umuc biol320 full course latest all weeks discussions,assignments,course project and final exam https://hwguiders.com/downloads/umuc-biol320-full-course-latest-weeksdiscussionsassignmentscourse-project-final-exam/
umuc biol320 full course latest all weeks discussions,assignments,course project and final exam
Week 1 covers the following main concepts:
definition of forensic biology
cell biology
basic cell differences
scientific method
validation
Based on the assigned reading, post an original response to the questions found below 1. What is forensic biology and how does it differ from one other discipline of forensic science? Examples of other disciplines of forensic science would include areas such as forensic anthropology, forensic odontology, crime scene investigation, forensic toxicology, forensic chemistry, trace evidence, firearms & toolmarks, etc 2. What is the difference between prokaryotes and eukaryotes? 3. Describe the basic structure of a eukaryotic cell 4. List and describe each of the steps of the scientific method 5. How is data typically validated in forensic laboratories? Refer to the powerpoint and the FBI Quality Assurance Standards to help answer this question
You are not required to respond to your classmates for this conference Be sure to correctly cite any material used in your responses that is not original This conference is worth a total of 3 points Your responses will be graded using the following scale: 2 points: Detailed, original response provided for each of the questions Reasoning is logical Terms and concepts from the assigned materials are incorporated 1 point: Proper form is used (grammar, spelling, style) If applicable, correct and full citations for sources are used Your responses are due by 11:59 pm on Sunday week 2 Post an original response to the following questions Use appropriate references when necessary Provide a thoughtful response to at least one other classmate You may need to rely heavily on the week 2 powerpoint to answer these questions You will have until Sunday at 11:59 pm to respond 1 A great deal of fingerprint examination has been considered subjective Based on the lab standard operating procedures, individual examiners will use their training and expertise to evaluate all of the information available in a fingerprint to decide whether there is a “match” or not There is no set number of points that must be met Do you agree with this method? Explain why or why not 2 Based on the formula used in the powerpoint, calculate the amount of 100 proof alcohol it would take for you personally to become “legally drunk” in the state of Maryland The limit in Maryland is 008% You can use a fake weight if you don’t want to expose how much you weigh to everyone Show your work
3 Two very important components to forensic serological analyses are the sensitivity and specificity of the test being used Describe the difference between sensitivity and specificity Do you think one is more important than the other? Explain why or why not 4 You are processing a sexual assault case The suspect allegedly attempted to force another individual to perform oral sex on him Upon arrest, the suspect defecated on himself His underwear were submitted for testing The investigators have requested amylase testing to corroborate or refute the suspect’s claim Would you perform amylase testing in this case? Explain why or why not Your responses will be graded using the following scale:
2 points: Detailed, original response provided for each of the questions Reasoning is logical Terms and concepts from the assigned materials are incorporated 05 point: Proper form is used (grammar, spelling, style) If applicable, correct and full citations for sources are used 05 point: Thoughtful response to at least one other classmate week 3 Considering what you have read this week, compare and contrast the various methods for determining time since death What do you consider to be the most reliable method of determining time since death? Be sure to include in your answer the reasoning behind your choice Try to include something in your answer from each chapter from the reading Please keep your answers to 1-3 paragraphs Use appropriate references when necessary Provide a thoughtful response to at least one other classmate You will have until Sunday at 11:59 pm to respond Your responses will be graded using the following scale: 2 points: Detailed and original response Reasoning is logical Terms and concepts from the assigned materials are incorporated 05 point: Proper form is used (grammar, spelling, style) If applicable, correct and full citations for sources are used 05 point: Thoughtful response to at least one other classmate week 4 1 As an expert witness, part of our job is to break down complex ideas when testifying so that a jury of individuals who may have little or no knowledge of science can easily grasp what we are saying The polymerase chain reaction is a concept that DNA experts are often asked to explain in court For a moment, pretend you are an expert witness in a trial How would you explain PCR to a jury? Remember, you are explaining it to a jury (with a potentially short attentive span because they are tired and hungry) so your response should be brief, yet clear and effective Creative analogies are encouraged 2 Occasionally, there can be mutations in DNA due to replication errors, transposable elements, or environmental hazard exposure Discuss the different types of mutations possible (base pair substitution, insertion, deletion) What is an example of when a mutation could be harmful to an individual? What is an example of when a mutation could be beneficial? 3 Do you feel that cloning should be allowed in the US? Why or why not? Support your answer with examples Note: Remember some feel stem cell research is a form of cloning
Use appropriate references when necessary Provide a thoughtful response to at least one other classmate You will have until Sunday at 11:59 pm to respond Your responses will be graded using the following scale: 2 points: Detailed and original response Reasoning is logical Terms and concepts from the assigned materials are incorporated 05 point: Proper form is used (grammar, spelling, style) If applicable, correct and full citations for sources are used 05 point: Thoughtful response to at least one other classmate week 5 Compare and contrast the following DNA analysis techniques: STRs, miniSTRs, mtDNA (mitochondrial DNA), and Y-STRs Do you believe that one technique is superior to any of the other ones? Discuss why or why not Use appropriate references when necessary Provide a thoughtful response to at least one other classmate You will have until Sunday at 11:59 pm to respond Your responses will be graded using the following scale: 2 points: Detailed and original response Reasoning is logical Terms and concepts from the assigned materials are incorporated 05 point: Proper form is used (grammar, spelling, style) If applicable, correct and full citations for sources are used 05 point: Thoughtful response to at least one other classmate week 6 Everyone is aware that additional training will occur at your new forensic lab, even if you are fully trained from an outside lab This is part of the ASCLD-LAB (American Society of Crime Lab Directors – Laboratory Accreditation Board) accreditation As part of that continuing education, you will be required to take 2 external proficiency tests per year Please explain why you think this process is important and how it could benefit you while testifying on the stand as an expert witness 2 Ethics is important in several careers but can be devastating in forensics One violation of ethics and a good attorney will have your career in ruins Please consider the scenarios below Choose ONE and explain your answer
If you know your co-worker has falsified some data on a case that you both completed analysis on, would you report it to your supervisor?
You arrive at a crime scene and find out it is the house of your wife’s ex-husband and you have a long history of conflict in the past five years Is it ethical for you to continue on the case?
The defense attorney made a mistake in defending the case on a DNA data and would lose the case for sure Do you have an obligation to correct him?
Use appropriate references when necessary Provide a thoughtful response to at least one other classmate You will have until Sunday at 11:59 pm to respond Your responses will be graded using the following scale: 2 points: Detailed and original response Reasoning is logical Terms and concepts from the assigned materials are incorporated 05 point: Proper form is used (grammar, spelling, style) If applicable, correct and full citations for sources are used 05 point: Thoughtful response to at least one other classmate week 7 1 Discuss your support or non-support of forensically maintained DNA databases including specific examples that will support your position Your discussion should include your view on the convicted offender DNA databases, arrestee DNA databases, and whether DNA should be collected at birth for all US citizens For more information regarding CODIS, you can visit this site: http://wwwfbigov/about-us/lab/codis/codis-and-ndis-fact-sheet 2 You were assigned this article: Error! Hyperlink reference not validumucedu/d2l/common/dialogs/quickLink/quickLinkd2l? ou=69222&type=content&rcode=UMUC-670665″>Digital ForensicsError! Hyperlink reference not validumucedu/d2l/common/dialogs/quickLink/quickLinkd2l? ou=69222&type=content&rcode=UMUC-570701″> Please post an interesting (or important) fact that you learned from reading your assigned article Post a response toTWO classmates (one in group 1 and someone in group 3) You will have until Sunday at 11:59 pm EST to respond Your responses will be graded using the following scale: 2 points: Detailed and original response Reasoning is logical Terms and concepts from the assigned materials are incorporated Proper form is used (grammar, spelling, style) If applicable, correct and full citations for sources are used 1 point: Thoughtful response to two other classmates week 7 1 Discuss your support or non-support of forensically maintained DNA databases including specific examples that will support your position Your discussion should include your view on the convicted offender DNA databases, arrestee DNA databases, and whether DNA should be collected at birth for all US citizens For more information regarding CODIS, you can visit this site: http://wwwfbigov/about-us/lab/codis/codis-and-ndis-fact-sheet 2 You were assigned this article: Error! Hyperlink reference not validumucedu/d2l/common/dialogs/quickLink/quickLinkd2l? ou=69222&type=content&rcode=UMUC-670666″>Microbial ForensicsError! Hyperlink reference not validumucedu/d2l/common/dialogs/quickLink/quickLinkd2l? ou=69222&type=content&rcode=UMUC-570701″>
Please post an interesting (or important) fact that you learned from reading your assigned article Post a response to TWO classmates (one in group 1 and someone in group 2) You will have until Sunday at 11:59 pm EST to respond Your responses will be graded using the following scale: 2 points: Detailed and original response Reasoning is logical Terms and concepts from the assigned materials are incorporated Proper form is used (grammar, spelling, style) If applicable, correct and full citations for sources are used 1 point: Thoughtful response to two other classmates BIOL 320 Homework #1 1The two most important components of a cell for forensic DNA purposes are the and the 2 A cell that contains a nucleus is called cell 3 DNA and RNA are structurally similar; however, the only difference between the two is the lack of in DNA 4 When proteins are heated they lose their 5 is the component of fecal matter that is used in forensic serological testing utilizing the _________ test 6 When evaluating the ability of a presumptive test two factors must be considered __________ and ____________ 7 is the component of urine that is used in forensic serological testing utilizing the _________________ test 8_______________ is the component of blood that is used in forensic serological testing One type of presumptive blood test is called 9 Amylase’s ability to break down ___________ _____ allows the Phadebas test to be utilized as an effective presumptive test for the presence of saliva 10 is one of the components of seminal fluid used in forensic serological testing WORD BANK: BIOL 320 Homework #2 1 What does PCR stand for (1 pt)?
2 List AND describe the three main steps of PCR (6 points)? PCR amplifies a specific gene from essentially a signal copy of DNA 3 Adenine bonds with ____________________ (1 pt) 4 Cytosine bonds with _______________ (1 pt) 5 True of False Uracil is a nucleotide found in DNA (1 pt) BIOL 320 Quiz #1 1 The scientific method comes in various forms The book shows one version, and in my lecture notes, I presented another version Despite variations, the core elements are always present Which of the following would not be considered a core element of the scientific method? a observation b hypothesis c question d, experiment e conclusion 2 Fill in the blank: Mitosis results in _______2___ daughter cells and meiosis results in ____4_____ daughter cells 3What is the difference between the cause and manner of death? a The cause of death is the biological reason for the cessation of life while the manner of death is the way death occurred b The cause of death is the way death occurred and the manner of death is the biological reason for life cessation c The cause of death is a doctors term and is no different from the coroners term of manner of death d The term cause of death is used in hospital autopsy and manner of death in medico-legal autopsy
4 Which of the following does not belong? a homicide b drug overdose c suicide d natural e accidental 5 Which of the following is incorrectly matched? (multiple select) a livor mortis: post-mortem cooling b rigor mortis: muscle stiffening c algor mortis: post mortem blood settling d petechiae: pin point hemorrhages 6 True or False: Petechiae are a conclusive way to determine death by hanging or strangulation 7 Transcribe the following DNA template strand into mRNA: AAGTACGTAAGCTGGATATT 8 True or False An autopsy is required if a firefighter dies in the line of duty in Maryland 9 Which of the following components is most commonly tested for in forensic laboratories today to indicate the presence of fecal matter? a creatinine b amylase c urobilinogen d urea 10 True or False Necrophagous means live-flesh eating 11 What are the two types of amylase? How do they differ?
Amy 1 “salivary locus “responsible for amylase detected in saliva, sweat, nasal secretions, breast milk Amy2 on the other hand “pancreatic locus” It is responsible for amylase detected in semen, blood, urine feces, and vaginal fluid 12 A positive result with the Jaffe Reaction turns deep orange colo 13 What are the main components of a sperm cell? Head, neck, acrosome, nucleus, mid-piece, and tail 14 True or False A presumptive test can definitively identify a biological fluid 15 Name a confirmatory test for blood Crystalline test 16 Submit to your assignments folder with your name in the filename BIOL 320 Quiz #2 You are reviewing the Quantifiler results after running a real time PCR (RT-PCR) assay Sample 1 crossed the threshold after 24 cycles Sample 2 crossed the threshold after 29 cycles Without considering any factors such as degradation, which sample likely has more DNA? Three sequential bases in mRNA are called a ___ Which of the following shows a short tandem repeat (STR)? AATG GAT ACTA GTAGC AATG GAT ACTA GTAGC AATG GAT ACTA GTAGC AATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATG What would be the allele value (DNA type) for that short tandem repeat sequence? The four nucleotides of DNA are: The three main steps of STR DNA analysis are: True/false: YSTRs are maternally inherited True/False: Nuclear STRs are only paternally inherited True/False: miniSTRs are paternally and maternally inherited