Skip to main content

Spring 2012

Page 1

HARVARD POLITICAL REVIEW VOLUME XXXIX NO. 1, SPRING 2012 HPRONLINE.ORG

THE FOOD ISSUE Inside FIXING AMERICA’S FOOD CULTURE

EXPORTING OBESITY TO CHINA

DRONES AND THE FUTURE OF WAR


THE FOOD ISSUE

6

Politics of Food Beatrice Walton

7 Exporting Obesity to China Jason Gandelman

12 Frankenfood and Their Farmers Sandra Korn

10 America’s Next Farm Bill Jordan Rasmusson & Arjun Mody

14 America’s Food Culture Amy Weiss-Meyer & Teresa Yan

OPENING SHOT

WORLD

3

26 Election 2012: The World Votes

HUDS by the Numbers

FUNNY PAGES 20 Drones and the Future of Combat Gabriel Rosen

4

GOP-tical Illusions

5

Politicians’ Homestyle Recipes Sarah Siskind

UNITED STATES 18 Legislation Watch Alexander Smith 19 On the Docket 30 Inside Iran’s Nuclear Program Elsa Kania

Jose Robles

23 Mitt Romney’s Harvard Elitism Ross Svenson

INTERVIEWS 42 Peter Thiel Corinne Curcie

36 Once Upon a Car Cory Pletan

16 The Everglades, Sweetened Matt Shuham

43 Cemil Çiçek Alpkaan Celik

27 The Arab World’s Forgotten Springs Ken Mai 28 Is the European Project Stalled? Krister Koskelo 32 Striking a Balance in South Sudan Atul Bhattarai 34 Burmese Spring Caitlin Pendleton & Nur Ibrahim

BOOKS & ARTS 38 A Nation Divided Ethan Loewi 40 The Figure of Figaro Rachel Wong

ENDPAPER 44 GOP and Man at Harvard Chris Danello

Email: editor@hpronline.org. ISSN 0090-1030. Copyright 2012 Harvard Political Review. All rights reserved. Image Credits: Wikimedia: Cover-Renee Comet; 4-David Shankbone, Sakurambo; 5-Kander; 8-TUBS; 12-Softeis; 14-FotoosVanRobin; 15-Evan Swigart; 16-Peggy Greb; 23-Gage Skidmore; 26-Russian Presidential Press and Information Office; 30-Daniella Zalcman; 34-Htoo Tay Zar; 37-Yavno; 40-Tamcgath; 42-David Orban; 43-Sabri76. U.S. Federal Government: 1-Chuck Kennedy, The White House; 6-Pete Souza, The White House; 18-U.S. Congress; 19-Supreme Court; 20-U.S. Air Force; 36-The White House. Flickr: 7-Paul Needham; 32-babasteve. Gotham: 38. Gina Kim: 44.

SPRING 2012 HARVARD POLITICAL REVIEW 1


HARVARD POLITICAL REVIEW

FROM THE EDITOR

A Nonpartisan Journal of Politics Established 1969—Vol. XXXIX, No. 1

EDITORIAL BOARD EDITOR-IN-CHIEF: Jonathan Yip PUBLISHER: Andrew Seo MANAGING EDITOR: Neil Patel ASSISTANT MANAGING EDITOR: Alex Chen ONLINE EDITOR: Paul Schied COVERS EDITOR: Beatrice Walton CAMPUS EDITOR: Tom Gaudett CAMPUS ASSOCIATE EDITOR: Medha Gargeya INTERVIEWS EDITOR: Alpkaan Celik U.S. SENIOR EDITOR: Caroline Cox U.S. ASSOCIATE EDITOR: Frank Mace U.S. ASSOCIATE EDITOR: Daniel Backman WORLD SENIOR EDITOR: Josh Lipson WORLD ASSOCIATE EDITOR: Arjun Mody WORLD ASSOCIATE EDITOR: Gram Slattery B&A SENIOR EDITOR: Christine Ann Hurd B&A ASSOCIATE EDITOR: Eli Kozminsky B&A ASSOCIATE EDITOR: Lena Bae HUMOR EDITOR: Sarah Siskind STAFF DIRECTOR: Zeenia Framroze BUSINESS MANAGER: Olivia Zhu ASSISTANT BUSINESS MANAGER: Naji Filali CIRCULATION MANAGER: Ross Svenson DESIGN EDITOR: Sam Finegold GRAPHICS EDITOR: Gina Kim MULTIMEDIA EDITOR: Eric Hendey WEBMASTER: Corinne Curcie WEBMASTER: Ben Shryock

SENIOR WRITERS Chris Danello, Kathy Lee, Paul Mathis, Max Novendstern, Jeremy Patashnik, Henry Shull, Simon Thompson, Jimmy Wu

STAFF Jay Alver, Oreoluwa Babarinsa, Elizabeth Bloom, Humza Syed Bokhari, Peter Bozzo, Gabby Bryant, Samuel Coffin, Catherine Cook, Tyler Cusick, Jacob Drucker, Farha Faisal, Mikhaila Fogel, Harleen Gambhir, Aditi Ghai, Raphael Haro, Kaiyang Huang, Nur Ibrahim, Elsa Kania, Adam Kern, Sandra Korn, Ha Le, Ben Lopez, Jimmy Meixiong, Peyton Miller, Laura Mirviss, Chris Oppermann, Lily Ostrer, Samir Patel, Caitlin Pendleton, Mason Pesek, Heather Pickerell, John Prince, Matt Shuham, Martin Steinbauer, Alastair Su, Lucas Swisher, Rajiv Tarigopula, Pooja Venkatraman, Ben Wilcox, Danny Wilson, Jenny Ye, Benjamin Zhou

ADVISORY BOARD Jonathan Alter Richard L. Berke Carl Cannon E.J. Dionne, Jr. Walter Isaacson Whitney Patton Maralee Schwartz

2 HARVARD POLITICAL REVIEW SPRING 2012

You Are What You Eat Dear Readers, Given that I proposed a food issue more than two years ago, it is my great pleasure to finally present to you the Politics of Food. While the culinary and gastronomic—the world of foie gras and Big Macs—might seem out of the norm for the Harvard Political Review, this cover in fact epitomizes the kind of politics that lies at the heart of our mission; it goes far beyond the daily tracking polls and horse race of cable news. At the HPR, we believe that politics, broadly construed, touches and shapes every human endeavor. And, of course, few are more basic than eating. It is amazing how intricate this most fundamental of human activities has become. We take so much of the sustenance and flavor of food for granted, but it was only a few hundred years ago that conquistadors brought the tomato to Europe and Asia. Since then, stunning advances in agricultural technology, including the Green Revolution, have made possible a world that can sustain a staggering seven billion people. Developed economies also owe much to increasingly efficient agricultural sectors, which have freed citizens to pursue education and innovation in other industries. And today, globalization has brought American fast food across the world and made fresh foods more available than ever before. The human story of food, then, has largely been one of continual progress: better food, more food, safer food. Yet, however far we’ve come in promoting sustainable agriculture or in tackling the obesity crisis in America, the story remains one of glaring failure. Some 900 million people go hungry every day, and one in four children in the developing world is critically underweight. These are often the statistics of guilt and dismay, and they should be. But this year, they are also ones of hope. Though the absolute number of malnourished has increased in recent years, as a proportion

of the world population, the hungry have dropped from 35 percent in 1970 to just 16 percent in 2010. Most promisingly, developing countries are finally beginning to recover from the food crisis of 2008 and the global economic slowdown. In their combined wake, food prices shot up, millions went unemployed, and credit and aid flows contracted. We are, today, exactly where we were a decade ago: 16 percent of the world remains hungry. But now, we have an unprecedented technological capacity to end hunger. Bill Gates has invested smartly in research on disease-resistant grains and called for a digital revolution in using genetically modified foods and satellite imagery to improve farm yields. While these policies will doubtlessly save lives, extreme hunger is not a technological problem; there is enough food to feed the world. The calories needed by the world’s hungry could be provided with one percent of the global food supply. At its core, extreme hunger is about politics. Nobel laureate and Harvard professor Amartya Sen once wrote, “there is no such thing as an apolitical food problem.” We can end extreme hunger in our lifetimes. But in our age of technological miracles and government dysfunction, it is, ironically, more politics, not more technology that will be the answer. It is no coincidence that the rise of capitalist China was the greatest decrease in malnutrition in human history. Economic growth is the be-all and end-all of solving extreme hunger. To finally feed the world, then, we need strong governments and sound economic policy. And that’s all politics.

Jonathan Yip Editor-in-Chief


OPENING SHOT Total HUDS employees.

650 246 160

26,500 Pounds of food waste a week.

15 $36,821,425 Full-time HUDS employees in the Local 26 Union.

Part-time HUDS employees in the Local 26 Union.

Loyal E. Horton Awards won by HUDS.

Board payments received by HUDS in 2011.

HARVARD UNIVERSITY DINING BY THE NUMBERS $4,677,389 Crimson Catering sales in 2011.

$9,576,790 HUDS retail sales in 2011.

1%, 4%, 5%

8%

Vegans, students with food allergies, and students with food intolerances at Harvard College. Food allergies are immune responses. Food intolerances are digestive ones.

4,758,051

Vegetarians at Harvard College.

TOP 5 ITEMS SERVED BY QUANTITY: Chicken Fingers Chicken Wings Red Spiced Chicken Pizza Roast Beef, Dinner

HUDS meals served in 2011.

SPRING 2012 HARVARD POLITICAL REVIEW 3


THE FUNNY PAGES GOP-TICAL ILLUSIONS LINE ’EM UP The length of the horizontal line represents the egregious taxation level under Obama:

BLIND SPOT TEST Cover your left eye, suspend disbelief, and get lost in Ron Paul’s beady eyes. Soon the debt will disappear!

The Deficit

This horizontal line represents the estimated level of taxation under Gingrich:

WHAT DO YOU SEE? Look closely. Some people see a Massachusetts Moderate. Others see a Christian Right winger!"

This line is the probable taxation level under Romney:

THE STRATEGY Santorum’s 10-step foreign policy plan

Ron Paul:

4 HARVARD POLITICAL REVIEW SPRING 2012


POLITICIANS’ HOMESTYLE RECIPES

Romney’s Turnovers: 1. Take 4 apples and dice them up. Or slice them. Or cut them in tiny bits. Put them in a skillet, or pan, while you continually mix them, flipping and flopping.

Barack Obama’s Nutritious, Delicious, Awesome, Wonderful, Super-Secret Recipe:

Just carrots.

1. Preheat oven at 270 degrees.

2. After ten minutes turn down the heat on the apples. No, pears. This recipe has always called for pears.

2. Grab a giant mixer, spatula, bowl, grater, ladle, funnel, waffle iron, rolling pin, and thermometer.

3. To make the dough, use 1 cup of flour, ½ cup of powdered brown sugar, 4 tbsp of baking powder, or baking soda if you prefer, and 1 stick of unsalted butter with salt.

3. Grease a pan and put the Cuisnart on high.

4. Bake until de-electable.

Michelle Obama’s Carrots:

4. Set water on high ecstatic boil and then let it simmer until lukewarm. 5. Mix all the ingredients we talked about thoroughly and put in the oven. 6. Wait to serve. Keep waiting.

SPRING 2012 HARVARD POLITICAL REVIEW 5


FOOD

POLITICS OF FOOD Beatrice Walton

I

n his 2008 book In Defense of Food: An Eater’s Manifesto, Michael Pollan advised people to restore simplicity to food practices. Pollan’s message, clearly encapsulated as, “Eat food. Not too much. Mostly plants,” resonated strongly with the myriad groups and differentiated movements that have morphed into “the food movement.” In stressing simplicity, these recent efforts at food reform have differed from their predecessors by moving past the politics of food production, regulation, and inspection. They focus instead on the diverse ethical, cultural, environmental, and health implications of food. Yet, despite that broad focus, the recent food movement is inherently political. By challenging us to slow down and carefully consider the consequences of food consumption and creation, the movement and its crisscrossing components challenge us to rethink the role of government in the new “politics” of food. Though the movement often strives for simplicity in food practices, its debates hardly have narrow scope. In one subset of

6 HARVARD POLITICAL REVIEW SPRING 2012

food politics, health and lifestyle concerns drive efforts to change America’s “food culture” (see p. 14) and render its defining practices more sustainable. This has given rise to campaigns promoting gardening, composting, healthy cooking, and food literacy. Likewise, as Americans continue to struggle against diet-related illnesses, government health experts are tasked with balancing the country’s needs for greater access to quality food (online article) and limiting unhealthy food in programs such as school lunches. This debate is central to efforts to reform the food stamp program, where ensuring positive health outcomes is more important than ever, given that one out of every seven Americans currently uses the program (online). In these instances, the food movement has stressed the importance of fostering positive relationships with healthy food. Elsewhere, there is concern about how governments impact agricultural practices. From subsidies in the U.S. Farm Bill (p. 10) to preferential trade policies for European agricultural producers in the EU’s

Common Agricultural Policy (online), debate as to which crops should be supported and what effects those preferential policies have on developing foreign markets. Genetically modified crops, and their potentially controversial environmental effects, are also included in this discussion (p. 12). Furthermore, political moves to support agriculture at the expense of natural resources have recently come under fire, as with the Florida Everglades (p. 16). Ultimately, moves towards sustainable, grass-grazed, cage-free, and organic foods, as well as improved food access and culture, form the backbone of the modern food movement. Still, as China’s example shows (p. 7), oversight is still necessary, particularly when concerning the deceptive food-marketing tactics of corporations in the developing world. If there is one overarching goal that everyone in the food movement agrees on, it is avoiding exporting past mistakes of the United States’ unsustainable and unhealthy food practices abroad.


FOOD

EXPORTING OBESITY TO CHINA

Will China Get Fat Before it Gets Rich? Jason Gandelman

W

ith the American public increasingly wary of obesity and diabetes, sales of unhealthy food products in the US have slowed over the past few years. Nevertheless, the profits of American food corporations continue to grow, due in large part to the corporate focus on emerging markets. Particularly in China, where regulation is limited and susceptible young consumers abound, American food corporations have been ambitiously and deceptively promoting their products. Though the first American fast food restaurant only opened its doors in China in 1987, an ACNeilson survey reports that 97 percent of the Chinese population has already eaten at a fast food restaurant. With this rise in consumption of Americanized “High in Fat, Salt, and Sugar” foods in China, the childhood obesity rate has climbed approximately eight percent per year. Currently, 16 to 20 percent of Chinese urban children are considered clinically obese. This figure foreshadows a major public health crisis in the most populous nation on earth. Childhood obesity in China is a result of the predatory tactics used by American food corporations to capitalize on the Chinese market. These corporations have driven con-

sumption in China by advertising heavily to children and dismissing scientific criticism. According to Christine Chester of Corporate Accountability International, such strategies indicate that “Big Food is following the example set [decades ago] by Big Tobacco.” It is imperative that governments learn from the past and set policies to curb the health disaster created by the rise of fast food consumption in the developing world.

EXPORTING ILLNESS: CHINA AS A “PROFIT CENTER” In its latest financial statement, Pepsico CEO Indra Nooyi remarked that, despite “challenging conditions in the North American beverage market,” Pepsico’s income has increased 18 percent over last year because they “continue to enjoy robust top-line growth in key emerging markets.” Likewise, Yum! Corporation, the owner of KFC and Pizza Hut, now makes far more profit in China than it does in the US. In the third quarter of 2010, Yum’s China sales hit $1.2 billion, up 20 percent, while US sales sunk 8 percent. In their search for new markets, American food corpora-

SPRING 2012 HARVARD POLITICAL REVIEW 7


FOOD

tions have shifted a burden of disease from the American public onto the Chinese people as the tobacco industry did decades ago. Harvard professor Frank Hu notes that since the Chinese market opened up to American corporations, the health consequences have been staggering. In only two decades, the number of type II diabetics has grown ten fold to 95 million. Harvard professor Arthur Kleinman explains that while American corporations have increasingly “looked to China as a profit center,” in recent years, the social cost of this profit has been quite high.

JOE CAMEL: ADVERTISING TO CHILDREN Using tactics similar to the tobacco industry, whose Joe Camel icon was found in a 1991 study to be recognizable by a majority of schoolchildren, American food corporations have been heavily promoting their icons in China. Spending nearly 750 million renminbi ($119 million) to push its Colonel Sanders’ iconic image, KFC was the number two television and print ad buyer in all of China in 2008. McDonald’s created a reality television show in the run-up to the 2008 Beijing Olympics with the help of the Chinese government that implied that the healthy children on screen were fans of McDonald’s. The American Academy of Pediatrics has called for such ads to be banned from American television sets based on evidence that strongly links the ads to childhood obesity. In China, however, there is no such group fighting these ads and the public is largely unaccustomed to battling obesity. According to Hu, many parents still hold the traditional belief that a chubby appearance is healthy. Food corporations have seized on China’s one-child policy and the idea of China’s

8 HARVARD POLITICAL REVIEW SPRING 2012

“little emperors.” They have urged parents to lavish their single child with food rewards.

THE MARLBORO MAN: ENCOURAGING INDIVIDUAL FREEDOM OF CHOICE AND RISK But the ad blitz does not stop at children. American food corporations have also targeted the teen population by subtly promoting the old drum-line of the tobacco industry that “freedom and choice are inextricably linked.” According to Harvard professor Alan Brandt, the tobacco industry made this argument by employing the Marlboro Man, “at a time when men were wearing suits, the icon for the cigarette would become the cowboy, out on the range, by himself… which harkened to a notion of autonomy. People will tell you bad things about cigarettes, but you make your choice.” The subtlety of this message also resonates with the findings of a 2002 McDonald’s brand imaging study in China that found customers preferred McDonald’s because “you can have your own choice” and “choose freely” from the menu. This type of advertising coincides with what Kleinman defines as the new Chinese generation’s neo-liberalist construction of the self as being “a consuming self, desiring for material goods—one of which is food.” Indeed, this young generation believes that freedom and choice in consumption are linked. A recent survey by the China Mainland Information Group of Chinese teens found that over 50 percent believe determining what they buy themselves is the most important thing about shopping. Ironically, the extent to which these teens truly make independent decisions is questionable, as 50 percent also agreed with the statement that they were generally influenced by advertising.


FOOD

FOOD CORPORATIONS HAVE SEIZED ON CHINA’S ONE-CHILD POLICY AND THE IDEA OF CHINA’S “LITTLE EMPERORS.” “SAFE-CIGARETTES”: CORPORATE RESPONSES TO CRITICISM Not only have American food corporations advertised shrewdly in China, but they have also advertised in ways that are purposely deceptive, similar to how the tobacco industry misconstrued scientific revelations in the 1950s. In response to new evidence that their product caused cancer, the tobacco industry disseminated misinformation by releasing ads with doctors’ testimonials and ads claiming that “more doctors smoke Camels than any other cigarette.” Strikingly, McDonalds is now following this same pattern, generating misinformation in China about the healthiness of eating beef to encourage the Chinese to consume a meat which has never been part of their traditional diet. According to a 2006 Modern Weekly interview with Gary Rosen, McDonald’s Marketing President in China, the company has commenced a long-term “beef education” campaign targeted at children under the slogan “Do you have enough beef?” McDonald’s invites children to join the “Beef Club” online. More disturbingly, McDonald’s has hired nutritionists to endorse the nutritious qualities of beef. Rosen even boasts that “nutritionists in China, particularly the Ministry of Health, all publicize the need for Chinese to insert more protein in their diet.” McDonald’s has fabricated the idea that beef should be an essential dietary item. According to scientific consensus, increased red meat consumption is linked to cardiovascular disease and increased risk of mortality. As the science became overwhelming, the tobacco industry famously circulated its “Frank Statement to Cigarette Smokers” in 1954 where they, “accepted an interest in people’s health as a basic responsibility” and announced the formation of the tobacco industry Research Council. This is

strikingly similar to what KFC has announced on in China as its “New Fast Food” strategy. In this flier, KFC acknowledges the “emergence of a worldwide overweight and obesity phenomenon” and announces its establishment of a “food health inquiry committee.” While KFC has added a few vegetable items to its menu, the most popular meals still include up to 1600 calories. Washington University professor Peter Benson writes that this strategy of “acknowledgment that a problem exists” and “symbolic gestures of recompense or amelioration” are common tactics that are not intended to make a substantial difference. SURGEON GENERAL WARNING: SOLVING THE EPIDEMIC Should American food corporations take responsibility themselves or are they simply giving the Chinese consumers what they want: more modern choice? As Brandt explains, the question of freedom and risk versus regulation in the marketplace is still “one of the essential debates in American political culture.” Despite this, both Republicans and Democrats have largely united against tobacco industry tactics by acknowledging the value of accurate, and non-deceptive, information to inform consumer decisions and achieve the best market outcome. The tobacco industry’s actions in the past and the food industry’s actions today deprive consumers of knowledge to make informed choices. While the food industry can continue on the path followed by the tobacco industry and create a deadly legacy in the process, the food industry can work to create real consumer freedom by removing deception and embracing scientific information. The American food corporations have urged freedom of choice. Now it is time for them to make one.

SPRING 2012 HARVARD POLITICAL REVIEW 9


FOOD

PLACING OUR ORDER: AMERICA’S NEXT FARM BILL Thinking through the farm bill more carefully. Jordan Rasmusson and Arjun Mody

E

very five years, Capitol Hill authorizes funding for American agricultural policy through a concoction of tax credits, regulation, and developmental programs. Most recently, in 2008 Congress passed a 700 page farm bill, whose contents impacted food prices paid by American consumers and global commodities markets. Though originally narrow in scope, the bill evolved into a monolith encompassing everything from food stamps and school lunches to direct subsidies and conservation initiatives. While contentious, farm bills have historically benefited many American farmers and stabilized food prices. Nevertheless, the farm bill has potentially negative international consequences, something the United States must consider as changing global demographics strain our agricultural system.

THE 2008 FARM BILL The modern farm bill dates back to 1933, when Congress passed the Agricultural Adjustment Act amidst the Great Depression and Dust Bowl. Corn prices plummeted and demand became almost non-existent, leading President Franklin Roosevelt to implement farm assistance “to rescue American agriculture.” The bill reduced crop surpluses by paying farmers to leave their fields fallow and destroy crops and livestock to raise prices. Since then, the Farm Bill has evolved into a complex legislative item and provides the basis for America’s agricultural dominance. Its most recent edition, the Food, Conservation, and Energy Act of 2008, allocated $288 billion over a five-year period. Over 70 percent of funding was directed towards nutritional programs like food stamps and school lunches, and more than half of remaining funds were subsidies for commodities. Yet, because farmers have high amounts of capital invested in every growing season, crop insurance has

10 HARVARD POLITICAL REVIEW SPRING 2012

The farm bill would slow consolidation of family farms like this one in Fergus Falls, MN.

become the most vital program of the farm bill. Before the advent of federally subsidized crop insurance, farmers’ livelihoods were subject to the whims of nature. Fluctuating weather patterns could render a farmer’s entire yearlong effort useless. According to Food Fight: The Citizen’s Guide to a Food and Farm Bill, many farmers “can’t buy enough insurance” because private insurers are often unwilling to take on such risk, leading the federal government last year to spend $5.2 billion on crop insurance. However, the future of federal spending on agriculture programs is far from certain in the midst of deficit reduction efforts. The new Republican majority in the House has sought to cut government spending across many programs. The current farm bill will expire this September and some farm interest groups are even worried Congress will not renew the bill and that programs will see automatic funding cuts. According to a statement given exclusively to the HPR, Congressman Collin Peterson (D-Minn.), the ranking member of the House Agriculture Committee, said “it’s going

to be a tough year” to pass the farm bill. Peterson and other committee leaders already proposed $23 billion in farm bill cuts to the failed debt Super Committee, but there is still a lingering concern that election year politics will prevent renewal. Peterson acknowledges, “we’ve passed a farm bill in an election before, but it is difficult.”

THE MODERN FARMER Tracing the evolution of the American farmer reveals much about the parallel development of American agricultural policy. In 1950, there were 5.38 million farms in the United States, and the average farm was 213 acres. Since then, the number of farms has been slashed to around two million, while the average size has doubled. Today, truly profitable farms are generally larger than 2,000 acres, capital which most Americans cannot afford. According to the Department of Agriculture, “fewer than two percent of Americans farm for a living today, and only 17 percent of Americans live in rural


FOOD

areas.” This statistic is indeed a far cry from Jefferson’s ideal of a republic where the yeoman farmer constituted the bedrock of American society. Many economists attribute this trend to technological growth and increased productivity with scale. Some denounce this trend. Hilde Steffey, program director for Farm Aid, a group dedicated to supporting family farms, tells the HPR that Farm Aid’s mission is to, “keep every farmer we can.” Farm Aid issued a report to Congress stating that, “far from Wall Street, family farms are creating real wealth, producing real value, [and] growing from seeds and sunlight a product that nourishes us both psychically and economically.” They argue that supporting decentralized family farms is essential to vibrant rural communities. However, the modern agricultural system has transformed the perspective farmers take on their livelihood. To compete in an increasingly complex domestic and global market, the contemporary farmer has become a technocratic businessman that stays abreast of recent advances in farming technologies. Jonathan Piekarski runs a 1,600 acre family farm in Fergus Falls, Minnesota, and his encyclopedic knowledge of global commodity prices and agricultural news underscores this development. For example, Piekarski observes how the current drought in Argentina, a large corn producer, has raised the global price of his crop. He explained to the HPR how agricultural policies from Washington affect his daily life. When Piekarski was involved with Future Farmers of America during high school, the farm bill’s programs were touted as keeping, “rural America vital.” Since then, the farm bill has done little but slow the consolidation of America’s family farms. Yet he remains an advocate for a strong farm bill, acknowledging the stabilizing effect on prices and supply, and highlighting the benefits of the crop insurance program. He notes, “U.S. farmers feed the world... [and] the goal is global food security.”

THE INTERNATIONAL TAKE However, farmers from other countries rarely commend U.S. agricultural policy, viewing subsidies as anti-competitive. Indeed, some argue that subsidies have allowed American farmers to pursue dumping policies where they flood developing countries with cheap crops in a monopolistic fashion. In 2002, some of these issues came to the forefront when Brazil charged the United States with violating World Trade Organization guidelines and other multilateral trade agreements with its cotton subsidies. A recent rise in global commodity prices has tempered these disputes, but also created problems of another kind. Randy Schnepf, an economist and specialist in agricultural policy for the Congressional Research Service, told the HPR that, “third world countries are facing high prices because a lot of them are

importers of food.” Moreover, he added that many governments “don’t allow global prices in rural areas, so farmers can’t benefit from the high prices.” This mismatching of supply and demand creates an imperfect pricing system, and even slight changes in prices are calamitous for people living on mere dollars per day.

POSSIBLE REFORMS: A FOOD BILL? Many different proposals have arisen to reform the farm bill. Subsidies have generally declined over recent years, but the government still protects niche industries like sugar and rice. Furthermore, because some food policy items may violate international trade agreements, policymakers have additional incentive to make reforms. Direct payments, sums of money paid to farms regardless of the year’s profits, are among the most controversial programs in the farm bill, and cost the federal government $4.9 billion last year. According to Congressman Peterson, “Direct payments are tough to defend, especially now when the agricultural economy is doing so well...[they] will be gone” in the next farm bill. Some have argued for progressive subsidies, which would involve subsidizing poorer and smaller farmers instead of agribusiness. This aligns more closely with the goals of the original farm bill, but would also face challenges. Overall, many agriculture policymakers and farmers agree that an adequate safety net must exist for farmers, which stabilizes agricultural supply for the American public. Policy recommendations put forth by Farm Aid emphasize, “Family Farm-Centered Food Systems,” postulating that food should be grown and consumed locally. Steffey claims that beef cattle are often transported from Maine to Colorado for slaughter and processing before being sent back to Maine for consumption. By enforcing stricter anti-trust laws against large meat-packers and providing funds to rebuild local granaries and processing facilities, the farm bill could help communities eat more of what they grow. Another step in the right direction would be amending federal farm loan programs that prevent organic farmers from accessing credit because they are classified as “risky.” These reforms would perhaps enable large-scale and local agricultural production to successfully coexist. Domestically, the farm bill has many positive consequences, providing a safety net for America’s farm communities, nutritional programs for the hungry, and a steady food supply for consumers. However, the farm bill hearkens back to what we eat, and writer Daniel Imhoff argues, the farm bill is really a “food bill.” America’s farmers are the most productive, innovative agricultural specialists in the world. We place our food orders to them through the farm bill, which will shape the future of farming, and the food and prices we find at local grocers.

SPRING 2012 HARVARD POLITICAL REVIEW 11


FOOD

FRANKENFOODS AND THEIR FARMERS Sandra Korn

ATTATAGACTCACTACTTATAAGTCAACCCCCACGCTAGTCAACTA

H

umans have been genetically modifying foods since the beginning of agriculture by simply selecting crops that are nutritious and have high yields. With the recent advent of transgene technology, scientists have been exploring new ways to modify a plant’s genes without relying on the slow process of artificial selection. The development of these “genetically modified organisms,” has promised an environmentally sustainable and efficient way to increase food production. Activists, however, have raised concerns regarding potential environmental risks, health dangers, corporate monopolies, and globalization. Determining the market and social factors influencing the complicated politics of genetically modified food requires a close analysis of the promises and consequences of biotechnology in areas such as the United States, India, and sub-Saharan Africa.

PROMISE AND REALITY The first genetically engineered food crop introduced for public consumption was the Flavr Savr tomato, which contained a gene to slow the ripening of the tomato to allow the produce to retain its color and flavor while sitting on supermarket shelves. Although the Flavr Savr tomato was approved by the FDA in 1994, it was taken off the market in 1997 due to insufficient profitability. Over the next ten years, however, funding was increased for the development and implementation of genetically modified crops, ranging from herbicide-resistant soybeans to insect-resistant corn. Proponents of biotechnology have long touted the potential societal benefits of genetically engineered crops for both the United States and developing countries. For example, Calestous Juma, Harvard Kennedy School professor and former executive director of the UN Convention on Biological Diversity believes that biotechnology, broadly defined as “technology applied to biological systems,” should define the future of global crop production in a “second Green Revolution.” In a publication entitled “Feeding the Next Generation: Science, Business, and Public Policy,” he wrote

12 HARVARD POLITICAL REVIEW SPRING 2012

that biotechnology “has the promise of leading to increased food security and sustainable forestry practices.” Juma and other advocates note that biotechnology can increase environmental sustainability of food production, decrease pesticide and herbicide use, and increase food stability in regions prone to pests and drought. Biotechnology has not been controversial. Markets for genetically modified foods have raised many concerns regarding environmental impact, human health, and corporate control of agribusiness. These concerns have inspired significant dissent from small farmers and activists in the US. Transgenic food crops are made by inserting genes from different organisms that confer various desirable traits such as resistance to pests. Because of these traits, transgenic crop populations can be more virulent than wild-type plants. Conservationists fear that transgenic populations may take over and replace wild-type populations. In addition, consumer advocates have expressed numerous health and safety concerns regarding genetically modified foods, noting that the health implications of ingesting transgenic materials have not been the subject of any conclusive long-term studies. Sheila Jasanoff, Professor of Science and Technology Studies at the Harvard Kennedy School, notes that although the US Food and Drug Administration considers genetically modified foods safe for human consumption, its investigations may have failed to address concerns that are inherently unique to transgenic organisms, “Maybe there are differences that we don’t know how to look for.” Jasanoff says that the US government’s regulation of genetically modified foods for the past decade has been informed by the “high-level administrative decision that the government was going to assume that biotech products were the same as other products.”

A MONSANTO MONOPOLY? Globally, transgenic food crops remain controlled almost entirely by agribusiness. Monsanto, a multinational biotechnol-


FOOD

ogy corporation, produces the huge majority of transgenic seeds used in the US and across the world. Its most successful products, “Roundup-Ready” soybeans, corn, canola, sugar beet, and cotton are resistant to an herbicide called RoundUp, which is also produced by Monsanto. RoundUp-Ready crops make weed-killing easier for farmers, but also coerce those same farmers to depend on Monsanto’s seeds and RoundUp herbicide, raising concerns about corporate monopoly and decreasing the financial viability of small organic farming. Laura Resnick, who works at a small sustainable farm, notes that consumers who do purchase organic food usually make that decision deliberately, “The people who come to farmers’ markets are knowledgeable about GMO and they want to get the majority of their food from as local and sustainable a source as possible.” Organic produce may be prohibitively expensive for other consumers, however, drawing them to supermarkets instead of farmer’s markets. Signe Porteshawver, a consumer activist and farmworker, notes that neglecting to take environmental impact into account can drive food prices to artificially low levels. “In fact,” she says, “sustainable food captures the actual price. In sustainable food, what we pay for is the externalities: the environmental cost, the dead zones.” Additionally, government farming subsidies often compensate large factory farms at the expense of small farmers. Porteshawver believes that government-funded incentives leveraged through subsidies could incentivize consumers to purchase from small farmers.

nology must be balanced with the concerns for the livelihoods of small farmers. She notes, “Can biotech be effectively used to improve agriculture? Yes, for sure. Will it be the kind that’s sensitive of human means of production? That’s a different question. Only if there are scholars and activists and others who join together to say that agriculture is a fundamentally social activity and you can’t simply wrap it up into the model of technological production.” Because of this, attempts to institute genetically modified crops in developing countries have faced objections by not only environmentalists but also anti-globalization advocates. Dr. Juma argues that, far from globalizing, biotechnologies allow developing countries to engineer for economic independence and food security. He warns, “One of the most popular myths is that this research is supported by foreign firms seeking profits. The evidence points in a different direction. Much of the research is locally-driven and inspired by the search for solutions to local challenges.” Dr. Jasanoff, however, disagrees. She told the HPR, “When you look at funding programs in Africa and India, I think you would find the fingerprint of the multinational wherever you go.” For example, an Indian company named Mahyco developed a pest-resistant transgenic eggplant called BT brinjal. Mahyco, a partner of Monsanto, attempted to bring the eggplant to commercial production. In 2010, the Indian government instituted a moratorium on BT brinjal deployment in response to mobilization by Indian activists and farmers.

GM AND DEVELOPMENT

With concerns regarding the environment, human health, corporatization, and globalization, there is valid reason for small farmers in both the US and in developing countries to object to the spread of GM crops. These crops, however, also hold huge promise for a more sustainable and more productive agricultural future. As Addie Rolnick, a senior at Harvard writing her thesis on the politics of genetically modified crops in India has learned, any decision about biotechnology regulation must take many factors into consideration. Rolnick notes that a productive discussion about GM foods must “move forward in a way that looks at the details and the specific issues at stake.”

Issues of environment, health, and corporate control extend to the developing world, where GM crops have been applied to help resource-poor farmers increase nutrition and crop yields in Indian and some African countries. Proponents of biotechnology argue that these technologies will increase farmers’ self-sufficiency and prevent famines. At times, biotechnologies that originate in the US can transform local agricultural economies in developing countries in harmful ways. Dr. Jasanoff argues that the promises of biotech-

“When you look at funding programs in Africa and India, I think you would find the fingerprint of the multinational wherever you go.”

SPRING 2012 HARVARD POLITICAL REVIEW 13


FOOD

Bye, Bye Miss American Pie: America’s Food Culture Amy Weiss-Meyer and Teresa Yan

A

ny attempt to define American food culture leads, inevitably, to a realization that no singular, overarching food culture exists in America. Harvard professor Joyce Chaplin, who teaches a course on American food history, explains, “One of the big points about American food culture is that there isn’t one.” Chaplin is not indicating that America has no food culture. The operative word here is certainly one. Instead, America’s diverse gastronomical landscape, formed over the years by a steady influx of immigrants, draws from a variety of food cultures, with origins around the globe. The diversity of American food cultures and practices can be used as an asset in efforts to solve fundamental environmental, social, and health dilemmas facing America today. While America may lack a unifying food culture, there are certainly food practices that span all genres of American cooking, many of which are not only unhealthy, but damaging to the environment.

14 HARVARD POLITICAL REVIEW SPRING 2012

THE WRONG INGREDIENTS FOR THE WRONG RECIPES A defining characteristic of food in America is the overemphasis placed on meat. According to Michael Romano, named Best Chef in New York in 2001 and who has studied cooking around

the world, one fundamental difference between the US and other nations is that, “Nowhere [else] in the world do you see

such a massive consumption of protein in daily diets.” As he explained to the HPR, raising livestock exacts a heavy toll on the environment and is unsustainable in the long term. Due to the United State’s large size and space to cultivate livestock, Americans have been able to escape these problems and enjoy a food culture based largely on the consumption of meat. Furthermore, many Americans, when considering food, often forget about seasonality. Through her travels in Southeast Asia, food journalist and blogger Karen Coates concluded that an awareness of seasonality becomes increasingly difficult with improved access to foods both in and out of season. “We have so much access here to food from all over the world at any time of the year,” she described in an interview with the HPR. “It’s difficult for Americans to think of not having bananas in store all year round.” According to Romano, Americans are “divorced from the reality of our food” and ignorant of its origins due to continuous access to a wide variety of foods. While it is common in other cultures to see whole chickens hanging in butcher


FOOD

shops, most Americans think of chicken as something that comes pre-packaged in Styrofoam. Many supermarkets in Japan feature photographs of the farmers who raised the produce. In the US, however, most food products bear little evidence of their origins once they have reached grocery shelves. This depersonalization of food in America decreases consumer awareness of food sources and makes it more difficult to conceptualize the importance of seasonality in purchasing and cooking habits.

CHANGING AMERICA’S GROCERY LISTS Solving the problems with American food culture will require a fundamental shift in perspectives about food. Robyn Eckhardt, a food and travel journalist specializing in Asian and Turkish cuisines, suggests that Americans should treat

are renowned for their large portions, but size is not always beneficial. “People will often judge a meal by how big the piece of fish was or how much they paid,” notes Eckhardt, instead of focusing on “appreciating well-made food.” Stressing quality over quantity can lead to sustainable methods of living, particularly with regard to meat consumption. Coates notes that meat is almost a side note in many other cultures and that “a lot of people make vegetables or herbs the focus of the meal” instead. As a result, diets in such cultures are healthier for people and for the environment. Furthermore, emphasizing quality may help shift views about seasonality. As Coates indicates, eating local and seasonal

more work into food. In order to change the way they treat food, Americans must become more mindful of food they are eating. Eckhardt suggests that education can help inspire

The Western diet is primarily concerned with “food that is fast, cheap, and easy.” food more like an occasion, as is common in Mediterranean culture. Eckhardt explained to the HPR, “You’re not going to linger over a Twinkie, but you might be compelled to linger over a fresh croissant.” Eckhardt similarly suggests that Americans should prioritize quality over quantity or cost in their diets. Americans

food is something that people in other cultures have been doing for centuries. In Thailand, a country known for devising seasonal recipes, the northern Thai vegetable curry, gaeng hhae, is a prime example of a dish which varies its vegetable components based on the season.

HITTING THE (COOK)BOOKS Beyond merely changing their perspectives on food, Americans need to put more work into their food. As Michael Pollan argues in his book, In Defense of Food, “For most people for most of history, gathering and preparing food has been an occupation at the very heart of daily life.” Today, Americans are primarily concerned with “food that is fast, cheap, and easy” and are increasingly prone to diet-related illnesses like diabetes, cardiovascular disease, obesity and cancer. Good health and good eating are the simple, yet vital, rewards of putting

people to spend more time eating and making good food. Magazines, television shows, and food blogs can increase interest in healthy food, introduce different culinary styles, and teach simple cooking techniques to readers and watchers. “People need to be shown that eating good food doesn’t mean eating a plain steamed piece of fish and vegetables with no seasoning,” she said. There is also much to do outside of the kitchen to change the way Americans relate to food. Nonetheless, Coates believes that “there are a lot of small things that people can certainly do without going out of their way.” She particularly recommends getting involved with gardening, composting, and shopping locally. By learning more about how food is made and how food can be used, Americans will become more conscientious of the links between food, health, and the environment. With inspiration from other food cultures and adopting some of those cultures’ food practices, American food culture can take a turn for the better.

SPRING 2012 HARVARD POLITICAL REVIEW 15


THE EVERGLADES, SWEETENED The battle to save Florida’s natural treasure.

Matt Shuham

W

hen I fly home to Ft. Lauderdale International Airport, I always look out the window. The view is spectacularly beautiful and mechanistically awe-inspiring. Vast fields of marshes, swamps, and saw grass stretch out past the horizon’s end, accompanied by a harsh grid of concrete canals that scar the Everglades, the 60-mile wide wetlands that flows through the southern portion of Florida. The canals were put in place in 1948 when Lake Okeechobee, Florida’s largest body of water, overflowed after a series of destructive hurricanes and killed thousands. The plan to contain the great lake, called The Central and Southern Florida Project, successfully diverted flood water to domestic real estate markets and mitigated the destructive effects of hurricanes on the region. Unfortunately, the environmental impact of the project was not the highest consideration at the time. Human alterations of the area have left the Everglades almost unrecognizable. Water that would have naturally flooded the wilderness is diverted off to the Atlantic Ocean on the east and the Gulf of Mexico to the west. Remaining water is polluted by run-off from residential and agricultural fertilizer and other pollution that leads to algae blooms and extremely high levels of phosphorous and nitrogen. Nevertheless, the canals provide for the soil that sweetens much of the United States. Besides oranges, grapefruit, and others, south Florida produces half of America’s annual sugarcane crop, grown right in the middle of the Everglades. As global warming, water pollution, fertilizer runoff, and saltwater intrusion slowly degrade the national treasure that is the Everglades ecosystem, Florida is left to weigh the value of sugar production.

16 HARVARD POLITICAL REVIEW SPRING 2012


FOOD

In 2000, Bill Clinton and Congress tried to answer it with the Comprehensive Everglades Restoration Plan, which pledged federal dollars to invest in the health of the Everglades by diverting water back into the ecosystem and focusing on wildlife protection. Despite a series of setbacks and engineering difficulties, the initiative has funded local restoration and infrastructure projects and is gradually restoring water flow. Charlie Crist proposed one of the most ambitious plans to date while governor in 2008. He proposed purchasing United States Sugar, one of the nation’s largest sugar corporations, and re-integrating its vast sugarcane fields back into the Everglades ecosystem. The governor drew plenty of criticism for the deal. The land was overpriced and even a spokesperson for USS acknowledged the “very active” relationship between the sugar industry and government negotiators. But the state and United States Sugar soon reached an agreement to purchase more than 180,000 acres of land for $1.37 billion. It was a win for environmentalists, who had long cherished the valuable land upon which the farms sat, and it was a win for the farmers themselves as drought and water restrictions had put USS in serious debt. As the full force of the recession hit, Florida, with a massive real-estate market and a huge foreclosure crisis, was an economic ground zero. The ambitious land-grab was soon viewed as too aggressive, costly, and inappropriate in such an austere time. In May 2009, a new deal was arranged through which 73,000 acres of land would be bought for $536 million, with the option to purchase the rest later. As the recession continued, the project was downsized again in August 2010 with $197 million for 26,800 acres. Environmentalists were hesitant to criticize the new deal, worried of either party withdrawing altogether. United States Sugar felt slighted after expecting a much larger sale than reality afforded. Charlie Crist finished his governorship and ran for the Senate seat that would eventually become Marco Rubio’s seat. The deal concluded, not with a continuous path for the Everglades to flow into the ocean, but with two isolated pieces of land, parts of which were wholly unfit for restoration or water treatment.

In hindsight, many preservationists are faulting the state’s negotiators for not steeling themselves, insisting on lower prices, and sticking to the full acreage amount. According to Judy Sanchez, Senior Director of Corporate Communications and Public Affairs for US Sugar, “current economic conditions make [it] highly unlikely” that any more of the original 187,000 acre offer will be purchased by the state. The need for the restoration of the Everglades is as urgent as ever. The water is no less polluted and the animals no less endangered than they ever were before. White-tailed deer sightings are down 94 percent. More than anything, water quality is the most troubling issue. Storm water treatment centers, large above-ground reservoirs used to purify water from the Everglades, do not have the capacity to process all of the fertilizer-polluted water. Some, including Peg McPherson, Executive Director at the Legacy Institute for Nature and Culture, believe that water purification should be a priority for the future, “I’m very, very hopeful for the day when we can ask farmers to use their property for restoring and treating water,” McPherson said. “The original idea was that we were going to get that land and use it for storm water treatment areas, and for other uses that we couldn’t do while it was in US Sugar’s hands… The deal that finally came through with US Sugar isn’t necessarily the deal we thought we were going to get.” In the past few months, Rick Scott, Florida’s penny-pinching governor, has shown some favor to the Everglades preservation movement, pledging $40 million to restoration work. It is a start, but more must be done in the areas of land reclamation, water quality improvement, and environmental standards. Florida lost big in the recession. The state missed its chance to make a big impact when prices were low, but it should not give up the fight. The Everglades touch almost every aspect of the Florida economy including property values, water purification prices, and tourism. The environmental significance and natural beauty of the Everglades are unparalleled. This goes beyond agriculture, however powerful those forces may be. The state of Florida must get behind the fight to save the Everglades.

The plan to purchase and restore Flordia’s Everglades collapsed in the wake of the financial crisis.

SPRING 2012 HARVARD POLITICAL REVIEW 17


UNITED STATES

IN BRIEF Legislation Watch Alexander Smith HR 2306: “ENDING FEDERAL MARIJUANA PROHIBITION ACT OF 2011” HR 2306 is a rare example of bipartisan collaboration in a particularly divided Congress. Congressmen Ron Paul (R-Texas) and Barney Frank (DMass.), both prominent members of their respective parties, are cosponsors. But the fact that the bill tackles a seemingly untouchable issue, federal marijuana regulation, is even more interesting. During the previous two Congresses, Frank introduced legislation curbing federal enforcement of marijuana usage laws. Both times, the bills had bipartisan support, but never made it beyond committee, and its latest incarnation will likely meet that same fate. Since its introduction last June, HR 2306 has been recommended to both the House Judiciary and the Energy and Commerce Committees, but neither has acted. Regardless, the topic is certain to galvanize groups seeking drug law reform, and the two prominent cosponsors add greater legitimacy to the marijuana legalization movement. Indeed, there are already proposed ballot initiatives in California, Colorado, and Washington state to decriminalize marijuana. Victories there could encourage the federal government to seriously examine the issue, as supporters of legalization are increasingly encouraged to advocate on both the state and federal level. Currently, little discussion exists regarding this legislation, but as November approaches, accompanied by the aforementioned ballot initiatives and a Presidential campaign, HR 2306 will likely gain additional attention. ¶

18 HARVARD POLITICAL REVIEW SPRING 2012

HR 3806: “ONE SUBJECT AT A TIME ACT” While pundits are criticizing Congress for its inaction, Congressman Tom Marino (R-Pa.) is claiming legislators are doing too much simultaneously. HR 3806 states, “Each bill or joint resolution shall embrace no more than one subject,” but this seemingly simple bill could have serious repercussions if signed into law. The practice of attaching riders, or typically irrelevant legislative items attached to popularly supported bills, would be prohibited. Indeed, many controversial bills have been attached as riders in recent years, and the most famous one was the Patient Protection and Affordable Care Act. In reality, the Democrats introduced it as an amendment to the “Service Members Home Ownership Tax Act of 2009”. HR 3806 has yet to pass the House Subcommittee on the Constitution, and has only received five cosponsors. However, the importance of this bill lies not in its potential passage, but in its implications. Assisted in its drafting by the Williamsport, Pa. Tea Party, the bill’s focus is very appealing to small government conservatives and libertarians. While HR 3806 may not become law, any discussion indicates sincere thoughts about restructuring the way Congress conducts its business. ¶

HR 1981: “PROTECTING CHILDREN FROM INTERNET PORNOGRAPHERS ACT OF 2011” The Stop Online Piracy Act (SOPA) stole the legislative spotlight for January, but the bill’s sponsor, Rep. Lamar Smith (R-Tex.), has another bill, the “Protecting Children From Internet Pornographers Act of 2011” under discussion. While the title suggests possible bipartisan support, HR 1981 would significantly change the federal government’s role in monitoring the Internet. Among the new punishments for possessing or creating child pornography are mandates for Internet service providers to maintain databases tracking convicted perpetrators’ IP addresses for one year at minimum. The goal is to locate individuals exchanging child pornography, but the implications extend well beyond that. Essentially, information the government previously required a warrant for, Internet service providers would have to submit to authorities upon request. The online community has remained silent, however, and because this legislation affects users rather than major service providers, few are protesting the bill. Service providers have expressed disagreement with the expansion of federal authority, but the lack of outrage is most likely a product of minimal opposition from major online organizations. HR 1981 has passed the House Judiciary Committee, and is awaiting discussion by the full chamber. Expect for this bill to dominate discussion about civil liberties in the upcoming months. ¶


UNITED STATES

On the Docket Jose Robles

MILLER V. ALABAMA On March 20, the Supreme Court will hear oral arguments for Miller v. Alabama, and must decide whether life sentences without parole are constitutional for minors. Not only will this case significantly impact the 2570 juveniles serving such sentences throughout the country, but also it could greatly influence future rulings on the Eighth Amendment. Over the past decade, the Court has heard two cases involving criminal sentencing for minors. In Roper v. Simmons (2005), the Court struck down capital punishment for minors, and five years later, in Graham v. Florida, the justices declared that a minor could not be sentenced to life without parole for crimes other than murder. The court will revisit issue again when considering Evan Miller, who at age fourteen assaulted a middle-aged man and subsequently set his trailer on fire. Miller was later convicted of murder and given a life sentence without possibility of parole. Miller appealed the decision, but the Alabama Supreme Court declined to hear the case. The case is likely to split along familiar lines. Conservatives justices like Clarence Thomas believe that sentences should be judged according to, “the standards that prevailed at the time of the founding.” Meanwhile, liberal justices adhere to the precedent set by former Chief Justice Earl Warren, that sentences should be judged according to the, “evolving standards of decency that mark the progress of a maturing society.”

KIOBEL V. ROYAL DUTCH PETROLEUM In the Citizens United (2010) decision, the Supreme Court ruled that corporations could be considered persons, allowing them to spend unlimited sums on political advertising. The Court has begun examining the issue of corporate personhood during February oral arguments for Kiobel v. Royal Dutch Petroleum. The case questions whether corporations can be sued under the Alien Tort Statute, which allows foreigners to sue for damages for actions carried outside the United States in violation of U.S. law or international treaties. The suit, brought by Nigerian citizens, seeks damages against Royal Dutch Petroleum for allegedly helping the Nigerian government carry out torture and extrajudicial killings. The Second Circuit Court of Appeals has already decided only individuals, not corporations, are liable under the Alien Tort Statute. However, the implications of Citizens United may sway the Supreme Court in a different direction. ¶

As with Graham, Justice Anthony Kennedy will probably cast the deciding vote, which will either send the Court in the direction of increasingly liberal readings of the cruel and unusual punishment clause or maintain the status quo. ¶

SPRING 2012 HARVARD POLITICAL REVIEW 19


AMERICA, DRONES AND THE FUTURE OF COMBAT Gabriel Rosen

O

n November 26, 2011, an American drone flew over the hilly Pakistani border after successfully hitting its target. The result: 24 Pakistani soldiers lay dead, and 13 civilians were injured. This dramatic incident was no anomaly. The United States has engaged in drone warfare in Pakistan for almost a decade, killing over 2300 militants and at least 500 civilians according to the Bureau of Investigative Journalism. Unmanned Aerial Vehicles, or drones, are used to fly in conditions deemed unsuitable

20 HARVARD POLITICAL REVIEW SPRING 2012

or unsafe for humans. However, is this impersonal method of killing immoral? While drone warfare is no more damaging than conventional warfare, the psychological effects it could have on drone pilots and the virtually unchecked power the President has to conduct military strikes without Congressional approval are extremely worrying.

HUMAN COSTS Among the most significant criticisms of drone warfare is the claim that the unmanned aircrafts minimize the full emotional impact of death, turning killing into something akin to a video game. During missilefire, soldiers take their cues from computers, shooting at targets that might be hundreds of miles away.


UNITED STATES

While military generals have frequently made orders outside of warzones throughout history, the lack of an actual human being directly executing attacks contributes to a new level of impersonality in war. However, the very dispassion that drones are criticized for also provides one of the strongest arguments in their favor. Drone strikes allow for cooler calculations, mitigating the effect of human emotions that can compromise decisionmaking capabilities. Drones permit precise, calculated strikes, theoretically minimizing the toll on civilian lives and shielding soldiers from direct combat. There is some disagreement as to the actual benefits of impersonal warfare. As Harvard preceptor Paul Sludds explained to the HPR, “Many philosophers think that emotion is a key factor in our moral compass.” While dispassion might yield the most effective course of action, emotion can allow individuals to experience, “more acutely what is going on and to make the most moral decision possible.” Impersonality in drone warfare, therefore, could be a double-edged sword.

decisions he makes on the battlefield. But, a less obvious distinction with traditional combat is the lack of clear separation between military and civilian life. Soldiers on the ground do not immediately return home after missions, but instead stay on base close to the battlefield. This separation allows soldiers a chance to reflect and decompress before their return home. This lack of separation for drone pilots is potentially troublesome, given that they can remotely complete a mission, often involving the death of numerous individuals, and return home immediately after. As Sludds explained, “The danger with these people, is that we would have some guy in Nevada going to work in the morning, killing a few people, then coming back home to hug his wife and watch the Super Bowl.” The effects are largely unstudied, but the blurring line between the warfront and home front underscores the potential problems of a highly impersonal form of warfare.

THE MEN BEHIND THE MACHINES

The greatest questions surrounding drone warfare, however, are more legal than ethical, and drone usage may undermine the democratic process. When the United States invaded Iraq, it was heavily criticized for not putting the decision up to a true democratic vote. However, the issue was at least debated and contested by Congress because it involved risking the lives of the American soldiers.

While drones represent a sizeable improvement over conventional methods in precision and minimizing casualties, the effects on pilots are unclear. Sludds notes that in all other forms of battle, the soldier is imperiled. It is precisely this risk that conveys the full impact of war onto a soldier and affects the

SILENT KILLERS OF AMERICAN DEMOCRACY

SPRING 2012 HARVARD POLITICAL REVIEW 21


UNITED STATES

The lack of oversight from groups outside of the executive branch marks a significant shift in power. Drones in contrast remove the human element, making the decision of going to war much less contentious. American drone strikes in Pakistan, Africa, the Middle East, and elsewhere are on a scale that would have received more political scrutiny from the public had they been manned missions. Peter Singer of the Brookings Institute explained in a recent article that lack of men on the ground significantly reduces the financial and mental cost of war. Singer asserted that without military casualties to influence voters, politicians “no longer treat the previously weighty matters of war and peace the same way.”

AMERICAN APATHY There is some question, however, as to the legitimacy of these concerns. The war decision-making process has long excluded average Americans, and since the Civil War, the United States has not fought a major battle on American soil, shielding civilians from the true costs of war. But drone use may further reduce the citizenry’s ability to control when the United States wages war. Harvard Professor Shawn Ramirez tells the HPR that drone warfare allows the President, “to bypass Congress and essentially conduct strikes that nobody else knows about.” Because the drone program is controlled by the CIA and not the military, the President has exclusive authority to reveal statistics about the engagements conducted and resulting casualties. Congress has limited capacity to investigate these matters, and even groups like the American Civil Liberties Union cannot discuss the matter meaningfully because drone programs are not officially recognized. The lack of oversight from groups outside of the executive branch marks a significant shift in power. Nevertheless, Professor Patrick Lin of the California Polytechnic State Institute disagrees with this notion that new military technology is a threat to democracy. He explained to the HPR that although this may appear to create an imbalance of power between the branches, the “balance of powers is already off kilter since the War Powers Resolution has been routinely ignored by our presidents for decades.” Instead, the power of shared information through the Internet and the media has replaced the importance of shared power among the three branches. Demonstrations of public disapproval are immediate

22 HARVARD POLITICAL REVIEW SPRING 2012

and effective, leading Lin to contend that power focused on the executive allows citizens to “focus [their] disapproval on a single person” rather than creating general discontent with “hundreds of elected officials.” While the initial decision to carry out strikes may rest with one individual, the choice to continue falls upon the many.

PROMOTING TERRORISM A more subtle concern with drone strikes shifts the focus from domestic effects to their global impact. Ramirez argues that the United States’ main hesitation when it comes to drone warfare should be the political instability it often breeds. Ironically, the very tool intended to fight terrorists may actually undercut American efforts. Initially, drone warfare offered a diplomatic loophole whereby the United States could conduct anti-terror strikes without Pakistan and other countries perceiving a violation of sovereignty. Instead, drone strikes are now widely regarded on par with any manned craft in terms of intrusiveness. Policymakers fear that citizens of targeted countries will no longer support their governments if the United States is allowed to conduct drone strikes. This uncertainty may fuel more instability in the already shaky Arab world, and in the turmoil terrorist groups could gain a greater foothold. Tom Barry, director of the TransBorder Project at the Center for International Policy, told the HPR that he sees no end to drone warfare in the near future. Barry said, “The U.S. public, the U.S. Congress and most of the media support these clandestine operations for two main reasons: support for counterterrorism wars and intervention, and the relative lack of risk to U.S. lives.” Indeed, there may even be a time when, “drone operations at home become more common, whether for homeland security, military training, or law enforcement and public safety.” Only then perhaps will the public begin raising real questions about their use. Until that time though, as the United States continues to modernize its military, drones have become an integral part of the military’s repertoire.


UNITED STATES

MITT ROMNEY’S HARVARD PROBLEM Ross Svenson

SPRING 2012 HARVARD POLITICAL REVIEW 23


UNITED STATES

R

ick Santorum’s February surge underscores what many have been saying all along: Republican voters are unwilling to accept Mitt Romney as their nominee. While Romney has considerable political experience and remains the strongest threat to President Obama this fall, he has failed to charm the base. Romney’s image is at the core of this problem: Harvard and Massachusetts, long associated with liberal elites, are not popular attributes, particularly in the eyes of Tea Party members. Yet, Romney graduated from Harvard’s Law and Business Schools and served as Governor of Massachusetts. These connections have reinforced the perception that Romney is “out of touch” with ordinary Americans. Romney has attempted to distance himself from Harvard and cast himself as the conservative standard-bearer during the campaign with mixed results. The right’s perception of Romney as disconnected will continue to haunt him throughout the nominating process, but it is unlikely that this would harm him significantly among Republican voters in the general election.

THE ALBATROSS OF ELITISM “Harvard is the symbol of elite America,” Vanessa Williamson, co-author of The Tea Party and the Remaking of Republican Conservatism, told the HPR. This symbolism has been evident for decades with Richard Nixon calling Harvard, “the Kremlin on the Charles” during the 1970s. Even today, conservative commentators dub HLS professor Elizabeth Warren a member of the “Harvard elite.” According to Williamson, when conservatives refer to Harvard elites, they criticize cultural or liberal elitism. “Fear of

24 HARVARD POLITICAL REVIEW SPRING 2012

elitism is a fear of cultural elitism … the Tea Party is concerned about liberal, coastal elites who look down on average Americans,” she explained. Harvard professor Brett Flehinger agrees, telling the HPR that conservatives like Republican presidential hopeful Rick Santorum express, “a critique of liberalism.” Republicans and Tea Party supporters do not want those associated with elite institutions and liberal surroundings in positions of power. This Republican definition of elitism may explain why Mitt Romney is confronting a larger issue with his association with the Ivy League than both President Bushes, who attended Yale. They had the benefit of a Texan identity, while Romney’s connection to the elite Ivy League is compounded by his history as Massachusetts Governor. With conservatives holding these beliefs, Romney clearly began his campaign at a disadvantage when it came to connecting with Republican voters. Indeed, Romney has experienced what Harvard-affiliated Williamson found when she researched the Tea Party. She comments, “As a general rule, people were suspicious before they met me.” Romney similarly has to shatter this barrier of suspicion.

TRYING TO BREAK THROUGH Romney has taken several measures to connect with conservatives; on a superficial level, Flehinger notes Romney has been wearing open-collared shirts and jeans this campaign cycle. He also has placed, “great emphasis on patriotism” to stave off perceptions of disconnectedness from ordinary citizens, and singing ‘America the Beautiful’ has become a regular feature on the stump.


UNITED STATES

More importantly though Flehinger believes Romney is “running as a businessman.” While this positioning as a businessman highlights his wealth, giving him a more traditionally populist definition of elitism among Democrats and Independents, it actually plays well with conservatives. The Tea Party members Williamson interviewed “weren’t [classic] populists.” She reasserts the idea that, “right wing populism aims at cultural symbols of the left wing…being rich is not a bad thing, and in fact is something to be admired.” Furthermore, Flehinger observed that throughout the nomination process Romney’s opponents have not paid attention to his multiple houses. Such an attack on personal wealth would likely sit poorly with Republican voters, even though Newt Gingrich has not shied away from criticizing job-cutting aspects of Romney’s tenure at Bain Capital. Still, even this attack earned Gingrich criticism because fellow Republicans found parallels with liberal attacks on the free market. Although Romney’s personal wealth itself does not raise concerns for Republican voters, he has made several gaffes regarding his wealth, earning widespread criticism from the media, Democrats, and even some Republicans. He infamously bet Texas Governor Rick Perry $10,000 at a debate over previous statements on the individual mandate. He even jokingly referred to himself as “unemployed” while speaking with a group of unemployed Floridians. Both incidents were widely covered by the media and Democrats sent out email blasts to supporters in hopes of raising money from Romney’s perceived aloofness. Some Republican opponents, like Rick Perry, criticized the bet as, “a little out of touch with the normal Iowa citizen.” The bet, however, along with his unemployment joke, proved unimportant with the Republican electorate. In addition to attempts to separate himself from perceived elitism, Romney has explicitly put distance between himself and Harvard. He has repeatedly criticized Obama as out-of-touch, asserting that the President’s Harvard-linked foreign policy advisors advocate for more diplomatic engagement and reduced military strength. In a strong address to the Veterans of Foreign Wars Convention, Romney criticized these advisors, stating, “That may be what they think in the Harvard faculty lounge, but it’s not what they know on the battlefield!” But Romney’s attempts to distance himself from Harvard are often little more than words. Romney retains many Harvard professors and alumni as advisor, including economic advisor Professor N. Gregory Mankiw and key foreign policy advisor Kennedy School Professor Meghan O’Sullivan. Romney additionally continues to donate substantial sums to Harvard Business School according to recently released tax returns, and he has received over $56,000 from Harvard professors and their spouses in campaign donations since 2002.

FIXING PERCEPTIONS To Williamson, Romney in a way has become “a Tea Party candidate.” Not only has he, “made a big effort to show he’s not still the guy who passed Romneycare,” but he has, “done things like show support for the Ryan budget.” Through these actions, Williamson claims Romney has sent signals to conservatives that he shares their orthodox views. Many leading conservatives have responded positively to these demonstrations of conserva-

tism. Tea Party favorites South Carolina Governor Nikki Haley, Congressman Jason Chaffetz of Utah, Delaware 2010 Senate nominee Christine O’Donnell, and many others have endorsed him. There is evidence however, that despite his support among leading conservative figures, Romney has not made a favorable impression on voters who express strong anti-elite sentiments. He has struggled with Tea Party supporters and self-identified “very conservative” voters throughout the nomination process. He also has lost several caucus contests, which tend to be smaller and filled with more conservative members of the Republican base. Explaining Romney’s losses thus far, Williamson said, “No one I interviewed a year and half ago liked Romney. They still don’t like him.” She finds substantial evidence of his impalpability to many Republicans on Tea Party blogs. For example, the Virginia Tea Party Patriot Federation posted a link on their Facebook page to an article entitled, “The Mitt Romney Deception” while posing the question, “If you are supporting Mitt Romney as a Tea Party person, ask yourself – is he the kind of person that best represents Tea Party values?” A February Rasmussen Reports survey also showed Romney trailing Santorum among Tea Party supporters by 35 percentage points and “very conservative” voters by 36 points. If Romney can reduce these deficits like he managed in Florida and use his vast organizational advantages to outlast his opponents, he should be able to arrive at the Republican National Convention with the nomination sewn up. His ability to counteract his elitist image will matter little in winning the conservative votes, although he will certainly face Democratic attacks on his fabulous wealth. According to Williamson, “Beating Obama is the number one concern…He doesn’t have to worry that [anti-elite conservatives won’t] come out to vote in the general election.”

FOCUS ON NOVEMBER Romney may be a Harvard-educated governor from Massachusetts, but he is nothing like Obama in the eyes of conservatives. Nevertheless, Obama does not have an elitist image problem with his own party as Democrats subscribe to more economic-based populism, and consequently see Obama as the son of a single mother who broke through significant social barriers to achieve success. The President is, however, roundly criticized by Republicans for elitist viewpoints. Flehinger noted, “Obama’s personality, aside from other issues like race, makes him more susceptible to that criticism [elitism].” Additionally, Flehinger observed, “Figures of the far right have done a good job of keeping him ‘foreign.’” For conservatives, Obama is emblematic of the cultural or liberal elitism Williamson described. This disdain for Obama will keep conservatives from staying home on Election Day even with Romney as the Republican nominee. For Romney to win, he must focus on November, given that time is running out for Romney to successfully shed his Harvard and Massachusetts background. While mitigating his elitist image is certainly important, his success will ultimately entail convincing Republican voters that he remains the strongest contender in the general election.

SPRING 2012 HARVARD POLITICAL REVIEW 25


WORLD

IN BRIEF Venezuela, 10/7/12

Russia, 3/4/12 On February 1, President Vladimir Putin surprisingly acknowledged that a presidential run-off might be possible. Weeks before the March election, Putin has been busy suppressing criticism from dissidents, even restraining Russia’s leading independent radio station. Nonetheless, during the February 4 protests, Putin detractors far outnumbered supporters. Putin’s hard stance and stubborn resistance to social media will likely hurt his final performance and prevent him from achieving an outright popular majority. Communist Party leader Gennaday Zyuganov would be Putin’s likely opponent in any run-off. ¶

France, First Round 4/22/12 According to recent polling, incumbent Nicolas Sarkozy is currently trailing Socialist nominee François Hollande while barely edging the unelectable nationalist Marine Le Pen. Sarkozy’s attempt to remedy this sore situation by calling in German Chancellor Angela Merkel will likely accomplish nothing, except for recalling memories of unpopular austerity measures. Though such reforms like raising the retirement age to 62, seem innocuous to Americans, the French public has responded negatively. Meanwhile, the inexperienced Hollande does not have much more to offer beyond regime change, but this would likely be enough to trounce Sarkozy in a run-off. ¶

26 HARVARD POLITICAL REVIEW SPRING 2012

Chavez has been fairly cautious since the 2010 legislative elections, in which the opposition coalition claimed a majority of votes. Indeed, his position looks increasingly perilous as the opposition coalesces. Leopoldo López, one of three opposition candidates, recently threw his support behind primary opposition leader Henrique Capriles Radonski. Given these developments, Chavez strengthened his military support by appointing an army friend to Congress in an attempt to solidify his power base. However, whether this will be enough for an outright victory remains questionable. Nevertheless, given Chavez’s popularity with the electorate, especially the poor, the possibility of his winning another six year term remains quite high. ¶

ELECTION 2012: THE WORLD VOTES Ken Mai

Mexico, 7/1/12 This year’s election has created a political phenomenon that everyone is buzzing about: PAN (National Action Party) candidate Josefina Vázquez Mota. Having won her conservative party’s primary with a whopping 55 percent against incumbent President Calderón’s handpicked Ernesto Cordero, she symbolizes a break from the party’s past. Voters, disillusioned by PAN’s inability to deliver on their promises, have increasingly been looking toward PRI’s (Institutional Revolutionary Party) Enrique Pena Nieto. The third candidate, Andrés Manuel Lopez Obrador from the Democratic Revolution Party, has lost his former luster. Although pundits are predicting a comfortable Nieto win, polls are beginning suggest a shift in momentum. Over the upcoming months, Vázquez Mota could articulate a platform to distinguish herself from the Calderón’s presidency’s inefficacy, giving her a chance to become Mexico’s first woman President. ¶

Egypt, May 2012 With the end of parliamentary elections, Egypt is heading for more political turmoil. Presidential elections have been moved up to April due to demands from activists and presidential hopeful Amr Moussa, the exchief of the Arab League. Moussa is widely expected to be victorious, but the Freedom and Justice Party’s momentum could propel their nominee, Khairat Al Shater. Other hopefuls include Lt. Gen. Ahmed Shafik, the alKarama party’s Hamdeen Sabahy, and Lt. Gen. Ahmed Hossam Khairallah, who predicts that concerns about stability and economic growth will push voters toward the widely respected military. ¶


WORLD

Ken Mai

The Arab World’s Forgotten Springs OMAN

JORDAN

ALGERIA

WHAT HAPPENED

WHAT HAPPENED

WHAT HAPPENED

After the Tunisian protests in January 2011, 200 Omanis gathered in the capital city of Muscat to protest government corruption and demand a minimum wage increase. After a series of similar, relatively calm February protests, Sultan Qaboos bin Said increased the minimum wage of private sector workers, raised stipends for college students, and replaced six members of his cabinet. Further protests in the industrial city Sohar left some bloodshed, resulting in further government restructuring, most prominently elevating the role of parliament from advisory to legislative.

Protests here against high food prices early last year eventually developed into a wider call for political reform. Rooted in criticisms of then Prime Minister Samir Rifai’s ineffectual policies and corrupt administration, the protesters’ calls for Rafai’s dismissal by the king succeeded. However, the monarchy remained largely free from criticism. Eventually, King Abdullah II replaced Rifai with ex-general Marouf al-Bakhit, but following additional slow economic growth, Bakhit himself was replaced by Awn al-Khasawneh, a former judge with the International Court of Justice.

WHAT’S COMING

WHAT’S COMING

A major source of the country’s peace is the people’s love for the sultan. At age 70 and without an heir however, the sultan’s influence over Oman might not last much longer. Coupled with the country’s depleting oil supply, the source of its recent economic boom, experts are concerned for Oman’s future. Some factors are promising though: the new legislative role of parliament represents a promising move toward democracy, and the country’s friendship with the West and Iran will prove pivotal in future dealings between the two entities. ¶

Because the government has largely failed in attempts to placate the people, Jordanians have begun lodging complaints against the monarchy, Amman’s ultimate fount of political power. Interestingly though, these new protesters are different from before. Comprised of tribal members outside the cities, they are typically unwavering supporters of the monarchy. This underlies a shift in attitudes toward the existing power structure, and could pose a far more significant threat. ¶

Similarly, Algeria’s protests also began in response to food price hikes and evolved into a clarion call about problems including a 10 percent unemployment rate, police state restrictions, and the two-decade long state of emergency that has stifled public protests. Mimicking Tunisian protester Muhammed Bouazizi, ten protesters self-immolated or committed other such acts. In an attempt to counter this trend, the government halved food prices, and then afterwards lifted the state of emergency, allowing protests in all areas outside the capital. Finally, in an attempt to permanently resolve wthis, President Bouteflika, who has ruled the nation since 1999, announced parliamentary elections tentatively scheduled for May 10th this year.

WHAT’S COMING Last February’s protests were considered ‘a key turning point,’ given the concessions extracted from the government. Indeed, activist Ali Rachedi of the Front of Socialist Forces party explained that protesters broken the ‘psychological barrier’ that previously hindered such popular action. However, the solutions proposed by the government seem are nominal and unsustainable: political concessions aside, continued economic stagnation in a country where 70 percent of the population is under age 30 represents a fundamental challenge to = government’s stability. Coupled with new dissatisfaction of the disbanded Communal Guards, the state militia that has been fighting terrorist forces, Algeria remains a kettle of volatile forces reaching its boiling point. ¶

SPRING 2012 HARVARD POLITICAL REVIEW 27


WORLD

IS THE EUROPEAN PROJECT STALLED? The Future Prospects of E.U. Enlargement

Krister Koskelo

A

s the Eurozone crisis drags on, many are questioning whether the very essence of the European project has been jeopardized. The European Union’s capacity to absorb new member states seems particularly imperiled, as E.U. enlargement has slowed recently, even grinding to a halt.  Though the economic crisis has certainly

28 HARVARD POLITICAL REVIEW SPRING 2012

played a significant role in stalling expansion, it is important not to lose sight of long-term geopolitical and cultural considerations. Overall, though some countries have decided to tentatively remain outside the

European Union for political or economic reasons, many obstacles toward expansion come from within the organization itself.


WORLD

HOLDING OFF MEMBERSHIP Some slowdown can be attributed to waning desires and growing doubts about membership within candidate countries, sentiments that are perhaps most pronounced in Turkey. As Hilmi Güvenal, a prominent Istanbul businessman, points out for the HPR, the majority of Turkey’s population is Islamic and nationalistic. Hence, Güvenal says, “being independent [from Western influence] and having good relations with other Muslim countries sells better in the domestic market than accepting the harsh membership conditions of the E.U.,” a multilateral entity viewed as a “Christian club” in the Middle East. According to Güvenal, the current crisis per se has not significantly affected Turkish desire for E.U. membership yet. Rather, the decreasing economic disparity over the past decade between a rapidly modernizing Turkey and an increasingly stagnant E.U. has become more evident, and this fact, more than the crisis itself, has reduced Turkish support for membership. Meanwhile, Turkey has rediscovered its position as a geopolitical superpower in the Middle East, asserting itself as a bridge between the West and Arab world, a vastly more appealing position for Ankara than that of a peripheral E.U. member. Despite the decline of Turkey’s E.U. aspirations, the prospect of joining the single market and integrating fully into Europe remains attractive for many smaller countries, especially in the Western Balkans. In Croatia, despite the “deep impact” that the Eurozone crisis has had on public perceptions of E.U. membership, former Croatian foreign minister Miomir Žužul observes that Croatians did approve E.U. accession in a referendum this past January. Žužul notes that the prospect of accessing the concrete benefits of E.U. membership remains relatively attractive. Furthermore, many Croatians view E.U. membership as a “homecoming,” whereby Croatia can rejoin the Western European community that it has historically had significant ties with. Croatia’s neighbors, including countries like Serbia, Macedonia and Albania have thus far been undeterred by the crisis, each having made E.U. accession an important foreign policy priority. However, these countries still face significant political and economic hurdles. For example, Albania’s political stalemate following its June 2009 elections prevents it from being recognized as an official candidate by the European Union, and Bosnia is still very fragile fifteen years after rampant ethnic conflict.

INTERNAL DIVISIONS Though individual candidate states have issues delaying accession, most of the slowdown can be attributed to factors within the E.U. itself. According to Harvard professor Grzegorz Ekiert, an expert in Eastern European E.U. politics, the Eurozone crisis has sharpened the sense of “enlargement fatigue” in Brussels. Given the economic woes of Greece and other debt laden states, these nations may soon avidly pursue the E.U.’s generous structural funds, in addition to the

bailouts already dispensed. When even existing members are exorbitantly expensive to support, the E.U. will think twice before admitting new members. Žužul further highlights internal disputes within the E.U., noting that since the mid-1990s, the E.U. has been split into two factions regarding the Balkans. One faction felt that Croatia should “remain tied with the Balkans” due to its position as “the only stable actor in a historically troubled region,” and hence advocated simultaneous accession for all the Balkan countries. The other favored approaching accession on a nation by nation basis. Žužul claims that disagreements between these two groups were the “chief cause” in delays to Croatia’s accession, because they ended up imposing “far stricter procedures and requirements for Croatia’s membership” than had been the case for previous members.

FUTURE CONCERNS Longer-term geopolitical and cultural factors must also be considered. Ekiert, paraphrasing well-known scholar Jacques Rupnik, claims that “the E.U. is reaching its geopolitical limits.” Russia considers the Caucasus region, Belarus, and Ukraine to be firmly within its sphere of influence and severely opposes any prospect of E.U. membership for these nations. The Putin administration disapproves of even mere attempts by those countries to cooperate more closely with the European community. Furthermore, though cultural disputes are significant taboos in E.U. circles, Ekiert notes there is a view in Brussels that the Western Balkans is the only remaining area that is “culturally European.” From this school of thought, a preliminary consensus is emerging between France and Germany that the Mediterranean basin, including Turkey, does not belong in the E.U. The huge populations of Turkey and Ukraine would also guarantee them large representation in the European institutions, which operate on proportional representation. The current core European countries are unlikely to yield their substantial existing influence to the prospective newcomers. For the short term, E.U. enlargement will be delayed for at least several years. Ekiert and Žužul concur that Croatia will be the last country admitted for some time, with the possible exception of Iceland, which due to its tiny size and its preexisting compliance with most E.U. requirements should be easy to integrate. During this severe crisis, enlargement is a low priority for the E.U., and as a senior German politician notes, “the efficiency of E.U. institutions must be improved first,” before any further enlargement can be considered. But beyond that, the great era of European expansion may be reaching its twilight, and the (eventual) admittance of the Western Balkan countries will, in all likelihood, demarcate the final limit of E.U. expansion. Limited free trade agreements notwithstanding, it now looks as if the inhabitants of Turkey, Ukraine, and the Caucasus countries will forever be left out of Europe’s great political and economic experiment.

SPRING 2012 HARVARD POLITICAL REVIEW 29


WORLD

INSIDE IRAN’S NUCLEAR PROGRAM Elsa Kania

I

n November 2011, the International Atomic Energy Association released a report with compelling evidence that Iran has, “carried out activities relevant to the development of a nuclear device.” A veritable explosion of frenetic media coverage, heated political rhetoric, and escalating international pressure ensued, given that a nuclear Iran would have serious ramifications for security in the Persian Gulf and beyond. Tehran could potentially use nuclear capacity to increase its regional leverage, potentially inciting an arms race, or as President Ahmadinejad has threatened, to “wipe [Israel] off the map.” Nonetheless, Iran continues to claim that its nuclear program is solely for peaceful purposes, attributing the IAEA report to, in the words of Ahmadinejad, “absurd U.S. claims.” After its publication, Ahmadinejad proclaimed to a crowd of thousands of Iranians, “This nation won’t retreat one iota from the path it is going.” However, there remains great uncertainty as to what, precisely, that path might be. While Iran’s nuclear program has advanced beyond what the requirements for a civilian nuclear program, the strategic aims of this nuclear quest remain unclear. Does Iran seek simply to deter a threatened military strike or foreign intervention? Or does Iran intend to project its power more aggressively in the Persian Gulf? The stakes and the costs of miscalculation are high. Beyond the media hype though, a balanced and nuanced examination of domestic dynamics surrounding Iran’s nuclear program is needed.

A LEGITIMIZING NARRATIVE A brief look at the historical context of the political calculus guiding Iranian elites is revealing. Although originally initiated by the Shah with U.S. support, Iran’s nuclear program was revived during, and must be understood in the context of, the Iran-Iraq War. This devastating conflict left over 1.5 million dead and deeply shaped the new Islamic Republic’s perspective on its political, strategic, and military surroundings. The United States’

30 HARVARD POLITICAL REVIEW SPRING 2012

perceived encouragement of Iraq gave rise to both an increasingly polemical narrative of a Western conspiracy against Iran and the perceived imperative of sophisticated deterrent capacity. Iran’s nuclear program has become integral to the regime’s character and base of support. Annie Tracy Samuel, a research fellow at the Kennedy School’s Belfer Center for Science and International Affairs told the HPR, “the nuclear program symbolizes for Iran its struggle for independence from what it perceives to be an unfair and oppressive international system.” Samuel continues, it, “plays an important role in the regime’s overall legitimizing narrative, on domestic, international, and strategic levels… symboliz[ing] Iran’s technological advancement and capabilities, its independence, and its power.” This overarching narrative was highlighted by the purge of moderate political figures and ascendance of hardliners after the 2009 Green Movement protests against Ahmadinejad’s reelection. Hooman Majd, former advisor and translator for Iranian Presidents Khatami and Ahmadinejad, and author of The Ayatollahs’ Democracy tells the HPR, “It’s become a question of Iran’s national rights.” Because the regime has relied heavily upon this narrative of independence and

self-sufficiency, Majd believes, “If they were to give in on the nuclear program, they would lose a tremendous amount of credibility.”

THE PEOPLE’S PROGRAM? With increasing economic pressures and the potential for domestic unrest, social cohesion is deeply entwined with this legitimizing narrative. Examples of strife include protests on the anniversary of opposition leaders’ Mir Hossein Mousavi and Mehdi Karoubi house arrest. Dr. Djavad Salehi-Isfahani of the Brookings Institute told the HPR, “Iran’s society is polarized. The regime has legitimacy with the lower strata of society, and the reason why it has legitimacy is because it’s against powerful countries, against rich countries.” Substantial popular support remains for Iran’s nuclear program. Even the economic hardships that ordinary citizens have endured because of international sanctions are framed by the regime in terms of a Western conspiracy. Sanctions thus far have provoked negative sentiments more against the West than against the regime itself. Certainly, the government has been held responsible for earlier economic challenges. In general, according to Majd, public opinion, “criticize[s] Ahmadinejad for giving the


WORLD

West and Israel excuses to get the international community to be anti-Iran with his belligerent rhetoric.” Many believe that this bellicosity has facilitated U.S. efforts to coordinate multilateral support for sanctions and other punitive measures. However, sanctions’ effectiveness on the Iranian street have hardly had the desired effect, engendering renewed bitterness towards the West while weakening the middle class, including reformers and opposition figures, and thus ultimately strengthening the regime further.

WHO AND WHY? The Islamic Republic of Iran has one of the world’s most opaque regimes, an amalgamation of political and clerical authorities. Powerful actors including the Guardian Council and Islamic Revolutionary Guards Corps play key roles. Competition among regime elites, even between the Supreme Leader, Ayatollah Khamenei, and President Ahmadinejad, has been ongoing. However, the current crisis has created unity of purpose. Majd, who maintains close ties to key figures in the current administration, believes these, “divisions [are] not on whether Iran should or should not have a nuclear program…but based on how Iran has approached dealings with the West.” While the Guards Corps theoretically oversees the program and the Iranian Atomic Energy Organization operates day-today activities, Majd emphasized, “only one person has true

Sanctions’ effectiveness on the Iranian street have hardly had the desired effect, engendering renewed bitterness authority—the nuclear weapons program is controlled by the Supreme Leader.” While Ahmadinejad may be willing to extend conciliatory policies with the West, conscious of his legacy, the matter may be largely beyond his control. Ahmadinejad’s influence is questioned, and he was recently summoned before Iran’s parliament to answer charges economic mismanagement.

INTENTIONS? Day by day, the situation escalates on between Iran and the West, as progressively harsher sanctions have been imposed without measurable progress. Beyond the constantly fervent political rhetoric and threats, the assassination of Iranian nuclear scientists and similar attacks on Israeli diplomats in Georgia and India reveal a covert war waged behind the scenes. Meanwhile, further destabilization and even nuclear proliferation in the region seem inevitable. Robert Haddick, who has advised the State Department and the National Intelligence Council on irregular warfare, observes that Sunni Arab neighbors are becoming increasingly “terrified” of Iran’s nuclear program and are enhancing their own military capacity. Haddick tells the HPR, “Iran’s leaders should realize that they have started an arms race that in the end they can’t win and that will hurt Iran’s security.”

However, for these wary neighbors and the international community alike, a question persists. What are Iran’s intentions, and how would a nuclear Iran behave? Nuclear capacity has been credited with forcing greater responsibility upon states and reducing the potential for direct conflict, whether between the Soviet Union and the U.S. during the Cold War or between India and Pakistan. Perhaps, contrary to predominating doomsday predictions, raising the stakes could allow for greater security and stability in the region. Yet, anticipating the full implications and consequences of such scenarios is impossible. Nuclear capacity could instead become an instrument of Iranian efforts to dominate the Persian Gulf. Haddick suggested that Iran could enhance its security more aggressively, by “lever[ing] its nuclear program to expand its influence in its region, through coercion and stepped-up proxy action.” On the other hand, Majd emphasized the prestige that nuclear capacity would confer, saying, “I don’t think it’s about expansionism. I think its much more about geopolitical power.” Meanwhile, Samuel somewhat paradoxically comments, “The nuclear program is a sign of strength, but the need for a deterrent force is a sign of weakness.” Indeed, Majd believes that Iran seeks will use its program, “to protect the regime from outside force being used against it,” rather than as a means of, “protect[ing] regime longevity.” Perceived national interests hint towards a more aggressive track. Considering ongoing covert measures and that official U.S. policy towards Iran has long been supporting regime change though, Iran has rational reasons to seek security through enhanced deterrence.

ENDGAMES As the situation continues to escalate, unease prevails in the United States and Iran alike. Patterns of mutual escalation leave little room for compromise. The question now becomes what the endgames of U.S. and Iranian policy are and whether war is inevitable. The United States, according to Majd, “is putting itself into a corner—at some point…war, becomes the only option.” Iran has threatened to close the Strait of Hormuz, begun cutting off oil from European customers, and publicly unveiled new advances in its nuclear program. While the potential for an Israeli strike with tacit U.S. support is openly discussed, diplomatic initiatives offer potential for rapprochement. The hope, however faint, still remains that a negotiated solution is within reach. With mounting pressure, Iran has expressed a desire to renew diplomatic talks. Indeed, William Tobey, Senior Fellow at the Belfer Center and former Deputy Administrator for Defense Nuclear Nonproliferation at the National Nuclear Security Administration, tells the HPR that, “the critical time is now” as, “the window for negotiation is closing.” To prevent worst-case scenarios, leaders must confront deeply-rooted political and policy constraints. This entails that both sides redefine traditional conceptions of acceptable outcomes are. Unrelenting pressures have only perpetuated tensions, and Samuel believes that the regime’s ability to justify such a radical policy reversal to its citizens is central and thus, “if the regime can incorporate its changed policies into its legitimizing narrative, then it could agree to a negotiated settlement.” Genuine dialogue and a willingness to transcend immediate political considerations in seeking compromise have been lacking thus far and are essential at this critical moment.

SPRING 2012 HARVARD POLITICAL REVIEW 31


STRIKING A BALANCE IN SOUTH SUDAN Atul Bhattarai

E

arly July last year, the world clamoured to celebrate the birth of South Sudan after a protracted and bloody conflict with its northern counterpart, Sudan. Despite wide coverage in international media, the referendum that established the world’s 193rd nation did little to address the most pressing sources of conflict. As South Sudan’s independence approaches its first anniversary, the central African country remains mired in many problems, ranging from conflict over ill-defined borders to internal ethnic violence that reportedly has killed thousands. Resolving these problems demands active cooperation between the governments of Sudan and South Sudan, a willingness to make concessions toward security, and a vigorous effort from the international community to ensure stability in the region.

THE ABYEI CRISIS Formally a Sudanese region, Abyei is an ethnically diverse area of South Kordofan province, slightly smaller than Connecticut, which straddles the divide between Sudan and South Sudan. Because of its location, Abyei is often inaccurately characterized as oil-rich. Jonathan Temin, director of the Sudan program at the United States Institute of Peace, explains that, “it used to have decent amounts, but it has minimal reserves now.” Although oil remains highly contested between the two Sudans, the current impasse in Abyei has deeper origins. Conflict over the area originated with the First Sudanese Civil

32 HARVARD POLITICAL REVIEW SPRING 2012

War that began during the 1950s, and since then both sides have laid competing claims. The 2004 Comprehensive Peace Agreement (CPA) stipulated that Abyei would be jointly administered by both nations, pending the 2011 referendum. Temin tells the HPR that regarding South Sudanese independence, “it seems they were willing to let Abyei fly in favour of the larger referendum. The international community was okay with that and let it happen.” Deliberations over Abyei’s status became more muddled after neither side could decide what individuals were eligible to vote. Sudanese authorities pushed enfranchising the nomadic Missiri while South Sudanese officials argued for more constrained definitions of Abyei citizenship. Amid the gridlock, an U.N.backed agreement in September 2011 required both sides to withdraw military forces from the region. Abyei’s unresolved status represents a major struggle between the Sudans and no clear solutions exist. The most logical path forward to determining Abyei’s ownership, the referendum, has effectively been eliminated, increasing tension and the threat of military combat. Temin suggests three routes the conflict could take: first, a popular referendum, second, a unilateral declaration by either Sudan claiming Abyei, and third, the preservation of the current nebulous status quo. However, a referendum would likely be rife with disagreement over voting rights, and a unilateral decision is politically impossible. Worst yet, Temin asserts, maintaining the status quo, “would be a pretty lousy outcome for the people who actually live in Abyei.”


WORLD

To preserve regional stability, South Sudan must play its cards right, finding a means to advance its interests without aggravating Sudan and provoking military confrontation.

ETHNIC CONFLICT Although ethnic conflict has dominated Sudanese landscape for decades, the form it has taken over recent months in South Sudan raises unique concerns. Like other communities mobilized along ethnic boundaries, South Sudan’s population is comprised of groups that nurture animosity towards each other, which has traditionally entailed small cattle raids and minor skirmishes. Since independence, the magnitude of violence has been magnified, particularly in the Jonglei state where increased cattle raiding and violence between the Dinka Bor, Murle and Lou Nuer tribes Cattle has killed over 3,000 and driven 150,000 people from their homes. Identifying the source of the violence would help bring stability to the ravaged region, but ethnic conflict is multifaceted and difficult to resolve. John Campbell, a regional expert at the Council on Foreign Relations, explains that resolving the issue is particularly difficult when ethnic divisions form around economic boundaries, as South Sudan is experiencing. However, there is increasing evidence from discovered weapons caches that ethnic violence in South Sudan has been perpetrated and exacerbated by the Sudanese government in Khartoum. Eric Reeves, a Professor at Smith College, pinpoints this as a major concern, telling the HPR that, “these automatic weapons have changed cattle raids into something much more destructive.” The current internecine violence underlies multiple struggles taking place in greater Sudan. From economic hardship to escalating tensions, the endemic conflict in South Sudan resulted from many deep-seated issues that must be addressed gradually. However, the violence and deaths stemming from ethnic conflict demand immediate action. Campbell tells the HPR, “The government of South Sudan must address ethnic issues by reaching out to the disaffected minorities, and the international community can mobilize itself to meet some of the humanitarian needs of the people.” Temin adds that international efforts could, “support the capacity of the government…to deliver services, and support the UN mission in South Sudan.”

BLACK GOLD For both Sudan and South Sudan, oil remains the single most challenging issue on the political horizon. Currently, South

Sudan possesses approximately 80 percent of total oil reserves between the two countries, despite the fact that only its northern counterpart contains the refineries and oil pipelines necessary for the processing and exportation of crude oil. Yet, even accounting for logistical difficulties, South Sudan remains extremely dependent on oil; over 90 percent of its revenues are oil exports. According to Campbell, the international community had expected the two nations to resolve the issues of oil infrastructural cooperation and revenue sharing in advance of South Sudanese independence. However, Sudan and South Sudan have yet to establish a feasible system or pipeline rental arrangement. Furthermore, the South Sudanese government has accused Khartoum of stealing from its oil reserves, which Sudan justifies as compensation for unpaid transit fees. Consequently, South Sudan is seeking alternative methods for exporting its oil. A deal was recently signed between South Sudan and Kenya to construct a pipeline that would sidestep Sudan, and plans to build an independent refinery are underway. “South Sudan would have no trouble gaining international funding for the project,” says Campbell. Although the deal could be a boon for South Sudan, Khartoum fears a collapse of inflows to its refineries, and might respond violently. Thus, to preserve regional stability, South Sudan must play its cards right, finding a means to advance its interests without aggravating Sudan and provoking military confrontation.

THE WAY FORWARD Despite having attained independence and international recognition without plunging into full-scale conflict, South Sudan hangs in a precarious balance. As unresolved problems like Abyei, interethnic warfare, and oil arrangements with Sudan continue to fester, the prospect of violence metastasizing looms, demanding the full and absolute attention of South Sudan’s newly-christened leadership. Resolving ethnic conflict without resorting to military intervention that could exacerbate violence should be prioritized. South Sudan has international support and should capitalize on that to placate aggressors and aid civilian victims. After decades of civil war, South Sudan cannot afford to become embroiled in military confrontation with Sudan, and must proceed carefully and diplomatically with its northern neighbor in advancing its interests.

SPRING 2012 HARVARD POLITICAL REVIEW 33


WORLD

The Burmese Spring Caitlin Pendleton and Nur Ibrahim

O

n November 13, 2010, Aung San Suu Kyi emerged from her villa to greet supporters after seven years of house arrest. Emblematic of Burma’s fledgling pro-democracy movement, Suu Kyi’s release was hailed by the international community and locals alike as a positive sign of change at a pivotal time in Burmese history. Following a half century of authoritarian rule, the Burmese government has recently begun what it insists is a transition from military junta to democratic civilian government. Many observers hope that Burma’s top-down revolution will be an alternative and comparatively peaceful model for governments grappling with the social movements of the Arab Spring. But, any celebration of a “Burmese Spring” would be preemptive. Suu Kyi has declared that she will participate in upcoming April parliamentary elections, which are seen as a major test of the Burmese government’s dubious sincerity.

A BURMESE GOLDMINE

Aung San Suu Kyi is the General Secretary of the Burmese opposition party.

34 HARVARD POLITICAL REVIEW SPRING 2012

Suu Kyi now meets a Burma that is starkly different from the one she knew before her release. Today, with major investment from China and great strategic value, Burma has a steadily growing economy, a wealth of oil and minerals, and a burgeoning middle class of industrialists and businessmen. This renewal of economic activity in Yangon holds the possibility of major consequences for the military regime. Anticipating that corresponding positive developments will lift foreign sanctions, the government might steadily move away from its longtime economic ally, China. Previously last October, President Thein Sein surprisingly suspended the construction of a new hydroelectric dam being developed jointly with the China Power Investment Corporation. The dam’s construction created controversy when the BBC reported that perhaps 90 percent of generated electricity would go to China. Donald Emmerson, director of the South East Asia Forum at Stanford University, says that the dam suspension represents a new model for a Burmese government concerned with reducing its dependency on China. While China’s attempts to expand its economic influence into Burma have been largely successful in the past decade, the dam’s suspension is an important signal from Burma. It behooves the Burmese military to encourage Western investment by making political concessions and diversifying the country’s economic options. But, Emmerson explains to the HPR that this pivot away from China and toward reforms could eventually endanger the military with, “a juggernaut that


WORLD

could destroy it. Opening the gates to investment and aid could enrich the generals, but it could also spur the growth of a new middle class that supports Aung San Suu Kyi and wants even more reform.”

THE ETHNIC DILEMMA According to David Steinberg, a Professor of Asian Studies at Georgetown University, the oft-ignored issue of ethnic minority rights represents the most fundamental challenge for presentday Burma. Since 1949, the Karen community has carried out insurgencies in Burma’s hilly northern flank in response to its marginalization by both civilian and military governments. Especially since the 1962 military coup, the Karen and other ethnic minority groups have faced harsh discriminatory treatment from generals in Yangon. Despite many calls to end the violence, and a stipulation by Suu Kyi that international embargoes should only be lifted once a solution to ethnic conflict is realized, violence has broken out again in the northern Kachin state. Conversely, recent months have seen progress in the government’s policy toward the Karen, as embodied in the declaration of a ceasefire in the longest ethnic rebellion of the modern era.

JOURNALISTIC FREEDOM AND POLITICAL PRISONERS Despite talk about increasing channels for free speech, Burma’s advances in the realm of journalism have been among the most superficial. Reporters Without Borders’ 2011-2012 World Press Freedom Index ranked Burma 169 out of 179 nations, among the ranks of Syria and North Korea. The report also notes that while the government’s efforts to reduce censorship count as improvements, Burma, “remain[s] largely under the control of an authoritarian government run by former members of the military junta, reinvented as civilian politicians.” In a radical departure from previous state rhetoric, Tint Swe, director of the Press Scrutiny and Registration Department, suggested closing his own office this past September. However, by late January, the Burmese government had abandoned Swe’s proposed initiative, with local journalists reporting that the state had returned to heavily censoring politically-sensitive news. Ismael credited the Burmese government’s hypocrisy to more than mere mendacity; instead, there is reason to believe there no single opinion dominates the Burmese government. Citing a familiar theme in democratization, Ismael asserts that focusing on journalistic freedom reforms will enable and encourage improvements in other problematic elements of Burmese politics, including ethnic conflicts and political prisoners. For the time being, Reporters Without Borders has cautiously welcomed the Burmese reforms, in full recognition that they are incomplete.

Furthermore, although international observers heralded Burmese policymakers for the granting of mass amnesty to 230 political prisoners last October and 651 political prisoners on January 13, this is a small dent in a broader problem. According to the United Nations, more than 2,000 political prisoners remain in military custody.

AUNG SAN SUU KYI: AGENT OF TRUE CHANGE? “Despite her international presence,” Emmerson continued, “Suu Kyi’s ability to deepen and broaden reform should not be exaggerated.” More specifically, even if she wins a parliamentary seat her efforts to bring about change there could be outvoted and overruled. Burma’s constitution, controversially ratified in 2008 as part of the military junta’s Roadmap to Democracy, guarantees a certain number of seats for the military. With only 48 seats up for grabs on April 1st and many already occupied by pro-military parties, the National League for Democracy, Suu Kyi’s party, will fall far short of a majority, even if it wins every seat it contests. “She will be balanced on a knife edge between cooptation as a token reformer and isolation as a principled critic,” Emmerson said. “If it appears that by cooperating with the government she is giving up more than she gets, her supporters may have second thoughts. She seems to trust President Thein Sein. How much that trust is warranted remains to be seen.”

THE PATH FORWARD U.S. and international response is crucial toward shaping the future of Burma. According to Emmerson, there are three major routes the international community can take: doing nothing, dropping sanctions completely and normalizing relations, or providing a measured response. Europe and the U.S. have previously asserted that freeing political prisoners and reaching an agreement with ethnic minorities are prerequisites for the removal of economic sanctions against Burma. After the recent mass amnesties, President Obama authorized an easing of American economic sanctions against Burma on February 8, but it was a limited move principally designed to allow Burma to acquire help from international financial institutions like the World Bank. On the diplomatic end, Secretary of State Hillary Clinton’s much-publicized visit to Burma in December has led to conversation about the appointment of a new U.S. ambassador to Burma, a first since representation was downgraded to the level of Charge d’Affaires in 1988. Ultimately, it is worth noting that if Burma’s transition proves successful, it would inspire reform in nations like Cambodia and Laos rather than Middle Eastern countries involved in the Arab Spring. But until its reforms are proven credible, Burma has little chance of serving as a model for top-down revolution.

SPRING 2012 HARVARD POLITICAL REVIEW 35


Cory Pletan

ONCE UPON A CAR

I

n his State of the Union address, President Obama proclaimed, “We bet on American workers. We bet on American ingenuity. And tonight, the American auto industry is back.” President Obama has good reason to be optimistic. Collectively, General Motors, Ford, and Chrysler gained market share against foreign brands for the first time since 1988. GM and Ford earned solid yearly profits, and even Chrysler posted a profit for the first time in years. The domestic auto industry will be the feather in President Obama’s cap during the presidential election as he defends himself against Republican attacks on government bailouts. The recent history of the auto industry has been muddled by politics, and it has become increasingly difficult to uncover the real story. Once Upon a Car: The Fall and Resurrection of America’s Big Three Auto Makers by Bill Vlasic, the Detroit bureau chief for The New York Times, succeeds in putting aside politics and personal vendettas as it tells the real story of the decline and recovery of the American auto industry. The book begins in 2005. For over a decade, GM, Ford, and Chrysler had dominated the hugely profitable market for large pickup trucks and SUVs. However, the era of cheap gas and easy loans was coming to an end. To make matters worse, the Big Three were slowly being suffocated by crushing health care

36 HARVARD POLITICAL REVIEW SPRING 2012


BOOKS & ARTS

and pension costs for its hundreds of thousands of current and retired workers. These costs were sustainable in past decades when the Detroit automakers had a majority share of the American auto market, but they could no longer afford to compete with Asian automakers whose non-unionized workers cost $55 an hour instead of the $77 an hour that GM, Ford, and Chrysler were paying in wages and benefits. There was a storm on the horizon that the leaders of GM, Ford, and Chrysler failed to anticipate. Vlasic is at his best as he details GM and Chrysler’s spiral into bankruptcy and Ford’s fight for its life from the perspective of every group involved in an interwoven and fast-paced narrative. The President of the United Auto Workers Ron Gettelfinger garner’s sympathy as he passionately tries to preserve the way of life enjoyed by hundreds of thousands of factory workers and retirees. Vlasic describes him as “both an idealist and a pragmatist, a true believer waging a holy war and a hardheaded negotiator determined to cut the best possible deal.” Interviews with longtime factory workers as they face the uncertainty of unemployment are particularly moving. Reading about Rebecca Oelfke, a mother of two who supports her kids and disabled husband by working at one of GM’s parts suppliers really injects a human element into the whole tragedy and illuminates how important the Big Three are to the economy of the United States. Vlasic’s ability to integrate the perspectives of the many stakeholders sets Once Upon a Car apart from other books about the auto bailouts. Paul Ingrassia’s book Crash Course: The American Automobile Industry’s Road to Bankruptcy and Bailout-and Beyond provides a more extensive analysis of the events and decisions that brought down the Big Three, but Once Upon a Car is written in a more readable, fast-paced manner The book feels like a novel rather than a nonfiction recollection of a recent industrial calamity. In September 2010, Steven Rattner, the car czar, released his own account of the auto bailout in his book Overhaul. It is an interesting account, but it focuses almost exclusively on the government’s role in the bailouts of GM and Chrysler. And unlike Once Upon a Car, it does not really analyze why the Big Three got into their precarious situations. GM and Chrysler emerged from bankruptcy court with clean balance sheets and strong future product portfolios. GM got a new CEO and management team, and its situation improved to the point where it was able to have the largest IPO in U.S. history in late 2010. Chrysler was incorporated into the Italian automaker Fiat, where CEO Sergio Marchionne finally added small fuel efficient cars to Chrysler’s lineup. Ford emerged from the crisis better than ever. Alan Mulally had assembled a team of executives who were completely dedicated to continuing Ford’s success. Ford had a range of hot-selling vehicles such as the midsize Ford Fusion, the compact Ford Focus, and the rugged Ford F-Series trucks which were competitive with the best vehicles that Honda or Toyota had to offer. Times had definitely changed. Several Republicans, with Mitt Romney being the most notable, have harshly criticized President Obama’s handling of the auto bailouts. In fact, Romney published an op-ed in the Detroit News on February 14, 2012 clarifying his position on the issue. In the editorial, Romney attacks Obama’s decision to provide $85 billion in bailout funds to GM and Chrysler before easing them into accelerated bankruptcy. This claim is not completely true because President Bush approved over $17 billion in bailout funds near the end of his term. He also echoes many Republi-

cans’ criticisms by arguing that the Big Three should have been left to enter bankruptcy with no government intervention.This course of action would have been extremely risky. Hundreds of thousands of jobs would have been lost from the closure of auto dealerships, factories, and parts suppliers. Even more would have been lost when the small business around the closed factories disappeared. In his op-ed, Romney said, “The president tells us that without his intervention, things in Detroit would be worse. I believe that without his intervention things there would be better.” Maybe Romney and the other critics of the auto bailouts are right. It is possible that GM, Chrysler, and Ford could have recovered without government intervention. But considering what was at stake, as Vlasic makes clear, it would have been reckless to leave one of America’s most important industries in such an uncertain condition. No matter what your opinion on the auto bailouts, there is no escaping the sense of optimism felt at the end of the book. By the start of 2011, GM, Ford, and Chrysler were finally producing cars that could compete against anyone else’s. Like a mythical phoenix, the American auto industry had risen out of the ashes of its near destruction and emerged stronger than ever. Everyone loves a comeback, and after reading Once Upon a Car and watching the recent performance of the Big Three, it is clear that President Obama is right. Detroit is back.

GM’s Renaissance Center Headquarters in Detroit.

SPRING 2012 HARVARD POLITICAL REVIEW 37


BOOKS & ARTS

A NATION DIVIDED Ethan Loewi

E

ach era is defined by the great rivalries to which it bears witness. Intractable, riveting clashes where neutrality is not an option, and the side you take reflects not just your preference, but the contents of your soul. In 21st century America, the fate-of-the-world-deciding-conflictdu-jour is even color-coded for convenience. It is, of course, that trusty bichromatic bastard Red vs. Blue. Every year, South Carolina based militiamen become more wary of their Bible-burning neighbors to the north. The jokes that New England dwelling college students make about Republicans grow snarkier. A tragic and totally one-sided civil war redux seems inevitable: the gun-loving southerners will sidestep the weakly-thrown iPhones that the college students are using for weapons, mow them down with a few M-16 blasts, say a prayer for their lost atheist souls, and America will be no more. Without a savior, this doomsday scenario could take place as soon as President Paul’s third term. So praise be to Dante Chinni, James Gimpel, and their new book, Our Patchwork Nation. The book is a work of political geography that aims to free us from the shallow and divisive tyranny of the red-state/blue-state map. Rather than cram Americans into two boxes, Chinni and Gimpel have endeavored to cram us into 12. By examining statistics such as income levels, immigrationemigration patterns, and age distribution, the authors have sorted all of America’s 3,143 counties into one of 12 categories: “Industrial Metropolis,” “Evangelical Epicenters,” “Monied Burbs,” “Minority Central,” and so on. These are tooled to reflect something like an ideal cross-section of the population and replace the binary of red or blue with teal, orange, and magenta. The result is, as promised, a “Patchwork Nation,” where an electoral map of California is a dozen colors rather than just party-approved blue. The pitch seems airtight and borderline utopian: anything that is not Red vs. Blue is surely a step in the right direction, no? But this new division of the country is open to a litany of criticisms, and begs the more serious question of whether categorizing a country of 307 million by any color scheme is inherently a fool’s errand. Thus, Our Patchwork Nation enters choppy ideological waters. The book is structured to give a statistical and anecdotal snapshot of each of the 12 community types before reflecting on the

38 HARVARD POLITICAL REVIEW SPRING 2012

Our Patchwork Nation: The Surprising Truth About the “Real” America Dante Chinni, James Gimpel


BOOKS & ARTS

A work of political geography that aims to free us from the shallow, divisive tyranny of the red-state/blue-state map. state of broad topics such as “politics” in light of the Patchwork Nation framework. The snapshot chapters, the result of much travel and investigation, are all interesting and well told in their own right. For example, analysis of deep-seated racism in Baton Rouge is a perfect opportunity for Chinni and Gimpel to show off their respective skill sets. On the quantitative front, Gimpel’s statistical work is extensive and often enlightening, particularly when examining the distinct economic motivations behind community types like “Tractor Country” and “Boom Towns” distinct. Qualitatively, Chinni’s prose is deft and efficient, perfect for bitesized storytelling. To capture the racial tension in Baton Rouge, he describes two adjacent bars that are effectively segregated, writing that “the M Bar isn’t the Wine Loft, and the main difference isn’t that martinis are the house specialty. Here, everyone is black.” Our Patchwork Nation is by no means an unpleasant read. Its findings are approachable and probably educational to anyone at all interested in demography. But the efforts of Chinni and Gimpel to concisely define all 12 communities lean on familiar archetypes of the very kind that the book aims to discredit such as latte-sipping college students or small-town Christians who hate to read anything but the Bible. Chinni and Gimpel seem hesitant to enter truly ambiguous ground, for fear of muddying their 12-type breakdown. Upon even brief examination, there are hundreds of nitpicks to be raised with their rationale. Should “Mormon Outposts” really be considered one of the 12 community types that make up the country? Why does Boulder County, home to the University of Colorado, fall into the “Colleges and Careers” category while Larimer County, a largely analogous town home to Colorado State, fall into “Monied Burbs?” And does California really have the only “Emptying Nest” community west of the Rockies? On these issues and many others, Our Patchwork Nation comes off as arbitrary, confused, and overly ambitious. Under the Chinni and Gimpel’s map, Cambridge falls into the “Monied Burbs” category. While it is undeniably a place of great affluence, Cambridge is also defined by its universities. Why not place it in “Colleges and Careers?” And what of the

large contingent of homeless people that populate its streets? In the case of Cambridge and many other places, the Patchwork Nation framework is reductive in the worst way. To try and lock Cambridge or any other town into one tidy category is to take something hugely complex and make it brutishly simple, not unlike doing dental work with a jackhammer. The book’s goal, to ride in on a rainbow-maned horse and save us from the narrow-minded generalizations that are ripping our country apart, is a noble one. But the foundation on which their anecdotes and evidence rest ultimately proves unworthy of their research. To learn more about what defines America is an unequivocal good, and Chinni and Gimpel give our national diversity in politics, economics, and culture its due. Still, their dogged insistence on shoehorning it all into a color-coded map only lends greater entrenchment to the notion that vast populations can and should be color-coded. Chinni and Gimpel fall all over themselves to point out that “no place fits entirely into one type,” but this only draws attention to the fact that their strong investigative work is being forced to serve a troubled premise. Constant apologies suggest flaws that are more than skin deep. In both the book’s introduction and conclusion, the authors write that “the principal aim of this project was to get beyond the oversimplified red-state/blue-state model.” Regardless, the Patchwork map is still profoundly oversimplified. And as much as it seems like an improvement, there is still something fundamentally unsettling about painting thousands of people one color or the other. The red-state/blue-state map is, by all accounts, a destructive and divisive monster. As the authors say themselves, “We hate that map. In so many ways, it represents a lie.” But rather than try to one-up that map, we should be attempting to do away with the ethos that led to its creation. The irony is palpable. In their efforts to fight stereotypes, Chinni and Gimpel have created a nuanced, thoughtful, and well-researched set of stereotypes in their misdirected masterpiece. To its credit, Our Patchwork Nation provides the best color-coded political map on the market. That, however, is the very definition of faint praise.

SPRING 2012 HARVARD POLITICAL REVIEW 39


BOOKS & ARTS

THE FIGURE OF FIGARO Rachel Wong

I

n the space of an hour, we have already seen a man with a crowbar, a cross-dressing pageboy, and a string of attempted seductions. Act Three opens. As the music begins, a Count, sporting a brocaded jacket with lace at his cuffs, walks solemnly onstage. He looks like he is about to address the Vatican Council, but he sings, with a great deal of earnestness, “What a bitch of a morning…” The audience jumps and bursts out into nervous laughter. This year, the Dunster House Opera Society celebrated its twentieth birthday with a polished and refreshingly colloquial interpretation of Mozart’s classic opera, The Marriage of Figaro. For five nights in February, the House’s dining hall was filled with the music of a cast and orchestra made up entirely of undergraduates, whose goal was to present opera not just as art, but as accessible entertainment.

A BREATHLESS ART The set of Figaro, with all its embroidered upholstery, contrasted as much against the scheming, lustful, almost Oedipal relationships in the story as the words that came out of the refined Count’s mouth. In Mozart’s opera, Figaro must outwit his master, Count Almaviva, in order to prevent him from seducing his bride-to-be. But this goal is not so easily met. First, the young pageboy Cherubino tries to seduce every woman in his sight, even the Countess, before he is packed off to the military. Then, an old housekeeper appears with a contract that entitles her to Figaro’s hand in marriage, before she discovers that

40 HARVARD POLITICAL REVIEW SPRING 2012


BOOKS & ARTS

REVIEWING THE DUNSTER HOUSE OPERA Figaro is really her long-lost son. Trysts are arranged. Figaro’s bride trades places with the Countess. When the Count finally realizes that he has been had, having seduced his own wife, he cries “Forgive me!” Everyone declares that they will be happy thereafter, and the opera hurtles on to its heady conclusion. “It’s not a love story,” says Elizabeth Leimkuhler ’15, who played the reckless pageboy Cherubino. “It’s a collection of flawed characters that you’re laughing at and laughing with. The opera itself is a lot of slapstick comedy, and the audience is always in on the joke.” Leimkuhler, who saw Figaro years ago at New York’s Metropolitan Opera, recalls how she first fell in love with the lively, flirtatious role of Cherubino. “It’s the perfect role to start out. He’s a memorable and a lot of fun.” On stage, she wears a red and yellow suit printed with ridiculous, Escher-like patterns. We can nott help but imagine that she is an eleven-year-old boy, swimming in pajamas that are just slightly too big for her. But it’s her aerodynamic pixie cut, endlessly jumping eyebrows, and the frightening velocity with which she flings herself around the stage that really puts the part together. “In one of the arias, there’s only about two bars when I’m not singing,” Leimkuhler laughs, “And in those two bars, I’m doubled over the couch, wheezing in the Countess’ face, trying to catch my breath.” She adds, “It’s definitely physically demanding to have to run around so much while singing – I had to hit the gym and be in shape!” Eric Padilla ’14, who played Count Almaviva and has had six years of experience in musical theatre, echoed Leimkuhler’s thoughts on the demanding nature of the work, “I definitely would not be able to perform in either musical theatre or opera without the training I’ve had,” he observes. Even so, the Count’s role was written for a much older singer: “While the part is in my vocal range,” Padilla explains, “it requires a certain vocal weight that I just don’t have yet because of my age.” He calls Mozart’s highly ornamented melodies “crazy,” but loves them for their beauty. “With directors as great as the ones for this show,” Padilla concludes, “it was made possible.”

REKINDLING RELEVANCE The directors, like the rest of the company, are undergraduates. Months before the show, Matthew Aucoin ’12 and Stewart Kramer ’12 had begun looking for English translations of the libretto. “At some point,” Leimkuhler recounts, “they just realized that what they were looking at wasn’t real. So they decided to translate it themselves.” Aucoin, who is fluent in Italian, wanted to create a more direct, down-to-earth interpretation. Especially for an opera written over two centuries ago, bringing out the humor of the piece was vital, explains Leimkuhler. She leans

forward. “I mean, people are going to laugh at sex jokes.” Recently accepted into Harvard, Jake Wilder-Smith attended one of the first performances and agrees that the translation helped bridge the divide between audience and music. As an opera singer himself, he admits, “There definitely is an elitist stigma on opera, especially more lately, but this is a perfect example of the fact that it’s not. Everyone laughs at certain moments, and everyone can relate to the characters.” When asked about the role that opera plays in today’s world, Wilder-Smith pauses, and says, “It’s a beautiful art form.” Another audience member looked surprised at the question, “It’s culture. It’s like how you need art history in order to understand art. Opera can tell us a lot about the way pop music works.” Eric Padilla commented on how the original play was banned by the soon-to-be deposed Louis XVI of France. “I imagine the aristocracy was not completely pleased with Figaro at the time of its premiere,” he says, “as it undermines the concept of their divine right to power. Today, I feel it’s a period piece. While its position on the aristocracy is still relevant, it’s not really controversial.” Leimkuhler adds, “Plot is never important. Plots are never complicated. It’s all about the music.” The work of this entirely undergraduate cast came together in the dining hall of a dorm, but the effect was anything but amateur. “The cast, in addition to the staff, is absolutely brilliant,” says Padilla. “Everyone is extremely professional and some of us intend on pursuing professional careers in performance.” “When I look at Dunster House Opera,” Leimkuhler says, “it’s just a group of people trying to make opera more accessible. It’s a great community of people.” When asked about her professional plans, she says, “My sister once gave me a picture, probably taken in the 1920’s or 1930’s. It’s a view of the Met from center stage. I just want to perform. I love singing, I love acting – having people watch me while I do fun things on stage.” After the last show, the company will stay in the dining hall until the small hours of the morning as the set is dismantled. “I’m small,” laughs Leimkuhler, “so I just pick up all the props and everyone thinks I’m helping!” The next day, breakfast opens as usual in Dunster House. There are no traces of the hilarity and extraordinary musicality that had filled the hall just hours ago. A glob of peanut butter splatters over the same patch of floor that, just a while ago, had received the bending knee of a great Spanish Count. A sophomore falls asleep over her organic chemistry where, yesterday, Matthew Aucoin had conjured up the first whisperings of the overture. Perhaps that’s the point: a two hundred-year-old Mozart opera, sung by undergraduates one tenth its age, in a space that houses the daily minutiae. It cannot get more accessible than that.

SPRING 2012 HARVARD POLITICAL REVIEW 41


INTERVIEWS

INTERVIEW: PETER THIEL with Corinne Curcie

You have received a lot of attention for donating to the Seasteading Institutue, which seeks to build small sovereign nations on artificial islands. Could you explain why you see this as a worthwhile cause in terms of experimenting with governments and societies? Just like there is room for starting new companies, because not all existing companies solve all the problems we need to solve, there should also be some room for starting new countries, new governments, and new communities because not all existing communities are perfect. I was attracted by the seasteading project because there is also a technological dimension to it. We need to somehow re-open the frontier, both in technology and in terms of the areas we look at for people to explore and develop.

Peter Thiel is the co-founder and former CEO of PayPal. He also was an early investor in Facebook. He currently serves as president of Clarium Capital.

As a successful investor in technology, you wield a great amount of influence in that sector. How do you see your role as an investor and that of other investors in today’s market? How much power do you and they have to combat the stagnation that you have been advocating against? Technological progress is the key for the advanced countries. The developing countries have a somewhat different story; they can simply copy the West. But for the West—the United States, western Europe, and Japan—to not remain stagnant, we have to progress. Technology is the single most important area for such progress. It can happen in the context of government, non-profits, big companies, or startup companies. The largest area for progress involves people starting new technology ventures, and that’s where the whole ecosystem of venture capital exists. More importantly, the entrepreneurs who create these businesses are such a critical part to the future. Our challenge is to identify great businesses and find ones that involve a powerful transformative way in which they will take our civilization to the next level. My bias is to always tilt it a little bit more in the direction of things that are not merely incremental—but rather towards some technologies that are going to be very big both as businesses and in terms of their potential cultural, political, and economic impact.

How do you know the direction of a business when the financial world is filled with so many uncertainties? We probably have invested in 140 technology companies over the last 10, 12 years. We have looked back on how we thought about these businesses at the time we invested. Whenever you think of things as just being probabilistic or a lottery ticket, you are setting yourself up for losing and not thinking. You have to get yourself into a mindset where it is not a lottery ticket at all, but it is as near a certain thing as it can possibly be. Do we think this technology really works? How does it compare with what else is on the market? Are these people really the people who can take this business and built it? You have to be very honest in answering these questions, and you cannot avoid them. Avoiding them ends up attributing more things to chance. It is not simply a matter of luck, chance, or statistics. I do not think that these companies are lottery tickets. There is a great deal of scope for determinant planning in building these businesses, and that’s what we set out to do.

What is the secret to a successful startup? It is always unique. The important part of these businesses is always unique. The question we ended up focusing a great deal on is in fact this question of uniqueness. Is there something about this business where it is the only business of its kind in the world? People are not looking at a variety of breakthrough technology areas. There are not that many people looking at artificial intelligence, next generation biotechnology, robotics. If it is possible, if things can be technically done in those areas, they tend to be very promising. This interview is edited and condensed.

42 HARVARD POLITICAL REVIEW SPRING 2012


INTERVIEWS

INTERVIEW: CEMIL ÇIÇEK with Alpkaan Celik

lead this challenging path to democracy in the Middle East? Turkey has ancient historical and cultural ties to the Middle Eastern and African nations, which has been reinforced for generations. In Turkey, the process of enlightenment took place much earlier than those countries. We have a history of 200 years of democratization and modernization. Democracy is not an easy target to reach. It requires social and political struggles. Now, most of the Middle East is experiencing this important process, and we cannot say that Turkey is not inspiring those countries on their way to democracy. Furthermore, Turkey, although it is an Islamic country, is still a secular state, and achieved to separate the religious issues from the affairs of the state. I believe that this can present a valuable example to other Islamic nations.

Cemil Çiçek has served as the Ministry of Justice and the Deputy Prime Minister of Turkey. Çiçek is the incumbent President of Turkish Grand National Assembly.

Western observers have noted that Turkey has shifted its diplomatic focus away from Europe and is strengthening its ties to the Middle East. Do you think there is an emerging paradigm shift in Turkish diplomacy? Turkey is in a very significant geopolitical position on the crossroads between Asia and Europe. Historically, Turkey has always tried to keep good relations with both sides. Yet the region around Turkey is full of security problems, as well as social and economic problems. The abundance in natural resources makes these problems even worse. We have been trying to lead a peaceful policy in a region full of landmines. Our leader Ataturk’s eternal words, “Peace at home, peace in the world,” summarize Turkey’s national policy perfectly. Consequently, Turkey’s focus still faces both the west and the east. On both directions, we are trying to minimize the social and economic problems of the region using peaceful negotiations.

In the wake of the Arab Spring, a “Turkish Model” to guide the Arab countries to democracy has been discussed. How do you think Turkey can

In terms of both national and international affairs, where do you imagine Turkey a decade from today? Turkey is dynamic country that also became a regional power in its area. Now, we are world’s 16th largest and Europe’s 6th largest economy. Recently our economic growth rates are in record levels. While Europe is in the midst of a crisis, we continue our steady economic growth. These data let us talk more optimistically about Turkey’s future. Turkey has changed drastically in the last 10 years, and we expect a similar largescale change in the next 10 years. As 2023 is the 100th anniversary of the Turkish Republic, we want to honor this day by becoming one of the top ten economies of the world by then. Likewise, we aim to increase our export levels to 500 billion dollars, which is three times larger than the current levels. Also, we want to reinforce human rights in the country by our new constitution, and increase the rate of literacy to nearly 100%. When we make all of these things happen, Turkey will become a country known not by its problems, but by the creative solutions we brought to those problems.

Finally, what is the secret behind a successful life in politics? Like in any other career, the keys to success in politics are patience and persistence. If you are conducting politics against the public, you will end up alone. However, if your goal is truly to serve the people, then you will eventually rise in the political world. This interview is edited and condensed. The original interview was conducted in Turkish, and then translated into English by the interviewer.

SPRING 2012 HARVARD POLITICAL REVIEW 43


ENDPAPER

GOP AND MAN AT HARVARD Chris Danello

Oh. I see. Uh huh. It’s a comment that almost never fails to draw response. Hmm. I didn’t know. Well, that explains a lot. No matter how I frame the point, the reaction ranges from shock to incredulity. Really? Seriously? You actually mean it? You see, dear reader, I have a startling confession to make. I am a Republican. How can you be so smart and so dumb? (I was particularly proud of that last one.) Conservatives are, perhaps, the most exotic species at Harvard. As early as 1701, a group of Congregationalist ministers, worried that the university was growing insufficiently lax, quit the school in protest and promptly founded Yale. Richard Nixon enjoyed denouncing the faculty as “the Kremlin on the Charles.” And, indeed, this place’s reputation is often well deserved. One of the more traumatic memories of freshman year was my having to explain to a political philosophy section why I was, apparently, the only student to agree with Edmund Burke. Yet the image of Harvard as a hotbed of wild revolutionaries is often an overstated one. To my immense disappointment, I have only met one avowed Communist over my four years. The vast majority of Democrats on this campus are almost disappointingly moderate in their politics. And Republicans, though a substantial

44 HARVARD POLITICAL REVIEW SPRING 2012

minority, stand far more numerous than they could be. As a graduate of a Washington, D.C. high school, I am shocked that more than one conservative per year is allowed. Still, I write not to bury Ivy League conservatism, but to praise it. For it seems to me that Harvard conservatives enjoy substantial benefits to which their liberal friends have no recourse. The school’s political culture, one-sided as it may be, serves to sharpen those on the right and enfeeble those on the left. The reasons for these are several. Liberals live in a cocoon. Conservatives enjoy no such protection. A Democrat can pass through four years without hearing a dissenting viewpoint. A Republican can scarce do the same for a day. There are certain conservative principles that I feel more confident about, having had to defend them some dozens of times. There are some others that I abandoned, finding them unable to withstand the assault. Conservatives learn to appreciate the nuance of their opponents’ positions. This is, to be sure, not always a helpful thing. One of the responsibilities of an editor of the Harvard Political Review is to read their writers’ articles and muster all possible objections to the thesis. One of the first times I did so, my writer had written an article with which I largely agreed. Unfortunately, my objections from the left proved so sufficiently close

to the real article. The author promptly agreed with me and began revising the article in that direction. Most of all, Republicans learn the value of selectivity. Most of my friends probably dispute my politics. Were I to constantly emphasize that disagreement, however, we would find each other’s company intolerable. It’s often fun, and important, to talk politics. But being in an environment where an opinion means a fifteen-minute debate has taught me judiciousness too. Now, I should emphasize that the vast majority of Harvard liberals I know are thoughtful and sincere in their beliefs. And conservatives are not free of stereotypes either. I have one Republican friend with whom conversations often revolve around our mutual admiration of Brooks Brothers. Still, Republicans often state that competition promotes superior outcomes. It is tremendously gratifying to be able to note that Harvard’s ideological marketplace proves that point. In closing, I offer a challenge to those readers who disagree with the politics of the writer. Take time to test the assumptions under which you suffer. Seek out the viewpoints of those opposed to you. And have no fear of any Republican’s opinions, Harvard-variety or otherwise. We may think different. But we think Right.


The Harvard Political Review. On screens near you. HPROnline.org


Amemor i alt oPr es i dentKennedy , t heI ns t i t ut eofPol i t i cshasasi t smi s s i ont o i ns pi r es t udent si nt oal i f eofpol i t i cs , publ i cs er vi ceandl eader s hi p.

TheI ns t i t ut eofPol i t i csatHar var dUni ver s i t y 79J FKSt r et|Cambr i dge, MA02138|( 617)4951360 F orevenmor ewayst obeapar toft heI OP , checkout :www. i op. har var d. edu


Turn static files into dynamic content formats.

Create a flipbook
Spring 2012 by The Harvard Political Review - Issuu