Skip to main content

generator [ volume one ] floating-point

Page 1

generator [volume one] floating-point gregory zbitnew


Knowledge is universal. Information integrated into this document has been derived from innumerable sources; both real and imaginary, then modified to suit the intentions of the narrative. The names, characters, places and incidents portrayed in this document, as well as data obtained from published scientific research, or references pertaining to works of literature, registered product trademarks, and so on... are not intended to infringe on the proprietary rights of their author or manufacturer. Their inclusion has been based solely on the fact that they are part of the reality which we all share.

generator [volume one]: floating-point gregory zbitnew Š2000 dream logic corporation www.dreamlogiccorporation.com

Original paperback printed August 2000 in an edition of 1000 copies. ISBN 0-9686729-0-6 Published in Canada First digital publication: www.issuu.com ~ November 11, 2011 [11/11/11]

This is volume one of a quartet entitled; ‘generator’... For information about forthcoming volumes, or to order bound printed copies, contact the publisher via email: factory@istar.ca

Retailers: File under MetaFiction


Dedicated to my son: Jaman Jules Orion Lloyd-Zbitnew


“You may not even exist.” - Kropton Ernst. from the unpublished novel ‘Invisible Waves’ (page 350)


INTRODUCTION [November 11, 2022]

To those discovering the existence of this file with great expectations of delving into a work of literature, it is with apologies that I must confess: I am not a novelist. The ultimate intention has been to present the reader with an accurate chronicle of a young man named Jurgen Ernst, and to reveal the true nature of the mission to which he had dedicated his life; a historical record which, until now, has remained cloaked in secrecy. The initiative for compiling this document had originally commenced through involvement as a member of a security investigation team, yet during the course of the past decade, the motivation for gathering research has gradually transformed into a quest for personal understanding. It has been a search which has required traversing the innumerable invisible pathways linking the networked universe in order to painstakingly recover fragmented information which has become buried in time; a task perhaps similar to an archeologist who attempts to reconstruct the excavated skeletal remains of an ancient machine located in some remote region of the globe. And while the skill of both the investigator and the archeologist is in their devotion to extensively analyze and present each cherished component that has been discovered, this level of detail is not necessarily for the consideration of every audience; the scientific concepts and theories defining Jurgen Ernst's work have been provided for those who are fascinated by exploring the intricacies of complexity. For some readers, this will be more information than can be sustained. Perhaps it will be discovered that by simply scanning the text for passages which are of interest, ultimately a clearer picture may emerge. While the necessity of supplementing extensive research with speculation has resulted in a narrative format, please recognize that it is an account which is based on accurate information provided by the most reliable sources; the people named within the document. Jurgen Ernst's credit card transactions, network traffic history, employ� ment records, academic transcripts, digital voice recordings, notebooks, journals, and even forensic data recovered from hard drives have also been thoroughly referenced. Since much of this material has been obtained from what remain highly classified security documents - and for other reasons which will become apparent when the intended further volumes of 'generator' are published - it has been necessary for the author of this work to assume a ‘protected’ identity...


TABLE OF CONTENTS [ Select title to link to the chapter page in the story ]

part one I. II. III. IV. V. VI. VII. VIII. IX. X. XI. XII.

DR. PLANCHETTE THE CASTLE MRS. BOSHOVSKY MASTER BRONCHEV A DIGITAL CONSTELLATION INVISIBLE WAVES [PART 1] LEVELAND INVISIBLE WAVES [ PART 2] THE OUTSIDERS PIRATES THE PLAGIARIST SNAKES + LADDERS WHITE SANDS BLACK CHRISTMAS

part two I. II. III. IV. V. VI. VII. VIII. IX. X.

INVISIBLE WAVES [PART 3] THE ATOMIC TECHNOLOGY MAZE INVISIBLE WAVES [PART 4] THE GARDEN THE HISTORY OF INNOCENCE DUST LOVE FAITH THE HANGED MAN GRAVITY THE MIRROR COVENANT


part three I. HAWAII II. ZINTHROP'S BEES III. MENEHUNE IV. JAPAN V. DR. SATO VI. THE MONSTER VII. A SYNTHETIC WORLD VIII. COCOON IX. THE DISPOSABLE MIND X. KROPTON ERNST XI. T-4 XII. WHITE CHRISTMAS XIII. THE UNIVERSAL MIND XIV. THE PLAN XV. THE HIVE XVI. GENERATOR XVII. SAYONARA

part four I. SOLA II. QUONSET III. THE BODY IV. FROZEN OVER V. WONDERLAND VI. LOKI VII. THE JOURNAL VIII. THE CHEMICAL BRIDE IX. RUSS VAI X. FLOATING-POINT XI. THE MIND XII. THE SOUL XIII. CORDOVA FROST XIV. 11:11 XV. THE TWILIGHT OF THE GODS


part one I. DR. PLANCHETTE

“Bienvenue dans le futur!” These words had greeted Jurgen Ernst the first time he had visited Dr. Planchette’s laboratory. That he had not immediately understood their meaning enhanced the sensation of unreality created by the vision which had appeared as his eyesight had grown accustomed to a scene rendered in subdued light; an absurd collection of sleek technological apparatus chaotically strewn about a large stone room which had once been the castle’s dungeon. Jurgen paused, momentarily frozen, casting an awkward, lanky shadow that sprawled across the threshold of the laboratory's doorway as he tried to remember... It had not been until the beginning of his second year at the Akademy that Jurgen had realized that the mysterious Dr. Planchette actually existed; since he had seemed a fictional character, often described by other students as a ‘mad scientist’ who had a penchant for conducting outlandish and dangerous experiments. Jurgen had been entertained by these tales in which the Doctor was illustrated as a pale creature, cloaked in darkness, who roamed the lowlands under the light of the full moon to exhume bodies of recently dead humans or to victimize live animals in order to conduct his evil experiments. Naturally, Jurgen had assumed these stories were exaggerated to enhance their dramatic quality. In reality, they turned out to be not far from the truth. The invitation to formally meet Dr. Planchette ~ a brief handwritten letter on person‐ alized stationary declaring him to be an instructor of Metaphysics at the Akademy ~ had been contained within a small, wax-sealed envelope which Jurgen had collected at the Administration Office. That night at the appointed hour, uncertain as to why he had been summoned, Jurgen tentatively crept down the stone steps of the spiral staircase that led deep into the foundation of the castle. Expecting the atmosphere to be dank and musty, he had been surprised to notice that cool, fresh air was piped in through a modern ventilation system. Following a network of narrow passageways illuminated by electric lights mounted in fittings which had once held torches, Jurgen finally arrived at an ancient door bearing a metal plate inscribed with the Doctor’s name. He knocked firmly upon the heavy oak and almost immediately was answered by a muffled voice from inside.


Upon opening the door, Jurgen discovered Dr. Planchette kneeling in front of what appeared to be a naked, headless woman, with his face close to the figure’s genital region, his hand gently caressing the back of the woman’s thigh. Jurgen watched for several moments puzzled by the scene that had presented itself to him, cast in shadows within the radius of a single low-intensity spotlight. To divert his attention, Jurgen followed the halogen glow as it faded away into darkness towards the edges of a moderately large laboratory. In the twilight, a collection of numerous other torsos were hanging suspended from the rafters or chained to the stone walls. An assortment of dismembered limbs were carelessly strewn across the rough stone floor. Dr. Planchette suddenly jumped up from behind the figure and peered quizzically at Jurgen through a magnifying lens attached to his headband - which made his eyes frightfully enormous. As he approached he flipped up the magnifier and Jurgen immediately recognized a face he had occasionally noticed in the village and more frequently in the hallways of the Akademy; a man whose youthful appearance had led Jurgen to assume that he was also one of the students, since he appeared to be approximately the same age as Jurgen was. The slim man had shoulder length black hair, a goatee, pasty pale skin, and tiny, black, octagonal wire-rim glasses framing his intensely curious eyes. This night he had been wearing a cool grey sweatshirt, military green cargo pants and a pair of ragged black sneakers. Now standing nearby, Dr. Planchette smiled broadly as he partially turned to gesture dramatically toward the creation behind him, “Bienvenue dans le futur!”, he exclaimed. Jurgen was uncertain of what he meant, and had stared blankly. "Parlez vous Francais?" Jurgen shook his head; "Deutsch." "How about English then," Dr. Planchette offered in a heavy Parisian accent. When Jurgen concurred, he continued, "As I said; welcome to the future! Welcome to the future of home entertainment!” Then he proudly added, “She is a beauty, no?” Jurgen responded by nodding in agreement. The shadows cast by the overhead light accentuated the back of the nude figure's attractive body; well-proportioned, firm and young. “Come in, come in, have a closer look ... go ahead touch, feel.” Jurgen walked over and circled the figure. It was anatomically accurate in every detail, except for a dense collection of thin wires and circuitry which terminated at a flat plate within the collar of the neck. Upon careful examination he noted the presence of fine hairs and pores on the surface, and a network of darker bluish veins revealing themselves through the skin’s semi-transparency. He studied the nipples on her small,


perfect breasts for a moment then cautiously reached out his hand to touch the figure’s shoulder. The skin was soft and smooth. “Very realistic!” Jurgen observed. He turned to find that the Doctor was now sitting on a comfortable chair in the shadows, smoking a joint, still admiring his own creation. Jurgen cautiously made his way over to a nearby chair and sat down. It had taken a moment for his eyes to adjust to the darkness. “Did you notice the pubic hair? It’s real live hair. I’ve finally managed to find a synthetic medium to support its growth. I just installed it today.” The Doctor took another puff, and inhaled deeply. He extended a small plastic bag half filled with the herb towards Jurgen, talking while continuing to hold his breath, “If you want to roll one up, there are papers in the baggy.” Jurgen shook his head. “No thanks.” The Doctor exhaled a giant cloud of blue smoke. “How about a glass of wine then? Come with me.” Dr. Planchette picked up a flashlight from a nearby workbench and motioned Jurgen to follow him out through the door. They traveled through the maze in silence, then turned to enter a dark passageway which led off to their right. The Doctor turned on his flashlight and advanced quickly as though he were quite familiar with this route. Jurgen scrambled to keep up. Because of his height, he had to bend down frequently to avoid smacking his head on the low stone archways. He caught up to the Doctor, who had pulled out an old key from a chain around his neck and was opening the lock of a large metal door. “This cellar was installed in the year 1643 and has the capacity to store one thousand hectoliters of wine”, the Doctor explained as they entered the surprisingly large room. “Some of us Faculty types are continuing the tradition... and this is where we store it.” The Doctor patted a large wooden barrel. “I prefer grapes from the Moravske Slovacko Region... but tonight... since this is a special occasion let’s try some of the wine which came with the castle. I don’t know by whom, or when this was bottled, but it is very good.” After quite some time the Doctor finally selected a couple of dusty, dark glass bottles from a rack along the wall. There were plenty of others in storage. “Here’s one for tonight, and a couple to take with you when you return home.” They returned to the lab and sat in the same places they had occupied before. Dr. Planchette placed two glasses on a packing crate which served as a table, then immediately produced a Swiss Army knife from his pocket and spiralled its corkscrew into the top of the bottle. “Dr. Planchette...” Jurgen tentatively begun, but the Doctor immediately interrupted him, “My friends call me Marcel," he said, as he casually popped the cork. “OK, Marcel," Jurgen tentatively spoke his name, "this... uh... body that you have


created is very impressive, and I thank you for inviting me here to see it, but is that the only reason you have sent for me?” “No!” Marcel shook his head as he poured out two glasses of wine as thick and red as blood and handed one to Jurgen. He took a sip, letting the wine linger in his mouth for a moment before swallowing, then continued, “First of all, this is not just a ‘body’; it is a work of art!” Passionate, slightly insulted. “Secondly, as beautiful as she is, she is not very intelligent. I need your assistance in that regard. I understand from your instructors that you are a very talented young man in the field of artificial intelligence and I would like to propose that we work together.” He raised his glass. “You create the code, and I will manufacture the hardware, and together we will make history.” Marcel laughed quietly. Jurgen, still puzzled by the situation he found himself in, made no reply. “Come, let me give you the tour!” He got out of his chair. Jurgen, carrying his glass of wine, followed him as they strolled across the room. Marcel flipped a light switch to reveal that the laboratory was filled with sophisticated technology and tools for molding and fabricating a variety of materials. The appearance of the sleek appliances contrasted the crumbling stone walls still anchoring rusted iron shackles that were once used to confine prisoners. A large grating on the floor in the corner covered a pit that had been used for the sewer. Now a toilet and shower connected to a modern plumbing system were located nearby. Everywhere were chaotic piles of debris; acetylene tanks, blow torches, wooden crates, drawings and magazine images taped to the wall, bottles and cans with skull and crossbones warning labels that contained various chemicals, rolls of plastic, pieces of assorted metal, and so on. Several of the earlier prototypes for the models hung chained to the wall, dismembered and scav‐ enged for serviceable parts. It was somewhat creepy, but Marcel’s easy-going manner had begun to make Jurgen feel comfortable. The progression of the model’s refinement had been remarkable; from the early discarded monstrosities to the newest ones which were authentically realistic. Yet, Jurgen could not help but wondering what purpose these creations were intended to serve. As if reading Jurgen's thoughts, Marcel had attempted to explain, “What you see here is a product at the prototype stage. How it is developed is open to many possibili‐ ties. Several of my colleagues have used their influence with the Akademy’s corporate sponsors in order to furnish me with the funding that is required to carry out my work; a private venture which is separate from the mandate of the Akademy. This is privately funded research, and as such, I am required to use my abilities toward fulfilling the desires of my benefactors.” Marcel took a large drink of wine before continuing. “You would be surprised how much demand their is for a product like this! There are a lot of lonely people out there who would love to have a helpmate; someone to confide in, someone who possesses a wealth of knowledge and is able to offer them advice, or someone who is much less unpredictable than an organic human companion... Yet my benefactors have requested that the robot unit be designed primarily for the purpose of providing customers with sexual pleasure.” With a solid thwack, he slapped a nearby model on its buttocks. “These things are built to last... with replacement parts and


regular updates to their operating systems, they could live forever... and remain perpetually young.” To Jurgen the concept did not seem all that wholesome. “Say hello to ‘HUNOW’,” said Marcel, introducing Jurgen to the life-size, plastic fibre skeleton laying on a metal table in front of them. “This chassis,” Marcel stated proudly, “has articulated joints that are fully motorized... the wiring is entirely concealed inside the bone.” He pressed several buttons on a small remote control and the skeleton came to life, rattling around on the tabletop as if it had received an electric shock. “C’mon, get something on, you look like death”, Jurgen quipped. The creature's inventor did not acknowledge the remark, continuing on with the tour: “The customer will be able to order models according to their own unique specifica‐ tions: simulating the physical appearance of any man, woman or child. Any size, shape, age, or race. One of my benefactors has already provided payment in advance for a fully functional model in his own likeness!” He raised one eyebrow as he said this, then directed Jurgen’s attention to a number of wooden boxes along the wall that were filled with body parts. “This product can be customized and updated with unlimited interchangeable components; a different head ... larger breasts ... a bigger penis ... two left feet ... whatever the client desires.” Marcel finished his wine then settled at a computer terminal near the row of replacement heads lining a shelf. While he booted up the computer, Jurgen took a closer look at the head of the young woman in front of him; quite beautiful, although a slight seam was visible along its crown as the hair had yet to be applied. The skin texture covering her delicate features was remarkably accurate down to the smallest details; slight wrinkles, moles and blemishes. It was imperfect in an entirely perfect way. An incredible rainbow of thin wires emerged from the base of her neck, bundled together with plastic fasteners at intervals as it ran down behind the shelf to connect with the computer. Marcel pressed a sequence of keys, and the head opened its eyes as if awakening from a deep sleep. Jurgen now realized that the molded silicon head essentially functioned as the computer's monitor. Hunching over the keyboard like a classical composer, Marcel began rapidly typing commands which caused the head to speak, gaze about the room and then finally begin laughing as if noticing Jurgen’s discomfort. Feeling faint, Jurgen clutched at the edge of the shelf to steady himself nearly toppling the row of heads to the floor. The head that had been laughing now wore an expres‐ sion of fear as it wobbled. Jurgen instinctively grasped it with both hands to steady it. She looked up at him gratefully, making eye contact, and smiling. The artificial eyes were not like the eyes of a fish laying on a bed of crushed ice in a market window; the lustrous irises were a very realistic pale green, even the fine detail of her eyelashes, the moistened tear ducts and the thin red veins embedded in the whites of her eyes made them appear alive. It was her pupils though - blackness as dark and deep as a


well, that had held him transfixed, because in that moment, deep at the bottom of that well, Jurgen had glimpsed an almost imperceptible flash of illumination, possibly a trick of the light reflecting off the surface of her eye. Yet, if the eyes are a mirror of the soul, then Jurgen wondered if perhaps he had caught a glimmer expressing the spirit of an inner life. Holding the head in his hands, Jurgen remained transfixed for some time, until suddenly its eyelids blinked, breaking the spell. “So what do you think of the alpha version?” asked Dr. Planchette. The image seemed to have embedded itself in his mind; her face hovered before him like a ghostly apparition in the night, the pavement quickly racing under the wheels of his blue and white Cezeta scooter as Jurgen piloted the rusty rocket ship down the winding hill and through the narrow cobbled lanes of the village, the single headlight in its aerodynamic nose helped to light his way. It was late. Jurgen was anxious to make it home by curfew since he was well aware of the custom that citizens would be arrested if they were discovered out of doors between the hours of one and six A.M. Soon the village would fall silent and all the streetlights would turn black. Jurgen stealthily crept up a flight of wooden stairs, remaining quiet so that he would not awaken any of the others, just as the lights had just gone out. He entered his unlocked room, lit an oil lamp with a match then perched on a wooden box by the window. Behind the dusty glass the shape of the distant castle atop a large hill created an irregular silhouette against a field of bright stars. Beneath the sky was pitch darkness. Jurgen was a night bird. He hunched over the slim black journal cradled in his lap and scrawled notes in pencil across ruled pages that were illuminated by the soft glow of the nearby lamp: “It suddenly all became clear, in Dr. Planchette’s strange laboratory this evening, as I gazed into the eyes of a disembodied head on the metal shelf before me and experienced a profound revelation in which I could plainly see the path which destiny had determined for me. It seemed that the knowledge and experience I had acquired during my young life had been preparing me to recognize the actual potential of creating life inside a machine - if, and only if, it were possible to give it a soul. At that moment I truly believed it was!” Jurgen closed the journal and placed it inside the opening of the wooden box on which he customarily sat. He leaned back against the wall and drank deeply from one of the bottles of wine that Marcel had presented him. He wiped his mouth with his sleeve and once again contemplated the view of the castle framed symmetrically by the window...


II. THE CASTLE

The bucolic splendor of Bohemia had captivated Sam Harriton who was vacation‐ ing with a female business associate in the Czech Republic during the summer of 2001. One afternoon they happened upon an impressive 14th century Gothic castle crowning a small, heavily forested mountain, and decided to take the tour. The castle’s prominence afforded a commanding view of the surrounding valley; the densely wooded hills, the pastoral fertile fields, and the tiny village huddled at the mountain’s base; consisting of clusters of wooden houses scattered along the bank of the narrow river flowing slowly towards Prague. Sam immediately jumped on his cellular phone to spearhead an initiative to acquire this piece of real estate. Upon returning to the Pisces Corporation Benelux Headquarters in Luxembourg, Sam had no difficulty structuring the deal. He flew in senior executives from a few other medium-sized European corporations and persuaded them that the site would be well suited for what he proposed to be an International Akademy of Technology. The corporations would form an alliance, each contributing investment funds to create a facility which would provide them with an ongoing resource of future employees. With the operating capital in place, Sam was able to present the current owners with a very generous offer. Since the damp, drafty, stone structure was badly in need of repair, the owners readily agreed to sell. Structural restoration commenced immediately to stabilize the stonework of the disintegrating sand-colored walls which had been breached by the thick surrounding forest, reinforce the ancient wooden beams and fallen vaults, repair the rust-red roofs of the numerous buildings and structurally support the tall crumbling round tower rising above the fortification. The extensive network of passageways and subterranean chambers that were hewn into the solid foundation of volcanic basalt rock were excavated, and the ancient well was cleared of sediment by a team of divers who subsequently exposed hundreds of valuable artifacts; coins, unbroken gilded plates of Dresden china, swords, and even ruby goblets of Czech glass that had accumulated throughout the ages. During 2002-03, an enormous workforce set about renovating the massive main structure, the collection of outbuildings surrounding the central courtyard, as well as constructing additional stories above the circular bastions at three corners of the curtain walls; converting them into residences for approximately fifty instructors and two hundred and fifty ‘elite’ students from throughout Europe who were expected to attend the institution. The fourth and largest bastion, situated at the northern end of the castle - once the Hall of the Ancestors and still decorated with frescoes depicting


members of the family, became the administration offices. Interior designers had been hired to explore elegant light colours that created a more open space that moved away from the dreary Gothic look. The servant’s chambers, kitchen and stables were once again to be used by the maintenance staff. The castle was a haphazard museum of 800 years of architecture; Romanesque, Gothic, Renaissance, Baroque. The many large rooms of the main structure; the lord’s palace with its vaulted halls, the chapel and archadesbridge of luxurious representa‐ tive salons along the ground floor, were transformed into state-of-the-art classroom and laboratories. The ornate suites retained their original marble fireplaces embla‐ zoned with the lord’s coat-of-arms and Dutch tapestries decorating their walls. The 17th century theater had been preserved along with an ornate library containing several precious prints, books, and manuscripts which had not been pilfered by the Swedes during the 30-year war. The armory, the prison and torture chambers became laboratories for the Masters. The surrounding parkland, once the refuge of white stags and peacocks, was cleared of its tangled underbrush. The gardens were landscaped with ponds, statuary and stone fountains and replanted with blue roses and orange trees. The corporations had not only bought the castle, but had also purchased the entire village and surrounding farmland. It was a trend becoming commonplace throughout the world by the time Jurgen had attended the Akademy; corporate ownership gradually extending from the acquisition of villages and towns to larger territories and regions during the coming years. It didn’t matter to villagers who seemed satisfied to gain employment as cooks, maids, electricians, plumbers, security guards and so on... or tend the fields; producing crops and livestock which sustained the students and staff. As descendants of the Slavs and the early Saxon and Celtic tribes, they had seen it all. To them the new boss was the same as the old boss. The castle remained while the faces changed; via conquest and intrigue, sale and treachery, with the stroke of a pen or the edge of a sword. The castle seemed eternal. It had originated as a noble obsession some six centuries before; during the Golden Age of Charles IV. The Holy Roman Emperor had been instrumental in developing the Bohemian Kingdom into the most powerful empire in Central Europe before subsequently deciding to reduce his communication with the outside world to a tiny hole in the wall of St. Catherine’s Chapel. The stately castle’s strategic location formed part of an extensive network of fortifications providing the feudal aristocracy with a military and administrative base to control trade routes and protect the lord's land holdings against the permanent threat of armed attacks by more powerful neighbors. The castle had survived the uprising of the "Morning Star"; the revolution after Hus had been burned at the stake. Utraquists took a turn, only to have their property confiscated under the Reformist ascension of the Hapsburg throne. The ejection of two hapless Hapsburgs from the upper floor window of a Prague castle sparked the Thirty years' War during which the interior was burned out leaving it a desolate robbers


hideaway for plundered cathedral treasure. The castle was reconstructed by nobles, then centuries later, pawned and subsequently resold. Between peasant uprisings its magnificent ballroom played host to emperors and kings from throughout the world and visiting luminaries such as Goethe, Beethoven and Wagner. Yet opera music was soon replaced by the sound of muskets and sabers as Napoleon invaded the land. Eventually the chateaux served as a military hospital during the Prussian-Austrian war before becoming a home of the poor. The Nazi SS commandeered it during World War II as a Czechoslovakian headquarters within which the Gestapo found ample space to utilize the castle once again to hoard confiscated objects and art. After the war it returned to the state, yet remained under Stalin’s communist central control. Toward the end of the century it witnessed the crushing of Dubcek, the ‘Velvet’ glove, the rebuilding of democracy and capitalization, the split of Czechoslovakia in 1993, only to finally end up being operated as another roadside attraction... Jurgen had fallen asleep on the train. The rails seemed to have carried the single car back in time as it wound its way through the pages of history along the steep slope of the narrow wooded valley. He had bolted awake when the large steel wheels had squealed to a stop. Glancing out the window, he had been unexpectedly greeted by an image that hadn’t faded in hundreds of years; a sleepy village, and a castle on the hill. No-one had been there to meet him. He stepped off the train onto the small wooden platform. The only other person in sight was the agent who was preoccupied by dragging a heavy grey canvas sack of mail into the small shack which served as the station. So Jurgen picked up his suitcase, walked over the stone bridge, and crossed the river to enter the village on a late summer evening in 2003. It was a surprisingly long walk through the village following the meandering cobblestone lanes. As he headed toward the base of the mountain; where he had noticed a road leading up to the castle, he couldn’t help but think about the story that Kafka wrote ... now, how did that story end? Faces occasionally appeared, wearing expressions that were curious but impassive behind the steamy glass windows of the tidy, well kept wooden houses along the way. Children playing along the road called out in greeting as he strolled past. Jurgen cheerfully waved back and responded using several of the Czech phrases he knew. It made him happy to be reminded of his own childhood days, not so long ago, when he had also been young and carefree. It had only been this morning that he had awoken to discover that he had been transformed into a very tall, slim, awkward young man of nineteen years of age, who was entirely uncertain about his future. The light had not burned intensely on that distant horizon - living in the same small house in Eigenvalue, Germany that he had shared throughout his entire life with his mother. He had learned to become self-reliant from an early age, since his parents had separated when he was five. Although his father had participated in his upbring‐ ing by continuing to faithfully forward money every month for support, Jurgen had never had the feeling of belonging to a family. Often he had felt isolated and alone; rarely spending time with his mother who was very active socially and preoccupied with her newspaper career, while his father, through the distance imposed by his


mother, had remained a shadowy figure like a fictional character from a novel who did not really seem to exist. Instead Jurgen had concentrated on his schoolwork. In the spring he had complet‐ ed A-Levels at the Berufsakademie, then during the summer, he had accepted a job as a System Analyst with the K’ung Te ‘Oversea’ Foodstuff Company; a large plant manufacturing freeze-dried food products in the industrial park at the edge of town. Since the company was part of a vast distribution network spanning the globe, Jurgen had an opportunity to witness the theories of systems science as they were manifested within the vast experiment called the 'real world'. Those theories had speculated that the properties of collective behavior would always naturally emerge; creating a type of organization regardless of how diverse or complex the system had appeared - and what was perceived as 'chaos' was just a period in which the code was not yet apparent. Jurgen had spent his days deciphering the pattern of shipping routes to determine if he could discover their hidden sense of order. And while, at the time, the work had seemed interesting, he had begun to wonder if the only possibilities for his future were either to study Informatics at the nearby University of Constance or to continue with his day job at the factory while spending each evening and weekend for the rest of his life locked away in his bedroom sitting in front of the monitor of his computer. One night while checking his email, Jurgen had been surprised to receive a message from a former instructor named Mr. Krust - yes, that was actually his name. "Krusty", who was almost eighty years old at the time, had always considered his former student to be one of his ‘brightest stars’. He had contacted Jurgen to advise him that the International Akademy of Technology in the Czech Republic was still accept‐ ing applications for its initial program scheduled for the fall of that year. “There are still a few openings left on the waiting list...” the message had read, “...there continues to be a possibility of gaining admission as some students are likely to cancel at the last minute.” The message had concluded by stating; “This could be an excellent opportu‐ nity for you to meet other intelligent young students and gain knowledge from notable instructors, some of whom may be of assistance to you in realizing your full potential. You are welcome to use my name as a reference.” Intrigued by the information he had received, Jurgen immediately connected to the I.A.T. web site and completed an application form on-line. He received a response one hour later; at three o’clock in the morning. He was beginning to like this place! The admission process turned out to be quite rigorous. He had been requested to forward a copy of his birth certificate, a full set of transcripts for each of his grades since primary school, detailed medical and dental records, a waiver of criminal activity (notarized by the local authorities), his curriculum vitae, the names of three personal references, as well as a copy of his passport, credit rating and insurance information. Later he completed the required entrance examinations, and participated in a series of on-line personal interviews before being accepted as a candidate. He finally received an official letter of admission in late August of 2003, stating that he had been accepted


to study Artificial Intelligence at the Akademy. One week later he had boarded a train to the Czech Republic. As the sun set over the low western mountains, it began to dawn on him that he would be not see his mother’s face for almost another year. And now as he trudged along the gravel shoulder of the winding road climbing the hillside to the castle, he sensed that the footsteps of this journey were beginning a path which would lead to many new experiences. He suddenly felt both vulnerable and elated at what this adventure held in store. Yet, the excitement passed momentarily, as the gravity of the heavy suitcase began to pull him back into the moment. How much further could it be? Several vehicles had already raced down the mountain past him but none had driven up offering him a chance to catch a ride. Soon Jurgen had arrived at the small guardhouse outside the main gate. The security guard slid open the window and with a few casual gestures indicated the location of the Administration office. Jurgen walked through the stone archway and was immediately forced to pause for several moments in the parking lot, awestruck by the massive exterior of the main building. The walls consisted of enormous stone blocks stacked upon one another, which lit by mercury vapour lamps arranged on the ground surrounding the castle, inverted the normal shadows of daylight. The light faded away as his gaze panned up the tall, white, circular tower to the a cluster of satellite dishes crowning its conical roof. Here and there, soft light emanated through the arched window openings above. Silence. There was no-one around. Jurgen ventured from the pathway, and ignoring a warning sign which read; ‘Neslapte po trave’, took a shortcut across the manicured lawn. Allegorical statues had been installed near a small pond; to the west, stood the twelve Vices represented by the Angel of Grievous Death, and to the east, the twelve Virtues; the Angel of Blessed Death. He passed between them, crossing the pond on stepping stones, and made his way, as instructed, toward a building towering above the north wall. He quietly pushed open the heavy door and entered the apparently vacant Hall of Ancestors; which served as the Administration Office. The only human forms in sight were suits of armor standing near the entrance. Jurgen set his heavy suitcase down and creeping across the marble floor, approached the long wooden counter. It had been his understanding that the students were required to provide for their own living expenses; many of the students who came from wealthy families were able to afford the apparently quite luxurious accommodation of the residential dormitory within the castle walls which featured indoor tennis courts, a swimming pool, small shops, restaurants and a movie theater. Jurgen, because of his meager savings, had opted for one of the less expensive accommodations that were available in the village. Instructed by an email message received before he left Germany, he had been requested to report to the Administration office upon arrival to receive the address of the accommodation he had been assigned.


Waiting interminably for someone to appear, Jurgen happened to notice a package addressed to him on the counter nearby. He examined it and immediately recognized that the return address was his father’s, who was currently living in a town called Little Falls, located in Minnesota, U.S.A. Resting on top of the small parcel was also an envelope bearing the official seal of the Akademy. He opened the envelope and read the brief message inside; a printed form letter that welcomed him to I.A.T.. Scrawled at the bottom of the page was a small, hand-drawn map providing directions to the lodgings of Mrs. Boshovsky. Penciled along the margin were the only instructions: ‘Just turn left at the slaughterhouse and continue for one half kilometer to the very end.’ He placed the note in his pocket then tore open the paper covering the package. Enclosed was a worn, bound manuscript of an unpublished Kropton Ernst novel entitled ‘Invisible Waves’ and a postcard whose photograph depicted a cottage on the bank of the Mississippi River where the aviator, Charles Lindbergh had spent his childhood. Across the bottom of the image on the card was the caption: ‘Little Falls Minnesota, ‘A Place To Call Home”. On the reverse, simply written: “I hope you find this story of interest. All the best in the future. Love, dad.” Jurgen tucked the package under one arm, hoisted the suitcase with the other, and set out once again, back down to the village. It was very dark as he shuffled along the gravel shoulder of the road. He was hoping for a ride, but now the only traffic were vehicles returning up the hill to the castle.

III. MRS. BOSHOVSKY (and the temptation of Marina.)

Following the instructions on the handwritten note, Jurgen found himself standing in front of a small, two storey house at the edge of the village, out by a large swampy bog. The main floor was dark, except for one window illuminated by the flickering blue glow of television. He climbed the front steps, passing a wreath of wolfbane and garlic nailed to the frame, then entered a small lobby to knock quietly upon the door before him. Eventually it was opened by a pretty young girl; barefoot, wearing blue jeans and a bright orange t-shirt with the logo “PTSD” across the front. (Post Traumatic Stress Disorder was a popular band at the time). Jurgen asked if he had come to the right place to rent a room. The girl replied by slamming the door.


Once again Jurgen stood for some time ... waiting ... wondering ... listening to voices on the other side of the door. He could hear the girl call out loudly to her mother, as if trying to awaken her. Soon the mother’s voice responded; harsh, very rapid Czech. By the tone of voice Jurgen could tell she was scolding her daughter but all that he could clearly make out was the word “emteevee”. When the door reopened, a short, plump woman appeared. She was wearing a pink cloth nightgown, although fastened by a band about her waist, opened provocatively to reveal her cleavage and her thighs. She had a youthful, pretty, pleasant face and long, curly, auburn hair that had been tousled by sleep. Her feet were encased in fuzzy pink slippers. Speaking in rudimentary German, she introduced herself as Mrs. Boshovsky, then quickly apologized for her daughter Marina’s behavior and for her own appearance not having expected a visitor at this hour of the evening. Mrs. Boshovsky bustled past him and began to climb the stairs. Jurgen picked up his suitcases and followed her. As she led the way, her plump, round bottom swayed seductively under the tight fabric of her nightgown just in front of him. Jurgen averted his eyes to watch his step as he climbed. On the second floor was a small, triangular landing with three doors facing one another. The rooms were numbered one, two and three. His would be the one on the left at the top of the stairs; room number one. "The other rooms are already accommodating students," Mrs. Boshovsky whispered, as she pulled a key, it seemed, from her bosom. Jurgen followed her inside. The apartment itself was a decent size for someone living alone. It had three rooms; a kitchen, a bedroom, and a living area with one large picture window framing a postcard view of the castle. The apartment was fairly well maintained considering that it was over a century old; it was to be expected that the broad strips of wood flooring would be heavily abraded and charred to blackness around the ancient cast iron fireplace, that the cracked plaster would have been patched over many times with wallpaper of various textures and that the kitchen plumbing would perpetually leak, eroding the porcelain kitchen sink with dull red, oxide stains. The apartment was furnished with a Hungarian-made Gorenja range and electric refrigerator, a rickety antique kitchen table with three matching dark- stained wooden chairs, a crudely constructed wooden box, an oil lamp, and a large brass bed with squeaky springs, covered over by a hard, lumpy mattress and thick down quilt. The bathroom, shared by everyone in the building, was located on the main floor. It had a sink, a toilet and a big white bathtub standing on feet resembling a lion’s paws. Mrs. Boshovsky explained that the only rule of the house was that there were to be no loud parties after curfew. She also mentioned that for an extra payment Jurgen could request to have meals delivered to his room, requiring him to slide a note under her door, in the morning for supper that day, or on the previous night for breakfast the following morning. He nodded his head that he understood, then set his suitcase down just inside the door.


Jurgen smiled and thanked her for the accommodation; explaining that he found it to be to his satisfaction. At that point he assumed she would return downstairs but she had continued to linger; drifting around the apartment, checking to make sure that everything was fine. She stuck her little finger under the tap of the kitchen sink to test the temperature of the hot water, demonstrated how to work the damper on the wood burning stove, then turned her attention to the bedroom; pulling back the cover on the bed to inspect the sheets. Jurgen knew some Czech words, and she knew some German phrases, which enabled an understanding. Eventually she left the apartment, but before Jurgen could begin to unpack his suitcase, she had returned with a bottle of wine and two glasses. Jurgen noticed that during her brief absence she had brushed her hair and even applied some makeup. They sat at the table and talked for several hours; until the bottle of wine had emptied. While they talked Jurgen noticed that the front of her nightgown had gradual‐ ly opened wider. In the glow of the oil lamp, and through the haze of the powerful wine, she had seemed to become increasingly attractive. She smiled frequently, often bursting out in pleasant laughter, at which time Jurgen noted that her teeth were quite white. At one point though, the mood had become somber, and she started to cry when discussing the fate of her husband. Through the tears, and with the difficulty in translation, Jurgen would always remain uncertain whether her husband had drowned, or had drank himself to death. Nevertheless, the result, she explained, was that she was now a thirty-five year old widow, who was left to raise a mischievous sixteen year old daughter on her own. Jurgen had felt an almost overwhelming desire to walk over to her, to hold her and comfort her. Fortunately she had arisen from her chair before he could. She approached and leaned toward him; he could clearly see that her large breasts were firm and attractive, he could feel her long soft hair brush against his arm as she gently kissed him on the cheek. She said ‘good night’ then exited the room. Jurgen had difficulty sleeping that night. He tossed and turned in the unfamiliar bed; insomnia had never been a stranger. He stared at the darkness, thinking about Mrs. Boshovsky and her daughter Marina, although unaware that this night was to be the beginning of many encounters - temptations which would require all of his will to endure. When he opened his eyes the next morning he found himself in unfamiliar sur‐ roundings; his own apartment. It appeared very different in the light of day. It was early; he didn’t know the time since his clock had not yet arrived. He put on his pants and went about to meet his neighbours. Surely someone must have a car - he needed a ride to the station to collect his belongings that would be delivered later that day. The apartment next door, he discovered, was inhabited by a wiry young man named Brak Danych; a computer programmer from Poland. Perhaps Jurgen had awakened him too early - first impressions are the lasting ones - they had gotten off to a bad start from which they would never really recover. Brak had eyed him suspiciously and was unwilling to engage in conversation. Jurgen let him go back to sleep and went to see what was behind door number three.


Vagusstoff ‘Gus’ Grass had also been awakened by Jurgen, but despite a massive hangover, he was in a much better mood than Brak had been. Gus was a jovial, rotund fellow with a ruddy complexion. He turned out to be a German countryman who was studying Robotics at the Akademy. Inviting Jurgen in, Gus lit up a cigarette and moving very slowly placed a pot of coffee on the stove, then sat at the edge of the bed massag‐ ing his face as if his head were in great pain. Gus explained that during the previous evening he had attempted to discover how much Plzensky Prazdroj he could drink at a nearby pub; a place named something like ‘Legrace Panic’ - which Gus believed could be translated as the ‘Screaming Virgin’. In the same breath, and with a knowing wink that Jurgen found disconcerting, he had asked Jurgen what he thought of Mrs. Boshovsky. The tone implied that Gus was intimately familiar with the landlady. Jurgen had tried to form a mental image of them together, but it seemed impossible for a bed to support their combined weight, after all, Jurgen had been an excellent student of physics - the thought had vanished as quickly as it had formed. The two talked; getting to know each other while they finished their coffee. Gus had a car, which he offered in Jurgen's assistance - suggesting that they first go for breakfast at a restaurant in the village which prepared the best bacon sandwiches on the planet; thick slices of pork, a fried egg and fresh tomatoes stacked between slices of heavy dark rye bread, served with plenty of hot mustard and some sauerkraut on the side. They would then have a couple of pints at the Screaming Virgin; until it was time to go to the station. By early evening, when the single car train pulled into the station, Jurgen had difficulty walking in a straight line. He staggered across the wooden platform, pleased to discover that his mother had ensured his belongings were shipped and that everything had safely arrived. And later, with the help of Gus and Mrs. Boshovsky, Jurgen had piled the boxes into his apartment. He then went to bed and slept through the night; dreaming of nothing. In the morning, feeling rested, he immediately went in search of the breaker box. He ran several metal shielded cables snaking along the base of the walls to energize his collection of computers and an array of peripherals; monitors, modems, removable storage devices, and a small server. It was an odd assortment of hardware devices, all had been customized, wired together and crammed with boards that he had assem‐ bled himself. He carefully arranged the components atop the sturdy wooden table; creating an island of technology in the center of what was to become a perpetual sea of chaos. In the future, objects would gradually accumulate to fill the space available to store them; clothing would be heaped upon the suitcase in the corner, dishes would always be in need of washing on the kitchen counter, miscellaneous pieces of wood scattered on the floor around the stove and cardboard boxes filled with various computer components that formed precariously leaning towers stacked against the wall. The only furniture added, to what had originally been there when he moved in, would be a large bookshelf constructed from boards discarded by the sawmill; a token attempt at organization, since as soon as the shelves were filled, other books and several piles of paper would spill out onto the floor to form a sloping avalanche beside


it. This accumulation would evolve so gradually that the familiarity of his surroundings would seem to remain constant; as if no time had passed at all. In contrast, his days at the Akademy had elapsed in a blur... Most of the other students had arrived at the castle about one week prior to Jurgen, who had only been notified by the registrar at the last minute. His first introductions took place during the orientation seminars held with everyone assembled outside on the grounds. The interests and areas of specialization of the talented young students he met were as diverse as their cultural backgrounds and the location of their Euro‐ pean origins: from Glasgow to Moscow, from Oslo to Rome. It had quickly been made apparent to all; by the panel of administrators and corporate executives conducting the orientation, that the Akademy would be operated in a businesslike manner. Dressed in a flowing white robe, Sam Harriton, the president of the ACB; the somewhat dyslexic initials of the educational institution’s advisory board - an acronym for the unimaginative name of the Alliance of Corporate Benefac‐ tors, stepped up to the podium to address the assembly. It was a long speech, but several comments had caught the students attention; particularly when Mr. Harriton notified the students that they would be required to sign a contract agreeing that the products developed through their knowledge and abilities, while they attended the Akademy, would become the property of the ACB. In exchange, Sam Harriton an‐ nounced, the advisory board had decreed that each student would be paid a modest honorarium; the credits deposited directly into accounts that had been established the Ceska Narodni Banka. As well, he continued, in order to maintain their standing, the students were expected to manage their time effectively and make significant progress with their research projects; performance evaluation sessions of the students work would determine if the their semi-annual contract would be renewed. Finally, each student would be granted a period of four weeks vacation every year. A murmur from the student assembly had greeted each new item, since the information had come as a surprise to everyone. Jurgen, and likely many of the other students, were considering the impact of signing away the rights to the products of their imagination as the orientation program segued smoothly to the next item on the agenda; the introduction of the faculty. The core staff consisted of twelve ‘Masters’, each were introduced in turn. Jurgen recognized several of their names and faces based on their notable reputation. Students would be able to attain knowledge from the Masters by scheduling an appointment for individual consultation. On these occasions it was expected that the student would wear the formal Akademy uniform; a deep blue smock with a gold crest embroidered on the breast. Other members of the faculty, designated as instructors, would run the labs. These lesser beings consisted primarily of senior researchers and managers of project development teams who would take up residence at the Akademy for brief terms during their sabbatical from various corporations. The majority of instruction would come from on-line access to universities around the world; students would connect with the lectures they wanted from the network, any time of the day or night.


Following the orientation Jurgen proceeded to the administration office where he waited in line to sign his contract and be issued a formal uniform, after which he walked back home. Wandering into the forest, he discovered a steep trail linking the village and the castle; which he would subsequently hike along as he climbed the mountain early every morning and descended late every night. Just below the castle, a short distance off the trail, was a narrow ledge along the top of a cliff that overlooked the village and the valley below. A large tree that had fallen years before made the perfect bench to rest upon and contemplate the view. Jurgen enjoyed the walk through the forest; it was peaceful, and it was a much safer journey than the treacherous three kilometers of narrow, winding road, which had often became a ‘journey of terror’ in Gus's battered Toyura truck. Jurgen had learned to decline an offer of a ride up to the Akademy in the morning, since Gus often became distracted; focusing his full attention on the passenger sitting next to him while oblivious to approaching vehicles swerving erratically onto the shoulder of the road to avoid a head-on collision. Caught up in his own enthusiasm, Gus would attempt to explain something about servos or synchros or resolvers; gesturing wildly with an ever-present bacon sandwich in hand ~ grease dripping from his wrist ~ his mouth full, muffled. Jurgen couldn’t understand a word that was said. It didn't matter, Jurgen would never listen anyway; he would stare through the wind‐ shield with eyes the size of saucers, white knuckles securely gripping the dashboard. Considerate of his friend's need for transportation independence and always anxious to maintain their friendship, one day Gus had presented Jurgen with the Cezeta 502 scooter that he had discovered while scouting for suitable robot compo‐ nents at a metal recycling depot near Prague. Jurgen burst out laughing when he saw it. The Czechoslovakian-made bike, manufactured in 1963, resembled a hybrid between a regular scooter and an amusement park ride. It needed plenty of repair work, so, every evening for several weeks the two friends got together in the robotics lab to work on the bike. Once the castle’s chapel, situated in a small building adjoining the palace, the room had been thoroughly retrofitted as a metal shop, retaining only the leaded glass windows from its past. Gus was a wizard with the fabrication equip‐ ment and Jurgen was the sorcerer’s apprentice. Constantly perspiring and wiping his face with a dirty rag smudged with grease, Gus taught Jurgen how to build replace‐ ment parts. Gus would place the damaged parts in a volume scanner which built a three dimensional map of the object’s surfaces. These digitized objects were then edited and customized with modeling software, creating output files that instructed the automated cutting tools and fabricators to bevel, taper and extrude metal or plastic into the desired shape, or to create casting masters. Gus, the eternal perfectionist, had tried to convince Jurgen of the need to optimize the performance of every component, but Jurgen insisted that the scooter retain the look and feel of the original design. Despite the minor disagreement over aesthetics, both had enjoyed working on the project together. And when they had put the machine back together again, it looked like a beauty, and it ran like a dream.


Now able to arrive and depart with quickness and ease, Jurgen could intensely immerse himself in exploring the facilities at his convenience. His insatiable quest for knowledge thrived in the Renaissance environment that had been cultivated at the Akademy. The students had been encouraged to familiarize themselves with the theories, tools and procedures of as many disciplines as possible in order to enhance the specialized research project they had selected for themselves; of course, one that had met the approval of the Masters. Each of the laboratories were equipped with computers running sophisticated simulation software, much of it being written and developed by the students and faculty of the Akademy itself. Programs had been developed to decode and reconstruct the genetic structure of DNA in order to observe its resulting evolutionary mutations. Other students created software enabling them to explore the universe of data collected by orbiting telescopes, design architectural structures, efficiently refine ecological processes, or manufacture new food products and experimental entertainment delivery platforms. For most students it was an atmosphere charged with energy and excitement, although a few quickly began to realize that they were unprepared for the demanding, intensive experience of the Akademy’s imposed philosophy of self sufficiency and ‘dedication to purpose’. Others discovered that the isolated location of the village minimized direct contact with the outside world, effectively sequestering them almost monastically during their period of study. These students gradually drifted away. The attrition continued moderately during the years, with new students arriving to replace those who had left. The survivors remained for a variety of reasons. Many, like Jurgen himself, had discovered that the freedom to progress at their own pace, access to state-of-the-art facilities and knowledgeable Masters, enabled them to flourish in the process of understanding themselves and in clearly formulating a direction for their studies which were meaningful to them. For others it was simply because of the friendships they had formed. By nature, Jurgen had been drawn into a group of students who were considered to be ‘free radicals’. He seemed to take pleasure in the freshness of their ‘independent thought’ and ‘colourful characteristics’; phrases used by the administrators to politely express disapproval. Jurgen’s frequent associates included his neighbour Gus Grass, William Triumph; ‘a wealthy urbanite’ who experimented with a Deuterium-Fluoride chemical laser technology - a powerful tool which in William's hands occasionally transformed into a high energy weapon of destruction, strange little Gregor Samsa; the entomologist, the engineer Heartfield, plump little Katscha who studied genetics, the stern biomechanic Mechtilde, and of course, Ljubomir, an enormous boy from Bulgaria who was often found fast asleep, slumped over a chair somewhere, grinding his teeth down to stubs. Jurgen watched over Ljubomir, in particular, as if he were a younger, bigger brother. The gentle giant, who suffered from nervous disorders, often experi‐ mented in the chemistry lab by creating new pharmaceutical ‘prescriptions’ which he then administered to himself. Frequently, various combinations of members of this social group would get together during the evening at one of the taverns in the village; usually the Count’s


Arms or the Screaming Virgin, to hoist pints of Bohemian beer. The interiors of both consisted of ceilings supported by heavy beams, stained glass panels on the windows, and thick wooden tables whose surfaces were scarred by years of wear and tear. On one of these occasions, Jurgen happened to be sitting at the table next to William and Katscha. Both were already quite drunk. They were discussing Katscha’s room mate from the dormitory; a young woman named Coraline, whom William described as being incredibly attractive. “Don’t even think about it,” Katscha had laughed, “Like, the only thing that she is interested in is redesigning the world. I don’t understand her. It’s like, she’s totally taken a vow of celibacy, right. Like, she’s never even kissed a guy. I mean, I’ve seen her naked, and if I were a guy I would like totally die for her body. I don't blame you young rogues for, like, having a permanent hard-on for her.” This was a typical conversation during one of these entertaining evenings. Who was this mysterious 'Coraline', Jurgen had wondered. He was intrigued. This same crew of misfits eventually managed to be shunned by nearly all of the other students; particularly those who had acquired the mannerisms and air of nobility which came from dwelling within the castle walls. This was understandable; gazing from the ramparts, or through the arched stone windows, at a vast rolling landscape that stretched away in every direction, imparted a sense of feudal superiority over everything that the eye surveyed - perhaps a historic memory that had been encoded in their genes. Heartfield had once referred to these students as unknowing prisoners of their own egotism; insecure, lonely, and deprived of the naive, simple, and unso‐ phisticated enjoyment of life. Due to the dynamics created by the students' close proximity, and the intensity of their interaction, the characteristics of a distinct society had gradually emerged during the Akademy’s brief history; similar to the way a young child begins to selectively integrate the influences which determine its behavior. The intervention of a stern parent ensured that this developing society was governed according to the philoso‐ phy of the Akademy. For a student to be successful, the administrators patiently explained, it was necessary to obtain a clear understanding of, and behave in a manner consistent with, the fundamental principles to which the corporate benefactors subscribed. The indoctrination was thorough. Jurgen was grateful that he had chosen to live in the village. His apartment was his sanctuary; a quiet solitude that provided a welcome reprieve from the intensity of the social politics within the castle walls, and a place where he could revitalize his energy after the sometime overwhelming insanity of time spent with his friends. William Triumph was the ringleader and the financial sponsor of the escapades. He seemed to have inexhaustible financial resources and was very generous in entertaining his friends. Since he didn’t have a car; he even claimed that he didn’t know how to drive, the whole sick crew - with Gus behind the wheel, would head off on a series of madcap pranks and stunts at any time of the year: concerts in Prague, all night drinking parties in Budapest or snowboarding in Salzburg. One weekend, at the end of April, they went hunting for witches near Brno during Paleni Carodejnic. Not finding any, they instead decided to steal as many sugar beets as they could carry from a


farmer’s field located on the historic site of Napoleon’s battle of Austerlitz. Jurgen had read about it in ‘War and Peace’, and was searching in the darkness for Zuran Hill, while the maniacs he was with could care less; they were too busy digging in the dirt. Some people feed off the energy of those around them, and Jurgen would always be their prey. Even though he enjoyed these adventures, they seemed to drain him and distract him from his work. His friends lived for the moment, always ready for the next distraction. They did enough work at the Akademy to maintain their status, but as soon as they could they were back on-line; immersed in games, watching movies, or listening to streaming music from radio stations around the world. They couldn’t understand the passion that motivated Jurgen to dedicate himself to his pursuits. Perhaps it was an obsession. Sometimes he would stay home for days at a time with the curtains drawn, avoiding distractions that could disrupt his concentration while he sat before his keyboard, churning out lines of code with untiring devotion. There were times when the outside world did not seem to exist, when he didn’t know if it was raining or snowing, or even whether it was night or day. During those times he often wished he had someone to talk to about the deeply philosophical concepts which engaged him in his work. He could exchange ideas and information with contacts on the network, but the experience only intensified his awareness that he was just one of the millions of people sitting by themselves and talking to their machines in the middle of the night. Whether they were avatars or faces on a camera, it often seemed unreal. Sometimes he felt so alone. The flatscreen monitor illuminated the darkness of his nocturnal existence... almost midnight, the full moon behind the dusty grey nicotine stained clouds... the silhouette of the castle... insomnia. Jurgen had finished the second bottle of wine he had received from Dr. Planchette, yet he had still been able to clearly recall the details; recording impressions of his arrival to the village, his acquaintance with Mrs. Boshovsky and his initiation into the life at the Akademy in the pages of his journal. He got up from the wooden box and began pacing back and forth along a pathway of cardboard sheets that covered the old wooden floorboards. Out of consideration for Mrs. Boshovsky, who lived directly beneath him and retired early, he had placed the cardboard down to muffle the sound of his footsteps. Presently, he realized that he needed to use the toilet, so he crept silently down the stairs to the main floor. The bathroom was locked. In the darkness, thin steams of light were shining from the crack under the door and through the keyhole. Jurgen could hear the sound of water draining from the tub, so he quietly knocked and inquired if the occupant would be long. He was answered by the sound of Marina’s laughter; the landlady’s daughter, a flirtatious sixteen year old girl. Now aware that he was outside, she began singing ‘Beautiful Dreamer’, intentionally delaying his access to the room. He was kept waiting for quite some time - he couldn’t imagine what she was doing in there. Suddenly the door flew open, and Marina emerged. Her bathrobe had been deliberately left open, apparently to illicit a response from him to her young body just beginning to blossom into womanhood. For a moment she stood before him; sullen, delicate features, moist blond hair, a thin impetuous smile and frail hands like tiny birds. Her pale skin was


warm and rosy after her bath. He knew what she was doing. She knew what he was thinking. With a wink she walked away.

IV. MASTER BRONCHEV

It had been another long, restless night on his hard mattress, but Jurgen had risen with the sun. After sleeping on it, he had come to the decision that he would accept Dr. Planchette’s offer to collaborate with him on his project. All that was required to finalize the arrangement was to obtain the Akademy’s approval. Still lying in bed, Jurgen reached over and picked up his cell phone. He pressed the number sequence on the keypad which connected him to the Administration Office. He spoke briefly with Master Bronchev’s assistant, scheduling an appointment with the Master for a time in the early afternoon. He reached under the bed, dragging out a mismatched pair of Bertlemann's socks. He pulled on a pair of black jeans, a grey wool sweater and a heavy brown jacket, then went outside. The thick mat of leaves that had fallen from nearby almond trees cushioned the sound of his hiking boots on the muddy cobblestones. It was a tranquil scene: wooden houses lined the narrow lane, a cat fast asleep in the shadow of a wall, freshly washed clothes billowed in the breeze. There was an aroma of damp earth, cooking pork, and wood smoke rising from the chimneys. The sound of a baby crying. Over a fence, an old woman with a wizened face stooped down to gather peaches and apricots that had fallen to the ground; Broskovice and Merunkovice would warm her spirit during the coming winter months ahead. A Saker Falcon drifted over the lowland mists, then was lost among forests that were ablaze with colour in the bright sunlight on the distant mountainside. The scenery in this hidden valley had changed little since the Dark Ages, except, now nearly every home in the village had a satellite dish on the roof. Walking quickly, Jurgen soon reached the pavement of the main road. A slaughter‐ house fabricated from sheet metal stood at the intersection. Outside, in one of the pens, a dozen African Black Domesticated Ostriches, unaware of their fate, didn’t bother to hide their heads in the sand. Jurgen continued along the highway toward the main square in the center of the village, where, around a monument to commemorate the plague, vendors would set up their stalls to sell ceramics, handicrafts and flowers, and where, during certain summer weekends, the country folk would gather to dance to the music of a fantastic Bohemian band. A silver split-tailed lion, a silver and red checkered eagle, and a black eagle with silver crescent, representing Bohemia,


Moravia and Silesia formed the crests of the Czech national emblem above the door of the village hall overlooking the square. Inside, the constables were filing reports, rewriting history and waiting for the change of shift so they could return home after fulfilling a night of dutifully maintaining occasional curfew patrols. Farmers drove off the pavement and were heading out to complete the harvest of their fields, the bald tires on their trucks spinning in the mud. Young and old men, their weathered faces were a portrait of peaceful, honest toil; infinitely more perfect than any painting could capture. They had no reason to be inspired by lofty ideals. They seemed to have an intuitive understanding of the true essence of reality; they did not deny the existence of pain, they had the courage to rise above any tragedy, and their minds were open to the purity and integrity of nature. Like animals, they were crea‐ tures of the earth. A short poem that Jurgen had written as a child came to mind... It was entitled ‘Speed of Light’: Mass extends toward infinity, as time stands still. The cattle grazing on the moist green grass never think about it, nor does the cobbler in the sleepy village. Life is simple there. No point filling their heads with endless lines... The vapour trail of an invisible jet carved itself across the sky. Jurgen turned up his jacket’s collar. He often experienced a sense of uneasiness as he roamed through the village. To the Romantics, an agrarian lifestyle had seemed idyllic, yet Jurgen had been sympathetic to the harsh living conditions he had observed the rural people often enduring. There was no longer a contrast between the first world and the third, but between the old world and the new. And caught between those worlds, Jurgen, out of necessity, had been required to pledge allegiance to the corporations who owned this land, since they were also his benefactors by sponsoring his education. He had always valued his ability to differentiate between what he believed and what he had been told, and would not be pressured into abiding by principles which came into conflict with his perceptions and direct experience of the world. The recognition that his life was interchangeable with theirs, that under slightly different circumstances he could have been one of those young men harvesting the wheat that fed the foreign strangers sheltered in the castle, caused him to constantly question his


own role within this society. He often wondered how his position as one of the privileged elite, with the freedom to explore esoteric theoretical concepts, could benefit these villagers. And he wondered if the wage of 40000 Kc per month which he was paid as a student, was worth the value of three times the amount paid to the village worker. While the rural folk were pleasant and friendly, they could occasionally be overheard making disparaging remarks directed at the students; “Arrogant snobs... Bourgeois... Who do they think they are?” As a result, Jurgen had decided to remain discreet; to minimize his interaction with the villagers. A very tall young man, he had acquired the habit of walking stooped over as if trying to equalize the differential in size between himself and the rest of the population. He managed to make himself nearly invisible. No-one seemed to notice him as he walked past the church and the cemetery, or entered the market where he bought his food. Very seldom would someone glance at him or acknowledge his presence as he browsed through the shelves of the small bookstore. He sat alone at the table of the restaurant in the ‘Only Hotel’ and ate a quick meal of knedlo-zelovepro, (dumplings, sauerkraut and roast pork, seasoned with caraway seed, bacon and salt), and even avoided acknowledging a couple of students who sat a few tables away. For the most part it had been preferable to avoid the distractions of daily life, such as; being drawn into situations he did not want to be involved in, or into casual conversations with the people he encountered. With his backpack full of groceries, he made his way back toward his apartment. His thoughts had now shifted to analyzing the complex concepts that were stored within his mind. Inspiration could occur at any time. He jotted notes in a small notebook that he carried in his pocket as he walked briskly along; the movement, and the cool, fresh autumn air had helped to clear his mind. He had acquired several insights by the time he returned home. As he entered the landing, Mrs. Boshovsky rushed from her apartment to intercept him. She appeared excited, but spoke quietly, “I hope that Marina hasn’t been bothering you,” she said, her eyes casually glancing in the direction of the open door to the bathroom, then returning to make contact with him. “She is such a little devil. Just let me know if she is disturbing you and I will see to it that she is punished.” Jurgen nodded, hoping to put an end to a topic that would be awkward to discuss, but as he began to climb the stairs, Mrs. Boshovsky followed him and caught him by the pant leg. He turned toward her. She was standing at the foot of the stairs with her head level with his waist. Facing straight ahead she continued, “Sometimes it’s just so hard with her. I know the impulses a young girl can feel.” She looked up into his face now, “I was a pretty young girl, once... and I certainly would have been attracted to someone like you.” The dull light of the landing, reflecting off the walls from the sunshine outside, captured some of her still youthful charm. Highlights of red glowed in the curly locks of her long, dark brown hair, and glistened on the surface of her full ruby lips. Her dark


eyes were searching his expectantly, causing him to feel uncomfortable and avert his gaze, only to discover himself staring down at the firm nipples protruding through the patterned cloth of her dress, which, because of the angle she was leaning, wrapped snugly around her astonishingly large breasts. Now staring intently into her eyes, somewhat mesmerized by their beauty, he hesitantly replied, “You are still very pretty”; and he was surprised to realize that he meant it. He also became aware of something stiffening down the leg of his jeans. She smiled, then reached out and ran her hand up along the inside of his leg, “That is very nice of you to say.” She pulled her hand back and gently patted his knee, “I think we should get together and drink some wine sometime soon. I hardly ever see you any more ... you always seem to lock yourself away.” “Uh ... yes ... I would like that ... very much”, Jurgen replied as he turned and made his way up the stairs to his apartment. He sat on the wooden box by the window for some time, staring at the various scenes inside his room, thinking over the recent situations that had occurred with Mrs. Boshovsky and her daughter. Suddenly glancing over at the digital clock on the floor, he realized that it was well past noon. He hurriedly put his groceries in the cupboard and fridge, donned his formal uniform, then picked up the keys to his scooter. The engine howled as he raced up the hill to the castle. He didn’t want to be late for his appointment. The Masters lived in the upper regions of the ‘Ivory Tower’; the tall, white, cylindrical building rising above the castle. Jurgen took the elevator up to the 7th floor, knocked on the door, then entered Master Bronchev’s study. The Master looked up from the monitor he had been staring at and asked Jurgen to take a seat. The small room was decorated with some of the Baroque furnishings purchased with the castle; elegant dark oak bookshelves, thick carpeting and an ornate ceiling. To Jurgen’s left was a door leading into the Master’s chambers. Master Bronchev played the role of Jurgen’s faculty advisor. That he was teaching at the Akademy had been one of the contributing factors in determining Jurgen’s decision to enroll. Master Bronchev was thoroughly knowledgeable in the theory and technology involved in many fields of cybernetics, particularly expert systems and computer virology. The Master had gained his reputation by studying these new ‘life’ forms; vicious little organisms that adapt and survive within the digital environment, analogous to the way a universe of microbes exist within the human body host. As well, the Master had made it his mission to publicize information about the virus creators; casting light on the shadowy figures who had anonymously been able to generate an increasing level of fear throughout the network since the 1980’s.


Master Bronchev, a man in his 50’s, peered across the desk at Jurgen, his dark eyes glistening behind the lenses of his glasses. His smooth, round face had the pale complexion of someone who spends most of their time in front of a monitor, and carried an expression which was serious yet friendly. He was wearing the customary uniform of the faculty; a smartly tailored white robe. His most notable feature was his extraordinarily large hands, which he now placed on the desk in front of him with his fingers interlaced, waiting patiently for Jurgen to speak. With some nervousness, Jurgen explained that he had recently met with Dr. Planchette, and that he was considering being involved in his project. With a look of satisfaction, Master Bronchev leaned back in his chair and broadly smiled. “I thought you would,” he said, before returning to his familiar serious expression. “Marcel and I spoke about the matter, and I suggested that he invite you to meet with him. Dr. Planchette is a very talented young man, like yourself... “, Master Bronchev gestured toward Jurgen with his enormous hands, “... but I do have some concerns about the intentions of his experimentation. From what he has explained to me, I cannot help but think that he is merely dabbling in superstition and magic. Of course, that is the same accusation directed toward every field of science; since the first investigations into the existence of laws in nature and the quest to understand the essence of phenomena separated the inquiring scientific mind from obedient religious devotion. Nevertheless, I am certain you will be able to gauge the merits of the project for yourself, and dedicate your efforts toward it appropriately.” “In considering your involvement in this project, I should cast some light on the relationship of Dr. Planchette’s work to the operating principles put in place by the governing bodies who have established this institution.” Master Bronchev now leaned forward and spoke in a quiet, confidential voice as if the conversation were being recorded. “Although we remain polarized in our views, I, for one, admire Marcel’s ‘visionary spirit’. Yet, the fact is that not many of my colleagues enthusiastically support his work.” Recognizing that Jurgen had understood, Master Bronchev leaned back in his chair once again and returned to a normal speaking voice. “You might not be fully aware of what the operating principles are that guide the direction of the Akademy. They have not been carved in stone. They are virtual and they are constantly evolving, adapting to trends emerging within the ‘New World Economy’. Through your contract, you have agreed to participate in the process of shaping and defining these principles by developing knowledge and skills which will ultimately have a beneficial influence on humanity.” Jurgen recalled that phrase as one of the many items in the multi-page contract he had signed in the administration office after orientation; although he had not taken the time to thoroughly read its entire contents. He now listened carefully, hoping to gain a more complete understanding of his own obligations to the Akademy. Master Bronchev began by briefly providing a historic context:


“The corporations advancing into the future are moving away from the outdated notions of the past. History has taught us that the balance sheet of human evolution has been a ledger of conquest; predatory forces continually expanded into new regions to establish themselves as the privileged class. The conquerors seized ownership of the land and appointed a system of ethical values to guide the behavior of the vanquished; religion, laws and tariffs. Unfortunately this system created an uneven distribution of power and wealth. This inequity was the major cause of revolutions within a state and ignited many territorial wars.” “During the past century, corporations emulated the hierarchical structure of ‘the kingdom’ which enabled them to amass substantial profits. As these corporations developed and grew more powerful, their products began to be distributed internation‐ ally. Gradually, the common desire to obtain these products became the predominate influence shaping the behavior of the world’s population. ‘Politics’ and ‘nationalism’ became antiquated notions as the artificial boundaries dissolved. Soon there were no longer new territories to conquer, only new horizons to explore. To supply the need, these smaller corporations merged to create larger ones, and a global economy; “The ‘New World Economy’ was formed.” Jurgen recognized the trademark phrase of ACB, the coalition of corporations acting as sponsors of the Akademy, whose slogan was ‘Exploring New Horizons’. “Imagine the structure of the global economy as a network of individual ‘nodes’; numerous geographic locations where either raw resources or recycled materials are extracted, and the sites of numerous manufacturing plants, warehouses, and retail outlets.” Master Bronchev illustrated his comments by drawing on the wooden surface of his desk with his large forefinger. “These networks have developed highly efficient infrastructures which are capable of distributing material from nodes where it is plentiful to the nodes where material is in demand. Each of the nodes contains an operating system, comprised of certain components; the workers, the management and the support staff. Every component within the operating system forms a symbiotic relationship with every other component. In a similar manner, each node within the network is ultimately dependent for its survival by its relationship with every other node.” Bronchev now looked up from his detailed invisible map, “There is an allegory from Hindu mythology called the ‘Net of Indra’, describing everything in the universe as a vast multitude of highly polished gems, in which each gem suspended within the net is able to reflect every other gem.” Jurgen was forming a three-dimensional image of a multifaceted bright blue gem in his mind while the Master continued to speak, shifting to a different analogy... “Corporations are the organisms responsible for the operation of these nodes and like other organisms they must be adaptable to their environment. Their continued existence depends on obtaining global resources and transforming them into products which meet the needs of the ‘planetary community’. The balance between production and consumption, supply and demand, is always motivated by profit, in that to ensure


the optimum operation of the corporation it is necessary for it to retain a surplus; stocks of raw materials, warehoused products, or creditable finances. This excess is used as insurance against a wide variety of unforeseen circumstances.” “In the past, profit has been associated with greed; individuals whose exaggerated competitive attitude enticed them to worship acquisitive success and place their needs above the rest of humanity, the producers who believed that their fortunate circum‐ stance entitled them to receive greater rewards, and the consumers, who had accumu‐ lated more possessions than they need. It has taken the widespread effects of environmental damage, famine and disease to create a realization that when nature is destroyed, mankind is destroyed. A realization that the survival of both the corporate organisms and the human organisms are dependent on the well-being of their host; a healthy planet. As a result, we are beginning to see changes in the way corporations are being operated, as a younger generation of executives assume the reigns. These new administrators are energetic, compassionate leaders who have risen through the ranks by becoming extremely efficient at managing the complexity of large corpora‐ tions. They are capable of providing effective direction to restructure operating procedures; maintaining the components of the existing system which are vital and augmenting them with important innovations.” Jurgen was not certain if the Master was trying to convince him, or convince himself. Master Bronchev was stating his position as if it were the first time he had spoken these ideas out loud. “The merger of smaller companies into supranational corporations eliminated competition, and created an enormous accumulation of private capital. These finances have enabled executives to dedicate personnel and resources to devising solutions to alleviate hardship within the underprivileged sectors of society in various regions throughout the world. These responsibilities had once been the province of govern‐ ments. Unfortunately, the citizens in many of the countries who most desperately needed the intervention of a benevolent authority for protection and assistance, were the ones who often had fallen prey to ruthless dictators, who through their greed and corruption drove the fearful population even deeper into disastrous ruin. The demo‐ cratically organized political societies haven’t fared much better, since the bureaucrats who finally assume public office become reluctant to take a stand or make any decision which could negatively impact their bid for re-election. As a result they commission endless studies and hope that the issues eventually fade from the public eye. In our modern world, governments have risen and fallen but the corporations have endured.” “Because of their humanitarian efforts, the leading corporations of The New World Economy create a favorable public perception, achieving greater productivity from workers who are more enthusiastic about directing their labor to benefit a broader social context, as well as increasing consumer’s support for their products. This is understandable, since both the producer and consumer are dependent upon the corporation for their physical, emotional or economic existence.


“And as these corporations face unique challenges, the administrators will require highly trained, specialized advisors to provide them with the information they need to make their decisions. Consequently, these corporations are establishing their own network of academic institutions based on the philosophy that the education of the individual, in addition to promoting their own innate abilities, should develop a sense of social responsibility within the student.” Master Bronchev tilted back in his chair. Jurgen had been listening attentively to the Master’s voice, with his head tilted to one side and his ear turned slightly toward the speaker. The words had renewed his sense of optimism and hope for the future. Although, the thought crossed his mind that, perhaps, Master Bronchev had been playing the devil’s advocate; trying to draw a reaction from him. Jurgen was aware of an enormous number of regions around the planet that required the assistance of a beneficent source. Even with the best inten‐ tions of many large corporations, it would still be a monumental task, requiring many years of dedicated effort to remedy the environmental and social problems at even a few locations. Having given Jurgen a few moments to consider what he had said, Master Bronchev continued, “As I am sure you realize, a network such as the one I have described is vastly complex and needs the guidance of expert systems, which I believe only software can provide.” The Master once again leaned forward and placed his large hands on the desk. “Your understanding of knowledge-based systems and artificial intelligence would be extremely valuable in furthering the objectives of ACB. While I am confident in the integrity of the corporate executives I have become associated with since the Akademy began operations, I am also aware that the management of a sophisticated process such as rebuilding the world is beyond the capabilities of most humans.” The Master paused and smiled. “Humans tend to become distracted and make errors, deviate from their objectives with the intervention of emotion and desire, or possibly even become overwhelmed with hopeless despair at the enormity of the challenges they face. What I am proposing is the development of software to keep the corporate mechanism on track, similar to the way that automated systems manage extremely complex operations of space travel. The components of the problem are analyzed in simulation, then the timeline and method of solutions are mapped out in advance. As the operation is carried out, new data is entered into the program and the process is adjusted accordingly. The software serves as a resource and reference point to provide information at every step along the way until the objective is completed.” Jurgen responded; “You are describing a system which essentially acts as a conscience; a source the executives are able to consult to provide them with informa‐ tion on the most appropriate direction to take in the event that human nature compels them to deviate from their course.”


“Yes, I suppose that is true,” the Master continued, “After all, ‘they’ say, ‘history repeats itself’, and we do not want to return to a state which is run by a disembodied head; in which the strength of the body, made up of the human labour forces who have been mobilized to effect a solution, become disengaged from their source of guiding intellect and will.” Jurgen picked up on the reference to ‘disembodied head’~ the image of the head he held in Dr. Planchette’s lab immediately flashed into his mind. Those eyes... He was immediately drawn back to the present by Master Bronchev’s voice, “So... the decision is yours. Give some thought to your preference; determine if you want to experiment with Dr. Planchette, or use your abilities to help devise an efficient intelligence system for the New World Economy.” The Master, perceiving that Jurgen was already balancing the options in his mind, considered, “Perhaps I shouldn’t have phrased it as a binary choice. You have plenty of time to decide; graduation is still two years away. It is possible that you already have a vision of how you plan to utilize your talents in the future. I am merely suggesting another option that you are welcome to explore.”

V. A DIGITAL CONSTELLATION

It seemed that everyone wanted a piece of him; Mrs. Boshovsky, Marina, Dr. Planchette, Master Bronchev, Gus, Ljubomir, Will... and there wasn’t enough of him to go around. How was it possible to be all things to all people and still have enough energy remaining to be himself? He needed time to think. There were enough groceries that he could sequester himself inside his room for several days, just like he used to do when he was child; his innocent youth when he shared a house with his mother as if they were strangers. He loved his mother, but they were distant, perhaps because he was the one who seemed to be the more responsible adult. By about twelve years of age, he was already taller than she was, and immersed in intellectual and scientific studies that were well beyond her ability to comprehend. He was the one who stayed home, taking care of the house and preparing most of the meals after school, while his mother would go out almost every


evening to attend a theater play, concert or movie. Often she wouldn’t return until the early hours of the morning. She would sleep late, reporting to the office sometime in the early afternoon. Her job was to write columns on society and cultural events as an editor of the regional newspaper in Eigenvalue, Germany. Even now Jurgen could fondly recall the smell of printer’s ink, newsprint, cigar smoke, wine and perfume that lingered on her clothing when he washed the laundry. During his teenage years, at almost two meters tall and as thin as a rake, he definitely stood out among his friends. It made him uncomfortable to be so conspicu‐ ous in public that he gradually spent more of his time at home. His interests, also, were very different from his friends. He began to immerse himself in the study of automation and robots; fascinated by the similarity of the processes controlling both living organ‐ isms and machines. He built a modem in the early 1990’s to gathered information from bulletin boards and various university FTP sites, and through the network became aware of a mathematician named Norbert Wiener, who, during the 1940’s, introduced the concept of ‘cybernetics’; demonstrating, among other things, that machines were capable of ‘intelligent’ behavior and that it was possible for them to be infected by ‘disease’. Around this time, Jurgen's good friend, Uli Wahl, stopped by, as he often did, on his way to the rehearsal space. He played bass guitar in a band called ‘Dangerous Waltz’. Occasionally, he managed to coax Jurgen into a Volkswagen van, to join him and the other members of the band; Attila, Robotto and Jellyman, who would drive like maniacs down the autobahn to play a gig at the Klangerhalle. This day however, Uli had just returned from a recent trip to Hannover where he had discovered a copy of “Cybernetic Machines” by T.N.Nemes in a secondhand bookstore. The hardcover was in excellent condition; an original edition printed in Hungary in 1969. Jurgen was intrigued by Tihame´r Nemes’ concepts which were far ahead of their time. Working tirelessly throughout that entire summer, Jurgen had managed to construct working prototypes of several of the whimsical devices described in the book, including a machine for analyzing the ridiculous, and a machine which shouted out in pain when struck by a heavy blow. He could readily relate to these surreal concepts, since he had always considered the DADA art movement to be one of the world’s greatest cultural achievements. It was fitting that he should have received the book via Hannover; the birthplace of Schwitters and Merz. Following the thread that connected ‘experiential’ machines to adaptive phenome‐ na, Jurgen rapidly digested any information that he could discover on the subject of ‘artificial life’. He developed a new operating system for the processor of the ‘Power Mac’ computer in the corner of his bedroom and dedicated it to run an elaborate simulated environment. Soon this digital ‘terrarium’ became inhabited by several species of tiny creatures he had authored. Although, in the beginning, these primitive life forms were essentially invisible constructs of pure code; no more complex than simple amoebae, Jurgen had eventually cloaked them in a graphic form to visualize them on a computer display - so that he could be certain that they even existed. The entities’ adaptive characteristics; derived by adjusting the permutations of their


instruction sets, resulted in constellations of structural variations which Jurgen named by using a method similar to astronomical numbers; having been inspired during contemplation of the starry night out his window that appeared to be suspended over Eigenvalue like a dome. By the time Jurgen had arrived at the Akademy, his creatures had evolved in complexity. Aware of his responsibilities as their supreme creator, he had nurtured the entities, diversifying their structure and behavior, and enhancing their performance through the endowment of intellect. Information theory and the calculus of neural networks inspired him to fabricate the digital architecture of newer versions of his entities to emulate the function of a neuron: The brain, he learned, was a complex analog computational/storage device formed by the interconnection of approximately ten billion neurons. Each neuron consisted of a nucleus, a long nerve fibre called an axon, and perhaps one thousand dendrites radiating out like the branches of a tree. The dendrites functioned as antenna to collect impulses transmitted by other neurons, capturing these signals in the form of an electrical charge. When the cumulative strength of all the input signals arriving at a neuron exceeded a certain threshold level, it caused the neuron to fire off an output signal its own. This nerve impulse traveled along the axon like a wave, branching off at terminals to release neurotransmitters; chemical messengers which triggered other neurons nearby. At the same time, the signal continued downstream along the axon’s main trunk to effect target cells in a muscle or gland located in a distant part of the body. The neuron was either active, or at rest, analogous to a binary digital state. The behavior of the overall system was the consequence of neurons exchanging signals according to a predetermined code. Information could be relayed at a speed of 150m/sec in long axons, slower than a computer, but the nervous system could carry out millions of these operations simultaneously. Jurgen calculated the storage capacity of the human brain, if information was encoded in an 8 bit digital format. Given that there were approximately ten billion neurons, and assuming that all cells were used for storage, Jurgen estimated that at any given time the brain could store approximately 1.25 terabytes of data. During his first year at the Akademy Jurgen built a neuro-computer, by authoring lines of code for a compact, self-contained software program designed to mimic a biological neuron. Each of these constructs were capable of receiving a large number of strings of digital code to its inputs, then use algorithms to evaluate this data as the basis for deciding whether or not to fire off a response signal as an output. At first he duplicated a few hundred identical copies, then progressed to thousands, then millions of these tiny programs, each occupying a location within a three dimensional matrix in the virtual space of a large hard drive; a layered structure designed to replicate certain portions of the brain. These synthetic neurons were designed to be more efficient than biological neurons.


Patiently, using a technique similar to teaching a newborn child, Jurgen began to input data into the system; “name = blue”, “name = colour”, “blue = colour”, or later, “name = Jurgen”, “receive = yes”, “response = hello”, and so on... The organizational properties of their collective behavior determined the logic of how each new field of encoded data would be evaluated, and the location it would be stored. The complexity of the model was an evolutionary process; the system gradually developed the ability to determine the dynamic relationship of each new piece of information by retrieving existing data to make comparisons which reinforced or eliminated models that the entities had previously constructed. Feedback loops, built into subroutines within the program, served as an error correction mechanism; continually analyzing and verifying the integrity of the data that each unit stored. In addition these 'control loops' func‐ tioned as short term memory; actively circulating data throughout the system whenever it was needed. One day, Jurgen typed in the word: ‘hello’. In response, the words: “hello Jurgen” appeared on the screen. Almost instantly, these words were replaced by a sentence which read: ‘What is my name?’ Even though he was just beginning to conduct a rudimentary dialogue with the software, the exchange still seemed too mechanical, too analytical; it was like talking to a machine. Jurgen went back to the drawing board and spent several months creating flowcharts to map out the logical evolutionary progression of a new type of species. His objective was to create an autopoietic network; one that was not based on a discriminatory recognition process within the individual entities themselves, but one that utilized the dynamics of the entire system. This design took a constructivist approach, in that the environment itself would instruct the organism how to adapt, and how to develop the capacity to learn, and think and feel. Once again, Jurgen rewrote the structure of the code. In order to create a system which operated as a network of processes, it was necessary that each of the entities would evolve through a life cycle; they would need to be able to come into being, have the ability to transform, and when they had outlived their usefulness, they would be required to self-destruct. Similar to biological cell metabolism, the potential of destruc‐ tion was the motivational force to encourage regeneration. This was the key to the stability of the process. Based on the cumulative knowledge inherited from all previous interactions, the entities would develop the cognition to determine how and what they responded to in their complex, changing environment, and be able to restructure themselves accordingly. Each generation should be more adaptable than the previous one had been. Eventually, at a micro level, it was possible that they may organize themselves into the most perfect society. Now, during this evening following his meeting with Master Bronchev, as he paused to reflect on the course of his work, Jurgen began to realize that the entities he had been experimenting with could be developed to serve the New World Economy. It seemed to him that the altruistic notion of compassion existed somewhere within the spectrum extending between despair and blind hope; a state of equilibrium which


seemed not possible to sustain for more than a few fleeting moments when emotion and desire acted as gravity influencing human behavior. Perhaps, in the future, a fully advanced form of his entities could be released into the network, not only to merely assist in managing the enormous complexity of data, but, one day, potentially provide an effective means of democratizing the system - having the ability to regulate greed and human injustice; eliminating the caustic forces which corrupt absolute power. He imagined entities that were designed to seek out blocks of data with the objective of verifying their truth. If true, the entity would learn and incorporate this knowledge, if false, the data would be erased. Ultimately, perhaps, this entity could even be capable of leading humanity toward a higher consciousness and ushering in a new golden age. Outside, in the darkness after curfew, a few lights still burned in the windows of the castle on the hill, crowned with distant constellations glimmering in the night sky. Jurgen struck his static pose in front of the computer’s display screen and wandered over to the bookshelf. For several minutes he rummaged through the clutter. Eventual‐ ly he unearthed what he had been searching for; a book of poetry entitled, ‘The Pill vs. The Springfield Mine Disaster’ written by Richard Brautigan in 1967, and in particular the verse introducing the collection; ‘All Watched Over By Machines of Loving Grace’. This book, like many of the other works of contemporary literature which had broadened his horizons and inspired him with their magic had been received as a gift from his father; the author Kropton Ernst. At Christmas, or on the occasion of his birthday, his father had often sent him a paperback novel by Thomas Pynchon, William Burroughs, Henry Miller, Kurt Vonnegut, Ferdinand Celene, Jack Kerouak, Alejo Carpentier, Gabriel Garcia Marquez and so on... authors, (“who unlike myself”, his father had modestly claimed, “actually knew how to write”). Rarely had his father ever sent him a copy of one of his own books, which was surprising, since Kropton had authored over fifty novels of pulp science fiction during his prolific career. While there were an impressive number of copies of his books in print which were revered by a dedicated, cult-like following, his royalties had only generated a modest income since he had never had a huge best seller. As he thought of his father, Jurgen recalled the painful sense of emptiness he often experienced during his childhood, and wondered now, as he did then, if he would ever see him again. Jurgen had read the Brautigan poem then put the slim book aside to once again browse through the bookshelf. Eventually he excavated the manuscript that Kropton had sent; the one contained in the package awaiting him on the counter of the Administration office that evening he had first arrived. Until now, Jurgen hadn’t even glanced through the unfinished novel; a story that his father had entitled 'Invisible Waves'. He had just placed it on the shelf and forgotten about it - allowing the bound collection of typewritten sheets to become buried in time. Now something had com‐ pelled him to search through its contents. Perhaps it would provide an insight...


VI. Excerpt from INVISIBLE WAVES (PART 1) LEVELAND

Close up of a television screen. On the white screen, dark black letters of a title fade up: “LEVELAND June 22, 1956”. The title fades out. The music on the soundtrack is appropriate to a monochromatic science fiction film of that era. From out of a pure white void, clustered arrays of tiny, isolated black dots appear on the screen. There is a low level humming, accompanied by the gentle sound of moving air as the small black shapes increase in size. As the aerial viewpoint approaches, the shapes can be recognized as groups of small houses; their detail defined by deep shadows contrasting the endless expanse of the white featureless landscape. The viewpoint approaches an individual house. Circling in a gentle arc around to the darker, shadow side of the house, the viewpoint then drops in altitude as it slowly approaches. A constant gentle humming sound can be heard. In the far distance other houses can be seen as small dark objects dotting an invisible horizon. The house is modular; a collection of cubic structures of various sizes, each with rounded corners, and one silo-like tower rising above. Covering the large sloping roof of the main building is a solar panel facing the light. Exiting the side of the house is a covered corridor leading to a low building with a curved roof that is used as the garage. The music on the soundtrack signals that something is about to happen... Cameron Stark is sitting at the kitchen table reading the morning newspaper. The television, playing the movie, is on in the background, but he is not watching it. He is studying the text of a newspaper article under a banner headline that reads, “Mystery Object Seen in the Sky.” The accompanying photograph appears to be an out of focus, blurry, greyish object apparently hovering in a clear white sky. The article reports that the ‘flying saucer’ was thought to be a new kind of sophisticated reconnaissance device of the enemy, although the Authority had yet to issue an official statement in confirmation. 'It is difficult to believe everything you read', Cameron thought as he scooped up the last bite of his breakfast with a fork and flipped to another section of the paper. The kitchen is roomy - with plenty of cupboards, a large fridge, a stove and flowerpatterned curtains on the window. The appliances in the kitchen are clean, streamline and sturdy - 1950’s futuramic - they have large dials and switches on their control panels. Subdued tints and pastel shading slightly colourize this black and white scene. The low buzz of the fridge is ambient under the sound of the TV in the background. Cameron is sitting with his back to a large picture window - brilliant light is stream‐ ing in from outdoors. He takes a sip of coffee, unaware that behind him the shadow of


a large object is slowly coming into view, matching the motion of a UFO approaching an identical house in the televised movie. Both the show, and the object’s approach behind him go unnoticed. The shadow briefly eclipses the sun as it moves over the house. At that moment there is the sound of a woman screaming from the television which rouses Cameron from his absorbed reflection on the box scores in the sports section of the newspaper. By the time he looks over at the television, the image has been replaced by the static of white noise. Momentarily the kitchen lights fade as the power dims. He glances around, as if detecting the presence of something, but everything still appears normal. Quickly the sensation passes. The telephone is ringing now - it demands his attention. With the press of a button on the remote control, Cameron turns off the television, now aware of a scarcely audible humming sound in the background that seems to gently vanish into silence. The telephone rings again. Cameron puts down the newspaper and answers the phone; “Hello, Adda!” A woman’s voice is on the line, “I was thinking about the project last night, and I think I came up with a solution to the problem that plagued us yesterday. I couldn’t sleep, so I think I am going to head down to the lab. How are you doing? You sound tired.” “Well, I didn’t sleep much either...I guess I’m anxious to run the simulation. Seems like we’ve been punching computer cards for months.” “We have!” “Ha... Okay, I’m just on my way out the door too. See you soon”. Cameron hangs up the phone, takes one more sip of coffee, picks up a briefcase from beside the table and walks through the adjoining passageway into the garage. Out here, within the secure protection of the gated suburban community, the houses are loosely grouped into ‘cells’. Each house is independent of its neighbors; au‐ tonomous and self-sufficient. Viewed from the air, the arrangement of these groupings are reminiscent of the layout of a computer circuit board. Cameron lives in a modest house located in one of the cell clusters at the edge of the wasteland. It affords him a certain measure of privacy. Through his window he is able to comfortably gaze into the infinite lightness of day, or contemplate the bottomless blackness of night. It is peaceful. Yet, as much as he enjoys the freedom of the suburbs, he really hates the commute. It was a treacherous ten kilometre drive from his house into the core of the city.


VII. Excerpt from INVISIBLE WAVES (PART 2) THE OUTSIDERS

The doors slide open and sunlight floods in. Cameron starts the engine and the car silently glides outside, floating on a cushion of air. The vehicle has an angular, futuristic design, although the rounded headlights, door panels and front windshield are reminiscent of a 1950’s family sedan. Solar panels mounted on the roof provide energy to drive the motor. The shiny black car gleams in the morning light as it swiftly travels along. Particles of white dust fly up from the vehicle, invisible except where they pass in front of the body or obscure the dark shadow hovering under the car. There is no landscape and no horizon, only the remnants of isolated fragments of the past and their shadows strewn across the empty space. Here and there, receding into the distance are the crumbling concrete ruins of the previous civilization and the stripped bodies of abandoned automobiles, their rusted skeletons partially buried, sinking into the whiteness of the sand. Cameron’s breathing intensifies. He nervously runs his fingers through his thick dark hair. Reaching over, he pushes a button on the dashboard panel and a projector beams navigation information onto the windshield. Tilting his seat back, Cameron places his hands behind his head to relax. He watches the map update his position relative to the core of the city - it distracts his attention from the harsh reality of the terrain outside. The steering wheel moves on its own. The vehicle’s autopilot has locked on to the frequency transmitted by a line of small pyramid shaped buoys evenly spaced across the barren landscape. These markers have a distinctive red and white checkerboard pattern on them, and each are labeled with numeric geographic co-ordinates. As the vehicle flies over the landscape, it appears to be ‘jumping through hoops’; phosphor green lines projected on the windshield as a sequence of rectangular boxes are connected like a tunnel, diminishing in size towards a vanishing point that twists and turns in response to the motion of the vehicle. The actual city skyline floats in the distance like a mirage, represented on the display as a grid of electric blue cubes. A flashing light on the dashboard suddenly warned of danger ahead. The location of an abandoned vehicle directly in his path has been picked up on radar by the collision detection system. The hazard is displayed as a block of red text within a bright yellow circle, which is rapidly increasing in diameter. Cameron stares intently through the front windshield as the wreckage comes into view. The carcass has been thor‐ oughly dismantled, leaving only the shell of a stripped car body that has been rolled over onto its roof. It is an ominous reminder of the fate awaiting vehicles which have been abandoned due to mechanical failure, and illustrates the importance of regularly scheduled preventative maintenance. It must have happened recently since the


transports haven’t been out to remove it yet, Cameron considers as he approaches. Impact is imminent, but at the last possible moment his vehicle automatically performs an avoidance maneuver; dodging off the path line, around the hazard, then back on track again. Cameron breathes a sigh of relief. Nomadic tribes of human outcasts roam the night, profiting from the misfortune of travelers and from scavenging the irradiated ruins of the former city which had once extended to this distance from the core. Evaporating under the rays of the rising sun, the ‘Outsiders’ disappear into shelters fabricated from car parts buried deep within the camouflage of the dunes. The white dust raining down from above, driven by the wind - the drifting white dust merging land and sky. The empty whiteness erasing footprints, crumbling concrete, bleaching bones of the fallen and burying the past. He could sense their hidden eyes watching from the shadows. A moment of intense panic grips Cameron at the thought of being stranded out here alone. The fear washes over him in a wave of nausea and dizziness that breaks in a cold sweat. He wipes his forehead with a trembling hand. Disengaging the cruise control, he presses the accelerator down to the floor with his polished black shoe, making the vehicle go even faster. He catches a glimpse of nervous tired eyes in the rear view mirror, as he watches the stripped metal body recede rapidly behind him and vanish into the dust. Cameron scans the familiar landmarks he passes every morning on the drive in to work. Over there, a collection of enormous concrete blocks have collapsed in a random scattered arrangement after tumbling down a small rise. At the top of the hill, all that remains of the original building is a freestanding section of wall with a large open window framing the vacant sky. He pans his gaze out the front of the vehicle, past the electronic display, noticing that the panoramic skyline stretching across the horizon was gradually engulfing the vehicle as it moved toward the central core. Even though the Old City was abandoned, derelict and now lay in ruins, some still preferred to live above ground in the sunshine. Citizens holding leases on fortress apartments were protected inside black monolithic structures which towered above the wreckage. Mirrored windows filtered out harmful ultraviolet rays and reflected the empty white sky. Security was maintained by the Authority. The logo was omnipresent: the pyramid with a single eye mounted in a hovering capstone - remaining eternally vigilant to protect the welfare of its most productive citizens, and ever watchful in detecting any irregularities which could compromise the integrity of the system. Cameron’s vehicle glided silently through an intersection. The streetlights were gone. On the corner, he noticed a large billboard displaying the image of a handsome young man dressed in a technician’s uniform, looking upward into the great beyond. The familiar slogan, printed in large type across the bottom of the image read; “Young eyes look toward the future.” He continued along the boulevard past several compact warehouse buildings surrounded by chain-link fences, security cameras and guards. He turned down avenues where the empty markets were gutted; their storefronts now densely covered with graffiti, their window glass shattered across the sidewalk. The


sound of the city was barely audible inside the car; muffled, monotonous, regular and rhythmic. At this hour of the morning the streets were virtually empty, except for several Authority patrol cruisers or the occasional maintenance vehicle. A pedestrian was extremely rare and usually running very quickly. Clusters of headframes towered above the dusty remnants of buildings which lined the streets on the surface. These towers, housing the mechanisms to plunge elevators down deep shafts underground into the New City, had sleek walls covered with seamless plates of steel. Their smooth surfaces and sharp corners created a cutting edge which separated the darkness from the light in the harsh morning sun. Entrances to these buildings were underground for security purposes. The automatic navigation system now guided Cameron’s vehicle into the base of one of the elevator towers. The girder steel of the headframe's upper storeys displayed the number; 'seven seven seven'. The vehicle glided to a stop and hovered by the entrance gate to the underground parkade. Security was extremely high at level zero of the Atomic Technology building. Cameron kept his foot on the brake while he dug into his pocket for his wallet. He recognized the familiar face that appeared on the small monitor beside the car. In the window was a security guard wearing a stern countenance and a name tag embossed with the word 'McCarthy'. He was heavily armed and shielded behind thick bulleproof glass in a re-enforced concrete wall. In the background of the video image, Cameron noted that McCarthy's partner, with feigned interest, was keeping an eye on several dozen rows of tiny monitors displaying views from remote cameras located every‐ where throughout the building - even in the toilet stalls. “Hello Joe,” Cameron cordially greeting the guard through the video camera pointed at him. He inserted his pass card into the slot, which was scanned to record the time in/out. Joe briefly glanced at the monitor to check Cameron’s credentials. “You have yourself a good day, Mr. Stark.”


VIII. PIRATES

Jurgen paused... it was certainly an odd story, he thought. He flipped open to the title page of the dog-eared draft of ‘Invisible Waves’ to discover that his father had written it in 1973. The date explained the post-apocalyptic sensibilities of the unpub‐ lished novel, since it had been authored during a time when the world was still preoccupied with the proliferation of nuclear arms. Yet, despite the gloomy settings the novel seemed prescient of the future. In many ways Kropton was ahead of his time. Still dressed, Jurgen stretched out on the soft, goose feather quilt covering his bed. He was intrigued that Kropton had used his parent’s actual names. Perhaps Kropton had intended to disguise the biography by exaggerating many of the events in their lives, portraying it as a work of fiction in order to release the novel to the general public. Jurgen was aware that his grandparents had conducted top secret scientific experiments for the US military during the 1950s, but he did not know much more about them than that. He was also curious why his father had decided not to publish the novel. These thoughts slowly drifted away and soon he was fast asleep. The next day at the Akademy, Jurgen sat down at a terminal in the computer lab to see if he could discover any information about Cameron and Adda Stark on the network. He spent a few hours searching public archives for files pertaining to their lives or work but only managed to discover a small amount of fragmentary information. References appeared in several strange files; one document from the mid 1960’s had listed their names among people who had been abducted by aliens during encounters with unidentified flying objects, another mentioned that they had retired and were living in a mobile home in Phoenix, Arizona as late as 1977. Jurgen could find no other evidence to substantiate either of these references. By chance, Jurgen discovered an on-line library, housing the archived editions of a vast array of international newspapers. Someone had taken the time to create a neat array of thumbnails for every issue, each calling up a full size scans of yellowed newsprint whenever they were selected. Flipping through the pages as he traveled back to 1959, Jurgen randomly skimmed stories in the digital archive to acclimatize himself to the time zones as he submerged into the depths. Each article described an increasingly distant and very different world from the one he was familiar with. Eventually he found what he’d been searching for: a banner headline on the front page of a Washington newspaper announced: ‘Scientists Die in Mysterious Crash’. Beneath the headline was a black and white halftone photograph of a young couple standing in front of the open doorway at the tail of an airplane. The tall man, bearing a striking resemblance to Jurgen, wore what looked like a grey raincoat over dark trousers, and a white shirt with narrow tie. His short dark hair was unkempt. Next to him


was a very beautiful Asian woman dressed casually in blue jeans and an Icelandic wool sweater. She had a dark pirate patch over one eye. She appeared to be waving. The photo was captioned: 'The Starks Depart for the Orient’. Jurgen carefully reread the article. It reported that Cameron and Adda Stark were missing and presumed dead after their charter DC-3 went down in the Yellow Sea on a flight originating in Seoul, Korea, destined for Peking. The accident occurred during the evening of November 11th. Senior government officials refused to confirm that the scientists, who had recently been conducting highly classified research for the U.S. military, were attempting to defect to the Communists, although this viewpoint was certainly implied. The article concluded by suggesting that Adda was returning with her husband to her homeland rather than becoming the subject of an investigation under the McCarran Act (a recently introduced Internal Security Act permitting the emergency detention of potential spies and saboteurs). Jurgen couldn’t imagine why the Starks would suddenly choose to ‘defect’ and leave their newborn child behind. He was certain that his father had been born in Iceland in 1959. Jurgen wasn’t disappointed by the results of his preliminary investigation. He knew he would have to dig deep beneath the surface to begin to understand the real story. Certainly if the Stark’s research had been of any significance to the US military, then their activity would have left a paper trail. These documents would reveal the true nature of their research work and perhaps unravel the mystery surrounding their disappearance. He was familiar enough with the network to know that he would have to unpack a few of his special tools to crack open the shell of security in order to reveal the pearls of data locked away deep inside... Some people still refer to them as ‘hackers’; those individuals who use their computer savvy to gain unauthorized access to secured databases in order to discover information unavailable to the general public. Those affiliated with the underground had romantically stylized themselves as data bandits, techno-pirates or digital desperadoes. While network security agencies had often gained media attention by labeling them infiltrators, intruders and spies. These colourful tags, issued from both sides of the firewall, have only resulted in further substantiating the criminality of a primary aspect of human nature; the inquisitiveness to learn and explore - the desire to discover the truth for one’s self. Jurgen was a hacker in the more accurate definition of the term; in that he was continually obsessed with customizing his hardware using modified circuitry, and by the process of writing his own software code. When carrying out clandestine subter‐ ranean journeys within the virtual domain, he preferred to think of himself as a ‘phantom’; an imaginary, unreal presence which could be considered ethically neutral - a being that could pass through the walls of data vaults undetected, leaving the material that it discovered unharmed and undisturbed. During the next few weeks Jurgen would conduct his phantasmal wanderings using the computers in the castle. The Akademy had a large number of connections to the


network which would make his individual identity much more difficult to determine, if through some unfortunate circumstance, his activity had been tracked to its source. As far as Jurgen could determine, the only downside was that the computer lab was patrolled under the watchful eye of Brak Danych, his neighbour, and now nemesis, who had recently exchanged his status as a student for permanent employment as the system administrator. Brak’s demented signature was scrawled over the line at the bottom of every one of Jurgen’s permission slips. All movement of data, everywhere in the network, was continually tracked and logged and correlated; everything left a trace. In order to avoid detection, the first thing that Jurgen had needed to do was to update his arsenal of tools. Since he had been out of the loop for a while and wanted to see what was available, he contacted a few former acquaintances among the elite, who in turn provided him with links further up the food chain. The network gateway to ‘the pirate ship’, as it was called, changed frequently. Only credible professionals were able to contact Captain Jolly Roger directly. According to legend, the pirate ran his operation out of a ghost ship; a small rusty freighter permanently anchored in a cove near the port of T'ai-tung in Taiwan. Entry level access to the server was gained by solving a simple visual encryption, which Jurgen managed to decode after calling up some reference; sometimes letters represented as the waveforms of a sound file, sometimes tiny dots of Braille. This day, the graphic file resembled a patchwork quilt made up of flags from the international code of symbols that are common to all mariners; in addition to representing the alphanumeric characters of the English language, individual flags when hoisted above a ship also conveyed messages such as ‘diver down’, or ‘dangerous cargo on board’, by displaying bold patterns in primary colours which were distinguishable from quite a distance over open water. In this pattern, the signal flags were arranged in a particular matrix representing letters of the alphabet which in turn spelled out a code word to remember. Once inside the gateway, a tattered black flag with a skull and crossed bones filled the screen, animated in a looped cycle that made it appear to be blowing in a virtual breeze. Soon a voice came through the speakers. It sounded as if it had been pirated from a vintage motion picture; “Welcome aboard ye scurvy dogs”, or “I give ye fair warning that all landlubbers will be keelhauled,” and so on... it was all part of the charm. The Captain, obviously with humor, had really played up the theme. He had even employed the metaphor of treasure maps as the interface to a network of mirrored servers located around the world that acted as exchange and drop points for a wide variety of warez. Those worthy would be given the skeleton keys to unlock treasure chests within the various domains; ‘Skull Island’, ‘Danger Island’, ‘Skeleton Island’ , and so on. The more skillful they were at writing code, or the better the quality of what they had attempted to exchange, the more access that they would given to these domains. Secret locations on the map contained the most valuable treasure that were only revealed to the most worthy; the Super_Elite. Jurgen recognized the ‘nyms’ attached to files of several of the computerists that frequently contributed to the vast array of booty available on these boards: ‘Festering Green Beard’, ‘Captain Blood‐


storm’, 'Cosmos Jester', 'Count Zero', and 'Death Dispatcher'. Jurgen had once again chosen to return to his old pseudonym, ‘Captain Beyond’, for his exploration of these uncharted regions. Jolly Roger had developed a broad network of miscreants who shared in the deviance of pursuing high level files rather than commercial software and games. It was an addiction. They were hunters and collectors of data, usually loners, who used the tools onboard the pirate ship to infiltrate systems and retrieve hidden information. For most, the primary reason for gathering data was the pure thrill of exploration and the notoriety of collecting prize specimens as a source of pride and reputation. Their motivation was infrequently driven by material gain. Although, in many instances, the acquisition of proprietary information could certainly be a valuable commodity if successfully delivered to the appropriate customer; a black market of information culled from vast empires of data that had been encrypted and classified as restricted, proprietary, confidential, top secret, and sensitive - the accumulated wealth of secret societies that built their sand castles from a universe of tiny electrical charges then tried to stop the tide from rushing in with no more than the utterance of a few royal commands. The Captain’s ragtag band of buccaneers were held together by the principles of co-operation and mutual trust. They considered the other members to be their peers, and they respected the fact that everyone had to earn the right to gain access to the files. The unwritten code was: honor among thieves. Live by the code, or die by the code. As in the days of wooden ships on the high seas, most modern digital pirates ran their organizations as a democracy, a community dedicated to the rules of liberty, equality, and brotherhood. The free exchange of information and software was intended for the intellectual benefit of computer enthusiasts everywhere. In days of yore, punishments for infractions of the code included; walking the plank, keel hauling, or having burning fuses placed in the ears. These days the penalty was virtual death. If someone didn’t play by the rules, they could be sent a copy of something like the Black Bat Disk Destroyer; a nasty little code fragment that could eat a drive alive, and corrupt all the files within reach of the system. On the other hand, what the Captain did was considered to be above the common law. How he made money from the operation of warehousing one of finest under‐ ground digital databases in the world, and providing access to warez specializing in cracking corporate security, industrial espionage, and information warfare was a matter of speculation, and essentially none of their concern. The folklore exchanged among the mates while they were swabbing the deck was that the Captain particularly prized valid credit card codez that were useful to him in his other ventures. Jurgen had downloaded a powerful cloaking device called ‘Phoenix’ from the pirate board; an extremely compact program which had the attribute of mutational encryption. The code was current; so fresh that scanners had yet to be devised that could detect it. In exchange, he uploaded a pair of tracers named ‘piranha’ and ‘barracuda’; two strains of elegantly compact cruise viruses he had hand-coded in assembly language


to optimize their performance. These unique strains of viral code were not only designed to recognize packet signatures in the data streams and trace them back of their source, but they were also able to emulate the appearance of responding packets that were returning to the host. Imagine that transmitted over the microwave spectrum during every instant, were vast quantities of heavily encrypted industrial and military traffic - each consisting of a fragmented stream of tiny packets encoding information. Jurgen’s predatory creatures were able to hijack some of these packages enroute and strip out the identity information they contained; essentially swapping the shipper and receiver address labels. It would then replace the packet’s payload cargo with the encrypted data that Jurgen created and return it to the sender. These packets quietly slipped across the border like a Trojan horse wheeled inside a defended fortification. They bypassed the packet filters in the gateway routers located along the perimeter of the network boundary by fooling the filter into believing it was merely receiving a response to a message that had just been sent. Inside the system, these tiny packets were reassembled, transforming themselves into a custom search agent in less than five seconds. The agent quickly explored the root of the system, gathering data on user’s identities and their password codes before once again deconstructing itself into component parts. The newly acquired identity informa‐ tion was generated into packets for transport by the tiny, stealthy phantom marine creatures, who had the ability to use ESP; an encapsulated security payload to which only Jurgen held the decryption key. These packets were addressed to randomly generated ports of servers that Jurgen had specified, with each packet taking a different path through the network. As they moved out into the data streams they erased all traces of their existence behind themselves, vacating the storage location they had recently occupied. These creatures were conducting similar activities, occurring simultaneously at several other locations on the network as they rapidly traveled around a world with no boundaries. From the sanctuary where they had gathered, Jurgen harvested the data from his creatures; a collection of identities and passwords which now enabled him to enter the host systems as a registered user. Protected by Phoenix encryption, he had become an anonymous specter; a quicksilver invisible surfer streaming through the optic fibers along digital pathways that he shifted around him like a maze - linking, disconnecting, leaving trap doors behind him, erasing his trail as he went. To create this deliberate confusion of intention and identity required ingenuity, skill, determination and luck. ‘There is no try.’ The elaborate precautions to maintain the illusion that the phantom did not actually exist were vitally necessary since the risks were very grave. Getting caught would mean expulsion from the Akademy, being arrested, or perhaps worse. Although, there was one creature able to detect his presence wherever he went throughout the network; a pet program he had called ‘Black Dog’ - a faithful compan‐ ion that accompanied him along the trail. Jurgen had designed it to act as a sniffer program. If it detected the presence of a signal tracking him or logging his journey, it would generate a warning signal. By the time Jurgen had heard, “Hey, hey, mama, said the way you move...”, a sampled Led Zeppelin song that was audible through his headphones, he would have already taken evasive action. In the meantime, Black Dog


would have raced off to trace the trace. When Jurgen got back on-line, Black Dog would find him, bearing information specifying the location of the security surveillance source and details of who or what had been tracking him - keeping one step ahead of the ghost-robots. As much as Jurgen loved the thrill of navigating the network’s vast universe, and the challenge of using his intelligence and weapons to defeat the strange creatures he encountered, the real adrenaline rush didn’t kick in until he was finally able to, metaphorically, touch down on the surface of a distant planet. In like sin; it was surprisingly easy to penetrate most security shells. All information is vulnerable nothing is secure! The only sure way of protecting data was to completely destroy all traces of it. Yet, as easy as it was to infiltrate these databases, it was extremely difficult to find what he was looking for. As an analogy, imagine trying to find a person located somewhere within a very large city that you have never been to before, they may be either moving or stationary at any given time, and initially you do not even know their name. To track them you must be discreet; you cannot speak with anyone in this city, and you must not be seen. To make what is difficult sometimes almost impossible, was that when you discover the person that you seek, you must find a way to read the thoughts within their mind. Even with Jurgen’s arsenal of special tools, this often took a very long time; requiring him to return to his task night after night, and to minimize detection, never returning to the same location on consecutive occasions. Inside, after he had updated an existing ‘authentic’ identity with extra privileges, he was able to assume that identity to move throughout the system as a 'super-user'. The sense of freedom and adventure was greater than anything he had ever experienced in the real world. As he explored the dark and dusty corners at the deepest levels of protected servers, he discovered hidden archives that contained ancient databases that were so secret that even the people storing it had likely forgotten of its existence. He skimmed the documents pointed to by search agents he deployed, pausing to read a block of text when a word or phrase happened to catch his attention. This is the way information is absorbed in the digital age; no one has time to read the entire contents of anything. Jurgen typed very quickly. He had taught himself to initiate command sequences in many international languages, in addition to almost all the standard variations of computer operating systems. Each followed the familiar patterns of formatting, syntax and protocol. After all, code is code. Whenever he came across an interesting file, he copied it, encrypted it and bundled it into packets to send back home. While Jurgen roamed the stacks inside, the Black Dog, waiting patiently for its master to return, patrolling the perimeter of the system, alert for the presence of any danger which the clandestine shipment of packets exiting the host's data warehouse might attract. Jurgen was always aware that the clock was running. The window of opportunity within a system lasted for only a relatively brief time; the longer he took, the more the likelihood increased of being detected. Exces‐ sive use of an account would soon exhaust the allocation, thus depriving him of the privilege of future access. So, before he left, Jurgen cached new passwords to use if ever he returned.


Late at night, if it was a complicated 'creep', many hours would pass before he found an island of sanctuary in the turbulent sea of data. He often returned to reality with red eyes and fragments of aberrant data still dancing in his head; hard dreams integrated into the fabric of the outsider’s world. He rested his eyes in his cupped palms for a few moments. He took on some fuel in the form of Punjab purée with mango chutney, carrot juice, or cold lentil soup that he had picked up in the cafeteria hours before. He opened his soft bound journal that he always kept with him to note down network addresses and keep track of passwords and the locations of secret entrances. He needed to record the information while he still remembered it; densely covering the pages in cryptic pencil scribbles that were nearly indecipherable to anyone but him. He downloaded the data that he had recovered during his mission onto a remov‐ able storage card; read/write/verify at fifty megabytes per second - all the files in the blink of an eye. He slipped the cards into the deck containing his own software, picked up his portable wireless drive and his notebook and dumped them into his backpack just as Brak came around on patrol. Living in the village, Jurgen had either needed to return home before curfew, or spend the night in the lab. Jurgen erased his files from the system, hopped on his scooter, and raced down the hill back home.

IX. THE PLAGIARIST

"I’m surprised that you made it this far..." The journey through the marshlands had been recommended as an ‘interesting’ route to Dr. Planchette’s house, which was, apparently, located in a secluded forest some distance up the narrow valley. Jurgen discovered that it was a perilous journey once the sun had set and the thick clouds blotted out the sky. He attempted to illumi‐ nate the indistinct trail with a flashlight, only to become disoriented several times and find himself plunging into mud well above the knees. The evening was cold and he began to shiver. At one point, fearful that he might become hopelessly lost, he called Marcel using his cell phone. The reassuring voice in the tiny speaker instructed him to turn to his right once he reached the bleached cattle skeletons. Discovering the bones, Jurgen turned, and made his way up the hillside from the swamp, following a path through the dense forest. Soon he emerged into a clearing. Soft, warm light flooded from the windows of a tiny house, illuminating an enormous black dog which stood


before him on the path. Both he and the dog stood motionless, silently confronting each other for some time as if trying to determine what the other would do. Marcel, who had been watching like a shadow in the darkness, suddenly called out in greeting from the porch, adding, “Don’t be afraid of Cerberus. If your soul is pure, he is as gentle as a lamb.” Jurgen continued toward the house, pausing briefly to allow Cerberus the opportu‐ nity to sniff at his crotch. The massive animal was large enough for even Jurgen to ride. “I’m surprised that you made it this far. Just look at the condition you are in,” Marcel said, shaking his head. He placed a hand on Jurgen’s shoulder and guided him into the house. “Now that you’re here, I’m afraid you will have to spend the night. Come join us, we are just about to have supper.” Jurgen who was cold, tired and hungry, gladly accepted the offer. While the exterior of the house was typical of any other in the village, the front entrance formed a passageway to a strange interior. Marcel was a collector of a miscellany of items from the past, which he later explained were the earthly posses‐ sions of souls who had departed this world and which he had recovered inexpensively from estate sales and auctions. Arranged on shelves, as if it were a warehouse, were labeled cardboard boxes filled with parts from alarm clocks, lawn mowers, movie projectors, microwave ovens, sextants, sewing machines and even an x-ray machine. There were ancient medical textbooks, toys, tortoise shells, umbrellas, bird cages, fishing nets and a framed collection of preserved centipedes. Everywhere that he looked around the room were also a variety of strange, exotic plants that seemed to have sprouted from pots and jars and old brass diving helmets. Jurgen stood in the doorway for several moments, unable to move, astounded by the densely cluttered environment he had entered. “Take off your pants and stay awhile,” Marcel suggested, “I’ll see if I can find you something to wear.” He exited the room. Jurgen’s pants and shoes were encrusted with sticky, black mud. He struggled out of them and placed them in a pile on the floor, then hung up his coat on a peg near the door. Just wearing a T-shirt, (he never wore underwear), he covered himself with his hands and walked barefoot into the room. For several moments he examined the exotic items while he waited for Marcel to return, but to his surprise, it was Marcel’s wife who entered. “Hello”, she said enthusiastically, “You must be Jurgen. My name is Angelique.” She extended her hand in greeting. Jurgen instinctively reached out and shook her hand. “Oh,” she exclaimed as her eyes glanced down, “I would really like to have you pose for a portrait.”


With a profound sense of déjà vu, Jurgen suddenly recognized her; it was her body that Marcel had sculpted in the dungeon and it was her head that Jurgen had held in his hands. At that moment, Marcel returned to the room. “I see you two have met... I don’t have any clothes in your large size, but you can wear my house coat.” He handed it to Jurgen, who was grateful for the concealment that it offered. “Shall we eat?” Marcel led the way to the rear of the house, followed soon by Angelique and Jurgen. The small kitchen was rustic, yet soft and feminine; decorated to be pretty. It was cluttered in a similar manner to the rest of the house; filled with cooking utensils, appliances, jars of spices, knick-knacks and a variety of flowering plants. Green glass cloches protected the tender sprouts. Angelique added hot water to the basin under the old hand pump so that Jurgen could wash the mud off his face and hands. The washstand had the clean smell of strong soap, and the towels had the freshness of having been dried in the air. The table at which they sat was covered with a white cloth embroidered at the corners with red poppies. A number of enameled pots were boiling or simmering on a large black cast iron stove. The meal started with hot soup and liver dumplings. When the bowls were cleared away, Angelique brought out the main course which consisted of a roast goose with carrots, moules marinieres, foie gras and heavy dark rye bread. For desert they enjoyed freshly baked poppy-seed rolls and a bowl of spiced plums. They sat and talked after the meal, drinking plenty of the excellent brandy that Marcel had imported from France. During their conversation, Jurgen discovered that Angelique was a painter of some renown; having exhibited her work in galleries throughout Europe, the United States and even as faraway as Canada. After they had finished eating, she offered to show him her studio. They exited the kitchen and passed through several other rooms filled with a large quantity of objects and plants before climbing a set of narrow stairs up to the attic. The studio, in contrast to the rest of the house, was a large uncluttered space under a pyramid shaped roof. As they talked, Angelique explained that she and Marcel had spent most of their lives in Paris, but during her time in the Czech Republic she had discovered, and become an ardent admirer of the Surrealist painter Jan Zrzavy. Angelique claimed to have originally been inspired to start painting after seeing the work of Leonora Carrington and Dorothea Tanning, both of whom had been wives of Max Ernst. “Is it possible that you are related?” she had asked Jurgen expectantly, her eyes glowing with excitement. “No, it is impossible,” Jurgen calmly replied, “My last name is entirely fictitious.” He surveyed the completed paintings stacked against the walls of the room and studied the work in progress on the easel. The subject matter, predominantly themes


of love and death; the extremes of passion, were typically depicted as a naked human form interacting with a variety of objects; padlocks, wasps, gears, levers, fruit, lizards, scissors, false teeth, candles, a chalice filled with blood, or numerous religious icons, aesthetically arranged within an organic abstract landscape. The human figures were highly realistic; represented as ordinary body types - creating the impression that actual people had posed for the paintings since Angelique had not attempted to conceal their blemishes, folds, scars or wrinkles in any way. Jurgen began to imagine how his body would be portrayed if he took Angelique up on her offer to immortalize him in oils. At that moment, Marcel came thumping up the stairs, interrupting the painting that had begun to form within Jurgen's thoughts. Now anxious to show off his own workspace, he encouraged Jurgen to follow him outside. Jurgen wrapped the night‐ gown tightly around himself to protect himself from the cold, attempting to keep up with Marcel who walked rapidly; leading him down the garden path toward a small shed nestled in the forest at the back of the yard. A fire that had previously been lit within the workshop stove had made it warm and cozy inside. Jurgen discovered the workspace was even more chaotic than the interior of the house had been; material was heaped into piles rather than neatly filed away in boxes. The most organized part was the collection of craft tools from a wide variety of industries that hung from large nails driven into the wall. He was certainly resourceful, Jurgen thought; he seemed to be able to modify anything that he needed to suit his purposes. There were strange machines everywhere - in various stages of completion; a robotic floor polisher with a metallic body shaped like a cockroach whose articulated legs terminated in circular pads, a lamp consisting of the decapitated head of a stuffed owl rotating atop a large metal urn with eyes that beamed intensely like a lighthouse beacon, some kind of chopping device with a windmill of cleavers, and several tiny mechanical spiders on a workbench whose visual recognition system had been developed from the electronics of discarded instamatic cameras. “Those are just toys; experiments, trial and error, an attempt to determine if the juxtaposition of disparate elements will evolve into something that is meaningful,” he muttered, dismissing them... over here, now this was what I wanted you to see.” Marcel and Jurgen cautiously approached an object at the far end of the room. The clutter had been pushed aside to make space for a metal table supporting what could best be described as a shrine. It was an intricate assemblage of numerous silver metal components connected to what appeared to be an industrial-size espresso machine. Each of the pieces had been cleaned and polished to a bright, metallic gleam before they had been welded into place. The bulk of the structure was mounted on a circular arrangement of eight, short angular legs. The body was comprised of a large cylindri‐ cal stainless steel tank with numerous thin metal tubes emerging from it, forming tightly coiled segments. The longer curved lengths, which ran over and through the assembly, seemed to feed back once again into the main tank. One of the larger tubes, which curved out from the front, had a clear glass gravity gauge to view the level of fluid in the tank; a thick, rusty brown liquid that came almost up to the marking labeled ‘full’. Rising from the top of the construction was a polished metal sphere from a Van


de Graff generator. “I’m not going to turn it on,” Marcel declared. “It’s a complicated procedure, and besides, to operate it you must be spiritually prepared.” Jurgen leaned in to take a closer look at the components as Marcel pointed them out. There was a sewing machine motor, a short wave radio receiver, coloured strands of wire, a transformer and some tubing from a television antenna. Resting on a small platform attached to the left side of the tank was an automatic writing device; a pen plotter which recorded the waveforms of the frequencies captured by the receiver. At first glance it had not looked very finely crafted, but upon closer inspection, Jurgen noted that all the components had been precisely calibrated. Marcel unlocked the pen from the restraint, and demonstrated its sensitivity. A movement of hummingbird grease and extremely tiny ball bearings had reduced the pen’s friction to practically zero. Marcel explained that the assembly was a perceptual apparatus which, he assured Jurgen, was able to authenticate communications with the spirits of the dead. He summarized its operations simply; the Van de Graff generator creates a constant energy field which is sensitive to interference caused by any external source, in this case, contact with a ‘spirit’. Minor variations in the field are channeled through the short wave receiver which converts the energy fluctuations into signals of various frequencies. These signals are amplified and transmitted to an ‘ideomotor’ controlling the plotter which graphs the waveforms onto a continuous scroll of paper. “Miracles are made from the most unlikely ingredients,” Marcel proudly exclaimed. “What’s that fluid in the tank?” Jurgen asked. “It’s human blood.” “Human blood? Where do you get that?” “Well... some of it is mine,” Marcel casually replied. “It seems to be a necessary component for the successful intervention of the machine.” “This apparatus has been a labour of love during the past several years. The material for each of the components has indeed been carefully selected, and assem‐ bled with utmost precision to ensure that every source of error is eliminated. I am constantly adjusting and refining it to produce consistent results. It’s not likely that you will take my word that the machine actually works, but I will demonstrate its operation one day soon. For now, I would like to show you the results from a recent session.” Marcel unrolled a length of paper that was wound onto the take-up reel of the scroll. “These are previous messages, transmissions of information, diagrams that reveal the truth. The frequency and characteristics of the wavelengths conform to an alphanumer‐ ic code.”


Jurgen followed the path of the graph from left to right along the sheet. At first the line had only wavered slightly; indicating a low level of random ambient noise. But further along, a huge spike was suddenly scrawled across the paper, which Marcel explained had been the moment that the spirit had first made contact. For several meters past the initial spike, an oscillating pattern had emerged; sequences of smooth waveforms of varying amplitude, spaced at regular intervals. These continued until another large spike marked the termination point when the spirit disconnected. “This information is communicated extremely rapidly - in very short bursts. You can see the consistency of the shapes which repeat themselves; for example this repre‐ sents an ‘s’, and this represents an ‘a’.” Marcel quickly jotted down the corresponding letters with a pencil along the sheet of graph paper. The notation certainly matched the distinctive shapes of the waveforms. Jurgen was now able to read the fragments of cryptic sentences: “... safe haven for those who are dancing in the sun ... his opponents try to evade his light ...” “I have a lot of these recordings,” Marcel said, as he patted the large roll wrapped around the cylinder. “It has now become easy to decipher the code, but it is still very difficult to interpret the meaning of the information that is revealed. Also, I am not always able to maintain contact... I have to concentrate very hard." By the time they returned to the house it was very late. Angelique was already sound asleep. As they passed a closet in the hallway, Marcel gave Jurgen an armload of blankets and pillows; he would sleep on the couch. While Jurgen prepared his bed, Marcel had left the room, returning a short time later with the remainder of a bottle of wine from supper. He pulled the cork out with his teeth, poured them each a glass, then sat in a chair by the fireplace while Jurgen curled up under the covers. The only light in the darkened room came from the flickering flames. Marcel raised his glass in a toast; the sparkling fire light refracted like rubies from the depths of the burgundy wine. Marcel spoke softly, “Ambrosia... the soul of poets, the blood of the moon, and the divine cure for all that is evil.” He smiled, “Here’s to the hermeticism of technology; the alchemy of creating life from the grains of silicon sand ... here’s to the purity of data; the elixir of life.” Jurgen carefully observed Marcel’s hands for the first time. They were muscular and sinewy, gnarled veins rippled under the surface of his pale skin, the fingernails were long and discoloured. His powerful hand contrasted the fragile delicacy of the fine crystal glass he clutched within his grasp. After they had both taken a drink of their wine, Marcel slid open a concealed drawer in the low table in front of him, withdrawing a block of hashish that was about the size of a bar of soap. A colleague had sent it to him from Amsterdam, a man named Dr. William Thomson, “Perhaps you have heard of him?” Marcel asked. He took out a butane lighter and heated a corner of the slab, crumbling a large chunk into a simple soapstone pipe, then set fire to the resin and inhaled deeply. He passed the pipe over to Jurgen who also took a hit, but unable to


hold it in his lungs, gently coughed out clouds of cool blue smoke. “The time has come, the Walrus said, to talk of many things...,” Marcel burst out in hearty laughter... “According to Rimbaud, ‘the derangement of the senses is the first step to becoming a poet-seer’...,” Marcel inhaled another load, “... and from what I understand, this may be true in Zen Buddhism as well. Marcel explained: “When we lock ourselves into perceiving events in a certain way, we permanently fix our perspec‐ tive, gradually building a permanent model of reality to which every subsequent event must conform. This is when creativity and imagination, the blessings of childhood, begin to fade away. Before we can generate a more complete understanding of new sensations, it is necessarily to scramble our codes, to blast our preconceived notions into fragments and let them blow away like dust. Our concepts, similar to every other process within the cycle of nature, must originate, mature to serve some useful purpose, and then... ” Marcel’s voice trailed off. He sat silent for a few moments, then put down his pipe and poured another glass of wine. Jurgen hadn’t touched his. He was beginning to feel the effects of the hash; relaxed and pleasantly comfortable, wrapped in blankets on the couch he hoped Marcel would continue expressing his interesting and unusual ideas. Marcel suddenly smiled broadly, as if reading Jurgen’s thoughts. “I am a plagiarist!,” he proudly declared. “Unlike almost everyone, at least I will admit it. I use whatever I can, whenever I need it; if something already exists why should I reinvent it? To plagiarize Isador Ducasse, the surrealist author, “Plagiarism is necessary. Progress implies it.” This is a reference to the fact that progress is built upon a foundation of tradition. Without knowledge of the past, the future has no reality. Artists and scientists, for instance, draw their inspiration from everything that has preceded their work, carefully examining the concepts which already exist, appropriating elements which are proven to be true and discarding those that are based on false assumptions. It is an editing process in which ideas are refined as they evolve toward a more advanced state. And since they seem to naturally emerge at the most opportune time to meet the requirements of global humanity, they are therefore perceived to be of great value.” “Nevertheless, as the saying goes: 'timing is everything'. It is only the first who stake their legal claim to a concept that are able to register as its owner. No one remembers those who toil in isolation, working independently for many years to form a theory, or build an invention, only to discover as they near completion that someone has already beat them to the punch. It is even more distressing if that first concept, rushed to market as a packaged product, is poorly considered or less carefully crafted than the solution to the problem the second has managed to elegantly resolve. The second, a more intelligent and practical approach, perhaps of greater benefit to society, will be blocked in the courts, in writs and record books, where everything that is knowable, eventually becomes ownable; the attorneys and accountants ensuring that there is always something to sell. Proprietary knowledge; the currency of the digital age, only be‐ comes a valuable commodity when the data is encrypted and securely locked away. In the pursuit of knowledge, those few who own the facts, possess the power over the greater masses of humanity whose ignorance makes them easier to manipulate and


control. Of course it is an illusion, but nonetheless a consentient illusion, as almost everyone eventually becomes indoctrinated into believing that for a certain price, anything can be bought or sold; an idea, an object, a territory, and ultimately, even the human soul.” Marcel inhaled a soapstone bowl of hashish before adding, “You must have read the story of Dr. Faustus and you know what happened to him.” Jurgen smiled, “He got more than he bargained for ... it was a hell of a deal.” Marcel laughed momentarily then returned with more seriousness to the point of his argument, “It is dangerous to attempt to contain something that one does not have the ability to control. Captivity breeds violence; the monsters and demons of myth and legend, poisoned with vengeance, become lethal adversaries when they finally make good their escape. Sometimes it may take centuries, but eventually they always gain freedom. From my experience, the only way to deal with forces that are considered ‘evil’ is to acknowledge their existence and treat them with respect.” “Those are creatures of the darkness, which is one matter, but not unrelated to the people that I have been discussing; those who attempt to confine the source of all light. Truth, beauty, justice and equality are as essential for our survival as our need for oxygen and have always been the most valuable properties that those who long for power are anxious to contain. By depriving the population of these elements, they are able to parcel out small quantities in exchange for obedience and subservience, or in reward for any other objective that they hope to achieve; to assist them in building fortresses or attempting to block the natural course of streams.” “Yet, they are only fooling themselves. No matter how they attempt to shackle it, the truth will eventually be set free, either as a revolutionary solution to bring about an end to total oppression, or through the subversive activities of technological infiltrators who penetrate the storehouses and disseminate the data they have discovered. If they are wise, they will eventually become aware that it is the unlimited source of everything they desire, if they develop the ability to perceive. Nothing is new; everything already exists, it only needs to be recovered.” While Marcel had been speaking, Jurgen glanced at the nearby cabinet in the darkened room trying to discern the titles of the antique clothbound books. They were mainly French editions. Jurgen noted that the collection included works by Baudelaire, Jung, Goethe, Alester Crowley and Edgar Cayce; authors which had certainly influ‐ enced the programming of Marcel’s mind. “Many writers eventually become aware that all literature is derived from one ageless source,” Marcel continued, “plagiarized, if you will. Those talented authors who are in communion with what they call their ‘muse’, are granted the vision to perceive and understand portions of the code; the logic of the collective soul, and are granted license to transcribe this information and weave it into the narratives which


they feel most important for them to express. Poets, artists, scientists, philosophers, mystics and fools, with discipline, or more likely with purity of soul, are able to ‘read’ from the ‘Book of Life’. Others refer to it as the Akashic Chronicles; a record containing the entire history of every soul that has existed since the dawn of creation. This energy is all around us, swirling like an invisible storm, a moving, shifting force that is detected by clairvoyants as spirits and ghosts, an energy that is able to enter the embryo within the womb at the moment of conception, sometimes experienced as the sensation of an electrical spark.” “Karma, rebirth within the wheel of life - the soul of the foetus begins with a packet of energy, delivered from out of this Somniferous Aether. A cycle in which adaptation to the future is based on past performances. Energy... data... soul... a non-physical entity, or if you will, an immortal ‘consciousness’ which is able to exist without a body, until certain conditions shift into alignment, or at a certain moment in time, when this entity is called upon to inhabit and interact with a human body in order to determine the essence of that individual. Is it recursive, or more like a computer program loop endlessly executing a subroutine, from which the only escape is the ability of the soul to achieve the ultimate bliss of the state of nirvana? The philosophic concept of a soul is the foundation for all lucrative religious industries, and also the basis for many superstitions. Perhaps, as some believe, it is the Akashic Records that connect everything; those who access the Divine Mind are able to penetrate the mist of mysteries, to glimpse the eternal origins of all past events, even those whose mean‐ ings have vanished with the passage of time, and perhaps they are able to understand the ever-changing fluid array of possible futures that are called into potential whenever we interact and learn from the data that has already been accumulated. Perhaps this is the source of inspiration for every dream and the blueprint for every invention.” Marcel got up from his chair and went over to the fire. As he shifted the position of the logs with an iron, showers of sparks shot up inside the stone chimney. He replaced the poker in the bucket to the right of the fireplace then hunched down next to the fire to warm his hands. “Energy exists; it cannot be created or destroyed, only transformed,” he said quietly, then for several moments he was silent as he stared into the new flames which had come into being as virgin portions of the partially burnt logs came into contact with the heat of the glowing coals. Deep in thought, he slowly stood, took a few paces into the darkness of the room, becoming a shadowy presence, then, as he turned toward Jurgen, only the flickering flames reflecting from the surfaces of his eyeglasses defined his position in the room. “When I was very young child I became aware that I was able to receive signals from ‘out there’; I heard voices, saw visions and received information transmitted directly into my thoughts. Similar to the way that dogs are perceptive of frequencies that humans cannot hear, or that bees are able to see ultraviolet light, my innate antenna was fine-tuned to the sensitivity of the metaphysical universe, or the spiritual realm of the Akasha.” He emerged from the darkness and returned to his chair in the light.


“This natural gift that I had been blessed with caused a great deal of difficulty at home. My father, a Roman Catholic priest, became concerned about the unusual thoughts and ideas forming in his intelligent and highly sensitive young son’s mind. “Communication with the dead is a sin,” he would shout, “It is forbidden by god.” Whenever I so much as mentioned one of the many topics forbidden to be discussed in his house - anything that he considered to pertain to mysticism; the occult, tarot, astrology or other hermetic subjects, he would punish me cruelly with a whip and force me to read passages of the bible as penitence... I have scars on my legs and on my back from his many viscous attacks.” “On the contrary, my mother was a kind, loving woman; frail, subservient and terrified of my father. She catered to his every desire and was forced against her will to join in his condemnation of me. In his increasing dementia he had gradually con‐ vinced himself that I was possessed by demons, and several times conducted exorcism rituals in which I was strapped to a table, deprived of food for several days and periodically tortured by the melted wax of candles. I was about ten when my mother died in a car accident. For my father, the loss of his wife had been devastating. Convinced that my evil had been the cause of the accident, I became the target of his rage and many times was beaten mercilessly, often until I lost consciousness. By that time he had begun to drink heavily to erase the grief, eventually reaching a state in which he was enveloped by a sinister fog of his own design. His inability to function resulted in extended hospitalization due to mental instability. I was placed in a foster home when I was eleven and quickly became terrified of my adopted family’s devout religious fanaticism. It seemed like it was all happening again; I just had to run away.” “My childhood ended then. I began the process of repairing my life and reaffirming my faith in human nature, growing up in the streets of Paris. Although, I am certain there are worse places in the world to scavenge a living and rely on the kindness and charity of others. Soon I found some work, my own apartment and eventually I had returned to school. Throughout that entire time, and even to this day, the only way that I was able to survive was that one of the guides came forth to act as my Guardian Angel; it was the spirit of my mother!” Marcel crumbled another chunk of hash into his pipe, breaking it apart with his long fingernails. “From my personal experience, religion for most Christians isn’t about spirituality. It seems to be a matter of understanding a set of moral codes that are enforced by an omnipresent authority who sits in judgment of sinners and is capable of inflicting pain and suffering, and ultimately casting us into the fiery pits of hell as punishment for failing to obey the rules. What I am interested in sharing with people is Enlightenment; to facilitate the ordinary human’s contact with the spirit world. That is spirituality; that is the force which is greater than ourselves, from which we gain understanding of the true nature of harmony, joy and strength. When I was a child I could enter this state frequently and easily, but as I matured, and as the ‘reality’ of our physical world surprinted its programming onto my mind this state has become more difficult to attain. Through the discipline of controlling the mind through the practice of Yoga, I have


learned to master the ‘Body of Light’, an astral body which enables my consciousness to pass through the veil of the world of illusion and unite with the Universal Mind. The human apparatus is the best instrument. The apparently limited range of our senses can be extended magnificently with training, but unfortunately most of us do not have the initiative or discipline to spend the time mastering the necessary skills.” Marcel fired up the soapstone pipe then passed it to Jurgen. “Of course there is the fear,” he continued, “the fear of evil, or more importantly, the fear that is the basis of the whole pyramid of skulls - the fear of freedom. Socialism and democracy are illusions of the poor since they require that knowledge and decision-making ability are shared equally by every one of the citizens. Many of these people become afraid when the faith in their own perceptions are tested and are more than willing to exchange their freedom for the satisfaction of a secure place within the hierarchy of a structure, and are relieved when they are able to relinquish control over their lives, shifting the responsibility to a god, a boss, or a big brother who will make their decisions for them. When I say ‘the poor’, I refer to those who equate power with money and who believe that they will never possess either... which is true, because one is given and the other is taken away the moment they relinquish control to their ‘superiors’.” “We can all benefit by developing the skill of critical thinking; by placing rational thought above superstition and religious belief. You and I, as scientists, are able to examine phenomena objectively. We are skeptical of paranormal events, we rigorous‐ ly test out the rules and explore alternate explanations, empirically establishing a foundation for concepts we hold to be true. We can conceive of particles that exist at an atomic scale; molecules, atoms, electrons, photons, neurons and so on... Yet, at the same time, among the general public there is a decreasing respect for knowledge, and a general distrust of technology. For some people, science is equated with black magic; fanciful superstitions arising from ignorance in coping with the anxieties caused by the unpredictability of the natural world. It is ignorance encouraged and influenced by mass media in all its forms; in which each source is continually broadcasting messages that are beamed throughout the world. We are told what to believe and these notions are reinforced with attractive visual displays that makes it all seem real. We desire it, and we are forever attempting to attain it, yet it is always just beyond our reach.” “When people become immersed in the world of illusion, everything seems real, yet at the same time, nothing is real. It is a virtual existence in which people become disconnected from the source of all knowledge and spirituality. The source of the memory is forgotten. Emptiness. There is no tradition, no identity, no truth. We are the hollow men. Where do the humanist values of enlightenment, harmony with nature, liberty and equality fit into the equations that compute our models of the technological world? It becomes futile to appeal to the intelligence of those brutes. They are no better off than livestock or sacrificial offerings waiting their turn to appease their gods. I for one do not want to live in a slaughterhouse that is run by the machines.” “By developing the means of becoming adept at creating a perception of regions


which exist beyond the senses; call it the Unknown, we become aware of divine intervention. We become enlightened to the existence of ‘celestial’ beings; the spirits or angels who act as ‘Guides’, creating a communion with a state of consciousness which can open the gateway to access the knowledge of all time; the past, present and the future; the collective unconscious containing a record of all events, actions, thoughts and feelings that have ever occurred and ever will occur, and will never be forgotten. What is necessary is to understand that the world belongs to the dead. By that I mean our departed ancestors who created the world we have inherited.” Jurgen yawned as he sunk deeper into the cushions of the couch and wrapped the blankets more tightly around himself. His attention to Marcel’s monologue alternated between fascination and distraction. Whenever certain words had triggered his interest he would listen more attentively, only to find himself gradually slipping away into his own thoughts during the intervals in between. Marcel now emptied the last of the wine into his glass. “It’s getting late, and I see that you are tired,” Marcel observed. “Much of what I have been talking about might not seem important to you right now, but I have glimpsed into your future Jurgen Ernst, and the guides have indicated that it will be your destiny to understand the importance of these matters for yourself. Today has just been one short chapter in your life, and I wanted you to know that it is a privilege for me to play the part of one of the characters in that story.” “We are similar in many ways. My life is the story of a man who has pursued a dream for many years; the dream to use technology to create a mechanism which functions as a datalink with the collective unconscious. To build a machine which can harness the isolated units of data which flow from the source and structure them using the pattern-seeking processes of a powerful computer processor. Knowledge convert‐ ed into algorithms; the calculus of logic. I believe that by connecting these clusters of eternal memory patterns that are drifting through the Universe, it will one day be possible to create a machine which will enable anyone to access their own personal ‘Guides'; a source which they are able to consult to provide them with information, leadership and direction, comfort when they are lonely or afraid, and even to reveal the possibilities for the future which could give them hope.” Marcel finished his wine, then set the crystal glass on the table, generating a soft musical note as it came to rest on the stone tiles. It was a tone which lingered, endless‐ ly sustained like a gently echoed ring. “It is a story, appropriately, that ends in mystery.” Marcel laughed softly. Noticing that Jurgen’s eyes had closed, he continued in almost a whisper, “And perhaps the central character in this story was a being from another planet, or possibly one who had traveled back through time from the future, since one day it was discovered that he no longer existed, and perhaps he never had.” Jurgen, almost asleep on the red leather couch, wondered if he had dreamt the final words that Marcel had spoken, since soon the voice had faded away, replaced by sequences of fantastic imagery arising from his subconscious...


X. SNAKES + LADDERS

The revelation occurred to him as he returned along the trail through the swamp the next morning after breakfast with Marcel and Angelique. The path, which during the previous night had seemed like an illusion on the terrifying journey through the darkness, was now clearly obvious as he made his way through tall, dry brown grass, past rotting stumps, and over outcroppings of rock in a scene which seemed pleasant in the light of day. The path had not changed, only his perception of it had. As he thought about this, Jurgen realized that this path was a metaphor for the two forces which had initially seemed to be pulling him in opposite directions. Both Master Bronchev and Marcel Planchette had requested that he write software for them. At first it had seemed that he would have to choose to work on one project or the other - a very difficult decision, but as he considered the situation he realized that both of them wanted essentially the same software, which would then be used for purposes of their choice; to guide corporate management, or to communicate with the dead. Jurgen passed a location where imprints of both his hands remained in the dark black mud beside the path. He signed his name beneath the indentations with a stick, replicating an image he had once seen in a magazine depicting the way that famous movie stars are honoured by leaving their mark along Hollywood boulevards. It was Sunday; he could hear the distant church bells as he climbed the stairway to his apartment. The harvest had just been completed and it was a day of rest in the village, but Jurgen was anxious to get to work. He changed his clothes, still muddied from the hike, hopped on his scooter and drove up the hill to the Academy. For the next twenty-four hours he worked almost non-stop. He felt inspired. Creating the base code for the artificial intelligence program was territory that was familiar to him. His plan was to create a modular program in which custom components could be plugged into the base code, swapped out or adapted to the needs of the program’s application. He called up his own previously authored software from his storage drive, augmented with fragments of open source code that were readily available on the network. Someone, somewhere had already written program software that did nearly everything imagin� able, if you knew where to look for it. The key was to examine the code and completely understand it, then modify it and insert it in to the project at hand. It was a tedious waste of time to enter the thousands of key strokes which comprised a common subroutine, or even to use voice entry, when all that was necessary was simply to copy and paste. He laughed to himself as he thought about Marcel’s recent diatribe against the corporate conception of plagiarism. The familiar windows containing text boxes were arranged on the plasma display panel in front of him. A row of brightly coloured dimensional icons were aligned along the right side of the screen, the menu bar across the top. The familiar scene was


deceptive in its simplicity. The clean and efficient layout provided immediate access to the various tools which enabled him to manifest and record his thought process. The screen was an interface between his brain and the internal hardware of the machine; the two locations where the real activity took place. Jurgen was anxious to complete the mechanics of the underlying structure. Once it was built, he could focus on the more enjoyable creative process of bringing the code to life. It was analogous to taking the time to craft a musical instrument, which you could then learn to master in order to create beautiful compositions. It was difficult to formalize his thoughts into a sequence of symbols which the computer could understand. Often he used common language; spoken through a microphone attached to a light-weight headset. The computer had a more extensive vocabulary database than he had. A semantic analyzer interpreted the context of his words using pattern recognition in order to understand their meaning. Since programs consisted primarily of sets of instructions, it was obviously important that his command lines could not be ambiguous, and for efficiency, needed to be elegantly compact and error free. Yet, while authoring the code, he frequently encountered situations in which it was ultimately necessary to translate esoteric concepts into a mathematical algo‐ rithms. Sometimes it would take many days to resolve these problems. Typically the breakthrough would occur during a moment of enlightenment at the end of a long arduous ordeal of experiencing the failure resulting from exploring every conceivable logical option. Jurgen’s advantage was that he understood the nature of this beast, and that he was aware of many of the techniques he could use to teach the computer to learn on its own. Originally, when computers were first designed, operators would map out flow charts simply by outlining instructions for a limited array of possibilities; if this happens, then do this, if something else happens, then do that, and so on... While modern, sophisticated operating systems enabled Jurgen to build on top of the existing code and instruct the computer to keep a record of its previous decisions as the basis for further activity. It also resulted in the creation of increasingly more complex problems as well. Once the system became active in mutating its own code, there was often no documentation available to understand what was happening when something went wrong. Jurgen would sometime sit awake most of the night trying to psychoanalyze a little metal box that was plugged into the wall. “The devil is in the details,” Marcel had said, shaking his head, after listening to Jurgen explain the difficulties he had experienced with the program’s complexity. The two would regularly get together at night, down in the dungeon. Marcel had become his confidant, mentor and guide; patiently listening to problems Jurgen had encountered with the project, and always willing to contribute helpful suggestions and advice. His cryptic comments were often derived from an encyclopedic knowledge of ancient mysticism; the Tao, Qabalah, Tarot, Astrology, and such, which rather than provide direct answers, served as indications or supplied clues that Jurgen could use to seek the solutions for himself.


During this time, although much less frequently, Jurgen would meet with Master Bronchev to keep him appraised of his progress as well. Jurgen had decided to keep secret the fact that he was developing two different versions of the same software; one for each of them. Although Jurgen suspected that both men were aware of his sub‐ terfuge, it was a topic which had never arisen during conversation. Perhaps all three of them, in their own way, were aware that the development of the software was a quest for the ‘truth’ obtainable by accessing a universal source of knowledge. It did not matter if this source was the network database of all digitized information or if it was derived from the Akasha. After all, it was how the knowledge was used once it was acquired that was important, not where it originated. To Jurgen, the Master and the Doctor had come to personify the polarity of the material and the spiritual worlds; worlds which collided, or alternately, became a unified synarchistic force depending on the frequency at which they were perceived. Like a winged messenger suspended between heaven and earth, Jurgen drew energy and inspiration from both spheres of influence; ‘... creating the gravity which provided the harmony and balance holding reality in place’. He felt fully dialed in to the frequen‐ cy; alert and intensely focused, as the momentum of an energy wave carried him along for the ride... and it was a wonderful ride! He considered himself fortunate to be able to further his studies under the guidance of such marvelous teachers, each with a distinct, although polarized set of knowledge and skills. The development of his software greatly increased his self-confidence and advanced his esteem in the teacher’s perception of his work as well. It was inconsequential that he began to consider Marcel to be a friend, while his relationship to the Master maintained the hierarchy between them, since gradually the two had begun to consider Jurgen as one of their colleagues, which greatly increased his opportunity to interact and learn from them both. The following passage is transcribed directly from one of Jurgen’s notebooks recorded at this time: “The past couple of months have been an endless dream; an endless stream of knowledge flooding in to nourish my soul. Everything is fitting together. The process seems automatic, guided by an invisible source. Each new piece arrives when it is required as if I were working on an assembly line. All that I need to do is recognize it, reach out and grasp it, then merely drop it into place. These components are revealed to me even during my sleep. When I awaken, I am aware of what the next step will be." "It’s odd, but I have visualized an image clearly in mind during the past several days; a ladder connecting day and night: represented as a perfect square dissected at a forty-five degree angle. One half is white, containing a dark circle in the upper left corner, the opposite half-reversed, with a ladder consisting of seven rungs that are parallel to the horizon which connects these two circles. [There is an illustration in pencil in the margin of the slim notebook.] This image is the same (yet opposite?) when flipped vertically; a stairway leading from darkness to the light, or vice versa. It is an image that is significant; yin/yang, an hourglass, the childhood game of ‘Snakes


and Ladders’, or the game of ‘Rebirth’, (which is a Buddhist children’s book that Marcel had lent me) ... And as I write about it, many other interpretations come to mind. I have been perpetually (and effortlessly) climbing the ladder while I build the software... The world turns, and I am able to see it all in a fresh perspective; as I move from the light into the darkness and back again." "Yet, while I have been merrily carrying out my tasks like the fool on his journey, I have been oblivious to the danger. I am so easily drawn into the illusion of the ‘virtual’ reality that I construct for myself that I fail to realize my addiction... and also my vulnerability. I sometimes feel that I am invincible. Yet the warning was clear - Brak (my distant neighbour, and now system administrator at the Akademy) met me (significantly) on the stairs, as I was climbing up to my apartment near midnight and he was descending. I nodded to him silently in greeting as we were about to pass, but suddenly, and quite unexpectedly, he reached out and stopped my progress by placing a hand on my chest. “Be careful,” he said, looking into my eyes. That was all. We both continued on our way." "I am certain that he was referring to my ‘extracurricular activities’ in conducting research into my family’s history on the network. He is an intelligent young man, (as are all of the students at the Akademy), and quite likely he has discovered residual traces of my activity on the system. Perhaps he has even entered my unlocked room. [This last sentence had been crossed out of the journal.] I will not live in fear. The message is clear: be aware." "I have been so caught up in my own activity that this fortunate occurrence has given me pause to reflect on my recent experiences, and has induced me to take the time to structure my thoughts; thus, this entry in my journal. So much has happened that I can not possibly record it all. My hand gets tired from writing..." "Dr. Planchette, (Marcel) is amazing. We have been spending a lot of time together. He has opened a doorway into a world of which I was previously unaware of its existence. My perception of the spiritual realm has been blown open by the knowledge and literature he has imparted to me, and even more by his presence. (Marcel received his Masters degree in Ontology from the University of Paris and is employed by the Akademy instructing students in Metaphysics). He and his beautiful wife, Angelique, have been very kind in welcoming me with their friendship. They rent a small house outside the village. They have no children." "Angelique has been painting my portrait; a process which has required me to pose during four separate sessions so far. She has chosen to depict me as ‘The Hanged Man’ from the Tarot. I am required to lay on my back, stretched out on a mattress on the floor, arms behind my back, and my left leg tucked behind my right - naked except for a small triangular piece of white cloth that covers my genitals. Angelique had told me; “I usually depict my subjects completely naked, but I feel this gives the figure in the painting a sense of an innocence and purity.” I have to admit that during the last session my thoughts were not so innocent or pure. She had turned up the heat to


make it warm for me to pose in the attic. It was a little bit too warm. Angelique was wearing jeans and a thin t-shirt, and her beautiful breasts were clearly visible through the perspiration saturated material of her shirt. Gradually the triangular cloth covering me began to rise. I began to adjust the material, but Angelique commanded me to lay still. “Don’t worry, this sometimes happens in art, it’s natural.” The situation made me realize that I need a woman in my life." "Marcel is the image of perpetual youth, energy and vitality. Although he is ap‐ proaching forty-four years of age, I often consider him to be the same age as myself. “It is due to inherited genetics, and my training in metaphysics,” is all that Marcel has ever revealed on the topic of his youthful appearance." "It is curious that the villagers seem to have great respect for Marcel; a reverence bordering on fear. It is as if there is the familiarity of having known him for a very long time. Dressed in his long black cloak, he does present an imposing, almost princely figure, but that still does not explain the unusual reactions of pregnant women who seem to avoid him by moving to the opposite side of the street, or the priest who always crosses himself when meeting Marcel by the iron gates of the cemetery or near the old stone church. Marcel confided that the priest believed he was an apparition of a man who had drowned in the river several years before." "Other strange events have also occurred. One evening as we walked past the little flower stall near the Main Square, where men line up to buy flowers for their wives or girlfriends every Friday night, the pretty young girl working in the stall left her cus‐ tomers, and ran up to Marcel to offer him a white rose. Many young women in the village would flirt with him; attracted to him as if the atmosphere were sexually charged. Men also seemed to have respect for him. In the taverns, stout peasants, sitting at the picnic tables, red faces and thick fingers wrapped around the handles of half-liter glass mugs of dark, sweet draught beer, would suddenly fall silent when Marcel entered the room. Yet, a few moments later each would raise their glass in unison as a toast, before resuming the activities that were briefly interrupted." "In the evening, Marcel will occasionally park his Skoda electric car in a secluded forest at the edge of the village and we will set off on foot, taking a circuitous route across the terrain - avoiding the zigzag roads leading out into the fields. He offers me a pair of night vision goggles to wear, as he seems to have no difficulty navigating in almost total absence of light. Through the glass, the greenish world seems alive with ghosts as we make our way out to the household wine cellars at the eastern edge of the village. The ‘vinne sklipky’ is like a separate village consisting of small budas; brick huts whose musty interiors have been partially excavated into the earth. The wine cellars were used as air raid shelter during WW2 but are now only used for their original intended purpose: to make wine and to drink it. Often during the summer, when the farmers are working, they will head to the budas to take a break. The walls are lined with casks and barrels and furnished simply with a few benches. It is customary to stand and partake of a ritual which is conducted by siphoning wine from a barrel into a long glass tube which is carried about by the host, resting on his


shoulder. Wine is dispensed by releasing the finger covering the narrow opening at the bottom of the tube into glasses that have been washed out in a bucket in the corner. The men and women drink wine and sing folk songs in sonorous voices with occasional passionate renditions of the national anthem; Kde domov muj... (Where is my Home), as they made their way from one underground cellar to the next, experienc‐ ing the pride and skill of the wine making ability of each host, until curfew. Marcel would often recite beautiful poetry that he had written, effortlessly translated into Czech for the occasion; long verse recalled from memory which held the country folk spell‐ bound and which occasionally moved them to tears as they sat mesmerized from the wine on the crude wooden benches in the candle light." "Other times I will accompany Marcel on visits to the farmer’s homes in the village. He is always graciously welcomed. As his companion, the same courtesy is also extended to me. We would arrive at the same time as other neighbours who had gathered for a feast. I assumed that Marcel had been an invited guest but the villagers would usually seem startled by his appearance, sometimes quickly and subtly crossing themselves when he was not looking in their direction. They always warmly inviting us into their homes for hearty meals of roast pork, horseradish, cabbage, dumplings with sour cream and rye bread. After the meal had been cleared away, the men return to the table to play Stovkahra using a deck of cards illustrated in the Italian suits of coins, cups, swords and batons. They play fast, enthusiastically and loudly; banging the cards down on the table and keeping track of the score with match sticks or small pieces of wood. The object is to score one hundred points, at which time they loudly call out ‘Dost’. Under socialism, drinking and playing cards were practically the only legal leisure-time activities that were permitted; a way to escape the dreariness that pervaded life during the winter months in the village." "I will occasionally sit in, but Marcel prefers to watch the game, amusing himself by noting the significance of the cards which are dealt to the players. The cards (using the same suits as Tarot), reveal to him, he claims, hidden aspects of the player’s lives, events which have been significant in their past and those that will influence their future, yet remain unknown to the players. “Tarot isn’t a parlour game”, he had confided to me recently. “Its hidden symbolism reveals the highest philosophy; it is a method of revealing the forces determining our fate. Just by watching the game I can know more about these men than even they know about themselves.” "The women, meanwhile, sit in the next room talking, drinking wine, and exchang‐ ing baked items they have made. There is always laughter. Sometimes they will have what they call ‘stripping parties’; a traditional activity in which they will gather to remove mounds of goose feathers from old quilts and pillows who’s material has worn out, and lovingly clean and sterilize the feathers to prepare them as filler for the new comforters and quilts they have recently sewn. Some of the feathers were originally from pillows that had been made a century before; passed down like heirlooms from one generation to the next."


"The children are like children everywhere; they tug at my pant leg to pull me away from my limited ability to converse with the adults so that they can show me the cool moves they have mastered on their Nintendo games." "The simple lifestyle and self-sufficiency of the villagers; the joyous social activity, the exchange of goods and services through barter, the honest toil of tilling small fields and growing all of their own food, and the healthy environment in which they live is refreshing and inspirational. They leave the factories to the machines and the corpora� tions to the elite. All that they need is provided by their ability to store seeds, their skill at crafting whatever they required from the material at hand, and through the wisdom of the truth passed down from their elders. Yet, the children are aware that the modern world is not far away, and it is closing in. Soon this paradise may be lost forever." "The entire Czech Republic is very beautiful, with the exception of the northern regions which have been ravaged by air pollution and acid-rain. Marcel, Angelique and I sometimes journey throughout the countryside together in the electric car on weekends. In the sunshine, the vehicle does not rely on its batteries at all, obtaining energy from an array of solar panels built into the roof. We leave early in the morning, packing a picnic lunch to eat when we discover a suitably picturesque landscape to immerse ourselves in; among the virgin woods and meadows, beside the small ponds created for fish-farming or along the watchtowers; remnants of the Iron Curtain amongst the vineyards. The red blanket on the green grass, her thin face looking up into the sky, grey eyes searching for patterns in the anonymous autumn clouds, the wind blowing through her long dark hair - Angelique is always taking photographs, the old fashion kind, not the digital ones - she develops and prints them in a darkroom in the basement of their house. I am always amazed by her insatiable creative desire; she is always making something; painting, drawing, photography, sewing, growing plants... (I wonder why?)" "During the past couple of months we have drank Becherovka (a medicinal herbal liqueur) and ate the paper thin wafers at the spa in Karlsbad, after relaxing in the therapeutic mineral hot springs. We explored the Caves of Koneprusy. We have passed through tiny villages with speakers atop poles along the street; once used to warn the citizens of raids during the war and make announcements, they now broad� cast orchestral music. We have wandered through the Old Town Square with its Astrological Clock and St. Vitus’ Cathedral in the city of Prague. Yet what intrigued and continued to fascinate Marcel, even after several previous visits before we had met, was the Sedlec Ossuary; the cathedral of bones in Kutna Hora. We have just returned from my first trip to this town tonight and I want to document the experience in my notebook, and more particularly, record my recollections of the information Marcel communicated to me in the car on the journey home." "The people of Kutna Hora once mined the rich veins of silver below the town and established the Royal Mint during the 14th Century which produced most of the hard currency circulating in central Europe at the time. The cemetery already contained the remains of some 40,000 victims of the Thirty Year War and the Black Death by the time


Abbot Henry returned with a jar full of earth from Golgotha - in the Holy Land. Once he had spread it over the cemetery, people from throughout Europe considered the graveyard to be sacred ground, assuring those buried a place in heaven. As people came to bury their dead relatives or friends, the small plot of land rapidly filled to capacity. So to make room, apparently, a half-blind monk was burdened with the task of gathering the bones from abolished graves and hauling them down into the crypt in the cellar of the cathedral." "Sometime around 1870, a local woodcarver, Frantisek Rindt, was inspired to use this massive amount of material to decorate the interior of the cathedral; bone chande‐ liers are suspended from the vaulted ceiling, as well as strings of skulls, each with a bone clenched between their teeth, hanging like paper streamers at a party. Enormous, elegant, tightly-packed pyramids of bones with skulls lovingly grouped together like family portraits set inside small alcoves within the structure. Particularly well crafted was the large coat of arms; constructed from an arrangement of shoulder blades, broken knee ball joints, and fringed with the narrow bones of fingers. The ornaments are indeed macabre, yet they are also peaceful in their eerie beauty. While we explored the site, Marcel frequently declared; “This is where I want to be buried." The stones in the graveyard were topped with the design of an actual skull and crossbones rather than a Christian cross." "From Sedlec we drove to a Gothic tower located near the center of Kutna Hora and briefly toured the Alchemy Museum, established in the laboratory once used by an alchemist named Hynek during the 15th century. It was late and the museum was ready to close by the time we arrived but the curator allowed us to wander around for some time during which I could get a general sense of the place. I was fascinated by the illustrated texts of Lazarus Ercker; the mint master of Kutna Hora during its glory years." "On the trip back, Marcel used the fully charged batteries to power the car (which had plenty of energy to return us home). The car ran silently down the highway through the twilight. Angelique listened to music through her headphones, contemplat‐ ing the glorious colours of the sunset, then later watching a movie on the tiny screen of the compact player for awhile before falling asleep. As soon as we left Kutna Hora, Marcel half turned toward me in the back, resting his arm casually along the seat. He remained in this relaxed pose for the next hour, explaining the concepts of alchemy and the Hermetic tradition in great detail, alternately dividing his attention between me and the road. I listened carefully, but what I am about to record is only a few of the key points and I am not entirely certain that I am able to recall all of the details as accurate‐ ly as Marcel communicated them to me. The information floods my thoughts with further questions and piques my curiosity to discover more about these mysterious topics, as I am just beginning to understand the importance of these subjects in the pursuit of my own quest..." Marcel spoke quietly, yet despite his distinct accent, had articulated clearly; "Alchemy is said to have originated with a man named Hermes Trismegistus who lived


some time around 1200 BC, and was later was immortalized as the Mercurial messen‐ ger of Greek mythology. He is also believed to be the same man known as Moses in the Bible, who performed miracles and delivered commandments on tablets of stone which several scholars have theorized that the Hebrew letters were actually secret hieroglyphs from Egypt. The verification of Moses' true identity, and the circumstances surrounding his birth and mysterious disappearance were cloaked in secrecy by early Christians. Perhaps Moses/Hermes was known in Egypt as Akhnaton, an enigmatic king who existed during that time, who disappeared from Egyptological records, erasing all memory of him after the Exodus. His face must be kept veiled, his disap‐ pearance must remain secret to protect his soul from Satan; Seth, the pharaoh Seti." "The son of an Egyptian father and a Hebrew mother, Hermes was educated and initiated at Heliopolis, eventually becoming a high priest of Osiris. He used his mastered knowledge of the Egyptian occult to produce a set of texts known as Hermetica, which dealt with the three degrees of Magic; Natural Magic equating with physics, Celestial Magic with psychology and Ceremonial Magic with sociology and politics. Elected by the Hebrews as their administrator, he was the messenger who delivered this knowledge to his people in the form of ‘laws and letters’." "Hermes is considered the first author of theology. He introduced the concept of monotheism; the doctrine that there is only one divine force. This ‘God’, he believed, should not be represented with the images and symbols of animals or human-like forms; common in the Egyptian pantheon, since it is an omnipresent spirit existing throughout the universe. In his writings he prophesied the birth of a new faith which would exist without excessive formalism and priestly exactions, and without abuse of practices. Anyone of wisdom and purity would be able to receive divine communica‐ tion - if through devotion to continual practice they maintained a state of readiness for the benefaction manifested by the Supreme Will..." "At that moment, the car suddenly hit a deep hole in the ragged, weathered pave‐ ment and abruptly swerved. The motion had been enough to awaken Angelique from her dreams. “Drive carefully,” she softly scolded. Marcel had nodded solemnly; his face becoming an expression of concentration as he returned his full attention to the road. Angelique slid a new disc into her player and soon drifted often again into sleep. It was dark. The headlights did not shine far into the distance. Soon, Marcel continued his dialogue, once again gradually assuming his more comfortable, casual position; sitting partially turned toward me with his right leg curled up on the seat, so that he was more easily able to speak..." “Since ancient times, Hermetism provided the foundation for wisdom exchanged between teacher and student; a continuum from Hermes to Orpheus to Aglaophemus to Pythagoras to Philolaus to Plato, from one generation to the next, extending to the European alchemists of the Middle-Ages, with each building upon and refining the ideas of their predecessors. Each gained an understanding of the ‘Book of the World’, and committed its contents to memory; the knowledge of science and mathematics, medicine and healing, the reformation of society, its politics, law, theology and


economics, made virtuous and brought into harmony with the Truth imparted by the Great Architect of the Universe. The mysteries were revealed to initiates in terms of a spiritual journey; a progression through planes of awareness, advancing through successive stages, the nine degrees, through the successful completion of a particular trial or ordeal, in order to obtain their liberation.” "In this way, they were able to experience the vast forces of nature which extend beyond the ordinary perception of senses; they could pass beyond this world into the spiritual realm, returning with the knowledge to grant them the ability to see into the future and to prophesy many things. Some developed the ability to become invisible, or were able to levitate; powers attributed to the God Hermes in Greek mythology. Others created a potion they called the Elixir of Life which was capable of curing all disease, thereby conferring immortality. Likely this involved the use of colloidal silver; very small mineral crystals observable only through a microscope, the magnetism of which affects the structure of water molecules within the body, acting as a perfect disinfectant at the cellular level, maintaining vitality and longevity." "Most fascinating, of course, when speaking of alchemy, is the concept of the Philosopher’s Stone. According to folklore and legend, it was an object purported to have the property of turning base metals into gold, yet, as has been described by Zosimus (an Egyptian alchemist living in 300 BC) it was; ‘A stone which is not a stone, a precious thing which has no value, a thing of many shapes which has no shape; this unknown thing which is known to all’." "I clearly remember that we continued down the highway in silence while I pon‐ dered the meaning of this koan. After some time, Marcel supplied further information; the philosopher’s stone can be considered to be a metaphor for the transmutation of power. After all, as the study of physics centuries later confirmed; energy can neither be created nor destroyed, it can only be converted from one state to another. The potential exists for each of us to become aware of, and subsequently make use of, the divine power within us, through which we are able to realize the potential of achieving whatever we will. To paraphrase Alipili; ‘If you cannot find it within yourself, you will never find it without yourself, for in you is hidden the treasure of treasures.’ This energy already exists within your mind, your heart, and your soul, all that is required to discover it is to obtain the realization that knowledge and love are the only paths to attaining divine wisdom. ‘Those who wish, may see’." "This enlightenment was cast into shadow by the dark clouds of the Inquisition; a tribunal established by the Roman Catholic Church around 1229, and continuing officially until 1834 - although some would say until the present day, which determined that alchemy was among the many loathsome, diabolical practices carried out by heretics. This court proposed that the most effective solution was to burn these vile and evil creatures at the stake. The brutal suppression of Hermetism in effect brought about an end to the true Renaissance in science, humanities and the arts flourishing at the time, and replaced these studies with scientific investigations whose findings could be more readily aligned with the dogmatic programming enforced by Christianity."


"Marcel had become increasingly animated; occasionally he pounded on the steering wheel with the palm of his hand or tossed an ambiguous gesture out the window at the darkened countryside in order to punctuate a passionate dissertation that was delivered in his heavy French accent; “Generations of knowledge - that these men of wonderful talents had accumulated, were systematically discredited by the new scientists; rational analysts, who, discovering that they were able to gain the favorable patronage of Queens and Kings by aligning their theories more closely with the bible, had joined the campaign against Hermetic wisdom. They branded alchemists as evil wizards who had obtained their powers through unspeakable acts of necromancy and who used herbs and stones, spells and amulets as a means to create black magic. The logic of the scientists had been easily understood since it was presented in a simplistic form which appealed to the limited perceptions of the privileged elite." "Consequently, the alchemists lived in constant fear of the authorities; who would set them ablaze along with all of their books and equipment should their laboratories be discovered. Driven underground to pursue their work and study as hermits within virtual isolation, they resorted to desperate measures to ensure their survival; creating false names and passwords to identify themselves, and by corresponding in encrypted code that was cloaked in metaphor, allegories, numbers, symbols and riddles, to ensure that the knowledge was transmitted only to those who were worthy of receiving the gift - those who were disciplined and intelligent in their thought, and just and virtuous in their actions. As a result, condemned openly, or by continuing in secrecy, their knowledge has been doomed to nearly total extinction. All that remains are stories which have been transformed into legend, and fragments of information, which, obscured by the disruption in the evolution of their communication, have made the data extremely difficult to recover; the decryption keys - needed to provide the clues which fill in the missing pieces of the puzzle, have been intentionally destroyed, have crumbled to dust, or have long been lost to memory." "This is the pattern of history; a pattern that has been repeated since the earliest civilizations - Lemuria, Atlantis and the Aztecs and Maya, Sumeria, Babylon, and Egypt. Each of these civilizations had rapidly advanced in the development of lan‐ guage, mathematics, metallurgy, medicine, astronomy and art, and each of these civilizations, as rapidly as they have appeared, have disappeared with scarcely a trace. Perhaps they had accessed more powerful knowledge than they were able to control which ultimately caused their destruction. Perhaps this is the real reason that the knowledge of the alchemists was suppressed; because the rulers, and the general population of the time were afraid of the power." "For awhile we had continued in silence. We had turned off the main highway, and were now driving down the narrow road through the valley toward our village, when Marcel glanced up into the night sky to notice that the moon had just passed complete‐ ly into the shadow of the Earth. Neither of us had been aware that there was to be a total eclipse of the moon tonight. Marcel pulled the car over onto the shoulder of the road, then reached over and gently shook Angelique’s shoulder to awaken her to witness the event. “C’est fantastique!”, she murmured dreamily. We watched for


several minutes; until the full moon once again began to reveal itself, then we contin‐ ued along our way." "The road became very winding. Although concentrating intently on steering the car, Marcel nevertheless continued his dialogue, drawing toward the conclusion of the discussion which had made the journey seem to elapse very quickly..." “It is my belief that civilization is progressing toward discovering, once again, the means of accessing this ancient knowledge, and this time we will finally be able to master the secrets of its mysteries. The ancient civilizations were unable to construct the sophisticated tools necessary to unite technology with the ultimate force of the divine. The alchemists of the past could only fashion devices from primitive materials, while we have advanced much further. More importantly, there will be those among us who will have the awareness to recognize the truth when it is discovered and be able to implement this knowledge for the benefit of all mankind. I go on record; you can quote my prediction, that by the end of two decades - sometime after the year 2022, we will begin to witness the miracles." "The potential will be unlimited; mystical revelations regarding the nature of substances combined with our knowledge of the biological algorithms of DNA, the Akashic records enhanced by Artificial Intelligence to create a superconsciousness within the human brain, and angel magick recorded and shared throughout the Universal Matrix. Just imagine the possibilities of technological alchemy! Absolute freedom; a spiritual revolution! The dawning of a Golden Age!" "The lights of the village came into view further along the road. I suddenly noticed that Marcel’s eyes seemed to glow in the rear view mirror, as he looked back toward me. “One day, Jurgen...”, he said very softly, his voice barely audible over the quiet hum of the engine, “...the guides have indicated that you are going to be an important part of the transformation, even though you might not realize it.” "My advice to you is this; stay true to your will and let the forces of the universe guide you. Avoid the dangers and temptations lurking along the path; if you go looking for demons, you may just find them, and above all, maintain the qualities that you have been blessed with: the mind of a scientist, the heart of a poet, and the soul of a Bodhisatva. When the time arrives, you will find the courage to surrender to the chaos." "I had been leaning forward to hear the words more clearly when I discovered that Angelique had gently placed her hand on top of one of mine that had been clinging tightly to the back of the seat. She smiled sweetly, then softly moved her hand away. I leaned back in the seat wondering if I had been listening to the statements of a man who had striven in vain to attain an equilibrium within himself and had more or less lost hope of succeeding." "Soon we arrived on the street where Mrs. Boshovsky’s house was located. As usual, Marcel had stopped some distance away. For some reason he had always


seemed reluctant to approach the building too closely. I bid them goodnight, got out of the car and walked to my apartment. As I climbed the stairs, Brak, who was descend‐ ing, unexpectedly reached out to stop my progress by placing a hand on my chest. “Be careful,” he said, looking into my eyes. That was all. We both continued on our way."

XI. WHITE SANDS

Months had passed. It was almost Christmas. Jurgen lay in bed, exhausted, even though he had just awoke. A glance at the digital clock on the floor indicated that it was 2:22 am.. He recalled that he had gone to bed just after 7:00 PM.. From under the warm covers he watched the tiny lights outside his frosted windowpane twinkle merrily in the cold darkness. Since he was the tallest tenant, and the ladder was quite short, he was the one Mrs. Boshovsky had convinced to decorate the building. The weather had been bitterly cold. He had spent the entire day outside; hammering up strings of lights and struggling with the ladder in the deep drifts of snow. In the process he had caught a chill that had seemed to freeze his very bones. Even now Jurgen shivered although he was tucked snugly into his bed. He could see the vapor of his breath. The fire had gone out. Jurgen crawled from under the covers wearing long thermal underwear and woolen socks. He pulled on another pair of socks, pants, a shirt, a sweater, and then his heavy jacket. He went into the adjoining room where he loaded the cast iron stove with split chunks of wood, then lit some crumpled paper to kindle the blaze. The electric heaters radiated very little warmth, useless when the weather was this cold. Jurgen walked around to try to get his circulation going. The coolness of the room made him feel much more wide awake, which made him even more aware of how horrible he felt. He wasn’t surprised that his biological system had finally crashed, and that some type of virus was running rampant throughout his internal network. He felt mentally, physically and emotionally exhausted; drained. The past few months he had been working around the clock to develop software for both Master Bronchev and Dr. Planchette, in addition to conducting his own research into digital life on a dedicated machine at home. Whenever he had managed to spare even a little bit of time, he would use it to gather further information about his grandparents in the computer lab at the Akademy. He had hardly ever seemed to eat or sleep during this hectic work phase. Now there was the sudden recognition that he wasn’t superhuman.


The room was growing warmer now that there was fire crackling in the stove. Since he couldn’t sleep, he decided to review his collection of files that he had downloaded from the network. Jurgen turned on the computer. After briefly waiting for the startup icon to display on the thin, flat panel screen, he initiated the wireless link to his portable drive. He slid a stack of memory cards from a small cardboard box, shuffled through them, and arranged them on the table. As Jurgen gradually assembled these memory fragments, a portrait of the lives of Cameron and Adda Stark had emerged: Cameron Stark had been born on December 8th, 1921, in a simple house overlook‐ ing Lake Mburo in Uganda. His father, Jurgen Stark, a tall, thin Norwegian man, was working in Africa as a land surveyor under contract to the British government. Whenev‐ er he traveled out to map the endless rolling savannah, his wife, Anna Stark, would spend her time teaching a handful of children in a one-room Methodist mission school that she had founded near their home. One rainy morning, February 2nd, 1922, Jurgen Stark was standing exactly on the equator. While he was concentrating on focusing the eyepiece of his transit, perhaps taking a sighting on a distant benchmark, a large, powerful leopard suddenly pounced on him from out of the tall grass where it had been hiding. The newspaper article reported that his Bantu assistant discovered Jurgen dead by the time he returned to the scene, apparently, after running to the jeep to fetch a rifle. Anna, now with a two month old child to raise on her own, decided to leave what she considered to be a ‘god forsaken’ land and return to her family and friends in Christiania, the capital city of Norway - which would soon be renamed Oslo. Cameron was raised by his mother, and soon also, by her new husband, Otto Mehrgaard, a bank manager. As a child, Cameron had adapted quickly to the northern climate, enjoying skiing along the trails through the rugged forests in the winter, or hiking along the fractal-like infinite coastline of the fjords during the summer. As Cameron pro‐ gressed in his education, he demonstrated exceptional ability in the fields of science and physics. He received his Master’s degree in Mathematics from the University of Oslo, presenting a thesis which advanced his theories in the field of computational logic. A very interesting, and well written paper, Jurgen noted, as he read through sections of the transcript. In 1950, at the age of 29, Cameron emigrated to the United States, taking a job as a research scientist with the US Atomic Energy Commission. He lived near Baltimore, Maryland, and worked at the military base in Aberdeen. The exact nature of his role as a civilian contractor during his first two years at the Aberdeen Testing Facility still remained one of the many gaps in the jigsaw puzzle that Jurgen was piecing together. Penetrating the present day military ‘information factory’ was very difficult since many of the highly classified files were stored as ‘intelligent documents’. The operating system could detect when a file had been accessed, and depending on the destination address, was capable of altering the content of the data while the document was in transit from storage. Jurgen had developed a workaround, but it was as laborious a process as performing digital surgery.


Nevertheless, Jurgen had discovered that Cameron was first employed within the electronic warfare division of the Army Research Lab, analyzing the effect of electro‐ magnetic radiation on various electronic equipment and components. In 1952 Cameron had shifted over to the Human Engineering Laboratory at the facility. Likely in recognition of his scientific work in these departments, he had earned a selection among a group of representatives who traveled to Hong Kong in 1953, during a perilous time when the Americans were considering using the atomic bomb to end the Korean War. Cameron had been brought along as a technical consultant to the secretive negotiations between the wary American and Chinese diplomats. It was at these meetings that Cameron met a young scientist named Adda Tzu, who provided technical support to the members of the Chinese delegation. She was both Cameron’s counterpart and opponent at the meetings, sitting directly across the table from him. Cameron would later relate that when their eyes first met, he had been instantly captivated by Adda’s beauty and grace. At twenty seven, Adda was a very attractive woman, even though her delicate features had been damaged in an accident which had left the traces of several thin, deep scars marking her cheek, and required her to wear a patch over her right eye. Cameron was also impressed by the intensity of an inner light which seemed to radiate from her, dispelling some of the darkness of doom which naturally lingered over the solemn discussions. During breaks in these sessions, the two were occasionally afforded the intimacy of private, casual conversations. Cameron discovered Adda was charmingly eloquent in her use of the English language. She had been born and raised in Hong Kong, before attending university in the capital of China, a city which at the time was known as Peking. She had returned to live and work in Hong Kong four years earlier, just before Mao Tse Tung and the Communist Party had formed the People’s Republic of China. After the meetings, separated by the vastness of the Pacific Ocean during 1954, Cameron and Adda frequently exchanged mail. Since they both were involved in classified projects at the time, neither mentioned anything about their work. If they had, they were aware that censors monitoring their private correspondence would have either deleted text or destroyed the entire document anyway. Jurgen found copies of many of their poetic and romantic letters inside a classified military file, including an ‘artistic’ black and white photograph that had been enclosed in one letter. Adda had sent a portrait in which she had posed nude in an atmosphere of soft lighting and shadows; she was kneeling on a white cloth in the darkness with her hands modestly covering herself, her long hair untied and draped over her shoulder, her left profile turned toward the camera. It did not seem proper to think this thought, but Jurgen had to admit that his grandmother had a voluptuous body. During the course of their correspondence, Cameron became aware of many hidden talents which she would gradually reveal to him. In addition to her passion for crafting computer code, she was also an accomplished violinist. If she had desired to, Cameron believed, she would certainly have been welcomed to perform with sympho‐ ny orchestras in many cities throughout the world. She had sent Cameron copies of


previously published books of poetry; the passages of text having been illustrated with symbolic collages constructed of images torn from the pages of medical and biological textbooks. Cameron had also seen several of her paintings on canvas featured in international magazines. Her human-scale artwork, composed with the rhythmic harmony traditional in oriental art, explored intricately-detailed, dream-like technologi‐ cal landscapes, were the prizes of many private art collections. While in Maryland, Cameron had initiated a project, code-named ‘Leveland’, which would be conducted for the Atomic Energy Commission. From what Jurgen had been able to gather, the purpose of the project was to develop a ‘reality simulator’; which would utilize a massive mainframe computer to generate models simulating the effects of an atomic blast on the human body - proposed as an alternative to the current method of using ‘volunteers’. At that point in time, the Nevada Proving Grounds, northwest of Las Vegas, had been the military test site for atomic blasts; detonating explosions which had progressively become more massive, nearly every week for the past several years. During a typical test, a ten or twenty kiloton A-bomb, about the size of the ‘Little Boy’ that leveled Hiroshima, would be suspended from a tower, or a gigantic weather balloon. In the darkness just before dawn, a company of four or five hundred volunteer soldiers would be marched into the desert to huddle in the cold, sitting on the ground with their backs toward ground zero, a distance of 1000 meters away. A blast of intense heat, and a brilliant flash of cold white light, clearly visible through eyelids closed tight, were the signals that the soldiers could turn to watch the turbulent multicoloured mushroom cloud rise high into the sky. If they were rookies and had stood up too quickly, they would discover that a deafening roar and a powerful shockwave would knock them back onto their ass a few seconds later. Sh-boom, Shboom! After waiting for about an hour for the dust to clear, the soldiers would move in to clean up any remnants of the vaporized tower, and prepare the site for the next test in a few days time. The military conducted these ‘human radiation experiments’ to study the effects of flash blindness, and determine the amount of protection that a soldier’s regulation issue clothing provided against high levels of sustained radiation. The general idea was that through repeated exposure, the troops would become acclima‐ tized to the actual battlefield conditions of an imminently expected nuclear war. Jurgen could now distinctly detect the smell of fried bacon rising up from Mrs. Boshovsky’s apartment downstairs. Dawn was beginning to break through the frosted window pane; pale orange light shattering along the thin ridges of ice. Jurgen noticed that he was shivering like a frightened kitten. He walked over to the stove and threw in a couple of chunks of wood, then returned to his perch by the screen. Although tired, he felt compelled to continue examining the files in detail. Now that he had the time to assemble the pieces of his research, the story was beginning to come together. From his discovery of a series of inter-departmental memos, Jurgen had noted that it had been not been an easy matter for Cameron to convince either the directors at the Department of Energy, or the commanding officers at Aberdeen of the necessity of the


‘Leveland’ project. After all, now that the war in Korea was over, there were a surplus of expendable G.I. Joes whose primary purpose now entailed digging a network of tunnels throughout the country to install the command centers, missile silos, and bomb shelters which would provide underground concealment to the military superiors preparing to battle the unholy specters of the ominous forces of darkness during the imminent Cold War Armageddon. It was an atmosphere of urgency, paranoia and fear. The commanders didn’t have time to wait while scientists fiddled around with computa‐ tional machines that were notoriously unreliable and slow. Most military sites were fortunate if they had an old ENIAC kicking around from 1946; a mainframe which filled a large room, weighed thirty-four tons, and required round-the-clock trouble shooting to replace the thousands of vacuum tubes which were continually burning out. Yet, Cameron was persistent in carrying out his mission. Determined to stay clear of the media circus in Nevada and the fallout that the nuclear explosions had generated in the press, Cameron had contacted his associates by telephone, soon discovering that the White Sands military installation in New Mexico was about to receive several UNIVAC 120s, dramatically increasing the speed of calculating the gravity rainbow trajectories of various test missiles that were being launched from the site. White Sands Proving ground was the vanguard of the ‘space’ program. A program that had started off with three hundred railway boxcars full of V-2 rocket components; combus‐ tion chambers, turbo pumps, and jet vanes, all captured in 1945 - at the end of WW2, from the underground tunnels of the Nazi’s Nordhausen assembly lines, along with a large number of German scientists and missile experts from the VfR whose folders had been tagged with paper clips. From 1946 - 52, some sixty seven, fifteen meter high V-2 rockets had been assembled from these pieces, fueled with alcohol and liquid oxygen and fired off the Meilerwagon. The program had rapidly progressed with the building of Complex 33, launching bigger rockets; Corporal, Ajax, Nike, Honest John, and recently, the Aerobee rocket which had reached an altitude of 158 miles. While many of the scientists were beginning to dream of pushing the envelope; breaking through the atmosphere and journeying into outer space, each remained aware of the reality that these rockets were being primarily designed as inter-continental ballistic missiles capable of carrying a nuclear payload, and ultimately creating the potential of destroy‐ ing all life on their own planet. Cameron was able to leverage his knowledge that White Sands would be spending $150,000 for each new mainframe to his advantage. Attached to one memo sent to his employers in Maryland, Cameron had detailed a proposal to rebuild and modify one of the outdated EDVAC mainframes at the facility, which would soon be shunted aside, for a fraction of the cost of a new machine. He explained that his custom design would integrate several manufactured components which were state-of-the art in 1955. Silicon transistors had just come out; they were faster, smaller and cheaper than the massive array of vacuum tubes that were currently in use. Other developments, that had only recently come into existence, enabled him to replace hard-wired plug boards with transistorized printed circuits, use a photoelectric reader to accumulate data from punched cards and store these programs on magnetic tape, and increase the capacity of the core memory cylinder to create a function table of over 10k, 36-bit words.


He had already drafted blueprints for the design of a key piece of innovative hardware which would improve the capability of the ancient mainframe; a peripheral component he called the ‘data synchronizer’. Housed in a black metal chassis, the solid state circuitry within the small device contained a recent, commercially devel‐ oped, floating-point unit which greatly increased the speed of calculating complex mathematical operations. In floating-point processing, the code representing real numbers had no fixed number of digits before or after the decimal point enabling the processor to consume more digestible numeric values which had been pre-formatted for its convenience. As well, the unit also functioned as a pipeline to stream informa‐ tion more efficiently into and out of the processor. Several input filters verified the integrity of the data before passing them along to the synchronizer, which functioned similar to a taxi dispatcher in a very large metropolis; sorting and channeling the electronic signals directly to specific circuits within the mainframe whenever they were required. The device was able to process an instruction in under a microsecond! Not only had Cameron managed to convince his employers to transfer him to White Sands with an allocation of funds to build his advanced computer design; which he now called the TRINIAC (officially an acronym for Transistorized Innovative Numerical‐ ly Integrated Automatic Computer), but he had also persuaded them to allow Adda to immigrate to the USA to join him on the project. Her impressive credentials supported his case that she was one of the few people in the world, at that time, who was proficient in devising an operating system which could equal TRINIAC’s innovative processing architecture. In other words, she would provide an intelligent brain which could match the behemoth’s brawn. In one of his frequent philosophical entries, digitized from a hand written lab journal which became property of the government after his death, Cameron noted that he had; “decided to name the machine ‘TRINIAC’, partly to commemorate the ‘Trinity Site’ within the White Sands Proving Grounds, where, a decade before, the testing of the first atomic bomb blew apart Pandora’s box, unleashing its ills into the world, yet more importantly, and more positively; to desig‐ nate the three equal qualities of which a living being consists; a mind, a body and a soul”. He went on to explain that, “neither human nor machine can claim to actually exist if any of these essential ingredients are lacking ... often, they merely appear as a, sometimes convincing, simulation”. During the spring of 1955, Cameron arrived at Alamogordo, a dusty little town in the Chihuahuan Dessert of southern New Mexico, thirty kilometers from the White Sands Proving Grounds. Although he was a ‘civilian’, Cameron rented a small bungalow within a subdivision of military housing out in the desert. Each morning he drove his shiny new, black sedan out to the base through the large, pure white gypsum dunes stretching across the Tularosa Basin. The drifting sand, continually burying the present and revealing the past, were entirely encircled by a ring of small, rugged, barren mountains. Adda arrived about one month later, and unexpected to them both, promptly became an internee, segregated within one of the barracks on the base, and allowed to leave the security zone only under authorized supervision. Cameron protested her


‘temporary alien’ status, and demanded that she be given more adequate accommo‐ dation. The only reply was that the situation would be reviewed after a six month period of evaluation. A series of inter-departmental memos, exchanged among the upper echelons of the military brass, reveal that they considered Adda to be a potential spy. The words ‘clandestine’ and ‘espionage’ were liberally sprinkled within dozens of the documents. Jurgen had even uncovered the transcripts of several of the secretly taped telephone conversations between Cameron at home in Alamogordo, and Adda at a pay phone on the base. Also unknown to them, was that they were also watched over by the machinations of the FBI, who were always vigilant for any source of a communist threat. Cameron’s FBI file had also dramatically increased in size since arriving at White Sands. The authorities had labeled him as a ‘communist sympathizer’, and were concerned that he had frequently expressed views about the atomic program, to associates during casual conversation, which they considered ‘un-American’. Cameron had recently found a kindred spirit in the publications and social activism of Edmund Berkeley, a computer scientist and robot designer who Cameron had heard speak in Newton, Massachusetts the year before. ‘Helping the common man to think logically would end the threat of nuclear war’, had been the general theme of his discourse. To ease the hardship of their separation, Cameron and Adda dedicated all of their effort to be together by working long hours at their home away from home. Their underground laboratory, located within a labyrinth of tunnels, had, in an emergency, thick steel doors which would seal off the outside world; the hatches were even imbedded with poison gas jets to provide protection against the physical intrusion of terrorist attacks. Their sanctuary contained several small, collapsible cots and a quantity of food rations on which they could survive for several months. They had decorated the bomb shelter with some of Adda’s paintings, vases of flowers Cameron had picked, and a hot plate to cook meals and make coffee or tea. Sometimes they stayed down there for days. In addition to a flourishing romance, work was also progressing successfully on their computer. The EDVAC they would use as the base machine had already been disassembled into a mountainous pile of rubble before they had arrived at the base. It was up to Cameron to roll up the sleeves of his white shirt, remove his ID badge and thin dark tie, and set to work soldiering together components strewn across the black and white checkerboard pattern of tiles on the floor. He would be sweating profusely after several hours under the cool green fluorescent light, since even underground it was impossible to escape the eternal heat. He reconfigured these components to create a totally new design, finding replacement parts for damaged components by scavenging parts from other old EDVACs, ORDVACs, and UNIVACS throughout the military supply network, and by contracting technicians at both military and civilian facilities to modify these components to his specifications. He carefully managed his shoestring budget to requisition only the specific custom parts that he needed; transistorized circuits, patch panels, dials, and sets of cathode ray tubes - originally


designed for an oscilloscope, to fit into the head-mounted displays. This visual interface was an odd design; he started with leather aviator’s helmets, attaching two soda pop bottle-sized cathode tubes to the front, pointing straight up like devil’s horns, or aliens from Mars. Mirrors reflected a slightly offset image to each eye, creating a three-dimensional graphic effect. At the beginning of the project, Adda spent several months configuring the comput‐ er’s core. In an almost Zen-like meditative state, she rolled back and forth on the casters of an office chair, weaving together an intricate network of small, circular ferrite magnets, each suspended by thin wires and connected to four other beads nearby. The structure that emerged was similar to a spider web hanging on the wall. Each magnet would represent one bit of storage data when a current was induced; positive or negative polarity represented a ‘1’ or ‘0’. She was able to configure its properties as a logic device by stringing the beads in the core together in a particular way. It was obviously the type of work that they frequently needed to take a break from and get outside the bunker. Adda was free to go with Cameron for a drive in his car as long as she was returned to the base by 9 P.M.. They would take off into the desert, listening to ‘their’ song on the car radio; ‘My Happiness’ by Connie Francis, go frolicking through the dunes where strange white creatures; mice, lizards, crickets, and grasshoppers, had adapted their coloration to the environment. They watched tiny, electric blue pupfish flashing in the salty ponds, and hiked along the black lava beds of the malpais; petrified rivers of blood and bones that were remnants of giant monsters from the Navajo’s Age of Gods. Adda was fascinated by the native’s sand painting; simple, almost cartoon-like geometric forms which represented Mother Earth and Father Sky, depicted a bat - the spirit of the night which delivered sacred messages between the humans and the deities, or illustrated the Pollen Path. On the way back to the base they would sometimes stop at an American restaurant which served Chinese food, which to Adda was not like the real thing, but close enough, and nevertheless, a pleasant change from a steady diet of army chow. Although sometimes the experience had reminded her of her increasing desire to see her homeland once again; she missed the dai pai dong food stalls along the waterfront, the sampans and junks in Hong Kong Harbour, but most of all she missed her father and her friends. Yet, she was in love with Cameron, and he was in love with her, and she was willing to forget her past as long as they could be together. The process of constructing the machine continued for an entire year. The project took longer than work carried out by larger teams at commercial labs, but the advan‐ tage was, that since they were not constrained by specific business or industrial applications for the hardware, they were able to build a much more innovative machine. Adda created an entirely new programming language by deconstructing the PACT manual and improvising upon the theme. She would write the code as if it were a musical composition, exploring the digital synthesis emerging from binary duality; the forces of yin/yang, darkness/light, masculine/feminine, to create the rhythmic harmony of her subroutines.


Each piece of code was painstakingly punched onto a card; - , - , , - , , - , - , - , , - , , , - , , - , and so on ... Adda would then withdraw a thick stack from a cardboard box, periodically holding one of the cards up to the overhead fluorescent light to check for any damage to the array of small rectangular holes which comprised the data on the card. She would then feed them one at a time into the sorting tray where the holes would be tabulated by the reader; it was a process which Adda had enjoyed since it was repetitive and peaceful... From the reader, the information would be converted into the form of binary code, then transferred out to storage by being recorded onto a reel of magnetic tape. Ultimately, when the program was run, a compiler would organize the relationships between the encoded subroutines into an instruction language recognized by the machine. Jurgen had been fascinated to discover the existence of what had been called ‘centipede cards’; a special set of punched cards which recorded the missing data occurring during runtime errors when the program had originally been compiled. Jurgen would later wonder if the data comprising these accumulated errors had somehow provided the metaphor of 'a missing the link' in creating the illusion of life. The Starks ran their first tests in the late spring of 1956; flipping an array of toggle switches to boot up the core and hoping that the machine wouldn’t crash. Since they couldn’t afford to build their machine using entirely solid state circuits, they continually had problems with the older vacuum tubes, considering themselves fortunate to have six hours of error-free operation. Since the elaborate preparations to set up a program usually took several days in advance, they limited each session to thirty minutes to ensure an uninterrupted run. By the summer of 1956 they received the mannequins they had ordered from a factory in Chicago. The modified crash test dummies had been designed to their specifications; sensors on their bodies could detect alpha, beta and gamma radiation as well as atmospheric pressure. Their eyes could see ultraviolet and infrared light, and their ears were sensitive to the full human frequency spectrum from 20Hz to 20KHz. The initial shipment included four identical males they named Fred, Tom, Dick and Harry, and a female named Betty Boop, because of her comical facial paint job, and a child for whom they could never agree on a name. This group sat silently on the floor, in the corner of the underground shelter, waiting for the bomb. With the hardware in place and operational, Cameron and Adda were ready to commence the project; code named ‘Leveland’... The screen went black... Jurgen had turned off the display then swivelled his gaze in the direction of the window; cold sunlight was brilliantly streaming in... he hadn’t intended to stay awake


all night. He threw the last few pieces of wood into the fire. Soon he would need to go out to the shed behind the house to get more, but right now he was too tired; all that he wanted to do was go to bed. He peeled off his clothes down to his long underwear then crawled under the covers. He lay there for a long time shivering, noticing that his hands had turned blue. The details from the files that he had recently read kept returning to the surface of his thoughts. It seemed that the more information he discovered about his grandparents, the more he seemed to discover about himself. He was beginning to recognize the source of some of the characteristic traits he had genetically inherited. Suddenly, there came a furiously loud rapping on his door. The door swung open and Gus stuck his head inside to offer him a ride to the Akademy. Jurgen, just peering over top of the thick comforter, explained that he wasn’t feeling well. Gus nodded gravely, said a few sympathetic words, then quickly vanished. Soon, Jurgen could hear a similar sound of someone knocking on Mrs. Boshovsky’s door downstairs and a subsequent exchange of distant voices. Not long afterward, Mrs. Boshovsky entered his room carrying a big bowl of hot soup on a tray. Without a word, she pulled up a chair to the side of the bed, put the tray on her lap and began feeding him chicken broth with a hand-painted wooden spoon as if he were a baby. Jurgen didn’t complain. The soup tasted delicious, and he even welcomed the look of compassion expressed in Mrs. Boshovsky’s eyes. When he had drank most of the soup, she put the tray down on the floor and placed her hand on his forehead to check his temperature. She gently brushed away the long strands of dark hair which hung down over his eyes. “I know what will make you feel better and help you to sleep,” Mrs. Boshovsky said as she began removing her clothing. “It’s the cure for anything that ails you...” She removed her dress, “... it’s been a long time...” She removed her stockings, “ ...I think I could use a little of that medicine too!” Jurgen watched with entrancement as she unhooked her brassiere, and her massive, firm breasts swung free from their restraint like a pair of atomic bombs. In the coolness of the room, the nipples on her milky white breasts protruded from the center of dark aureole. She slid her worn, off-colour panties over her broad hips, dropping them to the floor to reveal a dense, triangular, auburn forest that sloped up her chubby, dumpling belly, and nestled between her thick thighs. Her broad back, and her short arms and legs were muscular and strong. He could smell her body; the aroma of faded perfume blended with the pleasant stronger fragrances of bitter garlic and sweet sweat. She had undressed in a matter of moments and had quickly hopped into bed. The bedsprings squeaked as she pressed her nakedness against him. He could feel her heat. “Don’t worry.” She slid her hand down the front of his underwear and fumbled with the buttons at the crotch. “Don’t be afraid.” She popped the buttons open and found


what she was looking for. “You’ll realize that this is just what you need.” Her practiced fingers knew the technique which made Jurgen very quickly become stiff. “Oh my, you are big.” She climbed on top of him and enveloped him in the warmth of her surprising‐ ly firm body...

XII. BLACK CHRISTMAS

A sea of moving umbrellas reflecting off a rainy neon sidewalk... Jurgen emerged from the dark and murky depths of dreams into brilliant sunlight; diffused through the thick coating of frost on the window as it flooded into the room. Perhaps it had been a dream. Mrs. Boshovsky’s prescription had not effected a cure, in fact, he felt even worse. The only sensation was a dull pain which radiated throughout his entire body. Jurgen assumed that it was a powerful new strain of influenza that ravaged his body, deplet‐ ing him physically, mentally and emotionally, and leaving him as drained and exhaust‐ ed as a hollow man. The strange condition seemed to last forever. As the disease lingered, a fear began to overpower him, causing him to wonder whether there would ever be a time when he would regain his health. For an entire week he had not the energy to even get out of bed. Jurgen found himself in a purgatory in which it was difficult to tell when he was awake or asleep, whether it was day or night; everything seemed to be in a perpetual state of suspended animation. He was aware that the illness was affecting the biological components of his brain. Occasionally he had the sensation that his brain was reformatting itself, experienced as a rush of imagery flashing through his thoughts like a burst of electricity, as if his mind was attempting to salvage memories stored in the cells attacked from a virus by rapidly rewriting them to a new location. He spent some time reading or recording random thoughts in his notebook but for the most part he simply lay there in kind of a daze staring at the floral pattern of the wallpaper. During sleep, which was frequent, he experienced horrific nightmares which seemed much more real than the reality he perceived when he was awake. After a few days of this he became afraid to fall asleep, endeavoring valiantly to fend off somnolence. It was a struggle for which it was impossible for him to be the victor for whenever his will power had evaporated, sleep would once again engulf him and plunge him into its terrifying depths. At first the nightmare consisted of a long sequence of events which always were replayed from the beginning whenever he fell asleep. The horror was that after experiencing the recurring dream several times he had learned exactly what was going to happen next, yet he was powerless to do anything


about it. He could only watch helplessly as the story unfolded, a plot which somehow involved the death of a character who resembled Jurgen in appearance, but whom was viewed remotely as if Jurgen were watching a movie he had seen many times. One morning, as soon as he awoke, Jurgen attempted to record the content of the dream in his notebook but was surprised that he could not recall even a single detail of the vivid, horrific experience he had been forced to relive night after night. Across the top of a blank page he had written a title; ‘The Complex Dream of Vincent Innocent’. Mysteriously, from that moment on, the dream vanished. It seemed that by naming the demon which haunted him, he had broken its spell over him. Soon he had fallen asleep once again, then a short while later he would reawaken. It was a cycle that perpetuated itself in a relentless loop. The difference between reality and dreams no longer seemed to matter. The only way to measure the passage of time was by the accumulation of snow outside the window. The eternal snow continued falling like a blizzard; an avalanche of particles that threatened to bury everything alive. Snow, death... death, snow; it was the same. Occasionally Mrs. Boshovsky appeared like a vision bringing him whatever he needed; soup, juice, tea with honey, vitamins or medication. She maintained the fire in the woodstove and emptied the chamber pot that had been placed under his bed; a metal bucket covered with a piece of plywood. Occasionally Marina came to his room. To avoid catching his disease she covered her mouth and nose with a white scarf, appearing as unreal as an angel hovering beside his bed, a halo of fair hair above her darkened eyes. She did not want to stay long or engage in conversation, and only answered his question of why it was so quiet at night by informing him that Gus and Brak had left for vacation. He felt terribly alone and afraid when the house and the village were silent. The rest of the world seemed so far away. Each night of his solitude he hoped that he would somehow survive to see the next day; reminded of death by a shadowy owl that sometimes perched outside the window, invisible in the total darkness, its deep throaty chant a harbinger of doom, conjuring up the nightmares which would soon torment him. His fever broke on Christmas morning. He opened his eyes to perceive the world more clearly again. He glanced around quickly but did not see a golden pig upon the wall. Wrapped in the quilt he could feel the warm slickness of the sweat which bathed his body, his hair was tangled and matted like a strange bird’s nest, and he could detect the odor of stale urine that seemed to permeate the bedding and the entire room. He crawled out of bed and put on his slippers. His body felt thin and fragile. His movements shaky as he tentatively made his way across the floor into the main room. He drank a glass of metallic tap water, threw a few pieces of wood into the fire, then went over and sat on his perch. He pressed his palm against the window to melt the frost. Through the shape created by the heat of his hand he saw a landscape consist‐ ing of smooth, soft, pure white contours, all watched over by the dark angular castle upon the hill. He shivered.


He suddenly recalled that he had made plans to return to Germany for two weeks to visit his mother during her Christmas vacation from work. He immediately searched for his cell phone and gave her a call. He began by wishing her a ‘Merry Christmas’, then briefly explained why he had been unable to travel. Her tone of voice indicated that she was very disappointed, and she did not offer many words of condolence to comfort him. After they had spoken, and he had disconnected, he began crying. He felt broken. He sobbed gently for quite some time; until he couldn’t cry anymore. A short time later Mrs. Boshovsky arrived with a mysterious package, explaining that it had been abandoned like an infant on the doorstep outside the house. The word ‘Jurgen’ had been carefully printed on the white cardboard box. Mrs. Boshovsky set the heavy parcel on the table. She was smiling, happy that Jurgen was up and out of bed, but her expression quickly changed to concern when she noticed him wiping tears away from his eyes. She remained motionless by the table, uncertain of what to do. Jurgen hoped that she would come to him, hold him and comfort him in her powerful arms. For a moment it seemed that she would, but instead she hesitantly turned and left the room. Neither of them had mentioned the event which had taken place that night a week before. Jurgen sensed that she felt ashamed or guilty for having taken advantage of him, but he felt uncomfortable for a different reason; from his vague memory of the event, which he recalled as being pleasurable and one that he would be very willing to experience again. He still felt apprehensive about how to initiate that type of situation, as he still had no idea how to persuade a woman to go to bed with him. Upon opening the parcel, the first thing he discovered was a small handmade card with an abstract painting on the front; possibly of a sunflower. Inside the card simply read; ‘Stay Positive, love, Marcel and Angelique’. Since he didn’t have any groceries in the fridge, their present was quite timely; the large parcel was packed with fresh apples, oranges and lemons (very difficult to find this time of year), a loaf of rye bread, sausage, vacuum-sealed packs of dried apricots, figs, papayas, and raisins, a bottle of expensive brandy from France, and even a yellow paper bag containing ‘Dad’s’ chocolate chip cookies that were made in Canada. The manner in which Marcel seemed to be able to materialize anything he desired never ceased to amaze. As he dug deeper, Jurgen discovered a couple of thick paperback novels; the first two volumes of Marcel Proust’s epic, ‘In Search of Lost Time’. At the bottom was a Christ‐ mas present. He tore open the wrapping and discovered a small battery operated toy; a Santa Claus robot that trundled along carrying a brown canvas sack over its shoulder. Randomly, Santa would stop and abruptly lean over, flipping the sack forward, then it would turn its head from side to side as if searching through the bag, or perhaps indicating ‘ No... he had no presents’. All the while, Santa emitted the contagious sound of maniacal laughter that brought a smile to Jurgen’s face. Then suddenly, Santa would quickly stand upright, and the bag would flip over onto his back, and he would continue on his way. Jurgen could tell that Marcel had made the toy by the telltale assortment of odd components which it consisted of. He was amused and fascinated by it, and watched it operate for hours.


The parcel lifted Jurgen’s spirits because he realized that someone cared enough about him to do something to cheer him up while he was ill. His friends were no longer around when he needed them. He couldn’t blame them. He had been so involved in his work that he had also forsaken them. The only people that he had any relationship with during the past few months were Marcel and Angelique. Whenever he wasn’t working he spent his time with them. As he thought about it, he realized that perhaps he had developed a dependency on them. He also was puzzled why the parcel had been left outside and why the Planchettes had not come up to see him; it was odd the way that Marcel had always firmly declined to enter, or even approach Mrs. Boshovsky’s house, any time Jurgen had invited him. During the festive season, Jurgen had received quite a number of email messages, but his father had been the only one to send him a Christmas card by means of the archaic postal system. Mrs. Boshovsky had delivered the envelope to him while he was still confined to bed. The lengthy note, entirely covering all surfaces of the card, even the cartoon drawing of the snowman on the front, mentioned that Kropton had transferred credits to Jurgen’s account as his present this year. His father explained that his career was gathering momentum again with the publication of a new book entitled ‘The Age of Miracles’, which had recently been adapted for television. He explained that he was disappointed that the movie did not follow the plot of the book very closely - even the title had been changed, now called; ‘The House of Horrors’. Kropton had mentioned in the note that he shouldn’t complain since the licensing rights had been very lucrative. The movie was primarily centered around one of the minor events in the book; a young girl escapes from household appliances that have come to life and are terroriz‐ ing her family who have become trapped inside their own home. With the assistance of a jet pack she flies out into a desert where she meets an aboriginal shaman who strengthens her spirituality enabling her to return home with ‘magical powers’ to defeat the renegade ‘electronic servants’. The movie capitalized on the ability of computer graphics and special effects to generate horrific scenes of dismembered bodies, forsaking the ultimately positive message conveyed by the book. Jurgen often wondered how his father came up with such bizarre ideas and he questioned the values of the apparently substantial number of people around the world who were interested in reading his strange stories. Yet, maybe he shouldn’t be so quick to judge. After all, he had never read any of his father’s books, with the exception of the unpublished manuscript for ‘Invisible Waves’. Of course, he hadn’t given much consideration to the writing style, nor was he able to determine whether the story would be of interest to the general public, but he had to admire his father’s drive and determination to produce the prodigious number of books he had authored during his lifetime. Jurgen had read the story because the subject matter interested him; since the characters in the story were based on his grandparents.


Recalling the manuscript, Jurgen shuffled over to the book shelf and excavated it from sedementary layers of paper. Tonight Jurgen had wanted to curl up with a book; the choice was either to read Ernst or Proust. He was too exhausted to do anything else. He hardly had enough energy to negotiate the stairs to the bathroom on the main floor and then climb back up to his apartment again. Even his blood pressure was acting strangely. Sometimes his veins would expand; bulging out like dark ropes all over his body, and other times they would become constricted; pinching themselves tight, making his fingers and eyes itch and his brain throb with surges of pain. It was impossible to sit at the computer; the glow of the monitor played tricks with his eyes and after a very short time he felt exhausted and had needed to return to his bed. Clutching a cup of Messmer mint tea laced with honey and brandy, Jurgen wrapped himself snugly in the quilt on his bed and opened the manuscript of ‘Invisible Waves, to continue with the story...

part two

I. Excerpt from INVISIBLE WAVES (PART 3) THE ATOMIC TECHNOLOGY MAZE

Adda Stark hung up the phone. It had been difficult to sleep, she still felt tired. Anxious to meet with Cameron at the lab, she dresses quickly, the clothes sliding gracefully onto her short, slender frame, fitting comfortably. She glances into the mirror. Reflected is a young woman who she modestly believes is pretty in a plain sort of way, with pleasant features framed by short, jet black hair styled to make her look American. Her most notable feature is the dark patch she wears over her right eye. She would never say much about it and no one ever asked. Barefoot, she shuffles into the kitchen of her small apartment on the 22nd floor of a tower near the center of the city. Bright white light is streaming in through the window. The sound of a small yellow bird chirping away from its perch in its cage catches her attention.


“Oh Napoleon, did I forget to feed you last night? I’m sorry little one, but my thoughts are elsewhere.” She places a small handful of hemp seed into the bird feeder and watches the bird furiously peck at the trough while she hurriedly eats her own breakfast; a bowl of congee with some pickled vegetables and dried fish. She grabs her briefcase, slips on her shoes, then rushes from the apartment. Her footsteps in the hallway are silenced by the plush, olive green carpeting. The light cream coloured walls are evenly illuminated by invisible light sources. She enters the elevator and travels down the glass tube through the interior of the building, flashing through the courtyard atrium on the second floor and continuing down into the underground Highspeed Direct station. There are not many passengers on the train at this time of the morning. Adda sits on a bench seat beneath a route map printed on a large plexiglas sheet near the com‐ partment door. A tiny light indicates the train’s current position within the network. She closes her eyes as the train rockets through the tunnel, her thoughts drift to the project that she and Cameron have been working on during the past year. It has been a pleasurable collaboration, each providing unique skills in their pursuit of a shared goal. Cameron provided the driving force, backed by his wealth of knowledge and experience obtained from previous research. Adda complimented his skills by channeling this knowledge effectively to the problem at hand. She had a knack for discovering innovative solutions that seemed to elude him. More importantly, the project allowed them to share time together, providing a way to circumvent the regulations which kept them apart. As their love for each other grew stronger with each passing day, it made the enforced separation all the more difficult when they returned home to sleep alone. She sighed. Some day they would marry when the circum‐ stances were right. In the meantime it was better not to think about it or discuss it. They had both dedicated so much time and effort to the project that neither were willing to jeopardize its success by unnecessary distractions now that they were so close to achieving their goal. This was the day they had been waiting for; the day they would conduct their first full test run. The long days and nights of punching cards, compiling the code onto tape, and testing the thousands of wiring connections of the vacuum tube circuitry in the massive mainframe had been mentally and physically exhausting. Their efforts had experienced its share of setbacks, which was to be expected as they explored new frontiers in the interaction between mind and machine. Ultimately their efforts had advanced far beyond the boundaries of the original goal of the project which, as described in Cameron’s official proposal, was; ‘to create the appearance of a simulat‐ ed environment on a display monitor and develop a means of navigating within the environment through the manipulation of hand controls’. From the beginning, most of their superiors were skeptical that the proposed device could actually be constructed. To them, the concept sounded like something right out of the pages of a science fiction comic book. Yet, Cameron had been persuasive, to the extent that he had even managed to obtain top level security status for the project


which allowed them to progress without interference from the government and military agencies who funded their work. Cameron never discussed the project with anyone except for his immediate supervisor, Colonel Robert Moss. The required monthly progress reports were never questioned. There were no indications that their work was being monitored in any way. Sometimes they even wondered if they had been forgotten about altogether, working away in the isolation of their tiny underground bunker on an independent computer that for security reasons was not even linked into the system. They never had much contact with their fellow workers either, and did not know any of their names. The only time Cameron felt any pressure was during rare occasions when he had been called up to personally meet with Moss. Although the Colonel had been a friend and colleague since Maryland and their relationship was cordial, Moss often communicated a sense of urgency that his own superior, a man code named ‘Archbishop’, would like to see results, preferably soon or they would both ‘have to pay the piper’. The cryptic comments were not intended as a threat. Cameron understood the way things worked in the food chain of military command and had always man‐ aged to find a way to reassure the Colonel that everything was progressing on schedule; usually over tequila shots at the roadhouse situated in a cactus patch out near the far end of the rocket sled rails, where they were running tests for project Sonic Wind. The original plan had been to construct four distinct environments; a hedge maze, a tropical jungle, a colony on the moon, and ultimately, a simulation of a portion of New York City based on data obtained from aerial photographs. They began with the hedge maze, but because of the simplicity of the wireframe display graphics it came closer to approximating the rectilinear corridors of the Computer Research Facility than to creating the illusion of moving between rows of English Yew. As a result, they decided to call it the ‘Atomic Technology Maze’ or ‘ATM’, instead. When the program compo‐ nents for a rough version of the ATM had been assembled and tested, both Cameron and Adda were astonished that it had run nearly error-free. Adda quickly developed code that would enable the computer to create a new maze layout by randomizing the database; adding variations to the location of the connectors and termination points within each new array. To make the simulation more interesting she decided to also insert “rabbit holes” into the environment; named after of a favourite story from her childhood, ‘Alice in Wonderland’. Tumbling into a rabbit hole transported the operator to a distant, linked region of the maze. Cameron found them to be very disorienting but Adda thoroughly enjoyed the game. Navigation through the maze was controlled manually using the flight-control stick salvaged from an F-84F Thunderstreak jet fighter. One day Adda thought it would be interesting to experiment by navigating through the maze using the power of the mind alone; concentrating intensely on making decisions about which way to move at each intersection branch-point. She developed rudimentary bioneurilogical sensors which attached to their scalp. The experimental results were satisfactory. Also as expected, upon exiting the confines of the structure of the maze, they quickly reached the


limitation of the program, entering a fuzzy grey area at the edge of its parameters; a void they called the ‘no zone’. Pleased with their results, they decided to challenge their abilities by creating the tropical jungle, the only area, other than the maze, which they had developed past the initial prototype stage. The programming was exponentially more complex, and took much longer than expected to create. Adda would often wander down to her apartment building’s atrium in the middle of the night, intent on researching every variety of plant life she could discover; Arboricola, Majesty Palms, Ficus Benjamina, Calamondin Orange, Cymbidium and Orchids. Careful attention was applied to every detail in order to recreate as accurate a sense of natural realism as possible in the simulated environment; the texture of the bark, the glossiness, shape, and patterning of the leaves were all painstakingly crafted in code. In the meantime, Cameron had devised a technique to scan photographic images into the computer, manipulate them, and map them onto the dimensional shapes that were displayed on the monitor. Adda spent her time authoring a text editor which she used to design and modify the topography of the zone. She realized that if the program ran successfully they could use the jungle environment as a template, adapting its code to create any type of environmental simulation they desired. Adda opened her eyes just as the Highspeed pulled into her stop. Smooth, cool green tiles lined the curved ceiling and platform of the station, everything seemed slightly surreal under the even illumination of the invisible light. She realizes that she could have used a few more hours sleep. She disembarks from the train into a strong wind rushing through the tunnel that smells like damp cement, then heads for the gate under the familiar Atomic Technology logo mounted on the wall. She passes through the metal detector and enters the sterile white brick security room, pausing on the white line to be observed by the camera. When the green light comes on, she passes her identity tag through the reader and proceeds into the building. She takes the elevator down to level nine and casually wanders through the maze of corridors to the lab. The corridors are nearly empty at this time of the morning.

II. Excerpt from INVISIBLE WAVES (PART 4) THE GARDEN

The gate opens. Cameron drives in. Parks. He enters the building and walks down the corridor. Cameras mounted in the ceiling swivel to track his movement. He enters


the locker room where he is expected to wash up and change into his tech uniform. There always seem to be people sitting around the locker room at any time of the day or night. There were no regular hours; employees could work whenever they wanted to, depending on how many credits they wished to earn. Cameron logged a lot of hours. He enjoyed his work. The metal face of the locker panel is subtly embossed with the Authority emblem. The 'all-seeing-eye' is everywhere, encouraging correct behavior and thought by acting as a reminder of the omnipresent security force. The emblem, as you know, is the official seal; the pyramid with a hovering eye in the capstone. Letters across the background of the circular crest spell out the words “Ex Deus ex Machina”. Cameron put his palm up to a reader and his locker door swings open. Inside are Cameron’s white coveralls with the AT logo patch on the shoulder, and his name; 'Stark', embroi‐ dered above the breast pocket. Cameron stows his ‘civvies’ in the locker and marches down the hall toward the elevators in his flight suit. He is wearing his face mask respirator to avoid contaminating the sterile underground environment. A bank of elevator doors are located in the hallway. The ceiling here contains formations of recessed lights casting down narrow columns of intense light within the darkened loading zone. Each elevator leads to a different section of the underground. A passcard allows, or restricts, access to the various authorized areas. Cameron selects the elevator which will take him down to the laboratory on level nine. He slides his passcard through the reader and the doors open with a gentle rush of air. It always made him uncomfortable to be alone in an elevator. He uttered a silent prayer to the Authority to ensure that the elevator would not get stuck between floors, forcing him to confront his claustrophobia within the solitary isolation of total darkness. A gentle synthetic voice read out the day’s announcements. Cameron paid little attention to them, since he was thinking about some of the lines of code that should be revised. The display screen above the door updated information indicating the level of descent. When it reached level seven; about one hundred feet underground, the elevator suddenly shimmied to a stop. The doors glided open and Cameron could feel a trace of the cool, damp air. A man in a white tech suit stepped briskly inside, immedi‐ ately turning toward the control panel to enter his secret code. The door closed. As Cameron studied the man to determine if he recognized him, the other man slowly turned to meet his gaze. Something about the expression on the man’s face held him captivated. For a moment he had the impression that he was staring into a mirror. The man had the weariness of someone who had logged an excessive amount of overtime attempting to achieve an unrealistic goal. His frame was bent, his movements were slow and uncertain, and his dull grey eyes, as lusterless as steel bearings, had sunken deeply into the darkened hollows above his respirator mask. There was a subtle glimmer Cameron detected in the cool gaze the man returned, giving the impression that this man was thinking similar thoughts about him. They maintained contact for several seconds in silence; two tired electrons moving through the circuits of a giant machine - the machine which sustained them and gave them life, and which


in turn drew upon their united individual energies, like a battery, in order to maintain a state of equilibrium in the symbiotic relationship. Cameron had often noted the weariness in humans and the mechanical failure occurring in the machines. Perhaps this fellow human being would have some thoughts on the fragile nature of their existence, but he didn’t even know how to communicate with him. He broke off their tentative contact by glancing down at the digital numerals on his watch, then gingerly pressing a few of the miniature buttons beneath the display with his fingertip to make himself look busy. The sound of the elevator changed frequency as they dropped to level nine. The elevator came to a stop, the doors open, and Cameron steps past the man without another glance. The air here is cooler, dryer, and cleaner than up above on the surface. There is a low level ambient sound from the drives and the cooling fans of the ventilation system. Cameron notices that a new poster has been installed on the wall; the latest propaganda from the Authority. In this version of the design he had seen on the billboard in the street, a young girl dressed in a technical uniform is gazing intently into the distance. The message printed in large text across the bottom of the poster reads, “Young eyes look toward the future.” These corridors have been tunneled through solid rock. The walls are surfaced with smoothly polished grey concrete. Heavy metal support beams, painted dark grey, slope up towards the curved ceiling about every ten feet. From the hub of the elevators, the corridors branch out like the roots of a tree. Each corridor branches at right angles, and continues only a short distance before splitting in two again. The deeper you go in levels, the smaller the network of corridors. As you approach level zero, the corridors extend much further, eventually connecting with the root system of another complex, which is also centered around the hub of another elevator shaft. These are the arteries of the Underground City. The entire level is scrupulously clean. Breathing masks keep harmful microorgan‐ isms out of the environment. Even the smallest dust particles are removed by electro‐ static filters, and all refuse is disposed of in specially designed containers which are taken 'Authority knows where'. The ventilation system is comprised of a myriad of shafts that link the underground with the surface. Maintenance robots service the shafts by crawling through them to carry out repair work. It has been reported that every so often Outsiders had attempted to infiltrate the system by crawling through the ventilation network, but to Cameron that did not seem likely. There is activity down here. A tiny robot the size of a vacuum cleaner zooms past with a whir on its way to deliver messages along the corridor. Groups of workers gather together in the hallways. Conversations are quiet and brief. Two women turn their head to watch Cameron walk past. They appear to be talking about him behind their masks. It is unusual that anyone notices him. He can’t hear their words, he can’t even read any expression in their eyes. The sound of his footsteps echo off the checkerboard of black and white vinyl tiles that swirl under his feet, reflecting off the solid metal doorways lining the corridor. Cameron passes a door that is open. Inside,


beside a dull green mainframe in the center of the large room, a man and two women are in discussion. Heavy black cables radiate across the floor to several smaller satellite workstations along the pale green walls. Cameron continues down the corridor until he arrives at a room designated as; ‘945F - A.R.R.L.’, on the plastic tag glued to the door. He enters his passcode, turns the doorknob and steps into the ‘Artificial Reality Research Laboratory’. After the door seals, Cameron removes his mask. The hum of the ventilation fans is quieter and the lighting is much more subdued than in the corridors. Twinkling lights sparkle as cheerfully as a Christmas tree on the front panels of the dull grey metallic cabinet which consumes nearly half the space. Across the room, facing the massive main‐ frame computer are two computer workstations, consisting of an array of small monitors built into a console surrounding a pair of decommissioned ejector seats from the cockpit of an F-104 Starfighter, arranged side by side like the front seat of an automobile. A ray of light shines down on Adda who is was already sitting at the console. She looks up from her work and smiles, “I just ran a system check. Everything looks like a go.” Cameron sits down next to her in the left hand chair. “You’re amazing!” he says, returning her smile, then leans over to kiss her on the cheek. Cameron often noticed how pretty she looked when she smiled. Even though their work on the project compelled them to maintain a professional relationship, there were frequent moments of romantic intimacy throughout the day - and often intensely passionate sexual encounters at the end of a shift whenever they worked late into the night. Cameron strapped himself in, excitedly anticipating the oncoming rush of adrenaline that would kick in when he experienced the full impact of the simulation, “I think we are go!” “Okay, lets run it. I’m so excited this first time... I feel like we are two virgins.” Adda entered a few commands into one of the small keypads built into the armrest of her chair while Cameron watched the display patterns emerging on one of the small monitors on the console. “Launch sequence initiated... come into the garden,” Adda winked, laughing happily. She motions to Cameron by repeatedly curling her index finger. They both pull on headgear similar to the type that a fighter pilot would wear and tighten the chin-straps securely. A pair of small cathode ray tubes mounted on Cameron’s helmet like devil’s horns reflect stereoscopic images onto his goggles; beaming signals to each eye which are offset to create the illusion of depth within the simulation. Having only monocular vision, Adda has adapted the helmet to provide a composite graphic display within a single eyepiece. The graphics still retain the illusion of depth, but she cannot experience the full effect the way that Cameron can. Their voices are captured by a small microphone built into their helmets, transferring the signal to a reel to reel tape recorder acting as the flight recorder. The purpose is for


the convenience of hands-free note taking. Adda notices the sound of Cameron’s breathing intensify in her headset as the image on the display begins to rapidly digitize pixel by pixel. “Relax”, she says calmly. “Okay... I am adjusting the ray tracer and the anti-aliasing,” he reports. The image of a lush tropical jungle gradually appears on the screen. The vegetation consists of palm fronds and ferns rendered in shades of green vector lines glowing with bright phosphoresce. To their left stretches an infinite beach; its sand is designat‐ ed as an area bordered by a thick tan coloured outline. The ocean is turquoise, the horizon is a slightly curved light blue line about 3/4 of the way up the display. Occa‐ sional sounds of jungle ambience fade up in the background; the rustling of leaves and the cry of strange distant birds blend with the gentle rhythm of waves slowly rolling up onto the beach. No clouds are noticeable in the sky. “Nice day.” Adda adjusts a few of the controls, “Attenuating the transparency factor...wow, that’s beautiful!” They spend a few minutes on the beach, acclimatizing themselves to their new surroundings. Each of them is able to view the scene independently from their shared location position. The portion of the visible landscape available to them is tracked by swiveling the position of their head mounted display. “Drive carefully, and don’t get lost this time!” Adda laughed. It was a private joke referring to Cameron’s notorious difficulty he often experienced in negotiating the maze. Cameron presses forward on the hand grip of the flight control stick and they begin to travel along the shoreline. Soon they arrive at a rocky outcropping that emerges from the jungle, crossing their path, and disappearing underwater. They stop. Off to their right they can see the peaks of a pair of low, conical volcanic mountains that are further inland, rising above the canopy. “Let’s explore the jungle”, Adda suggests. “Okay, here we go.” Cameron moves the stick to the right and the viewpoint moves slowly through the complex array of shapes representing dense vegetation. The bushes and vines seem to be pushed aside by the their movement; they could almost feel the branches brush against their skin. Cameron pushes their viewpoint forward, advancing quite a distance into the jungle. As they press on, both excitedly record notes documenting the status of the control functions and brief descriptions of the visual features of the landscape onto the voice recorder. Here and there they observe patches of flowers; brilliant orange, violet and pink. Occasionally they notice areas of


reduced texture detail where the program does not have enough information to interpolate the data tables. They are like quicksand patches, which if entered, would probably crash the program. As they advance toward what they expect to be the boundary of the program, the branches move apart and they unexpectedly emerge from the shadows of the jungle into a brightly lit clearing. Tall grass and small bushes fill the meadow creating a verdant matrix. Through gaps between the tall dark palms and trees which encircle the clearing, the leafy vegetation continues unbroken over the low, gently contoured surrounding hills. To the northwest is a high cliff. Thousands of animated white particles tumble down the rock formation following the invisible pathways of software gravity, creating the illusion of a narrow waterfall that splashes into a clear blue pond and generates circular ripples that travel out toward a tiny island. The sound of the distant waterfall is faint. “I can’t believe it... this is more beautiful than I imagined,” Adda whispers. They remain transfixed by the scene, time seems suspended. Both have become aware of a strange bronze coloured shape, mottled with patches of texture resembling rusted metal, standing in the middle of the island. At first it appears to be the twisted trunk of an ancient tree that has lost its leaves and most of its branches, yet as they study it further, they notice that its structure consists of a pair of helical spirals forming a vortex around the central pillar at its core. Suddenly, the cry of a wild bird, calling out loudly nearby, interrupts their reverie. “Where did this come from, I didn’t write it into the program, did you?” Cameron asks quietly. Adda does not reply. “I’m going to move closer.” Cameron advances through the tall grass toward the edge of the pond. The sound of the waterfall increases in volume as the viewpoint draws closer. Abruptly, progress is halted as their location coordinates intersect the bounding region which delineates the large pool. “Collision detection is active...”, Adda explains, “... I can’t turn it off. “We haven’t written the code to describe the depth of the pond yet. When we do we can go for a swim!” Cameron chuckled nervously, still unsettled by the appearance of the algorithmic anomaly looming before them on the island. From a closer vantage point, a double helix orbiting the exterior of the main structure is revealed as two serpents, one a dark bronze colour, the other a lighter shade - almost white. They are connected to the central pillar by a sequence of vectors, as if climbing the rungs of a symmetrical ladder that is coiled about the core. Suspended at intervals along this lattice are a number of multifaceted translucent gems; pure, deep blue sapphires gleaming with a cool, dull luster in the artificial daylight.


The dense core, also twisted into a spiral, consists of the seamless, intricately detailed anatomy of human and animal forms, merged with strange, machine-like components; all stacked one upon another in a similar manner to a totem pole. Tightly intertwined about the structure is a finely modeled network of vines bearing leaves, fruit and flowers, creating the appearance that the vegetation had, at one time, overgrown an archaic artifact, before ultimately integrating with it when it became fossilized. The entire organic structure is rendered in the spectrum of shades associat‐ ed with oxidized metal. Several human arms and animal paws emerge from the structure, similar to the branches of a tree. Shiva-like, they are either arranged in expressive gestures or are bearing such items as; a blossom, an apple, a quill, a vial, a crystal, a wand, a cup or a sword. At the summit, the naked torso of a woman’s body emerges from the structure with upraised wings rather than arms. She has the head of a large bird which is surrounded by the glow of a luminous corona, and posed suspended in the action of screaming at the sky. “This is very odd.” Gradually, a humming sound fades in. At first nearly imperceptible, but as it intensifies, it begins to oscillate in pitch, finally pulsating with a steady rhythm that shifts through a sequence of harmonic frequencies. The volume soon becomes almost unbearable; the terrifying roar of sustained thunder which rattles the tiny speakers in their headphones, making communication with each other impossible. A few moments later, the sound is followed by a narrow stream of intense violet light which beams down from above. Cameron attempts to tilt his viewpoint upward to determine the source of the illumination, only to discover that it originates outside the vertical range of the head mounted display. The brilliant ray has transformed the statue from leaden rust into glimmering gold. The gems suspended in the lattices refract the light as though they were prisms; projecting an aura of rainbows which surround the structure. Just then, a radiant wheel ~ which turned in every way like a gyroscope of flames ~ slowly descends into the scene where it remains hovering directly above the construct in the middle of the island - in the center of the pond. As if under command of the rotating disc, the helical structure beneath it began to distort; expanding to accommo‐ date a circular opening which had appeared at its center and slowly increased in diameter. Intently watching this inexplicable event unfolding before their eyes, they began to detect the faint, ghostly images of a naked man and woman that were materializing on the island, standing on either side of the structure, at approximately one quarter of its size. “We’re in here!” Cameron seemed to hear Adda’s quiet, astonished voice in his thoughts, clearly audible above the roar. As the dark opening in the structure expands, one of the lower arm-like branches moves closer to the female figure on the island, now clearly visible to resemble Adda.


The arm is holding something in the palm of its hand; tempting, tantalizing ~ a smooth round pearl glowing with pure white light. The figure representing Adda reaches up toward it, but it remains just beyond her grasp. At that moment, the rendered land‐ scape on the head-mounted display starts to break apart. The ancient volcanic mountains in the distance erupt into thousands of fragments which begin to swirl about with great force. The waterfall, the pond, the jungle and the sky become a random chaos of particles, their bright glow diminishing into fading embers as they rush toward the ever-increasing darkness of the deep, black hole in the structure. Groups of pixels, retaining the shapes of the figures and the island are rapidly extinguished like a grid of city lights during a power outage. The serpents uncoil and momentarily appear to come alive as they are swallowed up by the void. Finally, as the fiery disc ascends out of view, the central pillar shatters and implodes upon itself, vanishing without a trace. The screen is black. The rushing hurricane of pure white noise has faded to silence. The only sound in their headphones now is their own rapid breathing.

III. THE HISTORY OF INNOCENCE

Jurgen opened his eyes and the world came into being. Wrapped like a mummy in the covers of his bed, he groggily surveyed the wreckage on the floor of his living room through the open bedroom doorway. The memories slowly returned: Around ten o’clock in the evening, Jurgen had switched on the display screen of his computer, intending to greet the new year once again by quietly immersing himself in his work. This was his personal New Year’s Eve tradition. He believed that how a person started the year was a determining factor in how it would progress. And so far, it seemed, each year had been more productive than the last. He never made resolu‐ tions. The only time he celebrated the turn of the calendar page was when he had been much younger, at the insistence of his mother who would drag him to an annual gathering of her relatives. Invariably as the clock struck midnight, Uncle Hans would step out into the street to unload his Luger pistol at the canopy of stars suspended above the tiny German town. Tonight was the first time Jurgen had felt compelled to sit at the computer in nearly two weeks; he simply hadn’t had the desire while suffering the malaise caused by his flu. It had only been during the past couple of days that he began to regain his physical strength and emotional energy. His rapid recovery had been accompanied by a sense of profound change in his perception of himself and his relationship to the world.


Perhaps the effects of the virus had made him aware of how fragile he had been and how close he had been to knocking at death’s door. Maybe it was simply that his spirit had been lifted by the presence of the sun which had returned to shining brightly again, beaming down its warm rays to melt most of the snow in the village. Whatever the cause, he felt as renewed as the phoenix rising from the ashes of its pyre. In the darkness, the display panel bathed him in its cool, familiar glow. He soon discovered his enthusiasm returning. Anxiously, he checked out his artificial life programs which had been left running unattended during his illness. He had survived, but he wondered if his little creatures had. He dialed up the environment’s status reports from the menu bar and was relieved to see signs of life. He moved through the windows, intently observing the graphically displayed changes: which creatures had evolved, which had been lost through attrition, and the locations where species populations had migrated throughout the micro-universe in their search for ‘nutrition’. He was fascinated by some of the unexpected events which had resulted without his constant interference: it had been impossible not to tinker with the environment when he was in the habit of accessing the program several times a day. His exploration of the data was unexpectedly interrupted by a soft rapping upon his door. Startled, he spun around in his chair. The door slowly creaked open, and Mrs. Boshovsky stuck her head into the room, “‘Happy New Year’, how are you feeling?” “I’m feeling fine Jenna, come on in.” During the time that Mrs. Boshovsky had nursed him back to health, she insisted he call her Jenna. Jurgen glanced at the clock in the corner of the display; the time was 11:11. When he turned toward her again, she had just placed a bottle of wine and a tray of party snacks on the table: sardines, crackers, black olives and cheese. “I didn’t feel like going out tonight, but I didn’t want to be all alone,” Jenna explained. The house was empty: Gus and Brak had not yet returned from vacation. Marina had told her mother that she would be out with her friends watching the fireworks which were to be launched at midnight near the bandstand in the central square of the village. Jurgen removed his computer equipment from the table and the two sat across from each other in the light of a large white candle, quietly talking and drinking wine. At one point during the conversation, Jenna casually inquired who had left the box for him. He replied that Marcel Planchette had. Upon hearing this, Jenna became quite pale, and for several moments her expression froze into a blank stare as if she had gone into shock. Her body trembled slightly, she crossed herself, then muttered something in Czech to the effect that the man was not human. Jurgen considered asking her why she and the other villagers acted so strangely in his presence or merely at the mention of his name, but thought better of it, as the topic seemed to disturb her. Instead he


poured them each another glass of wine. Still fragile, he discovered that tonight he was more susceptible than usual to the soothing effect which permeated him with its comforting warmth. It was a pleasant sensation. Beeswax and vinegar, and the subtle scent of perspiration from Jenna’s freshly scrubbed body. Dirty clean. The traces of her earthy aroma evoked memories of their previous night of passion, the embers of which were once again inflamed by how pretty she looked in her plainly-patterned country-style dress. Yes, he was much healthier. He felt a growing desire to make love with her again. It would be up to Jenna, he decided, to have the discretion to leave before anything developed. The sound of fireworks exploded in the distance. As excited as a child, Jenna jumped out of her chair and rushed to the window, hurriedly motioning for Jurgen to join her. Her expression of joy was truly contagious, “Come on ... come here ... look ... look!” They squeezed together in the window frame to watch thin streamers of coloured light etch traces across the sky. A brilliant red flower unfolded, remained briefly suspended, then faded into the night. “Oooh!” she softly exclaimed. She reached out and embraced him. Jurgen in turn, took her in his arms. For a moment they gazed into each other’s eyes; her twinkling eyes, her rosy cheeks, her face beaming with a smile. Then he bent down to kiss her; a lingering kiss, her full soft lips were wet and warm. Holding her tightly, he could feel the firmness of his erection plunge into the softness of her belly. After forever, Jenna pulled back from the kiss and opened her eyes. “Let’s do something memorable to start the new year,” she gasped, attempting to catch her breath. Quickly undoing his zipper, she pulled his jeans to the floor in one smooth motion as she went down to her knees. She yanked on his boxer shorts. They dropped around his ankles, the sudden lack of restraint causing the arrow of his compass to swing wildly in the cool air, coming to rest, pointing up like the Big Dipper, straight toward the North Star. Kneeling before him, she took him in her mouth as if she were famished; kneading his bottom like two loaves of bread and devouring his sausage and eggs. Jurgen had no idea that anything could feel so good and quickly experi‐ enced the insatiable desire to unload. Before that moment, Jenna stood up and skipped across the room. “I think I know what you want to do,” she laughed. She hiked up her dress and bent over the table. She wasn’t wearing anything underneath. Her round white pimply bottom glowed like a full moon, partially eclipsed in the shadow cast by the candlelight. The sound of the fireworks continued outside. Jurgen attempted to take a step toward her, then struggled comically to maintain his balance, nearly tripping over the pants wrapped around his shoes. Somewhat embarrassed, he was forced to make a series of small hops to get across the room. Jenna looked over her shoulder and laughed playfully.


“Don’t be in a hurry,” she advised. “Try to make it last." Then, “Grab my hips,” she instructed, guiding him slowly inside. Holding tightly to the edges of the table as the tempo increased, Jenna’s feet were no longer touching the floor. The alignment was perfect. The table squeaked and groaned as it slid back and forth. The wine bottle tipped over and rolled off the table, followed by an empty wine glass which shattered on the wooden floor. Jenna let out a growl. The rattling, rumbling, moaning and groaning had reached a furious pace, when suddenly the door flew open, and Marina appeared, holding a cast iron poker in her hand. Her jaw dropped with surprise. “Mama! I thought you were being murdered,” she stammered. Jurgen never let up, he couldn’t; he was past the point of no return. He maintained a steady tempo that perhaps increased now that his attention had focused on the innocent expression on the young girl’s pretty face. Marina remained in the doorway, as still as a statue, continuing to watch with eyes the size of saucers. By now, Jenna was kicking her short, plump legs in a swimming motion, vainly struggling to get back on her feet, all the while emitting a continual stream of shrill, angry shouts in Czech that were directed at her daughter. Realizing she was pinned, she attempted to blow out the candle; the only light betraying the concealment of darkness. It was too far away, the flame only flickered. Just then Jurgen intensely exploded inside her. Jenna came loudly a few moments later, knocking the tray of snacks to the floor... The fog of sleep still lingered. Jurgen now sat at the table in the very same chair that he had sat in during his conversation with Jenna the night before. He surveyed the surreal wreckage strewn across the floor. Here was evidence of how the year 2007 had commenced; the aftermath of his lustful encounter, the landscape of the dreamer: sardines and crackers and tiny fragments of broken glass. This collage on the floor and the lumpy mattress buried under the thick warm quilt, which had very nearly become his death bed as he had struggled with the wicked flu, were tangible mile‐ stones of recent events that had indicated he was moving in a new direction. Love and death; the only two forces capable of changing the course of a life, he thought. But what determined its ultimate destiny? He drank the contents of a glass, half filled with wine, that had miraculously survived on the table. Absently, his thoughts drifted, and he began to recall portions of Kropton’s strange story that he had recently read. Perhaps this was a way to pass the time while he summoned the courage for the inevitable visit to Jenna’s apartment - to request a dust pan and a broom. Although ‘Invisible Waves’ appeared to be a work of fiction, a figment of the writer’s imagination, Jurgen believed that it revealed some truth about his grandparent’s lives, their work, and described some of the demons they encountered. The lessons learned within the cryptic passages of the manuscript had provided the catalyst in re-evaluat‐


ing the purpose and direction of his own research work. It seemed that it had taken him twenty-two years to finally mature; as if the sum of his life experiences had been an investment in preparation and training to finally embark on a more meaningful phase of his life. He wondered if the revelation that he had unknowingly chosen to follow in the footsteps of Cameron and Adda Stark; to tentatively begin his own exploration into the dangerous territory that they had already chartered, was perhaps an indication of a family curse. It was interesting that Kropton had chosen to relate the Stark’s encounter with unexpected phenomena in their simulated paradise as a variation on the theme of Genesis. It was Jurgen’s understanding that the biblical ‘tree of knowledge’ was a metaphor for the map guiding the journey of the soul from the fundamental to the sublime: a hierarchical network of branching pathways comprising the ancient wisdom of the Gnostics and the Kabbalah, made known to those who were instructed in the mysteries. Coincidentally, Jurgen noted, it also described the structure of the energy flow traveling through the human body’s tree-like cerebrospinal nervous system: the Kundalini express. When Jurgen was first told about the Garden of Eden, during the few times he attended church as young boy, he had been instructed that after Adam and Eve had eaten the forbidden fruit, their eyes were opened to the awareness that sexual intercourse was evil; apparently a realization which had caused them to become ashamed of their own bodies. What a preposterous thing to teach a child, he had thought, even at that tender age. Without love, what sort of religion can exist? The myth of the ‘original sin’, as well as the interpretations of many of the other teachings just did not seem to ring true. Subsequently he refused to attend church again. He preferred to study and understand the bible on his own. Later, as he delved into the teachings of Zen and Taoism, he appreciated that an intuitive understanding of their poetic philosophy could deliver moments of enlightenment. It was a refreshing approach to spirituality after being subjected to the didactic apologetics of Catholics, Baptists, Methodists, and so on... who continually broadcast their televised messages around the world, encouraging moral discipline and mind control as the means to assure a place in heaven. Certainly the temptation of the ‘forbidden fruit’ is not a lesson expounding the shameful guilt of physical love, rather, it is an allegory representing the act of making a choice between maintaining a blissful existence of contentedly tending the garden of paradise in peaceful serenity and in harmony with nature, OR, ‘becoming as gods’, by taking possession of the key which accesses the encoded, sacred (secret) knowledge, thus enabling mankind to edit, manipulate and redesign the world in a manner more suited to their preference. “The hacker mentality is the history of mankind,” Jurgen said to himself as he put a pot of coffee on the stove. While it was brewing he returned to his seat at the table and jotted down the line in his notebook.


Pragmatically, Jurgen believed that mankind was doomed to the process of evolution which determined the nature of all existence. The only escape was to either accept the challenge of discovery; to create order from chaos by seeking out the patterns determining the intricate structural designs of nature, gain a complete understanding of the complex set of instructions which program its behavior, and ultimately redefine the code in order to ensure that the human species develop and survive, OR, alternatively, devote oneself to attaining a more perfect spiritual aware‐ ness. This seemed to be a more meaningful, and more contemporary interpretation of the metaphor, and a choice which each individual was able to determine for them‐ selves. Jurgen drank his coffee and continued making notes: ‘It seems that it is necessary for mankind to suffer hardship before being rewarded elusive glimpses of the won‐ drous perfection which is the eternal universal spirit. Yet, these sacrifices make attaining that state a more profound experience. (If it is a state which is possible to sustain). Marcel was right when he said, “Now more than ever, humanity needs to establish a direct connection to the guides.” Without connection to the source of spirituality, mankind is destined to remain mortal, to be denied the fruit of the tree of life. Perhaps we lost our innocence when we assumed the role of ‘gods’. He recalled the testaments of several noted scientists and artists, who, at the end of their careers, having dedicating a lifetime of study to the refinement of their craft and to seeking out an explanation to the mysteries, finally discovered an awareness that was there all along - by recapturing the innocence and purity of the perceptions they had had as a child.

IV. DUST

Jurgen didn’t leave the house for a week. A total recluse, seeing no one, taking no calls. He survived on whatever food items he could discover in the cupboard, or melting onto the racks in the fridge: oatmeal, rice, rubbery carrots, vacupacs of raisins, and apples that looked like shrunken heads. Jenna came buzzing around a few times but he didn’t want to get stung. He casually barred the doorway with his lanky body during a brief conversation with Gus; who had ham-fistedly hammered on the door, anxious to tell Jurgen every detail about his Xmas vacation in Altenberg, Germany. Gus had taken part in a Bobsled competition as the brakeman on a two man team; running like a maniac at the start, hopping into the sled, then tucking his head down


behind the pilot and closing his eyes during the entire high-speed run. Once across the finish line, but not a moment before, it was his responsibility to yank hard on the brakes; blades which dug into the ice of the track and brought the sled to a halt. Gus proudly claimed to have also designed the runners of the sled, and was anxious to provide Jurgen with a detailed analysis of the engineering specifications... but they were all distractions. Jurgen was already having difficulty trying to get his own life back on track and avoid having his own tenuous progress turn into a downhill slide; it demanded intense concentration to sit and write new code for hours while burning the midnight oil. Almost all the snow had melted, although the air was frosty and the puddles were still frozen solid all around. He hesitated at the doorway. Watching the world. Some‐ how everything had changed. Finally he cautiously emerged from the house to take his first few tentative steps upon the icy ground. He felt as virtual as a shadow once the sun was gone. The village was perfectly quiet this evening, as if its volume had been set to zero. He made his way around to the back of the house and lifted the old board which held the big doors to the woodshed closed. Tiny icicles tumbled off the door frame as he pulled the door open and stepped inside. Along one wall was stacked a ‘cord’ of wood. At the center of the small shed, an axe was buried into a large tree stump which served as a chopping block. The entire floor was covered by a thick carpet of wood chips. Jurgen smiled when he saw the scooter. It’s funny, he thought, how some objects can become your friend. It wasn’t so bad; at least he hadn’t given it a name. Jurgen powered the scooter up the treacherous, icy hill, arriving at the Akademy with a sense of unease about entering the foreboding edifice after an absence of one month. Vulnerable, apprehensive; uncertain that he could completely rely on his instincts to detect every potential source of danger since his neuron-powered reflexes were still not on full survival alert. He crept into the computer lab at approximately nine o’clock and quickly scanned the dimly-lit scene: only a few students were scattered among the matrix of terminals, their eyes glazed over, mesmerized by their screens. A couple of the really hardcore propellerheads were face down on their keyboards, exhausted, drooling in deep sleep, soon to awaken with a ‘qwerty’ tattoo stenciled in reverse across their forehead. Sitting over at a work station in the corner was the pretty girl he had sometimes seen in the lab but had never spoken to. She was absorbed in her work as if she were on a mission and paid no attention to him. He chose a workstation in a distant corner of the lab and began hauling gear out of his backpack. He knew what he had to do: he wanted to get out of there by midnight before Brak came on duty. He linked one of his portables to the wireless port and began uploading the customized software tools he would need for his clandestine excursion... sitting there watching the little icon spin around. Everything seemed normal but something didn’t feel right. He didn’t know if it was sixth sense or the paranoia of suddenly hearing the tiny sound of Brak’s voice warning him to ‘be careful’ that echoed in his thoughts. Abruptly he escaped out, aborting the data transfer.


It seemed certain that Brak had discovered something during his absence, although Jurgen could only guess what that might be: some residual fragments of data left on the drive, the log or the directory. It is impossible to use a computer and not leave a trace. With expertise and patience the evidence could be found. And as diligent as Brak certainly was, whatever he discovered would immediately be reported directly to Flex Global; the international digital security agency contracted to ensure the integrity of the Akademy’s servers. By now Flex may have already set up scanners that could detect his search agents’ digital profile: a pattern as unique as snowflakes or finger‐ prints. Instead of invisible phantoms creeping stealthily through network, they could become glowing beacons marking his trail like the runway lights of an international airport. The only alternative was to do it the old-fashioned way; manually. Since he was a little rusty, it would be a good opportunity to brush up on the basic skills. On a hunch, Jurgen decided to check out a clue from ‘Invisible Waves’ ~ the cryptic comments: a man code named ‘Archbishop’, and ‘have to pay the piper’. Jurgen scanned the surface level of the network using standard commercial search engines. In a short time he discovered the existence of a Major Archibald Piper, a World War Two hero who held down a desk job in the Pentagon from 1945 until he retired in 1962. Deceased 1965; a single car accident in the Everglades near the town of Chosen, Florida. Jurgen quickly flipped through the pages of access codez recorded in his notebook for the keys that would get him inside. The digital archive was organized to such a high degree of complexity that it approached a state of chaos. It must have been an archivists worst nightmare. Jurgen wondered whether they had the security clearance to even read some of the documents they were supposed to file: Secret, Top Secret, Eyes Only, Unclassified, Declassified, scanned originals, and copies censored with a black marker pen. Many of the files from the 1950’s were indexed in the multi-path subdirectories with a distinctive numeric code, but the actual documents, Jurgen surmised, were stored off-line in a fortified warehouse somewhere, since he could never find them. Perhaps nobody could. An enormous number of files had been produced over the years. It seemed that the primary activity of the staff was to continu‐ ally send memos to each other. Jurgen glanced over his shoulder. Assuming the virtual identity of a high-level authorized user, Jurgen was able to discover several memos and reports referencing research projects conducted by the Starks that were generated by Major Piper during the period from 1954 to 1962. From what Jurgen could glean by quickly scanning some of the files, the Major had appar‐ ently been the archangel designated as the Stark's guardian; watching over their every move like a hawk and determining the destiny of their career. Jurgen targeted a denser cluster of documents created during the fall of 1959. He selected a few files from this batch at random, copied them, fragmented them into tiny chunks, then downloaded them to a server in Ghana. The computer, located in a


mattress factory in Accra, was one of Jurgen’s many safe havens. Like the others, it had previously been seeded with a small program called ‘Dust’ which Jurgen had authored. Dust remained dormant within the system until just such an eventuality as this, at which time the software, awakened by a ping, would begin to recognize and filter out the packets he sent, and forward them on through a predetermined series of routers and satellite relays to their final destination at the Akademy. Once it had completed its mission, the software would erase itself and vanish without a trace -Poof! Jurgen glanced at the time on the menu bar as he transferred the files to his portable deck. Several hours had elapsed while he lost himself in the network, and midnight was rapidly approaching. Anxious to see the results, he gently tapped on the small flatscreen of the portable to open the document files. He just hoped that he had captured enough of the information he had been seeking to make the high- risk approach worthwhile. He had downloaded about a dozen files. Some of the documents were text files, while others were high contrast black and white scans of the original paper communi‐ cation. The images were enormous; coarsely textured typewritten letters filled the tiny screen. When he zoomed out to see the entire document, the type became completely illegible. He was forced to pan the vast terrain with the toggle controller, creating the impression that his viewpoint was that of a fly walking around on the surface of the document. The strange landscape consisted of deep canyons where the paper had been creased and enormous black oceans applied by rubber stamp at the top of the page: ‘TOP SECRET’ and ‘ALOHA’. They seemed to have a penchant for assigning each covert operation with a unique five letter designation, using codewords like a spell or incantation to summon the secret knowledge. Why had they scanned the documents so large? Word by word, he pieced together the message: ‘TOP SECRET ... ALOHA ... Issued October 9/59 ... Memo from ARCH‐ BISHOP ... To WIZARD ... Cameron Stark and his wife Adda... stationed in Iceland... summon for debriefing and evaluation... limited viability of project FLAMING SWORD... sensitive nature of classified research to national defense ... source indicates they do not intend to return to United States upon completion of contract ...have requested clearance from department for travel to Asia ... possible intention to establish contacts within Communist China’. In another document, the Stark’s names had been encoded. Its tone was ominous: ‘TOP SECRET ... ALOHA ... Issued October 22/59 ... Memo from ARCHBISHOP ... To WIZARD ... agree with proposed course of action suggested in garble (an encrypted telegram)... advise REAPER to proceed with arrangements at Wheeler (at that time, a US Air Force base in Hawaii)... travel schedule of Charles and Able Baker has been approved... trust you will ensure that the operation is conducted in a strictly confidential manner’. The third file Jurgen selected, was a memo from ARCHBISHOP to someone named INKHORN, issued on November 12/59. The codename rubber stamped at the top of


the page was GHOST. The brief document read in entirety: ‘ALOHA objective complet‐ ed. 674 should be issued to wire services with appropriate photograph’. The cold logic of the memo chilled his body like an Arctic blast as the full impact of the information kicked in. With trembling fingers he opened the file he always carried with him on his portable deck. The digital yellow newspaper page appeared on the tiny screen, and even at the small size it was displayed, he could clearly read the headline; ‘Scientists Die in Mysterious Crash’. He zoomed in tight on the photo. Cameron and Adda were standing at the top of the loading stairs, framed by the rounded open doorway at the tail of a plane. The white blocks on the airplane’s wheel in the foreground were stenciled in black; ‘Wheeler AFB’. To the right of the plane, past an expanse of tarmac, was a broad flat valley and distant low rounded hills covered in tropical vegetation. As he studied the photo more carefully, Jurgen noticed that the Starks both looked tired and neither of them were smiling, although Adda was captured by the camera’s shutter in the motion of waving her hand. The thing he hadn’t noticed before, was that Cameron’s knee was slightly bent, and that his foot was moving forward, in the action of take a step down the stairs. The caption beneath the photo read: ‘The Starks Depart for the Orient’. Jurgen now realized that they were arriving, not departing and were unwittingly walking into a trap. An overwhelming sensation of sorrow suddenly welled up from within and poured out in a torrent of tears. He leaned forward, and for a long, long time, he wept quietly with his face buried in his hands. “Are you okay?” a gentle voice asked, placing a hand on his shoulder. He imagined it was the voice of a memory from when he was a child. “Momma ... why did they have to die?” he whispered his question, then began crying more forcibly. In his thoughts, his mother put her arms around his shoulders, then pressed her forehead against the back of his head, caressing him tightly until the crying subsided. “It’s all right,” she repeated softly. Jurgen raised his face from between his palms, startled by the presence of real arms wrapped around his shoulders, and real hands pressed gently against his chest. He cautiously sat upright and the arms around him were released. Before he glanced behind himself, he pressed a key on the deck to turn off power to the display, then stared into the void of its blankness for a few moments while he composed himself and wiped away his tears. As he slowly turned his head, he beheld a vision of loveliness; a tall young girl with a slender, well proportioned figure, dressed in the Akademy uniform. Her delicate dark eyebrows and sensual lips contrasted the fair complexion of her thin, noble face. Her dark brown hair, parted in the center, emerged as wisps near her ears. Its length extended to the base of her neck where it curled up slightly just above her shoulders. But it was her eyes; two dark pools of emerald green that


bestowed her face with a tranquil yet intensely-haunting quality. Elusive glimmers in her moistened eyes betrayed that she had also been crying. Jurgen opened his mouth as if about to speak, but no sound emerged. Feeling awkward, he turned back toward the computer, methodically gathered his notebook, pencils, and digital gear then tucked them into his worn blue knapsack. Once again, the gentle voice appeared behind him, “I heard you... you sounded so hurt, lamenting as if someone had wounded your soul.” She had spoken the words as if reciting a poem. Jurgen had been trying to recognize her accent, but its identity eluded him. He paused, checking that he had collected all his belongings, then prepared himself for the vision he would encounter when he turned to meet her gaze. Sealing its velcro flap, he slung the pack over his shoulder as he faced her. He cleared his throat, “Thank you for comforting me... that was very kind.” Unexpectedly, it was her turn to exhibit shyness, imparting a child-like appearance as she timidly confessed, “It was pleasant...” Her voice trailed off. They both stood silently for several moments, staring into each other’s eyes, uncertain what to do. Soon a radiant smile gradually brightened on her face. “Oh... my name is Coraline... Coraline Coventry.” She extended her hand. “Jurgen Ernst.” As they clasped hands, physically reconnecting the bond already established between them, Jurgen had the impression that she was someone with whom he was already very familiar. He found this disconcerting since they were strangers meeting for the very first time. “You are incredibly beautiful.” The realization that he had unintentionally given voice to his thoughts, caused him to release her hand. He was beginning to feel very nervous. He glanced at the clock. It was a few minutes before midnight. Brak! Shit! He needed to get out of the lab. “I really must leave... thank you, I’m feeling better now,” starting toward the door. “Wait, I want to go with you,” she called softly after him. The two drifted through empty corridors and down the stairwells without a word, and soon were standing outside the castle in the lamplight of the snow covered courtyard. The sky was black and the stars were cold and bright. A chill was in the air. Coraline shivered. Jurgen took off his coat and placed it over her shoulders.


“Gallant knight.” She laughed. Her laughter was very pleasant. “You live in the village don’t you?” Jurgen nodded. “I live up there.” She pointed to a narrow, illuminated window high above in the stone wall of the old fortress. “I’ll walk with you to the entrance,” Jurgen offered. Water from the snow that had melted during the day was now frozen into sheets of ice. Holding hands they laughed as they skipped across the treacherous terrain on stepping stones formed by clumps of brittle, dry grass and small patches of snow that made a crunching sound under their feet. It was wonderful! The sensation of joy, and freedom, and innocence that had all but vanished from his life, suddenly emerged like forgotten treasure from the dusty archives of his past. The comfortable warmth of sharing these moments of closeness together made him feel impervious to the chill of the bitter wind in the cold, dark night. So this is what love feels like! Too soon they reached the dormitory, taking shelter in the narrow vestibule where they could catch their breath. Coraline, standing in front of the heavy wooden door at the entrance, looked up at him and smiled, then began to remove the coat to return it to him. Jurgen reached out to assist her, then impulsively, he gently grasped the coat and drew her toward him. Coraline did not resist. Gazing into her eyes, he understood the meaning of their tentative expression; rather than kissing her on the lips, he kissed her briefly, tenderly, on her forehead. Without another word, Jurgen turned and walked away.

V. LOVE

New life returned to the world. The sun shone brighter, the springtime flowers blossomed, and the fertile black earth sprouted with tender green fields of wheat. Their romance flourished like a fairy tale; Coraline was the princess dwelling in a castle made of sand, and he was her valiant prince. He had never felt happier. With the increased intensity of radiant solar energy, Jurgen had regained his strength and once again became almost superhuman. Everything was sweetness and light. His activity accelerated, motivated by the realization that if he applied himself and


focused on his work he could fulfill the terms of his contract with the Akademy by the fall of the year. He was nearly ready, after all, how many years had he spent in this forsaken valley; the land that time forgot? Recently the restlessness had increased. He desired to move on, longing for the excitement of seeing new faces, and experiencing the new places that were out there on the surface of this great, big ball of dust called the world. To complete his plan, it had become his dream to share this adventure accompanied by the beautiful Coraline; the woman he loved, and the woman with whom he hoped to spend forever with, or at least, the remainder of his life. It seemed that providence, or destiny, had reunited them after a separation that had lasted decades, centuries, millenniums. During the short time that they had been together, both had begun to recognize that somehow they knew each other intimately, deeply, and spiritually, in a way that neither had ever experienced before. Jurgen did not want to lose her again. Beginning bright and early the next morning, Jurgen roamed throughout the castle searching everywhere for her. It didn’t take long to find her: there she was coming down the corridor of the second floor; the vision of a dream. At first sight he suddenly became so nervous that he thought his heart was about to explode, but as she approached, he mastered his fear, and a sense of calm prevailed. He smiled, stepped toward her, and gave her a warm hug as if they had known each other their entire lives and she returned his affection as if they always had. Once upon a time... that was the way this storybook began. During a stroll around the castle grounds, Coraline had briefly encapsulated her history: she had been born in a small village in the county of Cumbria on England’s North coast, where she had transformed from a child into a woman in an ancient stone house surrounded by white roses and which had a view overlooking the Irish Sea. Childhood had been a wonderful memory. Coraline had cherished those times with her grandfather when he had painted his pictures in the little shed by the lane, or when her parents had taken her into nearby Blackpool to enjoy the amusements along the Golden Mile; Pleasure Beach, Funland, Jungle Jim’s Adventure Park and the Under‐ sea World. But most of all she enjoyed the time that she had been able to spend by herself exploring her imagination; immersed in the construction of intricate fantastic structures made of pieces of wood, mud, grass and flowers that she had cleverly devised methods of assembling in the garden behind her house. She had explained to Jurgen that the designs she had fabricated during her childhood had appeared to her in visions, which as she matured, compelled her to obtain the skills and abilities necessary to manifest her dreams. She had diligently studied throughout her youth, both on her own and in school, and consequently had been very excited about the opportunity to advance her expertise in the fields of architecture and engineering under tutelage of the notable Masters at the Akademy. In addition to the intensive research projects she had initiated for herself, Coraline worked out in the small gymnasium every day, practiced meditation, and in her free time had continued to learn several languages from the networked computer in her dormitory room: French, Spanish, Russian and Chinese.


Following their stroll, they had come to rest on a marble bench to sit in silent contemplation of each other for some time. Before them were statues of the Angel of Grievous Death and the Angel of Blessed Death separated by a small pond which had frozen over. Jurgen had recognized several similarities between Coraline and himself; physical‐ ly, both were taller than average, each were slim and had dark hair, but the main distinguishing characteristic they shared in common was their driven, relentless passion to attain any goal they had established for themselves. Alas, unfortunately unknown to either of them at the time, the paths describing their destinies had been drafted as a pair of tangent curves, and the attraction of their initial introduction had been the mutual awareness of each other as these paths converged. During the weeks and months that followed they saw each other nearly every single day. Each of them had somehow managed to concentrate fully on their work, having the pleasure of knowing that, at certain times, they would gain respite from their effort to spend in the comfort of unconditional love. It seemed like the ultimate relationship; the flow between periods of work and pleasure had been like a perfect sine wave describing a cycle of intensity and release. They had even begun to establish a routine: usually meeting in the morning for coffee in the cafeteria, then once again late at night for a walk under the stars, often coming to rest on the bench near the pond, watched over by the blank stone eyes of the statues of angels. Soon, Jurgen had introduced Coraline to the small clearing in the forest just below the castle, which afforded a panoramic view of the village and the entire valley. There, resting on the fallen log under the moonlight, they would discuss philosophy, the universe and the nature of design, but they would never kiss. Naturally, other students had taken note of Jurgen and Coraline's attraction to one another and rumors had begun to spread. Jurgen subsequently found that he had regained a place among the company of his friends; the old gang, the whole sick crew, who began coming around again. In fact, they had elevated his stature to that of some kind of hero, buying him round after round at the Screaming Virgin until curfew, compelling him to drink to excess. Katscha moved in close to him one night and slid her hand up his leg, “It’s always the quiet ones,” she said with a wink. Gus would sometimes haul Jurgen home curled up in a foetal position in the back seat. Uncon‐ cerned about the direction the car was headed, Gus would rest his hamhock forearm across the seat and swivel his head completely around: “Hey Jurgen, you fuckin’ scored, man! Coraline is the ultimate babe from heaven. There is absolutely no-one who wouldn’t want to explore that uncharted terrain, unless, I suppose, if they were dead.” Gus would then burst out with a hearty laugh that soon disintegrated into a hacking wheeze, which ultimately compelled him to cough up chunks of phlegm. Jurgen would have liked to discuss the situation with Gus - to explain the anguish and frustration he felt, to tell him the truth; that Coraline was indeed an angel from heaven, but unfortunately with an intrinsic purity that exempted her from the common


desires afflicting mere mortals such as him. But he knew that Gus could never under‐ stand; perhaps no-one ever would. “You must remain strong. You must conquer your desires with discipline. Only then will you achieve a higher awareness.” Coraline had recently begun instructing Jurgen in the art of meditation. They were alone, sitting on cushions in a casemate; a small room with stone walls and stone floor, in which, long ago, a cannon had been posi‐ tioned in defense of the castle through the narrow opening in the wall. This was now a quiet area into which students could retreat from their hectic schedule for moments of privacy and solitude. They had soon begun a ritual of meeting in the small room every morning. Coraline had taught Jurgen to relax and clear his mind, and in time, demonstrated how they could communicate with each other within a meditative state. Eventually he experi‐ enced the pleasurable sensation of entering her being, then later learned how to become attuned to the frequency of her energy vibration. He could determine how she was feeling; if at her core she was internally happy, sad, tense, or upset. Gradually he seemed to develop the ability to be able to read and understand her thoughts, or sense when she was emerging from the meditative state to regain her consciousness of reality. One time when she had suddenly opened her eyes, startled from her deep state by a nightingale which had called out loudly from the window, he briefly caught a glimpse of himself from her point of view. It was a very strange sensation. Through this training, a degree of telepathic communication began to manifest itself within their regular lives. With intensely focused concentration they were able to beam messages across the room to each other like wireless portable decks. Coraline insisted that they continue to practice honing their ability during their customary late night walks, and Jurgen, also fascinated by the phenomena, had no hesitation in agreeing. Soon this telepathic exchange became effortless, and intensified to the point that whenever they were together, they seemed to prefer this silent, intimate exchange rather than engaging in verbal communication. It wasn’t long before Jurgen had introduced Coraline to Marcel and Angelique. Together, the former trio, continued the Planchette’s tradition of weekend country drives in the electric car, but now as a gang of four. It remained unspoken, yet was clearly evident, they were pleased Jurgen had found a companion. Marcel behaved himself when Coraline was around; he seemed to become more dignified and reserved as if acting the role demanded by his profession as an Akademy instructor, and rarely launched into one of his notorious soliloquies. When Coraline revealed that her research work was inspired by the designs found in nature, rather than by the classic architecture of Prague, Vienna, or for that matter any other major city, their excursions began to lead them further afield: into the Beskydy mountains in Northern Moravia, the glacial limestone lakes found in Sumava, or even to the Erzgebirge Mountains along the Czech - East German border, whose dead forests were monuments grimly proclaiming the dangers of air pollution and


acid-rain. Coraline was fascinated by birds - quickly identifying nearly every species that she observed through the pair of binoculars which she always carried with her; ducks and wild geese in the reed-beds of the medieval Trebonsko fish ponds, or the Marsh Harrier and Collared Flycatcher nesting near the Odra River. One day in the Ash Mountains, wandering through a narrow valley near Praded Peak, Jurgen and Coraline found themselves alone. Tired from the hike, they sat together on a large flat rock resting beside a narrow stream. Coraline’s face had flushed with a healthy glow from the exercise and fresh air, thin strands of hair moistened by perspiration caressed the side of her face. She looked so lovely in that setting that Jurgen could only gaze in wonder; it was like studying the finest portrait ever produced by the world’s most talented artist. Impulsively he leaned toward her and kissed her tenderly on the lips, then withdrew a short distance to see what her reaction would be. He was surprised that she quickly returned his challenge with a lingering kiss. An eternity passed in this brief moment as the entire world stood still. Kisses sweeter than poison; an affection that Jurgen craved like an addict after the isolation of a hermit. As they kissed he slowly moved his hand along the muscular firmness of her thigh. Briefly his fingers came to rest nestled in the warm softness of her narrow seam, causing her to release a gentle moan. He was fully erect, its powerful force urging through the fabric of his trousers like a flag pole, his testicles swollen to the size of tennis balls were threatening to involuntarily unload. Oh god how he ached for the pleasure of unifying their bodies - right there on that rock in the warm sunshine by the stream, to desperately realize a sensation he could only imagine; the sensation of enveloping her while she completely enveloped him. Coraline did not forcibly push his hand away. Rather, she held it tightly, raising it to her lips to kiss his fingertips, then placing his palm against the side of her face to allow Jurgen to run his fingers through her hair. “Dear sweet Jurgen, we must not give in to temptation, not now...” her voice trailed off, she was breathing heavily - her words had been spoken softly in a British accent, which often only became noticeable when her emotions had been stirred. She looked up at him with clear green eyes. In the sunlight he could see the faint traces of freckles that spanned the bridge of her nose. “I will always love you,” she said as she wrapped her arms around his chest. Jurgen released an anguished groan as his heart was pierced by a sword. Here it was one week later and he couldn’t drive the images from his thoughts; neither the pastoral splendor that the scenery had created, nor the overwhelming sensation of lustful desire which had played upon that stage. It was a tragedy! He could rationalize the situation by comparing their circumstance to charged particles in physics; once the particles exceed a certain limit of proximity to one another, they either unite through bonding, are forcibly repelled, or on rare occasions, theoretically, have the potential to totally annihilate each other. In any event, whatever


happened would precipitate a radical change of state. He realized that Coraline’s passion was dedicated to her work, and that the closeness of their attraction threat‐ ened to disrupt her concentration. He could understand the situation, as it affected him the same way, although the logic did absolutely nothing to ease the pain; the gravity was real. Suspended, floating at a point somewhere near the center of an impossible triangle, where gravity is neutralized and weightlessness begins, an optically illusory structure which positioned Coraline, Master Brontchev, and Dr. Planchette; the Sun, The World, and The Moon, at its vertices. Jurgen chased away his daydreams and returned to work.

VI. FAITH

Toward the middle of February, Jurgen presented Master Bronchev with the design specifications for the software project he would conduct as his graduation project. It had taken one week to formulate the proposal; rewriting it several times before the document clearly presented his project’s technical considerations in a concise language. In summary, Jurgen’s proposal was to design a new species of digital agent; service robots that could explore an information database and (re)organize the data into a computer readable format. At its core, the code created a heuristic engine which provided the robots with the ability to analyze the semantics of stored information content and redefine its context in relation to a growing, ever-branching global directory. Jurgen illustrated that this organic process was analogous to the activity of the human mind during a state of sleep. With the cessation of constant input stimulation, the brain at rest is able to reorganize the clutter that has accumulated during the day; indexing the subject matter of stored knowledge and rearranging its hierarchy. Information that, in the past, has proven to be more frequently required is stored in one region to enable quicker access, while other less essential data is shunted out to regions further away and placed in long term storage. Jurgen speculated that in the human mind, dreams occur during this reformatting process. The robots that Jurgen intended to develop were much more dynamic, since they would never need to sleep. They would automatically verify, optimize and classify incoming information before assigning it to a location within the structure’s hierarchy. They would continually perform routine maintenance tasks to clean up any clutter by discarding information that is redundant or obsolete.


The resulting relational database would be highly organized and efficient; residing within a mobile personal computer it would transform it into a ‘guide’. The nature of the customized information, determining the function of their guide, would be defined by the user; it could become a personal advisor, a spiritual guru, a financial analyst, or even a fashion consultant. Specialized databases would provide corporate managers, research scientists, or medical personnel, for example, instant access to the ‘best available knowledge’, enabling them to make a complex or critical decision. More importantly, the intelligent agents learn to recognize the needs of the masters whom they serve and teach. Through interaction, the digital entities gradually determine patterns within the preferences of their master’s thought processes, enabling them to seek out and gather the next batch of information which logically follows a previous inquiry, in other words, they are continually aware of what their master needs to know, well before their master does. Ask it any question and it immediately responds. In the future, Jurgen projected, the unique ‘machine encoded’ format of the digital data within the directory structure; consisting of unlimited, interconnected fragments of ‘meta’ information, would provide the capability of being translated and spoken/ listened to in any international language. The proposal concluded with a request for a private research space and a dedicat‐ ed machine within the Akademy. This facility would enable Jurgen to conduct the extensive testing which was essential, since, when ultimately released, these robots, like ants, would spread out through the global network, harvesting data resources from every remote host encountered, before returning to cache this information back ‘home’. As their creator, it was Jurgen’s ethical responsibility to ensure that these robots were distinguished with an encoded identity marker to make them detectable within the network, and prevent them from accessing secured proprietary information. Master Bronchev was impressed by the presentation, and deemed the project to be worthy of fulfilling Jurgen’s contract with the Akademy. Even as he sat within the Master’s oak paneled study, Jurgen was already contemplating an early release; if he devoted himself to this project he would be able to escape the constricted confinement, which he had recently experienced even thinking about the Akademy, well before the completion of the mandatory four year term. At that moment he had wondered if the Master, now subtly wringing his oversize hands, was contemplating this same idea. Certainly the Master had recognized that Jurgen’s talent would be an asset, or in cruder terms, a commodity of value, when the Akademy represented him in negotiating his placement within the corporate world upon completion of his term. The Master had readily agreed to provide him with an ‘office’ in the castle; a small room at the back of the main building’s third floor, furnished with whatever hardware Jurgen desired. That was the good news. What, at the time, had seemed to be the bad news, was that the Master insisted that Jurgen team up with another student; a young Russian named Ruza Blazhek - reputedly a gifted programmer, in order to complete an accelerated software development program.


Extremely disappointed by his Master’s suggestion, since he had been determined to develop the project on his own, Jurgen returned to immerse himself in the depths of melancholy within the quiet solitude of his room. It was a silence soon shattered, however, by the sound of violently squeaking floorboards emerging from Gus’s room, accompanied by lustful screams and shouts of encouragement which he recognized as Mrs. Boshovsky. Jurgen couldn’t help thinking that this performance had been enhanced for his benefit; since Jenna was perhaps spiteful that, since New Year’s eve, he had evaded her numerous advances. Although this disturbance had not lasted long, it provided Jurgen the incentive to finish off half a bottle of Brandy; the remainder of his Christmas medication, then promptly go to bed. Jurgen’s apprehension about working with a partner did not evaporate quickly. For his initial meeting with Ruza Blazhek the next day. Jurgen took an elevator to the top floor of a dormitory, situated on the opposite side of the castle grounds from the building Coraline was staying. From there, Jurgen eventually discovered a narrow fight of stone stairs leading up to what had once likely been a watch tower. He was greeted at the door by Ruza; a young man of average height, casually dressed in a ragged black t-shirt, plaid shorts, and expensive brand-name running shoes. His round face was characterized by a pleasant grin, patches of unshaven facial hair that created the impression of a goatee, and intense curious eyes glimmering within a pair of darkened hollows. He wore his long dark hair tied back at the base of his neck, his ghostly pale skin was illustrated by numerous tattoos. Particularly striking was the ominously large devilfish covering his entire upper left arm. “Call me Rujjie, or ‘Ruj’,” Ruza said in introduction as he led Jurgen inside his small room, kicking a cardboard box out of the way. “Sorry about the mess, but I don’t do much entertaining.” Dead air reeked with the foul odor of garbage and tobacco smoke. The tiny room appeared not to have been cleaned or to have even seen any light since the day Ruj had moved in over three years before. All of the tall, narrow windows in the circular room were covered over in thick curtains, casting it into perpetual darkness. In true hacker aesthetic, most of the space was given over to computer hardware, numerous peripheral devices and several display monitors lighting portions of the room. Jurgen couldn’t help but notice that the image on one of the displays was a photograph of a naked man and woman in an erotic position that seemed like it would be physically impossible to attain. The twilight glow of the monitors made it difficult to discern the identity of the piles of dusty objects scattered around the room, or to clearly understand the nature of the strange cuneiform symbols encoded on ancient scrolls of computer printout that decorated the walls. During the entire time they sat and talked the gloomy atmosphere was punctured by the bruising grind and blasting fury of heavy metal played at low volume from hidden speakers throughout the room. First impressions, though lasting, are often misleading. As they began working together, literally back to back within the cramped quarters of their ‘office’ space; a tiny stone room with no windows on the third floor of the castle, intimacy was their only


option. Fortunately, Jurgen discovered that Ruj was enthusiastic and pleasant to be around; often laughing and making jokes. The darkness in his soul, he had later explained, was a genetic Slavic disposition, that had been amplified by the poverty of growing up in a Moscow suburb. Not only had they discovered that the equally matched ability of their coding skills were complimentary as opposites, it had also not taken long to realize that their organizational interests and personal habits also followed suit; Jurgen was order to Rujjie’s chaos. It was as though upon taking responsibility as the project leader that Jurgen had determined to ensure that the surfaces of his work areas were always neat and carefully arranged. Perhaps it was to set an example to contrast the avalanche of clutter from Ruj’s half which continually threatened to engulf the room. While Jurgen arrived punctually at ten o’clock every morning, Ruj often sauntered in around noon disheveled in a mockery of his school uniform that he had modified and desecrated until it had become almost unrecognizable. It was a superficial dynamic which occasionally led to friction, yet both were aware that they were actually not that different, and perhaps they had intentionally created a sense of opposition in their forces as a way to continually energize their partnership. Rujjie was the devil’s advocate by his own admission. In fact it defined his character. While he was firm in his devotion to the Russian Orthodox church; the gilded domes, the Holy Synod, the icons, the incense, the deeply stirring sonorous voices -the liturgy of the Byzantine Rite, the ultimate communion that one day all humanity would be united at the Mystical Wedding Banquet Table of the Lamb of God yet he chose not to live like a saint. If there seemed to be a contradiction, it was a result of his own internal struggle. It was his belief that it is necessary to experience life to its fullest, its pleasure and its vices, and to continually doubt, then reaffirm one’s faith on the path to spiritual fulfillment. “The greatest evil is the complacency one has when they believe that they are completely good and true,” Rujjie would say. “What is the difference between one path or another if the destination is the same? "Odin’ ebe’tsya, drugoi draznitsya, kakaya raznitsa,” quoting one of the many strange proverbs of his grandmother. Rujjie had a passion for vodka, chess and women. Chess to him was not just a game, it was Armageddon; kings and queens and knights and pawns struggling on a spiritual terrain. He always chose black. He claimed that his strategy in chess, as well as life, was to learn about evil’s strength and discover secret methods by which it could be defeated. The vodka and the women, in this same way, were also the temptation of evil; taken to excess was the only way he could learn of their darkest power. He didn’t find the women in the castle attractive, preferring the young girls of the village. Because of his dress and mannerisms they were attracted to him in the same way that groupies devote themselves to a rock star. Rujjie claimed that vodka mixed with reindeer antler blood was a very powerful aphrodisiac; allowing him to take on four frisky young girls at a time.


It didn’t matter to Jurgen how Ruj lived his life, since he had demonstrated that he was intensely committed to their project. Ruj had immediately grasped the concept that Jurgen intended to achieve; continually providing fresh perspectives to the approach, and innovative solutions to the problems they encountered as the project progressed. “This software will do all the work for you like Kinkach Martinko,” Rujjie was fond of exclaiming; in reference to the Slavic equivalent of the folk tale of ‘Rumpelstiltskin’. For some time they explored various possibilities of a name for their software, but none seemed entirely suitable. Finally, one name that they both readily agreed upon appeared late one evening during a philosophical conversation; a frequent pastime of the two. Ruj had remarked: “How can people believe that the database (of accumulated knowledge) is accurate and true? Answer: the same way they can believe in anything that is incomprehensible, unfathomable, and absolute; simply by having faith. Most people have a sense of when they are being told the truth or when they are being told lies, and unless they have complete faith in their guides, they haven’t got a prayer.” From that day hence, the software was code-named: FAITH. Ruj had approved of the choice since it seemed to bestow a profound religious significance upon their labour. Jurgen, on the other hand, while he took the project very seriously, considered the name to be more of an ironic, or humorous designation - the perfect name for vapor-ware; the type of software that had fueled speculation in the stock market at the beginning of the century, resulting in such disastrous conse‐ quences for the panicked investors who had ultimately lost their life savings by believing in the hype of charlatans.

VII. THE HANGED MAN

Throughout the springtime, energized by the progress that he and Ruj had been making on their project, Jurgen once again became totally obsessed with work. For him, it was the process of applying the information he had discovered during his insatiable quest for knowledge that had given his life its meaning. During this explo‐ ration, studying such diverse topics such as; insects, computer viruses, genetics, biomechanics and cognitive systems, key pieces of information seemed to appear when required. As the pattern began to take shape and he could recognize the connection between the elements of its structure, his quest became his means to enlightenment.


It was a dangerous activity. Like Rujjie’s journey, Jurgen’s own path often led him into treacherous terrain, threatening to entangle him like a spider caught in a web of its own delusion. It was the eternal fear of peering amid the mist of mysteries and obtaining awareness of an energy so powerful and so impossible to fathom that it could permanently overload his circuits. Or conversely, perhaps he would be destined to eternally pursue an elusive goal which continued to remain just beyond his reach, with its attainment his escape ~ an addiction that could ultimately plunge him into a darkness which consumed him with its desire. Whenever they met for breakfast, which for Jurgen usually consisted of several cups of coffee, Coraline often expressed concern that his relentless schedule was begin‐ ning to wear him down. She noticed that he was losing weight and seemed to con‐ stantly have dark patches under his eyes. He explained that writing the code for FAITH was a lot more difficult than he had originally imagined. There were so many details that needed to be attended to; many small problems each requiring innovative solutions, which once resolved, in turn created an entirely new set problems. He had been struggling to manage the parameters of the program to keep it from infinitely expanding and spiraling out of control. They no longer spent much time together, not even during the weekend. He could sense Coraline was unhappy that they seemed to be drifting apart, but what could he do? He desperately loved her with all his heart, but it seemed that they had already achieved the limit of their physical intimacy; it was so difficult to manage the sensation of lust - the desire to naturally express his love that still coursed through his body like pure testosterone. Often he had become aroused by just gazing into her sensual emerald eyes... and the way her school uniform wrapped itself tightly around the contours of her voluptuous body... She could read his thoughts; she frowned and sadly shook her head. ‘You need to love me with your soul, before you can love me with your body’, her voice seemed to say. She got up from the table and left the cafeteria for her morning workout in the gymnasium. Jurgen sat at the table for quite some time contemplating the dark, reflective surface of his coffee: ‘His soul?’ He left a note on Rujjie’s workstation to inform him that he was taking the day off, then made his way down into the dungeon to find Marcel. As he drifted through the narrow stone corridors, he could detect a strong chemical odor emanating from the lab, quite some distance away. By the time he reached Marcel’s door, the fumes were so strong they stung his eyes and made it difficult to breathe. Inside, Marcel was wearing a breathing apparatus like a diver with two small tanks on his back. He whirled around in surprise when he detected Jurgen’s presence, quickly grabbed another tank from a hook on the wall, and rushed over to help Jurgen put it on. Soon Jurgen was breathing pure oxygen, the only smell was black rubber. Adapted from a war surplus gas mask, the apparatus was fitted with two round glass goggles and modified with a small microphone and speakers to facilitate communication. The


sound was extremely clean. As they talked, Jurgen experienced a moment of déjà-vu; since the speakers seemed to simulate the clarity of some of his telepathic conversa‐ tions with Coraline. Marcel had just finished giving one of his fabricated girls a thorough scrubbing with acetone while she lounged in an old porcelain bathtub. Now he needed to lift her up and place her on a rack to dry. “I’m glad you’re here, I need a hand. I thought I could do it myself,” came the voice in Jurgen’s ear. “Here put these on,” Marcel said as he handed Jurgen a rubber apron and a pair of high-top rubber gloves. “Careful, she’s slippery, and she weighs over fifty kilos,” Marcel advised. “This is the last one. I was supposed to ship them yesterday, but I am running behind schedule... I worked here all night.” Marcel sounded tired and the lab was a mess; evidence supporting his claim. Chemical containers were scattered on shelves haphazardly: acetone, ammonia nitrate, mercury salts, sodium sulfate, hydrochloric acid, and sodium cyanide. Some containers had spilled, leaving a white frothy residue where the chemicals had eaten into metal or stone. While Marcel attended to the young woman now suspended from the rack, Jurgen’s eyes explored the room. Three of Marcel’s creatures were ready to ship, lying naked in open wooden packing crates: one young woman, one older woman, and an athletically endowed black man. Their eyes were closed, creating the impression that they were resting peacefully. They looked so realistic that Jurgen wouldn’t have been surprised that if he had kicked their coffins they would have jumped up from the dead. Jurgen could hear the continual sound of Marcel’s laboured breathing through his earphones. Occasionally the phrases, “So what do you think... How do you like the paint job... Aren’t they lovely machines?” would appear. Later Marcel modestly admitted, “I’m just the technician. I give full credit to Angelique, the artist who applied all of the colouring and make up." Every detail was subtle and believable: the slight trace of bathing suit tan line on the mature woman, light bronze eye shadow and burgundy manicured nails. The young girl’s fair skin was blushed at the cheeks and nipples, tufted auburn pubic hair nested a glistening ruby, and there was a small tattoo of a blue butterfly on her left shoulder. The muscular, dark-skinned man had a large permanent erection, and a lighter skin tone on the palms of his hands and the soles of his feet. As sexually realistic as they were they did not stir any desire. Jurgen wondered if coroners felt that way. Marcel later showed Jurgen a concoction to which he added human pheromones to impart a realistic fragrance to the silicon flesh.


“I am zee alchemist, I can perform many miracles, I will make for you zee love potion ... after all, that is why you are here, no?” Perhaps it was the pure oxygen pumped through the breathing apparatus that had generated the euphoria, but Marcel began to appear strangely comical in his mask; like a space alien in an old science fiction movie. Jurgen burst out laughing, Marcel joined in, and soon they were both doubled over holding their sides. Realizing that they needed to get out of the poorly ventilated lab, they put on their coats, exited the castle, and didn’t stop walking... “Angelique was with me all night. She drove the car home. I better not phone her, she’s probably still sleeping... she is an amazing woman... I don’t understand how she puts up with me.” It was already getting dark as they made their way through the swamp. Marcel led the way and Jurgen followed closely; stepping only in Marcel’s footprints so as not to sink out of sight in ground which was marshy and soft. Marcel fired up a reefer, which they passed back and forth, prompting Marcel to deliver a short discourse on the topic of ‘Love’: “Love isn’t just the most mysterious force in the universe, it is the only real force in the universe. To have faith, is to have faith in love. Physicists have discovered that all energy is capable of being transformed into any other form of energy by using suitable means, and similarly, mankind must learn to direct the force called love in the service of creative rather than destructive purposes.” When they had arrived at the fork in the paths; at the intersection surrounded by bleached out cattle bones, they stopped for a few minutes to catch their breath. Marcel added, “I am an optimist. I believe that we are born with an inherent ability to love, or in a sense, we have an antenna tuned to the frequency of universal love, which if we maintain dialed in, provides a source of unlimited energy. Which reminds me...” He pulled a cell phone from his pocket, flipped it open with practiced grace and punched in a numeric code. “Hello honey, guess where I am?... We’re going to have a guest for supper.... No, don’t worry, I’m sure that will be fine... it’s just Jurgen and he looks hungry enough to eat anything.” Marcel winked. As they made their way up the hill to be greeted by Cerberus, Marcel imparted one final piece of wisdom: “You need to experience love before you can share it, yet you only receive love when you give it away. Life is a paradox, no?” Angelique fidgeted nervously throughout supper. Jurgen at first thought she was anxious that she hadn’t been given adequate time to prepare an elaborate meal, but he soon discovered that their delicious banquet was not the cause of her uneasiness; she was apprehensive about Jurgen’s reaction to his portrait she had recently completed.


After supper, glasses of wine in hand, the three made their way up to her studio in the loft. With little ceremony, Angelique hesitantly withdrew a white cloth to unveil the large painting which was still resting on the easel. Jurgen was speechless, nearly overwhelmed by the immensely talented rendering that graced his eye: The portrait was based on ‘The Hanged Man’ from the Tarot; a card representing self sacrifice. In the painting, Jurgen’s image was suspended upside down, hanging by one foot from a branch connecting two sturdy oaks. The tree's verdant foliage was contrasted by the bleak desolation of the painting's background; a mountainous landscape of ice and snow, which depicted on the left side of the scene, a deep fissure in the ice which radiated clouds of steam. Angelique had captured a peaceful look of quiet contemplation on Jurgen’s face, which was surrounded by a glorious, radiant halo of energy. As with the work she had performed on the creations in Marcel’s lab, the painting was accurately realistic in every detail. Marcel explained: “The painting represents the process of transformation between a material and a spiritual consciousness - a sacrifice of physical temptation which brings about redemption through unity with the collective forces which guide the universe. It was my suggestion to introduce a connection to Norse mythology, since I am certain it is part of your ancestry. Odin, whose counterpart is Hermes from the Greek pantheon, was said to have hung upside down for nine days in order to gain entry to the under‐ world, thus enabling him to understand the meaning of the runes; the sacred inscrip‐ tions carved in stone. Odin’s apocalypse was Ragnorok, a disastrous event brought about by his pride. It is the final act of Wagner’s beautiful symphony, Gotterdammerung; ‘The Twilight of the Gods’.

VIII. GRAVITY

Gravity is an unexplained phenomena... The late summer weather had been dry for several weeks; acrid yellow skies during the day, dense with dust blowing off the farmland. The windows were closed tight to keep the grit out of the hardware. It was hotter than hell inside his apartment. His clothing was soaked through with sweat by the time the sun came up. This morning he watched the huge, black anvil of a thunderhead forming where the cold front drifting in off the Baltic Sea collided with the warmer air rising up from the land. The cloud quickly grew in size as it gathered up moisture.


A powerful storm was brewing. Jurgen had a premonition that it was coming; he could feel it in his bones. He had been awake all night anaesthetizing his artificial life programs; placing them into a dormant state ~ book-marking the progress of his experimentation so that he could continue later from where he had left off. Now he disconnected the power cables from his hardware and sat down on the wooden box by the window to await the storm’s arrival. To pass the time, Jurgen decided to explore another chapter of the Stark’s lives and careers; files he had previously downloaded but had not yet reviewed. He slid a memory stick into his portable deck; a flat tablet about the size of a book, but only about 25mm thick. The screen, covering most of the surface area, flickered to life. Along the right side were several switches, a navigation controller in the lower corner and a microphone indentation at the upper right. The microphone was used for voice commands and to enter text. The deck could speak, but its switch was permanently set to the ‘mute’ position. Jurgen didn’t like the tone of its voice; it reminded him of the voice you hear in waiting rooms and airports. He preferred to use his eyes to scan the data on the screen. It had taken some time before the incentive returned to continue with the story, once the ending had been revealed. The circumstances surrounding his grandparent’s disappearance would likely always remain a mystery, since Jurgen had no interest in digging up skeletons from the past. ‘What’s done is done’, a proverb of Rujjie’s own grandmother. After all, it was an event which had happened almost fifty years before. Yet, while it was a tragedy that had affected him deeply, Jurgen preferred to use his understanding about the lives of Cameron and Adda Stark in a positive light; it had provided him with a point of reference to gauge his own progress, and to assist him in making decisions which were in harmony with the direction already plotted by his destiny. Since his youth, Jurgen had been thoughtful; the sensitivity of his awareness had been tuned to a very fine degree. Most often during his life this was considered to be a personality flaw; a weakness which separated him from the flock and left him vulnera‐ ble and isolated. As a result, it created a permanent condition which necessitated that he become self-reliant and develop inner strength. Yet, during moments of fear or uncertainty, he realized that he had no-one to turn to as his guide. These moments would always pass and he would somehow find the courage to continue on again, but it always seemed he was drifting; meandering without purpose or destination. Now, as he discovered information about the Starks' lives, his own had acquired a more profound meaning. He began to recognize inherited characteristics that had been encapsulated in his genetic code, and in a broader sense, he began to realize that a pattern was emerging, that his life had been unfolding in similar manner to theirs; that if the vibrant path of his own journey were placed in register and superimposed on theirs; an ancient graph that had become indistinct through the dense layers of data accumulated by the yellowed acetate of time, the points could be now be plotted where the two paths were aligned. Perhaps this is what had taken time; to prepare himself to receive an indication of where next that path would lead.


Jurgen tapped open text files on the flat panel display; isolated moments of history linked in a chronological progression: In November of 1957, a dog named Laika was orbiting the Earth every 100 minutes. The fact that the dog was inside a 500 kg. Russian satellite called Sputnik II, had turned up the heat on the Cold War by several degrees. The US military realized that the Space Race had started without them. As soon as its enemy had achieved control of outer space, they feared, it would provide a platform from which to rain down weapons of mass destruction upon American soil. Sessions were called by military brass to reorganize their strategy. Projects whose benefits could not demonstrate immediate strategic value, like the Starks' artificial simulation project at White Sands, were immediately shelved. The impetus now was to develop new projects to regain their tactical advantage. As a result, the Starks were immediately reassigned to the Nevada Proving Ground. Although it was the worst possible news, Cameron and Adda were determined to make the best of the situation. The silver lining on their dark cloud was that during the journey from southern New Mexico to central Nevada they had decided to elope. They arrived on the Las Vegas Strip at midnight with everything they owned in the trunk of Cameron’s black sedan. Colourful swirls of neon light reflected off the polished hood as they headed directly to the County Courthouse, showed their military ID, and paid in cash for a marriage license which would remain valid for one year. By one o’clock in the morning they were standing at the alter of the Wishing Well Wedding Chapel. For twenty dollars the brief ceremony included a wedding dress, an ill-fitting tuxedo, a bouquet and a set of glossy photos (the military file had copies of all the receipts). For a witness, the minister had awoken an old guy named Bill Smith, who worked the night shift at the tiny chapel; sleeping on a pew in the back row until his services were required. The wedding ring had been Cameron’s most cherished keepsake. When he told Adda the story of the ring, she had begun to cry; the ring had been his mother’s ~ placed on her finger by the surveyor who would later be killed by a leopard in Uganda. After she remarried a wealthy banker, his mother had given Cameron the ring saying, “Someday I want this to be for your bride.” Leaving Las Vegas, the young couple ate slices of a wedding cake they had bought at the Star Garden Bakery, then drove 90 miles across the Nevada desert toward a fate that they had dreaded; taking up residence in close proximity to an atomic bomb testing site. They moved into a small white bungalow in Mercury; the company town adjoining the base, then a few hours later - as the sun was rising - they reported to work at a facility located within one of the grid-like subdivisions designated as Area 51; also known as Groom Lake. Due to its remoteness, the site had recently been used as a testing ground for ‘black budget’ aircraft such as the U-2 spy plane. It was not the perfect honeymoon.


Jurgen tumbled through the files like dominoes, collecting fragments of information here and there, assembling them in his thoughts to form a more complete picture by which to understand the story. Many files had only a brief mention of the Stark’s activity or referenced them in a tangential way. Other documents contained very specific, detailed information which will likely continue to be forever locked away. What Jurgen had discovered always made him wonder what had not been revealed. Several documents indicated that the Starks were initially assigned to a secret military project intended to construct a device referred to as ‘The Holographic Cannon’, capable of projecting images of ‘simulated’ assets within an enemy terrain. It was imagined that the appearance of decoy planes, tanks or possibly even troops, would create a convincing illusion, diverting the enemy’s attention away from an actual attack. Cameron became increasingly dissatisfied under the project direction of [name deleted from the document]. During the course of several tersely worded handwritten memos to his superiors, he expressed concern that the project was unlikely to achieve any practical results. As an alternative, Cameron had submitted sketches and docu‐ ments detailing a new type of weapon which he and Adda had taken the initiative to prepare. Although his correspondence apparently ruffled more than a few feathers, by late in the year the holographic project was discontinued and the Stark’s proposed project commenced - with Cameron as its leader. Cameron was a voracious reader; regularly consuming vast quantities of military reports (which his high level security clearance enabled him to access), and digesting a constant stream of complex physics theories. He was intrigued by a wide variety of topics, but in particular, he had become fascinated by the concept of an anti-gravity device; a notion which had recently come into vogue in both the military and popular culture; ‘This Island Earth’, foo fighters over Greenland and the Spokraketerna at the close of WW2. These chimerical, mythical objects were also circulating within classi‐ fied military research and development reports. The experimental work undertaken during Project Gold Bug and Project Winterhaven, and a detailed report entitled ‘Electrogravic Systems’, commissioned by the USAF just the previous year, provided Cameron with tangible information, and were the source of his inspiration. Jurgen opened another collection of digital files, each containing actual-sized black and white scans selected from several of Stark’s lab journals from early 1958. The sequences were fascinating. Each image consisted of a pair of facing pages from a small, tattered, unruled notebook; a format which viewed at 100%, perfectly filled his tablet’s screen. Handwritten technical notes were jotted down in point form, accompa‐ nied by conceptual sketches and numerous complex calculus equations. He turned the page and a small, compact saucer-shaped object appeared on his screen; the prototype of an anti-gravity device which the Starks had identified as the ‘Ultrasonic Invisible Weapon’ [UIW]. The schemata indicated that the object was approximately one meter in diameter. Its outer structural shell, manufactured to Cameron’s specifica‐ tions by the Naval Surface Weapons Center, consisted of a high-density plastic infused with Bismuth; a white, crystalline, highly lustrous metal. At its core, the device was powered by a small reactor fueled by uranium; the catalyst driving a gyroscope


formed by atoms rapidly rotating within a polished sphere of solid fused crystal quartz. Jurgen was amazed that the device had no moving parts. Each component had been arranged in a manner which redirected and synchronized the energy existing at the subatomic level within their specific material; utilizing the dynamic bonds holding tiny elementary particles together as they drifted through the vast universe within the quantum field which gave each component its mass. It sounded like science fiction, but Jurgen was familiar enough with the properties of the individual materials to recognize that by restructuring this dynamic energy, an electromagnetic force could be generated which countered gravity and would cause the disc to levitate and hover at any altitude. Ionized clouds of electrostatic energy, a by-product of its own internal reactor, would provide propulsion to maneuver the craft, enabling it to advance on a gravity wave similar to the way surfers ride an ocean. The craft could instantly accelerate horizontal‐ ly or vertically before returning to a steady hover. During the entire time the disc would remain parallel to the surface of the planet. Jurgen’s attention was drawn to certain passages that had been isolated on the pages, encircled by a crude dark line (likely originally red). These aggressive bound‐ aries enclosed fragile arrangements of cursive script that had been carefully formed by a delicate feminine hand. As he read the content of these regions, Jurgen noted they often recorded poetic, contemplative philosophical observations on the nature of their experimentation. In these notes, Adda likened the atmosphere to an ocean in which the air is also fluid; its molecules affecting the craft’s trajectory. Their experimental craft, whose mass could counteract its attraction to the underground sun - the molten liquid core (the source of gravity waves) at the center of the Earth, to voyage through this ocean of air. She imagined the disc maintaining buoyancy on these invisible waves by calibrating the frequency of its driving oscillator with fine precision; that by balancing the forces the disc would begin floating once its resonance point had been achieved. Each component of the device could be thought of as a section of an orchestra, performing a symphony of ultra-sonic frequencies attuned to a mathematical score. An object’s mass, similar to a music composition, is often perceived as an undivided whole. Yet with simple understanding, an awareness is formed that each are actually complex arrangements of encoded information, structured in a specific way. Se‐ quences of musical notes perched on a staff are as commonly seen as a flock of tiny black birds resting on power lines. Unseen are massive galaxies consisting of billions of stars in the depths of space, and also their counterparts in the micro-universe. The relationship between particles of each individual atom are as subtle and intricate as our own solar system. No matter how closely we study a complex system, all that is revealed is even greater complexity. Adda often referenced the work of a philosophical physicist she admired, a man named David Bohm. She quoted: ‘Electrons unfold from their medium, appearing or disappearing to our sight... Reality is a surface, behind which unknown or unrecognized forces operate....”


The planet electron orbits its star; the nucleus of an atom. Relatively, incredibly faster than the period of our solar year, its orbital frequency approaching the speed of light creates the appearance that, during an instant of time, the electrons have only a probability of existence somewhere within their quantum field. Similar also to our solar system, matter is dispersed throughout the vastness of space, more densely concen‐ trated in certain areas, and absent in others. Between each of the elements within an atom (the protons, the neutrons and electrons), as well as between the billions of atoms forming a piece of matter; ‘all the atoms in the eraser of my pencil’, (Adda had neatly written), there is gravity. As well, surrounding each charged spinning mass there is also an infinitesimal gravitational field which is negative, aligned perpendicu‐ lar to the axis of its rotation. A shift in wavelength, Adda had commented, would realign the angular momentum of the orbits of all the electrons slightly, amplifying the force produced by each tiny unit of negative molecular gravity, resulting in a cumulative field which was very strong. Adda preferred to imagine this generated field to be fundamentally thought-like energy, organized from out of the chaos. By modulating the signals, information would be transmitted which enabled the device to engage in communication with the gravity waves that the Earth produced. The basic idea of active information is that a form having very little energy enters into and directs a much greater energy. The reason soon became apparent why the entries on these pages had been flagged; someone within the military had discovered the notebooks and was highly skeptical of Adda’s theoretical approach to scientific research. As he read through the fascinating comments, Jurgen discovered that on other pages the passages circled were diary entries, reflecting experiences of Adda’s daily life and revealing her deepest personal thoughts... Dawn had quickly turned to dusk. The morning had gradually vanished in nearly imperceptibly stages as the sun had been obliterated. Jurgen hadn’t noticed. His intense stare was still mesmerized by isolated patches of data appearing on the tiny, hypnotic screen. His concentration had not wavered even as a fury of lightning was now unleashed upon the village; twisted veins and arteries of raw energy, ripping up the sky - synapses flashing within the brain-like clouds that rose miles into the air... ... “an enormous explosion that lit up the mountains, and bathed the mesas, flats, and scrub cactus on the shores of dry lake beds in cold, death white light. Fitful sleep filled with nightmares of the bomb, a turbulent mushroom cloud rising 35,000 feet into the air. Relaxation - peaceful thoughts - cannot reduce my anxiety. Radiation film badges. Air burst tests at Frenchman Flat, larger than the one which leveled Hiroshima. Even though, in part, it delivered liberation (from an internment camp in Hong Kong after the 1942 Japanese invasion), I fear this horror will soon visit mass destruction upon cities filled with innocence, and I cannot live knowing that I have been a participant.”


The lightning was relentless, streaming down hot electric blue like an umbilical cord connecting the earth and the sky. The image persisted, etching traces on the clouds and onto the retina of Jurgen's eye, hanging suspended for a few seconds before fading away. The electricity collided with the air, rapidly burning up oxygen molecules which expanded outward explosively, sending out a shock wave of sound that rumbled and phase shifted as it echoed along the valley. The continual peal of church bells ringing were drowned out by the intermittent roaring thunder Suddenly the power went out. Jurgen set down his deck, its screen still glowing, and stumbled blindly through the darkness to find a candle. The lightning strikes were occurring every few seconds now; at times the loud crash occurred simultaneously with the lightning flash, erasing the darkness of the room with a brilliant flickering glow. He could hear the crackle of the corona discharge ionizing air molecules and sense the tingling presence of the electric field on his hair and skin. A lingering fragrant trace of ozone drifted into the room. Another strike, and in an instant, the energy rapidly flowing along its sinuous path toward the ground reached temperatures in excess of 50,000 degrees Fahrenheit. A temperature, Jurgen recalled, as he rummaged through the cupboards and drawers to finally find the candle, that was five times hotter than the surface of the sun, and with a force equal to the power of ten Hiroshima-sized atomic bombs. Fortunately it was not sustained. It was no wonder Adda had lived in fear, Jurgen thought. He lit the candle then returned to sit by the window in the darkened room. While the Starks were stationed in Nevada, atomic bombs were continually being detonated, literally, right in their back yard. Operation Plumbbob; the Boltzmann Shot in May 1957, followed by increasing larger atomic explosions: Priscilla, Diablo, Doppler, and so on... replaying a fully real Armageddon nearly every single week. In the distance, the scream of sirens; rickety antique trucks scrambled by the volunteer fire department. Torrents of rain hammered the glass in intermittent waves, quickly building in intensity, gradually diminishing, then pausing for long intervals of time before recycling again. It was unusual that there should be so little rain accompa� nying a storm of this severity. Flocks of small birds blasted apart then hurriedly flew helter-skelter from one tree to another following every strike - a single lost bird flying chaotically across the sky, vainly searching for the others. High on the hilltop, lightning continued to strike the towers of the castle, scratching slate skies with broken nails. He returned his attention to the exploration of a collection of files he had previously downloaded, which as he examined them, provided additional evidence that they were part of a package intended to build a case to discredit Adda by casting doubt on her mental stability. The military file contained confidential medical records itemizing an inventory of prescriptions issued to Adda by a civilian doctor on the outskirts of Las Vegas during 1957 and 1958. Adda had apparently acquired a dependency to barbiturates; consuming an increasing quantity of seconal, nembutal and amytal. The


reason listed for issuing the prescription, supplied by the doctor at the bottom of the document, was ‘to ease the lingering pain resulting from her eye injury’, and ironically, ‘to help her to cope with a negative spiral of insomnia and depression’, which could partially be attributed to an established pattern of already overusing these little red, yellow and blue pills. Jurgen ejected one memory stick and replaced it with another, loading up a new collection of files. While he waited, he captured his reflection in the shiny coating of the black screen; uncombed hair like Einstein. He ran his fingers through it to smooth it down, then glanced out the window. The rain had stopped again and the lightning strikes were much less frequent. The village was still strangely quiet. Only a few brave souls had begun to venture out into the mid-day twilight. Most remained safety sheltered in their homes; knowing that lightning was unpredictable, they were unwill‐ ing to risk the randomness of chance. For a few moments he studied the flickering flame of the candle floating tentatively above a misshapen melted mass of wax inside a pickle jar lid. What he had as yet been unable to understand is why the Starks continued their military contract, particu‐ larly since living at ground zero in the most dangerous place on earth at the time was obviously taking its toll. He realized that during that era, not long after WW2, military contracts were one of the few places that scientists could find employment or conduct advanced research; and a 60 billion dollar annual defense budget was an unimagin‐ able amount of money during the 1950’s. Still, Jurgen, who had always considered himself to be a pacifist, was disappointed that the Starks had been involved in the creation of a new weapon of destruction. He wanted to believe that some other factors had influenced their decision to continue their experiment. The search for the answer encouraged him to explore further... More technical files: In his original proposal, Cameron had suggested that the hovering weapons platform, (using military terminology in his official document - although often referring to them as a ‘flying saucers’ in his notes), be developed as the delivery vehicle for an electromagnetic pulse transformer (EMP/T) bomb: The electromagnetic pulse effect had recently been observed as an unexpected phenomena which occurred during testing of airburst nuclear weapons. It was discovered that the explosion released a powerful electromagnetic shockwave which traveled quickly through the air, transfer‐ ring the energy produced by the explosion into high voltages wherever it came into contact with conductive material. Its effect on electronic equipment was similar to a close proximity lightning strike. Cameron had calculated that each platform would weigh less than 50 kg., and could be fabricated for a cost as low as $1,000-$2,000 per unit. Powered by a small atomic reactor, the device would be able to exceed Mach 3 (three times the speed of sound), be capable of traveling at very high altitude, and have unlimited range. It was pro‐ posed that a fleet of these stealthy, expendable, unmanned vehicles would be


extremely effective in infiltrating enemy terrain, since the combination of their small size, erratic maneuverability, and material construction would render them virtually invisible to radar. Each flying saucer in the fleet would be equipped with an autopilot system which guided its trajectory toward a key strategic location, as well as having an on-board locator to detect and home in on a suitable emitter of Van Eck radiation; the distinct magnetic field produced by all electrical equipment. Hovering at an altitude of several hundred metres above the target, axial antenna would be deployed from cable spools; unfurling like the tentacles of an octopus. The antenna would radiate the extremely intense burst of electromagnetic energy unleashed as the craft self-distructed, detonating its small payload of nuclear fuel and disintegrating into molecules as it expended itself against its target. The electromagnetic emission would induce a ramping current with peak field strengths of several kilovolts per meter within the ‘lethal footprint’ illuminated by the blast; an area of... [at this point within the document several passages of text had been deleted with heavily inked lines]. ‘Spooks’ employed in covert operations would identify a target’s coordinates; using aerial photographs, radar images, or by carrying out clandestine reconnaissance missions. The agents of surveillance - what is to be believed? No doubt the agents would find that urban areas were particularly well suited as targets since the wiring infrastructure of power lines and telephone networks typically follow a grid. The bomb would be programmed to detonate at the optimal position to inflict a maximum amount of electrical damage; although, whatever the orientation of the weapon’s field, it would be certain that several lengthy conductors within the linear array would be positioned in such a way so as to effectively drive a powerful transient voltage spike into the sensitive circuitry at the heart of the machine. Equipment used by the military, in government offices, financial institutions, media broadcast facilities and industrial manufacturing plants were all potentially vulnerable to attack. Since electromagnetic fields easily penetrate all materials, even shielding electronics in a TEMPEST (Tran‐ sient ElectroMagnetic Pulse Emanation Standard) rated Faraday cage could provide only limited protection. Data processing systems, telephone networks, industrial control applications, variable duty cycle electrical power controllers, superheterodyne receiver local oscillators, navigational radar sites, transmission lines and magnetic tape libraries would all be effectively destroyed by the standing waves generated by magnetic flux. Jurgen was fascinated by details of how the device operated, particularly since he recognized similarities between the Stark’s proposed device and a recent incident reported on one of the network news channels that Rujjie constantly left open in a small window in the corner of his monitor: during coverage of the recent military conflict between China and Taiwan, witnesses reported observing a formation of small ‘UFOs’ that attacked semiconductor fab plants in the Hsinchu Science Park and exploded several transformers along TaiPower transmission lines carrying electricity from the TienLuen Generation Complex. Jurgen wondered if it was a coincidence - fifty years later.


As the storm slowly faded away across the landscape, the atmosphere remained charged by its force. Jurgen noticed that the energy of the storm had seemed to subtly affect his electrical brain activity. It was as if it had re-aligned his thought patterns to somehow connect them to the deeper innate primal flow of energy throughout the world. It was a slight shift, but enough to cause him to notice the change in perception. It was an awareness which had occasionally recurred during his life, affording him moments filled with a profound sense of perspective about the relationship of man to the natural world; that the awesome power and sublime complexity harbored in nature humbled the greatest achievements of all mankind. Out in the distance, fingers of lightning continued to reach to ground. The rumble of the thunder was now a faint occasional growl lingering in the sky. The answer to his ultimate question, which had originally initiated this foray into the past, eventually materialized within several of the files Jurgen opened on the flat screen of his slim, metallic silver deck around noon. In the pages of a lab notebook, he discovered that Cameron had responded to the same question; a question that he had apparently asked himself one day while driving his black sedan down the Mercury highway to Area 51. It seemed that he had begun by preparing a pragmatically worded draft for a military proposal, which gradually became a heartfelt confession: “The ‘Ultrasonic Invisible Weapon’ is a non-lethal device designed with the capability of a precision strike, to render strategic equipment and systems inoperable without any loss in human life... ‘How subtle and insubstantial, that the expert leaves no trace. How divinely mysterious, that he is inaudible. Thus he is the master of his enemy’s fate’, (Sun Tzu- ‘The Art of War’- Void and Actuality)... Tactically, I believe that a fleet of flying saucers could be more effective than an atomic bomb as a deterrent to further aggression within a theatre of war; to be able to stealthily creep among the fortresses of the enemies and disrupt their communication channels and power supplies, then vanish without a trace, would provide a formidable advantage. It is much more cost effective, and much more humane, than other weapons currently being developed by military agencies.” Jurgen was aware that during that period of time, military experiments were underway to develop psychoactive chemicals which affect the mind, lethal gases that erupt blood vessels in the lungs, and the creation of biological agents which induce diseases similar to AIDS. ... “Today, as we drove past [deleted] and watched the foot soldiers clearing away the radioactive debris in the desert, I realized once again that THERE IS NO WAR. What are we doing here? I have continually petitioned for a transfer but the request will not be considered until we are able to demonstrate results. The pressure is immense, this is a very stressful time.”... Catch 22 is military protocol.


... “I cannot bear to see the spirit crushed of my beautiful delicate flower. If only I could take her far away from here, if only we were able to escape this hell, that is all I pray.”...“This is not my land, and it is not Adda’s. There seems no reason to defend, or to be an aggressor supporting, a country that refuses to allow us to call it our home.” ... “Delusions about human nature and the virtues of science were factors corrupting communism, perhaps we are not so different from our enemies.”... These passages were encircled by thick, red pencil lines. It demonstrates the danger of recording personal thoughts and ideas; since once they have been given physicality they can often become a weapon that is turned against their creator. The Starks had confided in no-one, yet they had been betrayed. Gradually the lights came back on in the village. Jurgen blew out the candle. A stream of smoke floated lazily across the room and disappeared out the now open window. The earth and sky smelled fresh and clean. Jurgen couldn’t recall the last time he’d seen a storm of such intensity. Weather patterns seemed to have become more extreme and unpredictable with every passing year. As the natural balance of the planet had become disrupted, entire global regions had increasingly experienced environmental catastrophes; unseasonably cold weather, droughts, floods, forest fires and severe hurricanes. The more complex a system is, the more unpredictable it could become, Jurgen thought. Chaos was not just occurring in weather systems, he had realized, it was also becoming more apparent within the operating systems and vast networks of computer technology. [Yet]... Children were now running outside to splash in puddles, laughing and playing beneath a glorious rainbow that spanned the clear blue sky.

IX. THE MIRROR

The village remained suspended in an uneasy state of silence during the evening, throughout the night, and into the morning following the storm. It wasn’t until the spell had been broken by the church bells ringing that the world had once again seemed to come alive. Suddenly there was a commotion of activity outside. Jurgen went to the window to see what was happening. People were emerging from their houses dressed in their finest clothing, getting into cars, onto bicycles, or beginning to walk in the


direction of the church. This was odd, since it was a Monday. Perhaps it was a wedding or funeral, Jurgen thought. Perhaps it was some type of religious holiday. Not everyone was making the pilgrimage; just families who lived in houses here and there, some with their children who would usually be in school. From his perch Jurgen could see faces in the windows of people who remained in their homes. Some, like himself, seemed puzzled, several expressions of pity or scorn, while others wore a vacant stare; a dull unblinking gaze impossible to decode. As he watched, Jenna bustled out of the house down below. She was wearing a patterned dress and bright red lipstick-coloured shoes; her high heels punching holes in the rain sodden lawn. As if sensing she were being watched, she glanced up briefly over her shoulder toward him before quickly turning away. It made this entire event seem even stranger, since Jurgen was certain that she rarely, if ever, attended church. Jurgen watched as she hopped into a car of someone who had offered her a ride. The car drove away and a short time later the church bells stopped ringing. Jurgen parked his scooter in the shadow of the castle tower and made his way through the labyrinth of passageways down into the dungeon. He was curious to see if Marcel could explain to him the significance of the occasion, since he was familiar with many of the villagers, and if prompted could explain their customs. The first thing Jurgen noticed upon arriving at the heavy oak door was that the familiar metal plate, inscribed with the Doctor’s name, had been removed. The door was partially ajar, the room was dark inside. Jurgen slowly pushed the door open and turned on the light. The room was empty! There were no bodies, no boxes of torsos, nor shelves lined with heads. There were no machines, nor tools, nor old battered couches, just rusty chains and shackles hanging on the wall, and the ends of severed electrical cables dangling from the ceiling. As Jurgen wandered about the room, he suddenly wondered if he had been dreaming this strange day and in a moment would possibly awaken. He glanced down at the floor. Near his foot he noticed a large scar where acid had eaten into the stone. Soon Jurgen found himself disembarking from the elevator on the seventh floor of the Ivory Tower. He knocked firmly on the door of Master Bronchev’s study then immediately went inside. The Master quickly swung his gaze away from the monitor. For a moment his dark eyes, like a trapped creature, displayed a look of fear behind the thick lenses of his glasses. Yet, his glance also froze Jurgen in the doorway, who now himself was uncertain of what to do, waited, watching the startled expression vanish as the Master’s pale, round face began to regain its composure, watching as the Master’s enormous fingers gently massaged his chest, then gestured to indicate that Jurgen should take a seat. Jurgen remained standing. A drop of perspiration ran along his cheek. He struggled to calm the emotion in his voice; was it anger or sadness?, as he asked for explanation of what had become of Dr. Planchette. Master Bronchev peered back nervously across the desk, carefully considering the wording of his reply.


“Dr. Planchette... has departed from his position at the Akademy, effective yesterday morning. It is a confidential matter. All that I am at liberty to say is... how should I phrase this ... Dr. Planchette has been summoned by a higher authority.” The Master’s smooth complexion had now regained its customary impassive expression. Jurgen was uncertain how to respond. His mind was cycled through several imagined scenarios trying to interpret what these words might mean, yet no one thought could completely resolve itself into a definite conclusion. The Master, sensing Jurgen’s confusion and anguish, became more compassion‐ ate, “I realize that you and Marcel had developed a close friendship and I am certain that he would have wanted to bid you farewell... You must understand that his depar‐ ture was unexpected... Perhaps he will contact you when he is able.” Jurgen seemed to detect an imperceptible tone of sarcasm delivered in the last comment, which the Master had nearly successfully disguised as sincerity, or perhaps it was only a projection of his own imagination, a memory of the Master’s disdain for Marcel which had been clearly communicated during their previous conversations. This thought had occurred in an instant, causing him to wince in pain. The Master sighed. “I’m worried that you have been under a lot of stress lately.” “No sir,” Jurgen replied, “I am fine...” Jurgen opened up the throttle along the road heading toward Marcel and Angelique’s house. This was not a casual visit; no time to take the leisurely stroll through the mysterious swamp. He hoped that they might be at home, perhaps still packing up to leave. The scooter splashed through pools of water and occasionally swerved in the thick mud that had slid onto the highway from the eroding mountainside. He soon reached the turnoff and plunged down onto a much narrower road which meandered through dense forest; the private drive leading to the Planchette's house. Immediately he was forced to apply the brakes and slide to a complete stop. Before him were the wide tire treads made by a large truck that had recently gouged deep ruts into the muddy road, making it difficult to navigate. Although disheartened, disappointed that they had already gone, Jurgen dropped the wheels of the scooter into one of the grooves like a slot racer and continued on. As he had suspected, the house had been abandoned; each room had been thoroughly cleared of material possessions - although Jurgen had soon discovered that the Planchettes had not vanished without a trace. While surveying the vacant artist's loft from the top of the stairs leading to the attic, he had happened to notice the appearance of a slightly burned area on the wooden floorboards. Advancing more closely to examine it, he recognized that the shape resembled the life-sized silhouette of a woman laying sprawled on the floor. Exiting the house, Jurgen discovered the silhouette of a large dog laying on the grass in the front yard, and exploring further, the shadowy shape of a man on the concrete floor of the shed Marcel had used as his


workshop. All the devices and apparatus that had once filled the small building were gone - it was empty now with the exception of a small fragment of painted wood; a piece of a Ouija board which lay on the floor just beyond the reach of the shadow's hand - the sentence at the bottom of the board read; 'Good Bye'. What the hell was this evidence of; spontaneous combustion? Jurgen couldn’t understand what had hap‐ pened, it was beyond reason. Tears stung his eyes. It was twilight in the zone. The sun was already setting when Jurgen drove past the church, now quiet and deserted. Everywhere he went in the village he noticed that people had resumed their activity as if nothing had happened; not the storm, not the church bells, nor the mysterious disappearance. Yet, he sensed that the villagers knew something about what had happened, and certainly many were aware that he had been a friend of the Planchettes. It was as if they dreaded an encounter from which their secret could possibly be revealed. They purposefully avoided eye contact, obviously pretending they hadn’t noticed him driving down the street. The unsettling atmosphere sent a shiver crawling up his spine, precipitating a rising wave of terrifying panic which threatened to engulf him: the horror of isolation returning to greet him like a long lost friend. His hand nervously twisted the throttle. The engine amplifying his fearful grip produced a dissonant, erratic sound. Now they were swiveling their heads to watch him drive away; he could feel the burning heat of their searing stares cutting through him like laser beams. He drove as fast as the Cezeta would go, he wished he could run away faster. As if guided by autopilot he discovered that his mount had once again returned him to the castle. He threw a small pebble at the window high above him. Coraline’s roommate; Katscha, appeared, squinting through the illuminated glass into the darkness. She made a few hand gestures which Jurgen couldn’t understand then quickly disap‐ peared. He waited by the dormitory doorway remembering their first embrace, preparing himself for the encounter by clearing away the thoughts he didn’t want Coraline to access. When she appeared, she didn’t say a word, although she immedi‐ ately recognized that something was wrong; she approached and for a long while held Jurgen tightly against her to comfort him. They joined hands as they descended the steep trail down the mountainside through the black forest of dense fir to the spot they often went. There was the fallen log that they used for a bench, with the initials: C.C. + J.E., at the center of a crudely fashioned heart that Jurgen once upon a time had carved into its bark. The full moon was rising over the far end of the valley, casting a silver glow which highlighted the rooftops and the edges of the buildings in the village, and made it all seem as magical as a wonderland again. They sat in silence for awhile. Gazing up, high above them, the International Space Station orbited the night sky like a slow motion shooting star. He had wanted to explain to her that Marcel and Angelique had vanished under mysterious circumstances during the lightning storm but as he struggled to form the


thoughts he realized that it would be as difficult as trying to describe a dream that someone had once told him about; a dream in which the dreamer was lost within an infinite hall of mirrors. As they sat closely together under the stars, he realized that he didn’t need to convince her. He didn’t need to tell her about his discovery of strange, uncertain clues. He didn’t even think about it in case she could detect it. Coraline simply understood. So sympathetic and so compassionate, yet it was the only time he could remember that Coraline had cried. The flame of her inner strength, always eternal and bright, had begun to waver then, and seemed like it would go out. Perhaps she was crying for him; sharing in his sadness since his tears had dried and he could not cry anymore. Perhaps she was intuitively aware of the circumstances of their friend’s departure, perhaps there was another reason. It didn’t really matter. He held her tightly, shielding her with his body to protect the delicate flame. At that moment he loved her more than he had ever loved her; more than he had ever loved anyone or anything during his life. He put his feelings into words. He whispered in her ear. Sleep, awaken again, return to work; that would be the cycle. With the dawn of a new day he tried to convince himself that he could negate all trace of emotion associ‐ ated with the recent events. He believed that, with determination, he could become just another zombie, who marched into the future, oblivious of its past. Rujjie listened to his vow and laughed. “This is the past. This all happened a long time ago. It only seems like the present when you remember and relive these vivid experiences in your mind.” Ruj was watching a little inset window running in the corner of his screen; randomly dialing up channels from around the world - a Tokyo television station was screaming through his optic cable at that very moment... ... sleek plastic umbrellas reflecting torrential neon rain... Rujjie had been a slacker during Jurgen’s absence of the past few days. He needed a certain level of supervision to maintain his motivation; a minimal amount, but definitely greater than zero. In an effort to disrupt the inertia, Jurgen immediately fired up his screen and began pounding in lines of code; his fingers rattling the tiny keys. Jurgen had once claimed that sequences of computer instructions would sometimes occur to him during a dream. Ruj believed him; in the morning he had often witnessed Jurgen scrambling frantically to capture these elusive fragments by quickly formatting them into the program. But he wasn’t buying it today. Leaning back in his chair, gnawing a pencil right down to the lead, Ruj watched him intently. Ruj must have sensed that he was struggling to get back into the flow. He persisted in initiating a conversation with Jurgen, perhaps hoping that it would cause him to open up and reveal why he was being so secretive, or, more likely, because Ruj was always more than willing to recount his own recent exploits. Today was no exception. Jurgen eventually complied; he spun around to face Ruj, then lent him an attentive ear.


The tale of three devotchkas: Since yesterday’s sunny morning had turned into a pleasant afternoon, and since Jurgen would apparently not be checking in, (Rujjie gently reprimanded him that he hadn’t even called), Ruj decided to journey from the castle and wander aimlessly through the village to see what could be found. He discovered three young lovelies hanging around the video arcade, maybe seventeen or eighteen years old, and asked them why they were not in school. Oh, they replied, they were excused because of the special service at the church; they didn’t know, or care, much about it. One described it as some kind of exorcist thing, like, to give thanks for ridding the village of some kind of bizarre demon. Anyway, since their parents weren’t home, and there was plenty of wine on the shelves, they decided to have a little party. Ruj got them high and it wasn’t long before the four of them were naked and cavorting on the parent’s great big bed. He then went into an elaborate description of how he had taken each one, this way and that way, while making the others wait their turn. The best, had been an ‘awesome devotcka’, whom after he thought about it, suddenly recalled had been named Marina, and whom he described as being ‘intensely hot’. Later, after smoking another joint, they had all fallen asleep as a heap of naked bodies on the bed. Fortunately, Ruj declared, he was a light sleeper and instantly heard the sound of Dad and Mom coming in through the front door. Without waking the girls, Ruj had slipped out of bed, gathered up his clothes, and with presence of mind, tossed the mother’s large, purple sexual stimulation device (which someone had found after rummaging through the dresser and then later dropped on the floor) among them. Then literally, Ruj had barely escaped out the window just before the parents entered the room. Rujjie had a grin from ear to ear, "The perfect crime; three stoned, naked de‐ votchkas laying in bed with mother’s plaything - what would be believed?" With that, Ruj returned to work. Jurgen had a much more difficult time maintaining focus after hearing the story. 'Rujjie, Rujjie, Rujjie', Jurgen had thought to himself, gently shaking his head... Rujjie was like the brother Jurgen never had; a few years younger and about a year behind him at the Akademy, Ruj was one of the earliest replacements after the first wave of attrition had set in. As students resigned, or in Jurgen’s case, would soon begin to graduate, new recruits would arrive to take their place. Rujjie was a talented programmer and a devoted disciple of the software they were authoring; ‘FAITH’, (which would soon be approaching alpha). Yet Jurgen often felt insincere through trying to appease him by silently consenting to the subject matter of his stories. It often seemed a desperate measure; a way to somehow ‘buy’ his loyalty. The Akademy had instilled that in him; the militaristic notion that the leader, the boss, could not show weakness - that he shouldn’t become too familiar with those over whom he had authority. It just was not good business practice. Paradoxically, he was acutely aware that the distinction between the guide and the follower was exactly the artificial barrier that their software was intended to erase. Yet, as Jurgen mulled it over, he considered


that perhaps it was just that he was envious of the ease with which Rujjie seemed to be able to slip in and out of sexual escapades without sustaining any wounds. No visible scars; there were no skeletons in his closet, or so it seemed. In harsh contrast to Rujjie's carefree existence, the recent incidents in Jurgen's life had made him intensely aware that the pressure and the stress on him were increas‐ ing. Even though he had denied it in front of Master Bronchev, he could not deny it to himself. He had begun to sense the desperate need to escape this institution, and this village, but he knew that it was not possible until he was able to demonstrate results, or alternatively, until he was forced to abandon his dedicated work and effort of the past few years, and like a coward, steal away into the twilight. He had come too far for that, there was no turning back; it was imperative to get this software to work. And in that regard, Rujjie’s participation had become essential; Jurgen could not do this on his own, especially within a compressed timeframe. The walls were closing in. Sleep, awaken again, return to work, forget about the past; that was the cycle Jurgen maintained for several weeks. FAITH beckoned him with its guiding light, attracting him like a moth to a flame. Burning the midnight oil, testing the software; everything seemed perfect in every way. That is, until one particular Sunday morning during the fall: Jurgen had awoke and was still rubbing away the residue from his sleep encrusted eyes when he arrived at the woodshed to discover that the front tire of his Cezeta had gone flat. He dug out his wrenches and patching kit from the saddle pods, rolled up his sleeves and set to work. It was a difficult task. The old tire was in such poor condition that he was concerned it would be damaged in the struggle to pry it off the rim. He fiddled with it until he became frustrated; he didn’t have the right size wrench and soon the lightweight nylon storm jacket he wore over his uniform became stained with grease. Ready to give up, he was about to awaken Gus from his deep hangover induced sleep to help him, when Marina unexpectedly arrived. Marina had been sent to the woodshed to gather some firewood so her mother could cook breakfast. She was sleepy. As she sat down on the large stump used for chopping wood, her faded pink bathrobe slipped open to reveal that all she was wearing beneath it were panties so worn that they were practically transparent. Jurgen, crouched beside the tire, had become mesmerized by the heart-shaped patch of pubic hair, perfectly framed by the cute little ‘v’ showing through white cotton. Marina didn’t seem to notice. She withdrew a package of cigarettes from her bathrobe pocket and lit one up. “You want one?” she offered. Jurgen shook his head, “No, I don’t smoke.” He was surprised; he didn’t think anyone smoked anymore.


“So... you are a friend of Rujjie Blades.” “Ruj? No, I’m not really a friend... we work together.” He turned his attention back to his task. “That little weasel left us in a very awkward situation.” Jurgen nodded his head, pretending to fix the tire. “Oh, so he told you about that?” She spit out a tiny piece of tobacco from the unfiltered cigarette. Jurgen nodded his head again, still looking at the tire. For some reason he offered, “He said you were the best.” Marina laughed. “I bet you would like to find out.” Then a few moments later, in Czech, “Cemnay!” When he turned to look at her again, she was standing naked, wearing only panties and sneakers. Her housecoat was draped over the stump. Her firm breasts seemed very large in proportion to her slender body. “Cemnay,” she beckoned him with a mischievous grin, “or don’t you understand.” In response, Jurgen arose from his kneeling position beside the scooter as she approached him. Marina licked her lips, gazed up at him with her pretty eyes, then wrapped her arms around him. They didn't kiss. Jurgen trembled anxiously while she slowly tugged down the zipper of his jeans. He allowed Marina’s nimble fingers to slip through the opening and grasp ahold of what was growing there inside. That was how they were positioned when Mrs. Boshovsky burst into the shed. Jenna was furious! Screaming something hysterically in Czech, she used her over‐ whelming physical dominance to quickly subdue her daughter. Forcing her to kneel across the stump, then picking up a willow branch, she began whipping Marina’s tender bottom, continuing until a bright red colour became visible through the thin material of her frayed underwear. Jurgen was transfixed with amazement; he had never seen such a sight. Marina did not stop howling until the frenzy eventually subsided. She stood and wiped tears away from her eyes, then leaving her housecoat behind her, she quickly scampered off toward the house. Still brandishing the switch, Jenna now turned toward Jurgen with fire in her eyes, ordering him to remove his trousers. Jurgen swallowed hard, then out of fear, immedi‐ ately complied. It soon became apparent to both of them that he was still quite stiff. Instead of beating him, as he had expected, Jenna turned and gracefully spread the pink housecoat over the wood chips on the floor as if she were laying out a picnic blanket. She shimmed out of her dress and underwear, stepped toward him, then


grabbed him by the arm to drag him down on top of her; both still dressed above the waist. She guided him inside, saying something like, “You don’t need to play with children, you are a big boy now.” He was frantically making love to her but his thoughts were somewhere else... perhaps he was fantasizing about three young girls on their parent’s bed, or maybe Marina’s naked body. Whatever he was imagining during Jenna’s ecstatic ode to joy, the spell was broken when the screams of pleasure turned into complaints of discom‐ fort, caused by wood chip splinters in her butt. Jurgen splashed water against his face. Drops slid down the reflection staring vacantly at him in the bathroom mirror. He noticed the grease stain above his left eye. He scrubbed it away with a fluffy white washcloth, then continued to gaze at his reflection. Who was this tall young man, with the tired, drawn, bewildered expression, the dark unkempt hair, the slightly Asian shaped lids that were pierced by the cool steel gray eyes staring back at him from behind the glass? Was this who he had become? He didn’t like the looks of this fellow; he didn’t know if he could be trusted. It was the facial hair that made him look sinister; the thin dark mustache that tapered into a thicker patch covering the chin and another dense tuft floating beneath the lower lip. His electric razor was on a shelf inside the medicine cabinet wedged in between open packages of tampons, smeared golden lipstick tubes, blush applicators, and small bottles of aspirins, calamine lotion, aloe vera cream, ... It would be an improve‐ ment. The tiny electric motor buzzed as it trimmed away tiny black hairs the size of eyelashes that tumbled randomly into the sink. As the hair vanished, his face trans‐ formed, taking on a more youthful, more anonymous appearance. He thought about Coraline, (as he often did), and flashing back on various scenes that had just taken place in the woodshed, he immediately felt ashamed that he had betrayed her; that he had once again violated the bond of trust and respect that they had developed for each other. He just could not seem to rise above the temptation, the feral hedonism, and the subsequent guilt. It was not Jenna’s fault but his own that he had always complied; it was his own lustful desire that had turned him into a monster, an impure creature that was not worthy or deserving of Coraline’s love. Jurgen recalled that during a recent conversation, Coraline had remarked: “Our spirits are enfleshed in human bodies to both challenge and punish us. Flesh, since it is matter, is temporal, while the spirit, which is energy, remains eternal. It is this which causes us pain; the sensation that our material flesh is reacting to wear, abuse and decay. Yet, sensation is an illusion. Through disciplined mastery, an awareness could be achieved to perceive this illusion from the perspective of another dimension; an awareness termed enlightenment.” As an analogy illustrating her comment, she had suggested that this detached awareness was comparable to how we perceive ‘virtual’ computer generated reality; when the simulated modeling, texture, lighting and


perspective are rendered with a high degree of craft, the environment appears to be just as real as our everyday world, but when we turn off the screen and look around us, we suddenly realize that it has just been an insubstantial illusion. The cutting blades were not very sharp. Stubborn isolated hairs refused to fall as he passed over the area again, and again. The friction, combined with the heat of the tiny overworked motor made it feel like he was trying to burn the hair away; a process which turned his sensitive skin bright red. When he finished shaving and turned off the razor, he could hear Marina whimpering outside the door. As he exited the bathroom, she hustled in past him and without a glance, quickly flashed him the finger.

X. COVENANT

He had arrived at the Akademy with the intent of making himself complete, but unexpectedly those plans had unraveled. There was nothing left, only to salvage what he could and try to make a graceful exit. October, 2007. Jurgen recorded in his notebook that during the past few months, cloistered within the keep, he and Rujjie had brought FAITH to fruition. The develop‐ ment of FAITH actually resulted in a collection of small, mutually integrated software programs, which, when operating collectively, had the capacity to develop learned behavior: the active agents were cybervores, harvesting and retrieving information from the network universe while other ‘factory’ programs remained resident within the host system where they formed an assembly line to sort the data and manufacture information from these components, then subsequently compress and warehouse this data onto portable storage devices. During the final stages, Master Bronchev had personally appeared in their tiny cell frequently to test the software for himself. He was impressed enough to contact the lawyers for ACB, (the benefactors of the institution), who immediately commenced proceedings to obtain patents for the software and device. Jurgen and Rujjie would receive credit in the software’s ‘about box’, or, on the front end screen, but in accordance with the terms of the student contract; the Akademy owned the rights to ‘exploit all future usage of the software in a manner which they deemed appropriate’. The marketing people at ACB would ultimately rename the software: GURU. “Thanks boys, good job!” said the marketing manager who had just arrived from Belgium to take possession of the source code. Jurgen and Rujjie were too exhausted to coherently reply; by the time she arrived, both had been awake for three consecu‐ tive days, working like slaves. The moment she left the only thing they were capable of


doing was heading down to the Screaming Virgin to determine how many pints of Radegast they could drink. After the fifth beer, Jurgen began to consider the still murky, unresolved issue of ACB’s potential claim to the proprietary knowledge within his brain. The original contract stipulated that he could not use the knowledge gained by developing the software to create what could be considered a ‘similar’ product which could benefit any ‘competitor’ of ACB for a period of two years. No, he didn’t want to think about that right now. His only interest in authoring the software had been as a means of satisfying his contractual obligations; that was all that really mattered. Now that he had finally delivered on his end of the bargain, it was up to the Akademy to fulfill its commitment to him. Jurgen leaned across the beer soaked table to inform Rujjie of the news; the Master had assured him that negotiations were already underway with several international corporations who were interested in recruiting him. Rujjie nodded his head and ordered another round. The long days and long nights of coding had afforded very few opportunities to spend time with Coraline. Sometimes he sensed that she was thinking of him. When‐ ever these thoughts had drifted in he was able to suppress them so that he could concentrate on his work. It was painful; the time they spent apart only increased the longing to see her again. Yet both had realized that their commitment to their field of study had taken the highest priority in their lives. It did not seem possible that they could have both a relationship together and at the same time be able to intensely pursue their individual careers. The lengthy intervals between moments with Coraline had made evident the recent gradual changes in her personality and image. She had become more lean and svelte, her arms and legs were more muscular and sinewy; she had been working out religiously in the gymnasium three times daily. Her dark hair had been trimmed quite short, giving her an almost masculine appearance. Her expression and demeanor had become even more calm and mature; her eyes were clear and bright. Whenever they were together, each of her attributes contrasted sharply with Jurgen’s disheveled appearance and the general decline in his personal hygiene; hair unkempt, uniform wrinkled, and sometimes even forgetting to brush his teeth. It was like beauty and the beast: the more intently she worked, the more graceful and relaxed she seemed, meanwhile he had gone completely the other way. Jurgen tried to rationalize it by imagining that he was under much greater pressure. He would be leaving the Akade‐ my in a few weeks (in early November), while Coraline was at liberty to continue her work with the intention of completing her contract the following summer. During midnight moonlit walks through the courtyard and castle grounds, Coraline told him about recent progress in her own work. She had been developing a unique interface for the software she used in architectural design. She had become intrigued by the notion of using her telepathic abilities to communicate with her computer, and was pleasantly surprised by the initial satisfactory results. To enhance the experience, she consulted another student named Macy; a pretty, dark skinned girl from Tunis who


was designing biomedical prosthesis to replace damaged human limbs, nerves, organs, and so on... Thus via sensory prosthesis connected to various portions of her body, Coraline discovered that she could project her presence into the three dimen‐ sional architecture of a computer generated image. Rather than navigate by keyboard, voice or wand, she could use her remote perception to see, hear and touch the objects within the virtual environment. The computer, in effect, perceived and interpreted her behavior, enabling her to explore and even edit and manipulate the shapes of the buildings she constructed. On the marble bench situated between the statues by the reflecting pond, it was Jurgen who suggested that Coraline construct a virtual paradise, where perhaps someday they could live together in immortality. It was a naive, but very romantic thought that brought a tear to Coraline’s eye, compelling her to briefly, gently kiss him on the lips. Every time Jurgen was with her he fell in love all over again. She was like a fantasy character from a novel; a woman with incredible intelligence and divine beauty, who also possessed a clear vision of how she intended to direct the course of events in her life. Coraline’s dedication to her studies had consistently achieved the highest award levels of any student at the Akademy. As a reward she had finally been allocated her own private studio. It took a few days to clean and prepare the space, but as soon as it was ready she invited Jurgen up to view it. The studio was a small, perfectly cubeshaped room located within a cupola near the very top of the Ivory Tower. It was sparsely furnished; simply a single massive computer with a wireless flatscreen display suspended over a thick mat covering the stone floor. One single narrow arched window faced directly toward the village. Jurgen stared silently for awhile at the tiny house in which he lived. Coraline did not demonstrate her use of the interface, although the sensor cables were neatly coiled on the black mat on the floor. She explained that she needed absolute isolation to achieve the highly meditative state, then shyly confessed that the isolation was not just to avoid distraction, but mainly because the process only seemed to work when she was completely naked. Jurgen had just begun to imagine the scene, but as soon as he did, Coraline shot him a disapproving glance. “That is exactly the reason,” she said with a slight grin. Before he left the garret, Coraline coyly reminded him about the dance in the castle’s ballroom the following weekend; the dress was formal attire. “It will be our...” her voice suddenly trailed off. Her expression clouded with sadness. Jurgen held her in a tight embrace; her warmth permeated his. The subtle, intoxicating fragrance of her body.


He gazed deeply into her eyes. Silently... Snow was beginning to fall. Giant snowflakes drifted through the beam cast by the headlight mounted in the nose cone of his scooter as Jurgen followed the winding road down from the tower to the tiny house he had spotted from its window. Back home, boxes already packed in anticipation were strewn about him. He had made arrangements to store his belong‐ ings at his mother’s house; most of his hardware, notebooks, and digital media. He tread carefully through this warehouse as he headed toward his bed. He wanted to be well rested when he met the recruiter from GenSynth in the morning... During its first few years of operation, the Akademy had already received the prestigious reputation of being the training ground for some of the most exceptional students in the world. Several students had already been acquired before Jurgen and many more would follow. It had become a frequent occurrence to sense the presence of corporate recruiters roaming the drafty stone passageways like hungry ghosts as they scouted out top prospects. Jurgen could feel them closing in, since he was a candidate on whom they had recently directed a great deal of their attention. The negotiation process was intense and dynamic, as well as lucrative for the Akademy. This was how the institution would be remunerated for the time they had invested in a student’s training. Early in the process corporations had placed options on candidates they likely wished to recruit in the form of an advance payment. Depending on the student’s academic achievement the value of their stock would rise or fall. Their market value not only determined the entry level of competitive bids, which naturally would favor corporations which had claimed first right of refusal, but also served as a way to evaluate those students whose options had become part of a strategic trade. It all seemed very cozy behind the scenes within the politics of the situation, as Jurgen had discovered recently when he had tapped into the database of the Akade‐ my. Representatives from some of the larger corporations offered regular payments to Akademy directors for information on potential prospects, as well as guaranteeing a percentage of the signing fee for the students they were ultimately successful in drafting. In turn, members of the Selection Committee had kept them updated with a list of the top students in each department, supplying a record of their academic achieve‐ ments and personal statistics. Jurgen believed that it was always wise to familiarize himself as much as possible with situations, particularly those of major significance in a his life, by researching them as thoroughly as he could in advance. Through his unauthorized access of the Akademy’s database he discovered that PanopticComm had him under option. The corporation, with its main headquarters in Huntsville, Alabama, manufactured satellite tracking systems used primarily by law


enforcement officers to keep tabs on current, former, (and perhaps future) felons all around the world. They required a highly trained software engineer to enhance the ‘intelligence’ of the sophisticated surveillance system which they were currently implementing: a routine surgical procedure which imbedded a tiny microchip into the convicts’ hearts, so that wherever they went from that day forth the satellites orbiting the planet would always know the precise coordinates of their location. While Jurgen could write enough high-powered code to create a truly omniscient system, the moral and ethical considerations of working for PanopticComm; a corporation who's mission to protect the innocents from monsters, criminals and deviates had also had the potential to turn the entire world into a prison - came into conflict with his philosophical temperament. Jurgen realized that in order to resolve this situation he would need to take matters into his own hands. He recalled a name he had encountered on the network: Shozo Nishimura, a programmer with a nostalgic love of archaic computer hardware and software. Jurgen rummaged quickly through a box of memory sticks, each small white screen-printed patch cryptically labeled with a black marker pen. He eventually discovered the storage archive, turned on the power, and slipped the stick into his portable deck to once again familiarize himself with the reference. The path leading to Shozo Nishimura had its origin within a US military document: a bill of sale for the Stark’s computer; the one that had been constructed in their bunker beneath the white sands of New Mexico. The disassembled computer hardware had been purchased by General Synthetics Corporation in 1999 then freighted across the Pacific Ocean to their warehouse near Osaka, Japan. Several cardboard boxes containing the Stark’s original data files, recorded in a now archaic tape format, as well as declassified technical documentation, had been included in the deal. Shozo was the resourceful agent who had purchased the equipment on behalf of the corporation. Since the mid-1990’s, he had displayed initiative in acquiring a massive amount of outdated hardware and associated operating systems from organizations throughout the world. Although General Synthetics was primarily recognized as the manufacturer of a wide variety of synthetic organic components, (which found their way into everything from insects to machines), apparently several of its directors had a plan to open the largest computer museum in the world; a wonderful amusement park complete with fully functional equipment. Shozo, although certainly unaware of the nature of the Stark’s early experimentation, was very interested in a hybrid computer built during the mid-1950’s, essentially from scratch. ‘Exceptionally unique is a rare commodity for collectors’, he had mentioned in a memo eagerly notifying the directors of his find. Surprised, and excited, that the computer still existed, Jurgen had immediately sent Shozo an email message which precipitated a brief but enthusiastic flurry of corre‐ spondence. During the exchange, Jurgen had identified himself as the only grandchild of the Starks, (information he had discretely withheld from the administration of the Akademy, and even from his friends), expressing a desire to one day see the equip‐


ment first hand, and also to meet Shozo in person. As Jurgen considered the options for his future employment, he realized that perhaps now he had his chance. He immediately contacted the employment person‐ nel officer from GenSynth, as the corporation was generally called, requesting placement at their head office in Japan. He forwarded copies of his student records as attachments; obtained by infiltrating the Akademy’s database. Two days later, when he received the positive reply that GenSynth was indeed interested in employing him, Jurgen re-entered the Akademy’s database, and in the text field listing the highest bidder he erased the name ‘PanopticComm’, and replaced it with ‘General Synthetics’. As previously mentioned, Jurgen was well aware that he wasn’t the only one wheeling and dealing behind the scenes. He chuckled as he imagined the Selection Committee scratching their heads, and eyeing each other suspiciously as they pondered the changes to his file. It would probably be beyond their comprehension that a student would have taken the initiative to determine their own fate; it was just not the way things were done in modern times. Certainly some students employed agents or lawyers to assist in negotiating the most advantageous deal, although their student contract stipulated that ultimately these representatives could only act on the student’s behalf with the approval of the Selection Committee. These negotiations usually dealt strictly with issues of wages, benefits, bonuses, dental plans, and those type of things. Rarely did the student have any say in the matter of where they had been ‘assigned’. Jurgen had informed the Selection Committee that he would be representing himself. ...It was still snowing when he awoke the following morning. A fine white down covered the ground. He stumbled out of bed, and before his eyes were fully open, he was already setting up the coffee machine, finding filters and prying the can of coffee from the ice in the empty freezer compartment of his refrigerator. He shivered until his morning coffee began to warm him up. Still clutching the coffee mug in his hand, he maneuvered his scooter up the winding road to the Akademy. Clean shaven, wearing his formal white uniform, Jurgen arrived punctually at 11 a.m. for his scheduled appointment. The meeting took place in the elaborately ornate executive board room on the second floor of the Administration Office; tapestries, statues, and an enormous, delicate chandelier suspended over a heavy, oval-shaped wooden table. The only face he immediately recognized was that of Master Bronchev, who swiveled slightly in his chair at the head of the table to introduce Jurgen, first to three delegates from the Selection Committee, then finally to Heidi Schoenschreiber; the representative from GenSynth, who had just arrived from the corporation’s regional office in Switzerland for the meeting. The interview, recorded on digital video, lasted approximately one hour. Ms. Schoenschreiber astutely tested Jurgen’s knowledge in his field of study, then attempted to gauge his personality and characteristics in order to determine if his chemistry was compatible with other members of the team. Jurgen, for his part, had also demonstrated his familiarity with the corporation’s history and operational


structure, which Heidi, (first name basis now), had found equally impressive. As a tactic, perhaps, she initially offered him a position with their operation in Mexico, but Jurgen firmly replied that he would only be willing to work at General Synthetics’ head office in Japan. That settled, Jurgen sat back, remained silent and watched the financial negotiations unfold. He took no pleasure in listening to the Master describe him as a respected honor student, or conferring other noble praises, since he was well aware that it was in the best interest of the Akademy to market his abilities; the institution would receive a substantial percentage of any offer that was made. As his thoughts drifted during the proceedings, Jurgen considered that this source of funding would contribute to providing state-of-the-art labs and classrooms during the years ahead, and he would readily admit that he had already been fortunate to have had access to some of the most knowledgeable instructors and best equipped training facilities in the world. The meeting had gone better than he expected. Once the Master had finished blowing smoke, Jurgen managed to exude some charm and humour which interjected a sense of camaraderie into the room. The only condition that Jurgen had stipulated raised a few eyebrows among the Selection Committee members; they found it odd that in lieu of a ‘signing bonus’, he would request a one week expense paid vacation in Hawaii instead. Heidi smiled, impressed once again, “You really have done your research. I assume you are familiar with our current research project in development with Professor Zinthrop?” Jurgen nodded his head knowingly, although he had no idea what she was referring to. Besides, he did not want to discuss his personal reasons for the request. Ultimately, Heidi indicated that GenSynth was prepared to make Jurgen a very generous initial offer to consider; she transmitted a figure to his portable deck via an infrared beam. It was more money than he had ever dreamed of. Contracts would be sent in a few days time once she had made a presentation to her superiors for final approval. At that point the meeting was adjourned; handshakes all around, and immediately Heidi vanished from the castle parking lot in her shiny red Renault. The night passed slowly, Jurgen was unable to sleep; insomnia was a chronic condition. Usually, working into the early hours of morning provided the most effective medication to alleviate the onset of loneliness, but tonight he had nothing to do. It wasn’t that he minded being alone, it was the need to love and be loved; the intense longing for a passionate embrace, that caused the painful emptiness. It was like an addiction... It was Coraline. She had become the spirit visiting him in the night when the tiny village was quiet and he lay awake in his empty bed. He tried to expel the memories conjured up by his thoughts; the late night strolls through the moonlit forest to ex‐ change their dreams under the constellations, climbing the massifs in Moravia to


observe the birds and wild flowers in the Biosphere Reserve, or even the recollection of a chance encounter in the hallways of the Akademy. These thoughts revitalized those many pleasurable experiences that now often came back to haunt him. Not only past memories, but his hopes for the future contributed to his present torment. It seemed that cruel fate had intervened by separating the pathways of their journeys; perhaps such was their star-crossed destiny. Yet he often fantasized what their life together could be like if he was willing to make a different decision, (willing to make the sacrifice?): Instead of setting off on a bold adventure; some vague quest, what if he had chosen to stay? Occasionally he had plotted the vectors, defined the function of the curve, and calculated the paths of potential trajectories. The scenario unreeled like an ancient motion picture film, spilling onto the projection room floor: the happiness, the romance, the house, the kids, the arguments, the affairs, the divorce, and ultimately the fear. He realized that it was wrong to imagine life lived out at the speed of light, especially since they were both so young; he was twenty-two years old, and she was only twenty-one. Yet, still... Instead, he imagined her sleeping comfortably in her bed and soon he was fast asleep as well. During the finals days, numerous details had arisen that occupied his full attention and his time. The flurry of activity rapidly swirled into a whirlwind; signing contracts with GenSynth, booking his flight, dismantling equipment and packing boxes. A bar of soap, an old threadbare blanket, a box of damaged circuit boards ~ he wondered how he had managed to accumulate so much junk. It hadn’t been difficult to decide what to discard; the books, the school uniform, the dishes, the piles of assorted cables, on and on... The most essential items, actually needed for the trip, fit into one small suitcase that he could carry with him to the other side of the globe. The remainder he stuffed into about half a dozen cardboard boxes that he would take with him on the train to his mother’s house in Eigenvalue, Germany. He had planned to spend a few weeks there before departing to Hawaii via connecting flights from Munich. Jurgen also briefly met with each of his long lost friends to bid each one farewell. Most of the original crew were still there; Gus, Rujjie, William, Gregor and Katscha, as well as Heartfield and his recent bride Mechtilde. The only exception was the gentle giant, Ljubomir, who had died of an overdose during the previous year. Jurgen even said good-bye to master Bronchev, then later Marina; who only sneered at him, and finally Jenna, who actually had a tear in her eye and left him with a tender kiss. On the morning of November 11th, 2007, Jurgen prepared himself for his final departure from the village. As he awaited Gus Grass, who would drive him to the station, Jurgen thought about Coraline and the formal dance in the ballroom of the castle that evening. For a long time he stared at the cell phone in his hand. He knew that she was waiting for his call, and he wanted to reconnect with her, but he also realized that it would likely rekindle the longing and desire that had gradually dissipat� ed during the past few weeks. He had always held to the faith that they would be


together again some day, and besides, he didn’t know what he could he say that hadn’t already been said; 'Parting is such sweet sorrow'? He would call her from Japan, he thought. A horn was honking outside. Gus was waiting outside in a brand new Nisaburu van. He was with his girlfriend, Esmeralda Nagua, a student who had recently arrived at the Akademy from her home in Bilbao, Spain. They all pitched in to load the boxes, then a short time later, unload them onto the small wooden platform at the station. They kissed and hugged and said good-bye, leaving Jurgen to wait alone near the small shack which served as the station for the single car train. The agent was the only other person in sight. He was preoccupied with dragging a heavy grey canvas sack of mail across the deck. The snow was falling again. It was like a scene from Dr. Zhivago.

part three I. HAWAII

Jet-lagged, hung-over and as pale as a ghost, Jurgen placed his hand in the fingerprint reader - scanned, he then wandered into the terminal of the Honolulu airport, midmorning. It had the same generic appearance as every other one, he thought; a vast, surreal, geographically neutral space that was much larger than it really needed to be. There was a sense of fear, angst and sadness in this environment that squeezed all the joy out of his anticipated adventure, and for a moment made it difficult to even remember what city he was in; Munich, Amsterdam, New York, Seattle... it had been a long flight. Somewhere over the USA he had downloaded the latest issue of Phrack via satellite link to help pass the time. It wasn’t until the big sliding doors opened like an airlock and he stepped outside the terminal for his first breath of air that the true impact of where he was rushed in. Tall palms with fronds bursting like vibrant green fireworks into the clear blue sky, cute, brown-skinned tourist promotion girls wearing coconut shells, grass skirts, leis and enormous white smiles, and everywhere the stars and stripes undulating slowly in the gentle breeze. A classic, battered white Cadillac limousine drove him to his hotel; as was the custom on the island of Oahu. Jurgen fiddled with the dials on the TV set in the back seat as he drove down the freeway past the industrial area and past the old town


center. The reception was poor; all he could make out was the text of some kind of sports scores: N.Y. 7/ Atlanta 5, Moscow 4 / Tel Aviv 2... “Do you know what year this is?” the driver had asked. Jurgen looked up. All that he could see of the driver were his mirrored sunglasses; which had a third lens mounted center and above the two regular lenses, gleaming in the rear-view mirror. Before Jurgen could respond, the driver answered for him; "1959." The year had significance for Jurgen since it was the same year that the Starks had disappeared from Wheeler AFB, located on this very island. Jurgen wondered what he meant. In a moment the driver added, “This Caddy was made in 1959.” “Know where you are coming from?” the driver asked cryptically, then laughed as he delivered the punch-line; “The past!” ...Some distance had been travelled before he introduced himself; “My name is Allen.. This is my day job; at night I proof-read novels for my friends.” He said nothing after that. Jurgen turned his attention out the window, staring through the tinted glass at a verdant matrix; the light and shadows on dark palms and the tall grass meadows of the jungle vegetation created a lush, random green texture covering the low, gently contoured hills. To his right, the blue Pacific Ocean vanished at infinity somewhere along the invisible horizon where a few fluffy white clouds gently floated across the brilliant sky. Before he realized it, Jurgen had been delivered to the hotel; a tall paintweathered concrete structure towering above the palm trees lining Waikiki beach. He stepped out of the air-conditioned limo and onto the sidewalk; the air was fiery hot - in a moment everything could melt. The noon-day sun, nearly overhead, cast a shadow directly beneath him as if he were a character in an Tex Avery cartoon. He checked into the hotel, tossed his suitcase onto the bed, then immediately headed down to the beach. Along the way he purchased a cheap inflatable mattress from an ABC; swiped onto a smart card that had the look and feel of plastic but actually consisted of a biodegradable plant-based material. His credit card; the ‘robocard’, was not only a convenient method of making transactions, it also provided him with an identity he could use for security and communication purposes; his every action tracked and permanently memorized within a database at GenSynth. Moments later he was adrift on a bright yellow mattress, watching Diamondhead gently bob up and down at the end of the long, long beach. He floated on endless waves until his pale white skin turned toasty red. Yesterday, he recalled, he had been trudging through the bleak icy streets of Munich; a million miles away. That was the past. He now had a great future to look forward to, but for the present... could he actually believe he was in Hawaii! He scooped up some ocean in the palm of his hand and tasted the fishy, salty brine just to make sure that this environment was real and not an elaborate virtual simulation.


The purchases Jurgen made at a Daiei Supermarket, at 3:15 p.m. on November 17, 2007 included: papayas, mangoes, a package of Haupia coconut Luau dessert, a jar of Kanai Poha preserves, a plastic bottle of dark brown tropical blossom honey and a 567 gram paper bag of purple Taro pancake mix. He carried these items in a plastic bag, along with ingredients to make island sandwiches, up to the kitchenette of his ocean-view room. During the heat of the day he sat on the balcony drinking Margaritas and watching the activity in the city below. This wasn’t the future they used to write about in science fiction; a dark world advanced in entropic decay. The sun was shining, the birds were singing, and there was hardly a robot in sight. Gradually his gaze drifted vacantly off into the blue, he needed to relax and clear his mind. The next few days were spent in leisure; island girls, brown skin, eagle looks, whisps of hair in the wind emerging from matted dreadlocks, hair that was always graceful in the breeze, swimming at Sandy’s, quenching his thirst with a bottle of Jones soda from H-Mart; the ‘Hygienic Grocery Store’, on his way to watch surfers at Yoko‐ hama Bay, or just wandering through the shops in Waikiki where Samoan fire knife dancers performed for the customers drinking microwave espresso under thatched umbrellas in the mall. Jurgen explored nearly every part of Oahu by riding on the public transportation system; appropriately called ‘The Bus’. One afternoon he hiked up a muddy path through a narrow ravine on the eastern side of the island. Small red apples were growing high in the trees and were scattered all over the ground. The pungent jungle aroma, although reminiscent of fermenting cheese, or the smell of a poultry farm, seemed rich, earthy and pleasant. Near an automated station which would warn of flash floods, Jurgen entered a low tunnel-like alcove of dense jungle foliage, following the meandering trail which led him to the magnificent Sacred Falls. According to island mythology, a gigantic wild pig had scraped out the large, strange semicircular gouge, several hundred meters high, into the solid rock wall with its powerful back once upon a time - long, long ago. Jurgen chose two small, smooth dark stones from the river bed and wrapped them each in a green Ti leaf; similar to the way he observed that local natives performed this ritual. He placed the wrapped stones next to each other on a narrow rock shelf among the countless others that had already accumulated there; the leaves of which had become various textures and shades of brittle and brown. For some time he sat in the gentle mist of the thin waterfall, thoughtful of the spirit of his grandparents as he meditated within the tranquil setting. When he was mentally prepared, Jurgen continued his journey into the heart of the island. Arriving on 'The Bus', he had immediately climbed a suitable ridge overlooking Wheeler Air Force Base. The panorama of Mar’s red soil stretched across the broad valley below. Neat arrays of bright green spiky plants emerged from the landscape to contrast the gently rolling, rust-coloured hills; pineapple fields forever. He spent several hours contemplating the scene of the military installation where his grandpar‐ ents had disappeared. Long after the tears had dried, Jurgen felt content that the brief visit provided a sense of closure which justified the purpose of the trip. He felt that, in a way, he was retracing the path of their journey, except that he was moving ever-closer


to its source. As a souvenir, Jurgen gathered a sample of the finely powdered soil in a discarded 35mm film canister that he had found, then caught The Bus back to Honolu‐ lu just as the sun fell from the sky. The next morning he packed his suitcase, checked out of the hotel and took a taxi down to the harbour. He found himself heading south, blasting across the waves on his way to his pre-arranged meeting with Professor Zinthrop on the island of Lanai. Most of the passengers were tourists dressed in loud flowery shirts; the costume of the Haole. Their youngest off-spring, dressed in khaki shorts and wearing their t-shirts inside-out, were all plugged in; listening to MPEG or playing video games, completely unaware of the enormous Blue Marlin frolicking in the waves off the starboard bow. Jurgen overheard another tourist nearby reading a brochure to his wife; “In ancient times Lanai was believed inhabited by bands of cannibalistic, howling demons...”After awhile Jurgen grew weary; he leaned back in his seat, closed his eyes, and listened to the soothing drone of the hovercraft’s engines.

II. ZINTHROP’S BEES

Bzzzzzzz..... A figure dressed in white moved amongst a dozen wooden boxes arranged in a circular formation in the jungle clearing. The layout was vaguely reminiscent of the Stonehenge monument on the Salisbury plains of the United Kingdom. The boxes were white; stenciled with the words ‘Imago Enterprises’ in small black letters on their side. Jurgen’s first impression of Professor John Zinthrop was that he resembled an astronaut in his beekeeper’s outfit. He could not yet see his face behind the fine mesh veil that surrounded his helmet; a halo of rectangular panels providing protection from the swarming bees. Some bees hovered lazily around the opening, others darted from their hive like a bullet, flying off into the dense, green jungle vegetation which sur‐ rounded the clearing. In the distance, the red, ragged lava cliffs of the highlands were partially cast into shadow under gigantic white cumulus clouds. The sun was a burning wheel of flame suspended in the sky. Approaching a hive, Zinthrop (as he would soon introduce himself), crouched down to eavesdrop on the bee’s distinctive communication patterns in order to understand the mood of the hive. He then connected a pair of thin wires emerging from the hive to


a battery located nearby on the ground. Soon angry buzzing rapidly increased in volume. After a about a minute, he disconnected the leads, and just as quickly the sound again subsided. Zinthrop would later explain that a low amperage was generat‐ ed in a special screen which caused nearby bees to release an alarm pheromone which in turn soon induced many of the bees to sting a collector. Each sting yielded 0.1 mg of venom; a colourless, bitter tasting liquid with a banana-like odor. The small quantities harvested were sent to a Czech pharmacology lab, presently developing a synthetic version used in apitherapy; to suppress inflammation of arthritis and rheuma‐ tism as well as a treatment for multiple sclerosis. After Zinthrop had obtained his samples, he motioned to Jurgen, who had been watching from the distant edge of the clearing, to join him. Jurgen soon caught up with Zinthrop and they casually made their way back to the research lab compound a short distance up the mountainside. Along the walk, through a wonderland of flora which served as the food source for the hives, Zinthrop (still wearing his helmet and veil), pointed out examples of lehua, macadamia, kiawe, mango, banana, avocado, Christmas berry and many other varieties of wild flowers which were in bloom yearround. Jurgen deeply inhaled the heady fragrance of the beautiful blossoms. The lab was an encampment of small portable buildings sheltered in a grove of Sandalwood and Banana trees. They were arranged in a more random fashion than the hives but painted with the same colour of white paint. The wooden buildings were weathered from the rain, and the paint was cracked and peeling from the sun. In the wooden shed near the main lab building, Zinthrop removed his helmet, gloves, and veil. He appeared to be in his late 40’s; slightly receding thick brown hair with a touch of grey along the temples. His eyes were dark brown and intense behind his circular silver-rimmed glasses. His teeth seemed large when he smiled, which he did frequent‐ ly; although it often seemed to be a forced smile almost resembling a grimace of pain. His face was wide, upon which floated a small nose, narrow mouth and a deep cleft in his chin. Under the beekeeper’s coveralls he wore a light coloured t-shirt and trousers which made his tanned skin appear to be quite dark. Jurgen was intrigued by his twangy American accent. While Zinthrop was changing, Jurgen had explored the shed; inside were the tools of a beekeeper’s trade; bee blower, honey refractometer, fuming board, Bee-Go, drip pans, smoker and smoker fuel. Jurgen wiped away a stream of sweat that ran down along the side of his face. The heat and humidity were incredible. An old blind dog laying on the steps didn’t bother to move when Zinthrop stepped over him to enter the main laboratory. Although the building didn’t look very impressive from the outside, it was equipped with the latest, state-of-the-art lab equipment and computer technology. Inside, two of Zinthrop’s seven colleagues were busy with their work. The entomologists worked among the clutter and chaos of computer equipment, cardboard boxes, specimen jars, trays, bottles, cabinets, rubber tubes, tanks, books and paper that covered every available surface. Zinthrop introduced Jurgen to a young woman named Xanthe who had been examining a spectrum analysis sample of freeze


dried bees which had just been processed in the rotary evaporator. Across the table sat a young man, who wore his long brown hair past his shoulders, counting body parts which seemed to have come from some type of giant insect. To keep track of the totals, he pushed large colourful plastic buttons which incremented the counters on the ancient multiple-tally denominator. When he suddenly whipped off the headphones connected to his iPod, Jurgen could hear the residual scream of heavy metal blasting through the tiny speakers. “Hey Bra’, welcome to the jungle. I’m King Richard,” the young man exclaimed, jumping up enthusiastically to shake Jurgen’s hand. His broad grin quickly vanished into a playful, distrustful glare; “You’re not from the government are you?” Then instantly the grin returned. “Sorry man, just shittin’ you, Hey!... who put that fuckin’ slack key radio station on again?” Xanthe shrugged her shoulders as if to indicate that it had not been her. King was stoned again. His hobby was tending a little crop of Maui Wowie growing up in the nearby jungle. Zinthrop didn’t mind. He recognized that much of the lab work was laboriously tedious and repetitious, thus he tolerated anything which broke up his employee’s monotony and kept them from becoming bored. Built into one wall of the lab, behind a large Plexiglas sheet, was an observation hive which the bees could access from the exterior of the building. Zinthrop had his computer monitor set up directly in front of it, apparently taking great interest in the day to day activities within the comb structure inside. The sound of a constant, distant hum blended with the droning sound of the radio, which despite King’s protests, still continued to play Hawaiian slack key guitar at a low volume. Jurgen began to wonder why he was here; it seemed like a typical research lab. He couldn’t understand why the compound had been surrounded with security cameras and coils of razor wire along the top of the perimeter electric fence. Even the journey to the secluded location had been a harrowing experience: Jurgen had been met at Kaumalapau Harbour by a driver named Hanford and one of Imago Enterprises' brand new four wheel drive Mazukis. They had raced along the paved road through Lanai City; a dusty little plantation village, then turned north and continued for several kilometers through rolling ranchland with patches of scrub covering the baked dry red soil. “This all use ta’ be pineapple plantations years ago,” Hanford shouted over the roar of the engine. He explained that the entire island of Lanai had remained private property since it was originally purchased by Jim Dole; the pineapple magnate, back in 1922. Lanai had received some media attention when a billionaire named Bill Gates rented it for his wedding, yet the tiny island did not even rate as a brief news item when it was acquired by the Golden Sun Corporation earlier in 2007.


They rattled past the ‘Garden of the Gods’; an otherworldly landscape strewn with large wind-eroded boulders. Without really slowing down, Hanford spun the steering wheel and the Mazuki veered erratically off the pavement onto an abandoned plantation road completely overgrown with wild grass. As if it were a video game, Hanford kept the throttle down as they bolted along steep, nearly inaccessible eroded gorges that were filled with clumps of Mesquite bushes and an occasional Axis deer which frantically leapt out of their way... Jurgen's thoughts returned to the present... Zinthrop was in the process of answer‐ ing his query about why the compound was so isolated and heavily fortified: he explained that in addition to preventing unwanted human intrusion, the research facility’s isolation helped keep the bees free from chemical contamination, parasites and disease. It was imperative that the researchers maintain control over the bees' genetic purity. The queen bees were of Ligurian stock, obtained from Kangaroo Island; just across Gulf St. Vincent from Adelaide, Australia. The Ligurian queens were descendants of an Italian race of honeybee that had been raised in isolation on Kangaroo Island since 1881. Although each hive in the apiary could yield an average of 150 kilos of honey, it was the least important product for Zinthrop’s research purposes. Zinthrop had pitched his initial concept to Mr. Luk, an executive of the Golden Sun Corporation, painting a vision of the glorious possibilities which could be realized with only a modest invest‐ ment; with appropriate facilities and research funding, Zinthrop claimed, he would be able to put together a team which could create a wide variety of commercial products by analyzing constituent compounds produced by the bees and developing methods to synthesize them. Convinced by Zinthrop’s persuasive presentation, and since he believed that he was shrewd enough to recognize a viable and profitable opportunity, Mr. Luk immedi‐ ately set Zinthrop up with a substantial grant to completely fund his research activities for the next seven years. As well, Mr. Luk had initiated the process which resulted in the purchase of the entire island of Lanai. Thus, Imago Enterprises; Zinthrop’s research corporation, had begun. In return for their investment, the Golden Sun Corporation would be entitled to claim exclusive ownership over all products derived from Imago Enterprises' research during the course of the sponsorship contract. Through Mr. Luk’s established network of international contacts, Zinthrop’s research station was connected with other centers around the world to further testing and development. A contract with Daisy Day cosmetics in France developed new lines of honey and beeswax based beauty cosmetics. Synthetic development of propolis in Brussels produced agents which were effective against a variety of bacteria, viruses, fungi and molds. Experiments would be carried out to test the effectiveness of royal jelly and honey carbohydrate boosters on athletes on the Greek island of Hydra. There was another contract with an Egyptian corporation that was experimenting with something called synthesized bloodhoney that was used to embalm bodies that were being prepared for cryogenic preservation.


With the successful establishment of these franchise contracts, Zinthrop had secured his research facility’s continued existence. Now, finally, he had been able to turn his full attention to the completion of his master work: the initial results of which Jurgen would soon be the first person, outside the core research team, to actually observe. They left the office. Eagerly anticipating Jurgen's reaction, Zinthrop led him to a structure hidden away in the jungle a short distance behind the main research compound. Its large, lightweight, metal frame was covered over by a very thick layer of semi-transparent plastic. Within the outer enclosure of the white plastic canopy was another structure; a very large hive kept in darkness by a matte-black plastic housing - a cube within a cube. Before entering, Jurgen donned the appropriate apparel; dark coveralls and a helmet mounted with a filtered lantern that beamed a dull red light. After he had dressed, one of the researchers completely sprayed his protective clothing with an aerosol can containing a nearly imperceptible scent. “Bees, although they are diligent workers, are limited in their capacity by their physical size, and their extremely limited longevity. We have devised proprietary biological techniques to improve their natural characteristics. There are only about 40 bees inside the hive; workers, nurses, drones and many queens. Each is the product of a long series of experimental research into the processes of genetic mutation,” Zinthrop explained as they moved through the airlock and entered the darkness inside. An incredible roar was immediately apparent; which Jurgen had at first assumed was caused by an immense air conditioning system. As his vision became sensitized to the near darkness, he could distinguish that the structure was composed of large, lightweight aluminum alloy frames, arranged in levels like a multiple storey house, with each frame supporting an array of large hexagonal wax combs. A system of ladders mounted on scaffolding enable the researchers to move about inside. They were almost invisible; except for the lights on their helmets which glowed like embers in the darkness. Soon he became startled and terrified by the presence of other moving shapes: the bees were the size of small birds - ‘Zinthrop’s bees’. Zinthrop told Jurgen not to be afraid since the bees had been altered so that they could no longer grow a stinger or venom sacs. Zinthrop had assured him that they were very docile and well behaved; "They enjoy being stroked like a kitten." “The current brood of workers are about 15 centimeters in length. But over here, some of the newer queen bees will be twice as large when they reach adult stage.” Zinthrop indicated a queen pupae contained inside a cell which hung vertically from the frame. It had the appearance of a cocoon made of beeswax. Several researchers, dressed in dark coveralls were standing by, clinging to the metal supports while they waited for the queen to chew her way through the cell and emerge.


“The main purpose of the artificial hive is to create new queens,” Zinthrop informed him, “which are then extracted and preserved. Queen bees are born from the exact same eggs as worker bees. The only difference is they are fed exclusively on a diet of Royal Jelly, an extremely nutritious, creamy-white liquid secreted by the hypopharryn‐ geal glands of the nurse bees. In addition to its other miraculous qualities, such as increasing size and improving fertility and longevity, Royal Jelly is rich in the important nucleic acids RNZ and DNA.” Zinthrop had devoted the entire previous winter to isolating and analyzing the genetic sequence of Royal Jelly’s growth hormone to enhance its natural attributes. He modestly boasted that with each successive generation there had been an incremental increase in the magnitude of scale, although he was still uncertain of any limit to the size the designed insect could achieve. They now climbed through a network of gangways and gantries to another location in the structure. The dull red light emitted from Jurgen’s helmet lantern provided only a minimal amount of illumination. When they arrived, they discovered a member of the research team engaged in the act of artificially inseminating a ‘virgin’ queen with genetically altered drone sperm. She used a hypodermic syringe to inject the sperm into the queen’s storage sac where it would be preserved to fertilize all the eggs the queen could produce during a possible three year life span. From this storage reservoir, the virgin queen could lay eggs from which hatched only male drones. To lay eggs which produced the female worker bees, she must be fertilized. Zinthrop personally graded the eggs. He then isolated them within an arrangement of hexagonal sided ‘lay cages’; individual cells which contained enough food for adequate larvae development. Nearby frames contained young nurse bees dedicated to the care of the new queen; feeding her a Royal Jelly compound that had been genetically moderated. Once the metamorphosis was complete and the queens emerged, only the best quality and largest ones were selected. Those chosen were transferred to ‘protector cages’ and the rest culled; since any emerging queen will naturally, quickly destroy any other cells which contain queens in an advanced stage, as an effective means of eliminating the competition. Jurgen flinched under the sudden impact of a bee; the size of a parrot, that had landed on his right shoulder. It then slowly began to crawl up the back of his neck. Its antenna wriggled and tapped on his hair. Its intermittent buzz sounded like an electric motor whirring beside his ear. Zinthrop told him to remain perfectly still; that it would not harm him. The bee turned, crawled over his left shoulder and onto his chest; its soft, waxy fur brushing against his chin. Then it took flight into the darkness; leaving behind a gentle rush of wind beneath its wings. Because of bees’ enormous size, the lab technicians had an opportunity to dissect them in order to analyze their component parts. They had recently discovered during their experimentation that they were able to successfully replace portions of the bees’ anatomy with bio-mechanical devices. They had inserted computer chips to improve


the resolution within the mosaic pattern of the bees' vision as well as rewire their nervous network to make them easier to train. Other experimentation involved grafting organs from other insect species onto their bodies at an early stage of their develop‐ ment; to determine if grasshopper legs, for instance, would also respond to the enhanced growth hormone. “The possibilities are endless,” Zinthrop announced. “We have discovered that the enhanced growth hormone can be injected into other types of insects as well; increas‐ ing their size at maturity by a factor of ten.” These experiments were conducted primarily on cockroaches; which were quite plentiful on the island, as well as on butterflies, centipedes and a few preying mantis. Two researchers then approached, both carrying a bee under each arm. “Its time for their exercise." Zinthrop narrated the strange movie playing out before Jurgen's eyes. "The bees are supplied with their food; nectar and pollen obtained from the hives in the clearing; since it is impossible for them to forage on their own. In captivity they tend to eat too much and become too heavy to fly. That's when we have to switch their diet to a diluted solution and regularly exercise them outside.” Exiting the darkness of the inner sanctum, Jurgen and Zinthrop followed the workers outside, emerging into the outer enclosure. The bees were released; left to walk around on the smooth, white plastic floor. After a few minutes, one of the re‐ searchers produced a small remote control. She deftly pressed a sequence of tiny buttons; immediately the bees' wings vibrated more rapidly and they began to hover in the air. Soon they were flying in short tentative hops, gradually increasing their speed until they were orbiting the space between the two enclosures much faster; zooming out of view around the far corner then quickly reappearing from the other direction again. Jurgen noted that the two researchers; who had carried the bees, had now cowered into a crouch against the wall and were loudly cheering the bees on - calling them by name as if it were a race. “A magnetic field guides the bees,” was Zinthrop’s hurried explanation. There wasn’t time for further words. He forcefully directed Jurgen into the airlock while the bees were out of sight; fearing immanent impact with the rapidly moving projectiles when they once again returned.


III. MENEHUNE

The crew’s quarters consisted of an encampment of canvas ‘prospector’ tents pitched on a hillside overlooking the research compound. They were arranged in a loose formation around a cooking shack without walls, but large posts supported a thatched roof which opened above a fire pit dug deep into the ground. What appeared to be some type of small animal had been roasted in honor of their guest. It was served with poi and pineapple flavored rice. The crew, with the exception of two working night shift, sat together at a long table to enjoy the delicious meal. It was now their turn to ask Jurgen questions about who he was and where he was from. By the time they finished their meal, the sun was setting behind the nearby dark‐ ened silhouettes of foliage; spectacular bands of yellow, orange and red spanned the western horizon. Gradually the tired crew drifted off to their tents. Jurgen followed Zinthrop, who had graciously offered him the hospitality of a cot. Taking off his shoes before he entered the tent, Jurgen noticed they were completely covered in brown stains; honey dripping from the combs inside the hive had stuck to the white ‘Hiawatha’ runners which he had recently purchased from the Ala Moana mall. Some of the crew watched television, others played Go or chess for awhile before they fell asleep. King smoked a joint, Xanthe played the violin, but Zinthrop loved to read. Often on a trip into Honolulu; to pick up supplies for the camp, Zinthrop would return with several books - mostly on the topic of entomology, although occasionally, mythological literature. Along one wall of his tent were cardboard boxes full of books, with more books stacked on top of the boxes. No sooner than they had entered the claustrophobic interior, Zinthrop had opened a specially designed, sturdy metal suitcase to eagerly exhibit his most valued treasure; an ancient, fragile, original edition - containing four volumes, entitled; “Travels into Several Remote Nations of the World, by Lemuel Gulliver.” According to the frontispiece, the book had actually been authored by Jonathan Swift and published in M,DCC,XXVI. Zinthrop claimed that he read a chapter of the book every Saturday night, and that when he had reached the end, he would start all over again, gaining some new insight with every passage. Zinthrop also loved insects. "Of the thirty million species currently comprising the ‘animal kingdom’, by far the vast majority are invertebrates...," he declared; "primarily arthropods". And Zinthrop was fascinated with every one. Insects, he reasoned, were the most perfect form of life, since each had adapted to fulfill a vital role within the biological matrix; each contributing its own unique abilities and remarkable attributes to preserving the ecosystem’s stability. By redistributing nutrients and energy through the decomposition of waste and the process of aeration, they perpetually struggled to improve the quality of soil. They assisted in plant reproduction and were often respon‐


sible for their protection. In addition, insects were essential in providing the foundation for the food chain’s pyramid. Above all, Zinthrop praised these tiny creatures for their ability to organize the most exquisitely complex and efficiently industrious societies of any species that have ever existed since the dawn of time. Mankind could not survive without them. Yet, he lamented, it had been humanity who had caused the extinction of hundreds of thousands of insect species since the time of the Industrial Revolution; subsequently depleting a substantial portion of the world’s necessary biodiversity. "Humans," he declared, "could learn a great deal from these tiny creatures as soon as they begin to consider them as something more than insignificant ‘bugs’." As an example, he had stated that Drosophila, the fruit fly, had played an instrumental role in providing humans with an understanding of their own genetic code. Standing by the entrance inside the tent, still clutching ‘Gulliver’s Travels’ to his chest, Zinthrop fervently suggested that he was interested in challenging humanity to become more competitive with insects in utilizing the resources of the planet: “If humans and insects were of approximately the same biological size, how would mankind fare in acquiring new techniques to compete on equal terms? Which civiliza‐ tion would survive; would it still be the insects who were trampled under foot?” Jurgen assumed they had been rhetorical questions and did not respond. Zinthrop went on to explain that he foresaw the possibility of this happening, not only by making insects larger, but by actually breeding smaller humans through genetic manipulation. Each successive generation decreasing gradually in size, until the entire population were approximately the scale of gnomes, leprechauns or even Lilliputians. Zinthrop had arrived at the concept, not only from his treasured novel, nor even by reading the many other legendary tales from around the world describing the ‘little folk’ that had accumulated in his cardboard box library. He approached more closely and lowered his voice to a whisper, revealing that on several occasions he had actually seen the Menehune in the jungle with his own eyes. Although, he confidential‐ ly confessed, that try as he might he had yet to capture one. Jurgen sat perfectly still on his cot. Zinthrop now knelt close by. In a quiet voice he described how he had first seen the Menehune under the light of a full moon, shortly after setting up the research station. The tiny, beautiful, dark-skinned figures were no more than a dozen centimeters tall. They scampered naked through the tall grass with their long, straight, black hair; that reached to their knees, flowing behind them as they ran. He was convinced they were attracted to the hives, since they were similar to bees in many ways; both were industrious creatures that could be malicious one day; ‘shooting magic arrows’, and entirely harmless the next. Both were social beings, fond of dancing and singing, which is how they were able to communicate with each other. Zinthrop believed that the Menehune acted as guardians; protecting the bees from predators and even helping to repair the interior of the hives when they were damaged in a storm. In return, the bees rewarded them with honey; which they truly loved.


The intense zeal in Zinthrop’s eyes suddenly flickered and faded as he emerged from his reverie. He got up from his knees somewhat shakily and returned Jonathan Swift to its hermetic chamber before settling into a worn canvas chair. He appeared tired, but still seemed anxious to continue talking; as if he were grateful for this opportunity to unburden himself of thoughts and ideas that he was reluctant to discuss with his employees. Jurgen was a patient listener; which often made him a confidant of many people’s confessions. Zinthrop then continued in a calm, quiet voice, mentioning that the others in the camp were accustomed to his mysterious disappearances; alone into the blackness of the jungle at night, carrying his flashlight and collection jars. He usually brought back a few specimens of interesting insects that he discovered, but he had never revealed to anyone what he was actually searching for, since they might think he had gone mad. Certainly, he admitted, many of the crew considered him to be somewhat peculiar and eccentric, although he was also aware, that in general, the crew had great respect and admiration for him as a talented scientist and as a solid team leader. Yet, he had not always been held in high regard by his fellow human beings. As a young boy growing up in Moxahala, Ohio, he recalled, the other children often used to laugh and call him names, and would rarely allow him to join in any of their games. It was a sad and lonely childhood, until he discovered that insects could be his friends. He then began to spend all his time roaming through the fields and forests, collecting and studying these marvelous creatures; gathering a great deal of empirical knowl‐ edge about their habits, food sources, reproduction and life span, then carefully documenting his observations through an elaborately cross-referenced system of record keeping; a process, he admitted, which some of his colleagues considered to border on being obsessively compulsive. It hadn’t mattered what his colleagues thought. He had discovered a rapport with insects; a form of communication in which he could read and understand the symbol‐ ism of their actions, and they seemed to understand his. Bees especially attracted him since they had evolved a high degree of acoustic communication that Zinthrop believed was a form of language. In college, he had even written a computer program to analyze the sounds the bees made and record the nuances of their ‘vocabulary’. He found that he could send an acoustic signal into the hive to get them to do certain things; forage in a certain quadrant of the field or perform a defensive maneuver to protect the hive - even when no enemy was present. In particular, he had gradually developed an intimate dialogue with certain individual bees in which they were able to exchange the knowledge that each individual species had acquired during their experience of the world. This research, concluding his distinguished academic career, resulted in an incredibly detailed and complex 800 page thesis dealing with the sociobiology, behavior, ecology, adaptation, evolution, genetics, taxonomy, physiology, pollination, and the flower nectar production of bees.


He could tell that Jurgen was having difficulty staying awake toward the end of his monologue, so in conclusion, Zinthrop provided one final anecdote which Jurgen might appreciate. One peculiar twist of fate, he stated, was that he had discovered from an early age, that his body was extremely allergic to the venom injected by bee stings. He had never built up a tolerance, and was frequently victimized by swollen lumps appearing on various portions of his anatomy. To demonstrate, Zinthrop rolled up his pant leg. Just above his right ankle was a red bump about the size of a golf ball which had been sustained that morning. Zinthrop wondered aloud if it was human nature to be attracted to the things which were the most harmful to them. He mentioned that it was an irony he could never comprehend, then he turned out the electric light. With that, they had both retired to bed. Jurgen lay quietly for some time gazing out through the window flap of the tent at the starry night sky. Once his vision had adapted, he could clearly see the Milky Way - the innumerable stars which comprised our galaxy - which, he recalled, was about 100,000 light years in diameter. Jurgen then thought about how the young hot stars in the spiral arms radiating out from the core were less than one million years old, while the red stars in the core were more than 5 billion years old, and soon he was fast asleep. Not surprisingly, he dreamt of gigantic bees... When Jurgen opened his eyes, what he had believed was only a few moments later, he discovered that it was already morning and there actually was a tiny honey bee buzzing around his head. He swatted at it, but missed. He looked around; Zinthrop was gone. He crawled through the tent flap to discover that the camp was completely deserted as well. He put on his honey stained runners and hiked down the trail to the research compound, soon arriving at the building with the lazy dog on its doorstep. Inside the scene was almost identical to the previous day; Xanthe and King were engaged in similar activities, but over in front of his observational hive, Zinthrop was now wearing a clean white lab coat and staring at the screen of his videocomm. Suddenly noticing Jurgen’s arrival, Zinthrop motioned him over. “Mr. Luk, I would like to introduce you to Jurgen Ernst, a recently hired employee of GenSynth Osaka.” Jurgen stepped closer and briefly waved at the tiny camera transmitting his image to some unknown network destination; “Good day, Mr. Luk,” he said. “Hello Mr. Ernst, I have heard about you. It’s timely that you join our conversation; we were just discussing the project you will be involved with. Now that you have familiarized yourself with the operation of Zinthrop’s team, I can provide you with a few details about what we at Golden Sun, through our subsidiary; General Synthetics, are attempting to achieve. When you arrive in Osaka, you will be under the direction of Dr. Sato; your team's project manager. He will provide you with further information and instruction on how you are to proceed. For the moment, let me explain that our ultimate objective is to


enhance the capabilities of humans working in industrial environments. Your team is currently researching mechanical and bio-mechanical prosthetics; essentially devel‐ oping a method by which human workers are able to increase their stamina and strength, for example; lifting and moving heavy objects, in order to thereby enhance their output potential. In order to precisely determine the engineering tolerances, a computer simulated, fully functional prototype of an exoskeleton has been designed which functions as an extension of the human operator. This shell is simply based on the design characteristics which are common to an insect. We trust you will be able to design an internal guidance system for these fabrications by working in cooperation with the other programmers on the artificial intelligence team.” Jurgen just stared at the image of the middle-aged Asian man on the screen; a man with a stern countenance and somewhat aggressive manner who was dressed in an expensive looking suit. This was the first time that Jurgen had learned about what his duties at GenSynth would be. He began to wonder what he had gotten himself into. “Since you are acquainted with Professor Zinthrop and the researchers at Imago Enterprises, we are hoping that, in the future, you are willing to act as a liaison with his team.” Jurgen nodded his head; “Certainly!”

IV. JAPAN

Jurgen arrived back in Honolulu later that afternoon. This time, for variety, he stayed at a different hotel. He ordered an expensive meal and a bottle of wine from room service; that was swiped through on his GenSynth card, then spent most of the evening composing a letter to Coraline, which began by tenderly expressing his love for her before gradually deteriorating into a rambling account of his adventure with Professor Zinthrop, the bees and the island of Lanai. He sent the document to his palmtop printer which spewed out a coil of paper. The screen was now black and silent, as was the distant ocean. Out on the balcony, Jurgen gazed down at the electric blue swimming pool twenty floors below, the nearby palm trees underlit with brilliant warm light, and up above, the multiplex constellation of stars suspended across the heavens. Around midnight a limo drove him to the airport; the driver was not a three-eyed alien. Jurgen slipped out onto the sweeping rainbow concrete of the loading zone,


tipping the sky cap with a few larger denomination Czech Krona; just to watch the expression on his face. After checking his bags at the ticket counter, he placed the printed scroll into a small package along with a coral necklace (alternating red and black) on a thin gold chain, which he mailed to Coraline from the airport post office. Then he boarded the jet and took off for Japan. During the seven hour flight, west across the Pacific Ocean, he watched CGI movies on the VR glasses for a little while, got bored, then slept, jolted awake when the plane suddenly plummeted from the sky, down through dense overcast to land at Kansai International Airport, outside Osaka, a downpour of dirty heavy rain, inside, another terminal that looked exactly the same, the bustling excitement of a television crew who were at the gate to meet a popular music artist who happened to be arriving at the same time. It was completely disorienting; he didn’t understand the language, the signs might as well have been in braille, and the pace was extremely frenetic after the tranquillity of his paradise vacation. His suitcase spewed onto a baggage carousel watched over by the vacant eyes of a giant fiberglass cartoon cat. Wired travelers were drinking coffee in small bamboo gardens tapping on their notebooks, uniformed pilots and attendants strolled briskly across the polished floor pulling their little carts, and passengers awaiting their flight were curled up fast asleep on the rows of seats in the lounge. The intermittent voices of perky Japanese girls came from hidden speakers. Jurgen made his way up the escalator with the early morning rain pounding on the glass. While he was studying a bank of pay phones, wondering who he could call, someone snuck up behind him and called out his name. Jurgen wheeled around in surprise. Shozo Nishimura politely introduced himself, then explained that Jurgen had not been difficult to spot among the crowd. Shozo was probably in his mid-30’s, but his smooth, handsome face imparted a boyish, good-natured appearance. His dark hair was trimmed very short, like bristles, and he proudly sported a dark blue nylon jacket with the logo of GenSynth on his breast. Jurgen found him to be very affable and informative, since he was able to speak English; a second language they shared in common. During their conversation, as they exited the airport and searched for Shozo's car in the enormous lot, a bond of friendship had naturally begun to form between the two; it was rare that Jurgen had encountered people who immediately put him at his ease. Once underway in heavy traffic, Shozo had graciously invited Jurgen to be his guest; to spend some time with him and his family until Jurgen had become acclima‐ tized to his new surroundings. Eventually they arrived at Shozo’s small home, situated in a densely populated residential area somewhere in Osaka. Shozo lived with his pretty wife, Kama, a black woman who looked very young and spoke only Japanese, and their energetic two year old son named Nazokoe. Kama prepared a magnificent feast for dinner; tempura, sashimi, octopus, eggplant soup, peanuts, bean sprouts, bonito, cucumbers, melon... After supper Kama changed into her uniform and left for night shift at the hospital where she worked as a nurse.


Jurgen and Shozo spent the next few days traveling around the southern part of Japan in a luxurious company car, returning to Osaka in the evening. When Jurgen wondered if he shouldn’t report to work, Shozo laughed and said that GenSynth could wait. What seemed to be implied; this was an opportunity to get to know each other as friends, before the formalities of the workplace imprinted itself on their relationship. Near Kyoto, they visited Sanjusangendo, the Temple of a Thousand Buddhas. They traveled to Hiroshima where Jurgen saw the Atomic Dome in the Peace Park. They hiked over suspension bridges, enjoyed the beautiful views of countryside along the curving, foggy mountain roads, and saw Mount Fuji rising up above the distant clouds. Everywhere he glanced during their whirlwind journeys there were interesting and unusual sights. Soon, Shozo introduced him to the apartment which had been selected for him; the rent paid for by GenSynth. The apartment was on the seventh floor of a sleek, modular building located near Kansai Science City; small, modern, with a narrow balcony displaying a panorama of the dense urban sprawl. Nearby, on the side of the massive Sports Center, a large electronic billboard advertising NTT: National Telephone and Telegraph, was prominent in the view. The apartment itself was furnished; the bed‐ room had a new futon, and the small bathroom had a shower. Kitchen appliances included a microwave oven, a fridge, and a two element range to cook up udon noodles or karage. A coin operated laundry and a bath house were located on the main floor. There was underground parking. Shozo informed Jurgen that the office was approximately one kilometer away; a longish walk, or a quick taxi ride. He quickly sketched out a map indicating the route on a paper napkin. On the way out the door, Shozo indicated that there was a market complex just down the street from the apartment building where Jurgen could use his GenSynth card; “Good luck, see you in the morning!” After awhile, Jurgen went to the fridge and was pleasantly surprised to discover a six pack of Kirin that Shozo had placed there as a house-warming present. The apartment was empty, and since he didn’t feel inclined to go outside, he entertained himself by sitting on the narrow balcony to watch the scene as the sky grew dark; the smoggy hills past the distant industrial flatlands and the aircraft warning lights flashing on the tall red and white communication tower. Either full motion or full stop. That was just the way he was; either working perpetually around the clock, or sitting quietly contemplating a landscape - observing the subtle changes that occurred during the passage of time.


V. DR. SATO

Still fully dressed, Jurgen awoke on the futon and looked around at the strange surroundings of his new home. The bedroom was completely empty other than his tattered suitcase in the corner which contained all of his earthly possessions. He had no idea what time it was; but it seemed early. Recalling that there was a digital clock built into the NTT display, he scrambled into the livingroom and stared out the balcony door; it was 7a.m.. He grabbed the map that Shozo had drawn and headed out the door. The past couple of weeks of relaxation had been enjoyable, he thought, but he was anxious to become active again. Down the elevator, through the lobby, out the front door; and he was back in Japan again. He set off on foot, which was a big mistake. Every now and then he referenced the directions provided by the smudged drawing on the napkin; which had inadvertently been used as a beer coaster the night before. Jurgen knew the direction he wanted to go but along the way obstacles continually presented themselves that would have to be negotiated; he came upon dead-end streets and when he cut through back lanes he was chased by strange little dogs that barked at his heels as if to say; 'run you silly bastard, run!' Eventually he got trapped inside the tall security fence of a parking lot enclosure. He was prepared to scale it until he noticed a small group had gathered to see what he would do. All during this experience of just trying to get to work, Jurgen had received startled glances from Japanese citizens everywhere he went. Their expressions conveyed a mixture of terror, awe, and humour: the pale foreign devil, the Gaijin running helterskelter with a tissue in his hand; he might as well have dropped in from another planet. He paced the perimeter of the compound until he found an opening in the screen from which he was able to escape. A short time later; there it was! Jurgen recognized the GenSynth logo on the side of a large, anonymous low building with opaque black windows, surrounded by an immaculately tended lawn - on the opposite side of the freeway! The ultimate challenge was to avoid the cars that locked on their brakes as he rabbited across eight lanes of freeway in the final sprint to his destination. Shozo, and the other workers who had gathered around a table in the ‘leisure area’, laughed as Jurgen tried to describe the obstacle course he had run, primarily illustrat‐ ing the story by means of pantomine since none of the others understood his words. Shozo suggested it would be much safer if he traveled by bicycle, then immediately picked up his cell phone and made a call. Cup of coffee in hand, Jurgen was led through the corridors to the cubicle that would be his workspace. It was a tiny room with no window view; but there really wasn’t much to see outside except for a few of the other buildings in the industrial park at the edge of Kansai Science City. The space


was clean and brightly painted, and equipped with the latest computer technology. There was even a small couch that he could use for naps. The swivel chair was comfortable, the bookshelf spacious, and the desk; well stocked with all manner of office supplies. Jurgen sat in his cubicle all morning with nothing to do. He fiddled around with the computer’s operating system and deleted a bunch of files. In the afternoon, a surprise!; a beautiful bike was delivered to his office. It was presented with a certain amount of ceremony by a rather large contingent of onlookers who had crowded into the hallway to clap and cheer. Jurgen found this unexpected attention disconcerting. At the Akademy he had blended in, to the point that he might have been invisible for all that he knew. But here, everywhere he went and everything he did was a public perfor‐ mance. As a result; from that day hence, he began to confine himself to his office cubicle during working hours, with the exception of necessity. He often left work late so that he would be less conspicuous during rush hour on the bicycle trip home. Although eventually once he had the routine down, and had familiarized himself with a few other members of his team, Jurgen had begun to feel much more relaxed. The subroutine became a recursive arrangement of nested loops: Jurgen awoke at 6 a.m., rode his bicycle along the same predictable route, reported to the security desk at General Synthetics by seven, then entered a small auditorium to exercise with the other members of his team; synchronized to aerobics broadcast on a large projection screen by a local TV station. After a shower, he would go to the ‘leisure area’ where the team were fed breakfast; miso soup, fish, rice and tea, served by the company’s catering staff. Work until noon, one hour break to eat lunch, (again served in the ‘leisure area’), relax in an informal manner by indulging in casual conversation, then seal himself back into his cubicle again until quitting time at five/ six/ seven... After work he would ride his bicycle back along the same predictable route to return to his apartment once again. Repeat... Every team at GenSynth worked within the isolation of their ‘cell’; an area of the building with limited access to employees from other departments. The cell was divided into cubicles; each employee had their own private room. The team worked together on the same project, with each member designated tasks according to their area of expertise. Jurgen would be working along with several other programmers authoring artificial intelligence code, while some, like Shozo, designed computer graphic simulations, others specialized in genetic engineering or building robotic systems and so on... The project managers were located in some mysterious portion of the building and rarely interacted in person with any members of the team. Contact was usually facilitated by vidcomm links; two-way video-conferencing, or occasionally a team member would be summoned for a personal meeting. In Jurgen’s case, he had been receiving all his instructions by email during his first few days of employment; just plain text files. The tasks were quite simple and not very challenging; they were usually routine coding procedures that could easily be accomplished within the morning work


period. By the fourth day, Jurgen had begun to complain about this situation to one of the others in the ‘leisure area’. In reply, the team-mate suggested that Jurgen always appear busy while in his cubicle, since it was likely that his activity was constantly being monitored. That afternoon, his assignment completed, Jurgen was lying on his couch deep in thought, absently staring at the Gensynth logo and company’s slogan - printed in English on the side of his plastic coffee cup: “Creating a new and better world.” For the past few days he had been eating stuff from the vending machines and often napping on the couch. He had begun to notice that he had been slipping into a kind of perpetual dream state caused by boredom and the sensory deprivation of his sterile cubicle. While he was thinking about mounting a flat digital display panel on the wall, he gradually recognized a voice creeping into his consciousness from just above the threshold of hearing. He soon recognized that it was a woman’s voice, repeating what sounded like his name, over and over again; “Jo Kan ..... Jo Kan ..... Jo Kan”. Jurgen leaned over and twisted the knob on his ‘squawk box’; which he had set to the lowest possible volume setting, since it mainly broadcast what Jurgen believed was some type of motivational propaganda but was uncertain since the messages were spoken entirely in Japanese. He fumbled with the device, wondering if it had a built-in microphone. “Yes?” .... “What?” ... “Hello, can you hear me?” Jurgen questioned the box. “Jo Kan, .... report to Dr. Sato in sector 7G immediately please.... thank you!” He asked Shozo where sector 7G was and Shozo quickly sketched a map on a chocolate bar wrapper. Jurgen threaded his way through a maze of cubicles, taking the elevator up to sector seven, located on the third floor. It was the level that contained the offices of the executive administrators and research project leaders. Admission was by invitation only; if they wanted to see you, they would call. A darkened room framed a large black reception desk within its polished black marble walls. Jurgen immediately noticed the astonishing receptionist, who incredibly, was even more gorgeous than he had been led to believe. He had often heard her described in terms reserved for an angel. The rumor was that no-one had ever seen her enter or leave the building. Although no one was really sure, everyone believed that it was possible she was synthetic. Even Jurgen’s female team-mates seemed to have great admiration for her; to them she was an idol. Certainly she seemed ethereal; answering incoming calls with poise and grace, intimate with the tiny microphone emerging from her long, dark, shiny hair, lit from above by a single beam which bathed her curvaceously-tight red sweater in a soft halo


of pure golden light. Jurgen swooned into one of the plush black vinyl chairs, arranged in a row facing the receptionist. There was nothing else to look at in the empty waiting room while she performed her delicate ballet center stage. Politely attempting not to stare, he gazed down at his sneakers to notice that they were still covered in dirty honey stains. He suddenly became self-conscious about his appearance, realizing that his casual clothing; faded grey jeans, and a white t-shirt with a ‘hardwire’ logo, although standard attire within the cubicles, seemed inappropriate in this formal environment. He shifted his gaze, searching the black void of the polished floor, anxiously awaiting the moment she would deign to acknowledged his presence. Still, that moment lingered, then stretched into eternity, until he must return his gaze. His heart skipped a beat when she finally, casually turned her head, and penetrated him with her enormous beautiful eyes, and in a sweet, sullen voice quietly whispered; “I love you, will you take me for your wife?” Jurgen’s mouth remained open dumbly during the few moments it took to realize that she had actually said something which sounded similar; speaking Japanese to some remote person through her tiny microphone. He had just closed his jaw when suddenly an energetic assistant burst into the room from one of the darkened pas‐ sageways connected to the reception area. His fantasy dissolved as the receptionist engaged another call, and the short, muscular body-builder type approached, offering to guide him to Dr. Sato’s office. The narrow hallway was dark; its atmosphere hushed and secretive. The thick carpeting produced only silence. Each of the heavy doors along the passageway were closed. When they reached the fourth or fifth door on the right, the assistant briefly knocked, opened the door, then stepped aside to allow Jurgen to enter. Once inside, the assistant disappeared and the door immediately closed behind him. Dr. Sato lay motionless on the floor. Neatly dressed in a white, custom-tailored uniform; a hybrid between a suit and lab coat, Dr. Sato's arms were folded across his chest and his eyes were closed, resting peacefully on a mat near the center of a room. He didn’t appear to be breathing ...silence... the only sound was Jurgen’s own heartbeat. Uncertain what to do, Jurgen cleared his throat quietly. Still no movement. Jurgen’s eyes darted about the space. The plain white room was austere in the Japanese tradition of aesthetic orderliness and simplicity; its only furnishings were a computer monitor positioned on a low pine table and several neutral grey mats scattered around the floor. There were no windows. After remaining immobile, for what to Jurgen had seemed an uncomfortably long time, Dr. Sato suddenly opened his eyes and sprightly sat up. He smiled briefly then gestured for Jurgen to join him on the mat. Jurgen cautiously approached, casually sitting nearby at a distance that, if they had both extended their arms, their fingertips would almost touch. Facing directly toward each other, they both spent several moments studying the other’s features. Jurgen observed a man, possibly in his middle


40’s, whose face displayed calm, boldly defined, yet delicate features. His unevenly trimmed, coarse, grey hair and his wrinkled eyelids, which draped over a pair of jet black glistening eyes that twinkled like stars under a heavy canopy, imparted an air of wisdom, weariness, and eccentricity. Jurgen had recently become aware of Dr. Sato’s genius as a mathematician; reputed to have demonstrated on numerous occasions his ability of computing several complex equations, simultaneously, within his mind. He apparently was also a notorious task master who demanded strict attention to detail and a dedicated work ethic from his employees; in order to assure a level of production quality which approached absolute perfection. Yet, as Jurgen would soon discover, his inscrutable expression seldom betrayed either his thoughts or emotions. His first words were formed as a request that Jurgen assume a ‘lotus position’, similar to his own posture; sitting with his back straight and with each leg crossed over the other. When Jurgen had graciously complied, Dr. Sato then began the indoctrina‐ tion in a slow, quiet voice: “Non-disclosure should be assumed effective in all activities, including information dialogue exchanged. There are many current project developments, therefore important, that each employee need be aware of only information pertinent to their own... A mind free of clutter, thoughtful and clear, leads to successful achievement.” Jurgen appreciated Dr. Sato’s careful selection of his words, since English was a language he himself had often found difficulty in speaking as well. Dr. Sato explained that Jurgen had been ‘naturally selected’ to join the team because of his expertise in digital genetics. He mentioned that the scope of Jurgen’s participation was about to increase, since Dr. Sato, himself, would be taking a more active role in directing the project, and as a result, from now on Jurgen would report directly to him; most often via vidcomm display. Dr. Sato encouraged Jurgen to take initiative in exploring alternative solutions to any task he was assigned, yet at the same time, reminded him of his obligations to the team. Standard operating procedure; defining the bounds of freedom. While Dr. Sato continued to outline the regulations and requirements, Jurgen’s concentration lapsed. He recalled an expression that Shozo had introduced him to shortly after his arrival in Japan. Loosely translated: ‘The nail that sticks up, is hammered down’, implied that non-conformity was often the target of decisive corrective action. His thoughts continued to wander further away as he considered the odd sense of informal formality created by this face to face encounter, sitting cross-legged on the mat. It reminded him of similar sessions with Coraline at the Akademy (he could clearly imagine her beautiful face); in which they had learned to read each other’s thoughts. He had just begun to ponder whether Dr. Sato had that same ability, when he suddenly became aware that Dr. Sato had paused and was patiently awaiting Jurgen’s full attention to return to their meeting.


He then continued on, supplying information about the research being conducted by Jurgen’s team. He explained that the project’s ultimate objective was to develop several new species of life. Each model in the series would be organically manufac‐ tured by integrating the anatomy of a human operator with components obtained from enhanced insects and machines, and merging them with the latest developments in computer technology. Dr. Sato referred to them as ‘hybrid workers’; since in terms of strength, intelligence, and adaptability, each could carry out tasks currently beyond the capabilities of either an individual human or the most sophisticated robot. He went on to add that each variation in model design was determined by the unique environment into which the assembly was introduced. The first model on the drafting board was a giant ant which would be cloned to create a work force specifically fabricated to harvest fields of grain or rice. Jurgen was intrigued by the concept but wondered why it was necessary for the assembly to have a human operator. Dr. Sato simply responded by explaining that since they were guided by human intelligence, it would make them easier to control. He reminded Jurgen that the entire assembly was essentially organic, with the exception of certain replaceable metal or plastic components, and that each of these beings would be born, would live to perform their tasks, and ultimately would die. Behavior and motivation were factors that were clearly understood; the stimuli detected by any living creature’s nervous system would make them responsive to pleasure and pain, and to some degree, an awareness of their own mortality would provide a sense of fear. Dr. Sato had been watching Jurgen’s expression closely. Detecting an uneasiness, Dr. Sato urged him to think beyond any limitations he held in defining the concept of what is considered to be ‘human’. Evolution is a process of transformation and adaptability that has seen the physical form and lifestyle of humanity change substan‐ tially over a gradual period of time. What the research team at GenSynth were preparing to do was compress that timeline during the upcoming decade, in order to create an enhanced human being that was better able to fulfill its role in providing for the greater needs of its society. Dr. Sato assured him that within the next ten years, before the first hybrid workers began to make their appearance, the imperative, recognized by all the research and development teams, would be to ensure that their progress was carried out in a conscientious manner. He then mentioned that the project involved the collaborative effort of numerous facilities around the world, each of which shared the responsibility of carefully, and continually, evaluating the ethical and moral considerations of their work. Jurgen was already familiar with Professor Zinthrop and his research team at Imago Enterprises who would supply a growth hormone that was predicted to increase the size of an ant’s body by an estimated factor of 100, by early 2010. He had also learned that researchers, at the facility in Osaka, as well as at other GenSynth locations around the world, were working to modify the DNA of the human operators using sperm samples obtained from athletes training at a special facility on the island of Hydra, in Greece. Extensive theoretical testing of bio-mechanical devices, composed of an


organic cellular material, had commenced using elaborate computer simulations to determine the most effective way of integrating these components seamlessly within a human, or insect’s, anatomical structure. Yet, perhaps the most essential component was the one that Jurgen would be involved in developing; the operating system which would provide instructions and create awareness within the mind of the hybrid assembly. It had been determined that the tiny organic computer would be fabricated using the storage and logic properties of the DNA helix itself. At the conclusion of their meeting, the muscular attendant immediately reappeared in the doorway, even though Jurgen could not detect any means by which he had been summoned. Jurgen then somewhat unsteadily rose to his feet, since his lanky legs had partially fallen asleep, immediately returning the courtesy of Dr. Sato's bow. He followed the attendant along the dark corridor, casually glancing at the receptionist on the way out, but once again he had become invisible to her. Out among the corridors and cubicles again it felt like he was walking through a dream. His mind was full of strange thoughts. He tried to gauge his reaction to the information he had just received but his logic and emotions kept oscillating between extremes. The polarity of attraction and revulsion seemed to cancel out, producing a somewhat neutral response; analogous to the way an alternating current of electricity is often perceived to be a steady stream, or perhaps more appropriately, the sensation of being uncomfortably numb, just like the dull feeling he was experiencing in his rubbery legs. He was certain that his grandfather had likely considered similar ethical questions when he had been designing the emp/t bomb. [At times like these, Jurgen had often wondered if it were possible that he was the reincarnation of Cameron Stark]. Jurgen had been immersed in scientific discovery during his entire life. He had learned that nothing was outside the realm of possibility, that scientific concepts evolved in the same way that everything else had evolved; once upon a time it was commonly believed that the sun revolved around a flat earth. Even during his own lifetime, Jurgen had observed that many of the firmly established scientific principles had eroded like foundations made of sand wherever a new ocean of evident proof had advanced. Science fiction wasn’t fiction anymore.


VI. THE MONSTER

They finally zoomed off to the warehouse one Sunday afternoon in a small Photon. The experimental vehicle was a company car; a solar-powered two-seater encased in a bright lemon tear drop shell. It moved quickly through Osaka with Shozo behind the wheel. He had selected a radio station, and now strange music blasted through the speakers; a high-pitched female voice soaring over a field of electric violins that were tuned real low to create a dissonant roaring symphony. Nearly every day during his first few weeks in Japan, Jurgen had urged Shozo to take him to the warehouse to see the computer that his grandparent’s had built. Shozo replied that if Jurgen remained patient, everything would soon be arranged ... now that day had finally arrived! Jurgen trembled; mainly from excitement but partially from terror. The tiny vehicle careened through crowded streets filled with shoppers buying presents for Kurisamasu and Santa’s arrival was only about one week away. Jurgen realized that he was fortunate to have developed a close friendship with Shozo. Not only did he appreciate having someone who could provide a reference point in this present chaos; by guiding him in the protocol of Japanese culture and acting as an interpreter when required. But even more so, Jurgen was constantly impressed by Shozo’s knowledge of legacy computer hardware; a subject which had already become an acquired fascination since researching the Stark’s experimental machine. Jurgen was grateful for any enlightenment passed along to him by his wise and indulgent friend in facilitating an understanding about any of these matters. In return, Jurgen supposed that he was an interesting companion, who offered Shozo an endless amount of amusement as a rakugo; by his humorous reaction to common‐ place objects and every-day events, as well as entertaining him with intriguing stories about the strange, far-away land he was from. Shozo guided the three-wheeled Photon into the empty parking lot next to a large warehouse that looked just the same as countless others nearby. They walked around the exterior of the anonymous building which bore no logo or insignia, and entered through an unmarked door at the back. Inside a small office they startled an elderly security guard who had been catching up on his rest. The guard checked their passes with a cursory glance then flipped the handle on a breaker box to illuminate a few of the tiny fluorescent lights high on the ceiling of the dusty, cavernous space. The interior housed a vast accumulation of dinosaur artifacts from an ancient lost civilization; each pile covered by a heavy brown canvas tarp. Since the piles were not arranged in any particular fashion, it created the appearance that they were enormous carcasses that had been left scattered over a killing floor. Every once in awhile a large


rat would scamper between the shadows, freezing briefly to stare into the beam from the flashlight Shozo had borrowed from the guard. Shozo forged ahead, continuing to lead the way as they explored this environment for quite some time, here and there, randomly lifting a corner of a tarpaulin to see what it concealed. Jurgen was once again impressed that Shozo had been able to identify nearly every machine: a BunkerRamo 230, a GE-53, a Whirlwind, an Oracle, a Monrobot VI, a Burroughs B5500... and then there it was! The TRINIAC! Jurgen’s eyes lit up when he saw the computer. He had not been concerned that it resembled a pile of junk. To finally see and touch the machine that he had only been able to read about was an almost mystical experience. Jurgen pulled off the tarp and immediately started taking an inventory of the damage. There seemed to be compo‐ nents missing, tubes were blown, and masses of wires hung down where sections had been cut apart in order to transport the gigantic apparatus. He ran his hands over the surface metal texture and studied the wear around the switches and knobs, taking note of the craftsmanship that had gone into fabricating every part. The more he explored, the more convinced he became that the equipment could be repaired. Next he turned his attention to about a dozen ripped and stained cardboard boxes that sat on the floor nearby. They contained an even more exciting treasure; several handwritten technical manuals and notebooks, and quite a number of magnetic tapes containing the original program code. He picked one up at random, and unrolled a length from its spool; the tape did not seem too brittle or to have suffered significant damage from poor storage and handling during the past half century. “We can get this running,” Jurgen said. “Okay!, lets do it!” Shozo replied. That’s how easy it was decided. Shozo, perhaps, may have had doubts about the integrity of the hardware, but he had none about the enthusiasm of his friend. The next few weeks were hectic, even by Japanese standards. Fortunately it was the end of the year, and GenSynth employees’ thoughts had turned to festive celebra‐ tions; Bonenkai, Shogatsu, and Kurisumasu Keki topped with strawberries and whipped cream. Shozo was able to spend his time at the office facilitating operation TRINIAC Recovery. He efficiently arranged the authorization to have the hardware transferred from the warehouse to what had been described in the official interdepartment communication as a private industrial shop. He even managed to requisi‐ tion a small budget to obtain the tools and materials that would be needed to recon‐ struct it. To Jurgen’s dismay the ‘private industrial shop’ turned out to be a run-down, abandoned workshop that Shozo's uncle had last used for woodworking and cabinet making several years before. It was also located quite a distance from Jurgen’s apartment; on an old country homestead near the edge of Izumi-fuchu that was now surrounded by tall buildings on all sides.


“Can’t we find another place?” “I don’t know how you can complain; the rent is free, in exchange for repairing the building,” Shozo replied with a smile. “I don’t know... it’s very dilapidated. It’s going to take forever just to clean it up.” But Shozo soon managed to round up a dedicated volunteer labour force consisting of his extended family who cheerfully pitched in to get the building cleaned up during only three days of team effort. It was an enjoyable time. Jurgen met the family; the brothers and sisters, the uncles, aunts and cousins - including a young woman his age named Kaori; a fragrant, girlish name. Kaori was very pleasant, and very pretty, but she had a nasty, identical twin sister named Kiyomi, who often seemed to be on a mission to keep Jurgen and Kaori apart. At first Jurgen assumed Kaori was a traditional girl, since she dressed conservative‐ ly and acted kind of shy. She had a cute, innocent face, which always remained partially hidden behind the light wisps of hair covering her dark brown eyes. Yet when they were revealed, her eyes shone merrily like mischievous bright pools of reflected glimmering light. Her delicate lips were usually set into a beautiful pink flowering bud as though she were concentrating very intently on something in her thoughts, and although seldom, whenever she smiled, her face would be transformed into an expression of radiant joy which immediately caused those around her to also smile as well. In addition to her beauty, Jurgen was amazed at the determination Kaori would direct to the tasks. Although her arms were slender, they were powerful. She would pitch in and help carry even the large wooden beams that had been stacked up in the shed. Since she didn’t speak his language, and Jurgen had only learned a few phrases in Japanese, it was their subtle glances and body gestures that communicat‐ ed an interest that had increased since their first introduction, and seemed to make the clean up of the storage space a more pleasant task for them both. When the shack had been swept out, the roof repaired and the windows replaced, Shozo called on another cousin, a young man everyone called Yadon, who had a dumptruck that he used for hauling gravel. They had managed to transport the computer equipment in just one trip between the warehouse and the workshop. It rattled and bumped around in the back of the truck during the entire journey. Jurgen was becoming increasingly tense and anxious as he rode up in the front seat with Yadon; he kept shouting above the roar of the engine for Yadon to drive more carefully. Yadon just nodded and smiled, “Hey man, this is a dumptruck! What did you expect?” Jurgen, who usually remained calm, found that his level of stress kept increasing, since it was soon discovered that several components were slightly larger than the narrow double doors at the back of the shed. Once they had widened the door’s


dimensions by knocking out the frame, part of the wall soon collapsed and would also need to be repaired. The whole ordeal, from the time they started cleaning, until all the equipment had finally been moved inside, had taken much longer than Jurgen expected; it was already New Year’s eve - and he hadn’t even noticed Christmas. It seemed to be a universal principle that simple projects keep expanding, consuming more resources until they eventually turn into a monster that takes on a life of its own. Jurgen had always been sympathetic to the fate of that poor devil; Dr. Frankenstein. The others had left for a New Year's Eve party that night, but Jurgen had declined their persistent invitations, deciding to remain in the workshop to evaluate the situation. He began by dragging the parts around to create an approximate configura‐ tion; the length of the old wooden shed was just slightly larger than the estimated reconstructed size of the machine. He wondered what level of insanity would be required to attempt to get the computer to work under these circumstances. His initial estimation was that the level would be extreme; the computer was designed to be used at a regulated air temperature and in a dust free environment, not to mention that several key components seemed to be missing. Yet, if Cameron Stark had been able to originally build this machine from a bunch of odds and ends, Jurgen believed there wasn't any reason why he couldn’t repair it by himself.

VII. A SYNTHETIC WORLD

The Shogatsu holiday lingered into early 2008. The traditionalists worshiped Toshigami; the deity of rice - praising the past harvest and preparing wishes to ensure good fortune during the incoming year. But for the young crew of geeks at GenSynth, the party mode continued. This gang would still get wildly drunk every night, singing in Karaoke bars or visiting the Love Hotels; it seemed that once they got started it was difficult to stop. They would drift in every morning, their eyes as red as fire, and once again attempt to assume their typical restrained, conservative behavior which was customary within the hallowed cubicle halls. Most would secretively sleep all morning with their faces pressed against the keys. Jurgen had gotten to know most of the team quite well: Nashi, Chiyuki, Takako, Saihoon, Rakkii, Myushi, Tattsu, Tomoko, Etsuko, and cute little Pikachu. Of course their was also Shozo, but of the crew listed above, Tattsu and Takako were the two that he had most closely formed a bond of friendship with. Tattsu, for some reason had become convinced that Jurgen was from the USA, and it didn’t matter what Jurgen said to dissuade him since Tattsu spoke only Japanese. Tattsu was a huge fan of the


Chicago Blackhawks; a hockey team in America, and almost always wore one of his many Chicago team jerseys to work every day. While Tattsu was exuberant and outgoing, Takako was withdrawn and quiet to the same extreme. She worked with Jurgen in the area of artificial intelligence; she was extremely talented and clever. Because she was deaf, she communicated with everyone using sign language; which Jurgen discovered he was more readily able to understand than his comprehension of spoken Japanese. Their secret communication, and the fact that they were both outsiders, perhaps had drawn them closer together. Although, Rakkii occasionally insinuated that it was Takako's breasts; which were exceptionally large for a Japanese woman, that had motivated Jurgen's desire to develop an close working relationship with her. Jurgen understood Rakkii’s message, since he made a gesture that went like this... Several times during his first few weeks in Japan, Jurgen had gone out for a night on the town with the crew; it was expected of him. He soon found it somewhat terrifying to watch these typically mild-mannered programmers transform into wild and crazy beasts, once the saki, beer, scotch and vodka had started to flow. They would strip off their shirts and ties, and roll around half-naked in the broken glass on the table. They would grab a woman’s breasts and pretend to hump her leg. It was all in good sport, yet for Jurgen, sometimes it was a little too much. The next day they would all return to the plant disguised as efficient, serious workers, and go about their routine chores as if nothing had happened the night before; Dr. Jekyll and Mr. Hydoru. Jurgen gradually eased himself out of invitations to participate in the madness; explaining that he was handicapped by his European values. In the meantime, Jurgen worked hard, and Dr. Sato was pleased; giving him a rating of ‘Satisfactory Plus’ on the tasks that had been assigned. Dr. Sato had also praised the care Jurgen had taken in commenting the code and preparing the documentation. As a result of his dedicated effort, he had also recently earned a promotion to programming lead of General Synthetics’ Artificial Life Division. Dr. Sato and Jurgen had begun to meet regularly; every morning at ten for a fifteen to twenty minute vidcomm exchange. Jurgen welcomed this daily communication, since it often afforded him the opportunity to discover information that provided a broader context about the project’s scope. Jurgen soon became aware that GenSynths’ parent company; The Golden Sun Corporation, was much larger than he had imagined. Its tentacles wrapped around the entire globe, probing into every aspect of new technology that teams of scientists, researchers and technicians, working at the laboratories of its many subsidiaries, had managed to conceive. This was the new digital alchemy; the magic derived from wizards who had transformed insignificantly tiny molecules and fragments of code by rearranging them and recom‐ bining them in new ways to create extremely powerful substances that were formerly beyond the realm of human imagination. Everything was operated under the Golden Sun umbrella, which ultimately owned the rights to any significant products or processes that evolved from this research


activity. The corporation’s hierarchy was similar to a pyramid, in which thousands of projects were undertaken at the base level, and those rare gems which proved to yield quality results, gradually moved up in priority, until they finally arrived at the apex of the structure where president of the Golden Sun Corporation; the Sun King dwelled. Over the decades, the Sun King had shrewdly gathered about him a collection of most trusted advisors. It was the prerogative of these administrators to manage the innova‐ tive technical discoveries in the manner that they saw fit. Their ability to make skillful executive decisions enhanced their own personal power as well as provided long term financial benefit to the Golden Sun Corporation. Mr. Luk, whom Jurgen had spoken to on the video phone in front of Zinthrop’s observational hive in Hawaii, was among this upper echelon. General Synthetics, for its part within this grand scheme, was a relatively recent acquisition. With offices in fourteen countries, it was primarily dedicated to exploring the potential of cellular chemistry to create molecular compounds which were not found in nature. Work was proceeding around the clock to develop functionalized polymers, to introduce substituents on the pyridine ring and to the totally synthesize cyclodextrins in order to manufacture an array of new, and beneficial products; disease resistant plant life, curative cosmetics, drink additives, resin teeth, artificial turf, synthetic vitamins, minerals, leather, lubricants, human organs, skin tissue, and so on... ... and Jurgen, well, he was merely one of the sorcerer’s apprentices. As he had in the past, he continued to toil away writing the code that created programs which simulated digital evolutionary systems. The progression in the development of his work, which began with larval experi‐ ments as a youth in his mother’s basement, then later evolved at the Akademy, had now fully matured with his access to the more sophisticated advanced technologies. A fringe benefit was that his research work also provided high-level clearance to explore the databases located within the secured servers of the Golden Sun Corporation. Jurgen would regularly download DNA code that had been collected by the corpora‐ tion as part of a project called NOAH. He was naturally interested in the insect files, since the DNA, although complex, was still manageable for replication within the synthetic environments. He created algorithms which translated the code mathemati‐ cally into three-dimensional graphic representations of insects at any stage of their development. By manipulating the variables, Jurgen could adjust the relative size between the insect’s component parts; the head, thorax, abdomen... so that if desired he could create shorter legs or provide the creature with a greater wingspan. He would readily take code from one insect and integrate it with the code of another to create diverse forms of new life that existed only within his computer. Since the synthetic creatures evolved within in a synthetic world, both the organisms and the environments they inhabited could be constructed for a variety of purposes. He experimented by adjusting the parameters, then let the program render out overnight. The following morning, wandering in with a coffee cup glued to his hand, he would


study the fascinating results that were revealed. He spent hours calculating methods for adjusting their rate of evolution, in order to achieve the emergence of entirely new phylogenies of complex digital organisms that had the ability to adapt themselves to any type of environment. The object of the ‘bug game’ wasn’t actually to create an eugenically improved form of natural life; it was only another stage in the process of designing a molecular computer. It had been at Dr. Sato’s request that the mind of the ‘hybrid worker assem‐ bly’ be equipped with an extremely powerful and compact bio-electronic computer in which strands of molecular DNA would perform the processing and digital storage, rather than imbedded circuitry imprinted on silicon chips. In principle, a computer can be made of any substance if software can be written to instruct this hardware how to operate. Jurgen’s experiments in artificial life, using actual insect DNA, provided a method of understanding how a set of molecules arranged in a double helix are able to process its own code; how it is able to replicate itself, which genetic fragments are lost in the process of cellular reproduction, and to determine how much, and which, information is passed along to the next generation. It was also critical to understand how the factors of mutation and random chance created variation within the process, so that ultimately, the power of this natural occurring process could be harnessed to create a functioning logic machine. Of course, the greatest challenge in taking the process to its final stage would be to build an environment of even greater complexity in which a massive amount of ‘live’ data was integrated into the virtually-constructed simulation. Yet, as Jurgen watched his bizarre insects crawl about within a surreal digital terrain he had taken great care to construct; sometimes an office space with potted plants, sometimes a Japanese garden made up of fields of raked gravel and islands of stone, Jurgen often became intensely aware that if it were possible to simulate, it would soon be possible to construct actual lifeforms of this type, using the wonders of biotechnology. This idea sometimes frightened him. Creating life that existed inside an isolated computer was manageable, since everything was carefully designed and controlled. The potential danger of releasing actual creatures into the natural world, (or a similar type of complex entity into the network, for that matter), where there were no real limits to the variables, could lead to unexpected consequences that were beyond the ability to conceive. One day at the office Jurgen noticed some strange seeds that had attached themselves to his pant leg. They were bright green, shiny, with little barbed hooks on their thin white spindly arms. He thought about these little self-contained biological packages. He thought about the way they had been designed to be distributed, and the way they contained all of the nutrients and information that were needed to create new life. He thought about how they had been introduced into the foreign environment of his tiny cubicle inside the office. These tiny little packages would continued to flourish while larger creatures would always have much greater difficulty in adapting to the environmental changes within their habitats. Maybe...


Maybe he was just working too hard. He seldom took breaks other than to briefly cover his eyes with the inside of his elbow to give them respite from their intense concentration of the screen. He often considered with certain irony that isolation is conducive to progress, and as such, his fellow workers had learned that he did not like to be disturbed. Once his concentration had been interrupted by an intruder entering his space, he often found it difficult to regain the focus of managing the intricate complexity of the instruction sets that his computer needed to carry out its work. The computer was his slave and it was his master. It did what it was told, billions of times faster than it took Jurgen to decide what it should do next. The little electrons were flying around in there at a speed approaching the speed of light, flipping switches and accumulating in registers, and carrying out mathematical operations constantly. Yet, the little factory gave no outward sign of life other than the gentle humming sound of its cooling fan. Suddenly there was a knock on the door... Shozo came in laughing and smiling. “Hey man, it’s time to go. You shouldn’t be working on a Saturday. Besides Kaori told me that you were going to meet up with her tonight. She wanted to help out at the workshop.” He punctuated the last sentence with a subtle wink that made Jurgen feel a little uncomfortable.

VIII. COCOON

Jurgen eventually discovered a bus which roamed out into the wilds of Izumi-fuchu. Once he had found it, it became the same route that he would always take. The familiarity was necessary since sometimes his thoughts were elsewhere. The way points of the journey had been automatically programmed into his memory; it helped to reduce the instances of unexpected circumstances which could result in awkward situations. The workshop was a rustic, natural environment which felt warm and relaxing after being confined within his sterile GenSynth cubicle and staring at a viewscreen for twelve hours at a stretch. The wood-frame building had been kept in good condition. It had an old-fashioned, steeply sloping roof covered in Lioli tiles, and had a pair of tiny windows along each of the building’s longest sides. A single door became the front entrance when the building was approached across a patch of tall, unkempt grass from the main street. At the back, a set of double doors opened out into the lane. Several other buildings stood on the small plot of land; one used as a hen house, one


as a storage shed, and one for something else. They were dissolving from the weather, the same as the crumbling fence which encircled the perimeter of the lot. The workshop had become Jurgen’s meditation space; a place where he could reflect on a past that was not really his but was somehow encoded in his genes. The computer had become a way to access that past and reassemble those lost memories. Often, the recurring sensation, deja vu; he had built this machine before - sometimes his thoughts would absently drift away only to suddenly return with the realization that, during the interval, he had fastened together several components without giving it a conscious thought. It was a strange temple. Inside was a single open space that was dry and smelled like old wood. An ancient workbench lined one wall, and directly opposite, a pile of metal computer components were strewn along the other. That night, Kaori arrived to help Jurgen line the entire room with heavy plastic sheets in order to create a makeshift cleanroom. He had previously obtained an air-conditioning unit, and this evening, had modified the filters to provide the enclosure with a supply of fresh air at a consis‐ tent temperature. Together they ran cable, then suspended several halogen lights from the rafters; the intense beams blasting through the thick, transparent sheets gave the room an atmosphere of being inside a space station, or more like a cocoon. They worked almost until dawn to install the protective environment then he and Kaori curled up together, exhausted from their labour. Still dressed in their clothing, and using a sheet of plastic as a blanket, they snuggled closely on an old futon in a corner of the tent for warmth and for comfort; nestling like two caterpillars within the cocoon. They had kissed briefly then had quickly fallen asleep. They awoke some time later; both feeling somewhat awkward and embarrassed about having spent the night together. When they emerged from the cocoon there was brilliant daylight outside; Sunday morning. They ate breakfast at a nearby restaurant then took the Cosmo bus to Cosmosquare; Kaori lived in the dense urban region of Nanko (South Port) near the Aquarium and Cosmotower. As they parted at the bus station, Jurgen noticed that she looked tired. He inquired if her parents would be worried that she had not come home that night. She smiled shyly and shook her head. Jurgen then made a rare appearance at his bachelor apartment to shower and change. His afternoon lunch consisted of; sautéed mushrooms, potato chips, cole slaw, apples, and soda pop. Then he immediately returned to the workshop. Shozo was already there, but Jurgen was disappointed to discover that his friend wasn’t willing to help work on the computer that night as they had previously planned. Instead he was sitting on a bench out in the yard, using bamboo and some of the leftover plastic to build a large box kite. Jurgen, visibly expressing his displeasure had retreated inside the workshop, but after spending some time chilling out within the cocoon he was able to give the matter clearer thought: gradually coming to the realization that he was at fault for expecting his friend to be as interested in this project as he was. He realized that his own stubborn, intense inner drive made it difficult for


him not to obsessively pursue a goal once he had committed himself to it. In the past, that commitment had been obtained at the expense of close friendships; friendships that he often missed, and perhaps now valued more. Why couldn’t he be like other people with normal lives, he wondered; people who had the ability to embrace a broad spectrum of interests rather than single-mindedly pursue an illusive goal that always hovered in the distance like a vague mirage? To make sure that Shozo wasn’t offended by his earlier dark mood, Jurgen returned outside to make amends, wanting to demonstrate that he was happy now, and erase the impression that he was some kind of forlorn grouch. He sat on a pile of wood outside the shed and listened patiently to Shozo describing how excited his nephew would be; explaining that the young boy had always dreamed of owning a kite. Soon he would be able to make that dream come true. Shozo enthused that he would get the biggest spool of string that he could possibly buy, then, on the next windy day, he and his nephew would take the kite up into the Keihanna hills to see how high it would fly. Jurgen glanced up at the sky, only to notice a row of tiny black crows that were perched along the power line. The sound of Shozo’s voice seemed to fade away as he began to wonder if their tiny bodies were affected by the magnetism induced by the electric current. Perhaps it was a pleasurable sensation that they enjoyed... It didn’t take long before Jurgen realized that his concentration on the kite project had begun to lapse. Sensing that he had spent enough time to politely acknowledge Shozo’s activity, the former Jurgen returned, tapped him on the shoulder, and beckoned him back inside the workshop. The entire night was spent assembling just one small component of the computer, an activity that consumed him until the sun was nudged above the horizon. At daybreak, a rooster, posing on the nearby hen house, began to crow its awful, warbling shriek. This was Jurgen’s alarm clock, indicating that it was time to return to his cubicle at General Synthetics once again. This cycle; working at GenSynth during weekdays, then spending nearly every night and every weekend at the workshop, formed a pattern that continued well into the summer. Jurgen worked tirelessly to rebuild the ancient machine and when he did sleep, it wasn’t at his apartment but on the futon in the corner of the workshop. It hadn’t taken long before the restoration project had become an obsession. He was con‐ vinced that the hardware embodied some type of spiritual force, so that soon, the computer, protected within its cocoon housing, became a shrine within the workshop temple. He had even begun to adopt a range of superstitious rituals that involved entering and exiting the building and handling the components and tools. Weird things, like; making sure that his shoelaces were tied before entering the workshop, always turning on the lights in a certain sequence, or using a screwdriver with his left hand to tighten screws and with his right hand when he loosened them. Shozo helped out at the workshop whenever he could, but proved to be more valuable as a contact with suppliers. Shozo never left home without his cell; his voice activated headphone allowed him to speak to anyone, anywhere, just by speaking those two magic words, followed by the name of the party. Because of his thorough knowledge of arcane technology and his dogged perseverance, Shozo had even


managed to track down suitable replacement components from such obscure sources as government auctions and recycling plants located all over the world. More than a few parts were also obtained locally from GenSynth's computer museum warehouse. Shozo's access had enabled Jurgen to scavenge tubes, transistors, wires and dials from the odd assortment of stored junk. And it wasn't long before shipments began to arrive at the workshop packed in wooden crates. Of course, Jurgen had offered to use his wages to pay for these parts and the cost of their airfare delivery, but Shozo wouldn’t hear of it. Instead Shozo sent the bills directly to the accountants at GenSynth. Kaori, Jurgen's little caterpillar friend, continued to come by, sometimes bringing him supper; karage and sushi, in a cute wooden bento box. She had secretly hoped that they would mate within the cocoon; hoping that one day soon she would finally transform within the chrysalis to emerge as a beautiful butterfly. Unfortunately for her, Jurgen had recently become even more binary and existed in only one of either two conditions; when his status was on, he would be completely immersed within the computer’s dull bluish-green metal chassis, or when that state was zero, he would be curled up exhausted on the futon in the corner, wrapped in an old ragged blanket, too tired to even open his eyes. Sometimes she would curl up next to him and sleep. By July, Jurgen had finally managed to fully reconstruct and refurbish the entire machine, practically single-handed. In its final stage, the monstrous TRINIAC filled well over half the workshop and was an incredible power hog. When he fired up the computer, the little dials on the power meter connected to a recently installed heavyduty underground line, would spin around like a dervish. With the vacuum tubes lit the thing ran hotter than hell in the mid-summer heat of the tiny space, even though the air conditioner was cranked to its maximum setting. Shozo was becoming increasingly concerned about his friend, who never seemed to eat or sleep very often. It was obvious that Jurgen’s dedication to this project was beginning to take its toll on his health and also on his corporate work. While Jurgen seemed to successfully manage to complete his work on both projects, he always appeared tired and haggard, and continually had dark shadows under his eyes. He was now quite thin and pale, his hair had grown long and his beard and mustache had remained untrimmed for quite some time. Shozo once jokingly remarked that Jurgen was beginning to resemble Jesus - and he didn’t want his friend to end up the same way. One day when Shozo stopped by, he found Jurgen to be in an extremely agitated state; he was wearing only a pair of boxer shorts, and was pacing rapidly back and forth, muttering and scratching his head. He had just finished trying to run a set of the Stark’s original data tapes and was completely dissatisfied with the results. Portions of the files would load and run but the system would always crash. There were too many variables, he complained, between the hardware and the software for him to be able to isolate the sources of the many problems. After a twenty minute run, it would take him a few hours just to crawl around behind the chassis and replace all the burned-out tubes. Today, he claimed, he had just discovered for the first time than an insect had


melted onto one of the circuits. Not recently, but a very long time ago; only the silhou‐ ette of its body outline and wings, like a faded shadow, was all that had remained. Forgetting the fact that Shozo was completely unaware of any background information about the Starks, Jurgen seemed to be rambling almost incoherently as he tried to convince Shozo that this insect, literally a computer ‘bug’, or rather, some type of large moth, had somehow affected the Stark’s computer program by randomly destroying part of the circuitry during their ‘virtual reality’ experiment during the 1950’s. When the computer tried to access that part of the system, it had received aberrant data that somehow caused the program to produce unexpected results. At the end of this rant, he gave Shozo a look that said: ‘There, doesn’t that explain it!’ In response, Shozo wrinkled his forehead into a puzzled expression that became frozen on his face for several moments. Frustrated, Jurgen picked up a loaf of sliced bread, that was in a plastic bag on the work bench, and threw it with enough force that it accidentally crashed through the glass of one of the small window panes. These frequent outbursts made it difficult for others to be around him. Although he would calm down quickly enough, no-one knew when he was going to blow up again. Jurgen didn’t like the person he was becoming and neither did anyone else, subse‐ quently, most of the time he worked through the night alone. It was during one of these times; sitting by himself at 4 o’clock on a Saturday morning, that he decided to search through the cardboard boxes again. He had already read the handwritten notebooks cover to cover countless times and the manuals that described the computer’s configuration and its operating procedure had become his bible. He had previously loaded up tape files stored in some of the boxes, but that night he decided to look through one of the others that he hadn’t browsed through in awhile. At the bottom, under another stack of data spools, he discovered about a dozen slim boxes of audio tape that were formatted on 1/4 inch reels. He tucked them in his backpack and brought them home as soon as the buses started running - after the rooster crowed again. He immediately called Shozo who arrived at his apartment later that same morning bearing a dusty old reel-to-reel deck. (Amazing! - Where did he find this stuff?) While converting the audio tracks into digital files on his home computer, Jurgen discovered that they were voice recordings taped by Cameron and Adda during their early experimental sessions. He lay on the floor during the eight hours it took to transfer the material, listening to the soundtrack through a pair of headphones, hoping to receive some clues. When the transfer was completed, he then listened to the digital copy for another eight hours ~ from beginning to end once again. He found it fascinating to eavesdrop on actual conversations between his then young, (future) grandparents. He could sense their personalities by their tone of voice and its inflection. It provided solace to become more familiar with them via the record‐


ings. Unfortunately, the subject matter of the recordings turned out to be a disappoint‐ ment. The sessions primarily documented the routine analysis of radiation dosimeter readings obtained from life-like human dummies that had been ripped apart in the blast of an atomic bomb. The tapes did contain a few significant instances when the Starks expressed awe or surprise at noticing certain ‘blips’ on the printed strip spooling out of the TRINIAC computer back in 1957. As well, there were a few personal exchanges, but in between those rare moments were long gaps of ‘dead air,’ during which all Jurgen could hear was only the continual background hum of the machine. He had hoped the tapes would provide confirmation that the Starks had once upon a time created a virtual paradise, and had found a way to escape into it through a primitive computer interface. Perhaps those tapes were still sequestered in vaults, he thought; locked away somewhere and forgotten, or perhaps they had been erased or destroyed as part of a cover-up after the Stark’s mysterious disappearance. Jurgen sighed: most probably those records were actually nonexistent. The playback had ended. He continued to lay on the floor staring at the digital clock on the large NTT electronic billboard. Sunday morning was streaming in through the balcony window. It was then he realized that he hadn’t slept in days.

IX. THE DISPOSABLE MIND

“So, what do you think about story?” “It doesn’t make sense, because it is about future and only the character do ordinary thing.” Jurgen stared out the window. The summer sun that beamed down on the industrial park had dissolved into autumn rain; tears falling from the sky now darkly streaked the tinted glass. It was lunch break, so Jurgen was sitting in the ‘leisure area’ watching the rain and listening in on a discussion between two of his fellow employees; Nashi and Chiyuki, about the books they had just purchased. Frequently during lunch, the two would zip off in their Suzonda to a nearby BookBook; a second-hand book supermar‐ ket, always returning with an armload of inexpensive paperbacks that were now strewn over the table. Chiyuki spent the remainder of the lunch break drinking Ovaltine, instead of coffee, while speed reading through the Japanese books; if they


were boring they were discarded into the recycling bin - since there was no time to review them while they had been shopping in the store. If they liked the cover, these two would occasionally buy books printed in English; which was how they’ve learned the language. Jurgen was aware that they were speaking English now to impress him, or perhaps taunt him; since he had been only able to master the most rudimentary words in the Japanese vocabulary. Whatever the case, he appreciated their effort to speak a language through which he could communicate with them without necessitating the use of his dLt; the digital linguistic translator. “Do you mind if I take a look through these?” Jurgen asked, indicating the stack destined for the bin. “Sure, go for it!,” Nashi replied. Jurgen flipped through the pile. “Holy sh....” Surprised, Chiyuki looked up then shyly offered, “If you like it, you may have.” It was a dog-eared paperback novel entitled; ‘The Disposable Mind’, written by Kropton Ernst in the year 2000! It was in English. The cover design was just a plain white cover titled with a generic text block and bar-code resembling the identity label from some type of machine printed in one colour on the front. “Why did you pick this one?” Jurgen asked holding up the book, “Did you buy it because of the cover?” “No, the cover boring,” Chiyuki replied. Nashi pitched in, “I thought it was in Japanese. I read many books by Kropton Ernst in Japanese. He is very weird, very strange story. But in English not so good, transla‐ tion better! He is appearing in Tokyo on this weekend. I want him to sign all my copies of his book, but now, no.” He shook his head sadly, then instantly more cheerful, “because my mother getting married.” As usual, Jurgen returned to his apartment after work. He hadn’t been going to the workshop very often lately. In fact he hadn’t been there in about two weeks. Once his progress on the project had achieved a state of critical mass, it became a standoff in which it was either going to be him or the machine that would be the first to selfdestruct. It was at that point that he decided to pull the plug and walk away. The last time he stopped by was just to make sure that the equipment was still okay and to check that the roof wasn’t leaking from all the recent rain. It was raining even heavier now; it was a dark and stormy night. One of the frequent storms moving in off the coast had been recently elevated in status to a full-blown


cyclone which the meteorologists had named Kuzira. But within the fake modular grid of his apartment’s interior, with its soft earth colours, compact rooms, low furniture, cushions, tiny kitchen, pots, tea... Jurgen was curled up cozily on the futon with his copy of ‘The Disposable Mind’ and a glass of Bolskaya vodka mixed with tomato juice. The novel was a fascinating blend of science, fiction, mystery, romance, philosophy and the occult, although Jurgen soon discovered that the writing was poorly crafted; filled with many grammatical errors, and the punctuation was atrocious. Yet he could overlook the technicalities since he was more interested in understanding the central premise of the story: ‘The Disposable Mind’ was the story of a man named Volken Sheen. He lived in Omaha, Nebraska in the year 2010, working at a factory that manufactured shoes. This factory had an amazing device which was simply called a ‘time clock’. Every morning Volken ‘punched in’ by sitting down in a recliner chair and placing a helmet-like device over his head. It only took an instant for all of his memories to be sucked out of his mind (Kropton called it ‘checking his memory at the door’). A brief moment of ecstasy. Clear. Erasure. Void. Then this blank slate was quickly scribbled over and painlessly encoded by a new set of data that was streaming in; a specialized expert system which provided all the information Volken needed to effectively carry out his labour: monitor complex operations, analyze data, detect problems, make decisions, and ultimately take action. Out on the shop floor, Volken was not burdened by distractions; daydreams, fantasies and the like. He could literally keep his mind focused on his work. At the end of his shift, the cherished memories of his personal life were once again replaced, and Volken was able to return home a carefree and happy man; feeling no stress, anxiety, or the desire to escape the pressures of the job, since it no longer seemed to exist. Of course, Volken Sheen’s story continued, interwoven with a myriad of other increasingly strange, technically detailed themes and situations. Jurgen was intrigued by the hard science of Kropton’s speculation for the future, which only now, nearly a decade later, was actually coming true. Jurgen was reminded of a recent prospectus (seeking potential investors). It was disguised as a news item that appeared recently on his viewscreen. Beneath what was intended to be a humorous title caption; 'Chimp on a Chip' - the article claimed that researchers working for a corporate lab located within Kansai Science City, had successfully been able to record the entire contents of a chimpanzee’s brain; plotting the co-ordinates of all neurons, synapses and neuro‐ transmitter concentrations to create an identical, three-dimensional replica that could be stored on a computer chip. Jurgen read the novel the same way he read most fiction; by opening pages here and there to explore the novel’s passages at random. Sometimes he would be fascinated by the content and intently read every word. At other times he would just skim through the pages to flip ahead more quickly. This interactive approach suited the writing style, since the story documenting the life of Volken Sheen continually jumped


back and forth through time itself. Wherever it went, the story portrayed Volken Sheen as just an ordinary guy who tried to live his life by doing his best to accommodate everyone, but through a series of unusual circumstances, he meets a somewhat predictable, yet ultimately tragic end... After work on Friday night, Jurgen and Nashi went out for a few drinks at a place called Octopus Garden; which had floor to ceiling aquarium tanks built into every wall (including the interior of the washroom). Inside the bar Jurgen quizzed Nashi about navigating Tokyo, explaining that he was interested in attending the book signing of the author Kropton Ernst that would be happening the next day. The few drinks gradually turned into many, yet Nashi seemed reluctant, or unable, to reveal any information. At one point, when Jurgen mentioned that the author was his father, it was like a switch had been flipped, since afterwards Nashi could not stop talking. By late that night, they were both so drunk that they left Nashi’s car in a parkade somewhere. They took a taxi back to his place, where with great ceremony, Nashi presented him with a stack of paperbacks that he wanted to have signed by the author. Jurgen ended up sleeping on Nashi’s tiny couch, waking up early the next morning with a hangover, then catching a cab to the station. The bullet fired down the rails like a rocket sled, past an unbroken wall of human civilization lining both sides of the tracks; there was never a moment during the entire trip when there wasn’t some type of building in sight. In the distance; green hills, stone walls, hay stacks, wind generators, chickens and an occasional tori arch. Trapped behind the glass, Jurgen inhaled the heady mix of body odors, cooked meals and toilet chemicals that had gradually blended into one composite aroma as the stale air recycled within the sealed passenger compartment. He tried to sleep, but just as often was awoken by the movement of the train. It left him feeling even more tired than if he had stayed awake. The densely packed Shinkansen arrived in Tokyo three hours later. Hello Tokyo! Jurgen thought as he unfolded his crumpled, tired frame from the bullet train and stepped onto the platform. Everything around the station seemed too small, too compact. He tried to remember the vague instructions that Nashi had provided but they were clouded in a haze, so he studied the guide posted on the wall; hoping that the names located within the intricate network of overlapping coloured pathways might be able jog his memory. All that he was able to discover was that there is nothing more complex than a Tokyo subway map. He bought an umbrella from a kiosk then headed off on foot into the heart of Tokyo. The cyclone Kuzira, spiraling like a galaxy not too far away, tossed down heavy monsoon rain that pounded hard around him while he wandered in the direction he thought that he should go. Everywhere he looked, the environment had been fabricat‐ ed by civilization, materialized for human consumption; the city seemed more like virtual reality than anything he could imagine. Every construct was labeled in trade‐ marks and identity, creating a textural pattern that was relentless on the street. Products were everywhere, everywhere bright colours, faces everywhere, glancing, glimpses of desire, or oblivious to everything, oblivious to the sea of humanity,


beneath umbrellas, moving in waves of purposeful determination, seemingly. The sea was everywhere... he felt like he were drowning. Through noodle house steam, past a pair of cardboard sumo wrestlers, Jurgen made his way down into an underground shopping complex to get out of the rain. A flood of people flowing down the steps like a river. Baby carriage. A woman with round glasses wearing a black coat. Young punk in a dragon t-shirt, silver spoon shades, tattoos up to his elbows. Large metallic eyes like an alien head, a pig withdangerous teeth. Underground, Plato’s cave, his uneasy feeling of claustrophobia was intensify‐ ing. The voices invaded his consciousness, hovering just above the level of perception, emerging from hidden speakers giving instructions that he could not understand. Little girls in sailor uniforms, cicadas singing in cages, noisy pachinko arcades, fish markets and electronics stores selling virtual reality contact lenses, digital accessories, extension of the body, communication... a woman reading a book. All this suddenly did not seem real. He felt faint; a sensation of vertigo. He needed to get something to eat. The residual alcohol from the night before was still pumping through his blood‐ stream, his skin green, as pale as a ghost under the harsh fluorescent light reflecting off the shiny display surfaces. Jurgen's runners and jeans were soaked, his hair was lank and damp, but his nylon waterproof jacket had kept his t-shirt dry. He glided like an apparition along the stainless-steel counter of the robot sushi bar, ordered a dozen rolls and a coffee. Then he waited. Reclining in the adjustable padded seat with his arm hanging over the backrest, he watched the shoppers adapting to the computerengineered environment, exploring its unlimited potential: The shoppers seemed like intelligent automata; constantly in motion, self-replicat‐ ing and responsive to their programming. Television had taught them that the world is flat; a two-dimensional representation on their mobile video screen. Addicted to stimulation, to input, and to the next purchased product. Mind-wrenching graphic design and the remote manipulation streaming directly through their sensors were scrambling computer codes. Information, control, feedback, communication, glazed, baked, pinched, slotted, reduced, enhanced. The zombie voodoo of floor-to-ceiling wall-length billboards that constantly transformed; reconfiguring into new images every few seconds, conveying new messages, virtually endless choice, extreme closeups of eternally-youthful and happy faces in a virtual world. The fashionable pose, the manifestation of forms that desire can assume; the sweet smiles of young girls, white stockings, pupils glowing, and a rack full of pink dresses. Then cute cartoon characters danced erratically, a wacky world, singing in high-pitched voices, advertising gum that never loses its flavour, or digital clothing; ‘Press a button, they change colour - you’ll ever only need one set!’ Aesthetic hedonism; everything is beautiful. The concept of ugliness has been destroyed. Definitely. A floating world with cultural turmoil and personal angst lurking just below the surface. Technology for fun and profit, or to make the world a better place?


The sushi arrived on a neat little tray delivered by a conveyor belt. Jurgen swal‐ lowed a handful of the pills that have recently become a mainstay; dietary supple‐ ments, energy enhancers, mood moderating chemicals, washing them down with coffee. All the geeks at GenSynth were eating them. They were manufactured right there in the lab. His hand shook as the initial rush kicked in, spilling coffee onto the slick steel of the counter surface. A non-existent explosion, the crises of illusion, the mouth caresses the spoon. Cream. Whipped cream. Kick the habit. Waiting... Still a few hours before the signing at the bookstore... but Jurgen realized that he still needed to find it. He pushed the tray aside and once again set himself in motion. Not even the sound of muzak drifting through the hall of mirrors could camouflage the thousands of footsteps. They echoed sharply off walls and floors that were paved with jet black tiles, and the sound of his own footsteps joined them. He was thinking that while he had been locked away, diligently doing his part to keep the machinery in the factory running, he had remained unaware of the world that the factory had produced. Now another underground tunnel; through the Shinjuku, swirling across interlocking tile patterns that stretch off into infinity. The mural of a giant, stylized eye is watching the scene, peering through the slot formed by the space between the floor and the ceiling. The bright movement of tiny lights flow through the elaborate circuitry of its metal iris. Its pupil is a camera staring passively; its gaze is hypnotic, unwavering, burning with a dull red glow. The eye is eternally watching a cardboard world that has evolved under thin glowing tubes of fluorescent light. It is a massive chaotic arrangement of boxes contrasting the formal, rigid, modern design of the tunnel passageway. A city within a city. Homeless, they have constructed ragged shelters for themselves from the discarded packaging of high tech electronic products, lashing the structures together with knotted sections of rope. Serial numbers and printed corporate logos are their only decoration. Smaller boxes and plastic bags filled with possessions are stored on the roofs of structures which could comfortably accommodate only one or two people. The smell of human suffering and excrement permeates the air, making it difficult to breathe. Ordinary citizens walk by without a glance, covering their mouths with handkerchiefs or breathing filters as they emerge from the subway stations on their way home from work. This scene does not exist to them. Jurgen moved out of the traffic flow. Guided by an inner, instinctual force, he was compelled to stray from the designated walkway and venture between the narrow corridors, stumbling like a giant through the scaled down streets of a makeshift city. As if in a dream, he was searching for something, sensing that some fragment of informa‐ tion would soon be revealed. Suddenly, at the last moment, Jurgen just managed to avoid tripping over an old man laying with his head and shoulders protruding from a crumpled Sony Playstation box.


The old man had motioned for Jurgen to come closer. His eyes were cool, but glowing with the dull embers of malice. Jurgen crouched down. The acrid smell of urine stung his eyes, rising from a puddle that was staining the side of his ‘house’, soaking into the cardboard. A barely audible, harsh, throaty whisper. What was he saying? Jurgen leaned closer. The toothless mouth foamed, the word spit out like phlegm; “Parasites!”

X. KROPTON ERNST

Jurgen rode the subway from Shinjuku to the Shimbashi business district, emerging not far from Ginza. He had managed to shed his fear and loathing like a second skin in the underground, along with most of his paranoia; the instinctive fear, genetically inherited from ancestors who were vulnerable to predators. He was thinking about the old man in the cardboard village, and the word that he spoken; ‘parasites'. Even now, riding the escalator up to street level, Jurgen was still wondering what he had meant; had it been an epithet directed at Jurgen or a plaintive, desperate description of the old man himself? Jurgen preferred to believe that it had been delivered as some kind of sign; confirming the validity of his observations within the shopping mall. It seemed to help relax him; to calm him down - the certainty of knowing that what he was experiencing was actually real, and not some awesome, horrific dream. Either that, he thought, or perhaps it was purely that the medication he had taken in the sushi bar was effective in soothing his jangled nerves. Whatever, nevermind ... He was back out in the neon twilight of the rainfall, in the early afternoon, gliding through the Ginza shopping district, congested with a thousand shops and clubs. Neon dragon, digital billboard of a geisha eating a cherry. The madness still continued like a carnival sideshow but he tried to ignore the monsters; Pandemonium, Happy House Plus, Khaos, Sea-Dog, 404, Paradise Lost. A small ice-skating rink had been installed inside a store with giant snowflakes drifting down. In another, a large bronze Buddha was selling the printed lids from international product jars. Rice dumplings wrapped in Lotus leaves, ginseng in brandy, swallows nest soup - every few seconds the aromas shift and change; the smell of seaweed transforming into a perfume factory explosion. Strolling briskly, his attention on the shop windows and the scenes behind the glass, Jurgen suddenly collided heavily with someone on the street; a woman wearing digital clothing. She had words tattooed on her face. Jurgen helped her to regain her feet, but her clothing was going crazy. She tried to stop the wild colour shifts by fingering her buttons, eventually managing to regain control before angrily storming off.


Jurgen brushed some of the mud off his jeans, and when he looked around, found himself standing in front of a Tokyo cowboy bar called ‘Way Out West’. Nearby, a group of young girls had gathered around an advertisement at street level near the door. “Why do they call it ‘The Stallion’?” he overheard one girl innocently asking her friends. They all giggled excitedly. One of the others leaned close to whisper in the curious girl's ear. The revelation caused her eyes to become the size of saucers; “Oh, I see!” she said. A moment later they all tried to squeeze through the narrow doorway at the same time. Once they had vanished, Jurgen approached the advertisement, and to his own surprise, learned that ‘The Stallion’ was a machine similar to a mechanical bull, except that to ride it, the woman was strapped on underneath. He was tempted to enter the bar to join the audience of the show, but catching a glimpse of the clock on Moonshine Music, he realized that his father's reading had already commenced. A block away, on Harumi-dori, Jurgen entered the Kondo Bookstore. Quite a crowd had gathered at the back of the main level, to surround a figure standing near a table displaying an arrangement of books. Behind the table stood an exceptionally tall man with graying hair, metal framed spectacles, and wearing an inexpensive brown suit. He could have been any stranger if they had happened to meet by chance on the street but as Jurgen watched from the back of the crowd he observed certain physical characteristics and mannerisms that were similar to his own; genetically inherited from a father that he had not seen for what seemed his entire lifetime. It was like traveling into the future to meet a version of himself. Kropton was skillfully fielding the questions fired at him by the throng; responding with answers that were both humorous and glib: “The only reason that I write is so that people have something to do on the bus.”... “As their author, I try to provide my characters with a full, rich life, although it is fortunate that it’s not against the law for the writer, when necessary, to kill them off.” ... “If I wanted to make money, I would have written romance.” ... and so on... concluding, of course, with the obligatory plug for his website. The moment that Kropton sat down on a folding chair, the crowded rabble immedi‐ ately surrounding him transformed into an orderly line on the opposite side of the table. Jurgen took his place among the rest of the fans; each person approaching the author to exchange small talk and pleasantries, and Kropton likely hoped, to have him sign a recently purchased book. Jurgen was somewhat surprised that Kropton’s novels were so popular, and that he had such a loyal following. As Jurgen waited, he became more nervous, anticipating several possibilities of what his father’s reaction could be. The line slowly inched along until he finally arrived at the table. Kropton looked up at him after signing yet another book, then blinked his eyes as if scanning his memory banks... “Hello Dad, how are you?”


With that, Kropton quickly stood up, almost knocking over a pyramid of books that were displayed at the end of the table, “What the hell... are you doing here?” The two immediately spanned the gap that separated them, clasping hands, and attempted to give each other a hug. Murmurs whispered throughout the crowd. “Forgive these tears,” Kropton said a moment later, wiping his eyes. Jurgen also started crying after witnessing his father’s joy. They were now standing facing each other, eye to eye, and grinning from ear to ear. Kropton explained that he had to stay for awhile to fulfill his obligation but they quickly arranged to meet at Kropton’s room in the Ginza Metroluxe Hotel; its address was somewhere around 6-chome - right along the strip. Just over an hour later, Jurgen approached the front desk of the hotel, bearing two large bottles of sake in a canvas bag. The lobby was being remodeled to replace its current ‘industrial design’ look; Schroder stairs in checkerplate and halogens clamped onto sleek black pipes, were being converted into light blue plastic ‘bubblepak’ walls and enormous inflatable palms. The elevator was out of service, so Jurgen took the stairs as instructed by the clerk, up to room #103. Kropton had apparently arrived only moments before; since Jurgen had caught him in the act of busily tidying up the place. Jurgen was amazed, Kropton had just stayed in the room only one previous night, but it was already a total shambles. “It’s not a superior hotel, but I’m trying to maintain its representation as a ‘well groomed and affordable room’. Amenities included a mini-bar and American TV!” Contrary to the impression created by the lobby, the hotel room looked exactly the same as any other that Jurgen had ever been in. Two beds filled the room, a lamp on an end-table in the gap between them, and over by the window were a couple of chairs and a small table. Everything was coloured a shade of beige; a kind of interna‐ tional neutral territory. Jurgen sunk deep into the striped pastel upholstery of one of the comfortable chairs, then turned his head to study the view. The rain was still coming down heavily outside, reflecting the bright colours of large advertising displays along the Ginza that were captured like rainbows streaming down the glass. Pulled along by gravity, the rain drops gave the hotel window the appearance of a stained glass painting in neon light. He glanced over at Kropton who had just joined him, now sitting across the table in the other chair. It seemed strange to be sitting in a hotel room in Tokyo with his father; this entire day just did not seem real. Kropton opened the sake and poured them each a big bathroom-sized glass; using the discarded paper wrappers as coasters. Then he started fumbling with a small gadget, concentrating intently on it with the tired eyes of a writer, as he attempted to change the slim optical disc. Jurgen had agreed to his request that their conversation


be recorded using this tiny dictation unit, since Kropton had just bought it and wanted to test it out. He mentioned that it was practically the only digital appliance he owned, claiming that he was old-fashioned and still preferred analog; writing his stories on the same old Royal typewriter that he had always used, back at his house in Little Falls, Minnesota ~ a place that he called home. They had a lot to catch up on... It was Jurgen who started things off by telling his story; from Germany to the Czech Republic, on to Hawaii then finally Japan. Jurgen told Kropton about some of the information he had discovered while researching the lives of the Starks. Kropton seemed impressed that his son had gone to the effort of also attempting to revive their old computer. “Jurgen, you are so much like your grandparents; very talented and very smart. I’m certain that they would be as proud of you as I am; for your determination and the success you have achieved in your career. It is from them...and your mother, that you have inherited your genes... and I only say this because I love you dearly, that I hope you haven’t inherited many of mine.” Kropton began his story by saying, “Let me begin at the beginning: I was a newborn baby when my parents were killed. I was an orphan, adopted, and then raised without knowing anything about my biological parents. It was not until my teenage years that I even realized I had been adopted. It was a shocking revelation, accompanied by an intuitive fear that something dark and sinister had caused my real parents to disappear. I had quickly generated this impression since my foster parents seemed extremely uneasy whenever I tried to discuss this topic. I had the sense that it was a secret they had sworn never to reveal. Of course this only served to peak my interest, which naturally encouraged me to relentlessly attempt to extract the truth from them.” Kropton discovered that he had been born on the evening of October 31, 1959, in a quonset hut on an isolated US military research station located in a northern region of Iceland. He had been named Heinrich Stark. There had been complications with the pregnancy leading up to the birth, so Cameron had radioed a request for a doctor to fly in from Reykjavik. Because of the severity of a winter blizzard and the remote location, the doctor was unable to arrive for several days. Without any other choice, they relied on one of the mechanics who had some medical training, and who, during the delivery, used some type of forceps to get a firm grip on Kropton’s head and pry him out; “Like a cork from a bottle.” Consequently, Kropton’s face was partially paralyzed; a condition which gradually disappeared during the first year after his introduction to the world. Regardless of his initial appearance, his parents were excited about their new baby and were hoping to take their little bundle of joy to see Adda’s parents, who at the time were living in Hong Kong. Several months before, Cameron had already forwarded a request to this effect, directing it to his military superiors back in the USA. The memo had requested


permission for the young family to travel to Asia during the following spring, at the conclusion of the term of their current research project. Cameron didn’t receive a reply to his request until a few days after Kropton’s birth, but rather than receiving permis‐ sion to travel to Hong Kong in the spring as he expected, he was surprised by an order demanding that he and Adda return immediately to the United States or face an immediate termination of the project. Cameron protested strongly but was reminded by his superiors that in the military, an order is an order. The storm let up about one week after the birth and an airplane finally arrived. There was no doctor on the flight, just the pilot who would transport the young family to Reykjavik. Because of Kropton’s need for medical attention they decided to leave him in the care of the hospital. Then Cameron and Adda said good-bye to their son, catching a flight on a military transport out of Keflavik airfield, expecting to return to Iceland within a week. “That was all that I was able to learn from my foster parents. Where Cameron and Adda had gone was still a mystery, but now, at least, I knew my real parents’ names. At that point, I began to imagine numerous possible reasons why they had abandoned me, which continued to cause me considerable emotional distress throughout my entire middle-teenage years. “My foster parents; Hazel and Rulf Fjordenborgen were unable to console me during this extended grieving period. Their only suggestion was that I do what they did whenever they had a problem; which was go to church and pray to God. The Fjorden‐ borgens were poor sheep ranchers who owned a patch of land just south of Hella. They were an elderly couple who had never had children of their own, and were also devout Lutherans who ensured that I attended church every Sunday during my formative years. “Although they were almost illiterate, they did have an encyclopedic knowledge of Icelandic folklore committed to memory. This created an awareness for me that Christianity and Norse mythology consisted of essentially identical stories. In fact, Hazel firmly believed that the Vikings had written the bible,” Kropton chuckled. “They were also able to introduce me to the rich variety of cultural experiences which formed the basis of my customs and lifestyle, because, and this might seem odd, even though I had grown up in Iceland, to me it had always seemed like a foreign country.” “I attended school, and in my free time, donned a wet suit to surf the North Atlantic, or at other times wander through the mountains and glaciers. Upon graduating from high school, I worked at odd jobs, eventually joining a small movie production company where I developed skills as a camera operator. Eventually I was in demand for work on a number of documentary films and commercials. In search of further opportunity, I decided to travel to America, winding up at a studio in Cleveland where I began shooting low-budget science fiction films; horrible movies, with incredibly awful titles, that featured big-breasted women and giant insects. Soon I began to discover that I had an aptitude for writing the type of film scripts that producers loved and as a


result was paid much better than the meager wages I earned as a cameraman. These stories followed typical B-movie themes, but I always tried to inject innovative twists to the plot. I slept during the daylight and I stayed up every night, working in my small apartment. At one point I decided to send off a few of my short stories to publishers, and to my surprise some of these manuscripts were published. And as you know, my books continue to be based on weird science fiction themes, right up to the present day. Although, I’d like to think that they have gotten better ... more sophisticated,” Kropton added with a wink. “After some time in the States, I began to long for Iceland; the people more than the landscape. I ended up moving to Minneapolis, Minnesota, where I was able to find a small community among other émigrés. Although she wasn’t Icelandic, that is where I met your mother; a vivacious German girl named Ingrit Schutzdorfoberasch, who was studying journalism at the university. At the time I had been searching for someone to help me edit my first full-length novel, ‘Uncertainty of the Day’, and was eventually placed in contact with her by a mutual friend. She was a very talented editor, and although she was not interested in my fiction, she managed to transform my humble ramblings into a work of literature. During the process we often spent time together. Soon those hours turned into days, then weeks and months. It took awhile but I managed to convince her to come and live with me; I had a small house then - I was just living by myself. We never got married - I’m not the religious type, but we were always in love...” Kropton’s voice drifted off. After a long pause, Kropton declared, “I still miss her. I will never love anyone else.” He poured them both another sake, then continued. “As you know, Ingrit is a determined woman once she gets a thought stuck in her mind... and well, she persuaded me to return with her to Germany a few days after she completed her studies. We just packed up and moved to Bavaria, which I did against my better judgment; we were young and in love, and that was all that seemed to matter. At first we lived on a floating home on Lake Constance; a peaceful lake bordering on Switzerland, situated within a landscape that is beautiful and silent. It snowed heavily during the winter time, but we had a little woodstove and our love to keep us warm... and that, my son, was the place where you were born. It was really a very happy time in our lives.” Kropton then pulled out a brown, imitation alligator skin wallet. “I have something to show you.” He opened it, revealing an interior that consisted of a collection of thin crumbling amber acetate leaves. From among them, he withdrew a small photo; a faded and wrinkled off-colour image of Jurgen with his father and mother. They were grouped together on a driftwood log, positioned before the scenery of a large lake with distant mountains covered in pines. Jurgen was about three or four years old. “I would like you to have this. It is the only piece of the past that I can return to you. I already have this photograph permanently recorded in my memory; up here, where I can look at it any time I want.”


Jurgen smiled as he received the photograph. As he put it in his pocket Jurgen thought about his mother and momentarily considered giving her a call; ‘Hey mom, guess where I am?’ Here was his father sitting across the table from him, and once again the impression that he was studying a future version of himself in the mirror; he was glad that he was here. Although the evening had started off slowly, as if they were strangers, as the night had progressed and the sake vanished, they quickly became reacquainted. It had been a welcome discovery that, after all these years, they were both thoroughly enjoying each other’s company. Rather than linger on this moment, Jurgen was pleased when Kropton returned to the recollections of his past: “The reason that you were named Jurgen Ernst, rather than Jurgen FjordenborgenSchutzdorfoberasch, was that shortly after we had arrived in Germany, I decided to change my name. At that time I was still officially Heinrich Fjordenborgen, aka Hank Borg; a name I had also used earlier in my film and writing career. I simply made up a new identity, an alias, as a way to reinvent myself, and as a way to blend in with Germany literary circles in a country where I imagined I would be living for a great many years. I thought of the name Kropton one day and kept it because I just liked the sound of it. But I plagiarized the surname of Max Ernst; a German painter and poet whose work I admired because of their fantastic and sometimes disturbing imagery. His collages and paintings often conjure up strange atmospheric settings, full of fear and apprehension, and I believed at the time that my writing style was analogous to his work.” Kropton explained that during this time he had still clung desperately to his dream of pursuing his fledgling writing career. But while his dream included being rewarded with wealth and fame, the decision to continue his writing career based in Germany cast him into poverty and obscurity instead. He was not accepted in the new country and the publishers back in the USA, where he had already established himself, now began to consider him to be a ‘foreign author’ and had quickly lost interest in his work. “It was a difficult time for both your mother and myself. We loved each other and we both loved you, but I have to admit that I just wasn’t financially responsible. I was devoted to writing and I continued to relentlessly pursue that dream until it ended up becoming an obsession. And as my imaginary goal meandered off into the distance, I followed it, dogging its trail wherever it went. Ultimately, and foolishly I was always willing to pay the high price it exacted, as it took its toll on our family, then later on my health, and eventually, nearly caused me to release my claim on conventional reality. We separated then; your mother took you, the majority of our life savings and my name, before moving to Eigenvalue, while I remained in a small apartment in Ravens‐ burg, attempting to fend for myself. I was alone then, afraid and ashamed, and filled with remorse and despair. I began drinking heavily to forget but the memories refused to be erased.” At this point there was an interval of silence as each became lost in thoughts of their own. For Kropton those distant memories still seemed painful to discuss. His expres‐ sion revealed deep feelings of guilt and anguish that had lingered throughout his life and had now once again risen to the surface; particularly when he recalled the


circumstances that had separated him from his wife and his only son. Jurgen also felt sadness and a sense of loss, but for reasons that drifted up from his own memories of the past; the reference to Max Ernst had reminded him of Marcel, Angelique, and the painting of the hanged man. He could sympathize with Kropton’s sorrow about friends and loved ones in a person’s life that suddenly disappear. The silence had not been uncomfortable, although it quickly vanished when Kropton turned on the television. He fumbled with the remote control for awhile; until he was finally able to master the tiny buttons well enough to order a late supper and two more bottles of sake from the room service menu. The sake had been Jurgen’s suggestion. It was a drink he had grown fond of during the past year, because it wasn’t sweet, like most alcohol seemed to be, and when served warm, it provided a pleasant comfortable sensation. Once the order had been placed, Kropton turned off the television, then quietly continued with his story: “So... once I hit bottom, I began to realize that instead of trying to forget my past, I decided I would accept it. This was a turning point which suddenly gave me the freedom to move ahead, and utilize the resources that were available to me. I man‐ aged to get plane fare to return to USA and found a place to stay in Minneapolis through the kindness of some friends. This was in 1988, twenty years ago, when I was twenty-nine. I started to reconstruct my life then, vicariously, through the character that I had authored for myself; Kropton Ernst. I determined that this character, my alter ego, would become what I had wanted to be; the author of intelligent, popular stories. Soon, Kropton began writing, and I became his vehicle; a medium channeling new stories, which seemed to magically appear from the aether. As his agent, I began to send these stories to publishers, and in return began to receive enthusiastic approval. The more successful Kropton became, the more the writing improved. His stories were beginning to sell, bringing him the financial rewards that I had always dreamed of. The success precipitated a return of my own self-confidence, and when it did, I had the audacity to assume the role of my own nom de plume and to ultimately, finally leave my old self behind.” Kropton had discovered that the readers of his stories were interested in certain topics that proved to sell quite well, particularly when he was able to provide his readers with an understanding of the character’s perceptions; of what they thought about, and why. He was aware that his audience was fascinated with concepts about memory and reality shifts, notions such as; What can be considered to be real when everything is simulated? As a result, his stories often dealt with ‘digital reality’ and the reasons why it was manufactured by media, corporations, and religious groups. Kropton explained that the intention of his novels was not to instill paranoia, since his readers, to some extent, were already more paranoid than any level his stories could summon. He immediately qualified that statement by mentioning that perhaps ‘paranoia’ was too extreme a term; "Perhaps it should be called skepticism, empiricism, or an inquiring mind," which Kropton believed were the essential qualities that made us human. “It is that quality within a conscious, sentient being, that permits


us to be unwilling to accept, on faith alone, the belief in everything we’re told.” Another related theme recurring throughout his books was that; “When individuals relinquish the power to make decisions governing their own lives, then any complaints of the consequences are in vain.” He mentioned that the central characters in his novels always illustrated the necessity of taking responsibility for their actions. The relationship between author and reader, Kropton maintained, was a covenant which required mutual trust: He always directed his writing toward an audience which he considered to be enlightened; since without the reader’s ability to supply their own knowledge of the truth, his fiction would be meaningless, and in return, whatever dark passages he led his readers through, the reputation that he established before embarking upon the journey, enabled his readers to trust him as their guide. This reputation was built on a foundation of solid research into the subjects that he ex‐ plored. He did not rely on speculation and he was not afraid to awaken sleeping ghosts as he navigated the course of the story to its successful resolution. Kropton always had, from an early age, retained a healthy skepticism for the ‘official’ explanation, since it was sometimes intended to disguise the truth rather than actually reveal it. He explained that; “... crumpled propaganda often encloses an inner transparent clarity, similar to the way a sanitary paper wrapper surrounds a hotel drinking glass.” Jurgen appreciated the way that Kropton had just happened to observe an item on the table in front of him and then incorporate it as a convenient metaphor. Jurgen laughed and poured them each another glass, draining the bottle. As if on cue, that moment, the room-service meals suddenly arrived, along with sake re-enforcements, including the proper paraphernalia to keep the bottle warm; a stainless steel pot of water on a little hot plate device and some elegant porcelain cups. Kropton filled Jurgen’s cup then poured himself a shot. While they devoured Swordfish steak served with prawns and carrots, questions and answers occurred between mouthfuls: Were the Fjordenborgens still living in Iceland? “No, years ago they apparently disappeared into a volcanic erosion pit while hiking into the interior.” What about the place that Kropton was born; where the Starks conducted their experiments? “I own it. The site was decommissioned in the late 1960’s after being used by NASA to train astronauts for the Apollo space program; the terrain simulates a lunar environment...this fish is really tender... Out of nostalgia, I decided to purchase the land with the proceeds from one of my early novels... hmmm, I can’t remember which one, perhaps it was ‘Paper Nautilus’... could you pass the hot sauce... I understand that the buildings are still standing, but I imagine that they are in very poor condition. It had always been my hope to return one day but I still haven’t made it back there.” While they finished their midnight lunch, Jurgen was thinking about Iceland and fantasizing about traveling to the site. He could fix the place up, perhaps even spend a summer; it sounded like an exciting adventure!


Although it was late, both were still interested in continuing their conversation. Jurgen now inquired why Kropton had decided not to publish ‘Invisible Waves’, and wondered if it was an accurate portrayal of the lives of Cameron and Adda Stark. He also wanted to learn more about the Stark’s research in Iceland. All these questions prompted Kropton to continue... “After I returned to the states, I began considering publishing a story based on the lives of the Starks. At that point, more than ever, I wanted to discover information about their past and writing a story seemed to be a convenient way to justify that pursuit. Pursuing leads like Sherlock Holmes, I began my research by going directly to the source. But, naturally the military authorities were reluctant to reveal anything to ‘the public’; even though I was the Stark’s ‘next of kin’. It was inconsequential; my name had changed so many times that instead I decided to take advantage of my anony‐ mous identity. The only information that the military officials were able to release were simply general stats about who they were; name, rank and serial number... and of course, they were also unable to provide a satisfactory explanation to account for their disappearance, which, as I recall went something like this: The Starks had attempted to defect to China onboard a small DC3 propeller plane. It was apparently piloted by another communist agent who had earlier been successful in commandeering the craft. After a secretly arranged rendezvous with their co-conspirator, the Stark’s plane took flight only to subsequently experience engine trouble then crash into the Formosa Strait. This was on November 11th, 1959; four days after the Starks had departed from Iceland. The wreckage of the plane has never been found.” “Back in 1988, well before the internet became prevalent, I was young and brash, and became a ‘hacker’ of reality; infiltrating physical space. Over time I gradually smuggled out most of the Stark’s original lab journals and some of the other docu‐ ments that I discovered in a cardboard box within the archives of the Charles Babbage Institute at the University of Minnesota. It did ease my conscience considerably, to later learn, that these documents themselves had been previously stolen. An explanation will soon become evident...” The lab journals primarily consisted of a series of brief observations recorded in point form, written by hand in a tattered ruled notebook. By carefully examining the cryptic entries I was finally able to piece together an idea of what the Starks had been working toward during their time in Iceland. Essentially, they were attempting to verify predictions made by Albert Einstein in 1916, that gravity is not actually a force, rather, a ‘field’ which is capable of distorting space and time. These three properties are inextricably linked, so that by changing an object's space-time energy pattern to one which is substantially different from the normal pattern, the resulting gravitational forces acting on the object will also change; making it possible, for example, to create a force which counters gravity!” “As you know, the ‘engine’ of their device operated on the principle that electrons are able to become self-sustaining vortexes, by modifying the spin on their axis through sonic resonance. The Starks used crystal filters to generate energy frequen‐


cies which synchronized the motion of the rotating gravitators, orbiting the atom’s nucleus, with the harmonics of the aetheric flow. As a result, a rotating standing wave was formed which nullified the device’s weight to create antigravity. In other words, when the forces within the energy field became balanced, a floating- point was achieved which enabled the device to levitate.” “Rather than a solid object that rotated, it was actually the individual electrons within the object that were rotating at a very high speed, while the object itself appeared to remain static. The Starks soon discovered that the coriolis forces produced by this ‘rotational standing wave’; in which all the electrons within the device were spinning in unity, took on characteristics which were similar to a very much larger, revolving, solid mass, although it remained essentially invisible energy. Interestingly, as this ‘virtual mass’ appeared to increase in size, its weight decreased, rather than increase proportionately.... Mass is the physical content; the number of electrons, protons, etc. and remains relatively constant, while weight is caused by the attraction of one mass to another, and is variable,” Kropton added. Jurgen understood what he was saying and nodded his head. Kropton continued: “The Starks were also aware that in 1918, two years after Einstein formulated general relativity, scientists Lense and Thirring concluded that, according to the theory, a rotating massive body should begin to drag space and time around with it. Which is exactly what the Starks would discover, in 1959! As such, there are several entries within their journals which explicitly make reference to a ‘time machine’. Apparently, they had discovered during their tests that, when the aligned electrons spinning within the nuclear core of their device reached a certain speed or frequency, it effected a distortion which enabled the device to ‘travel’ backward in time; not to the Cenozoic Era or even to the ‘Dirty 30’s’, but merely just a few microseconds. In other words, once the speed of the electrons reached a critical point, it triggered a jump back to a previous state in time, in which the now slower speed once more increased to the point which caused it to jump back once again. This process formed a loop, which if sustained, would keep the device perpetually frozen in time.” Jurgen perhaps appeared skeptical, so Kropton explained... “I know what you are thinking; your investigation into their work in Nevada revealed that they were attempting to build what Cameron often referred to as the ‘Ultrasonic Invisible Weapon’, and which Adda poetically described as having the appearance of a, ‘fragile, eerie, elusive glow in the night, suspended like a paper lantern over the desert’. True. And I have it on authority that they had achieved success in designing a ‘weapon’; the official purpose of their research. But at the time they had also become increasingly fascinated with the possibility of designing a time machine. It was a secret that Cameron and Adda confided to no one; no one that is, except to their journal.” “This brings me to another interesting lead which had arisen from nabbing the papers. The ‘authority’, that I mentioned, was the person who had actually donated the


documents to the institute. The man’s name was Jude Randson, a trusted technician who had worked with the Starks for many years - thrice betrayed, who then confessed on his deathbed. I tracked him to Phoenix, Arizona, then drove down in a rented car all the way from Minnesota. By the time I discovered him, he was in the hospital suffering the terminal stages of cancer which was caused by exposure to hundreds of atomic explosions that had irradiated the Nevada test site while he had been working with the Starks. Fortunately I recorded the interviews on a number of ‘cassette’ tapes which subsequently formed the research for the story ‘Invisible Waves’. “At the time of our meeting, Jude had recognized that he was dying and wanted to clear his conscience. He confessed that he had betrayed the Starks, and felt remorse, because the loyal team of engineers and technicians had gradually become, as he put it; ‘their disciples’. All the members of the crew had been dedicated to the project and all had the greatest admiration for Starks’ leadership and scientific abilities. He explained that this group; consisting of six members including the Starks, had become almost like a ‘family’ within the remote outpost in Iceland. Jude was practically my godfather, since he was one of those that were present the night I was born.” Kropton downed a glass of sake then sadly stated, “I later learned that Jude had died a few days after our conversation.” “To be fair, it’s necessary to bear in mind that during the late 1950’s, Cold War hysteria was very much in vogue. McCarthyism, Sputnik, The Great Leap Forward and Anna Louise Strong - the spooks were everywhere; operatives and agents carrying out espionage, infiltrating governments, military and research facilities, crawling through‐ out wires, scanning the fields, stealing secrets and carrying out covert operations and sabotage all around the world. The ideological differences at the time were perceived as a heavyweight title bout: Christian democratic liberty vs. Communism’s atheist totalitarian slavery. Fear and propaganda were driving a race to expand nuclear arsenals and Armageddon loomed on the horizon. Fundamentalists, Protestants, snake handlers, John Birchers, and the KKK all along the bible belt were bunkered down for the ultimate battle between good and evil; an end game which they sincerely believed would bring down a new heaven upon the Earth. And within this environment of suspicion and fear, was Jude Randson; a twenty year old American patriotic from Oklahoma who just happened to be working with a couple of foreigners on a Top Secret advanced strategic weapons project.” “The G-men worked on him from Nevada all the way to Iceland; generating conspir‐ acy theories to discredit the Starks, convincing Jude that they were a threat to national security. He told me that he eventually became aware that the Starks would soon be made to ‘disappear’. The plan was to undertake a covert action with a high degree of ‘deniability’ built in. Once the Starks had boarded the plane departing from Reykjavik, Jude had been instructed to gather up all of the Stark’s research documents, pho‐ tographs and journals, and to personally deliver them to military headquarters. For some still unexplained reason, Jude retained some of the material - which later ended up in the archives where I found them.”


Jurgen was captivated by Kropton’s cloak and dagger narrative, and was also impressed that he seemed to have committed the contents of Stark’s notebooks to memory, but he still wanted to find out about Iceland. He prompted Kropton to reveal the reasons that the Starks had traveled there and asked him to describe the nature of their experiments. “Jude said, that in Nevada, the team lead by the Starks were achieving results with their experiments, which he described as being ‘ahead of their time’. They had finally managed to build a successful prototype; which unfortunately for their highly classified project had inadvertently received unwanted public attention in the media. Witnesses had not only reported seeing ‘unidentified flying objects’ in the night sky, but someone had also taken snapshots which ultimately made their way onto the front page of a number of newspapers. Area 51, and the entire Nevada test site for that matter, had become ‘hot’ by 1958-59. It had long been a popular tourist destination for ‘blast watchers’, but even after the general public reaction to nuclear testing had began to turn negative the region continued to remain under constant public scrutiny.” “With the success of the early prototype tests, the interest of the military brass had intensified, particularly since the newest wave in computer technology was arriving; integrated solid state circuitry. The administration was made aware that the induced voltages caused by the electromagnetic weapon would be much more effective against the newer transistorized technology than it had been against the substantially more resilient, but suddenly outdated, vacuum tube machines. As a result, it was imperative to continue with the project, as well as seek out a more discreet location.” “Iceland had been Cameron’s idea. He persuaded military authorities that the remote location was necessary in order to reduce the effect of ambient electrical and magnetic interference on the device, and, for some reason, made mention of the country’s proximity to the North Pole. It is much more likely however that Cameron had made the request based on the hope that it would return him to a Nordic landscape similar to the one he had experience in his youth. Whatever the motive, the recommen‐ dation met with military approval since they already had established radar stations in that country as part of the Distant Early Warning defense line and were able to mobilize resources within the territory.” “The research station became the headquarters of the project known as ‘Flaming Sword’. It consisted of a number of standard military-type buildings that had been airlifted to the site. At its center was a large quonset hut; its semi-cylindrical, corrugated steel shell had once been used as an aircraft maintenance shed, before being taken apart and flown across the Icelandic tundra where it was reassembled. The quonset housed the laboratory, workshop and computers. As well, it provided quarters for Cameron and Adda, who lived in rooms built on a platform at the back. Orbiting the quonset were several other smaller buildings; two bunkhouses which housed the four other crew members, a small mess hall, and a storage shed containing parts and supplies. Also nearby was a short length of paved runway.”


Kropton mentioned that a stylized representation of that concept appeared in the design of the Icelandic Defense Force crest which the Starks wore on their official uniforms. The new code name for the device became ‘ANGEL’; an acronym for ‘Advanced Nuclear Gravatic Electromagnetic Levitation’, sometimes referenced in communication exchanges as the ‘Angel of Destruction’. Kropton thought that it was significant that the final journal entry that Adda had recorded just before they departed Iceland, was, Kropton believed, a quotation from the bible; “The flaming sword... by which the illusion of material permanence is slain.” After that, the last four pages of the book were blank. After venturing up this tributary, Kropton returned to his stream of thought: “The team arrived after the buildings had been fabricated during the fall, but at this high geographical latitude, winter had already begun to set in. Adda’s entry on the first page of a new journal described the landscape as a; ‘frozen world where lost souls go, never to return’. Her prescience would prove accurate once again, as the entire team soon found difficulty acclimatizing to the harsh northern winter and the isolation of being cut off from the rest of the world. Within this bleak terrain, the only way to occupy themselves was to immerse themselves in work. Under banks of fluorescent lights on the quonset ceiling and warmed by an oil furnace, the technicians worked late every night constructing streamline disks that were death black, non reflective, and bore no distinguishing markings. By the time spring arrived, seven discs had been fabricated, each exploring a slightly different variation in design.” “For the first time, the Starks had access to newly-developed solid-state technology, which had fully transistorized integrated circuits. The CDC 1604 at their facility was designed by Seymour Cray. Processing instructions were composed of thirty-six bit words; characters were six bit at the time, and it could perform 300K calculations per second. An external CDC 160 served as its input/output unit. As well, they had a couple of smaller IBM 1620’s; each with a core memory of 40K. These computers were much more powerful than any they had used before, which substantially reduced theoretical development time.” “Adda authored the custom code used to build numerical simulation models and to crunch the calculus equations for determining the electron’s resonant frequencies within the antigravity generator. It was a programming language which only she could understand; likely as a form of encryption to protect the confidential nature of the experimental program. The code, which she humorously called ‘Volapuk’, incorporat‐ ed elements of FORTRAN and LISP, but used new grammar and syntax rules, and eliminated the parenthesis.” “Cameron was the mechanic. Dressed in perennial coveralls, he tinkered with the ANGEL’s physical characteristics, creating an apparatus which was elegant in its assembly. He also worked closely with Jude, who specialized in guidance and navigation systems. Together they designed the control panel which housed a sophisticated waveform generator; since radio frequency was used to remotely control


the flight profile of the craft. All their test flights were conducted during the night. There were plenty of opportunities, particularly since there were only three to four hours of daylight during the winter months. They used the shadow of the planet to shield the craft from the effects of solar wind. This electromagnetic energy streaming off the sun was noticeable in the night sky at an altitude high above the test site where the radiation interacted with the Van Allen Belts to create a spectacular display; wispy translucent green, blue and orange curtains that veiled the stars, known as aurora borealis or the Northern Lights.” “Apparently the crew had actually tested its capability as a weapon on only one occasion; during a summer night in 1959. Jude had described how they rolled out a large grid of bare copper wire across an open patch of tundra, around which were positioned a number of recorders to measure the voltage, magnetic flux, and so on. Cameron, Jude, and two of the other crew members were standing nearby to witness the test, unaware that they would be affected by the intensity of the electromagnetic burst. When the device reached an altitude of about 100 meters, the tentacles unfurled and there was a brilliant flash of light as the device was detonated. A moment later, Jude found himself on the ground experiencing overwhelming nausea and vertigo, which he recalled as feeling similar as a blow to the head, but without the accompany‐ ing pain. As he lay there, he noticed a visual strobing; magnetophosphenes induced by electric currents in the retina of his eyes, and later the sensation that an electrical voltage was ‘swirling’ through his blood vessels. After they had all shakily regained their feet, they realized that the gauss meter had registered a measurement of nearly four tesla; about 40,000 times the strength of the magnetic field generated by a power transmission line.” For some time, Kropton continued to vividly recount Jude’s recollections as though they had now become his own. Jurgen listened attentively, attempting to visualize the scenes and situations in his mind; he pictured Iceland as a wonderland both danger‐ ous and beautiful, and the more Kropton had spoken, the more his words had kindled Jurgen’s desire to see it for himself. Eventually the story completed its cycle; Kropton once again reached that point in the chronological sequence of events in which the Starks were called away from the island, never to return... “Jude had frequently commented that the Stark’s experiments were ahead of their time. The problem was that the computer’s insufficient processing power, coupled with the lack of precision machinery to engineer the components to their required tolerance, continually created situations which made it difficult to realize their dreams. For Cameron, in particular, these imposed limitations became a source of immense frustration. And during those times when they got the best of him, he would leave the shelter of the quonset to prowl the glacial ice under the light of the moon; not returning until he had regained his customary calm and tranquil state.”


“Later in his life, when Jude explored the information contained in the Stark’s journals which he had kept, and after he had reflected on his past experiences of working together with them on their project, he also came to the realization that the Starks had been on the verge of harnessing properties of both gravity and time; forces which were as mysterious as they were immense. He suggested that if they had managed to continue, they would one day have opened the window for advances that would have benefited all humanity and given us all hope for the future.” “I will never forget the final words that he said to me, just before I left his hospital room. He said; “It was the content of their minds that made them dangerous; a threat, which, the authorities believed, needed to be eliminated.” Kropton got up from his chair for one of his many excursions to the bathroom; a more frequent occurrence since the empty sake bottles had begun to litter the floor. Jurgen glanced out the window; it had been some time since the rain had stopped. The sky was brightening in the east. The toilet flushed. Kropton returned to the room, smiling, and drying his hands on a towel. He was walking hunched over as Jurgen sometimes did, since they were both quite tall. “You know...,” Kropton continued, “I’m so glad that I was able to have this conversa‐ tion with you tonight. I often think about my parents but I have never been able to discuss these things with anyone before. What also, pleasantly, has returned tonight is the concept for a story that has been floating around in my head ever since I first read the Starks’ journals. As soon as I get back home from this trip, I’m going to sit down and go through the torture of squeezing that information out of my brain cells and splattering it onto paper. I must confess that it is the part of the job that I dislike the most; sitting there pecking at the keys like a lab chimp pushing buttons.” Kropton stated that the central premise of the novel was that UFO’s were not actually spaceships piloted by extraterrestrial visitors from a distant galaxy, rather, he sincerely believed, they were a transportation mechanism used by time travelers from the future of our own planet. To terrestrial observers, these craft would seem to mysteriously appear and disappear as they made the leap between the future, the past and the present. He added, that the reason they make the jump in time from a high altitude was to avoid collision with objects located on the ever-transforming surface geography of the planet. He then went on to speculate, that since time is relative, and often unfairly represented as a linear one-dimensional interpretation, perhaps all three states; past, present, and future, actually exist simultaneously. Kropton explained that people who have encountered UFOs, described these ‘aliens’ as shrunken creatures with pale green skin and enormous eyes. They were unaware that these creatures are actually descendants of the human race; a future civilization whose bodies, mannerisms and language have mutated during the passage of time ~ evolving into forms that are no longer recognizable to us. While only a very few claim to have had close encounters, many others still prefer to believe in their existence, since the notion gives them hope that there are other lifeforms ‘out


there’, in what often seems to be an infinitely empty and vastly lonely universe. Kropton said the story would examine these implications, asking the reader; ‘Does it comfort you to know that our species has survived into the distant future or are you terrified by the recognition of what humanity had become?’ Dawn. A faint glow on the distant horizon. Shadows circle overhead turning dust into gold. The sun suddenly rising over the ocean now blasts through the window glass with a brilliant orange intensity. A sea of umbrellas reflecting off a rainy sidewalk. Ping ... beep ... beep ... ping ... beep ... beep ... The vidcomm was ringing. It was a wake up call from the front desk. A pleasant Japanese woman spoke cheerfully; “Good Morning. It’s 7 am!” Kropton acknowledged her call, then pressed a button to turn off the display. “Well I got a plane to catch, I have a reading in Hong Kong tonight. I am still packed, but I am going to have a shower... and later I’ll catch some sleep on the plane. Do you want to order breakfast? I usually just have coffee in the morning...” “No, it’s okay, I’m not hungry. Oh... I almost forgot, I have some books for you to sign, for my friend Nashi. I work with him at GenSynth. He’s a huge fan.” Jurgen hauled a stack of books from his backpack and placed them on the table. Kropton seemed surprised that some of these books had been translated into Japanese. He withdrew an old-fashioned, expensive-looking pen from his crumpled jacket pocket then inscribed a brief message inside each of the paperback covers. Jurgen read one inscription: ‘Read everything, learn it all while you are young, then profit from this knowledge so that you are able to gracefully retire into the blissful amnesia of your twilight days.’ While Kropton was signing the books, Jurgen called down to the front desk. “Mushi, mushi,” the same woman answered. Jurgen requested a cab to take him to the Shinkansen station. Father and son said good-bye to each other in the hotel room doorway, then after a moment of hesitation, gave each other a heartfelt hug. “It’s been great to see you again. Now I’m going to miss you,” Jurgen had said...


XI. T-4

As Jurgen awoke one morning from uneasy dreams he found himself transformed in his bed into a gigantic insect... He crawled from under the covers, across the carpet and up to the bathroom mirror; where he was relieved to discover the familiar reflection that he had known for many years. Feeling that it had just been an aberration caused by the cobwebs of sleep, he thoroughly brushed and flossed his teeth. As the fog drifted away, he gradually became aware of the reality; he had arrived back in Osaka around noon the previous day and had been asleep ever since. Studying his features in the mirror, Jurgen once again clearly recognized his resem‐ blance to his father. It seemed that it had been predetermined that they would meet. In just one night he had re-established a close connection to someone he hadn’t seen throughout his entire life. He had discovered that his father was not to be the monster that his mother had often portrayed him to be. He had also gained insight into the life of his grandparents. For the first time his past no longer seemed to be a mystery. His perceptions had changed since his trip to Tokyo, although not as radically as he had first perceived this morning. What he had thought about on the bullet train, during his return trip, was that it was time to move forward and put his past behind him. He realized that it would be wise to abandon his attempt to resurrect the Starks’ ancient computer hardware, and instead, consider it to be something of a momento mori. Although, he thought, there were certain components that would be useful to him, if he followed through on the new plan he was formulating; to ship some computer equip‐ ment to the abandoned base in Iceland in order to conduct some research experi‐ ments of his own. To carry out the mission, he would need to earn and save adequate credits by concentrating on his project work at GenSynth, in order to buy himself the time. Jurgen glanced at the clock on the NTT billboard. It was time to go to work... What at first appeared to be some type of machine, descended to the surface. Its large polygonal head was mounted at the top of a tall narrow column. At the base of the column, near the docking connectors, were mounted six, thin, single-jointed legs that were folded up like the legs of a sleeping spider. When sensors mounted at the tips of the legs came in contact with the surface, the legs slowly extended, docking with receptors on the surface of the membrane. Securely in place, the tall column contract‐ ed, forcing the base-plate of the docking connector to puncture the surface and drive a


small tube through the cell membrane, injecting DNA from the head of the device deep inside the cell... Jurgen was sitting in one the dilapidated chairs in the laboratory on the main floor of the General Synthetics building, watching with fascination as an organism called a Bacteriophage T4 docked with the surface of an Escherichia coli cell. The cell of the E-coli bacteria filled the lower half of a viewscreen displaying the output of a scanning electron microscope. Jurgen found the scene somewhat reminiscent of the Apollo 11 Lunar Excursion Module landing at Tranquillity base nearly forty years before, although the image he was watching now was considerably higher in resolution than the grainy, black and white, archival video footage of the moon landing which occa‐ sionally replayed on the zTV history channel. No, this wasn’t the surface of his planet’s only natural satellite; the scene that Jurgen was observing was being played out in human feces obtained from a sample of raw sewage. Nonetheless, it was awe inspiring; this was the first time that he had been able to observe the process live and in colour. Jurgen had made arrangements to view the procedure in order to provide some background for his current research into the development of artificial life. He had already become familiar with the T4 while studying data about biological viruses at the Akademy. The information had provided valuable reference since computer viruses functioned in a similar manner. Rather than preying upon bacteria as the bacterio‐ phage did, computer viruses instead consumed digital resources by replicating within a computer’s operating system, yet the end result was the same. Seiei Nishimura, the lab technician, enthusiastically provided the ‘narration’: “Viruses like T4, seek out and infect only bacteria cells in order to replicate them‐ selves. Drifting through the environment in their dormant state they are called virions, but once they come in contact with a suitable host they activate, becoming a virus. Once its legs dock with the outer plasma membrane of the bacterium, it drives an injection tube through the wall. Immediately after the injection of DNA, genes inside the host cell form a macromolecular T4 assembly line. The host cell, in effect, becomes a factory which creates the components of the bacteriophage; head, legs and sheath... connecting the pieces together to manufacture a new batch of progeny. The assembly line follows the instructions of the genetic blueprint, which is contained in the DNA code initially injected into the cell. The formula calls for the cell factory to also produce the proteins which polymerize new sets of viral DNA which are then packaged into the head of every completed version of the new T4s.” “Once the bacteria host cell is ready to begin creating the DNA instruction sets to be placed inside the head of the new machines, the viral DNA injected by the original Bacteriophage T4 assumes control over the factory. The viral DNA consists of instruc‐ tions for the production of about 100 genes. One of first viral genes that is synthesized is an enzyme that attacks and chops up the host’s own DNA instruction set, breaking down the host’s DNA into nucleotides that can be cannibalized or pirated by the


replicants. After the host DNA is destroyed, the virus takes over the cell, directing the host metabolic machinery to produce viral components.” “Deoxyribonucleic acid, DNA, is a linear double-stranded molecule. The two strands are encoded with a series of nitrogen bases that are represented by the symbols A, T, G and C, which stand for adenine, thymine, guanine, and cytosine; the T4 contains approximately 168,800 base pairs. Replication occurs when the two strands separate. Each half of the original strand becomes a template for the formation of a new pair. Since A only pairs with T, and C with G, the sequence of the original strand determines precisely the sequence along the new strand, which now becomes the complimentary pair to the original nucleotides. Together the two strands form a complete chromosome.” “With the bacteriophage T4, viral DNA replication proceeds bidirectionally from the point of origin, which after only 4 to 5 rounds of replication, produces about 16 to 32 copies of a complete sequence of the genome. The single-stranded ends of the viral progeny are complimentary, joining together like Lego™ blocks to make molecules over 10 times the unit length of the virus. The genetic map of the sequence is repre‐ sented as a circle, because the order of the genes on the genome begins again at the end, like a snake swallowing its own tail.” “The concatenated sequence is fed into the phage head until it is full, at which point it is sliced off like a sausage at one genome unit in excess of a full sequence; ABCDE‐ FGABCDEFGABCDEFG ---> ABCDEFGAB+CDEFGABCD+EFGABCDEF etc...” “The entire process of T4 infection, from first contact to the time that between 100 and 200 fully-loaded progeny emerge from the cell, takes about 25 minutes.” “The nature of the bacteriophage T4 is such that once it gets into the cell, it immediately undergoes the replication process. Another group of related phages take a different approach. These viruses infect cells and then integrate into the chromo‐ some where they may remain dormant for several, or many generations, until some‐ thing triggers their activation. This type of phage carries a gene that is active, even while the phage remains dormant into the host. This gene may introduce toxins into the host bacteria, which results in a variety of diseases; botulism, diphtheria, or scarlet fever in the meta-host; the human or animal which functions as the ‘universe’ in which this drama unfolds.” Someone in the lab had begun coughing loudly and hoarsely, distracting Jurgen from this microbiology lesson. He turned his attention away from the screen and gazed around the room; the sound was coming from a young woman over in the corner of the lab who was eating a sandwich while she sorted and stacked a collection of bacteria samples contained in small, round, white plastic containers. Jurgen stood up, thanked Seiei for taking the time to set up the display and provide informative data, bowed slightly toward him, then exited the lab. He rode the elevator


up to the 2nd floor, got off, and continued through the labyrinth of passageways. Along the walk, his mind replayed what he had just observed; the link between computer viruses, written as software code, and the replication techniques of the Bacteriophage T4 were becoming even more apparent: it had been confirmed that the relationship between predator and prey, or a host and its parasites, established an essential factor in determining the survival of a species. It reminded him of the word, spoken by a toothless old man laying inside his urine soaked cardboard box within the Tokyo subway village: ‘Parasites’. By the time he arrived back inside his tiny cubicle, this spark of inspiration was already triggering a chain reaction of related concepts. He submitted the question; ‘What is a parasite?’, into the network and an interesting definition immediately returned to his screen: ‘Formerly, one who habitually ate at the table of another, repaying with flattery’. The definition implied a symbiotic relationship; a beneficial mutual exchange. Perhaps, then, it just was a question of numbers; the quantum differential between various types of species within a given environment ultimately determined whether a creature was a parasite or not. If the balance was tilted, if the amounts were far from proportionate, then the overwhelming number would become harmful to every other of species within the environment, the environment itself, and finally to their own existence. Jurgen imagined a scene in which a huge crowd of uninvited guests, all exchanging insincere compliments, suddenly discover that the host has only a meager supply of food ~ It would certainly place the host in a difficult and dangerous situation.. Reproduction. He considered the primal urge. For, once the organism had repro‐ duced, it would have fulfilled its primary purpose; biologically replicating its code. Jurgen was aware that in order to ensure its success within the next generation, this instruction set needed to be capable of evolving. The code mutated, adapting to changes occurring within the environment, integrating essential information into its structure. Based on current trends, the code was capable of projecting the trajectory of future possibilities, instructing the creatures to grow legs or wings, develop an ability to change color, become larger or smaller, or lose their gills or body hair. Yet, evolution was a slow process for creatures with a long life span. Sudden, unexpected changes in the environment could be devastating. By contrast, a T4 could create a new generation within the span of one half hour. Jurgen recognized that the bacteriophage was more adaptable than a human, for example, since it only needed to transmit a small amount of code, yet, at the same time, this limited instruction set also minimized its physical size and complexity. He imagined the T4 as being similar to a tiny robot that had only one short instruction set stored in its memory. This compact software was elegant in its execution; it was able to commandeer the host’s operating system, instructing it to dismantle its own cellular material in order to supply the resources to construct component parts for replicant T4s. Also interesting: this pirated factory efficiently manufactured instruction sets for each new T4 robot, initially as a long, redundant DNA chain. When the body of the new bacteriophage moved to the end of the assembly line, a chunk of this instruction


code was sliced off the roll and inserted into the head of each T4 unit. The process was analogous to dropping a printed copy of the manual into the box before shrinkwrapping the package for shipment. It was very late now; the middle of the night. Jurgen was washing down pills with coffee and staring at the thick pad of paper on the desk in front of him. It was filled with sketches and scribbles that only he could read. Most of the others had gone home a long time ago, but he could still hear an intermittent phaser, or occasionally the sound of a styrofoam rock tumbling down the corridor toward his room from the video lounge where someone must be watching an original Star Trek™ episode on digital disc. Although he was tired, Jurgen remained, deep in conversation with himself: Up until this point, he realized, his digital entities had been rather simple construc‐ tions, not much more complex than the single strand of genetic information enclosed within the protein capsule of a virus. But now he began to consider the possibility of creating a more sophisticated entity, in which different types of data packets were designed in such a way that they were able to interlock like building blocks or molecules to compose themselves into a variety of new combinations. He could imagine that each of these packets would begin their existence in a very primitive state; a parallel with the early stages of life on our planet which began as microorganisms emerging from the sea or from the clay. Each entity would be de‐ signed to transport a unique fragment of data, written in assembly language in order to be as tightly coded as possible. As they encountered one another, they would transfer this information in the form of energy patterns; in a similar manner to the way that ideas are exchanged by the interaction of individual thoughts. He realized that it could be possible for a complex entity to emerge from this interaction which was greater than the sum of its component parts. Perhaps much greater. Perhaps this larger interactive system would begin to modify itself; adapting its characteristics in response to the digital environment it had discovered. Within the system architecture of a computer, information transfer, genetic recombi‐ nation and random mutation would progress much faster than similar processes in the physical world. If the packets were initially designed with integrity, then the entities themselves would quickly discover the most successful methods of ensuring their own survival. Then Jurgen naturally thought about the network, which because of its immense size, could support a very large number of individual packets of code, which could gradually interact to form a much larger ‘virtual’ entity without their activity ever being noticed. He felt a sudden rush of excitement, the exhilarating awareness that this idea was not some far-fetched dream. The reality was that he could actually create a complex form of life that could exist within the network. Like the Starks before him; whose research took a great leap forward with the arrival of solid-state, Jurgen realized that his own conceptual endeavor would be facilitated by utilizing the latest advances of the computer technology from his own time.


Each successive generation of computer technology had been increasing in sophistication, evolving to the point that, powered by the sun, it had become nearly self sustaining; photonic computers with wafer circuitry consisting of optical chips fabricat� ed of gallium arsenide, bromine molecules and lollingite. Optical amplifiers and transmitters bouncing data off of satellites, traveling wirelessly through the air, captured again to ricochet through the fibrous veins in the bloodstream of the optical network; blue fibre lasers streaming superluminal energy through photovoltaic membranes at the speed of light; 300,000,000 m/s. Dense division multiplexing; 1000 wavelengths each transporting gigabits of data on every fibre. A petrabit; one quadrillion bits per second of information transfer exchanged as beams of light. Stochastic fractal compression in DRAM storing 68 billion bits per chip, 128 bit IP address... and so on, and so on... The virtual had replaced the physical; this was the new world. protected securely in underground locations, and maintained by robots and teams of programmers; the propeller heads and geeks who had dedicated their lives, with monk-like devotion, to ushering in the era. Jurgen smiled as he thought of a landscape inhabited by new forms of flora and fauna; creatures that could find a home within the digital terrain - flourishing within oceans of energy and frolicking in the vast data fields encompassing each global village. The entities he imagined were not mean little viruses that were malicious and destructive, but benevolent entities that would be beneficial to humanity. Jurgen was reminded of the Brautigan poem that he had once read in his apartment at Mrs. Boshovsky's house; 'All Watched Over by Machines of Loving Grace'. Then he asked himself the same question which human beings have asked themselves since the dawn of time. The answer to that question was: If it can be done, someone will try. It might as well be him. He had the concept. He had the equipment and the resources. He had the knowledge and the skill. And most importantly, he believed, was that he had a conscience. It was at that moment that he happened to gaze at his own reflection framed by the darkened screen of his computer monitor. It was the moment that he first began to consider the possibility of digitizing himself...

XII. WHITE CHRISTMAS

Jurgen was once again sitting at home alone on Christmas eve, as usual he was staring into his monitor. Suddenly he was startled by a harsh electronic warning sound:


‘Brrrrrrrrrrrrrrrrrratt!’ The sound beckoned him to the intercom. He walked over to the console to study the tiny colour video image transmitted to his apartment from the security camera in the lobby. Even though it was bitterly cold outside, to his amazement, Kaori and her identical twin sister, Kiyomi, were dressed as cute little elves; wearing short skirts lined with imitation red and green fur and thigh-high white plastic boots. He could hear them laughing, giggling and jingling their bells through the small speaker. He immediately buzzed them in. From the moment they arrived, he noticed they were acting in a suspicious manner; as if they had previously concocted some type of mischievous plan. But he soon dismissed the notion, since their altered behavior could simply be attributed to the fact they were high; a happy, excited, bubbly state that was certainly chemical induced. They had brought a special present for Jurgen; a beautiful package which he quickly, yet carefully unwrapped. Inside, he had been ecstatic to discover a very large Venus Flytrap. He carried the plant into the living room and set it on top of the reel-toreel deck that still had a tape of the Starks on its spool. Kaori demonstrated how hungry the plant was by placing a delicate finger into its open pink lips then quickly removing it before the plant's trigger hairs could mechanically snap the trap shut to capture it. While Kaori was playing with the plant, Kiyomi opened her backpack; a cute yellow backpack, decorated all over with stickers of cute cartoon characters, from which she extracted a bottle of red wine. Jurgen took the bottle into the small kitchen, searching everywhere for a corkscrew, only to discover that he had a woefully inadequate collection of kitchen utensils; he might as well be living in a cave. So, he tried improvising. He found a long wood screw in a cabinet drawer; step one - drive it into the cork with a screwdriver, step two struggle to pry the cork out by grasping the head of the screw with a pair of pliers, step three - break the cork off halfway leaving most of it wedged inside the neck of the bottle. The girls rushed in, giggling to find him kneeling on the kitchen floor with the bottle grasped firmly between his knees. He tried a new tactic; now applying steady pressure on the cork with the screwdriver, eventually managing to force it down into the bottle. But he had pushed a little too forcibly, since as soon as the cork had been released from the neck of the bottle, the pressure had ended up splashing dark red wine onto his t-shirt and jeans and all over the kitchen floor. The sisters were laughing so hard that tears rolled down their cheeks. “Take off your pants,” commanded Kiyomi. “Take off your shirt,” added Kaori, “You don’t want the wine to stain.” Jurgen complied, and while Kaori ran water over his clothes in the bathtub, he was left wearing only a pair of boxer shorts to clean up the spill. Soon he could hear the


sound of Christmas music coming from the adjoining living room, and more giggling. He poured three large glasses then entered the room carrying the tray like a waiter. The sisters were sitting together on the futon; which during the day was folded up into a couch. Other than mannerisms and voice, the only way to tell them apart was by differences in the way they wore their hair - and their clothing. They preferred not to dress alike; tonight they had chosen different color elf costumes - Kiyomi, red, Kaori green. When Jurgen crouched down to clear some space in the center of a low wooden table, he clearly noticed that they weren’t wearing anything under their costumes - except a little triangular patch of black fur. As they reached out to take the glasses he offered them, each had playfully grabbed one of his wrists, gently guiding him down between them on the folded mattress. For some time he sat, nervously sipping his wine and staring at his new, and only, plant. “I know what we need,” Kiyomi exclaimed to break the ice. “White Christmas!” She dropped a small white tablet into each of their drinks. “What is it?” Jurgen asked suspiciously. “It will make you feel love!”, was Kaori’s happy reply, her dark eyes twinkling merrily. The two girls talked and laughed while they all drank their wine, then hopped up into the center of the room, attempting to sing-along, karaoke style, to the digital files of Christmas carols on Kaori’s player. Jurgen watched the performance for awhile, grinning from ear to ear, then at the girl's insistent coaxing soon joined in on the fun singing into an invisible microphone; “... later on by the fire, we will sit and perspire...,” None of them knew any of the words. Laughing, they all collapsed onto the futon. Jurgen was beginning to experience the spirit of Christmas; a profound sense of wellbeing and peaceful harmony washed over him. He felt calm, relaxed. He poured them each another glass of wine then sat back to sip from his glass. The girls snuggled in closer toward him. “My muffin is cold”, one of them said, and they all started laughing again. Kaori then asked him which one he thought was the prettiest. He honestly couldn’t decide. As she leaned toward him and kissed him on the cheek, to influence his decision, he could plainly see her small round breasts inside her elf costume. But it wasn’t until he felt a hand slide up his leg and grasp the swollen shaft inside his boxers, that he even realized that he had an erection. Kiyomi let out a surprised shout in Japanese, then both girls giggled excitedly. “She says it’s enormous,” Kaori translated, as she reached over to touch it for herself.


This attention had made it grow even harder; straining against the fabric like a broomstick. By now, Kiyomi had yanked the boxers down around his knees, while Kaori began kissing him passionately on his lips. Most of his thoughts were devoted to the face pressed against his, but a portion of his attention was diverted by the sensa‐ tion of having his penis licked like an ice-cream cone and having his balls fondled by tiny, agile fingers. Kaori had quickly slipped out of her costume and was pleading with Jurgen to kiss her breasts. When he looked down he was surprised that his penis was now encased in a black condom shaped like Bad Batz Maru. Soon he found himself totally naked, laying on his back on the futon. Kaori hovered above his face enjoying the sensation of his tongue exploring her intimate regions, while Kiyomi, pulling off her costume, had straddled Bad Batz Maru. While they tumbled on the futon, Jurgen had noticed that with their hair untied, the two girls were entirely identical out of uniform. By now he had seen every inch of each of their naked bodies and had been unable to discovered any physical characteristics by which he could tell them apart. They continued in various combinations for possibly several hours; Bad Batz had no problem maintaining his strength and endurance, which was amazing, considering the treatment he was subjected to and the difficult situations he found himself in. Yet, ultimately he erupted in an explosive climax when he just couldn’t take any more. They remained snuggled together like naked apes until Kaori happened to glance at her watch. Suddenly, panic, it was well past midnight. Kiyomi pulled a cell phone from her backpack to summon a cab. They could not stay out too late, since they were still living at home and had promised to spend time with their parents when they opened their gifts in the morning. They quickly slipped their elf costumes over their naked bodies and each gave Jurgen a goodnight kiss. “Thank you for the present”, Jurgen said referring to the flytrap. “Thank you for your present too,” the nymphs said in unison as they flew out the door. Jurgen watched from the balcony as the tail-lights of the taxi vanished into the night, leaving only snowflakes to fall gently on the empty street.


XIII. THE UNIVERSAL MIND

While it had been a pleasurable Christmas, the first quarter of 2009 turned out to be a frustrating and miserable time. Jurgen had truly hoped that he would continue to enjoy his work at General Synthetics but the increasing stress and erratic behavior of his team-mates; resulting from the crises of ‘the Situation’, prevented him from becoming more sanguine. It was a bloodless conflict, but a battle nonetheless, and one by one it had taken its toll on the isolated inhabitants of the other cubicles nearby. The atmosphere had turned black as the pressure increased. It had come from high above, within the stratosphere of the Golden Sun Corporation, and as its overlord, Mr. Luk came to personify the irresistible force that pressed down, squeezing the life out of nearly everyone involved with the project; squashing them like a bug. The Situation was that the project was simply not achieving the milestones that apparently had been carved in stone on a design document somewhere, and now, having reached a critical condition, Mr. Luk was anxious to express his concern that investor confidence in the project had begun to waver. Dr. Sato complained that Mr. Luk’s evaluation was from the perspective of a market-oriented entrepreneur who didn’t fully appreciate the difficulty of the task or truly grasp the project’s long term beneficial goals. Lately, Dr. Sato had often told Jurgen more than he needed, or had even wanted to know. Up until this point, Jurgen believed that this sense of candor and trust was a result of earning Dr. Sato’s respect by achieving all of his assignments. He, and other team members working on the development of artificial intelligence, Takako in particular, had managed to keep pace with the project schedule and sometimes had even advanced beyond the specified goal markers. But they were only writing lines of code which, one day, would provide instructions for its human brain, and not actually attempting to physically fabricate a very large, bio-mechanical ant. This was proving to be a much more formidable challenge. A working prototype of the ANT (an acronym for Agricultural Nutriment Transactor); essentially designed to become a human piloted machine used to harvest grain, still had many 'bugs' to work out in its development. One of the more successful current models stood about two meters tall. It was operated by a lab technician who would crawl into a narrow space inside its body and attempt to get the ANT to turn its head, or walk around, by manually sequencing through instruc‐ tions programmed into its onboard computer. During a recent test that Jurgen had observed on a surveillance monitor in Sato’s office, the ANT had broken a leg, fallen onto its side with a very loud crash, and lay twitching on the floor. These set-backs had become standard operating procedure on a project which, Jurgen often thought to himself, should be code named SNAFU. As the Situation deteriorated, and one chaotic crises was heaped upon another, most of the employees


had gradually adopted a mood swing frequency which, typically, seemed to oscillate wildly between a state of total emotional devastation and an optimal survival mode. It was not a pretty sight; the top workers, over eager achievers who were duty bound by the honor of some type of Samurai code, seemed to be the first to experience stress fractures, which cracked even further under continued pressure, until they finally wigged out and began to speak in tongues. Surveillance cameras suddenly began to appear where none had been before; tiny little eyes, the size of a pack of gum, stuck to walls, on the ceilings, the vending machine in the ‘leisure area’ ~ they were probably everywhere. The omnipresent eye was watchful for unruly outbursts by distraught members of the crew; should an incident erupt, a pair of ‘health workers’, stationed at the site, were immediately dispatched to modify the worker’s behavior. The treatment consisted of a combination of counseling and medication; more or less of one or the other, depending on the patient. For those that medication could not comfort, other disciplinary measures were strictly imposed. To set an example, several of the workers were subjected to the practice of murahachibu; social ostracism - no longer invited to the meetings, office furniture disappears, and so on... while others were sent off on ‘vacation’, never to return. The employees did stay at the office for longer hours now, and work with greater intensity, but the environment had become tainted with the odor of bottled up stress and fear. Jurgen recognized that dynamics, similar to the principles of cellular automa‐ ta, had been invoked by the intervention of these extreme tactics; workers had become responsive to their conditioning by minimizing their contact with each other, and concentrating their energy solely on achieving the collective global objective. Yet, at the same time, they became more reluctant to do anything unless signaled: move, grow, divide, release the molecule they had been storing, or whatever was required. Once an action had been quickly and efficiently executed, the employee-organism would again return to their highly agitated ‘resting’ state, anxiously awaiting to be triggered by the next signal fired in their direction. Naturally, Jurgen had not been swept up into the swirling maelstrom of madness; he had remained an island of calm within the raging river of fear that had subsequently followed the intensity of every storm. Although increasingly dissatisfied with the working conditions under Dr. Sato’s ‘regime’, Jurgen managed to maintain momentum within his area of research on the project by guiding its direction for himself. He simply propped a chair up against the door handle inside his cubicle, kept to himself and went about his activity, as if each were just another ordinary day. His preferred method of working was to first intelligently consider various approaches to solving a given problem, then select the course of action which had the highest probability of achiev‐ ing the most successful result. He would then dedicate his effort to pursuing that direction until, either he had achieved the desired conclusion, or had discovered that the approach was no longer likely to yield a significant result.


Of course, Dr. Sato had been watching him and had recently begun to interrupt Jurgen’s activity by frequently summoning him to his office. Jurgen did not have the training to be able to psychoanalyze the man, but his instincts told him that something just did not seem right. It seemed odd, but he began to suspect that Dr. Sato had made it his mission to attempt to subvert any progress Jurgen made. It was like being kept on a leash; if he forged ahead, he would be reigned in, and Dr. Sato would shelve whatever progress he had accomplished. He would then request that Jurgen begin again; starting over by exploring an entirely new direction without being supplied with any suggestions about what that course of action should be. Jurgen soon found it draining to expend so much energy trying to second guess what was required of him. He began to feel like a canary in a coal mine; forced to explore various tunnels until he finally discovered a high enough concentration of carbon monoxide to make him keel over and die. The only bright light on his regular dreary march to Dr. Sato’s office was that Jurgen had the opportunity to talk to the receptionist. She had grown accustomed to seeing him, and although reluctant at first to approve of his advances, she had gradually granted him the intimacy of allowing him to approach her desk. When he was near, Jurgen became aroused by her beauty and the delicate fragrance of her perfume. Although he was aware that she wasn’t real, she still often appeared in his dreams. After several weeks of repeatedly colliding with Dr. Sato’s wall of denial, Jurgen had retreated into his cubicle and shaved his head as a form of silent protest. Out of concern, Shozo and some of his other friends from the office had offered their support by expressing a willingness to sit down and calmly discuss the situation with him. Jurgen didn’t want to talk about it; he said that he was fine. But after that day, he would frequently leave for home as soon as he had put in the required number of hours to complete his shift. Jurgen regained the vitality that had been missing in his life by enjoying break‐ throughs in the development of his own pet project established on a dedicated computer at home. Notably, he had succeeded in creating a version of the digital life he had conceived during an epiphany within his office cubicle late one night. This ‘being’ that he constructed consisted of a number of small entities which interacted with each other in a very complex manner. Although analogous to the way that stars make up a galaxy, or a substance is composed of atoms, this digital being would never assume a tangible form; as creatures do in the real world, since it was actually just a virtual, shifting pattern of energy. Each of the smaller components; the packets of data, were structured as an arrangement of code. The code instructed the digital environ‐ ment within the computer to recognize it as a pattern; 00111100... and so on... becoming the sequence indicating the position of regions within its structure in which there was either a presence (1) or absence (0) of energy. This code pattern also enabled an entity to recognize and exchange information with the other entities it discovered within the digital landscape, and when it found a suitable mate, enabled it to breed. The offspring would carry certain hereditary


information that had been passed along from its predecessor, and as these entities reproduced within the enclosed environment, they all very quickly became related to each other. Like a bunch of rats locked inside a cage, eventually these entities had mated with each other in every conceivable way, and as with any inbred species, there are potentially undesirable results. So Jurgen would periodically introduce new information into the environment; feeding the creatures data in the form of binary digital strings. These entities developed a hunger for new information which seemed insatiable. It reminded Jurgen of the way that humans persevere; exploring ideas and continually searching for new discoveries - one question leads to the next. By studying his little creatures, Jurgen began to gain insight into the distinction between learned and instinctual behavior. He had discovered that when new informa‐ tion was incorporated into the entities, in addition to creating a broader biodiversity within the species, it also provided them with a method of understanding their environ‐ ment. It was this understanding, incorporated into the fabric of their code, that when passed along to subsequent generations, developed a type of ‘instinctual’ behavior; an innate awareness of situations or circumstances which were either potentially dangerous or beneficial to them, and which enabled them to have more success of surviving within the environment. But what had been most interesting was that the entities naturally formed into a collective of individual personalities; some were more active, developing a talent for accumulating information, others were slower but became specialists in the fine art of reproduction, and so on... It was this relationship between the entities which created the macrocosm; the ultimate, larger ‘virtual’ digital organism, which Jurgen likened unto Jung’s Universal Mind, or what Marcel Planchette had often referred to as the Akashic records. Jurgen considered that when a larger number of humans get together to participate and interact as a group, they form a society; which tends to become the definition of the collective activity which emerges. Yet, within this body, each member retains its own unique characteristics, even if the distinction was as minor as the similarity or differences between one fingerprint and another. Finally, he introduced predators into the environment, to ensure that his entities would not become too complacent: these ‘entity eaters’ were ruthless, streamlined, sleek machines, whose code contained only a limited set of instructions: seek out entities that had either accumulated greater than, or less than, a specified amount of ‘environmental’ information, and when discovered, completely tear apart their energy fields until nothing remained but fragments. It went against his nature to target creatures which were obese or weak, but Jurgen realized that, by necessity, his entities would need to be prepared to meet with creatures in the wilds of the digital jungle that were naturally spiteful and mean. Out there, in the vast network, the law is, 'survival of the fittest'; code eat code. Not surprisingly, the original entities responded to the threat. But what was surpris‐ ing was how quickly the news spread throughout the macrocosm; the inter-connection existing between the entities triggered an almost spontaneous awareness of the


danger. While the existence of some of the entities were quickly terminated, their sacrifice helped to buy time for many of the others to come up with imaginative ways to react to the situation: some quickly learned that if they gathered a certain amount of information, they would surpass the threshold which would then provide them with protection, while others found ways to condense the information that they had already accumulated, or simply, discarded excess ballast. A certain number discovered other methods of eluding their attackers, either by continually changing locations, or interestingly, in some cases by disguising themselves as the predators... and so on... the more successful, inventive tactics were then passed along to their descendants. These coding sessions often lasted the better part of the night. In the early hours of the morning, Jurgen would leave the processors running to render out the calculations for a new scenario, catch a few hours of sleep, then wake up and head off to his cubicle at General Synthetics, riding his bicycle with coffee cup in hand. Immediately after work, he would anxiously rush home on his bicycle again; peddling much faster than he had in the morning, to check out the results... Sitting in silence eyes glazed by monitor glow suddenly startled... ‘Brrrrrrrrrrrrrrrrrratt!’

XIV. THE PLAN

Jurgen recognized the smiling face of the person waving at him in the tiny video image on the intercom console: “It’s me, Kaori! Can you come out to play?” “Just let me put some pants on, I’ll be right down.” They always took the bus, occasionally during evenings, and often on the week‐ ends, traveling to different portions of the city: Osaka Tower, Nanba City, Nanba bridge, US Taste snack bar, takoyaki; octopus balls, okonomiyaki at Fugetsu, ‘grilled as you like’, the Eccentric Bar Magnet or the Mystery-Spot lounge for drinks, then off to play Pachinko at Galaxy P-Ark with its enormous gargoyle menacingly poised above the entrance. Shopping for ‘cute stuff’ in the Kita district; low buildings, architectural sleek design, enclosed by a modular framework of pink, white, grey and blue steel... the entire city was like an enormous amusement park; cleanliness, safety, excitement...


and the cartoon products - watches, erasers, stationary and stickers were like the midway prizes. Every two weeks the credits that had accumulated from his employ‐ ment were transferred directly into an Asahi bank account; all that Jurgen needed to do was swipe his robocard wherever he went. His relationship with Kaori had intensified since the incident the past Xmas. Of the twins, it seemed Kaori was determined to have him for herself, although Jurgen was never sure if they had sometimes decided to trade off... As the year elapsed, Kaori had moved out of her parents home and now lived in an apartment nearby. She worked during the day as a clerk in a music store. After her shift, she would let herself into Jurgen’s apartment to prepare a supper that was ready by the time he returned home from work. Kaori would often bring over a few Sony miniDiscs, which Jurgen had recently gotten into the habit of using to make voice recordings of the findings of his research experiments; a technique that had been inspired by the Starks. He would speak calmly into a microphone that was clipped to the front of his T-shirt to describe the complexity of his artificial life forms. The creatures had lately begun to take on a life of their own; beginning to grow and multiply inside the computer. On the recording discs, Jurgen documented such things as; an exami‐ nation of the factors which caused the termination of the creature's existence, as well as descriptions of the methods he was devising to prolong their life experience. When it was full, Jurgen would legibly print the date and other information with a marker pen on the label of the thin black disc before tossing it into a small wooden box under the table. Near his workstation was the Venus flytrap. Jurgen had decided to name it ‘god’. During the past few months the flytrap had become the centerpiece of an increasingly strange tableaux. The shrine on top of the reel-to-reel, surrounding the voracious plant, consisted of various plastic bugs, little toy robots, Gamera; the flying turtle monster, and a 10 centimeter tall, black and white cow covered with soft artificial hair. Jurgen often brought back genetically enhanced insects from GenSynth's entomology lab to feed to ‘god’, taking great pleasure in the process. Kaori had very subtly and skillfully intensified the intimate relationship she had developed with Jurgen. She was pleased that he had been responsive and that he was frequently willing to put aside his work to devote some time to her. They would often go out in the evening to a movie or restaurant, or party all night at a rave. Sometimes they would leave the city and spend the entire weekend hiking and camping in the mountains. Kaori was also very expressive in her lovemaking, always suggesting interesting new ways to experience pleasure together. Jurgen had been hesitant at first, but as they explored nearly every sexual position imaginable, he seemed to want it all the time. Once she fed Jurgen a powerful herbal aphrodisiac, tied him to a chair, then used her thin body to ride him relentlessly. He managed to sustain an erection even after releasing several consecutive orgasms. Kaori's wails of delight drowned out the sound of the neighbours pounding hard on the walls. On another occasion they had made love with unbridled passion on the bare wooden floor of a


Shinto shrine. It was wicked, but she loved it. She began to notice that he seemed more calm and relaxed when he was away from technology, yet it was like a Dr. Jekyll and Mr. Hyde syndrome whenever he got back in front of the computer display again. In the meantime, while all these things were happening, the thought of an aban‐ doned airbase in Iceland still continued to attract Jurgen like a magnet; exerting its powerful force from the opposite side of the globe. Secretly he had formulated ‘the plan’, which was growing in importance as it continued to evolve. It was as if a pathway, that he had been destined to follow, once shrouded in fog, was now revealed to him step by step. In his mind he began to consider that he was about to become the catalyst for some significant event which was destined to soon manifest. As the first step in carrying out ‘the plan’, Jurgen had initiated an exchange of letters with his father using the postal system. It was expensive and slow but Kropton refused the suggestion of using electronic mail. He preferred the more personal touch of arranging hand crafted alphabetic sequences on pieces of paper. He had mentioned during one of his correspondences that a handwritten letter is more than a message; it is an original work of art. Jurgen occasionally wrote to his father about the problems that he had in dealing with the perpetual state of chaos at GenSynth, mentioning that he also found that he had never been able to acclimatize himself to the culture of Japan. He scribbled lines to the effect that if everything went according to plan, he would be able to take an extended ‘summer vacation’, journeying to Iceland during the following summer. Kropton replied that he was pleased that Jurgen was interested in making the ‘pilgrim‐ age’ to the Stark's former laboratory, forwarding detailed instructions on how to get to the remote location. During the autumn, Jurgen believed that in order to carry out his secret plan, it would be necessary to begin to distance himself from the corporation and initiate the process of separation. By now he had firmly resolved to leave the company in seven months time, on June 22, 2010; which was also the date his birth. He had a consider‐ able amount of credits saved up; since he was well-paid and his living expenses were covered by the company. Although he could survive for quite some time on these savings, Jurgen had been anxious to step up the process of his preliminary research, so that he would not later need to subsidize actual development time by depleting his own resources. In that regard, rather than limit his own research to periods spent working at home, Jurgen had decided to take advantage of the facilities and equip‐ ment at GenSynth for purposes more suited to his own requirements... Dr. Sato be damned. As it turned out, perhaps this attitude, on the surface, had been exactly what Dr. Sato had expected and hoped for. Jurgen often wondered if it had been Dr. Sato’s strategy all along to find a way to bring out Jurgen’s anger and passion; as a way to fuel more interesting and innovative results in his work. Had Dr. Sato set fire beneath the wooden man to see if it would come alive and sever the puppet strings which held


it under his control? Dr. Sato was possibly watching him at that moment through the surveillance cameras mounted within his cubicle.

XV. THE HIVE

The camera silently swiveled and panned, unnoticed by Jurgen who sat on a tall stool at one of the long tables in the entomology lab. He had been staring intently into a small black case, oblivious of the activity buzzing around him. Jurgen had been spending a great deal of time in the lab lately. Although, this evening, he was only there, waiting for the shipment to arrive: Zinthrop had been expected to send an example of the recent results obtained by his team in Lanai. They had been conducting experimentation in methods of fertilizing queen bee eggs with human semen; obtained from a fitness center on the island of Hydra in Greece. To pass the time, Jurgen had been peering at a collection of tiny preserved creatures; suspended inside the space between the thick styrofoam base and the dusty glass. The table top surrounding him was strewn with several similar black cases, each displaying insects, grouped by species, from regions all over the world. Nearby, the vacant eyepieces of electron microscopes stared into the room. Chemical separators and a jumbled disarray of glass beakers lined the counters. Restless machines buzzed quietly in the background. A young entomologist named Karoshi sat on the stool next to him, leaning in over Jurgen's shoulder to examine the contents of the case as well. Karoshi hadn’t collect‐ ed or arranged the specimens, but he had appreciated the meticulous attention to detail and tender care that had been demonstrated; indicating that the collection had obviously become a source of pride for the person who had preserved the remains. Yet, to Jurgen, the contents of the case were just an array of bugs with pins through them; flytrap fodder. “The legs are arranged nicely,” Karoshi noted without emotion, serious, intense, tired eyes magnified by the thickness of his eyeglass lenses. “Yeah, I guess... but what is it?” Jurgen inquired.


“Euglossa Ignita, from Brazil.” Skewered on the pin was a metallic turquoise orchid bee with a wingspan of twelve to fourteen centimetres. The bee had a long proboscis and bright golden wings. It was certainly a beauty, and quite large... Jurgen’s thoughts had slowly begun to drift away... At first it had been ants, but now it had become bees that formed the biological model for the prototype of the new machines. While the former project continued to lurch ahead during the process of mechanical translation, recent developments taking place within Zinthrop’s hive in Lanai had caused a revision in the Golden Sun Corporation’s marketing plan, with the resulting formulation of an entirely new product stream. The buzz word among investors now, was ‘Giant Bees’. It had been quite some time since he had heard anything about Zinthrop and his team at Imago Enterprises. While Jurgen had been caught up with other things that were happening in his life, he had forgotten all about them. Now, suddenly they had once again reappeared on his screen. And to make matters worse, Zinthrop himself had requested that Jurgen take an active role in the project; suggesting that he head up development as the team leader. Of course, the timing of this recommendation was completely out of synchronization with Jurgen's own secretive plans; ‘the plan’ had been to extricate himself gracefully from what had become an unpleasant situation, not to immerse himself even further. Jurgen had immediately protested to Dr. Sato; claiming that he was just a programmer and would be unsuitable as a manager. But Dr. Sato had refused to listen to these words, instead forming ones of his own that communicated to Jurgen that this task would now become his responsibility, and that it was necessary for him to rise to the challenge. As an incentive, Jurgen’s ‘promotion’ had been accompanied by an immediate increase in his wages and relocation to an office with a window view on the second floor. This level of the building was occupied by other middle management types. It was a more formal, regulated environment; talking in the corridors and the chewing of stress gum were not tolerated. Its mandatory policy required that all personnel strictly adhere to the dress code. Jurgen had considered these regulations to be more of a guideline for professional conduct rather than a set of commandments carved in stone. His cavalier attitude had become a source of irritation to an intense, precisiondriven employee, who occupied the office directly across the corridor. This fellow was the manager of an unknown department, or at least one that Jurgen would never discover, and had apparently stalled somewhere along his ascent up the corporate ladder. In his late forties, it seemed he had constructed a pompous and frightening facade like a shell around his fragile reputation; a shield which was designed to prevent the lowly employees from detecting that the knowledge he had acquired during his lengthy career was very limited in extent. His opaque dark eyes glinted with cold malice. His grim features had been carved into a mask that had been crafted to instill terror in those around him.


Jurgen had first become aware of his intense hateful glare on the day he moved into his new office. Across the hall, framed within the open door of his office, this fellow sat behind a desk which faced out into the corridor. As he had approached the threshold, Jurgen instinctively froze as soon as the man had begun grinding his teeth. It was an audible gritty sound that grew louder as his agitation increased. Jurgen had tried to introduce himself, in English, but his fellow manager refused to tell Jurgen his name; instead his face sequenced through deeper shades of crimson. Fearing that the man was about to go ballistic, Jurgen retreated back to his own office, only later realizing that the man had possibly been upset by his attire; a faded red shirt (that he had bought in Hawaii) with a patterned-print of yellow and green parrots burning traces onto the retina and a pair of black jeans that were ripped out in both knees. Ultimately, their working relationship had never improved; there had been no second chance to make a first impression... and unfortunately, the first impressions were lasting. They avoided each other like the plague. The third component of ‘the incentive package’; just like a genie’s three wishes, had been the promise of a larger, more luxurious apartment. At the time, in early December, Jurgen had been assured that the move would be arranged for him early in the new year. Although, it had yet to transpire, a memo recently informed him that his new living space would soon be available. Jurgen absently recalled that memo now by tapping on the surface of his digital tablet, resting before him on the entomology lab table. The text instantly appeared on the small screen of the slim device. The date in the top corner of the display read: January 5th, 2010: 7:15 P.M.. The delivery was late... Jurgen continued to wait patiently, his gaze once again absently drifting about his familiar surroundings... Yes, he had been spending a lot of time in the lab lately; he was there much more often than he would have preferred. It had been Dr. Sato's request that Jurgen glean as much research data and information about insects as he could; primarily bees, as well as participate in or observe many of the experiments first hand. Although, in a short time he had become satiated by the experience. Invariably, the novelty had been replaced by repetitive routine and an environment which never changed: the same harsh lights, sterile white walls, unpleasant toxic odors and the same tiny, complex machines, each of which had been designed to serve only one particular purpose. Maybe that was it, Jurgen had thought; the sense of myopia. The near-sighted lab technicians who operated these machines had also trained their vision into a very tight focus; a range limited entirely to their own particular area of specialization. After intensely dedicating themselves, over a long interval of time, to exploring this, and only this, narrow spectrum of knowledge, they no longer seemed to have any idea of where their concepts fit into the larger equation, and consequently appeared to have lost all contact with the ultimate objective of the research they were carrying out. It was like science for science’s sake; experiments conducted simply to achieve a successful result.


During the time that he had spent hanging around the lab, Jurgen began to discover that different personality types coincided with their area of specialization. The chemists were scrupulously clean, obsessively attempting to minimize the variables that could be introduced by contamination since the smallest unwanted particle could wipe out months of effort. The bug people were playful and enjoyed constructing elaborate enclosures to house and breed their insects. They looked upon the gel jockeys; the researchers studying DNA, with disdain, since the pests considered the jockeys to be nerds who concentrated purely on the code. Whenever Jurgen lent a pest a sympathetic ear, he would be reminded that every single day, somewhere in the world, entomologists were continuing to discover a species of insect that had previous� ly been unknown or unnamed. The pests brooded that the jockeys did not seem to give any consideration to the fact that each of the insects had a physical beauty and unique personality which distinguished them from one another, and from every other species in the kingdom. In rebuttal; if they said anything at all, the jockeys would tersely respond that it was unscientific to form an emotional bond with the subject of an experiment. Feeling like a perpetual visitor within this realm, Jurgen frequently noted the constant palpable, but unspoken tension within the laboratory atmosphere created by the different factions working at close quarters with one another. To the objective observer it was a type of social science experiment of its own... Blammo! The doors slammed open as Irene exploded the somber ambiance within the lab. The short, full-figured woman stormed into the room, bringing a smile to every face. Even though the entire building was chilled from air-conditioning, Irene brushed away the drops of perspiration forming on her brow then gathered up her long black hair to securely re-tie it with a band behind her head. Always loud and happy, always laughing and joking, her energetic charisma, yet calm and laid-back manner, immedi� ately charged the atmosphere with its positive intensity. Jurgen had quickly developed a friendship with Irene; who was the head of the entomology department for General Synthetics, and who was also, without question, the nucleus of the lab. While she worked primarily in her second floor office just down the hall from Jurgen, the powerful influence that her personality generated during frequent visits to the laboratory hive kept the lab drones happily buzzing with activity; examining little trays of fungus, keeping the deep-freezers stocked with little plastic bags filled with frozen insect body parts, or baking, weighing and processing them in the rotary evaporator. What little social interaction existed among the humans in the lab, occurred because Irene had created it. She was the den mother and also the matchmaker. When the young boys and girls became overly absorbed in the quiet contemplation of radioactive tracers; gazing through a microscope at body parts within little plastic cells to detect concentrations of technetium that had been added to the nutritional compound fed to the insects, Irene would come along and subtly, but purposefully attempt to shift their attention away from their work, so that they would begin to notice the other gender of their own species. Irene had developed many cunning strategies that were implemented with clever ingenuity in acting as the


catalyst for these encounters. Once she had managed to bring a pair of opposites into close enough proximity, she would let nature take its course in exerting its influence on intimate attraction. 7:45 P.M.; Jurgen picked up his digital pen and had begun to doodle on the tablet screen; quickly sketching his conception of the ‘ultimate insect worker’. His sketches, and any other information he recorded in his digital notebook, were wirelessly transmitted to the large mainframe server of General Synthetics high-security data base. Jurgen chewed on the end of the pen while he paused to consider the design. The objective was to develop a worker that genetically and mechanically combined elements of three entities; bee, human and machine. The bee would provide the conceptual framework and general design of the worker, the machine components would give it strength, and the human would essentially provide its guidance. These giant bio-robotic insect-machines, or autonomous airborne vehicles, would be trained to airlift building components used to fabricate the architecture of mega-construction projects, particularly very tall skyscrapers. Since these human machines would be navigating through the open environment of the real world, it would be necessary for a centralized computer to monitor the machine's operation and act as the flight control program which linked the human operator’s mind to 'The Hive’ by means of transmitted signals which were received by the bee's head-mounted antenna. While Jurgen gathered intelligence through vidcomm links with technical specialists from various GenSynth departments, both in Japan and at branch offices around the world, his primary source of knowledge came from information files and direct commu‐ nication with Zinthrop himself. He learned that in nature, worker bees are foragers. They learn the routes to food sources by memorizing a sequence of visual cues in the landscape, and when they return to the hive, they communicate this information about distance and direction to the other bees in the form of ritualized ‘dances’ or by exchanging honey laced with specially coded pheromones; a hormonal scent which soon permeates the hive. These bees have a very short life-span since they complete‐ ly expend themselves through the effort of their labor; they keep flying until their wings give out. In a similar manner, the giant insect-machines were also designed for the sole purpose of navigating from building component storage areas to the construction site, carrying heavy loads of material and supplies through the air. The distinction between them is that the machines were designed as an arrangement of interconnect‐ ed component parts which could be overhauled and replaced whenever they wore out; not only the wings or the bees’ knees, but also the human operator or perhaps just its brain. It was the brain that intrigued Jurgen, and it was the subject that had occupied most of his research trips to the lab. On numerous occasions, viewed through a scanning electron microscope display, Jurgen had observed technicians from the department of nuclear medicine insert micro-electrodes into the ‘mushroom bodies’ within the brain of a living bee; the tiny, organic nodules within its brain that are responsible for its memory and behavior. Beyond neuroimaging, the sensitivity of these probes; carbon fibre sensors thin enough to penetrate the cellular structure of the brain with minimal


tissue damage, were such that they could detect even the most minute electromagnetic field activity within the bee’s neural network and capture the fluctuation of the energy patterns in real-time. These data-streams recorded the complex structural arrangement of neurons into the storage memory of a computer processor which then used custom software to decode and interpret the signals. It was this translated data; regarding the innate programming which guided the behavior of worker bees in nature, that his loyal associate, Takako, had used to write a simulation model which completely synthesized the bee’s brain activity. Jurgen communicated with Takako in sign language. 7:56 P.M.; Jurgen took a big swig of coffee from the plastic cup beside him, then continued to scribble on the tablet... Takako's computer model was used by the artificial intelligence researchers to understand and modify the algorithms defining the bee’s cognitive reasoning process‐ es - such as its ability to interpret images within a unified ocular brain; which transmit‐ ted visual information directly through a ventral nerve cord to an imaging surface, bypassing the antenna nerve centers. Or to determine how range, altitude, direction and velocity were stored and recalled within the bees' navigational memory. What Zinthrop and other researchers had discovered, was that the bee created ‘filters’ - interpretations of its environment that were perceived through its senses, and which it continually compared to template filters; permanent patterns of neurons stored within its brain that are an expression of its genetic architecture. It was these perma‐ nent patterns; the template filters, which Jurgen believed could be transferred to the human brain of the insect-machine by splicing them into the DNA of the operator. Zinthrop had also concurred with Dr. Sato’s recommendation, made earlier, regarding modifying the behavior of the ANTs; that the on-board computer processor within the brain of the machine’s operator should be responsive to human motivational factors rather than replicate the natural instinctual desire of the bee; which was simply to collect as much nectar as possible during its limited lifespan. Jurgen was reminded of his father’s book, ‘The Disposable Mind’, and how, in the story, a worker’s mind would be replaced during their shift so that they were able to function more efficiently on the job. In the case of the new machines, since the human brain would be genetically altered in its embryonic state, there would be much less reprogramming involved as it matured; less human traits to clear, as well as less beethought processes to load, and the ones loaded or cleared could be selective. Once the genetic code was developed and the programming instructions written, all that would be required would be to simply reproduce those digital processes within a physical organic medium through a combination of genetic engineering, behavioral development, synthetically developed neurochemicals, and cloning. It was well within the capabilities of the team at General Synthetics to re-engineer the human brain in order to introduce into it bee ‘consciousness’. And, ultimately, whatever customized instructions were required on the job-site could be continually updated from the Hive Mind; wireless digital messages transmitted to the machine-bee units from a central


computer within their hive. Carrrrrrunch! Jurgen, still deep in thought, had been startled. He whirled instinctively in the direction of the loud sound nearby; a pair of FastAirFreight delivery men, dressed in their familiar electric orange coveralls, had just knocked over a large metal garbage can near the door. 8:09 P.M.; Jurgen turned off the power on his tablet. The shipment had finally arrived. The delivery men had tried to regain a sense of professionalism by carefully wheeling the plastic crate, strapped to their dolly, through the maze of lab equipment without further incident. But the impression quickly vanished again once they tried to lift the box onto a table; it slipped from their grasp and tumbled noisily to the floor. Irene had hustled over and gave them some serious hell and very rapidly the delivery men had vanished. Jurgen, Irene, Karoshi and two or three other technicians still remaining in the lab, had gathered around, each anticipating what the crate might contain... the surveillance camera swiveled in the corner; Dr. Sato was gazing upon the scene from above... Irene pulled out a set of keys to open the tamper-proof locks at the corners of the white plastic case, which was about the same height but a little bit longer than a picnic cooler. Stenciled in black along the sides were the words; 'Imago Enterprises'. Irene popped open the lid. Within the darkened lab, with steam rising from the melting dry ice in the intensity of a lone work lamp, was a sight that Jurgen would never forget: Cradled in the manger, partially wrapped in transparent plastic sheets, was a freeze-dried, genetically-modified worker about 50 centimeters long and 20 centime� ters wide. It was shaped like a bee; abdomen, thorax, wings and legs, but its body was covered with a soft, larval, pinkish-grey skin that had little tufts of black and yellow fur emerging sporadically. What disturbed Jurgen the most was that on the front of its head, staring out of the crate with its eyes and mouth open wide, was a humanoid baby face that looked as wrinkled as if it had wizened in the advanced stages of progeria. It was not a pretty sight. Jurgen had scarcely made it as far as the emergency eyewash station before the contents of his stomach were violently evacuated ...


XVI. GENERATOR

Jurgen didn’t go to work the next day; he phoned the office, leaving a message with the virtual female receptionist to inform Dr. Sato that he was ill. Actually he was more tired than sick; all through the night that face had returned to haunt him like a night‐ mare - even though he hadn’t slept. Until the previous night, he had always imagined the bee-machine as if it were a fantasy illustration; a perfectly-rendered computer graphic with clean lines and smooth shading. He had not been prepared to experience the harsh reality; that the creature could be as horrific in appearance as the one which Dr. Frankenstein had stitched together from the rotted cadavers he had wheeled into his laboratory from the dissect‐ ing rooms and slaughterhouses of Ingolstadt, Germany. ‘It's alive!’... Jurgen shuddered. Not nearly... it was a mutant. It had broken the law of nature - if the definition of a species was; entities which could reproduce only with their own type... the consecrated bread and wine. Anything can be faked, or stated another way, anything can be realized, depending on one’s perception... All the truth at once. According to his file, he was due 66.25 vacation/ illness/ non-specified leave of absence days since he had commenced his term of employment. Jurgen had checked. By slipping through the security filters of the GenSynth server, he had gained access to his personal data. He had skimmed through his records and performance evaluation reviews and found nothing there that he hadn’t expected. Then he turned off the monitor then pretty much slept straight through the next 48 hours like Rip van Winkel. He awoke. Not exactly refreshed; his logic was still fuzzy. But with the dawn of a new day Jurgen was determined to accept the unpleasantness of recent events and continue on the best he could. He arrived at his office cubicle, and within moments, Dr. Sato had appeared on his screen. As usual, Dr. Sato’s expression was inscrutable and his manner was restrained; there was no discussion about Jurgen’s absence - his first since he had become an employee. It seemed that Dr. Sato had merely wanted to personally deliver the good news that Jurgen’s new apartment was ready for him. He disconnected by kindly suggesting that Jurgen take a few days off to move his belongings to the new location and take some time to settle in. Jurgen noted the address of the apartment that Dr. Sato had provided and, accom‐ panied by Shozo, headed out to CosmoSquare. The landlord met them in the lobby of a bright new building, bowed politely, then together the three took the elevator up to the 40th floor. The interior of the apartment was a spacious 30 square metres, nicely furnished, with a view that looked across at the nearby World Trade Center; Cosmo‐ Tower, the arteries of highways and streets landscaped with tiny dots of trees far


below, and in the distance, the Akashi Kaikyo bridge and the vast expanse of Osaka Bay. As he signed the lease contract, Jurgen was surprised to note that the rent was 250,000 yen; fortunately it was being paid by the GenSynth corporation. Shozo helped him pack up the stuff back at his old apartment, which didn’t take long; several computers, boxes of peripherals, cables and spare components, reel-toreel/god shrine, dishes, pots, suitcase, clothes, books and his bicycle. Jurgen had simply decided to leave behind his old furniture, items in the fridge, toiletries, and so on... which Shozo at first frowned upon, since it was not the custom in this land. Yet, Shozo's mild protest had been diplomatically understated out of consideration for the apparently still fragile condition of his friend. The move to the new apartment in CosmoSquare took several trips. When that mission was accomplished, the pair decided to take a break and eat some sushi at a karaoke bar. Although, before entering, they had mutually agreed not to talk shop, within minutes they were discussing computers, gigantic bees and biotechnology. This went on for a couple of hours, until later, after they had consumed several glasses of beer they found that they had finally summoned the courage to climb onto the small stage and sing a duet along with the music of some Frank Sinatra songs; ‘Three Coins in the Fountain’ and of course, ‘My Way’. Both Jurgen and Shozo were in fine voice, or so it seemed to them. They laughed and patted each other on the back when the small crowd enthusiastically applauded. Arriving back at the apartment building, Jurgen was surprised to find Kaori waiting in the lobby. ‘A little bird’ had told her the news about the new apartment, she said, although Jurgen naturally suspected that Kaori had conspired with her cousin Shozo. Perhaps because of the tranquilizing effects of the alcohol, Jurgen went along with the game, not even objecting when Kaori, who had just taken a cursory look around the apartment, playfully begged; “I want to live here with you.” Assuming that his lack of response meant ‘yes’, Kaori immediately convinced Shozo to help her move also. Jurgen didn’t participate in the process of hauling Kaori’s accumulated worldly possessions up and down and along a network of corridors, elevators and city streets; a move from one building to another, which lasted the rest of the afternoon and well into the evening. And he didn’t even seem to notice the gradually increasing accumu‐ lation boxes and garbage bags that intermittently piled up in the entrance hall and spilled into the livingroom of the new apartment; he had more important matters to attend to. His first priority had been to set up the computers, check out their operating system, and ensure that his creatures were still residing in its memory. Jurgen was particularly proud of the prototype computer that he had designed and built from a collection of various commercial and custom hardware purchased through a corporate account that Shozo had set up for him at GenSynth. The culmination of the combined applied effort of his intellectual ability, technical proficiency, and labour during the past year had resulted in a unique experimental computer; a multistate device that carried out its operations on data stored as variable voltages. Rather than the binary states of standard digital devices; in which a charge is either totally present,


or totally absent - on/off, black/white, Jurgen’s computer functioned with stored degrees of charge, i.e. not ‘1’ or ‘0’, but ‘.2256’ - analogous to a scale made up of shades of grey. The computer used a special floating-point unit to translate this energy variance into a stored distributed array; an array which was also sampled by the floating-point unit once again, to determine the percentage of change, when called up by the processor in executing program instructions. The purpose of this subtlety was to permit the creation of digital creatures that were more ‘organic’, due to the finer resolution which distinguished the differences between each individual entity’s internal logic structure. While his older hardware was relegated to a long shelf built into the wall, Jurgen decided to arrange the components of his new computer on a low table in the center of the living room. The computer itself was encased inside a perfect cube, 35 centimeters on a side; a dull blue-grey metallic chassis that had been fabricated by a neighbour‐ hood machine shop to his specifications. In front of the computer was a data entry pad, and above, clamped to a slim, hinged supporting arm, floated the flat screen display. Next to the table stood a rather large, standard commercial Zentron memory storage array; ultramatte black, which sent and received signals through a fibre-optic connec‐ tion. The final piece, which completed this collection, was the one Jurgen had consid‐ ered to be his system's most important part... Jurgen unpacked a small wooden crate. Neatly stored within the padding was the only component of the Stark’s old TRINIAC computer that he had decided to salvage. The massive machine would remain within the cocoon inside the workshop in Izumi-fuchu; Jurgen hadn’t known what else to do with his monument to an experiment that had failed. The battered black box, that Jurgen had carefully extracted from the small wooden crate, was an electronic device known as an All-Code Data Synchronizer. It had originally been designed to check for errors in the signals being input to, or output from the TRINIAC; ensuring that the signals were locked in synchronization with the computer's internal clock - the heartbeat guiding the computer’s rhythm as it processed sets of instructions. Filters inside the black box also removed the noise of digital pollution which degraded signals and introduced content errors. Jurgen situated the Synchronizer on the table, connecting it to the fiber-optic pipeline as an intermediary on the data path between the computer and the Zentron memory storage array. Jurgen believed in its magic; it was a completely unscientific notion that this battered black box with a few lights, knobs, and switches on its face plate, could be a talisman or token, but since it had originally, only, and last been used to filter the code that had been written by Adda and Cameron, Jurgen believed that the device continued to contain some essence of their spirit. When the positioning of this arrangement had finally achieved perfection, Jurgen knelt before the assembly on cushions he had placed on the floor. He looked ahead then, past the display monitor to contemplate the ocean view through the balcony doorway; calming his mind with a few moments of reverie. He then switched on the computer...


The shorn hair had started to grow back, a little mustache, and a goatee; the focused intensity of his face had been captured in the cool light of the glowing pixels trapped behind the glass surface of the display screen. These creatures, pretty little arrangements of coloured light, moved gracefully, pure and beautiful, growing and evolving inside the digital aquarium. Unlike the mutant bee baby, the only similarity between his creatures and the monster from Mary Shelley’s story, was that electricity was the primary energy which gave the creatures life. They were constructed of energy and survived by consuming information; they lived and died by the code. Once Jurgen had determined that everything in the system was up and running, he began testing recent modifications to the algorithms which produced entities with an upgradable, reprogrammable data structure. The key to the entire process was a software engine called ‘generator’, the only program on his prototype machine; the computer and the software each having been custom-designed to specifically suit the requirements of the other. The generator functioned as a data pump - the system’s primogenitor, creating unique genetic algorithms for each of the entities like the shimmering nucleus of some digital protozoan soup; the primordial concoction from which all lifeforms sprang forth. The large flatscreen display functioned as the graphi‐ cal interface to the generator; at his touch icons unfolded becoming windows on the screen, emulating sliders, adjustable tri-dimensional graphs, numerical entry pads, text fields, and so on... with which Jurgen could adjust the variables specifying both the form and function of a new creation - tuning these parameters with a very high degree of refinement. The objective was to achieve perfection. Entities which were efficiently-designed, better-adapted and more durably-constructed than any other data existing within the network had their chances for survival greatly improved. Jurgen maintained quality control by intently watching over the fabrication process at every stage along the assembly line. Should an entity inadvertently incorporate incorrect information or develop an error in their structure, their existence would be terminated in the magnetic field generated by a flying erase-head passing over their memory storage location. Initially, the information contained in the main body of an entity’s code was roughly equivalent to the DNA of a biological virus; approximately 50k. While an individual entity would never grow much larger in size, its ability to link and exchange messages with other entities in the network would begin to emulate the code equivalent to a creature the size of an insect, then a small animal, and eventually the complexity of a human brain... It was fascinating; Jurgen never ceased to be amazed at the humanistic qualities that these little packets of data seemed to personify. Each entity was given a specific set of instructions from a wide range of variable code, consisting of parameters which determined their initial behavior, such as; aggressive hunters, joiners, helpers, followers, builders, etc.. Once they began to interact with other entities, the characteris‐ tics of a society began to emerge. For example; ‘joiners’ seemed to wander around almost timidly at first, avoiding the more aggressive types. Eventually they would find a


‘leader’ around which other entities of a similar constitution would begin to form an alliance. Thus by banding together to form a dynamic presence within the virtual world, each individual began to become much bolder in its actions. While most entities preferred to remain autonomous, and travel on their own, occasionally they would partner with a complimentary type of entity to create a temporary symbiotic relationship, the purpose of which was not intended to reproduce their code. Jurgen dutifully recorded his observations about the characteristics of every creature in this kingdom; describing their interactions in minute detail into a microphone clipped to the collar of his T-shirt. During the past few months Jurgen had designed several thousand distinctive units of life that were arranged within a biological hierarchy; kingdom, phylum, class, order, family, genus, species. He had decided to name them in a manner similar to the way astronomers designate numbers identifying celestial objects within a star catalog: G42-7, J99-4, Z22-7... And this batch were a hardy bunch of survivors; several having already lived for nearly a century within their virtual environment. Since the software was designed to emulate the expansion or contraction of time; in relation to the human perception of chronological time, a creature’s entire life span could be viewed within the duration of a certain number of the computer processor’s cycles. As their creator, Jurgen recognized that it was his ethical responsibility to test each entity thoroughly under the ‘laboratory conditions’ within his own computer’s enclosed environment, since once he had perfected their structure, each entity in their final version would be released into the wild. Within the almost endless memory fields that existed at every moment among millions of computers continually communicating with each other on-line, each compact, self-contained entity, similar to a tiny seed, would perceptively discover a favorable digital terrain in which to take root, flourish by selectively accessing data, then finally, spread its brood. As a result, he had naturally implemented certain guidelines written into the kernel of their code, to prevent them from running rampant within the neural architecture of cyberspace. The guidelines were software instructions which governed the entity’s behavior and determined its code of conduct; a set of ten ‘commandments’, encoded in machine language and integrated into their fabric. The instructions created an awareness within the entity; a consciousness of itself and of its surroundings, in the form of a list which the entity cycled through once during every time-step. If it happened to discover a situation in which two rules came into conflict, then the one further up in the table (list) automatically took precedence. In its interaction with the environment, the rules instructed the entity that its first priority was to inhabit ‘virgin’ territory; unused by a computer system, and that once it had taken up residence, it was to continually monitor the storage capacity of its immediate surroundings to ensure that available free space did not diminish past a predetermined threshold - if it did, the entity was then instructed to migrate to a new location. The entity was reminded to remain invisible by consuming a negligible amount of system resources, and when it replicated, it was to produce only self-


contained offspring whose survival was not dependent on attaching themselves to a host. It was to make itself aware of the number of instances of similar entities within an environment; if the population reached a predetermined density, the entity instructed itself to either migrate or terminate its existence. If one of Jurgen’s creatures encountered another entity within the network, its internal code would be evaluated to determine its identity. Since those creatures spawned by the generator; or who were descendants of those who were, bore a distinguishing tag embedded in their code, it could be quickly established whether the other entity encountered was a friend or foe. Once the identity had been established, the instruction list would provide reference in determining a response: other versions of a species would be queried to verify the integrity of their code, and depending on their status, they could either be ‘upgraded’ through the transmission of more relevant data, remain undisturbed, or in a situation where an irreparable error was detected, they would be automatically removed. In a similar manner, entities identified as harmful computer viruses would be immediately disabled or destroyed. The last few instructions in the list created a feedback loop which the entity cycled through to maintain optimal performance; evaluating its own fitness in effectively integrating new code. This loop also provided it with a method of verifying the code structure of its offspring during the replication process; acting as a checking mecha‐ nism to ensure that random corruption had not occurred. Jurgen lapsed into reflective thought ... the graphics flickered on the screen; not the actual entities but merely a visual representation of them as spacial-encoded vectors... He was contemplating one final issue that had yet to be resolved: determining an effective external means of terminating the existence of perhaps six billion entities, roaming through the network one day in the future ... should the need arise. He had already considered several alternatives for the fail-safe mechanism but had yet to decide which technique to implement, if any. One option had been to predeter‐ mine the life-span of the entities; five minutes, five years or fifty years, whatever... programming their code to check the date by referencing the operating system, or possibly having the mass auto-destruct sequence initiate if a certain specific event or events occurred. Perhaps a more elegant approach would be to conceive of a canonical magic word; a secret password which the entities could discover on the system. Each entity would carry a portion of a strong encryption algorithm which would act in 'lock and key' fashion with the magic word; authenticating the key phrase by some mathematical or cryptographical means, and matching it to the code-word which the entity had retained like a primal memory deep within its core. On the other hand, Jurgen thought, instead of acting as the angel of their destruction, perhaps the magic word could trigger a global convergence of all the entities, comprised of trillions of little fragments spread across the digital universe, each communicating with every other one of its constituent parts, every few milliseconds, in order to create some type of massive digital manifestation...


The sound of something crashing through the door suddenly diverted his attention. Still sitting on the cushions, Jurgen rotated his body 180 degrees to observe Kaori struggling through the entranceway of the apartment carrying an armload of garbage bags; the last of her belongings. They both looked exhausted, especially Shozo, who faded into the background. “I am so happy,” Kaori exclaimed as she ran over, dropped to her knees, wrapped her arms around his neck, and rained kisses on his cheek. Jurgen smiled but his thoughts seemed elsewhere. When he looked around; Shozo was gone. “What’re you doing?” Kaori now inquired. Her eyes were dark and tired. Perhaps to ingratiate herself with her new host she feigned interest in his work. Yet, Jurgen was very appreciative; it is always nice when someone is curious about what one is doing, even if their attention is not completely sincere. “Well...,” Jurgen decided to use an analogy to describe the concepts behind his work, presented as a narrative which he believed would make it easier for Kaori to comprehend: “Once upon a time,” he began, “little packets of energy were released as a series of bursts sent out from another solar system somewhere, orbiting a distant star. The energy packets travelled through the clusters and constellations of data, eventually arriving at a planet by random chance... and let’s say that the planet is Earth. It turns out that these energy packets are actually a rather tiny alien species which are able to take on various forms appropriate to the system they wish to inhabit. Imagine that a few of these aliens, arriving on Earth, get together and take on the shape of the first form of life they discover... say, an insect.” “An insect,” Kaori giggled, complying with Jurgen's request. “Funny... so, they wander around for awhile, surviving by utilizing the resources that they discover on the planet,” Jurgen makes the sound of something chewing a leaf, “gnarrr, gnarrr, gnarrr...” “Some time passes and they discover a species called Homo Sapiens. They decide that they want to assume that form because it seems more interesting than being a bug, so they get together with others of their kind; who have spent their time on Earth so far busily procreating, and pool their energy resources to assume a human form. They come up with a reasonable facsimile of the human’s physical design, but it takes a little while before they can convincingly assimilate the mannerisms. Of course, this leads to a series of humorous misadventures in which they startle the other humans they encounter with a display of inappropriate behavior. Eventually they begin to act normal and blend in with the crowd.”


“These alien entities have an innate need to be mobile; they feel that if they stay in one place too long their true identity may be revealed. By gathering information from their environment they soon discover that they are able to move around the world very quickly if they travel by airplane, so they hop on a jet, and on a whim, disembark at a random airport; it doesn’t matter which one because after awhile every airport seems the same to them.” “If the security is not too tight they manage to clear customs and hail a cab, then immediately head downtown, right into its heart. They wander around the dense computer architecture of system city for awhile, searching for a place to stay. They usually quickly manage to find a location that is not being occupied, and when no-one is looking they take up residence at a discreet address somewhere on ‘Memory Lane’.” “The aliens, for the most part, tend to keep to themselves, but they do occasionally venture out to gather data about their surroundings. They sneak around at night when the city is less active, always making sure that they are not followed and that no human being ever discovers their address; they would be in for trouble if their existence was detected, since they never pay their rent. Other aliens, though, are able to find them very quickly when they arrive in town, since they can read the hidden messages that have been used to mark the dwellings of the squatters. When these aliens get together, the first thing they want to do, if they are compatible, is to jump in the sack and procreate until the sun comes up.” Kaori, now resting on the cushions let out a gentle moan. “It’s actually the only thing they ever want to do, other than traveling. It’s more than their job, it’s a way of life,” Jurgen added in a cartoon voice, then continued, “During their travels they accumulate little souvenirs; pieces of coded knowledge which they believe will increase the chances of their own survival, as well as make them attractive to a mate.” “When a couple generate offspring, the children inherit the inherent blueprint common to each of their parent’s original code. As well, they inherit a few selected pieces of this accumulated information, which is sort of like advice that their parents pass along to them. For the parents, an awareness of the current conditions within their environment will determine the number of children they produce.” “The children head directly to the airport the moment they are born. The parents go their separate ways, new aliens come to town, and...” Jurgen suddenly noticed that the description of his project had the same effect on Kaori as if it were a bedtime story; she had drifted off to sleep on one of the large cushions on the floor. So Jurgen ended with, “...and they lived happily ever after.” He carried Kaori to his bed, tucked her in, then returned to the living room. Turning off the lights, he caught a trace of the city skyline streaming in through the balcony


window. He slid a memory stick into the player... Voice in the darkness, ”Okay, here we go...” Quiet in the background; electronic Big Band style music, synthesized with heavy metal... All right. He’s ready to get back to work again ... what the f... the deadly BLACK SCREEN. A short video clip, recalled from somewhere, quickly flashes through his mind: Fade up on... computer generated urban scene by night, viewed from above. The camera flies through the virtual landscape, moving in quickly toward one of the tall apartment towers. The camera shatters the balcony glass and falls to the floor with a loud bump. The view askew from an angle on the floor of this very room... the screen freezes. The computer has crashed. "Shit!" Reboot. Computer lock was a relatively infrequent occurrence as Jurgen refined his hardware configuration. Sure, occasional software ‘bugs’ appeared when the program tried to execute a command line which was outside the expected parameters of the instruction set, but they never hung up the system like this. He was certain that one of the internal components had failed. Before he assembled the computer, he had taken the time to shop around for the most reliable hardware, and he believed he had chosen wisely. But this was a common problem which, he had often noted in the past, had arisen from pushing a system to its limits. Jurgen blamed this failure on the blatant disregard for design specifications and the cost cutting methods of motherboard and component manufacturers; large industrial plants which employed an underpaid work force to crank out substandard hardware to keep pace with an impossible demand. Jurgen opened a plastic container. He tilted out two of the small deep blue capsules; each imprinted with tiny unique white serial numbers, onto the tabletop next to his data entry pad. He contemplated the situation for a moment, then popped them into his mouth, swallowing dryly. This was the new stuff, experimental prototypes direct from the laboratory; General Synthetic’s chemistry lab which constantly discovered innovative ways to create new compounds which were not found in nature. This stuff wasn’t on the market yet... maybe never would be, but it got the job done. Although side effects, like digital glitches in his thought process, had begun to occur at intermit‐ tently increasing intervals... > 12 Midnight. 7gi3TgE. Rain falling outside now, behind the glass; invisible in the darkness. mk04. Outside is Japan, but it could be anywhere. hjr8. Just the sound of the tiny drops shattering. ZW50IDxkd. Headlights of cars moving through the streets. Traveling along the path. mAy6vH8AAAJ7xUz. Refinement of process. 5nGFuZ2Bios: C451 + CK 1VudEBk. Encapsulated in soft wires, pipelines of data. DfoV68voLOonR. To be. 2yXL0rnoT. 2B a hacker is to question. XvhUWp, to want knowledge. D224, OS 50-37.423. Hacking is the path. BiB6+code find the answers for yourself. ===--Sometimes the medicine was a little too much. Fortunately the symptoms would not last long; usually just during the initial wave, when the rush kicked in. It quickly dissipated, as the force of the breaker, metaphorically, returned to the sea; smoothing the sand and leaving behind a beach momentarily cleansed and pristine.


Jurgen splashed water on his face. His new washroom was still unfamiliar to him; it was tiny - everything folded out from the wall when it was needed. The ceilingmounted shower head was designed to swivel so that it could wash the entire room, which was encased in stainless steel. The toilet was a hole in the floor. Sensors somewhere down the tube could take urine samples, if desired, and display informa� tion about the health of the occupant on a small waterproof display mounted on the wall. Jurgen studied his reflection in the mirror; it looked like the face of an old friend that had been burning the candle at both ends. Whatever that means. It was a face engraved with dark lines encircling lower eyelids and patches of red veins pushing through to the surface from beneath its pale skin. He entered the kitchen to make some coffee to soothe his rattled nerves; caffeine, the oil in the veins of the machine, Jurgen thought, returning to the living room to take apart the chassis and get inside its guts. The concentration of his work drew him back into focus again, wiring the machine back to functionality like a robot working on the assembly line of the factory. Spare components in cardboard boxes, swapping out the parts, reconnecting it, soldering a wire here and there, onto the primary core, to resume full functionality. Stack pointer. Accumulator. Register. Address of the memory locator. Interrupt mask. The execution of an instruction. Cold logic. Factored facts. Permutations... Sitting in an upholstered chair beside the wooden kitchen table. Clouds drift past the balcony window. And as the sun rises through the mist once again he approaches a State of Grace...

XVII. SAYONARA

While the discoveries and the progress that he had made during his personal experiments within the digital world were rewarding and fulfilling, his ability to interact with life in the real, physical world had continued to seriously disintegrate. It was March and the blossoms on the Cherry trees were coming into bloom. He hadn’t noticed their beauty along the avenue, nor even the ferocity of the dogs which continued to chase him nearly every day as he rode his bicycle to work. People on the street, in the food market, or even at the office continued to stare at him as if he were an alien, a foreign intrusion, or strange apparition. And with a few exceptions, he had rarely felt welcomed or had experienced any real warmth or kindness since he had arrived in this land.


More frequently now, it seemed, he came into conflict with GenSynth managers who admonished him about his lack of performance, his choice of attire, or occasionally caught him chewing stress gum in the hall. Of course, Dr. Sato still continued the torture of subjecting him to his egotistical persona, and Jurgen certainly had become increasingly-concerned about the strange denizen that inhabited the office across the hall; the one who daily practiced his meditation on death like some crazed, high strung Samurai. The project itself; to build giant bees, was still constantly beset by a series of delays, set-backs, and changes in direction; he didn’t seem to be making any progress. As a result, his loss of initiative triggered further ‘deficiencies’ in his perfor‐ mance; cascading into a downward spiral. Often he wondered to himself what reason he had to remain in Japan if he found it more difficult to continue working on the project which provided the purpose of living in Osaka. True, he was still going to work, but it never really felt like he was actually there anymore; present in mind and body, but not in spirit. And he was intensely aware of where his spirit had gone; it had already packed its bags and flown off to the wilds of Iceland, where he recognized that soon his mind and body should journey to join it. Of course, the major complication in the graceful exit he had scripted was a fragile, sweet, beautiful little girl who her parents had named Kaori. So far he had kept his plans a secret, waiting for an opportune time to tell her, but as that moment was continually postponed, his anxiety proportionately increased. He tried to sort out his thoughts, but found it impossible to rationalize love; to format the logic of that emotion or even simply determine how he really felt: Perhaps he didn’t love her, or maybe he had just grown accustomed to the convenience. Perhaps he knew how much she believed in the dream; that they would be together forever, that he just couldn’t bring himself to destroy it. When he thought about it, it was amazing - he really had it all; a woman who loved him, a well paying job, and an apartment in the sky overlooking CosmoSquare. Sometimes he wondered what it would be like if he had all this with Coraline; where was she now? She seemed to have lost all contact with him... Kaori would never be able to understand how he could consider giving all this up. She belonged to a culture in which the notion was ingrained that individualism brings shame. Selfish, selfless, self-conscious... Lately he had often felt lonely. He regretted also that the friendship he shared with Shozo, and especially Kaori, had never been able to span the superficial barrier that he, perhaps even subconsciously, had constructed around himself which maintained a distance between them. They had provided him with plenty of opportunity to tear down that wall, but he still continued to prioritize his work above the time that they could have spent together as friends. He was aware that they didn’t really seem to appreci‐ ate the significance of the project that he was working towards, although he had often tried to explain it in terms that they could understand. It could be that the concept was too abstract, or maybe they just weren’t interested; it was difficult to tell. Their reaction was understandable, since, even for him, the ideas continued to remain complex and amorphous. It took the full effort of his concentration to bring them into realization; many of the concepts he was researching still existed only as thoughts


inside his head, and would continue to remain intangible until he had discovered some way to record the information or capture the data in some format that could be reproduced. He had always believed that this calm, passionate search into the nature of artificial reality had been a path that destiny had set out for him to follow. Yet, where that path was leading, or how long it would be before he reached his destination was still unknown. It was a matter of time; time that he needed to perfect his experiments, time that he could spend by himself far way from the distractions of another life that had imposed itself upon him. Sleep. Awaken. Return to work, then back home again. Back and forth, back and forth. Kaori, a hot meal waiting when he arrived; it was just like being married - and typically, even the passion had diminished in their lovemaking. Jurgen continued to devote most of his time to his project, alone at home, subsequently Kaori went out every night with her twin sister or her friends. Empty apartment again this evening. Jurgen was kneeling comfortably on the cushions arranged before the display. He was grateful for this period of uninterrupted time so that he could enjoy his new appliance; recently acquired from colleagues who worked as neuroscientists within a GenSynth lab. Jurgen slipped the soft helmet over his head; interwoven into its fabric were 124 EEG electrodes; a network of electromag‐ netic encephalographic sensors placed against his scalp which could detect the neural activity taking place inside his brain. It was his intention to record the output signals obtained through these sensors and store them in a digital format within the Zentron memory array. This process had already been achieved in the laboratory; capturing signals from within tiny bees, and by working together with Takako, they had successfully managed to transform these signals into algorithms which created a simulated model of the insect’s entire brain. While the social pattern and activity in the lives of bees was determined by rigid, hereditary instincts, Jurgen believed that by scaling up the software to accommodate a very much higher order of magnitude, he would capture and reconstruct the complex signals emanating from within the electro‐ magnetic network inside his own human mind. The objective, of course, was to translate this information; the content of his thought, into data which the generator could directly integrate into the code of digital entities in order to fabricate a more sophisticated design. If the process was successful, Jurgen thought, in addition to just providing them with instructions, as he had in the past through their on-board programming, each entity would also retain a fragment of Jurgen’s memories, ideas, hopes and dreams and fears, and perhaps these refer‐ ences would be recalled and exchanged occasionally when the entities interacted and communicated with each other as they advanced along the path toward a higher state of evolution. Perhaps, he also thought, this process of neurogenesis would create a code of reason within the synthetic creatures which ultimately could lead to the development of some form of universal collective consciousness. After all, the process of development; memory, reasoning and communication - those qualities which manifest themselves in traditions, literature, science and art are dictated by biological necessity; the need for an entity to influence the lives of others, as well as contribute to


their own sense of well-being. Connected to the pipeline, Jurgen monitored the data streaming into the system through an optical fiber. A 3D model, represented in very high spatial resolution, rotated on the screen; temporary local totalities - the frontal, parietal, temporal and occipital lobes, the cerebellum, basal ganglia, the anterior region of the hippocampus and the fissure between the hemispheres - a constantly flowing movement of electrical activity that changed every few milliseconds, mapped as patterns of bright orange, yellow and red which swept through the structure, expanding and dissipating like clouds in a time-lapse satellite weather map. As he watched the display, Jurgen became aware that there was a hidden order within the rapid fluctuations of this dynamic process that had yet to be revealed; perhaps the complex swirls in nested patterns of energy interactions, apparently disordered and chaotic, contained the essence of the consciousness enfolded within the hierarchies of its structure, similar to the manner in which charged particles migrated within a thunderhead, or subatomic particles were able to communicate with each other instantaneously within the quantum potential that pervades all space, as if they were alive. His challenge would be to learn to focus the weather patterns, directing the processor to sample specific portions of his brain by controlling his thought processes and develop software which made use of the elegant language of mathematical algorithms to reduce the complexity of these signals into simple, precise expressions which could accurately be recorded. It was not impossible, he thought; and that thought immediately registered on the computer-generated model revolving before him on the screen. He laughed, because of this perception, and interactively, the energy pattern shifted once again. He then experimented by entering into a meditative state; decreasing his brain activity to achieve a lower load-rate on the data streaming into the machine. For awhile he was aware that the shifting forms and colours on the display screen began to stabilize, but as he approached that floating-point awareness vaporized... ... Kaori came rushing into the apartment with some friends; everyone was giggling and high... how much time had passed? Later, he lay beside her in bed, after she had fallen asleep. The same thought returned again; the thought that had been continually repeating during the past few months like an endless cycle in his mind. Tonight, as every other time, the only conclusion obtained from this thought process was a decision not to tell Kaori about his master plan. It would be better that way, he assumed. He had arranged with Dr. Sato to take a leave of absence from work, and Dr. Sato had immediately consented, noting in Jurgen’s employee file: “Due to the ‘fragile’ nature of Jurgen’s current mental and emotional state”. It would be a summer vacation,


during which time his wages would be paid by GenSynth. Jurgen had mentioned that he planned to travel to Germany to see his mother, but aside from that, no other destination had been specified. And, of course, it was expected that he would return to work at the end of August. Jurgen crated up his most essential computer equipment in compact shipping cases; the prototype computer, Zentron memory storage array, data-entry pad, flatscreen display, and most importantly; the All-Code Data Synchronizer. Later, a pair of FastAirFreight delivery; dressed in their familiar electric-orange coveralls, arrived to transport the cases to the airport. Determined not to disclose his ultimate destination to anyone, Jurgen specified that the shipment be directed to Munich, Germany. Kaori was concerned. But Jurgen had just mumbled something about it being likely that he would find some time to continue with his research work during the vacation.... his voice trailed off into silence ... he felt as guilty as hell about lying to her... and of course she wanted to come with him... she wanted to meet his mother... and all that had unspokenly implied. No, Jurgen shook his head and gently smiled, not this time... it would be better if she remained to look after the apartment. June 22, 2010 It had been a long night. The last supper with Kaori, Shozo and about a dozen other friends and colleagues continued at a restaurant into the early morning hours. Since it was his birthday, Jurgen drank considerably more than he had intended. It felt good, at the time; the alcohol seemed to numb the emotional overload, creating a state of equilibrium between the oscillating intensity of joy and sorrow that had flooded in to overwhelm him. When they arrived back at the apartment, Kaori kept a vigil with him throughout the night as he packed and addressed the last minute details of preparing for the trip. When she wasn’t looking, he secretly placed the Venus flytrap into its terrarium case and slipped it into one of the cardboard boxes he would ship with him on the plane. At dawn they had taken a taxi to the airport. Kaori had wept softly during the entire trip. He held her silently in the back seat as the cab wended its way through the maze of streets and highways. He didn’t know what to say. He had already left Japan in his mind; he had been preparing himself for some time and it was an odd sensation, sometimes, to discover that he was still there. Right now he just wanted to press a button and automatically beam out. He could deal with it, but Kaori didn’t seem to want to. At the departure gate they kissed and said good-bye. He couldn’t promise her anything, that would not be true.


part four

I. SOLLA

The oxidized remnants of a copper-wire grid were still arrayed on the ground. Rust coloured lichens had claimed a home on islands of soil that had drifted between smooth, dry, black streams of hardened lava, streaked across the rugged, barren terrain. The distant mountains were cut through with sharp, clear glacial fields which swept down their sides leaving behind a vast moraine of rough-hewn rocks that had been deposited at the base of the mountain when the ice had retreated. He took in the view, peering through his round wire-frame sunglasses. The landscape was spectacu‐ lar in its stark beauty, Jurgen thought as he urinated onto the ground. He zipped the fly of the ancient, faded blue flight coveralls that he had found in one of the abandoned buildings. His collar-length hair, unkempt, was blowing in the perpetual breeze that swept over the landscape. He had given up combing his hair or shaving since he had arrived on the island, although he usually kept his hair tied at the back of his head with a rubber band. His figure, a thin, vertical stripe of blue, contrasted the immense fields of muted greys and browns; the horizontal planes of the tundra, mountains and sky which created the panorama surrounding him. During these moments, alone in the vastness of the landscape, he would often reflect on the reasons why he had chosen to pur‐ posefully separate himself, both physically and emotionally, from the people that he had cared about by transporting himself here, to the edge of the world. Perhaps he had needed the tranquillity of this barren terrain in order to isolate and examine his thoughts and feelings; to re-acquire the sense of self and purpose that he had lost in the chaos of the inhabited world. Perhaps he had needed the peace of mind to put the cultural turmoil behind him and rearrange the components of his life into some logical order. The pursuit of this personal quest was a path that he had to walk alone. In order to reach the destination of the journey, he would need to dedicate the time to concen‐ trate on his work and commit his entire energy to the challenge of overcoming the obstacles that had presented themselves to him. True, he had become disillusioned by his recent experiences in the world, yet at the same time he was aware that he had been an active participant in the events of his life, not the victim of circumstances that had been foisted upon him. It hadn’t been easy becoming acclimatized to the silent desolation of his new environment after the frenetic hustle of activity in Japan. Sometimes when he closed his eyes, he could vividly see images of the crowded street scenes in Osaka; the faces staring at him, the


massive density of buildings, advertising signs, the metal array of transmission towers and electrical power grids, and the sea of umbrellas reflecting off the rainy neon sidewalk. When he opened his eyes, the image would disappear leaving only the vacant earth and sky. Perhaps the self imposed exile was a form of penance; a way for him to absolve the feelings of guilt for the role he had played at General Synthetics. In the process of delivering technological developments in the field of genetic synthesis, he had become privy to classified information, which would likely never be made available to the general public. The files revealed a concept of the future that he hoped would never come true. His own research work, contracted to the company, would play a role in bringing about changes to society, which if not implemented responsibly could ultimately cause irrevocable harm. He turned around to study the remnants of the small dilapidated shacks huddled along the edge of the runway of the abandoned airbase that he now called home. Grasses and weeds had grown up through the cracked asphalt of the landing strip. Over the years, rust and frost had attempted to reclaim the buildings and dissolve the wreckage of a World War Two era fighter plane; a Hawker Hurricane, that for some reason was parked at the end of the runway. The tattered remains of a wind sock rattled from atop a tall weathered pole; red and whites stripes, paint cracked and faded, bleached to pale shades by the wind and the sun. The wind rustled the fabric of his coveralls as he walked along the runway, past a scene that had changed little since its first impressions were etched into his mind. He now recalled the sequence of events that had led him here, deep in the heart of Iceland... He had boarded a Jumbo Jet in Osaka then traveled back in time to Munich; across Korea, China, Mongolia, Russia, and Poland - returning to the point of origin from which he had originally departed for Japan, thus completing a circumnavigation of the globe. From Munich, the train carried him to Eigenvalue, where he spent two weeks with his mother. During the interval he had been in Japan; from November 2007 to June 2010, their relationship and individual personalities had shifted in ways which were much more evident to Jurgen than they were to his mother. She had simply welcomed him home, accompanied by a display of great affection, then immediately tried to recreate the familiar atmosphere of his youth by pretending that he was still a child. It had been difficult for Jurgen to even recall the established patterns of the past in order to play this pretend game but he had tried his best since he had not wanted to hurt his mother’s feelings. On a couple of occasions he had borrowed his mother’s car; an older Marathon that was nearing the end of the race, to drive around town and gather up the supplies that he would need while he was in Iceland. Everywhere he went, roaming the sidewalks


and gathered within shops, were the familiar nameless faces. They all looked the same, and to Jurgen, they had somehow seemed mutated and ugly; all fleshy and pale compared to the ones, he had realized, that he had grown accustomed to seeing in Japan. Even the language, his own native tongue, sounded foreign to his ear, making it difficult to communicate or to conduct simple business transactions. One afternoon Jurgen had phoned Uli Wahl, who then contacted a few of Jurgen’s other old friends; getting them all together to drink beer in a tavern. The evening was pleasant, but as it progressed, Jurgen discovered that he no longer had much in common with the others; they were all married or divorced, had children and a job in the town, but they didn’t have any dreams of the future. As the beer continued to flow, and they exchanged stories, Jurgen had tried to tell them about some of his experi‐ ences in Japan or Hawaii. But as they politely listened, they all just kind of stared at him blankly as if his words didn’t make any sense. So once again, as he often had in his youth, he kept himself confined within his mother’s home. The sense of nostalgia flooded back in waves; the artificial wood paneling, the patterned wallpaper in the kitchen, the antique plaque hanging on the bathroom wall; ‘Ve git too soon oldt und too late schmart’, the television set from the previous century, and the various childhood memories which were still arranged as he had left them on shelves surrounding the vintage 2002 Macintosh computer in his former bedroom. The computer still had a modem that worked; the high pitched squeal as it connect‐ ed to the phone line was like a familiar voice from the past. It was adequate for his purposes, facilitating a process which consumed most of his time in Germany: He dialed around, routing the calls through a reliable network of alternative relays, tracking down and ordering a Frankensteinian collection of parts and pieces of technical equipment; all of the resources necessary to complete his mission and to assemble what he thought of as his laboratory in Iceland. By the end of two weeks he had scavenged an accumulation of odds and ends from sources all over the world; solar panels from Malaysia, various biotechnology and medical equipment from the USA and Belgium, cases of food from Germany, computer hardware from India, transformers, batteries and so on... Roving from one on-line pharmacy to the next, he also ensured that he would have plenty of medication, since he would be a long distance away from any health care facilities in Iceland. Besides, a large proportion of the items on the list were customized pharmaceuticals from Black Clinics; highly specialized manufacturing sources. Jurgen directed his suppliers to send all of the shipments directly via air express to Reykjavik. He ordered more of everything than he needed; to ensure that a sufficient quantity of what he actually required would arrive. Everything was billed to various General Synthetics accounts that he had noted before he left Japan; accounts from which Jurgen transferred small sums to various suppliers in Israel, Finland, Colombia and the Netherlands... Although he had his own personal credits banked in several accounts around the world, he liked the idea the GenSynth would pick up the tab. He


considered it to be a fair exchange for the thousands of overtime hours that he had worked and had never been compensated for. Of course he hadn’t been requested to work the extra time, it was just that, typically, whenever he worked on a project, it was assumed to be an unspoken requirement by the corporation; the commitment of extra time as an expression of the employee’s devotion. The amount of the credit transfers were small, therefore almost undetectable. Jurgen took advantage of the reality that, at some level, accounting becomes virtual and abstract; a system that was easy to manipulate and fully adjustable since its reality is expressed only in terms of money numbers. Yet, although his anonymity was assured by several layers of encryption, numerous pseudonyms and a maze of relay stations, Jurgen was nervous and occasionally followed up the transactions to determine whether GenSynth had attempted to take any measures to cancel them: the data representing illicit transfers flashed across his screen... Approved! Jurgen could breathe a sigh of relief. It became vitally important to Jurgen that no one discover his location, not only because of the questionable financial transactions, but primarily because he wanted to remain invisible until he had sufficient time to set up his experiments and determine if they would be successful. To assist in thoroughly erasing his trail, on the day before he left Eigenvalue he drove to a refuse site out in the country and set the Macintosh on fire; if someone did take the trouble to unravel the trail and track the calls to the source, he wanted to make sure they wouldn’t find the evidence at his mother’s house. He was well aware that when a file is deleted, or even when the hard disc is reformatted, the only thing that the operating system usually erases are the names of the file and any pointers to the location of the data on the disc, leaving most of the forensically useful information untouched. At the end of two weeks, when he said farewell to his mother, his explanation; that he was returning to work in Japan, was so convincing that he had almost begun to believe it himself. At the moment, his father was the only person in the world who knew of his destination, and even to Jurgen, the fact that he was heading to Iceland didn’t really sink in until the plane was already on its way. The jet landed at Keflavik Airport. The realization that nearby; on the adjacent military base, was the runway which had launched Cameron and Adda Stark on their journey into the mysterious unknown. It was with mixed emotions that Jurgen departed from the plane and first made contact with the soil of this land; his profound grief tempered by a sense that the undaunted, inevitable spirit of the Starks had finally returned home once again, embodied within the physical form of their descendant. Jurgen retrieved the computer hardware which had accompanied him as baggage on the flight arriving from Munich, then loaded the small shipping containers into the back of a taxi van parked outside the terminal. In a hybrid dialect located somewhere between Icelandic and English, the driver entertained his captive audience with strange true stories and fragments of folklore during the forty minute drive from the


airport; rapidly speaking of many things which his passengers would never under‐ stand. At one point, the driver had explained that the broad expanse of the island's interior beyond the rugged mountains were considered the haunt of 'utilegumenn'; outlaws fleeing revenge. Yet, he had declared, they would not ultimately escape since the land was inhabited by a divine being whose skin was like ice and snow. It existed on mist and steam as it roamed beyond the limits of the mortal regions and wherever this spirit gravitated it could ward off corruption from all things... “That is why the people call it nonsense and why they do not believe.” Through the windshield, steam rising up from Laugardalur hovered lazily over the black volcanic landscape, shrouding the faces of the mountains in the distance, before drifting out to dissolve into the cold, brutal ocean that hammered against the rugged shore. Soon the city was revealed. As the van approached Reykjavik, the driver vaguely gestured toward a foggy apparition in the distance beyond Myvatn - Mt. Sneffels; the mountain which had hosted the expedition in Jules Verne's novel; 'Journey To the Center of the Earth'. Finally, the animated driver had commented with pride that the city had first been settled in the year 874 - although, what Jurgen now observed scattered over the flat tundra landscape along the freeway, were a collection of boxy white rectangles; apartments, schools, churches, theaters, museums, bowling lanes, swimming pools, warehouses, factories, libraries, restaurants and stores which appeared to have had been designed without consideration of the climate or terrain. To Jurgen it seemed there were only a limited number of templates when it came to manufacturing buildings; and these could have been transplanted from anywhere in the world as if seeded by some enormous, common architectural plant. It was evening by the time he had ensconced himself within a small room at the Hotel Borg; where he had registered under the name Jurgen Stark. It had been difficult to communicate, since whenever people would rapidly speak in their native language, it became impossible for his digital translation device to interpret. He had also soon realized that to use the telephone was futile; he had laughed - the phone book in Iceland was alphabetized by first name. Anyway, it was late; businesses were closed for the day. He made his way through the labyrinth down to Skuggabarinn; the shadow bar. The hotel’s ballroom was decorated in lush red velvet curtains and its high ceiling was painted with clouds and stars. Under the chandelier, men in dark suits and ties danced with blondes in cocktail dresses, high heels and glossy pantyhose. Jurgen sat at a table off to the side, sipping the glass of vodka he had purchased for 2000 Kronur. It wasn’t long before a young woman approached and asked to join him. Her name was Solla. She was young and healthy, wild and vibrant; brown curly locks, ruby lips and an embroidered white blouse that did nothing to conceal her pert breasts. Solla led him out of the ballroom and into the streets where a much livelier party was in progress. She introduced Jurgen to her friends, and her friends introduced him to Brennivin; a powerful alcohol made from potatoes, flavored with caraway seeds,


which everyone called Black Death. Others had become inebriated by drinking beer out of plastic containers, or Landi; home brew, the nectar of the gods - some drinking until unconscious, perhaps as a means to attain direct contact with divinity - Rujjie would have approved. This group of recently acquainted friends roamed through the streets of Reykjavik laughing, singing, smoking cigarettes and occasionally trying to pick fights with Jurgen by taunting him with good-natured belligerence. Jurgen had never fought with anyone before in his life, and was uncertain how to respond. During these sporadic moments Solla often wound her arms around his chest to defend him as if by proclaiming her affection for him; and she was very affectionate, often demand‐ ing that Jurgen give her a kiss. It was odd, but as the night progressed and the spirit permeated his body, there were times that Jurgen could have sworn Solla was actually Coraline. It was not only the resemblance of the facial features which was striking, but they were both about the same age, had the same physique and even shared similar characteristic traits. By around three or four in the morning, Jurgen and Solla were making out on a bench near the cemetery. They had both had too much to drink and both were very tired. She asked Jurgen where he was staying, he replied the Hotel Borg, and she insisted that she be invited to his room. As they headed back to the hotel, Jurgen was grateful that she was along, since he realized that he had become completely lost. They had somehow stumbled and staggered up the stairs and through the corridor, eventually finding the room which matched the number on the key tag. Within just one moment inside the room, Solla’s clothes had suddenly vanished; her firm, lean body lay spread out on top of the russet sheets of the bed, urging him to join her in the most intimately-physical way. The memories returned of the unfulfilled desire; his longing to make love to Coraline in the way he had often experienced it in his dreams. But it was as if an inner sensation came over him, out of nowhere, to take control of the situation; that he no longer wanted to be unfaithful to Coraline, and if this was Coraline; in the form of a messenger, spirit or virtual projection, he could not take advantage of her during this moment of weakness - as if this were perhaps a test of his chivalry - not to steal away the purity that he knew she still maintained. He sat on the bed next to Solla, wrapped her naked body in the sheets, kissed her on the lips then whispered goodnight and like a young child she was soon fast asleep... The next morning; a little foggy, under the weather, a picture of Reykjavik harbour was framed by the hotel window. Still dressed, Jurgen had awoke slouched in a chair. His head was pounding as he shuffled into the bathroom to drink some tap water. In the mirror the reflection of his eyes were like fiery embers. He ordered something from the room service menu, he couldn’t understand, and when the meal was delivered it turned out to be a sheep’s head served on a silver platter with jellied ram’s testicles and congealed blood sausage. The meal arrived just as Solla was waking up, so the hotel attendant served it to her as breakfast in bed. She seemed pleased; she gnawed hungrily on the skull, ate the eyes, the tongue, and scooped out the brains. Jurgen was


content just to drink both of their cups of coffee. After breakfast Jurgen explained that he needed Solla’s help in contacting local cargo terminals to see if his shipments had arrived. Still naked she got on the phone, speaking Icelandic, while Jurgen paced nervously back and forth awaiting the outcome of every call, and trying to suppress his natural instinctive urge. He begged her to put some clothes on, but instead she insisted on taunting him by assuming provocative poses while she rattled off nonsense into the handset. It had been a nightmare to arrange air transport to the remote base. One airline had refused because of the size and weight of the cargo. Another was reluctant to fly to a remote location. Fortunately Solla remembered a former lover; a pilot who owned a small cargo plane which he flew for IcelandicAir. She then contacted him by phone, speak‐ ing Icelandic, somehow persuading him to take the charter. “You don’t know what I am going to have to do to complete my end of the bargain. His plane may be small, but that is the only...” “Okay, okay,” Jurgen interrupted, “You don’t need to tell me all the details. I appreci‐ ate how much...” “Oh, if you appreciate so much why don’t you show me.” She walked over to Jurgen who was sitting in a chair, straddled his lap and began kissing him passionately... Jurgen skipped a pebble along the tarmac of the runway. Those were the type of thoughts that he could no longer permit to enter his mind. He let the relentless wind carry the image away and instead returned to his recollection of the journey at the point during the sequence of events when he was already on-board the heavilyloaded cargo plane - flying low over the landscape; at first over farms and ranch land on which sheep and horses grazed, then later over steeply-sloping volcanic moun‐ tains, crystal glaciers, rugged canyons, the mud pools and steam vents of Solfatara fields, treeless meadows filled with ochre-rusted moss, lichens and wildflowers, streaked through with lava black and rivulets of melting ice that drained into small shattered lakes. At the controls had been a short, husky young man, with white-blonde hair and long handle-bar mustache whom Jurgen would know only as Erik the Viking. Since he didn’t speak any language that Jurgen could understand, their conversation had been limited to an exchange of hand gestures; the pilot pointing out features of the landscape and Jurgen acknowledging them. During most of the flight Erik sang loudly; some strange Icelandic songs, his voice blending in with the harmonics of the old propeller engines bolted onto the wings. They traveled much longer than Jurgen had expected. Suddenly, the plane pitched into a steep banked turn as it circled the abandoned site, enabling Erik to check out the condition of the runway. Jurgen craned his neck to catch a glimpse; the collection of buildings simulated a human habitat but the sur‐


rounding environment seemed as desolate as the moon. Jurgen recalled that Kropton had mentioned that nearly 50 years before, lunar astronauts had set foot on this same rugged terrain, using this volcanic area for field geology training in preparation for the Apollo program. The plane bounced along, skidded to a stop at the end of the runway, then spun around from the thrust of the engines and taxied back to a spot near the quonset. Erik brought the plane to a halt. Leaving the engines running, he hopped down, went around to the cargo door and began loading out the shipment. Jurgen joined in the activity. As they dragged and dropped the heavy boxes and crates, Erik kept saying things, looking puzzled, shrugging his shoulders and shaking his head, then shortly climbed back into the plane and disappeared. Jurgen stood motionless for some time, facing the direction that the plane had gone; still watching the sky long after the tiny dot had vanished. Now all that remained was silence and a pile of boxes in the dry grass beside the runway.

II. QUONSET

Jurgen turned; and there it was - the quonset! He couldn’t believe it - he had finally arrived. This had once been the Stark’s home and workshop; a place that he had often tried to imagine! He experienced an increasing rush of excitement as he quickly approached the building. its large, rusted, semi-cylindrical corrugated metal roof arched above a cracked concrete pad that formed its foundation; resembling a tin can half-buried in the ground. He pushed open one of the weathered wooden double doors on the front of the building and it immediately collapsed off its hinges. Everything about the interior of the shelter was perfect in its sense of abandonment; the variegated texture of nature growing back - brown ochre moss and blue grey lichens that patterned the surfaces of walls, the rusted metal that burnt holes in the sky, the rotted grey wood turning to dust, even the curled-up tiles of linoleum and the broken cement on the floor reminded him of the cracks and crevices of a mud flat that had been parched by the sun. This wasn’t wholesome nature growing in the light of day; it was the dark creeping nature of corrosion and hidden decay. It had already claimed the outlying buildings, the abandoned airplane and ancient machines, and in a short time it would reclaim this structure as well. Nature that would still remain long after he had gone.


The sun streamed in through numerous perforations in the roof, drilled through by rust, illuminating the musty interior in its narrow beams of light. Dark silhouettes loomed in the shadows, strung all over with a delicate fabric of cobwebs. Once his eyes became accustomed to a scene rendered in subdued light, Jurgen was excited to discover that these strange shapes were a miscellany of objects that had remained in the quonset since the time of the Starks. Everything was oily, rusty or covered with mildew. Jurgen ventured deeper into the building; at the back, up a flight of metal steps were three small rooms; a kitchen, a bedroom, and an office, each illuminated by daylight shining in through a tiny dusty window facing south ~ the remnants of the canvas roll-ups over the windows had rotted away to tatters. Some of the original furnishings still remained; an oil stove, kitchen table, chairs, shelves still stocked with rusted canned food, a small dresser in the bedroom, a mattress badly deteriorated from mold melting onto a rusted metal frame bed and a sagging bookshelf containing a number of water damaged books. And in the office, a desk, a few more chairs, a filing cabinet, and the skeletal remains of some of the original vacuum tubes, wiring and power transformers, of a radio transmitter housed within a military-grey metal cabinet. Jurgen had expected the building to be completely empty; all traces of the Starks cleared away, but he was pleased that these artifacts existed ~ there was no telling what other treasures he might find! Yet, his first priority had been to retrieve the crates and cardboard boxes, that were piled along the runway, determined to haul them into the quonset hut by either pushing, pulling or dragging them. At first he had foolishly tried to lift and carry boxes that were too heavy to move by himself - it didn’t take long to realize that he was out of shape; the sedentary lifestyle of a computer programmer had toned his muscles to a very low note. Seeking an alternative, to avoid injuring his back, he scoured the guts of the quonset with a flashlight, eventually discovering a small wooden platform with tiny coaster wheels; a dolly of the type that mechanics use to slide themselves underneath cars. Using levers, Jurgen hoisted the crates onto the dolly, only to discover that it sunk into the ground as soon as it had rolled off the runway. Inch by inch, he used brute force to coax them into the shelter; a painfully slow moving process which took most of the night - well past the rising of the midnight sun. During the first week after his arrival; in early July 2010, the days had been ex� tremely long days, literally, the sun had never seemed to set. Jurgen had set up a solar panel array which collected all the energy he would need to run the systems on the base. At night, electricity was transmitted from a wind turbine, as well, power was obtained from the excess radiant solar energy that had accumulated in batteries. Jurgen kept pace with the sun, working around the clock to make a new home for himself. He cleaned out the quonset; mopped up an expanse of water in the center of the floor and fabricated a ladder to patch the ceiling with cannibalized sheets of metal from the remnants of the other buildings. Of those outlying buildings, the only one remaining functional was the small building that the Starks had originally designated as their storage shed. All of the others; the small bunk houses and the kitchen shack, were beyond repair, well into the process of returning to nature.


These buildings had already provided a valuable source of scavenged material; sheet metal, insulation, electrical wiring, fittings and fixtures - whatever could be used to renovate the quonset to create a more inhabitable interior. Their systematic destruc� tion had also been part of a therapeutic process: Jurgen had gradually discovered that portions of the shipment were missing or had been damaged in transit - especially essential tools or faulty digital components which caused some of the equipment to run intermittently, or not at all. He recognized that problems were always to be expected, even under the best of conditions, but out here, miles from nowhere, the fear and panic caused by malfunctioning hardware put a strain on his nerves which sometimes got the better of him. As a result, he quickly discovered that he could release his anger by occasionally attacking small buildings around the station with a hammer and crowbar; screaming like a wild animal he would wrestle them to the ground. Then calmly he would return to the lab and set about obtaining a more rational solution to the problem. Jurgen eventually managed to clear out enough debris to transform the bedroom at the back of the quonset into a fairly comfortable living space. Under the light of a bare bulb that shone down from the ceiling, Jurgen worked late into the night; scraping hardened mud off the curled linoleum tiles, hammering together the dilapidated dresser and stitching together the rusty springs of the metal bed frame using lengths of electrical wiring. He had replaced the stuffing in the old waterlogged mattress with some insulation ripped out of the walls and wrapped it in a thick plastic sheet, then covered the mattress over with padded mover’s blankets and a sleeping bag to make a nest for himself. He then patched up the segmented chimney pipe, intended to heat the space. It emerged through the wall separating the bedroom from the battered oil stove in the kitchen area next door. The renovations completed, Jurgen surveyed his surroundings and saw that it was good. The only thing lacking was the type of furniture he had seen in the movie; 'Soylent Green'. Water came through a pipe in the kitchen which was connected to a well; a narrow hole that had been drilled straight down beneath the quonset. It was always hot and reeked of sulphur since it was heated by a source deep underground - but it had tested out fairly clean. To fill the tank in the kitchen, it had been necessary for Jurgen to operate the hand pump that capped the well. He had learned by trial and error how many strokes it took before the storage tank inside the kitchen had begun to overflow. He had rigged up a rubber hose from the tank which drained into the sink, after discovering that most of the interior plumbing was gone; the pipes were either cracked, rusted through or disconnected at the fittings. It hadn't really mattered if he had a functional sink, since he had no dishes to wash; the vacupacs of food were disposable and biodegradable, he just needed to add water. Tracing another set of pipes, Jurgen noted that they terminated along the wall near holes in the floor down on the main level of the quonset - perhaps once connected to a toilet and shower that had probably drained into a septic tank. Jurgen had no use for those conveniences either, since he had the great outdoors - he had already discovered a muddy hot spring pool about one kilometer away over the tundra; it was the place he would go to cleanse his body should the need arise, or sometimes just a place to soak and drift and relax - floating in


the steamy mists until his skin was pink and wrinkled. Off the side of the storage shed, Jurgen had constructed a greenhouse out of heavy gauge sheets of transparent plastic. He cut apart and filled empty cardboard boxes with local soil in which were planted a wide variety of seeds. As a break from the mechanical labour of quonset renovation, Jurgen made it part of his daily ritual to tend the seedlings. It was his hope that the resulting crop would supply him with fresh food during the darkest part of what he expected to be a harsh upcoming winter. On the seventh day he rested... satisfied that he had successfully created a comfort‐ able climate-controlled living environment for himself; his own little world. Yet, he had been very tired after his intensive effort. He had sustained assorted cuts and bruises and his muscles ached from strain; he had been working every minute that his eyes had been open - and that had been about 18 hours every day. His endurance had been assisted by chemicals which energized him, tranquilized the pain, nourished him, helped him sleep, but primarily kept him awake. Then finally, when his tasks had been completed, Jurgen had allowed himself time to recover; indulging in a period of sleep which lasted nearly 24 hours... Yes, this was the paradise he had invented for himself, and those were his memo‐ ries of it; his recollections of that first week were still as fresh and clear as Icelandic air. Gradually he became aware of the grasses and weeds that had grown up through the cracked asphalt of the landing strip under his feet, and suddenly he realized that he had been transported back into the present. He had been pacing the runway, as he often did, as a form of exercise, while these thoughts had resurfaced from the depths of his mind. Soon, he would need to let those memories go, he thought; let the forceful wind rushing over the landscape blow away his past. Jurgen turned at the end of the runway and made his way back toward the quonset. Past the fallen Hurricane and the tattered remnants of a wind sock that rattled atop a tall weathered pole; red and whites stripes, paint cracked and faded, bleached to pale shades by the sun and the wind. Past the storage shed supporting a greenhouse along its southern exposure, past the rubble of small wooden buildings that he had dismantled like an animal, then through the weathered doorway of the quonset entering the sanctuary which he had created inside... Whenever he awoke his ‘day’ would begin; it didn’t matter whether it was truly day or night. The routine, after he crawled out of bed, was to wander into the kitchen, make some coffee and grab a vacupac of ‘astronaut’ food; obtained by reaching his hand into one of the many holes he had ripped through the side of the cardboard boxes that were stacked from floor to ceiling within the tiny kitchen - an arrangement which created the appearance of a claustrophobic storage locker. Jurgen had ordered this shipment from the same manufacturing plant where he had worked as a System Analyst in his youth; the K’ung Te ‘Oversea’ Foodstuff Company, located in the industrial park just outside Eigenvalue. Although an inexpensive hand-held barcode scanner had been included with the shipment, Jurgen had never used it. He had


decided that his meals would be the product of random chance; the luck of the draw. It didn’t really matter, everything was dehydrated and had the tendency to taste the same; fruit, cereal, juice, soup, eggs, vegetables, lasagna, fried chicken, bean burritos - the only difference was that some were salty and some were sweet. He just added water to the slim bag, kneaded the flexible plastic for a few minutes then sucked it up through a straw. Instantly his hunger would be satiated. For desert he would swallow a handful of tablets - vitamins, minerals and other supplements; actaphorasine, Lglutamine, chlorophyll, beta carotene and so on... all washed down with plenty of coffee. He usually ate his meals seated on the kitchen floor, propped up in the pilot’s chair he had salvaged from the cockpit of the wrecked Hawker Hurricane rusting out near the end of the runway. A huge bullet hole; several centimeters in diameter, had penetrated the upholstery in the center of the seat long ago. But it was a comfortable chair; Jurgen leaned back and stretched his legs out across the broken linoleum tiles while he waited for his waking reality to become less dream-like. He sipped his coffee directly from the pot, bemused by watching his surroundings becoming more distinct; the kitchen walls were faded cream, smudged black around the exhaust pipe of the oil stove, which Jurgen had modified into a contraption now able to burn wood... ‘Adversity is the patron of ingenuity’, Jurgen had thought as he wandered the area to gather fuel from the buildings that he had previously deconstructed. He had tossed most of the lumber into what had once been the Stark's office; a small room located next to his bedroom. As well, a ready supply of wood had been stacked next to the stove in advance of the approaching winter. ... Jurgen continued to pan the room; beside the wood pile, his gaze came into focus on the coffee machine - an appliance which bestowed the magic elixir of life, huffing steam as the next batch brewed, resting upon the narrow kitchen counter. Further along the counter was a dysfunctional sink; Jurgen had yet to discover where the water drained, and nearby, a short-handled water pump to keep the storage tank filled with a natural source of hot water. The remnants of a few rusted tins and a collection of jars remained on the shelves above the counter since the Starks had lived in the quonset; shriveled black lumps had congealed in the bottom of the sealed glass containers and their labels were illustrated with mildew. And on the far wall; a small square window, a map of the world and a calendar dated 1959. Still drinking from the coffee machine's glass carafe, Jurgen exited the kitchen and stepped out onto the platform. The worn plywood sheets, that covered the welded metal frame, served as a narrow walkway connecting the three small rooms built into a loft at the back of the quonset; the office, the bedroom and the kitchen. A flight of seven small steps led down to the main floor - and at the length of the building, to the only doorway leading to the outside world. Jurgen now leaned against the rusty metal railing to survey his work area from this vantage point; under the sheltering sky of the arched corrugated metal ceiling, the cluster of equipment filled the central portion of the large open dimly lit room. This was the working environment that he had always


dreamed of; cables snaking between hardware components and tubes, beakers and flasks scattered over work tables - which he had also constructed from the wood of the old buildings he had torn down. As he pondered the scene before him, Jurgen thought about his grandparents; Cameron and Adda Stark, as he often did - since they had been an inspiration to him throughout his life. Yet, it was only now that he felt he was truly carrying on the legacy and the spirit of the family tradition; by pioneering technology, exploring frontiers, challenging perceptions and finally, fully experiencing the reality imposed by this isolated environment. He imagined that they would have been proud of what he had accomplished and certainly they would have admired the way he had managed to scramble together this ad hoc collection of technology; strange machines, re-engi‐ neered and modified by cannibalizing parts and grafting them onto other machines to invent new hybrids which were dedicated to their specialized purpose, then optimizing the equipment to work at the highest level of its capabilities. How times had changed! When compared with the hardware that the Starks had used, everything now seemed compact, powerful and disposable. Millions of hours of human labour by the employees of major corporations had created highly-efficient devices which had minimized error to a probability approaching zero. At the factory’s heart, the computer system had been recently modified from the prototype which Jurgen had assembled just before leaving Japan. Within the perfectly-dimensioned cube of the computer's blue-grey metallic chassis, the photorefractive crystals within the processor's optical circuitry had now been significantly upgraded. Jurgen had pulled the boards out of a Logika 2007z; the workhorse of Russian computer technolo‐ gy. He had replaced all contacts with silver, and used Daylight™ fibre optics through‐ out the architecture, which channeled data, in the form of light, through the switches at a rate of ten gigabytes per second. He had dropped in a modified eight-gate timestep loadcase that accessed the floating-state memory; a fluid memory storage environ‐ ment able to store data in a full range of voltage states - rather than the on/off, all or nothing duality of binary storage. He had also recently installed a light-wave transmis‐ sion cable to connect the computer to the network through a small satellite dish he had bolted to the apex of the curved roof, outside on top of the quonset. To navigate the software’s graphical interface, Jurgen had eventually grown accustomed to using his brand new ‘wand’; a small cylindrical device made of metal and plastic with an arrangement of buttons along its side. Whenever he repositioned the wand, depending on its proximity, a corresponding icon either appeared on the large flat-screen display, hovering above the desk top in front of him, or on one of the arrangement of several smaller panels which orbited nearby - each floating on a hinged support arm. He still used the data-entry pad to input text while writing code, and certainly, had also retained the battered black box of the All-Code Data Synchro‐ nizer; the only component of the Stark’s old computer that he had salvaged... For a moment he wondered if the old TRINIAC still existed back inside the co‐ cooned workshop in Izumi-fuchu where he had left it... it didn’t matter... that was the


past; it was a period of time which now held less attachment. Since arriving in Iceland he had turned his attention to the future. What had been the recurring propaganda message displayed on billboards and posters in the city described by his father in his unpublished novel; ‘Invisible Waves’?... “Young eyes look toward the future.”... Yes, that was it! Jurgen pushed off the railing and made his way down the steps, shuffling across the broken concrete of the quonset floor toward his computer workstation. The old arborite kitchen table on which his computer rested was taller than the one he had used in Japan, and rather than cushions on the floor, he now sat on an old battered rusty chrome kitchen chair; its orange and black vinyl covering badly ripped, revealing the moldy upholstery and stained particle board underneath. Cranked from caffeine and stimulated by the supplements, Jurgen now set about the task of configuring the operating system within his new memory storage array. The towers had been manufactured in Bombay, shipped to Reykjavik, and had accompa‐ nied Jurgen on the chartered flight piloted by Erik the Viking. Jurgen had purchased these particular units from a website in India because he was intrigued by the compa‐ ny’s claim that the internal arrangement of their drives had been designed on the principle of Tantric chakras. In Sanskrit, he had learned, the word chakra meant ‘revolving wheel’; a term used to designate the seven energy vortexes positioned at certain points within the human body which were apparently related to the plexuses the focal points of the branching structure of blood vessels, and more particularly, the neural network running up the spine. That the chakras also shared similarities with the Tree of Life and the Yggdrasil of Nordic mythology, enhanced the mystical significance of the hardware configuration. Yet, Jurgen had shrewdly confirmed the manufacturer’s reputation and the integrity of the technical components by referencing other sites of customers who appeared to be very satisfied with the product. Each unit was housed in a clean white, rectangular molded metal and plastic chassis, simply ornamented with a pair of chrome handles on the access panels to every drive, machined screws on the mounting plates and several discreet tiny black and yellow warning stickers. These boxes, which stood at waist level and flanked the central workstation, reminded Jurgen of the hives that Zinthrop had been tending when first encountered in the jungle clearing on the island of Lanai. And like the hives, the external appearance of the towers was deceptive of the complex activity capable of taking place beneath the surface. Their memory storage capacity was immense; a vast universe, already divided into subdivisions of space that awaited the charged particles that would inhabit this virtual real estate and gradually evolve into constellations of digital data. Stacked vertically within each chassis was a networked disk array; each containing seven drives, with each drive capable of storing several terabytes of data. The twin towers were connected, enabling them to continually communicate, and to mirror each other by functioning as the other's redundant system backup.


At its root level, coiled at the base of the spine within the tower’s primeval structural architecture, was the operating system. It dwelled on only a portion of the disk posi‐ tioned at level zero within the hierarchy. The operating system contained the instruc‐ tions which were accessed by the on-board processor within the enclosure; circuitry which functioned as the ‘brain’ of the unit and also enabled it to communicate with the other external hardware devices located within the workshop. To adapt it to the purposes he required it to fulfill, Jurgen had spent the past two weeks modifying the software to reconfigure the way in which the operating system formatted incoming data. He had written a new ‘sorter’ algorithm which enabled the processor to recog‐ nize the identity tags embedded in the incoming data and direct the packets to specific storage compartments; designating that the data be recorded on certain discs within the stack or even particular sectors on their physical surface - laying down this information as logically concatenated sequences. Although he was aware that this highly organized sorting process would lengthen the writing process - it was of little consequence, since it was only essential to minimize the amount of time that it would ultimately take to read this data. Jurgen swiveled his position on the kitchen chair then waved his magic wand. Instantly the system diagnostics appeared as a graphical representation on one of the flat panel displays which hovered about the workstation; it reported that the installation of the software had been successful! Jurgen smiled, pleased that the twin towers were now fully operational. At that moment, the system existed only in a state of potential; an empty vessel, although, one day, the towers would function as the warehouses which supplied a stream of raw data components to the assembly line within his tiny virtual factory - called upon by the generator - sometime in the future, when the fabrication of his entities went into full production. Yet, within that potential, the towers still radiated a sense of power with quiet intensity; only the constant gentle hum of the fans within the enclosure and an array of tiny glowing, blinking coloured lights on the small panels along the front the tower’s chassis provided any indication that the towers were alive.

III. THE BODY (700 genes of happiness)

Since he had arrived, Jurgen had made steady progress assembling, what he often referred to in his journals as the ‘factory’; the interconnected local network of comput‐ ers and memory storage arrays. The work felt casual, relaxed. It wasn’t exactly rocket science; he had put these type of systems together and tore them down so often that it had become second-nature to run through the standard checks, test out the compo‐ nents, patch in the new assemblies or solder on new boards to get the system hot and


ready. But setting up the ‘laboratory’ had been another matter... The bulk of the scientific apparatus in his ‘basic’ microbiology lab consisted of a menagerie of flotsam he had acquired ‘off the shelf’ from sources around the world; sources discovered on the network with names like International Biosystems or Bio Logic Industries. Jurgen had unpacked the carefully padded delicate components from the small yellow plastic crates and set up the equipment; probes, pipettes, syringes, valves, an amino acid analyzer, a liquid extraction apparatus, a fraction collector, a centrifuge, and a fully automated chromosome scanner. Originally developed by researchers on the human genome project, these specialized instruments were handme-downs that were a few years old - which was why Jurgen had been able to purchase them so inexpensively. The new state-of-the-art equipment, in which samples were simply loaded into the scanner on ultra-thin gel membranes, although outside his price range, had now become commonplace. It seemed that everyone was using them; not just the geneti‐ cists who were busy cloning livestock or engineering crops that were more resilient against diseases and parasites, but the technology had also become widely used by employers and insurance companies to screen out possible high-risk candidates, by doctors in the diagnosis of disease, by law enforcement officers in identifying criminals and in conducting forensic investigations, by lawyers championing unwed mothers involved in paternity suits, by prospective parents using the services of fertility clinics, in anthropological research to trace family genealogy, in the treatment of aberrant psychological behavior by eliminating abnormalities through medication which produced corrected-thought, in meat processing to track the product from the field to the retail freezer, to analyze organic material obtained from icebergs that were over 3000 years old, and even in the DNA samples preserved from the loved ones of the dearly departed. To Jurgen, it was significant that this equipment, which had evolved during the decades spanning the turn of the century with the US Department of Energy’s involve‐ ment in the Human Genome Project, had actually commenced with research initiatives carried out by that agency’s laboratories in studying the effect of radiation on human bodies at the Nevada test site during the 1950’s. Once again, Jurgen sensed the bond that connected him to the Starks, facilitated by another link in the web of life. And in a related thought, Jurgen naturally wondered if he had inherited any damage to his genetic structure that could be attributable to his grandparents’ exposure to nuclear radiation sustained during that time. He was aware that environmental factors could result in mutation; all it took was an error in communication - a misplaced letter within a word of the program could trigger cancer, hijacking the body’s cellular assembly lines, multiplying like parasites with no destiny or purpose beyond endless replication, staging a revolution whose explosive repercussions would spread like a nuclear blast throughout the body and ultimately consume its host. He also recalled being informed that DNA single-strand breaks increased in brain cells within a 60-Hz magnetic field at a flux density greater than 0.1 mT (microtesla), and he was aware that his grandpar‐ ents had often exposed themselves to fields many thousands of times greater.


These thoughts had added incentive for Jurgen to familiarize himself with the basic principles of biology; knowledge which he believed would be necessary in order to acquire a more complete understanding of the processes he was about to perform. He was already aware that the simple interaction of the trillions of individual cells within the human body manifested an apparent complexity; providing each person with their ‘global’ physical characteristics, behavior, intelligence, and so on... since this was similar to the model he had used in designing his own self-organizing algorithms in the past; each insignificant entity gradually forming a harmonious relationship with many other entities to ultimately create a vast and intricate universe, a pattern, which from their own perspective within the complexity would be nearly incomprehensible. His entities, like cells were nearsighted and could not see the grand design; they could not make choices to determine their own activity since they lacked an aware‐ ness of the ‘big picture’ and as such were required to rely on the programming of their limited internal instruction sets to tell them what to do. In the body, Jurgen had discovered, these instruction sets were contained in tiny packages called chromo‐ somes within the nucleus of every cell. In total there were 46 physically separate chromosomes; one copy of the original set inherited from each parent which formed 22 matched pairs - like salt and pepper shakers, as well as just one additional pair of chromosomes which determined the sex of the offspring; an X+Y chromosome in a male, and 2 X’s in a female. Inside each chromosome, encased within the protein cocoon, was an instruction set; a length of DNA; deoxyribonucleic acid, which consisted of an arrangement of chemical elements strung like pearls along two complimentary strands, pointing in opposite directions, that were intertwined around each other like the serpents on the caduceus in a helical spiral. This form, which resembled a twisted ladder, was constructed of sugar and phosphate molecules, and had at intervals as its rungs, linked pairs of repeating nucleotides which were one of four nitrogenous bases, either; adenine (A), thymine (T), cytosine (C), or guanine (G). A always pairs with T, and C with G; a sequence of bases that created an unambiguous template whenever the tightly coiled threads unwound for replication; reproducing by attracting a complimen‐ tary base to form a new pair. This was essential; what 1 and 0 are to the computer program’s binary digital code, A, T, C and G were to all forms of physical existence. Added together, the individual sections of these 92 separate strands of DNA, com‐ bined from within all the chromosomes, formed the complete human genome; a string of 3.3 billion A, T, C and G’s which would fill several hundred city phone books; or about 200,000 pages if written out as text. Jurgen ate a bowl of ramen noodles as he contemplated how the complete instruction set, which was originally written during the spark of conception, had subtly recombined material; swapped between paired chromosomes to create variation during the fertilization of the egg by a sperm. This event defined who and what the new human being would be, and for many, determined their destiny. At the moment, the population in the year 2011 provided nearly seven billion existing variations on a theme. And infinitely more, since DNA wasn’t unique to humans; a very similar


information string provided the score for the symphonies performed by bacteria and insects, flowers and sharks, in fact, manifested as every single living thing. It was important for Jurgen to understand how the body’s programming was driven by the biological code, so he immersed himself in research by exploring the informa‐ tion available from research institutes on the network. Each of the 24 different types of chromosomes, he discovered, contained a length of DNA which varied in the number of its base pairs; the smallest, chromosome Y, contained about 50 million, while the longest, chromosome 1, contained just over 250 million base pairs. Within the millions, which functioned as a type of library, many shorter sequences of the nucleotides A, T, C and G, along the strands of the DNA molecule could be considered to be analogous to books on the library shelf, and these manuals were called genes. These genetic segments initiated various processes, such as triggering messenger RNA molecules to ‘read’ the DNA manual and transmit the sequence to the ribosomes within the cell; the fabrication machinery that operated on the code and followed the instructions to assemble, often many thousand, amino acids into a complex structure called a protein. Each of the approximately 100,000 types of proteins in the body corresponded to the instruction set provided by the manual of a different gene, creating linked chains of amino acids that were transcribed letter by letter in a similar manner to written commu‐ nication. Yet, an altered word, a misplaced letter; defective genes were the cause of over 4,000 hereditary human diseases. The energy to create the protein, although supplied primarily by the cell, also drew upon the energy within its universe; the entire human body, since each cell’s activity was linked to the processes occurring within every other cell. Every cell was constantly coming into creation, existing, replicating and dying. As the cell divided, exons and introns in its DNA signaled messengers to trigger or interrupt protein coding se‐ quences; turning on or shutting down the machines that manufactured the new cell, at the same time the DNA made a copy of itself by unraveling its strands and linking the bases to new bonds to create another set of chromosomes as the payload within the new cell’s nucleus. Where, when, and how much protein the gene manufactured determined whether these cells would form part of the skin, hair, eyes, muscles or heart of their human universe, and also their size, shape and/or colour. Jurgen was fascinated by genes and the efforts researchers had made over the years to read this mysterious serial novel. The genetic sequences not only expressed themselves as the physical properties which provided structure, function and regula‐ tion of all of the body’s cells, tissues and organs, or facilitated the chemical processes; the routine maintenance of cellular metabolism and the activity of hormones and antibodies that sustained all living things, or created receptors; proteins on the surfaces of cells that were able to receive signals from its surrounding environment, but most interestingly, researchers had discovered that 50% of the genes were responsible for shaping behavior - the copied code was transmitted by the messenger RNA to the brain where enzymes synthesized or degraded the chemical neurotrans‐ mitters; clusters of genes affected the balance between greed and altruism... there were 700 genes of happiness. Of course there were also enigmatic passages;


stretches of the code which had been transmitted and reproduced since primordial times whose meaning and purpose could not be determined. The parallels between the structure of the cells and the digital entities that Jurgen had spent years designing, modifying and perfecting was becoming increasingly obvious: each construct was a self-contained packet, able to reproduce, mutate and evolve, and both were endowed with an on-board instruction set which enabled them to interact and communicate with their environment and with each other. As part of the instruction set within his entities, Jurgen was determined to include a portion of his own genome; a unique sequence of his own DNA that had been translated into digital code... Jurgen followed the instructions in the manuals that had arrived with the shipment which described the processes for assembling and using the equipment. And as he put together the various components of the machines within his microbiology lab with utmost precision, so that every source of error was eliminated, he would occasionally engage in conversation with himself or sing as he worked; just to hear the sound of a human voice. Obtaining the samples had been a painless process. Jurgen could have chosen to select samples from any of the 250 different types of cells which made up the various organs, tissues and substances within the physical architecture of his body since they each carried the same DNA. Significantly, he chose blood, sweat and tears; samples carefully obtained with a micro pipette outfitted with a disposable plastic tip and surgically sterilized to eliminate contamination. While step one in the manual had been quick and easy, Jurgen had gradually discovered that preparation of a chromosome suspension for flow analysis was a much more time consuming process and one that had also required a great deal of skill - although, for Jurgen, it turned out to be a process of trial and error. The grunt work occupied long hours: pipetting and diluting reagents, labeling tubes, preparing the fluorochrome solution; Jurgen tried both Acridine orange and Sytox green, plus the time it took to load and unload the incubators and centrifuges. As soon as he had learned that the cells needed to be kept in total darkness at every stage, aluminum foil became indispensable and he never seemed to have enough. Jurgen inserted the prepared solution; containing his individual chromosomes held in suspension, into the receptacle in the side of a small, ambiguously neutral grey machine called a chromosome scanner. The machine automatically sorted the chromosomes and sequenced their DNA using the process of flow cytometry. Jurgen had repeated this procedure countless times to ensure that the scanner had read enough samples to reduce the possibility of error to less than one in a million bases. Essentially, in the simplest terms, the prepared solution was drawn inside the machine by a vacuum, where the stream was disrupted into very tiny droplets by means of an ultrasonic vibration. Thousands of droplets per second emerged from a 70 micron nozzle as they were drawn into the sheath of a quartz cuvette; a process that, as


diagrammed in the manual, reminded Jurgen of the way that an egg travels from the ovaries to the uterus within a female’s body. Each droplet that entered the ‘womb’ was irradiated by an air-cooled argon gas laser that generated an ultraviolet beam, and in less than the millisecond it took to travel past the sensing point, the chromosomes scattered the laser light and emitted a fluorescence that enabled their nucleotide sequences to be identified in order, according to the time required for them to reach the laser detection region. The resulting deflected and emitted light was detected by an arrangement of lenses, beam splitters, filters, a multi-channel detector and logarith‐ mic amplifiers that transmitted the resulting measurement data to Jurgen’s computer. Jurgen had already shopped around and downloaded the source code for several types of genome informatic software; readily obtainable from the secured servers within the research labs of biotech and biopharmaceutical companies. It had taken several weeks to modify the code to his purposes, but he was satisfied with the results. The process of cataloging and arranging the components which made up the com‐ plexity of his physical characteristics was simply a matter of brute processing power once the samples had been scanned as input; the software analyzed and differentiat‐ ed the encoded sequences before committing the digitized fragments to memory within the tower's disk array. Jurgen was able to observe the process as a graphic display in which the chromosomes were represented as horizontal tubes capped with cylindrical ends; linked like a chain of sausages that narrowed where the translocation breakpoints separated the segments. Gene signatures were represented as thin, vertical coloured bands superimposed on the chromosome... 82 bp frameshift deletion (exon 4) after position 315... 10

062256

20 GATTACATAAAGCCTCAGCCACAAA X::::::::::::::::::::::X

M99421 TGCAGCATGGCCCCTGCCTTAGGCCTACCTGATCAAAATAAAGCCTCAGCCACA 1110 1120 1130 1140 1150 ... signal recognition particle subunit 9 (SRP9) mRNA, complete cds...100.0% identity in 24 nt overlap... Jurgen had not needed to understand or edit or manipulate the code. His only objective had been to take a biographical ‘snapshot’ that faithfully captured his genome at the present time and preserve the information without error, deletions or rearrangement. The computer processor continually cross-checked the codon number‐ ing as a means of verification and quality assurance, minimizing redundancy by performing similarity searches to find repetitive nucleotide sequences and filtering out aberrant expressions or digital pollution which were then eliminated from the database. The resulting contiguous map; a linked library of all the DNA sequences which comprised his genome, would be divided up as a payload on-board the entities that


Jurgen planned to release. He had decided to parcel out the information with approxi‐ mately 3,000 base pairs designated to every distinct digital unit, estimating that the initial number would be somewhere in the range of 3.327 million entities. Although, in actuality, the amount of data per unit would vary since he had wanted to separate the sequence at certain natural variations occurring within the code; exons and introns and regulatory sequences that tended to appear as markers at intervals approximately every 300 to 500 base pairs. As a result, he had modified the software to separate the DNA code at these standard recognized sequence tagged sites by emulating the cutting process of restriction enzymes at these precise locations along the chromo‐ some. Data links and anchor points would identify how the pieces would fit together and determine their position in the chain should it ever be required that the sequences be reassembled. Absorbed in the process, the days had turned into weeks, then into months. And even though he had worked steadily, he felt that he had accomplished very little especially when, eventually, he was shocked into an awareness of the passage of time by the arrival of the first snowfall; as the gentle flakes drifted down from the metallic grey sky, Jurgen suddenly wondered why had he dedicated so much effort to capturing his physical data, since, all along he had considered it to be the least important of the payload components that he planned to transport onboard each of the digital entities. Had it been that he had ultimately convinced himself that these entities could become the vehicle for his immortality; that there was a possibility for his continuation as a newly created version of himself - based on the person that he once had been - manifested as some as yet unimaginable form of computer technology or genetically engineered human being or biomechanical creature at some point in the future? Or had it been, perhaps, that the project had simply increased in complexity and its territory had expanded outward, as if the boundaries, which defined the project’s parameters, continued to advance at a pace which exceeded his approach? Partially both, probably. During the long process, involved in quantifying and transcribing the innate organic encoding of his DNA, he had discovered that he had taken somewhat of a detour; throughout his life he had always underestimated how long it took to do things - when would he ever learn! But it had been somewhere along that meandering path, during one of those intervals when he had been engaged in some tedious technical process which typically precipitated a detailed exploration of his own thoughts, that he had contemplated the concept of reincarnation. It intrigued him. Who at one time hasn’t imagined what it would be like, or had even hoped or prayed, to live forever? And even if immortality could only be attained through the transference of energy from one vessel to another; a dying elder dreaming their soul would be resurrected in the body of a newborn child - for most, certainly, it was an option which would be welcomed. Of course, all that anyone could do was hope and pray, since this wish could only be granted by that mysterious, unknowable, allencompassing energy; the superior being or force which formed the basis of every one of the world’s religions. Yet, Jurgen must have begun to recognize that it was within his potential to be able to realize mankind’s eternal dream for himself.


Having already digitized the code which defined the physical specifications of his body, Jurgen next planned to record the knowledge and thoughts stored as neurons within his brain. These two elements; the physical and mental, would comprise the database which would be parceled out and integrated into the entities’ instruction sets, providing them with the characteristics and intelligence which partially governed their behavior. Yet, Jurgen realized that it was not enough to achieve immortality of his mind and body alone, he would also eventually need to digitize the very essence of his soul; that essential element which would bestow true life upon entities. If it were possible, he intended to devise a method to capture and portion out quantities of the energy comprising his state of being, since, although each of the entities would be selfsufficient, self-reproducing and self-contained, only a soul, or ‘spirit’, could instill a desire to exist which was not artificial.

IV. FROZEN OVER

Jurgen opened his eyes, and the cycle began again - a program looped into an endless subroutine; wake up at some hour, work for as long as he was able, then return to a dormant state, fully dressed and stuffed inside his polymer sleeping bag. The sun was coming up over the distant horizon now; the noon dawn. He felt like hell this afternoon. Although he had slept forever, he had still awoke feeling exhausted and drained. He had an intense craving for chocolate, gingerbread, mustard and fresh fruit, but the nearest grocery store was several hundred miles away. His hunger reminded him of the plants in the greenhouse; how they had dried up and were now dead and buried - he had given up on them when the snow began to fall. And now, for the first time he began to experience fear; perhaps doubting his calculations - the possibility of error, causing him to wonder whether he would really have enough food supplies to survive the entire winter. His brain was clouded in haze; it seemed like everything was moving in slow motion as he made his way into the dangerous little kitchen. The dog-eared tiles; forming a grid of stained linoleum on the floor, cracked and squeaked under his shuffling steps. He grabbed a small, soft metallic bag from a hole in one of the nearly empty cardboard boxes stacked along the kitchen wall. He ripped open a corner of the bag with a sharp knife. He poured the ground coffee into the tray of the tiny electric machine. Punched a hole through the layer of thin ice that had formed in the water bucket, stoked the fire, then slumped into the Hurricane's pilot chair and waited; watching the coffee machine rumble and sputter as it filled the dirty glass pot with dark black fluid. Soon the small room was filled with the rich aroma of roasted coffee and


wood smoke. White steam rose in front of the opaque golden window. There was no need to scrape the ice off its panes; he already knew what was outside... endless enormous snowflakes that gently drifted down from the glassy sky like particles in a snow globe. Rosebud. It was colder than hell; somewhere around minus ten degrees Celsius. The numbing cold passed through the walls as if they were not even there, forming icicles that hung from the ceiling as if it were a cave. At least he was thankful that he had the foresight to prepare himself with appropriate attire; thermal underwear, heavy sweaters, mittens, a toque and a snowsuit - a garment advertised as being of the same design as those worn by snowmobile drivers who, earlier in the year, had raced their machines to the South Pole. Having rarely taken off these layers of clothing during the past couple of months, Jurgen would agree with the endorsement. The most essential thing to his comfort had become a dry pair of socks. As the heat began to warm the space and his blood circulation began to flow, his body slowly returned to life. Sprawled in the chair with his legs stretched out across the linoleum tiles, he took on nutrients and caffeine to kick start his day. Trembling fingers shook some tablets; vitamins, minerals, amino acids, JCB, and Ketamin (Special K) into the palm of his hand. He swallowed, washing them down with coffee and a couple of 10ml vials of Renshenfengwangjiang Ginseng Royal Jelly tonic (that was produced by The Third Pharmaceutical Manufactory in Harbin, China). He studied the 1959 calendar on the wall: scenes commemorating various types of aviation and war machinery used in World War Two; airplanes, soldiers operating antiaircraft guns, and mechanics repairing a tank had already graced the yellowed pages that were stained and rippled from condensation. This month; an image of a woman working on an assembly line in a munitions factory, surrounded by rows of massive dark metallic bombs with their white conical nipples pointing skyward. Jurgen recalled how, one day, autumn had suddenly transformed itself into a bleak winter that had elapsed in shades as dreary as the grey scale of a photographic emulsion which did not have sufficient sunlight to provide the correct exposure. During those few hours when the sun did arc its low trajectory along the southern horizon, Jurgen had noted its appearance by crossing off another day; filling the rows of boxes with an ‘x’ had become a ritual that provided him with his only awareness that time still existed and progressed as a sequence. It didn’t matter whether there was a discrepan‐ cy in the position of the days in the array; whether the date, a Friday in 1959, was actually a Saturday in 2010 - the names had changed but the numbers remained the same. It must be December 4th, Jurgen thought; a ‘Friday’ according to the calendar. He exhaled; a sigh, the vapor of his breath, as he recalled that at one time it had been his master plan to schedule the launch to coincide with the upcoming Christmas eve. He had believed that there was something poetic in the metaphor. After all, once his experimental digital creatures had been released into the network, they would travel


their pathless path, expanding across the network and around the globe, just like the journey of Santa during that single, special night of the year. Jurgen opened his eyes and glanced up at the familiar map nailed to the kitchen wall. The large, flat paper world had clung to the wall for many decades and was hopelessly out of date. Many of the countries no longer existed; having merged with their neighbours or now called by a name which differed from the large printed letters that spanned the irregular areas of colour that divided up the continents like a jigsaw puzzle of pale yellow, pink and green. Yet, even the accurately-named shapes, enclosed by a jagged broken line which indicated national borders, now had significance only as a means of designat� ing sales regions common to a large number of global corporations, including several portions of the map which had been obliterated by patches of fungus growing on the surface. The world, which he had once traversed, was distant in his thoughts - as abstract and as meaningless as the map. Jurgen's physical reality now extended to the distance he could see when he stepped outside the door, and even that had gradually diminished to within the confines of the quonset as the days had grown shorter then essentially disappeared. A sensory deprivation environment; everything either monotone grey or completely black - and inside the snow globe, the only sign of the external world’s existence - the eternal wind, blowing snow through rusted holes and cracks in the building’s armor. And with the sun, his energy had also gone - literally; it soon began to take an enormous amount of physical effort just to capture the few brief hours of twilight that were available. The photovoltaic panel arrays that he had set out to capture solar energy were constantly buried under the heavy snowfall delivered by the onslaught of the relentless blizzards, or during the night, covered over by massive drifts. The difficult task of clearing them often forced him to spend an hour, or more, in the pre-dawn darkness stubbornly shoveling snow against the bitter razor winds. Frost numbed his fingers and toes, a sensation which later burned like an invisible flame when his digits slowly and painfully thawed. To make matters worse, even when the panels were cleared, melted snow would soon turn to ice and build up on exposed surfaces, diffusing the meager traces of radiant energy that the panels were vainly attempting to collect. The effort it took just to maintain his existence; clearing solar panels, gathering more wood from the demolished buildings, keeping the flame alive in the stove, and thawing snow for drinking water, had become progressively harder as the darkness had closed in. It was becoming a losing battle. Jurgen discovered that he had less strength with each passing day and that it took longer to recover after pushing himself to the point of exhaustion; those times when it seemed he would collapse from the exertion. He no longer had the physical or mental stamina that he had even a month before, when the snow only lightly blanketed the ground and he had been able to work around the clock. Now time had become compressed; there were never enough hours in the day.


Inevitably he had conceded defeat; surrendering the solar panels to the snow and relying on the small wind turbine to provide the only source of power. As a result, he was forced to shut down most of the systems to keep power consumption to a mini‐ mum; using the generated electricity of the wind turbine, and reserves stored in the batteries, to run the small essential computer system on which he tested his program code - and which also provided his only connection with the outside world. Once the chill in his body had dissipated, Jurgen emerged from the kitchen and went down into the lab. Dressed in his snowsuit and gloves; with their fingertips cut off so that he could touch the keys, he would sit in front of the display and lose himself within the code. Yet, even with this protection, his body always felt chilled to the bone within the eternal darkness on the main floor of the quonset; an area which had been plunged into a deep freeze similar to a cryogenic chamber. During the few hours that he was able to work, time seemed to pass slowly. And when he had reached the limit of his endurance to sustain the cold, and when exhaustion had set in and the need for rest overcame him, he once again returned to bed... Jurgen crawled into his sleeping bag and nestled under a thick covering of clothes, plastic, blankets ~ anything which could provide insulation. His body felt tired but his mind was still alert from the chemicals; he couldn’t sleep. He glanced around the small room; the curved ceiling, the tiny window, a faded chart nailed to the wall - mapping out the detailed polarity and geometry of atomic structures, along the wall opposite the bed, a shelf that Jurgen had propped up, supporting stained, weathered books, their pages expanded and rippled from moisture, their binding no longer square, his old battered suitcase, the crumpled cardboard box in the corner filled with miscellaneous documents; such as a copy of Feynman’s papers on proton Quarks, which, during the interval since its publication in 1958, the ink on the printed sheets had been surprinted with abstract patterns of fungus and mold, and on the short, narrow shelf above his bed, a collection of personal mementos and artifacts; a now shriveled Venus flytrap still in its terrarium case - 'god' was dead, a deck of tarot cards, an hourglass he had filled with the sand he had sampled from near Wheeler Air Force Base in Hawaii, and a variety of small plastic toys which had once belonged to the former reel-to-reel shrine in his apartment in Osaka, Japan. During these evenings, when the screaming wind had been silenced by the snow, and the deep blue barren landscape was inhabited only by spirits and ghosts, there was quiet calm; sealed inside his sleeping bag within the quonset, wrapped in a thick blanket of snow which had buried the smooth curve of the building’s outer shell, the only sound his breathing, and occasionally, the snap of a piece of wood burning slowly in the cast iron stove. As he awaited sleep he stared at the patterns etched onto the broken panes of glass in the bedroom window, frozen over, an external plastic sheet, nearly opaque, illuminated by the pale diffused light of the full moon. Hunger/ cold/ pain/ life/ death; it was all the same. It was all in his mind, he thought, transcend this/that, scrawled letters in pencil on notebook pages, barely legible, fingertips cut off gloves, frostbitten and dark, scars, an intricate pattern of frost.


He cursed the darkness. He howled at the moon. Why had he come to this godfor� saken place? He had only wanted to separate himself from the world, he hadn’t expected to battle for his very survival every day. True, it had been a romantic notion, and with romance, sometimes, a harsh reality existed on the opposite side of the dream. Now he had found that his reality had been reduced to black and white; the white ground and the black sky was all that there was. His existence was tentative, suspended somewhere between the opposite of extremes; positive and negative, one and zero, life and death. He closed his eyes to shut out his reality. He entered the land of dreams... Coraline. He would dream about her at night. The dreams would seem so real: together on the mountainside beneath the castle and the stars... he could hear her voice... conversations... sometimes they would make love... sometimes it was difficult to wake up, he did not want to leave...

V. WONDERLAND

It was the night before Christmas and not a creature was stirring; Jurgen sat motionless, alone in the darkness, illuminated by the glow of the display. On screen was a world that no longer seemed familiar; the faces and images that could have been beamed in from a distant planet, or could have been the memory of a dream that he once had a long time ago... It was with reluctance that Jurgen had tentatively begun to explore the network once again, since, for some time now, he had managed to maintain radio silence; no digital communication with the outside world. With the exception of a few brief, clandestine sorties to gather the information and software needed to run his microbiology lab, he had minimized his network presence, as he knew it was critical to maintain the illusion that he had vanished from the face of the Earth. If he could be tracked at all, it would be by unraveling the carefully deliberated measures he had taken to effect the intentional disappearance; a decision taken both as a means to avoid unwanted distraction while he conducted his experiments, but more importantly, he believed, to prevent the possibility of some unspecified outside agency from arriving to intervene. Jurgen was certain by now that someone would be searching for him; Kaori, Shozo, or even his mother could have already contacted, or have been contacted by the authorities, since he was almost four months late in reporting back to work. Not only that, but it was also likely that someone at GenSynth had discovered certain accounting irregularities. To investigate either of these situations, Jurgen knew that it was entirely probable that Dr.


Sato, for instance, would contract the services of a digital security agency since the easiest way to track someone was to monitor their network activity; credit card transac‐ tions, medical records, electronic communication, and so on. And once the user’s identity had been confirmed, it was simply a matter of tracing the data streams back to their source. Yet, aside from his security concerns, Jurgen perhaps considered the need to reestablish network contact as a form of compromise; confirmation that he had reached the limit of his endurance to sustain this self-sufficient existence and selfimposed solitary confinement. Now that he had been forced to minimize the power consumption of his equipment, the progress of his experimentation no longer re‐ mained the central and sole purpose of his existence - and the less activity he had to distract him, the more the uncertainty came creeping in. And it was during those moments that he had become acutely aware that he was by himself within a quonset hut, far away from everyone and everything, during the darkest depths of the dead of an almost metaphorical winter. Perhaps he experienced the weakness of a human being fully confronting the overwhelming forces of nature, perhaps the feeling of loneliness had once again returned, or perhaps it was the fear of death. Until now it had been impossible to prepare himself for these circumstances, or even imagine this type of situation, but now that he was experiencing them, the reality came flooding in... ‘No’, he said to himself, struggling to regain equilibrium; the sense of calm balance that he customarily maintained - ‘Imagination becomes reality only when a person considers their existence to be confined within their mind’. Of course, once he had made the decision to dive back into the network, he took the necessary precautions to prepare himself; preserving his anonymity by disguising his identity using the tools at his disposal to build an intricate, ethereal architecture of pathways through a maze of digitally encrypted relays that would be very difficult to trace. Within the quonset, bathed in the cold clear light of a full moon, Jurgen resurrect‐ ed ‘the phantoms’ of his past. Now wearing this protection; cloaked in a veil of secrecy of his own design, he took the plunge, penetrating the interface of the network’s graphical surface. He was in, floating, immersed in a virtual world, mesmerized by the mindless patterns and kaleidoscope of acid colours that rippled and splashed across the screen; bitter, harsh, fluid, streaming in to refresh the display in response to every movement. He tread cautiously at first to minimize the stimuli; he needed to gradually acclimatize himself to what had once been a familiar environment... take his time... calmly explore a web of virtual domains. Yet, each random link advanced his viewpoint to a different part of the globe, triggering a flow of information and imagery which unfolded on screen like a shockwave explosion. It was all there; everything that a human being could possibly desire, tantalizing, intangible, dancing like visions of sugar plums, an electronic rush that became an overwhelming flood. Soon he found himself drowning in an ocean of data - a sensory overload of hallucinogenic dreams that verged on becoming an abstract, endless sequence of meaningless symbols; streams of deconstructed text, a collage of talking heads and perfect dimensionally rendered products that were laid


out before him like a sumptuous banquet. Drooling like Pavlov’s dog, Jurgen feasted on dazzling displays that had been programmed to arouse sensations of lust and greed and envy; propaganda messages of advertisers, news from around the world, entertainment fragments, spliced and diced and modified into bite sized packets, small enough to be easily digestible as well as cater to limited attention spans... These delicate appetizers only fueled his hunger; he wanted more... he wasn’t satisfied, he wanted to get wired, wanted to get off... the electrons blasting from the display... his eyes, focused with the intensity of an animal stalking its prey... scanning... transmitting the data into his brain... pure...uncut... signals firing off synapses and releasing chemicals which he could taste in the back of his mouth...the pulse, the frequency... the urge... he immediately felt that he had been away from the world for years, rather than just a few months. Jurgen scratched his scruffy beard. The screen had transformed into a beautiful mirror; an expression of viral software that was both innocuous and malicious - a parasite that penetrated into the core of his conscience, that even while it devoured him from the inside, externally it reflected back only whatever he wanted it to be, whatever he wanted to see. Jurgen smiled: he knew it was watching him as intently as he was watching it. He was aware that programs behind the scenes were tracking his every move. He recognized the program’s logic; present the user with an endless variety of flavours, register their responses to stimuli in order to determine their preferences then begin to narrow down the possibilities... it timed the responses; when the user was active in making a selection or when he lingered... then fed him more of what he wanted to see and hear, continually testing him, tantalizing him, guiding him, discarding the rest... until, once the user had taken the bait, it would reel him in... IT. Jurgen immediately recognized the program, it was a twisted mutation of the software he had developed at the Akademy, the software he and Rujjie had called ‘Faith’. ‘GURU’ had been developed from the source code of that same program. Perhaps programmers had augmented the software with their own code. Perhaps the code had been entirely devised by a computer processor - humans were becoming more like machines, while the machines were becoming more human. This was not what he had intended, yet Jurgen smiled because the program was effective; he felt like a proud parent, who observing a child that they had taken care to raise, eventually discovered that the child had misconstrued the intentions of the fundamental principles which the parent had attempted to convey, by implementing them in a way that the parent could never have possibly imagined. Jurgen shook his head; beautiful, misguided youth... naive, innocent vision - infused with a nondiscrimi‐ nating, vigorous energy that flowed unconstrained through the channels of rational thought, overflowed the dams constructed by conventional morality and spilled out over the delta, eroding the strata deposits of human history and burying the sedimen‐ tary layers containing the archaic fossils they hold so dear... And he was there. Scraping into that bedrock, driven along by the force of that flow... he couldn’t remember if he had requested these images, or if somehow merely a thought had been enough to summon a subconscious desire - but now alluring sirens


appeared before him; beautiful women tempting him with their naked bodies. It was illegal, yet he had found some way inside... he hadn’t given it a thought; it was second nature to circumvent the security... instinct had been his guide; perhaps the perpetual human need to transfer the genetic material which replicates the species, or in less analytical scientific terms, the sensual, emotional desire to release his seed into a perfectly formed vessel; a crystal chalice with a smoothly-curved hollow bowl mounted atop an erect phallic shaft, sealing the union with a kiss of thick vulvic lips... or perhaps the full firm lactating breasts had beckoned him once again with memories of the sensation of being nurtured as an infant suckling at his mother’s bosom... it... the program, had detected this desire and had gently guided him toward the graphical source of a fantasy interface where he was able to indulge in the activity of assembling the woman of his dreams. A vast array of components were selectable on floating menu palettes... flesh... shaped and contoured into breasts; gentle curves, volumes formed by weight and gravity, pretty pink nipples, erect. Creamy thighs; firm, trim, or flabby... tummies, armpits, ankles, feet, lips, eyes so real, a mesh of transparent skin, every colour, every size, every shape, every variety of face... select, select, select... morphing... becoming the universal woman, the perfect woman... Soon he was totally immersed within this digital reality to the point that everything else seemed to disappear. He took great pleasure in appraising several digitally enhanced models of perfection that he had created; viewing them from every angle, manipulating the positioning their anatomy as if they were a doll. Erotic poses; elongated legs spread wide, pert bottoms bent over, then rotated to face toward him on the screen, eyes closed, mouth forming the shape of an ‘o’, nipples pointing toward toes... it wasn’t until he had become painfully aware that something in his trousers had grown large, firm and twisted like the root of a tree, that his reality finally expanded from within the confines of his mind to encompass the cold, darkened interior of the quonset and the image of the idealized woman before him on the screen... it was with shock then to realize that the final version of the woman he had fabricated was remarkably similar in appearance to Coraline! She stood before him naked on the screen; her trim body, tall and lean, short dark hair, delicate features, slender arms, small firm breasts, and a narrow wedge of black pubic hair hovering just above the intersection where her muscular long legs joined her slim abdomen. Her body was everything that he imagined it to be... a body that had been denied to him in reality was right there in front of him, yet denied once again from physical contact behind the glass separating him from the pixels creating the display. It was almost too much. It took will not to be drawn into the illusion. It took will to over‐ come the urge to massage his erection, to release the immense sense of frustration that had accumulated within his swollen testicles. The awareness of his physical discomfort was suddenly accompanied by a profound sense of shame and guilt; the realization that he had succumbed to such a basic human voyeuristic state of mind that now threatened to undermine the strength and resolve he needed to carry out his mission.


He now realized that the training and skills which he had once possessed and with which he relied on to maintain the stability of his focus and intensity of concentration, had become tarnished from lack of practice. He had lost his ability to filter, differentiate and process the information as quickly as the mass of data flooded in. To escape the turbulence, Jurgen felt compelled to submerge beneath the surface to explore the calm tranquillity within the intricacies of the underlying code; down there, where he knew that his old instincts would return. Yet, he lingered, still observing the simulated Coraline on his display, lifeless but very real. She was no longer an object of lust; that dragon had been slain, but still the image conjured up an uncertain mix of conflicting emotions; love and despair, joy and sadness, which resulted in an increasingly-intense state of anxiety. It suddenly occurred to him that he should contact her... but no, he had immediately concluded that interaction could cause him to lose his tenuous grip on whatever impetus re‐ mained to see his project through to completion, since, as he had just discovered, his will was not very strong. These days he needed to continually remind himself of the importance of his mission as he was often ready to release his grasp and free fall back to Earth; any reason to escape from his task was valid. Still unwilling to return to work, yet to break the spell Coraline held over him and create movement once again, Jurgen randomly selected one of the advertisement banners along the edge of the screen. As he linked out, Coraline vanished from the screen, and instantly, Wonderland appeared... As the visible portion of the massive virtual environment rendered onto the screen; from his current point-of-view, Jurgen realized that before his eyes was an architec‐ turally engineered mutation, combining elements of a shopping mall with an amuse‐ ment park. At the moment, Jurgen’s viewpoint was outside a gateway, beneath a large sign decorated with twinkling lights which proclaimed the name and information about the site. Wonderland remained open 24 hours during every day of the year. The landscape surrounding the theme park had apparently been customized for the festive season; a crop of enormous cartoon candy canes; swirled with a helix of red and white stripes around their smooth curves, sprouted here and there, tilted at odd angles in the snowy terrain. Two gigantic Xmas trees stood like sentries near the gate, artificial snow flakes sparkled as they drifted down through the evenly distributed light while the muzak of carols played continually in the background. But the sense of cold, which made the setting more realistic, was provided by the actual chill, live within the quonset. Jurgen could pan the view or move through space by pressing buttons on the shaft of his wand, but as he attempted to advance through the gateway he was greeted by the image of a young woman dressed in a skimpy elf costume who had pranced into the frame to block his way. She wasn’t Japanese, although Jurgen could not discern what nationally she was, she reminded him of Kaori - and the Christmas two years before when she had arrived with her sister and they had first made love. It was as if Coraline had vanished from the screen and had now been replaced by Kaori; Jurgen


was beginning to feel that this experience was somewhat similar to the Charles Dickens story in which a character named Scrooge is visited by a series of ghosts who impart visions of the past, present and future... Bah Humbug! At first Jurgen had assumed that the greeter elf had been a video sequence; electronically clipped out of a studio blue screen, but as she talked to him and moved around, he realized that she was likely a digital sprite - she was too cute to be real. Her eyes were slightly too large, her skin too smooth, and he could detect a slight flatness to the polygonal mesh structure under the surface of the skin texture revealed by the cleavage of her breasts. The sprightly young girl performed her routines for several minutes as the introduc‐ tory section idled; Jurgen watched and waited - perhaps he wanted to see how well the program had been crafted, perhaps he was already experiencing the early symptoms of ‘technarcosis’; more common with prolonged exposure to digital reality. Even his brief immersion, so far, had already seemed to overload his senses... Her voice seemed sweet and seductive in its innocence, coyly enticing him to come inside by prompting him with an enthusiastic tone that alternated between pleading, coaxing and teasing. Although her wiles did not seem to have any effect on Jurgen, she had never lost her patience; she was just an endless sequence of playback loops, that consisted of permutations and combinations of prerecorded segments that the computer had seamlessly edited together: sometimes the fragments of spoken dialogue would repeat, then for variety, would be neatly spliced onto a new segment which he had not yet seen, creating the illusion that the screen was fresh, active and alive. While he waited, Jurgen had been informed that each pavilion within Wonderland functioned as an outlet for the merchandise carried by a variety of international retail chains, and that the host site was a ‘virtual subsidiary’ of the Golden Sun Corporation. To gain admission, it was required that he input his credit number; the magic password which would allow him to access the wonders of this consumer paradise. Jurgen shivered in the cool glow of the display; the emerging vapor illustrated the volume of his breath. Shopping, it seemed to him, provided the only solace for human beings who desperately wanted to escape the harsh reality of their existence, and for many, Christmas was a time when that desire threatened to become a mass consump‐ tion overdose. It was not a revelation; he had been aware of it throughout his life. Even as a child, the exchange of manufactured gifts as a means of demonstrating affection held very little significance for him. But now, removed from any association which could give it context, this display of commercialism; the gaudy, brilliant colours of the theme park, and the insincerely cheerful voice of the young greeter invoked a sensa‐ tion of revulsion and disgust which brought back into clarity those feelings, which he now realized, had been a contributing factor in choosing to isolate himself from the temptations and illusions of the material world.


It had been a spontaneous decision: He had determined that he would make a statement in response to another ludicrous apparition that devoured bandwidth of the network, which, when conceived two decades before, had been intended to facilitate the exchange of intelligent communication and enable everyone to access knowledge which could enrich their lives by providing an awareness of the world around them. His response, he had determined, would be in the form of hidden code implanted within a secure memory location deep within the computer system sustaining Wonder‐ land; a wired little program that would trigger a display hack at a predetermined time. Jurgen paused for a moment to consider whether he would be carrying out this action to be malicious, or simply as a routine exercise to keep his talents honed. Perhaps he was frustrated since he had originally planned to release his entities into the network this night, Christmas eve, but at the moment a realistic launch date still seemed far away... No, he decided, his motives were entirely altruistic; his response had been motivated by a sense of compassion for the emptiness of human existence when the need for love is replaced by the compulsion to purchase products. His impulse had been based on the desire to send a message to other people, who like himself, were alone within their own virtual reality, shopping rather than sharing the joy, peace and understanding with other real human beings which the season should bring. He disconnected from Wonderland without even trying to negotiate admission with the greeter elf outside the gateway. Instead he dusted off and plugged in his old portable storage device to call up the software files containing the tools that he needed. Caught up now in the process and the technology of what he was trying to achieve, Jurgen experienced a growing excitement. He smiled as he explored a software collection that had remained dormant for some time, suddenly regaining his sense of youthful enthusiasm; recalling hacker pranks of his teenage years when he had first learned to explore a hidden world that revealed itself to him more fully and completely the further he had descended into its hidden depths. Entries in his journal from this time would later reveal that he did not believe that the consequences of his actions would cause any serious harm. He was aware that his tactics would disrupt the income generated by the sale of products during a brief period of time, but he believed at this late hour on Christmas eve, that it would be an negligible loss of revenue for whatever corporation happened to be hosting this site. He was experienced and conscientious enough to ensure that he got in cleanly and that he would not damage any of the data which resided on the system. Anyway, he believed that it wouldn’t take long for a Sysop with a rudimentary level of skill to solve the ‘problem’ and get the system back up and running quickly. Sitting inside this ice station, lost in the expanse of permafrost covering central Iceland, it was not difficult for Jurgen to imagine Santa’s fabled workshop at the North pole. They were similar, yet in many ways opposite. Instead of elves working on the assembly line, painting faces onto dolls, Jurgen’s little helpers were the computers that now sat idle around the room. Instead of the warmth of a rustic workshop with a fire


crackling in the hearth, Jurgen was freezing his ass off in a tin can, his fingertips turning white. Instead of glowing lights framing a view of giant candy canes and snowmen, Jurgen could scratch through the frost-encrusted window to reveal a bleak, vast, barren Arctic snow field devoid of any sign of life. And since Santa Claus, within the past few decades, had become the benevolent, jolly corporate executive, Jurgen decided to take on the role of Anti-Claus, the frozen, bitter idealist. Humming Xmas carols to ward off the chill, Jurgen modeled a dimensional cartoonlike head then used the software to cycle its eyes and mouth in rudimentary animated cheerfulness. He searched his surroundings to discover the robotic Santa that Marcel had given him as a present all those years ago; a machine-made toy, carrying a brown canvas sack over its shoulder; carefully assembled from a telltale assortment of odd components. The batteries were dead ~ but Jurgen spent more time than he would have liked rigging up a method of powering it. He recorded its sound through his TVi microphone; filtering the media clip to produce jovial, although slightly demonic, Santa laughter. Jurgen smiled. He had begun to get into the Christmas spirit while he had resurrected the toy ~ a mirthfulness which had increased by watching the animated Santa head rotating on the screen. As the finishing touch, Jurgen added a few lines of code which generated a voice; creating the illusion that the movement of Santa's lips were synchronized with a simple spoken message: “Peace on Earth, Goodwill to all,” was what the Santa head had said. ‘Nice job’, Jurgen had thought to himself. The next step was to insert the file onto Wonderland’s main server, which Jurgen discovered was physically located in Los Angeles, California. It had been easy to crack its security shell. For privacy, Jurgen used an old keyboard that had its electronic identity chip scrubbed clean. Then, all he had to do was run a key-code generator until it found a match with a virtual customer’s ID. Once inside, he had created a new customer within the system, which he named ‘Jost Nicholas’, an acronym for ‘jolly old saint’. Just for fun he gave old Nick a ton of credit points; instantly the saint became a very wealthy man. From there it was just a matter of finding its graphical interface with the network, rerouting the pathways connecting it to the extensive database and rewriting the links to point to the display hack he had created for the occasion. Rubbing his hands together to maintain circulation and using his breath to warm his fingertips, Jurgen uploaded the file at about half-past ten in the evening; Iceland’s perpetual time zone is the prime meridian, zero GMT. Jurgen’s small file hopped off the dish on top of the quonset and ran quickly through a maze of relays before leaping across the surface of the planet through the linked network of satellites orbiting in space. The program was set on a timer which would trigger its launch at twelve midnight Greenwich Mean Time; 4 p.m. in Los Angeles, 2 a.m. in Paris and Rome, and 11 a.m. in Osaka. Jurgen then covered his tracks; his location was no location - the anti-Claus did not exist. Then he went up to the kitchen to get something to eat.


A short while later, sitting in the pilot's chair, ingesting chicken consume from a vacupac, Jurgen happened to glance out through the kitchen doorway to experience a vision which made him spill soup into his lap. There, as real as life, in his laboratory on the main floor of the quonset below, Jurgen was certain that he saw Cameron and Adda Stark studying his computer, quietly engaged in a conversation which he could not hear. Their faces and their clothing looked identical to the newspaper photograph he had seen; the one that had captured them disembarking from their plane after they had landed in Hawaii. Jurgen watched them for several moments, at first uncertain whether it had been another hallucination; Cameron had pointed at something on the display and Adda had responded by nodding her head. Jurgen then cautiously got out of the chair and made his way through the doorway; but as slowly as he had approached the railing of the walkway, the vision had just as quickly vanished. He stood still, his heartbeat racing, hands tightly gripping the rail, frozen in his tracks, gazing at nothing but the familiar scene that he had seen so many times before. After a long while he conscious‐ ly blinked his eyes. Trembling, he suddenly recalled the activity he had been involved in... Sitting on a kitchen chair in front of the display, Jurgen entered Wonderland at approximately ten minutes before midnight; now identified as the customer he had created - the one he'd named Jost Nicholas - Jurgen nervously glanced around the darkened quonset to make certain that the apparitions of his grandparents were not watching over his shoulder. He shivered in the cool blue light of the screen... This time a young man dressed in an elf costume greeted him at the gateway; large white teeth grinning broadly. His name tag simply read ‘Juan’. Jurgen did not stick around to watch Juan’s intro sequence variations. He simply entered Jost’s credit number and the password he had created: the word ‘present’. Instantly he was granted access. Like everyone else currently logged onto Wonderland at that moment, Jost was represented within the theme park as a three-dimensional avatar; a collection of simple geometric shapes stacked like child’s building blocks in an approximation of human anatomy. Jurgen used the wand to maneuver Jost’s avatar through space. He could see the position of many others on screen, drifting quickly between pavilions, hovering just above the ground, casting a shadow beneath them in the virtual light. It wasn’t long before he began to distinguish similarities and differences in the shape and colouration of their constructions; appearances which likely encoded information to identify their customer status to the merchants, or possibly to each other. He also discovered that the avatars were able to communicate with each other, either via voice or text boxes, as almost immediately upon entering Wonderland he was approached by a chatty avatar named Lisa; who was logged-on from South Africa. Jost did not respond verbally, only physically - by quickly moving away. This encounter was followed by several other particularly aggressive female avatars during the first few minutes in the park. Perhaps his avatar’s distinctive patterning reflected the customer profile Jurgen had created for Jost; identifying him as a wealthy young single male perhaps a mark for gold diggers. Jurgen wondered what his avatar looked like, but he


could not see himself in any of the mirrored surfaces mapped onto the structure of the pavilions. Since Wonderland was entirely computer generated and not based on actual structural dynamics, the pavilion’s design tended to be gigantic and surreal; an enormous soup can, cellular phone, pop bottle, running shoes, ten gallon hat, chicken, sunglasses, cactus, submarine, double-decker bus, or hamburger that oozed animat‐ ed ketchup and mustard, and so on... Others displayed more formal contemporary or futuristic architecture, rendered in a variety of materials that simulated the appearance of steel, plastic, wood, rubber or crystal. A midway was situated in the center of the theme park; roller coaster, Ferris wheel, tunnel of love, freak show, game arcade... a map of the site rotated in the corner of the display. Inside one pavilion, Jost scanned the variety of products that had been made available for mass consumption; they were designed to be modern and appealing. The shopper could fiddle with the gadgets; open them, look inside, change their shape and texture or move the parts around, and amuse themselves by viewing the item from any perspective that was desired. When a version met their approval, it was a simple matter to order the product on-line from a menu bar running down the right side of the screen. With the amount of credits that Jost had available, he could have purchased any product that he desired. Yet he bought nothing. He just drifted aimlessly through the promenades between the shops, awaiting the midnight hour to strike, noting the omnipresent slogan; ‘Get It All’ - on motion billboards everywhere, and listening to ‘Jingle Bells’, ‘Silent Night’, ‘Here Comes Santa Claus’ and so on... The ethereal muzak; piped into the reality of the quonset through a set of speakers near Jurgen’s display, was intermittently interrupted by disembodied digital voices asking if they could assist him. ‘No thank you’, Jurgen had answered on Jost’s behalf by selecting a generic response from the menu; he was just browsing. Back out on the fairgrounds, Jost’s avatar happened to be passing by a pavilion called Cinderella’s Fashion Gallery when the bomb went off. At the stroke of midnight, the ornate carriage metaphorically turned into a pumpkin and the glass slipper shattered. Jurgen watched with delight for several moments while the network ran the hacked display. The revolving Santa head remained in the center of the screen no matter which way Jurgen turned Jost’s viewpoint. He noticed that each of the other shoppers who were on-line were also experiencing the same effect; their avatars had either come to a halt or had begun rotating in a vain attempt to face away from the face. Jurgen had to admit that the Santa head did look crude compared with the glossy rendering of the theme park, but, he reminded himself, as with any Christmas present, it was the thought that mattered... “Peace on Earth, Goodwill to all,” Santa’s lips mouthed while its head rotated from left profile to full-frontal to right profile ~ laughing its jovial canned laughter during the


phase of the cycle when the back of its head was in view. Satisfied that everything was working fine, Jurgen logged out of the mall and shut off the computer. He was cold and tired; it had been a long day. He climbed the metal stairs up to his bedroom. Fully-dressed, he crawled into his warm sleeping bag. He sat for some time in the candle light documenting the experience in his journal, then put the book aside, blew out the candle and soon was fast asleep. He didn’t give the incident another thought. Within his isolation he would remain unaware of any effect that had been caused by his ‘harmless’ prank, nor at the time would he have had any reason to imagine that this event would provide a critical link in identifying his location to someone who had already begun the long process of obsessively tracking him down.

VI. LOKI

During the Yule-tide, Jurgen had frequently experienced the sensation that he was being watched; that the presence of mysterious forces were evident in the shadows - it seemed that he could detect movement out of the corner of his eye. Sometimes he thought he could hear the sound of hooves; horses galloping past outside, fading into the distance. At times, an unseen canine dogged his heels caused him to rapidly whirl around. Also inexplicably, objects had begun to disappear - a kitchen knife, a screw‐ driver, a pencil and his favorite coffee cup were misplaced - never to be found. These were insignificant items, but when his shoes, that he had certainly placed beside the bed before he went to sleep, had vanished in the morning, Jurgen became concerned. In the days that followed; sitting before the display screen wearing cardboard shoes that were fastened together with duct tape, Jurgen had noticed that the gremlins had also infiltrated his computer, since he was often unable to locate digital files that were certainly stored on his computer, or... unexpectedly the system would crash... These occurrences had made it much more difficult to continue with his work, especially since both his physical strength and motivation were rapidly diminishing with each passing day. Adverse conditions within the frozen interior of the quonset and fluctuations in the electricity powering his computer could have caused the hardware to malfunction, Jurgen concluded. Although he found it difficult to explain the other unsettling inci‐ dents. As he had during the perception of the ghostly apparitions of his grandparents in his workshop on Christmas eve, Jurgen had seemed willing to attribute these recent


sensory illusions to his perpetual state of exhaustion, or perhaps, to side-effects induced by the chemical enhancements he regularly consumed. He had recorded in his journal: ‘The mental and emotional wear and tear of the isolation and loneliness has disrupted my thought process, causing it to become fragile; as if brittle from the cold’. He was aware that his ‘flawed logic’ had already resulted in several poor decisions, the most notable being, ‘the foolish impetuousness of hacking into Wonder‐ land’; as he had awoke on Christmas morning to immediately regret his activities of the previous night. Perhaps now; one week later, he realized that it would be better to withdraw than to make any further mistakes - errors which could prove fatal. On New Year’s eve, 2011, finally relenting to the sensory aberrations and to the brutal forces of nature, Jurgen reluctantly decided to pull the plug on his remaining hardware systems - including his connection to the network; his only lifeline to the outside world. He bundled the equipment in a protective barrier which he had crudely fashioned from cardboard, wads of grey, pulpy asbestos and sheets of heavy plastic to insulate the hardware against the cold. Then, around midnight, when everything was securely nestled in its wrapping, he switched off a series of breakers that provided power to the main floor of the quonset. With the final click, the work area became vast, empty and silent; no tiny twinkling lights, no gentle hum of the fans - nothing. And as he stood motionless in the absence of light, Jurgen suddenly had the impression that the atmosphere had become ominous and foreboding; a sensation, he recalled, as being similar to one he had experienced during the power outage following the lightning storm in the small Czech village - the day that the Planchettes had disap‐ peared. He reached down and grasped the handle of the small sledge hammer nearby; the one that he had once used to knock over the neighbouring buildings. Hammer in hand, Jurgen escaped the darkness by retreating up the short flight of metal stairs to the living quarters at the back of the quonset; guided like a moth toward the glowing hazy light suspended from the kitchen ceiling. Then, with several mighty blows, he punched a hole through the wall that separated the kitchen from the bedroom, continuing with the task until he had managed to clear a narrow passage that he could walk through if he hunched over. He next sealed both doorways from the inside with heavy plastic sheets; the bottom corner of the flap on the bedroom doorway remaining loose to form a hatch which enabled him to access the wood supply strewn haphazardly on the floor of what had once been the office next door. The plastic barriers were designed to retain the heat supplied by the woodstove - a source augmented by two small electric heaters; one in the kitchen and one in the bedroom. Both were powered by the wind turbine mounted atop a tall stand outside the quonset - the turbine's blades, resembling a rather large eggbeater, rotated rapidly whenever there was wind. As a result of his renovations, the physical parameters of his world had diminished in size again; now to no more than a few square meters ~ a self-contained environ‐ ment which he would rarely leave. Stacked along the wall of the kitchen was the dwindling remainder of what was once an ample food cache; a supply he hoped would enable him to survive the winter. There was water, which often turned to ice in


the kitchen, even though it had been pumped from a much warmer source deep beneath the frozen ground. As a result, Jurgen seldom washed. He didn’t shave or comb his hair - just existed - minimizing his activity to conserve his energy, heat and food requirements, remaining, for the most part, fully-dressed within his sleeping bag, in a state approaching suspended animation. During this dormant period, the only way to cope with his adversary; harsh reality, was to immerse himself in some type of activity. He had browsed through the books on the shelf in the bedroom; arranged as if they were theatre props in order to create a setting which emulated a normal living environment. The collection consisted primarily of technical manuals for outdated equipment or moldy physics and chemistry text‐ books ~ although Jurgen had been pleasantly surprised to discover an anthology of Norse mythology hidden among them. Like Zinthrop with his ‘Gulliver’s Travels’, Jurgen read and reread the anthology entitled ‘The Nine Worlds’ during his self-imposed solitary confinement. Ancient Norse mythology; the Eddas and the Sagas ~ contained all the elements of a good story; comedy, tragedy, romance and farce. Jurgen discovered that the Norse belief system was simple and unburdened by theology and dogma. No salvation was possible or necessary. Immortality came only to warriors who died in battle, whose bodies were gathered up by the Valkyries; the warrior maids, and carried off on their horses to Valhalla. In other sections of the book, Jurgen had learned about the roots of contem‐ porary customs and folklore which had been adopted by generations of people who lived in the Northern lands. And it was in one chapter of ‘The Nine Worlds’ that Jurgen believed he had discovered an explanation for the phenomena he had recently experienced, and as he thought about it, realized he had occasionally experienced in the past. Jurgen had learned that, for centuries, perhaps millennia, the Yule-tide had been the most significant ceremony in Scandinavian culture; a period beginning with the Winter Solstice; the longest night of the year - the Mother Night, and ending at the Twelfth night. It spanned the interval between one year and the next; the border between the living and the dead. These were the nights ‘when the Wyrd may be turned - when doom is set’, when 'human dominion on Earth is at its weakest, and those of the Otherworld; the trolls, dark elves and wights from the underground, were able to wander freely'. And at the border, where the worlds overlap; 'the ghosts of the dead return to visit their old home to make sure that everything is right'. Also during this time of year, the thirteen Jolasveinar; the dirty, mischievous Yuleswains ~ Christmas elves with names like Pot-licker, Skirt-blower, Sausage-grabber, Window-peeper, and Candle-scrounger, arrived to play tricks and steal food and candles from people’s homes ~ or even kidnap those children who had been excep‐ tionally bad. Jurgen now understood that he had been menaced and tormented by these horrible little creatures who had managed to conceal themselves from view. As he placed a log on the fire Jurgen realized that he understood he had already experienced the magic of this land. Yet, it hadn’t been until he had read the story,


which provided the context, that the lesson could be learned: ‘The Yule log burning brightly through the night, tiding over humanity until the light returns ~ making a sacrifice to the darkness to prompt daylight to return...’ Considering his own tenuous existence, Jurgen appreciated the timely source of comfort he had discovered within the holistic philosophy of Norse mythology; legends in which the ‘darker’ aspects of nature were accepted, rather than labeled as some‐ thing ‘evil’; which, it seemed, contemporary religions were often prone to do. The more he had read of ‘The Nine Worlds’, the clearer his understanding became that the stories contained profound perceptions which opposed the historical depiction of Vikings as pagan barbarians. Jurgen had discovered in Norse cosmology that life and death were not considered to be the polarized absolutes they are often imagined today. In this ancient belief system, existence was perceived as a wheel that perpetu‐ ally cycled ~ emerging from darkness into light, or from light into darkness ~ like the phases of the moon - a movement held in balance by the unseen forces within the universe - which they called the Wyrd. And within both life and nature, the phase of the cycle associated with death, or Winter, had been perceived as a time of reckoning, of cleansing, of energy restructuring - a state in which chaos would be transformed into order once again - a process which would manifest a new state of being; rejuvenation, resurrection or rebirth. Jurgen had recognized this principle as one which later formed the foundation of modern physics; that energy could neither be created nor destroyed, it could only be transformed. And thus, the ancients believed, that although life is transitory, the soul remained eternal - that even though an individual’s human form would one day cease to exist, the spirit inhabiting that form would eventually return. The concept; that everything was 'transient and ever-changing', was also reflected in the fascinating legend of Ragnarok - ‘The Twilight (or Doom) of the Gods’; the cataclysmic battle that resulted in the destruction of the world... Yet, before Jurgen had been able to grasp the full significance of this event, he found it necessary to explore the narrative within the legends further: The Norse pantheon consisted of a cast of characters who each played a distinctive role within an elaborate play. The Aesir; a group of gods and goddesses associated with poetry, magic, and war, and the Vanir; deities of fertility and fortune. Jurgen learned that their characteristics and attributes had been intended metaphorically; as a means of illustrating various human situations and traits - and that the legends; the storytelling medium of its time, similar to modern motion pictures, elevated the actors to a level of grandeur which made them appear to be ‘larger than life’. Of this eclectic cast, it was the character named Loki, whom Jurgen could most closely identify with. Always the outsider, Loki had discovered that he could gain favour with the major deities by using his ingenuity to create devices and artifacts which enhanced their power and prestige. He provided Thor; the God of Thunder, with his mighty hammer, Odin with an enchanted multiplying ring, and Freyr with a ship; the


Skibladne, which magically, could be folded to a compact size which enabled it to fit inside a pocket. Jurgen had thought it significant that the ‘top gods’ of the Norse pantheon did not have the ability to conceive of, or manufacture these things for themselves, but, as is still typical of the rulers and the corporate elite of today, they were certainly in a position to exploit the capabilities of the technology they had acquired. As Jurgen had interpreted the myths, the character of Loki seemed to represent the spirit of alchemy which has existed throughout time; the directed effort of those select few who have chosen to use their skill and wisdom in devising new inventions to improve human lives, and provide a method for humanity to gain some insight into the otherwise impenetrable mysteries. Loki was the archetype of the fool: whose inspira‐ tion was drawn from a vast reservoir of purity and innocence. He was the clever, cunning trickster; a shape-shifter who was inclined to disregard authority, to transgress boundaries in disguise, and most importantly, use his magic to initiate conflict and dissension which forced both gods and humans to overcome the stasis of their complacent tendencies. Yet it was not malice, but kindness that motivated Loki to act as the catalyst for the resulting struggle, exertion and endeavor of the humans and the gods. Jurgen believed that ultimately Loki was serving a higher purpose, since the changes he had set in motion were intended to maintain equilibrium by shifting the energy patterns that flow throughout the universe. Yet, perhaps Loki’s efforts had been in vain since his initiatives had not produced the desired effect; the balance had not shifted in a positive manner. Resisted by both gods and humans, since radical change is never welcome, they had attempted to maintain the status quo by choosing not to respond to his challenges. And naturally, whenever there is inactivity, entropy appears; causing any situation, in which it takes effect, to slowly begin to deteriorate. Also apparent, as conditions worsened, was that as the power of the technological capabilities of Loki’s inventions increased, they had quickly grown more difficult to control. Thus, what had originally been intended to provide wondrous benefits to mankind, had instead become harmful weapons. As the outsider, Loki had been afforded a perspective which enabled him to see the situation clearly; he had recognized that the gods were no longer harmonious with nature and that they had lost their love and compassion for the people that they governed. Yet, in the eternal paradox, it was the outsider who was not to be believed; rather than blame the handsome, affluent, charming gods for their problems, the people had convinced themselves that it was the trickster - the sly god - who was culpable. After all, it had been Loki who had meddled with the balance of energy in his attempt to create a better world, and it was Loki who had designed the devices which had ultimately caused them harm. As a result, it seemed, Loki had become the enemy of the people, although, Jurgen considered that a more accurate interpretation would be that the enemy, in actuality, was a manifestation within the people's own minds and souls.


This, of course, was the beginning of the end ~ it had to be... was it possible for there to be any other way that the story-teller could entertain and enlighten an audience other than by concluding the tale with a dramatic and spectacular ending? Thus, the period of time during which a sequence of tragic events occurred, which ultimately culminated in the climactic battle known as Ragnarok, were referred to as the ‘Dark Age’; perhaps a time which had already existed, or a time that is yet to come, or both; since in Scandinavian culture, intervals during which the spirit of every living thing is cast into darkness, Jurgen had recognized, was considered to be a recurrent event. And it was during the Dark Age that the Fimbulvetr; the winter of all winters, continued for three long years without relenting in its intensity. And it was during this Age when the beasts broke free of their bonds; the gigantic wolves that devoured the sun and the moon and caused the stars to vanish from the sky, and an enormous serpent which had been awakened from the oceans depths to create earthquakes and tidal waves that shook the world and caused massive devastation upon the land. And ultimately, without the guidance or protection of the gods - wickedness, illness and misery overcame the people: mothers abandoned their husbands to seduce their sons, and brothers ripped out each other’s hearts... Yet, during this time of darkness and crises, Jurgen found it significant that Loki had not abandoned the people. Although, it was possible that his heroic action had been a means of avenging the betrayal by the major divinities who had misused his gifts and abilities, it was more likely, Jurgen believed, that Loki had forced the cycle to its conclusion because he had recognized that the only solution was to clear the way for a new beginning ~ to liberate new forces. As he set off on his mission, Loki had gathered together a legion of doom ~ consisting of giants, dwarves, demons and the undead, leading them into battle against Asgard; the domain of the gods. In the battle which ensued, ‘The Nine Worlds’ were consumed in flames before they had sunk beneath the waves... Jurgen had recognized that the revolution had actually been a metaphor; that Ragnarok represented the end of an era ~ a shift in consciousness ~ rather than an epic tale of total annihilation. This understanding reaffirmed notions which he had already discovered which were intrinsic to Nordic culture; that death, winter and destruction were a natural part of the universal cycle, and that these events provided an opportunity for the growth and development of new concepts and objectives, since only through the ‘chaotic’ disintegration of an existing structure could transcendence truly be attained. Ragnarok had been a way to erase an outmoded way of thinking and living; one which was not inherently ‘bad’, or ‘wrong’. Simply, the time had arrived to clear away the crumbling structures supported by the foundations of the old world, so that a new abundant world could arise. According to the legend of Ragnarok, following the conflagration, the world as it had been had suddenly ceased to exist. The destruction had claimed the life of Loki, the entire pantheon, as well as most of humanity. Although, reincarnation had been


implied in the aftermath of the battle; the children of the vanquished gods had survived to watch over the beginning of a new age, and a human man and woman ~ who had sheltered under the branches of the Yggdrasil during the conflict, emerged to repopu‐ late the earth. Light had again returned once darkness had been dispelled.

VII. THE JOURNAL

Although the darkness of his winter seemed to last forever, Jurgen had been inspired by the strength of character displayed by the heroes in the Nordic legends, and had managed to summon the courage to continue on. During January and February, his food supplies had dwindled, along with the wood stored in a haphazard pile of broken boards, scattered across the floor of the room next door ~ that had once been the Stark’s office. Unable to exit the snow-bound quonset and weakened from lack of adequate nutrition, Jurgen scavenged any form of flammable material that he could find nearby; everything from broom handles to books, paper, cardboard boxes, and even items of furniture - the dresser, chairs and shelves deconstructing them with the small sledge hammer to stingily feed the woodstove's flames. Confined within his tiny bedroom, in addition to sleeping and reading, Jurgen had also spent considerable time writing in his journals. Every day, to remain mentally alert, he would exercise his mind by continuing to develop the theory and technical documentation on which his upcoming experiments would be based: propped up in bed, wrapped in the warmth of thick blankets, he would rest with his back against the kitchen wall and the journal cradled in his lap, sketching out quick impressions of the thoughts and ideas running around his head. A pencil inscribed sequences of letters in tiny script onto the pages of the bound journal; pages illuminated by the gently flickering, ghostly glow of a white candle and a sliver of moonlight that shone dimly through the plastic covering the window. In time, his candles had melted away, leaving an accumulation of hardened wax to gradually form stalactites beneath the rusty can wired onto the metal frame of his bed. Jurgen had filled nearly every page of several journals with a dense texture of notes, mathematical formulas and sketches. This eventuality necessitated the use of ‘free space’ within some of the ancient waterlogged books that had remained in the quonset since his grandparent’s time; those remaining few books which had not yet fueled the fire. Jurgen inserted his notes in the gaps between - occasionally overlap‐


ping or superimposed upon - existing lines of printed text; his hasty scrawl often spilled out to flood the margins making it even more difficult to discern the sentence structure of the paragraphs. When he was tired, his writing appeared to consist of a rambling series of disjointed fragments; perhaps these cryptic passages had intentionally been encoded in a manner which would be difficult for anyone but him to decipher. Yet, for the most part, the entries were lucid; primarily detailed technical notes interspersed with elaboratelycomplex diagrams. As well, there were many pages filled with strings of computer instructions that comprised nearly complete handwritten programs. Interestingly, under careful examination, once they had been laid down in Jurgen’s customary manner of printing the letterforms, rather than using cursive script, his code revealed very few instances in which the symbols had been erased or revised in any way. Jurgen had frequently used his journals to explore the challenging theoretical or philosophical concepts that had arisen during the time he had been alone, as though by documenting his inner dialogue he had been provided with a method of evaluating the clarity of his own thought processes. Occasionally, when struck by the muse, his reflections had a poetic quality reminiscent of the insights recorded by his grandmoth‐ er, Adda Stark; whose skillful ability to interweave principles from both science and art had often inspired Jurgen with the beautiful imagery her words had conjured within his imagination. The following excerpts from Jurgen’s journal - likely recorded at intervals during January, 2011 - are separated by hyphens to indicate how they had been interspersed throughout the pages of a book of Norse mythology entitled; ‘The Nine Worlds’. Often, whenever entries related directly to the original printed text nearby, Jurgen had simply circled words or phrases from the passages as a form of short-hand, eliminating the need to write them out for himself: “In the beginning, the Wyrd; the unseen influence behind all events - all possibilities exist within the swirling firmament of potential energy - everything is interconnected like a web - the original form - a simple, ordered system - millions of years ago - the protean transformation; strings of carbon molecules had begun to exist - independent from the clay medium with which they had once bonded - free particles sustained by the sun - animated by energy - the Becoming - the manifestation of life.” “And this code went forth into virgin terrain - in time, other simple entities had been conceived - and they too went forth and flourished by absorbing nutrients - integrating chemical elements into their structure - then through a long process of trial and error evolution - modified by random mutation or programmed variations - a multitude eventually appeared; trees, flowers, animals, birds, fish, reptiles, bacteria, viruses... a population which increased in number - diversified and expanded within their en‐ closed environment - many species had grown larger - as their instruction sets increased in size, it became necessary for them to sustain themselves by acquiring a greater amount of the shared resources - the once pristine environment gradually


became a Darwinian jungle - a competition in which each entity discovered unique methods to adapt - modifying their physical characteristics or developing highly advanced skills - some became predators - using their power, size and ferocity to consume other entities - while other less detectable, shorter fragments of code acted as parasites by sharing the instruction sets of their host - in either case, they primarily preyed upon those gentler entities whose strength was their ability to reproduce in great numbers - survival of the fittest meant not only keeping the physical body from harm - to avoid becoming discorporate - more importantly - the most successful versions of the species - those best suited - using any means necessary - had the ability to pass along their instruction sets to their progeny - evolution means never having to say you’re sorry.” “Ceaseless struggle became the legacy for all species - instinctually driven by fear; survival - desire; reproduction - continually developing new methods to sustain existence - endless variations - to avoid predators or seek out prey - and always prime - to discover the most attractive mate - some species formed symbiotic relationships with other species - their strengths and abilities compensating for the weaknesses of their counterpart - mutually advantageous business-like mergers - although, more often, species formed relationships with others of like kind - communities or societies in which the individual was dedicated to the objectives of the collective - in return participated in the wealth of its accumulated resources and shared attributes - this complex arrangement often appeared to function as a single entity; forest, hive, city, corporation - it operated at a more advanced level of development than any of its individual constituent components could attain on their own - and one species in particular - cognizant of their own existence - eventually became aware of the nested communal hierarchies within the structure of nature - societies of atoms formed cells cells formed the body - the body existed on a planet orbiting a star - the stars formed galaxies within a universe - yet, what atoms were made of, or what the universe was part of - was beyond their vision or their ability to comprehend - but that really didn’t matter - it was a civilization that had the potential to be an effective collective process able to use the diversity of skills and abilities of its citizens to ensure that everyone lived a fulfilling life - effectively and fairly managing its resources and its population and distributing the sum of its accumulated knowledge to enrich their minds - consen‐ sus - a common sense - those were the more important concepts which each citizen needed to simply comprehend... the Wyrd, the Akasha, the Aether, the Eternal Spirit, the Generator, whatever it was named - that vast unknowable source of the energy which permeates all universes great and small - that is all - all that is required is to attune its frequency - to achieve harmony with its wavelength - enlightenment - bliss...” + ...for some reason, Jurgen had marked the end of each day’s entry with a ‘+’ sign. It is intriguing that Jurgen had chosen to analyze the evolution of carbon based life; from the simple amoebae to human civilization, in the past tense. Although Jurgen’s journal entries often reveal his faith that at the core of human existence was the quest


for the truth, it was as if, during his contemplation, he had come to the conclusion that the process was incomplete; that mankind still had needed to evolve considerably further before it would be able to achieve an advanced state which could truly be called civilization. One marginal note in the journal read; “Considering human life as a form of virus is one way of understanding the course of history.” Perhaps Jurgen had considered that, even in the ancient pagan religion of the Nordic lands - the Asatru - humanity would never be able to achieve perfection in its entirety; that ‘Valhalla’ was reserved for the few who had devoted themselves to the nine noble virtues: courage, truth, honour, fidelity, discipline, hospitality, industrious‐ ness, self-reliance, and perseverance - a state attainable only once an individual had conquered all human difficulties and had dedicated themselves to the spiritual path purifying their mind, body, and spirit: ... “The State is fictitious - it is merely a convenient way to define a group of individuals - who have formed a common, interconnected relationship - without the rigid structure imposed - by the highly complex environment of modern industrialism - the rules and the bureaucracy of the lawgivers and enforcers; the kings, the politicians, the corporate presidents and the authorities - whose motivation is always driven - first and foremost by their own survival needs - often corrupted by greed and the masochistic dominance afforded by their position of power - most humans - if left to themselves - tend to the good - tend to peacefully co-exist with nature - tend to align themselves with the subtle forces of the greater invisible energy of which everything is simply an element.” “Anarchy is feared - because it is divergent from the programming - the pattern of centuries - established by those who have made the laws - who primarily benefit from the laws - and whose progeny inherit a position within society that will enable them, in the future, to make the laws themselves - and while the rules prevent the individual from achieving their full potential - since none can rise above the status of the lawgiver without breaking the law - violent overthrow - hostile takeover - the majority of the citizens - who dutifully obey the laws - do so because they are content to benefit from the protection provided by the laws - protection from those individuals within society who are weak of will or morally corrupt - even if it means relinquishing all control over the management of their own affairs - or their ability to determine their own destiny that is how society has evolved.” “Yet in nature - from a human perspective - anarchy is inherent in everything - it is a state in which disorder and chaos are merely complex patterns which are unable to be differentiated by the rigid framework of rule-based thought - everything exists in a state of lawless uncertainty - from the atom to the universe - since perfection can only be achieved by expanding beyond the rational perception of the senses.” +


Comparisons between carbon-based and energy-based life-forms were explored further in the following entry. Jurgen had reprised the theme of ‘genesis’, suggesting that the creator; identified by the encircled word ‘Loki’ within the mythological pas‐ sages - in developing digital entities specifically suited to their unique environment, had modified the biological model of evolution in order to minimize what are perceived to be the errors in design which have ultimately led to mankind’s deficiencies: ... “In the beginning - (once again) - the generator emanates the frequency of the infinite cycle - the majestic sine wave enveloping space and time - oscillating between everything; the Wyrd - and nothingness; a tabula rasa - peaks and valleys of the same fluctuating energy force - and Loki; the technical alchemist - stared into the blank screen - and thought a thought - from which emerged a fragment of pure code - a digital entity - assembly language instructions read directly by the computer’s central processing unit - compact and efficient - fractal compression - the binary duality of digital notation - a sequence of programmed instructions - a pattern - ones and zeros the absence or presence of electrons - particles sustained by the energy of the Sun...” “And this digital entity - the firstling - a discrete unit of artificial life - went forth into the void - a simple cellular creature in a vast digital ocean - and in time - Loki had conceived of other entities - and they too went forth and flourished - the only purpose for their existence was to sustain themselves - to continually seek out relevant fragments of information resident within the system - and the digital species were peaceful - their mutual benefit relied on sustained interaction - the continued wellbeing of every member was essential to their ‘society’ - a society which would not dissolve into factions - which could not erupt into civil war - unlike creatures in the physical world, they did not need to consume each other - or compete for resources within their environment in order to survive - all data in the network is nourished by the same central force - the solar energy which powers the system - the species were able to detect conditions within the environment - indicators which determined how they manage - their own population growth - reproducing when necessary - limiting their own life span in order to maintain levels - within the capacity of their medium to support their existence.” “Loki tested and evaluated the code - their instruction set - the code at the core of their being which determined their function and behavior - their response to their environment - how they communicated with one another - how the messages were sent and received - how this information would be acted upon - and Loki encouraged it to evolve - modifying it by selective breeding - random mutation or programmed variations - flexible, adaptable, mutational - then selected from the most successful designs - the instruction sets were refined - resulting in species that were optimally suited to their environment - the vast network - the digital web which connected computers around the planet.” “Within the interconnected web - each entity functions as a genetic logical machine - an independent node - cellular - similar to neurons within the brain - they existed in a


perpetually restless state - transitional - able to retrieve data in a highly organized manner - heuristic selection - detecting patterns - seeking data similarities in the target code that are logically connected to its core concepts - the information content of the data packet they transport as their payload - a fragment of their creator’s original memory - axioms - the starting point for acquiring, substituting, transforming, eliminat‐ ing and chaining all subsequent code fragments - differentiation - evaluation - natural selection - making interpretation possible - verifying the information - determining its importance by examining its status within the hierarchy of the system in which it is contained - analyzing its ancestry; when the data had been created - how often it had been accessed - and if/how it had been modified from a previous state - a copy of the new data not just appended to the entity’s existing code structure - but integrated into its being - like card players drawing and discarding from a hand - meaningful informa‐ tion is retained - less vital information is selectively eliminated - restructuring their payload as they replicate themselves.” “Replication - information content also evolves through interaction with other entities they encounter - when they meet, they exchange code - a handshake deter‐ mining the other’s identity - if they are compatible, the entities couple - deriving new code fragments from the merged data of their differentiated cores - manufacturing a hybrid copy of their composite code - which splits off to become the next generation in turn going out in search of a compliment - in this way an individual’s genetic code survives in its continuers - the replication process progressing for as long as the sun shines - providing electrical power to the network - immortality.” “The entities cycle through their instruction set - report/ seek/ send/ edit/ clear/ transmit/ stop - their activity synchronized with the rhythm - of the internal clock of the system in which they reside - instructions to examine their own status - to monitor their surrounding environment - to avoid detection and erasure - to discover safe locations to temporarily reside - examining the code in adjacent storage locations - to continual‐ ly forage for new information - access forbidden knowledge - an architecture of relationships - recognition - a shifting dynamic of integrated patterns as intricate as a fractal - an interactive exchange emulating the qualities of knowledge, intelligence and memory - learning to create more complex relationships with their environment associating concepts more readily - generating interpretations more rapidly - con‐ structing more advanced versions of themselves - as clusters of molecules - increasing their ability to exchange encoded information with each other - as bees within the hive mind - communicating simultaneously over great distances - as electrons - forming intelligent thought - as the neural network within the brain - the collective memory each gem polished and refined - each gem reflecting every other gem - the net of Indra - the meta-structure - a collective of all entities - linked - continually evolving toward a condition of greater understanding - awareness - consciousness.” + Similar to the journal pages he had textured with program code, this interesting stream of word association had also remained unedited; each word that had been


etched into the ancient yellowed paper of the book showed no sign of erasure or alteration. By late February, it was apparent that fear and doubt had once again begun to creep into Jurgen’s mind, since correspondingly, his journal entries had shifted in their tone. He had noted that his courage and resolve had begun to waver, likening it to; “the flickering flame in the tiny wax pool of the remnants of the candle”. And as his body continued to lose its strength, he occasionally wondered in which manner he would most likely perish; whether he would freeze to death in his sleep from the intense cold, or starve; since food was scarce - all that remained were a few meager rations; nutrition supplements in tablet form and vacupacs of powdered ‘yellow dove’ juice. Some entries further revealed his increasing difficulty in maintaining a balanced state of mind, since often he expressed the fear of being swallowed up by the dark night, or being consumed by dreams which had begun to occur during times, he believed, that he had been wide awake. Yet, his impetus to valiantly persevere had been his realization that it was neces‐ sary to honour the commitment he had made to himself: to complete the project he had commenced. That would be The Pact - The Test; all of the challenges that he had endured suddenly seemed to enhance the significance of the mission: it became apparent to him, more now than ever, that this was the reason that he had been placed on this Earth - that this was his destiny to fulfill. And with that revelation, rather than fending off the dreams which lately had possessed him, he instead began to immerse himself more completely within these visions to; “learn of their secrets”: “The hero descends into the dark deep Ocean - the virtuous one - determined to discover the enormous, smooth, opalescent Pearl which encapsulates All Light stolen from the world - but just as the hero attains the treasure - finally holds it in his grasp - the pressure of the depths close in to crush away his life - unable to surface because of the massive weight he bears - the hero comes face to face with death who has assumed the form of a beautiful woman - he realizes then that his only chance to escape is to embrace death - to subdue her with his passion - but the energy it takes to accomplish this causes him to become discorporate - in his final moments - his last act is to form a crack in the surface of the Pearl - and as the light is liberated - his body, mind and soul are atomized - to join the particles of light dis‐ persed in an orgasmic rush of energy - returning to its source.”


VIII. THE CHEMICAL BRIDE

The vast, unseen universal mechanism which turned the planetary gears had once again caused the northern regions of the Earth to slowly tilt toward the sun. With every passing day, the point which demarcated the closest distance between the two celestial bodies had etched an imaginary band that girdled the circumference of the globe, and had gradually traversed its surface from the Tropic of Capricorn toward the equator. The planet’s rotation, tilt and orbit about the nearby star created a perfect arrangement of overlapping sine waves; harmonic frequencies that designated days and seasons and years - creating an endless cycle of potential states which were continually in flux - eventually springtime. By early March, the lengthening days and the warm Gulf Stream had delivered heat and light to the shadow side of the planet; magical properties which released the shackles that had held Jurgen captive during his banishment to a land of darkness and despair. During the winter it had often seemed that his fate was similar to Loki; who had been constrained until the end of time by the dissected bowels of his son Narfi, impaled on three sharp, jagged rocks, with a poisonous serpent placed above his head to drip its acid venom onto his face. Like Loki, the lesson Jurgen had learned was that darkness was an aspect of nature which must be recognized and accepted, since to ignore or deny its existence often meant an exchange for one’s own existence; that was the price of ignorance... The first sunny day in weeks! What was that firey object in the sky? Jurgen emerged from hibernation after being trapped within the quonset cave; his womb, or tomb, and his ordeal, as an emaciated skeleton. Shuffling out of the quonset, he allowed the rays of sunshine to warm his bones. The snow would soon be melting out in the barrens... He had survived! He smiled. He laughed. The radiant energy was pure joy... It was a time of rejuvenation; a time to renew his work. With increasing enthusiasm he revived the dusty machines that had remained idle for the past several months and repaired the stands of solar panels that had crumbled under the weight of the snow. He gathered more firewood, defrosted the pipes and primed the pump, took an inventory of his meager remaining food rations, and catalogued the damage to the hardware, ordering replacement parts and supplies from sources throughout the network; directing the shipments to a warehouse in Reykjavik. This time, to pay for the merchandise, he used the credits he had accumulated in his own bank accounts. The accounts had remained dormant, and although he realized that this activity could trigger detection, he was willing to risk it... He was ready to move into the final phase of the project; the final roll of the dice. After what he had been through, he was prepared for it; nothing could stop him now.


During his confinement, Jurgen had given careful consideration to the resources that would realistically be needed to complete his mission. Although, once on-line, purchase decisions often became impulsive. Once again the flood of data streaming in had disoriented him; the vibrant colours, the pulsing beat, even at the sites of compa‐ nies supplying high end technical equipment. As a result he ordered more supplies than he actually needed, particularly food - he craved everything, and soon his finances became depleted. As he sat before the display, scheduling the deliveries, he thought about Solla... she was a pleasant memory; a happy thought from his past - one night in Reykjavik... was like a year in any other place. He wondered if she had followed-through on her obligation to the pilot. If she had, Erik would definitely be Erik the Lucky. Then for a moment he imagined that it could be possible that she would come to him if he was able to contact her; that she would fly out on-board the plane carrying the supplies. Then he laughed and shook his head as he looked around the interior of the quonset; what woman in her right mind would come to a place like this? He couldn’t even imagine how he himself might appear to someone from the outside world. Although he hadn’t seen his own reflection in a mirror for several months, he knew that it was likely a frightful sight. Finally, one day, a few weeks later, the airplane from Reykjavik buzzed low over the landing strip, rattling the corrugated metal walls of the quonset. Jurgen stumbled outside into the daylight in his weird cardboard shoes to watch the old plane come in for a landing, swooping down from the sky, the engines roaring like angry demons. It had skis in place of wheels that sent up a blizzard, tossed back by the propellers as it plowed through the deep snow which covered the runway. It was a welcome sight; Erik the Viking and his plane landing with the delivery. As the plane taxied to a stop, Jurgen tried to recall what the pilot looked like. It wasn’t until the tall, husky young man with white blonde hair and long mustache emerged from the tiny door at the front of the plane that the image completely formed. The sole occupant of the plane was the first human contact that Jurgen had experienced during his self-imposed exile ~ Had Jurgen perceived that the pilot had crossed himself upon first noticing him; as if his facial hair had given him the appear‐ ance of a werewolf? The good-natured young man was somewhat surprised, but relieved, that Jurgen had survived the winter. Erik spoke a hybrid language which merged both Icelandic and English, uttered in a series of rapid fire bursts, it produced a result which Jurgen often had no idea what he was saying; a language which would be impossible for even a digital linguistic translator to decode. Noting that Jurgen was thin, gaunt and pale, naturally the pilot inquired about what he had been doing. Jurgen muttered something about conducting remote seismic and atmospheric weather tests for one of the large corporations ~ The nature of the research was secretive, and for that reason he could not invite the pilot into the quonset. Both of them knew the story wasn’t true, but what did it really matter? It was his story, and he was sticking to it. Besides Jurgen knew that the actual truth would be stranger than fiction, and that it


would be impossible for the young pilot to even begin to comprehend. Jurgen and the pilot spent about thirty minutes off-loading the plane. The supplies had been packed in small boxes; food, medical equipment, tools and computer hardware components and a couple of pairs of brand new hiking boots. Jurgen examined the shipping labels on each box to determine that everything had been delivered. Every component was critical. He was especially enthusiastic about the coffee; mentioning to Erik that he hadn’t had a good cup of coffee in months. Jurgen was now grinning from ear to ear, the hood of his tattered parka slung across his back, his long dirty dark hair blowing in the breeze. “Yaw, coffee good!”, said the pilot, grimly nodding, struggling to hoist the last of the heavy crates from the open freight door on the side of the plane and set it down gently into the snow bank. There was enough high explosives in these boxes to blow up a small town. Erik didn’t say a thing about it. The airline had at first refused to deliver this component of the shipment, but Jurgen had transferred a substantial amount of bonus credits into their account to make it worth their while. It was an extravagant gesture but Jurgen realized that he would soon have no need for bank accounts. Besides it seemed a fair reward for the commitment that the staff of IcelandicAir Charters had provided in supplying him with his lifeline to the outside world. They had stored the shipments in their warehouse during the interim, then when everything had arrived, they were loaded on the plane for delivery. Needless to say, they were extremely suspicious about Jurgen’s secretive activity. They also thought it was odd that he was receiving unusual shipments from various locations around the world. As a result, Jurgen had taken extra care to ensure that the ‘paperwork’ was in order so that no irregularities need be reported to the Authorities. Erik noted that Jurgen had difficulty struggling to load the heavy boxes onto a make-shift sleigh; a large sheet of tin, curved on one end and attached to a handle fashioned from a length of electrical cable. Although he had been willing to help Jurgen move them across the patch of slushy ground between the landing strip and the quonset, Jurgen politely declined the pilot's offer: “Thanks Erik. It’s okay, I’ll manage,” Jurgen had said. “Bless!” the pilot had said as he climbed aboard through the narrow door. It was already growing dark as the plane, empty now, bounced along the snow drifts and took to the sky. Jurgen watched as it flew into the distance. The flashing light on the bottom of the plane was now high above the shallow parabolic path which the afternoon sun had just traced as it had arched above the chain of distant, rugged mountains which stood low along the southern horizon. The setting sun melted into the frozen wasteland like a dull, blood red stain that gradually faded into total darkness as Jurgen wearily continued to drag the heavily laden sled along the compacted trail he had carved through the snow.


The pilot was already back in Reykjavik by the time Jurgen had finally dragged the last of the containers inside the shelter of the quonset. Although exhausted, Jurgen was anxious to examine the contents of the collection of wooden crates, plastic containers and cardboard boxes that now surrounded him. With a crowbar, sledge hammer and razor knife he opened the parcels as excited as a child at Christmas; clothing, hiking boots, sunglasses, glue, tape, clamps, aluminum tubes, more rolls of plastic sheets and seeds to once again rebuild the greenhouse. Pencils, journals, candles, toilet paper, tooth paste, alcohol and chocolate bars. Computer hardware components; replacement motherboards, optical cables and connectors, antistatic IC inserter, and a variety of technical tools; wire cutters, crimpers, strippers, pliers, extractors, connectors, screw drivers, probes, scopes, testers, battery charger, solder, heat sink, magnifying lenses and so on... Of course, boxes of edible supplies made up a large portion of the shipment; mostly dehydrated and ‘smart’ foods - neutraceuticals - which enhanced nutrition levels and increased calorie counts. Most were in the form of bars or sticks, cylindrical plastic tubes partially filled with powder - just add water - as well as transdermal nutritional delivery systems - patches worn on the surface of the skin to time release vitamins, minerals and amino acids throughout the day or night. And as a special treat although they would not keep long - he had ordered a small quantity of real food, all imported from Denmark; fruit ~ apples, oranges, yellow doves, mangoes, bananas, ~ vegetables; broccoli, celery, mushrooms, zucchini, green peppers, milk, butter and a few loaves of bread ~ just enough to once again savor the texture and flavour of natural unprocessed food. He had saved the best for the last; one dozen pure white packages; each the size of a shoe box, designated only by a corporate logo in bold, angular black stylized symbols representing three letters; Z, P and C. Jurgen had discovered Zanadu Pharmaceutical Corporation by chance while surfing the net to find sources for his medical supplies. ZPC operated a research laboratory in Switzerland that created experimental synthetic chemical products, which, they claimed, were designed to increase mental and physical stamina as well as improve memory and intelligence. Following an email message to the Swiss lab, Jurgen had promptly received a reply from Dr. Brenner; a heavy-set older woman, whose closely-cropped grey hair was styled in a similar manner to the way men had worn their hair during the 1950’s. Her dark eyes and stern countenance; which featured prominent cheekbones, created the somewhat contradictory appearance of a severe but kindly grandmother. During their TVi conversation, she had become intrigued with Jurgen; who she would later describe as “A strange young man living in Iceland, with pale skin, an intense expres‐ sion, and long black hair that was in complete disarray”. She was impressed by Jurgen’s knowledge of the commercial product lines they carried, and following their lengthy conversation, she had agreed to send him some of the new experimental products that were currently in development ~ recent advances in genomics had fueled chemical enhancements which were designed to directly interact with specific genes. Needless to say, Dr. Brenner was surprised when Jurgen unhesitatingly


offered to be one of the first humans on the planet to test the products outside of a controlled clinical laboratory environment; since within that environment the ‘volun‐ teers’ were either; patients experiencing the terminal stages of cancer or HIV infection, severely mentally-challenged or marginally existing within a comatose state in intensive care - having been consigned to the corporation, in exchange for credits, by their next of kin. Jurgen electronically signed a waiver/ declaration which stated that the products were for personal use, and that he would not bring legal action against the corporation for any adverse ‘side effects’; including death, caused by the products. Jurgen transferred the appropriate credits to their account and the shipment was arranged. In addition to the experimental chemicals; which had yet to be named - having only code numbers to distinguish them, Jurgen had also ordered a substantial supply of ZPC’s other standard commercial products. Classified as nootropics, these smart drugs were based on synthesized and enhanced amino acids and other elements which were found to be naturally occurring in organic life forms. Each variety pack consisted of a three-month supply of Piracetam, L-Phenylalanine, Hydergine, Dilantin, DHEA, Acetyl-L-carnitine, Lucidril, Choline, DMAE, Inderal, Vasopressin, L-tryptophan and L-pyroglutimate. In another box were containers of Pantothenic acid, Tocopherol acetate, Beta carotene, Manganese, Folic acid, Selenium, Niacinamide, Taurine, Pyridoxine, Niacin, Riboflavin, Zinc, and a range of vitamin supplements which assisted with the uptake and conversion of the nootropic substances. Jurgen had occasionally used some of these products in the past, discovering they had worked with varying degrees of success. In particular, he had become familiar with L-Phenylalanine while working at GenSynth; since it had been popular with programmers who wanted improved mental alertness in combination with sleep and appetite suppression. The substance also promoted the production of endorphins which alleviated stress by producing the sensation of being comfortably numb. Whenever he needed a boost, he would place 200 mg between his upper lip and gum where the blood vessels could rush it directly to his brain. During their on-screen conversation, Dr. Brenner had promised to contact Jurgen periodically to check in on him, and provide him with information to help use the substances more effectively. She had left him with a warning that although these products were generally non-toxic, side-effects included increased blood pressure, irritability, severe headaches, and nausea. Immediately upon awakening the next morning, and during the subsequent days following the arrival of the shipment, Jurgen experimented with the substances; he discovered when and what to take to give him the enhancement that he needed. The chemicals varied in their attributes depending on whether he wanted to alleviate fatigue, speed up his reaction time, increase his wakefulness, improve his memory, or decrease stress, anxiety or depression. Inhaling a blast of vassopressin would quickly improve his concentration, while a couple of tabs of Dimethylaminoethanol allowed


him to sustain a caffeine-like buzz, which also gave his neurotransmitters a boost. Chemicals were an integral part of the modern world, he had reasoned, after all, his processed food provisions contained a wide variety of chemicals that were customarily used by manufacturers for colour and flavour enhancement, emulsifiers, stabilizers, and preservatives in commercial products, even though it was internationally recog‐ nized that several of the food additives were known to be toxic or carcinogenic. Name your poison: Tri-ammonium citrate, tert Butylhydroquinone, Tartrazine, Erythrosine, Capsanthin, Ammonium chloride, Magnesium silicates, Disodiumguanylate, Aspar‐ tame, Sulphur dioxides, Natamycin, Ammonium acetate, Hexamine , Mannitol, Stearyl tartrate, Disodium inosinate, and so on... Just look at the ingredients in some of the products on your own shelf. He recalled that old expression ‘What doesn’t kill you makes you stronger.’ As he attempted to process the thought, his on-board computer had difficulty determining whether the statement was true or false; it may not kill, he concluded, but a gradual accumulation which reached a high level of toxicity could cause a person to wish that they were dead. Yet, in reality it was just a matter of moderation and balance. After all, the entire physical world, including the human body, was composed of just over one hundred chemical elements which could be recombined and assembled in an enormous number of ways to manufacture entirely new compounds; some of which had already been developed to create life, while others were used to take it away. Jurgen had always been fascinated by the Periodic Table, and was pleased to discover that his grandparents had been as well; a now faded colour poster had remained on the bedroom wall since the time they had occupied the quonset. Some‐ times as he lay in bed, Jurgen contemplated the grid; each square a different colour each representing a chemical element, abundant or rare, which were most often designated by a two letter code. The array mapped out a highly organized hierarchy in which the atomic number; the number of protons within the nucleus, were incremented by one - from square to square, progressing from lighter to heavier elements - from the top left to the bottom right of the chart. Of course the old table did not include recently fabricated elements like ununoctium (Uuo 118), which decayed in less than a millisec‐ ond; in steps of two protons at a time down to the synthetic element seaborgium (Sg 106)... then he would drift off to sleep. One night, shortly after beginning his experimentation, Jurgen had a strange dream; which at first he suspected might have been caused by a mental toxic reaction to the wide array of capsules he had taken earlier that day. Yet, the same dream began to recur on subsequent nights, then later, even at certain times during the day when he believed he was awake... The dream was very vivid; even though, at first, images had appeared as just a montage of vague ghost-like impressions, later, further aspects of the scenario had begun to reveal themselves in more defined clarity. As the sequence of dreams progressed, it were as if the episodes of some bizarre television series were being


received by a tuner within his mind. The dream was always situated within the same vast, overly bright white room; a wedding chapel which resembled an immaculately clean pharmacology lab - except that everything about the scale of its interior was gigantic. It had seemed that the floor was actually a long counter top, since its texture was similar to smooth grey arborite and it was dotted with scattered pills. If there was a ceiling to the room, it was ethereal and light like a high glowing fog. The walls of the chapel consisted of enormous old-fashioned white metal cabinets; slightly rusted where the paint had chipped away. And behind the glass, positioned on white shelving, were a collection of dusty brown medication bottles with typewritten labels in boxes stuffed with cotton and an arrangement of sterilized stainless steel tools; either laying on shelves or clipped into rows of holders along the back wall of the cabinet ~ appearing in softer focus because of the distance. The steel tools were particularly odd, reminding Jurgen of Dada collages or maybe an assembly created by Marcel Duchamp; jagged wheeled teeth, smooth curved blades, drill bits, grinders, pinchers and claws. Although these threatening metal appliances had appeared somewhat frightening, Jurgen felt safe knowing that they were immobile behind the glass. In fact, the overall sensation generated by the dream was typically a warm, comfortable feeling that lingered long after the visions had faded away and reality had returned once again. This pleasant sensation was surprising since it contrasted the rather unsettling way the images of the dream were presented; abruptly, and randomly, Jurgen’s point-ofview within this surreal environment was constantly shifting perspective as if the changes of location, camera angle, and the composition of the framing were a collection of linked cinematic jump cuts. Sometimes he was presented with an extreme close-up view, at other times the elements of the scene were lost on the far horizon of the endless counter top. Jurgen had no ability to control how the sequences were edited together, he was relegated entirely to the role of passive observer - similar to watching a movie. The scenario that unfolded within the laboratory chapel was of a wedding ceremony which was continually underway, yet one which would never reached its conclusion. The bride was dressed in an elaborate white gown, Her body was a large, gleaming white syringe with a sequence of raised red numerals along the side, and she had a plunger in place of her head. The groom was a dark antique leather doctor’s bag, sharply dressed in a suit with long tails. And standing before the bride and groom, raised upon the base of a set of silver weigh scales, a pharmacist, speaking in Latin, was presiding over the ceremony. The three figures remained almost motionless; only the sound of the pharmacist’s droning voice marked the passage of time - with the exception of a periodic disturbance from the back of the hall; whenever an enchanted‐ ly possessed pestle crushed substances to powder within a massive porcelain mortar, it interrupted proceedings with a menacingly loud grinding sound. Meanwhile, ever so softly the pipe organ would begin to play, automatically, without the intervention of an organist. It consisted of an arrangement of clear beakers; each clamped to a stand and positioned over a Bunsen burner which intermittently flared up


as a ring of blue flame. The containers were filled with shades of pale fluids in a spectrum including; pink rose, orange, yellow, luminous green, water blue, indigo and violet. The beakers were sealed with rubber stoppers at the top from which glass pipes of various diameters emerged. It was this collection of tubes which created the impression of a cathedral pipe organ; densely packed together and extending up to a vanishing point which was out of sight. As the coloured fluids were heated, bubbles traveled up the stems, performing a rich, melodic symphony whenever they popped releasing notes of different pitches and frequencies. Each dream seemed to last an eternity. Whenever he awoke, or emerged from his reverie, Jurgen had the feeling that he would never experience another episode again, yet, as previously mentioned, during the day or night, awake or asleep, he continued to have recurring visions - sometimes short flashes that were just as vivid as the full-length dream had been. From that point on, in his journal, Jurgen referred to his medicinal supplements as his ‘chemical bride’. With the benefit of the chemical enhancements, Jurgen plugged into his work with renewed vigor. It wasn’t long before he was able to moderate the doses and apply them at the most appropriate time to carry out whatever task was at hand. He soon found that he needed only one or two hours of sleep to feel sufficiently rested, and as his appetite increased, it was only a short time before his body had been restored in strength and vibrancy. At the same time, as the days grew longer, Jurgen was able to make full use of the additional energy provided by the sunlight; he was able to get more systems operational, and the more systems that were up and running, the busier he became. The result of this increased activity was that by the end of March the factory was fully-operational again. Even though there was still snow on the ground, Jurgen was already anticipating the arrival of the next winter. He realized that he had much work to accomplish before the snow began to fall once again, and since the recent memories had been indelibly etched into his mind, he could readily imagine how difficult it would be to survive another winter. These thoughts provided the motivation to make the full use of the days ahead. And he was grateful that he could now immerse himself in the process of setting up the equipment and begin to actualize the computer code that he had theorized in the journals; it was a welcome escape from the morose thoughts that had plagued him during the past winter - a time during which he had felt dreadfully lonely, often dwelling on his need for human contact and love. He lost himself in his work - friends and family were distant memories now, faces that he knew he would never see again. If he had desired, he could have contacted them, yet they did not seem to exist to him anymore - and he had convinced himself that he no longer existed to them... The chemical bride was his only companion out here in the wasteland. It was late afternoon when Jurgen had the impulse to bathe; to take a break from his work, to cleanse and purify his body - perhaps it was just that he was so wired that he suddenly felt the need to come down. He exited the quonset and immediately noted


the sun was still suspended above the western horizon; he quickly calculated that he would have enough time to walk one kilometer to the hot springs and make it back before darkness set in. He made his way through slushy snow. Watching his step. Skirting large patches of open water that had pooled on the barrens. Skipping over stepping stones and patches of ice. Once on firmer ground he lifted his gaze; in the distance were the familiar rugged mountains covered with glacial ice, deceptively maintaining the appearance of that permanent state, since he was aware that the volcanic range could explode at any moment - as it occasionally had in the past. Upon reaching the hot springs Jurgen stripped off his clothing and draped them over the naturally formed stone shelf along the side of a nearby boulder; which stood about the same height as he did. It was then he noticed that further down - near its base, strange markings were carved into the stone’s pale surface; he was surprised that he hadn’t noticed them before. Immediately recognizing them as ancient runic symbols, he felt a surge of excitement: he had read about runes in ‘The Nine Worlds’. As he crouched down to run his fingertips along the shallow indentations, now faded from erosion after centuries of exposure to the elements, he imagined that the symbols likely formed a mystical inscription, perhaps a marker left by a solitary wanderer who, as he had advanced along the path of his odyssey, had chosen to document the location where he had received the gift of spiritual insight, overcome an obstacle, or had learned some valuable lesson which provided a more complete understanding of his destiny in life. What other reason could have caused an author to carve poetry into solid rock with simple tools, then sign his work by reddening the inscription with his own blood? The appearance of the symbols had suddenly reminded Jurgen of his old friends Marcel and Angelique Planchette; their mysterious disappearance... and the portrait which had depicted him as The Hanged Man. He recalled that Marcel had suggested that his wife metaphorically link the subject of the painting to the trial of Odin; the Norse god who had suspended himself upside down for nine days and nights in order to gain entry into the underworld and learn the meaning and the magic of the runes. At the time, Jurgen had wondered why Marcel had made such a whimsical proposal, but now it seemed that it had been a prescient indicator of the events which were unfolding: ‘Odin, in a state of solitude, had submitted himself to divine will: bravely, he did not give up his search - he had not become distracted by attaining lesser goals, and his self-sacrifice, symbolized by crucifixion, had allowed him to obtain the mystical knowledge which had brought about a shift from material to spiritual consciousness, and ultimately, his redemption,’ Jurgen recalled the passages from ‘The Nine Worlds’ ~ ‘The Scandinavian idea of Valhalla may be primitive, but it is manly’. Jurgen examined the symbols closely. He recalled the book explaining that the futhark; named after the first few angular symbols in the runic sequence - similar to the way that the word alphabet had been derived from the names of the letters ‘alpha’ and ‘beta’... perhaps had its roots in the Sanskrit language, since the author had claimed that the tribes which became Scandinavian people had migrated out of India, led by a man named Odinn, many centuries before Jesus had been conceived. And, as Marcel


Planchette had made him aware; in ancient times, each letter had represented the physical embodiment of a thought - each letter a complete book. And when the symbols were arranged in various sequences, they were able to communicate increasingly complex ideas. Knowledge and power were obtained by learning the names which encoded the magic power of the word: the language of Sages seeking truth, revealing truth; the mystical experience - the ultimate reality which cannot be understood by means of logic or reason, but of which a concept can be formed; recalled by reading the recorded symbols. The runes, it seemed to Jurgen, coincided with his understanding of the mechanism of memory. He believed that fragments of data ~ similar to pieces of a fractured hologram; in which each part contained the sum ~ when linked together formed a system which could reproduce the entire whole. This model had also become evident to Jurgen in the way that countless interconnected patterns of energy could manifest as the Universe. Yet, the key to understanding the complex symbolism contained within each fragment of runic code; the encryption keys to decipher their hidden secrets, perhaps had already been lost to antiquity forever, since the meaning of language, similar to a virus, is dependent for its replication on the survival of its host. The sacred documents of the ancients profaned long ago; during the dark age of the Inquisition, when Roman Catholic zealots had made it their mission to violently exterminate all forms of paganism throughout Europe, including Norse beliefs and customs - since anything which seemed magical to them were considered to be the work of the devil. And once the transmission cycle of the encoded symbols had been interrupted; between one generation to the next, it had not taken long before there were very few who could understand the meaning of these patterns on stones. The chill air caused Jurgen’s naked body to shiver. He skipped barefoot through the snow then knelt at the edge of the thermal pool, scooping up handfuls of mud to rub all over his body. Its warmth acclimatized him to the extreme temperature of water heated by an underground lava stream. Before he discovered this technique, he once had taken the plunge straight in and had instantly experienced the unpleasant sensation of being boiled alive. Now he had learned to gently ease himself into the sulfurous waters. The high mineral content increased his buoyancy, enabling him to effortlessly float on his back, suspended upon the surface in a state of relaxed equilibrium. The surrounding panorama; a pale Gespensterfeld, was softly bathed in the rusted glow of the setting sun, and off in distance, contrasting the pale light with dense darkness, were an arrangement of large, angular, standing stones - randomly positioned following the activity of an immemorial volcanic eruption. The mischievous fairies; the Landvaettir, which dwelled within the stones, at the moment had chosen to remain hidden from view. He closed his eyes. For some time nothing; an emptiness, void - mysterious subconscious - then - for some reason, an image of Coraline, naked, began to develop within his thoughts; rapidly reassembling itself as it were a digitized photograph decoded by a processor within his mind. Once the transmission had been completed,


Jurgen could clearly recognize a troubled expression on her face; her thin ruby lips were pressed tightly together, her emerald green eyes glistened as if she had been recently crying. Then animating, at first with the intermittence of a zoetrope, increasing gradually toward the type of unreality often noticeable in motion capture data, her body’s movement began to approximate the sensual sway that he had often recalled. As she slowly approached, Jurgen noted her muscular long legs, her graceful hips, her trim abdomen and her firm, perfectly elegant breasts. But before she could reach him, suddenly, the image had frozen, distorted like a computer glitch. He had desper� ately anticipated being able to hold her, but she remained just beyond his reach - then the image began to fade away. From somewhere came the sound of an anguished moan. When his eyes flashed open, Jurgen immediately realized that his thick, chemicallyinduced erection pointed directly at the middle of the sky; its apex at the center of the circular horizon which spanned his peripheral vision. He stared up through the rising mists; discrete localized particles evaporating into a phantasmal haze of statistical probabilities, then vanishing into a canopy of ultramarine - where the first stars of the evening penetrated the atmosphere and sketched out constellations; Orion, Pegasus, Hercules, and the North Star - the sign - the herald. Perhaps the star he had followed, guided by will, to this magical island of fire and ice, once upon a time... which now seemed like it could have been centuries ago.... The angel of reason. The spirit of his ancestors. Supernatural terrors. Blind and secret ways... ...a flaming sword hovered above...

IX. RUSS VAI

Reality or just another dream? Jurgen tossed aside the thick layer of ragged blankets which had covered him during his rest and sat up at the edge of the mattress. Still dressed in the clothes he had worn when he had fallen asleep, he became aware of something as firm as a broomstick staining against the material of his trousers. He overcame the urge to massage it. Nearby, the numbers glowed like thin green worms. Their bodies, for one minute, had formed into a parallel arrangement of four straight lines on the digital clock, with a colon between the pairs. He stared at the display with glazed eyes which felt tired and swollen; the veins were like lightning behind his eyes


- flashes that seemed to briefly flicker in the darkness at the periphery of his field of vision. A drop of fluid dripped from his nose. He wiped it away with the sleeve of his sweater, then finally got out of bed. He made his way into the kitchen; slowly shuffling across the dog-eared linoleum tiles. Ripped open the corner of a soft metallic bag. Poured the coffee into the tray of the machine then slid a minidisk into the compact player. Instantly the heavy sound of a Mongolian band called; ‘Dance of Death’, pounded through the tiny speakers. He turned it loud while he went through the ritual of sorting and arranging various capsules and tablets using the sharp point of a knife. As he dissected the tablets, powder crumbled onto the strange, green-patterned, Formica surface of the kitchen counter; a texture which resembled crumpled plastic faded by decades of exposure to sunlight that had filtered in through the dusty glass of the tiny window. The measure‐ ment of dosages had been carefully calculated to provide a partial requirement of his daily nutritional needs; proteins, minerals, vitamins, amino acids, were taken at intervals throughout the day. Other packaged enhancements; chemically synthesized or naturally obtained from herbs, had been designed to boost his mind, provide energy to his body, or dampen the sensation of pain. Numerous small plastic bottles; a collection which would not look out of place in a pharmacy ~ lined the kitchen shelf, replacing the few decrepit remnants of sealer-jar preserves and museum-age tins that Jurgen had finally discarded. ‘Yaw, coffee good!’: Jurgen chuckled to himself as he recalled the humourous way that Erik the Viking had spoken the expression. Jurgen gradually ingested a substan‐ tial handful of pills, one at a time, washing them down with the hot, black fluid ~ sip, swallow, sip, swallow. Immediately, they had begun to take effect; the tiny packets traveled the network of his blood stream and dispersed throughout his system to kickstart his metabolism once again. His body, he considered, was a self-contained chemistry experiment, nested within the grand experiment of the chemical evolution of the planet; creating conditions unique to him which were not found in nature. Pharma‐ ceutical compounds that anesthetized the demons which would return whenever the medication had begun to dissipate; veins wristed and twist, cored-up like ropes, ripping to the rhythm like metallic-hued robot arms that did all the work. As the clouds of haze began to disperse, inside his skull, his synapses snapped and crackled, popping with palpable electricity, until once again his focus and concentration regained their usual clarity. His body had become warmer, breaking out in a sweat. He removed the outer layers of his clothing; now just dressed in tan trousers, a faded black t-shirt and slippers, he slid out of the kitchen. Sipping out of the small coffee pot, Jurgen posed at the top of the short flight of metal stairs with his hand on the railing, like a captain on the bridge of his ship. In the heart of this darkness, his eye caught the gleam of smooth metal alloy; machinery that had been restored to life with the return of the sun. Yet, he had chosen to revive only the most essential components; maintenance was a burden, and it was simply a matter of priorities, and as a result, most of the experimental digital factory remained in a state of ruin and decay. Among the wreckage, lichens had once again begun to paint


abstract compositions on the rusted metal surfaces and everything was covered over with a thin film of dust. Biotech equipment had been casually tossed into boxes, and tools and cables lay at rest where, long ago, they had fallen. It didn’t matter, the decision was clear; there were no spare parts for either the machines or himself... He kept trying to convince himself that just a few more months was all that anything had needed to last. His plans were based on the design that he had carefully constructed, in great detail, within his mind; a blueprint augmented only by his ability to piece together whatever clues he could glean from notes he had scribbled, almost indecipherably, between the lines of text and in the margins of books about Norse mythology, physics and chemistry, and so on... during the darkness of the deepest winter. He had faith that this conceptual map would guide him, step by step along a daunting path through treacherous terrain, and enable him to reach his final destination, and ultimately, complete the objective of his mission. Of course, Jurgen had acknowledged that the map was theoretical, and theory is often ideal. In reality... it took Jurgen a few moments to recall an expression once used by Marcel Planchette, long ago... ‘The devil is in the details’. Yes, that it was. Anything could happen... Just at that moment, an alert signaled an incoming call. Jurgen had assumed it was Dr. Brenner, since she was one of the very few people who knew his contact informa‐ tion. Periodically she would appear on screen as streaming video, instructing him to ingest a certain number of tablets from one of the various slim aluminum tubes that were designated only by a mysterious code number. Then she would wait and watch; observing the effects of the experimental medications on his behavior, all the while taking readings from a biometric device he had worn like a glove - which had also been included in the kit. But she never usually contacted him this late... Jurgen stumbled down the steps, inadvertently splashing lukewarm coffee on his pants, as he ambled toward the computer. He happened to notice the time near the familiar green icon of the TVi flashing in the upper corner of the screen: 12:00 Midnight, April 13, 2011. He pressed a combination of buttons on the shaft of the wand and the tiny green icon suddenly unfolded to fill one quarter of the display with a TVi window; an unexpected visitor now peered at him from behind the glass. The face of the young man on the video feed seemed distorted as if it were locked in a frozen expression. His lank, dark hair was pasted to his scalp, his head turned awkwardly away from a thin, frail body that rested in a semi-reclined position - propped up in a chair and partially covered with a blanket. Jurgen quickly recognized that the young man was afflicted with some type of illness or disease. But his eyes! His eyes were animated; glowing with a bright mischievous intensity. “... Uhm... you must have entered the wrong domain,” Jurgen spoke into the camera. His finger hovered above the letter ‘w’ on the keypad; ready to disconnect. It was late, and he was wary of talking to strangers.


“No... I didn’t... make an error... although... it is... difficult... to operate... this machine.” The young man held his crippled hand up to his camera; it was encased in a data glove - fingers and wrist bent at an unusual angle. He had difficulty forming words; his lips scarcely moved when he talked - slurring speech that was delivered in a very slow, even rhythm, “You are... the only per...son to... have seen... my face... in quite some time... other than... the mon...sters who have... locked me in... this cell... and come... to torture me... periodically... Do you want to play... a game... do you want to... guess my name?” Jurgen could see that the young man was located inside a small room that was either dimly lit, or it was nighttime at his location. The room appeared to contain a number of medical machines and a variety of computer hardware components, then Jurgen realized that this person was also seeing a similar background behind him. “Look, I don’t know who you are, or what you want, but I am extremely busy and I don’t have time for games.” Jurgen had replied somewhat angrily; not only upset about the unwanted intrusion but perhaps also frustrated that it took so long for the young man to say his words. “I’m sorry.” The face on the screen seemed to shrivel with sadness, then suddenly brighten, “The gods... never weary... from their toil... I’m sure you are... too busy... to play, Jurgen.” Jurgen was startled, “How do you know my name?” “I am... a great admirer... of your work... and your... friend’s... I don’t know why... you don’t... want to see her... she is so... beautiful... and you both... are so powerful.” “Who is ‘so beautiful’?” The young man slowly shook his head then drew in a ragged breath as if gasping for air. “Of course...,” his facial muscles quivered momentarily as he forced his expres‐ sion to emulate a smile, which then quickly relaxed as it returned to its customary blank stare, “I had forgotten... that you... have banished... yourself... to the purgatory... of your... frozen kingdom... to toil... in twilight... Your eyes... have now... darkened to beauty... and all you see... is pain.” Jurgen was silent. There was some truth to the words he had spoken. “I am... referring to... your lady love... from the distant... past... the fair Coraline.” He then released a heavy sigh. “Coraline?” Jurgen exclaimed softly. He ran his fingers through the scruffy beard that he had grown during the winter. “You two... should be together... but unfortunately... I believe... that she is now... in


love with me... or at least... with the person... that she... thinks is me... And I’m... sorry... that might... be you.” Jurgen had no idea what he was talking about. “Where is she?” he asked. “She is... carrying... the sun... in the palm... of her hand... holding it aloft to... shine its light... around the world... Can’t you... see it... from your... darkened land?” He emitted a brief sound of laughter, although his expression remained unchanged. “You... disappoint me... Jurgen... I had waited... with... anticipation for this moment... to meet an... omniscient god... but now... that I’ve found you... I see... that you... are just... a shadow... You are... just a hollow man.” “What made you expect me to be a god?” “I know... all about you... I’ve admired... your work... ever since... you posted... your files... all those... years ago.... Those were clever files... exceptional... they taught me... the basics... from which I learned... what I... needed to know... You see me... I am... locked inside... a prison... I... don’t mean... this room... but this... mortal flesh... You helped... give me... the tools to travel... with my mind... to move... around the world... and experience its wonder.” He paused for a few moments to rest; it seemed to tire him to talk. Jurgen waited patiently for the young man to continue; still hoping to receive some indication of what he was after. Although his impulse had been to send off a tracer which would swim upstream to discover the source of the video signal - his instinct instructed him to delay using this tactic. “You see... at the time... I had been searching... for the key... and I... found it... on the pirate ship.... I examined... the code... in infinite detail... and I... discovered... what made it work... and how... I could expand upon it... You were careless... to leave weapons... in the hands... of fools... But not many... could discover... the secrets... of the code... Do you... think I’m worthy? “I don’t know what you mean by pirates. You're still talking in riddles.” But Jurgen knew exactly what he meant; the young man was referring to the files he had uploaded to the Jolly Roger years before - when he was still attending the Akademy. “You shouldn’t... have encrypted... your name... into the code... if you never... wanted anyone... to recognize... your work... but it’s natural... for an artist... to want... to sign... their masterpiece... Vanity.” Once again, the forced smile. “It wasn’t easy... to track... the phantom... around the world... you always... seemed to disappear... I only discovered... that you were here... because you... cracked the sun... Wonderland... I recognized... your work... your signature... Do you know... they have a copy... of the file... The investigators... Flex Global Security... Ho... Ho... Ho...” - imitating a Santa laugh.


As Jurgen continued to listen in silence, his anxiety increased. Even though he considered it to be a minor crime; since nothing had been stolen and nothing had been harmed, Jurgen wasn’t surprised that agents of Flex Global Security had investigated his intrusion of the shopping network. But what had terrified him was that this guy knew that Flex had the file, and whoever he was, he had obviously been dedicated in his effort to piece together Jurgen’s identity... and from such obscure sources. He had tracked him and, apparently, he had tracked Coraline. Jurgen suddenly experienced the same type of fear that hunted prey must feel when they first become aware that they are being stalked by predators who are closing in for the kill. “Who are you working for?” Jurgen had tried to ask the question calmly, yet he was immediately betrayed by the tension in his voice. “Hey... don’t go... all paranoid on me.... It’s not like that... I’m on... your side... I am... your comrade... and your decoy... and your... number one fan... I am... the promoter... that will... one day... make you famous... all that I want... is to get in... on your new invention... or whatever... you are working on... Why don’t... you tell me... all about it... or should... I just step inside... and see for myself?” The situation was turning ugly; Jurgen experienced a sensation which, he imag‐ ined, was similar to someone, who in the process of trying to comfort a small, strange, injured creature they had felt sorry for, discovered its potential to turn into a parasite only the moment that it quickly burrowed through their flesh to disappear inside their body. Jurgen shuddered. The situation hadn’t occurred entirely by surprise; Jurgen’s instinct had already been on alert. But now that this extremely dangerous creature was poised on the verge of entering his system, Jurgen felt the need of immediately discovering some way of being rid of him. To shut down and close off contact was not an option, since Jurgen realized that this creature would always be there, waiting for him, whenever he connected again. And it would also not be wise to launch any type of scanning or detection software; since the intruder was obviously an elite programmer who was still very active within the network and it was likely that his weapons and attributes were much more sophisti‐ cated than any that Jurgen had at his own disposal. It was a standoff; an intense moment held suspended during the chess game between two adversaries; each closely studying the other on their video screen - sizing each other up as an opponent. Jurgen suddenly recalled an expression that Rujjie Blades had often used, and as a way to ease the tension, Jurgen challenged him: “I know your name!” “No... you don’t,” the young man responded, surprised by Jurgen's unexpected tactic. “Sure, it’s Kinkach Martinko!” Jurgen then gently laughed. The expression on the young man’s face remained puzzled for some time. “No... my name... is Russ Vai,” his voice finally pleaded weakly; pained as if his pride had been


wounded by Jurgen’s failure to recognize and acknowledge an identity, which, by his reaction just now, had apparently taken great effort to construct... Vanity. Jurgen smiled, “Well Russ, if you wish to be my promoter and accept responsibility for announcing the results of my experiment to the world, you will need to wait until they are ready to be revealed. I can tell you, in all honesty, that at the moment, I am still uncertain where this journey will lead.” Russ was now listening intently to what Jurgen had to say. Jurgen continued, “As you suggested, circumstances have necessitated that I maintain a sanctuary of solitude in order to continue undisturbed with my work. I am not a god, I am merely human, and perhaps I am a human that is even more vulnera‐ ble than others are to the influences that exist in the outside world, since I am not strong enough to withstand forces which could easily deflect the direction of the course that I have chosen for myself. Even now as I recall my love for Coraline, I am willing to admit that I would relinquish this task and my dreams in an instant for the opportunity just to see her once again... and that is the power that you hold over me, since you know where she is. Yet, that revelation would not benefit anyone at this time; not you nor her nor me - do you believe that’s true?” Russ appeared to consider the question for some time but did not supply a re‐ sponse. “I exist to Coraline only as a memory now, since I no longer have a physical presence in her world. Perhaps during this conversation you have already begun to realize that you are just channeling the spirit of a ghost,” Jurgen smiled briefly. “I hope you understand that I must remain in this state to follow the path that destiny has determined for me. One day this journey will reach its culmination, and when that time comes, you will know. Until then, be patient, and let that be enough for now.” With that, Jurgen disconnected - the video window vanished. He stared at the black screen for some time. Then with trembling fingers he popped open the lid of a nearby container and swallowed several of the tablets; the contact had been unsettling. After awhile, Jurgen began to recall the glee he had experienced during the previous Christmas - watching the disembodied Santa head float through the virtual mall; the sound of its voice punctuated by an intermittent loop of maniacal canned laughter, its animated mouth movement synchronized with a simple message of peace and goodwill. But now those words seemed empty and meaningless. Whatever had been intended had been negated by this unwanted intrusion. What a fool he had been! Hackers like Russ Vai comprised the vermiculture of the network; nightcrawlers who burrowed underground because they could not tolerate the sun. They were virtually indestructible; they had the ability to rear their ugly head, have it chopped off and then


grow it back again. How long would it be before the worm returned to slither inside his system? Jurgen recognized that they were both aware he could only remain off-line for a finite period time - if that was to be his choice. Eventually he would need to recon� nect to his lifeline to the world; it was his other dependency.... Jurgen perhaps now recognized the identity of the groom in his dream; the satellite dish emerged from the doctors bag and swiveled to scan the wedding chapel.

X. FLOATING-POINT

void scale _ array _ elements (floating-point scale _ factor)... Not every day had been a fully productive day: it was a given that writing and revising code always took longer than expected. There were many times that he had dug down into the root of the system, only to come up stained with digital mud. Even more frustrating was that, on occasion, equipment would break down and he would spend more time than he had planned to repair it; fiddling around with boards, cables and connections. Frustrated and burned-out from lack of sleep, he had sometimes reacted without rationalization: One day he had tossed a valuable piece of equipment across the room, realizing only after it had left his hand what he had done - leaving him to watch in horror as the fragile machine smashed into fragments on the concrete floor. Another time, he had punched the wall as hard as he could, ripping a jagged metal cut deep into his knuckles. He had wrapped his right hand with a piece of cloth, but later, upon discovering that the bleeding had not stopped, was forced to suture the wound closed with thirty three stitches and then administer a tetanus shot to himself. Yet, the reward of his effort had been to finally arrive at a version of the digital entities, which once released from captivity and sent out into cyberspace, could be relied upon to perpetuate the code and learn to adapt and survive on their own... Now, with selectively programmed tracks pulsating from the compact player up in the kitchen, providing the soundtrack for this exploration, Jurgen had donned the VR helmet he had crudely constructed for himself; immersing himself in the virtual representation of a universe consisting of an infinite variety of simple polygon wire� frame shapes that ranged through the blackness of three-dimensional space. Coded to enable Jurgen to visualize their classification, the tiny creatures spanned the full visual spectrum; from the deepest violet to a hue which approached infrared. Jurgen moved among the brightly coloured fragments. Whenever he wished, he could teleport to another region of the vast universe by using his magic wand; represented as a hollow shaded tube that floated within his field of vision.


He navigated through space by tilting the device and operating the finger switches and controls which were positioned at intervals along its length. He was seeking out entities that had already reproduced. Periodically, he selected individual life forms at random by zapping them with the wand. Once selected, a small text field popped up to display the status of the chosen one; estimated life span and current generation within the process of its species evolution. At the same time, a copy of the data was automati‐ cally shunted off to a storage cache, which Jurgen could later examine in more detail to discover how their payload had mutated. When he had harvested enough samples to study, Jurgen removed the helmet and set down his wand. Once again the exploration had returned positive results, which had made Jurgen extremely happy... in fact, he had been ecstatic. He tilted back his head and let out a roar at the top of his lungs which reverberated off the metal roof of the quonset. Then he danced a little step across the concrete floor.. the sudden agitation had re-percolat‐ ed too much coffee, suddenly beginning to rumble in his guts. Wiping away beads of perspiration from his forehead with the front of his shirt - he was becoming aware that a response was urgently required to nature’s call. He pulled a heavy ‘lopapaysa’ wool sweater over his t-shirt and jeans, then opened the rusted metal door. Outside the sun was shining, and the cool, fresh May air filled his lungs as he screamed again once more; this time the sound was lost in the vastness of the tundra ~ carried off on the constant breeze. Across the runway, his silent footsteps traced a well-traveled path over amber grass and rugged moss, trudging into the distance toward the metal frame of an old kitchen chair standing like a lone inukshuk out on the landscape. The seat had been removed and the metal frame wrapped with colourful rags of cloth - it was not very comfortable but it served its purpose. There were no toilet fixtures in the quonset - although, certainly, at one time there must have been. Had the military requisitioned them, he wondered? His chemical diet produced very little solid waste. Sometimes he brought a book to read while he waited patiently between thin, intermittent, liquid streams. Not much to see on the horizon, and what there was, had already been imprinted in his mind. To amuse himself, while he sat on the chair, he would occasionally play a game: he would close his eyes and imagine some portion of the landscape. With eyes still shut, he would turn his head in that direction, then open them to compare the view on the horizon with the image in his mind. They were almost always identical in every detail... he didn’t play that game anymore. He wiped himself with a handful of moss and moved the chair to a new location; ready for his next visit. Then he headed back across the landscape toward the quonset. Home. Safe inside. Shivering yet invigorated by his stroll, Jurgen had decided that it was time for an energy boost. He made his way through the machinery assembled on the shop floor, grabbing the empty coffee pot as he skimmed past his workstation. He climbed the stairs and entered the kitchen; empty pill containers littered the floor - he kicked them out of the way. Nudging the slider a little to the left; toward a setting of ‘8’; Jurgen turned down the volume on the music which had been playing throughout the


day, then took up his trusty barcode reader. He scanned the selection of containers in the cupboard; seeking out that elusive elixir which not only enhanced the drive within his brain but also enabled him to transcend his ordinary consciousness - launching his mind beyond the realm of rational possibilities through the wonders of chemical alchemy. Jurgen swallowed; a colourful array of dietary supplements rode the rapids of rehydrated protein drink that plunged into his empty stomach. Now sitting in the pilot’s chair, he carefully measured out 50mg of 2C-X; an experimental phenethylamine pouring the quantity of powder into the small enamel serving tray which had accompa� nied the shipment. 2C-X was a synthetic substance that had evolved from an ancient chemical known as STP - popular many decades before. Modified with added halogen atoms, it had been designed to enhance the user’s conscious awareness of sensory experience and increase physical energy, all the while allowing the user to remain mentally focused and clear. It would become activated shortly after Jurgen snorted it through a clear plastic tube... discovering the particular effects of each synthetic chemical had been a process of trial and error, which sometimes, had left him vomiting blood or convulsing on the floor. Although he had learned from his mistakes, Jurgen was beginning to realize that it was critical to capture the data of his thoughts while his mind still retained some semblance of cognizance... As he made his way down into the work area, Jurgen gingerly slid his fingers over the smooth surface of his scalp to check the thin wires which emerged from the top of his skull; it had taken about two weeks for the tenderness to subside but now there was hardly any discomfort at all. Although, the foreign projections were clearly a reminder of the agonizing procedure to which he had subjected himself. In preparation, he had first taken scissors and then an electric razor to his matted locks, shaving his entire head, with the exception of one patch of hair at the back which retained its original length - the memory of a story that he had once read during his childhood; a legend from ancient China which explained that a braid of hair was used by angels to pull the spirit toward the heavens when the time had arrived for it to leave its body. Then, struggling to function while maintaining the level of medication required to anesthetize the pain, he had clamped his head into a makeshift drill-press, using an extremely fine bit ~ no larger than a pore ~ to bore eight tiny holes through the hard bone of his cranium. Through these apertures he had inserted fine filaments directly into the grey matter ~ just below the surface. The biofeedback sensors, implanted at precise locations throughout the hemispheres of the cerebral cortex, had been designed to record the electrochemical processes generated by his brain and transmit the impulses to the processor which would digitize the data. Wrapped in an old blanket, Jurgen settled comfortably into the padding of the weathered mattress covering a crumbling patch of concrete floor. He adjusted the cables that connected the computer to the biosensor jacks protruding from his scalp then ran his fingers along the braid of hair, which, bound with a rubber band at the back of his head, swept down across the base of his neck and over his left shoulder to brush against his chest - it provided him with a sense of comfort and strength. Then


after some time, as he sat quiet, motionless, he had moderated his breathing to synchronize with the rhythm of the digital ocean sounds that drifted out of the computer’s speakers. Gradually his mind had become tranquil and reality slowly evaporated away. The objective of this meditative state was not the absence of thought, rather, it was to acquire the ability to fully explore the mysteries of his subconscious mind: It was a state of awareness which Jurgen had referred to in his journal as the ‘floating-point’. Through practice, Jurgen had learned to sustain the sensation, to focus his mind, to navigate the hidden depths, then in the instant that he had envisioned certain memo‐ ries, or had recalled certain thoughts, press a button on the wand to capture clusters of signals surrounding specific locations and digitally record them onto the storage arrays within the towers. ... descending deeper into the blue. He could still hear a sound; like waves crashing on a distant shore, synchronized with his breathing and the quiet rhythm of his heart. Sunlight dispersed as it penetrated this other world - liquid digital light that formed delicate patterns suspended around him, glowing intensely like a net of gems, twinkling, constantly in flux. As he submerged through the layers, gradually, all sensation faded away. In the tranquillity of this silence, he had become aware of the presence of some form of life nearby, unseen, surrounding him in the cool darkness. Its energy seemed enormous, it encompassed him, comforted him like the amniotic fluid within a womb, yet buffered him from the unknown entity. And by merging with this energy, an exchange - the pure flow of data - was possible. This exchange had not been encoded in language; it was a communion which formed a more complete understanding - one which exceeded the clarity and speed of information transferred as words and transcended that nameless understanding obtained by gazing into a lover’s eyes - the sensation of merging identities - the profound awareness of experi‐ encing thoughts which were not entirely one’s own. Yet, the thoughts he had merged with were not those of another, but the thoughts within the recesses of his own mind. Relentless, inexhaustible memories; images mapped onto shapes, transparent, overlapping with other images, or nested inside them as they moved up from the depths. Images in motion of every size and colour, partially erased, written onto, over and over, uncountable times, the sense of smell and taste and touch, the voices from the past, from media, from dreams, words, letterforms and symbols he could not understand. The experiences which emerged were mostly familiar, although at times the memories had seemed foreign and strange. Other times they were terrifying and frightening; as if he had unleashed the demons locked away inside a Pandora’s box... A sea of moving umbrellas below a hotel room window; coarse rasterized digital walls of neon glaring brilliantly in the darkened city street. Lingering memories of the experience of his birth. Pieces moving into place like a puzzle. Jurgen never knew what to expect once he had connected to the machine after reality had evaporated away.


Then from the depths to the heights - freedom; the sensation of soaring above an undulating landscape blanketed with a shimmering white covering that resembled freshly fallen snow. Perhaps, this had been a memory of the past winter, viewed from a unique perspective, since even higher above, in what resembled the night sky, were brightly coloured veils of northern lights that swept across the face of a silvery full moon like transparent, ephemeral, cool green spirits just beyond his reach. No sense of the cold. Detached. Hovering over endless fields of ice that drifted gently across low rolling hills that vanished into darkness towards the horizon. Far below, near the center of this scene, a ridge of higher elevation had risen smoothly from the plains. The terrain of the mountainous range consisted of towering peaks and precipitous valleys, odd formations, improbable in the geography of the natural world... No... Abruptly the two halves of a rusted metal shell arched closed above him to eclipse the starry night like the claws of a giant machine, and the landscape had transformed, folding away as efficiently as a theater set to reveal the interior of the quonset once again. As Jurgen slowly regained awareness within the dim light of his laboratory, the shapes of various equipment positioned about the room were not immediately familiar. The computer workstation, resting on the kitchen table, appeared as a dark silhouette, seemingly the shape of a large immobile creature standing on four legs. The glowing display panels, at first idle, had suddenly come to life. Mobile, tethered to the ends of octopus-like tentacles, they hovered above what could have been the creature’s shoulders. On each screen was an extreme close-up video image; individual facial features of the stranger that had recently come to call. Several panels displayed Russ Vai’s eyes, which moved about; floating on a hinged support arm to independently scan the room. The larger, central panel displayed his mouth; abstract greyish-blue lips which moved slowly to form words. Yet, there was only silence. Jurgen concentrat‐ ed on the sequence, mimicking the shape - forming the words with his own lips; a cycle that appeared to be repeating one slowly-slurred phrase, over and over, as if it were a mantra. As the silent sequence looped, the display’s surrealistically long neck had slithered the screen closer toward him, now filling his awareness with an enor‐ mous shape animating in the bright electric blue video field before him. Gradually, Jurgen had begun to understand the message: “Well, well, well... so you want to escape.” The moment Jurgen had uttered the words aloud, it were as if he had evoked their magic spell. The cycle immediately stopped repeating and the lips formed themselves into a tight little smile. The screen began to grow darker, fading only imperceptibly darker with each refresh cycle. Jurgen felt like he was sinking, that it had become difficult to breathe; ‘I'm drowning’, he had thought. Rising to the surface, he opened his eyes, and suddenly the light of day flooded in. How much time had passed? He blinked his eyes. It took a few moments to recognize the tiny room he found himself in; the curved ceiling, the tiny window, books scattered


on the floor near an old battered suitcase, a pot which once contained a Venus flytrap, and an hourglass filled with bright red sand. It was his bedroom up in the loft, but, he wondered how had he ended up there. Was it real or just another dream? It didn’t matter. Slowly, he panned his gaze over to the cast iron stove; it was cool and silent. Nearby on the floor, the paper surface on the back of the mirror that rested in the corner, turned toward the wall. He didn’t want to see himself and he didn’t want to see anyone else right now. It reminded him too much of humanity. He had often tried to convince himself that he was beyond that now. It had also become increasingly clear that his brain; which he relied on for function‐ ality as a human being, had been gradually co-opted by the experimental processes he had subjected it to, as well as the massive quantity of drugs which he consumed. The daily limits had kept increasing; behind each barrier had been a new one, stronger, thicker, more difficult to penetrate. Each level required increased effort. No password could be entered to save the progress of this ‘game’ - the commitment was total, complete. There would be no escape from the journey, from the effort and the exhaustion, from the experiences that had begun to recur, even in his dreams. After a few moments, his eyes tracked toward the faded periodic table, taped and nailed to the bedroom wall. Jurgen had been pleased that the sheet of paper did not break its bonds by turning into a flock of small white birds and fly away.

XI. THE MIND

As usual, after he had awoken ~ a pot of coffee, a handful of tablets, Jurgen had immediately begun his shift. Brief periods of increasingly intense activity alternated like a checkerboard with intervals overtaken by complete exhaustion - either on or off, one absolute state or the other, continually, around the clock. And as had often happened, awake or asleep, his mind would often experience some type of disturbing glitch; vivid dreams, realistic hallucinations, or reality jitters that occurred more frequently and lasted for a longer duration, intermittently throughout the day and night. This day, wrapped in a blanket and settled comfortably upon the mattress on the quonset floor, Jurgen had just adjusted the cables connected to the biosensor jacks, preparing for immersion, when another strange flashback had occurred; it reprised the now familiar scenario in which the display screens had come alive and were about to speak to him again. Jurgen recoiled in horror; although the sensation had lasted only momentarily, and although, by then, it seemed that he should have had grown accustomed to these randomly occurring events - the clarity and intensity of the terror


that the vision of Russ Vai had inspired, once again left him feeling shaken. For some time after the sensation had abated, Jurgen tried to calm himself and regain the tranquillity that he needed to proceed. Although he could never be sure whether it had been just a paranoid delusion or if the intruder had actually implanted a virus on his system; which had manifested as a strange display hack - Jurgen was certain of the reason why the anxiety had began to creep in. It had not been intuition, but logic which determined that it would not be long before Russ Vai, or whoever-thehell-he-was, would draw attention from the authorities; he was too brash and too confrontational, which for a hacker, would one day certainly provide a cure for invincibility. And once discovered, Jurgen was aware, that Russ Vai would either intentionally or inadvertently give Jurgen’s location away... Jurgen had often cursed the foolishness of his seemingly harmless Christmas prank. And although his nemesis had not contacted him directly since their first and only encounter, Jurgen constantly experienced the uncertainty of wondering if he still lingered out there, somewhere in the network, and whether, one day, he would attempt to gain access to Jurgen’s data files or perhaps even sabotage the project. Beyond the customary precautions, Jurgen was aware that no matter what type of security barrier he constructed, it would not be enough to protect his systems from a highly skilled attack. In fact, such a wall might pose an inviting challenge by its presence - demand‐ ing to be breached. What Jurgen had believed to be at stake, was the time and effort that he had already devoted to the project. The sacrifice had been considerable. The data that he possessed had become a valuable resource that would be difficult to replace should an intruder damage the source files or cause unforeseen delays. And it was time that he could not afford; since it now seemed that the window of opportunity would remain open for only a very brief time, and that if Jurgen did not complete his project soon, the chance may never come again. So, as a result, Jurgen worked harder, more often - in an effort to compress the timeline. Yet, no matter how it was compressed, time kept running out... Under pressure, Jurgen relied more often on substitutes to minimize his hunger and fatigue in order to continue with his work, then would try his best to push aside the fears and hallucinations which resulted. Those were the side effects. He had con‐ vinced himself that they were another sacrifice that had been necessary in pursuit of the project’s ultimate objective, just as the chemicals themselves had been; not to seek pleasure but as a means to avoid pain. Typical of that rational, the chemicals had soon become an insidious double-edged sword: appearing beneficial, while at the same time, perpetuating Jurgen's constant state of anxious paranoia. And while he recog‐ nized that the chemicals were gaining greater control; that he had become more dependent on his addiction with each passing day, he had also convinced himself that, when the time arrived, he would once again claim mastery over his vices eventually the pain would cease. Yes, he had thought, after all these months, the sessions to capture data from his mind were finally drawing to a conclusion. May into August - almost continual daylight


- the endless summer; the sun had been shining, the birds had been singing, yet Jurgen had rarely ventured outside. Even his plans to create a garden or hike through the countryside; things that, during the winter, he had imagined that he would like to do, were put on hold, eventually never to materialize, while instead he had dedicated himself to harvesting the thoughts and memories of his past. Now, tonight, he planned one final foray into the furthest reaches of his mind; to gather the last few remaining pearls of wisdom submerged within the darkest depths. After this, he realized, it would become impossible; he had already traveled to the furthest extremes that his ability, and artificial enhancements had allowed him to proceed. The deeper he had gone, the more he had relied on the chemicals to increase his rate of metabolism; to give him the speed he needed to rapidly sift through massive amounts of accumulated information within his brain, or enough to maintain a heightened state of awareness and the focused discipline to prevent the flow of streaming fragments from becoming disorienting and completely overwhelming him. To continue further, Jurgen had recognized, his consumption would likely seriously impair the data transfer between his brain and the computer, increasing the risk of contaminated results by introducing error. Thought is a material process. Jurgen ran his fingers along the braided strands of hair which swept across his shoulder. Then after some time, as he sat quiet, motionless, moderating his breathing into synchronization with the rhythm of the digital ocean sounds that drifted out of the computer’s speakers, his mind had gradually become tranquil and reality slowly evaporated away... ... a prolonged scream... gasping for breath... lids fired open and eyes that darted wildly about the room... nothing had seemed familiar... panic at first ... eventually he had regained control. With trembling fingers, Jurgen fumbled to disconnect the leads from his cranial jacks, his breathing still labored, his throat, ragged and dry. He dragged the coarse grey blanket over his shivering body; which felt chilled yet was sweating profusely, then curled up in a foetal position on the mattress to wait. It had always been this way; four hours on the memory machine had been like putting his mind through a blender. But he had come prepared. Reaching into his pocket, he withdrew several small, light green tablets that he carried with him to help weather the storm of activity within his mind, and to quiet the swirling residual chaos of the persis‐ tent visions which would linger for almost an hour. He slid them between his parched lips, grinding their hard shells into bitter powder with his teeth. Then for several minutes mild nausea would cause his empty stomach to heave. “Here she comes again,” Jurgen had thought; the bride would administer her tender mercies whenever the pain had become unbearable. She appeared as a radiant vision, glowing with pure white love, as if suspended, precariously, on a large sheet of glass, descending from the oily darkness, where, high above, a shadowy form, resembling a gigantic magneto, moved with quick precision - throwing off sparks of constant desire like the icy gleam of tiny meteorites illuminating the blackness of naked terror. Those lights indicated that the machine was operating, and the sound it


produced; a wall of white noise, unbearable in its intensity - washed through his brain, erased his senses, numbed his being and hammered his body with its palpable force. Gripping the blanket tightly, Jurgen rode out the storm. The deafening roar subsided, gradually replaced by the sound of the forceful breeze that rattled against the curved metal roof of his shelter. He opened his eyes and for a few moments stared blankly at the burned out lighting tubes on the ceiling, then slowly tilted his gaze down to take in the view of the various apparatus situated throughout the room. In the dim light they appeared as ethereal as displays in a wax museum - through which invisible parasites seemed to have eaten away the transparent wax where the light on the machines fell away into shadow. It had been an illusion, a deception in judgment merely a play of the mind. Jurgen had begun to feel calmer once the chemicals had stabilized his mental equilibrium. With effort, he had sat up, but still feeling wasted, decided to return to the mattress and sleep for a little while.... then later, as usual, after he had awoke - he made his way up into the kitchen - made a pot of coffee, ate a handful of tablets, then immediately had begun another shift. Jurgen had learned to explore a brave new world. During his vision quest, the computer storage had gradually accumulated a lifetime of experiences, thoughts and perceptions; memories of his childhood, or friends and family that he had now left behind. Voices from the past. The sense of smell and taste. Places that he had been and things he had seen. He had spent many long sessions randomly reviewing individual memories to ensure their integrity - digital files that could be selected based on the grid coordinates of their point of origin and accessed at a lightning pace. Heuristic algorithms filtered out unrelated concepts, random noise and digital pollution, to refine the thoughts to a purity of essence, which were received as a stream of sequenced data that returned to his mind through the jacks in his skull connecting him with the machine. And each time, Jurgen had been amazed that when the input data had stimulated his brain, it created simulations which were more real and vivid than his own memories had seemed; it were as if he had actually relived those moments he had previously experienced in his life, since they evoked the same sensational responses; joy, sorrow, anger, fear, passion and despair, as they originally had. Later, as an experiment, Jurgen had modified some of the software routines so that the processor could arrange and restructure the sequences itself before digitally testing them out on Jurgen's brain. These algorithms analyzed the data as purely mathematical expressions, enabling the computer to establish correlation’s between the stored thoughts; exploring permutations and combinations, making connections, imposing logic and recombining the data into new forms ~ which because of its speed in processing a vast array of potentials, in effect had created ‘insights’ unlikely to be discovered by Jurgen's human brain. Since, as the processor had explored Jurgen’s thoughts more deeply, it had created connections that he had not established, yet were potentially ones which he might form someday. Perhaps it was possible, that


even though they had been Jurgen’s thoughts, the machine had somehow recom‐ bined them to form new thoughts of its own. Often the results had been disorienting or frightening; familiar notions that Jurgen had still been able to recall from his own memory were replayed as surreal scenes in which the perception had shifted in meaning - it were as if he had gone back in time to relive an event with an awareness, that, in part, had already been obtained from previously experiencing that event. Well-known memories had become merged; blending with others less familiar, and images occurred within unexpected contexts or had been reassembled from events which had occurred during unrelated periods of time, which sometimes resulted in sequences spiraling into an endless feedback loop. Although the results had been intriguing, Jurgen soon realized that this new hybrid data had begun to corrupt his authentic source memories; since, after these sessions, he had begun to vividly recall the new hybrid memories as if he had experienced them himself. Inspired by his father’s novel; ‘The Disposable Mind’, and its protagonist, Volken Sheen; the fictional shoe factory employee who had lived in Omaha, Nebraska in 2010, Jurgen had realized that he could better use this same process by transferring quantities of stored technical data from the computer into his brain. At first experiment‐ ing with small files, Jurgen had discovered that it was possible to overwrite the coordinates within specific locations of his mind; replacing selected personal memo‐ ries - which had already been uploaded and safely preserved within the computer’s tower - with technical reference information that he would need to complete his project. Although, in the story, Volken’s mind had been replaced twice-daily; like a bucket emptied and refilled, Jurgen had decided to write one time and dedicate only a portion of his brain to storing the database. Yet, similar to the story, Jurgen had hoped that he would also focus more intently on his work - since he would be able to selectively eliminate some of his more distracting personal memories. Needless to say, Jurgen had been surprised; surprised to realize that just one year after the fictional date in the story, he had proven that his father’s prediction had been accurate - since until now, he had always assumed that the entire book had been a figment of the writer’s imagination. As well, he had also been surprised at how simple the process had been; aside from drilling a few holes in his head and writing a ton of custom code, he wondered why no-one had ever tried it before. Although, by now, perhaps it had already become common practice; he had been isolated for so long and he was aware of how fast events could have occurred, out there in the real world. How long had it been? He had already forgotten - crossed-out squares on the calendar in his kitchen indicated that the days were moving into September... 1959. All that he knew was that for many weeks now, he had dedicated himself to the process of selecting his most significant memories. He had recognized that it was essential that the foundation data be edited with great care, since these compact memory fragments would be integrated into the payload of each of his entities as they were fabricated. The payload components; memory fragments, as well as previously digitized portions


of his genome, dropped into place as they moved along an assembly line within the generator’s mutation engine, would be appended to the entities’ complete instruction set - a small, self-contained program which would determine the logic of their respons‐ es - enabling them to ‘think’ and make decisions. Jurgen had rigorously tested the program to ensure its stability. The algorithms which controlled the entity’s behavior followed a formal logic system in which knowl‐ edge was obtained by means of inference. Similar to biological units, the entities made decisions through pattern recognition. By referencing their base code; the ‘previous memory’ transported onboard as payload, the entity’s would seek out similar (useful) information from within the databases they encountered, and once evaluated, they could incorporate the data into their structure. It had been Jurgen’s intention that the entity’s knowledge base would evolve; enhancing the limited set of knowledge and experience he had originally imparted to them, as they continued their endless journeys throughout the world - accessing the virtually unlimited data fields distributed among all of the networked computers. While scanning his memories he had recalled an image he had once seen; a plaque mounted to the side of a satellite called Pioneer10. Among the symbols on the cryptic plaque; sent off into the depths of space many years before, were representa‐ tions of the size and appearance of human beings, as well as encoded information which located the planet Earth within the solar system - indicating from whom and where the message had originated. Jurgen had thought of each of his entities as being similar to Pioneer 10, in that, each entity carried its own unique symbolic message into cyberspace, which also contained information about the originator of the code. Yet, each entity had an advantage over the space probe, since they could actively ensure that their data survived through the process of replication. In designing the entities, Jurgen had implemented code which controlled their growth; both in terms of the size that individual units attained, as well as how they established factors which determined their own network population rates. Their instruction set regulated that each entity must retain less than 150 kilobytes of data; although most were considerably smaller - practically invisible on the terabyte landscape. And once they had reached that maximum threshold, the code instructed the entities to split - in a process similar to the division of chromosomes - in which each half replicated a copy of the main control unit; the encoded nucleus of their instruction set, then dividing the data of the payload cargo between themselves. During this process, error correction code maintained the integrity of the data within the divisible payload - since without the code, random events would have made iteration unpre‐ dictable, producing aberrant mutations; transposing some ‘1’s’ and ‘0’s’ due to transcription error, network computer malfunction or even the effect of errant particles from the cosmic rays that eternally bombard the planet. Jurgen had been startled to discover that, after division, the two created entities continued to share a communication link between them wherever they went in the ‘world’; similar to the way that telepathy sometimes occurs between identical twins - or


the way that he and Coraline had once formed a bond - which over time, in Jurgen’s case - unfortunately - it seemed the capacity had diminished. But for the entities, it was an ability which continually persisted. When tested under laboratory conditions, Jurgen had determined that whenever one of the twin entities had been subjected to a certain stimuli, both of the entities had responded. It had been astonishing, consider‐ ing that at the time, both entities had been separated within isolated environments disconnected from any form of linked digital pathway. Although the entities' attribute of telepathy had been unexpected, longevity had been intentionally crafted into their code - they were engineered for survival. Jurgen had granted them the ability to recognize security protection traps, scanner worms, magnetic black holes and the presence of dangerous viral entities which could swallow them alive - which at the time, had been far beyond these agent's capacity to detect them and terminate their existence. In fact, Jurgen had been concerned that they were perhaps too well constructed - since he was aware of the consequences of introducing a species into an environment with few natural predators... They operated in a similar manner to bacteria, which notoriously, in the real world, had become resistant to most forms of natural and synthetic antibodies by simply acquiring resistant genes as soon as they were available; picking up a plasmid on the genetic Black Market or stealing the enchanted ring of DNA from a bacterial friend. Their base code also made it possible for entities to communicate ‘antibody warning’ information with one another; enabling them to re-encrypt themselves in order to evade detection from security bots or other forms of killer code which one or the other had already discov‐ ered lurking within the global environment. Viva la Resistance! Since they were capable of adapting to any type of change in the structure or configuration of their environment, and, if necessary, survive prolonged periods of dormancy, and since they would also quickly learn to recognize and avoid any form of danger, Jurgen was aware that the entities would be virtually indestructible. By having the ability to make judgments in a more logical and efficient manner than human reason; evaluating and integrating newly discovered data into their structure while they continually engaged in the exploration of environments - they would also perpetuate some integral aspect of the code derived from Jurgen’s own ‘being’ transporting his essence within their digital core; so that what he was, had been, and potentially could be, would always remain a part of them, and possibly also exist forever within the digital realm... Miniature, compact, immense, omnipresent, eternal.


XII. THE SOUL

It is one thing to read about it - but it must have been quite another to have lived it. Even more difficult to imagine are the events which Jurgen had ultimately experienced during the final stages of his experimentation; glimpses obtained from the fragmented remnants of his journals discovered scattered in the blood-stained snow had been as difficult to discern as any attempt to recognize a reflection by gazing into the shards of a shattered mirror. In both instances, although detail had been lost or distorted by the chaotic rendering, it was still possible with astute observation to eventually infer a fairly accurate overall impression... Over a period of time; perhaps dating back to his days at the Akademy - when he worked with Rujjie Blades to develop the software they had called ‘Faith’, Jurgen had gradually come to the realization that although logic and intelligence were perfectly capable of emulating the illusion of life, they could not be enough to sustain it. As their progenitor; in the sense that the creatures reflected the characteristics of their creator, Jurgen felt the weight of responsibility to ensure that his entities would always remain benevolent forms of life. The danger was that over the course of many generations without an internal guiding force; a source of energy which would enable them to maintain their alignment with the ‘Good’, the entities' ability to determine whether propositions were true - by logic alone - may occasionally render them incapable of distinguishing if it were in their best interest to incorporate the data into their structure in order to modify their behavior. As a result, the entities could eventually find a port of entry into a labyrinth of the onerous and gradually spiral into the darkest depths of that abyss. Jurgen was concerned that replication of this cold, malevolent data could ultimately spawn a significant concentration of entities, that bent on destruction, would be almost impossible to stop. Jurgen believed that comprehension of the force which perpetuated the Good in the universe was beyond the realm of logical thought. Although it could not be understood through reason, it could be named: Jurgen, in his journal, referred to the essence of this force as ‘pure spirit’, or often, as the ‘soul’. It was this force, he believed, which provided living things with their vitality, as well, which guided thought toward the truth; enabling circumstances to be evaluated with an inherent sense of justice and fairness by acting as intelligence's conscience. Ultimately, it was this energy which became evident whenever humans perceived that they existed; an awareness of the relation‐ ship between their individual consciousness and the collective universal conscious‐ ness - that primal source of all potential from which everything that we perceive is manifest and to which everything that is manifest returns...


Yes, he had dedicated himself to the project completely; driven by a relentless force - consumed by a purpose of which only he could fully realize the potential. His path had separated him from the mass of humanity a long time ago. Now the only direction that this path could go was further on - there was no turning back. He no longer had family or friends, his finances were gone, and he had barely clung to the final remnants of his mental and physical health. Everything was falling apart; his equipment, the quonset, his body. The irony, perhaps, was that while his project had ultimately been intended to benefit humanity, he had often felt so alone - frequently longing for a companion that could accompany him to a destination located some� where between reality and dreams. But there was no-one, and if there were, there would be no way that he could make them understand; they would have already had to have had similar experiences in order for them to even begin to comprehend. So alone, throughout the summer and now into late September of 2011, Jurgen had continued to subject himself to an intensive experimental program; enduring an endless procession of captured memories, ingesting a variety of chemical substances and internalizing flash-fed streams of technological reference data until eventually it seemed he had transformed into another creature; some type of organic machine whose human emotions had become negligible and whose mind had been replaced by a processor which operated with an almost clinically-pure analytical logic. No longer joy nor beauty ~ no fear, no sadness; those sensations typical of who he had known himself to be ~ or who he had thought he had once been. Yet occasionally, without warning, those emotions; which he thought had been completely overwritten, would suddenly resurface; manifesting as infrequent explosions of anger or brief states of tranquil euphoria, or more often, as symptoms of anxiety and depression ~ as if residual traces of the eternal darkness that had accumulated during the previous winter had once again emerged to cloud over the already waning sunlight filtering through the autumnal skies. Jurgen recalled the bitter cold of that winter; the memories were still vivid and painfully clear. He had almost not survived the previous one and knew that he would not survive the next. To cope with the advancing darkness, to live through the fear and the loneliness ~ to maintain ~ Jurgen had still needed chemical enhancements. Without them he would once again become all too aware of his distance from humanity and the increasing separation from his own body ~ it helped to ease his pain. The chemicals had also been a requirement to coherently comprehend the texture of the extremely detailed knowledge that he had downloaded into his mind; it was the only way that he could manage the relentlessly accessible database which he referenced to efficiently author thousands of lines of program code. His logical mind, within that state, had neatly explained that it really didn’t matter; since the data comprising his memories and genetic structure had already been safely sequestered within the storage tower and would be perpetuated onboard the digital entities when they were released. Yet, he was aware of the danger - the warning signs were evident - reminding him that his will would have to be strong; that he would need to minimize his dependency so that it would not get the best of him before he could complete his mission.


As a result of this ordeal, the onslaught of mood shifts and his struggle to overcome his dependencies, journal entries composed during this time subtly reflect the portrait of a state of mind which was constantly in flux; frequently oscillating - like the sweep of a sine wave - between rational, logical observations, and what were perhaps drug induced phantasies - cryptic, obscure fragments, referencing; demons, the green glow of a swamp, listening for the dogs, hard ice, wax women pirouettes and the saint shaking the serpent into the fire... vague, almost poetic, entries - recorded at much more sporadic intervals than in the past when he had been nestled within the sanctu‐ ary of his winter cocoon - now hastily scrawled in strange script which did not conform to the rectangular shape of the sheet of paper, the words grouped into tight blocks of text or forming long rambling lines which exceeded the margins, never to complete the thought by returning to the page: “The soul is a dream...", Jurgen had written, " ... a butterfly locked inside a cage of meat, skin pale and transparent, ephemeral, tentative, its dark veins revealed through the surface like a map in the cool blue light of the few remaining tubes above that flicker from the ceil... ” Jurgen's only previous experience of a disembodied sensation had accompanied sojourns into digital reality - but as immersive as those experiences had been, at some level he had always been aware that the sensing apparatus; connected to the computer through the fibre-optic cables, had been the warm, breathing organic composition he had grown accustomed to inhabiting. Still, he had occasionally entertained the possibility of a state of being completely disassociated from any physical form; perhaps as a spirit or a ghost, perhaps Nirvana - described in Buddhism as the final freedom; the attainment of perfect inner peace through the complete destruction of all human desire, fear and error - the total annihilation of the self. Jurgen had convinced himself that the soul was a quantum of universal energy; immutable and pure, that was integrated into the fabric of his being - and that when his being had ceased its physical existence, that energy would discorporate. He could imagine release from the perpetual motion of the wheel of life which spins out the casualty of all incarnations, as being similar to the sensation that occurs when reality dissolves into the sleeper's dream or when shadows evaporate into light. “Who believes in the soul anymore? It seems that we have all become automated machines; more rigorous than robots in obediently following our programming - yet we do not give a thought to the programs that we run. Arrogant and narrow minded, the Masters of Reality; those who attempt to play the role of gods without sufficient knowledge of the Divine Plan, have come into possession of ingeniously crafted code which skillfully manipulates our perceptions in a manner which allows them to maintain control. They have eliminated our ability to truly experience love and compassion; those qualities which sustain the soul. Instead they have persuaded us that our obligation to fabricate commodities and our insatiable craving to consume them is the only way to be fulfilled and to minimize our fear. Marketable products; gadgets, medication, entertainment - everything is the same; homogenized, safe and soothing as a glass of warm milk - that is what we want - we long to escape uncertainty


and the terrors, we desperately seek something to replace the actuality of our situation - satisfied by even a temporary solution - something to pass the time - distractions to fill the void. The citizen’s only freedom has become their ability to lose their memories, their only escape is to lose track of their identity. Rather than attempting to achieve enlightenment, their disembodied minds separate them from the physical world by seeking out happiness within the illusions of digital reality. Seduced, we have become attached to it; it is our everything. The consensual reality which defines who we are; creating our vanity, desire and ambition; those traits which ultimately result in torments of suffering, pain, and fear - perpetuating the endless cycle.” “Some people have a religion which fills them with joy and gives them the courage to contemplate the notion of dying or to confront the finality of their existence. Eventual‐ ly they recognize that to love reality is to love something of doubtful existence, and that the knowledge of that love becomes a record of life’s futility - the struggle in vain against the inevitable. Aware that their minds are only required to exist as long as their bodies; which for everyone is expected to be a finite duration of time - death becomes a natural consequence within the process of evolution, as humanity, individually, and ultimately collectively, approaches a state which is divine. Some have also discovered that their soul is eternal, yet while inhabiting their bodies it often remains in a dormant state. It is released with the destruction of 'self'; only then do we have the freedom to love another - everyone - only then do we have the freedom to merge with the divine." Jurgen was aware that the path of his journey was not for everyone: since, to be released from attachment and to attain the freedom from illusion was an expedition with uncertain rewards. To go too deep - to explore and to question, was to ultimately experience the unknown - one question leads to the next but the answer is always the same... Who was willing to explore beyond the boundaries of their ability to compre‐ hend? Who was willing to have faith in what they believe? Physicists no longer spoke about pre-determined events which occurred according to fixed laws, but rather they factored in the unpredictability of probable events as they peered through the quantum layers to discover that there is no foundation - that everything is interconnected, and everything is impermanent within the vastness of the all-encompassing endless beginning - a state neither coming into being nor ceasing to be. Yet, Jurgen had recognized that the majority could not be faulted for believing what they were told; for following the instructions of their code - they were just trying to live their lives to the best of their abilities - they were the Good, they didn’t need to fill their heads with endless lines...” In 2011, at the age of 27, Jurgen had not longed for immortality, neither had he feared mortality. His faith had been in the scientific process; a process conducted with a rationalization understood in terms of logic rather than emotion. Originally conceived as an attempt to fabricate entities which could inhabit the network, the objective of his experiment had eventually become a quest to discover a way to transform his state of existence. One night, during the previous winter, the revelation of a mechanism by which he could encode his soul had appeared to him as a vision. Subsequently, he


had spent several weeks drafting out diagrams and transcribing the information into one of his journals before beginning the arduous process of handwriting the software which could facilitate the process. The realization had been that, in addition to preserving the encapsulated essence of his being; his memory and his DNA, the possibility had now existed that his life force could also be distributed among the billions of tiny packets; in which each unique entity contained a condensed quantum of the universal energy which had energized by his soul. It had always been Jurgen's hope that what had begun in this world would be fulfilled in the next. It had been a romantic notion. Nonetheless, Jurgen had been intrigued by the possibility of being able to continue his existence beyond physical death, not - in a sense - by merely transcending reality, but by reproducing himself through the creations that he had brought into the world. As they freely moved about as particles of light on the data streams throughout the network universe - similar to the way that viral entities travel through the bloodstream of biological creatures, Jurgen believed that his entities would ultimately achieve a collective consciousness through the process of their continual interaction. They had been engineered to obtain knowledge - harvesting fragments of data which then determined the sequential order of their code; so that as they progressed toward a more advanced stage of evolution, the more their awareness would increase. At some time in the future, his digital presence - integrated within the multitude of entities which contained his vital force, could reconfigure itself into another version of his being... ultimately attaining, he believed, a state which approached perfection. Yet, the conception of the manner in which that entity would be perceived was beyond the realm of even his own imagination: His presence could possibly manifest in a form which was able to contact those citizens who feel entrapped by an increasingly soulless system, and perhaps inspire them with hope. Perhaps it would provide them with knowledge; illuminating their minds and leading them out of illusion, or just send an expression of his love which could transport them from their loneliness: “the loneliness of being human which comes from the realization that there is a solitary part of us that no one else will ever touch.” Although the culmination of the experiment would result in the end of life as he had known it, perhaps Jurgen had been willing to endure the pain, and sacrifice himself to the machine on behalf of humanity, since he believed that they needed some force to protect them - he believed in their need for salvation, as well, he truly believed that he loved everyone and that he loved the world. “The soul that guides human compassion is brought into being through love. The man who renounces the body in order to deliver the soul is divine.” Jurgen's commitment to seeing his project through to completion had been planned in intricate detail - cloaked in secrecy and isolation with the intention that there could be no final judgment; no method to evaluate the experiment's failure or success. Jurgen had recognized that it was possible to reason that he was making an error in judgment; after all, who would willingly sacrifice their human existence in exchange for


a virtual one? His friends or family; had they been aware of the true nature of his activity, would certainly have tried to dissuade him from his course of action. Yet, as mad as the endeavor sometimes seemed; even to him, he knew that he was not prepared to leap blindly into an abyss. The final step was inevitable, it was the final solution; a determination of the unknown variable. And he had not relied on faith alone to ensure that the resolution of the process would be successful - it was all part of a meticulously crafted plan. Thus, the notebook(s); upon which he recorded his crudely sketched schematics for the soul-catcher apparatus, and the lines of program code etched onto pages by thousands of tiny hand-printed letters, had been consigned to the woodstove in the kitchen. Soon a roaring fire crackled heartily. And while the heat had warmed his body, Jurgen considered that the decision to come face to face with mortality and to tenderly embrace it had been the logical culmination of a journey which had involved years of research and experimentation. While their were no assurances, Jurgen was confident that however the story ended it would be worth the price of its consequences. It seemed to him that his life’s mission could be considered complete when his body had served its purpose. What did it matter if he was 27 or 207 - time was relative in the universal scheme of things. At least he would have the satisfaction of knowing that his life had served a purpose; that he had accomplished what he had set out to achieve. And along the way, Jurgen had been inspired by some intangible source to which he could not give a name; fate, divine intervention ... deus ex machina? It had given him the faith that he relied upon to take the final step across the threshold. It had provided him with a sense of reassurance that this path - which he had now clearly recognized, was predetermined for him to follow. That realization, in turn, had given him the courage to confront the temporality of his existence. Sometimes, when he had contemplated the eventuality of his final moments, Jurgen imagined the energy comprising his soul becoming more concentrated; focused - like a sun burning hotter before going nova - then exploding in a rush - rapidly releasing the burst of energy seeding new forms of life throughout the network universe. Soon thy will be done. It is one thing to attempt to simulate life but it was quite another to create a living consciousness. Jurgen recalled fragments of 'Frankenstein' - and the lessons learned; the story of another young German scientist who had willingly tampered with the forbidden - playing the role of God by undertaking the experimental process of animating dead flesh. Or Dr. Faust's devil, who had agreed to provide Faust with anything that he requested - for a period of twenty-four years - at which time the devil would demand the surrender of his soul. At daybreak; the morning after Faust's contract had expired - those assembled at the Doctor’s home had discovered the price that he had paid; bloodstains were everywhere, bits of brain clung to the walls, here they discovered an eye, and over there a few teeth...


XIII. CORDOVA FROST

Jurgen was wired; his body thin and nervous as if it had been eaten by birds. He had awoke within the protective environment which he had recently fabricated; a large, irregular-shaped, translucent structure; illuminated orange by interior halogen lights, suspended by wires from the ceiling to enclose his laboratory in the center of the quonset. Jurgen paused to contemplate the oddly-constructed form; once again experiencing the vague déjà-vu-like recollection of another similar cocoon he had made in Japan several years before. The enclosure's semi-transparent walls; consist‐ ing of ragged weathered plastic sheets patched and held together with duct tape, had been scavenged by dismantling the protective barrier which had sealed his bedroom sanctuary - the environment which had enabled him to survive the previous winter. It was more important now that within the enclosure there was heat, light and power; the necessary resources sacrificed from other areas of the building in order to ensure that the essential equipment at the core of the experiment would be able to continue operating. He pulled on his heavy duty hiking boots and stood up next to the mattress. He stretched and yawned; the night was late, but there was still much work to do. Dressed in a tattered heavy parka, he returned to his workstation, watching the vapor of his breath drift through the light of the illuminated cocoon. Once again he deeply im‐ mersed himself encoding a series of intricate differential variables; defining the coefficients of experience, perception, and memory ~ the calculus of thought and experience. Time step. Relational theory. Reality testing. Pounding down blocks of code. Segments - fragments - dosage of CBr (2,5-Dimethoxy-4 Bromophenethylamine) one fortieth of a gram. He had been trying to cut down on his usage; oh how he had tried! But it had seemed to be the only way of getting through the night; the only means to sustain his momentum - the path of least resistance... and on that path, that point had long since been surpassed during each of those successive moments in which it had already seemed that this had gone on for too long. All that he wanted to do now was to find some way of successfully completing his journey - under pressure since he was increasingly aware of an internal gauge which registered that the situation was becoming critical. There was just enough energy remaining for the final push to the finish line and Jurgen knew that if he didn’t make it in this last sprint he was going to hit the wall. Ping ... beep ... beep ... ping ... beep ... beep ... The warning prompt had begun to flash within the spinning icon of the TVi which floated in the corner of the screen. The call line; a narrow text field across the top, indicated that the link request had come from Dr. Brenner of ZPC.


Jurgen had anticipated envisioning Dr. Brenner's stern, masculine, grandmotherly countenance... he had several questions to ask her about his current dosages. He scratched his scalp through the ratty black toque he had been wearing then switched on the tiny camera mounted above his workstation. Positioning himself before the screen, Jurgen selected the icon which opened the TVi window: It was not Dr. Brenner, but an unexpected face which had instantly appeared. Perplexed, Jurgen had glanced up at the line of text above the icon to double check the origin of the call, sure enough it read: Dr. Brenner, ZPC. 20:22, October 31st, 2011. “Who the devil are you?” Jurgen had spoken quietly. “I’m agent Cordova Frost; Flex Global Security.” The agent's identity authorization appeared in the bottom left corner of the video transmission screen. Upon hearing these words, a variety of unsettling thoughts had begun to sequence through his mind, yet Jurgen remained silent, waiting to hear what the agent had to say. It had not been unexpected; he had anticipated that this moment would eventually arrive, although, the way that it had happened had taken him by surprise. Cordova seemed calm and politely stated; “It’s important that we talk.” Jurgen pursed his lips and remained silent; as if considering what his next move would be. As he stared intently at the blood-stained screen, Jurgen noticed that an image of his own face had been superimposed over that of the agent in the video window; a reflection from the glass surface of the display - a hollow man who had appeared extremely tired - eyes sunken and dark, pale skin that sharply contrasted the black toque and scruffy mustache and goatee which enclosed thin, tight lips... Cordova continued, “Our agents have recently apprehended a hacker named Stephen Williams, known by several aliases. During debriefing, he claimed to have recently been in contact with you. And he has informed me that he believes you are in the process of developing a potentially dangerous virus which you plan to release into the network.” “I have no idea who that person is, but I can assure you that I am conducting legitimate research for a major corporation and unfortunately I can’t divulge any more information than that.” “Contract work for General Synthetics in Osaka?” Cordova pleasantly suggested. “No,” Jurgen smiled a brief thin smile, “I can’t disclose the... it’s proprietary...” “I understand,” Cordova interrupted, nodding his head, “You see, the person who allegedly contacted you - possibly using the name Russ Vai - was captured in the act of infiltrating protected computer systems. Interestingly, he has confessed that some of the tools he’d been using to carry out his activities were modified from base code you


had originally authored. Naturally, we checked out his story... I’m sure you know what we have discovered. Now, what we can do to save us both some time is to simply run a scan of your system to make sure that it’s clean.” Jurgen rubbed the hair on his chin with his fingertips; deep in thought - aware that Cordova knew if he was telling the truth, “I’m sorry that I can’t co-operate with your request since the scanners will affect my experiment. The objective of my research is to develop new forms of synthetic life and I must insist that they are not subjected to any source of external contamination.” “I can assure that the scanners will not harm the data, unless they happen to recognize the signature of a known virus embedded in its code.” Jurgen patiently explained, “The synthetic lifeforms do contain evolutionary code which is similar to a virus in certain respects; although I am certain there are no regulations restricting their development. I don’t have time to explain the project in more detail since at the moment I am engaged in my work.” “I appreciate that you are reluctant to co-operate, but understand that you can either voluntarily allow access to your system or we can obtain an Authorized warrant based on our suspicion that you intend to release these entities into the network.” Jurgen’s mouth felt dry, he licked his lips. “The system is isolated and contained.” The image of Cordova in Jurgen's video window appeared to scan a text file that he had called up on his screen, “I’ve noted in your file that you have a record of subver‐ sive activity.” Jurgen considered the statement for a few moments. “You are referring to the temporary disruption of the Wonderland shopping network last Christmas,” Jurgen responded. “Yes, I admit that it was an impulsive reaction to send a message to the consumers of the world on that festive day; it was inappropriate to separate them from their beloved products for even a brief period of time. It was wrong and I apologize. Is that what this is about?” “Partially; that strike had caused the Golden Sun Corporation to become concerned about the integrity of its servers, at which point I was assigned to the case. The crack on their system was very clean, professional, you obviously know your way around the network. I am investigating the possibility that you were merely testing the waters, exploring their system, in order to perpetrate a more lethal strike.” “I’m not interested in destroying anything.” Cordova paused, then proceeded with another approach; “Word of your activity has begun to spread throughout the media and has become a popular discussion topic between hackers around the world. Some believe that you are developing digital


entities which will clean the corruption from the network, while others are hoping they will trigger an apocalypse which will destroy it entirely by shutting the system down.” The subtle trace of a strange, half-smile appeared on Jurgen's face. He narrowed his eyelids slightly, “I must confess that I haven’t been keeping up with current events for some time; I am a programmer - politics are not my line. You know, there are those who create stories for reasons of their own, then there are others who follow them wherever they lead. What are they waiting for? An apocalypse! An apocalypse is the revelation of hidden truth ~ the lifting of a veil. It is not about the destruction of humani‐ ty or hardware.” Jurgen paused for a moment to formulate his next thought, “You seem to be a reasonable man: do you actually think that anyone could create an entity as powerful as that?” “There is considerable potential danger to all networked computer systems, even if such an attempt did not completely succeed.” Cordova still continued cycling through the documents that had appeared on his screen, “Is it not possible that a potential attack could be motivated by revenge; as a method of striking back at the Golden Sun Corporation for their involvement in the disappearance of your grandparents?” “I don't understand...” Jurgen's voice had trailed off. “While examining background information about your personal history, I discovered that, several years ago, you had accessed a number of military files. The subject matter of one report had stated that your grandparents; Cameron and Adda Stark, were terminated in the process of delivering secret documents to a contact located in mainland China when their plane disappeared in the sea. Upon further investigation, I had discovered that Adda Stark was the daughter of Sun Tzu; the CEO of Golden Sun Corporation, and that their contact was an executive of the corporation - a man named Mr. Luk.” Jurgen's expression revealed that he was having difficulty processing this informa‐ tion; lately he found it difficult to clearly remember any details about the past. The machine had stolen his memories; the hermetic storage towers standing like sentinels near his workstation now contained more of his recollections than his own mind did. “There is plenty of speculation about what may have happened,” Jurgen replied calmly. “The records of actual events are buried deep. I don’t know which sources you have obtained your information from, but I don't believe I have ever been made aware of any connection between my grandparents and the Golden Sun Corporation before.” Jurgen paused, thoughtful, “In any event, even if it were true, revenge has never provided motivation for my actions. I have put the past behind me now. I am only interested in the future.” The agent appeared as though about to speak but then had thought better of it. Yet, in a moment he had concluded their conversation with a warning - tempered with what had been intended to be humour; “The Flex Global eye is eternally vigilant; able to see everything ~ it knows whether you've been bad or good, so be good for goodness


sake.” The agent had not smiled. “It’s been a pleasure speaking with you, Cordova Frost.” "In the future.” Cordova replied amiably as he had disconnected. The TVi window folded back into a compact icon; rotating endlessly in the corner of the blank screen to mark the passage of time. Jurgen stared into the void. He searched for memories about the research he had conducted into the lives of Cameron and Adda Stark; only a few lingering traces remained - scattered fragments - partial memories; ones that for the most part had been overwritten by the technical data he had already downloaded into his brain. It had made it difficult for him to reassemble an accurate recollection of the past - attempting to link the disappearance of his grandpar‐ ents with the Golden Sun Corporation... he couldn't remember... he could plug the jacks into the tower to scan the digital files, but it really didn't matter. Jurgen's curiosity about events from the past had been replaced with an increased sense of urgency about his present situation. His former nemesis; Russ Vai, had been consumed by a creature further up the food chain - an agent who had inherited the desire of its prey to continue the investigation of Jurgen's activities. It had been expected. And while the exchange with the agent had been casual, Jurgen was well aware of how these things work - he knew the routine. Jurgen was also aware that once he had become a primary target, the Flex Global forces would close in swiftly and effectively. It was not paranoia, it was a fact. It seemed that the timer had just been given an abrupt twist towards zero, compressing the timeline almost impossibly tight. Jurgen pulled off his toque and furiously tossed it across the room then let out a string of curses. Just when he had reached the limit of his endurance, it had been frustrating to become frustrated again ~ the ecstasies of despair! Still agitated, Jurgen shakily climbed the metal steps, entered the kitchen and grabbed a bottle of pills off the shelf. Sitting, eyes closed, with his head titled back against the headrest of the fighter pilot’s seat, the medication had crept in from the darkest shadows. It traveled through his veins and pumped out to his extremities with every beat of his heart. After awhile he had felt calmer. He slowly opened his eyes to dreamily consider the crossed-out frames on the calendar - suddenly realizing that it was All Hallow’s Eve; the date commemorating his father's birth in this very quonset all those years ago. An image had then formed in his thoughts; a nativity scene in which his father, as a babe, lay on the very same mattress that Jurgen had used for his bed - watched over by his parents; Cameron and Adda. In the vision, young Kropton had been wrapped in swaddling, which insulated him within the metallic manger, from the cold, howling wind, and then, as now, from the driving snow which blanketed the terrain. As he crawled under the covers of his bed, Jurgen had sensed that his grandparent's spirit remained to watch over him as well.


XIV. 11:11

The glowing green numerals; 11:11, had greeted him when he awoke. In the blur of haze from sleep the numerals resembled the eyes of a skull on the face of the digital clock. Jurgen had emerged naked from under the thick coverings then sat at the edge of the mattress on the floor of the dimly-lit orange cocoon. He scanned the flesh of his body - observing signs of the torture inflicted by his long ordeal; the scars from wounds which had healed leaving zipper tracks like tiny red centipedes tattooing his pale skin. And beneath the surface, dark blood vessels tingled like thin electric wires carrying a current, constricted, creating an absence of sensation in his fingertips - which now trembled as he painfully tugged at his frozen clothes until they had enveloped his body. Stooped like an old man, Jurgen shuffled into the kitchen, made a cup of coffee, ate a handful of pills then turned a new page of the calendar: November. Grainy parachutists descended from the overcast sky like thousands of tiny dandelion seeds in the faded printed photograph; glowing white canopies suspended above a land� scape ravaged by barbed wire, shallow trenches and the tracks of heavy war ma� chines rendered in tones of neutral grey, and further down - beneath the rusted staple along the fold, a grid of numbered squares scored through with the ragged, handdrawn lines that he had made during the previous year. Those squares, and the dreaded cold which had returned with a vengeance, were a grim reminder of the horrors of the winter he had previously endured. And they provided the realization that his rendezvous with destiny was soon about to occur. All the days had seemed to merge into one long day. Preparation for the final transfer had become the obsession; the sole focus of his effort and of his concentration. Within the isolation of his insulated environment he had no idea of what had been happening in the outside world; sometimes he wondered if it still existed. Once again he had become an invisible; without a fixed point of contact into the network, ever since Flex Global agent Cordova Frost had appeared on his screen. He had decided to remain off-line until the final launch. He estimated that he needed a window of approximately twenty-two minutes to generate and transmit his entities out into the network. It was essential that nothing interfered with that process, since he would only be able to do it once. As he now sat slumped in the pilot's chair he deter� mined the precise time for his departure: November 11th, 2011 at 11:11 am. Why had he chosen that date?


There had been an entry which provided an explanation, discovered in one of the charred notebooks scattered among the quonset's wreckage; retrieved by a member of Flex Global Security's investigation team. Jurgen had been written that the most important reason for making his selection was because it commemerated the day that his grandparents had disappeared in 1959. Jurgen had also been fascinated by a mathematical co-incidence which had also given the event significance. He had planned the moment of transfer to occur when the second, minute, hour, day, month, and year were composed of a string of digits, represented as: 11:11:11:11:11:11. His powerful computer was capable of extending this string much further into digital dimensions than he could possibly imagine; splitting the second into milliseconds, nanoseconds and so on... calculating one exact, precise instant when the transfer would begin. The alignment seemed analogous to binary notation. ‘1’ meant that the register or digital storage location held an electrical charge; that it was on. Also, in a much more intangible way, throughout his life, whenever he had observed 11:11 on a digital clock, the glowing numerals had somehow seemed to be a portent of his destiny. Even as a child, Jurgen had often noted the occurrence of that particular time since it was the only instance during the day when all four digital numerals on the clock were exactly the same. Its symmetrical mathematical perfection had filled him with excitement and dread. Yes, he had thought, soon his living force would disseminate throughout the network of the system - an Epiphany. Jurgen had anticipated the experience with neither joy nor fear. He stood at the edge of a black pool; reflective, translucent, associative, ambiguous, and evocative. Its mystery was its capacity to generate illusion; to evoke a sense of wonder. He shivered as he contemplated its awesome power; the object of his fixation, the vision of his dreams. Yet, as he observed the vision, it receded into the distance to become fragmented. 'Had his intense focus on details caused him to lose touch with reality?', he had asked himself, 'What was real?' This perception continually shifted from one moment to the next. Then the moment of doubt would pass and the clarity would return; the resolve of his conviction - he erased the thought from his mind if ever it occurred. It didn’t matter anymore; not the cold reality nor the number of the date since Jurgen was aware that time, in actuality, was just a mutable state. He could work continually, both day and the night, seldom pausing for rest. He could triple the standard dose; the medication which created a balance between stimulation and sedation as he drove himself to the limit of his capabilities. He could rely upon algorithms within the technical data he had downloaded into his mind to enable him to work more efficiently. And the bitter temperatures indoors had become part of the process of purifying his soul; one aspect of the prescription - suffering, contemplation and faith. Soon the chemicals he had ingested for breakfast had animated him; rousing him from his reverie by catapulting him out of the cockpit chair and down the short flight of rusted steps into the laboratory below. Under the parabola of the ceiling was perpetual twilight, although he knew that outside the afternoon was cold, clear and bright. Out


there it seemed that the sun went down and came up; spinning along the tight little arch described above the southern horizon as if it had become accelerated. Jurgen watched tracers of dappled sunlight streaming in through the perforations in the ceiling; expanding rusted holes where the rivets in the curved roof were missing, projecting constellations of jagged spotlight beams that carved across the corrugated metal like a welder's torch. The plastic sheets rustled as the quantum mechanic reentered the enclosure. Dressed in a frayed Nordic sweater patterned with abstract pixel-like bands of grey, burgundy, black and white, worn over greasy denim coveralls, Jurgen padded through the chaotic arrangement of strange machinery, his feet encased in dirty, thick woolen socks that were stuffed inside ragged slippers, a spanner in one hand and a pot of coffee firmly gripped in the other. The low-volume hum of technology which had been noticeable at first was soon replaced by the sound of Jurgen's internal dialogue. He approached the familiar workstation where he had perched for many long months and once again stared at the display with the eyes of a child. Mentally focused and alert Jurgen juggled several operations simultaneously; navigating layered graphical representations, carefully examining windows filled with text and continually shifting his concentration from one screen to the next; the data fields and images would come into focus whenever he passed his wand in front of the display. Running through simulation after simulation, he had thoroughly tested out the process. It had been the only way to eliminate any possibility of error occurring during the final sequence of the actual launch. And although Jurgen would never witness the final results of his experiment, the simulation had provided him with a method of visualizing his entities' existence... The results were fascinating. Studying the representation on the display had been like gazing through a telescope into the vast expanse of space; the data expanded like spiral galaxies unfolding in three dimensions. Although the simulation had only reproduced a very small micro-universe, as Jurgen had gradually increased the magnification of the image's resolution, the density of the information revealed yet another galaxy within the first one he had observed. The experience had seemed sublime; it seemed like something wonderful was about to happen. At the moment, the encoded data awaited in purgatory, although its potential would soon be realized through the protean formation of several billion intelligent digital entities created within a computer program which Jurgen had called 'the generator'. The software that he had authored would enable the generator to function in a manner similar to an assembly line in a factory; each version being fabricated from a collection of various component parts - integrating a fragment of Jurgen’s memory and digital DNA into the entities' ‘liveware’ code. The burst of vital energy which would give them ‘life’ occurred when the release of Jurgen's soul was captured as a quantifiable energy, then flash-fed into dynamic memory storage and scaled and parceled out to each entity as they were shuttled


along the datapath within the generator. The strings of digital notation would then be compacted using fractal compression to eliminate the incidence of recurrence and negative iteration, then finally; similar to the way that workers are customarily searched by security at the end of their factory shift, each entity would be thoroughly checked to verify the integrity of their code. Once packaged, the entities would be distributed through a softrouter which would fire them off at random to disperse them throughout the network. The generation process would happen quickly. Like a dying star going super nova - an orgasmic explosion of atoms radiating out from its fiery core; billions of entities drifting through an expanding network universe. Streaming around the globe as optical packets of light and interacting with other particles of data they would create a host of new celestial bodies. The pattern of the replication of encoded information would eventually manifest as the essence of the purity of knowledge ~ the threshold of passage from darkness into the light ~ the same light which Prometheus had stolen from the gods and which Lucifer had offered Eve in the ‘garden of earthly delight’.

XV. THE TWILIGHT OF THE GODS

Jurgen struggled to his feet, stumbling out of the dilapidated kitchen chair posi� tioned in front of the screen. He emerged through the flap of a plastic sheet into the dark metal room illuminated by the glow of an enormous dull orange paper lantern patterned all over with the erratic texture of grey strips of tape like the veins of a leaf. All the coffee he had been drinking was now rumbling in his guts. There was no need to go outside anymore. He relieved himself into the large fuel tank that he had salvaged from the wreckage of the Hurricane. The tank was positioned along the wall; furthest from the warmth of the heat at the core - the volume inside remained a frozen mass; the tank was not yet full. He glanced down warily at the cold cement; at night, iceworm tracks formed ridges under the surface indicating where they had burrowed, and Jurgen often feared the worms would suddenly burst through cracks in the concrete floor. Steam emerged from the rusted fill pipe as he screwed on the lid of the tank. Returning to the cocoon, Jurgen checked the countdown clock in the top corner of the display. It seemed that with every glance one or two hours would elapse. All systems were go. T minus 14 hours 46 minutes and counting... As the digital numerals scrolled, fractions of seconds turned over in a frenetic blur. The plastic around him rustled; the wind had picked up outside - the chill had become more intense inside the quonset as the light had vanished from the external


world. Jurgen scratched his scalp through the coarse black toque and stroked the hair around his lips and chin. He read the data as it streamed off the screen; an unblinking gaze fixed staring at the display - eyes red and sore - the veins inside his soft flesh tight and constricted. He couldn't recall the last time that he had slept - only to find his way back through the strange sequence of dreams, which, when they had reached the conclusion of the stories they had attempted to tell him, he would once again be rudely be awakened by the bitter cold. Sleep was a luxury that he could not afford... Sitting in the kitchen, eyes closed, his head tilted back against the headrest of the fighter pilot’s seat. The medication once again crept in from the darkest shadows. He could feel the ripped upholstery against his back where a hole had been carved out by the passage of a bullet penetrating the center of the seat. How much time had elapsed he wondered? He had just experienced one of those eternal moments which seemed to give life its meaning; an eclipse of the sun beginning through the kitchen window. He had trudged outside into the Arctic wasteland; glowing pale blue in the cool light of day, to watch the solar flares exploding on the distant ball of gas. The corona had seemed enor‐ mous; plasma streams blasting from behind the cold, spherical barren rock of moon, reaching out into a sky that had gradually faded into darkness. It was rare. These days he didn’t often venture outside the safety of the quonset - Tranquillity base - an island; rigid, immobile in the midst of an immense sea of desolation. The gentle snowflakes relentlessly tumbled from the sky as if the scene had been contained within a snow globe - accumulating in massive drifts which partially covered the building and had made the world seem quiet and peaceful. Jurgen massaged his face with his hands - and when he had opened his eyes to examine them, they appeared to have been molded out of partially opaque plastic; revealing the dark blue wiring of veins beneath the surface. Now less than four hours to go... Jurgen glanced down at his grease-stained coveralls; he was as filthy as a French‐ man. A hot shower would be nice, he thought. He sipped a tall glass of Brennivin; the bottle of Black Death had been a gift from Erik the pilot - Jurgen had been saving it for an appropriate occasion. The drink was laced with acetylcholine and some L-pyroglu‐ timate to give himself courage for what he was about to face. The immediate revelation had been that it was to be his last day upon Earth. After all these years of preparing for this moment, he was not surprised that as he stood at the threshold he had begun to tremble at the realization of his own mortality and the fragility of his existence. Until now he had not anticipated how it would feel, but as that moment had approached the experience no longer seem real. Nothing seemed real anymore. He had tried to remind himself that he was merely a mechanism preparing for transformation, but the reassurance of the voice within his thoughts could not stem the fear.


Determinedly he had set himself to the task at hand rather than dwell upon the uncertainty of his thoughts. With a crowbar he had pried open the wooden crates. The soft explosives were sealed inside slim transparent plastic tubes; resembling flaked metallic silver sausages. Jurgen used duct tape to fasten them onto his hardware then attach blasting caps along their smooth surface. He ran the leads into a timer delay which would send a current through the wires to detonate at a predetermined time; approximately one hour after the digital data had begun streaming out on-line. Jurgen had gone to considerable effort to ensure the destruction of the evidence - since he apparently had a great deal of explosives. Not only did he target his computer and storage towers, but he had also placed charges at regular intervals throughout the building, stuffed them into the mattress on the floor of the cocoon, and had even taped them onto his body. The devil is in the details. The explosion would be complete in its devastation; spreading many small frag� ments of wreckage over several hundred metres from the epicenter. Jurgen stood up feeling shaky, walking slowly, hunched over like an old man; moving with the purposeful determination of a cosmonaut preparing to travel up the gantry elevator to his space capsule as the digital clock unwound. The tangy smell of plastic drifted off the sheets of the enclosure, warmed by the heat generated from the lamps and the computer hardware clustered around the mattress like surgeons preparing for an operation. This was the adventus; the time of final preparation. Digital Vestal Virgins were his guardians; they kept alight the perpetual flame at the mystic heart of the machine - the unearthly sound of their engines were the low volume hum of the technology buzzing within the dimly lit cocoon. Within was an oasis of life; a vitality contrasting the world existing outside the quonset in the bitter darkness - where the brittle cold had frozen everything solid and had caused all motion to cease. The cluster of bright halogen lights suspended under the canopy projected shadows of the hardware onto the plastic sheets; shapes resembling the standing stones of Stonehenge encircled the mattress laying on the concrete floor. As he made his way among the monoliths it was as if preparing for an ancient spiritual ceremony. Each movement had been dedicated to purpose like a ritual. His mind clear; the technical data he had downloaded into his brain told him what he needed to do - step by step he followed the program that he had previously prepared for himself. The instruction set was the ritual; part of the natural order within his mechanical ecosystem - as if he were merely one of the components rather than the creator or the master. Even the equipment seemed to obey the same force of nature which caused plants to grow and wind to erode mountains. There was no distinction between his inner self, the equipment within the cocoon, and the external world and universe beyond the quonset walls. He and the machines shared that universe; both were composed of matter within the physical world. The same energy streaming through the circuitry of the computer also ran through the cells of a leaf, and the cells of his body - all physical objects within the realm of the vast subatomic creation... 'The manifestation of the physical object captures one moment in the unfolding of its energy', Jurgen had thought to himself.


As part of the ritual, Jurgen had carefully arranged an ancient electronic device upon the wooden dynamite crate positioned at the head of the mattress; the data synchronizer which had been an essential component of the Stark's Leveland experiment. He ran his hand over the surface of the battered chassis. Its texture felt rough where the paint had chipped and peeled away to reveal the metal underneath. The signs of wear and tear around the knobs and buttons and the random scratches on the cabinet had remained preserved since the time that his grandparents had originally operated the equipment. During the past summer Jurgen had modified the data synchronizer considerably to create an essential component of the soul-catcher's hardware mechanism; it had been redesigned to interpolate data from the sensors he would attach to his body, running through cables into the processor where the generator would parcel out the energy released by the soul during his final moment. He turned on the power to the ancient machine; the vacuum tubes buzzed and gradually began to burn with a dull red glow. There had been a sense that the process completed a connection with grandpar‐ ents that he had never known; fulfilling their experimentation, in a sense, by delivering its ultimate conclusion - they would have appreciated his intention of converting his physical being into a quantum of digital energy, since they had a thorough under‐ standing of the law of thermodynamics regarding energy/mass conservation. But even more than this, Jurgen believed that the small black metal box held an intrinsic form of power which had given it the ability to produce some type of magic - or generate a spirit - a belief which Jurgen realized resided beyond the bounds of rational explana‐ tion. Stripping off his clothing, he lay upon the mattress; his body naked except for a small white triangular cloth covering his genitals. Tiny jacks emerged from the short bristles covering his previously shaved scalp; during time he had grown accustomed to the short lengths of wire permanently protruding from the top of his head. Clear eyes and clear mind. The patient prepped himself for the operation. There was no need to scrub up in a clean room; bacteria was the least of his concerns. He inserted a tube deep into a vein in his right arm - connected to a morphine pump. He entered a sequence of codes into a digital control mechanism which would gradually increase the quantity administered; approaching a lethal dosage as the countdown to the launch expired. A side effect was that the medication also prevented the signals sent out by his nervous system; which indicated pain, from reaching the cortex of his brain. He then inserted sensors under the skin at twenty-one points over his body; making the small incisions by slicing through the pasty layer of flesh with a razor scalpel. He hadn’t realized how emaciated his body had become until he caught a glimpse of his image reflected off a piece of chrome. Jurgen swung a small control panel over the mattress. Hovering above him were an array of readouts, buttons and displays. He slid a data glove onto his left hand then tightened the velcro straps on the 'crown of thorns' which wired the jacks connecting the probes inserted into his brain. Finally he fitted an elastic band over his head to hold the oxygen mask tightly to his face; a flexible white corrugated plastic hose was


connected to a valve on the stainless-steel oxygen tank on the floor beside the mattress. Inside the mask was a small microphone suspended close to his lips; a voice -activated recorder wirelessly connected to the storage towers with which Jurgen recorded comments and observations during his experiment's final moments ~ files which were transmitted to a storage location on the network. He intended that the data recovered would provide a source of explanation for the reasons that he had carried out the experiment, and perhaps provide a final message to those who knew and loved him. He now spoke, testing the levels; light-emitting diodes moved as coloured bands on the vu meter of the digital recorder ~ the microphone activated only during periods that a signal was detected ~ the sound of his voice. Wires and cables extending between the control panel suspended over the mattress and the processor on the nearby kitchen table were neatly-bound with short sections of black tape snaking between the various hardware components. Breathing heavily like a cosmonaut waiting within the capsule on the pad, his heartbeat was a function of the clock-speed of the processor. Jurgen sequenced through a system check of the equipment; flipping switches and monitoring the information displayed on screen - the final preparation for a voyage from the physical world into whatever was beyond... Angels turned the wheel of the pump; each revolution sending a measured dose of morphine into his system. He collapsed back as the next wave washed over him. Then adrenaline anxiety; the fear that he had miscalculated - since it had kicked in very hard. He hoped that it wouldn't incapacitate him since he still needed to be able to function; to monitor and adjust the settings on his equipment. He tried to raise his head but his neck could not support the weight; his head sunk back into the mattress. He closed his eyes. Visions: shapes that passed through each other rearranging the atoms like energy fields or cellular division. Particles which make up the organic structure of nature. Dreaming of umbrellas in the rain in Tokyo. He struggled to regain consciousness - drawn back to reality by the sound of the machines. He opened his eyes. His heart was pounding hard. A glowing green line; a ragged sawtooth of sharp jagged spikes, moved across the screen with a regular rhythm. The electrical impulses generated by the activity of the muscles of his heart cycled in frequency, kicking the spike, which would rebound in echo. Positive and negative peaks swept across the median plane. When that line stretched out to infinity; the flat horizon of inactivity - life would cease to exist. He reached out toward the keypad on the grey faceplate of the pump. The panel was covered with warning stickers lettered in German - surrounding a big red warning light which was not yet shining. Through cloudy eyes Jurgen could scarcely discern the image on the tiny display screen mounted in the control panel; the graphical representation of a human body spread out like a Divinci drawing - colour-mapped to represent the thermal flow of his neurological activity - continually updated as a stream of numerical values appearing in the lower right-hand corner of the screen. As he moved his gloved hand in front of


the display, the model slowly rotated through the axes of three-dimensional space. He changed views with the movement of a finger; the surface shape morphed and evolved displaying the structure of the molecular map - the pattern vibrated with frozen distortion leaving behind a transparent trace whenever the data scan was transitioning between states. He now entered in the sequence code to initialize the master program which would carry out the data transfer when the countdown had reached zero. A stream of saliva flowed from the corner of his mouth. The launch sequence time elapsed: T minus 00:12:43. The slow movement of the icon superimposed over the grid of graphic maps. Inj no 22 [morphine]. He watched as the bands of colour pushed the plateau level of the graphs far above the plane. "The sangha flew off to mount Kailas, where the ragged saint spent the night meditating in the cave. All life is suffering. All life is self replicating," Jurgen spoke into the micro‐ phone. At 00:11:11 the automated launch sequence systems began to initialize. Beyond this moment there was no return. The commitment to separate himself from the pain of existence, the courage to break the bonds of attachment with physical reality would be complete. "What have I sacrificed?" Dreaming of umbrellas in the neon rain outside the Tokyo hotel window once again... The creator locked inside his factory fortress paid no heed to the cries outside. He was concentrating on adding depth to the modeled shapes within the mechanical reproduction; textures wrapped with photographic realism onto a swirling spiral of liquid silver, surfing through a virtual simulated universe. He did not seem to notice the amber glow through the translucent dusty windows; the torches carried by the teeming mob outside - he was building the world, the flesh and the devil, shaping the faces of the meshes to create the superhuman. Behold the object in all its radiance, he had marveled - an object far greater than the sum of its parts. But the mob was unruly, they were hammering at the door with axes and rakes attempting to splinter it to bits, they screamed curses that he was evil - accusations that he was not just content to manu‐ facture life but constantly trying to improve upon it. The creator finally turned to acknowledge the ignorant masses with a jagged sneer; did they not appreciate that an artist can never tell when the work is complete? - his expression seemed to indicate. Taking his cue from Hephaestus, he had threatened the mob with an oath to fashion a beautiful Pandora and send her forth with a grain jar full of evil as punishment to the villagers for their boorish criticism, their jeering taunts, and their screams of bloody murder... The sequencer software faded out the power circuits connected to the overhead halogen lights inside the room; diminishing the illumination - channeling the precious power from non-essential equipment to ensure a reserve supply for the computer hardware which would soon become essential. The glowing displays orbiting his workstation now switched out to black in standby mode as the countdown continued to progress. In the dimly lit cocoon the tiny lights on the equipment twinkled intently like a field of stars. “Many worlds, these paths are not real, only artifacts of theory. I am the...”


...the child had once observed his father constructing strange machines but had not understood their importance. The separation from home, the commute across the wasteland of everyday life and the obsession with work had removed his father from involvement in his life. Had his father sought escape from the sanctuary of the home? Had he been compelled by the need to lose himself in the vast complexities of his work? Addiction - dependencies. Iceworms shattered the concrete floor, slithering up along the sides of the mattress, crawling under the translucent surface of his pure white skin, erasing the senses, sliding like cool fire through the thin plastic tube. Now particles flashed like a wall of white noise as the medication tranquilized his brain even though his eyes were open wide. The logic of chaos, predicting the unpre� dictable; a life inexorably unyielding to prayer. Above the static now the clear voice of an angel. A vision of Coraline in a futuristic suit illuminated by a glowing chemical halo. The ephemeral video-like sequence repeated again and again. The sound of ragged breathing had grown calmer - less irregular, as the sequence began to fade. The cadence of his speech had slowed; his voice becoming hoarse. An error message suddenly displayed on the control panel; the error was -48. Jurgen attempted to raise his hand but the display seemed to be beyond his reach. Time 00:04:12. Everything seemed to be moving in slow motion, he could feel the flames licking his flesh, the strength draining from his body. His hand dropped to the mattress. He slowly closed his eyes and submerged into the void. There was a sense of tranquil serenity; once again the floating-point - suspended between possibilities. Here there was neither life nor death. No longer existence, yet the awareness of existence. An experience of understanding the activity surrounding him, a data communion, a spiritual relationship, as if his consciousness had expanded into the machines. The generator was running. Like a hive, billions of fragments which made up his physical structure and dreams had begun to swarm with the energy of life. The synthesis of his own being, a duplicate - external from himself, was beginning to form within the code. He could sense the exact moment that the computer accessed the global network; the expanse of data opened to his consciousness like a vast blue ocean. He anticipated that soon the energy of his existence would begin to flow back to the source like spawning salmon finding their way back along the streams. The moment of fulfillment, or possibly self-destruction, was imminent - yet, it had seemed that the final scenes of his life had expanded in duration; as if time had stretched towards infinity. He gazed up into the halo of light suspended above him and wondered if in that final moment there would be the realization of ultimate release, the bliss of nirvana or, as the darkness engulfed him, would there only be the experience of complete and devastating defeat; the horror or the bliss when the Swallower consumed his soul... Something had to die in order for there to be resurrection - he had convinced himself that it was a noble and compassionate sacrifice that he had been willing to make.


He felt at peace as the pump delivered its lethal injection. He could feel the chemical flowing through his veins and taste the poison at the back of his throat. This is the way the world ends; reality dissolving like a dream. The sensation of leaving his body, of deconstructing into atoms, tapped and flowing through the connections hardwired to the machine. The energy was massive as the matter dispersed. His consciousness expanded to encompass all things, overflowing like the substance and emptiness of particles expanding through the zero gravity of space. He experienced the vision of his body; the viewpoint gradually rising to a position directly overhead, then slowly beginning to revolve like a camera mounted on a ceiling fan. On the mattress beneath him was the image of The Hanged Man from tarot; stretched out on his back, left leg tucked behind the right - naked except for a small triangular piece of white cloth. The body thin and pale, drenched in sweat, dried smears of blood where the wires emerged from the flesh. Pale bread and wine the colour of fire. A cloud of light encompassed the body with a radiant glow. He could visualize the flow of light from the wired implants beneath the skin which were beginning to stream into the machine. The facial expression was one of deep concentration which showed no signs of suffering. Mercy. Compassion. Clear. Time elapsed: 00:00:01... The chemical bride. A radiant vision - a smooth pearl suspended precariously in the oily darkness, glowing with pure white love. Silence. The elaborate pattern of lace in the fabric of her wedding gown was ancient and had yellowed over the course of time. Elegant silvery moonlight gloves clutching a fragile bouquet of white roses - she gently placed one of the flowers on the chest of the young man who rested peacefully before her - he was asleep and she did not want to wake him. “Pleasant dreams,” she said. Within the firmament, seven stars had become perceptible; ascending the ladder through the orbits - the chakras had begun to open within the storage towers... alpha and omega... the rotating spiral arms of a galaxy... the flaming sword distinguishing the temporal from the eternal. Weightlessly floating in space, she gracefully rotated toward him... when the angel appeared it had been horror but as she approaches it is bliss... she slowly raised the veil which had been masking her identity to reveal a glimpse of a face that he had recognized; that he had seen before. Who was she? Just at that moment - the shadows evaporated in a brilliant, incandescent flash; pure white light going supernova. Jurgen whispered, “I can’t remem


Turn static files into dynamic content formats.

Create a flipbook