Target Reseach 2012 (1 of 4)

Target Research Issue 1 of 4 2012

Time to register A must read

How patient registries are opening up opportunities for both patients and researchers

Improving care standards Clinical trial opportunities

Speeding up recruitment to clinical trials

Access to information

tttggtgggaagaagtagaggactgttatgaaagagaagatgttcaaaagaaaacattcacaaaatgggtaaatgcacaattttctaagtttgggaagcagcatat Patient’s link to the research community

Crucial for clinical trial planning

Myotonic dystrophy CUTTING-EDGE

Our researchers are improving diagnosis and moving towards possible therapies

Point of View What’s it like to join a patient registry?

Also inside…experts answer your questions and read about all the latest research and clinical trial news

2

The Muscular Dystrophy Campaign is the leading UK charity focusing on muscular dystrophy and related conditions. We are dedicated to finding treatments and cures and improving the lives of the 70,000 adults and children affected by the conditions. We focus on funding world-class research, providing practical information, advice and support, campaigning to bring about change and raise awareness, awarding grants towards the cost of specialist equipment and providing specialist education and development for health professionals.

Glossary This glossary is intended to help with some of the scientific and technical terms used in this magazine. Words that are in the glossary are highlighted in italics in the text.

Ambulant – able to walk.

Antisense oligonucleotide (AO) - a short piece of genetic material (DNA or RNA) which can bind to a specific gene and change how the code is read.

Animal model – a laboratory animal such as a mouse or rat that is useful for medical research because it has specific characteristics that resemble a human disease or disorder.

Chromosome – cylindrical shaped bundles of DNA found in the cell nucleus. They consist of long, threadlike strands of DNA coiled upon themselves many times. We inherit 23 chromosomes from our mother and 23 from our father.

DNA – (deoxyribonucleic acid) is the molecule that contains the genetic instructions for the functioning of all known living organisms. DNA is divided into segments called genes.

Dystrophin – the protein missing in people with Duchenne muscular dystrophy and reduced in those with Becker muscular dystrophy. Dystrophin is important for maintaining the structure of muscle cells.

Exon – genes are divided into regions called exons and introns. Exons contain the code for the protein and are interspersed with introns, which are also sometimes called ‘junk DNA’.

Exon skipping – a potential therapy currently in clinical trial for Duchenne muscular dystrophy.

It involves ‘molecular patches’ or ‘antisense oligonucleotides’ which mask a portion (exon) of a gene and causes the body to ignore or skip-over that part of the gene. This restores production of the dystrophin protein, albeit with a piece missing in the middle.

Gene – a portion of DNA containing the instructions for the production of a specific protein.

Genes usually come in pairs, one inherited from each parent.

Molecular patch – see antisense oligonucleotide.

Motor neuron - nerves that carry signals from the central nervous system to the muscle. They are responsible for telling the muscle to contract.

www.muscular-dystrophy.org/research

The motor neurons are affected in spinal muscular atrophy (SMA).

Mouse model – see animal model.

Mutation – a change in a gene. Mutations can be passed on from generation to generation.

Outcome measure – a way to reliably measure the effectiveness of a treatment or therapy.

Preimplantation genetic diagnosis – a technique developed to enable people with a genetic condition running in their family to avoid passing it on to their children. It involves eggs being fertilised by sperm in the laboratory (IVF) and testing the resulting embryos to identify low-risk embryos to start a pregnancy.

Phase 3 clinical trial – multicentre trial involving a large number of patients aimed at being the definitive assessment of how effective a treatment is prior to applying to the regulatory authorities for approval to make the treatment widely available.

Placebo-controlled trial – a clinical trial where some of the participants receive a placebo treatment - an inactive substance designed to resemble the drug being tested. This clinical trial design is used to rule out any benefits a drug might exhibit because the recipients believe they are taking it.

Protein – molecules required for the structure, function, and regulation of the body’s cells, tissues, and organs. Our bodies contain many thousands of different proteins, each with unique functions. The instructions for their construction are contained in our genes.

RNA – a substance very similar to DNA. When a gene is ‘switched on’ RNA carbon copies of the gene are made which move to the protein producing machinery of the cell.

Stem cells – cells that have not yet specialised to form a particular cell type, and can become other types of cell such as muscle cells. They are present in embryos (embryonic stem cells) and in small numbers in many adult organs and tissues, including muscle.

The Muscular Dystrophy Campaign’s medical research programme has an international reputation for excellence, investing in excess of £1m each year, which includes more than 25 live projects taking place at any one time.

Our information, care and support services, support networks and advocacy programmes support more than 5,000 families across the UK each year. Over the past 25 years we have awarded more than 6,000 grants totalling more than £6m towards specialist equipment, such as powered wheelchairs.

Disclaimer While every effort has been made to ensure the information contained within Target Research is accurate, the Muscular Dystrophy Campaign accepts no responsibility or liability where errors or omissions are made. The views expressed in this magazine are not necessarily those of the charity.

ISSN 1663-4538 Muscular Dystrophy Campaign 61 Southwark Street London SE1 0HL t: 020 7803 2862 e: hello@muscular-dystrophy.org w: www.muscular-dystrophy.org

Registered Charity No. 205395 and Registered Scottish Charity No. SC039445 Printed on PEFC paper, produced at a mill that is certified with the ISO14001 environmental management standard Enclosed into a bio-degradeable polybag

3 Happy New Year and welcome to the first issue of Target Research for 2012! With the New Year comes good news about advances in research and clinical trials, but also new challenges (and not just working off that extra serving of Christmas pud!).

Welcome

One challenge the Muscular Dystrophy Campaign has taken on this year is to help support the setting up of patient registries (see page 4). Patient registries are a topic close to my heart because when people phone or email me and want to know how they can get involved in clinical trials, one proactive thing I can advise them to do is to join a registry if one exists for their condition. Patient registries are an important tool for researchers too because they help with clinical trial planning and get trials under way more quickly.

The bulk of our news pages this quarter are filled with updates from the World Muscle Society congress where lots of research results were reported for many different neuromuscular conditions. Two members of our team attended the meeting and they report the news on page 8.

Another highlight of this issue is an article about the myotonic dystrophy research we have been funding in Professor Darren Monckton’s laboratory in Glasgow. In this article, beautifully illustrated by our in-house designer Deborah Waters, you can find out about their latest results.

You won’t want to miss the latest edition of our sister publication TargetMD. If you are a subscriber you will already have your copy and may have already enjoyed this issue which has an education theme at its heart. As editor Ruth Martin tells us on page 10, she has travelled all over the country to gather loads of personal perspectives on education and more. If you would like to subscribe to receive the TargetMD and Target Research package posted to you four times per year, please contact us. I hope you enjoy this edition of Target Research, if you have any feedback or ideas for future issues I’d love to hear from you.

Kristina Elvidge, Ph.D Editor

Contents

t: 020 7803 4813 e: k.elvidge@muscular-dystrophy.org tw: twitter.com/kelvidge

4 Time to register - how patient registries are opening up opportunities for

both patients and researchers 7 Point of view - Sarah Rose tells us what its like to join a patient registry 8 Research and clinical trials - news from the UK and around the world 11 Myotonic dystrophy - a more accurate diagnosis and possible therapies?

14 Ask a scientist – your questions answered by experts in the field 15 A stronger future – words of hope from Dr Marita Pohlschmidt,

Director of Research Follow us on: www.facebook.com/musculardystrophycampaign Follow us on: www.twitter.com/TargetMD leading the way forward

4

Time to register Professor Hans Lochmüller Newcastle University - Patient registries activity leader and Chair of the Oversight Committee, TREAT-NMD Rachel Thompson PR and Communications Officer, TREAT-NMD Patient registries are a hot topic at the moment. At the Muscular Dystrophy Campaign we are receiving more and more enquiries from patients interested in registering with the hope of opening up opportunities to take part in clinical trials. Over the past year we have also set the wheels in motion to establish more patient registries so that families in the UK don’t miss out. A driving force in setting up patient registries both in the UK and internationally has been the organisation TREAT-NMD so we asked Professor Lochmüller and Rachel Thompson to tell us more.

www.muscular-dystrophy.org/research

5 Introduction The advances made in research over the last two decades have led to a better understanding of the biological processes that make muscles move and why they get weaker and waste away when disease strikes. Researchers now have a clearer idea about the key players and how they interact to make our muscles carry out the tasks we’d like them to do.

Understanding muscle biology and what goes wrong in muscle disease has been the gateway for the development of promising therapies and a growing number of clinical trials are now underway to test their safety and benefit in patients.

Setting up clinical trials, however, is not an easy enterprise. Most inherited muscle conditions are rare and any one muscle centre will not look after a sufficient number of patients to be able to conduct a clinical trial on its own.

In addition, potential treatments such as “exon-skipping”, which is currently being developed for Duchenne muscular dystrophy, can only be used for a subset of boys and therefore the number of people suitable for a clinical trial is even smaller. This means that several muscle centres nationally or even internationally have to work together and this requires a certain infrastructure.

Patient registries represent a crucial part of this infrastructure, because quite simply they enable the people doing the research to make contact with the individuals who might be able to take part in it.

What are patient registries?

Patient registries are databases that contain information about individuals affected by a particular condition. Most registries focus on the information that is needed to find patients eligible for clinical trials, but they have many other benefits. Patients can link to the research community and have the opportunity to find out about care standards and other information directly relevant for their condition.

The registries are generally designed for one specific condition and include information about the symptoms of those patients and, if possible, what

their genetic diagnosis is. In many countries the individual with the condition or his/her parent or guardian enters the information themselves using an online interface. The registries are managed by a curator who monitors whether the data is entered correctly.

TREAT-NMD – a driving force in patient registries TREAT-NMD is an international initiative bringing together doctors, researchers and patients to speed up the process by which promising research in the lab can make it all the way to becoming an approved therapy for patients.

The network covers many different aspects of this highly complex process.

For example, scientists are encouraged to agree on ways of doing research in the laboratory such as testing new potential treatments in the same type of animal models. This enables them to directly compare their results. TREATNMD also strives to gain international agreement on the best way to test the benefit of a drug in a clinical trial - these are sometimes referred to as outcome measures. This is particularly essential for international trials as results from different participating centres can only be compared if clinicians assess safety and muscle function in the same way.

Another aspect of the initiative’s work is to bring international experts together to discuss how best to care for patients.

The aim is to standardise care all over the world so that patients will benefit from the best possible treatment no matter where they live.

Since its launch in 2007, TREAT-NMD has been instrumental in setting up patient registries across the world.

For example, before TREAT-NMD began, there were just four registries for Duchenne muscular dystrophy and each of these collected a slightly different set of information. Now, at the end of 2011, there are registries in over 40 countries and all of them collect the same standardised details about their patients (see map page 6). The information from the national registries is combined into a single international registry, which has a wealth of useful information for research and care.

These registries would not be possible without the support of patient charities across the world, who have understood the importance of combining all this

information into a single powerful resource and who are themselves responsible for many of the national registries that provide their data to the international system.

Who can register and how do you do it?

Registries are already in place for several neuromuscular diseases (please see page 6) and anyone who has one of the conditions listed can register. If you are the parent of a child with the condition, you can register on their behalf. All registries involve filling in a form on the internet and if you do not have access to the internet you can make contact by phone and be sent a paper version of the registration form.

You are generally asked a number of questions about yourself and how the condition affects you. You might also be asked to give your consent for the curator to approach your clinician for more specific clinical or genetic information.

For some very rare conditions, or conditions that have many different subtypes such as the congenital muscular dystrophies, international registries have been set up without the intermediate step of national registries.

So rather than registering with a local database you will be directed to a registry website for patients with your condition worldwide.

Is my data safe?

All data you give to the registries is stored on a secure server (protected in a similar way to online bank accounts) and only specially appointed staff have access to it. If the registry is run by a patient organisation we ask them to adhere to the ‘TREAT-NMD Registries Charter’ that sets out our relationship with the national registry and provides guidelines to protect your data. At all times the data remains your property and you have the right to withdraw it.

When your data is transferred to the international TREAT-NMD registry, your personally identifiable information does not go with it – your data is identified only by a code. This means you can be sure that your details are safe and nobody unauthorised can access them.

The national and international registries are also governed by an oversight committee that includes members from leading the way forward

6 Registries Duchenne muscular dystrophy Online registration for the UK national registry: www.dmdregistry.org or phone 0208 556 9955.

Spinal muscular atrophy Online registration for the UK national registry: www.treat-nmd.org.uk/registry or phone 0191 241 8640.

LGMD2I and MDC1C One international registry has been established for all conditions caused by mutations in the FKRP gene which includes limb girdle muscular dystrophy type 2I (LGMD2I) and congenital muscular dystrophy type 1C (MDC1C).

Online registration: www.fkrp-registry. org or phone 0191 241 8640.

Congenital muscular dystrophy and congenital myopathies The Congenital Muscle Disease International Registry (CMDIR) accepts online registration from patients with all forms of these conditions: www.cmdir.org. There is no phone number but you can call the Muscular Dystrophy Campaign if you need assistance.

LGMD2B and miyoshi myopathy Both limb girdle muscular dystrophy type 2B (LGMD2B) and miyoshi myopathy are caused by mutations in a gene called dysferlin and data will be collected in the International Dysferlinopathy Registry which is currently under development. The launch date worldwide is in early 2012.

In the meantime you can register with the Jain Foundation’s patient registry at www.jain-foundation.org

Duchenne muscular dystrophy national registries in 2007 before TREAT-NMD was set up www.muscular-dystrophy.org/research

the TREAT-NMD network and patient organisations. It is their responsibility to monitor that the registry is appropriately run and to review any request for data, for example if a company planning a clinical trial requests information from the registry.

If you don’t give my details away, how will I be contacted about trials?

The main point of the registries is to be able to find patients for trials and the registry acts as a kind of “trusted intermediary”. A company or researcher can come to us with a specific request – like “we need to recruit 15 patients in the UK who have this specific mutation, are in this particular age range, are taking these drugs, and are able to walk without assistance”, and the registries have all this information immediately to hand. First it is checked that the company has all the necessary ethical approvals to run the trial.

If the oversight committee for the registry approves the request then we can contact everyone in the registry who meets these criteria to tell them there is a trial they might be eligible for and give them details of how to proceed. This usually involves patients contacting the clinic running the trial to arrange an appointment to discuss the trial and what it involves. Only if they are interested do patients need to do anything – the company is never given their details.

How have registries helped in the development of treatments?

Companies developing treatments for neuromuscular conditions have asked for help from the registries in two main areas. Firstly, when they are in the planning stages of their trial, they can use the registries to find out statistical data about the numbers of patients who might meet the criteria for the trial and this helps them decide how many centres in how many countries they need in order to make sure they can recruit sufficient patients quickly enough. Secondly, when they come to recruit patients for the trial, they can ask the registries to contact all potentially eligible patients on their behalf. This is particularly helpful because usually only one or two centres in every country will be running the trial, and those centres only know the patients who are normally seen in that centre, which means patients elsewhere in the country may miss out.

Several pharmaceutical companies have already made good use of the data in the patient registries.

For example, when Prosensa and GlaxoSmithKline found that recruitment into their exon skipping trial for Duchenne muscular dystrophy was too slow they used the international Duchenne muscular dystrophy registry to help them recruit their remaining patients. Trophos, a French company used the international SMA registry for recruitment to its recent European

TREAT-NMD affiliated Duchenne muscular dystrophy national registries in 2011

7 trial to test the benefit of a drug called olesoxime for patients with spinal muscular atrophy type 2 and 3. In several countries this really sped up the recruitment of participants and the trial could be started more quickly.

Registries currently in development Myotonic dystrophy type I TREAT-NMD is currently working with the Muscular Dystrophy Campaign and the Myotonic Dystrophy Support Group to establish a UK registry for patients with myotonic dystrophy type I (DM1).* Facioscapulohumeral muscular dystrophy (FSHD) TREAT-NMD is also working with the Muscular Dystrophy Campaign to set up a registry for people in the UK with FSHD.* *A curator based in Newcastle has been in post since the new year to manage both the myotonic dystrophy and FSHD registries which will be developed in 2012. If you would like to be notified when these registries are up and running please contact us.

Myotubular and centronuclear myopathies This registry is a joint venture between TREAT-NMD, University College London and The Myotubular Trust and is for patients in the UK and continental Europe. If you would like to be notified of its launch, please email the Myotubular Trust for a pre-registration form: research@myotubulartrust.org Congenital myasthenic syndromes The Muscular Dystrophy Campaign is working with the Myasthenia Gravis Association and Myasthenia Kids to establish an international registry for congenital myasthenic syndromes.

If you can’t find your condition listed above but would be interested in knowing whether a registry is planned for you, please contact the Muscular Dystrophy Campaign’s dedicated research information service: Phone Kristina on 020 7803 4813, or email research@muscular-dystrophy.org

Links... w: www.treat-nmd.eu w: www.muscular-dystrophy.org/research/ patient_registries

What is it like to join a patient registry?

We asked Sarah Rose, one of the volunteer moderators of our online forum TalkMD, how she went about joining a registry and what it involved.

Sarah is 33 and was diagnosed with congenital muscular dystrophy when she was six. She was told in her twenties that she probably has the subtype called Ullrich congenital muscular dystrophy, although the exact mutation has not yet been identified. She lives in East Sussex in an adapted bungalow with 24 hour care and as well as moderating our forum, Sarah also does social policy work for her local Citizens Advice Bureau.

What registry have you signed up to?

The Congenital Muscle Disease International Registry (CMDIR) (www. cmdir.org) which is managed by the US patient organisation CureCMD.

experiences of congenital muscular dystrophy can be shared the more can be learnt, and it has the potential to affect clinical trials and research into treatments.

How did you hear about it?

I found out about it through my links with the CureCMD organization in the US and from being a member of an online support group for my subtype of muscular dystrophy.

Did you have any concerns when you were considering registering?

I didn’t have any concerns. I thought it was a worthwhile thing to do. It is an international database and it is great to think that people all over the world can contribute to the bank of information and make a difference. It is supported by recognised muscular dystrophy charities including the Muscular Dystrophy Campaign and the TreatNMD Neuromuscular Network so I was sure the details I provided would be safe and used wisely and the website states that all information is stored in a secure database.

What did you have to do to register?

How long did it take?

I had to create a login and password then go through a number of categories, basically building a profile of myself and my condition.

The categories include questions on diagnosis, motor and breathing ability and treatment. There is also the opportunity to attach documents, for example, biopsy reports and other relevant information. I think it took about half an hour but it does not have to be done all at once.

What made you want to sign up?

What do you see the benefits as being?

I signed up because I think the more our knowledge and first-hand

Have you seen any benefits from signing up yet?

I receive an annual newsletter and notices of clinical trials. I would be willing to help if I was contacted about research. Also there is an online counselling service if you have any questions - I may have cause to use this in the future. leading the way forward

8

Research

news

Highlights from the World Muscle Society Congress Over 550 scientists and clinicians from around the world came together for the World Muscle Society congress and highlights included news of potential therapies for Duchenne muscular dystrophy, spinal muscular atrophy and myotonic dystrophy. This was a welcome step forward compared to the congress we attended two years ago which was more focussed on understanding muscle disease than developing therapies.

Dr Julia Amber Head of Grants, attended the congress and here summaries her highlights.

Duchenne muscular dystrophy Muscular Dystrophy Campaign-funded scientist, Professor Steve Winder from the University of Sheffield, gave the opening lecture of the conference describing his work to find a therapy for Duchenne muscular dystrophy.

Professor Winder is using zebrafish to screen for drugs which could stabilise the structural scaffolding inside the muscle cell without replacing the dystrophin protein.

Dr Nathalie Goemans from University Hospitals Leuven in Belgium gave one of the most exciting presentations about clinical trial results. She updated us on the ongoing Prosensa/GSK phase 1/2a extension trial of the www.muscular-dystrophy.org/research

molecular patch (also called antisense oligonucleotide) designed to skip exon 51 of the dystrophin gene. In this study the 12 boys involved in the original trial continued to receive the molecular patch for up to 96 weeks. Dr Goemans reported that the drug was safe and well tolerated and of the 10 ambulant boys that entered the extension study, seven either stabilised or improved in the six-minute walk test. It’s important to remember that this is an open-label study (all the participants know they are getting the active drug) in a very small number of patients and we look forward to seeing these results being confirmed in a placebo-controlled trial.

Such a trial - the phase 3 trial - is now underway.

Dwi Kemaladewi from Dr Aartsma-Rus’ research group in the Netherlands presented data from studies in mice that showed that blocking the activity of a hormone called myostatin could be a potential treatment for Duchenne muscular dystrophy. This hormone usually slows down muscle growth, so blocking it could boost muscle mass in patients. Combining myostatin blocking with exon skipping to repair the dystrophin gene could prove to be an effective treatment package, but more research is required to improve its effectiveness before testing in humans can be considered. We are funding research into optimising this strategy in Professor Dickson’s laboratory at Royal Holloway - University of London.

Exon skipping and other approaches to gene therapy cropped up a lot at the congress and Dr Matthew Wood from the University of Oxford gave an excellent presentation on this subject.

He presented his cutting-edge work, funded by the Muscular Dystrophy Campaign, on improving delivery of molecular patches to the muscle and heart for Duchenne muscular dystrophy. Although the recent clinical trial results for exon skipping have shown promise, there are still challenges in getting the molecular patches to all the muscles. He and his colleagues have developed “nextgeneration” molecular patches by chemically joining the patches to small protein molecules called peptides that are able to get into the muscle cells more easily. They hope to start a clinical trial to test these new molecular patches in 2013, which is great news.

Spinal muscular atrophy Another main theme of the conference was spinal muscular atrophy (SMA).

This part of the conference was kicked off with an excellent talk by Professor Arthur Burghes from Ohio State University. He talked about three different treatment approaches for SMA - gene therapy using a virus to deliver a healthy gene, antisense oligonucleotides (AOs) and drug therapy. It was stressed that preliminary research has shown that all of these potential treatments would need to be given early in life to have a beneficial effect. If this is the case, it would mean that newborn screening for SMA is a necessity.

Individuals with SMA have two nonfunctional copies of the SMN1 gene in their DNA (one inherited from each parent). The SMN1 gene is responsible for the production of a protein called SMN which is critical for motor neuron survival. Gene therapy for SMA involves using a virus to deliver a healthy copy of the SMN1 gene to the nerves. Initial results using an animal model of SMA have been promising with the mice showing an increase in lifespan to over a year (they normally die within a few days after birth) and SMN protein detected in the nerves.

Antisense oligonucleotides (AOs) are currently being used to develop a type of gene therapy for Duchenne muscular dystrophy. It is thought the same

9 technology could be used in a different way to treat other conditions including SMA. Scientists can take advantage of the fact that everybody has at least one copy of a gene that is closely related to the SMN1 gene called SMN2. This gene mostly produces shortened versions of the SMN protein that do not work but AOs can be used to increase the amount of full-length, working SMN protein produced from this gene. This approach has been successfully tested in a mouse model of SMA - SMN protein was seen in the nerves and the lifespan of the mice was increased.

The final approach is a drug therapy being investigated by PTC Therapeutics.

Researchers at the company have screened thousands of potential drugs for any that increased levels of SMN protein in cells grown in the laboratory.

So far they have found three positive hits. Testing in a mouse model of SMA provided further encouraging data: SMN protein was produced and a positive effect was seen on the lifespan of the mice. Further work is now ongoing to optimize these drugs before a lead compound is identified to go into clinical trial.

On 29 November 2011 PTC Therapeutics signed an agreement with pharmaceutical giant Roche which will provide the crucial injection of cash needed to bring this promising potential treatment to clinical trial.

showed that the AOs could decrease the levels of toxic RNA by up to 90 percent in cells grown in the laboratory.

They got similar results when the AOs were injected into the muscle of a mouse model of myotonic dystrophy type 1, but when they were injected into the blood stream the results were not as good since the AOs were not reaching the muscles in sufficient quantity. This problem is one that is also being faced in exon skipping for Duchenne muscular dystrophy where it can be difficult to get the AOs to all the muscles of the body in high enough quantities. Professor Puymirat intends to investigate this further and he reported that they hope to start the first clinical trial in 2013.

FSHD research advances There were two main highlights at the American FSH Society congress in Boston in November. It is now known that the genetic change causing FSHD results in the production of a toxic protein called DUX4, but how it exerts its toxic effect on muscle is not understood. At the meeting Dr Tapscott from Seattle presented his group’s latest research into DUX4. It is thought that DUX4 protein can interact with and regulate the activity of various genes.

Using a new technique they identified a number of genes that are directly under the control of DUX4. The identification of DUX4 target genes will greatly aid

future research and could lead to the identification of new therapeutic approaches that could be developed for FSHD. Another highlight at the congress concerns a rare type of FSHD which is often called FSHD2. These patients don’t have the DNA deletion that usually causes FSHD. However, it has been shown that their DNA, for some unknown reason, has features in common with patients with the deletion. The DNA, rather than being tightly coiled, is more relaxed which allows the production of toxic DUX4 protein. Dr Lemmers from The Netherlands presented his work at the congress on their development of a very reliable laboratory test to detect the DNA relaxation in FSHD1 and FSHD2 patients. This is important because patients without the usual DNA deletion currently do not get a definite genetic diagnosis and are often misdiagnosed as having other types of muscular dystrophy. The improved laboratory test will therefore allow clinicians to give patients with FSHD2 a clearer diagnosis.

Myotonic dystrophy Professor Jack Puymirat, from Canada gave an update on the use of antisense oligonucleotides (AOs) for myotonic dystrophy. His group has been using AOs to decrease the amount of toxic RNA produced by cells affected by myotonic dystrophy type 1. Testing Professor Victor Dubowitz, President of the World Muscle Society, with the young scientists who were presented with prizes for the best posters

leading the way forward

10

News in Brief Reliable muscle function test for boys with Duchenne developed The Muscular Dystrophy Campaign’s North Star project has developed a way to reliably test the muscle function of boys with Duchenne muscular dystrophy. The protocol sets out a standard way for clinicians to assess the ability of the child to perform 17 activities, including standing, headraising, hopping, and running. The test was shown to be quick to carry out and could be accurately scored by many examiners. This makes it ideal for use in clinical trials based across several locations.

Potential new therapy for nemaline myopathy Australian scientists have discovered a potential new therapy for nemaline myopathy by studying a new mouse model of the condition. The researchers found that supplementing the diets of these mice with L-tyrosine improved their mobility and the appearance of the muscles under the microscope.

We don’t know if these results in mice will translate into improvements in

symptoms for people with nemaline myopathy but we hope a clinical trial will be organised in the near future because, if proven to work, it could bring a relatively cheap and widely available treatment to patients.

Stem cell transplant success in mice Adding a healthy copy of the dystrophin gene to muscle cells in the body is one approach to treating Duchenne muscular dystrophy.

However, due to its huge size it has so far only been possible to add shortened copies of the gene to cells. An Italian group of scientists have recently overcome this problem by creating an artificial chromosome (a bundle of genetic information) containing a complete copy of the dystrophin gene.

This chromosome was added to stem cells taken from the blood vessels of mice that have a condition similar to Duchenne muscular dystrophy. When the stem cells were transplanted back into the mice, healthy muscle cells were made and symptoms alleviated.

Generating enough stem cells for transplant is a challenge so further research is needed in order to apply this approach to humans.

More exon skipping drugs for Duchenne AVI Biopharma has entered into collaborations with various research institutions and funding bodies in the US to develop two new exon skipping drugs for Duchenne muscular dystrophy.

They will focus on developing exon skipping drugs to target exons 45 and 50 of the dystrophin gene which could potentially treat about eight and four percent of boys respectively. The research will involve preclinical studies in the laboratory to test the safety of the new drugs and to gain an understanding of how the drugs are likely to be absorbed and metabolised by the body. These studies need to be carried out before applying for permission to test them in human patients.

This brings the number of molecular patches in the pipeline up to seven. Dutch biopharmaceutical company Prosensa has developed a slightly different chemistry of molecular patch and in 2009 they entered a partnership with GSK to further develop and test exon skipping therapies.

Exon skipped

Proportion of boys potentially treated

AVI Biopharma

44

6.2 %

45

8.1 %

50

4.0 %

Pre-clinical

51

13 %

Phase 2 trial

Pre-clinical*

52

4.1 %

Pre-clinical

7.7 %

Pre-clinical*

55

2.0 %

Pre-clinical

www.muscular-dystrophy.org/research

The January edition of Target MD focuses on education as its central theme, with a feature on pupils from a few mainstream and special schools around the country, as well as stories from a current university student and a recent graduate. You can read about our new schools’ network and our specialist training for education professionals.

To write our regular features on sport and inspiring individuals, I travelled up to Scotland in late November to meet some young men with muscular dystrophy, who are likely to play Boccia for ParalympicsGB at the 2012 Paralympics, and to meet two other outstanding individuals whose life stories are certain to inspire.

We also bring you news of success in our campaigns and advocacy services, all the details of the President’s Awards from our National Conference in Nottingham last October, as well as our regular fundraising inserts from your region.

I hope you’ll enjoy reading Target MD. If you have any ideas or feedback about any of the articles or future articles you’d like to see, please do get in touch.

I’d love to hear from you.

Ruth Martin Editor, Target MD

Phase 3 trial

53

* estimated to go to phase 1 trial in 2012

I wanted to pop over to Target Research to tell you a bit about the sister magazine that I edit: Target MD. It forms part of the two-magazine package from the Muscular Dystrophy Campaign that you’ll receive if you subscribe, and if you don’t yet subscribe, perhaps this will whet your appetite to consider doing just that!

Prosensa/GSK Phase 1/2 trial

Pre-clinical

Hello from Target MD!

Target MD is also available to read online www.muscular-dystrophy.org/ about/what_we_do/key_publications/ targetmd

11

Myotonic dystrophy: A more accurate diagnosis and possible therapies?

Dr Sarah Cumming University of Glasgow

Recently, researchers in Professor Darren Monckton’s laboratory at the University of Glasgow funded by the Muscular Dystrophy Campaign discovered that in some families the symptoms of myotonic dystrophy are much less severe due to an unusual change in their DNA. The information they are gathering by studying these unusual families may eventually lead to new therapies for myotonic dystrophy. Dr Sarah Cumming, a post-doctoral researcher in Professor Monckton’s laboratory, tells us more.

What is myotonic dystrophy?

Myotonic dystrophy type 1 (DM1) is the most common form of muscular dystrophy, affecting approximately 7,500 people in the UK. Patients may have a variety of symptoms including muscle weakness that particularly affects the muscles of the face and neck, muscle stiffness (myotonia), cataracts and heart problems. The condition can affect both sexes, and occurs when a mutated copy of a particular gene is inherited from either parent. DM1 is very variable in terms of which symptoms may occur and when, and our research is helping us to understand why this is.

What causes myotonic dystrophy?

In each of our cells there are two copies of the DNA instructions needed to make and maintain our bodies, one copy each from our mother and father. This DNA contains four different chemicals known as A, C, G and T, which are arranged in a different order depending on where in the DNA you look. This order is known as the sequence of the DNA. Usually the sequence of the DNA appears superficially random, but it is in fact a kind of code that contains the information needed to make all the

Family tree of a typical family with myotonic dystrophy type 1 (DM1) Through the generations, the number of CTGs in the DM1 gene (shown on each person in the family tree) increases and the symptoms worsen and appear at a younger age.

80

Only family members affected by DM1 are shown. Each child of a parent with DM1 has a 50% chance of inheriting the condition.

170

650

200

150

700

leading the way forward

12 proteins in the body, at the right time and in the right place. To achieve this massive feat, our genetic code needs about three billion of the A, C, G and T chemicals.

Our DNA is divided into approximately 26, 000 genes. The DNA code of each gene is translated into the chemical letters of a protein (known as amino acids) via an intermediate messenger known as RNA. When a particular protein is needed by the body, the gene containing the instructions for making it is ‘switched on’ inside the nucleus or ‘control centre’ of the cell. Then RNA ‘photocopies’ of the gene’s code are made which move outside the nucleus to where they direct the manufacture of proteins.

Sometimes there are changes in the DNA sequence. Often, these changes do not matter, because the meaning of the instructions is not altered, and the same protein is made. However, if they do change the meaning of the DNA, they can cause an inherited disease.

These DNA changes are known as mutations. Often the disease results from a particular protein either not being made at all, or not working in the correct way.

In the DM1 gene, there is a stretch of DNA code consisting of C, T and G repeated several times (CTG CTG CTG CTG CTG…). In most people, there are between five and around 40 CTG repeats. People with DM1 however, have extra copies of CTG in that particular gene. These people may have anything from 50 up to many thousands of CTGs in their DM1 gene, while their second copy has the more usual number of five to 40 repeats.

In people with DM1 the protein encoded by the DM1 gene appears perfectly normal. Instead it is the RNA copy of the gene that causes problems.

The extra repeats in the RNA code stick to other proteins in the cell such as a protein called ‘muscleblind’. This means there are not enough of these proteins free to do their proper job. This has a knock-on effect on other proteins in various parts of the body, and can provide a good explanation for most of the known symptoms of myotonic dystrophy.

In DM1 patients - the more CTG repeats www.muscular-dystrophy.org/research

that are present, the more severe their symptoms are. The number of CTG triplets in a patient’s DNA increases during their lifetime, so their symptoms get worse as they get older. Also, for reasons we do not yet fully understand, the number of CTGs in an affected baby’s gene is usually larger than in their parent’s, particularly when the gene is inherited from the mother.

This means the symptoms are likely to begin earlier, and be more severe, in successive generations. This worsening over successive generations is known as anticipation, and is shown in the family tree diagram on page 11.

Unusual DNA repeats equal mild symptoms Sometimes, families with DM1 have much less severe symptoms than expected. They may not show anticipation, or may have extra symptoms that do not quite fit with the ones clinicians usually see. For example, a researcher called Dr Frank Spaans and his colleagues in the Netherlands have spent over 20 years studying one particularly unusual family that has some symptoms of a disease called Charcot-Marie-Tooth (CMT), as well as DM1. In CMT nerve impulses are conducted more slowly than usual down the arms and legs resulting in weakness and wasting of the muscles below the knees and often those of the hands. Several generations of this Dutch family had these classic signs of CMT but they could not find the mutation that usually causes CMT. Then Dr Claudia Braida from Professor Monckton’s lab showed that in DNA samples from this family, the CTG repeats are mixed up with other sequences, for example CCG and CGG, in a complicated pattern. This appears to account for the extra symptoms in these patients. At around the same time, another research group in the Czech Republic described some similarly unusual repeats in families with fewer symptoms than expected.

It turns out that these unusual repeats are found in about three or four percent of all DM1 families, and we now know they can make a big difference to how the disease progresses.

In Professor Monckton’s laboratory, work has been ongoing to study a much larger number of these unusual repeats so that we can better

330

0

13 understand how they impact on patients’ symptoms. When we get patients’ DNA samples in the lab, we first look carefully at the descriptions of their symptoms, and try to spot any unusual patterns.

We then start to study the DNA of these patients. In the lab we are able to find out the size of the CTG repeat in the DM1 gene and whether the CTG triplets are interspersed with the unusual ones such as CGGs and CCGs.

Family tree of a family with myotonic dystrophy type 1 (DM1) and unusual repeats in their DNA

500

Through the generations, the number of DNA repeats decreases (shown on each person in the family tree), and the symptoms do not get dramatically worse in the younger members of the family.

Only family members affected by DM1 are shown.

Each child of a parent with DM1 has a 50% chance of inheriting the condition.

400

400

From studying the DNA of many families with unusual repeats, it is now clear that such families do not typically have extra symptoms. Rather, their symptoms are often less severe, probably at least partly because the unusual triplets stabilise the region and stop the triplets expanding so quickly, either during the patient’s lifetime or between generations. This is shown in the family tree diagram left.

Why are the symptoms milder?

We have taken copies of these unusual repeat sequences and added them to human cells grown in the laboratory.

We can use a red dye to show us where the RNA that corresponds to the repeats is found. In the same cells, we can use a green dye to locate muscleblind protein. By looking at these cells under a microscope we see that muscleblind protein sticks to the repeat-containing RNA, even when unusual triplets are present. However, the location of the unusual repeat RNA in the cell is different and it seems that more of it is escaping from the nucleus of the cell. This might help explain

why the symptoms are less severe in patients with unusual repeats. It isn’t straightforward though and varies depending on the mixture of different repeats in the RNA. More accurate diagnosis and possible therapies Myotonic dystrophy is a highly variable disease, making it hard to discern clear connections between the particular mutations in the affected gene and the symptoms that patients experience.

As we study more and more DNA containing unusual repeats however, our understanding of how the pattern of the disease is altered increases all the time. In the next few years, we hope to develop a diagnostic test for unusual repeats that could be used more routinely. But it is essential that such a test be combined with sound information about what the results could imply for the patients involved, so that clinicians can give them the best possible advice to help them manage their symptoms.

In the longer term, our understanding of the stabilising effect of unusual repeats could be applied to the much more common pure CTG triplet repeats, perhaps eventually allowing us to develop therapies that could slow the progress of the disease. For example, using a type of gene therapy the unusual repeats could be introduced into the DNA of people with pure CTG repeats, stabilising the DNA and lessening the symptoms. Of course there would be many difficulties, such as getting the DNA into the correct cell types but it is an option for exploration in the future.

How do we study DNA in the laboratory?

330

400

300

The DNA photocopier In the lab, we have a machine called a polymerase chain reaction (PCR) machine that can make millions of copies of the tiny part of the patient’s DNA we want to look at, which is the part that contains the extra CTGs. A DNA sieve We use a kind of sieve to determine the length of the piece of DNA we have made with the PCR machine. Knowing the length of the DNA allows us to calculate how many times the CTGs are repeated. The sieve is a gel which sets like jelly. It has small holes in it so short pieces of DNA pass easily through the holes and go a long way, and longer pieces cannot move so far .

DNA scissors We use something that acts like a tiny pair of scissors, but which only cuts the DNA where one of the unusual triplet repeats is found. If the DNA gets smaller after using these ‘scissors’, we have detected unusual repeats.

The DNA reader When we have found a patient whose DNA appears to have unusual repeats we can then use a machine to work out the exact order of all the A, C, G and T letters that are present. This is called DNA sequencing. leading the way forward

14

Ask a Scientist The Muscular Dystrophy Campaign research team is always available to answer any questions about research. Questions we don’t know the answer to, we refer to our network of scientists and clinicians working in the field. In this article we posed some of the questions we have received recently to top researchers for further expert opinions.

Q. Could the utrophin drugs being

developed for Duchenne muscular dystrophy also help Becker muscular dystrophy patients? @paulph via Twitter

A. It is thought that utrophin,

a protein naturally present in our body in small amounts, may be able to compensate for a lack of dystrophin since both proteins are structurally similar and appear to have very similar functions. Duchenne muscular dystrophy patients have no dystrophin in their muscles so any extra utrophin produced can quickly occupy the positions left empty by dystrophin at the edge of muscle cells. In Becker muscular dystrophy patients, the situation is different. In some cases, reduced levels of dystrophin are observed and there are also some muscle fibres which have no dystrophin.

Here, utrophin protein could occupy the vacant sites and if there was enough utrophin it would improve muscle function. In cases where the Becker muscular dystrophy patient has partially functional dystrophin in every muscle fibre, utrophin will only be able to replace dystrophin if it can attach to the muscle cell more effectively than the partially functional dystrophin that is already there and replace it. This may well be the situation for many patient mutations but it has not been tested yet.

In collaboration with Oxford drug discovery company Summit Corporation plc we have found a potential drug to increase levels of

www.muscular-dystrophy.org/research

utrophin called SMT C1100. Research has shown that treating a mouse model of Duchenne muscular dystrophy with SMT C1100 resulted in increased muscle strength and muscles that didn’t tire as easily. Summit has recently secured £1 million worth of funding from several US-based charities. This will enable Summit to manufacture a new formulation of SMT C1100 and conduct a Phase 1 clinical trial in healthy volunteers.

Our laboratory together with our collaborators in the Department

of Chemistry has recently received funding from the Muscular Dystrophy Campaign and Muscular Dystrophy Association USA to search for further compounds that may be even more efficient at increasing levels of utrophin in the muscles.

Professor Dame Kay Davies University of Oxford.

Q. Do you know whether

preimplantation genetic diagnosis (PGD) is available in the UK for people with facioscapulohumeral muscular dystrophy (FSHD)?

Question asked via the FSH-MD Support Group UK.

A. We have had several referrals

to the Centre for Reproductive and Genetic Health and University College London Centre for PGD for FSHD and have already carried out treatments.

Due to the nature of the inheritance of this condition it is important for the individual hoping to go down the route of PGD to have genetic test results available. We accept NHS and private referrals, which should come via a clinical geneticist and include the patients’ telephone numbers and molecular genetics report. I aim to see a couple within a month of receiving the letter and will be happy to answer their

15 questions and arrange the next steps for IVF and PGD.

their muscles and develop progressive muscle weakness.

Karen Fordham Lead PGD Nurse, Centre for Reproductive and Genetic Health/ University College London Centre for PGD. (You can read more about PGD in the November 2011 edition of Target Research)

In recent years many potential treatments for OPMD have been tested in the laboratory. The antibiotic doxycycline, a type of sugar called trehalose and a chemical called cystamine have shown promise.

These have been shown to inhibit the aggregation of altered PABPN1 and reduce muscle weakness in OPMD mice. In addition, doxycycline and cystamine improve muscle strength in OPMD mice by limiting the death of muscle fibres. It has recently been shown that a group of drugs previously proven to slow-down aging of worms, also slowed down muscle degeneration in OPMD worms. Whilst all these drugs show promise, whether the same effects will be seen in humans needs to be tested in clinical trials. Clinical trials are extremely expensive so further research is required first to determine which of these potential treatments is promising enough to take forward.

In the meantime the infrastructure to conduct clinical trials needs to be put in place, such as the setting up of patient registries.

Q.

Is there any news on the development of potential treatments for OPMD? Asked by Mrs Pamela Towers at the Muscular Dystrophy Campaign conference in Nottingham

A. People with occulopharyngeal

muscular dystrophy (OPMD) have one altered copy of the gene that codes for a protein called PABPN1. This alteration causes the PABPN1 protein to form clumps (also known as aggregates) in muscle fibres. The formation of aggregates is associated with the degeneration and ultimately the death of muscle fibres.

Scientists have studied OPMD by putting a copy of the altered PABPN1 gene into cells grown in the laboratory, and animals such as mice and worms.

Mice with the altered PABPN1 gene (OPMD mice) have aggregates within

OPMD affects very specific muscle groups around the eyes and in the throat so one potential therapy that has been proposed for this condition is myoblast transfer. This involves taking healthy muscle cells (myoblasts) from unaffected muscles and transferring them to muscles weakened by the condition. A clinical trial is currently underway in France with the aim to use myoblast transfer to correct the swallowing difficulties in OPMD.

Exon skipping is now in the advanced stages of clinical testing and it is looking promising. However, the first experiments were carried out more than 20 years ago. This is a long time, but the good news is that once a technology shows promise researchers will explore every avenue to use it for as many conditions as possible. For example, although exon skipping was originally developed for Duchenne muscular dystrophy, a modified version might be used for other conditions such as myotonic dystrophy and spinal muscular atrophy.

If you have any research questions please get in touch: t: 020 7803 4813 e: research@muscular-dystrophy.org

At this meeting several presentations including the opening lecture were given by scientists funded by the Muscular Dystrophy Campaign which made me feel very proud. This could not have been achieved without your support and every donation, however small, is vital especially in these difficult times. This year is a leap year and we want to make this extra day count. There are lots of fundraising opportunities - you might want to join me jumping out of an aeroplane on the 29th of February. There are also less daring ways to help on this special day, please contact us to find out more.

All funds will go towards research and you can direct the funds towards the condition of your interest. Please get involved and help our scientists to find the treatments that will give our families a stronger future.

You can also join the discussion about research on TalkMD forum w: www.community.muscular-dystrophy.org

Dr Marita Pohlschmidt Director of Research, Muscular Dystrophy Campaign.

Dr Janet E. Davies Post-doctoral Researcher at Kings College London Preimplantation genetic diagnosis (PGD) is a technique developed to enable people with a genetic condition running in their family to avoid passing it on to their children.

It involves eggs being fertilised by sperm in the laboratory (IVF). The fertilised eggs are allowed to grow until they are embryos consisting of eight cells. Then one or two cells are removed and are tested for a specific genetic condition. Only embryos that test negative for the condition are put back into the womb.

A Stronger Future At the end of October the 16th International Congress of the World Muscle Society took place in beautiful southern Portugal and more than 500 scientists and clinicians met to discuss their latest advances and to network. The meeting was also a good opportunity for Julia, our Head of Grants and I to get an update on the latest progress. You might have already read Julia’s conference report on page 8 and noticed the great advances that have been made towards the development of therapeutic approaches. Although a lot of money has been dedicated to this area since the early nineties the successes of these investments are only becoming apparent now.

Links...

leading the way forward

for the

Make today count

Muscular Dystrophy Campaign Every year 100 boys are born in the UK with Duchenne muscular dystrophy. Research is getting closer to an answer every day, so funding this work is vital to the future success of finding treatments and a cure.

As 2012 is a leap year, make the extra day count with a special day of fundraising to help us raise ÂŁ30,000 towards vital research. Doing a parachute jump is one exciting option. To find out what else you can do, please contact your local volunteer fundraising manager or get in touch with us on: t: 0845 872 9058 (fundraising hotline) e: volunteerfundraising@muscular-dystrophy.org w: www.muscular-dystrophy.org/maketodaycount Registered Charity No. 205395 and Registered Scottish Charity No. SC039445