Page 1

técnicas de producción

Selección de bacterias probióticas para uso en larvicultura de camarón La prevención y el control de las enfermedades del camarón se han concentrado la mejora de las técnicas de cultivo y el uso de vacunas y antibióticos, pero las bacterias probióticas y los inmunoestimulantes han sido, durante los últimos años, dos de los métodos preventivos más prometedores.

L

a industria acuícola está plagada de problemas provocados por enfermedades. En revisiones recientes se han definido los criterios de sanidad y las propiedades funcionales de los probióticos exitosos. Éstos incluyen las siguientes

especificaciones: evaluación de las propiedades de adhesión, exclusión de patógenos por competencia, evaluación inmunológica y efectos de crecimiento en el hospedero. Varias especies de probióticos han sido aplicadas en peces y mariscos, entre los que se

incluyen Aeromonas, Alteromonas, A r t h r o b a c t e r, Bacillus, Bifidobacterium, Carnobacterium, Enterococcus, Lactobacillus, Lactococcus, Micr ococcus, Photorbodobacterium, Pseudomonas, Roseobacter, Streptococcus, Streptomyces,


Thalassobacter, Vibrio y Weissella. Se ha reportado que la mayoría de estas bacterias probióticas son efectivas en la reducción de enfermedades bacterianas y en la estimulación de la respuesta inmune, y han sido utilizadas en el cultivo larvario de camarón, cangrejo, trucha, ostión y peces. Éstas son suministradas como células liofilizadas directamente en el agua o a través de organismos acarreadores, como nauplios de Artemia o rotíferos. Algunas bacterias son antagonistas de virus y pueden ser eficientes en el control biológico de enfermedades virales. Recientemente se han realizado estudios de investigación sobre métodos para mejorar la calidad de agua de los cultivos larvarios, y la aplicación de probióticos en la acuicultura ha cobrado impulso. La solución fermentada es un subproducto de organismos productores de hidrógeno. Se propuso evaluar sus efectos sobre la salud de organismos acuáticos para ser utilizada. Cuando el tiempo de co-cultivo fue menor a 4.5 h y las bacterias patógenas eran añadidas en concentraciones de 2-4 UFC∙mL-1, se encontraron actividades antagonistas contra Vibrio harveyi, Vibrio alginolyticus, Vibrio parahaemolyticus, Streptococcus iniae y Photobacterium damselae subesp. piscicida en experimentos in vitro (Tabla 1). El antagonista debe estar presente mayores cantidades que el patógeno, y el grado de inhibición se incrementa con el nivel del antagonista. También se evaluó la actividad antibacteriana de la solución fermentada, con y sin organismos, contra patógenos, observando que la primera mostró mayor eficiencia (datos no mostrados). En este estudio, por tanto, los objetivos fueron aislar las bacterias candidatas a probióticos de una solución fermentada productora de hidrógeno e identificarlos utilizando análisis de secuencias de 16S rARN. La selección de probióticos se basó en su antagonismo in vitro contra bacterias patógenas y posteriormente fueron probados en el sistema de cultivo larvario de camarón, desde zoea 1 (Z1) hasta postlarva 1 (PL1) para evaluar su efecto en la sobrevivencia larvaria y en la metamorfosis.

Los probióticos candidatos B. cereus biovar. toyoi y B. fusiformis obtuvieron un fuerte antagonismo contra los patógenos S. iniae y P. damselae subesp. piscicida, por lo que fueron elegidos para estudios posteriores como probióticos.

Materiales y métodos Aislamiento de probióticos candidatos Diferentes morfologías de bacterias candidatas a probióticos fueron aisladas esparciendo muestras de la solución fermentada en agar de soya tríptica (TSA) y las placas fueron incubadas durante 24 h a 28°C. Se tomaron colonias únicas y se purificaron en cultivos sucesivos. Cepas bacterianas y condiciones de cultivo Se obtuvieron del Instituto de Investigación de la Industria Alimenticia Hinchu, en Taiwán, tres cepas de referencia: V. parahaemolyticus BCRC 12865, V. alginolyticus BCRC 12829 y V. harveyi BCRC 12907. Éstas se cultivaron en placas de agar TSA y agar TiosulfatoCitrato-Bilis-Sacarosa (TCBS) con 1% NaCl. Los aislados en campo de S. iniae fueron cultivados en agar sangre (TSA con 5% de sangre de borrego) con 1% de NaCl, y P. damselae subesp. piscicida fue cultivada en TSA con 1% de NaCl, ambos aislados de cobia (Rachycentron canadum) con signos de enfermedad. Se utilizaron cinco cepas como patógenos.

Condiciones de cultivo e identificación de candidatos a probióticos Tres candidatos a probióticos fueron cultivados en agar TSA y caldo de tripticaseína soya (TSB), y temporalmente designados como BCFRI-1, BCFRI-2 y BCFRI-3. Éstos fueron identificados utilizando secuenciación de 16S rARN. Todas las cepas fueron cultivadas en TSB a 25°C para la extracción del ADN bacteriano. Un cultivo en crecimiento exponencial fue extraído por centrifugación a 12000 g por 2 min. El ADN fue disuelto en buffer TE (10mM TrisHCl, 1mM EDTA pH 8.0) hasta una concentración final de 0.25 mg∙mL-1 para la amplificación y secuenciación de los genes 16S rARN. Estos genes fueron amplificados utilizando la reacción en cadena de la polimerasa (PCR) con primers universales 16SF (AGAGTTTGATCATGGCTCAG) y 16S-R (GGCTACCTTGTTACGACTT). Los productos del PCR se limpiaron utilizando el kit de purificación QIAquic PCR. Todos los productos obtenidos por este método fueron directamente clonados en el vector pGEM-Teasy. El ADN de los plásmidos fue aislado de colonias bacterianas que mostraban un inserto de


técnicas de producción Se ha reportado que los camarones alimentados con dietas que contienen probióticos potenciales (p. ej. B. subtilis, V. alginolyticus, Roseobacter gallaeciensis y Pseudomonas aestumarina) han mostrado la mayor tasa de conversión alimenticia en comparación con los grupos control.

tamaño apropiado utilizando el kit Quiaprep spin miniprep. Tres clones seleccionados al azar representando cada producto fueron secuenciados en un secuenciador ABI 377 automático, utilizando primers. Se llevaron a cabo comparaciones de nucleótidos con las bases de datos de GenBank utilizando el programa BLAST. Sólo las secuencias de las cepas tipo de las especies cuyos nombres han sido publicados fueron consideradas. Cuando más de una secuencia se encontraba disponible, se utilizó la más completa. Interacción competitiva in vitro entre probióticos candidatos y patógenos Los probióticos fueron probados por sus propiedades inhibitorias in vitro ante bacterias patógenas utilizando ensayos en co-cultivos en TSB, siembra en placas de agar TSA, TCBS o agar sangre. Se ha reportado que durante los co-cultivos se requieren 107-109 UFC∙mL-1 para inhibir el crecimiento del patógeno V. harveyi a 103-104 UFC∙mL-1. Por tanto, se inocularon tres candidatos

a probióticos a un nivel de 105-106 UFC∙mL-1, mientras que los patógenos se inocularon a una concentración de 2-4 UFC∙mL-1 en TSB a 28°C con aireación y agitación a 1.4 g. También se realizó un precultivo con los probióticos en el TSB por 4.5 y 24 h antes de la inoculación con bacterias patógenas para el ensayo de competencia in vitro. Durante la incubación, las muestras fueron extraídas después de 0, 4.5, 24, 48, 72, 96 y 120 h para observar la relación de competencia entre los probióticos candidatos y los patógenos. Cada tratamiento se llevó a cabo por duplicado. Curva de crecimiento de candidatos a probióticos Un cultivo viejo de candidatos a probióticos fue inoculado en TSB fresco a una concentración final de 105 UFC∙mL-1 con aireación y agitación a 1.4 g. Se extrajeron muestras después de 0, 5, 13, 24, 29, 48, 53 y 72 h para conteo bacteriano y se obtuvo la curva de crecimiento (cambio en la cantidad de células vs tiempo).

Ensayos de sobrevivencia larvaria Con base en los resultados de los experimentos previos, dos candidatos efectivos, BCFRI-2 y BCFRI-3 fueron cultivados en agar TSA por 24 h a 28°C, cosechados y resuspendidos en solución salina. La absorbancia se ajustó a una densidad óptica (DO) de 2 a 540 nm, aproximadamente 4.7x108 UFC∙mL-1 (BCFRI-2) y 5.7x109 UFC∙mL-1 (BCFRI-3). Los probióticos probados fueron añadidos al sistema de cultivo larvario en una concentración final de 105 UFC∙mL-1. Se utilizaron larvas (Z1) de Penaeus monodon y Litopenaeus vannamei, respectivamente, en este experimento, y fueron cultivadas hasta PL1 para el ensayo de sobrevivencia. Se alimentaron con un alimento formulado sin alterar y con Skeletonema costatum cuatro veces por día. Las condiciones de cultivo fueron las siguientes: temperatura del agua de 30 ± 1oC, salinidad de 31 ± 1g L-1 y sin recambio de agua. Se colectaron tres muestras de agua de cada tanque, de 1 mL cada una, antes de la adición de los probióticos candidatos para evaluar la población microbiana. La sobrevivencia fue registrada al fin del experimento. Se aplicó un diseño al azar a las dos especies experimentales de camarón, con los dos tratamientos (la adición diaria de probióticos BCFRI-2 y BCFRI-3) y un control (sin probiótico). Cada tratamiento se hizo por triplicado con 45000 ± 820 organismos en tanques de 500 L. La calidad del agua fue monitoreada diariamente, incluyendo temperatura, salinidad, amonio, nitratos, nitritos y fosfatos. Las diferencias se consideraron significativas cuando P<0.05.

Resultados Los tres candidatos a probióticos, BCFRI-1, BCFRI-2 y BCFRI-3, fueron aislados de una solución fermentada productora de hidrógeno. Los análisis de la secuencia del rARN 16S mostraron que la cepa BCFRI-1 se encontraba cercanamente relacionada a B. foraminis, la cepa BCFRI-2 a Bacillus cereus biovar. toyoi, y la cepa BCFRI-3 a B. fusiformis. En la prueba in vitro de exclusión por competencia, el efecto de los tres candidatos a probióticos contra los patógenos bacterianos V. harveyi, V. alginolyticus y V. parahaemolyticus fue muy débil. Los


candidatos a probióticos B. cereus biovar toyoi y B. fusiformis obtuvieron un fuerte antagonismo contra los patógenos S. iniae y P. damselae subesp. piscicida, por lo que fueron elegidos para futuros estudios como probióticos, pero para el candidato a probiótico B. foraminis únicamente el tratamiento de 4.5 h de pre-cultivo mostró habilidad de exclusión. Las curvas de crecimiento de B. cereus biovar toyoi y B. fusiformis mostraron que la fase lag fue obviada y el crecimiento exponencial continuó durante 14 horas antes de alcanzar la fase estacionaria. Estas dos bacterias probióticas después de 24 h de cultivo alcanzaron la fase estacionaria, por tanto, fueron cosechadas y añadidas al sistema de cultivo larvario de P. monodon y L. vannamei. La adición diaria de B. cereus biovar. toyoi a una concentración de 105 UFC∙mL-1 resultó en efectos dañinos en la sobrevivencia de P. monodon (sólo 2.0 ± 0.3%) (P<0.01) mientras que la adición diaria de B. fusiformis mostró la tasa de sobrevivencia más alta (88.7 ± 0.7%) pero sin diferencia estadísticamente significativa con el control (73.3 ± 12.1%). Por tanto, sólo el probiótico candidato B. fusiformis fue introducido en el sistema de cultivo larvario de L. vannamei. El uso de esta cepa incrementó significativamente la sobrevivencia (P<0.01) en ambos tratamientos, siendo añadida diariamente (87.9 ± 1.7%) y cada tercer día (54.7 ± 1.2%), respectivamente, a una concentración de 105 UFC∙mL1, a diferencia del control (41.2 ± 1.3%). Los camarones que recibieron B. fusiformis diariamente sufrieron metamorfosis un día antes que los organismos control. No se observaron efectos obvios de los dos probióticos candidatos en la calidad del agua en todos los tratamientos. El nitrógeno amoniacal total (00.3 mg∙L-1), nitratos (0.4-1.7 mg∙L-1), nitritos (0-9 µg∙L-1) y fosfatos (0- 450 µg∙L-1) se encontraron dentro de los rangos aceptables para el cultivo de camarón. Las cepas probióticas pudieron ser detectadas en el agua durante todo el proceso de larvicultura, en el cual mostraron una fuerte capacidad de colonización para llevar a cabo sustitución por competencia. Se concluyó que el candidato a probiótico B. fusiformis fue confirmado como probiótico, el cual fue añadido diariamente en

una concentración de 105 UFC∙mL-1 en el cultivo larvario de P. monodon y L. vannamei.

Discusión Un probiótico, el cual es utilizado en acuicultura para manipular la población microbiana del ambiente y para reducir o eliminar microorganismos patógenos, es definido como suplemento microbiano vivo que afecta positivamente a los hospederos a través de la modificación de la comunidad microbiana asociada a éstos, mejora la degradación del alimento y su valor nutricional y mejora la calidad de los parámetros ambientales. Diferentes bacterias han sido utilizadas en el cultivo larvario de organismos acuáticos. Se ha reportado mejoras en la sobrevivencia y crecimiento de las larvas de ostras perleras como resultado de la adición del probiótico Lactobacillus acidophilus. Otros investigadores reportaron mejores parámetros de calidad de agua en tanques de cultivo experimental con Streptomyces que en el tanque control, y un incremento en el crecimiento conforme la cantidad de células de Streptomyces aumentaba. También encontraron que la duración del período de intermuda en animales con tratamientos de 10 g fue significativamente menor que en los controles. Posteriormente se ha reportado que Bacillus subtilis y Bacillus megaterium presentaron alta degradación de ingredientes comúnmente utilizados en alimentos para camarón.

Donde el probiótico era administrado durante los estadios larvarios (nauplio 1-2 hasta PL 30) y en los estadios de engorda, la tasa de conversión alimenticia, tasa de crecimiento específico y la producción final fueron significativamente mayores en los camarones que recibieron el probiótico que en los controles. Se ha reportado que los camarones alimentados con dietas conteniendo el probiótico potencial (p. ej. B. subtilis, V. alginolyticus, Roseobacter gallaeciensis y Pseudomonas aestumarina) mostraron la mejor tasa de conversión alimenticia en comparación con los grupos control, y después de alimentarlos con los probióticos potenciales por 28 días, la prueba por inmersión indicó la efectividad de reducción de enfermedades causadas por V. parahaemolyticus en camarones. El presente estudio sugiere que se mejora la sobrevivencia y la metamorfosis de los camarones con la adición del probiótico B. fusiformis en la mayoría de los ensayos, debido a que el género Bacillus, utilizado como probiótico, fue capaz de colonizar tanto el agua de cultivo como el tracto digestivo del camarón para competir con otras bacterias (especialmente con las patógenas) por nutrientes o especio, o a través de la producción de antibióticos. Las características de este género son similares a nuestros hallazgos excepto por la proporción de células de Bacillus en la flora intestinal


técnicas de producción La adición diaria de B. fusiformis a una concentración de 105 UFC∙mL-1 en sistemas larvicultura de camarón puede incrementar la sobrevivencia y avanzar la metamorfosis de las larvas.

de los camarones, la cual no fue monitoreada. En este estudio, los probióticos candidatos B. cereus biovar. toyoi y B. fusiformis fueron dominantes en co-cultivo in vitro, así como en los ensayos de sobrevivencia larvaria, aunque lo anterior resultó en una baja tasa de sobrevivencia de los camarones, lo cual puede estar relacionado a la concentración del aditivo, la proliferación masiva de los probióticos en el sistema, o los metabolitos producidos y excretados en el mismo. El efecto de estos probióticos candidatos en el crecimiento algal y la proliferación exhibieron un mayor incremento que en el control. Además Bacillus toyoi, sinónimo de B. cereus biovar. toyoi y B. cereus var. toyoi, ha sido utilizado como aditivo alimenticio de rutina en animales terrestres y en acuicultura para suprimir el crecimiento de bacterias dañinas para la salud del organismo. Esta cepa, por tanto, seguirá siendo valiosa en el esfuerzo para encontrar su potencial probiótico en acuicultura. La adición diaria de B. fusiformis a una concentración de 105 UFC∙mL1 en sistemas de larvicultura puede incrementar la sobrevivencia y avanzar la metamorfosis de las larvas.

Este es el primer reporte de uso de esta cepa en el biocontrol del cultivo larvario de camarón sin recambio de agua. La adición diaria de B. fusiformis en el sistema de cultivo larvario experimental de P. monodon y L. vannamei mostró altas tasas de sobrevivencia, de 88.7 ± 0.7% y 87.9 ± 1.7%, respectivamente. En el experimento con L. vannamei, el tratamiento con adición diaria mostró una significativa mayor tasa de sobrevivencia y metamorfosis más rápidas que en el tratamiento adicionándola cada tercer día, lo que puede deberse a la enzima proteolítica producida por el probionte B. fusiformis como en el caso de Bacillus S11; las especies de Bacillus también degradan la acumulación orgánica en tanques de cultivo de camarón y, aplicada al alimento, llegan al intestino de los animales y mejoran su salud. El tratamiento control en el experimento larvario de P. monodon mostró una alta tasa de sobrevivencia y una variación de 73.3 ± 12.1%, lo cual puede estar relacionado con las buenas condiciones ambientales en dos de las tres réplicas, por tanto no se encontró diferencia estadística significativa con el tratamiento con B. fusiformis.

El ambiente de cultivo contenía especies de Vibrio, las cuales son generalmente la flora dominante en varios de los estadios de desarrollo de P. monodon, y han sido descritas como patógenos. Éstas fueron observadas en el experimento larvario con L. vannamei, de manera que el control, el cual no recibió B. fusiformis sólo exhibió una tasa de sobrevivencia de 41.2 ± 1.3%. Se puede concluir que B. fusiformis, la cual fue aislada de una solución fermentada productora de hidrógeno y analizado su potencial para combatir bacterias patógenas en acuicultura en experimentos in vitro, fue corroborada como probiótico. La habilidad de exclusión por competencia contra patógenos fue la principal fuente de beneficios cuando se utilizó como probiótico, como se muestra en este estudio. La adición de B. fusiformis puede mejorar la sobrevivencia y acelerar la metamorfosis de P. monodon y L. vannamei. El método óptimo para su aplicación en el sistema larvario fue a una concentración de 105 UFC∙mL-1 diariamente. Artículo original: Guo Jiin-Ju, Liu Kuan-Fu, et al. “Selection of Probiotic Bacteria for Use in Shrimp Larviculture” Aquaculture Research, EE.UU., 2009

Selección de bacteriasprobióticas para uso en larvicultura de camarón  
Selección de bacteriasprobióticas para uso en larvicultura de camarón  

TECNICAS DE PRODUCION; PANORAMA ACUICOLA EDICION 15-2.La prevención y el control de las enfermedades del camarón se han concentrado la mejor...