Page 1

genetica humana

28/3/07

17:50

Página 1

Incluye CD-ROM

Genética Humana Conceptos, mecanismos y aplicaciones de la Genética en el campo de la Biomedicina Texto multimedia

Francisco Javier Novo Villaverde www.FreeLibros.me


00-Portadillas

5/12/06

06:44

Pรกgina i

www.FreeLibros.me


00-Portadillas

5/12/06

06:44

Página i

Genética Humana Conceptos, mecanismos y aplicaciones de la Genética en el campo de la Biomedicina

www.FreeLibros.me


00-Portadillas

5/12/06

06:44

Página iii

CELL AND MOLECULAR BIOLOGY IN ACTION SERIES

Genética Humana Conceptos, mecanismos y aplicaciones de la Genética en el campo de la Biomedicina Texto multimedia Francisco Javier Novo Villaverde Departamento de Genética Universidad de Navarra

Madrid • México • Santafé de Bogotá • Buenos Aires • Caracas • Lima • Montevideo • San Juan San José • Santiago • São Paulo • White Plains

www.FreeLibros.me


00-Portadillas

5/12/06

06:44

Página iv

Datos de catalogación bibliográfica

GENÉTICA HUMANA. Conceptos, mecanismos y aplicaciones de la Genética en el campo de la Biomedicina Francisco Javier Novo Villaverde PEARSON EDUCACIÓN, S. A., Madrid, 2007 ISBN: 9788483223598 Materia: Genética, 575 Formato 170 × 240

Páginas: 000

Todos los derechos reservados. Queda prohibida, salvo excepción prevista en la Ley, cualquier forma de reproducción, distribución, comunicación pública y transformación de esta obra sin contar con autorización de los titulares de propiedad intelectual. La infracción de los derechos mencionados puede ser constitutiva de delito contra la propiedad intelectual (arts. 270 y sgts. Código Penal). DERECHOS RESERVADOS © 2007 PEARSON EDUCACIÓN, S. A. Ribera del Loira, 28 28042 Madrid GENÉTICA HUMANA. Conceptos, mecanismos y aplicaciones de la Genética en el campo de la Biomedicina Francisco Javier Novo Villaverde ISBN: 9788483223598 Deposito Legal: MPEARSON PRENTICE HALL es un sello editorial autorizado de PEARSON EDUCACIÓN, S. A. Equipo editorial Editor: Miguel Martín-Romo Técnico editorial: Marta Caicoya Equipo de producción: Director: José Antonio Clares Técnico: María Alvear Diseño de cubierta: Equipo de diseño de Pearson Educación, S. A. Composición: Claroscuro Servicio Gráfico, S. L. Impreso por: IMPRESO EN ESPAÑA - PRINTED IN SPAIN

Este libro ha sido impreso con papel y tintas ecológicos

www.FreeLibros.me


00-Portadillas

5/12/06

06:44

Página v

Utilización de este texto

Las figuras son un elemento fundamental en este texto multimedia. Por lo tanto, se aconseja vivamente seguir a la vez el texto y las figuras. El método habitual de estudio comenzará con la lectura de un apartado para intentar comprender los conceptos y mecanismos mostrados. A continuación, el lector deberá observar atentamente las figuras correspondientes a ese apartado, volviendo después al texto para repasar y fijar los contenidos que no hubiesen quedado claros en la primera lectura. En la página web www.unav.es/genetica/GH/ estarán disponibles actualizaciones, noticias, enlaces, etc., relacionados con este texto.

www.FreeLibros.me


0-INDICE CONTENIDO

5/12/06

06:46

Página VII

Índice de contenido

Prólogo

IX A) Introducción

1. El flujo de la información genética 1.1 Los ácidos nucleicos 1.2 Visión general del proceso de expresión génica 1.3 La transcripción 1.4 Regulación de la transcripción en eucariotas 1.5 Maduración del ARN mensajero 1.6 El ayuste (splicing) y su regulación 1.7 Traducción y código genético en eucariotas

3 3 5 6 8 9 10 13

2. El ADN en el núcleo de la célula eucariota 2.1 La cromatina durante el ciclo celular 2.2 Replicación de la cromatina en interfase 2.3 Formación y segregación de los cromosomas durante la mitosis 2.4 Gametogénesis y meiosis 2.5 Recombinación a nivel molecular

17 17 19 23 25 29

3. Técnicas básicas de genética molecular 3.1 Tecnología del ADN recombinante: métodos y usos más frecuentes 3.2 Enzimas de restricción 3.3 Técnicas básicas de hibridación de ácidos nucleicos 3.4 Amplificación in vitro de ADN (PCR) 3.5 Secuenciación del ADN 3.6 Microarrays

33 33 37 38 40 44 47

B) El genoma humano 4. La geografía del genoma humano 4.1 Historia y desarrollo del Proyecto Genoma Humano

www.FreeLibros.me

51 51


0-INDICE CONTENIDO

VIII

5/12/06

06:46

Página VIII

Genética Humana

4.2 Estructura del genoma humano y variación inter-individual 4.3 El ADN repetitivo 4.4 El genoma mitocondrial

58 62 66

5. El genoma humano en acción 5.1 La secuencia influye en el estado funcional de la cromatina 5.2 Modificaciones epigenéticas y su importancia en la regulación del estado funcional de la cromatina 5.3 Relación entre secuencia, estructura y función de la cromatina: territorios cromosómicos

69 69

6. Origen de la variación genética en humanos 6.1 Variación en el ADN: polimorfismos y mutaciones 6.2 Mecanismos de reparación del ADN en humanos. Enfermedades causadas por alteraciones en los mecanismos de reparación

81 81

71 78

82

C) La transmisión de los caracteres hereditarios 7. Genética mendeliana 7.1 Planteamiento experimental de Mendel 7.2 Monohíbridos: primera Ley de Mendel 7.3 Segunda Ley de Mendel: dihíbridos y trihíbridos 7.4 Redescubrimiento del trabajo de Mendel 7.5. ¿Dónde están los «factores unitarios»? La teoría cromosómica de la herencia

93 94 95 99 102

8. Herencia relacionada con el sexo 8.1 Cada sexo tiene distinta constitución cromosómica 8.2 Los genes situados en el cromosoma X muestran un modo especial de herencia 8.3 Determinación genética del sexo en humanos 8.4 Compensación de dosis: hipótesis de Lyon 8.5 Estructura de los cromosomas sexuales humanos

107 107

9. Modificaciones de las proporciones mendelianas 9.1 Modo de estimar si se cumplen las proporciones mendelianas esperadas 9.2 Modificaciones de las proporciones mendelianas al estudiar un carácter 9.3 Modificaciones del dihibridismo. Interacción génica y epistasia 10. Genética de los caracteres cuantitativos 10.1 Genética de los caracteres cuantitativos: experimentos de Johannsen, Nilsson-Ehle y East 10.2 Modelo poligenes-ambiente y enfermedades multifactoriales 10.3 Heredabilidad en sentido amplio y en sentido restringido. Cálculo de la heredabilidad en Genética Humana

www.FreeLibros.me

103

108 109 111 114 117 117 120 123 129 129 133 135


0-INDICE CONTENIDO

5/12/06

06:46

Página IX

11. Ligamiento genético en humanos 11.1 El concepto de ligamiento genético: fracción de recombinación y distancia genética 11.2 Informatividad de los marcadores utilizados en estudios de ligamiento 11.3 El cálculo del LOD score 11.4 Ligamiento no paramétrico y su utilización en Genética Humana

139

IX

139

12. Los genes en las poblaciones 12.1 El equilibrio de Hardy-Weinberg 12.2 Cambios en las condiciones que mantienen el equilibrio: cruzamientos no aleatorios 12.3 Cambios en las condiciones que mantienen el equilibrio: efectos del tamaño poblacional 12.4 Cambios en las condiciones que mantienen el equilibrio: migración o flujo genético 12.5 Cambios en las condiciones que mantienen el equilibrio: recombinación y mutación 12.6 Cambios en las condiciones que mantienen el equilibrio: selección 12.7 Aplicaciones en Genética Humana 12.8 Formación de la Teoría Sintética de la Evolución 12.9 Explicación actual del proceso evolutivo y sus limitaciones

153 153

Índice de contenido

142 144 147

155 158 160 160 161 165 167 169

D) Patología genética 13. Citogenética 13.1 El estudio de los cromosomas humanos 13.2 Anomalías del número de los cromosomas 13.3 El fenómeno de no disyunción meiótica 13.4 Anomalías estructurales de los cromosomas

177 177 180 183 185

14. Mutaciones simples como causa de enfermedad 14.1 Características generales de las mutaciones 14.2 Mutaciones simples: tipos y nomenclatura 14.3 Potencial patogénico de las mutaciones en el ADN codificante y en el ADN no-codificante intragénico e intergénico 14.4 Potencial patogénico de las mutaciones en el ADN no-codificante 14.5 Nomenclatura general de mutaciones

189 189 190

15. Potencial patogénico de las secuencias repetidas 15.1 Mutaciones en secuencias que están repetidas en tándem 15.2 Expansión de trinucleótidos: neuropatías por expansiones de CAG y enfermedades por expansión de otros trinucleótidos 15.3 Neuropatías por expansiones de CAG 15.4 Enfermedades por expansión de otros trinucleótidos 15.5 Otras enfermedades por expansión de secuencias repetidas 15.6 Mutaciones debidas a repeticiones dispersas 15.7 Desórdenes genómicos

199 199

www.FreeLibros.me

190 192 195

200 201 202 204 205 206


0-INDICE CONTENIDO

X

5/12/06

06:46

Página X

Genética Humana

16. Efectos fenotípicos de las mutaciones 16.1 Pérdida de función, fenotipos recesivos y haploinsuficiencia 16.2 Fenotipos dominantes por ganancia de función 16.3 Alteraciones de la impronta genómica 16.4 Mutaciones que afectan a la morfogénesis

211 212 213 215 221

17. Diagnóstico de enfermedades genéticas 17. 1 Estrategias generales de diagnóstico de enfermedades genéticas 17. 2 Métodos de detección de mutaciones 17. 3 Aplicación del ligamiento genético al diagnóstico: el proceso de diagnóstico indirecto de enfermedades genéticas

227 227 228

18. Genética clínica 18.1 Genética clínica y consejo genético 18.2 Enfermedades de herencia autosómica 18.3 Enfermedades de herencia ligada al cromosoma X 18.4 Teorema de Bayes y su aplicación al cálculo de riesgos genéticos 18.5 Enfermedades por alteración del ADN mitocondrial 18.6 Diagnóstico prenatal

237 237 239 243 246 248 252

234

E) Nuevas herramientas de la genética moderna 19. Terapia génica 19.1 Componentes de un sistema de terapia génica y vías de administración 19.2 Naturaleza del ácido nucleico terapéutico 19.3 Tipos de vectores y su utilización en distintas estrategias de transferencia génica 19.4 Aplicaciones clínicas de la terapia génica en el momento actual

257 257 258 260 270

20. Bioinformática del genoma humano 20.1 La Bioinformática 20.2 Bases de datos en Genética Humana: bases de datos de secuencias 20.3 Bases de datos en Genética Humana: bases de datos relacionadas con enfermedades 20.4 Búsquedas en bases de datos con BLAST 20.5 Navegadores del genoma humano

273 273 274

Índice analítico

281

www.FreeLibros.me

276 277 279


0-INDICE CONTENIDO

5/12/06

06:46

Página XI

Prólogo

La generalización del uso de Internet y de las computadoras domésticas permite concebir libros de texto cada vez más interactivos, con tutoriales multimedia y enlaces a los abundantísimos sitios educativos disponibles en la Red. Esto es especialmente útil en una materia como la Genética, en la que la percepción gráfica de los procesos es imprescindible para la adecuada comprensión de los conceptos y mecanismos implicados. Este libro de texto es fruto de mi reflexión acerca del modo de impartir la docencia de Genética a alumnos de disciplinas biomédicas que se enfrentan por primera vez con el apasionante mundo de los genes. Durante años he venido impartiendo la asignatura de Genética Humana a alumnos de las licenciaturas de Biología y Bioquímica de la Universidad de Navarra, y esto me ha permitido preparar poco a poco un manual detallado y abundante material gráfico que han constituido el esqueleto del presente texto. Sobre este esqueleto inicial he añadido nuevos capítulos y gran cantidad de material multimedia que han dado como resultado este texto de «Genética Humana: conceptos, mecanismos y aplicaciones de la Genética en el campo de la Biomedicina». Quizás lo que más llame la atención sobre este texto es que se presenta en un formato novedoso: sólo se incluyen algunas tablas e ilustraciones que ayudan a mantener la fluidez de la lectura, pero todos los materiales gráficos se han incluido en un CD que contiene todas las figuras a las que se hace referencia en el texto. El CD está compuesto por una serie de páginas web que se pueden visualizar con cualquier navegador, y que van guiando al alumno paso a paso a través de tutoriales propios o de enlaces a vídeos o figuras de especial interés para comprender algún concepto. Por tanto, el mayor aprovechamiento se conseguirá si el alumno va estudiando el texto y siguiendo al mismo tiempo, con calma, las figuras del CD. Este método permitirá, o al menos eso espero, una comprensión rápida de los conceptos y mecanismos, ya que éste es el enfoque que he pretendido dar al texto. En mi opinión, ninguna figura «estática» puede suplir la información aportada por un video o una animación comentada, y por ello la mayoría de los tutoriales están grabados con una voz en «off» que

www.FreeLibros.me


0-INDICE CONTENIDO

XII

5/12/06

06:46

Página XII

Genética Humana

explica lo que se está viendo. Esto supone que el alumno debe utilizar una computadora con tarjeta de sonido y altavoces (o auriculares); para los enlaces externos necesita también conexión a Internet. Confío en que la mayoría de los hogares cuentan hoy en día con esta tecnología. Una ventaja (no despreciable) de esta estructura es que permite abaratar significativamente el coste final del producto, al no requerir figuras a color dentro del propio texto; espero que esto ayude también a conseguir una amplia difusión del libro. Sin duda, algunos de los que han leído las líneas precedentes (en especial, colegas en la docencia universitaria de Genética) habrán pensado que este libro de texto supone una especie de «autotexto» que podría hacer innecesarias las clases teóricas. Nada más lejos de mi intención. De todas formas, al elaborar este método he tenido en mente las directrices sobre el nuevo Espacio Europeo de Educación Superior, y en especial el sistema de transferencia de créditos europeos (ECTS) de reciente implantación en la Unión Europea. Este sistema está basado en la cantidad de trabajo que —a juicio del profesor— debe invertir un alumno para la adecuada comprensión y aprendizaje de la materia respectiva, y por eso el concepto de crédito incluye también las horas de trabajo personal del alumno. El presente libro, que exige al alumno una inversión sustancial de tiempo mientras «navega» por las figuras al tiempo que estudia el texto, se adapta especialmente bien a este nuevo concepto. En cualquier caso, como es lógico, las clases presenciales siguen siendo un pilar básico de la docencia universitaria, puesto que en ellas el alumno recibe una visión diferente de los mismos conceptos que se exponen en el libro, puede además aclarar las dudas que le hayan surgido (si ha leído el capítulo correspondiente antes de la clase, como es aconsejable) y puede también fijar los conceptos clave que poco a poco le irán ayudando a «pensar» como un genetista. Como he dicho, el principal destinatario de este texto es el alumno que cursa una asignatura general de Genética en una licenciatura biomédica (Medicina, Farmacia), y que se enfrenta por primera vez con esta materia. De todas formas, también puede ser útil para alumnos de la licenciatura de Biología que ya hayan cursado una asignatura de Genética General (y, quizás, Ingeniería Genética) y se enfrentan con una asignatura más específica de Genética Humana, especialmente los capítulos incluidos en los bloques B, D y E. En este caso, los capítulos correspondientes al bloque A y al bloque C ya habrán sido estudiados con mucho más detalle en esas otras asignaturas, pero lo presentado aquí puede servir como resumen que ayude a recordar los conceptos fundamentales. Lógicamente, espero que este texto también resulte útil a médicos y otros profesionales del mundo biomédico que quieran ponerse al día, o que necesiten un compendio claro, actualizado y moderno de los conceptos, mecanismos y aplicaciones que ofrece la Genética en el siglo XXI.

www.FreeLibros.me


CAPITULO 1

5/12/06

06:52

Pรกgina 1

www.FreeLibros.me


CAPITULO 1

5/12/06

06:52

Página 1

A) Introducción

Se incluyen en esta sección tres temas que servirán para repasar los aspectos fundamentales de la estructura de los ácidos nucleicos y la biología molecular del gen, así como la estructura básica de la cromatina y sus cambios durante el ciclo celular.

www.FreeLibros.me


CAPITULO 1

5/12/06

06:52

Página 3

CAPÍTULO 1

El flujo de la información genética

Contenidos 1.1 Los ácidos nucleicos 1.2 Visión general del proceso de expresión génica 1.3 La transcripción 1.4 Regulación de la transcripción en eucariotas 1.5 Maduración del ARN mensajero 1.6 El ayuste (splicing) y su regulación 1.7 Traducción y código genético en eucariotas

1.1 Los ácidos nucleicos La información genética se transmite a través de unas moléculas llamadas ácidos nucleicos, polímeros formados por unidades denominadas nucleótidos. Un nucleótido es una molécula formada por una pentosa, una base nitrogenada y un grupo fosfato. Al conjunto formado por la pentosa y la base nitrogenada se le denomina nucleósido. Por tanto, un nucleótido es el éster fosfato de un nucleósido. Dependiendo de la naturaleza de la pentosa, se distinguen dos tipos de ácidos nucleicos: el ácido ribonucleico (ARN) lleva D-ribosa, y el ácido desoxi-ribonucleico (ADN) contiene 2-desoxi-D-ribosa. Las bases nitrogenadas que forman parte de los ácidos nucleicos pueden ser monocíclicas (pirimidinas) o bicíclicas (purinas). Las bases que intervienen en la formación del ADN se denominan Adenina (A), Citosina (C), Guanina (G) y Timina (T). El ARN contiene las tres primeras y Uracilo (U) en vez de Timina. Fue Friedrich Miescher el primero en identificar, en 1869, un material que llamó nucleína. Estudios posteriores fueron caracterizando progresivamente la naturaleza quími-

www.FreeLibros.me


CAPITULO 1

4

5/12/06

06:52

Página 4

El flujo de la información genética

ca de esta sustancia, así como su importancia biológica. Después de bastante controversia, Avery, MacLeod y McCarthy demostraron en 1944 que la introducción de ADN purificado en bacterias hace que éstas cambien su fenotipo y es, por tanto, la molécula transmisora de la información genética. En 1953, Rosalind Franklin, Maurice Wilkins, James Watson y Francis Crick describieron la estructura tridimensional del ADN. La Figura 1.1 contiene enlaces a los artículos originales de estos autores.

El ADN y el ARN son cadenas de polinucleótidos. Como los nucleótidos tienen direccionalidad debido a la posición del grupo fosfato en el carbono 5’ y del grupo hidroxilo en el carbono 3’ de la pentosa, las moléculas de ADN y ARN también tienen una polaridad concreta que viene definida por la dirección 5’→3’. El ADN es una molécula formada por dos cadenas antiparalelas, es decir, con polaridad contraria. Cada cadena está formada por un esqueleto desoxi-ribosa-fosfato, en el que alternan moléculas de desoxi-ribosa unidas a los grupos fosfato mediante enlaces fosfo-diéster. De este esqueleto «protruyen» las bases nitrogenadas, unidas a la pentosa mediante enlaces glucosídicos. Además, la molécula de ADN está formada por dos cadenas complementarias, lo que significa que la secuencia de bases nitrogenadas de una cadena es complementaria a la de la otra cadena. Esto se debe al hecho de que las bases nitrogenadas forman sólo dos tipos de parejas: Citosina se empareja con Guanina y Adenina se empareja con Timina. Erwin Chargaff fue el primero en demostrar en 1950 que el ADN de doble cadena tiene relaciones equimolares de purinas y pirimidinas; la cantidad total de desoxi-adenina (dA) es igual a la de desoxi-timina (dT), y la de desoxi-guanina (dG) igual a la de desoxi-citosina (dC). Por tanto, una conclusión derivada de esto es que siempre se emparejan una purina con una pirimidina del mismo modo, siendo los pares dA con dT y dG con dC. Watson y Crick, en su modelo de doble hélice, establecieron el modo exacto en que se forman los enlaces en cada par de bases, con tres puentes de hidrógeno en un par dG·dC y dos puentes de hidrógeno en un par dA·dT. Aunque hay muchos más tipos posibles de enlaces entre cada uno de estos nucleótidos, los enlaces tipo Watson-Crick tienen una propiedad importante: ocupan el mismo espacio dentro de la doble cadena y pueden intercambiarse sin distorsionar la molécula. Finalmente, el hecho de que sólo se formen dos tipos de pares de bases explica que las dos cadenas sean complementarias, ya que la secuencia de bases de una puede convertirse fácilmente en la secuencia de bases de la otra cadena sustituyendo cada base por su complementaria. La Figura 1.2 contiene un enlace a animaciones en las que se explica la estructura de los ácidos nucleicos y de la doble hélice.

Por tanto, en la molécula completa de ADN, las cadenas polinucleotídicas se mantienen unidas entre sí gracias a los puentes de hidrógeno que se forman entre bases pertenecientes a cada una de las cadenas. Además, esta doble hebra no es lineal (como una escalera de mano), sino que adopta una configuración helicoidal en la que las bases nitrogenadas ocupan el interior y se disponen perpendicularmente a las cadenas laterales. Este fenómeno se denomina «apilamiento» de las bases (base stac-

www.FreeLibros.me


CAPITULO 1

5/12/06

06:52

Página 5

La Figura 1.3 permite visualizar la forma B del ADN en tres dimensiones.

1.2 Visión general del proceso de expresión génica La secuencia de nucleótidos de determinados fragmentos del ADN contiene información para la fabricación de proteínas, que son los principales elementos estructurales y funcionales de las células. De hecho, la secuencia de nucleótidos determina el tipo de aminoácidos y el orden en que se añaden en el proceso de síntesis de proteínas, y esa información está contenida de un modo codificado en la secuencia de bases del ADN. El proceso por el que dicha información es descodificada y «traducida» para dar lugar a la síntesis de proteínas específicas se conoce como expresión génica. Este proceso comprende varios pasos de descodificación, que en líneas generales son la transcripción y la traducción. En lenguaje coloquial, transcribir significa pasar algún tipo de información de un medio a otro. Por ejemplo, se transcribe una conversación al ponerla por escrito. El primer paso en la lectura de la información contenida en la secuencia de nucleótidos consiste en la síntesis de una cadena de ARN a partir de un segmento de ADN. Este proceso de copia de una secuencia «molde» de ADN en un ARN se denomina transcripción. El ARN mantiene la información que estaba contenida en el ADN precisamente porque lleva la misma secuencia de nucleótidos (con la excepción de las timinas, que son sustituidas por uracilos). Esta cadena de ARN puede intervenir directamente en algún proceso celular, pero lo más habitual es que transmita la información al siguiente elemento de la cadena de descodificación, y por eso se llama ARN mensajero (abreviado como ARNm). El ARNm es, por tanto, la molécula que va a llevar la información contenida en un segmento concreto de ADN (es decir, un gen) hasta la maquinaria de fabricación de proteínas. Como esta maquinaria está en el citoplasma, el ARNm debe salir del núcleo celular a través de los poros nucleares y llegar a los ribosomas. Allí, mediante un proceso denominado traducción, la información genética contenida originalmente en la secuencia de nucleótidos del ADN será finalmente traducida en una serie de instrucciones que permiten al ribosoma sintetizar una proteína concreta. En los siguientes apartados veremos con detalle cada uno de estos procesos. La Figura 1.4 contiene un vídeo en el que se ve el proceso general de expresión génica.

www.FreeLibros.me

5

Visión general del proceso de expresión génica

king) y es muy importante para mantener la estabilidad global de la doble hélice. Existen distintos tipos de configuraciones que puede adoptar la doble hélice dependiendo de las condiciones del medio, pero la más relevante desde el punto de vista biológico es la forma B, ya que es la más frecuente en condiciones fisiológicas. En esta configuración, la hélice es dextrógira, con un diámetro de 2 nm, tiene 10 pares de bases por vuelta y una distancia de 0,34 nm entre cada par de bases. Las dos moléculas de desoxi-ribosa a las que se unen cada una de las bases del mismo par forman dos «surcos» en la superficie externa de la hélice. Además, como estas dos desoxi-ribosas no están situadas simétricamente, sino que miran hacia la misma cara de la doble hélice, los dos surcos que se forman no son iguales: uno de ellos es más ancho (surco mayor) y otro más estrecho (surco menor).


CAPITULO 1

6

5/12/06

06:52

Página 6

1.3 La transcripción

El flujo de la información genética

El proceso general de transcripción consiste en la síntesis de una cadena de ARN por la acción de una polimerasa de ARN, que lee la secuencia de nucleótidos contenida en el ADN molde y sintetiza la nueva cadena de ARN utilizando nucleótidos libres. En este proceso, la polimerasa se desliza por la cadena molde de ADN. La transcripción es un proceso cíclico que se repite, en el que hay varias fases esenciales: i) determinar la región molde de ADN que ha de ser copiada, ii) iniciar la síntesis de ARN, iii) estabilizar y modular la elongación del ARNm naciente, iv) terminar el proceso. En eucariotas, la molécula encargada de la síntesis es una polimerasa de ARN dependiente de ADN, es decir una polimerasa que usa un molde de ADN para sintetizar un ARN. Este enzima es en realidad un complejo enzimático formado por múltiples subunidades proteicas al que se unen también factores accesorios sin los cuales no puede reconocer el lugar correcto de inicio de la síntesis. En eucariotas se distinguen tres tipos de ARN polimerasas en función del tipo de genes que transcriben. Los genes tipo I de eucariotas son los que codifican los ARN ribosomales que veremos más adelante, y la polimerasa encargada de transcribir estos genes es la ARN polimerasa I. La mayoría de los genes son genes tipo II, que codifican proteínas y algunos ARN pequeños con funciones concretas; su transcripción corre a cargo de la ARN polimerasa II. Finalmente, otros ARN pequeños, algunos ARN ribosomales y los ARN transferentes son sintetizados por la ARN polimerasa III. El primer paso en la transcripción es determinar en qué punto comienza. Esto viene determinado por la existencia de unas secuencias que definen la región del gen en la que se une el complejo enzimático responsable de la síntesis. Estas secuencias se llaman promotores, y son necesarios para que la transcripción pueda tener lugar. Un promotor consta de varios pequeños motivos de secuencia, dispersos a lo largo de varios cientos de pares de bases, a los que se unen los distintos factores proteicos necesarios para la transcripción. De hecho, la ARN polimerasa no se une al promotor directamente, sino a través de otro complejo proteico denominado complejo de preiniciación. Por ejemplo, una de las secuencias más constantes en promotores de eucariotas es la caja TATA, cuya secuencia consenso es 5’-TATATAAAT-3’; a esta secuencia se une un factor proteico llamado «proteína de unión a TATA» (en inglés TATA-binding protein, abreviado TBP). Sobre este factor se unen otros factores accesorios y dan lugar a un factor de transcripción llamado TFIID. De modo similar, se forman otros factores de transcripción, que en el fondo no son más que proteínas con algún dominio de unión al ADN, que reconocen específicamente las secuencias presentes en los promotores y se unen a ellas. En el promotor eucariota típico de genes tipo II se forma un complejo con TFIID, TFIIA, TFIIB y TFIIF, al que se une la ARN polimerasa II. La unión posterior de TFIIH y TFIIE añade otras actividades al complejo, como la actividad helicasa necesaria para abrir la doble hélice y permitir el copiado de una cadena, y hace que comience la transcripción. Por tanto, la formación del complejo de preiniciación sobre promotores específicos es la forma de controlar que la ARN polimerasa comience a sintetizar en el lugar correcto. Además, los promotores eucariotas están también modulados por otros elementos más lejanos del punto de inicio de la transcripción, llamados «potenciadores» (enhancers en inglés) o «silenciadores». Estos elementos son secuencias de ADN sobre las que se

www.FreeLibros.me


CAPITULO 1

5/12/06

06:52

Página 7

Exon 1

PROMOTOR

CAJA TATA

INICIO DE LA TRANSC RIPCIÓN

5’—ACGtataaGATCTCGATCGAGACTAGCTAGCTAGCT AgCGATCGAGCTA-3’ |||||||||||||||||||||||||||| ||||||||||||||||||||| 3’-TGCTAGCTAGATAGCTAGCTCTGAT CGATCGATCGATCGCTAGCTCGAT-5’

DOBLE CADENA DE ADN (GEN)

La Figura 1.5 muestra una secuencia de ADN en la que se representan las principales secuencias implicadas en la transcripción de un gen.

Con la fosforilación del extremo carboxilo-terminal de la ARN polimerasa II, comienza el desplazamiento de la misma por la cadena molde de ADN y la síntesis del ARN naciente. En este proceso, la polimerasa lee la secuencia de nucleótidos de una de las cadenas de la doble hebra de ADN y sintetiza un polinucleótido complementario, reemplazando las timinas del ADN por uracilos. De este modo, se conserva perfectamente la información que estaba contenida en el ADN. En este sentido, tiene importancia saber cuál es la hebra de la doble hélice que es utilizada como molde, y a veces existe cierta confusión sobre la nomenclatura de las dos hebras del ADN bicatenario. Es importante recordar que los polinucleótidos se sintetizan en dirección 5’→3’, y lo mismo sucede con la síntesis del ARN mensajero. Por tanto, la hebra molde se lee en sentido 3’→5’ (es decir, antisentido) al tiempo que la transcripción procede en sentido 5’→3’. Por eso, el convenio es llamar «hebra codificante» o «hebra sentido» a la hebra de la doble cadena de ADN que contiene exactamente la misma secuencia de nucleótidos que el futuro ARNm transcrito (excepto por los uracilos). A la hebra complementaria, que es la que se utiliza como molde, se le llama «hebra molde» o «hebra antisentido».

www.FreeLibros.me

7

La transcripción

unen factores proteicos que contribuyen a estabilizar y potenciar el complejo de preiniciación, en el caso de los potenciadores, o a impedir la transcripción en el caso de los silenciadores. Existen muchos otros elementos de secuencia que forman parte de promotores y que permiten regular dónde o cuándo se transcribe un gen. Muchos de estos elementos tienen una localización precisa respecto al inicio de la transcripción: por ejemplo, la caja TATA suele estar 25 nucleótidos en dirección 5’ al inicio de la transcripción (es decir, en posición –25, ya que se considera como posición +1 la del nucleótido donde se inicia la síntesis). Otros elementos frecuentes son la caja GC (secuencia consenso GGGCGG) o la caja CAAT (CCAAT) en posición –100, a las que se unen factores de transcripción específicos.


CAPITULO 1

8

5/12/06

06:52

Página 8

El flujo de la información genética

El proceso de elongación del transcrito naciente, al menos en eucariotas, está sujeto a numerosas pausas o paradas, debido a diversos obstáculos que la polimerasa se puede encontrar al avanzar por el ADN molde. Como veremos en el siguiente capítulo, la doble hélice está empaquetada en forma de cromatina, y esto crea obstáculos importantes a los procesos de transcripción; además, el ADN puede haber sufrido daños que a veces impiden el paso del complejo transcripcional. Por eso, es importante la presencia de factores que favorecen la elongación, tales como algunos factores de transcripción (TFIIF y TFIIS) o la elongina. La fosforilación de la ARN polimerasa también favorece significativamente el proceso de elongación. La última fase del proceso de transcripción es la terminación de la síntesis. Así como en procariotas la terminación está mediada por unas secuencias específicas en el ADN molde, en eucariotas la terminación no sigue este modelo, sobre todo en el caso de la ARN polimerasa tipo II. La síntesis habitualmente sigue hasta que se ha sobrepasado el punto que constituirá el extremo 3’ del ARN mensajero, y la terminación está ligada a los procesos de maduración del transcrito que se describen a continuación. La Figura 1.6 contiene un enlace a un vídeo que muestra esquemáticamente el proceso de transcripción.

1.4 Regulación de la transcripción en eucariotas Así como los mecanismos que regulan la expresión génica son bastante bien conocidos en procariotas, y se han identificado distintos tipos de ARN polimerasas y de factores de transcripción implicados en el inicio de la transcripción, el panorama en eucariotas es mucho más complejo. Sólo en los últimos años ha comenzado a conocerse con cierto detalle el modo en que se regula la intensidad de la expresión génica, su restricción a determinados tejidos y su variación en respuesta a estímulos extracelulares. Aunque esta regulación se puede dar a varios niveles de complejidad, en este apartado estudiaremos únicamente el nivel basal, que es el compuesto por las secuencias promotoras, potenciadoras y silenciadoras del inicio de la transcripción y los factores proteicos que se unen a ellas. El complejo basal de iniciación es una maquinaria molecular gigante, con distintas actividades, cuyo ensamblaje es necesario para la transcripción correcta tanto de genes constitutivos como de genes que se expresan sólo en determinados tejidos. Hasta hace unos 10 años, se conocían seis factores generales de iniciación de la transcripción de genes clase II en eucariotas, llamados TFIIA, TFIIB, TFIID, TFIIE, TFIIF y TFIIH. Éstos, junto con la ARN polimerasa II, son suficientes para iniciar la transcripción de algunos genes in vitro, es decir, en el tubo de ensayo. Pronto se vio que algunos de estos factores generales eran en realidad complejos formados por varios componentes, y se identificaron un total de 23 proteínas además de las 12 subunidades de la ARN polimerasa II; con esto, se propuso un modelo por el que todos estos factores se ensamblan durante la iniciación de la transcripción. Los progresos de los últimos años han revelado que en realidad el transcriptosoma es un complejo mucho mayor de lo que se creía, con muchos otros componentes proteicos que llevan a cabo otras funciones, como la remodelación de la cromatina o la reparación del

www.FreeLibros.me


CAPITULO 1

5/12/06

06:52

Página 9

La Figura 1.7 muestra el ensamblaje del complejo basal de transcripción por la acción de activadores y mediadores.

1.5 Maduración del ARN mensajero En los genes transcritos por la ARN polimerasa tipo II, que en su inmensa mayoría son genes codificantes de proteínas, el ARN mensajero primitivo debe ser procesado para mejorar su estabilidad y para eliminar las regiones que no son codificantes. Además, en algunos casos es sometido a un proceso de corrección de errores o «edición». En primer lugar, el ARN naciente es estabilizado mediante la adición de distintos grupos en sus extremos 5’ y 3’, ya que los extremos libres de la molécula de ARN son los más vulnerables a la degradación por unas enzimas llamadas exonucleasas. El extremo 5’ es modificado mediante la adición del capuchón o caperuza (cap en inglés), que consiste en la adición al primer nucleótido del ARN de una guanina modificada. Podemos representar el extremo 5’ de un ARN recién transcrito por 5’pppNpN…-3’, siendo cada p un grupo fosfato y N un nucleótido cualquiera (como es habitual, el primer nucleótido de la cadena tiene tres grupos fosfato unidos al carbono 5’ de la ribosa). La caperuza consiste en una guanina metilada en posición 7, que se une por su carbono 5’ al primer grupo fosfato de la cadena. Por tanto, el enlace entre la 7-metil-guanina y el primer nucleótido es atípico, ya que es un enlace 5’→5’ en vez del enlace 5’→3’ habitual. El otro tipo de modificación del ARN mensajero tiene lugar en el extremo 3’ del mismo, y consiste en el corte por un punto concreto y la posterior adición de una

www.FreeLibros.me

9

Maduración del ARN mensajero

ADN. La regulación de la expresión génica se ejerce, a este nivel basal, mediante la regulación del ensamblaje de la maquinaria proteica necesaria para la transcripción, y en este sentido se ha estudiado especialmente el papel de los potenciadores y los activadores. Los potenciadores (enhancers en inglés) son pequeños elementos de secuencia del ADN a los cuales se unen unos factores proteicos llamados activadores, y dicha unión estimula la transcripción. Dado que distintos genes tienen distintos elementos potenciadores y que no todas las células poseen los mismos activadores, este sistema permite cierta especificidad en la respuesta a estímulos fisiológicos que recibe las células de distintos tejidos. Además, los activadores son proteínas modulares, es decir, poseen distintos dominios de unión a potenciadores diferentes, lo cual regula la afinidad y especificidad de las interacciones con los elementos de ADN. El modo en que la unión de los activadores a los potenciadores es capaz de promover la trancripción, ha sido estudiado con profundidad en los últimos años. Estos estudios han permitido aislar otro complejo proteico llamado mediador, constituido también por varias subunidades, que interacciona con los activadores y con la ARN polimerasa II y así transduce las señales proporcionadas por los potenciadores al promotor basal de la transcripción. Se han identificado varios mediadores en humanos, como TRAP, DRIP y otros; además de ayudar a estabilizar el complejo de iniciación gracias a las interacciones con los activadores y los factores generales de transcripción, los mediadores también pueden regular directamente la actividad de la ARN polimerasa II.


CAPITULO 1

10

5/12/06

06:52

Página 10

El flujo de la información genética

cola de poli-adeninas. Es importante recordar que dicha cola no se añade al extremo final del transcrito primario, sino que previamente tiene lugar un corte interno. El punto de corte viene definido por la presencia de una señal de poli-adenilación en el ARNm (cuya secuencia consenso es 5’-AAUAAA-3’) y un tracto rico en guaninas y uracilos (tracto GU) localizado unos 30-40 nucleótidos por debajo de la señal de poli-adenilación (es decir, en dirección 3’). El proceso está mediado por unos factores proteicos que se unen a cada una de estas señales, cortan al ARN mensajero unos 20 nucleótidos por debajo de la señal de poli-adenilación, y comienzan a añadir adeninas. La formación de esta cola poli(A) es muy importante para mantener la estabilidad del ARNm y asegurar que éste pueda seguir siendo procesado y llegue a traducirse correctamente. La Figura 1.8 contiene un enlace a un vídeo educativo que muestra esquemáticamente la adición de la caperuza y la formación de la cola poli(A).

Un último tipo de modificación que pueden sufrir algunos ARNm es la corrección o «edición». La edición del ARN es un mecanismo de modificación co- o post-transcripcional mediante el cual se cambian uno o varios nucleótidos de un ARNm, con el resultado de que la secuencia del mensajero es ligeramente distinta de la que venía codificada en la secuencia genómica. Este fenómeno, bastante común en otras especies pero más raro en humanos, permite generar diversos ARNm a partir de un mismo gen. Por ejemplo, la apolipoproteína ApoB48, que se produce en el intestino para entrar a formar parte de los quilomicrones, se origina por efeco de un cambio C→U en el que una citosina se des-amina para dar lugar a un uracilo; este cambio crea un codón de parada en el ARNm de la ApoB100 y se produce una proteína más corta de lo que sería esperado según la secuencia inicial. Un mecanismo similar está implicado en el origen de enfermedades como la neurofibromatosis tipo I o el tumor de Wilms, debidas a alteraciones en los genes NF1 y WT1, respectivamente. La Figura 1.9 muestra esquemáticamente la edición del ARN que da lugar a la ApoB48.

1.6 El ayuste (splicing) y su regulación Los ARN mensajeros de eucariotas tienen una característica muy importante: no son codificantes en su totalidad, desde el principio al fin, sino que las regiones codificantes están interrumpidas por otras regiones no-codificantes. Es decir, no todos los nucleótidos del ARN mensajero son leídos para sintetizar proteínas, sino que existen regiones codificantes llamada exones que alternan con otras regiones no-codificantes llamadas intrones. Debido a esta configuración, el siguiente paso en la maduración de un ARNm consiste en eliminar los intrones y pegar los exones para formar un mensajero maduro que pueda ser traducido desde el principio hasta el fin y sin interrupciones. Este proceso de corte y eliminación de intrones con empalme de los exones se denomina en inglés splicing, término naútico que corresponde al castellano ayuste: la unión de dos cabos por sus chicotes. El ayuste es un proceso complejo, porque hay que tener en cuenta que el número de exones e intrones de un gen

www.FreeLibros.me


CAPITULO 1

5/12/06

06:52

Página 11

Exón 1

Exón 2

Intrón 1

ARNn p U1

GUC CAUUCA CAG GUA AGU

…UGAC…..….[C/T] [C/T][C/T][C/T] [C/C/T]AG G

La Figura 1.10 muestra esquemáticamente las distintas secuencias que son importantes en el proceso de ayuste.

www.FreeLibros.me

11

El ayuste (splicing) y su regulación

puede ser muy grande, y requiere una maquinaria proteica bastante sofisticada. En primer lugar, es importante definir el punto exacto que delimita la frontera entre un exón y un intrón, para que la maquinaria encargada del ayuste pueda actuar. Estos puntos vienen determinados por secuencias específicas del ARNm. Por ejemplo, los intrones de eucariotas comienzan en la práctica totalidad de los casos por los nucleótidos Guanina-Uracilo (secuencia 5’ de ayuste, GU) y terminan en Adenina–Guanina (secuencia 3’ de ayuste, AG). Estas secuencias se localizan dentro de unas regiones más amplias que cumplen un consenso de secuencia concreto. Por ejemplo, la secuencia de ayuste 5’ está formada por el consenso 5’AG|GU[A/G]AGU-3’ (la barra vertical indica el sitio de corte donde termina el exón precedente y comienza el intrón; [A/G] significa que en esa posición puede haber una A o una G). Por su parte, la secuencia de ayuste 3’ se ajusta al consenso 5’NCAG|G-3’ (siendo N cualquier nucleótido). Además, es importante la presencia de una adenina 20-40 nucleótidos por arriba (es decir, en dirección 5’) de la secuencia 3’ de ayuste. Esta adenina se encuentra en la secuencia consenso 5’CU[A/G]A[C/U]-3’ (es la adenina en negrita y subrayada), es decir, precedida por A o G y seguida por C o U, y se denomina punto de ramificación (en inglés, branch point). Entre el punto de ramificación y la secuencia de ayuste 3’ se encuentra un tracto rico en pirimidinas, es decir, formado casi exclusivamente por timinas o citosinas. Finalmente, se han identificado pequeños elementos de secuencia en exones o en intrones que actúan como potenciadores o silenciadores del proceso de ayuste, y que tienen gran importancia en la modulación y regulación fina del proceso.


CAPITULO 1

12

5/12/06

06:52

Página 12

El flujo de la información genética

El proceso de ayuste implica varias reacciones enzimáticas que realizan cortes endonucleolíticos y unión de extremos libres. El primer paso del proceso es el corte en el sitio de ayuste 5’, justo por delante de la guanina del GU inicial del intrón. Este extremo libre se une a la Adenina del punto de ramificación mediante un enlace fosfo-diéster 5’-2’, creando una estructura en lazo. Finalmente, se corta la secuencia de ayuste 3’ por detrás de la guanina del sitio AG, lo que resulta en la liberación del intrón; los extremos libres de los dos exones flanqueantes son entonces religados. Las moléculas que llevan a cabo estos procesos son unas ribonucleoproteínas nucleares pequeñas (RNPnp), formadas por un ARN nuclear pequeño (ARNnp) y varias subunidades proteicas. Aunque hay varios tipos de ARNnp, los que participan en el proceso de ayuste se llaman U1, U2, U4, U5 y U6, y además dan su nombre a las correspondientes RNPnp. La RNPnp U1 se une a la secuencia de ayuste 5’ por complementariedad de bases, ya que uno de sus extremos es complementario a la secuencia consenso que rodea a la GU del extremo 5’ del intrón. Las otras ribonucleoproteínas implicadas actúan en los siguientes pasos del proceso. La RNPnp U2 se une al punto de ramificación y esto hace que ambas RNP entren en contacto y facilita la formación del lazo. A continuación, un complejo formado por la RNPnp U4/6 y la RNPnp U5 se une a la región de ayuste 3’ y estabiliza la formación de todo el complejo, llamado ayusteosoma (spliceosome en inglés), y lleva a cabo el corte 3’ y la unión de los exones. La Figura 1.11 contiene un enlace a un vídeo educativo que muestra esquemáticamente el proceso de ayuste.

Como se puede suponer, en un genoma eucariota hay miles de sitios que cumplen el consenso de secuencia necesario para funcionar como sitios de ayuste, pero sin embargo sólo unos pocos participan en el procesamiento normal de los genes. De hecho, uno de los temas más interesantes en la regulación del ayuste es cómo se definen exactamente los límites de exones e intrones, de modo que la maquinaria de ayuste los reconozca como tales. Aunque todavía quedan incógnitas por resolver, hoy en día sabemos que hay otros elementos que cooperan para estabilizar el ayusteosoma y permitir que se lleve a cabo el proceso. Entre estos elementos destacan la proteínas SR (llamadas así por ser ricas en los aminoácidos Serina y Arginina), que interaccionan con distintos componentes del ayusteosoma y se unen a secuencias moduladoras como son los potenciadores exónicos del ayuste. Todas estas interacciones tienen lugar antes de la unión de las RNPnp U4/6 y RNPnp U5, y son muy importantes para definir los límites de exones e intrones y para regular el ayuste alternativo, que es el fenómeno por el cual un mismo gen puede sufrir distintos patrones de ayuste dependiendo del tejido o del tipo celular en que se lleva a cabo. El ayuste alternativo es un fenómeno muy común en humanos, y hace que los ARNm resultantes de los distintos tipos de ayuste sean diferentes y por tanto tengan la capacidad de codificar proteínas distintas, lo que añade un nivel más de complejidad en la función del genoma. La Figura 1.12 muestra esquemáticamente los complejos que intervienen en la definición de los exones e intrones, así como el fenómeno de ayuste alternativo.

www.FreeLibros.me


CAPITULO 1

5/12/06

06:52

Página 13

1.7 Traducción y código genético en eucariotas

13

El paso final en el proceso de la expresión génica es la fabricación de una proteína a partir de la información contenida en la secuencia del ARNm. Conceptualmente, este proceso es parecido a la interpretación de unas instrucciones escritas en un idioma, siguiendo un código de interpretación concreto. Por eso, el proceso se denomina traducción. Si queremos traducir un lenguaje, en primer lugar necesitamos conocer el diccionario para entender el significado de las palabras. En este caso, el diccionario se conoce como código genético, que es la correspondencia entre la información contenida en el ARNm y el tipo de aminoácido que se añade a la proteína durante su síntesis. En el ARNm, las instrucciones están compuestas por palabras de tres letras, es decir, cada tres nucleótidos forman una palabra que instruye a la maquinaria de síntesis proteica a añadir un aminoácido concreto. Estas palabras de tres letras se denominan codones. Es fácil calcular el número posible de palabras de tres letras que se pueden formar con un alfabeto de cuatro letras (A, C, G y T): 43, es decir 64 palabras distintas. Sin embargo, sólo hay 20 aminoácidos esenciales en las proteínas, por lo que en teoría sólo serían necesarios 20 codones. Teniendo en cuenta las palabras necesarias para la instrucción de iniciar la transcripción (AUG) y de terminarla (UAG, UAA, UGA), todavía tenemos la posibilidad de codificar un mismo aminoácido con varios codones distintos. Para indicar este fenómeno se dice que el código genético es degenerado, en el sentido de que varias palabras a veces codifican el mismo aminioácido. Por ejemplo, algunos aminoácidos como la leucina están codificados por seis codones diferentes.

Traducción y código genético en eucariotas

La Figura 1.13 muestra el código genético, con la tabla de equivalencias entre los distintos aminoácidos y los codones que los codifican.

El hecho de que el código genético utilice palabras de tres letras implica que cualquier secuencia anónima, cuyo significado no conocemos, podría dar lugar al menos a tres proteínas distintas dependiendo del punto de inicio de la traducción. En efecto, cualquier secuencia (supongamos la secuencia 5’-ACGACTGCGTACACGTC-3’, por ejemplo) puede dividirse en bloques de tres palabras que configurarán instrucciones distintas si comenzamos a contar desde el primer nucleótido (ACG, ACT, GCG, etc. en nuestro ejemplo), desde el segundo (CGA, CTG, CGT, etc.) o desde el tercero (GAC, TGC, GTA, etc.). Como puede observarse, las proteínas codificadas en cada caso tienen una secuencia de aminoácidos diferente. Cada una de estas posibles formas de leer una secuencia codificante se denomina marco de lectura, y siempre existen tres marcos de lectura posibles (en secuencias de una sola hebra) porque el cuarto marco de lectura es idéntico al primero, el quinto al segundo, etc. Esto plantea el problema de cómo reconoce la célula cuál es el marco de lectura que debe usar para sintetizar la proteína correcta. Esto se soluciona de dos formas: en primer lugar, por la existencia de un codón de inicio (AUG, que codifica para el aminoácido metionina), y en segundo lugar porque sólo uno de los tres marcos de lectura (llamado por eso «abierto») da lugar a una proteína de longitud adecuada, ya que en los otros dos marcos de lectura aparecen codones de parada y las proteínas codificadas resultarían muy cortas y sin funcionalidad. En eucariotas, el codón de inicio está inclui-

www.FreeLibros.me


CAPITULO 1

14

5/12/06

06:52

Página 14

El flujo de la información genética

do en una secuencia consenso definida por Marilyn Kozak, que es 5’C[A/G]CCAUGG-3’. El marco de lectura abierto quedará definido, por tanto, cuando el codón de inicio vaya seguido por un número suficiente de codones codificantes hasta llegar a un codón de parada. Es importante tener en cuenta que la traducción no comienza al principio del ARNm, y tampoco termina al final del mensajero. De hecho, en el gen y en el ARNm se pueden definir dos regiones no-traducidas, una en dirección 5’ al inicio de la traducción y otra desde el codón de parada hasta el final, que flanquean la región codificante (el marco de lectura abierto). La región no traducida 5’ (RNT-5’, en inglés UnTranslated Region o 5’-UTR) se extiende desde el inicio del ARNm (la caperuza) hasta el inicio de la traducción (codón de iniciación); la RNT-3’ (en inglés 3’-UTR) se extiende desde el codón de parada hasta el inicio de la cola poli(A).

70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| atgTGGTTTTCTGTCCACTTCCCCTatgCAGGTGTCCAACGGATGTGTGAGTAAAATTCT M W F S V H F P Y A G V Q R M C E * N S C G F L S T S P M Q V S N G C V S K I L V V F C P L P L C R C P T D V * V K F W 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCAATCGGTGGTAGTAAACCGAG G Q V L R D W L H Q T Q G N R W * * T E G R Y Y E T G S I R P R A I G G S K P R A G I T R L A P S D P G Q S V V V N R E La Figura 1.14 muestra una secuencia de ADN con los distintos marcos de lectura posibles en el ARNm, señalando además las regiones no traducidas.

La maquinaria que lleva a cabo la traducción está constituida básicamente por dos elementos: los ribosomas y los ARN de transferencia. El ribosoma es una partícula compleja formada por subunidades de naturaleza ribonucleoproteica. En eucariotas, el ribosoma consta de una subunidad pequeña (coeficiente de sedimentación 40S) formada por un ARN y unas 30 proteínas, y otra subunidad grande (60S) formada por 3 ARN y unas 50 proteínas. Los ARN transferentes (ARNt) son pequeñas moléculas de ARN que llevan en uno de sus extremos un aminoácido, y actúan como los adaptadores que leen la información de cada codón y la transforman en un aminoácido específico. Aunque se representan habitualmente con forma de trébol, en realidad están doblados en forma de L. Las dos regiones más importantes de un ARNt son el anticodón y el extremo 3’, que termina en los nucleótidos 5’-CCA-3’ y lleva el aminoácido correspondiente. El anticodón está formado por los tres nucleótidos que se emparejan con el codón por complementariedad, ya que la secuencia del codón y la del anticodón son complementarias (ambas en dirección 5’→3’). Este emparejamiento no necesita ser siempre perfecto, sino que en ocasiones se permite un

www.FreeLibros.me


CAPITULO 1

5/12/06

06:52

Página 15

La Figura 1.15 muestra un ARNt, señalando el anticodón unido al codón.

El proceso de traducción comienza con la fase de iniciación, mediante la unión de la subunidad pequeña del ribosoma a la caperuza del ARNm maduro que proviene del proceso de ayuste. A continuación, la misma subunidad ribosomal se desplaza por el ARNm hasta encontrar el codón de iniciación apropiado, momento en que se unen el ARNtMet (el ARN transferente que lleva el aminoácido Metionina) y la subunidad ribosomal grande. El bolsillo del ribosoma donde está unido este primer ARNt se llama sitio A (aminoacil). En este proceso participan también varios factores de iniciación (eIF1 a eIF6, del inglés eukaryotic initiation factor). La segunda fase de la traducción se llama elongación, y consiste en un proceso cíclico por el que el ribosoma se desplaza tres nucleótidos y el ARNt que ocupaba el sitio A pasa a ocupar otra región del ribosoma llamada sitio P (peptidil). Gracias a este movimiento, el siguiente codón del ARNm queda dentro del sitio A, a donde acude otro ARNt con un anticodón complementario al nuevo codón. A continuación, la cadena peptídica que «cuelga» del ARNt que ocupa el sitio P es transferida al aminoácido del ARNt que ocupa el sitio A, con lo que la cadena polipeptídica se alarga en un aminoácido. Estos procesos están ayudados y catalizados por los propios ARN ribosomales y por dos factores de elongación (eEF1 y eEF2, del inglés eukaryotic elongation factor). La terminación de la traducción tiene lugar cuando alguno de los tres codones de parada ocupa el sitio A, porque en vez de unirse un ARNt acude un factor de terminación (eRF1 y eRF3 en eucariotas, del inglés eukaryotic release factor). La Figura 1.16 contiene un enlace a un vídeo que muestra el proceso de traducción.

La traducción completa el proceso de expresión génica. Aunque actualmente se está reconociendo el papel de los ARN no codificantes, que se transcriben y son procesados pero no se traducen en proteínas, el aforismo «un gen, una proteína» sigue siendo válido en la mayoría de los casos. Igualmente, el «dogma central de la biología molecular» (es decir, la vía ADN→ARN→Proteína) no siempre se cumple, porque algunos virus y otros organismos tienen un genoma con ARN que se retro-transcribe a ADN. En cualquier caso, las nociones y mecanismos que se han repasado en este capítulo constituyen el punto básico de arranque para comprender la naturaleza molecular de los genes y su función como portadores de información biológica.

www.FreeLibros.me

15

Traducción y código genético en eucariotas

cierto «tambaleo» cuando uno de los tres nucleótidos no forma un emparejamiento perfecto tipo Watson-Crick; precisamente, esto es lo que permite que varios codones sean leídos por un mismo anticodón.


CAPITULO 1

5/12/06

06:52

Pรกgina 15

www.FreeLibros.me


CAPITULO 2

5/12/06

06:54

Página 17

CAPÍTULO 2

El ADN en el núcleo de la célula eucariota

Contenidos 2.1 La cromatina durante el ciclo celular 2.2 Replicación de la cromatina en interfase 2.3 Formación y segregación de los cromosomas durante la mitosis 2.4 Gametogénesis y meiosis 2.5 Recombinación a nivel molecular

2.1 La cromatina durante el ciclo celular En las células somáticas que tienen núcleo, la molécula de ADN está presente en una forma peculiar llamada originalmente cromatina. Por la estructura de la doble hélice del ADN, sabemos que la distancia entre nucleótidos es de 0,34 nm; si el genoma humano haploide tiene 3 × 109 pares de bases, la longitud total del genoma en forma de doble hélice lineal sería algo superior a un metro, y además cada núcleo contiene dos copias del genoma. Todo este material debe entrar en el núcleo de una célula eucariota, cuyo diámetro medio es de 5 µm. Esto significa que el ADN ha de adoptar un alto grado de empaquetamiento para poder alojarse dentro del núcleo. Este empaquetamiento se lleva a cabo mediante la unión de la doble hélice con varios tipos de proteínas para dar lugar a una estructura que es, precisamente, la cromatina. Las células eucariotas, al proliferar, siguen una serie de etapas en las que se llevan a cabo los procesos necesarios para dar lugar a dos células hijas: duplicar los componentes celulares, segregarlos espacialmente y dividir la célula de modo que las dos células resultantes lleven todos los ingredientes necesarios para su correcto funcionamiento. Estas etapas deben completarse en orden, de un modo altamente regulado, y constituyen lo que

www.FreeLibros.me


CAPITULO 2

18

5/12/06

06:54

Página 18

El ADN en el núcleo de la célula eucariota

se llama ciclo celular. En cada ciclo celular se distinguen por tanto varias fases: la interfase (etapa en la que la célula duplica su contenido), la mitosis (etapa en la que los componentes se separan a polos opuestos de la célula) y citoquinesis (separación física de las dos células hijas). Probablemente sea la cromatina el componente celular en el que es más importante la duplicación y segregación correctas, ya que esto va a asegurar que la información genética se transmita sin alteraciones. Por tanto, es importante saber cómo se comporta la cromatina en las distintas etapas del ciclo celular. La Figura 2.1 muestra las distintas fases del ciclo celular de una célula eucariota y los cambios que sufre la cromatina.

Durante la interfase, que es la etapa más larga del ciclo, la cromatina está sujeta a un grado de empaquetamiento de unas 2 000 veces, es decir, lo que en su estado natural ocuparía un tamaño de 2 000 mm se reduce a un tamaño de 1 mm. Esto se consigue por la unión de la doble hebra de ADN con unas proteínas básicas llamadas histonas, cuyos grupos positivos interaccionan con los grupos negativos del esqueleto fosfato del ADN. Hay cinco tipos principales de histonas, llamadas H1, H2A, H2B, H3 y H4, que se asocian entre sí para formar un octámero: dos moléculas de H3 junto con dos moléculas de H4 forman un tetrámero, y dos dímeros H2A/H2B forman otro tetrámero; ambos tetrámeros se asocian para formar un núcleo proteico (octámero) alrededor del cual se enrolla la molécula de ADN. En concreto, 146 pares de bases de ADN dan 1,65 vueltas alrededor del octámero, y sobre este complejo se une la histona H1. Esta estructura, de unos 10 nm de diámetro, es lo que se conoce con el nombre de nucleosoma, y es la unidad básica de organización de la cromatina. Los nucleosomas están unidos entre sí por el filamento de ADN que se va enrollando a su alrededor, como bolas en una cuerda, y esto da lugar a la fibra de cromatina de 10 nm. En esta estructura, unos 200 pares de bases ocupan 10 nm, lo que significa un grado de empaquetamiento de unas seis veces respecto al tamaño lineal que ocuparía un fragmento de ADN de esa longitud (200 × 0,34 nm = 64 nm). La Figura 2.2 muestra algunos modelos tridimensionales de un nucleosoma.

En condiciones fisiológicas, la fibra de 10 nm sufre un segundo grado de enrollamiento sobre sí misma para dar lugar a una estructura en forma de solenoide, con seis nucleosomas por vuelta. Esta configuración constituye la fibra de 30 nm, en la que el grado de empaquetamiento del ADN es de unas 40 veces. La fibra de 30 nm sufre diferentes grados de empaquetamiento durante interfase y, especialmente, en la mitosis, en la que la cromatina alcanza su empaquetamiento máximo (unas 10 000 veces) y da lugar a las estructuras visibles que llamamos cromosomas. Estos tipos de alto grado de enrollamiento se consiguen porque la fibra de 30 nm forma asas que se unen por su base a una estructura proteica que sirve como andamio. El andamio (scaffold en inglés) está constituido por proteínas no histonas, de las que las principales son la Sc1 (idéntica a la topoisomerasa II) y la Sc2 o SMC2, que pertenece a una familia de proteínas llamada SMC (Structural Maintenance of Chromosomes, en inglés). Estas proteínas cumplen también un papel importante en el mantenimiento

www.FreeLibros.me


CAPITULO 2

5/12/06

06:54

Página 19

Doble hélice (2 nm) Nucleosoma

Fibra de 10 nm Fibra de 30 nm

Solenoide

La Figura 2.3 muestra los distintos grados de empaquetamiento de la cromatina.

2.2 Replicación de la cromatina en interfase La interfase se subdivide en tres fases, de las que la más importante es la fase de síntesis (fase S). En esta fase tiene lugar la duplicación de los componentes celulares, incluyendo la cromatina. La fase S viene precedida y seguida por dos breves fases G (de gap, hueco o hiato), fase G1 y fase G2 respectivamente. Uno de los principales procesos que tienen lugar durante la fase S es la duplicación del contenido total de ADN del núcleo, que se lleva a cabo mediante la replicación del ADN y el ensamblaje en nucleosomas para dar lugar a la nueva cromatina. El proceso de replicación del ADN ya había sido sugerido por Watson y Crick en su descripción del ADN, al darse cuenta de que la estructura de la doble hélice y la complementariedad de bases permitía un mecanismo sencillo de copia. Aunque durante algunos años se discutió cómo podría funcionar este mecanismo, Matthew Meselson y Franklin Stahl demostraron que el ADN se replica de modo semi-conservativo, es decir, que cada

www.FreeLibros.me

19

Replicación de la cromatina en interfase

de la condensación de la cromatina (de ahí que también se les llame condensinas). Las asas de la fibra de 30 nm se unen al andamio mediante unas secuencias ricas en Adeninas y Timinas llamadas SAR (Scaffold Attachment Region en inglés), que tienen gran afinidad por las proteínas del andamio. La estructura que resulta de este enrollamiento da lugar a una fibra de unos 300 nm de grosor, en la que el grado total de empaquetamiento del ADN es de unas 2 000 veces. Las SAR son regiones importantes, dispersas por el genoma, que flanquean genes y a menudo se asocian con los orígenes de replicación que veremos más adelante, por lo que se piensa que pueden jugar un papel importante en la función y estructura de la cromatina. Finalmente, el empaquetamiento máximo de la cromatina durante la mitosis se consigue al espiralizarse la fibra de 300 nm para dar lugar a una estructura de 600 nm de grosor (una cromátide) en la que el ADN alcanza ya un grado de empaquetamiento de 10 000 veces.


CAPITULO 2

20

5/12/06

06:54

Página 20

El ADN en el núcleo de la célula eucariota

una de las nuevas moléculas lleva una cadena de la molécula original y otra cadena nueva, sintetizada tomando como molde la cadena complementaria. Posteriormente se fueron descubriendo los detalles del proceso, e identificando los distintos componentes que lo llevan a cabo. La Figura 2.4 muestra esquemáticamente la replicación semiconservativa, y contiene un enlace a un sitio educativo que explica los experimentos de Meselson y Stahl.

En eucariotas, la replicación comienza en múltiples sitios de una misma molécula de ADN a la vez, llamados orígenes de replicación. Dada la velocidad de copia de las polimerasas, una sola molécula de ADN polimerasa tardaría varios días en replicar un cromosoma completo, por lo que de hecho la replicación de la cromatina se lleva a cabo en varios miles de orígenes de replicación a la vez. De todas formas, aunque todos los orígenes funcionan durante la fase S, no todos se ponen en marcha a la vez: en algunos orígenes la replicación comienza al principio de la fase S (replicación temprana) y en otros comienza hacia el final (replicación tardía). En cada origen de replicación se forma una burbuja de replicación, por acción de unas helicasas que abren la doble hélice para permitir la unión de las enzimas que llevarán a cabo la síntesis, que son las polimerasas de ADN. Este primer paso está sujeto a una fina regulación, ya que un mismo origen sólo se replica una vez en cada ciclo celular. De hecho, aunque la replicación a partir de un origen ya haya terminado y ése mismo origen pudiese volver a iniciar otro ciclo de replicación en la misma fase S, esto nunca sucede. Esta regulación se lleva a cabo por la acción de varios complejos proteicos como el ORC (del inglés Origin Recognition Complex), el complejo de proteínas MCM, y la geminina. En cada burbuja se forman dos horquillas de replicación, apuntando en direcciones contrarias. Como los eventos que tienen lugar en cada horquilla son idénticos, basta estudiar lo que sucede en una de ellas. En primer lugar, una proteína de unión a ADN mono-catenario, llamada RPA (Replication Protein A, en inglés) se une a las cadenas que han sido separadas por las helicasas, y esto ayuda a mantener la burbuja de replicación abierta. A continuación, a cada una de las cadenas se une una enzima llamada primasa, que es una ARN polimerasa dependiente de ADN (es decir, sintetiza ARN tomando como molde ADN). La primasa sintetiza un pequeño ARN que actúa como cebador (primer, en inglés, de ahí su nombre) para iniciar la síntesis de ADN. Las polimerasas de ADN dependientes de ADN llevan a cabo la síntesis de ADN elongando la cadena a partir del cebador de ARN generado previamente. Esta síntesis tiene lugar de modo diferente en cada una de las cadenas, debido a la distinta orientación que tienen. En la cadena que discurre en sentido 3’→5’, el cebador y la nueva cadena sintetizada sobre ella discurrirán en sentido 5’→3’, que es el único modo en que pueden sintetizar ADN las polimerasas. Por tanto, en esta cadena, llamada cadena guía (leading strand en inglés) se puede sintetizar el nuevo ADN de modo continuo. Por el contrario, la otra cadena de la molécula original discurre en sentido 5’→3’, por lo que la nueva cadena sintetizada a partir de ésta (cadena retrasada, o lagging strand en inglés) debería crecer en sentido 3’→5’. Como esto no es posible, ya que las polimerasas son incapaces de sintetizar ADN de esta forma, lo que sucede es que se generan varios cebadores de ARN a pequeñas distancias, sinteti-

www.FreeLibros.me


CAPITULO 2

5/12/06

06:54

Página 21

Figura 2.5. En estas animaciones se muestra esquemáticamente el proceso de síntesis de la cadena guía y de la cadena retrasada durante la replicación del ADN.

Aunque los complejos proteicos que intervienen en la replicación del ADN en eucariotas no han sido caracterizados con tanta profundidad como en procariotas, hoy en día se conocen bastantes detalles. De entre las diferentes ADN polimerasas identificadas en eucariotas, la síntesis de los cebadores de ARN es obra de la primasa, que actúa junto con la ADN polimerasa α. Ésta prolonga el cebador de ARN unos pocos nucleótidos. El factor C de la replicación (RFC) desplaza la polimerasa α-primasa, una vez que se ha formado el cebador de ARN, y trae consigo otra proteína llamada PCNA (Proliferating Cell Nuclear Antigen, en inglés), que a su vez es la responsable de reclutar la polimerasa que lleva a cabo la síntesis de ADN. Éstas son la ADN polimerasa δ (en la cadena retrasada) y la ADN polimerasa ε (en la cadena guía). El complejo PCNA-Polimerasa también incluye una endonucleasa (FEN1 en eucariotas) que es la responsable de degradar los cebadores de ARN que son desplazados por la polimerasa. Finalmente, la ligasa que culmina el proceso en eucariotas es la ADN ligasa I. La Figura 2.6 contiene un vídeo que explica el proceso de replicación de la cadena retrasada, con los distintos complejos proteicos implicados.

Es importante entender que la replicación del ADN no se refiere sólo a la duplicación de la doble cadena, sino que implica también el ensamblaje de la cromatina a medida que el ADN se va replicando. De hecho, durante la replicación sólo se altera el empaquetamiento de la cromatina en una pequeña región: se estima que sólo los dos nucleosomas por delante de la horquilla de replicación se ven afectados por el avance de la maquinaria replicativa, y que unos 300 nucleótidos por detrás de la horquilla ya se vuelven a ensamblar los nuevos nucleosomas para comenzar a formar las dos nuevas fibras de cromatina. Este re-ensamblaje de la cromatina se produce en varias etapas, comenzando con la unión del tetrámero H3-H4 en primer lugar, seguida de la deposición del tetrámero H2A/H2B; finalmente se añade la histona H1. Lógicamente, es muy importante mantener la «memoria» acerca del estado en que estaba una región de cromatina, para que las fibras hijas que se producen tras la replicación mantengan el mismo estado que tenía la fibra original. Como veremos, esto

www.FreeLibros.me

21

Replicación de la cromatina en interfase

zándose el ADN a partir de cada uno de ellos en sentido 5’→3’. El resultado neto es la síntesis semi-discontinua de la cadena retrasada en sentido 3’→5’ gracias a la síntesis de pequeños fragmentos (cada uno de los cuales fue sintetizado en sentido 5’→3’). Estos fragmentos se denominan fragmentos de Okazaki, y tienen una longitud entre 100 y 1 000 nucleótidos en eucariotas. A medida que la horquilla de replicación avanza, las helicasas continúan abriendo la doble hélice (ayudadas por otras enzimas llamadas topoisomerasas, que relajan la tensión generada por delante de la horquilla). Tras la síntesis en ambas cadenas, otras enzimas eliminan los fragmentos de ARN que habían servido de cebadores, rellenan los huecos que quedan, y finalmente unas ligasas sellan los últimos enlaces fosfo-di-éster para obtener una cadena sin solución de continuidad.


CAPITULO 2

22

5/12/06

06:54

Página 22

El ADN en el núcleo de la célula eucariota

se consigue por modificaciones químicas de algunos aminoácidos de las histonas, que se distribuyen por igual desde los nucleosomas de la fibra original a los nucleosomas de las fibras recién formadas. En el caso de moléculas lineales de ADN, como los cromosomas, la replicación de los extremos terminales presenta un problema particular, puesto que el cebador de ARN localizado en el extremo de la cadena retrasada no puede ser reemplazado por ADN (como ocurre en la replicación normal). Por tanto, los cromosomas estarían sujetos a una degradación progresiva de sus extremos con cada división celular, y esto sería letal en células que se dividen muchas veces a lo largo de la vida de un individuo. Para evitar esto, los cromosomas de eucariotas tienen en sus extremos unas estructuras especiales, llamadas telómeros, que protegen los extremos libres y evitan la erosión asociada con la replicación. Estas estructuras están formadas por la repetición una pequeña secuencia que está repetida múltiples veces al final del extremo 3’ de una de las cadenas de la doble hélice, cadena que por tanto será más larga que la otra. Estas repeticiones, que en humanos están formadas por el hexanucleótido TTAGGG, son añadidas por la acción de un enzima denominado telomerasa, que consta de un componente ARN y de un componente enzimático con actividad polimerasa de ADN dependiente de ARN. Usando el componente ARN como molde, la telomerasa va añadiendo nuevas repeticiones TTAGGG al extremo 3’ de una de las cadenas del cromosoma. Esto posibilita que, durante la replicación, se sintetice el cebador de ARN sobre las repeticiones teloméricas y no se pierda material genético propio del cromosoma. Las repeticiones que se pierden por causa de la replicación, son después añadidas por acción de la telomerasa, lo que asegura la integridad de los cromosomas durante toda la vida de la célula. La Figura 2.7 incluye un vídeo que ilustra el problema de la replicación de los extremos y la acción de la telomerasa.

Una consecuencia importante de la replicación es que el contenido total de ADN de la célula se duplica antes de que los cromosomas se hagan visibles y se separen en la mitosis, como veremos a continuación. Esto es precisamente lo que hace que cada cromosoma, durante la mitosis, esté compuesto por dos cromátides hermanas pegadas. En este sentido, es importante evitar la confusión entre el número de cromosomas y el contenido total de ADN de una célula. El número haploide de cromosomas (número de cromosomas distintos, que es característico de cada especie) se representa por la letra n; una célula somática tiene un número diploide (2n) de cromosomas, ya que tiene dos copias de cada cromosoma (n parejas de cromosomas homólogos). Antes de entrar en la fase S, una célula somática tiene un número 2n de cromosomas (aunque no se ven en su forma típica, por estar la cromatina poco condensada) y un contenido total de ADN correspondiente a una cromátide por cromosoma: esto se representa por la cantidad de ADN 2C. Al final de la replicación del ADN, esa célula sigue teniendo 2n cromosomas (todavía invisibles) pero ahora tiene un contenido de ADN igual a 4C, ya que tenemos dos cromátides por cromosoma. Tras la mitosis, la segregación de las cromátides hermanas tiene como resultado que cada una de las células hijas lleva otra vez 2n cromosomas y un contenido de ADN

www.FreeLibros.me


CAPITULO 2

5/12/06

06:54

Página 23

igual a 2C. De este modo, se mantiene el número de cromosomas y la cantidad total de ADN tras las sucesivas divisiones celulares.

La cromatina es una estructura dinámica cuyo grado de empaquetamiento es máximo durante la mitosis, y por eso en esta fase del ciclo celular se puede ver en una forma especialmente condensada que da lugar a los cromosomas. Como hemos visto, esta condensación se produce porque la fibra de cromatina de 300 nm se enrolla en forma de espiral, proporcionando un grado de empaquetamiento unas cinco veces mayor al observado durante la interfase. La mitosis es el proceso de división de las células somáticas, fundamental en la proliferación celular que tiene lugar durante el desarrollo embrionario, el crecimiento y el mantenimiento de los tejidos. Supone una reorganización drástica de todos los componentes celulares, pero muy especialmente de los cromosomas, cuya segregación a cada una de las células hijas debe ser muy precisa y estar finamente regulada y coordinada con la separación física de las nuevas células (citoquinesis). Durante la mitosis, la maquinaria celular se especializa en llevar a cabo los distintos procesos que tienen lugar en la célula: condensación de la cromatina, formación del huso mitótico, segregación de los componentes y fisión celular. La primera fase de la mitosis (profase), comienza con la condensación de la cromatina, la ruptura de la envuelta nuclear y el desarrollo del huso mitótico. Es importante recordar que la cromatina ha sido replicada en la fase S de la interfase previa, por lo que cada cromosoma está ahora formado por dos cromátides hermanas. Los microtúbulos se unen a los quinetocoros, estructuras proteicas formadas sobre los centrómeros de cada cromosoma, y comienzan a transportar a los cromosomas hacia el plano ecuatorial del huso. En la fase siguiente (metafase) cada cromosoma está unido a microtúbulos procedentes de los dos polos de la célula, de modo que todos los cromosomas están en el ecuador del huso mitótico sometidos a fuerzas tensionales opuestas. Los mecanismos moleculares que regulan la cohesión de cromátides hermanas comienzan a conocerse cada vez mejor, y su implicación en patología humana está adquiriendo mayor relevancia. Por ejemplo, se han identificado las proteínas cromosómicas necesarias para mantener la cohesión de cromátides hermanas, que se denominan cohesinas. En eucariotas funcionan como cohesinas al menos cuatro miembros de la familia SMC (Structural Maintenance of Chromosomes), y en Xenopus (sapo) se ha identificado un complejo que es necesario para la cohesión y que está formado por SMC1 y SMC3 junto con SCC1 (Sister Chromatid Cohesion 1). La cohesión se establece en la fase S del ciclo celular, durante la replicación del ADN, aunque las cohesinas estaban ya presentes en la cromatina. Al replicarse el ADN, ambas cromátides quedan unidas por las cohesinas en toda su longitud, distinguiéndose dos tipos de cohesión: la cohesión en los centrómeros y la cohesión en los brazos cromosómicos. Ambos tipos de cohesión están mediados por cohesinas, pero los procesos que los regulan son algo diferentes. El mantenimiento de esta cohesión durante metafase es muy importante, porque es precisamente el balance entre las fuerzas de los microtúbulos y la cohesión de

www.FreeLibros.me

Formación y segregación de los cromosomas durante la mitosis

2.3 Formación y segregación de los cromosomas durante 2.3 la mitosis

23


CAPITULO 2

24

5/12/06

06:54

Página 24

El ADN en el núcleo de la célula eucariota

ambas cromátides lo que permite el alineamiento de los cromosomas en el plano ecuatorial: la tendencia de los microtúbulos a separar las cromátides se ve contrarrestada por la cohesión que las mantiene unidas, y gracias a esta cohesión se genera la tensión necesaria para formar la placa metafásica. Es precisamente la pérdida brusca de cohesión lo que permite la separación de las cromátides. Lógicamente, un componente fundamental en estos procesos es el quinetocoro, que en definitiva es el punto de cada cromosoma donde se anclan los microtúbulos. Existe en células eucariotas un sistema que comprueba que todos los quinetocoros estén unidos a microtúbulos y activa un punto de control que impide la separación de las cromátides antes de conseguir la perfecta unión de todos los quinetocoros a sus microtúbulos respectivos. La metafase va seguida por la anafase, en la que tiene lugar la segregación de las cromátides hermanas de cada cromosoma hacia polos opuestos de la célula. La separación simultánea de 46 pares de cromátides hermanas en la transición metafaseanafase es un momento crucial del ciclo celular, y por tanto está finamente regulado. Por ejemplo, es crítico que la cohesión se pierda en el momento adecuado, para que cada cromátide pueda migrar a una célula hija sin errores. En general, se observa que primero se pierde la cohesión en los centrómeros, y a medida que los microtúbulos van «tirando» de los quinetocoros se va perdiendo la cohesión en los brazos. La separación se lleva a cabo mediante la degradación de las cohesinas. La última fase de la mitosis es la telofase, en la que los cromosomas vuelven a descondensarse y se forma la envoltura nuclear alrededor de cada uno de los nuevos núcleos que se han formado en cada polo de la célula. Terminada la mitosis, el proceso de división celular se completará con la citoquinesis, en la que los componentes celulares se reordenan y se reorganiza el citoesqueleto para facilitar la divisón física de la célula en dos células hijas. La Figura 2.8 contiene un vídeo que ilustra las principales fases de la mitosis.

Dada la importancia de la separación de las cromátides hermanas en anafase, se ha investigado mucho en torno a su regulación. Se sabe que la degradación de las cohesinas se lleva a cabo por dos mecanismos distintos: fosforilación (mediada por la quinasa Polo) de algunos componentes, y proteolisis de otros. Las proteínas implicadas en la proteolisis de la cohesinas se llaman separinas (o separasas). Se ha comprobado que las separinas son capaces de romper el complejo cohesina porque degradan la proteína SCC1 (una cohesina) durante el comienzo de la anafase, permitiendo la separación de las cromátides por la fuerza que ejercen los microtúbulos. ¿Cómo se activan las separinas en el momento exacto de la anafase? Esto se ha resuelto gracias a la identificación de las securinas, proteínas que inhiben la acción proteolítica que ejercen las separinas sobre las cohesinas. Por tanto, durante la mitosis las securinas están unidas a las separinas y así inhiben su acción, de modo que el complejo cohesina permanece intacto y las cromátides permanecen unidas. La disociación de las cohesinas se produce por la degradación súbita de las securinas al comienzo de la anafase, de manera que las separinas quedan libres y pueden cortar por proteolisis el complejo cohesina. El evento crucial, por tanto, es la degradación de securinas, degradación que está mediada por un complejo proteico llamado APC (Anaphase Promoting Complex) que posee actividad ubiquitina-protein-ligasa y promueve

www.FreeLibros.me


CAPITULO 2

5/12/06

06:54

Página 25

En la Figura 2.9 se explica el mecanismo de degradación de las cohesinas.

2.4 Gametogénesis y meiosis En organismos de reproducción sexual, la formación de los gametos implica un modo de división celular diferente al de las células somáticas. Los gametos deberán poseer una sola copia de cada cromosoma, de modo que el cigoto resultante de la unión del gameto masculino y del gameto femenino en la fertilización sea diploide (con un cromosoma de origen paterno y otro cromosoma de origen materno en cada par cromosómico). Para obtener un número haploide (n) de cromosomas en los gametos, el proceso de formación de los mismos (gametogénesis) tiene unas características especiales. La principal peculiaridad es la existencia de un tipo distinto de división celular en el que una célula diploide (2n) replica su ADN una vez (duplicando su contenido total en ADN de 2C a 4C) pero experimenta dos divisiones cromosómicas; esto tiene como consecuencia que los gametos masculino (espermatozoide) y femenino (oocito) llevan un número haploide de cromosomas (n) y un contenido total de ADN igual a C (una cromátide por cromosoma). Este modo de división celular se denomina meiosis, y tiene además otras características muy importantes para la transmisión de la variabilidad genética. En ambas líneas germinales, masculina o femenina, la gametogénesis comienza cuando los gonocitos experimentan una serie de divisiones mitóticas típicas en las que las células van madurando hasta llegar a formar las gonias (espermatogonias u oogonias, respectivamente) y los gametocitos primarios, que son células diploides (2n). A partir de este momento, las células replican su ADN en la fase S y a continuación entran en meiosis, en vez de dividirse por mitosis. La meiosis incluye en realidad dos distintas divisiones cromosómicas, por lo que suele separarse en dos fases llamadas meiosis I (o primera división meiótica) y meiosis II (segunda división meiótica). La meiosis I es la más importante de las dos, y comienza con una profase larga, complicada y claramente distinta de la profase de la mitosis. Esta profase de la meiosis I (llamada, por tanto, profase I) comienza con la condensación de la cromatina que, no lo olvidemos, se había replicado en la fase S precedente. Ambas cromátides están íntimamente unidas formando un único filamento, que se une por sus extremos a la membrana nuclear. Esta primera parte de la profase I se llama leptoteno. En la siguiente etapa, llamada cigoteno, los cromosomas homólogos se emparejan longitudinalmente con gran exactitud, de manera que las secuencias de cada uno de los dos homólogos quedan perfectamente alineadas. La unión entre los cromosomas de cada par se hace progresivamente más fuerte, dando lugar a un fenómeno que se conoce como sinapsis. La sinapsis se mantiene gra-

www.FreeLibros.me

25

Gametogénesis y meiosis

la degradación de diversas proteínas al comienzo de la anafase. Lógicamente, estos procesos no deben comenzar hasta que todos los quinetocoros están correctamente unidos a los microtúbulos del huso, pues de lo contrario la segregación de las cromátides no sería correcta. Por tanto, existe también un mecanismo de señalización que detecta si todos los quinetocoros han sido correctamente unidos por microtúbulos y envía una señal de activación del APC, para que dé comienzo la pérdida de cohesión.


CAPITULO 2

5/12/06

06:54

Página 26

26

El ADN en el núcleo de la célula eucariota

GAMETOGÉNESIS Gametocitos Primarios 2n / 4C

Gametocitos Secundarios

n / 2C

Oocito Secundario

Espermatocitos Secundarios

Corpúsculo Polar Primario

Gametos

n/C

Espermatozoides

Óvulo

Corpúsculo Polar Secundario

En la Figura 2.10 se presenta un esquema de la gametogénesis.

cias a la formación del complejo sinaptonémico. La profase I continúa con la siguiente etapa, paquiteno, en la que los cromosomas se condensan todavía más y cada par de homólogos apacece como un bivalente (una estructura formada por dos cromosomas) o tétrada (por estar formada por cuatro cromátides). De todas formas, el evento más importante de la etapa de paquiteno es el intercambio de material genético entre cromosomas homólogos, a través del proceso de recombinación que estudiaremos más adelante. En la siguiente etapa, la de diploteno, desaparece el complejo sinaptonémico y los cromosomas homólogos comienzan a separarse. Recordemos que hasta este momento la célula es diploide (2n) con contenido 4C de ADN, al tener dos cromátides por cromosoma. Durante la separación de los cromosomas homólogos en diploteno, las dos cromátides de cada cromosoma permanecen todavía unidas entre sí. Sin embargo, debido al intercambio de material genético precedente, la separación pone de manifiesto los puntos en los que se produjo un sobrecruzamiento, ya que esas regiones forman «puentes» que mantienen unidos a los

www.FreeLibros.me


CAPITULO 2

5/12/06

06:54

Página 27

La Figura 2.11 incluye un vídeo en el que se muestran esquemáticamente las distintas fases de la meiosis.

www.FreeLibros.me

27

Gametogénesis y meiosis

dos homólogos de cada par e impiden la separación total. Estos puntos se denominan quiasmas, y han de resolverse de algún modo para que la separación de los cromosomas pueda completarse. Por tanto, la profase I termina con una etapa corta denominada diaquinesis, en la que la cromatina alcanza su grado máximo de condensación y los cromosomas aparecen más cortos y gruesos. Tras la profase I, los espermatocitos primarios entran ahora en metafase I, en la cual desaparece la membrana nuclear, se forma el huso y los microtúbulos traccionan por los quinetocoros. Esto hace que los bivalentes, que llevan los cromosomas parcialmente separados (unidos únicamente por los quiasmas), se orienten en el ecuador de la célula. Debido a esta configuración, los cromosomas homólogos se sitúan en la placa metafásica con los centrómeros apuntando cada uno hacia uno de los polos de la célula. En la anafase I, la tracción de los microtúbulos y la activación del Complejo Promotor de la Anafase permiten la separación total de cada cromosoma homólogo hacia uno de los polos, fenómeno llamado disyunción. Finalmente, en la telofase I se han formado ya dos grupos de cromosomas en cada polo de la célula: cada uno de estos grupos consta de un número haploide (n) de cromosomas, cada uno de los cuales posee dos cromátides (contenido total de ADN igual a 2C). La meiosis I termina con la citoquinesis, la división física de las dos células hijas. Esta última fase es diferente en la línea germinal masculina y femenina, porque así como las células hijas del espermatocito primario son iguales, en el caso de la línea femenina una de las dos células hijas se lleva casi todo el citoplasma mientras que la otra es mucho menor. Por tanto, en la espermatogénesis cada esperamatocito primario da lugar a dos espermatocitos secundarios, mientras en la oogénesis cada oocito primario da lugar a un oocito secundario y a un corpúsculo polar de primer orden. La segunda división meiótica, o meiosis II, es prácticamente igual a una mitosis. La única diferencia estriba en que la célula que se divide es haploide, mientras que en el caso de la mitosis la célula es diploide. Por tanto, esta división celular va a separar las dos cromátides que componen cada cromosoma de un gametocito secundario, para generar gametos con un número haploide de cromosomas (n), cada uno de los cuales está formado por una sola cromátide (contenido total de ADN igual a C). Como decíamos al principio, esto asegura que la fecundación da lugar a un cigoto diploide (2n) con contenido de ADN igual a 2C, al recibir un complemento cromosómico de cada gameto. El modo en que se completa la meiosis es también diferente en ambos sexos. Así como la espermatogénesis discurre de un modo continuo desde que se alcanza la madurez sexual, la oogénesis se detiene en profase I, de manera que un alto número de oocitos primarios permanecen en un estado prolongado de diploteno, llamado dictioteno. Estos oocitos sólo proseguirán su maduración al llegar la madurez sexual, cuando con cada ciclo menstrual un oocito culmina la meiosis I y completa también la meiosis II para dar un oocito secundario (óvulo) y un segundo corpúsculo polar.


CAPITULO 2

28

5/12/06

06:54

Página 28

El ADN en el núcleo de la célula eucariota

Es importante fijarse en un hecho distintivo de la anafase de la meiosis I, que no comparten ni la anafase de la meiosis II ni la anafase de la mitosis. Este hecho consiste en que los cromosomas homólogos se separan pero, al mismo tiempo, las dos cromátides de cada cromosoma, por la acción de unas moléculas llamadas shugoshinas, deben permanecer unidas por los centrómeros. Esto se consigue porque las cohesinas centroméricas no son degradadas por las separasas. Las shugoshinas se unen específicamente a los centrómeros y, por su asociación con una fosfatasa, impiden la fosforilación de las cohesinas a ese nivel, lo cual a su vez impide que las cohesinas sean degradadas por las separasas. Después, en la meiosis II, la ausencia de shugoshinas permite una segunda ola de activación de separasas que finalmente llevará a la separación completa de las dos cromátides de cada cromosoma homólogo. Al margen de lo dicho en relación con la reducción del número total de cromosomas en los gametos, la gran importancia de la meiosis reside en que es uno de los principales mecanismos de creación de variabilidad genética. Esto sucede a dos niveles, primero por la segregación aleatoria de los cromosomas de cada progenitor a los gametos, y en segundo lugar por el intercambio de material genético que tiene lugar durante los procesos de recombinación. Respecto a lo primero, es fácil comprender que cada división meiótica producirá gametos con distintas combinaciones de los cromosomas que estaban en la célula diploide original, ya que la segregación se produce al azar. Para entender esto es útil imaginarse todos los cromosomas de una célula diploide como la suma de dos conjuntos haploides, el paterno y el materno. Así, cada pareja de cromosomas homólogos consta de un homólogo de origen paterno y otro de origen materno. Cuando los homólogos se separan en la meiosis, no pasan todos los de origen paterno a una de las células hijas, y todos los de origen materno a la otra; por el contrario, se distribuyen aleatoriamente. Como los homólogos pueden tener pequeñas diferencias en los alelos presentes para algunos genes, el resultado es que cada gameto lleva una combinación única de cromosomas de origen paterno y materno mezclados. La variabilidad que se puede generar por este sencillo mecanismo es altísima, porque con 23 parejas de cromosomas el número de combinaciones posibles es igual a 223, o lo que es lo mismo 8.388.608. Por lo que respecta al segundo tipo de variabilidad introducida durante la meiosis, en la especie humana se ha calculado que se producen unos 55 sobrecruzamientos por célula, porque ese es el número medio de quiasmas que se observan. Esto supone una media de al menos dos sobrecruzamientos por par cromosómico, incluidos los cromosomas sexuales. La presencia de estos quiasmas es importante para mantener los bivalentes unidos hasta anafase I, y asegurar que la disyunción se produce de modo correcto. Pero además, es probable que el número total de eventos de recombinación sea todavía mayor al número de quiasmas, porque no todas las recombinaciones producen un sobrecruzamiento (como se verá en el apartado siguiente). Por tanto, el grado de intercambio de material genético entre cromátides de cromosomas homólogos es bastante alto, y hace que los cromosomas que finalmente llegan a un gameto sean ligeramente distintos a los cromosomas que estaban presentes en la célula inicial. Como resultado de esto, la variabilidad genética generada durante la meiosis es alta, y por eso la probabilidad de que dos individuos tengan dos descendientes genéticamente idénticos es prácticamente nula. Esto es precisamente lo que persigue la reproducción sexual: generar descendientes distintos a sus progenitores y distintos entre sí.

www.FreeLibros.me


CAPITULO 2

5/12/06

06:54

Página 29

2.5 Recombinación a nivel molecular

29

Uno de los temas más importantes en genética es la caracterización de los mecanismos moleculares por los que se produce intercambio de material genético entre cromátides durante la meiosis. Distintos modelos han intentado explicar cómo dos moléculas de ADN homólogas pueden entrecruzarse e intercambiar material genético. El paso inicial común a todos los modelos propuestos es el alineamiento preciso de ambas moléculas, precisamente debido a que son cadenas de ADN homólogas, es decir, pertenecientes a cromosomas homólogos y por tanto con la misma secuencia de nucleótidos. En realidad, hoy sabemos que ambas moléculas no son absolutamente idénticas, ya que pueden existir diferencias alélicas en su secuencia (por ejemplo, pequeñas diferencias de un nucleótido). En cualquier caso, el alineamiento de dos secuencias homólogas es un requisito imprescindible para que se inicie el proceso de recombinación, que se denomina por eso recombinación homóloga. Dicho alineamiento, como es lógico, se produce durante la profase I de la meiosis merced al complejo sinaptonémico que mantiene estrechamente unidos los cromosomas homólogos en toda su longitud. Es lógico pensar que dicha configuración permite que dos moléculas de ADN de secuencia homóloga se mantengan en contacto. Los primeros modelos de recombinación proponían que, tras el alineamiento, ambas moléculas de ADN sufren una mella en una de sus cadenas, exactamente en la misma posición, y esto deja dos cadenas «libres» que se intercambian entre sí y se unen a la molécula homóloga por complementariedad de bases. Dado que la generación de dos mellas simultáneas en la misma posición es un evento muy improbable, Meselson y Radding propusieron otro modelo en el que una sola mella en una de las dos moléculas es suficiente para iniciar el proceso de recombinación, ya que la cadena libre puede invadir la doble hélice homóloga. Los estudios llevados a cabo en distintas especies de eucariotas en los últimos años han demostrado que la recombinación se inicia por la aparición de una rotura completa de una de las dos moléculas homólogas, es decir, una rotura bi-catenaria (de las dos cadenas de una doble hélice). Dichas lesiones, llamadas DSB (Double-Strand Break, en inglés), se generan con cierta frecuencia en el ADN celular en respuesta a diversas causas; parece comprobado que la creación específica de un DSB durante profase I es el proceso iniciador de la recombinación. Según el modelo actual de recombinación homóloga, en este proceso intervienen una serie de complejos proteicos:

Recombinación a nivel molecular

• • •

Complejo RAD50, formado por las moléclulas MRE11, RAD50 y NBS1. El complejo RAD52, que incluye varios componentes (RAD51, RAD52, RAD54, RAD55 y RAD57 entre otros). La molécula RPA (la misma proteína A de la replicación).

Tras la creación de un DSB, los extremos libres son procesados mediante la actividad exonucleasa del complejo RAD50, que actúa en dirección 5’→3’ y, por tanto, genera extremos libres más largos en la hebra 3’. Este extremo protruyente se recubre de RPA, RAD51 y otras moléculas del complejo RAD52 para formar un filamento nucleo-proteico. Este filamento tiene la capacidad de invadir la doble hebra homóloga, abriendo en ella una burbuja, y se empareja a la cadena complementaria que

www.FreeLibros.me


CAPITULO 2

30

5/12/06

06:54

Página 30

El ADN en el núcleo de la célula eucariota

discurre en dirección antiparalela. A partir de este extremo 3’ se extiende la cadena usando la hebra complementaria como molde, al tiempo que se extiende también el otro extremo que había quedado libre. Tras una corta extensión, los extremos libres se unen por acción de una ligasa y esto genera dos estructuras en las que una hebra salta de una molécula de ADN a la molécula homóloga. Dichas estructuras se denominan estructuras de Holliday, que fue el primero en proponer su existencia. Es importante tener en cuenta que si las dos moléculas de ADN no son inicialmente idénticas en su secuencia, durante el proceso de recombinación se pueden formar moléculas híbridas, en las que ambas cadenas no son idénticas. Dichas moléculas de ADN se llaman heteroduplex, y son muy importantes porque los desemparejamientos son corregidos por un mecanismo de reparación que se estudiará en otro capítulo; dicha corrección hace que una de las dos cadenas se modifique para hacerse perfectamente complementaria a la otra, en un proceso llamado conversión génica. Como veremos en otras partes de este texto, la conversión génica es un mecanismo que da lugar a varias enfermedades genéticas en humanos. Las estructuras de Holliday dan lugar unas estructuras cruciformes formadas por dos moléculas de ADN, llamadas también estructuras chi, que han de resolverse de algún modo para permitir la separación de las dos cromátides. La resolución de las estructuras de Holliday puede hacerse según un plano vertical o según un plano horizontal, y es precisamente el tipo de resolución que se lleva a cabo lo que determina el tipo de moléculas que se generan. Por ejemplo, si las dos estructuras de Holliday se resuelven según el mismo plano, las moléculas resultantes van a dar lugar a un sobrecruzamiento (la configuración que da lugar a los quiasmas que se ven en la meiosis); en cambio, cuando las dos estructuras de Holliday se resuelven según planos distintos se producirá recombinación sin sobrecruzamiento. A su vez, cada una de estas dos posibilidades puede darse con o sin conversión génica, dependiendo de la presencia de heteroduplex y del modo en que se reparan. Curiosamente, el modelo de recombinación iniciado por una rotura bicatenaria en una cadena es fruto de los estudios de reparación de este tipo de lesiones en eucariotas. Como veremos en otro capítulo, las roturas bicatenarias son un tipo frecuente de agresión al ADN, y son reparados en células somáticas precisamente por un mecanismo de recombinación homóloga que tiene lugar durante la fase S del ciclo celular. En los últimos años se ha visto que este mismo mecanismo explica también las predicciones acerca de la recombinación durante la meiosis, y que de hecho la maquinaria proteica responsable es básicamente la misma. Por tanto, hoy en día se considera como un mismo mecanismo que se ha adaptado a dos funciones celulares importantes como la reparación del ADN y la generación de variabilidad genética durante la formación de los gametos. Más recientemente, se ha sugerido que la recombinación homóloga también puede tener otra función importante: la reiniciación de la replicación del ADN. A menudo, la horquilla de replicación se para prematuramente durante la síntesis de ADN y toda la maquinaria replicativa se desensambla; antes se pensaba que estas horquillas interrumpidas se reinician por el ensamblaje de un nuevo complejo de replicación en ese punto, pero cada vez hay más datos a favor de la hipótesis de que la replicación se reinicia en esas horquillas por un fenómeno de recombinación homóloga. Dicha recombinación podría darse entre las dos cromátides hermanas idénticas (la cromátide con la horquilla interrumpida y

www.FreeLibros.me


CAPITULO 2

5/12/06

06:54

Página 31

31 T

G

A

G

G

C

C

h/h

v

h/v

C

T

C

T

G

A

G

A

G

G

G

G

C

C

C

C

NO sobrecruzamiento

SI conversión NO conversión

SI sobrecruzamiento

La Figura 2.12 muestra esquemáticamente el modelo de recombinación iniciado por una rotura bicatenaria en uno de los cromosomas homólogos, así como la resolución de las estructuras de Holliday y los posibles resultados de los procesos de recombinación.

la que se ha originado por la replicación hasta ese punto), que sería lo normal, o bien puede darse entre cromátides de cromosomas homólogos, en cuyo caso se originaría un fenómeno de recombinación homóloga con posible sobrecruzamiento. De hecho, algunos autores han sugerido que, originalmente, la principal función del mecanismo de recombinación fue precisamente la reparación de horquillas de replicación interrumpidas.

www.FreeLibros.me

Recombinación a nivel molecular

h

C


CAPITULO 2

5/12/06

06:54

Pรกgina 31

www.FreeLibros.me


CAPITULO 3

5/12/06

07:02

Página 33

CAPÍTULO 3

Técnicas básicas de genética molecular

Contenidos 3.1 Tecnología del ADN recombinante: métodos y usos más frecuentes 3.2 Enzimas de restricción 3.3 Técnicas básicas de hibridación de ácidos nucleicos. 3.4 Amplificación in vitro de ADN (PCR) 3.5 Secuenciación del ADN 3.6 Microarrays.

3.1 Tecnología del ADN recombinante: métodos y usos 3.1 más frecuentes A principios de los años 1970 se desarrollaron una serie de técnicas que dieron lugar a lo que se llamó «ingeniería genética», «clonación molecular» o «tecnología del ADN recombinante». Básicamente, esta tecnología nació como respuesta a la necesidad de obtener grandes cantidades de un gen o genes, o incluso genomas completos, para poder llevar a cabo los estudios que permitiesen obtener la secuencia de nucleótidos de un gen concreto, estudiar sus mutaciones, analizar su función, etc. El nombre de clonación molecular sugiere precisamente la idea de un número grande de copias idénticas, y se utilizaba ya en biología para designar poblaciones de bacterias o células idénticas («clones»). Al aplicarlo a la obtención de copias idénticas de un ácido nucleico, se convirtió en clonación molecular. El primer experimento que mostró la posibilidad de propagar un fragmento de ADN de eucariotas en una bacteria fue la clonación de fragmentos del ADN ribosomal de Xenopus laevis dentro de la bacteria E. coli. Desde entonces, la tecnología del

www.FreeLibros.me


CAPITULO 3

34

5/12/06

07:02

Página 34

Técnicas básicas de genética molecular

ADN recombinante se ha utilizado con éxito en muchos campos, desde aplicaciones con fines industriales (dando lugar a la Biotecnología), hasta la detección de alteraciones genéticas, pasando por la modificación genética de organismos, la terapia génica y un largo etcétera. En este capítulo recordaremos los principios generales de las técnicas básicas de biología molecular; otras tecnologías más específicas utilizadas en Genética Humana, como el diagnóstico molecular de alteraciones genéticas o la terapia génica, se verán con más detalle en los capítulos correspondientes. En líneas generales, la obtención de grandes cantidades de un fragmento específico de ADN (es decir, de un gran número de copias idénticas) se lleva a cabo en varios pasos: i) obtención de un pequeño número de copias de dicho fragmento, habitualmente mediante la digestión del ADN celular con algún enzima que corte específicamente el genoma en el punto deseado; ii) la inserción de esas copias en un «vector de clonación», que es un fragmento de ADN con unas propiedades especiales que le permiten multiplicarse dentro de un huésped apropiado; iii) la propagación del nuevo fragmento «recombinante» (es decir, el fragmento híbrido formado por la unión del inserto y el vector) dentro del huésped, obteniendo un gran número de copias del mismo. Esta metodología puede también aplicarse a genomas completos, de forma que es posible cortar un genoma en pequeños fragmentos y clonar cada uno de esos fragmentos por separado; la colección completa de clones que representan un genoma se denomina genoteca (o biblioteca genómica). Aunque las genotecas pueden representar genomas completos, también es habitual crear genotecas de fragmentos genómicos (un cromosoma, por ejemplo, o una región cromosómica de interés) cuando no sea posible clonar ese fragmento debido a su gran tamaño. También es posible construir genotecas especializadas, en las que los fragmentos insertados en los vectores tienen una naturaleza específica; por ejemplo, son muy comunes las genotecas de ADNc, en las que cada clon lleva un ADN complementario (una copia en ADN de un ARN mensajero). Figura 3.1. Estrategia general de clonación molecular de un fragmento de ADN en un vector para su propagación en bacterias.

Por tanto, en toda estrategia de clonación molecular son necesarios tres elementos básicos: un inserto, un vector y un huésped. Como hemos dicho, el inserto es el fragmento de ADN que queremos obtener en grandes cantidades, para después proceder a estudiarlo. Por lo que respecta al huésped, lo más habitual es que se trate de alguna cepa de la bacteria Escherichia coli, especialmente modificada para permitir el crecimiento de vectores con gran eficacia y fidelidad. Respecto a los vectores de clonación, existe una gran variedad de posibilidades, cada una con características distintas que los hacen adecuados para aplicaciones concretas. Los primeros vectores utilizados fueron los plásmidos, que son elementos bacterianos extracromosómicos, circulares, que se replican dentro de la bacteria huésped con independencia de la replicación del cromosoma bacteriano. Los plásmidos utilizados en clonación molecular son variaciones de plásmidos nativos, que han sido modificados con el objeto de conseguir que se repliquen con mayor eficacia (hasta cientos de copias por bacteria). Además, también se ha creado en ellos una región que se puede cortar fácilmente con enzimas de restricción (ver más adelante) para introducir en ella el fragmento de ADN de interés (es decir, el inserto). También se ha introducido en ellos el gen de resistencia a algún antibiótico, que permita se-

www.FreeLibros.me


CAPITULO 3

5/12/06

07:02

Página 35

www.FreeLibros.me

35

Tecnología del ADN recombinante: métodos y usos más frecuentes

leccionar las bacterias que llevan el plásmido dentro: cuando al cultivo en el que crecen las bacterias se añade el antibiótico, sólo crecerán aquellas que tienen el plásmido y expresan los genes del mismo. Los plásmidos tienen una capacidad limitada, ya que permiten albergar insertos de unas 5-10 kilobases de tamaño, como máximo. La necesidad de clonar fragmentos de mayor tamaño hizo que se desarrollasen otros tipos de vectores derivados del genoma del fago lambda, un virus bacteriófago que infecta bacterias introduciendo en ellas el genoma viral. Modificando el genoma nativo del fago lambda, se han creado diversos vectores de clonación con una capacidad mayor que la de los plásmidos (permiten albergar insertos de tamaños en torno a las 15 kilobases), que también se replican en bacterias con gran eficacia. La necesidad de clonar fragmentos todavía mayores llevó a desarrollar otros tipos de vectores. Por ejemplo, los cósmidos son vectores artificiales con características de plásmidos y de fagos, y tienen una capacidad de unas 40 kilobases. Posteriormente aparecieron vectores derivados de los cromosomas de levaduras, incluyendo secuencias necesarias para la replicación y la estabilidad de los brazos cromosómicos. Estos vectores se denominan Cromosomas Artificiales de Levaduras (en inglés YAC, Yeast Artificial Chromosome), crecen dentro de levaduras y tienen una gran capacidad porque pueden albergar insertos de hasta dos megabases (2 × 106 pares de bases). Como veremos más adelante, los vectores tipo YAC fueron muy importantes para crear los primeros mapas del genoma humano, pero tienen algunos inconvenientes en su manejo ya que los insertos a veces sufren alteraciones a medida que se multiplican dentro de las levaduras. Por tanto, se desarrollaron otros vectores con menos capacidad pero mucho más estables y de manejo más fácil, como son los vectores derivados del fago P1 o del mismo cromosoma bacteriano. Estos vectores se denominan, respectivamente PAC (del inglés, P1-phage Artificial Chromosome) y BAC (Bacterial Artificial Chromosome); crecen también dentro de bacterias y son capaces de albergar insertos de tamaños entre 100-150 kilobases. Aunque existen muchos otros tipos de vectores que se utilizan en técnicas de clonación molecular, estos son los más usados en Genética humana, y aparecerán en otros capítulos de este texto. El proceso general de clonación molecular se desarrolla en varios pasos. En primer lugar, es necesario preparar el inserto y el vector de modo adecuado. Esto supone cortarlos de modo que los extremos libres del inserto puedan unirse a los extremos del vector. De hecho, como los vectores suelen ser circulares es necesario abrirlos en un lugar específico en el que introducir el inserto. Todos estos cortes se llevan a cabo con unas enzimas especiales llamadas enzimas de restricción, cuya característica principal es precisamente la capacidad de cortar el ADN en regiones específicas. Debido a la importancia de las enzimas de restricción en ingeniería genética, les dedicaremos el siguiente apartado de este capítulo; por ahora, es suficiente comprender que constituyen las «tijeras» moleculares que nos permiten realizar cortes específicos en el inserto y en el vector para que ambos tengan extremos compatibles que se puedan unir. El siguiente paso es, precisamente, la unión de inserto y vector para formar la molécula «recombinante» o híbrida. Esta unión la realiza un enzima denominada ADN ligasa, habitualmente procedente del fago T4. Este enzima tiene la capacidad de catalizar la formación de enlaces fosfo-di-éster entre el grupo 5’ fosfato y el grupo 3’ hidroxilo de dos cadenas nucleotídicas yuxtapuestas, y por tanto puede unir dos moléculas de ADN bicatenario cuyos extremos sean compatibles. Tras la reacción de ligación se obtiene una molécula circular de ADN conteniendo el inserto dentro del


CAPITULO 3

36

5/12/06

07:02

Página 36

Técnicas básicas de genética molecular

vector, y capaz de replicarse dentro de un huésped apropiado merced a las secuencias específicas del vector. Por tanto, el siguiente paso del proceso de clonación molecular consiste en la introducción de la molécula recombinante en el huésped, habitualmente E. coli. Este proceso se denomina transformación, y puede hacerse por métodos químicos o físicos. El método químico más empleado es el «golpe de calor» en una solución de cloruro de calcio, tras el cual las bacterias son capaces de permitir el acceso de moléculas de ADN a su interior. Este proceso es muy ineficaz, ya que sólo una bacteria de cada 500 o cada 1000 incorporará la molécula de ADN recombinante con éxito; sin embargo, las bacterias se multiplican varios órdenes de magnitud cuando crecen en cultivo, por lo que en teoría basta que la transformación sea eficaz en tan sólo unas pocas bacterias para que podamos crecerlas en condiciones de selección (utilizando antibióticos específicos dependiendo del tipo de vector que usemos) y obtener una población en la que todas las bacterias contienen la molécula de ADN recombinante. Los métodos físicos son más eficaces que los químicos, y se basan en la apertura de poros en la pared bacteriana mediante la aplicación de un shock eléctrico, por lo que la técnica se denomina electroporación. Al final del proceso, por tanto, contamos con una población bacteriana compuesta por millones de bacterias, cada una de las cuales lleva varios cientos de copias de una molécula recombinante que contiene un fragmento específico de ADN (el inserto original). Utilizando métodos sencillos de extracción de ADN de las bacterias, es posible obtener preparaciones muy puras que contienen millones de copias del fragmento, y esto nos permite llevar a cabo cualquier tipo de análisis o de estudios funcionales.

ADN GENÓMICO

GENOTECA La Figura 3.2 incluye enlaces a animaciones que muestran el proceso de transformación y la obtención de alto número de copias de moléculas recombinantes.

www.FreeLibros.me


CAPITULO 3

5/12/06

07:02

Página 37

3.2 Enzimas de restricción

37

En los años 1950 se descubrió que algunos bacteriófagos (virus que infectan y destruyen bacterias) podían infectar algún tipo concreto de bacterias pero no otros, debido a que algunas bacterias eran capaces de digerir el ADN del fago y por tanto impedían su crecimiento. Como el fago ve «restringido» el rango de huéspedes que puede infectar, a dicho sistema se le llamó sistema de restricción. Posteriormente se descubrió que dicha restricción se lleva a cabo gracias a unas enzimas del tipo endonucleasas, que digieren el ADN de doble cadena tras el reconocimiento y unión a secuencias específicas en el genoma «invasor». Por tanto, dichas enzimas reciben el nombre genérico de enzimas de restricción. Las enzimas de restricción tienen gran importancia para la supervivencia de las bacterias, y por ello son muy abundantes y aparecen en todos los géneros de bacterias que se han estudiado. El descubrimiento de las primeras enzimas de restricción de tipo II en los años 1970 fue clave para el desarrollo de las tecnologías del ADN recombinante. Las enzimas de restricción se clasifican en tres tipos: tipo I, tipo II y tipo III. Las enzimas de tipo I y las de tipo III son complejos multiproteicos que reconocen secuencias específicas de ADN asimétricas, y digieren al ADN en otra región inespecífica alejada de la secuencia de reconocimiento, bastante alejadas en el caso de las tipo I (desde 50 hasta varios miles de pares de bases) o menos alejadas en el caso de las tipo III (unos 25 pares de bases). De todas formas, las enzimas de restricción de interés en ingeniería genética son las de tipo II, que están codificadas por un único gen bacteriano y que suelen actuar en forma de dímeros. Su característica principal es que el corte endonucleolítico tiene lugar dentro de la misma secuencia de reconocimiento por la que se unen al ADN, llamadas también «dianas» o «sitios» de restricción. Hoy en día se conocen más de 3 000 endonucleasas de restricción de tipo II, que reconocen más de 200 dianas distintas. Las enzimas que reconocen la misma diana pero proceden de bacterias distintas se denominan isosquizómeros; es importante conocer su existencia para no confundir endonucleasas que tienen la misma secuencia de reconocimiento. En este sentido, es importante conocer la nomenclatura de estas enzimas, que depende del nombre de la cepa bacteriana de la que se aíslan. Por ejemplo, las enzimas de restricción purificadas a partir de Escherichia coli se denominan «EcoXX»: las tres primeras letras (en cursiva) designan la especie, y uno o más caracteres en mayúscula (letras o numeros romanos, nunca en cursiva) designan la cepa o distinguen varias enzimas de una misma bacteria. Por lo general, las dianas de reconocimiento de las enzimas tipo II tienen una longitud de cuatro a ocho pares de bases. Lógicamente, el número de posibles sitios de corte para una endonucleasa de restricción varía inversamente a la longitud de la diana de reconocimiento, ya que por azar es más fácil encontrar secuencias de cuatro nucleótidos que de ocho, por poner un ejemplo. Esto es importante a la hora de predecir si un enzima concreto presentará muchas o pocas dianas en un fragmento de ADN. Una característica importante de las enzimas de tipo II es que las secuencias de reconocimiento son idénticas cuando se leen en dirección 5’→3’ en cada una de las dos cadenas de la doble hélice. Es decir, las dianas de reconocimiento de las enzimas tipo II son secuencias palindrómicas. Existen algunas excepciones a esta regla general, sobre todo cuando las dianas de reconocimiento tienen alguna posición degenerada, es decir, que puede ser ocupada por dos o más nucleótidos indistintamente.

Enzimas de restricción

www.FreeLibros.me


CAPITULO 3

38

5/12/06

07:02

Página 38

Técnicas básicas de genética molecular

Finalmente, una característica común a la mayoría de las enzimas tipo II es que cortan la cadena de ADN dentro de la secuencia de reconocimiento. Dependiendo del sitio exacto donde corten, los extremos libres generados por el corte pueden ser de varios tipos. En primer lugar, si la secuencia de reconocimiento está constituida por un número par de nucleótidos y el corte se produce exactamente en el centro, los extremos serán «romos», es decir, las dos cadenas de la molécula de ADN tendrán la misma longitud. En cambio, en otras enzimas el punto de corte está desplazado respecto del eje de simetría de la secuencia de reconocimiento; dada la naturaleza palindrómica de dicha secuencia, esto genera extremos libres en los que una de las dos cadenas de la doble hélice es más larga que la otra, que se denominan extremos cohesivos. En las enzimas que generan extremos cohesivos, se distinguen además dos tipos según cuál de las dos cadenas de la molécula de ADN es más larga, la cadena 5’ o la 3’; así se habla de extremos cohesivos con «salientes» 5’ o 3’, respectivamente. El tipo de extremos que genera cada enzima es un factor importante en los experimentos de clonación molecular, porque las ligasan sólo pueden unir extremos que sean compatibles, y además los extremos cohesivos habitualmente son ligados con mucha mejor eficacia que los extremos romos.

AluI NlaIII Sau3AI TCGACAGCTGACGCATGTATAGCTAGCGATCTAGC ||||||||||||||||||||||||||||||||||| AGCTGTCGACTGCGTACATATCGATCG CTAGATCG

5’…GACAG CTGAC… ||||| ||||| …CTGTC GACTG…

5’…AGC GATCTAG… ||| ||| …TCGCTAG ATC…

5’

Extremos romos

5’

Extremos cohesivos (salientes 5’)

5’…ACGCATG TAT… ||| ||| …TGC GTACATA…

5’

Extremos cohesivos (salientes 3’)

En la Figura 3.3 se muestran ejemplos de dianas de restricción con extremos romos y cohesivos, así como una animación del proceso de corte.

3.3 Técnicas básicas de hibridación de ácidos nucleicos El desarrollo del concepto de hibridación entre moléculas de ácidos nucleicos ha tenido gran importancia en el desarrollo de la ingeniería genética, como veremos al ha-

www.FreeLibros.me


CAPITULO 3

5/12/06

07:02

Página 39

www.FreeLibros.me

39

Técnicas básicas de hibridación de ácidos nucleicos

blar de algunas técnicas concretas en otros apartados de este capítulo. En sentido general, hibridación se refiere al proceso por el que dos cadenas de ácidos nucleicos que son complementarias se unen para dar una molécula bicatenaria. Las cadenas originales pueden ser de ADN o de ARN, de modo que la hibridación puede ser ADN-ADN o ADN-ARN (es más infrecuente trabajar con dobles cadenas de ARN). La hibridación es un proceso con una cinética que se puede estudiar por las curvas de desnaturalización del ADN. Cuando una doble hélice se desnaturaliza hasta la separación completa de ambas cadenas y se retiran las condiciones desnaturalizantes, las cadenas vuelven a reasociarse buscando las regiones complementarias: a mayor número de nucleótidos complementarios, la renaturalización es más rápida (y la desnaturalización más difícil). Como hemos visto, la desnaturalización se realiza habitualmente por calor; si medimos el porcentaje de moléculas desnaturalizadas a medida que aumentan la temperatura, obtenemos una curva sigmoidea que permite calcular la temperatura a la cual el 50 por ciento de las moléculas están desnaturalizadas. Dicha temperatura se conoce como temperatura de fusión, abreviada Tm (de melting en inglés). Un fragmento de ADN tendrá una Tm característica que dependerá de su tamaño y de la composición de bases: como los pares entre citosina y guanina forman tres puentes de hidrógeno frente a los dos que forman los pares adenina-timina, un fragmento con muchos pares G:C será más estable y más difícil de desnaturalizar, por lo que su Tm será más alta que la de un fragmento rico en pares A:T. Estas propiedades de desnaturalización e hibridación de dobles hélices de ADN han sido explotadas para desarrollar métodos de laboratorio que permitan identificar la naturaleza de fragmentos de ácidos nucleicos en mezclas complejas. Por ejemplo, la digestión de ADN celular total con un enzima de restricción produce miles de fragmentos de distintos tamaños en el tubo de reacción; en esas circunstancias, es posible identificar cuál de esos fragmentos es portador de una secuencia específica utilizando técnicas de hibridación. Para ello, se añade a la mezcla otro pequeño fragmento de ADN que represente la región que queremos identificar, se desnaturalizan todos los fragmentos y se dejan hibridar libremente. La mayor parte de las cadenas complementarias se reasociarán para reconstruir los fragmentos originales; en cambio, la presencia de pequeñas cadenas que son perfectamente complementarias con una región de un fragmento grande permitirá la formación de híbridos entre la cadena pequeña y la correspondiente cadena larga complementaria. De hecho, esta reacción se ve favorecida respecto de la reasociación de cadenas largas entre sí, precisamente porque los fragmentos pequeños hibridan más rápidamente. Por tanto, un pequeño fragmento de ADN es capaz de identificar los fragmentos de una mezcla compleja que contienen secuencias complementarias al mismo. Por este motivo, estos pequeños fragmentos se denominan sondas (probe en inglés), y suelen estar constituidas por moléculas de ADN de varios cientos de pares de bases. De todas formas, en un tubo de ensayo no se ven las moléculas de ADN, por lo que una sonda de ADN no será de gran utilidad si no es fácilmente detectable. Por este motivo, las sondas utilizadas en biología molecular llevan algún tipo de marcaje que permita detectar su presencia: marcaje con algún isótopo radioactivo, con un fluorocromo o con una molécula con actividad enzimática detectable por alguna reacción química. La utilización de sondas de ADN marcadas ha sido uno de los pilares básicos de la ingeniería genética en los últimos decenios, y su utilización sigue estando


CAPITULO 3

40

5/12/06

07:02

Página 40

muy extendida; de hecho, algunas de las tecnologías más recientes, como los microarrays de ADN, se basan todavía en la hibridación de sondas con fragmentos «diana».

Técnicas básicas de genética molecular

La Figura 3.4 muestra el proceso de hibridación de una sonda sobre una molécula complementaria de ADN.

Aunque los fenómenos de hibridación se dan en solución, la utilización más habitual de sondas de ADN es la detección de fragmentos de ácidos nucleicos que han sido previamente inmovilizados sobre un soporte sólido. El ejemplo más sencillo es la detección de un fragmento específico de ADN celular que ha sido digerido con un enzima de restricción. La separación de los fragmentos generados por la digestión puede hacerse fácilmente mediante electroforesis en gel de agarosa o de acrilamida, sustancias porosas en las que la velocidad de migración electroforética varía en función del tamaño de los fragmentos. Una vez que los fragmentos han sido separados, el uso de una sonda marcada nos permitirá detectar el fragmento o fragmentos que contienen la secuencia de la sonda, ya que ésta hibridará específicamente en esas regiones. Para llevar a cabo de modo sencillo la reacción de hibridación entre la sonda y los fragmentos digeridos que se han separado en el gel, Edwin Southern ideó un método sencillo para transferir todos los fragmentos del gel a un soporte sólido de nitrocelulosa o de nylon, más resistente y fácilmente manejable que un gel. La transferencia crea una réplica del gel en el soporte sólido (llamado filtro, por utilizarse inicialmente papel de filtro), ya que mantiene la posición relativa que tenían los fragmentos en el gel. Tomando nombre de su creador, la transferencia de fragmentos de ADN de un gel a un filtro se denomina transferencia southern; cuando los fragmentos son de ARN, en vez de ADN, las condiciones en que se realiza la transferencia cambian un poco, y se denomina transferencia northern (juego de palabras con Southern, que significa «sureño»; northern es «norteño»). Posteriormente, esta técnica también se aplicó a las proteínas, tomando entonces el nombre de transferencia western («occidental»). La Figura 3.5 ilustra el proceso de electroforesis en gel de agarosa, así como la transferencia de fragmentos a una membrana rígida.

Los métodos de transferencia de ácidos nucleicos a soporte sólido junto con la hibridación con sondas marcadas han sido y siguen siendo muy utilizados en biología molecular. Estos mismos principios se han combinado también con las técnicas clásicas de citogenética para el estudio de cromosomas, dando lugar a las técnicas de citogenética molecular que veremos en un capítulo posterior. Otras aplicaciones de estas técnicas al diagnóstico de alteraciones genéticas en Genética humana serán abordadas en los capítulos correspondientes.

3.4 Amplificación in vitro de ADN (PCR) Aunque las técnicas de clonación molecular proporcionan altas cantidades de un fragmento de ADN, son técnicas laboriosas, con incubaciones largas: un experimen-

www.FreeLibros.me


CAPITULO 3

5/12/06

07:02

Página 41

El vídeo de la Figura 3.6 muestra la desnaturalización, unión y extensión de un cebador sobre una región específica de ADN.

www.FreeLibros.me

41

Amplificación in vitro de ADN (PCR)

to típico de clonaje lleva unos dos días. Hacia finales de los años 1980 se describió una metodología nueva que permitía amplificar selectivamente una región concreta de ADN, de modo que partiendo de cantidades iniciales pequeñísimas (teóricamente, una sola copia del fragmento) podrían obtenerse varios miles de millones de copias. El método se desarrolla en un periodo de pocas horas y no incluye ningún paso de digestión, ligación ni transformación, sino que se basa en la acción cíclica de una polimerasa de ADN que amplifica selectivamente la región de interés y ninguna otra. Por este motivo, el método se conoce como reacción en cadena de la polimerasa (abreviado PCR, en inglés Polymerase Chain Reaction). El punto central de la técnica de PCR es la síntesis de ADN desde un punto concreto, repetida durante un número elevado de veces (ciclos). Por tanto, hay dos elementos esenciales de la técnica: i) conseguir que la amplificación se limite exclusivamente a la región genómica de interés, y ii) utilizar algún tipo de polimerasa que permita repetir el proceso de síntesis de ADN muchas veces. Por lo que respecta al primer punto, la técnica utiliza algo que ya era conocido, como es la capacidad de las polimerasas de ADN de catalizar la síntesis de ADN a partir del extremo 3’ libre de un oligonucleótido que está unido a una cadena complementaria más larga, la cual actúa como molde de la síntesis. Este proceso, habitual en la replicación del ADN celular, puede reproducirse en el laboratorio utilizando pequeñas moléculas de ADN complementarias a una región concreta de una doble cadena más larga. Como es sabido, una de las formas de desnaturalizar el ADN (es decir, separar las dos cadenas de una doble hélice) es mediante calor; como sabemos, la temperatura necesaria para alcanzar dicha desnaturalización depende de la secuencia de la molécula, pero a partir de los 92-94 ºC la práctica totalidad de las moléculas estarán desnaturalizadas. Si se desnaturaliza una molécula de ADN, obtendremos dos cadenas libres; al dejar enfriar la preparación, ambas moléculas vuelven a unirse por complementariedad de bases hasta que el ADN se re-naturaliza por completo. Este proceso es lento, por lo que si la re-naturalización se lleva a cabo en presencia de pequeños oligonucleótidos cuya secuencia es complementaria a alguna porción de la molécula larga original, estas pequeñas moléculas se unirán rápidamente a la región complementaria de la molécula larga antes de que ésta llegue a re-naturalizarse. El resultado es que cada una de las cadenas originales se mantiene monocatenaria excepto en la región en que se ha unido el oligonucleótido. En esa región, una polimerasa de ADN puede sintetizar a partir del extremo 3’ libre de la molécula pequeña, usando como molde la secuencia de la molécula grande. Por este motivo, las moléculas cortas que inician la síntesis de ADN se llaman cebadores (primers, en inglés). Si utilizamos dos cebadores, cada uno de ellos complementario a cada una de las dos cadenas de la molécula original de ADN, habrá dos procesos de síntesis simultáneos en direcciones opuestas, y al final tendremos dos cadenas bicatenarias de ADN con la misma secuencia que la molécula original. Es fácil ver que, precisamente, es la posición de los cebadores la que determina qué región de la molécula larga se va a amplificar, ya que sólo la secuencia que queda comprendida entre los dos cebadores va a ser amplificada.


CAPITULO 3

42

5/12/06

07:02

Página 42

Técnicas básicas de genética molecular

Los elementos necesarios para llevar a cabo una reacción de PCR, por tanto, son el ADN molde original que se quiere amplificar, los cebadores, la polimerasa de ADN y nucleótidos libres que se incorporan a la cadena naciente durante la síntesis. Por lo que respecta al ADN molde, una de las grandes ventajas de la PCR es que puede utilizarse ADN relativamente impuro, e incluso es posible usar células o bacterias completas, sangre impregnada en papel de filtro, etc. En cualquier caso, la pureza del ADN molde asegura un buen funcionamiento de la reacción. Además, las cantidades necesarias son pequeñas, no deben superar los 100-200 ng por reacción; se estima que con estas cantidades de ADN genómico total se puede amplificar un gen que esté en una sola copia en el genoma. Los cebadores son oligonucleótidos sintéticos monocatenarios, con un grupo hidroxilo 3’ a partir del que se sintetiza la nueva cadena de polinucleótidos. La característica más crucial de un cebador es su especificidad, es decir, que sólo se pueda unir a una región concreta del ADN molde. Esto va a asegurar que sólo se amplifique la región de interés; por el contrario, si los cebadores se unen inespecíficamente en zonas distintas a la deseada, la PCR produce resultados difícilmente interpretables. Esto es especialmente importante cuando el ADN molde representa un genoma completo, o fragmentos cromosómicos grandes. Para asegurar este parámetro, se utilizan cebadores con una tamaño mínimo de 17 nucleótidos, ya que se estima que esta longitud es suficiente para reconocer una sola secuencia en un genoma eucariota. En efecto, la probabilidad de encontrar por azar una secuencia de 17 nucleótidos es 417 = 1,7 × 1010. Como los genomas de mamíferos tienen en torno a 3 × 109 nucleótidos, esto supone que un cebador de 17 nucleótidos en teoría puede identificar una secuencia única dentro de un genoma de ese tamaño. Evidentemente, pueden utilizarse cebadores más largos, dependiendo de otros factores que se comentarán más adelante, pero los cebadores utilizados en reacciones de PCR típicas están en un rango de tamaños entre los 17 y 25 nucleótidos. La polimerasa de ADN utilizada es la responsable de la extensión de la nueva cadena de ADN a partir de un cebador. El tipo de polimerasa utilizado viene determinado por las características de la propia reacción de PCR. Como la reacción ha de someterse a numerosos ciclos de desnaturalización-renaturalización, la actividad enzimática de la polimerasa se destruye con cada etapa de calentamiento para desnaturalizar el ADN, por lo que sería necesario añadirla nuevamente al comienzo de cada ciclo. Esta dificultad se ha superado por el descubrimiento de polimerasas de ADN que son termoestables, es decir, pueden soportar elevadas temperaturas durante largo tiempo sin perder su actividad. Las bacterias que viven en aguas termales, como la especie Thermus aquaticus, sobreviven en temperaturas cercanas a los 100 ºC y contienen polimerasas termoestables. De ahí que la polimerasa más frecuentemente utilizada en las reacciones de PCR se denomine polimerasa Taq, para indicar su origen. La polimerasa Taq requiere la presencia de ión magnesio como cofactor, por lo que todas las soluciones utilizadas deben llevar este elemento. La temperatura óptima de polimerización de la Taq es de 72 ºC: a esa temperatura se incorporan unos 100 nucleótidos por segundo. Además, la Taq carece de la actividad exonucleasa 3’→5’ que tienen otras polimerasas. Finalmente, los nucleótidos libres, necesarios para sintetizar las nuevas cadenas, tienen una buena resistencia al calor y su vida media es de más de 40 ciclos de calentamiento. Como se trata de sintetizar

www.FreeLibros.me


CAPITULO 3

5/12/06

07:02

Página 43

www.FreeLibros.me

43

Amplificación in vitro de ADN (PCR)

ADN, se utilizan desoxi-nucleótidos trifosfato (dATP, dCTP, dGTP y dTTP), que pueden incorporarse al extremo 3’ de una cadena creciente por su grupo fosfato 5’. Teniendo en cuenta todo lo dicho hasta el momento, podemos esquematizar una reacción de PCR como un proceso cíclico, repetitivo, en el que cada uno de los ciclos está constituido por tres fases: desnaturalización, hibridación y extensión. La fase de desnaturalización, como su nombre indica, consiste en someter la reacción a una temperatura de 94 ºC durante un minuto, para asegurar que todas las moléculas de ADN molde se han desnaturalizado y están en estado monocatenario. Realmente, la desnaturalización es prácticamente instantánea cuando toda la mezcla alcanza esa temperatura, pero la inercia térmica hace que haya que mantener la temperatura de desnaturalización durante unos segundos. No es bueno prolongarla demasiado, porque esto daña el ADN molde y reduce la actividad de la Taq. La siguiente fase de cada ciclo debe permitir la hibridación de los cebadores con sus secuencias complementarias en el ADN molde, y por eso se llama fase de hibridación. En este sentido, «hibridar» es formar una molécula bicatenaria de ADN a partir de la unión de dos moléculas monocatenarias que tienen secuencias complementarias. Para llevar esto a cabo, es necesario disminuir la temperatura de la reacción, de modo que los cebadores se unan a sus dianas pero las cadenas largas de la molécula original no lleguen a reasociarse entre sí. La temperatura a la que se realiza la hibridación depende de la secuencia de los cebadores, pero suele estar entre 55 ºC y 65 ºC, y se mantiene en torno a un minuto. La última etapa de un ciclo típico se denomina fase de extensión, porque en ella la polimerasa extiende los dos cebadores tomando como molde las secuencias de las cadenas originales, incorporando los desoxi-nucleótidos que están presentes en la mezcla de reacción. Por la temperatura óptima de la polimerasa, esta fase se realiza a 72 ºC, durante un tiempo variable dependiendo de la longitud del fragmento amplificado (entre 30 segundos y dos minutos, en condiciones estándar). Una reacción típica de PCR consta de 30-35 ciclos como el descrito. Además, suele ir precedida por un breve periodo de desnaturalización de unos tres a cinco minutos, para asegurar que todo el ADN está desnaturalizado antes del primer ciclo, y una fase final de extensión (unos cinco a 10 minutos a 72 ºC) para extender todas las moléculas que hayan quedado incompletas. Es fácil ver que, teóricamente, en cada ciclo se duplica el número de moléculas de ADN de la región específica que queremos amplificar; por tanto, el número de moléculas presentes en un ciclo dado es 2n, siendo n el número de ciclo. Por ejemplo, si partimos de una sola molécula inicial de ADN, tras 10 ciclos tendremos 1 024 copias, tras 20 ciclos tendremos 1 048 576 copias, y tras 30 ciclos tendremos 1 073 741 824 de copias de la molécula original. De todas formas, no todas las moléculas serán idénticas, porque en cada ciclo se generan moléculas que llevan cadenas largas que sobrepasan el límite de uno de los cebadores. Estas moléculas aumentan en progresión aritmética (se crean dos con cada ciclo), mientras que los fragmentos específicos comprendidos por los dos cebadores aumentan exponencialmente a partir del tercer ciclo. Por ejemplo, en una PCR de 35 ciclos tendremos 34 359 738 368 copias (235), de las que 70 corresponden a moléculas largas y el resto corresponden al fragmento de interés. Este aumento exponencial se observa también experimentalmente, cuando se cuantifica la cantidad de ADN total después de cada ciclo; tras


CAPITULO 3

44

5/12/06

07:02

Página 44

Técnicas básicas de genética molecular

una fase inicial más lenta, tiene lugar una fase de aumento exponencial (una línea recta cuando se representa en escala logarítmica), y una fase final (a partir del ciclo 32-35, más o menos) en la que se alcanza una meseta y la amplificación se detiene por agotamiento de los reactivos y pérdida de actividad de la polimerasa. La Figura 3.7 lleva a una animación que muestra los primeros ciclos de una PCR y permite calcular el número de moléculas que se generan por ciclo.

Lógicamente, la realización de una reacción de PCR requiere un equipamiento apropiado que permita llevar a cabo los ciclos de modo automático. Inicialmente, se utilizaban baños separados, cada uno a una temperatura distinta (desnaturalización, hibridación y extensión) y los investigadores debían pasar los tubos de reacción de un baño a otro a los tiempos apropiados. Pronto se desarrollaron máquinas que tienen una placa metálica, con capacidad para un alto número de tubos, cuya temperatura puede variarse con gran rapidez y precisión, estando todo el proceso controlado por un microprocesador. Estas máquinas, llamadas termocicladores (o cicladores térmicos), permiten programar las condiciones de tiempo, temperatura, número de ciclos, etc, de modo que el operador sólo tiene que introducir los tubos y esperar al final de la reacción, que suele durar en torno a los 60-90 minutos con los termocicladores modernos. Las aplicaciones de la técnica de PCR han sido múltiples desde su aparición; a lo largo de este libro veremos su uso en la detección de alteraciones genéticas que causan enfermedades. La descripción de los posibles usos en diferentes estrategias de análisis genético y en biotecnología, está más allá del objetivo de este apartado, en el que se ha pretendido únicamente introducir en esta técnica a aquellos que no la conocen. En cualquier caso, es importante reseñar una de las variantes más utilizadas, como es la amplificación de fragmentos de ARN mensajero. En este caso, en vez de utilizar ADN como molde para la amplificación, se usa una molécula de ADN que es copia de un ARNm, obtenida por un proceso que se llama retrotranscripción: gracias a la actividad transcriptasa reversa de la polimerasa de algunos virus (una ADN polimerasa dependiente de ARN), se puede sintetizar una molécula de ADN complementaria a una molécula de ARN. Por tanto, si queremos amplificar selectivamente un ARNm, es preciso obtener primero un ADN complementario (llamado ADNc) haciendo una retrotranscripción del ARNm, y después ese ADNc ya se puede amplificar por PCR como cualquier otro fragmento de ADN. Por este motivo, esta variante de la técnica se llama RT-PCR (retrotranscripción-PCR). Es una técnica muy utilizada y de gran interés cuando se quiere trabajar con las secuencias de los genes ya procesados, prescindiendo de los intrones, y supuso un gran avance porque hasta su aparición era muy difícil estudiar ARN mensajeros.

3.5 Secuenciación del ADN Desde el descubrimiento de la estructura del ADN y del código genético, una de las herramientas más importantes para identificar genes y predecir su función ha sido la determinación de la secuencia de nucleótidos que constituye cada gen. En las últimas décadas, la tecnología de secuenciación del ADN ha sido determinante para poder

www.FreeLibros.me


CAPITULO 3

5/12/06

07:02

Página 45

La Figura 3.8 contiene enlaces a animaciones que ilustran el método original de secuenciación de Sanger.

La reacción de secuenciación, una vez que tenemos los distintos componentes mezclados en cantidades adecuadas, procede del siguiente modo. En primer lugar, el fragmento a secuenciar se desnaturaliza para separar las dos cadenas y permitir que

www.FreeLibros.me

45

Secuenciación del ADN

llevar a cabo los distintos «proyectos genoma», cuya finalidad es obtener la secuencia completa de nucleótidos del genoma completo de una especie. Hoy en día, además, un aspecto crucial de la investigación genética es la determinación de pequeñas variaciones interindividuales, lo que requiere la secuenciación de una misma región en distintos individuos. Por tanto, los métodos actuales de determinación de la secuencia de nucleótidos de un fragmento de ADN son muy variados, y los desarrollos tecnológicos recientes han dado lugar a un gran abanico de técnicas diseñadas para responder a distintas necesidades. De todas formas, todas las tecnologías son de algún modo tributarias del método original ideado por Fred Sanger y Alan Coulson a finales de los años 1970. Este método se conoce como el método de «terminación de cadenas» o «di-desoxi», porque se basa en la interrupción del proceso de extensión de un cebador, dando lugar a cadenas de todas las posibles longitudes, puesto que cada una ha sido interrumpida en una posición distinta; la separación de las cadenas de distintos tamaños y la detección de qué nucleótido llevan en su extremo 3’ nos permite deducir la secuencia de la molécula original. El primer elemento de toda reacción de secuenciación es, lógicamente, el fragmento de ADN cuya secuencia queremos leer; precisamente, este fragmento sirve como molde para la síntesis de ADN a partir de un cebador específico que se une a él por complementariedad de bases, y esto es lo que nos va a permitir deducir la secuencia de nucleótidos del fragmento. Aunque inicialmente era necesario convertir el fragmento de ADN a su forma monocatenaria, clonándolo en un tipo especial de vectores, hoy en día puede utilizarse ADN de doble cadena, bien sea en forma de plásmidos (cuyo inserto queremos secuenciar) o como productos de PCR. Al igual que en el caso de la PCR, otro elemento necesario es el cebador que va a iniciar la síntesis de ADN desde el punto donde queremos empezar a leer la secuencia del fragmento original. Nótese que aquí sólo vamos a utilizar un cebador (en vez de dos, como en la PCR) ya que no queremos amplificar una región, sino simplemente sintetizar nuevas cadenas de ADN a partir de un punto concreto. Como toda reacción de síntesis de ADN, también es necesaria la presencia de una polimerasa de ADN que tenga buena procesividad y fidelidad (es decir, que no introduzca errores en la nueva cadena). El punto clave de este método de secuenciación está en los nucleótidos libres presentes en la reacción, que se van a ir incorporando a la nueva cadena sintetizada por la polimerasa a partir del extremo 3’ del cebador; además de 2’-desoxi-nucleótidos típicos en su forma tri-fosfato, este método incorpora a la mezcla de reacción unos nucleótidos especiales que actúan como «terminadores» de la síntesis. Los terminadores son nucleótidos modificados químicamente que carecen además del grupo hidroxilo 3’ por el que crece la cadena, de ahí su nombre de di-desoxi-NTP (abreviado como ddNTP), ya que corresponden a la forma 2’,3’-di-desoxi de cada nucleótido tri-fosfato.


CAPITULO 3

46

5/12/06

07:02

Página 46

Técnicas básicas de genética molecular

el cebador acceda a su región complementaria específica. Tras permitir la hibridación del cebador con la cadena molde respectiva, la polimerasa comienza a extender el cebador incorporando nucleótidos complementarios a los de la cadena molde. Como en la reacción están presentes desoxi-NTPs y didesoxi-NTPs, en cada posición es posible incorporar uno u otro. En el caso de incorporar un dNTP, la cadena seguirá extendiéndose normalmente, ya que el nuevo nucleótido proporciona el grupo hidroxilo 3’ necesario para formar un nuevo enlace fosfo-di-éster con el grupo fostato de un nuevo nucleótido; en cambio, si el nucleótido incorporado es un ddNTP, la síntesis de la cadena terminará en esa posición, ya que no existe el grupo hidroxilo 3’ necesario para continuar la elongación. Lógicamente, esto sucederá para cada posición, de modo que mientras la síntesis avanza (porque se han incorporado dNTPs) en cada nueva posición existe la posibilidad de que la cadena se termine en ese punto. Al final, tendremos una colección de fragmentos de todos los posibles tamaños, con una diferencia de longitud de un nucleótido; cada fragmento estará terminado por el nucleótido complementario al que estaba en la cadena molde original en esa posición. Cuando la reacción de secuenciación ha sido completada, sólo nos resta separar de alguna forma todos los fragmentos de los distintos tamaños y ver en qué nucleótido está terminado cada uno de ellos, de modo que así podremos reconstruir la secuencia original. Los métodos para separar los fragmentos y leer el nucleótido terminal han cambiado bastante desde la descripción original del método. Hoy en día, lo más habitual es utilizar terminadores marcados con algún fluorocromo específico: se trata de ddNTPs que llevan unido un grupo químico que produce fluorescencia cuando es excitado por una luz de una determinada longitud de onda. Como cada terminador lleva un fluorocromo distinto, es fácil saber en qué nucleótido terminó una cadena concreta, dependiendo del tipo de fluorescencia que produzca. Para la separación de los fragmentos se utilizan técnicas de electroforesis capilar, en la que la mezcla de reacción va pasando por unos finos capilares que contienen una matriz porosa capaz de resolver fragmentos de ADN que se diferencian en tamaños de tan sólo un nucleótido. De este modo, cuando la reacción de secuenciación ya completada pasa por el capilar, los fragmentos más pequeños pasan más facilmente y salen del capilar antes que los fragmentos mayores, que tienen más dificultad para atravesar los poros y por eso quedan retenidos temporalmente. El resultado es que todos los fragmentos de la mezcla de reacción van saliendo del capilar ordenados por tamaños, comenzando por el más corto, con diferencias de tamaño un solo nucleótido. A la salida del capilar se sitúa una fuente de luz (habitualmente un láser) que excita los fluorocromos y produce un tipo de fluorescencia específico de cada ddNTP, lo cual es detectado por un dispositivo especial. Así, viendo el orden en que van apareciendo los cuatro distintos colores correspondientes a los cuatro nucleótidos, podemos saber la secuencia de la cadena que se ha sintetizado, que será exactamente la secuencia complementaria a la cadena molde original. El vídeo de la Figura 3.9 muestra con detalle el método moderno de secuenciación con terminadores fluorescentes y separación de los fragmentos mediante electroforesis capilar.

Aunque en la actualidad se están desarrollando metodologías nuevas más rápidas y baratas, en dispositivos miniaturizados que permiten determinar la secuencia de un

www.FreeLibros.me


CAPITULO 3

5/12/06

07:02

Página 47

fragmento en segundos, el método de secuenciación de Sanger ha tenido una influencia crucial en el desarrollo de la biología molecular y la genética moderna.

La cuantificación del nivel de expresión de un gen, la intensidad con la que se transcribe, puede medirse utilizando las técnicas explicadas en los apartados precedentes. Inicialmente se utilizaba la técnica de Northern blot, en la que la intensidad de la señal obtenida es proporcional a la cantidad de ARNm presente en la muestra. Más recientemente se han desarrollado técnicas de PCR cuantitativa que consiguen cuantificar la cantidad de ARNm presente en la muestra: utilizando ADNc (ADN complementario) como molde, se puede realizar RT-PCR cuantitativa para determinar la abundancia relativa del ARNm y comparar varios tejidos o condiciones experimentales. Con la llegada de los grandes proyectos de secuenciación, se planteó la posibilidad de determinar la expresión génica a nivel genómico, es decir, analizar el perfil de expresión de todos los genes de un genoma en distintas situaciones, para así identificar los genes implicados en distintos procesos fisiológicos o en el desarrollo de enfermedades. La cuantificación de la expresión de miles de genes es impracticable por los métodos tradicionales, por lo que se desarrolló una metodología nueva que permitiese hacer este tipo de experimentos a bajo coste y en poco tiempo. Dicha tecnología se conoce como la tecnología de microarrays, también llamados a veces «chips» de ADN, porque se basa en la utilización de unos dispositivos sólidos miniaturizados en los que se puede medir la expresión de miles de genes a la vez. Aunque existen distintos tipos de microarrays en función de la tecnología de fabricación, el fundamento de todos ellos es la hibridación de una mezcla de dos clases de ADNc, marcados con fluorocromos distintos, sobre una fase sólida que contiene miles de sondas inmobilizadas, cada una de ellas específica para un gen distinto. Por tanto, a diferencia de los experimentos tradicionales de hibridación sobre filtros, en los que el ADN está fijado sobre la fase sólida y la sonda está presente en la solución de hibridación, en la tecnología de microarrays son las sondas las que están inmovilizadas sobre el soporte sólido, y son los ADNc los que «buscan» las sondas complementarias a su secuencia e hibridan con ellas. De modo general, un microarray es un portaobjetos de vidrio al que se han adherido, por métodos físicos o químicos, sondas de ADN en posiciones fijas y ordenadas, cada una ocupando un punto o «spot». Cada punto contiene entre 107-108 moléculas de una sonda concreta, que puede ser de distintos tamaños y que debería reconocer específicamente un solo gen del genoma. La Figura 3.10 muestra ejemplos de varios tipos de microarrays, cómo se fabrican y una imagen de hibridación.

Aunque los microarrays fueron originalmente diseñados para realizar estudios de expresión génica a escala genómica, también se pueden utilizar para detectar pequeñas deleciones o duplicaciones en un genoma. En este caso se habla de microarrays

www.FreeLibros.me

Microarrays

3.6 Microarrays

47


CAPITULO 3

48

5/12/06

07:02

Página 48

Técnicas básicas de genética molecular

genómicos, en los que las sondas son fragmentos de un genoma. Por ejemplo, un microarray genómico humano tendrá varios miles de sondas que representan todo el genoma humano ordenado en los distintos puntos del array; la hibridación se realiza con una mezcla de dos ADN genómicos, con la finalidad de detectar regiones genómicas que estén en distinto número de copias en uno de los genomas respecto al otro. En cualquier caso, la metología experimental es similar en los distintos tipos de microarrays. En primer lugar es necesario obtener los ADN que se van a hibridar sobre el microarray (ADNc si se van a hacer estudios de expresión génica o ADN genómico total si se trata de microarrays genómicos). Cada una de las dos muestras que se van a comparar es marcada con un fluorocromo distinto, habitualmente uno que da fluorescencia verde y otro con fluorescencia roja. A continuación se realiza la reacción de hibridación y se detecta la fluorescencia que emite cada punto del microarray. Dependiendo de la intensidad de la fluorescencia de cada color en cada punto, es posible deducir si el gen representado por esa sonda se expresa o no en las muestras. Lógicamente, un experimento con microarrays genera cantidades masivas de datos, al tratarse de miles de puntos analizados simultáneamente; por ello, las herramientas de análisis de imagen y de procesamiento de los datos son bastante sofisticadas. Gracias a esto, los estudios de microarrays están permitiendo avanzar en el diagnóstico de enfermedades, ya que permiten detectar «firmas» de expresión específicas para enfermedades concretas. Estas «firmas» son patrones característicos formados por los genes que tienen su expresión más alterada en un proceso concreto; al detectar el subgrupo de genes que se alteran con mayor intensidad, podemos utilizar esa información para diagnosticar si un individuo sufre ese mismo proceso. En algunos casos, la utilización de estas «firmas» moleculares ha ayudado a distinguir procesos que antes se agrupaban juntos, identificando enfermos que tienen distintas posibilidades de respuesta a tratamientos, distinta supervivencia, etc. La Figura 3.11 nos lleva a unas animaciones que muestran cómo se lleva a cabo y se interpreta un experimento con microarrays.

Actualmente se están generando bases de datos que archivan los resultados de múltiples estudios de microarrays, con lo que es posible acceder a esos datos y elaborarlos para obtener información sobre los niveles de expresión de un gen en distintos tipos celulares y en distintas condiciones experimentales. El análisis de estos datos permitirá establecer cómo varían los patrones de expresión génica de un genoma en distintos procesos metabólicos y fisiológicos, así como también en diversas situaciones patológicas. Así podremos identificar las variaciones típicas de los distintos tipos de cáncer, de enfermedades cardiovasculares, neurodegenerativas, etc; esto, a su vez, permitirá identificar nuevas dianas terapéuticas para restablecer esos patrones de expresión alterados.

www.FreeLibros.me


CAPITULO 4

5/12/06

07:06

Pรกgina 49

www.FreeLibros.me


CAPITULO 4

5/12/06

07:06

Página 49

B) El genoma humano

En tres temas se cubre la organización general del genoma humano y la relación entre estructura y función, además de prestar atención a las bases moleculares del cambio genético y a los mecanismos correctores de los errores introducidos en la secuencia.

www.FreeLibros.me


CAPITULO 4

5/12/06

07:06

Página 51

CAPÍTULO 4

La geografía del genoma humano

Contenidos 4.1 Historia y desarrollo del Proyecto Genoma Humano 4.2 Estructura del genoma humano y variación inter-individual 4.3 El ADN repetitivo 4.4 El genoma mitocondrial

4.1 Historia y desarrollo del Proyecto Genoma Humano En 1986, el Departamento de Energía de los Estados Unidos lideró la Iniciativa del Genoma Humano, tras varios años de contactos y reuniones, y puso en marcha el mayor proyecto biomédico de la historia con el objetivo final de conseguir la secuencia completa del genoma humano en el año 2005. El Proyecto Genoma Humano comenzó oficialmente en Estados Unidos en octubre de 1990, siguiendo un plan a cinco años para desarrollar las herramientas que permitiesen conseguir esa meta. Estas herramientas eran principalmente la construcción de mapas genéticos (de ligamiento) y de mapas físicos (de clones) de todo el genoma humano, al tiempo que se desarrollaba la tecnología necesaria para realizar secuenciación a gran escala. La estrategia general consistió en construir mapas genéticos y físicos e integrarlos, para aumentar cada vez más en resolución desde el cromosoma hasta la secuencia de ADN. Los mapas genéticos describen la organización cromosómica de caracteres (un rasgo fenotípico, una enfermedad) o de marcadores genéticos, mediante estudios de ligamiento genético.

www.FreeLibros.me


CAPITULO 4

52

5/12/06

07:06

Página 52

La geografía del genoma humano

El concepto de ligamiento genético y la forma en que se cuantifica son objeto del Capítulo 11. Si el lector no está familiarizado con la construcción de mapas de ligamiento, se aconseja estudiar el Capítulo 11 antes de seguir leyendo.

Los primeros éxitos de mapeo genético en humanos fueron los que consiguieron asociar un carácter a un cromosoma, como por ejemplo el ligamiento del daltonismo al cromosoma X, o ligamiento del grupo sanguíneo Duffy al cromosoma 1. Este último fue el primer rasgo hereditario mapeado a un autosoma (en 1968) gracias a que, en una familia concreta, se observó que este rasgo se heredaba junto con un heteromorfismo del cromosoma 1. Esto puso de manifiesto la utilidad de contar con marcadores de ADN que estuviesen distribuidos por todo el genoma, fuesen fáciles de estudiar en un número alto de individuos y tuviesen una posición cromosómica conocida, ya que así se podrían realizar estudios de ligamiento genético en familias que padecen una determinada enfermedad genética para determinar si esa enfermedad está en ligamiento con alguno de estos marcadores, lo que facilitaría la identificación del gen responsable.

Distancia en centimorgans (cM) DS16C4 DS16B3

STS 8 STS 6 STS 7 STS 5

DS16A2 DS16A1

STS 4 STS 3

STS 1 STS 2

MAPA GENÉTICO DE LIGAMIENTO 4 marcadores posicionados por estudios de ligamiento

MAPA FÍSICO 8 marcadores tipo STS cuya posición es conocida

Distancia física en pares de bases (bp) La Figura 4.1 explica cómo son los mapas físicos y los mapas de ligamiento genético, y su utilización en el Proyecto Genoma Humano.

Los tipos de marcadores más utilizados en estudios de ligamiento en Genética Humana son:

Polimorfismos de Longitud de Fragmentos de Restricción (en inglés, las siglas son RFLP). Un RFLP es un polimorfismo originado por un cambio de un nucleótido que crea o destruye una diana de restricción, de manera que encontraremos alelos con esa diana y alelos sin ella. Por tanto, un RFLP es por definición un marcador bialélico (sólo hay dos alelos posibles). La presencia

www.FreeLibros.me


CAPITULO 4

5/12/06

Página 53

o ausencia de esa diana hace que los fragmentos originados por la digestión del ADN con esa enzima de restricción sean de distinto tamaño. En general, un polimorfismo tipo RFLP puede detectarse de dos modos: a) digerir directamente el ADN genómico, separar los fragmentos en un gel, hacer un Southern blot e hibridarlo con una sonda específica para detectar cada uno de los fragmentos polimórficos; b) amplificar la región del polimorfismo mediante PCR y digerir directamente el producto de PCR para separar los fragmentos en un gel. Los marcadores tipo VNTR (acrónimo inglés de «Número Variable de Repeticiones en Tándem») son polimorfismos originados por pequeñas secuencias de ADN que están repetidas en tándem. El número de repeticiones es diferente en los distintos individuos de la población, por lo que en principio pueden existir más de dos alelos distintos para cada marcador (aunque cada individuo sólo lleve dos alelos, en la población general pueden existir más). Los marcadores en los que la secuencia repetida es corta (dos a cuatro nucleótidos) se denominan también microsatélites o STR («Short Tandem Repeats», Repeticiones Cortas en Tandem), y están homogéneamente distribuidos por todo el genoma. Los marcadores en los que la secuencia repetida es más larga (decenas a cientos de nucleótidos) se denominan minisatélites, y han sido muy importantes en los estudios de genética forense ya que permiten establecer una huella genética única para cada individuo. Los minisatélites son más abundantes hacia las regiones teloméricas de los cromosomas, y —debido a su tamaño— en principio deben detectarse mediante Southern blot e hibridación. En cambio, los marcadores de tipo microsatélite pueden detectarse mediante PCR y están distribuidos uniformemente por el genoma, por lo que su análisis es más rápido y sencillo y proporcionan mayor información. Los SNP (pronunciado snip) son polimorfismos de un solo nucleótido (Single Nucleotide Polymorphisms) en los que el simple cambio de un nucleótido en una secuencia genómica da lugar a distintos alelos. Lógicamente, para cada posición sólo puede haber cuatro alelos como máximo (A, C, G o T), aunque lo habitual es que un SNP tenga dos alelos en la población general. Se estima que, como promedio, hay al menos un SNP cada 500-1 000 pares de bases, de los cuales un porcentaje importante son polimorfismos codificantes (es decir, cambian un aminoácido en la proteína codificada por el gen) y constituyen la principal fuente de variabilidad genética inter-individual, puesto que dos individuos cualesquiera tienen alrededor de un 0,1 por ciento de sus nucleótidos distintos. La gran ventaja de los SNP sobre los demás tipos de marcadores, además de ser tan abundantes y estar muy uniformemente distribuidos por todo el genoma humano, es la posibilidad de analizarlos mediante métodos automatizables a gran escala, como los microarrays, de manera que se pueden determinar cientos o miles de SNPs a la vez en un mismo experimento.

La Figura 4.2 ilustra los tipos de marcadores más utilizados en la construcción de mapas de ligamiento genético en humanos.

www.FreeLibros.me

53

Historia y desarrollo del Proyecto Genoma Humano

07:06


CAPITULO 4

54

5/12/06

07:06

Página 54

La geografía del genoma humano

El objetivo inicial del PROYECTO GENOMA era crear un mapa genético (de ligamiento) con marcadores distribuidos por todo el genoma con una distancia media de 1 cM entre marcadores. Los mapas genéticos se basaron en un primer mapa publicado en 1987, hecho con 393 marcadores tipo RFLP agrupados en 23 grupos de ligamiento, con una distancia media entre marcadores superior a 10 cM. El primer mapa genético de todo el genoma fue el realizado por un centro de investigación francés llamado Généthon en 1992, e incluía 803 marcadores tipo microsatélite. Los mapas físicos, en cambio, reconstruyen la estructura de un segmento de ADN, determinando los tipos y orden relativo de las distintas secuencias que lo componen, sus tamaños, y las distancias entre ellas. Para la construcción de mapas físicos se utiliza un tipo de marcador distinto, que veremos más adelante. Lógicamente, el mapa físico de mayor resolución posible es la secuencia completa de ese segmento (resolución de un nucleótido), pero también es posible realizar mapas de menor resolución (un ejemplo, mapas de restricción). El tipo de marcador utilizado en la creación de mapas físicos se denominó STS (Sequence-Tagged Site = Sitio Etiquetado por su Secuencia). Un STS es un pequeño fragmento de ADN (unos pocos cientos de pares de bases) de secuencia y localización genómica conocidas, fácilmente amplificable mediante PCR. Durante años se habían identificado un buen número de marcadores STS, mediante la secuenciación parcial de clones previamente mapeados por otros métodos. Además, los microsatélites utilizados en la creación de mapas de ligamiento también pueden convertirse fácilmente en STS, leyendo la secuencia que flanquea las repeticiones del microsatélite. Gracias a esto, hoy contamos con una lista ordenada de STS que están distribuidos por todo el genoma humano, cuya secuencia y condiciones de amplificación mediante PCR son fácilmente accesibles a todo investigador. El PROYECTO GENOMA se propuso inicialmente conseguir mapas de marcadores tipo STS distribuidos por todo el genoma y con una distancia media entre marcadores en torno a 0,1 Mb (es decir, 100kb). Utilizando estos marcadores STS, se pudieron construir mapas físicos, es decir mapas compuestos por clones de bibliotecas genómicas, capaces de albergar insertos de gran tamaño. Existen distintos vectores de este tipo, entre los que destacan los vectores tipo YAC (Yeast Artificial Chromosome), PAC (P1-phage Artificial chromosome) y BAC (Bacterial Artificial Chromosome). Cada uno de estos vectores de clonación tiene características específicas, ventajas e inconvenientes. En concreto, los YAC son los vectores que permiten albergar un mayor tamaño de inserto (hasta dos megabases), pero son bastante inestables (tienden a perder fragmentos del inserto cuando se replican) y tienen un porcentaje relativamente alto de clones quiméricos (es decir, clones en los que el inserto está en realidad formado por dos fragmentos procedentes de cromosomas distintos). Los PACs y BACs, en cambio, sólo permiten clonar insertos de unas 100 a 150 kilobases de tamaño (por lo que son necesarios muchos más clones para cubrir completamente un segmento genómico determinado), pero en cambio son muy estables y el porcentaje de quimerismo es muy pequeño. Aunque los YACs han sido el vector principalmente utilizado al principio de los años 90, hoy en día han sido desplazados por PACs y BACs.

www.FreeLibros.me


CAPITULO 4

5/12/06

07:06

DS16B3

DS16C4

STS 6

STS 7

STS 5

DS16A2

STS 4

STS 3

DS16A1

STS 1 STS 2

CONTIG:conjunto CONTIG: conjunto de clones de clones solapantes solapantes quecubren cubren una región del genoma que una región del genoma

La secuenciación La secuenciación de cada de cada clon clon permite permite reconstruir reconstruir la original de esa genómica la secuencia secuencia original de región esa región genómica

GGAGACTACGGAGATTACCTACGGGACTACAGAAGGAGACTACGGAGAGTACCTACGGGACTGT CT

La Figura 4.3 explica la utilización de marcadores STS para crear un contig de clones que cubran una región del genoma.

Los primeros mapas físicos del genoma humano estaban compuestos por contigs de YACs que cubrían parcialmente el genoma humano, siendo el mejor ejemplo el mapa creado también por Généthon en 1993. Este mapa supuso un avance enorme porque —aunque sólo cubría algunas regiones genómicas— sirvió como punto de partida para elaborar mapas más completos con vectores más fiables y manejables, como BACs y PACs. El PROYECTO GENOMA hizo una revisión de sus objetivos en 1993, teniendo en cuenta los progresos realizados en los tres años anteriores, y estableció nuevas metas para los siguientes cinco años (1993-1998). En resumen, estos nuevos objetivos fueron:

• • • • •

Conseguir un mapa genético con resolución de dos a cinco cM entre marcadores. Conseguir un mapa físico con STS espaciados regularmente cada 0,1 Mb (lo que significaba identificar y localizar la posición de —como mínimo— unos 30 000 STS). Desarrollar nuevas tecnologías para la identificación de genes a partir de ADN genómico. Desarrollar nuevas tecnologías de secuenciación y completar 80 Mb de secuencia confirmada para todos los organismos que estaban siendo secuenciados por los distintos proyectos. Potenciar la genómica comparada: completar las secuencias de E. coli, S. cerevisiae y C. elegans, y comenzar los proyectos de secuenciación de los genomas de Drosophila y de ratón.

www.FreeLibros.me

55

Historia y desarrollo del Proyecto Genoma Humano

STS 8

Página 55


CAPITULO 4

56

5/12/06

07:06

Página 56

La geografía del genoma humano

Cuando en 1998 se revisaron los avances realizados en esos cinco años, con el fin de diseñar un nuevo plan quinquenal, los resultados habían sido realmente prometedores: en septiembre de 1994 se publicó un mapa genético de todo el genoma humano integrado por 4 000 marcadores tipo microsatélite y 1 800 marcadores tipo RFLP, con una distancia media entre marcadores de 0,7 cM. Esto superaba en más de tres años el objetivo propuesto inicialmente. Por su parte, Généthon publicó en 1995 otro mapa físico de YACs que estaba formado por 255 contigs (con un tamaño medio de 10 Mb cada contig) y cubría el 75 por ciento del genoma humano. Durante esos años se continuaron desarrollando nuevos marcadores tipo STS, hasta llegar en 1998 a un mapa que contenía 52 000 STS (casi el doble de los inicialmente propuestos). Por lo que respecta a la secuenciación, en octubre de 1998 se había obtenido un total de 180 Mb de secuencia del genoma humano (6 por ciento del total), además de 111 Mb de secuencia de otros organismos, muy por encima de lo previsto en el plan 1993-1998. Además, se había completado la secuencia de E. coli y de S. cerevisiae, éste último el primer organismo eucariota en ser secuenciado totalmente. Esto fue posible gracias a importantes avances en la tecnología de secuenciación, que se hizo progresivamente más rápida, fiable y barata. Posteriormente, en diciembre de 1998, se completó la secuencia de C. elegans, el primer organismo multicelular secuenciado en su totalidad con un genoma de unas 97 Mb. Por tanto, en 1998 el PROYECTO GENOMA se fijó un nuevo plan de objetivos hasta el año 2003, en el que se incluían ocho metas concretas: 1.

Completar la secuencia del genoma humano para 2003 (año que coincidía con el 50º aniversario del descubrimiento de la doble hélice por Watson y Crick), creando un primer borrador de trabajo en 2001. Este objetivo se aceleró enormemente por la competencia de la empresa privada Celera Genomics, que se propuso secuenciar todo el genoma humano, utilizando una estrategia distinta al consorcio internacional del PROYECTO GENOMA, con el fin de obtener la propiedad intelectual y poder explotar esa información con fines comerciales. A pesar de los problemas suscitados inicialmente por la fuerte competencia entre ambos proyectos, el 26 de junio de 2000 se produjo el anuncio oficial de que se había alcanzado un primer borrador del 87 por ciento de la secuencia del genoma humano. Este primer borrador fue publicado el 15 de febrero de 2001 en las revistas Nature (el mapa del Consorcio Internacional) y Science (el mapa de Celera Genomics).

La Figura 4.4 muestra el proceso general utilizado por el Consorcio Internacional para la secuenciación del Genoma Humano.

2.

3.

Continuar el desarrollo y la innovación de las tecnologías de secuenciación. Como ya se ha comentado, éste ha sido un factor determinante en el avance del PROYECTO GENOMA. Estudiar la variación en el genoma humano. Como hemos visto, los SNP se encuentran en el genoma humano a razón de uno por cada kilobase, como promedio, y representan las diferencias genéticas entre individuos de una misma especie. Como se verá en el Capítulo 11, la creación de mapas densos de SNP permitirá llevar a cabo estudios de asociación para detectar los genes

www.FreeLibros.me


CAPITULO 4

5/12/06

5.

6.

Página 57

que están implicados en enfermedades complejas, debidas a alteraciones en muchos genes —siendo la contribución de cada gen a la enfermedad pequeña— y, por tanto, difíciles de detectar por otros métodos de ligamiento. Desarrollar tecnología para la «genómica funcional», es decir, identificar todos los genes y determinar cuál es la función de cada gen. La gran revolución en las estrategias de identificación de regiones codificantes (es decir, genes) comenzó con la idea de Craig Venter de secuenciar al azar y a gran escala fragmentos de ADNc de bibliotecas obtenidas a partir de diversos tejidos. Estos fragmentos de secuencia se denominaron «Etiquetas de Secuencia Expresada» (EST, Expressed Sequence Tags), ya que —en el fondo— cada una representa un fragmento de un ARNm (una secuencia expresada en un tejido concreto). En pocos años, la base de datos de EST creció de manera exponencial, con cientos de miles de secuencias expresadas procedentes de distintas bibliotecas de ADNc. Como algunos de estos EST proceden de un mismo ARNm, se creó una colección no redundante llamada UNIGENE que agrupa los EST por familias, siendo cada familia representativa de un único ARNm. Poco después comenzaron también proyectos internacionales para mapear secuencias de UNIGENE, de manera que en 1994 se publicó un primer mapa con la localización de 16 000 EST correspondientes a genes distintos, y en 1998 se publicó un segundo mapa de 41 664 EST, que representaban 30 181 genes distintos. Cuando se conozca el catálogo completo de genes de nuestro genoma, será necesario estudiar la expresión de cada gen en distintos tejidos y en distintas situaciones fisiológicas y patológicas, en respuesta a distintos factores ambientales, etc. Lógicamente, esto será el objeto de la investigación biomédica de buena parte del siglo XXI. Genómica Comparada. El análisis comparado de los genomas de varias especies es de gran utilidad para identificar mecanismos biológicos conservados durante la evolución (por lo que son especialmente importantes), estructura y función de genes ortólogos, etc. Aunque el plan para 1998-2003 se propuso conseguir la secuencia completa del genoma de Drosophila para el año 2002, esta meta se cumplió en abril del año 2000 gracias a la colaboración de laboratorios y Universidades con Celera Genomics, descifrando unas 120 Mb de secuencia que comprenden la práctica totalidad de la eucromatina de este insecto. El nuevo gran reto ahora es conseguir la secuencia completa del genoma de otras especies de mamíferos: el primer borrador completo del genoma de ratón se obtuvo en 2002 y el del genoma de chimpancé en 2005. Implicaciones éticas, legales y sociales del PROYECTO GENOMA. Es importante tener consciencia de la influencia que va a tener el Proyecto Genoma y sus aplicaciones sobre los individuos y las sociedades. Cuestiones como el diagnóstico de enfermedades que no tienen tratamiento, la extensión de una mentalidad eugenésica que lleve a la discriminación por razón de deficiencias genéticas, el diagnóstico prenatal de alteraciones genéticas que confieren predisposición a sufrir enfermedades que se manifestarán en la edad adulta, la detección de rasgos psicológicos con base genética, la confidencialidad de la información genética de los individuos (y la posible discriminación

www.FreeLibros.me

57

Historia y desarrollo del Proyecto Genoma Humano

4.

07:06


CAPITULO 4

58

5/12/06

07:06

Página 58

La geografía del genoma humano

laboral) serán una constante en los debates sociales de este siglo, y es importante llevar a cabo una labor de divulgación seria para que la sociedad pueda discutir de modo sosegado y bien fundamentado las bases éticas sobre las que sostener las aplicaciones biomédicas de la biotecnología en los años que se avecinan. 7. Desarrollo de herramientas bioinformáticas (bases de datos y herramientas de análisis de datos) que puedan ser compartidas por la comunidad científica. Será especialmente importante el desarrollo de herramientas informáticas que permitan identificar exones y predecir la estructura de genes en grandes secuencias genómicas, así como plataformas de genómica funcional para el análisis de la expresión de miles de genes a la vez. 8. Formación en genómica: favorecer que científicos y académicos se dediquen a la investigación genómica y a divulgar y aumentar el conocimiento público de los distintos aspectos del PROYECTO GENOMA. Finalmente, la primera versión esencialmente completa del genoma humano fue anunciada oficialmente el 14 de abril de 2003, cubriendo un total de 3 069 Mb (92,3 por ciento del total estimado del genoma humano) con un 99,99 por ciento de fiabilidad en cada posición secuenciada. El análisis de la secuencia publicada permite hacerse una idea bastante aproximada de la estructura de nuestro genoma, su composición y algunas de sus características funcionales, como se explica a continuación.

4.2 Estructura del genoma humano y variación inter-individual El genoma humano nuclear tiene un tamaño aproximado de 3 200 Mb (megabases), es decir tres mil doscientos millones de pares de bases. Esta cifra total incluye unas 2 950 Mb de eucromatina y unas 250 Mb de heterocromatina (formada, como veremos, por ADN satélite). Esta cifra se refiere al genoma haploide, de manera que las células somáticas (diploides) contienen el doble. La Figura 4.5 muestra una visión general de los distintos tipos de secuencias que constituyen el genoma humano.

Una primera clasificación del genoma humano distingue, por un lado, los genes y secuencias relacionadas con genes (exones, intrones, regiones no traducidas que contienen elementos reguladores, etc.), y por otro todo el ADN que está entre los genes, llamado ADN extragénico o «de relleno» y que no codifica ninguna proteína ni contiene ningún elemento funcional. Curiosamente, la mayor parte del genoma humano (un 70 por ciento) está formada por este último, de forma que sólo un 30 por ciento del genoma humano incluye secuencias relacionadas con genes. Lo más sorprendente es que de este 30 por ciento sólo un cinco por ciento está constituído por ADN codificante (exones), siendo el resto ADN no-codificante asociado a genes. Por tanto, resulta que sólo un 1,5-2 por ciento del total del genoma humano es ADN codificante. El ADN extragénico está formado, sobre todo, por los componentes repetitivos del genoma humano que se explicarán más adelante, aunque también hay secuencias únicas o en bajo número de copia.

www.FreeLibros.me


CAPITULO 4

5/12/06

07:06

Página 59

Desde la publicación del primer borrador del Genoma Humano en febrero de 2001, podemos dar unos valores promedio estimados a partir de los datos publicados:

• • • •

Se estima que el genoma humano contiene en torno a los 20 000-25 000 genes. Alrededor de un 50 por ciento del genoma humano está constituido por ADN repetitivo. Se puede estimar que la densidad media de genes es de un gen cada 100 kb, aunque existen regiones ricas en genes (algunas zonas del cromosoma 19, por ejemplo) y otras regiones que son muy pobres en genes (como el cromosoma Y). Por tanto, se puede deducir una frecuencia media de 10 genes por cada Mb de secuencia. El tamaño promedio de un gen humano es de 20-30 kb, aunque hay grandes diferencias de unos genes a otros. El número de exones que forman un gen es muy variable (desde genes que tienen un solo exón hasta algunos genes con 100 exones o más), pero podemos establecer un valor promedio de siete-ocho exones por gen. El tamaño medio de un exón es de 150 nucleótidos. Por lo que respecta a los intrones, en cambio, existe una enorme variabilidad de tamaños, y no es infrecuente encontrar en casi todos los genes algún intrón de gran tamaño. El tamaño medio de un ARNm es de 1,8-2,2 kb incluyendo las regiones no-traducidas flanqueantes. La longitud media de una región codificante es de 1,4 kb.

Una de las características más evidentes del borrador de nuestro genoma es su heterogeneidad. En efecto, la secuencia no es uniforme, sino que muchas de sus características (riqueza en C+G frente a A+T, riqueza en genes, etc.) se distribuyen heterogéneamente, con regiones de gran abundancia flanqueadas por regiones en que esos parámetros son más escasos. Así por ejemplo, el contenido medio de G+C del genoma humano es del 41 por ciento, menor de lo teóricamente esperado. Además, si el genoma se divide en «ventanas» de 20 kb se observan regiones con valores muy alejados del promedio, con una dispersión 15 veces mayor de lo que sería esperable si la distribución fuese uniforme. La distribución de %G+C de estas ventanas no se ajusta a una distribución normal, sino que está desviada hacia valores bajos. Además, se ha comprobado que los genes tienden a concentrarse en las ventanas más ricas en G+C. Esto se conocía ya de antiguo, y de hecho se había acuñado el término isocoro para designar las regiones genómicas que son homogéneas en cuanto al contenido en G+C y que pueden separarse mediante gradientes de densidad. Se distinguen isocoros L e isocoros H, según su contenido en G+C sea bajo (Low) o alto (High), y dentro de cada isocoro hay varios subgrupos. La tabla que se presenta a continuación resume algunas características importantes de los distintos isocoros: Isocoro

% GC

% del genoma

Contenido Genes %

Mb ADN

Densidad de genes

L1 L2 H1 H2 H3

38 41 44 49 53

30 32 19 10 9

48

1,860

1 cada 130 kb

27

870

1 cada 100 kb

25

270

1 cada 35 kb

www.FreeLibros.me

Estructura del genoma humano y variación inter-individual

• • •

59


CAPITULO 4

60

5/12/06

07:06

Página 60

La geografía del genoma humano

Como puede apreciarse, existe una relación directa entre el contenido de una región genómica en nucleótidos G+C y su riqueza en genes. Es decir, hay en el genoma humano unas regiones con mayor riqueza de genes, regiones que a su vez son las que tienen un mayor porcentaje de nucleótidos G+C. Otro hallazgo inesperado en nuestro genoma ha sido la presencia de mayor número de duplicaciones del que se había estimado hasta entonces. De hecho, el análisis muestra alrededor de un cinco por ciento de duplicaciones segmentarias, definidas como dos o más segmentos cromosómicos >1 kb con >90 por ciento de identidad de secuencia; dicho nivel de homología corresponde a una antigüedad de unos 40 millones de años. Las duplicaciones intracromosómicas (las copias están en el mismo cromosoma) tienen un tamaño medio de unas 100 kb, mientras que las duplicaciones intercromosómicas (entre cromosomas distintos) son más pequeñas (1050 kb). Las duplicaciones segmentarias son más frecuentes en regiones centroméricas y cerca de los telómeros (donde pueden llegar a constituir un 25 por ciento de la secuencia). Los centrómeros, en concreto, están flanqueados por regiones ricas en duplicaciones intercromosómicas procedentes de regiones eucromáticas de otros cromosomas, que se han ido transponiendo a zonas pericentroméricas a una velocidad de seis-siete eventos por millón de años durante la evolución de primates. Las duplicaciones intracromosómicas pueden dar lugar a alteraciones genómicas, como veremos más adelante. La Figura 4.6 muestra esquemáticamente los tipos de duplicaciones segmentarias.

El análisis de la secuencia también ha mostrado la alta cantidad de pseudogenes que hay en el genoma humano. Como su nombre indica, los pseudogenes son versiones «incorrectas» de genes, que contienen diversos tipos de mutaciones y habitualmente no se transcriben. Se dividen en pseudogenes no procesados y pseudogenes procesados. Los primeros son copias de un gen, habitualmente originadas por duplicación del gen original y posteriores mutaciones que hacen que la copia pierda su capacidad codificante. Contienen exones e intrones, pero carecen de promotor y habitualmente tienen codones de parada prematuros. En cambio, los pseudogenes procesados son copias del ARN mensajero de un gen, que se ha retrotranscrito e insertado en otra posición del genoma (de ahí que se denominen también retropseudogenes). No tienen intrones, y tampoco tienen capacidad codificante por la ausencia de promotor y por la presencia de codones de parada. Se han identificado unos 11 000 pseudogenes en el genoma humano, de los que la mayor parte (unos 8 000) son pseudogenes procesados. En total, se estima que el número de pseudogenes en nuestro genoma puede llegar a unos 20 000. De todas formas, todos los pseudogenes detectados se originan a partir de tan sólo unos 2 500 genes funcionales, de modo que la mayor parte de los genes no tienen ningún pseudogen en el genoma. La Figura 4.7 muestra la estructura de los distintos tipos de pseudogenes.

Recientemente se han encontrado 481 segmentos >200 pares de bases totalmente conservados (100 por ciento de identidad sin gaps) en regiones ortólogas de humano, rata y ratón, y la gran mayoría están también conservados en pollo y perro (95

www.FreeLibros.me


CAPITULO 4

5/12/06

07:06

Página 61

www.FreeLibros.me

61

Estructura del genoma humano y variación inter-individual

y 99 por ciento de identidad, respectivamente). Muchas también están conservadas en pez. Estos «elementos ultraconservados» se solapan con exones de genes implicados en el procesamiento de ARN, y también son abundantes en intrones de genes relacionados con el desarrollo o con la regulación de la transcripción. Junto con las más de 5 000 secuencias >100 nucleótidos que están totalmente conservadas en los tres mamíferos secuenciados, estos fragmentos constituyen una nueva clase de elementos genéticos cuya función está por determinar, pero el hecho de que están más conservados que las proteínas indica que deben jugar algún papel importante. También es importante dedicar unas líneas a describir la presencia de genes que dan lugar a microARN. Como es sabido, el estudio del mecanismo de interferencia de ARN ha llevado a la identificación de ARN interferentes endógenos en los genomas de eucariotas, incluido el genoma humano. Estos ARN se denominan microARN (miARN) y se transcriben a partir de genes con un promotor de ARN-polimerasa II. Estos genes tienen un segmento palindrómico, de modo que el ARNm primario forma un pri-miARN que contiene una horquilla de ARN bicatenario; este pri-miARNm es procesado dentro del núcleo de la célula por una ARNasa tipo III llamada DROSHA y esto da lugar a un pre-miARN, una ARN bicatenario con forma de horquilla de unos 70 nucleótidos de tamaño. El pre-miARN sale del núcleo y es procesado en el citoplasma por Dicer, originando un miARN de unos 22 nucleótidos. Éste entra a formar parte del complejo RISC (denominado miRISC para los miARN) y regula la expresión de genes diana mediante degradación de sus mensajeros o por represión de la traducción. Actualmente se han identificado más de 300 genes de miARN en el genoma humano, y se calcula que puede haber en torno a 500. La mayoría de estos genes se localizan en intrones de genes codificantes, y además están bastante conservados en primates. Dado que cada uno de estos miARN puede regular la expresión de varios genes diana, se estima que hasta un 20-30 por ciento de todos los genes del genoma humano pueden estar regulados por miARN, lo que les confiere una extraordinaria importancia. La secuenciación del genoma humano ha permitido también estudiar la variación genética inter-individual, es decir, las diferencias genéticas que están en la base de las diferencias fenotípicas entre individuos. Esto tiene gran relevancia médica, porque muchas de estas variantes pueden ser también causa de la distinta susceptibilidad a desarrollar enfermedades o la diferente respuesta a fármacos que tienen personas distintas. Uno de los tipos más importantes de variabilidad genética es el constituido por los cambios en un nucleótido de la secuencia, conocidos con el nombre de SNP. Uno de los objetivos del PROYECTO GENOMA HUMANO era el estudio de la diversidad genética, y esto ha cristalizado en otro proyecto internacional denominado Proyecto HapMap que se propone precisamente identificar los SNP más frecuentes en el genoma humano en individuos de diferentes grupos étnicos. En octubre de 2005, el Proyecto Hapmap publicó un primer mapa que contiene 1 007 329 SNP con una distancia media entre ellos de cinco kb, con una frecuencia del alelo menos frecuente igual o superior al cinco por ciento (es decir, presentes en al menos el cinco por ciento de la población). Todos estos SNP fueron genotipados en 269 individuos de cuatro grupos raciales: 90 de raza yoruba, de Nigeria; 90 caucasianos de Utah; 45 de raza han, de China; y 44 japoneses. La segunda fase de este Proyecto se propone genotipar otros cinco millones de SNP. La inspección de estos mapas permite hacerse una idea


CAPITULO 4

62

5/12/06

07:06

Página 62

La geografía del genoma humano

de la variación en el genoma, tanto entre individuos como entre distintos grupos raciales. Además, estos datos han permitido comprobar que esta variación se agrupa en bloques, de modo que todos los SNP de un mismo bloque se heredan juntos. En un capítulo posterior veremos la importancia de estos bloques para estudiar la asociación de SNP concretos con la susceptibilidad a padecer enfermedades. La Figura 4.8 muestra la estructura de los haplotipos formados por los alelos de varios SNP cercanos.

Otro tipo de variación que se ha descubierto al analizar la secuencia del genoma humano es la originada por diferencias en el número de copias de grandes segmentos genómicos. Al analizar genomas de distintos individuos, se ha visto que existen unas 200-300 regiones genómicas de tamaño grande (entre 10 y 50 kilobases) cuyo número de copias en el genoma es diferente de unos individuos a otros. Este tipo de variaciones, llamadas LCV (Large-scale Copy number Variations) o CNP (Copy Number Polymorphisms) pueden ser deleciones o repeticiones en tándem. Una característica de todas estas regiones es que están flanqueadas por duplicaciones segmentarias, y esto hace pensar que la variación en el número de copias es el resultado de reordenaciones entre esos elementos flanqueantes. Aunque su papel biológico todavía no está claro, los CNP pueden tener importancia en la variación genética inter-individual que explica las diferencias en la predisposición a desarrollar enfermedades. Finalmente, se ha catalogado también otro tipo de variación consistente en polimorfismos de inserción/deleción pequeños (de tamaños entre un nucleótido a 10 kb). Se han detectado varios cientos de miles, y se estima que en total hay alrededor de 1,5 millones de estos polimorfimos en el genoma humano. Aunque se distribuyen por todo el genoma, se ha visto que en algunas regiones son especialmente frecuentes. Muchos de ellos están dentro de genes, y pueden causar alteraciones cuando afectan al promotor o a la región codificante (exones).

4.3 El ADN repetitivo Como hemos visto al principio de este capítulo, hasta un 50 por ciento del genoma humano está constituido por ADN repetitivo, antiguamente conocido como «ADN basura». Por su importancia, a continuación estudiamos con mayor detalle su composición y los distintos tipos de secuencias que lo forman. Ya se ha mencionado que podemos encontrar ADN repetitivo tanto en el ADN codificante (en los genes y secuencias relacionadas) como en el ADN no-codificante, pero la mayor parte se encuentra en el ADN no-codificante. Quizás el único ejemplo de ADN repetitivo codificante que merece la pena reseñar es el correspondiente al ADN ribosomal, que se concentra en los brazos cortos de los cromosomas acrocéntricos (13, 14, 15, 21 y 22) y está formado por tres genes que dan lugar a los tres ARN ribosomales de 5,8S, de 18S y de 28S. Los tres genes están juntos formando un bloque que mide unas 13 kilobases. Estos bloques se encuentran repetidos unas 50 veces, separados entre sí por un espaciador intergénico que mide unas 30 kilobases. En conjunto, el ADN ribosomal ocupa un tamaño de unas dos megabases.

www.FreeLibros.me


CAPITULO 4

5/12/06

07:06

Página 63

El genoma humano contiene en total unas 250 Mb de ADN satélite (llamado así porque al separar el ADN genómico en gradientes de densidad aparece como tres bandas «satélites» de la banda principal). El ADN satélite está formado por la repetición de una secuencia de ADN miles de veces en tándem, es decir unas copias pegadas a otras. Esto da lugar a regiones repetidas con tamaños que van desde 100 kb hasta varias megabases. Por ejemplo, el ADN Satélite 1 es una secuencia de 42 nucleótidos, mientras que en el Satélite 2 la secuencia repetida es (ATTCCATTCG) y en el Satélite 3 se repite el pentámero (ATTCC). Un tipo de ADN satélite muy importante es el ADN alfoide o Satélite alfa, en el que la secuencia repetida tiene un tamaño de 171 nucleótidos, y que forma parte del ADN de los centrómeros de los cromosomas humanos. Otros tipos de ADN satélite son el Satélite beta (repetición de 68 nucleótidos) y el Satélite gamma (repetición de 220 nucleótidos), que también se encuentran en la cromatina centromérica de varios cromosomas. El ADN de tipo Minisatélite está formado por secuencias de 6-25 nucleótidos que se repiten en tándem hasta dar un tamaño total entre 100 nucleótidos y 20 kb. Un ejemplo de ADN Minisatélite es la repetición que forma los telómeros de los cromosomas humanos, en los que el hexanucleótido (TTAGGG) se repite miles de veces en tándem dando lugar a bloques de 5-20 kb de tamaño. Algunas repeticiones de este tipo son polimórficas, y dan lugar a los marcadores de tipo VNTR que hemos mencionado en un apartado anterior. El ADN de tipo Microsatélite está formado por secuencias de dos, tres o cuatro nucleótidos que se repiten hasta dar bloques con un tamaño total habitualmente no superior a 150 nucleótidos. Hay repeticiones de este tipo por todo el genoma humano, y muchas de ellas son muy útiles como marcadores genéticos porque el número de repeticiones varía entre individuos. Ejemplos de ADN microsatélite son los dinucleótidos (CA), o las repeticiones de trinucleótidos (CAG).

El ADN repetido disperso está formado por secuencias que se repiten miles de veces en el genoma humano, pero no en tándem sino de manera dispersa. Este tipo de repeticiones constituyen un 45 por ciento de todo el genoma humano y se clasifican en función del tamaño de la unidad repetida:

Los SINE (Short Interspersed Nuclear Elements, elementos nucleares dispersos cortos) suponen un 13 por ciento del genoma humano. Son secuencias cortas repetidas miles de veces en el genoma humano de forma dispersa. El principal SINE es la familia de elementos Alu, que es específica de primates y constituye un 10 por ciento de nuestro genoma. Un elemento Alu está formado por una secuencia de 250-280 nucleótidos, con unas 1 500 000 copias por genoma y

www.FreeLibros.me

63

El ADN repetitivo

En el ADN no-codificante, tanto intragénico (es decir, intrones y otras regiones no-codificantes relacionadas con genes) como extragénico, podemos encontrar diversos tipos de elementos repetidos. En general, se trata de una secuencia de ADN que se repite en el genoma cientos o miles de veces. Estas repeticiones pueden encontrarse en tándem (es decir, seguidas una detrás de otra) o dispersas. El ADN repetido en tándem se divide en varios grupos según el tamaño total que origina la repetición:


CAPITULO 4

5/12/06

64

La geografía del genoma humano

07:06

Página 64

una repetición cada cuatro kb como promedio. Es un elemento relativamente rico en guaninas+citosinas (56 por ciento de contenido en CG, mientras que el contenido promedio del genoma humano es del 41 por ciento). Se localiza predominantemente en la bandas R de los cromosomas humanos. Está flanqueado por pequeñas repeticiones directas (en la misma orientación). Su estructura es la de un dímero no idéntico, ya que el segundo monómero es 30 nucleótidos mayor que el primero. Contiene colas poli-A al final de cada monómero, y se transcribe por la ARN polimerasa III a partir de un promotor interno, pero no codifica ninguna proteína. Actúa como un retrotransposón, ya que puede copiarse e insertarse en otras regiones del genoma. Los LINE (Long Interspersed Nuclear Elements, o elementos nucleares dispersos largos) constituyen un 20 por ciento del genoma humano. Son secuencias con un tamaño de varias kilobases, agrupados en distintas familias. El principal LINE es el llamado LINE-1 o L1, formado por una secuencia de unas seis kb repetida unas 800 000 veces en el genoma (aunque muchos de estos elementos no están completos, sino truncados y les falta la parte 5’), llegando a constituir alrededor de un 15 por ciento del genoma. Estos elementos, al contrario que los SINE, no son ricos en guaninas+citosinas (tienen un 42 por ciento de citosinas+guaninas, que es cercano al contenido promedio del genoma humano) y se localizan predominantemente en las bandas G de los cromosomas. Un elemento L1 codifica dos proteínas: una ARN-binding protein en el marco de lectura ORF1 y una proteína con actividad endonucleasa y retrotranscriptasa en el marco de lectura ORF2. Está flanqueado por unas pequeñas repeticiones directas (en la misma orientación) y termina en una cola poli-A. Los elementos LINE son retrotransposones, puesto que pueden copiarse a sí mismos a través de un intermediario ARN y transponerse a otras localizaciones genómicas. Según el modelo más aceptado, el elemento se transcribe por la ARN polimerasa II a partir de un promotor interno, sus productos proteicos se unen a la cola poli-A de su propio ARN mensajero y el complejo se inserta en el ADN genómico por la acción combinada de la endonucleasa (que corta dentro de regiones ricas en AT que llevan la secuencia TTTT↓A) y de la retrotranscriptasa. Las proteínas codificadas por los LINE son utilizadas también para la retrotransposición de elementos SINE y de pseudogenes procesados, por lo que pueden jugar un importante papel como elemento modificador del genoma. De hecho se ha visto que la secuencia propia de los L1 tiene la propiedad de inhibir la transcripción, de ahí que los niveles de ARNm y proteínas codificadas por los L1 en las células sea muy bajo. Lo más interesante es que también pueden modificar la transcripción de los genes en cuyos intrones hay abundancia de estos elementos: un 80 por ciento de los genes humanos tienen L1 en sus intrones, y la densidad en L1 correlaciona negativamente con los niveles de expresión de estos genes. Por tanto, su papel tanto en la evolución de genomas como en la regulación génica le confiere una gran importancia. Se acabó el mito del «ADN basura». Los HERV (retrovirus endógenos humanos), representan copias de los retrovirus humanos que se han ido integrando en el genoma humano en el curso

www.FreeLibros.me


CAPITULO 4

5/12/06

07:06

Página 65

65

transcripción Reparación

ARNm

Unión de las proteínas a su propio ARNm

traducción

Rotura endonucleolítica

Retrotranscripción

La Figura 4.9 ilustra el mecanismo de retrotransposición de los LINE.

de la evolución y con frecuencia son el origen de proto-oncogenes celulares. Habitualmente representan copias truncadas del genoma de estos virus, y constituyen alrededor de un ocho por ciento del genoma (hay unas 450 000 copias). Como habitualmente conservan alguna de las repeticiones terminales largas de estos genomas, se denominan también repeticiones tipo LTR (Long Terminal Repeat). Nuestro genoma también contiene unas 300 000 copias de elementos repetidos originados por transposones ADN, lo que supone un tres por ciento del total del genoma. Estos elementos contienen el gen (habitualmente truncado) de la transposasa, flanqueado por repeticiones invertidas. De entre las distintas familias que existen cabe destacar el tipo MER1 o MER2 y los elementos mariner (Hsmar2), responsables de algunas reordenaciones cromosómicas importantes en patología humana.

La Figura 4.10 muestra la estructura de los distintos tipos de repeticiones dispersas del genoma humano.

Es importante hacer algún comentario sobre la movilidad de los retroelementos dispersos. Tanto los LINE como los Alu que estén completos pueden, en teoría, copiarse e insertarse en otra posición del genoma a través de un intermediario ARNm. De hecho, esto sucede habitualmente, aunque por fortuna con muy baja frecuencia. Se calcula que uno de cada 100-200 nuevos nacimientos lleva una inserción nueva de un Alu o de un L1, que pueden ser causa de enfermedades por diversos mecanismos.

www.FreeLibros.me

El ADN repetitivo

Nuevo LINE (copia en otra localización)

LINE


CAPITULO 4

66

5/12/06

07:06

Página 66

La geografía del genoma humano

Esta tasa de nuevas inserciones es mucho más baja que en otros mamíferos. Por lo que respecta a los L1, se calcula que existen actualmente unos 5 000 elementos completos en el genoma humano, de los cuales unos 90 son activos (capaces de retrotransposición). El potencial patogénico de estos elementos viene dado por la propia capacidad de insertarse aleatoriamente en el genoma (e interrumpir genes), por la desregulación de la expresión de genes cercanos (por los elementos promotores de los LINE y SINE), pero sobre todo por recombinación ilegítima entre copias de Alu o L1 que están en localizaciones cromosómicas distintas. Curiosamente, los elementos Alu causan este tipo de recombinación con más frecuencia que los L1, especialmente en algunos genes que sufren duplicaciones o deleciones por recombinación entre secuencias Alu. Para finalizar, es interesante tener una visión de conjunto de la localización de los distintos tipos de elementos repetidos en el genoma humano, representados sobre un cariotipo convencional. Como ya se ha dicho, el ADN ribosomal se localiza en el brazo corto de los cromosomas acrocéntricos. El satélite alfa puede verse en todos los centrómeros. El satélite beta, en cambio, está en localización pericentromérica en los cromosomas acrocéntricos y en la constricción secundaria del cromosoma 1. El satélite gamma es pericentromérico en los cromosomas 8 y X. El satélite 1 está en los centrómeros de los cromosomas 3 y 4, además de encontrarse también en el brazo corto de los cromosomas acrocéntricos (distal al ADN ribosomal). El satélite 2 es pericentromérico en los cromosomas 2 y 10, además de formar la constricción secundaria de los cromosomas 1 y 16. Finalmente, el satélite 3 está en la constricción secundaria de los cromosomas 9 e Y, así como en el brazo corto de los cromosomas acrocéntricos (proximal al ADN ribosomal). Los elementos dispersos se encuentran distribuidos por todo el genoma, siendo los LINE más abundantes en bandas G y los elementos SINE más abundantes en bandas R (bandas claras); microsatélites y minisatélites también están dispersos, aunque éstos últimos tienden a concentrarse en torno a los telómeros. En la Figura 4.11 se ven dos ejemplos de la distribución de elementos repetidos de tipo satélite en cromosomas humanos.

4.4 El genoma mitocondrial La mitocondria es un orgánulo de probable origen endosimbióntico que se ha adaptado a su nicho intracelular: para aumentar su tasa de replicación y asegurar la transmisión a las células hijas después de cada división mitótica, el genoma de las mitocondrias de mamíferos se ha ido reduciendo de tamaño hasta alcanzar las 16 569 kb en el caso del genoma mitocondrial humano. Las mitocondrias son las verdaderas centrales térmicas de nuestro organismo ya que en ellas tiene lugar la fosforilación oxidativa (OXPHOS), es decir, la respiración celular acoplada a la producción de energía en forma de ATP. El funcionamiento del sistema OXPHOS tiene, además, importancia médica por la generación de especies reactivas de O2 (Reactive Oxygen Species, ROS) y por la regulación de la muerte celular programada o apoptosis. Las proteínas incluidas en el OXPHOS se localizan dentro de la membrana mitocon-

www.FreeLibros.me


CAPITULO 4

5/12/06

07:06

Página 67

• • •

Genes que codifican las dos subunidades 12S y 16S del ARNr (ARN ribosomal) de la matriz mitocondrial. Los genes para los 22 ARNt (ARN transferente), requeridos para la síntesis de proteínas mitocondriales en la misma matriz mitocondrial. Genes que codifican 13 polipéptidos que forman parte de los complejos multienzimáticos del sistema OXPHOS. En concreto, en el genoma mitocondrial se codifican siete subunidades del Complejo I, una subunidad del Complejo III, tres subunidades del Complejo IV, y dos subunidades de la ATPasa (Complejo V).

Es importante no perder de vista que el resto de las subunidades polipeptídicas de estos complejos, así como el Complejo II completo, están codificados en el genoma nuclear, de manera que no todas las enfermedades mitocondriales están necesariamente causadas por alteraciones en el ADN mitocondrial. La Figura 4.12 muestra los complejos proteicos de la membrana de la mitocondria que están codificados por genes del propio genoma mitocondrial.

La característica estructural más sorprendente del ADNmt es que los genes se encuentran situados uno a continuación del otro, sin apenas intrones ni regiones no codificantes entre los genes. Al contrario que el genoma nuclear, en el que las regiones no codificantes son mayoritarias, el ADN mitocondrial sólo posee un tres por ciento de secuencias no codificantes. Veintiocho de los genes mitocondriales (dos ARNr, 14 ARNt y 12 polipéptidos) se encuentran en una de las cadenas (cadena H o pesada), mientras que los nueve genes restantes (un polipéptido y ocho ARNt) están en la cadena complementaria (cadena L o ligera). La única zona del ADNmt que no codifica ningún gen es la región del bucle de desplazamiento (bucle-D), localizada alrededor del origen de replicación de la cadena H. Esta región contiene también los promotores de la transcripción y los elementos reguladores de la expresión génica. Otra de las peculiaridades de la organización genética del ADNmt es que los genes de los ARNt se distribuyen entre los genes de los ARNr y los codificantes de proteínas; esta disposición tiene consecuencias muy importantes para el procesamiento del ARN. Para la replicación del ADNmt hacen falta dos orígenes diferentes, uno para cada cadena (OH y OL). Ambos orígenes de replicación están muy separados, haciendo que el proceso sea unidireccional y asimétrico. La síntesis del ADN se inicia en OH y es realizada por una polimerasa específica de la mitocondria, la ADNpol γ, que alarga un ARN iniciador fruto del procesamiento de un transcrito primario que se sintetiza a partir del promotor L. La replicación continúa de modo unidireccional

www.FreeLibros.me

67

El genoma mitocondrial

drial interna, e incluyen: (1) componentes de la cadena transportadora de electrones (Cadena respiratoria mitocondrial, CRM); (2) ATPasa de membrana; (3) Translocador de nucleótidos de Adenina (ANT). El ADNmt humano es una molécula circular de 16 569 pares de bases. El número de moléculas de ADNmt por célula varía entre unos pocos cientos en los espermatozoides a unas 200 000 copias en el oocito, pero en la mayor parte de los tejidos el rango está comprendido entre unas 1 000 y 10 000 copias por célula, con 2-10 moléculas de ADN por mitocondria. Este genoma contiene información para 37 genes:


CAPITULO 4

68

5/12/06

07:06

Página 68

hasta alcanzar OL, momento en el cual comienza la síntesis de la segunda cadena del ADN, alargando también un pequeño iniciador de ARN.

La geografía del genoma humano

La Figura 4.13 muestra la estructura del ADN mitocondrial.

En la transcripción del ADNmt intervienen una polimerasa de ARN, al menos un factor de transcripción implicado en la iniciación (mtTFA), y uno de terminación (mTERF). Las dos cadenas del ADNmt se transcriben completamente a partir de tres puntos de iniciación diferentes, dos para la cadena pesada (H1 y H2) y uno para la cadena ligera (L), originando tres moléculas policistrónicas que se procesan posteriormente por cortes endonucleolíticos precisos en los extremos 5´ y 3´ de las secuencias de los ARNt, para dar lugar a los ARNr, ARNt y ARNm maduros. De esta forma los ARNt, situados entre los genes de los ARNr y ARNm, actúan como señales de reconocimiento para los enzimas de procesamiento. En particular, la cadena H se transcribe mediante dos unidades de transcripción solapadas en la región de los ARNr: la primera de estas unidades comienza delante del gen para el ARNtPhe (lugar de iniciación H1), termina en el extremo 3´ del gen para el ARNr 16S y es responsable de la síntesis de los ARNr 12S y 16S, del ARNtPhe y del ARNtVal. El factor de terminación (mTERF) se une a una secuencia situada en el gen del ARNtLeu y provoca la terminación de esta unidad. La segunda unidad de transcripción comienza cerca del extremo 5´ del gen del ARNr 12S (lugar de iniciación H2) y transcribe la casi totalidad de la cadena pesada; el procesamiento de este ARN policistrónico origina los ARNm de 12 péptidos y los otros 12 ARNt codificados en esta cadena. La transcripción de la cadena ligera comienza cerca del extremo 5´ del ARN 7S (en el bucle-D) y da lugar al iniciador de la replicación de la cadena pesada, ocho ARNt y un péptido (ND6). La síntesis de las proteínas mitocondriales tiene lugar en ribosomas específicos de la mitocondria, cuyos componentes están codificados en el ADNmt (ARNr 12S y 16S) y en el genoma nuclear (84 proteínas ribosomales). En este sistema de traducción se sintetizan las trece proteínas codificadas en el ADNmt utilizando un código genético que difiere ligeramente del código genético universal. Así, UGA codifica el aminoácido triptófano (Trp) en vez de ser un codón de terminación, y los codones AUA y AUU se utilizan también como codones de iniciación. La biogénesis de la mitocondria depende de la expresión coordinada de los genomas mitocondrial y nuclear, pero hasta ahora se conoce muy poco acerca de los mecanismos que regulan la interacción de ambos sistemas genéticos. La expresión del ADNmt parece estar regulada por el factor de iniciación de la transcripción mtTFA, codificado en el genoma nuclear. Este factor podría ser el responsable tanto de los niveles de ARN como del número de copias de ADNmt, ya que la replicación depende de la síntesis de un iniciador de ARN a partir del promotor de la cadena ligera. La regulación de la relación entre los ARNr y los ARNm mitocondriales se realiza fundamentalmente mediante la selección del lugar de iniciación de la transcripción de la cadena pesada, que a su vez está relacionada con el factor mtTERF (que causa terminación de la transcripción después de la síntesis de los ARNr) y con el procesamiento de los ARN primarios. Asimismo, la actividad transcripcional puede estar regulada por estímulos hormonales, especialmente por hormonas tiroideas que actúan tanto de un modo indirecto (por activación de genes nucleares) como directamente sobre el propio ADNmt.

www.FreeLibros.me


CAPITULO 5

5/12/06

07:08

Página 69

CAPÍTULO 5

El genoma humano en acción

Contenidos 5.1 La secuencia influye en el estado funcional de la cromatina 5.2 Modificaciones epigenéticas y su importancia en la regulación del estado funcional de la cromatina 5.3 Relación entre secuencia, estructura y función de la cromatina: territorios cromosómicos

5.1 La secuencia influye en el estado funcional de la cromatina Como ya se ha dicho, el grado de empaquetamiento no es uniforme a lo largo de todo el genoma. De hecho, en el núcleo en interfase siempre se distinguió una cromatina denominada eucromatina, poco condensada, y otra llamada heterocromatina, con un mayor grado de condensación. Hoy sabemos que estas categorías morfológicas tienen un correlato funcional, ya que la eucromatina es transcripcionalmente más activa mientras que los genes incluidos en heterocromatina tienen un bajo nivel de expresión. La heterocromatina, a su vez, puede ser de dos tipos: constitutiva, que nunca se transcribe y se localiza en los centrómeros y en la constricción secundaria de algunos cromosomas; o facultativa, que en el fondo es un tipo de eucromatina que se heterocromatiniza en situaciones concretas, como es el caso del cromosoma X inactivo en las mujeres. Además de estas dos grandes categorías de cromatina, es importante comprender que dentro de las regiones eucromáticas la cromatina tampoco es totalmente homogénea, como queda reflejado, por ejemplo, en su distinta repuesta a varias tinciones. Este comportamiento es precisamente la base del patrón de bandas característico de cada cromosoma y que permite la creación del cariotipo convencional. Como veremos en un capítulo posterior, la tinción con un colorante llamado Giemsa produce unas bandas oscuras (bandas G) separadas por bandas claras (bandas R). La tinción con otra sustancia llamada Quinacrina (que se une específicamente a regiones ricas en adeninas y timinas) produce un patrón de bandas similar a las bandas G, mientras que la tinción con Cromomicina-A (que se une preferentemente a regiones ricas en guaninas y citosinas) genera un patrón similar a las bandas R.

www.FreeLibros.me


CAPITULO 5

70

5/12/06

07:08

Página 70

El genoma humano en acción

Por tanto, las peculiaridades morfológicas de la cromatina son debidas, al menos en parte, a diferencias en la secuencia de nucleótidos del genoma; el modelo del andamio (scaffold) que vimos en el Capítulo 2 permite explicar esta relación, ya que las bandas G representan regiones con un mayor grado de empaquetamiento del ADN, lo que implica una mayor densidad de las regiones de unión al andamio (llamadas SAR). Como las SAR son relativamente ricas en adenina y timina, esto explica que estas regiones genómicas se tiñan más intensamente por Quinacrina y Giemsa, mientras las bandas R, más ricas en guanina y citosina, tienen un menor grado de empaquetamiento, menor densidad de SAR y se tiñen débilmente por estos colorantes. Por tanto, las distintas bandas del cariotipo reflejan no sólo diferencias en la condensación de la cromatina, sino también diferencias en su composición: ya hemos visto que el genoma humano tiene un contenido medio en G+C del 41 por ciento, pero que esto no se distribuye de manera uniforme por todo el genoma. A su vez, las diferencias en condensación y en composición de las distintas regiones de cromatina se correlacionan con otra variable importante: la riqueza en genes y su actividad transcripcional. Por ejemplo, se estima que un 80 por ciento de los genes se localizan en bandas R (las más ricas en nucleótidos G+C), que son las menos condensadas. También se ha observado que, en general, las bandas R son de replicación temprana, mientras que las bandas G son de replicación más tardía. Como se recordará del Capítulo 2, la replicación del ADN en eucariotas comienza en muchos orígenes de replicación durante la fase S del ciclo celular, pero no todos los orígenes de replicación comienzan a funcionar a la vez: hay unos orígenes que siempre comienzan al principio de la fase S (replicación temprana) y otros que van comenzando a funcionar más tarde (replicación tardía). Asimismo, se sabe que los genes constitutivos (housekeeping en inglés), que son los que se expresan en todos los tejidos, se replican temprano; por el contrario, los genes que están en regiones heterocromáticas (el cromosoma X inactivo, por ejemplo) son de replicación más tardía. Parece —por tanto— que regiones con alta densidad de genes, ricas en C+G y descondensadas se replican antes que regiones silenciadas o con baja densidad de genes. Otro aspecto que diferencia los distintos tipos de bandas es la acetilación de las histonas. Como se verá a continuación, se ha podido comprobar que la acetilación de las histonas que forman los nucleosomas lleva a la formación de una cromatina más abierta, que permite mejor el acceso de factores de transcripción y la expresión de los genes contenidos en esas regiones. Esto se debe a que las colas amino-terminales de las histonas interaccionan con más fuerza entre sí y con el ADN cuando los grupos épsilon-amino de las lisinas están en su forma des-acetilada; la acetilación relaja esas interacciones y descondensa parcialmente la fibra de 30 nm y la unión del ADN con los nucleososmas. Curiosamente, se ha comprobado que las histonas de las bandas G están menos acetiladas que las histonas de las bandas R. Esto ayudaría también a explicar la menor condensación de la cromatina en las bandas R, y nos proporciona un mecanismo para entender por qué las bandas R se replican antes y son más activas transcripcionalmente: por un lado, no necesitan descondensarse para que se lleve a cabo la replicación, y por otro constituyen unos dominios en los que el ADN es más accesible a los factores de transcripción. Figura 5.1 La acetilación de colas amino-terminales de las histonas influye en la condensación de la cromatina.

www.FreeLibros.me


CAPITULO 5

5/12/06

07:08

Página 71

Densidad en genes Porcentaje de G+C Replicación Composición Acetilación Histonas Repeticiones predominantes

Bandas G

Bandas R

Baja Bajo Tardía Ricas en A+T Baja LINE

Alta Alto Temprana Ricas en G+C Alta SINE

5.2 Modificaciones epigenéticas y su importancia 5.2 en la regulación del estado funcional de la cromatina Es muy importante comprender que los aspectos estructurales y funcionales se integran en un modelo «dinámico», según el cual una región de cromatina estará en un estado más o menos favorable a la expresión génica dependiendo del tipo de secuencias que la forman y también de las modificaciones epigenéticas a ese nivel. Por modificaciones epigenéticas se entienden todos aquellos cambios que sufre la cromatina pero que no afectan a la secuencia de nucleótidos: por eso no son modificaciones «genéticas», sino que están «por encima» (que es lo que significa epi en griego). En los últimos años se ha comprobado experimentalmente la gran importancia que tienen los mecanismos que regulan la actividad de la cromatina mediante cambios epigenéticos. Para entender esto, es importante recordar que la actividad transcripcional basal en eucariotas es esencialmente restrictiva, en el sentido de que los promotores están en estado inactivo hasta que se ponen en marcha por la acción de los elementos llamados «activadores» y el ensamblaje del complejo basal de transcripción. Para que estos factores proteicos se unan a sus dianas en el ADN es necesario que la cromatina de esa región esté relativamente descondensada, para exponer más fácilmente la doble hélice y permitir el acceso de factores proteicos. De hecho, los genes que son transcripcionalmente activos se asocian habitualmente con sitios hipersensibles a DNAsa I, regiones cortas (unos pocos cientos de pares de bases) formadas por ADN que no está asociado a nucleosomas, precisamente porque se encuentra unido a factores de transcripción. La Figura 5.2 ilustra esquemáticamente la distinta accesibilidad a una región de cromatina dependiendo del grado de condensación.

www.FreeLibros.me

71

Modificaciones epigenéticas y su importancia en la regulación del estado funcional …

En resumen, es importante darse cuenta de que los mecanismos básicos de regulación de la expresión génica estudiados en el Capítulo 1 están sometidos a un nivel superior de regulación, dependiente de la situación de un gen dentro del genoma y del estado funcional de la cromatina en que se encuentra, que a su vez está influido por el tipo de secuencias que la componen. Generalizando, podemos resumir las principales características de los dos estados de cromatina más frecuentes, representados por los dos tipos principales de bandas citogenéticas (banda G, oscuras, y bandas R, claras):


CAPITULO 5

72

5/12/06

07:08

Página 72

El genoma humano en acción

Los nucleosomas son, por tanto, un elemento fundamental para mantener este estado basal restrictivo, al impedir el acceso de la maquinaria transcripcional a los promotores. La represión transcripcional mediada por nucleosomas se debe tanto a las interacciones directas del octámero de histonas con el ADN, como a las interacciones que se originan entre nucleosomas vecinos para dar lugar a la fibra de cromatina. Como hemos visto más arriba, las colas N-terminales de las histonas de los nucleosomas quedan libres hacia fuera, y son las regiones más susceptibles de ser modificadas químicamente para variar su carga y alterar las interacciones, tanto entre histonas y ADN como entre nucleosomas vecinos. Por tanto, si conseguimos relajar alguna de estas interacciones conseguiremos favorecer la transcripción de los genes que están incluidos en esas regiones. Esta relajación se puede conseguir gracias a que las colas N-terminales de las histonas tienen una serie de aminoácidos (lisinas y serinas, principalmente) que pueden sufrir modificaciones covalentes del tipo acetilación, metilación o fosforilación, y que van a ser cruciales en la regulación de estos fenómenos. A su vez, estos cambios se coordinan con otras modificaciones epigenéticas que sufre la propia cadena de ADN en forma de metilación de algunos nucleótidos concretos, y en su conjunto ambos procesos constituyen un importante mecanismo de regulación de la actividad transcripcional. A continuación veremos por separado las modificaciones epigenéticas que sufre la cromatina, por una parte, y el ADN por otra. A. Modificación de la cromatina. Para superar la represión basal debida a la presencia de nucleosomas y facilitar la expresión de un gen, los activadores de la transcripción pueden potenciar la actividad transcripcional alterando, en primer lugar, la propia estructura de la cromatina: aunque el activador no se una directamente al promotor de un gen, puede reclutar distintas actividades modificadoras de la cromatina cuya acción sea conferir a esa región un estado que facilite la transcripción. Estas actividades pueden ser de varios tipos:

Complejos proteicos implicados en el remodelamiento nucleosomal: son capaces de mover los nucleosomas de su posición para dejar expuesta una región promotora y permitir la expresión génica. Este tipo de actividad está mediada por complejos multiproteicos con actividad ATPasa, de los cuales el primero en ser aislado fue el complejo SWI/SNF (primero se identificó en levaduras, después en humanos). Este complejo desestabiliza el nucleosoma al romper los contactos del ADN con el octámero, que queda libre para moverse y asociarse con una región vecina de la molécula de ADN. Todos los remodeladores de nucleosomas pertenecen a la familia SNF2 de ATPasas, y pueden dividirse en siete subgrupos dependiendo de los dominios proteicos que contienen.

En la Figura 5.3 se ilustra el movimiento de nucleosomas por la acción de remodeladores de la cromatina.

Complejos implicados en la acetilación de histonas: el factor Gcn5 de levadura fue el primer activador transcripcional con actividad acetilasa de histonas descubierto, en 1996. Posteriormente se vio que otros co-activadores de la transcripción de mamíferos también poseían actividad acetil-transferasa,

www.FreeLibros.me


CAPITULO 5

5/12/06

Página 73

factores tales como p300, CBP (CREB-BP) y P/CAF, de ahí que hoy se conozcan en conjunto con el nombre de HAT (Histone AcetylTransferase). Éstos actúan como factores de transcripción integradores de diversas vías de transducción de señales implicadas en el control del ciclo celular y de los procesos de diferenciación, reparación y apoptosis. Otros activadores transcripcionales con actividad HAT son el factor de transcripción TAFII250 (que forma parte del complejo TFIID), SRC-1 y ACTR (coactivadores de receptores nucleares). Al igual que la acetilación de las histonas conduce a la activación transcripcional, la des-acetilación de las histonas crea una estructura cromatínica más condensada que impide la transcripción de los genes incluidos en la esa región genómica. En este sentido, se ha comprobado que los factores HDAC1 y HDAC2 (Histone De-Acetylase), cuya función es des-acetilar las histonas, están presentes en el complejo Sin3-NcoR, un co-represor transcripcional que regula la expresión de genes importantes en el ciclo celular y en el desarrollo embrionario. En conjunto, acetilasas y des-acetilasas actúan sobre los mismos aminoácidos de las colas amino-terminales de las histonas H3 y H4, especialmente las lisinas 9, 14, 18 y 23 de la histona H3 y las lisinas 5, 8, 12 y 16 de la histona H4. En la Figura 5.1 ya se ha visto el posible mecanismo por el que la des-acetilación de las histonas favorece la compactación de nucleosomas vecinos e impide la transcripción en esa región. De hecho, se ha comprobado que la desacetilación de la lisina 16 en la histona H4 provoca la condensación de la fibra de 10 nm, mientras que la acetilación de este residuo impide la formación de la fibra de 30 nm y permite la interacción con co-activadores de la transcripción. Otras modificaciones muy importantes son la fosforilación de la histona H3 en la serina 10 y la metilación de las lisinas 4, 9, 27, 36 y 79 en la histona H3 y de la lisina 20 de la histona H4, metilación catalizada por unos complejos proteicos que tienen actividad metil-transferasa. Se ha comprobado que estas modificaciones actúan en coordinación con la acetilación, estableciendo lo que ahora se conoce como el «Código de Histonas». Según este código, una región se comportará como eucromatina o como heterocromatina dependiendo de las modificaciones epigenéticas de las histonas que conforman los nucleosomas de la región; las regiones limítrofes, en las que se da una transición de un tipo de cromatina al otro, muestran características propias de ambos tipos de cromatina, y son capaces de unir complejos proteicos llamados aisladores (en inglés insulator), que forman una especie de barrera física e impiden que un tipo de cromatina se extienda más allá del límite de la región e invada la región vecina. De modo general, el código de histonas establece que una región de eucromatina se caracteriza por tener la lisina 4 de la histona H3 metilada (con uno, dos o tres grupos metilo), y las lisinas 9 y 14 de la misma histona acetiladas. Se ha comprobado que esta configuración tiene la propiedad de unirse a un dominio proteico llamado «bromodominio», que está presente en muchos activadores de la transcripción. Una región con estas características puede heterocromatinizarse si sufre una cascada de alteraciones: la pérdida de la metilación de la lisina 4, la desacetilación progresiva de las lisinas 9 y 14, y

www.FreeLibros.me

73

Modificaciones epigenéticas y su importancia en la regulación del estado funcional …

07:08


CAPITULO 5

74

5/12/06

07:08

Página 74

El genoma humano en acción

finalmente la metilación de la lisina 9 constituyen una marca de heterocromatina, a la que se unen proteínas que contienen un dominio de silenciamiento llamado «cromodominio» que recluta factores de silenciamiento como la proteína HP1 (proteína de heterocromatina-1). Estas interacciones están influidas también por la fosforilación de la serina 10 de la histona H3; por ejemplo, dicha fosforilación —generada por la quinasa Aurora B— inhíbe la unión de HP1 con la lisina 9 metilada durante la mitosis.

Chromo

Me

Ac Me

14

T-K-Q-T-A-R-K-S-T T-K-Q-T-A-R-KT-G-G-K-A G-G-K-A 4

9

P

Ac Bromo

La Figura 5.4 ilustra el concepto del «Código de histonas» y su utilidad para definir distintas regiones de cromatina.

B. La metilación del ADN juega un papel fundamental en el mantenimiento del silenciamiento transcripcional. El ADN de vertebrados se metila en el carbono 5 de las citosinas que están en el dinucleótido CpG (la «p» indica el grupo fosfato que une una citosina con una guanina, en dirección 5’→3’). Curiosamente, la abundancia de este dinucleótido en el genoma de vertebrados es sólo un 25 por ciento de lo esperado, es decir, el porcentaje normalizado de este dinucleótido es de 0,25. En efecto, si el contenido en C+G del genoma es del 41 por ciento, la probabilidad esperada de encontrar un dinucleótido CpG es (0,205 × 0,205) = 0,042 (o sea, 4,2 por ciento); en cambio, la frecuencia observada de este dinucleótido está en torno al uno por ciento en el genoma humano, de ahí que el porcentaje normalizado sea 1/4 = 0,25. Además, los dinucleótidos CpG no están distribuidos homogéneamente a lo largo del genoma, sino que son más abundantes en los genes, tanto en los exones como, sobre todo, alrededor del inicio de la transcripción. Pues bien, los dinucleótidos CpG que tienen metilada la citosina son los que están distribuidos a lo largo de la secuencia de genes. Por el contrario, los dinucleótidos CpG que no están metilados tienden a concentrarse en regiones que se denominan islas CpG. Aunque estas islas se han definido tradicionalmente como las regiones de un tamaño igual o superior a 500 pb, con un contenido total de G+C superior a 50 por ciento y con un cociente de dinucleótidos CpG observados frente a esperados superior a 0,6, hoy en día se pueden definir por su porcentaje normalizado de CpG. De

www.FreeLibros.me


CAPITULO 5

5/12/06

07:08

Página 75

En la Figura 5.5 se representa la distribución de dinucleótidos CpG a lo largo de un gen, mostrando el concepto de «isla CpG».

La metilación del ADN está catalizada por unas metil-transferasas específicas de las citosinas que forman parte de dinucleótidos CpG, y se conocen básicamente dos tipos de estas metil-transferasas de ADN. Las DNMT3A y DNMT3B son responsables de la metilación de novo, es decir, la metilación de dinucleótidos CpG que no estaban previamente metilados. En cambio, la DNMT1 (ADN-metil-transferasa-1) es responsable de mantener la metilación durante la replicación. En efecto, dado que en la doble cadena de ADN un dinucleótido CpG tiene realmente dos citosinas metilables (ya que existe un CpG en cada una de las cadenas de la doble hélice), un sitio totalmente metilado tendrá realmente dos citosinas metiladas. Tras la replicación del ADN, ambas dobles hélices conservarán una cadena con el CpG metilado (la proveniente de la molécula original), mientras que la cadena de nueva síntesis estará sin metilar. Esto genera dinucleótidos CpG hemi-metilados, es decir, metilados en una de las citosinas pero no en la otra; la DNMT1 tiene la función de re-metilar precisamente estos dinucleótidos para restablecer el estado inicial de metilación completa que tenía la molécula original. La Figura 5.6 muestra el proceso de re-metilación de dinucleótidos CpG que han quedado hemi-metilados tras la replicación.

Numerosos estudios han mostrado el significado biológico de la metilación del ADN: 1) es un importante mecanismo epigenético de silenciamiento génico a nivel transcripcional, y permite mantener el silenciamiento de ciertos genes durante los procesos de diferenciación celular; 2) la metilación es un mecanismo de defensa frente a elementos móviles del genoma, cuyos promotores están habitualmente silenciados por metilación; y 3) la metilación es un mecanismo estabilizador de la cromatina, especialmente de la heterocromatina pericentromérica, ya que la des-metilación de este tipo de cromatina conduce a la aparición de reordenamientos cromosómicos severos. Los mecanismos moleculares por los que la metilación conduce al silenciamiento transcripcional pueden ser múltiples:

Impidiendo la unión de factores de transcripción al promotor. Por ejemplo, algunos factores de transcripción generales como Sp1, CREB, E2F o NF-kB

www.FreeLibros.me

75

Modificaciones epigenéticas y su importancia en la regulación del estado funcional …

hecho, el análisis de todos los promotores del genoma humano identifica dos tipos de genes: los que tienen un promotor con un porcentaje normalizado de CpG en torno al 0,61 y los que tienen un promotor con un porcentaje normalizado de CpG en torno al 0,23. Los primeros constituyen un 70 por ciento de todos los promotores, y corresponden a los genes constitutivos o «domésticos» (housekeeping, en inglés). Por el contrario, los promotores con bajo porcentaje normalizado de CpG constituyen un 30 por ciento del total de los promotores, y corresponden a los genes que se expresan en tejidos específicos. Los promotores que contienen una isla CpG están habitualmente hipometilados en la línea germinal, lo cual les protege frente a las transiciones C→T que sufren las citosinas metiladas.


CAPITULO 5

5/12/06

76

El genoma humano en acción

07:08

Página 76

se unen a dominios que contienen CpG, y esta unión disminuye cuando estos dominios están metilados. Sin embargo, este mecanismo no se puede aplicar de modo general a todos los genes. Mediante la unión específica de represores transcripcionales al ADN metilado. Existen varias proteínas de unión a los dinucleótidos CpG metilados, denominadas genéricamente MeCP (Methyl-Cytosine binding Protein) o MDB (Methyl Binding Domain), que forman parte de complejos con actividad represora de la transcripción. Por ejemplo, MeCP-2 es una proteína que contiene un dominio de unión a dinucleótidos CpG metilados, así como otro dominio por el que se une a un represor transcripcional llamado Sin3. Curiosamente, Sin3 reprime la transcripción a través de su unión con HDAC2 (que, como ya hemos visto, des-acetila las lisinas de la histona H3). De esta manera, la represión transcripcional debida a la metilación de los dinucleótidos CpG se produce gracias a la asociación entre metilación del ADN y acetilación de la cromatina, ya que el dominio de represión transcripcional de MeCP-2 es capaz de reclutar el complejo Sin3-NCoR-HDAC2 y así iniciar un foco de cromatina hipoacetilada en una región específica del genoma. Esto explica que las regiones en las que el ADN está metilado sean capaces de silenciar genes cercanos (aunque éstos no tengan sus dinucleótidos CpG metilados), al englobarlos en una región genómica silenciada por des-acetilación.

El vídeo incluido en la Figura 5.7 ilustra la interacción entre metilación del ADN y modificación de las histonas.

Una propiedad muy importante del silenciamiento por metilación es que es reversible: se ha comprobado que los promotores que han sido silenciados por metilación pueden reactivarse si se des-metila esa región. Un mecanismo posible para explicar esta reactivación es la pérdida de la metilación durante la replicación: esto sucedería si ciertos factores de transcripción o activadores nucleares consiguieran unirse a sus promotores inmediatamente después de la replicación y antes de que actúe la DNMT1 de mantenimiento en los sitios hemi-metilados. Una vez que se estabiliza el complejo basal de transcripción sobre esa región, éste atraería algunos componentes con actividad HAT, que a su vez actuarían manteniendo la cromatina abierta y permitiendo la transcripción. Esto, además, impediría la acción de la DNMT1 y terminaría por eliminar la metilación en esa región tras varios ciclos de replicación. Este mecanismo se conoce como des-metilación pasiva. Otro mecanismo alternativo para explicar la re-expresión de genes silenciados por metilación, sobre todo en células diferenciadas que ya no se replican, es la desmetilación activa, aunque todavía no se ha aislado de modo concluyente ninguna des-metilasa de ADN. En resumen, la metilación del ADN constituye un importantísimo mecanismo epigenético de regulación de la expresión génica, debido a su interacción con los mecanismos que modifican la estructura de la cromatina. El mantenimiento de los patrones de metilación explica también que las modificaciones epigenéticas sean heredadas establemente tras la replicación del ADN. Además, como ya se ha mencionado, la metilación tiene importantes implicaciones biológicas, y por tanto la alteración de los procesos normales de metilación de la cromatina puede pertur-

www.FreeLibros.me


CAPITULO 5

5/12/06

07:08

Página 77

La desaminación de citosinas metiladas (debida habitualmente a la acción de una citidín-desaminasa, o bien por desaminación hidrolítica espontánea) provoca un cambio de Citosina por Timina, haciendo que los dinucleótidos CpG metilados sean puntos calientes (hotspots) para la generación de mutaciones de este tipo. De hecho, se ha estimado que el 30 por ciento de las mutaciones encontradas en tumores en el gen TP53 (que codifica la proteína p53, un supresor tumoral importante) son transiciones C→T que tienen lugar dentro de dinucleótidos CpG. Se ha comprobado que durante el proceso de iniciación tumoral hay una hipometilación global del genoma de la célula pre-maligna, lo que provoca un aumento en la inestabilidad genómica y la aparición de anomalías cromosómicas. Por ejemplo, los ratones en los que el gen DNMT1 ha sido inactivado muestran una elevada tasa de deleciones o duplicaciones de regiones cromosómicas. Además, algunos oncogenes concretos se sobreexpresan en algunos tumores por des-metilación de sus promotores (por ejemplo el oncogén BCL2). Del mismo modo, se ha identificado una enfermedad (Síndrome ICF, siglas de Inmunodeficiencia, inestabilidad Centromérica y defectos Faciales) en la que los pacientes tienen mutaciones en el gen DNMT3B, que codifica una metil-transferasa que metila específicamente los satélites centroméricos 2 y 3; la desmetilación de esas regiones de heterocromatina provoca fusiones entre cromosomas. En conjunto, estos datos sugieren que la metilación es un mecanismo muy importante para mantener la estabilidad del genoma. Al mismo tiempo, la hipermetilación puntual de algunos genes supresores tumorales, con el consiguiente silenciamiento y pérdida de función, es un mecanismo muy frecuente de generación de distintos tipos de cáncer. Por ejem-

www.FreeLibros.me

77

Modificaciones epigenéticas y su importancia en la regulación del estado funcional …

bar procesos fisiológicos importantes. En primer lugar, por ser un mecanismo fundamental en el silenciamiento de retrovirus endógenos, transposones y ADN satélite, las alteraciones en la metilación de estos elementos puede provocar numerosas anomalías genéticas. Además, la metilación es la base molecular de los fenómenos de impronta genómica (imprinting) que se estudiarán más adelante, y es un mecanismo fundamental en la regulación de la expresión génica durante el desarrollo embrionario. De hecho, el embrión sufre una onda de des-metilación genómica global en la fase de mórula de ocho células, seguida por la re-metilación gradual que vuelve a fijar los patrones de metilación en la fase de blastocisto. También la inactivación del cromosoma X en mujeres es un proceso básicamente controlado por procesos de metilación, acetilación y silenciamiento. Por tanto, cada vez está más claro que la des-regulación de las modificaciones epigenéticas de la cromatina está en la base de algunas enfermedades humanas. El caso más claro es una enfermedad neurológica hereditaria llamada Síndrome de Rett, en el que se han identificado mutaciones en el gen que codifica la proteína de unión a metilcitosinas MECP2. Probablemente, esto origine un exceso de «ruido transcripcional» por falta de silenciamiento global de muchos genes, con efectos más marcados en el cerebro que en otros órganos. Por otra parte, el papel de la metilación en cáncer también está cobrando cada vez más importancia, ya que se ha visto que muchos tipos de tumores tienen alteraciones importantes en los procesos de metilación de la cromatina:


78

El genoma humano en acción

07:08

Página 78

plo, el gen RB1 está frecuentemente metilado en un tipo de tumores llamados retinoblastomas esporádicos. También es frecuente la hipermetilación (y silenciamiento) del gen supresor tumoral p16 en varios tipos de tumores; la hipermetilación del gen VHL (Von Hippel-Lindau) en 20 por ciento de los carcinomas de células renales esporádicos; la inactivación, por hipermetilación, del gen de reparación de desemparejamientos hMLH1 en tumores de colon esporádicos que muestran inestabilidad de microsatélites. En conjunto, se estima que en tejido tumoral hasta un 10 % de las islas CpG están metiladas, en contraste con células normales en las que este porcentaje es mucho más bajo. Por su parte, algunos complejos con actividad modificadora de la cromatina se han asociado también con el desarrollo de cáncer. Por ejemplo, el gen AIB1, que tiene actividad acetilasa de histonas, está amplificado en cáncer de mama y por tanto se expresa a niveles más altos de lo normal. Por otro lado, el co-activador transcripcional CBP, que también funciona como una acetilasa de histonas, está fusionado con el gen MOZ o con el gen MLL en pacientes con leucemia mieloide aguda; esta fusión hace que la actividad acetilasa esté aumentada en determinadas células de la médula ósea y esto desencadena la leucemia. Además, otro co-activador transcripcional con actividad acetilasa de histonas (la proteína p300) está mutado en cáncer colorrectal y delecionado en el 80 por ciento de los glioblastomas, un tipo de tumor cerebral. Lo mismo puede decirse de los complejos con actividad des-acetilasa de histonas (HDAC): ya hemos visto que la supresión de Myc y la unión de Rb con el factor de transcripción E2F dependen en gran medida de su unión con complejos que tienen actividad des-acetilasa. Además, se ha demostrado que algunas oncoproteinas

Translocación Translocación con con Proteína dede fusión Proteína fusión PML/ PML/RARa RARa

Gen Genque que responde responde

al Retinoico alÁcido Ácido Retinoico

Sin3 NCOR

Sin3 HDAC

NCOR

• Ausencia Ausencia dede ligando ligando • Desacetilación Desacetilación (Represión) (Represión)

Ac

Ac

NCOR

RXR

Ac

RXR

RXR

HAT

Sin3 HDAC

RAR

5/12/06

RAR

CAPITULO 5

HDAC

PML/RAR

Ac

• Unión Unióndel del ligando ligando (ácido retinoico ) (ácido retinoico)

• Forma Formaanómala anómala del delreceptor receptor

Acetilación • Acetilación ((Transcripción Transcripción )

• Impide Impide unión del del unión ligando ligando

La Figura 5.8 muestra la regulación de la transcripción de un gen que responde al ácido retinoico, mostrando la importancia de los complejos modificadores de la cromatina y su alteración en un tipo de leucemia.

www.FreeLibros.me


CAPITULO 5

5/12/06

07:08

Página 79

Considerando todos los ejemplos citados en los párrafos anteriores, podemos concluir que los procesos que regulan la metilación de la cromatina están implicados en la iniciación y progresión tumoral; esto, además, abre nuevas posibilidades terapéuticas en muchos tipos de cáncer, ya que el estado de metilación es potencialmente modificable mediante fármacos.

5.3 Relación entre secuencia, estructura y función 5.3 de la cromatina: territorios cromosómicos Al ocuparnos de los mecanismos que regulan la función del genoma a nivel global, es importante tener en cuenta el nivel superior de organización de un genoma dentro del núcleo. En los últimos años se ha puesto en evidencia que distintas regiones de la fibra de cromatina tienden a ocupar posiciones concretas en el núcleo, dependiendo de la secuencia subyacente, del estado transcripcional de los genes de esa región y de sus modificaciones epigenéticas, del tiempo de replicación del ADN implicado, etc. Por tanto, cada vez está más claro que si queremos tener una imagen completa de cómo se regula la función del genoma, no podemos ignorar aspectos estructurales tales como la composición en nucleótidos o la posición dentro del núcleo. Uno de los aspectos más intrigantes de la biología genómica de los últimos años es la organización espacial de la cromatina dentro del núcleo de la célula eucariota, dando lugar a lo que se han denominado «territorios cromosómicos». Este concepto ha venido a completar la imagen del núcleo eucariota como una estructura compartimentalizada, en la que distintas regiones contienen maquinarias específicas que llevan a cabo funciones concretas. Esta noción debe integrarse con la presencia de dominios cromatínicos definidos y más o menos estables a lo largo de la vida de una célula. Diversos estudios han mostrado de forma convincente que la cromatina correspondiente a cada uno de los cromosomas tiende a ocupar unas posiciones concretas en el núcleo en interfase, y que esas posiciones tienden a mantenerse durante el ciclo celular. Por ejemplo, la posición de un cromosoma concreto dentro del núcleo está relacionada con el tamaño del cromosoma y con su riqueza en genes, que —como hemos visto— se correlaciona también con la secuencia de nucleótidos subyacente. En general, se considera que los cromosomas pequeños tienden a localizarse hacia el interior del núcleo; igualmente, cromosomas ricos en genes tienden a ocupar posiciones centrales. También existen datos que muestran que las regiones pobres en genes y en secuencias Alu se asocian con la periferia del núcleo, dejando la cromatina rica en genes en el interior. De todas formas, todavía se desconoce cómo se establecen estos territorios y cómo se mantienen tras la mitosis. En la Figura 5.9 se ilustra el concepto de «territorio cromosómico».

www.FreeLibros.me

79

Relación entre secuencia, estructura y función de la cromatina: territorios cromosómicos

virales como HPV E7 o el antígeno T de SV40 inactivan el gen RB1 al impedir su unión con complejos que tienen actividad HDAC. Finalmente, las translocaciones asociadas con la leucemia promielocítica producen fusiones entre factores de transcripción que interaccionan con diversas acetilasas y des-acetilasas de histonas, con complejos remodeladores de la cromatina y con proteínas que tienen actividad metil-transferasa de histonas.


CAPITULO 5

80

5/12/06

07:08

Página 80

El genoma humano en acción

La replicación del ADN y la transcripción génica son dos procesos que tienen lugar dentro del núcleo y que exigen una remodelación importante de la fibra de cromatina para permitir el acceso de las maquinarias proteicas que los llevan a cabo. Además, se ha visto que ambos procesos no tienen lugar al azar, en cualquier lugar del núcleo, sino en compartimentos especializados a los que acuden las fibras de cromatina que están en la vecindad. Se habla así de «fábricas de replicación» o de «fabricas de transcripción», regiones nucleares ocupadas por regiones genómicas que se replican o transcriben simultáneamente aunque pertenezcan a territorios cromosómicos distintos. Lógicamente, las asas de cromatina que ocupan una fábrica determinada tendrán una configuración similar, en cuanto al grado de condensación de la cromatina, la secuencia de nucleótidos, la riqueza en genes, etc.; esto explica que el genoma se organice como un mosaico de regiones que comparten características similares, ya que esas regiones podrían interaccionar dentro del núcleo al situarse en una misma fábrica de replicación o de transcripción. Por ejemplo, se ha visto que en el genoma humano existen unas regiones llamadas RIDGES (Regions of IncreaseD Gene Expression, en inglés) en las que son más abundantes los genes que se transcriben activamente, y son regiones ricas en G+C, pobres en repeticiones tipo LINE y con densidad génica alta. Junto a éstas, se observan también regiones con poca densidad en genes, bajo nivel transcripcional y relativamente pobres en G+C, que se llaman por tanto anti-RIDGES. Pues bien, los genes presentes en RIDGES tienden a localizarse, dentro del núcleo, en torno a las fábricas de transcripción. Lo mismo sucede con los genes de replicación temprana, que se asocian significativamente con las fábricas de replicación nucleares. Por tanto, los modelos actuales postulan que los genes que son replicados o transcritos residen en regiones cromatínicas relativamente descondensadas, las cuales salen de sus propios territorios cromosómicos hacia fábricas de replicación o transcripción vecinas. En esas fábricas, por tanto, pueden interaccionar regiones alejadas de un mismo cromosoma, o incluso asas de cromatina de territorios cromosómicos distintos; esto permite explicar, en el caso de la transcripción, la acción de potenciadores de la expresión que actúan a larga distancia o incluso en trans. Como es lógico, en todas estas interacciones son importantes las modificaciones epigenéticas de la cromatina y del ADN que hemos estudiado en este capítulo, que en el fondo constituyen la base molecular que permite los fenómemos de condensación y descondensación necesarios para la replicación, transcripción y desplazamiento físico de las asas de cromatina. Conjugando todos estos elementos, obtenemos una visión dinámica de la cromatina nuclear en la que la estructura del núcleo se integra con la función y secuencia del genoma. Esta visión es mucho más rica que los modelos anteriores, que no tenían en cuenta todos estos factores, y además permite explicar mucho mejor la regulación fina de la expresión génica durante el desarrollo embrionario o la diferenciación celular. La otra cara de la moneda es que se trata de procesos tremendamente complicados y, por ello, potencialmente frágiles, de modo que pequeñas perturbaciones en estos mecanismos pueden dar lugar a alteraciones genéticas y enfermedades humanas. En este sentido, el cáncer es un ejemplo típico de proceso complejo de des-regulación de la diferenciación celular, en el que se observan importantes alteraciones epigenéticas y una fuerte desorganización de la estructura nuclear.

www.FreeLibros.me


CAPITULO 6

5/12/06

07:10

Página 81

CAPÍTULO 6

Origen de la variación genética en humanos

Contenidos 6.1 Variación en el ADN: polimorfismos y mutaciones 6.2 Mecanismos de reparación del ADN en humanos. Enfermedades causadas por alteraciones 6.3 en los mecanismos de reparación

6.1 Variación en el ADN: polimorfismos y mutaciones La variación observable en los individuos se debe en gran medida a la variación genética, sobre la que se añade la variación producida por la influencia del ambiente. La variación genética se debe a la presencia de cambios genéticos heredables (de una célula a sus células hijas), que además son transmitidos a la siguiente generación si afectan a la línea germinal (pero no son transmitidos si solamente afectan a células somáticas). Como es sabido, un gen —localizado en un locus— puede presentarse en formas diferentes debidas a variaciones en la secuencia. Cada forma alternativa se denomina alelo, y el porcentaje de ese alelo en la población general se denomina frecuencia alélica. Cuando un locus se presenta, al menos, en dos formas alélicas y la frecuencia alélica del alelo más raro es del uno por ciento o mayor, ese locus se llama locus polimórfico, y esa variación se denomina polimorfismo. La variación inter-individual garantiza la adaptación de una especie a condiciones ambientales cambiantes, a expensas de producir algunos individuos con mutaciones más graves, que desencadenan una enfermedad. En humanos, la variación entre individuos se genera principalmente durante el proceso de reproducción sexual (por recombinación meiótica). Además, durante la vida de un individuo se van introduciendo muchas nuevas mutaciones en el genoma de sus células, aunque sólo un pequeño porcentaje de estos cambios afectan a las células germinales y quedan fijados en el genoma de la especie. La tasa de nuevas mutaciones es re-

www.FreeLibros.me


CAPITULO 6

82

5/12/06

07:10

Página 82

Origen de la variación genética en humanos

sultado del equilibrio entre mutación y reparación de las mutaciones. En efecto, en cada división celular se incorporan 6x109 nucleótidos, y se estima que se producen unas 1017 divisiones celulares durante la vida media de un individuo: por tanto, un sistema sin errores debería tener una exactitud de 6x1026, lo que es virtualmente imposible. De hecho, se sabe que la ADN polimerasa produce un error cada 104 nucleótidos incorporados, aunque está dotada de un sistema de «edición» que mejora esta tasa hasta 107. Además, los sistemas de detección y reparación de errores consiguen que, al final, la replicación del ADN celular sólo origine un error cada 1010 nucleótidos. De hecho, se estima que en una célula somática aparecen unas 10-7 mutaciones por gen por división, es decir, una mutación por cada 300 divisiones celulares (asumiendo un total de 30 000 genes). Esta es una tasa extremadamente baja (insuficiente para explicar todas las mutaciones que se producen en cáncer, por ejemplo), lo que implica la existencia de sistemas celulares de reparación del ADN que se ocupan de reparar la inmensa mayoría de las mutaciones introducidas en el genoma, contribuyendo a mantener una fidelidad alta. Además, muchas de estas mutaciones serán silenciosas porque no afectan a ADN codificante; otras, las más dañinas, sufrirán una fuerte presión selectiva y su frecuencia alélica será muy baja. Como se ve, la presencia de polimorfismos y mutaciones en las poblaciones humanas es resultado del juego entre mutación-reparación-selección.

6.2 Mecanismos de reparación del ADN en humanos. 6.2 Enfermedades causadas por alteraciones 6.2 en los mecanismos de reparación A) Reparación de desemparejamientos entre nucleótidos normales Los mecanismos de reparación mencionados actúan reparando tipos específicos de daño al ADN. Los desemparejamientos entre bases normales pueden originarse por la tautomería de las bases (la forma imina de Citosina empareja con Adenina, o la forma enólica de Timina empareja con Guanina), por desaminación de citosinas metiladas (las citosinas metiladas de los dinucleótidos CpG se desaminan a Timina), y principalmente por los errores de la ADN polimerasa durante la replicación del ADN. También se producen desemparejamientos durante la formación de heteroduplexes en los procesos de recombinación. Además, el deslizamiento de la cadena nueva sobre la cadena molde durante la replicación también puede producir bucles de inserción/deleción (IDLs↓). Todos estos tipos de desemparejamiento se corrigen por el sistema MMR (mismatch repair), cuyos componentes conocidos en humanos son hMLH1, hMSH2, hMSH3, hMSH6, hPMS1, hMLH3 y hPMS2 (homólogos de MutS y MutL de E. coli). Estas subunidades actúan como heterodímeros hMSH2/hMSH6, que reconocen tanto los bucles (loops) de inserciones/deleciones de uno a ocho nucleótidos como los desemparejamientos simples de una base; o bien actúan como heterodímeros hMSH2/hMSH3, que reconoce sólo bucles. Cada uno de estos dímeros, a su vez,

www.FreeLibros.me


CAPITULO 6

5/12/06

07:10

Página 83

La Figura 6.1 muestra algunos ejemplos de desemparejamientos entre nucleótidos normales y el funcionamiento del sistema de reparación de desemparejamientos MMR.

En E. coli, este sistema actúa uniéndose al desemparejamiento y a una base metilada adyacente, corta la cadena no metilada (recién sintetizada) hasta una distancia de 1-2 kb del mismatch, una endonucleasa corta los nucleótidos contenidos en el asa, y la polimerasa rellena el hueco. En mamíferos el mecanismo no está todavía totalmente explicado, pero se ha encontrado una proteína (MBD4 o MED1) que se une a metil-citosinas, tiene actividad N-glicosilasa y forma complejos con MLH1, además de modular el sistema de MMR. Cuando hay defectos en este proceso de reparación aparecen errores durante la replicación del ADN, errores que se pueden ver al analizar secuencias repetidas cortas tipo microsatélite. Por tanto, los defectos en el sistema de reparación de desemparejamientos dan lugar al fenómeno conocido como Inestabilidad de Microsatélites (MIN = Microstallite INstability) o «fenotipo mutador». Se conocen algunas enfermedades debidas a mutaciones en componentes de estos sistemas de reparación. Por ejemplo el 90 por ciento de los pacientes con cáncer colo-rectal no-polipósico hereditario (HNPCC o Síndrome de Lynch) tienen mutaciones en uno de los genes hMSH2, hMLH1, hPMS1, hPMS2 o hMSH6, de forma que los individuos que han heredado una mutación tienen una alta probabilidad de sufrir una segunda mutación en el otro alelo en alguna de sus células somáticas, por lo que el riesgo global de desarrollar este tipo de cáncer es del 80-85 por ciento (o del 75 por ciento a los 55 años) en estos sujetos. Estos tumores muestran inestabilidad de microsatélites, pero además la inestabilidad también afecta a genes que tienen repeticiones en sus secuencias codificantes (BAX, TGFBRII). Son las mutaciones en estos genes las que a menudo llevan al desarrollo de neoplasias. Curiosamente, los pacientes homocigotos para mutaciones en MLH1 (dos mutaciones en la línea germinal) desarrollan en la infancia neoplasias hematológicas además de otros tumores (neurofibromatosis, meduloblastoma), lo que sugiere la existencia de genes implicados en la hematopoyesis y en el control del crecimiento celular que son dianas del sistema MMR.

B) Reparación de nucleótidos dañados Otros sistemas detectan la presencia de bases anormales tales como, por ejemplo, los uracilos que aparecen por la des-aminación de una citosina. En general, estas modificaciones están debidas a la acción de mutágenos: benzopirenos del tabaco, agentes alquilantes, diversos agentes químicos de la dieta, el daño causado por especies reactivas de oxígeno, así como las alteraciones debidas a la radiación ultravioleta. Los procesos químicos que con mayor frecuencia provocan mutaciones son 1) las

www.FreeLibros.me

83

Mecanismos de reparación del ADN en humanos…

actúa junto con los homólogos de MutL, que son hMLH1/hPMS2 y hMLH1/hPMS1 (recientemente se ha descrito también hMLH1/hMLH3). En concreto, los heterodímeros hMSH2/hMSH6 junto con hMLH1/hPMS2 reparan los desemparejamientos simples, mientras que cualquiera de los dos complejos (hMSH2/hMSH3 o hMSH2/hMSH6) en combinación con hMLH1/hPMS2 son capaces de reparar stem-loops (tallo-bucle) producidos por IDLs, como se muestra en la figura.


CAPITULO 6

84

5/12/06

07:10

Página 84

Origen de la variación genética en humanos

oxidaciones por radicales libres, especialmente la formación de 8-oxoguanina, que se empareja con T en vez de C (se calcula que se forman unas 10 000 al día en cada célula) y 2) las reacciones hidrolíticas, ya que la molécula de ADN sufre una hidrólisis espontánea lenta que hace que se pierdan unas 10 000 purinas al día en un genoma humano, con la consiguiente creación de otros tantos sitios apurínicos. También la radiación UV produce sitios apurínicos, pero sobre todo provoca dímeros de pirimidinas. La Figura 6.2 muestra la estructura de algunos nucleótidos anormales y la formación de lesiones por acción de la luz ultravioleta.

En general, todas estas lesiones son graves, ya que impiden la replicación correcta del ADN y, a la larga, llevan a la muerte celular. Podemos generalizar diciendo que las lesiones del ADN producidas por la presencia de nucleótidos anormales se corrigen por cuatro mecanismos: reversión directa, BER (Base Excision Repair), NER (Nucleotide Excision Repair) o por polimerasas capaces de pasar por encima de la lesión. Figura 6.3. Visión general de los mecanismos de reparación de lesiones que incluyen nucleótidos dañados.

A continuación se ve con más detalle cada uno de estos mecanismos: 1.

2.

Al contrario que otras especies, la reversión directa por enzimas fotoreactivadoras no existe en humanos. Nuestro único recurso en este sentido consiste en un enzima llamado MGMT (metil-guanina metil-transferasa), que puede eliminar el metilo introducido por agentes alquilantes en la guanina (el cual daría lugar a transiciones GàA, pues la O6-metilguanina se empareja con Timina). La reparación por escisión de bases (BER) elimina las bases que han sufrido ataques hidrolíticos (des-aminación, por ejemplo) por ROS o la 8-oxo-guanina producida por el tabaco. El paso crítico en este tipo de reparación es la rotura del enlace N-glicosídico que une la base al esqueleto desoxi-ribosa-fosfato, catalizado por ADN glicosilasas (específicas para determinados tipos de lesión: UDG, OGG, etc.). Posteriormente, el sitio AP (apurínico o apirimidínico) es roto por una AP endonucleasa que cataliza la incisión del enlace fosfodiester en posición 5’ al sitio AP. La escisión del azúcar se completa con la eliminación del residuo desoxi-ribosa-fosfato por la acción de una desoxi-ribosa-fosfodiesterasa que corta el otro enlace fosfodiéster. Finalmente, se rellena el hueco mediante la acción de ADN pol β y una ADN ligasa. Este mecanismo de reparación parece necesario para la viabilidad, ya que el ratón knock-out para ADN pol β es letal embrionario. Un proceso paralelo es crucial en la diversificación de los genes de las inmunoglobulinas, ya que los linfocitos B expresan un enzima llamado AID (Activation-Induced Deaminase) que desamina citosinas y las convierte en uracilos; dichos uracilos crean sitios AP que pueden ser procesados por un complejo llamado RAD50

www.FreeLibros.me


CAPITULO 6

5/12/06

07:10

Página 85

El vídeo de la Figura 6.4 muestra el funcionamiento del sistema de reparación por escisión de bases (BER).

3.

La reparación por escisión de nucleótidos (NER) elimina fotoproductos producidos por UV y otros aductos que confieren estructuras anormales a la cadena de ADN. El mecanismo de actuación de este sistema de reparación no está totalmente claro, pero se sabe que requiere la formación de un complejo entre XPC (proteína que es esencial para NER) y RPA (proteína de unión a ADN monocatenario) con la región lesionada. Sobre este foco también se unen XPA y el complejo TFIIH (que contiene, entre otras, las proteínas XPB (ERCC3) y XPD (ERCC2), ambas con actividad helicasa necesaria para llevar a cabo NER). El paso clave es la creación de dos incisiones, flanqueando la lesión, en la cadena de ADN que está dañada: una incisión tiene lugar tres a nueve bases en dirección 3’ de la lesión y la otra incisión se produce 16 a 25 bases en dirección 5’ de la lesión, comprendiendo unas 25-30 bases en total. En mamíferos, la incisión 3’ la lleva a cabo una nucleasa llamada XPG, y la incisión 5’ la realiza el heterodímero XPF/ERCC1. Tras las incisiones y eliminación de la región dañada, tiene lugar la resíntesis de esa región mediante la acción de un holoenzima que contiene PCNA y DNApol δ o ε.

La Figura 6.5 incluye un video que muestra esquemáticamente el funcionamiento del sistema de reparación por escisión de nucleótidos (NER).

3.

Un aspecto especialmente interesante es la relación del NER con la transcripción, a través de la presencia de XPB y XPD en TFIIH (que es uno de los factores de transcripción generales), dando lugar al concepto de Reparación acoplada a la transcripción (TCR = Transcription-Coupled Repair). De hecho, se ha comprobado que el daño por UV se repara con más eficacia y más rápido en la cadena que se transcribe y en genes transcripcionalmente activos. También se ha visto que ciertos tipos de daño oxidativo pueden repararse por TCR incluso cuando el NER no funciona. Además de los citados XPB y XPD, otras dos proteínas con actividad helicasa (CSA y CSB) son responsables de TCR, y también se ha implicado a hMLH1 en TCR. Las mutaciones que destruyen el sistema TCR dan lugar a una enfermedad llamada Síndrome de Cockayne. Las mutaciones en genes que codifican otras proteínas asociadas con NER dan lugar a varias enfermedades (Xeroderma pigmentosum, Tricotiodistrofia), que en su conjunto cursan con fotosensibilidad e inestabilidad cromosómica, y aumento del riesgo de aparición de melanoma (un tipo de cáncer de piel). Finalmente, algunos pacientes tienen una variante de Xeroderma Pigmentosum sin defectos en NER (llamada XP variante, o XP-V),

www.FreeLibros.me

85

Mecanismos de reparación del ADN en humanos…

(que veremos más adelante) cuya actividad liasa rompe el esqueleto desoxiribosa-fosfato y rompe el ADN. Dichas roturas son necesarias para que los genes de la inmunoglobulinas se reordenen y puedan dar lugar a la diversidad necesaria para una adecuada respuesta inmune.


CAPITULO 6

5/12/06

07:10

Página 86

que está debida a mutaciones en el gen humano homólogo del gen RAD30 de levadura. Este gen codifica la polimerasa eta (Polη), que puede replicar el ADN correctamente incluso en la presencia de dímeros de pirimidinas.

86

Origen de la variación genética en humanos

4.

Respecto al último mecanismo de reparación de nucleótidos dañados (es decir, las polimerasas capaces de «saltarse» la lesión), recientemente se ha visto que Pol ζ (polimerasa zeta) o Pol η (polimerasa eta) son capaces de sintetizar ADN frente a dímeros TT. Sin embargo, así como Pol η suele introducir dos Adeninas, Pol ζ introduce bases incorrectas y por tanto es un mecanismo de reparación de baja fidelidad.

C) Reparación de roturas de la doble hebra del ADN La creación de roturas bicatenarias del ADN (DSB=Double-Strand Breaks) es un paso necesario para la recombinación homóloga en meiosis y mitosis, y para la reordenación V(D)J de genes de las inmunoglobulinas y receptores de células T. Además, este tipo de roturas aparecen durante la replicación del ADN y también son causadas por diferentes agentes genotóxicos: radiación ionizante (rayos X), ROS originados por el metabolismo celular. Los DSB se reparan por dos vías principales, en diferentes fases del ciclo celular: Fusión no homóloga de extremos (NHEJ), que funciona sobre todo en G1/S (antes de la replicación del ADN) y Recombinación homóloga (HR), que teóricamente actuaría en S/G2, cuando ya hay dos cromátides hermanas (de manera que se utiliza la doble hebra homóloga como molde para la reparación). La Figura 6.6 muestra las posibilidades de respuesta celular a la aparición de roturas bicatenarias en el ADN (DSB) y sus efectos.

1.

1.

Recombinación Homóloga: como ya hemos comentado en el Capítulo 2, la maquinaria responsable del mecanismo molecular de recombinación meiótica se utiliza también para reparar DSB a partir de una cromátide hermana. El mecanismo general es bien conocido, e incluye el procesamiento de los extremos mediante una exonucleasa 5’→3’ para dejar extensiones 3’ libres, invasión de la doble hebra homóloga por parte del filamento de ADN monocatenario recubierto de proteínas, síntesis de nuevo ADN usando la cadena homóloga como molde, ligación y resolución de la recombinación. Da lugar a conversión génica con o sin sobrecruzamiento, según sea la resolución de las estructuras de Holliday. RAD51 (homólogo del gen RecA, que en E. coli es fundamental en la respuesta SOS) forma filamentos sobre el extremo monocatenario de ADN que resulta de la digestión de los extremos libres, y es necesario para que se pueda realizar la invasión de la cadena libre a la doble cadena homóloga. RAD51 es indetectable en G1 y se expresa en S/G2. Los ratones RAD51-/son letales embrionarios y sus células muestran inestabilidad cromosómica. Una línea celular de pollo, en la que RAD51 está bajo el control de un promotor represible, muestra inestabilidad cromosómica y muerte celular cuan-

www.FreeLibros.me


CAPITULO 6

5/12/06

1.

1.

Página 87

do se reprime la expresión de RAD51, lo que muestra la necesidad de este gen para la viabilidad celular. Hay otros genes implicados en reparación de DSB que tienen cierta homología con RAD51 y que podrían modular la acción de éste. Por ejemplo, se ha visto que la ausencia del gen XRCC2 (20 por ciento de homología con Rad51) disminuye la eficacia de la recombinación homóloga en la reparación de DSB, pero no es letal; lo mismo podría suceder con RAD55 o RAD57. Por otra parte, se ha comprobado en levadura que la proteína RPA altera la eficacia con la que se forman los filamentos de RAD51. RAD52 parece actuar como el «portero» del mecanismo de recombinación homóloga. Esta proteína interacciona con RPA y con RAD51, favoreciendo la formación del filamento de RAD51 en presencia de RPA. Como el ratón RAD52-/- no es letal (sólo se observa una ligera disminución en la eficacia de recombinación homóloga), se postula la existencia de genes homólogos de RAD52 que complementen la ausencia de éste. La expresión del complejo RAD50 no varía durante el ciclo celular, por lo que debe regularse post-traduccionalmente (mediante fosforilación o por compartimentalización en el núcleo). Este complejo tiene actividad 5’→3’ exonucleasa, y parece transducir señales de daño de ADN hacia la parada del ciclo celular. Experimentos de irradiación «en bandas» han mostrado, mediante anticuerpos monoclonales contra un componente de este complejo, que RAD50 se asocia a los DSB muy pronto tras la irradiación. En humanos, los pacientes con el llamado «Síndrome de Roturas de Nimega» tienen mutaciones en un componente de este complejo llamado NBS1, muestran sensibilidad a radiación ionizante e inestabilidad cromosómica, y las células de estos pacientes no son capaces de formar focos después de la irradiación con rayos X ultrablandos; por tanto, lo más probable es que la proteína NBS1 sea responsable de dirigir el complejo RAD50 a los lugares de daño del ADN. Una observación muy interesante es la implicación de BRCA1 y BRCA2 (genes mutados en ciertos tipos de cáncer de mama familiar) con la reparación de DSB, ya que se ha visto que las proteínas codificadas por estos genes interaccionan con RAD51, bien directamente (BRCA2) o de manera indirecta (BRCA1). Ambas son proteínas nucleares que se expresan en S/G2, funcionan como activadores transcripcionales, y los ratones knock out de ambas son letales embrionarios. En cambio, un ratón que lleva una copia de BRCA2 truncada (BRCA2tr/tr) sufre linfomas del timo, alta inestabilidad cromosómica y estimulación de la vía de señalización de p53. BRCA1 se fosforila tras daño al ADN, y se ha descrito la asociación de BRCA1 con el complejo RAD50 en el momento del ciclo celular en que BRCA1 está fosforilado (S/G2). Por otra parte, en estudios de colocalización tras irradiación similares a los descritos arriba, se ha visto que BRCA1 está presente en focos nucleares que contienen RAD50 en unas células o en focos que contienen RAD51 en otras células, pero no hay células en las que se asocie con ambos a la vez. Una hipótesis atractiva es que durante la reparación de DSB por recombinación homóloga BRCA1 coopera con RAD50 en el procesamiento de los extremos del ADN dañado y que, mediante la interacción entre

www.FreeLibros.me

87

Mecanismos de reparación del ADN en humanos.

1.

07:10


CAPITULO 6

5/12/06

07:10

Página 88

BRCA1 y BRCA2 (que se asocia físicamente a RAD51), facilita el acoplamiento con los procesos de recombinación mediados por RAD51.

88

Origen de la variación genética en humanos

La Figura 6.7 ilustra la presencia de focos de reparación en células que han sido previamente irradiadas para generar roturas bicatenarias (DSB) en el ADN.

2.

1.

Fusión no homóloga de extremos (NHEJ): el proceso general de reparación es similar pero sin recombinación, ya que en este caso no existe una doble cadena homóloga: simplemente se fusionan los extremos libres. Tras la generación del DSB, los extremos libres también son procesados por una nucleasa; posteriormente se procede a la unión de los mismos y a la ligación, perdiéndose siempre algunas bases en la región de unión. Este mecanismo tiene lugar fisiológicamente en linfocitos, donde es responsable de la reordenación de segmentos V(D)J de los genes de inmunoglobulinas. Un componente principal de este sistema es el complejo ADN-PK (DNAPK), una serina/treonina kinasa nuclear que consta de una subunidad catalítica (DNAPKcs) y de un heterodímero de unión a ADN llamado KU (que a su vez se compone de KU70 y KU80). El complejo ADN-PK se asocia a los extremos rotos, ayuda al alineamiento de los extremos y facilita su ligación. Este sistema de reparación es importante, sobre todo en células del sistema inmune, y de hecho las mutaciones en el gen que codifica la DNAPKcs provocan la enfermedad llamada Inmunodeficiencia Combinada Severa (SCID). Además, el complejo ADN-PK fosforila y activa una nucleasa llamada Artemis, que es la responsable de llevar a cabo el procesamiento de los extremos libres para que se puedan religar. Este último paso, la unión de los extremos ya procesados, es realizado por una ligasa (ADN ligasa IV) que actúa junto con XRCC4, una fosfoproteína nuclear que también es sustrato de ADN-PK in vitro.

El vídeo de la Figura 6.8 muestra, paso a paso, el funcionamiento del sistema de reparación por fusión de extremos (NHEJ).

1.

1.

Es muy interesante la asociación que se ha encontrado en levaduras entre Ku70 y proteínas silenciadoras de la transcripción de telómeros (Sir2, Sir3 y Sir4), sugiriendo la posibilidad de que Ku reclute proteínas Sir a los DSB para inducir un estado de cromatina condensada que evite la transcripción o replicación y facilite el proceso de reparación, o bien evite que los extremos libres de ADN puedan interaccionar con otras moléculas de ADN. Dado que la disrupción de Ku o del complejo RAD50 lleva al acortamiento de telómeros en levaduras, es lógico pensar que Ku se una al ADN telomérico e interaccione con Sir4 para inhibir la replicación a ese nivel. Tradicionalmente se ha considerado que el principal mecanismo de reparación de DSB en mamíferos es la fusión de extremos (NHEJ), ya que se ha visto que la frecuencia de recombinación homóloga en mitosis es muy baja. Esto es lo contrario de lo que sucede en levaduras, donde el principal mecanismo de reparación de DSBs es la recombinación homóloga. Actualmente, en cam-

www.FreeLibros.me


CAPITULO 6

5/12/06

07:10

Página 89

D)

Mecanismos de reparación presentes en mitocondrias

Un tema reciente en patología genética humana es la alteración de los mecanismos de reparación del ADN mitocondrial. Tradicionalmente se ha considerado que las mitocondrias de mamíferos no son capaces de llevar a cabo ningún tipo de reparación, ya que los dímeros de pirimidinas no son reparados con eficacia. Esto explicaría además la mayor tasa de mutaciones del ADN mitocondrial (ADNmt) respecto al ADN nuclear. Hoy se sabe que hay ciertos tipos de daño que sí pueden repararse en mitocondrias (por ejemplo, los sitios AP originados por daño oxidativo) y en general parece que las mitocondrias de organismos superiores son capaces de llevar a cabo BER pero no NER ni MMR. El tipo de daño que puede repararse mediante BER va a estar limitado por la presencia de ADN glicosilasas en la mitocondria, y hasta el momento se ha demostrado la presencia de uracil-ADN-glicosilasa (UDG) y de 8oxo-guanina-glicosilasa (OGG). Además, otras glicosilasas tienen señales de localización mitocondrial en sus extremos N-terminal. Una diferencia del BER que se lleva a cabo en mitocondrias con el BER nuclear es que la polimerasa presente en mitocondrias es la ADN pol γ, que además posee actividad liasa (fosfodiesterasa). También existe dentro de la mitocondria una actividad ADN ligasa, que se origina a partir del gen de la ADN ligasa III por un codón de iniciación alternativo que crea una señal de localización mitocondrial.

www.FreeLibros.me

89

Mecanismos de reparación del ADN en humanos…

bio, esto está en discusión. Por un lado, parece que la recombinación mitótica en mamíferos es más alta de lo que se creía: del orden de 10-4 a 10-5; por otro lado, los ratones incapaces de llevar a cabo NHEJ (DNAPK -/-) no son letales, mientras que los ratones incapaces de recombinación homóloga (RAD51-/- o los RAD54-/-) sí son letales. Esto indica que HR puede de alguna forma complementar la ausencia de NHEJ, pero en cambio NHEJ no puede complementar la ausencia de HR en células somáticas.


00-Portadillas

5/12/06

06:44

Pรกgina i

www.FreeLibros.me


CAPITULO 7

5/12/06

07:12

Página 91

C) La transmisión de los caracteres hereditarios

Esta sección incluye seis temas en los que se tratan los aspectos fundamentales del mendelismo y sus principales excepciones, dando paso al estudio del ligamiento genético, la genética de caracteres cuantitativos y de las enfermedades multifactoriales, así como unas nociones de genética de poblaciones y evolución.

www.FreeLibros.me


00-Portadillas

5/12/06

06:44

Pรกgina i

www.FreeLibros.me


CAPITULO 7

5/12/06

07:12

Página 93

CAPÍTULO 7

Genética mendeliana

Contenidos 7.1 Planteamiento experimental de Mendel 7.2 Monohíbridos: primera Ley de Mendel 7.3 Segunda ley de Mendel: dihíbridos y trihíbridos 7.4 Redescubrimiento del trabajo de Mendel 7.5 ¿Dónde están los «factores unitarios»? La teoría cromosómica de la herencia

A finales del siglo XIX, las observaciones de Gregor Mendel sentaron las bases biológicas de la herencia, dando lugar a lo que hoy conocemos como Genética. Es muy importante estudiar el desarrollo histórico de las ideas en torno a la herencia, para poner en el contexto adecuado las ideas propuestas por Mendel y comprender la gran novedad que supusieron en su momento. Ya los antiguos habían observado que muchos caracteres pasan de padres a hijos, y se habían preguntado cómo podría ser esto. Hipócrates fue el primero en elaborar una teoría, llamada «pangénesis», según la cual cada parte del cuerpo produce algún tipo de partícula que es recogida en lo que él denominó «semen» (hoy diríamos gametos) y transmitida a la descendencia. La pangénesis fue criticada por Aristóteles, que la desechó por varias razones. En primer lugar, constató que en ocasiones unos individuos tienen rasgos más parecidos a abuelos o ancestros remotos que a sus padres, lo que no encaja bien con el hecho de que la herencia se transmita únicamente de padres a hijos. Además, también observó que a veces se transmiten caracteres que aún no se poseen en el momento de tener descendencia (como la tendencia a tener canas o la calvicie, por ejemplo). Por otro lado, apuntó el hecho fácilmente comprobable de que las mutilaciones en animales y plantas no se heredan. Esto es algo fundamental, porque Aristóteles admitía como hecho cierto la herencia de los caracteres adquiridos, algo universalmente aceptado hasta muchos siglos después. Como la pangénesis no podía explicar estas discrepancias, el filósofo propuso que lo que se hereda no son los rasgos en sí mismos, sino la potencialidad

www.FreeLibros.me


CAPITULO 7

94

5/12/06

07:12

Página 94

Genética mendeliana

de producirlos. Hoy en día esto nos parece un concepto evidente, y se asemeja extraordinariamente a la idea de gen que actualmente tenemos, pero en su tiempo fue una propuesta revolucionaria a la que no se le dio toda la importancia que requería. No hay que olvidar que algunas nociones básicas como la existencia de gametos, la meiosis o la reproducción sexual eran totalmente desconocidas, por lo que era difícil formular teorías que explicasen la transmisión de caracteres a lo largo de generaciones sucesivas. Mendel no podría haber explicado sus resultados sin comprender un concepto básico que hoy expresaríamos diciendo que, tanto en animales como en plantas, un gameto masculino y un gameto femenino se unen para formar un cigoto. En este sentido, un avance fundamental fue la demostración de que las plantas superiores tienen reproducción sexual, siendo el polen el elemento masculino. Fue un botánico llamado Kölreuter, un siglo antes de Mendel, el que elaboró y sistematizó el trabajo sobre híbridos en plantas: modos de polinización, la obtención de híbridos con caracteres «intermedios» entre los progenitores (aunque un pequeño porcentaje de la descendencia expresa un rasgo que sólo se encuentra en uno de los progenitores), etc. Además, pocos años antes de Mendel ya se había propuesto la idea de que un solo grano de polen es suficiente para fecundar una planta, aunque este concepto todavía sería objeto de debate durante algún tiempo. En 1859, Charles Darwin publica El Origen de las especies, proponiendo la evolución de las especies mediante un proceso de selección natural. Sin embargo, Darwin no pudo proponer una explicación biológica coherente porque no conocía las bases biológicas de la variación y de la herencia. Darwin aceptaba la pangénesis porque era la teoría que mejor explicaba la herencia de caracteres adquiridos (lo cual le ayudaba a explicar la selección natural) y llamó «gémulas» a las partículas somáticas que un individuo transmite a su descendencia. En su libro The Variation in Animals and Plants under Domestication, de 1868, Darwin recoge las ideas más prevalentes en ese momento, y reconoce la existencia de dos tipos de variación: variación continua (caracteres cuantitativos) y variación discontinua (caracteres cualitativos). Sin embargo, consideraba que esta última era relativamente rara y no tenía tanta importancia como la variación continua, que podía modificarse mediante selección y por tanto era más útil para explicar el concepto de selección natural. Aunque parece que Darwin llegó a recibir una copia de los trabajos de Mendel publicados dos años antes, nunca llegó a leerlos y por tanto no pudo comprender la importancia de la variación discontinua.

7.1 Planteamiento experimental de Mendel Gregor Mendel nació el 22 de julio de 1822 en Heinzendorf. Hijo de labradores, se hizo sacerdote agustino en 1847. En 1850 suspendió el examen que le permitiría enseñar ciencias naturales, por lo que se marchó a Viena a estudiar física, química, zoología y botánica durante dos años. En 1853 se traslada al monasterio de los agustinos en Brno (en lo que hoy es la república Checa) y allí comienza a hacer sus experimentos con plantas. En 1865 presenta sus resultados y conclusiones en la reunión de la Sociedad de Historia Natural de Brno, que son publicadas un año después

www.FreeLibros.me


CAPITULO 7

5/12/06

07:12

Página 95

7.2 Monohíbridos: primera Ley de Mendel Mendel escogió la planta del guisante Pisum sativum (aunque había cultivado y estudiado también otras especies) porque es fácilmente cultivable, tiene un ciclo corto y los cruzamientos son fáciles de controlar. Seleccionó siete caracteres que mostraban variación claramente discontinua, es decir, representados cada uno por dos formas alternativas en líneas puras. Estas líneas puras eran el resultado de autofecundar plantas durante varias generaciones, hasta conseguir que esos caracteres se mantuviesen constantes. Los siete caracteres fueron:

• • • • • • •

Guisantes rugosos/lisos. Guisantes amarillos/verdes. Vainas en posición axial/terminal. Vainas hinchadas/arrugadas. Vainas verdes/amarillas. Flores violetas/blancas (o la envuelta de la semilla gris/blanca, respectivamente). Tallo de la planta alto/enano.

La Figura 7.1 contiene enlaces a recursos educativos que ilustran los conceptos básicos del mendelismo.

www.FreeLibros.me

95

Monohíbridos: primera Ley de Mendel

en las Actas de dicha Sociedad en un artículo que lleva el título de «Versuche über Pflanzenhybriden» (Experimentos sobre Híbridos de Plantas). En 1868 fue nombrado abad del monasterio, por lo que desde entonces no pudo dedicar tanto tiempo a sus experimentos. Murió el 6 de enero de 1884 a causa de una glomerulonefritis. Fruto de sus observaciones trabajando con híbridos de plantas, Mendel llegó al convencimiento de que el único modo de comprender las bases biológicas de la transmisión de caracteres hereditarios era mediante el estudio de variaciones discontinuas, es decir, aquellos caracteres que se presentan únicamente en dos formas alternativas. Como explica en su artículo, considera que es necesario: 1) determinar con exactitud el número de las diferentes formas que aparecen en la descendencia de los híbridos; 2) agrupar estas formas por separado en las distintas generaciones; 3) describir sus relaciones matemáticas exactas. Por ejemplo, en el artículo original de 1866 dice «...Entre los numerosos experimentos hechos hasta el momento, ninguno ha sido realizado de manera que sea posible determinar el número de las diferentes formas en que aparecen los descendientes de híbridos, o agrupar estas formas con certeza según generaciones separadas, o determinar exactamente sus relaciones estadísticas…». Gracias a esta aproximación metodológica, que le supuso analizar unas 28 000 plantas, Mendel pudo observar que las proporciones obtenidas en la descendencia de las distintas clases de híbridos se mantenían y se repetían para varios caracteres distintos. Esto le permitió elaborar una teoría que explicase cómo podrían darse esas proporciones y llevar a cabo experimentos concretos que validasen las predicciones formuladas por dicha teoría. Veamos con más detalle la manera en que desarrolló sus experimentos.


CAPITULO 7

96

5/12/06

07:12

Página 96

Genética mendeliana

En primer lugar, Mendel llevó a cabo cruces monohíbridos, es decir, para cada uno de los siete caracteres por separado cruzó plantas que se comportaban como variedades puras. Observó que sólo una de las dos formas alternativas estaba presente en el 100 por ciento de la F1 (la primera generación filial), mientras que la otra forma había «desaparecido». Curiosamente, al autofecundar individuos de la F1, observó que esa forma desaparecida volvía a aparecer en la F2. Lo más importante, y esta fue la aportación más novedosa de Mendel, estableció las proporciones en que se daba cada una de las formas en cada generación (en la F1 y en la F2). Por ejemplo, al analizar la forma del guisante, cruzó la variedad pura que producía guisantes rugosos con la variedad pura que producía guisantes lisos. En la F1 todas las plantas producían guisantes lisos, pero al autofecundar estas plantas de la F1 observó que en la F2 resultante había 5.474 guisantes lisos y 1.850 guisantes rugosos, lo que supone una relación de 2,96:1 lisos frente a rugosos. Al repetir esto para los siete caracteres, observó que se repetía el mismo fenómeno, siendo las proporciones obtenidas muy parecidas y siempre en torno a una relación 3:1, por lo que Mendel concluyó que se trataba de un fenómeno general que debía tener una explicación coherente. Mendel razonó que estos datos numéricos podrían explicarse suponiendo que cada carácter está controlado por un «factor» que puede presentarse en dos formas alternativas. Por ejemplo, habría un factor responsable de la forma del guisante, con una forma que produce guisantes lisos y otra forma que produce guisantes rugosos. Además, cada planta debería tener dos copias de ese «factor», que podrían ser idénticas o distintas (por ejemplo, podría haber plantas con dos copias de la forma que produce plantas rugosas, o con una copia de cada forma). En las variedades puras iniciales, cada planta tendría dos copias idénticas: las plantas con guisantes lisos tendrían dos copias de la forma que produce guisantes lisos, las plantas con guisantes rugosos tendrían dos copias de la forma que produce guisantes rugosos. Con estos presupuestos, si cada planta pasa a la descendencia sólo una de sus copias, todas las plantas de la F1 tendrían una copia de cada progenitor, por lo que todas tendrían una copia del factor que produce guisantes lisos y otra copia del factor que produce guisantes rugosos. Ahora bien, si una de las formas domina sobre la otra, todas las plantas de esta generación serían iguales (por ejemplo, si la forma que produce guisantes lisos domina sobre la forma que produce guisantes rugosos, todos los guisantes de la F1 serían lisos, como de hecho sucedía). Así pues, si estos factores se transmiten a la descendencia de forma totalmente aleatoria, la F2 resultante de autofecundar plantas de la F1 (que tienen dos copias distintas del factor), estaría compuesta por 25 por ciento de plantas con las dos copias idénticas e iguales a las de una de las variedades puras iniciales, 25 por ciento de plantas con dos copias idénticas iguales a las de la otra variedad pura inicial, y el 50 por ciento de plantas con dos copias distintas (como las plantas de la F1). Como una copia domina sobre la otra, realmente veríamos 75 por ciento de las plantas con la conformación de una de las variedades inciales (la que estaba presente en la F1) y 25 por ciento de las plantas con la conformación de la otra variedad inicial (la que había «desaparecido» en la F1). Es decir, veríamos una proporción 3:1 tal y como Mendel había encontrado experimentalmente. Como hemos visto, para que esta explicación sea coherente han de darse varias condiciones que se han marcado en negrita en el párrafo anterior. Estas condiciones constituyen los tres principios que Mendel propuso que debían cumplirse para poder

www.FreeLibros.me


CAPITULO 7

5/12/06

07:12

Página 97

www.FreeLibros.me

97

Monohíbridos: primera Ley de Mendel

explicar las proporciones encontradas, y que a veces se agrupan en lo que se conoce como Primera Ley de Mendel: i) los factores que determinan la herencia se encuentran en dos formas alternativas y cada individuo lleva dos copias (idénticas o distintas), de las cuales sólo una se transmite a la descendencia; ii) cada una de esas dos copias tiene la misma probabilidad de pasar a la descendencia, es decir, se transmiten de modo totalmente aleatorio; iii) una de las formas de cada factor domina sobre la otra, de modo que cuando las dos copias son distintas, el carácter se manifiesta como si las dos copias fuesen iguales para la forma dominante. Lógicamente, en la nomenclatura moderna podemos expresar estos conceptos de un modo mucho más preciso, pero en la época de Mendel esta nomenclatura todavía no existía. Hoy podemos decir que los «factores unitarios» de los que hablaba Mendel son lo que llamamos genes; las formas distintas que puede presentar cada gen se llaman alelos (o formas alélicas); la transmisión de uno de los dos alelos a la descendencia se conoce como segregación; los distintos tipos de parejas que se pueden dar son los tres posibles genotipos (dos homocigotos y un heterocigoto). Por tanto, hoy diríamos que un carácter fenotípico está controlado por un gen que se presenta en dos formas alélicas alternativas, una dominante y otra recesiva. Las variedades puras iniciales son homocigotos para cada uno de los alelos, las plantas de la F1 son todas heterogicotos y sólo manifiestan el carácter determinado por el alelo dominante; las plantas de la F2 son 25 por ciento homocigotos dominantes, 50 por ciento heterocigotos y 25 por ciento homocigotos recesivos (es decir, hay una relación genotípica 1:2:1). Los homocigotos dominantes y los heterocigotos son fenotípicamente idénticos, por lo que encontraremos una relación fenotípica 3:1 en la F2. Para expresar esto de un modo más gráfico, hoy en día usamos una letra para indicar cada forma alélica y representamos los cruces de manera esquemática. Por ejemplo, podemos designar el alelo que produce guisantes lisos como R y el alelo que produce guisantes rugosos como r, siendo R dominante sobre r. Las dos variedades puras iniciales serían homocigotos, RR en el caso de las que producen guisantes lisos y rr las que producen guisantes rugosos. El cruce inicial se puede representar como RR X rr. Si cada alelo segrega al azar, cada alelo R puede combinarse con un alelo r, pero en la descendencia (generación F1) todas las plantas tendrán genotipo Rr. Como R es dominante, su fenotipo será de guisantes lisos. Al cruzar plantas de la F1 entre sí, tendremos cruces del tipo Rr X Rr. Ahora tenemos cuatro posibles combinaciones de alelos en la descendencia (RR, Rr, rR y rr), cada una de ellas con la misma probabilidad de producirse. Es decir, en la F2 tendremos 25 por ciento de plantas con genotipos RR, 25 % con genotipo Rr, 25 por ciento con genotipo rR y 25 por ciento con genotipo rr. Como los genotipos Rr y rR son iguales desde el punto de vista funcional (heterocigotos, da igual el orden), tendremos un 25 por ciento de homocigotos dominantes (RR), 50 por ciento de heterocigotos (Rr) y 25 por ciento de homocigotos recesivos (rr). Como R es dominante, los heterocigotos y los homocigotos RR son idénticos (todos producen guisantes lisos), y por tanto el 75 por ciento de las plantas producirán guisante lisos y el 25 por ciento rugosos. Es muy útil utilizar métodos gráficos para representar los cruzamientos, porque eso simplifica el cálculo de las proporciones genotípicas en la descendencia. El método más sencillo es quizás el de los cuadrados de Punnett (ideados por Reginald Punnett), que consisten en representar los alelos de un progenitor en horizontal y los


CAPITULO 7

98

5/12/06

07:12

Página 98

del otro progenitor en vertical, formando unas cuadrículas que se rellenan con los genotipos resultantes.

Genética mendeliana

Los enlaces de la Figura 7.2 ayudan a comprender gráficamente las proporciones genotípicas y fenotípicas del cruce monohíbrido.

También se puede utilizar un método ramificado, tanto para calcular los genotipos como los fenotipos. Por ejemplo, en un cruce del tipo Rr X Rr estableceríamos la probabilidad de cada alelo de uno de los progenitores (1/2 R y 1/2 r, en este caso) y después, para cada uno de ellos, establecemos la probabilidad de cada alelo del otro progenitor. Al tratarse de sucesos independientes, las probabilidades se multiplican para calcular la probabilidad de cada genotipo en la descendencia. Así, en nuestro ejemplo, 1/2 R (del primer progenitor) puede combinarse por igual con cualquiera de los alelos del segundo progenitor (con 1/2 R o con 1/2 r). Por tanto, podríamos representarlo esquemáticamente de modo ramificado: 1

/2 R

{ {

1

/2 R = 1/2 X 1/2 = 1/4 RR

1

/2 r = 1/2 X 1/2 = 1/4 Rr

1

1

/2 r

/2 R = 1/2 X 1/2 = 1/4 rR

1

/2 v = 1/2 X 1/2 = 1/4 rr

Como Rr y rR son iguales, tenemos las proporciones genotípicas 1/4 RR, 1/2 Rr y /4 rr, o lo que es lo mismo 1:2:1. Impresiona bastante seguir el razonamiento de Mendel, cómo a partir de una simple proporción fenotípica deduce los principios generales que la explican. De todas formas, esto no era más que una hipótesis plausible, por lo que Mendel se propuso diseñar los experimentos que pudiesen confirmar las predicciones que se derivaban de su teoría. Para ello hizo dos tios de experimentos. Por un lado, llevó a cabo cruzamientos prueba, que es un tipo de retrocruzamiento (cruzar una planta con uno de sus progenitores). El cruzamiento prueba consiste en fecundar una planta de la F1 con el progenitor homocigoto recesivo, es decir, con la variedad pura cuyo fenotipo desaparecía en la F1. Si los postulados son ciertos, este cruzamiento entre un heterocigoto y un homocigoto recesivo debería dar descendencia con 50 % de plantas heterocigotos y 50 % homocigotos recesivos. Siguiendo con el ejemplo de la forma del guisante, si r es el alelo recesivo y R el dominante, tendríamos que todas las plantas de la F1 son Rr. Si hacemos el cruzamiento prueba con plantas rr, tendríamos un cruce Rr X rr en el que el 50 % de la descendencia será Rr y el 50 % será rr: es decir, la mitad de los guisantes serán lisos (R domina sobre r) y la mitad rugosos. La otra comprobación que hizo Mendel fue autofecundar plantas de la F2. Como hemos visto, 25 % de éstas deberían ser RR (guisantes lisos), 50 % Rr (también lisos) y 25 % rr (rugosos). Al autofecundar plantas rugosas (rr), todos los guisantes resultantes deberían ser también rugosos. En cambio, de todas las plantas de la F2 con guisantes lisos un tercio deberían ser homocigotos y dos tercios heterocigotos. Por eso, al autofecundar plan1

www.FreeLibros.me


CAPITULO 7

5/12/06

07:12

Página 99

ENANAS

ALTAS F2

50% Tt

25% TT

1

{

:

{

3

25% tt

autofecundación Tt X Tt

F3

3

:

tt X tt

100% TT

100% tt

25% tt

{

25% TT

{

50% Tt

TT X TT

1

La Figura 7.3 ilustra las pruebas utilizadas para confirmar la validez de los postulados de la primera Ley de Mendel.

7.3 Segunda Ley de Mendel: dihíbridos y trihíbridos No contento con lo que había encontrado al analizar cada uno de los caracteres por separado, Mendel se preguntó qué sucedería al estudiarlos conjuntamente. En primer lugar llevó a cabo cruces dihíbridos, es decir, entre plantas que se comportaban como variedades puras para dos caracteres distintos a la vez. Por ejemplo, estudió el color y la forma del guisante, obteniendo plantas con guisantes amarillos y lisos simultáneamente, y plantas con guisantes verdes y rugosos. Estas plantas podían considerarse variedades puras para ambos caracteres, porque siempre se daban esas mismas combinaciones de forma y color. Al cruzar plantas de ambas variedades puras, Mendel observó que en la F1 todos los guisantes eran iguales: amarillos y lisos a la vez; es decir, manifestaban los dos caracteres dominantes. La autofecundación de

www.FreeLibros.me

99

Segunda Ley de Mendel: dihíbridos y trihíbridos

tas con guisantes lisos, un tercio de los cruces deberían ser RR X RR y dar descendencia con 100 % de guisantes lisos en la F3; dos tercios de los cruces deberían ser del tipo Rr X Rr y dar descendencia en las proporciones fenotípicas 3:1 típicas de este cruce. Pues bien, en todos los casos Mendel encontró que las proporciones encontradas experimentalmente se ajustaban perfectamente a lo esperado, para todos los caracteres estudiados. Con esto, concluyó que los principios propuestos eran correctos y explicaban la transmisión hereditaria de la variación discontinua.


CAPITULO 7

100

5/12/06

07:12

Página 100

Genética mendeliana

estas plantas de la F1 dio como resultado una F2 con proporciones de 9/16 de dobles dominantes (amarillos/lisos), 3/16 para cada una de las dos combinaciones de un dominante con un recesivo (3/16 amarillos/rugosos y 3/16 verdes/lisos) y 1/16 de dobles recesivos (verdes/rugosos). Al analizar estos resultados, Mendel se dio cuenta de que éste sería precisamente el resultado esperado si consideramos el cruce dihíbrido como dos cruces monohíbridos independientes. En estas circunstancias, cada planta de la F1 produciría cuatro posibles tipos de gametos: si denominamos R/r a los alelos liso/rugoso y V/v a los alelos amarillo/verde, las plantas de la F1 (con guisantes amarillos y lisos) serían heterocigotos para ambos caracteres, con genotipo VvRr. Por tanto, cada una de estas plantas puede transmitir cuatro posibles combinaciones alélicas: VR, Vr, vR y vr. De este modo, al cruzar dos plantas de la F1 tendríamos 16 posibles tipos de cruces: VR X VR VR X Vr VR X vR VR X vr

Vr X VR Vr X Vr Vr X vR Vr X vr

vR X VR vR X Vr vR X vR vR X vr

vr X VR vr X Vr vr X vR vr X vr

Podemos calcular fácilmente los genotipos resultantes de cada cruce usando cuadrados de Punnett o con el método ramificado genotípico (VR X VR tendrá descendencia con genotipo VVRR, etc.). Como algunos cruces son idénticos (por ejemplo, los dos que están en negrita), podemos agrupar los genotipos resultantes y obtenemos nueve posibles genotipos distintos en la descendencia, en las siguientes proporciones: 1/16 VVRR, 2/16 VVRr, 2/16 VvRR, 4/16 VvRr, 1/16 VVrr, 2/16 Vvrr, 1/16 vvRR, 2/16 vvRr y 1/16 vvrr. Debido a la dominancia del liso y del amarillo, estos nueve genotipos dan lugar solamente a cuatro fenotipos en las siguientes proporciones: 9/16 amarillos/lisos, 3/16 amarillos/rugosos, 3/16 verdes/lisos y 1/16 verdes/rugosos. Esto lo vemos muy bien usando el método ramificado fenotípico: si la probabilidad de amarillos:verdes en la F2 es de 3:1, observaremos 3/4 amarillos y 1/4 verdes. Ahora bien, si de cada uno de estos hay 3/4 lisos y 1/4 rugosos, al final las probabilidades de cada fenotipo se pueden calcular: 1

/4 amarillos

1

/4 verdes

{ {

3

/4 lisos = 9/16 amarillos y lisos

1

/4 rugosos = 3/16 amarillos y rugosos

3

/4 lisos = 3/16 verdes y lisos

1

/4 rugosos = 1/16 verdes y rugosos

Pues bien, éstas fueron precisamente las proporciones que Mendel encontró al realizar estos cruces, la proporción fenotípica 9:3:3:1 de dobles dominantes : dominante/recesivo : recesivo/dominante : doble recesivo. Dado que sus resultados se ajustaban al modelo teórico, Mendel formuló su cuarto principio —también conocido hoy como la Segunda Ley— que establece que las parejas de factores segregan no sólo al azar, sino además de manera independiente para caracteres distintos. La Figura 7.4 contiene un enlace que ayuda a comprender los cruces dihíbridos.

www.FreeLibros.me


CAPITULO 7

5/12/06

07:12

Página 101

La Figura 7.5 muestra el diagrama ramificado genotípico de un cruzamiento trihíbrido.

Lógicamente, es fácil darse cuenta de que la interpretación de los resultados aumenta notablemente al estudiar varios caracteres a la vez, ya que las posibles combinaciones de genotipos (y, por tanto, de fenotipos) son mayores. En cualquier caso, hay una regla sencilla para calcular el número de posibles gametos, genotipos y fenotipos que se pueden generar al estudiar cualquier número de genes simultáneamente. Si n es el número de caracteres distintos que estudiamos, cada uno de ellos

www.FreeLibros.me

101

Segunda Ley de Mendel: dihíbridos y trihíbridos

Mendel también quiso comprobar este postulado realizando cruzamientos prueba de las plantas de la F2 con el progenitor doble homocigoto recesivo. Por ejemplo, los 9 /16 de plantas con guisantes amarillos y lisos de la F2 son el resultado de sumar todas las plantas con cuatro genotipos distintos: VVRR (1/16), VVRr (2/16), VvRR (2/16) y VvRr (4/16). Es decir, de todas las plantas de la F2 con guisantes amarillos y lisos, 1/9 serán VVRR, 2/9 serán VVRr, 2/9 serán VvRR y 4/9 serán VvRr. ¿Cómo saber los genotipos de estas plantas? Al igual que en el monohibridismo, mediante los cruzamientos prueba de cada una de ellas con una variedad pura doble homocigota recesiva (vvrr). Mendel predijo cómo debería ser la descendencia resultante de cada uno de estos cruces. Por ejemplo, al cruzarse los dobles homocigotos dominantes de la F2 (VVRR) con una planta vvrr darán un 100 por ciento de descendencia de tipo doble heterocigoto VvRr y por tanto con fenotipo amarillo y liso. Las plantas con genotipo VVRr en la F2 darán, en cambio, dos tipos posible de gametos (VR y Vr), por lo que el cruce prueba VVRr X vvrr dará como resultado un 50 por ciento de plantas VvRr y un 50 por ciento de plantas Vvrr (o, lo que es lo mismo, 50 por ciento con guisantes amarillos y lisos y 50 por ciento con guisantes amarillos y rugosos). Lo mismo puede hacerse para los otros dos cruzamientos prueba, los de plantas VvRR y VvRr y calcular las proporciones fenotípicas esperadas en la descendencia. Pues bien, cuando Mendel hizo todos estos cruces de prueba, comprobó que los resultados obtenidos coincidían con las predicciones de su modelo, por lo que concluyó que este cuarto postulado era también cierto. Mendel todavía fue más lejos y demostró que estos principios se cumplían también al cruzar plantas que se comportaban como variedades puras para tres factores a la vez (cruce trihíbrido). El cruce de una variedad pura triple dominante con otra triple recesiva dará como resultado 100 por ciento de triples heterocigotos en la F1 (todos manifiestan los tres fenotipos dominantes). Para calcular la descendencia resultante de la autofecundación de éstos, hay que tener en cuenta que cada planta producirá ocho tipos posibles de gametos. Por ejemplo, para tres genes A, B y C con alelos dominante (mayúscula) o recesivo (minúscula), cada triple heterocigoto (AaBbCc) dará lugar a gametos del tipo ABC, ABc, AbC, Abc, aBC, aBc, abC, o abc. Si hacemos un cuadrado de Punnett para calcular los genotipos resultantes y sus proporciones, vemos que el cruce AaBbCc X AaBbCc origina 64 combinaciones diferentes. Usando el método ramificado genotípico o fenotípico, vemos que todas estas posibles combinaciones se pueden agrupar en 27 genotipos distintos, que dan lugar a ocho fenotipos diferentes en proporciones 27:9:9:9:3:3:3:1. Una vez más, lo que Mendel encontró se correspondía exactamente con lo que debería suceder de acuerdo con sus postulados.


CAPITULO 7

102

5/12/06

07:12

Página 102

Genética mendeliana

controlado por un gen con dos alelos, el número de gametos posible será 2n, el número de posibles genotipos es 3n, y el número de posibles fenotipos es también 2n. Así, para tres genes tendríamos ocho gametos posibles que originan 64 combinaciones agrupadas en 27 genotipos y ocho fenotipos distintos.

7.4 Redescubrimiento del trabajo de Mendel Como hemos visto, Mendel comenzó sus experimentos en 1856, leyó los resultados en la reunión de la Sociedad de Historia Natural de Brno en 1865, y el trabajo fue publicado el año siguiente. En el período que transcurre entre 1866 y el 1900, la figura más influyente fue sin duda August Weismann, un discípulo de Darwin. En primer lugar, Weismann creía que la pangénesis no era correcta, y diseñó experimentos para probarlo. Por ejemplo, cortó la cola de ratones durante 22 generaciones sucesivas, comprobando que el tamaño de la cola no disminuía al nacer. Además, teniendo en cuenta los avances científicos de esos años, Weismann reconoció la existencia de células germinales, la importancia del núcleo y la existencia de cromosomas. Su gran contribución fue la elaboración de la teoría del germoplasma como material hereditario. Frente a la creencia en las gémulas de origen somático, Weismann propuso que la herencia se transmite únicamente a través de las células germinales y que las unidades hereditarias residen en los cromosomas. Lógicamente, esas ideas eran bastante teóricas y no tenían comprobación experimental, pero prepararon el camino para que a principios del siglo XX pudiesen comprenderse los trabajos de Mendel. Se sabe que del artículo original de Mendel se imprimieron 40 copias, aunque sólo hay constancia de tres que fueron enviadas a sus maestros y colegas. De todas formas, la Sociedad de Historia Natural de Brno enviaba sus Actas a unas 130 bibliotecas de toda Europa y América, por lo que sus hallazgos tuvieron una difusión adecuada. Sin embargo, llama la atención que durante años nunca fuesen citados, probablemente porque no fueron comprendidos del todo. La clave para que se prestase atención al trabajo original de Mendel fue una referencia de Focke en 1881, que en una revisión de la literatura sobre hibridaciones en plantas cita el artículo de Mendel (bajo el epígrafe «Pisum») y dice que «Mendel creyó haber encontrado relaciones numéricas constantes». Esta frase llamó la atención de Karl Correns, que había llegado independientemente a las conclusiones «mendelianas» en 1899 haciendo hibridaciones en varias especies. Al leer la alusión de Focke a las «relaciones numéricas constantes», Correns citó el trabajo original de Mendel y fue probablemente el primero en comprender su verdadero alcance. Al mismo tiempo, en el año 1900, Hugo de Vries publicó tres artículos en los que también llegaba a conclusiones parecidas, encontrando la relación 3:1 en varias especies distintas. En uno de esos trabajos se cita también el artículo de Mendel (aunque no se citaba en la versión original francesa, se cita en la versión posterior en alemán: parece que de Vries no había tenido noticia del trabajo de Mendel, pero incluyó la referencia al saber que Correns lo citaba en su artículo). Tshermak también publicó dos artículos en 1900 llegando a conclusiones mendelianas, pero con resultados más limitados que los dos anteriores. William Bateson era un zoólogo de Cambridge que ya en 1894 era consciente de la importancia de estudiar la variación discontinua con una aproximación más ma-

www.FreeLibros.me


CAPITULO 7

5/12/06

07:12

Página 103

7.5 ¿Dónde están los «factores unitarios»? La teoría 7.5 cromosómica de la herencia La aceptación de las leyes de Mendel a principios del siglo XX supuso que se iniciara la búsqueda de las bases celulares de la herencia, es decir, dónde residen los «factores» que controlan los caracteres hereditarios, cuál es la naturaleza de los distintos alelos, en qué estructuras se transmiten de una generación a la siguiente, etc. Hacia el año 1900, los conocimientos de Citología en plantas y animales permitían aventurar alguna hipótesis al respecto. Por ejemplo, se sabía que el núcleo de las células contiene una sustancia (cromatina) que se condensa en forma de cromosomas. Se aceptaba que cada especie tiene un número fijo de cromosomas, definido por el número de cromosomas presente en los gametos, y que en especies de reproducción sexual los gametos tienen una copia de cada cromosoma, mientras que las células somáticas tienen dos copias. También se había observado (al menos en plantas) que la reducción en el número de cromosomas se produce en las últimas fases de la formación de los gametos. En esos primeros años del siglo, por tanto, era generalmente aceptado que el material hereditario residía en los cromosomas, aunque la naturaleza amorfa y «estática» de la cromatina no permitía explicar cómo podría ser esto. De hecho, algunas cuestiones citológicas que entonces se creían ciertas distaban mucho de la realidad. Por ejemplo, existía la creencia general de que los cromosomas formaban un largo filamento continuo (el «espirema») que se dividía transversalmente al final de la interfase, de modo que todos los cromosomas eran esencialmente iguales unos a otros excepto por su tamaño. Aunque también se había observado la meiosis, se pensaba que en la división reductora los cromosomas se dividían transversalmente, estando unidos por los extremos. En general, la mecánica de estos procesos no estaba clara y esta falta de detalle no permitía establecer las bases citológicas de los principios mendelianos de transmisión de la herencia. Aunque ya Correns y Cannon habían propuesto en los primeros años del siglo XX la hipótesis de que los genes (los «factores» de Mendel) residen en los cromosomas, sus modelos eran poco claros. El citólogo que dio mayor impulso a este campo fue sin duda Theodor Bovery, que en 1902 llegó a la conclusión de que los cromosomas no son equivalentes, sino que son distintos unos de otros y todos son necesarios para dar lugar a un embrión

www.FreeLibros.me

103

¿Dónde están los «factores unitarios»? La teoría cromosómica de la herencia

temática. En mayo de 1900 dio una conferencia en la Royal Horticultural Society en Londres, describiendo los resultados de Mendel y su confirmación por De Vries, y se convirtió en el defensor más entusiasta del mendelismo. Junto a Reginald Punnett fue desarrollando los principios de la herencia según las leyes mendelianas. Poco a poco los principios de Mendel se fueron confirmando en otras plantas y en animales, y así se fue introduciendo y fijando la nomenclatura que utilizamos hoy en día. Por ejemplo, Bateson acuñó el término «genética» (del griego genetikos) al usarlo por vez primera en una carta del 18 de abril de 1905, dirigida a Adam Sedgewick. También inventó los términos homocigoto, heterocigoto o alelomorfo (hoy reemplazado por alelo). Johannsen, otro botánico del que hablaremos más adelante, introdujo en 1909 los términos gen, genotipo y fenotipo.


CAPITULO 7

104

5/12/06

07:12

Página 104

Genética mendeliana

viable. En sus estudios con embriones monospérmicos y polispérmicos de erizo de mar, pudo observar formas anormales de desarrollo embrionario cuando el número de cromosomas no era el adecuado. Además, esto le llevó a formular la teoría cromosómica del cáncer, que tanta influencia tendría en años posteriores. Pero la mayor evidencia experimental de que los procesos citológicos permitían explicar las leyes de Mendel la produjo Walter Sutton en 1902. Sutton era un estudiante de Medicina que dedicó sus primeros años a estudiar cromosomas de células somáticas de saltamontes, demostrando irrefutablemente por primera vez que los cromosomas se presentan en pares homólogos en las células somáticas y que los gametos tienen una sola copia, procedente de uno de los progenitores. En un trabajo de 1903 (The chromosomes in heredity) elabora más esta teoría mostrando que distintos pares cromosómicos se orientan al azar en el huso meiótico, y así sugirió que la división reduccional no era transversal sino longitudinal. Todos estos procesos permitían explicar perfectamente lo que Mendel había propuesto: la segregación al azar de factores que están en parejas, de las que sólo una copia pasa a la descendencia. De hecho, Sutton escribió en uno de sus trabajos: I may finally call attention to the probability that the association of paternal and maternal chromosomes in pairs and their subsequent separation during the reducing division… may constitute the physical basis of the Mendelian law of heredity. A pesar de la clarividencia de sus afirmaciones y de su evidente interés por la ciencia, Sutton no terminó su doctorado, sino que se hizo médico y se dedicó a la cirugía. En cualquier caso, su contribución permitió explicar la base física de la herencia y el comportamiento de los «factores» mendelianos, dando lugar a la teoría cromosómica de la herencia. De todas formas, no todos aceptaban fácilmente que los factores mendelianos «viajasen» en los cromosomas. La demostración formal no llegaría hasta años más tarde gracias al trabajo de Morgan, Sturtevant, Muller y Bridges en la mosca Drosophila melanogaster. Durante años, estos genetistas fueron estableciendo la posición de los genes responsables de distintos caracteres en los cromosomas de la mosca. Vieron que algunos caracteres se comportaban como si «viajasen» juntos, porque no segregaban al azar, y llamaron a este fenómeno «ligamiento». Establecieron así varios grupos de ligamiento y demostraron que coincidían con los tres pares de autosomas que tiene la Drosophila, es decir, que los genes se localizan en los cromosomas y se agrupan de modo lineal. En 1916 publicaron The Mechanism of Mendelian Heredity, que se conviertió en el primer tratado detallado de las leyes mendelianas, sus excepciones y sus bases citológicas. Aun así, la aceptación no fue unánime, y mendelistas tan brillantes como Bateson mostraban sus reservas. Por ejemplo, en una revisión sobre The Mechanism of Mendelian Heredity que hace el propio Bateson en 1916, dice: … it is inconceivable that particles of chromatin or of any other substance, however complex, can possess those powers which must be assigned to our factors… The supposition that particles of chromatin, indistinguisable from each other and indeed almost homogeneous under any known test, can by their material nature confer all the properties of life surpasses the range of even the most convinced materialism. Evidentemente, en aquellos años no se conocía la naturaleza química de la cromatina y era impensable que pudiese estar compuesta por una molécula como el ADN, tan simple en su estructura pero tan rica en su capacidad codificante y en sus funciones.

www.FreeLibros.me


CAPITULO 7

5/12/06

07:12

Página 105

www.FreeLibros.me

105

¿Dónde están los «factores unitarios»? La teoría cromosómica de la herencia

En cualquier caso, hacia 1920 la citología y la genética se habían encontrado definitivamente. El mendelismo podía ya explicarse sobre la base de la teoría cromosómica, es decir: i) los dos alelos de cada gen se localizan en la misma posición (locus) en cromosomas homólogos, y segregan al azar a los gametos gracias a la separación de los cromosomas durante la meiosis; ii) genes distintos segregan de manera independiente (4º postulado de Mendel) porque se localizan en cromosomas distintos. Además, estos conceptos se fueron ampliando progresivamente con las nociones de recombinación e intercambio de material genético entre cromosomas homólogos, ligamiento, etc.


CAPITULO 7

5/12/06

07:12

Pรกgina 105

www.FreeLibros.me


CAPITULO 8

5/12/06

07:14

Página 107

CAPÍTULO 8

Herencia relacionada con el sexo

Contenidos 8.1 Cada sexo tiene distinta constitución cromosómica 8.2 Los genes situados en el cromosoma X muestran un modo especial de herencia 8.3 Determinación genética del sexo en humanos 8.4 Compensación de dosis: hipótesis de Lyon 8.5 Estructura de los cromosomas sexuales humanos

8.1 Cada sexo tiene distinta constitución cromosómica En 1891, Hermann Henking describió un corpúsculo en el núcleo de las células de insectos machos de la especie Pyrrhocoris (un tipo de chinche). Dicho corpúsculo se formaba durante la meiosis, y Henking lo denominó «cuerpo X» por su naturaleza desconocida. Cuando se observó la meiosis con detenimiento, se comprobó que 22 de los 23 cromosomas de esta especie se emparejaban durante la meiosis para formar 11 parejas, pero otro cromosoma quedaba condensado y daba lugar al «cuerpo X» en uno de los polos en algunas células. Al reconocerse que se trataba de un cromosoma, dicho corpúsculo pasó a llamarse cromosoma X. A principios del siglo XX, en 1905, Edmund B. Wilson y una de sus estudiantes de doctorado, Nettie M. Stevens, comprobaron que el número de cromosomas X difiere entre machos y hembras. Estudiando insectos del género Protenor (saltamontes) y el Lygaeus turicus, observaron que cada sexo tiene configuraciones cromosómicas distintas, y llegaron a la conclusión de que el sexo está determinado por el número de cromosomas X presentes en las células. En Protenor comprobaron que las hembras tienen dos ejemplares de este cromosoma (XX) y en cambio los machos sólo tienen uno (XO). A este tipo de de-

www.FreeLibros.me


CAPITULO 8

108

5/12/06

07:14

Página 108

Herencia relacionada con el sexo

terminación cromosómica del sexo le llamaron modo XX/XO. En Lygaeus, en cambio, vieron que la situación era ligeramente distinta, ya que las hembras son XX y los machos tienen —además de un cromosoma X— otro cromosoma más pequeño llamado cromosoma Y. A este tipo de configuración le llamaron modo XX/XY. Estas observaciones pusieron de manifiesto el hecho fundamental de que uno de los sexos produce dos clases distintas de gametos: con o sin cromosoma X en el caso del modo Protenor; con cromosoma X o con cromosoma Y, en el modo Lygaeus. Al sexo que produce gametos distintos se le llama, por tanto, sexo heterogamético. Aunque lo más habitual es que el sexo heterogamético sea el masculino, como en la especie humana, esto no siempre es así. Por ejemplo, en muchas especies de aves el sexo heterogamético es el femenino, y siguen un modo distinto de determinación cromosómica del sexo, que se llama ZZ/ZW. En humanos se sigue el modo XX/XY, mientras que en la mosca Drosophila melanogaster, a pesar de que tiene un cromosoma Y, se sigue el modo XX/XO.

8.2 Los genes situados en el cromosoma X muestran un modo 8.2 especial de herencia Como hemos visto, en el laboratorio de Tomas H. Morgan, conocido como la «Fly Room» («Habitación de las Moscas»), se establecieron los principios del mendelismo estudiando diversos caracteres y mutaciones en Drosophila. Morgan observó en 1910 que en el caso de la mutación white del ojo de Drosophila a veces no se cumplían las proporciones mendelianas esperadas. Observó que el patrón de herencia de esta mutación dependía del sexo del progenitor que transmitía la mutación. Así, el cruce entre un mutante white macho y una hembra silvestre daba una F1 con 100 por cien de ojos silvestres (rojo ladrillo) y una F2 con la proporción 3:1 (rojo:blanco), que sería la proporción esperada si el alelo silvestre (rojo) es dominante sobre el mutante white. En cambio, el cruce recíproco, en el que la mutación white estaba en el progenitor hembra, daba una F1 con una proporción 1:1 en la que todos los machos tenían ojos blancos. Además, esta misma proporción se repetía en la F2, teniendo el 50 por ciento de los machos ojos blancos. Basándose en la teoría cromosómica de la herencia de Sutton y Boveri y, sobre todo, en la hipótesis propuesta por Stevens y Wilson pocos años antes, Morgan concluyó que el gen de esta mutación (el locus white) estaba localizado en el cromosoma X de Drosophila. Si esto era cierto, las hembras llevarían dos copias del gen y sólo manifiestarían el fenotipo cuando ambos alelos están mutados (es decir, la mutación sería recesiva y sólo se manifestaría en homocigosis). Los machos, en cambio, sólo llevan un cromosoma X; esta situación se describe como hemicigosis (un solo alelo, en vez de los dos que suele ser habitual en genes autosómicos), y por eso se dice que los machos son hemicigotos para todos los genes del cromosoma X. En estas circunstancias, los machos siempre manifestarán el fenotipo aunque sea recesivo, ya que el único alelo que tienen es el alelo mutante.

www.FreeLibros.me


CAPITULO 8

5/12/06

07:14

Página 109

Este hallazgo constituyó el primer ejemplo de ligamiento de un carácter a un cromosoma concreto, y además fue decisivo para respaldar la teoría cromosómica de la herencia. Todos los caracteres controlados por genes situados en el cromosoma X siguen este tipo de herencia, que pasó a llamarse «ligada al sexo». Sin embargo, un nombre más adecuado es el de «ligada al cromosoma X», ya que hay caracteres cuya herencia está influida por el sexo sin estar controlados por genes situados en ninguno de los cromosomas sexuales. Por ejemplo, existen rasgos controlados por genes autosómicos que sólo se expresan en un sexo por razones hormonales. Dichos caracteres, influidos o limitados por el sexo, pueden confundirse a veces con caracteres ligados al cromosoma X. Aunque la herencia ligada al X puede ser de tipo recesivo o dominante, lo más frecuente es la de tipo recesivo, que se caracteriza porque sólo los individuos hemicigotos (XY) manifiestan el fenotipo recesivo, ya que las hembras (XX) son habitualmente heterocigotos. Como veremos más adelante, la herencia ligada al X recesiva es muy importante en Genética Humana, y tiene unas características que permiten reconocerla y proporcionar un consejo genético muy valioso.

8.3 Determinación genética del sexo en humanos El hallazgo de que el sexo está determinado por el tipo de cromosomas sexuales que se heredan puso en marcha la búsqueda de los mecanismos por los que estos cromosomas influyen en la determinación del sexo. Estos mecanismos se fueron conociendo gracias a los trabajos de Calvin Bridges, un discípulo de Morgan. Bridges demostró que el sexo de Drosophila viene determinado por el número total de cromosomas X que están presentes, o más exactamente por el cociente entre el número de cromosomas X y el número de autosomas. Esta especie tiene tres pares de autosomas y un par de cromosomas sexuales, por lo que habitualmente el cociente X/autosomas de las moscas hembra es igual a 1 (dos copias del cromosoma X y dos copias de cada autosoma) y el de los machos es igual a 0,5 (un cromosoma X y dos copias de cada autosoma). Sin embargo, Bridges estudió el sexo de moscas con diferentes composiciones cromosómicas y encontró que las moscas XXY son hembras normales (cociente = 1), mientras que las moscas XO son machos estériles (cociente = 0,5). Esto le llevó a concluir que el cromosoma Y en Drosophila no tiene genes necesarios para la determinación del sexo masculino, pero sí genes necesarios para la fertilidad de los machos. Esta misma conclusión se confirmaba al estudiar la progenie de moscas con tres cromosomas X y con un número variable de autosomas. Bridges observó que un cociente X/autosomas = 1 produce hembras normales y fértiles; un cociente >1 produce metahembras infértiles; un cociente = 0,5 corresponde a machos; un cociente = 0,33 produce metamachos infértiles. Otros cocientes intermedios producen moscas con genitales ambiguos y estériles, denominados intersex. Por tanto, la conclusión fue que los genes que de-

www.FreeLibros.me

109

Determinación genética del sexo en humanos

La Figura 8.1 ilustra los cruces entre moscas con ojos de color silvestre (rojo ladrillo) y moscas con la mutación white (ojos blancos). También se muestra un ejemplo de herencia ligada al cromosoma X en humanos.


CAPITULO 8

110

5/12/06

07:14

Página 110

Herencia relacionada con el sexo

terminan el sexo en Drosophila están en los autosomas, pero el cromosoma X debe tener algún gen necesario para determinar el sexo femenino cuando está en doble dosis génica. Aunque no es el momento de explicar a fondo el proceso genético de determinación del sexo en Drosophila, nos sirve para introducir esta cuestión en relación con nuestra propia especie. En mamíferos, la determinación del sexo tiene su origen embriológico en la diferenciación de la gónada primitiva, bien hacia la gónada femenina (ovario) o hacia la gónada masculina (testículo). En el caso de que se inicie la vía de diferenciación testicular, este órgano comienza a producir Sustancia Inhibitoria Mülleriana (en las células de Sertoli) y andrógenos (en las células de Leydig), que determinan el desarrollo de los caracteres sexuales secundarios. Lo fundamental, por tanto, es la diferenciación inicial de la gónada primitiva en los primeros momentos del desarrollo embrionario. Desde que se conoció la implicación del cromosoma Y en la determinación del sexo por el modo XX/XY, se postuló que el cromosoma Y debía contener algún factor necesario para la diferenciación de la gónada primitiva hacia testículo, y se denominó TDF (testis-determining factor) a ese hipotético factor cuya identidad permaneció oculta durante años. Posteriormente se descubrió ZFY (Zincfinger on the Y), un gen del cromosoma Y que codifica un factor de transcripción del tipo dedo de zinc, y se pensó que podía ser el buscado TDF. Sin embargo, la búsqueda del gen responsable del desarrollo sexual masculino concluyó en 1993, al comprobarse que ratones hembras en los que se había insertado en uno de los cromosomas X una copia de un gen llamado Sry (localizado en el cromosoma Y) eran fenotípicamente machos. SRY (Sex-determining Region on the Y) es el gen iniciador de una cascada en la que también participan otros genes del cromosoma Y junto con otros genes localizados en autosomas. Básicamente, el proceso comienza cuando la cresta genital es poblada por células del mesonefros y del saco vitelino, que aportan las células somáticas y germinales respectivamente. La cresta genital se desarrolla hacia la gónada indiferenciada por acción de dos factores de transcripción llamados WT1 (Wilms Tumor 1) y SF1 (Steroidogenic Factor 1). A partir de este momento, la diferenciación hacia ovario o testículo será fruto de la acción de diversos genes. Si SRY está presente (como sucede en individuos con un cromosoma Y) la acción de éste factor de transcripción y de otro llamado SOX9 hace que la gónada primitiva se desarrolle hacia testículo. Éste, a su vez, producirá factores que inhiben el desarrollo de los conductos de Müller, estabilizan el desarrollo de los conductos de Wolff y promueven el desarrollo de los genitales externos masculinos. Otros genes implicados son MIS-R, el receptor de andrógenos, INSL3 y LGR8. En ausencia de SRY, como ocurre en mujeres con dos cromosomas X, los genes DAX1 y WNT4 promueven la diferenciación de la gónada primitiva hacia tejido ovárico; la ausencia del receptor androgénico y la presencia de WNT4 promueven la regresión de los conductos de Wolff y el desarrollo de las estructuras derivadas de los conductos de Müller. Por tanto, en el desarrollo sexual intervienen gran cantidad de genes que actúan a distintos niveles de la vía, y mutaciones en cualquiera de ellos puede dar lugar a alteraciones en el desarrollo sexual y por tanto a varones con cariotipo XX o a mujeres con constitución cromosómica XY.

www.FreeLibros.me


CAPITULO 8

5/12/06

07:14

Página 111

111

Células somáticas (mesonefros)

(gónada indiferenciada)

Células germinales (saco vitelino) WT1 SF1 SRY

WNT4 DAX1

SOX9

TESTÍCULO

OVARIO WNT4 Conductos de Müller

AR Regresión de conductos de Wolff

Genitales externos

MIS --R

Conductos de Wolff AR

Regresión de conductos de Müller

Genitales externos

En la Figura 8.2 se muestra esquemáticamente la vía de determinación del sexo en humanos.

8.4 Compensación de dosis: hipótesis de Lyon La distinta dotación cromosómica de ambos sexos supone que las mujeres (XX) tienen doble dosis génica de los genes presentes en el cromosoma X, respecto de los varones XY. El distinto número de cromosomas X que lleva cada tipo de gameto (uno en el gameto femenino y ninguno en el masculino), plantea una cuestión fundamental: ¿cómo es posible que la distinta dosis de los genes contenidos en el cromosoma X no provoque grandes problemas en varones? De hecho, mujeres con un solo cromosoma X (cariotipo 45,X0) desarrollan el Síndrome de Turner. ¿Por qué no sucede esto en varones, que tienen un solo cromosoma X? Murray Barr describió en 1949 que las células femeninas se podían distinguir por la presencia en su núcleo de un corpúsculo de cromatina, pegado a la pared interna del núcleo, que pasó a conocerse como corpúsculo de Barr. Posteriormente, se comprobó que el corpúsculo de Barr se ajusta a la llamada «regla (n–1)», según la cual el número de corpúsculos de Barr de una célula es igual al número de cromosomas X que posee esa célula (n) menos 1. Estas observaciones se completaron cuando Susumu Ohno demostró en 1959 que el corpúsculo de Barr corresponde a un cromosoma X condensado en forma de heterocromatina y propuso que uno de los dos cromosomas X está inactivo en células somáticas, de manera que sólo se expresan los genes del cromosoma X que permanece activo. En 1961 Mary Lyon formuló la hipótesis de que dicha inactivación se lleva a cabo al azar en fases precoces del periodo embrionario, y queda fijada una vez que se establece. Según esta hipótesis, todas las células hijas procedentes de una célula en la que se ha producido la inactivación tendrán el mismo patrón de inactivación que la célula original.

www.FreeLibros.me

Compensación de dosis: hipótesis de Lyon

Cresta genital


CAPITULO 8

112

5/12/06

07:14

Página 112

Herencia relacionada con el sexo

Esta hipótesis permitía explicar la expresión de algunos rasgos ligados al cromosoma X, tales como el color del pelaje en los gatos, en el que las gatas (que se conocen como gatas calico) muestran a veces manchas o bandas de color negro, naranja y blanco, mientras los gatos macho son de color totalmente negro o totalmente naranja. El proceso de inactivación también explicaría el patrón en mosaico de algunas enfermedades dermatológicas causadas por genes que están en el cromosoma X, como la displasia ectodérmica anhidrótica (fenómeno ya descrito por Darwin en 1875). El estudio de las isoformas de glucosa-6-fosfato deshidrogenasa en fibroblastos aislados de mujeres permitió confirmar la hipótesis de Lyon, al observarse la presencia de una sola isoforma en las células de mujeres heterocigotas (que deberían tener dos isoformas distintas). Hoy en día, el fenómeno de inactivación temprana y aleatoria de un cromosoma X en mujeres es universalmente aceptado, y se conoce también con el nombre de «Lyonización» en honor a Mary Lyon. Mediante este mecanismo, las células somáticas femeninas tienen uno de sus cromosomas X en estado inactivado, es decir, transcripcionalmente silenciado y altamente compactado en forma de heterocromatina. La inactivación del X se realiza al azar mediante un mecanismo de recuento que determina el cociente entre el número de cromosomas X y el número de autosomas. Si se detecta más de un cromosoma X, el proceso continúa con la inactivación, inicialmente temporal e inestable, de todos los cromosomas X menos uno. Finalmente, el proceso termina con el silenciamiento estable y definitivo de esos cromosomas. Aunque los mecanismos moleculares que regulan estos procesos no se entienden completamente, se conocen las regiones cromosómicas implicadas y los genes más importantes en el proceso de inactivación, como se describe a continuación. Los procesos de inactivación se ejecutan gracias un locus multifuncional denominado XIC, que está localizado en Xq13 y que contiene los elementos necesarios para el recuento del número de cromosomas X, para la elección del X que será silenciado y para el propio mecanismo de silenciamiento. Este locus incluye el gen XIST, un gen de 32 kb que se transcribe en un ARN de 19 kb, es procesado y poliadenilado pero no se traduce. XIST es necesario para iniciar el silenciamiento del cromosoma X, pero no para los mecanismos de contaje, elección ni para el posterior mantenimiento del estado silenciado. En XIC también se encuentra el mecanismo de contaje y posiblemente un mecanismo de elección, que dependen del locus XCE.

XIC

Xist

Tsx

TsiX

Brx

Cdx4

Xce

La Figura 8.3 muestra un ejemplo del fenómeno de inactivación del X. También se incluye un esquema del locus XIC.

www.FreeLibros.me


CAPITULO 8

5/12/06

07:14

Página 113

El vídeo de la Figura 8.4 sirve para ilustrar el proceso de inactivación del cromosoma X.

Mary Lyon también ha propuesto que la propagación del estado inactivado a partir del XIC se ve facilitada por la presencia de elementos distribuidos a lo largo de todo el cromosoma X y que actuarían como «estaciones repetidoras» del proceso de inactivación. Unos elementos que podrían cumplir esta función son los LINE, que son especialmente abundantes en el cromosoma X respecto a los autosomas (forman un 30 por ciento de la secuencia de este cromosoma). Además, al estudiar pacientes con translocaciones entre el cromosoma X y un autosoma, se ha comprobado que la inactivación del X se propaga a los autosomas pero sólo parcialmente, y que esta propagación es directamente proporcional a la riqueza en LINEs de cada autosoma. La secuenciación del cromosoma X apoya esta hipótesis, ya que se ha comprobado que los LINE se distribuyen a lo largo del X de manera coherente con la inactivación: son especialmente abundantes en las zonas que flanquean el XIC y disminuyen en

www.FreeLibros.me

113

Compensación de dosis: hipótesis de Lyon

Todos estos procesos comienzan en los estadios iniciales del desarrollo embrionario. Así, en la mórula de cuatro-ocho células se detecta expresión de XIST a bajo nivel en ambos cromosomas X, tanto en el de origen paterno (Xp) como en el de origen materno (Xm). A partir de ese momento, XIST deja de expresarse en uno de los cromosomas X (en el caso de embriones XX), o en el único cromosoma X (en embriones XY). Por tanto, la expresión inicial de XIST es transitoria y sólo se estabiliza en torno a la fase de blastocisto en uno de los dos cromosomas X (en aquél que quedará finalmente inactivado). Recientemente se ha descubierto un gen antisentido, denominado TSIX, cuyo transcrito se solapa parcialmente con el ARN codificado por XIST. Curiosamente, TSIX sigue un patrón de expresión similar a XIST: inicialmente se expresan ambos alelos, pero al comienzo de la inactivación únicamente se expresa el alelo del cromosoma X que permanecerá activo. Esto sugiere que la expresión de TSIX juega un papel importante en la expresión transitoria de XIST y en la elección del cromosoma que finalmente será inactivado. En este proceso participa el factor CTCF, que se une a la región de metilación diferencial cercana a TSIX. Dicha unión sólo se produce cuando esa región está des-metilada, y tiene dos posibles efectos: o bien impide la acción de un enhancer sobre XIST (porque CTCF es un elemento aislador o insulator); o bien estimula la transcripción de TSIX, con el consiguiente silenciamiento de XIST. Tras la elección, tiene lugar el proceso de iniciación del silenciamiento, seguida de otros cambios que permiten mantener el estado silenciado. En este proceso, el ARN codificado por XIST recubre todo el cromosoma y desencadena los cambios que caracterizarán al cromosoma X inactivo: metilación de las islas CpG, desacetilación de las histonas, replicación tardía en la fase S, presencia de una histona especial (macroH2A) en vez de H2A. Recientemente también se ha visto que la lisina 27 de la histona H3 está metilada en el cromosoma X inactivo. En cambio, el ARN codificado por XIST no llega a estabilizarse en el X que permanecerá activo, y finalmente el propio gen XIST se silencia y deja de expresarse. Lógicamente, en un embrión XY sólo hay expresión baja y transitoria de XIST en el cromosoma X de origen materno, que nunca se inactiva porque el mecanismo de contaje detecta la presencia de un solo cromosoma X.


CAPITULO 8

114

5/12/06

07:14

Página 114

Herencia relacionada con el sexo

abundancia en las regiones más distales del brazo corto, precisamente la región donde la inactivación es más débil. Es muy importante tener claro que la inactivación del cromosoma X no es completa, es decir, no afecta a todos los genes del cromosoma. De hecho, se estima que sólo un 65 por ciento de los genes presentes en el cromosoma X se inactivan; un 20 por ciento de los genes se inactivan sólo parcialmente (es decir, no están inactivados en todas las células) y un 15 por ciento escapan totalmente al proceso de inactivación. Esto quiere decir que, para esos genes, existen dos copias funcionales en mujeres XX pero sólo existe una copia en varones XY. Para evitar las diferencias de dosis génica en estos casos, algunos de estos genes que escapan a la inactivación tienen un gen homólogo funcional en el cromosoma Y, lo que hace que ambos sexos tengan la misma dosis génica funcional. Se piensa que el fenotipo de mujeres X0 con Síndrome de Turner se debe precisamente a la disminución de dosis de todos o algunos de los genes que escapan la inactivación, ya que estas pacientes sólo tienen una dosis funcional de estos genes (cuando deberían tener dos).

8.5 Estructura de los cromosomas sexuales humanos Lo que ahora conocemos como cromosomas X e Y, formaban una pareja de autosomas hace aproximadamente 300 millones de años. Los datos más recientes apoyan la «ley de Ohno» (formulada por Susumu Ohno en 1967), que dice que el primer paso en el proceso de creación del dimorfismo de los cromosomas sexuales fue la fijación del gen responsable del desarrollo del sexo masculino en uno de los cromosomas (el que se convertiría en el futuro cromosoma Y) y su pérdida en el otro cromosoma del par (el futuro X). Después, la limitación progresiva de recombinación entre ellos condujo a una evolución separada de ambos cromosomas: el Y perdió material rápidamente por la falta de recombinación, sufrió varias duplicaciones y se quedó con pocos genes, de los cuales un gran porcentaje tienen homólogos en el X. El cromosoma X, en cambio, se conservó mejor gracias a la existencia de recombinación entre las dos copias presentes en mujeres, y fue evolucionando progresivamente desde metaterios (mamíferos sin placenta, como los marsupiales) a euterios (mamíferos con placenta). Al final, en el cromosoma X actual conserva una región del autosoma ancestral de prototerios (mamíferos que ponen huevos), además de otra región «añadida» después de la separación de los metaterios. Actualmente, ambos cromosomas sexuales sólo se recombinan entre ellos en las dos pequeñas regiones pseudoautosómicas que están en los extremos de cada brazo. La reciente secuenciación completa del cromosoma X en el año 2005 ha aclarado la estructura de los cromosomas X e Y: En el cromosoma X se pueden distinguir:

• •

Dos regiones pseudoautosómicas PAR1 y PAR2, por las que se recombinan los cromosomas X e Y (al menos una recombinación en PAR1 es necesaria en la meiosis masculina). PAR1 (en Xp e Yp) tiene un tamaño de 2,7 Mb, mientras que PAR2 (en el extremo del brazo largo de ambos cromosomas) mide 330 kb. Una gran región conservada (XCR, X-conserved region) que ocupa la mayor parte del brazo largo del cromosoma X. Esta es la secuencia más antigua y representa los restos del autosoma original de prototerios del que se originaron

www.FreeLibros.me


CAPITULO 8

5/12/06

Página 115

los cromosomas X e Y actuales. Una pequeña porción de esta región se encuentra transpuesta al cromosoma Y (XTR, X-transposed region), calculándose que dicha transposición tuvo lugar hace 5 millones de años, después de la separación de humanos y chimpancés. Una región «añadida» (XAR, X-added region) más joven que XCR, al parecer incorporada al cromosoma X a partir de otro autosoma hace unos 100 millones de años en mamíferos placentarios (euterios). Esta región representa la mayor parte del brazo corto del cromosoma X actual. Algunos fragmentos de la porción más distal de este brazo, cercanos a la PAR1, están también presentes en el cromosoma Y, distinguiéndose hasta 12 bloques de homología entre ambos cromosomas.

De los aproximadamente 1 000 genes que hay en el cromosoma X, 54 tienen un homólogo funcional en el Y: 24 de ellos están en PAR1, cinco en PAR2 y 25 en las regiones no-recombinantes de ambos cromosomas. De éstos 25, 15 están en la XAR y tres en XTR; los siete genes restantes se localizan en la XCR y por eso se piensa que descienden del autosoma ancestral.

PAR1 PAR1

PAR1

XTR

XTR XCR

Genes que escapan a la inactivación

XAR

XTR

PAR2 PAR2

La Figura 8.5 muestra la estructura de los cromosomas X e Y humanos.

El cromosoma Y es el más peculiar de todos los cromosomas humanos, ya que sólo 23 megabases (de un total estimado de 50 Mb) están formadas por eucromatina. Por ello, este cromosoma es también el más pobre en genes. La peculiar estructura del cromosoma Y actual se debe a su comportamiento durante la meiosis: lógicamente, no puede quedar sin emparejar durante la meiosis, y de hecho se empareja con el cro-

www.FreeLibros.me

115

Estructura de los cromosomas sexuales humanos

07:14


CAPITULO 8

116

5/12/06

07:14

Página 116

Herencia relacionada con el sexo

mosoma X a través de las dos regiones pseudoatosómicas que contiene en los extremos del brazo corto y del brazo largo, respectivamente. El resto del cromosoma Y no se recombina nunca, y por esto ha ido acumulando mutaciones y degenerando con el tiempo. La región eucromática del Y comprende unas 22 Mb (el resto del cromosoma es heterocromatina) y está constituida por tres tipos de secuencias: i) un bloque de 3,4 Mb fruto de una transposición procedente del X (XTR, región transpuesta desde el X); ii) un total de 8,6 Mb de secuencias derivadas del cromosoma X, que representan las regiones derivadas del cromosoma ancestral; y iii) un total de 10,2 Mb de regiones palindrómicas, distribuidas en siete bloques. En total, en el cromosoma Y sólo se han encontrado 158 unidades transcripcionales, entre las que destacan 27 genes que tienen homólogos claros en el cromosoma X. De éstos, 13 están degenerados y se han convertido en pseudogenes; los 14 restantes son auténticos genes que se expresan en varios tejidos, con la excepción de SRY (que sólo se expresa en células germinales masculinas). Todos estos genes se localizan fundamentalmente en las regiones derivadas del X. Por el contrario, en las regiones palindrómicas hay unos 60 genes, agrupados en nueve familias, que sólo se expresan en el tejido testicular y que no tienen un homólogo claro en el cromosoma X: estos genes parecen codificar proteínas necesarias para la fertilidad masculina. Por lo que respecta al papel de las regiones palindrómicas, parecen tener una importancia clave en el mantenimiento de la secuencia y estructura del cromosoma Y: la recombinación entre los brazos de cada palíndromo y la conversión de secuencias entre ellos evita la rápida degeneración que tendría lugar por la ausencia de recombinación entre los cromosomas X e Y en esta región.

www.FreeLibros.me


CAPITULO 9

5/12/06

07:16

Página 117

CAPÍTULO 9

Modificaciones de las proporciones mendelianas

Contenidos 9.1 Modo de estimar si se cumplen las proporciones mendelianas esperadas 9.2 Modificaciones de las proporciones mendelianas al estudiar un carácter 9.3 Modificaciones del dihibridismo. Interacción génica y epistasia

Ya desde el inicio de los experimentos con plantas, diversos naturalistas habían encontrado proporciones fenotípicas en la F2 de monohíbridos o dihíbridos que no se correspondían con lo que cabría esperar según las leyes mendelianas (3:1 y 9:3:3:1, respectivamente). Como acabamos de ver, la búsqueda de las causas de estas desviaciones permitió descubrir la herencia ligada al sexo en los caracteres controlados por genes situados en el cromosoma X. Además, se descubrieron fenómenos como el multialelismo o la interacción génica en aquellos caracteres que están controlados por más de un gen. Aunque todas estas situaciones dan lugar a proporciones fenotípicas distintas a las esperadas por las leyes de Mendel, el análisis detallado de lo que sucede viene a confirmar que, efectivamente, los postulados mendelianos también explican estas situaciones.

9.1 Modo de estimar si se cumplen las proporciones 9.1 mendelianas esperadas Antes de pasar al estudio de estas cuestiones, es imprescindible estudiar la metodología empleada para poder afirmar con fiabilidad si unas proporciones fenotípicas dadas se apartan significativamente de lo esperado según las leyes mendelianas. Lógicamente, los

www.FreeLibros.me


CAPITULO 9

118

5/12/06

07:16

Página 118

Modificaciones de las proporciones mendelianas

porcentajes esperados nunca se cumplen perfectamente porque el tamaño de las muestras no es lo suficientemente grande. Por ejemplo, en un cruce moníbrido típico en el que analizamos 100 plantas en la F2, esperaríamos encontrar 75 con el fenotipo dominante y 25 con el fenotipo recesivo. Sin embargo, lo más probable es que nunca encontremos exactamente estos números, sino 74 y 26, o 77 y 23, por ejemplo. En el caso de especies con generaciones menos numerosas, como sucede en las familias humanas, las desviaciones pueden ser todavía mayores debido al pequeño número de individuos que se estudia. Por tanto, es imprescindible contar con un método cuantitativo que nos permita concluir con certeza estadística si los porcentajes encontrados se ajustan a lo esperado. El método utilizado es el cálculo del Chi cuadrado, un estadístico que se ajusta a una distribución concreta y que permite calcular la bondad del ajuste de unas proporciones a un modelo teórico. El método calcula la probabilidad de que la diferencia observada entre las proporciones experimentales y las proporciones teóricas sea atribuible al azar. La hipótesis nula es que las proporciones teóricas se cumplen y la diferencia es explicable por el azar, sobre todo cuando el tamaño de la muestra es pequeño. Si el estadístico χ2 (chi cuadrado) supera un cierto valor, se puede rechazar la hipótesis nula con una fiabilidad específica (5 por ciento, 1 por ciento, 0,1 por ciento) y por tanto se puede afirmar que las proporciones fenotípicas experimentales se alejan significativamente de las esperadas según el modelo teórico. Es fácil comprender la mecánica de este razonamiento con un ejemplo. En un cruce monohíbrido típico analizamos 1 000 individuos de la F2 y encontramos 760 con el fenotipo dominante y 240 con el fenotipo recesivo. Esto se aparta de los 750:250 que esperaríamos encontrar si este carácter se heredase de forma mendeliana, pero tenemos que comprobar si esta desviación es atribuible al azar (de modo que si hubiésemos analizado 10 000 individuos las proporciones hubiesen sido más cercanas al 3:1 teórico), o si efectivamente este carácter no sigue las leyes de Mendel. El primer paso es el cálculo del estadístico χ2 con arreglo a la fórmula χ2 = Σ [ (O – E)2/E], siendo O el número de casos observados y E el número de casos esperados para cada categoría. En nuestro ejemplo, para el fenotipo dominante esperaríamos encontrar 750 casos, pero hemos encontrado 760. Así, calculamos (760 – 750)2/750 = 0,133. Hacemos lo mismo para el fenotipo recesivo: (240 – 250)2/250 = 0,4. Ahora podemos obtener el sumatorio, de modo que χ2 = 0,133 + 0,4 = 0,533. El último paso es comprobar este valor en una tabla que represente los valores máximos del χ2 a los que se puede rechazar la hipótesis nula con distintos niveles de probabilidad y para varios grados de libertad. Si buscamos en una de estas tablas, vemos que —para un grado de libertad— se puede rechazar la hipótesis nula, con un error del cinco por ciento, cuando el valor del χ2 es igual o superior a 3,841. Como el valor calculado por nosotros es inferior, no podemos rechazar la hipótesis nula y, por tanto, las proporciones experimentales no se apartan significativamente de lo esperado según un modelo mendeliano de herencia. En cambio, si hubiésemos obtenido 780 dominantes y 220 recesivos, el χ2 resultante sería de 4,8. Como este valor rebasa el valor de la tabla para un grado de libertad y p = 0,05 (3,841) pero es inferior al valor de la tabla para p = 0,025 (5,024), podríamos rechazar la hipótesis nula con un nivel de confianza del 95 por ciento (p < 0,05) y afirmar

www.FreeLibros.me


CAPITULO 9

5/12/06

07:16

Página 119

La Figura 9.1 muestra el uso del χ2 para estimar si unas proporciones fenotípicas se ajustan a las esperadas según las leyes mendelianas.

Otra consideración previa a los temas que vamos a tratar en este capítulo hace referencia a la manera de nombrar los diferentes alelos de cada gen. Es bastante evidente que al principio cada genetista utilizaba distintas nomenclaturas, y se tardó un tiempo en alcanzar un consenso sobre la notación de los alelos. Aunque hoy en día se pueden utilizar distintas formas de denominar los alelos, podemos dar unas reglas generales. Como ya vimos al explicar los experimentos de Mendel, lo más habitual es denominar los alelos con la letra inicial del carácter recesivo (por ejemplo, vimos que los alelos para el color del guisante se llamaban V y v por ser ésta la inicial de «verde», que es el carácter recesivo). Así, podemos utilizar una sola letra tanto para el alelo dominante (poniéndola en mayúscula) como para el recesivo (en minúscula). En otros casos, se estudian mutaciones respecto a un carácter normal, y hay que establecer nombres para los alelos que causan las mutaciones y para el alelo normal. Un buen ejemplo es el color del ojo de Drosophila, para el que hay un alelo que causa el color normal rojo ladrillo y otros alelos mutantes que dan lugar a ojos de distintos colores. En general, a los alelos normales se les denomina alelos «silvestres» o «salvajes», porque son los que se encuentran en la naturaleza. Cada alelo mutante se representa por una o varias letras que describen la mutación (br para «brown», ojos marrones, por ejemplo) y el alelo salvaje se representa entonces por esas mismas letras añadiendo el superíndice +. Por ejemplo, una mosca heterocigota para la mutación «brown» tendría un genotipo br+/br. En ocasiones se eliminan las letras del alelo silvestre, dejando únicamente el +. Así, el genotipo anterior también podría representarse como +/br. Dependiendo del estado dominante o recesivo del alelo mutante, éste se representa con mayúsculas o minúsculas, respectivamente. En los casos en que no hay dominancia o en las series alélicas (en las que hay varios alelos para un mismo carácter y las relaciones de dominancia entre ellos son complejas) se suelen utilizar superíndices para designar los distintos alelos, como por ejemplo en el color del plumaje de patos «Mallard». Para este carácter hay tres alelos denominados M, MR y md, siendo la dominancia: MR (Restricted) > M (Mallard) > md (Dusky). En el caso concreto de la Genética Humana, las recomendaciones actuales indican que los alelos se designen mediante un número o una letra, precedido por un asterisco, a continuación del símbolo del gen. Por ejemplo, la variante Constant Spring de la hemoglobina alfa-2 se puede denominar HBA2*0001 (alelo 0001 del gen HBA2).

www.FreeLibros.me

119

Modo de estimar si se cumplen las proporciones mendelianas esperadas

que las proporciones obtenidas no se ajustan a un modelo mendeliano de herencia. El número de grados de libertad siempre es igual al número total de clases menos uno: como en nuestro caso sólo teníamos dos clases fenotípicas, hemos utilizado un grado de libertad. En el caso de un cruce dihíbrido, en el que tendremos cuatro clases fenotípicas distintas en la F2, deberíamos calcular el χ2 total y buscar en la tabla el valor correspondiente para tres grados de libertad.


CAPITULO 9

120

5/12/06

07:16

Página 120

Modificaciones de las proporciones mendelianas

9.2 Modificaciones de las proporciones mendelianas 9.2 al estudiar un carácter Como hemos visto, tras los trabajos de Bateson, Morgan y muchos otros genetistas los principios mendelianos se aceptaron como algo de aplicación general. Sin embargo, también desde el principio se reconocieron excepciones que no podían ser explicadas por estos principios, al menos aparentemente. Por ejemplo, observaciones en plantas habían revelado casos en los que la F1 de un cruce monohíbrido tenía un fenotipo intermedio entre el dominante y el recesivo de los progenitores, y ese fenotipo intermedio estaba presente también en el 50 por ciento de la F2. Este era el caso del color de la flor en algunas especies, en las que al cruzar una variedad pura de flores rojas con otra variedad pura de flores blancas se obtenía en la F1 un 100 por ciento de flores rojas (color intermedio entre el rojo y el blanco). En la F2 resultante de la autofecundación de flores de la F1 se obtenían 25 por ciento de flores rojas, 50 por ciento de flores rosas y 25 por ciento de flores blancas. Es fácil darse cuenta de que estas proporciones fenotípicas de la F2 (1:2:1) coinciden con las proporciones genotípicas esperadas, en vez de las proporciones fenotípicas 3:1 que son habituales en este tipo de cruces. Estos resultados sugieren que no se está cumpliendo la condición de dominancia completa de un alelo sobre el otro, de modo que los heterocigotos muestran un fenotipo distinto (un poco menos «fuerte») que los homocigotos dominantes. La explicación para esta dominancia «débil» está en que el carácter fenotípico obedece a efectos de dosis, es decir, el fenotipo depende de la dosis en que aparece el alelo dominante. En el ejemplo del color de las flores, podemos imaginar que el alelo recesivo da lugar a flores blancas (cuando se trata de plantas homocigotos recesivos) porque no produce ninguna cantidad de pigmento rojo; el alelo que da lugar al color rojo hace que se produzca una cantidad determinada de pigmento rojo, y por tanto la presencia de dos alelos rojos (homocigoto dominante) tendrá como resultado flores más rojas que la presencia de un solo alelo rojo (heterocigoto rojo/blanco), en cuyo caso las flores serán de un color rojo débil o rosa. Este fenómeno se denomina dominancia incompleta o semidominancia, y es muy común en caracteres fenotípicos que son el resultado de la acción de algún enzima, ya que la actividad enzimática total dependerá del número de alelos capaces de producir el enzima correspondiente. Otra circunstancia que puede modificar las proporciones fenotípicas mendelianas por relaciones anómalas entre alelos es la co-dominancia, en la que cada uno de los alelos da lugar a un producto funcional que se expresa con independencia del otro. En estas condiciones, el heterocigoto tendrá un fenotipo distinto a cualquiera de los dos homocigotos, que también serán distintos entre sí. Por eso, las proporciones fenotípicas de la F2 serán también del tipo 1:2:1, como en el caso anterior. Un ejemplo típico de co-dominancia en un carácter codificado por un gen es el grupo sanguíneo MN en la especie humana. El locus que codifica este carácter puede presentarse en dos formas alélicas llamadas LM y LN, las cuales codifican unas glicoproteínas de la membrana de los eritrocitos que dan lugar a los antígenos M y N respectivamente. Los individuos homocigotos LM/LM tienen fenotipo M, los homocigotos LN/LN tienen fenotipo N, y los heterocigotos LM/LN tienen fenotipo MN. Por tanto, un cruzamiento entre heterocigotos LM/LN X LM/LN producirá proporciones fenotípicas 1:2:1 (25 por ciento MM, 50 por ciento MN, 25 por ciento NN). En el fondo, se trata de la misma

www.FreeLibros.me


CAPITULO 9

5/12/06

07:16

Página 121

A

A

A

a

a

a

Los vídeos de la Figura 9.2 ilustran los conceptos de codominancia y dominancia incompleta.

Aunque en especies diploides cada individuo sólo tiene dos alelos en cada locus autosómico, esto no quiere decir que esos dos alelos sean los dos únicos alelos posibles que se pueden encontrar en la naturaleza para ese carácter. De hecho, para muchos rasgos fenotípicos es habitual que haya más de dos alelos posibles, sobre todo si se incluyen todos los alelos mutantes que se pueden encontrar. Este fenómeno se conoce como alelismo múltiple y el conjunto de alelos se denomina serie alélica. La presencia de alelos múltiples es otro motivo por el que en ocasiones las proporciones mendelianas no se cumplen. El ejemplo más ilustrativo en genética humana es el del grupo sanguíneo ABO, originado por unos antígenos de la membrana de los eritrocitos. Estos antígenos están derivados de la sustancia H, que es una glicoproteína de membrana que termina con los residuos N-acetil-Glucosamina—Galactosa—Fucosa (–NacGlu—>Gal—>Fucosa). El antígeno 0, codificado por el alelo IO o i, mantiene intacta la sustancia H; el antígeno A, codificado por el alelo IA, añade un resto N-acetil-Galactosamina a la Galactosa de la sustancia H, y el antígeno B, codifica-

www.FreeLibros.me

121

Modificaciones de las proporciones mendelianas al estudiar un carácter

situación que veíamos para la dominancia incompleta, con la diferencia de que aquí los dos alelos producen una proteína funcional y por tanto ambos son igualmente dominantes. Poniéndolo en los mismos términos del ejemplo anterior, sería como una planta con un alelo que produce un pigmento que genera flores de color rojo y otro alelo que produce un pigmento para el color amarillo: todas las plantas de la F1 serán de color naranja (heterocigotos) y en la F2 se producirán 25 por ciento de flores rojas, 50 por ciento naranjas y 25 por ciento amarillas.


CAPITULO 9

122

5/12/06

07:16

Página 122

Modificaciones de las proporciones mendelianas

do por el alelo IB, añade una Galactosa a la Galactosa de la sustancia H. Los alelos IA e IB son codominantes entre sí, pero lógicamente ambos son dominantes sobre IO ya que éste no produce ningún antígeno distinto a la sustancia H. Teniendo en cuenta estas relaciones de dominancia, esta serie alélica puede dar lugar a cuatro posibles fenotipos (A, B, AB y O) a partir de una gran variedad de genotipos. Por ejemplo, el cruce entre un individuo de fenotipo A y otro de fenotipo B puede dar lugar a distintos tipos de descendencia, dependiendo de los genotipos de los progenitores. Si el cruce es del tipo IA IA X IB IB toda la descendencia serán heterocigotos IA IB con fenotipo (grupo sanguíneo) AB. Sin embargo, si se trata de un cruce IA IO X IB IO (en el que los progenitores también son de grupo sanguíneo A y B respectivamente) la descendencia tendrá proporciones fenotípicas 1/4 A, 1/4 B, 1/4 AB y 1/4 O. Estos porcentajes, a primera vista, pueden confundir y llevar a pensar que este carácter no se hereda de forma mendeliana. El análisis detallado de cada tipo de cruzamiento confirma que también se cumplen los postulados de Mendel, aunque la presencia de más de dos alelos distintos, con diferentes relaciones de dominancia entre sí, puede confundir la interpretación de las proporciones halladas en la descendencia.

N Acetilgalactosamina N - Acetilgalactosamina

FENOTIPO AA FENOTIPO

Alelo I A (añade N-acetilgalactosamina)

Alelo i (no añade nada) Fucosa Fucosa

Galactosa Galactosa

FENOTIPO FENOTIPO O O

N - Acetilglucosamina

SustanciaHH Sustancia

Alelo I B (añade galactosa) Galactosa Galactosa

FENOTIPO FENOTIPO B B

La Figura 9.3 muestra la estructura de los grupos sanguíneos ABO y las consecuencias del alelismo múltiple.

La última situación en la que no se obtienen las proporciones mendelianas esperadas cuando se estudia un carácter fenotípico es aquella en la que uno de los alelos es letal, es decir, impide el desarrollo embrionario de los individuos que llevan una o dos copias de ese alelo. Cuando la letalidad se produce sólo en individuos homocigo-

www.FreeLibros.me


CAPITULO 9

5/12/06

07:16

Página 123

9.3 Modificaciones del dihibridismo. Interacción génica 9.3 y epistasia En ocasiones, cuando se estudian dos caracteres fenotípicos también se obtienen proporciones distintas a las esperadas según los principios mendelianos, que predicen una descendencia con proporciones 9:3:3:1 al cruzar dos individuos heterocigotos para cada uno de los caracteres. Lógicamente, las circunstancias estudiadas en el apartado anterior también afectarán a estas proporciones si uno de los genes que analizamos está sujeto a codominancia, dominancia incompleta, letalidad, etc. Por

www.FreeLibros.me

123

Modificaciones del dihibridismo. Interacción génica y epistasia

tos para ese alelo, se habla de un alelo letal recesivo, mientras que si basta con la presencia de un solo alelo para causar letalidad se habla de letal dominante. Un ejemplo típico de alelos letales es el del locus que controla el pelaje amarillo de ratones, estudiado por Cuenot en 1904. Al alelo que produce un pelaje normal se le llama agouti (o agutí) en referencia a un roedor de ese nombre que vive en Sudamérica. El pelaje agutí normal se debe a que cada pelo tiene pequeñas bandas transversales negras y amarillas, de modo que la apariencia final es de un pelaje castaño. Además del alelo agutí normal (A) y de su correspondiente recesivo a, existe un alelo que origina un pelaje de color completamente amarillo (AY), que es dominante respecto al alelo agutí A. Por tanto, los cruces entre un ratón agutí y otro amarillo, o entre dos ratones agutí, producen las proporciones mendelianas esperadas en al descendencia. Por ejemplo, el cruce AA X AYA (ratón agutí con ratón amarillo) tendrá una descendencia con 50 por ciento de ratones agutí y 50 por ciento amarillos. En cambio, los cruces entre ratones amarillos tienen descendencia con 1/3 de ratones agutí y 2/3 de ratones amarillos, lo cual no se corresponde con las proporciones fenotípicas esperadas. Si el cruce fuese del tipo AYA X AYA, en la descendencia deberíamos encontrar 1/4 AA, 1/4 AYAY y 1/2 AYA, lo cual se debería traducir en 3/4 amarillos y 1/4 agutí (proporción 3:1 típica). La explicación reside precisamente en que el alelo AY es letal recesivo, y provoca la muerte embrionaria de ratones homocigotos AYAY. Por eso, al descontar el 25 por ciento de ratones AYAY nos quedamos sólo con descendencia de genotipos AA o AYA y de ahí las proporciones encontradas. El alelo amarillo (AY) es, por tanto, un ejemplo de un alelo letal, recesivo en cuanto a la letalidad pero dominante en cuanto al carácter fenotípico que controla (el color amarillo del pelaje). En el caso de humanos es más difícil descubrir genes con alelos letales, porque habitualmente no tienen otro efecto fenotípico que permita reconocerlos. A veces se ven proporciones ligeramente distintas a las esperadas, y en esos casos se sospecha que uno de los alelos es subvital o subletal, es decir, que causa cierta mortalidad durante el desarrollo embrionario. Al llegar al final de este apartado, es muy importante recordar que todas las posibles desviaciones de las proporciones fenotípicas mendelianas que hemos visto hasta ahora están causadas por problemas en los alelos de un único gen que controla un carácter fenotípico, bien por falta de dominancia completa, por la existencia de múltiples alelos o por la presencia de alelos letales. Por eso las hemos agrupado bajo el epígrafe de modificaciones del monohibridismo, porque son situaciones que surjen al analizar un único gen.


CAPITULO 9

124

5/12/06

07:16

Página 124

Modificaciones de las proporciones mendelianas

ejemplo, podemos considerar dos caracteres distintos tales como el grupo sanguíneo ABO (cuyo sistema alélico ya ha sido explicado) y el albinismo. Éste último es un carácter mendeliano controlado en ratones por un solo gen, con un alelo silvestre A y un alelo recesivo a que provoca albinismo en homocigotos aa. Si cruzamos ratones dobles heterocigotos Aa/IAIB, la descendencia no se ajustará a las proporciones típicas 9:3:3:1, sino que obtendremos ratones pigmentados con grupo sanguíneo A, B o AB, y también ratones albinos con cualquiera de los tres grupos sanguíneos. Las proporciones fenotípicas serán 3:6:3:1:2:1, que en el fondo es una modificación de la relación 9:3:3:1. La razón de este fenómeno es que los alelos que determinan el grupo sanguíneo son co-dominantes (los alelos IA y IB) y por eso distorsionan las proporciones fenotípicas esperadas. Habitualmente, las anomalías en las proporciones del dihibridismo se detectan cuando se estudia un carácter fenotípico que está controlado por dos o más genes, debido a un fenómeno llamado interacción génica. En efecto, aunque cada gen por separado se comporte de acuerdo a los principios mendelianos y los genotipos sean los esperados, puede suceder que las proporciones fenotípicas sean aberrantes porque ambos genes están controlando un mismo carácter y la acción de uno enmascara los genotipos del otro. La interacción génica no significa que ambos genes o sus productos interaccionen directamente, sino que participan en una misma vía o proceso biológico (como puede ser la generación de un pigmento en varios pasos metabólicos, por ejemplo). Si cada gen actúa a distintos niveles de esa vía, uno de ellos puede afectar la expresión del otro y dar lugar a proporciones fenotípicas inesperadas en la descendencia. El principal obstáculo que nos encontramos para interpretar las proporciones es que, si únicamente estamos analizando un carácter fenotípico, es imposible saber a priori si dicho carácter está controlado por un gen o por varios. En efecto, en el caso de dos caracteres era fácil porque podíamos agrupar la descendencia en las cuatro posibles categorías fenotípicas que surjen al considerar dos caracteres a la vez, pero aquí estamos observando un carácter solamente. La pista que nos indica el número de genes implicados es el denominador de las proporciones fenotípicas encontradas: si éstas se expresan en dieciseisavos, podemos suponer que nos encontramos ante un carácter fenotípico controlado por dos genes, si son sesentaycuatroavos se tratará de tres genes, etc. Los efectos de la interacción génica pueden ser básicamente de dos tipos: la aparición de fenotipos nuevos (que no estaban presentes en los progenitores) y la modificación de las proporciones típicas del dihibridismo. Por lo que respecta al primero, recordemos que según los principios mendelianos el carácter recesivo de uno de los progenitores desaparece en la F1 y reaparece en el 25 por ciento de la F2. En cambio, si un carácter está controlado por dos genes distintos, a veces el resultado es que en la F2 aparecen fenotipos nuevos que no estaban presentes en la F1 ni en los progenitores. Tal es el caso, por ejemplo, del color del pimiento Capsicum annuum, que es un rasgo fenotípico determinado por dos loci: uno de ellos determina la producción o no de pigmento rojo, con un alelo R que produce pigmento rojo y es dominante sobre el alelo r que no produce pigmento. El otro gen controla la degradación de la clorofila (de color verde), con un alelo dominante C que degrada la clorofila para dar un color amarillento (sin pigmento), y un alelo recesivo c que no de-

www.FreeLibros.me


CAPITULO 9

5/12/06

07:16

Página 125

www.FreeLibros.me

125

Modificaciones del dihibridismo. Interacción génica y epistasia

grada la clorofila y por tanto da el color verde típico. En estas circunstancias, un cruce de variedades puras RRCC (de color rojo) X rrcc (de color verde) da lugar al 100 por cien de plantas RrCc (de color rojo) en la F1. Hasta aquí todo parecería indicar que el color del pimiento está controlado por un solo gen. En cambio, el cruce RrCc X RrCc produce en la F2 unas proporciones genotípicas con 9/16 R_C_ de color rojo, 3 /16 R_cc de color marrón (por la presencia simultánea del rojo y el verde), 3/16 rrC_ de color amarillento por la ausencia de pigmentos y 1/16 rrcc de color verde. Esto va contra los principios del monohibridismo mendeliano típico, ya que tenemos cuatro fenotipos distintos. Aunque esto podría sugerir la presencia de alelos múltiples para un solo locus, las proporciones encontradas para las cuatro clases fenotípicas (expresadas en dieciseisavos) sugieren que este carácter está controlado por dos loci. Otro ejemplo de este fenómeno es el color de los ojos de la Drosophila, en el que el tipo silvestre de color rojo ladrillo está controlado por dos genes: brown (marrón) y scarlet (escarlata). El locus brown tiene un alelo silvestre bw+ dominante sobre el recesivo marrón (br) y el locus scarlet tiene un alelo silvestre st+ dominante sobre el recesivo (st) que produce ojos de color rojo escarlata. Las moscas con ojos de color silvestre tienen un genotipo bw+bw+/st+st+. Al cruzar una mosca mutante con ojos de color marrón (bwbw/st+st+) con otra de ojos escarlata (bw+bw+/stst), toda la F1 es doble heterocigótica (bw+bw/st+st) y por tanto con ojos del color silvestre rojo ladrillo. En la F2 resultante del cruce entre moscas de la F1, se obtiene un nuevo fenotipo (ojos de color blanco) en 1/16 del total, y proporciones 9:3:3:1 de los fenotipos silvestre, marrón, escarlata y blanco respectivamente. Nuevamente, la presencia de 4 clases fenotípicas expresadas en dieciseisavos nos alerta sobre la presencia de dos loci controlando este carácter. De hecho, lo que sucede es que el locus brown controla la producción de un pigmento de color rojo brillante llamado drosopterina, mientras que el locus scarlet controla la producción de otro pigmento de color marrón llamado xantomatina. En situaciones normales, el color silvestre es el resultado de la mezcla de ambos pigmentos. En cambio, mutaciones en el locus brown hacen que no se produzca drosopterina y el único pigmento del ojo sea la xantomatina (de ahí el color marrón del ojo). Las mutaciones en el locus scarlet hacen que no se produzca xantomatina, siendo el color del ojo rojo escarlata por la presencia de drosopterina. Los dobles mutantes recesivos (1/16) del total de la F2, carecen de ambos pigmentos y por tanto tienen ojos de color blanco. El otro efecto de la interacción génica es la distorsión de las proporciones mendelianas esperadas al analizar un carácter. Dicha distorsión puede ser debida a la presencia de dos genes que controlan dicho carácter, de modo que uno de los genes enmascara la expresión del otro. Este fenómeno se conoce con el nombre de epistasia y puede ser de distintos tipos, como veremos a continuación. Al gen que modifica la expresión del otro se le denomina gen epistático, y al gen cuya expresión es modificada se le denomina gen hipostático. Un buen ejemplo para entender la epistasia, utilizando los grupos sanguíneos humanos, es el llamado fenotipo Bombay. Como se recordará, los isoantígenos A y B resultan de la adición de N-acetil-galactosamina o de galactosa, respectivamente, a la sustancia H. Por tanto, sólo los individuos que tienen sustancia H en la membrana de los eritrocitos pueden expresar antígenos A o B. La producción de sustancia H (la adición de la última fucosa a la cadena glicosídica) está controlada por otro locus distinto que presenta un alelo do-


CAPITULO 9

126

5/12/06

07:16

Página 126

Modificaciones de las proporciones mendelianas

minante H (produce sustancia H completa) y otro alelo recesivo h (no la produce). Por tanto, los individuos homocigotos hh no producirán sustancia H y no podrán expresar ningún isoantígeno aunque tengan alelos IA o IB para el locus del sistema ABO. Este fenómeno se encontró por primera vez en una mujer del grupo O hija de padres A y AB, lo cual es imposible según la herencia del sistema ABO. Esta mujer, casada con un individuo del grupo A (genotipos posibles Iai o IAIA) tuvo descendencia del grupo A, B y AB, lo cual también es imposible si ella fuese realmente del grupo O (genotipo ii). La explicación es que la mujer en realidad tenía genotipo IBi y por tanto debería ser del grupo B, pero como es homocigota para el alelo recesivo h y no produce sustancia H su fenotipo es del grupo O. Podemos imaginar un cruce entre individuos dobles heterocigotos para el grupo ABO y para la sustancia H, del tipo IAIB/Hh X IAIB/Hh. Según el locus ABO, la descendencia debería ser 1/4 del grupo A, 1/4 del grupo B y 1/2 del grupo AB. Sin embargo, al tener en cuenta el locus H vemos que 1/4 de cada una de esas categorías serán homocigotos hh (sin sustancia H) y por tanto del grupo O. Al considerar ambos loci, las proporciones fenotípicas serán 3 /16 del grupo A, 6/16 del grupo AB, 3/16 del grupo B y 4/16 del grupo O, lo cual se desvía de las proporciones esperadas 9:3:3:1. Como vemos, la presencia de un gen epistático (el que controla la producción de sustancia H) enmascara la expresión del locus ABO (que en este ejemplo es el gen hipostático) porque ambos genes están implicados en procesos bioquímicos que interaccionan en un mismo carácter fenotípico. Como las proporciones fenotípicos se expresan en dieciseisavos, esto nos alertaría inmediatamente sobre la presencia de dos genes interactuando de modo epistático aunque no supiésemos nada de la existencia de la sustancia H. La Figura 9.4 muestra un ejemplo del fenotipo Bombay.

En general, la epistasia puede ser recesiva o dominante, según el gen epistático deba estar en homocigosis o no, respectivamente, para enmascarar la expresión del gen hipostático. A su vez, la epistasia puede ser simple (uno de los genes es epistático sobre el otro) o doble (ambos loci son epistásicos el uno sobre el otro). Veamos algunos ejemplos de los tipos de epistasia más comunes: Epistasia simple recesiva: ya vimos que el color del pelaje de ratones está controlado por el gen agutí, con un alelo A dominante sobre a, de forma que los ratones A- (AA o Aa) son de fenotipo agutí y los ratones aa tienen pelaje negro (carecen de las pequeñas bandas amarillas). Existe otro gen que controla la presencia o no de pigmentación, con alelo dominante C (pigmentación) y un alelo recesivo Ca que impide cualquier tipo de pigmentación. Los ratones de genotipo homocigoto recesivo CaCa son, por tanto, albinos, mientras que los ratones C– (CC o CCa) son del color especificado por el locus agutí. La F1 de un doble homocigoto dominante AA/CC (agutí) con un doble homocigoto recesivo aa/CaCa (albino) son todos heterocigotos dobles de pelaje agutí (genotipo Aa/CCa). La F2 resultante de cruzar ratones de la F1 muestra una proporción 9:4:3 (agutí:albino:negro) por epistasia de C sobre A. En este caso, hablamos de epistasia recesiva porque el alelo Ca es recesivo (sólo CaCa modifica el fenotipo

www.FreeLibros.me


CAPITULO 9

5/12/06

07:16

Página 127

www.FreeLibros.me

127

Modificaciones del dihibridismo. Interacción génica y epistasia

determinado por A). El ejemplo anterior del fenotipo Bombay es también una epistasia de este tipo, pero al ser codominantes los grupos sanguíneos los 9/16 se descomponen en 6/16 y 3/16 (de ahí las proporciones 3:6:4:3 que veíamos). La epistasia simple recesiva es muy común entre genes que actúan a distintos pasos de una misma vía metabólica, y por eso es frecuente en enfermedades del metabolismo. Por ejemplo, cuando la producción de un pigmento se lleva a cabo en dos pasos metabólicos, de modo que el producto de la primera reacción es el sustrato de la segunda reacción, las mutaciones que afectan al enzima responsable de la primera reacción serán epistáticas sobre el gen que controla el segundo paso. Epistasia simple dominante: en este caso el alelo del gen epistático es dominante, y basta con una sola copia para que enmascare el efecto del gen hipostático. Un ejemplo típico es el color de la calabaza común, en el que interviene un gen que controla el primer paso metabólico en la producción de un pigmento. El alelo normal (w) permite la reacción química, pero es recesivo frente al alelo W que impide dicha reacción. El producto de este primer paso es el sustrato de una segunda reacción controlada por otro gen (con alelos Y e y) que da lugar al color final de la calabaza. Las plantas con genotipo ww para el primer gen (es decir, se lleva a cabo el primer paso de la vía) pueden ser amarillas (genotipos YY o Yy para el segundo gen) o verdes (genotipo yy). En cambio, basta la presencia de un alelo W en el primer locus para que todas las plantas sean blancas, porque no se completa la primera reacción y no hay pigmentación. En este tipo de espistasia, la F2 resultante del cruce de dobles heterocigotos muestra proporciones fenotípicas 12:3:1, con 12/16 del fenotipo determinado por el alelo dominante del gen epistático. Epistasia doble recesiva: este tipo de epistasia fue observada por primera vez por Bateson y Punnett al estudiar el color de las flores de Lathyrus odoratus (guisante oloroso). Vieron que al cruzar dos flores blancas todas las plantas de la F1 eran púrpuras y en la F2 aparecía una proporción 9:7 de púrpuras:blancas. Las proporciones en dieciseisavos confirman la presencia de dos loci P y Q que controlan este carácter. La proporción 9:7 se puede explicar si consideramos que ambos genes tienen un alelo dominante (P o Q) y otro recesivo (p o q) y actúan sobre dos pasos sucesivos en la vía metabólica que genera el pigmento de las flores. Si el pigmento que da el color púrpura sólo se produce cuando están presentes al menos un alelo dominante de cada uno de los genes implicados, la descendencia de un cruce del tipo PPqq x ppQQ (en el que ambas plantas tienen flores blancas), será del 100 por ciento de dobles heterocigotos PpQq en la F1 (todas con flores púrpuras, pues tienen un alelo dominante de cada par génico). El cruce de estas plantas dará en la F2 9/16 de plantas con genotipo homocigoto recesivo para alguno de los dos genes (blancas); el resto serán púrpuras por tener genotipos con un alelo dominante para ambos genes. Se denomina doble recesiva porque la presencia de cualquiera de los dos homocigotos recesivos para uno de los genes es epistático sobre el otro gen. Otros tipos de espistasia. Se conocen muchos otros ejemplos de epistasia en las que las relaciones entre el gen epistático y el hipostático pueden ser distintas. Por ejemplo, cuando un fenotipo requiere la presencia de al menos un alelo dominante para cualquiera de los dos loci que controlan un carácter, el fe-


CAPITULO 9

128

5/12/06

07:16

Página 128

Modificaciones de las proporciones mendelianas

notipo alternativo aparecerá únicamente en individuos dobles homocigotos, y las proporciones obtenidas en la F2 de un cruce entre dobles heterocigotos serán 15:1. Este tipo de epistasia se denomina doble dominante porque los dos alelos epistáticos son dominantes de modo recíproco, y es típica de genes que se han originado por duplicación a partir de un gen ancestral y controlan un mismo carácter fenotípico. Otra situación distinta es la que origina epistasia doble dominante/recesiva, debida a la supresión dominante de un gen sobre el efecto del otro y que produce proporciones fenotípicas 13:3. El vídeo de la Figura 9.5 ilustra el concepto de epistasia.

Como conclusión a este capítulo, conviene recordar que todas las desviaciones que hemos visto de las proporciones fenotípicas esperadas según los principios mendelianos no invalidan las conclusiones de Mendel, sino que en el fondo las confirman. Sin embargo, estas excepciones sirven para recordarnos que los caracteres hereditarios que están controlados por un solo locus con dos alelos son, en realidad, una minoría. Curiosamente, los siete caracteres descritos por Mendel en su artículo original cumplían estos requisitos, pero la mayor parte de los rasgos genéticos son más complejos y están sometidos a alguno de los fenómenos descritos (codominancia, alelismo múltiple, interacción, etc.). Como veremos más adelante, los rasgos de mayor importancia en Genética Humana están controlados por dos o más genes, y generan muchas veces variación fenotípica continua. Aunque las leyes de Mendel son todavía aplicables incluso en estos casos, la interpretación se complica tremendamente al aumentar el número de loci, al aparecer alelos mutantes y al añadirse los efectos de la interacción entre los genes y el ambiente.

www.FreeLibros.me


CAPITULO 10

5/12/06

07:18

Página 129

CAPÍTULO 10

Genética de los caracteres cuantitativos

Contenidos 10.1 Genética de los caracteres cuantitativos: experimentos de Johannsen, Nilsson-Ehle y East 10.2 Modelo poligenes-ambiente y enfermedades multifactoriales 10.3 Heredabilidad en sentido amplio y en sentido restringido. Cálculo de la heredabilidad en Genética 10.3 Humana

10.1 Genética de los caracteres cuantitativos: experimentos 10.1 de Johannsen, Nilsson-Ehle y East Hemos visto que Mendel se centró en el estudio de caracteres cualitativos (es decir, caracteres que sólo aparecen en dos posibles formas alternativas), que generan un tipo de variación llamada variación discontinua. Sin duda alguna, la gran intuición de Mendel fue que sólo el estudio de la variación discontinua le permitiría desentrañar las leyes de la herencia y los factores implicados en la misma. Sus experiencias le habían mostrado que este tipo de caracteres eran los únicos que reaparecían en la F2 después de haber desaparecido en la F1. Por el contrario, los caracteres cuantitativos o continuos (que admiten muchos valores posibles y en los que los valores individuales se agrupan en torno a una media, como el caso la altura de una planta, el peso de los frutos, etc.) no mostraban este comportamiento. La importancia de esta decisión fue extraordinaria, sobre todo teniendo en cuenta que la teoría prevalente en ese momento era contraria a esta manera de pensar. Por ejemplo, Darwin daba preferencia a los caracteres cuantitativos respecto a los cualitativos (que consideraba de menor importancia) y aceptaba una teoría llamada «pangénesis». Según esta teoría, la herencia sería el resultado de la mezcla de «gémulas», unas partículas somáticas que de algún modo llegarían a la descendencia y

www.FreeLibros.me


CAPITULO 10

130

5/12/06

07:18

Página 130

Genética de los caracteres cuantitativos

determinarían que los caracteres de la descendencia fuesen intermedios a lo encontrado en ambos progenitores. Es curioso que Darwin no se fijase en la importancia de la variación discontinua, porque de hecho un modelo de herencia basado en caracteres cualitativos favorecía más su teoría evolutiva. Probablemente fue muy importante la influencia del pensamiento de Francis Galton, que estaba convencido de que los caracteres cuantitativos constituyen la base de la variación entre individuos y no entendía que éstos pudiesen ser explicados por medio de variaciones discontinuas. De hecho, Galton había estudiado el tamaño de la planta del guisante y había encontrado evidencias de variación continua (una F1 con altura intermedia a la de ambos progenitores). Estos experimentos tenían sus antecedentes en Kölreuter, un botánico que en 1766 había hecho numerosos cruces en plantas y había encontrado caracteres (como la altura de la planta Nicotiana, por ejemplo) que mostraban variación continua. No es de extrañar, pues, que se generase una fuerte controversia a principios del siglo XX entre los partidarios del mendelismo y los biometricistas (discípulos de Galton, defensores de la variación continua). Por desgracia, la influencia de Galton y la aplicación de las ideas de los biometricistas a sujetos humanos ocasionaron una de las páginas más oscuras de la Genética a principios del siglo XX, ya que cristalizaron en el movimiento eugenésico, que floreció en los Estados Unidos de la mano de Charles Davenport en el laboratorio de Cold Spring Harbor. Con la idea de mejorar la raza humana mediante apareamientos selectivos, los eugenistas pretendían eliminar de la sociedad rasgos «negativos» como la criminalidad, el analfabetismo o la prostitución; su presión fue suficiente para que el gobierno de los Estados Unidos aprobase —entre 1910 y 1939– legislación eugenésica en tres áreas: restricción de la inmigración europea; impedir matrimonios entre individuos de razas distintas; esterilización de los individuos «genéticamente infradotados». El auge del movimiento nazi con la aplicación de la «solución final» contribuyó al descrédito del movimiento eugenista americano, llevando al cierre de su principal laboratorio en 1939. Por desgracia, muchas de las leyes aprobadas siguieron vigentes durante años, y la esterilización de los deficientes mentales continuó en Estados Unidos hasta los años 1970; para entonces, unos 60 000 norteamericanos habían sido esterilizados sin consentimiento propio o de los responsables legales. En la Figura 10.1 se puede encontrar un enlace a los archivos del movimiento eugenésico americano.

Las disputas en torno a las bases genéticas de la variación continua se resolvieron por los experimentos de varios genetistas en las primeras décadas del siglo XX. El primero en abordar la utilización de metodología estadística en el estudio de la variación continua fue el botánico danés Johannsen, que tuvo una gran importancia en la Genética (a él se deben los términos gen, genotipo y fenotipo, por ejemplo). En sus trabajos, que se extendieron de 1903 a 1909, intentó estudiar el efecto de la herencia y del ambiente sobre la variación, siguiendo la idea inicial de Galton de «nature versus nurture». Johannsen estudió sobre todo el peso de las alubias de Phaseolus vulgaris en una cepa comercial y detectó la presencia de variación continua, con alubias de distintos pesos que se agrupaban en torno a un valor medio. Autopolinizando durante va-

www.FreeLibros.me


CAPITULO 10

5/12/06

07:18

Página 131

La Figura 10.2 explica los experimentos de Johannsen.

De todas formas, esto no demostraba que los factores genéticos implicados en la herencia de caracteres continuos fuesen de tipo mendeliano. Algunos biometricistas, sobre todo el matemático Pearson, seguían negando la posibilidad de que los factores mendelianos pudiesen explicar la variación continua. Sin embargo, Bateson y Yule elaboraron en 1906 una argumentación matemática para explicar que la presencia de varios factores mendelianos con dominancia incompleta puede originar la variación continua propia de los caracteres cuantitativos. De todas formas, la demostración experimental de esto no llegaría hasta los estudios de Herman Nilsson-Ehle en 1909. Nilsson-Ehle tenía varias líneas puras de trigo, en las que estudió caracteres cuantitativos con variación continua, tales como el color de las espigas. En sus líneas, las espigas tenían colores que iban desde el blanco al rojo oscuro pasando por estadíos intermedios (rojo claro, rojo). Cruzó en primer lugar una planta de espiga blanca con una de color rojo claro y obtuvo F1 en la que todas las espigas eran de color intermedio («rosa»); en la F2 obtuvo tres clases fenotípicas con proporciones 1:2:1, siendo 1/4 de plantas con espigas blancas, 1/2 espigas rosas y 1/4 espigas de color rojo claro. En principio, como ya hemos visto al hablar del mendelismo, estas proporciones pueden explicarse perfectamente mediante un modelo mendeliano de dominancia incompleta del rojo sobre el blanco. Sin embargo, cuando cruzó plantas de espigas blancas con plantas de espigas rojas (más oscuras que el «rojo claro») obtuvo cinco clases de plantas: 1/16 rojas, 4/16 intermedio entre rojo y rojo claro, 6/16 rojo claro, 4/16 rosa y 1/16 blancas. Estas proporciones (1:4:6:4:1) sugieren un modelo de dos pares gé-

www.FreeLibros.me

131

Genética de los caracteres cuantitativos

rias generaciones, consiguió líneas puras para minimizar el efecto genético y estudió la F1. A pesar de tratarse de líneas puras, los pesos de las semillas de cada una de estas líneas siguen una distribución normal, con valores ligeramente distintos. Al plantar semillas de pesos diferentes (pero todas procedentes de una misma línea pura y por tanto genéticamente iguales), encontró que el peso medio de la progenie de las distintas semillas era idéntico (no significativamente distinto) y coincidía con la media de pesos de la línea pura original. Por ejemplo, en su línea pura número 13 las semillas se distribuían en torno a un peso medio de 0,45 g, pero había semillas de pesos mayores y menores a esta media, como es lógico. Al plantar algunas de estas semillas y estudiar el peso de la alubia en la progenie, encontró que una semilla de 0,28 g producía alubias con un peso medio de 0,45 g, una semilla de 0,48 g producía alubias con un peso medio de 0,43 g, y una semilla de 0,58g producía plantas que daban alubias con un peso medio de 0,46 g. Esto demostraba la presencia de factores genéticos (responsables de que el peso medio de las alubias sea igual a la media del peso de las semillas originales, como es de esperar en una línea pura); pero además también demostraba la presencia de otros factores (presumiblemente ambientales) que hacen que las semillas no sean todas idénticas, sino que el peso varíe en torno a un valor medio. Además, cada línea pura tenía un peso medio de alubia característico, con una media que se repetía en la F1 aunque se plantasen semillas con pesos dispares. Fue, por tanto, Johannsen el primero en sugerir experimentalmente que la variación continua podría explicarse por una combinación de factores genéticos y ambientales.


CAPITULO 10

132

5/12/06

07:18

Página 132

Genética de los caracteres cuantitativos

nicos con epistasia doble dominante (15:1) y dominancia incompleta (todos los rojos suman 15). De hecho, el cruce de plantas de espiga blanca con plantas de color rojo oscuro dio lugar a siete clases fenotípicas, con proporciones expresadas en sesentaycuatroavos: 1/64 de plantas con espigas blancas y el resto de las plantas con espigas de seis clases de rojos (rojo claro, rojo y rojo oscuro más las categorías intermedias entre cada una de estas tres). Estas proporciones y el número de clases fenotípicas sugieren un modelo de epistasis triple dominante: tres loci con dominancia incompleta (y efecto aditivo de dosis), y el resultado fenotípico es la distribución del color de la espiga como una variable continua. Esta fue la primera demostración experimental de que un carácter controlado por varios genes puede mostrar variación continua aunque cada uno de los genes se herede de forma mendeliana, si cada uno de ellos tiene un pequeño efecto aditivo sobre el carácter fenotípico. Faltaba por demostrar que la variación debida a efectos ambientales puede ser responsable de las diferencias observadas entre individuos con genotipos idénticos. La demostración formal no llegaría hasta los estudios de Edward East en 1916, nuevamente con plantas. Estudiando la longitud de la corola en dos líneas puras de Nicotiana longiflora, vio que la F1 mostraba un tamaño intermedio a los fenotipos parentales, con arreglo a una distribución normal. En la F2, el valor medio se mantenía pero la varianza se ampliaba notablemente, aunque sin llegar a los valores extremos que se veían en las clases parentales. Esto se explica porque las plantas de la F1 son heterocigotos para todos los genes que intervienen en el tamaño de la flor, de modo que las plantas de la F2 tendrán varias combinaciones distintas de genotipos y de ahí la mayor dispersión de los resultados. De hecho, East observó que la F3 resultante de cruces seleccionados (entre plantas de la F2 que tenían el mismo tamaño de corola) reproducía exactamente el tamaño de las plantas cruzadas, con una dispersión de tamaños debida a factores ambientales. Por ejemplo, cruzó inicialmente dos variedades puras de 40 mm y 93 mm de media, respectivamente. En la F1, el tamaño medio de corola fue de 64 mm (con valores entre 61 y 67 mm). En la F2 resultante de cruzar dos plantas de la F1 se mantuvo el tamaño medio de corola (67 mm) pero aumentó la dispersión (valores entre 52 y 82 mm), indicando la presencia de nuevos genotipos que están originando tamaños distintos. Al cruzar dos plantas de esta F2 que tenían corolas del mismo tamaño (58mm), vio que la descendencia tenía un tamaño medio cercano a 58 mm; al cruzar dos plantas de 70 mm obtuvo una descendencia con tamaño medio cercano 70 mm, etc. Es decir, comprobó que efectivamente hay factores genéticos responsables de los distintos tamaños medios en los distintos cruces, al tiempo que los factores ambientales son los responsables de la dispersión de valores que se observa en las plantas que tienen un mismo genotipo. Con estos experimentos, East pudo demostrar el efecto simultáneo de la variación genética y la variación ambiental, cuyos efectos combinados contribuyen a crear variación continua. Por tanto, un par de décadas después del re-descubrimiento de Mendel se había llegado a la explicación de cómo los principios mendelianos, que afectan a caracteres discretos (variación discontinua) pueden dar lugar a variación continua de caracteres cuantitativos: cuando un carácter fenotípico está controlado por dos o más genes y los efectos de cada gen sobre ese carácter se suman. Esto se conoce como herencia poligénica. En estos casos, es de gran interés determinar el número de loci que intervienen. Lo más habitual es determinar el porcentaje de individuos de la F2

www.FreeLibros.me


CAPITULO 10

5/12/06

07:18

Página 133

Línea pura A 40 mm

94 mm

F1 61

64

67

F2 52

67

82

F3 54

72

79

El vídeo de la Figura 10.3 ilustra los experimentos de H. Nilsson-Ehle y de E. East.

que tienen valores en torno a cualquiera de los dos parentales. Así, para un solo gen esto sería 1/4, para dos loci sería 1/16, para tres loci sería 1/64, etc. Se puede ver que esto es igual a (1/4)n, donde n es el número de loci distintos. Por ejemplo, ya vimos que el experimento de Nilsson-Ehle sugería tres loci (1/64 = [1/4]3), mientras que en el experimento de East ninguna de las 444 flores de la F2 tenía una corola de tamaño similar a la media de los progenitores, por lo que el número de poligenes debe ser al menos superior a 4 ([1/4]4 = 1/256).

10.2 Modelo poligenes-ambiente y enfermedades 10.1 multifactoriales Hemos visto cómo se llegó a explicar la variación continua por la acción de varios genes sobre un mismo carácter (herencia poligénica), y cómo la existencia de variación ambiental añadida hace que las diferencias entre las clases fenotípicas se suavicen y la variación sea más gradual. A la combinación de herencia poligénica con la variación introducida por factores ambientales se le llama herencia multifactorial, para indicar la multiplicidad de factores que intervienen en la expresión del carácter fenotípico. En el campo de la Genética Humana la herencia multifactorial es de gran

www.FreeLibros.me

133

Modelo poligenes-ambiente y enfermedades multifactoriales

− Longitud corola (x):

Línea pura B


CAPITULO 10

134

5/12/06

07:18

Página 134

Genética de los caracteres cuantitativos

importancia, porque la mayoría de los fenotipos y muchas enfermedades, llamadas también enfermedades complejas, siguen este tipo de herencia. De hecho, las enfermedades multifactoriales o complejas son las más importantes desde el punto de vista epidemiológico, por lo que actualmente son objeto de investigación con el fin de identificar los factores genéticos y ambientales implicados. Fruto del trabajo de estos últimos años, se ha detectado un alto número de loci relacionados con el desarrollo de enfermedades como cáncer, diabetes, hipertensión, esquizofrenia, enfermedades neuro-degenerativas, etc. Algunas de las enfermedades multifactoriales se manifiestan en rasgos fenotípicos claramente cuantitativos, como por ejemplo la presión arterial o los niveles de glucosa en sangre. Como hemos visto en el apartado anterior, se puede demostrar que los rasgos cuantitativos que se encuentran en la población mostrando una distribución normal pueden explicarse por la interacción de varios genes (cada uno de los cuales se heredaría de forma mendeliana). Por ejemplo, podemos imaginar un modelo sencillo de dos loci que regulan la presión sanguínea, de forma que cada uno de ellos se hereda de modo mendeliano y provoca un aumento de 20 mm de presión arterial cuando se encuentra en estado homocigoto para el alelo dominante (mayúscula), 10 mm en los heterocigotos o no provoca ningún aumento en los homocigotos para el alelo recesivo (minúscula). Representando estos valores en un gráfico de barras, se puede comprobar que 1/16 de la población tendrá un genotipo AA/BB (aumento de 40 mm de presión arterial), 4/16 de la población tendrá genotipos que provocan un aumento de 30 mm, 6/16 tendrá genotipos con 20 mm, 4/16 con 10 mm y 1/16 serán genotipo aa/bb (0 mm de aumento). Como se ve, estos valores se aproximan a una distribución normal. Lógicamente, la presencia de más loci hace que aparezcan más categorías (más barras) y que la curva de distribución se «suavice» cada vez más. La variación debida a factores ambientales (ingesta de sal, ejercicio físico, etc.) sobreañadidos a los factores genéticos producirá la curva gaussiana típica de muchos de estos rasgos cuantitativos. La Figura 10.4 incluye un vídeo que ilustra la importancia de la herencia poligénica en las enfermedades complejas.

Hay otro tipo de enfermedades que no tienen una herencia mendeliana reconocible, sino que se ajustan al modelo de enfermedades multifactoriales, y sin embargo no se presentan como rasgos cuantitativos típicos, sino que originan fenotipos cualitativos. Por ejemplo, algunas malformaciones frecuentes, como el labio leporino, forman parte de esta categoría. Una explicación bastante aceptada de estos rasgos propone que es la predisposición a manifestar la enfermedad o malformación lo que tiene un origen multifactorial (mezcla de factores genéticos mendelianos y de factores ambientales). Por tanto, aunque esta predisposición sí que se ajusta a una distribución normal en la población, la enfermedad sólo se desarrolla cuando se supera un cierto umbral de predisposición. En estos casos se presupone que los familiares directos de estos enfermos comparten con ellos algunos factores genéticos y/o ambientales, por lo que tendrán mayor predisposición que la población general a sufrir la misma enfermedad. Esto explica que el riesgo de recurrencia de la enfermedad

www.FreeLibros.me


CAPITULO 10

5/12/06

07:18

Página 135

El vídeo de la Figura 10.5 ilustra la herencia poligénica de algunos rasgos cualitativos.

10.3 Heredabilidad en sentido amplio y en sentido restringido. 10.2 Cálculo de la heredabilidad en Genética Humana La determinación de la influencia de factores genéticos en caracteres cuantitativos tiene consecuencias importantísimas en la explotación de especies vegetales o animales (tamaños, pesos, producción de leche, de huevos, de uvas, etc.). La aplicación más importante en Genética Humana es la posibilidad de determinar la importancia relativa de los factores genéticos y de los factores ambientales en las enfermedades multifactoriales, por las implicaciones que esto tiene para la prevención y tratamiento de estas dolencias. Una forma de resolver este problema es estimar la parte de la variación total de una variable que es debida a factores ambientales, para de ahí deducir la variación atribuíble a factores genéticos. En el caso de los caracteres cuantitativos, esto es relativamente sencillo porque pueden estudiarse con métodos estadísticos, analizando los parámetros que definen las variables poblacionales y sus relaciones (media, varianza, covarianza, regresión). De todos éstos, la varianza es el parámetro que mejor define la dispersión de una variable continua en torno a la media y por tanto podemos estimar la variación fenotípica calculando la varianza total de ese rasgo en la población. Esta varianza fenotípica total (VP ) será la suma de la varianza debida a factores genéticos (VG), más la varianza debida a factores ambientales (VE ), más la varianza debida a las interacciones entre genes y ambiente (VGE ). A su vez, la variación genética viene determinada por tres componentes: la varianza debida a efectos aditivos (VA), la varianza debida a efectos de dominancia (VD) y la varianza debida a efectos de interacción génica (VI ). Usando esta metodología podemos estimar la

www.FreeLibros.me

135

Heredabilidad en sentido amplio y en sentido restringido. Cálculo de la heredabilidad…

(probabilidad de que haya otro miembro afectado en una misma familia) sea mayor en los familiares de un enfermo que en la población general. Ejemplos clásicos de este tipo de enfermedades son la estenosis pilórica, que además muestra diferencias en cuanto al sexo (hay más varones que mujeres afectados por la enfermedad, lo que sugiere que el umbral de predisposición es más bajo en varones), o el paladar hendido (fisura del paladar/labio leporino). Para calcular el riesgo de recurrencia en estas enfermedades (la aparición de otro caso en una familia en la que ya hay un enfermo) se utilizan siempre riesgos empíricos, basados en la observación de los datos de prevalencia de la enfermedad en la población, datos que pueden variar considerablemente de una población a otra. Una propiedad a tener en cuenta es que en estos casos el riesgo es variable, al contrario de lo que ocurre en enfermedades con herencia mendeliana simple, en las que el riesgo es fijo. Así, cuando hay varios miembros de una misma familia afectados por una enfermedad multifactorial, el riesgo de que aparezca un nuevo caso en la misma familia es mayor que si hay un solo miembro enfermo; igualmente, cuando el individuo enfermo es del sexo que se afecta con menor frecuencia, el riesgo también aumenta. Esto se explica porque, en estos casos, se supone que en esa familia concreta concurren más factores genéticos y/o ambientales y su curva de predisposición está desplazada a la derecha.


CAPITULO 10

136

5/12/06

07:18

Página 136

Genética de los caracteres cuantitativos

heredabilidad (H 2) de un rasgo fenotípico cuantitativo. En sentido amplio, la heredabilidad indica qué proporción de la variación fenotípica total VP de una variable continua es atribuible a factores genéticos. Siguiendo las definiciones precedentes, esta heredabilidad en sentido amplio se calcula con arreglo a la fórmula: H 2 = VG/VP siendo VP = VG + VE + VGE (aunque VGE suele despreciarse). Para calcular H2 necesitamos usar especies puras (genotipos iguales), que nos permiten calcular la varianza ambiental VE variando las condiciones ambientales de forma que toda la variación sea debida al ambiente. Además de esta dificultad de tipo práctico, este concepto de heredabilidad en sentido amplio es poco útil porque no nos indica exactamente el porcentaje de la variación que es debida a factores genéticos aditivos, que son los más interesantes. Por eso, otra forma más habitual de calcular la heredabilidad (heredabilidad en sentido estricto, h2) se basa en calcular específicamente la parte de la varianza genética que es debida a factores aditivos (VA), respecto a la debida a diferencias en la dominancia (VD) y a efectos de interacción (VI ). Habitualmente, esta última es despreciable y se considera que la varianza genotípica total es VG = VA + VD. En especies que lo permiten, el cálculo se realiza mediante experimentos de selección artificial, para evaluar el posible beneficio derivado de tal selección. Por ejemplo, en una población en la que una variable continua tiene una media M, se toma una submuestra de individuos con una media significativamente diferente (esa diferencia se denomina «diferencial de selección», D), y se determina la media en la progenie de esos individuos seleccionados. La diferencia de la media en la descendencia con la media poblacional inicial se denomina «ganancia» G (o «respuesta» R). La heredabilidad en sentido estricto h2 se calcula como G/D, e incluye únicamente los factores genéticos aditivos. Se puede comprobar que con la selección prolongada, la heredabilidad va disminuyendo progresivamente, al haber cada vez menos factores genéticos aditivos que puedan seguir modificando el fenotipo. En la Figura 10.6 se incluye un vídeo y varias ilustraciones que muestran el concepto de heredabilidad y su cuantificación en Genética Humana.

Lógicamente, este tipo de aproximación experimental no es posible en el caso de la Genética Humana. Sin embargo, la enorme importancia socio-sanitaria de las enfermedades multifactoriales hace que sea de gran utilidad determinar cuánto influye el ambiente y cuánto la herencia en la génesis de esas enfermedades. Para cuantificar la magnitud del componente genético de una enfermedad, concepto análogo a la heredabilidad, se utilizan actualmente dos procedimientos:

Cálculo del riesgo relativo. Si calculamos el riesgo relativo de padecer la enfermedad que tienen distintos grupos de personas relacionadas genéticamente, como por ejemplo los hermanos de individuos enfermos, y vemos que el riesgo de padecer la enfermedad en ese grupo es significativamente mayor que en la población general, podemos deducir que existen factores genéticos que determinan la aparición de esta enfermedad. El riesgo relativo se calcula

www.FreeLibros.me


CAPITULO 10

07:18

Página 137

como λR, en el que el subíndice R indica el grado de parentesco del grupo que estamos estudiando con los individuos enfermos. Por ejemplo lo (la «O» viene del inglés offspring, que significa «descendencia») indicaría la prevalencia de la enfermedad en los hijos e hijas de individuos enfermos; λs (la «S» viene del inglés sibs, que significa «hermanos y hermanas») sería la prevalencia de la enfermedad en los hermanos y hermanas de individuos enfermos, etc. Calculando el cociente de cada uno de estos riesgos entre el riesgo poblacional general podemos calcular el riesgo relativo. Un concepto similar al de riesgo relativo es el de odds ratio (cociente del producto cruzado), que se calcula de otro modo pero nos da prácticamente la misma información. La interpretación de estos cálculos es la misma: si los parientes de los individuos enfermos tienen un riesgo significativamente aumentado de padecer la enfermedad frente al riesgo de la población general, se puede suponer que la enfermedad tiene un componente genético importante. Cálculo de las tasas de concordancia en parejas de gemelos. Si una enfermedad tiene un componente genético significativo, aparecerá con mayor frecuencia en individuos con mayor parecido genético que en individuos genéticamente más distantes. Un modo elegante de estudiar esto en la práctica es comparar los gemelos dicigóticos (cuyo grado de identidad genética es igual al de una pareja cualquiera de hermanos) y los gemelos monocigóticos, ya que éstos son prácticamente idénticos desde el punto de vista genético. Este tipo de estudios, que han dado abundantes frutos en Genética Humana, se basan en el cálculo de las tasas de concordancia, es decir, el porcentaje de parejas de gemelos que concuerdan para un mismo rasgo fenotípico (una enfermedad, en este caso), de manera que simplemente calculamos el porcentaje de parejas de gemelos en las que ambos padecen la misma enfermedad. Estas parejas serían «concordantes» para esa enfermedad, mientras que las parejas en las que un gemelo está enfermo pero el otro está sano serían parejas «discordantes». Pues bien, si una enfermedad tiene un fuerte componente genético, la tasa de concordancia en parejas de gemelos monocigóticos (MC) será claramente más alta que en parejas de gemelos dicigóticos (DC), pues aquellos comparten mayor número de genes que éstos. Además, este tipo de análisis tiene la ventaja de que corrige la influencia de los factores ambientales, ya que en la mayoría de los casos ambos hermanos gemelos —tanto MC como DC— han estado sometidos a las mismas influencias ambientales. En el caso de rasgos cuantitativos (la presión arterial, por ejemplo) la estimación de la concordancia puede realizarse mediante el cálculo del coeficiente de correlación intraclase (correlación de los valores de presión arterial de un hermano con su gemelo respectivo), de forma que un coeficiente de correlación R = 1 equivale al 100 por cien de concordancia. La comparación de concordancias entre gemelos MC y DC se hace del mismo modo que se comparan dos coeficientes de correlación. En el caso de rasgos cualitativos (presencia o ausencia de una enfermedad) simplemente calculamos el porcentaje de parejas de gemelos que concuerdan para esa enfermedad y así obtenemos la tasa de concordancia (porcentaje de parejas concordantes respecto al total de parejas). Con estos datos podemos estimar la heredabilidad (h), me-

www.FreeLibros.me

137

Heredabilidad en sentido amplio y en sentido restringido. Cálculo de la heredabilidad…

5/12/06


CAPITULO 10

138

5/12/06

07:18

Página 138

Genética de los caracteres cuantitativos

diante la fórmula h = 2 (Cmc – Cdc), en la que C es la tasa de concordancia (Cmc en monocigóticos y Cdc en dicigóticos). Los valores de heredabilidad calculados de este modo tienen un rango teórico entre +1.5 (que correspondería a un rasgo monogénico autosómico recesivo, con Cmc = 1 y Cdc = 0,25) y 0 (Cmc = Cdc, en el caso de un rasgo influido sólo por el ambiente). En general, se considera que las enfermedades con una heredabilidad en torno a 1 (o superior) tienen un componente genético importante.

h = 2 x (CMC – CDC) Tasa de concordancia

Enf. bipolar Autismo Sarampión Diabetes tipo I Diabetes tipo II Hipertensión

Gemelos MC

Gemelos DC

Heredabilidad

0,79 0,92 0,95 0,40 0,50 0,70

0,24 0,24 0,87 0,04 0,37 0,40

>1 >1 0,16 0,72 0,26 0,60

www.FreeLibros.me


CAPITULO 11

5/12/06

07:19

Página 139

C APÍTULO 11

Ligamiento genético en humanos

Contenidos 11.1 El concepto de ligamiento genético: fracción de recombinación y distancia genética 11.2 Informatividad de los marcadores utilizados en estudios de ligamiento 11.3 El cálculo del LOD score 11.4 Ligamiento no paramétrico y su utilización en Genética Humana

11.1 El concepto de ligamiento genético: fracción 11.1 de recombinación y distancia genética Aunque algunos autores ya habían sugerido la presencia de determinados genes en cromosomas concretos, no hubo evidencia clara de esto hasta el descubrimiento del ligamiento del locus white de Drosophila al cromosoma X (como se ha explicado en el Capítulo 8), descubrimiento hecho por Morgan en torno a 1910. Poco después, Morgan identificó nuevos mutantes, entre ellos otro llamado rudimentary, que también mostraba ligamiento al cromosoma X. Esto llevó a Morgan a estudiar la segregación simultánea de estos dos genes: si siempre se heredan juntos, esto sugeriría que están cerca en el mismo cromosoma, ya que no ha habido recombinación entre ellos. En efecto, según las leyes de la herencia mendeliana dos loci que están en cromosomas distintos segregarán de manera independiente, es decir, los dos alelos de cada locus se distribuirán en los gametos de modo aleatorio. En cambio, cuando los dos loci están en el mismo cromosoma (se dice entonces que son sinténicos), cabe pensar que siempre se heredará la misma combinación de alelos y un miembro de la descendencia que herede un alelo concreto de uno de los loci también heredará el alelo del otro locus que estaba en el mismo cromosoma parental. Por el contrario, si se produce una recombinación (con sobrecruzamiento) en algún punto in-

www.FreeLibros.me


CAPITULO 11

140

5/12/06

07:19

Página 140

Ligamiento genético en humanos

termedio entre ambos loci durante la meiosis, los gametos llevarán combinaciones alélicas que no estaban presentes en ninguno de los progenitores, es decir, se formen gametos recombinantes. Morgan comprobó que podía darse recombinación entre el locus white y el locus rudimentary en Drosophila, pero al estudiar otras mutaciones (especialmente el color amarillo del cuerpo y el color blanco de los ojos) observó que nunca se detectaba recombinación con otros loci localizados en el mismo cromosoma, y llamó ligamiento a ese fenómeno. Alfred Sturtevant, un estudiante de Morgan, demostró que la probabilidad de que haya una recombinación entre dos loci depende de la distancia física que los separa, y por tanto la frecuencia con que aparecen recombinantes puede utilizarse para deducir la distancia que separa dos genes que están en el mismo cromosoma; Sturtevant construyó en una noche el primer mapa genético de ligamiento, en el que se representaba el orden y la distancia de cinco genes localizados en el cromosoma X de Drosophila. Poco después, Calvin Bridges detectó los primeros casos de ligamiento entre genes localizados en autosomas, y poco a poco se fueron describiendo distintos grupos de ligamiento. El concepto de ligamiento genético, por tanto, va intrínsecamente unido al de distancia física entre genes, que es la que origina distintas proporciones de individuos recombinantes en la descendencia. Cuando ambos loci están suficientemente alejados (aunque estén en el mismo cromosoma) existe una probabilidad tan alta de que haya un sobrecruzamiento entre ellos que segregarán de manera similar a una segregación independiente, produciendo gametos recombinantes en la mitad de la descendencia (50 por ciento de gametos recombinantes y 50 por ciento de gametos no-recombinantes). En este sentido, es importante recordar que el sobrecruzamiento tiene lugar entre dos cromátides, cada una perteneciente a un cromosoma homólogo; las otras dos cromátides no se recombinan, de ahí que un sobrecruzamiento da lugar a cuatro gametos de los cuales dos son recombinantes y los otros dos son idénticos a los cromosomas originales. Sin embargo, a medida que dos loci sinténicos se sitúan más cerca uno del otro, la probabilidad de que haya un sobrecruzamiento entre ellos es cada vez menor, y por tanto la probabilidad de formación de gametos recombinantes también va decreciendo. Puede llegarse a un punto en que los loci estén tan juntos que nunca se dé un sobrecruzamiento entre ellos, de modo que no se originarán gametos recombinantes y no se encontrarán individuos recombinantes en la descendencia. Por tanto, la cuantificación del número de eventos de recombinación entre dos loci nos permite estimar la distancia genética entre ellos: a mayor proximidad, menor probabilidad de recombinación y por tanto el porcentaje de individuos recombinantes será menor. La Figura 11.1 ilustra por qué la probabilidad de recombinación entre dos loci es función de su distancia física.

En Genética Humana, la cuantificación de la frecuencia de recombinación se hace estudiando la segregación de dos secuencias de ADN en los individuos de una familia, e identificando aquellos individuos cuyo genotipo sólo pueda explicarse por una recombinación en la meiosis de uno de los progenitores. Las secuencias que se utilizan en estudios de ligamiento se denominan marcadores genéticos, que son secuencias que se encuentran en distintas formas (distintos alelos) en la población general, ya que para detectar si ha habido recombinación debemos ser capaces de dis-

www.FreeLibros.me


CAPITULO 11

5/12/06

07:19

Página 141

1-2

2-4

1-4

1-4

1-2

2-2

2-4

1-4

θ = 1/6 = 0,17 = 17% DISTANCIA GENÉTICA = 17 cM La Figura 11.2 muestra el modo de calcular la fracción de recombinación entre el locus responsable de una enfermedad autonómica dominante y un marcador genético.

www.FreeLibros.me

141

El concepto de ligamiento genético: fracción de recombinación y distancia genética

tinguir los distintos alelos. Además, los estudios de ligamiento entre marcadores sirven para establecer mapas de ligamiento en los que estos marcadores están en un orden determinado, separados por distancias precisas. Por tanto, los marcadores utilizados en estudios de ligamiento son polimorfismos genéticos, es decir, secuencias que se encuentran en la población en varias formas posibles. Diferentes individuos de la población pueden tener, por tanto, distintos genotipos (distintas combinaciones de alelos) para un marcador concreto. Los principales tipos de polimorfismos genéticos que se utilizan como marcadores en estudios de ligamiento han sido explicados con detalle al hablar del genoma humano en el Capítulo 4. Para realizar mapas de ligamiento entre marcadores, es necesario ante todo genotipar cada uno de los marcadores en todos los miembros de una o varias familias. Al analizar los genotipos de cada individuo y la segregación de los diferentes alelos, se pueden identificar los individuos recombinantes, aquellos cuyo genotipo sólo puede explicarse por una recombinación en uno de sus progenitores. La cantidad de individuos recombinantes en la descendencia nos permite calcular la fracción de recombinación (representada por la letra griega θ), que se define como el número de individuos recombinantes dividido por el número total de individuos en la descendencia. Además de estudiar la distancia entre marcadores, en los estudios de ligamiento que se realizan en Genética Humana es frecuente buscar cuál es la distancia entre un marcador y el locus responsable de una enfermedad genética. En estos casos, el análisis de ligamiento nos permitirá calcular la distancia entre el marcador y el gen responsable de una enfermedad. Utilizando esta metodología se han identificado los genes responsables de muchas enfermedades genéticas, mediante una estrategia denominada clonaje posicional: al conocer la distancia que separa el locus responsable de una enfermedad de varios marcadores genéticos concretos, se simplifica enormemente la tarea de identificar el gen causal.


CAPITULO 11

142

5/12/06

07:19

Página 142

Ligamiento genético en humanos

La fracción de recombinación, calculada tal y como se ha explicado en la figura anterior, nos permite estimar la distancia genética entre dos loci, distancia que se mide en centimorgans (cM): cuando entre dos loci se detecta una fracción de recombinación θ = 0,01 (uno por ciento de individuos recombinantes), se dice que ambos loci están a una distancia genética de 1 cM. Esta distancia genética (1 cM) equivale aproximadamente a 1 Mb (megabase) de distancia física, aunque esta equivalencia varía a lo largo del genoma y hay funciones matemáticas más exactas para convertir la distancia genética en distancia física. En cualquier caso, es importante comprender que la fracción de recombinación nunca podrá ser mayor a 0,5 (50 por ciento), ya que éste es precisamente el porcentaje de individuos recombinantes que se producen en ausencia de ligamiento (cuando siempre hay una recombinación, como se ha explicado más arriba) o en el caso de que ambos loci estén situados en cromosomas distintos.

11.2 Informatividad de los marcadores utilizados en estudios 11.2 de ligamiento Como acabamos de explicar, para poder realizar estudios de ligamiento es necesario identificar los individuos recombinantes para determinar la fracción de recombinación. Por desgracia, en ocasiones es imposible establecer si un individuo de la descendencia es recombinante o no, bien porque el individuo que transmite la enfermedad es homocigoto para el marcador analizado, o bien porque es heterocigoto idéntico al otro progenitor; estas situaciones dan lugar a lo que denominamos familias no-informativas o semi-informativas, respectivamente. La Figura 11.3 muestra algunos ejemplos de falta de informatividad de un marcador.

Lo posibilidad de perder informatividad subraya la importancia de usar marcadores para los que todos los árboles analizados sean informativos, lo cual dependerá directamente de la informatividad de los marcadores utilizados. La informatividad de un marcador refleja la probabilidad de encontrar individuos heterocigotos para ese marcador en la población general, y es función del número de alelos posibles para el marcador y de las frecuencias relativas de cada alelo en la población. Teniendo en cuenta las características de cada tipo de marcador, es posible calcular dos parámetros que definen la informatividad de un marcador genético: el índice de heterocigosidad y el PIC (contenido de información de un polimorfismo, Polymorphism Information Content en inglés). Estos parámetros se calculan mediante la siguiente fórmula: n

n–1

PIC = 1 – Σ pi2 – Σ i=1

n

Σ 2 pi2 pj2

i = 1 j =i + 1

heterocigosidad % heterocigotos idénticos

El primer miembro (1 - Σ pi 2) es la heterocigosidad, es decir, el porcentaje de individuos de la población general que son heterocigotos para ese marcador.

www.FreeLibros.me


CAPITULO 11

5/12/06

Página 143

Ya hemos visto que si el individuo que transmite la enfermedad es homocigoto para un marcador, esa familia no será informativa para ese marcador, de ahí que la heterocigosidad sea una medida de la informatividad de un marcador genético. Como pi2 es la frecuencia de homocigotos para cada alelo del marcador, el sumatorio de todos los posibles homocigotos se le resta a 1 y se obtiene así el porcentaje de heterocigotos. Como criterio general, se puede decir que la heterocigosidad de un marcador aumenta: (a) con el número de alelos que ese marcador presenta en la población general; y (b) cuanto más parecidas son las frecuencias de los distintos alelos de ese marcador. El segundo miembro de la ecuación le resta a la heterocigosidad la probabilidad de que una familia no sea informativa debido a que ambos padres son heterocigotos idénticos (en cuyo caso, como hemos visto antes, la mitad de la descendencia será informativa (homocigotos) y la mitad será no-informativa (los heterocigotos). Como es sabido, para dos alelos i y j con frecuencias alélicas pi y pj la frecuencia de heterocigotos es 2pi pj. Por tanto, la probabilidad de que dos individuos sean heterocigotos idénticos es 2pi pj × 2pi pj = 4 (pi2pi2), pero como sólo se pierde informatividad en la mitad de la descendencia, en la ecuación se resta sólo 2 (pi2pi2).

Algunos ejemplos del cálculo del PIC ilustrarán la informatividad de los distintos tipos de marcadores genéticos. Por ejemplo, un marcador bialélico (el caso típico sería un RFLP) con frecuencias alélicas iguales ( p1 = p2 = 0,5) tendría: Heterocigosidad = [1 – (p12 + p22)] = [1 – (0,52 + 0,52)] = 1– 0,5 = 0,5 PIC = 1 – (p12 + p22) – 2 (p12 × p22) = 1 – (0,52 + 0,52) – 2 (0,52 × 0,52) = 0,375 En cambio, un marcador con cuatro alelos (alelos 1, 2, 3 y 4) en el que cada alelo tiene una frecuencia p = 0,25, presentará en principio seis posibles combinaciones de heterocigotos, con genotipos (1-2), (1-3), (1-4), (2-3), (2-4) y (3-4). Por tanto, para calcular todos los posibles casos de heterocigotos idénticos en la población, habrá que sumar [2 (p12 p22)] + [2 (p12 p32)] + [2 (p12 p42)] + [2 (p22 p32)] + … hasta completar las seis posibles combinaciones de heterocigotos. Aplicando la fórmula general: Heterocigosidad = [1 – (0,252 + 0,252 + 0,252 + 0,252 )] = 0,75 PIC = 1 – (0,252 + 0,252 + 0,252 + 0,252 ) – 6 [2 (0,252 × 0,252 )] = 0,703 Como se ve, el hecho de que un marcador tenga cuatro posibles alelos en vez de dos aumenta su informatividad casi al doble. De hecho, un marcador con 10 alelos arrojaría, aplicando la fórmula anterior, un PIC de 0,891 si las frecuencias alélicas son iguales. Por tanto, de los distintos marcadores que se han mencionado más arriba, los más informativos son los de tipo microsatélite, seguidos por SNP y RFLP. De todas formas, como ya se ha comentado, la posibilidad de estudiar a la vez miles de SNPs de forma automatizada (algo que no es posible con los microsatélites), junto con su alta densidad a lo largo del genoma, hace que los SNP sean hoy en día los marcadores de mayor utilidad en la construcción de mapas de ligamiento genético de todo el genoma. Sea cual sea el tipo de marcador utilizado, los estudios de ligamiento requieren genotipar a todos los miembros de una familia para detectar la presencia de individuos

www.FreeLibros.me

143

Informatividad de los marcadores utilizados en estudios de ligamiento

07:19


CAPITULO 11

144

5/12/06

07:19

Página 144

Ligamiento genético en humanos

recombinantes y así poder calcular la fracción de recombinación. En el ejemplo de la familia con una enfermedad autosómica dominante presentado en la Figura 11.2, hemos podido establecer que el individuo transmisor de la enfermedad transmitía a la vez el alelo 2 del marcador, ya que ambos se localizan a poca distancia en el mismo cromosoma. Sabemos esto porque este individuo, a su vez, heredó la enfermedad de su padre, que también le transmitió el alelo 2 del marcador. Cuando en un individuo que transmite una enfermedad podemos determinar inequívocamente el origen parental tanto del alelo que causa la enfermedad como de los alelos del marcador —es decir, podemos determinar qué alelos de cada uno de los dos loci van en el mismo cromosoma— se dice que conocemos la fase de ligamiento de ese individuo. Precisamente es el hecho de conocer la fase de ligamiento en el individuo transmisor lo que hace que todas las meiosis de este individuo sean informativas, y nos permite determinar con certeza si los individuos de la descendencia son recombinantes o no. Se recordará que en el caso concreto de esta familia había un individuo recombinante de un total de seis, lo que sugiere que ambos loci (el marcador y el gen de la enfermedad) están en ligamiento a una distancia que produce un recombinante de cada seis individuos (fracción de recombinación θ = 1/6 = 0,17, es decir a una distancia genética de 17 cM). El principal problema es que este resultado podría haberse dado por azar: teóricamente es posible que no haya ligamiento y que una descendencia más numerosa nos mostrase una fracción de recombinación más cercana al 50 por ciento de individuos recombinantes. Frente a esta «hipótesis nula» (no ligamiento) tenemos una hipótesis alternativa de que existe ligamiento entre ambos loci, a una distancia tal que origina una θ = 0,17. ¿Cómo podemos determinar cuál de las dos hipótesis es la verdadera o, al menos, la que mejor explica los datos obtenidos en esta familia?

11.3 El cálculo del LOD score Para cuantificar la significación de cada una de estas hipótesis, los estudios de ligamiento utilizan un método llamado «Estimación de la Máxima Verosimilitud» («verosimilitud» es la traducción del término inglés likelihood). Este método consiste en estimar la verosimilitud de cada hipótesis, calculando la probabilidad de encontrarnos con esa fracción de recombinación cuando se verifica esa hipótesis. Por ejemplo, para estimar la verosimilitud de la hipótesis de ligamiento, calculamos la probabilidad de obtener un recombinante de cada seis individuos en el caso de que exista ligamiento a una distancia de 17 cM; para estimar la verosimilitud de la hipótesis nula, calculamos la probabilidad de obtener un recombinante de cada seis individuos en el caso de que no exista ligamiento, y así sucesivamente. El razonamiento matemático para estimar estas probabilidades se puede ilustrar con un ejemplo del lanzamiento de monedas. La Figura 11.4 ilustra el modo de estimar la verosimilitud de una hipótesis.

Aplicando esta forma de proceder al árbol que hemos venido estudiando, recordamos que hay cinco individuos no-recombinantes y un recombinante, luego formulamos la hipótesis H1 de que la distancia entre el locus de la enfermedad y el locus

www.FreeLibros.me


CAPITULO 11

5/12/06

07:19

Página 145

L (H1) = θR × (1 – θ)NR Por el contrario, la verosimilitud de la hipótesis nula para explicar nuestros datos sería: L (H0) = θ(R + NR) Para calcular cuántas veces más verosímil es nuestra hipótesis que la hipótesis nula, hallamos el cociente de verosimilitudes (likelihood ratio). En Genética Humana, para que este cociente sea significativo al 95 % se requiere que sea mayor o igual a 1 000. Es fácil darse cuenta de que uno de los principales problemas que nos encontramos es el tamaño pequeño de las generaciones, al contrario de los estudios de ligamiento que se hacen en otras especies. Una forma de solventar este problema es repetir el análisis en varias familias distintas, y combinar los resultados obtenidos en cada una de ellas con el fin de aumentar la potencia estadística de los estudios de ligamiento. Para poder combinar resultados de familias distintas, Newton Morton ideó el concepto del Lod score (que podría traducirse como «puntuación lod» y se representa por la letra Z), que es el log del cociente de verosimilitudes. Por tanto, un co10 ciente de verosimilitudes = 1 000 equivale a un lod score igual a 3 (Z = 3), y éste es precisamente el valor mínimo de Z que se requiere para poder afirmar que existe ligamiento significativo entre dos loci. Para hallar el lod score máximo de todos los posibles, es habitual utilizar programas informáticos que calculan directamente el lod score que se obtiene para varias hipótesis de ligamiento y a distintos valores de θ. Además, como los resultados de una sola familia raras veces serán significativos, necesitamos combinar los resultados obtenidos a partir de los datos de varias familias. Para ello, se suman los lod scores (Z) obtenidos para cada θ en las distintas familias que estamos analizando, hasta identificar la fracción de recombinación θ a la que obtenemos el lod score máximo en el conjunto de las familias analizadas. Éste es el valor que finalmente nos permitirá afirmar si existe o no ligamiento significativo entre el gen de la enfermedad y este marcador. Además, como la Z máxima se obtiene a una fracción de recombinación concreta, podemos también estimar la distancia genética más probable entre ambos loci, expresada —como siempre— en centimorgans. Por ejemplo, si la Z máxima se obtuvo a una θ = 0,16, la distancia genética entre ambos loci estará en torno de 16 cM, con un intervalo de confianza cuyo cálculo es también sencillo. La Figura 11.5 incluye un vídeo y varios gráficos que explican el modo de calcular el LOD store.

Un problema muy importante en los estudios de ligamiento es que muchas veces no podemos deducir la fase de ligamiento en el progenitor que transmite la enfer-

www.FreeLibros.me

145

El cálculo del LOD score

del marcador es tal que producen una frecuencia de recombinación θ = 1/6. Por tanto, bajo esta hipótesis, la probabilidad de encontrar un individuo recombinante es P(R) = 1/6, y la probabilidad de encontrar un no-recombinante es P (NR) = 5/6. La verosimilitud de que esta hipótesis (H1, θ = 1/6) explique nuestros datos experimentales (5 no-recombinantes y 1 recombinante) se calcula aplicando la fórmula general:


CAPITULO 11

146

5/12/06

07:19

Página 146

Ligamiento genético en humanos

medad, al no poder establecer con exactitud si un alelo concreto del marcador está en el mismo cromosoma que lleva el alelo mutado o si está en el cromosoma homólogo. Lógicamente, esto impide establecer si un individuo de la descendencia es recombinante o no, y por tanto complica mucho el cálculo de la fracción de recombinación. De hecho, hay dos posibles fases de ligamiento que tienen la misma probabilidad, y esto ha de tenerse en cuenta a la hora de estimar la verosimilitud de cada hipótesis. Así, se calcula el cociente de verosimilitudes para cada una de las fases de ligamiento alternativas y se halla el lod score promedio de ambas: Z (θ) = log10[1/2[θR(1 – θ)NR/0,5(R + NR)] + 1/2[θNR(1 – θ)R/0,5(R + NR)]] Lógicamente, el desconocimiento de la fase de ligamiento en el individuo que transmite la enfermedad hace que el valor final del lod score sea más bajo, por lo que –si los loci estudiados están realmente en ligamiento— será necesario estudiar un mayor número de familias para poder alcanzar el valor umbral de Z = 3. Es muy útil representar los valores que adopta el lod score Z en función de los distintos valores de la fracción de recombinación θ. Cuando se hace esto, podemos observar varios tipos posibles de curva:

• •

• •

Si no se ha encontrado ningún individuo recombinante en ninguna de las familias estudiadas, esto quiere decir que los dos loci que estamos estudiando (el locus de la enfermedad y el del marcador) están en ligamiento y tan cercanos entre sí que no se producen sobrecruzamientos entre ellos. El lod score es máximo a θ = 0, para ir bajando hasta Z = 0 para una θ = 0,5. Cuando existe ligamiento, lo más habitual es hallar una curva de forma parabólica, con un pico máximo de lod score a una determinada fracción de recombinación. En estos casos el lod score a la fracción de recombinación θ = 0 debe ser (– ∞), ya que hemos encontrado individuos recombinantes en alguna de las familias y esto hace imposible la hipótesis de que la fracción de recombinación sea cero. El intervalo de confianza de la fracción de recombinación máxima se calcula trazando una horizontal una unidad de lod score por debajo de la Z máxima, y viendo dónde corta ambas ramas de la curva. Como siempre, el lod score Z se hace 0 para una fracción de recombinación θ = 0,5, pues en este caso el cociente de verosimilitudes L(H1)/L(H0) = 1, y el log10 de 1 es igual a 0. En ocasiones, la curva alcanza valores de Z inferiores a –2. En estas circunstancias podemos afirmar que NO existe ligamiento por debajo de una determinada fracción de recombinación θ y por tanto ambos loci necesariamente están a una distancia genética superior a la indicada por esa fracción de recombinación (si es que efectivamente están en ligamiento). Finalmente, hay ocasiones en que no encontramos ligamiento significativo, pero tampoco podemos excluirlo para ninguna de las θ estudiadas, puesto que no hay ningún valor de lod score que sea superior a +3 o inferior a –2. En estos casos no podemos extraer ninguna información útil de los datos obtenidos de estas familias.

www.FreeLibros.me


CAPITULO 11

5/12/06

07:19

Página 147

Como acabamos de ver, uno de los requisitos para poder hacer estudios de ligamiento mediante el cálculo de lod score es conocer el tipo de herencia de la enfermedad que estamos estudiando, ya que sin esta información es imposible detectar la presencia de individuos recombinantes. De hecho, los programas informáticos que realizan los cálculos para el análisis de ligamiento exigen que se introduzcan varios parámetros indicando el tipo de herencia (autosómica dominante, recesiva, etc.). Por desgracia, la mayoría de las enfermedades complejas (aquellas que están determinadas por varios genes y por factores ambientales) no siguen un patrón hereditario mendeliano típico, por lo que los estudios de ligamiento clásicos que se han estudiado hasta ahora no se pueden aplicar. En estos casos hay que acudir a métodos de ligamiento que no requieren ajuste de la muestra a un modelo concreto de herencia, llamados por tanto métodos no-paramétricos o independientes de modelo. Hay básicamente dos tipos de pruebas, las que detectan ligamiento y las que detectan asociación alélica. Es muy importante darse cuenta de la diferencia entre ambos conceptos: el ligamiento es un fenómeno que afecta a loci —se dice, por ejemplo, que dos loci están en ligamiento a una distancia determinada— pero el alelo del marcador que «viaja» con el alelo de la enfermedad puede ser diferente en familias distintas. Por ejemplo, en una familia concreta podemos detectar ligamiento porque la enfermedad siempre segrega junto con el alelo A1 de un marcador, pero en otra familia distinta (con la misma enfermedad) el alelo mutado puede viajar con el alelo A5 de ese mismo marcador. Ambos loci (el marcador y el gen de la enfermedad) están en ligamiento pero en cambio no siempre se dan las mismas asociaciones de alelos en todas las familias. Esto es así porque existe una situación de equilibrio de Hardy-Weinberg entre ambos loci, de manera que cada alelo de uno de los locus puede encontrarse con cualquiera de los alelos del otro locus. Los métodos de análisis de ligamiento no paramétricos que detectan asociación alélica buscarán precisamente desviaciones de esta situación de equilibrio, detectando la presencia de un haplotipo (una determinada combinación de alelos para dos loci distintos, en nuestro caso serían el alelo mutado y un alelo concreto del marcador) que se encuentre con mayor frecuencia de la que cabría esperar si esos loci estuviesen en equilibrio. Si demostramos que, incluso en familias distintas, la enfermedad se asocia significativamente con un alelo concreto del marcador, podemos decir que existe asociación alélica; como la principal causa de asociación alélica es el desequilibrio de ligamiento por cercanía física de ambos loci (están tan cercanos uno al otro que no se ha alcanzado todavía el equilibrio de Hardy-Weinberg entre ellos), la asociación alélica se traduce en cercanía física. Por tanto, podemos servirnos de la asociación alélica para localizar genes responsables de enfermedades complejas. A continuación se explica brevemente cómo funciona cada uno de estos métodos: 1.

Los métodos que detectan ligamiento buscan alelos compartidos por todos los individuos que están enfermos en una misma familia. Para comprender cómo se hace esto, es importante aprender a distinguir los alelos que son

www.FreeLibros.me

147

Ligamiento no paramétrico y su utilización en Genética Humana

11.4 Ligamiento no paramétrico y su utilización 11.4 en Genética Humana


CAPITULO 11

5/12/06

07:19

Página 148

idénticos por descendencia (situación que se denomina IBD: identical by descent) de los alelos que son idénticos por estado (IBS: identical by state).

148

Ligamiento genético en humanos

1-2

3-4

1-2

3-4

1-2

3-4

1-3

1-3 2 IBD 1-4 1 IBD 2-3 2-4 0 IBD

1-3 1-

1-3 2 IBD 1-4 1 IBD

1-3 -

1-3

}

2 IBD

En la Figura 11.6 se intenta mostrar el concepto de alelos IBD y alelos IBS.

1.

1.

Los estudios de alelos idénticos por descendencia entre individuos enfermos de una misma familia se basan en el hecho de que los hermanos que padecen una misma enfermedad tienen mayor probabilidad de compartir el segmento genómico que contiene el gen causante de esa enfermedad. En ese segmento también habrá, en la vecindad del gen, algunos marcadores (polimorfismos), y por tanto esas parejas de hermanos también serán idénticos por descendencia para los alelos de esos marcadores. En general, se puede demostrar que dos hermanos tienen una probabilidad del 25 por ciento de tener dos alelos cualesquiera idénticos por descendencia (probabilidad de 1/4), una probabilidad del 50 por ciento de compartir un alelo IBD (dos de cuatro posibilidades) y una probabilidad del 25 por ciento de no compartir ningún alelo IBD. En cambio, si ambos hermanos han heredado la enfermedad, compartirán el segmento genómico que contiene el gen causal, incluidos los marcadores cercanos, por lo que encontraremos alelos IBD de esos marcadores en una frecuencia superior a la esperable por el azar. Por ejemplo, en una enfermedad autosómica dominante el 50 por ciento de los hermanos enfermos compartirán en promedio dos alelos IBD, y el 50 por ciento restante compartirán un alelo IBD; en el caso extremo de una enfermedad autosómica recesiva, todos los hermanos afectados compartirán como promedio dos alelos IBD. Por tanto, para realizar estas pruebas es preciso analizar miles de marcadores dispersos por todo el genoma en un número bastante grande de parejas de hermanos enfermos, y así detectaremos una frecuencia de alelos IBD significativamente superior a lo que sería esperable por el azar para aquellos marcadores cercanos al gen de la enfermedad. Por esta razón, este método se denomina frecuentemente ASP (affected sib-pair, parejas de hermanos afectados), porque busca regiones que sean idénticas por descendencia en parejas de hermanos afectados por la misma enfermedad. Como a veces no es fácil contar con el número suficiente de parejas de hermanos enfermos, otra

www.FreeLibros.me


CAPITULO 11

5/12/06

Página 149

variante de este método estudia miembros más distantes de una misma familia, conocido como APM (affected pedigree member, miembro afectado del árbol familiar). Como se ha mencionado, para poder detectar ligamiento utilizando estos métodos es necesario genotipar un número elevado de marcadores distribuidos por todo el genoma y detectar aquellos cuyos alelos son compartidos por parientes enfermos en proporciones significativamente mayores a lo esperable por azar. Estos análisis se realizan utilizando programas informáticos, tales como SIBPAL o GENEHUNTER. Además, Haseman y Elston desarrollaron un algoritmo para aplicar esto mismo a variables cuantitativas (cualquier variable cuantificable numéricamente), haciendo una gráfica que representa la diferencia entre hermanos para esa variable elevada al cuadrado (en ordenadas), frente al porcentaje de alelos IBD compartidos por hermanos (en abscisas). Si la pendiente de la recta de ajuste es significativamente negativa, esto indica que hay ligamiento, ya que en ausencia de ligamiento los valores deben distribuirse alrededor de una línea vertical centrada en torno al 50 por ciento de alelos IBD. Detección de asociación alélica. Cuando no se dispone de parejas de hermanos para estudios que buscan alelos idénticos por descendencia, se pueden hacer estudios de asociación alélica para detectar un marcador muy cercano al gen que causa una enfermedad. Aunque los estudios de asociación alélica pueden emplearse también en cualquier situación, resultan especialmente útiles en poblaciones aisladas sometidas a cierto efecto fundador, en las que todavía no han pasado el número suficiente de generaciones para que todos los alelos presentes en la población hayan llegado a una equilibrio de HardyWeinberg. Por ejemplo, la identificación del gen que está mutado en una enfermedad llamada Hemocromatosis Hereditaria se identificó gracias a que la mutación específica se originó en una región geográfica concreta, y hoy en día se encuentra especialmente en poblaciones de origen celta. El tipo de familia que se necesita para los estudios de asociación es muy sencillo: ambos padres y un solo descendiente enfermo. El cálculo puede hacerse mediante dos pruebas: TDT (Transmission-Disequilibrium Test, prueba de transmisión del desequilibrio) o HRR (Haplotype Relative Risk, riesgo relativo de un haplotipo), aunque el más popular y más usado es el método del TDT. Para realizar este test, se analiza un mismo marcador en varias familias distintas, escogiendo un marcador para el que los progenitores sean heterocigotos; a continuación se compara la frecuencia con la que se transmite cada alelo de los padres al hijo afectado. Al hacer esto en varias familias, podemos detectar si hay algún alelo concreto del marcador que se transmita preferencialmente a los hijos afectados sobre lo que sería esperable por el azar. Por ejemplo, si a es el número de veces que un progenitor transmite el alelo A1 de un marcador, y b es el número de veces que transmite un alelo distinto a A1, se puede demostrar que el estadístico (a – b)2/(a + b) sigue una distribución chi-cuadrado con un grado de libertad. Si la frecuencia de transmisión de este alelo a hijos enfermos es significativamente más alta de lo esperable por azar, podemos concluir que existe asociación alélica y que, por tanto, el gen de la enfermedad está muy cercano a este marcador. Lógicamente, como

www.FreeLibros.me

149

Ligamiento no paramétrico y su utilización en Genética Humana

2.

07:19


CAPITULO 11

150

5/12/06

07:19

Página 150

Ligamiento genético en humanos

a priori no sabemos dónde está localizado el gen, hay que hacer el análisis utilizando miles de marcadores distribuidos por todo el genoma, hasta dar con uno que muestre asociación con la enfermedad. La Figura 11.7 ilustra el Test de Transmisión de Desequilibrio (TDT) como medida de asociación alélica.

Como resumen, a la hora de escoger un método para la detección de genes responsables de enfermedades complejas hemos de tener en cuenta el tipo de familias de que disponemos, así como factores de tipo material y económico (derivados del altísimo número de genotipajes que es necesario realizar). Aunque los tests de ASP requieren menos genotipajes, la región genómica compartida que detectan es bastante grande, por lo que la identificación posterior del gen que causa la enfermedad sería más laboriosa. Por eso, lo ideal es complementar un estudio de ASP con estudios de asociación alélica, que requieren el genotipaje de muchos más individuos, pero revelan regiones genómicas habitualmente menores a 1 megabase. Aunque los estudios que utilizan ligamiento no-paramétrico o asociación alélica suelen dar resultados cuya significación es difícil de cuantificar, y a menudo los resultados obtenidos en estudios distintos no concuerdan entre sí, son los únicos métodos válidos para localizar genes implicados en el desarrollo de enfermedades complejas (poligénicas y multifactoriales). Precisamente son estas enfermedades las que tienen mayor repercusión socio-sanitaria, por afectar a gran parte de la población. Las nuevas tecnologías de genotipaje que utilizan marcadores tipo SNP (Single Nucleotide Polymorphisms, ya vistos anteriormente) han acelerado enormemente la identificación de genes que confieren susceptibilidad a enfermedades comunes. Por ejemplo, en los últimos años se ha demostrado asociación entre el gen CAPN10 y la susceptibilidad a desarrollar diabetes tipo 2, así como también entre un polimorfismo en el gen de la interleuquina 12 y la diabetes tipo 1. Es previsible que en los próximos años se identifiquen las principales variantes que confieren susceptibilidad a las enfermedades más frecuentes. Por ejemplo, podemos pensar que en un futuro no muy lejano un paciente hipertenso que acuda a la consulta genética será estudiado para detectar variantes de susceptibilidad en varios genes, y gracias a los resultados se le clasificará dentro de un grupo molecular determinado que permitirá asignarle un tratamiento dietético o farmacológico específico. Desde este punto de vista, el genotipaje de polimorfismos concretos puede convertirse en un análisis de rutina en el diagnóstico de un número creciente de enfermedades humanas en el próximo decenio. En este sentido, es importante detectar los SNP que pueden ser más informativos en estos estudios: se estima que en toda la población mundial se encuentran unos 10 millones de SNPs en los que ambas variantes alélicas tienen una frecuencia mayor o igual a uno por ciento. A pesar del indudable interés que tienen estos polimorfismos para realizar estudios de asociación alélica, genotipar todos estos SNPs en un número grande de individuos es, hoy por hoy, impracticable. Podemos salvar este obstáculo gracias a que muchos SNP, por estar muy cerca físicamente, se heredan juntos en pequeños bloques en los que todavía no se ha alcanzado el equilibrio de Hardy-Weinberg. Es decir, se pueden identificar bloques de desequilibrio de ligamiento en el genoma, puesto que los alelos de los SNP que están en un mismo blo-

www.FreeLibros.me


CAPITULO 11

5/12/06

07:19

Página 151

www.FreeLibros.me

151

Ligamiento no paramétrico y su utilización en Genética Humana

que están en desequilibrio de ligamiento. La combinación concreta de alelos de los distintos SNP que están en un mismo bloque constituye un haplotipo característico de ese bloque. Por tanto, un grupo reducido de SNPs de cada haplotipo pueden ser representativos de todo ese haplotipo (por lo que reciben el nombre de tag-SNPs, o SNP-etiqueta); de este modo, no es necesario genotipar todos los SNPs del genoma, sino sólo los SNP-etiqueta. De hecho, se estima que bastaría con analizar unos 200 000 para cubrir todos los haplotipos del genoma humano, y esa es una cifra que se puede estudiar con la metodología actual. Recientemente se ha publicado un mapa de 1,6 millones de SNPs que han sido genotipados en 71 individuos estadounidenses de ascendencia europea, asiática y africana. Este mapa fue completado por el Proyecto Internacional Hapmap, que publicó en 2005 un mapa con todos los haplotipos de SNPs presentes en diversas poblaciones humanas, como se ha explicado en el Capítulo 4. Este mapa permite identificar la estructura y el tamaño de los bloques de desequilibrio de ligamiento del genoma, y hará posible la realización de estudios de asociación para identificar las regiones donde residen los genes que confieren susceptibilidad a enfermedades comunes.


CAPITULO 11

5/12/06

07:19

Pรกgina 151

www.FreeLibros.me


CAPITULO 12

5/12/06

07:22

Página 153

CAPÍTULO 12

Los genes en las poblaciones

Contenidos 12.1 12.2 12.3 12.4 12.5 12.6 12.7 12.8

El equilibrio de Hardy-Weinberg Cambios en las condiciones que mantienen el equilibrio: cruzamientos no aleatorios Cambios en las condiciones que mantienen el equilibrio: efectos del tamaño poblacional Cambios en las condiciones que mantienen el equilibrio: migración o flujo genético Cambios en las condiciones que mantienen el equilibrio: recombinación y mutación Cambios en las condiciones que mantienen el equilibrio: selección Aplicaciones en Genética Humana Formación de la Teoría Sintética de la Evolución

12.9 Explicación actual del proceso evolutivo y sus limitaciones

La evolución biológica es el resultado de los cambios en los tipos y frecuencias de los alelos existentes en una población de individuos, siempre y cuando dichos cambios son transmitidos a la generación siguiente. En otras palabras, la evolución es el cambio en la constitución genética de una población a lo largo del tiempo. Es importante comprender que: i) el hecho de que los cambios sean heredables quiere decir que la base molecular de la evolución está en los genes; ii) la evolución no afecta a individuos, sino a poblaciones.

12.1 El equilibrio de Hardy-Weinberg La elaboración del concepto actual de evolución se remonta a los orígenes de la genética de poblaciones, que describe la estructura genética de una población de individuos y predice sus cambios en el tiempo. G. H. Hardy y W. Weinberg demostraron en 1908 que en una población sometida a unas condiciones determinadas se observa que: i) las frecuencias de los alelos se mantienen estables durante sucesivas generaciones, y ii) las frecuencias genotípicas también se mantienen constantes, debido a que dependen exclusi-

www.FreeLibros.me


CAPITULO 12

154

5/12/06

07:22

Página 154

Los genes en las poblaciones

vamente de las frecuencias alélicas. Estos postulados se conocen como la Ley del equilibrio de Hardy-Weinberg. Cuando no se dan las condiciones necesarias para que se cumplan estos presupuestos, aparecen alelos nuevos en la población o bien las frecuencias alélicas cambian. Esto, a su vez, crea las condiciones básicas necesarias para que pueda darse evolución. Las condiciones que deben cumplirse para que una población se encuentre en equilibrio genético, es decir, para que se cumpla la Ley de Hardy-Weinberg, son:

• • • • •

Población de tamaño grande en la que todos los individuos se reproducen. Los cruzamientos entre individuos de la población se producen al azar. Ausencia de mutación. Ausencia de selección natural. Ausencia de flujos migratorios.

Lógicamente, en la práctica es muy improbable encontrar una población en la que se cumplan todas estas condiciones, por lo que la evolución es un hecho tan frecuente en la naturaleza. La gran aportación metodológica de Hardy y Weinberg es que permite abordar el estudio de los cambios en la estructura genética de una población en términos matemáticos precisos. En primer lugar, dedujeron una ecuación que permite predecir las frecuencias genotípicas a partir de las frecuencias alélicas, y por tanto saber si una población se encuentra en equilibrio. Según la ecuación del equilibrio de Hardy-Weinberg, p2 + 2pq + q2 = 1 siendo p y q las frecuencias de los dos alelos A y a de un gen que controla un carácter fenotípico. En estas circunstancias, en una especie diploide, encontraremos individuos con tres posibles genotipos: AA, aa y Aa. Por tanto, es fácil establecer la relación entre frecuencias alélicas y frecuencias genotípicas: p = AA + 1/2 Aa q = aa + 1/2 Aa Lógicamente, al haber sólo dos alelos se cumple que p+q=1 p=1–q q=1—p De aquí se puede deducir que las frecuencias de los genotipos de los individuos de la población se distribuyen según la expansión del binomio: (p + q)2 = p2 + 2pq + q2 es decir, p2 es la frecuencia de individuos con el genotipo AA, q2 es la frecuencia de individuos con el genotipo aa, y 2pq es la frecuencia de individuos heterocigotos Aa. Lógicamente, el total es el 100 por cien de los individuos de la población, luego p2 + 2pq + q2 = 1 Llegados a este punto es importante recalcar una serie de conceptos fundamentales. En primer lugar, las frecuencias alélicas son en sí mismas estables. Este concepto es muy importante y fue revolucionario en su momento, porque hasta Hardy y

www.FreeLibros.me


CAPITULO 12

5/12/06

07:22

Página 155

12.2 Cambios en las condiciones que mantienen el equilibrio: 12.2 cruzamientos no aleatorios Hardy y Weinberg demostraron que, en una población que no esté sometida a ninguna fuerza evolutiva, las frecuencias alélicas se mantendrán constantes en generaciones sucesivas siempre que los cruzamientos entre individuos sean aleatorios. Por ejemplo, para un carácter determinado por un gen que tiene dos alelos A y a, de modo que la mitad de los alelos sean A y la otra mitad sean a (frecuencias alélicas de 0,5 para cada alelo), las frecuencias genotípicas serán 0,25 AA, 0,5 Aa y 0,25 aa. Si los individuos de esta población se reproducen al azar, encontraremos teóricamente nueve tipos de cruzamientos, todos en la misma proporción: AA AA AA

× × ×

AA Aa aa

Aa Aa Aa

× × ×

AA Aa aa

aa aa aa

× × ×

AA Aa aa

Si ahora calculamos los genotipos de la descendencia que resulta de cada cruzamiento, asignando cuatro descendientes por pareja, tendremos los resultados que se muestran en la siguiente tabla: Cruzamiento aleatorio Cruzamientos posibles AA

Genotipos esperados en la descendencia Aa aa

AA × AA AA × Aa AA × aa Aa × AA Aa × Aa Aa × aa aa × AA aa × Aa aa × aa

4 2

Total

9 (25 %)

2 1

2 4 2 2 2 4 2 18 (50 %)

1 2 2 4 9 (25 %)

Como se puede comprobar, en la descendencia se mantienen las frecuencias genotípicas que existían en la generación anterior: 25 por ciento de individuos AA, 50

www.FreeLibros.me

155

Cambios en las condiciones que mantienen el equilibrio: cruzamientos no aleatorios

Weinberg se pensaba que los alelos dominantes van desplazando a los alelos recesivos de la población con el transcurso del tiempo, hasta eliminarlos por completo. Hardy y Weinberg demostraron que esto no es así, siempre que se cumplan las condiciones básicas de equilibrio. De hecho, no todas las desviaciones del equilibrio producen evolución, porque muchas veces se alteran las frecuencias genotípicas sin que cambien las frecuencias alélicas. Como veremos a lo largo de este capítulo, cuando no se cumple alguna de las condiciones necesarias para el equilibrio genético podemos tener cambios en las frecuencias alélicas, en las frecuencias genotípicas, o en ambas.


CAPITULO 12

156

5/12/06

07:22

Página 156

Los genes en las poblaciones

por ciento de individuos Aa y 25 por ciento de individuos aa. Si contamos el número de alelos A y a que hay en la nueva población, vemos que también las frecuencias alélicas se han mantenido estables (50 por ciento de alelos A y 50 por ciento de alelos a). En la naturaleza es bastante frecuente que los cruzamientos no se realicen totalmente al azar. En muchas especies, los individuos se cruzan preferencialmente con otros que tienen ciertas características fenotípicas (y, por tanto, determinados genotipos). Esto rompe las condiciones de equilibrio y cambia las proporciones genotípicas esperadas. En los procesos de mejora animal y vegetal se utilizan a veces cruzamientos dirigidos, con el fin de obtener individuos que tengan determinadas características fenotípicas (tamaño de la flor, cantidad de carne, etc.). En humanos tampoco es raro que se den cruzamientos preferenciales por razones culturales, sociales, étnicas, geográficas, etc. Se distinguen varios tipos de cruzamientos preferenciales: Cruzamiento preferencial positivo: en este caso, los individuos tienden a cruzarse con otros que comparten sus mismas características fenotípicas. En el caso más extremo, sólo tendremos cruzamientos de individuos genotípicamente iguales, es decir AA X AA, Aa X Aa y aa X aa. Por tanto, habrá un incremento en el porcentaje de homocigotos y una disminución en la proporción de heterocigotos: Cruzamiento Preferencial Positivo Cruzamientos posibles AA

Genotipos esperados en la descendencia Aa aa

AA × AA AA × Aa aa × aa

4 1

2

1 4

Total

5 (42 %)

2 (17 %)

5 (42 %)

Nótese que en una sola generación las frecuencias genotípicas han variado sustancialmente apartándose del equilibrio, aunque las frecuencias alélicas se mantienen en 50 por ciento A y 50 por ciento a. Cruzamiento preferencial negativo: es muy raro en humanos, y se da cuando los individuos se cruzan preferencialmente con otros que tienen características fenotípicas distintas a las suyas. Teóricamente, se producirían seis tipos de cruzamientos, con un aumento en la proporción de heterocigotos y un descenso en las proporciones de homocigotos: Cruzamiento Preferencial Negativo Cruzamientos posibles AA AA × Aa

Genotipos esperados en la descendencia Aa aa

2

2 (continúa)

www.FreeLibros.me


CAPITULO 12

5/12/06

07:22

Página 157

(continuación)

157 4 Cruzamiento Preferencial Negativo

Cruzamientos posibles AA Aa × AA Aa × aa aa × AA aa × Aa

2

Total

4 (17 %)

Genotipos esperados en la descendencia Aa aa 2 2 4 2 16 (67 %)

2 2 4 (17 %)

Nótese que, nuevamente, las frecuencias genotípicas se apartan del equilibrio pero las frecuencias alélicas se mantienen constantes (50 por ciento A y 50 por ciento a). Endogamia: la endogamia (o consanguinidad, como se denomina en poblaciones humanas) es el cruzamiento entre individuos que guardan algún tipo de parentesco, es decir, que comparten un ancestro común. Constituye una forma extrema de cruzamiento preferencial positivo, ya que los individuos comparten una gran proporción de sus alelos (1/2 en el caso de hermanos, 1/8 en el caso de primos hermanos, etc.). La endogamia se puede cuantificar mediante el coeficiente de endogamia (F), que mide la probabilidad de que dos alelos en dos individuos de una población procedan de un ancestro común (es decir, sean idénticos por descendencia). El cociente de endogamia F puede variar entre 0 (cruzamiento aleatorio) y 1 (todos los alelos son idénticos porque proceden del mismo progenitor). Cuando nos encontramos en una situación de endogamia, las frecuencias genotípicas van a cambiar de tal forma que la frecuencia de homocigotos AA = p2 + Fpq, la frecuencia de heterocigotos Aa = 2pq – 2Fpq y la frecuencia de homocigotos aa = q2 + Fpq. Es decir, con cada generación de cruces endogámicos, la frecuencia de heterocigotos disminuye y la de homocigotos aumenta. En el caso de retrocruzamientos con un progenitor (como suele hacerse para conseguir líneas puras de ratones, por ejemplo), F = 0,5 y la frecuencia de heterocigotos disminuye a la mitad con cada generación. En general, el cruzamiento preferencial puede hacer que en pocas generaciones aumente enormemente la proporción de individuos que son homocigotos para un genotipo. El problema es que a veces un carácter resulta deletéreo y los individuos homocigotos tienen su viabilidad o su fertilidad reducidas, por lo que toda la población se ve afectada. Este fenómeno se conoce como depresión endogámica. Lógicamente, la endogamia es un fenómeno más grave que el apareamiento preferencial, ya que en este último sólo se alteran las frecuencias genotípicas para uno o varios genes (aquellos que controlan el carácter que condiciona la preferencia del apareamiento). La endogamia, por el contrario, afecta a todo el genoma y tiene consecuencias más severas. Aunque la gente piensa que los hijos de matrimonios consanguíneos tienen una alta probabilidad de sufrir anomalías, esto no es necesariamente así. Únicamente

www.FreeLibros.me

Cambios en las condiciones que mantienen el equilibrio: cruzamientos no aleatorios

AA × aa


CAPITULO 12

158

5/12/06

07:22

Página 158

Los genes en las poblaciones

cuando en la familia hay algún alelo recesivo deletéreo, habrá mayor frecuencia de homocigotos para ese alelo como fruto de la consanguinidad. Un ejemplo de lo anterior es el de la comunidad Amish de Pennsylvania y Ohio, que llevan varios siglos viviendo aislados por razones culturales y religiosas. Los matrimonios repetidos entre miembros de la misma comunidad han provocado una situación de endogamia en la que han aflorado algunas enfermedades recesivas que son mucho más frecuentes en esta población que en la población general. En este sentido, estudios hechos en niños japoneses han encontrado que cada aumento del 10 por ciento de F conlleva una disminución de seis puntos del cociente intelectual; además, en ese mismo estudio se vio que la descendencia de primos hermanos (en la que F = 0,0625) sufrió una mortalidad 40 por ciento superior a la de niños de matrimonios no endogámicos. De todas formas, estudios hechos en varias poblaciones han determinado que la descendencia de primos hermanos sólo tiene un riesgo de sufrir malformaciones congénitas aproximadamente dos por ciento superior al que existe en la población general, y de hecho los matrimonios entre primos hermanos son relativamente frecuentes en ciertas culturas, como en la hindú o la árabe. Hemos visto qué sucede cuando no se cumple una de las condiciones necesarias para mantener el equilibrio de Hardy-Weinberg en una población. Recordemos que la ausencia de cruzamientos aleatorios provoca un desvío del equilibrio, con cambios marcados en las frecuencias genotípicas pero sin afectar a las frecuencias alélicas. A continuación estudiaremos otras situaciones que, además de alterar las frecuencias genotípicas, también producen cambios en las frecuencias alélicas en la población.

12.3 Cambios en las condiciones que mantienen el equilibrio: 12.3 efectos del tamaño poblacional Con cierta frecuencia se producen cambios aleatorios en el número de alelos que pasan de una generación a la siguiente, por un efecto de error de muestreo. Dicho error se debe a que en una población no siempre se reproducen todos los individuos, por lo que en la siguiente generación sólo tendremos un subgrupo de los alelos que estaban presentes en la generación anterior, y esto da lugar a oscilaciones aleatorias en las frecuencias alélicas de una generación a la siguiente. Este fenómeno se conoce como deriva genética aleatoria, y es equivalente a sacar bolas de un saco que contiene, por ejemplo, 50 bolas blancas y 50 bolas negras (100 bolas en total). Si sacamos 40 bolas para formar 20 parejas (lo que sería equivalente a sacar alelos de una población para generar individuos diploides en la generación siguiente), lo normal es observar pequeñas desviaciones respecto a la proporción teórica esperada de 20 bolas blancas y 20 bolas negras. De este modo, con cada generación (cada vez que sacamos bolas de una bolsa), las frecuencias alélicas oscilan por efecto del azar. Además, estas oscilaciones serán mayores cuanto menor sea el tamaño de la población. Por ejemplo, si de la bolsa que contiene 100 bolas sacamos sólo 10 bolas, no sería de extrañar que obtuviésemos grupos de 10 bolas en los que la mayoría fuesen de un mismo color. Incluso, por mero azar, podríamos sacar 10 bolas blancas, en cuyo caso el color blanco se habría fijado en la nueva po-

www.FreeLibros.me


CAPITULO 12

5/12/06

07:22

Página 159

La Figura 12.1 ilustra el error de muestreo y la deriva genética aleatoria.

La deriva genética se puede estimar a partir de la variación alélica existente en la población, que se cuantifica mediante la varianza estadística. En una población de tamaño N con frecuencias alélicas p y q, la varianza de la frecuencia alélica (sp2) se puede calcular mediante la fórmula sp2 = pq/2N. En otras palabras, la deriva observada en una población depende de las frecuencias alélicas y del tamaño poblacional. Por el numerador, podemos deducir que la deriva será mayor si las frecuencias alélicas son iguales que si son muy dispares. De la fórmula se desprende también que la deriva será más acusada en poblaciones de pequeño tamaño. La deriva genética tiene dos efectos principales: origina cambios en las frecuencias alélicas, y puede también reducir la variabilidad genética cuando alguno de los alelos se fija en la población. Además, como es un fenómeno aleatorio, encontramos que diferentes poblaciones pueden derivar de modo distinto, aunque al principio del proceso tengan el mismo tamaño y las mismas frecuencias alélicas. Dos circunstancias afectan especialmente a poblaciones humanas y provocan cambios en las frecuencias alélicas de la población por deriva genética aleatoria. En primer lugar, algunas poblaciones humanas actuales han sido fundadas por un pequeño núcleo inicial de pobladores que han dado lugar a la población actual. Puede suceder que en el grupo inicial de pobladores existiese algún alelo concreto (por ejemplo, una mutación que causa una enfermedad genética) en baja frecuencia. Si todos los individuos se reproducen, incluyendo los enfermos, el resultado tras muchas generaciones será que ese alelo (y la enfermedad causada por él, en nuestro ejemplo) serán muy frecuentes en la población actual. Este fenómeno se conoce como efecto fundador. Hay muchos ejemplos de enfermedades o rasgos genéticos cuya alta frecuencia en determinadas poblaciones se puede explicar por un efecto fundador. Por ejemplo, la alta frecuencia del grupo sanguíneo 0 entre los indios de América del Sur y Central parece deberse a que todos proceden de un pequeño número de pobladores que entraron por el estrecho de Behring al final de la última glaciación, entre los que ese grupo sanguíneo debía ser predominante. Quizás el caso más extremo de efecto fundador es el de la enfermedad de Huntington, un desorden neurológico que se encuentra con una frecuencia mucho más alta de lo normal en una pequeña población del lago Maracaibo, en Venezuela. Parece que la gran mayoría de los pobladores actuales de esa región, unos 20 000, proceden de una misma mujer que llegó a la zona en el siglo XIX y que sufría la enfermedad. Otro fenómeno similar que perturba las frecuencias alélicas por deriva genética aleatoria es el efecto de cuello de botella. En este caso, alguna causa (un desastre natural, epidemias, guerras) lleva a reducir drásticamente el tamaño de una población en una generación, por lo que las frecuencias alélicas de la generación siguien-

www.FreeLibros.me

159

Cambios en las condiciones que mantienen el equilibrio: efectos del tamaño poblacional

blación ya que habría desaparecido la posibilidad de sacar bolas negras en sucesivas generaciones. Por tanto, en el caso de poblaciones con un pequeño número de individuos que se reproducen, la deriva genética aleatoria puede tener efectos muy marcados sobre las frecuencias alélicas, pudiendo incluso hacer que uno de los alelos sustituya completamente al otro (se dice entonces que un alelo ha quedado fijado y el otro ha sido «barrido» de la población).


CAPITULO 12

160

5/12/06

07:22

Página 160

Los genes en las poblaciones

te serán muy distintas a las de la generación anterior. En casos de cuello de botella muy acentuados, puede llegarse a la pérdida de algún alelo, y a menudo los cuellos de botella provocan una reducción importante en la diversidad genética de la población que sobrevive. Hasta ahora hemos visto situaciones que alteran el equilibrio de Hardy-Weinberg en una población, produciendo cambios en las frecuencias genotípicas y alélicas por diversos mecanismos. De todas formas, los mecanismos más importantes para generar evolución son los que introducen nuevos alelos en una población (trasladándolos desde otras poblaciones o generando alelos nuevos a partir de los ya existentes) y la selección natural, que elimina o favorece aquellos alelos que permiten la mejor adaptación de la especie a su medio. En primer lugar veremos los procesos que crean nuevos alelos en una población determinada.

12.4 Cambios en las condiciones que mantienen el equilibrio: 12.4 migración o flujo genético Sin duda, los fenómenos migratorios son actualmente la principal causa de entrada de alelos nuevos en poblaciones humanas. La llegada de individuos con una constitución genética distinta (flujo genético), en la medida en que los nuevos individuos se mezclan con la población existente, hace que las frecuencias alélicas de la población receptora cambien o que aparezcan nuevos alelos que antes no estaban presentes. Del mismo modo, la población que sufre la emigración también puede verse sometida a cambios en las frecuencias alélicas, si los individuos que la abandonan no son totalmente representativos del acervo genético de la población. Por ejemplo, si m individuos de una población 1 en la que un alelo tiene una frecuencia q1 migran a otra población 2 en la que ese alelo está en una frecuencia q2, la frecuencia del alelo en la población que resulta después de la migración será q’ = q1m + q2 (1-m). De esta ecuación es fácil deducir que el cambio en la frecuencia alélica en la población 2 (la población receptora) es igual a m (q1 – q2), lo que quiere decir que los efectos sobre las frecuencias alélicas dependerán del número de individuos que migran (m) y de la diferencia inicial en las frecuencias alélicas entre ambas poblaciones. Aunque el efecto de la migración es homogeneizar las diferencias genéticas entre poblaciones (al contrario que la deriva o la selección natural, como veremos más adelante), es una causa importante de entrada de nuevos alelos y de aumento de la variabilidad en una población concreta.

12.5 Cambios en las condiciones que mantienen el equilibrio: 12.4 recombinación y mutación Los fenómenos moleculares capaces de crear nuevos alelos o nuevas combinaciones de alelos ya existentes son la mutación y la recombinación, respectivamente. La recombinación tiene lugar en las células germinales, durante la meiosis. En el caso de la especie humana, los 23 cromosomas procedentes del gameto masculino se alinean con los procedentes del gameto femenino e intercambian segmentos de material genético. Esto hace que los cromosomas resultantes lleven combinaciones de alelos

www.FreeLibros.me


CAPITULO 12

5/12/06

07:22

Página 161

Los enlaces de la Figura 12.2 permiten simular el efecto de la migración y la mutación sobre las frecuencias alélicas.

12.6 Cambios en las condiciones que mantienen el equilibrio: 12.4 selección La principal intuición de Charles Darwin, fruto de las observaciones que le llevaron a escribir El origen de las especies, fue que el principal mecanismo evolutivo es la selección natural. El concepto de selección natural es simple, y podría definirse como la diferente eficacia biológica (entendida como viabilidad o capacidad reproductiva) que confieren alelos distintos. Así, los alelos que permiten una mejor adaptación al medio tienden a ser favorecidos, mientras que los alelos deletéreos tienden a ser eliminados de la población. Según esto, los alelos neutros, que no confieren ninguna ventaja ni desventaja, no estarán sometidos a selección. Un ejemplo muy citado es el de la polilla Biston betularia, estudiada por H. B. D. Kettlewell en la segunda mitad del siglo XIX en Manchester. Kettlewell observó que antes de 1848 esta especie se encontraba con dos colores distintos, claro u oscuro, y que las polillas oscuras eran menos del dos por ciento de la población de polillas de la zona. Durante los años siguientes, la proporción de polillas oscuras fue creciendo hasta llegar a constituir el 95 por ciento del total en el año 1898. Esto se observaba en las zonas industrializadas, mientras que en las zonas rurales el aumento de polillas oscuras era menos acusado. Como el color de las polillas es un rasgo codificado por un gen, el cambio en

www.FreeLibros.me

161

Cambios en las condiciones que mantienen el equilibrio: selección

(haplotipos) que no estaban presentes en ninguno de los progenitores. Aunque no se crean nuevos alelos sino nuevas combinaciones de los ya existentes, la recombinación constituye un importantísimo mecanismo de creación de diversidad genética. La mutación es el cambio introducido en el material genético a nivel molecular, alterando la secuencia de nucleótidos. Las mutaciones pueden ser puntuales (si afectan únicamente a un nucleótido) o pueden alterar segmentos más o menos grandes del genoma (alteraciones cromosómicas, por ejemplo). Desde el punto de vista evolutivo, las únicas mutaciones que interesan son las que afectan a las células germinales, pues son las únicas que se transmitirán a la generación siguiente. Lógicamente, además es necesario que la mutación se exprese en un fenotipo, es decir, que altere alguna función biológica. Esto no es lo habitual, ya que la mayoría de las mutaciones son silenciosas (no alteran la secuencia de aminoácidos de la proteína codificada por el gen) y, por tanto, son «neutras» desde el punto de vista evolutivo. Las mutaciones deletéreas suelen ser eliminadas por selección, aunque a veces quedan en el acervo genético en forma recesiva y pueden aflorar en generaciones futuras (esto es lo que se conoce como «lastre genético»). En definitiva, cuando la mutación es la única fuerza evolutiva que actúa sobre una población, los cambios en las frecuencias alélicas son muy pequeños y serían necesarias muchas generaciones para producir variaciones significativas. Aunque la tasa mutacional (el número de mutaciones que se introducen por generación) varía de una especie a otra y en general es bastante baja, la mutación es la «materia prima» sobre la que actúa la principal fuerza evolutiva: la selección.


CAPITULO 12

162

5/12/06

07:22

Página 162

Los genes en las poblaciones

los colores era el resultado de cambios en las frecuencias alélicas. Kettlewell atribuyó el cambio al hecho de que la industrialización de la región hizo que el hollín se depositase en los abedules donde se posaban las polillas, y esto hacía que las de color claro destacasen más y fuesen presa más fácil de los pájaros depredadores. Las polillas oscuras, en cambio, tenían una mayor probabilidad de pasar desapercibidas y sobrevivir. Por tanto, las polillas oscuras sobrevivían más que las claras y se reproducían con más frecuencia, haciendo que los alelos que generan el color oscuro pasaran preferentemente a las generaciones sucesivas. La mejor adaptación al medio de las polillas oscuras, simplemente por un mecanismo de selección, provocó la evolución de esta especie en esa región. Para cuantificar los efectos de la selección, es necesario calcular la eficacia biológica relativa o «fitness», que es el éxito reproductivo relativo de un genotipo concreto. La eficacia se representa por la letra w y su valor varía entre 0 y 1. Por ejemplo, para dos alelos A y a, se puede calcular la descendencia media que produce cada genotipo. Supongamos que los individuos con genotipo AA tienen una media de 10 descendientes, los Aa cinco descendientes y los aa dos descendientes. La eficacia de cada genotipo se calcula como el número de descendientes de ese genotipo respecto al genotipo más eficaz: wAA = 10/10 = 1; wAa = 5/10 = 0,5; waa = 2/10 = 0,2. Una variable relacionada con la eficacia biológica relativa es el coeficiente de selección (s), que indica la intensidad de la selección frente a un genotipo determinado. El cálculo se hace con arreglo a la fórmula s = 1 – w, luego en el ejemplo anterior tendríamos que sAA = 0; sAa = 0,5; saa = 0,8. Este modelo permite predecir que, en ausencia de otros factores, la diferente eficacia biológica de cada genotipo provocará cambios en las frecuencias alélicas con cada generación. Estos cambios dependerán únicamente de las frecuencias alélicas iniciales y de la eficacia biológica relativa de cada genotipo. Así, para genotipos AA, Aa y aa que estén en frecuencias p2, 2pq y q2 respectivamente, con eficacias wAA, wAa y waa, las frecuencias genotípicas tras selección durante una generación serán: f(AA) = p2 wAA f(Aa) = 2pq wAa f(aa) = q2 waa Es importante darse cuenta de que la selección, en sí misma, no tiene memoria ni es un proceso guiado hacia un fin, no «piensa» lo que va a suceder dos o tres procesos de selección después. Simplemente consigue la mejor adaptación a las condiciones ambientales que se dan en un momento dado, pero si esas condiciones cambian los rasgos que habían sido seleccionados pueden volver a perderse. Por eso, la selección no es un proceso progresivo de «mejora» de una población, porque los individuos mejor adaptados en un momento concreto no tienen por qué ser biológicamente más perfectos. En los enlaces de la Figura 12.3 se puede estudiar el efecto de la selección en distintas condiciones.

Existen varios tipos de selección que tienen distintos efectos sobre las frecuencias alélicas y la variabilidad genética de la población. Si consideramos un rasgo fenotí-

www.FreeLibros.me


CAPITULO 12

5/12/06

07:22

Página 163

pico controlado por un gen con dos alelos, podemos distinguir cuatro tipos principales de selección: selección contra uno de los homocigotos. En este caso, uno de los genotipos homocigóticos (AA o aa, en los ejemplos que venimos viendo) tiene desventaja adaptativa y por eso la selección actúa en su contra. La consecuencia es la disminución progresiva de la frecuencia del alelo presente en ese genotipo. Por ejemplo, en el caso extremo de selección completa en contra del genotipo aa, los individuos aa no llegarán a reproducirse y los únicos emparejamientos posibles serán los que se muestran en la siguiente tabla: Selección contra un homocigoto (aa) Posibles cruzamientos AA

i)

i)

i)

Genotipos esperados en la descendencia Aa aa

AA × AA AA × Aa Aa × AA Aa × Aa

4 2 2 1

2 2 2

1

Total

9 (56 %)

6 (38 %)

1 (6 %)

Como se observa, en la siguiente generación la frecuencia del alelo a habrá caído al 25 por ciento (ocho alelos a de un total de 32), y esta tendencia se mantendrá mientras dure la selección. De todas formas, es importante darse cuenta de que el alelo a nunca llegará a desaparecer de la población, porque siempre será transmitido por individuos heterocigotos Aa. En las poblaciones humanas, los rasgos recesivos se ven sometidos a este tipo de selección, aunque de un modo mucho más leve. Por una parte, algunos rasgos recesivos, como el albinismo, no suponen una gran desventaja selectiva. Otras enfermedades más severas, en las que hace años había una alta mortalidad antes de llegar a la edad reproductiva, cuentan hoy en día con tratamientos más eficaces y se consigue que los enfermos vivan más años y puedan reproducirse, por lo que el efecto de la selección sobre las frecuencias alélicas es menor. Si se conocen los valores de eficacia biológica relativa (w) de cada genotipo (y por tanto los del coeficiente de selección s), se puede calcular el cambio que se producirá en la frecuencia alélica utilizando diversas fórmulas para fenotipos recesivos, dominantes o sin dominancia. En la historia reciente de las poblaciones humanas encontramos un ejemplo muy ilustrativo de selección contra un homocigoto. Un alelo concreto del gen que codifica el receptor cinco de quimioquinas (alelo denominado CCR5delta32) confiere a las células resistencia frente a la invasión por la bacteria causante de la peste bubónica. Los individuos homocigotos para ese alelo son inmunes a la peste, y los heterocigotos tienen cierta inmunidad. Los homocigotos sin ese alelo, en cambio, son los más susceptibles. Dado

www.FreeLibros.me

Cambios en las condiciones que mantienen el equilibrio: selección

i)

163


CAPITULO 12

5/12/06

164

Los genes en las poblaciones

ii)

ii)

iii)

07:22

Página 164

que las poblaciones europeas fueron sometidas a varias epidemias de peste en los siglos XIV a XVIII, durante las que murieron millones de personas, el alelo CCRdelta32 aumentó mucho en su frecuencia, y hoy se encuentra en torno al 10 por ciento en poblaciones europeas, muy superior a otras zonas del planeta. Recientemente se ha visto que este alelo también protege frente a la infección por el virus VIH causante del SIDA. selección contra ambos homocigotos. En este caso, ambos homocigotos están en desventaja selectiva en comparación con los heterocigotos (wAA < wAa > waa), de ahí que se llame selección a favor de heterocigotos o también sobredominancia. En el caso más extremo, los individuos AA y aa nunca llegan a reproducirse, por lo que sólo hay cruzamientos Aa X Aa. Aunque este tipo de cruzamientos produce 1/4 de homocigotos AA y 1/4 de homocigotos aa, éstos no llegan a reproducirse y sólo los heterocigotos Aa pasan sus alelos a la generación siguiente. El efecto neto es que en pocas generaciones se estabilizan las frecuencias de los dos alelos (equilibrio polimórfico estable), por lo que este tipo de selección se llama también selección estabilizante. El ejemplo más ilustrativo de selección contra ambos homocigotos es la relación entre la anemia falciforme y la malaria en el África sub-sahariana. La anemia falciforme es una enfermedad recesiva rara, en la se produce un tipo de hemoglobina anormal (hemoglobina S) que hace que sus hematíes adquieran una conformación anómala. Los homocigotos sufren una forma grave de la enfermedad y mueren en la infancia, por lo que habitualmente no llegan a reproducirse. Los heterocigotos, en cambio, sufren una forma leve que no compromete su viabilidad. Curiosamente, la anemia falciforme protege frente a la infección por Plasmodium falciparum, el organismo causante de la malaria. El parásito crece dentro de los hematíes, pero no puede entrar en hematíes que están deformados como consecuencia de la hemoglobina S. Por tanto, los individuos con hemoglobina normal son mucho más susceptibles a la infección que los individuos con anemia falciforme: los individuos heterocigotos para la hemoglobina S están relativamente protegidos frente al Plasmodium, aunque no tanto como los homocigotos. Por tanto, tenemos una situación en la que tanto ambos tipos de homocigotos tienen comprometida su viabilidad: los individuos con dos alelos de hemoglobina S, debido a la anemia falciforme, y los individuos con hemoglobina normal, debido a que son más fácilmente infectados y mueren de malaria. En cambio, los heterocigotos con un solo alelo falciforme están relativamente protegidos frente a la malaria y no padecen la forma mortal de anemia, de modo que se ven favorecidos respecto a los homocigotos. El efecto neto es que en las zonas de África donde hay malaria la frecuencia del alelo falciforme es mucho más alta que en el resto del planeta. Selección contra heterocigotos y uno de los homocigotos. Esto equivale a la selección a favor de uno de los genotipos homocigotos (wAA > wAa > waa, por ejemplo). En este caso, los cambios en las frecuencias alélicas serán muy rápidos a favor del alelo presente en el genotipo más eficaz. De hecho, en el caso extremo en que los heterocigotos y un tipo de homocigotos no se re-

www.FreeLibros.me


CAPITULO 12

5/12/06

Página 165

produzcan, en una sola generación puede perderse un alelo y quedar fijado el otro. Por ejemplo, si la selección actúa contra heterocigotos Aa y homocigotos aa, sólo llegarán a reproducirse los individuos AA, con lo que el alelo a estará ausente en la siguiente generación. Lógicamente, esta forma extrema de selección no es frecuente en poblaciones humanas, aunque las enfermedades dominantes en las que tanto los heterocigotos como los homocigotos sufren la enfermedad podrían estar sujetas a este tipo de selección siempre que estos individuos vean reducida su viabilidad. selección contra heterocigotos. Finalmente, si la selección actúa únicamente en contra de los heterocigotos (wAA > wAa < waa) ocurrirá que la población se polarizará hacia los homocigotos, y esto se conoce como infradominancia. En el caso de alelos A y a con frecuencias p = q = 1/2, únicamente habrá cruzamientos entre homocigotos de ambos tipos, que producirán una descendencia típica con proporciones 25 por ciento AA, 50 por ciento Aa y 25 por ciento aa. Selección contra heterocigotos (Aa) Posibles cruzamientos AA AA × AA AA × Aa aa × AA aa × aa Total

ii)

Genotipos esperados en la descendencia Aa aa

4 4 4 4 (25 %)

8 (50 %)

4 4 (25 %)

De todas formas, como los individuos Aa fallecen antes de reproducirse, las frecuencias alélicas se reajustarán rápidamente hacia 50 por ciento A y 50 por ciento a. Por tanto, la subdominancia también produce un equilibrio polimórfico, pero al contrario que en el caso de la sobredominancia, aquí el equilibrio es inestable. Cualquier perturbación por alguna otra fuerza evolutiva hará que las frecuencias alélicas cambien rápidamente hasta fijar uno de los alelos en la población.

12.7 Aplicaciones en Genética Humana Aunque ya hemos visto algunos ejemplos en los que las nociones básicas de la Genética de poblaciones se aplican a poblaciones humanas, podemos hacer otras consideraciones de gran interés práctico. La más inmediata es que la Ley de Hardy-Weinberg permite calcular las frecuencias de los alelos mutantes que causan enfermedades humanas. Esto es especialmente útil en el caso de enfermedades recesivas, en las que sólo los homocigotos desarrollan la enfermedad. Si se conocen las cifras de prevalencia de la enfermedad en una población podemos calcular las frecuencias alélicas, la tasa de portadores en la población y las tasas de incidencia pre-

www.FreeLibros.me

165

Aplicaciones en Genética Humana

iv)

07:22


CAPITULO 12

166

5/12/06

07:22

Página 166

Los genes en las poblaciones

vistas en generaciones futuras. Por ejemplo, si la prevalencia de una enfermedad recesiva es de 25 enfermos por cada 100 000 habitantes, entonces q2 = 0,00025 y q = 0,016. Por tanto, p = 0,984 y 2pq = 0,031. En otras palabras, en esa población la tasa de portadores es del 3,1 por ciento y se mantendrá estable si no se alteran significativamente las condiciones del equilibrio. También es importante hacer algunas consideraciones respecto a la eficacia de las campañas de detección prenatal de enfermedades recesivas. La finalidad de estas campañas es evitar que nazcan individuos enfermos, es decir, homocigotos; sin embargo, esto no hace que disminuya la frecuencia alélica ni el porcentaje de individuos portadores (heterocigotos). En efecto, tal y como hemos visto al hablar de selección frente a un homocigoto (en este caso, recesivo), el alelo deletéreo nunca desaparece. Esto significa que las campañas eugenésicas son totalmente ineficaces para eliminar alelos recesivos de una población. Por ejemplo, se ha calculado que si la frecuencia del alelo recesivo causante del albinismo en Noruega es del 1 por ciento, un programa eugenésico dirigido a eliminar el alelo albino de la población noruega (esterilizando, por ejemplo, a todos los albinos) tardaría 100 generaciones en reducir la frecuencia alélica a la mitad de su valor actual (0,005) y llevaría 9 900 generaciones reducirla al 0,0001. En este sentido, el parámetro más importante para saber si es factible aplicar una campaña de detección prenatal en una enfermedad recesiva es el cociente entre heterocigotos y homocigotos: cuanto menor es la frecuencia del alelo mutante (q), mayor es el cociente 2pq/q2 y la frecuencia alélica q apenas bajará debido al alto número de portadores en la población. En cambio, estas campañas resultan más eficaces para hacer disminuir el número de nuevos enfermos en el caso de enfermedades recesivas más frecuentes, en las que q es más alto y el cociente 2pq/q2 menor. Las enfermedades ligadas al cromosoma X constituyen un caso especial para el cálculo de frecuencias alélicas y genotípicas, ya que los enfermos son habitualmente varones hemicigotos que sólo llevan una copia del alelo mutante. Por tanto, la prevalencia de la enfermedad en la población (varones enfermos por 100 000 habitantes) es igual a q (la frecuencia del alelo mutante). El porcentaje de mujeres homocigóticas (y, por tanto, enfermas) es q2, y suele ser muy bajo. Aunque en otras especies es relativamente sencillo calcular la tasa de mutaciones, la eficacia biológica relativa y el coeficiente de selección, en poblaciones humanas sólo podemos obtener aproximaciones. Por ejemplo, la tasa de nuevas mutaciones en enfermedades dominantes puede estimarse utilizando la fórmula µ = n/2N, siendo n el número de enfermos que nacen de padres sanos (los cuales deben ser homocigotos sanos si la enfermedad tiene penetrancia completa) y N el número total de nacimientos. Los cálculos de µ varían de unas enfermedades a otras, lo que refleja que las tasas de mutación no son iguales para todos los genes. Finalmente, podemos fijarnos en cómo mutación y selección natural actúan en direcciones opuestas, en especial sobre los alelos deletéreos. Éstos aumentan por efecto de la mutación, pero la selección tiende a eliminarlos de la población. Cuando ambas fuerzas alcanzan un equilibrio en el que todos los nuevos alelos mutados son eliminados por selección, la frecuencia de un alelo deletéreo dominante es igual al cociente µ/s, siendo µ la tasa de mutaciones y s el coeficiente de selección. En el caso de un alelo recesivo, su frecuencia es igual a la raíz cuadrada del cociente µ/s. Si conocemos la tasa de mutación y la frecuencia alélica, podemos calcular la eficacia bio-

www.FreeLibros.me


CAPITULO 12

5/12/06

07:22

Página 167

12.8 Formación de la Teoría Sintética de la Evolución En sentido biológico amplio, la evolución es un concepto universalmente aceptado: a lo largo de la historia natural del planeta, unas especies han ido desapareciendo y dando paso a otras que se derivan de las anteriores. Lamarck, al comienzo del siglo XIX, fue el primer naturalista en proponer el concepto de que unas especies se han ido transformando en otras, aunque en aquel momento esto no pasaba de ser una intuición, sin el respaldo de datos experimentales convincentes. En la Encyclopedia of Genetics, se define evolución como «el proceso mediante el cual, según unos individuos se diferencian gradualmente de otros al irse reproduciendo, los organismos cambian en otros nuevos a lo largo del tiempo». El diccionario de la RAE, en su 22.ª edición, define la evolución (biológica) como «el proceso constante de transformación de las especies a través de cambios producidos en sucesivas generaciones». El Diccionario del Español Actual (edición de 1999) la define como «cambio gradual y progresivo de las especies a lo largo de sucesivas generaciones». Este concepto de evolución es el que está en el imaginario popular, pero no debe ser confundido con la Teoría General de la Evolución, o evolución tal y como se entiende en ámbitos científicos, que es la teoría que intenta explicar los mecanismos que dan lugar a evolución. La Teoría de la Evolución arranca de las observaciones de Darwin, publicadas en El origen de las especies, y del descubrimiento de las leyes de la herencia por Mendel, a finales del siglo XIX. Darwin usó inicialmente la expresión «des-

www.FreeLibros.me

167

Formación de la Teoría Sintética de la Evolución

lógica o viceversa. Por ejemplo, se sabe que la acondroplasia, una enfermedad autosómica dominante, tiene una eficacia w = 0,74, ya que los individuos con acondroplasia son fértiles pero tienen en promedio un 74 por ciento de la descendencia que tienen los individuos sin acondroplasia. Por tanto, s = 1 – W = 0,26. Si la tasa mutacional calculada para este gen (usando la fórmula del párrafo anterior) es de 3 × 10-5 mutaciones por generación, podemos deducir que la frecuencia alélica es q = 0,0003/0,26 = 0,0012, que corresponde con la frecuencia de la enfermedad en la población. Una última consideración es la que hace referencia al papel de la selección natural en poblaciones humanas en la actualidad. Así como a lo largo de nuestra historia la selección ha jugado un papel importante en los cambios de frecuencias alélicas, y en gran parte del mundo todavía es así (recuérdese el ejemplo de la malaria en África), en el mundo industrializado el papel de la selección es cada vez menor. Esto es consecuencia de las mejoras en la calidad de vida y en los cuidados sanitarios, que hacen posible que individuos enfermos (que, de otro modo, fallecerían antes de la edad reproductiva) vivan más y puedan llegar a reproducirse y pasar los alelos mutantes a la siguiente generación. Esto es especialmente claro en el caso de tumores hereditarios de la infancia, como el retinoblastoma, que es una enfermedad de herencia autosómica dominante. También sucede con enfermedades recesivas comunes, como la fibrosis quística, que hace años tenía una alta mortalidad durante la infancia y en cambio hoy en día los enfermos suelen vivir hasta la edad adulta. Lógicamente, no debemos renunciar a los logros alcanzados en el tratamiento de las enfermedades, pero hemos de ser conscientes de que las poblaciones humanas van acumulando un lastre genético cada vez mayor.


CAPITULO 12

168

5/12/06

07:22

Página 168

Los genes en las poblaciones

cent with modification» para indicar que pequeños cambios heredados de una generación a la siguiente podían explicar la transformación de unas especies en otras. Pero en tiempos de Darwin todavía no se habían descubierto los principios de la Genética, por lo que no se podían describir los mecanismos que producían esos cambios ni cómo se heredaban de una generación a la siguiente. La gran intuición de Darwin fue que el principal mecanismo por el que opera la evolución es la selección natural, aunque no pudo demostrarlo experimentalmente por las razones apuntadas. El redescubrimiento de las leyes de Mendel en el año 1900 y la elaboración de la genética de poblaciones en las primeras décadas del siglo XX dieron lugar a la Teoría Sintética de la Evolución en torno a 1940. Posteriormente, los datos aportados por la biología molecular y la biología del desarrollo han completado y matizado algunos aspectos de la Teoría General. Por tanto, actualmente la evolución se define en términos científicos como el proceso mediante el cual una población de individuos adquiere cambios que son heredados a generaciones sucesivas. Por ejemplo, podemos citar la definición de evolución que propone Douglas J. Futuyma en su libro Evolutionary Biology (Sinauer Associates, 1986): Biological evolution (...) is change in the properties of populations of organisms that transcend the lifetime of a single individual. The ontogeny of an individual is not considered evolution; individual organisms do not evolve. The changes in populations that are considered evolutionary are those that are inheritable via the genetic material from one generation to the next. Es decir, la evolución biológica es el resultado de los cambios, pequeños o grandes, en los tipos y frecuencias de alelos existentes en una población de individuos, ya que esos cambios son transmitidos a las generaciones siguientes. Es interesante ver con un poco más de detalle el desarrollo histórico de las ideas que han dado lugar al concepto moderno de evolución. En las primeras décadas del siglo XX, como hemos visto, Hardy y Weinberg establecieron las bases de la genética de poblaciones. Los genetistas de principios de siglo pensaban que los alelos dominantes deberían ir desplazando poco a poco a los alelos recesivos de la población, hasta reemplazarlos por completo. Hardy (matemático) y Weinberg (físico) demostraron matemáticamente que esto no tenía por qué ser así, sino que —en determinadas condiciones— las frecuencias genotípicas deberían mantenerse estables y depender exclusivamente de las frecuencias alélicas. En los años posteriores, Ronald Fisher, J. B. S. Haldane y Sewall Wright desarrollaron estas ideas y elaboraron los conceptos que dieron lugar a la genética de poblaciones. Fisher, creador de la estadística moderna y del concepto de varianza, aportó entre otras muchas cosas lo que se conoce como el teorema fundamental de la selección natural: el cambio en la eficacia biológica (fitness) depende de la varianza genética aditiva (en otras palabras, a mayor variación en la población, mayor capacidad adaptativa). Sewall Wright, por su parte, hizo más hincapié en los efectos del tamaño poblacional, desarrollando el concepto de deriva genética y proponiendo la existencia de paisajes adaptativos. Todas estas ideas fueron sistematizadas y popularizadas por T. Dobzhansky, que en 1937 publicó Genetics and the Origin of Species. En este libro se exponía una teoría unificadora que explicaba de modo razonablemente satisfactorio las leyes por las que opera la evolución, la Teoría Sintética o «síntesis moderna». En torno a 1970 surgieron nuevas hipótesis para explicar aspectos evolutivos concretos, de manera que la Teoría Sintética fue matizada y ampliada para dar lugar a lo que hoy llamamos Teoría General de la Evolución.

www.FreeLibros.me


CAPITULO 12

5/12/06

07:22

Página 169

12.9 Explicación actual del proceso evolutivo y sus limitaciones El proceso evolutivo se divide habitualmente en tres fases: microevolución, especiación y macroevolución. La primera se refiere a los cambios relativamente pequeños que surgen en una población de individuos de una misma especie, y es la más fácil de observar y de estudiar experimentalmente. La especiación es el proceso por el que una especie da lugar a otra u otras mediante un proceso ramificado (cladogénesis) o lineal (anagénesis). Macroevolución se refiere a los cambios observados durante largos periodos de tiempo, que dan lugar a organismos muy diversos. La teoría moderna de la evolución explica satisfactoriamente la microevolución y la especiación, pero los mecanismos de macroevolución son más hipotéticos y sujetos a discusión, ya que la evidencia experimental es más fragmentaria y menos sólida. Una idea central a todos estos procesos es el concepto de especie, que en sí mismo es objeto de bastante controversia. Ernst Mayr fue el taxonomista que más ha contribuido a dar forma al concepto moderno de especie: en organismos de reproducción sexual, una especie es un grupo de poblaciones naturales que de hecho o en potencia se reproducen entre sí y que están aisladas reproductivamente de otros grupos similares. Este concepto de especie, que puede aplicarse con bastante generalidad a los animales pero con menos fiabilidad a las plantas, ha sido matizado más recientemente por la genética molecular y el concepto filogenético de especie: teniendo en cuenta características taxonómicas –basadas en diferencias morfológicas y funcionales– así como diferencias genéticas cuantificables por métodos moleculares, una especie es una rama claramente definida en un árbol filogenético. La teoría de la evolución explica satisfactoriamente cómo se producen la microevolución y la especiación. Una idea central en estos procesos, ya presente en la definición original de especie, es el aislamiento: para que pueda surgir una especie nueva, parte de la población original ha de quedar aislada del resto de los individuos de esa población. De hecho, los ejemplos mejor documentados de especiación se han verificado en condiciones de aislamiento: por ejemplo, hay evidencias de especiación especialmente intensa en archipiélagos, en los que es frecuente encontrar situaciones de aislamiento geográfico de poblaciones. Cuando dos poblaciones de una especie quedan separadas reproductivamente por razones geográficas, seguirán rumbos evo-

www.FreeLibros.me

169

Explicación actual del proceso evolutivo y sus limitaciones

Todo lo anterior sirve para subrayar la idea que se ha expuesto al principio de este capítulo: la evolución es fundamentalmente un fenómeno que afecta a la constitución genética de una población (el «acervo genético», es decir, el conjunto de alelos que están presentes en una población) y sus cambios en el tiempo. Por tanto, es natural que la evolución deba ser estudiada con un enfoque eminentemente genético y utilizando las metodologías propias del análisis genético. No se puede afrontar el estudio de la evolución sin comprender todos los conceptos explicados en la sección dedicada a la Genética de Poblaciones. Los métodos cuantitativos de análisis de la variabilidad genética y de la selección natural son imprescindibles en cualquier discusión científica en torno a la evolución. De hecho, algunos autores resumen el proceso evolutivo en una expresión sencilla pero llena de significado: «los genes mutan, los individuos son seleccionados, las poblaciones evolucionan».


CAPITULO 12

5/12/06

07:22

Página 170

escarabajos

avispas

avispas

mariposas

Los genes en las poblaciones

escarabajos

moscas

170

mariposas moscas

La Figura 12.4 explica qué es un árbol filogenético.

lutivos distintos con el paso del tiempo, tanto si los ambientes a los que están sometidas son distintos o no. Este tipo de especiación se llama especiación alopátrica, y es el más fácil de explicar y para el que se han encontrado más ejemplos en la naturaleza. Por el contrario, dos poblaciones pueden diverger sin estar aisladas geográficamente, fenómeno que se conoce como especiación simpátrica. Aunque ésta última es más difícil de explicar y está menos documentada, hay algunos ejemplos en plantas. El proceso de especiación es explicado por la teoría moderna de la evolución utilizando los conceptos de variabilidad, selección natural y deriva genética. El requisito necesario para que haya microevolución y especiación es la presencia de variación genética. Si no existe variación, no puede haber evolución. Como hemos visto, ya Fisher había postulado que la variación genética es directamente proporcional a la velocidad con la que opera la selección adaptativa. Al explicar los principios de la Genética de Poblaciones hemos visto que la mutación es el principal mecanismo por el que aumenta la variación genética, mientras que la selección natural habitualmente disminuye la variabilidad existente en la población, aunque en algunos casos la mantiene (selección a favor de heterocigotos y equilibrio polimórfico estable). En general, en el caso de dos poblaciones aisladas sometidas a condiciones ambientales distintas, la principal fuerza microevolutiva será la selección. El coeficiente de selección y la eficacia biológica (fitness) permiten predecir la magnitud de los cambios en las frecuencias alélicas con las sucesivas generaciones. La teoría moderna de la evolución también permite predecir que dos poblaciones en condiciones de aislamiento geográfico sufrirán evolución aunque no estén sometidas a presiones ambientales diferentes. Sewall Wright fue el primero en predecir que si el tamaño poblacional es pequeño, las frecuencias alélicas pueden cambiar rápidamente por deriva genética aleatoria, sin estar determinadas por la selección natural. Un mecanismo frecuente de especiación es el aislamiento de una población pequeña que contiene un pequeño grupo de los alelos presentes en la población original de partida (efecto fundador). En estas condiciones, la deriva genética puede fijar rá-

www.FreeLibros.me


CAPITULO 12

5/12/06

07:22

Página 171

www.FreeLibros.me

171

Explicación actual del proceso evolutivo y sus limitaciones

pidamente ciertos alelos en la población y producir evolución sin selección. El papel de la deriva genética en la evolución adquirió especial protagonismo tras los trabajos de Motoo Kimura en 1968. Durante los años precedentes, los avances en biología molecular habían hecho posible, por primera vez, cuantificar las diferencias genéticas que se observan entre especies distintas definidas por el concepto clásico de especie. Estas comparaciones confirmaron que los grupos taxonómicos se correspondían extraordinariamente bien con los grupos filogenéticos derivados de la comparación de secuencias de ADN. Kimura observó que la mayor parte de los cambios moleculares en el ADN eran «neutros» desde el punto de vista de la selección, ya que afectan a nucleótidos que no alteran la secuencia de aminoácidos de la proteína codificada. El descubrimiento de que los genomas de mamíferos están formados en su mayor parte por ADN no-codificante, así como la presencia de numerosos polimorfismos silenciosos y selectivamente neutros ha supuesto un respaldo de la teoría neutral de la evolución, que así complementó la Teoría Sintética prevalente hasta los años 70. La teoría neutral hace predicciones importantes, ya que postula que la gran mayoría de las mutaciones son neutras y, por tanto, la tasa de cambio evolutivo (a nivel molecular) viene determinada exclusivamente por la tasa de mutación, independientemente del tamaño de la población. Esto introdujo el concepto de «reloj molecular», tan importante en los estudios actuales de evolución molecular. Por otra parte, la teoría neutral también predice que la probabilidad de fijación de un alelo en la población dependerá exclusivamente del tamaño de la misma. Estas predicciones se han confirmado en bastantes casos, aunque actualmente la teoría neutral se ha modificado para incluir los efectos de alelos deletéreos sometidos a selección débil. Dado que la teoría sintética explicaba satisfactoriamente la microevolución y la especiación, hasta los años 70 era común aceptar que la macroevolución sería el resultado de estos mismos mecanismos operando durante grandes periodos de tiempo. Este modelo de pequeños cambios graduales a lo largo del tiempo se conoce como gradualismo, y supone que las especies están constantemente evolucionando a una velocidad lenta. En 1972, Stephen Jay Gould y Niles Eldredge propusieron la hipótesis del equilibrio puntuado, para intentar explicar el hecho de que el registro fósil muestra que muchas especies han estado durante millones de años básicamente sin cambios y en poco tiempo sufrieron transformaciones drásticas. Según estos autores y otros paleontólogos no es necesario que la evolución actúe constantemente, porque muchas especies están bien adaptadas y no necesitan cambiar si no se alteran las condiciones ambientales. Es precisamente en periodos de cambios ambientales bruscos (glaciaciones, sequías, cambios en el clima o en los recursos alimenticios, depredadores, etc.) cuando la selección natural puede favorecer variedades que estaban presentes en la población en baja frecuencia, dando lugar a cambios adaptativos rápidos. Por otro lado, los estudios de evolución molecular, sobre todo en la comparación de genomas, han mostrado que muchos genes reguladores y genes implicados en el desarrollo embrionario están muy conservados en la naturaleza. En concreto, la biología del desarrollo estudia los genes responsables de los patrones corporales, la polaridad, las extremidades y la organogénesis. Los genes implicados en estos procesos son extraordinariamente similares entre especies evolutivamente distantes, lo que ha llevado a generar una nueva disciplina llamada biología del desarrollo evolutiva


CAPITULO 12

172

5/12/06

07:22

Página 172

Los genes en las poblaciones

(«evo-devo», del inglés evolutionary developmental biology). La idea que se extrae de estos análisis es que pequeños cambios en genes clave, que regulan la expresión de un número elevado de genes distintos, puede producir alteraciones morfológicas importantes en un periodo corto de tiempo. La Figura 12.5 muestra la organización de los genes homeobox en humanos y en Drosophila.

En esta misma línea, los estudios comparativos de los genomas de distintas especies muestran que la duplicación de genes, la duplicación de genomas y los reordenamientos cromosómicos han sido frecuentes en diversos momentos evolutivos. Susumu Ohno publicó en 1970 el libro Evolution by gene duplication, proponiendo la idea de que la duplicación de genomas ha sido una de la fuerzas evolutivas que han permitido crear complejidad y aumentar la variación genética. Aunque en esos años no había mucha evidencia experimental para apoyar esta hipótesis, Ohno postuló que los cambios macroevolutivos no pueden explicarse por la acción lenta de la selección sobre la variedad alélica presente en la población, sino que es necesario que haya suficiente redundancia en el genoma para que la selección pueda actuar por separado sobre distintas copias de los mismos genes. Esa redundancia se habría alcanzado mediante duplicaciones genómicas parciales o totales. Los estudios moleculares de familias y superfamilias de genes, y la reciente secuenciación de genomas completos han ido confirmando algunas de las predicciones de Ohno. Hoy en día se acepta que grandes segmentos de los genomas de eucariotas están formados por regiones duplicadas y que la mayor parte de las familias génicas han surgido por duplicación y divergencia separada de las distintas copias, o incluso por duplicaciones genómicas completas. La comparación de familias de genes muestra que, en general, los genes ortólogos (copias de un gen en especies distintas) tienen mayor homología entre sí que los genes parálogos (copias duplicadas de un gen dentro de una misma especie), lo cual sugiere que la duplicación inicial es muy antigua. En cuanto a la duplicación de genomas, se ha sugerido que durante la evolución de los vertebrados han tenido lugar dos duplicaciones genómicas (hipótesis 2R), ya que muchos genes importantes (genes homeobox, genes del complejo mayor de histocompatibilidad, etc.) tienen una sola copia en invertebrados pero tres o cuatro copias en vertebrados. Los análisis más recientes del genoma humano muestran la existencia de muchos más genes duplicados de los que cabría esperar por azar, y cuando se compara con los genomas de Drosophila y de C. elegans parece que hubo al menos una duplicación genómica completa entre invertebrados y vertebrados. En el caso concreto de los mamíferos, los genomas analizados en los últimos años permiten constatar la presencia de gran cantidad de reordenaciones cromosómicas, de mayor o menor tamaño. Esto se ve especialmente bien al comparar genomas de especies muy similares: por ejemplo, si se alinean los genomas de primates, se observa que la sintenia es casi total, aunque varias translocaciones e inversiones dan lugar a los 46 autosomas del chimpancé frente a los 44 de la especie humana. Al comparar especies más separadas, como humano y ratón, los bloques de sintenia son más pequeños y están más dispersos (hay 342 bloques de un tamaño promedio de unas 10 Megabases cada uno). Esto sugiere que ambos genomas se han originado a partir de un genoma ancestral mediante complejos eventos de duplicación, inversión y translocación.

www.FreeLibros.me


CAPITULO 12

5/12/06

07:22

Página 173

www.FreeLibros.me

173

Explicación actual del proceso evolutivo y sus limitaciones

Como conclusión, parece bastante claro que la historia evolutiva de la vida del planeta es tremendamente complicada. Aunque los mecanismos básicos, sobre todo los que originan microevolución y especiación, son bastante bien comprendidos, los cambios macroevolutivos son más difíciles de analizar. Diferentes especies han evolucionado a distintas velocidades, en respuesta a factores ambientales muy cambiantes y a interacciones complejas con otras especies. Estos factores han propiciado, además, la extinción de la inmensa mayoría de las especies, por lo que el cuadro general macroevolutivo es fragmentario y no es fácil proponer explicaciones satisfactorias. En cualquier caso, la teoría sintética, que explicaba cambios pequeños, ha sido matizada y completada por aportaciones importantes como la teoría neutral de Kimura, la teoría del equilibrio puntuado y la hipótesis de Ohno. Con estas aportaciones, se ha rebajado algo la importancia de la selección natural gradual en los cambios macroevolutivos y en cambio se tiende a dar más importancia a alteraciones genómicas o a cambios ambientales bruscos que pueden haber provocado fases de evolución acelerada. Sobre los cambios adquiridos durante estos periodos, la selección habría proporcionado el «ajuste fino» adaptativo. La conciliación de la teoría moderna de la evolución con las convicciones filosóficas o religiosas de los individuos no debería ofrecer problemas, al tratarse de ámbitos del conocimiento diferentes. La mayor parte de los problemas han surgido cuando uno de esos ámbitos ha intentado invadir el otro. En el ámbito protestante anglosajón, especialmente en los Estados Unidos, se originó un movimiento llamado creacionismo al advertir que la teoría de la evolución estaba siendo utilizada para atacar los fundamentos de las creencias religiosas de los ciudadanos. Las disputas entre creacionistas y evolucionistas son todavía hoy muy acentuadas en ese país; por desgracia, algunos intentos recientes de deslegitimar ideas propias del ámbito filosófico-teológico en nombre de la ciencia no han ayudado en absoluto a conciliar ambas visiones. Un ejemplo muy claro fue la publicación en 1986 de «El relojero ciego» por Richard Dawkins. En ese libro el autor se propone refutar, recurriendo al mecanismo de la evolución y en particular a la selección natural, el «argumento del diseño» que había sido propuesto por el teólogo protestante William Paley en 1802. Obviamente, este planteamiento traspasa los límites de la ciencia experimental, ya que ésta responde a preguntas sobre mecanismos biológicos pero no puede responder a argumentos teológicos ni a preguntas sobre las causas primeras y el origen ontológico del mundo material; estas cuestiones pertenecen más al ámbito de la filosofía y escapan al propio método experimental. En cualquier caso, la publicación de ese libro dio lugar a una fuerte respuesta que cristalizó en un movimiento que hoy se conoce como «Diseño Inteligente», una reformulación moderna de la quinta vía de Tomás de Aquino (como lo era también, en el fondo, el argumento del diseño de Paley). El Diseño Inteligente intenta utilizar la ciencia actual (sobre todo a nivel molecular, proponiendo el concepto de «complejidad irreductible») para demostrar la existencia de un diseño en la naturaleza, y por tanto la existencia de un ser inteligente creador de dicho diseño. Nuevamente nos encontramos ante un intento de utilizar la ciencia con fines que no son los suyos, ya que el argumento del diseño inteligente, aunque basado en observaciones de la naturaleza, es básicamente un argumento de carácter filosófico más que científico. La particular situación de la sociedad americana ha hecho que el debate en torno al Diseño Inteligente y su posible inclusión en


CAPITULO 12

174

5/12/06

07:22

Página 174

Los genes en las poblaciones

las escuelas (en las asignaturas de ciencias naturales) sea especialmente agrio y haya llegado a las instancias políticas del país. Por suerte, los círculos científicos son cada vez más conscientes de la magnitud del problema, y estamos asistiendo a grandes avances en todo lo que rodea a las relaciones entre conocimiento científico y convicciones filosóficas personales. En la Figura 12.6 se puede leer un artículo de opinión acerca de las relaciones entre ciencia y fe.

En este sentido, un editorial de la revista Nature en abril de 2005 decía: …scientists would do better to offer some constructive thoughts of their own. For religious scientists, this may involve taking the time to talk to students about how they personally reconcile their beliefs with their research. Secular researchers should talk to others in order to understand how faiths have come to terms with science. All scientists whose classes are faced with such concerns should familiarize themselves with some basic arguments as to why evolution, cosmology and geology are not competing with religion. When they walk into the lecture hall, they should be prepared to talk about what science can and cannot do, and how it fits in with different religious belief s». Estas frases indican ciertamente una nueva sensibilidad hacia las creencias religiosas de los científicos, y un intento de mantener las conclusiones de las ciencias experimentales dentro del ámbito que les es propio. Un magnífico ejemplo reciente en el que se pone en práctica el consejo del párrafo citado, es la publicación de The language of God: a scientist present s evidence for belief, escrito por Francis Collins. El autor es un genetista de gran reputación, por haber identificado el gen responsable de la fibrosis quística y por haber dirigido el Proyecto Genoma Humano. En este libro, Collins describe su trayectoria intelectual personal hacia la fe en un Dios personal origen del Universo, creador también del mecanismo evolutivo para generar diversidad. Además, en Internet se pueden encontrar varios sitios de asociaciones de científicos cristianos, como la American Scientific Affiliation (www.asa3.org) o Christians in Science (www.cis.org.uk), que ilustran muy bien cómo el conocimiento científico y las creencias religiosas de los individuos ofrecen dos visiones del mundo que no son opuestas, sino que se armonizan y complementan mutuamente.

www.FreeLibros.me


CAPITULO 13

5/12/06

07:23

Pรกgina 175

www.FreeLibros.me


CAPITULO 13

5/12/06

07:23

Página 175

D) Patología genética

Consta de ocho temas en los que se aborda el núcleo principal de esta asignatura: los mecanismos genéticos de las enfermedades, el diagnóstico de las alteraciones genéticas y el cálculo de los riesgos de transmisión a la descendencia.

www.FreeLibros.me


CAPITULO 13

5/12/06

07:23

Página 177

CAPÍTULO 13

Citogenética

Contenidos 13.1 El estudio de los cromosomas humanos 13.2 Anomalías del número de los cromosomas 13.3 El fenómeno de no disyunción meiótica 13.4 Anomalías estructurales de los cromosomas

13.1 El estudio de los cromosomas humanos La citogenética constitucional se ocupa del análisis de los cromosomas en células que representan la línea germinal del individuo (habitualmente linfocitos de sangre periférica), y se llama así para distinguirla de los estudios citogenéticos sobre poblaciones celulares concretas que no representan la constitución genética de todo el individuo (células somáticas, por ejemplo las células de un tumor). La citogenética constitucional refleja, por tanto, la estructura cromosómica que ha sido heredada y que, a su vez, se transmitirá a la descendencia. La citogenética clásica se basa en la creación y análisis del cariotipo, que es la presentación ordenada de los cromosomas cuando se hacen visibles en metafase. Hasta los años 50 se creía que los humanos teníamos 48 cromosomas y que el sexo dependía del número de cromosomas X, como sucede en Drosophila. En 1956 se determinó el número exacto de cromosomas de la especia humana, y en 1959 ya se habían identificado las anomalías cromosómicas características de los Síndromes de Down, Turner y Klinefelter. Esto se debió a mejoras técnicas que permitieron cultivar leucocitos de sangre periférica (estimulando el crecimiento en cultivo con fitohemaglutinina y mitógenos), detener el ciclo celular específicamente en metafase (utilizando sustancias como colchicina) y realizar tinciones específicas del ADN. En 1968 Caspersson introdujo las bandas Q, y en 1971 se introdujeron las bandas G, que es el método más utilizado para generar cariotipos.

www.FreeLibros.me


CAPITULO 13

178

5/12/06

07:23

Página 178

Citogenética

El método habitual de cariotipado incluye la adición de un mitógeno (habitualmente fitohemaglutinina) a una suspensión de linfocitos, tras lo cual se cultivan las células durante 48-72 horas; cuando hay suficiente número de células, se detiene el ciclo celular en mitosis utilizando colchicina, de modo que todas las células se habrán parado en metafase (momento en que los cromosomas se hacen visibles). El tratamiento con una solución hipotónica rompe las células y separa los cromosomas, tras lo cual se procede a la fijación de la muestra. A continuación se aplican distintas tinciones, que producen patrones de bandas característicos en los distintos cromosomas. En el método de bandas Q, el primero en aparecer históricamente, los cromosomas se tiñen con un colorante fluorescente con afinidad por regiones ricas en adeninas y timinas, lo cual produce unas bandas características en los cromosomas cuando se observan con luz ultravioleta. El método de bandas G consiste en someter las preparaciones a una digestión suave con tripsina antes de teñirlas con Giemsa, un colorante con afinidad por el ADN; cuando se analizan las preparaciones al microscopio de luz, se observan unas bandas oscuras (bandas G) separadas por unas bandas claras. Para teñir los cromosomas según el método de bandas R se someten las preparaciones a un tratamiento de calor en solución salina antes de la tinción con Giemsa, lo cual produce un patrón de bandas claras y oscuras que es justamente el inverso al que se obtiene con el método de bandas G. Esto es así porque el tratamiento por calor hace que se desnaturalicen las regiones ricas en adeninas y timinas, por lo que las bandas R oscuras corresponden a las bandas G claras. El método de bandas C se utiliza para teñir la heterocromatina constitutiva (centrómeros), y consiste en la tinción con Giemsa tras la desnaturalización en una solución saturada de hidróxido de bario. En conjunto, utilizando estos métodos, y otros que son menos utilizados, se pueden ver cuatro tipos principales de estructuras:

• • • •

Bandas de heterocromatina constitutiva (bandas C) que corresponden a las regiones que permanecen condensadas durante la interfase. Bandas de eucromatina, formando un patrón de bandas claras y oscuras alternas a lo largo de todo el cromosoma; se ven como bandas G, R o Q. Regiones organizadoras del nucleolo, correspondientes a las regiones cromosómicas donde residen los genes del ARN ribosomal; se tiñen con una tinción especial de plata. Quinetocoros, las estructuras centroméricas que aparecen en mitosis y meiosis a las que se unen los microtúbulos del huso; se tiñen con tinciones especiales que usan anticuerpos específicos.

Los patrones de bandas G que definen cada cromosoma humano se publican periódicamente en el International System for Cytogenetics Nomenclature (ISCN), mostrando distintas resoluciones: desde 350-550 bandas por cariotipo cuando se estudian células en metafase, hasta 850 bandas por cariotipo cuando se analizan células en prometafase. Los cromosomas (22 pares de autosomas más los cromosomas sexuales X e Y) se ordenan en parejas de cromosomas homólogos, cada uno de los cuales tiene a su vez las dos cromátides que resultan de la replicación del ADN en la fase S previa, aunque en ocasiones las dos cromátides están pegadas y no se distinguen al microscopio. La forma de ordenar los cromosomas responde a un convenio (París,

www.FreeLibros.me


CAPITULO 13

5/12/06

07:23

Página 179

La Figura 13.1 explica la nomenclatura de las regiones y bandas cromosómicas, y muestra un ejemplo de cariotipo convencional con bandas G.

Además de las técnicas convencionales de bandeo, hoy contamos con una serie de técnicas que se engloban bajo una nueva disciplina llamada Citogenética Molecular, que combina la citogenética clásica con la hibridación específica de sondas marcadas con fluorocromos (FISH = Fluorescence In Situ Hybridisation). La técnica de FISH, muy utilizada hoy en día, consiste en la hibridación de sondas específicas con cromosomas metafásicos, que previamente han desnaturalizados como en cualquier reacción de hibridación. Aunque inicialmente se utilizaban preparaciones de metafases, también se puede hacer FISH directamente en núcleos interfásicos, lo que permite detectar anomalías numéricas o estructurales específicas (utilizando sondas específicas) incluso en poblaciones celulares que no pueden dividirse o que no producen buenas metafases (células fijadas e incluídas en parafina, por ejemplo). Algunas variantes de la técnica de FISH incluyen el llamado pintado cromosómico (painting), que permite resaltar un cromosoma concreto, incluyendo los fragmentos del mismo que se hayan translocado a otras posiciones. Igualmente, la técnica de SKY (Spectral Karyotyping) consiste en el pintado de cada cromosoma con un color distinto, gracias a combinaciones de fluorocromos y técnicas interferométricas en la detección de la fluorescencia emitida. A pesar de su complejidad y alto coste, el SKYFISH es una técnica valiosísima para detectar pequeñas alteraciones cromosómicas que, de otra forma, pasarían totalmente desapercibidas. Otra variante es la técnica de CGH (Comparative Genomic Hybridisation, Hibridación Genómica Comparativa), que permite detectar ganancias o pérdidas de material genético en un ADN prueba cuando se compara con un ADN de referencia, y es muy utilizada en la búsqueda de regiones cromosómicas amplificadas o delecionadas en tumores. Los vídeos de la Figura 13.2 muestran distintos ejemplos de técnicas de citogenética molecular.

El ISCN también es responsable de unificar la nomenclatura para la descripción de cariotipos normales o alterados. Las reglas básicas más importantes que hay que conocer son las siguientes:

Se especifica en primer lugar el número total de cromosomas, seguido de los cromosomas sexuales y, si las hay, las alteraciones que se encuentren. Estos

www.FreeLibros.me

179

El estudio de los cromosomas humanos

1971) y se lleva a cabo teniendo en cuenta el tamaño del cromosoma y la posición del centrómero, asignando a cada uno un brazo corto (p) y un brazo largo (q). Así se pueden distinguir cromosomas metacéntricos (ambos brazos de la misma longitud), submetacéntricos (con el brazo p más corto que el brazo q) o acrocéntricos (cuyo brazo corto está formado por ADN satélite con ADN ribosomal en el centro). Así, el cromosoma 1 es el de mayor tamaño, y el cromosoma 21 el más pequeño. Teniendo en cuenta todas estas características, el cariotipo humano se divide en varios grupos (que van del grupo A hasta el grupo G), con los cromosomas sexuales X e Y formando un grupo aparte.


CAPITULO 13

5/12/06

180

Citogenética

• •

07:23

Página 180

datos van separados por comas, sin espacios antes ni después de la coma. Por ejemplo, el cariotipo de un varón normal se expresaría como «46,XY». Los individuos denominados «mosaicos» (es decir, aquellos que tienen dos o más constituciones cromosómicas distintas) se describen separando cada constitución cromosómica por una barra «/». Las alteraciones que estudiaremos en este capítulo se describen utilizando abreviaturas apropiadas. Por ejemplo, «del» significa deleción, «dup» duplicación, «inv» inversión, «ins» inserción, «t» translocación, «i» isocromosoma, «r» cromosoma en anillo. Después de cada una de estas alteraciones se indican los cromosomas implicados (entre paréntesis) y a continuación las regiones implicadas (en otro paréntesis distinto). Las ganancias o pérdidas de cromosoma completos se indican con el signo + o – antes del número correspondiente al cromosoma implicado.

13.2 Anomalías del número de los cromosomas Las anomalías cromosómicas (cromosomopatías) son un tipo muy importante de patología genética. Los fenotipos provocados por las anomalías cromosómicas son muy variables, pero podemos describir algunas características generales que se cumplen en casi todos:

• • •

Se asocian a retraso en el desarrollo y retraso mental, frecuentemente con talla baja. Se asocian con alteraciones faciales y otras anomalías menores de cabeza y cuello. Se asocian a determinadas malformaciones congénitas (defectos cardíacos, malformaciones en manos y pies, etc.), que suelen seguir un patrón específico de cada síndrome.

Clásicamente las anomalías cromosómicas se dividen en dos grandes grupos: aquellas debidas a un número anormal de cromosomas (anomalías numéricas) y las debidas a alteraciones en la estructura de los cromosomas (anomalías estructurales). Por lo que respecta a las anomalías numéricas, en conjunto tienen una frecuencia en torno al 0,5 por ciento de nacidos vivos (1/200). A continuación se detalla la frecuencia de las anomalías numéricas más frecuentes: Frecuencia de anomalías cromosómicas numéricas (por 1 000 nacidos vivos): trisomía 21 trisomía 18 trisomía 13 XXY 45,X XYY

1,5 0,12 0,07 1,5 0,4 1,5

www.FreeLibros.me


CAPITULO 13

5/12/06

07:23

Página 181

Las anomalías numéricas pueden ser de dos tipos:

Aneuploidías: son alteraciones numéricas que no afectan a todo el complemento cromosómico, sino solamente a un par cromosómico. En ocasiones, la alteración no afecta a todo el cromosoma, sino sólo a un segmento cromosómico, en cuyo caso suelen denominarse aneusomías segmentarias. Las aneuploidías son alteraciones con distintos grados de severidad en cuanto a los fenotipos que provocan, aunque en general se puede decir que son más graves cuando afectan a un autosoma que a un cromosoma sexual, y que son más severas las pérdidas de cromosomas (monosomías) que las ganancias de cromosomas (trisomías). La ausencia completa de un par cromosómico (nulisomía) es incompatible con la vida. A continuación veremos algunas de las aneuploidías más frecuentes en patología humana:

Trisomía 21 (47,XX o XY,+21), Síndrome de Down. Es la causa más común de retraso mental congénito. Presentan una facies característica (en la que destacan las fisuras palpebrales oblicuas, hipoplasia de la nariz y macroglosia), estatura baja, defectos cardíacos y retraso mental variable. Algunos casos son mosaicos 46,XX/47,XX, ↓+21 (tienen dos poblaciones celulares, una con la trisomía y otra normal) y son clínicamente más leves. Alrededor de un cinco por ciento de los casos de Síndrome de Down se deben a una translocación robertsoniana entre los cromosomas acrocéntricos 14 y 21. El resto de los casos –la gran mayoría– son debidos a no-disyunción durante la gametogénesis, de los cuales el 75 por ciento son no-disyunciones en meiosis I. Por las razones que se explicarán más adelante, existe una mayor incidencia de Síndrome de Down en mujeres de edad más avanzada. Así, aunque la incidencia global de la enfermedad es de uno por ciento por cada 650 nacidos vivos, las tasas de incidencia desglosada por tramos de edad materna muestran una clara tendencia, sobre todo a partir de los 30 años de edad:

www.FreeLibros.me

Anomalías del número de los cromosomas

Euploidías: constituciones cromosómicas con un número total de cromosomas que es múltiplo del número haploide (23 en humanos). Si un cariotipo normal es diploide (46 cromosomas, 2n), es posible encontrar anomalías numéricas debidas a la presencia de otros múltiplos del número haploide: tri-ploidías (3n, 69 cromosomas), tetra-ploidías (4n, 92 cromosomas), etc. La nomenclatura aprobada de estos transtornos consiste en especificar el número total de cromosomas seguido de coma (sin espacios) y el conjunto de cromosomas sexuales. Por ejemplo, una triploidía en una mujer se representaría como 69,XXX. La triploidía es el tipo más frecuente de poliploidía (se estima que un 2 por ciento de todas las concepciones son triploides), pero la gran mayoría son letales y son muy raras en nacidos vivos. Las causas más frecuentes son la dispermia (fecundación de un óvulo por dos espermatozoides), la fusión de un óvulo con un cuerpo polar (diginia), o un error meiótico en la gametogénesis que dé lugar a un gameto diploide. La tetraploidía (4n) aparece normalmente en las células somáticas de algunos tejidos, y es el resultado de una reduplicación endomitótica, en la que hay dos duplicaciones cromosómicas con una sola división celular.

181


CAPITULO 13

5/12/06

182

Citogenética

07:23

Página 182

Edad materna

Riesgo de S. de Down

15 20 25 30 35 40

1:1578 1:1528 1:1351 1:909 1:384 1:112

El riesgo de recurrencia de la enfermedad en una pareja joven (la probabilidad de tener un segundo hijo con Síndrome de Down) está en torno al uno por ciento. No hay suficiente información sobre el riesgo de transmisión de la enfermedad en individuos que son mosaicos. La Figura 13.3 muestra el cariotipo de un Síndrome de Down.

• • •

Recientemente se ha visto, en un modelo murino, que el funcionamiento de una familia de factores de transcripción llamados NFATc (Nuclear Factor of Activated T cells) es muy importante en el desarrollo de esta enfermedad. Estos factores de transcripción regulan la expresión de genes durante el desarrollo, y viajan del núcleo al citoplasma (y viceversa) mediante una fosforilación que es regulada por dos genes que están en el cromosoma 21, en la región crítica que causa el Síndrome de Down. En presencia de un número alto de copias de estos genes, los NFAT no funcionan adecuadamente y sus genes diana se expresan débilmente, lo que podría causar algunas de las manifestaciones fenotípicas de la enfermedad. Trisomía 18 (47,XX o XY,+18), Síndrome de Edwards. La prevalencia de esta aneuploidía es de 1/6 000 nacidos vivos. Es la anomalía cromosómica que se encuentra más frecuentemente en abortos espontáneos. Muy pocos casos sobreviven el primer año de vida. Trisomía 13 (47,XX o XY,+13), Síndrome de Patau. Tiene una prevalencia de 1/10 000 nacidos vivos. Son rasgos característicos de esta enfermedad las fisuras orofaciales, polidactilia y microftalmia. El 90 por ciento de los nacidos vivos fallecen en el primer año de vida. Monosomía X (45,X), Síndrome de Turner. Los pacientes con S. de Turner sólo tienen un solo cromosoma X (es la única monosomía viable en humanos). La frecuencia de la enfermedad es 1/5 000 niñas recién nacidas. Las enfermas son fenotípicamente mujeres, siendo sus características más comunes la talla corta, malformaciones (cuello corto, pecho en coraza) e inmadurez sexual por disgenesia gonadal. No suele estar asociado a retraso mental. Se piensa que esta enfermedad se debe que el cromosoma X contiene genes que escapan a la inactivación fisiológica de uno de los cromosomas X, y que por tanto se necesitan las dos copias para un correcto funcionamiento celular. Al existir un solo cromosoma X en los sujetos con S. de Turner, estos genes estarían en dosis génica mitad de la normal (una sola copia), originando las alteraciones propias de la enfermedad. También existen individuos con S. de

www.FreeLibros.me


CAPITULO 13

5/12/06

Página 183

Turner que son mosaicos 46,XX/45,X o tienen anomalías estructurales del cromosoma X (como el isocromosoma del brazo largo). Los individuos con esta enfermedad suelen padecer abortos espontáneos. Síndrome de Klinefelter, 47,XXY. Esta aneuploidía se encuentra con una frecuencia de 1/1 000 nacidos varones. Son individuos con talla alta, hipogonadismo y ginecomastia, inteligencia ligeramente inferior a lo normal. Hasta un 15 por ciento de los enfermos muestran mosaicismo. De los raros casos de enfermos con S. de Klinefelter que tienen cariotipos 48,XXXY y 49,XXXXY se deduce que a mayor número de cromosomas X «extra», la gravedad de la enfermedad y el retraso mental son también mayores.

13.3 El fenómeno de no disyunción meiótica Se estima que hasta un cinco por ciento de todas las concepciones humanas son aneuploides, aunque la gran mayoría de éstas terminan en abortos espontáneos y no se reconocen clínicamente. La incidencia de aneuploidías varía según el periodo gestacional, tal y como se muestra en la siguiente tabla: Frecuencia de anomalías cromosómicas en: Mortinatos (20 a 40 semanas de gestación): Abortos espontáneos detectables clínicamente (7 a 8 semanas de gestación): Abortos espontáneos NO detectables clínicamente (antes de 7 semanas):

4% 35 % 20 %

También se ha visto que hasta un 20 por ciento de los oocitos humanos son portadores de aneuploidías, mientras que sólo el uno-dos por ciento de los espermatozoides tienen alteraciones en el número de cromosomas. De estos datos se concluye que la segregación de cromosomas durante la meiosis —especialmente durante la oogénesis— es un proceso que no se lleva a cabo de modo totalmente eficaz en humanos. La segregación cromosómica incorrecta origina alteraciones cromosómicas en el embrión, pero la mayoría de estos embarazos se pierden porque esas alteraciones son letales en estadíos iniciales del desarrollo embrionario. Como se recordará, los cromosomas homólogos y las cromátides hermanas se separan en cada una de las dos divisiones que tienen lugar durante la meiosis. Las aneuploidías se producen por una separación incorrecta (no-disyunción) en una de las dos divisiones meióticas, aunque lo más frecuente es la falta de disyunción en meiosis I por la presencia de un sobrecruzamiento mal posicionado. Se ha visto en el Capítulo 2 que una gonia diploide da lugar a cuatro gametos haploides ya que, tras la replicación del ADN en el gonocito primario, la primera división meiótica genera células con un solo cromosoma de cada par (aunque cada uno tiene todavía dos cromátides hermanas); la segunda división meiótica separa las cromátides hermanas a cada uno de los gametos. Teniendo este esquema en mente, es fácil comprender que los efectos de una no-disyunción en la meiosis I serán distintos a los efectos de una no-disyunción en la meiosis II. Si la no-disyunción ha tenido lugar en meiosis I, se producirán dos gametos nulisómicos (sin ninguna copia de ese cromosoma) y dos gametos

www.FreeLibros.me

183

El fenómeno de no disyunción meiótica

07:23


CAPITULO 13

184

5/12/06

07:23

Página 184

Citogenética

disómicos (con dos copias), los cuales llevarán una copia de cada cromosoma homólogo presente en la célula progenitora (es decir, son heterodisómicos). Por el contrario, si la no-disyunción sucede en la meiosis II, tendremos dos gametos normales, un gameto nulisómico y un gameto disómico con dos copias idénticas (isodisómico).

No disyunción en Meiosis I

No-disyunción en Meiosis II

El vídeo de la Figura 13.4 muestra los tipos de gametos resultantes de la no-disyunción en meiosis I o en meiosis II.

Como se ha mencionado más arriba, está comprobado que la mayoría de los errores de disyunción tienen lugar durante la oogénesis, especialmente en meiosis I. Esto se ha relacionado con el hecho de que la gametogénesis femenina –al contrario de lo que sucede en la espermatogénesis– experimenta una meiosis I especialmente larga (comienza en el periodo fetal y culmina individualmente con cada ovulación, entre 15 y 45 años después). Este hecho podría aumentar la sensibilidad del oocito a sufrir no-disyunciones. Estudios recientes muestran que la aparición de no-disyunciones tiene que ver con la posición de los quiasmas durante la recombinación, de modo que los quiasmas que están demasiado cerca de los centrómeros o de los telómeros favorecen los errores en la separación de los cromosomas homólogos. Actualmente se piensa que la maquinaria que procesa los quiasmas va perdiendo eficacia con los años, por lo que los oocitos con quiasmas en localizaciones «subóptimas» originan errores de disyunción con mayor facilidad en oocitos «viejos» que en oocitos «jóvenes». Esto encaja bien con el hecho de que las aneuploidías son más frecuentes al aumentar la edad materna. Respecto a las causas moleculares de la no-disyunción, es razonable pensar que la des-regulación de los procesos de recombinación, cohesión y separación de cromátides sea responsable, en buena medida, de la segregación deficiente de los cromosomas a las células hijas. Como se recordará, durante la meiosis I cada pare-

www.FreeLibros.me


CAPITULO 13

5/12/06

07:23

Página 185

13.4 Anomalías estructurales de los cromosomas Existen muchos posibles tipos de alteraciones en la estructura de los cromosomas. Si la alteración da lugar a la pérdida o ganancia de material genético, se habla de alteraciones desequilibradas; en el caso contrario, se denominan equilibradas. Las alteraciones equilibradas no suelen producir patología en el individuo que las lleva, aunque determinadas alteraciones equilibradas pueden favorecer la formación de aneuploidías en la descendencia, como se verá más adelante. Se piensa que las alteraciones estructurales se producen por errores durante la meiosis, bien porque los cromosomas homólogos no se alinean correctamente o bien porque se produce emparejamiento entre secuencias homólogas que pertenecen a cromosomas distintos. La recombinación entre cromosomas que no están correctamente alineados o entre cromosomas que no son homólogos tiene como resultado la generación de duplicaciones, deleciones, inversiones, translocaciones, isocromosomas o cromosomas en anillo. La Figura 13.5 muestra distintos tipos de anomalías cromosómicas estructurales.

Las inversiones son alteraciones estructurales intracromosómicas debidas a la aparición de dos roturas dentro de un mismo cromosoma y la inversión completa del segmento que queda entre ellas. Hay básicamente dos tipos de inversiones: pericéntricas (el centrómero del cromosoma queda incluido dentro de la región invertida) o paracéntricas (la región invertida está en uno de los brazos cromosómi-

www.FreeLibros.me

185

Anomalías estructurales de los cromosomas

ja de quinetocoros hermanos es arrastrada hacia un extremo del huso; si ha habido un sobrecruzamiento, la cohesión debida a la presencia de los quiasmas se opondrá a la fuerza de los microtúbulos que tienden a separar los dos cromosomas homólogos. Por tanto, es fundamental que la cohesión entre cromosomas homólogos se mantenga a nivel de los centrómeros mientras los homólogos se separan, para que las cromátides se mantengan unidas hasta la llegada de la meiosis II. En el Capítulo 2 se han esbozado los mecanismos moleculares que regulan estos procesos, por lo que la alteración de cualquiera de las proteínas implicadas puede provocar la aparición de aneuploidías. Esto se ha visto corroborado por la detección de alteraciones en estos mecanismos en cáncer, que en la mayoría de los casos se asocia con aneuploidías muy marcadas. Se ha visto, por ejemplo, que en tumores colorrectales aneuploides hay mutaciones en el gen BUB1, que codifica una proteína del complejo proteico que regula la cohesión en los quinetocoros. Además, se ha demostrado que una securina denominada PTTG (pituitary tumour transforming gene) tiene propiedades de oncogén: muestra niveles altos de expresión en tumores pituitarios y es un factor de mal pronóstico en cáncer de colon, ya que los niveles de PTTG correlacionan con la invasividad del tumor. Todo esto pone de manifiesto que los genes implicados en los mecanismos que regulan la segregación de cromátides hermanas durante la división celular son muy importantes para mantener una correcta segregación cromosómica durante la mitosis, y es lógico pensar que lo mismo se puede aplicar a la meiosis.


CAPITULO 13

186

5/12/06

07:23

Página 186

Citogenética

cos, sin incluir el centrómero). Habitualmente, las inversiones son equilibradas. Sin embargo, pueden originar problemas cuando se forman los bivalentes entre cromosomas homólogos durante la recombinación en meosis: al formarse el bivalente, el cromosoma con la inversión puede formar un bucle para que todas las regiones queden alineadas con las correspondientes secuencias del cromosoma homólogo. Si tiene lugar un sobrecruzamiento dentro del bucle de una inversión paracéntrica, se originará un cromosoma acéntrico (sin centrómero) y otro dicéntrico (con dos centrómeros). En anafase, cada centrómero del cromosoma dicéntrico migrará hacia cada uno de los polos, formándose un puente que se romperá al final de anafase. El resultado será la generación de gametos con diversas deleciones y/o duplicaciones, dependiendo del punto donde se rompa el puente anafásico. En cambio, si el sobrecruzamiento se produce dentro de una inversión pericéntrica, los dos cromosomas resultantes llevarán un solo centrómero pero tendrán duplicada o delecionada la región distal a los límites de la inversión. Por tanto, aunque un individuo portador de una inversión sea fenotípicamente normal, es importante recordar que en su descendencia pueden aparecer individuos con reordenaciones des-equilibradas (deleciones o duplicaciones), aunque no es posible calcular la probabilidad de que esto suceda. La Figura 13.6 contiene un vídeo en el que se muestran esquemáticamente los tipos de gametos que se generan por una recombinación entre cromosomas homólogos, cuando uno de ellos lleva una inversión.

Los isocromosomas son cromosomas en los que ambos brazos son idénticos, y se originan por la pérdida total de uno de los brazos y la duplicación del otro brazo; el resultado final es un cromosoma simétrico. Los isocromosomas de cromosomas autosómicos son habitualmente letales; el isocromosoma más frecuente en humanos es el del cromosoma X, que aparece en algunos sujetos con Síndrome de Turner dando lugar a cariotipos 46,X,i(Xq). Las deleciones pueden ser terminales (afectan a la región terminal o telomérica de un cromosoma) o intersticiales. Si son lo suficientemente grandes como para ser visibles citogenéticamente suelen ser graves. Por ejemplo, la deleción denominada 46,XY,del(5p), en la que se pierde un fragmento terminal del brazo corto del cromosoma 5, es causa del Síndrome de cri-du-chat (maullido de gato); la deleción terminal 46,XY,del(4p) da lugar al Síndrome de Wolf-Hirschhorn. Desde que se ha utilizado la técnica de FISH, se ha conseguido delimitar mejor las deleciones cromosómicas, e incluso se ha podido identificar algunos síndromes debidos a deleciones que no eran visibles por citogenética convencional (cariotipo de bandas G). Por esta razón, estas enfermedades se denominan «Síndromes por Microdeleción», aunque también se les llama aneusomías segmentarias o síndromes de genes contiguos (ya que en las pequeñas deleciones se pierden habitualmente varios genes). La siguiente tabla recoge algunos de los principales síndromes por microdeleción, indicando la región delecionada y el gen (o genes) implicados en esas deleciones:

www.FreeLibros.me


CAPITULO 13

5/12/06

07:23

Página 187

Síndrome

Deleción (genes) 4p16.3 7q11.23 (elastina) 11p13 (WT1 y PAX6) 15q11-q13 16p13.3 (CBP) 17p13.3 (LIS1) 17p11.2 (KER) 20p12.1-p11.23 (Jagged1) 22q11.21-q11.23

Las translocaciones consisten en el intercambio de fragmentos cromosómicos entre cromosomas no homólogos. Hablamos de translocaciones recíprocas cuando ambos cromosomas son donantes y receptores de material cromosómico, de modo que parte de un cromosoma pasa a otro y, a su vez, parte de éste pasa al primero. Las translocaciones recíprocas desequilibradas, en las que se ha perdido o ganado material genético durante el proceso de formación de la translocación, son habitualmente causa de enfermedad. Por el contrario, las translocaciones equilibradas no son necesariamente patogénicas, a no ser que los puntos de rotura en alguno de los cromosomas interrumpan algún gen concreto. En cambio, un individuo portador de una translocación recíproca equilibrada puede tener descendencia con alteraciones cromosómicas estructurales. Esto se debe a que, durante la meiosis, los cromosomas translocados se alinean con los dos cromosomas normales respectivos, dando lugar a la formación de un tetravalente en vez de un bivalente. La segregación de los cromosomas del cuadrivalente a cada gameto puede realizarse según un patrón adyacente o alternante: mientras la segregación alternante puede generar gametos normales o equilibrados, la segregación adyacente da lugar a gametos nulisómicos o disómicos, que causarán monosomías o trisomías en el embrión. La Figura 13.7 explica la segregación de cromosomas con una translocación recíproca equilibrada.

Otro tipo importante de translocación son las llamadas translocaciones Robertsonianas (también denominadas «fusión céntrica»), en las que dos cromosomas acrocéntricos se fusionan por sus centrómeros. Al igual que en las translocaciones equilibradas, los individuos portadores de una translocación robertsoniana no suelen padecer ninguna patología, ya que llevan dos copias completas de cada uno de los cromosomas implicados (la copia normal más la copia presente en el cromosoma con la translocación). En cambio, en la descendencia sí que pueden aparecer monosomías o trisomías de los segmentos implicados. Esto se debe a que durante la meiosis el cromosoma con la fusión céntrica se apareará con los dos cromosomas homólogos correspondientes, formando un trivalente en vez de un bivalente. El resultado de esta estructura, dependiendo de cómo sea la segregación, será la formación de gametos normales (segregación alternante) o de gametos nulisómicos o disómicos (segregaciones adyacentes), que a su vez provocarán monosomías o disomías en la descendencia. En la Figura 13.8 se muestra la segregación de cromosomas con una translocación robertsoniana.

www.FreeLibros.me

Anomalías estructurales de los cromosomas

Wolf-Hirschhorn Williams-Beuren WAGR (Wilms, aniridia, genital defects, growth retardation) Prader-Willi/Angelman Rubinstein-Taybi Miller-Diecker lisencefalia Smith-Magenis Alagille DiGeorge (CATCH22)

187


CAPITULO 13

5/12/06

07:23

Pรกgina 187

www.FreeLibros.me


CAPITULO 14

5/12/06

07:25

Página 189

CAPÍTULO 14

Mutaciones simples como causa de enfermedad

Contenidos 14.1 Características generales de las mutaciones 14.2 Mutaciones simples: tipos y nomenclatura 14.3 Potencial patogénico de las mutaciones en el ADN codificante y en el ADN no-codificante intragénico e intergénico 14.4 Potencial patogénico de las mutaciones en el ADN no-codificante

14.1 Características generales de las mutaciones Ya se ha mencionado que el genoma humano está sujeto a variación genética y que esta capacidad de introducir modificaciones genéticas heredables supone una ventaja para la especie, al permitir la adaptación a condiciones ambientales cambiantes. Sin embargo, la existencia de una tasa mutacional basal tiene el peligro de introducir cambios genéticos deletéreos en un individuo o una familia concreta, provocando enfermedades heredables. Por tanto, de modo general podemos decir que la presencia de mutaciones en una población está sujeta al juego entre la tasa mutacional basal (la velocidad a la que se producen) y la presión selectiva frente a cada una de las mutaciones, de forma que aquellas mutaciones que sean muy agresivas no se extenderán al resto de la población tan rápidamente como mutaciones con efectos fenotípicos más leves. Por ejemplo, ya hemos visto en otro capítulo que las aberraciones cromosómicas (trisomías, monosomías, etc.) son raras pero casi siempre patogénicas, mientras que los polimorfismos de secuencia —variantes alélicas que no causan ninguna enfermedad— son mucho más frecuentes. En cierto modo, lo mismo sucede con los distintos tipos de mutaciones: aquellas que provocan alteraciones graves del producto proteico, que están sometidas a una fuerte presión selectiva en su contra, suelen ser menos frecuentes que mutaciones con efectos más leves.

www.FreeLibros.me


CAPITULO 14

190

5/12/06

07:25

Página 190

Mutaciones simples como causa de enfermedad

Antes de estudiar todos los posibles tipos de mutaciones, será de gran utilidad recordar la estructura y procesamiento de un gen típico, porque esto nos ayudará a comprender cómo se clasifican y sus efectos. Recordemos que en el ADN genómico se puede distinguir una región 5’ no-traducida (desde el inicio de la transcripción hasta el ATG que señala el inicio de la traducción), exones separados por intrones (que contienen las secuencias consenso de ayuste GT-AG), el codón de terminación (TAA en la figura) y la región 3’ no traducida, que incluye la señal de poliadenilación (AATAAA). La transcripción del gen y la posterior maduración del transcrito primario dan como resultado el ARNm maduro, que después es traducido en la proteína correspondiente. En general, los distintos tipos de mutaciones que se encuentran en un gen pueden ser tanto mutaciones simples (deleciones, inserciones o substituciones que afectan a un nucleótido o a unas pocas bases) o reordenamientos grandes (deleciones parciales o reordenamientos que dan lugar a duplicaciones o deleciones del gen). En la Figura 14.1 se muestran esquemáticamente los distintos tipos de mutaciones que se pueden encontrar en un gen, y cómo afectan a su función.

A lo largo de este capítulo, veremos con detalle los distintos tipos de mutaciones que provocan enfermedades humanas.

14.2 Mutaciones simples: tipos y nomenclatura Las substituciones simples de un nucleótido por otro se denominan transiciones o transversiones, según provoquen el cambio de purina por purina o pirimidina por pirimidina (transiciones), o el cambio de una purina por pirimidina o viceversa (transversiones). En el esquema adjunto, las transiciones se representan por flechas T G grises y las transversiones por flechas negras. Como puede apreciarse, las transversiones deberían ser el doble de frecuentes que las transiciones (ocho posibles transversiones por cuatro posibles transiciones). En cambio, al analizar las mutaciones presentes en enfermedades humanas encontramos que las transiciones son más frecuentes. Esto es debido a que —en general— las transiciones provocan una alteración menos severa del producto proteico, por lo que la presión selectiva contra ellas es menor. Además, el dinucleótido CpG suele estar metilado en la citosina, y la des-aminación espontánea de una metil-citosina da lugar a una transición del tipo C→T. Como este cambio tiene lugar con relativa frecuencia en el genoma de mamíferos, esto también contribuye a la alta frecuencia de transiciones que se observa en estas especies.

A

C

14.3 Potencial patogénico de las mutaciones en el ADN 14.3 codificante y en el ADN no-codificante intragénico 14.3 e intergénico Cuando las substituciones simples tienen lugar en ADN codificante, sus efectos pueden ser de varios tipos:

www.FreeLibros.me


CAPITULO 14

5/12/06

a)

Página 191

Substituciones silenciosas (llamadas sinónimas, sin cambio de sentido): no cambian ningún aminoácido en la proteína codificada, debido a que la mutación cambia un codón por otro codón sinónimo. Como son biológicamente neutras, no están sujetas a selección y por tanto son relativamente frecuentes en ADN codificante. Habitualmente se producen por cambios en la tercera base de un triplete, ya que es habitualmente este nucleótido el que varía entre codones sinónimos. Substituciones no-sinónimas (el cambio de nucleótidos origina un cambio en la capacidad codificante del ARNm). Según el cambio introducido, podemos distinguir:

Mutaciones con cambio de sentido (mis-sense, en inglés), cuando el cambio de nucleótidos provoca un cambio de aminoácidos. Se habla de cambio conservativo cuando ambos aminoácidos (el original y el nuevo) pertenecen al mismo grupos bioquímico, o no conservativo cuando pertenecen a grupo distintos. Estos últimos son —en general— más graves, puesto que alteran la estructura de la proteína en mayor grado. También son importantes los cambios que afectan a Cisteínas y Prolinas, que son aminoácidos muy importantes en el mantenimiento de la estructura terciaria de la proteína. Mutaciones sin sentido (non-sense), cuando un codón que codifica un aminoácido se convierte en un codón de parada (UAA, UAG o UGA). Estas mutaciones dan lugar a proteínas truncadas en la región C-terminal, además de disminuir la estabilidad del ARNm. En general son muy graves, por lo que son menos frecuentes que las mutaciones con cambio de sentido.

En la Figura 14.2 se muestran distintos tipos de mutaciones puntuales y su efecto sobre el producto proteico.

Mutaciones con ganancia de sentido, cuando la mutación transforma un codón de parada en un codón codificante. Son casos infrecuentes, entre los que destaca el de una variante de la hemoglobina denominada Hemoglobina Constant Spring (variante alélica HBA20001), originada por el cambio de UAA (codón de parada) a CAA. Esto tiene como resultado la adición de 30 aminoácidos a la secuencia de la hemoglobina alfa-2, que se hace más inestable y provoca una enfermedad de la sangre llamada alfa-talasemia.

En la Figura 14.3 se esquematiza la mutación que origina la hemoglobina Constant Spring.

c)

Deleciones e inserciones de uno o de unos pocos nucleótidos pueden introducir o eliminar aminoácidos sin cambiar la pauta de lectura, siempre que se trate de inserciones o deleciones de tres nucleótidos (o múltiplos de tres). Cuando se insertan o delecionan nucleótidos en un número que no es múltiplo de tres, se produce un frameshift (desplazamiento del marco de lectura)

www.FreeLibros.me

191

Potencial patogénico de las mutaciones en el ADN codificante y en el ADN no-codificante…

b)

07:25


CAPITULO 14

5/12/06

07:25

Página 192

con un cambio muy importante en la estructura proteica. Para comprender las mutaciones con cambio del marco de lectura, es importante repasar este concepto, ya presentado en el Capítulo 1.

192

Mutaciones simples como causa de enfermedad

En la Figura 14.4 se recuerda el concepto de marco de lectura (frameshift) y se muestra su desplazamiento por efecto de distintos tipos de inserciones.

LOS LOS LOS LOS

QUE QaU Qab Qab

VES EVE UEV cUE

SON SSO ESS VES

LOS NLO ONL SON

QUE SQU OSQ LOS

SON ESO UES QUE

... N.. ON. SON

FRAMESHIFT +1 FRAMESHIFT +2 INSERCIÓN 3bp

Al igual que las mutaciones sin sentido, las mutaciones con cambio del marco de lectura provocan alteraciones importantes del producto proteico y, por tanto, están sometidas a mayor presión selectiva, por lo que suelen ser menos frecuentes en ADN codificante que las mutaciones sinónimas. Además, los cambios del marco de lectura suelen introducir codones de parada prematuros, por lo que habitualmente se producen también proteínas truncadas que ven muy comprometida su funcionalidad. Otro mecanismo por el que puede perderse o recuperarse el marco de lectura es la edición del ARN, fenómeno que ya se explicó en el Capítulo 1. Una variedad curiosa de edición del ARN surge en unas ratas que tienen una deleción de un solo nucleótido en el gen de la vasopresina, haciendo que desarrollen hipertensión arterial. Estas ratas mejoran espontáneamente al envejecer, debido a un proceso de edición del ARNm mediante el cual se pierde el dinucleótido GA en un motivo GAGAG de ese mismo gen. La deleción de estos dos nucleótidos, añadida a la deleción de un nucleótido que ya tenían, hace que se recupere el marco de lectura original y que se produzcan mayores niveles de vasopresina funcional. Recientemente, se ha encontrado un motivo GAGAGA en el gen de la proteína precursora de amiloide-β (βAPP) y se ha visto que tiene lugar una edición similar, con deleción de dos bases en el ARNm y la interrupción del marco de lectura que produce una proteína truncada y es causa de algunos casos de enfermedad de Alzheimer en humanos.

14.4 Potencial patogénico de las mutaciones en el ADN 14.4 no-codificante Las mutaciones simples que tienen lugar en ADN no codificante intragénico (es decir, en intrones y regiones no traducidas) son silenciosas, excepto cuando afectan a las secuencias de consenso para ayuste (splicing) de los extremos 5’ y 3’ de los intrones. En este caso, podemos encontrar:

Mutaciones que destruyen una de las secuencias de consenso. Si esto tiene lugar en ausencia de secuencias de ayuste crípticas (escondidas) y en intrones pequeños, habitualmente se lee todo el intrón, que queda así incluido en el ARNm. Esto hace que se añadan aminoácidos a la proteína, aunque tam-

www.FreeLibros.me


5/12/06

Página 193

bién es posible que se introduzca un cambio en el marco de lectura y se altere toda la secuencia de aminoácidos a partir de ese punto. Si la mutación que destruye la secuencia de ayuste tiene lugar en presencia de una secuencia de ayuste críptica en ese mismo intrón, el exón vecino será más largo; por el contrario, si la secuencia críptica está en el exón cercano a la mutación, dicho exón será más corto. En ocasiones, las mutaciones que destruyen una de las secuencias consenso de ayuste hacen que se «salte» el exón adyacente (lo que en inglés se denomina skipping del exón), dando lugar a una proteína que ha perdido un cierto número de aminoácidos, aunque también es posible que produzca un cambio en el marco de lectura. El exón afectado será el 5’ o el 3’ a la mutación, según se destruya el GT o el AG de un intrón, respectivamente.

EXÓN 1

EXÓN 2

INTRÓN 1 GT

TTAGG

AG

Lugar críptico de ayuste (intrónico)

MUTACIÓN

EXÓN 2A GT

TTAG G…

…AG

En la Figura 14.5 se muestran distintas mutaciones que afectan a las secuencias consenso de ayuste.

Un caso especial de este tipo de mutaciones es la transición A → G en posición + 3 de la secuencia donante de ayuste, una alteración que está asociada con desarrollo de enfermedades en –al menos– ocho genes humanos. Como se recordará, la secuencia donante de ayuste (la del extremo 5’ del intrón) es complementaria a la secuencia del ARN nuclear pequeño U1 (U1snRNA), cuya presencia es necesaria para que se lleve a cabo el proceso de ayuste. Los dos primeros nucleótidos del intrón son siempre GT (complementarios a CA en el U1snRNA), y el tercer nucleótido de la secuencia de ayuste suele ser adenina (complementaria al uracilo correspondiente en el U1snRNA). En cambio, las posiciones + 4 a + 6 no siempre son perfectamente complementarias. De hecho, la adenina en posición +3 dota de cierta flexibilidad a los nucleótidos de las posiciones + 4 a + 6, que pueden ser dis-

www.FreeLibros.me

193

Potencial patogénico de las mutaciones en el ADN no-codificante

07:25

{

CAPITULO 14


CAPITULO 14

5/12/06

07:25

Página 194

cordantes de la secuencia del U1snRNA y aún así son capaces de funcionar correctamente como secuencia donante de ayuste. En cambio, si alguna de las posiciones + 4 a + 6 no son complementarias a la secuencia del U1snRNA, una mutación en la posición + 3 tiene como resultado la falta de funcionalidad de esta secuencia de ayuste, con lo que se salta el exon precedente.

194

Mutaciones simples como causa de enfermedad

La Figura 14.6 muestra una mutación de la posición +3, que provocará el skipping del exón 16 del gen COLQ.

Finalmente, existen mutaciones que, sin afectar directamente a secuencias consenso de ayuste, pueden activar un lugar críptico en un intrón y producir un exón más grande y posiblemente un cambio en el marco de lectura.

La Figura 14.7 muestra la creación de secuencias de ayuste crípticas intrónicas.

Como regla general, podemos afirmar que las mutaciones que afectan al mecanismo de ayuste son más raras que las substituciones, aunque algunos genes tienen una estructura exónica que les otorga una tendencia especial a sufrir mutaciones de este tipo: se trata, habitualmente, de genes con muchos intrones y con exones pequeños, como sucede con los genes que codifican cadenas del colágeno (COL7A1, por ejemplo, tiene 118 exones), o bien genes con muchos sitios crípticos de ayuste (como es el caso del gen de la beta-globina). Como se explicaba en el Capítulo 1, recientemente se ha descrito que ciertas secuencias exónicas o intrónicas pueden actuar como potenciadores o silenciadores del ayuste. Estas secuencias se denominan ESE (Exonic Splicing Enhancers) o ESS (Exonic Splicing Silencers) cuando están en exones; ISE o ISS cuando están en intrones. A estas secuencias se unen proteínas llamadas proteínas SR (las que se unen a los potenciadores de ayuste) o algunas hnRNP (las que se unen a los silenciadores). Por tanto, estas proteínas regulan el proceso de ayuste y determinan si un exón va a estar presente en el transcrito final o, por el contrario, se va a saltar. Es importante tener en cuenta que algunas mutaciones en estos motivos, aunque sean silenciosas porque no cambian el aminoácido (o porque se localizan en intrones), pueden sin embargo tener efectos sobre el mensajero, haciendo que un exón se pierda y alterando así la estructura de la proteína o rompiendo el marco de lectura. De hecho, en algunos genes (ATM, NF1) se ha estimado que el 50 por ciento de las mutaciones que originan enfermedades afectan a regiones que cambian el patrón de ayuste sin cambiar la secuencia de aminoácidos. Un buen ejemplo para ilustrar esta situación es una enfermedad llamada Atrofia Muscular Espinal, debida a deleciones y/o mutaciones del gen SMN1. Cerca de este gen hay un gen parálogo casi idéntico llamado SMN2, en el que un cambio C → T modifica el patrón de ayuste (sin cambiar la secuencia de aminoácidos) y hace que el exón 7 se pierda, dando lugar a una proteína truncada no funcional. De todas formas, un pequeño porcentaje de las moléculas siguen un ayuste normal (con el exón 7) y producen proteína normal a partir del gen SMN2. Por tanto, aunque no haya ninguna copia funcional de SMN1 (como sucede en enfermos con atrofia muscular espinal) la enfermedad tiene distinta gravedad según el número de copias de SMN2

www.FreeLibros.me


CAPITULO 14

5/12/06

07:25

Página 195

presentes. De hecho, se piensa que esta circunstancia podría utilizarse para corregir la sintomatología de los pacientes con Atrofia Muscular Espinal.

6

8

SMN1

CAGACAA

SMN2 6

8 UAGACAA

SMN1 ∆7

La Figura 14.8 muestra la diferencia de ayuste entre los genes SMN1 y SMN2.

Otro tipo de mutaciones del ADN no-codificante intragénico son las que afectan a la señal de poli-adenilación, que se encuentra en la región no traducida 3’ de un gen. Estas mutaciones pueden originar proteínas defectuosas y llevar a la degradación del ARNm. Por ejemplo, una mutación en la señal de poliadenilación del gen que codifica la hemoglobina alfa-2 (alelo HBA20024) convierte la señal AATAAA en AATGAA, con lo que el ARNm no se poli-adenila correctamente, el ARNm se degrada y se desarrolla la enfermedad alfa-talasemia por ausencia de cadenas de hemoglobina alfa-2. Finalmente, las substituciones en el ADN no codificante intergénico, serán silenciosas excepto cuando afectan a elementos reguladores de la expresión génica (promotores, potenciadores, etc.) o a otros elementos necesarios para el correcto procesamiento del ARNm. Por ejemplo, mutaciones que afectan a la «Región de Control del Locus» de las alfa- y beta-globinas (un conjunto de potenciadores situados unas 40–60 kb en dirección 5’ de los genes respectivos) provocan unas enfermedades denominadas talasemias, debidas a la síntesis deficiente de globinas.

14.5 Nomenclatura general de mutaciones Llegados a este punto, interesa estudiar la nomenclatura recomendada para describir los distintos tipos de mutaciones que hemos visto hasta ahora. Aunque las recomendaciones van cambiando con el paso de los años, a continuación se resumen las reglas principales: 1.

Describir la mutación utilizando la numeración de nucleótidos de la secuencia genómica (g.) o del ADNc (c.) o la numeración de la secuencia de

www.FreeLibros.me

Nomenclatura general de mutaciones

SMN1

195


CAPITULO 14

5/12/06

196

Mutaciones simples como causa de enfermedad

2.

07:25

Página 196

aminoácidos, según los casos. Siempre la Adenina del codón de iniciación ATG se toma como posición +1, de forma que el nucleótido anterior es la posición –1. Describir las substituciones de nucleótidos según el esquema general: 2.

Intervalo + secuencia antigua + tipo de cambio + secuencia nueva.

2.

Utilizar una flecha o el signo «>» para las sustituciones, «del» para deleciones, «ins» para inserciones. Los rangos se indican con guión bajo (de subrayado) para evitar confusiones con el signo negativo. Las combinaciones de dos o más alteraciones se separan con el signo + y se incluyen en corchetes. Algunos ejemplos:

2.

g.12T>A (Cambio de timina por adenina en el nucleótido 12 de la secuencia genómica) [6T>C + 13_14del] (Dos cambios en el mismo alelo) [6T>C] + [13_14del] (Dos mutaciones, una en cada alelo) 14–15insT (Inserción de timina entre dos nucleótidos) 112_117delAGGTCAinsTG (Inserción de TG en vez de AGGTCA, también se podría indicar como 112_117>TG)

2. 2. 2. 2. 3.

4.

5.

2. 2.

6.

En repeticiones en tándem, se asigna por convenio el cambio a la última repetición (la que ocupa una posición más 3’): por ejemplo, la deleción de un dinucleótido TG en la secuencia ACTGTGTGCC (siendo A el nucleótido 1991) se describiría como 1997-1998del (o 1997-1998delTG). La variabilidad en microsatélites se designa contando la posición de la primera repetición. Si la secuencia del ejemplo anterior fuese polimórfica, se designaría 1993(TG)3-22, para indicar que en posición 1993 comienza un dinucleótido TG que se encuentra en la población repetido entre 3 y 22 veces. En intrones (cuando no se conoce la secuencia genómica), se señala la posición dentro del intrón con referencia al exón más cercano (utilizando números positivos comenzando con la G de la secuencia de ayuste GT donante, y números negativos contando desde la G de la secuencia AG aceptora). Se puede usar tanto la sigla IVS como sinónimo de «intrón», como la numeración correspondiente a la secuencia del ADNc. Ejemplos: IVS3+1G>T o c.621+1G>T (621 es el último nucleótido del exón 3, luego +1 es la G de la secuencia donante GT del intrón 3). IVS6-5C>A o c.1781–5C>A (1781 es el primer nucleótido del exón 7, luego –1 es la G de la secuencia aceptora AG del intrón 6, –2 es la A, y así sucesivamente hasta llegar a –5). Para describir substituciones de aminoácidos, se indica el número del aminoácido y el cambio operado, considerando la metionina iniciadora como

www.FreeLibros.me


CAPITULO 14

5/12/06

2. 2.

Página 197

+1. Se sigue el esquema general aminoácido cambiado + rango + aminoácido nuevo. Se recomienda usar el código de aminoácidos de una letra, aunque también puede utilizarse el de tres letras, empleando la letra X para indicar un codón de parada. Ejemplos: R117H (la Arg en posición 117 pasa a His) G542X (la Gly 542 se convierte en codón de parada) T97del (deleción de la treonina 97) o T97_C102del (deleción de los aminoácidos 97 a 102) T97_W98insLK (inserción de leucina y lisina entre las posiciones 97 y 98, ocupadas por treonina y triptófano)

www.FreeLibros.me

197

Nomenclatura general de mutaciones

2.

07:25


CAPITULO 14

5/12/06

07:25

Pรกgina 197

www.FreeLibros.me


CAPITULO 15

5/12/06

07:27

Página 199

CAPÍTULO 15

Potencial patogénico de las secuencias repetidas

Contenidos 15.1 Mutaciones en secuencias que están repetidas en tándem 15.2 Expansión de trinucleótidos: neuropatías por expansiones de CAG y enfermedades por expansión de otros trinucleótidos 15.3 Neuropatías por expansiones de CAG 15.4 Enfermedades por expansión de otros trinucleótidos 15.5 Otras enfermedades por expansión de secuencias repetidas 15.6 Mutaciones debidas a repeticiones dispersas 15.7 Desórdenes genómicos

Además de las mutaciones simples estudiadas en el capítulo anterior, puede haber mutaciones más complejas que afectan a secuencias repetidas, tanto repeticiones en tándem (mini- y micro-satélites) como repeticiones dispersas (elementos Alu, LINE, etc).

15.1 Mutaciones en secuencias que están repetidas en tándem Un tipo de mutación que afecta con frecuencia a las repeticiones cortas en tándem de tipo microsatélite es la expansión o contracción de la repetición. Como ya vimos al estudiar los mecanismos de reparación, este fenómeno se produce habitualmente por un mecanismo llamado «desemparejamiento por deslizamiento de cadenas» (slipped-strand mispairing en inglés). Dicho proceso puede tener lugar durante la replicación del ADN que contiene la repetición, si se da un deslizamiento hacia atrás o hacia delante de la cadena que está siendo sintetizada sobre la cadena molde. Este deslizamiento origina un

www.FreeLibros.me


CAPITULO 15

200

5/12/06

07:27

Página 200

Potencial patogénico de las secuencias repetidas

bucle en una de las cadenas, cuyo resultado final es que la nueva cadena de ADN tendrá una repetición más o una repetición menos que la cadena original, según el desplazamiento haya sido hacia atrás o hacia delante, respectivamente. Este mecanismo explica los polimorfismos de longitud de los microsatélites, que ya hemos estudiado al hablar de estos marcadores en el Capítulo 1. La Figura 15.1 muestra esquemáticamente el mecanismo de expansión de un trinucleótido por deslizamiento de una cadena durante la replicación.

Lo importante ahora es darse cuenta de que si la expansión o contracción tiene lugar en la región codificante de un gen que contiene repeticiones en tándem cortas, el resultado será la apari141 142 143 144 145 ción de deleciones de aminoácidos (si se GCC ATT TT*G GCC TT delecionan tres nucleótidos) o cambios en el marco de lectura (si se delecionan repeticiones de 329 330 331 332 333 uno, dos, cuatro o cinco nucleótidos). Se presenCCA CTT GTT GAC CGA tan a continuación dos ejemplos de lo dicho. En el cuadro superior observamos, arriba, la secuencia 329 330 331 332 nativa del gen CFTR (mutado en una enfermedad CCA CTT G** *AC CGA llamada «Fibrosis Quística del páncreas»), que contiene una repetición en tándem del nucleótido Timina (hay cinco Timinas seguidas en los codones 142 y 143). La deleción de una T por el fenómeno que acabamos de describir provocará un cambio del marco de lectura, como se aprecia en la fila de debajo. En el cuadro inferior vemos un ejemplo de deleción de un trinucleótido TTG en la región codificante del Factor IX de la coagulación: la secuencia nativa (fila superior) contiene dos repeticiones TTG en tándem, de modo que la deleción de una de ellas provoca la deleción de un aminoácido sin alterar el marco de lectura (fila inferior). Lógicamente, lo mismo que se ha ilustrado aquí con deleciones puede decirse de las inserciones. Los microsatélites del tipo trinucleotídico pueden además sufrir expansiones mayores, dando lugar a un grupo de enfermedades conocidas como «enfermedades por expansión de trinucleótidos». Dada su importancia en patología humana, las estudiamos con más detalle en el siguiente apartado.

141 142 143 144 145 GCC ATT TTT GGC CTT

15.2 Expansión de trinucleótidos: neuropatías por expansiones 15.2 de CAG y enfermedades por expansión 15.2 de otros trinucleótidos Hay un grupo de enfermedades debidas a la expansión de repeticiones de trinucleótidos, que tienen una serie de rasgos en común. El descubrimiento del mecanismo por el que se desencadenan estas enfermedades ayudó a comprender un fenómeno clínico que se conocía con el nombre de «anticipación»: la aparición de la enfermedad a una edad cada vez más temprana y de forma más severa en sucesivas generaciones de una misma familia. Como veremos, la presencia de secuencias trinucleotídicas inestables, que aumentan de tamaño en cada generación, permitió explicar este fenómeno.

www.FreeLibros.me


CAPITULO 15

5/12/06

07:27

Página 201

15.3 Neuropatías por expansiones de CAG Las enfermedades del primer grupo tienen como resultado la expansión de un tracto de poliglutaminas en la proteína codificada por el gen respectivo, y constituyen un grupo de enfermedades neurodegenerativas de gran importancia. La siguiente tabla resume las características más importantes de cada una de estas enfermedades:

Huntington Smith (Haw-River) (DRPLA) Kennedy (SBMA) SCA1 SCA2 SCA3/MJD SCA6 SCA7 SCA17 SCA12

Repetición

Normal

Enfermedad

Localización

Efecto

CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG

11-34 7-34 9-36 6-39 15-24 13-36 4-20 4-35 25-42 7-45

40-121 49-88 38-62 40-82 32-200 61-84 20-29 37-306 47-63 55-78

ORF (HD) ORF (DRPLA) ORF (AR) ORF (SCA1) ORF (SCA2) ORF (SCA3) ORF (CACNA1A) ORF (SCA7) ORF (TBP) 5’UTR? (PPP2R2B)

Ganancia Ganancia Ganancia Ganancia Ganancia Ganancia Ganancia Ganancia Ganancia ?

El modo de expansión, en general, es gradual. Así, la inestabilidad va aumentando con el tamaño de la expansión: por debajo de las 40 repeticiones, la frecuencia de expansiones es baja, pero al llegar a un rango de 40 a 100 repeticiones la inestabilidad ya es prácticamente del 100 por cien. Además, se observan diferencias si la transmisión es materna (las repeticiones de la descendencia se distribuyen normalmente alrededor de la media materna) o paterna (produce repeticiones con una media más alta que la paterna, con tendencia a aumentar en función de la edad paterna). El mecanismo patogénico en estas enfermedades se ha atribuido a la expansión de un tracto de glutaminas en las proteínas implicadas, lo que llevaría al mal plegamiento y/o formación de agregados proteicos que alteran la función neuronal. En general, se piensa que la expansión produce una ganancia de función, ya que muta-

www.FreeLibros.me

201

Neuropatías por expansiones de CAG

Las enfermedades por expansión de trinucleótidos pueden agruparse en dos grandes categorías: (1) enfermedades debidas a expansiones cortas (40 a 70 repeticiones) de un trinucleótido CAG localizado en la región codificante de un gen; y (2) enfermedades debidas a expansiones mayores (desde 50 hasta miles de repeticiones) de trinucleótidos situados en regiones no codificantes. Como ya hemos comentado, el mecanismo de expansión más probable es el desemparejamiento por deslizamiento de cadenas, aunque las grandes expansiones son más fáciles de explicar mediante un mecanismo de reparación por recombinación homóloga. De todas formas, todavía no se explica bien por qué en estas secuencias se dan muchas más expansiones que contracciones.


CAPITULO 15

202

5/12/06

07:27

Página 202

Potencial patogénico de las secuencias repetidas

ciones y deleciones que anulan la función de esos mismos genes no dan lugar a la misma enfermedad que la expansión del trinucleótido. Por ejemplo, la expansión de un trinucleótido CAG en el gen del receptor de andrógenos da lugar a la Atrofia Muscular Espino-Bulbar (SBMA, Enfermedad de Kennedy), mientras que las mutaciones de ese mismo gen provocan el Síndrome de feminización testicular. Por otro lado, la longitud de las expansiones correlaciona con la gravedad de la sintomatología, lo que hace pensar que estas enfermedades se deben a una ganancia de función con un efecto tóxico que aumenta con el número de glutaminas que lleva la proteína, probablemente a partir de un umbral de 35-40 residuos. También se ha demostrado que, para provocar degeneración neuronal, las proteínas mutantes deben entrar en el núcleo, ya que cuando se envían al citoplasma no se observa efecto patogénico alguno. Esto sugiere que pueden interaccionar con factores de transcripción ricos en glutamina y alterar la transcripción de genes necesarios para la supervivencia neuronal. De hecho, se ha demostrado que la acetilasa de histonas CBP (co-activador transcripcional del que hemos hablado en el Capítulo 2) es secuestrada en presencia de proteínas con tractos de poli-glutaminas, con lo que se altera la expresión de genes necesarios para la supervivencia neuronal. Dado que las proteínas con tractos de poli-glutaminas pueden unirse entre sí por interacciones proteína-proteína, otros factores de transcripción con poli-glutaminas también podrían quedar secuestrados en estas enfermedades. De hecho, se ha visto recientemente que el factor de transcripción TAFII130, un componente de TFIID, interacciona con el factor de transcripción Sp1 a través de regiones con tractos de glutaminas; la presencia de una proteína con tractos largos de poliglutaminas podría impedir esta interacción y cancelar la expresión de los genes regulados por estos factores. En el caso concreto de la huntingtina (la proteína codificada por el gen mutado en la Enfermedad de Hutington) se ha demostrado, por ejemplo, que la presencia de huntingtina con expansión de glutaminas impide la expresión del gen que codifica el receptor D2 de la dopamina, mediante un mecanismo como el descrito. En la Figura 15.2 se esquematiza un posible mecanismo patogénico de la huntingtina que lleva expansión de un tracto de glutaminas.

15.4 Enfermedades por expansión de otros trinucleótidos El segundo grupo de enfermedades por expansión de trinucleótidos incluye enfermedades más heterogéneas, aunque también se caracterizan por afectar al sistema nervioso. Sus características se resumen en la siguiente tabla, donde se muestra que la inestabilidad propia del rango de 40-100 repeticiones (llamado en estos casos «premutación») no causa la enfermedad, sino que favorece la aparición de una expansión explosiva, llegando de golpe hasta varios miles de repeticiones («mutación completa»), que ya causa la enfermedad. Esta «explosividad» no se produce cuando la repetición está interrumpida por un triplete distinto; por ejemplo, algunos alelos del gen FRAXA tienen repeticiones del trinucleótido CGG que están interrumpidas por el trinucleótido AGG cada 10 repeticiones CGG, y esos alelos no sufren expansión.

www.FreeLibros.me


CAPITULO 15

5/12/06

07:27

Repetición

Normal

Pre-mutación

Mutación

CTG CGG GCC GAA CTG

5-37 6-52 4-35 6-32 16-37

50-80? 59-230 (35-61)? (35-40)? ?

80-2000+ 230-2000+ 200-900 200-1700 107-127

Localización

203

3’ UTR (DMPK) 5’ UTR (FMRP) 5’ UTR (FMR2) Intron (FRDA) 3’ UTR (SCA8)

Enfermedades por expansión de otros trinucleótidos

Distrofia Miotónica (DM1) X Frágil (FRAXA) X Frágil (FRAXE) Ataxia Friedreich SCA8

Página 203

En estas enfermedades, como regla general, el efecto patogénico es resultado de la pérdida de función de la proteína o de la alteración en la función del ARNm, ya que las expansiones están en regiones no codificantes. En este grupo destacan:

Síndrome del X frágil. Es la causa más frecuente de retraso mental ligado al cromosoma X (un 40 por ciento de los casos) y la causa heredada más frecuente de retraso mental aislado. Inicialmente, esta enfermedad se detectaba por el cariotipo, que muestra una rotura en Xq27.3 cuando las células se cultivan en presencia de metrotexato o en ausencia de folato. Posteriormente, la identificación en 1991 del gen FMR1 reveló la existencia de un gen de 38 kb y 17 exones, con un trinucleótido CGG en una isla CpG de la región promotora del gen. Fue el primer ejemplo de una enfermedad originada por la expansión de una repetición de trinucleótidos. Las mutaciones de la región codificante son raras, pero también provocan la enfermedad cuando implican disminución de la proteína FMRP, lo que sugiere que la expansión del trinucleótido provoca una pérdida de función. La proteína codificada por el gen es citoplasmática y se expresa en cerebro (por igual en todos los tipos de neuronas, aunque no se expresa en células no-neuronales), así como en testículo (en células germinales pero no en células de Sertoli o de Leydig). La proteína posee dominios de unión al ARN y dominios de unión a otras proteínas, y se ha comprobado que se une a su propio mensajero, a un cuatro por ciento de todos los ARNm de cerebro fetal, y también a la subunidad 60S de los ribosomas. Podría por tanto entrar en el núcleo, capturar mensajeros y exportarlos al citoplasma como parte de la maquinaria traduccional, específicamente aquellos mensajeros que son cruciales para el desarrollo de las dendritas y para la función sináptica en las neuronas. Curiosamente, se ha visto que la mayor parte de los ARNm que se unen a FMRP forman estructuras secundarias llamadas «cuartetos-G», debido a la presencia de Guaninas espaciadas regularmente; mediante estas estructuras, los mensajeros se unen al dominio RGG (arginina-glicina-glicina) de la FMRP. También se ha visto que, en Drosophila, la proteína FMRP forma parte del complejo de silenciamiento por interferencia de ARN (RISC), lo que abre la posibilidad de que dicho mecanismo también esté implicado en la fisiopatología del Síndrome del X frágil. Aunque el hallazgo del gen y la elucidación de la estructura de la proteína todavía no han permitido desvelar completamente el mecanismo fisiopatológico de la enfermedad, sí han servido para explicar el modo inusual de transmisión de la misma, que se verá en un capítulo posterior.

La Figura 15.3 muestra la estructura de los cuartetos G.

www.FreeLibros.me


CAPITULO 15

204

5/12/06

Potencial patogénico de las secuencias repetidas

07:27

Página 204

La distrofia miotónica se puede producir por alteraciones en 2 loci. La forma más frecuente es la DM1, debida a la expansión del trinucleótido CTG en la región no traducida-3’ del gen DMPK, que codifica una proteín-quinasa. Como la enfermedad se hereda de forma autosómica dominante, parece que el complejo fenotipo de esta enfermedad (que incluye miotonía muscular, cataratas y arritmias cardíacas) debe ser el resultado de la alteración de algún proceso celular importante. De hecho, se ha comprobado que la expansión del trinucleótido CTG en el gen DMPK inhibe la expresión de un gen vecino llamado SIX5. Se ha visto que los ratones knock-out para el gen DMPK tienen una arritmia similar a la que se ve en los pacientes con distrofia miotónica, mientras que los ratones knock-out para SIX5 sufren unas cataratas que recuerdan a las de los enfermos. La miopatía se produce por la presencia de ARN con largas expansiones de repeticiones CUG (esto se ha comprobado también en ratones). La hipótesis más aceptada es que la expansión da lugar a un ARN que es capaz de unirse a varias proteínas de unión a ARN que regulan el fenómeno del ayuste, alterando su función. Como resultado, se altera el ayuste correcto de otros ARNm, y de hecho se han identificado más de 10 genes cuyo ayuste y función está alterada en esta enfermedad. Estos genes incluyen un canal de cloro, el propio SIX5, el gen de la troponina T, el receptor de la insulina, genes con funciones neuronales, etc. En conjunto, se piensa que la sintomatología de la enfermedad es el resultado conjunto de la desregulación de todos estos genes por la presencia de un ARNm con la expansión de CTG. La ataxia de Friedreich, enfermedad autosómica recesiva que no muestra el fenómeno clínico de anticipación, parece también un buen ejemplo de pérdida de función debida a la expansión, ya que los sujetos enfermos deben ser homocigotos (tener ambos alelos con la expansión) o heterocigotos compuestos (un alelo con expansión y el otro alelo con una mutación puntual). El trinucleótido GAA que sufre la expansión está localizado en una secuencia Alu del primer intrón del gen FRDA, que codifica una proteína llamada frataxina. Los alelos normales están interrumpidos por la secuencia (GAGGAA)5-9 y no tienen más de 32 repeticiones GAA. La expansión impide la transcripción del gen, al formar un intrón muy largo con estructuras de triple hélice en el ADN genómico. Los niveles bajos de frataxina alteran la función mitocondrial, ya que esta proteína es importante en la homeostasis del hierro en la mitocondria, y dan lugar a una disminución en la producción de energía y a la formación de especies reactivas de oxígeno.

15.5 Otras enfermedades por expansión 15.5 de secuencias repetidas Recientemente se ha descrito un tipo de epilepsia mioclónica progresiva de herencia autosómica recesiva, debida a la expansión de una secuencia de 12 nucleótidos (CCCCGCCCCGCG). Este es el primer ejemplo de enfermedad por expansión de un minisatélite, que en este caso se encuentra en la región promotora del

www.FreeLibros.me


CAPITULO 15

5/12/06

07:27

Página 205

15.6 Mutaciones debidas a repeticiones dispersas Las repeticiones dispersas del genoma humano, estudiadas con detalle en el Capítulo 4, suelen dar lugar a reordenamientos cromosómicos por un mecanismo denominado «sobrecruzamiento desigual» (en inglés, UnEqual Cross-over, UEC). Habitualmente, la recombinación homóloga durante la meiosis tiene como finalidad producir nuevas combinaciones de alelos, ya que se recombinan cromosomas homólogos. El sobrecruzamiento desigual consiste en la recombinación entre secuencias homólogas pero no-alélicas (es decir, que tienen homología en su secuencia pero están en localizaciones genómicas diferentes). Tal es el caso, por ejemplo, de los genes parálogos (miembros de una familia génica, con alto grado de homología entre ellos) o de las repeticiones dispersas tipo SINE o LINE (cuyos miembros tienen una secuencia muy homóloga). Un buen ejemplo que ilustra los efectos del sobrecruzamiento desigual es el mecanismo que origina varones con cariotipo XX o mujeres XY (con disgenesia gonadal y disfunción ovárica). Hasta un 30 por ciento de los casos de estas patologías son debidos a un sobrecruzamiento desigual entre los genes PRKX y PRKY, genes homólogos que están cerca de la Región Pseudoautosómica de los cromosomas sexuales X e Y, respectivamente. Fruto de esta recombinación desigual, el gen SRY —gen que determina el sexo masculino, situado en el cromosoma Y— acompaña al fragmento telomérico del cromosoma Y que se mueve al cromosoma X, dando como resultado un cromosoma X que contiene SRY y un cromosoma Y sin SRY. Esto origina individuos que fenotípicamente son varones a pesar de ser XX, así como mujeres con cariotipo XY. La Figura 15.4 muestra el proceso de recombinación desigual entre los genes PRKX y PRKY.

www.FreeLibros.me

205

Mutaciones debidas a repeticiones dispersas

gen CSTB (cistatina B, un inhibidor de proteasas). Los alelos normales tienen hasta tres repeticiones, mientras que sujetos con «premutación» tienen 12 a 17 repeticiones y los enfermos tienen entre 30 y 75 copias (en total, un tamaño de 360-900 nucleótidos). Un 14 por ciento de los individuos con esta enfermedad tienen mutaciones en la región codificante del gen, por lo que el mecanismo patogénico parece ser por pérdida de función. De hecho, la presencia de la expansión conduce a disminución de los niveles de ARNm, probablemente debido a la desorganización del promotor del gen CSTB. También se ha identificado un nuevo tipo de ataxia espino-cerebelosa (SCA10), de herencia autosómica dominante. La causa de esta enfermedad reside en la expansión de un pentanucleótido (ATTCT) en el intrón 9 del gen SCA10. Los individuos normales tienen 10 a 22 repeticiones, mientras que los sujetos con esta enfermedad tienen alelos entre 500 y 4 500 repeticiones. Posteriormente a este hallazgo, se identificó la primera enfermedad debida a la expansión de un tetranucleótido: la Distrofia Miotónica tipo 2. Los individuos normales tienen menos de 26 repeticiones CCTG en el intrón 1 del gen ZNF9, mientras que las expansiones en pacientes van desde 75 a 11 000 repeticiones.


CAPITULO 15

206

5/12/06

07:27

Página 206

Potencial patogénico de las secuencias repetidas

Además, los fenómenos de recombinación desigual son causa frecuente de duplicaciones o deleciones cuando tienen lugar entre repeticiones no alélicas de gran tamaño con un alto grado de homología, como son las duplicaciones segmentarias del genoma humano, que ya mencionamos en el Capítulo 4. Habitualmente, esto sucede entre secuencias que pertenecen a cromosomas distintos, pero en ocasiones la recombinación o sobrecruzamiento desigual también puede tener lugar entre cromátides hermanas. En este caso se produce el llamado «intercambio desigual entre cromatides hermanas» (en inglés, UnEqual Sister Chromatid Exchange, abreviado UESCE), que da lugar a alteraciones en ambas cromátides de un mismo cromosoma: habitualmente se produce una duplicación en una cromátide y una deleción en la otra. El vídeo de la Figura 15.5 ilustra el proceso de recombinación desigual entre secuencias de cromosomas homólogos o de cromátides hermanas.

Otro posible efecto de la recombinación desigual entre secuencias homólogas es la conversión génica entre ellas. Como hemos visto en un capítulo anterior, durante los procesos de recombinación homóloga se forma un heterodúplex que puede dar lugar a un proceso de conversión génica, de modo que una de las secuencias se copia a la otra. Habitualmente, la conversión génica tiene lugar entre alelos de un mismo gen; sin embargo, la recombinación desigual entre dos secuencias no alélicas (un gen y un pseudogen no funcional, por ejemplo) puede provocar la conversión de la secuencia del gen en la secuencia del pseudogen, lo que equivaldría a anular la función del gen. Un ejemplo clásico de este mecanismo es la enfermedad llamada «Hiperplasia Suprarrenal Congénita» (déficit del enzima 21-hidroxilasa). Alrededor del 75 por ciento de los casos de esta enfermedad están provocados por un fenómeno de conversión génica entre el gen CYP21B (que codifica el enzima) y el pseudogen CYP21A (que no es funcional). De modo general, hasta ahora hemos considerado que los elementos repetidos que se recombinan ilegítimamente están en la misma orientación. Puede suceder, sin embargo, que estén invertidos (en orientaciones contrarias uno respecto del otro). En este caso, la recombinación entre elementos repetidos dará lugar a la inversión de la región que queda entre las repeticiones, como se verá en un ejemplo del siguiente apartado.

15.7 Desórdenes genómicos En conjunto, los procesos de recombinación desigual dan lugar a un grupo de enfermedades humanas que se conocen con el nombre de «Desórdenes Genómicos», y que incluyen –entre otros– los Síndromes por microdeleción que se han mencionado estudiado en el Capítulo 13. Los Desórdenes Genómicos se pueden agrupar como sigue:

A) Debidos a deleciones

Los pacientes con Ictiosis ligada al X tienen una deleción del gen de la sulfatasa esteroidea en Xp22, por reordenación entre elementos repetidos (separados por 1,9 Mb) que flanquean este gen.

www.FreeLibros.me


CAPITULO 15

• •

07:27

Página 207

La deleción que produce el Síndrome de Williams-Beuren está originada por recombinación entre duplicaciones segmentarias que flanquean el gen de la elastina en 7q11, repeticiones que están separadas por 1,6 Mb. La causa más frecuente de los Síndromes de Prader-Willi y de Angelman es una deleción de 4 Mb por recombinación desigual entre duplicaciones en 15q11-q13. La reordenación más frecuente en el cromosoma 22 es la deleción de unas 3 Mb en 22q11.2, que se encuentra en el 90 por ciento de pacientes con Síndrome de Di George o con Síndrome Cardio-velo-facial. Un caso especial de deleción de secuencias repetidas es la contracción de una serie de repeticiones en tándem cerca del telómero 4q, que origina una enfermedad llamada distrofia facio-escápulo-humeral. Recientemente se ha comprendido el mecanismo molecular de dicha enfermedad. En la región subtelomérica 4q existe un elemento llamado D4Z4 que está repetido en tándem. Los cromosomas normales tienen entre 10 y 100 repeticiones del elemento. Los cromosomas «contraídos», que tienen entre una y 10 repeticiones, pueden dar lugar a la enfermedad si además ese cromosoma tiene un satélite beta a continuación de la repetición (lo que se conoce como variante 4qA); los cromosomas 4q sin el satélite beta no dan lugar a la enfermedad, aunque tengan sólo 1-10 repeticiones D4Z4 (variante 4qB). Esta contracción desencadena la enfermedad mediante la des-regulación de genes cercanos a esa región, especialmente por sobre-expresión del gen FRG1.

Deleción de 1,5 Mb (5-10%)

4 Mb

Deleción de 3 Mb (90%)

15q11 -q13

Di George (22p)

Prader -Willi /Angelman

En la Figura 15.6 se incluyen esquemas de los principales desórdenes genómicos debidos a deleciones.

B) Debidos a duplicaciones/deleciones Los reordenamientos entre dos elementos llamados CMT1A-REP, localizados en 17p12, dan lugar a individuos con la duplicación o con la deleción de la región com-

www.FreeLibros.me

207

Desórdenes genómicos

5/12/06


CAPITULO 15

208

5/12/06

07:27

Página 208

Potencial patogénico de las secuencias repetidas

prendida entre ambas repeticiones. Esta región incluye el gen PMP22, que codifica una proteína de la mielina, y la duplicación o deleción de esta región origina dos enfermedades distintas (Charcot-Marie-Tooth o Neuropatía Hereditaria con Parálisis por Presión, respectivamente). Las repeticiones CMT1A-REP tienen un tamaño de unas 30 kb y están a una distancia de 1,5 Mb, de forma que el sobrecruzamiento desigual entre ellas origina la deleción o duplicación de esa región. Estas repeticiones tienen una región pequeña (1,7 kb) que es casi totalmente idéntica en todas ellas, y también contienen un elemento similar al transposón «mariner». Parece que la presencia de éste último puede favorecer la acción de una transposasa a este nivel y facilitar la recombinación desigual entre cromátides. Algo similar sucede en el Síndrome de Smith-Magenis, debido a una deleción de unas 5 Mb en 17p11.2. Los individuos con duplicación de esa región tienen un fenotipo distinto. La Figura 15.7 ilustra el proceso de recombinación desigual que origina las enfermedades de Charcot-Marie-Tooth y la Neuropatía Hereditaria con Parálisis por Presión.

C) Debidos a inversiones Cuando la recombinación desigual se produce entre repeticiones invertidas que están en la misma cromátide, a menudo se originan inversiones cromosómicas. Este fenómeno es especialmente frecuente como causa de Hemofilia A, una coagulopatía debida al déficit de Factor VIII de la coagulación. El gen que codifica el Factor VIII tiene un elemento llamado int22h que está repetido dos veces antes del exón 1 y otra vez (en la orientación contraria) en el intrón 22 (entre los exones 22 y 23). Un sobrecruzamiento desigual entre uno de los elementos que están antes del exón 1 con el elemento del intrón 22 dará lugar a una inversión de toda la región comprendida entre ambas repeticiones, rompiendo totalmente la capacidad codificante del gen. Este mecanismo es responsable de un 45 por ciento de los casos de Hemofilia A en humanos, lo que subraya la gran importancia de este tipo de fenómenos en patología humana. La Figura 15.8 muestra el proceso de recombinación desigual que origina la inversión del gen del Factor VIII, causante de Hemofilia A.

Otro ejemplo de inversión es la que da lugar a la distrofia muscular de EmeryDreifuss, por recombinación entre repeticiones invertidas en Xq28. Este caso es especialmente interesante porque se ha detectado la inversión de esta región en un tercio de las mujeres normales.

D. Otras anomalías La recombinación desigual entre elementos duplicados del genoma humano origina también otros procesos. Por ejemplo, la duplicación invertida del cromosoma 15 es el cromosoma marcador que se encuentra con mayor frecuencia en recién nacidos. También se encuentra un cromosoma marcador dicéntrico debido a una duplicación invertida en 22q en pacientes con Síndrome de Ojo de Gato, por reordenamientos

www.FreeLibros.me


CAPITULO 15

5/12/06

07:27

Página 209

900 kb H1 (80%)

H2 (20%) 700 kb

microdeleción 17q21.31 La Figura 15.9 muestra la estructura de 17q21.31 y la microdeleción que se origina en esta región.

www.FreeLibros.me

209

Desórdenes genómicos

entre duplicaciones segmentarias. Estas mismas duplicaciones están implicadas en la translocación t(11;22)(q23;q11), que es la única translocación recíproca equilibrada recurrente en humanos. Finalmente, se ha observado que hasta un uno por ciento de los casos de retraso mental esporádico pueden ser debidos a una microdeleción en 17q21.31, por recombinación entre duplicaciones segmentarias flanqueantes. Curiosamente, esa región se presenta en humanos en dos configuraciones diferentes, ya que existe un polimorfismo de inversión debido también a la presencia de duplicaciones segmentarias en orientación invertida; una de esas configuraciones, la llamada H2, es la que puede dar lugar a la microdeleción.


CAPITULO 15

5/12/06

07:27

Pรกgina 209

www.FreeLibros.me


CAPITULO 16

5/12/06

07:29

Página 211

C APÍTULO 16

Efectos fenotípicos de las mutaciones

Contenidos 16.1 16.2 16.3 16.4

Pérdida de función, fenotipos recesivos y haploinsuficiencia Fenotipos dominantes por ganancia de función Alteraciones de la impronta genómica Mutaciones que afectan a la morfogénesis

Cuando un gen está mutado por cualquiera de los mecanismos que hemos visto en el capítulo anterior, pueden suceder fundamentalmente dos cosas: (a) que esa mutación se silenciosa, no tenga ningún efecto pernicioso ni provoque ningún fenotipo anómalo; o (b) que esa mutación provoque la aparición de un fenotipo aberrante que conduzca al desarrollo de una enfermedad. En este segundo caso, que es el que nos ocupa en esta Genética Humana, es importante darse cuenta de que la alteración de un gen puede provocar un fenotipo anormal mediante dos mecanismos, fundamentalmente: la pérdida de función o la ganancia de función. La pérdida de función de un gen equivale a su ausencia total, ya que el gen no codifica la proteína respectiva. En general, esto da lugar a fenotipos que se heredan de manera recesiva, ya que es necesario que estén mutados los dos alelos para que se manifieste el fenotipo. Sin embargo, en aquellos casos en los que hay un efecto de dosis génica, en los que se producen fenotipos dominantes por un fenómeno llamado haploinsuficiencia, la pérdida de función genera fenotipos de herencia dominante. En el caso de las mutaciones que provocan una ganancia de función, los fenotipos resultantes son generalmente de herencia dominante, porque la mutación facilita que el gen escape a los mecanismos que regulan su expresión, o bien crea una nueva función que tiene un efecto dominante negativo. Como regla general, podemos decir que cuando las mutaciones puntuales en un gen producen el mismo fenotipo que las deleciones de todo el gen, lo más probable es que esas mutaciones provoquen una pérdida

www.FreeLibros.me


CAPITULO 16

212

5/12/06

07:29

Página 212

Efectos fenotípicos de las mutaciones

de función; en cambio, las mutaciones que operan a través de una ganancia de función suelen provocar fenotipos distintos a los que genera la deleción o disrupción de ese gen. A continuación veremos un poco más a fondo cada una de estas dos situaciones.

16.1 Pérdida de función, fenotipos recesivos 16.1 y haploinsuficiencia Un gen puede perder su función de varias maneras:

Mutaciones en el propio gen: cualquier tipo de mutación que interrumpa la capacidad codificante del gen hará que se pierda su función. Como hemos visto en el capítulo precedente, puede tratarse de mutaciones puntuales, deleciones o inserciones que interrumpen el marco de lectura, así como alteraciones de las secuencias de ayuste (splicing). También podemos incluir aquellas mutaciones que no afectan a la secuencia del transcrito (ARNm) sino a su estabilidad, de forma que el mensajero se degrada rápidamente y no llega a traducirse en la proteína correspondiente. Mutaciones que afectan a los elementos que regulan la expresión génica. Un gen puede dejar de expresarse por mutaciones que afectan al promotor, bien por mutaciones que alteran las secuencias de unión a factores de transcripción o bien provocando su metilación. Otro mecanismo que disminuye la expresión génica es el que se conoce como efectos de posición, es decir, una reordenación cromosómica que mueve un gen de su posición original a otra región del genoma que está silenciada (una región de heterocromatina, por ejemplo). En ocasiones, esto hace que el gen deje de expresarse. Hay varios ejemplos de enfermedades humanas producidas por este mecanismo, como el caso de la Distrofia Facio-Escápulo-Humeral que hemos estudiado en el capítulo anterior. Otros ejemplos son la Aniridia (por alteraciones del gen PAX6) o la Displasia Campomélica (alteraciones del gen SOX9), enfermedades en las que muchas veces se observan translocaciones que no interrumpen directamente los genes respectivos, sino que los separan de su contexto genómico habitual y los colocan en una región de cromatina silenciada.

Aunque la pérdida de función de un gen suele desencadenar fenotipos recesivos, a veces se obtienen fenotipos con herencia dominante. Esto sucede en aquellos casos en los que la disminución de la dosis génica al 50 por ciento de lo que es habitual ya es capaz de provocar el fenotipo patológico. Como es sabido, los genes autosómicos y el cromosoma X en mujeres están en doble dosis génica (hay dos alelos para cada gen), lo que hace que en circunstancias normales se produzcan unos niveles determinados de producto proteico. Habitualmente, la pérdida de uno de los alelos no tiene ningún efecto patológico: aunque sólo se produce la mitad de proteína de lo que sería normal, la cantidad producida por el alelo normal es suficiente para realizar la función respectiva. Sin embargo, en algunos casos la simple disminución de la dosis génica a la mitad, por la inactivación de uno de los alelos mediante cualquier mecanismo muta-

www.FreeLibros.me


CAPITULO 16

5/12/06

07:29

Página 213

16.2 Fenotipos dominantes por ganancia de función Los mecanismos por los que las mutaciones pueden originar una ganancia de función que se manifieste en un fenotipo dominante son variados, pero podemos señalar tres:

Una mutación que altera la proteína de forma que ésta adquiere una nueva función. El mejor ejemplo es el alelo «Pittsburgh» de alfa-1 antitripsina, un enzima con actividad anti-elastasa. Habitualmente, los alelos mutantes de alfa-1 antitripsina producen una pérdida de función, con la consiguiente disminución de la actividad enzimática y el desarrollo de una enfermedad denominada enfisema pulmonar. En cambio, el alelo «Pittsburgh» está debido a una mutación que cambia la metionina en posición 358 a una arginina (M358R). Esto hace que el enzima adquiera una actividad anti-trombina que antes no tenía, dando lugar a un transtorno de la coagulación en vez de provocar enfisema pulmonar. Las mutaciones con ganancia de función son muy frecuentes en cáncer, siendo uno de los principales mecanismos de activación de oncogenes. Por ejemplo, la fusión de los genes BCR y ABL, en pacientes con leucemia mieloide crónica, es el resultado de una translocación (9;22) en la que el gen ABL —una tirosina-quinasa— pierde su región reguladora y queda fusionado con la región 5’ del gen BCR, que se expresa en células progenitoras hematopoyéticas. Esto provoca un nuevo gen de fusión que conduce a una expresión constitutiva y des-regulada de la tirosina-kinasa ABL en células de la serie mieloide en la médula ósea, lo que lleva el desarrollo de la leucemia. Ganancia de función también por la sobre-expresión de un gen, como resultado de duplicaciones o amplificaciones génicas: un segmento genómico que se copia varias veces, de forma que los genes contenidos en ese segmento estarán en un número de copias muy superior al normal. Este también es un mecanismo frecuente en distintos tipos de cáncer. Por ejemplo, el oncogén C-MYC está amplificado en varios tumores (sobre todo en neuroblastomas), C-ERBB2 en tumores de mama, etc. Aunque estas amplificaciones pue-

www.FreeLibros.me

213

Fenotipos dominantes por ganancia de función

cional de los que se han estudiado, provoca el desarrollo del fenotipo patológico. Cuando esto sucede, se habla de enfermedades causadas por haploinsuficiencia o insuficiencia haploide, que lógicamente se heredan con un patrón dominante. Aunque hay bastantes enfermedades humanas causadas por haploinsuficiencia, un buen ejemplo es el Síndrome de Turner (45,X0), en el que basta la pérdida de una copia de los genes implicados para que se desarrollen las características fenotípicas propias de esta enfermedad. En concreto, se ha visto que uno de los genes responsables de esta enfermedad (SHOX) se localiza en la región pseudoautosómica del cromosoma X y habitualmente escapa a la inactivación del cromosoma X, por lo que en condiciones normales está presente en doble dosis génica. Cuando se pierde una copia de este gen (por la ausencia de uno de los cromosomas X), la única copia que queda no es suficiente para llevar a cabo correctamente su función y esto parece ser la causa de la talla corta de las mujeres con Síndrome de Turner.


CAPITULO 16

5/12/06

07:29

Página 214

den verse en un cariotipo convencional como regiones de tinción homogénea (Homogenous Staining Regions, HSR), o también como «Dobles Diminutos» (cromosomas minúsculos), la técnica de FISH las detecta con mucha mayor sensibilidad y permite además contar el número de veces que el gen se ha amplificado.

214

Efectos fenotípicos de las mutaciones

La Figura 16.1 muestra algunos ejemplos de mutaciones que producen ganancia de función en cáncer.

Por un efecto dominante-negativo. Consiste en que ciertos tipos de genes codifican moléculas que funcionan como dímeros o forman parte de complejos multiméricos, de modo que basta la mutación en uno de los alelos del gen para que las moléculas proteicas mutantes desestabilicen totalmente los complejos de los que forman parte. Un ejemplo típico es el de enfermedades que afectan a los genes que codifican alguna de las cadenas de colágeno. La molécula de pro-colágeno es un trímero formado por distintos tipos de cadenas, cuya combinación da lugar a los diferentes tipos de colágeno que existen. De modo general, una mutación en el gen de una de las cadenas provocará la desestabilización de todo el complejo trimérico, por lo que basta la mutación en un solo alelo para que se desarrolle la enfermedad. En estos casos, puede darse la circunstancia de que una mutación puede tener distinta gravedad en función del número de moléculas mutantes y nativas que se generan.

En la Figura 16.2 se ilustra el efecto dominante negativo de las mutaciones que provocan la desestructuración de las moléculas de procolágeno tipo I.

Todo lo dicho hasta ahora supone, en cierta medida, una simplificación con fines didácticos. De hecho, existen algunos genes en los que distintas mutaciones pueden originar tanto una pérdida como una ganancia de función, llevando al desarrollo de fenotipos y enfermedades distintas según se trate de una pérdida o una ganancia. Ya hemos visto, por ejemplo, el caso del gen del receptor de andrógenos, en el que la expansión de un trinucleótido provoca la enfermedad de Kennedy (atrofia muscular espino-bulbar) mientras que las mutaciones con pérdida de función dan lugar al llamado Síndrome de feminización testicular. Otro ejemplo es el de PMP22 (localizado en 17p11.2), un gen sensible a dosis en el que la duplicación de uno de los alelos —lo que supone la existencia de tres copias funcionales del gen— provoca la enfermedad de Charcot-Marie-Tooth (un tipo de neuropatía periférica). Por el contrario, la pérdida de uno de los alelos por deleción o —menos frecuentemente— por mutación puntual provoca otra neuropatía distinta llamada «Neuropatía hereditaria con parálisis por presión». A continuación veremos otras dos situaciones especiales que sirven para ilustrar muy bien la variedad de efectos fenotípicos que se obtienen por mutaciones. En primer lugar estudiaremos el fenómeno de la impronta genómica y sus alteraciones; después veremos algunas alteraciones en el desarrollo embrionario debidas a mutaciones en genes que codifican factores de transcripción y receptores de membrana.

www.FreeLibros.me


CAPITULO 16

5/12/06

07:29

Página 215

16.3 Alteraciones de la impronta genómica

215

El imprinting o impronta genómica es la marca epigenética que define una región genómica como materna o paterna en el cigoto. La existencia de este fenómeno se descubrió al crear embriones de ratón por transferencia nuclear: cambiando un pronúcleo masculino por un segundo pronúcleo femenino se obtiene un ginogenonte; reemplazando el pronúcleo femenino por un segundo pronúcleo masculino se obtiene un androgenonte. En teoría, estos embriones (excepto los androgenontes YY) deberían ser viables, pero en cambio se observó que estas modificaciones son letales en el periodo embrionario, y que esa letalidad tiene dos formas diferentes: los ginogenontes muestran un embrión normal con falta de desarrollo de tejidos extraembrionarios, mientras que los androgenontes muestran más alteraciones en el embrión que en tejidos extraembrionarios. En humanos, las concepciones uniparentales androgenéticas, que se originan raramente por la pérdida de los cromosomas maternos poco después de la fertilización, se manifiestan en una estructura que se conoce como mola hidatidiforme completa. Por el contrario, los oocitos que se dividen por partenogénesis sólo contienen material materno, y dan lugar a quistes dermoides. Estos hallazgos se explican actualmente por la existencia en el genoma de genes «improntados» (sometidos al fenómeno de la impronta), en los que de algún modo se reconoce el origen parental de cada alelo y se produce el silenciamiento selectivo de uno de ellos: en unos casos siempre se silencia el materno, en otros genes siempre se silencia el alelo paterno. Por tanto, cuando el núcleo del cigoto sólo contiene material de uno de los progenitores, pero no una mezcla de ambos, los embriones resultantes son inviables. Esto sugiere la existencia de una asimetría de los genomas materno y paterno, en cuanto a que ambos genomas tienen silenciados distintos grupos de genes. Esta asimetría es necesaria para el correcto desarrollo embrionario. Dado que ambos alelos de los genes sometidos a imprinting son idénticos y capaces de interaccionar con los mismos factores de transcripción, el mecanismo que silencia uno de ellos de manera estable y heredable debe ser un mecanismo epigenético, que haga posible que el imprinting pueda borrarse durante la gametogénesis y re-establecerse tras la fecundación. La metilación, como mecanismo silenciador de la expresión génica, cumple la mayor parte de estos requisitos, y hay bastantes líneas de evidencia que apoyan el papel de la metilación en el fenómeno de imprinting: 1) todos los genes improntados descritos hasta el momento —excepto uno— muestran regiones con metilación diferencial (abreviadas DMR en inglés, regiones que están metiladas en uno de los alelos pero no en el otro), cuyos patrones de metilación se establecen durante la gametogénesis y se mantienen gracias a la metilación específica de ADN hemi-metilado; 2) los embriones de ratón dnmt1-/- (que carece de ADNmetiltransferasa-1) muestran expresión bi-alélica de genes improntados, es decir, en ausencia de la metilasa de mantenimiento se re-expresa el alelo que estaba silenciado; 3) se ha descrito el caso de una mujer con mutaciones en el gen DNMT3L (que codifica una metilasa) que tiene infertilidad porque los embriones fallecen al implantarse en el útero; y 4) no se ha encontrado un fenómeno similar al imprinting en especies incapaces de llevar a cabo metilación. Igualmente, se ha comprobado que los genes sometidos a imprinting también se replican de manera asincrónica: por FISH se suelen ver dos señales de hibridación

Alteraciones de la impronta genómica

www.FreeLibros.me


CAPITULO 16

216

5/12/06

07:29

Página 216

Efectos fenotípicos de las mutaciones

correspondientes a las dos cromátides que se forman durante la fase S del ciclo celular, pero en genes improntados se ve un cromosoma con dos señales y el otro cromosoma homólogo con una sola señal. Esto sugiere que el alelo específicamente silenciado se replica más tarde. Existen varios modelos para explicar cómo la metilación diferencial da lugar a las diferencias de expresión entre alelos paterno y materno, y cómo se regulan genes vecinos que tienen patrones de imprinting opuestos. Parece claro que en algunos casos es muy importante la proteína CTCF (CTC-binding factor) una proteína que se une a la las regiones de metilación diferencial (DMR) únicamente cuando éstas no están metiladas. Por ejemplo, se ha visto que la regulación de los genes Igf2 y H19 en ratón (que tienen patrones de imprinting opuestos) se lleva a cabo por este mecanismo, ya que CTCF actúa como aislador (insulator) del promotor de Igf2 de unos potenciadores lejanos.

Alelo 1 Me

Alelo 2

Alelo 1 Me

Alelo 2

Alelo 1 Me

Alelo 2 La Figura 16.3 muestra varios modelos de regulación de los genes que están sometidos a imprinting.

La importancia de la proteína CTCF se ha puesto de manifiesto gracias a un hallazgo sorprendente, al conseguir ratones partenogenéticos viables cuando se deleciona de su genoma el gen H19 y la región de metilación diferencial a la que se une CTCF. Inicialmente, un ratón partenogenético lleva dos copias del genoma materno, por lo que tendrá expresión bialélica del gen H19 y silenciamiento de ambos

www.FreeLibros.me


CAPITULO 16

5/12/06

07:29

Página 217

El vídeo de la Figura 16.4 muestra la importancia del fenómeno del imprinting en el desarrollo embrionario.

En cada ciclo reproductivo, los patrones de imprinting han de establecerse de nuevo, puesto que lo que en una meiosis fue material de origen paterno (transmisión de un varón a su hija, por ejemplo) en la siguiente meiosis pasará a ser marcado como materno (cuando esa hija tenga descendencia). Para poder cambiar el imprinting es necesario borrar toda la información previa sobre cuál de los alelos debe silenciarse. Como el genoma está muy desmetilado en los gametos, el cambio en los patrones de imprinting debe de tener lugar durante la gametogénesis. Con los datos actuales, la hipótesis más aceptada para explicar el borrado y re-establecimiento de los patrones de metilación durante la gametogénesis es la existencia de proteínas capaces de unirse a las DMR no-metiladas (y así protegerlas de la metilación), junto con otros factores que se unen a las DMR metiladas y ayudan a mantener el estado silenciado. Se piensa que sólo una de las líneas germinales (masculina o femenina) es capaz de producir los factores que protegen de la metilación a las regiones nometiladas. Así, estas regiones se mantendrán des-metiladas en la línea germinal que produzca estos factores. Por el contrario, estas regiones se metilarán y silenciarán en la línea germinal que no los produce. Por lo que respecta a la identidad de dichos factores, los candidatos ideales son las proteínas que se unen específicamente a regiones metiladas (MeCP2, HDAC, etc.) o a regiones no metiladas (CTCF, factores de transcripción que se unen a CpGs no metilados, etc.). La impronta es, por tanto, un mecanismo fisiológico normal. Sin embargo, algunas alteraciones genéticas que afectan a regiones sometidas a imprinting pueden dar lugar a enfermedades. Este es el caso de la llamada disomía uniparental, situación en la que ambas copias de un cromosoma o de una región cromosómica proceden del mismo progenitor. Si esa región contiene genes «improntados», el resultado puede ser la presencia de dos copias «silenciadas» de un gen, con lo que el efecto viene a ser similar a una deleción homocigótica de ese locus. Hoy en día conocemos una larga lista de enfermedades y tumores humanos debidos a disomía uniparental de loci sometidos a impronta. Además, se han detectado regiones improntadas en los cromosomas 11, 15, 7 y 14, y actualmente se conocen unos 30 genes improntados en ratón y humanos.

www.FreeLibros.me

217

Alteraciones de la impronta genómica

alelos de Igf2, de ahí que sean inviables. La deleción de una de las copias del H19 reestablece la expresión monoalélica de este gen, pero todavía hay silenciamiento total de Igf2 e inviabilidad embrionaria. En cambio, si además se deleciona la región de metilación diferencial a la que se une CTCF, ahora los potenciadores pueden promover la expresión de Igf2 en este cromosoma, con lo que se reestablece la expresión monoalélica de Igf2. El resultado final es la expresión monoalélica de H19 de uno de los cromosomas y la expresión monoalélica de Igf2 del cromosoma homólogo, que es la situación normal. Esto ilustra la importancia que tiene la impronta genómica en el desarrollo embrionario, y sugiere que la ineficacia de los procesos de clonación de mamíferos probablemente se deba a que los núcleos somáticos utilizados para la transferencia nuclear no tienen los patrones de imprinting necesarios para la viabilidad embrionaria.


CAPITULO 16

218

5/12/06

07:29

Página 218

Efectos fenotípicos de las mutaciones

Los loci sometidos a impronta tienden a aparecer agrupados en determinadas regiones cromosómicas, de manera que —dentro de cada uno de estos grupos o clusters— unos genes muestran expresión materna y otros genes muestran expresión paterna. Esto se ilustra con el ejemplo de dos enfermedades llamadas Síndrome de Prader-Willi y Síndrome de Angelman, originados por alteraciones en el grupo de genes improntados que se encuentran en 15q11-q13. Todos los genes improntados en esta región muestran expresión específica del alelo paterno excepto el gen UBE3A, que muestra expresión materna en cerebro. Parece que la expresión de UBE3A depende de la expresión de un transcrito antisentido que comienza 6,5 kb en dirección 3’ del codón de parada de UBE3A y que alcanza hasta la mitad 3’ de UBE3A, de manera que en la mayoría de los tejidos somáticos este transcrito no se expresa y por tanto la expresión de UBE3A en estos tejidos es bialélica. Por el contrario, el transcrito antisentido se expresa en células de Purkinje, neuronas del hipocampo y células mitrales olfatorias, silenciando el alelo paterno y originando el imprinting de UBE3A en estos tejidos.

PAR - 5 NECDINA

SNRPN

IPW PAR - 1

ZNF127

UBE3A Antisense

Paterno

Materno En la Figura 16.5 se muestra el cluster de genes sometidos a imprinting en 15q11, cuyas alteraciones causan los síndromes de Prader-Willi y de Angelman.

Por estudios en pacientes con microdeleciones, sabemos que el centro de imprinting de esta región es bipartito y cubre en total unas 100 kb. Dentro de esta región, el centro de imprinting para Angelman cubre 1,15 kb, mientras que el centro de imprinting Prader-Willi es más distal y cubre unas 4,3 kb (incluyendo el promotor y el exón 1 del gen SNRPN). Se postula que durante la gametogénesis estos centros fijan los patrones de expresión de toda esta región, de forma que en la oogénesis se activa el centro de imprinting AS —que, a su vez, bloquea la función del centro de imprinting PW—. Como resultado, los gametos femeninos sólo expresan el gen UBE3A. En cambio, en la espermatogénesis el centro AS estaría bloqueado, de manera que

www.FreeLibros.me


CAPITULO 16

5/12/06

07:29

Página 219

1.

2.

3.

4.

Deleciones grandes de la región: producirán Síndrome de Prader-Willi (SPW) si la deleción afecta al cromosoma paterno, o Síndrome de Angelman (AS) si la deleción afecta al cromosoma materno. Constituyen la principal causa de estas enfermedades (70 por ciento de todos los casos). Disomía uniparental (UPD), debida a no-disyunción durante una de las meiosis parentales. En efecto, la no-disyunción puede originar gametos disómicos o nulisómicos, que originan cigotos trisómicos o monosómicos. En estas circunstancias, la disomía uniparental puede ser resultado tanto de la recuperación de un cigoto trisómico por pérdida de uno de los cromosomas, como de la duplicación completa de un cromosoma para recuperar un cigoto monosómico. En este último caso vemos una isodisomía (ambos cromosomas provienen de la duplicación de un mismo cromosoma parental), mientras que un 70 por ciento de los casos de reducción de cigotos trisómicos dan lugar a heterodisomía (presencia de los dos cromosomas del mismo progenitor). La presencia de dos cromosomas 15 paternos da lugar a un dos por ciento de los casos de Síndrome de Angelman, mientras que el 25 por ciento de los casos de Síndrome de Prader-Willi se deben a la presencia de dos cromosomas 15 maternos. Mutaciones puntuales en los genes responsables. En el Síndrome de Angelman se detectan mutaciones en el gen UBE3A (que codifica la E6 ubiquitinligasa) hasta en un 20 por ciento de los enfermos. En el caso del Síndrome de Prader-Willi, en cambio, la búsqueda de un gen candidato no ha dado resultados, aunque el principal gen implicado es SNRPN. En el caso concreto de este gen (SNRPN), se ha visto que existe otra secuencia codificante en dirección 5’ (SNURF por SNRPN Upstream Reading Frame) de manera que, de hecho, ambos forman un único gen bicistrónico: un solo transcrito del que se traducen dos proteínas. Con los datos actuales, hay que considerar el Síndrome de Prader-Willi como un síndrome de microdeleción causado por la pérdida de varios genes contiguos. Mutaciones o microdeleciones que afectan a los centros de imprinting, de manera que no se podrán re-establecer los patrones durante la gametogé-

www.FreeLibros.me

219

Alteraciones de la impronta genómica

el centro de imprinting PW es ahora activo y promueve la expresión de todos los genes de expresión paterna, incluido el gen antisentido que bloquea la expresión de UBE3A. De este modo se crean los epigenotipos paterno y materno que se mantendrán durante el desarrollo embrionario y en células somáticas adultas. El Síndrome de Prader-Willi, cuya incidencia estimada es de 1/25 000, se caracteriza por disminución de la actividad fetal, obesidad, hipotonía muscular, retraso mental, hipogonadismo hipogonadotrófico, manos y pies pequeños, hipopigmentación, baja estatura y rasgos dismórficos. Se debe a la falta de expresión de los genes específicos del cromosoma paterno dentro de esta región. Por el contrario, el Síndrome de Angelman tiene una incidencia de 1/15 000 nacimientos y está caracterizado por un fenotipo distinto al de Prader-Willi: retraso mental severo, temblor, ataxia, marcha anormal, tendencia a la risa, trastornos del sueño y convulsiones. Está provocado por la falta de expresión del gen UBE3A, que se expresa específicamente en el cromosoma materno. Las alteraciones de la impronta de todos estos genes pueden tener lugar por varios mecanismos:


CAPITULO 16

5/12/06

07:29

Página 220

nesis en el caso de que haya transmisión de un sexo al opuesto (madrehijo o padre-hija). El resultado funcional en el cigoto es idéntico a lo que sucede en la disomía uniparental: ambos alelos llevan el mismo patrón de imprinting. Este tipo de alteraciones son responsables de un cinco por ciento de los casos de Síndrome de Prader-Willi o de Síndrome de Angelman. El ejemplo típico es el de la abuela paterna portadora de una mutación en el centro de imprinting del cromosoma 15 que lleva marcado como materno. Al transmitir este cromosoma a un hijo varón, el cromosoma mutado pasará a su hijo marcado como materno, por lo que no es necesario reestablecer el imprinting y el hijo será normal (llevará un cromosoma marcado como paterno y otro como materno). En la siguiente generación, en cambio, este individuo varón deberá pasar su cromosoma 15 marcado como paterno, por lo que la marca que lo identificaba como materno deberá ser borrada durante la espermatogénesis y sustituida por la marca que lo identifique como paterno. En este individuo dicho cambio será imposible, debido a la mutación en el centro de imprinting de su cromosoma 15 materno, por lo que su descendencia llevará dos cromosomas con epigenotipo materno y desarrollará Síndrome de Prader-Willi. Lo mismo puede suceder para el Síndrome de Angelman, cuando la mutación del centro de imprinting afecta al cromosoma paterno.

220

Efectos fenotípicos de las mutaciones

El diagnóstico genético en estas dos enfermedades va dirigido a la detección de deleciones, de disomía uniparental o de alteraciones en el centro de imprinting, y se realiza por los siguentes procedimientos:

• • • •

Cariotipo convencional: es insuficiente para detectar la microdeleción típica, pero es útil en el probando y en los padres para detectar posibles translocaciones, ya que un pequeño porcentaje de las deleciones son fruto de translocaciones no equilibradas (casi siempre de novo). También detectará translocaciones equilibradas de novo o heredadas, aunque estos casos son excepcionales. FISH: detecta todas las deleciones, usando sondas frente al gen SNRPN en combinación con una sonda centromérica del cromosoma 15. La mayoría de las deleciones son intersticiales, siendo la más frecuente una pequeña deleción de unas 4 Mb de tamaño. Detección de Disomía Uniparental: se usan microsatélites del cromosoma 15 para determinar el origen parental de cada cromosoma. Lógicamente, es necesario descartar primero la presencia de deleción, y además este procedimiento viene limitado por la necesidad de obtener muestras del probando y de ambos progenitores, así como por la posible falsa paternidad. Análisis de metilación: puede hacerse bien por Southern blot tras digestión del ADN genómico con enzimas de restricción sensibles a metilación, o por PCR específica de metilación (MS-PCR). Si el exón 1 de SNRPN y el centro de imprinting adyacente están metilados en los dinucleótidos CpG, esto indica un patrón materno; si no están metilados, podemos excluir el silenciamiento de SNRPN y los demás genes de expresión paterna. Es un análisis que no requiere muestras de los progenitores, y permite confirmar la existencia de Síndrome de Prader-Willi cuando se observa sólo el patrón de metilación materno. Tiene la ventaja de que si el análisis es normal (es decir, si se observan

www.FreeLibros.me


CAPITULO 16

5/12/06

Página 221

dos patrones distintos de metilación, correspondientes a los cromosomas paterno y materno), esto automáticamente excluye la presencia de deleción o de disomía uniparental. Cuando esta prueba es anormal (patrón únicamente materno) y no se detecta deleción ni disomía uniparental, esto sugiere la existencia de alteraciones en el centro de imprinting. En el caso concreto del Síndrome de Angelman también es necesario buscar mutaciones en UBE3A: aunque esto sólo supone un 20 por ciento de los pacientes, su detección es de gran importancia por el aumento dramático en el riesgo de recurrencia de la enfermedad en la misma familia. Se estima que hasta un tercio de los pacientes que tienen estudios de metilación normales tienen mutaciones en UBE3A, por lo que la estrategia diagnóstica recomendada es comenzar con estudios de metilación y después buscar mutaciones de UBE3A en aquellos sujetos con resultados de metilación normales.

La Figura 16.6 muestra la estrategia diagnóstica en los síndromes de Prader-Willi y Angelman.

En el Síndrome de Prader-Willi el riesgo de recurrencia (un segundo individuo enfermo en la misma familia) es prácticamente cero en los casos de deleción y de disomía uniparental que no están asociados a reordenaciones cromosómicas. De todas formas, a efectos de consejo genético se considera un riesgo de recurrencia del uno por ciento, ya que en una muestra amplia de pacientes se detectó un riesgo de recurrencia en hermanos de probandos del 1,6 por ciento (aunque esto incluía todas las posibles causas). El mayor riesgo de recurrencia se produce en los casos familiares que están debidos a alteraciones en el centro de imprinting. En estos casos, el riesgo de recurrencia es del 50 por ciento ya que volverá a suceder siempre que el padre transmita el cromosoma 15 que lleva la mutación. En el Síndrome de Angelman, el riesgo de recurrencia también se considera habitualmente del uno por ciento, excepto en los casos de mutaciones del centro de imprinting y de mutaciones en UBE3A, en las que el riesgo de heredar el cromosoma materno mutado es del 50 por ciento (si el cromosoma mutado se hereda del padre no hay enfermedad porque en ese cromosoma el gen UBE3A no se expresaría en cualquier caso).

16.4 Mutaciones que afectan a la morfogénesis El estudio comparativo del desarrollo embrionario en humanos, ratón y Drosophila ha permitido identificar los mecanismos genéticos por los que se generan varias enfermedades congénitas de la morfogénesis. En general, estas mutaciones afectan sobre todo a genes que codifican dos tipos de proteínas: A) Factores de transcripción: son proteínas con actividad reguladora de la expresión génica gracias a que poseen dos propiedades principales: capacidad de unión a determinados elementos en el ADN y capacidad de transactivación de otros factores proteicos. Los factores de transcripción tienen, por tanto, un dominio de unión al ADN y un dominio de transactivación por el que se une a los otros componentes de un complejo activador o represor de la transcripción. Hay cuatro tipos principa-

www.FreeLibros.me

221

Mutaciones que afectan a la morfogénesis

07:29


CAPITULO 16

222

5/12/06

07:29

Página 222

Efectos fenotípicos de las mutaciones

les de dominios de unión al ADN que se encuentran en la gran mayoría de factores de transcripción: 1) HTH (helix-turn-helix o hélice-vuelta-hélice), presente sobre todo en factores de transcripción que intervienen en la regulación de la expresión génica durante el desarrollo embrionario. El ejemplo mejor conocido es el homeodominio, que está presente en los genes homeobox que determinan la identidad posicional de las células a lo largo del eje craneo-caudal del embrión; 2) dedos de zinc, que suelen unirse a elementos de respuesta en el ADN; 3) cremalleras de leucina, con una hélice en la que hay una leucina cada siete aminoácidos de manera que quedan en la misma cara de la hélice y dimerizan fácilmente; 4) HLH (helix-loop-helix o hélice-lazo-hélice) son similares a cremalleras de leucina y también forman homoy heterodímeros; ambos son importantes en la regulación de procesos de diferenciación celular y desarrollo embrionario. En la Figura 16.7 se muestra la estructura de algunos factores de transcripción.

Entre los síndromes malformativos debidos a alteraciones en factores de transcripción encontramos varios grupos:

Las extremidades se organizan en torno a tres ejes (Antero-Posterior, DorsoVentral y Proximal-Distal), y se desarrollan a partir de un brote en el que hay una intensa actividad mitótica en la llamada zona de progresión, actividad que es inducida por el repliegue apical ectodérmico. Esta actividad mitótica está en equilibrio con los procesos de apoptosis de células del mesénquima, que da lugar a los espacios interdigitales e interóseos. El principal mecanismo de formación del eje antero-posterior es la vía de señalización intracelular de las proteínas Hedgehog, integrada por SHH, los factores de transcripción GLI1, GLI2 y GLI3, y los receptores Patched (PTCH) y Smoothened (SMO). El gen llamado Sonic Hedgehog (SHH) se expresa en la línea media del Sistema Nervioso Central, en la notocorda y en la Zona de Actividad Polarizante, que es la región que determina la «posterioridad» de un miembro. En general, la disregulación de este gen provoca sindactilia (fusión de dos o más dedos) y/o polidactilia, (aparición de uno o más dedos «extra») que tienden afectar a los dedos cercanos al pulgar (preaxiales) en casos de sobre-expresión de SHH, o bien afectan a los dedos cercanos al meñique (centrales/postaxiales) en casos de represión de este gen. Sin embargo, no se han encontrado mutaciones de SHH en malformaciones de miembros, pero sí en pacientes con holoprosencefalia autosómica dominante. Esta enfermedad se origina por el desarrollo defectuoso del cerebro anterior y de la cara, con unas manifestaciones muy variables que van desde un incisivo único hasta individuos con un solo ojo (cíclopes), pero es genéticamente heterogénea ya que mutaciones en otros genes como ZIC2, SIX3, TGIF y PATCHED también la causan. Por otro lado, las mutaciones del gen PTCH (localizado en 9q22.3) causan el Síndrome de Gorlin autosómico dominante (carcinoma nevoide de células basales), que además cursa frecuentemente con polidactilia pre- o postaxial, o bien sindactilia del 3º y 4º dedos del pie. Finalmente, los factores de transcripción GLI comparten el dedo de zinc de la proteína codificada por

www.FreeLibros.me


CAPITULO 16

5/12/06

07:29

Página 223

La Figura 16.8 ilustra el desarrollo de los miembros y la función de varios genes en este proceso.

Los genes que codifican proteínas con el homeodominio se denominan genes homeobox (la homeobox es la «caja» o secuencia de ADN que codifica el homeodominio), y se agrupan en varias familias. En Drosophila, el plan corporal se regula durante la embriogénesis por la expresión del grupo de genes HOM-C, organizados en un complejo Antennapedia (3’, estructuras anteriores) y un complejo Bithorax (5’, estructuras posteriores). Los factores de transcripción que regulan la expresión de estos genes son el grupo trithorax (regulación positiva) y el grupo polycomb (regulación negativa). Los ortólogos humanos de HOM-C son la familia de genes HOX, de los que hay cuatro grupos parálogos (cada grupo se denomina por una letra de la A a la D). Dentro de un grupo, cada gen se designa con un número del 1 al 13 en dirección 3’ a 5’. Así, los parálogos 1 determinan regiones anteriores y los parálogos 13 las regiones posteriores del eje corporal. El desarrollo de las extremidades tienen una fase inicial en la que es importante la expresión de genes HOX, y de hecho se ha descrito un tipo de sin-polidactilia en pacientes que tienen un aumento de 7-14 alaninas en el gen HOXD13, expansión que provoca una ganancia de función de dicho gen. También se han encontrado mutaciones en HOXA13 en pacientes con Síndrome mano-pie-genital, caracterizado por hipoplasia del quinto dedo de manos y pies y malformaciones genitourinarias (hipospadias o útero bicorne). Los genes de la familia Pax codifican factores de transcripción que contienen un dominio de unión al ADN de 128 aa con dos regiones de hélice-vuelta-hélice, llamado paired domain porque originalmente se encontró en el gen paired de Drosophila. Además, los factores Pax3, Pax4, Pax6 y Pax7 también contienen un homeodominio. Las mutaciones en el dominio paired de PAX6

www.FreeLibros.me

223

Mutaciones que afectan a la morfogénesis

el gen cubitus interruptus de Drosophila, y actúan como activadores o represores de la vía de transducción de señales de SHH. Por ejemplo, el Síndrome de cefalopolisindactilia de Greig (polidactilia postaxial de manos, preaxial de pies, macrocefalia, frente prominente con hipertelorismo leve), de herencia autosómica dominante, se debe a haploinsuficiencia de GLI3 por mutaciones que destruyen el dedo de zinc de este gen, de manera que se produce expresión ectópica preaxial de SHH (GLI3 normalmente inhibe la expresión de SHH). En cambio, GLI3 también parece implicado en el Síndrome de Pallister-Hall (hamartomas hipotalámicos con malformaciones de extremidades), por mutaciones que respetan el dedo de zinc y por tanto mantienen constitutivamente la actividad represora sobre SHH. Un mecanismo similar parece implicado en la Polidactilia postaxial tipo A (en la que se ha identificado una mutación de GLI3 que respeta el dedo de zinc). Por su parte, el Síndrome de Rubinstein-Taybi (retraso psicomotor y del crecimiento, dismorfismo facial, anomalías de los pulgares y, raramente, polidactilia preaxial de los pies) se debe a mutaciones en CBP: como GLI se transactiva a través de un dominio de unión a CBP, la ausencia de este factor provoca una expresión baja de GLI, seguida por la expresión anormalmente elevada de SHH.


CAPITULO 16

5/12/06

07:29

Página 224

224

Efectos fenotípicos de las mutaciones

1 HOX A

2

3

4

5

6

7

8

9

10

11

12

13 5’

3’

HOX B HOX C HOX D

Bithorax Antennapedia

La Figura 16.9 muestra un esquema de los genes homeobox humanos.

causan anomalías oculares (aniridia, anomalía de Peters, distrofia corneal, catarata congénita e hipoplasia de la fovea). En estos casos, la aniridia (o, a veces, anoftalmia) no parece producirse por un efecto dominante negativo, sino por haploinsuficiencia del gen PAX6, ya que los heterocigotos sólo tienen aniridia pero en cambio los homocigotos padecen anoftalmia, lo cual sugiere un efecto de dosis. Las mutaciones en PAX6 también son responsables de la aniridia del Síndrome WAGR, por una microdeleción en 11p13 que deleciona todo el gen. Por lo que respecta al gen PAX3, algunas mutaciones en el mismo producen el Síndrome de Waardenburg tipo 1 (distopia cantorum, pigmentación anormal y sordera sensorioneural), mientras que otras mutaciones en este mismo gen dan lugar al Síndrome de Klein-Waardenburg (lo anterior más camptodactilia y malformaciones de las extremidades). Otro miembro de esta familia, el gen PAX8, está mutado en casos familiares de disgenesia tiroidea. Por su parte, las mutaciones que afectan al gen PAX2 causan una condición autosómica dominante que incluye colobomas del nervio óptico, anomalías renales y reflujo vesico-ureteral. SRY es el gen que controla el desarrollo de la gónada masculina y, lógicamente, se localiza en el cromosoma Y. La proteína codificada por SRY contiene una caja HMG (High Mobility Group), que es un motivo de 79 aas por el que la proteína se une al ADN y lo dobla hasta 130 grados, con lo que favorece la activación de genes cercanos. Las mutaciones en SRY son causa de la aparición de individuos con cariotipo XY que fenotípicamente son mujeres. Otros genes relacionados con SRY son los genes de la familia SOX; por ejemplo, SOX9 está mutado en una enfermedad autosómica dominante llamada Displasia campomélica (inversión de sexo en varones, arqueamiento congénito de huesos largos, paladar hendido, ausencia de costillas y tórax pe-

www.FreeLibros.me


CAPITULO 16

5/12/06

07:29

Página 225

B) Receptores de las vías de transducción de señales: constituyen otro gran grupo de proteínas que suelen dar lugar a fenotipos de herencia dominante, habitualmente por un efecto dominante negativo de las moléculas mutadas. A continuación se señalan dos de los ejemplos más ilustrativos: El vídeo de la a 16.10 ilustra la estructura y funcionamiento de los receptores tirosina-quinasa, así como el efecto dominante negativo de las mutaciones que provocan la activación constitutiva de la vía de señalización.

Los genes que codifican receptores para el factor de crecimiento fibroblástico (FGF). Tras la unión del ligando extracelular al receptor, unión mediada por heparán-sulfato de la matriz extracelular, los receptores forman homo- o heterodímeros, se transfosforilan en el dominio quinasa intracelular y a continuación fosforilan proteínas intracelulares implicadas en diversas vías de transducción de señales. Las mutaciones que afectan a los genes de estos receptores (FGFR1, FGFR2 y FGFR3) causan varios síndromes de craniosinostosis y enanismo cuyas bases moleculares están comenzando a comprenderse. Por ejemplo, la Acondroplasia (un tipo de enanismo) es una enfermedad de herencia autosómica dominante debida a mutaciones en el gen del receptor del Factor de Crecimiento Fibroblástico-3 (FGF3). Este receptor forma un homodímero que se activa en respuesta a su ligando natural. En cambio, en los pacientes con acondroplasia se encuentran mutaciones en uno de los alelos del gen, de forma que la molécula mutada conduce a la dimerización del receptor incluso en ausencia de ligando. Como resultado, se obtiene una activación constitutiva de la cascada de señales iniciada por el receptor, que en último término provoca el cierre prematuro del cartílago de crecimiento de los huesos largos y la baja talla característica de esta enfermedad. La mutación más frecuente en casos de acondroplasia es la mutación G380R del gen FGFR3, que afecta al dominio transmembrana del receptor. Curiosamente, mutaciones en otras regiones de este mismo gen causan fenotipos similares pero no idénticos, como por ejemplo la displasia tanatofórica (micromelia e hipoplasia de costillas con fallo respiratorio). Estas enfermedades son de herencia dominante por el efecto dominante negativo de estas mutaciones, que hace que con una sola molécula mutada se produzca la activación constitutiva del receptor en ausencia de ligando. Respecto a mutaciones en otros genes que codifican receptores de FGF (FGFR1 y FGFR2), también causan enfermedades con alteraciones de huesos y cartílagos, como el Síndrome de Crouzon (craniosinostosis, bien aislada o bien asociada con otros defectos esqueléticos), el Síndrome de Pfeiffer (pulgares y primer dedo del pie anchos con

www.FreeLibros.me

225

Mutaciones que afectan a la morfogénesis

queño). Se piensa que las malformaciones esqueléticas de la displasia campomélica se deben a que SOX9 es un factor de transcripción que transactiva secuencias reguladoras que se encuentran en el primer intrón del gen COL2A1, que da lugar al colágeno tipo II. Por tanto, la falta de SOX9 lleva consigo una producción insuficiente de cadenas alfa-1 del colágeno tipo 2, con las consiguientes malformaciones en huesos y cartílagos.


CAPITULO 16

5/12/06

226

Efectos fenotípicos de las mutaciones

07:29

Página 226

anquilosis interfalángica), el Síndrome de Jackson-Weiss (lo anterior más coalescencia tarso-metatarsiana) y el Síndrome de Apert (sindactilia severa). Mutaciones que afectan al gen RET. Este gen codifica un receptor tirosinaquinasa, cuyo ligando es el GDNF (Glial cell line-Derived Neurotrophic Factor). Las mutaciones de RET son muy interesantes, ya que muestran cómo un mismo gen puede sufrir mutaciones que provocan pérdida o ganancia de función, dando lugar a fenotipos diferentes. En el caso concreto de RET, algunas mutaciones con cambio de sentido afectan a aminoácidos del dominio extracelular o del dominio quinasa, y provocan la activación del receptor de manera independiente de ligando. Estas mutaciones carcinoma medular de tiroides familiar u otros cuadros de cáncer familiar denominados MEN2 (Multiple Endocrine Neoplasia), que son de herencia dominante porque un solo alelo mutado desencadena la enfermedad por un efecto dominante negativo. Por el contrario, algunas mutaciones de RET que llevan a la pérdida de función (mutaciones sin sentido, cambios del marco de lectura, deleciones, etc.) provocan la ausencia de las moléculas del receptor codificadas por el alelo mutado, con el resultado de que la intensidad de la señalización de esta vía se ve disminuida. Esto provoca un déficit en la migración de precursores neurales al tubo digestivo durante el desarrollo embrionario, lo que da lugar a la Enfermedad de Hirschsprung (megacolon agangliónico: ausencia congénita de los plexos submucosos y mientérico del colon distal). Esta enfermedad se hereda con un patrón dominante, aunque también se han identificado mutaciones en otros genes que causan la misma enfermedad con herencia recesiva, como el gen EDNRB del receptor para endotelina B (receptor de proteinas G) o también el gen de su ligando EDN3 (endotelina 3).

www.FreeLibros.me


CAPITULO 17

5/12/06

07:31

Página 227

C APÍTULO 17

Diagnóstico de enfermedades genéticas

Contenidos 17.1 Estrategias generales de diagnóstico de enfermedades genéticas 17.2 Métodos de detección de mutaciones 17.3 Aplicación del ligamiento genético al diagnóstico: el proceso de diagnóstico indirecto de enfer17.3 medades genéticas

17.1 Estrategias generales de diagnóstico de enfermedades genéticas Como en cualquier otro tipo de patologías, el diagnóstico de enfermedades genéticas se realiza mediante la identificación clínica de los síntomas y signos que caracterizan cada síndrome concreto, apoyado en datos de laboratorio. Con los avances del Proyecto Genoma Humano, hoy en día es posible, en muchos casos, analizar directamente la alteración causal a nivel del ADN. De todas formas, en el entorno clínico nos encontramos varios problemas que pueden dificultar el diagnóstico correcto. En primer lugar, la posible presencia de heterogeneidad genética: varios genes pueden ser los responsables de una única enfermedad. Esta circunstancia hace muy laborioso el estudio mutacional, ya que multiplica el número de exones que hay que analizar. Incluso en aquellos casos en los que se sabe con exactitud qué gen está alterado, puede suceder que las mutaciones responsables del cuadro clínico se distribuyan por todo el gen (fenómeno que algunos autores denominan heterogeneidad alélica), de manera que sería necesario analizar toda la región codificante antes de poder descartar o confirmar que el gen en cuestión está mutado. Lógicamente, si se trata de un gen de gran tamaño, el análisis se hace extremadamente laborioso. La situación opuesta vendría dada por aquellas enfermedades genéticas que están causadas, en la gran mayoría de familias, por una misma mutación, de

www.FreeLibros.me


CAPITULO 17

228

5/12/06

07:31

Página 228

Diagnóstico de enfermedades genéticas

manera que podemos centrarnos en el estudio de esa mutación concreta para confirmar o descartar el defecto molecular que provoca esa enfermedad. Por tanto, hemos de sopesar todas las circunstancias mencionadas para decidir si nos inclinamos por realizar lo que se denomina diagnóstico directo (análisis de un individuo para ver si es portador de la mutación concreta que causa la enfermedad en esa familia), o si por el contrario aplicaremos el denominado diagnóstico indirecto (análisis de marcadores genéticos en la familia para ver si el consultando ha heredado el cromosoma que lleva la mutación). A continuación discutiremos las ventajas e inconvenientes de cada una de estas aproximaciones diagnósticas, así como los métodos más habitualmente empleados. La Figura 17.1 explica las dos estrategias diagnósticas para detectar alteraciones genéticas en enfermedades humanas.

17.2 Métodos de detección de mutaciones Como hemos dicho, el diagnóstico directo consiste en el estudio de un gen —cuya implicación en el desarrollo de una enfermedad ya ha sido demostrada— para detectar la presencia de posibles mutaciones en el mismo. En aquellos casos en que las mutaciones patogénicas pueden estar localizadas a lo largo de toda la secuencia codificante del gen (heterogeneidad alélica fuerte), se deben utilizar métodos «de barrido», que examinan cada exón por separado para detectar simplemente si existe una mutación o no. Estos métodos no identifican el tipo de mutación, pero nos permiten descartar rápidamente todos aquellos exones normales, para centrarnos en el estudio de los exones mutados. En cambio, cuando queremos detectar una mutación concreta, porque ya sabemos que es esta mutación la que origina la enfermedad en esa familia, utilizaremos métodos dirigidos a identificar únicamente esa mutación (métodos «de confirmación»). Estos últimos son quizás los métodos más utilizados en el contexto de un laboratorio diagnóstico, especialmente en aquellas enfermedades que tienen una heterogeneidad alélica limitada, es decir, enfermedades en las que un pequeño número de mutaciones causan la inmensa mayoría de los casos. Los ejemplos más notorios son la mutación C282Y (que causa la mayoría de los casos de Hemocromatosis Hereditaria en europeos); la mutación F508del, responsable de hasta el 80 por ciento de los casos de Fibrosis Quística en individuos nor-europeos; la inversión de los exones 1-22 del gen del Factor VIII de la coagulación (responsable de un 50 por ciento de los casos de hemofilia A); la mutación G380R del gen FGFR3 (que causa la mayoría de los casos de Acondroplasia), las mutaciones N370S y L444P (que detectan la mayoría de los casos de Enfermedad de Gaucher), o las enfermedades por expansión de trinucleótidos (Enfermedad de Huntington, Síndrome del X Frágil, etc.). A continuación analizaremos algunos de los métodos más utilizados en el diagnóstico directo, tanto métodos de barrido como de confirmación. 1.

Métodos de barrido para la detección rápida de mutaciones (sin identificar el tipo concreto de mutación). Excepto en el primero (SSCP) estos métodos se basan en la detección de heteroduplexes, que se forman por la reasociación lenta de las cadenas tras la desnaturalización del fragmento de ADN.

www.FreeLibros.me


CAPITULO 17

5/12/06

07:31

Página 229

SSCP (Single Strand Conformation Polymorphism, Polimorfismo de la Conformación de Cadenas Sencillas). Un cambio en la secuencia provoca cambios conformacionales cuando el ADN se desnaturaliza (se separan las dos cadenas) y se deja que cada cadena se repliegue por separado. Estos cambios conformacionales se detectan porque alteran la migración electroforética en geles de poliacrilamida no-desnaturalizantes. En el ejemplo típico, se amplifica un exón mediante PCR, se desnaturaliza el producto de PCR por calor, se cargan los productos desnaturalizados en un gel de acrilamida, se realiza la electroforesis y se tiñe el gel mediante una tinción específica para el ADN (tinción de plata, por ejemplo). Si no hay mutaciones, se detectarán únicamente las bandas correspondientes al homodúplex (resultado de la reasociación parcial de las dos cadenas complementarias durante la electroforesis) y las bandas correspondientes a cada una de las cadenas sencillas que se han replegado adoptando una conformación determinada. En cambio, la presencia de una mutación dará lugar a nuevas bandas debidas al patrón de plegamiento de las cadenas sencillas mutantes, que será diferente al de las cadenas nativas. Como hemos comentado, este análisis no nos dice de qué tipo de mutación se trata: para eso es necesario secuenciar este producto de PCR y compararlo con la secuencia normal. La ventaja es que nos permite descartar la presencia de mutaciones rápidamente, lo que ahorra tiempo y recursos.

La Figura 17.2 explica gráficamente la técnica de SSCP.

DGGE (Denaturing Gradient Gel Electrophoresis, Electroforesis en Gel con Gradiente Desnaturalizante) y sus variantes, entre las que destaca TGGE (Temperature Gradient Gel Electrophoresis). Esta técnica se basa en someter una muestra de ADN a una electroforesis en geles de acrilamida con un gradiente desnaturalizante químico o térmico, de manera que la muestra se encuentra con condiciones cada vez más desnaturalizantes a medida que avanza por el gel. Las muestras de ADN son productos de PCR (exones, habitualmente) en cuyo extremo hay una región corta muy rica en citosinas y guaninas (región llamada «clamp» o «pinza» GC), de forma que la temperatura de desnaturalización de esta pequeña región es mayor que la del resto del fragmento. Por tanto, cuando el fragmento va avanzando por el gel, llegará un momento en que se desnaturaliza todo excepto la región del clamp-GC. El resultado es que el fragmento se frena y deja de avanzar por el gel. Cuando la muestra de ADN es un heterodúplex que contiene un desemparejamiento, su punto de desnaturalización será distinto al del fragmento nativo, y por tanto se

www.FreeLibros.me

229

Métodos de detección de mutaciones

Cuando el fragmento contiene una mutación y se mezcla con un ADN normal, la desnaturalización-reasociación da lugar a moléculas heteroduplex portadoras de un desemparejamiento (mismatch) precisamente en el nucleótido donde está la mutación.


5/12/06

07:31

Página 230

parará en un punto distinto del gel. Esto se reflejará en la aparición de una banda con distinta migración electroforética.

Electroforesis

Diagnóstico de enfermedades genéticas

Electroforesis

230

Gradiente

CAPITULO 17

Gradiente

La Figura 17.3 ilustra el fundamento de las técnicas que detectan la presencia de heterodúlex, con ejemplos de DGGE y TGGE.

DHPLC (Denaturing HPLC) es una técnica en la que los heterodúplex y homodúplex son separados en un aparato de HPLC (High Performance Liquid Chromatography) utilizando un gradiente desnaturalizante de acetonitrilo y variando la temperatura de la columna. La muestra se injecta en una columna de cromatografía y el ADN se une a la matriz. El acetonitrilo deshace estas interacciones y el ADN eluido se detecta a la salida de la columna midiendo la absorbancia a 260 nm, originando un pico a un tiempo de elución característico. En temperaturas bajas, no desnaturalizantes, la concentración de acetonitrilo necesaria para eluir un fragmento depende del tamaño y la secuencia del mismo, por lo que cada fragmento da lugar a un pico de elución característico. Al aumentar la temperatura de la columna, la elución tiene lugar a concentraciones menores de acetonitrilo, a medida que el fragmento comienza a desnaturalizarse. Como los heterodúplex se desnaturalizan a temperaturas distintas a los homodúplex, generan picos a tiempos de elución diferentes. De este modo es posible detectar mutaciones puntuales. La gran ventaja del DHPLC es su rapidez, ya que los tiempos de elución típicos están en torno a los cinco minutos y una muestra se puede analizar en 10 minutos. Por tanto, conserva la gran sensibilidad de los métodos de detección de heterodúplex que utilizan un gradiente desnaturalizante (temperatura, en este caso), pero tiene una procesividad mucho mayor y es fácilmente automatizable.

La Figura 17.4 presenta ejemplos del análisis mediante DHPLC.

www.FreeLibros.me


CAPITULO 17

5/12/06

Página 231

Rotura de Desemparejamientos (Mismatch Cleavage). Es un método basado en el hecho de que determinados tratamientos químicos o enzimáticos son capaces de romper un fragmento de ADN específicamente en el punto donde existe un desemparejamiento. Como hemos dicho, los heteroduplexes son portadores de un desemparejamiento (mismatch) precisamente en el nucleótido donde está la mutación. Por tanto, el tratamiento con determinadas sustancias romperá el fragmento sólo en el caso de que existan desemparejamientos, de forma que una electroforesis en gel será suficiente para comprobar la presencia de una mutación. PTT (Protein Truncation Test, Prueba de truncamiento de proteínas). Es un método especialmente dirigido a la detección de mutaciones que crean un codón de parada prematuro y provocan el truncamiento de la proteína. Para llevar a cabo esta prueba, se prepara ADNc mediante RTPCR (PCR tras transcripción reversa del ARN del paciente) utilizando un cebador que contiene la secuencia del promotor del fago T7 y la secuencia consenso de inicio de la traducción (secuencia de Kozak). Esta construcción permite realizar la transcripción y traducción in vitro, a partir del producto de la RT-PCR. El análisis en un gel de acrilamida de los fragmentos proteicos que resultan de la transcripción/traducción revelará la presencia de una banda correspondiente al tamaño esperado para la secuencia nativa, o bien otras bandas de menor tamaño correspondientes a todas las posibles mutaciones que provoquen un truncamiento del producto proteico (mutaciones sin sentido, los cambios del marco de lectura y las mutaciones que afectan a las secuencias de ayuste).

La Figura 17.5 ilustra el fundamento de la técnica de PTT.

Secuenciación. Hoy en día, con la aparición de equipos fluorescentes automatizados y con bajo coste por reacción, la secuenciación directa de productos de PCR (exones, o incluso la secuenciación directa de un ADNc obtenido por RT-PCR) es un método cada vez más popular de detección de mutaciones. Tiene la ventaja de que identifica el tipo de mutación, y de hecho es un paso obligado para identificar las mutaciones detectadas por los métodos de barrido que acabamos de explicar. Sin embargo, sólo es realmente fiable cuando el ADN mutado está en una proporción superior al 15-20 por ciento del total de ADN presente en la muestra. Aunque esto se cumple en las enfermedades hereditarias, no es el caso de la detección de mutaciones en muestras procedentes de tumores, en las que con frecuencia la cantidad de células tumorales es baja y no todas son portadoras de una mutación concreta.

Cada uno de los métodos de barrido que hemos visto tiene sus ventajas e inconvenientes, sobre todo en lo referente a la sensibilidad (porcentaje de mutaciones que son capaces de detectar), coste, complejidad técnica, capacidad de especificar la posición de la mutación, etc. Aunque las características de cada método se presentan resumidas en la siguiente tabla, la elección de un método u otro dependerá de las pe-

www.FreeLibros.me

231

Métodos de detección de mutaciones

07:31


CAPITULO 17

5/12/06

07:31

Página 232

232

Diagnóstico de enfermedades genéticas

La Figura 17.6 muestra una mutación detectada mediante secuenciación con terminadores marcados.

culiaridades de cada laboratorio, del gen que se quiera estudiar, los medios disponibles y la experiencia previa con cada uno de los métodos. Método

Ventajas

Inconvenientes

Secuenciación

Detecta todas y especifica la posición.

Excesiva información, coste alto, laboriosa.

SSCP

Sencillo. Buena sensibilidad.

Secuencias <400bp. No especifica posición.

DGGE y DHPLC

Muy alta sensibilidad.

Cierta complejidad. No especifica posición.

Rotura de Desemparejamientos

Muy alta sensibilidad. Puede especificar posición.

Gran dificultad técnica. Toxicidad OsO4.

PTT

Alta sensibilidad. Especifica la posición.

No todos los tipos de mutaciones. Complejidad técnica, coste.

2.

Métodos de comprobación para detectar de la existencia de una mutación específica:

PCR-Digestión. El fundamento de esta técnica reside en el hecho de que la mutación crea o destruye una diana de restricción, de modo que la simple digestión del producto de PCR con el enzima de restricción permite determinar, en un gel de agarosa, el patrón de digestión indicativo de la presencia o ausencia de la mutación. Es un método que, por su sencillez y rapidez, es uno de los más utilizados en laboratorios clínicos. La prin-

www.FreeLibros.me


CAPITULO 17

5/12/06

07:31

Página 233

cipal limitación, lógicamente, es que no todas las mutaciones alteran una diana de restricción.

ASO (Allele Specific Oligonucleotide, Oligonucleótido Específico de Alelo). Una técnica bastante utilizada en los primeros años del diagnóstico molecular, aunque hoy en día ha caído en cierto desuso. Se basa en el diseño de sondas específicas para el alelo mutado y para el alelo nativo, utilizando oligonucleótidos. El tamaño de las sondas hace que su Tm (temperatura de desnaturalización) sea lo suficientemente distinta para que —en determinadas condiciones de hibridación— la sonda específica del alelo normal hibride solamente con ADN normal, y la sonda específica del alelo mutado hibride específicamente con ADN genómico que contiene la mutación. El ADN de los pacientes (puede ser tanto ADN genómico como un exón amplificado mediante PCR) se deposita en membranas de nylon haciendo un «dot-blot», y esas membranas se hibridan con cada una de las sondas (oligonucleótidos marcados con radioactividad o con fluorescencia). El análisis de la hibridación de cada sonda permite identificar si la muestra contiene un solo alelo mutado (heterocigoto), dos alelos mutados (homocigoto para la mutación), o ninguno (homocigoto sano). ARMS (Amplification Refractory Mutation System, Sistema de Mutación Resistente a la Amplificación) está basada en el mismo principio que ASO, es decir, la utilización de oligonucleótidos específicos para la secuencia normal y para la secuencia mutada. La diferencia estriba en que, en el caso del ARMS, estos oligonucleótidos son cebadores de PCR. Se diseñan, por tanto, dos reacciones de PCR que comparten un mismo cebador común pero se diferencian en los cebadores específicos para cada alelo: un cebador amplificará sólo el alelo normal, el otro cebador amplificará sólo el alelo mutado. Dada la rapidez y sencillez de la PCR, esta técnica está desplazando cada vez más a la técnica de ASO. OLA (Oligonucleotide Ligation Assay, Ensayo de Ligación de Oligonucleótidos). Se trata de un método algo más laborioso, pero que —una vez optimizado— permite analizar gran número de muestras con rapidez y fiabilidad. Se basa en la ligación de dos oligonucleótidos, uno de los cuales está marcado con biotina y el otro con una molécula radioactiva o fluorescente. El punto crucial es el diseño de los oligonucleótidos a ambos lados de la base mutada. Por ejemplo, un diseño habitual es que ambos oligos hibriden sobre la secuencia normal, de modo que la mutación impida la hibridación de uno de ellos. Como consecuencia, la reacción de ligación sólo será efectiva en presencia de una secuencia normal. Cuando se separan las sondas y se unen por los residuos de biotina a un soporte que contiene estreptavidinas, sólo las moléculas completas (fruto de la ligación de los dos oligos) emitirán la señal correspondiente al marcador (ra-

www.FreeLibros.me

Métodos de detección de mutaciones

La Figura 17.7 explica el proceso de detección de una mutación específica mediante la digestión de un producto de PCR con enzimas de restricción.

233


CAPITULO 17

5/12/06

07:31

234

Diagnóstico de enfermedades genéticas

Página 234

dioactividad o fluorescencia). Por el contrario, el ADN de un sujeto homocigoto para la mutación no dará ninguna señal. En principio, este método también permite detectar los individuos heterocigotos para la mutación, ya que la intensidad de la señal emitida será la mitad de la de un individuo homocigoto normal. El método de OLA permite la automatización y la cuantificación de la señal cuando se utilizan marcadores fluorescentes, lo que le convierte en un buen método para el análisis de gran cantidad de muestras. MLPA (Multiplex Ligation-dependent Probe Amplification) es una modificación del OLA que permite determinar el número de copias de hasta 45 genes en un solo ensayo, pudiendo discriminar secuencias que difieren en un solo nucleótido. MLPA utiliza, para cada gen, dos sondas: una de ellas es complementaria a la secuencia que se quiere estudiar (21-30 nucleótidos), a la que se añade la secuencia de un cebador universal en el extremo 5’; la otra sonda de la pareja tiene otra secuencia complementaria a la diana, un ADN de relleno —que puede ser de distintos tamaños— y la secuencia de otro cebador universal en el extremo 3’. Ambas sondas hibridan a ambos lados de la secuencia diana, y son ligadas por una ligasa termoestable. Con un solo cebador se pueden amplificar las sondas que se han ligado correctamente. Utilizando secuencias de relleno de distintos tamaños para cada gen, podemos amplificar en una misma reacción muchos fragmentos distintos, lo que ahorra mucho tiempo y reactivos. Además, como las condiciones de reacción son las mismas, la cantidad final de producto es proporcional a la cantidad inicial de ADN, por lo que los resultados de MLPA pueden ser cuantificados. Por tanto, MLPA permite detectar deleciones y amplificaciones, además de detectar mutaciones.

La Figura 17.8 resume los principios generales de varios métodos para la detección de mutaciones específicas, basados en la utilización de oligonucleótidos específicos.

Un comentario final a todas estas técnicas de análisis directo es que pueden aplicarse a ADN procedente de distintos tipos de muestra, ya que trabajan con secuencias amplificadas mediante PCR. Por tanto, es posible detectar la presencia de mutaciones no sólo en ADN de sangre periférica, sino también en raspados bucales, vellosidades coriales, cabello, biopsias, material incluido en bloques de parafina o incluso de tarjetas impregnadas con manchas de sangre (tarjetas de Guthrie, por ejemplo).

17.3 Aplicación del ligamiento genético al diagnóstico: el proceso 17.3 de diagnóstico indirecto de enfermedades genéticas Como ya se ha mencionado al principio de este capítulo, hay ocasiones en las que no es posible, o resulta muy poco práctico, llevar a cabo diagnóstico directo. Esto sucede en aquellos casos en los que no se conoce la secuencia del gen causante de una enfermedad, o cuando éste es excesivamente grande y complejo (compuesto por mu-

www.FreeLibros.me


CAPITULO 17

5/12/06

07:31

Página 235

a)

Distinguir los dos cromosomas en cada uno de los progenitores: para esto es imprescindible encontrar un marcador para el que ambos progenitores sean heterocigotos (a poder ser no idénticos), de manera que esta familia sea totalmente informativa.

www.FreeLibros.me

235

Aplicación del ligamiento genético al diagnóstico: el proceso …

chos exones, por ejemplo). En estos casos todavía podemos predecir si un individuo ha heredado la enfermedad, estudiando marcadores específicos que nos permitan identificar cuál cromosoma de los progenitores es el que lleva la mutación. Una vez identificado, simplemente hemos de ver qué cromosomas han heredado los hijos, para predecir la probabilidad de que también hayan heredado la mutación. Como no estudiamos directamente el gen, sino marcadores genéticos que nos ayudan a identificar los cromosomas, se denomina a este proceso «Diagnóstico Indirecto». Para comprender el diagnóstico indirecto es necesario repasar los conceptos generales de ligamiento genético y su aplicación a familias humanas que han sido expuestos en el Capítulo 11. A veces nos enfrentamos con una enfermedad genética cuyo gen causal no ha sido todavía identificado, lo que obviamente impide realizar diagnóstico directo. En otras ocasiones, aun conociendo el gen que debe estar mutado, resulta impracticable realizar estudios de diagnóstico directo en la rutina de un laboratorio clínico, por la gran heterogeneidad alélica que muestra esa enfermedad (un gran número de posibles mutaciones pueden ser las responsables del cuadro clínico), o en genes con una estructura exónica muy compleja. Un ejemplo bastante claro es la Distrofia Muscular de Duchenne (DMD), debida a mutaciones en el gen de la distrofina. Este gen es muy grande (ARNm de 14 kb) y tiene 79 exones distribuidos a lo largo de 2,3 megabases de ADN genómico, por lo que el estudio mutacional de cada exón sería excesivamente laborioso. En este tipo de situaciones, una alternativa muy utilizada es la de establecer si el probando ha heredado el cromosoma o los cromosomas parentales que llevan el gen mutado, o si por el contrario ha heredado los cromosomas parentales normales. Para hacer esto se sigue un proceso denominado «gene tracking», algo así como «seguir la pista» a los alelos enfermos en una familia concreta. Esto se hace utilizando marcadores polimórficos situados muy cerca o incluso dentro del gen en cuestión, escogiendo aquellos marcadores que sean informativos en cada familia concreta. Los marcadores son del mismo tipo que los utilizados en el análisis de ligamiento (RFLP, microsatélites). Utilizando esta estrategia podemos saber si un individuo ha heredado una mutación de su progenitor enfermo simplemente determinando si ha heredado el cromosoma mutado de ese progenitor. Lógicamente, esta estrategia es válida siempre que no haya habido ninguna recombinación entre el locus de la enfermedad y el locus del marcador, de ahí que utilicemos marcadores tan cercanos al gen que la frecuencia de recombinación sea prácticamente 0. De hecho, la metodología empleada es la misma que en los estudios de ligamiento, pero varía la manera de utilizar la información obtenida: mientras en los estudios de ligamiento queremos determinar la distancia entre dos loci, en el análisis indirecto ya sabemos cuál es esa distancia (y conocemos por tanto la frecuencia de recombinación) y simplemente utilizamos esa información para determinar qué cromosoma ha sido transmitido por cada progenitor a un individuo concreto de la descendencia. El proceso general que se sigue en el diagnóstico indirecto es el siguiente:


CAPITULO 17

236

5/12/06

b)

Diagnóstico de enfermedades genéticas

c)

07:31

Página 236

Resolver la fase de ligamiento en el individuo transmisor: esto supone ser capaces de determinar cuál de los alelos del marcador segrega con el alelo de la enfermedad (y «viaja», por tanto, en el mismo cromosoma). Para esto hay que estudiar a los progenitores del individuo transmisor o a su descendencia y deducir la fase de ligamiento entre el marcador y el gen. Nuevamente, una recombinación entre ambos loci (enfermedad y marcador) llevaría a resultados erróneos, de ahí la importancia de usar marcadores cercanos al gen (o intragénicos) de modo que la frecuencia de recombinación entre ambos sea despreciable. Determinar el alelo del marcador que ha sido transmitido al probando. Esto nos dirá (con una fiabilidad mayor o menor dependiendo de la fracción de recombinación entre el marcador y el gen) si se ha transmitido el cromosoma con el alelo mutado o el alelo normal. Aquí se hace evidente la enorme utilidad del diagnóstico indirecto: permite establecer si un individuo ha heredado la mutación sin necesidad de detectar directamente la presencia de la misma. Como hemos comentado, su gran limitación viene dada porque en ocasiones los marcadores están a cierta distancia del locus de la enfermedad y las predicciones no son fiables al 100 por cien. Por ejemplo, si la distancia entre el marcador y el locus de la enfermedad fuese de 5 cM (lo que supone una frecuencia de recombinación del cinco por ciento), la fiabilidad del análisis sólo sería del 95 por ciento, ya que en un cinco por ciento de los casos podría haberse dado un sobrecruzamiento entre ambos loci que hubiese trasladado el alelo mutado al cromosoma homólogo. En la práctica, solventamos esta limitación mediante el uso de varios marcadores, preferiblemente situados a ambos extremos del locus de la enfermedad. De esta forma, la única posibilidad de error sería un doble sobrecruzamiento entre el locus de la enfermedad con cada uno de los marcadores, pero la probabilidad de que esto suceda es prácticamente despreciable. Lógicamente, a mayor número de marcadores, mayor fiabilidad de los resultados, sobre todo si además se incluyen marcadores situados dentro del propio gen de la enfermedad.

La Figura 17.9 explica el proceso general del diagnóstico indirecto utilizando marcadores polimórficos en ligamiento con el gen responsable de una enfermedad genética.

www.FreeLibros.me


CAPITULO 18

5/12/06

07:33

Página 237

CAPÍTULO 18

Genética clínica

Contenidos 18.1 Genética clínica y consejo genético 18.2 Enfermedades de herencia autosómica 18.3 Enfermedades de herencia ligada al cromosoma X 18.4 Teorema de Bayes y su aplicación al cálculo de riesgos genéticos 18.5 Enfermedades por alteración del ADN mitocondrial 18.6 Diagnóstico prenatal

18.1 Genética clínica y consejo genético La genética clínica se ocupa del diagnóstico y atención de las personas y familias en las que aparece una enfermedad genética. Incluye varios aspectos, algunos de ellos algo diferentes de la práctica médica habitual:

• • •

Diagnóstico correcto de la enfermedad, de lo contrario el cálculo de riesgos genéticos no tiene sentido. Para ello, además de los métodos clásicos de diagnóstico, es importante realizar bien el diagnóstico molecular (estudiado en el capítulo anterior) y reconstruir la historia familiar detallada. La aplicación de los principios de la genética mendeliana permite calcular el riesgo de recurrencia de la enfermedad en la misma familia, establecer el pronóstico, iniciar medidas de diagnóstico precoz y de prevención en individuos de riesgo (antes de la aparición de los síntomas). Por todo esto, la genética clínica es un pilar básico de la «Medicina predictiva» del futuro. Un elemento fundamental es el consejo genético, que, según la definición de la Sociedad Americana de Genética Humana (1975) «es un proceso de comunicación que trata de los problemas humanos asociados con la ocurrencia, o riesgo de ocurrencia, de un transtorno genético en una familia. Este proceso requiere que una o más personas adiestradas de forma apropiada ayuden al individuo o fami-

www.FreeLibros.me


CAPITULO 18

5/12/06

07:33

Página 238

lia a: 1) comprender los hechos médicos, incluyendo el diagnóstico, la evolución probable del transtorno y el tratamiento disponible; 2) apreciar el modo en que la herencia contribuye al transtorno y el riesgo de recurrencia en parientes concretos; 3) comprender las alternativas para enfrentarse al riesgo de recurrencia; 4) escoger un curso de acción que les parezca apropiado a la vista de su riesgo, sus objetivos familiares y sus normas éticas y religiosas, y actuar de acuerdo con la decisión tomada, y 5) procurar la mejor adaptación posible a la enfermedad en un miembro afectado de la familia y/o al riesgo de esta enfermedad». En contraste con el método médico tradicional, en el que el facultativo prescribe al paciente lo que debe hacer, entre profesionales de la Genética Clínica existe un amplio consenso a favor de que el consejo genético sea un proceso no-directivo, es decir, que sea el propio paciente o la familia los que decidan qué acción tomar en función de la información proporcionada por el facultativo. En este sentido, es importante comprender que la carga de una enfermedad genética para el paciente y para la familia puede ser valorada de modo muy distinto de unos casos a otros, dependiendo de varias circunstancias. Es importante explicar bien las posibilidades de modificar la carga genética o el riesgo genético, y poner a las familias afectadas en contacto con servicios sociales de apoyo, organizaciones de afectados por la enfermedad, etc.

238

Genética clínica

Las dos herramientas básicas de la genética clínica, que el estudiante debe dominar, son la realización de la historia familiar y la estimación de riesgos genéticos. La historia familiar es la parte de la historia clínica en la que se reconstruye el árbol familiar y se intenta identificar otros miembros del mismo que puedan estar afectados por la enfermedad. Esto permitirá deducir el tipo de herencia y el riesgo de recurrencia. Se utilizan las reglas generales de construcción de árboles familiares, y además es importante:

• • • • • •

Preguntar acerca de nacidos muertos o abortos espontáneos. Indagar la existencia de posible consanguinidad. Tener en cuenta posibles casos de falsa paternidad. Recoger también información básica de las ramas del árbol que parezcan no estar afectadas. Siempre es mejor registrar la fecha de nacimiento que la edad. Tener en cuenta que el diagnóstico puede no ser acertado, sobre todo en el caso de individuos ya fallecidos. Por tanto, es importante examinar directamente, siempre que sea posible, a los individuos afectados; examinar a los presumiblemente «sanos», para excluir que en realidad tengan una forma poco severa de la enfermedad; tratar de obtener toda la información posible de otros parientes más lejanos.

Por lo que respecta a la estimación del riesgo genético, se expresa siempre como una probabilidad, es decir en modo fraccional o en porcentaje (un riesgo de 1/2 es igual a un riesgo del 50 por ciento). El riesgo genético no es más que la probabilidad de padecer la enfermedad que tiene un individuo concreto de la familia, probabilidad estimada a partir de los datos del árbol familiar que nos permiten deducir el tipo de herencia y aplicar las leyes mendelianas.

www.FreeLibros.me


CAPITULO 18

5/12/06

07:33

Página 239

La Figura 18.1 muestra los principales símbolos utilizados en la creación de árboles genealógicos (genealogías o pedigrís).

18.2 Enfermedades de herencia autosómica Las enfermedades autosómicas dominantes suelen tener una frecuencia génica muy baja (la prevalencia de estas enfermedades es habitualmente inferior a 1/1 000 individuos), y por tanto los individuos homocigotos son extremadamente infrecuentes; de hecho, la homocigosidad para estas enfermedades es muchas veces letal y provoca abortos espontáneos. El árbol típico de una enfermedad autosómica dominante muestra individuos enfermos en todas las generaciones, afectando ambos sexos por igual. Cuando se ve una transmisión de padre enfermo a hijo varón, podemos descartar la presencia de una enfermedad ligada al cromosoma X. Para calcular el riesgo de padecer la enfermedad en la descendencia, se utilizan los cuadrados de Punnet. Mediante el uso de estos diagramas es fácil concluir que la mitad de la descendencia serán heterocigotos enfermos y la otra mitad homocigotos sanos. Dos individuos sanos, si efectivamente son homocigotos (veremos alguna excepción más adelante), no pueden tener descendencia con la enfermedad. Ya se ha mencionado antes que es muy poco frecuente encontrar enfermos homocigotos (dos alelos mutados), pues esto exigiría la unión de dos heterocigotos enfermos. Sin embargo, hay algunas enfermedades autosómicas dominantes en la que esto sucede con mayor frecuencia de lo habitual, debido a que tienen una frecuencia génica más alta de lo habitual (no son letales, sino de comienzo tardío, por lo que permiten llegar a la edad fértil, tener descendencia y propagar la mutación). Un buen ejemplo de lo dicho es la Hipercolesterolemia familiar, una enfermedad autosómica dominante debida a mutaciones en el receptor de las LDL (lipoproteínas de baja densidad) que cursa con niveles altos de colesterol total y colesterol LDL, xantomas tendinosos, xantelasmas y aterosclerosis precoz. La enfermedad afecta a uno de cada 500 individuos de la población y es causa del cinco por ciento de los infartos de miocardio que se producen antes de los 60 años de edad. Como es una enfermedad que no altera la fertilidad, la frecuencia alélica es alta (en torno a uno de cada 1 000 alelos presentes en la población están mutados) y no es raro encontrar individuos homocigotos (en torno a uno por millón). Los homocigotos están afectados con más gravedad que los heterocigotos, mostrando niveles más altos de colesterol y mayor riesgo de enfermedad coronaria. El análisis molecular de los individuos enfermos y de los miembros de su familia permite predecir la gravedad de la enfermedad, establecer el riesgo en la descendencia y comenzar el tratamiento preventivo con dieta o fármacos hipolipemiantes. También se pueden encontrar individuos homocigotos en

www.FreeLibros.me

239

Enfermedades de herencia autosómica

Los patrones hereditarios típicos se pueden reconocer al analizar el árbol genealógico de la familia en la que hay individuos enfermos, ya que cada tipo de herencia produce árboles familiares con unas características propias. Para la construcción de árboles familiares, llamados también «genealogías» o «pedigrís» (por influencia del término inglés pedigree), se utilizan unos símbolos aceptados por convenio, y se construyen siguiendo unas reglas que hay que conocer.


CAPITULO 18

240

5/12/06

07:33

Página 240

Genética clínica

enfermedades autosómicas dominantes en las que existe una cierta predisposición a las uniones entre individuos enfermos. Esto último sucede, por ejemplo, en una enfermedad llamada acondroplasia. Los individuos que sufren esta enfermedad, dada su baja estatura, tienden a formar matrimonios entre ellos, lo que eleva la probabilidad de que aparezcan sujetos homocigotos. Las enfermedades autosómicas recesivas requieren, por definición, que los individuos afectados sean homocigotos (dos alelos mutados) y, por tanto, sus progenitores son habitualmente portadores sanos heterocigotos. El árbol típico de un patrón autosómico recesivo muestra generaciones con algún miembro afectado, separadas por generaciones en las que no hay ningún individuo enfermo, patrón muy poco probable en transtornos dominantes. Se encuentran individuos enfermos de ambos sexos, y es muy frecuente la presencia de uniones con-sanguíneas (entre individuos que comparten un ancestro común, como primos, primos segundos, etc.). Un buen ejemplo de enfermedad autosómica recesiva es la Fibrosis Quística del Páncreas, enfermedad debida a mutaciones en el gen CFTR (Cystic Fibrosis Transmembrane Regulator), localizado en 7q31. La enfermedad afecta a uno de cada 2 500 nacidos vivos de raza caucásica, lo que significa una frecuencia alélica del 0,02 (dos por ciento de los alelos presentes en la población están mutados) y una frecuencia de portadores del 0,04 (uno de cada 25 individuos de la población general son heterocigotos). La enfermedad surge por el mal funcionamiento de un canal de cloro, lo que provoca una mucoviscidosis (secreciones mucosas muy viscosas) que poco a poco conduce a la destrucción del tejido pulmonar y pancreático, además de provocar obstrucción intestinal en algunos neonatos. Se conocen alrededor de 400 mutaciones diferentes en el gen CFTR, pero en poblaciones europeas un 70 por ciento de los casos se deben a la deleción F508del, que deleciona tres bases sin cambiar el marco de lectura: SECUENCIA NORMAL

GAA AAT ATC ATC TTT GGT GTT GluA Asn IleTC IleC Phe GlyT Val

F508del

GAA AAT ATC AT- --T GGT GTT GluA Asn IleTCIle- --T GlyT Val

Además de F508del, hay otras mutaciones que causan Fibrosis Quística y que se encuentran con frecuencia alélica mayor a uno por ciento, de modo que el análisis de ocho mutaciones (incluyendo F508del) puede detectar hasta un 85-90 por ciento de los casos en poblaciones de origen europeo. Hay una serie de fenómenos —muchos de los cuales ya se han mencionado— que complican la evaluación de los árboles de enfermedades autosómicas dominantes y recesivas, y hacen que el cálculo de los riesgos en la descendencia sea menos fiable. A continuación se señalan los problemas más frecuentes:

Heterogeneidad genética de locus. Ya se ha mencionado que muchas enfermedades hereditarias pueden estar causadas por mutaciones en genes distintos, y se han visto algunos ejemplos. Esto se manifiesta, habitualmente, en la aparición de distintos patrones de herencia en familias diferentes. Así, por ejemplo, hemos visto un tipo de enfermedad de Charcot-Marie-Tooth que si-

www.FreeLibros.me


CAPITULO 18

5/12/06

07:33

Página 241

241

II 1

2

3

4

5

6

1

2

3

4

5

6

7

8

III

I

1

7

8

2

II 1

III

2

4

3

1

5

2

IV

? 1

2

3

4

La Figura 18.2 muestra los árboles genealógicos típicos de las enfermedades con herencia autonómica dominante y autonómica recesiva.

gue un patrón autosómico dominante (por duplicaciones del gen PMP22), pero también existen familias en las que esta enfermedad sigue un patrón ligado al sexo (por mutaciones en otro gen situado en el cromosoma X). Otro ejemplo notable es el Síndrome de Ehlers-Danlos, que puede estar causado por mutaciones en al menos ocho loci diferentes, dando lugar a familias con patrón autosómico dominante, autosómico recesivo o ligado al sexo recesivo, dependiendo del gen implicado en cada caso. Lógicamente, la identificación del tipo de herencia en una familia concreta nos ayudará a predecir el gen afectado (y buscar mutaciones en el mismo, si es posible) y a estimar el riesgo de padecer la enfermedad en la descendencia. Penetrancia incompleta. Hasta ahora hemos dado por supuesto que siempre que un gen está mutado se desarrollará la enfermedad correspondiente. Por desgracia para el profesional de la Genética (pero por suerte para los pacientes), esto no se cumple en el 100 por cien de los casos. De hecho, no es infrecuente encontrar árboles en los que un individuo ha transmitido una enfermedad dominante sin haber estado él mismo afectado por dicha enfermedad. En la Figura 18.3 puede observarse una familia afectada por una enfermedad autosómica dominante en la que el individuo II-2 (señalado por la flecha) ha heredado y transmitido la mutación, pero no ha llegado a desarrollar la en-

www.FreeLibros.me

Enfermedades de herencia autosómica

I


CAPITULO 18

5/12/06

242

Genética clínica

07:33

Página 242

fermedad. Descartando la posibilidad de que se trate de una nueva mutación que ha surgido en ese individuo, ya que esa misma enfermedad estaba ya presente en los progenitores, hemos de concluir que este individuo es portador de la mutación pero no expresa la enfermedad. Este fenómeno se denomina «penetrancia incompleta», y es característico de algunas enfermedades dominantes, como por ejemplo el Retinoblastoma hereditario. Expresividad variable. Muchas enfermedades hereditarias tienen manifestaciones clínicas complejas, con signos y síntomas que se pueden presentar en distintas combinaciones y con distinto grado de severidad. Se dice entonces que estas enfermedades tienen expresividad clínica variable. En algunos casos, como por ejemplo la Neurofibromatosis tipo 1, distintos miembros de una misma familia (todos con la misma mutación), pueden tener manifestaciones clínicas de la enfermedad muy dispares. No tenemos hoy en día una explicación clara para el fenómeno de la distinta expresividad de una misma mutación, pero es probable que esté originado por factores ambientales que influyen en el desarrollo de la enfermedad o por diferencias inter-individuales en otros genes que modifican la expresión del fenotipo.

En la Figura 18.3 se ilustran los conceptos de penetrancia incompleta y expresividad variable.

Por lo que respecta al cálculo de riesgos, podemos resumir:

Las enfermedades de herencia autosómica dominante tienen, en general, frecuencias alélicas muy bajas (<0,001) y por eso los individuos homocigotos (ambos alelos mutados) son muy raros. Lo normal es encontrar cruces entre un heterocigoto y un homocigoto sano, por lo que el riesgo en la descendencia es de 50 por ciento heterocigotos enfermos y 50 por ciento homocigotos sanos. Por eso, para cada hijo el riesgo de recurrencia es del 50 por ciento, aunque siempre hay que tener en cuenta los factores que pueden modificar estos riesgos (penetrancia incompleta, expresividad variable, tasa de nuevas mutaciones). En enfermedades de herencia autosómica recesiva, ambos progenitores tienen que ser al menos portadores, por lo que en la descendencia habrá 25 por ciento de enfermos (homocigotos con mutación), 25 por ciento de sanos (homocigotos sin mutación) y 50 por ciento de portadores sanos (heterocigotos). Por tanto, el riesgo de recurrencia es inicialmente 1/4 (25 por ciento). Es importante recordar que la presencia de consanguinidad es un hecho muy frecuente en estas enfermedades. Más raramente hay matrimonios entre un portador sano y un enfermo homocigoto, en cuyo caso se produce un patrón de herencia cuasi-dominante con 50 por ciento de enfermos y 50 por ciento de portadores sanos en la descendencia. Una causa frecuente de consulta en el caso de enfermedades de herencia autosómica recesiva es el matrimonio entre un portador y un individuo de otra familia distinta en la que no existe la enfermedad. Lógicamente, el riesgo final para la descendencia dependerá fundamentalmente de la probabilidad que tenga este individuo de ser portador, lo cual, a su vez, depende de la tasa de portadores en la población ge-

www.FreeLibros.me


CAPITULO 18

5/12/06

07:33

Página 243

neral. Como se recordará, la ley de Hardy-Weinberg permite estimar esta tasa en función de la prevalencia de la enfermedad en esa población.

18.3 Enfermedades de herencia ligada al cromosoma X Al igual que las enfermedades autosómicas, las enfermedades ligadas al sexo pueden ser recesivas o dominantes. Lo más habitual es encontrar enfermedades de herencia ligada al sexo recesivas, en las que las mujeres portadoras son sanas. El árbol típico muestra únicamente varones enfermos, habitualmente sin transmisión de la enfermedad de un padre a sus hijos varones. Se pueden dar tres situaciones, cuyos cuadrados de Punnet se presentan en la Figura 18.5. En primer lugar, la unión entre una mujer portadora (Aa) y un varón sano (A—) dará lugar a un 50 por ciento de hijas homocigotas sanas y un 50 por ciento de heterocigotas portadoras, mientras que el 50 por ciento de los hijos varones serán sanos y el otro 50 por ciento serán enfermos. En el caso de uniones entre una mujer portadora sana (Aa) y un varón enfermo (a—), los hijos varones tendrán los mismos riesgos que en el caso anterior (la mitad sanos y la mitad enfermos), pero las hijas serán homocigotas (enfermas, por tanto) en el 50 por ciento de los casos y portadoras sanas en el otro 50 por ciento. Por último, las uniones entre un varón enfermo (a—) y una mujer homocigota sana (AA) dan lugar a una descendencia en la que todos los hijos son sanos y todas las hijas son portadoras sanas. Como puede apreciarse, es importante distinguir las mujeres sanas que son homocigotas de aquellas que son heterocigotas portadoras. Ya hemos comentado que la inactivación del cromosoma X se realiza al azar en células somáticas, de forma que toda mujer es, en el fondo, un mosaico con poblaciones celulares en las que se ha inactivado un cromosoma X y poblaciones celulares en las que se ha inactivado el otro. Sin embargo, en algunas circunstancias la inactivación puede ser preferencial, inactivándose el mismo cromosoma X en todas las células. Esto sucede, por ejemplo, en casos de anomalías estructurales (deleciones o duplicaciones) que afectan a uno de los cromosomas X, en cuyo caso suele inactivarse el cromosoma anormal. En cambio, en individuos con translocaciones equilibradas entre el cromosoma X y un autosoma se inactiva preferencialmente el cromosoma normal, ya que de lo contrario se produciría a una monosomía parcial del autosoma implicado en la translocación. También se ha visto inactivación sesgada en algunas familias con deleciones que afectan a XIST o a TSIX, así como en familias con mutaciones que afectan al promotor de XIST. En algunos casos raros de enfermedades ligadas al sexo recesivas, la inactivación preferencial del cromosoma X normal en mujeres portadoras (que deberían ser fenotípicamente sanas) puede dar a lugar a la aparición de la enfermedad, aunque habitualmente con unas manifestaciones más leves. La Distrofia Muscular de Duchenne (DMD) es quizás uno de los mejores ejemplos de enfermedad ligada al sexo recesiva. Está causada por mutaciones en el gen de la distrofina, localizado en Xp21, y afecta a uno de cada 3 300 varones en todos los grupos

www.FreeLibros.me

Enfermedades de herencia ligada al cromosoma X

En la Figura 18.4 se muestran los cuadrados de Punnet que ayudan a calcular el riesgo de recurrencia en enfermedades de herencia autonómica dominante y recesiva.

243


CAPITULO 18

244

5/12/06

07:33

Página 244

Genética clínica

étnicos. La ausencia de distrofina provoca la desestructuración del Complejo Asociado a la Distrofina (DAC) del sarcolema y conduce a la aparición de una degeneración muscular progresiva que suele terminar con la vida del paciente alrededor de la tercera década de la vida. Como se recordará, el gen DMD es uno de los de mayor tamaño conocido, lo que condiciona una alta tasa de nuevas mutaciones (en torno a 10—4 nuevas mutaciones por generación). Alrededor del 60 por ciento de las mutaciones son deleciones (con tamaños que van desde varias kilobases hasta una megabase), con un «punto caliente» (hot spot) de aparición de deleciones en el exón 7. El resto de las mutaciones son deleciones pequeñas y mutaciones puntuales que alteran el marco de lectura. La distrofia muscular de Becker es un fenotipo más leve causado por mutaciones en el mismo gen, pero en este caso las mutaciones NO rompen el marco de lectura (deleciones pequeñas y mutaciones puntuales con cambio de sentido). El árbol típico de las enfermedades con herencia ligada al sexo dominante muestra una estructura similar al de las enfermedades autosómicas dominantes, con la peculiaridad de que nunca hay transmisión padre-hijo, pero en cambio todas las hijas de los varones enfermos son heterocigotas enfermas. Por el contrario, desarrollará la enfermedad el 50 por ciento de los hijos y el 50 por ciento de las hijas de una mujer portadora y un varón normal. En general, los árboles suelen mostrar la presencia del doble de mujeres enfermas que de varones enfermos, excepto en aquellos casos en que la enfermedad es letal en varones. De todas formas, las mujeres suelen desarrollar formas más leves de la enfermedad, debido a que el 50 por ciento de sus células habrán inactivado el cromosoma X portador de la mutación y expresarán el alelo normal del gen implicado. Algunos ejemplos de estas enfermedades son el Síndrome de Rett, el Raquitismo Hipofosfatasémico, o la Incontinencia Pigmentaria tipo 1 (enfermedad en la que sólo se ven mujeres afectadas, probablemente por letalidad embrionaria en varones).

I

1

2

II 1

2

4

3

5

III 1

2

3

4

5

1

2

IV En la Figura 18.5 se muestran los pedigrís típicos de enfermedades ligadas al sexo recesivas y dominantes.

Un patrón hereditario anómalo, dentro de las enfermedades ligadas al cromosoma X, es el que presentan las familias con Síndrome del X Frágil. El estudio del árbol de una familia con esta enfermedad pone de manifiesto un patrón de herencia

www.FreeLibros.me


CAPITULO 18

5/12/06

07:33

Página 245

La Figura 18.6 ilustra la paradoja de Sherman, mostrando en un árbol los riresgos de expansión a mutación completa dependiendo del tamaño de la premutación y del sexo.

En general podemos afirmar que la expansión de pre-mutación a mutación completa tiene lugar en menos del 20 por ciento de los alelos <70 repeticiones y en más del 70 por ciento de los alelos >90 repeticiones. Como se recordará, la expansión a mutación completa va acompañada de hipermetilación del promotor del gen FMR1, lo que provoca la ausencia de la proteína. Aunque la mutación provoca una pérdida de función del gen, el fenotipo es dominante (basta un alelo con la mutación completa para desarrollar la enfermedad). De hecho, la presencia de un cromosoma con mutación completa e hipermetilación se asocia con retraso mental en todos los varones y en el 50-70 por ciento de las mujeres (por la inactivación del X, muchas células habrán inactivado el cromosoma X mutado). Las mujeres que llevan un alelo con pre-mutación no suelen desarrollar la enfermedad, pero tienen riesgo de sufrir expansión en su descendencia. Por el contrario, los varones con pre-mutación —denominados Varones Transmisores Normales (NTM, Normal Transmitting Male)— transmiten el alelo premutado, sin sufrir expansión, a todas sus hijas (que serán portadoras sanas), y —como es lógico— no lo transmiten a ninguno de sus hijos. Recientemente se ha encontrado que estos varones desarrollan una enfermedad neurológica llamada FXTAS (síndrome de temblor/ataxia asociado con el X-frágil) en las últimas décadas de la vida. Estos individuos muestran inclusiones cerebrales con aumento del mRNA y de la proteína FMRP, además de otras proteínas como laminina A/C. Esta enfermedad es un bello ejemplo de cómo la identificación del mecanismo molecular genético ha permitido explicar una serie de fenómenos clínicos y hereditarios de difícil comprensión. El cálculo de riesgos en las enfermedades de herencia recesiva ligada al cromosoma X, por tanto, debe hacerse teniendo en cuenta que las mujeres portadoras (heterocigotas) son sanas pero los varones hemicigotos (con una mutación en su único cromosoma X) son enfermos. En el caso de mujeres portadoras, la mitad de sus hijos varones serán enfermos y la otra mitad sanos; de sus hijas, la mitad serán portadoras y la otra mitad homocigotas sanas. Es característico que nunca hay transmisión de padre enfermo a hijos varones, lo cual es muy importante para el consejo genético. En cambio, el 50 por ciento de las hijas de un varón enfermo serán portadoras (sanas), pero ninguna será enferma. La excepción a esta regla general es el matrimonio de un varón enfermo con una mujer portadora, lo cual sucede a veces en

www.FreeLibros.me

245

Enfermedades de herencia ligada al cromosoma X

dominante con penetrancia reducida en mujeres, además de otros hechos que constituyen lo que se conoce como «paradoja de Sherman»: 1) el riesgo de transmisión de la enfermedad aumenta en sucesivas generaciones, y 2) se encuentran varones normales que transmiten la enfermedad a todas sus hijas, que serán por tanto portadoras sanas. Como hemos comentado en otro capítulo, hoy en día sabemos que esta enfermedad está causada por la expansión de un trinucleótido en el gen FMR1, con alelos que varían en el número de veces que está repetido el trinucleótido. La presencia de premutación (rango de 50 a 230 repeticiones) no provoca manifestaciones fenotípicas en los portadores (tanto varones como mujeres). La expansión de estos alelos premutados sólo se produce por vía materna, y la probabilidad de que esto suceda depende de la longitud del alelo premutado.


CAPITULO 18

246

5/12/06

07:33

Página 246

Genética clínica

casos de consanguinidad. En estos casos puede haber mujeres enfermas (heredan dos mutaciones) e incluso transmisión de padre enfermo a hijo varón (aunque, en realidad, el hijo hereda la enfermedad de su madre). Por lo que respecta a la herencia ligada al X dominante, el matrimonio entre una mujer enferma (heterocigota) y un varón normal produce una descendencia con riesgo de recurrencia en el 50 por ciento de los hijos y en el 50 por ciento de las hijas. En cambio, el matrimonio entre un varón afectado y una mujer normal da lugar a un riesgo del 100 por cien de recurrencia en las hijas (todas heredan el cromosoma X paterno, que transmite la mutación), pero todos los hijos varones serán sanos.

18.4 Teorema de Bayes y su aplicación al cálculo de riesgos 18.4 genéticos En algunas situaciones, los riesgos de recurrencia calculados según los principios mendelianos pueden ser matizados y precisados por información adicional acerca de esa familia. Por este motivo, el consejo genético hace uso de la estadística bayesiana, derivada de la aplicación del teorema de Bayes. En su formulación general, el teorema de Bayes dice que: P(A) × P(B|A) P(A|B) = ————–————––––—— Σ P(A) × P(B|A) Esto significa que la probabilidad de un suceso A cuando se verifica una condición B (eso se representa como «A sobre B») es igual a la probabilidad inicial del primer suceso, multiplicado por la probabilidad de que la condición B se verifique en presencia del suceso A, dividido por la probabilidad total de la condición B (que es el sumatorio de todos los posibles numeradores). Es decir, la probabilidad inicial o teórica de un suceso cualquiera puede ser modificada si se cumple alguna condición que afecta a ese suceso, dependiendo de la probabilidad de esa condición y de la probabilidad de que cuando tal condición se cumple se vea afectado el suceso inicial. Este tipo de análisis estadístico tiene aplicación en muchos campos, pero en el caso concreto del consejo genético es especialmente útil en el cálculo de riesgos de recurrencia de enfermedades recesivas ligadas al cromosoma X, en las que podemos incluir información de tipo condicional. También es posible incorporar los datos del diagnóstico molecular para matizar los riesgos de recurrencia calculados según los principios mendelianos, como veremos en algunos ejemplos. Quizás el ejemplo más sencillo de cómo utilizar la información derivada de árboles genealógicos para modificar los riesgos iniciales sea el cálculo del riesgo de ser portador de una enfermedad autosómica recesiva. Como sabemos por los principios mendelianos, cualquier hermano o hermana de un afectado con una enfermedad autósomica recesiva, cuyos progenitores son portadores sanos, tiene una probabilidad inicial del 50 por ciento de ser portador sano, 25 por ciento de ser homocigoto sano y 25 por ciento de ser homocigoto enfermo. En cambio, puede darse el caso de que nos encontremos una familia en la que uno de los hermanos es sano, y claramente no ha desarrollado la enfermedad. En ese individuo, lógicamente, podemos despreciar el

www.FreeLibros.me


CAPITULO 18

5/12/06

07:33

Página 247

Inicial Condicional («si es sano») Conjunta Final

Portador

Homocigoto (sano)

1/2 1 1/2 2/4 ÷ 3/4 = 2/3

1/4 1 1/4 1/3

La suma de todas las posibles probabilidades conjuntas (el sumatorio que está en el denominador de la ecuación) es, en nuestro caso, 3/4 (1/2 + 1/4). Por tanto, la probabilidad final se calcula hallando el cociente entre la probabilidad conjunta de cada situación y la suma de todas ellas. En nuestro ejemplo, la probabilidad final de que el hermano de un enfermo con una enfermedad autosómica recesiva sea portador de la misma, si es sano, es de (1/2) ÷ (3/4) = 2/3, y la probabilidad final de que sea homocigoto sano es 1/3. Como se puede ver, los riesgos no siempre son algo fijo, sino que en ocasiones pueden modificarse, a veces de manera sustancial, con la incorporación de nueva información. El teorema de Bayes también se utiliza con frecuencia para calcular el riesgo derivado de pruebas diagnósticas bioquímicas o moleculares, y puede combinarse con la información obtenida del árbol genealógico. Por ejemplo, si se sabe que una enfermedad tiene una prevalencia de 1/100 000 individuos, la probabilidad inicial de padecerla es P(A) = 10-5. Si una prueba diagnóstica es positiva en el 80 por ciento de los in-

www.FreeLibros.me

247

Teorema de Bayes y su aplicación al cálculo de riesgos genéticos

25 % de probabilidad de ser enfermo, porque de hecho está sano. En efecto, sólo hay dos posibilidades de ser hermano sano de un afectado por una enfermedad autosómica recesiva: o ser portador (probabilidad inicial del 50 por ciento) o ser homocigoto sano (probabilidad inicial del 25 por ciento). De este 75 por ciento total, un 50 por ciento corresponde a la probabilidad de ser portador, luego el riesgo que tiene un hermano sano de ser portador de la enfermedad no es 50 por ciento, como inicialmente cabría suponer, sino realmente 2/3. Esto, que se comprende modo intuitivo, supone realmente una aplicación del teorema de Bayes. En efecto, la probabilidad (P) inicial de ser portador sano es 1/2 y de ser homocigoto sano es 1/4, como acabamos de ver. Establecemos la condición («si el individuo es SANO») y calculamos la probabilidad condicional para cada estado posible: en este caso, la probabilidad condicional es 1 (100 por cien) siempre, ya que tanto un portador sano como un homocigoto sano son sanos. Si hacemos una tabla en la que indicamos las probabilidades bajo cada una de las dos posibles situaciones, obtenemos algo como lo que se muestra a continuación. Un individuo portador tiene una probabilidad inicial (a priori) del 50 % de ser sano, y si cumple la condición de estar sano su probabilidad condicional (estar sano) es del 100 por cien (P = 1); lo mismo puede calcularse para un homocigoto sano (probabilidades inicial y condicional de 1/4 y 1, respectivamente). A continuación se calcula la probabilidad combinada o conjunta de que ambos sucesos tengan lugar a la vez, es decir, se multiplican la probabilidad inicial y la condicional. La probabilidad conjunta corresponde al término P(A) × P(B|A) de la ecuación anterior. Como vemos en la tabla, las probabilidades conjuntas son 1/2 y 1/4, respectivamente, para el caso de ser portador sano o de ser homocigoto sano:


CAPITULO 18

248

5/12/06

07:33

Página 248

Genética clínica

dividuos enfermos y en un cinco por ciento de sanos (falsos positivos), podemos calcular la probabilidad de que un individuo en el que la prueba es positiva realmente padezca la enfermedad. Para esto, calculamos la probabilidad de tener alterada la prueba si uno está enfermo: P(B|A) = 0,8. Igualmente, la probabilidad de tener alterada la prueba si uno está sano es 0,05 (obsérvese el uso del condicional para calcular las probabilidades condicionales). La probabilidad final de que un sujeto tenga la enfermedad y además una prueba diagnóstica positiva es, por tanto, el producto de la probabilidad inicial de enfermar multiplicado por la probabilidad condicional de tener alterada la prueba si está realmente enfermo, dividido por la probabilidad de que el marcador esté alterado en general (la suma de ambas probabilidades conjuntas):

Inicial Condicional Conjunta Final

Enfermo

Sano

10-5 0,8 0,8 × 10-5

0,99999 0,05 0,0499995

(0,8 × 10-5) ÷ 0,0500075 = 1,6 × 10-4

Obsérvese que hemos multiplicado por más de 10 el riesgo inicial, en aquellos casos en los que la prueba diagnóstica está alterada. En cualquier caso, la situación en la que más se utiliza el teorema de Bayes en consejo genético es para el cálculo del riesgo de ser mujer portadora en las enfermedades con herencia ligada al X recesiva, ya que en estos casos el riesgo puede modificarse sustancialmente. En estas familias es importante identificar correctamente la mujeres portadoras obligatorias (aquellas que han tenido al menos un hijo enfermo o una hija portadora) y asignar la información condicional correctamente, sobre todo en el caso de estudios moleculares de análisis indirecto. La Figura 18.7 ilustra la aplicación del teorema de Bayes al cálculo de riesgos en enfermedades de herencia ligada al X recesiva, utilizando algunos ejemplos prácticos.

18.5 Enfermedades por alteración del ADN mitocondrial El ADNmt presenta una serie de características genéticas que lo diferencian claramente del ADN nuclear:

Alta tasa de mutación: la tasa de mutación espontánea del ADNmt es unas 10 veces superior a la del ADN nuclear. Por tanto, hay una gran variación de secuencias entre especies e incluso entre individuos de una misma especie. En el hombre se ha calculado que dos individuos escogidos al azar tienen como promedio 50-70 nucleótidos diferentes en su genoma mitocondrial. Además de estas diferencias, en un individuo determinado se está produciendo continuamente, a lo largo de la vida, una heterogeneidad en el ADNmt como consecuencia de las mutaciones que se están dando en las células somáticas. Se

www.FreeLibros.me


CAPITULO 18

07:33

Página 249

ha propuesto que una acumulación de este daño mitocondrial pudiera ser la causa de la disminución en la capacidad respiratoria de los tejidos que tiene lugar durante el envejecimiento. Poliplasmia y Segregación mitótica: en cada célula hay cientos o miles de moléculas de ADNmt. En principio, todas las células de un individuo normal tienen moléculas idénticas de ADNmt, situación que se denomina homoplasmia. Si en una célula aparecen dos poblaciones de ADNmt, una normal y otra mutada, se dice que estamos en una situación de heteroplasmia. Durante la división celular, las mitocondrias —y, por tanto, las moléculas de ADNmt— se distribuyen al azar entre las células hijas. Efecto umbral: el fenotipo de una célula en heteroplasmia dependerá del porcentaje de ADN dañado que exista en la célula; es decir, del grado de heteroplasmia de una mutación. Cuando el número de moléculas de ADNmt mutadas es pequeño, el ADNmt normal es capaz de mantener la función mitocondrial. Sin embargo, cuando el número de copias de ADNmt mutado sobrepasa un umbral determinado, la producción de ATP puede llegar a estar por debajo de los mínimos necesarios para el funcionamiento de los tejidos, llevando al desarrollo de patología mitocondrial. Es importante tener en cuenta que los distintos tejidos pueden variar en el grado de homoplasmia o heteroplasmia para un ADNmt mutado, lo que origina una gran variabilidad en la expresividad clínica de las enfermedades mitocondriales. Por otra parte, los tejidos tienen distintas necesidades energéticas, y el número de orgánulos y de moléculas de ADNmt es también diferente en cada tejido. Por tanto, los órganos preferentemente afectados en las enfermedades mitocondriales son aquellos que dependen en mayor grado de la producción de energía para su correcto funcionamiento. Herencia materna: el ADNmt se hereda exclusivamente por vía materna. La pequeña cantidad de genoma mitocondrial contenido en el espermatozoide raramente entra en el óvulo fecundado, y cuando lo hace es eliminado activamente. El tipo de herencia matrilineal es bastante fácil de reconocer al examinar un árbol genealógico, y tiene importantes consecuencias en el consejo genético (ver más adelante).

Por lo que respecta a las enfermedades humanas debidas a mutaciones del ADNmt, podemos dividirlas en dos grandes grupos: enfermedades asociadas a mutaciones puntuales y enfermedades debidas a alteraciones estructurales del ADNmt. Las enfermedades asociadas a mutaciones puntuales son frecuentes, debido a la alta tasa de mutación del ADNmt. Actualmente se han descrito más de 50 mutaciones puntuales, que se localizan en los tres tipos de genes codificados en el ADNmt (ARNr, ARNt y polipéptidos del OXPHOS). Según su efecto patogénico, distinguimos las mutaciones que originan el cambio de un aminoácido por otro, afectando a alguno de los 13 genes codificantes de proteínas, y las mutaciones que afectan a los genes de los ARNr o ARNt, que tienen efectos globales en la síntesis de las proteínas mitocondriales. Las enfermedades asociadas a alteraciones estructurales del ADNmt pueden ser tanto deleciones más o menos grandes como, menos frecuentemente, inserciones y/o duplicaciones. Hasta el momento se han descrito varios cientos de reordenaciones del ADNmt, que —al contrario que las mutaciones puntuales— suelen

www.FreeLibros.me

249

Enfermedades por alteración del ADN mitocondrial

5/12/06


CAPITULO 18

250

5/12/06

07:33

Página 250

Genética clínica

ser esporádicas. Como regla práctica, podemos decir que en aquellos casos que muestran herencia matrilineal ha de sospecharse la presencia de mutaciones puntuales del ADNmt; en casos esporádicos, en cambio, son más frecuentes las deleciones y/o duplicaciones. Si, por el contrario, se confirma un patrón de herencia autosómico dominante, el estudio debe ir dirigido hacia la búsqueda de deleciones múltiples; si fuese autosómico recesivo, deben buscarse depleciones del ADNmt. La Figura 18.8 muestra las mutaciones puntuales más frecuentes del ADN mitocondrial.

La detección de mutaciones puntuales se realiza habitualmente por digestión de fragmentos de PCR con enzimas de restricción sensibles al cambio de nucleótido introducido por la mutación. En cualquier caso, resulta más fiable la detección mediante Southern del ADNmt digerido con enzimas de restricción específicas para cada una de las mutaciones concretas, pero esto no siempre es posible y, por otra parte, es más laborioso. Las deleciones se encuentran siempre en heteroplasmia, aunque pueden llegar a constituir un porcentaje muy alto de la población de ADNmt. Su determinación se hace fundamentalmente en biopsias musculares, pero si la afectación es muy grave se pueden llegar a detectar también en sangre periférica. Las deleciones se detectan con relativa facilidad por la técnica de Southern, que muestra poblaciones de ADNmt de menor tamaño que el normal (16.569 pb). Se emplea habitualmente ADNmt digerido con BamHI o con EcoRV, utilizando como sonda un gran fragmento de ADNmt obtenido mediante PCR de largo alcance. El diagnóstico de depleción del ADNmt se realiza también por hibridación Southern, comparando los niveles de ADNmt con los de ADN nuclear. La confirmación molecular de una alteración del ADNmt ayuda a establecer el diagnóstico de enfermedad mitocondrial y el patrón de herencia matrilineal. Esto tiene una importancia capital desde el punto de vista del consejo genético y el cálculo del riesgo de recurrencia de la enfermedad, ya que la herencia matrilineal está caracterizada por la transmisión exclusivamente por vía materna. Esto hace que tenga algunas características especiales: se afectan ambos sexos, pero los varones —enfermos o no— nunca transmiten la enfermedad, y sus descendientes (hijos o hijas) no son portadores; por otro lado, las mujeres afectadas transmiten la enfermedad a toda su descendencia, de forma que todas sus hijas tienen riesgo de transmitir y/o padecer la enfermedad, y todos sus hijos tienen riesgo de padecerla. Las enfermedades mitocondriales pueden deberse a defectos en genes nucleares o a alteraciones del propio genoma mitocondrial. La diferencia entre ambos tipos de procesos es importante porque los tipos de herencia son diferentes y las implicaciones para el cálculo de riesgos pueden ser grandes. Dada la importancia del metabolismo oxidativo, las enfermedades mitocondriales presentan gran variedad de síntomas y signos, y suponen un problema diagnóstico importante. En general encontramos afectación neuromuscular: neuropatía óptica, convulsiones, accidentes cerebrovasculares, mioclonías, neuropatía periférica, ataxia, demencia, miopatías. De todas formas, los pacientes con enfermedad del ADN mitocondrial pueden agruparse en tres categorías:

www.FreeLibros.me


CAPITULO 18

5/12/06

07:33

Página 251

251

Raramente se presenta como un síndrome fácilmente identificable: MELAS (encefalopatía mitocondrial con acidosis láctica y episodios de accidentes cerebrovasculares) muestra estatura baja, sordera bilateral, diabetes, convulsiones, accidentes cerebrovasculares y encefalopatía en la 3.ª o 4.ª décadas de la vida. LHON (Leber hereditary optic neuropathy) muestran fallo visual bilateral en la 2ª-3ª décadas. Otras presentaciones clásicas son la oftalmoplegia externa con o sin ptosis, que aparece junto con una miopatía proximal en CPEO (chronic progressvie external ophtalmoplegia) o con ataxia, sordera bilateral y defectos de conducción cardíaca en el Síndrome de Kearns-Sayre. Otros síndromes son NARP (neurogenic weakness, ataxia, retinitis pigmentosa) y MERRF (epilepsia mioclónica y ragged-red-fibers o fibras musculares rojas deshilachadas). Un segundo grupo de pacientes tienen una constelación de datos clínicos que sugieren enfermedad mitocondrial, pero no encajan en ninguno de los síndromes citados. Por ejemplo, son típicos los casos de estatura baja con sordera neurosensorial bilateral, oftalmoplegia con ptosis, diabetes y migrañas. Es necesario un estudio neurológico exhaustivo, y la asociación de cualquiera de estos datos con miopatía o signos de afectación neurológica central hace el diagnóstico de enfermedad mitocondrial muy probable. Sin embargo, lo más habitual es que estos pacientes sean estudiados para descartar gran cantidad de enfermedades neurológicas hereditarias autosómicas (alguna forma de ataxia espinocerebelosa, estadíos iniciales de la enfermedad de Huntington, síndrome de Usher, Charcot-Marie-Tooth) antes de que se llegue a pensar en enfermedad mitocondrial. Un diagnóstico común en estos pacientes es el de «miastenia congénita». El último gran grupo de enfermos es el más difícil de definir, y está constituido por pacientes con síntomas aislados que —después de un estudio exhaustivo— terminan achacándose a patología mitocondrial. Por ejemplo, un cierto porcentaje de accidentes cerebrovasculares juveniles son resultado de patología mitocondrial, pero además la presentación a menudo es extra-neurológica: cardiomiopatía hipertrófica, enfermedad tubular renal, hipoparatiroidis-

www.FreeLibros.me

Enfermedades por alteración del ADN mitocondrial

La Figura 18.9 muestra un árbol genealógico típico de herencia matrilineal.


CAPITULO 18

5/12/06

07:33

Página 252

mo, insuficiencia suprarrenal, diabetes, disfagia. La sordera familiar neurosensorial progresiva es frecuentemente debida a patología mitocondrial, como demostró el grupo de Xavier Estivill en 70 familias españolas con la mutación del nucleótido 1555.

252

Genética clínica

Entre las pruebas diagnósticas que resultan útiles para llegar al diagnóstico de patología mitocondrial, contamos con las siguientes:

• •

Investigaciones generales: habitualmente, estos pacientes han sido sometidos a gran catidad de tests. Es necesario ver la función cardíaca, test de tolerancia a glucosa, nivel de lactato en sangre (es más específico en el líquido cefalo-raquídeo), electroencefalograma para detectar encefalopatía subaguda, TAC cerebral (es común la calcificación bilateral de ganglios basales). Investigaciones específicas: detección de alteraciones en el ADN mitocondrial, tanto reordenamientos (deleciones, duplicaciones) como mutaciones puntuales. Lo más habitual es que las mutaciones estén en heteroplasmia, y esto determina la expresividad fenotípica (habitualmente es necesario >85 por ciento de ADNmt mutado para que se manifieste la enfermedad). Las mutaciones letales sólo pueden estar en heteroplasmia, pero en general el porcentaje de heteroplasmia varía en distintos órganos en un mismo individuo e incluso también con la edad, de ahí la enorme variabilidad clínica. En algunas entidades es relativamente sencilla la detección molecular: por ejemplo, hay tres mutaciones que en conjunto explican el 95 por ciento de los pacientes con LHON. En cambio, las deleciones responsables de los síndromes de CPEO o Kearns-Sayre no son detectables en sangre, por lo que los resultados negativos han de ser interpretados con cautela. En estos casos, la biopsia de músculo esquéletico es la piedra angular para el diagnóstico de patología mitocondrial: por un lado, la detección histoquímica de fibras deficientes en COX y en otros complejos de la cadena respiratoria confirma la afectación mitocondrial; además, los estudios moleculares en ADN muscular confirman la presencia de deleciones o de mutaciones puntuales.

18.6 Diagnóstico prenatal El avance de las técnicas diagnósticas genéticas permite hoy en día, para determinados procesos, realizar diagnóstico precoz dentro del útero. Esta modalidad diagnóstica, llamada diagnóstico prenatal, es con frecuencia causa de la petición de consejo genético, y tiene unos matices especiales por las implicaciones emocionales fuertes que conlleva para la familia. El desarrollo de los métodos de diagnóstico prenatal ha ido parejo a la práctica del consejo genético, y por tanto se ha realizado de modo responsable y adecuado. En cambio, el uso generalizado de nuevos métodos, especialmente la ecografía, fuera del contexto del consejo genético (o incluso como sustituto del mismo) sin realizar adecuadamente el cálculo de riesgos, la detección de portadores ni otras medidas de apoyo, supone un descenso en la calidad de la asistencia que reciben las familias con enfermedades genéticas. El uso de pruebas de barrido (screening) en el primer trimestre del embarazo significa que la mayor parte de las consultas de diagnóstico prenatal se realizan en situaciones en las que no exis-

www.FreeLibros.me


CAPITULO 18

5/12/06

07:33

Página 253

www.FreeLibros.me

253

Diagnóstico prenatal

tía riesgo previo de una enfermedad genética, lo cual genera situaciones especialmente delicadas que es importante gestionar bien. Dado que los procesos de diagnóstico prenatal suponen una cierta tensión emocional para la familia, especialmente para la madre, y pueden provocar una morbilidad fetal significativa, se recomienda que sólo se realice diagnóstico prenatal cuando se cumplen una serie de condiciones y en aquellos casos en que está indicado. En concreto, sólo se debe plantear el diagnóstico prenatal en el caso de enfermedades graves para las que exista un método diagnóstico específico y fiable, y que sean susceptibles de tratamiento o prevención. Las indicaciones principales, por tanto, son las cromosomopatías, los defectos del tubo neural, y la edad materna avanzada. También se debe valorar la aceptación o no, por parte de la familia, del aborto eugénico como opción, ya que algunos autores desaconsejan iniciar los estudios de diagnóstico prenatal cuando dicha opción no se acepta (por motivos éticos, religiosos o de índole personal). En efecto, en estas circunstancias no está claro que el diagnóstico conlleve ningún beneficio, y por el contrario pueden generarse conflictos serios que son difíciles de resolver y a los que el facultativo no podrá dar respuesta. En estas circunstancias, el diagnóstico prenatal sólo sería de utilidad si se pueden tomar medidas preventivas o terapéuticas en el periodo fetal, lo cual sólo es posible en un número reducido de enfermedades. Por tanto, antes de la puesta en marcha del proceso de diagnóstico prenatal es importante conocer las disposiciones de la pareja respecto a las posibles opciones terapéuticas, además de considerar otros factores como la severidad de la posible enfermedad, la posibilidad de tratamiento o medidas preventivas, y la fiabilidad de las técnicas de diagnóstico prenatal. Este último punto es también de gran importancia, y debe ser explicado con claridad y ejemplos prácticos, porque el concepto de «riesgo» no siempre es correctamente entendido. Igualmente es importante que no se realice diagnóstico prenatal sin una estimación previa del riesgo que tiene un feto concreto de padecer la enfermedad: el diagnóstico prenatal no está exento de complicaciones y supone en sí mismo un riesgo para el feto, por lo que no está justificado realizarlo cuando el riesgo previo de padecer esa enfermedad es muy bajo. Esto supone, lógicamente, que el diagnóstico prenatal debe formar parte del proceso global de consejo genético y ser realizado, siempre que sea posible, por especialistas en genética clínica. Los dos métodos más utilizados para la obtención de material fetal son la amniocentesis y la toma de una biopsia de vellosidades coriónicas. La amniocentesis consiste en la toma de una muestra de líquido amniótico, que contiene células fetales en suspensión. Dichas células se pueden cultivar in vitro para después realizar estudios cromosómicos, bioquímicos o moleculares, lo cual requiere entre una y tres semanas. El procedimiento es, guiado por ultrasonidos y, en manos experimentadas, fiable. Sus principales inconvenientes son el límite de edad fetal, ya que no puede realizarse antes de las 15 semanas de gestación, y los riesgos de pérdida fetal que conlleva (en torno al 0,5-1 por ciento). La biopsia de vellosidades coriónicas puede realizarse durante el primer trimestre del embarazo, en torno a la décima semana, y es especialmente útil para realizar estudios moleculares y en la presencia de un riesgo alto de cromosomopatía. En cambio, es menos utilizada que la amniocentesis cuando el riesgo de alteraciones citogenéticas es bajo. El procedimiento se realiza me-


CAPITULO 18

254

5/12/06

07:33

Página 254

Genética clínica

diante punción a través de la pared abdominal (transabdominal) o a través del cuello del útero (transcervical), bajo guía ecográfica. En ese momento, el tejido coriónico todavía no forma una placenta propiamente dicha, por lo que la biopsia se examina bajo microscopio y se aíslan las vellosidades (que únicamente contienen tejido fetal). El material obtenido puede utilizarse directamente (sin necesidad de cultivo) para estudios moleculares o enzimáticos. En general, este procedimiento se reserva para embarazos de alto riesgo, ya que la probabilidad de pérdida fetal es mayor que en la amniocentesis (en torno al 2-3 por ciento). Dado el riesgo relativamente alto de daño fetal que tienen la amniocentesis y, sobre todo, la obtención de vellosidades coriónicas, desde hace años se están buscando métodos no invasivos que permitan realizar estudios moleculares o bioquímicos en material fetal. Entre éstos, estan siendo muy utilizados los métodos ecográficos, el análisis bioquímico de sangre materna, el análisis de células fetales presentes en la sangre materna, o incluso la obtención de sangre fetal (aunque este procedimiento es más invasivo y por tanto más peligroso que los otros mencionados). También en los últimos años, con la proliferación de las técnicas de fertilización in vitro, es posible realizar diagnóstico genético preimplantatorio, obteniendo un blastómero a partir de un embrión de pocas células y realizando estudios moleculares a partir del ADN de esa única célula. Por desgracia, dicho procedimiento habitualmente no se realiza en el contexto del consejo genético, y todavía no existen datos claros acerca del posible daño fetal que pueda producir. Tampoco hay estudios abundantes sobre las tasas de error que se obtienen en el diagnóstico de las distintas enfermedades genéticas, y en cualquier caso su aplicación está limitada por la baja tasa de éxito de la fertilización in vitro.

www.FreeLibros.me


CAPITULO 15

5/12/06

07:27

Pรกgina 209

www.FreeLibros.me


CAPITULO 19

5/12/06

07:35

Página 255

E) Nuevas herramientas de la genética moderna

Esta sección aborda los dos últimos temas del programa, que introducen al alumno en las cuestiones de más actualidad y le abren perspectivas de futuro.

www.FreeLibros.me


CAPITULO 19

5/12/06

07:35

Página 257

CAPÍTULO 19

Terapia génica

Contenidos 19.1 Componentes de un sistema de terapia génica y vías de administración 19.2 Naturaleza del ácido nucleico terapéutico 19.3 Tipos de vectores y su utilización en distintas estrategias de transferencia génica 19.4 Aplicaciones clínicas de la terapia génica en el momento actual

19.1 Componentes de un sistema de terapia génica y vías 19.1 de administración El desarrollo de la genética molecular durante los últimos años, y especialmente toda la información derivada del Proyecto Genoma Humano, han propiciado que podamos afrontar la modificación directa de las alteraciones genéticas o la utilización de ácidos nucleicos como agentes terapéuticos. La terapia génica es una nueva modalidad terapéutica surgida a finales de los años 80, y que puede definirse como la transferencia de ácidos nucleicos (ADN o ARN) con fines terapéuticos. Toda estrategia de terapia génica se basa, por tanto, en la transferencia de ácidos nucleicos (transferencia génica) al interior de un grupo de células. Estas células pueden ser las células enfermas –cuyo daño se pretende reparar–, o bien un grupo de células normales que se modifican genéticamente para que sean las efectoras de una acción terapéutica, por ejemplo sintetizando una proteína concreta. Por lo tanto, todo sistema de terapia génica es análogo a un sistema de transporte, en el que hay un agente que es transportado y un vehículo de transporte. En nuestro caso, el agente transportado es un ácido nucleico y el vehículo encargado de llevarlo al interior de las células diana se denomina vector. Según el modo de hacer llegar el vector (conteniendo el agente terapéutico) a las células diana, es ya clásica la distinción entre terapia génica ex vivo y terapia génica in vivo. En el primer caso, la administración del vector se realiza fuera del cuerpo: se obtiene una biopsia del órgano de interés, se expanden las células mediante culti-

www.FreeLibros.me


CAPITULO 19

5/12/06

07:35

Página 258

258

Terapia génica

In vivo VECTOR

Ex vivo

La Figura 19.1 ilustra los componentes de un sistema de terapia génica y las vías de administración.

vo celular y se ponen en contacto con el vector mientras están siendo cultivadas. Esto hace posible seleccionar las células que hayan sido modificadas genéticamente y reintroducirlas en el paciente. En la administración in vivo, el vector terapéutico se administra directamente al individuo enfermo por cualquiera de las vías habituales (intramuscular, oral, intravenosa, intraportal, subcutánea), escogiendo aquella que nos permita alcanzar la máxima eficacia terapéutica.

19.2 Naturaleza del ácido nucleico terapéutico Según el efecto biológico que pretendemos obtener, el agente terapéutico será de distinta naturaleza. En general, podemos clasificar los ácidos nucleicos terapéuticos en tres grupos, dependiendo de si buscamos la corrección directa de una mutación, la suplementación génica, o la inhibición de la expresión. a)

En los últimos años se ha conseguido corregir específicamente defectos a nivel del ADN mediante la utilización de quimeraplastos, moléculas quiméricas (híbridas) formadas por ADN y ARN que son capaces de reconocer específicamente una mutación y corregirla. Este tipo de tecnología funciona con cierta eficacia cuando se aplica a células en cultivo (in vitro), y es de esperar que en los próximos años se pueda utilizar también in vivo. Los quimeraplastos son oligonucleótidos formados por una molécula lineal de ADN que contiene un tracto de cinco desoxi-ribonucleótidos complementarios a la secuencia genómica que se quiere corregir. Es importante que esta región co-

www.FreeLibros.me


CAPITULO 19

5/12/06

c)

Página 259

rrectora esté flanqueada por fragmentos de 10 ribonucleótidos (ARN). El oligonucleótido se empareja específicamente con la región mutada y los sistemas de reparación celulares llevan a cabo la reparación de la mutación tomando como molde la base correspondiente del oligonucleótido terapéutico. Teóricamente, es posible diseñar oligonucleótidos ARN/ADN para corregir directamente las mutaciones puntuales que causan las enfermedades hereditarias más frecuentes. En el caso de mutaciones que simplemente producen pérdida de función, puede ser suficiente la suplementación génica, es decir, suplementar las células con copias normales del gen sin preocuparnos de corregir las mutaciones presentes en el ADN genómico. Lo más habitual en estos casos es que el agente terapéutico sea una unidad de expresión en la que la transcripción del gen en cuestión viene regulada por promotores virales potentes, por promotores regulables o por promotores específicos de un tipo celular concreto. Cuando el defecto genético que tratamos de corregir origina una ganancia de función, como suele suceder en mutaciones con efectos oncogénicos, lo lógico es intentar inhibir la expresión del gen que está causando el fenotipo aberrante. Los agentes terapéuticos más utilizados en estas circunstancias son las moléculas antisentido o los ribozimas. Los oligonucleótidos antisentido pueden inhibir directamente la expresión de un gen al unirse a la doble hélice de ADN mediante enlaces tipo Hoogsteen, formando una triple hélice que impide la transcripción mediada por la ARN polimerasa II. Estos oligonucleótidos suelen estar modificados químicamente para aumentar su estabilidad y eficacia, siendo las principales modificaciones los grupos fósforo-tioato en el esqueleto desoxi-ribosa-fosfato de los oligonucleótidos, o bien los ácidos nucleicos en los que el enlace fosfo-diéster viene substituido por un enlace peptídico (denominados Acidos Nucleicos Peptídicos, PNA). Los ARNm antisentido son capaces de emparejarse con los ARN sentido y formar moléculas bicatenarias de ARN que no pueden ser traducidas y son digeridas por la RNAsa H celular. Los ribozimas, pequeñas moléculas de ARN con actividad catalítica, pueden ser diseñados para reconocer un ARNm específico y degradarlo merced a su actividad endonucleolítica específica. En general, la utilización de moléculas antisentido y ribozimas está limitada por la baja eficacia que muestran todavía en modelos in vivo. Hoy en día, las mejores perspectivas de inhibición eficaz y específica de la expresión génica se basan en la interferencia de ARN, un mecanismo de silenciamiento génico post-transcripcional descrito en plantas y C. elegans que consiste en la degradación de ARN mensajeros endógenos por la presencia de moléculas pequeñas de ARN de doble cadena homólogas al mensajero que se destruye. Este proceso depende de una RNAasa tipo III llamada DICER, responsable de la formación de los ARN pequeños, y de un complejo llamado RISC (RNA Induced Silencing Complex) que contiene unas proteínas del complejo ARGONAUTA y los ARN pequeños que dirigen el complejo a la diana. Se ha visto que este mecanismo también juega un papel importante en la regulación génica en humanos, ya que el análisis del genoma ha revelado la presencia de genes que codifican ARN pequeños (aproximadamente 75 nucleótidos) que forman horquillas y que son procesados por

www.FreeLibros.me

259

Naturaleza del ácido nucleico terapéutico

b)

07:35


CAPITULO 19

5/12/06

07:35

Página 260

DICER y proteínas del complejo Argonauta para generar ARN intereferentes pequeños, de unos 21-22 nucleótidos. Estos genes endógenos se denominan miRNA (microRNA), para diferenciarlos de los siRNA que provienen de moléculas bicatenarias de ARN de procedencia externa. Actualmente se piensa que ambos tipos de moléculas (miRNA y siRNA) tienen la misma vía efectora, que actúa impidiendo la traducción (si la homología de la molécula interferente con el ARN mensajero no es total), o bien eliminando los mensajeros si la homología es total. Sorprendentemente, también se ha visto que las repeticiones centroméricas y los transposones, cuando se transcriben, dan lugar a ARN interferentes pequeños que utilizan este mecanismo para modificar la cromatina, induciendo metilación en las histonas o en el ADN y provocando la formación de heterocromatina o el silenciamiento transcripcional. En los últimos años se ha demostrado que se pueden utilizar siRNAs o microRNAs para inhibir la expresión de genes endógenos, generando moléculas interferentes específicas para un gen concreto. Por ejemplo, se ha conseguido silenciar genes endógenos en células humanas mediante siRNAs dirigidos específicamente frente a promotores concretos. Dicho silenciamiento se lleva a cabo por metilación de los dinucleótidos CpG de esos promotores y por metilación de la lisina 9 de la histona H3 de esa región. El avance más espectacular usando esta tecnología tuvo lugar en 2004, cuando un grupo consiguió reducir hasta un 40 % los niveles de colesterol en ratón, usando unos siRNA sintéticos conjugados con colesterol que fueron injectados directamente en la vena de la cola. Los siRNA fueron captados eficazmente por receptores del hígado, yeyuno y otros órganos y provocaron la degradación de los ARNm endógenos de apolipoproteína B, con el consiguiente descenso en los niveles de LDL y colesterol total.

260

Terapia génica

En la Figura 19.2 se muestran algunos ejemplos de moléculas utilizadas en distintas estrategias de terapia génica.

19.3 Tipos de vectores y su utilización en distintas estrategias 19.3 de transferencia génica Los ácidos nucleicos terapéuticos han de ser vehiculizados al interior de las células diana por medio de vectores adecuados. Se distinguen dos tipos fundamentales de vectores: los basados en virus (vectores virales) y los vectores sintéticos (vectores no virales) que intentan emular la capacidad natural que tienen los virus de introducir ácidos nucleicos en las células. 1.

Los vectores virales fueron los primeros en ser utilizados, dada su alta eficacia como vehículos de ácidos nucleicos. Los virus están compuestos por un ADN o un ARN rodeado de una cápside proteica y, en algunos casos, una envuelta lipoproteica. El ciclo biológico de los virus pasa por la introducción del genoma viral en determinados tipos celulares, habitualmente por la presencia de receptores en la membrana de las células. Para poder utilizar un virus

www.FreeLibros.me


CAPITULO 19

5/12/06

07:35

Página 261

a)

a)

LTR

Vectores retrovirales. La familia Retroviridae está compuesta por las subfamilias Spumaviridae, Lentiviridae y Oncoviridae. Los vectores retrovirales utilizados en terapia génica están derivados de los oncovirus murinos del tipo C, especialmente los que son anfitrópicos (que pueden infectar tanto células murinas como humanas). Recientemente se han desarrollado vectores derivados de lentivirus, especialmente del HIV-1. Los retrovirus son virus ARN que tienen una envuelta fosfolipídica, con glicoproteínas que determinan el tropismo del virus al ser reconocidas por receptores celulares específicos. Dentro de esta envuelta hay una cápside proteica de estructura icosaédrica que contiene dos copias del genoma viral, la transcriptasa inversa (RT), y la integrasa. El genoma de un retrovirus es una molécula de ARN de polaridad positiva en la que se distinguen tres tipos de genes: genes gag (que codifican las proteínas de la cápside), genes pol (que codifican las enzimas necesarias para el ciclo viral, como la proteasa y la integrasa) y genes env (que codifican las glicoproteínas de la envuelta). El genoma está flanqueado por dos repeticiones terminales largas (LTR, Long Terminal Repeat), y contiene también una señal de empaquetamiento PSI mediante la cual las moléculas de ARN se unen a las proteínas de la cápside y son empaquetadas eficazmente. El LTR izquierdo contiene una región (U3) para el comienzo de la transcripción, y un primer binding site (pbs) para el comienzo de la retrotranscripción. El LTR derecho contiene una secuencia de poli-purinas (ppt) para la replicación de la segunda cadena.

PSI

gag

pol

env

U3 pbs

LTR ppt

La Figura 19.3 muestra la estructura del genoma de un retrovirus.

a)

El ciclo replicativo de los retrovirus comienza cuando el virus es reconocido por receptores celulares, lo que lleva a la fusión de la envuelta viral con la membrana celular y a la internalización del nucleoide. A continuación tiene lugar la retrotranscripción del ARNm para formar un ADNc bicatenario (este proceso tiene lugar dentro de la nucleocápside,

www.FreeLibros.me

261

Tipos de vectores y su utilización en distintas estrategias de transferencia génica

como vector en terapia génica, es preciso insertar el ácido nucleico terapéutico en el genoma viral, y conseguir al mismo tiempo que el virus no se replique y, por tanto, no sea patogénico. Por esto, los virus utilizados en terapia génica se denominan virus recombinantes y defectivos (carecen de alguna función necesaria para su propio ciclo replicativo). A continuación se repasan los principales vectores virales utilizados actualmente en terapia génica.


CAPITULO 19

5/12/06

07:35

262

Terapia génica a)

a)

Página 262

antes de su llegada al núcleo de la célula), y después se desensambla la cápside al llegar a la membrana nuclear. El genoma viral se integra en el genoma de la célula huésped (integración mediada por la propia integrasa del virus), y entonces comienza la transcripción a partir del promotor U3 que está en el LTR izquierdo. Se producen distintos tipos de ARNm, fundamentalmente un transcrito que contiene gag y pol y otros transcritos que codificarán las proteínas de la envuelta. Los ARNm son exportados al citoplasma y traducidos, dando lugar a poliproteínas gag-pol y a las proteínas de la envuelta. Estas últimas viajan a la membrana celular, mientras que las poliproteínas gag-pol forman nuevas nucleocápsides al unirse a la señal de empaquetamiento de los ARNm positivos. Tras el empaquetamiento, que tiene lugar en el citoplasma, las cápsides salen de la célula por gemación, quedando rodeadas de nuevo por una envuelta compuesta por la membrana celular y las glicoproteínas codificadas por el virus que habían llegado anteriormente a la membrana. Las nuevas partículas retrovirales se activan cuando la proteasa rompe la poliproteína gag-pol dentro de la propia partícula viral y da lugar a moléculas independientes de proteasa, integrasa y retrotranscriptasa. Es importante señalar que el nucleoide de un oncovirus es incapaz de atravesar la membrana nuclear, por lo que es necesario que la célula sufra al menos una mitosis para que el genoma viral entre en contacto con el genoma de la célula huésped. En cambio, los retrovirus de la familia de los lentivirus sí que pueden atravesar la membrana nuclear, por lo que pueden infectar células que no están en división. Esta es una propiedad muy importante a la hora de valorar las posibles aplicaciones de estos tipos de vectores. Para generar un retrovirus recombinante defectivo, es necesario sustituir los genes de las proteínas virales por el gen terapéutico que se quiere utilizar. Lógicamente, para producir estos virus defectivos debemos usar una línea célular (célula empaquetadora) que aporte los genes virales en trans. Estas células empaquetadoras tienen los genes virales insertados en el genoma celular, de modo que expresan establemente las proteínas virales. Sin embargo, las copias de los genes virales que están integradas en el genoma celular carecen de la señal de empaquetamiento, por lo que sus transcritos no pueden empaquetarse en las nuevas partículas virales. De este modo, una célula empaquetadora en condiciones normales no produce viriones completos, sino sólo partículas vacías. En cambio, cuando transfectamos estas células con un plásmido recombinante que contenga el ADN terapéutico flanqueado por los LTR y por la señal de empaquetamiento (además de otros elementos necesarios en cis como el primer binding site, y el tracto polipurínico necesario para la síntesis de la segunda cadena) se generarán partículas retrovirales recombinantes y defectivas, que pueden ser purificadas y concentradas a partir de los sobrenadantes del cultivo celular. En este proceso es muy importante evitar la aparición de retrovirus con capacidad replicativa, que podrían generarse por recombinación homóloga entre las secuencias virales que

www.FreeLibros.me


CAPITULO 19

5/12/06

07:35

Página 263

El vídeo de la Figura 19.4 explica el ciclo replicativo de los retrovirus y el proceso de generación de retrovirus defectivos recombinantes.

a)

a)

b)

Los retrovirus recombinantes defectivos han sido muy utilizados en terapia génica. Por las limitaciones propias del tamaño del genoma viral, el ADN terapéutico no puede ser mayor a 7-8 kb. Son vectores con buena infectividad, un tropismo amplio, pero son bastante lábiles (lo que dificulta su purificación) y sólo transducen eficazmente células que están en división. Además, son inactivados en el torrente sanguíneo por el sistema del complemento, por lo que su principal uso ha estado reservado a estrategias de terapia génica ex vivo. Su capacidad integrativa les permite alcanzar, en teoría, una duración muy larga de la expresión incluso en células que estén dividiéndose activamente. Sin embargo, los promotores virales suelen silenciarse por metilación, por lo que la expresión no es tan prolongada como cabría esperar. Se está investigando la posibilidad de modificar el tropismo de estos vectores, mediante la creación de proteínas de la envuelta quiméricas que incluyan algún scFv (anticuerpo monocatenario) u otros ligandos de receptores celulares conocidos. Como se ha mencionado, recientemente se han desarrollado vectores retrovirales basados en lentivirus, aprovechando la circunstancia de que el HIV-1 es uno de los virus mejor estudiados. El genoma de este virus contiene algunos genes (tat y rev, por ejemplo) que no están presentes en los oncoretrovirus y que son esenciales para la expresión de los genes virales. Algunas de las proteínas virales tienen señales de localización nuclear y facilitan la entrada del virus por los poros nucleares, de ahí la capacidad que tienen estos virus de infectar células que no están en división. Aunque los problemas de seguridad de los lentivirus están prácticamente superados, todavía hay que mejorar los sistemas de producción para poder utilizarlos en pacientes con total seguridad. Su principal aplicación está en la transferencia de genes a células del sistema nervioso in vivo, y a progenitores hematopoyéticos ex vivo, siendo esta última una propiedad especialmente interesante por su inmenso potencial terapéutico, y porque estas células son prácticamente intransfectables por otros medios. Vectores adenovirales. Se conocen gran cantidad de serotipos de adenovirus humanos, pero los más utilizados en terapia génica han sido los serotipos 2 y 5. Los adenovirus son virus ADN sin envuelta, responsables de las principales enfermedades de vías respiratorias altas (el «catarro» común), con muy buen tropismo por células humanas. La nucleocápside de un adenovirus consta de una cápside icosaédrica que está compuesta por 720 proteínas hexona y 60 proteínas pentona. De las pentonas parte

www.FreeLibros.me

263

Tipos de vectores y su utilización en distintas estrategias de transferencia génica

están presentes en nuestro plásmido con las secuencias virales presentes en el genoma de la célula empaquetadora. Por este motivo, se utilizan células empaquetadoras que tienen los genes virales separados entre sí, de modo que serían necesarias varias recombinaciones independientes para generar un virus replicativo, algo altamente improbable.


CAPITULO 19

5/12/06

07:35

264

Terapia génica

a)

la proteína de la fibra (una proteína trimérica) que termina en una proteína «botón» (knob) mediante la cual el adenovirus se une a receptores celulares específicos. El genoma adenoviral es un ADN de doble cadena de aproximadamente 35 kb de tamaño, flanqueado por repeticiones terminales invertidas (ITR) de 100-140 nucleótidos y una señal de empaquetamiento (psi) cerca del ITR izquierdo. Contiene gran cantidad de genes, que se agrupan en regiones tempranas (early) y tardías (late), según el momento en que se transcriben después de la infección. Así, las regiones tardías se transcriben tras la replicación del genoma viral, y contienen los genes que codifican las proteínas estructurales del virus. En cambio, las regiones tempranas se transcriben antes de la síntesis del ADN viral, y cumplen varias funciones:

• • • b)

b)

Página 264

Las proteínas codificadas en E1 incluyen, por ejemplo, E1A (proteína necesaria para transactivar la transcripción de los demás genes virales) y E1B 55kd (que se une a E4). Además, estas proteínas interfieren con las funciones de la célula huésped: E1A es una oncoproteína, E1B 19kd inhibe la apoptosis mediada por p53 y E1B 55kd promueve la degradación de p53. La región E2 codifica proteínas necesarias para la replicación viral: ADN polimerasa, proteína terminal, etc. La región E3 codifica algunas proteínas que ayudan al adenovirus a escapar al sistema immune, como la proteína gp19kd que inhibe la presentación de fragmentos antigénicos con moléculas de clase II del Complejo Mayor de Histocompatibilidad. La región E4 codifica diversas proteínas que silencian genes endógenos, regulando el transporte de ARN mensajeros fuera del núcleo.

El ciclo replicativo de un adenovirus es más sencillo que el de los retrovirus. El adenovirus se une a un receptor de membrana específico denominado CAR (CoxackieAdenovirusReceptor) mediante el botón de la fibra, y a continuación la pentona se une por un motivo RGD (arginina-glicina-aspártico) a integrinas cercanas para después ser internalizado por endocitosis. La propia cápside adenoviral es capaz de desestabilizar el endosoma, que se rompe y libera las partículas virales al citoplasma. Las nucleocápsides llegan a la membrana nuclear y son capaces de introducir el genoma viral a través de los poros nucleares. Para generar adenovirus recombinantes defectivos (es decir, que lleven el ADN terapéutico pero no puedan replicarse) se sigue una estrategia similar a la que veíamos para los retrovirus: substituir algún gen viral por el gen terapéutico. Lo más habitual es delecionar el genoma viral en la región E1, para lo que necesitaremos una célula empaquetadora que exprese de manera estable los genes contenidos en esa región. La línea celular más utilizada como célula empaquetadora para construir adenovirus recombinantes se denomina célula 293. Para conseguir el adenovirus recombinante, se cotransfectan células 293 con dos plásmidos distintos:

www.FreeLibros.me


CAPITULO 19

5/12/06

07:35

Página 265

La Figura 19.5 muestra la estructura del genoma de un adenovirus y de una partícula adenoviral, así como el proceso general de producción de adenovirus recombinantes defectivos.

b)

c)

Los adenovirus comenzaron a usarse en terapia génica más tarde que los retrovirus, pero rápidamente ganaron en popularidad y hoy en día son los vectores más utilizados para aplicaciones in vivo. Infectan gran variedad de células, son relativamente estables y fáciles de purificar y concentrar, y son eficaces tanto sobre células quiescentes como sobre células en división. Como el genoma del vector no se integra en el genoma de la célula huésped, la duración de la expresión en células en división es limitada. Su principal inconveniente es la toxicidad que producen a dosis altas, y la fuerte respuesta inmune celular y humoral que sigue a su administración, con la consiguiente disminución de eficacia terapéutica. Los nuevos vectores adenovirales «vacíos» superan algunos de estos inconvenientes. Vectores Virales Adenoasociados. Se trata de Parvovirus que infectan al hombre pero no son patógenos. Pertenecen al grupo de los Dependovirus, virus ADN sin envuelta que necesitan de funciones helper para completar su ciclo replicativo completo. Estas funciones helper las aporta un adenovirus o un herpesvirus que sobreinfecta las mismas células que previamente habían sido infectadas por un dependovirus. El genoma de un virus adenoasociado es un ADN monocatenario con un tamaño de 4,8 kb y una estructura muy simple, con dos regiones codificantes: cap, que codifica las tres proteínas de la cápside, y rep, que codifica cuatro proteínas necesarias para la replicación viral. El genoma está flanqueado por

www.FreeLibros.me

265

Tipos de vectores y su utilización en distintas estrategias de transferencia génica

un plásmido en el que el gen terapéutico está flanqueado por parte del gen E1, la señal de empaquetamiento y los ITR virales, y otro plásmido que contiene todo el genoma viral excepto la señal de empaquetamiento y la región de E1 que está presente en trans en el genoma de las células 293. Una vez dentro de la célula, los mecanismos de recombinación son capaces de generar un genoma viral recombinante que llevará el gen terapéutico dentro del genoma viral (al que le falta E1). Como el gen terapéutico va unido a la señal de empaquetamiento PSI, únicamente estos transcritos se empaquetarán correctamente en las nuevas cápsides virales, mientras que los genomas virales producidos endógenamente carecen de la señal PSI y por tanto no producen viriones infectivos. Los adenovirus delecionados en E1 permiten insertar genes terapéuticos con un tamaño máximo de 5 kb, por lo que posteriormente se han generado vectores que llevan además deleciones en E3 y E4, para conseguir llegar a una capacidad de 7-8 kb. La última generación de vectores adenovirales consiste en los llamados adenovirus gutless (vacíos), en los que todo el genoma viral ha sido delecionado y por tanto tienen una capacidad teórica en torno a las 30 kb de ADN exógeno. Para producirlos hay que aportar en trans todas las funciones adenovirales necesarias, mediante plásmidos helper o por estrategias que utilizan el sistema Cre/loxP.


CAPITULO 19

5/12/06

07:35

266

Terapia génica

b)

b)

b)

d)

Página 266

dos repeticiones terminales invertidas (ITR), que forman unas estructuras en horquilla y que son los únicos elementos necesarios en cis para poder llevar a cabo el ciclo vital del virus. La infección por un virus adenoasociado comienza por la unión del virus a receptores celulares y su entrada en la célula. El genoma viral es capaz de entrar en el núcleo incluso en células que no se dividen, y una vez allí se convierte a doble hebra y se integra en un locus específico localizado en el brazo largo del cromosoma 19 humano (banda 19q13). Todas estas funciones están mediadas por proteínas de la célula huésped, pero además se ha comprobado que las proteínas virales Rep78/68 son necesarias para la integración específica del genoma viral en una secuencia llamada AAVS1 que está en 19q13. En ausencia de funciones helper, el genoma viral integrado permanecerá como un provirus, en forma latente. Ante una sobreinfección por adenovirus o herpesvirus, el adenoasociado comienza su fase lítica con la transcripción de los genes virales, la replicación del genoma viral y el empaquetamiento en las cápsides para dar lugar a nuevos viriones. Para obtener virus adenoasociados recombinantes como vectores en terapia génica, se construye un plásmido recombinante que contiene el gen terapéutico flanqueado por los ITR virales. En el método clásico de producción de estos vectores, se cotransfectan células 293 con el plásmido recombinante y con otro plásmido que aporta en trans las funciones cap y rep, y después se infectan esas mismas células con un adenovirus. El problema de este procedimiento es que los preparados virales tienen una fuerte contaminación por adenovirus, por lo que es necesario inactivar este adenovirus contaminante mediante tratamiento con calor. Los métodos actuales de producción evitan este problema al aportar las funciones helper del adenovirus en un tercer plásmido que se cotransfecta con los otros dos, de forma que la generación de adenovirus maduros es prácticamente imposible. Los vectores adenoasociados están ganando popularidad rápidamente por sus extraordinarias características: buena infectividad, integración en el genoma de la célula huésped, muy baja toxicidad y ausencia de respuesta inmune celular frente a las proteínas virales. Por desgracia, la especificidad de la integración en un locus concreto se pierde en los virus adenoasociados recombinantes, ya que no se produce Rep68/78 (que es absolutamente necesaria para que tenga lugar esta integración específica). En consecuencia, la integración se realiza al azar, como en el caso de los retrovirus. Los virus adenoasociados pueden transducir células mitóticas o células en división, y están especialmente indicados en aplicaciones in vivo en las que se requiere una expresión prolongada del gen terapéutico. Otros vectores virales que actualmente están ganado en popularidad son los Herpesvirus, basados en el virus del herpes simplex (HSV), que tienen un marcado tropismo neuronal y por eso se emplean fundamentalmente para la transferencia de genes al sistema nervioso. Los HSV son virus envueltos con un genoma lineal de 152 kb de ADN bicatenario, en el que se

www.FreeLibros.me


CAPITULO 19

5/12/06

Página 267

han identificado más de 80 genes. El genoma está dividido en dos regiones únicas (Larga y Corta) que están flanqueadas por repeticiones terminales (TR) y repeticiones internas (IR). El virus se une a glicosamino-glucanos celulares y a receptores celulares específicos (por ejemplo, el receptor HveC, que pertenece a la superfamilia de las inmunoglobulinas y se expresa a alto nivel en el sistema nervioso). Tras la entrada en la célula, el virus avanza por transporte retrógrado y llega al núcleo, penetrando por los poros nucleares. Después de entrar en el núcleo se expresan los genes inmediatos tempranos, que activan la expresión de los genes tempranos (necesarios para la síntesis de ADN viral) y de los genes tardíos (proteínas estructurales). Una característica importante es que uno de los genes inmediatos tempranos (ICP4) es absolutamente necesario para la replicación viral, por lo que basta eliminarlo del genoma para obtener virus defectivos. En los vectores actualmente en uso se han delecionado todos los genes inmediatos tempranos, por lo que son totalmente apatogénicos. Otra característica importante de estos virus es que cuando no se replican entran en un periodo de latencia en el que se transcriben únicamente unos transcritos asociados a latencia (LATs), aunque no se expresen los genes inmediatos tempranos. Por tanto, incluyendo la unidad transcripcional en la región de latencia se pueden obtener virus defectivos que expresan de forma persistente un gen terapéutico. Además, se trata de vectores de gran capacidad porque permiten acomodar hasta 50 kb de ADN exógeno. rep

ITR

cap

ITR

rep78 p5

rep68 rep52 p19 rep40

VP1

p40

VP2 VP3

En la Figura 19.6 se muestra la estructura del genoma de virus adenoasociados (AAV) y herpes (HSV), así como el ciclo replicativo del AAV.

www.FreeLibros.me

267

Tipos de vectores y su utilización en distintas estrategias de transferencia génica

b)

07:35


CAPITULO 19

268

5/12/06

2.

07:35

Página 268

Terapia génica

Los Vectores no-virales representan un intento de imitar las funciones de los virus como vehículos de transferencia génica mediante sistemas sintéticos, de forma que en principio son vectores mucho más seguros desde el punto de vista de su peligrosidad biológica y su patogenicidad. En este sentido, los vectores no-virales no se diferencian conceptualmente de los fármacos a los que estamos habituados. La principal limitación de este tipo de vectores es que, en la actualidad, su eficacia in vivo es mucho menor que la de los vectores virales. Esto se debe a la inestabilidad propia de sistemas sintéticos complejos y a las diferentes barreras que han de superar:

Los complejos entre el ácido nucleico y los demás componentes de estos sistemas han de ser estables tras su administración, y no desintegrarse antes de alcanzar las células. Por otra parte, la biodistribución de estos preparados hace que la concentración efectiva en las células diana sea baja, por lo que es importante que lleven en su superficie algún tipo de ligando para receptores específicos de las células a las que lo queremos enviar. Habitualmente, estos complejos entran en las células por endocitosis, de manera que quedan expuestos al ataque de las enzimas lisosomales. Para evitar esto, se intenta incluir en estos vectores algún tipo de molécula que altere el pH del endosoma y consiga romperlo antes de su fusión con los lisosomas y liberar así el complejo intacto al citoplasma. Estas moléculas suelen ser péptidos o proteínas virales que cumplen esta misma función en algunos tipos de virus. Una vez en el citoplasma, estos complejos han de ser lo suficientemente estables como para llegar hasta el núcleo, pues si el ácido nucleico se libera muy pronto será degradado por nucleasas citoplasmáticas. Pero si son demasiado estables, el ácido nucleico no conseguirá liberarse y por tanto no podrá entrar en el núcleo de la célula. Este compromiso entre protección y liberación es quizás uno de los retos más importantes que tienen que superar los vectores no virales para aumentar su eficacia actual. En cierta medida, la inclusión en estos complejos de alguna molécula capaz de dirigirlos al núcleo celular serviría para acelerar su tránsito citoplasmático. Por tanto, otro componente habitual en los vectores no virales son las moléculas con señales de localización nuclear que además permitan la entrada del ácido nucleico a través del complejo del poro nuclear, pues de lo contrario sólo serán efectivos en células que estén en mitosis.

Como se ve, la tarea de construir un vector no-viral «ideal» equivale a intentar reconstruir en el laboratorio lo que los virus consiguen de manera natural, lo cual no es en absoluto sencillo. En cualquier caso, son uno de los campos de investigación más activa, sobre todo por parte de empresas farmacéuticas y de biotecnología, y es previsible que los próximos años vean avances significativos en este terreno. Actualmente, los vectores no-virales más utilizados son los siguientes: a)

Inyección Directa. Lógicamente, lo más sencillo es injectar directamente el ácido nucleico (ADN desnudo) en el órgano de interés. Aunque poco eficaz,

www.FreeLibros.me


CAPITULO 19

5/12/06

Página 269

este procedimiento funciona razonablemente en ciertas aplicaciones y en algunos órganos. Por ejemplo, el músculo esquelético es uno de los órganos que más eficazmente incorporan un plásmido inyectado, alcanzando niveles de expresión suficientes para conseguir inmunización frente a proteínas virales, tumorales, etc. En ocasiones se utiliza la inyección de ADN formulado con diversos polímeros (sobre todo poli-vinil-pirrolidona) que lo protegen de la acción de las nucleasas y prolongan su vida media tras la administración. También se utiliza el ADN encapsulado en microesferas de polímeros biodegradables (por ejemplo, copolímeros de ácido láctico y glicólico), que pueden inyectarse en un órgano y proporcionar liberación sostenida del ácido nucleico terapéutico durante un periodo de tiempo más o menos prolongado, dependiendo del tipo de polímero utilizado. Otra variedad es la transferencia génica balística (pistola génica o «gene gun»), en la que el ácido nucleico terapéutico se adsorbe sobre la superficie de una bolas microscópicas de oro u otro metal inerte, que son disparadas a presión sobre el órgano diana. Es una vía de administración utilizada en la piel (para inmunización génica) o a veces sobre otros órganos, pero las bolas no tienen un gran poder de penetración (raramente superior a unos pocos milímetros). Complejos formados por el ácido nucleico terapéutico y otros componentes. Son los sistemas más complicados de elaborar y optimizar, pero los más eficaces dentro de los vectores no-virales. El principio que subyace a todos los sistemas de este tipo es la complejación del ADN (molécula grande con alto número de cargas negativas) con polímeros de naturaleza catiónica (con cargas positivas), de manera que la neutralización de cargas da lugar a complejos más o menos estables, de pequeño tamaño, en los que el ADN está protegido de la acción de nucleasas. Suele distinguirse entre lipoplexos (cuando el ADN se compleja con lípidos catiónicos) y poliplexos (ADN complejado por policationes, habitualmente poli-lisina o poli-etilén-imina). Sobre la estructura básica de un lipoplexo o un poliplexo pueden añadirse otro tipo de moléculas que actúen como estabilizadores, ligandos para receptores específicos, moléculas desestabilizadoras del endosoma, señales de localización nuclear. Por ejemplo, se ha utilizado poli-etilén-glicol para aumentar la estabilidad de lipoplexos en el torrente sanguíneo y evitar la inactivación por el suero. Asimismo, ha sido muy utilizada la unión de poli-lisina a transferrina o a orosomucoide, para conseguir unión específica a receptores hepáticos. Otra estrategia utilizada con bastante éxito ha sido la formación de lipoplexos que además incluyen partículas del virus hemaglutinante del Japón (virus Sendai) inactivados, lo que proporciona una entrada en las células muy eficaz (por la fusogenicidad del virus Sendai) y buen escape endosomal.

En la Figura 19.7 se muestran algunos ejemplos de vectores no virales.

La siguiente tabla resume las principales características de los vectores que se han mencionado:

www.FreeLibros.me

269

Tipos de vectores y su utilización en distintas estrategias de transferencia génica

b)

07:35


CAPITULO 19

5/12/06

07:35

Página 270

Retrovirus

Adenovirus

AAV

No virales

Tamaño máximo teórico

7-8 kb

7-8 kb (30 kb)

5 kb

No límite

Títulos alcanzados durante la preparación (partículas/ml)

108/ml

1012/ml

1011/ml

No límite

Administración preferente

Ex vivo

Ex/in vivo

Ex/in vivo

Ex/in vivo

Integración en el genoma

No

Sí/No

Mínima

Duración expresión in vivo

Corta

Corta

Larga

Corta

Inmunogenicidad

Poca

Mucha

Poca

Nada

Inmunidad previa

Improbable

No

Mutagénesis

Inflamación Toxicidad

Mutagénesis

Ninguno

270

Terapia génica

Problemas de seguridad

Como resumen de todo lo dicho acerca de vectores, podemos concluir diciendo que el vector «ideal» de terapia génica debería ser fácil de preparar, tener gran capacidad para aceptar genes terapéuticos de gran tamaño, funcionar tanto en células en división como en células quiescentes, ser totalmente inocuo e «invisible» para el sistema inmune, fácilmente dirigible a distintos tipos de células diana, ser capaz de persistir en las células durante periodos prolongados y poseer elementos reguladores de la transcripción del gen terapéutico que sean fácilmente regulables para poder variar los niveles del producto terapéutico según sea necesario. Hay numerosos ejemplos de cómo se han conseguido mejorar los distintos tipos de vectores para dotarlos con alguna de estas propiedades. Por ejemplo, los retrovirus se han podido pseudotipar con las proteínas de la envuelta del virus de la estomatitis vesicular para modificar su tropismo. Igualmente, se ha modificado la proteína «botón» de la fibra de los adenovirus mediante anticuerpos bi-específicos o por modificación genética. Los vectores no virales se han glicosilado para ser selectivamente reconocidos por receptores específicos presentes en distintos tipos celulares. También se han construido sistemas de transcripción regulables muy efectivos, que se pueden incorporar en los distintos tipos de vectores.

19.4 Aplicaciones clínicas de la terapia génica 19.4 en el momento actual Desde el caso de la niña Ashanti Da Silva, primer paciente de la historia tratado mediante terapia génica en 1989 por sufrir Inmunodeficiencia Combinada Severa (déficit del enzima adenosín-desaminasa), el número de ensayos clínicos llevados a cabo en todo el mundo ha aumentado rápidamente, de manera que en la actualidad hay varios miles de enfermos incluidos en protocolos clínicos de terapia génica. Como las estrategias utilizadas son variadísimas, a continuación se resumen las más utilizadas hasta el momento:

www.FreeLibros.me


CAPITULO 19

5/12/06

07:35

Página 271

El vídeo de la Figura 19.8 muestra algunos ejemplos de utilización de terapia génica frente al cáncer.

Terapia génica de enfermedades hereditarias: la mayoría de las enfermedades metabólicas debidas a mutaciones inactivantes en genes que codifican proteínas con actividad biológica (un enzima, un factor de coagulación, una hormona, etc.) pueden abordarse mediante una estrategia de suplementación génica que restaure los niveles de la proteína deficiente. Por ejemplo, se ha utilizado la transferencia génica al músculo para conseguir la producción local de distrofina en casos de distrofia muscular de Duchenne. De manera similar, se han transferido genes al músculo o al hígado para que estos órganos secreten al torrente circulatorio un factor que está ausente. En este sentido, ha tenido especial resonancia el éxito alcanzado con la transferencia mediada por virus adenoasociados del gen del factor IX de la coagulación al músculo esquelético, para producir niveles plasmáticos de este factor que puedan corregir los defectos en la coagulación que sufren animales hemofílicos.

www.FreeLibros.me

271

Aplicaciones clínicas de la terapia génica en el momento actual

Terapia génica del cáncer: la estrategia más utilizada es, sin duda, la utilización de los llamados genes suicidas. Se trata de transferir a las células tumorales un gen que codifique una proteína capaz de activar un pro-fármaco inactivo a su forma activa. Es muy popular la utilización del gen de la timidín-kinasa del virus del Herpes Simplex (HSV-tk), que codifica una timidín-kinasa capaz de fosforilar el ganciclovir a ganciclovir-trifosfato. El ganciclovir tri-fosfato es la forma activa capaz de interferir con la replicación del ADN y provocar la muerte de las células que están dividiéndose activamente. Por tanto, si somos capaces de transferir el gen de la HSV-tk a las células de un tumor, que tienen una alta tasa replicativa, la administración sistémica de ganciclovir conseguirá matar selectivamente las células tumorales. Una ventaja añadida es el llamado efecto espectador (bystander), mediante el cual la timidín-kinasa producida en unas células puede pasar a las células vecinas, de forma que aunque no todas las células tumorales hayan incorporado el gen terapéutico, el efecto citotóxico es bastante homogéneo en todo el tumor. Esta estrategia se ha empleado en tumores cerebrales, usando vectores retrovirales para transducir sólo células tumorales (en división) pero no neuronas (que no se dividen). También se ha empleado con éxito en tumores hepáticos, usando en este caso vectores adenovirales. Otra estrategia utilizada en terapia génica del cáncer se basa en la suplementación de las células malignas con genes supresores tumorales (p53, por ejemplo). Se ha utilizado también la transferencia al tumor de genes que inhiben la angiogénesis (endostatina, angiostatina, etc.) para eliminar el tumor por falta de aporte vascular. Por último, una de las estrategias que han tenido más éxito y que ofrecen mejores perspectivas de futuro es la inmunopotenciación, es decir, favorecer la puesta en marcha de una respuesta inmune frente a las células tumorales. En este sentido, se han transferido los genes de gran variedad de citoquinas o moléculas inmunopotenciadoras (IL-2, IL-12, GM-CSF, IFN-γ, TNFα, etc.) tanto a células tumorales como a células presentadoras de antígeno (células dendríticas), o bien se han transferido a las células tumorales los genes de moléculas co-estimuladoreas del complejo mayor de histocompatibildad (por ejemplo, B7.1) para favorecer la presentación de los antígenos tumorales.


CAPITULO 19

272

5/12/06

07:35

Página 272

Terapia génica

Inmunización frente a enfermedades infecciosas mediante transferencia génica, con el fin de que las células sinteticen péptidos inmunogénicos y estimulen al sistema inmune hasta eliminar el agente patógeno. Se están ensayando inmunizaciones génicas frente a virus (virus B y virus C de la hepatitis, virus de la gripe) u otros agentes, como el parásito de la malaria. Es bastante eficaz la injección directa de un plásmido en músculo o la transferencia intradérmica mediante pistola génica. En general, la eficacia de estos tratamientos reside en la capacidad de producir localmente una proteína que sea liberada y capturada por macrófagos y otras células presentadoras de antígenos, que procesan esas proteínas a pequeños péptidos y los presentan con moléculas de clase II del sistema mayor de histocompatibilidad (MHC) para estimular las células CD4+ (linfocitos T helper). Además, si las células transfectadas expresan moléculas de clase I del MHC también podrán presentar los péptidos recién sintetizados y estimular células CD8+ (linfocitos T citotóxicos). Una de las asignaturas pendientes de la terapia génica es la demostración de su utilidad clínica en humanos. En enero de 2006, el número de ensayos clínicos que incluían transferencia de genes ascendía a 1 145 en todo el mundo. El 80 por ciento de estos estudios son ensayos clínicos en fase I (estudio de toxicidad) o fase I/II, el resto son ensayos en fase II (estudio de eficacia terapéutica) o en fase III. Estos datos se resumen a continuación: Ensayos clínicos en enero de 2006: 1 145 en total Distribuidos por el tipo de enfermedad: Cáncer: 67 % Monogénicas: 9% Marcaje: 4% Infecciosas: 7% Vasculares: 9% Distribuidos por el tipo de vector utilizado: Retrovirus: 24 % Lipofección: 8% Adenovirus: 25% DNA desnudo: 17% HSV: 3% Virus adenoasociados: 3% Distribuidos por el tipo de gen terapéutico: Citoquinas: 26 % Antígenos: 15 % Genes suicidas: 7 % Proteínas deficientes: 6 % Genes supresores tumorales: 12 % Genes antisentido y ribozimas: 1 % Receptores: 4 %

www.FreeLibros.me


CAPITULO 20

5/12/06

07:37

Página 273

CAPÍTULO 20

Bioinformática del genoma humano

Contenidos 20.1 La Bioinformática 20.2 Bases de datos en Genética Humana: bases de datos de secuencias 20.3 Bases de datos en Genética Humana: bases de datos relacionadas con enfermedades 20.4 Búsquedas en bases de datos con BLAST 20.5 Navegadores del genoma humano

20.1 La Bioinformática Tradicionalmente, la investigación en Biología Molecular se ha realizado en el laboratorio experimental, pero la inmensa cantidad de datos generados en los últimos años ha propiciado el desarrollo de herramientas computacionales para extraer, organizar y analizar toda la información contenida en esos datos y así poder generar nuevo conocimiento. Por eso, hoy en día es difícil entender la investigación en biología sin la utilización de herramientas informáticas más o menos sofisticadas. La Bioinformática es la disciplina científica que combina biología, computación y tecnologías de la información. El objetivo de esta disciplina es facilitar nuevas percepciones biológicas y crear una perspectiva global que permita identificar los principios unificadores de la biología. Inicialmente, la Bioinformática se ocupaba sobre todo de la creación de bases de datos de información biológica, especialmente secuencias de nucleótidos y de proteínas, y del desarrollo de herramientas para la utilización y análisis de los datos contenidos en esas bases de datos. Sin embargo, cada vez es más claro que será necesario unificar toda esta información si queremos alcanzar un cuadro completo de la biología de la célula, de forma que los investigadores puedan comprender cómo se alteran estos procesos en las distintas enfermedades. Por eso, la Bioinformática ha ido evo-

www.FreeLibros.me


CAPITULO 20

274

5/12/06

07:37

Página 274

Bioinformática del genoma humano

lucionando para ocuparse cada vez con mayor profundidad del análisis e interpetación de los distintos tipos de datos que se generan hoy en día (secuencias de genomas, proteomas, orfeomas, dominios y estructuras de proteínas, etc.). Estas formas de análisis e interpretación de datos suelen denominarse Biología Computacional. Las principales áreas de la Bioinformática y de la Biología Computacional son, por tanto, 1) el desarrollo de herramientas que permitan el acceso, uso y actualización de distintos tipos de información biológica; 2) el desarrollo de nuevos algoritmos y soluciones estadísticas para analizar grandes conjuntos de datos y resolver problemas biológicos complejos, tales como predecir la estructura de un gen en una secuencia genómica, predecir la estructura de proteínas, identificar familias de proteínas a partir de sus secuencias, etc. En este capítulo nos centraremos únicamente en algunas herramientas necesarias para explorar el genoma humano desde el punto de vista biomédico, pero es importante tener en cuenta que existen muchas otras áreas de la Bioinformática que no se tocarán aquí. La Figura 20.1 enlaza con algunos recursos educativos en Bioinformática.

20.2 Bases de datos en Genética Humana: bases de datos 20.2 de secuencias Las bases de datos biológicas son archivos de datos almacenados de modo eficaz y uniforme. Los datos provienen de las distintas áreas de la Biología Molecular. Las bases de dados primarias contienen secuencias de ADN y de proteínas, estructuras de proteínas o perfiles de expresión de genes y proteínas. Cada registro de estas bases de datos contiene una secuencia y su correpondiente «anotación» (comentarios que incluyen información acerca de esa secuencia, habitualmente hechos de modo manual por algún investigador). Las bases de datos secundarias archivan los datos que son fruto del análisis de las bases de datos primarias; por ejemplo, son bases de datos secundarias las que contienen familias de proteínas, motivos o dominios proteicos, familias de genes, etc. Un aspecto crucial en las Bases de Datos es la necesidad de un interfaz que permita interrogar cada base de datos (o, mejor incluso, todas a la vez) de un modo intuitivo y sencillo, de manera que el investigador pueda obtener una imagen global y completa del proceso biológico que se propone estudiar. Las dos herramientas principales de búsqueda que están disponibles hoy en día son SRS (Sequence Retrieval System) para las bases de datos mantenidas en Europa por el Instituto Europeo de Bioinformática (EBI, European Bioinformatics Institute en Hinxton, Reino Unido) y Entrez para las bases de datos mantenidas por el Centro Nacional para la Información en Biotecnología de los Estados Unidos (NCBI, National Center for Biotechnology Information en Bethesda, Estados Unidos). En general, estos interfaces permiten extraer información mediante búsquedas por texto, ya que nos ofrecen una página de búsqueda donde introducimos la expresión que queremos buscar y obtenemos todos los registros que contienen esa expresión en alguno de sus campos. Este tipo de búsqueda es rápido y potente, ya que nos permite obtener gran cantidad de información (secuencias, descripciones, etc.) sobre una entidad concreta.

www.FreeLibros.me


CAPITULO 20

5/12/06

07:37

Página 275

La Figura 20.2 incluye algunos tutoriales para ilustrar el uso de Entrez y de SRS.

Entrez Gene es otra base de datos del NCBI, que podríamos calificar de secundaria ya que contiene infromación derivada de GenBank. Se trata de una base de datos centrada en genes, más que en secuencias, y por eso reúne todas las secuencias (además de información de otro tipo) sobre un gen concreto, en todos los genomas en los que existen secuencias correspondientes a dicho gen. De hecho, Entrez Gene es un interfaz único con gran cantidad de información descriptiva sobre loci genéticos (nomenclatura, nombres alternativos, números de acceso de las secuencias, información sobre la posición y enlaces a otros recursos). Entrez Gene se basa en un tipo especial de secuencias llamadas RefSeq, generadas por el propio NCBI a partir de secuencias contenidas en GenBank. RefSeq pretende ser una colección integrada, completa y no redundante de secuencias de ADN genómico, ARN y proteínas, para los principales organismos. El NCBI genera secuencias RefSeq para más de 1 100 virus y 150 bacterias además de organismos superiores (humano, ratón, rata, zebrafish, etc.). Las principales características de la colección RefSeq son la no-redundancia, la conexión entre secuencias nucleotídicas y sus correspondientes secuencias proteicas, un formato constante, números de acceso específicos y mantenimiento (curation en inglés) a cargo del personal del NCBI y colaboradores externos. Los números de acceso de RefSeq tienen el formato: XX_123456 (dos letras, guión bajo y seis números). Las dos letras iniciales indican el tipo de secuencia. Por ejemplo, en el caso de secuencias que han sido revisadas manualmente podemos encontrar números de acceso de estos tipos:

www.FreeLibros.me

275

Bases de datos en Genética Humana: bases de datos de secuencias

Las tres principales bases de datos primarias de secuencias de nucleótidos son EMBL-Bank (en el EBI), DDBJ (en el CIB de Mishima, Japón) y GenBank (en el NCBI). Desde hace unos años, estas bases de datos firmaron un convenio de colaboración por el que constituyeron el INSDC (International Nucleotide Sequence Database Collaboration), de modo que se sincronizan entre ellas cada 24 horas y contienen exactamente la misma información. Además, son accesibles gratuitamente por Internet, y contienen todas las secuencias de nucleótidos que son de dominio público. En febrero de 2006 estas bases de datos contenían unos 54 millones de registros, con unos 60 000 millones de nucleótidos en total, y su crecimiento en los últimos años ha sido exponencial. Están divididas en varias secciones que reflejan grupos taxonómicos, además de otros grupos no taxonómicos como por ejemplo las secuencias protegidas por patente. En estas bases de datos prima la cantidad sobre la calidad, en el sentido de que contienen todo lo que los investigadores depositan en ellas, y por tanto son bastante heterogéneas en cuanto al tipo de secuencias, su calidad, su anotación, etc. Por este motivo son también redundantes, ya que la misma secuencia puede encontrarse repetida en distintos registros procedentes de distintos autores. Cada entrada en estas bases de datos es un registro que debe tener un identificador único, formado por letras y/o números, conocido como «número de acceso» (accession number), que es estable (nunca cambiará en sucesivas versiones de ese registro). Por tanto, otro código indicará las sucesivas versiones de cada número de acceso, por lo que es importante conocer ambos. En febrero de 1999, el consorcio GenBank/Embl/DDBJ acordó un formato de versión consistente en el número de acceso seguido de un punto y un número. Además, GenBank incluye el indicador «GI».


CAPITULO 20

276

5/12/06

07:37

Página 276

Bioinformática del genoma humano

NC_123456 NG_123456 NM_123456 NR_123456 NP_123456

Moléculas genómicas completas (genomas, cromosomas, plásmidos) Región genómica incompleta ARN mensajero ARN no codificante (ribosomal, pseudogenes, etc.) Proteína (en futuras versiones se añadirán dos números más)

En el caso de secuencias que todavía no han sido revisadas por el personal del NCBI, los números de acceso pueden ser: NT_123456 NW_123456 XM_123456 XR_123456 XP_123456

Secuencias de clones usados para ensamblar genomas (BACs) Ensamblajes parciales de genomas (shotgun) ARN mensajero deducido de las anotaciones del ADN genómico ARN no codificante deducido de las anotaciones Proteínas deducidas de las anotaciones del ADN genómico

La Figura 20.3 ilustra el uso de Entrez Gene para obtener información y secuencias de referencia de genes completos.

20.3 Bases de datos en Genética Humana: bases de datos 20.3 relacionadas con enfermedades Además de las bases de datos de secuencias, existen también muchos recursos de interés en Biomedicina, entre los que destacan las bases de datos relacionadas con enfermedades. A continuación se describen las tres que pueden ser de más utilidad al estudiante o profesional de una disciplina biomédica, para encontrar información sobre enfermedades genéticas y las mutaciones que las causan, descripción clínica, grupos de apoyo, etc. Online Mendelian Inheritance in Man (OMIM) es un catálogo de genes y enfermedades genéticas humanas, centrado especialmente en enfermedades hereditarias. OMIM se basa en el texto escrito por Victor A. McKusick llamado Mendelian Inheritance in Man, cuya última edición es de 1998. Cada entrada en OMIM está caracterizada por un número de acceso que consiste en un número de seis dígitos; el primer dígito es indicativo del modo de herencia de ese rasgo o gen. Así, los números OMIM que comienzan por 1, 2 ó 6 indican loci o fenotipos de herencia autosómica, los que empiezan por 3 indican loci o fenotipos de herencia ligada al cromosoma X, los que empiezan por 4 indican herencia ligada al cromosoma Y y los que empiezan por 5 indican herencia mitocondrial. Además, las variantes alélicas se designan por el número OMIM seguido por un punto y un número de cuatro dígitos. Cada número de acceso suele ir precedido por un símbolo, que nos indica algo más acerca de ese locus o fenotipo. Así, un asterisco (*) indica que se trata de un gen cuya secuencia es conocida; almohadilla (#) indica que es la descripción de un fenotipo, y no representa necesariamente un único locus; el símbolo «más» (+) indica que se trata de la descripción de un fenotipo y de un gen de secuencia conocida; el «tanto por cien» (%) indica que se trata de un fenotipo o locus con herencia mendeliana comprobada, del que se desconoce la base molecular. Cuando no hay ningún símbolo, quiere decir que esa entrada no tiene una base mendeliana confirmada, o bien que su diferenciación de otra entrada en la base de datos no está clara. En ocasiones en-

www.FreeLibros.me


CAPITULO 20

5/12/06

07:37

Página 277

En la Figura 20.4 se pueden encontrar enlaces a OMIM, Geneclinics, EDDNAL y HGMD.

20.4 Búsquedas en bases de datos con BLAST En las bases de datos que contienen secuencias, además de hacer búsquedas por texto también es posible interrogar directamente la base de datos con una secuencia concreta, con el fin de extraer todas las secuencias parecidas o idénticas que están en la base de datos. De esta forma, es posible conocer la identidad de una secuencia anónima, bien porque ya está depositada en la base de datos (indicando a qué corresponde) o bien por su alto grado de similitud con otras secuencias conocidas. Para hacer este tipo de búsquedas, es necesario comparar directamente nuestra secuencia «pregunta» (query) con cada una de las secuencias de la base de datos, y extraer únicamente las que superen un cierto grado de parecido. Lógicamente, si buscamos en todo GenBank, por ejemplo, hemos de comparar nuestra secuencia con varios millones de secuencias, lo que podría llevar un tiempo excesivo. Por suerte, disponemos de herramientas bioinformáticas que realizan alineamientos de secuencias de modo rápido y eficaz, por lo que una búsqueda típica en GenBank se completa en cuestión de segundos. Aunque no podemos entrar aquí en una descripción detallada de cómo funcionan los algoritmos para alineamientos de secuencias, es importante describir con cierto detalle el más utilizado hoy en día para búsquedas en bases de datos, que se llama BLAST (siglas en inglés de Basic Local Alignment Search Tool). BLAST compara secuencias de modo «apareado» (pairwise), es decir, de dos en dos, y cada compara-

www.FreeLibros.me

277

Búsquedas en bases de datos con BLAST

contraremos un acento circunflejo (^) para indicar que una entrada ha sido eliminada de la base de datos. GeneClinics y GeneTests son una base de datos estadounidense de enfermedades genéticas, dirigida a enfermos y personal sanitario, cuyo fin es proporcionar información sobre análisis genéticos y su uso en el diagnóstico, tratamiento y consejo genético. Contiene un listado de laboratorios de Estados Unidos y del resto del mundo donde se realizan pruebas genéticas diagnósticas y de investigación. Además, tiene un listado de centros donde se realiza consejo genético, una serie de revisiones hechas por expertos sobre algunas de las enfermedades genéticas más frecuentes, y materiales educativos como un glosario ilustrado de términos genéticos, presentaciones, etc. El equivalente europeo es EDDNAL (European Directory of DNA Laboratories), que contiene información sobre laboratorios de Europa que llevan a cabo pruebas moleculares diagnósticas para enfermedades genéticas; sin embargo, no contiene una descripción de las enfermedades ni ofrece apoyo a enfermos y sus familias. Finalmente, otro tipo de bases de datos de gran importancia en Genética Humana son las que reúnen mutaciones que causan enfermedades. Aunque existen muchas bases de datos para genes o enfermedades concretas, Human Gene Mutation Database (HGMD) intenta recopilar todas las mutaciones publicadas que causan enfermedades hereditarias humanas (no incluye, por tanto, mutaciones somáticas ni mutaciones del genoma mitocondrial). Desde 1999, HGMD también incluye polimorfismos asociados con enfermedades humanas, extraídos de la literatura científica. Estos polimorfismos sólo se incluyen si su relación con la enfermedad está demostrada de un modo convincente.


CAPITULO 20

278

5/12/06

07:37

Página 278

Bioinformática del genoma humano

ción da como resultado una puntuación (score) que es mayor cuanto mayor es el parecido entre las secuencias que se comparan. El algoritmo permite una implementación en programas informáticos de ejecución rápida y al mismo tiempo con alta sensibilidad, que se realiza en varios pasos. En primer lugar, el programa rompe nuestra secuencia «pregunta» (query) en pequeños fragmentos llamados «palabras» (words) y busca todas las palabras de la base de datos que se parezcan a cada una de las palabras de nuestra secuencia. Una vez que encuentra alineamientos entre palabras que superan una puntuación inicial determinada que viene definida por el parámetro «T», el programa extiende esos alineamientos iniciales en ambas direcciones hasta generar un alineamiento. La rapidez y sensibilidad de la búsqueda viene determinada por el parámetro T, mientras que W (el tamaño de palabra) puede ser modificado dependiendo del tipo de secuencias que estemos manejando. Al final, los posibles alineamientos se ordenan en función de la puntuación (score) final. Es importante comprender que la puntuación de un alineamiento se obtiene utilizando matrices de substitución, que permiten asignar una puntuación a cada posición del alineamiento. Inicialmente, las matrices se desarrollaron para los alineamientos entre secuencias de proteínas, en las que se puede calcular la probabilidad de que un aminoácido concreto (en una de las secuencias) esté substituido por otro aminoácido (en la otra secuencia). Las primeras matrices utilizadas fueron las matrices PAM, creadas por Margaret Dayhoff, y están basadas en alineamientos múltiples para determinar la frecuencia con la que se producen sustituciones de unos aminoácidos por otros. Examinando alineamientos globales de secuencias muy relacionadas y la frecuencia de las distintas sustituciones, Dayhoff construyó las matrices PAM (Point Accepted Mutation), matrices de probabilidad para cada sustitución dada una distancia evolutiva concreta. De hecho, 1 PAM representa la matriz de sustituciones para una distancia evolutiva tal que han cambiado el uno por ciento de los aminoácidos. La matriz PAM más utilizada es la PAM250, que corresponde a una distancia evolutiva tal que ha cambiado el 80 por ciento de los aminoácidos (aunque la mutabilidad varía para cada aminoácido dentro de una misma matriz). Por tanto, PAM250 es útil para alinear secuencias cuando no sabemos si son homólogas. Si la similitud entre las secuencias que queremos alinear es alta, deberemos utilizar otras matrices (habitualmente PAM30). Steven y Jorja Henikoff construyeron después otro tipo de matrices, llamadas matrices BLOSUM (Blocks Substitution Matrix), usando alineamientos locales múltiples de secuencias más divergentes que en el caso de las matrices PAM. Agrupando las secuencias según distintos umbrales de identidad de aminoácidos obtuvieron distintas matrices: por ejemplo BLOSUM80 se derivó de los alineamientos que contenían un 80 por ciento de identidad. Por tanto, se utilizan matrices BLOSUM con valores bajos para secuencias más divergentes (BLOSUM30) y matrices con valores altos (BLOSUM90) para secuencias muy similares. La más utilizada es BLOSUM62. En cualquier caso, las matrices se utilizan para puntuar alineamientos de proteínas, mientras que en alineamientos de secuencias de nucleótidos se utilizan matrices de sustitución unitarias en las que los únicos parámetros importantes son la puntuación que se le asigna a un emparejamiento y la penalización que se asignan a los desemparejamientos y a los huecos. La Figura 20.5 muestra las dos matrices de sustitución más utilizadas para calcular la puntuación de alineamientos de secuencias.

www.FreeLibros.me


CAPITULO 20

5/12/06

07:37

Página 279

La Figura 20.6 incluye enlaces a algunos tutoriales para aprender los fundamentos de la utilización de BLAST.

20.5 Navegadores del genoma humano Con la publicación del primer borrador de la secuencia completa del genoma humano en 2003, se desarrollaron varias herramientas informáticas para poder visualizar de modo gráfico la secuencia y todas las anotaciones hechas por distintos investigadores (por «anotación» se entiende cualquier elemento que se sitúa sobre la secuencia, en una posición concreta: genes, ARNm, SNP, los clones utilizados para la secuenciación, repeticiones, etc.). Las tres herramientas que acabaron por imponerse, por ser las de mayor envergadura y facilidad de uso, fueron ENSEMBL, creada por el EBI y el Instituto Sanger de Hinxton (Reino Unido), el Genome Browser de la Universidad de California en Santa Cruz (Estados Unidos) y el Map Viewer del NCBI (Estados Unidos). Inicialmente, cada uno de estos sitios desarrollaba su propio ensamblaje del genoma humano a partir de los fragmentos depositados en GenBank, y después añadían todas las anotaciones sobre dicho ensamblaje. Regularmente, cada tres o seis meses, se hacían nuevos ensamblajes incorporando las nuevas secuencias depositadas en GenBank, pero a partir de un momento dado el ensamblaje pasó a ser realizado únicamente por el NCBI. En el momento de escribir este texto, el ensamblaje utilizado es el llamado Build 36 del NCBI, correspondiente a la secuencia ya terminada, y realizado en noviembre de 2005. Genome Browser y ENSEMBL utilizan este mismo ensamblaje para realizar sus propias anotaciones y hacerlas de dominio público en sus respectivos sitios web. ENSEMBL y Genome Browser son, por tanto, similares en su concepción y en su estructura, pero muy distintos en su apariencia y en algunas de las anotaciones que ofrecen. En ambos casos, todas las anotaciones están almacenadas como entradas de una base de datos relacional, que es interrogada utilizando formularios en páginas web y que dispone la información en modo gráfico con elementos interactivos. Algunos aspectos importantes, como la predicción de genes y su estructura (exones,

www.FreeLibros.me

279

Navegadores del genoma humano

Para comparar la «calidad» de cada alineamiento, BLAST calcula la probabilidad de encontrar un alineamiento con esa misma puntuación en esa base de datos simplemente por azar, y a esa probabilidad le llama valor E (expectation), que es el parámetro que mejor describe la significación de los alineamientos hallados por el programa. En cualquier caso, todo alineamiento debe ser revisado para comprobar que efectivamente tiene relevancia biológica, ya que pequeñas regiones de baja complejidad, elementos repetidos, etc., suelen dar puntuaciones altas y significativas y confundir el alineamiento verdadero entre dos secuencias. Por esto, es importante utilizar los filtros que incluye el programa, para eliminar regiones de poco interés biológico que puedan interferir en la interpretación de los resultados. BLAST se ofrece como varios programas distintos, dependiendo del tipo de secuencias que se comparan; blastn para dos secuencias de nucleótidos, blastp para dos secuencias de proteínas, blastx para comparar una secuencia de nucleótidos (traducida) con una base de datos de proteínas, tblastn para comparar una secuencia de proteínas con una base de datos de nucleótidos (traducida), y tbalstx para comparar una secuencia de nucleótidos (traducida) con una base de datos de nucleótidos (traducida).


CAPITULO 20

280

5/12/06

07:37

Página 280

Bioinformática del genoma humano

transcritos alternativos, etc.) son elaborados siguiendo procesos distintos: por ejemplo, Genome Browser muestra «Known Genes» (genes conocidos), basados en el alineamiento de todas las proteínas contenidas en Uniprot y de todos los ARNm de RefSeq sobre la secuencia genómica; ENSEMBL, por el contrario, genera sus propios genes utilizando un proceso similar pero totalmente automático. Otras anotaciones son idénticas, ya que ambos sistemas usan el mismo procedimiento. Por ejemplo, para anotar los elementos repetidos tanto ENSEMBL como Genome Browser utilizan un programa llamado Repeatmasker, que detecta todas las repeticiones conocidas que están contenidas en una base de datos específica llamada Repbase. Cada uno de los sitios tiene también una herramienta de búsqueda rápida que realiza el alineamiento de una secuencia «pregunta» sobre la secuencia del genoma. Ambos navegadores permiten ver a la vez el genoma de otras especies, y contienen infinidad de anotaciones y enlaces con otras bases de datos y con los registros originales de GenBank. Todo estudiante o profesional que necesite explorar el genoma humano y los elementos que contiene debería aprender a manejar con soltura estas herramientas. En la Figura 20.7 se incluyen tutoriales para utilizar navegadores del genoma humano.

www.FreeLibros.me


21-INDICE ANALÍTICO

5/12/06

07:46

Página 281

281

«chips» de ADN, 47 45,X, 180 8-oxoguanina, 84 aborto eugénico, 253 acéntrico, 186 acetilación, 72, 76 acondroplasia, 225, 228, 240 acrocéntricos, 187 activadores adaptación, 161 adenovirus, 263 gutless, 265 ADN, 1 codificante, 58, 190 desnudo, 268 extragénico, 58 glicosilasas, 84 forma B, 5 mitocondrial, 89, 248 repetitivo, 59, 62 ribosomal, 62, 179 satélite, 63, 179 ADNc, 34, 44, 47 ADNmt, 67 ADN-PK, 88 agentes alquilantes, 84 agutí, 123, 126

Índice analítico

Índice analítico

aislador, 73, 216 albinismo, 124 alelismo múltiple, 121 alelo, 81, 97, 119, 120 letal, 123 «silvestre», 119 idéntico por descendencia, 148, 157 alfa-1 antitripsina, 213 alfa-talasemia, 195 algoritmos, 274 Alu, 63 amniocentesis, 253 amplificaciones génicas, 213 anafase, 24 anagénesis, 169 andamio, 18 androgenonte, 215 aneuploidías, 181 aneusomías segmentarias, 181, 186 Angelman aniridia, 212, 223 anotación, 274, 279 antennapedia, 223 anticipación, 200, 204 anticodón, 14 antiparalelas, 4 apolipoproteína ApoB48, 10 apolipoproteína B, 260

www.FreeLibros.me


21-INDICE ANALÍTICO

282

5/12/06

07:46

Página 282

Índice analítico

apoptosis, 66 árbol familiar, 238 árbol filogenético, 169 ARGONAUTA, 259 ARMS, 233 ARN, 1 mensajero, 5 ribosomal, 178 transferentes, 14 ARNm antisentido, 259 ARNnp, 12 Artemis, 88 ASO, 233 asociación alélica, 147, 149 ataxia de Friedreich, 204 espino-cerebelosa, 205 Atrofia Muscular Espinal, 194 Espino-Bulbar, 202 ayuste, 192, 204 (splicing), 10 alternativo, 12

bucle-D, 67 burbuja de replicación, 20, 82

BAC, 35, 54 bandas C, 69, 178 G, 177 Q, 177 R, 69, 178 bases de datos, 274 Bateson, 131 BER, 84, 89 bioinformática, 58, 273 biopsia de vellosidades coriónicas, 253 bithorax, 223 bivalente, 26, 27, 186, 187 BLAST, 277 BLOSUM, 278 brazo corto, 179 largo, 179 BRCA1, 87 BRCA2, 87 bromodominio, 73

cadena guía, 20 retrasada, 20 caja CAAT, 6 GC, 6 TATA, 6 cálculo de riesgos, 242, 245, 246, 250 caperuza, 9 carcinoma medular de tiroides familiar, 226 cariotipo, 177, 220 CBP, 73, 78, 202, 223 cebador, 20, 41, 42, 43, 45 cefalopolisindactilia, 223 célula empaquetadora, 262 centimorgans, 142 centro de imprinting, 218, 219 centrómeros, 23, 60, 63, 178 CFTR, 200, 240 CGH, 179 Charcot-Marie-Tooth, 208, 214 chi-cuadrado, 118, 149 ciclo celular, 18 cigoteno, 25 citogenética, 177 molecular, 40 citoquinesis, 18, 24, 27 cladogénesis, 169 clamp-GC, 229 clonación molecular, 33, 35 clonaje posicional, 141 C-MYC, 213 CNP, 62 cociente entre heterocigotos y homocigotos, 166 código de Histonas, 73 genético, 13, 68 co-dominancia, 120 codón de inicio, 13 terminación, 8, 190

www.FreeLibros.me


21-INDICE ANALÍTICO

5/12/06

07:46

Página 283

Darwin, 94, 129, 167 dedos de zinc, 222 deleción, 180, 186, 191, 206, 207, 219, 220, 250 depleción del ADNmt, 250 depresión endogámica, 157 deriva genética, 168 aleatoria, 158, 170

desemparejamiento, 82, 231 por deslizamiento de cadenas, 199 desequilibrio de ligamiento, 147, 150 desnaturalización, 43 DGGE, 229 DHPLC, 230 diagnóstico, 227, 237, 252 directo, 228 genético preimplantatorio, 254 indirecto, 235 prenatal, 252 diaquinesis, 27 dicéntrico, 186 Dicer, 61, 259 dictioteno, 27 diferencial de selección, 136 diginia, 181 dihibridismo, 124 dihíbridos, 99 dímeros de pirimidinas, 84 dinucleótido CpG, 74, 190 diploteno, 26 diseño inteligente, 173 disgenesia gonadal, 182, 205 disomía uniparental, 217, 219, 220 dispermia, 181 Displasia campomélica, 212, 224 tanatofórica, 225 distrofia facio-escápulo-humeral, 207, 212 miotónica, 203, 204, 205 muscular de Becker, 244 muscular de Duchenne, 235, 243 muscular de Emery-Dreifuss, 208 disyunción, 27 DNMT1, 75 Dobzhansky, 168 dominancia incompleta, 120, 131 dot-blot, 233 drosopterina, 125 DSB, 29, 86 duplicación, 180, 206, 207 duplicaciones genómicas, 172 segmentarias, 60, 62, 206

www.FreeLibros.me

283

Índice analítico

codones, 13 coeficiente de endogamia, 157 selección, 162 cohesinas, 23, 24, 28 colágeno, 214 colchicina, 178 Collins, 174 complejo basal de iniciación, 8 condensinas, 19 consanguinidad, 242, 246 consejo genético, 221, 237, 246, 252, 277 contigs, 55 conversión génica, 30, 206 corpúsculo de Barr, 111 cósmidos, 35 CPEO, 251 creacionismo, 173 cremalleras de leucina, 222 cresta genital, 110 cromátide, 22, 23, 25, 26, 27, 178 hermanas, 206 cromatina, 17, 21, 23, 25, 69, 71, 79, 80, 103 cromodominio, 74 cromosoma, 23, 177, 180 submetacéntrico, 179 X, 107, 111, 114 Y, 108, 115 cruce trihíbrido, 101 cruzamiento preferencial, 156 prueba, 98 CTCF, 216 cuadrados de Punnett, 97, 239 cuartetos-G, 203


21-INDICE ANALÍTICO

284

5/12/06

07:46

Página 284

Índice analítico

EBI, 274 edición del ARN, 10, 192 efecto de cuello de botella, 159 dominante-negativo, 211, 214, 225 fundador, 149, 159 umbral, 249 efectos de dosis, 120 posición, 212 eficacia biológica, 161 Ehlers-Danlos, 241 electroforesis, 40, 46, 229 electroporación, 36 elementos ultraconservados, 61 elongación, 8, 15 EMBL, 275 Endogamia, 157 enfermedad de Alzheimer, 192 Gaucher, 228 Hirschsprung, 226 enfermedades complejas, 133 multifactoriales, 133 por expansión de trinucleótidos, 200 enfisema pulmonar, 213 ENSEMBL, 279 enzimas de restricción, 35, 37 epigenéticas, 71 epilepsia mioclónica progresiva, 204 epistasia, 125, 126 equilibrio de Hardy-Weinberg, 154, 158 polimórfico, 165 polimórfico estable, 164 puntuado, 171 error de muestreo, 158 especiación, 169 alopátrica, 170 simpátrica, 170 EST, 57 estenosis pilórica, 134 estructuras de Holliday, 30 eucromatina, 69, 178

euploidías, 181 evo-devo, 172 evolución, 153, 167 exones, 10 expresión génica, 5, 71 expresividad variable, 242 extensión, 43 extremos cohesivos, 38 romos, 38 F1, 96 F2, 96 factor C de la replicación, 21 de crecimiento fibroblástico, 225 IX de la coagulación, 200 factores de transcripción, 6, 221 unitarios, 97, 103 fase de ligamiento, 144, 146, 236 fase S, 19 fenotipo Bombay, 125 Fibrosis del páncreas, 200, 240 FISH, 179, 220 fitohemaglutinina, 178 flujo genético, 160 fluorocromo, 46 FMR1, 203 FMRP, 203 fosforilación, 72 fracción de recombinación, 141 fragmentos de Okazaki, 21 frameshift, 191 frataxina, 204 frecuencia de recombinación, 235 frecuencias alélicas, 154, 159 genotípicas, 154 fusión céntrica, 187 no homóloga de extremos, 86, 88 FXTAS, 245

www.FreeLibros.me


21-INDICE ANALÍTICO

5/12/06

07:46

Página 285

haploide, 22 haploinsuficiencia, 211, 213, 223, 224 haplotipo, 147, 151 HapMap, 61 Haseman y Elston, 149 HAT, 73 HDAC1, 73 HDAC2, 73 hebra antisentido, 6 codificante, 6 molde, 6 sentido, 6

Hedgehog, 222 helicasas, 20 hélice -lazo-hélice, 222 -vuelta-hélice, 222 hemicigosis, 108 hemicigotos, 166 Hemocromatosis Hereditaria, 149, 228 Hemofilia A, 208, 228 heredabilidad, 135, 136, 137 herencia autosómica, 239 cuasi-dominante, 242 ligada al X, 248 matrilineal, 249, 250 multifactorial, 133 poligénica, 132, 133 herpesvirus, 266 HERV, 65 heterocromatina, 69, 111, 178, 260 heterodisomía, 219 heterodúplex, 30, 229 heterogeneidad alélica, 227 genética, 227, 240 heteroplasmia, 249 hibridación, 39, 43, 47, 179 Hipercolesterolemia familiar, 239 Hiperplasia Suprarrenal Congénita, 206 hipótesis 2R, 172 hipótesis de Lyon, 112 histonas, 18, 72, 73 historia familiar, 238 hnRNP, 194 holoprosencefalia, 222 homeodominio, 222, 223 homodúplex, 229 homoplasmia, 249 horquillas de replicación, 20 Huntington, 159, 201, 228 huso mitótico, 23, 27 Ictiosis, 206 idénticos por descendencia, 148 imprinting, 215 impronta genómica, 77, 215

www.FreeLibros.me

285

Índice analítico

gametocitos primarios, 25 gametogénesis, 25, 26, 181, 184, 215, 217, 218 gametos, 27, 28 recombinantes, 140 ganancia de función, 201, 211 sentido, 191 gatas calico, 112 gemelos, 137 gémulas, 94, 129 gen hipostático, 125 GenBank, 275 gene tracking, 235 genes, 97 constitutivos, 70, 75 homeobox, 172, 222, 223 HOX, 223 suicidas, 270 genética clínica, 237 de poblaciones, 153, 168 genoma mitocondrial, 66 Genome Browser, 279 genoteca, 34 genotipos, 97 germoplasma, 102 Giemsa, 178 ginogenonte, 215 gónada primitiva, 110 grados de libertad, 119 gradualismo, 171


21-INDICE ANALÍTICO

286

5/12/06

07:46

Página 286

Índice analítico

inactivación del cromosoma X, 77, 243 índice de heterocigosidad, 142 Inestabilidad de Microsatélites, 83 informatividad, 142 infradominancia, 165 Inmunodeficiencia Combinada Severa, 88, 270 inmunopotenciación, 271 inserción, 180, 191 inserto, 34 interacción génica, 124 interfase, 18, 18 interferencia de ARN, 259 International System for Cytogenetics Nomenclature, 178 intrones, 10 inversión, 180, 185, 206, 208 islas CpG, 74 isocoro, 59 isocromosoma, 180, 183, 186 isodisomía, 219 isosquizómeros, 37 ITR, 264, 266 Johannsen, 130 Kimura, 171 Kozak, 14 KU70, 88 KU80, 88 labio leporino, 134 lastre genético, 161 LCV, 62 lentivirus, 262, 263 leptoteno, 25 leucemia mieloide crónica, 213 ley de Ohno, 114 LHON, 251 ligamiento, 104, 109 genético, 51, 139, 234 no paramétrico, 147 ligasa, 35 ligasas, 21 likelihood ratio, 145 LINE, 63, 113, 205

línea germinal, 177 lipoplexos, 269 locus, 81, 105 LOD score, 144 LTR, 65, 261 Lyonización, 112 macroevolución, 169 macroH2A, 113 mapa genético, 140 mapas de ligamiento, 141 físicos, 53 genéticos, 51 marcadores, 52, 148, 235 genéticos, 140 marco de lectura, 191 matrices de substitución, 278 Máxima Verosimilitud, 144 MDB, 76 mediador, 9 medicina predictiva, 237 meiosis, 25, 28, 29, 140, 183, 187, 217 MELAS, 251 Mendel, 93, 94, 102 MERRF, 251 metacéntricos, 179 metafase, 23, 178, 179 metilación, 72, 74, 75, 77, 212, 215, 220, 260 metil-transferasas de ADN, 75 método ramificado, 98 MGMT, 84 MHC, 271 microARN, 61, 260 microarrays, 47, 53 microdeleción, 219 microevolución, 169 microsatélite, 53, 63, 143, 200 migración, 160 minisatélites, 53, 63 mis-sense, 191 mitosis, 18, 22, 23, 24 MLPA, 234 MMR, 82 mola hidatidiforme, 215

www.FreeLibros.me


21-INDICE ANALÍTICO

5/12/06

07:46

Página 287

NARP, 251 NCBI, 274 NER, 85 Neurofibromatosis tipo 1, 242 no-disyunción, 183 non-sense, 191 nucleína, 1 nucleósido, 1 nucleosoma, 18, 72 nucleótido, 1 nulisomía, 181 número de acceso, 275 octámero, 18, 72 Ohno, 172 OLA, 233 oligonucleótidos antisentido, 259 OMIM, 276 oncovirus, 262 orígenes de replicación, 20 PAC, 35, 54 PAM, 278 pangénesis, 93, 129 paquiteno, 26 paracéntricas, 185 paradoja de Sherman, 245 parálogos, 205 PCNA, 21 PCR, 41, 229, 232, 233, 250 penetrancia incompleta, 241 pérdida de función, 203, 211 pericéntricas, 185 PIC, 142

pintado cromosómico, 179 pirimidinas, 1 pistola génica, 268 placa metafásica, 24 plásmidos, 34 polidactilia, 222 polimerasa de ADN, 20, 41, 42, 45 ARN, 6 polimorfismo, 81, 141 de inversión, 209 poliplasmia, 249 poliplexos, 269 polycomb, 223 potenciadores, 6, 9, 11, 80, 194 exónicos del ayuste, 12 Prader-Willi preiniciación, 6 pre-miARN, 61 premutación, 202, 245 prevalencia, 165 primasa, 20 pri-miARN, 61 probabilidad, 247 condicional, 247 conjunta, 247 final, 247 inicial, 247 profase, 23 promotor, 6 proteínas SR, 12, 194 truncadas, 192 Proyecto Genoma, 51, 56, 57 Internacional Hapmap, 151 pseudogen, 60, 206 PTT, 231 punto de ramificación, 11 puntuación lod, 145 purinas, 1 quiasmas, 27, 30, 184 quimeraplastos, 258 quinetocoro, 23, 23, 27, 178, 185 quistes dermoides, 215

www.FreeLibros.me

287

Índice analítico

monohíbridos, 95 monosomía, 181, 182, 187 Morgan, 104, 108, 139 mortinatos, 183 mosaicos, 180, 181, 182 movimiento eugenésico, 130 mucoviscidosis, 240 mutación, 82, 83, 160, 166, 189, 199, 211 puntual, 250 sinónima, 191


21-INDICE ANALÍTICO

288

5/12/06

07:46

Página 288

Índice analítico

RAD50, 29, 84, 87 RAD51, 86 RAD52, 29, 87 radiación UV, 84 reacción en cadena de la polimerasa, 41 receptor de andrógenos, 214 recombinación, 26, 28, 30, 140, 160, 184 homóloga, 29, 86 RefSeq, 275 región 3’ no traducida, 190 5’ no-traducida, 190 regiones no-traducidas, 14 pseudoautosómicas, 114 relación fenotípica, 97 genotípica, 97 reparación, 82 acoplada a la transcripción, 85 Repeatmasker, 280 replicación, 19, 30, 75, 76, 80, 82 repliegue apical ectodérmico, 222 retinoblastoma, 167, 242 retrotranscripción, 44, 261 retrovirus, 261 RFLP, 52, 143, 235 ribonucleoproteínas nucleares pequeñas, 12 ribosoma, 14 ribozimas, 259 RIDGES, 80 riesgo de recurrencia, 135, 221, 237, 246 relativo, 136 RISC, 61, 203, 259 rotura bicatenaria, 29, 86 RPA, 20, 29, 85, 87 RT-PCR, 44, 231 SAR, 19, 70 secuencia de ayuste críptica, 193 secuenciación, 44, 55 securina, 24, 185 segregación, 28, 97, 139 adyacente, 187

alternante, 187 selección, 161, 166 estabilizante, 164 sensibilidad, 231 señal de empaquetamiento, 261 poliadenilación, 10, 190, 195 separasas, 28 separinas, 24 serie alélica, 121 sexo heterogamético, 108 shugoshinas, 28 silenciadores, 6, 11, 194 sinapsis, 25 sindactilia, 222 Síndrome de Angelman, 207, 218, 219, 221 de Apert, 226 de Cockayne, 85 de cri-du-chat, 186 de Crouzon, 225 de Di George, 187, 207 de Down, 181 de Edwards, 182 de Gorlin, 222 de Kearns-Sayre, 251 de Klein-Waardenburg, 224 de Klinefelter, 183 de Microdeleción, 186 de Ojo de Gato, 208 de Patau, 182 de Pfeiffer, 225 de Prader-Willi, 207, 218, 219 de Rett, 244 de Roturas de Nimega, 87 de Rubinstein-Taybi, 187, 223 de Smith-Magenis, 208 de Turner, 111, 182, 213 de Williams-Beuren, 187, 207 de Wolf-Hirschhorn, 186 del X frágil, 203, 228, 244 síndromes malformativos, 222 SINE, 63, 205 sinténicos, 139 sitio A, 15 sitio P, 15

www.FreeLibros.me


21-INDICE ANALÍTICO

5/12/06

07:46

Página 289

tag-SNPs, 151 tamaño poblacional, 159 tasa de portadores, 166 mutacional, 161, 248 mutacional basal, 189 tasas de concordancia, 137 TDT, 149 telofase, 24 telomerasa, 22 telómeros, 22, 63 temperatura de fusión, 39 teorema de Bayes, 246 fundamental de la selección natural, 168 teoría cromosómica de la herencia, 104 General de la Evolución, 167 neutral de la evolución, 171 terapia génica, 257 terminadores, 45 termocicladores, 44

tétrada, 26 tetra-ploidías, 181 tri-ploidías, 181 trisomía, 21, 181, 187 tetravalente, 187 TGGE, 229 topoisomerasas, 21 tracto rico en pirimidinas, 11 traducción, 5, 13, 14 transcripción, 5, 6, 80 transcriptosoma, 8 transferencia génica, 257 southern, 40 transformación, 36 transiciones, 190 translocación, 180, 187 robertsoniana, 181, 187 transposones, 65 transversiones, 190 trinucleótidos, 200 triploidía, 181 trisomía, 21, 180, 181 trithorax, 223 trivalente, 187 TSIX, 113 UBE3A, 218, 219, 221 UNIGENE, 57 VNTR, 53 variación, 56, 81 continua, 130 discontinua, 129 genética, 61 varianza fenotípica, 135, 136 genotípica, 136 vector, 257 de clonación, 34 no-viral, 267 viral, 260 virus adenoasociado, 265 hemaglutinante del Japón, 269

www.FreeLibros.me

289

Índice analítico

sitios apurínicos, 84 hipersensibles a DNAsa I, 71 skipping, 193 SKY, 179 SNP, 53, 61, 143, 150 sobrecruzamiento, 30, 139, 185, 186 desigual, 205 sobredominancia, 164 solenoide, 18 sonda, 39, 47, 233 sordera neurosensorial, 251 Southern, 40, 250 SOX9, 110 SRY, 110, 205, 224 SSCP, 229 STR, 53 STS, 54 Sturtevant, 140 substituciones, 190 suplementación génica, 259 sustancia H, 121, 125


21-INDICE ANALÍTICO

290

5/12/06

07:46

Página 290

Índice analítico

Walter Sutton, 104 William Bateson, 102 Williams-Beuren

XRCC4, 88 XXY, 180

xantomatina, 125 xeroderma pigmentosum, 85 XIC, 112 XIST, 112

YAC, 35, 54 ZFY, 110 Zona de Actividad Polarizante, 222

www.FreeLibros.me

Genetica Humana  

La genética humana es una especialización que estudia los caracteres hereditarios (genes) de la especie humana. La genética humana intenta...

Genetica Humana  

La genética humana es una especialización que estudia los caracteres hereditarios (genes) de la especie humana. La genética humana intenta...

Advertisement