Cancer Institute has created a spin-off company to spread the MaMaLoc system worldwide. Magseed is commercially available in many countries in Europe, North America, Asia, Africa and Australia.

Conclusions

Magnetic marker localisation is a safe and reliable method for breast tumour marking. There are four prospective studies available, each of which demonstrates that the Magseed system has a negative margin rate and a successful localisation rate comparable to standard marking systems used in breast cancer surgery. The main benefits of magnetic markers are that they require no radiation safety measures, and they offer the possibility of longer deployment times, thus simplifying surgery scheduling. The most important drawbacks are the cost of the system, depth limitation and need for frequent probe recalibration.

Acknowledgments

This article was supported by the Student Grant Competition of the University of Ostrava.

Conflict of interest

The authors declare no conflict of interest.

References

1. Wyld L, Markopoulos C, Leidenius M, Senkus-Konefka E (eds.). Breast Cancer Management for Surgeons: A European Multidisciplinary Textbook. Springer International Publishing 2018.

2. Patel SN, Mango VL, Jadeja P, et al. Reflector-guided breast tumor localization versus wire localization for lumpectomies: a comparison of surgical outcomes. Clin Imaging 2018; 47: 14-7.

3. Caudle AS, Yang WT, Krishnamurthy S, et al. Improved axillary evaluation following neoadjuvant therapy for patients with node-positive breast cancer using selective evaluation of clipped nodes: implementation of targeted axillary dissection. J Clin Oncol 2016; 34: 1072-8.

4. Spalluto LB, DeBenedectis CM, Morrow MS, Lourenco AP. Advances in breast localization techniques: an opportunity to improve quality of care and patient satisfaction. Semin Roentgenol 2018; 53: 270-9.

Jan Žatecký, Otakar Kubala, Petr Jelínek, Milan Lerch, Peter Ihnát, Matúš Peteja, Radim Brát

Figure

MaMaLoc marker – 1.5 × 3.5 mm magnetic localisation marker (with permission of Sirius Medical Systems B.V.)

5. Cheang E, Ha R, Thornton CM, Mango VL. Innovations in image-guided preoperative breast lesion localization. Br J Radiol 2018; 91: 20170740.

6. Jeffries DO, Dossett LA, Jorns JM. Localization for breast surgery: the next generation. Arch Pathol Lab Med 2017; 141: 1324-9.

7. Hayes MK. Update on preoperative breast localization. Radiol Clin North Am 2017; 55: 591-603.

8. Dash N, Chafin SH, Johnson RR, Contractor FM. Usefulness of tissue marker clips in patients undergoing neoadjuvant chemotherapy for breast cancer. Am J Roentgenol 1999; 173: 911-7.

9. Green M, Vidya R. Techniques used to localize occult breast lesions: an update. Clin Breast Cancer 2018; 18: e281-3.

10. Ruiz-Delgado ML, López-Ruiz JA, Sáiz-López A. Abnormal mammography and sonography associated with foreign-body giant-cell reaction after stereotactic vacuum-assisted breast biopsy with carbon marking. Acta Radiol 2008; 49: 1112-8.

11. Dauway EL, Saunders R, Friedland J. Innovative diagnostics for breast cancer: new frontiers for the new millennium using radioactive seed localization. Surgical forum: 85th annual American college of surgeons clinic congress. Vol. 50. Chicago, IL: American College of Surgeons; 1999.

12. Sharek D, Zuley ML, Zhang JY, Soran A, Ahrendt GM, Ganott MA. Radioactive seed localization versus wire localization for lumpectomies: a comparison of outcomes. AJR Am J Roentgenol 2015; 204: 872-7.

13. Langhans L, Tvedskov TF, Klausen TL, et al. Radioactive seed localization or wire-guided localization of nonpalpable invasive and in situ breast cancer: a randomized, multicenter, open-label trial. Ann Surg 2017; 266: 29-35.

14. Sung JS, King V, Thornton CM, et al. Safety and efficacy of radioactive seed localization with I-125 prior to lumpectomy and/or excisional biopsy. Eur J Radiol 2013; 82: 1453-7.

15. Dauphine C, Reicher JJ, Reicher MA, Gondusky C, Khalkhali I, Kim M. A prospective clinical study to evaluate the safety and performance of wireless localization of nonpalpable breast lesions using radiofrequency identification technology. AJR Am J Roentgenol 2015; 204: W720-3.

16. DiNome ML, Kusske AM, Attai DJ, Fischer CP, Hoyt AC. Microchipping the breast: an effective new technology for localizing non-palpable breast lesions for surgery. Breast Cancer Res Treat 2019; 175: 165-70.

17. Harvey JR, Lim Y, Murphy J, et al. Safety and feasibility of breast lesion localization using magnetic seeds (Magseed): a multi-centre, open-label cohort study. Breast Cancer Res Treat 2018; 169: 531-6.

18. Price ER, Khoury AL, Esserman LJ, Joe BN, Alvarado MD. Initial clinical experience with an inducible magnetic seed system for preoperative breast lesion localization. AJR Am J Roentgenol 2018; 210: 913-7.

19. Pohlodek K, Foltín M, Mečiarová I, Ondriaš F. Simultaneous use of magnetic method in localization of impalpable breast cancer and sentinel lymph nodes detection: initial experience. Nanomedicine 2018; 13: 3075-81.

20. Hersi AF, Eriksson S, Ramos J, Abdsaleh S, Wärnberg F, Karakatsanis A. A combined, totally magnetic technique with a magnetic marker for non-palpable tumour localization and superparamagnetic iron oxide nanoparticles for sentinel lymph node detection in breast cancer surgery. Eur J Surg Oncol 2019; 45: 544-9.

Magnetic marker localisation in breast cancer surgery

21. Pilewskie M, Morrow M. Margins in breast cancer: how much is enough? Cancer 2018; 124: 1335-41.

22. Houssami N, Macaskill P, Marinovich ML, et al. Metaanalysis of the impact of surgical margins on local recurrence in women with early-stage invasive breast cancer treated with breast-conserving therapy. Eur J Cancer 2010; 46: 3219-32.

23. Corsi F, Sorrentino L, Bossi D, Sartani A, Foschi D. Preoperative localization and surgical margins in conservative breast surgery. Int J Surg Oncol 2013; 2013: 793819.

24. Chacko SM, Marshall HN. Implementation of preoperative magnetic seed localization for breast and axillary lesions: an alternative to wires and radioactive seeds. J Radiol Nurs 2018; 37: 154-7.

25. Coufal O, Zapletal O, Gabrielová L, Fabian P, Schneiderová M. Targeted axillary dissection and sentinel lymph node biopsy in breast cancer patients after neoadjuvant chemotherapy – a retrospective study. Rozhl Chir 2018; 97: 551-7.

26. Lee J, Jung JH, Kim WW, et al. 5-year oncological outcomes of targeted axillary sampling in pT1-2N1 breast cancer. Asian J Surg 2019; 42: 681-7.

27. Study the Use of Magseed and Sentimag to Localize Axillary Lymph Nodes – Full Text View – ClinicalTrials. gov [Internet]. Available at: https://clinicaltrials.gov/ ct2/show/NCT03038152 (Accessed: 27.02.2019).

28. Magseed Enabled Long-Term Localization of Axillary Lymph Nodes – Full Text View – ClinicalTrials.gov [Internet]. Available at: https://clinicaltrials.gov/ct2/show/ NCT03796559 (Accessed: 4.02.2019).

29. Thill M, Kurylcio A, Welter R, et al. The Central-European SentiMag study: sentinel lymph node biopsy with superparamagnetic iron oxide (SPIO) vs. radioisotope. Breast 2014; 23: 175-9.

30. Ghilli M, Carretta E, Di Filippo F, et al. The superparamagnetic iron oxide tracer: a valid alternative in sentinel node biopsy for breast cancer treatment. Eur J Cancer Care (Engl) 2017; 26. doi: 10.1111/ecc.12385.

31. Douek M, Klaase J, Monypenny I, et al.; SentiMAG Trialists Group. Sentinel node biopsy using a magnetic tracer versus standard technique: the SentiMAG Multicentre Trial. Ann Surg Oncol 2014; 21: 1237-45.

32. Karakatsanis A, Christiansen PM, Fischer L, et al. The Nordic SentiMag trial: a comparison of super paramagnetic iron oxide (SPIO) nanoparticles versus Tc(99) and patent blue in the detection of sentinel node (SN) in patients with breast cancer and a meta-analysis of earlier studies. Breast Cancer Res Treat 2016; 157: 281-94.

33. Schermers B, van der Hage JA, Loo CE, et al. Feasibility of magnetic marker localisation for non-palpable breast cancer. Breast 2017; 33: 50-6.

34. MaMaLoc: a study on the use of a magnetic marker for tumor localization in breast cancer surgery. Trialregister. nl [Internet]. Available at: https://www.trialregister.nl/ trial/6553 (Accessed: 27.02.2019).

Systematic review/Meta-analysis

A systematic review and meta-analysis of the association between HOTAIR polymorphisms and susceptibility to breast cancer

Bei Wang1,2, Fenglai Yuan1,2, Feng Zhang1,2, Zongning Miao1,2, Donglin Jiang1,2

1Department of Central Laboratory, The Hospital Affiliated to Jiangnan University, Wuxi, Jiangsu, China

2Department of Central Laboratory, The Third Hospital Affiliated to Nantong University, Wuxi, Jiangsu, China

Submitted: 4 June 2019; Accepted: 1 August 2019 Online publication: 27 August 2019

Arch Med Sci 2023; 19 (1): 128–137

DOI: https://doi.org/10.5114/aoms.2019.87537

Copyright © 2019 Termedia & Banach

Abstract

Introduction: Many studies are drawing attention to the associations of HOTAIR polymorphisms and susceptibility to breast cancer, while the results remain inconsistent. We conducted a meta-analysis on the association of four common HOTAIR polymorphisms with breast cancer susceptibility.

Material and methods: Eligible published articles were searched in PubMed, Embase, Cochrane library databases and Web of Science databases up to July 2019. Odds ratios with 95% confidence intervals were used to identify potential links between lncRNA HOTAIR polymorphisms and the risk of breast cancer.

Results: Our results showed no significance in all genetic models of all four SNPs. Pooled analyses detected crucial links between the rs1899663 polymorphism and decreased susceptibility to breast cancer in five genetic models rather than the dominant model in the hospital-based control subgroup. For the rs920778 polymorphism, we found that it significantly decreased breast cancer risk under recessive, homozygous and heterozygous models within the west Asian subgroup and increased breast cancer risk under allele and dominant models within the East Asian subgroup. Additionally, rs920778 polymorphism decreased breast cancer risk under recessive and heterozygous models in the hospital-based control subgroup. However, no significant association was observed between the rs4759314 polymorphism and breast cancer risk in overall and stratified analyses. For rs12826786 polymorphism, it was greatly associated with decreased breast cancer risk under recessive, homozygous and heterozygous models in the hospital-based control subgroup.

Conclusions: HOTAIR rs920778, rs1899663 and rs12826786 polymorphisms may contribute to breast cancer susceptibility.

Key words: breast cancer, HOTAIR, polymorphism, lncRNA, meta-analysis.

Introduction

Breast cancer occurs most among females, and is the main cause of cancer-related mortality in women all over the world [1]. The development of breast cancer is very complicated, and includes environmental and genetic elements. As one of the genetic variants, single nucleotide polymorphisms (SNPs) are widely used to predict the disease risk, prognosis, and

Corresponding author: Bei Wang Department of Central Laboratory

The Third Hospital Affiliated to Nantong University Wuxi, Jiangsu 214041, China Phone: +86 0510-81196629 E-mail: xuewuhenwang@126. com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

clinical outcome [2, 3]. Accumulative investigations have found that SNPs in tumor oncogenes or suppressor genes could play a vital role in breast cancer genetic susceptibility [4–13]. Long non-coding RNAs (lncRNAs) are RNA molecules which exceed 200 nucleotides (nt), but they are unable to encode protein [14]. Growing evidence suggests that LncRNAs interact with DNA, RNA and protein so that they can regulate gene expression at transcriptional and post-transcriptional levels [15, 16].

HOX transcript antisense intergenic RNA (HOTAIR) is a non-coding RNA transcribed from the HOXC locus with an approximate length of 2.2 kb. The long arm of chromosome 12 (12q13.13) is where the HOTAIR gene is located. As an oncogene, HOTAIR is crucial in gene and chromatin regulation, and it is persistently overexpressed in various cancers, involved in tumor invasion, and associated with bad prognosis of corresponding cancers [2, 3, 17–22].

Recently, the relations of HOTAIR SNPs with breast tumor risk have been investigated [19, 23–25]. However, some conclusions remain controversial. Obviously, it is still necessary to further analyze the relation between HOTAIR SNPs and breast cancer susceptibility. Therefore, a meta-analysis of all eligible published case-control studies was conducted to assess the effect of four lncRNA HOTAIR SNPs (rs1899663, rs4759314, rs920778 and rs12826786) on breast cancer risk.

Material and methods

Search strategy and eligibility criteria

Electronic databases (Embase, PubMed, Cochrane Library databases, and Web of Science) were searched by us until July 16, 2019 using the following key words: “HOTAIR or HOX transcript antisense RNA or LncRNA HOTAIR” and “Polymorphism or variation or mutation or genotypes or SNP” and “breast cancer or breast tumor or breast carcinoma”. In addition, a manual search was needed for references of relevant articles in order to achieve potential eligible publications. Studies were included in our meta-analysis if the following criteria were met: (1) case-control studies concerned with the association between HOTAIR polymorphisms and breast cancer, (2) published data related to the frequencies of alleles or genotypes must be sufficient, (3) all studies were published in English. Exclusion criteria included: (1) metaanalysis, reviews and letters, (2) no more than two studies assessed one LncRNA HOTAIR gene.

Data extraction and quality evaluation

Two investigators (Wang B and Yuan FL) independently extracted the following data from each publication: First author, Year, Racial descent,

Country, Source of controls, Quantities of cases and controls, Genotype distributions of cases and controls. Diverse racial descendants were classified as West Asian and East Asian. Disputes were resolved by engaging a third investigator.

Statistical analysis

Crude odds ratios (ORs) with 95% confidence interval (95% CI) were used to calculate and evaluate the strength of relations between lncRNA HOTAIR polymorphisms and breast cancer susceptibility. The pooled ORs were estimated according to five different comparison models (allele contrast, dominant, recessive, homozygous and heterozygous). The heterogeneity between each study was assessed with the c2-based Q statistic test. If the p-value was less than 0.1, significant heterogeneity was found and the random effect (DerSimonian-Laird method) model was applied; otherwise, a fixed effect (Mantel-Haenszel method) model was used. In this meta-analysis, we went a step further to examine the ethnicities, source of controls and genotyping methods so that we could explore the source of heterogeneity. Sensitivity analysis was conducted through removing each study in turn to evaluate the stability of our results. Publication bias was evaluated by funnel plot and Egger’s test. All data analyses were carried out using the Stata 12.0 software. P-values < 0.05 were considered statistically significant.

Results Study characteristics

Through searching the Embase, PubMed, Cochrane Library databases, and Web of Science using the key words, we obtained 12 articles which focused on the association between the LncRNA HOTAIR polymorphisms and susceptibility to breast cancer. According to Figure 1, in all, 4 studies with 4936 cases and 5214 controls conformed to the inclusion criteria and four HOTAIR SNPs were included in this meta-analysis [23–26]. The chief characteristics of three HOTAIR SNPs are shown in Table I. 1813 cases and 1904 controls were contained in 4 studies for rs1899663 and rs4759314 polymorphisms. As for the rs920778 polymorphism, there were 845 cases and 856 controls. As for rs12826786, there were 465 cases and 550 controls. Racial descent came from Asia. The main countries were Iran, China and Turkey. According to the source of control, all studies were defined as hospital-based or population-based. Genotype methods included PCR-RFLP, PCR-sequencer, TaqMan, and CRS-RFLP. Four HOTAIR SNPs were extracted from all eligible studies.

Genotype distributions of HOTAIR rs1899663, rs4759314, rs920778, rs12826786 are list-

A systematic review and meta-analysis of the association between HOTAIR polymorphisms and susceptibility to breast cancer

Rs1899663 G/T (n = 4)

Records from PubMed, Embase, Cochrane library databases and Web of Sciences databases (n = 12)

3 articles excluded after title or abstract review

8 articles identified for further evaluation

4 articles excluded after full article review

5 different articles (including 9 case-control studies) meet all the inclusion criteria were enrolled

Rs4759314 A/G (n = 4)

Rs12826786 C/T (n = 3) Rs920778 T/C (n = 3)

Figure 1. Flowchart for selection of articles in this meta-analysis

Table I. Main characteristics of all included studies

SNPs First author Year Racial descent Country Source of controls Genotype methods Cases Controls

rs1899663

Hassanzarei 2017 West Asian Iran PB PCR-RFLP 220 230

Lin 2018 East Asian China HB PCR-sequencer 969 970

Yan 2015 East Asian China PB PCR-RFLP 502 504 Khorshidi 2017 West Asian Iran PB ARMS-PCR 122 200

rs4759314 Hassanzarei 2017 West Asian Iran PB PCR-RFLP 220 229

Lin 2018 East Asian China HB PCR-sequencer 969 970

Yan 2015 East Asian China PB PCR-RFLP 502 504

Khorshidi 2017 West Asian Iran PB ARMS-PCR 122 200

rs920778

Hassanzarei 2017 West Asian Iran PB PCR-RFLP 220 231

Yan 2015 East Asian China PB CRS-RFLP 502 504

Bayram 2015 West Asian Turkey HB TaqMan 123 122 rs12826786 Hassanzarei 2017 West Asian Iran PB PCR-RFLP 220 228

Bayram 2015 West Asian Turkey HB TaqMan 123 122

Khorshidi 2017 West Asian Iran PB ARMS-PCR 122 200

ed in Table II. Each has one study in three SNPs (rs1899663, rs4759314, rs920778) deviating from Hardy-Weinberg equilibrium (HWE).

Quantitative synthesis

The main meta-analysis results are shown in Table III. Five different comparison models were used to evaluate the pooled ORs. No significance was found in all genetic models of all three SNPs. To go a step further, the data were stratified into different subgroups in the light of ethnicity, source of controls and genotyping methods. There was no significance in the subgroup analysis of rs4759314 polymorphism either (Figure 2, Table III).

As for the rs1899663 polymorphism, there was no significance in the ethnicity subgroups. There was only one study about a hospital-based control subgroup. Increasing risks were found in the allele model, recessive model, homozygous model and heterozygous model with a hospital-based control subgroup (T vs. C: 1.22, 95% CI: 1.03–1.44, p = 0.02; TT vs. CC + CT: 2.00, 95% CI: 1.19–3.62, p = 0.008; TT vs. CC: 2.12, 95% CI: 1.24–3.42, p = 0.006; TT vs. CT: 1.9, 95% CI: 1.08–2.95, p = 0.023) (Figure 2, Table III).

As for the rs920778 polymorphism, it was interesting to find that decreasing risks were observed in the West Asian subgroup under recessive, ho-

Bei Wang, Fenglai Yuan, Feng Zhang, Zongning Miao, Donglin Jiang

A systematic review and meta-analysis of the association between HOTAIR polymorphisms and susceptibility to breast cancer

HWE test Cases

MAF

TT

GT

Genotype distribution

GG

0.46

8

198

T

G

MAF

Table II. Characteristics of case-control studies included in the meta-analysis SNPs

First author

TT

GT

GG

T

Controls G

24

214

246

0.34

16

121

83

153

287

Hassanzarei

rs1899663

0.17

21

284

665

326

1614

0.19

42

299

628

383

< 0.05 Lin

1555

0.19

20

158

326

198

810

0.18

14

149

339

177

0.14 Yan

827

0.41

MAF

38

GG

87

AG

75

AA

163

G

237

A

0.44

MAF

22

GG

64

AG

36

AA

108

0.88 Khorshidi

G

136

0.16 A

0.02

1

7

221

9

449

0.03

0

15

205

15

425

Hassanzarei

rs4759314

0.08

9

144

817

162

1778

0.09

11

157

801

179

< 0.05 Lin

1759

0.06

2

54

448

58

950

0.05

1

50

451

52

0.35 Yan

952

0.14

MAF

3

CC

49

TC

148

TT

55

C

345

T

0.11

MAF

2

CC

24

TC

96

TT

28

0.79 Khorshidi

0.64 T

216

C

0.25

8

98

125

114

348

0.42

33

119

68

185

255

Hassanzarei

rs920778

0.22

18

190

296

226

782

0.17

12

151

339

175

< 0.05 Yan

829

0.39

MAF

15

TT

66

CT

41

CC

96

T

148

C

0.46

MAF

31

TT

52

CT

40

CC

114

0.06 Bayram

T

132

0.14 C

0.46

61

122

45

244

212

0.26

123

80

17

326

114

Hassanzarei

rs12826786

0.17

0.38

0.47

14

49

64

90

44

61

92

188

152

212

0.45

0.45

30

26

51

59

42

37

111

0.25 Bayram

111

135

133

0.19 Khorshidi

mozygous and heterozygous models (TT vs. CC + CT: 3.33, 95% CI: 1.65–6.72, p = 0.001; TT vs. CC: 3.96, 95% CI: 1.13–13.85, p = 0.03; TT vs. CT: 2.94, 95% CI: 1.71–5.03, p < 0.0001). Meanwhile, increasing risks were found in the East Asian subgroup under allele and dominant models (T vs. C: 0.78, 95% CI: 0.65–0.93, p = 0.005; CT + TT vs. CC: 0.68, 95% CI: 0.53–1.89, p = 0.004). Additionally, the associations between HOTAIR and the breast cancer risk were found to be significant in the hospital-based control subgroup (TT vs. CC + CT: 2.4, 95% CI: 1.22–4.73, p = 0.01; TT vs. CT: 2.62, 95% CI: 1.28–5.37, p = 0.008) (Figure 2, Table III).

As for the rs12826786 polymorphism, racial descent was all from west Asia. Similarly to the

A

Study (ID)

PB

rs1899663 polymorphism, there was also one study about a hospital-based control subgroup. Increasing risks were found in the recessive model, homozygous model and heterozygous model with the hospital-based control subgroup (TT vs. CC + CT: 2.49, 95% CI: 1.25–4.97, p = 0.01; TT vs. CC: 2.25, 95% CI: 1.05–4.81, p = 0.038; TT vs. CT: 2.69, 95% CI: 1.29–5.56, p = 0.008) (Figure 2, Table III).

Publication bias and sensitivity analysis

Egger’s test and Begg’s funnel plot were used so that we could evaluate the potential publication bias of the studied literature. No obvious evidence of publication bias was detected in in-

RR (95% CI) Weight (%)

Hassanzarei (2017) 0.75 (0.64–0.88) 25.22

Yan (2015) 0.90 (0.75–1.08) 24.20

Khorshidi (2017) 1.09 (0.90–1.31) 24.16

Subtotal (I2 = 77.8%, p = 0.011) 0.90 (0.72, 1.11) 73.58

HB Lin (2018) 1.18 (1.03–1.34) 26.42

Subtotal 1.18 (1.03–1.34) 26.42

Overall (I2 = 85.1%, p < 0.001) 0.96 (0.78–1.19) 100

Note: Weights are from random effects analysis.

B

Study (ID)

PB

OR (95% CI) Weight (%)

Hassanzarei (2017) 1.76 (0.76–4.07) 3.45

Yan (2015) 0.89 (0.61–1.31) 22.20 Khorshidi (2017) 0.81 (0.50–1.32) 14.92

Subtotal (I2 = 22.0%, p = 0.277) 0.94 (0.71, 1.24) 40.56

HB Lin (2018) 1.12 (0.89–1.40) 59.44

Subtotal 1.12 (0.89–1.40) 59.44

Overall (I2 = 13.9%, p = 0.323) 1.04 (0.88–1.24) 100

0.636 1 1.57 0.246 1 4.07

Figure 2. Forest plot of the association between HOTAIR polymorphisms and breast cancer risk. A – rs1899663 in allele model; B – rs4759314 in allele model

A systematic review and meta-analysis of the association between HOTAIR polymorphisms and susceptibility to breast cancer

Study (ID)

PB

OR (95% CI) Weight (%)

Hassanzarei (2017) 4.33 (2.05–9.17) 32.22

Yan (2015) 0.67 (0.33–1.37) 32.70

Subtotal (I2 = 92.0%, p < 0.001) 1.70 (0.27–10.66) 64.92

HB Bayram (2015) 2.05 (1.17–3.60) 35.08 Subtotal 2.05 (1.17–3.60) 35.08

Overall (I2 = 84.3%, p = 0.002) 1.81 (0.68–4.84) 100 Note: Weights are from random effects analysis.

D

Study (ID) OR (95% CI) Weight (%)

PB

Hassanzarei (2017) 3.08 (2.03–4.67) 35.97 Khorshidi (2017) 0.81 (0.45–1.44) 33.40

Subtotal (I2 = 92.6%, p < 0.001) 1.60 (0.43–5.93) 69.37

HB Bayram (2015) 2.69 (1.29–5.60) 30.63 Subtotal 2.69 (1.29–5.60) 30.63

Overall (I2 = 85.8%, p = 0.001) 1.89 (0.79–4.50) 100

Note: Weights are from random effects analysis.

0.0938 1 10.7 0.246 1 4.07

Figure 2. Cont. C – rs920778 in recessive model; D – rs12826786 in heterozygous model

terleukin-1β (rs1899663, rs4759314, rs920778 and rs12826786) (Figure 3). Also, it showed good results in the sensitivity analysis (Figure 4).

Discussion

HOTAIR expression has been considered to be a new prognostic biomarker for primary breast cancer. GEPIA database (http://gepia.cancer-pku. cn/index.html) analysis based on data from The Cancer Genome Atlas (TCGA) showed that HOTAIR expression only existed in the mammary gland of BR patients. Meanwhile, the HOTAIR mRNA levels in the BR patients were significantly highly than in the controls. Subsequently, the circlncRNAnet database CirclncRNAnet (http://app.cgu.edu.tw/circl-

nc/) showed that lncRNA HOTAIR in BR patients was 4 times higher than in the normal patients and interacted with numerous miRNAs.

Emerging studies have concentrated on links between HOTAIR polymorphisms (rs1899663, rs4759314, rs920778 and rs12826786) and cancer risk. Meanwhile, several meta-analyses investigated the relations of HOTAIR polymorphisms and cancer risk [27–33]; however, none of them have focused on the breast cancer risk independently due to lack of eligible data and some results remain confusing. For example, Qi et al. reported that the HOTAIR rs920778 polymorphism increased cancer risk under allele and recessive models in overall analyses while Tian et al. failed to observe significant associations between them

Bei Wang, Fenglai Yuan, Feng Zhang, Zongning Miao, Donglin Jiang

A C

LogOR LogOR

0.5 0 –0.5 1.5 1.0 0.5 0 –0.5

0 0.1 0.2 S.E. of logOR 0 0.1 0.2 0.3 0.4 S.E. of logOR

B D

LogOR LogOR

1.0 0.5 0 –0.5 –1.0 2.0 1.0 0 –1.0

0 0.2 0.4 S.E. of logOR 0 0.2 0.4 0.6 S.E. of logOR

Figure 3. Begg’s funnel plot analysis of publication bias. A – rs1899663; B – rs4759314; C – rs920778; D – rs12826786

A

Meta-analysis estimates, given named study is omitted

Hassanzarei (2017)

Lin (2018) Yan (2015) Khorshidi (2017)

C

0.80 0.92 0.99 1.08 1.18

Lower CI limit Estimate Upper CI limit

Meta-analysis estimates, given named study is omitted

Hassanzarei (2017) Yan (2015) Bayram (2015)

0.85 1.31 1.88 2.70 4.42

Lower CI limit Estimate Upper CI limit

B D

Meta-analysis estimates, given named study is omitted

Hassanzarei (2017)

Lin (2018) Yan (2015) Khorshidi (2017)

0.73 0.89 1.04 1.22 1.29

Lower CI limit Estimate Upper CI limit

Meta-analysis estimates, given named study is omitted

Hassanzarei (2017) Bayram (2015)

Khorshidi (2017)

0.87 1.17 1.37 1.61 1.86

Lower CI limit Estimate Upper CI limit

Figure 4. Sensitivity analysis. A – rs1899663 in allele model; B – rs4759314; C – rs920778; D – rs12826786

A systematic review and meta-analysis of the association between HOTAIR polymorphisms and susceptibility to breast cancer Arch Med Sci 1, 1st January / 2023

[29, 33]. Zhang et al. reported that the rs920778 polymorphism was relevant to cancer susceptibility in Asian population but not in Turks [30]. Chu et al. summarized the results indicating that the rs920778 polymorphism could increase cancer risks under a recessive model [31]. Liu et al. detected the rs920778 polymorphism, finding that it was closely related to increased cancer risk in all genetic models, but no significant association between rs1899663 polymorphism and cancer risk was observed [32]. Li’s meta-analysis revealed a significant association between HOTAIR rs4759314 and susceptibility to breast cancer; however, we failed to corroborate that in our meta-analysis [34]. Therefore, a meta-analysis was needed.

To our knowledge, it is for the first time that such a meta-analysis has been used to evaluate the linkages between LncRNA HOTAIR polymorphisms and breast cancer susceptibility in overall and stratified analyses. Generally, our results showed no major relations of HOTAIR (rs1899663, rs4759314, rs920778 and rs12826786) polymorphisms and breast cancer risk. In terms of rs4759314 polymorphism, similar results with no significant association were found in subgroup analyses. As for rs1899663 polymorphism, there was decreasing breast cancer risk in the hospital-based control subgroup. As for the rs920778 polymorphism, in terms of ethnicity subgroup analysis, it was interesting to find that the results of West Asia and East Asia were contrary. As for rs12826786, it decreased breast cancer risk in the hospital-based control subgroup.

Although we found that LncRNA HOTAIR polymorphisms were closely related to breast cancer risk in our meta-analysis, there are some limitations to our study that should be taken into consideration. First, the sample size is relatively small in subgroup analysis. Second, only Asians were included in our meta-analysis, which will produce publication bias. Third, in one study on each of three SNPs (rs1899663, rs4759314, rs920778) of HOTAIR the data deviate from HWE. Finally, further analysis was limited by lack of detailed information and original data.

In conclusion, our current meta-analysis found significant links of HOTAIR polymorphisms and the breast cancer risk among Asian people, suggesting that HOTAIR rs920778, rs1899663 and rs12826786 polymorphisms may contribute to breast cancer susceptibility. In future, more comprehensive studies and a large number of samples are needed to verify this association.

Acknowledgments

We give thanks to Miss Dandan Chen for providing language help.

This research was supported by the National Nature Science Foundation of China (No. 31801171), China Postdoctoral Science Foundation (2019M650102) and Wuxi Commission of Health and Family Planning (No. Q201829).

Conflict of interest

The authors declare no conflict of interest.

References

1. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin 2015; 65: 87-108.

2. Kreile M, Piekuse L, Rots D, Dobele Z, Kovalova Z, Lace B. Analysis of possible genetic risk factors contributing to development of childhood acute lymphoblastic leukaemia in the Latvian population. Arch Med Sci 2016; 12: 479-85.

3. Grotenhuis AJ, Dudek AM, Verhaegh GW, et al. Independent replication of published germline polymorphisms associated with urinary bladder cancer prognosis and treatment response. Bladder Cancer 2016; 2: 77-89.

4. Orr N, Dudbridge F, Dryden N, et al. Fine-mapping identifies two additional breast cancer susceptibility loci at 9q31.2. Hum Mol Genet 2015; 24: 2966-84.

5. Cai Q, Zhang B, Sung H, et al. Genome-wide association analysis in East Asians identifies breast cancer susceptibility loci at 1q32.1, 5q14.3 and 15q26.1. Nat Genet 2014; 46: 886-90.

6. Hunter DJ, Kraft P, Jacobs KB, et al. A genome-wide association study identifies alleles in FGFR2 associated with risk of sporadic postmenopausal breast cancer. Nat Genet 2007; 39: 870-4.

7. Gaudet MM, Kirchhoff T, Green T, et al. Common genetic variants and modification of penetrance of BRCA2-associated breast cancer. PLoS Genet 2010; 6: e1001183.

8. Zhai C, Li S, Feng W, et al. Association of interleukin-17a rs2275913 gene polymorphism and asthma risk: a metaanalysis. Arch Med Sci 2018; 14: 1204-11.

9. Hao JQ, Zhang QK, Zhou YX, Chen LH, Wu PF. Association between circulating leptin concentration and G-2548A gene polymorphism in patients with breast cancer: a meta-analysis. Arch Med Sci 2019; 15: 275-83.

10. Zara-Lopes T, Galbiatti-Dias AL, Castanhole-Nunes MM, et al. Polymorphisms in MTHFR, MTR, RFC1 and CssS genes involved in folate metabolism and thyroid cancer: a case-control study. Arch Med Sci 2019; 15: 522-30.

11. Sokouti M, Sadeghi R, Pashazadeh S, Abadi SEH, Ghojazadeh M, Sokouti B. A systematic review and metaanalysis on the treatment of liver hydatid cyst using meta-MUMS tool: comparing PAIR and laparoscopic procedures. Arch Med Sci 2019; 15: 284-308.

12. Belohlavkova P, Vrbacky F, Voglova J, et al. The significance of enzyme and transporter polymorphisms for imatinib plasma levels and achieving an optimal response in chronic myeloid leukemia patients. Arch Med Sci 2018; 14: 1416-23.

13. Ma K, Li L, Liu C, Zhou L, Zhou X. Efficacy and safety of various anti-rheumatic treatments for patients with rheumatoid arthritis: a network meta-analysis. Arch Med Sci 2019; 15: 33-54.

14. Ponting CP, Oliver PL, Reik W. Evolution and functions of long noncoding RNAs. Cell 2009; 136: 629-41.

Bei Wang, Fenglai Yuan, Feng Zhang, Zongning Miao, Donglin Jiang

A systematic review and meta-analysis of the association between HOTAIR polymorphisms and susceptibility to breast cancer

15. Shi X, Sun M, Liu H, Yao Y, Song Y. Long non-coding RNAs: a new frontier in the study of human diseases. Cancer Lett 2013; 339: 159-66.

16. Huarte M. The emerging role of lncRNAs in cancer. Nat Med 2015; 21: 1253-61.

17. Gupta RA, Shah N, Wang KC, et al. Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature 2010; 464: 1071-6.

18. Zhang X, Zhou L, Fu G, et al. The identification of an ESCC susceptibility SNP rs920778 that regulates the expression of lncRNA HOTAIR via a novel intronic enhancer. Carcinogenesis 2014; 35: 2062-7.

19. Bayram S, Ulger Y, Sumbul AT, et al. A functional HOTAIR rs920778 polymorphism does not contributes to gastric cancer in a Turkish population: a case-control study. Fam Cancer 2015; 14: 561-7.

20. Pan W, Liu L, Wei J, et al. A functional lncRNA HOTAIR genetic variant contributes to gastric cancer susceptibility. Mol Carcinog 2016; 55: 90-6.

21. Gong WJ, Yin JY, Li XP, et al. Association of well-characterized lung cancer lncRNA polymorphisms with lung cancer susceptibility and platinum-based chemotherapy response. Tumour Biol 2016; 37: 8349-58.

22. Xue Y, Gu D, Ma G, et al. Genetic variants in lncRNA HOTAIR are associated with risk of colorectal cancer. Mutagenesis 2015; 30: 303-10.

23. Hassanzarei S, Hashemi M, Sattarifard H, Hashemi SM, Bahari G, Ghavami S. Genetic polymorphisms of HOTAIR gene are associated with the risk of breast cancer in a sample of southeast Iranian population. Tumour Biol 2017; 39: 1010428317727539.

24. Lin Y, Guo W, Li N, Fu F, Lin S, Wang C. Polymorphisms of long non-coding RNA HOTAIR with breast cancer susceptibility and clinical outcomes for a southeast Chinese Han population. Oncotarget 2018; 9: 3677-89.

25. Yan R, Cao J, Song C, et al. Polymorphisms in lncRNA HOTAIR and susceptibility to breast cancer in a Chinese population. Cancer Epidemiol 2015; 39: 978-85.

26. Bayram S, Sumbul AT, Batmaci CY, Genc A. Effect of HOTAIR rs920778 polymorphism on breast cancer susceptibility and clinicopathologic features in a Turkish population. Tumour Biol 2015; 36: 3863-70.

27. Lv Z, Xu Q and Yuan Y. A systematic review and metaanalysis of the association between long non-coding RNA polymorphisms and cancer risk. Mutat Res 2017; 771: 1-14.

28. Li J, Cui Z, Li H, et al. Long non-coding RNA HOTAIR polymorphism and susceptibility to cancer: an updated metaanalysis. Environ Health Prev Med 2018; 23: 8.

29. Qi Q, Wang J, Huang B, Chen A, Li G, Li X. Association of HOTAIR polymorphisms rs4759314 and rs920778 with cancer susceptibility on the basis of ethnicity and cancer type. Oncotarget 2016; 7: 38775-84.

30. Zhang ZX, Tong X, Zhang WN, Fu WN. Association between the HOTAIR polymorphisms and cancer risk: an updated meta-analysis. Oncotarget 2017; 8: 4460-70.

31. Chu H, Chen Y, Yuan Q, et al. The HOTAIR, PRNCR1 and POLR2E polymorphisms are associated with cancer risk: a meta-analysis. Oncotarget 2017; 8: 43271-83.

32. Liu X, Duan Q, Zhang J. Quantitative assessment of lncRNA HOTAIR polymorphisms and cancer risk in Chinese population: a meta-analysis based on 26,810 subjects. Oncotarget 2017; 8: 59698-708.

33. Tian T, Li C, Xiao J, et al. Quantitative assessment of the polymorphisms in the HOTAIR lncRNA and cancer risk: a meta-analysis of 8 case-control studies. PLoS One 2016; 11: e0152296.

34. Li J, Liu R, Tang S, et al. The effect of long noncoding RNAs HOX transcript antisense intergenic RNA single-nucleotide polymorphisms on breast cancer, cervical cancer, and ovarian cancer susceptibility: a meta-analysis. J Cell Biochem 2018. doi: 10.1002/jcb.27975.

Basic research Diabetology

High glucose promotes apoptosis and autophagy of MC3T3-E1 osteoblasts

Department of Endocrinology, First Affiliated Hospital of Chongqing Medical University, Chongqing, China

Submitted: 1 August 2019; Accepted: 7 March 2020 Online publication: 29 November 2020

Arch Med Sci 2023; 19 (1): 138–150

DOI: https://doi.org/10.5114/aoms.2020.101307

Copyright © 2020 Termedia & Banach

Abstract

Introduction: Diabetes and osteoporosis are common metabolic diseases. Abnormal high glucose can lead to the apoptosis of osteoblasts. Autophagy is a highly conserved cellular process that degrades proteins or organelles. In the present study, we comparatively analyzed the effects of high glucose and glucose fluctuation on apoptosis and autophagy of MC3T3-E1 osteoblasts.

Material and methods: MC3T3-E1 cells were respectively treated with different concentrations of D-glucose: 5.5 mM for the control group, 25 mM for the high glucose group and 5.5/25 mM for the glucose fluctuation group. Results: High glucose and glucose fluctuation decreased MC3T3-E1 proliferation and activated autophagy. Also, high glucose and glucose fluctuation might induce the production of reactive oxygen species, decline the mitochondrial membrane potential and trigger apoptosis. The differences in the glucose fluctuation treatment group were more significant. Moreover, N-acetylcysteine, an antioxidant reagent, dramatically eliminated the intracellular reactive oxygen species induced by high glucose and glucose fluctuation, and significantly inhibited the autophagy and apoptosis in MC3T3-E1 osteoblasts. Furthermore, treatment with chloroquine, an inhibitor of autophagy, significantly increased the apoptosis of MC3T3-E1 osteoblasts.

Conclusions: High glucose, especially high glucose fluctuation, inhibits proliferation and promotes apoptosis and autophagy of MC3T3-E1 osteoblasts. This may occur through inducing oxidative stress and mitochondrial damage in the osteoblasts.

Key words: autophagy, oxidative stress, apoptosis, osteoblast, glucose fluctuation.

Introduction

Diabetes and osteoporosis are common chronic metabolic diseases worldwide [1–4]. Diabetes may be an important reason for osteoporotic fractures. Type 1 diabetes mellitus is known to damage bone microstructure [5]. Additionally, type 2 diabetes mellitus can damage bone microstructure by compromising matrix structure and cell function, which induce increased osteoblast apoptosis, decreased osteoblast differentiation, and increased bone resorption [6]. Clinically, persistent high glucose and glucose fluctuation are two manifestations of patients with hyperglycemia. However, the specific molecular mechanism underlying the effects of hyperglycemia on osteoporosis remains unclear [7].

Corresponding author: Zhengping Feng Department of Endocrinology First Affiliated Hospital of Chongqing Medical University No. 1 Youyi Road

Yuzhong District, Chongqing 400016, China Phone: +86-13618329135

E-mail: fengzhengping@sina. com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Pei Zhang, Jing Liao, Xiaoju Wang, Zhengping Feng

Autophagy, an important pathway for degrading the damaged organelles and substances in cells, is a highly conserved cytoprotective process in which cytoplasmic contents are sequestered, transported to lysosomes by double-membrane autophagosomes and degraded [8]. It is also an adaptive response to help cells to survive various stresses, such as starvation, oxidative stress, hypoxia or infection, or even fatal stress [9, 10]. Nevertheless, excessive autophagy may result in excessive self-digestion or even death [11]. Autophagy has been reported to play an important role in the normal physiological function of bone cells. For example, Song et al. reported that autophagy activation can induce a survival response to protect bone marrow-derived mesenchymal stem cells from oxidative stress [12]. Meanwhile, autophagy is a double-edged sword. Several studies have demonstrated autophagy deficiency may lead to bone cell dysfunction. For instance, autophagy deficiency could cause declined mineralization capacity in osteoblasts, reduced cellular projections in osteocytes, and retention of organelles in osteocytes [13–15]. Among the markers of autophagy, Beclin1 is an essential protein that signals the onset of autophagy [16]. LC3-II is the only protein marker that is reliably associated with completed autophagosomes, which is typically characterized as an autophagosome marker [17]. In addition to LC3-II, P62 is also used as a protein marker of autophagic degradation [18]. Osteoblasts, the main functional cells for bone formation, play a crucial role in the maintenance of bone homeostasis. Recent studies have shown that high glucose can promote the production of reactive oxygen species (ROS), increase the oxidative stress, and impair the mitochondrial function, which lead to various complications of diabetes [19–21]. Meanwhile, production of ROS could induce apoptosis in various types of cells, such as pancreatic beta cells, endothelial cells, and osteoblasts [22–24]. ROS might affect the functions of osteoblasts, which has been confirmed by our group [25]. Additionally, Li et al. found a close correlation among ROS, autophagy and apoptosis [26]. Accumulation of ROS leads to oxidative damage, which results in mitochondrial dysfunction and cell damage [27, 28]. Meanwhile, apoptosis and autophagy both can be induced by various stress states via ROS generation [29, 30]. Although apoptosis and autophagy are two distinct processes that present clearly different biochemical and morphological features, there is a close relationship and regulatory network between them [31]. However, no previous study has investigated the role of autophagy in the hyperglycemia-induced apoptosis in osteoblasts.

Herein, we investigated the effects of high glucose (continuous high glucose and glucose fluctuation) on autophagy and apoptosis of MC3T3-E1 osteoblasts. The underlying mechanisms were further analyzed and discussed.

Material and methods

Cell culture and treatment

MC3T3-E1 osteoblasts were obtained from the Chinese Center for Type Culture Collection (Shanghai, China). Cells were cultured in a-Minimum Essential Medium (a-MEM, HyClone, USA) supplemented with 10% fetal bovine serum (PAN Biotech, Aidenbach, Germany), 1% sodium pyruvate (Solarbio, Beijing, China) and 1% penicillin/streptomycin (Beyotime, Shanghai, China) in a humidified incubator with 5% CO2 at 37°C. Cells were treated with different concentrations of D-glucose (Sigma, St. Louis, MO, USA): 5.5 mM for the control group (Ctr group), 25 mM for the high glucose group (HG group) and 5.5/25 mM for the glucose fluctuation group (GF group). N-acetylcysteine (NAC, 2 mM, Beyotime, Shanghai, China) and chloroquine (CQ, 10 μM, Sigma, St Louis, MO, USA) were used as an antioxidant and autophagy inhibitor, respectively. The medium, containing different concentrations of D-glucose and NAC/CQ, in each group was changed every eight hours. All the treatment in this study lasted for 48 h.

Cell Counting Kit-8 assay (CCK-8)

The CCK-8 kit (Dojindo, Kumamoto, Japan) is a highly sensitive, non-radioactive colorimetric method for determining the number of living cells in a cell proliferation experiment. The amount of formazan produced, which can be detected by a microplate reader, is directly proportional to the number of living cells. Briefly, MC3T3-E1 cells were seeded in 96-well plates at a density of 5 × 103 per well, and each sample was repeated six times. After incubation for 48 h, 10 μl of CCK-8 solution was added to each well and incubated for another 1–4 h. Then, the optical density (OD) at 450 nm was measured by the microplate reader.

Flow cytometry

Apoptosis was measured with an Annexin V-FITC/PI Apoptosis Detection Kit (Tianjin Sungene Biotech, China). Cells were collected and suspended with 400 μl 1 × binding buffer. Then, 5 μl of Annexin V-FITC was added to the cell suspension and incubated at 2–8°C for 15 min. After that, 10 μl of PI was added and incubated for 5 min at 2–8°C in the dark. Finally, cells were analyzed by flow cytometry (BD FACS Vantage SE). Annexin V-positive/PI-positive cells were considered as late apoptotic or necrotic cells.

Measurement of ROS and MitoSOX

Intracellular and mitochondrial ROS were detected by the 2’, 7’-dichlorofluorescein diacetate (DCFH-DA) fluorescent probe (Beyotime, China) and MitoSOX Red (Invitrogen, USA), a mitochondrial su-

High glucose promotes apoptosis and autophagy of MC3T3-E1 osteoblasts

peroxide indicator, respectively. Cells were plated at a density of 104/well in a 12-well plate. After incubation for 24 h, cells were respectively treated with different concentrations of glucose with or without NAC for another 48 h.

According to the instructions for the DCFH-DA fluorescent probe, cells were first washed with basal medium and then incubated with a diluted DCFHDA probe solution (1 : 1000). During 30 min incubation, the plate was gently shaken every 5–10 min three times. Later, the cells were washed with basal medium again and the green fluorescence intensity was observed by inverted fluorescence microscope (ZEISS, Germany).

For analysis of the mitochondrial ROS, cells were seeded on a glass coverslip in 12-well plates and treated with different concentrations of glucose. After washing with PBS, cells were loaded with 0.5–1.0 ml of MitoSOX (5 μM) solution for 10 min at 37°C and then washed with buffer three times. MitoTracker was used to localize the mitochondria and its fluorescence intensity was observed by fluorescence microscope (ZEISS, Germany).

JC-1 staining analysis

To detect the mitochondrial transmembrane potential (∆Ψm) of MC3T3-E1 osteoblasts in each group, JC-1 staining was performed. Cells were seeded on the slides in a 12-well plate. After 48 h of treatment, the culture medium was discarded, and the cells were washed with PBS. Then, 1 ml of fresh medium and 1 ml of JC-1 staining working solution were added to each well, and the plate was incubated at 37°C for 20 min. Later, the plate was washed twice with pre-chilled JC-1 staining buffer (1×) and 2 ml of fresh medium was added to each well. The fluorescence microscope (ZEISS, Germany) was used to observe the red and green fluorescence. Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was used as a positive control.

Western blot

Osteoblasts were lysed in RIPA lysis buffer with protease inhibitors (Beyotime, Shanghai, China). Proteins were collected after centrifugation. The protein concentrations were determined by BCA Protein Assay Kit (Beyotime, China). The protein samples were subjected to SDS-PAGE (8–12%), and then transferred onto PVDF membranes (Millipore, Germany). After blocking with 5% skimmed milk (Bio-Rad, USA) for at least 1 h, the membranes were incubated with primary antibodies overnight at 4°C, including rabbit anti-LC3 antibody (1 : 1000, Novus), rabbit anti-Bnip3 antibody (1 : 2000, Abcam), rabbit anti-P62 antibody (1 : 1000, Abcam), rabbit anti-Beclin1antibody (1 : 1000, Abcam), mouse anti-caspase 3 antibody (1 : 500, Santa Cruz), rabbit

anti-cleaved caspase 3 antibody (1 : 1000, CST), rabbit anti-Bcl-2 antibody (1 : 1000, CST), rabbit antiBax antibody (1 : 1000, CST) and mouse anti-βactin antibody (1 : 8000, Tianjin Sungene Biotech). Depending on the origin of the primary antibodies, the secondary antibody (1 : 7000 – 1 : 10000) was added and incubated for 1 h at room temperature. The intensities of bands were quantified with Fusion software (VILBER LOURMAT, Germany). All the results were normalized to β-actin.

Immunofluorescence assay

MC3T3-E1 osteoblasts were seeded on pre-coated glass coverslips and treated with different glucose concentrations. Then the coverslips were washed with PBS, fixed in 4% paraformaldehyde for 30 min, permeabilized with 0.25% Triton for 15 min, and blocked with 5% bovine serum albumin for 1 h at room temperature. The cells were incubated with primary antibodies against LC3 (1 : 200) and P62 (1 : 200) overnight at 4°C, followed by incubation with the matching biotinylated secondary antibody for 1 h in the dark at room temperature. Then, nucleus was stained with 4,6-diamidino-2-phenylindole (DAPI) for 5 min, and the fluorescence intensity was observed under the fluorescence microscope.

Transmission electron microscopy (TEM) analysis

Cells (at least 106/group) were collected and fixed with glutaraldehyde. The samples were observed and photographed using TEM (H-7500, Hitachi Company, Japan). Autophagic vacuoles were counted from four randomly selected fields, and the autophagic vacuoles per field were presented as mean ± SEM.

Statistical analysis

Data were analyzed using GraphPad Prism Version7.0a software (GraphPad Software, San Diego, CA, USA). Multiple group analysis was performed by one-way ANOVA or two-way ANOVA. Independent experiments were performed three times. The data were expressed as mean ± SEM. The value of p < 0.05 was considered statistically significant.

Results

High glucose and glucose fluctuation decrease proliferation and induce apoptosis in osteoblasts

To test the effects of high glucose and glucose fluctuation on the apoptosis and proliferation of osteoblasts, flow cytometry and CCK-8 assay, respectively, were performed. The late apoptotic rates of the HG group and the GF group were 2.3and 3.7-fold those of the control group, respec-

Pei Zhang, Jing Liao, Xiaoju Wang, Zhengping Feng

High glucose promotes apoptosis and autophagy of MC3T3-E1 osteoblasts

tively (p < 0.01, Figures 1 A and B) and the proliferation rates of the HG group and the GF group were significantly lower, especially the GF group (p < 0.01, Figure 1 C). Compared with the HG group, the GF group had a significantly higher apoptosis rate (p < 0.01, Figure 1 B) but a significantly lower OD value, which indicates a lower cell proliferation rate (p < 0.05, Figure 1 C). These results indicate that high glucose and glucose fluctuation could inhibit proliferation and induce apoptosis in the osteoblasts.

High glucose and glucose fluctuation induce oxidative stress and mitochondrial damage in osteoblasts

To assess the effect of high glucose and glucose fluctuation on the ROS production in the osteoblasts, the ROS-sensitive fluorescent probe DCFHDA and MitoSOX were used. There was an increase of fluorescence intensity in the HG and GF groups, especially in the latter (Figure 2 A). Thus, high glucose and glucose fluctuation might promote the intracellular and mitochondrial ROS production.

As reported by Pérez et al., intracellular mitochondrial damage was usually accompanied by

a decrease of ∆Ψm [32], which could be monitored by the fluorescent probe JC-1. In the control group, there were a lot of JC-1 aggregates shown as red fluorescence, and a small number of JC-1 monomers shown as green fluorescence, whereas there were more JC-1 monomers and fewer JC-1 aggregates in the HG and GF groups, which were similar to the CCCP group (positive control) (Figure 2 B). The green fluorescence intensity in the GF group was dramatically lower than in the control group and the HG group, indicating that high glucose and glucose fluctuation could cause ∆Ψm reduction and mitochondrial damage in the osteoblasts.

High glucose and glucose fluctuation induce autophagy in osteoblasts

To investigate whether the high glucose and glucose fluctuation may induce autophagy in the osteoblasts, we performed TEM, western blot, and immunofluorescence, respectively. Autophagosomes are autophagy vesicles with an acidic double-membrane structure [33]. The TEM results showed more autophagosomes in the GF group than in the HG group and the control group (Figure 3 A). The protein expression of LC3-II and

Figure 2. Effects of high glucose and glucose fluctuation on ROS and ∆Ψm of osteoblasts. A – Fluorescence images of ROS detected by DCFH-DA probe (green), and immunofluorescence images of mitochondrial ROS detected by MitoSOX. In the lower panel, fluorescence of green and red was MitoTracker and MitoSOX in each group (200×; scale bar = 100mm). B – ∆Ψm was analyzed by JC-1 staining. Representative images are shown (200×; scale bar = 100 mm). CCCP: Carbonyl cyanide 3-chlorophenylhydrazone

Beclin1 were increased in the osteoblasts, while the expression of p62 expression was apparently decreased, as determined by Western blot. Compared with high glucose treatment, the glucose fluctuation treatment could significantly increase the protein level of LC3-II and Beclin1, and decreased p62 expression (Figure 3 B). Immunofluorescence showed that LC3-II expression was increased, while p62 expression was decreased in HG and GF groups (Figure 3 C). These findings reveal that high glucose and glucose fluctuation, especially glucose fluctuation, may induce autophagy in the osteoblasts.

Role of oxidative stress on autophagy in osteoblasts

N-acetylcysteine, an antioxidant reagent, is reported to decrease the production of ROS in the osteoblasts [25]. To determine ROS level after NAC treatment, a DCFH-DA probe was used. As shown in Figure 4 A, the fluorescence intensity of ROS in the HG + NAC and GF + NAC groups was apparently lower than that in the HG and GF groups.

To test the role of oxidative stress on autophagy in the osteoblasts, cells were firstly incubated with NAC and then protein levels were detected by Western blot. Compared with the respective

Pei Zhang, Jing Liao, Xiaoju Wang, Zhengping Feng

MitoSOX

Figure 3. Cont. Effect of high glucose and glucose fluctuation on autophagy in the osteoblasts. C – Immunofluorescence assay (200×, scale bare = 100 mm) was used to show the expression of LC3-II and p62. Fluorescence of blue, green and red was DAPI, LC3-II and p62, respectively

HG and GF group, NAC reduced the expression of LC3-II, Beclin1 and Bnip3 and increased p62 expression in the HG + NAC group and GF + NAC group (Figures 4 B and C). In addition, the expression of p-Akt and p-mTOR in both HG and GF groups, especially in the GF group, was lower than in the control group, while NAC abolished this effect (Figures 4 B and C). These results suggest that the autophagy induced by high glucose and glucose fluctuation is inhibited after the decrease of oxidative stress by NAC.

Effects of oxidative stress and autophagy on apoptosis in osteoblasts

We previously demonstrated that high glucose and glucose fluctuation could induce apoptosis, oxidative stress and autophagy, while NAC could attenuate oxidative stress and inhibit autophagy. To further determine the effects of oxidative stress and autophagy on the apoptosis of osteoblasts, we used flow cytometry to test the apoptosis of osteoblasts treated with high glucose or glucose fluctuation in the presence or absence of NAC and CQ. Compared with the HG and GF groups, NAC significantly decreased their apoptotic rates (Figures 5 A and B, p < 0.01). Meanwhile, Bcl-2 protein expression was lower in the HG and GF groups in comparison to the control group, while Bax, caspase 3, cleaved caspase 3 and cytochrome C expression levels were significantly increased (Figure 5 C). Compared with the HG group, the protein level of Bcl-2 was much lower in the GF group, while the levels of Bax, caspase 3, cleaved caspase 3 and cytochrome C expression were much higher. However, NAC attenuated these effects (Figure 5 C).

After treatment with CQ (an autophagy inhibitor), LC3-II expression was significantly increased (Figures 6 A and B), indicating that autophagy induced by high glucose or glucose fluctuation treatments was inhibited. Also, the apoptotic rates were significantly higher in CQ treatment groups (HG + CQ and GF + CQ) than in the absence of CQ (Figures 6 C and D).

The above results indicated that inhibition of oxidative stress could decrease apoptosis, while inhibition of autophagy could increase apoptosis in osteoblasts.

Discussion

Diabetes and osteoporosis are two common chronic metabolic diseases. Previous studies have shown that diabetes could increase the risk of osteoporotic fracture [34, 35]. The osteoblasts and osteoclasts are known to play extremely important roles in the reconstruction of bone. The maintenance of bone homeostasis depends on the stable function of osteoblasts and osteoclasts [36]. High glucose leads to abnormal bone metabolism, osteoblast dysfunction and bone formation decrease [37]. However, the molecular mechanism of abnormal bone metabolism in diabetes has not been well studied.

Recent studies have shown that glucose fluctuation plays an important role in various chronic complications induced by diabetes [38–44]. In patients with type 1 and type 2 diabetes mellitus, glucose fluctuation has been reported to be closely related to oxidative stress [38, 45]. Moreover, in comparison to high glucose, there was a stronger correlation between glucose fluctuation and oxi-

Pei Zhang, Jing Liao, Xiaoju Wang, Zhengping Feng

High glucose promotes apoptosis and autophagy of MC3T3-E1 osteoblasts

Ctr HG GF – + – + – +

CQ LC3-I LC3-II β-actin

16 kDa 14 kDa 42 kDa b,c A

C B 10 8 6 4 2 0 Ctr HG GF LC3-II/ β -actin – CQ + CQ 670/30 [561]-PI 670/30 [561]-PI 670/30 [561]-PI 104 103 102 101 100 104 103 102 101 100 104 103 102 101 100 100 101 102 103 104 530/40 [488]-Annexin V FITC 100 101 102 103 104 530/40 [488]-Annexin V FITC 100 101 102 103 104 530/40 [488]-Annexin V FITC 670/30 [561]-PI 670/30 [561]-PI 670/30 [561]-PI 104 103 102 101 100 104 103 102 101 100 104 103 102 101 100 100 101 102 103 104 530/40 [488]-Annexin V FITC 100 101 102 103 104 530/40 [488]-Annexin V FITC D 50 40 30 20 10 0 Cell apaptosis (%) – CQ + CQ CQ HG + CQ GF + CQ Ctr HG GF PI Annexin V 100 101 102 103 104 530/40 [488]-Annexin V FITC

dative stress [39]. It was observed that high glucose induced the upregulation of an oxidative stress marker as well as an inflammation marker, which may further trigger apoptosis [41]. In vitro, oxidative stress has been reported to inhibit the differentiation of osteoblasts and induce the apoptosis of osteoblasts [46]. Meanwhile, the increase of intracellular oxidative stress was closely related to the occurrence and development of dysfunction of osteoblasts and osteoporosis [30, 47–49]. ROS is the product of normal metabolism and is important for cell signaling and homeostasis. However, excessive ROS can lead to cell damage [50]. Meanwhile, mitochondria are another source of ROS production. Here, we treated MC3T3-E1 osteoblasts with high glucose (25.0 mmol/l) and glucose fluctuation (5.5/25.0 mmol/l). Our results showed that high glucose and glucose fluctuation treatments might increase the intracellular and mitochondrial ROS production in osteoblasts, especially after glucose fluctuation treatment (Figure 2 A), which is in accordance with a previous study [40]. Also, glucose fluctuation caused a decrease of ∆Ψm and an increase of cytochrome C protein expression (Figures 2 B and 5 C), indicating the damage of intracellular mitochondria. In addition, our results revealed an effect of proliferation inhibition and apoptosis initiation on osteoblasts after high glucose and glucose fluctuation treatment (Figure 1). Also, this effect was more pronounced in the GF group. Above all, the high glucose and glucose fluctuation could induce oxidative stress and damage of osteoblasts.

Autophagy is a basic and crucial physiological activity for cells to adapt to the changing microenvironment [11]. It plays a major role in determining cell fate and is involved in growth and development, cellular homeostasis, and physiological or pathological processes [51]. Hocking et al. found that the dysregulation of autophagy was associated with the pathogenesis of bone or cartilage diseases, such as osteoporosis, Paget bone disease and osteoarthritis [33]. We found that high glucose and glucose fluctuation resulted in significant up-regulation of expression of autophagy-associated proteins LC3-II and Beclin1 as well as the expression of the mitochondrial autophagy-associated protein Bnip3, and down-regulation of p62 (Figure 3 B), which can bind with LC3 and promote degradation of polyubiquitinated protein aggregates, in MC3T3-E1 osteoblasts, especially in the GF group. Also, LC3-II was significantly increased after treatment with CQ (Figure 6 A). CQ, as an autophagy inhibitor, can increase accumulation of LC3-II by raising the lysosomal pH or inhibiting lysosome-mediated proteolysis, by which the autophagosome-lysosome fusion step of autophagy would be interrupted [17]. Furthermore, LC3-II, as

a receptor of the phagocytic membrane, plays an important role in the formation of autophagy [52], while Beclin1 is mainly involved in the initiation of autophagy. As a result, Beclin1 expression was not changed after adding CQ to block autophagosomal degradation (data not shown). TEM analyses also revealed that glucose fluctuation increased the number of autophagosomes (Figure 3 A). These results suggest that autophagy might be activated under the treatment of high glucose and glucose fluctuation, especially the latter.

An increased ROS level has been reported to affect the stability of cell function and was closely related to autophagy and apoptosis [26]. In the present study, glucose fluctuation led to a change of apoptosis-related protein expression, such as decreased Bcl-2 expression as well as increased Bax, caspase 3 and cleaved caspase 3 expression (Figure 5 C). With the treatment of antioxidant NAC, ROS production was reduced (Figure 4 A). Moreover, the increase of apoptosis and changes of protein expression induced by glucose fluctuation were reversed by NAC in MC3T3-E1 osteoblasts (Figure 5 C). Our study showed that NAC not only blocked the ROS production in the MC3T3-E1 osteoblasts, but also inhibited the apoptosis as well as their related protein expression. Then, NAC also suppressed the autophagy-related protein expression induced by glucose fluctuation (Figure 4 B), which indicated that autophagy was closely related to the ROS level in the osteoblasts. This might be related to the intracellular calcium overload induced by ROS [25, 53], which needs further verification. Taken together, these results reveal that ROS may play a role in the apoptosis and autophagy induced by high glucose and glucose fluctuation.

Autophagy plays an important role in the maintenance of cellular homeostasis. Here, we found that after treatment with CQ, an autophagy inhibitor, the apoptotic rates of osteoblasts were increased (Figure 6 C), which indicates that autophagy induced by high glucose and glucose fluctuation might protect MC3T3-E1 osteoblasts from apoptosis. In addition, there are various pathways that could influence autophagy, and we found that both p-Akt/Akt and p-mTOR/mTOR were decreased in the GF group. In a previous study, Ying el al. found that glucose fluctuation increased mesangial cell apoptosis and that was related to the Akt pathway [44]. Also, other studies show that oxidative stress and autophagy are related to the Akt pathway [54, 55]. Byun et al. showed that Bnip3 affected autophagy by regulating the Akt-mTOR-p70S6K pathway [56]. However, our present study was not profound enough. Specially, more accurate methods are needed to detect the production of ROS and the intensity of fluores-

Pei Zhang, Jing Liao, Xiaoju Wang, Zhengping Feng

cence images should be further quantified. Therefore, further studies are needed.

In conclusion, we found that high glucose and glucose fluctuation caused proliferation inhibition and induced apoptosis and autophagy in the MC3T3-E1 osteoblasts, and this effect was more profound under glucose fluctuation. The induction of autophagy and apoptosis was probably related to ROS production, which might be caused by damaged mitochondria. Additionally, further studies should be performed to investigate which organelles or molecules are involved in autophagy and how they regulate MC3T3-E1 osteoblasts under different glucose concentrations (high glucose and glucose fluctuation).

Acknowledgments

This study was supported by the Chongqing Medical Research Fund (grant number 2012-2041).

Conflict of interest

The authors declare no conflict of interest.

References

1. Chen P, Li Z, Hu Y. Prevalence of osteoporosis in China: a meta-analysis and systematic review. BMC Public Health 2016; 16: 1039.

2. Cho NH, Shaw JE, Karuranga S, et al. IDF Diabetes Atlas: Global estimates of diabetes prevalence for 2017 and projections for 2045. Diabetes Res Clin Pract 2018; 138: 271-81.

3. Looker AC, Sarafrazi Isfahani N, Fan B, Shepherd JA. Trends in osteoporosis and low bone mass in older US adults, 2005-2006 through 2013-2014. Osteoporos Int 2017; 28: 1979-88.

4. Noel SE, Mangano KM, Griffith JL, Wright NC, Dawson-Hughes B, Tucker KL. Prevalence of osteoporosis and low bone mass among puerto rican older adults. J Bone Miner Res 2018; 33: 396-403.

5. Wongdee K, Charoenphandhu N. Osteoporosis in diabetes mellitus: possible cellular and molecular mechanisms. World J Diabetes 2011; 2: 41-8.

6. Wongdee K, Charoenphandhu N. Update on type 2 diabetes-related osteoporosis. World J Diabetes 2015; 6: 673-8.

7. Oud L, Spellman C. The association of glucose variability and home discharge among survivors of critical Illness managed with a computerized decision-support tool for glycemic control. J Diabetes Sci Technol 2014; 8: 277-85.

8. Ouyang L, Shi Z, Zhao S, et al. Programmed cell death pathways in cancer: a review of apoptosis, autophagy and programmed necrosis. Cell Prolif 2012; 45: 487-98.

9. Levine B, Kroemer G. Autophagy in the pathogenesis of disease. Cell 2008; 132: 27-42.

10. Mizushima N, Levine B, Cuervo AM, Klionsky DJ. Autophagy fights disease through cellular self-digestion. Nature 2008; 451: 1069-75.

11. Maiuri MC, Kroemer G. Autophagy in stress and disease. Cell Death Differ 2015; 22: 365-6.

12. Song C, Song C, Tong F. Autophagy induction is a survival response against oxidative stress in bone marrow-derived mesenchymal stromal cells. Cytotherapy 2014; 16: 1361-70.

13. Kang X, Yang W, Feng D, et al. Cartilage-specific autophagy deficiency promotes ER stress and impairs chondrogenesis in PERK-ATF4-CHOP-dependent manner. J Bone Miner Res 2017; 32: 2128-41.

14. Nollet M, Santucci-Darmanin S, Breuil V, et al. Autophagy in osteoblasts is involved in mineralization and bone homeostasis. Autophagy 2014; 10: 1965-77.

15. Piemontese M, Onal M, Xiong J, et al. Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage. Sci Rep 2016; 6: 24262.

16. Cao Y, Klionsky DJ. Physiological functions of Atg6/ Beclin 1: a unique autophagy-related protein. Cell Res 2007; 17: 839-49.

17. Klionsky DJ, Abdelmohsen K, Abe A, et al. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 2016; 12: 1-222.

18. Komatsu M, Wang QJ, Holstein GR, et al. Essential role for autophagy protein Atg7 in the maintenance of axonal homeostasis and the prevention of axonal degeneration. Proc Natl Acad Sci USA 2007; 104: 14489-94

19. Giacco F, Brownlee M. Oxidative stress and diabetic complications. Circ Res 2010; 107: 1058-70.

20. Kim MK, Jung HS, Yoon CS, et al. The effect of glucose fluctuation on apoptosis and function of INS-1 pancreatic beta cells. Korean Diabetes J 2010; 34: 47-54.

21. Sun LQ, Xue B, Li XJ, et al. Inhibitory effects of salvianolic acid B on apoptosis of Schwann cells and its mechanism induced by intermittent high glucose. Life Sci 2012; 90: 99-108.

22. Jiao H, Xiao E, Graves DT. Diabetes and its effect on bone and fracture healing. Curr Osteoporos Rep 2015; 13: 327-35.

23. Paneni F, Beckman JA, Creager MA, Cosentino F. Diabetes and vascular disease: pathophysiology, clinical consequences, and medical therapy: part I. Eur Heart J 2013; 34: 2436-43.

24. Tanaka S, Aida K, Nishida Y, Kobayashi T. Pathophysiological mechanisms involving aggressive islet cell destruction in fulminant type 1 diabetes. Endocr J 2013; 60: 837-45.

25. Wang X, Feng Z, Li J, Chen L, Tang W. High glucose induces autophagy of MC3T3-E1 cells via ROS-AKT-mTOR axis. Mol Cell Endocrinol 2016; 429: 62-72.

26. Li L, Tan J, Miao Y, Lei P, Zhang Q. ROS and autophagy: interactions and molecular regulatory mechanisms. Cell Mol Neurobiol 2015; 35: 615-21.

27. Chakrabarti S, Jahandideh F, Wu J. Food-derived bioactive peptides on inflammation and oxidative stress. Biomed Res Int 2014; 2014: 608979.

28. Fandy TE, Jiemjit A, Thakar M, Rhoden P, Suarez L, Gore SD. Decitabine induces delayed reactive oxygen species (ROS) accumulation in leukemia cells and induces the expression of ROS generating enzymes. Clin Cancer Res 2014; 20: 1249-58.

29. Kaminskyy VO, Boris Z. Free radicals in cross talk between autophagy and apoptosis. Antioxid Redox Signal 2014; 21: 86-102.

30. Tang ZH, Cao WX, Su MX, Chen X, Lu JJ. Osimertinib induces autophagy and apoptosis via reactive oxygen species generation in non-small cell lung cancer cells. Toxicol Appl Pharmacol 2017; 321: 18-26.

High glucose promotes apoptosis and autophagy of MC3T3-E1 osteoblasts

31. Booth LA, Seyedmehrad T, Hamed HA, Nichola C, Paul D. The role of cell signalling in the crosstalk between autophagy and apoptosis. Cell Signal 2014; 26: 549-55.

32. Perez MJ, Quintanilla RA. Development or disease: duality of the mitochondrial permeability transition pore. Dev Biol 2017; 426: 1-7.

33. Hocking LJ, Whitehouse C, Helfrich MH. Autophagy: a new player in skeletal maintenance? J Bone Miner Res 2012; 27: 1439-47.

34. Janghorbani M, Van Dam RM, Willett WC, Hu FB. Systematic review of type 1 and type 2 diabetes mellitus and risk of fracture. Am J Epidemiol 2007; 166: 495-505.

35. Johnell O, Kanis JA. An estimate of the worldwide prevalence and disability associated with osteoporotic fractures. Osteoporos Int 2006; 17: 1726-33.

36. Ducy P, Schinke T, Karsenty G. The osteoblast: a sophisticated fibroblast under central surveillance. Science 2000; 289: 1501-4.

37. Masse PG, Pacifique MB, Tranchant CC, et al. Bone metabolic abnormalities associated with well-controlled type 1 diabetes (IDDM) in young adult women: a disease complication often ignored or neglected. J Am Coll Nutr 2010; 29: 419-29.

38. Meng X, Gong C, Cao B, et al. Glucose fluctuations in association with oxidative stress among children with T1DM: comparison of different phases. J Clin Endocrinol Metab 2015; 100: 1828-36.

39. Monnier L, Mas E, Ginet C, et al. Activation of oxidative stress by acute glucose fluctuations compared with sustained chronic hyperglycemia in patients with type 2 diabetes. JAMA 2006; 295: 1681-7.

40. Wu N, Shen H, Liu H, Wang Y, Bai Y, Han P. Acute blood glucose fluctuation enhances rat aorta endothelial cell apoptosis, oxidative stress and pro-inflammatory cytokine expression in vivo. Cardiovasc Diabetol 2016; 15: 109.

41. Wu N, Shen H, Wang Y, et al. Role of the PKCbetaII/JNK signaling pathway in acute glucose fluctuation-induced apoptosis of rat vascular endothelial cells. Acta Diabetol 2017; 54: 727-36.

42. Xia J, Qu Y, Yin C, Xu D. Optical coherence tomography assessment of glucose fluctuation impact on the neointimal proliferation after stent implantation in a diabetic/hypercholesterolemic swine model. Int Heart J 2017; 58: 608-14.

43. Yamagishi S. Role of advanced glycation end products (AGEs) in osteoporosis in diabetes. Curr Drug Targets 2011; 12: 2096-102.

44. Ying C, Wang S, Lu Y, et al. Glucose fluctuation increased mesangial cell apoptosis related to AKT signal pathway. Arch Med Sci 2019; 15: 730-7.

45. Ceriello A, Esposito K, Piconi L, et al. Oscillating glucose is more deleterious to endothelial function and oxidative stress than mean glucose in normal and type 2 diabetic patients. Diabetes 2008; 57: 1349-54.

46. Fatokun AA, Stone TW, Smith RA. Hydrogen peroxide-induced oxidative stress in MC3T3-E1 cells: the effects of glutamate and protection by purines. Bone 2006; 39: 542-51.

47. Dan L, Liangbi X, Maowei Y, et al. ZnT7 can protect MC3T3-E1 cells from oxidative stress-induced apoptosis via PI3K/Akt and MAPK/ERK signaling pathways. Cell Signal 2013; 25: 1126-35.

48. Feng YL, Tang XL. Effect of glucocorticoid-induced oxidative stress on the expression of Cbfa1. Chem Biol Interact 2014; 207: 26-31.

49. Wauquier F, Leotoing L, Coxam V, Guicheux J, Wittrant Y. Oxidative stress in bone remodelling and disease. Trends Mol Med 2009; 15: 468-77.

50. Circu ML, Aw TY. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic Biol Med 2010; 48: 749-62.

51. Eisenberg-Lerner A, Bialik S, Simon HU, Kimchi A. Life and death partners: apoptosis, autophagy and the cross-talk between them. Cell Death Differ 2009; 16: 966-75.

52. Mukhopadhyay S, Panda PK, Sinha N, Das DN, Bhutia SK. Autophagy and apoptosis: where do they meet? Apoptosis 2014; 19: 555-66.

53. Scherz-Shouval R, Elazar Z. Regulation of autophagy by ROS: physiology and pathology. Trends Biochem Sci 2011; 36: 30-8.

54. Shi X, Guan Y, Jiang S, Li T, Sun B, Cheng H. Renin-angiotensin system inhibitor attenuates oxidative stress induced human coronary artery endothelial cell dysfunction via the PI3K/AKT/mTOR pathway. Arch Med Sci 2019; 15: 152-64.

55. Guo H, He Y, Bu C, Peng Z. Antitumor and apoptotic effects of 5-methoxypsoralen in U87MG human glioma cells and its effect on cell cycle, autophagy and PI3K/ Akt signaling pathway. Arch Med Sci 2019; 15: 1530-8.

56. Byun YJ, Kim SK, Kim YM, Chae GT, Jeong SW, Lee SB. Hydrogen peroxide induces autophagic cell death in C6 glioma cells via BNIP3-mediated suppression of the mTOR pathway. Neurosci Lett 2009; 461: 131-5.

Pei Zhang, Jing Liao, Xiaoju Wang, Zhengping Feng

MiR-1286 inhibits lung cancer growth through aerobic glycolysis by targeting PKM2

Hui Li1, Xuexia Lin1, Chaopeng Li1, Jungai Li1, Xunxun Xu1, Dongyue Meng2, Shushen Zheng1

1Department of Pathology, Xingtai Medical College, Xingtai City, Hebei Province, China

2Department of Pathology, The Second Affiliated Hospital of Xingtai Medical College, Xingtai City, Hebei Province, China

Submitted: 17 April 2019; Accepted: 25 July 2019

Online publication: 18 September 2019

Arch Med Sci 2023; 19 (1): 151–159

DOI: https://doi.org/10.5114/aoms.2019.87812

Copyright © 2019 Termedia & Banach

Abstract

Introduction: This study aims to explore the effects of microRNA-1286 (miR1286) on the development of non-small cell lung cancer (NSCLC) via the aerobic glycolysis pathway by targeting pyruvate kinase muscle isozyme M2 (PKM2).

Material and methods: The mRNA levels of miR-1286 in NSCLC tissues and mouse tumor tissues were detected by q-PCR. MiR-1286 was knocked down and overexpressed separately in A549 cells. The effect of miR-1286 on cell proliferation was determined by CCK8 assay. Western blotting was used to measure the expression of PKM2 protein. Lactate production assay was used to detect the aerobic glycolysis in A549 cells. The effect of miR-1286 in vivo was determined by xenograft assay.

Results: The mRNA level of miR-1286 decreased in NSCLC tissues compared with paired, tumor adjacent normal tissues. In addition, miR-1286 inhibited A549 cell proliferation in vitro . Moreover, knockdown of miR-1286 increased PKM2 expression and lactate production. Thus, miR-1286 expression negatively correlated with PKM2 in A549 cells. At the same time, in vivo experiments also showed that miR-1286 suppressed the growth of A549 cells and PKM2 was the target gene of miR-1286.

Conclusions: These data show that miR-1286 inhibits lung cancer proliferation via aerobic glycolysis by targeting PKM2, which suggests that the functions of miR-1286 in NSCLC may play a key role in tumor progression and that miR-1286 can be a promising predictive biomarker and potential therapeutic target for NSCLC.

Key words: miR-1286, non-small cell lung cancer, aerobic glycolysis, PKM2.

Introduction

Lung cancer is the leading cause of cancer incidence and mortality worldwide [1]. Non-small cell lung cancer (NSCLC), which accounts for about 80% of all lung cancers, has a low 5-year survival rate [2]. Furthermore, about 75% of NSCLC patients are already in the advanced stage when they are properly diagnosed with NSCLC [3]. In addition, the effects of the clinical NSCLC treatments are still unsatisfactory. Patients who have undergone surgical resection have high recurrence rates. On the other hand, chemotherapy or radiotherapy always causes many side effects. Thus, more effective diagnoses and therapeutic options are urgently needed for patients who suffer from NSCLC.

Corresponding author: Dr. Shushen Zheng

Xingtai Medical College 618 Gangtiebei Road Qiaoxi District Xingtai 054000, China

Phone: +86 0319-2233396

E-mail: Zshushen0845@126. com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

MicroRNAs (miRNAs) are a type of highly conserved endogenous non-coding fractions of approximately 18 to 25 nt RNAs that play important roles in regulating cell differentiation, apoptosis, tumorigenesis and other biological processes by targeting mRNAs for cleavage or translational repression [4–8].

In the past few years, miRNAs have been found to be closely related to lung tumor biology [9, 10]. For example, Let-7 serves as an anti-tumor microRNA in lung cancer through its ability to downregulate the expression of RAS, which plays oncogenic roles in many kinds of tumors. Reduced expression of Let-7 is observed in lung cancer and is associated with shortened postoperative survival [11, 12]. MiR-340 suppresses lung cancer proliferation and induces apoptosis by enhancing p27 signaling, which can inhibit the activity of cell cycle protein cyclin-dependent kinase 2 (CDK2) [13]. Therefore, elucidating the underlying biological functions and molecular mechanisms of miRNAs in lung cancer will benefit our understanding of miRNAs in lung cancer therapy.

MiR-1286 is a newly identified microRNA located on human chromosome 22. It was reported that the expression of miR-1286 changed during brain development [14]. In another study, miR-1286 was found to be hypermethylated in breast cancer tumors compared with normal tissues, suggesting a potential role of miR-1286 in modulating cancer development [15]. However, as far as we know, the exact function of miR-1286 and its mechanism of action in cancer have never been reported and the potential targets of miR-1286 in lung cancer have not yet been identified.

Tumors need more nutrients and energy to sustain their rapid proliferation, thus resulting in abnormal glucose, lipid and protein metabolism. For example, even in the presence of sufficient oxygen, tumor cells tend to favor metabolism through glycolysis rather than the oxidative phosphorylation pathway, simultaneously accompanied by high glucose utilization and production of large amounts of lactate [16]. The above phenomenon is known as the Warburg effect. Pyruvate kinase muscle isozyme (PKM), including PKM1/M2, catalyzes the last step in the course of aerobic glycolysis [17]. A recent publication reported that miR-124, miR-137, and miR-340 impair colorectal cancer growth by counteracting the Warburg effect due to interference with PKM [18]. In addition, miR-148a/152 suppresses the expression of PKM2, which can increase the activity of pro-proliferating NF-κB signaling, by which miR-148a/152 inhibits the growth and angiogenesis of cancer cells [19]. However, whether miR-1286 is involved in regulating aerobic glycolysis in cancer cells remains unknown.

Here we demonstrate for the first time that miR-1286 is down-regulated in lung tumor tissues compared with adjacent normal tissues. Then, miR1286 inhibits lung cancer cell growth by decreasing PKM2 expression. A549 cells with miR-1286 overexpression have a significantly lower growth rate in vitro and in vivo. Thus, our study reveals the crucial role of miR-1286 in lung cancer and may have important clinical implications in lung cancer therapy.

Material and methods

Human samples

NSCLC tissues and paired adjacent noncancerous tissues were obtained from patients diagnosed with NSCLC in the Second Affiliated Hospital of Xingtai Medical College Hospital. Total RNA was extracted using TRIzol according to the standard procedure and prepared for quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) analysis. Studies involved in clinical specimens were approved by the Ethics Committee of the Second Affiliated Hospital of Xingtai Medical College Hospital.

Reagents

Anti-PKM2 antibody (D78A4, 1 : 1000), antiβ-actin antibody (8H10D10, 1 : 3000), HRP-conjugated polyclonal goat anti-mouse antibody (#7076, 1 : 2000) and HRP-conjugated polyclonal goat anti-rabbit antibody (#7074, 1 : 2000) were from Cell Signaling (Danvers, MA, USA). The lactate assay kit (MAK64) was purchased from Sigma-Aldrich (USA). Cell Counting Kit-8 (CCK8) was bought from Transgen Biotech (Beijing, China).

Cell transfection

Human NSCLC cell line A549 cells were purchased from American Type Culture Collection (ATCC). Cells were cultured in F-12K culture medium (Thermo Fisher Scientific, USA) containing 10% fetal bovine serum (Gibco, USA) at 37°C with 5% CO2 The miR-1286 mimics, miR-1286 inhibitors and negative control sequences were all purchased from GenePharma (Shanghai, China). Cells were divided into four groups: miR-1286 mimic group vs. control mimic group, miR-1286 inhibitor group vs. control inhibitor group. 1 × 105 A549 cells were plated into 24 wells overnight. When the cell density reached 50–60%, A549 was transfected using TransIT transfection reagent (Mirus) according to the manufacturer’s instructions. Forty-eight hours after transfection, cells were collected for detection. For A549 subcutaneous inoculation, A549 cells were transfected with pLenti-III-miR-1286 lentivirus or control lentivirus, and selected by puromycin for 5 weeks to acquire cells that stably overexpress miR-1286.

Hui Li, Xuexia Lin, Chaopeng Li, Jungai Li, Xunxun Xu, Dongyue Meng, Shushen Zheng

MiR-1286

Cell proliferation assay

After being transfected by miR-1286 mimic or miR-1286 inhibitor for 48 h, A549 cells were separately seeded in 96-well plates at a density of 3 × 103 cells/well in 100 μl medium and five duplicates for each group. The rate of cell proliferation was detected at the time points of 18 h and 36 h. 10 μl of CCK8 were added to each well and the cells were incubated for an additional 4 h. The absorbance value at 450 nm was then recorded and calculated. Meanwhile, cells were collected and counted by the plate counting method to determine cell number at 36 h.

RNA extraction and q-PCR

Total RNA was extracted with Trizol (Invitrogen, USA) and cDNA was synthesized using a PrimeScript RT reagent kit (Takara, Japan) according to the manufacturer’s instructions. Quantitative RT-PCR (qRT-PCR) was performed in an Applied Biosystems 7500 real-time PCR system (Foster City, CA, USA) through the application of SYBR Green PCR master mix (TaKaRa Biotechnology Co. Ltd). All quantitative RT-PCR reactions were performed in triplicate. The relative mRNA levels of miR-1286 and PKM2 were normalized against β-actin RNA. The corresponding PCR primers were as follows: PKM2 forward 5′-ATGTCGAAGCCCCATAGTGAA-3′ and reverse 5′-TGGGTGGTGAATCAATGTCCA-3′ ; β-actin was used as an internal control and was amplified using primers 5′-AGTGTGACGTTGACATCCGT-3′ and 5′- GCAGCTCAGTAACAGTCCGC-3′

Western blotting

Total protein of A549 cells was isolated with cell lysis buffer (Cell Signaling Technology) and quantified using the BCA protein assay. 20 μg of total proteins were separated by 10% SDS-PAGE gel and transferred onto a PVDF membrane (Millipore, Billerica, MA). The corresponding primary antibodies were incubated overnight. The corresponding HRP-conjugated secondary antibody was then added and incubated with membranes for 1.5 h at room temperature. Protein bands in PVDF membranes were visualized using SuperSignal West Femto Maximum (Thermo, IL, USA) and detected by BioImaging Systems (Tanon). All samples were assayed in triplicate.

Lactate production assay

A549 cells post-treated by miR-1286 mimic or miR-1286 inhibitor were seeded in 6-well plates in fresh medium for 24 h. Then, detection of lactate was performed using a lactate assay kit. A549 supernatants were collected by centrifugation at the speed of 600 g for 5 min. Lactate concentration in

A549 supernatants was measured using a Lactate Assay Kit (Sigma Aldrich, USA) according to the manufacturer’s instructions on a Nova Bioprofile 100 analyzer. (Nova Biomedical, USA)

In vivo tumor xenograft assay

Six-week-old female athymic nude mice were purchased from SIPPR-BK Experimental Animal Co. (Shanghai, China) and kept in a specific pathogen-free facility. A549 cells infected with lentivirus expressing miR-1286 or control were suspended in PBS at the density of 2 × 107 cells/ml. Subsequently, a 100 μl cell suspension was injected subcutaneously into the flank region of the nude mice. Every 4 days, tumor size was measured by a caliper and tumor volume was calculated by length × width2/2. Three weeks later, mice were sacrificed and tumor tissues were collected for further analysis.

Statistical analysis

All data represent at least three independent experiments to assess statistical significance. Data are shown as the mean ± SD. P < 0.05 was considered as statistically significant and indicated by *p < 0.05, **p < 0.01, ***p < 0.001. All data analysis was performed with SPSS 16.0 software (SPSS Inc., Chicago, IL) and analyses used in this study mainly included two-way ANOVA, paired t test and Student’s t test.

Results

MiR-1286 is down-regulated in NSCLC tissues

In order to investigate the potential role of miR-1286 in NSCLC, we firstly collected 14 pairs of NSCLC tissues and matched noncancerous adjacent tissues, and performed q-PCR to evaluate miR-1286 expression. As shown in Figure 1, miR1286 expression levels in NSCLC tissues were significantly lower than in corresponding noncancerous adjacent tissues, hinting that miR-1286 may take part in the tumorigenesis process of NSCLC.

MiR-1286

strongly inhibits NSCLC cell proliferation in vitro

We next evaluated the effect of miR-1286 on the proliferation of NSCLC cells. MiR-1286 overexpression in A549 cells was conducted by transfecting miR-1286 mimic or control mimic. Subsequently, CCK8 assay was performed to detect the level of cell proliferation. The results showed that compared with control mimic, miR-1286 mimic decreased A549 cell proliferation. In contrast, A549 cells treated with miR-1286 inhibitor exhibited a significant increase in growth (Figure 2 A). The suppressive role

inhibits lung cancer growth through aerobic glycolysis by targeting PKM2

Figure

of miR-1286 on A549 cell proliferation was further verified by cell number counting (Figure 2 B). Taken together, these results suggest that miR-1286 inhibits the proliferation of NSCLC cells in vitro

PKM2 is the target of miR-1286

MiRNAs usually exert their functions by binding to the 3′-UTR of their direct target genes thus downregulating their expression [20–23]. To iden-

tify potential downstream targets of miR-1286, we checked validated targets in the Probability of Interaction by Target Accessibility (PITA) database. Interestingly, we found that PKM2 was the target gene of miR-1286 (Figure 3 A). The PKM2 expression was decreased in miR-1286-overexpressing A549 cells, while PKM2 expression was increased in miR-1286-inhibitor treated A549 cells, which were verified by both q-PCR and western blot analysis (Figures 3 B, C).

Cell metabolism reprogramming, especially altered glucose metabolism, is vitally essential for tumorigenesis. Tumor cells preferentially use aerobic glycolysis to generate energy and support their fast proliferation. Particularly, PKM2 is known to be a crucial regulator in the glycolytic pathway [24, 25]. Therefore, we detected the level of lactate, the final product of glycolysis, in A549 culture supernatants. In comparison with the control group, miR-1286 overexpression led to less lactate production, while miR-1286-inhibitor treated A549 cells produced more lactate (Figure 3 D). On the other hand, the expression of several other glycolysis-related enzymes, including hexokinase 1 (HK1), hexokinase 2 (HK2), phosphofructokinase 1 (PFK1) and lactate dehydrogenase (LDH), showed no significant difference between miR-1286 mimic and control mimic cells (Figure 3 E). To investigate the role of miR-1286 in glycolysis, we analyzed the correlation of miR-1286 and PKM2 and found that the expression level of PKM2 was negatively correlated with miR-1286 (Figure 3 F). These data suggest that PKM2 is the target gene of miR-1286

inhibitor miR-1286 inhibitor

Figure 2. MiR-1286 overexpression inhibited the proliferation of NSCLC cells. A – CCK8 assay was performed to detect A549 cell proliferation ability at indicated time points after transfection of miR-1286 mimic or control mimic and miR-1286 inhibitor or control inhibitor. B – Cell number was determined by cell counting after transfection of miR-1286 mimic or control mimic and miR-1286 inhibitor or control inhibitor for 48 h in A549 cells *P < 0.05, **p < 0.01.

Hui Li, Xuexia Lin, Chaopeng Li, Jungai Li, Xunxun Xu, Dongyue Meng, Shushen Zheng

MiR-1286 inhibits lung cancer growth through aerobic glycolysis by targeting PKM2

miR-1286 5’UCCACUCAGCUGUCCUGCA 3’ PKM2 3’-UTR 3’ CCGAGUAGAACCAGGACGU 5’

miR-1286 mimic mimic inhibitor inhibitor D

miR-1286

p = 0.0054*

Figure 3. PKM2 was a target gene regulated by miR-1286. A – PTIA database was used to scan the matched sequence, and then PKM2 gene was predicted as a direct target of miR-1286. B, C – A549 cells were either transfected with miR-1286 mimic and control mimic or treated with miR-1286 inhibitor or control inhibitor respectively. The mRNA expression of PKM2 was analyzed by qRT-PCR after transfection for 24 h (B) and the protein level of PKM2 was measured by western blotting after transfection for 36 h (C). D – After A549 cells were either transfected with miR-1286 mimic and control mimic or treated with miR-1286 inhibitor or control inhibitor for 24 h, A549 supernatants were collected to detect the production of lactate. E – The expression of several glycolysis-related enzymes was evaluated by qRT-PCR, including hexokinase 1 (HK1), hexokinase 2 (HK2), phosphofructokinase 1 (PFK1) and lactate dehydrogenase (LDH). F – The correlation between expression of PKM2 and miR-1286 in A549 cells was analyzed by Spearman correlation analysis

*P < 0.05, **p < 0.01.

and miR-1286 may take part in regulating the aerobic glycolytic pathway.

MiR-1286 modulates NSCLC cell proliferation via targeting PKM2

In order to clarify whether the inhibitory effect of miR-1286 on lung cancer cell proliferation was dependent on PKM2 downregulation, A549 cells were co-transfected with miR-1286 mimic and PKM2. As shown in Figure 4 A, in contrast with the control group, PKM2 overexpression partially reversed the ability of miR-1286 mimic to repress cell proliferation. Correspondingly, inhibition of miR-1286 expression accelerated cell proliferation, which would be abolished by knockdown of PKM2 expression (Figure 4 B).

As we previously found that the lactate production could be modulated by miR-1286, it was nec-

essary to confirm whether this regulation function leans on PKM2. A549 cells with high expression of miR-1286 exhibited a decline in lactate production and this effect was inverted by co-transfecting with pcDNA3.1-PKM2 plasmid (Figure 4 C). Meanwhile, A549 cells treated with miR-1286 inhibitor produced less lactate, while decreasing PKM2 expression led to opposite results (Figure 4 D). Taken together, all these results indicate that miR-1286 is likely to participate in the glycolysis process by targeting PKM2 to inhibit NSCLC cell proliferation.

MiR-1286

restrains NSCLC tumor growth in vivo

To determine the role of miR-1286 in tumor development in vivo, we constructed the A549miR-1286 mimic cell line which could stably over-

Figure 4. MiR-1286 inhibited NSCLC cell proliferation via targeting PKM2. A – Cell proliferation was determined by CCK8 assay after transfection of miR-1286 mimic or control mimic, together with pcDNA3.1-PKM2 or pcDNA3.1 for 48 h.

proliferation

determined by CCK8 assay after transfection of miR-1286 inhibitor or control inhibitor, together with shPKM2 or sh-Scramble for 48 h. C – Lactate production was measured by using the Nova Bioprofile 100 analyzer after transfection miR-1286 mimic or control mimic, together with pcDNA3.1-PKM2 or pcDNA3.1 for 24 h. D – Lactate production was measured after transfection miR-1286 inhibitor or control inhibitor, together with shPKM2 or sh-Scramble for 48 h *P < 0.05, **p < 0.01, ***p < 0.001.

Hui Li, Xuexia Lin, Chaopeng Li, Jungai Li, Xunxun Xu, Dongyue Meng, Shushen Zheng

MiR-1286 inhibits lung cancer growth through aerobic glycolysis by targeting PKM2

express miR-1286. Cells were implanted into nude mice by subcutaneous injection. As shown in Figure 5 A, the tumor volume of the miR-1286 mimic group was significantly smaller than that of the control group. Meanwhile, the tumor tissues were found with higher expression of miR-1286 and a lower level of PKM2 (Figures 5 B, C). The correlation analysis revealed a negative correlation between PKM2 and miR-1286 expression (Figure 5 D).

PKM2 has been reported to be closely linked to embryogenesis, tissue repair, and cancer. Studies have found that in regional lymph node metastases in NSCLC patients, there is lower PKM2 expression and better overall survival rate of patients [26]. Hence, we also analyzed the association of PKM2 expression with tumor size in the mouse tumor xenograft model. We achieved a parallel result that the expression of PKM2 was positive-

0 9 13 16 20 A549-ctrl A549-miR1286 0 0.02 0.04 0.06 PKM2 level 0 0.02 0.04 0.06 PKM2 level

Figure 5. MiR-1286 affected NSCLC development in vivo A – Nude mice were subcutaneously injected with 2 × 106 A549-miR-1286 or A549-control cells. Tumor size was monitored over 3 weeks and the tumor volume was calculated. B, C – Expression of miR-1286 (B) and PKM2 (C) in the tumor tissues of A549-miR-1286 or A549-control mice xenograft was detected by q-PCR. D, E – Correlations between expression of PKM2 and miR-1286 (D) or PKM2 and tumor volume (E) in mice tumor tissues were analyzed by Spearman correlation analysis using GraphPad Prism 7 *P < 0.05, **p < 0.01.

ly correlated with tumor size (Figure 5 E). In sum, these findings suggest that miR-1286 is a key tumor suppressor that restrains NSCLC tumor cell growth in vivo through depending on PKM2.

Discussion

Emerging evidence has shown that abnormal miRNA expression boosts the initiation and progression of various human tumors [27, 28]. A large number of studies have also indicated that miRNAs can be used as target genes for tumor prediction and treatment, including NSCLC [29–31]. For instance, miR-224/-520c decreases the expression of tumor suppressor candidate 3 (TUSC3) and promotes NSCLC metastasis through impairing the unfolded protein response [32]. Administration of nanoparticles containing miR125b promotes the differentiation of anti-tumor macrophages, thus restraining the growth of NSCLC in vivo [33]. Inhibition of miR-582-3p reduces the malignancy of lung cancer stem cells by suppressing the Wnt/β-catenin pathway [34]. Thus, exploring the role of miRNA in tumors is of great significance for tumor therapy. In our study, we found that miR-1286 was down-regulated in tumor tissues from NSCLC compared with normal tissues for the first time. We also confirmed the negative correlation between miR-1286 expression and A549 cell proliferation in vitro. With regard to the mechanism, functional assays indicated that PKM2 functioned as a downstream target of miR-1286 in NSCLC. Lastly, in vivo experiments again confirmed that restoration of miR-1286 expression in A549 cells impaired their growth in mice. These findings suggest that miR-1286 may serve as a potential anti-tumor microRNA due to its capacity in interfering glycolytic metabolism in tumor cells.

To date, the function of miR-1286 has been poorly investigated. Previous studies only found the altered expression of miR-1286 during brain development and the hypermethylated miR-1286 in breast cancer tissues [14, 15]. To our knowledge, our present work for the first time investigated the regulatory role of miR-1286 in NSCLC. On the other hand, whether miR-1286 can exert a similar function in other types of tumors needs further exploration.

Tumor cells are inclined to favor aerobic glycolysis for glucose metabolism. Previous studies also demonstrated that glucose metabolism modulated by microRNAs is crucial for regulating tumor initiation and progression [35, 36]. There are several rate-limiting enzymes that catalyze the irreversible steps of glycolytic metabolism [37]. When we evaluated the expression of enzymes, including HK1/2, PFK1, LDH and PKM2, only PKM2 expression was found to be downregulated by

miR-1286 mimic. Moreover, miR-1286-induced downregulation of PKM2 resulted in the reduced production of lactate, the final product of glycolysis. Therefore, miR-1286 decreases lung cancer cell proliferation via interfering with the Warburg effect by specifically targeting PKM2.

PKM2, which is the terminal glycolytic enzyme pyruvate kinase, is overexpressed in cancer cells [38]. In the past years, studies have focused on the relationship between PKM2 and miRNA, and have revealed that miRNA may have direct or indirect associations with PKM2. Overexpression of miR-122 in human hepatocellular carcinoma significantly reduces the level of PKM2, which increases cell apoptosis and reduces cell migration and invasion [39]. Another report showed that miR-124 functions as a tumor suppressor and modulated energy metabolism through PTB1/ PKM1/PKM2 signaling in human colorectal tumor cells [40]. However, in this study, we demonstrated that PKM2 was the target gene of miR-1286 in A549 cells. In addition, miR-1286 was negatively related with PKM2 both in vitro and in vivo. These findings indicate that PKM2 may be investigated as an effective therapeutic target for NSCLC.

In conclusion, our study for the first time demonstrated that PKM2 acts as the target of miR-1286 in NSCLC. Moreover, miR-1286 is lower in tissue tumor from NSCLC compared with normal tissue. Our results contribute to better understanding of miR-1286-mediating lung cancer cell proliferation, which regulates tumor angiogenesis and cancer progression and may provide a novel biomarker and potential therapeutic interventions in the future.

Acknowledgments

This work was supported by Xingtai Science and Technology Foundation (2018ZC096).

Conflict of interest

The authors declare co conflict of interest.

References

1. Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018; 68: 394-424.

2. Aggarwal A, Lewison G, Idir S, et al. The state of lung cancer research: a global analysis. J Thorac Oncol 2016; 11: 1040-50.

3. Mao Y, Yang D, He J, Krasna MJ. Epidemiology of lung cancer. Surg Oncol Clin N Am 2016; 25: 439-45.

4. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 116: 281-97.

5. He L, Hannon GJ. MicroRNAs: small RNAs with a big role in gene regulation. Nat Rev Genet 2004; 5: 522-31.

6. Ambros V. The functions of animal microRNAs. Nature 2004; 431: 350-5.

Hui Li, Xuexia Lin, Chaopeng Li, Jungai Li, Xunxun Xu, Dongyue Meng, Shushen Zheng

MiR-1286 inhibits lung cancer growth through aerobic glycolysis by targeting PKM2

7. Calin GA, Sevignani C, Dan Dumitru C, et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci USA 2004; 101: 2999-3004.

8. Wu X, Chen W, Cai H, et al. MiR-216b inhibits pancreatic cancer cell progression and promotes apoptosis by down-regulating KRAS. Arch Med Sci 2018; 14: 1321-32.

9. Yanaihara N, Caplen N, Bowman E, et al. Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Res 2006; 9: 189-98.

10. Hui-Ning L, Qie P, Yang G, Yong-Bin S. miR-181b inhibits chemoresistance in cisplatin-resistant H446 small cell lung cancer cells by targeting Bcl-2. Arch Med Sci 2018; 14: 745-51.

11. Takamizawa J, Konishi H, Yanagisawa K, et al. Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res 2004; 64: 3753-6.

12. Johnson SM, Grosshans H, Shingara J, et al. RAS is regulated by the let-7 MicroRNA family. Cell 2005; 120: 635-47.

13. Fernandez S, Risolino M, Mandia N, et al. miR-340 inhibits tumor cell proliferation and induces apoptosis by targeting multiple negative regulators of p27 in non-small cell lung cancer. Oncogene 2015; 34: 3240-50.

14. Nowakowski TJ, Rani N, Golkaram M, et al. Regulation of cell-type-specific transcriptomes by microRNA networks during human brain development. Nat Neurosci 2018; 21: 1784-92.

15. Cordero F, Ferrero G, Polidoro S, et al. Differentially methylated microRNAs in prediagnostic samples of subjects who developed breast cancer in the European Prospective Investigation into Nutrition and Cancer (EPIC-Italy) cohort. Carcinogenesis 2015; 36: 1144-53.

16. Koppenol WH, Bounds PL, Dang CV. Otto Warburg’s contributions to current concepts of cancer metabolism. Nat Rev Cancer 2011; 11: 325-37.

17. Mazurek S. Pyruvate kinase type M2: A key regulator of the metabolic budget system in tumor cells. Int J Biochem Cell Biol 2011; 43: 969-80.

18. Sun Y, Zhao XP, Zhou YH, Hu Y. miR-124, miR-137 and miR-340 regulate colorectal cancer growth via inhibition of the Warburg effect. Oncol Rep 2012; 28: 1346-52.

19. Xu Q, Liu LZ, Yin Y, et al. Regulatory circuit of PKM2/ NF-kappaB/miR-148a/152-modulated tumor angiogenesis and cancer progression. Oncogene 2015; 34: 5482-93.

20. Corney DC, Flesken-Nikitin A, Godwin AK, Wang W, Nikitin AY. MicroRNA-34b and microRNA-34c are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growth. Cancer Res 2007; 67: 8433-8.

21. Mogilyansky E, Rigoutsos I. The miR-17/92 cluster: a comprehensive update on its genomics, genetics, functions and increasingly important and numerous roles in health and disease. Cell Death Differ 2013; 20: 1603-14.

22. Li X, Roslan S, Johnstone CN, et al. MiR-200 can repress breast cancer metastasis through ZEB1-independent but moesin-dependent pathways. Oncogene 2014; 33: 4077-88.

23. Kumar M, Lu Z, Takwi AAL, et al. Negative regulation of the tumor suppressor p53 gene by microRNAs. Oncogene 2011; 30: 843-53.

24. Dayton TL, Jacks T, Vander Heiden MG. PKM2, cancer metabolism, and the road ahead. EMBO Rep 2016; 17: 1721-30.

25. Christofk HR, Vander Heiden MG, Harris MH, et al. The M2 splice isoform of pyruvate kinase is important for

cancer metabolism and tumour growth. Nature 2008; 452: 230-74.

26. Tryfonidis K, Papadaki C, Assele S, et al. Association of BRCA1, ERCC1, RAP80, PKM2, RRM1, RRM2, TS, TSP1, and TXR1 mRNA expression levels between primary tumors and infiltrated regional lymph nodes in patients with resectable non-small cell lung cancer. Pharmacogenom J 2019; 19: 15-24.

27. Croce CM. Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet 2009; 10: 704-14.

28. Jesionek-Kupnicka D, Braun M, Trąbska-Kluch B, et al. MiR-21, miR-34a, miR-125b, miR-181d and miR-648 levels inversely correlate with MGMT and TP53 expression in primary glioblastoma patients. Arch Med Sci 2019; 15: 504-12.

29. Gao Y, Lin L, Li T, Yang J, Wei Y. The role of miRNA-223 in cancer: function, diagnosis and therapy. Gene 2017; 616: 1-7.

30. Rupaimoole R, Slack FJ. MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat Rev Drug Discov 2017; 16: 203-22.

31. Luo A, Yan H, Liang J, et al. MicroRNA-21 regulates hepatic glucose metabolism by targeting FOXO1. Gene 2017; 627: 194-201.

32. Jeon YJ, Kim T, Park D, et al. miRNA-mediated TUSC3 deficiency enhances UPR and ERAD to promote metastatic potential of NSCLC. Nat Commun 2018; 9: 5110.

33. Parayath NN, Parikh A, Amiji MM. Repolarization of tumor-associated macrophages in a genetically engineered nonsmall cell lung cancer model by intraperitoneal administration of hyaluronic acid-based nanoparticles encapsulating microRNA-125b. Nano Lett 2018; 18: 3571-9.

34. Fang L, Cai J, Chen B, et al. Aberrantly expressed miR582-3p maintains lung cancer stem cell-like traits by activating Wnt/beta-catenin signalling. Nat Commun 2015; 6: 8640.

35. Chan B, Manley J, Lee J, Singh SR. The emerging roles of microRNAs in cancer metabolism. Cancer Lett 2015; 356: 301-8.

36. Guo J, Dou L, Meng X, et al. Hepatic miR-291b-3p mediated glucose metabolism by directly targeting p65 to upregulate PTEN expression. Sci Rep 2017; 7: 39899.

37. Ippolito L, Morandi A, Giannoni E, Chiarugi P. Lactate: a metabolic driver in the tumour landscape. Trends Biochem Sci 2019; 44: 153-66.

38. Eigenbrodt E, Glossmann H. Glycolysis – one of the keys to cancer. Trends Pharmacol Sci 1980; 1: 240-5.

39. Xu QR, Zhang MQ, Tu JF, et al. MicroRNA-122 affects cell aggressiveness and apoptosis by targeting PKM2 in human hepatocellular carcinoma. Oncol Rep 2015; 34: 2054-64.

40. Taniguchi K, Sugito N, Kumazaki M, et al. MicroRNA-124 inhibits cancer cell growth through PTB1/PKM1/PKM2 feedback cascade in colorectal cancer. Cancer Lett 2015; 363: 17-27.

Increased IL-1a expression is correlated with bladder cancer malignant progression

Corresponding author: Shi-Jie Yao

Submitted: 21 February 2019; Accepted: 7 July 2019

Online publication: 13 November 2020

Arch Med Sci 2023; 19 (1): 160–170

DOI: https://doi.org/10.5114/aoms.2020.100677

Copyright © 2020 Termedia & Banach

Abstract

Introduction: To explore the function of interleukin 1 a (IL-1 a ) in bladder cancer (BCa).

Material and methods: Immunohistochemistry (IHC) was used to test the protein expression of IL-1 a in BCa tissues. The relationship between IL-1 a and clinical characteristics was analyzed by the Kaplan-Meier curve method. The gene and protein expression was tested by reverse transcription quantitative polymerase chain reaction (RT-q-PCR) and western blot, respectively. Colony formation and MTT assays were used to detect the potential of proliferation in vitro , and scratch and transwell chamber assays were used to detect the potential of invasion in vitro . Markers of proliferation such as Ki-67 and proliferating cell nuclear antigen (PCNA) and markers of invasion such as MMP-2 and MMP-9 were detected by western blot. Xenograft study was used for the in vivo experiment.

Results: We found that IL-1 a was highly expressed in BCa patients while highly expressed IL-1 a was significantly related to short overall survival and progression-free survival in BCa as well. Moreover, knockdown of IL-1 a might inhibit the ability of cancer cells to proliferate and invade or migrate both in vitro and in vivo

Conclusions: Our findings suggested that IL-1 a might be a therapy target for BCa malignant progression.

Key words: bladder cancer, cancer progression, IL-1 a , proliferation, invasion.

Introduction

Bladder cancer (BCa) is the second most malignant tumor of the urinary system in western society, but in China it is the most common urological malignancy, with an increased incidence [1, 2]. It is estimated that over 80,000 new cases of BCa and 17,000 cases of bladder cancer-related deaths will occur in America this year [3]. Overall, 70–80% of patients have been diagnosed with well-differentiated or moderately differentiated non-muscle invasive BCa. Despite clinical therapeutics, still 60–70% of patients suffered recurrence, of whom 10–30% eventually had malignant progression, including muscle invasiveness or metastasis [4–6]. Thus, it is necessary for clinicians to identify high-risk patients. Moreover, there is a need to study BCa progression mechanisms to develop better therapies, potential biomarkers, and reduce BCa-related morbidity and mortality.

The interleukin 1 (IL-1) cytokine family includes 3 major members that bind to the same receptor, including 2 isoforms of IL-1 (a and β)

Department of Urology Tianjin First Central Hospital 24, Fukang Road

Nankai district of Tianjin 300192, China

E-mail: bluefish-yao@126.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Department of Urology, Tianjin First Central Hospital, Tianjin, China

Shi-Jie Yao, Hong-Shun Ma, Guang-Ming Liu, Yue Gao, Wei Wang

and the antagonist IL-1Ra [7–9]. Interleukin 1a (IL-1a ) is a key cytokine involved in innate and adaptive immunity, inflammasome activation and hematopoiesis through the expression of metastatic and angiogenic genes and growth factors. Owing to the general characteristics IL-1a is associated with carcinogenesis and tumor progression. Recent research showed that IL-1, as a major pro-inflammatory (“alarm”) cytokine that affects both immunity and hematopoiesis, play important roles in tumor initiation, development, and metastasis [10–12]. However, to our knowledge, the biological role of IL-1a in BCa remains unclear.

In this study, we found that high levels of IL-1a expression were significantly associated with poor clinical outcome in BCa patients, and further functional assays showed that knockdown of IL-1a might inhibit the ability of cancer cells to proliferate and invade or migrate both in vivo and in vitro Based on the findings, IL-1a may be a prognostic biomarker for predicting BCa malignant progression and serve as a novel target in cancer therapy.

Material and methods

Patients and samples

One hundred twenty-three patients (aged 54–69 years) clinically and pathologically diagnosed with urothelial carcinoma of bladder in our hospital between July 2013 and May 2017 were included in our study. Tumor tissues were obtained after the first surgical treatment. The clinical and pathological characters such as age, gender, pTMN stage, tumor grade, tumor sizes, lymph metastasis and vascular invasion were recorded. All applicable international, national, and/or institutional guidelines for the care and use of human specimens were followed. Patients were classified according to the 2009 Union Internationale Contre le Cancer Tumour Node Metastasis staging and the 2004 World Health Organization International Society of Urologic Pathologists classification. All patients had no preoperative radiotherapy and/ or chemotherapy and neoadjuvant chemotherapy. Attendees provided written informed consent. All patients showed no evidence of tumor metastasis confirmed by cross-sectional imaging. The study was carried out in accordance with the guidelines approved by the Ethics Committee of Tianjin First Center Hospital.

Immunohistochemistry analysis

Immunohistochemical (IHC) staining was performed using Histostain – SP Kits (SPN-9001, ZSGB-BIO, China). Rabbit antibody against IL-1a (1 : 100 dilution, ab7632, Abcam, UK) was used following the manufacturer’s instructions. The method was described previously [13–15]. For the re-

sults, IL-1a cytoplasmic staining was scored using a 4-point scale (0, no staining; 1+, light staining at high magnification; 2+, intermediate staining; 3+, dark staining of linear membrane at low magnification). Additionally, an immunostaining score (H-score) was measured by the multiplication of IL-1a stained cells and the corresponding intensity score [13–15]. According to the distribution of H-scores, the IL-1a was divided into high and low expression groups.

Cell culture and reagents

T24 and 5637 cells were cultured in RPMI1640 (Invitrogen), supplemented with 10% heat-inactivated fetal bovine serum, 100 U/ml penicillin, and 0.1 mg/ml streptomycin in a 5% CO2 atm at 37°C.

Cell line generation

Small hairpin RNA (shRNA) virus (target virus and negative control) was generated from Vigene (Cat# SH833111, Vigene Biosciences Inc, Maryland, USA) for human IL-1a (RefSeq number: NM_000575) downregulation. Cells were transfected with virus according to the manufacturer’s instructions. Reverse transcription quantitative polymerase chain reaction (RT-q-PCR) and western blot were used to confirm the IL-1a silencing effect.

RNA analysis

Total RNA was extracted by the TRIzol reagent (Invitrogen). A Transcriptor Reverse Transcriptase kit (Roche) was used for first strand cDNA generation. RT-q-PCR was performed with SuperReal PreMix (Tiangen Biotech) by following the amplification scheme: 95°C for 2 min (1 cycle), 95°C for 5 s, 55°C for 30 s, and 72°C for 30 s (35 cycles) and final extension at 72°C for 6 min. A melting curve analysis was performed using the Applied Biosystems StepOne system to ensure correct DNA production. Using 2–∆∆Ct method, the relative expression level was normalized by the internal standard GAPDH. All experiments were performed in triplicate and repeated 3 times. Primer sequences were as follows:

IL1a , Forward Sequence: 5’-ACGGCTGAGTTTCAGTGAGACC-3’;

IL1a , Reverse Sequence: 5’- CACTCTGGTAGGTGTAAGGTGC-3’;

GAPDH, Forward Sequence: 5’- AACGGATTTGGTCGTATTGGG-3’;

GAPDH, Reverse Sequence: 5’- TCGCTCCTGGAAGATGGTGAT-3’.

Western blot analysis

Cells were washed by phosphate buffered saline (PBS) once and then suspended in lysis buf-

fer (50 mM Tris-HCl, pH 7.40, 150 mM NaCl, 1 mM EDTA, 1% deoxycholic acid, 1% NP-40 and protease inhibitor cocktail). Protein concentrations were measured by the BCa Protein Assay (Thermo Fisher Scientific) according to the manufacturer’s instructions. Next, an equal level of protein was electrophoresed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto Immobilon-P transfer membrane (Merck Millipore). The antibodies were as follows: rabbit antibody against IL-1a (1 : 1000 dilution, ab7632, Abcam, UK), mouse antibody against β-actin (1 : 1000 dilution, ab8226, Abcam, UK), rabbit antibody against Ki67 (1 : 1000 dilution, ab16667, Abcam, UK), mouse antibody against proliferating cell nuclear antigen (PCNA) (1 : 500 dilution, ab29, Abcam, UK), mouse antibody against metalloproteinase (MMP)-2 (1 : 1000 dilution, ab37150, Abcam, UK), and mouse antibody against MMP-9 (1 : 1000 dilution, ab38898, Abcam, UK).

Colony formation assay

800 cells per well were plated onto 6-well plates. Cells were fixed with methyl hydrate, stained with 0.5% crystal violet solution and counted after 2 weeks. The assays were performed in triplicate and repeated 3 times.

MTT proliferation assay

MTT assay was performed to detect cell proliferation. 2 × 103 cells were inoculated in a 96-well plate, and 20 μl of 5 mg/ml MTT solution was added to each well 5 h before the end of the incubation. After dimethyl sulfoxide was added to the wells, the plate was transferred to a plate reader (Bio-Rad, Hercules) and absorbance at 570 nm wavelength was measured.

In vitro scratch assay

In vitro scratch assay was performed to study cell migration changes. Trypsinized cells were seeded in 6-well plates and grew to full confluence overnight. A sterile pipette tip was used to scrape the cell monolayer in a straight line to create a scratch in the middle of each well. Subsequently, the medium was changed and replaced with fresh complete medium. The area of the wound closed was calculated at indicated time points.

Migration and invasion assay

For migration or invasion assay, 5 × 104 cells were inoculated in the upper chamber with solid growth factor reduced Matrigel (BD Biosciences, Bedford, MA, USA). The complete medium was placed in the lower chamber and cells were allowed to migrate for 12 h at 37°C. Next, cells that

had migrated through the filter pores from the underside of the membrane were fixed and stained. The number of cells in each chamber was counted under 3 randomized fields by microscope.

Xenograft study

The in vivo animal study was performed with approval by the Animal Experimentation Ethics Committee of Tianjin First Center Hospital. All immune-deficient nude mice (aged 4 weeks) were purchased from Beijing HFK bioscience Co., Ltd. (Beijing, China). 2 × 106 negative control shRNA treated T24 cells and 2 × 106 IL-1a targeting shRNA treated T24 cells were transplanted into mice to establish the xenograft tumor models. Thereafter, tumor final volume was recorded.

Statistical analysis

All data were proceeded by SPSS 22.0 software for Windows (SPSS Inc., Chicago, IL, USA). The clinical relationship between IL-1a expression level and BCa patients’ specific survival rate was evalated by the Kaplan-Meier curve method. Results were analyzed by independent Student’s t-test. Results and data are expressed as the mean ± standard deviation. P-value < 0.05 was defined as statistically significant.

Results

Increased IL-1a 6 expression in patients with bladder cancer correlated with poor clinical outcome

In our clinical cohort of 123 BCa patients, IHC analysis was used to detect low and high expression intensity of IL-1a in BCa specimens (Figure 1 A), while IL-1a was negative in the normal bladder tissues adjacent to carcinoma (Figure 1 B). Based on the protein expression level of IL-1a in the BCa patients, the cohort was divided into 2 groups: the IL-1a low expression group (n = 40) and IL-1a high expression group (n = 83) (Table I). In particular, patients with high IL-1a expression intensity were associated with malignant distant metastasis (p = 0.020) and vascular invasion (p = 0.025) compared with the low-intensity group. There was no clear clinical correlation between IL-1a expression and other clinicopathological features including age, gender, tumor stage, tumor grade, lymph node metastasis, and recurrence. To investigate the clinical relationship between IL-1a expression level and BCa patients’ specific overall survival rate and progression-free survival rate, the Kaplan-Meier curve method was performed. The data showed that the IL-1a high expression group tended to achieve a short overall survival rate and progression-free survival rate compared

Shi-Jie Yao, Hong-Shun Ma, Guang-Ming Liu, Yue Gao, Wei Wang

C

Overal survival rate %

Low 100 200 100 80 60 40 20 0

100 80 60 40 20 0 0 20 40 60 80 100

Time after the surgery [months] IL-1a low IL-1a high

Progression-free survival rate %

0 20 40 60 80 100 Time after the surgery [months] IL-1a low IL-1a high

Figure 1. Increased interleukin 1a (IL-1a) expression associated with poor clinical outcome. A – Low and high IL-1a expression intensity in the bladder cancer tissues with immunohistochemistry (IHC) was observed. B – Low IL-1a expression intensity in the normal bladder tissues adjacent to carcinoma with IHC was observed. C – Overall survival rate and progression-free survival rate in our clinical cohort: high IL-1a protein expression level was significantly associated with lower overall survival rate and progression-free survival rate compared with low expression group (p < 0.05, respectively)

with the low-intensity group (p < 0.05, respectively, Figure 1 C). In summary, the results suggested that IL-1a was highly expressed in BCa tumors while highly expressed IL-1a was closely related to short overall survival rate and progression-free survival rate in BCa patients.

The adeno-associated virus based IL-1a stable knockdown cell lines construction

By recombinant lentivirus, IL-1a expression in cancer cells was silenced by transfection in T24 and 5637 cells. In contrast to negative control cells, we generated stable cell lines with significantly reduced IL-1a mRNA and protein levels validated by RT-q-PCR and Western blot, respectively (both p < 0.05, Figures 2 A and B). We could further efficiently investigate the IL-1a role in BCa by using this model.

Knockdown of IL-1a reducing cell proliferation by modulating Ki-67 and proliferating cell nuclear antigen proteins in T24 and 5637 cell lines

To study the biological effects of IL-1a , colony formation assay and MTT proliferation assay were conducted to assess the possible proliferative effects in BCa cell lines. Colony formation assay results showed that the IL-1a silencing groups showed a significantly lower survival fraction than control groups in both T24 and 5637 cells lines (p < 0.05, Figures 3 A and B). The data imply that knockdown of IL-1a decreased the proliferative capacity of cancer cells. To study the mechanism of partial elimination of proliferation, proliferationrelated proteins such as Ki-67 and PCNA were measured by western blot. Western blot revealed that

Table I. Relationships of interleukin 1a (IL-1a) and clinicopathological characteristics in 123 patients with bladder cancer

Feature All N = 123 IL-1 a expression c 2 P -value Low n = 40 High n = 83

Age [years]: < 65 103 32 71 0.609 0.435 ≥ 65 24 8 12

Gender, n : Male 39 14 25 0.297 0.586 Female 84 26 58

Tumor stage, n : Ta–T2 50 19 31 1.153 0.283 T3/T4 73 21 52

Tumor grade, n : Low 41 16 25 1.186 0.276 High 82 24 58

Lymph node metastasis, n : Yes 33 10 23 0.101 0.751 No 90 30 60 Recurrence, n : Yes 60 17 43 0.936 0.333 No 63 23 40

Distant metastasis, n : Yes 49 10 39 5.445 0.020* No 74 30 44

Vascular invasion, n : Yes 70 17 53 5.020 0.025* No 53 23 30

Ki-67 and PCNA protein were significantly downregulated in both T24 and 5637 IL-1a silencing cell lines, respectively, as compared to the control group (p < 0.05, Figures 3 C and D). In a word, these data suggested that knockdown of IL-1a may downregulate Ki-67 and PCNA proteins to reduce BCa cell proliferation.

Knockdown of IL-1a inhibited migration or invasion in vitro by down-regulating metalloproteinase 2 and 9 proteins

To study cell migration changes, in vitro scratch assay was performed. Interleukin 1a silencing cells showed greater scratch space in T24 and 5637 cell lines, respectively, than cells treated with negative control shRNA (both p < 0.05, Figure 4 A). Cell invasion assays were performed to investigate the role of cancer cell invasion in stable knockdown IL-1a cells. Obviously, the invasive ability of IL-1a targeting shRNA treated cells tended to be partially lost compared to negative control cells 48 h later (both p < 0.05, Figure 4 B). In addition, to

investigate possible mechanisms for these changes, we examined proteins involved in invasion and metastasis at the protein level, including matrix metalloproteinases (MMP)-2 and -9, by immunoblotting. The data showed that in IL-1a shRNA treated cells, MMP-2 and MMP-9 protein levels were lower than the control (both p < 0.05, Figures 4 C and D). Taken together, the above data suggested that knockdown of IL-1a may inhibit the invasiveness of cancer cells by regulating related proteins.

Knockdown of IL-1a inhibited bladder cancer growth in vivo

Based the above results, down-regulated IL-1a significantly inhibited the ability of cell proliferation and invasion or migration in vitro in BCa cell lines. In order to better study the above findings in vivo, xenograft assay was performed. The tumor volume in the down-regulated IL-1a group after 4 weeks management was significantly smaller than that of the control group (p < 0.05, Figure 5 A).

Shi-Jie Yao, Hong-Shun Ma, Guang-Ming Liu, Yue Gao, Wei Wang

IL-1 a expression IL-1 a expression

1.5 1.0 0.5 0 1.5 1.0 0.5 0

IL-1a β-actin

T24 cell T24 cell

Control shRNA Control shRNA

IL-1 a expression IL1 a expression

1.5 1.0 0.5 0 1.5 1.0 0.5 0

IL-1a β-actin

5637 cell 5637 cell

Control shRNA Control shRNA

Figure 2. mRNA and protein expression level of interleukin 1a (IL-1a) in stable cell lines. A – reverse transcription quantitative polymerase chain reaction assay. Results showed that IL-1a mRNA expression levels were significantly reduced compared to negative control cells (p < 0.05). B – Western blot. Results showed that IL-1a protein expression levels were significantly reduced compared to negative control cells (p < 0.05) All results were obtained from at least 3 independent experiments.

To further confirm the silencing effect of IL-1a, immunohistochemical analysis was performed in mouse tumors. The following data showed that our recombinant adeno-associated virus (AAV) significantly reduced IL-1a expression (p < 0.05, Figure 5 B). In summary, the results indicated that knockdown of IL-1a may exert an inhibitory effect in vivo

Discussion

Bladder cancer is the fifth most common malignancy in the world [1]. Despite clinical therapeutics, still 60–70% of patients suffered recurrence, of whom 10–30% eventually had malignant progression, including muscle invasiveness or metastasis [4–6]. The prognosis is usually poor for patients with metastatic disease. In mouse and human genetic studies, IL-1a has been linked to

intrinsic and extrinsic pathways [16]. Interleukin 1a has been demonstrated downstream of Ras activation in an oncogenesis model study [17–19]. As an important driver protein, IL-1a activates the downstream genes of the NF-κB pathway and induces the expression of pro-inflammatory cytokines, developing the pre-malignant cells and overt tumors [20–22]. Multiple studies have revealed that IL-1a expression is elevated in various human tumors, such as cervical, gastric, pancreatic, colon, lung, head, and neck cancers and multiple myeloma [23–29]. However, to our knowledge, the biological role of IL-1a in BCa remains unclear.

Consistent with the previous results, the present study showed that IL-1a protein expression in BCa tissue was relatively high compared to the normal bladder tissue adjacent to carcinoma, and high expression of IL-1a protein suggested a poor progno-

T24 cell 5637 cell Control shRNA

200 150 100 50 0 T24 cell 5637 cell Control shRNA Cell numbers 1.5 1.0 0.5 0 1.5 1.0 0.5 0 Control shRNA Control shRNA T24 cell 5637 cell OD value (570 mm) OD value (570 mm) B 1.5 1.0 0.5 0 1.5 1.0 0.5 0 Control shRNA Ki-67 β-actin Ki-67 β-actin Control shRNA T24 cell 5637 cell Ki-67 expression Ki-67 expression C

Shi-Jie Yao, Hong-Shun Ma, Guang-Ming Liu, Yue Gao, Wei Wang

sis (short overall survival time and progression-free survival time). Several oncogenes, including Ret proto-oncogene and MYC proto-oncogene, mediate tumor transformation and activate intrinsic inflammatory cytokines to establish a tumor-promoting microenvironment [17, 30, 31]. Thus, IL-1a expression level might indicate whether the disease is progressing. Our clinical data demonstrated that patients with high IL-1a protein expression were associated with higher probability of malignant distant metastasis and vascular invasion compared with the low expression group, consistent with various studies on the function of IL-1a [23–31]. However, an early study reported that low IL-1a expression decreased survival of BCa patients, which was different from our result, and the reasons are perhaps the different kinds of peoples and the districts [32]. Therefore, it is urgent to explore the mechanism. Due to the limited number of clinical cases, no clear clinical correlation between IL-1a expression and other clinicopathological features including age, gender, tumor stage, tumor grade, lymph node metastasis and recurrence were found.

To confirm this clinical observation, we generated IL1a targeting the shRNA by AAV to silence its expression in BCa cell lines. Although the results were different, we could use similar research methods [33–36]. We studied the expression of several metastasis-associated proteins, such as MMP2 and MMP-9, after IL-1a silencing. The results suggested that IL-1a regulated MMP-2 and MMP-9 to affect cancer invasiveness. In pancreatic ductal adenocarcinoma, Vegardel suggested that production of IL-1a by pancreatic cancer cells induces changes in MMPs and up-regulated the expression and activation of

MMP1 and MMP3 and enhanced the migration of pancreatic cancer cells [37]. In addition, there have been many studies showing the potential of IL-1a neutralization in patients with cancer [38–41], which will be our future work to use these antibodies but not this study. Moreover, our data demonstrated that knockdown of IL-1a greatly decreased proliferation by regulating Ki-67 and PCNA proteins in T24 and 5637 cell lines in vitro. In summary, we showed that silencing IL-1a in BCa cell lines may cellular behavior by regulating related proteins. However, the key signaling pathways and molecular mechanisms of IL-1a remain to be elucidated.

We do not know whether IL-1β expression could be affected by IL-1a knockdown and the association between IL-1β and IL-1a. Also combining IL-1a knockdown with other therapies could work especially in immunocompetent mice, and these are our future jobs.

In conclusion, our study demonstrated that IL-1a protein expression in BCa tissue was relatively high compared to the normal bladder tissue adjacent to carcinoma. Furthermore, we showed that IL-1a might be a prognostic biomarker for predicting BCa malignant progression. Functional assays showed that knockdown of IL-1a might inhibit the ability of cancer cells to proliferate and invade or migrate both in vivo and in vitro. Hence, an anti-IL-1a strategy might be a potential form of BCa treatment.

Conflict of interest

The authors declare no conflict of interest.

Figure 4. Role of interleukin 1a (IL-1a) in cell migration and invasion in T24 and 5637 cell lines. A – In vitro scratch assay. Results showed that, compared with control, the IL-1a silencing cells showed bigger scratch space in T24 and 5637 cell lines (p < 0.05). B – Cell invasion assay. Results suggested that the number of invasive cells in the IL1-a6 small hairpin RNA treatment group was significantly lower than that in the control group (p < 0.05). C – Western blot showed that MMP-2 and MMP-9 proteins were significantly decreased in IL1a silencing group compared to control (p < 0.05) All results were obtained from at least 3 independent experiments.

Shi-Jie Yao, Hong-Shun Ma, Guang-Ming Liu, Yue Gao, Wei Wang

MMP-9 β-actin

T24 cell 5637 cell

MMP-9 expression MMP-9 expression

1.5 1.0 0.5 0

1.5 1.0 0.5 0 Control shRNA

MMP-9 β-actin Control shRNA

Figure 4. Cont. D – Western blot showed that MMP-2 and MMP-9 proteins were significantly decreased in IL-1a silencing group compared to control (p < 0.05) All results were obtained from at least 3 independent experiments.

Control shRNA Tumor volume [mm 3 ]

400 300 200 100 0 14 21 28 35 42 49 Time after injection [days] Control shRNA

IL-1 a expression

A B 1.5 1.0 0.5 0 Control shRNA

Figure 5. Inhibitory role of interleukin 1a (IL-1a) silencing in vivo A – Xenograft assay. After 4 weeks of treatment, the tumor volume of IL-1a down-regulation group was significantly smaller than control in subcutaneous sites (p < 0.05). B – Results suggested that IL-1a protein level was dramatically reduced by our recombinant the adenoassociated virus in injected tumor xenografts in nude mice by immunohistochemistry assays (p < 0.05)

References

1. Mahdavifar N, Ghoncheh M, Pakzad R, Momenimovahed Z, Salehiniya H. Epidemiology, incidence and mortality of bladder cancer and their relationship with the development index in the world. Asian Pac J Cancer Prev 2016; 17: 381-6.

2. Pakzad R, Mohammadianhafshejani A, Mohammadian M, et al. Incidence and mortality of bladder cancer and their relationship with development in Asia. Asian Pac J Cancer Prev 2015; 16: 7365-74.

3. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin 2018; 68: 7-30.

4. Kurian A, Lee J, Born A. Urothelial bladder cancer with cavitary lung metastases. Can Respir J 2016; 18: e46-7.

5. Raghavan D, Shipley WU, Garnick MB, Russell PJ, Richie JP. Biology and management of bladder cancer. N Engl J Med 1990; 322: 1129-38.

6. Stenzl A, Cowan NC, De Santis M, et al. The updated EAU guidelines on muscle-invasive and metastatic bladder cancer. Eur Urol 2009; 55: 815-25.

7. Colotta F, Re F, Muzio M, et al. Interleukin-1 type II receptor: a decoy target for IL-1 that is regulated by IL-4. Science 1993; 261: 472-5.

8. Garlanda C, Dinarello ChA, Mantovani A. The interleukin-1 family: back to the future. Immunity 2013; 39: 1003-8.

9. Netea MG, van de Veerdonk FL, van der Meer JWM, Dinarello ChA, Joosten LAB. Inflammasome-independent regulation of IL-1-family cytokines. Annu Rev Immunol 2015; 33: 49-77.

10. Voronow E, Dotan S, Krelin Y, et al. Unique versus redundant functions of IL-1a and IL-1β in the tumor microenvironment. Front Immunol 2013; 4: 177.

11. Lewis AM, Varghese S, Xu H, Alexander HR. Interleukin-1 and cancer progression: the emerging role of interleukin-1 receptor antagonist as a novel therapeutic agent in cancer treatment. J Transl Med 2006; 4: 48.

12. Lin WW, Karin M. A cytokine-mediated link between innate immunity, inflammation, and cancer. J Clin Invest 2007; 117: 1175-83.

13. Kanehira M, Katagiri T, Shimo A, et al. Oncogenic role of MPHOSPH1, a cancer-testis antigen specific to human bladder cancer. Cancer Res 2007; 67: 3276-85.

14. Andersen NL, Brugmann A, Lelkaitis G, Nielsen S, Lippert MF, Vyberg M. Virtual double staining: a digital approach to immunohistochemical quantification of estrogen receptor protein in breast carcinoma specimens. Appl Immunohistochem Mol Morphol 2018; 26: 620-6.

15. Zhang X, Liu L, Yang X, Wang L, Zhang C, Hu Y. Expression of TP53 and IL-1a in unicystic ameloblastoma predicts the efficacy of marsupialization treatment. Medicine 2018; 97: e9795.

16. Mantovani A, Allavena P, Sica A, Balkwill F. Cancer-related inflammation. Nature 2008; 454: 436-44.

17. Wang Q, Downey GP, McCulloch ChA. Focal adhesions and Ras are functionally and spatially integrated to mediate IL-1 activation of ERK. Faseb J 2011; 25: 3448-64.

18. McDermott EP, O’Neill LAJ. Ras participates in the activation of p38 MAPK by Interleukin-1 by associating with IRAK, IRAK2, TRAF6, and TAK-1. J Biol Chem 2002; 277: 7808-15.

19. Debret R, Le Naour RR, Sallenave JM, et al. Elastin fragments induce IL-1β upregulation via NF-κB pathway in melanoma cells. J Invest Dermatol 2006; 126: 1860-8.

20. Amit S, Ben-Neriah Y. NF-κB activation in cancer: a challenge for ubiquitination- and proteasome-based therapeutic approach. Semin Cancer Biol 2003; 13: 15-28.

21. Greten FR, Eckmann L, Greten TF, et al. IKKbeta links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell 2004; 118: 285-96.

22. Pikarsky E, Porat RM, Stein I, et al. NF-kappa B functions as a tumour promoter in inflammation-associated cancer. Nature 2004; 431: 461-6.

23. Song Z, Lin Y, Ye X, et al. Expression of IL-1alpha and IL-6 is associated with progression and prognosis of human cervical cancer. Med Sci Monit 2016; 22: 4475-81.

24. Gong Z, Ma J, Su H, et al. Interleukin-1 receptor antagonist inhibits angiogenesis in gastric cancer. Int J Clin Oncol 2018; 23: 659-70.

25. Sawai H, Funahashi H, Yamamoto M, et al. Interleukin-1alpha enhances integrin alpha(6)beta(1) expression

and metastatic capability of human pancreatic cancer. Oncology 2003; 65: 167-73.

26. Akagi Y, Liu W, Xie K, Zebrowski B, Shaheen RM, Ellis LM. Regulation of vascular endothelial growth factor expression in human colon cancer by interleukin-1beta. Br J Cancer 1999; 80: 1506-11.

27. Chen Z, Malhotra PS, Thomas GR, et al. Expression of proinflammatory and proangiogenic cytokines in patients with head and neck cancer. Clin Cancer Res 1999; 5: 1369-79.

28. Portier M, Zhang XG, Ursule E, et al. Cytokine gene expression in human multiple myeloma. Br J Haematol 1993; 85: 514-20.

29. Saijo Y, Tanaka M, Miki M, et al. Proinflammatory cytokine IL-1 beta promotes tumor growth of Lewis lung carcinoma by induction of angiogenic factors: in vivo analysis of tumor-stromal interaction. J Immunol 2002; 169: 469-75.

30. Cataisson C, Salcedo R, Hakim S, et al. IL-1R–MyD88 signaling in keratinocyte transformation and carcinogenesis. J Exp Med 2012; 209: 1689-702.

31. Apte RN, Dotan S, Elkabets M, et al. The involvement of IL-1 in tumorigenesis, tumor invasiveness, metastasis and tumor-host interactions. Cancer Metastasis Rev 2006; 25: 387-408.

32. Seddighzadeh M, Steineck G, Jansson O, et al. Low interleukin-1alpha messenger RNA levels predict decreased overall survival time of patients with urinary bladder carcinoma. Br J Cancer 2001; 84: 329-34.

33. Li J, Wu G, Cao Y, Hou Z. Roles of miR-210 in the pathogenesis of pre-eclampsia. Arch Med Sci 2019; 15: 183-90.

34. Yang M, Zhang L, Wang X, Zhou Y, Wu S. Down-regulation of miR-203a by lncRNA PVT1 in multiple myeloma promotes cell proliferation. Arch Med Sci 2018; 14: 1333-9.

35. Li JY, Liu ChP, Shiao WCh, et al. Inhibitory effect of PDGFBB and serum-stimulated responses in vascular smooth muscle cell proliferation by hinokitiol via up-regulation of p21 and p53. Arch Med Sci 2018; 14: 579-87.

36. Luo Z, Pan J, Ding Y, Zhang YS, Zeng Y. The function and clinical relevance of lncRNA UBE2CP3-001 in human gliomas. Arch Med Sci 2018; 14: 1308-20.

37. Tjomsland V, Pomianowska E, Aasrum M, Sandnes D, Verbeke CS, Gladhaug IP. Profile of MMP and TIMP expression in human pancreatic stellate cells: regulation by IL-1a and TGFβ and implications for migration of pancreatic cancer cells. Neoplasia 2016; 18: 447-56.

38. Dinarello CA. Interleukin-1alpha neutralisation in patients with cancer. Lancet Oncol 2014; 15: 552-3.

39. Hickish T, Andre T, Wyrwicz L, et al. MABp1 as a novel antibody treatment for advanced colorectal cancer: a randomised, double-blind, placebo-controlled, phase 3 study. Lancet Oncol 2017; 18: 192-201.

40. Hong DS, Hui D, Bruera E, et al. MABp1, a first-in-class true human antibody targeting interleukin-1alpha in refractory cancers: an open-label, phase 1 dose-escalation and expansion study. Lancet Oncol 2014; 15: 656-66.

41. Hong DS, Janku F, Naing A, et al. Xilonix, a novel true human antibody targeting the inflammatory cytokine interleukin-1 alpha, in non-small cell lung cancer. Invest New Drugs 2015; 33: 621-31.

Shi-Jie Yao, Hong-Shun Ma, Guang-Ming Liu, Yue Gao, Wei Wang

Prognostic role of CD11b+ myeloid-derived suppressor cells in oral squamous cell carcinoma

Yue Jiang1, Chenxing Wang1, Yanling Wang1,2, Wei Zhang3, Laikui Liu3, Jie Cheng1,2

1Jiangsu Key Laboratory of Oral Disease, Nanjing Medical University, Jiangsu, China

2Department of Oral and Maxillofacial Surgery, Affiliated Stomatological Hospital, Nanjing Medical University, Nanjing, China

3Department of Oral Pathology, Affiliated Stomatological Hospital, Nanjing Medical University, Nanjing, China

Submitted: 2 August 2019; Accepted: 19 January 2020

Online publication: 25 March 2021

Arch Med Sci 2023; 19 (1): 171–179

DOI: https://doi.org/10.5114/aoms/116683

Copyright © 2021 Termedia & Banach

Abstract

Introduction: Myeloid-derived suppressor cells (MDSCs) are critically involved in cancer immune suppression and MDSC density has been recognized as a robust prognostic biomarker. Here, we sought to characterize the densities and locations of CD11b + MDSCs in primary oral squamous cell carcinoma (OSCC) and determine their prognostic significance.

Material and methods: A total of 144 eligible OSCC samples from a tertiary referral oral cancer center were retrospectively collected. Intensities of CD11b + MDSCs at the tumor center (CT) and invasive margin (IM) in OSCC samples were detected by immunohistochemistry and automatically quantified using Image J software. The optimal cutoff values for CD11b CT and CD11b IM were determined by X-tile based on overall survival. The associations between CD11b + MDSCs and clinicopathological parameters were assessed by the c 2 test. The prognostic value of CD11b + MDSCs was evaluated by Kaplan-Meier plots, Cox regression analyses and receiver operating characteristics curves.

Results: High density of CD11b + MDSCs at CT or IM was significantly associated with inferior overall and disease-free survival (Kaplan-Meir, p < 0.05, log-rank test). CD11b CT and CD11b IM were identified as independent prognostic predictors for patient survival. The prediction accuracy and specificity of CD11b CT and CD11b IM were superior to other prognostic parameters.

Conclusions: Our data indicated that increased densities of CD11b + MDSCs in CT and IM regions were significantly associated with poor prognoses, which might be novel prognostic factors for OSCC.

Key words: oral squamous cell carcinoma, myeloid derived suppressor cells, CD11b, prognostic biomarker.

Introduction

The 5-year survival for patients with primary oral squamous cell carcinoma (OSCC) remains at approximately 60%, which has not been markedly improved in the past decades [1]. Such a dismal prognosis is in part due to the high proportion of patients who present with advanced disease at the initial diagnosis. Insufficient and inaccurate evaluation of this malignancy hampers effective treatment planning and proper prognostic prediction. Nowadays, patients with OSCC are commonly staged according to the TNM staging system based on the tumor dimension,

Corresponding author: Jie Cheng DDS, PhD, Assoc. Prof. Department of Oral and Maxillofacial Surgery

Affiliated Stomatological Hospital

Nanjing Medical University 136 Hanzhong Road

Nanjing, Jiangsu Province, China

Phone: +86-25-85031880

E-mail: jie_cheng_njnu@163. com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

lymph node and metastasis [2]. However, owing to the heterogeneity of OSCC, patients with the same TNM stage usually present a significant variety of clinical outcomes [3]. Thus, identification of novel prognostic factors is urgently needed to better estimate survival and guide treatment planning.

The tumor microenvironment of solid cancer including OSCC is usually characterized by significant infiltration of both innate and adaptive immune cells including but not restricted to T cells, B cells and macrophages [4]. Mounting evidence has demonstrated that various types of tumor-infiltrating immune cells promote cancer initiation, overgrowth and metastatic dissemination [5]. Moreover, quantifications of these cancer-associated immune cells have robust prognostic significance in a broad spectrum of human cancer [6]. In particular, myeloid-derived suppressor cells (MDSCs), one of the major components of the tumor microenvironment, have emerged as a key regulatory cell population that critically participates in tumorigenesis [7]. Intensive studies have indicated MDSCs as a negative predictor of clinical outcomes in various cancers and a potential predictive biomarker in malignancies including melanoma, gastrointestinal and bladder cancer [8–10]. Currently, human MDSCs are usually labelled as CD11b+CD33+HLA–DR–Lin– and consist of two groups of cells termed polymorphonuclear (PMNMDSCs, CD11b+CD33+CD14–CD15+HLA–DR–Lin–) and monocytic (M-MDSCs, CD11b+CD33+CD14+CD15–HLA–DR–Lin–) [11]. Several previous studies have used the CD11b to label tumor-infiltrating MDSCs by immunohistochemistry in various cancer contexts. Evaluation of CD11b+ MDSCs in the tumor center and microenvironment has been utilized to predict patients’ clinical outcome [11, 12]. For example, high densities of CD11b+ MDSCs were significantly associated with unfavorable survival of patients diagnosed with hepatocellular carcinoma [13]. However, to the best of our knowledge, the prognostic value of CD11b+ MDSCs infiltration in OSCC remains largely unknown.

The present study was designed to evaluate the densities of CD11b+ MDSCs in both center of tumor (CT) and invasive margin (IM) regions by immunohistochemistry and assess their prognostic significance in a retrospective cohort of OSCC from a tertiary referral oral cancer center.

Material and methods

Patients and specimens

This study was in accordance with the Declaration of Helsinki and approved by the Research Ethic Committees of Affiliated Stomatological Hospital, Nanjing Medical University. Informed

consent was obtained from each patient or their guardians. Records of patients with primary OSCC who underwent ablative surgery at the Affiliated Stomatological Hospital of Nanjing Medical University between April 2011 and December 2013 were reviewed. Patients enrolled here suffered from primary OSCC and were treatment-naive. Formalin-fixed paraffin-embedded (FFPE) specimens from ablative resection of OSCC and detailed clinical, pathological as well as follow-up data were available for all eligible patients. Histopathological grading and clinical staging of each case were evaluated according to the WHO classification and American Joint Committee on Cancer Staging System 7th edition, respectively [14].

Immunohistochemical staining of CD11b in OSCC

The FFPE specimens of all patients enrolled were collected for slide preparation. Immunohistochemical staining of CD11b was performed on 4-μm thickness sections as described previously [15]. Briefly, FFPE specimens were consecutively sliced into sections followed by deparaffinization in xylene and standard gradient ethanol. Subsequently, the slides were immersed in Tris-EDTA buffer (pH 8.0) for 15 min for antigen retrieval and incubated in 3% H2O2 for the blockage of endogenous peroxidase activity. The sections were further incubated with primary antibody (anti-CD11b, 1 : 200 dilution, CST, 49420) at 4°C overnight followed by phosphate-buffered saline washing and biotinylated secondary antibody incubation (Maxim, China). Finally, the antigen detection was conducted by a color reaction with 3.3-diaminobenzidinez (DAB) under microscopic monitoring and counterstained with hematoxylin. Negative controls without primary antibody incubation were included.

Evaluation of immunohistochemical staining

Images of selected areas were acquired using an upright microscope (Leica DM4000B, Germany), and the immunohistochemical staining results of CD11b+ MDSCs in OSCC samples were independently assessed by two senior oral pathologists without knowledge of patients’ clinicopathological data. When an agreement was difficult to reach, the final judgment was made by reevaluating the slides. For each tumor specimen, slides containing invasive margin (IM) and tumor center (CT) regions were selected. Five representative fields per slide including both of the regions were selected at 200×magnification after initial screening under a low power field (100×). As illustrated in Figure 1, similar to previous reports, the invasive margin (IM) was defined as a region of

Yue Jiang, Chenxing Wang, Yanling Wang, Wei Zhang, Laikui Liu, Jie Cheng

500 μm width on each side of the border between malignant cells and tumor stroma, while the tumor center (CT) was defined as a region in the center of the tumor which was full of malignant cells and excluded the first 250 μm adjacent to the tumor border [16, 17]. The density of CD11b+ MDSCs in OSCC specimens was recorded independently at the CT and IM and presented as the mean number of positively stained cells per mm2, similar to our previous report [18–20]. As shown in Figure 2, cell counts of CD11b+ MDSCs were automatically quantified using ImageJ (version 2.0). The optimal cut-off values for the densities of CD11b+ MDSCs at the CT and IM were determined after analyzing the association between cell amount and overall survival (OS) by X-tile software with a minimum p-value approach (version 3.6.1, https://medicine.yale.edu/lab/rimm/research/software/). The X-tile program is a commonly used statistical tool for the assessment of biological relationships between a biomarker and outcome and identification of the optimal cut-point based on marker expression [21].

Statistical analysis

The X-tile program was applied to determine the optimal cut-off value of the CD11b+ MDSC density with the minimum p-value. Analysis of the association between classified densities of CD11b+ MDSCs at CT or IM and multiple clinicopathological parameters was conducted using the c2 test or Fisher’s exact test. Overall survival (OS) and disease-free survival (DFS) were calculated with the Kaplan-Meier method and comparison

B E

Figure 1. Representative IHC image of CD11b+ MDSCs in OSCC. The dotted red line marks the border between the tumor and the surrounding stroma. Two red lines mark a region (IM) 500 μm wide (dotted red line with arrow) on each slide of the border between malignant cells and the surrounding nontumor stroma. CT comprised the tumor section excluding the first 250 μm adjacent to the tumor border

between groups was performed with the log-rank test. Univariate and multivariate Cox proportional hazards regression models were used to determine the hazard ratio of different prognostic factors and the association between these factors with OS and DFS for OSCC. Receiver operating characteristics (ROC) curves of indicated prognostic factors were plotted and the area under the curve (AUC) was calculated to identify the predictive performance of each individual marker. All tests were two-sided, and p-values less than 0.05 were considered statistically significant. All statis-

C F

Figure 2. Immunohistochemical staining of CD11b+ MDSCs in OSCC. A – Representative staining of CD11b+ MDSCs in the tumor center (CT) of OSCC. Scale bar: 100 μm. B, C – The number of CD11b+ MDSCs in tumor CT is semi-automatically quantified by ImageJ software. Scale bar: 50 μm. D – Representative staining of CD11b+ MDSCs in invasive margins (IM) of OSCC. Scale bar: 100 μm. E, F – The number of CD11b+ MDSCs in tumor IM is semi-automatically quantified by ImageJ software. Scale bar: 50 μm

Prognostic role of CD11b+ myeloid-derived suppressor cells in oral squamous cell carcinoma

tical analysis was performed with GraphPad Prism 8.0, IBM SPSS 22.0 software and R 3.5.3.

Results

Epidemiological and clinicopathological characteristics of patients

One hundred and forty-four patients (76 males and 68 females) who were diagnosed with primary OSCC and underwent ablative surgery were included. They were aged from 30 to 82 years. The median follow-up duration was 45 months (ranging from 6 to 138 month). Sixty-nine patients died during the follow-up and 8 patients with local recurrence or cervical node metastasis remained alive until the last follow-up. Detailed epidemiological and clinicopathological characteristics of these patients enrolled are summarized in Table I.

Associations between infiltrating CD11b+ MDSCs and clinicopathological features

Here, we employed immunochemical staining of CD11b, a common marker to label MDSCs in cancer, to characterize and quantify MDSCs in primary OSCC [7, 11, 12]. As shown in Figure 2, CD11b positive staining MDSCs was readily detected in CT and IM regions in OSCC samples. Following image capture and automatic cell counting by ImageJ, the densities of CD11b+ MDSCs in each tumor region (CT, IM) was calculated and recorded

(Figure 2). Our results revealed that the densities of infiltrating MDSCs varied in CT (130.9 ±5.84 per mm2) and IM (466.2 ±15.28 per mm2), thus suggesting the significant enrichment of MDSCs in IM compartments. Additionally, no significant association between intensities of CD11b+ MDSCs in CT and IM was identified (data not shown). Then, to achieve outcome-based cut-off optimization, the “minimum p-value” approach was employed using X-tile software [21]. The optimal cutoff value for CD11b+ MDSC at the IM was 389.0 per mm2 (p = 0.0012) and 143.0 per mm2 at the CT (p = 0.00189) (Figure 3). Consequently, patients were classified into low or high CD11b+ MDSC subgroups. As summarized in Table I, we analyzed the associations between CD11b+ MDSC densities and several clinicopathological parameters, but failed to identify any significant associations.

Association between infiltrating CD11b+ MDSCs and survival in OSCC patients

To identify the possible associations between CD11b+ MDSCs and patient survival, we performed Kaplan-Meier analyses and found that increased densities of CD11b+ MDSCs in both CT and IM regions were significantly associated with shorter OS and DFS (Figures 4 A–D). Furthermore, we verified the prognostic values of these immunological features for OSCC by Cox regression analysis. As shown in Table II, the univariate anal-

Table I. Associations between density of CD11b+ MDSCs and clinicopathological parameters in OSCC Variable CD11b CT CD11b IM ≥ 143.0 < 143.0 P -value * ≥ 389.0 < 389.0 P -value *

No. of patients 54 90 89 55 Age [years] ≤ 60 18 29 0.8905 24 23 0.0648 > 60 36 61 65 32

Gender Male 31 45 0.3887 49 27 0.4860 Female 23 45 40 28

Smoking No 39 73 0.2142 69 42 0.8717 Yes 15 17 20 13

Alcohol use No 45 77 0.7197 76 46 0.7759 Yes 9 13 13 9

Tumor size T1-T2 42 75 0.4083 73 44 0.7626 T3-T4 12 15 16 11

Pathological grade I 46 84 0.1101 78 52 0.2493 II–III 8 6 11 3

Cervical node metastasis N0 38 63 0.4741 60 41 0.3637 N+ 16 27 29 14

Clinical stage I–II 28 56 0.2217 50 34 0.5049 III–IV 26 34 39 21 *All p-values in Table I were obtained using c2 test or Fisher’s exact test. MDSCs – myeloid derived suppressor cells, OSCC – oral squamous cell carcinoma, CT – tumor center, IM – invasive margin.

Yue Jiang, Chenxing Wang, Yanling Wang, Wei Zhang, Laikui Liu, Jie Cheng

A C

Overall survival (%) Disease-free survival (%)

100 75 50 25 0 100 75 50 25 0

0 24 48 72 96 120 144

Time [months]

Log-rank test, p = 0.0007 CD11b CT-Low CD11b CT-High 0 24 48 72 96 120 144

Time [months]

Log-rank test, p = 0.0006 CD11b CT-Low CD11b CT-High

B D

Overall survival (%) Disease-free survival (%)

100 75 50 25 0 100 75 50 25 0

0 24 48 72 96 120 144

Time [months] Log-rank test, p < 0.0001 CD11b IM-Low CD11b IM-High 0 24 48 72 96 120 144

Time [months] Log-rank test, p < 0.0001 CD11b IM-Low CD11b IM-High

Figure 4. Prognostic significance of CD11b CT and CD11b IM in patients with OSCC. Kaplan-Meier analysis of overall survival (OS) and disease-free survival (DFS) in patients stratified by CD11b CT (A, C) and CD11b IM (B, D). P-values were calculated with the log-rank test

Table II. Univariate and multivariate survival analyses of prognostic factors associated with OS and DFS for OSCC

Variables OS DFS

Univariate survival analyses: Age (> 60, ≤ 60)

HR 95% CI P -value HR 95% CI P -value

0.893 0.546–1.461 0.653 1.028 0.639–1.654 0.909

Gender (male, female) 0.812 0.505–1.306 0.391 0.816 0.520–1.280 0.376

Smoking (yes, no) 0.749 0.402–1.397 0.363 0.807 0.451–1.442 0.469

Alcohol use (yes, no) 1.163 0.610–2.217 0.647 1.280 0.704–2.328 0.419

Tumor size (T3-T4, T1-T2) 1.264 0.712–2.243 0.424 1.329 0.773–2.286 0.303

Pathological grade (II–III, I) 1.942 0.958–3.938 0.066 2.496 1.338–4.658 0.004

Cervical node metastasis (N+, N0) 0.993 0.583–1.692 0.981 1.086 0.658–1.793 0.746

Clinical stage (III–IV, I–II) 1.217 0.749–1.978 0.427 1.395 0.879–2.215 0.158 CD11b CT (high, low) 2.283 1.390–3.750 0.001 2.235 1.388–3.597 0.001 CD11b IM (high, low) 3.285 1.850–5.835 < 0.001 2.868 1.693–4.857 <0.001

Multivariate survival analyses:

Pathological grade (II–III, I) 1.643 0.774–3.487 0.196 2.171 (1.105–4.265) 0.024 Cervical node metastasis (N+, N0) 0.599 0.269–1.332 0.209 0.536 (0.255–1.128) 0.101

Clinical stage (III–IV, I–II) 1.542 0.760–3.130 0.230 1.836 (0.949–3.552) 0.071

CD11b CT (high, low) 2.012 1.213–3.337 0.007 1.919 (1.181–3.119) 0.009 CD11b IM (high, low) 3.183 1.780–5.689 < 0.001 2.762 (1.618–4.715) < 0.001

ysis indicated that elevated densities of CD11b+ MDSCs at either the IM or CT were significantly associated with reduced OS (p = 0.001 and < 0.001, respectively) and DFS (p = 0.001 and < 0.001, respectively). Moreover, the multivariate Cox proportional regression analyses revealed that, besides pathological grade, densities of CD11b+ MDSCs

in the IM or CT were independent prognostic factors for OS (HR = 3.183, 95% CI: 1.780–5.689, p < 0.001 at IM; HR = 2.012, 95% CI: 1.213–3.337, p = 0.007 at CT). Similar results were found in the DFS analysis, where estimated HR for CD11b+MDSCs in the IM was 2.762 (95% CI: 1.618–4.715) and at the CT was 1.919 (95% CI: 1.181–3.119).

A B

Sensitivity

0 0.2 0.4 0.6 0.8 1.0

1 – Specificity

AUC at 1 year: 0.72 AUC at 3 years: 0.68 AUC at 5 year: 0.75

Sensitivity

Numbers in bold indicate statistical significance with p-values less than 0.05. HR – hazard ratio, CI – confidence interval, OS – overall survival, DFS – disease-free survival, OSCC – oral squamous cell carcinoma, CT – tumor center, IM – invasive margin. 1.0 0.8 0.6 0.4 0.2 0

1.0 0.8 0.6 0.4 0.2 0

0 0.2 0.4 0.6 0.8 1.0

1 – Specificity

AUC at 1 year: 0.69 AUC at 3 years: 0.58 AUC at 5 year: 0.78

Figure 5. Predictive ability of CD11b CT and CD11b IM for the prognosis of patients with OSCC. ROC curves and AUC at 1 year, 3 years and 5 years were used to estimate the sensitivity and specificity of CD11b CT (A) and CD11b IM (B) in the prognostic prediction of overall survival (OS)

Yue Jiang, Chenxing Wang, Yanling Wang, Wei Zhang, Laikui Liu, Jie Cheng

Predictive performance of CD11b+ MDSCs for OSCC prognosis

Next, we proceeded to determine the predictive performance of CD11b+ MDSCs for patients with OSCC by time-dependent ROC curve analysis. Tumor size, cervical nodal metastasis, pathological grade and clinical stage, widely adopted as prognostic factors for OSCC, were included for assessing the predictive value of CD11b+ MDSCs. With respect to the OS, the AUC values of CD11b IM at 1 year, 3 years and 5 years were 0.69, 0.58, 0.78 and the AUC values of CD11b CT were 0.72, 0.68, 0.75, respectively (Figurea 5 A, B). However, the AUC of the aforementioned four clinicopathological parameters was less than 0.54 (Figure 6).

Discussion

High mortality in OSCC necessitates development of effective biomarkers for treatment planning and prognostic prediction, ultimately improving patient management and long-term survival. The current commonly used TNM staging system fails to meet the clinical demand in accurate prognostic prediction [1]. Although various genetic or epigenetic biomarkers in OSCC have been proposed for prognostic assessment including microRNA, lncRNA and alternative mRNA splicing signature, they are still far from optimal [20, 22, 23]. In addition to these intrinsic features of cancer itself, tumor-infiltrating immunocytes have been established as key drivers underlying tumorigenesis as well as novel biomarkers with tremendous diagnostic and prognostic significance [4, 6]. Here, we determined the location and amount of MDSCs in OSCC and revealed that a high amount of CD11b+ MDSCs was associated with inferior survival and quantification of CD11b+ MDSCs might be a novel independent prognostic factor for OSCC.

Accumulating evidence has demonstrated that multiple types of immune cells infiltrate in the tumor itself or its microenvironment facilitate tumor overgrowth, invasion and metastasis [5]. In particular, MDSCs are a heterogeneous population of immature myeloid cells and utilize multiple mechanisms to establish a tumor-promoting environment [7, 11]. They can suppress T cells by depleting amino acids necessary for activation of T cells, inhibiting their migration and preventing their entry into lymph nodes or homing to tumor sites [24, 25]. Moreover, with respect to their indirect immunosuppressive mechanism, MDSCs altered the ability of antigen-presenting cells (APCs) to activate T cells and T regulatory cells (Tregs) [26]. Besides immune regulatory mechanisms, MDSCs also influenced tumor progression by modulating the tumor microenvironment and promoting angiogenesis via VEGF, bFGF and MMP9 [27, 28].

1.0 0.8 0.6 0.4 0.2 0

Sensitivity 0 0.2 0.4 0.6 0.8 1.0

1 – Specificity

Tumor size (0.529) Cervical node metastasis (0.478) Pathological grade (0.532) Clinical stage (0.503)

Reference line

Figure 6. Predictive ability of tumor size, cervical node metastasis, pathological grade and clinical stage for the prognosis of patients with OSCC. The sensitivity and specificity of four clinicopathological parameters in the prognostic prediction of overall survival (OS) were estimated by ROC curves

Consistent with these previous findings, our data revealed that MDSCs were highly enriched in invasive tumor margins, thus suggesting that their tumor-promoting roles occurred primarily in the tumor microenvironment. However, much work is needed to accurately dissect the roles of MDSCs and relevant mechanisms of action during OSCC tumorigenesis.

Until now, the prognostic impacts of several subsets of tumor-infiltrating immune cells in a broad spectrum of human cancers including OSCC have been documented, such as CD3+ TIL, CD8+ TIL, CD45RO+ TIL and CD11b+ MDSCs [12, 18, 19, 29]. For example, we reported that high densities of CD3+/CD8+ TIL and CD68+ macrophage were significantly associated with increased overall and disease-specific survival in OSCC [19, 30]. In the present study, we assessed the prognostic value of the density of CD11b+ MDSCs in either CT or IM regions. Our results revealed that high densities of CD11b+ MDSCs were significantly associated with reduced patient survival. In addition, multivariate Cox regression assay also identified CD11b+ MDSCs as a novel independent prognostic factor affecting patient survival. These findings are in line with previous reports wherein MDSC accumulation correlated with poor outcome in melanoma, gastrointestinal cancers and bladder cancer [8–10, 31]. Moreover, MDSCs in non-small lung and cervical cancer patients were associated with advanced tumor stage and unfavorable prognosis and served as an independent prognostic factor

Prognostic role of CD11b+ myeloid-derived suppressor cells in oral squamous cell carcinoma

predicting patients’ outcome [32, 33]. Here, we investigated the prognostic value of CD11b+ MDSCs in distinct locations (CT or IM) in OSCC with a relatively long-term follow-up. Our findings revealed that high densities of CD11b+ MDSCs in either the IM or CT compartment were significantly associated with unfavorable prognosis in OSCC and also served as independent prognostic factors in predicting patients’ survival. Previous studies mainly focused on MDSCs in whole tumor sections without discriminating different locations of infiltrating immunosuppressive cells in the tumor sample, which may partially explain the inconsistent results among various studies [10, 31–33]. Indeed, spatial distribution of immunoregulatory cells in different compartments such as the CT and IM might have diverse biological functions and their predictive value for clinical outcome may be region-specific [34]. Thus, we believe that our immunological evaluation of CD11b+ MDSCs by taking their distribution into account might be more accurate and powerful. In support of this, our time-dependent ROC curve analysis also revealed that the predictive performance of CD11b+ MDSCs in the IM or CT was superior to such prognostic factors as tumor size, cervical nodal metastasis and pathological grade.

Although our data revealed the prognostic values of CD11b+ MDSCs in IM or CT for OSCC patients, there are some limitations. Firstly, potential bias may remain due to the retrospective nature and limited sample size. Our findings need to be confirmed in a prospective study including a large, multicenter patient population. A single marker for MDSC labeling might not be adequate to evaluate their diverse subtypes as well as functional status. Combinations of two or more markers might be better and more accurate to dissect the clinical and biological significance of MDSCs during OSCC initiation and progression. In addition, some pathological factors such as depth of invasion, extracapsular extension or perineural invasion were not included in the prognostic analyses. Furthermore, whether CD11b+ MDSCs in IM or CT can be predictive for the response to various treatments as well as adverse events of adjuvant therapies in OSCC remains unknown.

In conclusion, our data indicated that high densities of CD11b+ MDSCs in the tumor center or invasive margins significantly correlated with unfavorable survival in patients with primary OSCC. Our findings also suggest that this infiltrating immune subset has pro-tumorigenic effects in OSCC which might be exploited for therapeutic intervention.

Acknowledgments

This work is financially supported, in whole or in part, by the National Natural Science Foundation of China (81572669, 81602386, 81602378);

Natural Science Foundation of Jiangsu Province (BK20161564, BK20161024); A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (2018-87); Project from Nanjing Municipal Committee of Science and Technology (201803044).

Yue Jiang and Chenxing Wang contributed equally to this work.

Conflict of interest

The authors declare no conflict of interest.

References

1. Chi AC, Day TA, Neville BW. Oral cavity and oropharyngeal squamous cell carcinoma: an update. CA Cancer J Clin 2015; 65: 401-21.

2. O’sullivan B, Brierley J, Byrd D, et al. The TNM classification of malignant tumours – towards common understanding and reasonable expectations. Lancet Oncol 2017; 18: 849-51.

3. Okuyemi OT, Piccirillo JF, Spitznagel E. TNM staging compared with a new clinicopathological model in predicting oral tongue squamous cell carcinoma survival. Head Neck 2014; 36: 1481-9.

4. Gentles AJ, Newman AM, Liu CL, et al. The prognostic landscape of genes and infiltrating immune cells across human cancers. Nat Med 2015; 21: 938-45.

5. Gonzalez H, Hagerling C, Werb Z. Roles of the immune system in cancer: from tumor initiation to metastatic progression. Genes Dev 2018; 32: 1267-84.

6. Fridman WH, Pages F, Sautes-Fridman C, Galon J. The immune contexture in human tumours: impact on clinical outcome. Nat Rev Cancer 2012; 12: 298-306.

7. Gabrilovich DI. Myeloid-derived suppressor cells. Cancer Immunol Res 2017; 5: 3-8.

8. Weide B, Martens A, Zelba H, et al. Myeloid-derived suppressor cells predict survival of patients with advanced melanoma: comparison with regulatory T cells and NYESO-1- or melan-A-specific T cells. Clin Cancer Res 2014; 20: 1601-9.

9. Wang L, Chang EW, Wong SC, Ong SM, Chong DQ, Ling KL. Increased myeloid-derived suppressor cells in gastric cancer correlate with cancer stage and plasma S100A8/A9 proinflammatory proteins. J Immunol 2013; 190: 794-804.

10. Yang G, Shen W, Zhang Y, et al. Accumulation of myeloid-derived suppressor cells (MDSCs) induced by low levels of IL-6 correlates with poor prognosis in bladder cancer. Oncotarget 2017; 8: 38378-88.

11. Parker KH, Beury DW, Ostrand-Rosenberg S. Myeloidderived suppressor cells: critical cells driving immune suppression in the tumor microenvironment. Adv Cancer Res 2015; 128: 95-139.

12. Ai L, Mu S, Wang Y, et al. Prognostic role of myeloid-derived suppressor cells in cancers: a systematic review and meta-analysis. BMC Cancer 2018; 18: 1220.

13. Deng Y, Cheng J, Fu B, et al. Hepatic carcinoma-associated fibroblasts enhance immune suppression by facilitating the generation of myeloid-derived suppressor cells. Oncogene 2017; 36: 1090-101.

14. Edge SB, Byrd DR, Compton CC, Fritz AG, Greene FL, Trotti A. AJCC Cancer Staging Manual (7th ed.). Springer, New York 2009.

Yue Jiang, Chenxing Wang, Yanling Wang, Wei Zhang, Laikui Liu, Jie Cheng

Prognostic role of CD11b+ myeloid-derived suppressor cells in oral squamous cell carcinoma

15. Li Z, Wang Y, Zhu Y, et al. The Hippo transducer TAZ promotes epithelial to mesenchymal transition and cancer stem cell maintenance in oral cancer. Mol Oncol 2015; 9: 1091-105.

16. Halama N, Michel S, Kloor M, et al. Localization and density of immune cells in the invasive margin of human colorectal cancer liver metastases are prognostic for response to chemotherapy. Cancer Res 2011; 71: 5670-7.

17. Galon J, Pages F, Marincola FM, et al. Cancer classification using the Immunoscore: a worldwide task force. J Transl Med 2012; 10: 205.

18. Zhou C, Li J, Wu Y, Diao P, Yang J, Cheng J. High density of intratumor CD45RO(+) memory tumor-infiltrating lymphocytes predicts favorable prognosis in patients with oral squamous cell carcinoma. J Oral Maxillofac Surg 2019; 77: 536-45.

19. Zhou C, Wu Y, Jiang L, et al. Density and location of CD3(+) and CD8(+) tumor-infiltrating lymphocytes correlate with prognosis of oral squamous cell carcinoma. J Oral Pathol Med 2018; 47: 359-67.

20. Zhou C, Diao P, Wu Y, et al. Development and validation of a seven-immune-feature-based prognostic score for oral squamous cell carcinoma after curative resection. Int J Cancer 2020; 146: 1152-63.

21. Camp RL, Dolled-Filhart M, Rimm DL. X-tile: a new bio-informatics tool for biomarker assessment and outcome-based cut-point optimization. Clin Cancer Res 2004; 10: 7252-9.

22. Han X, Xu Z, Tian G, et al. Suppression of the long non-coding RNA MALAT-1 impairs the growth and migration of human tongue squamous cell carcinoma SCC4 cells. Arch Med Sci 2019; 15: 992-1000.

23. Zhang ST, Wu X, Diao PF, et al. Identification of a prognostic alternative splicing signature in oral squamous cell carcinoma. J Cell Physiol 2020; 235: 4804-13.

24. Fletcher M, Ramirez ME, Sierra RA, et al. l-Arginine depletion blunts antitumor T-cell responses by inducing myeloid-derived suppressor cells. Cancer Res 2015; 75: 275-83.

25. Hanson EM, Clements VK, Sinha P, Ilkovitch D, Ostrand-Rosenberg S. Myeloid-derived suppressor cells down-regulate L-selectin expression on CD4+ and CD8+ T cells. J Immunol 2009; 183: 937-44.

26. Serafini P, Mgebroff S, Noonan K, Borrello I. Myeloid-derived suppressor cells promote cross-tolerance in B-cell lymphoma by expanding regulatory T cells. Cancer Res 2008; 68: 5439-49.

27. Tartour E, Pere H, Maillere B, et al. Angiogenesis and immunity: a bidirectional link potentially relevant for the monitoring of antiangiogenic therapy and the development of novel therapeutic combination with immunotherapy. Cancer Metastasis Rev 2011; 30: 83-95.

28. Shojaei F, Wu X, Qu X, et al. G-CSF-initiated myeloid cell mobilization and angiogenesis mediate tumor refractoriness to anti-VEGF therapy in mouse models. Proc Natl Acad Sci USA 2009; 106: 6742-7.

29. Wolf GT, Chepeha DB, Bellile E, Nguyen A, Thomas D, Mchugh J. Tumor infiltrating lymphocytes (TIL) and prognosis in oral cavity squamous carcinoma: a preliminary study. Oral Oncology 2015; 51: 90-5.

30. Hu Y, He MY, Zhu LF, et al. Tumor-associated macrophages correlate with the clinicopathological features and poor outcomes via inducing epithelial to mesenchymal transition in oral squamous cell carcinoma. J Exp Clin Cancer Res 2016; 35: 12.

31. Singh MM, Johnson B, Venkatarayan A, et al. Preclinical activity of combined HDAC and KDM1A inhibition in glioblastoma. Neuro Oncol 2015; 17: 1463-73.

32. Vetsika EK, Koinis F, Gioulbasani M, et al. A circulating subpopulation of monocytic myeloid-derived suppressor cells as an independent prognostic/predictive factor in untreated non-small lung cancer patients. J Immunol Res 2014; 2014: 659294.

33. Wu L, Liu H, Guo H, et al. Circulating and tumor-infiltrating myeloid-derived suppressor cells in cervical carcinoma patients. Oncol Lett 2018; 15: 9507-15.

34. Pages F, Kirilovsky A, Mlecnik B, et al. In situ cytotoxic and memory T cells predict outcome in patients with early-stage colorectal cancer. J Clin Oncol 2009; 27: 5944-51.

Long non-coding RNA SENCR alleviates endothelial-to-mesenchymal transition via targeting miR-126a

Chuang Lou, Tao Li

Department

Submitted: 18 March 2019; Accepted: 21 July 2019

Online publication: 16 November 2020

Arch Med Sci 2023; 19 (1): 180–188

DOI: https://doi.org/10.5114/aoms.2020.97991

Copyright © 2020 Termedia & Banach

Abstract

Introduction: Long non-coding RNAs (lncRNAs) constitute a growing class of non-coding genes with diverse cellular function. Recent studies have reported that lncRNA smooth muscle and endothelial cell-enriched (SENCR) was associated with the phenotype switch of vascular smooth muscle cells and participated in vascular homeostasis. However, the potential role of SENCR in endothelial-to-mesenchymal transition (EndMT) and the underlying mechanism remain unknown.

Material and methods: Human carotid plaque samples and human coronary endothelial cells (HACECs) were collected to examine the expression of SENCR. Quantitative PCR and immunoblots were performed to evaluate the expression of SENCR and miR-126a in HACECs in response to TGF- β 1 and transfected with small interfering RNA.

Results: We found that SENCR was significantly decreased in carotid plaques as compared to normal carotids. Knockdown of SENCR in HACECs aggravated the expression of smooth muscle markers a -SMA and calponin induced by TGF- β 1 but repressed the expression of endothelial markers platelet/endothelial cell adhesion molecule 1 (PECAM1) and VE-cadherin down-regulated by TGF- β 1. Through bioinformatic analysis and Luciferase assay, miR-126a was identified as the direct target of SENCR. Further mechanistic experiments revealed that overexpression of miR-126a bound to the 3 ′ UTR region of SMURF2 and inhibited the expression of SMURF2, which was considered as the negative regulator of TGF- β /Smad signaling. Finally, overexpression of miR-126a did not restore the decreased expression of the smooth muscle markers a -SMA and calponin under the condition of SMURF2 depletion, suggesting that the effect of miR-126a on EndMT progression is SMURF2 dependent.

Conclusions: SENCR alleviates TGF- β -induced EndMT and sponges miR-126a expression via direct inhibition of the negative regulator of TGF- β /Smad signaling SMURF2.

Key words: lncRNA SENCR, endothelial-to-mesenchymal transition, miR126a, TGF- β /Smad signaling, atherosclerosis.

Introduction

Endothelial cells (ECs) are reported to be capable of switching to a fibroproliferative mesenchymal phenotype through endothelial-to-mesenchymal transition (EndMT) [1]. This transition process could be characterized by loss of cell-to-cell adhesion and changes in cell polarity, which in turn

Corresponding author: Tao Li

Department of Cardiology Ankang Hospital of Traditional Chinese Medicine 47th BashanEast Road 725000, Ankang City Shaanxi Province, China E-mail: 18609151353@163.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

of Cardiology, AnKang Hospital of Traditional Chinese Medicine, Ankang, China

aggravate cell proliferation, migration and secretion of extracellular matrix proteins [2]. The expression of EC markers, such as cadherin 5 (VE-cadherin) and platelet/endothelial cell adhesion molecule 1 (PECAM1), is decreased, while the expression of mesenchymal cell markers, such as a-smooth muscle actin (a-SMA), myosin heavy chain 11 (Myh11) and calponin, is elevated [2, 3]. Shear stress and TGF-β have been regarded as the pivotal stimuli in driving EndMT progression [4, 5]. Functionally, EndMT progression is initially observed to occur during embryogenesis, where it plays an important role in cardiac valve formation [6]. Recent studies also conclude that EndMT is involved in a number of pathological conditions such as myocardial infarction, neointimal formation, pulmonary hypertension and atherosclerosis [2, 5, 7–10], whereas the exact underlying mechanism of EndMT during the pathogenesis remains poorly defined.

MicroRNAs (miRNAs) has been defined as one of the well-characterized non-coding RNAs ranging in size from 19 to 25 nucleotides. Over the past decades, a number of studies have demonstrated the important roles of miRNAs in endothelial dysfunction and EndMT progression [7]. On the other hand, long non-coding RNAs (lncRNAs) have been referred to as the transcripts longer than 200 nucleotides but without protein-coding potential. Accumulating evidence has indicated that lncRNAs are involved in a variety of biological functions such as epigenetic and post-transcriptional regulation in cellular homeostasis, cell proliferation and differentiation [11, 12]. Furthermore, lncRNAs exert sponge-like effects on numerous miRNAs, eventually regulating miRNA expression and their downstream mRNA functions. Likewise, miRNAs and lncRNAs have recently been recognized as candidate biomarkers for diagnosis, prognosis and therapeutics in cancer and cardiovascular diseases [11]. Collectively, the research relevant to lncRNA-miRNA-mRNA axes in the pathogenesis of cardiovascular diseases has been constantly reported and gradually evolving [13].

Current epidemiologic studies have consistently revealed that smooth muscle and endothelial cell-enriched migration/differentiation-associated lncRNA (SENCR) is particularly abundant in vascular smooth muscle cells (VSMCs) and ECs [14]. Despite the lack of data supporting the association between genetic polymorphisms within SENCR and the incidence of coronary artery disease (CAD), further research suggested that SENCR was involved in the regulation of VSMC proliferation and migration through controlling contractile gene myocardin and a-SMA expression, ensuing contributing to the pathogenesis of CAD [15, 16]. In the present study, we sought to investigate whether lncRNA SENCR contributes to EndMT progression and to decipher the underlying mechanism.

Materials and methods

Human samples

Carotid plaques were obtained from 5 patients undergoing endarterectomy. Healthy carotids were obtained from 3 patients undergoing trauma surgery without carotid plaques. All samples were immediately stored in liquid nitrogen after surgical removal.

Bioinformatics

The nucleotide sequence of miR-126a was obtained from the miRBase database (http://www. mirbase.org/). The candidate miR-126a binding sites within the 3′UTR was predicted by TargetScan (http://www.targetscan.org).

Cell culture

Human coronary endothelial cells (HACECs) were purchased from Lonza Walkersville (Cat# CC02585, USA) and regularly cultured in EBM-2 medium (Clonetics, Lonza, Switzerland) supplemented with human recombinant epidermal growth factor (hEGF, 3 ng/ml, 0.1% in EBM-2), hydrocortisone, human recombinant fibroblast growth factor-beta (hFGF-b, 1 ng/ml, 0.1% in EBM-2), vascular endothelial growth factor (VEGF, 0.1% in EBM-2), insulin-like growth factor-1 (IGF-1, 0.1% in EBM-2), ascorbic acid, 5% fetal bovine serum (FBS), 1% penicillin and streptomycin and 5% CO2 at 37°C. The cells were tested positively for CD31, vWF and acetylated low-density lipoprotein uptake according to the manufacturer’s instructions (Clonetics, Lonza, Switzerland). To validate the repeatability and reliability, we purchased and applied two batches of HACECs in the following experiments. EndMT was initiated by maintaining HACECs in complete EBM-2 medium, followed by addition of 5 ng/ml TGF-β1 (Peprotech, USA).

RNA interfering and miRNA mimics transfection

HACECs were plated in six-well plates and maintained overnight. HACECs were transfected with control siRNA or SENCR siRNA and miR-126a mimics (Genepharma, Shanghai, China) at a final concentration of 50 nM using Lipofectamine 2000 (Invitrogen, USA) for 48 h. The following experiments were conducted after 48-hour transfection.

Quantitative RT-PCR

Quantitative real-time reverse transcription (RT-PCR) was applied to determine the RNA expression levels of SENCR, miR-126a, VE-cadherin, PECAM1, a-SMA, calponin, Smad ubiquitin regulatory factor 2 (SMURF2) and GAPDH. The primers

Long non-coding RNA SENCR alleviates endothelial-to-mesenchymal transition via targeting miR-126a

Table I. Summary of primer sequences used for RT-PCR

Gene Sequence

SENCR

Forward: 5’ CAG CCA GAA AGG ACT CCA ACT CC 3’

Reverse: 5’ GGA GGC AGC TGG TGC TGA AAG 3’

fluorescence-labeled antibodies. Bands were visualized using the Odyssey Infrared Imaging System (LI-COR Biotechnology).

Dual luciferase assay

MiR-126a

Forward: 5’ GCC AGT CAG ATG TGG ATG AA 3’ Reverse: 5’ CCC AAC ACT GGC ACC AGT AA 3’ a -SMA Forward: 5’ GCG TGG CTA TTC CTT CGT TA 3’

Reverse:

5’ TGA TGC TGT TGT AGG TGG TTT C 3’

Forward: 5’ CTG TCA GCC GAG GTT AAG AAC 3’ Reverse: 5’ GAG GCC GTC CAT GAA GTT GTT 3’ PECAM1 Forward: 5’ CCT GCG GTA TTC AAA GAC AA 3’ Reverse: 5’ TGG GAC CAG ATC CTT CAT TCA C 3’

Calponin

VE-cadherin

Forward: 5’ TCG GTT GTT CAA TGC G 3’ Reverse: 5’ AGC GTC CTG GTA GTC G 3’ SMURF2

Forward:

5’ GGC AAT GCC ATT CTA CAG ATA CT 3’ Reverse: 5’ CAA CCG AGA AAT CCA GCA CCT 3’

GAPDH Forward: 5’ GGA GCG AGA TCC CTC CAA AAT 3’ Reverse: 5’ GGC TGT TGT CAT ACT TCT CAT GG 3’

predesigned for RT-PCR are listed in Table I. The amplification and detection of specific products were performed in triplicate using the SYBR Premix Ex Taq assay (Takara, Japan), and the relative expression levels between groups were calculated using the following equation: relative gene expression = 2-(∆Ctsample – ∆Ctcontrol) .

Western blot analysis

HACECs were re-suspended in lysis buffer and 2 mg/ml protease inhibitor cocktail (Roche Diagnostics Corp). Protein concentrations were determined using the Bradford Protein assay kit (Beyotime Biotechnology, China). An equal amount of protein was analyzed by SDS-PAGE and immunoblotting. Primary antibodies used included the following: a-SMA (ab5694, abcam, USA), calponin (ab46794, abcam, USA), VE-cadherin (Cat. 2500, Cell Signaling Technology, USA), PECAM1 (sc-71872, Santa Cruz, USA), SMURF2 (GTX31571, GeneTex, USA) and GAPDH (ab8245, abcam, USA). Secondary antibodies were

HEK293T cells were maintained in DMEM supplemented with 10% FBS and 1% penicillin and streptomycin. The oligonucleotide fragments of lncRNA SENCR that contained the putative miR-126a binding sites were amplified and inserted into the Dual-Luciferase Reporter plasmid psiCHECK-2 (Promega, USA). For the luciferase assay, HEK293T cells were transfected at 80% confluency in 24well dishes with psiCHECK-SENCR and miR-126a mimics using Lipofectamine 2000 (Invitrogen, USA) for 24 h. Likewise, SMURF2 3′UTR was cloned into the dual-luciferase reporter plasmid psiCHECK-2. Constructs carrying the mutated fragment of the SMURF2 3′UTR without the putative miR-126a binding sequence served as the mutated control. HEK293T cells were co-transfected with psiCHECK-SMURF2-3′UTR (Luci-SMURF2-WT) or with psiCHECK-SMURF2-3′UTR mutant (Luci-SMURF2Mut), and miR-126a mimics using Lipofectamine 2000 for 24 h. Based on the Dual-Luciferase Reporter Assay System (Promega, USA), the relative luciferase expression normalized to Renilla activity was measured using an automatic microplate reader.

Statistical analysis

Statistical analysis was performed using IBM SPSS software (Version 14.0, USA). Data were presented as mean ± standard deviation (SD). The analysis of raw data was performed using Student’s t test for two groups. One-way analysis of variance (ANOVA) was used to compare multiple groups, if appropriate, with Bonferroni correction for the post-hoc analysis. Differences were regarded as statistically significance for p < 0.05.

Results

SENCR was decreased in carotid plaques and in response to TGF-β1 stimulation

To determine the potential role of SENCR in atherosclerosis, quantitative RT-PCR was first performed to compare the expression levels of SENCR in normal carotid artery and carotid plaques. As illustrated in Figure 1, SENCR was significantly down-regulated in carotid plaques as compared to normal carotids.

Knockdown of SENCR enhanced EndMT progression of ECs

Indeed, it is widely accepted that researchers applied HACECs in vitro to validate the observations in coronary and carotid arteries, especially

plaques and aneurysm. Consistent with the observation in carotid samples, SENCR expression was significantly reduced in HACECs after the stimulation of TGF-β1, which is considered as a potent atherogenic stimulus (Figure 2 A). After induction of HACECs with TGF-β1, HACECs displayed remarkably decreased mRNA and protein levels of the endothelial markers PECAM1 and VE-cadherin, accompanied by significantly increased levels of smooth muscle markers a-SMA and calponin, confirming that HACECs underwent EndMT (Figures 2 B, C). Based on the in vitro EndMT model, we then examined the effect of SENCR silencing on EndMT progression. The results showed that depletion of SENCR markedly aggravated the expression of smooth muscle markers a-SMA and calponin induced by TGF-β1 but repressed the expression of endothelial markers PECAM1 and VE-cadherin down-regulated by TGF-β1, suggesting that knockdown of SENCR aggravated EndMT progression (Figures 2 D, E).

SENCR inhibited and bound to miR-126a

To find out the mechanism underlying the regulation of SENCR on EndMT and investigate the interplay between SENCR and miRNAs, we transfected HACECs with SENCR siRNA (siSENCR) and determined the miRNA targets based on previous reports. Among the candidate miRNAs, miR-126a emerged as a particularly interesting candidate that was decreased by 63.7% in HACECs transfected with siSENCR as compared to the control group (Figure 3 A). Likewise, the expression of miR-126a was markedly upregulated in carotid plaques compared with normal carotid artery (Figure 3 B). In vitro experiments in HACECs pretreated with TGF-β1 (5 ng/ml) for 7 days demonstrated a significant increase in miR-126a expression in a time-dependent manner (Figure 3 C). We then performed an in silico search within the sequence of miR-126a for the putative binding site of SENCR, finding a predicted binding motif in miR-126a for SENCR. Subsequent luciferase reporter experiments were applied to confirm the predicted binding site. As shown in Figure 3 D, co-transfection of SENCR luciferase vectors with miR-126a mimics in HACECs for 24 h led to substantially decreased SENCR luciferase activity, while there was no significant change of SENCR luciferase activity with scramble mimics transfection. Altogether, these data suggested that SENCR functioned through direct targeting of miR-126a.

MiR-126 inhibited SMURF2 via directly targeting its 3′UTR

The online in silico miRNA target identification tool TargetScan identified SMURF2 as a potential

Relative expression

8 6 4 2 0

*P < 0.05.

Normal carotid Carotid plaques

Figure 1. SENCR is down-regulated in carotid plaques. Quantitative RT-PCR showed that the expression of SENCR is lower in carotid plaques (n = 5) as compared to normal carotid arteries (n = 3). Bars indicate mean ± SD

target of miR-126a. Using quantitative RT-PCR, we found that the mRNA expression levels of SMURF2 were significantly repressed after respective transfection with siSENCR or miR-126a mimics as compared to the control group (Figures 4 A, B). Furthermore, western blots exhibited remarkable inhibition in SMURF2 expression after siSENCR or miR-126a mimics transfection in HACECs as well (Figure 4 C). To confirm the regulatory interaction, the effect of miR-126a on SMURF2 reporter genes was evaluated. Dual-Luciferase Reporter assays elucidated that overexpression of miR-126a significantly suppressed the luciferase activity of SMURF2 3′ UTR (Figure 4 D). These results imply that miR-126a directly binds to SMURF2 3′ UTR and negatively regulates its expression.

SENCR-miR126a exerted an inhibitory effect on EndMT via targeting SMURF2

It is known that activation of SMURF2 contributes to the inhibition of TGF-β/Smad signaling. We then examined the effect of miR-126a on smooth muscle markers and endothelial markers in the absence of SMURF2 in HACECs. Consistent with previous reports, knockdown of SMURF2 reduced PECAM1 and VE-cadherin expression and drove a-SMA and calponin expression in HACECs. As shown in Figure 5A and 5B, overexpression of miR126a moderately restored the elevated expression of the smooth muscle markers a-SMA and calponin under the condition of SMURF2 depletion. Similarly, transfection with miR-126a led to excessive expression of the endothelial markers PECAM1 and VE-cadherin induced by knockdown of SMURF2 in HACECs (Figures 5 A, B). These results suggest that the effect of miR-126a on EndMT progression, at least in part, relies on the inhibitory manner of SMURF2 in HACECs (Figure 5 C).

Long non-coding RNA SENCR alleviates endothelial-to-mesenchymal transition via targeting miR-126a

SENCR

Relative expression 8 6 4 2 0

HACECs 0 1 4 7 TGF-β1 (5 ng/ml) Time [days]

C

β1

ng/ml)

Relative mRNA levels TGF-β1 (5 ng/ml)

Relative mRNA levels

1.5 1.0 0.5 0

PECAM1

B 0 7 Time [days] a-SMA

Relative mRNA levels 10 8 6 4 2 0

β1 (5 ng/ml)

8 6 4 2 0

β1 (5 ng/ml)

Calponin

Figure 2. Knockdown of SENCR enhances EndMT progression and inhibits tube formation in ECs. A – Quantitative RT-PCR showed that the expression of SENCR is decreased after TGF-β1 stimulation (5 ng/ml). B – mRNA expression levels of PECAM1, VE-cadherin, a-SMA and calponin in HACECs in response to TGF-β1 (5 ng/ml) for 7 days are determined by quantitative RT-PCR. C – Western blotting of PECAM1, VE-cadherin, a-SMA, calponin and a-tubulin in HACECs with TGF-β1 (5 ng/ml) stimulation for 7 days. D – Expression levels of SENCR in HACECs transfected with control siRNA (siCon) or SENCR siRNA (siSENCR) in the presence of TGF-β1 (5 ng/ml) for 4 days. E – mRNA expression levels of PECAM1, VE-cadherin, a-SMA and calponin in HACECs transfected with control siCon or siSENCR in the presence of TGF-β1 (5 ng/ml) for 4 days. Experiments were performed three times. Bars indicate mean ± SD

Discussion

In the present study, we observed that lncRNA SENCR is decreased in human carotid plaques and depletion of SENCR contributes to the EndMT process in ECs. We provide a mechanistic model demonstrating that SENCR could directly bind to miR-126a and in turn suppress miR-126a expression. Next, miR-126a directly binds to the 3′UTR of SMURF2 and inhibits its expression. Considering the negative role of SMURF2 in TGF-β/Smad

signaling, the observation that SENCR-miR-126a mitigates the acquisition of a mesenchymal phenotype of ECs could be explained by the interaction of miR-126a with downstream protein SENCR and the effect of inhibition of SMURF2 on TGF-β/ Smad signaling.

Accumulating studies have shown that lncRNA and miRNA expression is frequently tissue- and/ or cell-specific with functional specificity in different tissues and cell types as well. LncRNA SENCR

Figure 3. Inhibitory effect of SENCR on miR-126a in ECs. A – Quantitative RT-PCR analysis of eight candidate miRNAs in SENCR siRNA (siSENCR) groups normalized to HACECs transfected with control siRNA (siCon).

B – Quantitative RT-PCR analysis of expression of miR-126a in carotid plaques (n = 5) and normal carotid arteries (n = 3). C – Quantitative RT-PCR analysis of expression of miR-126a in response to TGF-β1 stimulation (5 ng/ml).

D – Alignment of predicted miR-126a binding sties in the fragment of lncRNA SENCR in Homo sapiens (upper lane).

Luciferase activity of HEK293T cells transfected with psi-CHECK2-SENCR luciferase vectors plus miR-126a mimics or scramble mimics was normalized to Renilla activity (lower lane). Experiments were performed three times. Bars indicate mean ± SD

is predominantly located in VSMCs and ECs [14]. As a vascular-enriched lncRNA, SENCR overlaps Friend Leukemia Integration virus 1 (FLI1), which is referred to as an early regulator of hemato-endothelial development and a principle regulator of vascular hemostasis [17]. Using high-throughput RNA sequencing to access the changes in the transcriptome of VSMCs, Bell et al. [14] found that knockdown of SENCR altered VSMC phenotype presented as reduction in several VSMC contractile genes’ expression and accompanied by elevation of pro-migratory gene expression. Although SENCR did not control the endothelial differentiation from pluripotent cells, overexpression of SENCR induced the proliferation and angiogenesis of human umbilical endothelial cells [18]. Similar to these results, our data imply that lncRNA SENCR is significantly decreased in carotid plaque compared with normal carotids. Consistent with the observation in carotid samples, SENCR expres-

sion was significantly reduced in HACECs after the stimulation of TGF-β, which is considered as a potent atherogenic stimulus.

Our research also shows that loss of SENCR prominently boosts EndMT progression. EndMT is an important process in pulmonary artery remodeling, neointimal formation, atherosclerosis and cardiac hypertrophy [19, 20]. The biological process is complex and is regulated by a complex orchestration of signal pathways [6]. A growing body of evidence has shown that EndMT is primarily governed by common pathways including TGF-β signaling, Notch signaling and Wnt signaling [21, 22]. Consistent with our in vitro observations, two research groups found that TGF-β/Smad signaling promoted Snail-mediated EndMT via Smad-independent signaling and Smad2/3-Slug signaling [8, 23]. In vivo studies using experimental murine models confirmed that TGF-β/Smad-mediated EndMT participated in cardiac fibrosis, atheroscle-

Relative mRNA expression

4 3 2 1 0 A B

4 3 2 1 0

SMURF2 SMURF2 2.5 2.0 1.5 1.0 0.5 0 6 5 4 3 2 1 0 D Relative expression Relative Luci activity Scramble miR-126a SMURF2

Relative mRNA expression Luci-SMURF2-Mut Luci-SMURF2-WT

Scramble mimics miR-126a mimics SMURF2 a-tubulin

rosis and vein graft remodeling. Conversely, therapeutic strategies with TGF-β neutralizing antibody or some small-molecule inhibitors have been proven to retard the EndMT process and prevent vascular remodeling [8].

Apart from aforementioned traditional pathways, based on miRNA target-prediction bioinformatic analysis, a growing number of miRNAs have been recognized and the target downstream elements were concentrated in the TGF-β/Smad signaling and contribute to the EndMT process [7, 24]. To our best knowledge, one of the first indications of the engagement of miRNAs in EndMT came from Ghosh et al. [25], who observed the differential expression of a specific set of miRNAs during transition of mouse cardiac ECs to a mesenchymal phenotype. Since the EndMT process is

crucial for the regulation of skin wound healing, Miscianinov et al. [26] demonstrated that miR148b accelerated angiogenesis in a mouse model of wound healing and eventually exacerbated skin wound healing in vivo. In vitro mechanistic experiments revealed that overexpression of miR148b targeted TGFB2 and Smad2, proceeding with recovery of TNF-a/IL-1β-mediated EndMT. Our study identified miR-126a as a direct target of SENCR and promoter of TGF-β-induced EndMT progression. In this regard, Xu et al. [27] found that miR-126a was upregulated by hypoxia during pulmonary hypertension and contributed to EndMT through the p85-β/p-AKT pathway.

Figure 5. Effect of miR-126a on EndMT progression is SMURF2 dependent. A, B – Western blotting and quantitative analysis of a-SMA, calponin, PECAM1, VE-cadherin and a-tubulin in HACECs co-transfected with miR-126a mimics and SMURF2 siRNA in the presence of TGF-β1 (5 ng/ml). Experiments were performed three times. Bars indicate mean ± SD. *P < 0.05. C – Schematic diagram of SENCRmiR-126-SMURF2 axis in EndMT progression

SMURF2 is an E3 ubiquitin ligase that functions as an inhibitor of TGF-β/Smad signaling and is involved in a wide variety of cellular responses. E3 ubiquitin ligases play a central role in ubiquitination through catalyzation of the attachment of ubiquitin moieties to target proteins and accelerate the process of protein degradation. It is reported that SMURF2 interplays with TGF-β-responsive phosphorylated Smads and triggers their rapid ubiquitination and degradation in a timely manner [28]. On account of these molecular mechanisms, SMURF2 has been implicated in diverse cellular behavior, including cell polarity, cell invasion and cell migration [29, 30]. However, the exact function of SMURF2 in TGF-β-induced EndMT in

HACECs remained poorly understood. On the other hand, scientists focusing on the upstream mechanisms of SMURF2 found that microRNAs regulated SMURF2 and TGF-β/Smad signaling via an epigenetic pattern. For example, both miR-322 and miR503 bound to the 3′UTR fragments of SMURF2 mRNA and abrogated SMURF2 translation but did not affect total SMURF2 mRNA expression [31]. It is therefore accepted that the SENCR-miR-126a complex is capable of involvement in TGF-β/Smad signaling via interaction with the negative regulator SMURF2. Our present study provides additional evidence that SENCR-miR-126a-mediated SMURF2 activation increases the susceptibility of EndMT under exposure to TGF-β1.

In conclusion, we report for the first time that lncRNA SENCR reduces TGF-β-induced EndMT and sponges miR-126a expression via direct inhibition of the negative regulator of TGF-β/Smad signaling SMURF2.

Conflict of interest

The authors declare no conflict of interest.

References

1. Zeisberg EM, Tarnavski O, Zeisberg M, et al. Endothelial-to-mesenchymal transition contributes to cardiac fibrosis. Nat Med 2007; 13: 952-61.

2. Piera-Velazquez S, Li Z, Jimenez SA. Role of endothelial-mesenchymal transition (EndoMT) in the pathogenesis of fibrotic disorders. Am J Pathol 2011; 179: 1074-80.

3. Krenning G, Moonen JR, van Luyn MJ, Harmsen MC. Vascular smooth muscle cells for use in vascular tissue engineering obtained by endothelial-to-mesenchymal transdifferentiation (EnMT) on collagen matrices. Biomaterials 2008; 29: 3703-11.

4. Maleszewska M, Moonen JR, Huijkman N, van de Sluis B, Krenning G, Harmsen MC. IL-1β and TGFβ2 synergistically induce endothelial to mesenchymal transition in an NFκB-dependent anner. Immunobiology 2013; 218: 443-54.

5. Chen PY, Qin L, Baeyens N, et al. Endothelial-to-mesenchymal transition drives atherosclerosis progression. J Clin Invest 2015; 125: 4514-28.

6. Kovacic JC, Mercader N, Torres M, Boehm M, Fuster V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation 2012; 125: 1795-808.

7. Kim J. MicroRNAs as critical regulators of the endothelial to mesenchymal transition in vascular biology. BMB Rep 2018; 51: 65-72.

8. Cooley BC, Nevado J, Mellad J, et al. TGF-b signaling mediates endothelial-to-mesenchymal transition (EndMT) during vein graft remodeling. Sci Transl Med 2014; 6: 227-34.

9. Zhang H, Hui H, Li Z, et al. Pigment epithelium-derived factor attenuates myocardial fibrosis via inhibiting endothelial-to-mesenchymal transition in rats with acute myocardial infarction. Sci Rep 2017; 7: 41932.

10. Zhu X, Zhao P, Lu Y, et al. Potential injurious effects of the fine particulate PM2.5 on the progression of atherosclerosis in apoE-deficient mice by activating platelets and leukocytes. Arch Med Sci 2019; 15: 250-61.

11. Simion V, Haemmig S, Feinberg MW. LncRNAs in vascular biology and disease. Vascul Pharmacol 2019; 114: 145-56.

12. Lorenzen JM, Thum T. Long noncoding RNAs in kidney and cardiovascular diseases. Nat Rev Nephrol 2016; 12: 360-73.

13. He L, Chen Y, Hao S, Qian J. Uncovering novel landscape of cardiovascular diseases and therapeutic targets for cardioprotection via long noncoding RNA-miRNA-mRNA axes. Epigenomics 2018; 10: 661-71.

14. Bell RD, Long X, Lin M, et al. Identification and initial functional characterization of a human vascular cell-enriched long noncoding RNA. Arterioscler Thromb Vasc Biol 2014; 34: 1249-59.

15. Shahmoradi N, Nasiri M, Kamfiroozi H, Kheiry MA. Association of the rs555172 polymorphism in SENCR long

non-coding RNA and atherosclerotic coronary artery disease. J Cardiovasc Thorac Res 2017; 9: 170-4.

16. Zou ZQ, Xu J, Li L, Han YS. Down-regulation of SENCR promotes smooth muscle cells proliferation and migration in db/db mice through up-regulation of FoxO1 and TRPC6. Biomed Pharmacother 2015; 74: 35-41.

17. Abedin MJ, Nguyen A, Jiang N, et al. Fli1 acts downstream of Etv2 to govern cell survival and vascular homeostasis via positive autoregulation. Circ Res 2014; 114: 1690-9.

18. Boulberdaa M, Scott E, Ballantyne M, et al. A role for the long noncoding RNA SENCR in commitment and function of endothelial cells. Mol Ther 2016; 24: 978-90.

19. Atwa H, Gad K, Hagrasy H, et al. Is subclinical atherosclerosis associated with visceral fat and fatty liver in adolescents with type 1 diabetes? Arch Med Sci 2018; 14: 1355-60.

20. Sordyl J, Kopyta I, Sarecka-Hujar B, Francuz T, Matusik P, Malecka-Tendera E. Lipid levels and selected biomarkers of vascular changes in children with idiopathic headaches – a preliminary report. Arch Med Sci 2019; 15: 120-5.

21. Noseda M, McLean G, Niessen K, et al. Notch activation results in phenotypic and functional changes consistent with endothelial-to-mesenchymal transformation. Circ Res 2004; 94: 910-7.

22. Nauseef JT, Henry MD. Epithelial-to-mesenchymal transition in prostate cancer: paradigm or puzzle? Nat Rev Urol 2011; 8: 428-39.

23. Medici D, Potenta S, Kalluri R. Transforming growth factor-b2 promotes Snail-mediated endothelial-mesenchymal transition through convergence of Smad-dependent and Smad-independent signalling. Biochem J 2011; 437: 515-20.

24. Romero-Cordoba SL, Salido-Guadarrama I, Rodriguez-Dorantes M, Hidalgo-Miranda A. miRNA biogenesis: biological impact in the development of cancer. Cancer Biol Ther 2014; 15: 1444-55.

25. Ghosh AK, Nagpal V, Covington JW, Michaels MA, Vaughan DE. Molecular basis of cardiac endothelial-to-mesenchymal transition (EndMT): differential expression of microRNAs during EndMT. Cell Signal 2012; 24: 1031-6.

26. Miscianinov V, Martello A, Rose L, et al. MicroRNA-148b targets the TGF-b pathway to regulate angiogenesis and endothelial-to-mesenchymal transition during skin wound healing. Mol Ther 2018; 26: 1996-2007.

27. Xu YP, He Q, Shen Z, et al. MiR-126a-5p is involved in the hypoxia-induced endothelial-to-mesenchymal transition of neonatal pulmonary hypertension. Hypertens Res 2017; 40: 552-61.

28. David D, Nair SA, Pillai MR. Smurf E3 ubiquitin ligases at the cross roads of oncogenesis and tumor suppression. Biochim Biophys Acta 2013; 1835: 119-28.

29. Jin C, Yang YA, Anver MR, Morris N, Wang X, Zhang YE. Smad ubiquitination regulatory factor 2 promotes metastasis of breast cancer cells by enhancing migration and invasiveness. Cancer Res 2009; 69: 735-40.

30. Narimatsu M, Bose R, Pye M, et al. Regulation of planar cell polarity by Smurf ubiquitin ligases. Cell 2009; 137: 295-307.

31. Cao S, Xiao L, Rao JN, et al. Inhibition of Smurf2 translation by miR-322/503 modulates TGF-b/Smad2 signaling and intestinal epithelial homeostasis. Mol Biol Cell 2014; 25: 1234-43.

Activity of vancomycin combined with linezolid against clinical vancomycin-resistant Enterococcus strains

Gulseren Aktas

Department of Medical Microbiology, Faculty of Medicine, Istanbul University, Istanbul, Turkey

Submitted: 16 April 2019; Accepted: 12 July 2019

Online publication: 3 July 2020

Arch Med Sci 2023; 19 (1): 189–193

DOI: https://doi.org/10.5114/aoms.2020.96400

Copyright © 2020 Termedia & Banach

Abstract

Introduction: Because multi-drug-resistant Gram-positive bacteria have been isolated frequently worldwide and are difficult to treat, alternative treatment choices are required. Combination antibiotherapies have a distinct advantage over monotherapies in terms of their broad spectrum and synergistic effect. In the present study, it was aimed to investigate the  in vitro activity of vancomycin combined with linezolid against clinical vancomycin-resistant enterococci (VRE) strains with high-level aminoglycoside resistance.

Material and methods: A total of 30 randomly selected clinical VRE strains were studied. Susceptibility to agents tested was investigated using broth microdilution assay. The inoculum of strain was adjusted to approximately 5 × 10 5 CFU/ml in the wells. The results were interpreted in accordance with Clinical and Laboratory Standards Institute guidelines. In vitro activities of anti biotics in combination were assessed using the broth microcheckerboard technique. The fractional inhibitory concentration indexes (FICIs) were interpreted as follows: synergism, FICI ≤ 0.5; additive/indifference, FICI ≤ 0.5 – ≤ 4; antagonism, FICI > 4.

Results: All strains were resistant to vancomycin and susceptible to linezolid. The MIC50,90 and MIC range values of antimicrobials were 512, 512, and 512–1024 μg/ ml for vancomycin; 2, 2, and 2–4 μg/ml for linezolid. The rate of synergy was found to be 46.6% (14/30) for linezolid combined with vancomycin. No antagonism was observed.

Conclusions: The results of the study suggest that this combination may contribute to the treatment of VRE infections for their synergistic effect and because no antagonism was observed.

Key words: vancomycin, linezolid, combination, vancomycin-resistant enterococci, high-level aminoglycoside resistance.

Introduction

Enterococcus faecalis and E. faecium can cause community-acquired and nosocomial infections. In recent decades, an increase in the occurrence of vancomycin-resistant enterococci (VRE) has been observed in Europe, with E. faecium being the most dominant species [1–3]. They have been isolated frequently worldwide and are difficult to treat [4–7].

Because enterococci have intrinsic resistance to some classes of commonly used antibiotics and the ability to acquire resistance to most of the current available antibiotics, either by mutation or by receipt of foreign genetic material, infections caused with multidrug-resistant enterococci are particularly difficult to treat [5, 8].

Corresponding author: Gulseren Aktas Department of Medical Microbiology Faculty of Medicine Istanbul University Istanbul, Turkey Phone: 090 212 4142000/32417 Fax: 090 212 4142037 E-mail: gulserena2001@yahoo.co.uk

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Although new antimicrobial agents designed to treat infections caused by multidrug-resistant pathogens have been introduced in the past few years, there has been a worldwide increase in the incidence of infections caused by VRE [4, 6, 7, 9]. Other choices for overcoming drug resistance include synergistic combinations of antimicrobials. Combination antibiotherapies have a distinct advantage over monotherapies in terms of their broad spectrum and synergistic effect at lower doses. They are sometimes used in an attempt to prevent or delay the  in vivo emergence of drug-resistant subpopulations of pathogenic organisms [10, 11]. Linezolid is the first member of the structurally novel and totally synthetic antibiotic group named oxazolidinones, which acts by blocking protein synthesis at the ribosome. It was approved by the U.S. Food and Drug Administration in 2000. However, with the excessive use of linezolid during clinical trials and therapy, development of resistant isolates of  Enterococcus spp. occurred [12–14].

Serious infections associated with enterococci are usually treated with a combination of penicillin/ampicillin with an aminoglycoside. The emergence of high-level resistance to aminoglycoside in enterococci, especially E. faecium and E. faecalis, seriously affected the therapeutic approach. Vancomycin is an agent acting on the cell wall. Because of the lack of reliable synergistic interaction between a cell wall active antibiotic and an aminoglycoside against high-level aminoglycoside-resistant (HLAR) Enterococcus strains, vancomycin became a first-line drug effective against these strains [15]. The options of therapy of infections caused by Enterococcus spp., which have resistance both to aminoglycosides and vancomycin, have been limited.

In the present study we aimed to investigate the  in vitro activity of vancomycin combined with linezolid against VRE strains with high-level aminoglycoside resistance.

Material and methods

A total of 30 randomly selected clinical VRE strains were studied. Fourteen out of 30 strains were isolated from blood, and 16 from urine from different patients who were admitted to different clinics of the university’s hospital.

Bacterial identifications of the strains were undertaken using conventional methods. They were identified as the genus Enterococcus if they had the following properties: Gram-positive; catalase negative; ability to grow in 6.5% sodium chloride and 40% bile; hydrolysed esculin; and positive results in pyrrolidonyl arylamidase tests (PYR; BD; USA). The  Enterococcus species were identified using biochemical and physiological

tests such as arginine dihydrolase, hippurate hydrolysis, growth in pyruvate, pigment production, motility, arabinose, and lactose utilisation, and other carbohydrate utilisation tests by using both a commercial identification system for enterococci (Microgen Strep ID, Microgen Bioproducts Ltd, UK) and inhouse products [15]. All strains were also tested for susceptibilities to ampicillin (10 μg: Oxoid, UK), imipenem (10 μg: BBLTM, USA), and Quinupristin/Dalfopristin (Q/D) (15 μg: Oxoid, UK) using a disk diffusion test. E. faecium strains were resistant to ampicillin and imipenem and susceptible to Q/D, and E. faecalis strains had opposite results [4, 7, 16, 17]. Beta-lactamase enzyme production was also investigated by nitrocefin discs (BD BBLTM, Cefinase, USA). The high-level resistance of aminoglycoside among VRE strains was investigated using 120 μg gentamicin and 300 μg streptomycin (BD BBLTM BENEX Ltd., Ireland) disks [18].

The antibiotics tested in the study were vancomycin (Multicell, USA) and Linezolid (Pfizer Inc., Groton, CT, USA). Teicoplanin (Glentham Life Sciences Ltd., UK) was also studied for phenotyping of the VRE strains. Susceptibility to agents against the strains tested was investigated using broth microdilution assay as described by the Clinical and Laboratory Standards Institute (CLSI) [18, 19]. They were prepared in accordance with the proposals of CLSI and the manufacturers. In all tests, cation-adjusted Mueller-Hinton II Broth (CAMHB) (BBLTM, Becton, Dickinson and Company, France) were used for all experiments. The inoculum of each strain was adjusted to achieve a final inoculum of 105–106 CFU/ml in the wells of the plate. The minimum inhibitory concentration (MIC) was defined as the lowest concentration of antibiotic giving complete inhibition of visible growth, and was interpreted in accordance with the guidelines of the standards for antimicrobial susceptibility testing. Quality-control testing procedures were performed by also testing Staphylococcus aureus ATCC 29213 and Enterococcus faecalis ATCC 29212 as reference strains in each run [18–20].

In vitro activities of antibiotics in combination were assessed using a broth microcheckerboard [11]. The concentrations of antibiotics in combinations were based on two dilutions above and four dilutions below the MICs. The fractional inhibitory concentration (FIC) indexes (FICI) were calculated using the following formula: FICI = FICA + FICB. The FICI was interpreted as follows: synergism, FICI ≤ 0.5; additive/indifference, FICI ≤ 0.5 – ≤ 4; antagonism, FICI > 4 [21].

Results

Twenty-eight of 30 VRE strains were identified as E. faecium and two as E. faecalis, depend-

Table I. The minimum inhibitory concentration (MIC) values of antimicrobial agents and susceptibility rates

Agent MIC values [μg/ml]

Susceptibility, n (%) MIC50 MIC90 MIC range

LNZ 2 2 2–4 30 (100)

VAN 512 512 512–1024 0

TEC 64 128 16–128 0

LNZ – linezolid, VAN – vancomycin, TEC – teicoplanin. Susceptibility breakpoints: Lnz ≤ 4, Van ≤ 4, Teic ≤ 2 μg/ml [20].

Table II. The distribution of fractional inhibitory concentration indexes (FICI) values and interpreted FICI results of the combination against 30 VRE strains

Combination Distribution of FICI values ( n  = 30) Interpreted FICI results, n (%)

0.2 0.3 0.4 > 0.5 0.6 0.7 2 Syn Add/Ind Ant

VAN + LNZ 3 11 – 9 5 1 1 14 (46.6) 16 (53.4) 0

Syn – synergism, Add/Ind – additive/indifference, Ant – antagonism.

Table III. Distribution of aminoglycoside resistances and combination interactions by species in 30 VRE strains

VRE ( n  = 30) HLAR Non-HLAR HLSR Syn Add/Int Ant

Enterococcus faecium ( n  = 28) 24 0 4 14 14 0

Enterococcus faecalis ( n  = 2) 0 1 1 0 2 0

HLAR – high-level aminoglycoside resistant, HLSR – high-level streptomycin resistant, Syn – synergism, Add/Ind – additive/indifference, Ant – antagonism.

ing on conventional methods and antimicrobial results. All strains were found to be resistant to vancomycin and teicoplanin, and susceptible to linezolid by broth microdilution method. None of the strains detected beta-lactamase enzyme. The MIC values of antimicrobial agents and susceptibility rates are shown in Table I. The MIC50,90 and MIC range values were found as 2, 2, and 2–4 for linezolid, 512, 512, and 512–1024 for vancomycin, and 64, 128, and 16–128 μg/ml for teicoplanin. All strains had the VanA phenotype of glycopeptide resistance [15].

In this study, 24 (80%) of 30 VRE strains were identified as HLAR, five as high-level streptomycin resistant (HLSR), and one strain as non-HLAR. The rate of synergistic effect (FICI: ≤ 0.5) of vancomycin combined with linezolid against 30 VRE strains was found to be 46.6% (14/30) (Table II). One out of the 14 synergistic reactions belonged to the HLSR VRE strain, which was isolated from urine, and 13 to the HLAR VRE strains, which were isolated from both blood and urine samples. All synergistic reactions occurred against E. faecium strains. The rate of the additive/indifference effect (FICI: > 0.5–4) was found to be 53.4% (16/30). Two of them were E. faecalis that were isolated from urine samples. No antagonism was observed (Table III).

The MIC value distributions of each antimicrobial alone and in combination against 14 synergis-

Table IV. Comparative minimum inhibitory concentration (MIC) results of each antibiotic in both dilution and checkerboard tests against 14 synergistic VRE strains

MIC results [μg/ml] Microdilution Checkerboard MICVAN MICLNZ MICVAN/LNZ 13 512 2 32/0.5 1 512 4 32 /1

VRE strains ( n  = 14)

tic VRE strains are shown in Table IV. The MIC values of each antimicrobial alone against 14 strains given synergistic result were found as 512 μg/ml for vancomycin and 2, and 4 μg/ml for linezolid in microdilution method. However, in a combination of these antibiotics, the MIC concentration of each antibiotic was found as 32 μg/ml for vancomycin and 0.5 μg/ml for linezolid in 13 strains (32/0.5), and 32 μg/ml and 1 μg/ml in one strain (32/1) in the checkerboard method, respectively. The one strain had the HLAR.

Discussion

Linezolid is one of the last-resort antibiotics for the treatment of infections with VRE [17]. However, the increasing prevalence of linezolid resistance among clinical enterococ strains has been reported, especially during treatment of infections

Activity of vancomycin combined with linezolid against clinical vancomycin-resistant Enterococcus strains

[4, 22, 23]. Additionally, resistance to antibiotics that have been used to treat infections caused by VRE, such as tigecycline and daptomycin, has already been reported [4, 6].

Vancomycin is a bactericidal antimicrobial agent that is mainly active against Gram-positive cocci. Although vancomycin has been successfully used in therapy of Gram-positive bacterial infections for years, resistance has been increasing in recent years [4]. Because of the lack of reliable penicillin-aminoglycoside synergism among high-level aminoglycoside-resistant enterococci, vancomycin became a first-line drug effective against enterococci until the time when Enterococcus species–resistant to vancomycin were reported with increasing frequency [7, 15]. The synergistic effect of aminoglycosides and glycopeptide or beta-lactam antimicrobials is lost if there is high-level resistance to aminoglycosides [24]. Infections caused by Enterococcus spp. that have resistance both aminoglycosides and vancomycin have limited therapy options. Hence, it is important to introduce a new alternative method of treatment.

A high rate of resistance to antimicrobials in Enterococcus strains is obviously problematic, and a novel policy is needed to challenge the resistance in these microorganisms [25]. Additionally, the VRE strains with HLAR or HLSR that have aminoglycoside resistance have decreased the combination therapy alternatives to treat the infections caused.

In this study, 24 out of 30 VRE strains were found to have high-level aminoglycoside resistance (24/30). All these strains were E. faecium, which has high rate of resistance to antimicrobials [25]. The vancomycin concentrations alone in combination were found to be 32 mg/l in checkerboard test results (Table III). This concentration is reachable for vancomycin in human serum because it is inform that serum peak levels are reach to 30–40 mg/l in the administration of it at the treatment doses [13].

In conclusion, because of the synergistic results and lack of antagonism, the combination of vancomycin with linezolid can make an important contribution to the treatment of infections caused by VRE strains, especially VR–E. faecium with HLAR, which have limited numbers of alternative treatment choices if more in vitro experiments and in vivo applications on this combination are proven. Additionally, antibiotic combinations that have synergistic interaction have been used to treat infections in an attempt to prevent or delay resistant bacteria from arising.

Acknowledgments

The author gratefully acknowledges the head of the Department of Infectious Diseases and Clinical

Microbiology of the same university and Zeynep Memis for providing VRE strains that were isolated during routine work.

Conflict of interest

The author declares no conflict of interest.

References

1. Faron ML, Ledeboer NA, Buchan BW. Resistance mechanisms, epidemiology, and approaches to screening for vancomycin-resistant Enterococcus in the health care setting. J Clin Microbiol 2016; 54: 2436-47.

2. Hammerum AM, Baig S, Kamel Y, et al. Emergence of vanA Enterococcus faecium in Denmark, 2005-15. J Antimicrob Chemother 2017; 72: 2184-90.

3. ECDC. Summary of the Latest Data on Antibiotic Resistance in the European Union. Availabe at: http://ecdc. europa.eu/en/eaad/Documents/antibiotics-EARS-Netsummary-2016.pdf

4. Nellore A, Huprikar S; AST ID Community of Practice. Vancomycin-resistant Enterococcus in solid organ trantplant recipients: Guidelines from the American Society of Transplantation Infectious Diseases Community of Practice. Clin Transplant 2019. doi: 10.1111/ctr.13549.

5. Murray PR, Rosenthal KS, Pfaller MA. Medical Microbiology. 8th ed. Philadelphia (PA): Elsevier Inc.; 2016. p. 183-201.

6. O’Driscoll T, Crank CW. Vancomycin-resistant enterococcal infections: epidemiology, clinical manifestations, and optimal management. Infect Drug Resist 2015; 8: 217-30.

7. Guzman Prieto AM, van Schaik W, Rogers MR, et al. Global emergence and dissemination of enterococci as nosocomial pathogens: attack of the clones? Front Microbiol 2016; 7: 788.

8. Clewell DB. Movable genetic elements and antibiotic resistance in enterococci. Eur J Clin Microbiol Infect Dis 1990; 9: 90-102.

9. Reyes K, Bardossy AC, Zervos M. Vancomycin-resistant enterococci: epidemiology, infection prevention, and control. Infect Dis Clin North Am 2016; 30: 953-65.

10. Strelkauskas A, Strelkauskas J, Moszyk-Strelkauskas D. Microbiology, a clinical approach. USA: Garland Science, Taylor and Francis Group 2010; 435-77.

11. Pillai SK, Moellering RC Jr, Eliopoulos GM. Antimicrobial combinations. In: Lorian V, editor. Antibiotics in Laboratory Medicine. 5th ed. Philadelphia: Lippincott Williams and Wilkins 2005; 365-440.

12. Walsh C. Antibiotics: Actions, Origins, Resistance. Washington, DC: ASM Press 2003; 51-70.

13. Bryskier A, Veyssier P. Glycopeptides and lipoglycopeptides. In: Bryskier A, editor. Antimicrobial Agents. Washington DC: ASM Press 2005; 880-905.

14. Gonzales RD, Schreckenberger PC, Graham MB, Kelkar S, DenBesten K, Quinn JP. Infections due to vancomycinresistant Enterococcus faecium resistant to linezolid. Lancet 2001; 357: 1179.

15. Winn W Jr, Allen S, Janda W, et al. Koneman’s Color Atlas and Textbook of Diagnostic Microbiology. 6th ed. Philadelphia, PA: Lippincott Williams & Wilkins 2006; 672-764.

16. Ono S, Muratani T, Matsumoto T Mechanisms of resistance to imipenem and ampicillin in Enterococcus faecalis. Antimicrob Agents Chemother 2005; 49: 2954-8.

Activity of vancomycin combined with linezolid against clinical vancomycin-resistant Enterococcus strains

17. Hegstad K, Mikalsen T, Coque TM, Werner G, Sundsfjord A. Mobile genetic elements and their contribution to the emergence of antimicrobial resistant Enterococcus faecalis and Enterococcus faecium. Clin Microbiol Infect 2010; 16: 541-54.

18. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Eighteenth Informational supplement M100-S25, CLSI, Wayne, PA, USA, 2015.

19. Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically: Approved Guideline, 7. Approved Standard M7-A7, CLSI, Wayne, PA, USA, 2006.

20. EUCAST. Available at: http://www.eucast.org/clinical_ breakpoins/2018.

21. Odds FC. Synergy, antagonism, and what the chequerboard puts between them. J Antimicrob Chemother 2003; 52: 1.

22. Klare I, Fleige C, Geringer U. Increased frequency of linezolid resistance among clinical Enterococcus faecium isolates from German hospital patients. J Glob Antimicrob Resist 2015; 3: 128-31.

23. Niebel M, Perera MT, Shah T. Emergence of linezolid resistance in hepatobiliary infections caused by Enterococcus faecium. Liver Transpl 2016; 22: 201-8.

24. Yazgi H, Ertek M, Erol S, Ayyildiz A. A comparison of high-level aminoglycoside resistance in vancomycinsensitive and vancomycin-resistant Enterococcus species. J Int Med Res 2002; 30: 529-34.

25. Khodabandeh M, Mohammadi M, Abdolsalehi MR, et al. High-level aminoglycoside resistance in Enterococcus faecalis and Enterococcus faecium; as a serious threat in hospitals. Infect Disord Drug Targets 2020; 20: 223-8.

Basic research Vascular Surgery

Time-dependent effects of cellulose and gelatin-based hemostats on cellular processes of wound healing

Markus U. Wagenhäuser1, Waseem Garabet1, Mia van Bonn1, Wiebke Ibing1, Joscha Mulorz1,2, Yae Hyun Rhee1, Joshua M. Spin2, Christos Dimopoulos1, Alexander Oberhuber1, Hubert Schelzig1, Florian Simon1

1Department of Vascular and Endovascular Surgery, Heinrich-Heine University Düsseldorf, Düsseldorf, Germany

2Stanford Cardiovascular Institute, Stanford University School of Medicine, Stanford, CA, USA

Submitted: 13 March 2019; Accepted: 21 July 2019

Online publication: 4 February 2020

Arch Med Sci 2023; 19 (1): 194–202

DOI: https://doi.org/10.5114/aoms.2020.92830

Copyright © 2020 Termedia & Banach

Abstract

Introduction: Oxidized regenerated cellulose-based (ORC – TABOTAMP), oxidized non-regenerated cellulose-based (ONRC – RESORBA CELL), and gelatinbased (GELA – GELITA TUFT-IT) hemostats are commonly used in surgery. However, their impact on the wound healing process remains largely unexplored. We here assess time-dependent effects of exposure to these hemostats on fibroblast-related wound healing processes.

Material and methods: Hemostats were applied to fibroblast cell cultures for 5–10 (short-), 30 and 60 min (intermediate-) and 24 h (long-term). Representative images of the hemostat degradation process were obtained, and the pH value was measured. Cell viability, apoptosis and migration were analyzed after the above exposure times at 3, 6 and 24 h follow-up. Protein levels for tumor necrosis factor α (TNF- α ) and transforming-growth factor β (TGF- β ) were assessed.

Results: ORC and ONRC reduced pH values during degradation, while GELA proved to be pH-neutral. Hemostat structural integrity was prolonged for GELA (vs. ORC and ONRC). TGF- β and TNF- α levels were reduced for ORC and ONRC (vs. GELA and control) ( p  < 0.05). Further, exposure of ORC and ONRC for longer than 5–10 min reduced cell viability vs. GELA and control at 3 h post-exposure ( p  < 0.05). Similarly, cell migration was impaired with ORC and ONRC exposure longer than 60 min at 24 h follow-up ( p  < 0.05).

Conclusions: Short-term exposure to ORC and ONRC impairs relevant wound healing-related processes in fibroblasts, and alters protein levels of key mediating cytokines. GELA does not show similar effects. We conclude that GELA may be preferred over ORC and ONRC over short-, intermediate- and long-term exposures. Future validation of the clinical relevance is warranted.

Key words: hemostats, wound healing, fibroblast, exposure, cell migration, cell proliferation, gelatin, cellulose, cytokine.

Introduction

Hemostats are commonly used to control suture-hole and minor parenchymatous bleeding in all fields of surgery. As such, a wide range of materials has been introduced [1, 2]. Among these, cellulose-based hemostats (CBH) and gelatin-based hemostats (GBH) are well estab-

Corresponding author: Dr. Markus Udo Wagenhäuser Department of Vascular and Endovascular Surgery

Heinrich-Heine University Düsseldorf Moorenstrasse 5 40225, Düsseldorf, Germany E-mail: markus. wagenhaeuser@freenet.de

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

lished and have revealed similar practicality and functionality [3–5].

Originating from polymerized glucopyranose, oxidized cellulose is fabricated in a multi-step process, generating polyuronic acid as the main structural compound through the oxidation of cellulose fibers [6]. This process makes the materials biodegradable by the human body through β-elimination and enzymatic degradation [7]. In contrast to non-regenerated cellulose, the regenerated form consists of continuous fibers with a more defined ultrastructure [8].

Gelatin is a well-established hemostatic agent and was first introduced in the 1940s. Gelatin is generated by acid partial hydrolysis from porcine-derived collagen, forming a hydrocolloid [9]. Since the implementation of the first GBH, minimal product evolution has occurred [10]. Gelatin foams can expand up to 200% and are capable of absorbing as much as 40 times their weight, which can limit their practicality in specific clinical settings [11].

Given that these hemostats are often left at the application side following hemostasis or may only be applied for short time, it is important to consider the impact of different exposure times on the local wound healing process.

Wound healing is a complex sequence of inflammation, proliferation and matrix remodeling involving various cell types [12–14]. Of these, activated fibroblasts play a pivotal role, as they synthesize an early-stage collagen-rich matrix and then differentiate to myofibroblasts to create a wound-closing tensile force [14, 15]. Therefore, fibroblast proliferation and migration are imperative to ensure physiological wound healing after surgery [16].

There is controversy as to whether hemostats interfere with post-surgical wound healing, with some evidence showing that degradation endproducts might interfere with cellular sub-processes [17, 18]. As the application time of hemostats during surgery might vary from several minutes, up to weeks in those cases in which the material is left in situ, this study explores how the application time of oxidized regenerated cellulose-based (ORC), oxidized non-regenerated cellulose-based (ONRC) and GBH (GELA) alters fibroblast migration, metabolic activity and apoptosis. Further, this study analyzes changes in pH values over a 24 h time course and explores alterations of key mediating cytokines which are essential for physiological wound healing.

Material and methods

Hemostats

RESORBA CELL (RESORBA Medical GmbH, Nuremberg, Germany) (ONRC), TABOTAMP (Ethicon,

Norderstedt, Germany) (ORC) and GELITA TUFT-IT (GELITA Medical, Eberbach Germany) (GELA) were used in this study. Hemostats were applied to the supernatant of fibroblast cell cultures for 5–10 minutes (min) (short-term), 30 and 60 min (intermediate-term) and continuously for 24 hours (h) (long-term).

Cell culture

Human stromal fibroblasts (PromoCell GmbH, Heidelberg, Germany) were cultivated in Dulbecco’s Modified Eagle Media (DMEM) (Biochrom GmbH, Berlin, Germany) supplemented with 20% fetal bovine calf serum (Biochrom Berlin, Germany) and 10 U/ml Penicillin/Streptomycin (PAN Biotech GmbH, Aidenbach, Germany). Fibroblasts were cultured at 37°C and CO2 5% (HERAcell240, Heraeus, Hanau, Germany) with regular media exchange. At 90% confluence, cells were sub-cultured using 0.05% trypsin/0.02% ethylenediaminetetraacetic acid (EDTA) (PAN Biotech GmbH, Aidenbach, Germany). Passages 3 to 9 were used for experiments. Morphological cell assessment was performed using phase-contrast microscopy (Olympus CKX41, Olympus, Shinjuku, Japan).

Hemostat degradation and pH value measurement

To visualize the degradation process, hemostat sections (1 × 1 cm) were placed in 3 ml of physiological saline solution (NaCl 0.9%) (B. Braun Melsungen AG, Melsungen, Germany) or fibroblast culture media (Invitrogen/Thermo Fisher Scientific, Waltham MA USA) for 24 h. The pH value was measured at baseline, after 5, 30 and 60 min, and then hourly for the first 6 h, with additional measurements at 12 and 24 h using a pH meter (FiveEasy Profi-Kit 20 ATC, MetlerToledo, Gießen, Germany). Representative images at given time points were taken using a Discovery.V8 SteREO microscope (Carl Zeiss, Oberkochen, Germany) and/or Olympus XC10 Camera (Olympus, Shinjuku, Japan) at 30× magnification.

Enzyme-linked immunosorbent assay

Enzyme-linked immunosorbent assay (ELISA) for TGF-β (DY 240) and TNF-α (DY 210) were performed on fibroblast lysates according to the manufacturer’s instructions (R&D Systems, Minnesota, USA). Briefly, fibroblast cell cultures were exposed to hemostats for the stated exposure times. Next, hemostats and cell culture media were removed, and fibroblast cell cultures washed 3 times with ice-cold phosphatebuffered saline (dPBS, Invitrogen/Thermo Fisher Scientific, Waltham MA USA). Next, cell lysates were generated using RIPA buffer supplemented

Time-dependent effects of cellulose and gelatin-based hemostats on cellular processes of wound healing

with protease inhibitor cocktail (Sigma-Aldrich, Taufkirchen, Germany). Protein concentration was measured utilizing BCA-Assay (Pierce/Thermo Fisher Scientific, Waltham MA USA). Optical density was measured using a microplate reader (Victor X4, Perkin Elmer, Massachusetts, USA) with wavelengths 450 nm/570 nm.

Cell metabolic activity

Fibroblasts (1 × 105 cells/well) were seeded into a 24-well plate (Greiner Bio-One, Solingen, Germany). Hemostats were sliced into 0.5 × 0.5 cm pieces to ensure constant material input and added to the supernatant. Fibroblast cell cultures were exposed to hemostats for the stated exposure times. Thereafter, cell culture media were replaced to equal volumes. Cell metabolic activity was measured using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) proliferation assay (Carl Roth GmbH & Co, Karlsruhe, Germany) according to the manufacturer’s instructions at baseline and after 3, 6 and 24 h of incubation. Cell culture medium was replaced with 400 μl of a 1 : 9 mixture of MTT stock solution at 5 mg/ml in dPBS (Carl Roth GmbH & Co, Karlsruhe, Germany) and culture medium. After 2 h of incubation, cells were lysed using 200 μl of 2-Propanol. Measurements were performed at a wavelength of 570 nm using a microplate reader (Victor X4, Perkin Elmer, Massachusetts, USA).

Cell migration

Suspended fibroblasts were added to both chambers of a μ-dish insert (ibidi GmbH, Planegg, Germany) and incubated for 24 h. After cell attachment, the insert was removed, and fresh culture medium was added. Hemostats were sliced into 1 × 1 cm pieces and transferred to the supernatant for 5–10, 30 and 60 min, and 24 h. After exposure, slices were removed, and culture medium was exchanged at the same volume. Representative images were taken at baseline and after 3, 6 and 24 h using a light microscope (JuLI Br, NanoEnTek, Seoul, Korea). The analysis of the images was performed using TScratch (2008, T. Gebäck and M. Schulz, ETH Zürich).

Apoptosis assay

Fibroblast apoptosis was studied using a caspase-3/7 assay following the manufacturer’s instructions (Promega, Mannheim, Germany). In short, fibroblasts were exposed to hemostats for the stated exposure times, and 100 ml of Luciferase-Mix was added. Then, the mix was incubated at room temperature for 1 h. Luciferase activity was measured using a microplate reader (Victor X4 (PerkinElmer, Massachusetts, USA).

Statistical analysis

Data are presented as mean ± SEM. Analysis was performed using GraphPad Prism 6.0 (San Diego CA, USA). Iglewicz and Hoaglin’s two-sided robust test was used to identify outliers and the modified z-score was set to 3.5. The Kolmogorov-Smirnov test was used to test for normality and 2-way ANOVA with 2-stage step-up method of Benjamini, Krieger and Yekutieli was used to test for significance. The significance level was set to p < 0.05.

Results

Throughout the 24 h observation period, ORC and ONRC induced lower pH values when compared to GELA and the control. ONRC more strongly acidified cell culture medium when compared to ORC (Figures 1 A, B). Specifically, both ORC and ONRC reduced pH values within 30 min in physiological saline, while GELA showed no effect on pH value when compared to control. Notably, beyond 30 min after application of ORC and ONRC the pH value stabilized (Figure 1 A). Evaluating pH values in cell culture medium, which contains substantial buffering capacity, we found that both ORC and ONRC again caused acidosis, albeit milder when compared to effects in saline. Again, GELA did not change pH values when compared to the control. After two hours of exposure, pH values started trending towards an alkaline milieu for all groups due to lower atmospheric carbon dioxide concentration (vs. incubator), suggesting no further release of acidic groups (Figure 1 B). When studying the degradation process at a macroscopic level, we observed other differences between the three hemostats. Faster degradation of ONRC compared to ORC was found after 3 h, while minimal residual material was observed after 24 h for both ORC and ONRC. Changes in pH values for both ORC and ONRC were reflected in the marked color changes of the cell culture medium. Notably GELA did not appear to degrade over time, and showed prolonged structural integrity over a 24 h time period (Figure 1 C).

Next, we analyzed protein levels of TGF-β and TNF-α in response to hemostat exposure, given that they are key mediators for physiologic wound healing. We found that 6 h of hemostat exposure decreased TGF-β levels for ORC and ONRC significantly when compared to GELA and/or control, but this effect was not sustained to the level of statistical significance after 24 h (Figure 2 A). In contrast, TNF-α levels were decreased with ONRC exposure after 6 h and for both ORC and ONRC after 24 h of exposure (Figure 2 B). Notably, GELA did not significantly alter TGF-β or TNF-α levels at any time point (Figures 2 A, B).

Markus U. Wagenhäuser, Waseem Garabet, Mia van Bonn, Wiebke Ibing, Joscha Mulorz, Yae Hyun Rhee, Joshua M. Spin, Christos Dimopoulos, Alexander Oberhuber, Hubert Schelzig, Florian Simon

Figure 1. pH values and hemostat degradation. A, B – pH values over a 24 hour time course for GELA, ORC and ONRC in saline (A) and cell culture medium (B). Recognize the immediate drop in pH value for ORC and ONRC. ONRC creates a lower pH value during the investigation period in cell culture medium vs. ORC and GELA. GELA mimicked pH values of controls in saline and cell culture medium (n = 6 samples/time point). C – Representative light microscopy images of GELA, ORC and ONRC after 3, 6, 12, and 24 hours (h) in cell culture medium. GELA was dyed with blue ink for visualization. Note the color change of the medium indicating change in pH value. Also note the structural integrity of GELA after 24 h vs. completely degraded ORC and ONRC. Original magnification: 30× (n = 6)

Figure 2. Cytokine protein levels. Fibroblast cell cultures were exposed to hemostats for 6 and 24 hours (h). Protein levels of TGF-β (A) and TNF-α (B) were analyzed from cell lysates. ORC and ONRC reduced TGF-β levels after 6 h, while protein levels normalized after 24 h of exposure (A). ONRC reduced TNF-α levels after 6 and 24 h, while ORC reduced TNF-α levels after 24 h (B). No differential regulation vs. control was observed for GELA (A and B). **p < 0.05 ORC and/or ONRC vs. control and GELA; ***p < 0.05 ONRC vs. control, GELA and ORC. Two-way ANOVA with 2-stage step-up method of Benjamini, Krieger and Yekutieli was applied (q = 0.05, n = 4–5 samples/time point)

We then evaluated how different exposure times interfere with metabolic activity and migration of fibroblasts. Fibroblasts were exposed to he-

mostats for short- (5–10 min), intermediate- (30 and 60 min) and long-term (24 h) periods. We observed significantly reduced signal intensity during

A

1.3 1.2 1.1 1.0 0.9 0.8 0.7 0.6 0.5

x-fold change vs. control 3

**

B

1.5 1.4 1.3 1.2 1.1 1.0 0.9 0.8 0.7 0.6 0.5

x-fold change vs. control 6 24 3 6 24

Time [h]

C D

1.3 1.2 1.1 1.0 0.9 0.8 0.7 0.6 0.5

x-fold change vs. control 3

Time [h] Time [h]

1.3 1.2 1.1 1.0 0.9 0.8 0.7 0.6 0.5 0.4

x-fold change vs. control 6 24 Control GELA ORC ONRC

Control GELA ORC ONRC

Figure 3. MTT-cellular metabolic activity assay for fibroblast cell cultures with different hemostat exposure times. Data are normalized to controls. Human stromal fibroblasts were exposed to hemostats placed in their medium for 5–10 (A), 30 (B), or 60 minutes (min) (C) or continuously over 24 hours (h) (D). Cell metabolic activity was analyzed using an MTT assay after 3, 6 and 24 h. Reduced cellular metabolism was observed for both ORC and ONRC (vs. GELA and controls) at 5–10 and 60 min of hemostat exposure after 3 h (A and C). ONRC showed reduced cellular metabolism vs. control, GELA and ORC after 5–10, 30 and 60 min hemostat exposure after 3 h (A–C). This effect was maintained with continuous hemostat exposure for 24 h (D). Two-way ANOVA with 2-stage step-up method of Benjamini, Krieger and Yekutieli was applied (q = 0.05). No difference in cellular metabolism was found for GELA vs. control at any given exposure time. *p < 0.05 ORC vs. GELA; **p < 0.05 ORC vs. control and GELA; ***p < 0.05 ONRC vs. control, GELA and ORC (n = 8–12/group)

short- and intermediate-term exposure with ONRC after 3 h and with ORC after 3 h and 6 h follow-up when compared to GELA and/or control. At 24 h follow-up of the short- and intermediate-term exposures, no differences between the study groups were observed, suggesting a transient reduction of metabolic activity during ONRC and ORC exposure (Figures 3 A–C). Notably, only ONRC reduced metabolic fibroblast activity after continuous exposure for 24 h (Figure 3 D), while no changes were observed during GELA exposure at any exposure time for any follow-up time point when compared to controls (Figures 3 A–D).

Analyzing fibroblast migration over a pre-defined gap/area between two cell fractions, we found that none of the hemostats interfered with migration after short-term exposure (Figure 4 A). In comparison, intermediate- and/or long-term exposure with ORC and/or ONRC inhibited fibroblast migration at 24 h follow-up, although shorter follow-up time points revealed no effects (Figures 4 B–D). Notably, ONRC more strongly inhibited cell migration when compared to ORC for the aforementioned exposure

times (Figures 4 B, C), while GELA had no impact on fibroblast migration during any given exposure period or follow-up time point (Figures 4 A–D).

We found no relevant cell apoptosis differences in response to exposure with either ORC, ONRC or GELA vs. control (Figure 5).

Discussion

In this study we investigated the impact of different exposure times of CBH (ORC and ONRC) and GBH (GELA) on wound healing. Short-term exposure to CBH reduced cellular metabolic activity, while long-term exposure impaired cell migration. None of these unfavorable effects were observed during GBH exposure. Coincidently, CBH also acidified the local environment and altered protein levels of TGF-β and TNF-α, both key mediators of physiological wound healing [19].

Hemostats provide conformability and convenient handling, leading to these materials being integrated into daily surgical routine. As of today, there are multiple different products available,

Markus U. Wagenhäuser, Waseem Garabet, Mia van Bonn, Wiebke Ibing, Joscha Mulorz, Yae Hyun Rhee, Joshua M. Spin, Christos Dimopoulos, Alexander Oberhuber, Hubert Schelzig, Florian Simon

A B 1.0 0.9 0.8 0.7 0.6

Cell covered area vs. baseline 3

1.0 0.9 0.8 0.7 0.6

Time after experimental start [h]

C D

Time after experimental start [h]

Cell covered area vs. baseline 6 24 3 6 24 1.0 0.9 0.8 0.7 0.6 Cell covered area vs. baseline 3

Time after experimental start [h]

Control GELA ORC ONRC

**

* ***

1.0 0.9 0.8 0.7 0.6 Cell covered area vs. baseline 6 24 Control GELA ORC ONRC

Figure 4. Fibroblast migration time course after different exposure times to hemostats. Human stromal fibroblasts were placed in both chambers of a  μ-dish insert. After removal of the  μ-dish insert the area between the cell fractions was measured at baseline. Hemostats were applied to the cell culture medium for 5–10 (A), 30 (B), or 60 minutes (min) (C) or continuously over 24 hours (h) (D). The area between the two cell fractions was measured after 3, 6 and 24 h from representative images. Impaired cell migration was observed for ORC/ONRC vs. GELA/control and for ORC vs. ONRC for 60 min and 24 h of exposure (C and D). *p  < 0.05 vs. control; **p < 0.05 vs. control and GELA; ***p < 0.05 vs. control, GELA and ORC. Two-way ANOVA with 2-stage step-up method of Benjamini, Krieger and Yekutieli was applied (q = 0.05, n = 5–7/experimental group)

characterized by material-specific attributes. There is long-standing clinical experience with CBH and GBH, with both providing effective hemostasis and biodegradability. Despite many similarities, their mode of action differs [20, 21]. In particular, ORC and ONRC are thought to directly promote platelet activation and aggregation, forming a gel-like clot, while GBH is considered to anchor fibrinogen on the nano-rough material surface while simultaneously enhancing capillary effects [8, 22, 23]. Aside their different mode of action, hemostatic agent costs were 28–56% lower for CBH compared with other adjunctive hemostats, suggesting a major impact on overall treatment costs [24]. Indeed, current purchasing costs for GBH (GELA) appear to be higher compared with CBH (TABOTAMP > RESORBA CELL).

Our results suggest that CBH release acid groups during degradation, while GBH is pH neutral. For that reason, it might be expected that GBH lacks the anti-bacterial properties of CBH [25]. Since both CBH and GBH are bio-absorbable, they may

change essential cellular wound healing processes at the site of application. Given that the application time of hemostats during surgery may or may not be limited to several minutes, we explored the impact of short-, intermediate- and long-term exposure of CBH and GBH on relevant cellular processes for physiological wound healing.

Our group and others have previously demonstrated that CBH (ORC and/or ONRC) materials cause rapid local acidosis during degradation due to the absence of buffer-acting serum components [26, 27]. Consistent with previous findings, this study found that ONRC caused the strongest decline of pH values during degradation, as frayed and less condensed fibers form a larger surface area, leading to more rapid release of acidic groups [27]. In contrast, GELA proved to be pH neutral and maintained prolonged structural integrity over 24 h. Our findings seem plausible, since reported time frames for complete degradation in vivo vary from 14 days up to 5 weeks for CBH, while the same process may take as long as

Time-dependent effects of cellulose and gelatin-based hemostats on cellular processes of wound healing

A

Caspase-3/7 activity normalized vs. control

2.0 1.5 1.0 0.5 0.0

Control GELA ORC ONRC

B

2.0 1.5 1.0 0.5 0.0

C D

Caspase-3/7 activity normalized vs. control

2.0 1.5 1.0 0.5 0.0

Control GELA ORC ONRC

Caspase-3/7 activity normalized vs. control 2.0 1.5 1.0 0.5 0.0

Control GELA ORC ONRC

Caspase-3/7 activity normalized vs. control

Control GELA ORC ONRC

Figure 5. Fibroblast caspase-3/7 activity after different exposure times to hemostats. Human stromal fibroblasts were exposed to hemostats placed in their medium for 5–10 (A), 30 (B), or 60 minutes (min) (C) or continuously over 24 hours (h) (D). Caspase-3 and -7 activity was analyzed as an indirect measurement for apoptosis. None of the applied hemostats caused significant apoptosis at the given exposure times (A–D). Two-way ANOVA with 2-stage step-up method of Benjamini, Krieger and Yekutieli was applied (q = 0.05, n = 5–7/experimental group)

4–6 weeks for GBH and may be accelerated und standardized in in vitro conditions [28–30].

Lan et al. demonstrated that local acidosis can reduce cell metabolic activity, adhesion capacity and protein synthesis in cultured human gingival fibroblasts and described these effects as being reversible when pH values are re-adjusted to physiological conditions [31]. Similar observations have been reported for different cell types when exposed to an extracellular acidic milieu [32, 33]. The findings of the present study reveal that short-term exposure to ORC and/or ONRC significantly reduces cell metabolic activity at 3 h post-exposure, while intermediate-term and long-term exposure reduced metabolic activity at 6 h and/or 24 h, respectively. Our results do suggest that the reduction of metabolic activity for short- and intermediate-term exposure times with CBH is transient. However, GBH does not interfere with cell metabolic activity at all. Since metabolic activity is imperative for the initiation of physiological wound healing, including recruitment of various cell types and the formation of a provisional wound matrix, we conclude that GBH might be preferable when compared with CBH with regard to this endpoint [12, 34].

Along with proliferation, cell migration is crucial during the proliferative phase of physiological wound healing, as it enables the formation of granulation tissue at the side of injury [35].

Our results suggest that intermediate-term and long-term exposure to CBH impairs the migratory activity of fibroblasts at 24 h post-exposure. An association with local acidosis seems likely, since Kruse et al. demonstrated that acidic extracellular environments can impair fibroblast migration [36]. Transferring this functional finding to a cell signaling level, there is evidence that extracellular acidosis beyond the physiological range may activate mitogen-activated protein kinase (MAPK) signaling, which has shown to be involved in the regulation of cell migration [37, 38]. Given this, future experiments using targeting of MAPK signaling could help to validate our in vitro findings. For now, we again conclude that GBH might be preferred over CBH with regard to preserving fibroblast migration.

Of interest, our data suggest that some differences in functional findings may not devolve solely from acidosis, which is known to occur during CBH degradation. Our group recently found that CBH degradation end products might also cause functional alterations in migration and proliferation in fibroblasts as well as matrix contraction after exposure for 1–2 weeks [27]. Some of the phenotypic findings might have resulted from marked changes in wound healing-relevant cytokine levels. TGF-β signaling is involved in cardiovascular and pulmonary diseases [39, 40]. Denton et al. emphasized

Markus U. Wagenhäuser, Waseem Garabet, Mia van Bonn, Wiebke Ibing, Joscha Mulorz, Yae Hyun Rhee, Joshua M. Spin, Christos Dimopoulos, Alexander Oberhuber, Hubert Schelzig, Florian Simon

the significance of TGF-β for physiological wound healing using a mouse model of type II TGF-β receptor (TbetaRII) deletion in fibroblasts [41]. The present study suggests that, in contrast to GBH, CBH can reduce TGF-β protein levels in fibroblasts. Of interest, non-canonical intracellular TGF-β signaling might link reduced TGF-β levels upon CBH exposure to impaired fibroblast migration. In particular, it has been demonstrated that non-Smad depended signaling is able to activate the Erk MAPK pathway, which in turn interferes with cell migration [38]. Since our findings reveal delayed impaired fibroblast migration during intermediate- and long-term CBH exposure at late follow-up time points, the authors propose that evolutionarily conserved canonical TGF-β-induced Smad-signaling with interposed protein might also be critical for the findings of the present study [42–44]. Notably, short-term acidosis, such as that caused by CBH exposure, has shown to be sufficient to induce TGF-β-induced signaling [37].

Apart from TGF-β, the importance of TNF-α for physiological wound healing has been elucidated in various studies, as it promotes inflammatory leukocyte recruitment into the wounded tissues and enhances fibroblast proliferation/growth both in vitro and in vivo [45–48]. Our results indicate that CBHs can reduce intracellular TNF-α protein levels after 6 h and 24 h exposure. As a side point, these reductions in TNF-α levels might have contributed to reduced metabolic activity, which in turn serves as an indirect marker for the proliferative capacity of fibroblasts. Although reduced TNF-α levels in an acidic environment upon CBH exposure might seem contradictory at first glance, Riemann et al. also found that exposing rat kidney fibroblasts to acidic cell culture medium decreases TNF-α levels [37]. Further, since TGF-β is pivotal for the control of cell proliferation simultaneously decreased levels of TNF-α and TGF-β might have also substantially contributed to the observed impaired metabolic activity, linking the varying cytokine levels during CBH and GBH exposure to our functional findings [49, 50].

Our study has several limitations. First, we studied the effects of hemostat exposure in a monocellular in vitro model using stromal fibroblasts, which does not sufficiently mimic wound healing in vivo, as several different interacting cell types are involved. Further, the regulation of cell migration and metabolic activity through TGF-β and/or TNF-α has not been directly addressed using pathway inhibitors. Thus, a direct association between the altered cytokine levels and functional findings remains hypothetical. Lastly, it is unclear to what extent our findings are of clinical relevance, as neither experimental animal models nor human trials were part of this study.

In conclusion, this study found that ORC and ONRC (CBH) in contrast to GELA (GBH) impair essential cellular processes of physiological wound healing in vitro in fibroblasts even after short-term exposure. Decreased protein levels of TGF-β and TNF-α in response to ORC and ONRC exposure suggest that these effects may be cytokine-related. We conclude that GELA (GBH) might be more beneficial for physiological wound healing after surgery, although verification of the clinical relevance of these findings is required.

Acknowledgments

The study was supported by a Research Grant from Deutsche Gesellschaft für Gefässchirurgie und Gefässmedizin to MU Wagenhäuser.

Conflict of interest

All authors who are affiliated with the Department of Vascular and Endovascular Surgery, Heinrich-Heine University Düsseldorf, Germany and Alexander Oberhuber participated in the “GELITA Medical Gelatin Hemostat Postmarket Registry” (Registry-ID: 2016116001).

References

1. Baumann P, Schumacher H, Hüsing J, Luntz S, Knaebel HP. A randomized, controlled, prospective trial to evaluate the haemostatic effect of Lyostypt versus Surgicel in arterial bypass anastomosis: “COBBANA” trial. Trials 2009; 10: 91.

2. Sawada T, Nishizawa H, Nishio E, Kadowaki M. Postoperative adhesion prevention with an oxidized regenerated cellulose adhesion barrier in infertile women. J Reprod Med 2000; 45: 387-9.

3. Zoucas E, Göransson G, Bengmark S. Comparative evaluation of local hemostatic agents in experimental liver trauma: a study in the rat. J Surg Res 1984; 37: 145-50.

4. Coln D, Horton J, Ogden ME, Buja LM. Evaluation of hemostatic agents in experimental splenic lacerations. Am J Surg 1983; 145: 256-9.

5. Chvapil M, Owen JA, DeYoung DW. A standardized animal model for evaluation of hemostatic effectiveness of various materials. J Trauma 1983; 23: 1042-7.

6. Dimitrijevich SD, Tatarko M, Gracy RW, et al. In vivo degradation of oxidized, regenerated cellulose. Carbohydr Res 1990; 198: 331-41.

7. Pierce AM, Wiebkin OW, Wilson DF. Surgicel: its fate following implantation. J Oral Pathol 1984; 13: 661-70.

8. Martina B, Kateřina K, Miloslava R, Jan G, Ruta M. Oxycellulose: significant characteristics in relation to its pharmaceutical and medical applications. Adv Polym Technol 2009; 28: 199-208.

9. Vyas KS, Saha SP. Comparison of hemostatic agents used in vascular surgery. Expert Opin Biol Ther 2013; 13: 1663-72.

10. Sundaram CP, Keenan AC. Evolution of hemostatic agents in surgical practice. Indian J Urol 2010; 26: 374-8.

11. Echave M, Oyagüez I, Casado MA. Use of Floseal®, a human gelatine-thrombin matrix sealant, in surgery: a systematic review. BMC Surg 2014; 14: 111.

Time-dependent effects of cellulose and gelatin-based hemostats on cellular processes of wound healing

Markus U. Wagenhäuser, Waseem Garabet, Mia van Bonn, Wiebke Ibing, Joscha Mulorz, Yae Hyun Rhee, Joshua M. Spin, Christos Dimopoulos, Alexander Oberhuber, Hubert Schelzig, Florian Simon

12. Reinke JM, Sorg H. Wound repair and regeneration. Eur Surg Res 2012; 49: 35-43.

13. Schäfer M, Werner S. Cancer as an overhealing wound: an old hypothesis revisited. Nat Rev Mol Cell Biol 2008; 9: 628-38.

14. Baum CL, Arpey CJ. Normal cutaneous wound healing: clinical correlation with cellular and molecular events. Dermatol Surg 2005; 31: 674-86.

15. Grinnell F. Fibroblasts, myofibroblasts, and wound contraction. J Cell Biol 1994; 124: 401-4.

16. Bainbridge P. Wound healing and the role of fibroblasts. J Wound Care 2013; 22: 407-8, 410-12.

17. Jeschke MG, Sandmann G, Schubert T, Klein D. Effect of oxidized regenerated cellulose/collagen matrix on dermal and epidermal healing and growth factors in an acute wound. Wound Repair Regen 2005; 13: 324-31.

18. Cullen B, Watt PW, Lundqvist C, et al. The role of oxidised regenerated cellulose/collagen in chronic wound repair and its potential mechanism of action. Int J Biochem Cell Biol 2002; 34: 1544-56.

19. Behm B, Babilas P, Landthaler M, Schreml S. Cytokines, chemokines and growth factors in wound healing. J Eur Acad Dermatol Venereol 2012; 26: 812-20.

20. Hutchinson RW, George K, Johns D, Craven L, Zhang G, Shnoda P. Hemostatic efficacy and tissue reaction of oxidized regenerated cellulose hemostats. Cellulose 2013; 20: 537-45.

21. Wolkow N, Jakobiec FA, Yoon MK. Gelatin-based hemostatic agents: histopathologic differences. Ophthal Plast Reconstr Surg 2018; 34: 452-5.

22. Krízová P, Másová L, Suttnar J, et al. The influence of intrinsic coagulation pathway on blood platelets activation by oxidized cellulose. J Biomed Mater Res A 2007; 82: 274-80.

23. Hajosch R, Suckfuell M, Oesser S, Ahlers M, Flechsenhar K, Schlosshauer B. A novel gelatin sponge for accelerated hemostasis. J Biomed Mater Res B Appl Biomater 2010; 94: 372-9.

24. Martyn D, Meckley LM, Miyasato G, et al. Variation in hospital resource use and cost among surgical procedures using topical absorbable hemostats. Clinicoecon Outcomes Res 2015; 7: 567-74.

25. Spangler D, Rothenburger S, Nguyen K, Jampani H, Weiss S, Bhende S. In vitro antimicrobial activity of oxidized regenerated cellulose against antibiotic-resistant microorganisms. Surg Infect (Larchmt) 2003; 4: 255-62.

26. Dimitrijevich SD, Tatarko M, Gracy RW, Linsky CB, Olsen C. Biodegradation of oxidized regenerated cellulose. Carbohydr Res 1990; 195: 247-56.

27. Wagenhäuser MU, Mulorz J, Ibing W, et al. Oxidized (non)-regenerated cellulose affects fundamental cellular processes of wound healing. Sci Rep 2016; 6: 32238.

28. Charlesworth TM, Agthe P, Moores A, Anderson DM. The use of haemostatic gelatin sponges in veterinary surgery. J Small Anim Pract 2012; 53: 51-6.

29. Weaver FA, Hood DB, Zatina M, Messina L, Badduke B. Gelatin-thrombin-based hemostatic sealant for intraoperative bleeding in vascular surgery. Ann Vasc Surg 2002; 16: 286-93.

30. Chiara O, Cimbanassi S, Bellanova G, et al. A systematic review on the use of topical hemostats in trauma and emergency surgery. BMC Surg 2002; 16: 286-93.

31. Lan WC, Lan WH, Chan CP, Hsieh CC, Chang MC, Jeng JH. The effects of extracellular citric acid acidosis on the viability, cellular adhesion capacity and protein synthesis of cultured human gingival fibroblasts. Aust Dent J 1999; 44: 123-30.

32. Lecocq J, Dambly C. A bacterial RNA polymerase mutant that renders lambda growth independent of the N and cro functions at 42 degrees C. Mol Gen Genet 1976; 145: 53-64.

33. Huang S, He P, Xu D, et al. Acidic stress induces apoptosis and inhibits angiogenesis in human bone marrow-derived endothelial progenitor cells. Oncol Lett 2017; 14: 5695-702.

34. Robson MC, Steed DL, Franz MG. Wound healing: biologic features and approaches to maximize healing trajectories. Curr Probl Surg 2001; 38: 72-140.

35. Kirsner RS, Eaglstein WH. The wound healing process. Dermatol Clin 1993; 11: 629-40.

36. Kruse CR, Singh M, Targosinski S, et al. The effect of pH on cell viability, cell migration, cell proliferation, wound closure, and wound reepithelialization: in vitro and in vivo study. Wound Repair Regen 2017; 25: 260-9.

37. Riemann A, Ihling A, Thomas J, Schneider B, Thews O, Gekle M. Acidic environment activates inflammatory programs in fibroblasts via a cAMP-MAPK pathway. Biochim Biophys Acta 2015; 1853: 299-307.

38. Huang C, Jacobson K, Schaller MD. MAP kinases and cell migration. J Cell Sci 2004; 117 (Pt 20): 4619-28.

39. Shao S, Fang H, Duan L, et al. Lysyl hydroxylase 3 increases collagen deposition and promotes pulmonary fibrosis by activating TGFβ1/Smad3 and Wnt/β-catenin pathways. Arch Med Sci 2018; 24: 8592-601.

40. Kulach A, Dabek J, Wilczok T, Gasior Z. Changes in transforming growth factor β; and its receptors’ mRNA expression in monocytes from patients with acute coronary syndromes. Arch Med Sci 2010; 6: 526-32.

41. Denton CP, Khan K, Hoyles RK, et al. Inducible lineage-specific deletion of TbetaRII in fibroblasts defines a pivotal regulatory role during adult skin wound healing. J Invest Dermatol 2009; 129: 194-204.

42. Simeone DM, Zhang L, Graziano K, et al. Smad4 mediates activation of mitogen-activated protein kinases by TGF-beta in pancreatic acinar cells. Am J Physiol Cell Physiol 2001; 281: C311-9.

43. Olsson N, Piek E, Sundström M, ten Dijke P, Nilsson G. Transforming growth factor-beta-mediated mast cell migration depends on mitogen-activated protein kinase activity. Cell Signal 2001; 13: 483-90.

44. Zhang YE. Non-Smad pathways in TGF-beta signaling. Cell Res 2009; 19: 128-39.

45. Mast BA, Schultz GS. Interactions of cytokines, growth factors, and proteases in acute and chronic wounds. Wound Repair Regen 1996; 4: 411-20.

46. Liu JY, Brass DM, Hoyle GW, Brody AR. TNF-alpha receptor knockout mice are protected from the fibroproliferative effects of inhaled asbestos fibers. Am J Pathol 1998; 153: 1839-47.

47. Ortiz LA, Lasky J, Hamilton RF, et al. Expression of TNF and the necessity of TNF receptors in bleomycin-induced lung injury in mice. Exp Lung Res 1998; 24: 721-43.

48. Battegay EJ, Raines EW, Colbert T, Ross R. TNF-alpha stimulation of fibroblast proliferation. Dependence on platelet-derived growth factor (PDGF) secretion and alteration of PDGF receptor expression. J Immunol 1995; 154: 6040-7.

49. Huang SS, Huang JS. TGF-beta control of cell proliferation. J Cell Biochem 2005; 96: 447-62.

50. Clark RA, McCoy GA, Folkvord JM, McPherson JM. TGFbeta 1 stimulates cultured human fibroblasts to proliferate and produce tissue-like fibroplasia: a fibronectin matrix-dependent event. J Cell Physiol 1997; 170: 69-80.

pathway

Sarina Ataei1,2, Shiva Ganjali3, Maciej Banach4,5, Ehsan Karimi1, Amirhossein Sahebkar2,6,7,8

1Department of Biology, Mashhad Branch, Islamic Azad University, Mashhad, Iran

2Applied Biomedical Research Center, Mashhad University of Medical Sciences, Mashhad, Iran

3Department of Medical Biotechnology and Nanotechnology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

4Department of Preventive Cardiology and Lipidology, Medical University of Lodz (MUL), Lodz, Poland

5Cardiovascular Research Centre, University of Zielona Gora, Zielona Gora, Poland

6Biotechnology Research Center, Pharmaceutical Technology Institute, Mashhad University of Medical Sciences, Mashhad, Iran

7School of Medicine, The University of Western Australia, Perth, Australia

8Department of Biotechnology, School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran

Submitted: 19 June 2022; Accepted: 9 July 2022

Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 203–208

DOI: https://doi.org/10.5114/aoms/152000

Copyright © 2022 Termedia & Banach

Abstract

Introduction: MicroRNAs (miRNAs) are a class of gene expression epigenetic regulators that play roles in regulating genes involved in cholesterol homeostasis, including low-density lipoprotein receptor (LDLR) and PCSK9; therefore, miRNAs have been suggested as potential therapeutic targets for treating cardiometabolic disorders. Thus, the present study aimed to assess the effect of immunotherapy with the PCSK9 peptide vaccine on the hepatic expression levels of microRNAs associated with the LDLR pathway, including miRNA-27a, miRNA-30c, and miRNA-191, in normal vaccinated mice. Material and methods: PCSK9 immunogenic peptide and 0.4% alum adjuvant were mixed at a 1 : 1 ratio and used as a vaccine formulation. Male albino mice were randomly assigned to the vaccine or control group. Mice in the vaccine group were injected four times at two-week intervals with a PCSK9 peptide vaccine, and mice in the control group were injected with phosphate-buffered saline (PBS). Animal livers were sampled 2 weeks after the last injection to assess miRNA expression levels. The hepatic expression levels of miRNA-27a, miRNA-30c, and miRNA-191 were evaluated by SYBR Green real-time PCR, quantified by a comparative (2 –∆∆CT) method (fold change (FC)) and normalized to U6 small nuclear RNA (U6snRNA) expression as an internal control.

Results:  The hepatic expression level of miRNA-27a was significantly lower in mice following immunotherapy with the PCSK9 peptide vaccine compared to the control group (FC: 0.731 ±0.1, p = 0.027). Also, there was a borderline significantly lower hepatic expression level of miRNA-30c in the vaccinated group compared to the control (FC: 0.569 ±0.1, p = 0.078). However, no significant differences were found in the hepatic expression level of miRNA-191 between the two studied groups (FC: 0.852 ±0.1, p = 0.343).

Conclusions:  According to the findings, the PCSK9 peptide vaccine could effectively reduce the hepatic expression level of miRNA-27a and may be helpful in the management of LDL-C level and atherosclerosis, which may be mediated through the LDLR pathway.

Key words:  atherosclerosis, PCSK9, LDLR, miRNA.

Corresponding author: Prof. Amirhossein Sahebkar Department of Biotechnology School of Pharmacy Mashhad University of Medical Sciences Mashhad, Iran E-mail: amir_saheb2000@ yahoo.com; sahebkara@mums.ac.ir

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

The effect of PCSK9 immunization on the hepatic level of microRNAs associated with the PCSK9/LDLR

Introduction

Cardiovascular diseases (CVDs) are the leading causes of morbidity and mortality worldwide [1, 2]. Atherosclerosis, the most common underlying cause of CVDs, is a chronic and progressive pathological condition characterized by lipid proliferation and inflammation in the artery walls [1, 2]. One of the main risk factors contributing to the early development of atherosclerosis is elevated levels of circulating low-density lipoprotein cholesterol (LDL-C) [3]. A major pathway of LDL-C clearance from the bloodstream is its uptake by hepatic LDL receptors (LDLR) [4]. The proprotein convertase subtilisin-like kexin type 9 (PCSK9) is a serine protease which bind to the LDLR and chaperones it for lysosomal degradation, thereby elevating the circulating levels of LDL-C [4]. Inhibiting PCSK9, the critical negative regulator of the LDLR, with monoclonal antibodies (mAbs) has been a milestone in lipid-lowering medication over the last decade and has gained increasing attention for preventing and managing atherosclerosis and CVDs [5–7]. On the other hand, long-term clinical usage of mAbs has drawbacks such as a short in vivo half-life, which necessitates frequent administration and high cost, specific tolerability issues, and the potential development of host anti-mAbs [8]. Active immunotherapy and vaccination techniques against PCSK9 have exploded in popularity to overcome these constraints [8]. Our group has recently designed a novel anti-PCSK9 vaccine formulation named Liposomal Immunogenic Fused PCSK9-Tetanus peptide plus Alum adjuvant (L-IFPTA+), which has shown fascinating results in different animal models [9–14]. The vaccine could significantly inhibit PCSK9 enzyme synthesis by promoting antibody production against it, followed by a considerable reduction in LDL-C levels in the blood of atherosclerotic mice [10].

MicroRNAs (miRNAs) are a class of small (~23 nucleotides) endogenous non-coding single-strand RNAs that regulate gene expression at the posttranscriptional level [15, 16]. They interact with the 3′ untranslated region (3′ UTR) of target mRNAs and lower protein synthesis by enhancing mRNA degradation, interfering with mRNA translation, or both [15, 17]. miRNAs play a pivotal role in the pathophysiology of the cardiovascular system [18].

They assist in regulating lipid metabolism through a complicated interactive mechanism involving gene regulatory networks and represent novel therapeutic target agents for human metabolic diseases [19, 20]. miR-27a has been shown to decrease LDLR levels by directly binding to its 3′-untranslated region (UTR) and indirectly by enhancing PCSK9, which improves LDLR degradation. miR-27a also directly downregulates the expression of LDLR-related protein 6 (LRP6) and LDLR-adapter protein 1 (LDLRAP1), key players in the LDLR pathway necessary for endocytosis of the LDLR-LDL-C complex in the liver by binding to their 3′-UTR [21]. On the other hand, miRNA-191 can directly interact with PCSK9 3′-UTR and regulate its expression [22]. Changes in MiR-30c appear to have an impact on circulating cholesterol and triglyceride levels [23]. This microRNA binds to the 3′-untranslated region of microsomal triglyceride transfer protein (MTP) mRNA and causes it to degrade, reducing MTP activity and apolipoprotein B (APOB) secretion and inhibiting VLDL synthesis [23]. MiR-30c also inhibits hepatic lipid synthesis by targeting the enzyme lysophosphatidyl glycerol acyltransferase 1 (LPGAT1) [23].

In the present study, we developed a non-nanoliposomal form of the L-IFPTA+ vaccine due to its more straightforward system and easier quality control, including PCSK9 immunogenic peptide fused tetanus peptide plus alum adjuvant. Here we investigated the effects of PCSK9 immunogenic peptide and alum adjuvant on the hepatic expression of miRNAs involved in the cholesterol homeostasis and PCSK9/LDLR pathway, including miRNA-27a, miRNA-30c, and miRNA-191 in normal immunized mice.

Material and methods

Vaccine preparation

We used the PCSK9 peptide epitope linked to a tetanus peptide epitope with the SIPWNLERITPVRkkAQYIKANSKFIGITEL sequence as the immunogen. The vaccine structure includes a short PCSK9 peptide as a B cell epitope inspired by the AFFiRiS group [9, 20] linked to a tetanus peptide as a T cell epitope, a pharmaceutically acceptable carrier [24] (Table I). The peptide was synthesized by ChinaPeptides Co, Ltd. (Shanghai, China), and the vaccine formulation was prepared by homoge-

Table I. Sequences of the immunogenic peptides used in the present study. A 2-lysine-spacer sequence (kk) as the target sequence of cathepsin protease involved in antigen processing

Peptide name Sequence

PCSK9 S-I-P-W-N-L-E-R-I-T-P-V-R

Tetanus A-Q-Y-I-K-A-N-S-K-F-I-G-I-T-E-L

PCSK9 peptide vaccine SIPWNLERITPVRkkAQYIKANSKFIGITEL

Immunogenicity

B cell epitope

T cell epitope

Sarina Ataei, Shiva Ganjali, Maciej Banach, Ehsan Karimi, Amirhossein Sahebkar

neously mixing the PCSK9 immunogenic peptide with 0.4% alum adjuvant at a 1 : 1 ratio.

Animals

Animal studies were conducted on 6–8-weekold albino mice, prepared by Razi Vaccine and Serum Research Institute, Iran All animal handling steps were commensurate with the animal welfare guidelines approved by the Organizational Ethics Committee and the Research Advisory Committee of Mashhad University of Medical Sciences (Mashhad, Iran). Environmental conditions were the same during all phases of the study. The animals were kept under standard temperature, humidity, and darkness/light cycle conditions and fed freely on a standard rodent diet and water adlib. One week after adaptation to the laboratory environment, 20 male albino mice were randomly divided into two vaccine and control groups (10 mice in each group).

Immunization and tissue sampling

Mice were immunized four times subcutaneously with 10 μg of peptide antigen at bi-weekly intervals. Mice in the control group received phosphate-buffered saline (PBS). Two weeks after the last immunization (W8), the animals were sacrificed following an intraperitoneal sodium thiopental 30 mg/kg injection (Figure 1). To assess the hepatic expression of microRNAs in vaccinated mice, mice’s livers were dissected, washed with saline, and stored in RNAlater Solution (Denazist, S-5062, Mashhad, Iran) immediately.

Hepatic RNA isolation and cDNA synthesis

To determine the hepatic expression levels of miRNAs, total RNA was extracted from 5–10 mg frozen hepatic tissues using BIOzol RNA lysis buffer (BN-0011.33, Bonyakhteh, Tehran, Iran) according to the manufacturer’s protocol with some modifications, such as increasing the incubation period and centrifugation to obtain the largest amount of miRNAs in the samples. The quantity and quality of the isolated RNA were evaluated

using a Nanodrop2000 instrument (Thermo, Wilmington, DE, USA). About 5 μg of total RNA with absorbance of 1.8–2 at 260/280 nm was used for the initial polyadenylation step, followed by using the RT Stem-loop primer designed by Bonyakhteh company which was available in the BONmiR High Sensitivity MicroRNA 1st Strand cDNA Synthesis kit (BN-0011.17.2, Bonyakhteh, Tehran, Iran). The universal cDNA synthesis was completed via the thermocycler device for 10 min at 25°C, 60 min at 42°C, and 10 min at 70°C. The synthesized cDNA was stored at –20°C for future quantitative real-time PCR (qRT-PCR)

qRT-PCR

To assess the relative hepatic expression levels of miR-27a, miR-30c, and miR-191 the SYBR Green qPCR method was applied on the LightCycler 96 Instrument (Roche Diagnostics, Mannheim, Germany) using the BON microRNA QPCR master mix kit (BN0011.17.4, Tehran, Iran) containing miRNA-specific primers (designed by Bonyakhteh company, Tehran, Iran) (Table II). All reactions were carried out in duplicate. The qPCR steps were performed according to the manufacturer’s instructions. After pre-incubation (95°C for 2 min), amplification was run for 40 cycles (95°C for 5 s and 60°C for 30 s). The miRNAs expression levels were measured using the Ct (cycle threshold) values and calculated using the comparative (2–∆∆Ct) method (fold change (FC)). U6 small nuclear RNA (U6snRNA) was used as an internal control to normalize miRNA expression.

Statistical analysis

To analyze the miRNAs’ fold change in expression in the vaccinated mice compared to the

Table II. Sequences of forward primers used to evaluate the expression of microRNAs

miRNAs

Sequences

miR-27a 5´-CCG TTCACAGTGGCTA- 3´ miR-30c 5´-CGTGGTGTGTAAACATCC T- 3´ miR-191 5´-CAACGGAACCCAAAAG- 3´ mmu-U6 5´-AGATTTAACAAAAATTCGTC- 3´

The effect of PCSK9 immunization on the hepatic level of microRNAs associated with the PCSK9/LDLR pathway

Figure 1. Schematic diagram of immunization with the vaccine and tissue sampling schedule

Sacrificing mice and tissue sampling Immunization with the vaccine

control group, a relative expression software tool (REST) was employed. Results are presented as mean ± SE, and p-values of less than 0.05 were considered significant.

Results

Hepatic miRNA expression levels in albino mice treated with the PCSK9 peptide vaccine

We evaluated the hepatic expression of miR27a, miR-30c, and miR-191 in vaccinated mice compared to the control group and found that there was a significantly lower hepatic expression level of miR-27a in the vaccinated mice compared to the control mice (FC: 0.731 ±0.1, p = 0.027). Moreover, there was a borderline significantly lower hepatic expression level of miR-30c in the vaccinated mice compared to the control group (Fc: 0.569 ±0.1, p = 0.078). However, no significant difference was detected in the hepatic expression level of miR-191 between the vaccinated and control mice (FC: 0.852 ±0.1, p = 0.343) (Figure 2).

Discussion

Considering the critical importance of PCSK9 inhibition in dyslipidemia management, it is necessary to identify the underlying controlling mechanisms in which PCSK9 is involved. Moreover, discovering the mechanism of action of its inhibitors is highly desirable. miRNAs, as critical endogenous regulators, have a vital role in regulating cholesterol homeostasis involving genes including LDLR, PCSK9, and LDL-C. Therefore, to better understand the mechanism underlying PCSK9 inhibitors, including the PCSK9 peptide vaccine, it is important to detect whether the vaccine can affect miRNAs involved in cholesterol homeostasis. Here we observed a significant reduction in hepatic expression level of miRNA-27a after four vaccinations with the PCSK9 peptide vaccine.

miRNAs have been identified as players in the regulation of lipid homeostasis by a growing number of studies [25–30]. Several studies have

demonstrated dysregulation of miRNA levels or miRNA targeted sites in CVD [16], underlining the relevant role of miRNAs in atherosclerosis [21, 31]. It has been reported that miR-27a dysregulation is linked to a wide range of diseases, including metabolic syndrome [32] nonalcoholic fatty liver disease (NAFLD) [33], diabetes [32, 34, 35] obesity [36] and gestational hypercholesterolemia [37]. Recent studies suggest that miRNA-27a may be a potential novel drug target in atherosclerosis and lipid metabolism [21, 33, 38]. In a study, Choi et al. reported that LDLR is downregulated by miRNA-27a, and during hepatic differentiation, LDLR levels increase as miRNA-27a expression decreases [38]. Also, a study by Liu et al. demonstrated that miRNA-27a was induced by oxLDL, so that inhibition of PCSK9 repressed this induction, suggesting that PCSK9 could reciprocally induce miRNA-27a [33]. Moreover, Alvarez et al. showed that overexpressing miRNA-27a in HepG2 cells led to a 40% decrease in LDLR levels directly through binding to its untranslated regions and indirectly through a 3-fold increase in PCSK9, which enhances LDLR degradation [21]. In addition, they indicated that miR-27a also directly inhibits other members of the LDLR pathway, particularly LRP6 and LDLRAP1, which are essential for endocytosis of the LDLR-LDL-C complex in the liver [21]. They also reported a 70% increase in the levels of LDLR and a 50% decrease in PCSK9 by inhibition of miRNA-27a using a specific LNA antisense oligonucleotide. Furthermore, they found a 50% decrease in miRNA-27a levels in HepG2 treated with Bay-11, an inhibitor of nuclear factor κB (NF-κB), indicating that NF-κB upregulates hepatic miRNA27a, which may contribute to increasing LDL-C in NAFLD and atherosclerosis [21]. They also found that simvastatin, a well-known LDL-lowering drug, caused a dose-response increase in the miRNA-27a levels in HepG2 cells. Because miRNA-27a reduces LDLR levels while increasing PCSK9 levels, miRNA-27a upregulation might limit this drug’s effectiveness [21]. However, the PCSK9 peptide vaccine we developed, unlike simvastatin, could significantly reduce the hepatic expression of miRNA-27a in albino mice. This reduction of miRNA-27a can represent the anti-atherosclerotic and protective effects of this method of vaccination.

Thus, based on our findings, it is likely that the PCSK9 peptide vaccine helps manage LDL-C and atherosclerosis through the metabolic pathways in which miRNA-27a is involved, particularly the LDLR pathway [38–42]. Nevertheless, it may not work through pathways in which miRNA-30c and miRNA-191 are involved, including the pathway that reduces MTP activity and APOB secretion, leading to VLDL synthesis inhibition, regulated by miRNA-30c, and the pathway which leads to PCSK9 degradation regulated by miRNA-191, due

Sarina Ataei, Shiva Ganjali, Maciej Banach, Ehsan Karimi, Amirhossein Sahebkar

The effect of PCSK9 immunization on the hepatic level of microRNAs

to their non-significant differences between the vaccine and control groups. Since PCSK9 has also been proposed to be involved in pathways beyond LDL control [43–46], it would be interesting to explore if the altered levels of microRNAs mediate these pleiotropic actions.

To sum up, the results presented here provide an insight into the underlying mechanisms of the PCSK9 peptide vaccine and further evidence supporting the potential of the PCSK9 peptide vaccine as a therapeutic method of vaccination against atherosclerosis.

Acknowledgments

This study was supported by the Mashhad University of Medical Sciences, Mashhad, Iran.

Conflict of interest

M.B. speakers’ bureau: Amgen, Esperion, Herbapol, Kogen, KRKA, NovoNordisk, Novartis, Polpharma, Sanofi, Servier, Teva, Viatris, and Zentiva; consultant to: Amgen, Daichii Sankyo, Esperion, Freia Pharmaceuticals, Polfarmex, and Sanofi; grants from Amgen, Viatris, Sanofi, and Valeant. All other authors have nothing to disclose.

References

1. Roth GA, Mensah GA, Johnson CO, et al.; GBD-NHLBIJACC Global Burden of Cardiovascular Diseases Writing Group. Global burden of cardiovascular diseases and risk factors, 1990-2019: update from the GBD 2019 study. J Am Coll Cardiol 2020; 76: 2982-3021.

2. Banach M, Burchardt P, Chlebus K, et al. PoLA/CFPiP/ PCS/PSLD/PSD/PSH guidelines on diagnosis and therapy of lipid disorders in Poland 2021. Arch Med Sci 2021; 17: 1447-547.

3. Yusuf S, Hawken S, Ôunpuu S, et al. Effect of potentially modifiable risk factors associated with myocardial infarction in 52 countries (the INTERHEART study): case-control study. Lancet 2004; 364: 937-52.

4. Horton JD, Cohen JC, Hobbs HH. Molecular biology of PCSK9: its role in LDL metabolism. Trends Biochem Sci 2007; 32: 71-7.

5. Warden BA, Fazio S, Shapiro MD. The PCSK9 revolution: current status, controversies, and future directions. Trends Cardiovasc Med 2020; 30: 179-85.

6. Sahebkar A, Watts GF. New therapies targeting apoB metabolism for high-risk patients with inherited dyslipidaemias: what can the clinician expect? Cardiovasc Drugs Therapy 2013; 27: 559-67.

7. Sahebkar A, Watts GF. New LDL-cholesterol lowering therapies: pharmacology, clinical trials, and relevance to acute coronary syndromes. Clin Therap 2013; 35: 1082-98.

8. Sahebkar A, Momtazi-Borojeni AA, Banach M. PCSK9 vaccine: so near, yet so far! Eur Heart J 2021; 42: 4007-10.

9. Momtazi-Borojeni AA, Jaafari MR, Badiee A, Sahebkar A. Long-term generation of antiPCSK9 antibody using a nanoliposome-based vaccine delivery system. Atherosclerosis 2019; 283: 69-78.

10. Momtazi-Borojeni AA, Jaafari MR, Badiee A, Banach M, Sahebkar A. Therapeutic effect of nanoliposomal PCSK9

vaccine in a mouse model of atherosclerosis. BMC Med 2019; 17: 1-15.

11. Momtazi-Borojeni AA, Nik ME, Jaafari MR, Banach M, Sahebkar A. Effects of immunization against PCSK9 in an experimental model of breast cancer. Arch Med Sci 2019; 15: 570-9.

12. Momtazi-Borojeni AA, Jaafari MR, Banach M, Gorabi AM, Sahraei H, Sahebkar A. Pre-clinical evaluation of the nanoliposomal antiPCSK9 vaccine in healthy human primates. Vaccines 2021; 9: 749.

13. Momtazi-Borojeni A, Jaafari M, Abdollahi E, Banach M, Sahebkar A. P704 Nanoliposomal anti-PCSK9 vaccine ameliorates glucose intolerance and insulin resistance in diabetic rats. Eur Heart J 2019; 40 (Suppl 1): ehz747. 0309.

14. Momtazi-Borojeni AA, Nik ME, Jaafari MR, Banach M, Sahebkar A. Effects of immunisation against PCSK9 in mice bearing melanoma. Arch Med Sci 2020; 16: 189-99.

15. Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell 2009; 136: 215-33.

16. Ambros V. The functions of animal microRNAs. Nature 2004; 431: 350-5.

17. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 116: 281-97.

18. Fernández-Tussy P, Ruz-Maldonado I, Fernández-Hernando C. MicroRNAs and circular RNAs in lipoprotein metabolism. Curr Atheroscler Rep 2021; 23: 1-11.

19. Jeon TI, Osborne TF. miRNA and cholesterol homeostasis. Biochim Biophys Acta 2016; 1861: 2041-6.

20. Ng R, Wu H, Xiao H, et al. Inhibition of microRNA-24 expression in liver prevents hepatic lipid accumulation and hyperlipidemia. Hepatology 2014; 60: 554-64.

21. Alvarez ML, Khosroheidari M, Eddy E, Done SC. MicroRNA-27a decreases the level and efficiency of the LDL receptor and contributes to the dysregulation of cholesterol homeostasis. Atherosclerosis 2015; 242: 595-604.

22. Naeli P, Mirzadeh Azad F, Malakootian M, Seidah NG, Mowla SJ. Post-transcriptional regulation of PCSK9 by miR-191, miR-222, and miR-224. Front Genet 2017; 8: 189.

23. Soh J, Iqbal J, Queiroz J, Fernandez-Hernando C, Hussain MM. MicroRNA-30c reduces hyperlipidemia and atherosclerosis in mice by decreasing lipid synthesis and lipoprotein secretion. Nat Med 2013; 19: 892-900.

24. Slingluff CL, Yamshchikov G, Neese P, et al. Phase I trial of a melanoma vaccine with gp100280–288 peptide and tetanus helper peptide in adjuvant: immunologic and clinical outcomes. Clin Cancer Res 2001; 7: 3012-24.

25. Esau C, Davis S, Murray SF, et al. miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metabol 2006; 3: 87-98.

26. Iliopoulos D, Drosatos K, Hiyama Y, Goldberg IJ, Zannis VI. MicroRNA-370 controls the expression of MicroRNA-122 and Cpt1a and affects lipid metabolism. J Lipid Res 2010; 51: 1513-23.

27. Najafi-Shoushtari SH, Kristo F, Li Y, et al. MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science 2010; 328: 1566-9.

28. Khan AA, Gupta V, Mahapatra NR. Key regulatory miRNAs in lipid homeostasis: implications for cardiometabolic diseases and development of novel therapeutics. Drug Discov Today 2022; 27: 2170-80.

29. Zhang M, Wu JF, Chen WJ, et al. MicroRNA-27a/b regulates cellular cholesterol efflux, influx and esterification/hydrolysis in THP-1 macrophages. Atherosclerosis 2014; 234: 54-64.

30. Vickers KC, Shoucri BM, Levin MG, et al. MicroRNA-27b is a regulatory hub in lipid metabolism and is altered in dyslipidemia. Hepatology 2013; 57: 533-42.

the PCSK9/LDLR pathway Arch Med Sci 1, 1st January / 2023

associated with

31. Fernández-Hernando C, Suárez Y, Rayner KJ, Moore KJ. MicroRNAs in lipid metabolism. Curr Opin Lipidol 2011; 22: 86-92.

32. Karolina DS, Tavintharan S, Armugam A, et al. Circulating miRNA profiles in patients with metabolic syndrome. J Clin Endocrinol Metabol 2012; 97: E2271-6.

33. Alisi A, Da Sacco L, Bruscalupi G, et al. Mirnome analysis reveals novel molecular determinants in the pathogenesis of diet-induced nonalcoholic fatty liver disease. Labor Investig 2011; 91: 283-93.

34. Nielsen LB, Wang C, Sørensen K, et al. Circulating levels of microRNA from children with newly diagnosed type 1 diabetes and healthy controls: evidence that miR-25 associates to residual beta-cell function and glycaemic control during disease progression. Exp Diabetes Res 2012; 2012: 896362.

35. Herrera B, Lockstone H, Taylor J, et al. Global microRNA expression profiles in insulin target tissues in a spontaneous rat model of type 2 diabetes. Diabetologia 2010; 53: 1099-109.

36. Xie H, Sun L, Lodish HF. Targeting microRNAs in obesity. Expert Opin Ther Targets 2009; 13: 1227-38.

37. Dumolt JH, Ma M, Mathew J, Patel MS, Rideout TC. Gestational hypercholesterolemia alters fetal hepatic lipid metabolism and microRNA expression in Apo-E-deficient mice. Am J Physiol Endocrinol Metabol 2019; 317: E831-8.

38. Choi JE, Hur W, Kim JH, et al. MicroRNA-27a modulates HCV infection in differentiated hepatocyte-like cells from adipose tissue-derived mesenchymal stem cells. PLoS One 2014; 9: e91958.

39. Banach M, López-Sendon JL, Averna M, et al. Treatment adherence and effect of concurrent statin intensity on the efficacy and safety of alirocumab in a real-life setting: results from ODYSSEY APPRISE. Arch Med Sci 2021; 18: 285-92.

40. Lyall DM, Ward J, Banach M, et al. PCSK9 genetic variants and cognitive abilities: a large-scale Mendelian randomization study. Arch Med Sci 2021; 17: 241-4.

41. Momtazi-Borojeni AA, Jaafari MR, Afshar M, Banach M, Sahebkar A. PCSK9 immunization using nanoliposomes: preventive efficacy against hypercholesterolemia and atherosclerosis. Arch Med Sci 2021; 17: 1365-77.

42. Keshavarz R, Aghaee-Bakhtiari SH, Pakzad P, Banach M, Sahebkar A. Evaluation of miRNA-27a/b expression in patients with familial hypercholesterolemia. Arch Med Sci 2022. doi:10.5114/aoms/150500.

43. Momtazi AA, Banach M, Pirro M, Stein EA, Sahebkar A. PCSK9 and diabetes: is there a link? Drug Discov Today 2017; 22: 883-95.

44. Momtazi-Borojeni AA, Sabouri-Rad S, Gotto AM, et al. PCSK9 and inflammation: a review of experimental and clinical evidence. Eur Heart J Cardiovasc Pharmacother 2019; 5: 237-45.

45. Mahboobnia K, Pirro M, Marini E, et al. PCSK9 and cancer: rethinking the link. Biomed Pharmacother 2021; 140: 111758.

46. Jamialahmadi T, Panahi Y, Safarpour MA, et al. Association of serum PCSK9 levels with antibiotic resistance and severity of disease in patients with bacterial infections admitted to intensive care units. J Clin Med 2019; 8: 1742.

Sarina Ataei, Shiva Ganjali, Maciej Banach, Ehsan Karimi, Amirhossein Sahebkar

1Department of Food Science, College of Agriculture, National Pingtung University of Science and Technology, Neipu Township, Pingtung County, Taiwan

2Cardiovascular Center, Kaohsiung Veterans General Hospital, Kaohsiung City, Zuoying District, Taiwan

3Department of Medical Research, Chi-Mei Medical Center, Tainan City, Yongkang District, Taiwan

Submitted: 25 April 2019; Accepted: 26 June 2019

Online publication: 26 July 2019

Arch Med Sci 2023; 19 (1): 209–215

DOI: https://doi.org/10.5114/aoms.2019.86938

Copyright © 2019 Termedia & Banach

Abstract

Introduction: Thymoquinone (TQ) is one of the principal bioactive ingredients proven to exhibit anti-diabetic effects. Recently, glucagon-like peptide-1 (GLP-1) has been found to be involved in antidiabetic effects in rats. The aim of this study was to evaluate the mediation of GLP-1 in the antidiabetic effect of TQ and to understand the possible mechanisms.

Material and methods: NCI-H716 cells and CHO-K1 cells were used to investigate the effects of TQ on GLP-1 secretion in vitro . In type 1 diabetic rats, the changes in plasma glucose and GLP-1 levels were evaluated with TQ treatment.

Results: The direct effect of TQ on imidazoline receptors (I-Rs) was identified in CHO-K1 cells overexpressing I-Rs. Additionally, in the intestinal NCI-H716 cells that may secrete GLP-1, TQ treatment enhanced GLP-1 secretion in a dose-dependent manner. However, these effects of TQ were reduced by ablation of I-Rs with siRNA in NCI-H716 cells. Moreover, these effects were inhibited by BU224, the imidazoline I2 receptor (I-2R) antagonist. In diabetic rats, TQ increased plasma GLP-1 levels, which were inhibited by BU224 treatment. Functionally, TQ-attenuated hyperglycemia is also evidenced through GLP-1 using pharmacological manipulations.

Conclusions: This report demonstrates that TQ may promote GLP-1 secretion through I-R activation to reduce hyperglycemia in type-1 diabetic rats.

Key words: thymoquinone, glucagon-like peptide-1, imidazoline receptor, BU224, sitagliptin.

Introduction

Thymoquinone (2-isopropyl-5-methyl-1,4-benzoquinone), generally abbreviated TQ, is one of the phytochemical ingredients in the seeds and volatile oil extract of Nigella sativa (known as black seed or black cumin) [1]. Thymoquinone is reportedly a safe nutrient, during oral intake to experimental animals [2]. Thymoquinone has been documented to elicit many effects [3], including immunomodulatory, anticancer, antidiabetic, antioxidant, anti-infertility and anti-inflammatory activities, as well as protection of the liver, heart and nervous systems. Diabetes mellitus (DM) as one of the metabolic disorders, is characterized by hyperglycemia, probably due to pancreatic dysfunction, insulin resistance, or both [4].

Corresponding authors: Corresponding authors: Juei-Tang Cheng Department of Medical Research Chi-Mei Medical Center Tainan 71004, Taiwan E-mail: jtcheng5503@gmail. com

Ming Chang Wu Department of Food Science College of Agriculture National Pingtung University of Science and Technology Pingtung 91201, Taiwan e-mail: globalizationwu@ gmail.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Thymoquinone activates imidazoline receptor to enhance glucagon-like peptide-1 secretion in diabetic rats

Shu Ping Lee1, Feng Yu Kuo2, Juei-Tang Cheng3, Ming Chang Wu1

Clinically, the number of patients with DM has gradually increased worldwide, and the prevalence of DM has been predicted to reach 439 million people by 2030 [5]. Recently, incretin therapy has been widely used in DM treatment [6] and two strategies have been applied in clinics around the world: application of analogs of glucagon-like peptide-1 (GLP-1) and/or inhibitors of dipeptidyl peptidase-IV (DPP-4) that degrade GLP-1 rapidly to endogenous levels. However, the currently available drugs can have significant side effects and can also be quite expensive [7].

Thymoquinone is known to reduce hepatic glucose production in diabetic animals [8]. In clinics, black seed (black cumin) produced hypoglycemic and hypolipidemic effects in patients suffering from diabetes and other metabolic syndromes [9]. Thymoquinone has protective effects on the kidney and liver against target organ damage [10]. Therefore, development of TQ as a useful adjunct for DM appears clinically beneficial.

In clinics, metformin as a widely used antidiabetic drug has also been indicated to enhance plasma GLP-1 levels in healthy individuals and persons with type-2 diabetes [11, 12]. Further studies have indicated that metformin may activate the imidazoline receptors [13]. The imidazoline receptor activated by the natural product also reportedly results in attenuation of hyperglycemia in diabetic animals [14]. The chemical structure of TQ is similar to imidazolines. It appears possible that TQ may activate imidazoline receptors to enhance GLP-1 secretion. Therefore, it is of special interest to clarify the changes in GLP-1 levels in the face of TQ-induced hypoglycemic effects after the activation of imidazoline receptors.

Material and methods

Materials

Thymoquinone (purity > 98%) purchased from the Sigma-Aldrich Chemical Co. (St. Louis, MO, USA) and BU-224 purchased from Tocris Bioscience (Fisher Scientific, Leicestershire, UK) were dissolved in normal saline. Additionally, the present study also purchased NISCH cDNA ORF clone (Origene, Rockville, MD, USA), anti-β-actin antibody (Sigma-Aldrich, St. Louis, MO, USA), and antiNISCH antibody (Abcam, Cambridge, MA, USA).

Cell cultures

Human NCI-H716 cells (BCRC No. CCL-251) and CHO-K1 cells (BCRC No. CCL-61) were obtained from the Culture Collection and Research Center (BCRC) of the Food Industry Institute (Hsin-Chiu City, Taiwan). Cells subcultured every 3 to 4 days in medium containing 10% fetal bovine serum (FBS) were applied between passages 18 and 25 in the present study.

Transfection of NISCH in CHO-K1 cells

Nischarin is generally used as a functional imidazoline receptor because it is a mouse homolog of the human imidazoline receptor antisera-selective (IRAS) protein [15]. According to a previous report [16], an expression vector containing human NISCH cDNA (NISCH) (Myc-DDK-tagged human nischarin, NM_007184; Origene Technologies, Inc., Rockville, MD, USA) was stably transfected into CHO-K1 cells using the TurboFect transfection reagent (Thermo Fisher Scientific, Rockford, IL, USA). After 24 h of transfection, expression in cells was confirmed using Western blotting analysis (described below) and the cells were used to incubate with TQ for further experiments.

Western blotting analysis

The cells were lysed to extract the protein and thirty micrograms of the cell lysates were separated using 10% sodium dodecylsulfate polyacrylamide gel electrophoresis. Then, they were transferred to a polyvinyl difluoride membrane. After blocking with 10% skim milk for 1 h, the blots were developed with a primary antibody specific for NISCH. The secondary antibodies were then incubated with membranes for an additional 3 h. The mixed complexes were determined using an ECL kit (Thermo Fisher Scientific). Using a marker to verify specificity, immunoblots indicating NISCH (37 kDa) and β-actin (43 kDa) were obtained.

Estimation of intracellular calcium level

Intracellular calcium levels have been widely determined using the fluorescent probe fura-2 [14]. According to our previous report [17], NISCHCHO-K1 cells were maintained in physiological saline solution (PSS). Fura-2 (5 mM) was added to 1 ml of the cell suspension (1 × 106 cells) to incubate at 37°C for 30 min in the dark. After addition of a testing substance of vehicle, the fluorescence was continuously recorded using a fluorescence spectrofluorometer (Hitachi F-2000). Values of [Ca2+]i were detected and the background in unloaded cells was subtracted from all measurements.

Silencing of imidazoline receptors in GLP-1 secreting cells

Following a previous report [18], a validated small interfering RNA (siRNA) targeting human nischarin (NISCH) was purchased from a commercial source (GE Healthcare Dharmacon, Inc. Lafayette, CO, USA). Pooled non-targeting siRNA was used as a negative control to distinguish the silencing from nonspecific effects. Lipofectamine 2000 (Thermo Fisher Scientific, Pittsburgh,

Shu Ping Lee, Feng Yu Kuo, Juei-Tang Cheng, Ming Chang Wu

PA, USA) was applied to transfect the siRNA into NCI-H716 cells. After 24 h of transfection, Western blotting analysis was then used to evaluate the success of this silencing before assays.

Evaluation of GLP-1 secretion in vitro

NCI-H716 cells were seeded in 24-well plates (5 × 105 cells per well) to incubate in assay medium (DMEM 1 g/l glucose supplemented with 1 mmol/l pyruvate, 1% PenStrep, 0.1 mmol/l, DPP-IV inhibitor) containing desired concentration of TQ at 37°C for 1 h. Supernatants were collected and centrifuged (1,500 g, 5 min) to remove floating cells and debris for GLP-1 measurement. The concentrations of GLP-1 in the supernatants were then measured using an ELISA kit (Millipore, Burlington, MS, USA).

Animals

Male Sprague-Dawley (SD) rats, weighing 250 to 280 g, were supplied from the National Laboratory Animal Center (Taipei, Taiwan). Before the experiments, all protocols were approved by the Institutional Animal Ethics Committee (105051901) in Chi-Mei Medical Center. All experiments conformed to the Guide for the Care and Use of Laboratory Animals, as well as the guidelines of the Animal Welfare Act. Animals under sodium pentobarbital (35 mg/kg, i.p.) anesthesia were used in the present study to reduce their suffering.

Induction of diabetic rats

To induce the model of type 1-like diabetes, overnight fasted rats were used to receive an intravenous injection of streptozotocin (STZ) at 65 mg/ kg. Success of the model was identified once they showed hyperglycemia, the plasma glucose level not less than 300 mg/dl measured from an automatic analyzer, in addition to polyuria and other diabetic features at 1 week later. The plasma insulin levels determined by a rat insulin ELISA kit (Mercodia, Uppsala, Sweden) were also extremely lowered in these rats. Then, experiments were started 2 weeks after the preparation of the diabetic model.

Determination of plasma GLP-1 levels in vivo

The plasma GLP-1 levels were estimated after the treatment with TQ at the desired dose. The treated fasting rats were received 2.5 g/kg of glucose by gavage as described previously [19]. Under anesthesia with sodium pentobarbital (35 mg/ kg, i.p.), at 30 min following glucose load, blood samples (about 300 ml) collected from the femoral artery were kept in Eppendorf tubes containing EDTA and DPP-IV inhibitor (10 μl; Millipore). Blood

samples were centrifuged at 1500 g for 10 min and the GLP-1 levels in plasma were then estimated using an ELISA kit (Millipore).

Changes of plasma glucose in diabetic rats that received TQ treatment

Diabetic rats received sitagliptin (10 mg/kg) daily through oral gavage to inhibit DPP-4 or the same volume of vehicle for 2 weeks. Then, TQ at the indicated dose was administered by intraperitoneal injection (i.p.) in overnight-fasted diabetic rats with or without pretreatment with sitagliptin. Additionally, varying doses of exendin 9-39 (Ex9-39; Sigma-Aldrich) were pretreated 30 min before the injection of TQ in diabetic rats with or without pretreatment with sitagliptin. Under anesthesia, blood samples were collected at 1 h after TQ administration. Then, plasma glucose levels were determined as above.

Statistical analysis

Data shown are the mean ± SEM from the sample number (n) in each group. Statistical analysis regarding the one-way analysis of variance (ANOVA), followed by Tukey’s post hoc comparison, was performed with the software SPSS 21. A  p-value of 0.05 or less was defined as significant.

Results

Direct effect of TQ on imidazoline receptors in cells

transfecting NISCH

The exogenous NISCH gene transfected into CHO-K1 cells following our previous method [17]

Figure 1. Direct effect of thymoquinone (TQ) on imidazoline receptors (I-Rs) in vitro. Western blotting analysis confirmed the success of I-R gene transfection in CHO-K1 cells. Dose-dependent elevations in cellular calcium concentrations induced by TQ in I-R-transfected CHO-K1 cells (NISCH-CHO-K1 Cells) were observed compared with cells transfected with empty vector (CHO-K1 Cells). Values (means ± SEM) were obtained from 8 independent experiments

Thymoquinone activates imidazoline receptor to enhance glucagon-like peptide-1 secretion in diabetic rats

was confirmed using Western blot and it is indicated in the upper section of Figure 1. The imidazoline receptor (I-R) expressed in NISCH-CHO-K1 cells is proven to be functional [17].

Then, the possible effects of TQ on I-Rs were investigated. In NISCH-CHO-K1 cells incubated with TQ, the intracellular calcium concentration was markedly elevated in a dose-dependent manner (Figure 1). However, similar changes induced by TQ treatment were not obtained in the original CHO-K1 cells that were not transfected with an exogenous I-R gene (Figure 1). Therefore, a direct effect of TQ on I-Rs could be determined.

TQ enhances GLP-1 secretion via imidazoline receptors in intestinal cells

Intestinal NCI-H716 cells have been widely used to evaluate GLP-1 secretion [20]. TQ enhanced GLP-1 secretion in NCI-H716 cells, as shown in Figure 2, and this effect of TQ was inhibited after silencing of the I-R gene, which dominated in NCI-H716 cells. Activation of I-Rs by TQ therefore enhanced GLP-1 secretion. Interestingly, this effect of TQ was also blocked by BU-224 pre-treatment in a dose-dependent manner (Figure 2).

Elevation of plasma GLP-1 levels by TQ in diabetic rats

In the type 1-like diabetic rats, TQ treatment induced an increase in the plasma GLP-1 levels in a dose-dependent manner (Figure 3). Moreover, BU-224 pre-treatment also dose-dependently reversed the TQ-induced changes in these diabetic rats (Figure 3). However, similar treatment with BU-224 only at the most effective dose (1 mg/kg)

did not influence the GLP-1 level in these diabetic rats compared with the vehicle-treated group (7.83 ±0.34 pg/ml vs. 7.24 ±0.65 pg/ml, p > 0.05, n = 8).

Functional identification of the effects

of TQ

on GLP-1 associated action in vivo

In type 1-like diabetic rats, TQ treatment may reduce the hyperglycemia in a dose-dependent manner (Figure 4). The plasma insulin levels in these diabetic rats (46.24 ±14.35 pmol/l, n = 8) were significantly different (p < 0.01) from those in normal rats (185.65 ±25.20 pmol/l, n = 8). TQ treatment at the most effective dose did not influence the plasma insulin levels in these diabetic rats (42.67 ±18.06 pmol/l, n = 8). Therefore, mediation of endogenous insulin in the effect of TQ seems negligible in the type-1 diabetic model. Additionally, hyperglycemia was reduced in these diabetic rats by sitagliptin treatment due to inhibition of DPP-4. The decrease in hyperglycemia by TQ was markedly potentiated by sitagliptin in these diabetic rats (Figure 4). Moreover, Ex9-39 treatment reversed the TQ-induced changes in these diabetic rats whether they received sitagliptin pre-treatment or not (Figure 4). However, Ex9-39 alone at the most effective dose did not influence the plasma glucose level in the diabetic rats compared with that in the vehicle-treated group (387.18 ±16.13 mg/dl vs. 394.53 ±17.68 mg/dl, n = 8, p > 0.05). Also, the same treatment with Ex9-39 did not modify the plasma glucose in diabetic rats treated with sitagliptin compared that in vehicle-treated rats receiving sitagliptin pre-treatment (342.53 ±16.44 mg/dl vs. 336.14 ±14.5 mg/dl, p > 0.05, n = 8).

Shu Ping Lee, Feng Yu Kuo, Juei-Tang Cheng, Ming Chang Wu

GLP-1 [pg/ml]

Thymoquinone – – 40 60 80 [mg/kg]

GLP-1 [pg/ml]

20 15 10 5 0

Thymoquinone – – 80 80 80 –[mg/kg] BU224 [mg/kg] – – – 0.5 1 1

Figure 3. Effects of thymoquinone (TQ) on plasma GLP-1 levels in type 1-like diabetic rats. A – The plasma GLP-1 levels were reduced in diabetic rats (diabetes) as compared with the normal rats (first column) and administration of TQ at the indicated dose increased the plasma GLP-1 levels more markedly than in the vehicle-treated group (2nd column). B – BU-224 pretreatment inhibited the TQ-induced increase of plasma GLP-1 levels in diabetic rats. Diabetic rats were pretreated with BU-224 at the indicated dose for 30 min. Values are expressed as the mean ± SEM of 8 samples

*P < 0.05 compared with the vehicle-treated diabetic group. #P < 0.05 compared with the basal diabetic group without TQ treatment.

Plasma glucose [mg/dl]

20 15 10 5 0 450 360 270 180 90 0

Thymoquinone – 40 60 80 [mg/kg]

Plasma glucose [mg/dl]

500 400 300 200 100 0

Thymoquinone 80 80 80 80 [mg/kg] Ex9-39 [μg/kg] – 5 10 20

DM DM + sita

Figure 4. Effects of thymoquinone (TQ) treatment on plasma glucose levels in type 1-like diabetic rats. A – The plasma glucose levels were measured 1 h after administration of TQ at the indicated dose in diabetic rats that received vehicle treatment or sitagliptin (10 mg/kg per day orally) for 14 days. B – Exendin 9-39 treatment inhibits the TQ-induced reduction in hyperglycemia in diabetic rats that received vehicle or sitagliptin for 14 days. Animals were pretreated with exendin 9-39 at the indicated dose for 30 min. The values are expressed as the mean ± SEM of 8 samples

*P < 0.05 compared with the vehicle-treated diabetic group (each white column at same condition). #P < 0.05 compared with the vehicle-treated diabetic rats (first white column). †P < 0.05 compared with the diabetic rats that received sitagliptin treatment (first black column).

Discussion

Thymoquinone is the main active principle in the volatile oil of black seeds. TQ may reduce hepatic glucose production in diabetic hamsters [8] and abrogate the induction of STZ in a diabetic model [20]. The present study found that TQ might activate imidazoline receptors (I-Rs) to increase the plasma GLP-1 level in type-1 diabetic rats.

Initially, we characterized the direct effects of TQ on I-Rs using CHO-K1 cells that received a transient transfection of the I-R gene. Similar to the effect of another nutrient identified as an I-R agonist [14], TQ increased cellular calcium concentrations in cells that expressed the NISCH gene. Nischarin is known as a mouse homolog of human imidazoline receptor antisera-selective (IRAS) protein [21]. Human NISCH cDNA is widely used for

transfection because it may serve as a functional imidazoline receptor [15]. The effectiveness of TQ disappeared in CHO-K1-cells without I-R expression. TQ may therefore be associated with the activation of I-Rs. We have shown, for the first time, the direct activation of I-Rs by TQ in vitro.

Then, the effects of TQ on I-Rs were further identified in GLP-1 secreting cell line NCI-H716 cells in vitro [22]. We used siRNA specific for NISCH to silence I-Rs in NCI-H716 cells and identified the decrease in I-R expression using Western blotting analysis. A dose-dependent elevation in GLP-1 secretion by TQ was observed in control-siRNA transfected NCI-H716 cells that showed the presence of I-Rs. Interestingly, the effectiveness of TQ was abolished in NCI-H716 cells receiving siRNA specific for NISCH. Moreover, GLP-1-releasing effects of TQ were also blocked by BU-224, an imidazo-

Thymoquinone activates imidazoline receptor to enhance glucagon-like peptide-1 secretion in diabetic rats

line I-2 receptor antagonist, in a dose-dependent manner [14, 16]. The activation of I-2 receptors by TQ can thus be considered. It is the first time the stimulatory effect of TQ on GLP-1 secretion via I-R activation in vitro has been indicated.

Plasma insulin levels in type-1 diabetic rats were extremely low, to be considered negligible, as described in a previous report [23]. High-dose STZ treatment induces direct toxic effects on β cells to reduce the endogenous insulin production [24]. The plasma insulin levels were not modified by TQ treatment in the present study. Therefore, the reduction of hyperglycemia by TQ through endogenous insulin appears unlikely. It is consistent with our previous findings [25]. Activation of the TGR5 receptor by another chemical such as glycyrrhizic acid may exhibit the same effects.

GLP-1 is involved in plasma glucose homeostasis [26]. The type-1 diabetic rats without the role of endogenous insulin [27] were applied to evaluate the in vivo effects of TQ. Similar to the effect on the cell model, TQ treatment increased the plasma GLP-1 levels in these diabetic rats in a dose-dependent manner. Interestingly, BU-224 pretreatment reversed the effect of TQ in these diabetic rats, indicating the mediation of I-2 receptor activation. Moreover, reduction of hyperglycemia by TQ treatment was potentiated in diabetic rats receiving sitagliptin at a dose sufficient to inhibit DPP-4 [28]. It is similar to that induced by activation of TGR5 [25]. Additionally, blockade of GLP-1 receptor using Ex9-39 [29] also diminished the effects of TQ on hyperglycemia in diabetic rats that received sitagliptin and those that did not. Therefore, GLP-1 is identified to be involved in the reduction of hyperglycemia by TQ. Moreover, these effects of TQ were also reversed by BU-224 pre-treatment at doses sufficient to block I-2 receptors. Therefore, TQ may activate I-Rs to enhance GLP-1 secretion for attenuation of hyperglycemia in type-1 diabetic rats. It shows a new potential for TQ-induced reduction of hyperglycemia.

Furthermore, GLP-1 has been reported to delay diabetes induction in animal models [30]. This is similar to a previous report that TQ can prevent STZ-induced diabetic model establishment [31]. Endogenous glucose production was directly inhibited by GLP-1 in humans [32]. Agonist(s) of GLP-1 were therefore suggested as adjunctive therapies for patients with type-1 diabetes (T1DM) [33]. Regarding the mechanism(s) underlying GLP-1-induced hypoglycemia in T1DM, an acute effect on gastric emptying and an effect on glucagon suppression were suggested [34]. Therefore, insulinotropic effects of GLP-1 through receptor activation and the insulin mimetic functions independent of receptors could be considered [35]. This is consistent with the extrapancreatic effects of GLP-1 [36].

However, a direct effect of TQ on glucose homeostasis (shall be concerned) for the reduction of hyperglycemia. Moreover, discovery of new agents as I-R agonists [17] would be a promising direction for diabetes treatment in the future.

In conclusion, all considered, we suggest that TQ treatment may enhance plasma GLP-1 levels via I-R activation in type-1 diabetic rats. Therefore, TQ could have exciting future clinical applications.

Conflict of interest

The authors declare no conflict of interest.

References

1. Goyal SN, Prajapati CP, Gore PR, et al. Therapeutic potential and pharmaceutical development of thymoquinone: a multitargeted molecule of natural origin. Front Pharmacol 2017; 8: 656.

2. Al-Ali A, Alkhawajah AA, Randhawa MA, Shaikh NA. Oral and intraperitoneal LD50 of thymoquinone, an active principle of Nigella sativa, in mice and rats. J Ayub Med Coll Abbottabad 2008; 20: 25-7.

3. Khan MA, Chen HC, Tania M, Zhang DZ. Anticancer activities of Nigella sativa (black cumin). Afr J Tradit Complement Altern Med 2011; 8 (5 Suppl): 226-32.

4. American Diabetes A. Diagnosis and classification of diabetes mellitus. Diabetes Care 2012; 35 Suppl 1: S64-71.

5. Shaw JE, Sicree RA, Zimmet PZ. Global estimates of the prevalence of diabetes for 2010 and 2030. Diabetes Res Clin Pract 2010; 87: 4-14.

6. Drucker DJ, Sherman SI, Gorelick FS, Bergenstal RM, Sherwin RS, Buse JB. Incretin-based therapies for the treatment of type 2 diabetes: evaluation of the risks and benefits. Diabetes Care 2010; 33: 428-33.

7. Giorgino F, Penfornis A, Pechtner V, Gentilella R, Corcos A. Adherence to antihyperglycemic medications and glucagon-like peptide 1-receptor agonists in type 2 diabetes: clinical consequences and strategies for improvement. Patient Prefer Adherence 2018; 12: 707-19.

8. Fararh KM, Shimizu Y, Shiina T, Nikami H, Ghanem MM, Takewaki T. Thymoquinone reduces hepatic glucose production in diabetic hamsters. Res Vet Sci 2005; 79: 219-23.

9. Tavakkoli A, Mahdian V, Razavi BM, Hosseinzadeh H. Review on clinical trials of black seed (Nigella sativa) and its active constituent, thymoquinone. J Pharmacopuncture 2017; 20: 179-93.

10. Farag MM, Ahmed GO, Shehata RR, Kazem AH. Thymoquinone improves the kidney and liver changes induced by chronic cyclosporine A treatment and acute renal ischaemia/reperfusion in rats. J Pharm Pharmacol 2015; 67: 731-9.

11. Zander M, Taskiran M, Toft-Nielsen MB, Madsbad S, Holst JJ. Additive glucose-lowering effects of glucagon-like peptide-1 and metformin in type 2 diabetes. Diabetes Care 2001; 24: 720-5.

12. Cho YM, Kieffer TJ. New aspects of an old drug: metformin as a glucagon-like peptide 1 (GLP-1) enhancer and sensitiser. Diabetologia 2011; 54: 219-22.

13. Lee JP, Chen W, Wu HT, Lin KC, Cheng JT. Metformin can activate imidazoline I-2 receptors to lower plasma glucose in type 1-like diabetic rats. Horm Metab Res 2011; 43: 26-30.

Shu Ping Lee, Feng Yu Kuo, Juei-Tang Cheng, Ming Chang Wu

Thymoquinone activates imidazoline receptor to enhance glucagon-like peptide-1 secretion in diabetic rats

14. Hwang SL, Liu IM, Tzeng TF, Cheng JT. Activation of imidazoline receptors in adrenal gland to lower plasma glucose in streptozotocin-induced diabetic rats. Diabetologia 2005; 48: 767-75.

15. Zhang J, Abdel-Rahman AA. Nischarin as a functional imidazoline (I1) receptor. FEBS Lett 2006; 580: 3070-4.

16. Yang TT, Niu HS, Chen LJ, Ku PM, Lin KC, Cheng JT. Canavanine induces insulin release via activation of imidazoline I3 receptors. Clin Exp Pharmacol Physiol 2015; 42: 263-8.

17. Hsu CC, Lin MH, Cheng JT, Wu MC. Diosmin, a citrus nutrient, activates imidazoline receptors to alleviate blood glucose and lipids in type 1-like diabetic rats. Nutrients 2017; 9: pii: E684. doi: 10.3390/nu9070684.

18. Lin MH, Hsu CC, Lin J, Cheng JT, Wu MC. Investigation of morin-induced insulin secretion in cultured pancreatic cells. Clin Exp Pharmacol Physiol 2017; 44: 1254-62.

19. Liu C, Zhang M, Hu MY, et al. Increased glucagon-like peptide-1 secretion may be involved in antidiabetic effects of ginsenosides. J End 2013; 217: 185-96.

20. El-Mahmoudy A, Shimizu Y, Shiina T, Matsuyama H, ElSayed M, Takewaki T. Successful abrogation by thymoquinone against induction of diabetes mellitus with streptozotocin via nitric oxide inhibitory mechanism. Int Immunopharmacol 2005; 5: 195-207.

21. Alahari SK, Lee JW, Juliano RL. Nischarin, a novel protein that interacts with the integrin alpha5 subunit and inhibits cell migration. J Cell Biol 2000; 151: 1141-54.

22. Lim GE, Huang GJ, Flora N, LeRoith D, Rhodes CJ, Brubaker PL. Insulin regulates glucagon-like peptide-1 secretion from the enteroendocrine L cell. Endocrinology 2009; 150: 580-91.

23. Cheng JT, Huang CC, Liu IM, Tzeng TF, Chang CJ. Novel mechanism for plasma glucose-lowering action of metformin in streptozotocin-induced diabetic rats. Diabetes 2006; 55: 819-25.

24. Qinna NA, Badwan AA. Impact of streptozotocin on altering normal glucose homeostasis during insulin testing in diabetic rats compared to normoglycemic rats. Drug Des Devel Ther 2015; 9: 2515-25.

25. Wang LY, Cheng KC, Li Y, Niu CS, Cheng JT, Niu HS. Glycyrrhizic acid increases glucagon like peptide-1 secretion via TGR5 activation in type 1-like diabetic rats. Biomed Pharmacother 2017; 95: 599-604.

26. Nadkarni P, Chepurny OG, Holz GG. Regulation of glucose homeostasis by GLP-1. Prog Mol Biol Transl Sci 2014; 121: 23-65.

27. Niu HS, Chang CH, Niu CS, Cheng JT, Lee KS. Erythropoietin ameliorates hyperglycemia in type 1-like diabetic rats. Drug Des Devel Ther 2016; 10: 1877-84.

28. Singh AK. Dipeptidyl peptidase-4 inhibitors: novel mechanism of actions. Indian J Endocrinol Metab 2014; 18: 753-9.

29. Aulinger BA, Bedorf A, Kutscherauer G, et al. Defining the role of GLP-1 in the enteroinsulinar axis in type 2 diabetes using DPP-4 inhibition and GLP-1 receptor blockade. Diabetes 2014; 63: 1079-92.

30. Zhang J, Tokui Y, Yamagata K, et al. Continuous stimulation of human glucagon-like peptide-1 (7-36) amide in a mouse model (NOD) delays onset of autoimmune type 1 diabetes. Diabetologia 2007; 50: 1900-9.

31. Abdelmeguid NE, Fakhoury R, Kamal SM, Al Wafai RJ. Effects of Nigella sativa and thymoquinone on biochemical and subcellular changes in pancreatic beta-cells of streptozotocin-induced diabetic rats. J Diabetes 2010; 2: 256-66.

32. Seghieri M, Rebelos E, Gastaldelli A, et al. Direct effect of GLP-1 infusion on endogenous glucose production in humans. Diabetologia 2013; 56: 156-61.

33. Harris K, Boland C, Meade L, Battise D. Adjunctive therapy for glucose control in patients with type 1 diabetes. Diabetes Metab Syndr Obes 2018; 11: 159-73.

34. Marathe CS, Rayner CK, Jones KL, Horowitz M. Effects of GLP-1 and incretin-based therapies on gastrointestinal motor function. Exp Diabetes Res 2011; 2011: 279530.

35. Gallwitz B. Preclinical and clinical data on extraglycemic effects of GLP-1 receptor agonists. Rev Diabet Stud 2009; 6: 247-59.

36. Seufert J, Gallwitz B. The extra-pancreatic effects of GLP-1 receptor agonists: a focus on the cardiovascular, gastrointestinal and central nervous systems. Diabetes Obes Metab 2014; 16: 673-88.

Experimental research Cardiology

The direct effect of lipopolysaccharide on an isolated heart is different from the effect on cardiac myocytes in vitro

1Department of Food Science, College of Agriculture, National Pingtung University of Science and Technology, Pingtung, Taiwan

2Cardiovascular Centre, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan

3Department of Medical Research, Chi-Mei Medical Centre, Tainan, Taiwan

4Institute of Medical Science, College of Health Science, Chang Jung Christian University, Tainan, Taiwan

Submitted: 18 May 2019; Accepted: 4 July 2019

Online publication: 2 August 2019

Arch Med Sci 2023; 19 (1): 216–228

DOI: https://doi.org/10.5114/aoms.2019.86976

Copyright © 2019 Termedia & Banach

Abstract

Introduction: Lipopolysaccharide (LPS) is widely used to induce experimental animals. However, its effects on cardiac contraction is controversial. Although LPS probably induces its influence in vivo both directly and indirectly, we focused on the direct effects of LPS in this report.

Material and methods: Isolated ventricular myocytes mounted on a Langendorff apparatus were perfused with LPS. The changes in cultured H9c2 cells incubated with LPS over a 3-h exposure were compared with the changes after a 24-h incubation. Apoptosis was identified using flow cytometry and Western blotting. The mRNA levels were also determined.

Results: LPS directly stimulated cardiac contractility at low doses, although it produced inhibition at higher doses. The TLR4-coupled JAK2/STAT3 pathway was identified in H9c2 cells after LPS treatment, with an increase in intracellular calcium levels. LPS dose-dependently activated hypertrophic signals in H9c2 cells and induced apoptosis at the high dose. However, apoptosis was observed in H9c2 cells after a 24-h exposure to LPS, even at low doses. This observation appears to be associated with the level of paracrine cytokines. Changes in H9c2 cells by LPS were diminished by NPS2390, an inhibitor of the calcium-sensing receptor (CaSR). LPS also promoted CaSR mRNA expression in H9c2 cells, which may be unrelated to the changes in cytokine expression influenced by an inflammasome inhibitor.

Conclusions: In contrast to the isolated hearts, LPS activated hypertrophic signals prior to apoptotic signals in cardiac cells. Thus, LPS injury appears to be associated with CaSR, which was not markedly influenced by an inflammasome inhibitor.

Key words: lipopolysaccharide, cardiac contractility, Langendorff apparatus, Toll-like receptor 4, JAK/STAT pathway.

Introduction

Lipopolysaccharide (LPS) from the outer membrane of bacteria is the primary trigger of the systemic inflammatory response in sepsis [1]. LPS could mediate several inflammatory responses during sepsis and septic cardiomyopathy [2, 3] and may participate in the contractile dysfunction

Corresponding authors: Juei-Tang Cheng Department of Medical Research Chi-Mei Medical Centre Tainan 71004, Taiwan E-mail: jtcheng5503@gmail. com

Ming Chang Wu Department of Food Science College of Agriculture National Pingtung University of Science and Technology Pingtung 91201, Taiwan E-mail: globalizationwu@ gmail.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Feng Yu Kuo1,2, Shu Ping Lee1, Juei-Tang Cheng3,4, Ming Chang Wu1

The direct effect of lipopolysaccharide on an isolated heart is different from the effect on cardiac myocytes in vitro

observed in chronic heart failure [4–6]. Prolonged exposure (over 24 h) of adult rat ventricular myocytes to a mixture of LPS and inflammatory cytokines inhibited cell contractility [7]. Interestingly, LPS at a low concentration increased sarcomere shortening, shortening velocity, and relaxation velocity in cardiac myocytes [7]. Therefore, the divergent effects of LPS have also been characterised in ventricular myocytes isolated from adult rats.

Toll-like receptor 4 (TLR4) is required for cardiac myocyte impairment during endotoxaemia [8], and TLR4 is known as an LPS binding site [9]. Additionally, the Janus-activated kinase 2 (JAK2) and signal transducer and activator of transcription3 (STAT3) pathway (JAK2/STAT3 pathway) are coupled to signalling through cytokine receptors including TLR4 [10]. Interestingly, an agent was discovered that improves left ventricular performance via activation of the JAK2/STAT3 pathway in rats [11]. LPS-induced cardiac contraction has also been observed in dogs [12] and calves [13]. The LPS-induced alterations in cardiac function in mice are indicated to be due to altered loading conditions but not to reduced contractility, which may instead be slightly increased [14].

The effects of LPS on cardiac performance were shown to have two patterns in vitro, resulting in enhanced performance at low concentrations and inhibited performance at high concentrations [7]. Therefore, understanding the variations in LPS-induced cardiac injury in detail is of interest.

In the present study, we investigated the direct effects of LPS on the cardiac contractility of isolated ventricular myocytes using a Langendorff apparatus. Changes in the relevant signalling pathways were also characterised in H9c2 cells exposed to LPS.

Material and methods

Material

Lipopolysaccharide from Escherichia coli 0111: B4 was purchased from Sigma-Aldrich (St Louis, MO, USA). The fluorescent probe fura-2 was from Molecular Probes (Eugene, OR, USA). Antibodies to cardiac contractile protein myosin light chain 2 (MLC2) and phospho-myosin light chain 2 (pMLC2) (p-Ser19) were purchased from Thermo Fisher Scientific (Waltham, MA, USA).

Experimental animals

Male Sprague-Dawley (SD) rats weighing 250 to 280 g were obtained from the National Laboratory Animal Centre (Taipei, Taiwan). They were housed individually in plastic cages under standard laboratory conditions. The animals used in all the experiments were maintained under anaesthesia with sodium pentobarbital (35 mg/kg, i.p.)

to minimise suffering. The experimental protocols were approved by the Institutional Animal Ethics Committee (103101525) of Chi-Mei Medical Centre. All experiments conformed to the Guide for the Care and Use of Laboratory Animals as well as the guidelines of the Animal Welfare Act.

Langendorff apparatus for isolated heart determination

The experiments were performed according to our previous method [15]. Rats in each group were sacrificed under anaesthesia with 3% isoflurane, and their hearts were excised rapidly and rinsed by immersion in ice-cold Krebs-Henseleit buffer (KHB). The isolated ventricular myocytes mounted on the Langendorff apparatus were continuously perfused with warm (37°C) and oxygenated (95% O2, 5% CO2) KHB at a constant pressure of 70 mm Hg. The organ chamber temperature was maintained at 37°C during the experiment. A water-filled latex balloon was inserted through an incision in the left atrium into the left ventricle via the mitral valve and adjusted to a left-ventricular end-diastolic pressure (LVEDP) of 5–7 mm Hg during initial equilibrium. The distal end of the catheter was connected to the data acquisition system via a pressure transducer for continuous recording. The left-ventricular developed pressure (LVDP) was obtained from the difference between left-ventricular systolic pressure (LVSP) and LVEDP. Heart rates were monitored simultaneously. In each experiment, after a 30-min stabilisation with perfusion, the tested agent including LPS at the desired concentration was added into the KHB for further perfusion.

Cell culture

H9c2 cells (BCRC No. 60096), a cardiac myoblast cell line, were cultured following our previous method [16]. Briefly, H9c2 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, pH 7.2; GIBCO-BRL Life Technologies, Gaithersburg, MD, USA) supplemented with 10% foetal bovine serum. Cells were passaged every 3–4 days and subcultured when they reached 70–80% confluency. For H9c2 differentiation, cells were switched to differentiation medium (1% FBS-containing medium with 1 μM trans-retinoic acid, RA) for seven days as described previously [17]. After plating, the medium was replaced on the second day. The following day, the cells were incubated with LPS and/or inhibitors, as subsequently described.

Drug administration

In each experiment with the Langendorff apparatus, after 30 min of stabilisation with perfusion, the tested agent including LPS at the desired concentration was added to the solution for

further perfusion. Samples were pretreated with inhibitors for 10 min before perfusion with LPS. Cultured cells were pretreated with the specific inhibitors at the indicated doses for the desired time. Then, H9c2 cells were incubated with LPS at various doses for a 3-h or 24-h period, as described in each assay.

Measurement of changes in intracellular calcium levels

We measured intracellular calcium levels using fura-2, a fluorescent probe, as described previously [18]. Changes in fluorescence were recorded using a  fluorescence spectrofluorometer (F-2000; Hitachi, Tokyo, Japan). The intracellular calcium [Ca2+] i values were estimated according to our previous report [18]. Background autofluorescence obtained from untreated cells was subtracted from all measurements. Additionally, inhibitor effectiveness was assessed after a 30-min pretreatment.

Flow cytometry analysis

H9c2 apoptotic cell measurements were performed by flow cytometry with Annexin V-propidium iodide staining, as described previously (30), using a fluorescein isothiocyanate (FITC) apoptosis detection kit (BD Biosciences, San Diego, CA, USA). The Annexin reagent utilises Annexin V to detect phosphatidylserine on apoptotic cells and a dead cell marker as an indicator of membrane stability. H9c2 cells were seeded in a dish (10 cm) at a density of 1 × 106 cells/well, and the experimental procedure was performed according to the manufacturer’s protocol. Staining was analysed by fluorescence-activated cell sorting on a flow cytometer (NOVO Cyte 3000; ACEA Biosciences, San Diego, CA, USA). Spectral compensation and data quantification were performed using the NovoExpress software (2017 Version; ACEA Biosciences Inc., San Diego, CA, USA), which provides a variety of plots and gates for flow cytometry data analysis.

Determination of LDH release

LDH is a marker for remaining cells. To explore LPS-induced LDH release, H9c2 cell supernatants were collected for LDH determination in serum-free medium. LDH levels were measured in cell culture medium (20 μl) at different time points using a commercial kit (Biovision, Milpitas, CA, USA), as described previously [19]. The results were expressed as the percentage of total LDH activity (total LDH activity = LDH activity in the cell-free medium + LDH activity in the cell medium). Released LDH was calculated according to the following equation: LDH released (%) = (LDH activity in the serum-free medium/total LDH activity) × 100.

Real-time reverse transcription-polymerase chain reaction

Total RNA was isolated from H9c2 cardiomyocytes using TRIzol followed by chloroform extraction. The extracted messenger RNA (2 μg per sample) was reverse transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland), according to the manufacturer’s instructions.

Real-time quantitative polymerase chain reaction (RT-PCR, qPCR) was performed using SYBR Green (Roche) and mouse-specific primers on a LightCycler 480 system. The signal intensity was normalised to GAPDH. The primers used in this study are shown below.

TLR4 F: 5′-CATGGCATTGTTCCTTTCCT-3′ ; TLR4 R: 5′-CATGGAGCCTAATTCCCTGA-3′ ; ANP F: 5′-CACAGATCTGATGGATTTCAAGA-3′ ; ANP R: 5′-CCTCATCTTCTACCGGCATC-3′ ; BNP F: 5′-GTCAGTCGCTTGGGCTGT-3′ ; BNP R: 5′-CCAGAGCTGGGGAAAGAAG-3′ ; β-MHC F: 5′-CATCCCCAATGAGACGAAGT-3′ ; β-MHC R: 5′-GGGAAGCCCTTCCTACAGAT-3′ ; CaSR F: 5′-CCTGCTGGGACTTTTCTACATC-3′ ; CaSR R: 5′-TGTACTGGTTCTTATTGCTGAGGA-3′ ; IL6 F: 5′- GATGAGTACAAAAGTCCTGATCCA-3′ ; IL6 R: 5′- CTGCAGCCACTGGTTCTGT -3′ ; TNF-a F: 5′-CAGCCTCTTCTCCTTCCTGAT-3′ ; TNF-a R: 5′-GCCAGAGGGCTGATTAGAGA-3′ ; β-actin F: 5′-CTAAGGCCAACCGTGAAAAG-3′ ; β-actin R: 5′-GCCTGGATGGCTACGTACA-3′

Western blotting analysis

Total proteins (30 μg) were separated by SDS/ polyacrylamide gel electrophoresis (10% acrylamide gel) using the Bio-Rad Mini-Protein II System. Proteins were transferred to expanded polyvinylidene difluoride membranes (Pierce, Rockford, IL, USA). Following blocking, the membrane was probed with the primary antibodies. The blots were incubated with goat polyclonal antibody (1 : 1000) to bind actin, which served as the internal control. After removal of the primary antibody, the blots were incubated for 2 h at room temperature with the appropriate peroxidase-conjugated secondary antibody and then developed by autoradiography using an ECL-Western blotting system (Amersham International, Buckinghamshire, UK). The immunoblots for MLC2 (19 kDa) and phospho-MLC-2 (19 kDa) were quantified with a laser densitometer.

Statistical analysis

Results are presented as the means ± SEM of the sample number (n) for each group. Analysis of variance (ANOVA) was used to evaluate the significance of differences between multiple groups.

Feng Yu Kuo, Shu Ping Lee, Juei-Tang Cheng, Ming Chang Wu

The direct effect of lipopolysaccharide on an isolated heart is different from the effect on cardiac myocytes in vitro

Once significance was established between the groups, Tukey’s post hoc analysis was used. Values of p < 0.05 were considered significant.

Results

Effects of LPS on the contractility of isolated ventricular myocytes mounted on a Langendorff apparatus

The contractile functions in isolated hearts were increased after perfusion with LPS at 5 μg/ ml (2.3 ±0.3-fold) and 10 μg/ml (3.8 ±0.6-fold) compared with that in vehicle-treated controls. However, LPS at 30 μg/ml was shown to decrease the cardiac contractility (0.7 ±0.1-fold, Figure 1 A). Similarly, LPS at 5 μg/ml and 10 μg/ml enhanced the heart rate, while LPS at 30 μg/ml reduced the heart rate (Figure 1 B). The results indicated that LPS promotes cardiac contraction and beating at a low dose but attenuates heart functions at a higher dose.

Effects of LPS on the TLR4 signalling pathway in H9c2 cells

In an attempt to elucidate the signalling pathway of TLR4, H9c2 cells were directly incubated with LPS. Clear signals could be obtained only after 30 min of LPS exposure. Then, we compared the LPS-treated cells with the vehicle-treated controls. The representative responses of each signal determined from the Western blots are shown in Figure 2 A. Quantification of the changes in each signal is presented in Figures 2 B–D.

In line with the classically described signalling pathway, phosphorylated JAK2 and phosphorylated STAT3 were increased by treatment with 5 to 10 μg/ ml LPS in a dose-dependent manner (Figure 2 A). The quantified data also showed that activated JAK2 and activated STAT3 were increased by LPS treatment in the same manner (Figures 2 C, D). Interestingly, LPS promoted the expression of TLR4 (Figure 2 B) in a manner similar to the changes in

mRNA levels. Therefore, LPS may activate TLR4 to induce JAK2 and STAT3 signalling in cardiac myocytes.

However, LPS activated the established contractile protein myosin light chain-2 only at 5 μg/ml. As shown in Figures 2 A and E, levels of phosphorylated myosin light chain-2 were not increased by 10 μg/ml of LPS. This finding indicates that LPS could induce cardiac contraction in H9c2 cells only at 5 μg/ml.

Additionally, we also evaluated the changes in cellular calcium using a  fluorescent dye. In H9c2 cells, intracellular calcium levels were dose-dependently increased by 5 to 10 μg/ml LPS. We then investigated the effects of inhibitors specific for each signal on intracellular calcium levels. The calcium accumulation elicited by 5 μg/ml LPS was significantly reduced by each inhibitor. Interestingly, the attenuated levels after treatment with each inhibitor were similar, as shown in Figure 2 F.

LPS exerts time- and dose-dependent effects on cellular function in H9c2 cells

LPS is known to induce cardiac hypertrophy and apoptosis in the heart. We treated H9c2 cells with LPS at various concentrations for two different exposure times. First, H9c2 cells were incubated with 1, 5, and 10 μg/ml LPS for 3 h. Hypertrophic signals were dose-dependently increased by 1 to 5 μg/ml LPS (Table I). However, these signals were all attenuated by 10 μg/ml LPS. Additionally, apoptotic signals, as detected either by Western blot (Figure 3 A) or flow cytometry (Figure 3 B), were induced only by 10 μg/ml LPS. Thus, while a short exposure to a low concentration of LPS may promote hypertrophic signals in the heart, apoptotic signals were observed only when H9c2 cells were exposed to LPS for 24 h. As shown in Table I, hypertrophic signals were reduced by 24-h LPS exposure in a dose-dependent manner. Consequently, apoptotic signals were induced in both Western blot (Figure 3 C) and flow cytometry experiments (Figure 3 D) by 24-h LPS exposure at the same dose.

TLR4 P-JAK2 JAK2 P-STAT3 STAT3 P-MLC-2 MLC-2 LPS [μg/ml] – 5 10

C

1.0 0.8 0.6 0.4 0.2 0

E

P-MLC/MLC ratio

0.8 0.6 0.4 0.2 0

P-JAK2/JAK2 ratio – 5 10 LPS [μg/ml]

1.0 0.8 0.6 0.4 0.2 0

D

P-STAT3/STAT3 ratio

TLR4/actin ratio – 5 10 LPS [μg/ml]

F

Ca 2+ [nM/mg protein]

1.0 0.8 0.6 0.4 0.2 0

– 5 10 LPS [μg/ml]

500 400 300 200 100 0

– 5 10 LPS [μg/ml]

LPS 5 μg/ml

Control Vehicle GIT-27 AG490 Statitic (10 μg/ml) (2 × 10–5 M) (5 × 10–6 M)

Figure 2. Direct effects of LPS on the TLR4 signalling pathway in H9c2 cells. A – Representative pictures of Western blots, with each signal indicated. Quantified protein levels were calculated for TLR4 (B), JAK2 (C), and STAT3 (D). E – Changes in the cardiac contractile protein myosin light chain (MLC)-2 were compared. F – LPS (5 μg/ml) increased cellular calcium accumulation, which was suppressed by inhibitors including GIT-27, AG490, and Stattic at the indicated concentrations

*P < 0.05 and **p < 0.01 vs. the vehicle-treated control (first column). #P < 0.05 vs. another LPS-treated group (second column), n = 4.

The role of proinflammatory cytokines in the toxic effect of LPS on H9c2 cells The role of proinflammatory cytokines in apoptosis was investigated using H9c2 cells treated

with 24-h exposure to LPS. The expression of interleukin (IL)-6 (Figure 4 A), tumor necrosis factor a (TNF-a) (Figure 4 B), and calcium-sensing receptor (CaSR) (Figure 4 D), as well as LDH release (Figure 4 C), were upregulated by LPS at both

Feng Yu Kuo, Shu Ping Lee, Juei-Tang Cheng, Ming Chang Wu

Table I. Effects of LPS on hypertrophic biomarkers in H9c2 cells after a short (3 h) or longer (24 h) treatment time

Variable Control LPS (1 μg/ml) LPS (5 μg/ml) LPS (10 μg/ml)

Incubation for 3 h:

Relative mRNA of ANP/actin 1.00 ±0.00 1.16 ±0.02* 1.55 ±0.06**# 0.73 ±0.06#

Relative mRNA of BNP/actin 1.00 ±0.00 1.14 ±0.04* 1.46 ±0.02**# 0.82 ±0.02#

Relative mRNA of β -MHC/actin 1.00 ±0.00 1.19 ±0.02* 1.56 ±0.06**# 0.75 ±0.05#

Incubation for 24 h:

Relative mRNA of ANP/actin 1.00 ±0.00 0.81 ±0.03* 0.62 ±0.02**# 0.39 ±0.03**#

Relative mRNA of BNP/actin 1.00 ±0.00 0.85 ±0.02* 0.59 ±0.03**# 0.35 ±0.03**#

Relative mRNA of β -MHC/actin 1.00 ±0.00 0.84 ±0.03* 0.61 ±0.02**# 0.37 ±0.03**#

Each value (mean ± SEM) from 6 samples was compared with the vehicle-treated control. *P < 0.05 and **p < 0.01 vs. vehicle-treated control. #P < 0.05 vs. low-dose (1 μg/ml) LPS-treated group.

concentrations in a dose- and time-dependent manner. BAY11-7082, a potential inflammasome inhibitor, is an irreversible inhibitor of TNF-a-induced IκBa phosphorylation. In the presence of BAY11-7082, the time-dependent changes in IL-6 and TNF-a expression and LDH levels due to LPS at a higher concentration (5 μg/ml) were markedly decreased. However, CaSR expression was not markedly modified by BAY11-7082 in the same manner.

The role of calcium-sensing receptor in the toxic effect of LPS on H9c2 cells

CaSR is believed to regulate cardiac function. Therefore, we used NPS2390, a CaSR-specific inhibitor, to investigate the potential role of CaSR in the toxic effects of LPS.

A 3-h incubation with 10 μg/ml LPS can inhibit Bax and Bcl-2 expression levels in H9c2 cells. This effect was reversed by NPS2390 in a dose-dependent manner (Figure 5 A). Additionally, the apoptotic signals observed in Western blots were also reversed by GIT-27, AG490, and Stattic treatment (Figure 5 B). Moreover, the hypertrophic signals attenuated by 24 h of 5 μg/ml LPS exposure were also alleviated by NPS2390 at the same dose (Figure 5 C). Similarly, the apoptotic signals detected by Western blots were attenuated by GIT-27, AG490, and Stattic treatment (Figure 5 D). These findings indicate that the toxic effects of LPS were associated with CaSR in H9c2 cells.

We then evaluated CaSR gene expression in H9c2 cells. CaSR mRNA levels were increased by LPS in a dose-dependent manner and plateaued in cells incubated with LPS at a high dose for a short exposure time (10 μg/ml for 3 h) and at a low dose for a longer exposure time (5 μg/ml for 24 h). As shown in Table II, the inhibitors specific to each signal in the TLR4 pathway can attenuate the effects of LPS in the same manner. Therefore, we

found that LPS activated TLR4 to promote CaSR expression.

Discussion

In the present study, we demonstrated that the direct effect of LPS on isolated rat ventricular myocytes is markedly different from that on cardiac myocytes. Additionally, the effects of LPS on cardiac myocytes are associated with the treatment dose and related to the exposure time. The toxic effects of LPS on cardiac cells appear to be mainly mediated through proinflammatory cytokines and CaSR.

The present study focused on the effects of LPS alone, which are distinct from the changes that occur in animals or in clinical cases of sepsis; in those cases, the activation of endogenous inflammatory factors including cytokines and nitric oxide synthase 2 (NOS2) are involved [20]. The current study compared the changes after a 3-h exposure with those after a 24-h incubation. Among the acute effects after a 3-h exposure, low-dose LPS exposure activated hypertrophic signals in H9c2 cells in a dose-dependent manner, although apoptosis was also observed in cells exposed to the high dose of LPS. However, in H9c2 cells, apoptosis was only observed after a 24-h exposure to the low dose of LPS. This finding suggests a novel view that LPS activates hypertrophic signals prior to apoptotic signals in cardiac cells. The current finding is similar to the damage induced in cardiac myocytes by oxidants such as H2O2 [21] or potassium bromate [22], which induces cardiac hypertrophy at low doses but apoptosis at higher doses in vitro

In ventricular myocytes isolated from adult rats, perfusion with LPS induces cardiac stimulation, which has not been mentioned before, although it diverges from cardiac depression after LPS treatment [23]. Cardiac cells exposed directly to LPS and

The direct effect of lipopolysaccharide on an isolated heart is different from the effect on cardiac myocytes in vitro

Bcl2

Bax

Actin

Bcl2/Bax ratio

Control

LPS 5 μg/ml

Bcl2 Bax Actin

Bcl2/Bax ratio

2.5 2.0 1.5 1.0 0.5 0 3.0 2.5 2.0 1.5 1.0 0.5 0

0 1 5 10

LPS 1 μg/ml

LPS 10 μg/ml

LPS [μg/ml] 0 1 5 10

LPS [μg/ml]

Figure 3. Apoptosis induced by LPS in H9c2 cells. Western blot detection of apoptotic biomarkers that were promoted by LPS treatment at the indicated concentrations after a short (3 h) incubation (A) or longer (24 h) treatment (C). The upper panel shows the representative responses, and quantification of the levels is indicated in the last column. Additionally, apoptosis in H9c2 cells was characterised by flow cytometry after a short (3 h) incubation (B) or longer (24 h) treatment (D) with LPS at the indicated dose. The side-scatter intensity (vertical axis) is plotted against the fluorescence intensity in the APC channel (horizontal axis)

*P < 0.05 and **p < 0.01 vs. the vehicle-treated control (first column). #P < 0.05 and ##p < 0.01 vs. the low-dose LPS-treated group (second column), n = 4.

Feng Yu Kuo, Shu Ping Lee, Juei-Tang Cheng, Ming Chang Wu

Figure 3. Cont. Additionally, apoptosis in H9c2 cells was characterised by flow cytometry after a short (3 h) incubation (B) or longer (24 h) treatment (D) with LPS at the indicated dose. The side-scatter intensity (vertical axis) is plotted against the fluorescence intensity in the APC channel (horizontal axis) *P < 0.05 and **p < 0.01 vs. the vehicle-treated control (first column). #P < 0.05 and ##p < 0.01 vs. the low-dose LPS-treated group (second column), n = 4.

cytokines in vitro have shown decreased [24–28], unchanged [8], and increased [26, 29, 30] contractility. Possible reasons for these divergent results may be associated with the experimental conditions used. Some studies investigated the effects using exposure to LPS or inflammatory mediators at various times such as 5 min [25] and 4 h [8]. The results regarding the toxic effects of LPS are mostly obtained from acute influences. The exposure times appear insufficient to activate downstream enzymes, including nitric oxide synthase 2 (NOS2) [20], and may not accurately replicate the effects observed in vivo. Furthermore, LPS initiates a sequence of cellular events that leads to reversible or irreversible injury in cardiac myocytes [31, 32]. Impairment of intracellular calcium homeostasis, alterations in excitation-contraction coupling, and enhanced programmed cell death are thought to be involved [33, 34]. Therefore, the effects of LPS on cardiac myocytes seem variable [7].

In research focused on cardiac myocytes, primary rat neonatal cardiomyocytes and the rat-derived H9c2 cell line are widely applied because both are similar in vitro [33]. We used H9c2 cells in the present study to establish the signalling pathway regarding TLR4 coupled with JAK/STAT3 for LPS, which has not been mentioned before. Pharmacological inhibitors, such as GIT27 for TLR4

[35], Tyrphostin AG490 for JAK [36], and Stattic for STAT3 [37], were also characterised in H9c2 cells. Thus, these inhibitors could be used in research by others in the future. Although it has been documented that LPS may rapidly induce STAT3 phosphorylation in cardiac myocytes [38], we failed to repeat this finding and instead observed all the signals within 30 min.

LPS-induced cardiac impairment has been demonstrated primarily via TLR4 [22]. CaSR activation is involved in endotoxin rat myocardial cell injury and apoptosis induced by LPS [39]. Using the Langendorff system, hearts isolated from CaSR knock-out (KO) animals showed a significantly lower basal heart rate than that in wildtype animals [40]. Moreover, heart dysfunction was also observed in TLR4-deficient hearts [41]. In animals, LPS-induced cardiac hypertrophy has also been demonstrated [42] after the binding with TLR4 [22]. It would be interesting to find out why apoptosis is observed in H9c2 cells only after a 24-h exposure to LPS, even at the low dose. The inhibitory effects of LPS on cardiac function are mainly mediated by the production of proinflammatory cytokines, such as IL-6 and TNF-a [43, 44]. Paracrine actions from cardiac myocytes have been reported to play an important role in the production of proinflammatory cytokines, such as

The direct effect of lipopolysaccharide on an isolated heart is different from the effect on cardiac myocytes in vitro

LPS 5 μg/ml LPS 10 μg/ml

Relative mRNA IL-6/actin ratio

LDH release (fold change)

25 20 15 10 5 0 3 2 1 0

0 3 12 24 Time [h] 0 3 12 24 Time [h]

Relative mRNA TNFa /actin ratio

Relative mRNA CaSR/actin ratio

8 6 4 2 0 1.8 1.2 0.6 0

0 3 12 24 Time [h] 0 3 12 24 Time [h]

Control LPS 1 μg/ml LPS 5 μg/ml LPS 5 μg/ml + BAY11-7082

Figure 4. The role of proinflammatory cytokines in the toxic effects of LPS on H9c2 cells. Cells were treated with LPS (1 μg/ml or 5 μg/ml) or vehicle for 3, 12, and 24 h; cells were treated with or without BAY11-7082 (10 μmol/l) 30 mins before LPS (5 μg/ml) treatment. A – IL-6 mRNA expression, B – TNF-a mRNA expression, C – lactate dehydrogenase (LDH) release, D – CaSR mRNA expression

*P < 0.05 was compared between the 5 μg/ml LPS-treated group and the LPS (5 μg/ml), BAY11-7082-treated group, n = 6.

IL-6 and TNF-a [45]. In the present study, IL-6 and TNF-a mRNA levels were elevated with increased time of exposure to LPS. Cardiac injury also progressed in the same manner. It seems possible that cardiac injury induced by LPS is associated with inflammation. Moreover, TLR4-mediated activation of STAT3 increases IL-6 production, which induces secondary STAT3 activation through the IL-6/gp130/JAK2 pathway [46].

In the clinic, cytokine activation has been introduced as one of the mechanisms for the progression of heart failure [47]. Recently, pyroptosis has been acknowledged as one type of programmed cell death [48]. LPS may induce common pathways (such as free radical production) to activate the NLRP3 inflammasome and then trigger caspase-1-dependent pyroptosis [49]. Inflammasomes are intracellular multiprotein complexes with caspase-1-activating platforms that can be activated by LPS [50], and the role of the inflammasome in sepsis has been documented [51]. Therefore, LPS activates NLRP3 inflammasomes to aggravate H9C2 cells as stimuli for pyroptosis and the inflammatory response [52]. Similarly, we applied BAY11-7082 to inhibit the inflammasome. The progression of cardiac injury by LPS in H9c2 cells was reduced by BAY11-7082, indicating the

mediation of the inflammasome and/or pyroptosis. This new finding is a suitable explanation of why the effect of LPS progressed with time in H9c2 cells.

In the present study, we found that LPS promotes CaSR expression in H9c2 cells. CaSR is a member of the C subfamily of membrane G-protein coupled receptors, which is expressed in organs principally regulating systemic calcium homeostasis [53]. CaSR was involved in myocardial hypertrophy [54, 55] and heart failure [56]. CaSR is implicated in LPS-induced apoptosis through its increased expression, consequent Ca2+ overload, and TNF-a and IL-6 release [57]. In the present study, in contrast to the changes in expressions of proinflammatory cytokines, inhibition of the inflammasome did not markedly modify the CaSR expression in H9c2 cells receiving a long exposure of LPS. Therefore, LPS might have another way to modulate CaSR expression. However, further evidence to support this hypothesis is required. Moreover, both hypertrophy and apoptosis in H9c2 cells due to LPS were diminished by NPS2390 at a dose sufficient to inhibit CaSR [58]. The reversal of apoptosis due to acute treatment with LPS by NPS2390 was also observed in cardiac myocytes from neonatal rats [39]. Interestingly, NPS2390 inhibited the hypertrophic response to LPS and the apoptosis induced by

Feng Yu Kuo, Shu Ping Lee, Juei-Tang Cheng, Ming Chang Wu

A

Bcl2/Bax ratio

B

Relative mRNA of CaSR/actin ratio

LPS 10 μg/ml – + + + NPS2390 M – – 5 × 10–6 1 × 10–5

C

Bcl2/Bax ratio

2.5 2.0 1.5 1.0 0.5 0 2.5 2.0 1.5 1.0 0.5 0

LPS 5 μg/ml – + + + NPS2390 M – – 5 × 10–6 1 × 10–5

D

2.0 1.5 1.0 0.5 0

LPS 10 μg/ml 3 h

Control Vehicle GIT-27 AG490 Stattic (10 μg/ml) (2 × 10–5 M) (5 × 10–6 M)

2.0 1.5 1.0 0.5 0 Relative mRNA of CaSR/actin ratio

LPS 5 μg/ml 24 h

Control Vehicle GIT-27 AG490 Stattic (10 μg/ml) (2 × 10–5 M) (5 × 10–6 M)

Figure 5. Effects of specific inhibitors on the changes induced by LPS. NPS2390 at the dose required to block the calcium-sensing receptor (CaSR) may reverse the apoptosis induced by LPS at a high dose after a short incubation (A) or at a low dose after longer treatment (C). CaSR mRNA levels were increased by LPS treatment after either a short incubation time at a high dose (B) or a longer incubation time at a low dose (D) *P < 0.05 and **p < 0.01 vs. the vehicle-treated control (first column). #P < 0.05 and ##p < 0.01 vs. the low dose LPS-treated group (second column).

LPS at same dose. It seems that the role of CaSR in LPS-induced cardiac injury is not simple, and a detailed investigation is required. Additionally, CaSR has been reported to play a role in promoting cardiac fibrosis [59]. Pharmacological inhibitors specific to each signal in the TLR4-coupled JAK/STAT pathway blocked the effects of LPS on CaSR expression, which may enhance the potential role of the TLR4-coupled JAK/STAT pathway in CaSR activation.

In the clinic, LPS from the outer membrane of bacteria is the primary trigger of the systemic inflammatory response in sepsis [1]. Sepsis or septic shock occurs worldwide, with nearly half of these patients dying each year [60]. The clinical manifestations of sepsis are largely attributable

to the LPS-induced changes in both myeloid cells (macrophages) and non-myeloid cells (endothelial cells and cardiomyocytes). These events are the primary cause of myocardial dysfunction in sepsis, which is an important determinant of patient outcome. In the heart, LPS exerts its effects in two overlapping phases. Reduced systolic function and contractile reserve occur within minutes to hours of LPS exposure [61]. Early myocardial dysfunction has been related to direct LPS effects and the rapid LPS-stimulated production of proinflammatory cytokines. Proinflammatory cytokines and other mediator responses to LPS result in injury from a variety of mechanisms, including free radical production, nitric oxide generation, and arachi-

The direct effect of lipopolysaccharide on an isolated heart is different from the effect on cardiac myocytes in vitro

Table II. The effects of NPS2390 on LPS-modified hypertrophic biomarkers in H9c2 cells after a short (3 h) or longer (24 h) treatment time

Incubation for 3 h

Relative mRNA of ANP/actin

Relative mRNA of BNP/actin

Relative mRNA of β -MHC/actin

Control LPS (10 μg/ml) LPS (10 μg/ml) + NPS2390 (5 × 10–6M) LPS (10 μg/ml) + NPS2390 (10–5M)

1.00 ±0.00 0.73 ±0.05** 0.91 ±0.04*# 1.10 ±0.04##

1.00 ±0.00 v 0.69 ±0.04** 0.86 ±0.04*# 1.15 ±0.07##

1.00 ±0.00 0.67 ±0.032** 0.92 ±0.06*# 1.06 ±0.03##

Incubation for 24 h Control

LPS (5 μg/ml) LPS (5 μg/ml) + NPS2390 (5 × 10–6M) LPS (5 μg/ml) + NPS2390 (10–5M)

Relative mRNA of ANP/actin 1.00 ±0.00 0.56 ±0.03** 0.81 ±0.04*# 1.09 ±0.09##

Relative mRNA of BNP/actin 1.00 ±0.00 0.42 ±0.03** 0.76 ±0.05*# 1.06 ±0.06##

Relative mRNA of β -MHC/actin

1.00 ±0.00 0.53 ±0.05** 0.81 ±0.02*# 1.04 ±0.04##

Each value (mean ± SEM) from 6 samples was compared with the vehicle-treated control. *P < 0.05 and **p < 0.01 vs. vehicle-treated control. #P < 0.05 and ##p < 0.01 vs. LPS-treated group either at 10 μg/ml after a 3-h incubation or at 5 μg/ml after a 24-h treatment.

donic acid metabolite release. These events result in progressive contractile dysfunction, including heart failure [62]. Chronic heart failure appears to be accompanied by a persistent increase in inflammatory cytokines. Recently, LPS-induced hypomyelination has also been demonstrated in forebrain slices of neonatal rats [63]. However, CaSR is ubiquitously expressed in the human body where it activates multiple signalling pathways, and the role of CaSR in the heart is still quite controversial [64]. Few reports have been conducted the application of CaSR-related agent(s) in clinical practice.

The present study has some limitations, as follows. In LPS-treated Langendorff hearts, the changes in contractility, the expressions of TLR4/JAK2/STAT3/CaSR and molecules involved in apoptosis or hypertrophy should be studied further. The effects of LPS in the hearts isolated from TLR4 or CaSR deficient animals should also be investigated in advance. Moreover, it has been documented that IL-6 trans-signalling modulates TLR4-dependent inflammatory responses via STAT3 [65]. Further research including the crosstalk among JAK/STAT-, TLR-, and LPS-related pathways in cardiomyocyte should be investigated in our future work. Additionally, applications of GIT27, AG490, Stattic, or IL-6 blockade to investigate the changes of Ca2+ mobilisation and apoptosis in LPS-treated hearts should also be performed in advance.

In conclusion, we are the first to demonstrate the direct effects of LPS on isolated ventricular myocytes mounted on a Langendorff apparatus. In contrast to the inotropic effects in isolated ventricular myocytes, the toxicity induced by direct LPS treatment in cardiac myocytes was observed to be both time- and dose-dependent. The influence of LPS on

cardiac cells is mainly induced by the activation of the TLR4-coupled JAK/STAT pathway. We also found that LPS activates hypertrophic signals prior to apoptotic signals in cardiac cells. The time-dependent changes by LPS are associated with cytokines, although the inflammasome and LPS dosage are also involved. Moreover, CaSR activation also mediates cardiac injury induced by LPS. However, CaSR expression was not markedly reduced by inflammasome inhibitor as the progression of inflammation in H9c2 cells. Otherwise, CaSR is not a good target for the alleviation of LPS-induced injury because CaSR is ubiquitously expressed in the human body. Thus, inhibiting the inflammasome and/or inflammation would be helpful in the future.

Acknowledgments

We thank Y.L. Yen and Y.C. Chen for their kind help in the experiments, and we acknowledge American Journal Expert (AJE) for editing assistance.

Conflict of interest

The authors declare no conflict of interest.

References

1. Ma CY, Shi GY, Shi CS, et al. Monocytic thrombomodulin triggers LPS- and Gram-negative bacteria-induced inflammatory response. J Immunol 2012; 188: 6328-37.

2. Werdan K, Muller-Werdan U. Elucidating molecular mechanisms of septic cardiomyopathy: the cardiomyocyte model. Mol Cell Biochem 1996; 163-164: 291-303.

3. Cao Q, Li B, Wang X, et al. Therapeutic inhibition of CXC chemokine receptor 2 by SB225002 attenuates LPS-induced acute lung injury in mice. Arch Med Sci 2018; 14: 635-44.

Feng Yu Kuo, Shu Ping Lee, Juei-Tang Cheng, Ming Chang Wu

The direct effect of lipopolysaccharide on an isolated heart is different from the effect on cardiac myocytes in vitro

4. Anker SD, Egerer KR, Volk HD, et al. Elevated soluble CD14 receptors and altered cytokines in chronic heart failure. Am J Cardiol 1997; 79: 1426-30.

5. Niebauer J, Volk HD, Kemp M, et al. Endotoxin and immune activation in chronic heart failure: a prospective cohort study. Lancet 1999; 353: 1838-42.

6. Patten M, Kramer E, Bunemann J, et al. Endotoxin and cytokines alter contractile protein expression in cardiac myocytes in vivo. Pflugers Arch 2001; 442: 920-7.

7. Hobai IA, Morse JC, Siwik DA, et al. Lipopolysaccharide and cytokines inhibit rat cardiomyocyte contractility in vitro. J Surg Res 2015; 193: 888-901.

8. Tavener SA, Long EM, Robbins SM, et al. Immune cell Toll-like receptor 4 is required for cardiac myocyte impairment during endotoxemia. Circ Res 2004; 95: 700-7.

9. Chow JC, Young DW, Golenbock DT, et al. Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction. J Biol Chem 1999; 274: 10689-92.

10. Seavey MM, Dobrzanski P. The many faces of Janus kinase. Biochem Pharmacol 2012; 83: 1136-45.

11. Qiao S, Mao X, Wang Y, et al. Remifentanil preconditioning reduces postischemic myocardial infarction and improves left ventricular performance via activation of the Janus activated kinase-2/signal transducers and activators of transcription-3 signal pathway and subsequent inhibition of glycogen synthase kinase-3beta in rats. Crit Care Med 2016; 44: e131-45.

12. Fernandes CJ Jr, de Assuncao MS. Myocardial dysfunction in sepsis: a large, unsolved puzzle. Crit Care Res Pract 2012; 2012: 896430.

13. Constable PD. Acute endotoxemia increases left ventricular contractility and diastolic stiffness in calves. Shock 1999; 12: 391-401.

14. Jianhui L, Rosenblatt-Velin N, Loukili N, et al. Endotoxin impairs cardiac hemodynamics by affecting loading conditions but not by reducing cardiac inotropism. Am J Physiol Heart Circ Physiol 2010; 299: H492-501.

15. Sun L, Li DL, Zhao M, et al. The role of muscarinic receptors in the beneficial effects of adenosine against myocardial reperfusion injury in rats. PLoS One 2011; 6: e25618.

16. Chang WT, Cheng JT, Chen ZC. Telmisartan improves cardiac fibrosis in diabetes through peroxisome proliferator activated receptor delta (PPARdelta): from bedside to bench. Cardiovasc Diabetol 2016; 15: 113.

17. Kankeu C, Clarke K, Van Haver D, et al. Quantitative proteomics and systems analysis of cultured H9C2 cardiomyoblasts during differentiation over time supports a ‘function follows form’ model of differentiation. Mol Omics 2018; 14: 181-96.

18. Hwang SL, Liu IM, Tzeng TF, et al. Activation of imidazoline receptors in adrenal gland to lower plasma glucose in streptozotocin-induced diabetic rats. Diabetologia 2005; 48: 767-75.

19. Lin JS, Chen YS, Chiang HS, et al. Hypoxic preconditioning protects rat hearts against ischaemia-reperfusion injury: role of erythropoietin on progenitor cell mobilization. J Physiol 2008; 586: 5757-69.

20. Rudiger A, Singer M. Mechanisms of sepsis-induced cardiac dysfunction. Crit Care Med 2007; 35: 1599-608.

21. Kwon SH, Pimentel DR, Remondino A, et al. H(2)O(2) regulates cardiac myocyte phenotype via concentration-dependent activation of distinct kinase pathways. J Mol Cell Cardiol 2003; 35: 615-21.

22. Kuo SC, Li Y, Cheng YZ, et al. Molecular mechanisms regarding potassium bromate-induced cardiac hypertrophy without apoptosis in H9c2 cells. Mol Med rep 2018; 18: 4700-8.

23. Chang PC, Chen LJ, Cheng JT. Role of peroxisome proliferator-activated receptors delta (PPARdelta) in rats showing endotoxemic heart failure. J Appl Biomed 2014; 12: 79-85.

24. Kumar A, Thota V, Dee L, et al. Tumor necrosis factor alpha and interleukin 1beta are responsible for in vitro myocardial cell depression induced by human septic shock serum. J Exp Med 1996; 183: 949-58.

25. Sugishita K, Kinugawa K, Shimizu T, et al. Cellular basis for the acute inhibitory effects of IL-6 and TNF-alpha on excitation-contraction coupling. J Mol Cell Cardiol 1999; 31: 1457-67.

26. Cailleret M, Amadou A, Andrieu-Abadie N, et al. N-acetylcysteine prevents the deleterious effect of tumor necrosis factor-(alpha) on calcium transients and contraction in adult rat cardiomyocytes. Circulation 2004; 109: 406-11.

27. Yu XW, Chen Q, Kennedy RH, et al. Inhibition of sarcoplasmic reticular function by chronic interleukin-6 exposure via iNOS in adult ventricular myocytes. J Physiol 2005; 566: 327-40.

28. Kumar A, Paladugu B, Mensing J, et al. Nitric oxide-dependent and -independent mechanisms are involved in TNF-alpha induced depression of cardiac myocyte contractility. Am J Physiol Regul Integr Comp Physiol 2007; 292: R1900-6.

29. Bick RJ, Liao JP, King TW, et al. Temporal effects of cytokines on neonatal cardiac myocyte Ca2+ transients and adenylate cyclase activity. Am J Physiol 1997; 272: H1937-44.

30. Hagiwara Y, Miyoshi S, Fukuda K, et al. SHP2-mediated signaling cascade through gp130 is essential for LIF-dependent I CaL, [Ca2+]i transient, and APD increase in cardiomyocytes. J Mol Cell Cardiol 2007; 43: 710-6.

31. Raeburn CD, Calkins CM, Zimmerman MA, et al. Vascular cell adhesion molecule--1 expression is obligatory for endotoxin-induced myocardial neutrophil accumulation and contractile dysfunction. Surgery 2001; 130: 319-25.

32. Liu YC, Chang AY, Tsai YC, et al. Differential protection against oxidative stress and nitric oxide overproduction in cardiovascular and pulmonary systems by propofol during endotoxemia. J Biomed Sci 2009; 16: 8.

33. Haider N, Narula N, Narula J. Apoptosis in heart failure represents programmed cell survival, not death, of cardiomyocytes and likelihood of reverse remodeling. J Cardiac Failure 2002; 8: S512-7.

34. Motawi TK, Darwish HA, Abd El Tawab AM. Effects of caffeic acid phenethyl ester on endotoxin-induced cardiac stress in rats: a possible mechanism of protection. J Biochem Mol Toxicol 2011; 25: 84-94.

35. Saurus P, Kuusela S, Lehtonen E, et al. Podocyte apoptosis is prevented by blocking the Toll-like receptor pathway. Cell Death Dis 2015; 6: e1752.

36. Wang Y, Wang D, Zhang L, et al. Role of JAK-STAT pathway in reducing cardiomyocytes hypoxia/reoxygenation injury induced by S1P postconditioning. Eur J Pharmacol 2016; 784: 129-36.

37. Schust J, Sperl B, Hollis A, et al. Stattic: a small-molecule inhibitor of STAT3 activation and dimerization. Chem Biol 2006; 13: 1235-42.

38. Cowan DB, Poutias DN, Del Nido PJ, et al. CD14-independent activation of cardiomyocyte signal transduction by bacterial endotoxin. Am J Physiol Heart Circ Physiol 2000; 279: H619-29.

39. Wang HY, Liu XY, Han G, et al. LPS induces cardiomyocyte injury through calcium-sensing receptor. Mol Cell Biochem 2013; 379: 153-9.

Feng Yu Kuo, Shu Ping Lee, Juei-Tang Cheng, Ming Chang Wu

40. Schepelmann M, Yarova PL, Lopez-Fernandez I, et al. The vascular Ca2+-sensing receptor regulates blood vessel tone and blood pressure. Am J Physiol Cell Physiol 2016; 310: C193-204.

41. Ehrentraut H, Felix Ehrentraut S, Boehm O, et al. Tlr4 deficiency protects against cardiac pressure overload induced hyperinflammation. PLoS One 2015; 10: e0142921.

42. Magi S, Nasti AA, Gratteri S, et al. Gram-negative endotoxin lipopolysaccharide induces cardiac hypertrophy: detrimental role of Na(+)-Ca(2+) exchanger. Eur J Pharmacol 2015; 746: 31-40.

43. Tanaka T, Narazaki M, Kishimoto T. IL-6 in inflammation, immunity, and disease. Cold Spring Harb Perspect Biol 2014; 6: a016295.

44. Ma H, Zhang S, Xu Y, et al. Analysis of differentially expressed microRNA of TNF-alpha-stimulated mesenchymal stem cells and exosomes from their culture supernatant. Arch Med Sci 2018; 14: 1102-11.

45. Aoyagi T, Matsui T. The cardiomyocyte as a source of cytokines in cardiac injury. J Cell Sci Ther 2011; 2012: pII: 003.

46. Han J, Ye S, Zou C, et al. Angiotensin II causes biphasic STAT3 activation through TLR4 to initiate cardiac remodeling. Hypertension 2018; 72: 1301-11.

47. Bozkurt B. Activation of cytokines as a mechanism of disease progression in heart failure. Ann Rheum Dis 2000; 59 Suppl 1: i90-3.

48. Shi J, Zhao Y, Wang K, et al. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature 2015; 526: 660-5.

49. Qiu Z, Lei S, Zhao B, et al. NLRP3 inflammasome activation-mediated pyroptosis aggravates myocardial ischemia/reperfusion injury in diabetic rats. Oxid Med Cell Longev 2017; 2017: 9743280.

50. Franchi L, Eigenbrod T, Munoz-Planillo R, et al. The inflammasome: a caspase-1-activation platform that regulates immune responses and disease pathogenesis. Nat Immunol 2009; 10: 241-7.

51. Kumar V. Inflammasomes: Pandora’s box for sepsis. J Inflamm Res 2018; 11: 477-502.

52. Qiu Z, He Y, Ming H, et al. Lipopolysaccharide (LPS) aggravates high glucose- and hypoxia/reoxygenation-induced injury through activating ROS-dependent NLRP3 inflammasome-mediated pyroptosis in H9C2 cardiomyocytes. J Diabetes Res 2019; 2019: 8151836.

53. Brown EM, MacLeod RJ. Extracellular calcium sensing and extracellular calcium signaling. Physiol Rev 2001; 81: 239-97.

54. Wang LN, Wang C, Lin Y, et al. Involvement of calcium-sensing receptor in cardiac hypertrophy-induced by angiotensinII through calcineurin pathway in cultured neonatal rat cardiomyocytes. Biochem Biophys Res Commun 2008; 369: 584-9.

55. Liu L, Wang C, Lin Y, et al. Suppression of calciumsensing receptor ameliorates cardiac hypertrophy through inhibition of autophagy. Mol Med Rep 2016; 14: 111-20.

56. Lu FH, Fu SB, Leng X, et al. Role of the calcium-sensing receptor in cardiomyocyte apoptosis via the sarcoplasmic reticulum and mitochondrial death pathway in cardiac hypertrophy and heart failure. Cell Physiol Biochem 2013; 31: 728-43.

57. Minogue AM, Barrett JP, Lynch MA. LPS-induced release of IL-6 from glia modulates production of IL-1beta in a JAK2-dependent manner. J Neuroinflammation 2012; 9: 126.

58. Chi J, Zhu Y, Fu Y, et al. Cyclosporin A induces apoptosis in H9c2 cardiomyoblast cells through calcium-sensing receptor-mediated activation of the ERK MAPK and p38 MAPK pathways. Mol Cell Biochem 2012; 367: 227-36.

59. Zhang X, Zhang T, Wu J, et al. Calcium sensing receptor promotes cardiac fibroblast proliferation and extracellular matrix secretion. Cell Physiol Biochem 2014; 33: 557-68.

60. Finfer S, Machado FR. The global epidemiology of sepsis. Does it matter that we know so little? Am J Respir Crit Care Med 2016; 193: 228-30.

61. Fung MJ, Thomas L, Leung DY. Left ventricular function and contractile reserve in patients with hypertension. Eur Heart J Cardiovasc Imaging 2018; 19: 1253-9.

62. Gullestad L, Ueland T, Vinge LE, et al. Inflammatory cytokines in heart failure: mediators and markers. Cardiology 2012; 122: 23-35.

63. Kim JW, Lee KS, Chang YP. Disturbed maturation of oligodendrocyte progenitors in lipopolysaccharide-induced hypomyelination in cultured forebrain slices of neonatal rats. Folia Neuropathol 2019; 57: 24-35.

64. Gerbino A, Colella M. The different facets of extracellular calcium sensors: old and new concepts in calcium-sensing receptor signalling and pharmacology. Int J Mol Sci 2018; 19: pii: E999.

65. Greenhill CJ, Rose-John S, Lissilaa R, et al. IL-6 trans-signaling modulates TLR4-dependent inflammatory responses via STAT3. J Immunol 2011; 186: 1199-208.

An experimental study of buckwheat polysaccharide in adjuvant therapy for S180 sarcoma mice

Duo-Jiao Fan1, Peng Sun2, Shu-Ying Han3

1Department of Rehabilitation Medicine, Baoding Second Hospital, Baoding, China

2Department of Neurosurgery, Baoding Second Hospital, Baoding, China

3Department of Pharmacology, North China University of Science and Technology, Tangshan, Hebei, China

Submitted: 23 May 2019; Accepted: 24 December 2019

Online publication: 2 July 2020

Arch Med Sci 2023; 19 (1): 229–236

DOI: https://doi.org/10.5114/aoms.2020.96882

Copyright © 2020 Termedia & Banach

Abstract

Introduction: To discuss the auxiliary therapeutic effect of buckwheat polysaccharide (BP) on S180 sarcoma.

Material and methods: Buckwheat polysaccharide was extracted with water and precipitated with ethanol. Solid tumor and ascites tumor mice models were established. The mice in the high, medium and low dosing groups ( n = 24, each group) had their stomachs filled with different doses of BP. The cyclophosphamide (CTX) group and the model group ( n = 24, each group) were used as control groups. The influence on the life cycle, the rate of suppressing the tumor, the thymus index, and the spleen index were evaluated. Tumor cells were cultured in vitro and intervened with drugs; flow cytometry was used to detect the changes in the cell cycle.

Results: Buckwheat polysaccharide significantly improved the lifespan and survival rate of the mice. The group of mice treated with the medium dose showed the best survival rate when compared to the ones that received high and low doses of BP ( p < 0.01). The tumor cells cultured in vitro were arrested in the G0/G1 phase to some extent ( p > 0.05). The cyclophosphamide arrested the cycle of the tumor cells in the G2/M period ( p < 0.01). Buckwheat polysaccharide could increase the thymus index, spleen index and the rate of suppressing the tumor, but the differences were not statistically significant.

Conclusions: Buckwheat polysaccharide had no obvious effect in inhibiting the growth of tumors, but it significantly extended the lifespan, increased the survival rate and reduced the toxic effect of CTX.

Key words: buckwheat polysaccharide, lifespan, thymus index, spleen index, cell cycle.

Introduction

Malignant tumors have recently become one of the main diseases threatening the survival of human beings. In China, there are more than 1.6 million new cancer patients each year and it has become a major cause of death [1]. The main therapeutic function of antineoplastic drugs is to prolong and improve the quality of life of cancer patients; in this respect, traditional Chinese medicine has advantages. Buckwheat has the benefit of reducing blood pressure, reducing blood glucose and reducing lipids [2–5], and also has antineoplastic effects [6–9]. Buckwheat polysaccharide (BP) is a kind of polysaccharide extracted from the flowers

Corresponding author: Shu-Ying Han Department of Pharmacology North China University of Science and Technology Tangshan, Hebei, China

E-mail: shuying_ drhan2143@163.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

and leaves of buckwheat. An earlier study indicated that it was able to increase the immunologic function of experimental animals. The current study evaluated the adjuvant therapeutic effect of BP on S180 sarcoma mice.

Material and methods

Cell culture and animal model

S180 tumor cells were provided by the School of Preventive Medicine, North China Coal Medical University and maintained in a RPMI-1640 medium supplemented with 10% fetal bovine serum. The culture transfer cycle is 6 days. The S180 tumor-bearing model was established as previously described [10]. S180 mouse sarcoma cells were briefly diluted to a final concentration of 1 × 106/ml and inoculated subcutaneously into the right armpit or the abdominal cavity of healthy Kunming mice. The male-to-female ratio was 1 : 1. The weight was 19 ±3 g. The mice were provided by the Institute of Laboratory Animals Science, CAMS & PUMC. The qualified certificate number is No. SCXK (J) 2005-0013. The mice were fed in the barrier environment of the animal center of North China Coal Medical University. All animal experimental procedures were approved by the Animal Care and Use Committee of North China Coal Medical University and performed in accordance with the Guide for the Care and Use of Laboratory Animals [11].

Main instruments

Electronic balance (Shanghai Second Balance Instrument Plant), automatic dual pure water distiller SZ-93 (Sichuan Yaxi Machinery Co., Ltd.), carbon dioxide incubator (Forma Scientific Company), inverted phase-contrast microscope UFX-ILA (OLYMPUS), clean bench (Forma Scientific Company), TGL-16G desk centrifuge (Shanghai Anting Scientific Instrument Plant) and flow cytometer (Becton-Dickinson Company).

Drugs and reagents

Buckwheat polysaccharide: extracted by the pharmacologic teaching and research office of the North China Coal Medical University. Cyclophosphamide (CTX, Shang Hualian Pharmaceutical Co., Ltd., batch No.: 080612), PI, RNA enzyme and cell permeability agent (Beijing Solarbio Life Sciences Co., Ltd.).

Extraction method of buckwheat polysaccharide

Distilled water (5000 ml) was poured into the flowers and leaves of buckwheat (500 g) (volume/ weight = 10 : 1). Then, it was boiled at 95°C twice

(2 h and 1 h, respectively), and then filtered. After that, the filtrate was concentrated to 1/3 of the original solution. 95% ethanol was added and the crude polysaccharide was produced after sedimentation. Distilled water was added to the crude polysaccharide. 3% trichloroacetic acid was added at a ratio of 1 : 1 to remove protein. It was then left to stand for 24 h to obtain the liquid supernatant by centrifugation. Again, 95% ethanol was added for precipitation. Holosaccharide was then obtained after centrifugation and sediment drying.

Suppression of buckwheat polysaccharide on S180 sarcoma mice

Ascitic fluid was taken from S180 tumor-bearing mice that received tumor cell transplantation and culture for 6 days. The ascitic fluid was washed with normal saline twice, counted, and the number of cells was adjusted to 1 × 108/ml. The fluid was subcutaneously injected into the mice’s right axilla in accordance with the dose of 0.2 ml per mouse. The mice were randomly divided into six groups after inoculation: a high-dose BP group (BP-H, 400 mg/kg), a medium-concentration group (BP-M, 200 mg/kg), a low-concentration group (BP-L, 100 mg/kg), a CTX (150 μg/ml) positive control group, a BP-M+CTX (200 mg/kg + 150 μg/ml) group and a model control group. The number of mice in each group was 24. There was no significant difference in the baseline body mass among the groups. After inoculation, the BP was re-dissolved in 0.9% saline to the designated doses and intragastrically administered to the mice. Intraperitoneal injections were carried out for the mice in the CTX group. The mice in the model group received a p.o. administration of 0.9% saline (25 ml/kg). After successive administration for 14 days, the mice were weighed on the second day of the final administration, and executed by cervical vertebra dislocation. The tumor of each mouse was removed. The tumors were weighed, after the blood had been blotted up by filter paper, to calculate the anti-tumor rate.

Anti-tumor rate/% = (1 – average tumor mass of the experimental groups/average tumor mass of the control groups) × 100%.

Effects of buckwheat polysaccharide on the thymus index and spleen index of S180 tumor-bearing mice

The thymus and spleen of the above mice were taken and weighed, after the blood on the surface was blotted up by filter paper, to calculate the thymus index and spleen index.

Thymus (spleen) index = thymus (spleen) mass (mg)/weight (g) × 100%.

Duo-Jiao Fan, Peng Sun, Shu-Ying Han

Effects of BP on the lifespan and survival rate of S180 mice with solid tumor(s)

Mouse tumor inoculation, administration and grouping were the same as above. There were 24 mice in each group. The first day was the same day of administration. The experimental time was 25 days. The general conditions and time of death of the tumor-bearing mice were recorded to calculate the average lifetime and survival rate after 25 days.

Lifetime = (the sum of the survival time of the animals in the experimental group/the number of the animals in the experimental group) × 100%.

Survival rate after 25 days = (the number of animals that survived after 25 days/the number of the animals in the experimental group) × 100%.

Effects on lifespan and survival rate of S180 ascitic tumor mice

Mouse tumor inoculation, administration and grouping are the same as above. There were 24 mice in each group. The first day was the same day of administration. The experimental time was 25 days. The general conditions and time of death of the tumor-bearing mice were recorded to calculate the average lifetime and survival rate after 25 days.

Average lifespan = (the sum of the survival time of the animals in the experimental group/the number of the animals in the experimental group) × 100%.

Survival rate after 25 days = (the number of animals that survived after 25 days/the number of the animals in the experimental group) × 100%.

Cell apoptosis detection via flow cytometry

Ascitic fluid from the tumor cells of the S180 mice that had been inoculated for three days was drawn, and the fluid was washed with Hanks solution twice to adjust the cell concentration to 106/ml. The culture medium with cells was placed on a 24-well culture plate. These cells were divided into 6 groups with 6 duplicate wells, each well containing 0.6 mL of solution. Different drugs were then added to the culture wells in each group: the model group (with appropriate culture medium added); the high, medium and lower concentration groups (the BP solution concentration in the culture solution was 150 μg/ml and 75 μg/ml, respectively); the CTX group (the final concentration of CTX in the culture solution was 150 μg/ml), the CTX (150 μg/ml) + BP-M (150 μg/ml) group. It was ensured that the final volume of the groups was the same. After 24 h, the cells were collected into sterile centrifuge tubes. The liquid supernatant was removed by centrifugation twice. Then, 70% cold ethanol was added and the solution was placed in the refrigerator at –20°C. During analysis, the stored cell sap was taken to be washed with phosphate buffer saline (PBS) twice. After that, the liquid supernatant

was removed by centrifugation, and the BPS solution was re-suspended. The prepared propidium iodide (PI) dying liquor and RNA enzyme were added to produce a reaction by keeping it in the dark for 15 min. The solution was filtered by a 400-mesh net and then analyzed by computer.

Statistical analysis

The database of the experimental data was established in Excel. Statistical analysis was carried out using SPSS 13.0 software, and the pairwise comparison of the multiple samples conducted using one-way analysis of variance (ANOVA).

Results

Effects of buckwheat polysaccharide on lifespan and survival rate of S180 mice with solid tumor(s)

After the mice were inoculated with S180 sarcoma cells, the right fore armpits of the mice were enlarged after about 6 days, and the right fore armpit of the mice grew larger with time. In the model control group and the CTX group, the mice gradually reduced their activity and diet. The luster of the mice’s fur became dull and the mice were slow to respond. All the above conditions gradually became more serious. These conditions were rather more severe in the CTX group. The activity, diet, fur luster and mental conditions of the mice in the group with different BP doses were better than those of the mice in the CTX group and the model control group. From the 9th day, the mice in the model group and the CTX group began to die. The results during the 25-day observation period are shown in Figure 1 and Table I.

Effects of buckwheat polysaccharide on lifespan and survival rate of S180 ascitic tumor mice

For the mice with S180 ascitic fluid sarcoma strains inoculated in the abdominal cavity, their

Number of animals surviving ( n ) 30 28 26 24 22 20 18 16 14 12 10 8 6 4 2

1. Effect of buckwheat polysaccharide (BP) on the lifespan of S180 solid tumor mice (n = 24)

An experimental study of buckwheat polysaccharide in adjuvant therapy for S180 sarcoma mice

Table I. Effect of buckwheat polysaccharide (BP) on lifespan of S180 solid tumor mice (x ± s, n = 24)

Group Dose [mg/kg]

Lifespan (d) Survival rate (%)

Model – 25.29 ±8.22d 25.00

BP-H 400 29.29 ±8.14 54.17

BP-M 200 33.42 ±4.61b 62.50 BP-L 100 29.38 ±7.80 45.83 CTX 3 32.46 ±5.76b 66.67 CTX + BP-M 3 + 200 33.29 ±8.53b 70.83 ap < 0.05, bp < 0.01 vs. model group; cp < 0.05, dp < 0.01 vs. CTX group.

abdomen began to enlarge on the 5th day, and the abdomen girth and size increased with time. The activity, diet and mental conditions of the mice in the group with different BP doses were better than those of the mice in the CTX group and the model group. From the 6th day, the mice in the CTX group began to die. The results during the 25-day observation period are shown in Figure 2 and Table II.

Effects of buckwheat polysaccharide on the thymus and spleen indexes of S180 sarcoma mice

The thymus and spleen indexes of the mice in the group with different doses were higher than those of the mice in the model group; however, the differences were not statistically significant.

Number of animals surviving ( n ) 30 28 26 24 22 20 18 16 14 12 10 8 6 4 2

The thymus index and spleen index of the mice in the CTX group were significantly reduced, while BP-M successfully controlled the lowering of the thymus index and spleen index caused by CTX (Figure 3).

Observation of BP for the inhibition rate of mice S180 sarcoma

Thymus index and spleen index 6 5 4 3 2 1 0

Figure 2. Effect of buckwheat polysaccharide (BP) on the lifespan of S180 ascites tumor mice (n = 24)

d d d d

c c c

c b b

Model BP-H BP-M BP-L CTX CTX + BP-M

Thymus index [mg/g] Spleen index [mg/g]

As for the weights of the tumors in each group, the tumors in the model group were the most severe. The weight of the tumors in the CTX and CTX + BP groups was significantly lower than that in the model group (p < 0.01). High, medium and low doses of BP had the ability to suppress the growth of mouse S180 sarcoma. However, the dif5 10 15 20 25 Time [days] Model BP-H BP-M BP-L CTX CTX + BP-L

Figure 3. The effect of EBFL on thymus and spleen index ap < 0.05, bp < 0.01 vs. model group; cp < 0.05 , dp < 0.01 vs. CTX group

Table II. Effect of buckwheat polysaccharide (BP) on lifespan of S180 ascites tumor mice (x ± s, n = 24)

Group Dose [mg/kg] Lifespan (d) Survival rate (%)

Model – 18.87 ±6.10d 20.83

BP-H 400 22.00 ±5.54 50.00 BP-M 200 23.25 ±4.67b 58.33

BP-L 100 20.46 ±6.41c 45.83

CTX 3 23.67 ±4.66b 62.50

CTX+BP-M 3 + 200 24.08 ±5.58b 66.67 ap < 0.05, bp < 0.01 vs. model group; cp < 0.05, dp < 0.01 vs. CTX group.

Duo-Jiao Fan, Peng Sun, Shu-Ying Han

Table III. Effect of buckwheat polysaccharide (BP) on inhibiting S180 tumor in SA mice (x ± s, n = 24)

Group Dose [mg/kg]

Tumor weight [g] Inhibition rate (%)

Model 3.28 ±0.46d

BP-H 400 3.00 ±0.40d 9.04 ±1.55

BP-M 200 2.98 ±0.45d 9.27 ±2.21

BP-L 100 3.04 ±0.36d 7.37 ±1.71

CTX 3 1.91 ±0.31b 42.67 ±8.61

CTX + BP-M 3 + 200 1.69 ±0.38b 46.67 ±9.71

ap < 0.05, bp < 0.01 vs. model group; cp < 0.05, dp < 0.01 vs. CTX group.

ference compared with the model group was not statistically significant (p > 0.05). The difference in weight of the tumors in the CTX and CTX + BP-M groups was not statistically significant. The anti-tumor rate was significantly higher than in the BP-H, BP-M and BP-L groups. The detailed results are shown in Table III.

Cell cycle detection via flow cytometry

In the G0/G1 phase, the cells of the tumor cells in the group with different doses of BP increased, with the BP-M group having the most obvious increase. However, the difference compared with the model group was not statistically significant (p > 0.05). It indicated that BP was able to arrest the cycle of the tumor cells in the G0/G1 phase. The cell content of the tumor cells in the CTX group greatly increased in the G2/M phase compared with the model group (p < 0.01), while the content in the G0/G1 phase was significantly lower than the model group (p < 0.05), which indicated that the drug mainly arrested the tumor cells in the G2/M phase. Details are shown in Figure 4 and Table IV.

Discussion

The types of drugs available for the treatment of malignant tumors are varied [12, 13]. Chemotherapeutic drugs such as CTX, etc., can suppress the growth of tumors, but the toxic side effects remarkably lower the quality of the patients’ lives. Traditional Chinese medicine has gradually become a research hotspot for its advantages of high efficiency, low toxicity, and overall adjustment [14, 15]. The study of immunocompetence polysaccharide in the aspects of promoting and adjusting immunologic function has progressed greatly, and the study of its mechanism of action has been deepened at the molecular and genetic levels [16–22]. At present, the mechanism for polysaccharide antineoplastic study has two main aspects: one is that the polysaccharide directly kills tumor cells; the second is that the polysaccharide achieves the indirect antineoplastic effect by activating or

enhancing immunologic function [23]. The documents related to this study indicated that, at the same time as enhancing the immunity, this polysaccharide has no direct toxic side effects on normal cells. Therefore, this polysaccharide has been recognized as a very important biological effect regulator [24–26].

The results of this experiment indicate that BP had a certain suppressing effect on mouse S180 sarcoma; however, the difference was not statistically significan. BP was able to improve the lifespan, survival rate and survival quality of S180 sarcoma mice. Its application alone was able to improve the thymus and spleen index of tumor mice, while its combined application with CTX was able to improve the suppressing effects of CTX on the thymus index and spleen index of tumor mice. A flow cytometer was used to observe the effects of BP on tumor cell cycle. It was found that BP was able to arrest the tumor cell cycle in the G0/ G1 phase to prevent cell transformation. The experimental results indicated that BP did not have obvious antineoplastic effects, but it could prolong the lifespan of the tumor mice and improve the survival quality. In addition, it was able to prevent the suppressing and toxic reaction of CTX on immunologic function, which functions as adjuvant therapy for tumors.

There are some limitations to the present study. Firstly, the effect of BP in adjuvant therapy was solely investigated in S180 xenografts. Further studies on different tumor-bearing models will be needed to confirm the beneficial effect of BP in tumor progression. Secondly, we did not explore the molecular mechanisms of BP in extending the lifetime of tumor-bearing mice. Further investigation will be required to identify the potential regulatory targets of BP in tumor progression.

In conclusion, our results showed that BP significantly extended the lifespan, increased the survival rate and reduced the toxic effect of CTX in S180 tumor-bearing mice. The adjuvant therapeutic function of BP deserves further investigation to determine its role in the treatment of cancer.

An experimental study of buckwheat polysaccharide in adjuvant therapy for S180 sarcoma mice

File analyzed: 6.001

Date analyzed: 14035760--14037660 Model: 1 DAOn_DSF Analysis type: Manual analysis Diploid: 100.00 %

Dip G1: 42.99% at 45.77

Dip G2: 17.87% at 86.74

Dip S.: 39.14 % G2/G1: 1.90 %CV: 8.71

Total S-Phase: 39.14% Total B.A.D.: 0.09% Debris: 0.37%

Aggregates: 0.22% Modeled events: 12841

All cycle events: 12766

Cycle events per channel: 304 RCS: 10.201 File analyzed: 1.001 Date analyzed: 13854064–1385596 Model: 1 DAOn_DSF Analysis type: Manual analysis Diploid: 100.00%

Dip G1: 49.22% at 46.63

Dip G2: 14.25% at 91.11 Dip S: 36.54% G2/G1: 1.95 %CV: 6.18

Total S-Phase: 36.54%

Total B.A.D.: 0.81% Debris: 0.46%

Aggregates: 1.49% Modeled events: 13445

All cycle events: 13182

Cycle events per channel: 290 RCS: 13.860 File analyzed: 2.001 Date analyzed: 13854064–13855964

Model: 1DAOn_DSF

Analysis type: Manual analysis

Diploid: 100.00%

Dip G1: 51.27% at 46.11

Dip G2: 11.74% at 90.01 Dip S: 36.99% G2/G1: 1.95 %CV: 8.03

Total S-Phase: 36.99%

Total B.A.D.: 0.34% Debris: 0.36%

Aggregates: 0.53%

Modeled events 12678

All cycle events: 12559

Cycle events per channel: 280 RCS: 13.765

Figure 4. The effect of buckwheat polysaccharide (BP) on the cell cycle of S180 ascites tumor mice (x ± s) 6.001 = Control, 1.001 = BP-H, 2.001 = BP-M, 3.001 = BP-L

An experimental study of buckwheat polysaccharide in adjuvant therapy for S180 sarcoma mice

File analyzed: 3.001

Date analyzed: 13854064–13855964

Model: 1DA0n_DSF

Analysis type: Manual analysis

Diploid: 100.00%

Dip G1: 53.64% at 46.04

Dip G2: 9.91% at 88.95

Dip S: 36.45% G2/G1: 1.93 %CV: 7.50

Total S-Phase: 36.45%

Total B.A.D.: 0.54

Debris: 0.38%

Aggregates: 1.08%

Modeled events: 12319

All cycle events: 12139

Cycle events per channel: 276 RCS: 14.989 0 20 40 60 80 100 120

Channels (FL2-A-FL2-Area) Debris Aggregates Dip G1 Dip G2 Dip S

Figure 4. Cont. The effect of buckwheat polysaccharide (BP) on the cell cycle of S180 ascites tumor mice (x ± s)

6.001 = Control, 1.001 = BP-H, 2.001 = BP-M, 3.001 = BP-L

Table IV. Effect of buckwheat polysaccharide (BP) on cell cycle of S180 ascites tumor mice (x ± s)

Group Dose [ m g/ml] G0/G1 (%) S (%) G2/M (%)

Model – 44.16 ±1.03 44.18 ±2.70 11.66 ±3.06 BP-H 300 45.19 ±2.13d 42.11 ±3.27 12.59 ±1.16d

BP-M 150 47.30 ±4.70d 40.88 ±4.54 11.84 ±0.68d BP-L 75 46.26 ±4.67d 42.47 ±3.98 11.27 ±1.36d CTX 150 39.71 ±2.49a 42.72 ±1.12 17.57 ±2.48b

CTX + BP-M 150 + 150 43.71 ±3.18c 42.93 ±1.01 13.37 ±2.85d

ap < 0.05, bp < 0.01 vs. model group; cp < 0.05, dp < 0.01 vs. CTX group.

Acknowledgments

Duo-Jiao Fan and Peng Sun contributed equally to this study as first authors.

Conflict of interest

The authors declare no conflict of interest.

References

1. Wang ZL, Dong BW. [Research on the application of immune cells in immunotherapy of malignant tumors] [Article in Chinese]. Medical Recapitulate 2004; 11: 705-7.

2. Hou Z, Hu Y, Yang X, Chen W. Antihypertensive effects of Tartary buckwheat flavonoids by improvement of vascular insulin sensitivity in spontaneously hypertensive rats. Food Funct 2017; 8: 4217-28.

3. Mišan A, Petelin A, Stubelj M, et al. Buckwheat – enriched instant porridge improves lipid profile and reduces inflammation in participants with mild to moderate hypercholesterolemia. J Funct Foods 2017; 36: 186-94.

4. Li J, Gong FY, Li FL. Hypoglycemic and hypolipidemic effects of flavonoids from tatary buckwheat in type 2 diabetic rats. Biomed Res 2016; 27: 132-7.

5. Ji X, Han L, Liu F, Yin S, Peng Q, Wang M. A mini-review of isolation, chemical properties and bioactivities of poly-

saccharides from buckwheat (Fagopyrum Mill). Int J Biol Macromol 2019; 127: 204-9.

6. Chen H, He LJ, Lin LF. [Advances in anti-tumor mechanism of buckwheat] [Article in Chinese]. Strait Pharm J 2014; 26: 41-2.

7. Bai C, Feng M, Hao X, Zhao Z, Li Y, Wang Z. Anti-tumoral effects of a trypsin inhibitor derived from buckwheat in vitro and in vivo. Mol Med Rep 2015; 12: 1777-82.

8. Zhou XL, Meng XX, Wang Q, Zhou YM, Li ZJ. Comparative anti-tumor activity study of tartary buckwheat flavonoids and amphibian peptides. Adv Mat Res 2013; 781-784: 1270-4.

9. Guo X, Zhu K, Zhang H, Yao H. Anti-tumor activity of a novel protein obtained from tartary buckwheat. Int J Mol Sci 2010; 11: 5201-11.

10. Liu F, Wang JG, Wang SY, Li Y, Wu YP, Xi SM. Antitumor effect and mechanism of Gecko on human esophageal carcinoma cell lines in vitro and xenografted sarcoma 180 in Kunming mice. World J Gastroenterol 2008; 14: 3990-6.

11. National Research Council (US) Committee for the Update of the Guide for the Care and Use of Laboratory Animals. Guide for the Care and Use of Laboratory Animals. 8th Ed. Washington (DC): National Academies Press (US); 2011. Available from: https://www.ncbi.nlm. nih.gov/books/NBK54050/; doi: 10.17226/12910.

12. Long HY, Huang QX, Yu YY, et al. Dehydrocostus lactone inhibits in vitro gastrinoma cancer cell growth through

Duo-Jiao Fan, Peng Sun, Shu-Ying Han

apoptosis induction, sub-G1 cell cycle arrest, DNA damage and loss of mitochondrial membrane potential. Arch Med Sci 2019;15:765-773.

13. Zhang Z, Feng Y, Li Z, Cao X. Antiproliferative and apoptotic activity of glycyrrhizinic acid in MCF-7 human breast cancer cells and evaluation of its effect on cell cycle, cell migration and m-TOR/PI3K/Akt signalling pathway. Arch Med Sci 2019; 15: 174-82.

14. Nie J, Zhao C, Deng LI, et al. Efficacy of traditional Chinese medicine in treating cancer. Biomed Rep 2016; 4: 3-14.

15. Chen Y, Yao F, Ming K, Wang D, Hu Y, Liu J. Polysaccharides from traditional chinese medicines: extraction, purification, modification, and biological activity. Molecules 2016; 21: 1705.

16. Ruijun W, Shi W, Yijun X, Mengwuliji T, Lijuan Z, Yumin W. Antitumor effects and immune regulation activities of a purified polysaccharide extracted from Juglan regia. Int J Biol Macromol 2015; 72: 771-5.

17. Wu GH, Lu CL, Jiang JG, Li ZY, Huang ZL. Regulation effect of polysaccharides from Pleurotus tuber-regium (Fr.) on the immune activity of mice macrophages. Food Funct 2014; 5: 337-44.

18. Gu P, Liu Z, Sun Y, et al. Angelica sinensis polysaccharide encapsulated into PLGA nanoparticles as a vaccine delivery and adjuvant system for ovalbumin to promote immune responses. Int J Pharm 2019; 554: 72-80.

19. Yin M, Zhang Y, Li H. Advances in research on immunoregulation of macrophages by plant polysaccharides. Front Immunol 2019; 10: 145.

20. Sun J, Xiong J, Yao L, et al. The effect of dietary ginseng polysaccharide supplementation on porcine milk-derived esRNAs involved in the host immune responses. J Anim Physiol Anim Nutr (Berl) 2019; 103: 276-82.

21. Wang YQ, Mao JB, Zhou MQ, et al. Polysaccharide from Phellinus igniarius activates TLR4-mediated signaling pathways in macrophages and shows immune adjuvant activity in mice. Int J Biol Macromol 2019; 123: 157-66.

22. Bo R, Liu Z, Zhang J, et al. Mechanism of Lycium barbarum polysaccharides liposomes on activating murine dendritic cells. Carbohydr Polym 2019; 205: 540-9.

23. Du JW, Yang MF, Su YY, Xia ZL. [Experimental study on anti-S180 sarcoma of Grifola frondosa polysaccharide in vivo] [Article in Chinese]. Shandong J Traditional Chin Med 2006; 26: 193-5.

24. Furusawa E, Hirazumi A, Story S, Jensen J. Antitumour potential of a polysaccharide-rich substance from the fruit juice of Morinda citrifolia (Noni) on sarcoma 180 ascites tumour in mice. Phytother Res 2003; 17: 1158-64.

25. Zheng M. [Advances in pharmacology of Polysaccharides from traditional Chinese medicine against tumors] [Article in Chinese]. Foreign Med Sci 2000; 23: 259-63.

26. Bo R, Sun Y, Zhou S, et al. Simple nanoliposomes encapsulating Lycium barbarum polysaccharides as adjuvants improve humoral and cellular immunity in mice. Int J Nanomedicine 2017; 12: 6289-301.

Xiaoting Wang1, Liying Guan2, Changzhen Wu1, Yongjun Zhao3, Gang Zhao4

1Department of Otolaryngology-Head and Neck Surgery, Shandong Provincial Hospital affiliated to Shandong First Medical University, Jinan, China

2Health Management Center, Shandong Provincial Hospital affiliated to Shandong First Medical University, Jinan, China

3Sleep Medicine Center, Shandong Provincial Hospital affiliated to Shandong First Medical University, Jinan, China

4Department of Cardiology, Shandong Provincial Hospital affiliated to Shandong First Medical University, Jinan, China

Submitted: 16 September 2022; Accepted: 13 November 2022 Online publication: 9 December 2022

Arch Med Sci 2023; 19 (1): 237–241

DOI: https://doi.org/10.5114/aoms/156490

Copyright © 2022 Termedia & Banach

Abstract

Introduction: The work was designed to investigate the effect of continuous positive airway pressure (CPAP) on hypertension in obstructive sleep apnea-hypopnea syndrome (OSAHS) patients and to elucidate the underlying mechanisms.

Methods: We examined the effect of CPAP on blood pressure and biomarkers reflecting inflammation and oxidative stress, and investigated the correlation between changes in blood pressure and the biomarkers.

Results: CPAP significantly improved clinic, ambulatory and home blood pressure ( p < 0.05). The hypotensive effect of CPAP was positively correlated with the decrease of interleukin-6, C-reactive protein, NADPH oxidase and malonaldehyde.

Conclusions: CPAP has a significant antihypertensive effect on OSAHS patients, especially nocturnal hypertension, possibly by counteracting inflammation and oxidative stress.

Key words: obstructive sleep apnea-hypopnea syndrome, hypertension, continuous positive airway pressure, mechanism.

Obstructive sleep apnea-hypopnea syndrome (OSAHS) is an increasingly recognized health issue, which is characterized by recurrent hypoxemia, wakefulness, and fragmented sleep [1]. Considerable evidence indicates that OSAHS is relatively prevalent in patients with hypertension, especially resistant hypertension [2]. Hypertension combined with OSAHS has become a disease that seriously endangers human health.

In the last years, several reports on the underlying mechanism by which OSAHS increases the blood pressure have been published, involving a diverse range of mechanisms including oxidative stress, inflammation, enhancement of the renin-angiotensin-aldosterone system (RAAS) and sympathetic nerves [3].

Corresponding author: Gang Zhao Department of Cardiology Shandong Provincial Hospital affiliated to Shandong First Medical University Jinan, China Phone: +86-531-68776356 E-mail: zg000507@163.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Continuous positive airway pressure may improve hypertension in patients with obstructive sleep apnea-hypopnea syndrome by inhibiting inflammation and oxidative stress

Recent studies have confirmed that inflammation and oxidative stress are significantly increased in patients with OSAHS compared with those without OSAHS by detecting biomarkers [4]. Obviously, such biomarkers should be highly specific and sensitive, and can reflect the severity and treatment response of OSAHS [5]. Of the biomarkers that met the requirements, interleukin-6 (IL-6) and C-reactive protein (CRP) are well suited to indicate inflammation, while NADPH oxidase and malonaldehyde (MDA) are suitable indicators of oxidative stress. These four biomarkers are closely related to the pathogenesis of OSAHS [3].

Continuous positive airway pressure (CPAP) is recognized as the most effective therapy for patients suffering from OSAHS [6]. However, it still needs to be clarified whether CPAP is effective in treating hypertension in patients suffering from OSAHS. With regards to the mechanisms by which CPAP affects blood pressure, many previous studies have confirmed that CPAP reduces blood pressure by counteracting sympathetic activation and the renin-angiotensin-aldosterone system (RAAS) [7].

612 patients were included in initial recruitment

348 patients OSAHS 264 patients hypertension

185 patients hypertension 154 patients OSAHS

339 patients OSAHS + hypertension

175 were excluded 112 Refused to participate 19 Had already been on CPAP/Home PAP therapy treatment 8 Had too many underlying conditions/medications 10 severe hypertension 26 Other reasons

CPAP tolerance period (n = 164)

Intolerance of CPAP (n = 78)

Randomized (n = 86)

However, there are few studies on the relationship between oxidative stress, inflammation, and CPAP treatment in OSAHS patients with hypertension [8]. We hypothesized that CPAP might be efficacious in treating hypertension in patients with OSAHS, and designed this randomized controlled trial to test the conjecture. In addition, in this study, we explored the underlying mechanism whereby CPAP lowers blood pressure, which may provide theoretical support for CPAP as a convincing treatment in addition to drugs.

Methods. This study was a prospective, singlecenter, randomized, parallel-group trial. It was conducted in the Sleep Medicine Center of our hospital from June 2019 to June 2021. All enrolled patients between the ages of 18 and 80 had OSAHS (AHI ≥ 5) and hypertension (systolic diastolic blood pressure ≥ 140 mm Hg and/or diastolic blood pressure ≥ 90 mm Hg). Exclusion criteria were: patients with other known causes of secondary hypertension; severe hypertension; using CPAP; patients taking any anti-inflammatory drug and/or psychotropic agent. We fully communicated with the patients before the experiment and obtained written consent from all enrolled patients. The Research Protocol was discussed by multidisciplinary researchers and supported by the Ethics Committee of our hospital.

CPAP (n = 43) Sham-CPAP (n = 43)

Figure 1. Flow diagram illustrating selection of eligible subjects through the study

339 patients with a primary diagnosis of OSAHS and hypertension were sequentially enrolled in the PSG study, and 175 patients were subsequently excluded for various reasons. The remaining 164 participants initially underwent an acclimatization period (2 weeks, fixed pressure of 4 cm H2O) and a washout period (1 month). Then 86 OSAHS patients with hypertension were enrolled (Figure 1), including 47 males and 39 females. Baseline characteristics were documented, including age, body mass index (BMI), neck circumference, and waist circumference. These patients were then randomly divided into the CPAP treatment or sham CPAP control group without changing the original drug regimen for hypertension. All were subjected to the original pharmacological antihypertensive drug treatment combined with CPAP. Patients of the sham CPAP group received the fixed pressure of 4 cm H2O. Standard artificial pressure titration must be performed to determine the effective treatment pressure. The fixed CPAP pressure was used for the rest of the study in the treatment group. Before and after CPAP treatment, the differences in blood pressure changes (clinical, ambulatory, and home blood pressure) were compared between the two groups mentioned above. At the same time, the biomarkers including CRP, IL-6, NADPH oxidase, and MDA were measured. On average, CPAP was used for more than four hours per day, according to the preset CPAP prescriptions.

Xiaoting Wang, Liying Guan, Changzhen Wu, Yongjun Zhao, Gang Zhao

All patients underwent overnight PSG using the Philips Respironics, Alice 6 system. Data were obtained by manual scoring according to the criteria established by the American Academy of Sleep Medicine (AASM). We obtained blood pressure data (clinic, ambulatory and home blood pressure) at baseline and during follow-up. Under the premise of strictly adhering to the clinical guidelines, we used auto-titrating CPAP devices to complete CPAP treatment. All enrolled patients were followed up at 1 and 4 weeks, 8 and 12 weeks after initiation of treatment. As in our previous publications [9], we assessed CPAP adherence by weekly CPAP frequency and nightly CPAP time. Non-adherence refers to CPAP use less than 5 days/week or 4 h/night. After a 12-hour overnight fast, venous blood samples were taken from all patients at a fixed time (7 a.m. to 8 a.m.) before and after CPAP therapy. Then, the biomarkers (CRP, IL-6, NADPH oxidase and MDA) were determined according to the manufacturer’s instructions.

Statistical analysis. All data are presented as mean ± SD or as percentages. Pearson’s c2 are test was used to analyze differences in blood pressure between the two groups, and Student’s t-test was used to analyze differences in biomarkers between the two groups. Correlations between the effect of CPAP on hypertension and its effect on biomarkers were verified using Pearson correlation analysis. All statistical work was done using SPSS version 25.0. P <0.05 was defined as statistically significant.

Results. Table I showed the effect of CPAP on ambulatory, clinic, and home blood pressure in

Table I. Treatment effects on blood pressure

patients with OSAHS combined with hypertension. No statistically significant difference existed in blood pressure between the two groups of patients before CPAP treatment (p > 0.05). In the sham CPAP group, there was no significant difference in blood pressure before and after CPAP treatment. Compared with the sham CPAP group (after therapy), CPAP treatment in the CPAP group resulted in significant improvements in night-time ambulatory systolic and diastolic blood pressure (p < 0.05), as well as 24-h ambulatory systolic and diastolic blood pressure (p < 0.05). In addition, compared with the sham CPAP group (after therapy), although the effect of CPAP on daytime dynamic systolic and diastolic blood pressure was weak, the results were still statistically significant. Throughout the experiment, we confirmed that the CPAP treatment significantly downregulates home systolic and diastolic blood pressure in the morning. Meanwhile, the effect of CPAP on home evening or clinic systolic/diastolic blood pressure was also statistically significant, although this effect was indeed weaker, especially for clinical systolic/diastolic blood pressure.

Table II shows the effect of CPAP on biomarkers reflecting inflammation and oxidative stress. Before CPAP treatment, no significant difference in these parameters was found between the two groups (p > 0.05). In the sham CPAP group, there was no significant difference in these biomarkers before and after CPAP treatment. After 12 weeks of CPAP treatment, compared with the CPAP group (before treatment) and sham CPAP group (after treatment), the patients in the CPAP group had

Variable CPAP group Sham CPAP group

Before therapy After therapy Before therapy After therapy

24 h ambulatory blood pressure:

24 h systolic blood pressure 132.23 ±10.4 130.51 ±10*#& 131.95 ±10.63 131.79 ±10.69

24 h diastolic blood pressure 87.14 ±8.55 84.3 ±8.5*#& 87.28 ±8.53 86.98 ±8.29

Daytime systolic blood pressure 137.74 ±10.57 136.21 ±10.91*#& 138.05 ±10.64 137.77 ±10.9

Daytime diastolic blood pressure 89.6 ±8.33 87.56 ±7.98*#& 89.53 ±8.65 89.33 ±8.25

Night-time systolic blood pressure 126.21 ±10.59 122.16 ±10.09*#& 125.88 ±10.6 125.56 ±10.44

Night-time diastolic blood pressure 79.07 ±8.55 74.4 ±7.63*#& 79.26 ±8.64 79.21 ±8.55

Home blood pressure evening:

Systolic blood pressure 137.79 ±10.68 135.19 ±10.32*#& 138.02 ±10.61 137.79 ±10.59 Diastolic blood pressure 88.98 ±8.52 85.95 ±8.3*#& 89.12 ±8.5 88.84 ±8.27

Home blood pressure morning:

Systolic blood pressure 137.42 ±10.63 133.19 ±9.61*#& 137.74 ±10.7 137.23 ±10.83

Diastolic blood pressure 89.98 ±8.48 84.93 ±7.73*#& 89.67 ±8.75 89.53 ±8.34

Clinic blood pressure:

Systolic blood pressure 137.44 ±10.68 136.7 ±10.15*#& 137.6 ±10.8 137.19 ±10.26

Diastolic blood pressure 88.7 ±8.66 87.42 ±8.69*#& 88.91 ±8.69 88.65 ±7.91

*P < 0.05 vs. CPAP group (before therapy); #P < 0.05 vs. sham CPAP group (before therapy); &P < 0.05 vs. sham CPAP group (after therapy).

Continuous positive airway pressure may improve hypertension in patients with obstructive sleep apnea-hypopnea syndrome by inhibiting inflammation and oxidative stress

Table II. Treatment effects on inflammation biomarkers and oxidative stress biomarkers

Variable CPAP group

Before therapy After therapy

Sham CPAP group

Before therapy After therapy

CRP [ng/ml] 12.65 ±1.02 5.16 ±0.93*#& 12.54 ±1.03 12.56 ±1.27 IL-6 [pg/ml] 43.46 ±3.08 18.8 ±1.39*#& 43.69 ±2.79 43.63 ±2.7

NADPH oxidase [U/ml] 4.97 ±0.36 3.21 ±0.27*#& 4.92 ±0.33 4.93 ±0.31 MDA [nmol/ml] 13.54 ±1.98 8.65 ±1.21*#& 13.79 ±2.02 13.81 ±2.16

CRP – C-reactive protein, IL-6 – interleukin-6, NADPH oxidase – nicotinamide adenine dinucleotide phosphate oxidase, MDA – malonaldehyde. *P < 0.05 vs. CPAP group (before therapy); #p < 0.05 vs. sham CPAP group (before therapy); &p < 0.05 vs. sham CPAP group (after therapy).

significantly lower levels of CRP, IL-6, NADPH oxidase and MDA (p < 0.05). In addition, we used Pearson correlation analysis to confirm that the reduction of the night-time ambulatory systolic and diastolic blood pressure was significantly positively correlated with the reduction of IL-6, CRP, MDA and NADPH oxidase levels, respectively.

Discussion. In the current study, we investigated the effect of CPAP on clinical, ambulatory, and home blood pressure in patients with OSAS and hypertension. We found that appropriate use of CPAP has a significant antihypertensive effect on OSAHS patients complicated with hypertension, with a 1–5 mm Hg decline after 3 weeks. Additionally, we also found that the reduction in blood pressure due to CPAP was most obvious at night, and with the strongest impact on diastolic blood pressure values. This may be because the maintenance of diastolic blood pressure is mainly dependent on vasoconstriction, which is mainly affected by endothelin, nitric oxide, and catecholamines [10]. Also, the best effect of CPAP in reducing diastolic blood pressure occurs at night, probably because CPAP treatment of sleep apnea reduces the amplitude of changes in blood oxygen and thereby weakens sympathetic nerve excitability [11]. The effect of CPAP in lowering blood pressure at night lasts until waking up in the morning [11]. Thus, the direct effect of CPAP treatment results in lower nighttime and morning blood pressure, whereas daytime blood pressure regulation appears to be multifactorial [12].

We found in this study that CPAP significantly reduced inflammatory mediators (CRP, IL-6) and oxidative stress (NADPH oxidase, MDA) in the blood of patients with OSAHS and hypertension, which is consistent with previous literature reports [13]. Furthermore, we used Pearson correlation analysis to confirm that the therapeutic effect of CPAP on hypertension in OSAHS patients was significantly positively correlated with its inhibitory effect on oxidative stress and inflammation. Thus, this result confirms that nocturnal blood pressure reduction under CPAP is significantly positively associated with reduced inflammation and oxidative stress. In order to make up for the defects of this experiment, we will cooperate with other medical centers to further consolidate the

results by expanding the sample size and extending the experimental time in the future.

In conclusion, the current research shows that CPAP has a good hypotensive effect on the nighttime ambulatory blood pressure and morning blood pressure, especially on diastolic blood pressure. The inhibition of inflammation and oxidative stress by CPAP is likely to play an important role. Therefore, in addition to basic antihypertensive drugs, CPAP is an important intervention for patients with hypertension and OSAHS.

Acknowledgments

This work was supported by the Youth Natural Science Foundation of Shandong First Medical University (202201-065) and the Natural Science Foundation of Shandong Province (No. ZR2020MH031).

Conflict of interest

The authors declare no conflict of interest.

References

1. Assallum H, Song TY, Aronow WS, Chandy D. Obstructive sleep apnoea and cardiovascular disease: a literature review. Arch Med Sci 2021; 17: 1200-12.

2. Pleava R, Mihaicuta S, Serban CL, et al. Long-term effects of continuous positive airway pressure (CPAP) therapy on obesity and cardiovascular comorbidities in patients with obstructive sleep apnea and resistant hypertension-an observational study. J Clin Med 2020; 9: 2802.

3. Nicholl DDM, Hanly PJ, Zalucky AA, Handley GB, Sola DY, Ahmed SB. Nocturnal hypoxemia severity influences the effect of CPAP therapy on renal renin-angiotensin-aldosterone system activity in humans with obstructive sleep apnea. Sleep 2021; 44: zsaa228.

4. Thiel S, Haile SR, Peitzsch M, et al. Endocrine responses during CPAP withdrawal in obstructive sleep apnoea: data from two randomised controlled trials. Thorax 2019; 74: 1102-05.

5. Stradling JR, Craig SE, Kohler M, et al. Markers of inflammation: data from the MOSAIC randomised trial of CPAP for minimally symptomatic OSA. Thorax 2015; 70: 181-2.

6. Pusuroglu H, Somuncu U, Bolat I, et al. Assessment of the relationship between endocan and obstructive sleep apnea severity. Arch Med Sci 2020; 16: 1346-52.

Xiaoting Wang, Liying Guan, Changzhen Wu, Yongjun Zhao, Gang Zhao

7. Peker Y, Thunstrom E, Glantz H, Eulenburg C. Effect of obstructive sleep apnea and CPAP treatment on cardiovascular outcomes in acute coronary syndrome in the RICCADSA trial. J Clin Med 2020; 9: 4051.

8. Domingues CC, Dore FJ, Cho A, et al. Reassessing the effects of continuous positive airway pressure (CPAP) on arterial stiffness and peripheral blood derived CD34+ progenitor cells in subjects with sleep apnea. Stem Cell Res Ther 2019; 10: 147.

9. Wang X, Yue Z, Liu Z, et al. Continuous positive airway pressure effectively ameliorates arrhythmias in patients with obstructive sleep apnea-hypopnea via counteracting the inflammation. Am J Otolaryngol 2020; 41: 102655.

10. Treptow E, Pepin JL, Bailly S, et al. Reduction in sympathetic tone in patients with obstructive sleep apnoea: is fixed CPAP more effective than APAP? A randomised, parallel trial protocol. BMJ Open 2019; 9: e024253.

11. Kohler M, Stradling JR. OSA and hypertension: do we know all the answers? Chest 2013; 144: 1433-35.

12. Thiel S, Gaisl T, Lettau F, et al. Impact of hypertension on cerebral microvascular structure in CPAP-treated obstructive sleep apnoea patients: a diffusion magnetic resonance imaging study. Neuroradiology 2019; 61: 1437-45.

13. Al-Halawani M, Kyung C, Liang F, et al. Treatment of obstructive sleep apnea with CPAP improves chronic inflammation measured by neutrophil-to-lymphocyte ratio. J Clin Sleep Med 2020; 16: 251-57.

Continuous positive airway pressure may improve hypertension in patients with obstructive sleep apnea-hypopnea syndrome by inhibiting inflammation and oxidative stress

Department of Cardiology, Shanxi Cardiovascular Hospital, Taiyuan, Shanxi, China

Submitted: 26 September 2022; Accepted: 9 December 2022

Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 242–249

DOI: https://doi.org/10.5114/aoms/157287

Copyright © 2022 Termedia & Banach

Abstract

Introduction: This study aims to compare the safety and efficacy of bivalirudin bridging enoxaparin versus fondaparinux in patients with acute myocardial infarction (AMI) who were undergoing primary percutaneous coronary intervention (PPCI).

Methods: The study is a prospective, natural, and selective interventional trial based on real-world data for 482 AMI patients.

Results: At the end of the follow-up, the two groups demonstrated similar major adverse cardiovascular and cerebrovascular events (MACCE) and bleeding rates. After propensity score matching (PSM), the fondaparinux group showed greater advantages in reducing MACCE and bleeding events. Conclusions: The anticoagulation strategy of bivalirudin bridging fondaparinux seems to be superior to that of bivalirudin bridging enoxaparin in patients with AMI undergoing PPCI.

Key words: fondaparinux, bivalirudin, enoxaparin, acute myocardial infarction, primary percutaneous coronary intervention.

Emergency primary percutaneous coronary intervention (PPCI) is the preferred treatment strategy for patients with acute myocardial infarction (AMI) accompanied by heavy thrombotic load [1, 2]. Active anticoagulation and antiplatelet therapy during the PPCI perioperative period can increase PPCI’s success rate and reduce complications such as instent thrombosis, but it also increases the risk of bleeding. Regarding the selection of anticoagulant drugs during the PPCI perioperative period, there is no uniform standard either in China or worldwide. The problem of choosing anticoagulant drugs in clinical practice urgently needs to be solved using real-world evidence-based research.

When emergency invasive treatment strategies are adopted, the guidelines recommend using bivalirudin anticoagulation during the operation [3, 4]. Compared with traditional heparin drugs, fondaparinux has a longer action time and better efficacy and safety [5]. Several trials have shown that the risk of bleeding associated with fondaparinux therapy is lower than that associated with enoxaparin therapy [6, 7]. However, the enrolled patients in the above studies were mainly treated with thrombolytic therapy and elective percutaneous coronary intervention (PCI). By

Corresponding author: Jian An

Department of Cardiology Shanxi Cardiovascular Hospital Taiyuan, Shanxi, China

E-mail: anjianxxg@163.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Efficacy and safety of bivalirudin bridging enoxaparin versus fondaparinux in patients with acute myocardial infarction undergoing primary percutaneous coronary intervention: evidence from a single-center study

Yanqing Guo, Jingping Wang, Zhixin Wang, Li Li, Jian An

Efficacy

contrast, patients undergoing PPCI tend to have a heavy thrombotic load, and postoperative anticoagulant therapy strategies have not yet been agreed.

This study compared the PPCI perioperative application of bivalirudin bridging fondaparinux or enoxaparin and evaluated which treatment strategy is more effective for patients with AMI.

Methods. Trial design. The study is a registry-based, prospective, natural, and selective interventional trial that compares fondaparinux with enoxaparin in patients undergoing PPCI, using real-world data. The subjects were divided into an enoxaparin group and a fondaparinux group according to their actual clinical diagnosis and treatment. All patients were treated with bivalirudin during PPCI and were immediately given enoxaparin 40–60 mg/day or fondaparinux 2.5 mg/day after drug withdrawal, respectively. The patients were followed up for 180 days after PPCI. This study has been registered as a clinical trial with number ChiCTR1900023824 and was approved by the ethics committee of the Shanxi Cardiovascular Hospital.

Patients. Patients were eligible to be assigned to the study group if they were aged ≥ 18 years old, met the diagnostic criteria for AMI issued by the cardiovascular branch of the Chinese Medical Association and were patients undergoing PPCI treatment. In addition, it was necessary that the patient or their legal representative was informed of the nature of the study, understood the protocol, was able to ensure compliance and signed the informed consent form.

Case exclusion criteria were as follows: intraoperative IRA autolysis was found (forward TIMI blood flow ≥ 2); patients who were allergic to or with contraindications to anticoagulant and antiplatelet drugs; patients with cardiogenic shock, malignant ventricular arrhythmia, mechanical complications (such as ventricular septal rupture, papillary muscle rupture, acute mitral regurgitation, etc.); patients after coronary artery bypass graft (CABG); patients with clear indications of anticoagulation after PPCI (e.g., atrial fibrillation, left ventricular thrombosis, aortic balloon counterpulsation, pulmonary embolism, mechanical valve).

Patients were also excluded if they had long-term anticoagulant indications; any bleeding tendency, severe blood disease, intracranial parenchymal aneurysm, arteriovenous malformation, suspected aortic dissection; a history of ischemic stroke, transient ischemic attack, or intracranial hemorrhage within the last six months; or a history of gastrointestinal and urinary bleeding within the last 2 weeks. Additional exclusion criteria were severe anemia and immune diseases, and/or patients undergoing hormone therapy; life expectan-

cy with an active infection or concomitant disease such as tumor < 12 months; and coagulopathy, or moderate or severe hepatic or renal dysfunction (creatinine clearance rate < 60 ml/min/1.73 m2).

Outcome. Efficacy was evaluated by the incidence of major adverse cardiovascular and cerebrovascular events (MACCE), including death from all causes, myocardial infarction (MI), severe arrhythmia, heart failure (HF), stent thrombosis, stroke, and shock. Safety was evaluated by the incidence of bleeding. The definition and classification of bleeding in this study were based on the bleeding classification criteria developed by the Bleeding Academic Research Consortium (BARC) in 2011.

Statistical analysis. Continuous variables that followed a symmetric distribution are presented as the mean ± standard deviation (SD), and the differences between groups were analyzed using two-sample t-tests. Asymmetrically distributed continuous variables are expressed as medians with interquartile ranges, and the differences were analyzed by Wilcoxon rank-sum tests. The analyses for the categorical data expressed as percentages were performed by Pearson c2 or Fisher exact tests. Because baseline characteristics differed between the treatment groups, additional adjustments were performed. Propensity score matching (PSM) was performed using the proximity method according to 1 : 1 to adjust the baseline disequilibrium factors (age, height, weight, sex, smoking history, hemoglobin, red blood cells) between the two groups; the matching tolerance was 0.02. After PSM, a  c2 test was used to compare the incidence of outcome events between the two groups. The hazard ratio (for fondaparinux vs. enoxaparin) and two-sided 95% confidence interval were calculated using a Cox proportional-hazards model, with the treatment group as the only covariate. Two-tailed p-values of less than 0.05 were considered to indicate statistical significance. SPSS 26.0 software was used for the data analysis.

Results. Baseline characteristics. A total of 482 patients with AMI, who were attending the Shanxi

AMI patients eligible for the study (n = 567) from Cardiovascular Hospital affiliated to Shanxi Medical University between August 2019 to August 2021

• No upstream bivalirudin (n = 65)

• Lost to follow-up (n = 12)

• Incomplete data (n = 8)

AMI patients included in the study (n = 482)

Bivalirudin bridging fondaparinux (n = 260)

Figure 1. Flow chart

Bivalirudin bridging enoxaparin (n = 222)

and safety of bivalirudin bridging enoxaparin versus fondaparinux in patients with acute myocardial infarction undergoing primary percutaneous coronary intervention: evidence from a single-center study

Before PSM

c 2 / t value

Fondaparinux (171)

Variable

2.938

Enoxaparin (171)

P -value

c 2 / t value

After PSM Enoxaparin (222)

Fondaparinux (260)

14 (8.2)

22 (12.9)

0.175

3.490

17 (6.5)

P -value TIMI blood flow grading after stent implantation: 0

23 (10.4)

0.167

0 (0)

1 (0.4)

0.230 1

0 (0)

0.777

0.845

0 (0)

0 (0)

1 (0.6) 2

0 (0)

149 (87.1)

242 (93.1)

0 (0) 3

199 (89.6)

12 (7.0)

14 (8.2)

0.162

1.960

12 (4.6)

156 (91.2) Use of glycoprotein IIb/IIIa inhibitor during PPCI

17 (7.7)

162 (94.7)

167 (97.7)

158 (92.4)

164 (95.9)

0.583

0.398

Cardiovascular Hospital from August 2019 to August 2021, provided the data for this study. Patient enrolment and the flow of study participants are displayed in Figure 1. There were 222 patients in the enoxaparin group and 260 in the fondaparinux group. Patients treated with fondaparinux were on average 6.5 years older than those treated with enoxaparin, were shorter, and weighed less. Compared with the enoxaparin group, the proportion of men (76.2% vs. 91.0%) and patients smoking (64.2% vs. 75.2%) was smaller in the fondaparinux group. Regarding blood tests, patients in the fondaparinux group had lower red blood cell and hemoglobin levels. In terms of patients’ procedural characteristics, both groups were balanced. To eliminate selection bias, PSM was performed. After the match, 171 pairs of patients were screened, with the baseline and procedural characteristics being balanced between the two treatment groups (Tables I and II).

0.302

0.713

Clinical outcomes. Efficacy. Compared with the enoxaparin group, the fondaparinux group had lower rates of MACCE (0.0% vs. 0.5%, p = 0.006) at discharge (Table III). With the extension of follow-up time, the difference in MACCE incidence between the fondaparinux and enoxaparin groups gradually decreased. By the end of the follow-up, 7.7% of patients had experienced a MACCE in the fondaparinux group, compared with 9.0% of those in the enoxaparin group (HR = 0.840, 95% CI: 0.452–1.561, p = 0.581). After PSM, there was a trend toward a lower rate of MACCE at 180 days after PPCI (9.9% vs. 4.1%; hazard ratio, HR = 0.402, 95% CI: 0.167–0.970, p = 0.042).

239 (91.9)

0.683 Postoperative concomitant medication, n (%): Aspirin

254 (97.7)

207 (93.2)

214 (96.4)

0.358 Table II. Cont.

0.378 P2Y12 receptor inhibitors

Before matching, fondaparinux was slightly superior to enoxaparin in reducing the rate of death at the full follow-up time, but the difference was statistically insignificant significant. After matching, fondaparinux showed a significant advantage in reducing the death rate at 90 days after PPCI (1.2% vs. 5.3%, p = 0.032) and 180 days after PPCI (2.9% vs. 8.8%, p = 0.021). Among the dead patients, the incidence of recurrent myocardial infarction was higher in both groups, accounting for nearly half of all causes of death. MACCE other than death was less frequent (Table IV).

Safety. All patients had type 1 bleeding, and no major bleeding occurred. Overall, the fondaparinux group had a slight advantage over the enoxaparin group in terms of less bleeding over the entire follow-up period, but the difference was not statistically significant. After matching, the risk of bleeding in the fondaparinux group was significantly lower than that in the enoxaparin group at discharge (2.9% vs. 15.2%, p < 0.001) and at 30 days (5.8% vs. 19.3%, p < 0.001), 90 days (5.8% vs. 21.2%, p < 0.001), and 180 days (7.0% vs. 21.1%, p < 0.001) after PPCI (Table III).

Efficacy and safety of bivalirudin bridging enoxaparin versus fondaparinux in patients with acute myocardial infarction undergoing primary percutaneous coronary intervention: evidence from a single-center study

Table III. Major adverse clinical events in PPCI patients during follow-up time

Outcome Before PSM

At discharge:

After PSM

Enoxaparin (222) Fondaparinux (260) c 2/ t value P -value Enoxaparin (171) Fondaparinux (171) c 2/ t value P -value

MACCE 5 (2.3) 0 (0.0) 3.927 0.048 4 (2.3) 0 (0.0) 2.277 0.131

Bleeding 31 (14.0) 31 (11.9) 0.445 0.505 26 (15.2) 5 (2.9) 15.644 < 0.001

30 days after operation:

MACCE 6 (2.7) 1 (0.4) 3.022 0.082 5 (2.9) 0 (0.0) 3.247 0.072

Bleeding 39 (17.6) 39 (15.0) 0.582 0.446 33 (19.3) 10 (5.8) 14.072 < 0.001

90 days after operation:

MACCE 12 (5.4) 11 (4.2) 0.364 0.547 9 (5.3) 4 (2.3) 1.999 0.157

Bleeding 42 (18.9) 40 (15.4) 1.060 0.303 36 (21.1) 10 (5.8) 16.979 < 0.001

180 days after operation:

MACCE 20 (9.0) 20 (7.7) 0.273 0.601 17 (9.9) 7 (4.1) 4.481 0.034

Bleeding 42 (18.9) 43 (16.5) 0.467 0.494 36 (21.1) 12 (7.0) 13.959 < 0.001

Table IV. Death and cardiovascular and cerebrovascular events at 180 days of follow-up

Outcome Before PSM After PSM Enoxaparin (222) Fondaparinux (260) c 2/ t value P -value Enoxaparin (171) Fondaparinux (171) c 2/ t value P -value

Death: 16 (7.2) 15 (5.8) 0.411 0.521 15 (8.8) 5 (2.9) 5.311 0.021 MI 6 7 6 2

HF 2 3 2 0 Stroke 4 2 3 0 Sudden cardiac death 3 2 3 2 Shock 1 1 1 1 Cardiovascular and cerebrovascular events:

4 (1.8) 5 (1.9) 0.000 1.000 2 (1.2) 2 (1.2) 0.000 1.000

MI 1 2 0 1 HF 0 1 0 1

Arrhythmia 0 1 0 0 Stent thrombosis 2 1 1 0 Angina 1 0 1 0

Discussion. Currently, PPCI is the most effective treatment to reduce the mortality rate of AMI. Perioperative bleeding complications of PCI reduce patient satisfaction, delay discharge, and increase costs; furthermore, they increase the risk of death, myocardial infarction, and stroke within one year [8–10]. Hence, there is an urgent need to explore the perioperative anticoagulation strategy of PPCI.

ATOLL study was the first clinical study on the efficacy and safety of enoxaparin and unfraction-

ated heparin (UFH) in STEMI patients undergoing PPCI. The results show that enoxaparin significantly reduced combined ischemic events such as death, infarction, and emergency revascularization, compared with UFH [11]. In the subgroup of OASIS-6 undergoing PPCI, subcutaneous injection of fondaparinux eight days after operation did not yield a clear benefit [7]. Few studies have investigated perioperative anticoagulation strategies for AMI patients undergoing PPCI, and the results are inconsistent. In addition, most studies of this type

have been concentrated in Europe and America, and there are few studies on Asian races. Therefore, it is of practical and clinical significance to explore the safety and effectiveness of bivalirudin bridging fondaparinux or enoxaparin in perioperative PPCI. In general, our study found that the anticoagulation strategy of bivalirudin bridging fondaparinux seems to be superior to that of bivalirudin bridging enoxaparin in patients with AMI who are undergoing PPCI.

Bundhun et al. confirmed that fondaparinux is an ideal anticoagulant [12]. Two large-scale international clinical trials, OASIS-5 and 6, confirmed that compared with UFH or low-molecular-weight heparin (LMWH), fondaparinux had a similar anticoagulant effect on acute coronary syndrome (ACS) and significantly reduced the incidence of severe bleeding, with a significant clinical net benefit. Nevertheless, it was also found that catheter thrombosis increased significantly in patients treated with fondaparinux alone [13]. Abundant clinical trial evidence shows that bivalirudin has significant advantages in anticoagulation during PCI [14, 15]. In 2009, the US PCI guidelines recommended that bivalirudin be used in STEMI patients (Class I recommendation) and STEMI patients with a high risk of bleeding during direct PCI (Class IIa recommendation). The 2010 European Guidelines for myocardial revascularization also recommended that bivalirudin be the first choice in PCI for patients with ACS (Class I recommendation). Recently, a study from China showed that routine continuation of full-dose bivalirudin infusion for 2–4 h (mean 3 h) post-PCI is superior to UFH monotherapy in reducing bleeding and ischemic events at 30 days among patients with STEMI undergoing PPCI [16]. Bivalirudin has become a commonly used anticoagulant in emergency and elective PCI [17]. Compared with heparin or low molecular weight heparin, bivalirudin is more suitable for individuals at high risk of bleeding who require anticoagulant therapy because of its relatively low bleeding side effects.

In conclusion, the anticoagulation strategy of bivalirudin bridging fondaparinux seems to provide a favorable net clinical benefit in reducing patient mortality and bleeding risk. However, the data in this research are obtained from a single-center and non-randomized study, which may imply some selection bias. Multi-center randomized controlled trials are still needed to verify the results in the future. In addition, a longer follow-up period is needed to further confirm the efficacy and safety of bivalirudin bridging fondaparinux.

Acknowledgments

This work was supported by Special fund for clinical research of Zhongguancun precision Medi-

cine Foundation (grand NO. yxjl-2021-0353-0465) and Doctoral Research Fund of Shanxi Cardiovascular Hospital (XYS2021B003).

Conflict of interest

The authors declare no conflict of interest.

References

1. Vis MM, Beijk MA, Grundeken MJ, et al. A systematic review and meta-analysis on primary percutaneous coronary intervention of an unprotected left main coronary artery culprit lesion in the setting of acute myocardial infarction. JACC Cardiovasc Interv 2013; 6: 317-24.

2. Xu L, Wang LF, Li KB, Zhang ZY, Sun H, Yang XC. Nicorandil prior to primary percutaneous coronary intervention improves clinical outcomes in patients with acute myocardial infarction: a meta-analysis of randomized controlled trials. Drug Des Dev Ther 2019; 13: 1389-400.

3. Hamm CW, Bassand JP, Agewall S, et al. ESC Committee for Practice Guidelines; ESC Guidelines for the management of acute coronary syndromes in patients presenting without persistent ST-segment elevation: The Task Force for the management of acute coronary syndromes (ACS) in patients presenting without persistent ST-segment elevation of the European Society of Cardiology (ESC). Eur Heart J 2011; 32: 2999-3054.

4. Schulz S, Mehilli J, Ndrepepa G, et al. Intracoronary Stenting and Antithrombotic Regimen: Rapid Early Action for Coronary Treatment (ISAR-REACT) 3 Trial Investigators. Bivalirudin vs. unfractionated heparin during percutaneous coronary interventions in patients with stable and unstable angina pectoris: 1-year results of the ISAR-REACT 3 trial. Eur Heart J 2010; 31: 582-7.

5. Luca LD, Uguccioni M, Natale E, et al. Effectiveness of fondaparinux vs unfractionated heparin following percutaneous coronary intervention in survivors of out-of-hospital cardiac arrest due to acute myocardial infarction. Eur J Clin Pharmacol 2021; 77: 1563-7.

6. The OASIS-5 Trial Group. Comparison of fondaparinux and enoxaparin in acute coronary syndromes. N Engl J Med 2006; 354: 1464-76.

7. Yusuf S, Mehta RS, Chrolavicius S, et al. Effects of fondaparinux on mortality and reinfarction in patients with acute ST-segment elevation myocardial infarction: the OASIS-6 randomized trial. JAMA 2006; 295: 1519-30.

8. Wang X, Zhao GQ, Zhou MG, et al. Trends in bleeding events among patients with acute coronary syndrome in China, 2015 to 2019: Insights From the CCC-ACS Project. Front Cardiovas Med 2021; 8: 769165.

9. Mohamed OM, Kinnaird T, Anderson R, et al. Combinations of bleeding and ischemic risk and their association with clinical outcomes in acute coronary syndrome. Int J Cardiol 2019; 290: 7-14.

10. Januszek R, Dziewierz A, Siudak Z, et al. Concomitant multi-vessel disease is associated with a lower procedural death rate in patients treated with percutaneous coronary interventions within the left main coronary artery (from the ORPKI registry). Arch Med Sci 2021; 17: 881-90.

11. Montalescot G, Zeymer U, Silvain J, et al. Intravenous enoxaparin or unfractionated heparin in primary percutaneous coronary intervention for ST-elevation myocardial infarction: the international randomised open-label ATOLL trial. Lancet 2011; 378: 693-703.

Yanqing Guo, Jingping Wang, Zhixin Wang, Li Li, Jian An

Efficacy and safety of bivalirudin bridging enoxaparin versus fondaparinux in patients with acute myocardial infarction undergoing primary percutaneous coronary intervention: evidence from a single-center study

12. Bundhun PK, Shaik M, Yuan J. Choosing between Enoxaparin and Fondaparinux for the management of patients with acute coronary syndrome: a systematic review and meta-analysis. BMC Cardiovas Disor 2017; 17: 116.

13. Mehta SR, Boden WE, Eikelboom JW, et al. Antithrombotic therapy with fondaparinux in relation to interventional management strategy in patients with ST- and non-ST-segment elevation acute coronary syndromes: an individual patient-level combined analysis of the Fifth and Sixth Organization to Assess Strategies in Ischemic Syndromes (OASIS 5 and 6) randomized trials. Circulation 2008; 118: 2038-46.

14. Erlinge D, Omerovic E, Fröbert O, et al. Bivalirudin versus heparin monotherapy in myocardial infarction. N Engl J Med 2017; 377: 1132-42.

15. Han YL, Guo JC, Zheng Y, et al.; BRIGHT Investigators. Bivalirudin vs. heparin with or without tirofiban during primary percutaneous coronary intervention in acute myocardial infarction: the BRIGHT randomized clinical trial. JAMA 2015; 313: 1336-46.

16. Li Y, Liang Z, Qin L, et al. Bivalirudin plus a high-dose infusion versus heparin monotherapy in patients with ST-segment elevation myocardial infarction undergoing primary percutaneous coronary intervention: a randomized trial. Lancet 2022; 400: 1847-57.

17. Hu L, Guo K, Guo ZG. Bivalirudin for patients with STEMI at high risk of bleeding undergoing PPCI. Nature reviews. Cardiology 2017; 14: 626.

Extended application of BACs-on-Beads technique in prenatal diagnosis

Shiyu Sun1,2, Zhonghua Zhang3, Jing Zhao4, Xinqiang Lan1

1Department of Medical Genetics, The Affiliated Weihai Second Municipal Hospital of Qingdao University (Weihai Maternity and Child Care Hospital), Weihai, China

2Dong Guan Eontec Co., Ltd, Dongguan, Guangdong, China

3Department of Otorhinolaryngology, The Affiliated Weihai Second Municipal Hospital of Qingdao University (Weihai Maternity and Child Care Hospital), Weihai, China

4School of Life and Pharmaceutical Sciences, Dalian University of Technology, Panjin, China

Submitted: 11 September 2022; Accepted: 22 October 2022

Online publication: 9 December 2022

Arch Med Sci 2023; 19 (1): 250–257

DOI: https://doi.org/10.5114/aoms/155981

Copyright © 2022 Termedia & Banach

Abstract

Introduction: This study explored the application of bacterial artificial chromosomes (BACs)-on-Beads (BoBs) technique, especially its ability to detect microdeletion/microduplication regions with a single probe.

Methods: Both chromosome karyotyping and BoBs technique were applied on a total of 2218 pregnant women. Chromosome microarray analysis (CMA) was performed on patients whose cells were reported as being abnormal by BoBs technique with a single probe.

Results: Twenty-two cases were detected as microdeletion/microduplication with a single probe, which was consistent with the CMA results.

Conclusions: We believe that the microdeletion/microduplication results detected by BoBs technique with a single probe provide comprehensive guidance for prenatal diagnosis.

Key words: microdeletion, BoBs technology, single probe, microduplication.

Birth defects account for a high proportion of infant mortality and morbidity in China [1]. With the increased average age of pregnant women, neonatal birth defects have become increasingly prevalent. Therefore, it is of great significance to carry out a prenatal diagnosis to reduce the birth rate of defective newborns. Chromosomal abnormalities are an important cause of birth defects; thus using different detection methods to detect and study chromosomal abnormalities is important and significant.

Multiple detection methods have been developed to detect chromosomal abnormalities in prenatal diagnosis, including chromosome karyotyping, fluorescence in situ hybridization (FISH), bacterial artificial chromosomes (BACs)-on-Beads (BoBs), chromosomal microarray analysis (CMA), and quantitative fluorescent polymerase chain reaction (QF-PCR) [2]. Although chromosome karyotyping can accurately detect the number and structure of chromosomes in amniotic fluid cells, it cannot detect chromosome microdeletion and microduplication. Additionally, the period of amniotic fluid cell culture is relatively long (at least 7 days), suggesting that the karyotyping method is time-consuming and not suitable

Corresponding author: Shiyu Sun PhD Department of Medical Genetics

The Affiliated Weihai Second Municipal Hospital of Qingdao University Weihai Maternity and Child Care Hospital Weihai, China E-mail: 263152326@qq.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

for rapid diagnosis. To date, more than 300 microdeletion and microduplication syndromes have been reported worldwide, with the incidence rates ranging from 1/4000 to 1/50 000 [3]. Therefore, the importance of chromosome microdeletion and microduplication detection should be emphasized.

FISH can quickly detect trisomy 13, trisomy 18, trisomy 21, and numerical abnormalities of sex chromosomes; however, it requires specific probes to detect the microdeletion and microduplication of uncommon chromosomes. Instead, CMA can detect the chromosome deletion and duplication of the whole genome, however, the complicated results from CMA require plenty of time for analysis. In addition, CMA as a diagnostic tool also creates uncertainties when copy number variation (CNV) of unknown pathogenic significance (variant of unknown significance – VOUS) is detected and the test is relatively costly [4]. Recent studies have reported that BoBs technique has been used for the detection of aneuploidies, including trisomy 13, trisomy 18, trisomy 21, numerical abnormalities of sex chromosomes, as well as at least 9 microdeletion regions [5]. The BoBs technology is a cytogenetic assay for rapid prenatal diagnosis [6], and is a molecular detection technique based on the principle of liquid-phase gene microarray with biotin-labeled samples, hybridized with reference DNA and solidified into fluorescence-encoded microspheres, which are detected by specific BACs DNA probes [7] The BoBs assay is a bead-based multiplex assay, based on PerkinElmer’s BoBs and Luminex’s technologies [5, 8]. Therefore, it could be used to detect multiple syndromes caused by these microdeletion regions, which include Angelman syndrome (AS), Prader-Willi syndrome (PWS), DiGeorge syndrome (DGS), Miller-Dieker syndrome (MDS), cri-du-chat syndrome (CdCS), Wolf-Hirschhorn syndrome (WHS), Smith-Magenis syndrome (SMS), Langer-Giedion syndrome (LGS), and Williams-Beuren syndrome (WBS) [9].

Here, a total of 2218 pregnant women with high-risk factors were enrolled in this study for evaluation of BoBs technique in clinical settings. Amniotic fluid cells were examined by combining BoBs technique with chromosome karyotyping, aiming to explore potential benefits of combination of the two testing methods in prenatal diagnosis. Furthermore, CMA was employed on patients whose cells have microdeletion/microduplication detected by BoBs technique with a single probe.

Methods. Subjects A total of 2266 pregnant women with high-risk factors for chromosomal abnormalities admitted to Weihai Maternity and Child Care Hospital (Weihai, Shandong, China) in the period from September 2020 to December 2021 were enrolled in this study. The indications for prenatal

genetic evaluation included advanced maternal age (> 35 years), high-risk non-invasive prenatal testing (NIPT) results, abnormal ultrasound results, highrisk serological screening results, chromosomal disorder history from the couples, and adverse pregnancy history. In this study, the pregnant women or their family members signed informed consent.

Specimen collection. During amniocentesis guided by B-ultrasound, 25 ml of amniotic fluid was extracted, 20 ml of which was used for the amniotic fluid cell culture and 5 ml of which was used for the BoBs detection.

Conventional karyotype analysis Approximately 20 ml of amniotic fluid was centrifuged at 1,500 rpm for 10 min at 4°C to separate amniotic cells. The cells were cultured, harvested and mounted on glass slides for the chromosome G-banded analysis by the Leica system. On each slide, 20 stained metaphases were randomly selected and examined, and 6 karyograms were created for the chromosome analysis. If a suspicious chromosomal abnormality or a chromosomal polymorphism was found, the count number of metaphases was then increased to a number between 50 and 100 for a more reliable result.

BoBs assay The DNA samples were extracted from approximately 5 ml of amniotic fluid using DNA extraction reagents according to the kit’s handbook (QIAGEN, Germany). Approximately 5 ml of amniotic fluid was centrifuged and the flow-through was discarded. 200 μl of Buffer AL was added, and mixed thoroughly by vortexing. It was incubated at 56°C for 30 min. We briefly centrifuged the 1.5 ml microcentrifuge tube to remove drops from the lid, added 200 μl of ethanol (100%), mixed it thoroughly by vortexing, briefly centrifuged the tube to remove drops from the lid, pipetted the mixture onto the QIAamp Mini spin column (in a 2 ml collection tube) and centrifuged it at 12 000 rpm for 1 min. Then we discarded the flow-through and collection tube, placed the QIAamp Mini spin column in a new 2 ml collection tube and added 500 μl Buffer AW1, centrifuged and discarded the flow-through, added 500 μl of Buffer AW2, then centrifuged and discarded the flow-through, placed the column in a new collection tube and centrifuged at full speed for 1 min, placed the column in a new 1.5 ml microcentrifuge tube, added 40 μl of AE and incubated it at room temperature (15–25°C) for 3 min, and centrifuged it at 12 000 rpm for 2 min to elute the DNA.

Male and female reference samples were used for the internal quality control standards and the comparison standards. A BoBs kit (Perkin Elmer, Waltham, MA, USA) was used for BoBs assay. The beads were analyzed using a Luminex 200 cytometric acquisition system (Austin, TX, USA) for data collection. Data were analyzed using BoBsoft

Extended application of BACs-on-Beads technique in prenatal diagnosis

1.0 software. Results’ evaluation criteria: The normal ratio was 1.0. If the ratio was less than 0.8, it indicated that the probe was missing. If the ratio was more than 1.2, it indicated that the probe was repeated. The result suggested a deletion or duplication in the region if there were 3 or more probes in a certain target area exceeding the cut-off value of male and female reference, which indicated that the region was a deletion or duplication.

CMA assay. 10 ml of amniotic fluid was extracted for the CMA analysis. Using Affymetrix’s CytoScan 750K chip, the amplification, hybridization, scanning and analysis were followed as the standard operating procedures of the Infinium HD Assay. ClinGen, ClinVar, DGV, OMIM, DECIPHER and other databases were used for interpretation of results. According to the classification standards recommended by the ACMG (PMID: 31690835), five categories were divided for the clinical determination: pathogenic, likely pathogenic, uncertain significance, likely benign, and benign.

Ethics approval and consent to participate. The authors declare that the experiments of the present study comply with the current laws of China. All patients signed written informed consent forms and agreed to the use of relevant data and information for scientific research. This study was approved by the ethics committee of Weihai Maternity and Child Care Hospital (WHFY-YXLLWYH-L2022004).

Results. Cell culture results. The amniotic fluid cells from a total of 2218 cases were cultured for

detection. The length of harvest time was related to the number and growth state of cells. In general, the average harvest time was 9 days, with the shortest harvest time of 8 days and the longest harvest time of 15 days.

Chromosomal results detected by BoBs technique. Out of the 2218 amniotic fluid samples, 74 cases were reported with chromosomal abnormalities, with a detection rate of 3.34% (Tables I and II). Among the 74 cases, 47 cases had numerical abnormalities at chromosomes 13, 18, 21, X and Y, which was consistent with the karyotyping results; 4 cases showed microdeletion at 5p15.3-15.2, 18p11.32p11.21, 22q11.2, and Y microdeletion, respectively; 1 case showed microduplication at 18p11.32p11.21 (Table I and Figure 1); 3 cases were reported with a chromosome missing and 9 cases were reported with chromosome duplication with the first probe of Xp22.31; 4 cases were reported with chromosome duplication with the probes of 7q11.23, including 1 case with the first probe, 1 case with the second probe, 1 case with the second and third probe, and 1 case with the third probe; 1 case was reported with chromosome duplication with the fifth probe of 8q24.11; 1 case was reported with chromosome duplication with the second probe of 22q11.21; 2 cases were reported with chromosome duplication with the fourth probe of 22q11.21 (Table II). The patients whose samples were reported with chromosomal abnormalities with the single probe detection were recommended for further CMA detection.

Table I. Comparison of BoBs and chromosome karyotype analysis

BoBs Case

Karyotyping

Trisomy 21 30 47, XN, +21

Trisomy 18 5 47, XN, +18

Trisomy 13 2 47, XN, +13

Trisomy 18 1 47, XY, +18[15]/46, XY[45]

18p11.32p11.21 microdeletion 1 45, XN, -18[11]/46, XN, r18(p11.2q22.3)[39]

18p11.32p11.21 microduplication 1 46, XN, -21, +der(18)t(18;21)(q11.2;q11.2

Trisomy 21 1 47, XX, +21[55]/46, XX[5]

Trisomy 21 1 47, XX, +21[33]/46, XX[27]

Sex chromosomal abnormality 1 45, X0[30]/46, XY[20]

Sex chromosomal abnormality 1 47, XXY[68]/48, XXYY[17]/49, XXYYY[15]

Sex chromosomal abnormality 2 45, X0

Sex chromosomal abnormality 1 47, XXY

Sex chromosomal abnormality 1 45, X0[38]/46, X, der(X)t(X; 4)(q28;q26)[12]

Sex chromosomal abnormality 1 47, XXX

Y microdeletion 1 45, X0[40]/46, X, +mar[11]

46, XN 1 45, X0[11]/46, XX[39]

46, XN 1 45, X0[5]/46, XX[55]

46, XN 1 47, XX, +mar[51]/46, XX[9]

Shiyu Sun, Zhonghua Zhang, Jing Zhao, Xinqiang Lan

Table II. Microdeletions/microduplications detected by BoBs and CMA assay

No. Karyotyping BoBs CMA

1 46, XX

Microduplication on the first probe of Xp22.31 arr Xp22.31(6,449,836-8,135,103)x3

2 46, XX Microduplication on the first probe of Xp22.31 arr Xp22.31(6,449,837-8,135,568)x3

3 46, XX Microduplication on the first probe of Xp22.31 arr Xp22.31(6,455,152-8,135,103)x3

4 46, XY Microduplication on the first probe of Xp22.31 arr Xp22.31(6,455,152-8,135,568)x2

5 46, XX Microduplication on the first probe of Xp22.31 arr Xp22.31(6,449,559-7,218,608)x3

6 46, XX Microduplication on the first probe of Xp22.31 arr Xp22.31(6,449,837-8,135,568)x3

7 46, XY Microduplication on the first probe of Xp22.31 arr Xp22.31(6,455,152-8,135,644)x2

8 46, XX Microduplication on the first probe of Xp22.31 arr Xp22.31(6,449,559-8,135,568)x3

9 46, XN Microduplication on the first probe of Xp22.31 no

10 46, XY Microdeletion on the first probe of Xp22.31 arr Xp22.31(6,455,151-8,135,053)x0

11 46, XY Microdeletion on the first probe of Xp22.31 arr Xp22.31(6,455,152-8,141,076)x0

12 46, XX Microdeletion on the first probe of Xp22.31 arr Xp22.31(6,455,152-8,135,103)x1

13 45, X0[40]/46, X, + mar[11]

Y microdeletion

14 46, XN,del(5)(p15.2) 5p15.3-15.2 microdeletion

arr Yq11.22 1q11.222(15,465,819-21,460,245) x0-1,Yq11.22 2q11.23(21,494,511-28,799,654)x0

15 46, XN Microduplication on the second and third probe of 7q11.23 no

16 46, XN Microduplication on the third probe of 7q11.23 no

17 46, XN Microduplication on the first probe of 7q11.23 arr 7q11.23(72,723,371-74,136,633)x3

18 46, XN Microduplication on the second probe of 7q11.23 no

19 46, XN Microduplication on the fifth probe of 8q23-q24

arr 8q24.11(118,225,217-118,884,779) x3

20 46, XN Microduplication on the third probe of 15q11.2 arr 15q11. 2q13.1(22,770,422-28,397,034)x3

21 46, XN Microduplication on the third probe of 15q11.2 arr 15q11. 2q13.1(22,770,422-28,540,345)x3

22 46, XN, -21, +der(18)t(18;21) (q11.2;q11.2)

23 45, XN, -18[11]/46, XN, r18(p11.2q22.3) [39]

18p11.32p11.21 microduplication no

18p11.32p11.21 microdeletion arr 18p11.3 2p11.21(136,228-15,079,294)x1,18q2 2.3q23(68,960,865-78,013,728)x1

24 46, XN 22q11.21 microdeletion

25 46, XN Microduplication on the second probe of 22q11.21 no

26 46, XN Microduplication on the fourth probe of 22q11.21

arr 22q11.21(18,648,856-21,442,670) x3

27 46, XN Microduplication on the fourth probe of 22q11.21 arr 22q11.21(18,648,856-21,800,471) x3

Although 6 patients did not perform CMA, the CMA results of the remaining patients confirmed the chromosomal microdeletion/microduplication results reported by BOBs technique (Table II and Figure 2).

Chromosomal results detected by karyotyping We detected 95 cases of abnormal chromosomes with the detection rate of 4.28% (95/2218) by karyotyping. Among the 95 cases, 50 cases had

a numerical abnormality of chromosomes and 45 cases had a structural abnormality of chromosomes (Table III). For the numerical abnormality, 11 cases were reported as chimera with the karyotyping results of 45, X0[11]/46, XX[39], 45, X0[5]/46, XX[55] and 47, XX, +mar[51]/46, and XX[9]. However, their corresponding results from BoBs technique were reported as being normal. The cases detected as the chromosome structure

Extended application of BACs-on-Beads technique in prenatal diagnosis

abnormalities (chromosomal translocation and inversions) by karyotyping were also detected as being normal by BoBs technique.

Discussion. Birth defects are congenital disorders caused by various abnormalities during pregnancy, which are the main reasons for the disability and even death of the newborns. It is well known that chromosomal abnormality is one of the causes of birth defects. In recent years, although the three-level prevention and control policy has been implemented to prevent and treat birth defects in China, there are still about 900,000 newborns with birth defects each year. Therefore, there is an urgent need to employ pre-pregnancy examination and novel neonatal disease screening technologies to prevent disability and health hazards of newborns [10].

Karyotyping is a gold standard test for detecting chromosomal aberrations in prenatal diagnosis. However, it has several drawbacks, including 1) the long cell culture time (at least 7 days) of the

Figure 1. Microdeletions/microduplications detected by BoBs assay. A – Microdeletion of 18p11.32p11.21; B – Microduplication of 18p11.32p11.21; C – Microdeletion of Y

amniotic fluid cells; 2) the potential contamination during the cell culture; 3) few cells at the division phase; 4) the higher failure rate of the amniotic fluid cell culture with the increase of gestational ages; 5) the low loci resolution (greater than 10 Mb in size). Since September 2020, we have introduced the BoBs technique to combine with karyotyping for a more rapid and comprehensive prenatal diagnosis, with additional detection of aneuploidies at 9 microdeletion/microduplication regions.

In our study, the numerical abnormalities at chromosome 13, 18, 21, X, and Y detected by BoBs were found to be consistent with the results from the karyotyping analysis. Briefly, 2 cases of trisomy 13 were detected by BoBs, with the corresponding karyotyping results of 47, XN, +13. Six cases of trisomy 18 were detected by BoBs, five of which had the corresponding karyotyping result of 47, XN, +18 and one of which had the corresponding karyotyping result of 47, XY,

Figure 2. Single probe deletion/duplication detected by BoBs assay and confirmed by CMA. A , D –BoBs assay results revealed microdeletion on the first probe of Xp22.31; SNP array verification was consistent with BoBs assay; B , E –BoBs assay results revealed microduplication on the first probe of Xp22.31; SNP array verification was consistent with BoBs assay; C , F –BoBs assay results revealed microduplication on the third probe of 7q11.23; SNP array verification was consistent with BoBs assay

Table III. Chromosomal abnormalities detected by karyotyping and BoBs

Chromosomal abnormalities Karyotyping

Chromosomal abnormalities detected by BoBs

Chromosomal normalities detected by BoBs

Structural abnormality 45 3 42 Chimera 11 8 3

+18[15]/46, XY[45]. One case of microduplication at 18p11.32p11.21 was detected by BoBs, with the karyotyping result of 46, XN, -21, +der(18)t(18; 21)(q11.2; q11.2), and its corresponding CMA result of 18p11.32p11.21(136,228-15,079,294) x1, 18q22.3q23(68,960,865-78,013,728)x1. 32 cases of trisomy 21 were detected by BoBs, with thirty corresponding karyotyping results of 47, XN, +21, one corresponding karyotyping result of 47, XX, +21[55]/46, XX[5], and one corresponding karyotyping result of 47, XX, +21[33]/46, XX[27]. In addition, 6 cases were detected as sex chromosome abnormalities by BoBs technique, of which two had karyotyping results of 45, X0, one of 45, X0[30]/46, XY[20], one of 47, XXY[68]/48, XXYY[17]/49, XXYYY[15], one of 45, X0[38]/46, X, der(X)t(X; 4)(q28;q26)[12], one of 47, XXY, and one of 47, XXX. In contrast, 2 cases with normal results from BoBs technique were identified as chromosome abnormalities by karyotyping, with results of 45, X0[11]/46, XX[39] and 45, X0[5]/46, XX[55], respectively. Previous studies indicated that the detection threshold of BoBs on chimera was 20–40% [11]. Our results here also indicated the limitation of BoBs technique in the detection of a low proportion of chimeras. Additionally, the results of 42 amniotic fluid samples from karyotyping were reported as being abnormal, while their corresponding results detected by BoBs technique were shown as being normal, indicating that BoBs technique was incapable of detecting the balanced translocation of the chromosomes.

In addition to its rapid detection of aneuploidy, BoBs technique could also be used to detect chromosomal microdeletion and microduplication efficiently and sensitively. Our BoBs results identified 2 cases of microdeletion syndromes, including 5p15.3-15.2 microdeletion syndrome and 22q11.21 microdeletion syndrome. Therefore, the couples were recommended for genetic counseling and further chromosomal testing of maternal blood. It would be significant for their second conception if one of the couples were a carrier or chimera [12, 13].

Moreover, we identified 22 microdeletion/ microduplication cases by BoBs technique with a single probe. Briefly, 12 microdeletion/microduplication events occurred at the Xp22.31 region with the variation rate of 0.54% (12/2218) (Table II, Figures 2 A and B). Previous studies indicated that steroid sulfatase (STS) was located in

the Xp22.31 region. It has been reported that the deletion of the STS gene was associated with the X-linked recessive ichthyosis disease (XLRI) [14, 15]. Moreover, repetition of the Xp22.31 fragment was associated with developmental delay, autism, language development delay, hypotonia, epilepsy, congenital finger flexion, precocious puberty, hyperopia, digital flexion, absence seizures, and other clinical phenotypes [16, 17].

In addition, 4 cases were detected as microduplication at the 7q11.23 region by BoBs technique, one of which underwent further CMA with the result of 7q11.23 (72,723,371-74,136,633)x3 (Table II and Figures 2 C and F). The 7q11.23 region contains the elastin (ELN) gene. It has been reported that duplication of the ELN gene in the 7q11.23 region was associated with the autosomal dominant 7q11.23 duplication syndrome [18]. The 7q11.23 duplication syndrome is a rare chromosomal microduplication syndrome, with a prevalence of approximately 1/12,000, the clinical phenotypes of which include facial abnormalities, cardiovascular disease, neurological abnormalities, speech disorders, behavioral abnormalities, developmental delays, and intellectual disabilities [19, 20]. One case was identified as microduplication by the fifth probe at the 8q24.11 region with its further CMA result of 8q24.11 (118,225,217-118,884,779)x3, confirming our BoBs analysis. However, the potential impact of duplication of the 8q24.11 fragment was still unclear (Table II).

Moreover, 2 cases were identified as microduplication at the 15q11.2q13.1 region by the third probe with their CMA results of 15q11.2q13.1 (22,770,422- 28,397,034)x3 and 15q11.2q13.1 (22,770,422-28,540,345)x3 respectively, further validating our BoBs results (Table II). Angelman syndrome and Prader-Willi syndrome were caused by dysfunctional genes located in the 15q11.2q13.1 region. The region contains 24 OMIM genes which were associated with genetic imprinting. Duplication of the 15q11.2q13.1 region would cause various clinical phenotypes [21]. Therefore, we recommended further genetic counseling and CMA on parental amniotic fluid specimens for examining the origin of the 15q11.2q13.1 duplicated region with parental amniotic fluid specimens. One case was identified as microduplication at the 22q11.21 region by the second probe and two cases by the fourth probe. The 22q11.21 region contained 49 OMIM genes,

Shiyu Sun, Zhonghua Zhang, Jing Zhao, Xinqiang Lan

including CLTCL1, HIRA and TBX1 (Table II). Duplication of this region could lead to mental retardation, learning disabilities, growth retardation, and dystonia [22, 23].

In conclusion, our study demonstrated that the combination of traditional karyotyping and BoBs technique is essential for the rapid and accurate prenatal diagnosis and provides necessary information for genetic counseling and further examinations. BoBs technique could accelerate the speed of prenatal diagnosis, increase the detection rate, and reduce the incidence of birth defects. Although the microdeletion/microduplication results detected by BoBs techniques with a single probe were not included in the final diagnostic report, we confirmed all these results with CMA, indicating the accuracy of BoBs technique. We believe that this information is beneficial to the patients if they can be included in the diagnostic report in the future. Additionally, based on the massive results about the functional knowledge of key genes in these microdeletion/microduplication regions in the final diagnostic report, we believe our study will provide more comprehensive guidance for prenatal diagnosis.

Acknowledgments

We express our appreciation to the subjects who participated in this study. We also express our appreciation to Weihai City Health Commission for funding this work. This research was funded by Weihai City Health Commission (2013GNS046-1).

Conflict of interest

The authors declare no conflict of interest.

References

1. Zhuang JL, Chen CN, Jiang YY, et al. Application of the BACs-on-Beads assay for the prenatal diagnosis of chromosomal abnormalities in Quanzhou. China. BMC Pregnancy Childb 2021; 21: 94.

2. Pertl B, Yau SC, Sherlock J, et al. Rapid molecular method for prenatal detection of Down’s syndrome. Lancet 1994; 343: 1197-8.

3. Weise A, Mrasek K, Klein E, et al. Microdeletion and microduplication syndromes. J Histochem Cytochem 2012; 60: 346-58.

4. Miller DT, Adam MP, Aradhya S, et al. Consensus statement: chromosomal microarray is a first-tier clinical diagnostic test for individuals with developmental disabilities or congenital anomalies. Am J Hum Genet 2010; 86: 749-64.

5. Choy RKW, Chen Y, Sun XF, et al. BACs-on-beads: a new robust and rapid detection method for prenatal diagnosis. Expert Rev Mol Diagn 2014; 14: 273-80.

6. Fang Y, Wang GM, Gu LZ, et al. Application of karyotype analysis combined with BACs-on-Beads for prenatal diagnosis. Exp Ther Med 2018; 16: 2895-900.

7. Chen L, Du JM, Wang JL, et al. Study on the application value of BACs-on-Beads technology combined with chromosome karyotype analysis in prenatal diagnosis. Transl Pediatr 2022; 11: 212-8.

8. Gross SJ, Bajaj K, Garry D, et al. Rapid and novel prenatal molecular assay for detecting aneuploidies and microdeletion syndromes. Prenat Diagn 2011; 31: 259-66.

9. Vialard F, Simoni G, Aboura A, et al. Prenatal BACs-onBeads: a new technology for rapid detection of aneuploidies and microdeletions in prenatal diagnosis. Prenatal Diagnosis 2011; 31: 500-8.

10. Koczkodaj D, Zmorzyński S, Michalak-Wojnowska M, et al. Examination of the FLT3 and NPM1 mutational status in patients with acute myeloid leukemia from southeastern Poland. Arch Med Sci 2016; 12: 120-8.

11. Cheng YKY, Wong C, Wong HK, et al. The detection of mosaicism by prenatal BoBs? Prenat Diagn 2013; 33: 42-9.

12. Nguyen JM, Qualmann KJ, Okashah R, et al. 5pdeletions: current knowledge and futuredirections. Am J Med Genet C Semin Med Genet 2015; 169: 224-38.

13. Pang YH, Yu Y, Deng XY, et al. Chromosome 22q11.21 and 11p15.4 microdeletions confirmed by high-throughput sequencing analysis in one patient with asymmetric cry syndrome: case report and review of the literature. Clin Case Rep 2021; 9: e04072.

14. Gubb SJA, Brcic LJ, Underwood JFG, et al. Medical and neurobehavioural phenotypes in male and female carriers of Xp22.31 duplications in the UK Biobank. Hum Mol Genet 2020; 29: 2872-81.

15. Takeichi T, Akiyama M. Inherited ichthyosis: non-syndromic forms. J Dermatol 2016; 43: 242-51.

16. Li F, Shen YP, et al. Interstitial microduplication of Xp22.31: Causative of intellectual disability or benign copy number variant? Eur J Med Genet 2010; 53: 93-9.

17. Liu PF, Erez A, Nagamani SCS, et al. Copy number gain at Xp22.31 includes complex duplication rearrangements and recurrent triplications. Hum Mol Genet 2011; 20: 1975-88.

18. Osborne LR, Mervis CB. 7q11.23 deletion and duplication. Curr Opin Genet Dev 2021; 68: 41-8.

19. Velleman SL, Mervis CB. Children with 7q11.23 duplication syndrome: speech, language, cognitive, and behavioral characteristics and their implications for intervention. Perspect Lang Learn Educ 2011; 18: 108-16.

20. Morris CA, Mervis CB, Paciorkowski AP, et al. 7q11.23 duplication syndrome: physical characteristics and natural history. Am J Med Genet A 2015; 167A: 2916-35.

21. Riikonen RS, Wallden T, Kokkonen H. Infantile spasms and 15q11.2q13.1 chromosome duplication in two successive generations. Eur J Paediatr Neurol 2016; 20: 164-7.

22. Yu A, Turbiville D, Xu FL, et al. Genotypic and phenotypic variability of 22q11.2 microduplications: an institutional experience. Am J Med Genet A 2019; 179: 2178-89.

23. Dupont C, Grati FR, Choy KW, et al. Prenatal diagnosis of 24 cases of microduplication 22q11.2: an investigation of phenotype-genotype correlations. Prenat Diagn 2015; 35: 35-43.

Extended application of BACs-on-Beads technique in prenatal diagnosis

Osteoporosis

Yaonan Cheng1, Qin Chen2, Ru Huang1, Chunbo Lao1, Wenbin Fu3

1Department of Acupuncture, Gaozhou Hospital of Traditional Chinese Medicine, Gaozhou, Guangdong, China

2Department of Internal Medicine, Gaozhou Hospital of Traditional Chinese Medicine, Gaozhou, Guangdong, China

3Department of Acupuncture, Guangdong Provincial Hospital of Traditional Chinese Medicine, Guangzhou, Guangdong, China

Submitted: 6 October 2022; Accepted: 22 October 2022 Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 258–263

DOI: https://doi.org/10.5114/aoms/155982

Copyright © 2022 Termedia & Banach

Abstract

Introduction: This study aimed to investigate the potential role of moxibustion (MOX) in the treatment of lung infection in patients bed-ridden due to osteoporotic fracture of the spine.

Methods: 96 senile patients with pulmonary infection who were bed-ridden due to osteoporotic fracture of the spine were grouped into a MOX (–) group and a MOX (+) group. An animal model was established as a SHAM group, a PRIMED group, a MOX 15’ group and a MOX 30’ group.

Results: For the patients’ study, we found that the survival rate was higher for patients who received MOX. Moreover, tumor necrosis factor- a , interleukin (IL) 1 β , IL-6 and IL-18 were down-regulated while IL-10 was up-regulated by MOX. MOX time-dependently increased the survival while reducing the bacteria left in infected mice.

Conclusions: Moxibustion significantly alleviated the inflammatory responses, thus leading to a better survival rate of patients bed-ridden due to osteoporotic fracture of the spine.

Key words: moxibustion, mice, bed-ridden senile, pulmonary infection, osteoporotic fracture.

Respiratory infections induced by postoperative bed rest, such as pneumonia and empyema, could lead to mortality of lung cancer patients [1], and the mortality rate of pneumonia is high regardless of the fact that the postoperative mortality of lung resection is reduced [2].

Risk factors such as age, smoking history, weak respiratory functions, invasive operations, intraoperative complications, or pathologic stages are known to be more likely to lead to postoperative respiratory infections [1, 3–5], or even prolonged postoperative hospital stay [6].

Moxa, a traditional Chinese herb which is minced before being burned in moxibustion, has been found to affect neuroendocrine immune functions and induce the production of heat shock proteins to activate the process of pain reduction and self-healing [7, 8]. Moreover, several re-

Corresponding author: Wenbin Fu

Department of Acupuncture Guangdong Provincial Hospital of Traditional Chinese Medicine No. 111 Dade Road Yuexiu District Guangzhou, Guangdong China 510000 E-mail: lunggenemed@163. com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Moxibustion treatment increases the survival rate of lung infection of patients bed-ridden due to osteoporotic fracture of the spine via regulation of the inflammatory responses

ports have documented that moxibustion could influence gene expression, thus being beneficial to autoimmune and inflammatory diseases such as ulcerative colitis [9, 10], Crohn’s disease [11], arthritis [12] and intestinal mucositis [13]. Also, a previous study on recurrent respiratory tract infection in children suffering from cerebral palsy also indicated that moxibustion could exhibit a long-term clinical effect [14]. Moreover, moxibustion at the acupoint of ST36 (Zusanli) was proved to activate the protective responses against HSV-1 infection in male BALB/c mice by activating production of cytokines including interleukin and TNF-a [15].

Therefore, the aim of this study is to further investigate the potential role of moxibustion treatment in the management of respiratory infection in bed-ridden patients who are suffering from osteoporotic fracture of the spine.

Methods. The human study was approved by the institutional ethics committee and all experiments were performed in strict accordance with the 2013 version of the Declaration of Helsinki. Written informed consent was obtained from all participants or their first-degree relatives before the initiation of the human study. We recruited a total of 96 senile patients with pulmonary infection who were bed-ridden due to osteoporotic fracture of the spine in this study. The patients were randomly assigned to a MOX (–) group and a MOX (+) group in which the patients received moxibustion treatment at the points of BL13 (Feishu), RN8 (Shenque) and RN4 (Guanyuan). For the MOX treatment performed once each day for 12 weeks, 1.8 g of moxa cones (Hanyi, Nanyang, Henan, CN) were placed burning on a 3.3 cm × 0.7 cm herbal cake (Hanyi, Nanyang, Henan, CN).

The animal study was approved by the institutional animal ethics committee and all experiments were performed in strict accordance with the 8th edition of the Guide for the Care and Use of Laboratory Animals by the National Research Council (US) Committee. 32 specific-pathogenfree (SPF) male C57BL/6 mice 6–8 weeks of age

were randomly divided into 4 groups: a SHAM group a PRIMED group, a MOX 15’ group and a MOX 30’ group. The mice were established as acute infected animals by i.p. injection of 10 LD50 Staphylococcus aureus after 2 days of i.p. injection of 6% starch broth (Sigma-Aldrich, St. Louis, MI, US). At 48 h after the moxibustion treatment, peripheral blood was collected from all mice, followed by euthanasia by i.p. injection of 100 mg/kg sodium pentobarbital. The peritoneal fluids were immediately collected for subsequent bacterial colony formation analysis to evaluate the bacterial clearance, i.e., the number of Staphylococcus aureus colonies as colony-forming units (CFU).

Peripheral blood samples collected from patients and animal models were prepared to study the levels of C-reactive protein (CRP), myeloperoxidase (MPO), interleukin (IL) 18 (IL-18), IL-1β, IL-10, IL-6 and tumor necrosis factor-a (TNF-a) using the appropriate assay kits following the instructions provided by the manufacturer.

A  p-value no more than 0.05 was deemed as the level of statistical significance. All statistical analyses were carried out with GraphPad Prism software (GraphPad, Santa Barbara, CA, US).

Results. Human study. As indicated in Table I, demographic and baseline data of all bed-ridden senile patients were collected and compared in the table, and no significant differences were found in respect to the parameters. However, the survival curve up to 6 months showed that patients who received moxibustion treatment had a higher survival rate compared with patients in the MOX (–) group (Figure 1 A). Moreover, the MOX (+) group had lower levels of TNF-a (Figure 1 B), IL-6 (Figure 1 C), IL-1β (Figure 1 E) and IL-18 (Figure 1 F) compared with the MOX (–) group, and the level of IL-10 (Figure 1 D) was higher in the MOX (+) group, indicating the potential association between MOX treatment and reduced inflammation responses in the patients.

Animal study. The survival analysis showed the lowest survival rate in the PRIMED group, while both moxibustion treatments for 15 min or 30 min

Table I. Basic characteristics of the recruited bed-ridden senile patients

Characteristics

Age [years] 56.8 ±3.2 60.3 ±6.2 0.243

Sex, male (%) 32 (66.7) 28 (62.5) 0.298

Baseline date:

Lymphocytes [/μl] 1425 ±415 1374 ±447 0.726

LDH [U/l] 482 ±112 502 ±89 0.296

KL-6 [U/l] 712 ±154 692 ±174 0.403

CRP [mg/dl] 0.68 ±0.23 0.63 ±0.18 0.657

CK [U/l] 1835 ±884 1953 ±665 0.338

Ferritin [ng/ml] 235 ±35 264 ±41 0.708

Moxibustion treatment increases the survival rate of lung infection of patients bed-ridden due to osteoporotic fracture of the spine via regulation of the inflammatory responses

Figure 1. A – The survival rate of the MOX (+) patient group was higher than that of the MOX (+) patient group. B – The level of TNF-a was lower in the MOX (+) patient group than that in the MOX (–) patient group. C – The production of IL-6 was suppressed in the MOX (+) patient group compared with that in the MOX (–) patient group. D – Compared with the MOX (–) patient group, the IL-10 level was higher in the MOX (+) patient group. E – Compared with the MOX (–) patient group, the IL-1β level in the MOX (+) patient group was significantly lower. F – Compared with the MOX (–) patient group, the IL-18 level in the MOX (+) patient group was evidently reduced

Moxibustion treatment increases the survival rate of lung infection of patients bed-ridden due to osteoporotic fracture of the spine via regulation of the inflammatory responses

SHAM PRIMED MOX 15’ MOX 30’

SHAM PRIMED MOX 15’ MOX 30’

SHAM PRIMED MOX 15’ MOX 30’

SHAM PRIMED MOX 15’ MOX 30’

Figure 1. Cont. G – Survival curves of difference groups of mice. H – The bacteria left in different groups of mice. I – ELISA analysis of TNF-a production in different groups of mice. J – ELISA analysis of IL-6 production in different groups of mice. K – ELISA analysis of IL-10 level in different groups of mice. L – ELISA analysis of IL-1β level in different groups of mice

elevated the suppressed survival rate (Figure 1 G). Meanwhile, moxibustion was found to substantially reduce the high bacteria count in the infected mice (Figure 1 H). Moreover, the production of TNF-a (Figure 1 I), IL-6 (Figure 1 J), IL-10 (Figure 1 K), IL-1β (Figure 1 L) and IL-18 (Figure 1 M) in the PRIMED group was evidently higher compared with that of the SHAM group, whereas treatment with moxibustion restored the expression of these factors in a time-dependent manner. Also, ELISA assay of the serum level of CPR (Figure 1 N) and MPO (Figure 1 O) also presented evidently promoted CRP and MPO production in the PRIMED group, while moxibustion significantly reduced the CRP and MPO production in the MOX 15’ group and MOX 30’ group. Altogether, the above observations validated the time-dependent inhibitory effect of moxibustion treatment upon inflammatory responses in the bacteria-infected mice.

Discussion. The over-activation of inflammasome NOD-like receptor protein 3 (NLRP3) induces the maturation and release of proinflammatory cytokines IL-1β and IL-18 [16]. Since IL-1β participates in the process of inflammatory injuries and damaging the colonic barrier, the modulation of NLRP3 could inhibit inflammatory responses and

Figure 1. Cont. M – ELISA analysis of IL-18 level in different groups of mice. N – ELISA analysis of CPR production in different groups of mice. O – ELISA analysis of MPO production in different groups of mice

reconstruct colonic mucosal immune homeostasis [17]. Meanwhile, NLRP3 is also found to be regulated by the signaling pathway of nuclear factor κB (NF-κB), which participates in the inflammatory responses of inflammatory bowel disease (IBD) [18]. The high concentration of extracellular adenosine triphosphate (ATP) produced at inflammatory sites could activate the P2X7 receptor (P2X7R) [19], and P2X7R and ATP could collaboratively activate the pannexin-1 channel to promote transcription of NLRP3 mRNA [20]. According to Tourkochristou et al., upon the activation of NLRP3, apoptosis-associated speck-like protein (ASC) could trigger activation of caspase-1, which helps to produce mature IL-1β and IL-18 and induce chronic intestinal inflammation [21–23]. Also, it was found that the continuous interaction between the harmful gut bacteria and the pathogen-associated molecular patterns will accelerate activation of the NLRP3 inflammasome, which results in severer inflammatory reactions by the subsequent upregulation of the downstream pro-inflammatory cytokines such as TNF-a, IL-6, IL-1β and IL-18, thereby further aggravating the inflammatory reaction [24, 25]. Accordingly, compared with the MOX (–) patient group, we found that moxibustion in the MOX (+)

Moxibustion

patient group not only suppressed the expression of NLRP3, but also inhibited expression of pro-inflammatory factors such as TNF-a, IL-1β, IL-6 and IL-18 while increasing the level of IL-10. Similar results were obtained from the animal models primed with bacteria which subsequently received moxibustion treatment.

In this study, we not only studied the effect of moxibustion against lung infection, but also observed whether the moxibustion duration potentially influences the effect of moxibustion. Therefore, we treated the bacteria-infected mouse models for 15 min and 30 min, and we found that the 30-min treatment with moxibustion exerted a more beneficial effect against bacterial infection compared with the 15-min treatment with moxibustion, while both the 15-min moxibustion treatment and 30min moxibustion treatment exhibited a significant beneficial effect compared with the untreated mice.

In conclusion, by observing the lung-infected patients and mouse models, we found that the MOX treatment could significantly alleviate the inflammatory responses, thus leading to a better survival rate of patients bed-ridden due to osteoporotic fracture of the spine.

Acknowledgments

Yaonan Cheng and Qin Chen contributed equally to this study.

Conflict of interest

The authors declare no conflict of interest.

References

1. Shiono S, Yoshida J, Nishimura M, et al. Risk factors of postoperative respiratory infections in lung cancer surgery. J Thorac Oncol 2007; 2: 34-8.

2. Schussler O, Alifano M, Dermine H, et al. Postoperative pneumonia after major lung resection. Am J Respir Crit Care Med 2006; 173: 1161-9.

3. Ismail AMA. Rehabilitation with virtual reality for leukemic children during the fourth COVID-19 wave. Integr Cancer Ther 2021; 20: 15347354211049341.

4. Díaz-Ravetllat V, Ferrer M, Gimferrer-Garolera JM, Molins L, Torres A. Risk factors of postoperative nosocomial pneumonia after resection of bronchogenic carcinoma. Respir Med 2012; 106: 1463-71.

5. Alifano M, Regnard JF. Postoperative pneumonia in lung cancer patients: chronic obstructive pulmonary disease, preoperative bronchial colonisation and antibioprophylaxis are critical issues. Eur J Cardiothorac Surg 2010; 37: 750-1.

6. Kim HJ, Cha SI, Kim CH, et al. Risk factors of postoperative acute lung injury following lobectomy for nonsmall cell lung cancer. Medicine 2019; 98: e15078.

7. Deng H, Shen X. The mechanism of moxibustion: ancient theory and modern research. Evid Based Complement Alternat Med 2013; 2013: 379291.

8. Cakmak YO. A review of the potential effect of electroacupuncture and moxibustion on cell repair and

survival: the role of heat shock proteins. Acupunct Med 2009; 27: 183-6.

9. Zhou EH, Liu HR, Wu HG, et al. Down-regulation of protein and mRNA expression of IL-8 and ICAM-1 in colon tissue of ulcerative colitis patients by partition-herb moxibustion. Dig Dis Sci 2009; 54: 2198-206.

10. Wang XM, Lu Y, Wu LY, et al. Moxibustion inhibits interleukin-12 and tumor necrosis factor alpha and modulates intestinal flora in rat with ulcerative colitis. World J Gastroenterol 2012; 18: 6819-28.

11. Wang X, Lu Y, Wu L, et al. Moxibustion inhibits the ERK signaling pathway and intestinal fibrosis in rats with Crohn’s disease. Evid Based Complement Alternat Med 2013; 2013: 198282.

12. Shen X, Zhao L, Ding G, et al. Effect of combined laser acupuncture on knee osteoarthritis: a pilot study. Lasers Med Sci 2009; 24: 129-36.

13. Li BR, Shao SY, Yuan L, et al. Effects of mild moxibustion on intestinal microbiome and NLRP3 inflammasome in rats with 5-fluorouracil-induced intestinal mucositis. J Integr Med 2021; 19: 144-57.

14. Zhang HY, Lu SF, Xiao N. Effects of mild warming moxibustion on acupoints Shenque (RN8) and Guanyuan (RN4) for prevention and treatment of recurrent respiratory tract infection in children with cerebral palsy. Zhongguo Zhong Xi Yi Jie He Za Zhi 2010; 30: 935-7.

15. Takayama Y, Itoi M, Hamahashi T, et al. Moxibustion activates host defense against herpes simplex virus type I through augmentation of cytokine production. Microbiol Immunol 2010; 54: 551-7.

16. Kelley N, Jeltema D, Duan Y, He Y. The NLRP3 Inflammasome: an overview of mechanisms of activation and regulation. Int J Mol Sci 2019; 20: 3328.

17. Li XY, Yang YT, Zhao Y, et al. Moxibustion inhibits the expression of colonic NLRP3 through miR7/RNF183/NF-κB signaling pathway in UC rats. Evid Based Complement Alternat Med 2021; 2021: 6519063.

18. Yang Y, Wang H, Kouadir M, Song H, Shi F. Recent advances in the mechanisms of NLRP3 inflammasome activation and its inhibitors. Cell Death Dis 2019; 10: 128.

19. Di Virgilio F, Dal Ben D, Sarti AC, Giuliani AL, Falzoni S. The P2X7 receptor in infection and inflammation. Immunity 2017; 47: 15-31.

20. Zhang J, Wang XJ, Wu LJ, et al. Herb-partitioned moxibustion alleviates colonic inflammation in Crohn’s disease rats by inhibiting hyperactivation of the NLRP3 inflammasome via regulation of the P2X7R-Pannexin-1 signaling pathway. PLoS One 2021; 16: e0252334.

21. Tourkochristou E, Aggeletopoulou I, Konstantakis C, Triantos C. Role of NLRP3 inflammasome in inflammatory bowel diseases. World J Gastroenterol 2019; 25: 4796-804.

22. Korcok J, Raimundo LN, Ke HZ, Sims SM, Dixon SJ. Extracellular nucleotides act through P2X7 receptors to activate NF-kappaB in osteoclasts. J Bone Mineral Res 2004; 19: 642-51.

23. Qiao Y, Wang P, Qi J, Zhang L, Gao C. TLR-induced NF-κB activation regulates NLRP3 expression in murine macrophages. FEBS Lett 2012; 586: 1022-6.

24. Lima WG, Pessoa RM, Vital KD, Takenaka I, Cardoso VN, Fernandes SOA. Effect of probiotics on the maintenance of intestinal homeostasis after chemotherapy: systematic review and meta-analysis of pre-clinical studies. Beneficial Microbes 2020; 11: 305-18.

25. Yeung CY, Chan WT, Jiang CB, et al. Amelioration of chemotherapy-induced intestinal mucositis by orally administered probiotics in a mouse model. PLoS One 2015; 10: e0138746.

treatment increases the survival rate of lung infection of patients bed-ridden due to osteoporotic fracture of the spine via regulation of the inflammatory responses

Deep learning survival model for colorectal cancer patients (DeepCRC) with Asian clinical data compared with different theories

1Cancer Research Center, Beijing Chest Hospital, Capital Medical University, Beijing Tuberculosis and Thoracic Tumor Research Institute, Tongzhou District, Beijing, China

2Department of Gastroenterology, Beijing Chest Hospital, Capital Medical University, Tongzhou District, Beijing, China

3Department of Oncology, Beijing Chest Hospital, Capital Medical University, Tongzhou District, Beijing, China

Submitted: 18 September 2022; Accepted: 12 November 2022

Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 264–269

DOI: https://doi.org/10.5114/aoms/156477

Copyright © 2022 Termedia & Banach

Abstract

Introduction: Colorectal cancer (CRC) is the third most common cancer. Precise prediction of CRC patients’ overall survival (OS) probability could offer advice on its treatment. Neural network (NN) is the first-class algorithm, but a consensus on which NN survival models are better has not been established yet. A predictive model on CRC using Asian data is also lacking.

Methods: We conducted 8 NN survival models of CRC ( n = 416) with different theories and compared them using Asian data.

Results: DeepSurv performed best with a C-index value of 0.8300 in the training cohort and 0.7681 in the test cohort.

Conclusions: The deep learning survival model for CRC patients (DeepCRC) could predict CRC’s OS accurately.

Key words: colorectal cancer, neural network, deep learning, predictive model.

Colorectal cancer (CRC) is the third most common cancer, accounting for about 10% annually diagnosed tumors worldwide, and it is the second leading cause of death from among all tumors [1, 2]. Given the impairment of quality of life from not only CRC itself but also the treatment’s adverse effects, such as a stoma, it is pivotal to predict a patient’s overall survival (OS).

American Joint Committee on Cancer (AJCC) TNM stage is a typical and extensively used reference for cancer prognosis. However, many studies have revealed that the survival of the same stage CRC patients varied, and a more precise staging system is needed [3–7]. Another choice is to use the Cox proportional hazard model (CPH). But the CPH is a semiparametric model, assuming that a patient’s log-risk of an event (e.g., “death”) is a linear combination of the patient’s covariates, which might be too simplistic to handle time-to-event prediction in the real world [8, 9]. In this regard, some researchers began to set their sights on machine learning algorithms and even deep learning neural networks (NNs). NNs can improve prediction accuracy by discovering relevant features

Corresponding authors: Yuanming Pan PhD Cancer Research Cente Beijing Chest Hospital Capital Medical University Beijing Tuberculosis and Thoracic Tumor Research Institute Beijing 101149, China Phone: +86-10-89509372 Fax: +86-10-89509372 E-mail: peter.f.pan@ hsc.pku. edu.cn

Prof. Jinghui Wang MD Cancer Research Center Beijing Chest Hospital Capital Medical University Beijing Tuberculosis and Thoracic Tumor Research Institute Beijing 101149, China Phone: +86-10-89509372 Fax: +86-10-89509372 E-mail: jinghuiwang2006@163.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Wei Li1, Shuye Lin1, Yuqi He2, Jinghui Wang1,3, Yuanming Pan1

of high complexity [8, 9]. There are 8 popular NN survival theories, such as DeepSurv and CoxCC (Cox case-control corresponding methods). However, no study has compared them yet. At the same time, though there have been some predictive models for CRC, they were mainly based on the CPH, traditional machine learning method or using American clinical data, such as the Surveillance, Epidemiology, and End Results (SEER) database [10–12].

We aimed to compare several survival algorithms based on NN and develop a deep learning survival model for colorectal cancer patients (DeepCRC) using Asian clinical data. It might offer advice for Asian doctors on patients’ therapeutic decisions, to avoid unnecessary treatment and complications such as a stoma.

Methods. Study design and data source. This study was designed as a retrospective cohort study. Patients diagnosed with colorectal cancer in 2006–2014 were included and the last follow-up time was 2018. Raw clinical information was obtained from the biobank of Shanghai Outdo Biotech Company. Multivariate Imputation by Chained Equations was employed to fill in missing values (Supplementary Figure S1). All data were then divided into two cohorts randomly (Figure 1): the training cohort (80% of all) and the test cohort (20% of all). Survival models were trained using the training cohort, with validation by itself and the test cohort.

This study has been approved by the Ethics Committee (No. LW-2022-007) and individual consent for this retrospective analysis was waived.

Model training. Sex, age, size, site, grade, numbers of lymph nodes examined, numbers of posi-

tive lymph nodes, T, N, M and stage were all the clinical features included by the authors (abbreviated as ALL variables). Classical TNM variables (T, N, M and stage) were included as input features too, called TNM variables by us. Least Absolute Shrinkage and Selection Operator (LASSO) was adopted to refine variables, filtering non-zero coefficient features as LASSO variables (Age, Size, Site, Grade, Lymph nodes examined, Lymph nodes positive, T, N, M and Stage) (Supplementary Figure S2, Supplementary Table SI). Three group variables were then combined with 8 NN survival algorithms to identify the best one, with traditional Cox models conducted too as a comparison. Before building the models, categorical clinical features were recoded as dummy variables. The Adam algorithm was chosen to be an optimizer. Batch training and batch normalization were used to avoid underfitting, while dropout layers and the early stopping callback function were applied to avoid overfitting when necessary. Dropout layers could silence some neural nodes randomly and the early stopping callback function could end up training when performance did not improve during several epochs. Training curves are shown in Supplementary Figure S3.

Model evaluation. The concordance index (C-index), also known as area under the receiver operating curve (AUC), was the main criterion. The C-index close to 1.0 showed a perfect prediction, while a 0.5 or smaller one tended to randomly guess. Another indicator was the integrated Brier score, whose range was between 0 and 1, with a smaller one or near 0 representing a better performance. Each model was evaluated on the train-

Deep learning survival model for colorectal cancer patients (DeepCRC) with Asian clinical data compared with different theories

ing cohort and test cohort. 1000 times bootstrap (resampling 1000 times from the training or test cohort) was taken to get precise 95% confidence intervals (CIs) of the C-index.

Data processing and statistical analysis. Missing values were visualized and imputation performed by R 4.1.2 with mice and VIM packages. LASSO regression was established with the R package glmnet. NN was constructed with python 3.9.7, pytorch and pycox. R packages (fmsb, RColorBrewer and ggplot2) were used for visualization. Two-sided p < 0.05 was considered statistically significant.

Results. Patient characteristics. Patients diagnosed with CRC in 2006–2014 (n = 416) were

stochastically split up into two groups, the training cohort (80% of all, n = 333) and test cohort (20% of all, n = 83) (Figure 1). Table I shows the clinical characteristics of the two cohorts. The median follow-up time of the training cohort was 62 months, with that of the test cohort being 65 months. There were 156 events observed in the training cohort and 30 in the test cohort.

Model performance. As illustrated in Figure 2 and Table II, TNM variables could not reflect a patient prognosis appropriately enough even using the NN algorithm, with a C-index between 0.4756–0.6957, of which DeepSurv behaved best. When LASSO variables were inputted, the performances were boosted markedly, with the top C-in-

Table I. Demographics and clinical characteristic of two cohorts

Variable Training cohort ( n = 333) N (%)

Test cohort ( n = 83) N (%)

Sex: Female 136 (40.84) 37 (44.58) Male 197 (59.16) 46 (55.42)

Age: Median (IQR) 65 (57, 73) 66 (55.5, 75.5)

Size [mm]: Median (IQR) 50 (40, 70) 50 (42.5, 67.5)

Site:

Ascending colon 53 (15.92) 9 (10.84)

Descending colon 22 (6.61) 2 (2.41)

Hepatic flexure 1 (0.3) 1 (1.2)

Ileocecal junction 7 (2.1) 2 (2.41)

Rectosigmoid junction 11 (3.3) 2 (2.41)

Rectum 186 (55.86) 53 (63.86)

Sigmoid colon 39 (11.71) 8 (9.64)

Transverse colon 4 (1.2) 1 (1.2)

Others 10 (3) 5 (6.02)

Grade: I 11 (3.3) 0 (0)

II 228 (68.47) 60 (72.29)

III 94 (28.23) 23 (27.71)

Lymph nodes examined: Median (IQR) 8 (5, 15) 7 (4, 15)

Lymph nodes positive: Median (IQR) 0 (0, 2) 0 (0, 1)

T:

T1 3 (0.9) 1 (1.2)

T2 49 (14.71) 6 (7.23)

T3 181 (54.35) 57 (68.67)

T4 2 (0.6) 0 (0)

IQR – interquartile range.

Variable Training cohort ( n = 333) N (%)

Test cohort ( n = 83) N (%)

T4a 72 (21.62) 14 (16.87)

T4b 26 (7.81) 5 (6.02) N:

N0 189 (56.76) 51 (61.45)

N1 12 (3.6) 6 (7.23)

N1a 37 (11.11) 10 (12.05)

N1b 36 (10.81) 9 (10.84)

N1c 1 (0.3) 1 (1.2)

N2 15 (4.5) 2 (2.41)

N2a 29 (8.71) 3 (3.61) N2b 14 (4.2) 1 (1.2) M:

M0 323 (97) 81 (97.59)

M1 6 (1.8) 1 (1.2)

M1a 3 (0.9) 1 (1.2) M1b 1 (0.3) 0 (0)

Stage:

I 44 (13.21) 7 (8.43)

II 35 (10.51) 12 (14.46)

IIA 85 (25.53) 27 (32.53)

IIB 15 (4.5) 3 (3.61)

IIC 8 (2.4) 2 (2.41)

III 26 (7.81) 7 (8.43)

IIIA 6 (1.8) 0 (0)

IIIB 77 (23.12) 21 (25.3)

IIIC 27 (8.11) 2 (2.41)

IV 6 (1.8) 1 (1.2)

IVA 3 (0.9) 1 (1.2)

IVB 1 (0.3) 0 (0)

Follow-up time:

Median (IQR) 62 (28, 88) 65 (39.5, 90)

Wei Li, Shuye Lin, Yuqi He, Jinghui Wang, Yuanming Pan

Deep learning survival model for colorectal cancer patients (DeepCRC) with Asian clinical data compared with different theories

All vars LASSO vars TNM vars Internal validation

All vars LASSO vars TNM vars External validation

All vars LASSO vars TNM vars Internal validation

All vars LASSO vars TNM vars External validation

Figure 2. Performance of 8 neural network algorithms combined with 3 group variables, both internal and external validations. A – The Brier score of them. B – The concordance index of them. C – The radar plot showing the comparison of concordance index among these combinations C-index – concordance index. TNM vars – T + N + M + Stage. LASSO vars – Age + Size + Site + Grade + Lymph nodes examined + Lymph nodes positive + T + N + M + Stage. All vars – Sex + Age + Size + Site + Grade + Lymph nodes examined + Lymph nodes positive + T + N + M + Stage. CoxCC – Cox Case-control Corresponding methods. PCHazard – Piecewise Constant Hazard. N-MTLR – Neural Multi-Task Logistic Regression. PMF – Probability Mass Function. LASSO – Least Absolute Shrinkage and Selection Operator.

0.6947

0.1566

0.7537

0.1738

0.6814

0.1749

0.7080

0.1768

0.6755

0.1857

0.6664

0.7147

0.3379

0.7412

0.2655

0.6952

0.3375

0.7313

0.2373

0.6683

0.3392

0.1629 CoxTime

0.6686

0.6993

0.3675

0.7301

0.1675

0.6803

0.3695

0.7209

0.1780

0.6739

0.3764

0.2667 LogisticHazard

0.6729

0.1712

0.6529

0.7299

0.1685

0.3695

0.6662

0.5179

0.1680

0.1599

0.5913

0.6947

0.1611

0.3819

0.6660

0.5164

0.1754

0.1832

0.6016

0.6012

0.1874

0.1656 PCHazard

0.3835

0.6287

0.4975

0.1615 N-MTLR

0.7281

0.3701

0.6851

0.1803

0.6850

0.3628

0.6311

0.1859

0.6778

0.3797

0.4756

DeepHit

0.6803

0.6643

0.3776

-

0.6219

0.7343

0.1653

–

0.6803

0.6637

0.3834

–

0.5425

0.7347

0.1752

–

0.6606

0.6707

0.3834

0.1866 PMF

–

0.5164

0.6687

0.1753 Cox

C-index, concordance index. TNM variables: T + N + M + Stage. LASSO variables: Age + Size + Site + Grade + Lymph nodes examined + Lymph nodes positive + T + N + M + Stage. All variables: Sex + Age + Size + Site + Grade + Lymph nodes examined + Lymph nodes positive + T + N + M + Stage. LASSO –Least Absolute Shrinkage and Selection Operator. CoxCC –Cox Case-control Corresponding methods. PCHazard –Piecewise Constant Hazard. N-MTLR, Neural Multi-Task Logistic Regression. PMF –Probability Mass Function.

dex up to 0.8224 in the training cohort and 0.7491 in the test cohort, from DeepSurv too. All variables were employed to conduct models finally, making some enhancement, for the C-index was determined as 0.8300 in the training cohort and 0.7681 in the test cohort by DeepSurv. Of 3 groups, ALL variables seemed to be the best indicator while DeepSurv showed the greatest potency in predicting patient OS.

After 1000 times bootstrap, DeepSurv still exhibited the best performance, with the C-index 0.8315 (95% CIs: 0.8297–0.8332) in the training cohort and 0.7719 (95% CIs: 0.7693–0.7745) in the test cohort (Supplementary Table SII).

Discussion. As a semiparametric and linear-assumption model, CPH has inherent limitations in forecasting the real word data. As the top algorithm in the machine learning field, NN has become more and more popular in the medical domain. Typical examples were application for tumor pathology or X-ray computed tomography (CT). Reasonably, researchers hoped to utilize NN to improve the accuracy of predicting cancer patients’ OS. In fact, the NN survival model has shown great potential. For example, to predict urinary continence recovery after robot-assisted radical prostatectomy, Loc Trinh and colleagues compared the Cox and NN survival model DeepSurv (C-index: CPH 0.695, DeepSurv 0.708) [13]. However, there are several NN survival algorithms, but nobody has compared them yet.

Though there are already survival models for CRC, an NN model based on Asian data has not been reported but is needed. Simultaneously, we hoped to identify the best one based on our collected clinical features, by comparing 8 frequent NN survival algorithms. DeepSurv had the highest C-index in all 8 algorithms in both cohorts (0.8300 in the training cohort and 0.7681 in the test cohort). The codes we used have been uploaded to Github, hoping it will offer some help for doctors not only for CRC but also other cancers.

There were some limitations in this study. Family history, lifestyle and some biomarkers are important reasons for colorectal carcinogenesis, possibly influencing prognosis, but they were not considered in this study [14, 15]. The sample size of this study was moderate. It is better to validate DeepCRC using prospective data.

Collectively, this study pioneered the use of 8 NN survival models with real Asian data for predicting CRC patients’ OS. The prediction of OS might offer a reference for doctors on treatment options.

In conclusion, we utilized and compared 8 deep learning survival models to predict CRC patients’ survival (DeepCRC) using Asian data. The DeepCRC model had good performance in predicting CRC patients’ overall survival.

Wei Li, Shuye Lin, Yuqi He, Jinghui Wang, Yuanming Pan

Acknowledgments

Wei Li, Shuye Lin have equal contribution to the manuscript.

Conflict of interest

The authors declare no conflict of interest.

References

1. Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021; 71: 209-49.

2. Xia C, Dong X, Li H, et al. Cancer statistics in China and United States, 2022: profiles, trends, and determinants. Chin Med J 2022; 135: 584-90.

3. Xiao WW, Zhang LN, You KY, et al. A low lymphocyte-to-monocyte ratio predicts unfavorable prognosis in pathological T3N0 rectal cancer patients following total mesorectal excision. J Cancer 2015; 6: 616-22.

4. Puppa G, Sonzogni A, Colombari R, Pelosi G. TNM staging system of colorectal carcinoma: a critical appraisal of challenging issues. Arch Pathol Lab Med 2010; 134: 837-52.

5. Gong P, Chen C, Wang Z, et al. Prognostic significance for colorectal carcinoid tumors based on the 8th edition TNM staging system. Cancer Med 2020; 9: 7979-87.

6. Shia J, Klimstra DS, Bagci P, Basturk O, Adsay NV. TNM staging of colorectal carcinoma: issues and caveats. Semin Diagn Pathol 2012; 29: 142-53.

7. Ahmed Farag AF, Elbarmelgi MY, Azim HA, Abozeid AA, Mashhour AN. TNMF versus TNM in staging of colorectal cancer. Int J Surg 2016; 27: 147-50.

8. Katzman JL, Shaham U, Cloninger A, et al. DeepSurv: personalized treatment recommender system using a Cox proportional hazards deep neural network. BMC Med Res Methodol 2018; 18: 24.

9. She Y, Jin Z, Wu J, et al. Development and validation of a deep learning model for non-small cell lung cancer survival. JAMA Netw Open 2020; 3: e205842.

10. Yu H, Huang T, Feng B, Lyu J. Deep-learning model for predicting the survival of rectal adenocarcinoma patients based on a surveillance, epidemiology, and end results analysis. BMC Cancer 2022; 22: 210.

11. Mohammed M, Mboya IB, Mwambi H, Elbashir MK, Omolo B. Predictors of colorectal cancer survival using cox regression and random survival forests models based on gene expression data. PLoS One 2021; 16: e0261625.

12. Li C, Pei Q, Zhu H, et al. Survival nomograms for stage III colorectal cancer. Medicine 2018; 97: e13239.

13. Trinh L, Mingo S, Vanstrum EB, et al. Survival analysis using surgeon skill metrics and patient factors to predict urinary continence recovery after robot-assisted radical prostatectomy. Eur Urol Focus 2022; 8: 623-30.

14. Lee CH, Tseng PL, Tung HY, et al. Comparison of risk factors between colon cancer and rectum cancer in a single medical center hospital, Taiwan. Arch Med Sci 2020; 16: 102-11.

15. Zhang T, Cui G, Yao YL, et al. Value of CNRIP1 promoter methylation in colorectal cancer screening and prognosis assessment and its influence on the activity of cancer cells. Arch Med Sci 2017; 13: 1281-94.

Deep learning survival model for colorectal cancer patients (DeepCRC) with Asian clinical data compared with different theories Arch Med Sci 1, 1st January / 2023

POWER: an open, single-arm, post-market clinical trial using the TENA SmartCare Change Indicator in a home environment

Fredrik Agholme1, Artur Lamparski2, Piotr Radziszewski3

1Essity Hygiene and Health AB, Sweden

2Medical Concierge, Poland

3Department of Urology, Warsaw Medical University, Poland

Submitted: 8 November 2022; Accepted: 27 December 2022 Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 270–273

DOI: https://doi.org/10.5114/aoms/158568

Copyright © 2023 Termedia & Banach

Abstract

Introduction: This clinical trial tested the use of the TENA SmartCare Change Indicator in a homecare environment.

Methods: The trial included 35 elderly subjects with urinary incontinence. The trial lasted for 3 weeks. The primary outcome was the reduction in manual absorbing product checks between the baseline (first) and the investigational (third) week.

Results: The numbers of checks and leakages were significantly reduced by 16% ( p = 0.001) and 40% ( p = 0.0051).

Conclusions: Use of the device led to a reduction in the numbers of manual checks and leakages. The device appears to be safe, well tolerated and easy to use.

Key words: urinary incontinence, cognitive impairment, clinical trial, leakages, new device, manual check, skin irritation.

Urinary incontinence (UI) is defined as “the complaint of any involuntary leakage of urine”, according to the International Continence Society (ICS). UI has profound effects on the social and physiological well-being of incontinent patients and caregivers [1], being associated with depression [2] skin damage [3], isolation, embarrassment, falls and fractures [4, 5]. UI increases with age due to the gradually failing ligamentous and connective tissue supporting the pelvic organs and decreasing volume and tone of pelvic muscles [6]. Overweight and obesity [7], impaired mobility and diabetes mellitus [8] are important risk factors for UI. Conservative management and lifestyle interventions are primary treatment options. Containment care using incontinence products, such as absorbing incontinence products (AIPs), is part of the standard of care [9]. To ensure the comfort of the incontinent individual, the caregiver often checks the saturation level of the AIP by touching, looking and/or asking.

A wetness indicator in the form of a strip that shows the absorption level has been on the market for some time. However, it still needs to be manually observed by the caregiver and requires undressing. Multiple electronic systems to detect urine saturation have been proposed [10] and there are also other devices [11–13] under development. Although the use and benefits are unclear, some improvement in the quality of

Corresponding author: Fredrik Agholme Essity Hygiene and Health AB Sweden

E-mail: fredrik.agholme@ essity.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

continence care has been reported [14]. Furthermore, for UI due to neurogenic bladder, devices such as artificial urinary sphincters and neurostimulation are available [15].

In this study we investigated the TENA SmartCare Change Indicator (Change Indicator). The Change Indicator is a commercially available medical device manufactured by Essity Hygiene and Health AB (Gothenburg, Sweden). The device attaches to the outside of the AIP and consists of a reusable electronic sensor, transmitter and an application installed on one or more smart phones. The device estimates the wetness saturation of the AIP and communicates this to the caregiver via an app interface. The primary objective was to demonstrate that the device can reduce the number of manual AIP checks in a home care setting. Methods. Study design and study population. The POWER trial (NCT04846270) was conducted in the Warsaw region, Poland, between April and December 2021. The trial included 35 elderly subjects with UI, cared for in a home environment. All subjects had used TENA incontinence products before as well as during the study.

The trial was performed over a period of three weeks. During the first (baseline) week, the device was not used. The device was introduced during the second (learning) week and the third (investigational) week. During the first and third week the number of manual checks was noted using a diary. Subjects attended five visits during the study.

Outcome measurements. The primary outcome was the number of daily manual checks during the investigational week compared to the baseline week. The secondary outcomes were the leakage on garments, skin redness/irritation, fecal incidences, usability, and safety. The source data were collected by caregivers using eDiaries (and/or paper version) and eQuestionnaires.

The variable change in skin redness/irritation was evaluated using the GLOBIAD [16] tool. At

the end of the learning week and investigational week, caregivers were asked to evaluate the written instructions, the usability of the device and the application, performance of the investigated device, facilitation of decisions, well-being and comfort of subjects, overall usefulness, and continuous usage intention.

Statistical analysis. The investigational and baseline data were compared to discern any significant differences. The level of significance was set to 0.05 (p < 0.05) for all variables. Student’s paired t-test was used; if the variables were not normally distributed, the non-parametric Wilcoxon signed-rank test was used instead.

Safety measurements. All incidences of adverse events for subject, caregiver and device deficiencies were collected. Adverse events were documented as AE (adverse event), ADE (adverse device effect), SAE (serious adverse event), and SADE (serious adverse device effect).

Results. Subjects of study. A total of 35 subjects completed the trial. There were no dropouts or withdrawals from the study. The mean age of the subjects was 74 years (SD, standard deviation, 23). 80% of subjects were female. Up to 85% of the study population experienced mild to severe cognitive impairment.

Primary and secondary outcomes. The mean number of daily checks decreased from 4.3 ±2.0 during the baseline week to 3.5 ±1.8 during the investigational week (Figure 1). The mean difference of 0.8 ±1.7 (or 15.9% ±26.0%) in number of checks per day was statistically significant (p = 0.0006 and p = 0.0010 respectively).

Daily leakages decreased from 0.33 ±0.44 during the baseline week to 0.20 ±0.37 during the investigation week (Figure 1). This was a statistically significant reduction of 0.13 ±0.29 (p  = 0.0051) or 40%. Slight non-significant decreases in AIP changes and fecal incidents were also observed (Figure 1).

POWER: an open, single-arm, post-market clinical trial using the TENA SmartCare Change Indicator in a home environment

At the beginning of the baseline week, 5 out of 35 subjects (14%) showed skin redness/irritation. All were defined as “persistent redness without clinical signs of infection” and classified as the least severe grade (i.e., 1A) according to the GLOBIAD score. Two of the five subjects above were assessed with skin redness/irritation, scoring 1A, by the end of the baseline week. The other 33 subjects showed no skin redness/irritation. At the completion of the trial none of the 35 subjects showed signs of skin redness/irritation.

Safety endpoints. Five AEs were reported in four subjects. All AEs were considered unrelated to the medical device or the investigational procedures and none had the potential to become serious.

Thirty-nine device deficiencies (DDs) were reported in 27 subjects. These DDs mostly concerned problems with the sensor strip (29 cases). The source of these DDs was determined to be in a faulty batch of sensor strips that had a weakness in the cover material at the transmitter connection area. The DD did not affect the safety or performance of the sensor strip but affected its appearance. The remaining DDs concerned connectivity issues, meaning some disruptions in communication between the transmitter and the system.

Usability. 74% of caregivers rated the written instructions, the use of the device (83%) and the app (91%) as ‘very easy’ (highest score) at the completion of the study. However, 29% of caregivers experienced obstacles with the device, and 14% faced obstacles with the app during the study.

Facilitation and well-being. At the end of the study 60% of caregivers reported an improvement in the subjects’ well-being and 71% of caregivers reported a reduction of worry about the comfort of the subject. Furthermore, 86% of caregivers answered that the system had facilitated the decision to change AIPs. 89% of the caregivers assessed the overall usefulness as ‘good’ or ‘very good’. 54% of the caregivers would continue to use the system if available on the market, and 89% would recommend the system.

Discussion. The use of the device appears to improve the physiological well-being of incontinent subjects and their caregivers. The reduction in manual checks was about 16%; we considered a 20% reduction in daily checks clinically significant, and the current data cannot rule out that this is the actual reduction. There was a reduction in the number of manual checks and leakages on garments and a slight decrease in the number of changes, fecal incidents, and skin redness/irritation. These findings imply that using the device can reduce the need for privacy invasion of incontinent subjects due to manual checks. Furthermore, the device appears to ensure that the aip will be changed at the right time, leading to sub-

jects not needing to wear a wet aip for an extended period. That enhances the comfort and prevent subjects’ skin from prolonged exposure to urine and/or stool. Consequently, skin irritation/redness and/or incontinence-associated dermatitis such as fungal infections would be less likely to occur [3]. Although the device itself does not remedy the incontinence condition, its use could potentially increase the quality of life for subjects and caregivers. There are other commercial systems similar to the change indicator on the market, but to our knowledge there are limited clinical data available on their effectiveness. Experimental systems shows some promise to improve care in nursing home residents [17] but other data suggest there are still technical difficulties in achieving clinical benefit from these devices [18, 19]. The change indicator offers some advantages over current non-digital wetness indicators placed on the aips. The ability to get notified without physically having to check the product is beneficial. This allows the product to be changed at the discretion of the caregiver for instance if there is a concern about skin problems or distress of the user and not only because the product is full. Also, the caregiver and subject may have more undisturbed sleep, and during daytime caregivers have more freedom to perform other activities.

The system appeared to be safe and well tolerated. None of the five observed AEs were defined as severe and/or related to the medical device or the investigational procedures. Ultimately, the evaluation done by caregivers indicates that the investigated system is very easy to use. They are willing to use the system if available on the market and highly recommend others to use it.

Several limitations of the study should be addressed. Firstly, the study was open and single arm with a limited number of subjects. The observation period was short, even though one learning week appeared sufficient to establish a new baseline before the investigational week. Furthermore, data in the study were reported by the caregiver and could be subject to bias and differences in reporting.

In conclusion, the TENA SmartCare Change Indicator appears to be safe and well tolerated in its intended setting and in a home environment. It helps caregivers decide when to change the AIP, as demonstrated by the observed reductions in the number of manual checks and leakages. Overall usability aspects of device handling were reported to be satisfactory, and caregivers believe the system is easy to use and gives benefits to them and the comfort of the subjects.

Conflict of interest

Fredrik Agholme is an employee of Essity Hygiene and Health AB all other authors report no

Fredrik Agholme, Artur Lamparski, Piotr Radziszewski

POWER: an open, single-arm, post-market clinical trial using the TENA SmartCare Change Indicator in a home environment

conflict of interest. The study was funded by Essity Hygiene and Health AB.

References

1. Ko Y, Lin SJ, Salmon JW, Bron MS. The impact of urinary incontinence on quality of life of the elderly. Am J Manag Care 2005; 11 (4 Suppl): S103-111.

2. Sims J, Browning C, Lundgren-Lindquist B, Kendig H. Urinary incontinence in a community sample of older adults: prevalence and impact on quality of life. Disabil Rehabil 2011; 33: 1389-98.

3. Raepsaet C, Fourie A, Van Hecke A, Verhaeghe S, Beeckman D. Management of incontinence-associated dermatitis: a systematic review of monetary data. Int Wound J 2021; 18: 79-94.

4. Shah D, Badlani G. Treatment of overactive bladder and incontinence in the elderly. Rev Urol 2002; 4 Suppl 4: S38-43.

5. Zarowitz BJ, Allen C, O’Shea T, Tangalos E, Berner T, Ouslander JG. Clinical burden and nonpharmacologic management of nursing facility residents with overactive bladder and/or urinary incontinence. Consult Pharm 2015; 30: 533-42.

6. Doumouchtsis SK, Chrysanthopoulou EL. Urogenital consequences in ageing women. Best Pract Res Clin Obstet Gynaecol 2013; 27: 699-714.

7. Whitcomb EL, Subak LL. Effect of weight loss on urinary incontinence in women. Open Access J Urol 2011; 3: 123-32.

8. Du Moulin MF, Hamers JP, Ambergen AW, Janssen MA, Halfens RJ. Prevalence of urinary incontinence among community-dwelling adults receiving home care. Res Nurs Health 2008; 31: 604-12.

9. Nambiar AK, Arlandis S, Bø K, et al. European Association of Urology Guidelines on the diagnosis and management of female non-neurogenic lower urinary tract symptoms. Part 1: diagnostics, Overactive bladder, Stress urinary incontinence, and mixed urinary incontinence. Eur Urol 2022; 82: 49-59.

10. Jeong G, Park S. Review of urinary continence care products using sensor technology to improve effectiveness. Proc Inst Mech Eng H 2019; 233: 91-9.

11. Fischer M, Renzler M, Ussmueller T. Development of a smart bed insert for detection of incontinence and occupation in elder care. IEEE Access 2019; 7: 118498-508.

12. Ziai MA, Batchelor JC. Smart radio-frequency identification tag for diaper moisture detection. Healthc Technol Lett 2015; 2: 18-21.

13. Cho JH, Choi JY, Kim NH, et al. A smart diaper system using bluetooth and smartphones to automatically detect urination and volume of voiding: prospective observational pilot study in an acute care hospital. J Med Internet Res 2021; 23: e29979.

14. Yu P, Hailey D, Fleming R. An exploration of the effects of introducing a telemonitoring system for continence assessment in a nursing home. J Clin Nurs 2014; 23: 3069-76.

15. Persu C, Braschi E, Lavelle J. A review of prospective Clinical Trials for neurogenic bladder: the place of surgery, experimental techniques and devices. Cent Eur J Urol 2014; 67: 270-6.

16. The Ghent Global IAD Categorisation Tool (GLOBIAD) 2017, Skin Integrity Research Group-Ghent University.

17. Wai AA, Fook VF, Jayachandran M, et al. Smart wireless continence management system for persons with dementia. Telemed J E Health 2008; 14: 825-32.

18. Huion A, Decalf V, Kumps C, De Witte N, Everaert K. Smart diapers for nursing home residents with dementia: a pilot study. Acta Clin Belg 2019; 74: 258-62.

19. Cho JH, Choi JY, Kim NH, et al. A smart diaper system using bluetooth and smartphones to automatically detect urination and volume of voiding: prospective observational pilot study in an acute care hospital. J Med Internet Res 2021; 23: e29979.

Letter to the Editor

Thrombosis and Hemostasis

Soluble P-selectin level in patients with cancerassociated venous and artery thromboembolism: a systematic review and meta-analysis

Xueli Zhang1,2, Chen Zhang1,

1Department of Respiratory and Critical Care Medicine, Beijing Chao-Yang Hospital, Capital Medical University, Beijing Institute of Respiratory Medicine, Beijing, China

2Department of Respiratory and Critical Care Medicine, Beijing Shunyi District Hospital, Beijing, China

3Department of Pharmacy, Beijing Chao-Yang Hospital, Capital Medical University, Beijing, China

Submitted: 22 November 2022; Accepted: 5 January 2013 Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 274–282

DOI: https://doi.org/10.5114/aoms/159039

Copyright © 2023 Termedia & Banach

It is generally known that tumor and venous thromboembolism (VTE) are interrelated. VTE, a primary reason for death, can take place in about 20% of terminally ill patients [1]. The connection of tumors with arterial thromboembolism (ATE), as opposed to VTE related to cancer, has only lately been proven. For ischemic stroke, tumor is one of the known sensitive markers [2–4]. Tumor sufferers get a 2-fold greater chance of having an ischemic stroke within the initial 0.5 years following their medical assessment [2]. Compared to controls, strokes in tumor sufferers are typically more painful and deadly, and relapse more frequently [5].

By illustration, D-dimer, a nonspecific fibrin breakdown product, is a widely used marker for VTE in the clinic [6]. Multiple risk indicators and markers have also been found for tumor-induced VTE. According to the Optimal Anticoagulation Strategy In Stroke (OASIS)-Cancer study, extracellular matrix components and neutrophil extracellular trap formation (NETosis) are seen in high serum levels in tumor and ischemic stroke patients than controls [7, 8]. However, the repeatability and universality of the aforementioned indicators might restrict their potential efficacy.

Soluble P-selectin (sPsel) has drawn interest as a biomarker for both VTE and ATE. It is a member of the selectin family of cell-adhesion molecules, which is expressed on platelets and endothelial cells and mediates cell interaction, and it stimulates the formation of thrombin and fibrin, which indicates proangiogenic characteristics and a thrombogenic state [9]. Elevated sPsel serum contents are seen to be highly linked with VTE in case-control studies of non-tumor VTE patients and healthy participants without a diagnosis of vein or artery thrombosis [10]. sPsel was again demonstrated to be a significant predictor for recurring VTE in the prospective observational research [11]. Additionally, tumor sufferers had an increased probability of developing ATE when their sPsel contents were raised [12]. Moreover, chemotherapy and other anti-cancer treatments will lead to increased levels of sPsel and deep vein thrombosis (DVT) [13].

This meta-analysis aimed to compile the latest information on the role of sPsel in the identification of tumor-related thrombosis, specifically VTE and ATE.

Corresponding author: Yuhui Zhang Department of Respiratory and Critical Care Medicine Beijing Chao-Yang Hospital Capital Medical University Beijing Institute of Respiratory Medicine Beijing, China Phone/fax: +86+010-85231509 E-mail: zyuhuizyh@126.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Zhuo Ma3, Yuhui Zhang1

According to the Newcastle-Ottawa Scale (NOS), the prospective and case-control studies’ performance was measured. Patient selection (0–4 points), comparability (0–2 points), and effectiveness were the 3 main areas included in the NOS (0–3 points). Studies with a NOS score of ≥ 6 were deemed to be of excellent standard. The Agency for Healthcare Research and Quality (AHRQ)’s 11-item criteria were used to evaluate the methodological quality of cross-sectional studies. If a question was responded with “NO” or “UNCLEAR”, the element received “0” score; if “YES”, “1” score. Low, moderate, and high-quality articles referred to 0–3, 4-7, and 8-11, respectively.

For sPsel levels and a composite assessment of RR with 95% CI, the data were displayed as mean difference (MD) and 95% CI. By combining the collected OR/RR/HR as probability assessments, RR was determined. Given the heterogeneity among multiple studies, we opted for a random-effects model as opposed to a fixed-effects model. Forest plots were used to display results graphically.

For subgroup assessment, heterogeneity was assessed using the I2 statistic, with a value of 25–49% representing low heterogeneity, 50–75% moderate heterogeneity, and > 75% high heterogeneity. A  Z test was used to examine the consequences, and the suitable statistical threshold was chosen to be p < 0.05. Review Manager 5.4.1 and Stata SE16.0 were used for all analyses. A sensitivity analysis was conducted to assess the stability of pooled results. The presence of publication bias was further tested using Begg’s test.

Totally, 16 studies involving 455 cancer-associated thrombosis patients and 1812 cancer patients were enrolled (Figure 1).

Identification Eligibility

Screening Included

All of the selected articles were assessed for methodological quality. The quality score of each study was presented in Table I. Eleven studies were of high quality [13, 17–31], one study was of moderate quality [20] and two studies were of low quality [21, 29].

The pooled data exhibited that sPsel contents in cancer-associated thrombosis sufferers were conspicuously raised than in cancer sufferers (MD = 14.16, 95% CI; 9.36–18.96, I² = 67%, p = 0.0003) (Figure 2). Subgroup analyses did not show significant differences regarding the study design, tumor types, neoplasm staging or quality. Ethnic origin and sample size had a significant effect on the heterogeneity. Stratified by the ethnic origin, the level of sPsel of the Asians was higher than that of the non-Asians (MD = 18.75, 95% CI: 12.96–24.53 vs. MD = 10.90, 95% CI: 5.41–16.38, p = 0.05; I2 = 68%, p = 0.0002, random effect model). Meanwhile, the heterogeneity (I2) of the small study population (n < 100) group decreased to 8% after performing subgroup analysis with sample size, and it suggested that sample size probably was another bias of heterogeneity.

The sPsel level was significantly increased after cancer patients developed thrombosis (pooled RR = 1.94, 95% CI: 1.47–2.41, p < 0.001; I2 = 0%, p = 0.853, fixed effects model, Figure 3). As shown in Table II, there was no significant difference of sPsel level between cancer-associated VTE and ATE when subgroup analysis was based on the type of thromboembolism. sPsel was higher in VTE (RR = 2.00, 95% CI: 1.42–2.58, p < 0.001) and ATE populations (RR = 1.83, 95% CI: 1.03–2.63, p < 0.001, Figure 4), without between-study heterogeneity (p = 0.732).

Records identified through database searching (n = 583):

PubMed 147, Cochrane Library 22, Embase 66, Web of Science 184, Ovid 75, Others 89

Records based on review of title and abstract (n = 383)

Publications obtained for further evaluation (n = 32)

Studies included in meta-analysis (n = 16)

Figure 1. Flow diagram of literature search and study selection

Records after duplicates removed (n = 200)

Records excluded (n = 351)

Animal experiment trials (n = 28)

Case reports, reviews, metaanalysis, conference abstract, editorials, neither English nor Chinese (n = 70)

Not meeting the requirements (n = 253)

Full-text articles excluded (n = 16)

Lack of data of P-selectin (n = 6)

Not relevant to cancer and P-selectin (n = 4)

Overlap population (n = 2)

Study population was children (n = 4)

Soluble P-selectin level in patients with cancer-associated venous and artery thromboembolism: a systematic review and meta-analysis

Study Cancer related thrombosis Cancer Weight Mean difference IV, Mean difference IV, or subgroup Mean SD Total Mean SD Total (%) random, 95% CI random, 95% CI

Castellon Rubio VE 2020 35.29 17.86 18 8.53 8.17 72 10.0 26.76 [18.30, 35.22]

Cihan Ay 2008 48.17 21 44 42.42 14.33 643 11.5 5.75 [–0.55, 12.05]

Elmoamly S 2019 28.88 26.57 12 26.1 22.37 159 5.8 2.78 [–12.65, 18.21]

Fernandes LFB 2018 33.6 23.35 44 20.4 6.92 73 11.0 13.20 [6.12, 20.28]

Li Kun 2020 71.25 51.06 28 42.98 43.08 30 3.1 28.27 [3.87, 52.67]

Malaponte G 2015 75.8 32.3 64 55.4 22.5 321 10.1 20.40 [12.11, 28.69]

Navi BB 2021 43.54 25.95 50 35.42 13.74 50 10.2 8.12 [–0.02, 16.26]

Riedl J 2015 45.98 22.04 131 39.21 14.54 262 13.0 6.77 [2.61, 10.93]

Schorling RM 2020 54.31 34.28 6 48.71 19.7 67 2.5 5.60 [–22.23, 33.43]

Setiawan B 2020 138.65 81.51 5 73.57 14.92 35 0.4 65.08 [–6.54, 136.70]

Xiao X 2019 70.92 50.48 30 43.13 42.78 31 3.2 27.79 [4.27, 51.31]

Xin SZ 2012 128.49 8.18 3 112.62 10.31 26 8.8 15.87 [5.80, 25.94]

Zhong X 2020 31.46 17.13 20 13.51 7.43 43 10.4 17.95 [10.12, 25.78]

Total (95% CI) 455 1812 100.0 14.16 [9.36, 18.96] Heterogeneity: t2 = 41.67; c2 = 36.36, df = 12 (p = 0.0003); p = 67% Test for overall effect: Z = 5.78 (p < 0.00001)

Figure 2. Forest plot for sPsel contents among cancer-associated thrombosis sufferers and cancer sufferers

The deletion of any research did not change the pooled outcomes notably. Publication bias was tested by Begg’s test, and the results showed that P-selectin (p = 0.849) and pooled RR (p = 0.081) had no publication bias.

Cancer induces a 7-fold risk of VTE [32]. In contrast, cancer-related ATE has been just recently established. The etiopathogenesis of thromboembolism in tumor sufferers appears to be multifactorial. Once more, tumor formation, development, expansion, and migration are encouraged by tumor cells’ capacity to connect with and stimulate the hemostatic system and coagulation [33].

In thrombosis, infection, and the development and progression of cancer, P-selectin facilitates the adherence of platelets and tumor cells [12]. P-selectin and its primary counter-interaction re-

ceptors cause the production of procoagulant microscopic particles and promote the creation of thrombus and fibrin [12]. Additionally, P-selectin has been shown to promote surface-dependent thrombin production on monocytes and tissue factor expression [32]. It is interesting to note that tumor cells can boost the production of P-selectin on platelets, endothelial cells, macrophages, and monocytes [33]. Thrombin, its fractions, or other variables that cause a hypercoagulable condition may stimulate platelets, elevating sPsel [11].

According to C’s study (based on data from the CATS database), elevated plasma sPsel contents substantially reflect VTE in tumor sufferers [17]. Patients who are at a higher risk of VTE may be identified by measuring sPsel at the time of tumor diagnosis. Deterministic markers have only been

Study ID RR (95% CI) Weight (%)

Cihan Ay (2008) 2.60 (1.40, 4.90) 7.13

Thaler J (2014) 2.71 (1.34, 5.78) 4.43

Riedl J (2015) 2.27 (1.39, 3.70) 16.38

Fernandes LFB (2018) 3.38 (1.40, 8.21) 1.88

Griz E (2019) 1.80 (1.20, 2.80) 34.13

Obermeier (2019) 1.61 (1.00, 2.58) 35.00

Castelion Rubio VE (2020) 66.40 (8.70, 506.69) 0.00

Setiawan (2020) 1.02 (0.98, 11.05) 0.86

Navi BB (2021) 7.20 (–3.90, 18.30) 0.18

Overall (I2 = 0.0%, p = 0.853) 1.94 (1.47, 2.41) 100.00

–100 –50 0 50 100 Favours [control] Favours [case] –1 0 1 3 5

Figure 3. Forest plot of RR for pooled outcome comparisons between cancer-associated thrombosis patients and cancer patients RR – relative risk, CI – confidence interval

Xueli Zhang, Chen Zhang, Zhuo Ma, Yuhui Zhang

Soluble P-selectin level in patients with cancer-associated venous and artery thromboembolism: a systematic review and meta-analysis

Table II. Results of a meta-analysis of subgroups

Parameter

sPsel level [MD (ng/ml), 95%CI] Pooled RR (95%CI) P -value Heterogeneity [ I2 (%)] In subgroup Between subgroups

Ethnic origin Asians 18.75 [12.96, 24.53] 0.54 0% 73.1%, p = 0.05 Non-Asians 10.90 [5.41, 16.38] 0.0004 74%

Sample size n < 100 21.40 [16.20, 6.61] 0.36 8% 81.8%,  p = 0.02 n ≥ 100 12.17 [6.28, 18.07] 0.0002 78%

Type of thromboembolism VTE 2.00 (1.423, 2.576) 0.805 0% p = 0.732 ATE 1.828 (1.030 2.626) 0.342 0%

Prospective or retrospective Prospective 12.61 [6.05, 19.16] 0.004 66% 0%, p = 0.42 Retrospective 17.05 [8.39, 25.72] 0.004 74%

Neoplasm staging Local 23.07 [13.80, 2.33] 0.93 0% 0%, p = 0.75 Metastatic 23.64 [15.07, 2.21] 1.0 0%

Study design Case-control 16.25 [5.82, 26.68] 0.01 73% 0%, p = 0.58 Cohort 14.93 [6.37, 23.48] 0.001 73% Cross-sectional 11.01 [5.67, 16.35] 0.36 0%

Study quality Low/moderate 17.15 [12.79, 1.52] 0.45 0% 37.4%, p = 0.21 High 12.21 [5.90, 18.51] 0.001 69%

Study ID

VTE

RR (95% CI) Weight (%)

Cihan Ay (2008) 2.60 (1.40, 4.90) 7.13

Thaler J (2014) 2.71 (1.34, 5.78) 4.43

Riedl J (2015) 2.27 (1.39, 3.70) 16.38

Fernandes LFB (2018) 3.38 (1.40, 8.21) 1.88

Obermeier (2019) 1.61 (1.00, 2.58) 35.00

Castellon Rubio VE (2020) 66.40 (8.70, 506.69) 0.00

Setiawan (2020) 1.02 (0.98, 11.05) 0.86

Subtotal (I2 = 0.0%, p = 0.805) 2.00 (1.42, 2.58) 65.69

ATE

Gritz E (2019) 1.80 (1.20, 2.80) 34.13

Navi BB (2021) 7.20 (–3.90, 18.30) 0.18

Subtotal (I2 = 0.0%, p = 0.342) 1.83 (1.03, 2.63) 34.31

Heterogeneity between groups: p = 0.732

Overall (I2 = 0.0%, p = 0.853) 1.94 (1.47, 2.41) 100.00

MD – mean difference, CI – 95% confidence interval, RR – relative risk, VTE – venous thromboembolism, ATE – artery thromboembolism. –1 0 1 3 5

Figure 4. Forest plot according to RR of sPsel for VTE and ATE sufferers with their controls. Relative risk (RR), Confidence interval (CI), soluble P-selectin (sPsel), venous thromboembolism (VTE), artery thromboembolism (ATE)

examined in a small number of prospective trials in tumor and stroke patients. Arterial thrombosis is largely influenced by activated platelets. Bielinski et al. [34] revealed that elevated sPsel contents forecasted a 1.8-fold elevation in the probability of coronary heart disease in non-cancer individuals.

To our knowledge, we reported the first systematic review and meta-analysis of a specific level of sPsel in cancer-associated thrombosis, including VTE and ATE, published to date. Our study indicated for the first time that sPsel may be a risk factor for cancer patients with VTE or ATE.

The previous meta-analysis performed by Constantine first reviewed that the sPsel was significantly elevated in patients with VTE and it was a plasma biomarker that may help in the diagnosis of VTE [35]. The specific levels of sPsel were still unclear in patients with cancer-associated VTE and ATE. We conducted a pooled assessment of 16 studies. The results of this meta-analysis, synthesizing evidence of levels of sPsel from 455 CAT patients and 1,882 cancer patients from 13 types of studies indicated that sPsel contents were markedly raised in tumor sufferers associated with VTE and ATE. Mean sPsel contents were 1.94, 2.00, and 1.83 times higher in tumor sufferers with thrombosis, with VTE, and with ATE, respectively, compared to cancer patients.

Cancer-associated thromboembolism (ATE) has been just recently established [2–4]. There is a relationship of sPsel with ATE in tumor sufferers [13] or controls [36, 37]. Otherwise, another study [22] revealed that all hematological biomarkers except P-selectin were prominently raised in the tumor and stroke sufferers than tumor sufferers. Multiple linear regression models showed that tumor and stroke sufferers were dramatically related to higher D-dimer, but not P-selectin. So, it is controversial about levels of P-selectin in cancer-associated ATE. In our meta-analysis, cancer-associated ATE has a higher level of sPsel than cancer patients, suggesting sPsel is probably related to cancer-associated ATE.

Population-based subgroup analysis showed that the level of sPsel was significantly higher in Asian cancer patients with thrombosis than that in non-Asians. Besides, Bielinski’s study [34] observed ethnic heterogeneity in the association of P-selectin and the risk of coronary heart disease. Moreover, Asians had a decreased heterogeneity (Table II), indicating ethnics might be the possible source of heterogeneity. Additionally, the research design may not affect the results in the subgroup assessment. The outcome showed no difference among case-control studies, cohort studies and cross-sectional studies, but the cross-sectional study subgroup had a lower heterogeneity (Table II), which might be the possible source of heterogeneity. Meanwhile, in view of prospective or retrospective studies, there was no significant difference, either. Many studies have shown that raised plasma sPsel content notably influences solid tumors [17, 18, 25–27, 31, 38, 39], but few are about hematological tumors. Interestingly, inhibition of platelet activation can prevent the accumulation of P-selectin in cancer cells and reduce the growth and metastasis of tumors in

vivo [40]. In Elmoamly’s cohort study, the serum P-selectin level in hematological tumors was not associated with VTE ( p = 0.9) [19]. Besides, there was no difference in P-selectin level between local and metastatic cancer patients, possibly resulting from the insufficient sample size. When studying quality as a subgroup, heterogeneity ( I 2) of low/moderate quality group decreased to 0%, which indicates study quality may be a source of heterogeneity, needing more high-quality studies in the future.

This study has some limitations ineluctably in this meta-analysis. First, the sample size is probably a potential modifier in subgroup analysis. Second, low-quality studies including uncontrolled nature and quite a bit of bias may affect the reliability of the results reflecting methodological drawbacks of the eligible studies. Third, some studies might not be included on account of the unavailable full-text or incomplete data, such as a low absolute number of arterial events.

Future relevant studies may need to focus more on the study population in large-sample and multi-centers around the world. Besides, studies aiming at levels and diagnosed efficiency of sPsel in cancer-associated ATE (stroke, infarction, etc.) instead of VTE are needed. Moreover, high-quality studies and diagnostic clinical trials of sPsel in tumor sufferers associated VTE or ATE are urgently required to identify patients at high risk of thrombosis earlier and guide treatment.

All in all, we showed sPsel as a good indicator for cancer-associated VTE or ATE. Asian cancer patients may have a higher level of sPsel than nonAsians, indicating a genetic difference of sPsel. Evaluation of sPsel may be for monitoring and conduct of early and prompt identification for cancer-associated thromboembolic diseases.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Grant number 31770961).

Conflict of interest

The authors declare no conflict of interest.

References

1. Khorana AA., Francis CW, Culakova E, Kuderer NM, Lyman GH. Thromboembolism is a leading cause of death in cancer patients receiving outpatient chemotherapy. J Thromb Haemost 2007; 5: 632-4.

2. Grilz E, Konigsbrugge O, Posch F, et al. Frequency, risk factors, and impact on mortality of arterial thromboembolism in patients with cancer. Haematologica 2018; 103: 1549-56.

Xueli Zhang, Chen Zhang, Zhuo Ma, Yuhui Zhang

Soluble P-selectin level in patients with cancer-associated venous and artery thromboembolism: a systematic review and meta-analysis

3. Navi BB, Reiner AS, Kamel H, et al. Risk of arterial thromboembolism in patients with cancer. J Am Coll Cardiol 2017; 70: 926-38.

4. Navi BB, Reiner AS, Kamel H, et al. Arterial thromboembolic events preceding the diagnosis of cancer in older persons. Blood 2019; 133: 781-9.

5. Navi BB, Iadecola C. Ischemic stroke in cancer patients: a review of an underappreciated pathology. Ann Neurol 2018; 83: 873-83.

6. Pabinger I, Ay C. Biomarkers and venous thromboembolism. Arterioscler Thromb Vasc Biol 2009; 29: 332-6.

7. Bang OY, Chung JW, Cho YH, et al. Circulating DNAs, a marker of neutrophil extracellular traposis and cancer-related stroke: the OASIS-Cancer Study. Stroke 2019; e50: 2944-7.

8. Bang OY, Chung JW, Lee MJ, et al. Cancer cell-derived extracellular vesicles are associated with coagulopathy causing ischemic stroke via tissue factor-independent way: the OASIS-CANCER Study. PLoS One 2016; 11: e0159170.

9. Polgar J, Matuskova J, Wagner DD. The P-selectin, tissue factor, coagulation triad. J Thromb Haemost 2005; 3: 1590-6.

10. Ay C, Jungbauer LV, Sailer T, et al. High concentrations of soluble P-selectin are associated with risk of venous thromboembolism and the P-selectin Thr715 variant. Clin Chem 2007; 53: 1235-43.

11. Chen M, Geng JG. P-selectin mediates adhesion of leukocytes, platelets, and cancer cells in inflammation, thrombosis, and cancer growth and metastasis. Arch Immunol Ther Exp 2006; 54: 75-84.

12. Grilz E, Marosi C, Königsbrügge O, et al. Association of complete blood count parameters, d-dimer, and soluble P-selectin with risk of arterial thromboembolism in patients with cancer. J Thromb Haemost 2019; 17: 1335-44.

13. Setiawan B, Permatadewi CO, de Samakto B, et al. Von Willebrand factor:antigen and ADAMTS-13 level, but not soluble P-selectin, are risk factors for the first asymptomatic deep vein thrombosis in cancer patients undergoing chemotherapy. Thromb J 2020; 18: 33.

14. Moher D, Liberati A, Tetzlaff J, Altman DG, Group P. Preferred reporting items for systematic reviews and meta-analyses: the PRISMA statement. BMJ 2009; 39: b2535.

15. Luo D, Wan X, Liu J, Tong T. Optimally estimating the sample mean from the sample size, median, mid-range, and/or mid-quartile range. Stat Methods Med Res 2018; 27: 1785-805.

16. Wan X, Wang W, Liu J, Tong T. Estimating the sample mean and standard deviation from the sample size, median, range and/or interquartile range. BMC Med Res Methodol 2014; 14: 135.

17. Ay C, Simanek R, Vormittag R, et al. High plasma levels of soluble P-selectin are predictive of venous thromboembolism in cancer patients: results from the Vienna Cancer and Thrombosis Study (CATS). Blood 2008; 112: 2703-8.

18. Castellón Rubio VE, Segura PP, Muñoz A, Farré AL, Ruiz LC, Lorente JA. High plasma levels of soluble P-selectin and factor VIII predict venous thromboembolism in non-small cell lung cancer patients: the Thrombo-Nsclc risk score. Thrombosis Res 2020; 196: 349-54.

19. Elmoamly S, Mattar M, Yacoub MF, Afif A. Can biomarkers of coagulation, platelet activation, and inflammation predict venous thromboembolism in patients with haematological malignancies? Acta Haematol 2019; 141: 245-253.

20. Fernandes LFB, Fregnani J, Strunz CMC, de Andrade Ramos Nogueira A, Longatto-Filho A. Role of P-selectin in thromboembolic events in patients with cancer. Mol Clin Oncol 2018; 8: 188-96.

21. Malaponte G, Signorelli SS, Bevelacqua V, et al. Increased levels of NF-κB-dependent markers in cancer-associated deep venous thrombosis. PLoS One 2015; 10: e0132496.

22. Navi BB, Sherman CP, Genova R, et al. Mechanisms of ischemic stroke in patients with cancer: a prospective study. Ann Neurol 2021; 90: 159-69.

23. Obermeier HL, Riedl J, Ay C, et al. The role of ADAMTS-13 and von Willebrand factor in cancer patients: results from the Vienna Cancer and Thrombosis Study. Res Practice Thromb Haemostasis 2019; 3: 503-14.

24. Riedl J, Hell L, Kaider A, et al. Association of platelet activation markers with cancer-associated venous thromboembolism. Platelets 2016; 27: 80-5.

25. Schorling RM, Pfrepper C, Golombek T, et al. Evaluation of biomarkers for the prediction of venous thromboembolism in ambulatory cancer patients. Oncol Res Treat 2020; 43: 414-27.

26. Setiawan B, Permatadewi CO, de Samakto B, et al. Von Willebrand factor:antigen and ADAMTS-13 level, but not soluble P-selectin, are risk factors for the first asymptomatic deep vein thrombosis in cancer patients undergoing chemotherapy. Thromb J 2020; 18: 33.

27. Thaler J, Ay C, Kaider A, et al. Biomarkers predictive of venous thromboembolism in patients with newly diagnosed high-grade gliomas. Neuro Oncol 2014; 16: 1645-51.

28. Zhong X, Cao Z, Song J, Liu Y, Guo Q. Relationship of platelet glycoprotein IIb/IIIa and CD62P with hypercoagulable state after oncologic surgery. Clin Appl Thromb Hemost 2020; 26: 1076029620977906.

29. Li K, Zhang W. Analysis of expression and clinical application of plasma P-selectin malignant tumor complicated by pulmonary thromboembolism. Chin J Modern Drug Appl 2020; 14: 20-2.

30. Xiao X, Zou X. Clinical value of plasma P selectin in malignant tumor complicated with pulmonary embolism. Guangxi Medical University 2019.

31. Xin S, Wang Y. Correlation of platelet, P-selectin, tissue factor and D-dimer with thrombotic events and prognosis in non-small cell lung cancer. Tianjin Medical University 2012.

32. Celi A, Pellegrini G, Lorenzet R, et al. P-selectin induces the expression of tissue factor on monocytes. Proc Natl Acad Sci USA 1994; 91: 8767-71.

33. Shamay Y, Elkabets M, Li H, et al. P-selectin is a nanotherapeutic delivery target in the tumor microenvironment. Sci Transl Med 2016; 8: 345ra87.

34. Bielinski SJ, Berardi C, Decker PA, et al. P-selectin and subclinical and clinical atherosclerosis: the Multi-Ethnic Study of Atherosclerosis (MESA). Atherosclerosis 2015; 240: 3-9.

35. Antonopoulos CN, Sfyroeras GS, Kakisis JD, Moulakakis KG, Liapis CD. The role of soluble P selectin in the diagnosis of venous thromboembolism. Thromb Res 2014; 133: 17-24.

36. Tscharre M, Vogel B, Tentzeris I, et al. Prognostic impact of soluble P-selectin on long-term adverse cardiovascular outcomes in patients undergoing percutaneous coronary intervention. Thromb Haemost 2019; 119: 340-7.

37. Zamani P, Schwartz GG, Olsson AG, et al.; Myocardial Ischemia Reduction with Aggressive Cholesterol Lowering Study. Inflammatory biomarkers, death, and recur-

rent nonfatal coronary events after an acute coronary syndrome in the MIRACL study. J Am Heart Assoc 2013; 2: e003103.

38. Ay C, Dunkler D, Marosi C, et al. Prediction of venous thromboembolism in cancer patients. Blood 2010; 116: 5377-82.

39. Kanz R, Vukovich T, Vormittag R, et al. Thrombosis risk and survival in cancer patients with elevated C-reactive protein. J Thromb Haemost 2011; 9: 57-63.

40. Mezouar S, Darbousset R, Dignat-George F, Panicot-Dubois L, Dubois C. Inhibition of platelet activation prevents the P-selectin and integrin-dependent accumulation of cancer cell microparticles and reduces tumor growth and metastasis in vivo. Int J Cancer 2015; 136: 462-75.

Xueli Zhang, Chen Zhang, Zhuo Ma, Yuhui Zhang

Hepatology

Early thrombolysis combined with anticoagulation and antibiotics for

venous system thrombosis secondary

infection

Fangbo

1Liver Cirrhosis Study Group, Department of Gastroenterology, General Hospital of Northern Theater Command, Shenyang, China

2Postgraduate College, Shenyang Pharmaceutical University, Shenyang, China

3Department of Emergency, General Hospital of Northern Theater Command, Shenyang, China

Submitted: 5 October 2022; Accepted: 7 January 2023

Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 283–287

DOI: https://doi.org/10.5114/aoms/159083

Copyright © 2023 Termedia & Banach

Portal venous system thrombosis (PVST) refers to the development of clots within the main portal vein, intrahepatic portal vein branches, mesenteric vein, and/or splenic vein. It is an uncommon condition often associated with hypercoagulable state and intra-abdominal infection [1]. Acute PVST often causes abdominal pain secondary to intestinal ischemia. When intestinal necrosis develops, abdominal pain becomes more severe with high mortality, and bowel resection is often required. Anticoagulation has been regarded as the first-line choice for treating PVST [2]. However, more than 60% of non-cirrhotic and non-malignant patients with PVST cannot achieve portal vein recanalization after adequate anticoagulation [3]. Additionally, the rate of recurrent thrombosis is up to 40% in patients receiving anticoagulation alone, regardless of the duration of anticoagulation [4]. In this setting, thrombolysis has been attempted for improving the outcomes of acute PVST. Herein, we present a case of acute PVST secondary to intra-abdominal infection which was effectively treated with systemic thrombolysis combined with anticoagulation and antibiotics.

A 24-year-old solider with no significant medical history was admitted to the Department of Emergency of our hospital due to aggravating severe abdominal pain accompanied by fever, nausea, and vomiting for 4 days. He did not have any family history of venous thromboembolism. On day 1 of admission, laboratory tests demonstrated significantly elevated white blood cell counts, neutrophil counts, and C-reactive protein (Table I). Plain computed tomography (CT) scans also showed increased mesenteric density, suggesting a diagnosis of peritonitis. Intravenous injection of ertapenem at a dose of 1000 mg was given. On day 2 of admission, contrast-enhanced CT scans were performed after a consultation with gastroenterologists, and showed no contrast agent filling within the right portal vein (RPV) and superior mesenteric vein (SMV), but mesenteric venous gas (Figure 1 A). Thus, a diagnosis of acute PVST was made. On the same day, the subcutaneous injection of enoxaparin sodium was initiated at a dose of 40 mg twice per day and intravenous injection of levofloxacin was given at a daily dose of 500 mg. On day 5 of admission, he was transferred to the Department of Gastroenterology. Laboratory tests showed a reduction in white blood cell counts, neutrophil counts, and

Corresponding author: Dr. Xingshun Qi

Liver Cirrhosis Study Group Department of Gastroenterology General Hospital of Northern Theater Command Shenyang, China E-mail: xingshunqi@126.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

acute portal

to intra-abdominal

Gao1,2, Ran Wang1, Longfei Han3, Rui Zhang1, Xingshun Qi1

Table I. Laboratory tests in this patient

Laboratory tests

Reference range Before antithrombotic treatment

After 4-day anticoagulation alone

After 3-month anticoagulation

White blood cell count [× 109/l] 3.5–9.5 12.10 7.30 6.8

Neutrophil ratio (%) 40–75 79 67.70 70.4

Hemoglobin [mg/l] 130–175 145 127 145

Platelet count [× 109/l] 125–350 271 341 242

C-reactive protein concentration [mg/l] < 10 74.1 53.06 –

Total bilirubin [μmol/l] 5.1–22.2 16.70 8 9.9

Aspartate aminotransferase [U/l] 15–40 52.19 37.90 18.43

Alanine aminotransferase [U/l] 9–50 61.32 55.61 22.22

Alkaline phosphatase [U/l] 45–125 352.13 306.14 128.11

Prothrombin time [s] 11.0–13.7 14.80 13.60 13.5

International normalized ratio 0.9–1.2 1.16 1.05 1.01

Activated partial thromboplastin time [s] 31.5–43.5 48.90 51.40 42

D-dimer [mg/l] 0–0.55 7.09 2.34 0.10

Antithrombin III (%) 80–120 82 82 –

Fibrinogen [g/l] 2.0–4.0 5.88 4.17 3.0

Protein S (%) 75–130 80.6 – –

Protein C (%) 70–140 89.8 – –

Antiphospholipid antibodies:

IgG anti-cardiolipin (GPL) 0–20 – 2.12 2.34 IgM anti-cardiolipin (MPL) 0–20 – 1.96 1.83 Anti- β 2glycoprotein 1 IgM antibodies (SMU) 0–20 – 3.01 2.46

Anti- β 2glycoprotein 1 IgG antibodies (SGU) 0–20 – 2.52 2.03

Lupus anticoagulant 1 (S) 31–44 – 58.8 –Lupus anticoagulant 2 (S) 30–38 – 44.5 –Lupus anticoagulant 1/ Lupus anticoagulant 2 0.8–1.2 – 1.32 –

Thrombophilic gene polymorphisms: – –Methylenetetrahydrofolate reductase C677T – – CC –

Methionine synthase reductase A66G – – AG –

Plasminogen activator inhibitor 1 4G/5G – – 4G/4G –

Prothrombin G20210A – – GG –Factor V G1601A (Leiden) – – GG –

C-reactive protein (Table I). On day 8 of admission, contrast-enhanced CT scans showed that RPV thrombosis was recanalized, but SMV thrombosis remained occluded and mesenteric venous gas persisted (Figure 1 B). Thus, systemic thrombolysis was recommended. After this patient and his relatives’ informed consent forms were obtained, the intravenous injection of urokinase at a dose of 300,000 IU was added to enoxaparin sodium at a dose of 40 mg twice per day, and levofloxacin injection was changed to ceftriaxone sodium

at a dose of 1000 mg twice per day. On day 11 of admission, this patient’s abdominal pain improved significantly. On day 15 of admission, urokinase was discontinued, but enoxaparin sodium was continued. During systemic thrombolysis, the patient did not experience any bleeding episode. On day 31 of admission, his abdominal pain completely disappeared. Enoxaparin sodium was replaced with oral rivaroxaban 10 mg twice per day. Contrast-enhanced CT scans showed that SMV thrombosis was slightly improved, and mesenteric

Fangbo Gao, Ran Wang, Longfei Han, Rui Zhang, Xingshun Qi

Figure 1. Axial computed tomography images in this patient. A – On day 2 of admission, CT images demonstrated occlusive thrombosis within the right portal vein (RPV) (solid black arrow) and superior mesenteric vein (SMV) (solid red arrow) and mesenteric venous gas (dotted red arrow). B – On day 8 of admission, CT images demonstrated partially recanalized RPV (solid black arrow), but SMV (solid red arrow) thrombosis remained occluded and mesenteric venous gas persisted (dotted red arrow). C – On day 31 of admission, CT images demonstrated that SMV (solid red arrow) thrombosis was slightly improved, and the mesenteric venous gas disappeared (dotted red arrow). D – After 3-month anticoagulation with rivaroxaban, CT images demonstrated completely recanalized SMV (solid red arrow) without mesenteric venous gas (dotted red arrow)

venous gas disappeared (Figure 1 C). Then, he was discharged. After 3-month anticoagulation with rivaroxaban, contrast-enhanced CT scans showed that SMV became patent (Figure 1 D). Laboratory tests showed the normalization of white blood cell counts, neutrophil counts, and C-reactive protein (Table I).

Acute abdomen caused by PVST has been increasingly recognized. However, systemic thrombolysis has been rarely attempted for the treatment of acute PVST in clinical practice due to its potential bleeding risk [2]. Our case was diagnosed with acute symptomatic PVST according to the time of onset, and still presented with abdominal pain and occlusive mesenteric vein thrombosis after 1-week anticoagulation alone Finally, he underwent systemic thrombolysis, which may increase the possibility of thrombus recanalization.

PVST can be caused by various local and/or systemic thrombophilic factors, including pancreatitis, portal vein injury during surgery, and intra-abdominal infection [5]. In our case, pylephlebitis due to intra-abdominal infection should be a major predisposing factor for PVST because he developed persistent fever two days before the occurrence of abdominal pain, and had higher levels

of white blood cell count, neutrophils, and C-reactive protein at admission. Intra-abdominal infection can cause inflammation within and around splanchnic vessels via the procoagulant effects of gut anaerobes and neutrophil extracellular trap formation in local venules, thereby developing PVST [6]. Notably, our case developed mesenteric venous gas, which might be attributed to gas-producing microorganisms within the hepatic vascular or infection focus that enters into the splanchnic circulation [7]. Additionally, screening for other thrombotic risk factors revealed a heterozygous mutation in methionine synthase reductase A66G polymorphism and a homozygous mutation in plasminogen activator inhibitor 1 4G/5G in our case, which should also be concomitant risk factors for PVST [8, 9].

Antibiotics are the mainstay treatment for pylephlebitis. Anticoagulation has also been shown to further improve portal vein recanalization [10, 11]. If there is no response to anticoagulation therapy in patients with recent and extensive PVST and signs of intestinal ischemia or infarction, thrombolytic therapy may be effective [12]. However, the dosage and duration of thrombolysis have not been clearly recommended by the

Early thrombolysis combined with anticoagulation and antibiotics for acute portal venous system thrombosis secondary to intra-abdominal infection

guidelines. In a prospective cohort study [13], 9 cirrhotic patients with recent PVST received continuously intravenous infusion of recombinant tissue-type plasminogen activator (rtPA) at a dose of 0.25 mg/kg/day combined with subcutaneous injection of low molecular weight heparin for 4–7 days. The rate of PVST recanalization was 88.9%. In a retrospective cohort study [14], 33 patients with acute PVST were treated with intravenous injection of 750,000 IU/day streptokinase or 100–150 mg/6–12 h rtPA for 2–3 days followed with heparin infusion, and then received oral anticoagulant for 12 months after discharge. The rate of PVST recanalization was 69.7%. Until now, urokinase has never been employed for systemic thrombolytic therapy in patients with acute PVST. Considering that PVST was more severe in our case, urokinase was given at a greater dosage for a longer duration as compared to its recommended dosage and duration for deep vein thrombosis [15]. Notably, his abdominal pain disappeared completely without any bleeding at discharge.

There are several limitations in this case report. First, considering that this patient was thin with a weight of 50 kg and the specification of enoxaparin is 40 mg per dose, a dosage of 40 mg once was finally selected, which may be associated with suboptimal outcomes of anticoagulant therapy alone [16–18]. Second, we could not know if this patient has a JAK2 V617F mutation, because the gene mutation detection is not available at our hospital. Third, we have not re-examined the lupus anticoagulant in this patient yet. Thus, a diagnosis of antiphospholipid syndrome could not be made.

To the best of our knowledge, our case may be the first report of systemic thrombolysis combined with anticoagulation and antibiotics for acute PVST with pylephlebitis. Generally, systemic thrombolysis provides a non-invasive approach with its benefits in alleviating symptoms and achieving portal vein recanalization more rapidly [19]. But it should be cautiously employed in young patients with acute PVST secondary to intra-abdominal infection who are free of bleeding risk factors and have no response to anticoagulation and antibiotics alone. Additionally, transjugular intrahepatic portosystemic shunt should be selectively considered in such patients [20].

Acknowledgments

Fangbo Gao, Ran Wang, Longfei Han, Rui Zhang contributed equally.

Conflict of interest

The authors declare no conflict of interest.

References

1. Qi X. Portal vein thrombosis: recent advance. Adv Exp Med Biol 2017; 906: 229-39.

2. Hepatobiliary Disease Study Group, Chinese Society of Gastroenterology, Chinese Medical Association. Consensus for management of portal vein thrombosis in liver cirrhosis (2020, Shanghai). J Dig Dis 2021; 22: 17686.

3. DeLeve LD, Valla DC, Garcia-Tsao G. Vascular disorders of the liver. Hepatology 2009; 49: 1729-64.

4. Wang L, Guo X, Xu X, et al. Anticoagulation favors thrombus recanalization and survival in patients with liver cirrhosis and portal vein thrombosis: results of a meta-analysis. Adv Ther 2021; 38: 495-520.

5. Harnik IG, Brandt LJ. Mesenteric venous thrombosis. Vasc Med 2010; 15: 407-18.

6. Naymagon L, Tremblay D, Schiano T, Mascarenhas J. The role of anticoagulation in pylephlebitis: a retrospective examination of characteristics and outcomes. J Thromb Thrombolysis 2020; 49: 325-31.

7. Yuan K, Chen QQ, Zhu YL, Luo F. Hepatic portal venous gas without definite clinical manifestations of necrotizing enterocolitis in a 3-day-old full-term neonate: a case report. World J Clin Cases 2021; 9; 9269-75.

8. Yates Z, Lucock M. Interaction between common folate polymorphisms and B-vitamin nutritional status modulates homocysteine and risk for a thrombotic event. Mol Genet Metab 2003; 79: 201-13.

9. Zhang Q, Jin Y, Li X, et al. Plasminogen activator inhibitor-1 (PAI-1) 4G/5G promoter polymorphisms and risk of venous thromboembolism - a meta-analysis and systematic review. Vasa 2020; 49: 141-6.

10. Plemmons RM, Dooley DP, Longfield RN. Septic thrombophlebitis of the portal vein (pylephlebitis): diagnosis and management in the modern era. Clin Infect Dis 1995; 21: 1114-20.

11. Kanellopoulou T, Alexopoulou A, Theodossiades G, Koskinas J, Archimandritis AJ. Pylephlebitis: an overview of non-cirrhotic cases and factors related to outcome. Scand J Infect Dis 2010; 42: 804-11.

12. Northup PG, Garcia-Pagan JC, Garcia-Tsao G., et al. Vascular liver disorders, portal vein thrombosis, and procedural bleeding in patients with liver disease: 2020 Practice Guidance by the American Association for the Study of Liver Diseases. Hepatology 2021; 73: 366-413.

13. De Santis A, Moscatelli R, Catalano C, et al. Systemic thrombolysis of portal vein thrombosis in cirrhotic patients: a pilot study. Dig Liver Dis 2010; 42: 451-5.

14. Malkowski P, Pawlak J, Michalowicz B, et al. Thrombolytic treatment of portal thrombosis. Hepatogastroenterology 2003; 50: 2098-100.

15. Becattini C, Agnelli G. Acute treatment of venous thromboembolism. Blood 2020; 135: 305-16.

16. Kearon C, Akl EA, Comerota AJ, et al. Antithrombotic therapy for VTE disease: Antithrombotic Therapy and Prevention of Thrombosis, 9th ed: American College of Chest Physicians Evidence-Based Clinical Practice Guidelines. Chest 2012; 141 (2 Suppl): e419S-96S.

17. Kearon C, Kahn SR, Agnelli G, Goldhaber S, Raskob GE, Comerota AJ. Antithrombotic therapy for venous thromboembolic disease: American College of Chest Physicians Evidence-Based Clinical Practice Guidelines (8th Edition). Chest 2008; 133 (6 Suppl): 454S-545S.

18. Bates SM, Greer IA, Middeldorp S, Veenstra DL, Prabulos AM, Vandvik PO. VTE, thrombophilia, antithrombotic therapy, and pregnancy: antithrombotic therapy and prevention of thrombosis, 9th ed: American College

Fangbo Gao, Ran Wang, Longfei Han, Rui Zhang, Xingshun Qi

Early thrombolysis combined with anticoagulation and antibiotics for acute portal venous system thrombosis secondary to intra-abdominal infection

of Chest Physicians Evidence-Based Clinical Practice Guidelines. Chest 2012; 141 (2 Suppl): e691S-736S.

19. Gao F, Wang L, Pan J, et al. Efficacy and safety of thrombolytic therapy for portal venous system thrombosis: a systematic review and meta-analysis. J Intern Med 2023; 293: 212-27.

20. Qi X, Guo X. An early decision of transjugular intrahepatic portosystemic shunt may be considered for non-malignant and non-cirrhotic portal vein thrombosis with ascites: a concise review of the theoretical possibility and practical difficulty. Arch Med Sci 2016; 12: 1381-3.

Arch Med Sci 1, 1st January / 2023

Infectious Diseases

Cold chain-affiliated associated SARS-CoV-2

omicron

BA.2 infections, Qingdao, Shandong, China, 2022

1Department of Endocrinology, Affiliated Qingdao Central Hospital, Qingdao University, Qingdao, Shandong, China

2Department of Respiratory, Affiliated Qingdao Central Hospital, Qingdao University, Qingdao, Shandong, China

3Department of Quality control, Affiliated Qingdao Central Hospital, Qingdao University, Qingdao, Shandong, China

4Department of Traditional Chinese Medicine, Affiliated Qingdao Central Hospital, Qingdao University, Qingdao, Shandong, China

Submitted: 24 August 2022; Accepted: 19 October 2022

Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 288–291

DOI: https://doi.org/10.5114/aoms/155882

Copyright © 2022 Termedia & Banach

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variant B.1.1.529 was classified by the World Health Organization (WHO) as one of the variants of concern and named Omicron on November 26, 2021. The Omicron subvariant has been spreading around the world [1, 2]. It has been reported that the transmission power of the Omicron variant is 2.8 times that of the Delta variant [3]. By January 2022, BA.1 was the dominant variant circulating globally, and the BA.2 variant had been detected in several countries, including China [4, 5]. But the clinical features and severity of BA.2 in adults have not yet been well described.

The latest guidelines from the Chinese health authorities indicate that confirmed cases of SARS-CoV-2 should be treated in isolated hospitals with effective isolation and protection conditions. We describe illness severity and clinical outcomes of a 45-person China logistics cold chain-affiliated cohort from June 30, 2022 to July 21, 2022, comprising predominantly stevedores, who tested positive for BA.2. Medical staff of Qingdao Central Hospital investigated and described the epidemiologic and clinical outcomes of the cohort.

We defined illness onset as the first date a case-patient experienced any SARS-CoV-2 symptom or the specimen collection date if a person was asymptomatic. In addition, patients were classified according to their symptoms and chest computed tomography (CT) images.

We identified 45 cases; 39 (86.7%) were stevedores in the cold chain factory, while the other 6 (13.3%) were cold chain related service personal. Median age among all case-patients was 39.75 (range: 20–57) years; 44 (98%) were male (Table I). The median body mass index (BMI) of 45 patients was 25.76 kg/m2. There were 4 patients with hypertension, 2 of whom were on antihypertensive drugs before admission. Three patients had chronic hepatitis B virus infection and were not treated with anti-HBV drugs during the intervention. China has accumulated a lot of experience in prevention, diagnosis, and treatment of COVID-19. Traditional Chinese medicine (TCM) has played crucial roles in treating COVID-19 in China. During the fight against COVID-19 in China, TCM has been officially added to the diagnosis and treatment guideline issued by the National Health Commission, China [6].

Corresponding author: Chunling Zhang Department of Respiratory Affiliated Qingdao Central Hospital Qingdao University No. 127 Siliu South Road Qingdao, Shandong 266042, China Phone: chunqdz20@163.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

Fanghua Zhang1, Rongli Sun2, Chengming Qu3, Xueyu Ma4, Chunling Zhang2

At least 21 (46.6%) case-patients experienced > 1 symptom, most of which were consistent with a viral upper respiratory tract infection, such as fever, sore throat, rhinorrhea and cold-like symptoms, and cough (Table I). All patients were isolated and observed in Qingdao Public Health Emergency Standby Hospital after SARS-CoV-2 PCR-positive testing, and no severe illness or death. All 45 patients were treated with integrated TCM. According to the diagnosis and treatment protocol of COVID-19 in China, a Lianhua Qingwen capsule was applied to patients with fever, and a Huoxiang Zhengqi capsule was given to patients without fever. All were cured and discharged.

Of patients cases, 45 (100%) completed the primary vaccine series, 42 (93%) received booster vaccines, 2 (4.5%) received 2 doses of vaccines, while only 1 (2.5%) received 1 dose of vaccine. None has ever suffered from SARS-CoV-2. We performed blood routine examination and chest CT for all patients. No abnormal chest imaging of any patient was found. We classified the patients according to whether they had symptoms, and divided them into asymptomatic (21 cases) and mild type patients (24 cases). There were 2 people with a low lymphocyte count (the values were 1.02 × 109/l, 1.06 × 109/l, normal value range 1.1–3.2 × 109/l), both of whom were mild type patients.

We analyzed the positive rate of CRP (C-reactive protein) and PCT (procalcitonin) in 45 patients (Figure 1 A). Compared with asymptomatic patients, mild type patients’ CRP positive rate is higher (38.1% vs. 16.7%). The PCT positive rate in mild type patients is also higher than asymptomatic patients (80.9% vs. 66.6%). From the second day of hospitalization, we carried out SARS-CoV-2 PCR testing on nasopharyngeal swabs of patients every day until discharge and analyzed the Ct value of patients during hospitalization (Figures 1 B, C). Nucleic acid of a nasopharyngeal swab with ORF1ab and N genes Ct values over 35 for 2 consecutive days (twice with an interval of at least 24 h) and length of hospital stay at least 7 days is the discharge standard of patients, according to the latest guidelines from the Chinese health authorities.

Compared with the initial positive value, the Ct values of ORF1ab genes in both types of patients increased significantly on the second day of hospitalization (Figure 1 B asymptomatic and mild type patients ORF1ab, 29.98 vs. 36.12, 31.54 vs. 35.21, p < 0.05). The same is true of the Ct value of the N gene (Figure 1 C asymptomatic and mild type patients N, 30.61 vs. 35.15, 31.75 vs. 34.90, p < 0.05). Although the Ct values (ORF1ab and N genes) decreased slightly on the 4th day of hospitalization, it continued to rise again on the 5th day. The mean hospital stay of asymptomatic patients

was slightly longer than that of mild patients (Figures 1 D 9.16 vs. 8.62). Cold chain related person have been in a cold and humid environment for a long time, with a high moisture level and insufficient vital qi. Moisture in the body and external moisture exist at the same time, which promotes virus infection. The tongue image of all people suggests that the tongue is light and the tongue coating is greasy, which is the characteristic of a wet epidemic. According to the perspective of traditional Chinese medicine, asymptomatic people spend more time in hospital, which may be due to asymptomatic people having insufficient vital qi, their pathogenic factors are not predominant, and the struggle between vital qi and pathogenic factors is not intense.

We next compared the differences in IgM and IgG antibody values and positive rates. The IgM value of mild type patients was slightly higher

Table I. Characteristics of SARS-CoV-2 Omicron BA.2 cases among cold chain-affiliated cohort, Qingdao, China, June, 2022 Characteristics Value

Total number: 45

Asymptomatic number 24 (53.3) Symptomatic number 21 (46.7)

Median age [years]: Asymptomatic patients 41.20 ±2.22 Mild type patients 37.85 ±2.18 Sex, n (%): Male 44 (98) Female 1 (2)

Symptom status: No symptoms 24 (53.3) Any COVID-19 symptom 21 (46.7) Fever 16 (35.5) Sore throat 4 (8.8) Expectoration 5 (11.1) Cough 8 (17.7) Runny nose, cold-like symptoms 5 (11.1) Muscle aches 1 (2.2) Fatigue 1 (2.2) Diarrhea 2 (4.4)

COVID-19 vaccination status: 1 dose 1 (2.2) 2 doses 2 (4.4) 3 doses (boosted) 42 (93.4)

Median days from illness onset to cure:

Asymptomatic patients 9.16 ±2.58 Mild type patients 8.62 ±1.02 Low lymphocyte count 2 (4.4)

Cold chain-affiliated associated SARS-CoV-2 omicron BA.2 infections, Qingdao, Shandong, China, 2022

Positive rate (%)

80.9

Ct value Ct value

0.20 0.16 0.12 0.08 0.04 0

16.7

D F E B

41 39 37 35 33 31 29 41 39 37 35 33 31 29

Asymptomatic Mild Type

CRP positive PCT positive

90 80 70 60 50 40 30 20 10 9.2 9.0 8.8 8.6 8.4 8.2 7.6 7.5 7.4 7.3 7.2 7.1 7.0

66.6 9.16 7.53 0.08

Asymptomatic Mild Type

0 2 3 4 5 6 7 8 9 Time [days] Asymptomatic Mild 0 2 3 4 5 6 7 8 9 Time [days] Asymptomatic Mild

0.16

38.1 8.62 7.3

Asymptomatic Mild Type

Asymptomatic Mild Type

Figure 1. Characteristics of SARS-CoV-2 Omicron subvariant BA.2 in the cold chain-affiliated cohort. A – CRP and PCT positive rate in patients. B – Temporal evolution of Ct values (ORF 1ab gene). *p < 0.01, compared to the initial value; ∆p < 0.05, compared to the initial value. C – Temporal evolution of Ct values (N gene).*p < 0.01, compared to the initial value; ∆p < 0.05, compared to the initial value. D – Mean length of hospital stay. E – IgM antibody responses in patients. F – IgG antibody responses in patients

than that of asymptomatic patients (Figure 1 E 0.16 vs. 0.08, p > 0.05). The same is true of IgG in mild type patients (Figure 1 F 7.53 vs. 7.30, p > 0.05). Only one patient was IgM positive, a mild type patient. Serological detection of SARSCoV-2-specific IgG and IgM antibodies is becoming increasingly important in the management of the COVID-19 pandemic [7].

The Omicron variant of SARS-CoV-2 has rapidly replaced the Delta variant as dominating. This variant is a heavily mutated virus and designated as a variant of concern by the World Health Organization (WHO). The Omicron BA.2 variant is

about 1.5 times as infectious as BA.1. It is on its path to becoming the next dominating variant. In conclusion, 46.6% of 45 case-patients in our cohort suffered from symptomatic BA.2 infection, but all were mild and asymptomatic infections, suggesting BA.2 infection in a young population might be mild. In addition, 100% of case-patients completed a primary vaccination series which, in addition to their age, might have contributed to their mild illness. Therefore, vaccination should be encouraged. In addition, medical education on the severity of COVID-19 is also an important factor to avoid a COVID-19 pandemic [8].

Fanghua

Cold chain-affiliated associated SARS-CoV-2 omicron BA.2 infections, Qingdao, Shandong, China, 2022

Acknowledgments

Fanghua Zhang, Rongli Sun and Chengming Qu contributed equally contributed equally to this study.

Conflict of interest

The authors declare no conflict of interest.

References

1. Gao SJ, Guo H, Luo G. Omicron variant (B.1.1.529) of SARS-CoV-2, a global urgent public health alert! J Med Virol 2022; 94: 1255-6.

2. Chen JH, Wei GW. Omicron BA.2 (B.1.1.529.2): high potential to becoming the next dominating variant. ArXiv 2022; 25: 3840-9.

3. Chen JH, Wang R, Gilby NB, Wei GW. Omicron (B.1.1.529): infectivity, vaccine breakthrough, and antibody resistance. J Chem Inf Model 2021; 62: 412-22.

4. Li X, Wu L, Qu Y, et al. Clinical characteristics and vaccine effectiveness against SARS-CoV-2 omicron subvariant BA.2 in the children. Signal Transduct Target Ther 2022; 7: 203.

5. Cheng VC, Ip JD, Chu AW, et al. Rapid spread of SARSCoV-2 Omicron subvariant BA.2 in a single-source community outbreak. Clin Infect Dis 2022; 75: 44-9.

6. Diagnosis and Treatment Protocol for Novel Coronavirus Pneumonia (Trial Version 7). J Chin Med J 2020; 133: 1087-95.

7. Asic A, Prguda-Mujic J, Salihefendic L, et al. Serological testing for SARS-CoV-2 in Bosnia and Herzegovina: first report. Arch Med Sci 2021; 17: 823-6.

8. Kulesza W, Dolinski D, Muniak P, Derakhshan A, Rizulla A, Banach M. We are infected with the new, mutated virus UO-COVID-19. Arch Med Sci 2020; 17: 1706-15.

Aihong Pan1, Yu Zhao2, Weihua Yu3, Lili Chen4, Xufeng Wu5, Jing Liu6, Yating Zhao7, Yuqing Wang7, Jin Wang8, Linmei Zhang9

1Nursing Department, The First People’s Hospital of Hefei, Hefei, China

2Gerontology Department, Binhu District of The First People’s Hospital of Hefei, Hefei, China

3Dean’s Office, The First People’s Hospital of Hefei, Hefei, China

4Infection Department, Binhu District of The First People’s Hospital of Hefei, Hefei, China

5Department of Critical Care Medicine, Binhu District of The First People’s Hospital of Hefei, Hefei, China

6Emergency Department, Binhu District of The First People’s Hospital of Hefei, Hefei, China

7Graduate School, Wannan Medical College, Wuhu, China

8Department of Cardiology, The First People’s Hospital of Hefei, Hefei, China

9Infection Department, The First People’s Hospital of Hefei, Hefei, China

Submitted: 15 October 2022; Accepted: 26 December 2022 Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 292–297

DOI: https://doi.org/10.5114/aoms/158550

Copyright © 2023 Termedia & Banach

Coronavirus disease 2019 (COVID-19) is an infectious disease with fever, dry cough, and malaise as the main clinical manifestations [1, 2]. The public health safety of China is facing a great challenge [3]. To address the problems caused by COVID-19, according to the disease characteristics of the new coronavirus pneumonia, setting up the local hospital as a designated hospital for centralized isolation and treatment has become an important and effective initiative [4, 5]. However, at this stage, it is not possible to set up a hospital for the national COVID control program (NCCP), and there is no specific standard for the care service system of the designated hospital for NCCP, which cannot meet the current status of epidemic regularity.

Therefore, this study aims to construct a standardized nursing service system in the designated hospitals for NCCP, to provide nursing standards and a theoretical basis for the designated hospitals.

After reviewing the literature and consulting with experts from January to March 2021, the research team was established in April 2021, consisting of 12 members, including one expert in the field of standardization research, 2 chief nursing officers, one deputy chief nursing officer, 7 competent nursing officers, and one nurse practitioner. The main tasks of the team members were literature search, questionnaire production and distribution, statistical analysis, screening, determination, statistical analysis of questionnaire results, and construction of the final standard index system.

This study used “Corona Virus Disease 2019”, “standard system”, and “designed hospital” as English search terms in PubMed, Web of Science, The Cochrane Library, and other English databases. Meanwhile, we used “New Corona Pneumonia” and “Designated hospital” as Chinese search

Corresponding authors: Aihong Pan Nursing Department

The First People’s Hospital of Hefei 390 Huaihe Road Luyang District Hefei City Anhui Provence Chian, 230001, China E-mail: panaihonghong@ 163.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

The construction and practice of a standardized nursing service system based on the designated hospital for the treatment of COVID-19 in China

terms in Chinese databases such as Wanfang Medicine, CNKI, Wipu Database, and the China Biomedical Literature Database. Seventy-five relevant articles were retrieved (26 articles and 6 articles in English).

The correspondence form includes 3 parts, (1) Letters to the experts. Introducing the purpose and significance of this study, and the method of completing the questionnaire; (2) Survey of experts’ related conditions. Including the basic information of the experts, the basis of their judgment, and familiarity with each index; (3) Formation of the correspondence, from asking the experts to evaluating the importance of each first-, second-, and third-level indicator according to the Likert 5 scale, and giving guidance (1).

Based on the literature review, members of the research group discussed and identified 5 dimensions: “standardized work system”, “standardized workflow”, “standardized nursing service language”, “standardized environmental signage”, and “nursing service quality and safety assurance system”. The 5 dimensions of “standardized work system”, “standardized work process”, “standardized nursing service language”, “standardized environmental signage”, and “nursing service quality and safety assurance system” were identified as the primary indicators, with 20 secondary indicators, and 170 tertiary indicators.

Inclusion criteria: (1) clinical nursing, nursing education, or nursing management in a tertiary hospital for ≥10 years; (2) bachelor’s degree or above; (3) intermediate title or above; (4) understanding and agreeing to this correspondence. Exclusion criteria: experts who were “unfamiliar” or did not fill out the questionnaire actively, seriously, or with high quality were selected in one round of consultation.

The questionnaire was sent to the experts by e-mail in April 2021. Nineteen experts were consulted in the first round, and after the consultation, the research team added modified or deleted indicators based on the experts’ opinions after review and discussion. The revised questionnaire was sent to the experts again, with an interval of 20 days between the 2 inquiries to avoid errors. At the end of the second round, the members again revised the questionnaire according to the opinions given by the experts and stopped the correspondence when the experts’ opinions were gradually unified.

This study used Excel 2019, SPSS 25.0 software to analyse the data. The mean, standard deviation, variable coefficient (CV), perfect score rate, questionnaire return rate, expert authority coefficient, and Kendall’s harmony coefficient were calculated. Yaahp 12.8 software was used to calculate the weights of each indicator, and hierar-

chical analysis was used to determine the weight coefficients of the entries.

The basic information of the experts is shown in Table I.

Nineteen questionnaires were sent out in both rounds, and 19 valid questionnaires were returned with 100% positivity. The familiarity degree of experts in this study is 0.853, which means that the experts’ familiarity degree is good, and it is generally considered that Cr ≥ 0.7 is acceptable [6]. The degree of authority (Cr) = (familiarity + judgment basis)/2, and the degree of authority in this study was 0.914. The degree of expert opinion coordination is usually expressed by Kendall’s W. In this study, after 2 rounds of expert consultation, the Kendall’s W of the first, second, and third level indicators were 0.046, 0.008, and 0.000, respectively, with statistically significant differences (p < 0.05), indicating that the experts’ opinions were relatively consistent and the degree of coordination was good (Table II).

After a round of correspondence, according to expert opinion, 3 additional tertiary indicators were added: “COVID-19 isolation ward management system”, “resuscitation room environmental signage”, and “fever clinic patients’ nasal swab, pharyngeal swab collection operation procedures”. Two tertiary indicators were revised: changing “Infection protection system in the ob-

Table I. Basic information of the experts consulted by letter (n = 19)

Parameter Number of experts Percentage (%)

Age [years]: 30–39 4 21.05 40–49 6 31.58 50–59 9 47.37

Working time [years]: 10–20 4 21.05 21–30 10 47.37 Greater than 30 5 26.32

Academic qualifications: Specialty 2 10.53 Undergraduate 11 57.89 Master and above 6 31.58

Title: Intermediate title 3 15.79 Associate senior title 12 63.16 Positive senior title 4 21.05

Fields of work: Care Management 14 73.68 Clinical Care 3 15.79 Nursing Education 2 10.53

The construction and practice of a standardized nursing service system based on the designated hospital for the treatment of COVID-19 in China

Table II. Significance test of the degree of coordination of expert opinions

Projects Kendall Harmonic coefficient c 2 P -value

Tier 1 indicators 0.127 9.667 0.046

Secondary indicators 0.008 37.160 0.008 Tertiary indicators 0.098 323.480 0.000

servation ward, end-of-life treatment system in the observation ward” to “Infection protection system in the observation ward” and changing “Operating procedures for collection of pharyngeal/anal swabs from patients with neoconiosis” to “Procedure for collection of nasal and pharyngeal/ anal swabs from patients with COVID-19”. After the second round of correspondence, and again based on expert opinions, the panel members deliberately discussed the addition of 4 tertiary indicators: “environmental signage for resuscitation rooms”, “environmental signage for testing”, “oral medication distribution for patients with neoconiosis operation procedure”, and “operation procedure of prone ventilation for patients with severe neoconiosis”; modification of one level-2 indicator: “standardized system for the treatment or admission of patients with neoconiosis” to “The standardized system for treatment and isolation wards for neoconiosis”, and the deletion of a level-3 indicator: “end-of-life treatment system in the hospital ward”. The finalized standardized nursing service system of the hospital for the treatment of NCCP included 5 primary indicators, 20 secondary indicators, and 176 tertiary indicators. The importance scores of the above secondary and tertiary indicators are above 4.5, and the coefficients of variation are less than 0.25. The composition of standard indicators at all levels is scientific and the results are reliable, which have certain scientificity and value.

At a time when the form of the National Covid Control (NCC) epidemic is still severe, the National Health Commission has put forward higher work standards and more practical work initiatives to reduce the occurrence of nosocomial infections in designated hospitals for NCC admissions, and to optimize various work processes and technical operation procedures in designated hospitals, and put forward higher work standards and more practical work initiatives for nursing services in medical institutions. Based on the guidance of national policies and guidelines related to the prevention and control of neo-crown, research on the management norms and programs of designated hospitals for the treatment of neo-crown has also begun. Previous studies have been conducted on staff management systems in isolation wards of NCC sentinel admission hospitals [7], infection protection for healthcare workers in NCC sentinel admission hospitals [8], and medi-

cal management in NCC sentinel admission hospitals [9]. During the same period, local norms for sentinel treatment of NCC pneumonia, fever clinic, pre-screening triage, and management of isolation wards have also been introduced, but norms and service standards for nursing services in NCC sentinel admission hospitals are still lacking. A comprehensive and unified nursing service standard is essential to standardize nursing staff work behaviours, improve nursing workflow, enhance nursing work quality, and reduce hospital infection [10]. Therefore, this study initially determined the standardized nursing service system in the COVID-19 sentinel admission hospital by Delphi method, analysed the index weights at all levels by hierarchical analysis, and constructed the system completely after the consistency test was passed, aiming to improve the quality of nursing service in the New Crown sentinel admission hospital in the future and provide reference for the sentinel admission hospital to carry out nursing service practice.

In this study, after reviewing relevant literature at home and abroad, drawing on the experience of nursing management in designated admission wards of New Crown in various regions, combined with China’s policy guidance, the primary indicators: standardized work system, standardized work flow, standardized nursing service language, standardized environmental signs and nursing service quality, and safety assurance standards, were formulated according to the requirements of New Crown management program, and the standards of primary indicators were standardized and refined on the basis of the primary indicators. The process makes the content of the first-level indicators more enriched, while the third-level indicators refer to specific nursing service behaviours. The system of indicators at each level reflects the nursing service standards that must be followed in the work of the sentinel admission hospital, meets the requirements of the sentinel admission hospital for nursing services, and adapts to the principles of nursing services in the designated hospitals, and the research content is more perfect. In addition, the results of expert consultation in this study have good reliability. The 19 experts selected for this study have 10 years or more of clinical nursing work experience, and most of them are engaged in nursing management field-related work and are familiar with the connotation of this field of

Aihong Pan, Yu Zhao, Weihua Yu, Lili Chen, Xufeng Wu, Jing Liu, Yating Zhao, Yuqing Wang, Jin Wang, Linmei Zhang

work, so the experts selected for this study have typical representativeness. Two rounds of expert consultation questionnaires have a recovery rate of 100.00%, among which 6 experts have proposed, and the remaining experts expressed positive opinions on the consultation items, which indicates that the consulting experts have a high degree of participation and recognition in this study. The expert Cr after the 2 rounds of consultation was 0.914, which indicates that the authority of the experts is good. Kendall’s W was statistically significant for all levels of indicators in the results of the 2 rounds of expert consultation in this study, indicating relatively consistent and well-coordinated expert opinions. In this study, the Delphi method was applied, and the second round of correspondence was strictly completed according to the index construction requirements of the Delphi method, and the modified opinions guided by experts were expressed numerically by using hierarchical analysis, further quantifying the weight coefficients of indicators at all levels and conducting a consistency test on them, the results of which indicated that the index weights in the system constructed in this study were objective and scientific [11].

The index system constructed in this study is highly specialized, reflecting the similarities and differences between the nursing services of New Crown sentinel admission hospitals and general hospitals, and providing important technical support to further promote the quality improvement of nursing services in sentinel admission hospitals. The essential difference between the nursing services provided by New Crown sentinel admission hospitals and general hospitals is that the former starts from the epidemic situation, strictly implements the epidemic control system, zoning and grouping management, and avoids the occurrence of cross-infection. The workflow and system of nursing services in general hospitals can no longer meet the requirements of self-protection and epidemic prevention and control. This study starts from the current situation of the nursing service of the New Crown designated hospitals, and in response to the problem that there is no unified standard system for the nursing service of the New Crown designated hospitals in China, the nursing service standard index system constructed in this study emerges to meet the demand of the nursing service of the New Crown designated hospitals in a timely manner. For different hospitals and patient diseases, this study has taken into account in the design of indicators to adapt to the requirements of nursing service management in each hospital’s New Crown sentinel admission ward, and plays an important role in standardizing the nursing service in the New Crown sentinel admission ward; at the same time, the specific

contents are clearly defined conceptually, which maximally ensures the consistency of the consulting experts’ understanding of the indicators, and the indicators are specific and operable, which is easy for nursing staff to understand. The multidimensional indicators of nursing service in the New Crown designated admission hospitals were analysed through the consultation results, and among the 5 primary indicators, the weight of nursing service quality and safety assurance was larger at 0.3016, indicating that nursing service quality and safety assurance occupies an important position in the prevention and control of epidemics in the New Crown designated admission hospitals, which is consistent with the requirements of quality nursing and reflects the “people-oriented” service concept. This is in line with the requirements of quality care and reflects the concept of “people-oriented” services. Studies have shown that the construction of a unified system, workflow and safety and quality management is conducive to multiteam assistance, and homogeneous management, thus improving efficiency and quality and ensuring patient safety [12]. In addition, in terms of human resource management, scientific deployment of nursing human resources in the New Crown-admitted hospitals will directly affect the effect of standardization of nursing service practice, which is similar to the findings of Jing et al. [13]. The most weighted secondary indicator of nursing work system is the standardized system of rescue and isolation wards in the New Crown ward, with a weight of 0.4690, which indicates the lack of standardized system of rescue and isolation wards in designated hospitals at present, and precisely the high demand of medical and nursing for the standard of rescue and isolation ward system in the New Crown. At present, in the condition that the epidemic situation of New Crown is not optimistic, the fixed-point treatment isolation for febrile patients is the top priority, so setting up a reasonable standardized system of treatment isolation wards is a critical factor of the standardized system of nursing services in the fixed-point treatment hospital of New Crown, and it is also the basic guarantee of providing quality nursing service. Active and effective nursing management in isolation wards provides a reliable guarantee for the successful treatment of patients with new coronavirus pneumonia, which can effectively reduce the risk of infection among health care workers and ensure the smooth prevention and treatment of new coronavirus pneumonia, which is similar to the findings of Cao et al. [14]. Among the secondary indicators of standardized workflow, the weight coefficient of standardized process in the New Coronavirus Pneumonia Treatment Ward ranked first with a weight of 0.3412,

The construction and practice of a standardized nursing service system based on the designated hospital for the treatment of COVID-19 in China

indicating that the indicators of standardized process in the COVID-19 Treatment Ward are an integral part of the standardized care service system in the New Coronavirus Pneumonia Treatment Ward. The above indicators link the hospital, nurses, and patients together in an orderly manner and form a complete management process framework, which can not only monitor nurses’ nursing behaviours, but also detect problems early, intervene early, and serve patients better.

There have been more domestic studies on the psychological and ward management of nurses in neo-coronavirus designated hospitals, but there have been few studies on the standardization of clinical nursing service quality. The current recurrent epidemic in China and the numerous outbreaks of neo-coronavirus hospital infections have revealed problems behind these events that have forced medical institutions to be alerted to the fact that the closed-loop management of staff involved in the treatment of neo-coronavirus is not rigorous and the lack of a unified standardized nursing service plan for neo-coronavirus designated hospitals has posed a problem for the outpatient and emergency nursing services in neo-coronavirus designated hospitals [15]. The occurrence of nosocomial infections and nosocomial epidemics undoubtedly reflects many problems in the epidemic management systems and processes of hospitals. In addition, the nursing services in many regional Neonatal Intensive Care Units (NICUs) are not standardized, perhaps because the nursing groups are not systematically trained, the hospitals lack relevant related regulations and workflow, the standards of nursing services are not uniform, and the quality of nursing services varies, which is not conducive to the enhancement and improvement of the quality of nursing services in NICUs over time. This study uses the Delphi method to construct a standardized nursing service system for the New Crown sentinel wards, which can serve as a reference for the national policy and program, as well as a standard for the evaluation and assessment of nursing services in the New Crown designated hospitals, and better promote the development of the nursing industry.

In conclusion, the standardized nursing service system constructed in this study for the COVID-19 sentinel admission hospitals makes up for the lack of nursing service standards and is worthy of further clinical promotion. This study has now completed the first stage of index construction and will be followed by practical research with a view to conducting empirical research on the constructed index system, verifying the scientificity and practicality of this evaluation system in practical application, and gradually improving it.

Acknowledgments

2020 China, Hefei City Health and Health Commission COVID-19 Epidemic Prevention and Control Scientific Research Project Key Project, No. Hwk2020zd001, 2021 China, Anhui Provincial Health and Health Commission Scientific Research Project, No. AHWJ2021b010. Co-first author: Aihong Pan & Yu Zhao.

Conflict of interest

The authors declare no conflict of interest.

References

1. Treatment protocol for novel coronavirus pneumonia (trial version 6) (1). Chin J Infect Control 2020.

2. Zhu N, Zhang D, Wang W, et al.; China Novel Coronavirus Investigating. A novel Coronavirus from patients with pneumonia in China, 2019. N Engl J Med 2020; 382: 727-33.

3. Harrison G. COVID-19; addressing our reality and maintaining our resilience. Br J Surg 2020; 107: e446.

4. Shaukat N, Ali DM, Barolia R, et al. Documenting response to COVID-individual and systems successes and challenges: a longitudinal qualitative study. BMC Health Serv Res 2022; 22: 656.

5. Khuntia BK, Agarwal A, Sharma G. Letter to Editor on “A randomized, controlled, blinded, parallel-group, clinical trial to study the role of Ayurcov (AyurCoro3), a oneday regimen as an adjuvant therapy for COVID-19 disease management, at dedicated Covid Hospital (DCH) in India”. Complement Ther Med 2022; 68: 102838.

6. Lyndon H, Latour JM, Marsden J, Kent B. Designing a nurse-led assessment and care planning intervention to support frail older people in primary care: an e-Delphi study. J Adv Nurs 2022; 78: 1031-43.

7. Eftekhar Ardebili M, Naserbakht M, Bernstein C, Alazmani-Noodeh F, Hakimi H, Ranjbar H. Healthcare providers experience of working during the COVID-19 pandemic: a qualitative study. Am J Infect Control 2021; 49: 547-54.

8. Endacott R, Blot S. Fundamental drivers of nurses’ experiences of ICU surging during the coronavirus disease 2019 (COVID-19) pandemic. Curr Opin Crit Care 2022; 28: 645-51.

9. Perraud F, Ecarnot F, Loiseau M, et al. A qualitative study of reinforcement workers’ perceptions and experiences of working in intensive care during the COVID-19 pandemic: a PsyCOVID-ICU substudy. PLoS One 2022; 17: e0264287.

10. Saadatian-Elahi M, Alexander N, Möhlmann T, et al. Addressing the COVID-19 pandemic challenges for operational adaptations of a cluster randomized controlled trial on dengue vector control in Malaysia. BMC Public Health 2022; 22: 667.

11. Spoelstra SL, Schueller M, Basso V, Sikorskii A. Results of a multi-site pragmatic hybrid type 3 cluster randomized trial comparing level of facilitation while implementing an intervention in community-dwelling disabled and older adults in a Medicaid waiver. Implement Sci 2022; 17: 57.

12. Yıldırım D, Çiriş Yıldız C. The effect of mindfulness-based breathing and music therapy practice on nurses’ stress, work-related strain, and psychological well-being during

Aihong Pan, Yu Zhao, Weihua Yu, Lili Chen, Xufeng Wu, Jing Liu, Yating Zhao, Yuqing Wang, Jin Wang, Linmei Zhang

the COVID-19 pandemic: a randomized controlled trial. Holist Nurs Pract 2022; 36: 156-65.

13. Portuondo-Jimenez J, Bilbao-González A, TíscarGonzález V, et al.; COVID-19-Osakidetza Working group. Modelling the risk of hospital admission of lab confirmed SARS-CoV-2-infected patients in primary care: a population-based study. Intern Emerg Med 2022; 17: 1211-21.

14. Li Y, Wang Y, Wang G, et al. Effectiveness of a case management model in newly treated smear-positive pulmonary tuberculosis patients. J Infect Dev Ctries 2021; 15: 1670-6.

15. Hofstetter L, Tinhof V, Mayfurth H, et al. Experiences and challenges faced by patients with COVID-19 who were hospitalised and participated in a randomised controlled trial: a qualitative study. BMJ Open 2022; 12: e062176.

The construction and practice of a standardized nursing service system based on the designated hospital for the treatment of COVID-19 in China Arch Med Sci 1, 1st January / 2023

Otolaryngology

Cough syncope due to laryngeal herpes zoster successfully managed by pregabalin

Yingfang Song1,2,3, Jingfang Hong2,3,4, Zhenming Bao1,2,3, Jia Ye1,2,3, Xi Zheng1,5, Shumei Zou1,2,3

1Department of Pulmonary and Critical Care Medicine, 900th Hospital of Joint Logistics Support Forth, Fuzhou, China

2Dongfang Hospital, School of Medicine, Xiamen University, China

3Fuzong Clinical College of Fujian Medical University, Fuzhou, China

4Departments of Neurosurgery, 900th Hospital of Joint Logistics Support Forth, Fuzhou, China

5Department of Pulmonary and Critical Care Medicine, People’s Hospital of Tiantai County, Tiantai, China

Submitted: 29 September 2022; Accepted: 26 December 2022 Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 298–301 DOI: https://doi.org/10.5114/aoms/158551

Copyright © 2022 Termedia & Banach

Although laryngeal zoster-related cough syncope is rare, it should also be considered in the differential diagnosis in working up a syncopal episode. Pregabalin is an analogue of the neurotransmitter g-aminobutyric acid (GABA). It can reduce the depolarization and calcium influx of nerve terminals by binding and inhibiting the a2-σ subunit protein of voltage-dependent calcium channels, thereby inhibiting the release of excitatory neurotransmitters such as L-glutamate. The release of these excitatory neurotransmitters is associated with convulsions, pain, and anxiety. We found that pregabalin might be suggested as part of the treatment for its good tolerance, pharmacokinetics, and safety. This paper presents a rare case of a 51-year-old male who presented with cough syncope secondary to laryngeal herpes zoster. Short-term inhaled budesonide suspension stopped the syncope but not the coughs; however, the disturbing post-herpetic cough remained. Although many antitussives had been tried, the therapeutic effect was limited. Pregabalin was finally administered, with highly satisfactory results for cough relief without adverse effects. It provided new evidence that pregabalin use might be justified for the treatment of post-herpetic neurogenic cough.

A 51-year-old male was referred to our pulmonology department with non-productive cough for 14 days. During this time he had experienced 3 episodic losses of consciousness following bouts of cough, leading to emergency hospital visits. These events had precipitated his referral to our specialist cough clinic. His visual analogue scale (VAS) score was 9/10, where 0 is no cough and 10 is the worst possible cough. He had no concomitant symptoms of breathless, haemoptysis, wheeze, or fever. He also complained of hoarseness and progressive throat pain. He had never smoked. Medical review also noted no symptoms of dyspepsia or postnasal drip, and he had neither significant past medical history nor occupational exposure to chemical irritants.

His pulmonary investigations including chest computed tomography (CT) scan, pulmonary function tests, and endoscopic bronchoscopy showed no relevant changes. Overnight oximetry did not suggest obstructive sleep apnoea.

A detailed ear, nose, and throat examination with flexible trans-nasal laryngoscopy was done, which revealed numerous ulcers with purulent

Corresponding author: Xi Zheng Department of Pulmonary and Critical Care Medicine People’s Hospital of Tiantai County Tiantai, China E-mail: zhengxi8090@163. com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

exudate on the left half of his supraglottic area, and the left lateral and posterior pharyngeal wall (Figure 1). The vocal fold was markedly oedematous, but vocal fold mobility was intact bilaterally. An empirical diagnosis of laryngeal zoster was made based on these examination findings.

However, laryngeal herpes zoster-related cough syncope is rare, so the patient was admitted for further syncopal (diagnostic) workup to exclude other underlying aetiologies for cough syncope.

The patient underwent an extensive cardiological investigation, including an ECG (electrocardiogram), ECHO (echocardiogram), 24-h Holter monitoring, and carotid artery ultrasound, which were all within normal limits. Further neurological investigations were undertaken with magnetic resonance imaging (MRI) of the brain and electroencephalogram (EEG), which were also unremarkable. Accordingly, all these investigations excluded cardiac and neurological causes. The most likely cause of cough syncope was laryngeal herpes zoster. Daily inhale budesonide suspension 8 mg twice was prescribed by the ear, nose, and throat team. Adjunctive high-dose administration of steroids remains controversial, but it decreases the risk of post-herpetic neuralgia, so the potential benefit should be weighed against their known deleterious effects, particularly in patients with diabetic or psychiatric comorbidities.

However, antivirals were not suggested because they were not funded for the treatment of herpes zoster beyond 72 h of symptom onset. A week later, his hoarseness and left-sided throat pain had largely resolved. Flexible laryngoscopy showed complete resolution of the ulcers, with some areas of patchy erythema but complete re-mucolisation. Vocal fold oedema was also greatly reduced. He had no recurrence of cough-related syncopal episodes. Unfortunately, it only showed only slight reduction in the severity and frequency of cough, with his VAS score decreasing from 9/10 to 5/10, i.e. he was still experiencing chronic cough (Figure 2).

Subsequently, our patient was given several trials of anticough medications including codeine, dextromethorphan, montelukast, and oral antihistamines (chlorpheniramine), but the effects of these therapies were rather disappointing in alleviating his cough. Finally, the patient was treated with pregabalin at 75 mg twice per day. Surprisingly, after starting it, he reported that the cough was cured. After discharge, the perfect effect was still obtained during drug reduction for one month. Even after drug withdrawal, the patient did not feel cough after 1-year follow-up. It is worth mentioning that he experienced no adverse effects throughout the whole treatment period (Figure 3).

We present a rare case of a 51-year-old male who presented with cough syncope secondary

to laryngeal herpes zoster. Short-term inhaled budesonide suspension stopped the syncopal episodes entirely, but the disturbing post-herpetic cough remained. Although many other antitussive drugs had been given, their therapeutic effect

Cough syncope due to laryngeal herpes zoster successfully managed by pregabalin

Figure 1. Initial laryngoscopy pictures (2021-10-19)

Figure 2. One week after laryngeal herpes zoster treatment, review the laryngoscopy pictures (2021-10-25)

Figure 3. Before leaving the hospital, review the laryngoscope pictures again (2021-11-1)

was limited. Pregabalin was finally administered, which gave highly satisfactory results for cough relief without adverse effects.

In Herpes zoster, the most typical clinical presentation is vesicular eruption in the skin of the affected dermatome. Neurogenic sequelae, particularly pain, is another frequent clinical presentation [1]. However, as a special kind of herps zoster, laryngeal zosters are characterized by special mucosal manifestations, suggesting a vagal origin of the eruption. Hoarseness, odynophagia, and dysphagia were the predominant clinical symptoms in laryngeal zoster [2, 3]. Respiratory complaints are rarely reported in laryngeal zoster, and cough syncope is even rarer [4].

This study was approved by the Ethics Committee of the 900th Hospital of Joint Logistics Support Forth.

We describe a case of laryngeal zoster with characteristic presentation, which developed a cough, and cough-related syncope, as a post-herpetic sequela. To our knowledge, our report is the first to record laryngeal zoster presenting with symptoms of cough syncope.

Cough-associated syncope may constitute a clinical challenge given the multitude of potential pathophysiological mechanisms and different aetiologies [5]. Now that it is relatively uncommon for patients with laryngeal zoster to present with respiratory complaints, especially cough syncope, it is essential to further screen for many potential aetiologies underlying cough and cough syncope. Hence, in this case, a careful history and systematic evaluation were proposed. Since other differential pathologies and possible provoking factors had been eliminated in the central nervous system, respiratory or cardiovascular systems, cough, and cough syncope were attributed to laryngeal zoster, i.e. they were both regarded as sequelae of laryngeal zoster.

The exact cough-related cough syncope pathophysiology remains uncertain and debated. Various pathophysiological mechanisms have been proposed, such as compression of the midbrain ascending reticular system or vascular complication [6]. Among them, the haemodynamic mechanism seems to be the most convincing [7].

As for post-herpetic cough, there are several proposed pathophysiology mechanisms to explain this phenomenon. In this case, the special distribution of the mucocutaneous lesions from the supraglottic area to the level of the vocal folds conformed to the anatomical distribution of the internal branch of the superior laryngeal nerve (SLN) [8, 9]. It represented the reactivation of varicella zoster virus (VZV) dormant in this area innervated by the vagus nerve, which could result in damage and/or inflammation along the SLN [10].

As we know, the internal branch of the SLN is not only the sensory innervation of the larynx, but also the main primary afferent of the cough reflex. Therefore, the herpetic injury to the SLN could directly give rise to peripheral cough reflex hypersensitivity. Furthermore, some mediators, such as bradykinin, released from the local inflammation of SLN, could stimulate unmyelinated C-fibres, known as a type of peripheral cough receptor and part of the afferent arc of the cough reflex. In other words, these irritants can further enhance the cough excitability.

Another proposed mechanism is related to inappropriate re-synapsing. VZV SLN infection of the internal branch may induce laryngeal hypersensitivity. Meanwhile, its second-order neuron could be rewired in the cough reflex arc to accommodate the axon of an inappropriate primary afferent as a result of deprivation of its original primary afferent due to the damage to the SLN. Accordingly, activities that involve laryngeal function such as talking, laughing, and positional changes could become new inappropriate primary afferents and form a connection with the cough reflex, causing the cough to be evoked erroneously [11].

To sum up, in laryngeal zoster, herpetic infection may damage the vagus nerve, cause hypersensitivity and/or inappropriate re-synapsing of the peripheral cough reflex, and lead to neurogenic cough, and even cough-related syncope.

Similarly to Ling et al. [4], we suggest that the post-herpetic neurogenic cough is a neuropathic disorder, analogous to the post-herpetic neuralgia (PHN) of dermatomal shingles.

In terms of treatment management of cough, syncope should be tailored to individual provoking factors and then to treating the cough [12]. As far as this case is concerned, laryngeal zoster-related cough syncope was the main clinical diagnosis of exclusion when complete workup for other causes of syncope was negative. Short-term inhaled budesonide suspension, as an aetiological treatment, effectively relieved symptoms in the larynx and stopped syncopal episodes entirely, but the coughing persisted, disturbing chronic cough. Although many antitussives had been tried, the therapeutic effect was limited.

Based on this mechanism, as mentioned above, neurogenic medication for postherpetic neuralgia (PHN) could be a new treatment option [13–15]. Some previous studies have shown that gabapentin is effective as a neuromodulator for chronic cough [16–18]. However, due to drug tolerance and serious side effects, its administration was restricted [19]. As part of the new generation of anti-neuropathic pain drugs, pregabalin is regarded as a substitute for gabapentin given its lower dose, better tolerance, and fewer side effects [19, 20].

Yingfang Song, Jingfang Hong, Zhenming Bao, Jia Ye, Xi Zheng, Shumei Zou

However, there is no evidence to support the use of pregabalin in acute neuropathic pain scenarios. In the management of chronic neuropathic pain conditions, pregabalin was effective at high doses of 300 mg, 450 mg, and 600 mg daily. In chronic refractory cough, Pregabalin at 150 mg daily could lead to beneficial effects for cough relief. It provided new evidence that pregabalin had a good clinical application in the treatment of chronic cough.

However, given the limited number of clinical studies and fewer data, the optimal dose, the duration of treatment, and the safety of long-term use are still not well understood. Also, whether its administration affects varicella healing on the long with eventual hastened reinfection rate is still unknown. Its therapeutic potential is worthy of in-depth investigation.

In conclusion, this report provided a rare case of laryngeal zoster with characteristic mucosal signs, which developed cough, and even cough-related syncope, as a post-herpetic sequela. Although laryngeal zoster-related cough syncope is rare, it should also be considered in the differential diagnosis in working up a syncopal episode. Given the above proposed mechanisms, there are some similar neuronal pathways in PHN and laryngeal zoster-related cough.

Acknowledgments

This study was supported by Science and Technology Project of Fujian Province (Grant No. 2020J11134).

Co-first authors: Yingfang Song and Jingfang Hong.

Conflict of interest

The authors declare no conflict of interest.

References

1. Koshy E, Mengting L, Kumar H, Jianbo W. Epidemiology, treatment and prevention of herpes zoster: a comprehensive review. Indian J Dermatol Venereol Leprol 2018; 84: 251-62.

2. Roy CF, Turkdogan S, Silver JA, Young J. Herpes zoster of the larynx: a narrow diagnostic and therapeutic window. Ear Nose Throat J 2022; 1455613221077594. doi:10.1177/01455613221077594.

3. Nisa L, Landis BN, Giger R, Leuchter I. Pharyngolaryngeal involvement by varicella-zoster virus. J Voice 2013; 27: 636-41.

4. Ling B, Novakovic D, Sulica L. Cough after laryngeal herpes zoster: a new aspect of post-herpetic sensory disturbance. J Laryngol Otol 2014; 128: 209-11.

5. King J, Hennessey S, Wingfield Digby J, Smith JA, Marsden P. Syncope: a complication of chronic cough. Breathe 2021; 17: 210094.

6. Oliveira IC, Carvalho J, Oliveira L. Cough syncope, a rare presenting symptom of chiari I malformation and at-

lanto-occipital assimilation. Eur J Case Rep Intern Med 2020; 7: 001466..

7. Waldmann V, Combes N, Narayanan K, et al. Cough syncope. Am J Med 2017; 130: e295-6.

8. Zhang J, Wei X. Ramsay Hunt syndrome affecting the vagus nerve with epiglottic ulcers as the first manifestation: a case report. J Int Med Res 2020; 48: 300060520952276.

9. Alciato L, Bonfils P, Rubin F. Unilateral oral, pharyngeal and laryngeal vesicles. Eur Ann Otorhinolaryngol Head Neck Dis 2019; 136: 141-2.

10. Dhillon VK. Longitudinal follow-up of superior laryngeal nerve block for chronic neurogenic cough. OTO Open 2021; 5: 2473974X21994468.

11. Dhillon VK. Superior laryngeal nerve block for neurogenic cough: a case series. Laryngoscope Investig Otolaryngol 2019; 4: 410-3.

12. Dicpinigaitis PV, Lim L, Farmakidis C. Cough syncope. Respir Med 2014; 108: 244-51.

13. Dąbrowska M, Grabczak EM, Arcimowicz M, et al. Chronic cough – assessment of treatment efficacy based on two questionnaires. Arch Med Sci 2014; 10: 962-9.

14. Morice AH, Millqvist E, Bieksiene K, et al. ERS guidelines on the diagnosis and treatment of chronic cough in adults and children. Eur Respir J 2020; 55: 1901136.

15. Giliberto JP, Cohen SM, Misono S. Are neuromodulating medications effective for the treatment of chronic neurogenic cough? Laryngoscope 2017; 127: 1007-8.

16. Giliberto JP, Dibildox D, Merati A. Unilateral laryngoscopic findings associated with response to gabapentin in patients with chronic cough. JAMA Otolaryngol Head Neck Surg 2017; 143: 1081-5.

17. Atreya S, Kumar G, Datta SS. Gabapentin for chronic refractory cancer cough. Indian J Palliat Care 2016; 22: 94-6.

18. Chung KF. Approach to chronic cough: the neuropathic basis for cough hypersensitivity syndrome. J Thorac Dis 2014; 6 (Suppl 7): S699-707.

19. Jiao L, Zhang G, Yuan Y, et al. A systematic review and meta-analysis of correlation between cough variant asthma and mycoplasma pneumonia in children. Arch Med Sci 2020; doi.org/10.5114/aoms/130286.

20. Li J, Ye L. Effect of pregabalin for the treatment of chronic refractory cough: a case report. Medicine 2019; 98: e15916.

Cough syncope due to laryngeal herpes zoster successfully managed by pregabalin

Hematology

Hemophagocytic lymphohistiocytosis in a 26-year-old male

Aleksandra Pilśniak1, Agnieszka Jarosińska1, Agata Janoska-Gawrońska1, Grzegorz Helbig2, Michał Holecki1

1Department of Internal, Autoimmune and Metabolic Diseases, School of Medicine, Medical University of Silesia, Katowice, Poland

2Department of Haematology and Bone Marrow Transplantation, Medical University of Silesia, Katowice, Poland

Submitted: 14 November 2022; Accepted: 24 December 2022

Online publication: 13 January 2023

Arch Med Sci 2023; 19 (1): 302–304

DOI: https://doi.org/10.5114/aoms/158536

Copyright © 2023 Termedia & Banach

A 26-year-old male with achondroplasia presented with an 8-month history of recurrent fever, peripheral oedema, and ascites. Physical examination showed brown discoloration around the umbilicus, papular and keratotic lesions on the skin of the back, tachycardia, jaundice, ascites, and peripheral oedema. Laboratory findings included leukopaenia (3670/μl), increased activity of liver enzymes (alanine aminotransferase: 274 U/l, aspartate aminotransferase: 488 U/l, alkaline phosphatase 812 U/l, g-glutamyl transferase 389 U/l), hyperbilirubinaemia (3.41 mg/dl), hypoproteinaemia (4.84 g/dl), hypoalbuminaemia (1.84 g/dl), prolonged activated partial thromboplastin time (aPTT 60 s), decreased fibrinogen concentration (133 mg/dl), increased concentration of dimer-D (13078 ng/ml) and substantially elevated ferritin (19973 ng/ml). Autoimmune work-up was negative. Serological investigations showed no active Epstein-Barr virus (EBV), but IgG antibodies were found. Blood cultures grew Staphylococcus epidermidis and Staphylococcus hominis, and urine cultures grew (ESBL+) Escherichia coli. Abdominal ultrasonography revealed ascites (Figures 1 A, B), hepatic steatosis, and a thick-walled gallbladder with biliary sludge (Figure 1 C). High-resolution computed tomography (HRCT) revealed pericardial effusion (pericardium thickness of 12 mm) (Figure 1 D). Initial treatment including culture-directed antibiotics and intravenous loop-diuretic resulted in clinical improvement with significant reduction of peripheral oedema and ascites. Clinical signs and prior laboratory findings with further progression of pancytopenia, considered together, suggested hemophagocytic lymphohistiocytosis (HLH). Primary HLH was excluded after a bone marrow biopsy assessed by 2 independent haematologists was negative for hemophagocytes. Secondary HLH with prior sepsis as the initiatory factor was treated with a course of steroids, with good clinical response. However, the condition of the patient deteriorated within 30 days of discharge with intermittent hyperpyrexia, massive ascites, tachycardia, and hypotension. Laboratory workup showed persistent cytopaenia, and elevated ferritin and C-reactive protein. Blood cultures and tests for infective endocarditis were negative. Due to the signs of urinary tract infection, corticosteroid treatment was discontinued and broad-spectrum antibiotics as well as granulocyte colony-stimulating factor were administrated. Despite the applied treatment the patient remained feverish. Because of the advanced caries

Corresponding author: Aleksandra Pilśniak MD Department of Internal, Autoimmune and Metabolic Diseases School of Medicine Medical University of Silesia Katowice, Poland Phone: +48 536299664

E-mail: aleksandra.pilsniak@ gmail.com

Creative Commons licenses: This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY -NC -SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/).

being a potential cause of recurrent infections, the patient was transferred to the Maxillo-Facial Surgery Department and underwent surgical removal of the teeth. Immediately afterward, the patient was transferred to the Department of Haematology for further diagnostics. Trepanobiopsy revealed the presence of hemophagocytes (approx. 4%). The patient met 5 out of 8 diagnostic criteria for HLH [1], with an H score 80–88%.

After completion of the HLH 2004 treatment protocol our patient showed marked clinical improvement, with no further hyperpyrexia, recovery

Figure 1. A – Abdominal ultrasound showing the features of ascites – the thickness of the fluid layer is up to 55 mm in the right flank (the green dotted line shows the place where the thickness was measured). B – Abdominal ultrasound showing the features of ascites – the thickness of the fluid layer in the pelvis is 84 mm (the green dotted line shows where the thickness was measured). C – Abdominal ultrasound revealing a thickened wall of the gallbladder (the green arrow indicates the gallbladder wall). D – High-resolution computed tomography (HRCT) showing pericardial effusion (the green arrow indicates the pericardial effusion). E – Bone marrow trepanobiopsy shows hemophagocyte

of cell counts, and a decline in inflammatory markers and ferritin.

HLH is a syndrome of uncontrolled hyperinflammation, which, if untreated, leads to death [2]; however, as a rare condition, it is largely underdiagnosed [3]. Therefore, a timely diagnosis and introduction of adequate treatment is of utmost importance.

Conflict of interest

The authors declare no conflict of interest.

Hemophagocytic lymphohistiocytosis in a 26-year-old male

References

1. Henter JI, Horne A, Aricó M, et al. HLH-2004: Diagnostic and therapeutic guidelines for hemophagocytic lymphohistiocytosis. Pediatr Blood Cancer 2007; 48: 124-31.

2. Janka GE. Familial and acquired hemophagocytic lymphohistiocytosis. Annu Rev Med 2012; 63: 233-46.

3. Machowicz R, Basak G. How can an internal medicine specialist save a patient with hemophagocytic lymphohistiocytosis (HLH)? Pol Arch Intern Med 2020; 130: 431-7.

Aleksandra Pilśniak, Agnieszka Jarosińska, Agata Janoska-Gawrońska, Grzegorz Helbig, Michał Holecki

Aims and scope

Archives of Medical Science (AMS) publishes high quality original articles and reviews of recognized scientists that deal with all scientific medicine. Original papers from young scientists are especially welcomed.

AMS opens the possibilities for young, capable scientists. AMS would like to give them a chance to have a publication following matter-of-fact, professional review by outstanding, famous medical scientists. Thanks to that they will have an opportunity to present their study results and/or receive useful advice about the mistakes they have made so far.

The second equally important aim is a presentation of review manuscripts of recognized scientists about the educational capacity, in order that young scientists, often at the beginning of their scientific carrier, could constantly deepen their medical knowledge and be up-to-date with current guidelines and trends in world-wide medicine. The fact that our educational articles are written by world-famous scientists determines their innovation and the highest quality.

Full length articles should not exceed 8 printed pages (4400 words including tables and references – about 20 typewritten double-spaced 8˝” 11’’ sheets). Each article should contain structured abstract (200-250 words), divided such as the text of the manuscript. Subject matter should be organized under suitable headings and subheadings such as: Structured Abstract, Introduction, Materials and Methods, Results, Discussion, Conclusions, Acknowledgments and References. Footnotes should be avoided and their contents incorporated into the text. Manuscripts should be in their final form when submitted.

Reserach Letters and Letters to the Editor should be no more than 1000 words – 3-4 manuscript pages, excluding structured abstract (100 words – only for the Research Letters) references, name(s) and address(es) of the signers. The authors are strongly recommended to prepare the letters with no more than 10-15 references, no more than 2 tables or 1 figure, and no more than 5 authors, all of whom should sign the copyright release form. Keywords and name and mailing address of all authors should be included.

Review articles should follow the format for a regular article, but should be submitted only after consultation with the Editors. Each article should contain unstructured abstract (100-150 words) and up to 5 key words.

Ethical consideration

Papers describing animal experiments can be accepted for publication only if the experiment conforms to the legal requirements in Poland as well as with the European Communities Council Directive of November 24, 1986 or the National Institute of Health Guide (National Institute of Health Publications No. 80-23, Revised 1978) for the care and use of Laboratory Animals for experimental procedure. Authors must provide a full description of their anesthetics and surgical procedures. Papers describing experiments on human subjects must include a statement that experiments were performed with the understanding and consent of each subject, with the approval of the appropriate local ethics committee.

Submission of manuscripts

All manuscripts written in English should be submitted to Editorial Office by electronic Editorial System of Archives of Medical Science at the following URL: http://panel.termedia.pl/?ams (the link to Editorial System is also given on the main web page of the journal).

Tables and figures should be submitted separately; linked files such as images or charts should also be provided. Authors are requested not to submit the manuscripts by post or e-mail.

In of Legal aspects

In sending the manuscript the author(s) confirm(s) that (s)he has (they have) not previously submitted it to another journal (except for abstracts of no more than 250 words) or published it elsewhere. The author(s) also agree(s), if and when the manuscript is accepted for publication, to automatic and free transfer of copyright to the Publisher allowing for the publication and distribution of the material submitted in all available forms and fields of exploitation (Copyright © Termedia & Banach). The author(s) accept(s) that the manuscript will not be published elsewhere in any language without the written consent of the copyright holder, i.e. the Publisher.

All manuscripts submitted should be accompanied by a covering letter including signed confirmation of the above and confirming that this publication has been approved by all co-authors (if any), as well as by the responsible authorities at the institution where the work has been carried out. Generally no more than six authors should be listed (except multicenter studies). All authors must sign the covering letter (available online) and send to Editors with the manuscript. Materials previously published should be accompanied by written consent for reprinting from the relevant Publishers. In the case of photographs of identifiable persons, their written consent should also be provided. Any potential conflict of interest will be dealt with by the local court specific to the Publisher. Legal relations between the Publisher and the author(s) are in accordance with Polish law and with international conventions binding on Poland.

Instructions for authors

Anonymous review

All manuscripts will be subject to a process of anonymous editorial review (the name of authors and their affiliations will be disclosed to the referees only when the review process is complete). In order to achieve this, the first page and the acknowledgements page will be removed from the manuscripts sent to referees. Manuscripts will be sent to independent reviewers, and the information about acceptance should be limited to 4 weeks.

Archives of Medical Science may also consider high quality papers under the Fast Track Review scheme. This scheme relies on a dedicated group of top class reviewers to deliver a final decision on reviewed manuscripts within fourteen days and the possibility of online publishing in next 2 weeks after acceptance. The authors need to indicate that they want to have their paper proceed as a fast-track review during the submission process and additionally inform the Editor about this (m.banach@termedia.pl).

The scheme requires an additional fee to the standard one from authors (all together 1600 Euro).

Preparation of manuscripts

Articles must be written in English, with either British or American spelling used consistently throughout. Authors not entirely familiar with English usage are advised to seek the assistance of an English speaker; correct style is the responsibility of the authors.

• The length of original article should not exceed 20 printed pages including text, illustrations, tables, and references. Short research notes should not exceed 4 printed pages.

• Manuscripts should be typed, double-spaced, and fully corrected. Allow a margin at least 3 cm at the top, bottom and left side of the page. Text should not be justified, but flush left.

• The first page of each paper should indicate: the author’s name, title of the paper, the institute where the work was conducted, complete name and address for correspondence with telephone and fax numbers, and e-mail address if available; running head not exceed 40 characters including space.

• The second page contains the abstract which should be written in an informative style. Avoid generalizations and give essential details of research findings. For indexing purposes, a list of 3–5 key words (according to Index Medicus) in English and not included in the title should be typed below the abstract.

• The textual material of the article should be organized in a standard form with separate: Introduction, Material and Methods, Results, Discussion, Conclusion and References. Review articles should be divided into sections and subsections as appropriate without numbering.

• Do not underline in the text. Avoid footnotes. When essential, they are numbered consecutively and typed at the foot of the appropriate page.

• All dimensions and measurements must be specified in the metric system.

• The source of any drug and special reagent should be identified. Indicate doses and use the international names

• Particular attention needs to be paid to the selection of appropriate analysis of data and the results of statistical test should be incorporated in the results section. The Statistics Editor will check the statistical analysis of each submitted manuscript. The Editors reserve the right to check raw data.

• The nomenclature used should conform to the current edition of the Nomina Anatomica, Nomina Anatomica Veterinaria or to the Nomina Anatomica. Avium, Eponyms (e.g., Fallopian tube, Eustachian tube) should not be used.

• Legends of figures should be typed on separate sheet.

• Tables (numbered in Roman numerals) and illustrations (numbered in Arabic numerals) should be prepared on separate sheets.

• Abbreviations should be explained in full when first used in the text, table or figure.

• The editor reserves the right to make corrections.

Tables

• Tables require a brief but descriptive heading.

• The major divisions of the table should be indicated by horizontal rules.

• Explanatory matter should be included in footnotes, indicated in the body of the table in order of their appearance.

• Tables must not duplicate material in the text or in illustration.

Illustrations

• The desired position of the figures and tables in the text should be indicated in the left margin. When possible, group several illustrations on one block for reproduction; figures and photographs should be attached as separate printouts (in the electronic version, as separate files); figures should be saved in one of the following formats: .cdr, .tif, .jpg, .ai, .bmp or .eps. Photographs sent in the electronic form should be of the resolution of 300 dpi and in .tif or .jpg format. Do not place figures and photographs in MS Office files. Like all other figures, block should be prepared within a rectangular frame to fit within a single or double column width of 84 and 174 mm, respectively, and a maximum page height of 226 mm.

• Each figure should include scale magnification bar; do not use magnification factors in the figure legends.

• All figures, whether photographs, graphs or diagrams, should be numbered consecutively throughout. Do not give explanations on a back of illustrations.

Instructions for authors

• Only good drawings and original photographs can be accepted; negatives, photocopies or xerocopies cannot be used.

• On the back of each illustration indicate its number and top.

• Color illustrations can be included, but the expense must be borne by the authors. The cost of color print for every successive 8 pages is 200 Euro (VAT exclusive) irrespective of the number of color pages, i.e., the price remains the same whether there is one or eight pages. The Publisher makes out the bill to the Author.

References

The list of references (written on a separate sheet) should include only those publications that are cited in the text. Number references consecutively in the order in which they first appear in the text. Numbers in square brackets should give citation of literature references in the text at the appropriate places. All authors cited and only these must be included in the reference list. List all authors when there are six or fewer; when there are seven or more, list the first three, then “et al.”. References should be written as follows:

Journal papers: initials and names of all authors, full title of paper, journal abbreviation (according to Index Medicus), year of publication, volume (in Arabic numerals), first and last page (example below):

Banach M, Kosmider A, Zwolinski R, Walczak A, Okonski P, Zaslonka J. Mechanical aortic valve replacement in patients with stenosis or aortic valve regurgitation. The influence on improvement of haemodynamic parameters of heart. Eur J Heart Failure 2004; 3: 98-102.

If a cited work has been published in a language other than English, its title should be stated in English, and the original language should be included in square brackets (example below): Stefaniak B, Jaszewski R, Kosmider A, Zwolinski R, Knopik J, Walczak A, et al. Early and subsequent results of operation of trivalvular diseases [Polish]. Wiad Lek 2003; 56: 348-52.

Book and monographs: initials and names of all authors, full title, edition, publisher, place, year (examples below): Ringsven MK, Bond D. Gerontology and leadership skills for nurses. 2nd ed. Albany (NY): Delmar Publishers; 1996.

Chapter in a book: Phillips SJ, Whisnant JP. Hypertension and stroke. In: Laragh JH, Brenner BM, editors. Hypertension: pathophysiology, diagnosis, and management. 2nd ed. New York: Raven Press; 1995. p. 465-78.

Conference proceedings: Kimura J, Shibasaki H, editors. Recent advances in clinical neurophysiology. Proceedings of the 10th International Congress of EMG and Clinical Neurophysiology; 1995 Oct 15-19; Kyoto, Japan. Amsterdam: Elsevier; 1996.

Reference to articles that are accepted for publication may be cited as “in press”, whereas manuscripts that are still in preparation or submitted for publication should be referred to as “unpublished data”. This journal should be cited in lists as Arch Med Sci.

Proofs

Authors should keep a copy of their article, as proofs will be sent to them without the manuscript. Corrections to the proofs should be restricted to printer’s errors only; other alterations will be charged to the authors. In order to maintain rapid publication, proofs should be returned within 48 h after receipt, preferably by fax, courier mail or e-mail. If the Publisher receives no response from the authors after 5 days, it will be assumed that there are no errors to correct and the article will be published.

The Instruction for Authors and covering letter are also available online on page www.ams.termedia.pl

Publication charge

Please note that there is an obligatory charge (= 800 Euro) for each manuscript which is accepted for publication in Archives of Medical Science journal. We send invoices for payment after articles are accepted for publication.

Subscription information

The journal is published in one volume per year consisting of six numbers. The annual subscription price for 2020 is 250 Polish zloty for subscribers from Poland and 300 Polish zloty for foreign subscribers.

Payment should be made to:

Termedia sp. z o.o., ul. Kleeberga 8, 61-615 Poznań

BZ WBK III O/Poznań PL 61 1090 1359 0000 0000 3505 2645

SWIFT: WBKPPLPP

The publisher must be notified of a cancellation of a subscription not later than two months before the end of the calendar year. After that date the subscription is automatically prolonged for another year.

Publishing, Subscription and Advertising Office:

TERMEDIA Publishing House ul. Kleeberga 2 61-615 Poznań, Poland phone/fax +48 61 822 77 81 e-mail: termedia@termedia.pl http://www.ams.termedia.pl