TEST BANK for Biochemistry: A Short Course, 4th Edition, John Tymoczko, Jeremy Berg, Gregory Gatto,

TEST BANK for Biochemistry: A Short Course, 4th Edition, John Tymoczko, Jeremy M. Berg, Gregory J. Gatto Jr., Lubert Stryer.

Chapter 1 to 7 Indicate the answer choice that best completes the statement or answers the question.

1. What is the critical feature of the Michaelis–Menten model of enzyme catalysis? a. increasing the probability of product formation b. shifting the reaction equilibrium c. formation of an ES complex d. reaching the reaction equilibrium e. accumulation of the product 2. The formula V0 = Vmax ([S]/[S] + KM) indicates the relationship between the: a. enzyme activity and the equilibrium constant. b. rate of a catalyzed reaction and the equilibrium constant. c. enzyme activity and substrate concentration. d. probable substrate concentration and the normal concentration in vivo. e. turnover number and the rate of catalysis.

3. Which description of the concerted model for allosteric enzymes is TRUE? a. At a low substrate concentration, L0 is small. Upon increasing the substrate concentration, in accordance with the symmetry rule, L0 will be increasing. The disrupted equilibrium of the enzyme states results in a sharp increase of the reaction velocity. As the concentration reaches the threshold, the enzyme becomes more active. b. Upon increasing the substrate concentration, due to cooperativity, the number of enzyme molecules in the T state will be decreasing. The equilibrium between enzyme states is disturbed due to a lower stability of the R state. As the concentration reaches the threshold, the enzyme becomes more active. c. At a low substrate concentration, L0 is large. Increasing the substrate concentration will result in accumulation of the enzyme in the R state, which will increase L0. The disrupted equilibrium of the enzyme states results in a sharp increase of the reaction velocity. When the substrate concentration is way above KM, the enzyme activity is very sensitive to the changes in the concentration, which results in a sharp increase of the reaction velocity. d. Upon increasing the substrate concentration due to the symmetry rule, the number of enzyme molecules in the T state will be increasing. The equilibrium between enzyme states is disturbed due to a lower stability of the T state. When the substrate concentration is way above KM, the enzyme activity is very sensitive to the changes in the concentration, which results in a sharp increase of the reaction velocity. e. At a low substrate concentration, L0 is large. Upon increasing the substrate concentration, L0 will be markedly decreasing. The disrupted equilibrium of the enzyme states results in a sharp increase of the reaction velocity. As the concentration reaches the threshold, the enzyme becomes more active.

4. Which statement about mass spectrometry is FALSE? a. In electrospray ionization, the protein or peptide under study is co-precipitated with an organic compound that absorbs laser light of an appropriate wavelength.

b. In the time of flight analysis, tiny amounts of biomolecules as small as a few picomoles (pmol) or femtomoles (fmol) can be analyzed. c. In tandem mass spectrometry, peptides can be fragmented by bombardment with argon to generate a family of product ions in which one or more amino acids are removed from one end of the initial peptide analyte. d. MALDI-TOF is one of the most accurate means of determining protein mass. e. In MALDI-TOF, peptide masses are matched in a database against proteins that have been "electronically cleaved" by a computer simulating the same fragmentation technique used for the experimental sample.

5. When [S] << KM, the enzymatic velocity depends on: a. the values of kcat/KM, [S], and [E]T. b. Vmax of the reaction. c. the affinity of the substrate for the catalytic site. d. the values of kcat, [S], and [E]T. e. the formation of the ES complex.

6. What is the common strategy by which catalysis occurs? a. increasing the probability of product formation b. shifting the reaction equilibrium c. stabilizing the transition state d. increasing the free-energy difference between the transition state and the product e. changing the shape of substrate binding 7. When enzymes are purified, the assay is often based on: a. light absorbance. b. catalytic activity. c. pH. d. temperature changes. e. mRNA levels.

8. What is the reaction order if the reaction rate was doubled by doubling the reactant concentration? a. zero order b. first order c. second order d. pseudo-first order e. pseudo-second order 9. Gastroesophageal reflux disease is a common example of a pathological change in: a. pKa of acetic acid.

b. hydrogen bonds in a key digestive enzyme. c. protein structure. d. water content in cells. e. pH level.

10. What is the driving force for formation of the unique spatial structure of water-soluble proteins? a. the tendency of hydrophilic groups to cluster together b. the tendency of hydrophobic groups to repel each other c. the tendency of polar groups to interact with water molecules d. the tendency of hydrophobic groups to cluster together e. the tendency of hydrophilic groups to repel each other 11. Polyclonal antibodies rather than monoclonal antibodies: a. can be obtained by fusing of antibody-producing cells and myeloma cells. b. are generated from a large number of cells of a single kind. c. are used in purification of receptors or other proteins by immunoprecipitation. d. such as Trastuzumab are used to treat some forms of breast cancer. e. have an advantage for the detection of a protein with low abundance.

12. At equilibrium, the Gibbs free energy is/has: a. a positive value. b. neutral. c. a negative value. d. zero. e. equal to one.

13. The active site of an enzyme: a. is a series of amino acids that bind the enzyme. b. is a linear sequence of amino acids that react with each other. c. binds covalently to the substrate. d. allows water to enter into the solvate and the substrate. e. is responsible for the specificity of some enzymes.

14. Which amino acid is more conformationally restricted and why? a. glycine because it is achiral b. proline because its side chain is bonded to both the nitrogen and the α-carbon atoms c. glycine because two hydrogen atoms are bonded to the α-atom d. proline because its side chain is aliphatic e. proline because its side chain is bonded to both the carboxyl carbon and the α-carbon atom

15. Choose the CORRECT statement concerning the folding funnel. a. As the percentage of protein residues in native conformation increases, the total energy of the protein decreases, which increases the entropy of the protein. b. The energy of the protein grows as more hydrophobic interactions occur upon protein folding. c. In the nucleation-condensation model, both local and long-range interactions take place to lead to the formation of the native state. d. The molten globule model assumes that local interactions facilitate long-range hydrophobic interactions upon protein folding. e. The molten globule state has a lower energy than the partially correct intermediate.

16. Which of the following structures is lost when a peptide bond is formed between two amino acids? a. amino group b. water c. carboxyl group d. carbonyl group e. amino-terminal residue 17. The first step in catalysis by enzymes is the formation of the: a. transition state. b. active sites. c. cofactor–substrate complex. d. enzyme–substrate complex. e. binding energy between the enzyme and the substrate.

18. Protonation of a base yields its: a. conjugate molecule. b. conjugate base. c. conjugate acid. d. ionized derivative. e. ionized base.

19. What technique allows the detection of very small quantities of a particular protein in a cell or in body fluid and makes it possible to find a protein in a complex mixture, which is useful in monitoring protein purification and in the cloning of genes? a. sandwich ELISA b. indirect ELISA c. gradient centrifugation d. immunoblotting e. MALDI-TOF 20. Prions are:

a. proteins that are normally present in the brain. b. agents that are similar in size to viruses but consist only of protein. c. agents causing viral brain diseases. d. uncommon for brain proteins with a complex structure. e. proteins contributing to the correct folding of proteins.

21. Judging by the given Lineweaver–Burk plot, identify the turnover number of enzyme B if its total concentration is 0.2 M.

a. 0.1 b. 10 c. 5 d. –1 e. 2.5 22. Proteins that are exceptions to the paradigm that a given protein amino acid sequence will fold into a particular three-dimensional structure are those that: a. perform different functions in different conditions and with a different partner. b. are only hydrophobic. c. are only hydrophilic. d. perform different functions with the same partners. e. have a different structure.

23. It is NOT characteristic for the concerted model for allosteric enzymes to: a. catalyze multiple reactions within one enzyme. b. maintain two distinct conformations of the enzyme that can be spontaneously interconverted. c. bind the substrate to the more stable conformation more readily.

d. follow the symmetry rule by all of the enzyme active sites. e. disrupt the equilibrium between the conformations in favor of the least stable form after the substrate binding.

24. What are the primary chemical components present in a phosphate buffer at pH 7.4?

3–

a. H3PO4 and PO4 –

3–

2–

and PO43–

b. H2PO4 and PO4 c. HPO4

–

2–

e. H3PO4 and HPO4

2–

d. H2PO4 and HPO4

25. What is a holoenzyme? a. an enzyme without its cofactor b. an enzyme with its cofactor c. an enzyme with an active site d. an enzyme without prosthetic groups e. an enzyme with the transition state 26. Where are the majority of nonpolar residues located in myoglobin? a. The outside of myoglobin. b. The interior of myoglobin. c. Myoglobin consists of only nonpolar residues. d. The outside and the interior of myoglobin. e. The outside of the super helix.

27. Which statement about the compactness of the protein interior is TRUE? a. A small number of sizes and shapes of hydrocarbon side chains enable their compact packing. b. A wide variety of aliphatic side chains complicate their packing with little empty space. c. Large and different polar side chains restrict protein folding. d. A wide variety of sizes and shapes of hydrocarbon side chains enable their packing with little empty space. e. A small variety of aromatic side chains are used to direct protein folding to a more compact form.

28. What structures of polypeptide chains were proposed by Linus Pauling and Robert Corey? a. primary structures b. turns and loops c. secondary structures d. the alpha helix and the beta pleated sheet e. cis and trans configurations

29. What does NOT vary between amino acids? a. shape b. charge c. hydrophobicity d. L form in proteins e. hydrogen-bonding capacity 30. Which type of amino acid is responsible for increasing entropy as a protein folds? a. nonpolar b. polar but uncharged c. charged positively d. charged negatively e. amphipathic 31. When the substrate concentration is much greater than KM, the rate of catalysis is almost equal to: a. [S] + KM. b. kcat. c. Vmax. d. Vmax/2. e. (Vmax/KM)[S].

32. Choose the essential amino acids. a. aspartate and lysine b. glycine and leucine c. proline and phenylalanine d. tryptophan and glutamate e. leucine and isoleucine 33. The molecular structure that is short lived and is neither a substrate nor a product is known as: a. substrate analog. b. transition state. c. enzyme–substrate complex. d. cofactor. e. stable intermediate.

34. An example of a reaction of the double-displacement class is the: a. conversion of pyruvate and NADH to lactate and NAD+ by lactate dehydrogenase with formation of a ternary complex. b. conversion of creatine and ATP to phosphocreatine and ADP by creatine kinase with ATP being

released before both substrates bind the enzyme. c. conversion of aspartate and α-ketoglutarate to oxaloacetate and glutamate with formation of a ternary complex. d. cleavage of a peptide bond by chymotrypsin with the formation of a substituted intermediate on a serine residue. e. isomerization of dihydroxyacetone phosphate to glyceraldehyde 3-phosphate.

35. Which amino acid contains a group uncharged or positively charged near a neutral pH? a. histidine b. proline c. cysteine d. serine e. arginine 36. The specificity constant does NOT depend on the rate constant for the: a. formation of the ES complex (kcat). b. dissociation of the ES complex (k–1). c. formation of the product (k2). d. formation of the ES complex (k1). e. formation of the product (kcat).

37. The tripeptide that should have the highest solubility in water is: a. HRK. b. QRH. c. KDG. d. WET. e. RKM. 38. Which process covers the activation energy? a. formation of the product from a reactant b. catalysis of the reaction by enzymes c. achieving reaction equilibrium d. formation of the product from the transition state e. formation of the active site 39. Which statement about pseudo-first order reactions is FALSE? a. Bimolecular reactions can be pseudo-first-order reactions. b. The reaction rate will not appear to depend on the concentration of reactant A, whose concentration greatly exceeds that of reactant B. c. The reaction has a pseudo-first order if the concentration of one reactant greatly exceeds that of the

second one and if the second reactant is present at low concentrations. d. The reaction rate will not appear to depend on the concentration of reactant A, whose concentration is significantly less than that of reactant B. e. Unimolecular reactions cannot be pseudo-first-order reactions.

40. An enzyme will specifically bind its substrate because of: a. a tight lock-and-key binding mechanism. b. a high number of hydrophobic amino acids in the center of the protein. c. a large number of weak interactions at the active site. d. additional nonprotein cofactors. e. a transition state of its substrate.

41. Why are peptide bonds of proteins found mainly in the trans configuration in nature? a. In the cis configuration, side chains of amino acids are most distant from each other but steric clashes between the groups are necessary. b. In the trans configuration, side chains of amino acids are most distant from each other and steric clashes between the groups are excluded. c. In the trans configuration, side chains of amino acids are least distant from each other and steric clashes between the groups are excluded. d. In the trans configuration, the two adjacent rigid peptide units may rotate about amino acid bonds. e. The trans configuration contributes to the rotation of radicals in a clockwise direction.

42. Which amino acid can be used as a taste enhancer? a. glutamine b. asparagine c. glutamate d. aspartate e. glycine 43. What reagent helps to visualize amino acids in amino acid composition analysis? a. phenyl isothiocyanate b. clostripain c. β-mercaptoethanol d. hydroxylamine e. fluorescamine 44. How much energy (in kcal) is released during the oxidation of 1 mol of glucose, if it is known that ΔG = – 17.2 kJ? a. –4,11 kcal b. –0,239 kcal c. –298 kcal

d. –4110 kcal e. –1720 kcal 45. Which functional group distinguishes asparagine from aspartic acid? a. hydroxyl b. carboxamine c. sulfhydryl d. carboxamide e. guanidinium 46. Two proteins are similar in size but differ significantly in the number of acidic and basic amino acids. What technique would be BEST suited for separating these two proteins? a. SDS-PAGE and gel-filtration chromatography b. isoelectric focusing and dialysis c. immunoprecipitation and affinity chromatography d. isoelectric focusing and ion-exchange chromatography e. SDS-PAGE and immunoprecipitation 47. What is the reaction class if all substrates must bind to the enzyme in an arranged manner before any product is released? a. random sequential b. ping-pong c. ordered sequential d. second order e. first order 48. How can a protein that is positively charged at pH 7 be eluted in ion-exchange chromatography? a. displacement of the protein by another ligand b. increasing volume of the buffer c. increasing pH of the buffer d. increasing concentration of salt in the buffer e. decreasing concentration of salt in the buffer 49. Aspartate can't form the α-helix because it: a. has a ring structure. b. has closely located radicals that have a tendency to steric clashes. c. has hydrogen-bond acceptors that compete for the main chain groups. d. is a too short amino acid to form the α-helix. e. does not have NH groups.

50. A clinician friend comes to you and tells you she has a patient that she thinks has some sort of defect in the

collagen structure. She wants to know what kinds of structural differences there might be. Which of the following is FALSE for defects leading to scurvy or brittle bone disease? a. Proline residues are not hydroxylated. b. Glycine is replaced by other amino acids. c. Prolyl hydroxylase activity is deficient. d. Accumulation of defective collagen causes cell death. e. There is violation of the quaternary structure.

51. In what pH range is alanine present predominantly in its zwitterionic form? a. 0–2 b. 9–14 c. 8–10 d. 2–4 e. 2–9 52. Choose the CORRECT definition of the given terms. a. The total amount of protein is the measure of enzyme activity. b. Enzyme activity is the ratio of total activity to the amount of protein in the enzyme assay. c. An assay is not always based on some unique biochemical properties of the protein of interest. d. The purification level is obtained by dividing specific activity of the initial extract by the total volume of the fraction. e. The total activity is obtained by measuring specific activity of the fraction used in the assay and multiplying it by the fraction's total volume.

53. Which statement about Vmax is TRUE? a. Vmax is independent of enzyme concentration. b. For Michaelis–Menten enzymes, the maximal velocity is approached asymptotically. c. Vmax can be attained only when half of the enzyme is bound to the substrate. d. The reaction velocity is maximal when the concentration of the substrate equals KM. e. The reaction velocity is half Vmax when the entire enzyme is bound to the substrate.

54. What is the amount of energy needed to raise the temperature of 2 kilograms of water from 14.5°C to 15.5°C? a. 2 J b. 2 kJ c. 2 cal d. 20 cal e. 2 kcal 55. What is the net charge of a glycine molecule in human blood at pH 7.4, for an amino group of glycine pKa =

9.6 and for a carboxyl group pKa = 2.3? a. –2 b. –1 c. 0 d. +1 e. +2 56. What is the value of [S] as a fraction of KM required to obtain 20% Vmax? a. 0.2 KM b. 0.25 KM c. 0.5 KM d. 0.75 KM e. 0.8 KM 57. What would be the overall charge of the peptide Asp-Gly-Arg-His at pH 1? a. –1 b. 0 c. 1 d. 2 e. 3 58. How many amino acids can human beings synthesize? a. 20 b. 11 c. 5 d. 18 e. 3 59. What makes α-amino acids chiral to the largest extent? a. D isomers are more dominant in α solution. b. The α-carbon atom is tetrahedral. c. α-amino acids are able to exist in both mirror-image forms. d. L isomers are more dominant in a solution. e. Four different groups of α-amino acids are connected to the tetrahedral α-carbon atom.

60. A student observes that when an unknown molecule is added to water, it forms micelles, which under the right conditions can form membranes. What can this student infer about this phenomenon? a. The unknown molecule is amphipathic. b. The micelle formation is driven by the resulting decrease in entropy of water.

c. The unknown molecule forms many van der Waals interactions with water. d. The micelle formation is driven by the hydrophilic effect. e. The unknown molecule dissociates to ions in water.

61. What is the difference between a peptide and a protein? a. the number of amino acid residues b. the configuration of peptide bonds c. the structure of amino acid residues d. the charge of functional groups e. torsion angles 62. KM of the cytosolic isomer of fumarase is equal to 5 µM, whereas KM of the mitochondrial isomer is equal to 50 µM. What should the value of k2 be for a less active isomer of the enzyme to achieve kinetic perfection? a. from 5 × 108 to 5 × 109 b. from 2 × 107 to 2 × 108 c. from 1 × 108 to 1 × 109 d. from 5 × 102 to 5 × 103 e. from 2 × 106 to 2 × 107 63. What is the name for allosteric regulation when a molecule blocks the committed step of its own synthesis pathway? a. committed inhibition b. feedback inhibition c. concerted model d. sequential model e. cooperativity 64. What is the free energy of activation? a. the difference in concentration between the product and the substrate b. the difference in free energy between the product and the substrate c. a thermodynamic property that is a measure of useful energy, or energy that is capable of doing work d. the free energy required to initiate the conversion of reactants into products e. the difference in free energy between the transition state and the substrate 65. How can the turnover number of an enzyme be determined? a. as Vmax b. when the enzyme is fully saturated c. as [E]T d. when half of the enzyme is occupied with the substrate

e. by the initial velocity 66. What will be the weight of a protein consisting of 250 amino acid residues? a. 27,500 g mol–1 b. 22,000 g mol–1 c. 5500 g mol–1 d. 25,000 g mol–1 e. 250 kDa 67. What is TRUE regarding the action of allosteric effectors? a. Negative effectors inhibit the less stable form of the enzyme. b. Positive effectors stimulate the more stable form of the enzyme. c. Negative effectors stabilize the less stable form of the enzyme. d. Negative effectors inhibit the more stable form of the enzyme. e. Negative effectors stabilize the more stable form of the enzyme.

68. What fraction would you get as a pellet after centrifugation of the tissue homogenate at 104,000 g for 64 minutes? a. nuclear fraction b. mitochondrial fraction c. cytosol d. microsomal fraction e. cell membranes 69. Which term is MOST appropriate to explain an enzyme binding to its substrate? a. apoenzymes b. active site c. induced fit d. prosthetic group e. lock and key 70. What amino acids can be involved in acid–base catalysis? a. glutamic acid and asparagine b. tyrosine and serine c. asparagine and arginine d. glutamic acid and cysteine e. threonine and lysine 71. Choose the CORRECT statement concerning the reaction order. a. First-order rate constants have units M–1 s–1.

b. Biochemical reactions cannot have a zero order. c. Bimolecular reactions are always second-order reactions. d. Second-order reactions are usually unimolecular. e. First-order rate constants have unit s–1.

72. Every third residue in the protein collagen is: a. leucine. b. glycine. c. proline. d. tyrosine. e. titin.

73. How can you protect side chains of the main chain from interaction with water? a. pair all of the NO and CO groups by peptide bonding b. convert all nonpolar residues to polar ones c. form α helices and β sheets d. form quaternary structure e. form superhelices 74. Tris buffers are commonly used in biochemistry because they buffer within the physiological range of pH due to a pKa of 8.1. What is the concentration of the conjugate base in a 0.1 M tris solution with pH 5.1? a. 0.1 M b. 0.01 M c. 0.05 M d. 0.5 nM e. 0.1 mM 75. An organic acid ionizes to form a conjugate base and: a. hydrogen. b. water. c. a hydroxyl ion. d. a proton. e. hydrogen peroxide.

76. The velocity of a reaction is the quantity of the: a. reactant that appears in a specified unit of time. b. product that disappears in a specified unit of time. c. solution color that disappears in a specified unit of time. d. reactant that disappears in a specified unit of time. e. solution color that appears in a specified unit of time.

77. Choose the CORRECT statement concerning prions. a. The prion precursor contains mostly extended structural elements rather than tightly coiled ones. b. A large number of β strands prevents extensive contacts between different proteins. c. The difference in the free energy between PrP and PrPSC is small. d. Prions usually consist of two subunits of the normal PrP protein. e. The decrease in the content of α-helical structural elements is unique for prions and always leads to pathological conditions.

78. Below is a list of five tripeptides identified by their single letter codes. Which tripeptide has the most polar side chains? a. FNC b. RGK c. VIL d. MDE e. SYT 79. What is NOT a feature of allosteric enzymes? a. Their activity can be modified by environmental signals. b. They have a sigmoidal dependence of the reaction velocity on the substrate concentration. c. Each allosteric enzyme is capable of conducting multiple reactions. d. Their activity isn't regulated by a threshold effect. e. They depend on alterations in the quaternary structure.

80. What is TRUE for the sequential model for allosteric enzymes? a. The binding of a substrate disrupts the equilibrium between two states of the enzyme. b. The initial molecule of the substrate prevents unproductive colliding between other substrate molecules and the tense form of the enzyme. c. The rate constant for the binding of a substrate is lower for the last subunit of the enzyme than for the first one. d. The affinity to the substrate increases due to the influence of neighboring subunits. e. Cooperativity in the sequential model can only be positive.

81. Which amino acid contains an imidazole ring? a. proline b. arginine c. asparagine d. tryptophan e. histidine 82. What led to the conclusion that information about catalytic activity is contained in the primary sequence?

a. Anfinsen's experiment, which showed that denatured protein can spontaneously restore its structure after exposure to denaturing agents b. Sanger's experiment, which showed that a protein has a precisely defined amino acid sequence c. Sanger's experiment, which showed that denatured protein can spontaneously restore its structure after exposure to denaturing agents d. Ramachandran's experiment about the φ and ψ angles e. Anfinsen's experiment, which showed that a protein has a precisely defined amino acid sequence 83. Molecules that are readily soluble in water are considered: a. nonpolar. b. polar. c. zwitterionic. d. volatile. e. dielectric.

84. During the early stages of an enzyme purification protocol, when cells have been lysed but cytosolic components have not been separated, the reaction velocity-versus-substrate concentration is sigmoidal. As you continue to purify the enzyme, the curve shifts to the right. Explain your results. a. This is an enzyme that displays Michaelis–Menten kinetics and you purify away a homotropic inhibitor. b. This is an enzyme that displays Michaelis–Menten kinetics, and you must use a Lineweaver–Burk plot to determine KM and Vmax correctly. c. This is an allosteric enzyme and you must use a Lineweaver–Burk plot to determine KM and Vmax correctly. d. This is an allosteric enzyme and during purification you purify away a heterotropic activator. e. This is an allosteric enzyme displaying a double-displacement mechanism and during purification you purify away one of the substrates.

85. An enzyme will be MOST sensitive to changes in the substrate concentration when: a. [S] is near KM. b. [S] is below KM. c. KM is below Vmax. d. [S] is above KM. e. KM is Vmax/2.

86. A substrate must have a matching shape to fit into the site because: a. the enzyme and the substrate interact by means of short-range forces. b. the substrate may bind only to certain conformations of the enzyme. c. the mechanism of catalysis is dynamic, involving structural changes with multiple intermediates. d. enzymes are flexible and the shapes of active sites can be markedly modified by the binding of a

substrate. e. the noncovalent interactions between the enzyme and the substrate in ES complexes are much weaker than covalent bonds.

87. Below is a list of five tripeptides identified by their single letter codes. Which tripeptide is negatively charged at a physiological pH? a. FNC b. RGK c. VIL d. MDE e. SYT 88. The protein in a solution with a high concentration of (NH4)2SO4 doesn't bind to a column. What technique should you use to solve this problem? a. SDS-PAGE b. ELISA c. centrifugation d. dialysis e. HPLC 89. What amino acids should be prevailing in a protein at pH 7 for binding of that protein to beads containing negatively charged carboxylate groups? a. serine b. phenylalanine c. histidine d. glycine e. cysteine 90. In a typical cell, the water content is about: a. 60%. b. 70%. c. 80%. d. 90%. e. 99%.

91. Choose the CORRECT statement. a. The binding between Ig and antigen is a step in the immune response. b. Epitope is composed of heavy and light chains. c. Antigen is synthesized by an animal in response to the presence of a foreign substance. d. The Fc domain of the Ig is formed by two heavy chains and two flexible linkers.

e. Nucleic acids can't be effective antigens.

92. What is the difference between calculated and actual folding time called? a. Dawkins' paradox b. folding funnel c. Ramachandran plot d. Levinthal's paradox e. Anfinsen's paradox 93. What is the hydroxyl ion concentration in a urine sample that has a pH of 6? a. 10–6 M b. 10–8 M c. 106 M d. 10–14 M e. 6 M 94. What is the concentration of acetic acid in 250 ml of a 100 mM acetate buffer at pH 4.76? a. 250 mM b. 100 mM c. 50 mM d. 75 mM e. 25 mM 95. The secondary structure that is stabilized by CO and NH hydrogen bonding within the peptide chain is called a(n): a. turn. b. loop. c. α helix. d. β sheet. e. β strand.

96. Many transition-state analogs bind more tightly than the native substrate. This fact reinforces the concept that: a. transition-state analogs are planar structures. b. transition-state analogs are highly charged at a physiological pH. c. binding to the transition state is done through a lock-and-key mechanism. d. transition-state analogs are hydrophobic. e. binding to the transition state is done through an induced-fit mechanism.

97. How can a reaction be described if it is exergonic?

a. at equilibrium b. spontaneous c. with a positive free-energy change d. oxidation–reduction e. with a cofactor 98. What can enzymes alter in reactions? a. Gibbs free energy b. equilibrium constant c. reaction rate d. reaction equilibrium e. substrate concentration 99. What reagent cleaves the carboxyl side of lysine and arginine residues in proteins? a. hydroxylamine b. staphylococcal protease c. clostripain d. trypsin e. carboxypeptidase A 100. Calculate the turnover of an enzyme if the maximal velocity is 0.2 M sec–1 and the product concentration after the reaction is 1 M. a. 0.2 sec b. 0.2 sec–1 c. 5 sec d. 0.5 sec e. 0.5 sec–1 101. Which combination can associate to form a hydrogen bond? a. N–H and O b. N–H and S c. O–H and P d. C=O and S e. C=O and P 102. A tightly bound cofactor might be called a(n): a. apoenzyme. b. holoenzyme. c. transition state. d. prosthetic group.

e. coenzyme.

103. Which statement about active sites is INCORRECT? a. The active site is a three-dimensional cleft. b. Active sites are unique enzymes. c. The active site of an enzyme is the region that binds the substrates. d. The active site takes up a small part of the total volume of an enzyme. e. Active sites may include distant residues.

104. What determines a protein's function? a. its structure b. its gene sequence c. N-terminal amino acids d. time of its formation e. C-terminal amino acids 105. Which amino acid can be part of a protein? a. L glycine b. D glycine c. L alanine d. D alanine e. L imidazole 106. What fact is confirmed by effects of transition-state analogs? a. selective binding of the transition state b. selective binding of the substrate c. selective binding of antibodies d. a trigonal conformation of the α-carbon atom of an inhibitor e. selective binding of transition-state analogs themselves 107. In the Michaelis–Menten model: a. the reaction equilibrium is attained with time, and the change in the concentration of the product allows measuring of the reaction rate. b. a unique characteristic of the enzyme is investigated when the enzyme concentration is relatively constant and the product formation is negligible. c. enzyme concentration is relatively constant only near the end of the reaction, so only in the beginning of the reaction can the velocity be measured precisely. d. only in the beginning of the reaction, there is no net change in concentrations of S and P, so the reaction velocity can be measured precisely. e. the initial velocity depends on [S] only when the entire enzyme is bound to the substrate but the product has not accumulated yet.

108. What is the H+ concentration in a urine sample that has a pH of 6? a. 10–6 M b. 10–8 M c. 106 M d. 10–14 M e. 8 M 109. Where are β turns and loops often found? a. in a hydrophobic pocket b. on the interior cleft c. at the protein interface with a ligand d. on the surface of proteins e. between β sheets 110. The side chain of which amino acids can completely lose a proton at a slightly basic pH? a. methionine b. cysteine c. serine d. threonine e. tyrosine 111. What would be the solubility of a salt in a solvent with a low dielectric constant? a. excellent b. good c. suitable d. poor e. exclusive 112. In the formation of the alpha helix, the carbonyl group is connected by: a. a hydrogen bond not with a neighboring NH group, but with a NH group located at a distance of four amino acid residues from it. b. a hydrogen bond with a neighboring NH group. c. a disulfide bond not with a neighboring NH group, but with a NH group located at a distance of four amino acid residues from it. d. a peptide bond with a neighboring NO group. e. a hydrogen bond with a single amino acid on an adjacent strand.

113. Which statement about cofactors is CORRECT? a. A cofactor is a small molecule that is formed as a result of a reaction catalyzed by enzymes.

b. Cofactors can be subdivided into two groups: small organic molecules, derived from vitamins, and metals. c. Cofactors can be subdivided into two groups: small organic molecules, derived from vitamins, and prosthetic (helper) groups. d. An enzyme without its cofactor is referred to as a holoenzyme. e. The catalytic activity of many substrates depends on the presence of small molecules called cofactors.

114. The amino acids that contain sulfur are: a. cysteine and serine. b. cysteine and threonine. c. cysteine and methionine. d. threonine and methionine. e. serine and methionine.

115. Choose the CORRECT statement. Enzymes: a. force reactions to proceed in only one direction. b. alter the equilibrium of the reaction. c. alter the standard free energy of the reaction. d. without their cofactors are referred to as coenzymes. e. are very specific.

116. The interaction that is described by Coulomb's law is called: a. hydrophobic. b. weak. c. electrostatic. d. hydrogen. e. physical.

117. What technique is used to separate proteins by their charge and then by their size? a. molecular exclusion chromatography b. ion-exchange chromatography c. two-dimensional electrophoresis d. ELISA e. immunoprecipitation 118. Collagen has: a. pyrrolidine rings, which stabilize helices and glycine residues at every third position (because only glycine residues can fit inside of the super-helical cable). b. pyrrolidine rings, which can push off and destabilize the helix and glycine residues at every second position (because only glycine residues can fit inside of the super-helical cable).

c. rings of proline and glutamine residues at every second position. d. rings of glycine, which can stabilize helices and proline residues at every third position (because only proline residues can fit inside of the super-helical cable). e. rings of proline and glycine residues at every second position.

119. Which rate equation is TRUE if doubling the concentration of reactant A doubles the reaction rate and doubling the concentration of reactant B has no effect on the rate? a. V = k[A] b. V = k[A][B] c. V = k[A]2[B]1 d. V = k[A]2[B] e. V = k[A]2 120. The folding of a protein into its native shape can best be described as a(n): a. random event. b. random event catalyzed by ribosome proteins to maintain a low energy structure. c. series of controlled folds with a few random-shaped structures. d. series of repeatable random events where the lowest energy structure is maintained. e. event where the highest possible energy state is stabilized with discrete folding intermediates.

121. What is the distance between adjacent amino acids along the α helix and along the β strand (respectively)? a. 3.5 Å and 1.5 Å b. 5.4 Å and 45 Å c. 5.4 Å and 3.6 Å d. 1.5 Å and 36 Å e. 1.5 Å and 3.5 Å 122. The class of enzymes called ligases: a. catalyzes double bonds. b. transfers electrons between molecules. c. transfers functional groups between molecules. d. cleaves molecules by the addition of water. e. joins two molecules in a reaction powered by ATP hydrolysis.

123. Lymphotactin is an example of: a. metamorphic proteins. b. peptides. c. protein hormones. d. fatty-acid-binding proteins. e. fibrous proteins.

124. What is the concentration of acetate in a 0.1 M acetic acid solution at pH near to pKa = 4.76? a. 0.5 M b. nearly 0.1 M c. 0.05 M d. 0.01 M e. almost 0 125. Allosteric effectors: a. can cause large changes in enzymatic activity. b. can lead to a decrease in the availability of a protein. c. don't alter the sensitivity of a metabolic pathway. d. decrease the sensitivity of the enzyme at nearly all concentrations of the substrate. e. alter enzyme activity by binding to the active site of an enzyme.

126. Which amino acids would be most soluble in a nonpolar solvent such as benzene? a. valine b. histidine c. glutamine d. glycine e. threonine 127. What proteins have multiple conformations? a. ribonuclease and α-keratin b. collagen and prions c. synuclein and lymphotactin d. myoglobin and lymphotactin e. synuclein and collagen –1 128. What would be the equilibrium constant (approximately) if ΔG°' is 20 kJ mol ? a. 3 · 104

b. 10 c. 5.69 d. 1.36 e. 3 · 10–4 129. What is the term for the movement of particles due to the random fluctuations of energy content of the environment? a. dissociation b. Brownian motion

c. hydrophobic interaction d. van der Waals interaction e. entropy 130. Which statement about serine, threonine, and tyrosine is FALSE? a. All of them have a hydroxyl group. b. All of them have nonpolar counterpart amino acids. c. They are all aliphatic. d. They are all polar. e. All of them form zwitterions at physiological pH. 131. What is affinity chromatography based on? a. separation of proteins by size b. moving a molecule with a net charge in an electric field c. affinity of proteins for specific chemical groups or specific molecules d. separation of proteins by their net charge e. high affinity of the antibody for the proteins 132. Below is a list of five tripeptides identified by their single letter codes. Which tripeptide contains an amino acid capable of forming covalent disulfide bonds? a. FNC b. RGK c. VIL d. MDE e. SYT 133. What are the CORRECT constituents of the α-amino acid? a. central carbon with hydrogen atom, amino group, carboxyl group, R group b. α hydrogen, amino group, carboxyl group, D group c. α carbon, amino group, carboxyl group, R group d. central carbon with hydrogen atom, amide group, carboxyl group, L group e. α carbon, amino group with hydrogen atom, carboxyl group, L group 134. What is NOT a function of amino acids? a. building blocks of proteins b. neurotransmitters c. precursors of nucleic acids d. building blocks of lipids e. precursors of hormones 135. What amino acids are most likely to be found in the core of a water-soluble globular protein?

a. nonpolar b. polar but uncharged c. positively charged d. negatively charged e. random 136. What is the contact distance when two atoms no longer repulse each other yet have the strongest attraction? a. amphipathic b. Brownian c. hydrophobic d. hydrogen e. van der Waals 137. What condition is met when the amount of substrate is far greater than the amount of enzyme present? a. [S] is much less than KM. b. V0 is half of Vmax. c. The enzyme is displaying second-order kinetics. d. The enzyme is displaying first-order kinetics. e. The enzyme is displaying zero-order kinetics.

138. Homotropic effects of allosteric enzymes: a. are due to the effects of substrates. b. are due to the effects of allosteric activators. c. shift the kinetics curve to the left. d. shift the kinetics curve to the right. e. account for the linear nature of the kinetics curve.

139. Sedimentation of a particle isn't affected by: a. mass. b. shape. c. the density of the solution. d. charge. e. size.

140. What would be the base-to-acid ratio of histidine at pH 3? a. 100 b. 1000 c. 0.003 d. 300

e. 0.001 141. What did Emil Fischer suggest? a. induced-fit model b. term "induced fit" c. lock-and-key model d. conformation selection e. term "active site" 142. Recall the structural formula of an amino acid in the dipolar form. Choose the group that is projected behind the page away from the viewer. a. COO– b. NH3 c. R d. H e. C

+

143. What properties rise upon protein purification? a. enzyme activity b. amount of total protein c. specific activity d. bands on the gel electrophoresis e. total activity 144. What is the distance between the nitrogen and carbon atoms in a peptide bond? a. 1.45 Å b. 1.27 Å c. 1.51 Å d. 5.4 Å e. 1.32 Å 145. Peptides differ from proteins in: a. the direction of β strands. b. the number of amino acid residues. c. the three-dimensional structure. d. the primary structure. e. polarity.

146. How many major classes of enzymes are known? a. more than 1000

b. 6 c. 21 d. 65 e. 5 147. What tripeptide is able to accept the largest number of protons at pH 7.4? a. RHN b. HKE c. DQE d. EHD e. DKE 148. What organ in the human body is crucial for blood pH regulation by compensatory respiratory alkalosis? a. heart b. kidneys c. liver d. lungs e. muscles 149. Which is a chiral type of amino acids found in proteins? a. L amino acids b. D amino acids c. zwitterions d. α-amino acids e. polar amino acids 150. What is the ternary complex for the enzyme (E) that converts pyruvate to lactate using NADH as a cosubstrate? a. E (lactate) (NAD+) b. E (NADH) (pyruvate) c. E (pyruvate) (lactate) d. E (NADH) (NAD+) e. E (lactate) (NADH) 151. Which amino acid is often present in the active site of enzymes because of its ability to both donate and accept a proton at a physiological pH? a. arginine b. aspartic acid c. histidine d. glutamine

e. lysine 152. Which type of method allows investigation of molecular heterogeneity? a. homotropic b. ensemble studies c. heterotropic d. in singulo e. cooperative studies 153. You are interested in studying a powerful enzyme that is expressed in low amounts. What technique would you choose to determine how much of it is found in the tissue of interest? a. MALDI-TOF mass spectrometry to determine the protein mass b. ELISA to identify any antigenic determinants c. Amino Acid Composition Analysis because it can be done for the whole protein d. two-dimensional electrophoresis to determine charge and size data of the protein e. salting out to concentrate the protein for further study 154. Proteins with different sedimentation coefficients can be separated by: a. gradient centrifugation. b. differential centrifugation. c. two-dimensional electrophoresis. d. affinity chromatography. e. ELISA. 155. What is proteolysis? a. reaction of functional groups' removal b. oxidation–reduction reactions c. reaction of DNA synthesis d. reaction of DNA replication e. reaction of hydrolysis of a peptide bond 156. Your study group is trying to identify differences in the four levels of protein structure. The secondary structure but not the tertiary structure is stabilized by: a. ionic attractions between oppositely charged side chains. b. H-bonding between polar side chains. c. hydrophobic interactions between nonpolar side chains. d. H-bonding between the oxygen of the backbone carbonyl and the hydrogen of the backbone amine. e. van der Waals forces.

157. The amino acid residue that would MOST likely be buried in the interior of a water-soluble globular protein is:

a. aspartate. b. serine. c. phenylalanine. d. lysine. e. glutamine.

158. Will a reaction take place spontaneously, if ΔG°' is –5,46 kcal mol–1? a. The reaction cannot take place spontaneously. b. The reaction can take place spontaneously. c. The criterion of spontaneity for a reaction is ΔG, not ΔG'. d. The criterion of spontaneity for a reaction is K'eq, not ΔG°'. e. The reaction has stopped.

159. What is the term for the electrostatic interactions between atoms with opposite electrical charges? a. salt bridges b. Brownian motion c. hydrophobic interactions d. hydrogen bonds e. van der Waals interactions 160. Citric acid is an important intermediate in glucose metabolism and is synthesized in the mitochondrial matrix. The pKa values for each of the three carboxylic groups of the citric acid are 3.1, 4.8, and 6.4. What is the charge on a citrate molecule formed in the mitochondrial matrix where the pH is 7.8? a. +3 b. +2 c. –3 d. –2 e. +1 161. Which statement about free energy is INCORRECT? a. A reaction can take place spontaneously only if the free-energy change is positive. b. A reaction cannot take place spontaneously if the free-energy change is positive. c. In a system at equilibrium, there is no net change in the concentrations of the products and reactants, and the free-energy change is zero. d. The free-energy change of a reaction is independent of the path (or molecular mechanism) of the transformation. e. The free-energy change does not signify whether a reaction will proceed at a perceptible rate.

162. Antibodies as reagents are used by: a. western blotting.

b. gradient centrifugation. c. gel electrophoresis. d. ELISA. e. MALDI-TOF. 163. Choose the functional group that CANNOT form a hydrogen bond with water. a. carbonyl group b. amino group c. aromatic ring d. alcohol group e. sulfhydryl group 164. Which amino acids of the portion of the polypeptide AIGHTSM will be hydrogen-bonded to each other in the α helix? a. A-T, I-S, G-M b. A-H, I-T, G-S c. A-G, I-H, G-T d. A-I, G-H, T-S e. A-M, I-S, G-T 165. Water weakens the electrostatic interaction of ions due to its: a. ionic bonds or salt bridges. b. Brownian motion. c. entropy. d. ion product of water. e. dielectric constant.

166. Which of the following is NOT a cofactor? a. Zn2+ b. thiamine pyrophosphate c. coenzyme A d. tetrahydrofolate e. carbonic anhydrase 167. What ensures the accuracy of interaction between enzyme and substrate? a. the intricate three-dimensional structure of the enzyme protein b. the intricate structure of the substrate c. the presence of coenzymes d. the small size of molecules e. the two-dimensional structure of the enzyme protein

168. Calmodulin is a calcium-binding protein expressed in eukaryotic cells. What two techniques would greatly reduce the number of steps to purify calmodulin? a. SDS-PAGE and gel-filtration chromatography b. isoelectric focusing and dialysis c. immunoprecipitation and affinity chromatography d. isoelectric focusing and ion-exchange chromatography e. immunoprecipitation and ion-exchange chromatography 169. A loss of allosteric regulation in the production of purine nucleotides may result in: a. excess nucleotides for DNA. b. a loss of PRS catalytic activity. c. decreased urate degradation. d. a decrease in urate concentration. e. an excess accumulation of urates.

170. Which enzyme of the given metabolic pathway is most likely to be an allosteric enzyme that controls the synthesis of metabolite H?

a. e1 b. e2 c. e3 d. e5 e. e7 171. Which enzyme of the given metabolic pathway is most likely to catalyze a committed step for the synthesis of metabolite D?

a. e1 b. e2 c. e3 d. e4 e. e6

172. A mixture of all components of the cell that do NOT contain intact cells is called: a. a pellet. b. supernatant. c. dialysate. d. centrifugate. e. homogenate.

173. What is ion-exchange chromatography based on? a. separation of proteins by size b. moving a molecule with a net charge in an electric field c. affinity of proteins for specific chemical groups or specific molecules d. separation of proteins by their net charge e. high affinity of the antibody for the proteins 174. Genome rather than proteome: a. is a fixed characteristic of the cell. b. provides a list of gene products that are present in an organism. c. varies with the cell type and developmental stage. d. is influenced by the presence of hormones or inhibitors, or other environmental conditions. e. is the level of functional information, which encompasses the types, functions, and interactions of proteins that yield a functional unit.

175. Whether the reaction will take place or not depends mainly on: a. amount of available substrate. b. intricate structure of the enzyme. c. Gibbs free energy differences. d. presence of coenzyme. e. equilibrium of a system.

176. If you want to get several fractions of decreasing density, each still containing hundreds of different proteins, in a step-by-step fashion what technique would you use? a. gradient centrifugation b. differential centrifugation c. western blotting d. gel electrophoresis e. one of the chromatography methods 177. Which amino acid has a thiol group? a. histidine b. serine

c. cysteine d. tyrosine e. asparagine 178. Which characteristics are usually the first ones to be determined when studying enzyme activity? a. Vmax and KM b. V0 and KM c. Vmax and V0 d. [S] and KM e. Vmax and k2 179. What type of interactions is NOT a weak interaction? a. nuclear interactions b. salt bridges c. van der Waals interactions d. ionic bonds e. hydrogen bonds 180. Enzymes that transfer electrons are called: a. apoenzymes. b. hydrolyases. c. lyases. d. isomerases. e. oxidoreductases.

181. How many neighboring water molecules are hydrogen-bonded on average to one water molecule in a sample of pure water? a. 1.4 b. 2.4 c. 3.4 d. 4.4 e. 5.4 182. Choose the CORRECT statement about the secondary structure of protein. a. Adjacent strands in the parallel β sheet can be formed from the amino acids that are neighbors in the protein sequence. b. Loops and turns are required only to connect β strands while α helices are taking the whole length of the protein. c. Neighboring amino acids can form any possible secondary structure. d. Adjacent strands in the antiparallel β sheet can be formed from the amino acids that are neighbors in

the protein sequence. e. One β strand is stable enough to exist in the protein structure.

183. What group in nucleotide bases is a hydrogen-bond donor? a. N–H b. S–H c. P–O d. C=O e. C–H 184. What determines the rate of reaction? a. free-energy change b. formation of the transition state c. concentration of the enzyme d. free energy required to initiate the conversion of reactants into products e. free energy required to initiate the conversion of products into reactants 185. The relationship between ΔG°' and ΔG is BEST described as: a. determined by the temperature. b. described by changes in Keq. c. differing from standard state to physiological or actual concentrations of reactants and products. d. dependent on the mechanism of the reaction. e. differing only in terms of the types of reactions used for each value.

186. Separation of proteins only by their molecular weight by adding many negative charges to them is allowed by: a. the flow from the cathode to the anode. b. electricity. c. adjusted pH. d. SDS. e. β-mercaptoethanol.

187. What groups of amino acids are linked in the primary sequence? a. β-amino group and α-carboxyl group b. α-amino group and β-carboxyl group c. α-amino group and α-carboxyl group d. α-nitro group and α-carboxyl group e. β-nitro group and β-carboxyl group 188. What is the pH of human blood?

a. 5.5 b. 7.0 c. 9.4 d. 6.4 e. 7.4 189. Two amino acids undergo oxidation to form a dimer called: a. proline. b. glycine. c. cystine. d. tyrosine. e. leucine.

190. Protein purification can be monitored by measuring: a. specific activity and performing SDS-PAGE. b. total activity and performing SDS-PAGE. c. total protein and performing HPLC. d. specific activity and performing two-dimensional electrophoresis. e. total activity and performing HPLC. 191. Judging by the given Lineweaver–Burk plot, identify the concentration of substrate that is required for enzyme A to operate at half of its maximal speed.

a. 0.5 b. –0.5 c. -2 d. 2.5

e. 0.4 192. HCl is a strong acid that is easily and completely hydrolyzed in an aqueous solution. What is the concentration of hydroxyl ions in a 50 mM aqueous HCL solution? a. 2 × 10–7 M b. 5 × 10–6 M c. 2 × 10–12 M d. 2 × 10–13 M e. 5 × 10–4 M 193. What helices are energetically more favorable? a. right-handed b. counterclockwise c. left-handed d. twisted ribbons e. disulfide-bonded 194. The maximal binding energy is released when the: a. Gibbs free energy is negative. b. Gibbs free energy is positive. c. energy of the substrate and of the product are different. d. α-carbon atom of the inhibitor is trigonal. e. substrate is in the transition state.

195. Recall the structural formula of an amino acid in the dipolar form. Choose the group that is coming out of the plane of the page toward the viewer. a. COO– b. NH3 c. R d. C e. H

+

196. What is the most common protease used in sample preparation for a MALDI-TOF assay? a. pepsin b. papain c. trypsin d. thrombin e. carboxypeptidase A

197. What bonds does thrombin hydrolyze? a. bonds only on the carboxyl side of lysine and arginine residues b. lysine–arginine bonds in particular peptide sequences c. arginine–glycine bonds in particular peptide sequences d. lysine–glycine bonds in particular peptide sequences e. any peptide bonds 198. Choose only the aromatic amino acids. a. Phe, Trp, Ser b. Trp, Tyr, Ile c. Tyr, Phe, His d. Phe, Tyr, Leu e. Trp, Phe, Val 199. What does "spontaneously" mean in the context of thermodynamics? a. The reaction will take place with the input of free energy. b. The reaction does not release energy. c. The reaction will take place when ΔG is zero. d. The reaction depends only on the free energy of the products. e. The reaction will take place without the input of energy.

200. How can the reciprocal plot of initial velocity NOT be applied? a. When it is half the maximal speed, the substrate concentration equals KM. b. It gives a way to define KM when it is plotted against the reciprocal of the substrate concentration. c. When it is plotted against the reciprocal of the substrate concentration, it allows KM/Vmax to be defined as a slope of the graph. d. It allows definition of the reciprocal of the maximal velocity in a double-reciprocal plot. e. It is part of the Lineweaver–Burk equation.

201. Choose the correct name for the plot of pH changes in a weak acid solution under stepwise addition of a strong acid or base. a. van der Waals curve b. Michaelis–Menten curve c. Henderson–Hasselbalch curve d. compensatory respiratory alkalosis curve e. titration curve 202. The protein that interacts with both water and the hydrophobic regions of the membrane is considered: a. polar. b. nonpolar.

c. amphibious. d. anabolic. e. amphipathic.

203. Nonpolar molecules in water: a. dissolve independently. b. aggregate together. c. precipitate. d. dissociate to ions. e. form hydrogen bonds with water molecules.

204. What is TRUE regarding gel filtration chromatography and PAGE? a. In both, small proteins move most rapidly. b. In both, large proteins move most rapidly. c. In PAGE, large proteins move most rapidly but in gel filtration, small proteins move most rapidly. d. In gel filtration, large proteins move most rapidly but in PAGE, small proteins move most rapidly. e. In both, proteins are always in their native structure.

205. If the enzyme concentration is 5 nM, the substrate concentration is 5 mM, and KM is 5 μM: a. the enzyme will be saturated with the substrate. b. most of the enzyme won't have the substrate bound. c. there will be more enzyme than substrate. d. the enzyme will be displaying first-order kinetics. e. the rate of the reaction will be half its maximal value.

–

206. What is the [A ]/[HA] ratio when a weak acid is in a solution two pH units below its pKa? a. 1:100 b. 1:10 c. 10:1 d. 2:1 e. 1:2 207. What does polarity mean? a. ends of a polypeptide chain have different charges of the carboxyl group b. ends of a polypeptide chain always have different amino acid residues c. ends of an amino acid residue can link only the same amino acid residue d. a polypeptide chain has the amino-terminal residue and the carboxyl-terminal residue e. a polypeptide chain has the amino-terminal residue with a different charge 208. The largest number of individual proteins from a mixture is separated by:

a. affinity chromatography. b. molecular exclusion chromatography. c. ion-exchange chromatography. d. gel filtration. e. high-pressure liquid chromatography.

209. How much weaker are hydrogen bonds as compared to covalent bonds? a. from 2 to 10 times b. from 20 to 50 times c. from 100 to 1000 times d. from 1000 to 10,000 times e. from 10,000 to a million times 210. What is the reaction order if the reaction rate was increased by a factor of 4 by doubling the reactant concentration? a. zero order b. first order c. second order d. pseudo-first order e. pseudo-second order 211. What technique is used to remove salt from a solution? a. gel electrophoresis b. salting out c. dialysis d. centrifugation e. fractioning –

212. What is the [A ]/[HA] ratio when a weak acid is in a solution one pH unit above its pKa? a. 1:1 b. 1:10 c. 10:1 d. 2:1 e. 1:2 213. An enzyme has specificity constant values of 1.0 × 103, 1.1 × 104, and 4.0 × 10–1 for compounds A, B, and C, respectively. For which compound does the enzyme have a higher efficiency and why? a. Compound C; a low kcat value accounts for the high and specific rate of catalysis, while a high KM value lowers the required concentration of the compound. b. Compound B; a high KM value accounts for the high and specific rate of catalysis, while a low kcat

value lowers the required concentration of the compound. c. Compound A; higher kcat accounts for the high and specific rate of catalysis, while a low KM value lowers the required concentration of the compound. d. Compound C; the least amount of the compound is required to saturate the enzyme, while having the highest rate of catalysis. e. Compound B; the least amount of the compound is required to saturate the enzyme, while having the highest rate of catalysis.

214. Judging by the given scheme of two metabolic pathways where en denotes different enzymes, give the name of interactions that regulate the function of these pathways in a coherent fashion.

a. K inhibits e1 and e10 while F inhibits e1, and I inhibits e10. b. F and I inhibit e1 and e10, respectively, and stimulate e10 and e1, respectively, whereas K inhibits e1 and e10. c. F stimulates e10 and I stimulates e1 while K inhibits e1 and e10. d. K stimulates e1 and e10 while F inhibits e1, and I inhibits e10. e. F and I stimulate e1 and e10, respectively, and inhibit e10 and e1, respectively, whereas K inhibits e1 and e10.

215. How does Coulomb's energy depend on the distance (r) between the two interacting corpuscles? a. directly proportional to r b. directly proportional to r2 c. inversely proportional to r d. inversely proportional to r2 e. directly proportional to 2r 216. What factor does NOT affect electrostatic interaction according to Coulomb's law? a. the charges on the two interacting atoms b. a change in entropy if the interaction occurs c. the distance between the two interacting atoms d. the dielectric constant of the medium e. presence and concentration of other charged corpuscles in the medium

217. The Michaelis constant: a. depends on the concentration of the enzyme. b. displays the maximal rate of the reaction, when it is much less than the substrate concentration. c. describes the properties of the enzyme. d. displays the maximal rate of the reaction, when it is equal to the substrate concentration. e. displays zero-order kinetics, when the it is equal to the substrate concentration.

218. What is the molar concentration of water in pure water? a. 1 M b. 100 M c. 55.5 M d. 5.55 M e. 1 mM 219. Amino acids can contain all of the following functional groups EXCEPT: a. indole. b. thioester. c. phenyl. d. sulfhydryl. e. amine.

220. Why is the peptide bond planar? a. Bulky side chains prevent free rotation around the bond. b. It exhibits partial double-bond character, preventing rotation. c. Hydrogen bonding between the NH and C=O groups limits movement. d. The bond can have either cis conformation or trans conformation. e. It has different peptide bonds.

221. What is the amount of energy needed to apply a 1-newton force over a distance of 1 angstrom? a. 1010 J b. 10–10 J c. 1 J d. 10 J e. 1 kcal 222. Which statement about the role of functional groups of amino acids is FALSE? a. A narrow range of functional groups provides for the broad spectrum of protein function. b. Most of the properties of amino acids are conferred by functional groups. c. Functional groups are easier to identify in stereochemical renderings. d. A wide range of functional groups provides for the broad spectrum of protein function.

e. Under physiological conditions, at least two functional groups of amino acids are charged.

223. Tris buffers are commonly used in biochemistry because they buffer within the physiological range of pH due to a pKa of 8.1. What is the [A–]/[HA] ratio in a 0.1 M tris solution with pH 9.1? a. 1:100 b. 1:10 c. 10:1 d. 2:1 e. 1:2 224. Which technique CANNOT be used for quantitative analysis? a. gradient centrifugation b. ELISA c. enzyme assay d. SDS-PAGE e. chromatography 225. Riboflavin is a water-soluble organic substance that is not synthesized by humans. Metabolically, it is converted into a substance called flavin adenine dinucleotide, which is required by succinate dehydrogenase.

Choose the correct statement. a. Riboflavin is a coenzyme. b. Flavin adenine dinucleotide is a vitamin. c. Succinate dehydrogenase is a coenzyme. d. Flavin adenine dinucleotide is a coenzyme. e. Riboflavin is an enzyme catalyzing formation of succinate dehydrogenase.

226. What is the regularly repeating part of a polypeptide called? a. the distinctive side chain b. a variable part c. a peptide d. the backbone e. an oligopeptide 227. How many hydrogen bonds should be present within the antiparallel β sheet that curls into a closed barrellike structure if overall it has 8 β strands each 5 amino acids long? Do not consider the bonds that should be present in turns between the strands. a. 10 b. 30 c. 36 d. 44 e. 80

228. What is the consequence of a high KM value of an enzyme? a. Moderate concentration of the substrate will be enough for maximal enzyme activity. b. This enzyme has high maximal velocity. c. The enzyme is present in a large concentration in the cell. d. High concentration of the substrate should be reached for maximal enzyme activity. e. The velocity will be directly proportional to the substrate concentration.

229. Name the secondary structure shown in the figure

a. α helix b. reverse turns c. β sheet d. parallel β sheet e. mixed β sheet 230. What is the reason for the edema in kwashiorkor? a. insufficient protein in the blood plasma b. distorted hydrophilicity of the protein c. distorted distribution of water within capillaries d. disrupted hydrophobic effect e. excessive protein in the blood plasma 231. Which reactions proceed with an input of energy? a. exergonic b. isomerization c. oxidation–reduction d. enzyme-catalyzed

e. endergonic 232. The technique that obtains the isolation of the protein of interest from the thousands of other proteins in the cell is called: a. salting out. b. purification. c. precipitation. d. dialysis. e. exclusion.

233. Typical van der Waals energies are about: a. 4–20 kJ/mol. b. 2–4 kJ/mol. c. 200–400 kJ/mol. d. 2–4 J/mol. e. 200–400 MJ/mol.

234. Two-dimensional electrophoresis is a combination of what two techniques? a. isoelectric focusing and affinity chromatography b. ion-exchange chromatography and SDS-PAGE c. affinity chromatography and SDS-PAGE d. isoelectric focusing and SDS-PAGE e. isoelectric focusing and ion-exchange chromatography 235. What is the typical length of noncovalent bonds? a. 0.4 angstroms b. 4 angstroms c. 40 angstroms d. 4 nm e. 0.04 nm 236. Choose the FALSE statement about protein electrophoresis. a. The gel serves as a molecular sieve that enhances separation. b. The distance and speed that a protein moves depend on its shape. c. Small proteins move rapidly through the gel. d. The proteins in the gel can be visualized by staining them with silver. e. It is performed in a thin, horizontal slab of polyacrylamide.

237. The transition state means that: a. more product will be formed faster. b. more molecules have the energy required to reach the product.

c. fewer molecules have the energy required to reach the transition state. d. more molecules of the transition state will form more substrate. e. more molecules of the enzyme are needed.

238. What technique can be used to determine the size of a target protein? a. Edman degradation b. affinity chromatography c. western blot d. ELISA e. isoelectric focusing gel 239. What are small organic molecules that contribute to the catalytic activity of many enzymes and are derived from vitamins? a. cofactors b. coenzymes c. helper groups d. holoenzymes e. apoenzymes 240. Two proteins are similar in the number of acidic and basic amino acids but significantly differ in size.

What technique would be BEST suited for separating these two proteins? a. SDS-PAGE and gel-filtration chromatography b. isoelectric focusing and dialysis c. immunoprecipitation and affinity chromatography d. isoelectric focusing and ion-exchange chromatography e. isoelectric focusing and affinity chromatography 241. Oxygen is an electronegative atom. That means that in a molecule of water the: a. electrons of covalent bonds spend more time near the oxygen atom than near the hydrogen atoms. b. electrons of covalent bonds spend more time near the hydrogen atoms than near the oxygen atom. c. electrons of bonds are located closely to the hydrogen atoms. d. electrons of bonds are located closely to the oxygen atom. e. bonds joining the hydrogen atoms to the oxygen atom are noncovalent.

242. Which constant represents the nature of the enzyme–substrate interaction? a. specificity constant b. constant of the catalysis rate c. Michaelis constant d. rate constant k1 e. allosteric constant

243. Why does the interaction of a transition-state analogue with the enzyme take place? a. Compounds are more tightly bound to the transition state. b. The structure of some atoms of a transition state analogue is similar to the structure of transition-state atoms. c. The energy between the substrate and the product is different. d. The full complement of interactions is formed only when the substrate is in the transition state. e. The substrate may bind only to certain conformations of the transition-state analogue.

244. Which statement about enzyme kinetics is TRUE? a. Michaelis–Menten enzymes have sophisticated regulatory properties. b. The kinetic description of enzymatic activity is required to understand the structure of enzymes. c. The action of allosteric enzymes increases the metabolic chaos. d. Allosteric enzymes allow the efficient integration of metabolism. e. All enzymes obey Michaelis–Menten kinetics.

245. For enzymes, the assay is a measure of: a. total protein. b. total enzyme. c. enzyme activity. d. specific activity. e. total activity.

246. Allosteric effectors alter the equilibrium between the: a. ES state. b. R and T forms of a protein. c. forward and reverse reaction rate. d. formation of the product and its reverse reaction. e. concentration thresholds.

247. Van der Waals interactions do not depend on: a. the distance between the two interacting atoms. b. the distribution of electrons around the nuclei. c. the presence of other charged corpuscles in the medium. d. a transient asymmetry in electrical charge of atoms. e. the geometry of the large molecules.

248. What is a helix-turn-helix motif? a. supersecondary structure in which an α helix is separated from another α helix by a turn b. supersecondary structure in which a β sheet is separated from a helix by a turn c. secondary structure in which two right-handed α helices are intertwined

d. secondary structure in which two left-handed α helices are intertwined e. secondary structure in which an α helix is separated from a β sheet by a loop 249. What does it mean that liquid water has a partly ordered structure? a. There are van der Waals interactions between water molecules. b. Hydrogen-bonded clusters of molecules are continually being formed and broken apart in liquid water. c. In the physiological range of temperatures liquid water can undergo phase transition to gas that is completely unordered and to ice that is completely ordered. d. There is Brownian motion of water molecules. e. Water molecules can form hydrogen bonds with polar molecules but not with nonpolar molecules.

250. In a Ramachandran plot: a. the values of 0 to +180 for the angle of the N–αC bond and of 0 to –180 for the angle of the αC–C bond are strongly disfavored. b. the φ angle is positive if the amino group is rotated to the left from the α carbon. c. only a small part of conformations is sterically excluded because two atoms cannot be in the same place at the same time. d. clockwise rotations of the torsion angles correspond to the negative values. e. the ψ angle corresponds to the bond between the amino group and α carbon.

251. Which amino acid is important for providing components for the TCA cycle? a. glycine b. glutamine c. lysine d. glutamate e. arginine 252. Which amino acids have a branched side chain? a. Val, Leu, Met b. Ile, Leu, Ala c. Ala, Ile, Pro d. Leu, Gly, Val e. Ile, Leu, Val 253. What tripeptide is able to accept the least number of protons at pH 11? a. RHN b. HKE c. DQE d. EHD e. DKE

254. What amino acid contains a thioether bond? a. serine b. threonine c. cysteine d. isoleucine e. methionine 255. What is the mechanism of action of a hydrolyase? a. shuffling of amine groups between donor and acceptor molecules b. transfer of water molecules in aerobic conditions c. addition of atoms or functional groups d. addition of water e. addition of oxygen 256. Which amino acid contains a guanidinium functional group? a. alanine b. lysine c. histidine d. arginine e. asparagine 257. Calculate the turnover number for the enzyme if its Mr is 75,000 and if by assaying 5 μg of the enzyme under saturating [S] concentrations, you determine that Vmax is approached asymptotically and is equal to 1.68 μmol/sec. a. 2.25 × 106 sec–1 b. 1.50 × 105 sec–1 c. 2.50 × 105 sec–1 d. 2.52 × 104 sec–1 e. You also need to know KM for this enzyme to calculate the turnover number.

258. Which ionizable group has the lowest affinity for protons? a. asparagine side chain group b. aspartic acid side chain group c. terminal α-amino group d. glutamic acid side chain group e. terminal α-carboxyl group 259. What tertiary structure does myoglobin have? a. eight β sheets and α helices, turns and loops

b. eight α helices, turns and loops between helices, and heme group c. eight β sheets, turns and loops between helices, and heme group d. seven β sheets, turns and loops between helices e. seven α helices, turns and loops between helices 260. A denatured protein is a protein: a. devoid of enzymatic activity. b. with destroyed noncovalent bonds. c. in which the disulfides are fully converted into sulfhydryls. d. that was treated with β-mercaptoethanol. e. that has been transformed into a random coiled peptide incapable of normal activities.

261. What would be the interactions between side chains of aspartate and arginine at a neutral pH? a. hydrophobic b. ionic c. hydrogen bonding d. steric e. covalent 262. What is the premise of the Michaelis–Menten equation that is achieved by assuming equal rates of formation and breakdown of the ES complex? a. no-reverse-reaction assumption b. investigating the reaction at time close to zero c. steady-state assumption d. assumption of emanations e. equilibrium assumption 263. In the study of a new protein, you have observed the existence of several distinct stable conformations of the protein depending on presence or absence of other proteins in the solution. One form is 100% α helical, another contains about 75% α helices, and for the third one half of the protein had no distinctive secondary elements. Explain the results of your study. a. Most if not all of the forms are intermediates of the native protein. b. The protein should belong to the IDP class and is most likely involved in some signaling pathway. c. An intrinsically disordered form of the protein should have been present in the absence of any other protein, while in the presence of some other protein the folding should have proceeded as implied by the model of molten globule. d. The protein doesn't adhere to the paradigm of the folding funnel, and the existence of several forms strongly implies that the protein belongs to the metamorphic proteins. e. The protein doesn't adhere to the paradigm of the folding funnel, and the intrinsically disordered structure implies that this protein is metamorphic.

264. Choose the molecule around which in an aqueous solution water molecules are most ordered. a. alcohol b. aliphatic amino acid c. aromatic amino acid d. hydrocarbon chain e. carboxylic acid 265. Which amino acids are positively charged at a neutral pH? a. lysine and arginine b. histidine and arginine c. cysteine and arginine d. lysine and proline e. glutamine and histidine 266. What is the distinction between coenzymes and a normal substrate? a. Coenzymes are often derived from vitamins. b. Coenzymes can be subdivided into two groups, but substrates form only one group. c. Normal substrates are used by a variety of enzymes. d. An enzyme without its coenzyme is referred to as an apoenzyme; an enzyme with its substrate is called a holoenzyme. e. A coenzyme is a large molecule, and a substrate is a small molecule.

267. Which type of experiment allows simultaneous studying of millions of enzyme molecules? a. ensemble studies b. cooperative studies c. in singulo d. homotropic e. heterotropic 268. How many molecules can carbonic anhydrase hydrate per second and what are these molecules? a. 10 molecules of water b. 105 molecules of oxygen c. 106 molecules of carbon oxide d. 106 molecules of carbon dioxide e. 10 molecules of carbon dioxide 269. What technique is used to separate proteins by their net charge? a. molecular exclusion chromatography b. ion-exchange chromatography c. two-dimensional electrophoresis

d. ELISA e. immunoprecipitation 270. What does conformation selection mean? a. the mechanism of catalysis b. binding of a substrate only to certain conformations of the enzyme c. interaction of an enzyme and the substrate by means of short-range forces d. a process of dynamic recognition e. the general rule that polar residues are located on the surface of proteins 271. What is the term for the subset of gene products actually expressed by a cell? a. genomics b. metabolome c. genome d. Svedberg e. proteome 272. In which part of a globular protein are Trp and Phe located and why? a. exterior due to the hydrophilic effect b. interior due to the hydrophobic effect c. exterior forming polar H bonds with water d. interior forming ionic bonds with other amino acids e. exterior forming ionic polar bonds with water 273. Differential centrifugation rather than gradient centrifugation: a. is referred to as ultracentrifugation. b. doesn't depend of the shape of the particle. c. requires the formation of a density gradient in a centrifuge tube. d. can use radioactivity marks to determine the receptor from the fraction. e. applies the harvesting of the separated bands of protein, collecting them drop by drop.

274. Molecular exclusion chromatography is a technique of protein separation according to: a. size. b. isoelectric point. c. binding affinity. d. charge. e. definition of individual proteins.

275. is the least stable and most seldom-occurring along the reaction pathway, and has the highest free energy. a. Activation energy

b. Transition state c. Cofactor d. Coenzyme e. Apoenzyme 276. What technique helps to determine amino acid sequence by removing one amino acid at a time from the amino end of a peptide? a. Edman degradation b. specific cleavage c. peptides overlapping d. electrospray ionization e. MALDI-TOF 277. What is the difference in length between a typical hydrogen bond and a covalent bond? a. They are equal in length. b. A hydrogen bond is somewhat shorter than a covalent bond. c. A hydrogen bond is much shorter than a covalent bond. d. A hydrogen bond is somewhat longer than a covalent bond. e. A hydrogen bond is much longer than a covalent bond.

278. In which order will proteins A (55 kDa), B (60 Da), and C (50,000 Da) emerge from the column upon molecular exclusion chromatography? a. A → B → C b. A → C → B c. B → A → C d. B → C → A e. C → A → B 279. Hydrophobic molecules are driven together by: a. entropy. b. enthalpy. c. van der Waals interactions. d. affinity. e. hydrogen bonds.

280. What technique significantly increases the resolving power of protein purification? a. salting out b. gel electrophoresis c. ion-exchange chromatography d. high-pressure liquid chromatography

e. affinity chromatography Indicate one or more answer choices that best complete the statement or answer the question.

281. Which statements about the polypeptide Gly-Tyr-Gly-Phe-Met-Ser are CORRECT? Select all that apply. a. Glycine is the C-terminal residue. b. Serine is the N-terminal residue. c. Serine is the C-terminal residue. d. Methionine is the N-terminal residue. e. Glycine is the N-terminal residue.

282. What thermodynamic properties does one need to consider in order to understand how enzymes operate?

Select all that apply. a. The free energy of a reaction depends on the molecular mechanism of transformation. b. The free-energy change determines whether the reaction will take place spontaneously. c. The free energy signifies whether a reaction will proceed at a perceptible rate. d. The free-energy difference between the products and the reactants. e. The free energy required to initiate the conversion of reactants into products.

283. Which statements describe sandwich ELISA? Select all that apply. a. First, the antibody to a particular antigen is adsorbed to the bottom of a well. b. The production of color indicates the amount of an antibody to a specific antigen. c. This technique is used in tests for HIV infection. d. The detection antibody with an enzyme linked to it binds to a specific antibody. e. It is a quantitative method that permits the measurement of small quantities of an antigen.

284. What does the free-energy change (ΔG) depend on? Select all that apply. a. concentration of the reactants b. gas constant and absolute temperature c. concentration of water d. nature of the reactants e. concentration of enzymes 285. What structures did Pauling and Corey predict in 1951? Select all that apply. a. α helix b. β sheet c. turns between β sheets d. loops between α helices e. β strand 286. Which of the following proteins contains examples of the α-helical character? Select all that apply.

a. keratin b. ferritin c. myosin d. tropomyosin e. CD4 287. Which amino acids contain reactive aliphatic hydroxyl groups? Select all that apply. a. serine b. threonine c. methionine d. cysteine e. alanine 288. Select all that apply. An intermediate product of protein purification is: a. crude supernatant extract. b. crude pellet extract. c. homogenate. d. supernatant extract. e. dialysate.

289. Which amino acids with ionizable groups have a typical pKa value higher than 10? Select all that apply. a. lysine b. cysteine c. tyrosine d. arginine e. histidine 290. Select all that apply. Enzyme-linked immunosorbent assay: a. uses an enzyme, noncovalently linked to a specific antibody, that reacts with a colorless substrate to produce a colored product. b. is used in tests for HIV infection. c. is devoted to only two types. d. can detect less than 10–9 g of a protein. e. can be performed only with polyclonal antibodies.

291. What types of interactions are in the quaternary structure? Select all that apply. a. disulfide bonds b. ionic bonds c. hydrogen bonds d. peptide bonds

e. van der Waals forces 292. Which amino acid side chains are capable of ionization? Select all that apply. a. aspartate b. histidine c. serine d. alanine e. tyrosine 293. Select all that apply. Human hemoglobin: a. is the oxygen-carrying protein in mitochondria. b. exists as an α2β2 tetramer. c. consists of α helices and β sheets. d. contains heme groups. e. has a tertiary structure.

294. Select all that apply. In isoelectric focusing: a. proteins migrate to the location at which they have no net charge. b. the pH of a gel depends on the isoelectric point of the protein. c. a gel for isoelectric focusing contains SDS. d. a mixture of proteins with the same isoelectric point is subjected to electrophoresis. e. the isoelectric point (pI) of a protein is the pH at which its net charge is zero.

295. Interactions between these amino acids are parts of the driving force for protein folding. Choose all correct answers. a. Ile and Trp b. Ser and Tyr c. Trp and Met d. Phe and Gly e. Val and Thr 296. What are noncovalent interactions between the enzyme and the substrate mediated by? Select all that apply. a. hydrogen bonds b. hydrophobic effect c. transition state d. van der Waals forces e. electrostatic interactions Enter the appropriate word(s) to complete the statement.

297. The amino acid with the smallest-size side chain allowing greatest flexibility in a protein is 298. Compact globular units, called

.

, are polypeptide chains folded into two or more compact regions.

299. The sedimentation coefficient is expressed in 300. A reaction can occur spontaneously only if ΔG is

units. .

Answer Key 1. c 2. c 3. e 4. a 5. a 6. c 7. b 8. b 9. e 10. d 11. e 12. d 13. e 14. b 15. c 16. b 17. d 18. c 19. d 20. a 21. b 22. a 23. c

25. b 26. b 27. d 28. d 29. d 30. a 31. c 32. e 33. b 34. d 35. a 36. a 37. a 38. d 39. d 40. c 41. b 42. c 43. e 44. a 45. d 46. d 47. c

Test Bank for Biochemistry: A Short Course, 4e by John Tymoczko, Jeremy Berg, Gregory Gatto, Lubert Stryer (All Chapters) ch 1 to 7 48. d 49. c 50. e 51. e 52. b 53. b 54. e 55. c 56. b 57. e 58. b 59. e 60. a 61. a 62. d 63. b 64. e 65. b 66. a 67. e 68. c 69. c 70. d 71. e

72. b 73. c 74. e 75. d 76. d 77. c 78. e 79. d 80. d 81. e 82. a 83. b 84. d 85. b 86. a 87. d 88. d 89. c 90. b 91. a 92. d 93. b 94. c 95. c

96. e 97. b 98. c 99. d 100. b 101. a 102. d 103. b 104. a 105. c 106. a 107. b 108. a 109. d 110. b 111. d 112. a 113. b 114. c 115. e 116. c 117. c 118. a 119. a

120. d 121. e 122. e 123. a 124. b 125. a 126. a 127. c 128. e 129. b 130. c 131. c 132. a 133. a 134. d 135. a 136. e 137. e 138. a 139. d 140. e 141. c 142. d 143. c

144. e 145. b 146. b 147. d 148. d 149. a 150. e 151. c 152. d 153. b 154. b 155. e 156. d 157. c 158. c 159. a 160. c 161. a 162. d 163. c 164. a 165. e 166. e 167. a

168. c 169. e 170. e 171. c 172. e 173. d 174. a 175. c 176. b 177. c 178. a 179. a 180. e 181. c 182. d 183. a 184. d 185. c 186. d 187. c 188. e 189. c 190. a 191. a

192. d 193. a 194. e 195. c 196. c 197. c 198. c 199. e 200. a 201. e 202. e 203. b 204. d 205. a 206. a 207. d 208. e 209. b 210. c 211. c 212. c 213. e 214. b 215. d

216. b 217. b 218. c 219. b 220. b 221. b 222. a 223. c 224. a 225. d 226. d 227. c 228. d 229. e 230. a 231. e 232. b 233. b 234. d 235. b 236. e 237. a 238. c 239. b

240. a 241. a 242. c 243. b 244. d 245. c 246. b 247. c 248. a 249. b 250. a 251. b 252. e 253. a 254. e 255. d 256. d 257. d 258. e 259. b 260. e 261. b 262. c 263. b

264. d 265. a 266. a 267. a 268. d 269. b 270. b 271. e 272. b 273. b 274. a 275. b 276. a 277. d 278. b 279. a 280. d 281. c, e 282. d, e 283. a, e 284. a, d 285. a, b 286. a, b, c, d 287. a, b

288. b, d 289. a, c, d 290. a, c, e 291. b, c, e 292. a, b, e 293. b, d 294. a, e 295. a, c 296. a, d, e 297. glycine 298. domains 299. Svedberg 300. negative

Name:

Class:

Date:

ch 8 - 13 Indicate the answer choice that best completes the statement or answers the question.

1. Choose the CORRECT combination of type of membrane receptor and example of the receptor. a. seven-transmembrane-helix receptor; growth-hormone receptor b. dimeric receptors that recruit protein kinases; insulin receptor c. dimeric receptors that are protein kinases; insulin receptor d. dimeric receptors that recruit protein kinases; β-adrenergic receptor e. dimeric receptors that are protein kinases; growth-hormone receptor 2. Which carbon atoms are involved in the formation of α-D-fructopyranose? a. C-1 aldehyde group and C-5 hydroxyl group b. C-2 aldehyde group and C-6 hydroxyl group c. C-1 keto group and C-5 hydroxyl group d. C-2 keto group and C-6 hydroxyl group e. C-2 keto group and C-5 hydroxyl group 3. What is the kinetical hallmark of reversible noncompetitive inhibition? a. Vmax cannot be attained, even at high substrate concentrations. b. Vmax can be attained at sufficiently high concentrations of substrate. c. The apparent value for KM lowers as more inhibitor is added. d. The apparent value for KM remains unchanged as more inhibitor is added, while Vmax decreases. e. KM increases as more inhibitor is added.

4. What is the first step of the action potential? a. The flow of K+ out of the cell. b. The flow of Na+ out of the cell. c. The flow of K+ into the cell. d. The flow of Na+ into the cell. e. A low conductance for K+.

5. A(n) in the chain length will result in formation of chains and a(n) of the melting point. a. decrease; more; increase b. increase; more; increase c. increase; less; decrease d. decrease; more; decrease e. increase; less; increase 6. What are the products of the reaction of invertase? a. α-D-glucopyranose and β-D-glucopyranose

van der Waals interactions between the

Name:

Class:

Date:

ch 8 - 13 b. α-D-glucopyranose and β-L-fructopyranose c. β-D-glucopyranose and α-L-galactopyranose d. α-D-glucopyranose and β-D-fructofuranose e. β-D-fructofuranose and α-L-glucopyranose 7. The enzyme responsible for induction of the phosphoinositide cascade is: a. phospholipase C. b. phospholipase A. c. C-dependent protein (CDP). d. inositol triphosphate. e. adenylate cyclase.

8. The MOST fluid would be a bilayer made of lipids with: a. polyunsaturated 18-carbon fatty acids. b. saturated 18-carbon fatty acids. c. saturated 16-carbon fatty acids. d. polyunsaturated 16-carbon fatty acids. e. one double bond in 18-carbon fatty acids.

9. Which statement is consistent with the structure of biological membranes? a. All membrane proteins are integral and associate with the hydrophobic region of the membrane. b. Both proteins and lipids readily undergo transverse ("flip-flop") diffusion from the inside to the outside of the membrane. c. Membranes are symmetric. d. The membrane lipids self-assemble to form the lipid bilayer. e. A biological membrane consists of proteins sandwiched between two layers of lipids, which is referred to as a lipid bilayer.

10. How would the action potential on a neuron in the resting state change if all of the sodium ion channels were blocked? a. action potential wouldn't be generated or propagated b. no change in the action potential c. threshold for the action potential would decrease d. action potential would only be propagated e. threshold for the action potential would increase 11. What is an alcohol component in cerebroside? a. glycerol b. ethanolamine c. inositol d. sphingosine e. choline

Name:

Class:

Date:

ch 8 - 13 12. What determines the specificity of chymotrypsin? a. interaction of the active site amino acids with the substrate b. binding of the N-terminus amino acid at the active site c. covalent binding of a His residue to the substrate d. conformational change upon binding of the substrate e. binding of the proper amino acid into a deep hydrophobic pocket on the enzyme 13. What is a result of a genetic disorder in which the α chain of hemoglobin is NOT produced in sufficient quantities? a. α-thalassemia b. β-thalassemia c. Cooley anemia d. sickle-cell anemia e. a decrease in oxygen-binding affinity 14. Some tumor cells become more sensitive to a range of drugs as they become resistant to only one drug because they: a. obtain P-glycoprotein that transports different drugs inside the cell. b. obtain the multidrug-resistance protein that transports different drugs from the cell. c. have more ATP-binding cassettes than other cells. d. have mutated the ATP-regulated chloride channel. e. obtain the MDR ion channel that transports different drugs from the cell.

15. What factor influences the binding of oxygen to myoglobin?

–

a. the concentration of bicarbonate ions, HCO3 b. the partial pressure of oxygen, pO2 c. the concentration of hemoglobin present in the tissue d. the concentration of 2,3-bisphosphogycerate e. the concentration of the cooperative effect 16. The longer is the fatty acid, the a. more oxidized b. lower the melting point of c. more double bonds d. more reduced e. higher the melting point of

the fatty acid is/has.

17. Which role does the membrane play by separating the cell interior from the exterior and cell compartments from the cell interior? a. an open boundary b. lipid vesicle

Name:

Class:

Date:

ch 8 - 13 c. self-assembled structure d. an interface e. hydrophobic interior 18. What type of transport can proceed against a concentration gradient? a. simple diffusion b. passive transport c. active transport d. facilitated diffusion e. lateral diffusion 19. The process of has never been observed. a. lateral diffusion of proteins b. transverse diffusion of proteins c. lateral diffusion of lipids d. transverse diffusion of lipids e. passive diffusion of molecules through the membrane 20. What is a term for hydrophobic groups that are covalently attached to proteins and tether them to the membrane? a. lipid linkages b. membrane modifications c. membrane linkages d. membrane anchors e. membrane bonds 21. The anomer of α-D-glucopyranose is a.

b.

c.

Name:

Class:

ch 8 - 13 d.

e.

22. What is the main storage form of fatty acids? a. micelles b. liposomes c. triacylglycerols d. phospholipids e. glycolipids 23. What carbon atom from the carboxyl terminus of a fatty acid is often referred to as β? a. 1 b. 2 c. 3 d. 4 e. the last carbon atom in the chain 24. What is the evidence that myoglobin binds oxygen in a noncooperative manner? a. sigmoidal shape of the oxygen-binding curve b. hyperbolic shape of the oxygen-binding curve c. saturation level of the oxygen-binding curve d. the speed of oxygen binding at high pO2 e. the speed of oxygen binding at moderate pO2 25. What is a protease enzyme with an optimum at pH 1–2? a. phosphofructokinase b. collagenase c. tyrosinase d. chymotrypsin e. pepsin 26. Which carbon atoms are involved in the formation of α-D-fructofuranose? a. C-1 aldehyde group and C-5 hydroxyl group b. C-2 aldehyde group and C-6 hydroxyl group c. C-1 keto group and C-5 hydroxyl group

Date:

Name:

Class:

Date:

ch 8 - 13 d. C-2 keto group and C-6 hydroxyl group e. C-2 keto group and C-5 hydroxyl group 27. Valinomycin is an amphipathic antibiotic that is capable of facilitating diffusion of potassium ions because it can effectively replace the solvation shell of the ion while being able to diffuse through the plasma membrane. What would happen in the thought experiment if all of the potassium ion channels were blocked and valinomycin was added to the cells immediately after? Consider that the experiment is performed on neurons in the resting state and other ion channels are intact. a. K+ would be transported inside the neuron, which would increase its resting potential. b. K+ wouldn't be transported in any direction; thus, no change in the resting potential would be observed. c. K+ would be transported from the neuron, which would increase the resting potential. d. K+ would be transported inside the neuron, which would decrease its resting potential. e. K+ would be transported from the neuron, which would decrease the resting potential.

28. In the double-reciprocal plot of the rate of catalysis, the intercept with the x axis is unchanged in the presence and in the absence of the inhibitor. Choose the correct type of inhibitor. a. irreversible b. competitive c. uncompetitive d. noncompetitive e. The data are not enough to determine the type.

29. What group of living things contains in its cell membranes lipids with ether rather than ester linkages between the fatty acid chains and a glycerol backbone? a. fungi b. archaea c. bacteria d. mycoplasma e. eukaryotes 30. What functional group are polar head groups of phospholipids esterified to? a. methyl b. phosphate c. ketone d. thiol e. aldehyde 31. What compound is an irreversible group-specific inhibitor? a. sulfanilamide b. p-aminobenzoic acid (PABA)

Name:

Class:

Date:

ch 8 - 13 c. penicillin d. doxycycline e. diisopropylphosphofluoridate (DIPF) 32. In designing a drug to inhibit an enzyme specific to a new pathogenic strain of E. coli, would you choose a group-specific inhibitor or a mechanism-based inhibitor? Why? a. mechanism-based, because it mimics the transition-state intermediate b. mechanism-based, because it modifies a catalytically active group on the enzyme c. group-specific, because it will react to specific R groups in the enzyme d. group-specific, because its activity can be enhanced with an allosteric inhibitor e. group-specific, because it is structurally similar to the enzyme's substrate 33. What is the main cause of repolarization? a. The flow of K+ out of the cell. b. The flow of Na+ out of the cell. c. The flow of K+ into the cell. d. The flow of Na+ into the cell. e. A low conductance for K+.

34. What lipids are referred to as polycyclic hydrocarbons? a. phospholipids b. steroids c. sphingolipids d. triacylglycerols with highly unsaturated fatty acids e. glycolipids 35. The prosthetic group of myoglobin that causes its ability to bind oxygen is: a. heme. b. porphyrin. c. protoporphyrin. d. pyrrole. e. oxymyoglobin.

36. The MOST common motif found in membrane-spanning proteins is: a. α helices of nonpolar amino acids that pass through the membrane. b. α helices of charged amino acids that form channels via extensive hydrogen bonding. c. the triple helix of α helices. d. a helix-turn-helix arrangement of the peptide strands. e. a bent β sheet.

37. Which class of glycoproteins is characterized by the extensive O-glycosylation by N-acetylgalactosamine?

Name:

Class:

Date:

ch 8 - 13 a. chitins b. proteoglycans c. mucins d. simple glycoproteins e. glycosaminoglycans 38. Would you agree that a peripheral membrane protein can act as Na+-K+ ATPase? Why? a. Yes, because Na+ and K+ are available intracellularly and extracellularly. b. Yes, because the hydrophobic amino side chains of the α helices firmly anchor the protein to the membrane. c. No, because a peripheral protein does not form a transporter across the entire membrane. d. No, because only secondary active transport proteins can act as Na+-K+ ATPase. e. No, because P-glycoprotein must also be present for Na+-K+ ATPase activity.

39. Fluorescence recovery after photobleaching has been used to study: a. membrane composition. b. lateral diffusion in membranes. c. protein structural motifs in membranes. d. lipid rafts in membranes. e. ion channels activity.

40. The antibiotic penicillin is an example of a(n) a. irreversible b. competitive c. noncompetitive d. metal ion e. reversible 41. Phosphatidylethanolamine does NOT contain a(n) a. amino b. methylene c. carboxyl d. carbonyl e. methyl

inhibitor.

group.

42. Choose the CORRECT pathway of the adenylate cyclase cascade. a. ligand → 7TM receptor → Gαs → adenylate cyclase → cAMP → dissociation of the R2C2 of the PKA → proteins phosphorylation → turning off by the cAMP phosphodiesterase b. ligand → 7TM receptor → Gαq → adenylate cyclase → cAMP → dissociation of the R2C2 of the PKA → proteins phosphorylation → turning off by the cAMP phosphodiesterase

Name:

Class:

Date:

ch 8 - 13 2+

c. ligand → 7TM receptor → Gαq → phospholipase C → PIP2 → IP3 releases Ca , while DAG activates PKC → proteins phosphorylation d. ligand → tyrosine kinase receptor → Gαs → adenylate cyclase → cAMP → dissociation of the R2C2 of the PKA → proteins phosphorylation → turning off by the cAMP phosphodiesterase e. ligand → 7TM receptor → Gαs → adenylate cyclase → cAMP → joining of the R2C2 of the PKA into holoenzyme → proteins phosphorylation 43. Phosphatidate does NOT contain a(n): a. phosphate. b. glycerol. c. ester linkage. d. acyl chain. e. glucose.

44. What provides carbohydrates with an ability to form a vast array of spatial structures? a. They function in parallel with polysaccharides. b. They are just as amino acids are for proteins. c. The nature of covalent bonds of monosaccharides varies highly. d. A large variety of monosaccharides can be linked together in many different ways. e. Monosaccharides are basically hydrates of carbon.

45. What would happen to the neuron if the Na+-K+ ATPase activity would be completely inhibited? a. The action potential couldn't be generated. b. The resting potential would be restored too fast after the action potential. c. Repolarization of the membrane wouldn't appear. d. The resting potential wouldn't be restored after the action potential. e. Depolarization of the membrane wouldn't appear.

46. What component of the signal-transduction pathway transfers information from the environment to a cell's interior? a. primary messenger b. second messenger c. membrane receptor d. activator e. ligand 47. What is NOT a second messenger? a. cyclic adenosine monophosphate b. cyclic guanosine monophosphate c. inositol 1,4,5-trisphosphate d. phosphatidylinositol 4,5-bisphosphate

Name:

Class:

Date:

ch 8 - 13 e. diacylglycerol 48. How many carbonyl groups are required to "resolve" a potassium ion in the selectivity filter of the K+ ion channel? a. 1 b. 2 c. 3 d. 4 e. 8 49. What is the kinetical hallmark of reversible uncompetitive inhibition? a. Vmax cannot be attained, even at high substrate concentrations. b. Vmax can be attained at sufficiently high concentrations of substrate. c. The apparent value for KM decreases as more inhibitor is added. d. The apparent value for KM remains unchanged as more inhibitor is added. e. Vmax decreases as more inhibitor is added.

50. Choose the CORRECT statement about receptor dimerization and JAK2. a. The insulin receptor dimerizes after ligand binding. b. Activation of JAK2 brings together intracellular domains of the receptor. c. Janus kinase 2 is associated with each intracellular domain of the receptor in an activated form. d. Self-phosphorylation of Janus kinase 2 activates it catalytically. e. Janus kinases have two nearly identical active sites, but only one site is catalytically functional.

51. Intrinsic GTPase activity of Gα subunits is important in what step of the generalized scheme of signaltransduction pathways? a. termination b. release of the primary messenger c. relay of information by the second messenger d. reception of the primary messenger e. activation of effectors 52. What is the origin of the free energy of the Na+ ion gradient? a. free energy of the K+ ion gradient b. electric polarization c. Na+-K+ ATPase d. free energy of phosphoryl transfer e. free energy of AMP 53. The following compound is NOT:

Name:

Class:

Date:

ch 8 - 13

a. a component of biological membranes. b. a sphingolipid. c. a phosphoglyceride. d. amphipathic. e. phosphatidylcholine.

54. What is the term for hemoglobin in the R state? a. αβ dimer b. oxyhemoglobin c. deoxyhemoglobin d. desoxyhemoglobin e. cytoglobin 55. What is the form of the dependency graph of 1/V0 versus 1/S? a. logarithmic b. linear c. sigmoidal d. hyperbolic e. bell-shaped 56. Why do liposomes have high clinical importance? a. They act as systemic drugs. b. Only hydrophilic molecules can be trapped inside such vesicles. c. They are quite uniform in size. d. Different molecules can be trapped inside such vesicles. e. They increase the amount of drug delivered across the body.

57. How many rings are in the steroid nucleus? a. 0 b. 1 c. 2 d. 3 e. 4 58. What stabilizes the tetrahedral intermediate of hydrolysis of a peptide bond by chymotrypsin? a. oxyanion hole b. tetrahedral pocket

Name:

Class:

ch 8 - 13 c. catalytic triad d. hydrophobic pocket e. serine 195 59. What is the term for hemoglobin in the T state? a. αβ dimer b. oxyhemoglobin c. deoxyhemoglobin d. desoxyhemoglobin e. cytoglobin 60. An antiporter and a symporter are examples of: a. passive diffusion. b. primary active transporters. c. entropy driven pores. d. an ABC transporter. e. a secondary transporter.

61. What is an example of a glycosaminoglycan? a. UDP b. glycogen c. cellulose d. lectins e. heparin 62. The simplest polysaccharide is: a. monosaccharide. b. disaccharide. c. UDP. d. maltose. e. acetylglucosamine.

63. What is the partial pressure of oxygen in the alveoli of the human lungs? a. 10 torr b. 20 torr c. 100 torr d. 156 torr e. 760 torr 64. What linkages are in phosphoglycerides between fatty acids and a glycerol backbone? a. ether linkages b. thioether linkages

Date:

Name:

Class:

Date:

ch 8 - 13 c. phosphate linkages d. methylene linkages e. ester linkages 65. What statement concerning the differences between hemoglobin and myoglobin is TRUE? a. Both hemoglobin and myoglobin are tetrameric proteins. b. Hemoglobin exhibits a hyperbolic O2 saturation curve, while myoglobin exhibits a sigmoid-shaped curve. c. Hemoglobin exhibits cooperative binding of O2, while myoglobin does not. d. Hemoglobin exhibits a higher degree of O2 saturation at all physiologically relevant partial pressures of O2 than myoglobin does. e. Both hemoglobin and myoglobin help to transport carbon dioxide from actively metabolizing tissues to lungs.

66. If any of the histidine residues substitute with an arginine residue in the 2,3-BPG binding site of hemoglobin, 2,3-BPG would be bound: a. tighter because of the loss of a positive charge. b. tighter because of the gain of a positive charge. c. less tightly because of the loss of a positive charge. d. less tightly because of the gain of a positive charge. e. in the same way.

67. Choose the CORRECT statement about glycoproteins. a. About 80% of the simple glycoprotein molecule can be a carbohydrate. b. In proteoglycans, carbohydrate components make up about 95% of the molecule by weight. c. Half of the proteome is proteoglycans. d. In mucins, moieties of N-acetylgalactosamine can make up about 40% of the molecule by weight. e. Only 1%–2% of the proteome is glycosylated.

68. In what type of inhibition can the inhibitor bind only to the ES complex to form an ESI complex? a. competitive b. noncompetitive c. irreversible d. uncompetitive e. reversible 69. Which statements concerning the following equilibrium is FALSE? CO2 + H2O H2CO3 a. An increase in the pressure of CO2 in actively metabolizing tissues will result in a decrease of pH inside red blood cells. b. This reaction is catalyzed by carbonic anhydrase in red blood cells.

Name:

Class:

Date:

ch 8 - 13 +

–

c. H2CO3 dissociates to H and a bicarbonate ion, HCO3 .

– d. The majority of CO2 is transported to the lungs in the form of HCO3 . e. The oxygen-binding affinity of hemoglobin increases as pH decreases

70. In the allosteric regulation of oxygen binding to Hb, a. carbon dioxide b. carbon monoxide c. hydrogen ion d. carbonic acid e. 2,3-bisphosphoglycerate

does NOT participate.

71. Where is the 2,3-BPG-binding site in deoxyhemoglobin? a. in the central cavity b. near the heme pocket c. in the hydrophobic core d. on the α1β1–α2β2 interface e. in the groove on the surface 72. Choose the denotation for the double bond position and conformation in natural oleic acid. a. trans-Δ2 b. cis-Δ2 c. cis, cis-Δ9,Δ12 d. trans-Δ9 e. cis-Δ9 73. The effect of pH on oxygen binding of hemoglobin is called: a. pH effect. b. metabolic acidosis effect. c. Born effect. d. Herrick effect. e. Bohr effect.

74. What is a result of a genetic disorder in which a person gets defective alleles of the hemoglobin β chain from both parents and so has an almost complete absence of β chains? a. α-thalassemia b. a mutated form of hemoglobin that binds oxygen with high affinity and no cooperativity c. sickle-cell anemia d. Cooley anemia e. a decrease in oxygen-binding affinity

Name:

Class:

Date:

ch 8 - 13 75. Choose the catalytic strategy where a cofactor serves as an electrophile to stabilize a negative charge on a reaction intermediate. a. covalent catalysis b. general acid–base catalysis c. metal ion catalysis d. catalysis by approximation and orientation e. irreversible catalysis 76. At which carbon of glycerol is the polar head group of phospholipids found? a. C-1 b. C-2 c. C-3 d. C-1–OH e. C-2–OH 77. Normal adult hemoglobin A: a. isn't a tetramer. b. isn't composed of two α subunits and two β subunits. c. doesn't have a structure very similar to myoglobin. d. can't be best described as a pair of nonidentical αβ dimers. e. is not able to bind an oxygen molecule by each subunit.

78. The α and γ subunits of heterotrimeric G-proteins are anchored to the cell membrane by being covalently linked to: a. protein kinase A. b. small G proteins. c. fatty acids. d. protein kinase C. e. phospholipase C. 79. Where is chymotrypsin MOST likely to cleave proteins? a. carboxyl-terminal side of glutamate and aspartate b. carboxyl-terminal side of tryptophan, tyrosine, phenylalanine, methionine, and isoleucine c. amino-terminal side of tryptophan, tyrosine, phenylalanine, methionine, and isoleucine d. amino-terminal side of glutamate and aspartate e. carboxyl-terminal side of lysine, arginine and histidine 80. According to the given scheme, choose the most appropriate types of transport and, if applicable, transporters that can be used to transport glucose from the lumen to blood if the initial concentration of glucose in the lumen is higher than in the cells.

Name:

Class:

Date:

ch 8 - 13

a. simple diffusion along the glucose concentration gradient inside cells and primary active transport against the concentration gradient to blood b. symport to cells dependent on the gradient of sodium ions concentration and facilitated diffusion down the glucose concentration gradient to blood c. simple diffusion along the glucose concentration gradient inside cells and secondary active transport up the glucose concentration gradient to blood d. antiport inside cells dependent on the gradient of sodium ions concentration and symport to blood dependent on the gradient of potassium ions e. facilitated diffusion along the glucose concentration gradient to cells and active transport by the ATP-dependent antiporter to blood 81. Choose the CORRECT sequence of the insulin signaling pathway. a. insulin binding to the receptor → dimerization of the receptor → cross-phosphorylation and activation of the receptor → binding and phosphorylation of the IRS → the lipid kinase phosphoinositide 3-kinase binds to phosphorylated sites on IRS and then converts PIP2 into PIP3 → activation of the PIP3-dependent protein kinase → phosphorylation and activation of Akt b. insulin binding to the receptor → dimerization of the receptor → self-phosphorylation and activation of the receptor → binding and phosphorylation of the IRS → the lipid kinase phosphoinositide 3kinase binds to phosphorylated sites on IRS and then converts PIP3 into PIP2→ activation of the PIP2-dependent protein kinase → phosphorylation and activation of Akt c. insulin binding to the receptor → cross-phosphorylation and activation of the receptor → binding and phosphorylation of the IRS → the lipid kinase phosphoinositide 3-kinase binds to phosphorylated sites on IRS and then converts PIP2 into PIP3 → activation of the PIP3-dependent protein kinase → phosphorylation and activation of Akt d. insulin binding to the receptor → self-phosphorylation and activation of the receptor → binding and phosphorylation of the IRS → the lipid kinase phosphoinositide 3-kinase binds to phosphorylated sites on IRS and then converts PIP2 into PIP3 → activation of the PIP3-dependent protein kinase → phosphorylation and activation of Akt e. insulin binding to the receptor → binding and phosphorylation of the IRS → cross-phosphorylation and activation of the receptor → the lipid kinase phosphoinositide 3-kinase binds to phosphorylated sites on IRS and then converts PIP2 into PIP3 → activation of the PIP3-dependent protein kinase → phosphorylation and activation of Akt

Name:

Class:

Date:

ch 8 - 13 82. Most signal molecules: a. easily diffuse through the membrane and bind to a receptor in the cytoplasm. b. bind to membrane receptors and transmit information across a membrane without traversing the membrane. c. carry out functions in the nucleus after binding to a receptor in the cell membrane. d. easily diffuse through the membrane, bind to a receptor in the cytoplasm, and carry out functions in the cytoplasm. e. easily diffuse through the membrane and bind to a receptor in the nucleus.

83. Which statement about a chymotrypsin substrate binding is FALSE? a. Chymotrypsin binds its substrate with a deep hydrophobic pocket. b. The pocket locks the substrate into an appropriate conformation for the active site to do its job. c. The specificity of chymotrypsin depends almost entirely on which carboxylic acid is on the carboxylterminal side of the peptide bond to be cleaved. d. Few polar groups are present on the surface of the pocket. e. The specificity site of chymotrypsin is called the S1 pocket.

84. How does the binding of a hormone to a receptor activate a G-protein? a. It causes an exchange of GTP for bound GDP. b. γ subunit is released from binding to the β subunit. c. It causes an exchange of GDP for bound GTP. d. Second messengers activate the G-protein. e. The hormone directly activates the G-protein.

85. Choose the term for a catalytic mechanism that forces two distinct substrates into an appropriate 3dimensional arrangement on a single binding surface of an enzyme for the reaction to occur. a. covalent catalysis b. general acid–base catalysis c. metal ion catalysis d. catalysis by approximation and orientation e. irreversible catalysis 86. What is NOT a feature of second messengers? a. They are able to diffuse easily to other compartments of the cell. b. They are able to diffuse easily to the nucleus. c. They alter the tertiary or quaternary structure of the receptor. d. They change in concentration in response to environmental signals. e. The signal may be amplified significantly in the generation of second messengers.

87. What is a key difference between an enzyme that uses a covalent catalysis mechanism and the other catalytic strategies? a. Enzymes that utilize a covalent catalysis strategy facilitate reactions by donating electrons, whereas

Name:

Class:

Date:

ch 8 - 13 the other types facilitate reactions by accepting electrons. b. Enzymes that utilize a covalent catalysis strategy don't use metal ions as a cofactor. c. Enzymes that utilize a covalent catalysis strategy use water as a proton donor or acceptor, whereas the other types use other molecules for that role. d. Enzymes that utilize a covalent catalysis strategy facilitate the formation of the intermediate compound, whereas the other types facilitate the formation of the transition state. e. Enzymes that utilize a covalent catalysis strategy covalently bind the substrate to one or more of the amino acids in the active site, whereas the other types bind substrates to the site by noncovalent interactions.

88. Most membrane receptor proteins of the signal-transduction pathway do NOT belong to: a. seven-transmembrane-helix receptors. b. G-protein-coupled receptors. c. dimeric receptors that are protein kinases. d. dimeric receptors that recruit protein kinases. e. GTPase-activating proteins.

89. What prevents oxidation of the heme iron to the ferric form? a. protoporphyrin b. proximal histidine c. distal histidine d. β 82 lysine e. 2,3-bisphosphoglycerate 90. Tm of the membrane is lowest if it is composed of the: a. octadecanoate without cholesterol. b. octadecanoate and a few cholesterol molecules. c. hexadecanoate and a few cholesterol molecules. d. cis-Δ9-hexadecenoate and a few cholesterol molecules. e. cis-Δ9-hexadecenoate and a lot of cholesterol molecules.

91. Which phospholipid is abundant in the myelin sheath of neural cells? a. phosphatidic acid b. diacylglycerol c. diphophatidylglycerol d. sphingomyelin e. phosphatidylinositol 92. Choose the CORRECT order of signal transferring in the basic signal-transduction pathway. a. membrane receptor → primary messenger → second messenger → termination of the signal → activation/inhibition of the pumps, enzymes, gene-transcription factors

Name:

Class:

Date:

ch 8 - 13 b. primary messenger → activation/inhibition of the pumps, enzymes, gene-transcription factors → membrane receptor → second messenger → termination of the signal c. second messenger → membrane receptor → activation/inhibition of the pumps, enzymes, genetranscription factors → primary messenger → termination of the signal d. membrane receptor → activation/inhibition of the pumps, enzymes, gene-transcription factors → primary messenger → second messenger → termination of the signal e. primary messenger → membrane receptor → second messenger → activation/inhibition of the pumps, enzymes, gene-transcription factors → termination of the signal 93. What protein is referred to as a guanine-nucleotide exchange factor? a. Sos protein b. Ras protein c. Grb-2 protein d. small G proteins e. Arf protein 94. What describes the role of a protein in the selective permeability of a membrane? a. the polar heads of phospholipids, which allow polar molecules to cross membranes b. the binding of steroids to an extracellular peripheral membrane protein c. the insertion of a porin with polar amino acids forming the β strands d. Na+-K+ ATPase activity that sets up an electrical potential across the membrane e. passive diffusion according to the second law of thermodynamics 95. Withdrawal of the proton from the hydroxyl group of serine 195 in chymotrypsin by histidine 57 generates a(n): a. alkoxide ion. b. alkoxide radical. c. serine ion. d. oxyanion hole. e. hydroxyl ion.

96. Received information is called a transduced signal because: a. it is then converted into other chemical forms. b. it is then converted into other electrical forms. c. this process often has many steps of information conversion. d. it is then converted into other chemicals during metabolism. e. many different molecules form a signaling cascade.

97. What is the function of cAMP phosphodiesterase? a. It activates protein kinase A. b. It inactivates protein kinase B. c. It joins two R and two C subunits of the PKA.

Name:

Class:

Date:

ch 8 - 13 d. It converts cAMP into AMP. e. It phosphorylates other proteins.

98. Which form of hemoglobin binds oxygen with high affinity and no cooperativity? a. HbA b. HbH c. T state d. HbS e. HbF 99. What is the kinetical hallmark of reversible competitive inhibition? a. Vmax cannot be attained, even at high substrate concentrations. b. Vmax can be attained at sufficiently high concentrations of substrate. c. The apparent value for KM decreases as more inhibitor is added. d. The apparent value for KM remains unchanged as more inhibitor is added. e. Vmax decreases as more inhibitor is added.

100. Choose the CORRECT statement about flippases. a. As members of P-type ATPases family, flippases require P-glycoprotein for their activity. b. Formation of phosphorylaspartate is a prerequisite for the traverse of membrane lipids from the inner to the outer leaflet. c. Transverse diffusion of phospholipids from the inner to the outer leaflet is accomplished by the ABC transporter. d. As the members of the ABC transporter family, flippases require an aspartate residue for their activity. e. Transverse diffusion of phospholipids from the outer to the inner leaflet requires binding of ATP by the ABC domain.

101. Identify the differences in archaea membrane lipids compared to those of eukaryotes or bacteria and how these differences help them withstand extreme environmental conditions. a. The ether linkages are more readily hydrolyzed by enzymes, allowing the membrane to serve as an energy reserve. b. The glycerol moiety is esterified to multiple complex carbohydrate chains, making them more soluble in low-pH environments. c. The fatty acid chains are branched, allowing them to pack more tightly, thereby protecting membrane integrity. d. There are two phosphate esters instead of only one, giving the archaea better solubility in high-salt environments. e. Omega-3 fatty acids are common in membranes and may act as important precursors as they do in eukaryotes.

102. How many nucleotides are required for a glycosyltransferase to synthesize a disaccharide?

Name:

Class:

Date:

ch 8 - 13 a. 1 b. 2 c. 3 d. 0 e. 1%–2% of the total nucleotides 103. What is the term for the genes that encode proteins that either inhibit cell growth by turning off growthpromoting pathways or trigger the death of tumor cells? a. oncogenes b. proto-oncogenes c. paragenes d. adaptor genes e. tumor-suppressor genes 104. Digitalis is a cardiotonic steroid that does not act like a steroid. Instead, its function is to inhibit: a. the Na+-K+ pump. b. fatty acid intake. c. calcium channels. d. potassium and sodium pores. e. the dropsy channel.

105. What should be the approximate length of a phospholipid molecule, considering the average thickness of membranes? a. 10 ·Å b. 30–50 ·Å c. 60–100 ·Å d. 50 nm e. 6–10 nm 106. What corresponds to the polar head group of phosphatidylcholine? a. choline b. phosphorylcholine c. phosphate d. glycerophosphocholine e. glycerol 107. What term is used for a compound that does not necessarily mimic a native substrate but is used to modify specific functional groups of amino acids in enzymes? a. group-specific reagent b. mechanism-based reagent c. transition-state analog d. affinity label

Name:

Class:

Date:

ch 8 - 13 e. suicide inhibitor 108. What is the quaternary structure of adult human hemoglobin A? a. monomer b. dimer of the α subunit and β subunit c. trimer of the α, β, and γ subunits d. tetramer of the two α subunits and two β subunits e. tetramer of the four α subunits 109. What is the minimal number of negatively charged carboxylate or sulfate groups in one unit of glycosaminoglycan? a. 1 b. 2 c. 3 d. 4 e. 5 110. What role do van der Waals interactions play in membranes? a. favor the self-assembly of the lipid bilayer b. decrease the melting temperature c. increase membrane fluidity d. favor loose packing of the hydrophobic interior e. decrease membrane fluidity 111. The common feature of all ω-3 fatty acids is/are: a. a methyl group at the carboxyl end of the fatty acid. b. a methyl group on the third carbon of the chain. c. a double bond between carbon atoms 2 and 3. d. a triple bond at the carboxyl end of the fatty acid. e. several double bonds in the chain.

112. What step of the generalized scheme of signal-transduction pathways is defective in Cushing's syndrome? a. termination b. release of the primary messenger c. relay of information by the second messenger d. reception of the primary messenger e. activation of effectors 113. Associations of proteins with membranes that do NOT exist are: a. integral membrane-spanning β sheet with nonpolar side groups outside. b. integral membrane-spanning α helices with polar side groups outside. c. integral membrane-spanning nonpolar α helices.

Name:

Class:

Date:

ch 8 - 13 d. peripheral polar interactions with phospholipid heads. e. partial embedding in the membrane of relatively small hydrophobic regions.

114. In the double-reciprocal plot of the rate of catalysis, the slope of the line is the same in the presence and in the absence of the inhibitor. Choose the correct type of inhibitor. a. reversible b. competitive c. uncompetitive d. noncompetitive e. The data are not enough to determine the type.

115. Which carbon atom of aldohexose CANNOT be a part of a pyranose ring? a. C-1 b. C-2 c. C-β d. C-5 e. C-6 116. Hosphatidylcholine does NOT contain a(n): a. carbonyl group. b. hydroxyl group. c. ester linkage. d. amino group. e. methylene group.

117. According to the given scheme, what type of transport should be used to transport sodium ions to cells?

a. simple diffusion b. facilitated diffusion c. primary active transport d. coupled to K+ symport e. coupled to Cl– antiport

Name:

Class:

Date:

ch 8 - 13 118. What is the chemical form in which most of the carbon dioxide is transported in the blood? a. carbonic acid b. carbonate ion c. bicarbonate ion d. carbamate e. carbon monoxide 119. During synthesis of sucrose by a glycosyltransferase, the oxygen atom of the glycosidic bond comes from the hydroxyl group on the: a. first carbon atom of α-D-glucopyranose since in UDP-glucose, UDP is connected to this oxygen. b. second carbon atom of α-D-fructofuranose since in UDP-fructose, UDP is connected to this oxygen. c. second carbon atom of β-D-fructofuranose since oxygen of α-D-glucopyranose is left as part of UDP after the transfer. d. fifth carbon atom of β-D-fructofuranose since oxygen of α-D-glucopyranose is left as part of UDP after the transfer. e. second carbon atom of α-D-fructofuranose since oxygen of β-D-glucopyranose is left as part of UDP after the transfer.

120. What statement about polysaccharides is TRUE? a. The hollow helix is formed when monosaccharides are N-linked. b. Soluble O-linked polysaccharides can improve absorption of nutrients. c. The α-1,4 linkages favor straight structures, which are more suitable for storage. d. Insoluble β-linked polysaccharides can improve absorption of nutrients. e. Pectin can increase the rate at which digestion products pass through the large intestine.

121. Sodium ions can't pass through the K+ ion channel because they: a. are too small to be efficiently rehydrated by the channel. b. require hydrolysis of more than one ATP molecule. c. are too big to be efficiently rehydrated by the channel. d. are taken up by respective Na+ ion channels so they don't need to pass through K+ ion channels. e. need more binding sites in the selectivity filter.

122. Unlike adult forms of hemoglobin, fetal hemoglobin contains: a. two γ chains instead of α chains. b. one γ chain instead of an α chain. c. two ε chains instead of β chains. d. one ε chain instead of an α chain. e. two γ chains instead of β chains.

123. What compound is not an irreversible inhibitor? a. aspirin b. tosyl-L-phenylalanine chloromethyl ketone

Name:

Class:

Date:

ch 8 - 13 c. glyphosate d. diisopropylphosphofluoridate e. penicillin 124. If you want to study how membranes regulate their curvature and budding processes, what membrane structures would you study? a. presence of lipid rafts b. degree of fatty acid unsaturation c. presence of active transport proteins d. presence of prostaglandin H2 synthase-1 e. concentration of cholesterol 125. The iron atom in heme is bound to the fifth coordination site of which molecule? a. protoporphyrin b. oxygen c. carbonic acid d. carbamate e. histidine 126. What will happen upon hydrolysis of 3 ATP molecules by the Na+-K+ pump? a. 3 Na+ will be transported outside the cell, and 2 K+ will be transported inside the cell. b. 6 Na+ will be transported outside the cell, and 9 K+ will be transported inside the cell. c. 3 Na+ will be transported inside the cell, and 2 K+ will be transported outside the cell. d. 9 Na+ will be transported inside the cell, and 6 K+ will be transported outside the cell. e. 9 Na+ will be transported outside the cell, and 6 K+ will be transported inside the cell.

127. An enzyme that temporarily undergoes covalent catalysis as part of its mechanism is: a. tyrosinase. b. pepsin. c. phosphofructokinase. d. transpeptidase. e. chymotrypsin.

128. Which form of hemoglobin causes Hb aggregation in a newborn that is heterozygous for the sickle-cell hemoglobin allele? a. oxygenated HbA b. deoxygenated HbS c. oxygenated HbF d. deoxygenated HbA e. oxygenated HbS

Name:

Class:

Date:

ch 8 - 13 129. What signal molecule does NOT pass into the cell to transfer the environmental signal? a. primary messenger b. second messenger c. membrane receptor d. activator e. ligand 130. What property of membranes makes the transverse diffusion of phospholipids across the membrane energetically unfavorable? a. lateral diffusion b. hydrophobic interior of the membrane c. protein immobilization d. electric polarization e. membrane fluidity 131. What is the Bohr effect? a. the ability of hemoglobin to retain oxygen when in competition with myoglobin b. the regulation of hemoglobin binding by hydrogen ions and carbon dioxide c. the alteration of hemoglobin conformation during low oxygen stress d. the ability of hemoglobin to bind oxygen when the iron ion moves out of the porphyrin plane e. the regulation of hemoglobin oxygen-binding affinity by pH level 132. The cleavage of PIP2 is important in what step of the generalized scheme of signal-transduction pathways? a. termination b. release of the primary messenger c. relay of information by the second messenger d. reception of the primary messenger e. activation of effectors 133. How many times is/are the tetrahedral intermediate(s) formed during the complete enzymatic cycle of chymotrypsin? a. 0 b. 1 c. 2 d. 3 e. 4 134. What would be the expected result of substitution of aspartate 94 of the β chain with a serine residue? a. 2,3-BPG would bind tighter because of the loss of a negative charge. b. Oxygen-binding affinity would increase because of a disruption of a van der Waals contact, thus facilitating the formation of the R state. c. The formation of the salt bridge with C-terminal histidine in the β chain would be disrupted;

Name:

Class:

Date:

ch 8 - 13 therefore, hemoglobin sensitivity to acidification is expected to be reduced. d. 2,3-BPG would bind less tightly because of the loss of a negative charge. e. This substitution would have no effect on the allosteric properties of hemoglobin.

135. Which lipids contain a branched chain of seven sugar residues? a. gangliosides b. sphingolipids c. glycolipid d. cerebrosides e. sugar-containing lipids 136. What transmits the signal that a receptor has bound its ligand? a. the conformational change in the cytoplasmic domain of the 7TM receptor b. the dissociation of the G-protein into Gα and Gβγ subunits c. the exchange of the bound GTP for GDP in the G-protein d. the dissociation of the adenylate cyclase e. synthesis of the second messenger 137. Unlike the other members of the receptor tyrosine kinase class, the insulin receptor: a. has only one catalytically functional site out of two. b. undergoes cross-phosphorylation after ligand binding. c. activates the signal-transduction pathway. d. exists as a dimer even in the absence of insulin. e. acts in gene-transcription regulation.

138. What does NOT determine whether a small molecule will cross a membrane? a. concentration gradient b. molecule solubility in the hydrophilic environment c. replacement of the solvation shell of polar water molecules by nonpolar interactions with the membrane interior d. molecule solubility in the hydrophobic environment e. difference in the molecule concentration on both sides of the membrane 139. What is the molecule whose function is to facilitate diffusion of oxygen in muscle cells? a. hemoglobin b. myoglobin c. protoporphyrin d. carbamate e. histidine 140. is an antibiotic that acts as a competitive inhibitor. a. Sulfanilamide

Name:

Class:

Date:

ch 8 - 13 b. P-aminobenzoic acid (PABA) c. Penicillin d. Doxycycline e. Diisopropylphosphofluoridate (DIPF) 141. What is the reason hemoglobin S aggregates? Choose the MOST accurate statement. a. The exposed hydrophobic valine makes a better van der Waals contact surface between Hb tetramers. b. The exposed hydrophobic valine on the β chain interacts with a complementary hydrophobic patch on the β chain of another hemoglobin molecule. c. The exposed hydrophobic valine on the β chain interacts with a hydrophobic patch on the α chain of another hemoglobin molecule. d. The hydrophobic valine, instead of glutamate, disturbs folding of the β chain; therefore, more hydrophobic side chains become exposed. e. The valine side chain produces a hydrophobic patch in oxygenated hemoglobin.

142. In what form does a fatty acid exist in the physiological pH range? a. anion b. cation c. protonated molecule d. acid e. zwitterion 143. What is the evidence that hemoglobin binds oxygen in a cooperative manner? a. saturation level of the oxygen-binding curve b. hyperbolic shape of the oxygen-binding curve c. sigmoidal shape of the oxygen-binding curve d. the speed of oxygen binding at high pO2 e. the speed of oxygen binding at moderate pO2 144. What lectin selectively binds to the endothelium? a. L-selectin b. E-selectin c. P-selectin d. hemagglutinin e. erythropoietin 145. What is NOT a homopolymeric polysaccharide? a. amylose b. amylopectin c. glycogen d. aggrecan

Name:

Class:

Date:

ch 8 - 13 e. cellulose 146. Which irreversible inhibitor is also known as a substrate analog? a. group-specific reagent b. affinity label c. suicide inhibitor d. transition-state analog e. competitive inhibitor 147. What is the common name of (18:3) fatty acid? a. oleic acid b. stearic acid c. palmitic acid d. linoleic acid e. linolenic acid 148. In proteins, the glycosylphosphatidylinositol anchor is attached to the: a. cysteine residue. b. cysteine residue at the carboxyl terminus. c. carboxyl terminus. d. amino terminus. e. serine residue.

149. Choose the feature that is different in mechanisms of action of human chymotrypsin and bacterial glycopeptide transpeptidase. a. Treatment with organofluorophosphates, such as DIPF, would inactivate an enzyme irreversibly. b. The serine residue is at the active site. c. The active group of the enzyme attacks the carbonyl carbon atom of the substrate nucleophilically. d. Deacylation by hydrolysis regenerates the free enzyme. e. Both enzymes form covalent acyl-enzyme intermediates.

150. A precursor to estradiol is: a. sitosterol. b. eicosapentaenoate. c. cholesterol. d. cardiolipin. e. arachidonate.

151. The GPI anchor does NOT contain a(n): a. double bond. b. amino group. c. cyclopentane ring.

Name:

Class:

Date:

ch 8 - 13 d. ester linkage. e. mannose.

152. The formation of lipid bilayers is determined by: a. van der Waals attractive forces. b. hydrophobic interactions. c. electrostatic interactions. d. hydrogen bonds. e. van der Waals repulsive forces.

153. Which component of membranes provides their impermeability to polar molecules and ions? a. hydrophilic heads of phospholipids b. cholesterol c. hydrophobic tails of phospholipids d. integral proteins e. peripheral proteins 154. In nutrient sensing, what does the acetyl group of GlcNAc indicate? a. carbohydrate availability b. fatty acid availability c. protein availability d. diabetes e. oligosaccharide structure 155. What are the two biochemical principles that explain the enzyme activity versus temperature curve? a. The rising portion of the curve is due to an increase in Brownian motion of molecules, and the decrease is due to activation of inhibitor molecules. b. An increase in temperature increases the interactions with allosteric activators, and a decrease in temperature increases the interactions with allosteric inhibitors. c. The rising portion of the curve is due to an increase in Brownian motion of molecules, and the decrease is due to enzyme denaturation. d. The rising portion of the curve is due to an increase in enzyme synthesis, and the decrease is due to reduction in Brownian motion of the molecules. e. The rising portion of the curve is due to an increase in enzyme synthesis, and the decrease is due to activation of inhibitor molecules.

156. Eukaryotic cell membranes usually do NOT contain: a. phospholipids. b. glycolipids. c. steroids. d. triacylglycerols. e. sphingolipids.

Name:

Class:

Date:

ch 8 - 13 157. What evidence exists to show that membrane asymmetry can be preserved for long periods? a. Lateral diffusion from fluorescence recovery after photobleaching experiments. b. Transverse diffusion of proteins has not been observed. c. Facilitated diffusion can take place in either direction depending on the concentration gradient. d. Tumor cells often become resistant to drugs. e. The α helices in membrane-spanning proteins are hydrophobic and tightly packed.

158. A tetrose has asymmetric carbon atoms in the D and L configuration in the second and third positions, respectively. What is the respective configuration of the tetrose? a. D b. L c. DL d. α e. β 159. Which membrane lipid is composed of sphingosine, fatty acid, and a simple sugar? a. sphingoside b. cerebroside c. sphingolipid d. sphingomyelin e. cardiolipin 160. Which component of membranes is key to controlling membrane fluidity in prokaryotes? a. hydrophilic heads of phospholipids b. cholesterol c. hydrophobic tails of phospholipids d. integral proteins e. peripheral proteins 161. How many oxygen-binding sites in hemoglobin are occupied when blood travels through capillaries? a. about 98% b. about 66% c. about 7% d. about 32% e. about 50% 162. Choose a compound that acts by covalent modification of the serine residues in proteins. a. aspirin b. tosyl-L-phenylalanine chloromethyl ketone c. glyphosate d. diisopropylphosphofluoridate e. p-aminobenzoic acid

Name:

Class:

Date:

ch 8 - 13 163. Hemoglobin: a. doesn't help to transport hydrogen ions. b. doesn't help to transport carbon dioxide from actively metabolizing tissues to lungs. c. isn't the main transporter of oxygen. d. isn't the main transporter of carbon dioxide. e. doesn't bind oxygen in lungs where the partial pressure of oxygen is high.

164. Derivatives of cholesterol with an alcohol functional group are: a. steroids. b. sterols. c. hopanoids. d. hopanols. e. sterones.

165. What disease is NOT a result of a mutation in the receptor tyrosine kinases? a. arteriosclerosis b. type 2 diabetes c. inflammation d. Cushing's syndrome e. cancer 166. What is the term used for a substrate analog that is structurally similar to the substrate and chemically modifies a residue in the active site to mark it? a. group-specific reagent b. mechanism-based reagent c. transition-state analog d. affinity label e. suicide inhibitor 167. Hyaluronate in the cartilage acts as a: a. repeating unit of the aggrecan molecule. b. central filament for the aggrecan molecule. c. monomer of chondroitin sulfate. d. central filament of the aggrecan molecule. e. central filament between glycosaminoglycans.

168. What is the molecular basis for the (general) dependence of enzymatic activity on hydrogen ion concentration? a. metal ions b. special cofactors c. ionizable groups

Name:

Class:

Date:

ch 8 - 13 d. denaturation e. Brownian motion 169. What form of the guanyl nucleotide is bound in the unactivated state of the G-protein? a. GTP b. GDP c. GMP d. dGTP e. cGMP 170. fMRI measures the changes in the: a. fifth coordination site upon binding of iron, revealing the amount of carbon monoxide bound in carbon monoxide poisoning. b. fifth coordination site upon binding of iron, revealing sensory brain activity. c. magnetic properties of γ-chain hemoglobin and is a noninvasive way of measuring fetal hemoglobin levels during pregnancy. d. magnetic properties of hemoglobin, revealing the relative amounts of deoxy- and oxyhemoglobin in the circulation of a specific organ. e. pO2 levels in the circulatory system in any organism.

171. How many carbons does palmitate have in its chain? a. 12 b. 14 c. 16 d. 20 e. 24 172. What is the typical form of the curve describing pH dependence of enzymatic activity? a. sigmoidal b. hyperbolic c. growing curve with saturation d. bell-shaped curve with one maximum e. curve of two bells with two peaks 173. What second messenger stays in the membrane after cleavage of PIP2? a. phosphatidylinositol 4,5-bisphosphate b. 1,4,5-trisphosphate c. diacylglycerol d. phospholipase C e. cyclic adenosine monophosphate 174. What statement about the termination of insulin signaling is FALSE?

Name:

Class:

Date:

ch 8 - 13 a. Lipid phosphatases are required to remove phosphoryl groups. b. Lipid phosphatases hydrolyze PIP3 to PIP2. c. Tyrosine phosphatases remove phosphoryl groups from tyrosine residues on the insulin receptor. d. Serine phosphatases remove phosphoryl groups from activated protein kinases such as Akt. e. Proteins can promote their own inactivation by the release of a phosphoryl group.

175. What is the magnitude of rotation of one αβ dimer with respect to the other one upon oxygenation of hemoglobin? a. 3 degrees b. 30 degrees c. 90 degrees d. 5 degrees e. 15 degrees 176. The systematic name of linoleic acid is a. hexadecanoic b. octadecanoic c. octadecenoic d. octadecadienoic e. octadecatrienoic

_ acid.

177. Which of the statements concerning myoglobin is FALSE? a. The globin chain contains an extensive α-helix structure. b. The heme group is bound to the globin chain by two disulfide bonds between cysteine residues. c. The iron of the heme group is in the Fe2+ oxidation state. d. The diameter of the iron ion decreases upon binding of oxygen. e. The function of myoglobin is oxygen storage in muscle.

178. Fetal hemoglobin: a. is composed of two α and two γ subunits. b. binds 2,3-BPG more tightly than normal adult hemoglobin. c. binds oxygen with less affinity than HbA at all pO2. d. does not exist in the T state. e. does not exist in the R state.

179. What is the target for the Ca2+–calmodulin complex that regulates the metabolism of fuel, ionic permeability, neurotransmitter synthesis, and neurotransmitter release? a. Ca2+–ATPase pump b. CaM c. calmodulin-dependent protein kinase d. EF-hand protein family

Name:

Class:

Date:

ch 8 - 13 e. small G-proteins 180. How many asymmetric carbon atoms are there in the open-chain aldoheptose molecule? a. 4 b. 5 c. 6 d. 7 e. 8 181. What second messenger does NOT cause a cascade of phosphorylation to elicit a response from the cell? a. phosphatidylinositol 4,5-bisphosphate b. 1,4,5-trisphosphate c. diacylglycerol d. cyclic guanosine monophosphate e. cyclic adenosine monophosphate 182. Unlike hemoglobin A, hemoglobin S: a. tends to form large fibrous aggregates when it is deoxygenated. b. tends to form large fibrous aggregates when it is oxygenated. c. has much lower oxygen-binding affinity. d. has much higher oxygen-binding affinity. e. has modified regulation due to mutation.

183. The slowest type of molecule transport is: a. transverse diffusion of proteins. b. active transport. c. facilitated diffusion. d. lateral diffusion. e. transverse diffusion of lipids.

184. How does oxygen-binding affinity of hemoglobin change after the binding of 2,3-BPG? a. increases greatly b. increases slightly c. decreases d. is strongly inhibited e. does not change 185. When chymotrypsin activity is monitored with a chromogenic substrate, the kinetics within milliseconds shows a burst phase and a steady-state phase. What does this tell us about chymotrypsin's mechanism of catalysis? a. The chromogenic substrate is an uncompetitive inhibitor. b. Hydrolysis proceeds in two or three steps.

Name:

Class:

Date:

ch 8 - 13 c. The burst is observed because the first step is more rapid than the second step. d. The cleavage of the substrate does not obey Michaelis–Menten kinetics. e. The chromogenic substrate is not suitable to study chymotrypsin's mechanism of catalysis.

186. What type of the glycosidic bond is there in this disaccharide?

a. β-1,5 linkage b. α-1,4 linkage c. β-1,3 linkage d. α-1,3 linkage e. β-1,4 linkage 187. Which carbohydrate defines the B blood type? a. galactose linked to another galactose by an α-1,2 glycosidic bond b. N-acetylgalactosamine linked to galactose by an α-1,2 glycosidic bond c. galactose linked to N-acetylglucosamine by an α-1,3 glycosidic bond d. galactose linked to another galactose by an α-1,3 glycosidic bond e. N-acetylgalactosamine linked to galactose by an α-1,3 glycosidic bond 188. Which is NOT a function of lipids? a. intercellular signaling b. fuel source c. structural rigidity of the cytoskeleton d. membrane component e. source of intermediates for biosynthesis of other lipids 189. During the acidification inside erythrocytes, the specific way to stabilize the T state of hemoglobin is the formation of the salt bridge between: a. β1 His 146 and β2 Asp 94. b. β1 Asp 94 and N-terminal His of the β1 chain. c. α2 Lys 40 and β1 Asp 94. d. protonated β1 Asp 94 and C-terminal His of the β1 chain. e. β1 Asp 94 and protonated C-terminal His of the β1 chain.

190. What is the main function of lectins? a. inflammatory response b. glycosylation

Name:

Class:

Date:

ch 8 - 13 c. protein transport from the Golgi complex d. lubricants e. cellular contacts 191. Which bonds links monosaccharides in oligosaccharides? a. N-glycosidic bonds b. O-glycosidic bonds c. ester bonds d. N-linkages e. noncovalent interactions 192. What is the driving force for ion movement in the Knock-On model, which suggests that the ions never occupy adjacent sites? a. charge attraction b. patch-clamp c. interaction with carbonyl groups d. charge repulsion e. interaction with water 193. The R2C2 complex of PKA catalytically is inactive: a. at low concentrations of cAMP. b. in the absence of cAMP. c. at high concentrations of cAMP. d. in the absence of cAMP phosphodiesterase. e. after the dissociation of the R2C2 holoenzyme.

194. Choose the compound that is composed of a chain of hydrogen-bearing carbon atoms terminated with a carboxyl group. a. fatty acid b. triacylglycerol c. lipid d. carboxylic acid e. steroid 195. What component of the signal-transduction pathway transduces received information into other forms of information that can alter the cell's biochemistry? a. primary messenger b. second messenger c. membrane receptor d. activator e. ligand

Name:

Class:

Date:

ch 8 - 13 196. Some viruses gain entry into specific cells by: a. attaching to ion channels. b. cleaving the glycosidic bonds and altering protein shapes. c. binding to glycoproteins on the cell surface that are unique to specific cells. d. adding moieties of sialic acids to membrane proteins. e. changing permeability of membranes.

197. What is the common name of hexadecanoic acid? a. oleic acid b. stearic acid c. palmitic acid d. linoleic acid e. linolenic acid 198. What is one of the defects that lead to Hutchinson–Gilford progeria syndrome? a. The farnesyl group is not attached to the lamin precursor. b. The farnesyl group is not removed from the lamin precursor. c. The glycosylphosphatidylinositol anchor is not attached to the lamin precursor. d. The glycosylphosphatidylinositol anchor is not removed from the lamin precursor. e. Lamin is subject to hypermethylation.

199. Choose the CORRECT pathway of the phosphoinositide cascade. a. ligand → 7TM receptor → Gαq → adenylate cyclase → cAMP → dissociation of the R2C2 of the PKA → proteins phosphorylation → turning off by the cAMP phosphodiesterase 2+ b. ligand → tyrosine kinase receptor → Gαq → phospholipase C → PIP2 → IP3 releases Ca , while DAG activates PKC → proteins phosphorylation 2+ c. ligand → 7TM receptor → Gαq → phospholipase C → PIP2 → DAG releases Ca , while IP3 activates PKC → proteins phosphorylation d. ligand → 7TM receptor → Gαs → adenylate cyclase → cAMP → dissociation of the R2C2 of the PKA → proteins phosphorylation → turning off by the cAMP phosphodiesterase 2+ e. ligand → 7TM receptor → Gαq → phospholipase C → PIP2 → IP3 releases Ca , while DAG activates PKC → proteins phosphorylation

200. Which statement about P-type ATPases is FALSE? a. Ca2+ ATPase is the key enzyme in muscle contraction because it transports Ca2+ ions out of the cytoplasm. b. Na+-K+ ATPase utilizes about a third of the organism's total ATP. c. Release of Ca2+ from the sarcoplasmic reticulum is required for muscle contraction. d. Na+-K+ ATPase binds two ATP molecules to exchange Na+ and K+ ions. e. H+-K+ ATPase transports protons from the cells of the stomach wall.

Name:

Class:

Date:

ch 8 - 13 201. Which disaccharide comes from the hydrolysis of starch? a. maltase b. sucrose c. maltose d. amylose e. lactose 202. Choose the CORRECT statement about activation of G proteins. a. The ligand-binding site of the 7TM receptor lies near the cytoplasmic surface. b. The conformational change in the extracellular domain of the receptor activates a GTP-binding protein. c. GDP is bound in a pocket close to the surface at which the α subunit interacts with the βγ dimer. d. G proteins do not have the ability for self-deactivation. e. Gαi stimulates adenylate cyclase activity, thus increasing cAMP production.

203. Which statement regarding isomeric forms of carbohydrates is TRUE? a. Enantiomers of glyceraldehyde differ in the configuration of two asymmetric centers. b. Epimers appear due to a new asymmetric carbon that forms upon cyclization of a carbohydrate. c. Existence of the stereoisomers doesn't prevent existence of constitutional isomers for a particular carbohydrate. d. Diastereoisomers differ in the same asymmetric carbon. e. Among glucose anomers, the α form is the most abundant.

204. Phosphatidylinositol does NOT contain a(n): a. amino group. b. methylene group. c. ester linkage. d. carbonyl group. e. hydroxyl group.

205. Double-reciprocal plots are not used today to determine KM and Vmax for enzymes; however, they appear to be quite useful in studies of inhibition. Why? a. The slope of the line with the inhibitor relative to the slope of the line without the inhibitor gives information about whether the enzyme is regulated allosterically. b. The x axis determines kcat for the reaction with the inhibitor more accurately. c. The slope of the line provides information about the transition-state intermediate. d. The slope of the line with the inhibitor relative to the slope of the line without the inhibitor gives information about the mechanism of inhibition. e. The y axis can be used to determine binding constants for the substrate versus the inhibitor.

206. What ion is in the active site of the inositol monophosphatase and what ion replaces it and also is used to

Name:

Class:

Date:

ch 8 - 13 treat bipolar affective disorder? a. Na+ and K+, respectively b. Mg2+ and Ca2+, respectively c. Mg2+ and Li+, respectively d. Zn2+ and Pb2+, respectively e. Zn2+ and Mg2+, respectively 207. What is the maximal number of oxygen molecules that can be bound to one tetramer of normal adult hemoglobin A? a. 5 b. 4 c. 3 d. 2 e. 1 208. What is one of the sweetest chemicals known? a. β-D-glucose b. D-ribose c. D-deoxyribose d. β-D-fructopyranose e. β-D-fructofuranose 209. How many asymmetric carbon atoms are there in the β-D-glucopyranose molecule? a. 2 b. 3 c. 4 d. 5 e. 6 210. The presence of cis double bonds in fatty acids limits tight packaging and the number of interactions. a. hydrophobic b. ionic. c. nuclear d. hydrogen-bonding e. van der Waals 211. The action of 7TM proteins is important in what step of the generalized scheme of signal-transduction pathways? a. termination b. release of the primary messenger

Name:

Class:

Date:

ch 8 - 13 c. relay of information by the second messenger d. reception of the primary messenger e. activation of effectors 212. Lipid rafts: a. are complexes of cholesterol with saturated fatty acids and proteins that decrease overall Tm of the membrane. b. are small and dynamic regions rich in cholesterol that make phase transitions of the membrane less likely. c. can change membrane fluidity since they are large. d. increase membrane fluidity and at the same time are less prone to phase transitions. e. are complexes of cholesterol with unsaturated fatty acids and proteins that increase overall Tm of the membrane.

213. Carbon dioxide forms carbamate groups in hemoglobin by reacting with: a. aspartate residues. b. cysteine residues. c. N-terminal amino groups. d. tyrosine residues. e. heme.

214. In the double-reciprocal plot of the rate of catalysis depending on substrate concentration, the intercept with the y axis is the same in the presence and in the absence of the inhibitor. Choose the correct type of inhibitor. a. irreversible b. competitive c. uncompetitive d. noncompetitive e. The data are not enough to come to a conclusion.

215. What enzyme participates in pigment formation and has a low-temperature optimum? a. cyclooxygenase b. collagenase c. tyrosinase d. chymotrypsin e. pepsin 216. What are derived from the treatment of triacylglycerols with strong bases? a. salts of triacylglycerol b. diacylglycerols c. phosphatidic acids d. salts of fatty acids

Name:

Class:

Date:

ch 8 - 13 e. free glycerols 217. What is the cause of mucopolysaccharidosis? a. inability to degrade amino sugars b. overproduction of carbohydrates c. inability to degrade glycosaminoglycans d. dysregulation of GlcNAc transferase e. inability to synthesize amino sugars 218. is an antibiotic that functions at low concentrations as a noncompetitive inhibitor. a. Sulfanilamide b. P-aminobenzoic acid (PABA) c. Penicillin d. Doxycycline e. Diisopropylphosphofluoridate (DIPF) 219. What property is the basis for the proteoglycans of the cartilage to function as a shock absorber? a. Reversible nature of the bonds between negatively charged glycosaminoglycans and water. b. Reversible nature of the glycosidic bonds within proteoglycans. c. Irreversible nature of the glycosidic bonds within proteoglycans. d. Irreversible nature of the bonds between glycosaminoglycans and water. e. Reversible nature of the bonds between negatively charged carboxylate or sulfate groups and the proteins.

220. What is the oxidation state of the heme iron in myoglobin and hemoglobin under normal conditions? a. Fe2+ b. Fe3+ c. ferric ion d. oxidized e. Fe0 221. Which property is NOT associated with lipid membranes? a. asymmetry b. solvent for proteins c. self-assembled leaflets d. solvent for carbohydrates e. electric polarization 222. The mechanism by which insulin-signaling processes might be terminated includes: a. a change in temperature. b. the aggregation of all protein subunits.

Name:

Class:

Date:

ch 8 - 13 c. protein dephosphorylation by phosphatases. d. protein degradation by proteases. e. self-inhibition.

223. What allows an organism to sense its environment and formulate a proper biochemical response? a. oncogene b. proto-oncogene c. receptors d. primary messenger e. signal transduction 224. Where is the reactive bond of penicillin located? a. side chain b. thiazolidine ring c. pentaglycine bridge d. peptidoglycan e. β-lactam ring 225. Choose a catalytic mechanism where a molecule other than water plays the role of a proton donor or acceptor. a. covalent catalysis b. general acid–base catalysis c. metal ion catalysis d. catalysis by approximation and orientation e. irreversible catalysis 226. Choose the WRONG statement describing the coordination of the iron ion in hemoglobin. a. The Fe2+ ion is coordinated to the four nitrogen atoms in the center of the protoporphyrin of the heme. b. The fifth coordination site is occupied by the "proximal histidine" of the globin chain. c. The oxygen is bound to the sixth coordination site of the iron. d. The bonding between iron and oxygen leads to the rearrangement of electrons of the iron ion such that the number of electrons is decreased and the iron ion becomes effectively smaller. e. Histidine that occupies the fifth coordination site is capable of inhibiting oxidation of the iron to the ferric state.

227. What is the type of catalysis in which the proton donor is NOT water? a. acid–base b. metal ion c. approximation and orientation d. covalent e. noncompetitive

Name:

Class:

Date:

ch 8 - 13 228. What is the composition of the Ca2+-binding motif of the EF-hand protein family? a. helix-turn-helix b. helix-loop-helix c. β sheet d. leucine zipper e. zinc-fingers 229. Choose the CORRECT sequence of the olfactory signal-transduction cascade. a. odorant binds to the olfactory receptor → cross-phosphorylation and activation of the receptor → binding and phosphorylation of the adaptor proteins → the lipid kinase phosphoinositide 3-kinase converts PIP2 into PIP3 → activation of the PIP3-dependent protein kinase → phosphorylation and activation of Akt → initiation of an action potential b. odorant binds to the olfactory receptor → Gαs → adenylate cyclase → cAMP → dissociation of the R2C2 of the PKA → proteins phosphorylation → initiation of an action potential 2+

c. odorant binds to the olfactory receptor → Gαq → phospholipase C → PIP2 → IP3 releases Ca , while DAG activates PKC → proteins phosphorylation and initiation of an action potential d. odorant binds to the olfactory receptor → dimerization of the EGF receptor → cross-phosphorylation of the JAK2 proteins → Grb-2 protein binds to the phosphotyrosine residues of the receptor → recruiting of Sos protein → binding and activation of Ras protein → activation of the specific protein kinases → initiation of an action potential e. odorant binds to the olfactory receptor → Gα → adenylate cyclase → cAMP → activation of the nonspecific cation channel → flow of Ca2+ and other molecules into the cell → initiation of an action potential 230. Why can each activated insulin receptor phosphorylate multiple IRS molecules? a. An insulin receptor is dimeric even without ligand binding. b. An insulin receptor binds adaptor proteins. c. A phosphorylated insulin receptor doesn't hydrolyze spontaneously. d. The activated insulin receptor itself is a protein kinase. e. The activated insulin receptor recruits protein kinases.

231. In cyclic carbohydrates: a. steric hindrance between hydroxyl groups of the carbohydrate makes the "boat" conformation more stable. b. hydrogen atoms in the axial positions provide less steric hindrance since axial bonds are nearly perpendicular to the plane of the cycle. c. equatorial bonds are nearly parallel to the plane of the cycle in the "chair" form but nearly perpendicular in the "boat" form. d. hydrogen atoms in equatorial positions of the "boat" conformation cause more hindrance than in the "chair" conformation. e. axial bonds provide less steric hindrance for functional groups since they are nearly perpendicular to

Name:

Class:

Date:

ch 8 - 13 the plane of the cycle.

232. What is the term for the genes that normally regulate cell growth, but often cause cancer when mutated? a. oncogenes b. proto-oncogenes c. paragenes d. adaptor genes e. tumor-suppressor genes 233. Cholesterol and other steroids are not soluble in blood and therefore must be transported. Predict what chemical modifications must occur for cholesterol to move through the circulatory system. a. Cholesterol forms micelles in blood, the surface of which is hydrophilic and the interior hydrophobic. b. Cholesterol cannot be transported in blood, so it is broken down and resynthesized in all cells. c. Cholesterol moves through cell membranes from tissue to tissue. d. Cholesterol forms glycolipids with large carbohydrate complexes in order to increase solubility. e. Cholesterol is esterified to a fatty acid for transport by lipoprotein particles, the surface of which is hydrophilic and the interior hydrophobic.

234. What is the organic portion of the heme group in hemoglobin? a. carbonic acid b. histidine c. pyrrole ring d. carbamate e. protoporphyrin 235. Which enzyme digests amylopectin? a. α-amylase b. amylose c. cellulose d. lactase e. invertase 236. What is the term for an electron-deficient chemical that is attracted to the regions of negative charge in another molecule? a. ligand b. electrophile c. nucleophile d. inhibitor e. radical 237. What is the typical form of the curve describing dependence of enzymatic activity on temperature? a. bell-shaped curve with one maximum

Name:

Class:

Date:

ch 8 - 13 b. curve of two bells with two peaks c. sigmoidal d. hyperbolic e. growing curve with saturation 238. Potassium ion channels facilitate diffusion because: a. the K+ ion doesn't have to lose its solvation shell upon entering the cell. b. the channel decreases desolvation energy of the potassium ion by the selectivity filter. c. resolvation of the potassium ion within the channel costs more than its desolvation. d. the K+ ion loses its solvation shell upon entering the cell. e. the channel provides a concentration gradient.

239. How many double bonds does octadecatrienoic acid have? a. 0 b. 1 c. 2 d. 3 e. 4 240. Which fact about a fatty acid is indicated by the notation 12:2? a. There are 12 carbons in the chain with two double bonds. b. There are two 12-carbon chains for this fatty acid. c. The second carbon has a fatty acid double bond. d. The 12th carbon has a double bond. e. There are two trans double bonds on this 12-carbon fatty acid.

241. Choose the CORRECT sequence of the EGF signaling pathway. a. ligand binding → dimerization of the EGF receptor → self-phosphorylation of the JAK2 proteins → Sos protein binds to the phosphotyrosine residues of the receptor → recruiting of Grb-2 protein → binding and activation of Ras protein → activation of the specific protein kinases → cell growth promotion b. ligand binding → dimerization of the EGF receptor → cross-phosphorylation of the JAK2 proteins → Grb-2 protein binds to the phosphotyrosine residues of the receptor → recruiting of Sos protein → binding and activation of Ras protein → activation of the specific protein kinases → cell growth promotion c. ligand binding to the dimeric EGF receptor → self-phosphorylation of the JAK2 proteins → Sos protein binds to the phosphotyrosine residues of the receptor → recruiting of Grb-2 protein → binding and activation of Ras protein → activation of the specific protein kinases → cell growth promotion d. ligand binding to the dimeric EGF receptor → cross-phosphorylation of the JAK2 proteins → Grb-2 protein binds to the phosphotyrosine residues of the receptor → recruiting of Sos protein → binding and activation of Ras protein → activation of the specific protein kinases → cell growth promotion

Name:

Class:

Date:

ch 8 - 13 e. ligand binding → dimerization of the EGF receptor → cross-phosphorylation of the JAK2 proteins → Grb-2 protein binds to the phosphotyrosine residues of the receptor → activation of the specific protein kinases → recruiting of Sos protein → binding and activation of Ras protein → cell growth promotion 242. Choose the CORRECT statement about membrane permeability. a. Tryptophan crosses membranes 103 times more slowly than water. b. If a molecule easily crosses the solvation shell of the membrane, it can easily cross the whole membrane. c. Water can easily traverse through the membrane because it is amphipathic. d. Entry of sodium ions in the cell can increase membrane permeability for sodium ions. e. Nonpolar interactions with the core of the membrane are more favorable for Na+ than for K+.

243. N-linked oligosaccharides: a. don't contain N-acetylglucosamine. b. can't bind sialic acid to the pentasaccharide core. c. don't contain several mannoses. d. can't bind additional sugars to the mannose part of the pentasaccharide core. e. constitute the bigger part of glycoproteins.

244. What type of inhibitor binds irreversibly to the active site of an enzyme? a. suicide b. competitive c. uncompetitive d. noncompetitive e. reversible 245. Choose the WRONG statement about ketoses. a. The anomeric carbon exists only in the cyclic form of the monosaccharide such as fructose. b. The pyranose form of fructose predominates in the free solution. c. The C-1 keto group in the open-chain form of some ketoses can form an intramolecular hemiketal. d. The positioning of the keto group in the chain leaves ketoses with one fewer asymmetric center. e. Dihydroxyacetone is one of the smallest ketoses.

246. The configuration of most fatty acids in biological systems is predominantly: a. cis. b. trans. c. all-trans. d. Δ12. e. ω-3.

247. What statement about oxygen transport by hemoglobin is TRUE?

Name:

Class:

Date:

ch 8 - 13 a. Oxygen binds to the proximal histidine residue of the globin chain. b. Bonding of carbon dioxide to hemoglobin molecules increases the binding of oxygen. c. Hemoglobin binds more oxygen as the pH is lowered. d. Hemoglobin binds more oxygen at higher 2,3-BPG concentrations. e. The binding of each O2 molecule to hemoglobin increases its affinity for the next O2.

248. An aldehyde and alcohol can react to form a(n): a. hemialkyl. b. hemiketal. c. hemiacetal. d. amidyl. e. carbonyl.

249. Which carbon atom will always be outside of the ring in the cyclized form of the ketose? a. C-1 b. C-2 c. C-β d. C-5 e. C-6 250. What is a useful instrument to determine the reversible inhibition type? Choose the MOST accurate answer. a. Michaelis–Menten equation b. determination of the maximal rate of catalysis (Vmax) upon addition of the inhibitor c. determination of the apparent value for KM upon addition of the inhibitor d. Henderson–Hasselbalch equation e. double-reciprocal plots of the rate of catalysis at different concentrations of substrate upon addition of the inhibitor and without it 251. Which organisms do NOT have sterols in their membranes? a. bacteria b. fungi c. plants d. insects e. protozoa 252. Which carbon atom is anomeric in the furanose form of fructose? a. C-1 b. C-2 c. C-β d. C-5

Name:

Class:

Date:

ch 8 - 13 e. C-6 253. What amino acids can be phosphorylated? a. tyrosine, serine, threonine b. tyrosine, serine, tryptophan c. serine, threonine, asparagine d. histidine, serine, phenylalanine e. tyrosine, methionine, tryptophan 254. With how many positively charged amino acids does 2,3-BPG interact in each chain of deoxyhemoglobin? a. 1 b. 2 c. 3 d. 4 e. 6 255. What is the major site of accumulation of triacylglycerols in mammals? a. adipose tissue b. liver c. mitochondria d. endoplasmic reticulum e. insulating tissue 256. Why does fetal hemoglobin bind oxygen more tightly than adult hemoglobin? a. Fetal hemoglobin has a single mutation in the β subunit; therefore, it is called the γ chain. b. The substitution of a serine residue for histidine 143 in the γ chain of the 2,3-BPG-binding site causes reduced affinity for 2,3-bisphosphogycerate. c. The substitution of a histidine residue for serine 143 in the γ chain of the 2,3-BPG-binding site causes increased affinity for 2,3-bisphosphogycerate. d. One of the substitutions in the fetal α chain is alanine for proline, which facilitates a van der Waals interaction and depresses the formation of the R state. e. One of the changes in the fetal α chain is a substitution of proline for alanine, which disrupts a van der Waals contact and facilitates the formation of the R state.

257. Sickle-cell anemia is caused by: a. a decreased production of α chains of hemoglobin. b. a substitution of a Glu residue for a Phe residue at the β6 position. c. the loss of the heme group because the proximal His is oxidized. d. a substitution of a Val residue for a Glu residue at the β6 position. e. a substitution of a Glu residue for His at the C-terminal of the α chain.

258. Through which type of ion channels do neurotransmitters usually act?

Name:

Class:

Date:

ch 8 - 13 a. voltage-gated ion channels b. antiporters c. ligand-gated ion channels d. ABC transporters e. symporters 259. All of the following are repeating units of glycosaminoglycans EXCEPT: a. chondroitin 6-sulfate. b. keratin sulfate. c. hyaluronate. d. heparin. e. hemoglobin.

260. Cardiolipin does NOT contain a(n): a. phosphate group. b. methyl group. c. ester linkage. d. amino group. e. hydroxyl group.

261. An enzyme is optimally active at a neutral pH, but its activity drops off sharply if the pH is changed. What residue(s) is/are most likely in the active site of this enzyme? a. side chains of lysine and glutamate b. two histidine amino acid side chains c. a glycine amino acid d. polar side chains e. nonpolar side chains 262. Reducing sugars are called so due to a(n): a. ability of the cyclic form of the carbohydrate to reduce substances. b. disability of the open-chain form of the carbohydrate to reduce cupric ions. c. ability of the open-chain form of the carbohydrate to be oxidized. d. ability of the cyclic form of the carbohydrate to be oxidized. e. ability of the open-chain form of the carbohydrate to be reduced.

263. How many heme groups does a normal adult hemoglobin tetramer contain? a. 1 b. 2 c. 3 d. 4 e. 5

Name:

Class:

Date:

ch 8 - 13 264. Which amino acid residues in glycoproteins are the sugars commonly linked to? a. tyrosine and asparagine b. serine, threonine, and asparagine c. serine, tyrosine, and asparagine d. serine and threonine e. tyrosine, serine, threonine, and asparagine 265. What is the reason for using substrate analogs that form colored products in the study of kinetics and mechanisms of enzyme action? a. All of them are inhibitors. b. They covalently modify reactive groups in active sites of enzymes. c. They can be used as competitive inhibitors in a reaction with natural substrates. d. Formation of colored products can be readily monitored by spectrophotometers. e. Colored intermediates are formed of the substrate analogs.

266. What would happen to the resting potential if neurons were treated with tetrodotoxin? a. significant decrease b. it would disappear c. significant increase d. it would propagate e. no significant changes 267. Eating rich in the ω-3 fatty acids protects from: a. arachidonic acid; cardiovascular disease b. a low fat diet; cardiovascular disease c. fatty fish; cardiovascular disease d. shellfish; lung cancer e. vegetable oils; blood pressure 268. What is the chemical basis for cyclization of monosaccharides? a. Aldehyde can react with an alcohol to form a pyranose. b. The hydroxyl group of the sugar can attack carbonyl groups. c. The hydroxyl group of the monosaccharide is forced to react with its own carbonyl group due to the influence of alcohol. d. The carbonyl carbon of the sugar can attack the hydroxyl group of the same sugar. e. The hydroxyl group of the sugar can attack the carbonyl carbon of the same sugar.

269. What is the function of the aspartate 102 residue in the catalytic triad of chymotrypsin? a. It helps to stabilize the tetrahedral intermediate through hydrogen-bonding with it. b. It helps to collapse the tetrahedral intermediate by withdrawal of a proton from it. c. It acts as a donor of a hydroxyl group in the deacylation process. d. It helps to orient the histidine residue and make it a better proton donor through hydrogen-bonding

Name:

Class:

Date:

ch 8 - 13 and electrostatic effects. e. It helps to orient the histidine residue and make it a better proton acceptor through hydrogen-bonding and electrostatic effects.

270. Choose the proper order of permeability of molecules across a membrane, from the most to the least permeable molecules. a. water, glucose, urea, sodium ion b. water, indole, glucose, sodium ion c. water, indole, sodium ion, glucose d. indole, glucose, urea, sodium ion e. indole, water, glucose, sodium ion 271. What is the mechanism of action of the pertussis toxin secreted by Bordetella pertussis, the bacterium responsible for whooping cough? a. Protein kinase A stays active even in the absence of cAMP. b. The toxin modifies a Gαs-protein and stabilizes its active GTP-bound form. c. The genetic material is translocated 2+

d. The Gαi-protein is inactivated, which normally closes Ca

channels and opens K+ channels.

e. Protein kinase A opens a chloride channel and inhibits the Na+–H+ exchanger.

272. What is the typical protein content of mitochondrial membranes? a. 18% b. 25% c. 50% d. 75% e. 100% 273. Choose a FALSE statement about how oxygen binding to hemoglobin results in the T-to-R-state transition. a. When oxygen binds to hemoglobin, the iron ion moves out of the porphyrin plane. b. The movement of the iron ion causes changes in the quaternary structure that correspond to T-to-Rstate transition. c. The histidine residue bound in the fifth coordination site moves with the iron. d. Because proximal histidine is part of an α helix, the α helix moves as well. e. The carboxyl terminal of the α helix lies between the two αβ dimers.

274. In the human organism, myoglobin: a. helps to transport hydrogen ions in the body. b. helps to transport carbon dioxide from actively metabolizing tissues to lungs. c. facilitates the diffusion of oxygen to intercellular sites that require oxygen in muscles. d. is the main storage of carbon dioxide in muscles. e. binds oxygen in lungs where the partial pressure of oxygen is high and releases it in muscles in times

Name:

Class:

Date:

ch 8 - 13 of need.

275. What is the term for a gene that leads to the transformation of susceptible cell types into cell types with cancer-like characteristics? a. protein kinase A b. calmodulin c. fatty acids d. proto-oncogene e. oncogene 276. If a Lys residue is substituted with a Ser residue in the 2,3-bisphosphoglycerate (2,3-BPG) binding site of hemoglobin, 2,3-BPG would bind: a. 2 tighter because of the loss of a positive charge. b. tighter because of the gain of a positive charge. c. less tightly because of the loss of a positive charge. d. less tightly because of the gain of a positive charge. e. in the same way.

277. What is the main challenge for a protease to facilitate hydrolysis of a peptide bond? a. The peptide bond is very stable. b. The carbonyl group of a peptide bond is not very reactive; therefore, the catalytic mechanism must employ promotion of a nucleophilic attack of this group. c. The amino group of a peptide bond is not very reactive; therefore, the catalytic mechanism must employ promotion of a nucleophilic attack of this group. d. Peptide bonds are often buried under side chains; therefore, the catalytic mechanism must employ unfolding of a substrate protein to reach target bonds. e. The reaction is thermodynamically unfavorable.

278. The backbone of a phospholipid is a: a. glycerol. b. cholesterol. c. fatty acid chain. d. triacylglycerol. e. glucose.

279. What statement about small G-proteins is TRUE? a. They are heterotrimeric. b. Their molecular weight is 40–45 kDa. c. They cycle between an inactive GTP-bound form and an active GDP-bound form. d. Unlike G-proteins, they don't possess an intrinsic GTPase activity. e. The signal-transduction protein Ras belongs to the small G-proteins.

280. What process does NOT terminate the adenylate cyclase cascade?

Name:

Class:

Date:

ch 8 - 13 a. dissociation of the ligand–receptor complex b. conformation changes in the receptor c. self-deactivation of the G-protein by conversion of GTP into GDP d. conversion of cAMP into AMP by the cAMP phosphodiesterase e. dissociation of the PKA to subunits 281. According to the given scheme, what type of transport should be used to transport potassium ions to cells?

a. simple diffusion b. facilitated diffusion c. primary active transport d. coupled to Na+ antiport e. coupled to Cl– antiport 282. What is a term for an electron-rich chemical that is attracted to the regions of positive charge in another molecule? a. ligand b. electrophile c. nucleophile d. inhibitor e. radical Indicate one or more answer choices that best complete the statement or answer the question.

283. What are the smallest carbohydrates? Select all that apply. a. aldose b. altrose c. dihydroxyacetone d. ketose e. triose 284. Inhibitors against which viral enzyme have potential as anti-influenza agents? Select all that apply. a. calnexin

Name:

Class:

Date:

ch 8 - 13 b. neuraminidase c. selectin d. glycosyltransferase e. sialidase 285. Select all that apply. Lectins are proteins that: a. bind carbohydrates on glycoproteins and other macromolecules. b. promote cell-cell interaction. c. are found in animals and plants. d. exploit noncovalent interactions for binding carbohydrates. e. are never found in bacteria.

286. What force(s) stabilize(s) lipid bilayers? Select all that apply. a. van der Waals interactions b. electrostatic bonding between the polar heads and surrounding water c. covalent bonds between the lipid tails d. covalent bonds between the lipids and membrane proteins e. hydrogen bonding between the polar heads and surrounding water 287. Select all that apply. Most signal molecules can't pass through the cell membrane or through transporters because of their: a. large size. b. charge. c. high concentration. d. low concentration. e. small size.

288. Select all that apply. The nutritional storage forms of glucose in plants are: a. glycogen. b. amylose. c. amylopectin. d. starch. e. hemoglobin.

289. Select all that apply. The simplest carbohydrates are: a. D-glyceraldehyde. b. glycerate. c. dihydroxyacetone. d. L-glyceraldehyde. e. D-mannose.

290. Select all that apply. Carbohydrates are

_ with two or more hydroxyl groups.

Name:

Class:

Date:

ch 8 - 13 a. aldehydes b. ketones c. acids d. alcohols e. phenols 291. Which amino acids in chymotrypsin are found in the active site and are participants in substrate cleavage?

Select all that apply. a. His b. Asn c. Lys d. Ser e. Asp 292. What receptors initiate signal-transduction pathways through changes in quaternary structures after ligand binding? Select all that apply. a. seven-transmembrane-helix receptors b. G-protein-coupled receptors c. dimeric receptors that are protein kinases d. dimeric receptors that recruit protein kinases e. protein kinases 293. Select all that apply. Examples of diseases caused by altered G-protein activity include: a. whooping cough. b. arteriosclerosis. c. type 2 diabetes. d. cholera. e. Cushing's disease.

294. Select all that apply. Glycoproteins are normally: a. found on membranes. b. secreted as extracellular proteins. c. found inside organelles. d. found inside the nucleus. e. composed of structural components.

Enter the appropriate word(s) to complete the statement.

295. (CH2O)n is the basic empirical formula for _

.

296. Carbon dioxide reacts with the amino terminal groups of hemoglobin to form carbamate groups, which carry a charge.

Name:

Class:

Date:

ch 8 - 13 297. A(n) enzyme.

inhibitor has a structure similar to the substrate and reversibly binds to the active site of the

298. Unsaturation in fatty acids 299. The solvents.

melting points of lipids.

of small molecules is correlated with their relative solubilities in water and nonpolar

300. The shorthand notation indicating that there are two cis double bonds between carbons 9 and 10 and again between 12 and 13 is .

Name:

ch 8 - 13 Answer Key 1. c 2. d 3. d 4. b 5. b 6. d 7. a 8. d 9. d 10. a 11. d 12. e 13. a 14. b 15. b 16. e 17. d 18. c 19. b 20. d 21. c 22. c 23. c 24. b

Class:

Date:

Name:

ch 8 - 13 25. e 26. e 27. c 28. e 29. b 30. b 31. e 32. b 33. a 34. b 35. a 36. a 37. c 38. c 39. b 40. a 41. c 42. a 43. e 44. d 45. d 46. c 47. d 48. e 49. c

Class:

Date:

Name:

ch 8 - 13 50. e 51. a 52. d 53. b 54. b 55. b 56. d 57. e 58. a 59. c 60. e 61. e 62. b 63. c 64. e 65. c 66. e 67. b 68. d 69. e 70. b 71. a 72. e 73. e 74. d

Class:

Date:

Name:

ch 8 - 13 75. c 76. c 77. d 78. c 79. b 80. b 81. c 82. b 83. c 84. a 85. d 86. c 87. e 88. e 89. c 90. e 91. d 92. e 93. a 94. d 95. a 96. a 97. d 98. b 99. b

Class:

Date:

Name:

ch 8 - 13 100. c 101. c 102. a 103. e 104. a 105. b 106. b 107. a 108. d 109. a 110. e 111. e 112. e 113. b 114. c 115. e 116. b 117. b 118. c 119. c 120. b 121. a 122. e 123. c 124. a

Class:

Date:

Name:

ch 8 - 13 125. e 126. e 127. e 128. b 129. a 130. b 131. b 132. c 133. c 134. c 135. a 136. b 137. d 138. c 139. b 140. a 141. b 142. a 143. c 144. b 145. d 146. b 147. e 148. c 149. d

Class:

Date:

Name:

ch 8 - 13 150. c 151. c 152. b 153. c 154. b 155. c 156. d 157. b 158. b 159. b 160. c 161. d 162. d 163. d 164. b 165. d 166. d 167. b 168. c 169. b 170. d 171. c 172. d 173. c 174. e

Class:

Date:

Name:

ch 8 - 13 175. e 176. d 177. b 178. a 179. c 180. b 181. b 182. a 183. a 184. c 185. c 186. e 187. d 188. c 189. e 190. e 191. b 192. d 193. b 194. a 195. c 196. c 197. c 198. b 199. e

Class:

Date:

Name:

ch 8 - 13 200. d 201. c 202. c 203. c 204. a 205. d 206. c 207. b 208. d 209. d 210. e 211. d 212. b 213. c 214. b 215. c 216. d 217. c 218. d 219. a 220. a 221. d 222. c 223. e 224. e

Class:

Date:

Name:

ch 8 - 13 225. b 226. e 227. a 228. b 229. e 230. d 231. b 232. b 233. e 234. e 235. a 236. b 237. a 238. e 239. d 240. a 241. b 242. d 243. d 244. a 245. c 246. a 247. e 248. c 249. a

Class:

Date:

Name:

ch 8 - 13 250. e 251. a 252. b 253. a 254. c 255. a 256. b 257. d 258. c 259. e 260. d 261. a 262. c 263. d 264. b 265. d 266. e 267. c 268. e 269. e 270. b 271. d 272. d 273. a 274. c

Class:

Date:

Name:

ch 8 - 13 275. e 276. c 277. b 278. a 279. e 280. e 281. c 282. c 283. c, e 284. b, e 285. a, b, c, d 286. a, b, e 287. a, b 288. b, c, d 289. a, c, d 290. a, b 291. a, d 292. c, d 293. a, d 294. a, b, e 295. carbohydrates 296. negative 297. competitive 298. decreases 299. permeability

Class:

Date:

Name:

ch 8 - 13 300. Suggested Answer: cis, cis-Δ9, Δ12

Class:

Date:

Name:

Class:

Date:

ch 14 - 19 Indicate the answer choice that best completes the statement or answers the question.

1. Choose the CORRECT statements about ATP. a. The high phosphoryl-transfer potential of ATP can be explained by features of the ATP structure. b. Five factors differentiate stability of the reactants and products in ATP hydrolysis. c. The triphosphate unit of ATP carries about three negative charges at pH 7. d. The entropy of the reactants is greater than the entropy of the products in ATP hydrolysis. e. ΔG°´ depends on the difference in free energies of the products.

2. What is a common mechanistic feature of kinases? a. Phosphoryl groups are transferred from AMP to an acceptor. b. Binding of a substrate induces cleft closing. c. They convert aldoses to ketoses. d. They require Mg2+ for activity. e. The entire bound molecule of glucose becomes surrounded by the enzyme.

3. What causes the initial change in the conformation of citrate synthase? a. binding of acetyl CoA b. binding of oxaloacetate c. binding of water d. binding of ATP e. binding of NAD+ 4. Choose the correct coenzyme – transferring group pair? a. NADH – acyl b. tetrahydrofolate – electrons c. coenzyme A – acyl d. lipoamide – aldehyde e. thiamine pyrophosphate – glucose 5. What is the critical functional group of lipoamide responsible for carrying acetyl groups and maintaining the free energy of CoA? a. thioester group b. amide group c. tioether group d. carbamoyl group e. sulfhydryl group 6. What would be the result of a mutation in a gene coding pyruvate carboxylase? a. acidosis and hypoglycemia b. hyperglycemia c. liver cirrhosis

Name:

Class:

Date:

ch 14 - 19 d. polyuria e. malignant hyperthermia 7. What is the energy charge of resting muscle if concentrations of ATP, ADP, AMP, and Pi are 4 mM, 13 µM, 3 µM, and 10 mM, respectively? a. 0 b. 0.25 c. 0.5 d. 0.75 e. 1 8. What enzyme links the TCA cycle to the electron-transport chain? a. citrate synthase b. α-ketoglutarate dehydrogenase c. succinate dehydrogenase d. fumarase e. malate dehydrogenase 9. What are the consequences of biotin deficiency? a. lethargy and depression b. anorexia and insomnia c. headache and nausea d. blood-clotting disorder e. hepatitis 10. What is the function of a thioester intermediate such as the one formed from GAP? a. It speeds up the actual reaction so that a larger amount of product can be made. b. The thioester shifts the equilibrium of the first stage of the reaction. c. The thioester allows the two-step reaction to be coupled so the second reaction, the energetically unfavorable phosphorylation, can proceed. d. The thioester intermediate induces a conformational change that alters enzyme specificity. e. The thioester prevents the formation of metabolically unfavorable side products.

11. What enzyme of the TCA cycle produces L-malate? a. fumarase b. aconitase c. malate synthase d. isocitrate lyase e. succinate dehydrogenase 12. What is substrate-level phosphorylation? a. phosphorylation of AMP by ATP with 3-phosphoglycerate as a substrate

Name:

Class:

Date:

ch 14 - 19 b. ATP synthesis when the phosphate donor is a substrate with a high phosphoryl-transfer potential c. phosphorylation of glycolytic intermediates that have a high phosphoryl-transfer potential d. phosphorylation of ATP coupled to an ion gradient e. ATP and AMP synthesis from two molecules of ADP 13. What intermediate is formed upon isomerization of citrate to isocitrate? a. cis-aconitate b. semi-citrate c. trans-aconitate d. semi-isocitrate e. cis-aconitase 14. What is the purpose of phosphorylating glucose in cytosol? a. trap glucose in the cell b. destabilize glucose and facilitate the next series of metabolic steps c. convert it to a more soluble form d. receive more ATP from its metabolism e. trap glucose in the cell, destabilize it and facilitate the next series of metabolic steps 15. What would happen first if an enzyme mutation occurred that would seriously inhibit the activity of pancreatic amylase? a. The carbohydrates could not be transported into intestinal cells. b. The carbohydrates would be digested more quickly. c. The carbohydrates would not be shortened to smaller simple sugars. d. The polysaccharides would not be transported into the blood. e. Simple sugars would be resynthesized to di- or oligosaccharides.

16. How many electrons are transferred in the redox reactions of the TCA cycle upon catabolism of one molecule of glucose? a. 4 b. 8 c. 14 d. 16 e. 18 17. What do you call a pair of reactions: phosphorylation of fructose 6-phosphate to fructose 1,6-bisphosphate in the glycolytic pathway and its hydrolysis back to fructose 6-phosphate in the gluconeogenic pathway? a. isomerization b. glyoxylate cycle c. Calvin cycle d. citric acid cycle e. substrate cycle

Name:

Class:

Date:

ch 14 - 19 18. The E2 component of the pyruvate dehydrogenase complex contains a lipoyl group that is covalently attached to: a. the histidine residue of the enzyme. b. the lysine residue of the enzyme. c. the serine residue of the enzyme. d. the arginine residue of the enzyme. e. FAD. 19. Which statement about protein digestion is CORRECT? a. The proteins are denatured by the alkaline environment of the stomach. b. The proteins are not digested at the neutral environment of the intestine. c. The denaturation is caused by the breakage of sulfate bonds due to the low pH. d. The polypeptide products of pepsin digestion stimulate the release of the cholecystokinin. e. The pancreatic proteases only hydrolyze proteins into oligopeptides.

20. What type of enzyme catalyzes the intramolecular shift of a chemical group? a. hydrolase b. kinase c. dehydrogenase d. mutase e. isomerase 21. What factor promotes aerobic glycolysis? a. high insulin level b. pyruvate dehydrogenase kinase deficiency c. enhanced activity of pyruvate dehydrogenase kinase d. enhanced activity of pyruvate dehydrogenase phosphatase e. epinephrine rush 22. The patient has a delayed outflow of bile from the gallbladder. What may this condition lead to? a. Micelles would be formed correctly. b. Bile salts wouldn't be able to function normally. c. Bile salts wouldn't be formed from cholesterol. d. Chylomicrons wouldn't be able to function normally. e. Emulsification would be correct.

23. How are the glycolytic enzymes regulated? a. transcriptional control b. reversible phosphorylation c. allosteric control d. compensatory control

Name:

Class:

Date:

ch 14 - 19 e. control by concentration of products 24. Phosphofructokinase (PFK) is a highly regulated enzyme. What statement about PFK is CORRECT? a. AMP and ADP both bind to and stabilize the inactive conformation of fructose 6-phosphate. b. ATP can overcome the inhibition by citrate. c. Citrate is an inhibitor of PFK. d. Acidic conditions from anaerobic metabolism activate PFK. e. Fructose 2,6-bisphosphate is a potent activator of phosphofructokinase (PFK).

25. α-Amylase cleaves the of a polysaccharide such as starch and does not digest a limit dextrin because of . a. α-1,4 bonds; α-1,6 bonds b. α-1,6 bonds; α-1,4 bonds c. α-1,2 bonds; α-1,4 bonds d. α-1,2 bonds; α-1,6 bonds e. α-1,6 bonds; α-1,2 bonds 26. What is the event that ends the second stage of glycolysis? a. synthesis of ATP b. synthesis of glucose 6-phosphate c. synthesis of triose phosphates d. synthesis of pyruvate e. synthesis of NADH 27. What metabolic circumstance turns off the gene PEPCK in type 2 diabetes? a. insulin resistance b. hypoglycemia c. high level of amino acids in blood d. hypoglycemia e. phosphaturia 28. What is ΔG of gluconeogenesis? a. ΔG = 2 b. ΔG = 1 c. ΔG > 0 d. ΔG < 0 e. ΔG = 0 29. Hormonal activation of cyclic AMP levels will: a. activate protein kinase A phosphorylation of FBPase2. b. phosphorylate PFK2 on a tyrosine residue. c. lead to the activation of PFK.

Name:

Class:

Date:

ch 14 - 19 d. activate the PKC phosphorylation of PFK2. e. increase the activation of gluconeogenesis.

30. Which pathways should be stimulated in a muscle cell in resting state? a. catabolic pathways because energy charge is low b. catabolic pathways because energy charge is high c. amphibolic pathways because energy charge is 0 d. anabolic pathways because energy charge is low e. anabolic pathways because energy charge is high 31. What difference between NAD+ and FAD+ is FALSE? a. FAD+ has two reactive sites. b. NAD+ is synthesized from niacin. c. NAD+ has two reactive sites. d. FAD+ can accept two electrons. e. NAD+ can accept two electrons.

32. The citric acid cycle (CAC) is activated in the presence of oxygen, but what is the link between the CAC and oxygen? a. Oxygen is an allosteric activator for citrate synthase. b. The presence of O2 in the mitochondrial matrix releases CO2 into the cytosol. c. The one substrate-level phosphorylation in the CAC can occur in the absence of oxygen. d. A primary product of the CAC is NADH, the principle electron donor to O2. e. The iron–sulfur center requires oxygen to be in the appropriate oxidation state.

33. The result of lipase activity in digestion is: a. phospholipid head group hydrolysis. b. monoacylglycerol and two free fatty acids. c. bile salt formation. d. hydrolysis of membrane proteins. e. emulsion formation.

34. What compound is oxidized by a multienzyme complex that requires five different coenzymes? a.

b. c.

Name:

Class:

Date:

ch 14 - 19 d. e.

35. What is the name for a set of biochemical reactions by which food is converted into molecules? a. metabolism b. catabolism c. digestion d. enzymatic cleavage e. proteolytic destruction 36. What functional group actually yields carbon dioxide? a. acetyl b. carboxyl c. keto d. hydroxyl e. sulfhydryl 37. The Warburg effect is the conversion of glucose to a. lactate in the presence b. lactate in the absence c. fatty acids in the absence d. fatty acids in the presence e. acetyl CoA in the presence

of oxygen.

38. Calculate the net yield of ATP from glycolysis after consumption of 5 molecules of lactose. Consider that lactose is FULLY processed via glycolysis. a. 5 b. 10 c. 15 d. 20 e. 25 39. Why does steatorrhea occur? a. Emulsification takes place faster because of a lack of bile salts. b. Bile salts are not formed and cannot digest lipids. c. Bile salts are synthesized from cholecystokinin and cannot form micelles. d. Production of bile salts is insufficient; micelles cannot be formed. e. Production of bile salts is excessive; micelles cannot be formed.

Name:

Class:

Date:

ch 14 - 19 40. Why hydrophobicity of the kinases cleft upon binding of glucose is highly important? a. It favors a fast release of highly polar glucose. b. It prevents water from hydrolysis of glycopyranose. c. It attracts water to facilitate the phosphoryl group transfer. d. It prevents nonspecific energy consumption by the enzyme. e. It allows divalent ions to be used in the reaction.

41. PDH is inactive when it is: a. dephosphorylated. b. phosphorylated. c. acylated. d. oxidized. e. anchored in the membrane.

42. What covalent modification of the PDH complex is used to regulate its activity? a. phosphorylation b. glycosylation c. methylation d. adenylation e. ubiquitination 43. What reaction is catalyzed by aldolase? a. isomerization of DHAP to GAP b. ligation of GAP and DHAP c. reversible cleavage of F-1,6-BP to DHAP and GAP d. cleavage of DHAP to GAP e. irreversible aldol condensation of DHAP and GAP 44. What would happen if pH in the stomach decreased to 0.4? a. manifestation of gastroesophageal reflux disease b. work stoppage of the proton pump c. lack of protons d. decreased activity of lipid-digesting enzymes e. lack of zymogens activation 45. What statement about regulation of the TCA cycle is FALSE? a. α-Ketoglutarate dehydrogenase, like pyruvate dehydrogenase, is inhibited when the concentration of ATP is high. b. Both allosterically regulated enzymes of the TCA cycle are stimulated directly by the ADP. c. ATP and NADH are the only common regulators between three key control points of the citric acid cycle. d. The unique committed step of the cycle is hardly distinguishable due to involvement of its

Name:

Class:

Date:

ch 14 - 19 components in many metabolic pathways. e. Regulation of enzymes involved in the metabolism of citrate allows accounting for anabolic requirements of the cell.

46. If a lot of acetyl CoA and NADH were produced from fatty acid degradation, the PDH would be: a. subjected to degradation. b. dephosphorylated. c. activated. d. inhibited. e. dissociated.

47. Choose the CORRECT statement explaining importance of hydration for the phosphoryl-transfer potential of ATP. a. Effective hydrogen bonding with water molecules increases the free energy for ATP synthesis from the products of its hydrolysis. b. High resonance stabilization of orthophosphate makes the phosphoryl transfer to ADP less favorable. c. Effective hydrogen bonding with water molecules decreases the free energy for ATP synthesis from the products of its hydrolysis. d. A high concentration of water allows obtaining more energy from the hydrolysis of ATP, which increases the phosphoryl-transfer potential. e. A high concentration of water allows obtaining more energy from the hydrolysis of ATP, which decreases the phosphoryl-transfer potential.

48. What is necessary for reactivation of PDH to start the next catalytic cycle? a. protonation of the TPP carbanion b. oxidation of dihydrolipoamide c. phosphorylation d. dephosphorylation e. substantial ratio of ATP/ADP 49. What phosphoryl donor is used during oxaloacetate decarboxylation and phosphorylation? a. ADP b. ATP c. GDP d. GTP e. NTP 50. What class of enzymes exploits NAD+ in glycolysis? a. kinase b. mutase c. decarboxylase d. dehydrogenase

Name:

Class:

Date:

ch 14 - 19 e. enolase 51. What are the products of sucrose hydrolysis? a. glucose and galactose b. mannose and glucose c. galactose and fructose d. glucose and fructose e. two galactose molecules 52. What is the diameter of chylomicrons? a. 250 nm b. 90 nm c. 200 nm d. 2000 nm e. 98 nm 53. What is the final product of gluconeogenesis in most tissues? a. fructose 6-phosphate b. fructose 1,6-bisphosphate c. glucose d. glucose 6-phosphate e. phosphoenolpyruvate 54. What is the role of cholesterol in lipid digestion? a. Cholesterol cleaves bonds of lipids. b. Cholesterol transports free fatty acids through the intestinal cell membrane. c. Bile salts necessary for lipid digestion are synthesized from cholesterol. d. Cholesterol emulsifies micelles. e. Cholesterol activates lipases.

55. What is the net yield of ATP upon conversion of one molecule of glucose to two molecules of pyruvate? a. 1 b. 2 c. 3 d. 4 e. 5 56. Choose the CORRECT order of steps of the reaction catalyzed by succinyl CoA synthetase. a. Phosphorus atom of orthophosphate attacks the carbonyl carbon of succinyl CoA and displaces CoA → succinyl phosphate is formed → in another site, the phosphoryl group is transferred to ADP. b. Oxygen atom of orthophosphate attacks the carbonyl carbon of succinyl CoA and displaces CoA → succinyl phosphate is formed → His residue removes the phosphoryl group → phosphohistidine is

Name:

Class:

Date:

ch 14 - 19 formed and succinate is released → in another site, the phosphoryl group is transferred to ADP. c. ATP is hydrolyzed and phosphohistidine is formed → phosphohistidine swings in another site → phosphoryl group displaces CoA and succinyl phosphate is formed. d. Oxygen atom of orthophosphate attacks the carboxylic carbon of succinyl CoA and displaces CoA → succinyl phosphate is formed → in another site, the phosphoryl group is transferred from succinyl phosphate to His residue. e. Oxygen atom of orthophosphate attacks the carboxylic carbon of succinyl CoA and displaces CoA → succinyl phosphate is formed → in another site, the phosphoryl group is transferred to ADP. 57. Choose which property of glucokinase is TRUE. a. Overall, its activity depends on the transport of glucose by the GLUT4 transporter. b. Its activity depends on the presence of fructose 2,6-bisphosphate. c. Its dependence from the glucose concentration is similar to that of the GLUT2 transporter. d. Its activity depends on the activity of phosphofructokinase. e. Unlike hexokinase it catalyzes the committed step of glycolysis.

58. The hydrolysis of a phosphate group from ATP releases 30.5 kJ/mol, whereas the hydrolysis of a phosphate from glucose 6-phosphate releases only 13.82 kJ/mol. In that the product is the same, what accounts for the difference? a. ATP has greater resonance stabilization than the product orthophosphate. b. There is a greater increase in entropy when ATP is hydrolyzed. c. Water hydrates ATP to a greater degree than glucose 6-phosphate. d. ATP has a larger phosphoryl-transfer potential. e. The phosphate ester in ATP is more thermodynamically stable than in glucose 6-phosphate.

59. What compounds are monosaccharides? a. glucose and lactose b. galactose and maltose c. sucrose and glucose d. galactose and fructose e. lactose and sucrose 60. What reaction of the TCA cycle is, in part, driven by oxidative phosphorylation rather than a difference in free energy? a. citrate synthase b. fumarase c. malate synthase d. succinate dehydrogenase e. malate dehydrogenase 61. Which vitamin is important for synthesis of lipids? a. pantothenate

Name:

Class:

ch 14 - 19 b. biotin c. niacin d. thiamine e. adenine 62. What disrupts the components of the meal? a. symbiotic bacteria b. monosaccharides c. peptides d. zymogens e. enzymes 63. What subunit of the PDH decarboxylates pyruvate? a. E1 b. E2 c. E3 d. E4 e. E5 64. Lactose intolerance is caused by a deficiency of: a. lactase. b. elastase. c. lactose. d. sucrose. e. fructose.

65. The limit dextrin is: a. polysaccharide, digested by α-amylase. b. oligosaccharide, which has α-1,4 glycosidic bonds and is not digested by amylase. c. polysaccharide, which has α-1,4 and 1,6 glycosidic bonds. d. oligosaccharide which has α-1,6 bonds and is not digested by amylase. e. oligosaccharide, which has α-1,4 glycosidic bonds and is digested by amylase.

66. Which property is important for the energetic efficiency of glycolysis? a. equilibrium between triose phosphates b. hydrophobicity of the kinase cleft c. isomerization of aldoses to ketoses d. induced fit e. phosphoryl-transfer potential 67. How do intestinal cells protect themselves from the acidic environment?

Date:

Name:

Class:

Date:

ch 14 - 19 a. Pancreatic cells release secretin, which promotes the release of bicarbonates. b. Intestinal cells release secretin, which promotes the release of sodium bicarbonate. c. Intestine cells release sodium bicarbonate, which promotes the release of potassium carbonate. d. Intestinal cells release carbonates as a response to a low pH, which promotes the release of arrestin. e. Intestinal cells release sodium bicarbonate, which promotes the release of secretin.

68. What statement illustrates the role of Ca2+ in regulation of the PDH complex? a. Ca2+ activates phosphatase activity, deactivating PDH activity. b. Ca2+ is elevated in the cell with the increase of muscle contractions, activating PDH activity. c. Insulin causes a decrease in Ca2+, activating pyruvate dehydrogenase kinase activity. d. In liver, Ca2+ stimulates pyruvate dehydrogenase kinase, increasing conversion of pyruvate to acetyl CoA. e. Insulin causes an increase in intercellular Ca2+, inhibiting pyruvate dehydrogenase phosphatase activity.

69. The rate of the TCA cycle: a. increases if α-ketoglutarate dehydrogenase is stimulated. b. decreases if isocitrate dehydrogenase is stimulated. c. increases if α-ketoglutarate dehydrogenase is inhibited. d. decreases if isocitrate lyase is stimulated. e. increases if citrate synthase is stimulated.

70. In muscle, the enzyme that catalyzes a substrate-level phosphorylation is: a. nucleoside triphosphate transferase. b. protein kinase C. c. GTP kinase. d. succinyl CoA synthetase. e. ATP-GTP transferase.

71. What role does isocitrate lyase play in allowing plants to grow on acetate? a. Isocitrate lyase hydrolyzes isocitrate to form malate and acetate; acetate is used to synthesize fatty acids. b. Isocitrate lyase hydrolyzes isocitrate to form malate and acetate; acetate is used to synthesize glucose. c. Succinate formed by isocitrate lyase is an intermediate in glucose synthesis via gluconeogenesis. d. One of the isocitrate lyase products is a potent inhibitor of pyruvate kinase. e. One of the isocitrate lyase products is an intermediate in steroid synthesis.

72. Why is oxidation catalyzed by glyceraldehyde 3-phosphate dehydrogenase spontaneous? +

a. The free energy of the thioester intermediate is lower than that of GAP, NAD , and H2O.

Name:

Class:

Date:

ch 14 - 19 b. Acyl-phosphate formation is promoted by inorganic phosphate by increasing the phosphoryl-transfer potential. +

c. The free energy of the thioester intermediate is higher than that of GAP, NAD , and H2O. d. The thioester intermediate is more stable than 1,3-BPG. e. The free energy of the thioester intermediate is lower than that of 1,3-BPG. 73. What statement concerning acetyl CoA is FALSE? a. Acetyl CoA contains a pyrimidine ring. b. Acetyl CoA is the fuel for the citric acid cycle. c. The pyruvate dehydrogenase complex is not the only source of acetyl CoA. d. Acetyl CoA is esterified thiol. e. In resting human muscle, pyruvate is first converted into acetyl CoA. 74. What process takes place on the cytoplasmic face of the smooth endoplasmic reticulum? a. resynthesis of the triacylglycerols from fatty acids and monoacylglycerol b. synthesis of chylomicrons from triacylglycerols, proteins, cholesterol c. resynthesis of the triacylglycerols from amino acids and diacylglycerol d. synthesis of chylomicrons from monoacylglycerols e. synthesis of the monoacylglycerol from triacylglycerols 75. What strategy does the liver use to maintain adequate levels of glucose in the blood for use by other tissues? a. Glucose 6-phosphatase has a low KM for glucose 6-phosphate so that glycogen is formed only when glucose is plentiful. b. Transporters named T1, T2, and T3 are responsible for transporting glucose 6-phosphate in and glucose and inorganic phosphate out of the mitochondrion for gluconeogenesis. c. Pyruvate is transported out of the mitochondrion via the oxaloacetate shuttle when glucose levels in the blood are low. d. Glucose 6-phosphatase is bound to the lumen side of the ER, where the products of this enzyme reaction are then transported back to the cytoplasm. e. None of the answers is correct.

76. What substrate is used to synthesize glucose in the absence of oxygen? a. phosphoenolpyruvate b. oxaloacetate c. citrate d. lactate e. fructose 77. Which statement describes appropriate pyruvate kinase activity if there is enough ATP and alanine? If there is enough ATP and alanine, pyruvate kinase: a. is inhibited by citric acid. b. catalyzes the transfer of a phosphate group from fructose 6-phosphate to ADP.

Name:

Class:

Date:

ch 14 - 19 c. catalyzes formation of oxaloacetate from pyruvate. d. is inhibited only by alanine. e. is inhibited by these factors.

78. The formation of phosphoenolpyruvate from pyruvate in the gluconeogenic pathway has a ΔG° of: a. +7.8 kJ mol–1. b. –0.8 kJ mol–1. c. +0.8 kJ mol–1. d. +31 kJ mol–1. e. –31 kJ mol–1.

79. Where is the active site of E2 located? a. in the long hydrophobic channel inside the enzyme b. on the long flexible arm c. closely to the E1 active site d. on the surface of the hollow cube e. at the subunit interface inside the cube 80. What process takes part in NAD+ regeneration? a. metabolism of fructose b. synthesis of triose phosphates c. metabolism of pyruvate d. synthesis of pyruvate e. aldolase reaction 81. What is the major purpose of the citric acid cycle? a. reduction of NAD+ leading to the capture of high-transfer-potential electrons b. synthesis of citric acid c. utilization of pyruvate d. oxidation of carbon atoms leading to the capture of high-transfer-potential electrons e. generation of ATP due to the capture of high-transfer-potential electrons 82. Reaction pathways that only transform fuels into cellular energy are: a. anabolic. b. catabolic. c. allosteric. d. amphibolic. e. catalytic.

83. Which of the glycolytic enzymes catalyzes the reaction that does NOT require nucleotide-based cofactors

Name:

Class:

Date:

ch 14 - 19 and has two products? a. aldolase b. phosphoglucomutase c. hexokinase d. glyceraldehyde 3-phosphate dehydrogenase e. phosphoglycerate mutase 84. What molecule should be giving more energy upon catabolic conversion? a.

b.

c.

d.

e.

85. Choose the CORRECT order of steps of the reaction catalyzed by citrate synthase. a. binding of two oxaloacetate molecules → binding of two acetyl CoA molecules → cleavage and release of two CoA molecules → release of two citryl CoA molecules b. binding of oxaloacetate → binding of acetyl CoA → condensation to citryl CoA → cleavage and release of CoA → release of citrate c. binding of acetyl CoA → binding of oxaloacetate → condensation to citrate → cleavage and release of CoA → release of citrate d. binding of two acetyl CoA molecules → binding of two oxaloacetate molecules → condensation to two citryl CoA → cleavage and release of two citrate and two CoA molecules e. binding of oxaloacetate → binding of acetyl CoA → condensation to citrate and release of CoA 86. How many reactive sites are there in coenzyme A? a. 1 b. 2 c. 3 d. 4

Name:

Class:

Date:

ch 14 - 19 e. 5 87. What amino acid residue catalyzes the transfer of a phosphate group in the course of one of the steps of the citric acid cycle? a. histidine b. glutamate c. glutamine d. serine e. cysteine 88. Choose the statement that sums up reciprocal regulation of gluconeogenesis and glycolysis. a. When glucose is abundant, gluconeogenesis will predominate. b. When glucose is scarce, glycolysis will predominate. c. When glucose is abundant, glycolysis will predominate. d. When glucose is abundant, glycogenolysis will predominate. e. When glucose is abundant, glycolysis will be stopped.

89. What enzyme catalyzes formation of fructose 2,6-bisphosphate from fructose 6-phosphate? a. phosphofructokinase 2 b. pyruvate carboxylase c. glucose 6-phosphatase d. phosphoenolpyruvate carboxykinase e. fructose bisphosphatase 2 90. In which of the following tissues is the major site for gluconeogenesis located? The major site for gluconeogenesis is located in: a. the brain. b. the liver. c. striated muscle. d. adipose tisue. e. red blood cells.

91. How many bypassed reactions does gluconeogenesis have? a. 1 b. 2 c. 3 d. 6 e. 10 92. What disease is characterized by the development of a cataract and by the absence of a specific transferase in red blood cells? a. beriberi

Name:

Class:

Date:

ch 14 - 19 b. classic galactosemia c. pellagra d. Warburg effect e. lactose intolerance 93. What vitamin is essential for thiamine pyrophosphate synthesis in humans? a. B1 b. B5 c. B2 d. B6 e. PP 94. What is gluten enteropathy? a. celiac disease that is triggered in susceptible individuals by hordein in wheat, secalin in rye, and gliadin in barley b. a pancreatic inflammatory disorder that is triggered in susceptible individuals by proteins in wheat, rye, and barley c. celiac disease that is triggered by intolerance to animal proteins d. a pancreatic inflammatory disorder that is triggered in susceptible individuals by protein in rice, soya bean, and barley e. an intestinal inflammatory disorder that is triggered in susceptible individuals by gliadin in wheat, secalin in rye, and hordein in barley 95. How many protons can bind to FAD+ upon dehydrogenation of a substrate? a. 1 b. 2 c. 3 d. 4 e. 5 96. What is the reason active skeletal muscle forms lactate through lactic acid fermentation? a. Skeletal muscles don't have enough time to relax. b. Lactic acid is an unstable acid. c. The level of glucose is too high. d. The rate of glycolysis exceeds the rate at which muscle can process pyruvate aerobically. e. There is not enough hemoglobin in blood during the work of active skeletal muscle.

97. What is the common energy currency of the cell? a. ΔG°´ b. ΔG c. NAD+

Name:

Class:

Date:

ch 14 - 19 d. acetyl CoA e. ATP 98. What metabolic motif is common between the citric acid cycle and synthesis of fatty acids? a. oxidation-oxidation-oxidation b. dehydrogenation-dehydrogenation c. reduction-reduction-reduction d. condensation-condensation e. oxidation-hydration-oxidation 99. What condition is a result of PDH phosphatase deficiency? a. overstimulated PDH b. low blood glucose c. chronic elevated plasma lactate d. high levels of acetyl CoA e. increased synthesis of fatty acids 100. Which of the following does NOT inhibit the activity of phosphofructokinase in muscle cells? a. high level of ATP b. high pH c. low level of AMP d. low pH e. high energy charge of the cell 101. What enzyme activates trypsin? a. zymogenase b. pepsin c. trypsinase d. enteropeptidase e. carboxypeptidase 102. Which biological molecules are responsible for controlling the rate of gluconeogenesis? a. fructose 6-phosphate amino acids b. amino acids and nucleic acids c. glucose 6-phosphate and glucose d. pyruvate and fructose 1,6-bisphosphate e. lactate and glycerol 103. Where does the final step in the generation of free glucose primarily take place? a. cytoplasm of any cells b. mitochondria of hepatocytes c. mitochondria of skeleton muscle cells

Name:

Class:

Date:

ch 14 - 19 d. endoplasmic reticulum of hepatocytes e. endoplasmic reticulum of cardiac muscle 104. Choose the conditions when PDH is activated. a. NAD+/NADH ratio is low b. acetyl CoA/CoA ratio is high c. the mitochondrial Ca2+ level is high d. ADP/ATP ratio is low e. the energy charge is high 105. What transporter allows entrance of fructose into the intestinal cells? a. proton pump b. SGLT c. GLUT5 d. GLUT2 e. FABP 106. Taking into account the daily glucose requirement in a typical adult human being, calculate the weekly requirement for the whole body. a. 1120 g b. 840 g c. 1330 g d. 140 g e. 1960 g 107. The actions of which glucose transporters indirectly lead to the secretion of insulin and directly lead to the increased uptake of glucose in the presence of insulin? a. GLUT1 and GLUT2 b. GLUT1 and GLUT3 c. GLUT2 and GLUT3 d. GLUT2 and GLUT4 e. GLUT1 and GLUT5 108. Which statement about the role of isomerization in glycolysis is FALSE? a. Formation of the monosaccharide that is more stable in the open-chain form is of high importance for the first stage of glycolysis. b. Isomerization of hexoketose to hexoaldose is the base for the regulatory interplay between phosphofructokinase and glucokinase. c. The isomerization of ketose to aldose in the end of the first stage of glycolysis increases the net yield of ATP. d. The intramolecular shift of the phosphate group increases energy yield from the milk sugar. e. The phosphoryl shift near the end of glycolysis creates the base for the subsequent internal

Name:

Class:

Date:

ch 14 - 19 oxidation–reduction that will markedly elevate the transfer potential of that phosphoryl group.

109. What is the main role of the extra cost of gluconeogenesis rather than glycolysis in terms of nucleoside triphosphate molecules? a. Nucleoside triphosphates provide more energy for active muscle activity. b. Additional nucleoside triphosphates are needed to turn an energetically unfavorable process into a favorable one. c. Energy is used for lipid breakdown. d. Nucleoside triphosphate molecules are used for nucleic acid metabolism. e. Energy is saved up as reserves.

110. What criterion is necessary for the metabolic pathway to exist? a. All enzymes should have features that allow precise recognition of regulatory molecules. b. All individual reactions should be thermodynamically stable. c. The overall pathway should be exergonic. d. All individual reactions should be kinetically stable. e. The overall pathway should be endergonic.

111. What enzyme catalyzes the first redox reaction of the TCA cycle? a. pyruvate dehydrogenase b. isocitrate lyase c. α-ketoglutarate dehydrogenase d. isocitrate dehydrogenase e. malate dehydrogenase 112. A young child with normal development had diarrhea, vomiting, and abdominal pain after eating.

Exclusion of milk from the diet did not give a positive result. After feeding with sucrose, the level of glucose in the blood barely increased. Why could such symptoms occur? a. hereditary lactase deficiency b. secondary lactase deficiency c. disorders of transporters d. deficiency of amylase e. hereditary insufficiency of sucrase 113. Metabolic pathways that require an input of energy and are often biosynthetic processes are: a. anabolic. b. catabolic. c. allosteric. d. amphibolic. e. catalytic.

114. Fructose can enter glycolysis at two distinct points, depending on the tissue. How is fructose metabolized in adipose tissue?

Name:

Class:

Date:

ch 14 - 19 a. Fructose is cleaved to two molecules of GAP. b. Fructose is converted to fructose 1-phosphate. c. Fructose is converted to fructose 6-phosphate. d. Fructose is cleaved to GAP and DHAP. e. Fructose is converted to glucose, which enters the pathway.

115. What is the fate of acetyl CoA if NADH levels are high? a. oxidation to CO2 b. synthesis of fatty acids c. synthesis of glucose d. generation of energy e. synthesis of pyruvate 116. Why does acetyl CoA, a product of fatty acid catabolism, influence the pyruvate dehydrogenase complex (PDH), a control point in carbohydrate catabolism? a. When fatty acid breakdown is inhibited, ADP is low, causing a decrease in the activity of PDH. b. When fatty acid breakdown is inhibited, PDH is inhibited by acetyl CoA due to the phosphatase activity. c. When fatty acid breakdown is high, ADP is low and PDH is inhibited by the phosphatase activity. d. When fatty acid breakdown is high, PDH is inhibited by acetyl CoA due to the PDH kinase activity. e. When fatty acid breakdown is high, NADH levels drop, causing an increase in the E2 activity.

117. How are the three active sites of PDH connected to each other in E. coli? a. The subunits of PDH are bound together covalently. b. The subunits of PDH are linked by hydrophobic interactions. c. The subunits of PDH are linked together with the aid of another protein, E3-BP. d. The subunits of PDH are linked together with the aid of NAD+ and CoA. e. The long flexible arm of E2 carries the substrate from one active site to another.

118. What statement describes lipids rather than proteins and carbohydrates? a. They are not digested in small intestine. b. They are converted into an emulsion in the intestine. c. They are not fuel for cells and tissues. d. They form globular structure called monoacylglycerols. e. They are not soluble in water.

119. What statement about zymogens is FALSE? a. All digestive enzymes, except amylase, are synthesized in the inactive forms. b. Before secretion, zymogens exist in granules near the cell membrane. c. Zymogens are inactivated when a part of the precursor is proteolytically cleaved. d. A pancreatic zymogen trypsinogen can be cleaved to form an enzyme such as trypsin.

Name:

Class:

Date:

ch 14 - 19 e. Pepsinogen has a small amount of enzyme activity.

120. Choose the CORRECT sequence of starch digestion in the intestine. a. α-Amylase cleaves the α-1,6 bonds of starch to maltose, maltotriose, and limit dextrin → inside of the intestinal cells, α-glucosidase digests maltose, maltotriose, also α-dextrinase digests the limit dextrin to simple sugars. b. α-Amylase cleaves the α-1,4 bonds of starch to maltose, maltotriose and limit dextrin → on the surface of the intestinal cells, α-glucosidase digests maltose, maltotriose, also α-dextrinase digests the limit dextrin to simple sugars. c. α-Amylase cleaves the α-1,4 bonds of starch to maltose, galactose and limit dextrin → on the surface of the intestinal cells, α-glucosidase digests glucose, galactose, also α-dextrinase digests the limit dextrin to simple sugars. d. α-Amylase cleaves the α-1,6 bonds of dextrin to maltose → on the surface of the intestinal cells, αglucosidase digests glucose, galactose, also α-dextrinase digests maltose to simple sugars. e. α-Amylase cleaves the α-1,4 bonds of cellulose to maltose, maltotriose and limit dextrin → on the surface of the blood cells, α-glucosidase digests maltose, maltotriose, also α-dextrinase digests the limit dextrin to simple sugars.

121. Chylomicrons are: a. transport particles for the transfer of lipids into the intestinal cells. b. transport particles consisting of monoacylglycerols, proteins, and cholesterol. c. specific transport proteins for transport of carbohydrates into cells. d. transport particles consisting of triacylglycerols, proteins, phospholipids and cholesterol. e. globular structures formed by small lipids in aqueous solutions.

122. How many reactive sites are there in NADP+? a. 1 b. 2 c. 3 d. 4 e. 5 123. The regulation of which glycolytic enzyme indirectly depends on the cell energy charge in muscle cells? a. aldolase b. hexokinase c. enolase d. phosphofructokinase e. pyruvate kinase 124. A person has not eaten fats for a long time, but received a sufficient amount of carbohydrates and proteins.

After that, he was diagnosed with symptoms of a lack of vitamins, especially vitamins A, D, E, and K. Suggest the possible reason of hypovitaminosis. a. Water-soluble vitamins couldn't be absorbed.

Name:

Class:

Date:

ch 14 - 19 b. Micelles couldn't be formed to transport vitamins. c. Fat-soluble vitamins couldn't be absorbed. d. The diet, rich in proteins and carbohydrates, didn't contain vitamins. e. Fats take part in catabolism of vitamins.

125. What is the function of glyceraldehyde 3-phosphate dehydrogenase? a. oxidation by NAD+ and formation of acyl-phosphate b. oxidation of the alcohol to an aldehyde c. dehydration and dephosphorylation of GAP d. hydrolysis of GAP e. catalyzes the transfer of a phosphoryl group from ATP to an acceptor 126. The energy of which reaction yields ATP in glycolysis? a. oxidation of carbon b. acyl-phosphate formation c. attachment of Pi d. oxidation of NADH e. reduction of NAD+ 127. Choose the energy source required for synthase- and synthetase-catalyzed reactions of the TCA cycle. a. high phosphoryl-transfer potential b. oxidative decarboxylation c. thioester bond d. oxidative phosphorylation e. high acetyl-transfer potential 128. FAD is an electron carrier that is derived from the vitamin: a. pantothenate. b. niacin. c. riboflavin. d. thiamine. e. folate.

129. Although we study the citric acid cycle as the final stage in the oxidation of carbon from glucose, an indepth look at the cycle shows intermediates entering and leaving the cycle from a number of metabolic pathways. With all of these demands on the cycle, how does it maintain a minimal level of oxaloacetate (OAA) to allow the cycle to function? a. OAA can be formed by the condensation of two moles of acetyl CoA and occurs when the energy charge of the cell is high. b. The rate of the cycle increases when the cell has high levels of NADH. c. Isocitrate dehydrogenase is allosterically inhibited by ADP, which signifies the need for more

Name:

Class:

Date:

ch 14 - 19 energy. d. OAA is formed directly via the deamination of glutamate. e. OAA is synthesized via pyruvate carboxylase in an anaplerotic reaction that occurs when acetyl CoA is present.

130. What is the name for a reaction that replenishes pathway components? a. aerobic b. anaerobic c. anaplerotic d. anabolic e. allosteric 131. How many high-energy phosphate bonds are consumed in gluconeogenesis? a. 3 b. 6 c. 2 d. 4 e. 1 132. What is the CORRECT order of steps of conversion of pyruvate into acetyl CoA? a. decarboxylation, oxidation, transfer to CoA b. decarboxylation, transfer to CoA, transfer to lipoamide, oxidation c. oxidation, decarboxylation, transfer to CoA d. oxidation, transfer to lipoamide, decarboxylation e. oxidation, decarboxylation, transfer to CoA, recovery of lipoamide 133. What is released by the upper intestine and increases zymogen secretion? a. secretin b. pepsin c. cholecystokinin d. bile salts e. enteropeptidase 134. An anti-enzyme drug Gordox is extracted from the pancreas of cattle and is used in the treatment of pancreatitis. Suggest the possible mechanism of action of Gordox. a. Pancreatitis develops as a result of premature activation of pancreatic peptidases. Gordox is an inhibitor of trypsin, so it does not allow trypsin to move into blood. b. Pancreatitis develops as a result of premature activation of pancreatic peptidases. This may lead to the transport of trypsin into the blood due to pancreatic cells destruction. Gordox is an inhibitor of trypsin, so it inhibits the action of the enzyme on plasma proteins. c. Pancreatitis develops as a result of trypsin exit into the blood. Gordox is an inhibitor of trypsin, so it inhibits the activation of the enzyme.

Name:

Class:

Date:

ch 14 - 19 d. Pancreatitis develops as a result of a disorder in lipid digestion. Gordox is an inhibitor of cholecystokinin, so it inhibits the action on the pancreas. e. Pancreatitis develops as a result of disrupted zymogen activation. Gordox is an inhibitor of trypsinogen, so it inhibits the action of zymogen on the pancreas.

135. What coenzyme accepts electrons to reoxidize dihydrolipoamide in PDH? a. TPP b. CoA c. FAD d. NAD+ e. NADP 136. Glucose transport into intestinal epithelial cells takes place by: a. active transport using the sodium sucrose gradient. b. active transport using ATP as the energy source. c. passive transport using the sodium glucose gradient. d. secondary active transport using the potassium glucose gradient. e. secondary active transport using the sodium glucose cotransporter.

137. What reactions take place in the lactic acid fermentation of glucose starting with pyruvate? a. First, pyruvate is decarboxylated and then formed acetaldehyde is oxidized by NAD+. b. Pyruvate is reduced by NADH to yield lactate. c. First, pyruvate is decarboxylated and then formed acetaldehyde is reduced by NADH. d. Pyruvate is oxidized by NAD+ to yield lactate. e. Pyruvate is dehydrated to acetaldehyde, which is then decarboxylated to lactate.

138. What process can increase the phosphoryl-transfer potential of ATP? a. decreased solvation of products of ATP hydrolysis b. increase in the number of molecules upon hydrolysis c. decreased net charge of products due to resonance d. decrease in the number of molecules upon hydrolysis e. increased net charge of reactants due to resonance 139. The standard free energy for hydrolysis of the phosphoanhydride bond of ATP is –30.5 kJ mol–1 (–7.3 kcal mol–1) and for hydrolysis of the phosphoester bond of fructose 1,6-bisphosphate is –16.7 kJ mol–1 (–4.0 kcal mol–1). Which of the molecules has a greater phosphoryl transfer potential and why? a. ATP; because it is spontaneous b. fructose 1,6-bisphosphate; because phosphoester bonds are higher in energy c. ATP; because only phosphoanhydride bonds provide energy that is high enough d. fructose 1,6-bisphosphate; because the overall energy difference between reactants and products is favorable

Name:

Class:

Date:

ch 14 - 19 e. ATP; because the overall energy difference between reactants and products is favorable 140. Gluconeogenesis often ends with the formation of glucose 6-phosphate. Why does this happen? a. Most tissues lack glucose 6-phosphatase as a membrane transporter. b. Glucose 6-phosphate cannot convert into glucose because the reaction is energetically unfavorable. c. Glucose 6-phosphate is not hydrolyzed in the endoplasmic reticulum lumen. d. Glucose 6-phosphate is a stable compound. e. The formation of glucose 6-phosphate is the final step of gluconeogenesis.

141. The bifunctional enzyme is also known as: a. phosphofructokinase I. b. phosphofructokinase II. c. fructose 1-6 phosphatase. d. protein kinase 2. e. phosphoenolpyruvate carboxykinase.

142. What process (or condition) couples glycolysis that takes place in the cytoplasm of the cell with the citric acid cycle carried out in mitochondria? a. pyruvate transport into mitochondria b. acetyl CoA transport into mitochondria c. lactate transport into mitochondria d. lipoamide transport into mitochondria e. PDH transport into mitochondria 143. The ΔG°' for the sum of reactions in the pyruvate dehydrogenase complex is –33.4 kJ/mol. What is the primary contribution to this large and negative free-energy change? a. In E2, two electrons are transferred from FADH2 to NADH, a thermodynamically favored transfer. b. The product of the reaction, acetyl CoA, is shuttled into the mitochondria, keeping the cytosolic concentration low. c. Free energy from the decarboxylation step drives the formation of NADH. +

d. In E3, two electrons are transferred from FADH2 to NAD , a thermodynamically favored transfer. e. The oxidation of dyhydrolipoamide by E3 gives the largest contribution to ΔG°' of the whole process.

144. Choose the CORRECT sequence of protein digestion: a. Action of high pH and pepsinogen in the stomach → activation of CCK in the pancreas and release of digestive enzymes → in the intestine lumen, oligopeptides are formed by pancreatic proteases → on the internal surface of intestine cells, amino acids, di- and tripeptides are formed by peptidases → transport into the blood. b. Activation of CCK in the pancreas and release of digestive enzymes → in the intestine lumen, diand tripeptides are formed by pancreatic proteases → in the cytoplasm of intestine cells, amino acids are formed by specific peptidases. c. Action of low pH and pepsin in the stomach → activation of CCK in the pancreas and release of

Name:

Class:

Date:

ch 14 - 19 digestive enzymes → in the small intestine lumen, oligopeptides are formed by pancreatic proteases → on the external surface of intestine cells, amino acids, di- and tripeptides are formed by specific peptidases. d. Release of digestive enzymes in the small intestine → in the intestine lumen, di- and tripeptides are formed by proteases → in the cytoplasm of intestine cells, amino acids are formed by specific peptidases. e. Action of low pH and pepsin in the stomach → activation of enteropeptidase and release of pancreatic digestive enzymes in the small intestine → in the intestine lumen, oligopeptides are formed by pancreatic proteases → on the external surface of intestine cells, di- and tripeptides are formed by peptidases → in the cytoplasm of intestine cells, amino acids are formed by specific peptidases.

145. Calculate the ΔG of the hexokinase, which catalyzes the following reaction: glucose + ATP → glucose 6-phosphate + ADP Consider that concentrations of glucose and glucose 6-phsphate (G6P) are 2 mM and 83 µM, and of ATP and ADP are 4 mM and 13 µM; ΔG°´ of G6P hydrolysis is –13.8 kJ mol–1, and ΔG°´of ATP hydrolysis is –30.5 kJ mol–1. a. –5.78 kJ mol–1 b. –10.92 kJ mol–1 c. –38.7 kJ mol–1 d. –27.63 kJ mol–1 e. –55.22 kJ mol–1 146. What description of the second stage of the TCA cycle is TRUE? a. It starts with a four-carbon molecule and ends with a six-carbon molecule. b. It starts with a four-carbon molecule and ends with a four-carbon molecule. c. It starts with a six-carbon molecule and ends with a five-carbon molecule. d. It starts with a four-carbon molecule and ends with a five-carbon molecule. e. It starts with a five-carbon molecule and ends with a four-carbon molecule.

147. Why does FAD, rather than NAD+, act as a hydrogen acceptor in the reaction of succinate dehydrogenase? a. ΔG°' is too high. b. FAD is an enzyme-bound coenzyme. c. ΔG°' is too low. d. Concentration of NAD+ is insufficient. e. Concentration of FAD is sufficient.

148. Which organism's fermentation is the only way to generate energy from the decomposition of glucose? a. prokaryote b. eukaryote c. obligate anaerobe

Name:

Class:

Date:

ch 14 - 19 d. yeast e. facultative anaerobe 149. What statement CORRECTLY describes the structure of the transacetylase core monomer in E. coli? a. It is composed of about 45 copies of the E1 and about 10 copies of the E3 enzymes. b. It contains E3-binding protein (E3-BP). c. It consists of a small C-terminal lipoamide domain, a small domain that interacts with E3 within the PDH complex and a larger enzymatic domain at the amino terminus. d. It is composed of a small C-terminal lipoamide domain and a larger enzymatic domain at the amino terminus. e. It contains a small N-terminal lipoamide domain and a small domain that interacts with E3 within the PDH complex.

150. What is the biological role of hydrochloric acid in the stomach? a. It indirectly stimulates the transformation of trypsinogen into active trypsin. b. It creates high pH, which is optimal for the action of pepsin. c. It carries out denaturation of food proteins, preparing substrates for the action of amylase. d. It promotes the reuptake of protons. e. It stimulates the production of hormones regulating the digestive processes by enterocytes.

151. Choose the CORRECT sequence of action of omeprazole. a. In the intestine, it is converted into sulfenic acid by α-amylase, then in the stomach the acid forms sulfenamide, which interacts with the proton pump and modifies lysine residues on the pump, thereby inhibiting the pump. b. In the stomach, it is converted into sulfenamide, which interacts with the proton pump and modifies cysteine residues on the pump, thereby inhibiting the pump. c. In the stomach, it is converted into sulfenic acid, then the acid forms sulfenamide, which interacts with the proton pump and modifies arginine residues on the pump, thereby inhibiting the pump. d. In the intestine, it forms sulfenamide, which changes the structure of the proton pump. e. In the stomach, it is converted into sulfenic acid, then the acid forms sulfenamide, which interacts with the proton pump and modifies cysteine residues on the pump, thereby inhibiting the pump.

152. How would the equilibrium constant change if the reaction X with ΔG°´= +12.2 kJ mol–1 was coupled to the hydrolysis of ATP (ΔG°´ = –30.5 kJ mol–1)? Consider that R × T is equal to 2.47. a. would increase by a factor of 105 b. would increase by 5.15 c. would decrease by a factor of 106 d. would decrease by 5.15 e. would increase by a factor of 106 153. What is the main source of energy for muscle contraction during minutes of exercise?

Name:

Class:

Date:

ch 14 - 19 a. ATP b. creatine phosphate c. aerobic metabolism d. anaerobic metabolism e. glycogen 154. The transport of lipids in the lymph is carried out by: a. lipases. b. micelles. c. cholesterol. d. chylomicrons. e. free fatty acids 155. What molecule has a phosphoryl-transfer potential lower than that of ATP? a. UTP b. PEP c. creatine-phosphate d. glucose-1-phosphate e. 1,3-BPG 156. What molecule or structure inserts into the 20-Å-long hydrophobic channel in E1, forcing its active site to take the acetyl group? a. lysine side chain b. CoA c. dihydrolipoamide d. lipoamide arm e. transacetylase domain 157. Glycerol, lactate, and amino acids contribute carbon precursors in the formation of glucose; however, the path that glycerol takes is strikingly different from the other precursors. Explain how it differs. a. Glycerol is decarboxylated to acetyl CoA and enters gluconeogenesis as pyruvate. b. Glycerol enters gluconeogenesis as a breakdown product of triacylglycerols in the form of dihydroxyacetone phosphate. c. Glycerol undergoes a reversible reduction/oxidation reaction to form phosphoenolpyruvate. d. Glycerol is first oxidized in a reaction requiring NAD+ and then phosphorylated in a reversible reaction of glycolysis. e. Glycerol is oxidized and enters gluconeogenesis as glyceraldehyde phosphate.

158. Which statement about donors of free energy is TRUE? a. ATP is the only free-energy donor in the cell. b. ATP is the predominant free-energy donor because unlike other nucleotide triphosphates, its hydrolysis is exergonic.

Name:

Class:

Date:

ch 14 - 19 c. UTP can sometimes be the free-energy donor. d. Linkages between phosphoryl groups of UTP contain more energy than those of ATP. e. Linkages between phosphoryl groups of ATP contain more energy than those of UTP. 159. Choose the glycolytic intermediate that can be destabilized by the introduction of C2–C3 double bonds in its structure. a. 1,3-bisphosphoglycerate b. 2-phosphoglycerate c. 3-phosphoglycerate d. phosphoenolpyruvate e. pyruvate 160. What is the phosphorylation potential of resting muscle if concentrations of ATP, ADP, AMP, and Pi are 4 mM, 13 µM, 3 µM, and 10 mM, respectively? a. 0.1 b. 0.4 c. 0.5 d. 1 e. 2.5 161. Which statement about the control of metabolism is TRUE? a. Each metabolic pathway has unique reactions through which the whole pathway is controlled. b. Only reversible reactions can be used to regulate the whole pathway. c. Since metabolic pathways are interdependent, the regulated reactions can be identical between pathways. d. Biosynthetic and degradative pathways have nothing in common. e. In an amphibolic pathway, the regulated reaction can be reversible.

162. Which statement about principles of energy that flows in living systems is FALSE? a. The formation of energy-rich molecules relies on the energy obtained from the environment. b. The number of reaction types used in metabolic pathways is unlimited. c. Metabolic pathways are predominantly controlled by allosteric regulation. d. Organization of enzymes into large complexes facilitates metabolic processes. e. Energy-releasing and energy-requiring processes are linked by molecules with a high-phosphoryltransfer potential.

163. What is the main acceptor of the phosphoryl group in the TCA cycle in the liver? a. ADP b. GDP c. CoA d. succinate e. TPP

Name:

Class:

Date:

ch 14 - 19 164. Which vitamin is important for the transport of electrons during reductive biosynthesis? a. panthotenate b. biotin c. niacin d. thiamine e. adenine 165. When blood glucose is: a. scarce, glucagon concentration in the blood falls and insulin concentration rises. b. scarce, glucagon concentration in the blood rises and insulin concentration rises. c. abundant, glucagon concentration in the blood falls and insulin concentration rises. d. abundant, glucagon concentration in the blood rises and insulin concentration rises. e. abundant, glucagon concentration in the blood falls and insulin concentration falls.

166. Which statement about ATP is TRUE? a. The energy is stored in three phosphoanhydride linkages of ATP. b. The hydrolysis of α or β bonds of ATP releases a large amount of energy. c. Under typical cellular conditions, the hydrolysis of both energy-rich bonds of ATP together releases about 12 kcal mol-1. d. The hydrolysis of β or γ bonds of ATP releases a large amount of energy. e. The free energy is liberated when ATP is hydrolyzed to AMP and Pi. 167. What purpose is NOT a major one for a continual input of free energy for mammals? a. muscle contraction b. cellular movement c. biosynthetic processes d. facilitated transport e. ATP-mediated transport 168. What is the location of glucose 6-phosphatase? a. mitochondria b. cytoplasm c. membrane bound in the endoplasmic reticulum d. lysosome e. cell nucleus 169. Choose the intermediate that is formed upon binding of pyruvate to PDH. a. carboxyethyl-TPP b. carboxymethyl-TPP c. oxyethyl-TPP

Name:

Class:

Date:

ch 14 - 19 d. hydroxymethyl-TPP e. hydroxyethyl-TPP 170. In which compartment of the eukaryotic cell does glycolysis occur? a. membrane b. cytoplasm c. nucleus d. mitochondria e. endoplasmic reticulum 171. What is the structure of micelles? a. The polar head groups of fatty acids are outside the micelle and the carbon chains are inside. b. The polar head groups of proteins are inside the micelle and the carbon chains are outside. c. Bile salts are inside the micelle and the carbon chains are enclosed outside. d. Phospholipids are inside and cholesterol is outside of the micelle. e. Globular structure formed by small proteins in aqueous solution.

172. What is the rate-limiting step in the synthesis of acetyl CoA? a. decarboxylation b. oxidation c. transfer to CoA d. transfer to lipoamide e. regeneration of lipoamide 173. What enzyme of the TCA cycle is similar to the pyruvate dehydrogenase complex? a. citrate synthase b. isocitrate lyase c. malate dehydrogenase d. α-ketoglutarate dehydrogenase e. isocitrate dehydrogenase 174. You are interested in studying bacteria found in peat swamps and you identify a new bacterium that you believe is a chemotroph. Which of the following would you use to verify your belief? a. screen for ATP synthesis b. screen for enzymes that oxidize carbon c. screen for light gathering structures d. screen for digestive enzymes e. screen for linked reactions 175. What is the main fuel for the brain and red blood cells? a. galactose b. glucose

Name:

Class:

Date:

ch 14 - 19 c. cellulose d. fructose e. lactose 176. What subunit of the pyruvate dehydrogenase regenerates the oxidized form of lipoamide? a. E3 b. dihydrolipoyl transacetylase c. E2 d. E1 e. pyruvate dehydrogenase component 177. Which vitamin is important for the transport of electrons during catabolic reactions? a. panthotenate b. biotin c. niacin d. thiamine e. adenine 178. How does the conformation of the citrate synthase change upon catalyzing the reaction? a. open → closed → completely enclosed b. open → closed c. completely enclosed → closed → open d. closed → open e. unfit → fit 179. Which statement is FALSE? a. Fructose 1,6-bisphosphate is converted to fructose 6-phosphate in the endoplasmic reticulum. b. T1 protein transports glucose 6-phosphate into the lumen of the endoplasmic reticulum. c. T2 protein transports Pi into the cytoplasm. d. T3 protein transports glucose into the cytoplasm. e. Free glucose is not formed in the cytoplasm.

180. What condition does NOT cause lactic acidosis? a. Warburg effect b. pyruvate dehydrogenase phosphatase deficiency c. diabetes mellitus d. increase in mitochondrial Ca2+ e. synthesis of hypoxia inducible factor-1 181. Which of the following statements is TRUE? a. Pyruvate carboxylase is a trimer.

Name:

Class:

Date:

ch 14 - 19 b. Pyruvate carboxylase requires biotin during carboxylation of pyruvate. c. Pyruvate carboxylation takes place in two stages. d. Acetyl CoA has an essential effect on the second partial reaction of pyruvate carboxylation. e. The first step of gluconeogenesis occurs in the cytoplasm.

182. Choose the correct steps of lipid digestion. a. Emulsification in the stomach due to grinding and mixing → emulsification is enhanced by bile salts in the intestine → triacylglycerols of lipids are degraded to free fatty acids and monoacylglycerol by lipases in the lumen of the small intestine. b. Emulsification in the intestine due to the grinding and mixing → emulsification is enhanced by bile salts in the stomach → triacylglycerols of lipids are degraded to free fatty acids and monoacylglycerol by lipases in the lumen of the small intestine. c. Formation of micelles in the stomach due to the grinding and mixing → triacylglycerols of lipids are degraded to free fatty acids and monoacylglycerol by lipases in the lumen of the small intestine. d. Emulsification by bile salts in the stomach → emulsification is enhanced by zymogens after leaving the stomach → triacylglycerols of lipids are degraded to free fatty acids and monoacylglycerol by lipases in the pancreas. e. Emulsification in the stomach due to the grinding and mixing → emulsification is enhanced by bile salts → triacylglycerols of lipids are degraded to water and monoacylglycerol by lipases in the lumen of the small intestine.

183. What ions are present in saliva? +

–

–

+

a. Na , Cl , K , HCO3 b. H+, Cl–, Ca2+ –

+

–

c. H2PO4 , H , OH d. Ca2+, K+ e. H+, OH–, K+

184. What is the significance of the fact that amino acids are moved from the lumen of the small intestine into intestinal cells by transporters but then they are moved into blood by anti-porters? a. The transporters are driven by K+-H+ ATPase, which provides energy to completely deplete the intestine of all amino acids. b. The secondary active transport of the anti-porter moves amino acids into blood. c. Peptidases in the intestinal cell membrane also act as amino acid transport channels driving amino acids into intestinal cells. d. The transporters on the lumen side of the intestinal cell will let oligopeptides into the cell, and the anti-porter ensures that these oligopeptides can be utilized by serum proteins. e. The anti-porters can move only polar amino acids.

185. Which step for trapping of energy by the cell is TRUE? a. oxidation of fuel molecules → synthesis of molecules with a high-phosphoryl transfer potential b. energy of light → synthesis of molecules with a high-phosphoryl transfer potential

Name:

Class:

Date:

ch 14 - 19 c. oxidation of fuel molecules → synthesis of compounds with a high-phosphoryl transfer potential → synthesis of ATP d. energy of light → synthesis of ADP → synthesis of ATP e. oxidation of fuel molecules → synthesis of ATP → synthesis of compounds with a high-phosphoryl transfer potential 186. What are the glycolytic enzymes? a. fructose 1,6-bisphosphatase and pyruvate carboxylase b. pyruvate carboxylase and phosphofructokinase c. pyruvate kinase and phosphofructokinase d. glucose 6-phosphatase and fructose 1,6-bisphosphatase e. phosphoenolpyruvate carboxykinase and phosphofructokinase 187. Choose reaction that takes place in mitochondria. a. formation of glucose from fructose 6-phosphate b. formation of fructose 6-phosphate from fructose 1,6-bisphosphate c. activation of fructose 1,6-bisphosphatase by citrate d. phosphorylation of phosphofructokinase 2/ fructose bisphosphatase 2 by protein kinase A e. formation of oxaloacetate from pyruvate 188. What is the term for conversion of acetyl CoA into energy in the form of ATP in the presence of oxygen? a. cellular respiration b. citric acid cycle c. oxidative phosphorylation d. electron-transport chain e. proton gradient 189. How and why are pyruvate kinase isozymes regulated differently? a. In muscle, phosphorylation of pyruvate kinase diminishes its activity in response to low bloodglucose levels. b. In muscle, dephosphorylation of pyruvate kinase is activated in response to high levels of fructose 1,6-bisphosphate. c. In the liver, phosphorylation of pyruvate kinase diminishes its activity in response to low bloodglucose levels. d. In the liver, dephosphorylation of pyruvate kinase is activated in response to high levels of fructose 1,6-bisphosphate. e. In the liver, activation of the GLUT2 receptors increases ATP synthesis leading to a decrease in pyruvate kinase activity.

190. A newborn baby has symptoms such as intestinal colic, diarrhea, and regurgitations after the feeding. The activity of is reduced. a. α-amylase b. α-dextrinase

Name:

Class:

Date:

ch 14 - 19 c. α-glucosidase d. sucrase e. lactase 191. Complex carbohydrates are absorbed as: a. acetyl CoA. b. starch. c. glucose and simple sugars. d. short four-glucose residues. e. glycogen.

192. How many GTP and ATP molecules are required for the synthesis of four molecules of glucose from eight molecules of pyruvate? a. 2 and 4, respectively b. 8 and 16, respectively c. 4 and 4, respectively d. 8 and 4, respectively e. 6 and 12, respectively 193. What is the main reason hydrolysis of the thioester bond gives more energy than the oxygen ester bond? a. due to charge repulsion b. due to a favorable entropy change c. due to better solvation d. due to resonance stabilization e. due to charge attraction 194. What is the process that sustains the redox balance of glycolysis under aerobic conditions? a. transport of lactate from the cell b. regeneration of NAD+ in the citric acid cycle c. formation of NADH in the reaction of glyceraldehyde 3-phosphate dehydrogenase d. regeneration of NAD+ in fermentation processes e. regeneration of NAD+ in the mitochondrial electron-transport chain 195. What coenzyme does the E1 component of the pyruvate dehydrogenase complex require for proper activity? a. coenzyme A b. FAD c. NADH d. thiamine pyrophosphate e. NAD+

Name:

Class:

Date:

ch 14 - 19 196. In the following sequence of consecutive reactions, choose the numbers of CORRECT conversions: pyruvate →1 fructose 1,6-bisphosphate →2 malate →3 oxaloacetate →4 glucose a. 3 b. 1 and 4 c. 2 d. 2 and 4 e. 1 197. Which statement about β pancreatic cells is FALSE? a. Only the GLUT2 glucose transporter is present in these cells. b. The metabolism of glucose in these cells is translated into a physiological response by ion channels. c. They secrete insulin in response to a high concentration of glucose in blood. d. They are able to respond only to a high concentration of glucose because of the hexokinase isozyme that has a high KM value. e. The activity of these cells regulates synthesis of glycogen in the liver.

198. What is the name of a disorder when blood glucose rises to abnormally high levels? a. hyperglycemia b. hypertonia c. hyperplasia d. hypoglycemia e. polyuria 199. Choose the molecule that accepts electrons in alcoholic fermentation. a. GAP b. pyruvate c. ethanol d. acetaldehyde e. NADH 200. How many irreversible reactions are there in glycolysis and how many of them are involved in allosteric regulation? a. Three irreversible reactions; all of them are allosterically regulated. b. Three irreversible reactions; only the phosphofructokinase reaction is allosterically regulated. c. Three irreversible reactions; only two of them are allosterically regulated. d. Four irreversible reactions; only three of them are allosterically regulated. e. Three irreversible reactions; only the hexokinase reaction is allosterically regulated.

201. What is the origin of energy for anabolic reactions in phototrophs? a. oxidation of carbon to CO2 b. electrochemical potential of stored glycogen

Name:

Class:

Date:

ch 14 - 19 c. reduction of pyruvate to lactate d. ATP e. sunlight 202. How many NADH are produced after the TCA cycle due to aerobic catabolism of three molecules of glucose? a. 3 b. 9 c. 18 d. 27 e. 30 203. What statement about digestion is CORRECT? a. Digestion begins in the stomach. b. Almost all digestive enzymes are secreted as zymogens, except pepsin. c. Polysaccharides are cleaved into monosaccharides. d. Lipids are converted into fatty acids by α-amylase. e. All of the digestive enzymes are oxidoreductases.

204. What enzyme can catalyze the formation of the glycolytic intermediate with a high phosphoryl transfer potential from 3-phosphoglycerate? a. pyruvate kinase b. phosphofructokinase c. phosphoglycerate mutase d. phosphoglycerate kinase e. aldolase 205. Choose the conditions when PDH is inhibited. a. NADH/NAD+ ratio is low b. acetyl CoA/CoA ratio is high c. the mitochondrial Ca2+ level is high d. ATP/ADP ratio is low e. the energy charge is low 206. Choose the molecule that has a phosphoryl-transfer potential higher than that of ATP. a. 1,3-bisphosphoglycerate b. glyceraldehyde 3-phosphate c. dihydroxyacetone phosphate d. fructose 1,6-bisphosphate e. NAD+

Name:

Class:

Date:

ch 14 - 19 207. Why is the cell concentration of ATP 10 to 100 times higher than KM for most enzymes that use ATP as a substrate? a. to increase protein solubility b. long-term storage of energy c. to decrease protein solubility d. for unexpected activity e. for ATP-mediated transport 208. Beriberi is caused by a deficiency of: a. flavine. b. adenine. c. thiamine. d. pantothenate. e. niacin.

209. Judging by the given reactions and their standard free energies, choose the CORRECT statement.

A + B →C ΔG°´ = –36 kJ mol–1 C+D E ΔG°´ = + 12 kJ mol–1 E + F → A ΔG°´ = +5 kJ mol–1 a. The ΔG°´ of the reaction B + E + F → C should be positive. b. Formation of compound E is coupled to the formation of A. c. E is a shared intermediate that couples formation of C and A. d. Overall free energy of the pathway should be positive. e. B is a shared intermediate that couples formation of C and A. 210. The typical symptom of malignant hyperthermia is: a. blurred vision caused by inability to use glucose as a fuel. b. excessive thirst due to changing blood osmolarity. c. high body temperature due to an abnormally high level of blood glucose. d. high body temperature due to uncontrolled ATP hydrolysis. e. low body temperature due to uncontrolled ATP formation.

211. The pancreas releases to buffer the pH of the stomach juices. a. a strong base b. HCl c. NaHCO3 d. pepsin e. ATPase activating protein 212. High blood sugar after a meal a. increases

the level of insulin released by the pancreas.

Name:

Class:

Date:

ch 14 - 19 b. decreases c. has no effect on d. chronically activates e. chronically inhibits 213. How many ATP molecules are required for fructose to enter glycolysis in the liver? a. 0 b. 1 c. 2 d. 3 e. 4 214. How many molecules of CO2 and NADH will be produced by conversion of pyruvate from one glucose molecule into acetyl CoA? a. 1 molecule of CO2; 1 molecule of NADH b. 4 molecules of CO2; 4 molecules of NADH c. 2 molecules of CO2; 2 molecules of NADH d. 2 molecules of CO2; 1 molecule of NADH e. 4 molecules of CO2; 2 molecules of NADH 215. What is NOT a part of the citric acid cycle? a. capturing of high-energy electrons b. electron-transport chain c. oxidation of acetyl CoA d. synthesis of tricarboxylic acids e. formation of NADH and FADH2 216. What statement CORRECTLY describes the structure of the transacetylase core monomer in mammals? a. It is composed of about 45 copies of the E1 and about 10 copies of the E3 enzymes. b. It contains E3-binding protein (E3-BP). c. It consists of a small C-terminal lipoamide domain, a small domain that interacts with E3 within the PDH complex and a larger enzymatic domain at the amino terminus. d. It is composed of C-terminal enzymatic domain and a larger lipoamide domain at the amino terminus. e. It contains a small N-terminal lipoamide domain and a small domain that interacts with E3 within the PDH complex.

217. Since lipids are not soluble in water, what is the problem with their digestion? a. Lipids are not exposed to bile salt. b. Lipids are not digestible.

Name:

Class:

Date:

ch 14 - 19 c. Lipases cannot degrade large lipid droplets. d. Lipid droplets cannot be converted into an emulsion. e. Amylases cannot degrade large lipid droplets.

218. What is the process that sustains the redox balance of glycolysis under anaerobic conditions? a. transport of lactate from the cell b. regeneration of NAD+ in the citric acid cycle c. formation of NADH in the reaction of glyceraldehyde 3-phosphate dehydrogenase d. regeneration of NAD+ in fermentation processes e. regeneration of NAD+ in the mitochondrial electron-transport chain 219. Calculate the net yield of ATP from glycolysis after consumption of 10 molecules of sucrose. Consider that sucrose is FULLY processed via glycolysis in adipocytes. a. 10 b. 15 c. 20 d. 25 e. 30 220. Which glycolytic enzyme is the MOST important for regulation of glycolysis in mammals? a. aldolase b. hexokinase c. enolase d. phosphofructokinase e. pyruvate kinase 221. The enzymes involved in shuttling carbons in gluconeogenesis from the mitochondria to the cytosol are called: a. malate dehydrogenase. b. citrate synthase. c. oxaloacetate transferase. d. oxaloacetate reductase. e. glucose 1,6-bisphosphatase.

222. What is the event that ends the first stage of glycolysis? a. synthesis of ATP b. synthesis of glucose 6-phosphate c. synthesis of triose phosphates d. synthesis of pyruvate e. synthesis of NADH

Name:

Class:

Date:

ch 14 - 19 223. What part of the PDH complex is a flavoprotein? a. dihydrolipoyl transacetylase b. pyruvate dehydrogenase kinase c. dihydrolipoyl dehydrogenase d. pyruvate dehydrogenase phosphatase e. pyruvate dehydrogenase component 224. What molecule allosterically stimulates phosphorylation of fructose 6-phosphate? a. AMP b. fructose 2,6-diphosphate c. ADP d. glucose 6-phosphate e. fructose 2,6-bisphosphate 225. Why is gluconeogenesis not a reversal of glycolysis? a. All glycolysis reactions are completely different from those in gluconeogenesis. b. Gluconeogenesis is the main fuel during fasting. c. Glycolysis is more difficult and complicated than gluconeogenesis. d. The free Gibbs energy of several reactions is positive under typical cellular conditions. e. Glycolysis comprises irreversible steps which are bypassed in gluconeogenesis by gluconeogenic enzymes.

226. How many amino acids does the kinase domain of phosphofructokinase 2/ fructose bisphosphatase 2 have? a. 282 b. 220 c. 218 d. 438 e. 470 227. Which statement about snake venom is CORRECT? a. Snake venom is a highly modified form of pancreatic juice. b. The composition of the venom does not differ among snakes of the same species. c. Various proteolytic enzymes in the venom degrade intestinal cell membranes. d. Components of snake venoms may be used as drugs to prevent heart attack. e. Neurotoxins in the snake venom kill the prey.

228. Choose the electron donor used for reductive biosynthesis. a. NADH b. NADPH c. FADH2 d. CoA-SH e. ATP

Name:

Class:

Date:

ch 14 - 19 229. What is the site for oxidative decarboxylation of pyruvate? a. liver b. cytoplasm c. endoplasmic reticulum d. mitochondrial intermembrane space e. mitochondrial matrix 230. What factor is NOT used to regulate metabolism? a. concentration of the enzyme b. concentration of the substrate c. concentration of hormones d. availability of vitamins e. accessibility of the substrate 231. Choose the molecule that donates the phosphate group in glycolysis. a. glucose 6-phosphate b. fructose 6-phosphate c. 3-phosphoglycerate d. 1,3-bisphosphoglycerate e. fructose 1,6-bisphosphate 232. Which statement about glycolytic kinases is FALSE? a. Reactions catalyzed by kinases in the first stage of glycolysis use ATP as the donor of the phosphate group, while in the second stage they use ADP as the acceptor of the phosphate group. b. Phosphofructokinase catalyzes the committed step of glycolysis in muscle cells. c. Allosteric regulation of liver pyruvate kinase depends on the energy charge of the cell. d. The expression of glycolytic kinases is controlled by the partial pressure of oxygen in tissues. e. All of the glycolytic reactions catalyzed by kinases are irreversible.

233. Phosphorylation of fructose 6-phosphate is an endergonic reaction with a ΔG° of 16.3 kJ/mol. How do cells overcome this thermodynamic barrier for this reaction under standard conditions? a. The enzyme that catalyzes this reaction couples it with the condensation of ADP and inorganic phosphate, resulting in an overall ΔG° of –46.8 kJ/mol. b. The enzyme that catalyzes this reaction couples it with the hydrolysis of ATP to ADP and inorganic phosphate, resulting in an overall ΔG° of –14.2 kJ/mol. c. This reaction will proceed to the right because Keq is small. d. This reaction will proceed to the right because Keq is negative. e. The reaction can be driven forward by uncoupling the reaction from the hydrolysis of ATP. 234. What is the atomic mass of the polypeptide chain containing both PFK2 and FBPase2?

Name:

Class:

Date:

ch 14 - 19 a. 102 kDa b. 66 kDa c. 40 kDa d. 150 kDa e. 55 kDa 235. What is the essential compound required for carboxylation of pyruvate in humans? a. biotin b. glucose c. calcium d. oxaloacetate e. alanine 236. What two 3-carbon molecules are generated by the cleavage of fructose 1,6-bisphosphate? a. glyceraldehyde 3-phosphate and 3-phosphoglycerate b. glyceraldehyde 3-phosphate and dihydroxyacetone phosphate c. pyruvate and phosphoenolpyruvate d. enolase and 2-phosphoglycerate e. glyceraldehyde 3-phosphate and pyruvate 237. What disease has symptoms similar to those of beriberi? a. arsenite poisoning b. lactic acidosis c. type II diabetes d. scurvy e. cancer 238. What factor may be a contributing factor for the development of type 2 diabetes? a. viral respiratory infection b. emotional disorder c. obesity d. type 1 diabetes e. headache 239. What molecule can act as an activated carrier of acyl groups? a. flavin adenine dinucleotide b. pyruvate c. pantothenic acid d. coenzyme A e. thiamine pyrophosphate

Name:

Class:

Date:

ch 14 - 19 240. This energy source is used to regenerate ATP from ADP and Pi. a. oxidation of carbon to CO2 b. electrochemical potential of stored glycogen c. reduction of pyruvate to lactate d. reduction of pyruvate to acetyl CoA e. hydrolysis of glycerol 3-phosphate 241. What is the source of energy for muscle contraction during seconds of intense sprints? a. ATP b. creatine phosphate c. aerobic metabolism d. anaerobic metabolism e. glycogen 242. What enzyme catalyzes reactions that theoretically could follow a second-order kinetics? a. succinyl CoA synthetase b. succinate dehydrogenase c. isocitrate dehydrogenase d. succinate thiokinase e. α-ketoglutarate dehydrogenase 243. What is the basis of maintaining the glycolytic redox balance in fermentation processes? a. production of carbon dioxide b. utilization of pyruvate c. decrease of pH in the cell d. utilization of NAD+ e. regeneration of NAD+ 244. Which statement explaining the importance of electrostatic repulsion for the phosphoryl-transfer potential of ATP is TRUE? a. At a physiological pH, hydrolysis of ATP decreases the number of negative charges. b. Juxtaposition of negative charges of β and γ phosphoryl groups gives a lower free energy than that for free orthophosphate. c. A close proximity between phosphoryl groups of ATP gives a higher energy than does free orthophosphate in a solution. d. Juxtaposition of negative charges of α and β phosphoryl groups gives a lower free energy than that for free orthophosphate. e. Water more readily stabilizes negative charges of products of ATP hydrolysis than of ATP itself.

245. Choose the most precise description of an activated carrier. a. It is ATP.

Name:

Class:

Date:

ch 14 - 19 b. It is a compound that can transfer a functional group with negative ΔG of the transfer. c. It is a compound that transfers a phosphoryl group in an exergonic process. d. It is a compound that transfers a phosphoryl group in an endergonic process. e. It transfers electrons.

246. What reactions take place in the alcoholic fermentation of glucose starting with pyruvate? a. First, pyruvate is decarboxylated and then acetaldehyde is oxidized by NAD+. b. Pyruvate is reduced by NADH to yield lactate. c. First, pyruvate is decarboxylated and then acetaldehyde is reduced by NADH. d. Pyruvate is oxidized by NAD+ to yield lactate. e. Pyruvate is dehydrated to acetaldehyde, which is then decarboxylated to ethanol.

247. In addition to pyruvate dehydrogenase, what other enzyme in the citric acid cycle has a key thiamine pyrophosphate coenzyme? a. isocitrate dehydrogenase b. α-ketoglutarate dehydrogenase c. citrate synthase (in bacteria) d. phosphatase e. fumarase 248. What coenzyme of the PDH complex functions as a "flexible swinging arm" when it transfers the reaction intermediate from one active site to the other? a. FAD b. NAD+ c. lipoamide d. thiamine pyrophosphate e. coenzyme A 249. What is the chemical change involved in the conversion of citrate into isocitrate? a. hydration followed by dehydration b. oxidation followed by dehydration c. oxidation followed by reduction d. dehydration followed by hydration e. hydration followed by oxidation 250. What statement about the biosynthetic role of the citric acid cycle is FALSE? a. Oxaloacetate can be converted to glucose. b. Amino acids can be synthesized from α-ketoglutarate. c. Succinate is the direct precursor to porphyrins. d. Amino acids can be synthesized from oxaloacetate. e. Citrate can be used for the synthesis of fatty acids.

Name:

Class:

Date:

ch 14 - 19 251. What is the treatment for mercury poisoning? a. a ketogenic diet (high-fat, low-carbohydrate) b. hemodialysis c. the administration of painkillers d. the administration of sulfhydryl reagents with adjacent sulfhydryl groups e. pharmacological inhibition of pyruvate dehydrogenase kinase 252. Organisms that can convert fat into sugar use the a. Q b. fatty acid c. lipoxylate d. glyoxylate e. glucuronic acid

cycle.

253. In what step of the citric acid cycle is FADH2 formed? a. conversion of succinate to malate b. conversion of succinate to oxaloacetate c. conversion of succinate to fumarate d. conversion of malate to oxaloacetate e. conversion of malate to fumarate 254. What is the advantage of synthesizing enzymes as zymogens? a. It allows them to be packaged in chylomicrons more easily. b. Zymogens can be stored for rapid release when needed. c. It can be activated by the low pH in the stomach. d. Zymogens are resistant to inactivation by kinases. e. Diet pills can be designed to inhibit zymogen hydrolysis.

255. What condition is essential for conversion of pyruvate into acetyl coenzyme A rather than into lactic acid or ethanol? a. anaerobic conditions b. aerobic conditions c. acidic conditions d. alkaline medium e. high redox potential 256. What enzyme is responsible for the following reaction? pyruvate + coenzyme A + NAD+ → acetyl CoA + NADH + H+ + CO2 a. acetyl CoA synthetase b. pyruvate decarboxylase c. pyruvate dehydrogenase complex

Name:

Class:

Date:

ch 14 - 19 d. dihydrolipoyl dehydrogenase e. transacetylase 257. Which statement about the role of phosphoryl groups in the cell is FALSE? a. Phosphoryl groups are used as a tag for the enzymes of reductive biosynthesis. b. Kinetic stability of the phosphate esters allows their use for regulatory purposes. c. Thermodynamic stability of the phosphate esters facilitates their manipulation by enzymes. d. Phosphorylation prevents diffusion of molecules through the plasma membrane. e. Negative charges of phosphate esters decrease the chance of nonspecific hydrolysis in aqueous environment.

258. What enzyme requires a compound with a high acyl-transfer potential? a. isocitrate dehydrogenase b. succinate dehydrogenase c. succinate thiokinase d. isocitrate lyase e. malate dehydrogenase 259. The transacetylase component of the PDH complex in E. coli consists of: a. about 45 copies of E1 and about 10 copies of E3. b. three major domains. c. about 10 catalytic monomers. d. about 20 catalytic trimers. e. about 60 catalytic tetramers.

260. What enzyme catalyzes a committed step of the TCA cycle in prokaryotes? a. citrate synthase b. aconitase c. isocitrate dehydrogenase d. α-ketoglutarate dehydrogenase e. malate dehydrogenase 261. Snake venom contains a. pepsin b. zymogen c. lipases d. lipids e. enteropeptidase

, which cause(s) hydrolysis of red blood cells.

262. Chemically, why is it necessary for citrate to undergo an isomerization to isocitrate prior to decarboxylation? a. This conversion forms an unstable α-ketoacid, which drives the cycle forward.

Name:

Class:

Date:

ch 14 - 19 b. The aconitase reaction is a thermodynamically unfavorable hydration reaction followed by a highly favored dehydration. c. The tertiary alcohol in citrate does not favor the oxidative carboxylation that occurs next; however, the secondary alcohol of isocitrate does. d. Citrate induces a major structural rearrangement in aconitase, leading to the creation of the binding site for the water molecule in the hydration step. e. Only when the alcohol is attached to C-2 can it block the activity of prolyl hydroxylase 2, ensuring synthesis of glycolytic proteins.

263. Isomerization of citrate is catalyzed by: a. citrate synthase. b. aldolase. c. α-ketoglutarate dehydrogenase. d. aconitase. e. citrate isomerase.

264. The direct movement of substrates from one enzyme to the next is called: a. a protein complex. b. substrate channeling. c. a linker coenzyme. d. a cell with sufficient available water. e. an electron acceptor.

265. What is the process of glucose creation from lactate, pyruvate, and amino acids? a. saccharification b. glycogenolysis c. gluconeogenesis d. glycolysis e. hydrolysis 266. What is NOT a pancreatic protease? a. pepsin b. chymotrypsin c. trypsin d. carboxypeptidase e. elastase 267. What technique was used to detect both fructose 6-phosphate and fructose 1,6-bisphosphate in gluconeogenesis? a. lateral flow test b. isotope-labelling method c. electron-microscopic method

Name:

Class:

Date:

ch 14 - 19 d. ELISA e. immunoscreening 268. What is the primary metabolic fate of pyruvate? a. ethanol b. lactate c. acetyl CoA d. oxaloacetate e. malate 269. Choose the coenzyme involved in the transfer of electrons in catabolic processes. a. NADP+ b. FAD+ c. ATP d. biotin e. CoA Indicate one or more answer choices that best complete the statement or answer the question.

270. What enzymes of the TCA cycle are allosteric? Select all that apply. a. isocitrate dehydrogenase b. α-ketoglutarate dehydrogenase c. citrate synthase (in bacteria) d. succinate dehydrogenase e. pyruvate dehydrogenase 271. What processes characterize the citric acid cycle as catabolic? Select all that apply. a. carboxylation of pyruvate b. link with the electron-transport chain c. formation of α-ketoglutarate from glutamate d. substrate-level phosphorylation e. oxidative decarboxylation 272. What are anaplerotic reactions of the citric acid cycle? Select all that apply. a. glutamate → α-ketoglutarate b. α-ketoglutarate → glutamate c. pyruvate → oxaloacetate d. malate → oxaloacetate e. isocitrate → α-ketoglutarate 273. What serves as a stoichiometric coenzyme in the PDH complex reaction? Select all that apply. a. lipoic acid

Name:

Class:

Date:

ch 14 - 19 b. NAD+ c. thiamine pyrophosphate d. FAD e. CoA 274. What functions of the citric acid cycle are CORRECT? Select all that apply. a. It produces NADH and FADH2. b. It provides intermediates for gluconeogenesis. c. It provides intermediates for the synthesis of fatty acids. d. It bypasses oxidative decarboxylation. e. It produces FAD. 275. Select all that apply. Pantothenate kinase–associated degeneration: a. is a predominantly neurological disorder. b. can cause anemia. c. affects tissues that are dependent on aerobic metabolism. d. is a pathological condition characterized by iron accumulation in the muscles. e. is a disorder when a patient lacks the vitamin pantothenate.

276. Some of the mechanisms by which enzyme catalytic activity is controlled are: a. allosteric control. b. rate of transcription. c. covalent modification. d. availability of substrates. e. energy status of the cell.

277. What serves as a catalytic coenzyme in the PDH complex reaction? Select all that apply. a. lipoic acid b. NAD+ c. thiamine pyrophosphate d. FAD e. CoA 278. What catalytic strategies are employed by citrate synthase? Select all that apply. a. induced fit b. covalent catalysis c. catalysis by approximation d. general acid–base catalysis e. metal ion catalysis 279. What reactions of glycolysis are bypassed by the four steps of gluconeogenesis? Select all that apply.

Name:

Class:

Date:

ch 14 - 19 a. reaction catalyzed by the hexokinase reaction b. reaction catalyzed by the pyruvate carboxylase reaction c. reaction catalyzed by the phosphofructokinase reaction d. reaction catalyzed by the phosphoenolpyruvate carboxykinase reaction e. reaction catalyzed by the pyruvate kinase reaction 280. What are the precursors of glucose? Select all that apply. a. fatty acids b. amino acids c. lactate d. glycerol e. glycogen 281. Pepsin requires to achieve activity. Select all that apply. a. low pH b. partial denaturation of protein c. zymogen activation d. cholecystokinin activation e. formation of the emulsion 282. Bothropasin is the proteolytic enzyme of venom of the South African pit viper Bothrops jararaca, which is used for treatment of thrombosis. Suggest the possible action of this enzyme. Select all that apply. a. digestion of phospholipids of cells membrane b. degradation of fibrous proteins of membranes c. neurotoxic effect d. hydrolysis of peptide bonds e. depletion of the clotting factors 283. What symptoms accompany enterokinase deficiency? Select all that apply. a. disrupted activation of pepsin b. violation of the digestive process in the small intestine c. disrupted activation of saliva amylase d. disrupted activation of pancreatic enzymes e. inability of trypsinogen to form trypsin 284. Select all that apply. Intermediates of the reactions in the TCA cycle are: a. citryl CoA. b. cis-aconitate. c. oxalosuccinate. d. succinyl CoA. e. succinyl phosphate.

Name:

Class:

Date:

ch 14 - 19 285. What enzymes capture high-energy electrons? Select all that apply. a. pyruvate dehydrogenase complex b. citrate synthase c. isocitrate dehydrogenase d. aconitase e. α-ketoglutarate dehydrogenase 286. Which activated carriers contain adenosine phosphate units? a. NADH b. FADH2 c. coenzyme A d. FMNH2 e. biotin 287. What vitamins are precursors to coenzymes that are necessary for the formation of acetyl CoA from pyruvate? Select all that apply. a. pantothenic acid b. nicotine c. riboflavin d. thiamine pyrophosphate e. niacin 288. What conditions are required to obtain energy from acetyl CoA in the citric acid cycle? Select all that apply. a. availability of O2 b. high energy charge c. anaerobic conditions d. low energy charge e. availability of CO2 289. Pyruvate dehydrogenase is a. activated b. inhibited c. phosphorylated d. acetylated e. methylated

when ATP/ADP ratios are high. Select all that apply.

290. What is involved in the transport of monosaccharides into the intestinal epithelial cells? Select all that apply. a. a secondary active-transport b. osmosis c. facilitated diffusion

Name:

Class:

Date:

ch 14 - 19 d. filtration e. diffusion without transporters 291. What conditions will activate pyruvate dehydrogenase kinase, which catalyzes phosphorylation and inactivation of E1 in the pyruvate dehydrogenase complex? Select all that apply. a. elevated concentrations of NADH and ATP b. elevated concentrations of NAD+ and ADP c. elevated concentration of Ca2+ d. elevated concentration of insulin e. elevated concentration of acetyl CoA 292. Select all that apply. High levels of ATP and citrate: a. indicate a high-energy–well-fed state. b. indicate remote gluconeogenesis. c. inhibit glycolysis. d. activate glycolysis. e. indicate formation high-transfer-potential molecules.

293. Select all that apply. Milling and polishing rice results in: a. a loss of the husk of rice. b. white rice. c. a potential for beriberi. d. a loss of thiamine pyrophosphate. e. a potential for chronic elevated plasma lactate.

294. What coenzymes are used by α-ketoglutarate dehydrogenase? Select all that apply. a. CoA b. TPP c. FAD d. NAD+ e. lipoic acid Enter the appropriate word(s) to complete the statement.

295. The set of reactions that extract biologically useful energy from environmental sources is

.

296. A thermodynamically unfavorable reaction can be driven by a thermodynamically favorable reaction it is to.

297. A high-energy charge, which results in increasing concentration of NADH,

the activity of PDH.

298. Glycolysis is related to the synthesis of fatty acids through the conversion of pyruvate to

.

Name:

Class:

Date:

ch 14 - 19 299. The is an organelle in plants and some bacteria where two-carbon acetyl units are converted into four-carbon units (succinate) for glucose synthesis, energy production, and biosynthesis.

300. Glycerol from fats is modified first by glycerol kinase and then by a second enzyme to enter gluconeogenesis at the _ intermediate.

Name:

ch 14 - 19 Answer Key 1. a 2. b 3. b 4. c 5. e 6. a 7. e 8. c 9. a 10. c 11. a 12. b 13. a 14. e 15. c 16. d 17. e 18. b 19. e 20. d 21. c 22. b 23. d 24. e

Class:

Date:

Name:

ch 14 - 19 25. a 26. d 27. a 28. d 29. e 30. e 31. c 32. d 33. b 34. b 35. c 36. b 37. a 38. c 39. d 40. d 41. b 42. a 43. c 44. a 45. b 46. d 47. a 48. b 49. d

Class:

Date:

Name:

ch 14 - 19 50. d 51. d 52. c 53. d 54. c 55. b 56. b 57. c 58. d 59. d 60. e 61. a 62. e 63. a 64. a 65. d 66. e 67. b 68. b 69. a 70. d 71. c 72. a 73. a 74. a

Class:

Date:

Name:

ch 14 - 19 75. d 76. d 77. e 78. c 79. e 80. c 81. d 82. b 83. a 84. a 85. b 86. a 87. a 88. c 89. a 90. b 91. c 92. b 93. a 94. e 95. b 96. d 97. e 98. e 99. c

Class:

Date:

Name:

ch 14 - 19 100. d 101. d 102. e 103. d 104. c 105. c 106. a 107. d 108. b 109. b 110. c 111. d 112. e 113. a 114. c 115. b 116. d 117. e 118. e 119. c 120. b 121. d 122. a 123. b 124. c

Class:

Date:

Name:

ch 14 - 19 125. a 126. a 127. c 128. c 129. e 130. c 131. b 132. a 133. c 134. b 135. c 136. e 137. b 138. b 139. e 140. a 141. b 142. a 143. c 144. c 145. c 146. b 147. c 148. c 149. c

Class:

Date:

Name:

ch 14 - 19 150. e 151. e 152. e 153. d 154. d 155. d 156. d 157. b 158. c 159. d 160. b 161. a 162. b 163. b 164. c 165. c 166. d 167. d 168. c 169. e 170. b 171. a 172. a 173. d 174. c

Class:

Date:

Name:

ch 14 - 19 175. b 176. a 177. c 178. a 179. a 180. d 181. b 182. a 183. a 184. b 185. c 186. c 187. e 188. a 189. c 190. e 191. c 192. b 193. d 194. e 195. d 196. a 197. a 198. a 199. d

Class:

Date:

Name:

ch 14 - 19 200. a 201. e 202. e 203. c 204. d 205. b 206. a 207. a 208. c 209. c 210. d 211. c 212. a 213. c 214. c 215. b 216. b 217. c 218. d 219. e 220. d 221. a 222. c 223. c 224. e

Class:

Date:

Name:

ch 14 - 19 225. e 226. c 227. d 228. b 229. e 230. d 231. d 232. e 233. b 234. e 235. a 236. b 237. a 238. c 239. d 240. a 241. b 242. c 243. e 244. c 245. b 246. c 247. b 248. c 249. d

Class:

Date:

Name:

ch 14 - 19 250. c 251. d 252. d 253. c 254. b 255. b 256. c 257. c 258. c 259. d 260. a 261. c 262. c 263. d 264. b 265. c 266. a 267. b 268. d 269. b 270. a, b, c 271. a, b, d, e 272. a, c 273. b, e 274. a, b, c

Class:

Date:

Name:

ch 14 - 19 275. a, c 276. a, c 277. a, c, d 278. a, c 279. a, c, e 280. b, c, d 281. a, b, c 282. b, d, e 283. b, d, e 284. a, b, c, e 285. a, c, e 286. a, b, c 287. a, c, e 288. a, d 289. b, c 290. a, c 291. a, e 292. a, b 293. a, b, c, d 294. a, b, c, d, e 295. catabolism 296. coupled 297. inhibits 298. acetyl CoA 299. glyoxysome

Class:

Date:

Name:

ch 14 - 19 300. dihydroxyacetone phosphate

Class:

Date:

Name:

Class:

Date:

ch 20 - 25 Indicate the answer choice that best completes the statement or answers the question.

1. What is the original source of electrons used to neutralize the special pair in photosystem II? a. reduced cytochrome bf b. NADH c. H2O d. membrane lipids e. ferredoxin 2. An allosteric regulator of glycogen synthase is: a. glucose 6-phosphate. b. glucose 1-phosphate. c. UDP-glucose. d. cAMP. e. ATP. 3. Which form of thioredoxin activates certain Calvin cycle enzymes? a. reduced b. oxidized c. dimeric d. trimeric e. phosphorylated 4. The debranching enzyme releases a free glucose molecule by: a. hydrolysis of the α-1,4-glycosidic bond. b. hydrolysis of the α-1,6-glycosidic bond. c. phosphorylation of the glucose residue. d. dephosphorylation of the glucose residue. e. shifting a phosphoryl group from C-1 to C-6 in the glucose residue.

5. The enzyme that begins the kinase cascade activating glycogen degradation is: a. glycogen synthase. b. phosphorylase kinase. c. PKC. d. PKA. e. tyrosine kinase.

6. What is the term for the mechanism for the coupling of electron transfer from Q to cytochrome c to the transmembrane proton transport? a. Q pool b. Q cycle c. cellular respiration

Name:

Class:

Date:

ch 20 - 25 d. ubiquitin cycle e. cytochrome c pool 7. Suppose there is a mutation in the c subunit of ATP synthase, such that glutamate found in the middle of one of the membrane-spanning helices is converted to valine. What is likely to be the effect on ATP synthesis and why? a. No effect. The middle of the helix is in contact with the hydrophobic center of the lipid bilayer, and valine is readily soluble in lipid. b. No effect. The valine side chain is shorter than the glutamate side chain, so it causes no change in the secondary structure of the helix. c. Inhibition of ATP synthesis. Valine cannot bind a proton, so there will be no proton flow through the inner membrane. d. Inhibition of ATP synthesis. Because valine is hydrophobic, the a subunit will move in the reverse direction, causing hydrolysis, not synthesis, of ATP. e. Increase of ATP synthesis. Because the valine side chain is hydrophobic, the a subunit can move easily without regard for oxidative processes.

8. What molecule connects the citric acid cycle and the electron-transport chain? a. water b. O2 c. NADH d. H+ e. ADP 9. What enzyme is required to synthesize α-1,4-glycosidic bonds in glycogen? a. glycogen synthase b. UDP-glucose phosphorylase c. branching enzyme d. glycogen phosphorylase e. phosphoglucomutase 10. Where are the products of the light reactions transported for the following dark reactions to proceed? a. stroma b. thylakoid lumen c. granum d. thylakoid membrane e. stroma lamellae 11. What is NOT generated in cyclic photophosphorylation? a. ATP b. NADPH c. Fdred

Name:

Class:

Date:

ch 20 - 25 d. Fdox e. proton gradient 12. What is the more preferred name for a molecular assembly in the inner mitochondrial membrane, which carries out synthesis of ATP? a. F1F0 ATPase b. mitochondrial ATPase c. ATP synthase d. NADH e. the proton-motive force 13. When tissue is deprived of O2, the electron-transport chain is unable to generate a proton gradient and: a. ATP synthase will produce ATP. b. ATP synthase will stop its work. c. IF1 will inhibit the hydrolytic activity of ATP synthase. d. ATP synthase will hydrolyze ATP to ADP and Pi. e. IF1 will activate the hydrolytic activity of ATP synthase.

14.

is NOT required for synthesis of glycogen. a. Primer b. Phosphorylase kinase c. Glycogenin d. UTP e. Pyrophosphorylase

15. Which protein can self-glycosylate with up to 10–20 glucose units? a. nucleoside diphosphokinase b. the branching enzyme c. protein kinase A d. glycogen synthase e. glycogenin 16. What is the result of the activity of transferase? a. a single glucosyl residue on the outer branch b. a single glucosyl residue on the core chain c. a short chain of three glucosyl residues on the outer branch d. a short chain of four glucosyl residues on the outer branch e. free glucose and phosphate 17. The regulatory subunit of PP1 does NOT interact with: a. phosphorylase kinase.

Name:

Class:

Date:

ch 20 - 25 b. glycogen phosphorylase. c. glycogen synthase. d. adenylate cyclase. e. glycogen.

18. Name the pathway that requires a sufficient amount of CO2 for dark reactions to proceed to minimize wasteful photorespiration. a. C3 b. C4 c. CAM d. C2 e. glycolysis 19. Choose the CORRECT order of components that transfer electrons in light reactions of photosynthesis. a. P700 → A0 → A1 → 4Fe–4S → ferredoxin → P680 → plastocyanin → QA → QB → cytochrome b6f → pheophytin → NADPH → H2O b. H2O → P680 → pheophytin → plastoquinones → cytochrome b6f → plastocyanin → P700 → A0 → A1 → 4Fe–4S → ferredoxin → NADPH c. P680 → pheophytin → plastoquinones → cytochrome b6f → plastocyanin → WOC → P700 → A0 → A1 → 4Fe–4S → ferredoxin → NADPH d. H2O → P680 → plastocyanin → plastoquinones → cytochrome b6f → pheophytin → P700 → A0 → A1 → ferredoxin → 4Fe–4S → NADPH +

e. WOC → P680 → plastocyanin → QA → QB → Fd-NAD reductase → NADH → pheophytin → P700 → A0 → A1 → ferredoxin → 4Fe–4S → H2O 20. The concentration of glucose in the blood to meet the needs of the organism as a whole is maintained by: a. the spleen. b. skeletal muscle. c. smooth muscle. d. the brain. e. the liver.

21. What is the intermediate in the interconversion of glucose 1-phosphate and glucose 6-phosphate? a. glucose 1,6-bisphosphate b. α-1,6-glucoside c. free glucose d. a block of three glucosyl residues e. glucose 2-phosphate

Name:

Class:

Date:

ch 20 - 25 22. What type of bond is glycogen phosphorylase able to cleave? a. α-1,6-glycosidic bond at a glycogen branch b. α-1,6-glycosidic bond at a glycogen core chain c. β-1,6,-glycosidic bond at a glycogen core chain d. α-1,4-glycosidic bond at a glycogen branch e. β-1,4-glycosidic bond at a glycogen branch 23. In the Rieske center, the iron–sulfur center is coordinated to the amino acid: a. His. b. Cys. c. Ala. d. Met. e. Gly. 24. What enzyme catalyzes the transformation of erythrose 4-phosphate and dihydroxyacetone phosphate to sedoheptulose 1,7-bisphosphate? a. phosphopentose isomerase b. phosphopentose epimerase c. transketolase d. aldolase e. sedoheptulose 1,7-bisphosphate phosphatase 25. What statement concerning rubisco is FALSE? a. Small subunits enhance catalytic activity of large subunits. b. Only a small subunit has a regulatory site. c. Rubisco is very abundant in chloroplasts. d. Active sites lie only in the large subunits. e. Rubisco consists of eight large and eight small subunits.

26. Which form of glycogen synthase is active? a. phosphorylated b. unbound to glucose 6-phosphate c. a form d. T state e. b form 27. During what stage of the Calvin cycle are hexose sugars formed? a. stage 1 b. stage 4 c. stage 2 d. stage 3 e. stage 5

Name:

Class:

Date:

ch 20 - 25 28. Calculate ΔG°′ (in kilojoules per mole) for the reaction where ethanol + NAD+ are converted to acetaldehyde + NADH. E0' for the ethanol → acetaldehyde reaction is 0.20 V and E0' for the NAD+ → NADH reaction is –0.32 V. (F = 96.48 kJ mol–1 V–1) a. 100.34 b. 5.53 c. 23.98 d. 11.58 e. 23.16 29. The stimulation of ATP synthesis by the ε subunit of CF1 is NOT contributed to by: a. increasing proton-motive force. b. decreasing Fdred. c. catalyzing the reaction by cytochrome b6f. d. catalyzing reaction by Fd–NADP+ reductase. e. increased Fdred.

30. What statement concerning the structural elements required for proton pumping is FALSE? a. The intermembrane space half-channels are joined by a series of β-hairpin-helix-connecting elements βH. b. An enclosed Q chamber exists near the junction of the hydrophilic portion and the membraneembedded portion. c. A hydrophilic funnel connects the Q chamber to a water-lined channel into which the half-channels open. d. The matrix half-channels are connected by a long horizontal helix (HL). e. Four proton half-channels consist of vertical and horizontal helices.

31. What is the key process to both photosynthesis and cellular respiration? a. generation of high-energy electrons b. synthesis of glucose c. generation of CO2 d. generation of low-energy electrons e. oxidation of H2O 32. Why is it NOT surprising that substances such as intermediates for the citric acid cycle, protons, inorganic phosphates, nucleotide phosphates, and many others have their transport across the inner mitochondrial membrane regulated? a. Regulated transport allows for more effective substrate cycling. b. Ultimately, all electrons flow into the electron-transport chain, which regulates electron flow from the matrix to the inner membrane space. c. The experiment where bacteriorhodopsin and ATP synthase were inserted into reconstituted vesicles

Name:

Class:

Date:

ch 20 - 25 showed that biochemically, membranes control the movement of electrons in the respiratory chain. d. Many of the reactions in the citric acid cycle and ATP synthesis are driven by accessibility of substrates and differential gradients across the inner membrane. e. It is necessary to segregate the enzymes capable of substrate-level phosphorylation during anaerobic respiration.

33. How does the rotation of the c ring lead to ATP synthesis? a. The c ring is linked tightly to the gamma and epsilon subunits in the stalk of F1. b. The c ring interacts with the beta subunit. c. The gamma subunit rotates with proton gradient formation inducing the binding-change mechanism. d. All of the answers are correct. e. None of the answers is correct.

34. Hydrolysis of drives the formation of the activated precursor for glycogen synthesis from glucose 1phosphate. a. ATP b. UTP c. pyrophosphate d. glucose 1-phosphate e. UDP 35. Protons do NOT pump: a. Complex I. b. Complex II. c. Complex III. d. Complex IV. e. Complex V 36. McArdle's disease results from a lack of: a. glycogen phosphorylase a. b. glycogen phosphorylase b. c. protein phosphatase A. d. phosphofructokinase. e. phosphorylase kinase.

37. How much H+ will be pumped by ATP synthase, and how much ATP will be generated if ATP synthase has 12 subunit III components? a. 12 H+; 3 ATP b. 12 H+; 12 ATP c. 3 H+; 12 ATP d. 3 H+; 3 ATP

Name:

Class:

Date:

ch 20 - 25 e. 4 H+; 4 ATP 38. Which is a function of thioredoxin? a. The oxidized form of thioredoxin inactivates enzymes of the Calvin cycle. b. Thioredoxin reduces ferredoxin by ferredoxin–thioredoxin reductase. c. Reduced thioredoxin can cleave disulfide bonds in enzymes. d. The oxidized form of thioredoxin can destroy ferredoxin. e. Reduced thioredoxin inhibits rubisco.

39. Coenzyme Q is also called: a. NADH. b. oxidoreductase. c. ubiquinone. d. Complex II. e. Rieske center.

40. Insulin triggers a pathway that activates: a. protein kinase A. b. protein kinases. c. glycogen synthase kinase. d. adenylate cyclase. e. glycogen phosphorylase.

41. What enzymatic activity does the insulin receptor possess? a. tyrosine kinase b. serine kinase c. protein phosphatase d. threonine kinase e. protein phosphorylase 42. What is the rational way to say that electrons flow DOWN the electron-transport chain? a. Electrons flow from oxidized carriers to reduced carriers in discrete steps like a staircase. b. Electrons flow from half-reactions with more positive redox potentials to more negative. c. Electrons flow from reactions that continuously generate negative free-energy values. d. Electrons flow from the outer surface to the inner surface, a top-down perception. e. Because we think of electrons flowing like a liquid, the only direction electrons can flow is down.

43. Which of the following enzymes inactivates glycogen phosphorylase? a. protein phosphatase 1 b. phosphoglucomutase c. protein kinase A

Name:

Class:

Date:

ch 20 - 25 d. hexokinase e. transferase 44. What number of glucosyl units in the main glycogen chain is required for the branching enzyme to cleave the new branch? a. 7 b. 11 c. 4 d. 20 e. 50 45. What properties does a long tail of the isoprenoid give to ubiquinone? a. makes it hydrophilic and allows it to diffuse rapidly within the inner mitochondrial membrane b. makes it hydrophobic and allows it to diffuse rapidly within the mitochondrial membranes c. makes it hydrophobic and allows it to diffuse rapidly within the inner mitochondrial membrane d. anchors it in the membrane so protons and electrons could shuttle through it e. provides several oxidation states 46. What is the other name of Complex III? a. Q-cytochrome c oxidoreductase b. succinate-Q reductase c. NADH-Q oxidoreductase d. cytochrome c oxidase e. cytochrome c 47. Which statement about differences between C4 and C3 plants is FALSE? a. C3 and C4 plants have anatomical differences of the leaf. b. C3 plants use rubisco to directly fix CO2, while C4 uses a second pathway (PEP carboxylase) to fix CO2. c. C3 is called C3 because carbon dioxide is fixed into a three-carbon sugar, while C4 pathways fix CO2 into a four-carbon sugar. d. C3 plants comprise the majority of plants on Earth, and C4 plants are found in drier climates. e. C3 plants consume 30 molecules of ATP per hexose molecule formed, while C4 plants consume 12.

48. ATP is known as the energy currency of the cell; however, ATP is not used directly in any of the enzymatic reactions in glycogen synthesis. How, then, does ATP provide energy currency for glycogen synthesis? a. ATP is used to regenerate GTP in the cGMP cascade. b. ATP is used by diphosphokinase to regenerate UTP. c. Dietary glucose is phosphorylated to glucose 1-phosphate by hexokinase. d. The branching enzyme requires the hydrolysis of ATP.

Name:

Class:

Date:

ch 20 - 25 e. An activated glycosyl unit of ADP-glucose is transferred to the chain of glycogen.

49. C3 plants consume a. 12 b. 30 c. 18 d. 10 e. 48

molecules of ATP per hexose molecule formed in the absence of photorespiration.

50. Knowing what you do about the distribution of the light reaction enzymes, where would you expect to find the Calvin cycle enzymes and why? a. the luminal side of the thylakoid membrane, as this is the location of photolysis of water b. the luminal side of the thylakoid membrane, as this is the location of NADPH and ATP synthesis c. thylakoid integral membrane proteins that derive energy from proton pumping d. the stromal side of the thylakoid membrane, as this is the location of NADPH and ATP formation e. the stromal side of the thylakoid membrane, as this is the location of photolysis of water 51. What is the other name of Complex IV? a. Q-cytochrome c oxidoreductase b. cytochrome c c. succinate-Q reductase d. NADH-Q oxidoreductase e. cytochrome c oxidase 52. Muscle phosphorylase b is activated by: a. low blood-glucose concentration. b. high blood-glucose concentration. c. high AMP concentration. d. low AMP concentration. e. high ATP concentration.

53. Why does it make sense that muscle cells are not responsive to glucagon, but both types of cells are responsive to epinephrine? a. Glucagon in the liver signals the need for glycogen synthesis. b. Phosphorylase b in muscle transitions to the T state in the presence of epinephrine so that control is independent of liver phosphorylase b. c. Epinephrine stimulates the transferase enzyme so that glycogen is more readily available in highly active muscles. d. Lactate formed in muscle cells is released into the blood where it is taken up by the liver for gluconeogenesis. e. The function of epinephrine is to maintain a nearly constant concentration of glucose in the blood during periods of relaxation.

Name:

Class:

Date:

ch 20 - 25 54. What converts glycogen synthase into the a form after exercise? a. previous emission of epinephrine b. phosphorylase c. glycogen synthase kinase d. protein kinase A e. protein phosphatase 1 55. What are the isomeric forms of the hexose phosphate products of the Calvin cycle collectively called? a. glucose monophosphate pool b. fructose monophosphate pool c. hexose monophosphate pool d. monophosphates pool e. phosphates pool 56. Which a CORRECT photosynthetic special pair? a. chlorophyll a – chlorophyll a b. plastoquinone QA – plastoquinone QB c. chlorophyll a – chlorophyll b d. chlorophyll A0 – quinone A1 e. chlorophyll a – chlorophyll A0 + 1 + 57. Determine E 0 for the reaction NADP + H2O → NADPH + /2O2 + H if standard reduction potentials for

NADP+ → NAPDH and 1/2O2 + H+ → H2O are –0.32 V and +0.82 V, respectively. Consider that the Faraday constant is 96.48 kJ mol–1 V–1. a. –0.50 V b. +0.50 V c. –1.14 V d. +1.14 V e. –0.26 V 58. Light reactions do NOT lead to an increase in: a. stromal concentrations of Mg2+. b. stromal concentration of H+. c. stromal concentration of NADPH. d. stromal concentration of reduced ferredoxin. e. pH in the thylakoid lumen.

59. Predict the major consequence of the loss of the gene that encodes the glycogen-targeting subunit of protein phosphatase 1. a. Protein kinase A would not be inhibited by phosphorylating PP1.

Name:

Class:

Date:

ch 20 - 25 b. Glycogen synthase a will be maintained in the T form. c. Phosphorylase kinase will be activated only in the presence of cAMP. d. Glucose 6-phosphatase will display reduced activity. e. A loss of this gene would prevent association of the catalytic subunit of PP1 with its substrate.

60. What acts as a "high-energy handle" for glycogen synthesis? a. uridine triphosphate b. pyrophosphate c. uridine diphosphate glucose d. uridine diphosphate e. phosphoryl group 61. Insulin stimulates glycogen synthase by inactivating: a. protein phosphatase 1. b. protein kinase A. c. glycogen synthase kinase. d. glycogen phosphorylase. e. nucleoside diphosphokinase.

62. The more leaves receive light, the more sugar. a. pyruvate–Pi dikinase b. aldolase c. rubisco d. rubisco activase e. transketolase

will be active, and the more CO2 will be converted into

63. What is the name of protons that participate in the reduction of O2 to H2O? a. chemical protons b. additional protons c. reducing protons d. pumped protons e. redox protons 64. What is the key regulatory enzyme in glycogen synthesis? a. the branching enzyme b. glycogen synthase c. nucleoside diphosphokinase d. glycogen phosphorylase e. glycogenin

Name:

Class:

ch 20 - 25 65. Which process provides reduction of FADH2 using the electron-transport system? a. glycerol 3-posphate shuttle b. malate–aspartate shuttle c. ATP synthesis d. glycolysis e. hydrolysis of ATP 66. The direct transporter of H+ through UCP-1 is a(n): a. carboxyl group of a fatty acid. b. α-adrenergic hormone. c. NAD+ and FAD. d. malate. e. amino group of histidine.

67. What is the product of UCP-1 action? a. ATP b. proton-motive force c. heat d. ADP e. O2 68. What enzyme splits the glycosidic linkage between C-1 and C-4 carbon atoms? a. hexokinase b. glycogen phosphorylase c. phosphoglucomutase d. α-1,6-glucosidase e. phosphodiesterase 69. What makes aerobic organisms aerobic? a. They need to breathe. b. They use oxidative phosphorylation. c. Reduction of oxygen to useful water molecules takes place. d. The final acceptor in the electron-transport chain is oxygen. e. Oxygen is the prevailing gas in the atmosphere.

70. What is the other name of Complex II? a. succinate-Q reductase b. cytochrome c c. Q-cytochrome c oxidoreductase d. cytochrome c oxidase e. NADH-Q oxidoreductase

Date:

Name:

Class:

Date:

ch 20 - 25 71. What does NOT participate in, nor is a component of, the electron-transport chain? a. acetyl CoA b. nonheme-iron proteins c. coenzyme Q d. cytochrome c1 e. NADH 72. The rotation of the γ subunit leads to the change of: a. the structure and functions of the F1 subunit. b. the functions and structure of β subunits. c. the charge of the inner membrane. d. a method of ATP formation. e. the functions of the F0 subunit.

73. What enzyme is present in the endoplasmic reticulum of liver cells? a. glucose 6-phosphatase b. phosphorylase b c. protein phosphatase 1 d. protein kinase A e. phosphoglucomutase 74. What prosthetic group is present only in succinate-Q reductase? a. semiquinone b. FMN c. coenzyme Q d. heme group e. FAD 75. What is the donor of glycosyl units in autoglycosylation of glycogenin? a. glucose b. glucose 1-phosphate c. UDP-glucose d. the branching enzyme e. glycogen 76. Carbon monoxide is considered toxic because it acts on Complex IV. How would the addition of carbon monoxide to actively respiring mitochondria affect the relative oxidation–reduction state of all components of the electron-transport chain? a. All four complexes would remain oxidized because they function as a multisystem complex. b. Complexes I and III would be reduced, but Complexes II and IV would be oxidized. c. Complexes I, II, and III would be oxidized, but Complex IV would remain reduced.

Name:

Class:

Date:

ch 20 - 25 d. Complexes I, II, and III would be reduced, and Complex IV would be oxidized. e. All four complexes would remain reduced because they function as a multisystem complex.

77. What proton pump is L-shaped, with a hydrophobic horizontal arm lying in the membrane and a hydrophilic vertical arm projecting into the matrix? a. Q-cytochrome c oxidoreductase b. NADH dehydrogenase c. cytochrome c oxidase d. ATPase e. succinate-Q reductase 78. The activated glucose donor of glycogen synthesis is: a. glucose 1-phosphate. b. glucose 6-phosphate. c. uridine triphosphate glucose. d. glucose 1,6-bisphosphate. e. uridine diphosphate glucose.

79. The subunit of ATPase embedded in the inner mitochondrial membrane is the: a. anchor subunit. b. membrane–c ring subunit. c. F0 subunit. d. F1 subunit. e. Fm subunit.

80. A low blood-glucose level: a. shifts the equilibrium of phosphorylase a from the R state to the T state. b. shifts the equilibrium from phosphorylase a to phosphorylase b. c. activates glucagon secretion. d. activates insulin secretion. e. activates protein phosphatase 1.

81. How many complexes of the electron-transport chain use energy released by the electron flow to pump protons? a. 0 b. 1 c. 2 d. 3 e. 4 82. The energetic equivalent of

ATP molecule(s) is consumed in transporting CO2 to the chloroplasts of

Name:

Class:

Date:

ch 20 - 25 the bundle-sheath cells. a. one b. two c. three d. four e. six 83. The C4 pathway is necessary for tropical plants because: a. at high temperatures, the plants cannot maintain sufficient water levels within the cells. b. they do not have proper day/light cycles to maintain the balance of CO2 necessary for carbohydrate storage. c. at high temperatures, the oxygenase activity of rubisco is high. d. at high temperatures, transpiration stops. e. they always keep stomata of their leaves open.

84. What is the source of carbons for the Calvin cycle? a. glucose b. carbon dioxide c. glycogen d. glyoxylate e. sucrose 85. What is the other name for noncyclic photophosphorylation? a. light-independent phosphorylation b. cyclic phosphorylation c. Z scheme of photosynthesis d. dark phosphorylation e. proton-motive force 86. How many molecules of ATP are formed by the oxidation of glucose? a. 2.5 b. 26 c. 30 d. 2 e. 1.5 87. What accepts electrons in the electron-transport chain? a. O2 b. H2O2 c. NADPH d. NADP+

Name:

Class:

Date:

ch 20 - 25 e. FADH2 88. Complete the following reaction for photosystem I: Pc(Cu+) + Fdox + light → +

+

a. → Pc(Cu ) + (Cu )Fdred 2+ b. → Pc(Cu ) + Fdred 2+ c. → Pc + Fdred(Cu ) 3+ d. → Pc(Cu ) + Fdred 2+ e. → Pc(Cu ) + Fdox

89. Why is the T state of glycogen phosphorylase less active? a. The adjacent amino acids are not phosphorylated and thus catalysis cannot be carried out. b. The active site is partially blocked. c. ATP cannot be bound by the T state. d. The adjacent amino acids are phosphorylated and thus the active state is blocked. e. Phosphorylase in the T state has a ridge structure.

90. The organs most vulnerable to mitochondrial diseases: a. are highly dependent on oxidative phosphorylation. b. are highly dependent on glycolysis. c. consume a lot of energy. d. have a high level of brown fat. e. have a high level of adipose tissue.

91. Choose the CORRECT thermodynamic characteristic of the first reaction in the Calvin cycle. a. ΔG°' > 0; exergonic reaction b. ΔG°' < 0; endergonic reaction c. ΔG°' < 0; exergonic reaction d. ΔG°' = 0; endergonic reaction e. ΔG°' > 0; endergonic reaction 92. An α-1,6-glycosidic link is created by the: a. branching enzyme. b. glucose transferase. c. glycogen isomerase. d. glycogen synthase. e. glycogenin.

93. What protein catalyzes the reduction of O2? a. cytochrome c oxidase

Name:

Class:

Date:

ch 20 - 25 b. cytochrome c c. coenzyme Q d. catalase e. Q-cytochrome c oxidoreductase 94. How many chloroplasts does a typical plant cell have? a. 1–100 b. 200–500 c. > 1000 d. 500–800 e. > 2000 95. How much ATP is produced in cyclic photophosphorylation upon absorption of six photons? a. 1 b. 2 c. 3 d. 4 e. 6 96. What is the result of glycogen synthase phosphorylation? a. stimulation of glycogen synthesis b. stimulation of glycogen degradation c. inhibition of glycogen synthesis d. inhibition of glycogen degradation e. acceleration of glycogen synthesis 97. What is the main transporting carbohydrate in plants? a. lactose b. maltose c. glucose d. sucrose e. xylulose 98. Which special pair has the highest reduction potential? a. P680 b. P680* c. P700 d. P700* e. WOC 99. What explains a name of ATP synthase such as F1F0 ATP synthase?

Name:

Class:

Date:

ch 20 - 25 a. ATP synthase generates free energy (F). b. ATP synthase consists of four α and four β subunits. c. ATP synthase consists of an F0 subunit in the mitochondrial matrix and an F1 subunit in the inner membrane. d. ATP synthase provides a chemical gradient and a charge gradient. e. ATP synthase consists of an F0 subunit in the inner membrane and an F1 subunit in the mitochondrial matrix.

100. Which enzyme transfers UDP-glucose to the hydroxyl of an existing glycogen core? a. glycogen synthase b. glycogen synthetase c. glycogen ligase d. glycogen diphosphokinase e. nucleoside diphosphokinase 101. Glucagon is able to bind to the 7TM receptors of: a. liver cells. b. muscle cells. c. pancreas cells. d. neurons. e. epithelial cells.

102. ATP synthesis controls: a. reduction of NADH and FADH2. b. oxidation of NADH and FADH2. c. the flow of electrons through UCP-1. d. the proton gradient. e. reduction of glucose. + 1 + 103. Determine the ΔG° for the reaction NADP + H2O → NADPH + /2O2 + H if standard reduction

potentials for NADP+ → NAPDH and 1/2O2 + H+ → H2O are –0.32 V and +0.82 V, respectively. Consider that the Faraday constant is 96.48 kJ mol–1 V–1. a. 96.5 kJ/mol b. –96.5 kJ/mol c. 50.18 kJ/mol d. –220.02 kJ/mol e. 220.02 kJ/mol 104. What definition concerning the oxidation states of quinones is TRUE? a. Q is the fully oxidized state with two hydroxyl groups.

Name:

Class:

Date:

ch 20 - 25 b. QH-– is a semiquinone radical anion with one hydroxyl group. c. The addition of one electron results in the semiquinone form. d. QH- is a semiquinone intermediate with one hydroxyl group. e. QH2 is the fully reduced state with two keto groups.

105. Choose the INCORRECT statement about nonphotochemical quenching. a. NPQ requires the proton gradient across a thylakoid membrane. b. Nonphotochemical quenching disrupts the proper resonance energy transfer at the light stage of photosynthesis. c. Photosystem II subunit S is involved in NPQ. d. NPQ dissipates the energy from the light-harvesting complex as heat. e. Nonphotochemical quenching disrupts the proper photoinduced charge separation in the reaction center.

106. How many electrons are transferred to plastocyanin upon absorption of six photons? a. 2 b. 4 c. 6 d. 12 e. 18 107. Which hormone signifies the starved state? a. glucagon b. insulin c. norepinephrine d. calmodulin e. epinephrine 108. What amino acid residue of phosphoglucomutase is able to transfer the phosphoryl group to glucose 1phosphate? a. phosphorylated serine residue b. acetylated lysine residue c. phosphorylated lysine residue d. acetylated serine residue e. phosphorylated tyrosine residue 109. What is the MOST abundant protein on Earth? a. ribulose 1.5-bisphosphate b. aldolase c. rubisco d. phosphopentose epimerase

Name:

Class:

Date:

ch 20 - 25 e. transketolase 110. What conformation of β subunits contributes to form ATP? a. F1 conformation b. open conformation c. loose conformation d. tight conformation e. O conformation 111. Choose the CORRECT sequence of steps catalyzed by phosphoglucomutase. a. phosphoryl group is transferred from the serine residue to the C-6 hydroxyl group of glucose 1phosphate → phosphoryl group is transferred from C-1 of glucose 1-phosphate to the serine residue b. phosphoryl group is transferred from the serine residue to the C-1 hydroxyl group of glucose 6phosphate → phosphoryl group is transferred from C-6 of glucose 6-phosphate to the serine residue c. a free orthophosphate is formed → phosphoryl group is transferred from the serine residue to the C-6 hydroxyl group of glucose 1-phosphate d. phosphoryl group is transferred from the tyrosine residue to the C-6 hydroxyl group of glucose 1phosphate → a free orthophosphate is formed e. phosphoryl group is transferred from the lysine residue to the C-6 hydroxyl group of glucose 1phosphate → phosphoryl group is transferred from C-1 of glucose 1-phosphate to the serine residue 112. What prosthetic group is present in succinate-Q reductase, Q-cytochrome c oxidoreductase, and NADH-Q oxidoreductase? a. semiquinone b. FMN c. coenzyme Q d. heme group e. iron–sulfur cluster 113. What molecule gains reducing power upon absorbing the energy of light? a. special pair b. electron carrier c. electron acceptor d. electron donor e. proton acceptor 114. The only lipid-soluble antioxidant synthesized by human beings is: a. superoxide dismutase. b. catalase. c. ubiquinol. d. vitamins E. e. vitamins C.

Name:

Class:

Date:

ch 20 - 25 115. What are cristae and what is their function? a. They are internal ridges of the outer mitochondrial membrane; they increase the surface area of the outer mitochondrial membrane. b. They are internal ridges of the plasma membrane on prokaryotes; they increase the surface area of the plasma membrane. c. They are internal ridges of the inner mitochondrial membrane; they increase the surface area of the inner mitochondrial membrane. d. They are organelles of the mitochondrion; they play a role of the sites for oxidative. phosphorylation. e. They are organelles of the mitochondrion; they play a role as the site for ATP synthesis.

116. Choose the CORRECT statement. Glycogenin: a. is a homotetramer. b. is autoglycosylated by β-1,4-glucose polymers. c. is the primer for glycose synthase. d. binds glucose units to a tyrosine residue. e. catalyzes the formation of α-1,6-glucose polymers.

117. How many protons are transferred into the thylakoid lumen by photosystem I after absorption of six photons? a. 2 b. 4 c. 6 d. 12 e. 18 118. Acceptor control of oxidative phosphorylation means that the rate of respiration depends on the level of: a. O2. b. cAMP. c. ATP. d. ADP. e. AMP. 119. What is the main trigger for secretion of epinephrine and glucagon? a. low blood-glucose concentration b. high blood-glucose concentration c. low cAMP concentration d. high cAMP concentration e. low Ca2+ concentration 120. What is the energy cost of the C4 pathway? a. Thirty molecules of ATP are used per hexose molecule made.

Name:

Class:

Date:

ch 20 - 25 b. Eighteen molecules of ATP are used per hexose molecule made. c. Thirty molecules of NADPH are used per hexose molecule made. d. Eighteen molecules of ATP and 12 of NADPH are used per hexose molecule made. e. Fifteen molecules of NADPH are used per hexose molecule made.

121. What controls the rate of the citric acid cycle? a. availability of NAD+ and FAD b. availability of malate +

c. availability of NAD and Pi d. permeability of the inner mitochondrial membrane e. permeability of the outer mitochondrial membrane 122. What are mitochondrial carriers? a. transport molecules that carry only ATP across the outer mitochondrial membrane b. transmembrane glycoproteins that carry specific ions and charged metabolites across the inner mitochondrial membrane c. transmembrane proteins that carry specific ions and charged metabolites across the inner mitochondrial membrane d. transport molecules that carry the exchange of cytoplasmic ATP for matrix ADP and Pi e. surface proteins that carry specific ions and charged metabolites across the inner mitochondrial membrane 123. Which is the true glucose level sensor in the cell? a. insulin b. phosphorylase a c. glucagon d. glycogen synthase e. protein phosphatase I 124. How many ATP molecules are generated after a pair of transported electrons flows from NADH to O2? a. 2.5 b. 1.5 c. 2.0 d. 1.0 e. 3.0 125. What complex has seven Fe–S clusters? a. ATPase b. succinate-Q reductase c. cytochrome c oxidase d. Q-cytochrome c oxidoreductase

Name:

Class:

Date:

ch 20 - 25 e. NADH dehydrogenase 126. The Q cycle: a. transfers electrons from a two-electron carrier to a one-electron carrier. b. recycles protons. c. acts as an NADH exchanger within the cytosol. d. transfers electrons from a four-electron carrier to a two-electron carrier. e. acts as an ATP exchanger within the extracellular compartment.

127. What is the main function of the cAMP cascade? a. highly amplifies the effects of epinephrine and glucagon b. highly amplifies the effects of epinephrine and phosphorylase a c. inhibits phosphorylase kinase d. inhibits phosphodiesterase e. activates phosphofructokinase 128. How many molecules of ATP are used to create one branch on the glycogen chain by breaking an α-1,4 link and forming an α-1,6 link? a. 1 b. 2 c. 3 d. 4 e. 0 129. Plants store glucose as a. starch; sucrose b. fructose; sucrose c. starch; fructose d. glucose; starch e. galactose; fructose

and

.

130. What is the name of the chlorophyll with two H+ ions in place of the central Mg2+ ion? a. plastocyanin b. plastoquinone c. lutein d. pheophytin e. phycoerythrin 131. Light absorption induces electron transfer from P680 to: a. pheophytin. b. QH2.

Name:

Class:

Date:

ch 20 - 25 c. cytochrome c. d. chlorophyll PP. e. carotenoid.

132. What mitochondrial protein is crucial for the synthesis of Fe–S clusters? And what type of mutation is responsible for the Friedreich's ataxia? a. amytal; trinucleotide expansion b. amytal; trinucleotide deletion c. frataxin; trinucleotide expansion d. frataxin; trinucleotide deletion e. frataxin; trinucleotide inversion 133. What is one way NADH transfers across the mitochondrial membrane? a. transferring H+ from mitochondrial NADH to cytoplasmic NAD+ b. introducing NADH by the glycerol 3-phosphate shuttle c. introducing electrons from NADH by the glycerol 3-phosphate shuttle d. transferring electrons from NADH to FADH2 e. introducing H+ from NADH by dihydroxyacetone phosphate 134. Ribulose 1,5-bisphosphate needs to be regenerated because it is: a. used as a chemical fuel at the expense of NADPH and ATP. b. used for sucrose synthesis. c. the acceptor of CO2 in the first stage of the Calvin cycle. d. used in the gluconeogenic pathway. e. unstable.

135. Leber hereditary optic neuropathy is inherited from: a. both parents with the X chromosome. b. the father with the Y chromosome. c. the mother with the X chromosome. d. the mother with mitochondrial chromosomes. e. the father with mitochondrial chromosomes.

136. In the CAM plants, carbon dioxide is fixed by the C4 pathway into a. pyruvate; stroma b. oxaloacetate; stroma c. malate; vacuoles d. malate; stroma e. oxaloacetate; vacuoles 137. Glucose is a(n)

for glycogen phosphorylase a.

, which is stored in

.

Name:

Class:

Date:

ch 20 - 25 a. product b. allosteric activator c. allosteric inhibitor d. cofactor e. suicide inhibitor 138. What protein is activated in the cytoplasm due to activation of the insulin receptor? a. protein phosphatase 1 b. protein kinase A c. glycogen phosphorylase d. insulin-receptor substrate e. glycogen synthase kinase 139. Both phosphorylases a and b exist in an equilibrium between the R and T states. Which phosphorylase state is the MOST active? a. phosphorylase a in the R state b. phosphorylase a in the T state c. phosphorylase b in the R state d. phosphorylase b in the T state e. both phosphorylase a and phosphorylase b in the R state 140. What is the implication of the difference in permeability of the mitochondrial membrane versus the thylakoid membrane to Mg2+ and Cl–? a. The thylakoid membrane is less permeable to Mg+, Cl–, and H+; therefore, more energy is needed to pump protons across the membrane. b. The mitochondrial membrane being permeable to Mg2+ and Cl– means that the electron flow occurs only with transport of one Mg2+ and one Cl–. c. The thylakoid membrane being permeable to Mg2+ and Cl– means that the electron flow occurs only with transport of one Mg2+ and one Cl–. d. The mitochondrial membrane being permeable to Mg2+ and Cl– means that although protons are pumped across the membrane, no membrane potential is generated. e. The thylakoid membrane being permeable to Mg2+ and Cl– means that although protons are pumped across the membrane, no membrane potential is generated.

141. is not stimulated by cAMP. a. Brain phosphorylase b. Phosphofructokinase c. Muscle phosphorylase d. Epinephrine e. Protein kinase A

Name:

Class:

Date:

ch 20 - 25 142. What is the difference between the number of ATP molecules per molecule of hexose in C4 and C3 plants? a. 20 b. 12 c. 30 d. 10 e. 18 143. What is the name of the enzyme that catalyzes the first stage in the Calvin cycle? a. ribose 3,5-diphosphate oxygenase b. ribulose 1,5-diphosphate carboxylase/oxygenase c. ribulose 5-phosphate carboxylase d. ribose 4,5-bisphosphate carboxylase/oxygenase e. ribulose 1,5-bisphosphate carboxylase/oxygenase 144. Choose the CORRECT statement about transport of ATP. a. Transport of ATP is not coupled with transport of ADP. b. ATP is moved across the mitochondrial membrane by the 30-kDa specific protein. c. ATP has the same negative charge as ADP. d. Transport of ATP occurs without energy expenditure. e. ATP passes freely through the inner mitochondrial membrane.

145. What is the main fuel for slow-twitch fibers? a. glycogen b. fatty acids c. glucose 6-phosphate d. free glucose e. glucose 1,6-bisphosphate 146. What is the reaction of ATP synthase?

3–

+ 2HPO42– + H+ ↔ ATP4– + H2O

3–

+ HPO42– + H+ ↔ ATP4– + H2O

a. AMP b. ADP

3– 2– + 4– c. ADP + HPO4 + 2H ↔ ATP + H2O d. AMP3– + 2HPO42– + 2H+ ↔ ATP4– + H2O

e. None of the answers is correct.

147. How many glucose residues does the glycogen branching enzyme move to form a branch point? a. 2 b. 4 c. 7 d. 16

Name:

Class:

Date:

ch 20 - 25 e. 21 148. Why is photorespiration said to be wasteful? a. CO2 is consumed and O2 is released. b. Only five of the six carbon atoms of two molecules of glycolate are recycled. c. Two molecules of glycolate are not recycled, and the carbon skeleton is not recovered. d. The organic carbon is converted into CO2 without the production of an energy-rich metabolite. e.

One carbon atom of glycolate is lost as CO. 149. Very long outer branches of glycogen stored in normal amounts are the result of a mutation in: a. the insulin receptor. b. α-1,4-glucosidase. c. glycogen phosphorylase. d. α-1,6-glucosidase. e. the branching enzyme.

150. What level of photorespiration is characteristic of tropical plants with C4? a. very high b. high c. moderate d. zero e. low 151. In the presence of: a. a respiratory inhibitor, both ATP synthesis and O2 consumption stop. In the presence of a decoupling agent, only ATP synthesis stops. b. both a respiratory inhibitor and a decoupling agent, only ATP synthesis stops. c. both a respiratory inhibitor and a decoupling agent, only O2 consumption stops. d. a respiratory inhibitor, only O2 consumption stops. In the presence of a decoupling agent, only ATP synthesis stops. e. a respiratory inhibitor, only O2 consumption stops. In the presence of a decoupling agent, both ATP synthesis and O2 consumption stop.

152. What is the effect of the glucagon-triggered cAMP cascade on glycogen synthesis in the liver? a. initiation b. activation c. shutting off d. acceleration e. irreversible inhibition 153. What liver enzyme cleaves the phosphate from glucose 6-phosphate?

Name:

Class:

Date:

ch 20 - 25 a. α-1,6-glycosidic b. phosphorylase kinase c. α-1,4-glycoside d. phosphorylase a e. glucose 6-phosphatase 154. The proton-motive force consists of a. a chemical b. a proton c. an electron d. both a chemical and a proton e. a chemical, a proton, and an electron

gradient(s).

155. An incorrect, tight binding of PP1 to glycogen synthase would result in: a. a hyperactive glycogen synthase. b. hyperglycogen levels. c. an increase in insulin action. d. high blood glucose. e. an activated glycogen synthase.

156. What nucleotide-based cofactor is of high importance for light-sensitive complexes? a. UDP b. CoA c. NAD+ d. NADP+ e. TPP 157. What metal is present in ALL complexes of the electron-transport chain? a. copper b. iron c. magnesium d. potassium e. manganese 158. A complete oxidation of a glucose residue derived from glycogen yields a. 2 b. 4 c. 7 d. 11 e. 31

ATP.

Name:

Class:

Date:

ch 20 - 25 159. Choose the CORRECT aspect concerning carotenoids. a. absorbance of light between 400 and 500 nm b. suppression of damaging photochemical reactions c. absorbance of light of yellow and red spectra d. expansion of absorption spectra of chlorophylls e. absorbance of blue and indigo light 160. The wasteful side reaction of rubisco is binding of a. O3

instead of CO2.

b. O2 c. N2 d. CO e. NO2 161. What is the characteristic feature of type I diabetes? a. Glucagon-to-insulin ratio is low. b. Glucagon-to-insulin ratio is high. c. Insulin receptors are less sensitive to insulin. d. Insulin receptors are hypersensitive to insulin. e. Glucose is overproduced by the liver and is underused by other organs.

162. What evidence exists to support an endosymbiotic event for the formation of a chloroplast? The DNA of the chloroplast and the cyanobacterium: a. is arranged in operons. b. is linear. c. has multiple start sites for DNA replication. d. encodes all chloroplast proteins. e. contains both chlorophyll and mitochondrial genes.

163. After exercise, muscle cell glycogen metabolism is regulated by: a. insulin. b. phosphorylase a. c. glucagon. d. glycogen synthase. e. protein phosphatase 1.

164. You are taking your new puppy for a walk and a vicious-looking dog comes rushing out from an unfenced yard. You pick up your puppy and take off down the road. What is the MOST likely form of the phosphorylase in your muscle? a. phosphorylase a, R state, not phosphorylated b. phosphorylase a, R state, phosphorylated

Name:

Class:

Date:

ch 20 - 25 c. phosphorylase a, T state, phosphorylated d. phosphorylase b, R state, phosphorylated e. phosphorylase b, T state, phosphorylated 165. The proton channel of ATP synthase consists of: a. 8–14 pairs of α helices. b. 7 α helices. c. 8–14 α helices. d. 8–14 half-channels. e. 8–14 a subunits.

166. In light reactions of photosynthesis, the proton-motive force (Δp) does NOT contribute to: a. ΔpH. b. proton gradient. c. thylakoid membrane nonpermeability to protons. d. Δψ. e. thylakoid membrane permeability to ions other than H+.

167. What promotes the rotation of the γ subunit? a. hydrolysis of ADP b. hydrolysis of ATP c. formation of ATP d. change in the conformation of the β subunit e. binding of nucleotides 168. In the C4 pathway, oxaloacetate carries: a. O2 from bundle-sheath cells to mesophyll cells. b. CO2 from mesophyll cells to a stoma. c. O2 from bundle-sheath cells to vascular tissue. d. CO2 from a stoma to vascular tissue. e. CO2 from mesophyll cells to bundle-sheath cells.

169. Choose the CORRECT sequence of activation steps of phosphorylase kinase. a. low blood-glucose concentration → epinephrine secretion → protein kinase A phosphorylates the α subunit → protein kinase A phosphorylates the β subunit → Ca2+ binds to the δ subunit b. high blood-glucose concentration → epinephrine secretion → Ca2+ binds to the δ subunit → protein kinase A phosphorylates the β subunit → protein kinase A phosphorylates the α subunit c. low blood-glucose concentration → epinephrine secretion → Ca2+ binds to the δ subunit → protein phosphatase 1 dephosphorylates the β subunit → protein phosphatase 1 dephosphorylates the α subunit

Name:

Class:

Date:

ch 20 - 25 d. high blood-glucose concentration → epinephrine secretion → protein kinase A phosphorylates the α subunit → protein kinase A phosphorylates the β subunit → Ca2+ binds to the δ subunit e. low blood-glucose concentration → epinephrine secretion → Ca2+ binds to the δ subunit → protein kinase A phosphorylates the β subunit → protein kinase A phosphorylates the α subunit 170. round(s) of the Calvin cycle is/are required for the production of hexose. a. One b. Three c. Six d. Twelve e. Nine 171. What is the relationship between obesity and UCP-1? a. Obesity leads to a decrease in brown adipose tissue rich in UCP-1. b. Obesity leads to an increase in brown adipose tissue rich in UCP-1. c. Obesity leads to a decrease in white adipose tissue lacking UCP-1. d. An increase in white adipose tissue leads to obesity. e. An increase in brown adipose tissue leads to obesity.

172. The main role of glycogen degradation in the liver is: a. formation of glucose for export to other tissues. b. formation of glucose for itself. c. formation of glucose 1-phosphate for export to other tissues. d. formation of glucose 1,6-bisphosphate for itself. e. production of cAMP for regulation of glycogen degradation.

173. Which process slows down in muscle cells after binding epinephrine to β-adrenergic receptors? a. glycogen breakdown b. gluconeogenesis c. glycolysis d. the citric acid cycle e. oxidative phosphorylation 174. Choose the CORRECT pair of the enzyme and its allosteric effector. a. liver phosphorylase a – Ca2+ b. muscle phosphorylase b – glucose c. liver phosphorylase a – redox switch d. phosphorylase kinase – AMP e. muscle phosphorylase b – AMP 175. Choose the CORRECT statement.

Name:

Class:

Date:

ch 20 - 25 a. Starch can't be in the form of amylose. b. Starch is a polymer of fructose residues. c. Starch is never stored in the cytoplasm. d. Starch can't be in the form of amylopectin. e. Starch is synthesized in mitochondria.

176. In what part of chloroplasts do the coupled redox reactions occur? a. intermembrane space b. stroma c. thylakoid lumen d. stroma membrane e. thylakoid membrane 177. An electron flow down the electron-transport chain leads to: a. the transport of protons across the inner mitochondrial membrane from the matrix to the intermembrane space. b. the transport of protons across the inner mitochondrial membrane from the intermembrane space into the matrix. c. the coupled synthesis of GTP. d. a dangerous imbalance of K+ ions across the mitochondrial membrane. e. a dangerous imbalance of Na+ ions across the mitochondrial membrane.

178. What is the first step in glycogen degradation? a. isomerization of glucose 1-phosphate to glucose 6-phosphate b. remodeling of the glycogen substrate c. formation of glucose 6-phosphate from glucose 1-phosphate d. release of glucose 1-phosphate from glycogen e. activation of the T state of phosphorylase b 179. What is the other name of Complex I? a. succinate-Q reductase b. cytochrome c oxidase c. Q-cytochrome c oxidoreductase d. NADH-Q oxidoreductase e. cytochrome c 180. What happens to rubisco in the absence of CO2? a. Rubisco activase uses ATP to allow the release of a Mg2+ ion. b. Rubisco degenerates. c. Rubisco inactivates by tight binding to ribulose 1,5-bisphosphate. d. Rubisco inactivates by losing two small and two large subunits.

Name:

Class:

Date:

ch 20 - 25 e. Rubisco activase binds to ribulose 1,5-bisphosphate and activates rubisco.

181. Where is glycerol 3-phosphate reoxidized to dihydroxyacetone phosphate? a. the outer surface of the inner mitochondrial membrane b. the inner surface of the outer mitochondrial membrane c. cytoplasm of the cell d. matrix of the mitochondria e. lumen of the endoplasmic reticulum 182. Which enzyme initiates phosphorylation of glycogen phosphorylase? a. protein phosphatase 1 b. phosphorylase a c. protein kinase A d. phosphorylase kinase e. phosphorylase b 183. Electrons are not very soluble in hydrophobic environments such as a bilipid membrane. What is the evidence that electrons move from complex to complex through the lipid membrane? a. Cytochrome c is the electron carrier in the membrane and undergoes a head-over-heel flip to set up the proton gradient. b. Cytochrome c is the electron carrier in the membrane and contains a hydrophobic porphyrin center. c. CoQ is the electron carrier within the membrane and seems to be confined to the respirasome. d. CoQ is the electron carrier within the membrane and contains a hydrophobic porphyrin center. e. FeS clusters are the carriers within the membrane, and the electrons move from one cluster to the next in a chain-like fashion.

184. What second messenger switches off glycogen synthesis in the epinephrine-triggered cascade? a. insulin b. GTP c. cGMP d. ATP e. cAMP 185. Why would you expect the amount of glycogen in type I glycogen-storage disease (von Gierke disease) to be increased? a. Glycogen phosphatase is activated by an increase in glucose 6-phosphate. b. Glucose 6-phosphate, the first metabolite in glycogen synthesis, remains high. c. Epinephrine inhibition of glycogen synthesis is defective. d. cAMP inhibition of glycogen synthesis is defective. e. The R form of glycogen synthase is stabilized permanently.

186. Choose the CORRECT statement.

Name:

Class:

Date:

ch 20 - 25 a. Phosphorylase a has a single phosphorylated serine residue in each subunit. Phosphorylase b has a loop moved out from the active site. b. Phosphorylase a is contained in skeletal muscle cells. Phosphorylase b is contained in liver cells. c. Liver phosphorylase a favors the T state. Muscle phosphorylase b favors the R state. d. Phosphorylase b is activated by glucose molecules. Phosphorylase a is activated by AMP. e. Both phosphorylases have about a 40% difference in the amino acid sequence.

187. Choose the CORRECT statement concerning glycogen. a. Glycogen is a polymer of glucose with α-1,6-linkages and with α-1,4-linked branches at about every 12th residue. b. Muscle cells are not able to maintain the blood-glucose level because they lack glucose 6phosphatase. c. Liver cells are able to maintain the blood-glucose level because they are rich in mitochondria. d. Glycogen is a polymer of both amylose and branched amylopectin with α-1,4-linkages. e. Upon glycogen breakdown, glucose residues are sequentially removed from the reducing ends.

188. What are stomata? a. ABC transporters b. voltage-dependent ion channels c. microscopic openings in the leaves d. the other name for vascular tissue e. stroma of bundle-sheath cells and mesophyll cells 189. An electron flow down the electron-transport chain leads to: a. transport of protons across the inner mitochondrial membrane from inside the matrix to the intermembrane space. b. transport of protons across the inner mitochondrial membrane from the intermembrane space into the matrix. c. coupled synthesis of GTP. d. a dangerous imbalance of K+ ions across the mitochondrial membrane. e. None of the answers is correct.

190. Choose the CORRECT path taken by a pair of electrons as they travel down the electron-transport chain. a. NADH → Complex I → CoQ → Complex III → Cyt c → Complex IV → O2 → Complex I → CoQ → Complex II → Cyt c → Complex IV → O2 b. FADH2 → Complex I → CoQ → Complex III → Cyt c → Complex IV → O2 → Complex II → CoQ → Complex III → CoQ → Complex IV → O2 c. NADH → Complex I → Complex II → Complex III → Cyt c → Complex IV → O2 → Complex I → CoQ → Complex I → Cyt c → Complex I → O2 d. FADH2 → Complex II → CoQ → Complex III → Cyt c → Complex IV → O2 → Complex III → CoQ → Complex III → Cyt c → Complex IV → Complex I → O2

Name:

Class:

Date:

ch 20 - 25 e. NADH → Complex I → CoQ → Complex III → Cyt c → Complex IV → O2 and FADH2 → Complex II → CoQ → Complex III → Cyt c → Complex IV → O2 191. In McArdle's patients during vigorous exercise, the pH level rises because skeletal muscles synthesize ATP: a. from creatine phosphate and ADP. Creatine formed in this reaction has a guanidium group that is a strong base. b. from creatine phosphate and ADP. Creatine formed in this reaction has a guanidium group that is a strong acid. c. from creatine phosphate and ADP. Creatine formed in this reaction has a calmodulin group that is a strong base. d. by fatty acid oxidation. The product of fatty acid oxidation, oxaloacetate, is a strong acid. e. by fatty acid oxidation. The product of fatty acid oxidation, creatine, is a strong base.

192. What pathway of photosynthesis is activated by an increased concentration of carbon dioxide? a. CAM b. C4 c. C3 d. C2 e. Calvin cycle 193. What makes the outer mitochondrial membrane quite permeable? a. proton pump b. voltage gated active transporter c. ATP-powered pump d. mitochondrial porin e. pores in the membrane 194. Sucrose 6-phosphate is formed by the reaction between: a. fructose UDP-glucose and UDP-glucose. b. glucose 6-phosphate and UDP-fructose. c. fructose UDP-glucose and UDP-fructose. d. glucose and UDP-fructose. e. fructose 6-phosphate and UDP-glucose.

195. What is the largest complex in the electron-transport chain? a. cytochrome c oxidase b. succinate-Q reductase c. Q-cytochrome c oxidoreductase d. NADH dehydrogenase e. cytochrome c reductase

Name:

Class:

Date:

ch 20 - 25 196. Photosystem I does NOT contain: a. ferredoxin. b. quinone A1. c. PsaB. d. chlorophyll A0. e. PsaA. 197. Transport through the inner mitochondrial membrane is nearly impossible for: a. oxaloacetate. b. malate. c. aspartate. d. α-ketoglutarate. e. glutamate.

198. What is the core of the glycogen molecule? a. glucose b. glycogenin c. UDP-glucose d. glycogen synthase e. glycogen phosphorylase 199. What is the side product of light reactions of photosynthesis? a. ATP b. O2 c. NADP+ d. NADPH e. proton gradient 200. What molecule must be excluded from the active site of glycogen phosphorylase? a. glucose b. glucose 1-phosphate c. water d. orthophosphate e. glucose 6-phosphate 201. Which enzyme is involved in both the Calvin cycle and the pentose phosphate pathway? a. pyruvate-Pi dikinase b. transketolase c. phosphoenolpyruvate carboxylase d. ferredoxin–thioredoxin reductase

Name:

Class:

Date:

ch 20 - 25 e. sucrose 6-phosphate synthase 202. In what part of the chloroplasts does the Calvin cycle take place? a. matrix b. stroma c. thylakoid lumen d. cristae e. intermembrane space 203. In the overall stoichiometry of light reactions, eight photons of light generate: a. 4 NADPH. b. 4 NADH. c. 3 ATP. d. 4 NADH and 3 ATP. e. 4 NADPH, 4 NADH, and 3 ATP. 204. How many photons are required for photolysis of water to proceed? a. 1 b. 2 c. 3 d. 4 e. 5 205. Which statement about the water-oxidizing complex is TRUE? oz a. Yz extracts electrons from manganese ions, which contribute to the following oxidation of H2O in the manganese center. b. Tyrosine residues Yz extract electrons from water molecules to yield O2. ox

c. Yz reduces manganese ions of the manganese center, which contributes to binding of H2O by the center. d. Two molecules of water contained in the manganese center are oxidized to yield O2 upon oxidation of Yz. ox

e. Four molecules of H2O in the manganese center form two molecules of O2 as soon as one Y z reduced.

206. Which liver enzyme is deficient in Hers disease? a. phosphorylase b. transferase c. glucosidase d. phosphoglucomutase e. phosphofructokinase

is

Name:

Class:

Date:

ch 20 - 25 207. In the initial reaction of NADH-Q oxidoreductase, what prosthetic group of this complex accepts two highpotential electrons from NADH? a. FAD b. FMN c. flavin d. FMNH2 e. FADH2 208. You are on a long car trip and stop to fill up on gas and sugary snacks. Once back on the road, what is the MOST likely form of phosphorylase in your liver? a. phosphorylase a, R state, not phosphorylated b. phosphorylase a, R state, phosphorylated c. phosphorylase a, T state, phosphorylated d. phosphorylase b, R state, phosphorylated e. phosphorylase b, T state, phosphorylated 209. How many glucose molecules can one glycogen phosphorylase get from the fragment of glycogen that consists of two branches, each containing 11 α-1,4 linkages and the branching comes from the third glucose unit from the reducing end? a. 22 b. 11 c. 12 d. 13 e. 24 210. Which coenzyme is required by glyceraldehyde 3-phosphate dehydrogenase in chloroplasts to convert 3phosphoglycerate into glyceraldehyde 3-phosphate? a. NADH b. NADPH c. NAD+ d. NADP+ e. thiamine pyrophosphate 211. What is the final enzyme in the C4 pathway? a. pyruvate–Pi dikinase b. transketolase c. aldolase d. rubisco activase e. phosphopentose isomerase 212. What pathologic condition does NOT result from free-radical injury?

Name:

Class:

Date:

ch 20 - 25 a. emphysema b. Parkinson disease c. diabetes d. atherogenesis e. asthma 213. What condition is required for a c subunit to pass into the hydrophobic region? a. proton transfer through the proton pump b. proton binding to the glutamate residue c. electron transfer through the electron-transport chain d. electron binding to the aspartate residue e. releasing of protons to the proton-rich environment 214. Which reaction is the rate-limiting step in hexose synthesis? a. reduction of 3-phosphoglycerate to form fructose 6-phosphate b. regeneration of ribulose 1,5-bisphosphate c. formation of glyceraldehyde 3-phosphate d. fixation of CO2 e. formation of ribulose 5-phosphate from ribose 5-phosphate and xylulose 5-phosphate 215. What enzyme catalyzes the reaction of oxaloacetate formation? a. phosphopentose epimerase b. phosphoenolpyruvate carboxylase c. pyruvate–Pi dikinase d. aldolase e. rubisco 216. What provides energy for the rotation of bacterial flagella and ATP synthesis? a. proton gradient b. pH gradient c. charge gradient of H+ d. electrochemical gradient for OH– e. ATP gradient 217. How many molecules of NADPH are used to bring carbon dioxide to form hexoses in the Calvin cycle? a. 2 b. 3 c. 4 d. 5 e. 1

Name:

Class:

Date:

ch 20 - 25 218. What is a redox couple? a. two different substances, one of which acts as an oxidant and the other as a reductant b. a substance that can exist in both an oxidized form and a reduced form c. two isomers that act as oxidants d. two isomers that act as reductants e. a substance that can exist only in an oxidized form or only in a reduced form 219. CAM plants grow in: a. steppes. b. wet tropics. c. deserts. d. swamps. e. mountains.

220. Inhibition of muscle glycogen phosphorylase by glucose 6-phosphate is an example of what kind of inhibition? a. allosteric heterotropic activation b. allosteric homotropic inhibition c. feedback inhibition d. feedforward inhibition e. mixed inhibition 221. How many molecules of ATP are hydrolyzed to incorporate one dietary glucose molecule into glycogen? a. 1 b. 2 c. 4 d. 6 e. 8 222. What is the name of the group of photosynthetic organisms that uses sunlight energy as its only vital source? a. heterotrophs b. chemotrophs c. saprotrophs d. autotrophs e. autoheterotrophs 223. The transferase enzyme shifts a block of a. 3 b. 4 c. 6 d. 12

glycosyl units.

Name:

Class:

Date:

ch 20 - 25 e. 2 224. What is NOT cellular respiration? a. the process of generating high-transfer-potential electrons by the citric acid cycle, their flow through the respiratory chain, and the accompanying synthesis of ATP b. an ATP-generating process in which an inorganic compound serves as the electron donor for the ultimate electron acceptor c. an ATP-generating process in which an organic compound serves as the electron donor for the ultimate electron acceptor d. an ATP-generating process in which an inorganic compound serves as the ultimate electron acceptor e. an ATP-generating process in which an organic compound serves as the ultimate electron acceptor 225. On a molecular level, how might global warming affect carbon dioxide fixation? a. Carbon dioxide, being a denser gas than oxygen, will cause more plants to sequester CO2 in mesophyll cells. b. An increase in temperatures leads to an increase in water loss in leafy plants compared to succulents; thus, light reactions are inhibited. c. Rubisco's oxygenase activity decreases with an increase in temperature, requiring more plants to use the C3 cycle. d. Ribusco's oxygenase activity increases with an increase in temperature, requiring more plants to use the C4 pathway. e. Ribusco's carboxylase activity increases with an increase in temperature, requiring more plants to use the C3 pathway.

226. Epinephrine secretion: a. activates protein phosphatase 1 in liver and muscle cells. b. activates adenylate cyclase in liver and muscle cells. c. activates glycogen phosphorylase a in liver cells. d. inhibits glycogen phosphorylase in brain cells. e. inhibits glycogen phosphorylase b in muscle cells.

227. How many protons are transferred into the thylakoid lumen after absorption of four photons? a. 2 b. 12 c. 18 d. 4 e. 8 228. Choose the CORRECT order of reactions that are conducted by photosystem I. a. P700 is activated by a photon → pheophytin accepts two high-energy electrons → two bound plastiquinones are reduced → cytochrome b6f oxidizes plastoquinols to reduce FAD → two protons are pumped to the stroma

Name:

Class:

Date:

ch 20 - 25 b. P680 is activated by two photons → two Chl A0 accept two high-energy electrons → two molecules of ferredoxin are reduced → ferredoxin–NADP+ reductase oxidizes one ferredoxin at a time to reduce FAD to FADH- and then to FADH2 → the proton-motive force is created c. P700 is activated by a photon → Chl A0 accepts two high-energy electrons → one plastoquinone QA is fully reduced → two electrons are passed on one 4Fe–4S cluster → two molecules of ferredoxin are reduced → ferredoxin–NADP+ reductase takes two protons from the stroma and reduces one FAD d. P680 is activated by a photon → pheophytin accepts one high-energy electron → one mobile plastiquinone is fully reduced → cytochrome b6f oxidizes plastoquinol to reduce FAD → two protons are pumped to the thylakoid lumen e. P700 is activated by two photons → two Chl A0 accept two high-energy electrons → one quinone A1 is fully reduced → two electrons are passed on one 4Fe–4S cluster → two molecules of ferredoxin are reduced → ferredoxin–NADP+ reductase takes two protons from the stroma and reduces one NADP+ 229. An excessive amount of glucagon relative to that of insulin in patients with type I diabetes leads to in the liver. a. increased glucose transport b. increased glycogen synthesis c. a decrease in fructose 2,6-phosphate d. a decrease in gluconeogenesis e. an increase in glycolysis 230. The target of protein kinase A is the: a. active site of calmodulin. b. γ subunit of phosphorylase kinase. c. δ subunit of phosphorylase kinase. d. β subunit of phosphorylase kinase. e. active site of phosphorylase a.

231. A diet pill that acts to increase oxygen consumption and a high amount of electron transport without ATP production is likely to be what kind of compound? a. uncoupler b. ATP synthase activator c. site I inhibitor d. site II activator e. cyanide 232. A low concentration of atractyloside: a. stops oxidative phosphorylation. b. inhibits the hydrolytic activity of ATP synthase.

Name:

Class:

Date:

ch 20 - 25 c. activates ATP synthase. d. activates ATP–ADP translocase. e. inhibits the phosphate carrier.

233. Ferredoxin–NADP+ reductase: a. is able to synthesize one molecule of NADPH by accepting two protons from ferredoxin and taking two electrons from quinone A1. b. uses NADP+ as a cofactor to accept electrons from plastoquinol to reduce ferredoxin. c. is able to synthesize two molecules of NADPH by accepting two electrons from ferredoxin and taking two protons from the stroma. d. is able to bind two molecules of ferredoxin to reduce FAD to FADH2 without formation of an intermediate. e. is able to synthesize one molecule of NADPH by accepting two electrons from ferredoxin and taking two protons from the stroma.

234. In the malate–aspartate shuttle, electrons from NADH are transferred to a. oxaloacetate b. aspartate c. acetate d. glutamate e. None of the answers is correct.

, forming malate.

235. What makes chlorophyll an effective photoreceptor? a. double bonds b. resonance c. magnesium ion d. hydrophilic phytol group e. single bonds 236. Why are green potatoes poisonous? a. A bright light leads to an increased yield of alkaloids. b. They were exposed to light so toxic that cocaine has been synthesized from them. c. A toxic alkaloid formed upon exposure to light decreases starch yield. d. They were exposed to light so toxic that solanine has been synthesized from them. e. Chlorophyll in potatoes is toxic.

237. Glycogen metabolism is regulated, up to a point, by a cyclic AMP cascade. At what point do glycogen synthesis pathways diverge from glycogen degradation pathways? a. Phosphorylase kinase converts phosphorylase b to phosphorylase a and glycogen synthase a to glycogen synthase b. b. Protein kinase A leads to the activation of glycogen degradation, and also to the inhibition of glycogen synthase by conversion from a to b.

Name:

Class:

Date:

ch 20 - 25 c. Phosphorylase kinase converts phosphorylase a to phosphorylase b and glycogen synthase a to glycogen synthase b. d. Protein kinase A leads to the activation of glycogen degradation, and also to the inhibition of glycogen synthase by conversion from b to a. e. Cyclic AMP converts inactive PKA to active PKA, causing the inactivation of phosphorylase kinase.

238. How many ATP molecules will be synthesized if a γ subunit rotates three times by 360 degrees? a. 4.5 molecules b. 7.5 molecules c. 9 molecules d. 10 molecules e. 3.3 molecules 239. Very short outer branches of glycogen stored in normal amounts are the result of the mutation in: a. the insulin receptor. b. α-1,4-glucosidase. c. glycogen phosphorylase. d. α-1,6-glucosidase. e. the branching enzyme.

240. If phosphodiesterase is inhibited, then concentration of is . a. cAMP; high; activated b. cAMP; low; activated c. cAMP; high; inactivated d. AMP; high; activated e. AMP; low; inactivated

becomes

and glycogen phosphorylase

241. What component of the electron-transport chain is a quinone derivative with a long isoprenoid tail? a. cytochrome b. coenzyme Q10 c. catalase d. succinate-Q reductase e. ubiquitin 242. What is the difference between resonance energy transfer and photoinduced charge separation? a. In resonance energy transfer, an excited electron is transferred to a nearby molecule. b. In photoinduced charge separation, an excited electron moves from accessory pigments to the lightharvesting complex. c. Photoinduced charge separation of pigments in the light-harvesting complex drives the resonance energy transfer in a reaction center. d. In resonance energy transfer, the energy of electron excitement is transferred only to an appropriate

Name:

Class:

Date:

ch 20 - 25 acceptor. e. Resonance energy transfer from pigments of a light-harvesting complex drives the photoinduced charge separation in a reaction center.

243. On the graph, point 1 describes the:

a. increase of O2 consumption after adding ATP. b. increase of O2 consumption after adding ADP. c. increase of O2 consumption with time. d. decrease of O2 consumption after adding ADP. e. decrease of O2 consumption after adding ATP. 244. When glucose is totally oxidized to CO2 and H2O, how many ATP molecules are made by oxidative phosphorylation relative to the maximum yield? a. 12 out of 30 b. 26 out of 30 c. 26 out of 32 d. 12 out of 38 e. None of the answers is correct.

245. What amino acid residue of the water-oxidizing complex is the MOST important for water photolysis and why? a. tyrosine; because it is charged and can undergo acid–base reactions b. tryptophan; because it is aromatic and electrons can get trapped in its double bonds c. tyrosine; because it is polar and can undergo redox reactions d. tryptophan; because it is charged and can undergo acid–base reactions e. tyrosine; because it is aromatic and electrons can get trapped in its double bonds 246. What is the reaction in which a single reactant is converted into two different products? a. dismutation

Name:

Class:

Date:

ch 20 - 25 b. isomerization c. racemization d. synthesis e. cleavage 247. How many carbon atoms does phosphoglycolate have? a. 2 b. 3 c. 6 d. 5 e. 4 248. Choose the CORRECT sequence of action of ATP translocase. a. binding of ADP from the cytoplasm with the translocase → eversion of the transporter → releasing ADP into the matrix → binding of ATP from the matrix → back eversion to the primary conformation of ATP translocase → releasing ATP into the cytoplasm b. binding of ATP from the cytoplasm with the translocase → eversion of the transporter → binding of ADP from the matrix → back eversion to the primary conformation of ATP translocase → releasing ADP into the cytoplasm c. electrons enter the mitochondrial electron-transport chain → electrons transfer to ATP translocase → binding of ADP from the cytoplasm with the translocase → eversion of the transporter → binding of ATP from the matrix → releasing ATP into the cytoplasm d. binding of ADP from the cytoplasm with ATP synthase → ADP transfer to the transporter → eversion of the transporter → releasing ADP into the matrix → binding of ATP from the matrix → back eversion to the primary conformation of ATP translocase → releasing ATP into the cytoplasm e. electrons enter the mitochondrial electron-transport chain → electrons transfer to ATP translocase → eversion of the transporter → proton transfer to the translocase → binding of ATP → releasing ATP into the cytoplasm 249. What is the essence of Mitchell's chemiosmotic hypothesis? a. Electron transport and ATP synthesis are coupled by a proton gradient across the inner mitochondrial membrane. b. Electron transport and ATP synthesis are coupled by an electron gradient across the inner mitochondrial membrane. c. The proton concentration becomes higher in the matrix, and an electric field with a negative matrix side is generated. d. The respiratory chain and ATP synthase are biochemically separate systems, linked only by an electron-motive force. e. The transfer of protons leads to the pumping of electrons from the matrix to the cytoplasmic side of the inner mitochondrial membrane.

250. Which end of the glycogen molecule has the anomeric carbon that can freely turn to an open or closed conformation? a. reducing

Name:

Class:

Date:

ch 20 - 25 b. nonreducing c. free d. blunt e. phosphorylated 251. From a biochemical point of view, is the net effect of exercise negative and why? a. No, it is not. The amount of superoxide dismutase decreases in the cell. b. No, it is not. The increase in superoxide dismutase more effectively protects the cell during periods of rest. c. No, it is not. An increase in ROS is always beneficial, as they have been implicated in the control of cell differentiation. d. Yes, it is. The elevated aerobic metabolism during exercise causes more harmful ROS to be generated. e. Yes, it is. An increase in ROS never brings benefits.

252. Which enzyme catalyzes the following reaction?

Glucose 1-phosphate + UTP → UDP-glucose + PPi a. UDP-glucose pyrophosphorylase b. branching enzyme c. glycogen synthase b d. phosphofructokinase e. UDP-glucose phosphorylase 253. What results from a loss or inactivation of insulin receptors? a. hypoglycemia b. hypoinsulinemia c. type I diabetes d. type II diabetes e. protein phosphatase 1 dysregulation 254. What statement concerning CAM plants is FALSE? a. They decarboxylate oxaloacetate during the day to deliver CO2 to the Calvin cycle. b. CAM stands for crassulacean acid metabolism. c. They separate CO2 accumulation from CO2 utilization in time. d. They cannot generate CO2 as rapidly as C3 and C4 plants. e. They grow more slowly than C3 and C4 plants.

255. Choose the CORRECT sequence of oxidative phosphorylation. a. transfer of electrons through the electron-transport chain → movement of protons through the halfchannels → binding of the actin filament to the γ subunit → rotation of the α subunit → rotation of

Name:

Class:

Date:

ch 20 - 25 the β subunit → synthesis and releasing of ADP b. electron transport from NADH to a half-channel → movement of protons through the respiratory chain → synthesis and releasing of ADP c. transfer of electrons through the electron-transport chain → movement of protons through the halfchannels → rotation of the a subunit → rotation of the β subunit → synthesis and releasing of ADP d. transfer of electrons through the electron-transport chain → generation of a proton gradient → movement of protons through the half-channels → rotation of the c ring → rotation of the γ subunit → synthesis and releasing of ATP e. electron transport from NADH to a half-channel → movement of protons through the respiratory chain → rotation of the c ring → rotation of the γ subunit → synthesis and releasing of ATP 256. In the heart and liver, electrons from cytoplasmic NADH are brought into mitochondria by: a. ATP–ADP translocase. b. the malate–aspartate shuttle. c. pyruvate carrier. d. the glycerol–aspartate shuttle. e. phosphate carrier.

257. Maximal activity of chloroplastic ATP synthase is achieved when: a. the concentration of an oxidized ferredoxin has increased. b. two specific cysteines of the γ subunit are reduced. c. the concentration of a reduced thioredoxin has decreased. d. the specific disulfide bond of the γ subunit is formed. e. the concentration of a reduced ferredoxin has decreased.

258. What process results in the removal of the glucosyl residue from the nonreducing end of the glycogen molecule by the addition of orthophosphate? a. glycolysis b. dephosphorylation c. phosphorolysis d. hydrolysis e. phosphorylation Indicate one or more answer choices that best complete the statement or answer the question.

259. Select all that apply. Stacked and unstacked regions of the thylakoid are arranged such that: a. photosystem I is located in the unstacked regions. b. photosystem II is located in the stacked region. c. ATP synthesis occurs mainly in unstacked regions. d. photosystem I is located in the stacked regions. e. photosystem II is located in the unstacked regions.

260. Select all that apply. ATP–ADP translocase gets energy from:

Name:

Class:

Date:

ch 20 - 25 a. the charge gradient of ATP. b. the charge gradient. c. active transport by Na–K ATPase. d. the chemical gradient of ATP. e. the chemical gradient of phosphate.

261. Select all that apply. Glycogen synthase is converted into the active form by the action of: a. protein phosphatase 1. b. glucose 1-phosphate. c. glycogen synthase kinase. d. glucose 6-phosphate. e. glycogen diphosphokinase.

262. Select all that apply. The CF1–CF0 complex: a. transfers protons into the stroma. b. participates in the synthesis of ATP due to substrate-level phosphorylation. c. is a primary active transporter. d. transfers protons into the thylakoid lumen. e. participates in the synthesis of ATP due to the proton-motive force.

263. are components of the F1 subunit of ATP synthase. Select all that apply. a. Three α subunits b. Two ε subunits c. γ subunit d. 14 c subunits e. Subunit 264. Select all that apply. The major sites of glycogen storage are: a. adipose tissue. b. the liver. c. skeletal muscle. d. the blood. e. the brain.

265. What proves mitochondrial emergence through an endosymbiotic event? Select all that apply. a. specific transcription machinery b. circular DNA c. oxidative phosphorylation d. double membrane e. specific translation machinery

Name:

Class:

Date:

ch 20 - 25 266. What prevents the phosphatase activity of PP1 from always inhibiting glycogen degradation? Select all that apply. a. epinephrine cascade b. insulin-receptor cascade c. glucagon cascade d. cAMP cascade e. protein kinase A 267. What enzymes regulating liver-glycogen metabolism predominate in the fasting state? Select all that apply. a. glycogen phosphorylase a b. glycogen synthase a c. glycogen phosphorylase b d. glycogen synthase b e. protein phosphatase 1 268. Select all that apply. The redox balance of the light reactions of photosynthesis is maintained by the: a. reduction of P700 by Pcred. b. photolysis of water. c. reaction catalyzed by cytochrome b6f. d. reduction of QA. e. reaction catalyzed by Fd–NADP+ reductase.

269. Choose the CORRECT statement about pigments. Select all that apply. a. The formyl group of Chla allows it to cover light with the wavelength between 420 and 670 nm. b. Each pigment absorbs the light of a specific range of wavelengths. c. Assembly in light-harvesting complexes increases the range of light wavelengths absorbed by chlorophylls. d. Each pigment always absorbs the light of a wide range of wavelengths. e. Pigments of chloroplast grana absorb the light of longer wavelengths than pigments of stroma.

270. Why do reaction centers have different pigments rather than only chlorophylls? Select all that apply. a. increasing the coverage of the visible spectrum of light b. arranging light-harvesting complexes c. compensating for the high density of chlorophylls d. narrowing the coverage of the visible spectrum of light e. quantitatively increasing the absorption of photons 271. What proteins of the electron-transport chain contain iron and in what form? Select all that apply. a. iron–sulfur proteins; in the form of Fe–S clusters b. iron–sulfur proteins; in the form of a heme prosthetic group c. nonheme iron proteins; in the form of a nonheme prosthetic group

Name:

Class:

Date:

ch 20 - 25 d. cytochromes; in the form of Fe–S clusters e. cytochromes; in the form of a heme prosthetic group 272. Rubisco requires a bound CO2 for catalytic activity. What happens with rubisco when CO2 is bound?

Select all that apply. a. CO2 forms a carbamate with ribulose 1,5-bisphosphate. b. CO2 forms a carbamate with lysine 201 of the large subunit.

2+ c. CO2 binds to a Mg ion. d. Ribulose 1,5-bisphosphate forms a carbamate with alanine 150 of the large subunit.

e. The carbamate binds to a Mg2+ ion.

273. Select all that apply. Enzymes that have major roles in the rearrangement of carbon atoms in the final stage of the Calvin cycle are: a. phosphoribulose kinase. b. aldolase. c. rubisco activase. d. phosphopentose isomerase. e. transketolase.

274. Select all that apply. The targets of epinephrine are: a. β-adrenergic receptors of the liver cells. b. epinephrine receptors of the liver cells. c. β-adrenergic receptors of the skeletal muscle cells. d. δ-adrenergic receptors of the skeletal muscle cells. e. α-adrenergic receptors of the liver cells.

275. What are the steps of carbon dioxide fixation? Select all that apply. a. Hydrolysis of an unstable six-carbon compound to two molecules of 3-phosphoglycerate. b. Conversion of an unstable six-carbon compound to a stable five-carbon compound. c. Conversion of ribulose 1,5-bisphosphate into an enediolate intermediate. d. Hydrolysis of an enediolate intermediate to 3-phosphoglycerate and two molecules of CO2. e. Condensation of the CO2 molecule with the enediolate intermediate.

276. What enzymes are present in a single polypeptide chain? Select all that apply. a. glycogen phosphorylase b. transferase c. α-1,6-glucosidase d. α-1,4-glucosidase e. hexokinase 277. Select all that apply. Cytochrome is a:

Name:

Class:

Date:

ch 20 - 25 a. protein that transfers electrons. b. chloroplast protein that accumulates electrons. c. protein that pumps ATP. d. protein that contains a heme prosthetic group. e. protein that contains an iron sulfur prosthetic group.

278. Select all that apply. Activation of protein kinase A leads to: a. activation of glycogen synthesis. b. inhibition of glycogen synthesis. c. inhibition of glycogen phosphorolysis. d. activation of glycogen breakdown. e. inhibition of glycogen breakdown.

279. What is important for the regulation of liver-glycogen metabolism upon an increase in the blood-glucose concentration? Select all that apply. a. binding of glucose to phosphorylase a b. binding of PP1 to phosphorylase b c. binding of glucose to phosphorylase b d. binding of PP1 to phosphorylase a e. rendering of phosphoserine 14 on phosphorylase a 280. What molecules are able to carry electrons between components of two photosystems? Select all that apply. a. plastocyanin b. ferredoxin c. NADP+ d. plastoquinone QB e. plastoquinone QA 281. What is the function of the respirasome? Select all that apply. a. directly conducts ATP synthesis b. generates ROS c. facilitates a rapid transfer of the substrate d. prevents the release of reaction intermediates e. facilitates scavenging of ROS 282. What complexes are NOT included into the respirasome? Select all that apply. a. Complex I b. Complex II c. Complex III d. Complex IV

Name:

Class:

Date:

ch 20 - 25 e. ATP synthase 283. Why are mitochondria thought to be semiautonomous organelles? Select all that apply. a. They contain many proteins encoded by nuclear DNA. b. They are the only sites for oxidative phosphorylation in the cell. c. They can exist outside of the cell. d. They contain their own DNA. e. They have an outer quite permeable membrane.

284. Where can oxidative phosphorylation take place in living organisms? Select all that apply. a. plasma membrane b. mitochondrial matrix c. cristae d. cytoplasm e. inner membrane of mitochondrion 285. Select all that apply. The main outcomes of photosynthetic light reactions are: a. absorption of the light energy. b. proton transport across the membrane. c. glucose synthesis. d. water oxidation. e. utilization of reducing power.

286. Choose the compound that blocks the flow of electrons from cytochrome c to oxygen. Select all that apply. a. azide b. thermogenin c. bongkrekic acid d. atractyloside e. cyanide 287. Select all that apply. After a carbohydrate-rich meal: a. the blood-glucose level increases, leading to glycogen storage in the liver. b. the blood-glucose level increases, leading to glycogen storage in muscle. c. glycogen storage in the muscle becomes exhausted. d. the protein kinase A cascade is activated in muscle. e. the insulin-receptor cascade is activated in the liver.

288. Select all that apply. The isomeric forms of the hexose phosphate product of the Calvin cycle are: a. glucose 1-phosphate. b. glucose 6-phosphate. c. fructose 1,6-bisphosphate. d. fructose 6-phosphate.

Name:

Class:

Date:

ch 20 - 25 e. xylulose 5-phosphate.

289. Select all that apply. The first step of the adenylate cyclase cascade is binding of epinephrine or glucagon to the: a. 7TM receptor on the plasma membrane and activation of Gαs protein. b. 7TM receptor on the plasma membrane and activation of Gαq protein. c. Gαs protein of 7TM receptor on the lumenal side of the endoplasmic reticulum. d. Gαq protein of 7TM receptor on the lumenal side of the endoplasmic reticulum. e. Gαs which activates cAMP formation through activation of the adenylate cyclase.

290. What components form the ATP synthasome? Select all that apply. a. the malate–aspartate shuttle b. the phosphate carrier c. ATP–ADP translocase d. guanine nucleotide transporter e. ATP synthase 291. Which compounds is the proton-motive force composed of? Select all that apply. a. free energy b. a chemical gradient c. a concentration of ATPase d. a membrane potential e. transport of electrons 292. What hormones are signals for reversible phosphorylation? Select all that apply. a. insulin b. epinephrine c. glucagon d. calmodulin e. norepinephrine 293. What donates electrons in the electron-transport chain? a. O2 b. H2O2 c. NADH d. NAD+ e. FADH2 Enter the appropriate word(s) to complete the statement.

Name:

Class:

Date:

ch 20 - 25 294. The transfer of excitation energy from one molecule to one nearby through electromagnetic interactions is called .

295. In the glycerol phosphate shuttle, cytoplasmic glycerol phosphate dehydrogenase uses cytoplasmic NADH to reduce to glycerol 3-phosphate.

296. One mechanism for turning off glycogen degradation involves the removal of a phosphate group from glycogen phosphorylase by the enzyme .

297. Cytochrome c oxidase contains two heme A groups and three

_ ions.

298. The full name (not the abbreviation) of the adaptation that temporally separates CO2 accumulation from CO2 utilization by absorbing CO2 at night is .

299. P700 is the pigment reaction center for 300. Type I diabetes is also known as

.

-dependent diabetes mellitus.

Name:

ch 20 - 25 Answer Key 1. c 2. a 3. a 4. b 5. d 6. b 7. c 8. c 9. a 10. a 11. b 12. c 13. c 14. b 15. e 16. a 17. d 18. b 19. b 20. e 21. a 22. d 23. a 24. d

Class:

Date:

Name:

ch 20 - 25 25. b 26. c 27. c 28. e 29. b 30. e 31. a 32. d 33. d 34. c 35. b 36. b 37. a 38. c 39. c 40. b 41. a 42. c 43. a 44. b 45. c 46. a 47. e 48. b 49. c

Class:

Date:

Name:

ch 20 - 25 50. d 51. e 52. c 53. d 54. e 55. c 56. a 57. c 58. b 59. e 60. d 61. c 62. c 63. a 64. b 65. a 66. a 67. c 68. b 69. d 70. a 71. a 72. b 73. a 74. e

Class:

Date:

Name:

ch 20 - 25 75. c 76. d 77. b 78. e 79. c 80. c 81. d 82. b 83. c 84. b 85. c 86. c 87. a 88. b 89. b 90. a 91. c 92. a 93. a 94. a 95. c 96. c 97. d 98. a 99. e

Class:

Date:

Name:

ch 20 - 25 100. a 101. a 102. b 103. e 104. d 105. e 106. c 107. a 108. a 109. c 110. d 111. a 112. e 113. c 114. c 115. c 116. d 117. c 118. d 119. a 120. a 121. a 122. c 123. b 124. a

Class:

Date:

Name:

ch 20 - 25 125. e 126. a 127. a 128. e 129. a 130. d 131. a 132. c 133. c 134. c 135. d 136. c 137. c 138. d 139. a 140. e 141. d 142. b 143. e 144. b 145. b 146. b 147. c 148. d 149. e

Class:

Date:

Name:

ch 20 - 25 150. e 151. a 152. c 153. e 154. b 155. d 156. d 157. b 158. e 159. c 160. b 161. b 162. a 163. e 164. b 165. a 166. d 167. b 168. e 169. e 170. c 171. a 172. a 173. b 174. e

Class:

Date:

Name:

ch 20 - 25 175. c 176. e 177. a 178. d 179. d 180. c 181. a 182. d 183. c 184. e 185. b 186. a 187. b 188. c 189. a 190. e 191. a 192. e 193. d 194. e 195. d 196. b 197. a 198. b 199. b

Class:

Date:

Name:

ch 20 - 25 200. c 201. b 202. b 203. c 204. d 205. a 206. a 207. b 208. c 209. d 210. b 211. a 212. e 213. b 214. d 215. b 216. a 217. a 218. b 219. c 220. a 221. b 222. d 223. a 224. e

Class:

Date:

Name:

ch 20 - 25 225. d 226. b 227. b 228. e 229. c 230. d 231. a 232. a 233. e 234. a 235. b 236. d 237. b 238. c 239. d 240. a 241. b 242. e 243. b 244. b 245. c 246. a 247. a 248. a 249. a

Class:

Date:

Name:

ch 20 - 25 250. a 251. b 252. a 253. d 254. a 255. d 256. b 257. b 258. c 259. a, b, c 260. a, b, d 261. a, d 262. a, c, e 263. a, c 264. b, c 265. a, b, d, e 266. a, c, d, e 267. a, d 268. a, b 269. b, c 270. a, e 271. a, e 272. b, e 273. b, e 274. c, e

Class:

Date:

Name:

ch 20 - 25 275. a, c, e 276. b, c 277. a, d 278. b, d 279. a, d, e 280. a, b, d, e 281. c, d 282. b, e 283. a, b, d 284. a, c, e 285. a, b, d 286. a, e 287. a, b, e 288. a, b, d 289. a, b 290. b, c, e 291. b, d 292. b, c 293. c, e 294. resonance energy transfer 295. dihydroxyacetone phosphate 296. protein phosphatase 1 297. copper 298. Crassulacean acid metabolism 299. photosystem I

Class:

Date:

Name:

ch 20 - 25 300. insulin

Class:

Date:

Name:

Class:

Date:

ch 26 - 31 Indicate the answer choice that best completes the statement or answers the question.

1. Choose the CORRECT pair of epimers. a. glucose 6-phosphate and glucose 1-phosphate b. glucose 6-phosphate and fructose 6-phosphate c. xylulose 5-phosphate and ribulose 5-phosphate d. ribulose 5-phosphate and ribose 5-phosphate e. D-xylulose 5-phosphate and L-xylulose 5-phosphate 2. Which amino acids supply carbons for an eventual entry into metabolism as succinyl CoA? a. methionine, valine, leucine b. methionine, isoleucine, valine c. isoleucine, valine, leucine d. valine, leucine, threonine e. valine, alanine, arginine 3. Glucose 6-phosphate dehydrogenase is highly specific for: a. NADPH. b. NADP+. c. NAD+. d. NADH. e. ADP. 4. Which compound is the reactant in the transaldolase reaction that leads to the formation of fructose 6phosphate? a. ribose 5-phosphate b. sedoheptulose 7-phosphate c. glucose 6-phosphate d. fructose 1,6-bisphosphate e. dihydroxyacetone phosphate 5. Which compound is an intermediate in ketogenesis? a. 3-hydroxy-3-methyl-glutaryl CoA b. D-3-hydroxybutyrate c. acetone d. D-methylmalonyl CoA e. L-methylmalonyl CoA 6. Activation of acetyl CoA results in the production of: a. malonyl CoA. b. citrate. c. acetoacetyl CoA.

Name:

Class:

Date:

ch 26 - 31 d. acetyl ACP. e. citryl CoA. 7. Choose the CORRECT enzyme–substrate pair from the pentose phosphate pathway. a. glucose 6-phosphate dehydrogenase – 6-phosphoglucono-δ-lactone b. 6-phosphogluconate dehydrogenase – 6-phosphoglucono-δ-lactone c. transaldolase – xylulose 5-phosphate d. transketolase – xylulose 5-phosphate e. lactonase – ribulose 5-phosphate 8. Aspirin affects inflammation, fever, pain, and blood clotting because it inhibits the key enzyme leading to the synthesis of most eicosanoid hormones, which is: a. phospholipase A2. b. prostacyclin synthase. c. diaceylglycerol lipase. d. thromboxane synthase. e. prostaglandin synthase.

9. In what organisms are the component enzymes of fatty acid synthesis linked in a single large polypeptide chain? a. mammals b. plants c. archaea d. Gram-positive bacteria e. E. coli 10. Ammoniotelic organisms excrete excess nitrogen as: a. N2H8. +

b. NH4 . c. urea. d. arginine. e. alanine.

11. How many biosynthetic families of amino acids are defined? a. 4 b. 3 c. 6 d. 21 e. 2 12. How does formation of acetyl CoA by β oxidation not only provide energy for cellular respiration but also spare glucose?

Name:

Class:

Date:

ch 26 - 31 a. As acetyl CoA levels increase during lipid metabolism, D-3-hydroxybutyrate is reduced to pyruvate for gluconeogenesis. b. Acetyl CoA provides carbon for the formation of oxaloacetate, which in turn can be decarboxylated to form pyruvate. c. Acetyl CoA can be converted to acetoacetate and from there to lactate for anaerobic metabolism. d. Acetyl CoA derived from fatty acids inhibits pyruvate dehydrogenase, the enzyme that converts pyruvate into acetyl CoA. e. Acetyl CoA derived from fatty acids activates pyruvate carboxylase, stimulating gluconeogenesis.

13. Uricotelic organisms release nitrogen as: + a. NH4 . b. arginine. c. uric acid. d. alanine. e. N2H8.

14. Untreated, chronic ketone body production will: a. increase blood pH levels. b. decrease blood pH levels. c. increase blood glucose levels. d. decrease hydrogen ion concentration in blood. e. increase bicarbonate concentration in blood.

15. The enzyme that catalyzes the addition of an activated two-carbon compound to an activated three-carbon compound is: a. malonyl transacylase. b. β-ketoacyl synthase. c. β-ketoacyl ACP reductase. d. acetyl transacylase. e. enoyl ACP reductase.

16. What compound is used as an oxidant in the conversion of stearoyl CoA into oleoyl CoA? a. NADP+ b. O2 c. H2O d. FAD e. cytochrome c 17. The availability of cycle. a. pyrophosphate

determines whether acetyl CoA, made from fatty acids, can enter the citric acid

Name:

Class:

Date:

ch 26 - 31 b. pyruvate dehydrogenase c. oxaloacetate d. cobalamin e. β hydroxybutyrate 18. Predict the short-time result of triclosan addition to the growth medium for yeasts. a. The amount of acetyl CoA in cells would decrease. b. The amount of crotonyl ACP in cells would increase. c. NADPH concentration in cells would significantly increase. d. Citrate concentration in cells would significantly increase. e. The amount of butyryl ACP in cells would increase.

19. The compound _ is considered one of the ketone bodies. a. pyrophosphate b. glucagon c. cobalamin d. β hydroxybutyrate e. oxaloacetate 20. What amino acid is formed upon degradation of phenylalanine? a. tyrosine b. valine c. leucine d. serine e. threonine 21. What is the function of cis-Δ3-enoyl CoA isomerase? a. conversion of cis-Δ3 double bond into trans-Δ3 single bond b. conversion of trans-Δ2 double bond to cis-Δ3 double bond c. shift the position of the double bond for the proper work of acyl CoA dehydrogenase d. reduction of 2,4-dienoyl to cis-Δ3-enoyl CoA e. reduction of 2,4-dienoyl to trans-Δ2-enoyl CoA 22. An example of a reaction controlled by enzyme multiplicity is phosphorylation of: a. asparagine by aspartokinases. b. aspartate by aspartokinases. c. glutamine by glutamine synthetases. d. ammonia by nitrogenase. e. tyrosine by phenylalanine hydroxylases.

23. The increase in the concentration of phosphatidylinositol is due to:

Name:

Class:

Date:

ch 26 - 31 a. inhibited activity of phosphatidic acid phosphatase. b. inhibited activity of diacylglycerol kinase. c. stimulated activity of phosphatidic acid phosphatase. d. hydrolysis of pyrophosphate. e. hydrolysis of CTP. 24. All defects in the urea cycle lead to an elevated level of ammonium ion in blood, which is called: a. hypoammonemia. b. ammonemia. c. hyperammonemia. d. anemia. e. toxaemia.

25. Which carbohydrate is NOT produced in the pentose phosphate pathway? a. fructose 1,6-bisphosphate b. glyceraldehyde 3-phosphate c. fructose 6-phosphate d. glucose 6-phosphate e. erythrose 4-phosphate 26. What is the concomitant product of the reaction catalyzed by pyruvate kinase? a. NADPH b. NAD+ c. ATP d. ADP e. pyruvate 27. How many NADPH molecules can be produced in mode 3 of the pentose phosphate pathway, when the need for NADPH is greater than the need for ribose 5-phosphate? a. 2 b. 12 c. 106 d. 6 e. 8 28. How many amino acids are classified as solely glucogenic? a. 10 b. 11 c. 12 d. 13 e. 14

Name:

Class:

Date:

ch 26 - 31 29. In the urea cycle, the carbon skeleton of aspartate is preserved as: a. succinate. b. fumarate. c. urea. d. malate. e. asparagine.

30. What is the function of the pentose phosphate pathway in red blood cells? a. synthesis of fatty acids b. synthesis of steroids c. maintenance of reduced glutathione d. synthesis of proteins e. synthesis of ATP 31. What is the last common precursor of prostaglandins, prostacyclins, thromboxanes, and leukotrienes? a. phospholipids b. arachidonate c. prostaglandin H2 d. linolenate e. oleate 32. What group is bound to both N5 and N10 of tetrahydrofolate in the medium reduced state? a. methyl group b. formyl c. methenyl group d. formimino e. methylene group 33. How much glutamine can be synthesized upon reduction of 1 N2 molecules by the nitrogenase complex, and how much ATP will be required for that? a. 1 glutamine molecule; at least 16 ATP b. 2 glutamine molecules; at least 17 ATP c. 1 glutamine molecule; at least 32 ATP d. 2 glutamine molecules; at least 34 ATP e. 1 glutamine molecule; at least 33 ATP 34. Insufficient amounts of would not only inhibit protein synthesis but also synthesis of phostidylcholine and phostidylethanolamine. a. glutamine b. histidine c. phenylalanine

Name:

Class:

Date:

ch 26 - 31 d. methionine e. alanine 35. How many carbon atoms in oleic acid come from malonyl CoA? a. 2 b. 12 c. 16 d. 18 e. 9 36. α-Ketoglutarate is converted into: a. alanine by transfer of an NH3 group. b. alanine by a reaction with oxaloacetate. c. glutamate by a reaction with oxaloacetate. d. glutamate that is part of alanine synthesis. e. pyruvate that is part of alanine synthesis.

37. Which statement about hormones regulating fatty acid synthesis after exercise or a meal is TRUE? a. Insulin stimulates fatty acid synthesis by activating acetyl CoA carboxylase 1. b. Insulin stimulates the mobilization of fatty acids for β oxidation. c. Epinephrine stimulates the mobilization of fatty acids and stimulates their accumulation as triacylglycerols. d. Glucagon activates carboxylase by enhancing phosphorylation of AMPK. e. Epinephrine stimulates AMPK, preventing phosphorylation of acetyl CoA carboxylase 1.

38. What form is an ammonium ion converted into in most terrestrial vertebrates? a. urea b. glucose c. serine d. aspartate e. glycogen 39. What prosthetic group do all aminotransferases contain? a. tetrahydrofolate b. cobalamin c. pyridoxamine d. pyridoxal phosphate e. pyridoxine 40. What is a TRUE cellular sensor of cholesterol? a. SREBP b. SCAP

Name:

Class:

Date:

ch 26 - 31 c. SRE d. LDL e. HDL 41. Lactonase opens the lactone ring by hydrolyzing the: a. phosphoester link. b. phosphodiester link. c. ester link between C-1 and C-5. d. ester link between C-1 and C-6. e. pyrophosphate link.

42. In rapidly dividing cells: a. the needs for NADPH and ribose 5-phosphate are balanced. b. more NADPH than ribose 5-phosphate is required. c. much more ribose 5-phosphate than NADPH is required. d. the needs for NADPH and ATP are balanced. e. NADPH is needed in excess.

43. In what principal transport forms is nitrogen transported from muscle to the liver? a. alanine and glutamine b. alanine and leucine c. arginine and threonine d. serine and threonine e. valine and leucine 44. Choose the CORRECT reaction sequence for the utilization of propionyl CoA. a. carboxylation to D-methylmalonyl CoA → isomerization to L-methylmalonyl CoA → conversion to succinyl CoA, which enters the citric acid cycle b. carboxylation to D-methylmalonyl CoA → isomerization to L-methylmalonyl CoA → conversion to acetyl CoA, which enters the citric acid cycle c. carboxylation to L-methylmalonyl CoA → isomerization to D-methylmalonyl CoA → conversion to acetyl CoA, which enters the citric acid cycle d. isomerization to trans-Δ2-enoyl CoA → hydration to L-3-hydroxyacyl CoA → oxidation to 3ketoacyl CoA → thiolysis to acetyl CoA, which enters the citric acid cycle e. isomerization to trans-Δ2-enoyl CoA → hydration to L-3-hydroxyacyl CoA → oxidation to 3ketoacyl CoA → conversion to acetyl CoA, which enters the citric acid cycle 45. S-adenosylmethionine carries: a. methyl groups. b. CO2. c. ammonia.

Name:

Class:

Date:

ch 26 - 31 d. carbonyl groups. e. carboxyl groups.

46. Which statement about steroids is TRUE? a. Cytochrome P450 monooxygenase introduces oxygen atoms into calcitriol. b. Cholesterol is excreted from the organism only in the form of bile salts. c. All classes of steroid hormones have a different number of carbon atoms. d. Cytochrome c oxidase requires cholesterol for full activity. e. All steroids are usually hydrophilic, so they can be transported without the help of lipoprotein particles.

47. Which compound does β oxidation begin from? a. acetyl CoA b. trans-Δ2-enoyl CoA c. acyl CoA d. CoA e. acyl carnitine 48. The pentose phosphate pathway: a. is activated by NADH. b. operates in mitochondria. c. is an alternative pathway to gluconeogenesis. d. involves glutathione reductase. e. is primarily anabolic.

49. The LDL receptors on the plasma membrane are localized in coated pits that contain the receptors of which of the following proteins? a. clathrin b. lipoprotein A c. adrenodoxin d. HMG-CoA reductase e. sterol regulatory element binding protein (SREBP) 50. What is the product of the committed step in fatty acid synthesis? a. C16-acyl ACP b. acetyl CoA c. malonyl CoA d. acetoacetyl ACP e. β-hydroxybutyryl ACP 51. Which statement about the conversion of ribulose 5-phosphate to fructose 6-phosphate is TRUE? a. Fructose 6-phosphate is formed from glyceraldehyde 3-phosphate and sedoheptulose 7-phosphate.

Name:

Class:

Date:

ch 26 - 31 b. Glyceraldehyde 3-phosphate is formed after isomerization of C7 carbohydrates. c. Xylulose 5-phosphate is always required to produce ribose 5-phosphate. d. Erythrose 4-phosphate is directly formed from xylulose 5-phosphate. e. Fructose 6-phosphate is formed from erythrose 4-phosphate.

52. Coenzyme(s) involved in the degradation of saturated fatty acyl CoA include(s): a. FAD. b. NAD+. c. TPP. d. FAD and NAD+. e. All of the answers are correct.

53. In the nonoxidative stage of the pentose phosphate pathway, intermediates of a. the citric acid cycle b. glycolysis c. glycogen degradation d. fatty acid biosynthesis e. lipid degradation 54. ATP is called the energy currency. The currency of biosynthetic reducing power is: a. NADPH. b. NADH. c. AMP. d. ADP. e. FADH2.

55. Which enzyme catalyzes the conversion of acetoacetate into D-3-hydroxybutyrate? a. D-3-hydroxybutyrate dehydrogenase b. hydroxymethylglutaryl CoA cleavage enzyme c. 3-ketothiolase d. hydroxymethylglutaryl CoA synthase e. CoA transferase 56. In lipid metabolism, acetyl CoA is able to convert to a fatty acid and: a. all phospholipids. b. phosphatidylcholine. c. cholesterol. d. ceramide. e. all sphingolipids.

57. What enzyme catalyzes the committed step of the pentose phosphate pathway?

are produced.

Name:

Class:

Date:

ch 26 - 31 a. lactonase b. phosphofructokinase c. phosphopentose isomerase d. glucose 6-phosphate dehydrogenase e. 6-phosphogluconate dehydrogenase 58. Choose the enzymes that catalyze reactions with concomitant formation of NADPH. a. glucose 6-phosphate dehydrogenase and lactonase b. transketolase and transaldolase c. phosphopentose epimerase and glucose 6-phosphate dehydrogenase d. glucose 6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase e. phosphofructokinase and 6-phosphogluconate dehydrogenase 59. CDP-diacylglycerol is NOT a precursor of: a. cardiolipin. b. phosphatidylinositol. c. triacylglycerol. d. CMP. e. diphosphatidylglycerol.

60. What CANNOT repress the expression of genes of the cholesterol biosynthetic pathway? a. binding of SREBP by SCAP b. high cholesterol level c. inhibited transport of vesicles from the endoplasmic reticulum to the Golgi complex d. binding of SRE by SCAP e. transport of SCAP-SREBP to the Golgi apparatus 61. What functional group differs between phosphatidate and diacylglycerol? a. phosphate b. pyrophosphate c. CDP d. CMP e. acyl 62. How many NADPH molecules are formed when a sufficient quantity of acetyl CoA is transferred to the cytoplasm for synthesis of stearate? a. 1 b. 8 c. 9 d. 16 e. 18

Name:

Class:

Date:

ch 26 - 31 63. Under what conditions does the net reaction shown take place? glucose 6-phosphate + 12 NADP+ + 7 H2O → 6 CO2 + 12 NADPH + 12 H+ + Pi a. The need for ribose 5-phosphate is greater than the need for NADPH. b. The needs for NADPH and ribose 5-phosphate are balanced. c. Both NADPH and ATP are required. d. The need for NADPH is greater than the need for ribose 5-phosphate. e. Both NADPH and pyrophosphate are required.

64. The carrier of an acyl chain through the synthetic protein complex is: a. ACP. b. a serum albumin. c. acetyl coenzyme A. d. a biotin-activated complex. e. ψ domain.

65. Hemolytic anemia can be caused by a deficiency of which enzyme? a. glutathione peroxidase b. glutathione reductase c. glucose 6-phosphate dehydrogenase d. 6-phosphogluconate dehydrogenase e. lactonase 66. What complex is formed on the enzyme when a product is replaced by a substrate before the reaction is complete? a. failed complex b. ineffective complex c. unproductive complex d. worthless complex e. abortive complex 67. The actual respiratory quotient is greater than 1 for a hummingbird. What is the source of the extra carbon dioxide? a. the nonoxidative phase of the pentose phosphate pathway b. the oxidative phase of the pentose phosphate pathway c. fatty acid synthesis d. the combination of glycolysis and the pentose phosphate pathway e. the combination of glycolysis and nucleic acids synthesis 68. What lipoproteins are used to transport lipids from the liver to the blood? a. chylomicrons b. very low-density lipoproteins c. intermediate-density lipoproteins

Name:

Class:

Date:

ch 26 - 31 d. low-density lipoproteins e. high-density lipoproteins 69. Fatty acid synthesis primarily takes place in the: a. cytoplasm. b. inner membrane of mitochondria. c. matrix of mitochondria. d. Golgi apparatus. e. nucleoli.

70. The role of biotin in the reaction of acetyl CoA carboxylase 1 is: a. acting as a nucleophile and attacks the carbonyl group of acetyl CoA. b. binding of acetyl CoA. c. binding of ATP to the enzyme. d. binding of CO2 that results in production of carboxybiotin. e. covalent attaching to the epsilon-amino group of specific lysine residues in the enzyme.

71. During triacylglycerol hydrolysis, hormone-sensitive lipase catalyzes the release of: a. monoacylglycerol and two free fatty acids. b. diacylglycerol and a single free fatty acid. c. glycerol and three free fatty acids. d. monoacylglycerol and a single free fatty acid. e. glycerol and a single free fatty acid.

72. What statement about the regulation of fatty acid synthesis in a cell at low energy charge conditions is FALSE? a. Acetyl CoA carboxylase 1 is switched off by phosphorylation. b. AMP-activated protein kinase is activated by AMP. c. Acetyl CoA carboxylase 1 exists as inactive dimers unless citrate and ATP levels are high. d. Polymerization of active acetyl CoA carboxylase 1 is facilitated by the protein MIG12. e. Malonyl CoA is an especially effective inhibitor of acetyl CoA carboxylase 2 in the heart and muscle tissues.

73. What metabolic pathways do anaerobic bacteria use to metabolize pentose sugars? a. the nonoxidative phase of the pentose phosphate pathway and glycolysis b. the pentose phosphate pathway and gluconeogenesis c. the citric acid cycle and the pentose phosphate pathway d. the nonoxidative phase of the pentose phosphate pathway and fermentation e. only fermentation 74. In transamination reactions, the amino group is transferred to pyruvate from: a. glutamine.

Name:

Class:

Date:

ch 26 - 31 b. pyruvate. c. pyridoxal phosphate. d. pyridoxamine phosphate. e. glutamate.

75. Which statement about starvation is TRUE? a. Plasma levels of fatty acids and ketone bodies decrease, whereas the plasma level of glucose increases. b. Carbohydrate reserves are exhausted in a single day. c. Triacylglycerol reserves are exhausted in a single month. d. Plasma levels of fatty acids and glucose bodies decrease, whereas the plasma level of ketone bodies increases. e. During starvation, the liver cells convert any available acetyl CoA, lactate, and alanine to glucose for the brain's needs.

76. What condition is caused by vitamin D deficiency? a. atherosclerosis b. osteomalacia c. cholelithiasis d. Niemann–Pick disease e. Tangier disease 77. What is the last common precursor for the synthesis of triacylglycerols and phospholipids? a. dihydroxyacetone phosphate b. diacylglycerol c. cytidine monophosphate d. ethanolamine e. phosphatidate 78. What stereoisomer is a regular substrate in the β oxidation pathway? a. trans-Δ2-enoyl CoA b. cis-Δ12-enoyl CoA c. trans-Δ3-enoyl CoA d. cis-Δ3-enoyl CoA e. cis-Δ9-enoyl CoA 79. Feedback regulation of cholesterol synthesis is mainly controlled at the step catalyzed by the enzyme: a. 3-hydroxy-3-methylglutaryl (HMG) CoA reductase. b. geranyl transferase. c. HMG transferase. d. farnesyl reductase.

Name:

Class:

Date:

ch 26 - 31 e. HMG-mutase.

80. Insulin leads to: a. activation of fatty acid synthesis. b. inhibition of fatty acid synthesis. c. inhibition of ATP-citrate lyase. d. decrease of protein phosphatase hydrolysis of fatty acid synthesis enzymes. e. decrease in pyruvate transport into mitochondria.

81.

is NOT formed from cholesterol. a. Xanthoma b. Pregnenolone c. Vitamin D d. Limonene e. Glucocorticoids

82. The similarity of phospholipids and sphingolipids is the: a. requirement of activated diacylglycerol for their synthesis. b. synthesis from triacylglycerols. c. requirement of phosphatidate for their synthesis. d. availability of two fatty acid residues in their structure. e. availability of diacylglycerol in their structure.

83. Your grandfather has been told he has high cholesterol and has been given one of the statins to bring it down. He asks if you can think of any reason that he should not double the dose so that it will reduce his blood cholesterol faster. What do you tell him? a. Yes, statins block the reabsorption of bile, effectively blocking the absorption of cholesterol. b. Yes, statins decrease the number of LDL receptors on the surface of intestinal mucosal cells, thereby decreasing cholesterol uptake into the blood. c. Yes, statins increase the number of LDL receptors on the surface of blood vessels, increasing internalization of cholesterol into cells and clearing blood. d. No, at high levels, statins have a stimulatory effect, rather than inhibitory effect, on HMG-CoA reductase. e. No, some cholesterol synthesis is essential. Cholesterol is essential for proper functioning of cell membranes and for precursors for bile salts and steroid hormones.

84. How many citrate molecules should be transported from the mitochondrial matrix to the cytosol to provide all of the carbon atoms for oleate synthesis? a. 6 b. 16 c. 8 d. 9

Name:

Class:

Date:

ch 26 - 31 e. 18 85. When both NADPH and ATP are required, the intermediates from the pentose phosphate pathway: a. enter glycolysis. b. enter gluconeogenesis. c. restore glucose 6-phosphate by entering the nonoxidative phase of the pentose phosphate pathway. d. restore glucose 6-phosphate by entering the oxidative phase of the pentose phosphate pathway. e. enter the citric acid cycle.

86. Which prosthetic group is used in deamination reactions catalyzed by dehydratases? a. pyridoxal phosphate b. NAD+ c. NADP d. CoA e. FADH2 87. In previous chapters, biosynthetic pathways were commonly seen to be regulated by phosphorylation– dephosphorylation mechanisms. Which mechanism for steroid biosynthesis uses an alternative method? a. The sterol regulatory element binding protein (SREBP) migrates to the nucleus and binds the sterol regulatory element (SRE), which stimulates transcription. b. SREBP can be inactivated by the cleavage from the endoplasmic reticulum membrane; thus, it can no longer block steroid synthesis. c. CTP reacts with acetoacetate to provide an activated substrate to start cholesterol synthesis. d. CTP reacts with acetate to provide an activated substrate to start cholesterol synthesis. e. CTP is required to provide the phosphate for the conversion of mevalonate to 5-phosphomevalonate, unlike other pathways that use ATP. 88. The main priority of metabolism during starvation is: a. providing sufficient glucose to the muscles. b. preserving muscle proteins. c. providing the process of gluconeogenesis. d. preserving liver proteins. e. providing the citric acid cycle.

89. Which statement about phospholipid synthesis is TRUE? a. It usually takes place in microsomes of the liver cells. b. Phosphatidylethanolamine is synthesized from phosphatidate and ethanolamine. c. Hydrolysis of pyrophosphate can drive the activation of both diacylglycerol and alcohol. d. Phosphatidylglycerol can react with inositol to yield cardiolipin. e. Only the formation of CDP-diacylglycerol is driven by the hydrolysis of pyrophosphate.

90. Which lipids can be synthesized from cerebroside by addition of activated sugars?

Name:

Class:

Date:

ch 26 - 31 a. gangliosides b. sphingomyelin c. ceramide d. cardiolipin e. phosphatidate 91. What molecule is the direct product of adenylation of methionine? a. S-adenosyl methionine b. S-adenosyl homocysteine c. homocysteine d. cysteine e. succinyl CoA 92. Increasing the activity of adenylate kinase results in the inactivation of: a. acetyl CoA carboxylase. b. protein phosphatase 2A. c. protein kinase C. d. AMP-activated protein kinase. e. citrate synthase.

93. What is the role of citrate in the reaction of acetyl CoA carboxylase 1? a. product inhibitor b. prosthetic group c. mechanism-based inhibitor d. allosteric activator e. allosteric inhibitor 94. What enzyme initiates degradation of threonine? a. ornithine catalase b. ornithine deaminase c. threonine deaminase d. threonine amylase e. threonine catalase 95. What enzymes catalyze the transfer of an a-amino group from an α-amino acid to an α-ketoacid? a. aminotransferases b. dehydrogenases c. synthetases d. transcarbamoylases e. hydroxylases 96. Which statement about ketone bodies is TRUE?

Name:

Class:

ch 26 - 31 a. Acetone and D-3-hydroxybutyrate can be obtained from acetoacetate. b. Ketone bodies bind to the blood protein albumin, which delivers them to tissues. c. Ketone bodies increase the blood pH. d. Ketone bodies are the main fuel during short-term starvation. e. During starvation, acetoacetate can be captured to synthesize glucose.

97. What is the major site of amino acid degradation in mammals? a. kidneys b. stomach c. liver d. spleen e. intestine 98. What enzyme catalyzes the committed reaction of the urea cycle? a. carbamoyl phosphate synthetase I b. carbamoyl phosphate synthetase II c. carbamoyl phosphate dehydrogenase I d. carboxyphosphate synthetase I e. carboxyphosphate synthetase II 99. How many isoprene units does squalene contain? a. 1 b. 3 c. 5 d. 6 e. 30 100. Which coenzyme is used in the committed step of fatty acid synthesis? a. biotin b. lipoic acid c. FADH2 d. NADH e. NADPH 101. What is the acetyl group carrier from the mitochondrial matrix to the cytoplasm? a. acetyl CoA b. malonyl CoA c. citrate d. malate e. oxaloacetate

Date:

Name:

Class:

Date:

ch 26 - 31 102. What enzymes catalyze nearly all cleavages of aromatic rings in biological systems? a. catalases b. proteases c. monooxygenases d. dioxygenases e. hydrogenases 103. The hormone induces lipolysis, whereas a. epinephrine; adrenocorticotropin b. glucagon; insulin c. insulin; norepinephrine d. glucagon; epinephrine e. epinephrine; glucagon

inhibits the process.

104. What reaction activates squalene prior to its cyclization to lanosterol? a. protonation of carbocation b. protonation of epoxide to form a carbocation c. oxidation of the C-2 and C-3 atoms d. esterification e. oxidation of the C-30 atom 105. Exercising first thing in the morning without eating mobilizes lipid stores for fuel. All of the below are involved in this mobilization, EXCEPT: a. glucagon binds 7TM receptors that activate adenylate cyclase. b. perilipin is phosphorylated. c. cAMP stimulates protein kinase A. d. hormone-sensitive lipase completes the mobilization of fatty acids with the production of a free fatty acid and glycerol. e. hormone-sensitive lipase is phosphorylated.

106. Phosphorylation of perilipin: a. triggers the release of a coactivator for adipose triglyceride lipase. b. stimulates phosphorylation of protein kinase A. c. activates adenylate cyclase. d. initiates the release of a fatty acid from triacylglycerol. e. activates hormone-sensitive lipase.

107. How are the consumption of corn oil and prostaglandin synthesis related? a. Prostaglandins are synthesized from membrane proteins originally derived from corn oil. b. ω-6 fatty acids found in corn oil inhibit thromboxane synthase, shifting synthesis to prostaglandins. c. Corn oil contains linoleate, which is required for arachidonate synthesis. d. ω-3 fatty acids found in corn oil inhibit thromboxane synthase, shifting synthesis to prostaglandins.

Name:

Class:

Date:

ch 26 - 31 e. Prostaglandin synthesis and corn oil are not related.

108. A disrupted formation of phosphorylcholine would impair the synthesis of: a. sphingolipids. b. sphingomyelin. c. phosphatidylcholine. d. cerebroside. e. ganglioside.

109. In the urea cycle, the second nitrogen of urea enters the cycle in the form of: a. alanine. b. glutamine. c. ornithine. d. aspartate. e. arginine.

110. Excessive alcohol consumption not only makes you overweight, it can also lead to ammonia poisoning.

How is alcohol metabolism linked to increased levels of blood ammonia? a. Excessive alcohol consumption can cause liver damage, the primary site of urea formation. A loss of liver function can lead to increased ammonia in the blood. b. Excessive ethanol can halt the urea cycle at the formation of carbamoyl phosphate. c. Excessive alcohol consumption makes the liver more acidic, driving the equilibrium from ammonium ion to free ammonia. d. Alcohol acts as an allosteric inhibitor of carbamoyl phosphate, reducing the rate of ammonium ion removal. e. Excessive alcohol facilitates the formation of an abortive complex for glutamate.

111. What amino acid can be converted into serine by the enzymatic addition of a hydroxymethyl group? a. glycine b. valine c. alanine d. arginine e. leucine 112. Several conditions occur due to a deficiency in glucose 6-phosphate dehydrogenase. Why do all of these conditions include anemia as a symptom? a. The oxidized form of glutathione, which normally eliminates peroxides, is depleted in the absence of NADPH. b. Peroxides damage red blood cells due to the absence of NADPH production. c. Red blood cells with diminished glucose 6-phosphate dehydrogenase activity have an overactive response to oxidative stress. d. Reduced glutathione enhances reactive oxygen species formation, leading to cell membrane disruption.

Name:

Class:

Date:

ch 26 - 31 e. Red blood cells accumulate NADPH due to the loss of mitochondria.

113. Amino acids are divided into biosynthetic families according to the fact that there are: a. six sources of metabolic precursors. b. different families of bacteria which are able to convert N2 gas into NH3. c. six types of important metabolic precursors. d. different ways of converting N2 into NH3. e. three types of important metabolic precursors.

114. Hydrolysis of ATP is required for the: a. formation of phosphatidate from GAP. b. activation of diacylglycerol. c. activation of ethanolamine. d. activation of inositol. e. formation of ceramide.

115. Which amino acid is hydrolyzed to generate urea and ornithine in the urea cycle? a. arginine b. alanine c. valine d. leucine e. isoleucine 116. The link between the pentose phosphate pathway and glycolysis is well documented. How does this link facilitate the growth of rapidly dividing cancer cells? a. Rapidly dividing cells meet their NADP+ needs by switching to anaerobic glycolysis. b. Glycolytic intermediates are rapidly depleted due to the increased demand for ATP to synthesize cellular structures, leading to a decreased production of ribose 5-phosphate. c. Accumulated glycolytic intermediates are used by the pentose phosphate pathway to synthesize ribose 5-phosphate. d. Lactonase is allosterically activated by an increase in glycolytic intermediates. e. 6-Phosphogluconate dehydrogenase speeds up ribose 5-phosphate synthesis by switching to NADH formation.

117. Through what process might feedback inhibition processes have evolved? a. duplication of genes encoding catalytic domains b. evolution of homologous subunits in the enzyme catalyzing the committed step c. linking of specific regulator domains to catalytic domains d. linking of multiple regulatory domains e. duplication of multiple regulatory domains 118. In the absence of insulin, most acetyl CoA:

Name:

Class:

ch 26 - 31 a. enters the citric acid cycle. b. enters ketogenesis. c. enters gluconeogenesis. d. is released into blood. e. is stored as lipid droplets.

119. When energy charge is: a. high, the synthesis of cholesterol is stimulated by phosphorylation. b. high, the synthesis of cholesterol is inhibited. c. low, the synthesis of cholesterol is inhibited. d. low, the synthesis of cholesterol is stimulated by phosphorylation. e. low, dephosphorylation of 3-hydroxy-3-methylglutaryl CoA reductase is stimulated.

120. Which reaction in the pentose phosphate pathway releases carbon dioxide? a. oxidative decarboxylation of 6-phosphogluconate b. hydrolysis of 6-phosphoglucono-δ-lactone c. oxidation of glucose 6-phosphate d. oxidative decarboxylation of pyruvate e. oxidation of 6-phosphoglucono-δ-lactone 121. Which metabolic pathway requires NADPH? a. neurotransmitter biosynthesis b. light reaction of photosynthesis c. ATP synthesis d. pentose phosphate pathway e. glycolysis 122. Reductase is the Fe protein composed of two: a. polypeptide chains linked by a 4Fe–4S cluster. b. polypeptide chains linked by three disulfide bonds. c. α subunits and two β subunits. d. polypeptide chains linked by a 2Fe–2S cluster.

123. Phosphopentose epimerase converts ribulose 5-phosphate to: a. xylulose 5-phosphate. b. ribose 5-phosphate. c. fructose 6-phosphate. d. erythrose 4-phosphate. e. ribulose 3-phosphate.

124. Hormone-sensitive lipase acts in: a. fatty acid β oxidation.

Date:

Name:

Class:

Date:

ch 26 - 31 b. transport of a fatty acid through blood. c. thiolysis in the mitochondrial matrix. d. mobilization of triacylglycerols. e. hydrolysis of triacylglycerols in the mitochondrial matrix.

125. What happens when NADPH concentration is high? a. The pentose phosphate pathway halts and glucose 6-phosphate enters glycolysis. b. The nonoxidative phase of the pentose phosphate pathway halts and ribose 5-phosphate enters DNA synthesis. c. The oxidative phase of the pentose phosphate pathway halts and glucose 6-phosphate converts to pentose phosphates. d. The nonoxidative phase of the pentose phosphate pathway halts and ribose 5-phosphate enters gluconeogenesis. e. The pentose phosphate pathway activates and glucose 6-phosphate converts to pentose phosphates.

126. Organisms capable of carrying out reduction of atmospheric nitrogen include: a. some bacteria and archaea. b. higher eukaryotic organisms, such as mammals. c. all plants. d. higher eukaryotic organisms, such as birds. e. fungi.

127. Why is the biological reduction of N2 to NH3 an eight-electron process, not six? a. The biological reaction generates an additional 1 mol of H2 per each mole of N2 fixed. b. Two electrons are necessary for ATP. + c. The biological reaction generates an additional 1 mol of NH4 per each mole of N2 fixed. d. Two electrons are necessary for the formation of ferredoxin. e. Two electrons are necessary for the reductase.

128. The presence of alanine and aspartate aminotransferase in the blood is an indication of: a. heart disease. b. spleen damage. c. liver damage. d. kidney failure. e. intestinal obstruction.

129. In which compartment are double bonds introduced into fatty acids? a. cytosol b. inner membrane of mitochondria c. matrix of mitochondria d. Golgi apparatus

Name:

Class:

Date:

ch 26 - 31 e. endoplasmic reticulum 130. Which reaction is NOT involved in the pentose phosphate pathway?

C3 + C7 a. C5 + C5 C3 + C6 b. C4 + C5 c. C3 + C7 d. C5 + C6 e. 3C5

C6 + C4 C2 + C9 2C6 + C3

131. Nitrogenase is a protein of the nitrogenase complex that: a. provides electrons with a high reducing power. b. uses electrons to reduce N2 to NH3. c. carries out oxidation of N2 to NH3. d. transfers electrons from ADP to ATP. e. carries out reduction of N2 to NO3.

132. Methylmalonyl CoA mutase contains vitamin B12 as its coenzyme. What is the substrate for this enzyme? a. propionyl CoA b. D-glyceraldehyde 3-phosphate c. succinyl CoA d. trans-Δ2-enoyl CoA e. trans-Δ3-enoyl CoA 133. What molecule is dehydrogenated to yield β-methylcrotonyl CoA in the degradation of leucine? a. α-ketoisocaproate b. β-methylglutaconyl c. pyruvate carboxylase d. isovaleryl CoA e. succinyl CoA 134. You are prone to sunburn, but your doctor tells you not to apply your sunscreen until you have been outside for five minutes. Why? a. Sunscreen blocks UV radiation necessary for cholesterol synthesis in the skin, where it is converted to vitamin D. b. Sunlight is necessary for the conversion of cholesterol to vitamin D, a hormone necessary for bone health. c. Skin pigmentation, which occurs when you get a light tan, blocks UV radiation and reduces the incidence of skin cancers. d. Vitamin D in the skin blocks UV radiation, but only for a short period of time; thus, it is a natural sun

Name:

Class:

Date:

ch 26 - 31 block. e. Sunlight promotes HDL mobilization and clearing of cholesterol in blood.

135. N-Acetylglutamate synthase is activated by: a. alanine. b. arginine. c. asparagine. d. glutamate. e. serine.

136. During starvation, the brain begins to consume an appreciable amount of ketone bodies beginning of the starvation state. a. 3 b. 7 c. 14 d. 1 e. 30

days after the

137. The committed step in cholesterol formation is the synthesis of: a. HMG CoA. b. 3-isopentenyl pyrophosphate. c. squalene. d. isoprene. e. mevalonate.

138. Which statement about folic acid is FALSE? a. A lack of folic acid during prenatal development results in spinal-cord defects. b. Folic acid deficiency can result in scurvy. c. Green vegetables, such as spinach and broccoli, are good sources of folic acid. d. Folic acid is a precursor of tetrahydrofolate. e. Folic acid deficiency can result in anencephaly (lack of a brain).

139. How often do urea cycle disorders occur? a. 10 in 15,000 births b. 1 in 15,000 births c. 1 in 100,000 births d. 1 in 150,000 births e. 100 in 150,000 births 140. What are the conditions that lead to a "beer gut" due to an excess consumption of alcohol? a. NADH produced from the metabolism of ethanol stimulates the citric acid cycle for glucose-derived acetyl CoA.

Name:

Class:

Date:

ch 26 - 31 b. Excess ethanol metabolism leads to an accumulation of NADH that inhibits fatty acid metabolism. c. NADH stimulates citric acid cycle enzymes that stimulate glucose-derived acetyl CoA metabolism. d. NADH inhibits ketone body formation, stimulating glucose rather than fatty acid metabolism. e. The processing of acetate in the liver becomes inefficient, leading to a pH imbalance in liver cells, reducing enzyme efficiency in general.

141. What protein triggers mobilization of triacylglycerols? a. hormone-sensitive lipase b. adipose triglyceride lipase c. perilipin d. phosphorylase kinase e. cyclic AMP 142. A friend, who is struggling with weight gain, reads about a new miracle supplement that blocks the formation of phosphatidate, the precursor for triacylglycerols. Would taking this supplement work as a weight reduction scheme? a. Yes, many weight loss drugs target enzyme-catalyzed reactions that occur early in this biosynthetic pathway. b. Yes, a decrease in the amount of phosphatidate leads to activation of key β-oxidation enzymes, which drive lipid metabolism over glucose metabolism. c. Yes, a decrease in the amount of phosphatidate leads to an increase in cellular glycerol 3-phosphate, which stimulates glycolytic enzymes. d. No, because this would also block formation of phospholipids, and cell membrane integrity would be impacted. e. No, triacylglycerol synthesis takes place in the mitochondria and it is unlikely that there is a transporter for the supplement in the inner membrane.

143. Nitrogen fixation is the reaction of: a. fixing gaseous N2 into an unreactive form. b. conversion of gaseous N2 into a biologically useful form of nitrogen (NH3). c. conversion of gaseous NH3 into a biologically useful form of nitrogen (N2). d. reduction of nitrogen to a peptide bond. e. electron transfer to ATP. 144. What is the bond strength in the N2 molecule? a. 225 kJ mol–1 b. 300 kJ mol–1 c. 940 kJ mol–1 d. 240 kJ mol–1 e. 800 kJ mol–1

Name:

Class:

Date:

ch 26 - 31 145. Which compound inhibits the entry of fatty acyl CoA into the mitochondria when the cell is in the highenergy state? a. mitochondrial malonyl CoA b. carnitine acyltransferase I c. acetyl CoA carboxylase 2 d. citrate e. cytosolic malonyl CoA 146. What is the driving force of condensation of carbon units in fatty acid synthesis? a. carboxylation of malonyl CoA b. decarboxylation of acetoacetyl ACP c. NADPH oxidation d. ATP hydrolysis at the previous stage e. entropy 147. How does activated fatty acid move to the mitochondrial matrix? a. The activated fatty acid moves across the outer mitochondrial membrane through a porin channel.

Acetyl carnitine shuttles across the inner mitochondrial membrane by a translocase. b. The activated fatty acid moves across the outer mitochondrial membrane by passive diffusion. Acetyl carnitine moves across the inner mitochondrial membrane by a translocase. c. The activated fatty acid moves across the outer mitochondrial membrane through a porin channel, and shuttles across the outer mitochondrial membrane by a translocase. d. Acetyl carnitine moves across the outer mitochondrial membrane through a porin channel, and shuttles across the outer mitochondrial membrane by a translocase. e. D-glyceraldehyde 3-phosphate moves across the outer mitochondrial membrane through a porin channel, and shuttles across the outer mitochondrial membrane by a translocase.

148. If you were considering designing a drug to regulate blood pressure, which of the following families of steroids would you target? a. androgens b. estrogens c. glucocorticoids d. mineralocorticoids e. progestogens 149. What is the respiratory quotient for carbohydrates? a. 1.0 b. 0.7 c. 0.8 d. 0.5 e. 1.5 150. Which enzyme–substrate pair is CORRECT?

Name:

Class:

Date:

ch 26 - 31 a. methylmalonyl CoA mutase – 3-hydroxy-3-methyl-glutaryl CoA b. hydroxymethylglutaryl CoA synthase – L-methylmalonyl CoA c. cis-Δ3-enoyl CoA isomerase – trans-Δ3-enoyl CoA d. thiolase – 3-ketoacyl CoA e. acyl CoA synthetase – acetyl CoA 151. The activated methyl cycle involves production and use of: a. glutamine. b. glycine. c. heterocysteine. d. homocysteine. e. methanol.

152. A prominent means to reduce the risk of atherosclerosis is stimulation of: a. reverse transport of cholesterol. b. formation of cholesterol-bound HDL. c. direct transport of cholesterol. d. receptor-mediated endocytosis. e. formation of cholesterol-bound LDL. 153. Respiratory distress syndrome is caused by a failure in the biosynthetic pathway of: a. sphingosine. b. gangliosides. c. dipalmitoylphosphatidylcholine. d. cholesterol. e. bile salts.

154. Which statement about pyridoxine is TRUE? a. Pyridoxine is a precursor to pyridoxamine phosphate and adenosine monophosphate. b. Pyridoxine is also called vitamin B12. c. A deficiency of pyridoxine results in fatigue, cheilosis, glossitis, and stomatitis. d. The deficiency of pyridoxine is common in the United States. e. Pyridoxine serves as a cofactor in a host of enzymes, including transaminases.

155. HMG CoA is synthesized from acetyl CoA and: a. oxaloacetate. b. acetoacetyl CoA. c. acetyl CoA. d. farnesyl pyrophosphate. e. mevalonate.

Name:

Class:

Date:

ch 26 - 31 156. What compound is oxidatively deaminated to yield an ammonium ion? a. amino acid b. glutamate c. aspartate d. α-ketoglutarate e. oxaloacetate 157. What does enzyme multiplicity mean? a. One enzyme may catalyze the committed steps of different metabolic pathways. b. Multiple enzymes that are catalytically identical or similar but have different allosteric properties may catalyze the committed step of a metabolic pathway. c. The enzyme that catalyzes one step of the pathway is inhibited by another enzyme of a parallel pathway. d. It refers to the opportunity of enzymes to activate committed steps of different pathways. e. One enzyme activates a metabolic pathway, and the other inhibits the pathway.

158. What types of melanin exist? a. eumelanin and pheomelanin b. brown eumelanin and pheomelanin c. eumelanin and albinism d. pheomelanin and albinism e. black eumelanin and albinism 159. What coenzyme mediates the transfer of a methyl group upon formation of methionine from homocysteine? a. tetrahydrofolate b. methylcobalamin c. folic acid d. pteridine e. methionine 160. What can be used as a reducing power by glutamate dehydrogenase? a. NAD+ b. NADPH c. NADH d. either NADH or NADPH e. acetyl CoA 161. What is the role of ψ domains in mammalian fatty acid synthase? a. ketoreductase catalytic domains b. methyltransferase catalytic domains c. maintenance of the multifunctional enzyme structure

Name:

Class:

Date:

ch 26 - 31 d. transfer of intermediates from one catalytic site to another e. linker between functional domains 162. In the urea cycle, free NH3 is coupled with carboxyphosphate to form: a. uretic phosphate. b. pyruvate. c. carbamic acid. d. carbamoyl phosphate. e. N-acetylaspartate.

163. Where is adipose tissue located in a human body? a. under the skin (subcutaneous fat) and around the inner organs (visceral fat) b. under the skin (visceral fat) and around the inner organs (subcutaneous fat) c. under the skin (subcutaneous fat), around the inner organs (visceral fat), and in the liver d. under the skin (subcutaneous fat) and around the inner organs (blubber) e. inside muscle tissue 164. What enzyme catalyzes the committed step in fatty acid synthesis? a. enoyl reductase b. acetyl CoA carboxylase c. transacylase d. 3-hydroxyacyl dehydratase e. β-ketoacyl reductase 165. Name the enzyme that catalyzes the reaction shown in the figure.

a. glutathione peroxidase b. glutathione reductase c. pyruvate kinase isozyme d. glucose 6-phosphate dehydrogenase e. cytochrome c peroxidase 166. What does muscle weakness and cramping affecting skeletal muscle, the heart, and kidneys likely indicate? a. excess carnitine in the diet b. loss of hormone-sensitive lipase activity c. malfunctioning or deficient carnitine translocase d. ketone-body production

Name:

Class:

Date:

ch 26 - 31 e. ketogenic diet 167. The function of acyl CoA synthetase is: a. ATP-dependent lipolysis to release free glyceraldehyde. b. ATP-dependent reduction of acetyl-CoA prior to activation. c. ATP-dependent activation of fatty acids using CoA. d. ATP-dependent activation of acetyl-CoA. e. synthesis of acetyl CoA from three-carbon units.

168. Tay–Sachs disease is caused by an inability to degrade: a. sphingosine. b. gangliosides. c. dipalmitoylphosphatidylcholine. d. ceramide. e. acetylcholine.

169. Choose the CORRECT sequence of glycine formation. a. oxidation of 3-phosphoglycerate → transamination of 3-phosphohydroxypyruvate → hydrolysis of 3phosphoserine → transfer of the side-chain methylene group of serine to tetrahydrofolate → glycine b. oxidation of 3-phosphoglycerate → oxidation of 3-phosphohydroxypyruvate → hydrolysis of 3phosphoserine → glycine c. transamination of 3-phosphoglycerate → hydrolysis of 3-phosphohydroxypyruvate → hydrolysis of 3-phosphoserine → transfer of the side-chain methylene group of cysteine to tetrahydrofolate → glycine d. transamination of 3-phosphohydroxypyruvate → hydrolysis of 3-phosphoserine → oxidation of 3phosphoglycerate →transfer of the side-chain methylene group of serine to tetrahydrofolate → glycine e. transamination of 3-phosphohydroxypyruvate → oxidation of 3-phosphoglycerate → transfer of the side-chain amino group of serine to tetrahydrofolate → glycine 170. D-glyceraldehyde 3-phosphate can be converted: a. into pyruvate or glucose in the liver. b. only into pyruvate in the liver. c. only into glucose in muscles. d. only into acetyl CoA in muscles. e. only into acetyl CoA in the liver.

171. Acetoacetate is formed from acetyl CoA and can spontaneously turn to: a. acetone. b. acyl CoA. c. acetyl CoA. d. glucose.

Name:

Class:

Date:

ch 26 - 31 e. pyruvate.

172. Choose the CORRECT sequence of intermediate products in the oxidative phase of the pentose phosphate pathway. a. glucose 6-phosphate → 6-phosphoglucono-δ-lactone → 6-phosphogluconate → ribulose 5-phosphate b. glucose 6-phosphate → 6-phosphoglucono-δ-lactone → 6-phosphogluconate → ribose 5-phosphate c. glucose 6-phosphate → 6-phosphogluconate → 6-phosphoglucono-δ-lactone → ribose 5-phosphate d. glucose 6-phosphate → 6-phosphoglucono-δ-lactone → 6-phosphogluconate → ribulose 5-phosphate → fructose 6-phosphate e. glucose 6-phosphate → 6-phosphoglucono-δ-lactone → 6-phosphogluconate → ribulose 5-phosphate → ribose 5-phosphate → pyruvate 173. Deficiency of what vitamin is indicated by methylmalonic acid accumulation? a. B1 b. B2 c. B5 d. B6 e. B12 174. Which is NOT a phospholipid? a. cardiolipin b. phosphatidylinositol c. phosphatidylglycerol d. cerebroside e. phosphatidylethanolamine 175. Which product synthesized in the urea cycle is a precursor for glucose synthesis? a. glutamate b. aspartate c. fumarate d. oxaloacetate e. malate 176. How does the number of carbon atoms change upon synthesis of cholesterol starting from mevalonate? a. C6 → C5 → C10 → C15 → C30 b. C5 → C10 → C15 → C30 c. C5 → C6 → C10 → C15 → C30 d. C5 → C10 → C15 → C30 → C27 e. C6 → C5 → C10 → C15 → C30 → C27

Name:

Class:

Date:

ch 26 - 31 177. Which process makes the following reaction irreversible?

RCOO– + CoA RCO-CoA +AMP +PPi a. hydrolysis of inorganic pyrophosphate b. hydrolysis ATP c. heat release d. AMP release e. catalysis by acyl CoA synthetase 178. Choose the CORRECT sequence of utilization of D-3-hydroxybutyrate. a. D-3-hydroxybutyrate is oxidized to acetoacetate → acetoacetate converts into acetoacetyl CoA → acetoacetyl CoA converts into 2 molecules of acetyl CoA, which enter the citric acid cycle b. D-3-hydroxybutyrate is oxidized to acetoacetate → acetoacetate converts into acetoacetyl CoA → acetoacetyl CoA converts into CO2 and acetyl CoA, which enter the citric acid cycle c. D-3-hydroxybutyrate converts into acetone by D-3-hydroxybutyrate dehydrogenase d. D-3-hydroxybutyrate converts into acetoacetate by D-3-hydroxybutyrate dehydrogenase → acetoacetate spontaneously converts into acetone, which enters gluconeogenesis e. D-3-hydroxybutyrate is oxidized to acetoacetate → acetoacetate converts into acetoacetyl CoA → acetoacetyl CoA converts into 2 molecules of pyruvate, which enter the citric acid cycle 179. What allosteric regulator is required for carbamoyl phosphate synthetase activity? a. acetyl CoA b. glutamate c. acetylglutamate d. N-acetylglutamate e. carboxyphosphate 180. The result of the knockdown of the enzyme catalyzing the committed step in cholesterol formation is: a. condensation of acetyl CoA with mevalonate. b. dephosphorylation of phosphatidate. c. phosphorylation of mevalonate. d. reduction of 3-ketosphinganine. e. hydroxylation of mevalonate.

181. Where are triacylglycerols synthesized? a. ER of the liver cells b. bloodstream from low-density lipoproteins c. cells of adipose tissue d. bloodstream from lipoprotein particles e. cytoplasm of the liver cells 182. Which organs or tissues prefer to use ketone bodies such as acetoacetate as a fuel energy source instead of glucose?

Name:

Class:

Date:

ch 26 - 31 a. heart muscle b. renal cortex c. brain d. heart muscle and renal cortex e. liver 183. How often does phenylketonuria occur? a. 1 in 1000 births b. 1 in 10,000 births c. 1 in 15,000 births d. 1 in 20,000 births e. 1 in 100,000 births 184. What serves as an intermediate for the formation of phosphatidate? a. CDP-diacylglycerol b. lysophosphatidate c. diacylglycerol d. glycerol 3-phosphate e. acyl CoA 185. Which compound is a substrate for the pentose phosphate pathway? a. glucose 6-phosphate b. fructose 6-phosphate c. glucose d. glucose 1-phosphate e. ribose 5-phosphate 186. What are large and highly cross-linked polymers of 5,6-dihydroxyindole and 5,6-dihydroxyindole-2carboxylicacid? a. melanin b. pheomelanin c. eumelanin d. tyrosine e. glutathione 187. What can promote ketone body formation? a. accumulation of acetyl CoA b. lack of acetyl CoA c. high insulin level d. low glucagon level e. excessive protein intake

Name:

Class:

Date:

ch 26 - 31 188. How many moles of ATP are required to synthesize one mole of stearic (C18) acid from acetyl CoA? a. 0 b. 8 c. 7 d. 9 e. 18 189. High cAMP concentration: a. inhibits lipolysis in the liver cells. b. activates β oxidation of fatty acids in the mitochondrial matrix. c. decreases the level of free fatty acids in blood. d. increases the level of free fatty acids in blood. e. inhibits β oxidation of fatty acids in the mitochondrial matrix.

190. The nonoxidative phase of the pentose phosphate pathway is controlled by the: a. availability of ribulose 5-phosphate. b. availability of glucose 6-phosphate. c. concentration of NADPH. d. concentration of NADP+. e. availability of ATP. 191. Threonine deaminase is allosterically inhibited by: a. α-ketobutyrate. b. valine. c. isoleucine. d. threonine. e. leucine.

192. What tripeptide consists of a cysteine residue flanked by a glycine residue and a glutamate residue? a. thyroxine b. serotonin c. glutathione d. histamine e. sphingosine 193. What is the minimal number of ATP required for the reduction of 2 molecules of N2? a. 2 b. 4 c. 8 d. 16 e. 32

Name:

Class:

Date:

ch 26 - 31 194. Which state of acetyl CoA carboxylase 1 is active? a. monomer b. trimer c. tetramer d. R state e. dimer 195. β oxidation of myristyl-CoA (14:0) yields: +

a. 7 acetyl CoA + 7 FADH2 + 7 NADH + 7 H . +

b. 6 acetyl CoA + 7 FADH2 + 7 NADH + 7 H . +

c. 7 acetyl CoA + 6 FADH2 + 6 NADH + 6 H . d. 7 acetyl CoA + 7 FAD + 7 NAD+. +

e. 14 acetyl CoA + 12 FADH2 + 12 NADH + 12 H .

196. What happens when the needs for NADPH and ribose 5-phosphate are balanced? a. Glucose 6-phosphate primarily enters glycolysis, then the product enters the nonoxidative phase of the pentose phosphate pathway. b. Glucose 6-phosphate enters the oxidative phase of the pentose phosphate pathway, then the product enters the nonoxidative phase of the pentose phosphate pathway. c. Glucose 6-phosphate enters the oxidative phase of the pentose phosphate pathway, then the product enters glycolysis. d. Glucose 6-phosphate enters the oxidative phase of the pentose phosphate pathway, then the product enters gluconeogenesis. e. Glucose 6-phosphate primarily enters glycolysis, then the product enters the oxidative phase of the pentose phosphate pathway.

197. Choose the CORRECT statement concerning receptor-mediated endocytosis in cholesterol metabolism. a. Apoprotein A binds a specific receptor localized in coated pits on the cell membranes of the peripheral tissues. b. The acidic environment of the endosome induces the specific receptor to relinquish the lipoprotein particle. c. The released unesterified cholesterol is either used for membrane biosynthesis or stored in the cell. d. Unesterified cholesterol is directed to the Golgi complex to be used for membrane biosynthesis. e. Apoprotein B-100 binds an HDL receptor localized in coated pits on the cell membranes of the liver.

198. The α-amino groups of which amino acids can be directly converted into an ammonium ion? a. alanine and asparagine b. isoleucine and leucine c. arginine and serine d. serine and threonine

Name:

Class:

Date:

ch 26 - 31 e. valine and tyrosine 199. What is the third stage of liver damage from excessive ethanol consumption? a. alcoholic hepatitis b. fatty liver c. coma d. death e. cirrhosis 200. The increase in acetyl CoA during starvation inhibits the enzyme: a. acyl CoA dehydrogenase. b. cobalamin. c. glucagon. d. hormone-sensitive lipase. e. pyruvate dehydrogenase.

201. The main site of ketogenesis is: a. the liver cells. b. the muscles cells. c. neurons. d. blood plasma. e. adipocytes.

202. The intermediate in the oxidation of glucose 6-phosphate to ribulose 5-phosphate is: a. ribose 5-phosphate. b. xylulose 5-phosphate. c. glucose 1-phosphate. d. 6-phosphogluconate. e. fructose 6-phosphate.

203. The storage form of fatty acids is: a. cholesterol. b. phospholipid. c. triacylglycerol. d. sphingolipid. e. diacylglycerol.

204. In which cellular compartment does citrulline condense with aspartate, the donor of the second amino group of urea? a. endoplasmic reticulum b. cytoplasm c. vacuole

Name:

Class:

Date:

ch 26 - 31 d. mitochondria e. cell membrane 205. What are amino acids that are degraded to acetyl CoA or acetoacetyl CoA called? a. acetylated amino acids b. ketogenic amino acids c. glucogenic amino acids d. glycogenic amino acids e. ketone amino acids 206. Which product is regenerated in oxidative deamination of glutamate? a. pyruvate b. α-ketoglutarate c. oxaloacetate d. aspartate e. alanine 207. Animals that have fasted and are then fed high-carbohydrate or low-fat diets show a marked increase in activities of acetyl CoA carboxylase 1 and fatty acid synthase within a few days. What is the cause of this phenomenon? a. Glucose and insulin act at the level of gene transcription. b. Glucose and insulin act at the level of zymogen activation. c. The number of insulin receptors during fasting significantly decreases. d. The increase in epinephrine level during fasting causes activation of acetyl CoA carboxylase 1 and fatty acid synthase. e. The decrease in NADH level during fasting causes activation of acetyl CoA carboxylase 1 and fatty acid synthase.

208. The use of primaquine: a. will completely conquer malaria in the future. b. causes hemolysis in individuals with a deficiency in glucose 6-phosphate dehydrogenase. c. causes hemolysis in individuals with a deficiency in glutathione peroxidase. d. inhibits the formation of Heinz bodies in the red blood cells. e. inhibits glutathione reductase in the red blood cells.

209. Since phosphoenolpyruvate inhibits triose phosphate isomerase, the: a. phosphorylated glycolytic intermediates enter the nonoxidative phase of the pentose phosphate pathway. b. phosphorylated glycolytic intermediates enter the oxidative phase of the pentose phosphate pathway. c. conversion of phosphoenolpyruvate to pyruvate is inhibited. d. conversion of pyruvate to phosphoenolpyruvate is activated. e. phosphorylated glycolytic intermediates enter glycolysis.

Name:

Class:

Date:

ch 26 - 31 210. Every biochemistry student knows that most naturally occurring unsaturated fatty acids are cis fatty acids.

Why, then, do so many fat-containing foods come with the notation "Contains no trans fats"? a. Vegetable oils contain polyunsaturated fatty acids prone to oxidation, which then converts them to trans fats. b. Olive oils, normally healthy oils, are converted to trans fat when cooked at high temperatures. Thus, olive oils are used only at low temperatures. c. Vegetable oils are often hydrogenated to form trans unsaturated fatty acids to preserve shelf life. d. Oils that contain an odd number of carbon atoms are particularly susceptible to oxidation to trans fats. Thus, no odd-numbered carbon fatty acids are used in these foods. e. Oils that contain an odd number of carbon atoms are particularly susceptible to reduction to trans fats. Thus, no odd-numbered carbon fatty acids are used in these foods.

211. What is the source of the amino acid glutamine in eukaryotic cells? a. citric acid cycle b. glycolysis c. pentose phosphate pathway d. nitrogen fixation e. glycolysis and pentose phosphate pathway 212. The making of carbon–carbon bonds requires energy. How does the activated methyl cycle provide energy for methyl group transfer to a wide variety of acceptors? a. The side-chain methylene group of serine is transferred to tetrahydrofolate, a carrier of one-carbon units. b. A fully oxidized one-carbon unit, CO2, is carried by biotin. c. The most reduced form of one-carbon groups carried by tetrahydrofolate is the methyl group. d. Transmethylation reactions are carried out by pyridoxal phosphate–dependent methyltransferases. e. The methyl group of methionine is activated by the transfer of an adenosyl group to the sulfur atom of methionine.

213. Which compound is able to move across the inner mitochondrial membrane? a. glycerol b. free fatty acid c. acyl CoA d. D-glyceraldehyde 3-phosphate e. acyl carnitine 214. Erythrose 4-phosphate is a precursor to the amino acids: a. tryptophan, tyrosine, and phenylalanine. b. tryptophan and phenylalanine. c. tyrosine and phenylalanine. d. tryptophan, tyrosine, phenylalanine, and serine. e. None of the answers is correct.

Name:

Class:

Date:

ch 26 - 31 215. The ketogenic diet: a. kills the intestinal flora. b. decreases blood pH. c. is the only way to treat epilepsy. d. increases seizures in children with epilepsy. e. requires high-fat, adequate-protein, and low-carbohydrate consumption.

216. How many rounds of β oxidation would be required for a 16-carbon fatty acyl chain to be degraded to acetyl CoA? a. 16 b. 8 c. 7 d. 15 e. 10 217. What enzyme catalyzes the formation of glutamine? a. glutamate dehydrogenase b. glutamine synthetase c. homocysteine methyltransferase d. 3-phosphoglycerate dehydrogenase e. threonine deaminase 218. What reaction is catalyzed by the body and the legs of mammalian fatty acid synthase? a. dehydration b. reduction c. modification d. condensation e. CO2 binding 219. Identify the compound shown.

a. an intermediate in ketogenesis

Name:

Class:

Date:

ch 26 - 31 b. an intermediate in lipolysis c. an intermediate in fatty acid oxidation d. an intermediate in fatty acid activation e. a product of fatty acid activation 220. Where does the urea cycle begin? a. endoplasmic reticulum b. cytoplasm c. lysosome d. mitochondria e. cell membrane 221. How many molecules of ATP does the synthesis of carbamoyl phosphate require? a. 0 b. 1 c. 2 d. 3 e. 5 222. Polyunsaturated fatty acids are essential in mammals because they lack the enzymes to: a. introduce double bonds at carbon atoms beyond C-9. b. synthesize unsaturated fatty acids with cycles in their acyl chain. c. introduce double bonds at carbon atoms beyond C-2. d. introduce double bonds at carbon atoms beyond C-7. e. synthesize polyunsaturated fatty acids.

223. Choose the molecule into which the carbon skeletons of 20 fundamental amino acids are not funneled. a. pyruvate b. fumarate c. acetyl CoA d. oxaloacetate e. malate 224. Nonessential amino acids are those that: a. cannot be synthesized by a human and must be supplied in the diet. b. can be synthesized in the human organism if dietary content is insufficient. c. can be synthesized in the organism if glutamine is sufficient. d. are synthesized by bacteria. e. can be biosynthesized in a large number of steps.

225. The major carrier(s) of dietary fat from the intestine is/are: a. VLDL.

Name:

Class:

Date:

ch 26 - 31 b. chylomicrons. c. HDL. d. LDL. e. IDL. 226. Glucose 6-phosphate dehydrogenase is inhibited by low levels of a. NADPH. b. NADP+. c. ribose 5-phosphate. d. ribulose 5-phosphate. e. NADH. 227. The products of lipolysis are glycerol and free fatty acids. What is the role of these compounds? a. Glycerol can be phosphorylated to D-glyceraldehyde 3-phosphate, which can enter both glycolytic and gluconeogenic pathways. Free fatty acids can be oxidized to succinyl CoA, which enters the citric acid cycle. b. Free fatty acids can be used in both glycolytic and gluconeogenic pathways in the liver cells.

Glycerol can be used as a fuel inside cells. c. Glycerol can be used only in gluconeogenesis in the liver cells. Free fatty acids can be used as a fuel inside cells. d. Glycerol can be used only in glycolysis in the liver cells. Free fatty acids can be used as a fuel inside cells. e. Free fatty acids can be oxidized to acyl CoA, which enters the citric acid cycle. Glycerol can be phosphorylated to D-glyceraldehyde 3-phosphate, which can enter both glycolytic and gluconeogenic pathways.

228. How many molecules of acetyl CoA are involved in a single round of ketogenesis? a. 2 b. 3 c. 4 d. 1 e. 0 229. What does cumulative feedback inhibition mean? a. Each inhibitor can reduce the activity of an enzyme, even when other inhibitors are exerting their own maximal inhibition. b. Multiple enzymes that are catalytically identical or similar but have different allosteric properties may catalyze the committed step of a metabolic pathway. c. One enzyme may catalyze the committed step of a different metabolic pathway. d. One enzyme activates the metabolic pathway, and another inhibits the pathway. e. The committed step can be catalyzed by two or more enzymes with different regulatory properties.

230. Which statement about the activated methyl cycle is TRUE?

Name:

Class:

Date:

ch 26 - 31 a. Synthesis of SAM relies solely on hydrolysis of pyrophosphate. b. S-adenosylhomocysteine, rather than just homocysteine, is methylated to lower the free energy of methyl transfer. c. The most reduced form of the one-carbon unit on tetrahydrofolate is required to methylate homocysteine. d. The high transfer potential of the methyl group from methylcobalamin allows restoration of methionine. e. The ATP hydrolyzed in the synthesis of SAM is restored in the activated methyl cycle in the reaction of methionine synthase.

231. What amino acids are solely ketogenic? a. alanine and valine b. valine and leucine c. leucine and lysine d. tryptophan and tyrosine e. tyrosine and leucine 232. The increase in the concentration of DAG is due to: a. inhibited activity of phosphatidic acid phosphatase. b. stimulated activity of diacylglycerol kinase. c. stimulated activity of phosphatidic acid phosphatase. d. hydrolysis of pyrophosphate. e. hydrolysis of CTP. 233. The first step of β oxidation is: a. oxidation by FAD. b. oxidation by NAD+. c. hydration by enoyl CoA hydrase. d. thiolysis by CoA. e. activation by CoA. 234. Essential amino acids differ from nonessential amino acids in that: a. nonessential amino acids are synthesized in simple reactions compared to most essential amino acids. b. essential amino acids are generally synthesized directly from the citric acid cycle intermediates, but nonessential amino acids are not. c. microorganisms and animals cannot synthesize essential amino acids, but plants can. d. animals cannot synthesize essential amino acids because they have lost the ability to carry out transamination reactions. e. essential amino acids can be synthesized by the symbiotic bacteria in animals' intestines.

235. When the cell requires ribose for biosynthesis but does not require NADPH, the formation of ribose 5phosphate is summarized by

Name:

Class:

Date:

ch 26 - 31 5 glucose 6-phosphate + ATP → 6 ribose 5-phosphate + ADP Identify the enzyme that catalyzes the reaction that requires ATP. a. lactonase b. glutathione reductase c. aldolase d. phosphofructokinase e. 6-phosphogluconate dehydrogenase 236. Which of the following compounds is toxic? a. acetoacetate b. cobalamin c. hypoglycin d. methylene cyclopropylacetate e. trans-Δ3-enoyl CoA 237. For synthesis of what product is alanine taken up in the liver and converted into pyruvate? a. urea b. glucose c. lactate d. glutamate e. glycogen 238. What is a normal blood value for aspartate aminotransferase activity? a. 5–30 units/L b. 40–70 units/L c. 40–125 units/L d. 90–120 units/L e. 110–150 units/L 239. The carbon skeletons for amino acids are intermediates found in: a. glycolysis. b. the citric acid cycle. c. the pentose phosphate pathway. d. All of the answers are correct. e. None of the answers is correct.

240. Where do the reactions of the pentose phosphate pathway take place? a. mitochondrial matrix b. inner mitochondrial membrane c. cytoplasm d. lumen of the rough endoplasmic reticulum

Name:

Class:

Date:

ch 26 - 31 e. stroma of a chloroplast 241. Essential amino acids are synthesized by: a. microorganisms. b. humans. c. plants. d. both microorganisms and humans. e. both microorganisms and plants.

242. Which reaction is irreversible? a. sedoheptulose 7-phosphate + glyceraldehyde 6-phosphate → fructose 6-phosphate + erythrose 4phosphate b. ribulose 5-phosphate → ribose 5-phosphate c. ribulose 5-phosphate → xylulose 5-phosphate d. glucose 6-phosphate + NADP+ → 6-phosphoglucono-δ-lactone + NADPH + H+ e. oxidized glutathione + NADPH + H+ → reduced glutathione + NADP+ 243. What enzyme is regulated by feedback inhibition and activation? a. glutamine synthetase b. adenosine monophosphate synthetase c. 3-phosphoglycerate dehydrogenase d. threonine deaminase e. glutamate dehydrogenase 244. The activation of fatty acids for degradation takes place in two steps. What is the intermediate formed and why is activation necessary for β oxidation to occur? a. Acyl adenylate; cAMP formed by this reaction activates protein kinase A. b. Acyl adenylate; only the activated form of the fatty acid can react with coenzyme A. c. Propionate; only the activated form of the fatty acid can react with coenzyme A. d. Acyl carnitine; cAMP formed by this reaction activates protein kinase A. e. Acyl carnitine; this intermediate is needed to fuel the carnitine cycle.

245. How much urea is excreted by a human being per year? a. 10 kg b. 20 kg c. 30 kg d. 40 kg e. 50 kg 246. Which molecule can reduce reactive oxygen species (ROS)? a. reduced glutathione b. oxidized glutathione

Name:

Class:

Date:

ch 26 - 31 c. NADPH d. NADP+ e. glucose 6-phosphate dehydrogenase 247. The committed step in fatty acid synthesis is inactivated by: a. acetyl CoA carboxylase 2. b. citrate. c. protein phosphatase 2A. d. AMP-activated protein kinase. e. malonyl CoA. 248. What inhibits the nitrogenase complex? a. N2 b. O2 +

c. NH4 d. ATP e. ADP

249. What amino acid is formed in a reaction catalyzed by ornithine transcarbamylase? a. glutamine b. threonine c. arginine d. citrulline e. ornithine 250. Chronic ethanol ingestion leads to fatty liver due to an increase in: a. NADH. b. NADPH. c. ATP. d. AMP. e. lactate.

251. Which sequence of reactions leading to the reduction of the C-3 keto group to the methylene group upon fatty acid synthesis is TRUE? a. reduction – dehydration – reduction b. oxidation – hydration – reduction c. reduction – hydrogenation – dehydration d. reduction – hydrogenation – condensation e. condensation – dehydration – hydrogenation 252. Choose the CORRECT sequence of intermediate products in the pentose transfer between the pentose

Name:

Class:

Date:

ch 26 - 31 phosphate pathway and gluconeogenesis. a. ribose 5-phosphate → glyceraldehyde 3-phosphate → fructose 1,6-bisphosphate b. ribose 5-phosphate → glyceraldehyde 3-phosphate → fructose 6-phosphate c. ribulose 5-phosphate → fructose 6-phosphate d. fructose 6-phosphate → fructose 1,6-bisphosphate → ribose 5-phosphate e. ribose 5-phosphate → glyceraldehyde 3-phosphate → sedoheptulose 7-phosphate 253. What is the site of conversion of N2 to NH3? a. reductase b. bacterial membrane c. glutamine synthetase d. nitrogenase e. ATP receptor 254. This amino acid, in high levels, is correlated with the damage of cells lining blood vessels. a. serine b. cysteine c. S-adenosylmethionine d. citrulline e. homocysteine 255. What is the function of cystathionine β-synthase? a. stimulation of homocysteine formation b. transfer of the methyl group c. stimulation of serine formation d. combination of homocysteine and serine to form cystathionine e. combination of glycine and serine to form cystathionine 256. Which statement about bile is FALSE? a. Polar and nonpolar regions of cholesterol make bile a good detergent. b. Glycocholate is the major bile salt. c. Excess cholesterol in the bile leads to the formation of gallbladder stones. d. The addition of hydroxyl groups and glycine residues to cholesterol leads to the formation of glycocholate. e. Bile salts solubilize dietary lipids upon their release into the small intestine.

257. Using CoA in the condensation of carbon units is favorable because the condensation is coupled to carboxylation that contributes to a substantial in free energy. a. acetyl; decrease b. malonyl; decrease c. malonyl; increase d. citryl; increase

Name:

Class:

Date:

ch 26 - 31 e. acetyl; increase 258. What enzyme is regulated by cumulative feedback inhibition? a. threonine deaminase b. 3-phosphoglycerate dehydrogenase c. guanine synthase d. glutamine synthetase e. glutamine dehydrogenase 259. Which statement about sphingolipids is TRUE? a. Condensation of palmitoyl CoA and serine followed by oxidation, acylation, and reduction yields ceramide. b. All three classes of sphingolipids contain carbohydrate substituents. c. Two hydroxyl groups of ceramide serve as sites for different substituents. d. Condensation of palmitoyl CoA and serine followed by reduction, acylation, and oxidation yields ceramide. e. Only sphingomyelin and cerebroside contain carbohydrate substituents.

260. In fatty acid synthesis, what is the direct product of the following metabolic conversion?

a. crotonyl ACP b. D-3-hydroxybutyryl ACP c. butyryl ACP d. D-3-oxybutyryl CoA e. D-3-hydroxyacetyl ACP 261. If C-1 of ribose 5-phosphate is labeled with radioactive 14C, where would this label be after the reaction xylulose 5-phosphate + ribose 5-phosphate glyceraldehyde 3-phosphate + sedoheptulose 7-phosphate a. C-1 of glyceraldehyde 3-phosphate b. C-3 of glyceraldehyde 3-phosphate c. C-1 of sedoheptulose 7-phosphate d. C-2 of sedoheptulose 7-phosphate e. C-3 of sedoheptulose 7-phosphate 262. In eukaryotes, saturated fatty acids larger than 18 carbons are formed by: a. elongation reactions catalyzed by enzymes on the endoplasmic reticulum membrane. b. one-carbon additions at the inner mitochondrial membrane. c. elongation reactions catalyzed by enzymes in the peroxisomes. d. two-carbon additions at the inner mitochondrial membrane.

Name:

Class:

Date:

ch 26 - 31 e. elongation reactions catalyzed by enzymes in the lumen of the endoplasmic reticulum.

Indicate one or more answer choices that best complete the statement or answer the question.

263. Select all that apply. The role of lipoprotein particles is to: a. solubilize hydrophobic lipids. b. aid in clot formation. c. contain cell-targeting signals. d. reduce the amount of cholesterol in the blood. e. control phosphorous metabolism.

264. Acetylation of serine on prostaglandin synthase inhibits its activity. What eicosanoid hormones will NOT be produced? Select all that apply. a. prostacyclin b. thromboxane c. PGH2-derived prostaglandins d. leukotrienes e. prostaglandin H2 265. Select all that apply. The deleterious effects of excess ethanol consumption are due to: a. overconsumption of NADH. b. overproduction of NADH. c. generation of free radicals. d. overconsumption of NADPH. e. overproduction of NADPH. 266. What molecules enhance the activity of phosphatidic acid phosphatase (PAP)? Select all that apply. a. CDP-diacylglycerol b. sphingosine c. phosphatidylinositol d. dihydrosphingosine e. cardiolipin 267. Which amino acids can be ketogenic? Select all that apply. a. asparagine b. tyrosine c. valine d. lysine e. threonine 268. Select all that apply. Essential amino acids are: a. leucine.

Name:

Class:

Date:

ch 26 - 31 b. glycine. c. alanine. d. histidine. e. tryptophan.

269. What is the difference between reduction of acetoacetyl ACP to β-hydroxbutyryl ACP in fatty acid synthesis and the corresponding β oxidation in fatty acid degradation? Select all that apply. a. In reduction, the L rather than the D isomer is formed. b. In reduction, the D rather than the L isomer is formed. c. NADPH/NADP+ is a redox coenzyme pair used in reduction, whereas NADH/NAD+ is a redox coenzyme pair used in oxidation. d. NADH/NAD+ is a redox coenzyme pair used in reduction, whereas NADPH/NADP+ is a redox coenzyme pair used in oxidation. e. In reduction, NADPH is the reductant, whereas FAD is the oxidant in the corresponding reaction in β oxidation.

270. Which coenzymes are required for fatty acid synthesis? Select all that apply. a. biotin b. lipoic acid c. FADH2 d. NADH e. NADPH 271. Select all that apply. Essential fatty acids are: a. palmitate (16:0). b. palmitoleate (16:1). c. linoleate (18:2). d. oleate (18:1). e. linolenate (18:3).

272. Select all that apply. ATP is hydrolyzed by: a. MoFe proteins. b. Fe proteins. c. glutamine synthetases. d. methionine synthases. e. 3-phosphoglycerate dehydrogenases.

273. What molecules provide NH3 for incorporation into amino acids? Select all that apply. a. β-ketoglutarate b. serine c. glutamate

Name:

Class:

Date:

ch 26 - 31 d. aspartate e. glutamine 274. Select all that apply. Epidemiological evidence suggests that consumption of a large amount of saturated fatty acids and trans fat promotes: a. obesity. b. type 2 diabetes. c. type 1 diabetes. d. atherosclerosis. e. thrombosis.

275. What lipoproteins are used to transport lipids from blood or tissues to the liver? Select all that apply. a. chylomicrons b. very low-density lipoproteins c. intermediate-density lipoproteins d. low-density lipoproteins e. high-density lipoproteins 276. Which amino acid is a metabolite in the urea cycle but is not used as a building block of proteins? Select all that apply. a. ornithine b. citrulline c. glutamate d. asparagine e. argininosuccinate 277. Select all that apply. Hydroxylation of cholesterol by cytochrome P450 requires: a. NADPH. b. activated O2. c. PLP. d. NADH. e. HMG CoA. 278. What molecule can aspartate and asparagine be converted into upon their degradation? Select all that apply. a. glutamate b. acetate c. fumarate d. oxaloacetate e. malate 279. What are the sources of NADPH for fatty acid synthesis? Select all that apply.

Name:

Class:

Date:

ch 26 - 31 a. pentose phosphate pathway b. citric acid cycle c. malic enzyme reaction d. oxidative decarboxylation of malate by malic enzyme in cytosol e. action of cytoplasmic malate dehydrogenase 280. What are the results of a biotin-deficient diet? Select all that apply. a. increase in cytosolic crotonyl CoA b. decrease in butyryl ACP c. decrease in cytosolic acetyl CoA d. increase in cytosolic acetyl CoA e. decrease in fatty acid de novo synthesis 281. What are ways to regulate the activity of acetyl CoA carboxylase? Select all that apply. a. allosteric inhibitors b. phosphorylation and dephosphorylation c. zymogen activation d. the binding of cAMP e. allosteric activators 282. Select all that apply. Fatty acid synthesis is necessary during: a. fasting. b. embryonic development. c. after meal. d. lactation. e. sleep.

283. What intermediates of the pentose phosphate pathway can enter glycolysis in mode 4? Select all that apply. a. glyceraldehyde 3-phosphate b. fructose 6-phosphate c. ribose 5-phosphate d. glucose 6-phosphate e. fructose 1,6-bisphosphate 284. Which enzyme is bound to the outer mitochondrial membrane? Select all that apply. a. acyl CoA synthetase b. carnitine acyltransferase I c. translocase d. carnitine acyltransferase II e. acyl CoA dehydrogenase 285. What inhibits the translation of HMG-CoA reductase mRNA? Select all that apply.

Name:

Class:

Date:

ch 26 - 31 a. binding of SREPB to the sterol regulatory element b. dietary cholesterol c. phosphorylation of SREPB d. metabolites of mevalonate e. endogenous cholesterol 286. What are the concomitant products of the conversion of glucose 6-phosphate to pyruvate in mode 4 of the pentose phosphate pathway? Select all that apply. a. NADH b. NADPH c. ADP d. CO2 e. ATP 287. Select all that apply. Amino acid synthesis is generally regulated by: a. turnover. b. diet. c. feedback inhibition. d. feedback activation. e. enzyme multiplicity.

288. Select all that apply. The synthesis of triacylglycerol will increase in the case of: a. increased concentration of dihydroxyacetone phosphate. b. lipin 1 stimulation by cardiolipin. c. proteolytic release of the SREBP. d. hydrolysis of the phosphoester bond of phosphatidate. e. phosphorylation of diacylglycerol.

289. Which amino acids are glucogenic? Select all that apply. a. asparagine b. methionine c. valine d. lysine e. serine 290. What are the products at the stage of fatty acid synthesis when a two-carbon molecule reacts with a threecarbon molecule to give a four-carbon molecule and a one-carbon molecule? Select all that apply. a. acetyl CoA b. acetoacetyl CoA c. malonyl CoA d. methyl CoA

Name:

Class:

Date:

ch 26 - 31 e. CO2 291. What are the functions of the pentose phosphate pathway? Select all that apply. a. formation of NADPH b. formation of three- and six-carbon intermediates of glycolysis c. synthesis of pentose sugars for DNA and RNA synthesis d. ATP synthesis e. synthesis of pentose sugars for coenzyme A synthesis 292. What organisms can synthesize essential amino acids? Select all that apply. a. bacteria b. humans c. plants d. mammals e. archaea 293. How does reduced glutathione maintain the red blood cell structure? Select all that apply. a. protects against falciparum malaria b. maintains the hemoglobin structure c. prevents Heinz body formation d. causes Heinz body formation e. maintains the glutathione peroxidase structure 294. In what tissues is the pentose phosphate pathway active? Select all that apply. a. liver b. mammary gland c. red blood cells d. muscle e. pancreas Enter the appropriate word(s) to complete the statement.

295. A(n) 296.

is composed of a fatty acid linked to sphingosine via an amide bond. serves as a signal molecule for a high-energy state as it stimulates acetyl CoA carboxylase.

297. High levels of acetoacetate in blood lead to a decrease in the rate of lipolysis in

tissue.

298. Because their sufficiency is dependent on a particular set of conditions, amino acids such as arginine and tyrosine are sometimes called amino acids.

299. Phenylketonuria is caused by an absence or a deficiency of 300. The enzyme transketolase transfers a(n)

.

-carbon fragment from a ketose to an aldose. Write the

Name:

ch 26 - 31 number out as a word.

Class:

Date:

Name:

ch 26 - 31 Answer Key 1. c 2. b 3. b 4. b 5. a 6. a 7. d 8. e 9. a 10. b 11. c 12. d 13. c 14. b 15. b 16. b 17. c 18. b 19. d 20. a 21. c 22. b 23. a 24. c

Class:

Date:

Name:

ch 26 - 31 25. a 26. c 27. b 28. e 29. b 30. c 31. b 32. e 33. d 34. d 35. c 36. d 37. a 38. a 39. d 40. b 41. c 42. c 43. a 44. a 45. a 46. a 47. c 48. e 49. a

Class:

Date:

Name:

ch 26 - 31 50. c 51. a 52. d 53. b 54. a 55. a 56. c 57. d 58. d 59. c 60. e 61. a 62. c 63. d 64. a 65. c 66. e 67. b 68. b 69. a 70. d 71. d 72. e 73. d 74. c

Class:

Date:

Name:

ch 26 - 31 75. b 76. b 77. e 78. a 79. a 80. a 81. d 82. d 83. e 84. d 85. a 86. a 87. a 88. b 89. c 90. a 91. a 92. d 93. d 94. c 95. a 96. a 97. c 98. a 99. d

Class:

Date:

Name:

ch 26 - 31 100. a 101. c 102. d 103. b 104. c 105. d 106. a 107. c 108. b 109. d 110. a 111. a 112. b 113. c 114. c 115. a 116. c 117. c 118. b 119. c 120. a 121. a 122. a 123. a 124. d

Class:

Date:

Name:

ch 26 - 31 125. a 126. a 127. a 128. c 129. e 130. d 131. b 132. a 133. d 134. b 135. b 136. a 137. e 138. b 139. b 140. b 141. c 142. d 143. b 144. c 145. a 146. d 147. a 148. d 149. a

Class:

Date:

Name:

ch 26 - 31 150. d 151. d 152. a 153. c 154. c 155. b 156. b 157. b 158. a 159. b 160. d 161. c 162. c 163. a 164. b 165. b 166. c 167. c 168. b 169. a 170. a 171. a 172. a 173. e 174. d

Class:

Date:

Name:

ch 26 - 31 175. c 176. e 177. a 178. a 179. d 180. c 181. a 182. d 183. b 184. b 185. a 186. c 187. a 188. b 189. d 190. a 191. c 192. c 193. e 194. e 195. c 196. b 197. d 198. d 199. e

Class:

Date:

Name:

ch 26 - 31 200. e 201. a 202. d 203. c 204. b 205. b 206. b 207. a 208. b 209. a 210. c 211. a 212. e 213. e 214. a 215. e 216. c 217. b 218. d 219. d 220. d 221. c 222. a 223. e 224. b

Class:

Date:

Name:

ch 26 - 31 225. b 226. b 227. a 228. b 229. a 230. c 231. c 232. c 233. a 234. a 235. d 236. d 237. b 238. c 239. d 240. c 241. e 242. d 243. d 244. b 245. a 246. a 247. d 248. b 249. d

Class:

Date:

Name:

ch 26 - 31 250. a 251. a 252. a 253. d 254. e 255. d 256. a 257. b 258. d 259. d 260. b 261. e 262. a 263. a, c 264. a, b, c, e 265. b, c, d 266. a, c, e 267. b, d, e 268. a, d, e 269. b, c 270. a, e 271. c, e 272. b, c 273. c, e 274. a, b, d, e

Class:

Date:

Name:

ch 26 - 31 275. c, d, e 276. a, b, e 277. a, b 278. c, d 279. a, c, d 280. b, d, e 281. b, e 282. b, d 283. a, b 284. a, b 285. b, d 286. a, b, d, e 287. c, d, e 288. a, b, d 289. a, b, c, e 290. b, e 291. a, b, c, e 292. a, c, e 293. b, c 294. a, b, c 295. ceramide 296. Citrate 297. adipose 298. conditionally essential 299. phenylalanine hydroxylase

Class:

Date:

Name:

ch 26 - 31 300. two

Class:

Date:

Name:

Class:

Date:

ch 32 - 37 Indicate the answer choice that best completes the statement or answers the question.

1. Which statement about DNA is FALSE? a. DNA has a double-helix structure. b. DNA is composed of four bases: A, T, G, and C. c. Nucleosides are the monomeric units of DNA. d. The strands of DNA run in opposite directions. e. A-DNA appears when DNA is less hydrated.

2. Choose the enzyme that does NOT take part in DNA repair. a. DNA polymerase I b. DNA polymerase II c. DNA polymerase III d. DNA polymerase IV e. DNA polymerase V 3. Which statement about eukaryotic regulatory sequences is FALSE? a. Binding of the mediator requires an enhancer and promoter to be available for transcription activators and factors, respectively. b. The GC box can be located within CpG islands since they can be near the start of transcription and consist of appropriate nucleotides. c. The CAAT and GC boxes also require pairing with the initiator element at the +1 position. d. The regulatory +30 sequence will recruit PIC but without the help of TBP. e. RNA polymerase II isn't able to recognize any of the regulatory sequences by itself.

4. Human beings contain two different carbamoyl phosphate synthetase enzymes. If you wanted to study the enzyme inhibition for the enzyme specific for nucleotide synthesis, which of the following analogs would you choose? a. analog for bicarbonate b. analog for carboxyphosphate c. analog for carbamic acid d. analog for NH3 e. analog for glutamine 5. What statement about DNA polarity is TRUE? a. One end of the chain has a free 5′-OH group. The other end of the chain has a free 3′-OH group. b. One end of the chain has a 5′-OH group attached to a phosphoryl group. The other end of the chain has a free 3′-OH group, which is linked to another nucleotide. c. One end of the chain has a free 3′-OH group or 3′-OH group attached to a phosphoryl group. The other end of the chain has a free 3′-OH group, which is linked to another nucleotide. d. One end of the chain has only a free 5′-OH group. The other end of the chain has a free 3′-OH group.

Neither is linked to another nucleotide.

Name:

Class:

Date:

ch 32 - 37 e. One end of the chain has a free 5′-OH group or 5′-OH group attached to a phosphoryl group. The other end of the chain has a free 3′-OH group. None is linked to another nucleotide.

6. What does DNA polymerase accuracy depend on? a. polymerase activity b. type of polymerase c. length of DNA d. double helices formation e. Watson–Crick base pairings 7. What is the distinctive feature of many DNA-binding proteins that are involved in chromatin remodeling? a. helix-turn-helix motif b. acetyllysine binding domain c. zinc-finger motif d. Mg2+-binding domain e. ATP-binding domain 8. Which process that activate transcription in eukaryotes is FALSE? The transcription factor binds to the: a. –25 regulatory promoter sequence. b. template strand prior to the transcription start. c. +30 regulatory promoter sequence. d. –10 regulatory promoter sequence. e. template strand after the transcription start.

9. Choose the CORRECT statement about synthesis of adenylate. a. There are more salvage pathways to synthesize adenylate than guanylate. b. After the addition of aspartate, dihydroorotic acid is formed as an intermediate. c. Overall, two molecules of aspartate are required to bring a nitrogen atom within the pyrimidine ring and replace carbonyl oxygen with NH2. d. Cyclization of its imidazole ring is due to the addition of bicarbonate to the amino group. e. Overall, two molecules of glutamine are required to bring a nitrogen atom within the pyrimidine ring and replace carbonyl oxygen with NH2.

10. Choose the CORRECT sequence of reactions that is appropriate for nucleotide excision repair, in particular, excision of the thymine dimer. a. DNA polymerase I enters the gap → DNA ligase joins the DNA chain → UvrABC excinuclease cuts the damaged DNA. b. UvrABC excinuclease cuts the damaged DNA → DNA ligase joins the DNA chain. c. UvrABC excinuclease cuts the damaged DNA → DNA polymerase I enters the gap → DNA ligase joins the DNA chain. d. DNA polymerase I enters the gap → UvrABC excinuclease cuts the damaged DNA → DNA ligase joins the DNA chain.

Name:

Class:

ch 32 - 37 e. DNA polymerase I enters the gap → DNA ligase joins the DNA chain.

11. Choose the CORRECT components of a nucleoside. a. a pentose sugar bonded with a hexose sugar b. a base bonded to a sugar and one or more phosphoryl groups c. a base bonded to a sugar d. a base bonded to a sugar and an alcohol residue e. a sugar bonded to a lipid molecule 12. What are telomeres? a. ends of eukaryotic chromosomes b. ends of prokaryotic chromosomes c. replicon ends d. proofreading mechanisms e. replication fork 13. Ciprofloxacin is an inhibitor of: a. bacterial topoisomerase I. b. bacterial topoisomerase II. c. bacterial endonuclease. d. helicase. e. primase.

14. The loss of the occurs in an AP site. a. pyrimidine nucleotide b. nucleotide base c. deoxyribose d. purine nucleotide e. phosphate group 15. Transcription activators can be linked with the preinitiation complex by the: a. enhancer. b. promoter. c. transcription factor. d. CTD. e. mediator.

16. What is the nature of contact between DNA and the TATA-box-binding protein? a. ionic bonds b. hydrophobic interactions c. protein–protein interaction d. covalent bonds

Date:

Name:

Class:

Date:

ch 32 - 37 e. complementary binding 17. What is the main cause of Huntington disease? a. mismatched base pair in two genes: hMSH2 and hMLH1 b. huntingtin expression in the brain c. presence of glutamine residues within the gene d. from 6 to 31 CAG sequences in huntingtin e. expansion of trinucleotide repeats 18. Which statement about regulation of transcription through eukaryotic promoters is TRUE? a. Deviations from the consensus sequence of the promoter don't decrease its activity in eukaryotes. b. Elements of the eukaryotic promoters need to be present on the template strand to be effectively recognized by RNA polymerase. c. Location of promoter elements on the template strand is required for the promoter to be recognized by transcription factors. d. Promoters are usually present on both strands of DNA, which is important for binding of TBP proteins. e. Elements of eukaryotic promoters need to be present on the coding strand to be effectively recognized by RNA polymerase.

19. What are the components of a nucleic acid monomer? a. a base, an ester residue, a phosphate b. an amino acid, an ester residue, a base c. a sugar, a base d. a sugar, a phosphate, a base e. an amino acid, a sugar, a phosphate 20. Eukaryotic promoters: a. are referred to as trans-acting elements. b. have approximately the same composition. c. are referred to as cis-acting elements because they can be located at a distance from the genes they control. d. are referred to as cis-acting elements because they are located on the same molecule of DNA as the genes they control. e. are positioned near the genes they control.

21. The shorthand notation pApCpG denotes that: a. a phosphate is attached to the 5′ end of the adenosine nucleotide unit. b. a phosphate is attached to the 3′ end of the guanine nucleotide unit. c. the cytosine nucleotide has a free hydroxyl group. d. a phosphate is attached to the 5′ end of the adenosine nucleotide unit and the cytosine nucleotide has a free hydroxyl group.

Name:

Class:

Date:

ch 32 - 37 e. the guanosine nucleotide is attached to the 5′ end of the adenosine nucleotide unit.

22. The mode of DNA replication termed the trombone model describes a mechanism whereby the loop lengthens and shortens like the slide on a trombone. Specifically, what loop is being described? a. The loop refers to the clamp of DNA polymerase. b. The loop is the strand of RNA synthesized by the primase. c. The loop refers to the unwinding of the DNA by topoisomerase I. d. The loop is made by the leading strand as it completes replication. e. The loop is formed by the 3′-to-5′ lagging strand on the DNA template.

23. How many neurodegenerative diseases are caused by trinucleotide repeats? a. 5 b. about 10 c. about 35 d. more than 40 e. more than 70 24. Which polymerase is responsible for the completion of replication of damaged genomes? a. polymerase I b. polymerase II c. polymerase α d. error-prone polymerase e. telomerase 25. What actually dictates the 5′ → 3′ direction of DNA replication? a. The energy for polymerization is obtained from hydrolysis of pyrophosphate on a preexisting nucleotide (i.e., on the 3′ end). b. Okazaki fragments are not sterically hindered by 2′-OH found in ribonucleotides, making the 5′-to-3′ synthesis possible on both strands. c. The nucleophilic attack of the 3′-hydroxyl group on the 5′-phosphate group allows energy to be obtained from hydrolysis of pyrophosphate on the 5′ end. d. The triphosphate on 5′-OH undergoes a nucleophilic attack by Mg2+ in DNA polymerase. e. The direction of polymerization is determined by primase, not the nucleotide structure.

26. What difference between type I and type II topoisomerases is TRUE? a. Unlike type II, type I topoisomerases catalyze an uphill reaction and don't require energy from hydrolysis of ATP. b. Type I topoisomerases are prokaryotic, while type II are eukaryotic. c. Type II topoisomerases are prokaryotic, while type I are eukaryotic. d. Unlike type I, type II topoisomerases catalyze an uphill reaction and require energy from hydrolysis of ATP. e. Unlike type I, type II topoisomerases eliminate supercoils.

Name:

Class:

Date:

ch 32 - 37 27. Which statement about the regulation of ribonucleotide reductase is TRUE? a. Binding of dATP to the overall-activity control site enhances formation of deoxyribonucleotides. b. Binding of TTP to the substrate-specificity control site promotes the reduction of GDP and UDP. c. Binding of dATP to the substrate-specificity control site can enhance formation of pyrimidine deoxyribonucleotides. d. Binding of ATP to the overall-activity control site inhibits formation of ribonucleotides. e. Binding of any deoxyribonucleotide to the overall-activity control site inhibits the reduction of ribonucleotides.

28. What is the key role of melanin pigments? a. protection from biological toxins such as muscarine b. absorption of ultraviolet light c. decreasing tumor growth d. participating in oxygenation processes e. breaking the non-Watson–Crick base pair 29. How does the mismatch repair machinery of E. coli determine which of the bases is incorrect? a. The incorrect base is tagged by a hydroxyl group. b. A newly synthesized strand is vulnerable to exonucleases, so the enzymes work precisely. c. The incorrect base induces protein cascades to activate the repair machinery. d. RAD51 helps to identify the incorrect base. e. The incorrect base is nonmethylated in the newly synthesized daughter strand.

30. Choose the CORRECT statement about semiconservative replication of DNA. a. Daughter double-stranded DNA molecules are identical to the corresponding parental ones. b. One of the strands of each daughter DNA molecule is newly synthesized, whereas the other is passed unchanged from the parent DNA molecule. c. Each daughter DNA molecule is single-stranded and identical to the parent DNA molecule. d. Two daughter DNA molecules are double-stranded and differ from the parent. e. There is one daughter double-stranded DNA molecule, which is identical to the parental one.

31. Choose the CORRECT statement about regulation of purine nucleotides synthesis. a. The pool of purine nucleotides is balanced by the stimulation of aspartate transcarbamoylase by adenylate. b. Amidotransferase is inhibited by adenylate and guanylate, while PRPP synthase is inhibited by inosinate. c. PRPP synthase is inhibited by adenylate and guanylate, while amidotransferase is inhibited by inosinate. d. The pool of pyrimidine nucleotides is balanced through the reciprocal inhibition of aspartate transcarbamoylase by adenylate. e. The pool of purine nucleotides is balanced by the reciprocal inhibition of pathways branching from inosinate.

Name:

Class:

Date:

ch 32 - 37 32. Which type of disease does Huntington disease belong to? a. lysosomal storage disease b. protein-aggregation disease c. lipid storage disease d. disorder of carbohydrate metabolism e. sex-linked disorder 33. What is the direct consequence of the hydrophobic effect that stabilizes the double helix structure? a. DNA is insoluble. b. Sugars become more sensitive to digestion. c. Phosphodiester bonds are more prone to breaking. d. DNA is a rigid molecule. e. Bases are positioned inside the helix.

34. Choose the reaction that is driven by the hydrolysis of pyrophosphate. a. phosphorylation of uridylate b. reduction of ribonucleoside diphosphates c. formation of inosinate from hypoxanthine d. formation of adenylosuccinate e. formation of xanthylate 35. Which enzyme cleaves pyrimidine dimers in the direct repair system? a. DNA photolyase b. DNA polymerase I c. DNA polymerase III d. DNA ligase e. helicase 36. Normally, nucleotide biosynthesis is regulated by: a. suicide inhibition. b. phosphorylation. c. feedback inhibition. d. competitive inhibition. e. purinosomes.

37. What is the committed step in pyrimidine nucleotide biosynthesis? a. formation of carbamoylaspartate b. formation of orotate c. phosphorylation of ribose 5-phosphate d. formation of uridylate e. formation of phosphoribosylamine

Name:

Class:

Date:

ch 32 - 37 38. Why will two daughter double helices have different sequences in the replication process in case of a point mutation in the maternal helix? a. The daughter double helices will be synthesized while the reparation system is knocked down. b. The daughter double helices will be synthesized with a non-Watson–Crick base-pairing model. c. Mismatched maternal bases lead to different bases for two daughter double helices, according to the Watson–Crick base-pairing model. d. Daughter helices will change themselves spontaneously. e. There will not be two daughter helices, only one of them.

39. If you could look at individual strands of DNA and you saw a Holliday junction, what would that tell you? a. A region of DNA that contains a thymidine dimer is undergoing repair. b. DNA repair of a double-strand break is occurring via a recombination mechanism. c. DNA with a point mutation is undergoing base-excision repair. d. DNA with a point mutation is undergoing nucleotide-excision repair. e. Mutagenic reversal is occurring, as seen in the Ames test.

40. Why does DNA have thymine instead of uracil? a. It is energetically unfavorable to make A-U bonds in DNA. b. The repair system can distinguish cytosine and methylated cytosine. c. Uracil retains methylated thymine and the repair system excises it from the chain. d. Deamination of cytosine results in thymine, which is recognized by the repair system and excised from the chain. e. Deamination of cytosine results in uracil, which is recognized by the repair system and excised from the chain.

41. What is the distinctive feature of RNA polymerase II in comparison with other eukaryotic as well as prokaryotic polymerases? a. regulatory carboxyl-terminal domain (CTD) b. synthesis of microRNA c. synthesis of rRNA d. separation of transcription and translation in space and time e. bromodomain 42. What enzyme is the target for competitive inhibition by methotrexate? a. thymidylate synthase b. thymidylate kinase c. dihydrofolate reductase d. aspartate transcarbamoylase e. nucleoside diphosphate kinase 43. Which statement about interactions of transcription factors with DNA is FALSE? a. A minor groove of DNA needs to be bent for TBP to bind the TATA box.

Name:

Class:

Date:

ch 32 - 37 b. Changes in the DNA major groove near the gene can inhibit transcription. c. A major groove of DNA is unlikely to contain a TATA box. d. Unwinding of the DNA helix isn't required for the binding of transcription factors. e. Methylation of DNA inhibits transcriptions, but methylation of histones can activate it.

44. Which statement about nuclear hormone receptors is FALSE? a. The DNA-binding domain of nuclear receptors is fully functional regardless of the ligand binding. b. Corepressors act as antagonists of nuclear hormone receptors. c. Ligand binding is required to recruit a coactivator but not a corepressor. d. Binding of the agonist of the estradiol receptor will facilitate transcription by recruiting transcription activators to the estrogen response elements (EREs). e. Binding of receptor agonists doesn't influence the binding of the ligand–receptor complex to response elements.

45. What organisms are exposed to serious devastating influence by oxybenzone? a. human beings b. reptiles c. birds d. corals e. bacteria 46. In eukaryotes during transcription: a. all three RNA polymerases recognize all possible promoter sequences. b. each eukaryotic RNA polymerase recognizes one unique promoter. c. both RNA polymerases recognize specific sets of promoters. d. RNA polymerases don't require promoters and operate only through enhancers. e. each RNA polymerase recognizes some set of promoter sequences.

47. Which property of DNA makes the molecule appropriate for storing genetic information? a. length of DNA b. hydrogen bonds between nitrogen bases of different strands c. ability to form three different forms d. presence of A and T nitrogen bases e. sequence of one strand determines the sequence of the other 48. Explain the presence of DNA grooves in terms of donor–acceptor interactions. a. The O-4 atom of thymine and the O-6 atom of guanine are located in the major groove and can serve as hydrogen acceptors. b. In the major groove, N-7 of guanine or adenine is a potential donor. c. In the minor groove, N-3 of adenine or guanine can serve as a hydrogen donor. d. In the major groove, the amino group attached to C-2 of guanine can be a hydrogen acceptor. e. In the minor groove, N-3 of adenine or guanine and O-2 of thymine or cytosine can serve as

Name:

Class:

Date:

ch 32 - 37 hydrogen acceptors.

49. How is the purine nucleotide cycle linked to the citric acid cycle? a. The purine nucleotide cycle serves as an anapleurotic reaction for the formation of oxaloacetate. b. The purine nucleotide cycle serves as an anapleurotic reaction for the formation of fumarate. c. The purine nucleotide cycle serves as an anapleurotic reaction for the formation of pyruvate. d. Condensation of IMP with glutamate generates adenylosuccinate, which is hydrolyzed to form succinate. e. Condensation of IMP with glutamine generates adenylosuccinate, which is hydrolyzed to form succinate.

50. The transition from initiation to elongation is marked by the: a. dephosphorylation of the CTD domain of RNA polymerase II. b. phosphorylation of the CTD domain of RNA polymerase II. c. binding of a ligand by a steroid hormone receptor. d. binding of the G-protein. e. acetylation of TFIIH. 51. The free end of the eukaryotic chromosome is thought to form a unique DNA structure that allows for a complete replication, which is a: a. replication fork. b. large duplex loop. c. supercoiled loop. d. displacement loop. e. DNA clamp.

52. In genetics in the anticipation phenomenon: a. siblings of an affected person show the same symptoms of a disease at an older age than did the person. b. a disease in first-generation children is determined by the genotype of the mother. c. a disease in children of both the first and the second generations of an affected person is manifested with 100% frequency. d. first-generation children of an affected person tend to show symptoms of a disease determined by the genotype of the father. e. the first-generation children of an affected parent tend to show symptoms of a disease at an earlier age than did the parent.

53. What is the consequence of the replication stall? a. double-strand breaks b. single-strand breaks c. point mutations d. incomplete replication of both DNA strands

Name:

Class:

Date:

ch 32 - 37 e. recombination between two strands 54. What is the function of helicase? a. It removes mismatched nucleotides from the 3′ end of DNA. b. It eliminates supercoils by cleaving DNA. c. It primes synthesis of DNA. d. It utilizes the energy of ATP to add negative supercoils to DNA. e. It utilizes the energy of ATP for separation of strands.

55. Choose the CORRECT order of compaction of DNA in eukaryotes. a. DNA → nucleosome → "beads on a string" → fiber → loops → chromosome b. DNA → fiber → loops → nucleosome → "beads on a string" → chromosome c. DNA → "beads on a string" → fiber → nucleosome → loops → chromosome d. DNA → nucleosome → fiber → loops → "beads on a string" → chromosome e. DNA → nucleosome → loops → fiber → "beads on a string" → chromosome 56. What type of DNA has been discovered in the nuclei of eukaryotic cells only recently? a. rDNA b. eccDNA c. ssDNA d. mtDNA e. cpDNA 57. Eukaryotic RNA polymerases: a. unlike prokaryotic, require a primer. b. I are located in nucleoli and transcribe genes of rRNA. c. that are insensitive to α-amanitin are RNA polymerases III. d. can synthesize mRNA. e. III are the only polymerases capable of synthesizing rRNA. 58. What is the name of chemical agents that alter specific bases within DNA after completed replication? a. mutagens b. oncogenes c. acceptors d. replicative inhibitors e. mutants 59. What ion assists in stabilization of complexes of nucleic acids? a. Mg2+ b. Ca2+ c. K+

Name:

Class:

Date:

ch 32 - 37 d. Na+ e. Fe2+ 60. How often does DNA polymerase I remove a correct nucleotide? a. 1 correct nucleotide in 15 b. 1 correct nucleotide in 20 c. 1 correct nucleotide in 25 d. 1 correct nucleotide in 50 e. 1 correct nucleotide in 100 61. What statement about synthesis of guanylate is TRUE? a. Two carbonyl groups are present in guanylate: one originates from dehydrogenation by NAD+ and one from bicarbonate. b. Overall, two molecules of glutamine are required: one brings a nitrogen atom within the pyrimidine ring, and one is used to replace carbonyl oxygen by NH2. c. Two molecules of N5,N10-methylenetetrahydrofolate are required to synthesize one guanylate molecule. d. Four molecules of fumarate are formed upon synthesis of two molecules of guanylate. e. Overall, two molecules of aspartate are required: one brings a nitrogen atom within the pyrimidine ring, and one is used to replace carbonyl oxygen with NH2.

62. Which statement about eukaryotic RNA processing is TRUE? a. Splicing of the mRNA precursor is done in the cytoplasm, while modification of the ends is done in the nucleus. b. An unprocessed mRNA precursor is translocated into the cytoplasm to be modified before the translation. c. Transcription yields primary transcript, which can by itself yield a functional protein. d. Splicing of the mRNA precursor is done in the nucleus, while modification of the ends is done in the cytoplasm. e. Functional individual rRNA cannot be produced without splicing.

63. Choose the enzyme of nucleotide biosynthesis that is unique for DNA synthesis. a. thymidylate synthase b. GMP synthetase c. glutamine phosphoribosyl amidotransferase d. UMP kinase e. nucleoside diphosphate kinase 64. What enzyme is involved in relaxation of supercoils? a. helicase b. DNA polymerase I

Name:

Class:

Date:

ch 32 - 37 c. DNA polymerase II d. topoisomerase I e. topoisomerase II 65. Choose the CORRECT statement about the recombination of DNA. a. In homologous recombination, parent DNA duplexes align at regions of sequence similarity. b. Recombination is the exchange of segments between two DNA molecules. c. A displacement loop is a three-stranded structure. d. Holiday junction is a common intermediate of DNA recombination, which consists of two strands of DNA. e. Double-strand breaks can be repaired by recombination.

66. Which is important for establishing tissue specificity? a. prokaryotic promoter b. TATA box c. eukaryotic promoter d. enhancer e. TFIID 67. The chemical forces that contribute to the stability of DNA due to base-stacking present in the DNA helix are: a. hydrogen bonds. b. van der Waals interactions. c. disulfide bonds. d. covalent bonds. e. ionic bonds.

68. What enzyme can add negative supercoils to DNA? a. helicase b. DNA polymerase I c. DNA polymerase II d. topoisomerase I e. topoisomerase II 69. Choose the techniques that Meselson and Stahl used to establish semiconservative replication of DNA. a. isotope labeling and density gradient equilibrium sedimentation b. isotope labeling and photoaffinity labeling c. DNA sequencing and photoaffinity labeling d. density gradient equilibrium sedimentation and DNA sequencing e. PCR and stable-isotope probing 70. Which transcription factor is important for transcription elongation as well as for initiation in eukaryotes?

Name:

Class:

Date:

ch 32 - 37 a. TFIIA b. TFIIB c. TFIID d. TFIIE e. TFIIF 71. Which unit represents the origin of replication in eukaryotes? a. prepriming complex b. replicon c. oriC locus d. primase e. primosome 72. What statement about synthesis of deoxyribonucleotide triphosphates is FALSE? a. The first dUMP must be synthesized from UMP to yield thymidine triphosphate (TTP). b. dUDP is synthesized by reduced ribonucleotide reductase. c. Nucleoside diphosphate kinase phosphorylates TDP to yield TTP. d. Specific ADP kinase is required to transform ADP to ATP. e. dCDP can be synthesized if ribonucleotide reductase is reduced by thioredoxin.

73. An example of a bifunctional enzyme is: a. TFIIH. b. RNA polymerase III. c. histone acetyltransferase. d. RNA polymerase II. e. TFIID. 74. Why is negative supercoiling of DNA vital for the cell? a. Negatively supercoiled DNA is less sensitive to mutagens. b. DNA is limited by the cell space and has to fit it. c. Negative supercoiling prepares DNA for the processes requiring separation of DNA strands. d. While DNA is negatively supercoiled, it does not undergo mutations. e. Negative supercoiling makes the DNA molecule more stable.

75. Methylation of DNA: a. attracts corepressors to the DNA. b. usually activates transcription. c. attracts coactivators to the DNA. d. forms methylated islands of nucleotides that are usually near the transcription start site. e. can prevent binding of proteins to DNA. 76. Why does RNA have a 2′-hydroxyl group in a sugar while DNA does not?

Name:

Class:

Date:

ch 32 - 37 a. The hydroxyl group of a DNA sugar is broken rapidly in a water solution. b. The presence of a hydroxyl group is impossible in the negatively charged DNA. c. The absence of a 2′-hydroxyl group in DNA increases its resistance to hydrolysis. d. The hydroxyl group of a DNA sugar is absent in order to avoid possible mutations. e. The oxygen atom of the hydroxyl group is too reactive to be in a hydroxyl form.

77. How does oxybenzone affect DNA structure? a. It modifies thymine forming an oxetane derivative. b. It breaks phosphodiester bonds. c. It unwinds DNA chains. d. It forms stem-loop structures of DNA. e. It modifies deoxyribose forming ribose.

78. What would be the first process to happen to regulate gene expression upon the beginning of hemoglobin synthesis in 35-hour-old chicken embryos? a. binding of a coactivator b. binding of TBP c. recruitment of HATs d. recruitment of demethylases e. recruitment of histone deacetylases 79. What is a synonym of RNA-dependent DNA polymerase? a. helicase b. primase c. telomerase d. exonuclease e. gyrase 80. What is the name of the structure formed by an undamaged double strand (blue) and one damaged strand (red) of DNA during recombination?

a. tight junction b. Holliday junction c. helix-loop-helix d. helix-turn-helix e. D-loop

Name:

Class:

Date:

ch 32 - 37 81. Exposure to aflatoxin B1 can lead to: a. the expansion of repeats of three nucleotides. b. DNA damage by alkylation. c. the defective repair of DNA. d. the recombination of DNA. e. double-strand breaks in DNA. 82. How many full turns does a linear B-DNA have if its length is 374 bp? a. 11 b. 110 c. 37 d. 36 e. 35 83. In what direction does the DNA strand grow upon replication? a. 3′ → 5′ b. 5′ → 3′ c. 3′ → 3′ d. 5′ → 5′ e. both 3′ → 5′ and 3′ → 5′ 84. What is the synonym of DNA gyrase? a. bacterial topoisomerase I b. bacterial topoisomerase II c. helicase d. primase e. DNA polymerase I 85. How would a mutation that reduced uracil formation affect DNA replication? a. The effect would be negligible because uracil is found in RNA, not DNA. b. The effect would be minimal because UTP is formed from the emanation of CTP. c. Uracil could be synthesized by a salvage pathway and so the effect would be minimal. d. DNA synthesis depends on dCTP formed by nucleotide reductase of dUTP. e. DNA synthesis depends on the synthesis of a short strand of RNA primer; thus, DNA synthesis would be negatively impacted.

86. RNA-dependent DNA polymerase takes part in: a. relaxation of supercoiled DNA. b. formation of Okazaki fragments. c. addition of negative supercoils to DNA. d. rejoining of DNA strands.

Name:

Class:

Date:

ch 32 - 37 e. replication of telomeres.

87. What bonds connect adjacent sugars in a DNA strand? a. ionic bonds b. hydrogen bonds c. peptide bonds d. disulfide bridges e. phosphodiester bonds 88. If you are not genetically predisposed to xeroderma pigmentosum, is it okay to go ahead and get a summer tan? a. Yes, especially for children, because vitamin D formation is critical for bone growth and it requires extensive exposure to UV light. b. Yes, the mutation rate in affected genes is extremely low in the absence of xeroderma pigmentosum so there is nothing to be afraid of. c. No, many defects can arise through UV entering the eyes, which are not protected by the sunscreen. d. No, ultraviolet is still a mutagen and DNA mutations can arise from an inability to repair all photoinduced damage if there were too many. e. No, the defective gene in xeroderma pigmentosum is highly susceptible to UV mutation so the disease can be acquired later in life.

89. The frequency of DNA replication error is: a. 1 per 102 nucleotides b. 1 per 104 nucleotides c. 1 per 106 nucleotides d. 1 per 108 nucleotides e. 1 per 1010 nucleotides 90. DNA pieces that are synthesized on the lagging strand are referred as: a. replication fork. b. Okazaki fragments. c. polymerase. d. Holliday fragments. e. telomere.

91. By changing the expression of transcription factors in fibroblasts, it is possible to obtain a(n): a. pluripotent cell. b. totipotent cell. c. induced pluripotent cell. d. induced totipotent cell. e. organ transplant.

Name:

Class:

Date:

ch 32 - 37 92. Which polymerase acts after polymerase switching in eukaryotes to continue replication after synthesis of the first 20 deoxyribonucleotides? a. polymerase α b. polymerase δ c. polymerase I d. polymerase II e. polymerase III 93. Which element is common for promoters of genes with constitutive expression? a. TATA box b. GC box c. DPE d. Inr e. UPE 94. The Ames test is a simple and sensitive test for detecting chemical mutagens. What characteristic of the strain of Salmonella makes them appropriate for "detecting chemical mutagens"? a. A high proportion of Salmonella reverses the original mutation. b. The addition of the chemical mutagen allows reversal of a mutation in the genes of DNA synthesis. c. The addition of the chemical mutagen allows reversal of a mutation in the genes of histidine synthesis. d. Reversal of the original mutation requires liver homogenates; thus, there are no spontaneous reversals. e. This strain of bacteria is susceptible to very low levels of mutagens and amplifies very small signals.

95. These paired bases show a result of a chemical agent's influence. Give the names to bases 1 and 2, respectively. a. 8-oxoguanine and thymine b. 8-oxoguanine and adenine c. 5-methylcytosine and adenine d. thymine and hypoxanthine e. cytosine and hypoxanthine 96. Phosphorylation of histones is best known to participate in: a. transcription activation. b. transcription repression. c. DNA reparation. d. DNA hypersensitivity to the DNase I. e. hypomethylation of DNA. 97. The most likely cause of behavioral symptoms of Lesch–Nyhan syndrome is: a. hyperproliferation of dopamine-secreting neurons.

Name:

Class:

Date:

ch 32 - 37 b. mutation of adenosine deaminase. c. elevated levels of urate in the serum. d. allosteric regulation of ribonucleotide reductase. e. insufficient activation and regulation of G-protein-coupled receptors in neurons.

98. What structure forms when SSB proteins bind to the single-stranded regions of DNA after binding of DnaA and DnaB? a. replication fork b. Okazaki fragments c. prepriming complex d. origin of replication e. telomere 99. Choose the CORRECT sequence of metabolites in the synthesis of pyrimidine nucleotides. For the sake of simplicity, some metabolites are omitted. a. carbamoyl phosphate → dihydroorotate → orotate → cytidylate b. carboxyphosphate → carbamoylaspartate → inosinate → uridylate c. carbamoyl phosphate → orotate → dihydroorotate → uridylate d. glutamine → carbamoylaspartate → orotate → uridylate e. carboxyphosphate → orotate → carbamoylaspartate → uridylate 100. Which interactions take part in forming complementary base pairs? a. ionic bonds b. covalent bonds c. hydrogen bonds d. van der Waals forces e. base-stacking interactions 101. The three-strand structure involved in strand invasion is: a. the D-loop. b. recombinant DNA. c. an RNA triplet. d. non-Watson–Crick pairing. e. RecA. 102. What is the LEAST common metabolite in the synthesis of adenylate and guanylate? a. xanthylate b. fumarate c. inosinate d. phosphoribosylamine e. orotidylate

Name:

Class:

Date:

ch 32 - 37 103. What are the components of the mismatch repair systems? a. protein MutH, endonucleases MutS and MutL b. protein MutL, endonucleases MutS and MutH c. proteins MutL and MutH, endonuclease MutS d. proteins MutS and MutL, endonuclease MutH e. proteins MutS and MutH, endonuclease MutL 104. Why are insertions and deletions of DNA more damaging than a mismatched base pair? a. Replicative polymerases can stall or fall off a damaged template entirely. b. Offspring of the next generation will be sterile c. Synthesized proteins may have low activity. d. The organism will be susceptible to diseases. e. Replicative polymerases will make more mistakes.

105. RNA-processing enzymes that can act in the course of elongation in eukaryotes are recruited by: a. TFIIB. b. TFIIH. c. phosphorylated CTD of RNA polymerase II. d. activation domain of TFIID. e. dephosphorylated CTD of RNA polymerase II. 106. Triiodothyronine (T3) is a thyroid hormone that has a nuclear receptor but cannot cross the plasma membrane by simple diffusion. Which statement about the regulation of gene expression by T3 is TRUE? a. A specific coactivator binds to the T3–thyroid hormone receptor complex bound with the response elements. b. After binding the thyroid hormone receptor, the formed complex interacts with the specific response elements. c. A corepressor is bound to the specific response elements, preventing binding of the T3–thyroid hormone receptor complex d. A corepressor prevents chromatin remodeling by binding to the T3–thyroid hormone receptor complex. e. A specific coactivator recruits RNA polymerase after binding to the thyroid hormone receptor.

107. A common selective estrogen receptor modulator used in breast cancer therapy is: a. tamoxifen. b. α-amanitin. c. acetyllysine binding protein. d. p63. e. CTD. 108. The formation of a phosphodiester linkage between the 5′-phosphate group at the end of one DNA

Name:

Class:

Date:

ch 32 - 37 fragment and the 3′-hydroxyl group at the end of the other fragment is catalyzed by: a. telomerase. b. polymerase. c. gyrase. d. ligase. e. primase.

109. Choose the enzyme that primes synthesis of DNA. a. helicase b. topoisomerase I c. topoisomerase II d. primase e. gyrase 110. How many Holliday junctions are formed upon repair of one double-strand break in DNA? a. 1 b. 2 c. 3 d. 4 e. Holliday junctions are formed only when single-strand breaks are repaired.

111. The process whereby two daughter molecules of DNA are formed by the exchange of genetic material between two parent molecules is known as: a. chemical modification. b. recombination. c. alkylation. d. dimerization. e. replication.

112. Choose the CORRECT position at which given TATA boxes actually start. The transcription start site is given in green color.

1 2 3 4 5

GGGCTATAATACGCCACCTA GAGCTATAATGCTAGCGTCA GAGGTATAGAGCAGGGTTCA CGACTATAAAAGGGGTCTAA TCGGTATAAAGGTGAACAGA a. –10 b. –25 c. –15 d. –13 e. –16

Name:

Class:

Date:

ch 32 - 37 113. The bacteria illustrates the extraordinary power of DNA repair systems. a. Deinococcus radiodurans b. Deinococcus reticulitermes c. Escherichia coli d. Mycobacterium tuberculosis e. Mycobacterium leprae 114. There are 1080 depurination repair events required per cell per hour in the diploid human cell which contains about 6 × 109 base pairs. What is the overall spontaneous rate of depurination per minute? a. 1.08 × 10–8 depurinations per purine per minute b. 1.8 × 10–7 depurinations per purine per minute c. 4.8 × 10–9 depurinations per purine per minute d. 2 × 10–9 depurinations per purine per minute e. 3 × 10–9 depurinations per purine per minute 115. Choose the INCORRECT statement about nucleotides. a. Basically, a nucleoside is a phosphate ester of a nucleotide. b. In a nucleoside, as well as in nucleotides, the base is linked to a sugar. c. Deoxyribonucleotides are produced from ribonucleotides. d. Nucleotides contain a base, sugar, and from one to three phosphate residues. e. The purine base consists of two heterocyclic rings, whereas the pyrimidine base consists of one such ring.

116. As the result of gene knockout applied to myogenin, a regulatory protein of mice, the mouse: a. becomes weak. b. dies at birth. c. dies 3 days after birth. d. will have hypertrophied skeletal muscle. e. will be sterile.

117. Choose the enzyme that synthesizes an RNA strand consisting of 10 nucleotides that is complementary to one of the template DNA strands. a. polymerase b. endonuclease c. primase d. helicase e. topoisomerase 118. Choose the CORRECT statement about synthesis of nucleotides. a. Synthesis of the pyrimidine ring begins with attachment to ribose.

Name:

Class:

Date:

ch 32 - 37 b. Tetrahydrofolate is required for the synthesis of both purine and pyrimidine nucleotides. c. The purine ring is assembled on the deoxyribose unit. d. Inosinate is important only for the synthesis of purine nucleotides. e. The sugar has to be activated only for the synthesis of the pyrimidine base.

119. The genes of 18S, 5.8S, and 28S ribosomal RNA are transcribed: a. by RNA polymerase III. b. separately. c. as a single transcript. d. at the same time as they are translated. e. with 5S rRNA. 120. The main thing in the Ames test is to add mammalian liver homogenate to: a. compare both bacterial and mammalian activity of the potential carcinogens. b. use mammalian enzymes as a control group. c. test validity. d. activate the potential carcinogens that bacteria cannot convert by their enzymes. e. identify mammalian revertants.

121. After two generations of replication in the Meselson and Stahl experiment, what was the composition of the two bands? a. One band was all 14N and one band was all 15N. b. One band was all 14N and one band was half 14N and half 15N. c. One band was all 15N and one band was half 14N and half 15N. d. One band was all 14N and one band was one quarter 14N and three quarters 15N. e. One band was all 15N and one band was one quarter 14N and three quarters 15N. 122. How can the leading and lagging strands be synthesized in a coordinated fashion? a. Specific enzymes control the size of the DNA strands unwinding. b. Lagging-strand binding proteins inhibit leading-strand replication if the strands become disproportionate in size. c. The lagging strand is looped which allows DNA polymerase III to proceed in the same direction on each strand. d. The leading strand is looped which allows DNA polymerase III to proceed in the same direction on each strand. e. The DNA polymerase III holoenzyme is dimeric and can synthesize two new strands simultaneously.

123. What is the nitrogen base shown?

Name:

Class:

Date:

ch 32 - 37

a. 3-methyluracil b. 5-methylthymine c. thymine d. 3-methylcytosine e. 5-methylcytosine 124. The result of association of transcription factors into large complexes which differ in their specificity to genes in different cells is called: a. combinatorial control. b. synergy. c. the hypomethylation effect. d. mediating control. e. a mediator complex.

125. What is the role of the small RNA primer in DNA replication? a. It is involved in recognition of the replication origin. b. It provides a free 3′ hydroxyl group for DNA polymerase. c. Unlike the leading strand, the lagging strand cannot be replicated without primers. d. It provides a free 5′ phosphate group for DNA polymerase. e. It is used by RNA-dependent DNA polymerase.

126. If you were to subject E. coli circular DNA to gel electrophoresis in the absence (lane 1) and presence (lane 2) of topoisomerase I, what would you expect to find? a. Both lanes would look the same because the DNA is still the same size, with only a small portion uncoiled. b. Lane 1 would run farther than lane 2 due to a smaller charge/density ratio of the DNA in lane 1. c. Lane 1 would run farther than lane 2 due to relaxed and therefore slower moving DNA in lane 2. d. Lane 2 would run farther than lane 1 due to a smaller charge/density ratio of the DNA in lane 1. e. Lane 2 would run farther than lane 1 due to relaxed and therefore slower moving DNA in lane 1.

127. Choose the nitrogen base that pairs with guanine mutated by hydroxyl radical in DNA. a. uracil b. adenine c. cytosine

Name:

Class:

Date:

ch 32 - 37 d. thymine e. guanine 128. What reaction of nucleotide biosynthesis requires NAD+, rather than NADP, as a cofactor? a. formation of adenylosuccinate b. oxidation of hydrated inosinate c. reduction of ribonucleoside diphosphates d. oxidation of xanthine e. reduction of urate 129. What is the name of the process of rehybridization of melted DNA? a. denaturation b. Tm c. annealing d. dehybridization e. replication 130. Choose the component of the DNA chain. a. thymine b. thymidine c. thymidylate d. thymidine diphosphate e. thymidine triphosphate 131. Choose the CORRECT statement about telomeric DNA. a. It repairs DNA. b. It utilizes ATP. c. It forms the origin of replication. d. It contains a lot of tandemly repeated hexanucleotide sequences. e. It synthesizes short stretches of RNA. 132. What is the function of exonuclease activity of DNA polymerases? a. to remove incompatible nucleotides from the 3′ end of DNA b. to remove incompatible nucleotides from the 5′ end of DNA c. to start synthesis of complementary strands d. to initiate replication e. to catalyze strand separation 133. Which statement about DNA clamps is TRUE? a. They form ends of eukaryotic chromosomes. b. They consist of β2 subunits.

Name:

Class:

Date:

ch 32 - 37 c. They remove mismatched nucleotides. d. They prime synthesis of DNA. e. They utilize ATP. 134. What is a transient copy of genetic information? a. supercoiled RNA b. DNA c. B-DNA d. Z-DNA e. RNA 135. Which nitrogen atom of a purine and a pyrimidine bases is bound to a 1′-carbon atom of the sugar? a. N-1 of purine and N-1 of pyrimidine b. N-1 of purine and N-3 of pyrimidine c. N-3 of purine and N-9 of pyrimidine d. N-9 of purine and N-3 of pyrimidine e. N-9 of purine and N-1 of pyrimidine 136. What is the final product of purine catabolism? a. fumarate b. urate c. inosinate d. inosine e. xanthylate 137. What type of enzyme is RAD51 and what is its function? a. isomerase; has to make isomers of the recombination proteins b. transferase; helps to transfer a complex of proteins to damaged DNA c. ATPase; has to bind single-stranded DNA and keep it unwound d. polymerase; has to add dNTPs to synthesize a strand of DNA e. ligase; needs to join newly formed regions of DNA 138. What enzyme catalyzes the first step of pyrimidine nucleotides synthesis? a. aspartate transcarbamoylase b. carbamoyl phosphate synthetase II c. dihydroorotase d. carbamoyl phosphate synthetase I e. glutamine phosphoribosyl amidotransferase 139. What is the name of DNA isomers that have the same nucleotide sequence but a different coiling? a. topoisomers b. stereoisomers

Name:

Class:

Date:

ch 32 - 37 c. enantiomers d. cis-trans isomers e. structural isomers 140. What part of the 5′-CpG-3′ sequence is actually methylated? a. hydroxylated carbon of the cytosine base b. carbonyl carbon of the cytosine base c. one of the unsaturated carbons of the cytosine base d. 5′ carbon of deoxyribose e. carbonyl carbon of the guanine base 141. What is a symptom of xeroderma pigmentosum? a. keratoses b. pale skin of the face c. no melanin d. oily skin e. irregular melanin pattern 142. What prevents two complementary strands unwound by helicase from forming a double helix? a. DnaA proteins b. DnaB proteins c. SSB proteins d. oriC locus e. DNA polymerase 143. What is the first step of the reparation process? a. proofreading b. DNA synthesis using DNA polymerase c. cleavage of glycosidic bonds d. excision of wrong bases e. ligation of synthesized strands 144. Allopurinol is used to treat gout and is an inhibitor of the enzyme a. xanthine oxidase. b. xanthine hydrolase. c. hypoxanthine-guanine phosphoribosyltransferase. d. adenosine deaminase. e. nucleoside phosphorylase.

145. Which property of DNA makes it more stable than RNA in the basic environment? a. The negative charge of the phosphate on DNA repels the negative charged base. b. Histones block access to all except a few nucleotides that act as linkers.

Name:

Class:

Date:

ch 32 - 37 c. The 2′ –H in DNA is not reactive, whereas the 2′ –OH of RNA is reactive under basic conditions. d. DNA precipitates in basic solutions, making it unreactive. e. RNA forms elaborate structures that are susceptible to alkaline digestion.

146. In nucleotide excision repair of E. coli, AlkA: a. seals the repaired strand. b. binds with damaged DNA and cleaves the glycosidic bonds to release the damaged base. c. recognizes the AP site and nicks the backbone adjacent to the missing base. d. excises the residual deoxyribose phosphate unit. e. inserts an undamaged nucleotide, as dictated by the base on the undamaged complementary strand.

147. Which scientist provided data for Watson and Crick's model of DNA? a. Francis Collins b. Barbara McClintock c. Erwin Chargaff d. Rosalind Franklin e. Marcus Rhoades 148. Choose the temperature that corresponds to DNA annealing. a. <Tm b. >Tm c. =Tm d. 24ºC e. 48ºC 149. What part of nucleosome is crucial to the activation of transcription through remodeling of chromatin? a. histone H2B b. nucleosome core particle c. histone tails d. linker DNA e. major DNA groove 150. Why does deamination of cytosine to uracil not cause a problem in the next round of DNA replication? a. Although uracil cannot form the third hydrogen bond to guanine, it is recognized by DNA polymerase as a mismatch and the error is corrected in the next round of replication. b. AP endonuclease nicks the backbone, removes uracil, and replaces it with another cytosine nucleotide. c. The repair machinery recognizes uracil in DNA as a mistake and replaces it with a cytosine base. d. Uracil nucleotide undergoes spontaneous depurination and is replaced with cytosine. e. Deamination of cytosine rarely occurs within the coding region and so causes few mutations.

Name:

Class:

Date:

ch 32 - 37 151. Which polymerase initiates replications in eukaryotes? a. polymerase α b. polymerase δ c. polymerase I d. polymerase II e. polymerase III 152. Which statement about chromatin remodeling upon expression of genes is TRUE? a. First, TBP binds to the promoter and starts assembly of the preinitiation complex. b. HATs are attracted by coactivators to weaken the ionic bonds between the DNA backbone and histones. c. The coactivator binds to acetylated lysine residues of histones. d. The preinitiation complex can be assembled right after histones are acetylated. e. HATs are attracted by the chromatin-remodeling engines to weaken the ionic bonds between DNA bases and unwind the double helix.

153. How many allosteric sites are there in ribonucleotide reductase? a. 1 b. 2 c. 4 d. 5 e. 6 154. Processivity: a. indicates the error rate for a polymerase. b. is a deletion of one or more bases in the DNA. c. is specifically the speed of replication. d. is the ability to catalyze many consecutive reactions without releasing a substrate. e. indicates the observed rate of the lagging strand replication.

155. Thymidylate is formed from: a. dADP. b. ribonucleoside diphosphate. c. dihydrofolate. d. dUMP. e. dUDP. 156. What is the name of the reaction leading to the formation of hypoxanthine from adenine? a. halogenation b. carboxylation c. deamination d. dehydration

Name:

Class:

Date:

ch 32 - 37 e. nitrosation 157. Upon binding of a ligand: a. estrogen response elements are translocated into the nucleus. b. nuclear hormone receptors are internalized by the cell. c. nuclear receptors bind to the promoters. d. the ligand–nuclear receptor complex can bind specific response elements in the DNA. e. the receptor binds an enhancer.

158. How many nucleotides does the UvrABC enzyme excise from both ends of the damaged side of the DNA strand? a. 6 nucleotides on the 5′ side and 6 nucleotides on the 3′ side b. 5 nucleotides on the 5′ side and 7 nucleotides on the 3′ side c. 7 nucleotides on the 5′ side and 5 nucleotides on the 3′ side d. 4 nucleotides on the 5′ side and 8 nucleotides on the 3′ side e. 8 nucleotides on the 5′ side and 4 nucleotides on the 3′ side 159. Which organelle functions are disrupted by trinucleotide repeat expansion in the gene encoding frataxin? a. ribosomes b. mitochondria c. endoplasmic reticulum d. Golgi apparatus e. lysosomes 160. Why would an inhibitor of RNA polymerase II NOT cause rapid cell death, even if every molecule of RNA polymerase II were inhibited? a. Phosphorylation protects RNA polymerase II from binding of an inhibitor. b. As long as TFIID can bind, RNA polymerase II can stay bound and continue to transcribe proteins. c. There would still be many functional mRNA and viable proteins to continue cellular functions. d. TBP binding to the TATA box protects degradation of RNA polymerase II. e. Downstream core promoter elements initiate RNA polymerase activation.

161. Cisplatin is a cancer chemotherapy drug that prevents replication and transcription. How does it work? a. The platinic atom of cisplatin forms covalent bonds with carbon atoms in deoxyribose. b. Chloride ligands of cisplatin are displaced by purines on two adjacent bases. c. The molecule of cisplatin degrades phosphodiester bonds. d. Hydrogen bonds between DNA chains are degraded by cisplatin. e. Amino groups of cisplatin are displaced by pyrimidines on two opposite bases.

162. The enzyme that removes the RNA primer during DNA replication in E. coli is: a. DNA polymerase I. b. DNA polymerase II.

Name:

Class:

Date:

ch 32 - 37 c. DNA polymerase III. d. DNA polymerase IV. e. DNA polymerase V. 163. The activity of which enzyme that regulates transcription is linked to intermediary metabolism through ATP-citrate lyase? a. histone acetyltransferase (HAT) b. helicase c. RNA polymerase d. histone deacetylase e. methyltransferase 164. What would be the effect of the increased length of the double-stranded DNA on Tm? a. Tm would be about 0ºC. b. Tm would not change. c. Tm would decrease. d. Tm would increase. e. It is difficult to predict.

165. Which amino acid side chain in thymidylate synthase activates the ring of dUMP, making C-5 a good nucleophile? a. cysteine b. aspartate c. glutamine d. tyrosine e. serine 166. How much ATP will be required for the de novo synthesis of one molecule of ATP (starting from PRPP) and for synthesis in the salvage pathway (not accounting for the synthesis of PRPP)? a. 5 in the de novo pathway; 1 in the salvage pathway b. 5 in the de novo pathway; 0 in the salvage pathway c. 6 in the de novo pathway; 1 in the salvage pathway d. 6 in the de novo pathway; 0 in the salvage pathway e. 10 in the de novo pathway; 2 in the salvage pathway 167. The step-by-step addition of deoxyribonucleotides to a DNA strand is catalyzed by: a. topoisomerases. b. helicase. c. polymerases. d. gyrase. e. endonuclease.

Name:

Class:

Date:

ch 32 - 37 168. 3′-to-5′ exonuclease activity of DNA polymerase III of E.coli: a. cleaves a short nucleotide sequence from the recognition site near the 5′ end of DNA. b. cleaves a short nucleotide sequence from the recognition site near the 3′ end of DNA. c. removes mismatched nucleotides from both 3′ and 5′ ends of DNA. d. removes mismatched nucleotides from the 5′ end of DNA. e. replaces mismatched nucleotides from the 3′ end of DNA. 169. Choose the CORRECT components of a nucleosome. a. H2A-H2B dimer, (H3)2(H4)2 tetramer, 200-bp DNA, linker DNA b. (H2A)2-(H2B)2 tetramer, H3-H4 dimer, 200-bp DNA, linker DNA c. H2A-H2B dimer, (H3)2(H4)2 tetramer, 145-bp DNA, linker DNA d. H2A-H2B dimer, H3-H4 dimer, 100 bp DNA, linker DNA e. H2A-H2B dimer, (H3)2(H4)2 tetramer, 145-bp DNA 170. What proteins in eukaryotes bind to the origin of replication to form the DNA synthesis initiation complex? a. replicon b. licensing factors c. Okazaki fragments d. DnaA proteins e. DnaB proteins 171. What is the committed step in purine nucleotide biosynthesis? a. carboxylation of glycinamide ribonucleotide b. formation of phosphoribosylamine c. formation of fumarate d. decarboxylation of orotidylate e. formation of orotate 172. Suppose you have a cell culture that is capable of de novo synthesis of pyrimidine nucleotides but needs purine nucleotides for survival due to a lack of the required enzymes. What would happen if you supply the culture with excessive amounts of UMP and GMP? a. Excessive GMP would strongly inhibit amidotransferase by feedback inhibition. Excessive UMP would inhibit the formation of ATP. b. Excessive UMP would strongly inhibit ATCase by feedback inhibition. Excessive GMP would inhibit the formation of ATP. c. Excessive GMP would stimulate the synthesis of IMP, but excessive UMP would inhibit its formation. d. Excessive UMP would strongly inhibit ATCase due to feedback inhibition by CTP. Excessive GMP would inhibit the formation of IMP, which could halt cell division. e. Excessive UMP and GMP would completely halt the activity of aspartate transcarbamoylase due to

Name:

Class:

Date:

ch 32 - 37 feedback inhibition by GTP. 173. What statement about salvage pathways of nucleotide synthesis is TRUE? a. Hypoxanthine–guanine phosphoribosyltransferase (HGPRT) recycles guanine and adenine only through the formation of inosinate. b. TMP can be produced from thymidine by degradation. c. HGPRT recognizes only guanine and adenine as substrates, while PRPP is its cosubstrate. d. Phosphorylation of uridine results in formation of uridinylate. e. Thymidylate synthase produces thymidylate from thymine.

174. Which statement about assembly of the preinitiation complex is FALSE? a. First, there is binding of TBP to the TATA box. b. Factors TFIIA and TFIIB bind to TFIID. c. RNA polymerase is recruited by TFIID. d. The factor TFIIE binds to the complex after TFIIF. e. The helicase TFIIH is the last one to bind to the complex.

175. Coactivators mediate expression by: a. blocking RNA polymerase binding. b. loosening the bonding of the histone complex with DNA. c. inhibiting intron splicing. d. blocking binding of transcription factors. e. dephosphorylating the CTD domain.

176. Which statement about regulation of gene expression is FALSE? a. Hypomethylated regions of DNA can't be hypersensitive to DNase I. b. Most of the mammalian genes can be regulated through the CpG islands. c. Hypersensitivity to DNase I is associated with the action of chromatin-remodeling engines. d. Acetylated histones should be present in the sites hypersensitive to DNase I. e. Hypermethylated regions of DNA are not prone to cleavage by DNase I. 177. An assay used to determine carcinogenic potential is the a. Huntington disease b. mutagen c. photolyase d. Ames e. direct repair 178. What enzyme of nucleotide biosynthesis is bifunctional? a. PRPP synthetase b. oroate phosphoribosyltransferase c. TMP synthase

test.

Name:

Class:

Date:

ch 32 - 37 d. UMP synthase e. orotidylate decarboxylase 179. What metabolite is required for the synthesis of both purine and pyrimidine nucleotides? a. glycine b. tetrahydrofolate c. orotate d. urea e. 5-phosphoribosyl-1-pyrophosphate 180. What is formed by cytochrome P450 upon conversion of aflatoxin B1?

a. hypoxanthine b. polycyclic aromatic hydrocarbons c. reactive epoxide d. 8-oxoguanine e. thymine dimer 181. What is the complex of enzymes that synthesizes purine nucleotides? a. peroxisome b. endosome c. purinosome d. GFP complex e. purinergic receptor 182. Some forms of severe combined immunodeficiency (SCID) result from: a. the inability to form inosine by deamination of adenosine. b. bone marrow transplantation. c. reduced production of dATP. d. the inability to remove ribose from ribonucleoside. e. the inability to remove deoxyribose from deoxyribonucleoside.

Name:

Class:

Date:

ch 32 - 37 183. What intermediate in pyrimidine synthesis will accumulate if a strain of bacteria is lacking in aspartate? a. orotidylate b. orotate c. dihydroorotate d. 5-phosphoribosyl-1-amine e. carbamoyl phosphate 184. What is the name of the site of DNA synthesis in prokaryotes? a. origin of replication b. replicon c. prepriming complex d. replication fork e. Okazaki fragment 185. What is the compound that can act as a suicide inhibitor? a. thymine b. fluorodeoxyuridylate c. trimethoprim d. aminopterin e. adenylosuccinate 186. What enzyme forms deoxyribonucleotides from ribonucleotides? a. thymidine phosphorylase b. UMP kinase c. nucleoside diphosphate kinase d. ribonucleotide reductase e. AMP kinase 187. Which compounds are distinguished from each other by the presence of a methyl group? a. uracil and cytosine b. adenine and guanine c. uracil and thymine d. pyrimidine and cytosine e. purine and guanine 188. How many chromosomes does the human genome include? a. 22 autosomal chromosomes and 2 sex chromosomes b. 22 pairs of autosomal chromosomes and 2 sex chromosomes c. 46 pairs of autosomal chromosomes and 2 sex chromosomes d. 46 autosomal and 4 sex chromosomes e. 23 pairs of autosomal chromosomes and 1 sex chromosome

Name:

Class:

Date:

ch 32 - 37 189. What is critical during telomerase complex organization? a. prepriming complex b. polymerase activity c. double helix d. oriC locus e. G-rich strand 190. Ultraviolet light: a. is able to modify adenine to form hypoxanthine. b. adds a hydrocarbon molecule to nucleotide bases. c. promotes the formation of cross-links between adjacent pyrimidines along one DNA strand. d. converts a G-C base pair into a T-A base pair in a reaction of DNA with aflatoxin B1 epoxide. e. promotes the formation of single- and double-stranded breaks in DNA. 191. What is the reason for the presence of major and minor grooves in the B-DNA form? a. Water solution favors the presence of grooves. b. It is energetically favorable to have such a structure for the DNA molecule. c. Hydrogen bonds between complementary base pairs have a different length. d. Glycosidic bonds of a base pair are not diametrically opposite each other. e. The grooves are essential for the formation of the Z-DNA form.

192. How is the melting temperature of a double-stranded DNA defined? a. It's a temperature at which a double-stranded DNA is denatured to a single-stranded DNA. b. It's a temperature at which half of the helical structures are lost. c. It's a temperature at which stacking interactions are lost. d. The temperature is equal to 70ºC. e. It's a temperature of the boiling solution.

193. Choose the molecule that serves to stop replication of DNA. a. polymerase b. DnaA protein c. DnaB protein d. DNA ligase e. Tus protein 194. Amino acid residues that compose the tail of each histone in a nucleosome are: a. Lys and Ala. b. Ala and Asn. c. Lys and Asp. d. Lys and Arg.

Name:

Class:

Date:

ch 32 - 37 e. Arg and Ala. 195. What position would be labeled in newly synthesized nucleotides if the reaction were done in the presence of [15N]aspartate? a. N3 in IMP b. N7 in IMP c. N9 in IMP d. N1 in UTP e. N3 in UTP 196. What is the role of glycine in nucleotide biosynthesis? a. It finishes the formation of the pyrimidine ring, bringing two carbon atoms and one nitrogen atom. b. It starts the formation of the imidazole ring by bringing two carbon atoms and one nitrogen atom. c. Its α-amino group allows amination of the carbonyl group of formylglycinamide ribonucleotide. d. It starts the formation of the pyrimidine ring, bringing two nitrogen atoms and one carbon atom. e. It finishes the formation of the imidazole ring by bringing three carbon and three nitrogen atoms.

197. The difference in RNA bases compared with DNA bases is that RNA contains: a. A instead of T. b. U instead of G. c. U instead of T. d. A instead of U. e. C instead of G. 198. Choose the CORRECT consensus sequence of the given TATA boxes. Account only for 7 bases starting with the first T of the box. The subscripts in the answer options denote the frequency (%) of the base at the corresponding position.

1 2 3 4 5

GGGCTATAATACGCCACCTA GAGCTATAATGCTAGCGTCA GAGGTATAGAGCAGGGTTCA CGACTATAAAAGGGGTCTAA TCGGTATAAAGGTGAACAGA a. T100A100T100A100G20A60A40 b. T100A100T100A100A80A60A40 c. T100A100T100A100A90A60G60 d. T100A100T100A100A80A60G60 e. T100A100T100A100A80T50G40

199.

act in the formation of 8-oxoguanine.

Name:

Class:

ch 32 - 37 a. Guanosine triphosphate and ozone b. Guanosine and atomic oxygen c. Indole and hydroxyl radical d. Guanine and hydrogen peroxide e. Guanine and hydroxyl radical 200. Which form of DNA is possible as well as the linear form? a. supercoiled b. circular c. stem loop d. B-DNA e. A-DNA 201. Name these forms of DNA in numerical order 1-2-3.

a. A-Z-B b. Z-A-B c. Z-B-A d. A-B-Z e. B-A-Z 202. The defect in activity of this enzyme causes Werner syndrome. a. endonuclease b. gyrase c. primase d. helicase e. DNA polymerase II 203. DNA replication in E. coli starts with the binding of DnaA protein to:

Date:

Name:

Class:

Date:

ch 32 - 37 a. prepriming complex. b. replicon. c. oriC locus. d. primase. e. primosome.

204. What is the actual mode of replication in the cell? a. conservative b. random c. semiconservative d. N-linked e. direct 205. Sulfa drugs are analogs of p-aminobenzoate, a compound necessary for the biosynthesis of N10formyltetrahydrofolate. How should these drugs act upon bacterial infections and why are humans not susceptible? a. N10-Formyltetrahydrofolate is a ferredoxin analog and a potent inhibitor of ribonucleotide reductase in bacteria but not humans. b. N10-Formyltetrahydrofolate is a ferredoxin analog and a potent inhibitor of ribonucleotide reductase, but humans consume sufficient quantities of ferredoxin in their diet to saturate reductase. c. N10-Formyltetrahydrofolate is an NADPH analog and a potent inhibitor of ribonucleotide reductase in bacteria but not humans. d. N10-Formyltetrahydrofolate transfers a formyl group twice during de novo synthesis of the purine ring. Bacteria dihydrofolate reductase is blocked by sulfa drugs, whereas the human enzyme is not. e. N10-Formyltetrahydrofolate transfers a formyl group twice during de novo synthesis of the purine ring. Bacteria synthesize their own folate, whereas humans get theirs from eating green plants.

206. What disease is caused by a mutation in two genes of the DNA mismatch repair system (namely, hMSH2 and hMLH1)? a. xeroderma pigmentosum b. Huntington disease c. Lynch syndrome d. Friedreich ataxia e. skin cancer 207. What enzymes of nucleotide synthesis are translated as one polypeptide chain? a. CPS II, aspartate transcarbamoylase, and dihydroorotase b. CPS II, glutamine-PRPP amidotransferase, and dihydrofolate reductase c. CPS II, adenine phosphoribosyltransferase, and dihydroorotase d. CPS I, ATCase, and dihydrofolate reductase e. CPS II, adenine phosphoribosyltransferase, and ribonucleotide reductase

Name:

Class:

Date:

ch 32 - 37 208. Choose the CORRECT fact about RNA. a. branched polymer consisting of nucleotides A, G, U, C; the sugar is fructose b. unbranched polymer consisting of nucleotides A, G, C, T; the sugar is deoxyribose c. unbranched polymer consisting of nucleotides A, G, C, U; the sugar is ribose d. unbranched polymer consisting of nucleotides A, G, C, U; the sugar is deoxyribose e. unbranched polymer consisting of nucleotides A, G, C, T; the sugar is glucose 209. Why is the action of nuclear receptors so different from membrane-bound receptors? a. Membrane-bound receptors have no influence on nuclear proteins. b. Nuclear receptors activate transcription factors via methylation reactions, not phosphorylation. c. Membrane-bound receptors activate or inhibit enzymes and do not regulate transcription. d. Nuclear receptors bind steroids, which can cross the cellular membrane; thus, specificity of action resides in the cytoplasm. e. Membrane-bound receptors bind carbohydrate moieties, whereas nuclear receptors bind prostaglandin hormones.

210. What was shown by the existence of Z-DNA? a. DNA is a long molecule. b. DNA comprises four nitrogen bases. c. DNA has a double-helix structure. d. DNA chains are polar. e. DNA is a flexible molecule.

211. What was known about DNA by the 1950s? a. DNA is composed of four nitrogen bases. b. The structure of DNA is a double helix. c. There are certain principles of DNA replication. d. There are different enzymes that take part in DNA transcription. e. The stacked bases interact with van der Waals forces.

212. What is the distinctive feature of the promoters for RNA polymerase III? a. location downstream of the start site within the transcribed sequence b. location within the TATA box c. location upstream of the start site within the transcribed sequence d. possession of the TATA box e. very distant location upstream of the start site Indicate one or more answer choices that best complete the statement or answer the question.

213. Which factor causes double-strand breaks in DNA? Select all that apply. a. aflatoxin B1

Name:

Class:

Date:

ch 32 - 37 b. infrared radiation c. X-rays d. γ rays e. ionizing radiation 214. Select all that apply. Sliding DNA clamps: a. require clamp loaders. b. form a ring around the front of the fork of DNA. c. allow the polymerase to move along the DNA molecule without falling off. d. increase DNA polymerase processivity. e. are helicases.

215. Select all that apply. Pluripotent cells: a. are stem cells. b. can develop into any adult cell. c. can develop into any fetal cell. d. can develop into extraembryonic tissues. e. can grow into an entire organism.

216. What are the reasons for having multiple proteins in DNA replication rather than just DNA polymerase?

Select all that apply. a. It just has randomly happened in the course of evolution. b. DNA polymerase cannot correct mistakes, so other proteins do that. c. DNA polymerase requires a primer to start synthesis. d. The polymerase cannot by itself separate strands of such a stable molecule as DNA. e. Other proteins transfer nucleotides to the polymerase.

217. Select all that apply. Unwinding prior to ligation results in: a. a relaxed DNA. b. a narrowing of a major groove. c. negative supercoiling. d. positive supercoiling. e. restrictase activity.

218. Which statements reflect the Watson–Crick model of DNA? Select all that apply. a. Two helical DNA strands are coiled around a common axis, forming a right-handed double helix. b. The diameter of the helix is 30 Å. c. The purine and pyrimidine bases lie outside of the helix. d. The sugar–phosphate backbone lies outside of the helix. e. The strands of DNA run in the same direction.

219. Choose CORRECT statements about E. coli DNA polymerases. Select all that apply.

Name:

Class:

Date:

ch 32 - 37 a. There are five structural classes. b. All have finger and thumb domains that wrap around the DNA. c. All catalyze the same reaction, which requires a metal ion cofactor. d. Only some of them require a primer. e. All of them possess exonuclease activity.

220. How does acetylation of histones influence transcription? Select all that apply. a. decreasing affinity of histones to DNA b. increasing affinity of histones to DNA c. recruiting TBP-associated factors (TAFs) d. initiating dense packaging of chromatin e. recruiting chromatin-remodeling engines 221. Select all that apply. In E. coli, mismatch repair involves: a. recognition of a mismatched pair by MutS. b. removal of a mismatched nucleotide by DNA polymerase III. c. cleavage of the backbone by MutH. d. binding of RAD51 to single-stranded DNA. e. synthesis of new DNA by polymerase III. 222. Select all that apply. When phosphorylated, the carboxyl-terminal domain of RNA polymerase II: a. is insensitive to α-amanitin. b. enhances transcription. c. recruits other factors. d. transcribes ribosomal RNA. e. inhibits transcription.

223. Select all that apply. Combinatorial control is exploited by eukaryotes to: a. adjust the high strength of eukaryotic promoters. b. determine cell specificity. c. adjust the probability of transcription initiation. d. contribute to the developmental stage. e. account for the space separation of transcription and translation.

224. What are the most common forms of DNA present under physiological conditions? Select all that apply. a. left-handed double helix b. Z form c. right-handed double helix d. A form e. B form 225. What enzymes are sites of feedback inhibition of nucleotide biosynthesis in bacteria? Select all that apply.

Name:

Class:

Date:

ch 32 - 37 a. thymidine kinase b. carbamoyl phosphate synthetase c. glutamine phosphoribosyl amidotransferase d. nucleoside diphosphate kinase e. aspartate transcarbamoylase 226. Hypothetical protein X can specifically bind acetylated H3K9 residue. Which protein that it can recruit and their effects on transcription are TRUE? Select all that apply. a. specific methylase, which would activate the transcription by monomethylation of H3K4 b. deacetylase, which would activate the transcription c. other chromatin-remodeling proteins to activate the transcription d. coactivator; to activate the transcription e. corepressor; to repress the transcription 227. Select all that apply. The promoter for RNA polymerase I can contain: a. ribosomal initiator (rInr). b. downstream promoter element (DPE). c. initiator element (Inr). d. TATA box. e. upstream promoter element (UPE).

228. What individual reactions are catalyzed by carbamoyl phosphate synthetase II? Select all that apply. a. hydrolysis of carbamoyl phosphate b. cleavage of the amide bond of glutamine c. transfer of the phosphate group from ATP to bicarbonate d. phosphorylation of carbamic acid e. phosphorylation of glutamate 229. Choose reactions that always require hydrolysis of ATP. Select all that apply. a. formation of the phosphodiester linkage by DNA polymerase I b. unwinding of DNA strands by helicase c. formation of the phosphodiester linkage by DNA ligase d. sliding along template strands e. unwinding of DNA strands by β2 subunits 230. What compounds are precursors in the de novo synthesis of the purine ring? Select all that apply. a. bicarbonate b. Gln c. ribose d. Asp e. ammonia

Name:

Class:

Date:

ch 32 - 37 231. Select all that apply. Polymerase I of E. coli has: a. a 3′ → 5′ exonuclease site. b. a 5′ → 3′ exonuclease site. c. an oriC locus binding site. d. primase activity. e. a magnesium binding site.

232. Select all that apply. The Klenow fragment: a. has primase activity. b. is an E. coli DNA polymerase fragment. c. has exonuclease activity. d. is RNA-dependent DNA polymerase. e. has polymerase activity.

233. What are the pathway types for nucleotide biosynthesis? Select all that apply. a. anaplerotic b. in vitro c. salvage d. de novo e. allosteric 234. Binding of could be the most affected process with a mutation of cysteine residues of the nuclear estradiol receptor. Select all that apply. a. Zn2+ b. DNA c. estradiol d. a corepressor e. coactivators 235. What carriers of electrons are necessary for the transformation of ribonucleotides into deoxyribonucleotides? Select all that apply. a. NADPH b. NADH c. FADH2 d. NAD+ e. thioredoxin 236. How is replication specificity dictated? Select all that apply. a. Watson–Crick hydrogen bonding must occur. b. Enzyme interactions with the DNA act as a "ruler" to determine whether the properly spaced base pair has been formed.

Name:

Class:

Date:

ch 32 - 37 c. The bond is broken and reformed to ensure its accurate placement at each base pair. d. Binding of SSB proteins ensures specific action of DNA polymerase. e. The form of the pocket inside DNA polymerase dictates its specificity.

237. What is the role of DNA winding around the nucleosome? Select all that apply. a. Temporarily, noncoding DNA has to be packed. b. Histones in nucleosomes are temporary structures and have to be kept together only during DNA replication. c. It is essential not to let histones disassemble during DNA replication. d. The formed structure defends histones from bacteria. e. This DNA is packed by decreasing its linear extent.

238. What compounds are precursors in the de novo synthesis of the pyrimidine ring? Select all that apply. a. bicarbonate b. aspartic acid c. GTP d. Gly e. ammonia 239. Select all that apply. Inosinate can be converted to: a. AMP. b. GMP. c. UMP. d. TMP. e. ADP. 240. Select all that apply. The promoter for RNA polymerase II can contain: a. ribosomal initiator (rInr). b. downstream promoter element (DPE). c. initiator element (Inr). d. TATA box. e. upstream promoter element (UPE).

241. What structure can be formed from a single-stranded DNA or from a single-stranded RNA? Select all that apply. a. clover leaf b. double loop c. helix-turn-helix d. helix-loop-helix e. stem-loop 242. Choose the reactions of nucleotide biosynthesis pathways that represent reciprocal substrate relations.

Name:

Class:

Date:

ch 32 - 37 Select all that apply. a. stimulation of aspartate transcarbamoylase by ATP b. formation of CTP by amination of UTP c. hydrolysis of ATP in the synthesis of GMP d. inhibition of aspartate transcarbamoylase by ATP e. hydrolysis of GTP in the synthesis of ADP 243. What do eukaryotes exploit to regulate gene expression? Select all that apply. a. intensive translation b. extensive mRNA processing c. complex transcription d. complex replication e. compartmentalization 244. What are the roles of nucleotides? Select all that apply. a. They are activated precursors of the nucleic acid. b. They can serve as the energy currency. c. They contain genes. d. They are signal molecules. e. They can activate biosynthetic metabolites.

245. Select all that apply. Symptoms of Huntington disease are: a. polydipsia. b. uncontrolled movements. c. loss of cognitive facilities. d. enamel hypoplasia. e. personality alterations.

Enter the appropriate word(s) to complete the statement.

246. Hypoxanthine-guanine phosphoribosyltransferase catalyzes the formation of guanylate and

.

247. Well-defined and complex structures allow _ and single-stranded DNA to perform a host of functions that the double-stranded DNA molecule cannot.

248. Polymerase III is a dimeric direction with each strand.

, and the lagging strand allows the enzyme to proceed in the same

249. Excision of an adenine or guanine base while the sugar-phosphate backbone is still intact results in formation of a(n) _, or AP, site.

250. When a steroid hormone receptor binds a ligand, it does not change the binding of a receptor to DNA but to the .

Name:

ch 32 - 37 Answer Key 1. c 2. c 3. b 4. e 5. e 6. e 7. b 8. d 9. c 10. c 11. c 12. a 13. b 14. b 15. e 16. b 17. e 18. c 19. d 20. d 21. a 22. e 23. d 24. d

Class:

Date:

Name:

ch 32 - 37 25. c 26. d 27. c 28. b 29. e 30. b 31. e 32. b 33. e 34. c 35. a 36. c 37. a 38. c 39. b 40. e 41. a 42. c 43. d 44. b 45. d 46. e 47. e 48. e 49. b

Class:

Date:

Name:

ch 32 - 37 50. b 51. b 52. e 53. a 54. e 55. a 56. b 57. b 58. a 59. a 60. b 61. b 62. e 63. a 64. d 65. d 66. d 67. b 68. e 69. a 70. e 71. b 72. d 73. a 74. c

Class:

Date:

Name:

ch 32 - 37 75. e 76. c 77. a 78. d 79. c 80. e 81. b 82. e 83. b 84. b 85. e 86. e 87. e 88. d 89. d 90. b 91. c 92. b 93. b 94. c 95. e 96. c 97. e 98. c 99. a

Class:

Date:

Name:

ch 32 - 37 100. c 101. a 102. c 103. d 104. a 105. c 106. a 107. a 108. d 109. d 110. b 111. b 112. c 113. a 114. c 115. a 116. b 117. c 118. d 119. c 120. d 121. b 122. c 123. e 124. a

Class:

Date:

Name:

ch 32 - 37 125. b 126. c 127. b 128. b 129. c 130. c 131. d 132. a 133. b 134. e 135. e 136. b 137. c 138. b 139. a 140. c 141. a 142. c 143. a 144. a 145. c 146. b 147. d 148. a 149. c

Class:

Date:

Name:

ch 32 - 37 150. c 151. a 152. b 153. c 154. d 155. d 156. c 157. d 158. e 159. b 160. c 161. b 162. a 163. a 164. d 165. a 166. a 167. c 168. a 169. a 170. b 171. b 172. d 173. d 174. c

Class:

Date:

Name:

ch 32 - 37 175. b 176. a 177. d 178. d 179. e 180. c 181. c 182. a 183. e 184. d 185. b 186. d 187. c 188. b 189. e 190. c 191. d 192. b 193. e 194. d 195. d 196. b 197. c 198. d 199. e

Class:

Date:

Name:

ch 32 - 37 200. b 201. d 202. d 203. c 204. c 205. e 206. c 207. a 208. c 209. d 210. e 211. a 212. a 213. c, d, e 214. a, b, c, d 215. a, b, c 216. c, d 217. b, c 218. a, d 219. a, b, c 220. a, c, e 221. a, c 222. b, c 223. b, c, d 224. c, e

Class:

Date:

Name:

ch 32 - 37 225. b, c, e 226. a, c, d 227. a, e 228. b, c, d 229. b, c, d 230. b, d, e 231. a, b, e 232. b, c, e 233. c, d 234. a, b, d 235. a, c, e 236. a, b, e 237. a, e 238. a, b, e 239. a, b 240. b, c, d 241. a, e 242. a, c 243. b, c, e 244. a, b, d, e 245. b, c, e 246. inosinate 247. RNA 248. holoenzyme 249. apurinic

Class:

Date:

Name:

ch 32 - 37 250. coactivator

Class:

Date:

Name:

Class:

Date:

ch 38 - 41 Indicate the answer choice that best completes the statement or answers the question.

1. What prevents the aminoacyl-AMP intermediate from leaving the active site of the aminoacyl-tRNA synthetase? a. covalent bond with catalytic aspartate of the active site b. noncovalent interactions with the site c. noncovalent interactions with the CCA terminus of tRNA d. hydrolysis of the pyrophosphate e. covalent bond with a metal ion 2. What parts of tRNA are mostly recognized by the synthetase? a. anticodon loop and acceptor stem b. anticodon loop and DHU loop c. acceptor stem and CCA terminus d. CCA terminus and anticodon loop e. Tψc loop and DHU loop 3. What order of steps of the polymerase chain reaction cycle is CORRECT? a. annealing → denaturation → elongation b. elongation → annealing → denaturation c. separation → denaturation → annealing d. denaturation → annealing → elongation e. separation → hybridization → annealing 4. What would MORE likely yield a more optimal oligonucleotide probe, one with tryptophan and methionine or one with serine and leucine? a. It is impossible to predict the optimal nucleotide sequence, which is why poly-U nucleotides are generally used. b. The amino acids coded by codons, where all three positions can be the same nucleotide, generate the optimal oligonucleotide; therefore, serine and leucine. c. The amino acids coded by codons, where the first two positions are the same, generate the optimal oligonucleotide; therefore, serine and leucine. d. The amino acids with the least number of codons would not provide enough variation for all necessary oligonucleotides; therefore, leucine and serine. e. The amino acids with the least number of codons would require the fewest number of nucleotide probes; therefore, tryptophan and methionine.

5. Choose the initiating codon in bacterial mRNA and an amino acid that is encoded by it. a. threonine; ACG b. serine; UCG c. methionine; UAA d. methionine; AUG e. tryptophan; UGG

Name:

Class:

Date:

ch 38 - 41 6. Mutations in eukaryotic white (shown with arrows).

cause white matter replacement by cerebrospinal fluid, seen in the image in

a. eIF1 b. eIF2 c. eIF-4E d. EF1α e. EF1βγ 7. What is an amino acid ester of tRNA called? a. aminoacyl-tRNA b. acetyl-tRNA c. aminoacyl adenylate d. succinyl-tRNA e. acetoacetyl-tRNA 8. Which statement about PCR is TRUE? a. Knowledge of the full sequence of the target gene is a prerequisite for the reaction. b. High hybridization temperature is the only factor influencing PCR stringency. c. A single target molecule of appropriate length is enough for PCR to proceed. d. To date, the maximal length of the target sequence is limited to 1 kb. e. The exact sequence of the target gene needs to be known to synthesize exactly matching primers.

9. What nucleoside in tRNA is formed by deamination of adenosine after synthesis of the primary transcript? a. thymine b. inosine c. adenine d. adenosine e. guanine

Name:

Class:

Date:

ch 38 - 41 10. What processes are closely coupled in space and time in prokaryotes? a. translation and initiation b. transcription and termination c. transcription and translation d. initiation and termination e. transcription and translocation 11. Choose the CORRECT sequence of the first three acts of the SRP targeting cycle. a. Protein synthesis begins on free ribosomes → after the signal sequence has exited the ribosome, it is bound by SRP; protein synthesis halts → SRP–ribosome complex docks with the ER membrane. b. Protein synthesis begins on free ribosomes → SRP–ribosome complex docks with the ER membrane → the ribosome is released; protein tunnel in the translocon closes. c. After the signal sequence has exited the ribosome, it is bound by SRP → SRP and the SRP receptor hydrolyze bound GTPs → protein is synthesized into ER. d. SRP and the SRP receptor hydrolyze bound GTPs → SRP is free to bind another signal sequence → protein is synthesized into ER. e. The ribosome–nascent polypeptide is transferred to the translocon → the signal peptidase removes the signal sequence as it enters the lumen of ER → the ribosome is released; protein tunnel in the translocon closes.

12. What interaction allows snRNPs of the spliceosome to bind the pre-mRNA strand? a. electrostatic attraction between phosphoryl groups of the pre-mRNA and two magnesium ions in the catalytic center b. hydrophobic interaction between phosphoryl groups of the pre-mRNA and two magnesium ions in the catalytic center c. van der Waals interaction between pre-mRNA and amino acids of snRNPs d. hydrogen bonding between pre-mRNA and amino acids of snRNPs e. base-pairing between pre-mRNA and complimentary sequences of snRNAs 13. Which statement about alternative splicing is FALSE? a. Alternative splicing is a widespread mechanism for generating protein diversity. b. Selection of specific splicing sites is determined by the binding of trans-acting splicing factors to cisacting sequences in pre-mRNA. c. Mutations that affect alternative splicing cause diseases such as thalassemia. d. Current estimates are that more than 70% of human genes that encode proteins are alternatively spliced. e. Different combinations of exons in the same gene may be spliced into a mature RNA, producing distinct forms of a protein.

14. Which statement about splicing is FALSE? a. The splicing reaction is completed by the release of excised circular intron from the spliceosome. b. RNA molecules play key roles in directing the alignment of splice sites. c. RNA molecules play key roles in catalysis of the transesterification reactions.

Name:

Class:

Date:

ch 38 - 41 d. ATP-powered RNA helicases must unwind RNA helices and allow alternative base-pairing arrangements to form. e. Both transesterification reactions are promoted by a pair of bound magnesium ions.

15. Which statement about protein synthesis in eukaryotes is FALSE? a. Eukaryotic ribosomes consist of a 60S large subunit and a 40S small subunit. b. In eukaryotes, pre-mRNA must be processed more in comparison to prokaryotic pre-mRNA. c. Eukaryotic mRNA has multiple start sites. d. In eukaryotes, an amino acid that participates in initiation is methionine. e. Termination in eukaryotes is carried out by a single release factor named eRF1.

16. How many ribonucleotides does a transfer RNA molecule contain? a. between 33 and 53 b. between 53 and 73 c. between 73 and 93 d. between 73 and 83 e. between 93 and 103 17. Proteins that possess alternative splicing products include: a. antibodies. b. hemoglobin β. c. apolipoprotein. d. RNA polymerase. e. CPSF endonuclease.

18. The sequence that interacts with a complementary sequence on the 3′ end of the 16S rRNA is: a. ATP b. ricin c. Shine–Dalgarno d. kanamycin e. N-formylmethionine 19. Where does the interaction of the polymerase with the ribosome occur? a. carbonyl-terminal domain of the polymerase b. hydroxyl-terminal domain of the polymerase c. carboxyl-terminal domain of the polymerase d. acetyl-terminal domain of the polymerase e. acetoacetyl-terminal domain of the polymerase 20. What is the CORRECT sequence of eukaryotic pre-rRNA processing? a. cleavage → association with snoRNPs → modification of nucleotides → assembly with ribosomal proteins

Name:

Class:

Date:

ch 38 - 41 b. association with snoRNPs → modification of nucleotides → assembly with ribosomal proteins → cleavage c. association with snoRNPs → modification of nucleotides → cleavage → assembly with ribosomal proteins d. assembly with ribosomal proteins → modification of nucleotides → association with snoRNPs → cleavage e. cleavage → assembly with ribosomal proteins → association with snoRNPs → modification of nucleotides 21. Which statement about cloning with retroviruses is TRUE? a. The double-DNA genome of retroviruses has to be produced by reverse transcriptase and in this form to be incorporated into host DNA. b. A proviral genome version needs to be injected into the cell rather than the whole virion. c. The striking feature of the retroviral lifecycle is host genome editing. d. The insertion of the viral genome into the host cell is done in a highly specific manner. e. Reverse transcription of retroviral guide RNA allows insertion of the viral genome into the host genome.

22. What is the transcribing and translating complex consisting of RNA polymerase and the 60S ribosome called? a. polysome b. expressome c. multiple ribosome d. autosome e. monosome 23. Even if the protein synthesis machinery in the ribosomes is flawless, could there be other pitfalls in the formation of a biologically active protein? Why? a. Yes, a defect in the signal-recognition particle fails to recognize the termination signal. b. Yes, a defect in the signal-recognition particle fails to recognize the signal sequence. c. Yes, the splicing mechanism of the 18S rRNA is defective, so proteins are not spliced properly. d. No, proper protein folding is driven by hydrophobic interactions. e. No, protein tertiary structure is determined by the primary structure.

24. The small subunit of a eukaryotic ribosome contains: a. 5.8S RNA. b. 5S RNA. c. 18S RNA. d. 28S RNA. e. snRNA. 25. Choose a pair of homologous RNA of prokaryotes and eukaryotes, respectively. a. 23S and 18S

Name:

Class:

Date:

ch 38 - 41 b. 16S and 28S c. 5S and 5.8S d. 3′ end of 23S and 5S e. 5′ end of 23S and 5.8S 26. RNA self-splicing demonstrates the role of RNA as a(n): a. intron. b. exon. c. spliceosome. d. nucleophile. e. catalyst.

27. DNA degradation from resrictase in a specific site would be prevented by the: a. two-fold rotational symmetry. b. DNA sequence larger than 20 kb. c. circular DNA sequence. d. blunt ends of the DNA sequence. e. methylated cytosine base.

28. Aminoacyl-tRNA synthetase will incorporate the incorrect amino acid only once in: a. 102 or 103 reactions. b. 104 or 105 reactions. c. 105 or 106 reactions. d. 107 or 108 reactions. e. 109 or 1010 reactions.

29. Which of the reactions from the scheme (marked with numbers) has the highest initial number of gene copies and why?

a. the first reaction because it has lower CT b. the fifth reaction because it has higher CT c. the first reaction because 2n is the biggest

Name:

Class:

Date:

ch 38 - 41 d. the fifth reaction because 2n is the biggest e. the fourth reaction due to optimal CT (about 24) 30. What happens with the A and E sites when fMet-tRNA occupies the P site? a. The stop codon is in the A site; E is empty. b. EF-Tu binds aminoacyl-tRNA in the A site; E is empty. c. The A site is empty; E is occupied by a polypeptide. d. Aminoacyl-tRNA is in the A site; E is empty. e. The A and E sites are empty.

31. What event changes a codon for glutamine (CAA) to a stop codon (UAA) in the mRNA of apolipoprotein B-100? a. methylation b. amination c. deamination d. hydration e. dehydration 32. Which genome-editing machinery can insert a required sequence into the genome? a. ZFN fused to the restriction endonuclease b. TALEN fused to the restriction endonuclease c. CRISPR/Cas9 system d. two ZFN- or TALEN-fused restriction endonucleases e. None of the given machineries can do that.

33. Why do bacteria, unlike eukaryotes, have multiple start sites? a. Generally, bacterial mRNA has multiple Shine–Dalgarno sequences. b. Bacterial start sites have mutations, so they have one more Shine–Dalgarno sequence. c. Topology of cyclic bacterial mRNA requires conditions to favor the start of translation. d. The preinitiation complex of bacteria recognizes only multiple translation sites. e. Bacteria do not have the 5′ end of mRNA capped.

34. Diseases caused by mutations in splicing factors include: a. hemophilia A. b. thalassemia. c. retinitis pigmentosa. d. cystic fibrosis. e. spinal muscle atrophy.

35. Which method can amplify DNA sequences? a. controlled termination of replication

Name:

Class:

Date:

ch 38 - 41 b. polymerase chain reaction c. screening of the expression vectors d. constructing a plasmid e. polymerase cloning reaction 36. Suppose you added 20 amino acids, each carrying a 14C label, to a protein synthesis system with only one mRNA present. After one minute, you purify the newly synthesized protein and then cleave it through several rounds, first with an aminopeptidase and then a carboxypeptidase. The majority of the radioactive label is in the carboxypeptidase digest. What does this tell you? a. tRNA molecules are not bound to amino acids until mRNA binds to the 16S ribosomal site. b. The newly synthesized protein is not labeled because it is screened by the 18S rRNA. c. Protein synthesis occurs relative to the 3′-to-5′ direction of mRNA. d. Protein synthesis occurs in the amino-terminal to carboxy-terminal direction. e. Carboxypeptidase has a much higher kcat than aminopeptidase.

37. The equivalent of how many molecules of ATP is consumed in the synthesis of each aminoacyl-tRNA? a. 2 b. 3 c. 4 d. 5 e. 1 38. What tRNA base maximizes the number of codons that this tRNA can recognize? a. inosine b. 5-methylcytosine c. pseudouracil d. dehydrouridine e. guanine 39. The carboxy-terminal domain (CTD) of RNA polymerase II undergoes reversible phosphorylation by transcription factor TFIIH during transcription. What does this phosphorylation event signal? a. Dephosphorylation signals recruiting of proteins to catalyze polyadenylation. b. Phosphorylation signals recognition of the "stop" codon. c. Dephosphorylation signals recruiting of spliceosome proteins. d. Phosphorylation signals the transition from transcription initiation to elongation. e. Dephosphorylation activates the catalytic function of ribozymes.

40. The function of small nucleolar ribonucleoproteins (snoRNPs) is to: a. catch small nucleolar RNA and inactivate them. b. direct the base modification in pre-rRNA. c. be part of ribosomes. d. determine the sites of cleavage of pre-rRNA.

Name:

Class:

Date:

ch 38 - 41 e. enhance assembly of ribosomes.

41. What enzyme is required to obtain a single strand of cDNA apart from reverse transcriptase? a. DNA polymerase b. terminal transferase c. oligo(dG) transferase d. annealing enzyme e. DNA ligase 42. Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the exon, it will not affect the gene product. b. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may be affected. c. If the mutation occurs in the 3′ end of the start site, it will not affect the gene product. d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will not affect the gene product. e. If the mutation occurs in the 5′ end of the start site, it will not affect the gene product.

43. What is the direction of reverse transcription? a. from 5′-phosphate to 3′-hydroxyl end b. from 3′-hydroxyl to 5′-phosphate end c. from 5′-hydroxyl to 3′-phosphate end d. from 3′-phosphate to 5′-hydroxyl end e. depends on the primer 44. Judging by the given depiction of autoradiogram of electrophoresis gel, choose the correct sequence of the template (from 5′ to 3′ end).

a. CTC GTA TCA GCT A b. GAG CAT AGT CGA T c. ATC GAC TAT GCT C d. TAG CTG ATA CGA G e. There is not enough information to conclude.

45. Protein synthesis takes place in:

Name:

Class:

Date:

ch 38 - 41 a. lysosomes. b. nuclear pores. c. vacuoles. d. ribosomes. e. mitochondria.

46. What ion does the binding site of threonyl-tRNA synthetase contain? a. iron b. zinc c. magnesium d. calcium e. potassium 47. Consider the overall reaction of amino acid activation. amino acid + ATP + tRNA ⇌ aminoacyl-tRNA + AMP + PPi If the ATP was labeled with 32P in the α position, where would the label end up? a. aminoacyl-tRNA b. AMP c. AMP and PPi d. PPi e. the next tRNA in the sequence 48. A loss of 3′ polyadenylation will lead to: a. intensified capping. b. decreased stability of the mRNA. c. intensified splicing of mRNA. d. alternative splicing. e. intensified splicing of tRNA. 49. To what ends of the initial DNA are the direct and reverse primers bound? a. The direct primer binds to the 3′ end on one strand and reverse to the 5′ end on another strand. b. The reverse primer binds to the 5′ end on one strand and direct to the 5′ end on another strand. c. The direct primer binds to the 3′ end on one strand and reverse to the 5′ end on the same strand. d. There is only one primer and it binds to the 3′ end of the template strand. e. The direct primer binds to the 3′ end on one strand and reverse to the 3′ end on another strand.

50. Abundant amino acids in proteins have the most codons, and the least abundant amino acids have the fewest. Why might this provide a selective advantage? a. Degeneracy decreases the likelihood that a substitution for a base will change the encoded amino acid. b. Degeneracy prevents variation in base composition; therefore, proofreading is not necessary.

Name:

Class:

Date:

ch 38 - 41 c. Early organisms had overlapping DNA and under those conditions, each amino acid was coded by the same number of codons. d. Thermodynamically, less energy is expended by the cell in making abundant amino acids. e. Redundancy allows for base modifications without affecting the protein structure and function.

51. What sequence in the 3′-end region of pre-mRNA is recognized by the cleavage and polyadenylation specificity factor? a. AAUAAA b. GU-rich region downstream of the cleavage site c. CCA d. AAGUAAGU e. CstF 52. In what pattern can all tRNA molecules be arranged when depicted on a two-dimensional surface? a. cloverleaf pattern b. flower pattern c. maple leaf pattern d. petal pattern e. olive leaf pattern 53. Chloramphenicol acts by: a. binding to the peptidase cell-wall enzyme. b. inhibiting peptidyl transferase activity. c. inhibiting protein synthesis. d. binding to fMET-tRNA. e. changing the shape of the mRNA. 54. What is NOT required for the screening of the cDNA library? a. bacterial colonies b. agarose gel c. nitrocellulose membrane d. X-ray film e. radiolabeled probe 55. What process may codon bias help to regulate? a. initiation b. transcription c. RNA processing d. translocation e. translation 56. You read an article in a popular magazine about a unicellular plant that has DNA with catalytic activity.

Name:

Class:

Date:

ch 38 - 41 Knowing that RNA can have catalytic activity, would you believe this article? a. Yes, DNA could easily be attacked by a guanosine cofactor. b. Yes, if DNA is not associated with proteins that would constrain the formation of DNA-loop structures. c. Yes, because all that is required is a 3′–OH to attack the 3′ splice site. d. No, uracil of RNA is required in the catalytic site. e. No, DNA is constrained by its double helix structure and could not fold into a catalytic structure.

57. What is a genomic library? a. collection of vectors made of restriction fragments b. collection of all mRNAs of some organisms c. collection of vectors made of reversely transcribed mRNA d. collection of linker DNA e. collection of sequences made of DNA fragments 58. The percentage of all genetic diseases caused by mutations that affect mRNA splicing is: a. 2%. b. 15%. c. 20%. d. 30%. e. 7%.

59. The of the cell provides organization of the translation machinery in higher eukaryotes. a. cell wall b. centriole c. cytoskeleton d. starch granules e. peroxisomes 60. What is translocase? a. protein that provides proximity to the amino acid with aminoacyl-tRNA in the P site b. a component of the peptidyl transferase center c. an enzyme that makes the 5′ end capped in eukaryotes d. a GTP-activity factor catalyzing the removal of RF1 or RF2 from the ribosome e. a bacterial elongation factor G 61. What is the main function of U5 snRNP in the spliceosome? a. It is included in the catalytic center of the spliceosome. b. It holds two magnesium ions bound by phosphate groups. c. An inhibitor masks U6 until the specific splice sites are aligned. d. It holds the 5′ exon and the 3′ exon far away from each other. e. It holds the free 5′ exon and the 3′ exon close together.

Name:

Class:

Date:

ch 38 - 41 62. During preparation of the genomic library: a. fragments of DNA are separated by gel electrophoresis to isolate fragments longer than 15 kb. b. linkers are attached to the total genomic DNA. c. the total genomic DNA sequence first has to be determined. d. restriction endonucleases are used after the attachment of linkers. e. cloning can be done only with the phage as a vector; a bacterial plasmid cannot be used.

63. What molecule serves as an adaptor between the codon and its specified amino acid? a. transfer RNA b. transfer DNA c. transport RNA d. transport DNA e. transmission RNA 64. What is the function of chloramphenicol? a. It inhibits translocation in eukaryotes. b. It inhibits initiation and causes misreading of bacterial mRNA. c. It inhibits the peptidyl transferase activity of the 50S bacterial subunit. d. It binds to the 50S subunit and inhibits translocation in bacteria. e. It binds to the 30S subunit and inhibits the binding of mRNA in bacteria.

65. In what component of the ribosome would a mutation have the GREATEST impact and why? a. RNA, because RNA ensures proper orientation of amino acids. b. RNA, because RNA is thought to provide the catalytic activity. c. Protein, because protein is thought to provide the catalytic activity. d. Protein, because the recognition sites consist primarily of protein. e. Carbohydrate, because the recognition sites consist primarily of protein.

66. What is used as a primer for the synthesis of the first strand of cDNA? a. oligo(A) sequence b. the sequence complementary to the poly(A) tail c. oligo (dC) sequence d. oligo (dG) sequence e. the sequence complementary to the 5′ cap 67. Which statement about activation of amino acids for protein synthesis is TRUE? a. Aminoacyl-AMP is part of the CCA terminus of tRNA. b. Formation of aminoacyl-tRNA requires hydrolysis of three molecules of ATP. c. The aminoacyl-adenylate intermediate dissociates from the enzyme in the course of activation. d. The pyrophosphate is hydrolyzed in the first step of activation and it drives the whole activation. e. Aminoacyl-AMP is formed from the amino acid and ADP.

Name:

Class:

Date:

ch 38 - 41 68. What functional group prevents Thr-tRNAThr from fitting into the editing site of the corresponding aminoacyl-tRNA synthetase? a. butyl group b. hydroxyl group c. acetyl group d. ethyl group e. methyl group 69. In preparation for attachment to tRNA, amino acids are activated by: a. methylation. b. adenylation. c. demethylation. d. acetylation. e. oxidation.

70. What part of tRNA is phosphorylated? a. 3′ end b. 5′ end c. 3′ CCA d. 5′ CCA e. acceptor stem 71. What would happen if you introduced a substitution of two of the Gs for two Cs in the Shine–Dalgarno sequence? a. Weak base-pairing between mRNA and the 3′ end of the 16S rRNA could terminate initiation. b. Weak base-pairing between the 5′ end of tRNA and the 18S rRNA could cause an insertion of the wrong amino acid. c. Weak base-pairing between the codon and the anticodon sequences could cause an insertion of the wrong amino acid. d. The Shine–Dalgarno sequence allows for the proper pairing of each amino acid with its tRNA, which would lead to an incorrect protein sequence. e. The 16S and 18S ribosomal subunits would not be bound tightly enough, and early chain termination would occur.

72. What is DNA cloning? a. growing bacterial cells b. amplifying DNA c. growing cellular cultures d. finding palindromic sequences e. amplifying the sequence of interest

Name:

Class:

Date:

ch 38 - 41 73. What is the rate of protein synthesis in a bacterial cell (amino acids per sec)? a. 2 b. 10 c. 20 d. 40 e. 80 74. What forces tRNA and mRNA to move through the ribosome by a distance, corresponding to one codon? a. pairing of the initiator codon on mRNA with the anticodon of an initiator tRNA molecule b. interactions of EF-Tu with the sarcin–ricin loop c. conformational change in EF-G caused by binding EF-G with the EF-Tu binding site. d. N-formylmethionine e. interactions of the release factors with a loop containing the GGQ sequence 75. Which technique or method can be used to directly identify the presence of a specific RNA sequence? a. southern blotting b. western blotting c. northern blotting d. autoradiography e. polymerase chain reaction (PCR) 76. In vanishing white matter disease, nerve cells disappear due to: a. phagocytosis of living cells. b. an autoimmune result of mutations in mRNA. c. mutations in release factors. d. mutations in initiation factor 2. e. mutations in the tRNA charging mechanism.

77. Describe the reciprocal relations of ferritin and transferrin-receptor expression levels. a. When iron is high, the amount of transferrin receptor decreases, and little or no new ferritin is synthesized. b. When iron is high, the amount of transferrin receptor increases, and ferritin is synthesized. c. When iron is high, the amount of transferrin receptor increases, and no new ferritin is synthesized. d. When iron is scarce, the amount of transferrin receptor increases, and little or no new ferritin is synthesized. e. When iron is scarce, the amount of transferrin receptor decreases, and ferritin is synthesized.

78. Why is diphtheria toxin lethal? a. Corynebacterium diphtheriae is infected by a bacteriophage. b. The toxin of Corynebacterium diphtheriae is able to enter the cytoplasm of its target cell. c. The toxin of Corynebacterium diphtheriae is cleaved into two fragments when in the cell. d. People do not get appropriate immunization.

Name:

Class:

Date:

ch 38 - 41 e. Corynebacterium diphtheriae strains are mostly antibiotic resistant.

79. What would be the main negative outcome of the frequency of mistakes in protein synthesis being equal to 10–2? a. The protein synthesis would be too slow. b. The protein synthesis would halt. c. All proteins longer than 100 residues would be mutated. d. All proteins shorter than 100 residues would be mutated. e. Absolutely all proteins would be mutated.

80. A usual deoxyribonucleotide differs from its analog used in the controlled termination of the replication method in that it is: a. missing the 3′ hydroxyl group. b. missing the 2′ hydroxyl group. c. missing the 5′ hydroxyl group. d. missing the 5′ phosphate group. e. additional the 2′ hydroxyl group.

81. What protein of E. coli is responsible for translocation of mRNA as a result of a conformation change due to hydrolysis of GTP? a. RRF b. EF-Tu c. EF-G d. Shine–Dalgarno e. Rho 82. Recombinant DNA technologies are possible thanks to: a. restriction endonucleases. b. reverse transcriptases. c. DNA polymerases. d. zinc-finger nucleases. e. ligases.

83. Reverse transcriptase is normally found in: a. plants. b. retroviruses. c. mitochondria. d. the pancreas. e. mammals.

84. What event initiates a spliceosome assembly? a. The complex of U4, U5, and U6 binds to the complex of U1 and U2.

Name:

Class:

Date:

ch 38 - 41 b. U2 snRNP binds to the branch point of the pre-mRNA. c. The complex of U4, U5, and U6 snRNPs binds to the pre-mRNA strand. d. U5 snRNP interacts with the 5′ and 3′ splice sites. e. U1 snRNP binds to the 5′ splice site.

85. Which statement about a prokaryotic ribosome is TRUE? a. The large subunit contains more protein and RNA molecules than the small subunit. b. The small subunit is based on the 23S rRNA molecule. c. Even though the large subunit has a larger mass, it has a lower sedimentation coefficient. d. Ribosomal RNA has a mostly random folding pattern. e. The coefficient of sedimentation of the whole ribosome equals the sum of coefficients of the subunits.

86. Eukaryotic mRNA is: a. linear. b. circular. c. modified only at the ribose. d. discontinuously translated. e. planar.

87. What is the feature of the mRNA initiation sequence in eukaryotes? a. purine-rich on the 5′ side b. pyrimidine-rich on the 5′ side c. GGQ-sequence d. AUG near the 5′ end e. UAA and UGA sequence on the 5′ side 88. Catalytic RNA is called: a. ribosome. b. ribozyme. c. ribose. d. ribonuclease. e. ribonucleotidase.

89. What chemical structure do the activated intermediates have in protein synthesis? a. amino acid aldehydes b. amines c. amino alcohols d. amino acid esters e. amino acid ketones 90. What components of translation recognize stop codons?

Name:

Class:

Date:

ch 38 - 41 a. release factors b. elongation factors c. termination factors d. anticodons e. tRNA 91. What is the effect of diphtheria toxin on a cell? a. It prevents capping of the 5′ end of mRNA. b. It blocks the release factor eRF1 by modification of its amino group. c. It catalyzes the covalent modification of elongation factor 2. d. It makes the cell produce bacterial proteins. e. It damages glycoproteins of the cell membrane.

92. What statement about the spliceosome is FALSE? a. The spliceosome may be the most complicated molecular machine in the cell. b. The spliceosome contains more than 300 proteins. c. The spliceosome contains several snoRNAs. d. RNA components of the spliceosome recognize the 5′ and 3′ splice sites and the branch site. e. It removes introns and links exons together to form mature mRNA. 93. What is the function of the 5′ cap in eukaryotes? a. The 5′ cap is an initiating codon. b. It provides binding of the 40S ribosome to Met-tRNA. c. It helps elongation factors to increase the rate of amino acid adding. d. It provides an easily recognizable starting point for translation. e. The function is uncertain.

94. Ricin is made from castor beans and is a strong toxin that: a. removes adenine from 28S rRNA. b. glycosylates tRNA. c. inhibits protein synthesis initiation. d. blocks the A binding site. e. coats the mRNA. 95. What is the reason to clone vectors in eukaryotic cells? a. ability to create transgenic mice b. proper replication machinery c. more efficient technologies for cloning d. proper transcriptional machinery e. proper posttranslational processing 96. What is a cDNA library?

Name:

Class:

Date:

ch 38 - 41 a. collection of vectors made of restriction fragments b. collection of all mRNA of bacterial organisms c. collection of bacterial organisms containing a vector with an inserted piece of DNA d. collection of linker DNA e. collection of sequences made of DNA fragments 97. Codons that specify the same amino acid are called: a. analogues. b. antonyms. c. synonyms. d. equivalents. e. homonyms.

98. Using the table of genetic code, choose the DNA template strand that corresponds to the protein sequence with only two positively charged amino acid residues.

a. 5′-CGT CAT CTA AGA GCA-3′ b. 3′-GTA TTC CTA AAA GAG-5′ c. 5′-TTT CAT GCA AGA AAA-3′ d. 3′-CGT CAT CTA AGA GCA-5′ e. 3′-GTA TTC CTA AAA GCT-5′ 99. What do southern, northern, and western blots detect, respectively?

Name:

Class:

Date:

ch 38 - 41 a. DNA, RNA, and protein b. DNA, protein, and RNA c. RNA, DNA, and protein d. protein, DNA, and RNA e. RNA, protein, and DNA 100. Which method allows generating DNA fragments with a determined length? a. screening of the expression vectors b. constructing a plasmid c. gel-electrophoresis after reverse transcription d. Sanger dideoxy method e. DNA cloning 101. RISC is: a. a viral RNA. b. a process that leads to mRNA degradation induced by the presence of dsRNA. c. a dsRNA cleaved into 21-nucleotide fragments. d. one of the single-stranded components of RNase cleavage products. e. a complex of one strand of the former dsRNA with an Argonaute protein.

102. Restriction enzymes are useful for recombinant DNA technologies, as they allow: a. gene extraction from the bacteria. b. DNA release from the chromatin. c. obtaining smaller and more specific DNA fragments. d. cleavage of methylated DNA. e. obtaining the entire genome from the cell.

103. What complex prevents the 30S subunit from prematurely joining the 50S subunit? a. complex of the 30S subunit with IF2 b. 70S initiation complex c. IF2-tRNAf d. complex of the 30S subunit with IF1 and IF3 e. fMet-tRNAf 104. Consider a gene with three positions at which alternative splicing can take place. Assuming that these alternative splicing pathways are regulated independently, what is the total quantity of different mRNA that can be generated. a. 27 b. 9 c. 8 d. 6

Name:

Class:

Date:

ch 38 - 41 e. 3 105. What coordinates the transcription and processing of mRNA by recruiting different proteins? a. CTD of RNA polymerase II b. the nascent pre-mRNA strand c. CCA of RNA polymerase II d. the YSPSTPS domain of RNA polymerase II e. transcription factors, particularly TFIIH 106. What event would be inhibited by a mutation in a ribozyme that catalyzes a transesterification reaction? a. mRNA termination b. polyadenylation c. mRNA splicing d. 5′ capping e. chain initiation 107. What is the molecular basis of genetic code degeneracy? a. pseudouracil bases in the anticodon loop b. wobble base-pairing of the first base of the codon c. low specificity of the aminoacyl-tRNA synthetase d. wobble base-pairing of the third base of the codon e. Watson–Crick base-pairing of the third base of the anticodon 108. Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the following sense strand of DNA: 5′-AAA GTA CGG CCT TTG GAT CCC - 3′

Name:

Class:

ch 38 - 41

a. Pro-Stop b. Phe-His-Ala-Gly-Asn-Leu-Val c. Lys-Val-Arg-Pro-Leu-Asp-Pro d. Val-Ile-Gln-Arg-Pro-Tyr-Phe e. Val-Val-Ser-Pro-Leu-Asp-Thr 109. Signals that define the beginning and the end of protein synthesis are contained in: a. rRNA. b. tRNA. c. mRNA. d. the ribosome. e. protein.

110. What is the three-dimensional shape of transfer RNA molecules? a. U-shape b. L-shape c. O-shape d. X-shape e. T-shape 111. What is the feature of bacterial mRNA? a. Molecules are polycistronic.

Date:

Name:

Class:

Date:

ch 38 - 41 b. Molecules have many noncoding regions. c. The first translated codon is at the 5′ end. d. Molecules do not have signals that define the beginning of the polypeptide chain. e. Molecules do not have signals that define the end of the polypeptide chain.

112. What can occur in bacteria but not eukaryotes? a. RNA can be translated in both 5′ → 3′ and 3′ → 5′ directions. b. Splicing can occur. c. The genetic code is overlapping. d. Translation can start before transcription is completed. e. There is only one tRNA for each amino acid.

113. Which step of screening of the expression vectors is NOT required for screening of the cDNA library? a. transformation of bacteria b. transfer onto the nitrocellulose membrane c. autoradiographic visualization d. lysis of bacteria on the replica plate e. addition of the labeled selective marker 114. Using the table of genetic code, which mRNA sequences will contain three glutamic acid residues?

a. 5′-UUC AAA GAG GGG CAA GGA UUU UAU-3′ b. 5′-CAA UGU CAG GGG CAA GGA GUU UGU-3′

Name:

Class:

Date:

ch 38 - 41 c. 5′-UUC AAA GAG GAA CAA UUU GAA UAU-3′ d. 5′-CAA UGU CCC GAG CAA GGA CUA UCU-3′ e. 5′-CCC AGU GGU GGG GAA GGA GUU UGU-3′ 115. What is the minimal amount of DNA that can be analyzed with gel electrophoresis? a. 50 ng b. 100 ng c. 50 ng/ml d. 5 mg e. 5 µg 116. Which technique is the BEST one to study levels of gene expression in multiple genes and tissues? a. quantitative PCR b. gene cloning c. gel electrophoresis d. DNA microarray e. microinjections 117. In E. coli, the 70S ribosome is made up of a. 50S and 20S b. 50S and 30S c. 50S and 10S d. 30S and 40S e. 10S and 60S

subunits.

118. What is the rate-limiting step in protein synthesis in bacteria? a. formation of the 70S initiation complex b. formation of the 30S initiation complex c. formation of the IF2–GTP–initiator–tRNAf complex d. binding of EF-Tu to aminoacyl-tRNA e. formation of the 50S initiation complex 119. What is a southern blotting technique? a. transfer of molecules on the nitrocellulose sheet b. autoradiographic detection of specifically selected molecules on the nitrocellulose sheet c. transfer of specifically selected molecules on the nitrocellulose sheet d. fluorescent detection of specifically selected molecules on the nitrocellulose sheet e. transfer of molecules on agarose gel 120. How does the genome differ from the transcriptome? a. The genome is all of the genes in the DNA of a species, whereas the transcriptome is only those that are unique to an individual.

Name:

Class:

Date:

ch 38 - 41 b. The genome is all of the genes in the DNA of a cell, whereas the transcriptome is only those that are expressed within a specific tissue. c. The genome is the genes that encode proteins in a cell, whereas the transcriptome is only those proteins that are needed for steady-state levels of a particular cell. d. The transcriptome is all genes that can be transcribed by a cell, whereas the genome is the complete DNA sequence of the cell. e. The genome does not contain untranslated regions of the DNA, but the transcriptome includes all transcribed regions of the DNA. 121. What is the structure that ferritin mRNA includes? a. α helix b. β sheet c. iron-response element d. D-loop e. helix-loop-helix 122. Controlling stringency may be the most important parameter in PCR. If you want to check a gene from two distantly related species, for example, humans vs. zooplankton, what kinds of stringency measures would you take? a. Start PCR annealing temperatures high to see if there are similar sequences. b. Lower PCR annealing temperatures slowly if no product is formed. c. Adjust salt concentrations to achieve maximum ionic strength. d. Synthesize primers corresponding to the ends of the gene. e. All of the answers are correct.

123. What is a term for coding regions in primary transcripts of eukaryotic genes? a. sense b. consensus c. intron d. exon e. precursor 124. What is the biological role of restriction enzymes in bacteria? a. repair DNA b. induce DNA crossover c. cleave foreign DNA d. extract genes from the bacteria e. open sticky ends 125. How many adenosine bases are in a poly(A) tail? a. 5 b. 25

Name:

Class:

Date:

ch 38 - 41 c. 100 d. 250 e. 500 126. Which statement about DNA microarray technology is TRUE? a. DNA is isolated from the investigated cells or tissues. b. The samples of different tissues need to be combined prior to loading onto the microarray chip. c. The technology allows various pathological conditions to be revealed. d. Isolated mRNA are labeled with fluorescent tags depending on the tissue type. e. Differently labeled cDNA are loaded into different wells of the microarray chip.

127. What amino acid participates in eukaryotic initiation? a. Arg b. Lys c. Leu d. Met e. Gln 128. What characteristic of the genetic code minimizes deleterious effects of mutations? a. degradation b. universality c. termination d. directionality e. degeneracy 129. Is it possible to cleave a plasmid with one restriction enzyme and the sequence of interest with a different restriction enzyme and still obtain a fully functional vector after annealing? a. No, the enzymes have to be the same. b. Yes, if the enzymes produce the same cohesive ends. c. Yes, DNA ligase can fix the noncomplementary bonding between different sticky ends. d. No, you first need to account for the properties of the sequence and then decide about the restriction. e. Not unless you have a proper synthetic linker inserted in the plasmid.

130. nucleotides encode an amino acid. a. Two b. Three c. Four d. Five e. Six 131. Which statement about genome editing machinery is TRUE? a. Proteins with TALE repeats require fusion with restriction enzymes since alone they cannot cleave

Name:

Class:

Date:

ch 38 - 41 DNA. b. To recognize a six-base-long site in DNA, ZFN needs to have six zinc-finger domains. c. Six α helices in the TALE repeats can recognize six nucleotides. d. To recognize a six-base-long site in DNA, TALEN needs to have 204 amino acids coded in the TALE repeat array e. TALE repeats are palindromic, which allows them to bind sites in DNA with a similar two-fold rotational symmetry.

132. What is the name of the phenomenon of a nonrandom use of synonymous codons in genes in different organisms? a. codon dislocation b. nucleotide bias c. sequence bias d. codon bias e. synonym bias 133. What forms the catalytic center of the spliceosome? a. U5 b. U2 and U6 c. U4–U5–U6 tri-snRNP d. U2, U4, and U6 e. U1 and U5 134. What is affected by trans-acting mutations causing defective pre-mRNA splicing? a. pre-mRNA itself b. template strand of DNA c. splicing factors d. noncoding regions of DNA e. RNA polymerase 135. Assume you have a template sequence 3′-AAT GCG ATC CGG TAC G-5′. In the strand-termination method, upon addition of ddCTP, you can obtain: a. CGTA. b. AATGCGATCCG. c. GCGATCCGGTACG. d. AATGCC. e. TTACGCTAGGC. 136. What is the group of ribosomes bound to an mRNA molecule called? a. polysome b. expressome c. ribosomal complex

Name:

Class:

Date:

ch 38 - 41 d. autosome e. monosome 137. What event takes place at the second transesterification step of splicing? a. The branch-site adenosine attacks the 5′ splice site. b. The branch-site adenosine attacks the 3′ splice site. c. The 3′ splice-site hydroxyl group attacks the branch-site adenosine. d. The 5′ splice-site hydroxyl group attacks the 3′ splice site. e. The 3′ splice-site hydroxyl group attacks the 5′ splice site.

138. The key point for the accuracy of translation is: a. codon degeneracy. b. a wobble at the third base of the codon. c. tRNA specificity in binding the mRNA. d. synthesis of aminoacyl tRNA. e. the structure of mRNA. 139. What is a common principle exploited by next-generation sequencing (NGS) methods? a. detection of pyrophosphate b. detection of protons c. detection of nucleotide incorporation d. usage of fluorescence e. analysis of sequence fragments 140. What is the order of the tRNA binding sites on the 70S ribosome with respect to the 5′ → 3′ direction of mRNA? a. E P A b. P A E c. A E P d. P E A e. E A P 141. What amino acid sequence with one methylated amino acid does peptidyl transferase center contain? a. CQQ b. GGQ c. DDC d. QCE e. GCG 142. Which statement about recombinant DNA technology is FALSE? a. Basically, this technology is about constructing a vector and cloning it in the host organism. b. Recombination of the desired DNA fragments is the point of this technology.

Name:

Class:

Date:

ch 38 - 41 c. Vector bearing the DNA insert can be cleaved by restriction enzymes to check whether the insertion is correct. d. Southern blotting allows checking for correctness of the desired DNA fragment prior to recombination with the vector. e. To run gel electrophoresis, the constructed vector should be closer to the beginning of the gel than the original plasmid.

143. What base of an anticodon determines whether a particular tRNA molecule reads one, two, or three kinds of codons? a. first b. second c. third d. fourth e. fifth 144. What is used to form cap 0 of mRNA? a. S-adenosylmethionine b. cysteine c. biotin d. methanol e. dimethyl-RNA methylase 145. The group of three bases that encode an amino acid is called: a. codon. b. sequence. c. lexicon. d. DNA. e. RNA. 146. The initiating mRNA codon for the most organisms is: a. UAG. b. AUG. c. AAA. d. UAA. e. UGA. 147. An error in the synthesis of an RNA molecule or a protein molecule will not be passed on to subsequent generations. Suggest a reason why there is a proofreading mechanism in protein synthesis but not RNA synthesis. a. Protein proofreading occurs during protein folding events; thus, the rate of protein synthesis is not reduced. b. Protein proofreading occurs during posttranslational splicing of proteins (such as insulin); thus, the rate of protein synthesis is not reduced.

Name:

Class:

Date:

ch 38 - 41 c. Protein synthesis takes place at a much slower rate than RNA synthesis, thus giving time for improper codon–anticodon binding destabilization. d. The mischarging of some tRNA is corrected by the hydrolytic action of aminoacyl-tRNA synthetase; thus, mistakes are prevented. e. Some tRNAs are proofread in the E site, triggering hydrolytic action of peptidyl transferase; thus, mistakes are corrected as they are made.

148. The 5′ end of mRNA is modified: a. immediately after initiation of RNA synthesis. b. shortly after initiation of RNA synthesis, when the strand is about 100 nucleotides in length. c. shortly after initiation of RNA synthesis, when the strand is about 25 nucleotides in length. d. after the C-terminal domain of RNA polymerase II is dephosphorylated. e. after termination of RNA synthesis.

149. What must DNA strand(s) from the probe be complement to? a. either of the strands b. both strands together c. only the coding strand d. only the template strand e. mature mRNA strand 150. In what part of the cell does DNA encode a distinct set of transfer RNA–adaptor molecules that recognize the alternative codons? a. endoplasmic reticulum b. cytoplasm c. lysosome d. mitochondria e. nucleus 151. The function of the guanosine cofactor in self-splicing is: a. to provide energy. b. to provide an attacking group. c. a necessary base for RNA editing. d. to provide nucleophilic phosphate group. e. a matrix for splicing.

152. What RNA are critical for prokaryotic ribosomal architecture and function? a. 10S, 12S, 16S b. 5S, 6S, 7S c. 3S, 5S, 16S d. 6S, 16S, 25S e. 5S, 16S, 23S

Name:

Class:

Date:

ch 38 - 41 153. What structural element of eukaryotic cap 1 is methylated? a. N-7 nitrogen atom of the 3′-terminal guanine and ribose moiety of the third base b. N-5 nitrogen atom of the 5′-terminal guanine and ribose moiety of the first base c. N-7 nitrogen atom and ribose moiety of the 5′-terminal guanine d. N-7 nitrogen atom of the 5′-terminal guanine and ribose moiety of the second base e. N-5 nitrogen atom of the 5′-terminal guanine and ribose moiety of the third base 154. In the controlled termination method of DNA sequencing, reading the gel from gives the sequence in the direction; fragments that were terminated in polymerization move faster down the gel a. top to bottom; 5′ to 3′; shorter; early b. top to bottom; 5′ to 3′; longer; early c. bottom to top; 5′ to 3′; shorter; early d. bottom to top; 5′ to 3′; longer; later e. bottom to top; 3′ to 5′; shorter; early 155. How many parts does synthesis of proteins include? a. 1 b. 2 c. 3 d. 4 e. 5 156. What is the main role of tRNAf? a. It is included in the initiation complex to bind with IF-1. b. It formylates the amino group of the methionine molecule. c. It inserts methionine in internal positions during elongation. d. It modifies methionine to start protein synthesis. e. It brings formylmethionine to the ribosome to initiate protein synthesis.

157. The immediate product of RNA polymerase II is often referred to as: a. miRNA. b. mRNA. c. pro-mRNA. d. pre-mRNA. e. proto-mRNA. 158. Would it be possible for RF3 to catalyze the removal of RF1 and RF2 from the ribosome upon release of the newly synthesized protein? Why? a. Yes, RF1 and RF2 are compact proteins. b. Yes, RF3 is transferase. c. Yes, RF3 is GTPase.

Name:

Class:

Date:

ch 38 - 41 d. No, all RFs are elongation factors. e. No, RF1 is GTPase.

159. What catalyzes the formation of the peptide bond in protein synthesis? a. RRF b. RF3 c. aminoacyl-tRNA synthetase d. transformylase e. peptidyl transferase center 160. What event in eukaryotic tRNA processing is FALSE? a. modification of base and ribose moieties b. removal of the 3′ trailer by RNase Z c. cleavage of the 5′ leader by RNase P d. CCA addition by tRNA nucleotidyltransferase e. AUU addition to the 3′ end by tRNA nucleotidyltransferase 161. What snRNP recognizes the 5′ splice site at the first step of splicing in mammalian cells? a. U1 b. U2 c. U3 d. U4 e. U5 162. Which statement about CRISPR/Cas9 system is TRUE? a. First, it was discovered in the genome of E. coli. b. The target DNA site is recognized by the 3′ end of the single-guide RNA. c. The protospacer-adjacent motif has to be recognized by sg RNA to activate the NUC domain of Cas9. d. The CRISPR/Cas9 system is more efficient than the TALEN-based system because a single nuclease domain of Cas9 is enough to make a double-stranded nick. e. sgRNA in cells is bound to the Cas9 protein to efficiently couple recognition and cleavage.

163. To which functional group of the adenylate is the carboxyl group of the amino acid attached in the first step of amino acid activation? a. 5′-hydroxyl group b. 2′-hydroxyl group c. 3′-hydroxyl group d. 5′-phosphoryl group e. 3′-phosphoryl group 164. Because RNA polymerase II has no proofreading function, it may provide a mechanism for generating

Name:

Class:

Date:

ch 38 - 41 diversity. What is the most likely reason for the lack of proofreading function in RNA polymerase II? a. Small nucleolar ribonucleoproteins direct modification to form pseudouridine bases. b. RNA can be altered after transcription by RNA editing. c. Proofreading would slow down transcription, preventing cells from responding rapidly to changing cellular demands. d. The 5′ leader sequence is removed prior to translation. The synthesis of this extra length of transcript is thermodynamically unfavorable. e. Several 5′ caps are added to mRNA, which shifts the reading frame, depending on the cap.

165. What is the molecular mass of the E. coli ribosome? a. 5.7 Da b. 1.7 Da c. 1.7 MDa d. 2.7 Da e. 2.7 MDa 166. Which is the CORRECT pairing of the length of the signal sequence and type of amino acids it has? a. 9–14 hydrophobic amino acid residues – seldom positively charged b. 9–12 hydrophobic amino acid residues – sometimes positively charged c. 9–16 negatively charged amino acid residues – sometimes positively charged d. 9–16 positively charged amino acid residues – often hydrophobic e. 15–16 hydrophilic amino acid residues – often hydrophilic 167. What is a term for noncoding regions in primary transcripts of eukaryotic genes? a. nonsense b. empty c. intron d. exon e. enhancer 168. Which DNA sequence contains a four- to eight-base palindromic site? (Note: Only one strand is shown.) a. CAGTCC b. GCATCC c. CGATTAGC d. GAGAGAGA e. GCATATGC Indicate one or more answer choices that best complete the statement or answer the question.

169. What parts of tRNA are the least important for its binding by aminoacyl-tRNA synthetase? Select all that apply. a. acceptor stem

Name:

Class:

Date:

ch 38 - 41 b. anticodon loop c. TψC loop d. CCA terminus e. DHU loop 170. What factors are essential for initiation of translation? Select all that apply. a. IF1 b. IF2 c. IF3 d. EF-Tu e. EF-Ts 171. What is required for self-splicing in a group II intron? Select all that apply. a. guanosine cofactor b. free 2′-OH group of a specific adenylate of the intron c. free 3′-OH group of a specific adenylate of the intron d. free guanine nucleotide e. complex folding pattern of helices and loops in the intron 172. What components does the eukaryotic polyadenylation complex contain? Select all that apply. a. specific endonuclease b. PAS c. CstF d. CPSF e. RNase Z 173. What are the functions of the 5′ cap? Select all that apply. a. The cap contributes to the stability of mRNA by protecting their 5′ ends from phosphatases. b. The cap binds transport proteins to deliver mRNA from the nucleus to the cytoplasm. c. The cap enhances the translation of mRNA. d. The type of the cap (0, 1, or 2) defines the degree of methylation of mRNA bases. e. The cap enhances the lifetime of mRNA by protecting their 5′ ends from nucleases.

174. What RNA are transcribed by RNA polymerase III? Select all that apply. a. 18S rRNA b. mRNA c. tRNA d. 5S rRNA e. 5.8S rRNA 175. Select all that apply. The polypyrimidine tract: a. is found at the 3′ end of an intron.

Name:

Class:

Date:

ch 38 - 41 b. is a consensus sequence. c. contains a stretch of 10 pyrimidines. d. is followed by any base and then by G. e. ends with the invariant AG. 176. What amino acids are encoded by only one triplet? Select all that apply. a. leucine b. valine c. arginine d. tryptophan e. methionine 177. Select all that apply. The ribosome is: a. an example of a catalyst that has survived from the RNA world. b. unique to eukaryotes. c. a ribozyme. d. based mostly on proteins rather than on RNA. e. unique to prokaryotes.

178. Select all that apply. Plasmids used in recombinant DNA technology typically: a. possess a gene for antibiotic resistance. b. replicate independently of the host genome. c. are circular double-stranded molecules. d. cannot copy independently of the bacterial genome. e. possess a gene for antibiotic resistance and replicate independently of the host genome.

179. What toxins inhibit protein-synthesis elongation by covalent modification of rRNA? Select all that apply. a. diphtheria toxin b. tetrodotoxin c. ricin d. α-amanitin e. α-sarcin 180. What enzymes take part in 5′ capping of eukaryotic mRNA? Select all that apply. a. RNA phosphatase b. RNA triphosphatase c. nucleotidyltransferase d. guanylyltransferase e. N-7 guanine methyltransferase 181. What components can be linked with aminoacyl-tRNA synthetase? Select all that apply. a. EF-Tu

Name:

Class:

Date:

ch 38 - 41 b. EF–Tu–GDP complex c. tRNAf d. tRNA e. fMet-tRNAf 182. What does the mammalian pre-rRNA transcript contain? Select all that apply. a. CCA tail b. rRNA of the large ribosomal subunit c. rRNA of the small ribosomal subunit d. multiple methylation sites e. pseudouridine bases 183. Choose the codons that are recognizable by release factors. Select all that apply. a. UAG b. CAG c. UGA d. UAA e. UCA 184. What elements are required to construct an expression vector? Select all that apply. a. prokaryotic promoter b. DNA insert c. ribosome binding site d. poly(A) tail e. restriction site(s) 185. According to the theory of protein targeting, proteins from the cytoplasm are delivered to different parts of the cell. What are those parts? Select all that apply. a. nucleus b. centrioles c. peroxisomes d. lysosomes e. chloroplast 186. What RNA are transcribed by RNA polymerase I? Select all that apply. a. 18S rRNA b. 28S rRNA c. tRNA d. 5S RNA e. 5.8S rRNA

Name:

Class:

Date:

ch 38 - 41 187. What groups need to be protected to prevent undesirable side reactions in the synthesis of oligonucleotides by the phosphite triester method? Select all that apply. a. The 5′ hydroxyl group is protected by DMT. b. All reactive groups of the base are protected. c. The 3′ phosphate group is protected by βCE. d. The 3′ phosphate group is protected by phosphoramitide. e. The 5′ phosphate group is protected by βCE. 188. What is required for self-splicing in a group I intron? Select all that apply. a. guanosine cofactor b. free 2′-OH group of a specific adenylate of the intron c. free 3′-OH group of a specific adenylate of the intron d. free guanine nucleotide e. complex folding pattern of helices and loops in the intron 189. Choose the means of generating diverse proteins from one gene. Select all that apply. a. splicing b. alternative splicing c. RNA editing d. RNA methylation e. mutations 190. What are the components of protein synthesis initiation? Select all that apply. a. fMet-tRNAf b. EF-Tu c. mRNA d. GTPase e. Shine–Dalgarno sequence 191. Choose the components of the 30S initiation complex. Select all that apply. a. 30S subunit b. IF2-GTP c. IF1 d. IF3 e. mRNA 192. Select all that apply. In the synthesis of oligonucleotides by the solid-phase phosphite triester method: a. the first nucleoside, phosphoramitide, is covalently attached to the solid support material. b. deprotection of the 5′ end by detritylation always precedes coupling of nucleoside phosphoramitides. c. deprotection of the 3′ end by oxidation always precedes coupling of nucleoside phosphoramitides. d. the coupling reaction is directly followed by oxidation of the 3′ phosphite triester to a naturally occurring phosphotriester.

Name:

Class:

Date:

ch 38 - 41 e. the coupling reaction is directly followed by detritylation of the 5′ end to prepare it for the next cycle.

193. Select all that apply. The specificity or stringency of a PCR reaction can be controlled by altering the reaction: a. volume. b. target sequence. c. temperature. d. salt concentration. e. enzyme concentration.

194. What are common structural features of introns in vertebrates? Select all that apply. a. Introns begin with the invariant GU. b. The consensus sequence at the 3′ end includes 10 pyrimidines. c. The consensus sequence at the 5′ end is AGAUAA. d. The polypurine tract at the 3′ end is followed by G. e. Introns end with the invariant AG. 195. Select all that apply. A polymerase chain reaction can be used in: a. next-generation sequencing. b. Sanger sequencing. c. the screening of DNA libraries. d. gene disruption. e. studies of gene expression.

196. What proteins are products of RNA editing? Select all that apply. a. K+ channels of octopuses living in tropical and arctic seas b. apolipoproteins apo B-100 and apo B-48 c. antibodies d. blood coagulation factors VII and IX e. globins β and γ Enter the appropriate word(s) to complete the statement.

197. The is the relation between the sequence of bases in DNA (or its RNA transcripts) and the sequence of amino acids in proteins.

198. The

is a ribonucleoprotein consisting of a 7S RNA and six different proteins.

199. The ATP-powered _

unwinds RNA duplex intermediates of splicing.

200. Bacterial plasmid DNA and bacteriophage DNA are commonly used into a bacterium.

to introduce foreign DNA

Name:

ch 38 - 41 Answer Key 1. b 2. a 3. d 4. e 5. d 6. a 7. a 8. c 9. b 10. c 11. a 12. e 13. c 14. a 15. b 16. c 17. a 18. c 19. c 20. b 21. a 22. b 23. b 24. c

Class:

Date:

Name:

ch 38 - 41 25. e 26. e 27. e 28. b 29. a 30. e 31. c 32. e 33. a 34. c 35. b 36. d 37. a 38. a 39. d 40. b 41. b 42. d 43. a 44. a 45. d 46. b 47. b 48. b 49. e

Class:

Date:

Name:

ch 38 - 41 50. a 51. a 52. a 53. b 54. b 55. e 56. e 57. e 58. b 59. c 60. e 61. e 62. a 63. a 64. c 65. b 66. b 67. d 68. e 69. b 70. b 71. a 72. e 73. c 74. c

Class:

Date:

Name:

ch 38 - 41 75. c 76. d 77. d 78. a 79. c 80. a 81. c 82. a 83. b 84. e 85. a 86. b 87. d 88. b 89. d 90. a 91. c 92. c 93. d 94. a 95. e 96. c 97. c 98. b 99. a

Class:

Date:

Name:

ch 38 - 41 100. d 101. e 102. c 103. d 104. c 105. a 106. c 107. d 108. c 109. c 110. b 111. a 112. d 113. d 114. c 115. a 116. d 117. b 118. a 119. a 120. b 121. c 122. e 123. d 124. c

Class:

Date:

Name:

ch 38 - 41 125. d 126. b 127. d 128. e 129. b 130. b 131. d 132. d 133. b 134. c 135. e 136. a 137. d 138. d 139. c 140. a 141. b 142. b 143. a 144. a 145. a 146. b 147. d 148. c 149. a

Class:

Date:

Name:

ch 38 - 41 150. d 151. b 152. e 153. d 154. c 155. c 156. e 157. d 158. c 159. e 160. e 161. a 162. a 163. d 164. b 165. e 166. b 167. c 168. e 169. c, d, e 170. a, b, c 171. b, e 172. a, c, d 173. a, c, e 174. c, d

Class:

Date:

Name:

ch 38 - 41 175. a, b, c, e 176. d, e 177. a, c 178. a, b, c, e 179. c, e 180. b, d, e 181. c, d 182. b, c, d, e 183. a, c 184. a, b, c, e 185. a, c, e 186. a, b, e 187. a, c 188. a, d, e 189. b, c 190. a, c, d 191. a, b, e 192. a, b, d 193. c, d 194. a, b, e 195. a, c, e 196. a, b 197. genetic code 198. signal-recognition particle 199. helicase

Class:

Date:

Name:

ch 38 - 41 200. vectors

Class:

Date: