EssayService
EssayService is a professional Essay writing service that provides expert assistance to students in need of academic support. Our team of skilled writers is committed to delivering high-quality content that meets the most stringent academic standards.
An excellent quality Papers Are Free Of Plagiarism Revisions Are Free Punctuality and Reliability Payments Can Be Divided
Visit site
EssayBox
EssayBox is a reputable writing service that writes papers across more than 50 academic disciplines at any academic level, be it a a high school essay or a master’s thesis
Price from: $12 per page
Deadline: 3 hours
Money Back Guarantee Free Revisions
Visit site
SpeedyPaper
SpeedyPaper is known for its spotless reputation and strong online presence. Thousands of students report that the service delivers high-quality papers on time at a reasonable price.
Price from: $9 per page
Deadline: 6 hours
Money Back Guarantee Free Revisions
Visit site
PaperCoach
Paper Coach is a professional paper writing service based in the US that was founded to deliver academic aid to students who either lack time for their homework or want to boost their grades.
Price from: $9 per page
Deadline: 6 hours
Timely delivery
Multiple payment options
Visit site
PaperHelp
In the realm of academic writing, PaperHelp stands as the top-ranked service for Essay. So if you need help with your next term paper or research paper, choose PaperHelp for guaranteed success.
Since 2008
Money-back guaranty
Loyalty Program bonuses
100% Plagiarism FREE
Visit site
ExtraEssay
ExtraEssay is a premier Essay writing service that stands out among its competitors. With a focus on providing top-quality content, we ensure that our clients receive only the best from our team of highly skilled and experienced writers.
Loyalty discounts
Safe & Secure payments
Free Revisions and Round-the-clock support
100% Plagiarism FREE
Visit site
Professional Nursing Essay Writing Service
At our professional nursing Essay writing service, we understand the unique demands of the nursing field and are dedicated to providing top-quality writing services to nursing students. Our team of experienced writers is highly skilled in crafting professional nursing Essay that meet the highest academic standards.
Money-back guarantee
Complete confidentiality
14 days of free revisions
Chat with your writer
Visit site
Grademiners
Our services cover a wide range of subjects, ensuring that we can meet the needs of any student seeking assistance with their Essay. When it comes to research paper writing, you can rely on Grademiners to provide the best service available. Choose us for good Essay writers and achieve your academic goals.
100% Confidentiality
Money-back guaranty
Original Writing
Visit site
MyAdmissionsEssays
MyAdmissionsEssays is an expert Essay writing and editing service that specializes in providing high-quality academic support to students. Choose us for expert Essay writing and editing services and achieve the academic success you deserve.
Prices starting at $11 per page
Writers are native English speakers
On-time delivery
Visit site
EssayPro
At EssayPro, we take pride in being a leading provider of professional Essay writing services. Our team of expert writers possesses the knowledge and expertise to produce top-quality Essay that meet the highest academic standards.
Pricing Transparency
Top-Ranked Essay Writers
100% Plagiarism Free Papers
Any Topic or Difficulty can be handled!
Visit site
Studdit
Studdit is a leading professional Essay writing service that provides expert assistance to students in need. Our team of skilled writers is committed to delivering high-quality content that meets the most stringent academic standards.
Any deadline & subject
Interaction with a writer
Certified writers
Original & confidential
Visit site
ExpertWriting
ExpertWriting is among best college essay writing services in terms of the value you get for money. By hiring a writer on ExpertWriting to write your essay, you get a person who is directly qualified in a subject of your paper.
Price from: $9 per page
Deadline: 3 hours
Money Back Guarantee
Free Revisions
Visit site
Pisaster Ochraceus Essay
Sea stars along much of the North American Pacific coast are dying in great numbers from a mysterious wasting syndrome. Similar die offs have occurred before in the 1970s, 80s, and the 90s, but never before at this magnitude and over such a wide geographic area. Pisaster ochraceus and many other species of sea stars have been affected by the current sea star wastingsyndrome event. The following paper by Hewson et al. Densovirus associated with sea star wasting disease and mass mortality provides evidence for a link between a densovirus (SSaDV) and sea star wasting syndrome (SSWS) but there is still much work to be done before this mysterious disease is fully understood.
The first photograph in the below series of a sea star with wasting ... Show more content on Helpwriting.net ...
By the turn of the year it had been reported in 45 of the 84 MARINe sites from Alaska to San Diego sampled since that summer, and in the summer of 2014 it has spread to Mexico and parts of Oregon, which had previously been unaffected. It is also intensifying, appearing at additional sites in those regions already affected.
diseased pisaster ochraceus cdiseased pisaster ochraceus d
Photo credit: Nate Fletcher
In subtidal habitats, the sunflower star is typically the first species to succumb, followed by the rainbow star (Orthasterias koehleri), giant pink star (Pisaster brevispinus), giant star (Pisaster giganteus), mottled star, ochre star and sun star (Solaster), leather star (Dermasterias imbricata), vermilion star (Mediaster aequalis), six armed stars, and bat star (Patiria miniata).
We don t know whether the syndrome spreads sequentially from one species to the next, or if some species simply take longer to express symptoms, but the usually large populations of ochre and sunflower stars have experienced massive, geographically expansive (if patchy) and well documented declines. Other species are less abundant, so the impact of the syndrome is not as
In Living Color Race And American Culture Omi Analysis
Michael Omi argues about the racism in media nowadays; the racial stereotypes are still perpetuating in our popular culture, such as Mexicans are dark and Asians look smart. The Mad TV show Average Asian , portrays Asian s stereotypes well. People are expecting Bobby Lee to be stereotypical average Asian. They think he has right answers all the time and is good at everything, but driving. People expect something from Bobby Lee, but he didn t fit any of their stereotype.
Regards to In Living Color: Race and American Culture by Michael Omi, she mentioned about the Hollywood image of real Mexican and gave an example of model Aurora Garza s story. When she had Latino auditioning for role in television soap opera, she said, I m a real Mexican and very dark anyway. I m even darker right now because I have a tan. But they kept wanting to make my face darker and darker (pg547). ... Show more content on Helpwriting.net ...
I felt a little uncomfortable, because they are saying that just accept the racism as our culture. The video Kids React to Controversial Cheerios Commercial , shows the kids were angry when they heard that adults were upset about the different race married. They couldn t stand adults racism and they actually cared how the race minority would feel about the racism. I believe that there is a chance to overcome these racial stereotype, because America is full of diverse people. People must be respectful of others and their culture regardless of the race, because they don t know where they came from or their
The Jungle Book Comparison
Recently viewing the movie, The Jungle Book, decided to convey my thoughts. The movie was adapted from Rudyard Kipling s collective works, as well as Walt Disney s 1967 animated film. Being that, The Jungle Book is one of my favorites, I chose to unveil its three act structures, setup, confrontation and resolution. Act one reveals the protagonist, Mowgli, an orphan human boy raised by wolves. Antagonist, Sher Khan warns the wolves he would kill the boy and punish them, once the water truce is over. Mowgli then decides to leave to spare everyone by having the Panther, Bagheeratakes him back to the human village. Mowgli and Bagheera, eventually attacked by Sher Khan, is separated. Now Mowgli is on his own.
The second act begins, with a bear,
Breakdown Of The Legislative Process
Breakdown of the Legislative Process: In the current political climate in the Iowa Statehouse can be very toxic for bills that are novel and are trying to push the envelope on issues. Currently, House is where these types of bills go to die. There is very little support for progressive legislation in the House. With Republicans having a 57 to 43 Democratic margin in the House; it would be best to start the bill in the Senate. While margin of the majority in the Senate is much closer, with 26 Democrats to 24 Republicans, it will not be easy to pass this bill in the Senate, but there passage has much better odds. Because the Democrats hold the majority in the Senate, committee leaders are Democrats. If the bill is to have any chance at... Show more content on Helpwriting.net ... This means that passing a law that has environmental issues would be easier in the Senate than in the Republican controlled House. To get the bill started we would need to persuade Dick Dearden, the Chair of the Natural Resources Committee. This would allow the bill to have as little attention as possible, because Natural Resources tends to be a noncontroversial committee, where many issues are passed out of committee on unanimously. Senator Dearden is also the perfect person for the job. He has seen the effects that regulation can have on the environment. In a conversation with the Senator he said that when he was younger he had to clean off toilet paper off his fishing line when fishing in the Des Moines River. I believe that he would support green infrastructure conservation issues such as this because he knows that water quality is a major issue in the state. Another reason why Senator Dearden is the best starting place for this bill is because he is retiring, he won t have to face reelection in 2016. This means that he can handle politically hot issues without any repercussions in the election cycle. The Natural Resources ranking member is Senator Ken Rozenboom, and getting him to sign off on the bill will be more difficult because he is very conservative. This is where we are going
Physics and Fish Bioenergetics Essays
Welcome to the world of fish physics. Many of us understand basic fish behavior and can reach logical conclusions about where the best place to throw a fishing line is. But when we don t think much further than that we are missing out on some very interesting details of fish behavior. We can never fully understand why we find some fish in one location and some fish in other locations until we consider the concept of fish bioenergetics. Ultimately, fish behavior is a product of bioenergetics. First, we will take a look at basic fish bioenergetics, understanding the underlying quantitative principles. Then, we will look at some examples of how physical forces, thermodynamics, and light characteristics are specifically related to fish... Show more content on Helpwriting.net ... Energy expended by the fish depends on the velocity (flow) of the water and the swimming capability of the fish. The fish must exert a force in the upstream direction that is equal to the force of the water trying to push it downstream. When the fish goes to retrieve a prey item laterally, it will have to swim faster than the current. Getting a little bit more complex, we can consider Holling s disc equation (Stephens and Krebs 1986) which can apply to any foraging animal. This equation s most simplified derivation is R = λe s/ 1 + λh where R is the rate of intake, λ is the rate of encounter with other prey items, e is the energy gain, s is the search cost, and h is the handling time. This equation assumes that searching for prey and handling prey are mutually exclusive activities. It also assumes that the encounter rate will have a positive linear relationship with the time spent searching for prey. For fish, many aspects of the physical environment can effect all of these components. There are many physical factors that effect fish bioenergetics, such as local hydrologic characteristics in a stream or river. However, not all of the physical factors involved are especially obvious. We will look at three examples here. Water velocity plays an extremly important role in fish bioenergetics. It effects components that are detrimental to fish as
The Anti-Hero In The Quiet American
How do you measure the life of one person against the greater good? Can it ever be the right thing to sacrifice an innocent person? And how do you know what the greater good really is? (Amy Engel, The Book of Ivy). The greater good is a concept that Thomas Fowler, the protagonist of The Quiet American , uses to justify his part in the murder of an innocent man. Thomas Fowler embodies none of the qualities typically assigned to an protagonist, being a man whose failings from being an adulterer, an opium addict, and ultimately a murderer by choice that draws him into the defined role of the anti hero. The anti hero in a story, like Fowler, is branded by the imperfect, and experienced nature whose flaws both humanizes and horrifies. Thomas Fowler believes his intention was to get Pyle killed for the greater good, he in fact, does not wholly believe... Show more content on Helpwriting.net ... Fowler, a citizen of a constitutional monarchy and a parliamentary democracy, has sympathies towards the communist party in Vietnam. He would later use this political mindset to explain partly his reason for assisting in the assignation of the democratic Pyle. This is even a darker, and more twisted event, when Fowler admits that not only are his actions motivated by his political and moral ideals, but also that he will recover his young lover, Phuong, from Pyle. Alden Pyle died because Fowler justified his part in the assassination through his ideals of war, and the cost of the innocent, his political sentiments, and the repossession of a woman. He convinces himself that he is the hero of the scene by saving Vietnam from the brashness of the American Pyle, while also receiving the bonus of Phuong in the process. In the end, it is very clear that Fowler is an anti hero, which is made accurately well defined, by his proof of intent in the murder of an innocent man for the greater good of himself, and
Drainless Steel Eye Bolts
A Glance on Stainless Steel Eye Bolts
Stainless Steel eye bolts can be used as the anchor points or connection elements. An Eye Bolt is a fastener with an eye at one end to attach a hook or ring to it, while the other end contains the threaded end of a screw. Eye bolts are used to secure a cable, wire, or chain to some other object.
As per the functionality, eye bolts feature a welded or forged construction. In a forged bolt, the eye at the top is designed by twisting a steel piece forming a loop, that doesn t close completely. Welded bolts, on the other hand, contains a fully closed circular eye welded to a shank.
Both of these stainless steel eye bolts can be used in variety of applications, but welded bolts demands its use in the most
Argumentative Essay On Coffee
It seems to me that coffee is confusing. Some reports about it say it could lead to bladder cancer and spontaneous abortion. Others say it may keep cancer away. Most people will want to know definitively: is coffee good or an evil necessity? The answer might surprise many: one to three cups daily is actually good for many people. Others may safely enjoy as many as five cups a day! Here is why.
Coffee May Slow Aging
One of the surprising health benefits of coffee is that it may lead to a longer life. The well known and long running Nurse s Health Study recently published research that suggests women who drink more coffee tend to have longer telomeres.
Telomeres are to chromosomes what plastic tips are to shoelaces. They protect chromosomes... Show more content on Helpwriting.net ... The good news at present then is moderate coffee drinking is not cancer causing.
Other
Good News for Java Lovers
If you love your daily morning brew of coffee, you will also be happy to learn that coffee may lower risk of a stroke, lower your chance of developing type 2 Diabetes and even possibly lower depression. All these are plenty of reasons to indulge in the guilty pleasures of your favourite specialty coffee.
The Caveat All this positivity does not mean unlimited coffee is the secret to eternal youth and perfect health. Earlier studies have suggested that moderate coffee drinking (about 3 to 4 cups daily) provides caffeine intakes of about 300 to 400 mg per day. This much intake does not seem to have any adverse effects.
However, avoid more than three cups if you are pregnant. Also, kids, adolescents, the elderly and people suffering from hypertension may need to be careful because of caffeine s potential for dramatically spiking blood pressure. Too much caffeine may also cause plasma homocysteine (which is linked to strokes and heart attacks).
As always, drink
The Loss Of The Animals
The morale of the animals is in steady decline. They are still shocked from the executions for their comrades. Clover thought she remembered the 6th amendment said, No animal should kill any other animal . However when she asked Benjamin to read it he refused. She then enlisted Muriel to the task; she stated that the commandment said, No animalshould kill another animal, without cause. The animalsjust accepted that they were mistaken, and that they just forgotten the last two words of the commandments. This is all they could think, as nobody possessed any proof of how it had been.
Throughout the year the animals worked even harder than they had worked in previous years. They decide to build the walls twice as thick so no natural ... Show more content on Helpwriting.net ... He know longer was know as simply Napoleon he had many authoritive titles; the most popular being our leader comrade napoleon.
They became to look at Napoleon as a figurative inverse of Snowball. This being because, any fortune or positivity on the farm was directly correlated to napoleon, the same way that they attributed any misfortune or treachery to Snowball; Just as Stalin used this against Trotsky.
In place of beasts of England which was now forbidden to sing Napoleon enlisted Minimus to compose a poem to highlight his superiority.
Comrade napoleon:
Friend of fatherless!
Fountain of happiness!
Lord of the swill bucket! Oh, how my soul is on
Fire when I gaze at thy
Calm and commanding eye,
Like the sun in the sky,
Comrade Napoleon!
Thou are the giver of
All that thy creatures love,
Full belly twice a day, clean straw to roll upon;
Every beast great or small
Sleeps at peace in his stall,
Thou watchest over all,
Comrade Napoleon!
Had I a sucking pig,
Ere he had grown as big
Even as a pint bottle or as a rolling pin,
He should have learned to be
Faithful and true to thee,
Yes, his first squeak should be
Comrade Napoleon!
The general feeling on the farm was expressed in this poem composed by Minimus. This general message of this poem is the absolute superiority of There Leader Napoleon. They even go on to say that Napoleon is like the sun in their sky because he lights their soul
Revolutionary Changes in the Atlantic World, 1750 1850 I.
Prelude to Revolution: The Eighteenth Century Crisis
A. Colonial Wars and Fiscal Crises 1. Rivalry among the European powers intensified in the early 1600s as the Dutch Attacked Spanish and Portuguese possessions in the Americas and in Asia. In the 1600s and 1700s the British then checked Dutch commercial and colonial ambitions and went on to defeat France in the Seven Years War (1756 1763) and take over French colonial possessions in the Americas and in India. 2. The unprecedented costs of the wars of the seventeenth and eighteenth centuries drove European governments to seek new sources of revenue at a ... Show more content on Helpwriting.net ... Rationalist Enlightenment reformers also sparked popular opposition when they sought to replace popular festivals with rational civic rituals. 3.Spontaneous popular uprisings had revolutionary potential only when they coincided with conflicts within the elite. The American Revolution, 1775 1800
A. Frontiers and Taxes 1.After 1763, the British government faced two problems in its North American colonies: the danger of war with the Amerindians as colonists pushed west across the Appalachians, and the need to raise more taxes from the colonists in order to pay the increasing costs of colonial administration and defense. British attempts to impose new taxes or to prevent further westward settlement provoked protests in the colonies. 2.In the Great Lakes region, British policies undermined the Amerindian economy and provoked a series of Amerindian raids on the settled areas of Pennsylvania and Virginia. The Amerindian alliance that carried out these raids was defeated within a year. Fear of more violence led the British to establish a western limit for settlement in the Proclamation of 1763 and to slow down settlement of the regions north of the Ohio and east of the Mississippi in the Quebec Act of 1774. 3.The British government tried to
1.3.1 response Essay
Activity 1.3.1: Student Response Sheet
PART A Restriction Enzymes
Restriction enzymes are a tool that allows us to pinpoint human identity down to single differences in our DNA. Work through the following simulation so you can see these molecular scissors in action.
Find out more about restriction enzymes by viewing the animation and reading the article listed below. DolanDNALearningCenter: Restriction Enzymes http://www.dnalc.org/ddnalc/resources/restriction.html Access Excellence Classic Collection: Restriction Enzymes Background Paper http:/ /www.accessexcellence.org/AE/AEC/CC/restriction.php
1. From what organism are restriction enzymes derived? What role do these enzymes play in this natural host?Phages. Enzymes ... Show more content on Helpwriting.net ...
Beneath each strand indicate the number of fragments that would be created and also the size of each fragment (in base pairs). Some of the pieces will have bases overhanging the edge. Use only the bases that are paired up when completing your count. For example, for a piece that looks like ATTCAACCC GTTGGGAA
the size of the fragment would be listed as 6 base pairs (6bp).
Person 1:
GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAA
Number of restriction fragments (pieces of DNA after digestion): ___4
Size of restriction fragments (in bp) listed from largest to smallest 16;7;17;5
Person 2:
CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGG GGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCC
Number of restriction fragments (pieces of DNA after digestion): ___4______
Size of restriction fragments (in bp) listed from largest to smallest ________8;10;13;12______________________________________________________________
PART B: Gel Electrophoresis of Restriction Fragments
After you have reviewed the principles of electrophoresis, use what you know to complete the following:
2. Place a large + on the end of the gel diagram where the positive electrode would go. Place a large
CPA Report ACC/545 University of Phoenix Internal Memo To: Management From: CPA Re: Further Information regarding Request Before any information can be given to outside CPA s, the professional responsibilities of a CPA must be outlined and understood as well as what the differences between a review and an audit are. With the examination of a subsidiary that has been established as a corporation there are certain questions that arise such as: What is the methodology used in determining deferred taxes, What it t he procedures for reporting accounting changes and error corrections, and What is the rationale behind establishing the subsidiary as a corporation. The draft below outlines my response to the questions that have been... Show more content on Helpwriting.net ... Items that require estimates are uncollectible receivables, inventory obsolescence, useful lives and salvage values of assets and changes in depreciation methods to name a few. Such accounting estimates will alter as there are new events that occur, as they acquire more experience, or as it obtains further information on the events. Lastly, reporting a change in entity involves reporting the change by altering the financial statements of all prior periods presented. This allows the revised financials to reflect financial information for the newly developed entity for all periods. An example of a change in entity is presenting consolidated statements in place of statements of individual companies or changing the companies included in combined financial statements. Error Corrections There are certain errors that are not as imperative to investors as other errors are. An error that can be classified as significant for example those errors that result in overstatement should always be pointed out to investors. There are certain errors that can reveal weaknesses in a company s internal controls therefore, resulting in more significant errors. Errors should be corrected as soon as they are discovered. To correct errors the restatement approach should be employed and all prior period statements that are presented should be corrected and the beginning balance of retained earnings for the first period presented should be restated when the error effects occur
Managing Resistance to Organizational Change Essay
In the course of considering and implementing change, the need frequently arises for effective application of the approaches and tools for managing resistance to change (Palmer, Dunford, Akin, 2009). Change often fails from ineffective management of the internal and external forces of resistance opposing change (Kotter Schlesinger, 2008; Oreg, 2003; Palmer et al., 2009). In response, this paper discusses the approaches (tools) deemed most essential for managing resistance to change relative to the scope of the situational contexts in which they might be applied. The discussion centers on considerations for the multidimensional conceptualizations of resistance that are often ignored in evaluating alternatives for taking action.... Show more content on Helpwriting.net ...
According to Piderit (2000), each of these components contributes to an individual s disposition to resist or support change, which can range along a continuum from strong opposition to ambivalence to strong support. Oreg (2003) characterizes behavioral responses to change in terms of the perceived degrees of fairness of both change outcomes (distributive justice) and the change process (procedural justice), as mediated by differences in personality traits and contextual elements such as self efficacy, tolerance for change, and social influence. Further conceptualizations of the multidimensional nature and scope of resistance are captured in goal regulation theory (Meyer, Becker, Vandenberghe, 2004), which is grounded in theories related to regulatory focus (Higgins, 2002) and self determination (Deci Ryan, 2008; Gagné Deci, 2005). This integrated theory characterizes varying levels and polarity of behavioral responses to change relative to affective, normative, or continuance forms of motivation and commitment. The variation in behavioral responses when plotted on continuums of intrinsic/extrinsic motivation, internal/external locus of causality, and prevention/promotion focused regulation reflects the degree to which basic psychological needs of autonomy, competency, and relatedness are realized during the change
The Offspring Of Single Childhood In A Single Parents
For a long time, kids experiencing childhood in a solitary parent family have been seen as various. Being raised by just a single parent appears to be difficult to numerous yet finished the decades it has turned out to be more pervasive. In the present society numerous kids have grown up to wind up noticeably sincerely steady and effective whether they had maybe a couple guardians to demonstrate to them the rough way that life gives to every single person. The issue lies in the distinction of youngsters raised by single guardians versus kids raised by both a mother and a father. Does a youngster require the two guardians? Does a young man require a father figure around? Does the administration give assistance to single guardians? What part do step guardians and step kin play? With much theory, this point has turned into an extremely fascinating contention. What individuals must comprehend is that appropriately bringing up a youngster does not depend on the structure of a familybut rather ought to be more centered around the procedure or qualities that are educated to these kids as they figure out how to develop. Offspring of single guardians can be similarly as dynamic with enthusiastic, social and behavioral abilities as those with two guardians.
Individuals assert that the main route for youngsters to increase full enthusiastic and behavioral aptitudes is to be raised by both a mother and a father. At the point when a subject, for example, this one has an expansive