Skip to main content

Compendium of Rice Diseases and Pests, Second Edition

Page 1

Part I. Biotic Diseases Diseases Caused by Bacteria In this section, bacterial diseases of rice are classified into three main groups: seedling, sheath, and grain diseases; foliar diseases; and a culm and root disease. Diseases of the seedling, sheath, and grain are caused by Pseudomonas or

Burkholderia species or Acidovorax avenae subspecies; foliar diseases are caused by two Xanthomonas oryzae pathovars; and Dickeya chrysanthemi is responsible for a culm and root disease of rice.

Seedling, Sheath, and Grain Diseases Seedling, leaf sheath, and grain diseases of rice are caused almost exclusively by Burkholderia plantarii, Pseudomonas fuscovaginae, Pseudomonas syringae, Burkholderia glumae, and Acidovorax avenae subsp. avenae. The Pseudomonas species are primarily seedborne and cause a necrosis or rot of the plant part affected. With the possible exception of B. plantarii,

the other pathogens may attack seedlings and the grain and/or sheaths of mature plants. The diseases caused by the pseudo­ monads B. glumae and A. avenae subsp. avenae and their geographic distribution are summarized in Table 2. Phenotypic characters useful in distinguishing the different species are presented in Tables 3 and 4.

7


Selected References Azegami, K., Nishiyama, K., Watanabe, Y., Kadota, I., Ohuchi, A., and Fukazawa, C. 1987. Pseudomonas plantarii sp. nov., the causal agent of rice seedling blight. Int. J. Syst. Bacteriol. 37:144-152. Ziegler, R. S., and Alvarez, E. 1990. Characteristics of Pseudomonas spp. causing grain discoloration and sheath rot of rice, and associated pseudomonad epiphytes. Plant Dis. 74:917-922.

(Prepared by T. W. Mew; revised by C. Vera Cruz and V. Verdier)

Seedling Diseases In this section, seedling blight (Fig. 5) of rice, caused by Burk­holderia plantarii (syn. Pseudomonas plantarii), and bacterial brown stripe, caused by Acidovorax avenae subsp. avenae or Pseudomonas syringae pv. panici, are covered in depth. The pathogens Burkholderia glumae and Pseudomonas fuscovaginae and the symptoms they cause on seedlings are treated under Sheath and Grain Diseases below. The incidence and severity of rice seedling diseases caused by pseudomonads are problems in areas that use machines for transplanting seedlings. Seedlings for machine transplanting are raised in nursery boxes under conditions of high temperature and humidity that are conducive to the establishment of bacterial pathogens and their diseases.

Management of Bacterial Diseases in the Nursery Chemical treatment of rice seed has been useful in reducing seed infestation and disease caused by B. glumae. Kasugamycin used as a seed soak or applied to nursery soil before planting has been the most effective chemical treatment. Cultural practices that are recommended for management of bacterial diseases in the nursery include eliminating infected seed by discarding seeds that float in salt water with a specific gravity of 1.18, avoiding overwatering, ensuring a level soil surface and soil with good drainage so that water does not pool, and maintaining the air temperature between 15 and 30°C.

Fig. 5. Seedling blight symptoms, caused by Burkholderia plantarii, in a rice field. (Cour­ tesy K. Azegami— ­© APS)

8

P. fuscovaginae can be eradicated from seed by a dry heat treatment at 65°C for 6 days. Selected References Goto, K., Zeigler, R. S., and John, V. T. 1988. Progress on rice seedborne and seed contaminant bacteria, viruses, and nematodes. Pages 131-150 in: Rice Seed Health. International Rice Research Institute, Manila, Philippines. Uyematsu, T., Yoshimura, D., Nishiyama, K., Ibaraki, T., and Fuji, H. 1976. Occurrence of bacterial seedling rot in nursery flat caused by grain rot bacterium Pseudomonas glumae. Ann. Phytopathol. Soc. Jpn. 42:310-312. (In Japanese; English abstract.) Ziegler, R. S., and Alvarez, E. 1990. Characteristics of Pseudomonas spp. causing grain discoloration and sheath rot of rice, and associated pseudomonad epiphytes. Plant Dis. 74:917-922.

(Prepared by T. W. Mew; revised by C. Vera Cruz and V. Verdier)

Seedling Blight Rice seedling blight has been found in Chiba and Niigata prefectures, Japan, and is associated with the production of seedlings in nursery boxes.

Symptoms Early symptoms are characterized by basal chlorosis and withering of the second or third leaf (Fig. 6). Infected seedlings later become reddish brown and desiccated but do not exhibit a soft rot (Fig. 7). With severe infection, root growth is retarded and seedlings easily lodge.

Causal Organism Seedling blight is caused by Burkholderia plantarii. The bacterium is a gram-negative, non-spore-forming, nonencapsulated rod, 0.7–1.0 × 1.4–1.9 µm, with one to three polar flagella. On potato-peptone-glucose agar plates, colonies are round with

Fig. 6. Basal chlorosis and withering of the second and third leaves of rice caused by Burkholderia plantarii, the causal organism of seedling blight. (Cour­tesy K. Azegami— ­© APS)


description of Burkholderia vandii sp. nov. Int. J. Syst. Bacteriol. 44:235-245. Zeigler, R. S., and Alvarez, E. 1990. Characteristics of Pseudomonas spp. causing grain discoloration and sheath rot of rice, and associated pseudomonad epiphytes. Plant Dis. 74:917-922.

(Prepared by T. W. Mew; revised by C. Vera Cruz and V. Verdier)

Bacterial Brown Stripe

Fig. 7. Later stages of seedling blight, caused by Burkholderia plantarii, showing reddish brown discoloration and desiccation of rice seedlings in a nursery box. (Cour­tesy K. Azegami—­© APS)

tan centers and translucent margins, and the bacterium produces a weak, reddish brown pigment. Growth on nutrient agar is poor. The optimum and maximum temperatures for growth of the bacterium are 32–35°C and 38°C, respectively. The bacterium produces no fluorescent pigment on King’s medium B, is oxidase positive and arginine dihydrolase negative, and accumulates poly-β-hydroxybutyrate. B. plantarii produces a compound called tropolone, which is responsible for the retardation of root growth and leaf chlorosis observed in infected rice seedlings. Other phenotypic characters of the bacterium are listed in Table 3.

Disease Cycle and Epidemiology B. plantarii is a seed- and soilborne plant pathogen. In Japan, the incidence and severity of the disease increased with the advent of transplanting by machines. Seedlings for transplanting are raised in nursery boxes under conditions of high temperature and humidity that are conducive to infection. It has been demonstrated that graminaceous weeds growing on levees of paddy fields are a source of inoculum of the pathogen and that rice seeds are infected through the paddy water. It was confirmed that B. plantarii was rain splashed to a height of at least 30 cm in open fields. With stronger wind and rain, minute raindrops containing the bacterium were likely to scatter to higher parts of the plants.

Bacterial brown stripe, also known as bacterial stripe, occurs in upland and wetland nurseries and also in nursery boxes. Bacterial brown stripe symptoms are caused by both Acidovorax avenae subsp. avenae (syn. Pseudomonas avenae) and Pseudo­ monas syringae pv. panici. A. avenae subsp. avenae is reported to be widely distributed geographically, although seedling infection caused by the bacterium has only been reported from a limited number of countries. Seed testing has detected A. av­ enae subsp. avenae on seed lots from all major rice-growing countries of the world, and seeds carrying the pathogen produce seedlings with typical symptoms of the disease. Bacterial brown stripe caused by P. syringae pv. panici has only been reported from China and Japan. The disease is not known in the United States.

Symptoms Symptoms consist of water-soaked stripes on the leaves and leaf sheaths, which turn brown (Fig. 8). On the leaves, the stripes occur interveinally or along the midrib or leaf margins. The stripes or lesions are up to 1 mm × 10 cm but may coalesce to form wider lesions. Bacterial exudate may form on lesion surfaces during humid conditions. The pathogen can also attack and rot young, unfolded leaves, which may result in the stunting or death of the seedling (Fig. 9). Heavy bacterial ooze occurs at cuts across brown lesions. If only the primary leaves are affected, the seedlings generally outgrow the disease. A. avenae subsp. avenae can also cause grain discoloration.

Management The application of iron compounds suppresses seedling blight because the production of tropolone is inhibited in the presence of iron. Selected References Azegami, K., Nishiyama, K., Watanabe, Y., Suzuki, T., Yoshida, M., Nose, K., and Toda, S. 1985. Tropolone as a root growth-inhibitor produced by a plant pathogenic Pseudomonas sp. causing seedling blight of rice. Ann. Phytopathol. Soc. Jpn. 51:315-317. Azegami, K., Nishiyama, K., Watanabe, Y., Kadota, I., Ohuchi, A., and Fukazawa, C. 1987. Pseudomonas plantarii sp. nov., the causal agent of rice seedling blight. Int. J. Syst. Bacteriol. 37:144-152. Azegami, K., Nishiyama, K., and Kato, H. 1987. Growth of Pseudo­ monas plantarii, and production of tropolone and proteins under limited iron deficiency. Ann. Phytopathol. Soc. Jpn. 53:411-412. Miyagawa, H., and Inoue, H. 2002. Alternative route of infection for bacterial seedling blight of rice caused by Burkholderia plantarii. J. Gen. Plant Pathol. 68:356-362. Urakami, T., Ito-Yoshida, C., Araki, H., Kijima, T., Suzuki, K. I., and Komagata, K. 1994. Transfer of Pseudomonas plantarii and Pseudomonas glumae to Burkholderia as Burkholderia spp. and

Fig. 8. Early symptoms of bacterial brown stripe, caused by Pseudomonas syringae pv. panici, on rice seedlings. (Cour­ tesy T. W. Mew)

9


Fig. 9. Death of rice seedlings from bacterial brown stripe, caused by Pseudomonas syringae pv. panici or Acidovorax avenae subsp. avenae. (Cour­tesy T. W. Mew)

Causal Organisms Acidovorax avenae subsp. avenae is a gram-negative, nonspore-forming, nonencapsulated rod, 0.5–0.7 × 0.92–2.4 µm, with one or two polar flagella. The bacterium produces no fluorescent pigment on King’s medium B and is positive for oxidase, nitrate reduction, and starch hydrolysis. Pseudomonas syringae pv. panici (syn. P. panici) is also a gram-negative, non-spore-forming, nonencapsulated rod. The bacterium produces a fluorescent pigment on King’s medium B and is negative for oxidase, nitrate reduction, and starch hydrolysis.

Disease Cycle and Epidemiology A. avenae subsp. avenae is seedborne and is a seed-transmitted pathogen that can survive up to 8 years in seeds, while P. syringae pv. panici is likely seedborne. High humidity favors disease development. Seeds are the primary source of inoculum. Natural infection of Panicum miliaceum, Hordeum vulgare, and Setaria italica by P. syringae pv. panici has been reported.

Management Kasugamycin is effective against A. avenae subsp. avenae and P. syringae pv. panici and reduces damage to seedlings in nursery boxes. The pathogen can be eliminated from seed by applying dry heat treatment at 65°C for 6 days.

Molecular Detection Two sets of polymerase chain reaction (PCR) primers have been designed for use in a BIO-PCR assay for the detection of A. avenae subsp. avenae in rice seeds. The BIO-PCR assay provides a sensitive, reliable tool for the specific detection of the pathogen in rice seeds. An external primer set, Aaaf3 (5' GTCATCCTCCACCAACCAAG 3') and Aaar2 (5' AGAACAATTCGTCATTACTGAAC 3'), and an internal primer set, Aaaf5 (5' TGCCCTGCGGTAGGGCG 3') and Aaar2, designed from a 619-base pair (bp) fragment of the internal transcribed spacer region of the 16S–23S rDNA of A. av­ enae subsp. avenae CAa4 were specific at the subspecies level. The first PCR step (external primers: Aaaf3 and Aaar2) would amplify a 262-bp fragment, and the nested-PCR product obtained with primers Aaaf5 and Aaar2 would amplify 241 bp. Selected References Bradbury, J. F. 1985. Guide to Plant Pathogenic Bacteria. CAB International, Kew, England. Goto, K., and Ohata, K. L. 1961. Bacterial stripe of rice. Coll. Agric., Natl. Taiwan Univ., Spec. Publ. 10:49-59.

10

Goto, K., Zeigler, R. S., and John, V. T. 1988. Progress on rice seedborne and seed contaminant bacteria, viruses, and nematodes. Pages 131-150 in: Rice Seed Health. International Rice Research Institute, Manila, Philippines. Kadota, I., and Ohuchi, A. 1983. Symptoms of bacteria] brown stripe of rice seedlings in nursery boxes. Ann. Phytopathol. Soc. Jpn. 49:561-564. Mew, T. W., and Misra, J. K. 1994. A Manual of Rice Seed Health Testing. International Rice Research Institute, Manila, Philippines. Shakya, D., Vinther, F., and Mathur, S. 1985. Worldwide distribution of a bacterial stripe pathogen of rice identified as Pseudomonas av­ enae. Phytopathol. Z. 114:256-259. Song, W. Y., Kim, H. M., Hwang, C. Y., and Schaad, N. W. 2004. Detection of Acidovorax avenae ssp. avenae in rice seeds using BIOPCR. J. Phytopathol. 152:667-676. Tominaga, T. 1968. Brown stripe of bromegrass and wheat grasses caused by Pseudomonas setariae (Okabe) Savulescu. Jpn. J. Bacteriol. 23:176-183. Willems, A., Goor, M., Thielemans, S., Gillis, M., Kersters, K., and De Ley, J. 1992. Transfer of several phytopathogenic Pseudomonas species to Acidovorax as Acidovorax avenae ssp. avenae nov., comb. nov., Acidovorax avenae ssp. citrulli, Acidovorax avenae ssp. cat­ tleyae, and Acidovorax konjaci. Int. J. Syst. Bacteriol. 42:107-119. Young, J. M. 1988. Comment on the proposal of Hildebrand & Palleroni (1987) to reject the name Pseudomonas syringae pv. panici (Elliott 1923) Young et al. 1978. Lett. Appl. Microbiol. 88:47-50. Zeigler, R. S., and Alvarez, E. 1990. Characteristics of Pseudomonas spp. causing grain discoloration and sheath rot of rice, and associated pseudomonad epiphytes. Plant Dis. 74:917-922.

(Prepared by T. W. Mew; revised by C. Vera Cruz and V. Verdier)

Sheath and Grain Diseases Pseudomonas fuscovaginae, Pseudomonas syringae pv. sy­ ringae, Burkholderia glumae, Burkholderia gladioli, and Ac­ idovorax avenae subsp. avenae attack the flag leaf sheaths and grain of rice and are distributed worldwide. P. fuscovaginae and P. syringae pv. syringae typically cause a severe sheath rot and/or extensive spikelet sterility and grain discoloration, while B. glumae, B. gladioli, and A. avenae subsp. avenae are primarily associated with spikelet sterility and grain discoloration but may also cause mild sheath rot symptoms. The symptoms produced by these species on rice grain are similar. Other reports of pathogens that cause grain discoloration of rice include P. syringae pv. aptata, Erwinia amylovora, Pecto­ bacterium carotovorum, Xanthomonas cinnamona, and Xan­ thomonas atroviridigerum. Little information on the diseases caused by these pathogens is available, and the identities of the pathogens and their pathogenicities are questionable.

Sheath Brown Rot Sheath brown rot, caused by Pseudomonas fuscovaginae, has been reported in Asia, Central and South America, Central Africa, and Madagascar. The disease is manifested as a sheath rot of mature plants and as a grain rot as well as a seedling rot, and it has caused substantial yield losses in South America.

Symptoms On seedlings, a systemic discoloration of the leaf sheath occurs, which may spread to the midrib or veins of the leaves. On mature plants, symptoms typically occur on the flag leaf sheath (Fig. 10) from the booting to the heading stage and on the panicle. On the sheath, oblong to irregular dark green, water-soaked lesions occur, which become gray-brown or brown and may


be surrounded by an effuse dark brown margin (Fig. 11). The sheath may also exhibit general water-soaking and necrosis without definable lesions. With severe infections, the entire leaf sheath may become necrotic and dry out, and the panicle withers. Glumes of panicles emerging from infected sheaths exhibit water-soaked lesions that turn light brown. Grains of infected panicles are discolored, deformed, or empty, which is the most important damage associated with this bacterium.

Causal Organism The causal bacterium of sheath brown rot was originally described as Pseudomonas marginalis (Pseudomonas fluores­

cens biovar II). Later, the pathogen was described as a new species, Pseudomonas fuscovaginae. Strains of P. fusco­vaginae are reportedly heterogeneous and fall into two groups. Whether or not these groups represent distinct species has not been determined. P. fluorescens is not pathogenic to rice and is clearly different from P. fuscovaginae. P. fuscovaginae is a gram-negative, non-spore-forming rod, 0.5–0.8 × 2.0–3.5 µm, with one to four polar flagella. After 4–5 days at 28°C, colonies on nutrient agar are white to cream colored, smooth, convex, translucent, butyrous, and 3–5 mm in diameter. The bacterium produces a greenish brown fluorescent pigment on King’s medium B and is positive for oxidase and arginine dihydrolase. Colonies on nutrient agar medium are white to cream-white and translucent. Phenotypic characters that distinguish the different fluorescent pseudomonads associated with sheath rot are presented in Table 4.

Disease Cycle and Epidemiology P. fuscovaginae survives on rice seeds at a low level and as an epiphyte on graminaceous weeds in rice-growing areas. In inoculation studies, the bacterium has been found to be pathogenic to wheat, oats, barley, triticale, corn, Lolium perenne, Bromus marginatus, Phleum pratense, and Phalaris arundina­ cea. These hosts may serve as reservoirs of inoculum in the field. The bacterium can be recovered from healthy rice leaf blades and sheaths in the field, and epiphytic populations of the bacterium peak at the booting stage. Disease development on mature plants is favored by daytime temperatures of 17–23°C that delay panicle emergence. The seedling rot phase of the disease is most prevalent at temperatures below 20°C.

Management

Fig. 10. Systemic discoloration of the rice flag leaf sheath from sheath brown rot, caused by Pseudomonas fuscovaginae. (Cour ­tesy K. Miyajima— ­© APS)

Use of clean seed or seed treated with dry heat at 65°C for 6 days has been reported important in managing sheath brown rot. In addition, antibiotics such as streptomycin, alone or in combination with oxytetracycline, can effectively manage sheath brown rot if applied at or a few days after panicle emergence. Selected References Jaunet, T., Laguerre, G., Lemanceau, P., Frutos, R., and Notteghem, J. L. 1995. Diversity of Pseudomonas fuscovaginae and other fluorescent pseudomonads isolated from diseased rice. Phytopathology 85:1534-1541. Miyajima, K., Tanii, A., and Akita, T. 1983. Pseudomonas fuscovagi­ nae sp. nov., nom. rev. Int. J. Syst. Bacteriol. 33:656-657. Tanii, A., Miyajima, K., and Akita, T. 1976. The sheath brown rot disease of rice plant and its causal bacterium, Pseudomonas fusco­ vaginae, A. Tanii, K. Miyajima et T. Akita sp. nov. Ann. Phytopathol. Soc. Jpn. 42:540-548. Zeigler, R. S., and Alvarez, E. 1987. Bacterial sheath brown rot of rice caused by Pseudomonas fuscovaginae in Latin America. Plant Dis. 71:592-597. Zeigler, R. S., and Alvarez, E. 1990. Characteristics of Pseudomonas spp. causing grain discoloration and sheath rot of rice, and associated pseudomonad epiphytes. Plant Dis. 74:917-922. Zeigler, R. S., Aricapa, G., and Hoyos, E. 1987. Distribution of fluorescent Pseudomonas spp. causing grain and sheath discoloration of rice in Latin America. Plant Dis. 71:896-900.

(Prepared by T. W. Mew; revised by C. Vera Cruz and V. Verdier)

Sheath Rot Fig. 11. Close-­ up of sheath brown rot lesions, caused by Pseudomonas fusco­ vaginae. (Cour ­tesy K. Miyajima— ­© APS)

Sheath rot, caused by Pseudomonas syringae pv. syringae (syn. Pseudomonas oryzicola), is similar in symptomatology 11


and epidemiology to sheath brown rot, caused by Pseudomo­ nas fuscovaginae. It was the only reported bacterial sheath rot pathogen of rice in Chile, and it has been reported from Asia, Australia, and Hungary. P. syringae pv. syringae produces a fluorescent pigment on King’s medium B but is easily differentiated from P. fuscovagi­ nae because it is negative for oxidase and arginine dihydrolase. Selected References Dariush, S., Ebadi, A. A., Khoshkdaman, M., and Elahinia, A. 2012. Characterising the genetic diversity of Pseudomonas syringae pv. syringae isolated from rice and wheat in Iran. Plant Prot. Sci. 48(4):162-169. Zeigler, R. S., and Alvarez, E. 1990. Characteristics of Pseudomonas spp. causing grain discoloration and sheath rot of rice, and associated pseudomonad epiphytes. Plant Dis. 74:917-922.

(Prepared by T. W. Mew; revised by C. Vera Cruz and V. Verdier)

lar symptoms and saprophytic organisms mask panicle blight symptoms, especially after lesion maturity. Key diagnostic characteristics include discolored grain with a brown margin between the infected and healthy parts of the grain (Fig. 13) but the rachis stays green up to the seed (Fig. 14), and the presence of a partially filled grain with an embryo that aborts due to a basal rotting sometime after fertilization (Fig. 15). The pathogen may cause a mild rot of the flag leaf sheath or the flag leaf sheath collar that appears as a brown lesion with a diffuse to off-white center and a strong dark brown border (Fig. 16). The disease often develops initially in small patches in the field, with severely affected plants in the center and less affected plants around the edges (Fig. 17); however, under severe conditions in the southern United States, large regions of fields may be uniformly affected (Fig. 18), resulting in heavy yield loss. At times, symptoms may be confused with those of straighthead because of the upright nature of heavily infected panicles (Fig. 19), but kernel discoloration and the lack of kernel distortion distinguishes bacterial panicle blight.

Causal Organisms

Bacterial Panicle Blight and Grain Rot

Bacterial panicle blight is caused by Burkholderia glumae and Burkholderia gladioli, although B. gladioli tends to be less aggressive in southern U.S. rice fields. The bacterium is a gram-negative rod, 0.5–0.7 × 1.5–2.5 µm, with one to three

Bacterial panicle blight and grain rot has been identified as being caused by the bacteria Burkholderia glumae (syn. Pseudomonas glumae) and Burkholderia gladioli (syn. Pseu­ domonas gladioli) in the United States and Central and South America. The disease has been present in Japan, Korea, Taiwan, and other parts of Asia for many years and is referred to as grain rot. The disease is manifested as a grain rot and sterility of mature plants in the field and also as a seedling rot. Yield loss estimates vary from a trace to 50%, with severe reduction in grain quality. Since 2010, the disease has become one of the most important problems in southern U.S. rice production.

Symptoms On seedlings, symptoms consist of a brown, water-soaked soft rot of the leaf sheaths accompanied by wilting or soft rot of the leaves. Initial symptoms of grain infection appear as a light to dark discoloration of the lower glumes after pollination (Fig. 12). Infected grains can be unevenly distributed on the panicle. In severe infections, all of the seeds can be damaged. Diagnosis is difficult because other causes of seed infection produce simi-

Fig. 12. Early symptoms of bacterial panicle blight and grain rot of rice grain infected by Burkholderia glumae during flowering. (Cour­tesy D. E. Groth— ­© APS)

12

Fig. 13. Rice grain discoloration from bacterial panicle blight and grain rot, caused by Burkholderia glumae. (Cour­tesy R. D. Cartwright)

Fig. 14. Green rachis of a rice panicle infected by Burkholderia glumae, the causal organism of bacterial panicle blight and grain rot. (Cour­tesy D. E. Groth—­© APS)


polar flagella. It forms white colonies on nutrient agar and produces no fluorescent pigment on King’s medium B. A selective medium, S-PG, was developed in 1986 for preferential isolation of the bacterium. On this semiselective agar medium, B. glu­ mae produces circular, convex colonies with smooth margins that are reddish brown or opalescent with a purple or red-purple center. A newer semiselective medium, designated CCNT, is being used in more recent studies.

Management Outside the United States, antibacterial seed treatments, including kasugamycin and oxolinic acid, have shown some activity in reducing seedborne pathogen populations and subsequent head disease. Foliar sprays of antibacterial compounds, including oxolinic acid, also have shown promise but registra-

Disease Cycle and Epidemiology The panicle blight bacteria are primarily seedborne but can survive in the soil. Largely from seed and possibly infested soil, the pathogen establishes on the seedling and grows epiphytically at a low level until panicle emergence, when its population increases rapidly on the grain under favorable conditions. Disease development is favored by extended high day (>35°C) and night (±28°C) temperatures and high nitrogen fertilization levels. The bacteria invade the space between the palea and lemma, infecting them and the developing embryo. A suberized layer of tissue develops between the stem and seed and stops nutrient flow.

Fig. 17. Pattern of early bacterial panicle blight in a rice field caused by Burkholderia glumae, the causal organism of bacterial panicle blight and grain rot. (Cour­tesy D. E. Groth—­Reproduced by permission)

Fig. 15. Rotting of rice embryos infected by Burkholderia glumae, the causal organism of bacterial panicle blight and grain rot. (Cour­tesy R. D. Cartwright)

Fig. 18. Severe bacterial panicle blight in a rice field caused by Burkholderia glumae, the causal organism of bacterial panicle blight and grain rot. (Cour­tesy D. E. Groth—­Reproduced by permission)

Fig. 16. Rice flag leaf sheath rot, caused by Burkholderia glumae, the causal organism of bacterial panicle blight and grain rot. (Cour ­tesy D. E. Groth— ­© APS)

Fig. 19. Upright nature of infected rice panicles caused by Burk­ holderia glumae, the causal organism of bacterial panicle blight and grain rot. (Cour­tesy D. E. Groth—­© APS)

13


tion varies from country to country. None are currently registered in the United States. Early planted rice in the United States usually escapes damage during periods of higher temperatures later in the season. Excessive nitrogen fertilization enhances disease severity, and observations in the southern United States suggest that soils with lower potassium levels and fields planted rice after rice may have higher disease levels. A few cultivars have partial to high levels of resistance, but the durability of resistance in the field is not understood. Selected References Chien, C. C., Chang, Y. C., Lao, Y. M., and On, S. H. 1983. Bacterial grain rot of rice—A new disease in Taiwan. J. Agric. Res. China 32:360-366. Kawaradani, M., Okada, K., and Kusakari, S. 2000. New selective medium for isolation of Burkholderia glumae from rice seeds. J. Gen. Plant Pathol. 66:234-237. Nandakumar, R., Bollich, P. A., Shahjahan, A. K. M., Groth, D. E., and Rush, M. C. 2008. Evidence for the soilborne nature of the rice sheath rot and panicle blight pathogen, Burkholderia gladioli. Can. J. Plant Pathol. 30:148-154. Nandakumar, R., Shahjahan, A. K. M., Yuan, X. L., Dickstein, E. R., Groth, D. E., Clark, C. A., Cartwright, R. D., and Rush, M. C. 2009. Burkholderia glumae and B. gladioli cause bacterial panicle blight in rice in the southern United States. Plant Dis. 93:896-905. Tsushima, S., Wakimoto, S., and Mogi, S. 1986. Selective medium for detecting Pseudomonas glumae Kurita and Tabei, the causal bacterium of grain rot of rice. Ann. Phytopathol. Soc. Jpn. 52:253-259. Zeigler, R. S., and Alvarez, E. 1990. Characteristics of Pseudomonas spp. causing grain discoloration and sheath rot of rice, and associated pseudomonad epiphytes. Plant Dis. 74:917-922.

(Prepared by T. W. Mew; revised by D. E. Groth and Y. A. Wamishe)

Bacterial Palea Browning Bacterial palea browning was first reported in various districts in Japan and, subsequently, in other Asian countries. It was also reported as a new disease of rice in Italy. The disease primarily affects grain quality. Disease incidences as high as 38% and reductions in 1,000-seed weight by as much as 15% have been reported in some localities.

Symptoms Symptoms usually first appear at early flowering. Initially, light brown, water-soaked lesions occur on the lemma or palea (Fig. 20). The lesions then turn dark brown. The discoloration occurs most frequently on the palea. Infected panicles have more immature grains and lighter grains at harvest, and infected grain becomes brown after milling.

Causal Organism The bacterium responsible for palea browning has been identified as Pantoea agglomerans (syn. Erwinia herbicola), although it has affinities with Erwinia ananas. The bacterium is a gram-negative, fermentative, nonencapsulated, non-sporeforming straight rod, 0.5–1.0 × 1.0–3.0 µm. Most are motile and peritrichously flagellated and produce a yellow water-soluble pigment. Colonies on nutrient agar are smooth, translucent, and more or less convex with entire margins. It resembles E. ananas in that it produces acid from melibiose, cellobiose, and glycerol but not from dextrin; produces indole; does not reduce nitrate; and is phenylalanine delaminate negative.

14

Fig. 20. Lesions on glumes of rice kernels affected by bacterial palea browning, caused by Pantoea agglomerans. (Cour­ tesy K. Azegami— ­© APS)

Disease Cycle and Epidemiology High epiphytic populations of P. agglomerans are common on rice. The disease occurs when heading coincides with periods of rain and high temperatures of 30–35°C. Disease incidence is increased in fields with high levels of nitrogen fertilization, especially at heading.

Management No recommended management option for the disease is available but excessive nitrogen fertilization should be avoided.

Molecular Detection In Italy, all the strains studied were screened with API 20E (BioMérieux, Roma, Italy) and were proven to be Pantoea spp. DNA of each Italian strain and a known P. ananatis rice strain MAFF301720 was tested by polymerase chain reaction (PCR) using Sn2b–As2c specific primers designed to amplify a genome fragment within the 16S–23S internal transcribed spacer region and by repetitive sequence-based (rep)-PCR. Selected References Azegami, K., Ozaki, K., Matsuda, A., and Ohata, K. 1983. Bacterial palea browning, a new disease of rice caused by Erwinia herbicola. Bull. Natl. Inst. Agric. Sci. Ser. C 37:1-12. (In Japanese; English abstr.) Cortesi, P., and Pizzatti, C. 2007. Palea browning, a new disease of rice in Italy caused by Pantoea ananatis. J. Plant Pathol. 89:S76. Gavini, F., Mergaert, J., Beji, A., Mielcarek, C., Izard, D., Kersters, K., and De Ley, J. 1989. Transfer of Enterobacter agglomerans (Beijerink 1888) Ewing and Fife 1972 to Pantoea gen. nov. as Pan­ toea agglomerans comb. nov. and description of Pantoea dispersa sp. nov. Int. J. Syst. Bacteriol. 39:337-345.

(Prepared by T. W. Mew; revised by C. Vera Cruz and V. Verdier)


Turn static files into dynamic content formats.

Create a flipbook
Compendium of Rice Diseases and Pests, Second Edition by Scientific Societies - Issuu