Skip to main content

CFIA (Plain Language Science Fact Sheets)

Page 1

CFIA SCIENCE FACT SHEET Using genomics tools for day-to-day applications

What is genomics? Genomics is the science that decodes genetic information in an organism’s DNA. It enables the study of how genes function and interact with each other, and how they influence the growth and development of an organism. Genomics is sometimes confused with genetics, which is the study of individual genes and how organisms inherit genetic traits, for example, why somebody has brown eyes and another has blue. Genomics helps us to understand, interpret, and use DNA to solve real-world challenges. These challenges are wideranging, such as finding solutions to meet food and energy demands, climate change, and long-term health issues. What scientists learn from genomics has the potential to improve the quality of life for people in Canada and around the world.

How the CFIA uses genomics Researchers at the CFIA use genomics to develop new methods and tools to help improve how we develop policies and programs and enforce regulations. Genomics can also provide the scientific evidence that the CFIA needs to protect the health, safety and well-being of Canada’s plants, animals, food and economy. Examples of how the CFIA uses genomics: • • • • •

monitor and quickly respond to animal, plant health and food safety emergencies dramatically reduce the time and cost to detect, identify and understand pests and pathogens develop tools that help other countries identify organisms process large numbers of test samples more quickly and cost-effectively digitize an organism’s genetic information to share it with international partners electronically without having to transport a live sample

The CFIA uses DNA barcodes to: Track outbreaks of food-borne illness By analyzing the bacteria that cause foodborne illnesses down to the DNA level, investigators can narrow down specific strains of bacteria to specific locations or causes of contamination. The technology is similar to how a detective can link a fingerprint to a specific culprit at a crime scene.

Combat invasive species quickly and accurately Some insects can be harmless or even beneficial to their natural environment, while some invasive species can destroy ecosystems. For example, the Canadian Forestry Service estimates that removing and replacing trees affected by the emerald ash borer could cost up to $2 billion in Canada over 30 years. Bug experts, known as entomologists, can spend 20 years to develop the expertise to identify an insect visually. Using DNA technology means people trained in how to use the tool can simply and quickly identify an insect that might look nearly identical to several other species.

Identify fake food products Once meat or fish has been processed, it can be almost impossible to visually identify what animal it is. DNA barcoding allows inspectors to take a tiny sample of a product and not only confirm what the label says, but whether other unlisted ingredients have been mixed in, for example what meats are in a sausage.


Genomes and DNA barcodes The CFIA uses a process known as whole genome sequencing (WGS) to identify an organism’s entire genome. A short piece of it can be used to identify a species whenever its DNA is found. That short piece of the genome acts like a barcode – whenever scientists see that piece of DNA, they know without a doubt what species they’re dealing with.

Creating a DNA barcode Having a tool that can quickly and accurately identify an organism is a huge time saver for scientists trying to solve complex problems. A process known as whole genome sequencing identifies the complete DNA sequence of an organism at a single time. To do this, scientists collect a DNA sample and then analyze it to identify billions of nucleotides, the basic structures that compose the DNA of an organism’s genome. Almost any biological sample that contains a full copy of DNA—even a very small amount—can provide the genetic material necessary for whole genome sequencing. These samples can be skin cells, seeds, plant leaves, or anything else that has DNA-containing cells.

How we create a DNA barcode: GCATCTTCAGAGTTAGATTACA AGCATCTTCAGAGTTAGATTAC AAGCATCTTCAGAGTTAGATTA CAAGCATCTTCAGAGTTAGATT ACAAGCATCTTCAGAGTTAGA TTACAAGCATCTTCAGAGTTAG ATTACAAGCATCTTCAGAGTTA GATTACAAGCATCTTCAGAGTT AGATTACAA

EXTRACT DNA

FIND OUT HOW MUCH DNA IS AVAILABLE

MAKE COPIES OF THE DNA FOR ANALYSIS

PREPARE AND THEN SEQUENCE THE DNA

ANALYZE AND VALIDATE THE SEQUENCE

MAINTAIN THE SEQUENCE RECORD FOR FUTURE REFERENCE

Tools of the trade

While a DNA barcode makes solving problems simpler, identifying one is a complex process. There are many steps that each require specialized equipment and techniques to get the job done. Once researchers have collected tissue that contains DNA, they are careful to handle it in a way to keep the sample sterile. DNA barcodes can be kept in a database for future reference. The database also allows the DNA sequencing results from multiple projects to be merged and easily compared. CFIA scientists organize the DNA barcodes they obtain using the Barcode of Life database. The database is part of the International Barcode of Life project (iBOL), which is the largest biodiversity genomics initiative ever undertaken. Hundreds of biodiversity scientists and genomics specialists from 25 countries are working together to build a comprehensive DNA barcode library. This library will be used to create a system to identify all living things by their DNA.

CFIA P0972E-18

Catalogue No.: A104-148/2018E-PDF

ISBN: 978-0-660-27783-7

Aussi disponible en français


CFIA SCIENCE FACT SHEET Antimicrobial Resistance A Growing Problem Antimicrobial resistance (AMR) is now recognized as a growing health threat to public health in Canada and around the world. AMR occurs when microbes (e.g. bacteria, viruses, fungi and parasites) change in ways that reduce or eliminate the effectiveness of antimicrobial drugs to treat infections by killing or slowing microbial growth.

Importance of antimicrobial drugs Antimicrobial drugs are used to treat a wide range of infections. They are also essential for some important medical treatments. For example, antimicrobial drugs are used to prevent or control infections during chemotherapy treatment and after organ transplants, when the body’s natural immune defences are lowered. Without effective antimicrobial drugs, the risk of infection would increase. The result would be prolonged illnesses and increased risk of death. Antimicrobials are also used in livestock to treat, control and prevent bacterial disease, improve feed efficiency, promote growth, and to maintain animal health and welfare.

Overuse Antimicrobial drugs are sometimes overused and misused in human medicine, animal medicine, the agri-food industry, and even cleaning products. Humans and animals are often exposed unintentionally (e.g. through environmental contamination to unsafe food) to antimicrobials or microbes that have become resistant to antimicrobials.

How does AMR develop? Microbes naturally evolve in response to changes in their environment. This includes contact with antimicrobial drugs. The more we use antimicrobials, the faster resistance will develop. When antimicrobials are overused or misused, individual microbes that are resistant to the drug survive the treatment and multiply. Over time, enough of these resistant microbes can lead to new, drug-resistant strains that cannot be controlled by available treatments. For example, just like any other bacteria, resistant bacteria can be spread through the food chain in uncooked meat, produce that was contaminated by water or soil, prepared food contaminated through surfaces, or in the environment through animal or human waste. They can also be spread through poor infection prevention and control in health care, or through contact between people in the community.

Whenever there is a high number of bacteria, few of them are resistant to antibiotics

Antibiotics kill the bacteria that cause the illness, as well as good bacteria that protect the body from infection

The resistant bacteria can now grow and multiply without competition

Some bacteria can even transfer their resistance to antibiotics to other bacteria, which causes more problems


CFIA SCIENCE FACT SHEET Antimicrobial Resistance Food production and AMR in Canada Canada is a major producer of food animals for domestic and international markets. The country has 19 times more animals than humans, mostly poultry.

A global threat Public health organizations in most countries consider AMR a global threat. Antimicrobial resistant organisms (AROs) do not remain isolated in the location or environment where they first arise. Medical tourism, international food production, shipment of food and animals between countries, and travel can make it easy for AROs to travel around the world. Antimicrobial resistance now occurs in every country around the world. In some cases, certain tested strains of E.coli bacteria show resistance that ranges from 5% to 80%. AMR is considered one of the greatest risks to human health around the world.

According to data published by the Canadian Integrated Program for Antimicrobial Resistance Surveillance (CIPARS), in 2015, about 1.8 million kilograms of antimicrobial drugs were distributed or sold for use in humans, animals, and crops in Canada. About 1.6 times more antimicrobials were distributed for use in animals than humans. Of these antimicrobials:

82% were for food producing animals

17% were for humans

less than 1% for pets

less than 1% for crops

Most of the antimicrobials given to animals were the same types of antimicrobial drugs used for humans. This creates a challenge as microbes develop resistance to specific antimicrobial drugs, human health is at increased risk.

AMR and veterinary medicine

How the Government of Canada fights AMR

There is increasing evidence that antimicrobial drug use in veterinary medicine and livestock production contributes to AMR bacteria in humans. Antimicrobials are given to chickens, pigs, cattle, and other animals we eat to treat and prevent disease. However, the spread of AROs from animals to humans makes it necessary to assess how AMR in foodproducing animals puts human health at risk.

The Government of Canada monitors AMR in chicken, pork, and beef for E.coli, Campylobacter, and Salmonella. AMR in Campylobacter and Salmonella is also monitored in humans. This helps to measure how AROs move from animals to humans. The CFIA uses cutting-edge technology like whole genome sequencing to analyze how resistant food-borne bacteria are to antimicrobial drugs. This technology allows scientists to look at the entire genetic structure of bacteria like E. coli or Listeria. This helps them see just how resistant certain strains are so that correction or prevention plans with food producers can be put in place.


CFIA SCIENCE FACT SHEET Antimicrobial Resistance Keeping an eye on AMR in Canada The Public Health Agency of Canada’s Canadian Antimicrobial Resistance Surveillance System (CARSS) is the focal point for reporting antimicrobial resistance. It uses information from PHAC’s surveillance systems and laboratory reference services which track resistant organisms in Canada. CARSS works with partners in government, public health and academia to monitor trends and impacts, and address the gaps in surveillance. The objectives of CARSS and its component programs are to: •

Provide provinces, territories and stakeholders with data and analysis, integrating material from all of PHAC’s programs and surveillance on AMR and antimicrobial use (AMU) in humans, animals and crops This helps inform public health actions such as infection prevention and control, research, and innovation

Guide surveillance activities for resistant infections that pose the greatest risk to the health of Canadians

Provide Canadians with timely and reliable information on trends in AMR and AMU in humans and animals within Canada

Identify policies and measures that can be used to contain the emergence and spread of resistant bacteria between animals, food, and people in Canada

Working with veterinarians, feed companies, and farmers Promoting the responsible use of antimicrobials relies on collaboration with farmers, feed companies, and veterinarians to:

Fund research into other ways to improve animal health while reducing the use of antimicrobials

Change legislation to require antimicrobial use to be supervised by veterinarians

Improve the surveillance of antimicrobial use

Support programs that improve the health of farm animals

Encourage animal hygiene and livestock-raising practices that reduce the need for antimicrobials

Monitor the use of authorized antimicrobials on animal farms

Educate farmers and farming communities on using antimicrobials responsibly

Farm animals receive antibiotics, which cause antibiotic-resistant bacteria to develop.

Fertilizer or water contaminated with resistant bacteria are used on food crops.

Meat products that are not handled or cooked properly can transfer antibioticresistant bacteria to humans.

How can antibiotic resistance spread? Contaminated crops can transfer antibiotic resistant bacteria to humans.


CFIA SCIENCE FACT SHEET Using DNA science to fight food-borne illness

What is a pathogen? A pathogen is anything that can produce disease. This can be things like be a virus, fungus or bacteria. While most bacteria in food can be harmless or helpful, some can cause problems, like infections. Some bacteria, in small amounts, are harmless to most healthy adults, while others can multiply and spread and people can become ill. Bacteria that cause illness are known as bacterial pathogens. Foods that are contaminated with bacteria may not look, taste or smell different from foods that are safe to eat. To prevent or limit illness, scientists at the Canadian Food Inspection Agency (CFIA) work to quickly identify these bacterial pathogens in food. The work of CFIA scientists is essential in tracking down the sources of bacterial contamination in food when it happens.

Genomics and DNA barcoding Genomics helps us understand, interpret, and use DNA to create solutions to problems. The CFIA carries out genomics research to develop technologies that help scientists identify and understand specific pathogens. These technologies provide new ways to diagnose problems, and lead to faster, cheaper solutions.

Did you know ?

Bacteria like E. coli have around 4 million nucleotides. These are the basic structures that make up DNA. When scientists look for a section of DNA to identify an organism, they take a section of around 700 nucleotides to act as a barcode. This barcode can be used to distinguish one species of bacteria from every other species.

Using genomics is a huge improvement from the older biochemical techniques that are used to fight food-borne illnesses. This is like the difference between a detective only knowing a suspect’s height and rough physical description compared to having the suspect’s fingerprints and behaviour profile. This detailed information makes it much easier to identify the source of contamination leading to a food-borne illness.

That’s only 0.0175% of its overall DNA!

CFIA scientists can identify the complete DNA sequence of an organism’s genome at a single time using a process known as Whole Genome Sequencing (WGS). This can be done in as little as 24 hours. Once an organism’s entire genome is known, a short piece of it can be used as a way of identifying that species whenever its DNA is found. That short piece of the genome acts like a barcode—whenever scientists see that piece of DNA, they know without a doubt what species they’re dealing with.

Pinpointing food pathogens CFIA scientists can use genomic technologies to sequence the genome of a bacteria taken from a food manufacturing site or from food that has made somebody sick, allowing them to accurately detect and analyze food-borne illnesses and how potentially harmful they are to humans.

Did you know ?

The CFIA has sequenced the entire DNA structure of over 4,000 bacteria that are related to food-borne illnesses, like E. coli, Salmonella, and Listeria.

Biochemical techniques used by scientists can provide basic information about a sample from contaminated food, like whether the pathogen Listeria is present. Comparatively, a bacteria’s DNA barcode can reveal information like its exact strain or how resistant it is to antibiotics. Knowing the bacteria’s genome can help inspectors trace a specific sample from the food that it contaminated back to specific areas in a factory to identify where problems are coming from.


CFIA SCIENCE FACT SHEET Using DNA science to fight food-borne illness

How whole genome sequencing works Whole genome sequencing (WGS) is a laboratory procedure that determines the entire genetic structure of an organism in one process, similar to a blueprint for a building. WGS provides a very precise DNA fingerprint that can help link cases of illness or contamination to one another, allowing an outbreak to be detected and solved sooner.


Following up on problems When CFIA inspectors identify where problems with bacteria are coming from—for example a certain area of a food processing plant—corrective actions can be identified. If inspectors find the exact same type of bacteria when they come back for a followup inspection, the use of this DNA strain-based approach can let them know whether the original problem was not properly addressed, or whether they have an entirely new problem on their hands. If the new sample of bacteria matches the DNA barcode of the sample they found the first time, this tells the inspectors that the plant may not have fully corrected the problem.

Labs across Canada The CFIA has DNA sequencing machines in labs across the country. This means sequencing bacteria in food-borne illness outbreaks can be done rapidly—in some cases twice as quickly as older biochemical methods. Analyzing the large amounts of data that come from the CFIA’s food microbiology lab’s sequencing activities—known as bioinformatics—is done centrally at the CFIA’s Ottawa Carling Laboratory. Bioinformatics software, developed by the CFIA and named GeneSeekr, can identify certain important features in DNA sequencing data. For example, the species or strain of the bacteria, how harmful it is, and markers that indicate whether that bacteria is resistant to antibiotics. The software allows non-scientists to understand complex information quickly and easily to help make decisions in food safety investigations.


Turn static files into dynamic content formats.

Create a flipbook
CFIA (Plain Language Science Fact Sheets) by NIVA Inc. - Issuu