Page 1
















Premio de Investigación UANL 2012

Ya es una tradición. El número cuatro de cada volumen de la revista CiENCiAUANL está dedicado a la presentación de los trabajos ganadores del Premio de Investigación UANL, creado hace más de 30 años por acuerdo del Honorable Consejo Universitario para estimular y fomentar la investigación científica y tecnológica. Este año se recibieron 131 trabajos distribuidos en las siete áreas del conocimiento a premiar, de la manera siguiente: 28 en Ciencias Sociales, 21 en Humanidades, 13 en Ciencias Naturales, 13 en Ciencias de la Salud, 23 en Ciencias de la Tierra y Agropecuarias, 16 en Ciencias Exactas y 17 en Ingeniería y Tecnología. En el área de Ciencias Sociales, el trabajo ganador fue “Autonomía y bienestar en mujeres divorciadas”, de Blanca Mirthala Tamez Valdez y Manuel Ribeiro Ferreira. En este trabajo se estudia la relación entre el nivel de autonomía percibido por las mujeres que alguna vez han enfrentado el divorcio, tanto durante su matrimonio como después del divorcio, y el nivel de bienestar manifestado por ellas. Asimismo, se revisan los efectos, sociales y materiales, señalados por las mujeres tras el divorcio, centrándose en las divorciadas que viven en el área metropolitana de Monterrey. 6

En el área de Ciencias Exactas, el trabajo ganador fue “Nuevos óxidos multifuncionales Sm2FeTaO7 y Sm2InTaO7 para la descontaminación de agua vía fotocatálisis heterogénea”, de Mayra Zyzlila Figueroa Torres, Leticia Myriam Torres Guerra, Miguel Ángel Ruiz Gómez, Isaías Juárez Ramírez y Christian Gómez Solís. De acuerdo a los resultados obtenidos, los investigadores concluyeron que es posible llevar a cabo la síntesis del nuevo óxido del tipo pirocloro de composición Sm2FeTaO7 de manera pura, al utilizar tanto el método de estado sólido como el de sol-gel. En el área de Ingeniería y Tecnología hubo dos ganadores: “Diseño de suspensiones para producir cintas cerámicas ultradelgadas para capacitores multicapas mediante tape casting”, de Juan Antonio Aguilar Garib, Martín Edgar Reyes Melo, Román Jabir Nava Quintero, Sophie Guillemet-Fritsch y Bernard Durand. Este trabajo está dedicado a la producción de cinta cerámica mediante un proceso conocido como “tape casting”, que en la práctica se limita a 3.5 ˜m de espesor menor, mediante el diseño de una suspensión cuyas propiedades reológicas y condiciones de vaciado permitan la obtención de cintas de espesores menores a ese valor. El otro trabajo ganador fue “Degradación de un herbicida en CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


medio acuoso mediante la generación in situ de especies oxidantes”, de Minerva Villanueva Rodríguez, Ma. Araceli Hernández Ramírez y Juan Manuel Peralta Hernández. En el estudio se llevó a cabo la descomposición de un herbicida de uso muy común: el ácido 2,4-diclorofenoxiacético (2,4-D), mediante diferentes procesos que implican la generación de especies fuertemente oxidantes: los radicales hidroxilo (HO) y el ión ferrato [FeO42-]. En esta edición, en el área de Humanidades, el trabajo ganador fue “Nuevas formas de diagnóstico del procesamiento cognitivo de eventos de violencia y perdón en personas con antecedentes de maltrato infantil”, de María Isolde Hedlefs Aguilar, Ernesto Octavio López Ramírez y Guadalupe Elizabeth Morales Martínez. El propósito de la investigación fue explorar la naturaleza cognitiva de los mecanismos de evaluación de información sobre violencia y perdón en personas que experimentaron maltrato infantil en diferentes etapas del desarrollo. Con “Disección molecular de la función dual de Antenapedia en el control genético del desarrollo en Drosophila melanogaster”, Diana Reséndez Pérez, Diana Linda Cárdenas Chávez, Ricardo Canales del Castillo y Olga Karina Villanueva Segura se hicieron acreedores al premio en el área de Ciencias Naturales. En este trabajo se realizó la disección molecular de Antenapedia (Antp), para determinar su actividad funcional durante el desarrollo de D. melanogaster. Para ello, se aplicó el análisis mutacional de YPWM, el enlazador entre el HD y YPWM, así como la sustitución y fusión al dominio de represión WRPW en la actividad funcional, que permite la


activación y represión de los genes blanco de Antp. En el área de Ciencias de la Tierra y Agropecuarias, el trabajo ganador se denomina “Caracterización de bosques mixtos de pino-encino en la Sierra Madre Oriental en México considerando el factor limitante hídrico”, de Wibke Himmelsbach, Eduardo Javier Treviño Garza, Humberto González Rodríguez, Marco Aurelio González Tagle y Marco Vinicio Gómez Meza. El objetivo principal de este estudio fue comprender el funcionamiento y características de la mezcla de especies de bosque de pino-encino en relación con los principales factores limitantes, escasez de agua y el exceso de sal, para determinar las capacidades fisiológicas de varias especies comunes de árboles nativos. En Ciencias de la Salud, el trabajo ganador fue “El papel de los receptores CD14 y TLR2 de macrófagos THP-1 en la infección por Mycobacterium tuberculosis”, de Francisco Hernández Cabrera, Alma Yolanda Arce Mendoza, Adrián Geovanni Rosas Taraco, Mario César Salinas Carmona y Jorge Enrique Castro Garza. El objetivo de esta investigación fue evaluar el papel de los receptores de inmunidad innata CD14 y TLR2 de macrófagos THP-1 en la infección por M. tuberculosis. Los autores de estos trabajos y sus respectivas dependencias académicas recibieron, de manos del rector de nuestra UNAL, Dr. Jesús Ancer Rodríguez, el premio correspondiente, por Acuerdo del H. Consejo Universitario, en la Sesión Solemne del 13 de septiembre de 2012. Agradecemos a todos los participantes, y extendemos una sincera felicitación a los ganadores. Enhorabuena. 7














Entrevista al Dr. Francisco Hernández Cabrera, Premio de Investigación UANL 2012, en el área de Ciencias de la Salud ESPERANZA ARMENDÁRIZ

El Dr. Francisco Hernández Cabrera es un investigador con una formación multidisciplinaria: egresado de la Facultad de Ciencias Físico-Matemáticas, de la licenciatura en física; cursó la maestría en ingeniería en ciencias, con orientación en materiales biológicos; doctorado en ciencias biomédicas, con orientación en inmunología; y está inscrito en un posdoctorado en matemáticas aplicadas, en el Centro de Investigación en Matemáticas Aplicadas (CIMAT), en el Centro de Investigación y Desarrollo en Ciencias de la Salud (CIDCS). “Trato de integrar todas las disciplinas; en el posdoctorado trabajo la parte matemática para enfocarla al área de salud”, dice orgulloso Hernández Cabrera, profesor de tiempo completo en la Facultad de Ciencias Físico-Matemáticas, donde imparte clases de fundamentos de bioinformática, fundamentos de electromagnetismo y circuito digital. En 2004 recibió el Premio de Investigación UANL, con la tesis de maestría que presentó en la Facultad de Ingeniería Mecánica y Eléctrica (FIME). ¿Cómo surge el trabajo que lo hizo ganador del Premio de Investigación 2012? Es un trabajo de investigación que formó parte de la 8

tesis de doctorado en ciencias biomédicas, con orientación en inmunología. Tengo formación de físico, y el Dr. Mario César Salinas, jefe del Departamento (de Inmunología), me dio la oportunidad de aplicar el examen de doctorado y fui aceptado. Así me involucro en esta área, pero si lo vemos fríamente, hay mucha aplicación de las matemáticas y la física. ¿Siendo físico, cuál era su interés en este doctorado en inmunología? Siempre me ha interesado el área biomédica, de hecho mi tesis de maestría fue en propiedades eléctricas de tejido sanguíneo, vinculada a la salud y, gracias a ese estudio, ganamos el Premio de Investigación UANL en 2004, a partir de ahí me involucré más en el área de ciencias biomédicas. Al conocer opciones, sobre todo la inmunología, me ha fascinado todo el mecanismo que tiene y los conocimientos que se deben tener para entenderla. Esto me llevó a acercarme al Departamento de Inmunología de la Facultad de Medicina, donde inicié el doctorado en 2008 con este tema, que es parte de una hipótesis muy interesante acerca de la inmunología innata, en la que la primera línea de defensa está contra el acecho de los microorganismos que amenazan y tienen que ver con moléculas que se CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


encuentran en la superficie de las células del sistema inmune, cuya función es reconocer lo propio de lo extraño y, cuando esto ocurre, manda un mensaje para inducir una respuesta que elimine favorablemente, sin dañarnos; es una forma de actuar. El estudio está dirigido a la inmunología innata, ¿pero cómo se orienta a la tuberculosis? Es un sistema muy eficiente, pero con fallas; una de ellas es este microorganismo, el M. tuberculosis, ancestralmente uno de los más antiguos, hay reportes de momias de 4 mil años AC que presentaban la infección; y actualmente, a partir de la comunicación, la diversidad de etnias y facilidad de moverse CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

ha ido en aumento, y es una preocupación el atacar este problema. La bacteria M. tuberculosis provoca la tuberculosis pulmonar, y este bacilo se transmite por un estornudo, por toser, con gotitas pequeñas que llevan el bacilo y lo introducen en el tracto respiratorio y se insertan en los pulmones, donde se encuentran con los macrófagos celulares, células del sistema inmune que dan la primera línea de defensa con su inmunidad innata. Entonces, los macrófagos celulares tienen receptores que reconocen los patrones moleculares de estas bacterias, y se dan cuenta si están o no presentes; y estas bacterias también evolucionan para contrarrestar ese reconocimiento y vivir y multiplicarse en el 9


huésped; es una lucha entre dos partes, y la bacteria ha evolucionado para ser resistente y ha desarrollado mecanismos para internarse y que el macrófago no advierta su presencia y no mande la señal de la eliminación de la bacteria. ¿Estudiaron cómo la bacteria de la tuberculosis se ha vuelto inmune en las personas? Así es, y entre muchas otras moléculas involucradas en su reconocimiento hay una proteína TLR2, que es un receptor muy ancestral del reconocimiento de patrones moleculares asociados a patógenos. Este receptor se ha estudiado en los últimos doce años y se ha visto que tiene muchas moléculas que reconoce por parte de las microbacterias, y es extraño que reconozca muchas cosas de esas bacterias y no mande la alerta. La hipótesis que planteamos es de qué forma trabaja TLR2, por qué, si hay mucha activación de ese receptor, no manda esa señal de eliminación del bacilo. Junto con TLR2, actúa otro receptor CD14, un correceptor que se une para favorecer ese reconocimiento, estos receptores están implicados en el reconocimiento de muchas moléculas del patógeno; el estudio pretende saber cómo están involucrados y el papel que juegan en la infección por tuberculosis. Estudiamos el mecanismo por el cual estos receptores se expresan en la membrana y tiene que ver con un mecanismo de proceso de expresión del gen, el gen expresa una molécula renam mensajero, y ese mensajero cuando se traduce por otro mecanismo da lugar a la proteína. El paso intermedio es bloquear ese renam mensajero con una molécula denominada RNA de interferencia que, cuando se acopla, lo desactiva y degrada, ya no llega a ser proteína y ese gen no producirá la proteína, y esa proteína, cuando diseñamos esos RNA de interferencia la bloqueaban, la inhibía. 10

¿Resolvieron la duda inicial de qué sucedía con la proteína TLR2? Primero suprimimos esos receptores y utilizamos la cepa H37RV, que es virulenta; de control positivo utilizamos la cepa M. bobis, es otra bacteria que también infecta, pero no es muy patógena como la H37RV, que es la que nos interesaba. Entonces, indujimos este silenciamiento de genes e infectamos, observamos el plaqueo de las unidades formadoras de colonia para percibir si la batería entró. Las unidades formadoras deben estar presentes; si no entró o se eliminó, las unidades formadoras deben ser pocas, o nulas, entonces nos dimos cuenta que en todos los experimentos en los que faltaba TLR2 tuvimos muy pocas formadoras de colonia, y en los que estaba ausente CD14 teníamos pocas, pero eran más de la mitad del control. Entonces dijimos: vamos a analizar primero TLR2, porque TLR2 parece que es importante, volvimos a repetir los experimentos y resultó lo mismo, así sucesivamente, y llegamos a la conclusión: si no está presente en las unidades formadoras de la bacteria, es porque se eliminó por el mecanismo microbicida, y luego cuál mecanismo microbicida; entonces analizamos los sobrenadantes para darnos cuenta de que había la presencia de óxido nítrico, el cual forma parte de un mecanismo microbicida intracelular. ¿Y este óxido nítrico cómo funciona? Oxida los lípidos en la pared de la membrana de la bacteria, degrada los lípidos y abre la bacteria; se muere la bacteria y ya no hay protección, es una forma en la que se elimina eficazmente. Estábamos demostrando lo que ya se había planteado en muchos trabajos: TLR2 está implicado en una modulación de una respuesta inmune.



¿Cómo impacta el estudio en el tratamiento de la tuberculosis? Este estudio es in vitro, y el siguiente paso es hacerlo in vivo, o sea, en ratones. Ya está aprobado un proyecto en Conacyt, empezamos el próximo año. Dentro de dos años ya tendremos resultados sobre los experimentos en vivo, que serían la pauta para continuar con los tratamientos en humanos. ¿En la bibliografía médica este estudio generó conocimiento nuevo? Es conocimiento nuevo, se tenía esa hipótesis, pero nadie lo había demostrado, y ahora con estos resultados damos un paso importante en esa dirección; una dirección que los llevará a un tratamiento que pudiera ser muy eficaz en el caso de la tuberculosis, porque no hay vacuna, no se ha encontrado alguna forma de protección. ¿Cuándo se inició en la investigación? Desde la maestría, formalmente hace como cuatro años; todo este trabajo se realizó en el Departamento de Inmunología, y ahí estamos colaborando para continuar con esto. Además, tengo otros proyectos; durante el doctorado me sumé como colaborador en la Facultad de Medicina.

tribuyan a que la UANL se dé a conocer a nivel nacional e internacional, hay que ser institucional y si lo puedo hacer en FIME, en Medicina o Físico-Matemáticas, la Universidad sale ganando. ¿Quiénes fueron sus mentores en la investigación? Mi madre inmunológica es la Dra. Irma Yolanda, además el Dr. Adrián Rosas Taraco, el Dr. Jorge Castro y el Dr. Mario César Salinas Carmona. De los proyectos que tiene en puerta, ¿cuáles son sus objetivos concretos? Mi meta es continuar con esta contribución a la sociedad, que reconozcan nuestro trabajo es muy bueno e impulsa, pero hasta que no vea reflejada la aplicación y el beneficio en la sociedad voy a estar más a gusto. ¿Cuál es su compromiso con las nuevas generaciones? Hay que motivarlos, enseñarles el camino, fijarles metas, porque muchas veces se encuentran perdidos, guiarlos y conducirlos para que busquen lo que quieren. Soy de la idea de que el alumno necesita que lo orienten hacia donde quiere ir; conducirlo a objetivos concretos. Me gusta que se visualicen en 10 o 15 años y, dada su respuesta, ofrecerles opciones y guiarlos.

Ya un segundo Premio de Investigación UANL, ¿qué reflexiones hace al respecto?

¿Qué significa ganar este premio?

Este segundo premio es un buen estímulo, quiero continuar en esta rama de la investigación, apoyando a la Universidad, y haciendo proyectos que con-

Es un compromiso que necesitamos reafirmar año con año. En el mundo de la ciencia debemos mantener la constante.
















Entrevista a la Dra. Wibke Himmelsbach, Premio de Investigación UANL 2012, en el área de Ciencias de la Tierra y Agropecuarias JESSICA BALDERAS SALAZAR

En el área de Ciencias de la Tierra y Agropecuarias, “Caracterización de bosques mixtos de pino-encino en la Sierra Madre Oriental en México considerando el factor limitante hídrico”, de la Dra. Wibke Himmelsbach, apoyada por el equipo integrado por Eduardo Javier Treviño Garza, Humberto González Rodríguez, Marco Aurelio González Tagle y Marco Vinicio Gómez Meza, ganó el Premio de Investigación UANL 2012. De la Facultad de Ciencias Forestales, destacó entre 23 trabajos, por su objetivo principal, al comprender el funcionamiento y características de la mezcla de especies de bosque de pino-encino en relación con los principales factores limitantes: escasez de agua, exceso de sal, y para determinar o, más bien, distinguir las capacidades fisiológicas de varias especies comunes de árboles nativos. La doctora Himmelsbach explica a profundidad sobre el tema. ¿A qué se refiere el estudio que la hizo ganadora del Premio de Investigación UANL? La disponibilidad de agua y el exceso de sales en el suelo son factores limitantes para el crecimiento de los árboles en los bosques mixtos de pino-encino en la Sierra Madre Oriental (SMO). El objetivo de nues12

tra investigación fue identificar las estrategias de diferentes especies arbóreas de la región SMO, para evitar daños causados por la escasez de agua o superar temporadas de sequía, resultado de alteraciones en las precipitaciones anuales que podrían relacionarse con el cambio climático. Este conocimiento CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


nos permite mejorar el manejo sustentable y optimizar las acciones de reforestación y restauración ecológica. En este sentido, las plantas tienen diferentes tipos de adaptación al medio ambiente; se distinguen, por ejemplo, por su adaptación ambiental o a un nicho, la adaptación morfológica a través de la forma y estructura de sus hojas: anatómica, bioquímica, genética, fisiológica, etc. Como el latido del corazón en un humano, el estado hídrico nos dice mucho sobre el bienestar de una planta. Entonces, nos enfocamos en la medición del estado hídrico, el cual se determina a través del potencial hídrico y el potencial osmótico. En general, las plantas presentan dos tipos de estrategias fisiológicas para evitar daños causados por la falta de agua. El primer tipo es “isohydric”, plantas que mantienen su nivel de humedad igual o con poca variación en un lapso de tiempo con diferente disponibilidad de agua, y el segundo es “anisohydric”, plantas que parecen variar su nivel de humedad. Es importante señalar que las plantas con poca variación en su nivel de humedad tienen ventaja durante severas pero cortas sequías, mientras que plantas con mucha variación en su nivel de humedad tienen más probabilidad de sobrevivir durante largas sequías de menor intensidad. En total, se realizaron mediciones en cinco especies diferentes, bajo diferentes condiciones de sequía, en dos pendientes diferentes en el Campo Experimental Bosque Escuela de la UANL, en Santa Rosa, Iturbide. El Bosque Escuela nos proveyó las condiciones óptimas para la realización de mediciones directamente en el campo o sitio con un equipo pesado y peligroso. En el trabajo premiado –se trata del artículo científico “Acclimatation of three co-occurring three species to water stress and their role as site indicators in mixed pine-oak forests in the Sierra Madre Orien-


tal, México” (doi: 10.1007/s10342-011-0507-3), publicado en la revista European Journal of Forest Research–, se analizaron los datos de las tres especies principales: cedro (Juniperus fláccida), encino (Quercus canbyi) y pino (Pinus pseudostrobus), las cuales forman el dosel forestal. ¿Por qué se pensó en esta investigación? Después de concluir la licenciatura (ciencias forestales y ecología forestal), y la maestría (ciencias forestales tropicales e internacionales) en la GeorgAugust-Universität en Göttingen (Alemania), quise seguir con mis estudios en el extranjero, especialmente en la Facultad de Ciencias Forestales de la UANL, en Linares. Desde hace años existe un Memorandum de Entendimiento entre las dos facultades/universidades, y conocí varios becarios mexicanos que estudiaron una temporada en Göttingen. Como mi asesor externo, Prof. Dr. Ralph Mitlöhner, es especialista en el manejo de bosques semisecos y secos, me introdujo a este tema. Con su experiencia, elaboré el anteproyecto con el cual apliqué para entrar al programa de doctorado, con la especialización en el manejo de recursos naturales de la Facul13


tad de Ciencias Forestales y para una beca de la SRE (Secretaría de Relaciones Exteriores). Por la problemática de las alteraciones de sequías e intervenciones humanas en muchos ecosistemas sensibles, me interesaba estudiar y comprender la dinámica en dichos ecosistemas. Una vez aquí en Linares, México (a finales de marzo de 2005), especificamos y adoptamos el anteproyecto a las condiciones locales con los asesores principales (Dr. Eduardo Javier Treviño Garza y Dr. Humberto González Rodríguez), e iniciamos con el trabajo de campo en enero/febrero de 2006. ¿Cuáles son los alcances de esta investigación? Lo más relevante es saber que el pino está adaptado para superar severas sequías de corto tiempo, mientras que el encino y cedro están mejor preparados para manejar sequías largas, pero de poca intensidad. En la práctica, significa que si en áreas de reforestación o restauración se esperan severas pero cortas temporadas de sequía, la reforestación o actividades de restauración con la especies de pino es favorable. Al contrario, en áreas con sequías largas, pero de menos intensidad, se favorece la plantación de encinos y cedros. Sin embargo, los procesos ecofisiológicos en un bosque son muy complejos, y uno no debe tomar decisiones precipitadas sobre el futuro desarrollo de los bosques de la SMO. Hay que investigar más especies e incluir variables fisiológicas y ambientales adicionales, para concluir y modelar de forma más precisa los escenarios futuros de nuestros bosques relacionados con el cambio climático. El proyecto se inició en 2005, pero el trabajo de campo empezó en enero de 2006, y se tardó ocho meses, hasta agosto del mismo año. Después siguió la fase de los análisis y publicaciones. En diciembre de 2009 se terminó la tesis de doctorado y el trabajo 14

premiado (el artículo publicado en la revista European Journal of Forest Research) se aceptó completamente apenas en enero de 2011. El proyecto se concluyó con la tesis de doctorado y al publicar los resultados en revistas internacionales. Ahora trato de encontrar un camino profesional que me permita atender bien a mis hijos (uno y cinco años) y continuar con la ciencia al mismo tiempo. Estamos investigando procesos naturales, y no se esperan resultados específicos, como en ciencias químicas o en la tecnología. ¿De qué manera beneficia a la sociedad este proyecto? Los bosques son los pulmones de nuestra tierra. Su falta afecta el clima, nos purifican el aire, son parte crucial en el ciclo de carbono, influyen el nivel del agua subterráneo y superficial; sin olvidar su función como áreas recreativas, ornamentales y de esparcimiento en nuestras ciudades y sus alrededores para asimilar el estrés. Mantener nuestros bosques funcionando y sanos contribuye, sin duda, a la salud de la población humana, garantiza una mejor calidad de vida. Entonces, conocer y entender la función de los árboles y de sus estrategias es importante para la selección de especies arbóreas apropiadas para proyectos de reforestación y restauración ecológica en áreas propensas a sequías y aumenta la supervivencia de las reforestaciones. ¿Qué tanto se estudia este tema en México? Hay varios estudios similares en México, pero México es un país muy grande, con una gran variedad de ecosistemas. Sin embargo, en los bosques de pinoencino de la SMO se han realizado muy pocos estudios de este tipo.



Este premio es un gran honor para nosotros y significa mucho, aparte de que se da prioridad a nuestro tema de investigación –a los bosques y su manejo–, en el área de Ciencias de la Tierra y Agropecuarias, se reconoce la problemática de las sequías y sus consecuencias para nuestros bosques como una necesidad de actuar. Esto es muy importante para todos los investigadores de la Facultad de Ciencias Forestales, y motiva a los estudiantes actuales de nuestras carreras. Asimismo, nos da mucho gusto que se reconozca un trabajo que tardó varios años en publicarse en una revista internacional con alto factor de impacto. Nos confirma haber tomado la decisión correcta al insistir que se publicara a alto nivel. Personalmente, invertí mucho tiempo en esta publicación. Y muchas veces dudé si lo estaba haciendo bien, pero este premio es la confirmación y


una señal de que tomé la mejor decisión. De una labor de investigación siempre resultan nuevas ideas y preguntas con las cuales se encuentra confrontado el investigador, por lo mismo nunca se terminará la ciencia. Realmente logramos saber muy poco y siempre queda un mar de preguntas. Nos espera mucho trabajo, ahora hay que seguir el estudio y el análisis de los ecosistemas de la región a una escala mayor, incluyendo más variables y factores, y con tecnología mejorada para entender mejor los procesos naturales, y así intervenir de manera adecuada para garantizar la sustentabilidad de nuestros bosques. Para un proyecto de este tipo, el trabajo interdisciplinario es indispensable y al mismo tiempo un gran reto. Me gustaría llevar el proyecto a este nivel interdisciplinario, para contestar y analizar preguntas más complejas, que permitan explicar y entender mejor los procesos naturales en los ecosistemas de la SMO.















Entrevista a la Dra. Mayra Zyzlila Figueroa Torres, Premio de Investigación UANL 2012, en el área de Ciencias Exactas JESSICA BALDERAS SALAZAR

La Dra. Mayra Zyzlila Figueroa Torres y un grupo de científicos de la Facultad de Ingeniería Civil, integrado por la Dra. Leticia Myriam Torres Guerra, el MC Miguel Ángel Ruiz Gómez, el Dr. Isaías Juárez Ramírez y el MC Christian Gómez Solís, con su trabajo “Nuevos óxidos multifuncionales Sm2FeTaO7 y Sm2lnTao7 para la descontaminación de agua vía fotocatálisis heterogénea”, fueron los ganadores del Premio de Investigación UANL 2012, en el área de Ciencias Exactas. De entre 16 proyectos, éste resultó vencedor al llegar a la conclusión de que es posible la síntesis del nuevo óxido del tipo pirocloro de composición Sm2FeTaO7 de manera pura. Con los métodos de estado sólido y de solgel, se determinó que cuando se utiliza sol-gel como método de síntesis el material se obtiene a menos temperatura y menor tiempo de reacción, además de que los polvos presentan un tamaño de partícula pequeño y un área superficial de un orden de magnitud mayor, en comparación con el método de estado sólido. La doctora Figueroa Torres nos explica a detalle. ¿De qué trata el estudio que le dio el Premio de Investigación UANL? Principalmente, el proyecto estuvo orientado a de16

sarrollar nuevos materiales fotocatalizadores con la capacidad de eliminar compuestos orgánicos peligrosos; en particular, colorantes orgánicos, así como metales tóxicos que se encuentran comúnmente en las aguas del sector industrial. Para esto, nuestra primera meta fue sintetizar un nuevo óxido con una composición química especial; así logramos reporCIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


tar por primera vez el compuesto Sm2FeTaO7, empleando dos rutas de síntesis. Este resultado fue una aportación importante de nuestro proyecto, debido a que nuestro grupo de investigación genera conocimiento a nivel mundial, al desarrollar nuevos materiales y estudiar sus características estructurales y otras propiedades fisicoquímicas importantes para la descontaminación del agua. De igual manera, otra aportación científica fue la síntesis, por primera vez, del compuesto Sm2InTaO7, empleando un método de “química suave”, como el proceso sol-gel. Realizada la síntesis y caracterización de ambos óxidos, orientamos nuestra investigación hacia la eliminación de contaminantes presentes en el agua, como los colorantes orgánicos y el metal cromo, mediante el proceso conocido como fotocatálisis heterogénea; para ello, nuestros materiales (en forma de polvo) se ponen en contacto con el agua contaminada, y mediante la aplicación de luz, que puede ser artificial o solar, se activan para generar una reacción de oxidación y reducción, esto genera especies químicas capaces de descomponer los contaminantes que se encuentran en el agua. Al finalizar, los polvos se recuperan y se utilizan las veces que sea necesario. Con base en los resultados, encontramos que el compuesto Sm2FeTaO7 es activo para la eliminación de colorantes al emplear directamente la luz solar, lo cual es importante desde el punto de vista de sustentabilidad y economía. Por otro lado, encontramos que el compuesto Sm2InTaO7 se activa con luz ultravioleta y presenta la capacidad de eliminar colorantes, así como el cromo, el cual es altamente cancerígeno. Finalmente, con este proyecto fue posible generar conocimiento trascendente para posteriores investigaciones en el área de la ciencia e ingeniería de los materiales, en específico sobre las características estructurales, la composición química y propieda-


des que deben tener los materiales para aplicaciones en la ingeniería ambiental. ¿Cómo surge el interés en esta investigación? En este sentido, nuestro grupo de investigación cuenta con experiencia en el desarrollo de nuevos materiales, así como la modificación de compuestos ya existentes, con el fin de lograr un control en sus propiedades; con base en esto, se planteó el desarrollo de una familia de nuevos compuestos, como parte de un proyecto de investigación integral con el objetivo de estudiar nuevos materiales, determinar sus propiedades fisicoquímicas y evaluar su actividad en diversas aplicaciones fotocatalíticas. Con esto se pretende generar conocimiento para entender los aspectos más importantes que determinan las propiedades finales de los materiales fotocatalizadores, así como su aplicación tecnológica, con el fin de atacar problemas importantes que afectan a la sociedad. Referente al alcance de esta investigación… Los avances tecnológicos y el desarrollo de la sociedad siempre han ido de la mano con el tipo de materiales que se utilizan en la gran diversidad de actividades cotidianas; esto marca las grandes diferencias que encontramos en nuestro mundo actual, comparado, por ejemplo, con el de hace 50 años. Por ello, con este proyecto se busca principalmente desarrollar materiales multifuncionales con propiedades inusuales que muchas veces son difíciles de alcanzar. Los avances tecnológicos, así como la implementación de procesos sustentables, requieren de estos materiales para que algún día lleguen a ser una realidad, y contribuyan al incremento de la calidad de vida. Actualmente, esta investigación está en desarrollo, podríamos decir que el proyecto que ganó el Premio de Investigación representa 40 o 50% de la in17


vestigación integral que se planteó originalmente, ahora estamos enfocados al desarrollo de otros nuevos compuestos similares, y a la vez buscamos la manera de mejorar el desempeño de estos nuevos materiales en las reacciones para la degradación de contaminantes, así como para la generación de combustibles alternos, como el hidrógeno, buscando siempre la generación de conocimiento de vanguardia. Hasta el momento hemos dedicado alrededor de dos años a este proyecto. Como parte de una planeación adecuada, es necesario un análisis crítico de los reportes científicos existentes, proponer el trabajo a desarrollar y, finalmente, plasmar las ideas en el laboratorio; aún falta mucho por hacer.


¿Cuáles fueron los primeros resultados de este estudio? Al inicio se estudiaron materiales de composición química más simple, se encontró que los compuestos que contenían elementos químicos, como el tántalo y el samario, mostraban propiedades fotocatalíticas atractivas. Con la experiencia desarrollada e informándonos sobre las publicaciones científicas recientes en esta área, concluimos que al sintetizar materiales de composición química más compleja se presenta la formación de arreglos atómicos especiales, los cuales ayudan a mejorar el desempeño fotocatalítico de los materiales y les brindan mayor



estabilidad química en estas aplicaciones. De ahí que buscamos conjugar ambas cosas al proponer una nueva fase. Los primeros resultados interesantes se lograron en alrededor de seis meses; aterrizar un planteamiento a nivel laboratorio, en muchas ocasiones suele ser un proceso laborioso que debe ir paso a paso. Parte de ello implica la realización de experimentos previos y, sobre todo, un análisis muy detallado de las características de los compuestos, para posteriormente evaluar sus propiedades fotocatalíticas. Con los resultados de los análisis se hace una discusión detallada y ordenada, con el fin de redactar y publicar artículos científicos en revistas internacionales. Todo esto lleva alrededor de un año y medio. ¿Cómo beneficia a la sociedad este proyecto? Definitivamente, el beneficio de este proyecto es para la sociedad. La ciencia y la tecnología moderna deben estar orientadas al desarrollo de procesos que sean amigables con el medio ambiente, así como enfocar esfuerzos para la remediación ambiental. Esto, sin duda alguna, incrementa considerablemente la calidad de vida de la sociedad y al mismo tiempo ayuda a la construcción de un futuro sustentable. Desafortunadamente son contados los grupos de investigación que trabajan este tema en nuestro país. ¿Qué significa este reconocimiento? Este premio significa mucho para nosotros, es una satisfacción que nos llena de orgullo al ser acreedores a la máxima distinción en investigación que otorga la UANL. Estos incentivos también son una forma de reconocer los esfuerzos del día a día para realizar trabajos de calidad. Además, es una motivación muy grande para continuar con nuestra labor


en el área de la investigación. Sobre todo, como cuando, en mi caso, la oportunidad de trabajar en la UANL fue una cuestión del destino: por asuntos personales llegué a radicar a esta ciudad y mi formación profesional siempre ha sido en el área de la ciencia y la ingeniería de materiales. En busca de un lugar donde ejercer como profesionista, encontré al grupo de ecomateriales y energía liderado por la Dra. Leticia Torres, con quienes rápidamente logré una buena afinidad integrándome a la dinámica de trabajo. ¿Qué le ha dejado la labor de investigadora? Muchas satisfacciones profesionales, como ganar este premio; pero, principalmente, el hecho de hacer lo que me gusta. La investigación en el área de los materiales es fascinante, siempre hay un mundo de posibilidades y aplicaciones que estudiar, además es un área fundamental para el desarrollo de la sociedad. También es muy grato participar en la formación de recursos humanos con quienes se logra una convivencia muy cercana. Faltan muchas cosas por explorar. Hemos terminado la fase en la que se buscaba la formación de los compuestos con resultados bastante satisfactorios. Esto da pie a indagar en otras aplicaciones de importancia y trascendencia como la generación de fuentes alternas de energía como el hidrógeno a partir de procesos limpios y sustentables; otra área a explorar sería la eliminación de los gases contaminantes en el aire, y tenemos que trabajar sobre cómo mejorar las propiedades de los materiales. Ahora que sabemos que es posible la formación de esta fase, se pueden explorar otras rutas de síntesis, con el fin de modificar sus propiedades superficiales e incrementar la sensibilidad a la radiación de luz, lo cual se vería reflejado en una mayor capacidad para remover los contaminantes.















Entrevista a la Dra. Diana Reséndez Pérez, Premio de Investigación UANL 2012, en el área de Ciencias Naturales ESPERANZA ARMENDÁRIZ

Al Premio de Investigación UANL, en su edición 2012, respondieron trece trabajos en el área de Ciencias Naturales, pero el equipo de la Dra. Diana Reséndez Pérez, integrado por la MC Diana Linda Cárdenas Chávez, el Dr. Ricardo Canales del Castillo y la MC Olga Karina Villanueva Segura, fue electo por el jurado. Se trata de un trabajo en el que utilizaron como modelo experimental la mosca de la fruta (Drosophila melanogaster) y estudiaron unos genes conocidos como homeóticos o genes Hox, considerados por Reséndez Pérez como la caja de herramientas genéticas que permite a cada organismo tener una forma o diseño diferente. ¿En qué consiste el estudio que los hizo ganadores del premio? Seleccionamos al gen denominado Antenapedia (Antp), porque su mutación permite la evidente transformación de antenas por patas en la mosca de la fruta, donde realizamos un análisis molecular fino de este gen mediante mutagénesis dirigida. Los resultados obtenidos nos permitieron determinar las regiones que le confieren la actividad funcional a esta homeoproteína en la función dual, tanto activadora 20

como represora de sus genes blanco para la morfogénesis de las estructuras. ¿Hay bibliografía científica relacionada con este tipo de investigación? Sí, hay mucha información de Antenapedia, ya que es una mutación muy famosa en la biología del desarrollo, debido a que permitió el descubrimiento del homeobox; sin embargo, a la fecha no se ha dilucidado el mecanismo molecular detallado en su actividad funcional. CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


¿Hay algún antecedente concreto de este estudio? Las homeoproteínas altamente conservadas permiten la morfogénesis de las diferentes estructuras en el patrón corporal de los organismos, por lo que es fundamental determinar cómo realizan su actividad funcional en el control genético del desarrollo.

¿Dónde se realizaron las pruebas de laboratorio? En la Unidad de Biología del Desarrollo del Departamento de Inmunología y Virología y del Departamento de Biología Celular y Genética, de la Facultad de Ciencias Biológicas de la UANL. ¿Hay otros hallazgos relacionados con este estudio, pero dirigidos a otras líneas de investigación?

¿Qué aportación científica resultó de este estudio? El hallazgo de la actividad funcional dual de Antp nos permite entender mejor cómo se realizan a nivel molecular la activación y represión de cascadas de genes que permiten el desarrollo y morfogénesis de las estructuras, lo que puede tener implicaciones para el diseño de formación de tejidos y órganos ¿Cuándo se inició y en qué fase se encuentra la investigación? Esta línea de investigación se inició hace aproximadamente una década, cuando regresé de un posdoctorado de la Universidad de Basilea, Suiza, en el laboratorio donde se descubrieron los genes homeóticos. La actividad activadora y represora encontrada en Antp abre la oportunidad para continuar con el análisis molecular de estas homeoproteínas en la selección de los genes blanco para el control genético del desarrollo. ¿En México ya hay investigaciones en esta línea? No, especificamente en esta línea de investigación, aunque existen dos grupos en México usando Drosophila como modelo, en el Instituto de Neurobiología y en el Instiruto de Biotecnología, ambos en Cuernavaca, Morelos, y ambos de la UNAM.


Hay muchas evidencias experimentales que muestran la actividad funcional de las homeoproteínas, básicamente como activadoras o represoras y sólo recientemente se ha sugerido la interacción con coactivadores y correpresores para diversificar su función. ¿Cuál ha sido su formación académica? Estudié químico bacteriólogo parasitólogo, en la Facultad de Ciencias Biológicas de la UANL y, posteriormente, la maestría en ciencias, con especialidad en biología celular, en la misma FCB. El doctorado en ciencias, con especialidad en biología molecular e ingeniería genética, lo realicé en la Facultad de Medicina de esta Universidad. Luego hice un posdoctorado en el laboratorio del Dr. Walter Gehring, del Departamento de Biología Celular, Biozentrum, Universidad de Basilea, Suiza ¿Qué líneas de investigación ha desarrollado? Control genético del desarrollo en Drosophila melanogaster: genes homeóticos; determinación y diferenciación celular; expresión diferencial de genes Hox en cáncer genómica de la hormiga Pseudomyrmex sp y producción biotecnológica de péptidos para el tratamiento de enfermedades; asimismo, genotipificación y filogenia molecular de agaves, regulación



La biología del desarrollo es un área emergente y de oportunidad en México, la cual necesita mucho apoyo. ¿Qué medidas se deben asumir para apoyar con más ahínco a la comunidad científica? Incrementar los fondos para el apoyo a proyectos de investigación, tanto en ciencia básica como en aplicada. homeótica mediante interacciones proteína-proteína, y microRNAs en el control genético del desarrollo en D. melanogaster.

¿Qué le ha dado la investigación?

En 1991, cuando todavía era estudiante del doctorado en ciencias, fui galardonada con el Premio de Investigación UANL en el área de Ciencias Naturales con la tesis doctoral “Biología molecular de la familia multigénica de las hormonas lactogénica placentaria y del crecimiento humano”.

Realmente el desarrollo de la investigación científica me ha proporcionado una emoción continua que va desde la concepción de la idea, la realización del trabajo práctico y la búsqueda y curiosidad de la respuesta en el planteamiento de la hipótesis o pregunta científica. Aunado a esto, indudablemente, me ha permitido el privilegio de transmitir la pasión de la investigación a mis estudiantes de licenciatura y posgrado, que en este trabajo fueron dos estudiantes de maestría y uno del doctorado en ciencias.

¿Cuáles son sus reflexiones acerca de la investigación en el área de la genética y biología molecular?

¿Cómo promover en la licenciatura la formación de nuevos cuadros de investigadores?

Considero que lo más importante en el descubrimiento del mecanismo molecular de la función dual de esta proteína en el control genético del desarrollo en la mosca de la fruta es que puede ser extrapolado a otros genes Hox, que están altamente conservados en otros organismos, que van desde levaduras hasta vertebrados superiores incluyendo al humano.

Creo que deberíamos incrementar en la medida de lo posible el desarrollo de tesis de licenciatura en todas las carreras de ciencias.

¿Ya había recibido este reconocimiento?

¿Considera que es incipiente el desarrollo de estas ciencias en el país?


¿Alguna aportación personal? El desarrollo de investigación científica me ha proporcionado mucho más de lo que yo podría haber imaginado, tanto en mi vida personal como académica.


&,(1&,$ ;98$1/ $











El papel de los receptores TLR2 y CD14 de macrófagos THP-1 en la infección por M. tuberculosis F. HERNÁNDEZ CABRERA***, A. ROSAS TARACO*, M. SALINAS CARMONA*, J. CASTRO GARZA**, A. ARCE MENDOZA*

La tuberculosis pulmonar es la enfermedad infecciosa más arraigada en la humanidad, cada año causa más de 2 millones de muertes y se reportan 8 millones de nuevos casos clínicos con incremento de cepas multi y extremadamente resistentes. Aunque mucho se ha investigado sobre los mecanismos de la respuesta inmune a la infección por M. tuberculosis, no se ha logrado la identificación de marcadores específicos que expliquen la susceptibilidad de algunos individuos a desarrollar tuberculosis, mientras que en otros casos la infección permanece latente o se resuelve favorablemente. La resolución de la infección por M. tuberculosis se asocia a la respuesta inmune del tipo Th1, e involucra la producción de citocinas proinflamatorias y mecanismos microbicidas. Estudios in vitro reportan que TNF-˜, IL-12 e IFN- estimulan la producción de la enzima de óxido nítrico sintetasa inducible (iNOS), elevan los niveles de óxido nítrico para favorecer la eliminación intracelular de M. tuberculosis,1-3 mientras que algunos polimorfismos en el receptor de IFN-γ increEl presente artículo está basado en la investigación “El papel de los Receptores CD14 y TLR2 de macrófagos THP-1 en la infección por M. tuberculosis”, galardonada con el Premio de Investigación UANL 2012, en la categoría de Ciencias de la Salud, otorgado en sesión solemne del Consejo Universitario, en septiembre de 2012.


mentan la susceptibilidad a desarrollar tuberculosis pulmonar.4,5 La actividad de virulencia de M. tuberculosis se ha relacionado con las moléculas que forman su pared celular y con proteínas secretadas,6 estos antígenos parecen modular la respuesta inmune en etapas tempranas de la infección a través de los receptores de inmunidad innata de macrófagos alveolares. Los receptores de inmunidad innata más relevantes que participan en el reconocimiento de M. tuberculosis son los receptores Tipo Toll (TLR) de macrófagos. Investigaciones recientes apuntan a los receptores de reconocimiento TLR2 y CD14 como las piezas fundamentales en la respuesta inmune que determinarían el curso de la infección pulmonar causada por micobacterias, ya que estos receptores poseen la mayor capacidad para el reconocimiento de proteínas, glicolípidos y peptidoglicanos de M. tuberculosis.7-11 En etapas tempranas de la infección, TLR2 recluta a CD14 en regiones de la membrana citoplasmática con alto contenido de fosfatidilinositol 4,5-bifosfato (PtdIns(4,5)P2), esto permite que * Universidad Autónoma de Nuevo León. Departamento de Inmunología-FM. **Centro de Investigación Biomédica del Noreste del IMSS. *** Universidad Autónoma de Nuevo León, FCFM. 23


TLR2 sea reclutado a fagosomas con carga bacteriana en la que M. tuberculosis continúa estimulándolo.12 En esta etapa, los glicolípidos evitan la maduración del fagosoma, inhiben la asociación del fosfatidil inositol 3 fosfato (PI3P) y bloquean el flujo de calcio.13 Se ha demostrado que una alta tasa de activación en TLR2, por productos de M. tuberculosis (TDM, proteínas LpG y 19kDa) inhibe la producción de IFN-γ y la expresión de MHCII, además de moléculas coestimuladoras en macrófagos y células dendríticas, atenua la presentación de antígenos.14-16 En un estudio epidemiológico se identificó una variante de la proteína intracelular TIRAP relacionada con TLR2, que confiere protección contra bacteremias, neumococo invasivo, malaria y tuberculosis,17 al hacer evidente que la activación de TLR2 por estos patógenos puede ser una desventaja en la respuesta del huésped para eliminar la infección. Otros estudios en humanos muestran que polimorfismos de TLR2 o TLR4 dan un incremento en la susceptibilidad a infecciones microbianas, principalmente influenciado por el balance Th1/Th2.18-20 Se ha reportado que el aumento en la expresión de TLR2 y su activación excesiva en macrófagos infectados con M. tuberculosis generan una respuesta Th2, como resultado de la producción de las enzimas supresoras de señalización de citocinas como SOCS1, e IRAK-M, que inhiben la trayectoria de señalización del receptor de interferón gamma (IFNγ R) y de TLRs en macrófagos, así como de la inhibición de los receptores IL-12R, IL-23R e IFN-γ˜R en linfocitos; provoca vías de señalización antiinflamatorias (IL-10, TGF-β) que promueven la supervivencia y proliferación de los bacilos.21 Recientemente se demostró que M. tuberculosis restringe la respuesta proinflamatoria de macrófagos, mediante la actividad catalítica de la hidrolasa Hip1 atenuando la activación de TLR2.22 Más aún, 24

se ha evidenciado que ratones TLR2-/- presentan una respuesta inflamatoria excesiva con altos niveles de TNF-α, INF-γ y óxido nítrico en espacios alveolares ante la infección por M. tuberculosis.23 Nuestro estudio demuestra la importancia de los receptores TLR2 y CD14 de macrófagos humanos THP-1 en la infección por M. tuberculosis (H37Rv), en un modelo Knock Down (KD), evidenciando que M. tuberculosis modula la respuesta inmune a través del receptor TLR2, al inhibir la producción de óxido nítrico para favorecer su supervivencia, y utiliza a CD14 para favorecer una rápida internalización en macrófagos. MA TERIALES Y MÉTODOS MATERIALES A partir de la línea celular THP-1 de monocitos, se realizó la transformación a macrófagos, estimulando químicamente con fobol 12-miristato 13-acetato (PMA) a una concentración final de 10µM, por 48 hrs en medio DMEM, enriquecido con 10% de suero fetal bovino inactivado por calor. Para inducir el silenciamiento de los genes tlr2 y cd14 in vitro, los siRNAs duplex (siRNA-TLR2 forward 5'ACACAAUAGAGGAAGAUUC-3', reverse 5’-GA AUCUUCCUCUAUUGUGU-3’, siRNA-CD14 forward 5’-AAACGGCUUAGGUUGAGA-3’, reverse 5’-UCUCAACCUAGAGCCGUUU-3’) fueron transfectados con DARMAFECT2® por triplicado, en 1x106 macrófagos/pozo, con siRNAs a concentración final de 1.8 nM en los grupos de experimentación; silenciamiento de cd14 (CD14-KD), silenciamiento de tlr2 (TLR2-KD), silenciamiento de cd14 y tlr2 (CD14-KD/TLR2-KD), control de transfección (Liposomas), control negativo de silenciamiento la transfección con un siRNA inespecífico (Dharmacon Control no-ontarget) y células sin transfección. Se utilizó ramdom hexamers (Invitrogen) para la conversión de los transcritos a CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


cDNA, la amplificación se realizó con SyBR Green Supermix en un equipo CFX96TM, y la expresión génica se normalizó con el método ∆∆Ct, con los oligonucleótidos: TLR2 (forward 5’GGGTTGAAGCACTGGACAAT-3’, reverse 5’TCCTGTTGTTGGACAGGTCA-3’), CD14 (forward 5’-ACTTGCACTTTCCAGCTTGC-3’, reverse 5’-GCCCAGTCCAGGATTGTCAG-3’), y GAPDH (forward 5’GGCCTCCAAGGAGTAAGACC-3’, reverse 5’AGGGGTCTACATGGCAACTG-3’). La expresión de las proteínas TLR2 y CD14 en la membrana celular de los macrófagos se determinó por citometría de flujo, con anticuerpos monoclonales anti-TLR2FITC y anti-CD14-PE, con un equipo Beckton Dickinson modelo Calibur, y se empleó el software Cellquest para demostrar la efectividad del silenciamiento y comprobar la ausencia de los receptores TLR2 y CD14 en la membrana de los macrófagos. Los grupos de experimentación se infectaron con M. tuberculosis H37Rv, a una razón de infección 5:1 (bacterias/macrófagos), seis horas después se retiró el sobrenadante del cultivo celular, se lavó dos veces, con el fin de evitar bacterias remanentes no fagocitadas. A las 48hrs después del inicio de la infección, se colectó el sobrenadante y se filtró con una membrana de 0.22 µm, y se realizaron dos lavados para eliminar las posibles bacterias extracelulares. Posteriormente, las células en monocapa se lisaron con 1ml de agua estéril miliQ libre de RNasas a 0°C, y se centrifugaron a 1000rpm/10 minutos, el sobrenadante de esta centrifugación se guardó en Trizol®, para recuperar el RNA total y el pellet fue resuspendido en 500 µl de medio y sembrado en placas con agar Middlebrook 7H10. Luego de tres semanas, se midieron las unidades formadoras de colonias (UFC). A partir del sobrenadante de los grupos de experimentación, se hizo la cuantificación de citocinas (TNF-α, IL-12,


IFN- γ , IL-10 y TGF- β ) por ELISA, con kits eBiosciencie®. Del lisado celular se obtuvo el RNA total con columnas de extracción Qiagen RNAeasy®, y se midió la expresión génica normalizada de las citocinas, tomando como gen constitutivo GAPDH, se utilizó el método ∆∆Ct, con los siguientes oligonucleótidos; TNF-α (forward 5 4 0+”¨ GTGCTTGTTCCTCAGCCTCT-3’, reverse 5’TGGGGAACTCTTCCCTCTG-3’), IL-12 (forward 5 ”¨0+”¨ -GCCCAGCTGCTGAG GAGAGT-3 ”¨0+”¨ , reverse 5 ”¨0+”¨ -TGGGT GGGTCAGGTTTGATG-3 ”¨0+”¨ ), IFN- γ (forward 5’-ACGAGATGACTTCGAAAAGCTG3’, reverse 5’-TTTAGCTGCTGGCGACAGTTC3’), IL-10 (forward 5’-GGGAGAACCTGAA GACCCTCA-3’, reverse 5’-TGCTCTTGTTTTCA CAGGGAAG-3’), TGF-β (forward 5 ”¨0+”¨ A AGTGGACATCAACGGGTTC3 ”¨0+”¨ , reverse 5 ”¨0+”¨ GTCCTTGCGGAAGTCAATGT3 ”¨0+”), GAPDH (forward 5’-GGCCTCCAAG GAGTAAGACC-3’, reverse 5’-AGGGGTCT ACATGGCAACTG-3’). La actividad del óxido nítrico se evaluó de manera indirecta, utilizando el reactivo de Griess con los sobrenadantes de los grupos de experimentación. Además, se medió la expresión génica normalizada del gen óxido nítrico sintetasa inducible (inos) por RT-PCR en tiempo real. RESUL TADOS RESULT La optimización del modelo TLR2 Knock Down de macrófagos THP-1 (siRNA-TLR2 y siRNA-CD14) se obtuvo a una concentración de 1.8 nM/siRNA 48 hrs después de su transfección. En estas condiciones se presentó la máxima ausencia de transcritos tlr2, con un porcentaje de silenciamiento génico de 93±2%, mientras que la expresión de la proteína en la membrana celular se inhibió en 98±4% (p<0.001). 25


De igual manera, para cd14 el silenciamiento génico fue de 94±2%, y la expresión de CD14 en la membrana celular se suprimió en 92±4% (p<0.001). Después de infectar los grupos experimentales por 48 hrs con M. tuberculosis H37Rv, las bacterias intracelulares se plaquearon por tres semanas y se midieron las unidades formadoras de colonias (UFC). Los cultivos que involucraban el silenciamiento de TLR2 (siRNA-TLR2, siRNA-CD14/TLR2) mostraron una inhibición del crecimiento bacilar de 97±5% (p<0.001), y para el modelo siRNA-CD14 sólo se observó inhibición en el número de UFC del 36% (p<0.05) (figura 1). Estos resultados muestran que probablemente las bacterias fueron eliminadas, ya que no se presentaron UFC en los cultivos de sobrenadantes, tomados a las 6 hrs de infección en macrófagos con siRNA-TLR2. Para determinar si se activó el mecanismo microbicida iNOS/óxido nítrico, se analizó la expresión génica de la enzima iNOS.

DISCUSIÓN Los resultados de esta investigación permiten establecer que el silenciamiento del receptor TLR2 contribuyó a disminuir el número de UFC en un 97±5%, a 48hrs después de la infección. En este tiempo los macrófagos TLR2-KD y CD14-KD/TLR2-KD infectados con M. tuberculosis incrementaron significativamente la producción de IFN-ã, asociada con la activación de macrófagos para incrementar la producción de iNOS y óxido nítrico. Entonces, la exce-

Mecanismo microbicida iNOS/óxido nítrico La expresión génica de inos muestra un incremento significativo de 72% para siRNA-CD14, 116% para siRNA-TLR2 y 172% para siRNA-CD14/TLR2, con respecto al control de infección (figura 2). Por otra parte, la concentración de nitritos aumentó significativamente (p<0.05), e indica la presencia de óxido nítrico únicamente en macrófagos TLR2-KD infectados por M. tuberculosis (figura 3). Finalmente, los niveles de las citocinas TNF-α e IFN-γ presentan un incremento significativo en las muestras que involucran el silenciamiento de TLR2 (siRNA-TLR2) con respecto al control de infección (figura 4 y figura 5), sugieren que la respuesta inmune Th1 prevalece en la infección por M. tuberculosis en macrófagos TLR2-KD.


Fig. 1. Reducción significativa de las UFC para muestras TLR2-KD.

Fig. 2. Incremento significativo en los transcritos de inos en los grupos con silenciamiento génico.



Fig. 3. La actividad del óxido nítrico se observó sólo en el grupo de macrófagos TLR2-KD.

siva activación de TLR2 puede ser una desventaja en la respuesta inmune del huésped para eliminar la infección, e indica que el receptor TLR2 representa un fino sintonizador del balance inmunológico Th1/Th2 y, en consecuencia, es una pieza fundamental para el establecimiento de la infección por M. tuberculosis, la modulación de TLR2 por factores de virulencia de M. tuberculosis ajusta las condiciones para facilitar su supervivencia y multiplicación. Por esta razón, al inhibir la expresión del receptor TLR2 la infección por M. tuberculosis activa vías alternas que permiten la respuesta proinflamatoria y el mecanismo microbicida iNOS/óxido nítrico. RESUMEN

Fig. 4 Incremento significativo de la citocina TNF-α en el grupo de macrófagos TLR2-KD.

Fig. 5. Aumento significativo en la expresión de ifn-γ en los grupos de macrófagos con silenciamiento en tlr2.


La tuberculosis pulmonar es la forma clínica más frecuente de la infección causada por Mycobacterium tuberculosis (Mtb). La aparición de cepas multidrogoresistentes (MDR) y extremadamente drogoresistentes (XDR) de Mtb hace necesaria la exploración de nuevas alternativas para el control de la tuberculosis, entre ellas la inmunoterapia. El bacilo de la tuberculosis infecta a macrófagos, interaccionando con los receptores de superficie para inhibir los mecanismos microbicidas y permitir su supervivencia. El objetivo de esta investigación fue evaluar el papel de los receptores de inmunidad innata TLR2 y CD14 de macrófagos THP-1 en la infección por M. tuberculosis. Se utilizó un modelo Knock Down (KD) in vitro, silenciando los genes tlr2 y cd14 de macrófagos de la línea celular THP-1, y se infectaron con Mycobacterium tuberculosis (H37Rv) a razón de 5:1. El silenciamiento del receptor TLR2 reflejó un incremento en la expresión de citocinas proinflamatorias (TNF-α, IFN-γ), lo que activó el mecanismo microbicida iNOS/óxido nítrico para disminuir en más de 95% las UFC (p<0.001). El silenciamiento del receptor CD14 produjo una disminución de 29% 27


en el conteo de UFC con respecto al control, aunque sin actividad del mecanismo microbicida. Estos resultados sugieren que M. tuberculosis utiliza al receptor TLR2 de macrófagos para evadir la respuesta inmunem, y que la presencia de CD14 es importante para establecer la rápida internalización del bacilo. Los resultados obtenidos proporcionan la base de nuevas estrategias de tratamientos moleculares, y silencian genes temporalmente para favorecer una respuesta inmune efectiva que resuelva la infección causada por M. tuberculosis.

<0.001). Silencing CD14 receptor produced a 29% decrease in CFU counts compared to the control, though with inactivity of the microbicide mechanism. These results suggest that M. tuberculosis uses macrophage TLR2 receptor to evade the immune response, and that the presence of CD14 is important for establishing the rapid internalization of bacillus. The results provide the basis for new molecular treatment strategies, temporarily silencing genes to promote an effective immune response to resolve the infection caused by M. tuberculosis.

Palabras clave: Silenciamiento, Receptores, Macrófagos, M. tuberculosis, UFC (Unidades Formadoras de Colonia).

Keywords: Mute, Receivers, macrophages, M. tuberculosis, CFU (Colony Forming Units). BIBLIOGRAFÍA


Pulmonary tuberculosis is the most common clinical form of infection caused by Mycobacterium tuberculosis (Mtb). The emergence of multi-drug-resistant tuberculosis (MDR-TB) and extensively drugresistant tuberculosis (XDR-TB) requires the exploration of new alternatives for the control of tuberculosis, including immunotherapy. The tubercle bacillus infects macrophages by interacting with surface receptors to inhibit the mechanisms allowing their survival and microbicides. The aim of this investigation was to assess the role of innate immunity receptors TLR2 and CD14 on THP-1 macrophage infection with M. tuberculosis. We used an in vitro Knock Down (KD) model, silencing genes TLR2 and CD14 from the macrophage cell line THP-1, and were infected with Mycobacterium tuberculosis (H37Rv) at a ratio of 5:1. TLR2 receptor silencing reflected an increase in the expression of proinflammatory cytokines (TNF-á, IFN-ã), which activated the microbicidal mechanism iNOS / nitric oxide, decreasing CFUs by more than 95% (p 28

Ingo Fricke, Daniell Mitchell, Mycobacteria Induce IFNProduction in Human Dendritic Cells via Triggering of TLR2 The Journal of Immunology, 2006, 176: 5173– 5182.


Lammas, D.A., J.L. Casanova, and D.S. Kumararatne. 2000. Clinical consequences of defects in the IL-12dependent interferon-g (IFN-g) pathway. Clin. Exp. Immunol. 121: 417–425.


Nicholson S, Bonecini-Almeida M. da G., Lapa e Silva, et al. Inducible nitric oxide synthase in pulmonary alveolar macrophages from patients with tuberculosis. J Exp Med 1996;183:2293-2302.


Newport M.J., Huxley C.M., Huston S., et al. A mutation in the interferon-gamma-receptor gene and susceptibility to mycobacterial infection. N Engl J Med. 1996;335:1941–9.


Dorman S.E., Holland S.M.. Mutation in the signaltransducing chain of the interferon-gamma receptor and susceptibility to mycobacterial infection. J ClinInvest. 1998;101:2364–9.


Daffé, M. and Etienne, G. The capsule of Mycobacterium tuberculosis its implications for pathogenicity. Tuberc.



Lung Dis. (1999). 79, 153–169. 7.



January ; 11(1): 40–48.

Sugawara, I., H. Yamada, C. Li, S. Mizuno, O. Takeuchi,

15. Adam J. Gehring, Karen M. Dobos, Mycobacterium tu-

and S. Akira. Mycobacterial infection in TLR2 and TLR6

berculosis LprG (Rv1411c): A Novel TLR-2 Ligand That

knockout mice. Microbiol. Immunol. 2003. 47: 327–336.

Inhibits Human Macrophage Class II MHC Antigen

Dong-Min Shin, Jae-Min Yuk, Hye-Mi Lee, Sang-Hee Lee,

Processing, The Journal of Immunology, 2004; 173: 2660–

Ji Woong Son, Clifford V. Harding, Jin-Man Kim, Robert


L. Modlin, and Eun-Kyeong Jo, Mycobacterial lipoprotein

16. Rish K. Pai, Marilyn Convery, Thomas A. Hamilton, W.

activates autophagy via TLR2/1/CD14 and a functional

Henry Boom, and Clifford V. Harding, Inhibition of IFN-

vitamin D receptor signaling, Cell Microbiol. 2010

˜-Induced Class II Transactivator Expression by a 19-kDa

November ; 12(11): 1648–1665.

Lipoprotein from Mycobacterium tuberculosis: A Potential

Means, T.K., E. Lien, A. Yoshimura, S. Wang, D.T.

Mechanism for Immune Evasion. The Journal of

Golenbock, and M.J. Fenton. 1999. The CD14 ligands

Immunology, 2003, 171: 175-184.

lipoarabinomannan and lipopolysaccharide differ in their

17. Khor C., Chapman S.J., Vannberg F.O. A Mal functional

requirement for Toll-like receptors. J. Immunol. 163:

variant is associated with protection against invasive


pneumococcal disease, bacteremia, malaria and tubercu-

10. Catharina W. Wieland, Gerritje J.W. van der Windt, W.

losis. Nature Genet. 2007 Apr;39(4):523-528.

Joost Wiersinga, Sandrine Florquin and Tom van der Poll,

18. Bafica A., Scanga C.A., Feng C.G., Leifer C., Cheever A.,

CD14 contributes to pulmonary inflammation and

Sher A. TLR9 regulates Th1 responses and cooperates with

mortality during murine tuberculosis. 2008. Blackwell

TLR2 in mediating optimal resistance to Mycobacterium

Publishing Ltd, Immunology, 125, 272–279.

tuberculosis. J Exp Med. 2005 Dec 19;202(12):1715-24.

11. Bernardo, J., A. Billingslea, R. Blumenthal, K. Seetoo, E.

19. Marina A. Dobrovolskaia, Andrei E. Medvedev, Karen E.

Simons, and M. Fenton. 1998. Differential Responses of

Thomas, Natalia Cuesta, Vladimir Toshchakov, Tianbo

Human Mononuclear Phagocytes to Mycobacterial

Ren, Michael J. Cody, Suzanne M. Michalek, Nancy R.

Lipoarabinomannans: Role of CD14 and the Mannose

Rice and Stefanie N. Vogel, Induction of In Vitro

Receptor. Infect Immun. 66: 28 -35.

Reprogramming by Toll-Like Receptor (TLR)2 and TLR4

12. Gregory M. Barton and Jonathan C. Kagan, A cell

Agonists in Murine Macrophages: Effects of TLR

biological view of Toll-like receptor function: regulation

“Homotolerance” Versus “Heterotolerance” on NF-kB

through compartmentalization, Nature Reviews,

Signaling Pathway Components. The Journal of

Imunology, Volume 9, agust 2009.

Immunology, 2003, 170: 508-519.

13. Isabelle Vergne, Jennifer Chua, Hwang-Ho Lee, Megan

20. Brett Verstak, Kamalpreet Nagpal, Stephen P. Bottomley,

Lucas, John Belisle, and Vojo Deretic, Mechanism of

Douglas T. Golenbock, Paul J. Hertzog, and Ashley

phagolysosome biogenesis block by viable Mycobacterium

Mansell, MyD88 Adapter-like (Mal)/TIRAP Interaction

tuberculosis, PNAS, March 15, 2005 , Vol. 102, No. 11,

with TRAF6 Is Critical for TLR2- and TLR4-mediated


NF-kB Proinflammatory Responses, The Journal of

14. Celestine Kan-Sutton, Chinnaswamy Jagannath, and Robert L. Hunter Jr. Trehalose 6,62-dimycolate on the

Biological Chemistry Vol. 284, No. 36, pp. 24192–24203, September 4, 2009.

surface of Mycobacterium tuberculosis modulates surface

21. Berit Carow, Xiang qun Ye, Silencing suppressor of cytokine

marker expression for antigen presentation and

signaling-1 (SOCS1) in macrophages improves

costimulation in murine macrophages Microbes Infect. 2009

Mycobacterium tuberculosis control in an IFN-γ




dependent manner, JBC Papers in Press. Published on May 27, 2011 as Manuscript M111.238287.

25. Raju C. Reddy, Gina H. Chen, Michael W. Newstead, Tom Moore, Xianying Zeng, Kazuhiro Tateda, Theodore

22. Madan-Lala R., Peixoto K.V., Re F., Rengarajan J.

J. Standiford, Alveolar Macrophage Deactivation in Murine

Mycobacterium tuberculosis Hip1 dampens macrophage

Septic Peritonitis: Role of Interleukin 10. Infection and

proinflammatory responses by limiting toll-like receptor

immunity, Mar. 2001, p. 1394–1401.

2 activation, Infect Immun. 2011 Dec;79(12):4828-38.

26. Shawn J. Green, Libia F. Scheller, Michael A. Marietta,

23. Drennan, M.B., D. Nicolle, V.J. Quesniaux, M. Jacobs,

Matthew C. Seguin, Francis W. Klotz, Mike Slayter,

N. Allie, J. Mpagi, C. Fremond, H. Wagner, C. Kirschning,

Barbara J. Nelson and Carol A. Nacy. Nitric Oxide:

and B. Ryffel. Toll-like receptor 2-deficient mice succumb

Cytokine-regulation of nitric oxide in host resistance to

to Mycobacterium tuberculosis infection. Am. J. Pathol.

intracellular pathogens Immunology Letters, 43 (1994) 87-

2004. 164: 49–57.


24. Peterson, P., G. Gekker, S. Hu, W. Sheng, W. Anderson,

27. Zhou R., Wei H., Sun R., Tian Z., Recognition of double-

R. Ulevitch, P. Tobias, K. Gustafson, T. Molitor, and C.

stranded RNA by TLR3 induces severe small intestinal

Chao. CD14 Receptor-Mediated Uptake of Nonopsonized

injury in mice. J Immunol. 2007 Apr 1;178(7):4548-56.

Mycobacterium tuberculosis by Human Microglia. Infect. Immun. 1995. 63(4): 1598-1602.

Recibido: 1 de septiembre de 2012 Aceptado: 1 de septiembre de 2012



&,(1&,$ ;98$1/ $











Aclimatación de tres especies arbóreas al estrés hídrico y su papel como indicadores de sitio en bosques de la Sierra Madre Oriental WIBKE HIMMELSBACH*, EDUARDO JAVIER TREVIÑO GARZA*, HUMBERTO GONZÁLEZ RODRÍGUEZ*, MARCO AURELIO GONZÁLEZ TAGLE* Los bosques mixtos de pino-encino están expuestos a extremas condiciones climáticas de altas temperaturas y baja precipitación pluvial distribuida irregularmente en el transcurso del año. Además, el cambio climático caracterizado por la frecuencia aumentada de sequías (aumento de temperatura promedia global por 0.140.58ºC/década),1 en combinación con un alto potencial de evaporación que contribuye a la acumulación de sales en el suelo, son los principales factores limitantes para el crecimiento, ya que afectan muchos de los procesos fisiológicos de las plantas.2-4 Los efectos del cambio climático y la intervención inadecuada de la población humana están dificultando adicionalmente las condiciones para el crecimiento de las plantas en muchas partes de la Sierra Madre Oriental.5 No se conoce a ciencia cierta la respuesta de los bosques a estos cambios, pero dichos cambios tienen el potencial de modificar altamente la distribución y productividad de las especies arbóreas.5,9-11 El presente artículo está basado en la investigación “Caracterización de bosques mixtos de pino-encino en la Sierra Madre Oriental en México considerando el factor limitante hídrico”, galardonada con el Premio de Investigación UANL 2012, en la categoría de Ciencias de la Tierra y Agropecuarias, otorgado en sesión solemne del Consejo Universitario, en septiembre de 2012.


Entonces, es importante entender la respuesta fisiológica de las especies a factores como el estrés hídrico, el exceso de sales y su gama de tolerancia bajo condiciones ambientales difíciles. De tal manera que se puedan explicar las diferencias entre las especies, con respecto a su distribución y sobrevivencia. Aunado a lo anterior, dicho conocimiento nos permitirá realizar la mejor selección de especies aptas para la restauración ecológica y reforestación de áreas degradadas.3,4,12,13 Al medir los potenciales hídricos (Ψw) y osmóticos (Ψs), es posible valorar el estado hídrico de una planta14 y de esta manera su bienestar. En general, las especies se dejan clasificar en dos categorías, dependiendo del tipo de regulación de su estado hídrico, nombrado regulación isohídrica y no-iso-hídrica.4,15 De ahí se realizó un estudio con el objetivo de identificar, en primer lugar, el tipo de aclimatación al déficit de agua y la gama de tolerancia a altas concentraciones de sales en el suelo de tres especies arbóreas dominantes en la región de la Sierra Madre Oriental. Además se propone determinar el efecto de dos pendientes diferentes en el estado hídrico de las es*Universidad Autónoma de Nuevo León, FCF. 31


El estado hídrico de una planta refleja las condiciones ambientales de su sitio. Las plantas poseen diferentes estrategias para superar periodos de sequía o escasez de agua.

les hídricos (Ψw) y osmóticos (Ψs). El Ψw se midió dos veces por mes, y el Øs se determinó una sola vez en ese lapso. El Ψw se midió dos veces por día, a las 6:00 horas (Ψwpd) y a las 12:00 horas (Ψwmd), con una bomba de presión tipo Scholander.17 Los potenciales osmóticos (Ψspd y Ψsmd) se determinaron con el osmómetro crioscópico (Wescor HR 33T), basado en la medición del punto de congelación.18


Medio ambiente

La colecta de los datos comprendió el periodo de enero-septiembre de 2006, incluyendo diferentes estaciones. Dos sitios, uno con exposición al norte y otro al sur, fueron seleccionados en bosques de pino-encino, dentro del Bosque Escuela (BE) de la Universidad Autónoma de Nuevo León en la Sierra Madre Oriental, a 15 km al suroeste de Iturbide, Nuevo León, México (24° 42’ 23’’ N y 99° 51’ 39’’ W; 1250-1900 msnm). El BE, con una extensión de 1035 hectáreas, se presentó como área ideal, debido a su estado de protección durante aproximadamente 20 años. La precipitación total y la temperatura promedio anual son de 639 mm y 13.9°C, respectivamente. La mayor parte de la precipitación (80%) ocurre de mayo a octubre.16 Los suelos en el BE son delgados y muestran una gran variación en cuanto a colores y fertilidad, aparentemente relacionada con pendiente, exposición, vegetación y geología.

Datos microclimáticos, como temperatura del aire (°C), humedad relativa del aire (%) y precipitación (mm) se midieron simultáneamente en cada sitio. El déficit de vapor de presión (DVP) se calculó mediante los datos de temperatura y de la humedad relativa. La humedad relativa del suelo se calculó en cada sitio y fecha de muestreo, en las siguientes profundidades: 0-10 cm, 20-30 cm, 40-50 cm y 60-70 cm.

pecies y sus estrategias para evitar los daños causados por sequía. Hipótesis

Mediciones de los potenciales hídricos En cada exposición se tomaron cinco individuos jóvenes de tres diferentes especies: Pinus pseudostrobos, Quercus canbyi y Juniperus flaccida. En estos árboles jóvenes se realizaron las mediciones de los potencia32

Análisis estadístico La suposición de normalidad se examinó con la prueba de Kolmogorov-Smirnov para todos los datos. Las diferencias entre las dos pendientes (sitios N y S), las especies arbóreas y las fechas de muestreo (enero hasta agosto de 2006) fueron examinadas con un análisis de varianza de tres factores (ANOVA de tres factores), considerando pendiente y especie como factores entre los tratamientos y la fecha de muestreo (FM) como factor dentro de los tratamientos.19 Se hicieron análisis separados para los datos del amanecer y del mediodía. La distribución normal de los datos y homogeneidad de la varianza fueron comprobadas antes del ANOVA. Diferencias entre las condiciones meteorológicas en cada sitio, se compararon con un ANOVA de un CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


factor después de comprobar la distribución normal y homogeneidad de varianza de los datos.19,20 Las diferencias (FM) significativas entre los ˜spd y ˜smd de diferentes temporadas se comprobaron con la prueba de Wilcoxon, comparando los datos de una fecha de muestreo relativamente seco (abr-5) y una húmeda (ago-16/17). Los coeficientes de correlación entre las variables ambientales y los potenciales hídricos y osmóticos se cuantificaron con un análisis de correlación de Spearman, debido a que se rechazó la hipótesis nula de la distribución normal de los datos (p<0.05). Para este análisis se consideraron datos reales de cada especie de los dos sitios a una escala temporal.19,20 RESUL TADOS Y DISCUSIÓN RESULT Condiciones ambientales durante el periodo de investigación La figura 1 muestra las condiciones ambientales durante el estudio. En general, se disminuyó la disponibilidad de agua en el suelo con el incremento en la temperatura y el déficit de presión de vapor. Sin embargo, especialmente en la profundidad de suelo superior (0-10 cm), se presenta un aumento de agua disponible en el suelo después del inicio de las precipitaciones en mayo. La comparación estadística de los dos sitios no reveló ninguna diferencia significativa en las variables meteorológicas (ANOVA: p>0.18). No obstante, la comparación estadística del contenido de agua en el suelo resultó significativamente diferente, con una disponibilidad de agua mayor en el sitio norte que en el sur (tabla I). Las diferencias entre distintas profundidades de suelo no fueron estadísticamente significativas.


Fig.1. Variación estacional de la temperatura promedia del aire (ºC), humedad relativa del aire (%), déficit de presión de vapor (DPV; kPa), precipitación actual (mm) y humedad del suelo (%) a cuatro profundidades (n=5), durante el estudio desde febrero hasta agosto de 2006; las barras representan errores estándar.



Variaciones estacionales del potencial hĂ­drico y osmĂłtico

Especies no-isohídricas en comparación, permiten que los valores del mediodía (Ψwmd) bajen notablemente en el transcurso del día y aùo, respondiendo de esta manera a sequías.15 Entonces, J. flaccida presentó fluctuaciones típicas de especies noisohídricas (figura 2). Q. canbyi, en comparación, no se deja clasificar tan obviamente (figura 2). De acuerdo con la bibliografía, esta especie se maneja generalmente como una especie que posee una regulación isohídrica; 21,22 sin embargo, en el estudio presentó un comportamiento mås bien noisohídrica.4

El ANOVA factorial revelĂł diferencias significativas en los Ψw y Ψs entre las dos exposiciones, tres especies y fechas de muestreo (tabla I). La Ăşltima variable tuvo mayor influencia en los potenciales seguido por â&#x20AC;&#x153;especieâ&#x20AC;? y â&#x20AC;&#x153;exposiciĂłnâ&#x20AC;?. En general, todas las especies mostraron valores altos al amanecer y bajos al mediodĂ­a, los cuales declinaron progresivamente con el incremento de la sequĂ­a y pĂŠrdida de agua en el suelo (figuras 2 y 3). Fluctuaciones estacionales y diarias de los Ψw y Ψs fueron mĂĄs altos en la especie J. flaccida y Q. canbyi que en P. Pseudostrobus, la cual mantuvo valores mĂĄs equilibrados durante condiciones secas (figuras 2 y 3). Los potenciales Ψw y Ψs de J. flaccida y Q. canbyi presentaron una correlaciĂłn con el contenido de agua gravimĂŠtrico en el suelo (tabla II), mientras que los Ă&#x2DC;s de P. pseudostrobus mostraron muy poca correlaciĂłn con las variables ambientales. Debido a ello, P. pseudostrobus fue identificado como especie isohĂ­drica, ya que muchas veces regula su estado hĂ­drico a travĂŠs de sus estomas.15

CONCL USIONES CONCLUSIONES La regulaciĂłn del estado hĂ­drico durante periodos de sequĂ­a fue muy diferente en las tres especies nativas al igual que sus potenciales hĂ­dricos y osmĂłticos en el transcurso de ocho meses en la Sierra Madre Oriental. Mientras que la especie P. pseudostrobus mostrĂł un comportamiento tĂ­pico para plantas isohĂ­dricas; J. flĂĄccida y Q. canbyi regularon su estado hĂ­drico de manera no-isohĂ­drica. Una regulaciĂłn

Tabla I. Resultados de la ANOVA de tres factores: especie (entre tratamientos), exposiciĂłn (Exp: entre tratamientos) y fecha de muestreo (FM: dentro de los tratamientos), grados de libertad (df) y coeficiente de determinaciĂłn (r2). 


















([S )0







$129$U DGM 










































CIENCIA UANL / AĂ&#x2018;O 15, No. 60, OCTUBRE - DICIEMBRE 2012


Tabla II. Valores del coeficiente de correlaciĂłn de Spearman (rho) de tres especies arbĂłreas para potenciales hĂ­dricos (Ă&#x2DC;wpd y Ă&#x2DC;wmd) y osmĂłticos (Ă&#x2DC;spd y Ă&#x2DC;smd); en relaciĂłn con el contenido de agua gravimĂŠtrico en el suelo (CAGS) a cuatro profundidades, la temperatura del aire, humedad relativa del aire (HR) y dĂŠficit de presiĂłn de vapor (DPV) y la suma mensual de precipitaciĂłn. 


































































Fecha muestreo (mes-dĂ­a 2006) Fig. 2. VariaciĂłn estacional de los potenciales hĂ­dricos (Ď&#x2022;swpd y Ď&#x2022;swmd), asĂ­ como la diferencia entre el potencial del amanecer y del mediodĂ­a (Ă&#x201E;Ď&#x2022;sw) para tres especies medidas en dos exposiciones (norte y sur); valores promedios (n=5), las barras representan errores estĂĄndar.

CIENCIA UANL / AĂ&#x2018;O 15, No. 60, OCTUBRE - DICIEMBRE 2012



Fig. 3. Variación estacional de los potenciales osmóticos (ϕspd y ϕssmd), así como la diferencia entre el potencial del amanecer y del mediodía (Äϕss) de tres especies medidas en dos exposiciones (Norte y Sur); valores promedios (n=5), barras representan errores estándar.

isohídrica tiene ventajas durante severas sequías de poca duración, mientras que las plantas noisohídricas poseen ventajas durante largas sequías de poca intensidad.23 En la práctica, significa que árboles isohídricos se recomiendan para reforestaciones en áreas donde se esperan sequías severas, pero de corta duración; y árboles no-isohídricos en áreas propensas a sequías largas de menor intensidad.4 Sin embargo, para hacer conclusiones precisas sobre el desarrollo de los bosques en la Sierra Madre Oriental, se requieren estudios a largo plazo, incluyendo variables fisiológicas adicionales, como la conduc36

ción de estomas, actividad fotosintética y asimilación de carbono, así como inventarios forestales detallados, monitoreo de la distribución espacial y sobrevivencia de los árboles y de su regeneración. RESUMEN La disponibilidad de agua y el exceso de sales son factores limitantes en los bosques mixtos de pinoencino. Con la intención de caracterizar la adaptación de especies nativas a los factores antes mencionados, los potenciales hídricos (Øw) y osmóticos (Øs) CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


de Juniperus flaccida, Pinus pseudostrobus y Quercus canbyi fueron medidos bajo condiciones naturales húmedas y secas en dos diferentes exposiciones. Los resultados mostraron que las especies poseen diferentes estrategias para superar sequías. P. pseudostrobus fue identificado como especie isohídrica, mientras que J. flaccida y Q. canbyi regularon su estado hídrico de manera no-isohídrica. El tipo de estrategia para superar sequías podría ser un factor crítico para la supervivencia de las plantas en el contexto del cambio climático. Sin embargo, para conclusiones precisas sobre las ventajas y desventajas de cada tipo, se requieren investigaciones adicionales a largo tiempo.

J.M., Hu, A., Buja, L.E., Strand, W.G. y H. Teng (2005). How much more global warming and sea level rise? Science 307 (5716), 1769-1772. 2.

Indikatoren für den tropischen Standort. Shaker Verlag, Aachen. 3.

The adaptation to water stress of five plant species (Acacia rigidula, Arbutus xalapensis, Juniperus flaccida, Pinus pseudostrobus, Quercus canbyi) was studied using two aspects, measuring plant water (Ψw) and osmotic potentials (Ψs). The statistical analysis proved the importance of soil-water availability. In the case of Ψs, climatic variables were significantly related to most of the potentials. The influence of environmental variables in leaf water potentials was stronger at the southern aspect, and in the species Q. canbyi and J. flaccida. Due to their dynamic reaction to environmental changes, the species seemed to have different strategies of adaptation to water stress.

climático mundial: origen y consecuencias. CiENCiA UANL 6: 377-385. 4.

Himmelsbach, W., Treviño-Garza, E.J., González-Rodríguez, H., González-Tagle, M.A., Gómez-Meza, M.V., Aguirre Calderón, O.A., Estrada-Castillón, A.E. y R. Mitlöhner (2012). Acclimatation of three co-occurring tree species to water stress and their role as site indicators in mixed pine-oak forests in the Sierra Madre Oriental, Mexico. Eur J Forest Res 131: 355-367.


González Tagle, M.A., Himmelsbach, W., Jiménez Pérez, J. y B. Müller-Using (2005). Reconstruction fo fire history in pine-oak forests in the Sierra Madre Oriental, México. Forstarchiv 76 (4): 138-143.


Domínguez, P.A. y J.J. Návar (2000). Einfluss der Pflanzenqualität von Pinus pseudostrobus Lindl. auf Überlebensrate und Wuchsleistung bei Aufforstungen in der östlichen Sierra Madre Mexikos. Forstarch 71: 10-13.


Cantú, I. y H. González (2002). Propiedades hidrológicas del dosel de los bosques de pino-encino en el noreste de México. Cienc UANL 5: 72-77.


Ricker, M., Gutiérrez García, G. Y D.C Daly (2007). Modeling long-term tree growth curves in response to warming climate: test cases from a subtropical mountain forest and a tropical rainforest in Mexico. Can J For Res 37: 977-989.


Keywords: Water stress, Water availability, Environmental changes.

González-E.M., Jurado, E., González-E.S., Aguirre Calderón, O., Jiménez Pérez, J. y J. Návar (2003). Cambio

Palabras clave: Estrés hídrico, Disponibilidad de agua, Cambios ambientales. ABS TRA CT ABSTRA TRACT

Mitlöhner, R. (1998). Planzeninterne Potentiale als

Ramírez-Marcial, N., González-Espinosa, M. y G. Williams-Linera (2001). Anthropogenic disturbance and tree diversity in Montane Rain Forests in Chiapas, Mexico. For Ecol Manag 154: 311-326.


10. Jurado, E., Jiménez, J. y E. Treviño (1998). Biodiversidad en peligro. CiENCiA UANL 1: 43-47.


Meehl, G.A., Washington, W.M., Collins, W.D., Arblaster,


11. Kramer, P.J. y J.S. Boyer (1995). Water relations of plants



and soils. Academic Press, San Diego, CA, pp. 489. 12. McDowell, N., Pockman, W.T., Allen, C.D., Breshears, D.D., Cobb, N., Kolb, T., Plaut, J., Sperry, J., West, A., Williams, D.G. y E.A. Yepez (2008). Mechanisms of plant

16. Zar, J.H. (1999). Biostatistical analysis. Prentice-Hall Inc, New Jersey. 17. [20] Crawley, M.J. (2007). The R book. John Wiley, New York.

survival and mortality during drought: why do some plants

18. [Kolb, T.E. y J.E. Stone (2000). Differences in leaf gas

survive while others succumb to drought? New Phytol 178:

exchange and water relations among species and tree sizes


in an Arizona pine-oak forest. Tree Physiol 20: 1-12.

13. Cantú Silva, I. y H. González Rodríguez (2002). Propie-

19. Otieno, D.O., Schmid,t M.W., Adiku, A. y J. Tenhunen

dades hidrológicas del dosel de los bosques de pino-encino

(2005) Physiological and morphological response to water

en el noreste de México. CiENCiAUANL 5 (1), 72-77.

stress in two Acacia species from contrasting habits. Tree

14. Scholander, P.F., Hammel, H.T., Bradstreet, E.D. y E.A. Hemmingsen (1965). Sap pressure in vascular plants. Sci 148: 339-346.

Physiol 25: 361-371. 20. Breshears, D.D., Myers, O.B., Meyer, C.W., Barnes, F.J., Zou, C.B., Allen, C.D., McDowell, N.G. y W.T. Pockman

15. Wilson, J.R., Fisher, M.J., Schulze, E.D., Dolby, G.R. y

(2009). Tree die-off in response to global change-type

M.M. Ludlow (1979). Comparison between pressure-

drought: mortality insights from a decade of plant water

volume and dewpoint-hygrometry techniques for

potential measurements. Front Ecol Environ 7: 185-189.

determining the water relations characteristics of grass and legume leaves. Oecol (Berl.) 41: 77-88.

Recibido: 1 de septiembre de 2012 Aceptado: 1 de septiembre de 2012



&,(1&,$ ;98$1/ $











Nuevos óxidos multifuncionales Sm2FeTaO7 y Sm2InTaO7 para la descontaminación de agua vía fotocatálisis heterogénea MAYRA Z. FIGUEROA TORRES*, LETICIA M. TORRES GUERRA*, MIGUEL A. RUIZ GÓMEZ*, ISAÍAS JUÁREZ RAMÍREZ*, CHRISTIAN GÓMEZ SOLÍS*

En la actualidad, la investigación y la generación de nuevos materiales constituyen un pilar básico para sustentar el desarrollo de nuevos productos y servicios que contribuyan de manera decisiva al incremento de la calidad de vida de nuestra sociedad y a la construcción de un futuro sustentable. Una problemática que incide gravemente en la calidad de vida de millones de personas a nivel mundial es la contaminación del agua por los procesos industriales productivos, con contaminantes orgánicos e inorgánicos. La fotocatálisis heterogénea es uno de los procesos que más interés han despertado, debido a que mediante reacciones de oxidación y reducción elimina diversos contaminantes. Por otro lado, la posibilidad de aplicar la radiación solar como fuente de energía le otorga un importante y significativo valor medioambiental posicionando al proceso como un claro ejemplo de tecnología sustentable. Sin embargo, la eficiencia del proceso fotocatalítico, así como la cantidad de radiación solar que puede ser aprovechada, depende

de las características y propiedades del material utilizado como semiconductor. De ahí la gran importancia de desarrollar materiales semiconductores avanzados que actuen como fotocatalizadores. Entre los óxidos metálicos ternarios, los compuestos con fórmula general, A2B2O7 (A y B son iones metálicos), representan una familia isoestructural al mineral pirocloro, (NaCa)(NbTa)O6F/OH. Estos compuestos son predominantemente cúbicos y de naturaleza iónica; además, en su estructura cristalina se utiliza una amplia variedad de elementos químicos en los sitios A y B, siempre y cuando se cumplan los criterios de radio iónico y neutralidad de cargas.1-6 Los compuestos A2B2O7 presentan una gran variedad de interesantes propiedades físicas y químicas, así como importantes aplicaciones tecnológicas. Dentro de esta gran familia de óxidos, se encuentran los compuestos con fórmula , los cuales han recibido especial atención en aplicaciones fotocatalíticas. De acuerdo con la bibliografía, la mayoría de los óxidos tipo pirocloro, con fórmula A2B2O7 y los del tipo , se sintetizan mediante reacción

El presente artículo está basado en la investigación “Nuevos óxidos multifuncionales Sm2FeTaO7 y Sm2InTaO7 para la descontaminación de agua vía fotocatálisis heterogénea”, galardonada con el Premio de Investigación UANL 2012, en la categoría de Ciencias Exactas, otorgado en sesión solemne del Consejo Universitario, en septiembre de 2012.

* Universidad Autónoma de Nuevo León. Departamento de Ecomateriales y Energía-FIC.




en estado sólido, a altas temperaturas durante largos periodos de tiempo; obteniéndose sólidos altamente cristalinos, pero con baja área superficial y tamaño de partícula grande.5,7-11 Por otro lado, la ruta sol-gel permite obtener materiales bajo condiciones moderadas de reacción, y es posible controlar la estructura cristalina, área superficial, así como el tamaño y forma de los materiales.3,12,13 El presente proyecto se enfoca al desarrollo de un nuevo material Sm2FeTaO7, con base en dos metodologías de síntesis: la reacción en estado sólido y la técnica sol-gel. Se resolvió su estructura cristalina y se estudiaron sus propiedades fisicoquímicas. La actividad fotocatalítica se evaluó en la degradación del colorante índigo carmín, bajo la exposición directa a la radiación de luz solar. Además, se realizó la síntesis por primera vez del Sm2InTaO7, mediante la ruta sol-gel. Se estudiaron sus propiedades fisicoquímicas y se evaluó por primera vez su actividad fotocatalítica, para la degradación del colorante cristal violeta y la reducción del cromo (VI), presentes en disolución acuosa. METODOL OGÍA EXPERIMENT AL METODOLOGÍA EXPERIMENTAL Síntesis del Sm2FeTaO7 y Sm2InTaO7 por reacción en estado sólido Para la reacción, los óxidos Sm2O3, Fe2O3, In2O3 y Ta2O5 (Sigma-Aldrich, pureza > 99.9%) se usaron como reactivos, dependiendo del compuesto a sintetizar. El procedimiento fue el mismo en ambos casos. Los polvos se secaron a 200ºC, durante cuatro horas, antes de la síntesis. Posteriormente, las cantidades estequiométricas de cada óxido se pesaron y se mezclaron con acetona. La molienda se realizó hasta la evaporación completa de la acetona. Cada mezcla de los sólidos obtenidos se colocó, de manera separada, en un crisol de platino, y se efectuaron 40

diversos tratamientos térmicos en atmósfera de aire con una rampa de calentamiento de 1ºC min-1, hasta completar la reacción. Síntesis del Sm2FeTaO7 y Sm2InTaO7 por el método sol-gel Durante el proceso sol-gel, la cantidad estequiométrica de acetilacetonato de fierro (o acetilacetonato de indio) se disolvió en acetilacetona. La mezcla se mantuvo bajo agitación magnética y reflujo a 70ºC por una hora. Después, el acetato de samario se disolvió en una mezcla de etilenglicol y agua, y se puso en reflujo a 70ºC por una hora; posteriormente, se añadió ácido acético hasta obtener una disolución incolora. Al mismo tiempo se mezcló el etóxido de tántalo con etanol. Ambas disoluciones, la de samario y la de tántalo, se agregaron lentamente a la disolución de acetilacetonato de fierro (o acetilacetonato de indio). La disolución resultante se mantuvo en reflujo a 70ºC por 48 horas; concluido dicho tiempo, el pH se ajustó a 10, usando una disolución de hidróxido de amonio y se mantuvo en reflujo por otras 48 horas. Finalmente, la dispersión resultante se secó a 100ºC, durante 24 horas para obtener el material fresco. El material fresco se trató a diferentes temperaturas en atmósfera de aire con una rampa de calentamiento de 1ºC min-1, hasta completar la reacción. Impregnación del Sm2FeTaO7 Los materiales de Sm2FeTaO7 se impregnaron con CuO. Para esto, se preparó una disolución acuosa de concentración conocida de cobre (II), partiendo del nitrato de cobre (II). Posteriormente, se pesó de manera separada un gramo de cada material de Sm2FeTaO7, y se le añadió a cada uno el volumen necesario de la disolución de cobre para obtener 1% teórico de CuO impregnado. Cada dispersión CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


se calentó a 100ºC hasta la evaporación del solvente. Los polvos obtenidos se trataron térmicamente a 400ºC durante una hora, para obtener el CuO impregnado en la superficie del Sm2FeTaO7. CARA CTERIZA CIÓN CARACTERIZA CTERIZACIÓN Con el objetivo de determinar las características estructurales, las propiedades ópticas, morfológicas y texturales de los materiales sintetizados, se realizó la caracterización fisicoquímica mediante las técnicas de difracción de rayos X en polvos (DRX), el método de refinamiento de Rietveld, microscopía electrónica de transmisión (MET), espectroscopía UVvis para sólidos, microscopía electrónica de barrido (MEB) y fisisorción de nitrógeno.

Para el seguimiento de la reacción, se tomaron alícuotas periódicamente durante un total de diez horas, después se centrifugaron para remover las partículas del fotocatalizador. El líquido se analizó mediante un espectrofotómetro UV-vis, para determinar el porcentaje de degradación del colorante en función del tiempo, y se tomó como referencia la banda de absorción a 610 nm. Todas las pruebas se realizaron de manera simultánea para tener las mismas condiciones experimentales. Los datos sobre la radiación solar los proporcionó el Sistema Integral de Monitoreo Ambiental (SIMA) de Monterrey, Nuevo León, México. Degradación del colorante cristal violeta y reducción de cromo (VI) usando Sm2InTaO7


Degradación del cristal violeta

Degradación del colorante índigo carmín usando Sm2FeTaO7

Las pruebas se realizaron en un reactor de laboratorio equipado con una lámpara UV, tipo pluma (UV Products, 254 nm y 4,400 µW/cm2), la cual se encuentra inmersa en la disolución mediante un tubo de cuarzo. Para los experimentos, se preparó un litro de una disolución acuosa de 10 ppm del colorante cristal violeta. El pH de la disolución se ajustó a tres, adicionando ácido sulfúrico concentrado. Después, 150 mL de la disolución se mezclaron con 100 mg del Sm2InTaO7. La dispersión se mantuvo bajo agitación en la oscuridad, durante 30 minutos, para establecer el equilibrio adsorción-desorción, y en seguida se encendió la lámpara para dar inicio a la reacción. Para el seguimiento de la reacción, se tomaron alícuotas cada diez minutos, las cuales se centrifugaron para remover las partículas del fotocatalizador. El líquido se analizó mediante un espectrofotómetro UV-vis, para determinar el porcentaje de degradación del cristal violeta en función del tiempo, to-

Las pruebas se realizaron bajo radiación de luz solar en la ciudad de Monterrey, Nuevo León, México, utilizando botellas de vidrio como reactores. Durante los experimentos, 400 mg del material se dispersaron en 400 mL de una disolución acuosa del colorante índigo carmín, con una concentración de 10 partes por millón (ppm). Las dispersiones se mantuvieron bajo agitación en la oscuridad, durante 60 minutos, para establecer el equilibrio adsorcióndesorción, y en seguida se expusieron a la radiación de luz solar para dar inicio a la reacción. Como prueba de control (fotólisis), se colocó una botella con solamente 400 mL de la disolución acuosa del colorante índigo carmín. Durante el experimento, la temperatura de las disoluciones se mantuvo a 30ºC, mediante el flujo de agua fría por la parte externa de las botellas.




mando como referencia la banda de absorción máxima (590 nm). Además, se le dio seguimiento al proceso de mineralización con un equipo analizador de carbono orgánico total (COT). Reducción del cromo (VI) Las pruebas se efectuaron con el reactor descrito antes. Para este caso, se preparó un litro de una disolución acuosa de 20 ppm de cromo (VI); con la cantidad necesaria de dicromato de potasio, la disolución se ajustó a pH=2, adicionando ácido sulfúrico concentrado. Luego, 150 mL de la disolución se mezclaron con 100 mg del Sm2InTaO7. La dispersión se mantuvo bajo agitación en la oscuridad, durante 30 minutos, para establecer el equilibrio adsorción-desorción, y después se encendió la lámpara para iniciar la reacción. Durante la reacción, se tomaron alícuotas cada 20 minutos, y se centrifugaron para remover las partículas del fotocatalizador. El líquido se analizó mediante un espectrofotómetro UV-vis, para determinar el porcentaje de remoción del cromo (VI) en función del tiempo, y se tomó como referencia la banda de absorción a 348 nm.

tó una serie de reflexiones bien definidas a una temperatura de 800ºC, dichas reflexiones se asociaron a la estructura del Sm2FeTaO7. En la figura 1 se aprecian los patrones de DRX, son muy similares en ambos materiales, los cuales muestran solamente la presencia de la fase pura del Sm2FeTaO7. La diferencia observada en la intensidad y la anchura de los picos se debe a los distintos tratamientos térmicos realizados para cada ruta de síntesis. Estos resultados indican que es factible la síntesis del compuesto Sm2FeTaO7 por ambos métodos, estado sólido y sol-gel. En particular, mediante el método sol-gel, dicho compuesto se obtiene a una temperatura mucho más baja (800ºC), comparado con el método de estado sólido (1400ºC). En el método sol-gel se presenta una reactividad homogénea entre los reactivos organometálicos, los cuales producen un óxido amorfo como precursor; posteriormente, bajo tratamientos térmicos moderados es posible obtener el material cristalino. De acuerdo con los patrones de DRX obtenidos para el Sm2FeTaO7, éstos muestran considerables diferencias, comparados con los que presentan los materiales tipo pirocloro con estructura cúbica. Por lo tanto, se puede asumir que la fase pura del nuevo

RESUL TADOS Y DISCUSIÓN RESULT Caracterización del Sm2FeTaO7 Difracción de rayos X en polvos El Sm2FeTaO7 se obtuvo por reacción en estado sólido y el método sol-gel. Mediante la reacción por estado sólido, el compuesto comenzó a cristalizar a 1200ºC y la intensidad de las reflexiones aumentó, con respecto a la temperatura hasta la obtención de la fase pura a 1400ºC y 36 horas de reacción. Por otro lado, el material sintetizado por sol-gel presen42

Fig. 1. Patrones DRX obtenidos del refinamiento de Rietveld del Sm2FeTaO7, sintetizado mediante: (a) estado sólido y (b) sol-gel.



compuesto Sm2FeTaO7 se obtiene y Êsta se cristaliza en un sistema diferente al cúbico. Los compuestos con fórmula general A2BB´O7 se consideran óxidos tipo pirocloro, y la gran mayoría posee una estructura cúbica (grupo espacial Fd-3m).3-10,12,14 Sin embargo, dependiendo de los elementos que se utilicen en los sitios A o BB´, estos compuestos tambiÊn pueden cristalizar en estructuras de menor simetría, tales como el Bi2FeVO7 y Bi2AlVO7 (tetragonal),15,16 Er 2 Mn 2/3 Re 4/3 O 7 (trigonal), 17,18 Y 2 YbSbO 7 (ortorrómbica),11 o Y2FeMoO7 y Bi2Zn2/3Nb4/3O7 (monoclínica).19,20

Tabla I. Datos cristalogrĂĄficos obtenidos de los resultados del refinamiento de Rietveld del Sm2FeTaO7.

(VWDGRVyOLGR 6ROJHO Â&#x17E;& Â&#x17E;& D c        E c        F c        Č&#x2022; Â&#x192;        *UXSRHVSDFLDO &F &F =   6LVWHPD 0RQRFOtQLFR 0RQRFOtQLFR 5ZSÂś     Ȥ   3DUiPHWUR

DeterminaciĂłn de la estructura cristalina La estructura cristalina del Sm2FeTaO7 se determinĂł mediante el refinamiento de Rietveld con un modelo teĂłrico para la estructura monoclĂ­nica con grupo espacial C/2c (No. 15). 19 Para refinar dicho modelo, se considerĂł que los iones Fe3+ y Ta5+ ocupan sitios atĂłmicos equivalentes en la misma proporciĂłn cada uno de ellos. En la figura 1 se presentan los resultados del refinamiento de Rietveld, en donde se aprecia que los difractogramas experimental y calculado son muy similares, indicando que todas las reflexiones pueden ser completamente indexadas para una estructura cristalina monoclĂ­nica, con grupo espacial C/2c. En la tabla I se presentan los datos cristalogrĂĄficos y los factores de confiabilidad obtenidos. Se observa que los parĂĄmetros de celda obtenidos para el material sintetizado por estado sĂłlido y sol-gel son muy similares. Dichos valores van de acuerdo a los datos previamente reportados en bibliografĂ­a para compuestos similares con estructura monoclĂ­nica.9,20 La estructura monoclĂ­nica del Sm2FeTaO7 exhibe capas alternadas de Sm-O y Fe/Ta-O (figura 2(a)). La capa de Sm-O estĂĄ conformada por cationes de Sm1 y Sm2, ordenados y coordinados a ocho y siete CIENCIA UANL / AĂ&#x2018;O 15, No. 60, OCTUBRE - DICIEMBRE 2012

Fig. 2. Vista en poliedros de la estructura monoclĂ­nica del compuesto Sm2FeTaO7; los octaedros de Fe/Ta1 y Fe/Ta3 estĂĄn indicados. En (a) los ĂĄtomos de Sm y Fe/Ta2 se representan como esferas rojas y amarillas, respectivamente. En (b) los ĂĄtomos Sm, Fe/Ta2 y O, se representan como esferas rojas, amarillas y negras, respectivamente.

ĂĄtomos de oxĂ­geno, respectivamente. Por otro lado, en la capa de Fe/Ta-O, los cationes Fe/Ta1 y Fe/Ta3 estĂĄn coordinados a seis ĂĄtomos de oxĂ­geno, que forman octaedros irregulares interconectados mediante una cadena tipo BTH (bronces de tungsteno hexagonales), mientras que los ĂĄtomos Fe/Ta2 se localizan cerca del centro del hexĂĄgono (figura 2(b)). La cadena BTH es fundamental en las estructuras relacionadas con los Ăłxidos tipo pirocloro.1,8,3 En la figura 2(b) se observa claramente que el hexĂĄgono que se forma es irregular y muy distorsionado. EstĂĄ bien documentado que la relaciĂłn de los radios rA/rB, en los compuestos tipo pirocloro y sus 43


estructuras relacionadas con fórmula A2BB´O7, determina el sistema en que cristalizan.3,6,21 Luan et al.15,16 reportan que el Bi2FeTaO7 (rA/rB = 1.82) con estructura cúbica cambió a estructura tetragonal, cuando los sitios BB´ fueron sustituidos por distintos cationes, al obtenerse los compuestos Bi2FeVO7 (rA/rB = 1.97) y Bi2AlVO7 (rA/rB = 2.18). El compuesto Sm2FeTaO7 (rA/rB = 1.68) cristalizó con una estructura monoclínica (grupo espacial C2/c), debido a la sustitución del sitio B del compuesto tipo pirocloro Sm2InTaO7 (rA/rB = 1.50) con estructura cúbica.10 La pequeña diferencia de rA/rB generada cuando el indio (In) fue sustituido por el fierro (Fe) es suficiente para inducir una distorsión en los octaedros, al provocar el cambio en la estructura cristalina. Ambas estructuras, cúbica (Fd-3m) y monoclínica (C2/c), son muy similares.19,20 Para los compuestos A 2 BB´O 7 con estructura monoclínica, los octaedros [BO6- B´6] forman intersticios de tres y seis miembros, muchas veces referido como capa BTH, la cual equivale a la capa octaédrica {111}, presente en la estructura tipo pirocloro cúbica. La estructura cúbica se basa en un arreglo tridimensional de bloques BTH, mientras que en la estructura monoclínica hay un arreglo en dos dimensiones. En la estructura monoclínica, los intersticios hexagonales formados por los octaedros los ocupan los cationes B y B´, los cuales están completamente ordenados en sus sitios, a diferencia de la estructura cúbica.17

de zona [100] y [-110]. Todas las reflexiones de estos patrones de difracción fueron indexadas a la estructura cristalina monoclínica refinada (grupo espacial C2/c). Estos resultados son similares a los reportados previamente.19,22

Fig. 3. Patrones de difracción de electrones del Sm2FeTaO7 sintetizado por estado sólido.

Análisis por microscopía electrónica de barrido Las micrografías obtenidas presentan considerables diferencias con respecto al tamaño de partícula entre ambos métodos de síntesis, como se muestra en la figura 4. Se observa que mediante el método solgel se obtienen partículas de aproximadamente 100150 nm, que forman pequeños aglomerados similares a una esponja debido a la atracción entre ellas. Por el contrario, el material obtenido mediante el método de estado sólido exhibe partículas con una superficie lisa y tamaño de alrededor de 2-3µm, debido al crecimiento entre partículas. Esto se atribuye a que la reacción en estado sólido se lleva a

Análisis por microscopía electrónica de transmisión Con el objetivo de confirmar los resultados del refinamiento de Rietveld, los cuales indicaron que el Sm2FeTaO7 posee una estructura monoclínica, se analizaron los patrones de difracción de electrones obtenidos por MET para el material sintetizado por estado sólido. En la figura 3 se muestran los patrones de difracción de electrones obtenidos de los ejes 44

Fig. 4. Imágenes de MEB del Sm2FeTaO7.



cabo a 1400ºC, y favorece el sinterizado de partículas y el rápido incremento de su tamaño. En el caso de los materiales Sm2FeTaO7 impregnados con CuO, la cuantificación se realizó mediante el mapeo en cinco zonas aleatorias para obtener el promedio. El contenido de CuO presente en el Sm2FeTaO7 obtenido fue de 1.2 y 1.1% para el material sintetizado por estado sólido y sol-gel, respectivamente. Espectroscopía UV-vis para sólidos La energía de banda prohibida del Sm2FeTaO7 se determinó mediante la relación de Tauc,23 los valores de Eg obtenidos fueron de 1.99 eV y 2.01 eV para los materiales sintetizados por estado sólido y sol-gel, respectivamente. Los resultados anteriores revelan que el Sm2FeTaO7 puede activarse bajo longitudes de onda menores a 620 nm; por lo tanto, es factible el uso de luz visible para su activación. La capacidad del Sm2FeTaO7 para activarse bajo luz visible se relaciona directamente con la presencia de fierro (Fe) en su composición química. El fierro actúa como donador de electrones, y sus electrones 3d son fácilmente excitados por la luz visible,12,24,25 y genera una disminución del Eg en los compuestos que lo contienen. Área superficial específica Los resultados de área superficial se presentan en la tabla II, en la que se aprecia que el material sintetizado por sol-gel posee un área superficial diez veces mayor, comparado con el material sintetizado por estado sólido. Este resultado corrobora la diferencia en el tamaño de partículas observado por MEB. Asimismo, se observa que la variación en el área superficial después de la impregnación con CuO no fue significativa.


Tabla II. Área superficial de los materiales de Sm2FeTaO7.





Caracterización del Sm2InTaO7 Difracción de rayos X en polvos El compuesto Sm2InTaO7 fue previamente reportado por el método de reacción en estado sólido.10 Por tal motivo, en esta investigación se realizó la síntesis del Sm2InTaO7, por medio de la ruta sol-gel, y para fines de comparación también se realizó la síntesis por reacción en estado sólido. El análisis de DRX a los diferentes tratamientos térmicos del material preparado por sol-gel revela que el Sm2InTaO7 puede obtenerse de forma pura a 1200ºC y doce horas de reacción. Por lo tanto, mediante la ruta sol-gel es posible obtener dicho óxido a condiciones moderadas de reacción, comparadas con la reacción en estado sólido, 1400ºC y 72 horas. Determinación de parámetros estructurales El Sm2InTaO7 sintetizado por ambos métodos fue refinado mediante el método de Rietveld, para ello se usó el modelo teórico para el sistema cúbico y grupo espacial Fd-3m previamente reportado.10 Para el refinamiento, se consideró que los iones In3+ y Ta5+ están ocupando sitios atómicos equivalentes en la misma proporción cada uno. En la figura 5 se presentan los difractogramas obtenidos del refinamiento del Sm2InTaO7 preparado por sol-gel. Se observa 45


que el difractograma experimental y el calculado son similares, lo cual es indicativo de que todas las reflexiones pueden ser indexadas al sistema cĂşbico y grupo espacial Fd-3m. Los resultados sobre los datos cristalogrĂĄficos y los factores de confiabilidad se presentan en la tabla III. Con base en los resultados, se aprecia que el parĂĄmetro de red es muy similar en todos los casos y va de acuerdo a lo reportado en bibliografĂ­a.6,10 La estructura cĂşbica del Sm2InTaO7 consta de una cadena tridimensional de octaedros MO16 (M = In, Ta) unidos por sus esquinas (figura 6). Los octaedros de MO16 se conectan con otros mediante cadenas de MO13 a lo largo de la direcciĂłn [001], mientras que los cationes Sm se encuentran en el centro del hexĂĄgono formado por los octaedros de

MO16. Ambos octaedros de InO6 y TaO6 se encuentran distorsionados. AnĂĄlisis por microscopĂ­a electrĂłnica de barrido El anĂĄlisis de la morfologĂ­a mediante MEB revelĂł que los materiales preparados por la ruta sol-gel presentan partĂ­culas de tamaĂąo alrededor de 400 nm (figura 7). TambiĂŠn se aprecia que algunas partĂ­cu-

Fig. 6. Vista en poliedros de la estructura cĂşbica del Sm2InTaO7.

Fig. 5. Patrones DRX obtenidos del refinamiento de Rietveld del Sm2InTaO7 sintetizado mediante el mĂŠtodo sol-gel.

Tabla III. Datos cristalogrĂĄficos obtenidos del refinamiento de Rietveld del Sm2InTaO7.


(VWDGR VyOLGR Â&#x17E;&       6ROJHO Â&#x17E;&










 &~ELFR  1$

las comienzan a sinterizar, al aumentar su tamaĂąo. Por otro lado, el tamaĂąo promedio de las partĂ­culas del material preparado por reacciĂłn en estado sĂłlido es de alrededor de 2-3Âľm, para este caso fue mĂĄs evidente el crecimiento de las partĂ­culas, debido al proceso de sinterizaciĂłn causado por la alta temperatura y el tiempo largo de reacciĂłn. EspectroscopĂ­a UV-vis para sĂłlidos Los espectros de absorciĂłn UV-vis del Sm2InTaO7 sintetizado por sol-gel y estado sĂłlido presentaron varias bandas de absorciĂłn en la regiĂłn de luz visible (Îť> 400 nm). Dichas bandas se atribuyen a transiciones directas de la capa 4f, parcialmente llena del Sm.10 TambiĂŠn se observĂł que la mayor absorciĂłn se da a Îť< 350 nm. El valor de Eg calculado mediante


CIENCIA UANL / AĂ&#x2018;O 15, No. 60, OCTUBRE - DICIEMBRE 2012


Fig. 7. Imágenes de MEB obtenidas de los materiales de Sm2InTaO7.

el análisis de Kubelka-Munk corresponde a 3.5 eV y 3.6 eV, para el material preparado por sol-gel y estado sólido, respectivamente. La diferencia en los valores del Eg, con respecto a lo reportado en bibliografía (2.8 eV), puede darse debido a que durante el análisis mediante Kubelka-Munk no se consideraron las transiciones 4f del Sm. Área superficial específica Los resultados de área superficial del Sm2InTaO7 revelaron que el material preparado por sol-gel posee un área de 5 m2 g-1, la cual es superior a la obtenida mediante reacción en estado sólido (1 m2 g-1) y a lo reportado previamente para este óxido (0.47 m2 g-1).10 La diferencia mostrada en el valor del área superficial corrobora lo observado por MEB, donde el material preparado por sol-gel presentó menor tamaño de partícula que el material obtenido por estado sólido. Pruebas fotocatalíticas de los materiales Sm2FeTaO7 Las pruebas de fotodegradación se realizaron bajo las condiciones de luz solar. Los reactores con la disolución del colorante y el fotocatalizador se expusieron a la luz solar, a partir de las 9:00 a.m., hasta las 7:00 p.m., en que la energía máxima fue recibida. Además, mediante análisis UV-vis, se determinó que las botellas de vidrio permiten solamente la incidencia


de radiación con longitud de onda mayor a 300 nm. Durante las pruebas fotocatalíticas, la intensidad del color azul de la disolución del índigo carmín disminuyó en función del tiempo. El análisis, mediante espectroscopía UV-vis de las alícuotas tomadas para darle el seguimiento a la reacción, reveló que hubo una disminución en todas las bandas de absorción del espectro del índigo carmín (610, 286, 252 y 206nm). En la figura 8 se presenta la degradación del índigo carmín en función del tiempo de radiación, al emplear los diferentes materiales sintetizados. Es posible observar que mediante fotólisis se degrada 20% de la concentración inicial del colorante, debido a la pequeña porción de luz UV presente en la luz solar (y que no es bloqueada por la botella de vidrio), la cual participa directamente en la reacción fotoquímica. Por otro lado, los materiales sintetizados por estado sólido solamente lograron la degradación de 5% a 10% del colorante. Esto podría ser debido a diferentes factores, tales como la baja interacción entre el material y la disolución del colorante, la baja área superficial, así como el alto grado de recombinación de las cargas. Con respecto a los materiales sintetizados por sol-gel, éstos mostraron la mayor actividad en la degradación del colorante índigo carmín, la cual fue ocho veces mayor en comparación con los materiales preparados por estado sólido. Es bien conocido que la actividad fotocatalítica de un material está fuertemente asociada con su naturaleza y propiedades fisicoquímicas. En este caso, los materiales sintetizados por sol-gel presentan mayor área superficial y menor tamaño de partícula, permitiendo una mejor interacción entre el material y la disolución del colorante. La presencia de partículas pequeñas provee más sitios activos y disminuye la distancia de migración de las cargas fotogeneradas, hace más eficientes las reacciones de 47


Fig. 8. Fotodegradación del índigo carmín bajo radiación de luz solar, empleando los materiales Sm2FeTaO7 y CuO/Sm2FeTaO7.

oxidación-reducción sobre la superficie del fotocatalizador. 26 El uso del CuO como cocatalizador incrementó la actividad fotocatalítica del Sm2FeTaO7. En particular, con el material CuO/Sm2FeTaO7 sol-gel se logró una degradación de 38% de la concentración inicial del colorante (figura 8). El CuO actúa como un colector de electrones27 disminuye la recombinación de las cargas fotogeneradas y, por ende, más huecos estarán disponibles para oxidar las moléculas del colorante.28 Adicionalmente, se sabe que la recombinación compite significativamente con el proceso fotocatalítico, siendo ésta la mayor limitación de la fotocatálisis, debido a que se reduce su eficiencia cuántica.29 Con base a los resultados obtenidos, la relación entre el método de síntesis y el mecanismo de reacción de la degradación fotocatalítica del colorante índigo carmín se ilustra, esquemáticamente, en la figura 9: como primer paso, ambos materiales CuO/ Sm2FeTaO7 Sol-gel y CuO/ Sm2FeTaO7 estado sólido absorben fotones con energía mayor o igual que su energía de banda prohibida y producen el par hueco (h+)-electrón (e-). Posteriormente, las cargas generadas migran hacia la superficie, donde se lleva48

rán a cabo las reacciones de oxidación-reducción; simultáneamente, el proceso de recombinación ocurre y compite con el proceso fotocatalítico. Para nuestro caso, ambos procesos son afectados por el método de síntesis. Cuando el Sm2FeTaO7 se prepara por sol-gel, el tamaño de partícula es mucho menor que el Sm2FeTaO7 preparado por estado sólido; por lo tanto, la distancia de los electrones y huecos al migrar hacia la superficie es menor si disminuye el proceso de recombinación y, por ende, se generan más sitios activos para favorecer las reacciones superficiales. Además, el CuO actúa como una trampa de electrones, reduciendo la recombinación, lo cual a su vez favorece que haya más huecos disponibles para formar especies oxidantes, como el radical hidroxilo, que reaccionan con el índigo carmín hasta formar CO2 y H2O como producto final.26,28 Pruebas fotocatalíticas de los materiales Sm2InTaO7 Debido a que el Sm2InTaO7 presentó un valor de Eg ~3.5 eV, dicho compuesto solamente puede ser activado con energía UV. Degradación del colorante cristal violeta El análisis mediante UV-vis de las alícuotas mostró que la banda de absorción máxima del cristal violeta

Fig. 9. Esquema del mecanismo propuesto para la degradación fotocatalítica del colorante índigo carmín. BC = Banda de conducción y BV = Banda de valencia.



(λ= 590 nm) desaparece completamente después de 60 minutos de irradiación. Adicionalmente, se aprecia una disminución considerable de la banda de absorción situada a 208 nm, lo cual es indicativo de que la destrucción de los anillos aromáticos de la molécula del cristal violeta se está llevando a cabo durante el proceso fotocatalítico. En la figura 10 se presenta la comparativa de la actividad fotocatalítica para la degradación del colorante cristal violeta, usando el Sm2InTaO7 preparado por estado sólido y sol-gel, así como la fotólisis. De acuerdo con el gráfico, mediante el proceso de fotólisis es posible degradar el cristal violeta en 80% de su concentración inicial. Sin embargo, en la presencia del Sm2InTaO7 se logra prácticamente la degradación total del colorante en un tiempo de 60 minutos. Por otro lado, aunque se observó un efecto considerable de la fotólisis durante las pruebas fotocatalíticas, lo cual indica que es posible degradar al cristal violeta con luz UV, desde el punto de vista ambiental, un objetivo importante es lograr la mineralización completa de los compuestos orgánicos, los resultados del análisis de carbono orgánico total (COT) se muestran en la figura 11, los cuales revelan que el grado de mineralización del cristal violeta aumenta debido a la presencia del fotocatalizador.

Fig. 10. Degradación del cristal violeta al usar los materiales de Sm2InTaO7.


En particular, se aprecia que en presencia del Sm2InTaO7 se logra mineralizar alrededor del 65 a 70% del cristal violeta, siendo el material sintetizado por sol-gel el de mayor eficiencia; mientras que en el proceso de fotólisis solamente se mineralizó 25% del cristal violeta. Esto indica que el Sm2InTaO7 presenta actividad fotocatalítica para mineralizar el cristal violeta hasta sus productos finales, CO2, H2O, así como iones inorgánicos. Fotorreducción del cromo (VI) Los materiales de Sm2InTaO7 sintetizados por estado sólido y sol-gel se evaluaron en la reducción fotocatalítica de iones Cr (VI) presentes en la fase acuosa. Debido a que la reacción de fotorreducción de Cr (VI) se favorece bajo condiciones ácidas,30 las pruebas fotocatalíticas se realizaron a pH = 2. El análisis mediante UV-vis mostró una disminución constante en función del tiempo de la banda de absorción situada a λ= 348 nm, lo cual indica que la fotorreducción de Cr (VI) a Cr (III) se realizó. Además, se detectó una banda de absorción cercana a λ= 585 nm, la cual aumenta en función del tiempo de reacción; dicha banda de absorción es una evidencia clara de la presencia de Cr (III) en la disolución. Este resultado se corroboró mediante el análisis de una disolución de nitrato de cromo (III) em-

Fig. 11. Análisis del COT en la reacción de degradación del colorante cristal violeta.



pleado como referencia.Para verificar si parte del Cr (III) se adsorbe en la superficie del material Sm2InTaO7, se procedió a recuperar el material al finalizar la reacción; el polvo se filtró y se secó a 50ºC, luego se analizó mediante espectroscopía de reflectancia difusa. En dicho análisis, solamente se detectaron las bandas de absorción características del Sm2InTaO7; por lo tanto, el Cr (III) no está adsorbido en la superficie del fotocatalizador y permanece en disolución como fue discutido anteriormente. Los resultados de la fotorreducción de Cr (VI) se presentan en la figura 12, en la cual se observa que mediante el proceso de fotólisis es posible reducir en 28% el contenido de Cr (VI). Dicha disminución se atribuye a la radiación de luz UV,31 la cual en primera instancia (reacción 1) genera el rompimiento de la molécula del agua y subsecuentemente (reacción 2) se lleva a cabo la reducción del Cr (VI). Por otro lado, en presencia del Sm2InTaO7 la reacción de reducción del Cr (VI) se ve favorecida al alcanzar 52% y 40% para el material sintetizado por sol-gel y estado sólido, respectivamente.

UV Reacción 1 : 2 H 2O ⎯luz ⎯⎯ → O2 + 4 H + + 4 e −

Reacción2 : Cr2O72− + 14H + + 6e− → 2 Cr3+ + 7 H2O

Los resultados anteriores indican que el compuesto Sm2InTaO7 es capaz de lograr la fotorreducción de iones Cr (VI) presentes en la fase acuosa. En el caso del material sintetizado por sol-gel, se observó una mayor eficiencia al compararlo con el material sintetizado por estado sólido. Dicha diferencia podría estar asociada con la mayor área superficial obtenida por el método sol-gel. Además, el material obtenido por sol-gel presentó menor tamaño de partícula, lo que significa que los pares hueco-electrón, fotogenerados, migran de manera más rápida hacia 50

Fig. 12. Fotorreducción de Cr (VI), en la ausencia y presencia de los materiales de Sm2InTaO7.

la superficie del fotocatalizador, y se genera una mayor cantidad de sitios activos, en los cuales se realizan las reacciones de oxidación-reducción.26 CONCL USIONES CONCLUSIONES Es posible llevar a cabo la síntesis del nuevo óxido tipo pirocloro de composición Sm2FeTaO7 de manera pura, utilizando tanto el método de estado sólido como el de sol-gel, así como la síntesis de Sm2InTaO7 por sol-gel. Se determinó que cuando se utiliza sol-gel como método de síntesis, los polvos obtenidos presentan un tamaño de partícula pequeño y un área superficial de un orden de magnitud mayor, en comparación con el método de estado sólido. El Sm2FeTaO7 cristaliza en el sistema monoclínico y grupo espacial C2/c, mientras que el Sm2InTaO7 cristaliza en el sistema cúbico y grupo espacial Fd-3m. Ambos materiales, Sm2FeTaO7 y Sm2InTaO7, son potencialmente aplicables a la degradación de contaminantes en solución acuosa, como el colorante índigo carmín, el cristal violeta y la reducción de iones cromo (VI), respectivamente. En particular, las características del material Sm2FeTaO7 permiten su uso como un fotocatalizador bajo condiciones reales y variantes de radiación solar. CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


ABS TRA CT ABSTRA TRACT RESUMEN En esta investigación se reporta la síntesis por primera vez del óxido tipo pirocloro, con composición Sm2FeTaO7, por el método de estado sólido y el método sol-gel, así como el óxido con composición Sm2InTaO7 por el método sol-gel. Los resultados de la caracterización estructural revelaron que el compuesto Sm 2 FeTaO 7 cristalizó en el sistema monoclínico con el grupo espacial C2/c, mientras que el compuesto Sm2InTaO7 cristalizó en el sistema cúbico y grupo espacial Fd-3m. Esto indica que un factor muy importante en este tipo de compuestos es la elección de los elementos químicos, ya que de ello depende la estructura cristalina que presentará el material. Para ambos óxidos, cuando se utilizó el método sol-gel como ruta de síntesis se obtuvieron los materiales de forma pura a menor temperatura y tiempo de reacción que cuando se utiliza el método de estado sólido. Además, los resultados de la caracterización indican que el método de síntesis también es determinante en las propiedades morfológicas y superficiales de los mismos, principalmente, en su tamaño de partícula y aunado a ello su valor de área superficial específica. La evaluación fotocatalítica mostró que los óxidos tipo pirocloro Sm2FeTaO7 y Sm2InTaO7 son materiales multifuncionales atractivos para emplearse como fotocatalizadores en las reacciones de eliminación de contaminantes tóxicos presentes en solución acuosa, como el colorante índigo carmín, cristal violeta así como la reducción del cromo (VI). Palabras clave: Materiales avanzados, Sol-gel, Fotocatálisis solar, Degradación de colorantes, Reducción de cromo (VI).


This work reports the synthesis of a new pyrochlore compound Sm2FeTaO7 by both solid state reaction and sol–gel synthesis routes as well as the first time synthesis of the Sm2InTaO7 by sol-gel. The results revealed that Sm2FeTaO7 crystallized in the monoclinic system with space group C2/c and the Sm2InTaO7 in the cubic system with a space group Fd-3m. This indicates that an important factor that determines the crystal structure of the compound is the nature and size of the elements used. Moreover, it was also found that when sol-gel was used as synthesis route, it is possible to synthesize the materials at lower temperature and less reaction time when compared with solid state reaction. Both materials prepared by sol-gel processing present lower particle sizes and one order of magnitude higher in the specific surface area values than the solid state produced compounds. Additionally, the photocatalytic results showed that indigo carmine molecule can be degraded under solar light irradiation using Sm2FeTaO7, while Sm2InTaO7 is able to cause the photoreduction of Cr (VI) ions and degrade crystal violet dye in aqueous solution. Keywords: Advanced materials, Sol-gel, Solar photocatalysis, Dyes degradation, Cr (VI) reduction Agradecimientos Los autores agradecen a la UANL por el apoyo financiero, otorgado a través de los proyectos PaicytUANL 2010 clave IT607-10, IT176-09 e IT17109; al Conacyt, por el apoyo económico a través de los proyectos de Ciencia Básica 2007, clave 84809 y clave 83923, así como Ciencia Básica 2008 clave 98740, y el apoyo de beca de doctorado a los M.C. Miguel A. Ruiz Gómez y M.C. Christian Gómez Solís. 51



17. G.V. Bazuev, T.I. Chupakhina. Inorganic Materials, 45


18. G. Chen, H. Takenoshita, H. Satoh, N. Kamegashira, M.

(2009) 409. C.K. Matsuda, F.F. Ivashita, A. Paesano, Jr., E.V. Pannunzio Miner, M.C. Blanco, R.E. Carbonio, J.B. Marimon da Cunha, L. Ghivelder. Physical Review B, 81 (2010) 014417. 2.

P. Strobel, S. Zouari, R. Ballou, A. Cheikh-Rouhou, JeanClaude Jumas, J. Olivier-Fourcade. Solid States Science, 12 (2010) 570.


Journal of Materials Chemistry, 14 (2004) 1623. 20. I. Levin, T.G. Amos, J.C. Nino, T.A. Vanderah, I.M. Research, 17(2002) 1406.

Z. Teixeria, L. Otubo, R. Figueredo Gouveia, O. Luiz Alves. M. Sellami, V. Caignaert, M. Hamdad, A. Bekka, N.


M.A. Subramanian, G. Aravamudan, G.V. Subba Rao.

Bettahar. Journal Alloys and Compounds, 482 (2009) 13. Progress in Solid State Chemistry, 15 (1983) 55.

21. J.S. Gardner, M.J.P. Gingras, J.E. Greedan. Reviews of Modern Physics, 82 (2010) 53. 22. H. Nakano, A. Kishigami, M. Hisa, N. Kamegashira. Materials Research Bulletin, 34 (1999) 2075. 23. J. Tauc, R. Grigorovici, A. Vancu. Physica Status Solidi, 15 (1966) 627. 24. S. Murugesan, M.N. Huda, Y. Yan, M.M. Al-Jassim, V.

J. Luan, K. Ma, B. Pan, Y. Li, X. Wu, Z. Zou. Journal of

Subramanian. Journal of Physical Chemistry C, 114 (2010)

Molecular Catalysis A: Chemical, 321 (2010) 1.


J. Luan, M. Ni, K. Ma, Y. Li, Z. Zou. Chemical Engineering Journal, 167 (2011) 162.


M. Croft, F. Stowasser, J. Hadermann, G. V. Tendeloo.

Ravikumar, M. Vithal. Ceramics International, 36 (2010)

Materials Chemistry and Physics, 124 (2010) 552.


(2004) 177. 19. G. M. Veith, M. V. Lobanov, T. J. Emge, M. Greenblatt,

Reaney, C.A. Randall, M.T. Lanagan. Journal of Materials



Alloys and Compounds, 374

B. Vijaya Kumar, R. Velchuri, G. Prasad, B. Sreedhar, K. 1347.


Miyamoto. Journal of

X. Tang, H. Ye, Z. Zhao, H. Liu, C. Ma. Catalysis Letters, 133 (2009) 362.

10. X. Tang, H. Ye, H. Liu, C. Ma, Z. Zhao. Journal of Solid State Chemistry, 183 (2010) 192. 11. J. Luan, K. Ma, Y. Li, Z. Zou. Journal of Materials Science, 46 (2011) 813. 12. L.L. Garza-Tovar, L.M. Torres-Martínez, D. Bernal Rodríguez, R. Gómez, G. del Ángel. Journal of Molecular Catalysis A: Chemical, 247 (2006) 283. 13. M. Martos, B. Julián-López, E. Cordoncillo, P. Escribano. Journal of Physical Chemistry B, 112 (2008) 2319. 14. A. N. Radhakrishnan, P. Prabhakar Rao, K. S. Sibi, M. Deepa, P. Koshy. Journal of Solid State Chemistry, 182 (2009) 2312.

25. T. Umebayashi, T. Yamaki, H. Itoh, K. Asai. Journal of Physics and Chemistry of Solids, 63 (2002) 1909. 26. A. Hagfeldt, M. Graetzel. Chemical Reviews, 95 (1995) 49. 27. T. Miwa, S. Kaneco, H. Katsumata, T. Suzuki, K. Ohta, S. C. Verma, K. Sugihara. International Journal of Hydrogen Energy, 35 (2010) 6554. 28. Y.G. Adewuyi. Environmental Science and Technology, 39 (2005) 8557. 29. J. Liqiang, Q. Yichun, W. Baiqi, L. Shudan, J. Baojiang, Y. Libin, F. Wei, F. Honggang, S. Jiazhong. Solar Energy Materials and Solar Cells, 90 (2006) 1773. 30. Q.L. Yang, S.Z. Kang, H. Chen, W. Bu, J. Mu. Desalination, 266 (2010) 149. 31. S.L. Wang, C.C. Chen, Y.M. Tzou, C.L. Hsu, J.H. Chen, C.F. Lin. Journal of Hazardous Materials, 164 (2009) 223.

15. J. Luan, H. Cai, X. Hao, J. Zhang, G. Luan, X. Wu, Z. Zou. Research on Chemicals Intermediates, 33 (2007) 487.

Recibido: 1 de septiembre de 2012

16. J. Luan, W. Zhao, J. Feng, H. Cai, Z. Zheng, B. Pan, X.

Aceptado: 1 de septiembre de 2012

Wu, Z. Zou, Y. Li. Journal of Hazardous Materials, 164 (2009) 781. 52


&,(1&,$ ;98$1/ $











Disección molecular de la función dual de Antenapedia en el control genético del desarrollo en Drosophila melanogaster DIANA RESÉNDEZ PÉREZ*, DIANA L. CÁRDENAS CHÁVEZ*, RICARDO CANALES DEL CASTILLO*, KARINA VILLANUEVA SEGURA*

Los genes homeóticos están involucrados en el control genético del desarrollo de los diferentes organismos que permiten la especificación del plan corporal, a lo largo de los ejes antero-posteriores y dorsoventrales en los organismos bilaterales.1-3 Estos genes presentan una secuencia altamente conservada denominada homeobox, que codifica para un polipéptido de 60 aminoácidos, conocido como homeodominio (HD), el cual representa el dominio de unión al DNA,4-7 y contiene un motivo de cuatro aminoácidos altamente conservado, denominado “YPWM”, involucrado en interacciones proteína-proteína.8-11 En este trabajo se investigó la paradoja de los genes Hox, que consistió en determinar el mecanismo molecular mediante el cual las homeoproteínas altamente similares adquieren distintas funciones durante el desarrollo. Debido a lo anterior, se realizó la disección molecular de la homeoproteína Antenapedia (Antp), para determinar su actividad funcional durante diferentes etapas del desarrollo de D. melanogaster. Para ello, se analizó la actividad funEl presente artículo está basado en la investigación “Disección molecular de la función dual de Antenapedia en el control genético del desarrollo en Drosophila melanogaster”, galardonada con el Premio de Investigación UANL 2012, en la categoría de Ciencias Naturales, otorgado en sesión solemne del Consejo Universitario, en septiembre de 2012.


cional de Antp, mediante un análisis mutacional de YPWM, el enlazador corto y largo entre el HD y YPWM, así como la sustitución y fusión al dominio de represión WRPW. La mutación de YPWM en Antp mostró que este motivo es necesario e indispensable para la función in vivo de Antp en la involución de la cabeza, en las transformaciones torácicas T1 a T2 y antena-tarso, mediante represión de los genes de la antena y activación de los genes tarsales. Esta función dual del motivo YPWM también se demostró a nivel molecular en la activación y represión de los genes blancos específicos de Antp, en la que se requirió para la activación ectópica de los genes teashirt (tsh) y grain (grn), así como para represión endógena de Scr y ectópica de Salm y dan. Por otro lado, la sustitución y fusión del motivo WRPW rescató e incrementó, respectivamente, el fenotipo en la actividad represora de YPWM en Antp, y no afectó su activación funcional en las transformaciones tarsales, ni en la activación de los genes blanco de Antp analizados. Adicionalmente, las variaciones en la longitud del espaciador (4-8 aminoácidos) que se presentan en las diferentes isoformas de Antp incrementaron preferencialmente la eficiencia en la activación/represión, al sugerir la participación del espaciador en la especificidad funcional de Antp. * Universidad Autónoma de Nuevo León. FCB. 53


METODOL OGÍA METODOLOGÍA Construcción de plásmidos recombinantes

La detección de las señales de inmunohistoquímica e inmunofluorescencia se realizó mediante observación en microscopía visible y confocal-láser.19

La construcción de las secuencias codificantes para Antp y las mutantes se realizaron en el vector pUAST, con los procedimientos estándares de biología molecular.12-14


Generación de moscas transgénicas y cruzas genéticas

Para analizar la función in vivo del tetrapéptido YPWM, se llevó a cabo la expresión ectópica de la homeoproteína silvestre (YPWMLLAntp) y mutantes en YPWM, por un bloque de alaninas (AAAAAntp) o por el dominio de represión WRPW (WRPWAntp), así como la fusión de este dominio en el extremo Cterminal de Antp (YPWMAntpWRPW) y mutante de alaninas ( AAAA Antp WRPW ), durante la etapa de preblastodermo y blastodermo del embrión con la línea productora nullo-GAL4.4 Las larvas que sobreexpresaron Antp mostraron pérdida total de la involución de la cabeza, transformación homeótica del primer segmento protorácico (T1) a mesotóracico (T2) y reducción de dentículas protorácicas (figura 1B). Por el contrario, que la sustitución de alaninas en YPWM mostró un fenotipo normal (figura 1A), ya que no se detectó transformación homeótica o alteración de la involución de la cabeza (figura 1C). En contraste, la activación ectópica de las mutantes que contienen el dominio WRPW (figuras 1D-F) mostró transformación homeótica de T1 a T2 y represión de dentículas protorácicas. La fusión de WRPW en el extremo Cterminal de Antp generó el fenotipo más dramático, representado por pérdida drástica de la involución de la cabeza y transformación completa T1→T2, así como la deformación del embrión (figura 1E). Además, la sobreexpresión de mutantes con el enlazador corto (figuras 2G y H) causó un bloqueo pronunciado de la involución de la cabeza, y ocasionó la

Para la generación de las líneas de moscas transgénicas, los plásmidos recombinantes se introdujeron en la línea germinal de D. melanogaster, mediante microinyección,15 para su posterior identificación y balanceo de los cromosomas en las líneas transgénicas. Todas las líneas de Drosophila melanogaster se mantuvieron como homocigotas viables, o líneas balanceadas, a 18°C en tubos de comida estándar (Fisher Scientific). Para la expresión ectópica de Antp y las mutantes, se utilizó el sistema binario de regulación GAL4.16,20 Las cruzas genéticas se realizaron con moscas vírgenes de las líneas productoras ptcGal4, nullo-GAL4, Dll-GAL4 y Salm-lacZ, y machos de las líneas reporteras yw; UAS-Antp y UASmutantes, como se describió previamente.16 La colecta sincronizada de los embriones y la preparación de las cutículas embrionarias se llevó a cabo con el método antes descrito.16-17 Visualización de la expresión génica mediante inmunohistoquímica e inmunofluorescencia Para la tinción de los embriones, se emplearon los anticuerpos Anti-Antp4C3 1:250 (U. Iowa), AntiScr 1:100,22 Anti-b-gal 1:500 (Molecular Probes) y Anti-tsh 1:2000, de acuerdo a procedimientos estándares previamente descritos por Sullivan et al.18 54

El tetrapéptido YPWM de Antp es necesario para la función homeótica en D. melanogaster



Antp requiere la presencia del dominio funcional YPWM para inducir la transformación antena-tarso

Fig. 1. Efecto de la expresión ectópica de Antp y mutantes en la transformación homeótica e involución de la cabeza. El diagrama en la parte superior representa la estructura de la homeoproteína Antenapedia y sus mutantes en YPWM, enlazador y fusión de WRPW. El enlazador largo de ocho aminoácidos se describe como LL (del inglés long linker) y el espaciador corto de cuatro aminoácidos se representa como SL (del inglés short linker). Las proteínas con LL serán referidas en el texto únicamente como Antp, AAAAAntp, WRPW Antp, YPWMAntpWRPW y AAAAAntpWRPW. La imagen inferior muestra un embrión silvestre con un desarrollo normal (A), mientras que la expresión ectópica de Antp (B) y mutantes que contienen WRPW (D-F) bloquearon la involución de la cabeza y presentaron transformación torácica T1-T2, a diferencia de la línea AAAAAntp (C). Las líneas SL (G, H) mostraron un fenotipo idéntico a sus contrapartes LL (B, D). Los números representan los segmentos protorácico (1), mesotóracico (2) y metatorácico (3). Las flechas y asteriscos muestran las dentículas protorácicas y defectos en la involución de la cabeza, respectivamente.

pérdida completa de estructuras bucales, en comparación con sus contrapartes con el enlazador largo (figuras 1B y D). Estos resultados indican que el tetrapéptido YPWM se requiere para la función homeótica de Antp, la cual es favorecida por la presencia del enlazador corto; mientras que la sustitución de este motivo por el dominio WRPW permite conservar la especificidad funcional de esta homeoproteína en la expresión ectópica en la cabeza. CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

Para analizar si el motivo YPWM se requiere en las transformaciones tarsales de la antena en Drosophila, utilizamos el sistema UAS-GAL4, con el potenciador Distal-less (Dll), para dirigir Antp y mutantes a la antena. La inducción ectópica de patas torácicas T2 con cerdas apicales y preapicales en la tibia distal se generaron en las líneas que contenían el dominio YPWM (figuras 2B y 2G). En contraste, no se detectó transformación en la mutante de alaninas (figura 2C), únicamente muestra un leve engrosamiento de la arista y unas pocas cerdas ectópicas en el segmento número 3 de la antena (A3), debido probablemente a la presencia del HD en la proteína. Resultados similares se obtuvieron con la mutante de alaninas fusionada al dominio de represión WRPW (AAAAAntpWRPW), en la que numerosas cerdas tarsales y ausencia de la arista fueron identificadas en la antena (figura 2E). Asimismo, la sustitución de YPWM por WRPW en Antp causó un sobrecrecimiento del segmento A3 (figura 2D). Las transformaciones tarsales dependieron del tamaño del enlazador entre YPWM y el HD de Antp, ya que

Fig. 2. Transformaciones tarsales generadas por Antp con el motivo YPWM. La presencia de YPWM en Antp incrementa fuertemente la transformación tarsal de la antena (B, E, G); y su ausencia genera una muy débil transformación (C, F). La doble mutante YPWMAntpWRPW induce transformaciones tarsales (E), a diferencia de la sustitución con WRPW, que confiere únicamente engrosamiento débil de la arista (D, H). Los segmentos antenales están indicados con líneas curvas seguidas de números que corresponden a los diferentes segmentos (2= segundo segmento antenal, 3=tercer segmento antenal, Ar=arista). La cerdas de la pata se señalan con flechas negras, e indican una transformación débil del segmento A3, y la presencia de cerdas apicales/preapicales (cabeza de flecha roja) indica la identidad de patas mesotorácicas (T2). Los ganchos tarsales y segmentos antenales transformados se señalan con un asterisco azul o color rojo, respectivamente.



las líneas con el enlazador largo mostraron un efecto más dramático que con el corto de cuatro aminoácidos (figuras 2G y H). Estos resultados muestran, sin lugar a dudas, que la transformación de antena a tarso requiere la presencia del dominio funcional YPWM de Antp, y que el dominio de represión WRPW no sustituye la función de este motivo, mientras que el enlazador largo favorece transformaciones más dramáticas. La activación del gen blanco tsh por Antp es dependiente de YPWM Se utilizó el gen blanco tsh como modelo para determinar la función activadora de Antp in vivo (figura 3A). En todas las construcciones evaluadas se mostró que la activación de tsh en la región anterior del embrión (cabeza) requiere del motivo funcional de YPWM de Antp (figuras 3C, D, F y H). Sin embargo, se observaron diferencias en las líneas con distinta longitud del espaciador; la activación inducida por YPWMSLAntp fue menor que YPWMLLAntp (figuras 3B y G). Asimismo, se logró modificar la función activadora de Antp a parcialmente represora, me-

Fig. 3. La activación ectópica de tsh en segmentos anteriores depende de YPWM de Antp. Los embriones, en la parte superior, muestran la expresión de tsh (rojo) y en la inferior la colocalización (amarillo) de tsh con Antp (verde). Todas las líneas UAS se indujeron con el potenciador ptc-GAL4. El dominio de activación ectópica de tsh se señala con líneas punteadas. (A) La tinción de los embriones muestra la expresión de los genes endógenos. (B) Activación anterior de tsh por Antp. (C, D) La sustitución de YPWM por alaninas o WRPW inhibe la función activadora de Antp. (E, F) En contraste, la adición de WRPW no alteró su actividad, pero la doble mutación causó un decremento. (G, H) Las líneas con el enlazador corto exhiben una reducida función activadora, donde la sustitución con WRPW inhibe totalmente la activación de tsh por Antp.


diante la sustitución de YPWM con el motivo WRPW (figuras 3E, F y H). La activación del grn por Antp requiere la presencia de YPWM Las transformaciones tarsales requieren la activación ectópica de genes específicos de pata, como grain (grn). Para evaluar la actividad funcional de YPWM en Antp, se analizó la activación de grn en discos imaginales, con el potenciador Dll-Gal4. La tinción de b-gal mostró los patrones de expresión endógena y activación ectópica, debido a la expresión de las diferentes mutantes de Antp (figura 4). Estos resultados confirmaron un requerimiento absoluto de YPWM de Antp para la activación ectópica de grn en el disco de la antena (figuras 4C, D, F y H). Las líneas con la sustitución de YPWM por alaninas (figuras 4C y F) mostraron el mismo patrón de expresión endógena que el control (figura 4A), mientras que las mutantes en las que WRPW reemplazó al motivo YPWM fallaron en la activación de grn (figuras D y H), confirmaron así el requerimiento de YPWM para la activación transcripcional. En contraste, la adición de WRPW no alteró la regulación de Antp sobre grn (figura 4E). Asimismo, no se ob-

Fig. 4. Activación ectópica del gen específico de pata grn en el disco de la antena. (A) Patrón de expresión endógena de grn en el disco del ojo y nervio de Bolwin, mediante tinción de b-galactosidasa. (B) Activación ectópica de grn en el disco de la antena por Antp. (C) La mutación de YPWM por alaninas inhibe completamente la activación ectópica, y (D) la sustitución por WRPW inhibe ligeramente esta activación. (E) La adición de WRPW en Antp no modifica la activación de grn. (F) La adición de WRPW no modifica la pérdida de actividad en la sustitución de YPWM por alaninas. (G, H) Las variantes de enlazador corto activan o inhiben grn, de igual manera que las variantes del largo.



servaron diferencias entre la construcción con el enlazador largo y con el corto (figuras 4B y G). El motivo YPWM de Antp es esencial en la represión de Scr endógeno La represión endógena de Sex combs reduced (Scr) por Antp se usó para determinar la habilidad de Antp para actuar, directa o indirectamente como represor transcripcional. Para ello se utilizó el potenciador patched (ptc), que dirige la expresión ectópica de las construcciones de Antp en el compartimiento anterior de cada parasegmento; posteriormente, se analizó su efecto en la expresión endógena de Scr. Los resultados mostraron la represión de Scr en el segmento labial y T1 por Antp (figura 5B). En contraste, la mutación de YPWM por un bloque de alaninas no ocasionó la represión de Scr en el embrión (figura 5C), mientras que la sustitución por el dominio WRPW (WRPWAntp) muestra una represión parcial (figura 5D). Las mutantes con la fusión de WRPW en el extremo C-terminal de Antp presentaron la actividad ectópica de Antp normal (figuras 5E y F), y las proteí-

Fig. 5. La represión de Scr en embriones requiere la presencia de YPWM en Antenapedia. Las imágenes superiores corresponden a un acercamiento de la región de represión, y las inferiores muestran el embrión completo. (A) Scr se expresa normalmente en los segmentos labial (lb) y T1 del embrión (rojo). (B, D-H) La expresión ectópica de Antp y mutantes (verde) con sustitución de YPWM por WRPW o adición de WRPW en el extremo C-terminal reprimen total o parcialmente la expresión endógena de Scr. (C) La sobreexpresión de la mutante AAAAAntp no ocasionó la represión de Scr en el embrión, observándose una colocalización de ambas proteínas (amarillo).


nas con el enlazador corto exhiben una mayor actividad represora en comparación con las del largo (figuras 5G y 6H). Estos resultados demuestran la importancia del motivo YPWM en la actividad funcional de Antp para la represión de Scr; asimismo, sugieren que la capacidad represora de la homeoproteína Antp depende parcialmente del tamaño del enlazador. YPWM de Antp es crucial para la represión del gen antenal Salm Las transformaciones tarsales en el disco antenal también requieren la represión de genes Salm y dan necesarios para la morfogénesis de la antena. Esta represión permite que las células del disco antenal se rediseñen para el desarrollo de la pata.24 Como se esperaba, la expresión ectópica de Antp mostró la represión de Salm en el disco de la antena (figura 6B). Este gen blanco se reprime completamente en el segmento antenal A3 en todas las mutantes probadas (figuras 6D-H), con excepción de la línea que presenta la sustitución de alaninas en YPWM (figura 6C). Las proteínas mutantes de enlazador corto no mostraron diferencia con Antp (figuras 6G y H).

Fig. 6. La expresión ectópica de Antp reprime Salm de manera dependiente de YPWM. (A) Expresión endógena y ectópica de Salm (rojo) y Antp (verde), respectivamente, en el disco imaginal ojo-antena. (B, D-H) Las mutantes con dominio YPWM y WRPW reprimen la expresión de Salm en el segmento antenal. (C) La línea AAAAAntp no afecta la expresión del gen blanco Salm ocasionando la colocalización de ambas proteínas (amarillo).



Estos resultados corroboran la importancia de la presencia del motivo YPWM en Antp, para llevar a cabo la represión del Salm en el disco imaginal de antena. DISCUSIÓN Y CONCL USIONES CONCLUSIONES Una de las estrategias empleadas en D. melanogaster para analizar la función in vivo, ya sea activadora o represora de las homeoproteínas, es expresarlas ectópicamente en un lugar donde normalmente no se expresan.5,26 Por ello, utilizamos el sistema de regulación UAS/GAL4 para dirigir la expresión de la homeoproteína Antp y las mutantes en YPWM, región enlazadora o fusionadas con WRPW en diferentes etapas del desarrollo. Este dominio se encuentra altamente conservado en proteínas represoras con estructura bHLH (Hairy, Huckebein, etc.), y su importancia se demostró en la secuenciación de los alelos del gen Hairy, que presentaba dos mutaciones que afectaban específicamente al dominio WRPW de esta proteína.27,28 Nuestros resultados muestran que la expresión ectópica de Antp generó la transformación homeótica T1-T2, con pérdida de involución de la cabeza, lo cual corrobora que esta sobreexpresión causa la represión de genes requeridos en el desarrollo normal de la cabeza.24,21 En este caso, el dominio YPWM es responsable de la actividad represora de Antp, ya que la mutación de este motivo por alaninas mostró un fenotipo larvario normal. Además, la fusión de un segundo dominio represor (WRPW) incrementó la capacidad represora y el efecto fenotípico de la homeoproteína, debido probablemente a la interacción con el correpresor Groucho, que reconoce el dominio WRPW.29-31 La sobreexpresión de las mutantes con sustitución del motivo YPWM por WRPW mostraron un fenotipo similar al obtenido con Antp, sugiriendo que el dominio WRPW rescata la actividad homeótica de Antp, en ausencia de 58

YPWM. En la etapa adulta de la mosca, la expresión ectópica de Antp generó además la transformación homeótica del segmento antenal A3 a tarso y la presencia de cerdas en la tibia distal. Como se esperaba, las mutantes con sustitución de YPWM por alaninas presentaron una transformación nula o débil de la antena, y corroboraron así la importancia funcional de YPWM en la actividad homeótica de Antp. Resultados similares se obtuvieron en la combinación de AAAA-Antp y una forma activa constitutiva del receptor Notch,9 o en la sustitución de YPWM por AAAA en fushi tarazu.32 En contraste con los defectos en el desarrollo embrionario, las mutantes que contienen WRPW mostraron únicamente un engrosamiento del segmento A3, indicando que este dominio represor no sustituye la función de YPWM en la transformación antena-tarso. Dado que la transformación homeótica depende de la activación/represión de genes endógenos, se evaluó el papel del motivo YPWM en la expresión de los genes blanco tsh, grn, Scr y Salm como modelo de estudio. El gen homeótico tsh se expresa normalmente en los parasegmentos 3-13 del embrión.33 La sobreexpresión de Antp induce la activación ectópica de este gen blanco en la región anterior del embrión.34-36 La ausencia de activación de tsh en la mutante Antp con alaninas confirma que YPWM es indispensable para la activación de este gen blanco en Drosophila. Sin embargo, estudios realizados con las homeoproteínas ftz de Drosophila y Tribolium establecieron que el motivo YPWM es necesario para la activación de tsh in vivo.36 Asimismo, estos resultados proponen la formación de un heterodímero con el cofactor Exd para la regulación del gen blanco tsh, debido a que la expresión de este gen blanco en embriones nulos de Exd se reduce considerablemente.37 Ensayos adicionales de transactivación y retardación en gel corroboraron la interacción Antp/Exd mediada exclusivamente CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


por el tetrapéptido YPWM de Antp.38 Otros estudios revelan que el motivo YPWM también une la homeoproteína Antp con la maquinaria transcripcional basal, a través del factor TAF155.11 En el caso de las transformaciones homeóticas antena-tarso, se requiere principalmente la activación de genes específicos de pata y represión de genes necesarios para la antena.24 Los resultados obtenidos muestran que la sobreexpresión de Antp resultó en una activación ectópica del gen grn en el disco imaginal de la antena,39 y esta activación presenta el mismo patrón de comportamiento que el gen blanco tsh: un requerimiento absoluto del motivo YPWM de Antp. Por otra parte, el gen homeótico Scr se expresa normalmente en el segmento protorácico (T1) del embrión, pero no en el mesotóracico (T2), debido a la expresión endógena de la homeoproteína Antp.40,41 Sorprendentemente, la expresión ectópica de Antp es capaz de reprimir Scr en el segmento T1, a diferencia de la mutante que presenta la sustitución de YPWM por alaninas, lo cual permite concluir que YPWM es crucial en Antp para la represión de este gen blanco. De igual manera, la represión del gen de antena Salm en el disco imaginal ojo-antena por la sobreexpresión de Antp o mutantes que contienen un dominio funcional YPWM, con excepción de AAAA Antp, indican que este motivo presenta un papel esencial en el reclutamiento de correpresores para la regulación de estos genes blanco. El potencial represor de YPWM fue adicionalmente corroborado mediante su fusión al extremo C-terminal de la proteína transactivadora GAL4 (GAL4YPWM). El análisis de la actividad transcripcional de esta proteína mostró una reducción significativa de 55%, debido a la presencia de YPWM, confirmando que este motivo actúa como un dominio de represión transcripcional de manera similar que la fusión GAL4-WRPW previamente descrita.30,38 Es importante mencionar que en todos los experimenCIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

tos las mutantes con sustitución de YPWM por WRPW conservaron la actividad represora, debida probablemente a la presencia de este dominio, mientras que la fusión de WRPW al extremo C-terminal de Antp mostró una mayor represión, ya que contiene dos dominios represores (YPWM y WRPW). En relación a esto, la adición del dominio de represión engrailed (En), que es capaz de unirse a Gro in vivo,42 no confirió cambios significantes en la actividad de Antp (resultados no mostrados). Este requerimiento diferencial del motivo YPWM en Antp sustenta la noción de que diferentes reglas pueden aplicarse en la regulación transcripcional activadora y represora mediada por las homeoproteínas. La comparación de secuencias de sitios de unión Hox8 muestran que los sitios bipartitas HoxPbx se encuentran en potenciadores de genes activados por el complejo Hox-Pbx, mientras que los elementos regulatorios con sitios individuales Hox (sin la unión de Pbx) se distribuyen igualmente entre los genes activados o reprimidos por estos factores. En conclusión, nuestros resultados son contundentes, al demostrar que la homeoproteína Antp tiene una función dual para la activación de los genes requeridos en la morfogénesis del tórax, así como la represión de los genes de la cabeza en D. melanogaster como se detalla a continuación: ·



La actividad funcional dual in vivo de Antp en las transformaciones homeóticas, en embriones y antena → tarso en adultos, requiere la presencia de YPWM. El dominio YPWM de Antp es necesario para la activación de los genes blanco tsh y grn en la región anterior del embrión y el disco antenal de D. melanogaster, respectivamente. La represión de los genes blanco: Scr en embriones, Salm y dan en el disco de antena depende del tetrapéptido YPWM de Antp. 59



La sustitución y fusión del motivo WRPW rescata e incrementa, respectivamente, el fenotipo de la actividad represora de YPWM en Antp, y no afecta su activación funcional. El enlazador largo incrementa la capacidad de activación, mientras que el corto aumenta la represión de Antp en D. melanogaster.


RESUMEN Los genes homeóticos están involucrados en el control genético del desarrollo de los diferentes organismos que permiten la especificación del plan corporal. Estos genes presentan una secuencia altamente conservada denominada homeobox , que codifica para un polipéptido de 60 aminoácidos, conocido como homeodominio (HD), el cual representa el dominio de unión al DNA y contiene un motivo de cuatro aminoácidos altamente conservado denominado “YPWM”, involucrado en interacciones proteínaproteína. En este trabajo se investigó la paradoja de los genes Hox, que consiste en determinar el mecanismo mediante el cual homeoproteínas altamente similares adquieren distintas funciones durante el desarrollo. Se realizó la disección molecular de Antenapedia (Antp) para determinar su actividad funcional durante el desarrollo de D. melanogaster. Para ello se realizó el análisis mutacional de YPWM, el enlazador entre el HD y YPWM, así como la sustitución y fusión al dominio de represión WRPW en la actividad funcional que permite la activación y represión de los genes blanco de Antp. La mutación de YPWM en Antp mostró que este motivo es necesario e indispensable para la función in vivo de Antp en la involución de la cabeza, en las transformaciones torácicas T1 a T2 y tarsales mediante represión de los genes de la antena y activación de los genes tarsales. Esta función dual del motivo YPWM también se mostró en la activación y represión de los 60

genes blanco de Antp, ya que se requirió para la activación ectópica de los genes blanco teashirt (tsh) y grain (grn), así como para represión endógena de Scr y ectópica de Salm y dan. La sustitución y fusión del motivo WRPW rescataron e incrementaron, respectivamente, la actividad represora de YPWM en Antp, sin afectar su activación funcional en las transformaciones tarsales ni en la activación de los genes blanco de Antp analizados. Por otro lado, las variaciones en el número de aminoácidos que separan YPWM del HD en las isoformas de Antp incrementaron preferencialmente la eficiencia de Antp para la actividad de represión o activación, lo que sugiere su participación en la especificidad funcional de Antp. Los resultados obtenidos permiten concluir que el tetrapéptido YPWM de Antp tiene una función dual para la activación de los genes requeridos en la inducción del tarso, así como la represión de los genes antena, ya que mostró ser indispensable y crucial para la activación y represión de los genes blanco de Antp en diferentes etapas del desarrollo de D. melanogaster. Lo anterior es altamente relevante, ya que la actividad funcional de los diferentes genes blanco se regula por interacciones proteína-proteína, a través del tetrapéptido YPWM, modulando la selección de los genes blanco de Antp, que permiten el desarrollo del tórax y reprimen los genes de la cabeza en D. melanogaster. Este mecanismo molecular de activación-represión génica sugiere la interacción con diferentes cofactores (activadores o represores), en una forma dinámica que permite la especificidad funcional de Antp durante el desarrollo de D. melanogaster. Palabras clave: D. melanogaster, Antenapedia, YPWM, WRPW. ABS TRA CT ABSTRA TRACT The homeotic genes are involved in the genetic conCIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


trol of development of the different organisms the specification of body plan. These genes have a highly conserved sequence known as homeobox, which encodes a polypeptide of 60 aminoacids known as homeodomain (HD), which represents the DNA binding domain and contains four highly conserved amino acids called «YPWM», involved in proteinprotein interactions. In this study the paradox of Hox genes is studied, to determine the mechanism by which highly related homeoproteins acquire different functions during development. We performed molecular dissection of Antennapedia (Antp) to determine their functional activity during development of D. melanogaster. To do this, we performed mutational analysis of YPWM, the link between HD and YPWM, as well as the substitution and fusion into the WRPW domain of repression to dtermine the functional activity that allow activation and repression of target genes Antp. The mutation of YPWM showed that this motif is necessary and indispensable for the in vivo function of Antp in the involution of the head, in the thoracic transformations of T1 to T2, and in the tarsal transformation through repression of genes of the antenna and tarsal gene activation. This dual function of YPWM was also shown in the activation and repression of target genes Antp because it was required for ectopic activation of target genes teshirt (tsh) and grain (grn), as well as for endogenous repression of Scr and ectopic repression of Salm and dan. The replacement and fusion of the WRPW motif rescued and increased respectively the repressive activity of YPWM in Antp, with no effect on the functional activation of tarsal changes, or in the activation of the analyzed Antp target genes. On the other hand, variations in the number of amino acids which naturally separate YPWM from HD in the Antp isoforms preferentiallly increased efficiency of Antp for repression or activation activity, suggesting


its involvement in the funcional specificity of Antp. The results obtained indicate that the tetrapeptide YPWM of Antp has a dual role in the activation of genes required for the induction of tarsus, as well as the repression of antenna genes, which proved to be essential and crucial for the activation and repression of genes target of Antp in different developmental stages of D. melanogaster. The latter is highly relevant, as the functional activity of the different target genes can be regulated by protein-protein interactions, through the tetrapeptide YPWM modulating the selection of target genes that allow the development of thorax by Antp and repress the head genes in D. melanogaster. The molecular mechanism of activation and repression gene suggests interaction with different cofactors (activator or repressors) in a dynamic way that allows the functional specificity of Antp during development of D. melanogaster. Keywords: D. melanogaster, Antennapedia, YPWM, WRPW. AGRADECIMIENTOS Los autores agradecen al grupo del Prof. Walter Gehring, de la Universidad de Basilea, en Suiza, por la colaboración, apoyo y discusión al presente trabajo. Asimismo, al Conacyt, por el apoyo en el proyecto 39479-Q, y al Paicyt, con el proyecto CN1341-06. D.L. Cárdenas y K. Villanueva agradecen el apoyo de las becas de Conacyt 46659 y 167042, respectivamente. REFERENCIAS 1.

Gehring, W. Homeoboxes in the study of development. Science 1987; 236: 1245-1252.


Lewis, E. A gene complex controlling segmentation in Drosophila. Nature 1978; 276(5688): 565-70.


McGinnis W. and Krumlauf R. Homeobox genes and axial



patterning. Cell 1992; 68(2) : 283-302. 4.




Gehring W.J., Kloter U., Suga H. Evolution of the Hox

control of gene expression in Drosophila by means of

gene complex from an evolutionary ground state. Curr Top

tetracycline responsive promoters Development 1998

Dev Biol. 2009; 88: 35-61.


Kmita-Cunisse M., Loosli F. et al. Homeobox genes in the

15. Reséndez-Pérez, D., Canales-del Castillo, et al. Arquitec-

ribbonworm Lineus sanguineus: evolutionary implications.

tos moleculares en el diseño del cuerpo: análisis funcional

Proc Natl Acad Sci USA. 1998; 95 (6): 3030-3035.

de Antennapedia en Drosophila. CiENCiAUANL 2002.

McGinnis, W., Garber, R. et al. A homologous protein-

V3: 305-315.

coding sequence in Drosophila homeotic genes and its

16. Moreno-Rocha, J.C., Rodríguez-Padilla, C. et al. Visuali-

conservation in other metazoans. Cell 1984; 37(2): 403-

zación de la expresión específica de tejido mediante mi-


croscopía confocal láser. CiENCiAUANL 2004 VII:3348-

Scott M.P. and Weiner A.J. Structural relationships among


genes that control development : sequence homology bet-

17. Villanueva-Segura, O.K. Efecto del motivo WRPW en la

ween the Antennapedia, Ultrabithorax and fushi tarazu

actividad funcional de Antennapedia en Drosophila mela-

loci of Drosophila. Proc Natl Acad Sci USA. 1984; 81(13): 4115-4119. 8.

Gehring, W., Y. Qian, et al. Homeodomain-DNA recognition. Cell 1994; 78(2): 211-23.


14. Bello, B., Reséndez-Pérez, D. et al. Spatial and temporal

nogaster Tesis de maestría, FCB/UANL 2007. 18. Sullivan, M., Hawley, R.S. Asburner, M. Drosophila Protocols CSH Laboratory Press 2000. 19. Canales-del-Castillo, R. Actividad funcional del tetrapép-

Qian, Y.Q., Otting G., Furukubo-Tokunaga K., Affolter

tido YPWM de Antennapedia en la regulación de los ge-

M., Gehring W.J. and Wuthrich K. NMR structure

nes blanco durante el desarrollo embrionario de Drosophi-

determination reveals that the homeodomain is connected

la melanogaster. Tesis de maestría en ciencias, FCB/UANL,

through a flexible linker to the main body in the Droso-


phila Antennapedia protein. Proc. Natl. Acad. Sci. 1992; 89: 10738-42. 10. Qian, Y.Q., Reséndez-Pérez, D. et al. The des(1-6) Anten-

20. Brand A.H., Manoukian A.S. and Perrimon N. Ectopic expression in Drosophila. Methods Cell Biol. 1994; 44: 635-654.

napedia homeodomain: Comparison of the NMR solution

21. Gibson, G. and W. Gehring. Head and thoracic transfor-

structure and the DNA-binding affinity with the intact

mations caused by ectopic expression of Antennapedia

Antennapedia homeodomain. Proc. Natl. Acad. Sci. USA

during Drosophila development. Development 1988;

1994 91:4091-4095.

102(4): 657-675.

11. Prince, F., Katsuyama T. et al. The YPWM motif links

22. Kaufman, T.C., Seeger, M.A. and Olsen, G. Molecular

Antennapedia to the basal transcriptional machinery. De-

and genetic organization of the Antennapedia gene complex

velopment 2008; 135 : 1669-1679.

of Drosophila melanogaster. Adv. Genet. 1990; 27: 309-

12. Green, M.R. and Sambrook, J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York Fourth Edition. 13. Cárdenas-Chávez, D.L. Purificación de las proteínas An-

362. 23. Panganiban G., Sebring A., et al. The development of crustacean limbs and the evolution of arthropods. Science 1995; 270(5240): 1363-1366.

tennapedia, GAL4 y mutantes en el tetrapéptido YPWM:

24. Struhl, G.A gene product required for correct initiation of

Dominio de represión transcripcional en Antennapedia.

segmental determination in Drosophila. Nature1981;

Tesis de Maestría en Ciencias FCB/UANL 2007.

293(5827): 36-41.




25. Duffy J.B. GAL4 system in Drosophila: A fly geneticist´s swiss army knife. Genesis 2002;34: 1-15. 26. Li, X., Murre C. et al. Activity regulation of a Hox protein and a role for the homeodomain in inhibiting

35. Zeng, W., D. Andrew, et al. Ectopic expression and function of the Antp and Scr homeotic genes: the N terminus of the homeodomain is critical to functional specificity. Development 1993; 118(2): 339-352.

transcriptional activation. EMBO J. 1999; 18: 198-211.

36. Lohr, U., M. Yussa, et al. Drosophila fushi tarazu, a gene

27. Wainwright S.M. and Ish-Horowicz D. Point mutations

on the border of homeotic function. Curr. Biol. 2001;

in the Drosophila hairy gene demonstrate in vivo requirements for basic, helix-loop-helix and WRPW domains. Mol. Cell. Biol. 1992; 12(6): 2475-2483. 28. Goldstein, R.E., Jiménez G. et al. Huckebein repressor activity in Drosophila terminal patterning is mediated by Groucho. Development 1999; 17: 3747-55.

11(18): 1403-12. 37. Rauskolb C. and Wieschaus E. Coordinate regulation of downstream genes by extradenticle and the homeotic selector proteins. EMBO J. 1994; 13(15): 3561-3569. 38. Papadopoulos D.K., Reséndez-Pérez D., Cárdenas-Chávez D.L., et al. Functional synthetic Antennapedia genes and

29. Dawson, S.R., Turner D.L. et al. Specificity for the hairy/

the dual roles of YPWM motif and linker size in

enhancer of split basic helix-loop-helix (bHLH) proteins

transcriptional activation and repression. PNAS 2011; 108

maps outside the bHLH domain and suggest two separable modes of transcriptional repression. Mol. Cell. Biol. 1995; 15: 6923-6931. 30. Fisher, A.L., Ohsako, S., Caudy, M. The WRPW motif of the hairy-related basic helix-loop-helix repressor proteins

(29):11959-64. 39. Grieder N.C. et al. Spalt major controls the development of the notum and of wing hinge primordia of the Drosophila melanogaster wing imaginal disc. Dev Biol 2009; 329:315–326.

acts as a 4-amino-acid transcription repression and protein-

40. Riley P.D., Carroll S.B. and Scott M.P. The expression

protein interaction domain. Mol. Cell. Biol 1996; 16:

and regulation of Sex combs reduced protein in Droso-


phila embryos. Genes Dev. 1987; 1(7): 716-730.

31. Parkhurst, S.M. Groucho: making its Marx as a

41. Pelaz S., Urquía N. and Morata G. Normal and ectopic

transcriptional co-repressor. Trends. Genetic. 1998; 14:

domains of the homeotic gene Sex combs reduced of Dro-


sophila. Development 1993; 117(3): 917-923.

32. Löhr U. and Pick L. Cofactor-interactions motifs and the

42. Tolkunova E.N., Fujioka M., et al. Two distinct types of

cooption of a homeotic Hox protein into the segmentation

repression domain in engrailed: one interacts with the

pathway of Drosophila melanogaster. Curr Biol. 2005;

groucho corepressor and is preferentially active on

15(7): 643-649.

integrated target genes. Mol Cell Biol. 1998; 18(5): 2804-

33. McCormick A., Coré N., et al. Homeotic response


elements are tightly linked to tissue-specific elements in a transcriptional enhancer of the teashirt gene. Development 1995; 121: 2799-2812.

Recibido: 1 de septiembre de 2012 Aceptado: 1 de septiembre de 2012

34. Roder, L., C. Vola, et al. The role of the teashirt gene in trunk segmental identity in Drosophila. Development 1992; 115(4): 1017-1033.



&,(1&,$ ;98$1/ $











Autonomía y bienestar en las mujeres divorciadas BLANCA MIRTHALA TAMEZ VALDEZ*, MANUEL RIBEIRO FERREIRA**

El divorcio constituye un fenómeno social en expansión, ya que tanto en el estado de Nuevo León, como a nivel nacional, se advierte un notorio incremento en las últimas décadas (figura 1). No obstante, el comportamiento es distinto al observado en países desarrollados, apareció más tarde y sin llegar aún a los niveles observados en dichos países: España presentó una tasa de 59% en 1991; en Estados Unidos, 50% de los matrimonios llegó al divorcio en 1998, y Austria alcanzó 65% en 2005.1 En los países más industrializados son marcadas diferencias en torno a dicho fenómeno: por un lado, en Estados Unidos, Reino Unido, Suecia y Noruega se observó un pronunciado incremento a fines del siglo pasado, mientras que en los últimos años se han estabilizado sus tasas de divorcio; por otro lado, España, Francia e Italia muestran, hasta el momento, un incremento sostenido en el registro de divorcios. De acuerdo con estadísticas oficiales brindadas por Eurostat,a tan sólo entre 1998 y 2005, España presentó un incremento de 100%, Italia, a su vez, lo vio incrementarse en 40%, y Francia en 30%.1 a

Eurostat (Oficina Estadística de la Unión Europea). Fundada en 1953, su cometido es reunir y analizar datos de los diferentes institutos de estadística europeos y producir datos comparables a nivel de la UE. El presente artículo está basado en la investigación “Autonomía y bienestar en las mujeres divorciadas”, galardonada con el Premio de Investigación UANL 2012, en la categoría de Ciencias Sociales, otorgado en sesión solemne del Consejo Universitario, en septiembre de 2012.


En México, durante las últimas décadas, se advierte una clara tendencia ascendente, siendo aún más evidente a nivel estatal. De acuerdo con las estadísticas oficiales, entre 1971 y 2008 la relación entre el número de divorcios registrados por cada 100 matrimonios prácticamente se ha cuadruplicado a nivel nacional, en el transcurso de las últimas cuatro décadas. En el estado de Nuevo León llama la atención el comportamiento causado por el divorcio, el cual se ha triplicado en lo que va del presente siglo (figura 1).2 Además del sostenido incremento del divorcio, un elemento de suma importancia para su estudio estriba en que éste representa un signo de los cambios observados en la disolución conyugal.b A nivel sociodemográfico, conforma uno de los principales indicadores de la llamada “segunda transición sociodemográfica”, que a su vez se vincula a una serie de transformaciones ocurridas al interior de la familia, ligadas de manera directa con un cambio en el papel de la mujer, especialmente el aumento en el


En México, la principal forma de disolución conyugal ha sido la viudez y, en menor medida, la ruptura o separación de los cónyuges. A partir de los datos señalados, esta última cobra cada vez mayor importancia en el país aun cuando sigue constituyendo la segunda en proporción.

* Universidad Autónoma de Nuevo León, FTS. CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


Fig. 1. Relación de divorcios por cada 100 matrimonios a nivel nacional y en el estado de Nuevo León. Fuente: Elaboración propia con datos del INEGI (2009).

nivel de su autonomía, así como de los nuevos significados adquiridos por estos cambios en las relaciones familiares. A nivel microsocial, en la dimensión familiar, el divorcio consiste en un proceso de ruptura y transformación familiar que muestra una creciente y compleja diversidad, lo que ha tornado el fenómeno en diverso y heterogéneo, haciendo hincapié en la necesidad de incorporar su estudio dentro del análisis de las transformaciones familiares, particularmente en México, donde los estudios con respecto a esta cuestión son escasos. El aumento del divorcio conforma un indicador relevante de las transformaciones sociales y familiares, cuyo análisis permite adentrarse de manera alterna en las transformaciones ocurridas a nivel macrosocial, así como en las repercusiones de éstas en los cambios ocurridos al interior de la familia. Además, la situación diferencial que enfrentan las mujeres, tanto al interior de la familia como en el mercado laboral, aunado a los reportes de los estu-


dios realizados sobre los efectos del divorcio en las mujeres,3-8 indica una situación de mayor vulnerabilidad en ellas, en particular por el hecho de que generalmente conservan la custodia de los hijos y conforman en gran medida familias de tipo monoparental; mientras en lo laboral, en ocasiones dejaron de trabajar, otras veces mantuvieron una carrera intermitente a partir del ciclo de vida familiar, o se mantuvieron trabajando tiempo parcial en muchos casos, dificultando su reincorporación a un trabajo de tiempo completo y en condiciones propicias para enfrentar la jefatura del hogar y responsabilizarse de las necesidades familiares. Esto resalta la importancia del estudio de estos efectos en este grupo particular. El presente documento muestra los resultados de un estudio realizado sobre el divorcio en el área metropolitana de Monterrey, enfocado en la relación entre el nivel de autonomía que las mujeres perciben haber tenido antes y después del divorcio y su nivel de bienestar. La perspectiva teórica que guía la interpretación de los resultados obtenidos se encuentra conformada principalmente por la teoría de la estructuración y praxis social de Giddens,9 que de la mano con los conceptos de agencia y bienestar desarrollados por Sen,10 y en combinación con la perspectiva de género, brinda las herramientas de análisis que permiten la lectura de la evidencia obtenida. OBJETIV O DEL ES TUDIO OBJETIVO ESTUDIO Estudiar la relación presente entre el nivel de autonomía percibido por las mujeres que alguna vez han enfrentado el divorcio, tanto durante su matrimonio, como después del divorcio y el nivel de bienestar que ellas señalan tener; además, revisar los efectos, sociales y materiales, señalados por las mujeres tras el divorcio, centrándose en las mujeres divorcia65


das que viven en el área metropolitana de Monterrey. HIPÓTESIS PLANTEAD AS PLANTEADAS A. El nivel de autonomía percibido por las mujeres presenta un aumento después del divorcio. B. El nivel de bienestar que las mujeres perciben será mayor en el momento posterior al divorcio. C. A mayor nivel de autonomía percibido por las mujeres con respecto al momento anterior al divorcio, menores efectos negativos presentarán tras el divorcio. D. A mayor nivel de autonomía percibido por las mujeres de manera posterior al divorcio, menores efectos negativos se presentarán en este grupo de estudio. E. El nivel de autonomía que las mujeres perciben durante el matrimonio influye en el nivel de bienestar que percibieron durante el mismo período. F. El nivel de autonomía que las mujeres perciben, después del divorcio, influye en el nivel de bienestar de éstas en el mismo momento. MÉTODO El estudio siguió un diseño de tipo transversal, cuantitativo y correlacional, a través del cual se aplicaron 779 cédulas a 322 hombres y 457 mujeres que alguna vez enfrentaron el divorcio y viven en el área metropolitana de Monterrey. La aplicación se realizó entre los meses de noviembre de 2009 y septiembre de 2010, incorporándose principalmente ocho de los diez municipios que conforman el área metropolitana de Monterrey: Monterrey, San Nicolás de los Garza, Guadalupe, San Pedro, Santa Catarina, Apodaca, Escobedo y Juárez. El instrumento diseñado para el estudio consiste en una cédula con un total de 219 preguntas, de las 66

cuales 189 son de opción múltiple y 30 abiertas. La cédula fue elaborada por el equipo de investigadores dirigido por Manuel Ribeiro, tras una revisión exhaustiva, tanto de bibliografía en torno al tema, como de otros estudios que abordan distintos aspectos del fenómeno en cuestión. Asimismo, fue validada por jueces expertos en el tema, probada y corregida a través de una prueba piloto y revisada de forma exhaustiva por el equipo investigador. Para su aplicación se utilizó la entrevista dirigida. Las dimensiones que contiene el instrumento elaborado son: a) datos de identificación, b) composición familiar, c) matrimonio, divorcio e hijos, d) trabajo, e) relación con excónyuge, f ) salud, g) estado de ánimo, h) situación antes y después del divorcio, i) apoyos j) autonomía, k) bienestar, l) ingresos familiares. Muestra Se diseñó una muestra no probabilística para el estudio, al no contar con datos de localización de los sujetos de estudio; siendo mixta, se eligieron, en un primer momento y de forma aleatoria, las zonas de aplicación: áreas geoestadísticas básicas (AGEB) y muestreo por cuota para la selección de personas divorciadas en cada AGEB. Se buscó la representatividad de las distintas zonas del área metropolitana y que la selección de AGEB se encontrara conformada por distintos niveles socioeconómicos. Para el cálculo de la muestra, se consideró el total de áreas geoestadísticas básicas (AGEB) contenidas en el área metropolitana de Monterrey, siendo éste de 1200 unidades. Para calcular las AGEB requeridas en la muestra, de acuerdo a la fórmula aplicada, se consideró un margen de error de .05 y un alfa o intervalo de confianza de 95%. La muestra se calculó de acuerdo con la fórmula siguiente:



ĹðĂ&#x201A;Č&#x192;Ă&#x201A;SĂ&#x201A;T Q ²²²²²²² Ǩð_Č&#x192;O_ ĹðĂ&#x201A;SĂ&#x201A;T

Se obtuvo como resultado 298 AGEB (tamaĂąo de muestra con alfa de 95% y margen de error de 0.5). Se seleccionaron 300 AGEB, cuya relaciĂłn quedĂł distribuida de la siguiente manera: en Monterrey fueron seleccionadas 123 AGEB (41%), en San NicolĂĄs de los Garza 21 AGEB (7%), en Guadalupe 42 AGEB (14%), en Apodaca 37 AGEB (12%), en Escobedo 29 AGEB (9.7%), en Santa Catarina 25 AGEB (8.3%), en San Pedro 12 AGEB (4%) y en JuĂĄrez 11 AGEB (3.7%). El porcentaje se determinĂł con base en la proporciĂłn de AGEB de cada municipio, en relaciĂłn con el total del ĂĄrea metropolitana de Monterrey. En una segunda fase se diversificĂł el mĂŠtodo de captaciĂłn de los sujetos de investigaciĂłn, recurriĂŠndose a diversas fuentes que facilitaran el acceso a ĂŠstos: como grupos de apoyo a divorciados en diversos municipios de dicha ĂĄrea (San Pedro, Guadalupe, San NicolĂĄs de los Garza y Escobedo); quienes acuden al Tribunal EclesiĂĄstico de Nuevo LeĂłn para solicitar la anulaciĂłn de su matrimonio religioso; y voluntarios que acudieron a dos juzgados de lo familiar en Monterrey. La incorporaciĂłn de estas fuentes brindĂł la posibilidad de ampliar y diversificar la muestra, captando personas que realizaron su divorcio en distintos tiempos, sumĂĄndose tanto casos recientes como los de personas que presentaban mayor tiempo de divorciados, lo cual facilitĂł el anĂĄlisis de las principales variables incluidas en relaciĂłn al tiempo transcurrido tras el divorcio. Cabe seĂąalar que aĂşn despuĂŠs de diversificar las fuentes de captaciĂłn, se cuidĂł que las encuestas captadas se ajustaran a la distribuciĂłn esperada en los distintos municipios del ĂĄrea seĂąalada, respetĂĄndose la proporciĂłn de poblaciĂłn que vive en los distintos municipios de la misma. Criterios de inclusiĂłn:

CIENCIA UANL / AĂ&#x2018;O 15, No. 60, OCTUBRE - DICIEMBRE 2012

¡ ¡ ¡

Haber enfrentado el proceso de divorcio, por lo menos una vez Haber concluido su trĂĄmite de divorcio legal Vivir en el ĂĄrea metropolitana de Monterrey.

Criterios de exclusión: ¡


Personas que no han concluido su trĂĄmite de divorcio legal y se encuentran Ăşnicamente separados. Personas que no viven en el ĂĄrea seĂąalada.

Cabe seĂąalar que a partir de ĂŠstos fueron incluidas en el estudio mujeres que enfrentaron alguna vez el divorcio, independientemente del nĂşmero de divorcios enfrentados, asĂ­ como de su estado civil actual y el tiempo transcurrido despuĂŠs de su divorcio. ANĂ LISIS DE RESUL TADOS RESULT Perfil sociodemogrĂĄfico del grupo de estudio El grupo de estudio estuvo conformado por 457 mujeres, cuya edad fluctuĂł entre los 19 y 82 aĂąos, con una media de 40 aĂąos; una escolaridad promedio de 14 aĂąos aprobados en la educaciĂłn formal, fluctuando entre 0 y 26 aĂąos; advirtiĂŠndose que supera mucho al promedio de escolaridad en la poblaciĂłn general (nueve aĂąos), segĂşn las cifras oficiales (INEGI, 2011). El estado civil que predomina entre las participantes es el de divorciadas (siete de cada diez), siguiendo las casadas en segundas o terceras nupcias (dos de cada diez), el resto estĂĄ constituido por quienes viven en uniĂłn libre (siete de cada cien) y, en mĂ­nima proporciĂłn (una de cada cien), por quienes enviudaron o se encuentran separadas de un segundo matrimonio. En torno a la actividad econĂłmica que realizan, se observĂł que 83% se encuentra incorporado al 67


mercado laboral al momento del estudio, resaltando que de ellas 70% comenzó a hacerlo de forma previa a su divorcio, mientras que 9% lo hizo al mismo tiempo que se divorciaba, únicamente 21% inició su actividad laboral de forma posterior al divorcio. Esta evidencia muestra que las mujeres participantes trabajaron regularmente durante su matrimonio en mayor proporción que la población total de mujeres casadas lo hace actualmente (39%), de acuerdo con los datos oficiales mostrados por la Encuesta Nacional de Ocupación y Empleo (INEGI, 2010). Características del matrimonio Entre las características del matrimonio resalta la duración legal,c que en promedio fue de nueve años, con un rango de 45 (0 a 45 años). Asimismo, la situación de homogamiad presente en las parejas, por un lado, se observó que en torno a edad la mitad de las participantes refirió presentar homogamia, al mostrar una ligera o nula diferencia con su expareja (0 a 2 años). Sin embargo, una proporción muy similar señaló tener una diferencia de entre 3 y 28 años, siendo mayor el varón; mientras que solamente cinco de cada cien presentan una edad mayor al varón (entre 3 y 20 años). Por el contrario, con respecto a la escolaridad, los datos indican que seis de cada diez parejas presentan nula o escasa diferencia (0 a 2 años) con su expareja; pero en torno a la heterogamia sobresale que la cuarta parte mostró mayor escolaridad que el hombre con quien estuvieron casadas (3 a 12 años), mientras que en sólo quince de cada cien la escolari-


El estudio presentado realiza una distinción entre la duración legal que corresponde al tiempo que la pareja permaneció casada legalmente y la duración social que implica el tiempo que permanecieron viviendo juntos, es decir, hasta la separación física de la pareja. d Homogamia es el término utilizado para referirse a la igualdad presente entre los miembros de la pareja en torno a aspectos como: escolaridad, edad, posición social, etc.


dad es mayor en su expareja (3 a 11 años). Lo anterior indica que las mujeres igualaron o superaron la escolaridad de su expareja, aunque por limitantes del estudio, ignoramos en qué momento ocurrió. Características del divorcio Las participantes en el estudio presentan una media de 7.54 años de divorciadas, con un rango de 44 (0 a 43 años), aunque generalmente estuvieron separadas en promedio 18 meses y pensaron en el divorcio durante un promedio de 21 meses antes de la separación. En cuanto a la iniciativa de divorciarse, en seis de cada diez casos lo decidió la mujer; en tanto que en sólo dos de cada diez casos lo decidieron ambos y, en menor proporción, fue la expareja quien lo hizo. Con respecto al tipo de divorcio, la mayoría (siete de cada diez) decidió por el divorcio voluntario, una séptima parte tuvo un divorcio necesario, en igual proporción tramitaron un divorcio administrativo, y solamente en una de cada cien procedió la anulación del matrimonio. En torno a la custodia de los hijos, 90% de quienes tenían hijos menores de edad al momento del divorcio conservó la custodia, en tanto siete de cada diez mujeres indicó vivir actualmente con alguno de sus hijos; la cuarta parte señaló no haber tenido hijos. La prueba de hipótesis Para medir el incremento en el nivel de autonomía que las mujeres perciben entre el periodo anterior al divorcio y el actual, planteado en la hipótesis “A”, se utilizó la prueba t para comparar la media de los puntajes obtenidos en cada una de las variables en cuestión: nivel de autonomía que las mujeres perciben durante su matrimonio y nivel de autonomía que perciben al momento del estudio. Se observó un valor de



t = 14.360, el cual indica una diferencia estadĂ­sticamente significativa en la percepciĂłn de ambos momentos (tabla I). La prueba estadĂ­stica permite retener la hipĂłtesis planteada, lo que indica un incremento estadĂ­sticamente significativo, en torno al nivel de autonomĂ­a que las mujeres perciben despuĂŠs del divorcio.

Tabla I. Medidas de tendencia central en ambos puntajes.







Para probar la hipĂłtesis â&#x20AC;&#x153;Bâ&#x20AC;? del presente estudio, tambiĂŠn se utilizĂł la prueba t, de tal forma que permitiese analizar la diferencia estadĂ­stica entre los puntajes obtenidos en: nivel de bienestar que las mujeres perciben durante su matrimonio y nivel de bienestar que perciben despuĂŠs del divorcio. Se obtuvo un valor de t = 20.759, que indica la existencia de una diferencia estadĂ­sticamente significativa entre ambos puntajes, y permiten retener la hipĂłtesis â&#x20AC;&#x153;Bâ&#x20AC;?, que plantea un incremento significativo en el momento posterior (tabla II). En la prueba estadĂ­stica realizada para confrontar la evidencia empĂ­rica con el planteamiento de las hipĂłtesis â&#x20AC;&#x153;Câ&#x20AC;? y â&#x20AC;&#x153;Dâ&#x20AC;?, se eligiĂł la prueba de regresiĂłn lineal, que fue corrida luego de revisar detenidamente los valores de correlaciĂłn presentes entre la variable dependiente: efectos percibidos por las mujeres tras el CIENCIA UANL / AĂ&#x2018;O 15, No. 60, OCTUBRE - DICIEMBRE 2012

divorcio y las variables independientes, entre las que destacan las referidas al nivel de autonomĂ­a percibido por las mujeres, tanto de forma anterior, como posterior al divorcio. A partir de los valores arrojados por la prueba estadĂ­stica, es posible retener la hipĂłtesis â&#x20AC;&#x153;Dâ&#x20AC;?, que seĂąala una relaciĂłn entre el nivel de autonomĂ­a posterior al divorcio y los menores efectos enfrentados tras el divorcio, pero no asĂ­ la hipĂłtesis â&#x20AC;&#x153;Câ&#x20AC;? que indica una relaciĂłn entre el nivel de autonomĂ­a durante el matrimonio y dichos efectos tras el divorcio, misma que se rechaza a partir del resultado obtenido (tabla III). Cabe seĂąalar que en torno a la percepciĂłn de los efectos que las participantes indicaron, se observa que la mayorĂ­a, 94%, indicĂł una clara mejorĂ­a en su situaciĂłn al comparar varias situaciones (salud, trabajo, estado de ĂĄnimo, sentimientos de soledad, sentimientos de felicidad, relaciĂłn con los hijos, situaciĂłn econĂłmica, vida amorosa, vida social y relaciones con amigos), entre el momento anterior al divorcio y el posterior al mismo; mientras que la minorĂ­a indicĂł percibir un empeoramiento de su situaciĂłn, principalmente en la relaciĂłn con su expareja.

Tabla II. Medidas de tendencia central en puntajes obtenidos en la percepciĂłn de bienestar.






t= 20.759 significancia estadĂ­stica=.000.



Tabla III. Modelo que explica el nivel de efectos enfrentados tras el divorcio.








 Al realizar un anĂĄlisis mĂĄs fino, que permitiese distinguir los grupos de mujeres que presentan mejorĂ­a de las que no la perciben, llama la atenciĂłn que las diferencias en torno a la percepciĂłn de estos efectos no son significativas a partir de su situaciĂłn de trabajo, ni por el hecho de tener o no hijos, como tampoco se denota influencia del tiempo que llevan de divorciadas; la diferencia significativa aparece en funciĂłn principalmente de la iniciativa tomada en relaciĂłn al divorcio, asĂ­ como de forma menos significativa en cuanto a la escolaridad de la mujer. A fin de probar la relaciĂłn planteada por la hipĂłtesis â&#x20AC;&#x153;Eâ&#x20AC;? entre el nivel de autonomĂ­a que las mujeres perciben haber tenido durante su matrimonio y el bienestar mostrado en ese mismo momento, se utilizĂł la prueba de regresiĂłn lineal, para determinar si la hipĂłtesis independiente es mantenida por el modelo de regresiĂłn que explica o predice la variable dependiente. De esta forma, el anĂĄlisis estadĂ­stico permite retener la hipĂłtesis â&#x20AC;&#x153;Eâ&#x20AC;?, tanto por el nivel de significancia del modelo arrojado por la prueba, 70

como por el valor elevado mostrado por la variable independiente, cuya varianza permite explicar en gran medida a la variable dependiente (tabla IV).

Tabla IV. Modelo que explica el bienestar que las mujeres perciben haber tenido durante el matrimonio.








No obstante, llama la atenciĂłn que, por un lado, la duraciĂłn legal del matrimonio influye directamente en el nivel de bienestar; por otro lado, la duraciĂłn social del mismo muestra una relaciĂłn inversa con el bienestar. Ello sugiere que una mayor convivencia con la expareja influye de manera inversa en el nivel de bienestar que la mujer percibiĂł durante el matrimonio, a diferencia de la combinaciĂłn de nivel de autonomĂ­a con la duraciĂłn legal del matrimonio y la edad, las cuales, al incrementarse, ven aumentar su percepciĂłn de bienestar. Finalmente, al probar la hipĂłtesis â&#x20AC;&#x153;Fâ&#x20AC;? se buscĂł la relaciĂłn presente entre el nivel de autonomĂ­a percibido al momento posterior al divorcio con el bienestar en el mismo momento. A partir del valor arrojado por la prueba, se advierte que en gran medida el nivel de bienestar posterior al divorcio se explica o predice por la varianza de una combinaciĂłn entre el nivel de autonomĂ­a percibido por las mujeres tras

CIENCIA UANL / AĂ&#x2018;O 15, No. 60, OCTUBRE - DICIEMBRE 2012


el divorcio con su nivel de escolaridad, lo que indica que se trata de una combinaciĂłn de recursos tanto autoritarios como distributivos, de acuerdo con lo seĂąalado por Giddens en su teorĂ­a de la estructuraciĂłn y praxis social (tabla V). CONCL USIONES CONCLUSIONES A partir de las evidencias empĂ­ricas, es posible seĂąalar que la percepciĂłn de las mujeres en torno a los

Tabla V. Modelo que explica el bienestar de las mujeres despuĂŠs del divorcio.






efectos del divorcio es principalmente de mejorĂ­a. De forma paralela a esta mejorĂ­a, se advierte el notorio incremento reportado por el grupo, tanto en el nivel de autonomĂ­a como en el de bienestar, al comparar el que percibieron antes del divorcio con el que perciben en un segundo momento, posterior al divorcio. Por un lado, en torno al nivel de autonomĂ­a se observĂł que siete de cada diez participantes percibiĂł un incremento en el mismo, siendo mĂĄs evidente en quienes indicaron tener un nivel bajo durante su matrimonio. El incremento fue mĂĄs notorio en torno a la libertad para decidir sobre su tiempo libre y la libertad para decidir sobre el ingreso

CIENCIA UANL / AĂ&#x2018;O 15, No. 60, OCTUBRE - DICIEMBRE 2012

familiar. Por otro lado, con respecto al nivel de bienestar, fueron ocho de cada diez mujeres quienes percibieron una mejorĂ­a de grado en torno al bienestar que muestran despuĂŠs del divorcio, observĂĄndose que el incremento de forma mĂĄs evidente se da en torno a la satisfacciĂłn que muestran con su nivel de autonomĂ­a, asĂ­ como la que presentan consigo mismas. Con respecto a la relaciĂłn observada entre el nivel de autonomĂ­a y el nivel de bienestar percibido por las mujeres, se advierte que la combinaciĂłn del nivel de autonomĂ­a y el nivel de escolaridad de la mujer, principalmente en el momento posterior al divorcio, predice en gran medida el nivel de bienestar y mejorĂ­a observada en los efectos. Ello permite retomar y confirmar el planteamiento realizado a la luz de la teorĂ­a de la estructuraciĂłn y praxis social, con respecto a que la combinaciĂłn de recursos en la mujer, tanto autoritarios (nivel de autonomĂ­a) como distributivos (nivel de escolaridad), le permite a la mujer cambiar su circunstancia, responsabilizĂĄndose de su situaciĂłn y la de sus hijos, para producir un cambio que conlleva mejoras en su calidad de vida y con ello su nivel de bienestar.9 Dicha combinaciĂłn de recursos (autoritarios y distributivos) predice o explica en forma significativa el nivel de bienestar mostrado por las mujeres de manera posterior al divorcio. De esta manera, las evidencias obtenidas parecen seĂąalar que las participantes, en promedio, vivieron un proceso de emancipaciĂłn, superĂĄndose en lo educativo (aĂąos de escolaridad), asĂ­ como en su participaciĂłn laboral, pero principalmente en torno a su participaciĂłn en la toma de decisiones y el control de sus recursos, lo que permitiĂł una sensible mejorĂ­a de su situaciĂłn luego del divorcio enfrentado. Los datos obtenidos parecen revelar que, a la par, tambiĂŠn estuvo presente un proceso al interior del matrimonio, en el que generalmente las mujeres decidieron divorciarse luego de algunos meses de pensarlo y, en ocasiones, tras una variable separaciĂłn fĂ­71


sica de su excónyuge. Por otro lado, a nivel macro es posible observar que las mujeres divorciadas conforman principalmente familias de tipo monoparental, especialmente cuando tienen hijos menores de edad, aunque también se advierte una tendencia a volver a unirse o casarse mayor a la presente en décadas anteriores, así como a regresar a su familia de origen o conformar hogares unipersonales, sobre todo cuando no tuvieron hijos. Asimismo, se denota que las mujeres divorciadas en promedio tienen una escolaridad mayor a la promedio, trabajan también en mayor medida, aun cuando tengan hijos, y demandan, por lo tanto, requerimientos de apoyo a la política social, particularmente a la laboral.

amount of independence that women perceive to have had at the moment prior to their divorce and soon after, and their state of well-being. The information analysis is performed under the Giddens theoretical perspective of structure and social praxis, reviewing the social phenomenon as a process involving break- up and family transformation; meanwhile incorporating the sociodemographic context. Keywords: Divorce, Autonomy, Welfare, Women. REFERENCIAS 1.

Eurostat (2009). Oficina Estadística de la Unión Europea. Instituto Nacional de Estadística en España. http://


El presente documento aborda el análisis de los resultados arrojados por un estudio sobre los efectos del divorcio, realizado en el área metropolitana de Monterrey. Se centra en la relación presente entre el nivel de autonomía que las mujeres perciben tanto en el momento previo al divorcio como posterior al mismo y su nivel de bienestar. El análisis de los datos se realiza desde la perspectiva teórica de la estructuración y praxis social de Giddens, con una revisión del fenómeno social como proceso de ruptura y transformación familiar; e incorpora a su vez el contexto sociodemográfico.

INEGI (2010). Estadísticas sobre Matrimonios y Divorcios. Aguascalientes: Instituto Nacional de Estadística, Geografía e Informática.


Bursik, K. (1991). Correlates of women’s adjustment during the separation and divorce process. In: Sandra S. Volgy (1991). Women and divorce, Men and divorce. Gender differences in separation, divorce and remarriage. New York: The Haworth Press.


Garvin, V.; N. Kalter & J. Hansell (1993).Divorced women: factors contributing to resilency and vulnerability. In: Journal of divorce & remarriage. Vol. 21(1/2). Pp.2139.


Henríquez, M. (1998). Significaciones en el proceso de divorcio. Estudios de caso en mujeres de sectores medios

Palabras clave: Divorcio, Autonomía, Bienestar, Mujeres.

de la Ciudad de México. México: Tesis para optar por el grado de maestría en antropología social. CIESAS: Centro de Investigaciones y Estudios Superiores en Antropo-


logía Social. 6.

This document discusses the analysis of the results obtained by a study on the effects of divorce, conducted in the metropolitan area of Monterrey, Mexico. It focuses on the relationship between the 72

Mauldin, T. (1991). Economic consequences of divorce or separation among women in poverty. In: Sandra Volgy. Women and divorce, Men and divorce. Gender differences in separation, divorce and remarriage. New York: The Haworth Press.




Molina, O. (1999). The effect of divorce on african american working women. In: Journal of divorce & remarriage, vol. 32 (1/2). pp.1-15.


Molina, O. (2000). Stresses and strengths of working


Giddens, A. (1984). The Constitution of Society. Outline of the Theory of Structuration. Cambridge: Polity Press.

10. Sen, A, (2002). Desarrollo y libertad. Barcelona: Editorial Planeta, S. A.

women in a divorce support group. In: Journal of divorce & remarriage, vol. 33 (3/4) pp. 145-160.

Recibido: 1 de septiembre de 2012 Aceptado: 1 de septiembre de 2012



&,(1&,$ ;98$1/ $











Violencia y perdón en personas con antecedentes de maltrato infantil. Diagnóstico del procesamiento cognitivo MA. ISOLDE HEDLEFS AGUILAR*, ERNESTO O. LÓPEZ RAMÍREZ*, GUADALUPE E. MORALES MARTÍNEZ*

El maltrato infantil se ha señalado como un factor de riesgo o predisposición para diferentes desórdenes emocionales (por ejemplo, trastorno por estrés postraumático, ansiedad).1-3 Asimismo, las experiencias de maltrato durante la infancia tienen un efecto poco favorable sobre el desarrollo psicosocial4 y causan cambios potencialmente adversos en la estructura y funcionamiento del cerebro.5-9 El maltrato infantil parece estar correlacionado con la aparición de desórdenes psiquiátricos y del comportamiento.8,10,11 En general, el rango de los síntomas del maltrato es muy amplio. Aunque las experiencias de abuso o daño físico, psicológico, emocional, sexual y abandono que dañan la integridad de una persona durante su infancia (el maltrato infantil) tienen consecuencias desfavorables a corto, mediano y largo plazo en su vida, es difícil medir el verdadero alcance de este fenómeno, El presente artículo está basado en la investigación “Nuevas formas de diagnóstico del procesamiento cognitivo de eventos de violencia y perdón en personas con antecedentes de maltrato infantil”, galardonada con el Premio de Investigación UANL 2012, en la categoría de Humanidades, otorgado en sesión solemne del Consejo Universitario, en septiembre de 2012.


porque no se cuenta con una cifra exacta del número de casos de maltrato infantil. Sin embargo, el Fondo de las Naciones Unidas para la Infancia (UNICEF)12 estima que, al año, entre 500 y 1,500 millones de niños padecen violencia, y señala que entre los países con mayor número de muertes por maltrato infantil se encuentran: México, Estados Unidos y Portugal.13 En el caso particular de México, el Sistema de Desarrollo Integral de la Familia Nacional (DIF)14 registró y comprobó entre 17,000 y 35,000 casos de maltrato infantil severo, durante el periodo que comprende 2001-2010, observó además una tendencia a incrementarse en los más años recientes. Las estadísticas disponibles a nivel mundial y en México señalan al maltrato infantil como un problema de amplio espectro social y de salud pública, por lo que han surgido esfuerzos académicos para ampliar la comprensión de este fenómeno. La mayoría de estos esfuerzos se ha centrado principalmente en la exploración de casos clínicos,15,16 la obtención de indicadores para la detección y prevención del maltrato infantil,17 y el estudio de la * Universidad Autónoma de Nuevo León, Laboratorio de Psicología Cognitiva, FaPsi.



transmisión intergeneracional de conductas de maltrato.18 Sin embargo, aún se conoce poco sobre el efecto de los eventos estresantes de violencia en la infancia sobre la estructura cognitiva de las personas que los experimentan. Hay poca información sobre qué tipo de mecanismos de procesamiento emocional preatentivo se instala, dados los antecedentes de maltrato y cómo es que posibles esquemas conceptuales disfuncionales en memoria a largo plazo sobre violencia se pueden organizar y mantener. Además, se desconoce cómo dichos mecanismos y esquemas regulan o influyen las estrategias cognitivas de afrontamiento exitosas ante el trauma de haber vivido violencia, por ejemplo, el caso del perdón humano. El perdón humano es un proceso mediante el cual los pensamientos, sentimientos y comportamientos negativos hacia el transgresor se transforman en aspectos positivos. Y algunos estudios señalan que a éste le subyace una estructura multifactorial que comprende al menos un factor de cambio de actitud hacia el agresor (cambio de corazón), un factor moral, un factor relacional (relación entre considerar dos o más personas) y un factor que motiva el arrepentimiento.19 La estructura mental del perdón se ha encontrado en adultos de África,20 Uruguay y Francia.21 En México, al igual que en otros países en desarrollo, se desconoce si la estructura factorial que subyace al proceso de perdón es similar a la encontrada en los estudios anteriores, también se desconocen los mecanismos cognitivos bajo los que se da este proceso en las personas que han sido maltratadas. Al respecto, es necesario considerar que en el caso del maltrato infantil, el perdón implica la recuperación o sanación de un antecedente de violencia por parte de un agresor,22-24 por lo que para que la persona maltratada pueda perdonar necesitará reformar e integrar en su estructura cognitiva la información sobre los eventos de maltrato que ha vivido, así como reconceptualizar a la persona que la ha maltratado. CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

Lo anterior significa que, en el proceso de perdón, los mecanismos cognitivos de evaluación emocional de la persona son especialmente relevantes. Sin embargo, dado que estos procesos se dan de manera implícita en una estructura cognitiva automática que no es accesible a la conciencia, ha sido difícil explorarlos, porque la mayoría de los instrumentos disponibles miden la estructura mental del perdón a nivel consciente y explícito, esto señala la necesidad de nuevas direcciones metodológicas en el estudio del perdón dentro del maltrato infantil. El empleo de instrumentos de medición implícita y automática, como los utilizados en el presente trabajo, es relevante en el estudio cognitivo del perdón y el maltrato infantil, porque nos permitirá determinar si las personas con antecedentes de maltrato que reportan recuperación presentan estilos de procesamiento automático emocional no concientizados que pueden representar un factor de riesgo para el desencadenamiento de desórdenes emocionales en situaciones de estrés extremo, también permitiría determinar si el estilo de procesamiento emocional automático en personas con maltrato infantil es diferente a los presentes en una población típica. Lo anterior representa uno de los principales intereses de esta investigación. Por otra parte, también se hipotetizó que habría diferencias de afrontamiento emocional por factor de género y de edad en los participantes, con y sin antecedentes de maltrato infantil. Y se asume que habría formas de procesamiento automático emocional atípico en las poblaciones con antecedentes de maltrato25,26 que involucrarían sesgos evaluativos disfuncionales (atípicos)27 sobre el contenido de información violencia. Son éstos los que tipifican a una persona con antecedentes de maltrato que no ha establecido estrategias de afrontamiento exitosas ante su experiencia de maltrato. En contraste, se asume que el afrontamiento exitoso de la persona que se 75


reporta completamente recuperada no debe mostrar procesamiento automático atípico cuando evalúa información de violencia, y es probable que dicho procesamiento involucre el uso de reglas cognitivas específicas (álgebra cognitiva implícita) aún desconocidas en esta área del comportamiento humano.28 Finalmente, formas de significar el perdón, dada una representación mental, pueden estar asociadas al mantenimiento de un procesamiento emocional disfuncional sobre la información de violencia, como en el caso de los desórdenes emocionales de la ansiedad y la depresión.27 No hay evidencia académica al respecto, y en este sentido la presente investigación aporta información nueva y valiosa, obtenida a través de los siguientes estudios. MÉTODO Se realizó una serie de estudios de ciencia cognitiva de representación mental del perdón y de procesamiento cognitivo emocional automático relacionado con eventos de violencia, para determinar cómo la información de perdón y violencia es organizada, significada, procesada e integrada en la estructura cognitiva de participantes, con y sin antecedentes de maltrato infantil. Estudio de representación del conocimiento del perdón. Diseño con la técnica de prototipia Se llevó a cabo un estudio cognitivo descriptivo de prototipia semántica29 sobre la categoría de perdón, para determinar la organización semántica del perdón en la estructura cognitiva de las muestras exploradas. La técnica de prototipia permitió obtener definiciones, de las cuales fue posible elegir aquellos conceptos que son más familiares al prototipo del perdón humano. 76

MA TERIALES MATERIALES En la primera fase se utilizaron hojas de papel con la palabra perdón impresa. En la segunda, se utilizó una lista de conceptos extraída de las respuestas de los participantes en la primera fase, los cuales se presentaron con el software Super Labpro. Participantes Se requirió la participación de 108 personas universitarias, sin antecedentes de maltrato infantil, de entre 18 y 25 años. Procedimiento A los participantes se les solicitó que generaran conceptos definidores del perdón sin usar frases, artículos, pronombres o conjuntivos. Estudios de procesamiento automático A) Diseño experimentales de facilitación semántica La facilitación semántica permite reconocer cómo la información, en este caso de violencia y perdón, se organiza semánticamente en la memoria a largo plazo.30 Dicho paradigma experimental asume que la presentación de un estímulo (facilitador) puede interferir o facilitar el reconocimiento de otro (objetivo), dependiendo de la relación semántica que dichos conceptos mantengan en el lexicón humano. Dado que un propósito del presente estudio fue observar si conceptos de perdón son semánticamente relevantes a los participantes, se emplearon palabras seleccionadas del estudio de prototipia (tabla I).



Tabla I. Lista de palabras del estudio de prototipia con sus porcentajes y frecuencia de generación.

Fig. 1. Secuencia de los ensayos experimentales para el estudio de procesamiento automático de relaciones semánticas y emocionales (visuales y faciales).

Participantes Participaron 121 personas (niños, jóvenes y adultos) con y sin maltrato infantil. En sí, la muestra constó de 18 niños (ocho con antecedentes de maltrato infantil, diez sin antecedentes de maltrato infantil), cuyo rango de edad osciló entre 9 y 11 años, 103 jóvenes y adultos (89 sin antecedentes de maltrato y catorce jóvenes con antecedentes de maltrato infantil), cuya edad oscilaba entre 16 y 60 años. Se utilizó una lista de conceptos relacionados con perdón seleccionada del estudio de prototipia, considerando sus porcentajes y frecuencia.

Fig. 2. Estímulos del estudio de facilitación semántica.

seguido por un blanco de 50 ms (SOA de 300 ms: ISI 50 ms.), después se presentó el objetivo sobre el cual habría que decidir si se trata de una palabra bien o mal escrita (figura 1). La figura 2 muestra los pares de palabras para comparar relaciones semánticas de perdón y violencia con respecto a estímulos neutros.

Procedimiento B) Diseños experimentales de facilitación afectiva A los participantes se les citó en sesiones individuales y se les presentó en una computadora con pares de estímulos verbales (palabra facilitador-palabra objetivo). El facilitador fue presentado por 250 ms, CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

Por otra parte, para verificar el tipo de procesamiento cognitivo emocional automático sobre eventos de violencia, tanto en población típica como en pobla77


ción con antecedentes de maltrato, se aplicó una serie de estudios experimentales de facilitación afectiva. Este paradigma experimental propone que la valencia emocional de un evento (cara de felicidad) “facilita” o interfiere el reconocimiento de la valencia emocional de otro evento u objeto (cara enojada). 31 Participantes En ambos estudios de facilitación afectiva, 79 personas (niños, jóvenes y adultos), con y sin maltrato infantil, fueron requeridas para participar. De manera específica, la muestra constó de 56 jóvenes y adultos sin antecedentes de maltrato y nueve niños, catorce jóvenes y adultos con antecedentes de maltrato infantil En la construcción del instrumento de imágenes de violencia se emplearon 20 imágenes con extrema violencia, que se compararon con pares de imágenes positivas y neutras. Para construir el instrumento de reconocimiento facial, se seleccionaron 18 imágenes faciales del sistema Be-Face, construida y validada por Morales et al.32 PR OCEDIMIENTO PROCEDIMIENTO En ambos estudios (imágenes y caras) se citó a los participantes en sesiones individuales y se les presentaron los pares de estímulos, con la secuencia experimental ilustrada en la figura 1. Nótese que a diferencia de los estudios de facilitación semántica, la tarea cognitiva en este tipo de estudios es decidir si el objetivo es emocional o no. Esto permite el análisis del estilo de procesamiento emocional de un participante.31 RESUL TADOS RESULT Se presentan sólo los hallazgos de mayor relevancia, por razones de espacio. 78

Resultados del estudio de prototipia En este estudio se observó que 30 conceptos se tipificaron como relevantes a la categoría del perdón (tabla II). La tabla II muestra que 20 de estos conceptos se relacionan con la estructura multifactorial del perdón de Mullet et al.16 Dichos conceptos parecen agruparse de acuerdo a dos categorías de la vaTabla II. Conceptos relacionados con la categoría del perdón organizados por locus de control. /RFXVLQWHUQR





riable de locus de control, la cual es de suma relevancia en el mantenimiento y la recuperación de un desorden emocional o trauma psicológico.33 Obsérvese la tabla, diez de estos conceptos se relacionan con el no perdón. De ahí que los pares de palabras usados para explorar la existencia de relación semántica en el lexicón humano, a través del estudio de facilitación semántica, provengan de los 20 conceptos considerados por la estructura psicológica de perdón. Resultados del estudio de facilitación semántica Los resultados del estudio de facilitación semántica, con las palabras del análisis de prototipia en el grupo control, se muestran en la figura 3. Las palabras seleccionadas por el análisis de prototipia para el esquema de perdón fueron semánticamente diferentes de los pares de palabras no relacioCIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


Fig. 3. Se muestran las latencias de relación semántica entre conceptos de perdón y violencia.

nadas y de violencia. El patrón de datos sugiere que la información conceptual de violencia y perdón es de relevancia semántica en la memoria a largo plazo de los participantes. Nótese también que el procesamiento conceptual de perdón humano consume mayor tiempo, dada su complejidad semántica. Además de los análisis grupales, se llevaron a cabo análisis de un solo caso, considerando que para el grupo experimental las rutinas traumáticas de maltrato infantil son específicas y personales para cada participante. Para ello se realizó el examen de los datos desde la perspectiva del álgebra cognitiva, la cual permite detectar el procesamiento cognitivo sistemático.34 Esta perspectiva cuenta con una sólida evidencia sobre la existencia de reglas algebraicas cognitivas en una gran variedad de comportamiento humano.35 La figura 4 muestra evidencia acerca de esta forma de procesamiento en personas con antecedentes de maltrato, ya que la información de perdón y violencia parecen integrarse de acuerdo a una regla de procesamiento sistemático. En particular, cuando se observa el efecto que los estímulos facilitadores de violencia y perdón tienen sobre sus objetivos (4.B y 4.D), el procesamiento parece se-


Fig. 4. Formas de integración de información sistemática de violencia y perdón sin efecto principal de facilitación semántica (A, B) y con efecto principal de facilitación semántica (C, D).

guir una regla multiplicativa. Cabe resaltar que alrededor de 80% de los participantes con antecedentes de maltrato no mostró dicho patrón sistemático de integración, más bien estilos personales no sistemáticos denotados por gráficas de interacción significativa, como se muestra en la figura 5.

Fig. 5. La gráfica muestra una interacción significativa y, por lo tanto, una ausencia de integración sistemática de información de violencia y perdón.



En la misma línea de presentación de resultados, en los estudios de facilitación afectiva se presenta el desempeño de la población típica para la identificación de valencia emocional de imágenes de violencia (figura 6) y de estímulos faciales emocionales (figura 7). En ambos estudios, las latencias del reconocimiento emocional negativo son levemente superiores a la información neutra, y se facilita la identificación de

información positiva, esto es típico y frecuentemente reportado en la bibliografía.32

Fig. 8. Evidencia de una regla cognitiva sumativa en la población típica, cuando se evalúa emocionalmente información de violencia.

Fig. 6. Desempeño de los participantes en el estudio de facilitación afectiva con imágenes de violencia.

Fig. 7. Desempeño de los participantes en el estudio de facilitación afectiva con imágenes faciales emocionales.


Fue relevante encontrar que en el estudio de facilitación afectiva sobre imágenes de violencia, la población típica utilizó una regla aditiva para integrar la información emocional (figura 8). En el caso de la población con antecedentes de maltrato, hubo al menos dos participantes que presentaron este comportamiento (figura 9). Sin embargo, ningún participante con antecedentes de maltrato presentó reglas cognitivas de integración en el estudio de reconocimiento de valencia emocional facial. Finalmente, de los participantes que presentaron reglas de integración en el estudio de facilitación semántica, ninguno presentó reglas cognitivas de integración en los estudios de facilitación afectiva y viceversa. Lo anterior señala que hay una especie de estilística cognitiva muy variada, cuando se evalúa información de violencia y perdón por parte de la población con antecedentes de maltrato. Algunos CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


peración del desorden emocional de la depresión.36 Esto sucede a pesar de que haya un efecto principal, comparando pares positivos y neutros en el diseño experimental F(6, 12) = 3.6126, p= .02777. Este filtro cognitivo no se presentó en ninguno de los adultos que tomaron los estudios de facilitación afectiva y que reportan recuperación del trauma. DISCUSIÓN Y CONCL USIÓN CONCLUSIÓN

Fig. 9. Evidencia de una regla cognitiva sumativa en un caso de la población con antecedentes de maltrato, cuando se evalúa emocionalmente información de violencia.

muestran patrones cercanos a la población promedio, pero en su mayoría se tipifica con estilos de procesamiento diferentes, esto aun y cuando hayan reportado que se recuperaron del trauma. Este aspecto diferencial de estilos de procesamiento se mantiene incluso a nivel intragrupo en las muestras de maltrato. En particular, cuando se compararon las latencias de desempeño en un estudio de facilitación afectiva de reconocimiento facial emocional por género en un grupo de niños, se encontraron diferencias significativas dado este factor. Por ejemplo, la aplicación del estudio de facilitación afectiva de reconocimiento facial a nueve niños que recién habían sufrido violencia extrema trajo como resultado que 90% de las mujeres y sólo 5% de los varones presentaran un filtro cognitivo disfuncional sobre información con contenido negativo. Dicho filtro se caracteriza por presentar una respuesta errónea 100% de las veces, cuando se trataba de reconocer una cara negativa. Esto es, implementaban un filtro de selección emocional preatentiva, tal y como sucede en procesos de recu-


El desempeño de los participantes, a través de las diferentes condiciones experimentales de procesamiento automático, muestra características del procesamiento cognitivo que son difícilmente detectadas por medidas explicitas de autorreporte y cuestionarios.37 Aun con el uso de medidas e indicadores de pruebas estándar de magnitud internacional especializados en el diagnóstico de recuperación del desorden emocional, formas de procesamiento automático pasan desapercibidas,38 y dejan un vacío en el diagnóstico de posibles efectos colaterales no deseados de la intervención clínica.36 Aquí es importante señalar que, hasta donde es de nuestro conocimiento, los estudios aquí reportados son seminales en el tratado de los estilos de procesamiento automático de violencia y perdón. Los resultados de estos esfuerzos académicos iniciales por expandir la comprensión de los mecanismos automáticos de evaluación emocional en poblaciones con maltrato señalan que los niños maltratados parecen fomentar por lo menos dos estrategias de procesamiento automático, esto es, filtrando información negativa o bien eliminándola.25 Posteriormente, en la adolescencia y en la madurez parece que dicho estilo de afrontamiento desaparece y es reemplazado por formas de procesamiento automático, que en algunas ocasiones involucran reglas cognitivas sistemáticas en el procesamiento de violencia y negatividad, así como de violencia y perdón. 81


Aun cuando la mayoría de los participantes con antecedentes de maltrato infantil no pareció usar dichas reglas cognitivas, es interesante el hecho de que exista esta posibilidad de comportamiento cognitivo. Si este procesamiento sistemático es el resultado de que el participante con antecedentes de maltrato fue sumergido posteriormente en ambientes sanadores o recibió intervención clínica, no se establece de la presente investigación; esto señala la necesidad de nuevas líneas de investigación con el uso de los métodos y técnicas como los utilizados en el presente estudio. Finalmente, esta investigación provee, por primera vez, una forma de diagnóstico a nivel implícito para evaluar el impacto que las intervenciones clínicas tienen sobre la estructura cognitiva que ha sufrido maltrato extremo.



Keywords: Child maltreatment, Automatic emotional processing style, Forgiveness and violence, Affective and semantic priming.

A 586 participantes se les dividió en muestras de niños, adolescentes y adultos con antecedentes de maltrato infantil, los cuales se compararon en desempeño con participantes sin antecedentes en estudios experimentales de facilitación afectiva y semántica y en un estudio de representación del conocimiento del perdón. Se evaluó si la información conceptual de perdón y violencia se integra en reglas cognitivas de procesamiento automático. Se observó que niños con maltrato implementan procesamiento disfuncional preatentivo. Este estilo se reemplaza en la adolescencia y en la madurez por un estilo personal de integración de información de violencia y perdón, que en ocasiones obedece a reglas cognitivas algebraicas como las propuestas por la teoría de integración de la información.

586 participants were divided into groups of children, adolescents, and adults with a history of child abuse. Their performance in experimental studies through semantic and affective priming experiments and their knowledge representation about forgiveness were compared to those without a history of abuse. Children who suffered maltreatment developed dysfunctional pre-attentive processing of negative information. This affective style is later replaced during adolescence and adulthood by a personal style where information about violence and forgiveness is integrated, which is occasionally guided by cognitive algebraic rules like the ones proposed by the Information Integration Theory.


Marty, C.M., & Carvajal, C.A. (2005). Maltrato infantil como factor de riesgo de trastorno por estrés postraumático en la adultez. Rev. Chil. Neuro-Psiquiatry, 43 (3), 180187.


De Bellis, M.D., Keshavan, M.S., Shifflett, H., Iyengar, S., Beers, S.R., Hall, J., & Moritz, G. (2002). Brian structures in pediatric maltreatment-related posttraumatic stress disorder: A sociodemographically matched study. Biological Psychiatry, 52(11), 1066-1078.


De Bellis, M.D. (2005). The psychobiology of neglect. Child Maltreatment, 10 (2), 150-172.


Pollak, S.D. (2010). El impacto del maltrato infantil en el desarrollo psicosocial de los niños pequeños. En R. E.

Palabras clave: Maltrato infantil, Estilo de procesamiento automático emocional, Perdón y violencia, Facilitación afectiva y semántica. 82

Tremblay, R. G. Barr, R. DeV. Peters & M. Boivin (Eds.), Enciclopedia sobre el Desarrollo de la Primera Infancia (pp. 1-6). Montreal, Quebec: Centre of Excellence for Early



Childhood Development. Disponible en: http://

2011, de

w w w. e n c i c l o p e d i a - i n f a n t e s . c o m / d o c u m e n t s /


PollakESPxp.pdf 5.

Rev. Mex. Neuroci., 7 (2), 156-163. 6.


México: Editores de Textos Mexicanos. 16. Loredo, A.A., Trejo, J.H., Jordán, N.T.G., López, G.N.,

Pollak, S.D., & Kistler, D.J. (2002). Early experience is

Muñoz, A.G., Perea, A.M., & Ridaura, C.S. (2006). Mal-

associated with the development of categorical represen-

trato infantil y síndrome de muerte súbita del lactante:

tations for facial expressions of emotion. PNAS, 99(13),

estrategias para el diagnóstico diferencial. Medigraphic, 63,

9072-9076. doi:10.1073/pnas.142165999


Teicher, M.H., Andersen, S.L., Polcari, A., Anderson,

17. Loredo, A.A., & Perea, A.M. (2005). La atención integral

C.M., & Navalta, C.P. (2002). Developmental

y la prevención del maltrato infantil en México. Acta

neurobiology of childhood stress and trauma. Psychiatric

Pediatr. Mex., 26 (3), 137-140.

Clinics of North America, 25, 397-426. 8.

15. Loredo, A.A. (2004). Maltrato en niños y adolescentes.

Escobar, A., & Gómez, B.G. (2006). Violencia y cerebro.

18. Gómez, E.P., & De Paúl, J. (2003). La transmisión inter-

Rick, S., & Douglas, D.H. (2007). Neurobiological Effects

generacional del maltrato físico infantil: estudio en dos

of Childhood Abuse. Journal of Psychosocial Nursing. 45 (4), 47-54. 9.

generaciones. Psicothema, 15, 452-457. 19.

Mullet, E., Girard, M., & Bakhshi, P. (2004).

Teicher, M.H., Dumont, N.L., Ito, Y., Vaituzis, C., Giedd,

Conceptualizations of Forgiveness. European Psychologist,

J.N., & Andersen, S.L. (2004). Childhood neglect is

9 (2); 78-86.

associated with reduced corpus callosum area. Biological Psychiatry, 56(2), 80-85.


Kadiangandu, J.K., Gauché, M., Vinsonneau, G., & Mullet, E. (2007). Conceptualizations of Forgiveness

10. National Research Council, Panel on Research on Child

Collectivist-Congolese versus Individualist-French

Abuse and Neglect (1993). Understanding Child Abuse

Viewpoints. Journal of Cross-Cultural Psychology, 38 (4):

and Neglect. Washington, DC: National Academy Press.


11. Rosenberg, D., Lu, W., Mueser, K.T., Jankowski, M.K.,

21. Bagnulo, A., Muñoz-Sastre, M.T., & Mullet, E. (2009).

& Cournos, F. (2007). Correlates of Adverse Childhood

Conceptualizations of forgiveness: A Latin America-

Events Among Adults with Schizophrenia Spectrum

Western Europe Comparison. Universitas Psychologica, 8

Disorders. Psychiatric Services. 58 (2), 245-253.

(3): 673-682.

12. Fondo de las Naciones Unidas para la Infancia (UNICEF)

22. Enright, R.D., & Coyle, C.T. (1998). Researching the

2009. Concentrado de datos estadísticos de menores mal-

process model of forgiveness with psychological

tratados Periodo comprendido de 2001 a 2009. Recupe-

interventions. En E.L. Worthington (Ed.), Dimensions of

rado el 5 marzo de 2011, de

forgiveness (pp.139–161). Radnor, PA: Templeton Foun-


dation Press.

13. Lozano, A.R., Del Río, A., Azaola, G.E., Castro, P.R.,

23. Harris, A., Luskin, F., Norman, S., Standard, S., Bruning,

Pamplona, R.F., Atrián, S.M. & Híjar, M. M. (2006).

J., Evans, S., & Thoresen, C. (2006). Effects of a Group

Extracto del Informe Nacional sobre Violencia y Salud.

Forgiveness Intervention on Forgiveness, Perceived Stress,

México: D.R. Secretaría de Salud.

and Trait-Anger. Journal of Clinical Psychology, 62(6),

14. Desarrollo Integral de la Familia (DIF) 2011. Concentra-


do de datos estadísticos de menores maltratados. Periodo

24. Suwartono, C., Prawasti, Y., & Mullet, E. (2007). Effect

comprendido de 2001 a 2009. Recuperado en mayo de

of culture on forgivingness: A Southern Asia-Western




Europe comparison. Personalityand Individual Differences, 42, 513-523. 25. Hedlefs, A.M.I. (2007). Mecanismos cognitivos de evaluación emocional de palabras de violencia e imágenes emocionales en niños con maltrato infantil. Tesis de licenciatura inédita. Universidad Autónoma de Nuevo León.

32. Morales, M.G.E., López, R.E.O. & Hedlefs, A.M.I. (2010). La psicología de las emociones: La expresión facial como una revelación de la emoción y el pensamiento. México: Trillas. 33. Alloy, L.B., Abramson, L.Y., Safford, S.M. & Gibb, B.E. (2006). The Cognitive Vulnerability to Depression (CVD)

26. Hedlefs, A.M.I. (2009). Mecanismos cognitivos de eva-

Project: Current Findings and Future Directions. In:

luación de imágenes de violencia en jóvenes y adultos con

Lauren, A. Alloy & John H. Riskind (Es.). Cognitive

antecedentes de maltrato infantil. Tesis de maestría inédi-

vulnerability to emotional disorders. Mahwah, New Jer-

ta. Universidad Autónoma de Nuevo León.

sey: LEA.

27. Williams, J.M.G., Watts, F.N., MacLeod, C. y Mathews

34. Anderson, N. (2001). Empirical directions in design and

A. (1997). Cognitive psychology and emotional disorders,

analysis: Scientific Psychology Series. Mahwah, New Jer-

«2nd Ed. Chichester: Willey.

sey: LEA.

28. Hedlefs, A.M.I., & López, R.E.O. (2011). Mecanismos

35. Anderson, N.H. (2007). Unified Social Cogntion.

cognitivos de evaluación de imágenes de violencia en jóve-

Scientific Psychology Series. New York: Psychology Press.

nes adultos con historia de maltrato infantil. Psicología y

36. Rosas, U.M.E. & López, R.E.O. (2011). La depresión:

Salud, 21 (2): 195-204. 29. Kearns, J. N., & Fincham, F.D. (2004). A Prototype Analysis of Forgiveness. Personality and Social Psychology Bulletin, 30, 838-855. 30. McNamara, T.P. (2005). Semantic priming: Perspectives from memory and word recognition. New York: Psychology Press.

Nuevas herramientas psicoterapéuticas. México, D.F.: Trillas. 37. Gawronsky, B. & Payne, B.K. (2010). Handbook of social implicit cognition: Measurement, Theory and applications. New York: Guilford Press. 38. Hedlefs, A.M.I., López, R.E.O. & Antona C.C.J. (2010). Social anxiety assessment through self report and automatic

31. Klauer, K.C., y Musch, J. (2003). An affective priming:

processing of emotional information. In: Cirilo H. García

findings and theories. En: J. Musch, y K. Klauer, The

(Ed.). Nova Publisher: Hispanic Psychology Yearbook, Vol.

psychology of evaluation: affective processes in cognition

1, pp. 167-176.

and emotion (págs. 7-50). New Jersey: Lawrence Erlbaum associates publishers.

Recibido: 1 de septiembre de 2012 Aceptado: 1 de septiembre de 2012



&,(1&,$ ;98$1/ $











Degradación de un herbicida en medio acuoso mediante la generación in situ de especies oxidantes M. VILLANUEVA RODRÍGUEZ*, J. M. PERALTA HERNÁNDEZ*, A. HERNÁNDEZ RAMÍREZ*

Uno de los recursos más importantes a nivel mundial es el agua; en México, aproximadamente 77% de este recurso se emplea en la agricultura,1 actividad en la que, debido al incremento en la demanda de alimentos, se promueve el uso de productos agrícolas, como fertilizantes y plaguicidas, los cuales, en ocasiones, debido al poco control sobre su uso y disposición, originan un problema ambiental. Dentro de los plaguicidas se encuentran los herbicidas, de los cuales el ácido 2,4-Diclorofenoxiacético (2,4-D) es ampliamente utilizado para el control de hierbas dicotiledóneas.2 Este herbicida causa problemas de salud tanto en humanos como en otros seres vivos, por su toxicidad y posible efecto carcinogénico.3 A fin de reducir el impacto de contaminantes orgánicos, se ha desarrollado una serie de tratamientos oxidativos, entre éstos los procesos avanzados de oxidación (PAO), que se basan en la formación de especies oxidantes, principalmente el radical hidroxilo (HO·), el cual posee un elevado poder oxidante (Eº = 2.8 V vs. ENH).4,5 El presente artículo está basado en la investigación “Degradación de un herbicida en medio acuoso mediante la generación in situ de especies oxidantes”, galardonada con el Premio de Investigación UANL 2012, en la categoría de Ingeniería y Tecnología, otorgado en sesión solemne del Consejo Universitario, en septiembre de 2012.


La fotocatálisis heterogénea pertenece a los PAOs y consiste básicamente en la activación de un semiconductor con fotones de la región ultravioleta o visible. 6 Un semiconductor posee una región vacía de energía entre la banda de valencia (BV) y la banda de conducción (BC) llamada banda de energía prohibida (Eg). Cuando la radiación aplicada al semiconductor es de energía igual o mayor a la Eg, un electrón de la BV es promovido a la BC del semiconductor, y forma así el par electrón-hueco. Los huecos formados oxidan a las especies que se encuentren presentes en el medio y oxidan al agua y producen así los radicales OH. Por otra parte, la eficiencia de la fotocatálisis heterogénea en la degradación de un contaminante depende del catalizador utilizado, de las condiciones de reacción7,8 y de la fuente de radiación,9,10 entre otras, para propiciar la formación de las especies oxidantes: los huecos fotogenerados y los radicales hidroxilo. La oxidación anódica, otro tratamiento perteneciente a los PAOs, se basa en la generación de radicales HO• formados durante la oxidación del agua, empleando diferentes electrodos. En este proceso, uno de los principales problemas observados es la *Universidad Autónoma de Nuevo León, FCQ. 85


disminución de la actividad causada por la evolución de O2 y la formación de películas sobre la superficie del electrodo. Los electrodos de diamante dopado con boro (DDB), por sus propiedades electroquímicas, reducen estos inconvenientes.11,12 Además de los radicales hidroxilo HO·, otra especie fuertemente oxidante es el ión ferrato (FeO42), el cual posee un potencial de reducción de 0.7 V vs. ENH en medio alcalino, y 2.2 V vs. ENH en medio ácido, un valor mayor que el de otros desinfectantes comunes, como O3 o H2O2.13,14 El ferrato se considera un agente amigable con el ambiente, no genera residuos peligrosos, como los subproductos derivados del tratamiento con cloro.13 Se han observado mejores resultados conforme disminuye el valor de pH, lo que se explica por el elevado potencial de reducción del ferrato en medio ácido y la reactividad de sus especies protonadas.15-17 Algunas de las aplicaciones más comunes del ferrato como sal de K2FeO4 es su uso como agente oxidante y coagulante en tratamiento de aguas residuales y en la desinfección de agua, al inactivar algunos microorganismos patógenos,. Sin embargo, las soluciones de esta sal de ferrato presentan elevada inestabilidad en solución;18 además, la síntesis de ésta resulta costosa.19,20 De aquí que la tendencia actual en el tratamiento con ferrato es la generación in situ de esta especie oxidante para la eliminación de los contaminantes.21 En este sentido, con base en que el ferrato se genera a partir de una sal de Fe2+ en medio ácido, con un electrodo de DDB,22 se aplicó la electrogeneración in situ de esta especie oxidante como un método para la degradación del 2,4-D23,24 y se comparó con la degradación del herbicida por fotocatálisis heterogénea. MA TERIALES Y MÉTODOS MATERIALES Para la degradación del 2,4-D, por fotocatálisis heterogénea, se llevó a cabo la síntesis de catalizadores 86

TiO2 y TiO2-Fe2O3 al 0.5 y 1.0%, por la técnica solgel a pH3. Los productos obtenidos se caracterizaron, entre otras técnicas, por espectrofotometría UVVis (Lambda 12), con reflectancia difusa y difracción de rayos X (difractómetro Siemens D500). En la degradación con ferrato electrogenerado, se realizó la caracterización electroquímica del ferrato con estudios de voltamperometría cíclica (VC), usando un potenciostato/galvanostato BAS-Epsilon y microscopía electroquímica de barrido (MEQB), en modo de retroalimentación y en modo sustrato generador-tip colector (SG-TC), en un microscopio electroquímico modelo CHI910B; ambos estudios sobre electrodos de DDB (Adamant Technologies), con disoluciones de Fe2+ y Fe3+ como precursores de ferrato en HClO4. El ferrato generado también al aplicar un potencial constante (2.5 V) se cuantificó, espectrofotométricamente, aλ=415nm, por la técnica ABTS 2,2’azino bis (3,etilbenzotiazolina-6sulfonato) de diamonio.25 Pruebas de degradación Degradación fotocatalítica. Una solución de 250 mL del 2,4-D de 50 mg L-1 (pH 3.5), con 0.6 g L-1 de catalizador en suspensión, se irradió con una lámpara de que emite radiación de ˜λ=365 nm. Asimismo, se realizaron pruebas de adsorción con los catalizadores sin irradiar con luz, y pruebas de fotólisis sin adicionar el catalizador. Degradación electroquímica. Se llevaron a cabo degradaciones de una solución de 2,4-D de 50 mg L-1, con un electrodo de DDB como ánodo, y un alambre de platino como cátodo en una celda no dividida. La actividad oxidante del ión ferrato se evaluó con diferentes concentraciones iniciales de Fe2+ (0.5, 1 y 3 mM) y de Fe3+ como precursores. Estas degradaciones se realizaron tanto a potencial constante (2.5 V), como a corriente constante (5 mA CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


RESUL TADOS Y DISCUSIร“N RESULT Caracterizaciรณn de catalizadores. De acuerdo con los resultados de difracciรณn de rayos X, se obtuvo la fase cristalina anatasa del TiO2, mientras que los espectros de absorciรณn UV-Vis muestran un desplazamiento en la banda de absorciรณn hacia la regiรณn visible en el catalizador modificado con Fe2O3 En la tabla I se muestran los valores de Eg, calculados a partir de los espectros de absorciรณn UV-vis de los sรณlidos.

Tabla I. Valores de Eg de diferentes catalizadores.









)H 9,


, $FP




( 9YV$J$J&O


)H ,,,

cm-2 y 50 mA cm-2). Los resultados se compararon con oxidaciรณn anรณdica, es decir, sin agregar hierro. Degradaciรณn con sal de ferrato. Para efectos comparativos, se evaluรณ la degradaciรณn de 2,4-D, utilizando la sal comercial de K2FeO4 en una relaciรณn molar de 1:5 (2,4-D: ferrato), en buffer de fosfatos/ boratos (pH 9.1). El seguimiento de la degradaciรณn del 2,4-D se evaluรณ por cromatografรญa de lรญquidos de alta resoluciรณn (CLAR), en fase reversa con detector UV-Vis a 285 nm; mientras que el grado de mineralizaciรณn se llevรณ a cabo por la determinaciรณn del carbono orgรกnico total (COT). El principal compuesto de degradaciรณn (2,4-diclorofenol se identificรณ y analizรณ bajo las mismas condiciones de anรกlisis que el 2,4-D). La formaciรณn de compuestos mรกs simples, como los รกcidos orgรกnicos, se evaluรณ por cromatografรญa, con una columna de exclusiรณn iรณnica.


)H ,,


Fig. 1. Voltamperometrรญa cรญclica de FeSO4 6 mM en HClO4 0.1 M sobre un electrodo de DDB a diferentes velocidades de barrido: (a) sin FeSO4, (b) 10 mV s-1, (c) 50 mV s-1, (d) 100 mV s-1, (e) 250 mV s-1 y (f) 500 mV s-1.

Caracterizaciรณn electroquรญmica del iรณn ferrato. En los estudios de VC (figura 1) se observaron dos picos anรณdicos, uno a 1.0 V y el otro entre 2.3 y 2.5V vs. Ag/AgCl, los cuales se asignan a la oxidaciรณn del Fe (II) a Fe (III) y Fe (VI), respectivamente. Tambiรฉn se apreciรณ una seรฑal catรณdica a 0.2 V vs. Ag/AgCl, que se asignรณ a la reducciรณn a Fe (II). En MEQB, en el modo operativo de retroalimentaciรณn, se observรณ un cambio significativo en la corriente desde distancias lejanas, debido a la contribuciรณn de la formaciรณn del iรณn ferrato y, posiblemente, a un proceso catalรญtico del ferrato a Fe3+ y O2, lo cual se constatรณ en el modo SG-TC24. En cuanto a la cuantificaciรณn de ferrato, รฉste se electrogenerรณ a partir de diferentes concentraciones iniciales de Fe2+, y se obtuvieron concentraciones similares de esta especie oxidante (0.2 mM). Fotocatรกlisis heterogรฉnea. De acuerdo con los resultados de la degradaciรณn fotocatalรญtica del 2,4-D, mostrados en la figura 2, se aprecia que la adsorciรณn del 2,4-D con los catalizadores y la fotรณlisis por sรญ sola, prรกcticamente no disminuyen la concentraciรณn del herbicida. En esta misma figura, se observa que los 87






dos catalizadores presentan una actividad semejante en cuanto al porcentaje de degradaciรณn del contaminante (96%); sin embargo, con el TiO2 se logra



7L2  7L2)H 2     7L2)H 2    





7LHPSR PLQXWRV  Fig. 3. Remociรณn del carbono orgรกnico total en la degradaciรณn fotocatalรญtica de 2,4-D, con los diferentes catalizadores sintetizados



Fig. 2. Degradaciรณn fotocatalรญtica de una soluciรณn 50 mg L-1de 2,4-D, 0.6 g L-1 de catalizador, radiaciรณn 365 nm de 800 mW cm-2.

este porcentaje de descomposiciรณn en menor tiempo (240 min). Por otra parte, en cuanto a los resultados de la remociรณn de COT, se obtuvo hasta 60% de reducciรณn en cuatro horas. Con respecto a la remociรณn de carbono orgรกnico total (COT) durante el proceso fotocatalรญtico, se observa mayor porcentaje de remociรณn de COT con el semiconductor TiO2 sintetizado por sol-gel, en comparaciรณn con el รณxido modificado (figura 3). Este comportamiento se debe, posiblemente, a la diferencia en las propiedades del catalizador mixto por la presencia del hierro que propicia otro nรบmero y tipo de sitios activos, los cuales en las condiciones en las que se lleva a cabo la reacciรณn (tipo de radiaciรณn, pH de la soluciรณn, y cantidad de catalizador) no son favorecidos.24 Sin embargo, de acuerdo a la caracterizaciรณn UV-Vis con reflectancia difusa, el catalizador modificado posee una Eg menor (2.44 eV), lo cual le da la posibilidad que bajo otras condiciones de radiaciรณn, como la solar, pueda presentar mejor actividad. 88

Durante el seguimiento de la reacciรณn de degradaciรณn de 2,4-D por CLAR, se observรณ un intermediario de la degradaciรณn, el cual se identificรณ como: 2,4-Diclorofenol (2,4-DCF), uno de los compuestos mรกs reportados en la degradaciรณn del 2,4-D en tratamientos fotocatalรญticos20 y en otras tecnologรญas.11,12 La formaciรณn del 2,4-DCF, durante el proceso fotocatalรญtico, comienza a evolucionar hasta una concentraciรณn mรกxima en aproximadamente cuatro horas, y despuรฉs disminuye gradualmente. La concentraciรณn mรกs alta de 2,4-DCF se obtiene con el catalizador sin dopar. Otros intermediarios formados en la degradaciรณn fotocatalรญtica de 2,4-D fueron identificados, como en el caso del รกcido fรณrmico que se identificรณ en el cromatograma a un tiempo de retenciรณn de 14.07 min. Degradaciรณn electroquรญmica. Se aplicรณ un potencial de celda de 2.5 V, que ademรกs de oxidar a la molรฉcula de 2,4-D evita la polimerizaciรณn sobre el รกnodo, favorece la formaciรณn de radicales hidroxilo y genera al mismo tiempo al iรณn ferrato en el medio de reacciรณn. La figura 4 muestra el descenso de la concentraciรณn del 2,4-D, cuando se genera el ferrato y CIENCIA UANL / Aร‘O 15, No. 60, OCTUBRE - DICIEMBRE 2012


se compara contra la oxidaciรณn anรณdica, apreciรกndose que la formaciรณn del ferrato mejora la degradaciรณn del herbicida. Por otro lado, se observa que a medida que aumenta la concentraciรณn de la sal ferrosa aรฑadida, disminuye la velocidad de eliminaciรณn del 2,4-D, y esto puede deberse a que un exceso de iones ferroso actรบa como secuestrante de los radicales HOยท,   

;  $=MG,


fรณrmico (tr = 13.6 min), en que se observaron diferencias en la evoluciรณn de estos รกcidos, cuando se forma el iรณn ferrato en comparaciรณn a la oxidaciรณn anรณdica, lo que indica que el poder oxidante del ferrato propicia una ruta de degradaciรณn mรกs eficiente. Asimismo, se observรณ que el proceso de electrogeneraciรณn de ferrato se ajusta a una cinรฉtica de pseudoprimer orden, como en el caso de la oxidaciรณn anรณdica y en el proceso fotocatalรญtico del 2,4-D. 18 En la tabla II, se muestran los parรกmetros cinรฉticos de la degradaciรณn del 2,4-D por estos tres procesos, calculados de acuerdo al modelo LangmiurHinshelwood. De acuerdo con estos datos, se aprecia que la oxidaciรณn del 2,4-D fue mรกs favorecida con




Tabla II. Parรกmetros cinรฉticos de la eliminaciรณn del 2,4-D por fotocatรกlisis heterogรฉnea, electrooxidaciรณn y electrogeneraciรณn de ferrato.




'HJUDGDFLyQ K  7L2  7L2)H2    2[LGDFLyQDQyGLFD  E >)H@P0  E >)H@P0  E >)H@P0 

7LHPSR PLQ  Fig. 4. Eliminaciรณn de 2,4-D 50 mg L-1 con ferrato electrogenerado, a partir de una sal ferrosa, y aplicando un potencial de 2.5 V. (*) sin hierro (oxidaciรณn anรณdica), ( ) Fe2+ 0.5 mM, ( ) Fe2+ 1.0 mM y ( ) Fe2+ 3.0 mM.

y ademรกs provoca una mayor concentraciรณn de Fe3+ en disoluciรณn, lo que inhibe la formaciรณn del iรณn ferrato. La remociรณn de COT mostrรณ un comportamiento similar en las diferentes condiciones de reacciรณn, y se logrรณ remover aproximadamente en 30%. El compuesto 2,4-DCF fue tambiรฉn uno de los principales intermediarios identificados, y la velocidad de formaciรณn del 2,4-DCF fue mayor cuando se generรณ el iรณn ferrato; y se observรณ que conforme avanza la reacciรณn de descomposiciรณn, aproximadamente a los 150 minutos, la concentraciรณn de 2,4-DCF disminuyรณ notablemente. Se identificaron ademรกs algunos รกcidos orgรกnicos de cadena corta por cromatografรญa de lรญquidos de exclusiรณn iรณnica, tales como: รกcido maleico (tr = 8.2 min), mรกlico (tr = 9.4 min), acรฉtico (tr = 14.9 min), oxรกlico (tr = 6.9 min) y CIENCIA UANL / Aร‘O 15, No. 60, OCTUBRE - DICIEMBRE 2012


N PLQ  [ [  [ [ [ [

W PLQ        

Concentraciรณn de la sal ferrosa como precursor del ion ferrato.

el proceso fotocatalรญtico con TiO2 como catalizador, seguida de la degradaciรณn del herbicida, con la generaciรณn de iรณn ferrato, a partir de Fe2+ 0.5 mM. Sin embargo, la acciรณn de los radicales HOโ€ข, en combinaciรณn con el ferrato logra romper la molรฉcula del 2,4-D en una mayor cantidad de intermediarios de cadena corta, como los รกcidos orgรกnicos de bajo peso molecular, lo que darรก como resultado una soluciรณn acuosa sin compuestos tรณxicos. CONCL USIONES CONCLUSIONES Los resultados obtenidos indicaron que la descomposiciรณn del 2,4-D, por la acciรณn de los radicales 89


hidroxilo generados en el proceso fotocatalítico, depende del catalizador, del uso y de las condiciones del proceso. Mientras que por el proceso electroquímico, la degradación del herbicida se debe a la acción del radical hidroxilo y del ión ferrato electrogenerados in situ. De aquí que estos procesos son viables como metodologías alternas para tratamiento de aguas contaminadas con herbicidas. De acuerdo a los intermediarios, formados por la destrucción de la molécula durante el proceso de degradación del herbicida, se encontró que la descomposición del compuesto orgánico sigue una ruta diferente según el proceso oxidativo aplicado. De aquí que, dependiendo de la finalidad del tratamiento, puede optarse por un tratamiento u otro en términos de costo, el grado de remoción de compuestos orgánicos y de toxicidad del efluente, según las características que se deseen en el agua tratada. RESUMEN En el presente estudio, se llevó a cabo la descomposición de un herbicida de uso común, el ácido 2,4diclorofenoxiacético (2,4-D), mediante diferentes procesos que implican la generación de especies fuertemente oxidantes: los radicales hidroxilo (HO•) y el ión ferrato [FeO42-]. Los procesos mediante los cuales se generaron dichas especies para la degradación del herbicida fueron la fotocatálisis heterogénea, la oxidación anódica y la electrogeneración del ión ferrato a partir de una sal ferrosa. Los resultados obtenidos indicaron que la descomposición del 2,4D por la acción de los radicales hidroxilo generados en el medio, durante el proceso fotocatalítico, depende del catalizador a utilizar y de las condiciones del proceso. Mientras que por el proceso electroquímico, la degradación del herbicida sucede debido a la acción conjunta del radical hidroxilo y del ión ferrato electrogenerados in situ. 90

Palabras clave: Ferrato, Fotocatálisis, Ácido 2,4-D. ABS TRA CT ABSTRA TRACT In the present study, the decomposition of a commonly used herbicide, 2,4-dichlorophenoxyacetic acid (2,4-D) was carried out by different processes that involve the generation of strongly oxidizing species: hydroxyl radical (HO•) and ferrate ion [FeO42-]. The processes by which these species were generated for the degradation of the herbicide were heterogeneous photocatalysis, anodic oxidation, and the electrogeneration of ferrate ion from a ferrous salt. The results showed that the decomposition of 2,4D by the action of hydroxyl radicals generated in the medium during the photocatalytic process depends on the catalyst used and the process conditions. While in the electrochemical process, degradation of the herbicide occurs due to the action of the hydroxyl radical and electrogenerated ferrate in situ. Keywords: Ferrate, Photocatalysis, 2,4-D. REFERENCIAS 1.

Sistema Nacional de Información del Agua (SINA). Estadísticas del Agua en México (2008). consultado 10/08/2010.


Industry Task Force II on 2,4-D Research Data, Issue Backgrounder WHAT IS 2,4-D? Consultado 14/10/09.


International Agency for Research on Cancer. Chlorophenoxi herbicides. IARC Monographs Supplement 7 (1987) 156-160.


R. Andreozzi, V. Caprio, A. Insola and R. Marotta. Advanced oxidation processes (AOP) for water purification and recovery. Catalysis Today 53 (1999), pp. 51.


M. Pera-Titus, V. García-Molina, M.A. Baños Jaime Giménez, S. Esplugas. Degradation of chlorophenols by






means of advanced oxidation processes: a general review.

15. Y. Lee, S.G. Zimmermann, A. Kieu, U. Von Guten. Ferrate

Applied Catalysis B: Environmental 47 (2004) 219–256.

(Fe(VI)) Application for Municipal Wastewater Treatment:

K. Kabra, R. Chaudhary, R.L. Sawhney. Treatment of

A Novel Process for Simultaneous Micropollutant

hazardous organic and inorganic compounds trhough

Oxidation and Phosphate Removal. Environmental Science

aqueous phase photocatalysis: A review. Industrial &

and Technology 43 (2009) 3831–3838.

Engineering Chemistry Research 43 (2004) 7683-7696.

16. C. He, X. Zhongli, V.K. Sharma, S. Yuli. Elimination of

M. Trillas, J. Peral and X. Domènech. Redox photodegradation

Sludge Odor by Oxidizing Sulfur-Containing Compounds

of 2,4-dichlorophenoxyacetic acid over TiO2 Applied

with Ferrate (VI). Environmental Science and Technolo-

Catalysis B: Environmental 5, Issue 4 (1995) 377-387.

gy 43 (2009) 5890–5895.

V. Rodríguez-González, A. Moreno-Rodríguez, M. May,

17. Y. Lee, I-H. Um and J. Yoon. Arsenic(III) Oxidation by

F. Tzompantzi, and R. Gómez. Slurry photodegradation

Iron(VI) (Ferrate) and Subsequent Removal of Arsenic(V)

of 2,4-dichlorophenoxyacetic acid: A comparative study

by Iron(III) Coagulation. Environmental Science and Te-

of impregnated and sol–gel In2O3–TiO2 mixed oxide

chnology 37 (2003) 5750-5756.

catalysts. Journal of Photochemistry and Photobiology A: 9.

18. J.M. Schreyer, L.T. Ockerman. Stability of the Ferrate (VI)

Chemistry 193 (2008) 266-270.

Ion in Aqueous Solution. Analytical Chemistry. Vol. 23,

S.P. Kamble, S.P. Deosarkar, S.B. Sawant, J.A. Moulijn,

No. 9 (1951) 1312-1314.

and V.G. Pangarkar. Photocatalytic Degradation of 2,4-

19. J.Q. Jiang, B. Lloyd. Progress in the development and use

Dichlorophenoxyacetic Acid Using Concentrated Solar

of ferrate (VI) salt as an oxidant and coagulant

Radiation: Batch and Continuous Operation. Industrial

for water and wastewater treatment. Water Res. 36 (2002)

& Engineering Chemistry Research 43 (2004) 8178-8187.


10. J.M. Herrmann; J. Disdier, P. Pichat, S. Malato and J.

20. Y.D. Perfiliev, E.M. Benko, D.A. Pankratov, V.K. Sharma,

Blanco.TiO2-based solar photocatalytic detoxification of water

S.K. Dedushenko. Formation of Iron(VI) in Ozonalysis

containing organic pollutants. Case studies of 2,4-dichlorophe-

of Iron(III) in Alkaline Solution. Inorg. Chim. Acta. 360

noxyaceticacid (2,4-D) and of benzofuran. Applied Catalysis

(2007) 2789.

B: Environmental 17 Issues 1-2 (1998) 15-23.

21. J.Q. Jiang, C. Stanford, M. Alsheyab. The on line

11. F. Beck, W. Kaiser, H. Krohn. Boron doped diamond

generation and application of ferrate (VI) for sewage

(BDD)-layers on titanium substrates as electrodes in

treatment - A pilot scale trial. Separation and Purification

applied electrochemistry. Electrochimica Acta 45 (2000)

Technology 68 (2009) 227–231.

4691–4695. 12. M. Panizza , G. Cerisola. Critical review. Application of

22. J. Lee, D.A. Tryk, A. Fujishima and S-M. Park. Electrochemical generation of ferrate in acidic media at

diamond electrodes to electrochemical processes.


Electrochimica Acta 51 (2005) 191–199.

Communications (2002) 486-487.




13. J.Q. Jiang. Research progress in the use of ferrate (VI) for

23. M. Villanueva-Rodríguez, A. Hernández-Ramírez, J.M.

the environmental remediation. Journal of Hazardous

Peralta-Hernández, Erick, R. Bandala, Marco A. Quiroz-

Materials 146 (2007) 617–623.

Alfaro. Enhancing the electrochemical oxidation of acid-yellow

14. Y. Lee, M. Cho, J.Y. Kim, J. Yoon. Chemistry of ferrate (Fe(VI)) in aqueous solution and its applications as a green chemical. Industrial & Engineering Chemistry Vol. 10 No. 1 (2004) 161-171.


36 azo dye using boron doped diamond electrodes by addition of ferrous ion.J. Hazard. Mater. 167 (2009) 1226. 24. M. Villanueva, C. M. Sánchez, V. Montiel, E. Brillas, J. M. Peralta, A. Hernández. Characterization of ferrate ion



electrogeneration in acidic media by voltametry and

25. Y. Lee, J. Yoon, U. von Gunten. Spectrophotometric

scanning electrochemical microscopy. Assesment of its

determination of ferrate (Fe (VI)) in water by ABTS. Water

reactivity on 2,4-dichlorophenoxiacetic acid degradation.

Research 39(2005) 1946-1953.

Electrochimica Acta 64 (2012) 196– 204. Recibido: 1 de septiembre de 2012 Aceptado: 1 de septiembre de 2012



&,(1&,$ ;98$1/ $












Los capacitores, elementos esenciales en la industria electrónica, al igual que otros componentes de ese tipo, están expuestos a las exigencias comerciales y energéticas correspondientes a la reducción en tamaño y peso; asimismo, mantienen su eficiencia energética. El principio de funcionamiento de un capacitor requiere de un material de alta constante dieléctrica en capas cada vez más delgadas, apiladas en una forma denominada capacitor multicapa (CMC). La figura 1 muestra el arreglo de este capacitor en el que las capas se conectan en paralelo, con lo que la capacitancia de cada capa se suma.

Fig. 1. Arreglo de un capacitor multicapas.

El presente artículo está basado en la investigación “Diseño de suspensiones para producir cintas cerámicas ultradelgadas para capacitores multicapas mediante tape casting”, galardonada con el Premio de Investigación UANL 2012, en la categoría de Ingeniería y Tecnología, otorgado en sesión solemne del Consejo Universitario, en septiembre de 2012.


Una forma de satisfacer esta condición consiste en preparar polvo de material dieléctrico en una suspensión con la que se forma una capa delgada a la que luego se le colocan los electrodos mediante un proceso serigráfico. Entre las técnicas más directas para producir estas capas delgadas a escala industrial se encuentra el vaciado de cintas (tape casting) que la industria continúa utilizando a pesar de que se ha llegado a un límite en el cual ya no parece posible obtener capas de espesor más delgado. El trabajo más importante en la reducción del espesor de la cinta y, por ende, del capacitor, está en el diseño de una suspensión cuyas propiedades reológicas sean adecuadas para su vaciado en capas delgadas, cintas que sean continuas. Una revisión amplia muestra 1-3 que el límite práctico al que ha llegado hasta ahora mediante tape casting es de 3.5 µm. En este trabajo se diseña una formulación que reúne las mejores condiciones reológicas para obtener cintas delgadas, de espesor menor de 3.5 µm, mediante tape casting, por lo que siendo que este valor el límite práctico para esta técnica, cualquier espesor menor a éste calificaría de ultradelgado. * Universidad Autónoma de Nuevo León, FIME. ** Universidad de Toulousse III, Paul Sabatier, Centre Interuniverstaire de Recherche et d’Ingeniere des Matériaux. 93


Tape casting La figura 2 muestra un esquema del proceso de tape casting en el que se hace pasar a la suspensión por debajo de la cuchilla, entre ésta y un sustrato. El espesor de la cinta formada depende de la velocidad de arrastre, de las propiedades reológicas de la suspensión y del espacio bajo de la cuchilla.

Fig. 2. Esquema del proceso de vaciado en cintas tape casting.

El control del espesor se lograría con sólo fijar el espacio por el que pasa la suspensión, si no hubiera componente elástico en el comportamiento reológico de la suspensión; pero sí lo hay, lo que conlleva una dificultad para obtener cintas delgadas. La figura 3 muestra los desarrollos industriales y científicos en el campo de las cintas gruesas y delgadas. El proceso tape casting se considera un método de fabricación para cintas gruesas a nivel laborato-

rio; en condiciones extraordinarias el espesor mínimo reportado es de 2 µm, mientras que en la industria el mínimo reportado es de 3.5 µm. Prueba en modo oscilatorio Este tipo de prueba, también llamada dinámica, consiste en la aplicación de una fuerza de corte oscilatorio con una frecuencia ω a la muestra en estudio. No se trata de un régimen transitorio, sino armónico permanente. Significa que durante el movimiento periódico la ondas correspondientes, el esfuerzo σ(t) y la tasa de deformación γ& (t) evolucionan de manera sinusoidal, con respecto al tiempo, con la misma frecuencia pero con un ángulo de desfasamiento entre ellos. A partir del análisis de las señales sinusoidales de esfuerzo y tasa de deformación, se define el desfasamiento entre la tasa de corte y el esfuerzo de la muestra y su razón:

G* =

σ0 γ0

o ó0 y ã0 que representan, respectivamente, las amplitudes máximas del esfuerzo y la deformación. Esta razón se denomina módulo de deformación o rigidez,6 y se expresa en pascales (Pa).

σ (t ) = σ 0 eiωt



γ (t ) = γ 0 e i( ωt − δ )


De ahí se tiene que: G* =

σ0 γ 0 (cosδ + isenδ )


Donde, Fig. 3. Estado del arte de los avances académicos e industriales de cintas delgadas y espesas para aplicaciones de CCM. 1-3,4,5


G′ = G * cos δ G ′′ = G * senδ

(4) (5)



AsĂ­, la energĂ­a elĂĄstica conservada y restituida durante un periodo es proporcional a Gâ&#x20AC;&#x2122;, el mĂłdulo elĂĄstico (o de conservaciĂłn); mientras la energĂ­a disipada por fricciĂłn debido a la viscosidad durante el mismo ciclo es proporcional a Gâ&#x20AC;&#x2122;â&#x20AC;&#x2122;, el mĂłdulo viscoso (o de pĂŠrdida). El desfasamiento δ se corresponde con los mĂłdulos por la relaciĂłn: tan δ =

Gâ&#x20AC;˛â&#x20AC;˛ Gâ&#x20AC;˛


El cual serĂ­a de 0° (para un sĂłlido elĂĄstico perfecto, si Gâ&#x20AC;?=0) y 90° (para un lĂ­quido puramente viscoso sin componente elĂĄstico, G´=0). Cabe seĂąalar que δ y tanδË&#x153; se denominan, respetivamente, ĂĄngulo de pĂŠrdida y tangente de pĂŠrdida. La dependencia de las variables reolĂłgicas oscilatorias, en funciĂłn de la frecuencia, resulta en una especie de filtro en la que sĂłlo hay respuesta de los grupos con tiempos cercanos a las frecuencias de pulsaciĂłn utilizadas.9 Las caracterĂ­sticas dinĂĄmicas informan acerca de los grupos que componen la estructura, tĂŠcnica importante para el desarrollo de dispersiones de alto rendimiento. 10

Tabla I. CaracterĂ­sticas fĂ­sico-quĂ­micas de los polvos de BaTiO3.














BaTiO3 Se utilizaron dos polvos de BaTiO3 elaborados por Marion Technologies, y dos mĂĄs de Sakai Chemical, en funciĂłn de los criterios de pureza (>99%), morfologĂ­a esfĂŠrica y tamaĂąo de partĂ­cula. La tabla I agrupa los polvos caracterizados en este trabajo, y la morfologĂ­a de los polvos de BaTiO3 utilizados se muestra en la figura 4.

CIENCIA UANL / AĂ&#x2018;O 15, No. 60, OCTUBRE - DICIEMBRE 2012

Fig. 4. ImĂĄgenes en MEB de polvos de BaTiO3: a) BT-01 b) BT-02 c) MT-03 d) MT-02.

Solventes Se seleccionĂł un sistema binario de solventes compuestos por un lĂ­quido con constante dielĂŠctrica elevada (polar) y otro de baja (no polar).7 La tabla II agrupa los detalles de los solventes utilizados. 95


Aglutinante Tabla II. Solventes utilizados para fabricar barbotinas.



Dispersantes Se agregan agentes dispersantes para garantizar la metaestabilidad de la dispersiĂłn. La disminuciĂłn de especies polares para disociar los pares de iones en la superficie de las partĂ­culas de BaTiO3 es mĂĄs probable lograrla con la ayuda de macromolĂŠculas que forman una capa alrededor de ĂŠstas. Lo anterior es una seĂąal de que una dispersiĂłn debe estabilizarse con macromolĂŠculas que promuevan mecanismos de repulsiĂłn estĂŠrica que eviten la agregaciĂłn entre partĂ­culas. HistĂłricamente, ha existido un reto en cuanto la compatibilidad de sistemas solventes con los tipos de dispersantes utilizados, como lo reporta la bibliografĂ­a.6,8,9 La tabla III muestra los dispersantes utilizados para los diversos experimentos.

A bajas concentraciones, el PVB actĂşa como dispersante, dado que en su estructura contiene grupos hidroxilo y ĂŠster. Entonces, para evitar la competencia de ĂŠste con el dispersante para la adopciĂłn sobre las partĂ­culas cerĂĄmicas, el aglutinante se agrega despuĂŠs de los procesos de molido o dispersado.17 Se seleccionaron tres tipos, con respecto al peso molecular, de PVB (tabla IV) para formar cintas cerĂĄmicas con espesores menores que 3 Âľm, y se mantuvo la misma concentraciĂłn de grupos OH- y butilo remanente, para comparar sĂłlo el efecto de la longitud de cadena. Tabla IV. CaracterĂ­sticas quĂ­micas del PVB.





= 6





MĂ&#x2030;TODOS EXPERIMENT ALES EXPERIMENTALES Tabla III. Dispersantes utilizados.

Arreglo para el tape casting 1RPEUH FRPHUFLDO 








3' .' 7ULWRQ; 



Se adaptĂł una mĂĄquina de tape casting manual para evaluar el comportamiento de la suspensiĂłn, en la que es posible variar la distancia entre la base y la cuchilla, mediante lĂĄminas de aluminio y micrĂłmetros de ajuste de altura (figura 5). FormulaciĂłn y fabricaciĂłn de barbotinas Se utilizĂł la tĂŠcnica de sedimentaciĂłn para seleccionar el sistema polvo + solvente + dispersante, de acuer-


CIENCIA UANL / AĂ&#x2018;O 15, No. 60, OCTUBRE - DICIEMBRE 2012


ron muestras aptas o metaestables aquéllas en las que, después de diez días, la razón H/H0 fue de al menos 0.7. En la figura 6 se aprecia cómo se sedimentan las suspensiones, se consideran para las siguientes pruebas sólo las que cumplieron con el criterio mencionado de 70%.

Fig. 5. Esquema de la cuchilla de la máquina aplicadora: 1) Micrómetro de ajuste, 2) Laina de aluminio, 3) Mylar.

do al grado de compatibilidad en función de su metaestabilidad. A continuación se describen las tres etapas de formulación de dispersiones: sedimentación, determinación de la concentración de dispersante y selección del aglutinante. Sedimentación Los polvos y dispersantes se prepararon de la siguiente manera: se agregaron 2 g de BaTiO3 a 10 ml de mezcla de solvente-dispersante, el contenido de dispersante fue de 3% en peso, con respecto a la cantidad de BaTiO3, todo se puso en un tubo de ensayo y se selló con una tapa de hule. Las suspensiones (polvo + solvente + dispersante) se dejaron estabilizar por 30 minutos, para que el dispersante se adsorbiera a las partículas. Enseguida, se agitaron mediante ultrasonido durante 10 min, a una frecuencia de 42 Hz. Luego, las muestras se dispusieron en posición vertical dentro de un cuarto con una temperatura controlada entre 21°C y 23°C y 60% de humedad relativa. La altura máxima se registró como (Ho) y es la referencia. La altura del frente de sedimentación (H) se midió periódicamente cada 8 h. Las mediciones se realizaron durante dos semanas. Se consideraCIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

Fig. 6. Pruebas de sedimentación.

Optimización de la suspensión Las suspensiones que cumplieron satisfactoriamente la etapa de sedimentación se seleccionaron para determinar la concentración óptima de dispersante. Es decir, se prepararon suspensiones a diferentes concentraciones, las cuales fueron: 0% (sin dispersante), 2%, 4% y 6% en peso. El procedimiento de fabricación de éstas fue el siguiente: el polvo cerámico se agregó a la mezcla de solvente y dispersante. Posteriormente se procedió a un paso de dispersión para romper los agregados, en una jarra de polietileno con bolas de molido de zirconio de tamaño de 0.65 mm. Las condiciones fueron: 120 rpm durante 24 h. El método de análisis y selección de suspensiones fue mediante reología en modo estático y dinámico, única manera de conocer los dos módulos de la viscosidad. 97


Optimización de la barbotina

Fabricación de cintas cerámicas

Una vez que la concentración óptima de dispersante se determinó para las suspensiones preparadas, se fabricaron las dispersiones (barbotinas) mediante la adición y homogenización del aglutinante y el plastificante. La preparación del aglutinante se realizó en paralelo a la preparación de la suspensión, y se agregó 15.7% en peso de PVB en polvo a una mezcla de solventes (compatibles con el solvente utilizado en la suspensión). La solubilización del PVB se realizó mediante la agitación de la mezcla (PVB solventes), durante 24 h a 75 rpm y a temperatura ambiente. Las suspensiones preparadas con la cantidad óptima (con base en sus propiedades viscoelásticas mostradas) se dividieron en tres partes proporcionales para agregar los tres tipos de aglutinantes (B1 con un peso molecular de 23,000, B3 de 32,000 y B5 de 53,000) más el plastificante. La proporción en peso de suspensión-aglutinante-plastificante fue de 1.41:1:0.04. Una vez completada la mezcla, se procedió a homogeneizarla mediante rolado durante 24 h a 10 cpm. El método de análisis de las dispersiones fue la reología, al igual que con las suspensiones.

El tape casting se realiza con un volumen de dispersión de 3 ml, depositado para aplicarse sobre una sección de Mylar mediante un esfuerzo de corte dado por la cuchilla, al desplazarse linealmente a una velocidad constante de 50 mm/s y una apertura de aplicación de 2.5 µm. La longitud de la cinta elaborada fue de 26 mm. El espesor de las bandas se midió con microscopía electrónica y perfilometría de contacto. Las dos técnicas mostraron resultados estadísticamente iguales con resolución para cintas de espesores delgados.

Reología de dispersiones En este trabajo se construyeron reogramas, en modo estático y en modo dinámico. Para el primero, las curvas son de viscosidad aparente contra tasa de corte en un rango comprendido entre 0.001 s-1 y 500 s-1; mientras que para el segundo las curvas son de los módulos contra frecuencia en un rango de 0.01 a 500 Hz a 25° C, con una amplitud de 5% de la deformación total bajo condiciones isotérmicas. Las mediciones reológicas se realizaron con un reómetro Physica MCR301.


Resultados y discusión Formulación de suspensiones Sabiendo qué variables tienen mayor influencia sobre la viscosidad y al optimizarse permitirán reducir el espesor de las cintas, aun cuando el tamaño de partícula sea menor o igual a 300 nm, a continuación se presenta la reformulación de suspensiones para obtener viscosidad baja (100 cPs) y un módulo elástico lo más bajo posible, de manera que permitan elaborar cintas cerámicas “delgadas” y homogéneas. La interpretación de los fenómenos que ocurren debido a las interacciones de los componentes de la suspensión se realizará a partir de los resultados del análisis reológico en modo estático y oscilatorio. Sedimentación La sedimentación da una idea de la metaestabilidad del sistema. Un tiempo de sedimentación corto indica una fuerte interacción entre partículas cerámicas y una pobre efectividad del dispersante. En la tabla V se enlistan sólo las formulaciones que presentaron los tiempos de sedimentación determina-



dos para considerase aptos (H/H0 > 0.7 después de 10 días).

Tabla V. Muestras de la prueba de sedimentación.










%77(56 %77(3' %77(3' %77(.' %770.' %7;(3' %7;(3' %77(3' %77(.' %7;(56

Los sistemas binarios utilizados como medios de dispersión, compuestos por un líquido polar y otro débilmente polar al que se puede considerar no polar, han resultado compatibles con algunos de los dispersantes seleccionados. Es el caso para los polvos BT-01 y BT-02, en las mezclas de tolueno-etanol y xileno-etanol. Por otra parte, todas las suspensiones en las que se utilizó el dispersante tipo octilfenol etoxilado resultaron inestables. Este dispersante tiene una estructura molecular con un grupo OH¯ y otro fenol ligado a un grupo alquilo. Los grupos OH¯ se adsorben en la superficie de las partículas cerámicas,8 mientras que el grupo fenol ligado a la cadena de hidrocarburos, en teoría, se debe expandir hacia el medio. La inestabilidad presente provoca que la corona, que debe formar la parte no adsorbida de la CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

cadena correspondiente a la parte no polar, tenga una pobre compatibilidad con el medio y no se extienda, da un peso adicional a la partícula y provoca la sedimentación.

Efectividad de los dispersantes Las suspensiones superaron el valor límite de sedimentación y se caracterizaron reológicamente. Para cada dispersión seleccionada, la concentración del dispersante varió en 0, 2, 4 y 6% en peso. Se clasificaron los dispersantes seleccionados en dos familias, con base en su estructura química. La primera, compuesta por macromoléculas “lineales” que comprenden los dispersantes de tipo éster fosfato y el éster oligomérico; y la segunda, compuesta por macromoléculas en bloque o injerto (graft) con estructuras ABA y ABn. La denominación lineal utilizada para clasificar a los dispersantes de tipo éster sólo los diferencia de otros con estructuras más complejas, como los copolímeros grafeados, y se decidió así, porque sus respuestas reológicas fueron similares. Dispersantes de macromoléculas lineales Las viscosidades aparentes de las formulaciones sin dispersante (esto es, BT01TE, BT01XE, BT02XE) tienen un comportamiento pseudoplástico, y las muestras BT01TE y BT01XE poseen una viscosidad más elevada que la identificada como BT02TE. Lo anterior puede atribuirse al efecto del área superficial, la cual es más elevada en el polvo BT01 y, por ende, éste tendrá una fuerte tendencia a formar agregados.10 Un comportamiento pseudoplástico también se observa en las muestras con dispersante dentro del rango que va de 10-3 s-1 a 100 s-1 para luego tornarse a un comportamiento de tipo newtoniano y, finalmente, dilatante por arriba de 100 s-1. Las muestras 99


compuestas por xileno-etanol con dispersante tipo poliéster oligomérico (PD100) tienen un comportamiento similar al mostrado por las muestras compuestas con tolueno-etanol y fosfato éster (RS410). La adsorción de dispersantes clasificados como lineales de este estudio puede ser descrita considerando que en el caso del éster oligomérico es el grupo éster, el cual se adsorbe en la superficie del BaTiO3, y la parte que se extiende al medio se compone por la cadena de hidrocarburos. Por su parte, para el fosfato éster es el grupo éster fosfato el que se adsorbe a la superficie del BaTiO3, mientras que la parte de etilenos oxidados se extiende hacia el medio. En los dos casos, las interacciones de la parte no polar con el medio son ampliamente diferentes entre dispersantes, debido a las diferentes conformaciones estructurales, y dependen del grupo éster para el mecanismo de adsorción. No obstante, aun si el momento dipolar de los iones ligados al oxígeno en los grupos químicos que se adsorben (dipolos inducidos) son diferentes a la liga fósforo-oxígeno para el caso del fosfato éster, y la liga carbono-oxígeno para el oligómero éster, tienen un carácter aniónico en ambos. La adición de dispersante a las suspensiones base BaTiO3 mejora las propiedades de fluidez, debido a una reducción importante en la magnitud de la viscosidad aparente, de cuatro órdenes de magnitud, observada en todas las muestras (figuras 7 y 8). Durante la dispersión de partículas en el “molido” o, mejor dicho, “dispersado”, pues involucra más la desintegración de aglomerados que la ruptura de partículas, se facilita la adsorción de las macromoléculas a la superficie del BaTiO3, cuando son separadas por la energía mecánica para que luego ya recubiertas no se vuelvan a aglomerar. Este proceso reduce las interacciones partícula-partícula y mejora la fluidez.


Fig. 7. Reología de una suspensión con polvo BT-01.

Fig.8. Reología de una suspensión con polvo BT-02.

Es evidente el cambio en el comportamiento viscoso alrededor de 5 s-1, pues denota una frontera entre dos mecanismos de interacción: por un lado, pseudoplástico cuando es menor a 5 s-1 y la gama de tiempo es lo suficientemente larga para favorecer las interacciones entre partículas-dipolos inducidos y dipolos inducidos-con el medio; por otro lado, newtoniano cuando es mayor a 5 s-1 y los tiempos de interacción al interior de la estructura son tan cortos que en promedio no hay un cambio, y en sistemas de este tipo se consideran como esferas rígidas bien dispersas por todo el medio, con una viscosidad cercana a la magnitud reportada para el solvente.7 CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


Por debajo de 5 s-1, la formulación con polvo de 100 nm con dispersante oligomérico éster y la formulación con polvo de 200 nm con dispersante fosfato éster, ambos en un medio xileno-etanol tienen un comportamiento mixto: newtonianopseudoplástico. Este comportamiento se atribuye en este trabajo, para los dos sistemas con el mismo medio, a una fuerte influencia de las moléculas del solvente sobre las cadenas poliméricas no polares. La reología como único método de caracterización de suspensiones no explica totalmente este fenómeno; sin embargo, es posible suponer la existencia de fuertes interacciones entre las moléculas del solvente sobre los grupos de la parte polar y la longitud de la corona que se extiende al medio. Las suspensiones con dispersante de tipo fosfato éster tienen una transición pseudoplástico-dilatantenewtoniano alrededor de 5 s-1, que sugiere un efecto dado por el dispersante, ya que sólo se presenta para el fosfato éster por causa de una transición en la distancia de equilibrio y la influencia electroestática de los grupos etoxilados. Por otro lado, la región newtoniana de las dispersiones tiene un interés práctico, debido a que el proceso de tape casting se desarrolla dentro de esta gama de tasas de deformación.8 Mientras el esfuerzo de corte aumenta, las partículas llegan a un estado en el que la distancia de equilibrio se reduce y la probabilidad de que las partículas se encuentren aumenta, de manera que se generan repulsiones estéricas creadas por el entrecruzamiento de las partes no polares extendidas al medio. Este impedimento físico se manifiesta a 160 s-1, para el fosfato éster, y a 230 s-1 para el oligómero éster; y se marca por un cambio a un comportamiento dilatante. De manera que las cadenas compuestas por hidrocarburos generan una barrera física; las de grupos polietoxilados, más de tipo electroestático, debido a la presencia de oxígeno en la cadena. CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

En general, se observa que las suspensiones con dispersante tipo éster oligomérico presentan una viscosidad mayor que aquéllas con éster fosfato. Lo cual sugiere, en cada sistema, una interacción más fuerte entre el solvente y el medio solvente, con respecto a la longitud de la corona que se extiende hacia el medio y la naturaleza de las especies que conforman la corona y las moléculas que la rodean, hay una diferencia debido al tipo de dispersante en la gama comprendida entre 50 y 100 s-1, los cuales se reportan como los valores característicos de tape casting. No obstante, las diferencias de estructura y el conocimiento de la contribución elástica sirven para establecer la metaestabilidad de la suspensión, con respecto a la concentración de dispersante. En el modo oscilatorio (figura 9), se evidencia el efecto de los dispersantes. No importa que la concentración de la magnitud del módulo elástico y de pérdida sean muy pequeños e indiquen una alta movilidad del sistema, con respecto a la condición sin dispersante. Las suspensiones de polvo sin dispersante son muy agregadas, debido a que el medio es débil para reducir su energía libre, lo cual garantizaría la metaestabilidad de la dispersión. En esta condición la suspensión puede imaginarse como una red tridimensional de agregados con fuertes interacciones. A frecuencias altas en las suspensiones con dispersante, el módulo de pérdida (G”) es la lectura que el aparato muestra, e indica que el comportamiento elástico está fuera de la gama medible de la geometría. Mientras que el módulo elástico (G´) sea igual o menor que el módulo de pérdida (G”), el sistema tendrá un comportamiento de tipo fluido donde las moléculas del solvente no tienen una interacción de tipo elástico, debido a su gran movilidad, así como la tienen también las partículas.



Fig. 9a. Suspensiones con dispersantes grafeados, BT-01 en tolueno-etanol con fosfato éster

El punto donde G´y G” son iguales está en función de la dispersión. Esto depende del tipo de dispersante mediante sus interacciones en la polarizabilidad electrónica de las moléculas del medio. Este es el caso que se supone en este trabajo para las muestras de las figuras 9a y 9b. Mientras tanto, a bajas frecuencias hay un ligero incremento en los módulos, y la tendencia es a un comportamiento más de tipo elástico (G´). Esto se asocia en el presente trabajo al comportamiento browniano de las partículas, debido a que las moléculas adsorbidas al BaTiO3 evitan la interacción entre partículas durante la deformación. Como conclusión en cuanto a los dispersantes lineales, el polvo BT-01 con tamaño promedio de 100 nm tiene el mejor comportamiento reológico con este tipo de dispersantes. Lo que indica que éste es más compatible con los mecanismos de adsorción que se desarrollan entre los grupos de tendencia aniónica del dispersante y los grupos OH en la superficie, producto del método de síntesis. Dispersantes de macromoléculas grafeadas (en bloque)

Fig. 9b. Suspensiones con dispersantes “grafeados”, BT-01 en tolueno-etanol con oligómero éster.

Fig. 9c. Suspensiones con dispersantes “grafeados”, BT-02 en xileno-etanol con fosfato éster.


La adición del dispersante genera una reducción en la viscosidad aparente. No obstante, el efecto de la viscosidad a bajas tasas de deformación es diferente a lo observado en los mismos sistemas con polímeros clasificados como lineales. Las muestras de 100 nm con dispersante graft tipo AB n , a una concentración de 2% en peso (BT01TEKD62) tiene un comportamiento newtoniano de 240 Pa·s entre 0.001 s-1 y 0.007 s-1. Posteriormente, tiene un comportamiento pseudoplástico hasta el fin de la gama de medición. Por su parte, la muestra a 4% en peso (BT01TEKD64) y 6% en peso (BT01TEKD66) expresan un comportamiento mixto; esto es, a 4% en peso un comportaCIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


miento pseudoplástico que va de 4.76 Pa·s a 0.0009 s-1 hasta 0.194 Pa·s a 0.027 s-1, luego tiene un ligero comportamiento plástico, hasta llegar a un comportamiento newtoniano, que comienza en 8.32 s-1, con una viscosidad de 0.01 Pa·s para pasar a ser dilatante por arriba de los 252 s-1. Un comportamiento parecido lo muestra la suspensión a 6%, excepto que la región pseudoplástica es continua hasta llegar a 8.32 s-1 con una viscosidad de 0.01 Pa·s. Las muestras con el mismo dispersante, pero con partículas de 200 nm a 2% en peso (BT02TEKD62), tienen un comportamiento pseudoplástico en una gama de entre 4.36 Pa·s a 0.001 s-1 y 0.006 Pa·s a 3.63 s-1. En seguida, el comportamiento se torna newtoniano hasta 147 s-1 para, finalmente, pasar a ser dilatante. No se pudo medir por debajo de una tasa de corte de 0.90 s-1, debido a la sensibilidad de la geometría utilizada. No obstante, ambas suspensiones presentan un comportamiento newtoniano de 3.63 s-1 a 147 s-1, y dilatante arriba de este último valor. Los copolímeros grafeados o de bloque son ramificaciones laterales de un tipo de homopolímero “A” que se encadena a otro “B”. Éstos tienen un comportamiento anfotérico, debido a que uno de los bloques es compatible en una de las fases y el otro miscible en la otra fase. 13 En este estudio, el dispersante de fórmula ABn (tipo peine) tiene como “A” un grupo polimetil metacrilato (PMMA) con grupos hridoxilos y éster que se adsorben a la superficie de la partícula de BaTiO3; mientras que “B” es un grupo de cadenas polietoxiladas que se extienden al medio. Para los copolímeros en bloque de fórmula ABA, el grupo “A” son cadenas de hidrocarbones enlazados a grupos éster que adsorben a la partícula, mientras los grupos “B” son cadenas de polioxietileno que se extienden al medio. En función del tamaño de partícula, se observan diferencias notables en la magnitud y comportamiento de las suspensiones a CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

diferentes concentraciones de dispersante. Las muestras con el polvo de 200 nm revelan una viscosidad menor en comparación al de 100 nm. El polvo de 100 nm a una concentración por arriba de 4% sugiere una mejor dispersión, pues a 2% en peso el comportamiento es completamente pseudoplástico en la gama medida. Lo cual puede estar asociado a una pobre densidad de polímero adsorbido alrededor de la partícula y que la corona que las recubre no es suficiente para impedir las fuertes interacciones entre partículas. Las formulaciones con 4% en peso y 6% en peso tienen un comportamiento similar al observado en los dispersantes con macromoléculas lineales y en los cuales este comportamiento, en este trabajo, se asocia a la buena dispersión de partículas. En la suspensión con el polvo de 100 nm a concentraciones por debajo de 4% en peso tienen un comportamiento mixto a tasas de corte por debajo de 2 s-1, es pseudoplástico como en las formulaciones xileno-etanol y en los dispersantes fosfato éster y oligómero éster. Por la configuración y longitud de los grupos no polares que se extienden al medio, se especula que en esta región el sistema se encuentra dentro de una gama de tiempos de relajación correspondientes a las interacciones entre la corona extendida y el medio durante el desplazamiento de partículas en la deformación del fluido. Entonces, de la misma manera que en los dispersantes lineales, este comportamiento sugiere la existencia de fuertes interacciones ejercidas por las moléculas del solvente; sin embargo, el método se limita para descomponer cada efecto. En el modo oscilatorio, las suspensiones con polvo de 100 nm y una concentración de dispersante arriba de 4% en peso tienen un comportamiento viscoelástico. La suspensión con 2% y polvo de 100 nm soporta la suposición de un mal recubrimiento de partículas en razón de presentar un comportamiento “tipo só103


lido”,14 que se manifiesta como pseudoplástico en modo estático, como consecuencia de un gran número de interacciones influenciadas por las moléculas del medio que rodean a las partículas. En el caso de los dos polvos, el módulo de conservación no se registró, lo que significa una débil sensibilidad de esta geometría en la gama de medición. Con base en las curvas, se llega a pensar que el mecanismo que se impone sobre la movilidad es la deformación del solvente, ya que mientras los módulos disminuyen a bajas frecuencias no hay información, excepto la formulación con partículas de 200 nm con una concentración de 6% en peso. Para el copolímero en bloque ABA (PD 2206), hay una influencia del tamaño de partícula sobre el desempeño a la deformación y la dispersión de partículas en la suspensión. Por su lado, el polvo de 100 nm (BT-01) tiene un pobre desempeño con el dispersante de bloque, debido a la manifestación de interacciones complejas con manifestación pseudoplástica en modo estático y de respuesta débil, con respecto a sus módulos en función de la frecuencia en modo dinámico al igual que la suspensión sin dispersante. Asimismo, el desempeño del polvo BT-02 (200 nm) (figura 10) con el dispersante de bloque es similar para los dos tipos (ABA y ABn).

En el caso del PD 2206, el grupo que se adsorbe es una cetona con dos grupos por molécula; entonces, es posible que la eficacia de adsorción disminuya debido a las características de la pureza de la superficie, con respecto a grupos OH– y CO3–ˆ. Por esta razón, se especula que el polvo BT-01, con una pérdida de 1.5% en peso (en ATG), tiene un pobre desempeño con el dispersante PD 2206. En general, con los dispersantes graft el polvo BT02 muestra mejor desempeño, con respecto a sus características reológicas de viscosidad y el módulo elástico con los dispersantes “lineales”. Es posible que la causa de que el tamaño de partícula aumente genere que el mecanismo de repulsión estérico sea más efectivo, debido a la longitud y la compatibilidad de la corona extendida al medio. Reología de dispersiones: efecto del aglutinante Las suspensiones seleccionadas con base en un comportamiento newtoniano por arriba de una tasa de corte de 1 s-1 y un comportamiento viscoso predominantes (débil modulo elástico). Cada suspensión se mezcló con tres diferentes aglutinantes y el mismo contenido de plastificante (DOP). En la figura 11 se muestra el comportamiento reológico de los aglutinantes utilizados en un sistema tolueno-etanol. Dispersiones de la familia de dispersantes lineales

Fig.10. Suspensión con BT-02 (200 nm) en modo oscilatorio.


De pruebas reológicas del mismo tipo surge que una dispersión de polvo con tamaño de 100 nm (BT-01) y dispersante fosfato éster. Es evidente la fuerte influencia del aglutinante para imponer sus propiedades viscoelásticas al sistema. Por ello, las diferencias entre el comportamiento reológico de la dispersión y la suspensión se deben a las interacciones moleculares entre la suspensión, el aglutinante y el plastificante. De ahí la importancia de la estructura



Fig. 11a. Comportamiento reológico de los aglutinantes. en modo estático.

Fig. 11b. Comportamiento reológico de los aglutinantes en modo oscilatorio.

del aglutinante que, para el caso de la dispersión BT01TERS42B1 (BL-SH), tiene un comportamiento mixto en el análisis estático. Es decir, la geometría no es sensible a las interacciones por debajo de 0.01 s1-, después se observa una gama de transición de un comportamiento dilatante a uno newtoniano después de 1 s-1. Este comportamiento puede estar gobernado por las interacciones entre los grupos hidroxilo del aglutinante y la parte polar de las moléculas del dispersante por el efecto de dipolos inducidos, el cual crea una fricción a tasas de corte bajas. Asimismo, los efectos del aglutinante B3 ( BL5Z) y B5 (BM-SH) tienen una gran influencia en la gama medida, y por ello se observan dos comportaCIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

mientos: pseudoplástico antes de 1 s-1 y newtoniano. La primera región indica una evolución de la dispersión a nivel molecular, bajo el efecto de un esfuerzo de corte, y la segunda de una cantidad de interacciones con tiempo de relajación cortos. La dispersión con BT-01 en xileno-etanol y PDMIL tiene el mismo comportamiento antes mencionado. Finalmente, el efecto de rotación de las macromoléculas del PBB predomina bajo la deformación y, por ende, en el comportamiento reológico de ésta. Además, la concentración volumétrica de las partículas no mostró un efecto importante en su reología. Por ello, las suspensiones no se mejoran al agregar el PVB, pues en un estado de agregación el aglutinante lo mantendrá. En el modo dinámico, las propiedades viscoelásticas del aglutinante predominan. Es evidente que el efecto de la suspensión disminuye al agregar el aglutinante, pues espera que la movilidad de las partículas cerámicas se reduzca hacia la zona de altas frecuencias, en tanto que las moléculas del medio solvente se deforman. Mientras que la frecuencia disminuye los éster grandes como las partículas se trasladan e interactúan entre ellas. En el caso de las dispersiones con PVB del peso molecular alto BM-SH, el aumento en la magnitud de los módulos (en especial el elástico) indica el enlazado de cadenas en función a su longitud. Dispersiones de la familia de dispersantes grafeados En los resultados para una dispersión con BT02 (200 nm), en un medio tolueno-etanol con un dispersante tipo copolímero graft (KD-6), esta dispersión muestra que por el contrario de los dispersantes de la familia (lineales), hay un efecto sobresaliente de la dispersión en el comportamiento del aglutinante, cuando la cadena de PVB es tan larga como en B5 (BM-SH); mientras que los aglutinantes B1 y B3 tie105


nen un comportamiento similar al observado con los dispersantes aniĂłnicos. Lo anterior sugiere que las macromolĂŠculas de polioxitileno se extienden hacia el medio e interactĂşan con las molĂŠculas de PVB, dicho efecto genera una fricciĂłn durante la difusiĂłn de partĂ­culas a travĂŠs del medio y reduce. Por tanto, el comportamiento pseudoplĂĄstico sugiere el efecto antes mencionado con un grado de desorden de las cadenas polimĂŠricas en el solvente. Si bien la deformaciĂłn se conserva y la tasa de corte aumenta, es de esperarse un cierto grado de orden en la alineaciĂłn de cadenas arriba de 2 s1 , tornando al sistema con tiempos de relajaciĂłn cortos y un comportamiento newtoniano. Entonces, el sistema se torna mucho mĂĄs dinĂĄmico, lo que sugiere que no se debe a interacciones entre partĂ­culas. En el caso del modo dinĂĄmico, las propiedades viscoelĂĄsticas del aglutinante predominan; es evidente, el efecto de la suspensiĂłn se debilita cuando se agrega el aglutinante por la reducciĂłn en la movilidad y la difusiĂłn de las partĂ­culas, sobre todo a altas frecuencias en las que las molĂŠculas del solvente se desplazan. Conforme la frecuencia disminuye, las fracciones como las partĂ­culas que podrĂ­an ser desplazadas en el medio en los que las molĂŠculas de PVB y el plastificante estĂĄn suspendidas e interactĂşan con la corona de las partĂ­culas. Este efecto es muy fuerte cuando la dispersiĂłn tiene cadenas largas, lo que significa un entrelazamiento, como en el caso de los dispersantes (lineales). Se espera que la magnitud de los mĂłdulos sea tambiĂŠn mĂĄs larga, debido a que la longitud de las cadenas en bloque es en su mayorĂ­a larga, con respecto a las cadenas lineales. La dispersiĂłn con polvo BT02 (200 nm) en un sistema tolueno-etanol y PD2206 muestra un comportamiento similar al discutido. En general, el comportamiento reolĂłgico es gobernado por el aglutinante, y a bajas deformaciones se observa un efecto del aglutinante y el dispersante en funciĂłn a su estructura, siendo el de mayor influencia el 106

de mayor peso molecular. El aglutinante B3 (BL-SZ), con un peso molecular de 32,000, muestra las propiedades viscoelĂĄsticas mĂĄs adecuadas para (tape casting) de cintas (delgadas). FabricaciĂłn de cintas cerĂĄmicas Las formulaciones descritas en la tabla VI conforman cintas sobre el Mylar. Un cuarto polvo (MT02), elaborado por la empresa Marion Technologies, se utilizĂł en reemplazo del MT-03. Estas corridas experimentales se realizaron para obtener el sistema estable y dĂŠbilmente viscoso.

Tabla VI. Formulaciones de barbotinas para el tape casting.























DespuĂŠs del secado, se determinaron el espesor y la rugosidad de la cinta. Los tres pasos a continuaciĂłn son primordiales en las etapas de fabricaciĂłn de CCM con la tecnologĂ­a tape casting, pues se determinan segĂşn la calidad y el desempeĂąo de capacitores. CIENCIA UANL / AĂ&#x2018;O 15, No. 60, OCTUBRE - DICIEMBRE 2012


Morfología y relación espesor-formulación Primero, se ha determinado el espesor de cinta en crudo después de haber optimizado la dispersión. La figura 12 muestra el espesor en función de la formulación, así como la rugosidad en función a la formulación. Las formulaciones presentan las propiedades adecuadas para fabricar cintas de espesores (delgados). El valor reportado es el estadístico predominante (la moda) medido por un perfilómetro de contacto y el MEB.

desintegrados durante la etapa de molido o a la contaminación del material proveniente del recubrimiento del molino. Las imágenes de la superficie de la banda B3 obtenidas en el interferómetro corroboran esta hipótesis (figura 14). El valor de rugosidad de esta cinta B3 es más bajo que aquélla en la banda B1. De este modo se ha reducido el espesor de bandas hasta el límite permitido por los ajustes; sin embargo, la contaminación debida a la erosión del molino es un factor a considerar. Sin duda, la barrera tecnológica bajo la técnica tape casting para la subsecuente reducción de espesor de cinta será la eliminación de agregados y de ajustes mecánicos en la altura de la cuchilla.

Fig. 12. (Negro) Espesor de bandas en función de la formulación. Altura de la cuchilla: 2.5 µm. (Azul) Rugosidad (Rz) de cinta por interferómetro.

El valor de la rugosidad reportada proviene de las lecturas del interferómetro. La figura 13 muestra las cintas de espesor de 2.1 y 2.5 µm obtenidas con los polvos BT01 y BT02, respectivamente. Sin duda, la reducción del tamaño de partícula es un factor ligado a la obtención de espesor. Se aprecia que los valores de espesores más grandes son para las cintas elaboradas con el polvo BT-01 (B1 y B2), que sugiere una concentración más elevada de agregados. Las muestras B3 y B4 manifiestan una concentración de agregados menor al igual que espesores bajos. Ahora bien, es posible visualizar una etapa suplementaria durante la elaboración de la cinta, como una filtración para retener los agregados no

Fig.13a. Imágenes laterales de cinta B1.

Fig. 13b. Imágenes laterales de cinta B3.




Una característica importante de las cintas cerámicas elaboradas es su facilidad para despegarse del Mylar, con el propósito de apilarlas para fabricar estructuras multicapas. En nuestro caso, todas las cintas se despegaron sin dejar residuos cerámicos, algo importante, pues las bandas desarrolladas en este estudio son factibles de ejecutarse con los métodos tradicionales de la fabricación de CCM. A partir de los resultados anteriores y en función de la hipótesis postulada, se demostró que una dispersión con una baja viscosidad y un bajo modo elástico es apta para conformar una cinta cerámica de 2 µm por tape casting. Por otro lado, este estudio demuestra la utilización de polvos nanométricos, que no tienen una señal de capacitancia hacia la reducción de espesor, porque la agregación juega un papel preponderante.

Fig.14a. Imagen se la superficie de cinta B1D en donde se aprecian los agregados (en rojo).

Fig. 14b. Imagen se la superficie de cinta B3D en donde se aprecian los agregados (en rojo).


CONCL USIONES CONCLUSIONES Para reducir el espesor en cintas cerámicas es necesario que las propiedades reológicas de la formulación sean de baja viscosidad y débil contribución elástica. Se ha establecido una relación cuantitativa entre los materiales utilizados y el espesor final de cinta. El peso molecular promedio del aglutinante es el factor dominante para reducir la viscosidad de la dispersión en medios no acuosos. La selección de los solventes y el dispersante están en función del tamaño de partícula para dispersiones de BaTiO3 concentradas a 15% (en volumen). Se encontró que la simple adición de dispersante al sistema reduce la viscosidad hasta cuatro órdenes de magnitud, sin importar el tipo de polvo de BaTiO3 o el tamaño de partícula utilizado. El diseño de experimentos desarrollado en este trabajo considera indispensable el uso de la reología dinámica para el diseño de dispersiones adecuadas para elaborar cintas cerámicas delgadas. Muchos trabajos caracterizan formulaciones de BaTiO3 desde el punto de vista estático y con una visión de medio continuo; en cambio, el enfoque de este trabajo es de un punto de vista estructural: la viscosidad se toma como una variable compleja con una componente elástica (conservación) y otra viscosa (pérdida). Se observó que el criterio de selección de suspensiones capaces de conformar cintas de espesor de 2 µm son una viscosidad por debajo de los 100 Pa•s y un módulo de conservación menor al de pérdida en los tiempos de relajación propios del tape casting. El límite de espesor para conformar cintas cerámicas delgadas uniformes por medio de la técnica tape casting es de 2.5 µm, está limitada por los ajustes mecánicos que puedan realizarse a una escala tan pequeña. Este valor del espesor se considera como ultradelgado para la técnica tape casting, pues alcanza los límites de otras técnicas desarrolladas especialmente para producir



película delgada: dip coating, spin coating, depositación química en fase vapor, no necesariamente útiles al tape casting para producción a escala industrial. RESUMEN En este estudio se diseñó una barbotina cuyo comportamiento viscoelástico resulta óptimo para obtener cintas cerámicas con base en BaTiO3 de espesor menores de 3.5 µm, mediante tape casting. Se considera la caracterización de la parte elástica del comportamiento viscoelástico de la suspensión, la cual por lo común no se toma en cuenta en la caracterización reológica de este tipo de materiales, y se demuestra que es relevante en el espesor final de la cinta que logre producirse. Se probaron diferentes polvos de BaTiO3, solventes, dispersantes y aglutinantes para preparar una barbotina, y se encontró que el solvente más adecuado es una mezcla tolueno-etanol, y que dependiendo del tipo de cerámico el dispersante puede ser copolímero graft ABn o fosfato éster. El aglutinante fue PVB de peso molecular medio. Estas cintas se utilizan regularmente en la industria de los capacitores cerámicos multicapas. Se considera en la industria en general que el espesor mínimo que se puede obtener mediante tape casting es de 3.5 µm, por lo que los resultados de este trabajo corresponderían en estos términos a cintas ultradelgadas, ya que se obtuvieron valores menores de 3 µm. Palabras clave: Viscoelasticidad, Suspensión, Tape casting, TiBaO3. ABS TRA CT ABSTRA TRACT A barbotine design, whose viscoelastic behavior is optimal for “tape casting” of ceramic tapes based on BaTiO3 of thickness lower than 3.5 µm, is presented. This design considers the elastic characterization of CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

the viscoelast behavior of the slip, which is usually not taken into account in the rheological characterization of this kind of materials, and that was proven relevant over the final thickness of the tape that is produced. Several BaTiO3 powders, solvents, dispersants, and agglutinants for preparing the barbotine were tried. It was found that the most suitable solvent is a mixture of toluene-ethanol, and that depending on the kind of ceramic, the dispersant could be a graft ABn or phosphate ester. The agglutinant used was PVB of medium molecular weight. These tapes are commonly employed in the manufacture of multilayer ceramic capacitors. It is considered in the industry that the minimum achievable thickness by means of “tape casting” is 3.5 µm, which according to the results of this work could be considered in these terms as ultrathin, since layer thinner than 3 µm were obtained. Keywords: Viscoelasticity, Sip, Tape casting, TiBaO3.

Agradecimientos Este trabajo se desarrolló en el marco del proyecto Conacyt PCP 11/07 (Programa de Colaboración de Posgrado) que involucra a la Universidad Autónoma de Nuevo León, particularmente a la Facultad de Ingeniería Mecánica y Eléctrica, a la Universidad Paul Sabatier, en específico al Institut Carnot Cirimat, a Kemet de México y a Marion Technologies en Francia. Se agradece el apoyo del MC Leonel Montelongo Concha, de Kemet Charged de México, y del Dr. Joseph Sarrías, de Marion Technologies. Asimismo, se reconoce la colaboración de Jean-Jaques Demai (Cirimat), Celine Combettes y del Dr. Zarel Valdez Nava.





Vinotini (V.), Sing (P.), Balasubramanian (M.). Optimization of barium titanate nanopowder slip for tape


Nguyen (D.Q.), Lebey (T.), Castelan (P.), Bley (V.), Boulos (M.), Guillemet-Fritsch (S.), Combettes (C.), Durand

casting, J. Mater. Sci., 41, pp. 7082-7087, 2006. 8.

BaTiO3 powders (Part I), Cer. Int., 10, p. 43-48, 1984.

(B.).- Electrical and Physical Characterization of Bulk Ceramics and Thick Layers of Barium Titanate


Pure Barium Titanate Proceedings of a special conference of the 85th Annual Meeting of the American Ceramic

Barbier (B.). Elaboration et caractérisation de

Society, held on April 24-27, Chicago Illinois, pp. 164-

condensateurs à base de CaCu3Ti4O12 à forte permittivité

183, 1983. aqueous barium titanate tape properties, J. Amer. Cer. Soc.,

Cho (C.W.), Yeo (J.G.), Jung (Y.G.), Paik (U.). Green

87[6], pp. 1066-107, 2004c.

22, pp. 1639-641, 2003.

11. MARCUS (Y.). The properties of Solvents, John Wiley and Sons, Vol. 4, pp. 67-121, 1999. 12. Woon (C.C.), Gu (Y.J.), Gil (J.Y.), Ungyu (P.). Green

Sakabe (Y.), Wada (N.), Ikeda (J.), Hamaji (Y.). Ceramics

microstructure and mechanical properties of BaTiO3-

for Ultra-thin Dielectric Layer of Multilayer Ceramic

poly(vinyl butyral) tape-cast bodies, J. of Mat. Sci. Lett.

Capacitors, IEEE, 98, p. 565-569, 1998.

22, pp. 1639-1641, 2003.

Sakabe (Y.). Recent Development in Multilayer Ceramic

13. Tadros (T.F.). Applied Surfactants : Principles and

Capacitors, Ceramic Volume Transactions, Vol. 97,

Applications. Germany, Wiley-VCH Verlag GmbH & Co,

Multilayer Electronic Ceramic Devices, ed. J.-H. Jean, T.K.


Gupta, K.M. Nair, and K. Niwa, pp. 3-15, Am. Cerm. Soc., Westerville, OH, 1999. 6.

10. Yoon (D.H.), Lee (B.I.). Effects of excess barium ions on

Université Toulouse III – Paul Sabatier, 2009.

poly(vinyl butyral) tape-cast bodies, J. of Mat. Sci. Lett.


Mikeska (K.), Cannon (R.). Dispersants for Tape Casting

634, 2007.

microstructure and mechanical properties of BaTiO3-



manufactured using Nanopowders, ASM Int., 16, pp. 626-

relative pour l’électronique de puissance, Thèse de doctorat, 3.

Mizuta (S.), Parish (M.), Bowen (H.K.). Dispersion of

14. Lewis (J.A). Colloidal Processing of Ceramics , J. Amer. Cer. Soc. 83 [10], pp. 2341-2359, 2000.

Tseng (W.J.), Wang (S.R.). Dispersion and rheology of BaTiO3 nanoparticles in ethanol–isopropanol solvents, J.

Recibido: 1 de septiembre de 2012

Electroceram, 18, pp. 197-204, 2007.

Aceptado: 1 de septiembre de 2012
















Entrevista a la Dra. Blanca Mirthala Tamez Valdez, Premio de Investigación UANL 2012, en el área de Ciencias Sociales ESPERANZA ARMENDÁRIZ

En México, el número de divorcios se ha incrementado en forma significativa en la última década, y Nuevo León ha registrado estadísticas sorprendentes, considerando que se ha cuadriplicado la cantidad de parejas que terminan el matrimonio de manera legal. La Dra. Blanca Mirthala Tamez Valdez, como investigadora de los fenómenos sociales más apremiantes, le apostó a este tema tan controversial para postularse al Premio de Investigación UANL 2012, del que fue ganadora en la categoría de Ciencias Sociales. El objetivo de este proyecto fue estudiar la relación presente entre el nivel de autonomía percibido por las mujeres que alguna vez han enfrentado el divorcio (tanto durante su matrimonio, como después del divorcio) y el nivel de bienestar que ellas perciben; asimismo, revisar los efectos sociales y materiales señalados por las mujeres tras el divorcio, centrándose en las mujeres divorciadas del área metropolitana de Monterrey. ¿Qué metodología se empleó en esta investigación? El estudio se centró en la relación entre el nivel de autonomía que ellas perciben y su nivel de bienestar, antes y después del divorcio. Es un estudio cuantitativo, transversal y a nivel correccional, con una muesCIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

tra mixta, se eligió de manera aleatoria un total de 300 AGEBs en los que se estableció una cuota de cuatro sujetos de estudio por zona; pero en una segunda fase, la muestra se diversificó. También abrimos la muestra a otras fuentes para captar a personas divorciadas que atendieran las encuestas, a través de grupos de apoyo en cuatro municipios diferentes 111


del área metropolitana a los que acuden al vivir el proceso de divorcio; al tribunal eclesiástico (para aquellas mujeres que pedían anulación religiosa) y se tomaron algunos voluntarios de dos juzgados de lo familiar.

Sin embargo, los resultados de nuestra investigación sí que nos sorprenden; pero es evidente que ellas vivieron un proceso de duelo o separación, que dura al menos dos años; y cabe señalar que muchas lo vivieron durante el matrimonio, porque pensaron en el divorcio dos años antes de concretarlo.

¿Qué resultados arrojó el estudio? ¿Otros hallazgos que tuvieron en esta investigación? En una serie de áreas se pidió a las mujeres comparar el antes y el después del divorcio, en los aspectos económico, emocional, familiar, amoroso, social; y los resultados nos sorprendieron, porque una gran cantidad de mujeres, una proporción elevada, señala estar mejor después del divorcio, al comparar su situación con el antes; sólo en la situación económica, la mitad indica que está mejor y el resto dice que empeoró o está igual. Pero reportan mejoría en su vida social y en el estado de ánimo. En relación de autonomía y bienestar, ellas reportan que tienen un mejor nivel de autonomía que durante su matrimonio, es decir, la libertad que ellas perciben en la toma de decisiones, en el control de los recursos y la administración en el hogar, así como en la educación de sus hijos. Que sin duda esto impacta en lo social y emocional… Influye de manera directa en su bienestar. En el nivel de autonomía, siete de cada diez mujeres tienen mayor libertad y control de sus recursos; en cuanto al bienestar, son ocho de cada diez las que responden positivamente. ¿Este estudio rompe los mitos en torno al divorcio? Esperábamos encontrar mayor diversidad. Sí, hay otros estudios que nos reportan que las mujeres sentían alivio y una liberación cuando ellas tomaban la decisión. 112

Nos llama la atención que las más escolarizadas son las que llegan hasta el divorcio. Esto no quiere decir que no haya rupturas en niveles de baja escolaridad, pero lo que pasa es que no se formaliza y queda en una separación. Entrevistamos a 457 mujeres y registramos a algunas sin escolaridad o sólo con primaria, hasta aquéllas con estudios de posgrado; el promedio (de estudios) es de 14 años, y es mayor al promedio de 10, que hay en el estado. ¿Había estudios previos acerca del tema? Claro, y han registrado que se está incrementando la proporción de mujeres que vuelven a casarse o a unirse después del matrimonio, esto significa que la mujer no cuestiona la institución del matrimonio, solamente la manera en que se desarrolló ese matrimonio en particular. ¿Qué estadísticas hay en relación a este indicador? Sólo una de cada cuatro mujeres se vuelve a casar o a unir; vemos una cuestión multifactorial, en la cual las transformaciones sociales-familiares, el papel de la mujer está cambiando y las relaciones de la pareja también. Ahora hay distintos tipos de pareja, ya no es sólo el esquema tradicional. Hay parejas que logran tener cierta equidad y otras que no; se quedan en una transición o se ven obligadas al cambio. Además, estas transformaciones que ocurren en el papel



de la mujer y los hijos cambiaron, y las expectativas de la mujer también: busca más a una pareja que trabaje codo a codo, más que alguien que le dé protección. ¿De este estudio continúa alguna otra línea de investigación? Seguimos analizando los resultados. Este estudio es la tesis que presenté para obtener el doctorado en la Facultad de Trabajo Social y Desarrollo Humano; antes realicé la investigación “La solidaridad familiar hacia los adultos mayores en Monterrey”, un estudio sobre envejecimiento, el cual me hizo ganadora del Premio a la Mejor Tesis de Maestría, en 2007. ¿Es su primer Premio de Investigación por parte de la UANL? Sí, y la verdad no me lo esperaba, porque había mucha competencia, incluso colegas de mi misma Facultad, así que me sorprendió mucho de entrada. Estoy muy contenta por haberlo obtenido, que haya llamado la atención mi trabajo con esta línea, en un tema controvertido. Estoy muy agradecida con la UANL, por el apoyo y el estímulo recibidos. ¿Qué compromisos cree que debe asumir un investigador al obtener este reconocimiento? Sí, es un compromiso, y de alguna forma me motiva a seguir con la investigación, haciendo trabajos de


mejor calidad; la competencia es con uno mismo, al tratar de mejorar lo que uno ha realizado. ¿Qué temas atraen a los estudiantes en relación con la investigación en el área de ciencias sociales? Ahora mismo tengo cuatro grupos que trabajan sus proyectos, son muy entusiastas y están muy interesados en la investigación. Les interesa mucho el bulling, sobre todo en las secundarias; el envejecimiento, la violencia que se manifiesta en el noviazgo, y algunos se han enfocado en la violencia hacia la mujer, pero también hacia los hombres; la discriminación que viven los discapacitados. ¿Qué encuentra en la investigación? Uno busca aportar, profundizar un poco en el estudio de los fenómenos sociales, que luego arroja resultados muy reveladores. Nosotros queremos conocer más acerca de la problemática y de las tendencias sobre el tema.

La Dra. Blanca Mirthala Tamez Valdez, desde 1998, ha estado vinculada a proyectos de investigación en la Facultad de Trabajo Social y Desarrollo Humano (FTSyDH); sus líneas de investigación son envejecimiento, familia y divorcio. Actualmente imparte la cátedra de metodología de la investigación. 113














Entrevista a la Dra. Isolde Hedlefs, Premio de Investigación UANL 2012, en el área de Humanidades JESSICA BALDERAS SALAZAR

A partir de la exploración de la naturaleza cognitiva de los mecanismos de evaluación de información sobre violencia y perdón en personas que experimentaron maltrato infantil en diferentes etapas del desarrollo, estableciendo, además, un sistema de diagnóstico cognitivo para determinar si existe procesamiento disfuncional de información de eventos de violencia en esta población, esta investigación fue vencedora entre 21 proyectos del área de Humanidades. “Nuevas formas de diagnóstico del procesamiento cognitivo de eventos de violencia y perdón en personas con antecedentes de maltrato infantil”, es el proyecto realizado por especialistas de la Facultad de Psicología, encabezados por la Dra. Isolde Hedlefs, con el apoyo del Dr. Ernesto Octavio López Ramírez y la Dra. Guadalupe Elizabeth Morales Martínez. La doctora Hedlefs ahonda en dicho trabajo y nos comenta al respecto. El estudio que le hizo ganadora del Premio de Investigación UANL, ¿de qué trata? Trata sobre los mecanismos cognitivos de evaluación emocional que subyacen al procesamiento de eventos de violencia y perdón en niños, jóvenes y adultos con antecedentes de maltrato infantil. Básicamente se trató de mostrar cómo las personas que sufrieron 114

maltrato infantil procesan la información de violencia y perdón. ¿Cómo surge esta investigación? El Fondo de las Naciones Unidas para la Infancia (UNICEF, 2009) estima que, al año, entre 500 y 1,500 millones de niños padecen violencia, y entre los países con mayor número de casos de muerte CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


por maltrato infantil se encuentran: México, Estados Unidos y Portugal (Lozano et al., 2006). De manera particular, en el caso de México, los registros estadísticos del Sistema de Desarrollo Integral de la Familia Nacional (DIF Nacional, 2011) señalan que las denuncias sobre casos de maltrato infantil en la última década se han incrementado notablemente. Sin embargo, en México no había investigaciones sobre cómo las personas que sufrieron maltrato infantil procesan la información emocional a nivel automático, o sobre cómo esta condición les afecta. Entonces, esto marcó la necesidad de enfocar líneas de investigación sobre dicho tema, y así nace esta investigación. ¿Cuál es el alcance de este trabajo? La presente investigación es relevante en varias áreas; CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

a nivel teórico, la exploración de los sesgos en la percepción o preferencia de determinada información emocional en personas que han experimentado violencia en edades tempranas, contribuye a la comprensión de los mecanismos de evaluación emocional de esta población. A su vez, los avances en este campo favorecen el establecimiento de formas confiables y efectivas de diagnóstico; aquí, las técnicas utilizadas para este proyecto no sólo permiten determinar el impacto de los eventos de violencia en el aparato cognitivo de las personas que han experimentado maltrato, también brindan parámetros para saber cómo dichas experiencias afectan procesos de relevancia en cualquier ser humano. Por ejemplo, el perdón es un proceso de relevancia para la vida humana; desde muy temprano, las personas se ven en la necesidad de desarrollar estrategias y habilidades para superar e, incluso, en ocasiones extremas, so115


brevivir a las transgresiones de otros. En el caso del maltrato, éste es un tema especial, porque el proceso del perdón surge como una posible aproximación de sanación; en este sentido, la presente investigación brinda herramientas que permiten determinar cómo las personas significan este tipo de procesos, que es un primer paso para delimitar las herramientas psicológicas con las que cuenta un individuo que ha experimentado el maltrato. Los resultados de la investigación sugieren que personas con antecedentes de maltrato infantil tienden a desarrollar una forma particular de estilo de procesamiento preatentivo sobre información de violencia y perdón, y sólo en ocasiones dicho procesamiento particular parece seguir reglas de integración de información de violencia y perdón.

Uno de los primeros resultados que nos sorprendió mucho, y nos motivó a seguir en esta misma línea de investigación, fue que cuando realizamos el estudio de reconocimiento facial con tiempos de reacción, los datos sugirieron que las niñas y los niños con maltrato infantil parecen presentar diferencias en sus estilos de procesamiento afectivo. Tuvo relevancia, ya que las niñas, aunque reportaban verbalmente el reconocimiento de caras negativas, ellas bloqueaban o filtraban este tipo de información; es decir, no categorizaban la información negativa como tal, sino que la juzgaban sin emoción o neutra; mientras que los niños con maltrato presentaban un proceso de rumiación disfuncional a niveles de procesamiento automático sobre la información negativa.

¿Cuánto tiempo lleva este proyecto?

¿Cuánto tiempo llevó lograr los resultados deseados, cómo se llevó a cabo cada una de las etapas?

Ha sido un proceso largo, aproximadamente de ocho años, en los que han surgido varias ponencias y tesis de todos los niveles académicos. ¿En qué etapa se encuentra actualmente? Aunque la línea de investigación ha alcanzado madurez en diferentes aspectos, aún falta mucho por realizar en este campo, desde la perspectiva cognitiva. Específicamente, la siguiente etapa sería la construcción de un modelo teórico, en el que se vean enclavadas las variables cognitivas y emocionales desde el procesamiento automático, así como su evaluación. ¿Cuáles fueron sus primeros resultados, sobre todo los que encaminaron a este estudio a buscar otra fase mejor preparada?


Debido a que es difícil el acceso a la población, en este caso niños, adolescentes y adultos que habían sufrido maltrato infantil, cada experimento se realizó en un periodo aproximado de entre seis meses y un año. ¿De qué manera beneficia a la sociedad este proyecto? Un beneficio primordial es que este proyecto culminó con una batería de diagnóstico denominada vulnerabilidad cognitiva ante el maltrato infantil, una herramienta para los terapeutas que trabajan con esta población. Dicha batería está diseñada para auxiliar en el diagnóstico y la evaluación de los pacientes con maltrato infantil, y puede utilizarse para monitorear la eficiencia de la terapia a través de explorar el procesamiento de información emocional, ya sea controlado o en automático.



¿Qué tanto se estudia este tema en México? Debido al contexto que desafortunadamente vive nuestro país, el interés por explorar este tipo de temas se ha incrementado relativamente; sin embargo, hasta donde sabemos, el estudio de los mecanismos cognitivos hacia los eventos de maltrato y violencia no se había explorado desde una perspectiva cognitiva. Incluso, al parecer, en el país somos el único laboratorio que estudia desde una perspectiva de ciencia cognitiva el procesamiento de la información emocional relacionada con eventos de maltrato y violencia. ¿Qué significa este reconocimiento? Significa un aplauso al esfuerzo y a la dedicación que como equipo hemos realizado. En lo personal, es una satisfacción saber que, a través de estos procesos de difusión, muchas personas conocerán nuestra investigación y probablemente surgirá interés en otros profesionales por unirse a esta línea de investigación. Significa brindar oportunidades de diagnóstico con herramientas sofisticadas que impactarían en la planeación de los procesos de sanación de aquellas personas que han experimentado maltrato infantil.


¿Cómo se convierte en investigadora de la Universidad Autónoma de Nuevo León? Todo comenzó a través de un proyecto de investigación de la UANL llamado Provercyt, por medio del cual comencé en la preparatoria con actividades de investigación, en el Laboratorio de Ciencia Cognitiva que dirige el Dr. Ernesto López. A través de este proyecto, descubrí que mi pasión era la investigación, me enamoré de la investigación y la elegí como mi camino. Esta labor me ha dejado muchas cosas, desde crecimiento académico hasta crecimiento personal. Así como la línea de investigación creció con los años, así crecí yo, tanto académica como personalmente. ¿Qué sigue ahora? Seguir haciendo investigación. Como comenté antes, todavía hay muchas cosas por hacer en esta área, en especial por el contexto que vive nuestro país. Los esfuerzos por comprender los efectos de la violencia ayudan a generar conciencia del costo que tiene este tipo de experiencias, no sólo a nivel individual, sino en términos de desarrollo humano, para cualquier sociedad.















Entrevista a la Dra. Ma. Aracely Hernández Ramírez, Premio de Investigación UANL 2012, en el área de Ingeniería y Tecnología JESSICA BALDERAS SALAZAR

Ganador del Premio de Investigación UANL 2012, en el área de Ingeniería y Tecnología, el trabajo denominado “Degradación de un herbicida en medio acuoso mediante la generación in situ de especies oxidantes”, fue un proyecto encabezado por la Dra. Ma. Aracely Hernández Ramírez, en conjunto con los investigadores Minerva Villanueva Rodríguez y Juan Manuel Peralta Hernández, del Laboratorio de Fotocatálisis y Electroquímica Ambiental, de la Facultad de Ciencias Químicas. Al competir contra 17 proyectos, resultaron dos ganadores, entre ellos éste, en el cual se lleva a cabo la descomposición de un herbicida de uso muy común, el ácido 2,4-diclorofenoxiacético (2,4-D), mediante diferentes procesos que implican la generación de especies fuertemente oxidantes: los radicales hidroxilo (HO•) y el ión ferrato [FeO42-]. A profundidad, la doctora Hernández Ramírez nos cuenta sobre este importante proyecto. Su estudio ganador del Premio de Investigación UANL, ¿de qué trata? Acerca del desarrollo de nuevos procesos que permitan la generación de especies muy oxidantes in situ, es decir, en el medio acuoso donde se van a aplicar 118

para degradar contaminantes que se encuentran en el agua; dichas especies son el radical hidroxilo y el ión ferrato, que son más oxidantes que el cloro y el ozono, por ejemplo. ¿Cómo nace la idea de realizar esta investigación? Las especies oxidantes que se generan in situ, en esta investigación, el radical hidroxilo y el ión ferrato, se pueden producir por diferentes rutas o procesos, entre éstos la fotocatálisis heterogénea y la vía electroquímica. En nuestro grupo de investigación tenemos ya varios años estudiando la fotocatálisis, proceso que requiere de un catalizador y luz para producir los radicales hidroxilo, fuertemente oxidantes, y así destruir los contaminantes; sin embargo, las características del catalizador y las condiciones del medio definen la eficiencia del proceso, por eso en nuestra investigación estamos sintetizando nuevos catalizadores o modificando los ya existentes, como en el caso de la modificación del óxido de titanio o el óxido de zinc con pequeñas cantidades de óxido de hierro, esto permite que su activación genere la producción de los radicales hidroxilo más eficientemente al estar en contacto con el contaminante y de esta manera destruirlo. Además, la modificación de estos materiales permite su activación con luz solar, lo que CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


hace más sustentable el proceso. Por otra parte, las sales comerciales de ferrato; como ferrato de potasio, son también muy oxidantes, sin embargo el costo de éstas es muy elevado y son inestables, deben mantenerse en medios alcalinos para su aplicación en el tratamiento de contaminantes en aguas residuales. En este sentido, en nuestro grupo, y como parte de la tesis doctoral que dirigí, de la Dra. Minerva Villanueva, con la coasesoría del Dr. Juan Manuel Peralta, planteamos la idea de generar ambas especies, el radical hidroxilo y el ión ferrato in situ por la vía electroquímica para probar su eficiencia en la degradación de un herbicida como el 2,4-D. Incluso, se investigó el mecanismo de la producción del ión ferrato generado en medio ácido y la sinergia que entre éste y el radical hidroxilo se presentó para destruir el contaminante. Finalmente, para complementar nuestro proyecto, se realizó un estudio comparativo de los procesos estudiados, tanto del fotocatalítico como del electroquímico, y se generó conocimiento en la aplicación de ambos procesos al seguir los intermediarios que se formaron durante la descomposición del herbicida. ¿Hasta dónde llega esta investigación? Con la investigación de estos procesos, englobados entre los procesos avanzados de oxidación, que permiten la generación de especies oxidantes in situ, pretendemos desarrollar tecnologías de tratamiento de contaminantes recalcitrantes en aguas residuales, como una alternativa a la oxidación química, evitando el gasto de reactivos químicos costosos, por ejemplo, el uso del cloro o el ozono que además pueden generar subproductos tóxicos. Por eso en esta investigación no sólo se estudió la generación de las especies oxidantes y la degradación del contaminante, sino que se realizó el seguimiento de los subproductos que se forman durante el proceso, para asegurarnos de


que no se estén produciendo sustancias más tóxicas que las que se están tratando. ¿Cuánto tiempo llevan trabajando con este proyecto? No es un proyecto aislado, son varios, tenemos más de diez años trabajando en procesos avanzados de oxidación, especialmente para el tratamiento de aguas residuales, buscando alternativas. No existe un proceso que destruya todos los contaminantes; algunos resultan efectivos para degradar un tipo de sustancias tóxicas, pero presentan algunos inconvenientes según la matriz donde se encuentran los contaminantes. Entonces hay que investigar otra forma de producir las especies oxidantes para resolver el problema de contaminación. ¿Cuáles fueron sus primeros resultados, sobre todo los que encaminaron este estudio a buscar otra fase mejor preparada? Iniciamos la investigación en fotocatálisis para la producción de las especies oxidantes, aplicando la radiación que requiere el proceso mediante lámparas que emiten luz UV, lo cual conlleva un costo elevado, ya que este tipo de radiación es de muy alta energía. Sin embargo, en búsqueda de reducir costos, la investigación se encaminó hacia la obtención de catalizadores que se activen con menor energía, es decir, con radiación del espectro visible, lo cual implica el uso de lámparas menos costosas o la aplicación de luz solar; esto último disminuye los costos de operación haciendo el proceso más sustentable. En cuanto a la generación electroquímica del ión ferrato en el medio de reacción, uno de los primeros resultados obtenidos, alentadores, fue la aplicación de éste en la degradación de colorantes; sin embargo, era necesario caracterizar la formación del ión en el medio, y 119


para esto se llevó a cabo el estudio del mecanismo de la electrogeneración del ferrato en medio ácido a partir de una sal ferrosa en solución. ¿De qué manera beneficia a la sociedad este proyecto? En varios aspectos, uno de ellos, y quizá el más importante, es en la preparación de recursos humanos, como la formación de maestros y doctores en ciencias, quienes van a forjar la investigación del futuro. Por otra parte, cada vez son más variados los compuestos tóxicos que se encuentran en el agua, los métodos tradicionales que se aplican no son efectivos para la remoción de compuestos orgánicos re-


calcitrantes, es decir, aquéllos que son muy difíciles de destruir, de aquí que el beneficio a los diversos sectores de la sociedad sería la resolución de los problemas relacionados con la contaminación del agua. ¿Qué significa para ustedes este premio como reconocimiento a su trabajo? Es un aliciente para seguir trabajando y formando recursos humanos de muy buen nivel, nos motiva como grupo a redoblar esfuerzos, motiva a los estudiantes de nuestro posgrado y de nuestra Facultad a interesarse más por la investigación. Nuestra labor como investigadores a la par de la docencia de alguna manera se ve recompensada; sin embargo, esto



representa un reconocimiento no sólo a nuestro grupo de investigación, sino también a nuestra Facultad por el apoyo al trabajo en conjunto. ¿Cómo llega usted a ser investigadora en la Universidad Autónoma de Nuevo León? En mi caso, inicié mi carrera profesional en nuestra Universidad como profesora en la Facultad de Ciencias Químicas, adscrita a la carrera de QFB; sin embargo, ya como docente, la misma Universidad me dio la oportunidad de realizar los estudios de posgrado; primero la maestría en la que me inicié en la investigación y continuando el doctorado en ingeniería cerámica de nuestra propia Facultad; esto me permitió proseguir con la tarea de investigadora. Posteriormente, la dirección de tesis de licenciatura, de maestría y de doctorado en los programas de estudios de nuestra Facultad, me ha permitido seguir en este camino de combinar la docencia y la investigación, obteniendo resultados tan alentadores como éste.


¿Qué le ha dejado ser investigadora? Muchas satisfacciones, paso a paso, poco a poco, en cada uno de los estudiantes que formamos en una tesis de licenciatura, de maestría o de doctorado, vemos recompensados los esfuerzos realizados; el trabajo en la investigación es arduo y muy demandante, pero yo les digo a mis estudiantes: tarde o temprano se recogen los frutos, es cuestión de tener paciencia, la recompensa llega. ¿Qué sigue ahora? Continuar con el trabajo, seguir con la investigación de la generación de este tipo de especies, para que estos procesos deriven en tecnologías “verdes” con bajos consumos de energía que permitan descontaminar el agua eficientemente y a bajo costo, ya sea para su reutilización o para permitir su descarga cumpliendo con los requerimientos establecidos… todavía hay mucho trabajo por hacer.















Entrevista al Dr. Juan Antonio Aguilar Garib, Premio de Investigación UANL 2012, en el área de Ingeniería y Tecnología ESPERANZA ARMENDÁRIZ

El Dr. Juan Antonio Aguilar Garib encabezó un estudio para producir una cinta cerámica de menos de 3.5 micras de espesor mediante un método conocido como tape casting. Este valor se ha reportado como el límite práctico para este método, pero en este trabajo se diseñó una suspensión cuyas propiedades reológicas, en ciertas condiciones de vaciado, permiten la obtención de cintas de menor espesor. Numerosos reportes recomiendan que la suspensión tenga baja viscosidad, sin considerar que también existe una contribución elástica, por lo que el comportamiento de las suspensiones es viscoelástico. El científico nacido en Matamoros, Tamaulipas, adscrito a la Facultad de Ingeniería Mecánica y Eléctrica desde 1991, ha recibido el Premio de Investigación UANL en cuatro ocasiones, lo que confirma su constancia en la generación de conocimiento nuevo en las áreas de ingeniería y tecnología. ¿Cuál era el objetivo de esta investigación? La idea es producir capas cerámicas para capacitores multicapas lo más delgado posible mediante tape casting, pero este método tiene un límite práctico, en la industria, de 3.5 micras, por lo que el objetivo es encontrar las condiciones con las que se podría 122

utilizar este mismo método para fabricar algo más delgado. Dado el límite del tape casting, definimos como ultradelgada a la cinta con espesor menor de 3.5 micras y que se fabrique mediante este método. Para este trabajo se tomaron en cuenta las propiedades reológicas, considerando que la viscosidad tiene una componente viscosa, que señala cómo se deforma; y una componente elástica que corresponde a la tendencia del material para recuperar su forma. La mayoría de los trabajos tratan sólo la parte viscosa, y nosotros encontramos que la parte elástica es también relevante para la formulación de las suspensiones que hacen posible la producción de estas cintas, que hemos definido como ultradelgadas. ¿Cómo se traducen estos resultados en la industria? Primero te comento que este proyecto está dentro de un marco de colaboración: el Programa de Cooperación del Posgrado (PCP) entre México y Francia. Los resultados del PCP se traducen en innovación industrial, lo cual es uno de los propósitos de este programa. El PCP también provee el marco para realizar actividades de doble titulación; me enteré recientemente que la Universidad Autónoma de Nuevo León ha otorgado cuatro grados de doctor CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


de carácter internacional en esta modalidad. Personalmente he tenido el honor de dirigir, en cotutela, a dos de ellos. El PCP exige que la investigación involucre a científicos mexicanos y franceses que codirijan un trabajo, debe haber una institución educativa y una empresa de cada país, en este caso la UANL y la Universidad de Toulouse III Paul Sabatier de Francia; junto con Kemet de México y Marion Technologies. Uno de los impulsores de este proyecto fue el MC Leonel Montelongo, por cierto egresado del posgrado de FIME, por parte de Kemet, y el Dr. Joseph Sarrías en la contraparte en Francia, quienes fueron los copatrocinadores de esta investigación. Los resultados de este trabajo tienen trascendencia, pues se graduó un doctor que trabaja en Kemet de México en investigación y desarrollo. CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

¿Por qué hacer este estudio específico? ¿Había un interés concreto de la industria? Marion Technologies produce polvos y tenía interés en evaluar el potencial del polvo de titanato de bario que ellos producen, y Kemet hace capacitores que utilizan este material como dieléctrico; entonces, a la empresa mexicana le atrajeron las películas, y a la francesa los polvos. ¿Con este trabajo Kemet reduce costos, aumenta producción o cuál es el impacto que tiene? Cuando se habla de ciencia e ingeniería se trata de hacer algo que hasta el momento otros no pueden hacer, ahí está el secreto de la competitividad. Estamos haciendo algo que no se puede hacer de otra 123


manera; los otros métodos para crear películas delgadas son muy complicados, prácticamente de laboratorio, muy costosos. Hay maneras muy sofisticadas para elaborar películas delgadas que si se pueden evitar reducirán los costos, que es una pregunta que mucha gente hace, pero también aspiramos a fabricar otros productos de mayor valor agregado con un mayor margen.

¿Dirige a estudiantes de posgrado? Actualmente tengo dos estudiantes de doctorado y uno de maestría. ¿Cómo provocar en los alumnos la pasión por la ciencia?

He trabajado un buen tiempo en el área de cerámicos y una persona muy importante en esto, una clave, es el Dr. Edgar Reyes Melo, un experto en reología, quien fue esencial en este proyecto. Junto con la experiencia en cerámicos propia de la Dra. Sophie Guillemet-Fritsch, del Dr. Bernard Durand, hicimos una alianza en la que el Dr. Román Jabir Nava Quintero se graduó en cotutela.

En realidad, por naturaleza, todos somos investigadores. Un niño que explora, quiere ver qué hay del otro lado; no le parece importante si sirve o no, si da dinero o no, sólo quiere saber. Vamos creciendo y dependiendo de las sociedades, hay quienes están interesados en ¿para qué sirve?, y se llega a pensar que “si no sirve o no da dinero”, no interesa. El estudiante debe aprender a ser paciente, que los frutos no se dan de la noche a la mañana, ya verá que esta actividad también brinda satisfacciones y satisfactores.

¿Y las líneas de investigación, cómo han evolucionado en su carrera como científico?

¿Y cuál es la tarea de los investigadores ante este reto?

He trabajado en procesamiento de materiales y hace algunos años me incliné al procesamiento de cerámicos. Me interesan las propiedades funcionales, aquéllas que se refieren a lo que el material puede hacer, de los cerámicos, en contraste con las propiedades estructurales. Se inició la relación con Francia al trabajar con termistores, que también son cerámicos, procesados mediante microondas, por lo que cubrimos diferentes formas de procesamiento.

Podemos educar con el ejemplo, que nos vean investigando, haciendo, interesados, explorando. Un investigador hace lo que un niño: explora. La diferencia entre el niño y el investigador formado es que el segundo ha sido entrenado y puede aprovechar las experiencias de otros investigadores. El investigador explora con método –no necesariamente el método científico que se pregona, pero posee herramientas y medios para investigar–, y lo que hace al dirigir es en realidad dejar que lo vean, dejar que lo sigan, sería muy difícil hacerle al Quijote y obligar a que a todos les interese la investigación; pero el ejemplo, bueno o malo, arrastra, hay que ser de los buenos.

¿Esta línea de investigación ya la había trabajado?

¿Qué le atrajo de este material? Las propiedades que estoy llamando “funcionales”, me interesa qué pueden hacer los materiales.




La ventaja de los alumnos de posgrado es que desde que se inscriben como alumnos de tiempo completo, les interesa la ciencia, y ese interés lo adquieren al contacto con investigadores desde la licenciatura. ¿Cómo integrar la licenciatura con la investigación? La licenciatura es muy importante. Tenemos que estar presentes en la licenciatura para integrarla a la investigación, pero sin distraernos mucho, es decir, hay que escoger elementos clave en la licenciatura: si eres investigador, dar clases que están relacionadas con lo que haces y ver a los estudiantes en acción. Los mejores estudiantes que hemos tenido en el posgrado no siempre fueron los mejores alumnos en la licenciatura, pero sí los más dispuestos a trabajar. La idea de estar en la licenciatura es que en el salón se puede ver más que en el kárdex, porque conoces a los estudiantes, los ves todos los días, sabes si están interesados y luego ellos mismos se acercan para ayudar, es cuando haces permear el posgrado en la licenciatura; sin embargo, la vida de una facultad está en la licenciatura, es algo que no debe descuidarse. Actualmente imparto la clase de mecánica de fluidos en la licenciatura, una materia relacionada con fenómenos del transporte, y en el posgrado de materiales se trabajan muchas líneas en este tema. A los estudiantes no hay que tomarlos al último, porque ya tienen planes y hay mucha competencia de intereses, ya están formados. Con respecto a los estudiantes ¿por qué a unos les surge el interés por la ciencia y a otros no? Esto es algo que depende del ejemplo que demos como sociedad; en México, el científico no está re-


conocido como un médico o un abogado, y mucho menos como un artista o un futbolista. La ciencia no recibe muy buena promoción y, según me expresan algunos estudiantes, a los que les he hecho la misma pregunta, a quienes les surgió el interés lo tomaron de las pláticas a favor de la ciencia de sus profesores, no necesariamente investigadores; y a los que no es porque ya les llamó la atención otra cosa, o, según ellos, en general la perciben como de mucho trabajo y poco futuro, económico por supuesto. Lo bueno es que siempre hay a quien le guste esto. ¿Qué lo inspira? Pensar que todo, hasta lo que no lo necesita, tiene una explicación. Creo que es una tarea noble de gente noble. ¿Qué lo motiva cada día? En realidad, más que investigador, uno es profesor. No resistimos la tentación de enseñar y de genuinamente tratar de ser tutores, no asesores, porque queremos que te vaya bien en todo lo que haces. Esta vocación de profesor es la que alimenta la labor de investigación. La investigación no es monótona, a veces es solitaria, porque andas metido en cosas que ni entiendes, porque a veces no sabes ni cómo explicarlas. Tuve la fortuna de tener en la primaria muy buenos profesores, que era obvio que disfrutaban al enseñar. Otra cosa que me ayudó personalmente es que estudié en una ciudad pequeña, los grupos no eran numerosos y había mayor oportunidad de interactuar con los profesores. Pero lo más motivante es que haces lo que te gusta.
















Asume Jesús Ancer Rodríguez Rectoría de la UANL

En sesión solemne del H. Consejo Universitario, el doctor Jesús Ancer Rodríguez asumió el cargo de rector de la Universidad Autónoma de Nuevo León para el trienio 2012-2015. Acorde a lo establecido por la Ley Orgánica y el Estatuto General de la UANL, el presidente de la Junta de Gobierno de la Máxima Casa de Estudios, Juan Francisco Garza Tamez, realizó la toma de protesta al funcionario reelecto, teniendo como testigo de calidad al gobernador Rodrigo Medina de la Cruz. El acto protocolario se llevó a cabo en el Teatro Universitario del Campus Mederos, después de que el doctor Jesús Ancer Rodríguez presentara su Tercer Informe Anual de Actividades, correspondiente al periodo 2011-2012. Antes del juramento de ley, el ingeniero Juan Francisco Garza Tamez resaltó que la decisión de los


integrantes de la Junta de Gobierno fue unánime al ratificar al doctor Ancer Rodríguez al frente de la Universidad Autónoma de Nuevo León. Garza Tamez destacó los proyectos establecidos por Ancer Rodríguez en el plan de trabajo para el nuevo periodo, enfocándose en áreas estratégicas: educación de calidad, administración y gestión, vinculación e internacionalización, así como la investigación y desarrollo tecnológico. Agregó que este plan dará continuidad a diversas acciones que se traducirán en la consolidación de la calidad, pertinencia y cobertura educativa en todos sus niveles, que ha impulsado del rector de la UANL durante los tres años anteriores. Garza Tamez subrayó el incremento en la matrícula escolar de más 130 mil alumnos en el 2010, a más de 153 mil en el 2012: “un logro de gran excelencia es el incremento de becas otorgadas a alumnos por limitaciones económicas; la calidad de la educación se manifiesta en mantener el 100 por ciento de la matrícula de licenciatura en programas de calidad, el incremento sostenido en la incorporación de programas de posgrados al padrón nacional del Conacyt”. También destacó acciones concretas que han permitido avances significativos en la formación de profesores: incremento de investigadores adscritos al sistema nacional de del Conacyt, consolidación de los cuerpos académicos, al incrementarse la población CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012


científica, la presencia de la tecnología y el reconocimiento de los investigadores que han traspasado las fronteras del país. (Fuente: Prensa UANL)(Luis E. Gómez) Inicia consulta para definir agenda sobre ciencia y tecnología

En el Senado de la República, dio inicio la primera consulta nacional para definir una Agenda ciudadana de ciencia, tecnología e innovación con diez prioridades en materia de agua, cambio climático, educación, energía, investigación espacial, medio ambiente, migración, adicciones, salud pública y seguridad alimentaria. La consulta se realizará a nivel nacional vía Internet, y concluirá el 30 de enero del 2013. La población podrá conocer los retos propuestos y emitir su opinión en el portal: La iniciativa, impulsada por la Academia Mexicana de Ciencias, forma parte de la propuesta presentada a los tres poderes de la Unión por 62 instituciones de educación superior, encabezadas por el rector de la Universidad Nacional Autónoma de México, José Narro Robles. Durante el evento, que se llevó a cabo en el Auditorio “Octavio Paz”, el senador Alejandro Tello Cristerna, presidente de la Comisión de Ciencia y


Tecnología, resaltó que el conocimiento es una herramienta imprescindible en la toma de decisiones para enfrentar la desigualdad que “aqueja a todos los sectores de la sociedad”. Manifestó que la construcción de una sociedad del conocimiento democrático, equitativo y con desarrollo sostenible, requiere que la ciencia y la tecnología formen parte de la agenda nacional, y que sea tomada en cuenta la participación de la ciudadanía en el diseño de las políticas que fomenten esta importante área del desarrollo social. En tanto, el senador Juan Carlos Romero Hicks, titular de la Comisión de Educación, expresó que las instituciones tienen que responder con soluciones a las demandas de la población en sus servicios básicos. (Fuente: El Occidental)(Luis E. Gómez) Rinde rector de la UANL Tercer Informe de Actividades El rector de la UANL, Jesús Ancer Rodríguez, presentó su Tercer Informe de Actividades, correspondiente al ejercicio 2011-2012, en acto que encabezó el gobernador Rodrigo Medina de la Cruz, en el Teatro Universitario. En este mismo evento, se realizó la toma de protesta del doctor Ancer Rodríguez para continuar al frente de la Máxima Casa de Estudios, para un periodo comprendido de 2012 al 2015. El ingeniero



Juan Francisco Garza Tamez, en calidad de presidente de la Junta de Gobierno, tomó la protesta de ley, ante el pleno del Consejo Universitario. Jesús Ancer Rodríguez expuso cada una de las estrategias que se han establecido durante su administración para alcanzar a plenitud la Visión 2020, puesta en marcha para posicionar a la UANL como una institución socialmente responsable y de clase mundial por su calidad, relevancia y contribuciones al desarrollo científico, tecnológico, la innovación, la construcción de escuelas de pensamiento y al desarrollo humano de la sociedad nuevoleonesa y del país. Explicó que, para lograrlo, se constituyó un Plan de Desarrollo Institucional en el que se consideran diez puntos específicos: acceso a la educación con calidad y equidad, fortalecimiento del modelo educativo, aumento en el número de cuerpos académicos, mantener la calidad en todos los niveles formativos, incrementar las acreditaciones internacionales, inscribir a las preparatorias en el Sistema Nacional de Bachillerato, fortalecer la vinculación, mejorar la situación laboral de su planta docente, formular planes de estudio pertinentes, y mejora de la educación continua. Ancer Rodríguez manifestó que los logros alcanzados en este primer periodo de su gestión han sido posibles gracias al trabajo colectivo, de la participación de toda la comunidad universitaria, de los diferentes sectores de la sociedad y de las autoridades a nivel estatal y federal. (Fuente: Prensa UANL)(Luis E. Gómez) Una investigación bien hecha produce riqueza La investigación bien hecha es aquélla que produce riqueza; la que no la produce no lo es, dijo categórico el científico español Mateo Valero Cortés, líder mundial en computación de alto rendimiento, du128

rante la ceremonia en la que ingresó como miembro correspondiente a la Academia Mexicana de Ciencias (AMC), en una ceremonia realizada ayer en el Centro de Investigación y de Estudios Avanzados (Cinvestav). “El objetivo de la investigación es el conocimiento, y éste debe orientarse si es posible a producir riqueza. Investigar es usar dinero para producir ideas, luego la transferencia a tecnología es usar esas ideas para producir más dinero del que se ha invertido en la investigación. Los países más ricos hoy son los que más invierten en investigación, y eso lo sabemos desde hace años”. Sobre su ingreso a la AMC, el experto en arquitectura de supercomputadoras comentó que es importante por dos aspectos: “Primero, porque la comunidad científica mexicana reconoce el trabajo de investigación que hemos hecho entre muchos, y a nivel personal es que viene de mi querido México. Yo me considero mexicano, he venido 60 veces, tengo muchos amigos, he dado sinfín de conferencias, soy doctor Honoris Causa de la Veracruzana, profesor distinguido del Politécnico…qué más puedo decir”. (Fuente: AMC)(Luis E. Gómez) Dan a conocer la iniciativa de energía renovable Hacer frente a los fenómenos climáticos adversos asociados al calentamiento global y contribuir a la reducción de emisiones de CO2 a la atmósfera, es una tarea que demanda la unión de esfuerzos de numerosos científicos con miras a desarrollar procesos altamente sustentables que beneficien a largo plazo a la sociedad mexicana. Por ello, el Consejo Nacional de Ciencia y Tecnología presentó la iniciativa Fotosíntesis artificial,




Sin el mismo idioma digital Si bien en México hay más de 40 millones de internautas, los mexicanos no hablan el mismo idioma digital, ni a nivel empresarial, educativo o en los hogares, pues se dan interpretaciones diferentes a temas y conceptos incluso cotidianos. Para el experto en Internet, Sergio Gutiérrez Garay, los mexicanos tienen distintas interpretaciones para conceptos como redes sociales, Internet, computación en la nube, software, ACTA, entre otros más.

que responde a la necesidad de articular proyectos innovadores de largo alcance que ayuden a asegurar la sustentabilidad energética. Durante la presentación del proyecto, el Dr. Enrique Villa Rivera, director general del Conacyt, recordó que éste responde en parte a los señalamientos hechos en el Plan Nacional de Energía, establecido por la Secretaría de Energía, que sugiere la modificación, a 25 años, de los métodos para obtener energéticos, así como el desarrollo de nuevas fuentes de energía sustentable basadas en recursos renovables. Señaló que la inversión inicial será de 30 millones de pesos para apoyar la primera fase del proyecto en la que se profundizará la investigación en materiales nanoestructurados, materiales catalíticos y polímeros para mejorar la infraestructura experimental, pues el objetivo central es que nuestro país desarrolle tecnología propia que le permita crear dispositivos que lleven a cabo la fotosíntesis de manera artificial. El funcionario federal dijo que para este fin se estableció un consorcio multidisciplinario de investigadores mexicanos de alto nivel internacional de instituciones como el Instituto Politécnico Nacional (IPN), la Universidad Autónoma de Nuevo León (UANL), la Universidad Autónoma Metropolitana (UAM) y el Centro de Investigación de Materiales Avanzados (Cimav), centro de investigación del

Conacyt, cuyos objetivos se centrarán, durante un primer periodo de un año, en avanzar en el desarrollo de nanomateriales y aprovechar el enfoque multidisciplinario en materia de fotocatálisis y microscopía electrónica aplicados a este proyecto. Por su parte, la Dra. Leticia Torres Guerra, directora adjunta de Desarrollo Científico del Conacyt, destacó que el equipo de trabajo buscará desarrollar la tecnología necesaria para optimizar y economizar procesos de transformación de agua y dióxido de carbono en energéticos, como el metanol o el hidrógeno, éste último un combustible tres veces más potente que la propia gasolina o el diesel. (Fuente: Conacyt)(Luis E. Gómez)



Sin embargo, este fenómeno también tiene consecuencias delicadas, que van desde desacelerar el uso productivo de las tecnologías de la información y comunicación (TIC), hasta la dificultad para describir claramente el perfil de vacantes que requiere una empresa. Y es que, las compañías generalmente utilizan frases como: «orientado a la tecnología», «buen manejo de computadora», «80 por ciento de hojas de cálculo», «manejo de redes sociales», para describir las características o el perfil que necesitan para contratar algún experto en TIC. No hablar el mismo idioma digital también pone en ocasiones en franca desventaja al consumidor cuando adquiere algún tipo de tecnología. Asimismo, dificulta a las personas comprender el alcance real de sus conocimientos: qué sabe, cuánto sabe, para qué le sirve y económicamente cuánto vale lo que sabe. (Fuente: El Periódico de México)(Luis E. Gómez)

director general de Relaciones Internacionales de la Universidad de Medicina Tradicional China de Nanjing; el doctor Santos Guzmán López, director de la Facultad de Medicina y Hospital Universitario “José Eleuterio González”; el doctor Thomax Fox, presidente del Consejo Consultivo Internacional de la UANL, y el doctor Gerardo Muñoz Maldonado, subdirector de Posgrado de la Facultad de Medicina. La maestría en medicina tradicional china surge en la UANL luego de observar las necesidades de la población que busca medidas alternativas para su tratamiento y control; en esta alianza de instituciones académicas hay cooperación con el Instituto Politécnico Nacional (IPN,) a través de la Escuela Nacional de Medicina y Homeopatía. (Fuente: Prensa UANL)(Luis E. Gómez) Destinan sólo 0.43% del PIB a ciencia y tecnología en este sexenio

Impartirán maestría en medicina tradicional china


La Universidad Autónoma de Nuevo León ha puesto en marcha un nuevo programa académico de posgrado en la Facultad de Medicina, con siete alumnos inscritos: la maestría Integración de la medicina tradicional china con la medicina occidental, con especialidad en acupuntura y moxibustión, que se concreta en alianza con la Universidad de Medicina Tradicional China de Nanjing. Así, la máxima casa de estudios de Nuevo León se constituye como la primera institución de educación superior en México que ofrece una maestría profesionalizante en medicina alternativa, programa que se imparte en las mejores universidades del mundo y que ahora ve nuevos horizontes en la región norte del país. La ceremonia de apertura fue encabezada por el rector Jesús Ancer Rodríguez; el doctor Dai Shen,

En los últimos seis años, la inversión en ciencia y tecnología registró un promedio de apenas 0.43 por ciento anual como proporción del producto interno bruto (PIB), según revelan los anexos del Sexto In-



forme de Gobierno del presidente Felipe Calderón. Esta cifra se ubica muy por debajo del mínimo internacional recomendado que debería ser de al menos uno por ciento, y muy lejos de lo que destinan otros países integrantes de la Organización para la Cooperación y el Desarrollo Económicos (OCDE), como Estados Unidos, Canadá, Alemania, España, Japón, Italia, Reino Unido y Francia. Bernardo Olmedo Carranza, investigador del Instituto de Investigaciones Económicas (IIE) de la UNAM, aseguró que la inversión destinada por México a ciencia y tecnología en los pasados 30 años es prácticamente inexistente. «Lo que antes era una brecha ahora es un abismo», y hoy no es suficiente aumentar el gasto en ciencia y tecnología al uno por ciento, sino mucho más arriba. Recordó que Corea del Sur se dio a la tarea de incrementar este 2012 la inversión en ciencia y tecnología a una proporción de 5 por ciento del PIB, después de que lograron llegar el año pasado a 4 por ciento del PIB. Los informes oficiales detallan que la inversión interna en investigación científica y desarrollo experimental en México fue en 2006 de apenas 0.38 por ciento del PIB; en 2007, 0.37; en 2008, 0.41; en 2009, 0.44; en 2010, 0.48, y en 2011, 0.46 por ciento. Lo anterior contrasta con lo destinado en este mismo rubro durante el último año por Estados Unidos, que alcanzó 2.90 por ciento del PIB; Canadá, 1.74; Alemania, 2.82; España, 1.39; Japón, 3.26; Italia, 1.26 y Francia, 2.25 por ciento del PIB. Esta ínfima inversión en ciencia y tecnología propició que el número de investigadores en México en 2010, último año registrado en los anexos del Sexto Informe de gobierno, sea de 11 por cada 10 mil integrantes de la fuerza de trabajo, cuando en Estados Unidos esta proporción es de 95; en Canadá, 86; en Alemania, 81; en España, 72; en Japón, 104; en Italia, 43; en Reino Unido, 76 y en Francia, 91 investi-


gadores pro cada 10 mil trabajadores. (Fuente: El Universal)(Luis E. Gómez) Exigen presupuestos acordes con la necesidad del país La comunidad científica y tecnológica de México entregó al Poder Judicial Federal la denominada “Agenda Nacional en Ciencia, Tecnología e Innovación”, que en lo fundamental propone invertir uno por ciento del producto interno bruto (PIB) del país en esos rubros durante la próxima administración federal. Durante el acto, efectuado en las instalaciones de la Suprema Corte de Justicia de la Nación (SCJN), ante la presencia del presidente del máximo tribunal, ministro Juan Silva Meza, el rector de la Universidad Nacional Autónoma de México, José Narro Robles, destacó que México tiene una deuda histórica con la pobreza y la desigualdad, y que sólo con mayor inversión en educación, ciencia y tecnología se saldará esa deuda. En su turno, el ministro Silva Meza, quien habló en representación del Poder Judicial Federal, sostuvo que la cúpula judicial y la comunidad jurídica «haremos de la ciencia una prioridad de Estado, para exigir la asignación de presupuestos acordes con las necesidades del país en el siglo XXI». El también presidente del Consejo de la Judicatura Federal refirió que una justicia de vanguardia, preocupada por el respeto de los derechos humanos, no puede tener cabida en un espacio ajeno a los avances de la ciencia: «por eso celebramos que las instituciones científicas del país hayan pensado en el Poder Judicial de la Federación para compartir las propuestas planteadas por los especialistas de la ciencia y la tecnología (al nuevo gobierno federal que está por comenzar en diciembre próximo)». (Fuente: La Jornada)(Luis E. Gómez) 131


“Estamos con ustedes”

Es momento de atender mercados emergentes de robótica

México está en el momento óptimo para participar en los mercados emergentes que se abrirán durante los próximos diez años en el área de robótica móvil, aseguró el investigador de la Universidad La Salle, Luis Lupián Sánchez. Al dar a conocer los detalles de Robo Show México 2012, dijo que el país tiene muchas oportunidades que aprovechar en materia tecnológica. Una de ellas, expuso, es el uso personal de robots, área que crecerá durante los próximos diez años y será tan «común como tener una computadora en casa». A su vez, el titular de la Dirección de Tecnologías Urbanas y Sociales del Instituto de Ciencia y Tecnología del Distrito Federal (ICyTDF), Rodrigo Montufar Chávez Nava, consideró que exposiciones de este tipo promueven el interés en los jóvenes por las tecnologías de la información y la comunicación (TIC). Aseguró que ello permitirá en el futuro tener «una gran cantidad de jóvenes que, mediante el desarrollo tecnológico, puedan brindar soluciones a problemas y generen recursos económicos para el país», tanto en mercados conocidos como emergentes. (Fuente: Notimex)(Luis E. Gómez)


La comunidad científica tendrá más de su lado a partir de la elaboración y presentación que hizo de una propuesta en ciencia, tecnología e innovación, que si no se hubiera expresado sobre cómo ayudar al país a alcanzar un desarrollo económico sostenible, consideró la coordinadora del Foro Consultivo Científico y Tecnológico (FCCT), Gabriela Dutrénit Bielous. La integrante de la Academia Mexicana de Ciencias señaló que la entrega que se realizó en días pasados a los principales tomadores de decisión en el país del documento “Hacia una agenda nacional en ciencia, tecnología e innovación”, elaborado por un extenso grupo de instituciones académicas, científicas y empresariales, es un acto simbólico importante. De la Agenda, apuntó que fue una actividad central, porque se puso de acuerdo un número significativo de instituciones y organizaciones. La investigadora de la Universidad Autónoma Metropolitana dijo que el mensaje en todos los discursos en los diferentes actos de entrega-recepción del documento –las Cámaras de Senadores y Diputados, la Conago, la Suprema Corte de Justicia de la Nación y el presidente electo Enrique Peña Nieto– fue: “Estamos con ustedes”. Pero subrayó que espera que esta palabra se cumpla y se concrete en los hechos. (Fuente: AMC)(Luis E. Gómez) El proceso artificial de la fotosíntesis El estudio de los procesos fotosintéticos a nivel internacional ha merecido diez premios Nobel, desde 1917. En la década de los sesenta, se descubrió el fenómeno fotocatalítico de la descomposición del



agua, lo que sentó un precedente para fortalecer los estudios que adelantaron que la fotosíntesis artificial era posible. Dentro de su esquema, el proceso artificial de la fotosíntesis se suma al conocimiento que se tiene de los procesos fisiológicos de las plantas, las capacidades de observar y manipular la estructura de los nanomateriales para elaborar dispositivos que repliquen la fotosíntesis. En México, la comunidad académica respondió a la necesidad de innovar en este proceso, considerado, a nivel internacional, como la oferta tecnológica más avanzada para obtener energéticos renovables de alta potencia mediante el aprovechamiento de la luz solar, el agua y la absorción del CO2 ambiental. Por ello, el Conacyt presentó el proyecto Fotosíntesis artificial, primero en su tipo, que agrupa a investigadores nacionales especializados en fotocatálisis, electroquímica, microscopía electrónica, el desarrollo de nanomateriales, entre otras disciplinas, para que desarrollen en el mediano plazo la tecnología propia, que permita a nuestro país crear sus propios dispositivos que utilicen la luz solar para realizar la fotosíntesis artificial. A decir del Dr. Ricardo Gómez, investigador de la UAM Iztapalapa, y uno de los seis coordinadores académicos de este esquema: “ésta sería la primera vez que México estuviera en una búsqueda de este tipo, pues se parte de la ciencia básica para obtener estos resultados (…) y no podemos esperar diez años para que nos digan que ya se puede hacer”. El académico destacó que desde hace cinco años su grupo de trabajo, en conjunto con la Universidad Autónoma de Nuevo León (UANL), comenzó a ocuCIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

parse sobre la producción de hidrógeno a partir de la luz solar, influenciados por los trabajos de producción directa de hidrógeno mediante catalizadores que se realizan en Japón. En esa misma línea, el coordinador de la UANL, Dr. Isaías Juárez, explicó que su grupo analiza la obtención de hidrógeno a través de la fotocatálisis, donde han acumulado experiencia en la observación de nanoestructuras, pues “esos semiconductores son susceptibles de mejora para agilizar el proceso”. (Fuente: Conacyt)(Luis E. Gómez) Sería algo histórico: Asomoza Para René Asomoza Palacio, director del Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional, la propuesta titulada “Hacia una agenda nacional en ciencia, tecnología e innovación”, es fundamental, porque es un planteamiento único, elaborado por un gran número de instituciones que han logrado ponerse de acuerdo. “Si esto da lugar a una política de Estado en ciencia y tecnología, creo que sería histórico”, dijo al abandonar el Palacio Legislativo, donde la propuesta fue entregada a la Cámara de Diputados. Sobre la importancia de recepción del documento por parte de los legisladores, Asomoza Palacio, miembro de la Academia Mexicana de Ciencias, dijo que se trata de algo sumamente importante: “porque finalmente estamos hablando de modificar la ley en ciertos rubros, de modificar los reglamentos, y los diputados son los que tienen a cargo esa tarea. Pero, además, la actitud con la que lo han recibido no sólo los diputados, sino otras instancias ha sido excelente, yo creo que ese es un gran avance. Todos 133


Sí hay recursos El rector de la UNAM, José Narro Robles, destacó que con un presupuesto con el tamaño del que tiene el país es indiscutible que hay formas para encontrar que se incremente cada año una décima de punto del Producto Interno Bruto (PIB) a la ciencia, la tecnología y la innovación; señaló, además, que de esa manera el próximo sexenio terminaría en 2018 con al menos uno por ciento del PIB destinado a esos rubros. Agradeció el compromiso del senador Emilio Gamboa Patrón, presidente de la Junta de Coordinación Política del Senado, de subir un punto de acuerdo que se haga llegar a la colegisladora, la Cámara de Diputados, en favor de que México tenga un presupuesto más robusto, mejor para la ciencia, la tecnología y la innovación. Sobre la posibilidad de la creación de una Secretaría de Ciencia y Tecnología, consideró que «nuestra perspectiva es útil, pero al mismo tiempo hemos dejado muy claramente sentado en el documento que es factible encontrar, con la estructura que tenemos, la posibilidad de caminar en el sentido correcto. ¿De qué depende entonces? Depende del titular del Ejecutivo. Le hemos presentado al presidente electo de México en el mes de septiembre el documento y le 134

hemos hecho el planteamiento», expuso. El titular del Ejecutivo tendrá que tomar algunas determinaciones, y ahí está esa posibilidad de crear la Secretaría de ciencia, de crear la Agencia nacional de innovación, y de hacer una serie de ajustes en la estructura de gobierno en lo que se refiere a ciencia. (Fuente: Notimex)(Luis E. Gómez) Se reúnen científicos con Peña Nieto La reunión de la comunidad científica del país con el presidente electo, Enrique Peña Nieto, fue productiva y se dio en un ambiente de confianza, pero para que efectivamente se traduzca en mejores condiciones para el sector, debe haber voluntad para que su presupuesto aumente hasta llegar a uno por ciento del producto interno bruto (PIB) a finales del sexenio que está por iniciar, señaló el presidente de la Academia Mexicana de Ciencias, José Franco. Sin embargo, más allá del número, lo primordial es que las organizaciones involucradas lograron formular un documento consensuado y se lo entregaron a Peña Nieto, quien en principio manifestó buena voluntad para incorporarlo en su programa de gobierno, dijo el astrónomo. Durante el encuentro titulado “Hacia una agenda nacional en ciencia, tecnología e innovación”, el exgobernador del Estado de México aseguró que es-

los organismos que lo han recibido se han mostrado favorables y eso es algo que hay que resaltar”. En relación a la propuesta de crear una nueva Secretaría de Estado, el doctor señaló: “Para mí eso es un instrumento. Primero necesitamos tener un plan, necesitamos proyectos importantes que resuelvan problemas y una secretaría es un ente que nos puede ayudar a llevarlo a cabo, no es un fin en sí, más bien es un mecanismo para poder llevar a cabo un proyecto más ambicioso. (Fuente: AMC)(Luis E. Gómez)



El cambio de gobierno permitirá replantear agenda nacional Al dar un espaldarazo a la propuesta sobre ciencia, tecnología e innovación impulsada bajo el liderazgo de la UNAM, el presidente de la Conferencia Nacional de Gobernadores (Conago), César Duarte, consideró que a partir del primero de diciembre no habrá un cambio de gobierno, sino un “cambio de régimen” que permitirá replantear la agenda nacional –incluida la de este rubro– y “romper” la dinámica que nos ha llevado “a un desgaste social y a un sufrimiento colectivo impensable”. Ante representantes de dicha agrupación, así como académicos y funcionarios universitarios, el rector de la UNAM, José Narro Robles, reiteró que es imperativo incrementar anualmente una décima de punto porcentual del Producto Interno Bruto (PIB), para que en 2018 se destine uno por ciento de inversión al sector, tal como establece la ley desde hace más de ocho años. La próxima década de nuestro país debe ser la del conocimiento, insistió. En la entrega a la Conago del documento “Hacia una agenda nacional en ciencia, tecnología e innovación”, realizada en la torre de Rectoría, los académicos participantes subrayaron la responsabilidad del gobierno federal en el financiamiento de este sector. Tan sólo para llegar a la meta de uno por ciento al finalizar el próximo sexenio, se requiere pasar de un monto actual de 61 mil millones de pesos a más de 150 mil millones de pesos, puntualizó el abogado general, Luis Raúl González Pérez. (Fuente: La Jornada)(Luis E. Gómez)


México, con bajo desempeño en innovación México ocupa el lugar 79 de 141 países clasificados en el Ranking Global de Innovación 2012, por su «capacidad de innovación o habilidad para inventar nuevos productos». Esto lo coloca por debajo de Chile, Brasil, Colombia, Uruguay, Argentina, Perú y Guyana. El ranking fue elaborado por la Organización Mundial de la Propiedad Intelectual de la ONU y el Institut Européen d’Administration des Affaires (Insead), con sede en Francia, y considera en la medición elementos como nuevas patentes, inversión en investigación y desarrollo y el clima empresarial y regulatorio. En un comunicado, la Academia Mexicana de Ciencias explicó que dicha clasificación es para los 141 países evaluados en tres categorías. La primera agrupa a los «líderes»; la segunda, a los que «aprenden» o «están aprendiendo», y finalmente, la tercera categoría incluye a los de «bajo desempeño», en la cual se ubica México. Según el ranking, el número uno es Suiza, seguido de Suecia, Singapur, Finlandia, Inglaterra, Holanda, Dinamarca, Hong Kong, Irlanda y Estados Unidos, países que conforman los diez líderes mundiales en el campo de la innovación. Por América Latina, sólo Chile figura entre los 50 líderes en dicho campo, ocupando el lugar número 39. Le siguen Brasil (59), Colombia (65), Uruguay (67), Argentina (70), Perú (75), Guyana (77), México (79), Paraguay (84), Panamá (87), El Salvador (93), Ecuador (98), Guatemala (99), Nicaragua (105), Honduras (111), Bolivia (114) y Venezuela (118). (Fuente: El Periódico de México)(Luis E. Gómez) 135

tos rubros serían utilizados por su gobierno como una “palanca” para redireccionar el rumbo del país hacia esquemas más competitivos, lo cual “implica que entendió la propuesta”, añadió Franco. (Fuente: Notimex)(Luis E. Gómez)


El crecimiento económico del país es posible, si se invierte en tecnología


Las sociedades deben tomar la decisión final

El titular del Instituto de Ciencia y Tecnología del Distrito Federal (ICyTDF), Julio Mendoza, llamó a los sectores público y privado a invertir en ciencia y tecnología, pues es la única forma de levantar la economía y transformar a México en una nación de vanguardia, para que deje de ser solamente un Estado maquilador. Opinó que para la siguiente administración federal debe ser una prioridad el financiamiento de productos y diseños mexicanos de valor agregado que se exporten al extranjero, pues el país presenta un rezago muy importante en comparación con el resto de miembros de la Organización para la Cooperación y el Desarrollo Económicos (OCDE). El funcionario capitalino destacó que México se encuentra actualmente en el lugar 79 de 142 países en el Ranking Global de Innovación 2012, por debajo incluso de Chile (39) o Colombia (65). Esta situación se debe a que México sólo cuenta con 40 mil investigadores, y destina únicamente 0.4 por ciento de su Producto Interno Bruto (PIB) a la investigación. Por su parte, el director de la Academia Mexicana de la Ciencia (AMC), José Franco López, llamó al equipo de transición del presidente electo Enrique Peña Nieto, para que consulte a las instituciones científicas del país en el marco de la elaboración de una política pública en la materia, de largo plazo. Durante la Semana de la Ciencia y la Innovación

2012, la AMC presentó el proyecto Agenda Ciudadana, que promueve la participación de los ciudadanos en el siguiente presupuesto científico e incidir en la clase política para que reflexione sobre la importancia de este sector, del cual depende el crecimiento del país. (Fuente: Notimex)(Luis E. Gómez)

Ante el reto de generar nuevos conocimientos científicos y avances tecnológicos, México tiene una oportunidad extraordinaria para invertir en este sector, porque «nada mejor que un nuevo gobierno para fortalecer este compromiso», afirmó Carlos López Otín, científico español galardonado con el Premio México de Ciencia y Tecnología 2011. En conferencia de prensa, donde dio a conocer la jornada de conferencias que dictará en varias universidades del país, destacó que en un contexto mundial de crisis la principal amenaza es que se pierda el «hilo conductor» de una generación de científicos con sus estudiantes, ante la falta de oportunidades para incorporarse a la investigación de alto nivel y «que todo el esfuerzo hecho durante años esté en riesgo de desaparecer». El experto destacó que los grandes retos científicos que enfrenta la humanidad es una tarea en la que «no hay atajos, y cada vez está más cerca lo imposible del mundo de lo posible, como el acceso a una medicina personalizada». Sin embargo, enfatizó que este conocimiento en campos como la genómica, genética y biología también demandarán a las sociedades futuras la toma de decisiones. Se trata, insistió, de temas en los que «todos debemos aportar, y tener opiniones muy bien argumentadas, porque las definiciones finales no son cuestión de los científicos, sino de la sociedad. Los especialistas pueden dirigir la conversación, pero la sociedad debe tomar la decisión». (Fuente: Notimex)(Luis E. Gómez)



mos avanzar, consideró el biólogo. (Fuente: El Universal)(Luis E. Gómez)

José Sarukhán Kermez, exrector de la UNAM, afirmó que una secretaría de ciencia, tecnología e innovación no resolvería nada, si no incorpora también la educación superior. La tradición en México indica que lo único que ocurre es que se burocratiza todo. Si va a haber algo nuevo en ese sentido, debería ser una secretaría que una a la educación superior con la investigación, indicó el miembro titular y también expresidente de la AMC. Sarukhán Kermez añadió que la existencia de dicha secretaría sin una percepción del Estado de que la función de la investigación no sólo es ciencia, y verla en su sentido más amplio es un aspecto central para tener herramientas que puedan cambiar al país. Con respecto al documento “Hacia una agenda nacional en ciencia, tecnología e innovación”, que José Narro, actual rector de la UNAM, presentó a los representantes de los tres poderes de la Unión, Sarukhán Kermez consideró que contiene planteamientos que se han expuesto por décadas, aunque también hay algunas propuestas nuevas. En la medida en que la sociedad y los gobiernos no entiendan que la forma de cambiar al país es con la generación de inteligencia, con conocimientos para entender los problemas y resolverlos, poco podre-

Hay que construir un mundo mucho mejor y más justo

Secretaría de Ciencia debe unir educación superior e investigación


El Consejo Nacional de Ciencia y Tecnología (Conacyt) fue la sede para una conferencia de prensa que ofreció el científico español Carlos López Otín, experto en bioquímica y biología molecular, ganador del Premio México de Ciencia y Tecnología 2011, quien, como parte de su visita académica a México, compartió sus contribuciones en el estudio del cáncer y envejecimiento prematuro. Al dar la bienvenida, en representación del titular del Conacyt, la Dra. Leticia Torres Guerra, directora adjunta de Desarrollo Científico, enfatizó que invertir en ciencia no debe considerarse un gasto, sino una inversión, y expresó su beneplácito por tener en nuestro país al Dr. López Otín, quien se ha convertido en “referente fundamental” para el estudio del cáncer, “cuyo enfoque innovador lo ubica en la frontera del conocimiento”. Por su parte, el Dr. Jorge Flores, coordinador general del Consejo Consultivo de Ciencias, en su calidad de vicepresidente del Consejo de Premiación del Premio México, agradeció la visita del científico a nuestro país, ofreció una semblanza del mismo y detalló el programa de conferencias que brindará en diversas instituciones de educación superior nacionales. El Dr. López Otín mencionó que en esta visita académica espera encontrar curiosidad, afán de conocimiento, ganas de aprender “y aprender yo mismo”, toda vez que el discurso académico y el discurso científico nunca fluyen en una misma dirección, 137


por lo que se enriquecen mutuamente desde múltiples perspectivas. Las contribuciones científicas, añadió, conducirán a que todos podamos construir un mundo mucho mejor y más justo. (Fuente: Conacyt)(Luis E. Gómez) Realizan primer seminario para publicar en redes de información científica Con el propósito de facilitar el acceso a la información científica a las universidades y centros de investigación del país y posicionar a las revistas científicas mexicanas en el plano internacional, se inauguró el primer seminario para publicar y navegar en las redes de información científica, denominado “Entre Pares”. Este seminario fue el resultado de la labor continua del Consorcio Nacional de Recursos de Información Científica y Tecnológica (Conricyt), que, en su estrategia de incrementar la producción de publicaciones científicas nacionales y difundirlas a nivel mundial, estableció un espacio de encuentro entre las principales editoriales científicas internacionales y la comunidad científica nacional, en el Centro Cultural Universitario de la UNAM, en Tlatelolco. Durante el Seminario, el doctor Marco Antonio Meraz Ríos, secretario de Planeación del Centro de

Investigación y Estudios Avanzados del Instituto Politécnico Nacional (Cinvestav), mencionó que “Entre Pares” es la consecuencia de una labor continua por parte del Conricyt, que, en su estrategia de incrementar la producción y actividad científica de la comunidad académica nacional y promover su difusión a nivel internacional, plantea un espacio de encuentro con las principales editoriales científicas internacionales. Señaló que entre las metas más importantes del seminario destacan: difundir el programa del Conricyt, como una iniciativa interinstitucional que a dos años de su creación está impactando positivamente en la comunidad académica de nuestro país, al incrementar sustancialmente el acceso a la información científica a las universidades y centros de investigación, con el fin de coadyuvar en la productividad científica de nuestra comunidad. Impulsar que las revistas científicas mexicanas de alta calidad incrementen su visibilidad a nivel internacional y que los jóvenes investigadores tengan acceso al acervo bibliográfico que les permita mejorar su competitividad, en un espacio que promueva su talento y habilidad científica. (Fuente: Conacyt)(Luis E. Gómez) Centros educativos y científicos darán diagnóstico del sector En los próximas meses, representantes de instituciones de educación superior y centros científicos entregarán al presidente electo, Enrique Peña Nieto, al Congreso de la Unión y a los gobiernos y legislativos locales, el documento Agenda nacional para la ciencia, la tecnología y la innovación, donde se establece el diagnóstico sobre el estado actual del sector y las estrategias necesarias para convertirlo por fin en palanca real del desarrollo nacional. Frente al deterioro y abandono presupuestal de los dos últimos sexenios hacia la ciencia, la tecnolo-




gía y la innovación mexicanas, a iniciativa del rector de la Universidad Nacional Autónoma de México (UNAM), José Narro Robles, unas 80 instituciones académicas y científicas de los sectores público y privado aportaron elementos constitutivos a esa agenda, la cual representa el primer gran diagnóstico del rubro en el país. El documento fue elaborado y suscrito con las aportaciones de, entre otros, la propia UNAM, el Instituto Politécnico Nacional, la Universidad Autónoma Metropolitana; de claustros científicos, como el Consejo Consultivo de la Ciencia, las academias Mexicana de Ciencias, de Ingeniería y de Medicina y el Foro Consultivo Científico y Tecnológico; el Consejo Nacional de Ciencia y Tecnología y la Asociación Nacional de Universidades e Instituciones de Educación Superior (Anuies). Está avalado también por organismos del sector privado, como la Asociación Mexicana de Directivos de la Investigación Aplicada y el Desarrollo Tecnológico, la Confederación Patronal de la República Mexicana, la Confederación Nacional de Cámaras Industriales y la Cámara Nacional de la Industria de la Transformación (Canacintra), entre otras. Del mismo modo y a título individual, entre los signantes, figuran científicos y tecnólogos merecedores de distinciones tanto nacionales como internacionales CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

La ciencia requiere más estudiantes y un cambio de actitud Pablo Rudomín, expresidente de la AMC, consideró que la importancia del documento “Hacia una agenda en ciencia, tecnología e innovación”, radica en que ayudó a los miembros de la comunidad científica a tener una idea más objetiva de los problemas que vive el país. También opinó que la inversión en estos sectores debe ser gradual hasta llegar al uno por ciento del producto interno bruto (PIB), e ir acompañada de cambios estructurales para que los recursos ser utilicen de manera eficiente. El documento contiene unas propuestas más realistas que otras, y nuestras necesidades como país son inmensas. Creo que no debemos ver lo que se dice, sino lo que se puede hacer. En opinión del neurofisiólogo, preparar más científicos no se logra de un día para otro, pues antes se necesita tener estudiantes y un cambio de actitud hacia la ciencia y la

por sus aportaciones en los diferentes campos de su especialidad. El documento es el resultado de varias reuniones de trabajo entre integrantes de las instituciones, agrupaciones e instancias firmantes, que se desarrollan desde hace al menos un año. (Fuente: El Periódico de México)(Luis E. Gómez)



tecnología. Se requiere de un esfuerzo concertado. No basta decir: “ya llegó la varita mágica y ahora vamos a tener ciencia de primer mundo”. Tenemos muy buenos científicos de forma individual, pero como comunidad todavía tenemos mucho por hacer. Sobre la creación de una secretaría de ciencia y tecnología, menciona que algunos piensan que es lo más positivo, pero otros consideran que hay países – como Estados Unidos– que funcionan sin esa modalidad. En ellos cada agencia tiene sus propios programas, y esta opción puede ser otra salida. Como siempre, el Poder Ejecutivo tiene la responsabilidad de decidir; ciertamente, lo acertado de sus decisiones dependerá mucho de la gente de la que se rodeé. (Fuente: La Jornada)(Luis E. Gómez) López Otín en la UANL En relación al cáncer, en un futuro próximo una de cada tres personas padecerá una enfermedad oncológica, cifra que lejos de ser alarmante, es el reflejo de la vida actual: la esperanza de vida es mayor y las estrategias de diagnóstico permiten detectar más oportunamente los tumores. “Y antes estas estadísticas, el compromiso está en redoblar esfuerzos en investigación, porque en este

momento el cáncer acaba de superar la primera causa de muerte, las enfermedades cardiovasculares, eso indica que hay que ponerse a trabajar para que la atención oncológica sea capaz de encontrar respuesta para aquellos tumores que hoy por hoy no se pueden curar todavía, o al menos convertirlos en una situación crónica con la se pueda vivir el mayor tiempo posible”, expresó el Dr. Carlos López Otín. El ganador del Premio México de Ciencia y Tecnología 2011 dictó la conferencia “El paisaje genómico del cáncer y del envejecimiento”, en el Centro de Investigación y Desarrollo en Ciencias de la Salud (CIDCS), en el inicio de una serie de visitas por instituciones de educación superior en México. López Otín agregó que los esfuerzos de la medicina han sido tan significativos, que actualmente el 50 por ciento de los tumores malignos se curan. Advirtió que ahora la investigación es universal y la comunidad científica se une en proyectos específicos. Precisó que los proyectos genoma del cáncer son ahora la gran iniciativa mundial para conocer la biografía de los tumores malignos, y que se van a requerir unos cinco o seis años de acumulación de datos para poder dar el siguiente paso, que es identificar los genes más frecuentemente mutados en cada tipo de tumor. (Esperanza Armendáriz) Realizan Cuarta Jornada Nacional de Innovación y Competitividad Al inaugurar la Cuarta Jornada Nacional de Innovación y Competitividad, el Dr. Enrique Villa Rivera, director general del Conacyt, aseguró que las capacidades científicas y tecnológicas de un estado deben servir para favorecer el desarrollo económico de una región, pues en la medida en que se invierta en ellas se logrará consolidar el esquema de atracción de inversiones que apoyen las iniciativas de innova-




ción que requiere el país. Acompañado del gobernador del estado de Puebla, Rafael Moreno Valle, así como por funcionarios de la entidad y de invitados internacionales expertos en el tema de la innovación, el titular del Conacyt expresó que esperan obtener elementos decisivos que ayuden a que la ciencia, la tecnología y la innovación impacten favorablemente el crecimiento económico del país. Recordó que la OCDE establece a la innovación como un elemento central para el desarrollo de las naciones, por lo que en México es necesario impulsar el crecimiento de las empresas para que puedan competir con las industrias transnacionales, y contribuyan a que el país crezca a tasas mayores del tres por ciento anual.


Villa Rivera explicó que en años recientes la redistribución de recursos públicos ha sido favorable, por lo que en la presente administración federal el presupuesto del Conacyt se duplicó, lo que ha permitido avanzar en la formación de capital humano de calidad, pues en este año se han registrado 47 mil becarios, formados en México y el extranjero. De ellos, 17 mil cursan actualmente estudios de doctorado. La Cuarta Jornada Nacional de Innovación y Competitividad dio inicio formal con la conferencia magistral del investigador español Carlos López Otín, La vida desde la ciencia: Mirando al futuro, en la que se pronunció por “sembrar semillas de ciencia”, pues a la postre la imaginación de un científico y la fuerza de la innovación y la tecnología –que favorecen a los más preparados—hacen que seamos capaces de mejorar como sociedad. (Fuente: Conacyt)(Luis E. Gómez)
















Juan Antonio Aguilar Garib Ingeniero mecánico y maestro en metalurgia por el Instituto Tecnológico de Saltillo. Doctorado en ingeniería de materiales por la UANL. Premio de Investigación UANL, en 1991, 2001, 2003 y 2012. Premio TECNOS, en 2000. Profesor-investigador de la FIME y el CIIDIT de la UANL. Miembro del SNI, nivel I, y de la AMC. Esperanza Armendáriz Licenciada en ciencias de la comunicación, con especialidad en periodismo por la UANL. Publica en la página de la UANL y en los periódicos El Porvenir y Vida Universitaria. Colabora en secciones de cultura y tendencias en Milenio del Diario de Monterrey, del Grupo Multimedios Estrellas de Oro. Jessica Balderas Salazar Licenciada en ciencias de la comunicación, con especialidad en periodismo por la UANL. Ha colaborado en publicaciones como el periódico Alas, de la región citrícola, y Vida Universitaria de la UANL. Ricardo Canales del Castillo Químico bacteriólogo parasitólogo, maestro en ciencias, con especialidad en microbiología. Doctor, con especialidad en manejo de vida silvestre, por la FCB-UANL. Actualmente se desempeña como profesor de tiempo completo en la misma institución, donde desarrolla proyectos principalmente con aves, de genética de la conservación, filogeografía y evolución molecular, en colaboración con el Rocky-Mountain Bird Observatory y la Universidad de Washington. Candidato al SNI. 142

Diana L. Cárdenas Chávez Bióloga y maestra en ciencias, con especialidad en microbiología, por la FCB-UANL. Candidata a doctora en ciencias, con especialidad en microbiología, por la UANL. Durante su desarrollo profesional ha realizado estancias de investigación y colaboración con instituciones nacionales, como el Instituto de Neurobiología de la UNAM y el Centro de Investigación y de Estudios Avanzados del IPN, Campus Monterrey, e internacionales como el Instituto Biozentrum de la Universidad de Basilea, Suiza. Alan Castillo Rodríguez Ingeniero y maestro por la UANL. Realizó una estancia de investigación en la Universidad Técnica de Clausthal, Alemania, donde obtuvo doctorado en ingeniería de materiales. Entre sus reconocimientos destacan las becas para estudios de posgrado por el Conacyt y el Servicio Alemán de Intercambio Académico (DAAD), el Reconocimiento al Mérito del Desarrollo Tecnológico, el Premio a la Investigación UANL. Reconocido como honorable educador iberoamericano por el Consejo Iberoamericano en Honor a la Calidad Educativa. Miembro del SNI, nivel I. Actualmente es director de Investigación de la UANL y de la revista CiENCiAUANL. Bernard Durand Ingeniero de la Escuela Superior de Química de Mulhouse. Maestro en electroquímica de Strasbourg, doctor ingeniero por la Universidad Claude Bernard en Lyon y doctor de estado en ciencias. Profesor emérito de la Universidad de Toulouse III, Paul Sabatier, en Francia.


Mayra Zyzlila Figueroa Torres Egresada de la carrera de ingeniería en materiales del Instituto Tecnológico de Morelia. Maestra en ciencias, con especialidad en ingeniería metalúrgica, por el IPN. Doctora en ciencia de materiales por el Centro de Investigación en Materiales Avanzados. Su línea de investigación se centra en el desarrollo de materiales avanzados, con aplicaciones ambientales y energías alternas. Actualmente es profesora-investigadora en el Departamento de Ecomateriales y Energía de la FIC-UANL. Pertenece al SNI. Marco Vinicio Gómez Meza Profesor-investigador de la FaEco-UANL. Doctor en estadística por la Universidad de Texas A&M, EUA. Ingeniero agrónomo fiotecnista por la UANL y maestro en estadística por el Colegio de Posgraduados de la Universidad Autónoma de Chapingo. Miembro del SNI, nivel I. Sus líneas de investigación son los métodos estadísticos, la estimación de componentes de varianza, las técnicas de muestreo y los modelos lineales en el área de ciencias sociales. Christian Gómez Solís Licenciado en química y maestro en ciencias químicas por la Universidad de Guanajuato en colaboración con la Universidad Tecnológica de Nagaoka, Japón, donde realizó una estancia de investigación. Doctor en ingeniería y ciencia de los materiales. Realizó una estancia de investigación en el Kumoh National Institute of Technology yen la Sun Moon University, Corea del Sur. Sus investigaciones están relacionadas principalmente con la síntesis y caracterización de materiales multifuncionales. Luis Enrique Gómez Vanegas Egresado de letras hispánicas de la Facultad de Filosofía y Letras de la UANL. Diplomado en periodismo científico por la FCC-UANL, donde además participó como investigador en el libro Violencia y ciudad. Autor del libro Soledades. Es secretario de redacción de la revista CiENCiAUANL, y revisor de Entorno Universitario, de la Preparatoria 16-UANL. CIENCIA UANL / AÑO 15, No. 60, OCTUBRE - DICIEMBRE 2012

Humberto González Rodríguez Profesor-investigador de la FCF-UANL. Maestro en ciencias, M.Sc., y doctor, PH.D., por la Texas A&M University, USA. Tiene especialidad por la International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), India. Ingeniero agrónomo fitotecnista por la UANL. Miembro del SNI, nivel II. Sus líneas de investigación son la adaptación y flujos de materia y energía en ecosistemas forestales. Marco Aurelio González Tagle Profesor-investigador de la FCF-UANL. Doctor en ciencias forestales por la Georg-August Universität Göttingen, Alemania. Maestro en ciencias forestales e ingeniero forestal por la FCF-UANL. Miembro del SNI, nivel I. Sus líneas de investigación son la silvicultura, el manejo integral de incendios forestales y el manejo forestal. Sophie Guillemet-Fritsch Graduada en física y ciencias aplicadas de la Universidad de Haute Alsace, Mulhouse. Maestra en metalurgia por la Universidad de París IX, Orsay. Doctora en ciencia de materiales por la Universidad Paul Sabatier y posdoctorada en la Universidad de Princeton. Es investigadora CNRS en la Universidad Paul Sabatier, Toulouse, Francia. María Isolde Hedlefs Aguilar Licenciada en psicología, maestra y doctora, todas en la FaPsi-UANL. Acreedora a diferentes reconocimientos por investigación científica. La línea de investigación en la que se especializa es sobre el procesamiento cognitivo de la información de violencia y perdón en personas que sufrieron maltrato infantil. Cuenta con publicaciones nacionales e internacionales; asimismo, un libro y capítulos de libros. Aracely Hernández Ramírez Química farmacéutica bióloga por la FCQ-UANL. Maestra en ciencias por el ITESM y doctora en ciencias, con orientación en ingeniería cerámica, por la FCQ-UANL. Sus áreas de investigación son la síntesis y caracterización de materiales cerámicos vía sol gel, con aplicaciones en 143

incorporación de fármacos en matrices cerámicas, celdas electroquímicas, catálisis y procesos avanzados de oxidación para tratamiento de contaminantes en medios acuosos (fotocatálisis heterogénea, Fenton, y foto-Fenton). Perfil Promep. Miembro del SNI, nivel I, y de la AMC. Es profesora-investigadora en la FCQ-UANL y coordinadora del Doctorado en Ciencias reconocido en el Programa Nacional de Posgrados de calidad de Conacyt. Wibke Himmelsbach Doctora en manejo de recursos naturales por la FCFUANL. M.Sc. en “Tropical and international forestry” y B.Sc. en “Forest sciences and forest ecology” por la GeorgAugust-Universität Göttingen, Alemania. Sus líneas de investigación son la ecofisiología, en especial, la adaptación de árboles a factores ambientales, y sus estrategias de supervivencia. Isaías Juárez Ramírez Licenciado en química industrial y doctor, con orientación en ingeniería cerámica, ambas por la UANL. Cuenta con más de 30 artículos científicos publicados en revistas internacionales indizadas. Ha recibido cerca de 15 premios y distinciones. Profesor-investigador en la FICUANL. Tiene a su cargo la Coordinación de Investigación del Departamento de Ecomateriales y Energía. Es miembro del SNI, nivel I, de la AMC y de la Red Nacional de Ecomateriales.

FaPsi-UANL. Investigadora y docente en Laboratorio de Ciencia Cognitiva del Centro de Investigaciones Psicológicas de la FaPsi-UANL. La línea de investigación en la que se especializa está relacionada al estudio de la emoción en diferentes poblaciones. Cuenta con publicaciones de libros, capítulos de libros y artículos científicos nacionales e internacionales. Román Jabir Nava Quintero Ingeniero mecánico electricista y maestro en ciencias de la ingeniería mecánica, con especialidad en materiales, por la UANL. Doctor en cotutela por la UANL y la Universidad Paul Sabatier de Francia. Actualmente labora en el área de investigación y desarrollo de Kemet de México. Juan Manuel Peralta Hernández Estudió la licenciatura en ingeniería química en el IT Toluca. Maestro y doctor en electroquímica por el CIDETEQ. Ha realizado estancias de investigación en la Plataforma Solar de Almería-España y en la Universidad de Barcelona-España. Actualmente es miembro del SNI, nivel I. Ha publicado 29 artículos en revistas indexadas, un libro y ocho capítulos de libro. Sus intereses de investigación incluyen la electrocoagulación, la oxidación electroquímica (BDD), electro y fotoelectro-Fenton, así como la fotocatálisis.

Ernesto Octavio López Ramírez Trabaja en el Laboratorio de Ciencia Cognitiva del Centro de Investigaciones Psicológicas de la FaPsi-UANL. Doctor en cognición humana por la Universidad de Wisconsin, Madison, EUA. Sus principales líneas de estudio son la memoria y la emoción humana; en particular, a través de técnicas de simulaciones neurocomputacionales, psicofísica y diseño experimental para el estudio de la memoria y la emoción. Autor de numerosas publicaciones nacionales e internacionales.

Diana Reséndez Pérez Química bacterióloga parasitóloga. Maestra en ciencias y doctora en ciencias, con especialidad en biología molecular e ingeniería genética, por la UANL. Posdoctorada en genética y biología del desarrollo en el Biozentrum de la Universidad de Basilea en Suiza. Profesora-investigadora de la FCB-UANL, donde actualmente dirige el Departamento de Biología Celular y Genética, así como la Subdirección de Posgrado. Sus líneas de investigación son el control genético del desarrollo, genes homeóticos, determinación y diferenciación celular, regulación génica mediante microRNAs y análisis genómico de hormigas.

Guadalupe Morales Martínez Licenciada en psicología maestra y doctora, todas en la

Martín Edgar Reyes Melo Ingeniero en industrias alimentarias por la Facultad de



Agronomía de la UANL. Maestro en ciencias de la ingeniería mecánica, con especialidad en materiales, por la FIME-UANL. Doctor en ingeniería de materiales, por la Universidad Paul Sabatier de Toulouse, Francia. Ha obtenido el Premio de Investigación UANL en 1999, 2004, 2009, 2011 y 2012. Catedrático investigador en la FIME y el CIIDIT de la UANL. Miembro del SIN, nivel I. Manuel Ribeiro Ferreira Licenciado en sociología por la Universidad Iberoamericana. Maestro y doctor en ciencias de la educación por la Universidad Laval de Quebec, Canadá. Además, cursó una especialización en género y desarrollo en la Universidad de Manchester, Inglaterra, y realizó una estancia posdoctoral en el Instituto Quebequense de Investigaciones sobre la Cultura en Montreal, Canadá. Es autor de 20 libros, 43 capítulos en libros, 31 artículos con arbitraje y 13 artículos en revistas de divulgación. Trabajó como investigador en el Instituto Mexicano de Estudios Sociales, A.C., y como consultor en UNICEF. Profesor de tiempo completo titular “D” en la FTS-UANL. Miembro del SNI, nivel II. Miguel Ángel Ruiz Gómez Licenciado en química industrial y maestro en ciencias, con especialidad en ingeniería ambiental, ambas por la UANL. Ha ganado en dos ocasiones el Premio de Investigación de la UANL. Cuenta con cinco artículos científicos en revistas internacionales indizadas. Blanca Mirthala Tamez Valdez Licenciada en trabajo social. Maestra en ciencias, con orientación en trabajo social, y doctora en filosofía, con orientación en trabajo social y políticas comparadas de bienestar social, todos por la UANL. Ha trabajado para diversas instituciones, además de desempeñarse como docente y participar en algunos proyectos de investigación en la FTS-UANL. Ha realizado algunos proyectos de investigación para diversas instituciones educativas y


empresas privadas. Sus líneas de investigación son el envejecimiento, el divorcio y la familia. Leticia M. Torres Martínez Licenciada en química industrial por la UANL. Doctora en química de materiales cerámicos avanzados por la Universidad de Aberdeen, Escocia. Actualmente es directora adjunta de Desarrollo Científico en el CONACYT. Miembro del SNI, nivel III. Ha publicado más de 135 artículos científicos en revistas indizadas con arbitraje internacional y cuenta con más de 750 citas auténticas. Ha recibido más de 50 premios y distinciones a nivel nacional e internacional. Ha ganado en 17 ocasiones el Premio de Investigación UANL, en la modalidad de Ciencias Exactas e Ingeniería y Tecnología. Eduardo Javier Treviño Garza Profesor-investigador de la FCF-UANL. Doctor en ciencias forestales por la Georg-August Universität Göttingen, Alemania. Biólogo por la FCB-UANL. Miembro del SNI, nivel I. Sus líneas de investigación son la geomática aplicada a la evaluación y monitoreo de los recursos naturales. Minerva Villanueva Rodríguez Química farmacéutica bióloga y doctora en ciencias, con en orientación en química analítica ambiental, ambos grados por la UANL. Actualmente cursa un posdoctorado en el Colegio de la Frontera Sur, ECOSUR, Tapachula. Candidata al SNI. O. Karina Villanueva Segura Bióloga y maestra en ciencias, con especialidad en microbiología, por la FCB-UANL. Actualmente estudia el doctorado, con especialidad en entomología médica en la UANL. Durante su desarrollo profesional se ha desempeñado como personal no docente en la Facultad de Medicina, y como personal docente en FCB. Asimismo, se ha desempeñado como bioanalista en la industria privada.


Información para los autores

La revista CiENCiA UANL tiene como propósito difundir la producción científica y tecnológica de la Universidad Autónoma de Nuevo León en los ámbitos académico, científico, tecnológico y empresarial. CiENCiA UANL está dirigida a aca-démicos, científicos, tecnólogos y profesionales en general interesados en aumentar sus conocimientos y fortalecer su perfil cultural. En sus páginas se presentan avances de investigación científica, desarrollo tecnológico y artículos de difusión en cualesquiera de las siguientes áreas: Ciencias Exactas, Ciencias de la Tierra, Ciencias Biológicas, Biomédicas y Químicas, Ciencias Naturales, Ciencias Sociales e Ingenierías. En el caso de las áreas de Arquitectura, Psicología y similares, sólo se aceptarán trabajos con resultados experimentales. Se invita a todos los profesores e investigadores a enviar sus artículos de carácter científico o tecnológico. Las colaboraciones deberán estar escritas en un lenguaje claro, didáctico y accesible a lectores con formación profesional. Las colaboraciones serán evaluadas por especialistas por área científica. Los criterios aplicables a la selección de textos serán: el rigor científico, la calidad y precisión de la información, el interés general del tema expuesto y la claridad del lenguaje. Se publicarán artículos en inglés sólo si todos los autores tienen como primera lengua un idioma diferente al español.

ginales, entendiendo por ello que el contenido sea producto de su trabajo directo y que una versión similar no se haya publicado o enviado a otras revistas. En el caso de los trabajos de difusión, además de los lineamientos deberá considerarse lo siguiente: * El autor debe demostrar haber trabajado y publicado en el tema del artículo. * El artículo debe ofrecer una panorámica clara del campo temático. * El artículo debe ser ordenado. Separar las dimensiones del tema y evitar romper la línea de tiempo. * Debe considerarse la experiencia nacional y local, si la hubiera. * Debe estar adecuadamente (cantidad y calidad) ilustrado: fotos, diagramas, etc. No se aceptan reportes de mediciones. Los artículos deben contener no sólo la presentación de resultados de medición y su comparación, también deben presentar un análisis detallado de los mismos, un desarrollo metodológico original, una manipulación nueva de la materia o ser de gran impacto y novedad social. Sólo se aceptan modelos matemáticos si son validados experimentalmente por el autor. No se aceptarán trabajos basados en encuestas de opinión o entrevistas, a menos que aunadas a ellas se realicen mediciones y se efectúe un análisis de correlación para su validación.

Criterios editoriales

Lineamientos editoriales

No se aceptarán trabajos que no cumplan con los criterios y lineamientos indicados. Sólo se aceptan artículos ori-

El autor deberá entregar o enviar, para su consideración editorial, un original y dos copias del artículo impresos, así


como un CD o DVD con el archivo del mismo en formato .doc de Word, originales de material gráfico, fichas biográficas de cada autor de máximo 100 palabras y carta firmada por los autores que certifique la originalidad del artículo y cedan derechos de autor a favor de la UANL. Los artículos deberán remitirse a: Revista CiENCiAUANL Biblioteca Magna Universitaria “Raúl Rangel Frías”, 5o. Piso Av. Alfonso Reyes 4000 Nte. C.P. 64440, Monterrey, N.L., México Los originales deberán tener una extensión máxima de cinco páginas (incluyendo gráficas y fotos) de acuerdo al formato que a continuación se especifica: —Formato. Tamaño carta. El margen superior deberá ser de 2.5 cm y el resto de 2 cm. —Título. Máximo dos renglones, tipografiado en altas y bajas, tipo Times New Roman a 24 puntos, con interlínea normal, en negritas. —Nombre del autor o autores. En mayúsculas con alineación al margen derecho, misma fuente tipográfica en 12 puntos, asterisco sobreescrito al final. —Adscripción. Colocarla en pie de página de la 2a. columna antecedida por un asterisco, en tipografía Times New Roman de 8 puntos. —Cuerpo del texto. A dos columnas, con tipografía Times New Roman de 10 puntos, justificado. —Resúmenes. No mayores de 100 palabras tanto en inglés como en español. Incluir a lo sumo cinco palabras clave tanto en inglés como en español para ser utilizadas en índices. Deben ubicarse al terminar el cuerpo y antes de las


referencias. Misma tipografía que el cuerpo. —Referencias. Deberán ser numeradas y aparecerán en el orden que fueron citadas en el texto, utilizando la misma tipografía del cuerpo. Las fichas bibliográficas deberán contener los siguientes datos: autores o editores, título del artículo, nombre del libro o de la revista, lugar, empresa editorial, año de la

publicación, volumen y número de páginas. —Subtítulos. Tipografía Times New Roman, 10 puntos, negritas. —Notas al pie. Times New Roman, 8 puntos. —Material gráfico. Mínimo tres imágenes o gráficas en blanco y negro, a una o dos columnas, máximo media página (deben entregarse originales).

—Pie de gráficos. Tipografía Times New Roman, itálica de 9 puntos. Para cualquier comentario o duda estamos a disposición de los interesados:

CiENCiA UANL has as its primary purpose to publish scientific and technological articles for the academic, technological and business communities in order that scientists, engineers, technologists and professionals in general may benefit from the knowledge and culture that its authors contribute with their interventions for the journal. Through these pages, advances in research from the natural sciences, exact sciences, earth sciences, biological sciences, biomedical sciences, chemical sciences and social sciences; technological developments and science written for laymen will be presented in both Spanish and English languages.* In the areas of architecture, psychology and similar areas investigations will be accepted only if there are experimental results. All professors and researchers are invited to send their articles that fit into the above purpose. Contributions must be written in a clear, concise and didactic manner for a readership with professional training. All contributions will be evaluated by specialists in the appropriate scientific or engineering area. Criteria employed for contributions are: scientific rigor,

quality and accuracy of information, general interest of the topic dealt with as well as clarity of language. Articles will be published in English only if all of the authors have as their first language, a language other than Spanish.

rating the dimensions of the topic but avoid breaking the time line. * Local and national experience should be taken into account if existent. * The article should be adequately (both quantity and quality) illustrated with photographs and diagrams (figures and/or tables). Reports dealing only with measurements will not be accepted. Articles must contain not only the presentation of results of measurements and their comparison but also a detailed analysis of the same. Articles must show a new manipulation of material or have great social impact and novelty as well as original methodological development. Mathematic models will only be accepted if they are experimentally validated by the author(s). Report based on opinion surveys and interviews will not be accepted, unless they are accompanied by measurements and that carry out correlational analysis for validating.

Editorial policy Research work will not be accept that do not comply with the following criteria and indications. Only original articles will be accepted, understanding by this that the contents are the product of the author(s)’ direct work and has not been published or similar version has not been sent for publication to other journals. In case of scientific articles written for a wider readership, in addition to general indications the following should be considered: * The author must demonstrate having worked and published in the thematic area of the article. * The article must offer a clear panorama of the topic dealt with in the article. * The article must be ordered, sepa-


E-mail: Tel: (81) 8329-4236 y fax (81) 8329-4090 ext. 6623

Editorial considerations The author(s) must deliver or send to the journal for editorial consideration an


original and two printed copies of the manuscript together with a CD o DVD written in Microsoft Word, original graphic material, a 100-word biographical sketch of each contributing author and a letter with all author(s)’ signature(s) transferring copyright to CiENCiAUANL, certifying that the article is original. Articles must be sent or delivered to: Revista CiENCiAUANL Biblioteca MagnaUniversitaria “Raúl Rangel Frías” 5to. Piso Avenida Alfonso Reyes 4000 Norte C.P. 64440, Monterrey, N.L., México The original articles should be no longer than 5 pages (including photographs, figures and tables) according to the following specifications: —Format. Letter size, leaving 2.5 cm


margin at the top and 2.0 cm on all other sides. —Title. Maximum 2 lines, written in upper and lower case with Times New Roman font 24 bold without between-line spacing. —Name(s) of author(s). Written in Times New Roman font 12 with raised asterisk at end of line. —Affiliation. To be put in the second column with a raised asterisk, followed by the name of the author’s department and the name of the author’s research center or university. —Body of Text. Two-column format written in font 10 Times New Roman, with right- and left-hand alignment. —Abstract. No more than 100 words. At end of abstract but before references, listing five keywords. —References. List references as they appear in the body of the text, using the same font as the text. Bibliographical citations will have the following order:

author(s) or editor(s), title of article, name book or journal, year of publication, volume and number, and number of pages and/or pagination. —Subtitles. Use font 10 Times New Roman bold. —Foot Notes. Use font 8 Times New Roman. —Graphic Material. A minimum of 3 images or graphics in black and white should be used, one or two columns wide, one half page maximum height. —Graphic Foot Notes. Use font 9 Times New Roman. If you have any comments or doubts, do not hesitate to communicate at: E-mail: Telephone: (5281) 8329-4236 Fax: (5281) 8329-4090 ext. 6623


Ciencia UANL 15-60  

Ciencia UANL 15-60 Revista Ciencia UANL 15-60 Revista Ciencia UANL 15-60, Octubre - Diciembre 2012

Ciencia UANL 15-60  

Ciencia UANL 15-60 Revista Ciencia UANL 15-60 Revista Ciencia UANL 15-60, Octubre - Diciembre 2012
