CVJA Volume 26 Issue 2

MARCH/APRIL 2015 VOL 26 NO 2

www.cvja.co.za

CardioVascular Journal of Africa (official journal for PASCAR)

• H pylori infection in HIV-infected Africans on HAART • Dietary salt intake among medical students in Angola • TNNI3 gene mutations in South African patients • HIV-associated large-vessel vasculopathy • PASCAR Hypertension Task Force meeting • Spontaneous coronary artery dissection • Sudden cardiac death in low-resource settings • Cardiac sarcoidosis in pregnant women with arrhythmia

From only R31.61 SEP excl. VAT per tablet.

PUBLISHED ONLINE

For further product information contact PHARMA DYNAMICS P O Box 30958 Tokai Cape Town 7966 CUSTOMER CARE LINE 0860 PHARMA (742 762) www.pharmadynamics.co.za

Tel 021 707 7000 Fax 021 701 5898 Email info@pharmadynamics.co.za

DYNAFIL 50 mg: Each film-coated tablet contains sildenafil citrate equivalent to 50 mg sildenafil. Reg. No.: RSA S4 42/7.1.5/1071. NAM NS2 13/7.1.5/0086. DYNAFIL 100 mg: Each film-coated tablet contains sildenafil citrate equivalent to 100 mg sildenafil. Reg. No.: RSA S4 42/7.1.5/1072. NAM NS2 13/7.1.5/0087. For full prescribing information refer to the package insert approved by the Medicines Control Council, September 2012. * Department of Health Website. http://www.health.gov.za – Accessed 19/02/2015. DLC94/03/2015.

Printed by Tandym Printers

Active Ingredient: Sildenafil 50 mg 4’s pack SEP excl.VAT - R126,46 100 mg 4’s pack SEP excl.VAT - R173,44

Cardiovascular Journal of Africa . Vol 26, No 2, March/April 2015

Advise your patients about THE AFFORDABLE OPTION* for Erectile Dysfunction

• Radiofrequency ablation on a morbidly obese patient • May–Thurner syndrome with inconsistent findings

www.cvja.co.za

CardioVascular Journal of Africa (official journal for PASCAR)

Why you should publish with CVJA • Increased international exposure (indexed in Pubmed, Medline, Pubmed Central, Scopus, Embase and Thompson Reuters/ISI)

• Quick return on submissions • Changing patterns of heart disease in Africa get more exposure than in other journals

• Acceptance of diabetes studies as vascular studies in CVJA • African studies are given preference • Well-illustrated interventional studies are needed for CME in Africa (full website support capability)

• Instructions for authors on www.cvja.co.za • A PowerPoint presentation for new authors: 'How to write a scientific paper'

• Submit your manuscript online at www.cvja.co.za

Contact us on info@clinicscardive.com CVJA has the capability of publishing on Pubmed Central

For further product information contact PHARMA DYNAMICS P O Box 30958 Tokai Cape Town 7966 Tel 021 707 7000 Fax 021 701 5898 Email info@pharmadynamics.co.za CUSTOMER CARE LINE 0860 PHARMA (742 762) www.pharmadynamics.co.za

BRB93/03/2015.

ISSN 1995-1892 (print) ISSN 1680-0745 (online)

Vol 26, No 2, MARCH/APRIL 2015

CONTENTS

Cardiovascular Journal of Africa 51

www.cvja.co.za

From the Editor’s Desk P Commerford

Cardiovascular Topics 52 Association of Helicobacter pylori infection with the metabolic syndrome among HIV-infected black Africans receiving highly active antiretroviral therapy B Longo-Mbenza • T Apalata • M Longokolo • MM Mambimbi • E Mokondjimobe • T Gombet • B Ellenga • B Buassa-bu-Tsumbu • GM Dipa • EL Luila • AN Okwe 57 Knowledge, attitude and behaviour regarding dietary salt intake among medical students in Angola P Magalhães • EJR Sanhangala • IM Dombele • HSN Ulundo • DP Capingana • ABT Silva 63 Diagnostic disparity and identification of two TNNI3 gene mutations, one novel and one arising de novo, in South African patients with restrictive cardiomyopathy and focal ventricular hypertrophy JM Mouton • AS Pellizzon • A Goosen • CJ Kinnear • PG Herbst • PA Brink • JC Moolman-Smook

Review Article 70 HIV-associated large-vessel vasculopathy: a review of the current and emerging clinicopathological spectrum in vascular surgical practice B Pillay • PK Ramdial • DP Naidoo

Conference Proceedings 82 Development of the roadmap and guidelines for the prevention and management of high blood pressure in Africa: proceedings of the PASCAR Hypertension Task Force meeting: Nairobi, Kenya, 27 October 2014 A Dzudie • D Ojji • BC Anisiuba • BAS Abdou • R Cornick • A Damasceno • A Kane • AO Mocumbi • A Mohamed • G Nel • E Ogola • B Onwubere • H Otieno • B Rainer • A Schutte • IT Ali • M Twagirumukiza • N Poulter • B Mayosi • on behalf of the PASCAR Hypertension Task Force members

INDEXED AT SCISEARCH (SCI), PUBMED, PUBMED CENTRAL AND SABINET

Editors

SUBJECT Editors

Editorial Board

Editor in Chief (South Africa) Prof Pat Commerford

Nuclear Medicine and Imaging DR MM SATHEKGE

prof PA Brink Experimental & Laboratory Cardiology

PROF A LOCHNER Biochemistry/Laboratory Science

PROF R DELPORT Chemical Pathology

PROF BM MAYOSI Chronic Rheumatic Heart Disease

Assistant Editor Prof JAMES KER (JUN) Regional Editor DR A Dzudie Regional Editor (Kenya) Dr F Bukachi Regional Editor (South Africa) PROF R DELPORT

Heart Failure Dr g visagie Paediatric dr s brown Paediatric Surgery Dr Darshan Reddy Renal Hypertension dr brian rayner Surgical dr f aziz Adult Surgery dr j rossouw Epidemiology and Preventionist dr ap kengne Pregnancy-associated Heart Disease Prof K Sliwa-hahnle

PROF MR ESSOP Haemodynamics, Heart Failure DR MT MPE Cardiomyopathy & Valvular Heart Disease DR OB FAMILONI Clinical Cardiology DR V GRIGOROV Invasive Cardiology & Heart Failure

International Advisory Board PROF DAVID CELEMAJER Australia (Clinical Cardiology) PROF KEITH COPELIN FERDINAND USA (General Cardiology) DR SAMUEL KINGUE Cameroon (General Cardiology)

PROF DP NAIDOO Echocardiography

DR GEORGE A MENSAH USA (General Cardiology)

PROF B RAYNER Hypertension/Society

PROF WILLIAM NELSON USA (Electrocardiology)

PROF MM SATHEKGE Nuclear Medicine/Society PROF J KER (SEN) Hypertension, Cardiomyopathy, PROF YK SEEDAT Cardiovascular Physiology Diabetes & Hypertension

DR ULRICH VON OPPEL Wales (Cardiovascular Surgery)

DR J LAWRENSON Paediatric Heart Disease

PROF ERNST VON SCHWARZ USA (Interventional Cardiology)

PROF H DU T THERON Invasive Cardiology

PROF PETER SCHWARTZ Italy (Dysrhythmias)

Case Reports 86 Spontaneous coronary artery dissection associated with fibromuscular dysplasia AJ Dalby • LJ Levien

Vol 26, No 2, MARCH/APRIL 2015

CONTENTS

91 Sudden cardiac death in low-resource settings: lessons from a resuscitated cardiac arrest A Bonny • SN Amougou • M-L Mbenoun • K Karaye 96 Two cases of cardiac sarcoidosis in pregnant women with supraventricular arrhythmia E Ertekin • S Moosa • JW Roos-Hesselink • K Sliwa

S1

H3 Africa supplement Human Heredity and Health in Africa

PUBLISHED ONLINE (Available on www.cvja.co.za, Pubmed and in Pubmed Central) Case Reports

e1 Application of radiofrequency ablation procedure on a morbidly obese patient with a venous ulcer and large saphenous vein AÜ Yener • Ö Yener • HS Gedik • K Korkmaz • T Özkan • A Lafçı • K Çağlı e3 A case of May–Thurner syndrome with inconsistent radiological and surgical findings F Akin • S Aygun • N Gormus • YD Kar • HT Susam • A Ozel e6 Endocardite tricuspide sub-aigue du post abortum: a propos d’un cas LH Codjo • K-MS de Tove • FA Hounkponou • SHM Dohou • MD Houenassi e9 Removal of broken catheter piece with snare device during endovascular treatment of post-traumatic brachial artery pseudo-aneurysm V Temizkan • A Ucak • I Alp • MF Can • G Arslan • AT Yilmaz

financial & production co-ordinator ELSABÉ BURMEISTER Tel: 021 976 8129 Fax: 086 664 4202 Cell: 082 775 6808 e-mail: elsabe@clinicscardive.com

Production Editor

SHAUNA GERMISHUIZEN Tel: 021 785 7178 Fax: 086 628 1197 e-mail: shauna@clinicscardive.com

CONTENT MANAGER

Michael Meadon (Design Connection) Tel: 021 976 8129 Fax: 0866 557 149 e-mail: michael@clinicscardive.com

GAUTENG CONTRIBUTOR

PETER WAGENAAR Cell 082 413 9954 e-mail: skylark65@myconnection.co.za The Cardiovascular Journal of Africa, incorporating the Cardiovascular Journal of South Africa, is published 10 times a year, the publication date being the third week of the designated month.

Copyright: Clinics Cardive Publishing (Pty) Ltd.

All submissions to CVJA are to be made online via www.cvja.co.za

Subscriptions for 6 issues:

Electronic submission by means of an e-mail attachment may be considered under exceptional circumstances.

your postal address, e-mail

Postal address: PO Box 1013, Durbanville, RSA, 7551 Tel: 021 976 8129 Fax: 0866 644 202 Int.: +27 21 976 8129

To subscribe to the journal or change elsabe@clinicscardive.com South Africa: R450 (incl VAT) Overseas: R1250 Online subscription: R200 The views and opinions expressed in the articles and reviews published are those

Layout: Martingraphix

e-mail: info@clinicscardive.com

Printer: Durbanville Commercial Printers/ Tandym Print

Electronic abstracts available on Pubmed

reflect those of the editors of the Journal

Audited circulation

or its sponsors. In all clinical instances,

ONLINE SERVICES: Design Connection

Full text articles available on: www.cvja. co.za or via www.sabinet.co.za; for access codes contact elsabe@clinicscardive.com

of the authors and do not necessarily

medical practitioners are referred to the product insert documentation as approved by the relevant control authorities.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

51

From the Editor’s Desk It is difficult for those of us who trained in medicine prior to the advent of the epidemic of HIV/AIDS to explain to junior colleagues just how the epidemic has affected every aspect of medical practice, and the degree of complexity it has added. The timely review by Pillay and colleagues (page 70) of HIV-associated large-vessel vasculopathy, which surveys both the current and emerging spectrum of the condition, as seen in vascular surgical practice, serves to clarify some of the uncertainties around this complex problem. It is difficult to comprehend that the diverse disease spectrum of aneurysms, occlusive disease, spontaneous arteriovenous fistulae and dissections have a unifying pathogenesis and it may well be that further advances in knowledge will lead to re-classification and changes in terminology. The authors, importantly, highlight areas of therapeutic uncertainty, which hopefully will change with advances in the understanding of pathophysiology and a more structured approach to interventions.

Further exploring the relationship of HIV/AIDS with cardiovascular disease, Longo-Mbenza and co-workers (page 52), in a cross-sectional study, examined the relationship between H pylori infection and the metabolic syndrome among HIV-infected black Africans. The results, showing that H pylori infection was associated with the metabolic syndrome in HIV-infected patients, are intriguing but require confirmation in larger studies involving control subjects from a similar population who are not HIV infected.

The proceedings of the recent meeting of the PASCAR Hypertension Task Force, reported in this issue (page 82), discusses the importance of hypertension in Africa, the reasons for its increase and the urgent need for strategies to limit and control the impact on life-expectancy and health of the population. Notably, the document expresses the importance of involving all relevant groups, societies and organisations with influence in this area.

The publication of the proceedings in this issue provides an opportunity for any individuals or groups who believe that they should have an input into the process, and who have not been involved, to contact PASCAR and voice their interest in participation. Particularly fascinating in the PASCAR report is the declared interest in re-examining the issues of prevention and treatment in the African context rather than simply adopting solutions developed elsewhere.

The proceedings review all the available evidence and express an interest in examining critically relevant issues regarding applicability of results of clinical trials and selection of drug therapy in an African context. This roadmap, if brought to a successful conclusion in the spirit expressed by those initiating it, should have a significant impact on the problem of hypertension in Africa.

It is helpful to be able to publish in the same issue, the article from Magalhaes and colleagues (page 57), which examined the 24-hour urinary sodium excretion and knowledge, attitudes and behaviour regarding salt intake of 123 Angolan medical students at a single medical school in that country. The authors concluded that the level of salt intake was excessive and the behaviour of medical students was inappropriate and inadequate regarding salt intake. The authors are to be congratulated for investigating a difficult issue and for publishing their results. If we do not recognise the deficiencies of our medical educational facilities we will not improve them.

The research and publication by the authors of the Magalhaes article challenge all of us involved in medical student education to re-examine our own students and our own practice. Do we as teachers know how many of our own students smoke, drink excessively or use recreational drugs? The Magelhaes article should be a resounding call to all of us to focus on our trainees, as the attitudes and habits they learn while students will significantly influence their management of patients in the future.

Returning to the opening theme of what I have learned during a career that leaves me astounded at the amount of new information I have had to absorb (and have not done so very well), I report my response to the Mouton article (page 63). Forty years ago, hypertrophic cardiomyopathy was a mystery. We agonised over the physical signs, argued about the haemodynamic characteristics and had little information about the treatment and natural history. The situation is now dramatically different with definitive natural history studies guiding therapeutic choices, and echocardiographic studies establishing unequivocally the phenotypic characteristics and correlating them with genotypic features.

Pat Commerford Editor-in-Chief

52

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

AFRICA

Cardiovascular Topics Association of Helicobacter pylori infection with the metabolic syndrome among HIV-infected black Africans receiving highly active antiretroviral therapy Benjamin Longo-Mbenza, Teke Apalata, Murielle Longokolo, Marcel Mbula Mambimbi, Etienne Mokondjimobe, Thierry Gombet, Bertrain Ellenga, Baudouin Buassa-bu-Tsumbu, Guy Milongo Dipa, Evelyne Lukoki Luila, Augustin Nge Okwe

Abstract Introduction: The metabolic syndrome (MetS) is common in human immune deficiency virus (HIV)-infected individuals receiving highly active antiretroviral therapy (HAART).

Immune deficiencies caused by HIV give rise to numerous opportunistic gastrointestinal pathogens such as Helicobacter pylori, the commonest cause of chronic gastritis. The study sought to determine the relationship between H pylori infection and the MetS among HIV-infected clinic attendees.

Methods: This cross-sectional study was carried out in a specialised heart clinic in Kinshasa, DR Congo. Between January 2004 and December 2008, 116 HIV-infected patients (61 with MetS and 55 without MetS) who underwent upper gastrointestinal endoscopy for dyspeptic symptoms were included in the study following an informed consent.

Univariate associations were determined by odds ratios (OR),

Research Unit, Faculty of Health Sciences, Walter Sisulu University, Mthatha, South Africa Benjamin Longo-Mbenza, MD

Department of Medical Microbiology, Faculty of Health Sciences, Walter Sisulu University, Mthatha, South Africa Teke Apalata, MD, tapalata@wsu.ac.za

Department of Internal Medicine, University of Kinshasa, Democratic Republic of the Congo Murielle Longokolo, MD Marcel Mbula Mambimbi, MD

Laboratoire de Biochimie et Pharmacologie, Faculté des Sciences de Santé, Brazzaville, Congo Etienne Mokondjimobe, MD Baudouin Buassa-bu-Tsumbu, MD

Centre Hospitalier Universitaire, Faculté des Sciences de Santé, University of Marien Ngouabi, Brazzaville, Congo Thierry Gombet, MD Bertrain Ellenga, MD

Biostatistic Unit, Lomo Medical Cardiovascular Centre for Africa, Limete, Kinshasa, Democratic Republic of the Congo Guy Milongo Dipa, MD Evelyne Lukoki Luila, MD Augustin Nge Okwe, MD

while multivariate logistic regression analysis was used to identify factors associated with the MetS. Results: H pylori infection (OR = 13.5, 95% CI: 10.3–17.6; p < 0.0001) and peripheral obesity (median hip circumference ≥ 97 cm) (OR = 4.7, 95% CI: 1.2–18.8; p = 0.029) were identified as MetS-related factors in HIV-infected patients.

Higher rates of the MetS were associated with increased incidence of HIV-related immunocompromise using World Health Organisation (WHO) staging criteria. There was a univariate significant difference in the prevalence of the MetS between antiretroviral therapy (ART)-naïve patients and patients treated by means of a first-line HAART regimen of stavudine (d4T), lamivudine (3TC) and nevirapine (NVP). However, this difference was not significant in multivariate logistic analysis.

Conclusion: H pylori infection was significantly associated with the MetS in HIV-infected patients.

Keywords: metabolic syndrome, Helicobacter pylori, HIV, HAART Submitted 13/2/13, accepted 27/1/15 Cardiovasc J Afr 2015; 26: 52–56

www.cvja.co.za

DOI: 10.5830/CVJA-2015-012

Developing countries have recently been experiencing an increase in the prevalence of risk factors associated with the metabolic syndrome (MetS) and cardiovascular diseases (CVD) in both general and working class populations.1-5 Progressive urbanisation and westernisation of lifestyle leading to an epidemiological transition in developing countries can be mentioned among possible reasons.1,2 The metabolic syndrome is a cluster of metabolic and haemodynamic risk factors that act multiplicatively to promote atherosclerotic CVD and type 2 diabetes mellitus (T2DM).6,7 Its initial description by Reaven (1988) included dyslipidaemia, hypertension, hyperglycaemia and insulin resistance.8 These disturbances promote an elevated prothrombotic/procoagulant state, endothelial cell dysfunction and inflammatory response with premature atherosclerotic complications.9,10 Helicobacter pylori, a spiral-shaped gram-negative flagellated bacterium, enhances human chronic inflammatory diseases.11

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

Epidemiological data from the literature support a significant association of H pylori seropositivity with CVD, insulin resistance and elevated parameters of the metabolic syndrome.12,13 The risk of the MetS is greater in HIV-infected individuals compared with the general population because of a greater prevalence of lipid and glucose abnormalities.14,15 HIV infection itself is associated with disturbances in lipid metabolism such as hyperglyceridaemia, and a decrease in total cholesterol and high-density lipoprotein (HDL) cholesterol levels.16 Treatment of HIV infection with highly active antiretroviral therapy (HAART) can also induce severe metabolic complications including lipodystrophy, dyslipidaemia, and insulin resistance.

Patients with HIV infection and the MetS had increased intima– media thickness (IMT), similar to that found in diabetes.

While inflammation is recognised as a major contributor in the pathogenesis of both diabetes and atherosclerosis, little is known about the key inflammatory molecules involved in atheroma and diabetes in HIV-positive HAART recipients.

However, epidemiological studies have shown that H pylori infection has become a common cause of chronic gastritis in HIV/AIDS patients.17 It is possible that prevalent infection by H pylori enhances the inflammatory process observed in the atheroma of HAART-recipient HIV-positive individuals, leading to CVD and the MetS. In many central African countries, the first-line anti-retroviral therapy (ART) protocol in the public health sector recommends the combination of three drugs (stavudine, lamivudine and efavirenz), commonly referred to as ‘regimen 1A’. In ‘regimen 1B’, efavirenz is substituted with nevirapine, particularly in females of reproductive age.

There is a paucity of data on H pylori seropositivity, socioeconomic status and the use of HAART in patients with the MetS and HIV co-infection among black Africans. Hence, the aim of this study was to determine the relationship between H pylori infection and the MetS among HIV-infected black Africans.

Methods This was a cross-sectional study design. The study population consisted of HIV-infected patients, aged 20 years and above; all black Africans attending LOMO specialised heart clinic in Kinshasa, Democratic Republic of the Congo between January 2004 and December 2008.

The study protocol was designed according to the Helsinki Declaration II,18 and approved by the local ethics committee.

Patients were consecutively enrolled in the study if they were HIV infected, and diagnosed with or without the MetS. Exclusion criteria included pregnancy, dysfunctional thyroid gland, nephrotic syndrome, hepatic cirrhosis, and use of any of beta-blocker, digoxine, lipid-lowering drugs or insulin. All study participants were enrolled by informed consent. Associations between H pylori infection and the MetS were assessed among HIV-infected patients with and without the MetS. Data were collected using structured and standardised questionnaires. Demographic data (gender, age), lifestyle (socioeconomic status) and behavioural risk factors (intravenous drug use, current cigarette smoking and excessive alcohol intake) were recorded. Low and high socio-economic status (SES) were defined according to our previous work.2 Patients’

53

anthropometric parameters (body weight and height, waist and hip circumferences) were measured following a physical examination.

For patients diagnosed as having HIV infection, we used World Health Organisation (WHO)19 and Centres for Diseases Control and Prevention (CDC)20 staging systems to classify their disease stages. Information on the use of highly active anti-retroviral therapy (HAART) was obtained from all study participants.

Blood pressure (BP) was measured after the participant had rested for 10 minutes, seated in a quiet waiting room. BP was measured on the left arm with elbow flexed at heart level, by the same physician using an Omron HEM 705 electronic BP manometer (Omron Life Science Co, Ltd, Tokyo, Japan).

Three readings were obtained, and the average was used for the analysis.

Definitions and criteria for the MetS Criteria defined by the 2005 International Diabetes Federations (IDF) report were used to ascertain cases of the MetS.21 Participants with three of the following criteria were defined as having the metabolic syndrome: prerequisite was waist circumference ≥ 94 cm in men and ≥ 80 cm in women; triglycerides ≥ 150 mg/dl (1.7 mmol/l); HDL cholesterol < 40mg/ dl (1.03 mmol/l) in men and < 50 mg/dl (1.29 mmol/l) in women; systolic blood pressure ≥ 130 mmHg, diastolic blood pressure ≥ 85 mmHg; and fasting glucose ≥ 100 mg/dl (5.6 mmol/l) or previously diagnosed type 2 diabetes. Other participants met the criteria for high blood pressure or high fasting glucose levels if they were currently on antihypertensive or oral hypoglycaemic therapies, respectively.

The cardiometabolic co-morbidities included arterial hypertension, type 2 diabetes, myocardial infarction, stroke, long QTc ≥ 0.420 ms, gout/hyperuricaemia (uric acid ≥ 7 mg/dl), and subclinical atherosclerosis (pulse pressure ≥ 60 mmHg + IMT ≥ 1 mm or carotid plaque).4,22,23

Laboratory investigations The initial HIV test was performed using HIV rapid test (SmartCheck test, World Diagnostics Inc, USA) while a confirmatory test following an initial positive HIV result was performed using Uni-GoldTM Recombigen® HIV (Trinity Biotech PLC, USA) from the blood samples. CD4+ lymphocyte cell count was measured using CyFlowR Counter (Partec GmbH; Munstar, Germany) and HIV RNA viral load was quantified by means of Nuclisens Easy Q HIV-1 system (Biomérieux, Box tel, the Netherlands).

Haemoglobin and haematocrit levels were measured in blood using standard haematological techniques. Fasting glucose levels were measured from plasma samples using the glucoseoxydase method and spectrophotometer (Hospitex Diagnostics, Florence, Italy). Total cholesterol, HDL cholesterol, uric acid and triglyceride levels were measured using enzymatic colorimetric methods (Biomérieux, Marcy l’Etoile, France).

Oxidised low-density lipoprotein (LDL) cholesterol, a biomarker of oxidative stress, was measured using solid-phase two-side enzyme immunoassay (Mercodia AB, Sylveniusgatan 8A, SE754 50, Uppsala, Sweden).

54

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

H pylori infection was assayed by the determination of immunoglobulin G (IgG) antibodies as described elsewhere.4 Briefly, IgG antibodies to H pylori (anti-HP Ab) were measured by a commercial enzyme-linked immunosorbent assay (Pyloriset® EIA-G; Orion Diagnostica, Espoo, Finland). The detection range of serum levels of anti-HP Ab assay was between 100 and 12 800 U.

Imaging techniques Subclinical atherosclerosis was assayed by IMT using echoDoppler, and the diagnosis of H pylori-related chronic gastritis was confirmed as described elsewhere.4 Atherosclerotic complications including different forms of CVD (myocardial infarction, stroke, peripheral artery disease) were ascertained by clinical symptoms and signs, cardiac enzymes and tropinin levels, as well as results from electrocardiogram, echo-Doppler, tomodensitometry and coronary angiogram.

Statistical analyses Data were expressed as means ± standard deviation (SD) for the continuous variables and proportions (percentages) for the categorical variables. The Student’s t-test was performed to assess differences between two means and ANOVA between groups. When data were not normally distributed, the Mann– Whitney U-test was used. Either the chi-square test with and without trend or Fischer’s exact test was used to test the degree of association of categorical variables.

Table 1. Univariate factors associated with the metabolic syndrome in HIV-infected individuals (n = 116)

Variable of interest

Presence Absence of MetS of MetS n (%) n (%)

Gender males (n = 54)

31 (57.4) 23 (42.6)

females (n = 62)

30 (48.4) 32 (51.6)

Socio-economic status (SES) high (n = 36)

26 (72.2) 10 (27.8)

low (n = 80)

35 (43.8) 45 (56.2)

Smoking 23 (88.5)

no (n = 90)

38 (42.2) 52 (57.8)

0.332

3.3 (1.4 – 7.8)

0.004

<0.0001

3 (11.5)

Helicobacter pylori seropositivity no (n = 44)

p-value

1.4 (0.7 – 3)

10.5 (2.9 – 37.9)

yes (n = 26)

yes (n = 72)

OR (95% CI)

95.3 (20.4 – 444.7) <0.0001 59 (81.9) 13 (18.1) 2 (4.5)

42 (95.5)

chronic gastritis due to H pylori

28.1 (9.5 – 83)

yes (n = 50)

45 (90)

no (n = 66)

16 (24.2) 50 (75.8)

<0.0001

5 (10)

Peripheral obesity (median hip circumference ≥ 97 cm) yes (n = 58)

41 (70.7) 17 (29.3)

no (n = 58)

20 (32.8) 38 (67.2)

Excessive alcohol intake

Variables were first computed to identify univariate potential factors and cardiometabolic co-morbidities associated with the MetS; the significant association between variables being calculated as odds ratios (OR) with 95% confidence interval (CI). Potential factors demonstrating a univariate relationship (p < 0.20) with the MetS were included in the multivariate logistic regression analysis to assess the effect of their independent association with the MetS. Goodness-of-fit was verified with the Hosmer and Lemeshow statistical method. A p-value < 0.05 was considered statistically significant. All data were analysed using the Statistical Package for the Social Sciences (SPSS for Windows, version 21; Chicago, IL).

Results A total of 116 heterosexual HIV-infected patients were enrolled.

Of the 116 eligible study participants, 54 (46.6%) were men and 62 (53.4%) women. The mean age of the study participants was 42 ± 9 years. Of these, 65 (56%) were ART naïve and 51 (44%) were on a 13 ± 1 month first-line HAART regimen of stavudine (d4T), lamivudine (3TC) and nevirapine (NVP). No patient received either efavirenz or protease inhibitors. Based on the 2005 International Diabetes Federation definition, 61/116 patients (52.6%) met the criteria for the MetS versus 55/116 patients (47.4%) without the MetS. During univariate analyses, numerous factors were shown to be significantly associated with the MetS in HIV-infected individuals, as depicted in Tables 1 and 2. There was a significant univariate association in the prevalence of the MetS between ART-naïve patients and those treated by means of a first-line HAART regimen of d4T, 3TC and NVP (Table 1) but this association did not reach significant difference in multivariate regression analysis.

Table 2. Other univariate factors associated with metabolic syndrome in HIV-infected individuals (n = 116) Variables of interest

<0.0001

p-value ANOVA 0.005

46.4 ± 8

40.8 ± 11.1

23.1 ± 4.4

20.5 ± 4.1

109.2 ± 16.8

90 ± 16.6

HC (cm)

111.6 ± 13.7

103.2 ± 16.3

SBP (mmHg)

138.7 ± 25.1

114.5 ± 21

DBP (mmHg)

77.1 ± 12.9

72.3 ± 12.2

0.068

Pulse pressure (mmHg)

61.6 ± 23.2

42.2 ± 13.2

< 0.0001

Haemoglobin (g/dl)

13.7 ± 1.1

12.2 ± 1.8

0.005

Haematocrit (%)

36.8 ± 5.9

28.2 ± 7.4

< 0.0001 < 0.0001

394.6 ± 61.1

126.9 ± 192.1

199.5 ± 157.9

181.5 ± 193.9

0.026**

270373 ± 147064

208741 ± 102629

< 0.0001**

Uric acid (mg/dl) Fasting glucose (mg/dl)

33.9 ± 10.2

10.7 ± 10.8

< 0.0001

130.1 ± 26.4

106.4 ± 50.2

0.008

7.22 ± 1.47

5.91 ± 2.79

193.9 ± 51.9

157.6 ± 79.8

(mmol/l)

5.02 ± 1.34

4.08 ± 2.07

31 (70.5) 13 (29.5)

HDL-C (mg/dl)

78.5 ± 26.6

70.4 ± 16.8

30 (41.7) 42 (58.3)

(mmol/l)

2.03 ± 0.69

1.82 ± 0.44

255.8 ± 41.7

206.8 ± 69.5

2.89 ± 0.47

2.34 ± 0.79

0.045

Triglycerides (mg/dl)

yes (n = 65)

34 (52.3) 31 (47.7)

(mmol/l)

no (n = 35)

11 (31.4) 24 (68.6)

Oxidised LDL-C (mg/dl)

HAART = highly active antiretroviral therapy; MetS = metabolic syndrome; OR = odds ratio; CI = confidence interval.

0.013 < 0.0001

IgG H pylori (U/ml)

no (n = 72)

2.4 (1.01 – 5.7)

< 0.0001

CD4+ count (cells/mm3)

yes (n = 44) HAART exposure

0.003

WC (cm)

Total cholesterol (mg/dl) 0.003

Absence of Mets Mean ± SD

BMI (kg/m²)

(mmol/l) 3.3 (1.5 – 7.4)

Presence of Mets Mean ± SD

Age (years)

Viral load (copies/ml) 4.6 (2.1 – 10)

AFRICA

(mmol/l)

155.1 ± 0.3 4.02 ± 0.01

**Non-parametric Mann–Whitney U-test

101.2 ± 0.1 2.62 ± 0.00

0.018 0.084 0.009 < 0.0001

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

94.70%

MetS (%)

78.90% 50% 33.30%

Stage 1 (CD4 ≥ 500mm3)

Stage 2 Stage 3 (CD4 = 350–499mm3)(CD4 = 200–349mm3)

Stage 4 (CD4 < 200mm3)

WHO staging

Fig. 1. D istribution of the MetS by HIV/AIDS WHO staging groups (p < 0.0001).

When using non-parametric Mann–Whitney U-tests, there were significant univariate associations of CD4+ T cell counts and HIV viral loads with the MetS (Table 2). There was also a significant relationship (p < 0.0001) between the WHO HIV disease stages and the presence of the MetS (Fig. 1).

HIV-infected patients of WHO stages 3 and 4 were in CDC stage C and those of WHO stages 1 and 2 were in CDC stage B. However, during multivariate logistic regression analysis, after adjusting for age, SES, HAART exposure, smoking, excessive alcohol intake, waist circumference, CD4+ T-cell counts and plasma HIV loads, H pylori seropositivity (constant B = 5.2; SE = 1.114; wald χ2 = 21.785; OR = 13.5, 95% CI: 10.3–17.6; p < 0.0001) and peripheral obesity (median hip circumference ≥ 97 cm) (constant B = 1.545; SE = 0.708; wald χ2 = 4.756; OR = 4.7, 95% CI: 1.2–18.8; p = 0.029) were identified as the only factors significantly associated with the MetS in HIV-infected patients.

Discussion The metabolic syndrome is recognised as a major public health concern, even in the absence of HIV infection.4,6,21,24 The majority of patients with the MetS were defined by high SES, physical inactivity, excessive alcohol intake, and total and peripheral obesity.6,25 In Africa, many individuals gain weight later in their adult life and do not want to loose weight because of the stigma of HIV.24 Furthermore, abdominal obesity is considered a social achievement.

Lifestyle has a strong influence on the MetS, particularly among HIV-infected patients. Therefore the main emphasis in the management of the MetS should focus on addressing lifestyle changes, mainly efforts to stop smoking, reduce body weight and alcohol intake, and increase moderate physical activity. Elevated blood pressure, dyslipidaemia and hyperglycaemia may however require additional drug treatment.

Additional correlates of the MetS among HIV-infected Africans in our study population were hypercoagulability, increased levels of uric acid, and infection/inflammatory markers, as reported in other study cohorts of both HIV-infected and uninfected patients.4,5,26 Helicobacter pylori infection and hip circumference ≥ 97cm (peripheral obesity) were identified as the only factors associated with the MetS in our study population during a multivariate analysis.

Findings from this study showed only univariate association between exposure to first-line combination antiretroviral therapy

55

and the MetS. A previous report from the literature has underlined the independent role of stavudine (d4T as a part of ARV) in determining the MetS in HIV-infected populations.26 A possible contribution of the nucleoside analogue stavudine to lipid abnormalities was also previously reported in the literature.27 Numerous other studies confirmed that non-nucleoside reverse transcriptase inhibitors had a more favourable impact on lipid levels than most members of the protease inhibitor class.24,28,29 In addition, higher frequency of coronary heart disease,30 stroke31 and diabetes mellitus32 have been observed by others in HIV/AIDS patients with the MetS. Oxidative stress-mediated LDL cholesterol modification may be a key role player in initiation and exacerbation of the MetS and atherosclerosis in these HIV-infected patients.

Findings from this present study have supported the association between H pylori infection and larger hip circumference (≥ 97 cm). Appropriate lifestyle changes and in some cases, medication (antibiotics, statins, antihypertensives, antidiabetic drugs) may improve all of the MetS components.

Getting more physical activity, losing weight (5–10% of weight), quitting smoking, limiting alcohol intake and appropriate diet (vitamins, antioxidants, fruits, vegetables, fish and whole grains) could be proposed to patients with the MetS. Limitations of this study are mainly the small size of the study sample, the cross-sectional study design, and absence of an HIV-negative group. In this regard, results reported herein are only associations from which no conclusions regarding causality can be drawn.

Conclusion H pylori infection and peripheral obesity (median hip circumference ≥ 97 cm) were shown to be associated with higher risk of the MetS in HIV/AIDS patients. Screening for the presence of H pylori infection can be helpful when managing HIV/AIDS patients diagnosed with the MetS. However, further studies are warranted in order to ascertain the value of this recommendation.

References 1.

World Health Organisation (WHO). Cardiovascular Disease Prevention and Control, 2003. Accessed at http//www.who.int/cardiovasculardisease.

2.

Longo-Mbenza B, Nkoy Belila J, Vangu Ngoma D, Mbungu S. Prevalence and risk factors of arterial hypertension among urban Africans in workplace: the obsolete role of body mass index. Niger J Med 2007; 16: 42–49.

3.

Gombet T, Longo-Mbenza B, Ellenga-Mbolla B, Ikama MS, KimballyKaky G, Nkoua JL. Relationship between coronary heart disease, metabolic syndrome, energy expenditure, body composition, kidney function and low-grade inflammation among bank African employees in Brazzaville. Diab Metab Synd Clin Res Rev 2010; 4(4): 197–203.

4.

Longo-Mbenza B, Nkondi Nsenga J, Vangu Ngoma D. Prevention of the metabolic syndrome insulin resistance and the atherosclerotic diseases in Africans infected by Helicobacter pylori infection and treated by antibiotics. Int J Cardiol 2007; 121: 229–238.

5.

Longo-Mbenza B, Nge Okwe A, Kangola Kabangu N, Mbungu FS. Metabolic syndrome, aging, physical inactivity, and incidence of type 2 diabetes in general African population. Diab Vasc Dis Res 2010; 7(1):

56

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

28–39.

6.

system for HIV infection and expanded surveillance case definition for

of metabolic syndrome: Report of the National Heart, Lung, and Blood

AIDS among adolescents and adults. MMWR Recomm Rep 1992; 41:

Related to Definition. Circulation 2004; 109: 433–438.

Ford ES. Risk for all-cause mortality, cardiovascular disease, and diabetes associated with the metabolic syndrome: a summary of evidence.

Diabetes care 2005; 28: 1769–1778.

8.

9.

20. Centers for disease control and prevention: 1993 revised classification

Grundy SM, Brewer B, Cleeman JI, Smith SC Jr, Lenfant C. Definition Institute/American Heart Association Conference on Scientific Issues

7.

AFRICA

1–19.

21. Alberti KG, Zimmet P, Shaw J. IDF Epidemiology Task Force consensus group. The metabolic syndrome-a nex worldwide definition. Lancet 2005; 366: 1059–1062.

22. Longo-Mbenza B, Bieleli E, Muls E, Vangu N, Ditu Mpadamadi S. The

Reaven GM. Banting lecture 1998. Role of insulin resistance in human

role of early hemodynamic impairment and disease duration on diabetic

disease. Diabetes 1988; 37: 1595–1607.

cardiomyopathy and hypertension in central Africans with atherosclero-

Ridker PM, Buring JE, Cook NR, Rifai N. C-reactive protein, the meta-

sis. J Diabetes Complicat 2002, 16: 146–152.

bolic syndrome, and risk of incident cardiovascular events: an 8-year

23. Longo-Mbenza B, Kasiam Lasi On’kin JB, Nge Okwe A, Vangu Ngoma

follow-up of 14,719 initially healthy American women. Circulation 2003;

D, Mbungu Fuele S, Milongo Dipa G. Comparison of abdominal

107: 391–397.

obesity and total obesity in predicting risk of prehypertension status

10. Chapman MJ. Metabolic syndrome and type 2 diabetes: lipid and physiological consequences. Diabetes Vasc Dis Res 2007; 4(suppl): S5–S8.

with reference to economic development in the south-west of Congo.

Circulation 2008; 117 [Abstract 0169].

11. Wang CM, Kaltenboeck B. Exacerbation of chronic inflammatory

24. Iacobellis G, Sharma AM, Pellicelli AM, Grisorio B, Barbarini G,

diseases by infectious agents: Fact or fiction? World J Diabetes 2010;

Barbaro G. Epicardial adipose tissue is related to carotid intima–media

1: 27–35.

thickness and visceral adiposity in HIV-infected patients with highly

12. Aydemir S, Bayraktaroglu T, Sert M, Sokmen C, Atmaca H, Mungan G, et al. The effect of Helicobacter pylori on insulin resistance. Dig Dis Sci 2005; 50: 2090–2093.

13. Ekesbo R, Nilsson PM, Lindholm LH, Persson K, Wadström T. Combined seropositivity for H. pylori and C. pneumoniae is associated with age, obesity and social factors. J Cardiovasc Risk 2000; 7: 191–195.

14. Bonfanti P, Ricci E, de Socio G, et al. Metabolic syndrome: a real threat for HIV-positive patients? Results from the SIMONE study. J Acquir Immune Defic Syndr 2006; 42: 128–131.

active antiretroviral therapy-associated metabolic syndrome. Curr HIV Res 2007; 5: 275–279.

25. Fezeu L, Balkau B, Kengne AP, Sobngwi E, Mbanya JC. Metabolic syndrome in a sub-Saharan African setting: Central obesity may be the key determinant. Atherosclerosis 2007; 193: 70–76.

26. Currier J. Management of metabolic complications of therapy. AIDS 2002; 16(Suppl 4): S171–S176.

27. Staszewski S, Gallant J, Posniak A, et al. Efficacy and safety of tenofovir disproxil fumarate (TDF) versus stavudine (d4T) when used in combi-

15. Bonfanti P, Giannattasio C, Ricci E, et al. HIV and metabolic syndrome:

nation with lamivudine (3TC) and efavirenz (EFV) in HIV-1 infected

a comparison with the general population. J Acquir Immune Defic Syndr

patients naive to antiretroviral therapy (ART): 48-week interim results.

2007; 45: 426–431.

16. Carr A, Samaras K, Burton S, et al. A syndrome of peripheral lipodystrophy, hyperlipidemia and insulin resistance due to HIV protease inhibitors. AIDS A998; 12: F51–58.

17. Huypmann AR, Orenstein JM. Opportunistic disorders of the gastrointestinal tract in the age of highly active antiretroviral therapy. Hul Pathol 2010; 41: 1777–1787.

18. Coats AJS, Shewan LG. Statement on authorship and publishing ethics in the International Journal of Cardiology. Int J Cardiol 2011; 153: 239–240.

19. World Health Organization: acquired immune deficiency syndrome (AIDS): interim proposal for a WHO staging system for HIV-A infection and disease. Wkly Epdemiol Rec 1990; 65: 221–228.

XIV International AIDS Conference. Barcelona, 2002.

28. Carr A. HIV lipodystrophy: risk factors, pathogenesis, diagnosis and management. AIDS 2003; 17(suppl 1): 141–148.

29. Longo-Mbenza B, Seghers KV, Phuati M, Bikangi FN, Mubagwa K. Heart involvement and HIV infection in African patients: determinants of survival. Int J Cardiol 1998; 64: 63–73.

30. Bau, MK, Rafie C, Lai S, et al. Coronary heart disease (CHD) risk factors and metabolic syndrome in HIV-positive drug users in Miami.

Am J Infect Dis 2006; 2: 173–179.

31. Mochan A, Modi M, Modi G. Stroke in black South African HIV-positive patients. A prospective analysis. Stroke 2003; 34: 10–15.

32. Samarasinghe YP, Higgs C, Gazzard B, Feher MD. Diabetes in a HIV population: a hidden epidemic. Diab Met 2002; 19(Suppl 2): 28–115.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

57

Knowledge, attitude and behaviour regarding dietary salt intake among medical students in Angola Pedro Magalhães, Edgar JR Sanhangala, Isildro M Dombele, Henrique SN Ulundo, Daniel P Capingana, Amílcar BT Silva

Abstract Background: Levels of salt consumption and its awareness among medical students in Angola remain insufficiently studied. This study determined salt intake and assessed medical students’ knowledge, attitude and behaviour regarding salt consumption.

Methods: Were collected 24-hour urine samples from a random sample of 123 undergraduate medical students aged 17–43 years who were studying at the University of Agostinho Neto in Luanda. Their knowledge, attitude and behaviour regarding dietary salt were surveyed. Socio-demographic, clinical and anthropometric data were collected.

Results: Average salt intake was 14.2 ± 5.1 g/day, without significant difference between genders (p = 0.221). In total, 96.7% consumed over 5 g/day, but only 6.5% of participants were aware of their excessive salt intake. The majority knew about salt-related health consequences and 45.5% reported they controlled their salt intake.

Conclusions: This study indicated a high salt intake and inadequate behaviour regarding dietary salt consumption among medical students studying at the University of Agostinho Neto. This highlights the need for nutritional education to improve their dietary habits and future role in counselling.

Keywords: salt intake, behavioural, medical students Submitted 8/7/14, accepted 27/1/15 Cardiovasc J Afr 2015; 26: 57–62

www.cvja.co.za

DOI: 10.5830/CVJA-2015-018

High salt (sodium chloride) consumption is an important determinant of high blood pressure and cardiovascular risk.

According to World Health Organisation (WHO) statistics, over 80% of cardiovascular disease (CVD) deaths take place in lowand middle-income countries, and elevated blood pressure levels were a major cause of these CVD deaths in those countries.1 Lifestyle factors such as unhealthy diet, physical inactivity, tobacco use and harmful use of alcohol have been considered the most important behavioural risk factors for heart disease and stroke.2

Department of Physiology, Faculty of Medicine, University Agostinho Neto, Luanda, Angola Pedro Magalhães, MD, pedromagalhaes24@hotmail.com Edgar JR Sanhangala, MD Isildro M Dombele, MD Henrique SN Ulundo, MD Daniel P Capingana, MD Amílcar BT Silva, MD

Among dietary factors, high salt intake has been the most strongly associated with raised blood pressure and increased risk of stroke and CVD.3 Therefore dietary sodium restriction has been recommended as a non-pharmacological approach to blood pressure lowering,4-6 and for the prevention and control of non-communicable diseases at the population level.7,8 Cumulative evidence has shown that even a modest reduction in salt intake was associated with blood pressure lowering and therefore with a significant reduction in incidence of cardiovascular events.9-12 Furthermore, data from the most recent systematic review and meta-analyses has shown the benefit of lowering sodium intake in apparently healthy adults and children,13 and in both hypertensive and normotensive individuals, irrespective of gender and ethnic group.9 Since hypertension is associated with CVD worldwide, a public health intervention to reduce high blood pressure must target the role of lifestyle, particularly reduced sodium intake.7 Therefore, several countries have initiated strategies to reduce dietary salt intake in the general population by a combination of various procedures such as public education, food labelling, and collaboration with the food industry to reduce the salt content of processed food.14 Among sub-Saharan African countries, only Nigeria and South Africa have developed dietary guidelines regarding salt intake.15 Recently, the South African government implemented important specific legislation towards decreasing salt intake in the population by reducing sodium content of processed foods by industries.16 Therefore, the current public health recommendation is that countries should launch national initiatives to reduce the over-consumption of salt as part of non-communicable disease prevention and healthy nutrition policies for limiting salt intake to less than 5 g/day for the general population including children.7 Despite of this guideline, however, high sodium intake remains prevalent around the world, with average daily salt intake varying from 5 to 18 g/day per person.17 Although processed foods have been found to be the principal source of excessive dietary salt intake,18 sources of dietary sodium vary largely worldwide and may be influenced by cultural context and dietary habits of the population.19 In sub-Saharan African countries experiencing demographic and epidemiological transition, the rapid rise in prevalence of CVD (chiefly hypertension) has been attributed to lifestyle change, including high dietary sodium intake.20,21 However, consistent data from studies on risk factors are lacking for the majority of these countries.

With regard to Angola, available data from a cross-sectional study reported a high prevalence of multiple cardiovascular risk factors, such as hypertension, sedentary lifestyle, electrocardiographic left ventricular hypertrophy,22 and high rate of the metabolic syndrome23 in an apparently healthy middleaged population of university public employees living in urban and peri-urban areas.

58

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

Determining the level of sodium intake in the population is crucial to establish intervention strategies and policy on reduction of sodium intake. For medical students in particular, it is very important to assess their awareness regarding dietary salt intake, since they are the future providers of healthcare information for the counselling of people about the need to reduce salt consumption. The aim of this study was to determine salt intake and to assess the knowledge, attitude and behaviour regarding dietary salt among medical students.

Methods Participants were undergraduate medical students randomly recruited from a population of 625 students listed in 2013 at the Faculty of Medicine of the University Agostinho Neto (FMUAN) in Luanda, Angola. Due to limited resources, the study was planned to collect 24-hour urine samples from 30% of the students (n = 188) representative of the student population.

Data were collected from September to October 2013 in the Department of Physiology of FMUAN. The protocol of the study was in agreement with the Declaration of Helsinki and approved by the institutional review board. Each participant gave informed, written consent, and no compensation was given for participation in the study.

For recruitment, the academic secretary of FMUAN provided a list of all students from first to fifth year. We randomly selected 30% from each year and contacted them by phone one day later to invite them to participate in a cross-sectional survey on ‘cardiovascular risk factors’. A participant information sheet and a consent form explaining the purpose and protocol of the study were also provided. If participation was declined, another student from the same academic year, gender and age group was contacted.

Thus 188 students were randomly selected from 625 registered students, and 153 agreed to participate. Of these, seven subjects were excluded as they met the exclusion criteria [being pregnant (n = 1), having a history of hypertension or taking anti-hypertensive medication (n = 6)]. A further 23 students were excluded from the analyses due to incomplete 24-hour urine collections [i.e. 24-hour urine volume ≤ 500 ml (n = 5); urine loss more than once in 24 hours (n = 7), timing of the urine collection less than 23 hours (n = 11)]. Final analyses were undertaken on 123 participants (54 men and 69 women) with valid urine collections.

Data collection A standardised questionnaire was administered for each participant to obtain demographic data and information on medical history, smoking habits, intake of alcohol, use of medication and physical activity. Participants’ awareness of a diagnosis of hypertension was based on having previously been informed on the diagnosis of the condition, receipt of therapy for it, or an awareness of the purpose of antihypertensive therapy.

Relevant knowledge, attitude and behaviour on dietary salt were assessed using a standardised questionnaire from the WHO.24 Participants were classified as non-smokers (never and ex-smokers) and current smokers (daily and occasional smokers).

Alcohol consumption was assessed on their answer to the question about consumption of alcoholic beverage (‘yes/no’).

Physical activity was assessed with the following two questions: ‘Do you currently participate in any regular physical activity for

AFRICA

leisure (‘yes/no’)? If ‘yes’, what frequency per week? Participants were classified as sedentary or inactive if they answered ‘no’ to the first question or reported a frequency of regular physical activity less than three days per week. They were considered active if they reported regular physical activity at least three days a week of at least 30 minutes or more per session.

Study protocol and laboratory tests Clinical examinations were performed between 08:00 and 12:00 in temperature-controlled rooms (22–23°C) after a 10- to 12-hour fast. Participants were asked to refrain from smoking, physical exercise and caffeinated beverages before the visit.

Venous blood samples were obtained from the forearm using standard techniques and processed immediately with commercially available kits (BioSystems SA, Costa Brava 30, Barcelona, Spain) for determination of levels of serum triglycerides, total cholesterol, glucose, creatinine and uric acid.

Biochemical parameters were analysed using enzymatic methods with a spectrophotometer (BioSystems BTS-350, Costa Brava 30, Barcelona, Spain). Diabetes was defined as a fasting glucose level ≥ 126 mg/dl (7 mmol/l) or the use of antidiabetic drugs.25 Urine was collected during the 24-hour period preceding the clinic visit. Participants were asked to collect all urine they passed during a 24-hour period starting from the second urination on the morning of the collection day, and ending with the first urine passed the following morning. In order to maximise a correct 24-hour urine collection, participants were asked to collect their samples from Sunday 7:00 to Monday 7:00.

Participants were also asked to note on the record sheet the start and finish times of their urine collection, if some urine was lost, and any medication taken during the collection period. Females were encouraged to collect their urine on non-menstruation days.

For the collection, participants were provided with urine collection kits and standardised written instructions on how to collect and handle urine. The urine collection kit comprised five-litre plastic bottles with screw caps to serve as the collection container for urine; two-litre plastic bottles with screw caps for collections made away from home; one-litre plastic jugs; one funnel and a plastic carrier bag for transporting the equipment from home.

Participants were instructed to pass urine into the one-litre plastic jug, and then pour the sample into the five-litre container using the funnel provided. Plastic bags were provided to carry the equipment (including a smaller two-litre collection container) if participants were not at home for some of the collection period.

The validity of 24-hour urine collection was verified by a combination of three criteria. Urine samples were considered incomplete for a 24-hour collection period and excluded from analysis if: (1) there was more than one self-reported loss of a urine sample; (2) a 24-hour urine sample measured at the laboratory was ≤ 500 ml/day; (3) timing of the urine collection was less than 23 hours or more than 25 hours.

After validation, a sample of 60 ml was centrifuged at 3 500 rotations/minute, using a Sigma 2-6E device (Germany), before aliquots were sampled. The urine was transferred in duplicate into screw-top plastic test tubes. The aliquots were kept in a freezer within 24 hours of collection and stored at –15ºC until analysed in the laboratory at the Department of Biochemistry of FMUAN.

AFRICA

59

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

Urinary sodium and potassium concentrations in the aliquots were measured using the ion-selective electrode method on a Medica Easylyte Plus Na/K/Cl analyser (Netherlands). Sodium (Na) was converted from millimoles (mmol) to grams by dividing by 17 and the conversion from sodium to salt (sodium chloride) was made by multiplying by 2.542, as previously proposed.26

Anthropometric and blood pressure measurement Weight and height were measured using a digital electronic balance equipped with a digital stadiometer (SECA, GmbH & Co, Germany; range 0.1–250 kg, precision 50 g and range 110–200 cm, precision 0.1 cm, respectively). Body mass index (BMI) was calculated as the weight divided by the square of the height (kg/ m2). According to BMI values, individuals were classified as overweight (25.0–29.9 kg/m2) and obese (≥ 30.0 kg/m2).27 The waist and hip circumferences were measured with participants in a standing position using a non-extending 1-cm-wide measuring tape. The waist circumference was measured at the end of normal expiration, at the midpoint between the lower border of the rib cage and the top of the iliac crest, and recorded to the nearest 0.1 cm.

Blood pressure and heart rate were measured in triplicate after five minutes of resting in a seated position, using a validated, automated digital oscillometric sphygmomanometer (Omron 705CP, Tokyo, Japan). The readings were repeated at three-minute intervals. The mean of the last two readings was recorded. Hypertension was defined as systolic blood pressure ≥ 140 mmHg, and/or diastolic blood pressure ≥ 90 mmHg, and/or the use of antihypertensive drugs.

A standard 12-lead electrocardiogram (ECG) recorded at rest for each participant, using a computerised device (Schiller AT-10 EKG, Baar, Switzerland). Each ECG was assessed by an experienced observer who was blinded to other clinical characteristics of the participants.

Statistical analysis The normality of the data was checked using the Kolmogorov– Smirnov test. Continuous variables are reported as mean ± standard deviation or median and interquartile range (25th – 75th percentile). These variables were compared by gender using the independent samples t-test or Mann–Whitney test for normally or non-normally distributed data, respectively. Categorical variables were expressed as proportions and compared using the chi-square test or Fisher’s exact test if appropriate. Data were analysed using SPSS software, version 13.0 (SPSS Inc, Chicago, IL). A two-tailed p < 0.05 was considered statistically significant.

Results The response rate for the random sample was approximately 68% (123/181) of the planned study sample after excluding subjects with potentially confounding factors that could influence urinary excretion of sodium and potassium. Of the 123 participants, the mean age was 22.6 ± 4.3 years (range 17–43), and more were women (56.1%) with a similar age to the men. The characteristics of the population are presented in Table 1.

When compared with women, men had significantly higher mean values for weight, height and systolic blood pressure, and

higher levels of blood creatinine and uric acid. Women had significantly higher heart rate values compared to men. The proportion of subjects with obesity and a sedentary lifestyle was significantly higher in women than men. There was no significant difference between men and women regarding the prevalence of hypertension, diabetes, obesity and alcohol consumption. None of the participants reported current or past smoking.

Participant’s answers to the questionnaire regarding their knowledge, attitude and behaviour on dietary salt are shown in Table 2. The majority of participants stated that salt was always added in preparing food at home, and rarely or sometimes added to food at the table. It was also observed that almost all participants knew that a high-salt diet could cause health problems, and 91.1% of them recognised the importance of reduced salt in the diet. However, less than half of the participants (45.5%) were aware of their high dietary sodium intake, and most reported a preventative measure was the avoidance of adding salt at the table.

Less-reported measures were: avoidance or minimising salt intake, use of low-sodium or low-salt alternatives, avoidance of adding salt when cooking, and avoiding eating out. Unexpectedly, none of the participants reported the habit of reading food labels to see the sodium content before consumption. Similarly, our participants were unaware of the possibility of using spices with lower sodium content as a salt substitute in cooking.

When participants were asked their perception of the amount of salt they were consuming, the majority of them classified their own level of salt consumption as ‘just right’ or ‘too little’. Only 6.5% of participants recognised they consumed salt excessively.

Table 1. Characteristics of the participants by gender Characteristics

All (n = 123)

Men (n = 54)

Women (n = 69)

p-value

Number (%)

123 (100)

54 (43.9)

69 (56.1)

0.245

Age (years)

22.6 ± 4.3

22.9 ± 4.4

22.5 ± 4.3

0.595

Weight (kg)

60.6 ± 13.1

64.5 ± 13.6

57.6 ± 11.8

Height (cm)

165.6 ± 7.8

170.3 ± 7.4

0.003

162.0 ± 6.1

< 0.001 0.088

WC (cm)

72.4 ± 9.9

74.1 ± 10.6

71.0 ± 9.2

HC (cm)

91.7 ± 10.4

90.2 ± 10.4

92.9 ± 10.4

0.150

BMI (kg/m2)

22.0 ± 3.9

22.1 ± 3.5

21.9 ± 4.2

0.819

SBP (mmHg)

113.8 ± 11.4

119.9 ± 11.6

109.6 ± 9.4

< 0.001

DBP (mmHg)

68.1 ± 7.5

67.6 ± 7.4

68.5 ± 7.6

0.501

Heart rate (bpm)

75.0 ± 11.0

72.0 ± 11.0

78.0 ± 9.0

0.002

Glucose (mg/dl)

90.3 ± 11.1

89.1 ± 12.4

91.2 ± 9.9

0.306

(5.01 ± 0.62)

(4.95 ± 0.69)

(5.06 ± 0.55)

(mmol/l) Creatinine (mg/dl) (μmol/l)

0.96 ± 0.13

1.07 ± 0.10

0.88 ± 0.09

(84.86 ± 11.49)

(94.59 ± 8.84)

(77.79 ± 7.96)

4.8 ± 1.2

5.5 ± 1.0

4.2 ± 1.0

TC (mg/dl)

171.7 ± 36.4

175.5 ± 39.7

168.8 ± 33.6

(mmol/l)

(4.45 ± 0.94)

(4.55 ± 1.03)

(4.37 ± 0.87)

Uric acid (mg/dl)

< 0.001 < 0.001 0.311

TG (mg/dl)

79.3 ± 36.7

79.2 ± 36.3

79.5 ± 37.4

(mmol/l)

(0.9 ± 0.41)

(0.89 ± 0.41)

(0.9 ± 0.42)

Hypertension, n (%)

4 (3.3)

3 (5.6)

1 (1.4)

0.203

Diabetes, n (%)

1 (0.8)

1 (1.9)

0 (0.0)

0.256

17 (13.8)

8 (14.8)

9 (13.0)

0.551

4 (3.3)

1 (1.9)

3 (4.3)

0.001

Sedentary, n (%)

97 (78.9)

35 (64.8)

62 (89.9)

0.001

Alcohol intake, n (%)

19 (15.4)

12 (22.2)

7 (10.1)

0.132

Overweight, n (%) Obesity, n (%)

0.962

Values are means ± standard deviation or percentages. WC, waist circumference; HC, hip circumference; BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; TC, total cholesterol; TG, triglycerides.

60

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

Table 2. Knowledge, attitude and behaviour on dietary salt Question

Total n (%)

Is salt added in cooking the food that you eat at the home?

AFRICA

Table 3. Mean and median values of urinary data according to gender All (n = 123)

Men (n = 54)

Women (n = 69)

p-value

1429.7 ± 649.0

1579.0 ± 738.5

1312.8 ± 546.7

0.023

Variables Urine volume (ml/d)

Never

0 (0.0)

Mean ± SD

Rarely

1 (0.8)

Median (25th, 75th pc) 1320 (900, 1800) 1443.5 (915, 2152.5) 1250 (870, 1645)

Sometimes Often Always

0 (0.0) 19 (15.4) 103 (83.7)

How much salt do you think you consume?

Far too much

4 (3.3)

Too much

4 (3.3)

Just the right amount

69 (56.1)

Too little

31 (25.2)

Far too little

2 (1.6)

Don’t know

13 (10.6)

Do you add salt to food at the table?

U Na (mmol/l) Mean ± SD

Mean ± SD

Mean ± SD

30 (24.4) 46 (37.4)

Salt intake (g/d)

Sometimes

40 (32.5)

Mean ± SD

5 (4.1)

91.3 ± 31.7

0.221

33.0 ± 15.9

34.7 ± 11.6

29.0 (22.0, 39.4)

34.7 (25.4, 43.5)

3.0 ± 1.2

3.3 ± 1.3

2.8 ± 1.0

2.7 (2.2, 3.5)

2.8 (2.3, 4.0)

2.7 (2.1, 3.3)

14.2 ± 5.1

14.8 ± 5.6

13.7 ± 4.7

0.221

14.2 (9.7, 17.3)

15.4 (9.5, 18.3)

13.8 (10.0, 17.0)

119 (96.7)

53 (98.1)

66 (95.7)

0.439

0.496

Na:K ratio

Never

Always

33.9 ± 13.6

Median (25th, 75th pc) 33.3 (24.9, 42.9)

Rarely

2 (1.6)

99.2 ± 37.4

U K (mmol/l)

Median (25th, 75th pc)

Often

94.8 ± 34.4

Median (25th, 75th pc) 95.2 (65.1, 116.0) 102.8 (63.7, 122.3) 92.6 (66.7, 113.8)

Median (25th, 75th pc)

0.029

High salt intake

Do you think that a high-salt diet could cause a health problem?

Yes

122 (99.2)

No

0 (0.0)

Don’t know

1 (0.8)

(> 5 g/d), n (%)

SD, standard deviation; U Na, urinary sodium; U K, urinary potassium; Na:K, sodium-to-potassium ratio; 25th, 75th pc, 25th and 75th percentiles.

How important to you is lowering the salt/sodium in your diet?

Not at all important Somewhat important Very important

2 (1.6) 9 (7.3) 112 (91.1)

Do you do anything to control your salt or sodium intake?

Yes

56 (45.5)

No

63 (51.2)

Don’t know

4 (3.3)

If answered ‘yes’, what do you do to control your salt intake?

Avoid/minimise consumption of processed foods Look at the salt or sodium labels on food Do not add salt at the table

4 (7.1) 0 (0.0) 47 (83.9)

Buy low-salt alternatives

2 (3.6)

Buy low-sodium alternatives

1 (1.8)

Do not add salt when cooking

1 (1.8)

Use spices other than salt when cooking

0 (0.0)

Avoid eating out

1 (1.8)

Table 3 shows means (SD) and medians (25th and 75th percentiles) of urine volume, urinary sodium, urinary potassium and salt intake, according to gender. Compared to women, men had significantly higher mean values for urine volume and sodium-to-potassium ratio. There was no statistically significant difference between men and women for urinary sodium and potassium concentration and daily salt intake. The proportion of participants exceeding the limit of 5 g/day of salt in the overall population was 96.7%, without a gender difference.

Discussion The purpose of this study was to determine salt intake so as to assess the knowledge, attitude and behaviour regarding dietary salt in a representative sample of medical students. The main findings were a high average daily salt intake and inadequate behaviour regarding dietary salt consumption in the majority of participants.

The level of salt intake seen in this study was more than two-fold the maximum internationally recommended limit,7 indicating a salt-rich diet consumed by our participants. This finding corroborates with that reported for the general population worldwide.7,17,19 Despite the known relationship between salt intake and blood pressure levels, data on salt consumption based on properly collected 24-hour urine samples are lacking for young medical students.

Participants for this study were randomly selected from a population of medical students and we used the ‘gold-standard’ 24-hour urine method to assess salt intake. Their knowledge, behaviour and attitudes on dietary salt intake were also assessed using a standardised WHO questionnaire.24 Salt intake was estimated using sodium concentration in 24-hour urine samples, and checks for completeness of 24-hour urine collection were based on a combination of self-reported urine loss, 24-hour urine volume measured at the laboratory, and the recorded timing of urine collection. These criteria enabled us to exclude 15% of the urine samples assumed to be incomplete collections for the 24-hour period, with the majority of them excluded due to incomplete timing of the urine collection.

The validated urine samples were therefore 80.4% of the total collected.

Identifying the main source of dietary salt is important to control high salt intake in the population. Therefore, behavioural change in the use of salt is one of the strategies recommended to reduce high salt intake in contexts where most sodium intake comes from salt added during cooking or at the table at home.7 From the survey, we found that almost all our participants were aware of the health consequences of a high-salt diet, and reported more frequently eating food with salt added during cooking in their homes, and less frequently eating food with salt added at the table. However, less than half the total participants reported being aware of their high sodium intake, and the

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

majority (83.9%) reported mainly avoiding adding salt to food at the table.

As previously reported,28 there is a tendency for individuals to perceive their dietary quality as good, even in the presence of results of an objective measure showing opposite results.

Therefore, although it is difficult to know the exact amount of salt added to food at the table or in cooking, we found that contrary to the high urinary sodium values found, the majority of our participants classified their own level of salt consumption as ‘just right’ or ‘too little’, indicating a misperception of the amount of salt they were eating. This gap between the selfperceived and actual quality of a diet has been attributed to the inability of individuals to perceive their own dietary salt imbalance,29 therefore leading to an unrecognised high salt intake.

On the other hand, it has also been observed that some people have a taste preference for high-sodium foods,7 which leads to an inadequate perception of the amount of salt they are consuming. Of concern is that although our participants were medical students and future educators in public health, none of them reported the habit of reading the labels of processed foods to see the sodium content before consumption. Although sources of dietary sodium vary largely worldwide,7 a high amount of sodium has been found in processed foods,30,31 which are the main sources of dietary salt.

A high-potassium diet has many benefits for health. As previously reported,32 an increase of 42 mmol of potassium per day is associated with a 21% reduced risk of stroke. In our study, the average potassium intake was lower than the recommended value of approximately 90 mmol per day.33 Considering that the potassium excreted in 24-hour urine comes from the diet, the findings of lower values of urinary potassium in our participants suggest an unhealthy diet, in particular a poor consumption of fresh vegetables and fruits.

It has been advised that a healthy diet should provide enough content of potassium to achieve the molar ratio of sodium to potassium of approximately one to one.33 We found a ratio of three to one, confirming a high dietary salt intake in the majority of our participants. Although the proportion of subjects classified as having hypertension was low, there is a potential risk for early blood pressure in this young population if the current level of salt intake is maintained.

With regard to other classic cardiovascular risk factors, we found a high prevalence of physical inactivity and 15% of participants reported alcohol intake, but a low prevalence of hypertension, diabetes and obesity. The high prevalence of physical inactivity seen in this study is similar to the findings of a study that enrolled university students from developed and developing countries, in which physical inactivity tended to be higher among students from developing countries.34 A positive finding in our study was that none of our participants reported smoking. This result may reflect a possible cultural difference regarding smoking among young people from different countries.

The unsatisfactory behaviour regarding dietary salt seen in this study may reflect the fact that because our students were aware of their current health status, they did not worry about their salt intake and therefore did not perceive their high risk for the development of health-related consequences.

The main limitation of the study was that our sample was not representative of a national student population. Despite the

61

small sample size, the strength of this study was that a possible selection bias was minimised by randomly selecting the students from the overall student body.

The complete 24-hour urine collection provided an estimation of salt and potassium consumption, reflecting the daily pattern of nutrient intake by our participants. Beyond the measurement of the amount of salt consumption, the study also included a survey on awareness and attitude regarding dietary salt, including discretionary salt use (i.e. cooking or at the table), which are important elements in finding the main source of salt consumed by our participants.

Overall, our findings suggest urgent educational action is needed to target behavioural change on dietary salt habits and other health-risk behaviour of the students. This is required for early prevention of the development of chronic non-communicable diseases.

Conclusion The study indicates a high salt intake among medical students, with a misperception of their level of salt intake, and insufficient attitude and behaviour regarding control of salt intake. These results justify urgent nutritional education to upgrade their knowledge for appropriate behaviour aiming at reducing their salt intake and preparing them for their future role in community counselling.

We thank Dr Carlos A Tembua and Mrs Nidia LPA van Dúnem for their help in sample collection. The study was supported by a special grant from Fundação para Ciência e Desenvolvimento from Angola.

References 1.

Global status report on non-communicable diseases 2010. Geneva, World Health Organization, 2011. Available at: http://www.who.int/ nmh/publications/ncd_report_full_en.pdf. Accessed 20 October 2013.

2.

World Health Organization. Cardiovascular disease. Available at: http:// www.who.int/mediacentre/factsheets/fs317/en/ Accessed 20 October, 2013.

3.

Strazzullo P, D’Elia L, Kandala N-B, Cappuccio FP. Salt intake, stroke, and cardiovascular disease: meta-analysis of prospective studies. Br Med J 2009; 339: b4567. doi:10.1136/bmj.b4567.

4.

Zou J, Li Y, Yan C-H, Wei F-F, Zhang L, Wang J-G. Blood Pressure in relation to interactions between sodium dietary intake and renal handling Hypertension 2013; 62: 719-725.

5.

Appel LJ, Brands MW, Daniels SR, Karanja N, Elmer PJ, Sacks FM. Dietary approaches to prevent and treat hypertension: A scientific statement from the American Heart Association. Hypertension 2006; 47: 296−308.

6.

Chobanian AV, Hill M. National Heart, Lung, and Blood Institute workshop on sodium and blood pressure: a critical review of current scientific evidence. Hypertension 2000; 35: 858−863.

7.

World Health Organization: Guideline: Sodium intake for adults and children. Geneva: WHO; 2012. Available at: http://www.who.int/nutrition/publications/guidelines/sodium_intake_printversion.pdf. Accessed 31 March, 2014.

8.

Beaglehole R, Bonita R, Horton R, Adams C, Alleyne G. Priority actions for the non-communicable diseases crisis. Lancet 2011; 377: 1438−1447.

9.

He FJ, Li J, MacGregor GA. Effect of longer term modest salt reduc-

62

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

tion on blood pressure: Cochrane systematic review and meta-analysis of randomised trials. Br Med J 2013; 346: f1325.

10. Taylor RS, Ashton KE, Moxham T, Hooper L, Ebrahim S. Reduced dietary salt for the prevention of cardiovascular disease: a meta-analysis of randomized controlled trials (Cochrane review). Am J Hypertens 2011; 24: 843−853.

AFRICA

23. Magalhães P, Capingana DP, Mill JG. Prevalence of the metabolic syndrome and determination of optimal cut-off values of waist circumference in university employees from Angola. Cardiovasc J Afr 2014; 25(1): 27–33.

24. WHO/PAHO regional expert group for cardiovascular disease prevention through population-wide dietary salt reduction: sub-group for research

11. Cook NR, Cutler JA, Obarzanek E, Buring JE, Rexrode KM,

and surveillance. Protocol for population level sodium determination

Kumanyika SK, et al. Long-term effects of dietary sodium reduction on

in 24-hour urine samples. 2010. Available at http://www.paho.org/hq/

cardiovascular disease outcomes: observational follow-up of the trials

index.php?option=com_docman&task=doc_view&gid=21488&Itemid.

of hypertension prevention (TOHP). Br Med J 2007; 334: 885−888.

Accessed 28 May 2013.

12. He FJ, Li J, MacGregor GA. Effect of longer-term modest salt reduc-

25. Pereira AC, Sposito AC, Mota GF, Cunha RS, Herkenhoff FL, Mill JG,

tion on blood pressure. Cochrane Database Syst Rev 2013; 4: CD004937.

Krieger JE. Endothelial nitric oxide synthase gene variant modulates the

DOI: 10.1002/14651858.CD004937.pub2.

relationship between serum cholesterol levels and blood pressure in the

13. Aburto NJ, Ziolkovska A, Hooper L, Elliott P, Cappuccio FP, Meerpohl JJ. Effect of lower sodium intake on health: systematic review and metaanalyses Br Med J 2013; 346: f1326 doi: 10.1136/bmj.f1326.

14. Webster JL, Dunford EK, Hawkes C, Neal BC. Salt reduction initiatives around the world. J Hypertens 2011; 29(6): 1043−1050.

15. World Health Organization (WHO). Reducing salt intake in popula-

general population: new evidence for a direct effect of lipids in arterial blood pressure. Atherosclerosis 2006; 184: 193–200.

26. Land M-A Webster J, Christoforou A, Jeffery DPP, Chalmers J, Smith W, et al. Salt intake assessed by 24-h urinary sodium excretion in a random and opportunistic sample in Australia. Br Med J Open 2014; 4: e003720. doi:10.1136/ bmjopen-2013-003720.

tions: Report of a WHO forum and technical meeting (Paris 5−7

27. World Health Organisation. Obesity: preventing and managing the glob-

October 2006). Geneva, WHO, 2007. Available at: http://www.who.int/

al epidemic: Report of a WHO consultation on obesity, Geneva, 3–5

dietphysicalactivity/Salt_Report_VC_april07.pdf. Accessed 23 October,

June 1997. Geneva (CH): World Health Organisation, 1998. Available

2014.

at http://whqlibdoc.who.int/hq/1998/WHO_NUT_NCD_98.1_(p1-158).

16. Government Gazette. Republic of South Africa. Regulations relating to the reduction of sodium in certain foodstuffs and related matters. R214. 20 March 2013. Available at: http://www.info.gov.za/ view/DownloadFileAction?id=186474. Accessed 28 June 2014.

17. Brinden HC, Farrand CE. Reducing salt; preventing stroke. Nutr Bull 2012; 37: 57–63.

pdf. Accessed 13 July 2013.

28. Variyam JN, Shim Y, Blaylock J. Consumer misperception of diet quality. J Nutr Educ 2001; 33: 314−321.

29. Cornélio ME, Gallani M-CBJ, Godin G, Rodrigues RCM, Nadruz Jr W, Mendez RDR. Behavioural determinants of salt consumption among hypertensive individuals. J Hum Nutr Diet 2012; 25: 334–344.

18. World Health Organization: Healthy lifestyle and non-communicable

30. Ni Mhurchu C, Capelin C, Dunford EK, Webster JL, Neal BC, Jebb SA.

disease prevention, Moscow 2011. Available at: http://www.who.int/

Sodium content of processed foods in the United Kingdom: analysis of

nmh/events/moscow_ncds_2011/conference_documents/moscow_ncds_

44,000 foods purchased by 21,000 households. Am J Clin Nutr 2011;

roundtable_2_food_and_nutrition. pdf. Accessed 31 March, 2014.

19. Brown IJ, Tzoulaki I, Candeias V, Elliott P. Salt intakes around the world: implications for public health. J Epidemiol 2009; 38(3): 791–813.

93(3): 594−600.

31. Webster JL, Dunford EK, Neal BC. A systematic survey of the sodium contents of processed foods. Am J Clin Nutr 2010; 91(2): 413−420.

20. Yusuf S, Reddy S, Ounpuu S, Anand S. Global burden of cardiovascular

32. D’Elia L, Barba G, Cappuccio FP, Strazzullo P. Potassium intake,

diseases: part I: general considerations, the epidemiologic transition,

stroke, and cardiovascular disease: a meta-analysis of prospective stud-

risk factors, and impact of urbanization. Circulation 2001; 104(22): 2746–2753.

ies. J Am Coll Cardiol 2011; 57: 1210−1219.

33. World Health Organization. Guideline: potassium intake for adults and

21. World Health Organization. Non-communicable diseases: A strategy

children. Geneva, World Health Organization (WHO), 2012. Available

for the African region. Harare, Zimbabwe: WHO Regional Office for

at: http://www.who.int/nutrition/publications/guidelines/potassium_

Africa; 2000.

intake_printversion.pdf. Accessed 01 April, 2014.

22. Capingana DP, Magalhães P, Silva ABT, Gonçalves MAA, Baldo MP,

34. Bleske BE, Erickson SR, Fahoum S, Devarakonda KR, Welage LS,

Rodrigues SL, et al. Prevalence of cardiovascular risk factors and socio-

Koudmani M, et al. Cardiovascular risk among university students

economic level among public sector workers in Angola. BMC Public

from developed and developing nations. Open Cardiovasc Med J 2011;

Health 2013; 13: 732.

5: 117−122.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

63

Diagnostic disparity and identification of two TNNI3 gene mutations, one novel and one arising de novo, in South African patients with restrictive cardiomyopathy and focal ventricular hypertrophy Jomien M Mouton, Adriano S Pellizzon, Althea Goosen, Craig J Kinnear, Philip G Herbst, Paul A Brink, Johanna C Moolman-Smook

Abstract Introduction: The minimum criterion for the diagnosis of hypertrophic cardiomyopathy (HCM) is thickening of the left ventricular wall, typically in an asymmetrical or focal fashion, and it requires no functional deficit. Using this criterion, we identified a family with four affected individuals and a single unrelated individual essentially with restrictive cardiomyopathy (RCM). Mutations in genes coding for the thin filaments of cardiac muscle have been described in RCM and HCM with ‘restrictive features’. One such gene encodes for cardiac troponin I (TNNI3), a sub-unit of the troponin complex involved in the regulation of striated muscle contraction. We hypothesised that mutations in TNNI3 could underlie this particular phenotype, and we therefore screened TNNI3 for mutations in 115 HCM probands.

Methods: Clinical investigation involved examination, echocardiography, chest X-ray and an electrocardiogram of both the index cases and close relatives. The study cohort consisted of 113 South African HCM probands, with and without known founder HCM mutations, and 100 ethnically matched control individuals. Mutation screening of TNNI3 for diseasecausing mutations were performed using high-resolution melt (HRM) analysis.

Results: HRM analyses identified three previously described HCM-causing mutations (p.Pro82Ser, p.Arg162Gln, p.Arg170Gln) and a novel exonic variant (p.Leu144His). A previous study involving the same amino acid identified a

SA MRC Centre for Tuberculosis Research, DST/NRF Centre of Excellence for Biomedical Tuberculosis Research, Division of Molecular Biology and Human Genetics, Faculty of Medicine and Health Sciences, Stellenbosch University, Cape Town, South Africa Jomien M Mouton, PhD, jomien@sun.ac.za Craig J Kinnear, PhD Johanna C Moolman-Smook, PhD

Division of Cardiology, Department of Medicine, Faculty of Medicine and Health Sciences, Tygerberg Academic Hospital, Stellenbosch University, Cape Town, South Africa Philip G Herbst, MB ChB, MRCP (UK), FCP (CMSA), Cert Cardiol (CMSA)

Department of Medicine, Faculty of Medicine and Health Sciences, Stellenbosch University, Cape Town South Africa Adriano S Pellizzon, MB ChB (UCT), MMed (Int), FCP (SA) Althea Goosen, RHN Paul A Brink, MB ChB, MMed, BSc (Hons), PhD (SU)

p.Leu144Gln mutation in a patient presenting with RCM, with clinical features of HCM. We observed the novel p.Leu144His mutation in three siblings with clinical RCM and varying degrees of ventricular hypertrophy. The isolated index case with the de novo p.Arg170Gln mutation presented with a similar phenotype. Both mutations were absent in a healthy control group.

Conclusion: We have identified a novel disease-causing p.Leu144His mutation and a de novo p.Arg170Gln mutation associated with RCM and focal ventricular hypertrophy, often below the typical diagnostic threshold for HCM. Our study provides information regarding TNNI3 mutations underlying RCM in contrast to other causes of a similar presentation, such as constrictive pericarditis or infiltration of cardiac muscle, all with marked right-sided cardiac manifestations.

This study therefore highlights the need for extensive mutation screening of genes encoding for sarcomeric proteins, such as TNNI3 to identify the underlying cause of this particular phenotype.

Keywords: hypertrophic cardiomyopathy, restrictive cardiomyopathy, troponin I, echocardiography, disease-causing mutation Submitted 3/9/14, accepted 27/1/15 Cardiovasc J Afr 2015; 26: 63–69

www.cvja.co.za

DOI: 10.5830/CVJA-2015-019

Identifying disease and making sophisticated diagnoses at a specialist level is dependent on opportunity. Effective and accurate diagnosis starts with persons presenting to medical concern, their subsequent funneling, levels of awareness and expertise encountered, and available technology. In this article we describe a young woman (index case) with classic features of restrictive cardiomyopathy (RCM) who was referred to us with hypertrophic cardiomyopathy (HCM). Cascade screening identified the same disease in four relatives, in whom the diagnosis for some has changed from tuberculosis (TB) as a cause for pleural effusions, to cor pulmonale, constrictive pericarditis (CP) and RCM as the cause of sarcoidosis or amyloidosis. At the same time, an unrelated young boy presented with a disease profile similar to our index case, but without a history of disease in any other first-degree relative.

In view of the associated focal hypertrophy, we speculated that it could be caused by a mutation in troponin I [I type 3 (TNNI3; Genbank accession no. X90780.1)], which has been implicated in cases of unexplained RCM and/or HCM with

64

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

‘restrictive features’.1-3 Mutations in this gene have been described to cause RCM, HCM and dilated cardiomyopathy and specific mutations have on occasion been associated with more than one of these phenotypes.4 We focused on screening TNNI3 in a South African panel of HCM-affected probands for mutations, which included these two probands, using a high-resolution melt (HRM) approach.

Methods Institutional approval was granted for this study by the Ethical Review Committee of the Faculty of Medicine and Health Science at Stellenbosch University (N04/C3/062). Informed, written consent was obtained from all participants or, on the behalf of minors/children enrolled in the study, from their next of kin, caretakers or guardians. Clinical investigations were conducted according to the principles expressed in the Declaration of Helsinki.

The study cohort included the two index individuals with RCM with focal ventricular hypertrophy and restrictive features as well as 113 South African HCM-unrelated probands, all previously diagnosed with HCM using standard criteria, with or without known HCM-causing mutations. The two index individuals and first-degree family members underwent a physical examination, 12-lead electrocardiography and transthoracic two-dimensional echocardiography (Doppler, tissue Doppler).

Past medical records were attained for deceased family members and, if relevant, in living individuals. Rhythm and conduction abnormalities were defined using established criteria.

Echocardiograms were analysed using measurement conventions as outlined in the American Society of Echocardiography5 and the British Society of Echocardiography (http://www.bsecho.org/ hypertropic-cardiomyopathy/) guidelines for the assessment of patients with HCM. DNA extraction and mutation analysis: DNA was extracted from peripheral blood obtained from the participants as previously described.6 A control group consisted of anonymous blood samples from 100 mixed-ancestry individuals of varying age and gender obtained from the Western Province Blood Transfusion Services.

PCR amplification: the TNNI3 gene reference sequence (accession number: NM_000363.4) was obtained from NCBI Entrez Nucleotides Database (http://www.ncbi.nlm.nih.gov/ nucleotide/). All primers were designed using Integrated DNA Technologies Software, Primer Quest (http://www.idtdna.com).

Primer sequences are given in Table 1. The NCBI basic local alignment search tool (BLAST) (http://www.ncbi.nlm.nih.gov/ BLAST/) was used to examine primer specificity.

Polymerase chain reaction (PCR) was performed in a reaction mixture consisting of 30 ng of genomic DNA, kapa readymix (Kapa Biosystems Inc, Massachusetts, USA) (1X Kapa buffer, 1.5 mM MgCl2, 200 μM dNTPs, 1.0 U of kapa polymerase enzyme), 0.2 μM of each forward and reverse primer, 5% formamide, 2 μM SYTO9 fluorescent dye (Invitrogen, California, USA), and H2O to a final volume of 50 μl. PCR amplifications were performed using the GeneAmp® PCR System 2700 (Applied Biosystems Inc, California, USA). The standard PCR cycle consisted of initial denaturation at 95°C for three minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at the Ta for the specific PCR primer sets for 30 seconds, elongation at

AFRICA

72°C for 30 seconds, and a final elongation step at 72°C for five minutes.

HRM analysis: PCR products were subsequently subjected to HRM analysis on a Rotor-Gene 6000 analyser (Corbet Life Sciences, Brisbane, Australia). The samples were held at 50°C for one minute to ensure that the DNA was double stranded before being melted by increasing the temperature from 75 to 95°C in 0.1°C increments. As the DNA separated into single strands, the shift in fluorescence was measured. A characteristic denaturing profile, which is based on the length and GC content of the amplicon, was visualised for each DNA sample.

Nucleotide sequencing: representative DNA samples for each distinct melting curve, identified by HRM analysis, were bi-directionally sequenced using the BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems Inc), followed by electrophoresis on an ABI 3130XL genetic analyser (Applied Biosystems Inc). Sequences were analysed using BioEdit sequence alignment editor software v7.0.9.0.7 The sequences were aligned to the TNNI3 reference sequence (accession number: NM_000363.4) in NCBI (http://www.ncbi.nlm.nih.gov/ nucleotide/), using the ClustalW v1.4 programme and analysed for mismatches to the reference sequence.

The effect of sequence variants on restriction enzyme recognition sites was determined using restrictionmapper.org, http://insilico.ehu.es/restriction, and NEBcutter, http://tools.neb. com/NEBcutter2/. Restriction enzyme analysis was then used to confirm genotypes, where possible. Digestion reactions consisted of 10 μl of the PCR product, 1 × appropriate restriction enzyme buffer, five units of the restriction enzyme and H2O to a final volume of 20 μl. Samples were then incubated at the temperature and for the duration recommended by the manufacturer (New England Biolabs Inc, Massachusetts).

Haplotype construction: haplotypes were typed on different loci with microsatellite markers provided by the Ensemble database. Linkage to a specific region on a certain chromosome was determined with four microsatellite markers, namely (D19S926, D19S418, D19S880, D19S605) for TNNI3. The forward primer for each marker was fluorescently labelled with either FAM, HEX or Cy5 for easy genotyping. Each marker Table 1. Oligonucleotide primers used for the amplification of relevant exons in the TNNI3 gene Ta Size Position Tm Primers (5′-3′) (C°) (C°) (bp) (exon) 1F CCGTTATCTGGCATAGTGG 56.6 54 338 1R AGAGTCCCTACGCCTACCT 55.5 2_3F GACACAGCCCACCACTAA 55.3 54 366 2_3R ACTCCCAGGGTCTTGGAT 56.8 4F ACTCAGGGCTCAAGTTGG 56.2 54 239 4R CACCCATTCTCAAGCTCC 56.6 5F CACGCCTGGTCTTTATCC 56.6 54 222 5R AGAAACCTCGCATCCTTG 56.3 6F CCCAACAACACACACCAC 56.4 54 177 6R AAGTCCCAGCCATCTCAC 55.9 7F GGAAATGGAAGGAGAAGTACC 56.7 52 257 7R CCTCAGCATCCTCTTTCC 55.7 8F GGAGACCAAGAAGAGACCC 56.1 54 230 8R GCCTAAGCCCTGGGTAAT 56.7 bp: base pairs; C°: degrees Celsius; F: forward, R: reverse; Ta: annealing temperature; Tm: melting temperature.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

65

was amplified by polymerase chain reaction (PCR) using kapa readymix (Kapa Biosystems Inc) using the GeneAmp® PCR system 2700 (Applied Biosystems Inc) and products were analysed on the ABI sequencer (Applied Biosystems Inc).

Genotyping data were scored using the ABI GeneMapper 3.0 software (Applied Biosystems Inc).

Results Clinical features of the proband in pedigree 1 (individual 1.III.3) A diagnosis of the same disease process was made in a proband and three first-degree family members, namely the father and two brothers of the proband, of whom one was asymptomatic (Fig. 1). While the proband and her two brothers had echocardiograms typically associated with RCM, such as significant bi-atrial dilatation (Table 2) in the presence of non-dilated ventricles with preserved left ventricular systolic function, their presentations differed. The proband, aged 27, had heart failure as evidenced by dyspnoea, a raised jugular venous pressure, marked peripheral oedema and gross hepatomegaly, but with a heart of normal size clinically and on chest X-ray. The latter also showed pulmonary congestion. An apical murmur consistent with mitral regurgitation was present.

Despite management involving diuretics, other heartfailure medication and anticoagulation, the disease progressed.

Atrial fibrillation ensued and heart failure worsened. Three years after presentation the proband suffered an embolic ilio-

Fig. 1. Diagram of the pedigree of the family carrying the familial HCM-causing p.Leu144His mutation (pedigree 1).

The arrow indicates the proband. Solid symbols indicate documented affected individuals, open symbols indicate unaffected individuals. Mutation carriers are indicated by a + sign, and individuals without mutations are indicated by a – sign. Slashed symbols indicate deceased members. The arrows in the chromatogram indicate the point of variation for the p.Leu144Gln (c.432T>A) mutation and p.Leu144 (c.433G>T) variant, respectively, that results in the novel p.Leu144His mutation.

Table 2. Echocardiographic features of the four affected individuals (*), and the four close family members who screened negative, as comparison Measurement *1.III.3 *1.III.1 *1.III.2 *2.III.3 2.III.2 2.III.1 2.II.8 2.II.7 Rhythm Atrial flutter SR Atrial fibrillation SR SR SR SR SR 31 31 32 34 15 15 18 18 LA area (cm2) 29 22 37 46 11 15 11 14 RA area (cm2) LVED (mm) 41 48 46 40 53 54 55 51 LVEF (%) 54 56 59 31 63 50 62 60 3.6 9 8 4 11 11 11 7 S′ lat (cm/s) RVED 4C (mm) 33 27 31 30 32 36 29 38 TAPSE (mm) 7 17 10 6 20 20 28 25 Max WT (mm) 14 13 10 21 7 7 8 8 Max WT (position) LV apex Mid-LV septum RV free wall Mid-LV septum – – – – Max RVH (mm) 13 nil 10 9 nil nil nil nil IVCm/ IVCs (mm/mm) 31/31 16/9 27/26 25/19 x x x x E (cm/s) 44 68 74 48 121 88 89 69 A (cm/s) – 25 – 21 44 68 96 54 E/A – 2.7 – 2.3 2.8 1.3 0.9 1.3 E–DT (ms) 96 111 135 105 209 210 217 207 4 7 7.6 3.5 26 18 17 14 e′ lat (cm/s) 3 x x 2 x x x x e′ sep (cm/s) 11 9.7 9.7 13.7 4.6 4.9 5.3 4.9 E/e′ lat A: maximal transmitral A-wave velocity measured with pulsed-wave Doppler; E: maximal transmitral E-wave velocity with pulsed-wave Doppler; E/A: ratio of E to A; E–DT: transmitral E-wave deceleration time in ms; E/e′ lat: ratio of E wave to e′ lat; e′ lat: early diastolic pulsed-wave tissue Doppler velocity measured at the lateral mitral valve annulus; e′ sep: late diastolic (atrial contraction) pulsed-wave tissue Doppler velocity measured at the septal mitral annulus; LA area: left atrial area; LV: left ventricular area; LVED: left ventricular end-diastolic dimension; LVEF: left ventricular ejection fraction; IVCm/IVCs: the two numbers represent the maximal inferior vena cava diameter and the minimum inferior vena cava diameter, respectively, after a sniff manoeuvre; Max RVH: where right ventricular hypertrophy is present, this denotes the maximal right ventricular wall thickness measurement; Max WT: maximal wall thickness measured in mm; Max WT position: describes the position of measurement of maximal wall thickness; RA area: right atrial area; RV: right ventricular area; RVED 4C: basal right ventricular inflow dimension at end-diastole as measured in the four-chamber view; S′ lat: pulsed-wave tissue Doppler-derived lateral mitral annular systolic velocity; SR: sinus rhythm; TAPSE: tricuspid annular-plane systolic excursion measured by m-mode; x: data not available; –: measurement not applicable.

66

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

femoral occlusion and died. Post-mortem examination showed a large thrombus in the right atrium with evidence of multiple pulmonary emboli.

Pedigree 1 clinical analysis The younger brother of the proband, individual 1.III.2 (Fig. 1) had recurrent admissions over a seven-year period from the age of 25 years, with recurrent isolated pleural effusions, both right and left. Despite being transudates, the effusions were on more than one occasion empirically treated as tuberculous. He was also labelled ‘cor pulmonale’ but no lung disease that could explain such a diagnosis was present. He has since died at the age of 32 with severe right-sided congestion while being evaluated for a heart transplant. The elder brother of the proband, individual 1.III.1 (Fig. 1), was asymptomatic at the time of most recent contact, with an unremarkable clinical examination.

Their father, individual 1.II.2 (Fig. 1) presented at a similar age as the proband, aged 25 years (in 1978). With the clinical emphasis on right-sided heart failure, he had a sequential series of diagnoses, namely pulmonary hypertension with cardiac failure, CP due to TB, since TB and its various manifestations are extremely common in South Africa,8 and finally RCM (sarcoidosis/amyloidosis). A first cardiac catheterisation was believed to be compatible with CP, but a note drew attention to the absence of an apparent thickened pericardium.

His course was complicated by the onset of atrial fibrillation and he died, aged 28 years, as a consequence of recurrent embolic phenomena with cerebrovascular accidents on more than one occasion, despite anticoagulation. Material from a pericardial, endocardial or tongue biopsy as a possible source of DNA for a molecular diagnosis could not be traced.

Clinical features of the proband in pedigree 2 (Individual 2.II.3) Individual 2.II.3 (Fig. 3) presented with signs and symptoms of biventricular cardiac failure at age 15 years. Although clubbed feet were surgically corrected soon after birth, no cardiac anomalies were documented at that time. An electrocardiogram A

AFRICA

showed sinus rhythm with peaked P waves and a chest X-ray demonstrated a widened cardiothoracic ratio with evidence of pulmonary vascular congestion. His echocardiogram showed markedly dilated atria and non-dilated, small ventricles (Table 2).

He was treated for heart failure on admission and was discharged on anti-failure and anti-coagulation medication.

Pedigree 2 clinical analysis The nuclear family, comprising the parents, an older sister and older brother (Fig. 3), were normal on physical examination, electrocardiography and echocardiography (Table 2).

In-depth echocardiographic analysis Echocardiographic findings are summarised in Table 2. In pedigree 1, all the siblings had extremely enlarged atriae with relatively small end-diastolic left ventricles with good ejection fractions (Fig. 2). However, in the proband (1.III.3, Fig. 1), long-axis systolic function was compromised, as exemplified by the averaged septal and lateral systolic annular velocities measured with pulse-wave tissue Doppler (s′ septal and s′ lateral, respectively), while in the younger (1.III.2, Fig. 1) and older brother (1.III.1, Fig. 1) it was preserved. In the case of right ventricular systolic function, the longitudinal tricuspid annular-plane systolic excursion (TAPSE) was only 7 mm, suggesting significant impairment of longitudinal right ventricular shortening. However, this was slightly better in the symptomatic brother (10 mm) and relatively good in the asymptomatic brother (17 mm).

Severe diastolic dysfunction with raised filling pressures was present in the proband, as shown by the restrictive transmitral filling pattern (transmitral E-wave deceleration time 96 ms) and E/e′ lateral > 10, in addition to the atrial dilatation. In individual 1.III.2, the left ventricular diastolic parameters were measured with the patient in atrial fibrillation and were impaired. In the older, asymptomatic brother (1.III.1, Fig. 1), the left ventricular diastolic function was significantly impaired with early diastolic lateral annular long-axis velocities of 7 cm/s. Filling pressures were elevated as evidenced by a restrictive transmitral filling B

Fig. 2. C linical features of RCM in individual 1.III.3 affected by the p.Leu144His mutation in TNNI3. (A) Apical four-chamber echocardiogram in diastole with marked bi-atrial dilatation, which was captured using a GE Vivid 7 ultrasound machine. (LA, left atrium; LV, left ventricle; RA, right atrium; RV, right ventricle). (B) 12-lead electrocardiogram in sinus rhythm with P-mitrale and partial right bundle branch block, which was captured using a GE Mac 1200: ECG/EKG system.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

pattern (transmitral pulse-wave E/A ratio of 2.7 and E-wave deceleration time of 111 ms) supported by an E/e′ lateral of almost 10.

The distribution of hypertrophy in/between the family members varied. The proband showed a focal area of significant hypertrophy involving the left ventricular apex and mid- to apical segments of the right ventricular free wall [maximal wall thickness (MWT) 14 mm]. In the younger brother (1.III.2, Fig. 1) the pattern of hypertrophy involved the right ventricle exclusively. The mid- to basal right ventricular free wall demonstrated significant focal hypertrophy of up to 10 mm, causing the bulging right ventricular free wall to almost ‘kiss’ the interventricular septum in systole – associated with a small intra-cavitary right ventricular gradient and prominent systolic flow turbulence on colour Doppler. The elder brother of the proband (1.III.1, Fig. 1) showed a focal area of hypertrophy with a MWT of 13 mm at the mid-septal region associated with mid-left ventricular cavity obliteration.

In pedigree 2, the proband (2.II.3, Fig. 3) was the only affected person from the family and showed systolic impairment with poor EF of 31%. In line with this, systolic left ventricular longaxis function and right ventricular long-axis systolic function, as assessed by a TAPSE of 6 mm, was severely impaired. Tissue Doppler indices demonstrated an individual with severe left ventricular diastolic early relaxation impairment and high filling pressures, reflected by a restrictive transmitral filling pattern

67

(E/A; E-wave deceleration time and E/e′ lateral measuring > 13) (Table 2). Significantly more hypertrophy was observed in the MWT (21 mm) and mid-right ventricular free wall (9 mm).

Furthermore, the right heart flow was sluggish as highlighted by marked spontaneous echo contrast present in both the right atrium and right ventricle.

Molecular analysis Molecular analysis of the cohort identified 14 genetic variants, of which six were exonic variants and eight were intronic variants (Table 3). In total, four novel variants were identified, of which one was an exonic variant (p.Leu144His) and three were intronic variants (c. –47C>T, c.109–17C>A, c.*35C>T). The remaining variants have previously been documented, and all exonic variants that resulted in an amino acid change (p.Pro82Ser,9,10 p.Arg162Gln9,11,12 p.Arg170Gln11) were tested for by restriction enzyme analysis in available family members.

The mutation found in pedigree 1 (p.Leu144His) is novel, and together with the exonic variant (p.Arg170Gln) found in pedigree 2, have not been observed in the South African population before; these will be discussed in more detail. The remaining two identified exonic variants, namely p.Arg162Gln and p.Pro82Ser, were observed in two patients diagnosed with HCM. One patient presented with symptoms of atrial fibrillation (male, 61 years) and the other, an unexpected death, was diagnosed post mortem (male, 41 years, ventricular hypertrophy). Both mutations had previously been associated with HCM. Other family members were either unaffected by HCM or not available for further testing.

Identification of a novel cardiac troponin I gene mutation A BccI restriction enzyme digest was performed to confirm the presence of the p.Leu144His mutation in the three siblings in pedigree 1. Furthermore, this mutation was absent in a healthy, Table 3. List of genetic variants identified in TNNI3 Sequence v Amino acid ariants effect Documented c.-148A>G None rs73935313 c.-47C>T None Novel c.-35C>A None rs3729707 Exon 2 c.25-8T>A None rs3729836 c.108+21G>A None rs3729837 Exon 4 c.109-17C>A None Novel c.150+13G>A None rs73617692 Exon 5 c.198G>A p.Glu66 rs3729710 c.204G>T p.Arg68 rs3729711 c.244C>T p.Pro82Ser rs77615401 * Exon 7 Novel c.432TG>AT p.Leu144His c.485G>A p.Arg162Gln Previously described12,14,15 c.509G>A p.Arg170Gln Previously described16 Exon 8 c.*35C>T None Novel Arg: arginine; Glu: glutamine; His: histadine; Leu: leucine; TNNI3: cardiac troponin I; Pro: proline. *Novel mutation caused by two adjacent sequence changes; c.432T>A (synonymous), which has been reported before,5 and a novel c.433G>T (non-synonymous) variant.

Fragment Exon 1

Fig. 3. D iagram of the pedigree of the family carrying the familial HCM-causing p.Arg170Gln mutation (pedigree 2). The arrow indicates the proband. Solid symbols indicate documented affected individuals, open symbols indicate unaffected individuals. The mutation carrier is indicated by + sign, and individuals without mutations are indicated by a – sign. Slashed symbols indicate deceased members. The arrow in the chromatogram indicate the point of variation for the p.Arg170Gln (c.509G>A) mutation. Individual alleles of four microsatellite markers (D19S926, D19S418, D19S880, D19S605) are shown for pedigree 2.

68

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

ethnically matched control group (n = 100). Genotypes of pedigree 1 for the p.Leu144His mutation were further confirmed by bi-directional semi-automated DNA sequencing (Fig. 1).

Identification of previously documented de novo missense mutation The mutation p.Arg170Gln (c.509G>A) has previously been associated with HCM in children younger than 13 years.13 A PstI restriction enzyme digestion confirmed that this mutation was not present in the other available family members of pedigree 2, including the parents of individual 2.II.3. Haplotype analysis of pedigree 2 derived from four microsatellite markers in the TNNI3-located chromosomal region shown in Fig. 3 indicated that the parents (2.I.1 and 2.I.2) are definitely the biological father and mother of all three of their offspring (2.II.1, 2.II.2 and 2.II.3). The p.Arg170Gln (c.509G>A) mutation is considered to have occurred de novo in the affected patient (2.II.3), since this mutation was absent in all other family members available for testing, and no family members presented with symptoms.

Discussion In this article we describe the screening of a panel of HCM-affected probands for TNNI3, a gene that has been associated not only with HCM but also with dilated cardiomyopathy and RCM.4 The screening was performed because two unrelated individuals, referred with HCM, had features resembling that of RCM. Of the sequence variants identified, four caused amino acid changes, of which two were present in our probands with RCM; one novel (p.Leu144His) and one a previously described de novo mutation (p.Arg170Gln). The p.Leu144His mutation was present in the first actin-binding domain and overlapped with the ATPase inhibitory region, and p.Arg170Gln was located in the second actin-binding domain.14 The other two, namely p.Arg162Gln and p.Pro82Ser, were observed in two patients diagnosed with HCM. One patient presented with symptoms of atrial fibrillation (male, 61 years) and the other was an unexplained death diagnosed post mortem (male, 41 years). Both mutations have previously been associated with HCM. Other family members were either unaffected by HCM or not available for further testing.

RCM segregated in pedigree 1 for two generations, while in pedigree 2 an isolated case presented with RCM with no evidence of clustering within his immediate family. Two individuals also fulfilled the diagnostic criteria for HCM by way of focal ‘hypertrophy’ for HCM. The p.Leu144His mutation was also present in two brothers (1.III.1 and 1.III.2, Fig. 1) and most likely in the father of the proband who died from the same disease. The p.Arg170Gln mutation was identified in a single individual (2.II.3, Fig. 3). We have subsequently shown that this mutation arose de novo on the background of a haplotype inherited from his father.

In a previous study investigating the genetic aetiology of HCM in pre-adolescent children between 1989 and 2007, the p.Arg170Gln mutation was the only mutation identified in TNNI3.13 The proband and her father in pedigree 1 were severely affected but only became symptomatic in their mid-twenties, and had had children before then. The other two siblings of the proband voluntarily had no children. In most cases of sarcomere-associated RCM, individuals with mutations in TNNI3 in particular, present with likely de novo mutations,

AFRICA

as affected individuals tend to die young.3,4 This pattern was observed in 2.II.3 (Fig. 3), who died at age 16 years, and had a de novo mutation on an allele inherited from his father.

The marked bi-atrial dilatation in the presence of normalto-small left and right ventricular dimensions and generally preserved left ventricular systolic function (as measured by left ventricular ejection fraction in three of four cases) argues strongly for a restrictive process involving both ventricles in these cases. Left ventricular diastolic function measurements were universally abnormal, as expected, and this process associated with high filling pressures most likely explains the bi-atrial dilatation (inferior vena cava data for high right ventricular filling pressures – see Table 2). These ‘restrictive hearts’ show two additional morphological features of interest, namely focal hypertrophy, which often does not reach the cut-off values for the diagnosis of HCM by current criteria (15 mm), and prominent involvement of the right ventricle in terms of hypertrophy (three of four patients). The prominence of right ventricular involvement is not only echocardiographic, but translates into clinical involvement in terms of prominent right heart failure.

The index cases from both pedigrees demonstrated evidence of advanced long-axis systolic impairment of both ventricles and were worst affected from the viewpoint of symptomatic congestive heart failure. The elder brother of the proband from pedigree 1 (1.III.1, Fig. 1), with sparing of long-axis systolic function of both ventricles, seemed least affected clinically and in fact was relatively asymptomatic. The brother from pedigree 1 was intermediate, with relatively preserved left ventricular longaxis function but significantly impaired right ventricular longaxis function. The right ventricular long-axis function in all these cases, as assessed by TAPSE, appeared to predict the presence of right heart failure, or vice versa. Furthermore, interestingly, both these features tracked the presence of right ventricular hypertrophy in all three individuals exhibiting this.

Empirical data on outcomes related to right ventricular structure is generally lacking because of the unique geometry of the right ventricle.15 TAPSE estimates longitudinal function, but is not comprehensive.15 However, a recent magnetic resonance imaging-based study showed a higher risk in persons free of cardiovascular disease at baseline, but with an increased right ventricular mass.16 The novel mutation p.Leu144His involves the same amino acid residue as p.Leu144Gln, although it results in a different amino acid change. The latter is one of several RCM-causing mutations studied at laboratory level (p.Arg145Trp, p.Ala171Thr, p.Lys178Glu and p.Arg192His). The amino acid involving these mutations is located within the actin-binding domain (residue 130–148, 173–181) and the troponin C-binding domain (residue 113–164) of cardiac troponin I.17 In principle, this mutation could affect the normal function of cardiac troponin I since it is located in the sequence (residues 137–148) required for inhibition of human cardiac troponin I actomysin ATPase activity18 and has been shown to cause excessive inhibition in assays. However, all of the mutations tested, including p.Ala171Thr, which is in the second actin-binding domain and is next to the de novo mutation, p.Arg170Gln, also have similar effects on basal actin-myosin– ATPase activity. One suggestion is that the second binding domain increases the cardiac troponin I concentration on actin.14 All of these mutations exhibit an increased Ca++ sensitivity

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

of the myofilament.19,20 Although it is not clear how this affects cross-bridge cycling and sarcomere energetics, some experiments suggest that these mutations are thought to weaken the ability of the cardiac troponin complex to fully inhibit the cross-bridge attachment during the relaxation phase of muscle contraction,21–23 consequently reducing the rate of relaxation. Higher energy use observed in transgenic models of HCM at a whole-cell or wholeanimal level may relate to a shift in Ca++ homeostasis (or other changes) with higher energy costs to return the cells to their pre-contractile basal state.

69

6. Corfield VA, Moolman JC, Martell R, Brink PA. Polymerase chain reaction-based detection of MN blood group-specific sequences in the human genome. Transfusion 1993; 33: 119–124.

7. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 1999; 41: 95–98.

8. Wyndham CH. Mortality trends in the populations of the RSA from causes commonly observed in developing communities, 1968-1977. S Afr Med J 1984; 66: 945–950.

9. Mogensen J, Murphy RT, Kubo T, Bahl A, Moon JC, Klausen IC, et al.

Frequency and clinical expression of cardiac troponin I mutations in 748

Conclusion

consecutive families with hypertrophic cardiomyopathy. J Am Coll Cardiol 2004; 44: 2315–2325.

In the current investigation, we have demonstrated the usefulness of HRM analysis for the identification of HCM-causing mutations. The mutations identified here will now be used for pre-symptomatic genetic screening of additional family members to identify individuals at risk. Furthermore, new patients with similar clinical features could also initially be screened for these mutations.

Research studies often do not recount diagnostic disparities, which could be a result of high incidence of disease, diagnostic sophistication and personal interests. The ‘wrong’ diagnoses of cor pulmonale, CP and TB pleuritis highlight the influence of the high prevalence of TB in South Africa in making a diagnosis. Furthermore, this study provides insight into diagnostic disparities and processes that led to inappropriate diagnosis in two individuals.

10. Niimura H, Patton KK, McKenna WJ, Soults J, Maron BJ, Seidman JG,

This work was supported by the Wellcome Trust (International Senior

15. Jurcut R, Giusca S, La GA, Vasile S, Ginghina C, Voigt JU. The echo-

Research Fellowship, fellowship GR073610MA to Hanlie Moolman-Smook),

cardiographic assessment of the right ventricle: what to do in 2010? Eur J

et al. Sarcomere protein gene mutations in hypertrophic cardiomyopathy of the elderly. Circulation 2002; 105: 446–451.

11. Gruner C, Care M, Siminovitch K, Moravsky G, Wigle ED, Woo A, et al. Sarcomere protein gene mutations in patients with apical hypertrophic cardiomyopathy. Circ Cardiovasc Genet 2011; 4: 288–295.

12. Moon JC, Mogensen J, Elliott PM, Smith GC, Elkington AG, Prasad SK, et al. Myocardial late gadolinium enhancement cardiovascular magnetic resonance in hypertrophic cardiomyopathy caused by mutations in troponin I. Heart 2005; 91: 1036–1040.

13. Kaski JP, Syrris P, Esteban MT, Jenkins S, Pantazis A, Deanfield JE, et al. Prevalence of sarcomere protein gene mutations in preadolescent children with hypertrophic cardiomyopathy. Circ Cardiovasc Genet 2009; 2: 436–441.

14. Ohtsuki I, Morimoto S. Troponin: regulatory function and disorders.

Biochem Biophys Res Commun 2008; 369: 62–73.

London, United Kingdom. We thank all the participants involved in this study and Mrs Ina le Roux for her technical assistance.

Echocardiogr 2010; 11: 81–96.

16. Kawut SM, Barr RG, Lima JA, Praestgaard A, Johnson WC, Chahal H, et al. Right ventricular structure is associated with the risk of heart fail-

References 1. Van den Wijngaard A, Volders P, Van Tintelen JP, Jongbloed JD, van den Berg MP, Lekanne Deprez RH, et al. Recurrent and founder mutations in

ure and cardiovascular death: the Multi-Ethnic Study of Atherosclerosis (MESA) – right ventricle study. Circulation 2012; 126: 1681–1688.

17. Perry SV. Troponin I: inhibitor or facilitator. Mol Cell Biochem 1999; 190: 9–32.

the Netherlands: cardiac troponin I (TNNI3) gene mutations as a cause of

18. Syska H, Wilkinson JM, Grand RJ, Perry SV. The relationship between

severe forms of hypertrophic and restrictive cardiomyopathy. Neth Heart

biological activity and primary structure of troponin I from white skeletal

J 2011; 19: 344–351.

2. Mogensen J, Kubo T, Duque M, Uribe W, Shaw A, Murphy R, et al.

Idiopathic restrictive cardiomyopathy is part of the clinical expression of cardiac troponin I mutations. J Clin Invest 2003; 111: 209–216.

muscle of the rabbit. Biochem J 1976; 153: 375–387.

19. Watkins H, Ashrafian H, McKenna WJ. The genetics of hypertrophic cardiomyopathy: Teare redux. Heart 2008; 94: 1264–1268.

20. Gomes AV, Liang J, Potter JD. Mutations in human cardiac troponin I that

3. Kaski JP, Syrris P, Burch M, Tome-Esteban MT, Fenton M, Christiansen

are associated with restrictive cardiomyopathy affect basal ATPase activity

M, et al. Idiopathic restrictive cardiomyopathy in children is caused by

and the calcium sensitivity of force development. J Biol Chem 2005; 280:

mutations in cardiac sarcomere protein genes. Heart 2008; 94: 1478–1484.

30909–30915.

4. Willott RH, Gomes AV, Chang AN, Parvatiyar MS, Pinto JR, Potter JD.

21. Wen Y, Pinto JR, Gomes AV, Xu Y, Wang Y, Wang Y, et al. Functional

Mutations in Troponin that cause HCM, DCM AND RCM: what can we

consequences of the human cardiac troponin I hypertrophic cardio-

learn about thin filament function? J Mol Cell Cardiol 2010; 48: 882–892.

myopathy mutation R145G in transgenic mice. J Biol Chem 2008; 283:

5. Nagueh SF, Bierig SM, Budoff MJ, Desai M, Dilsizian V, Eidem B,

20484–20494.

et al. American Society of Echocardiography clinical recommenda-

22. Lang R, Gomes AV, Zhao J, Housmans PR, Miller T, Potter JD. Functional

tions for multimodality cardiovascular imaging of patients with hyper-

analysis of a troponin I (R145G) mutation associated with familial hyper-

trophic cardiomyopathy: Endorsed by the American Society of Nuclear Cardiology, Society for Cardiovascular Magnetic Resonance, and Society

trophic cardiomyopathy. J Biol Chem 2002; 277: 11670–11678.

23. Elliott K, Watkins H, Redwood CS. Altered regulatory properties of

of Cardiovascular Computed Tomography. J Am Soc Echocardiogr 2011;

human cardiac troponin I mutants that cause hypertrophic cardiomyopa-

24: 473–498.

thy. J Biol Chem 2000; 275: 22069–22074.

70

CARDIOVASCULAR JOURNAL OF AFRICA â&#x20AC;˘ Volume 26, No 2, March/April 2015

AFRICA

Review Article HIV-associated large-vessel vasculopathy: a review of the current and emerging clinicopathological spectrum in vascular surgical practice Balasoobramanien Pillay, Pratistadevi K Ramdial, Datshana P Naidoo

Abstract An established relationship exists between human immunodeficiency virus (HIV) and the vascular system, which is characterised by clinical expressions of aneurysmal and occlusive disease that emanate from a common pathological process.

The exact pathogenesis is currently unknown; attempts to implicate opportunistic pathogens have been futile. Theories converge on leucocytoclastic vasculitis with the vaso vasora as the vasculopathic epicentre. It is thought that the virus itself or viral proteins trigger the release of inflammatory mediators that cause endothelial dysfunction and smooth muscle proliferation leading to vascular injury and thrombosis.

The beneficial effects of highly active anti-retroviral therapy alter the natural history of the disease profile and promote longevity but are negated by cardiovascular complications.

Atherosclerosis is an emerging challenge. Presently patients are managed by standard surgical protocols because of nonexistent universal surgical interventional guidelines. Clinical response to treatment is variable and often compounded by complications of graft occlusion, sepsis and poor wound healing. The clinical, imaging and pathological observations position HIV-associated large-vessel vasculopathy as a unique entity. This review highlights the spectrum of HIV-associated large-vessel aneurysmal, occlusive and atherosclerotic disease in vascular surgical practice.

Keywords: human immunodeficiency virus, vasculopathy, aneurysms, occlusive disease, atherosclerosis, vascular surgery

Department of Vascular/Endovascular Surgery, Nelson R Mandela School of Medicine, Durban, South Africa Balasoobramanien Pillay, BSc, BSc (Hons), MB ChB, FCS (SA), CVS (SA), balapil@ialch.co.za; balapillay@vodamail.co.za

Department of Anatomical Pathology, School of Laboratory Medicine and Medical Sciences, University of KwaZuluNatal and National Health Laboratory Service, Durban, South Africa Pratistadevi K Ramdial, FCPath (Anat) (SA)

Department of Cardiology, University of KwaZulu-Natal, Durban, South Africa Datshana P Naidoo, FRCP (SA)

Submitted 3/7/14, accepted 27/1/15 Cardiovasc J Afr 2015; 26: 70â&#x20AC;&#x201C;81

www.cvja.co.za

DOI: 10.5830/CVJA-2015-017

Since the first description of human immunodeficiency virus (HIV) disease more than three decades ago,1 HIV infection has become a global phenomenon, afflicting approximately 40 million people worldwide.2 Over 70% of infected individuals reside in sub-Saharan Africa.2 HIV is implicated in a multisystem disease process and the cardiovascular system is not spared. Many infected patients are in the advanced stages of disease and present with vascular complications.3,4 The unique vascular manifestations of HIV-related disease, documented as early as 1987 in children,5 may present with a diverse spectrum of aneurysms, occlusive disease, spontaneous arteriovenous fistulae and dissections. In addition, despite the heightened recognition of the spectrum of HIV and other HIV-associated infective vasculitic and vasculopathic reactions,6-10 the exact pathogenetic mechanisms and reasons underpinning the varied manifestations of the HIV-associated vascular pathology remain enigmatic.

This review discusses the spectrum of HIV-associated large-vessel disease in vascular surgical practice, including the current understanding of pathogenetic mechanisms, the clinicopathological profile of aneurymal and occlusive disease, and the impact of highly active anti-retroviral therapy (HAART) in the development of atherosclerosis in this patient population.

Pathogenesis of HIV-associated large-vessel vasculopathy The pathogenesis of HIV-associated large vessel vasculopathy involves intricate, dynamic interactions between viral-induced inflammatory responses, vascular smooth muscle changes, endothelial alterations and circulating blood factors that result in pathological vessel wall alterations and symptomatic clinical disease (Fig. 1A, B).11,12

Inflammatory alterations The hallmark pathological feature common to aneurysmal and occlusive disease is an HIV-associated vasculitic process, the exact mechanism of which is poorly understood (Fig. 1A, B).13,14

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

71

Fig. 1A. S chematic illustration of direct and indirect endothelial damage. The former is characterised by viral endothelial invasion, upregulation of adhesion molecules, generation of reactive oxygen species and varied cytokine and chemokine responses.

The latter encompasses continued viral invasion, generation of an inflammatory cascade that leads to a vicious circle of endothelial injury, activation and remodelling, culminating in thrombosis and occlusion.

HIV-INDUCED ENDOTHELIAL DYSFUNCTION

PERMEABILITY • protein leakage • encephalitis

INFLAMMATION • vasculitis • occlusive disease • aneurysms • arteriovenous fistula • dissections

PROLIFERATION • Kaposi sarcoma

• intimal hyperplasia • elastic fragmentation • thrombotic occlusion

Fig. 1B. S chematic representation of the clinicopathological manifestations arising from HIV-induced endothelial dysfunction.

HIV-related endothelial dysfunction, incorporating a complex interplay between cytokines and inflammatory components, has been proposed.14 The theoretical basis of this includes continuing viral infection and associated viral protein toxicity leading to vascular wall injury, an increase in viral load associated with the release of interleukin 1 (IL1), interleukin 6 (IL6), interleukin 8 (IL8) and tumour necrosis factor-α (TNF-α), in conjunction with immune activation and immune reconstitution as a result of HAART.14

This has been observed by Nieuwhof et al.15 who postulated increased T-cell numbers associated with elevated CD25-positive receptors in the setting of cerebral vasculitis. This theory is supported by the response to steroids and daclizumab, a human immunoglobulin G-K recombinant antibody that binds to CD25.15 It is thought that the HIV-transactivator of transcription protein, tat, triggers inflammatory pathways that result in the production of cytokines and adhesion molecules. A viral envelope glycoprotein component (gp120) is a catalyst that stimulates production of pro-inflammatory mediators, which target endothelial cells.14,16,17 Evidence from studies on flow-mediated vasodilatation demonstrates that HIV-associated endothelial dysfunction is catalysed by these cytokines and the inflammatory process.13,14,17

Role of smooth muscle cells Smooth muscle cells (SMCs), the major cellular component of the arterial muscularis media, have proliferative and migratory potential. Key surface receptors, CD4, CCR5 and CXCR4, render SMCs an ideal infective target that facilitates entry of the HIV-1 viral components.18 Viral invasion results in thinning of the medial layer and sub-intimal aggregation of SMCs. Entry of the viral envelope proteins may activate tissue factor 2, which is a potent stimulant for the coagulation cascade.

While the SMCs seems to play a central role in arterial wall pathophysiology, as evidenced by in vivo and in vitro SMC studies,19 this aspect of smooth muscle involvement has not been studied in depth. More recently Gutierrez et al.,20 in their appraisal of intracranial vessels from autopsy specimens in a pilot study of 15 arterial wall samples from five patients, found

72

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

that there was thinning of the arterial media. Although this observation may be indicative of a significant pre-clinical stage towards HIV-associated vasculopathy with resultant vessel wall weakening, it has to be interpreted with caution in view of study limitations in terms of numbers, lack of information on HAART and duration of HIV infection.

The entry of the virus into the cell triggers release of tissue factor 2, which induces thrombosis and chemokine c-c motif ligand (CCL-2) production. This is instrumental in promoting atherogenesis. These observations may support a role for direct viral invasion, and may contribute to knowledge on the thrombotic complications and coronary events experienced

by HIV-infected patients.

‘Molecular mimicry’ Tilson21 studied an HIV-related carotid aneurysm and explains molecular mimicry whereby HIV viral proteins share antigens in the wall of the vasculopathic process. The load-bearing matrix of the arterial wall is composed of an artery-specific antigenic protein (ASAP), matrix cell adhesion molecule-1 (Mat-CAM-1).

It is theorised that the virus and its toxic by-products share ligands that are characterised by DNA sequence similarities between the ASAP and viral envelope glycoprotein, gp41 and gp120.21 This may potentially result in autoimmune-mediated cell damage during infection. However, no similarities were found between Mat-CAM-1 and HIV envelope glycoproteins in this study.

Therefore an alternate explanation proposed is that of direct viral invasion of the aortic fibroblasts at the level of the adventitia.21

AFRICA

Current descriptions of HIV-associated vasculopathy Aneurysmal disease Since the first report of Salmonella-related mycotic aneurysmal disease by Du Pont et al.24 in an HIV-positive patient in 1989, increasing numbers of reports have emanated from Zimbabwe, Zambia and South Africa,4,25-31 confirming the occurrence of aneurysmal disease independent of bacterial infection. These aneurysms are multiple, with a predilection for young individuals and atypical locations, including the aorta, carotid, popliteal and femoral vessels.28,29,31 More recently, a predilection for femoral artery involvement has been documented.4 These aneurysms occur in the advanced stages of HIV disease, as demonstrated by low CD4 counts and systemic clinical features.3,4

Clinical manifestations Patients with aneurysms can be asymptomatic. However, when presenting as a space-occupying lesion, the clinical features are governed by the rate of growth, expansion and anatomical location. The presence of a pulsatile mass (Fig. 2A) may be complemented by constitutional findings of weight loss, associated lymphadenopathy and/or the presence of opportunistic infections. The symptom complex entails a varying spectrum, from pain in the majority of patients, to the associated effects of mechanical compression. An expanding carotid aneurysm (Fig. 2B) may result in dysphagia, stridor, hoarseness of voice, cranial nerve palsies, a hemispheric event as a consequence of thrombo-embolisation or frank aneurysmal rupture producing haemodynamic instability. Peripheral

Thrombophilic screening While the pathogenesis of occlusive disease is presently unclear, thrombophilic screens have been sporadically performed with regard to protein S, protein C and antithrombin III. Mulaudzi et al.,22 however, found negative thrombophilic screens in 10 patients with primary arterial thrombosis in the acute setting.

Chronic infection in HIV-infected patients results in endothelial injury and associated dysfunction. This sequence of events culminates in atherosclerosis and thrombosis.

Experimental models Animal models23 have been employed to simulate the arterial wall pathology in order to improve insight into the underlying mechanisms of HIV-associated vasculopathy. Studies conducted in transgenic mice infected by the HIV-1 provirus have demonstrated an adventitial mixed inflammatory cell infiltrate, medial hypocellularity and intimal hyperplasia following smooth muscle migration, with sparing of the endothelial cells. The intimal thickening produces intraluminal narrowing of some vessels causing distal tissue ischaemia.

In addition, viral components have been observed in SMCs, which in some instances have proliferated in the absence of inflammation. This model partially explains the findings in human arterial wall samples, with the key feature being endothelial dysfunction. Although this model highlights the conceptual principles of viral invasion, extrapolation of the pathophysiological findings of arterial wall studies to the human scenario remains challenging.

Fig. 2. Clinical presentation of HIV-aneurysmal disease: mass in the left anterior thigh (A), and left neck (B, arrows).

CT angiogram demonstration of multiple aneurysms in various anatomical locations (C, arrows). ‘Yin-yang’ sign demonstrated on the right common femoral artery (D). Gross demonstration (E) of aneurysm (arrow) with a ‘blow-out’ (*) and pseudo-aneurysm (P) formation.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

aneurysms may be associated with venous thrombosis as a result of venous compression by the aneurysmal mass.

Imaging studies Studies have shown aneurysmal transformation of the carotid, aortic, femoral and popliteal vessels.3,4 These aneurysms are multiple (usually more than three) (Fig. 2C) with a greater frequency in the carotid and femoral vessels. Doppler studies demonstrating the imaging features in HIV-associated vasculopathy are documented uncommonly. Woolgar et al.32 described the imaging characteristics with the aid of duplex ultrasound in HIV-related aneurysms in 12 patients. This modality has proven to be a valuable non-invasive screening tool.

As a general principle, aneurysms found clinically at one location guided the screening for aneurysms at other locations.

Duplex ultrasound features characterised by forward and backward flow within a pseudo-aneurysm are reflected as a ‘yin-yang’ sign32 (Fig. 2D), cavitational echogenicity and turbulent flow with a vessel wall defect (Fig. 2E).32 This pathological process is eclipsed by adjacent hypo-echoic spotting and vessel wall thickening with normal proximal and distal vasculature. Patients deemed suitable for surgery are subjected to definitive imaging in the form of angiography or computerised tomographic angiography. Angiographically, the aneurysms are usually multiple, saccular or pseudo-aneurysmal with a variable location. The uninvolved arterial segments are pristine with a smooth vessel contour (Fig. 2C).

73

• absence of vasa vasora in the intracranial vessels, suggestive of a mechanism other than a leucocytoclastic vasculitis • identification of specific vasculitic agents, such as varicella zoster virus, in lesional tissue.

In our unit Nair et al.29 studied the histopathological features of the aneurysm wall in detail in 10 patients. The common theme that was documented was inflammation of the vessel walls with the vasa vasora being the epicentre of this inflammatory process. Active lesions demonstrate inflammatory changes, necrosis and luminal narrowing (Fig. 3A), while inactive lesions are characterised by chronic features, including fibrosis and haemosiderin deposition. The media displays fragmented elastic fibres, variable loss of smooth muscle and fibromuscular hyperplasia (Fig. 3B). Intense involvement of the vasa vasora is hypothesised to cause transmural ischaemic necrosis. The adventitia demonstrates evolving inflammatory changes, characterised by macrophage infiltration with haemosiderin deposits.

Similarly, large-vessel vasculopathy has also been characterised by adventitial, medial and intimal alterations.6,46 Leucocytoclastic vasculitis of the vasa vasora and periadventitial vessels, proliferation of slit-like vascular channels, chronic inflammation and fibrosis are seen in the adventitia (Fig. 3C). While medial fibrosis, muscle damage, elastic fragmentation and intimal duplication are also present, the intima demonstrates fragmentation of the internal elastic lamina (Fig. 3D) and calcification (Fig. 3E).

Pathology HIV-associated vasculopathy has a predilection for medium and large vessels. Its pathological profile has been compared to Takayasu’s disease because it affects young individuals and shares similar disease distribution and transmural vessel involvement. Histopathological vascular changes in AIDS were initially described by Joshi et al.5 in autopsies of children. Small and medium-sized vessels in six children demonstrated intimal fibrosis, elastic fragmentation, medial calcification, luminal narrowing and perivasculitis.5,33 By contrast, Calabrese et al.34 documented a systemic necrotising vasculitis following HIV infection in 11/14 patients with small-vessel involvement and lymphocytic infiltration.

These features overlapped with polyarteritis nodosa, angiocentric lymphoproliferative disorder and primary angiitis of the nervous system.34 Marks and Kuskov28 demonstrated peri-arteritic fibroproliferative granulomatous inflammation of the aortic and iliac vessels in 5/12 patients with HIV-associated aneurysms, and hypothesised that most HIV patients develop a necrotising vasculitis of the vessel wall followed by the development of false aneurysms.

Some autopsy case studies and series of HIV-associated intracranial aneurysms,35-45 documented mainly in children, report similar microscopic features to those in extracranial vessels.

While this observation suggests that intracranial aneurysmal pathology is a continuum of the same disease process, some workers, however, have noted differences as follows: • variable absence of internal elastic lamina fragmentation • medial thickening with sub-intimal SMC deposition • controversial identification of viral protein, specifically gp 41, in the macrophages of the arterial wall, with inflammatory sparing of smaller leptomeningeal and parenchymal vessels

Fig. 3. Histopathology of HIV aneurysmal disease: active vasa vasorum inflammation (A), and luminal narrowing (*) (haematoxylin and eosin, 240×); vasa vasorum fibromuscular hyperplasia (B) (haematoxylin and eosin, 240×); peri-adventitial slit-like vascular channels with inflammatory cells (C); and haemosiderin pigment (arrows) (haematoxylin and eosin, 240×). Vessel wall (D) with fragmentation of the internal elastic lamina (arrows) (* = intima) (elastic van Gieson, 240×) and medial calcification (E) (von Kossa, 240×).

74

CARDIOVASCULAR JOURNAL OF AFRICA â&#x20AC;˘ Volume 26, No 2, March/April 2015

Bacterial infection is also hypothesised to play a minor pathogenetic role. Although secondary infection caused by bacteria, viruses and fungi have been implicated, this has not been conclusively demonstrated. In the series by Nair et al.,29 microorganisms were not identified, while in that of Marks and Kuskov,28 Staphylococcus aureus was isolated from peri-aneurysmal exudate.

It is debatable whether the latter was a surface contaminant.

Management In the current era, HIV-infected patients presenting with vascular pathology are managed by the standard guidelines of HIV-naĂŻve patients, with conservative management being reserved for patients with full-blown AIDS.3,4,26,47-49 The overall management of these patients poses a moral and ethical dilemma with regard to the appropriateness and timing of surgical intervention.

At present there are no universal guidelines. Emergencies are prioritised irrespective of immune status. The majority of patients are young, fit and able to tolerate major surgery.

Treatment should be individualised and priority given to patients with symptomatic aneurysms. Intra-operatively, false or true aneurysms are identified (Fig. 4A).3,4,26 Intervention is offered for symptomatic aneurysmal lesions, and involves either ligation of vessels in septic lesions and occluded distal vessels, or resection (Figs 4B) and restoration of arterial continuity (Fig. 4C) following aneurysmal excision.3,4 The ligation of carotid lesions seems to be well tolerated, as evidenced by Nair et al.,29 with little or no neurological sequelae peri-operatively. The choice of conduit, namely prosthetic or autogenous grafts, for surgical bypass remains controversial.29 The latter is plagued by the associated risk of deep-vein thrombosis in these patients.

Fig. 4. H IV aneurysm management: intra-operative left common carotid artery exposure (A, arrow) with aneurysm (*). Resected specimen (B) with aneurysm (arrow) and pseudo-aneurysm (*). Prosthetic interpositional graft (C, arrows). Endovascular management of a left superficial femoral artery pseudo-aneurysm (D, arrow) with a stent graft (E, bracket).

AFRICA

In selected patients with appropriate technical imaging criteria and poor physiological reserves, endovascular management with a stent-graft (Fig. 4D, E) constitutes a suitable alternative.

Anecdotal reports with small patient numbers have documented its selected use and immediate success.26,50,51 Complications of this modality include stent-graft sepsis, occlusion, endoleaks and missed opportunistic infections.4,52 Scholtz53 has raised concerns about this modality, from a radiological perspective, with regard to angiographic access, small-calibre vessels and contrast pooling in the multiple aneurysms. Despite these reservations, it remains an attractive alternative because it promotes flexibility of treatment options. Endovascular intervention represents technology in evolution, with unknown long-term results. Patient selection is therefore crucial; the procedure should be reserved for patients with poor physiological reserves.

There have been no comparative studies, to date, on surgery versus endovascular intervention in patients with HIV vasculopathy. Expertise in this sphere is at present anecdotal and has been confined to isolated case reports.54,55 From a technical perspective, these aneurysms may present a challenge in relation to their large size, vessel tortuosity, flow dynamics and specific anatomical location, especially in relation to outflow tracts that may originate in close proximity to, or from the aneurysm sac itself. The branch vessels of interest in this instance would include the vertebral, internal iliac and visceral arteries.

The rationale for endovascular intervention entails aneurysmal exclusion of the target vessel and preservation of laminar flow in the outflow tract. Endovascular devices to exclude these aneurysms include the use of covered or uncovered stents in the form of multi-layered compact cobalt,55 or open-cell nitinol mesh design. More recently, a novel idea of aneurysm exclusion using multi-layered stent technology without compromising branch vessel patency has been reported in HIV-infected patients.

The basis for this technique has been extrapolated from the pipeline embolisation device,54 which is used to treat intracranial aneurysms. Its successful usage has been described by Euringer et al.55 in a patient with multiple HIV-related aneurysms. The deployment of this type of stent achieves aneurysm exclusion and restoration of laminar flow with aneurysm autothrombosis as a result of strangulated flow.

This technique can, in theory, also be augmented with coiling to ensure complete thrombosis within the aneurysm sac. Success when utilising the multi-layered stent in this setting requires definition because the aneurysmal sac can be completely excluded with total sac content thrombosis or sac shrinkage with sluggish flow. According to the authors,55,56 the merit in this technique facilitates continuous branch vessel patency, especially the patency of visceral branches of the aorta. Sustained patency may require the use of long-term antiplatelet therapeutic agents such as clopidogrel. The effect of this type of anti-platelet therapy may be negated by some anti-retroviral agents,54 but it is possible to identify patients with this form of resistance prior to intervention.

The multi-layered stent has the technical limitations of a compact strut design, which precludes additive coiling and potential excessive foreshortening during deployment. This may result in a geographical miss. Although the endovascular approach is cushioned and not plagued by the physiological challenges of robust anaesthesia, blood loss and the peri-operative complications of contamination, wound sepsis and transfusion

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

requirements during operative surgery, the attractiveness is evidenced by a shorter hospital stay, and access to a lesion from a remote site free of contamination. The long-term durability of this form of intervention is unknown at present.

Prognosis and outcome The laboratory features are characterised by deranged CD4 counts, hyperglobulinaemia, inverted CD4/CD8 ratios and hypoalbuminaemia.29,31,47 Van Marle et al.47 attempted to correlate some of these parameters to surgical outcome and revealed that these markers were associated with a poorer prognosis, while Robbs and Paruk4 failed to demonstrate a correlation.

Peri-operative mortality rates have ranged from 9–10.6% in South Africa4 to 33% in Houston,57 where the majority (56%) of patients were intravenous drug abusers with challenges related to wound healing and sepsis. Lin et al.57 reported a late graft sepsis rate of 10% with prosthethic graft usage.

The long-term results are largely unknown as follow-up remains a problem. Furthermore, the majority of the reported cases were conducted in the pre-HAART era.

Occlusive disease Occlusive disease is a less studied entity that shares microscopic and laboratory features with its aneurysmal counterpart. It has an affinity for young males under 40 years of age. The limbs are usually involved, with the lower limbs involved more frequently than the upper limbs.3,4,47,48,58-60 The classic risk factors for occlusive vascular disease are less prevalent.46,58

Clinical manifestations

75

6B), mural fibrosis (Fig. 6C) and luminal organising thrombus (Fig. 6A) have been noted. In addition, viral proteins on the lymphocytes of arterial and aneurysmal tissue were seen but atherosclerosis was not identified.

Nair et al.59 found no evidence of atherosclerotic involvement of the vessel wall during macroscopic examination at surgery. Autopsy studies performed by Micheletti et al.61 on donor coronary vessels of 10 HIV-positive patients revealed linear calcium deposition in the internal elastic lamina, independent of intimal atherosclerosis and calcification, a microscopic feature supposedly unique to HIV-infected individuals. This feature is theorised to reflect arterial stiffening and may be associated with premature vascular aging and chronic illness in HIV-infected patients.

Management The management of HIV-infected patients who present with vascular pathology is congruent with the standard guidelines of HIV-naïve patients, with conservative management being reserved for patients with full-blown AIDS.3,4,47,48,58 Those patients presenting with acute arterial occlusion as a result of primary thrombosis are characterised by unfavourable outcomes with embolectomy. This is borne out in the study by Mulaudzi et al.,22 who demonstrated that embolectomy was often followed by re-thrombosis within 48 hours. In his study, 17/22 patients were treated by ablation, with a limb salvage rate of 27%.22 A possible reason for the poor outcome was explained by the persistence of the underlying vasculitic process despite management of the obstructing lesion.

Patients with chronic disease are imaged and treated with surgical bypass, catheter-directed therapy, or an ablation for

Patients may manifest acutely with primary thrombosis and clinical features of acute arterial occlusion. Chronic disease may present with features of critical ischaemia in the form of rest pain or gangrene in more than 50% of patients (Fig. 5A–C).

Anatomically, infra-inguinal disease is more common than aorto-iliac disease.

Imaging studies Duplex studies have demonstrated typical linear sub-intimal deposition of calcium in the vessel wall, classically described as a ‘string of beads’32 appearance (Fig. 5D), together with evidence of intraluminal thrombus in patients presenting acutely.

Mulaudzi et al.22 documented that additional imaging in this group of patients was non-contributory.

Invasive imaging using computed tomographic studies and angiography have shown that the contralateral vessels are usually disease free while the symptomatic limb vessels demonstrate multi-segment involvement, long-segment occlusions (Fig. 5E), poor distal run-off and an abundance of well-established collaterals (Fig. 5F).3,4,47,48,58,59

Pathology In the series by Mulaudzi et al.,22 36% of patients (n = 8) who had histopathological investigations had organised bland thrombus and an intense inflammatory reaction in the vessel lumen. On microscopic analysis of the occlusive lesions, medial scattered chronic inflammatory cells, focal medial calcification, destruction of the internal elastic lamina (Fig. 6A) and medial muscle, leucocytoclastic vasculitis of the vasa vasora (Fig.

Fig. 5. Clinical presentation of HIV occlusive disease: gangrene of the fifth digit (A, arrow); left forefoot (B); and entire foot (C). Duplex image of the superficial femoral artery (D), demonstrating a ‘string of beads’ pattern (arrowheads). Angiogram demonstrating left femoro-popliteal disease with occlusion (E, bracket), poor distal run-off (F, arrow), and abundant collaterals (F, *).

76

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

unsalvageable limbs. Post-operative wound healing and graft sepsis is not unusual.48 To overcome this shortcoming, van Marle et al.58 used silver-impregnated grafts for surgical bypass.

Immediate post-operative results were favourable.

Prognosis and outcome Attempts have been made to correlate serum albumin and CD4 counts with postoperative outcome in these patients but the results vary. Although a low CD4 count in association with hypoalbuminaemia correlated with a poor postoperative outcome,58 the overall 30-day mortality rate for acute and chronic occlusive disease attained by Robbs and Paruk4 was 23%, compared to a long-term mortality of 28.75% by van Marle et al.58 Furthermore, improved long-term survival in this grouping was negated by poor limb-salvage rates of 36.1%, with poor distal run-off being a contributory factor that precluded surgical bypass.58

Other HIV-associated vascular manifestations Spontaneous arteriovenous fistulae Arteriovenous fistulae may occur as a result of trauma or endovascular procedures. Spontaneous arteriovenous fistulae following HIV infection are rare, with anecdotal experiences reported in the literature.48,62 A case report detailing this clinical scenario related to a young patient presenting with a pulsatile mass of his right lower thigh.62 Angiography revealed a distal superficial artery lesion with pooling of contrast and delayed venous filling. The patient was treated surgically, with a successful outcome. Microscopy of the arterial wall with regard to the index patient demonstrated features similar to that observed in aneurysmal and occlusive disease.

Fig. 6. H istopathology of occlusive HIV disease: internal elastic lamina damage (A, arrows) and organising luminal thrombus (A, asterisks) (haematoxylin and eosin, 240×); leucocytoclastic vasculitis (B, arrow) (haematoxylin and eosin, 240×); and medial and adventitial fibrosis (C) (Masson trichrome, 240×).

AFRICA

Spontaneous cervical artery dissection An isolated case report described a spontaneous cervical artery dissection.63 This pathology was observed in the vertebral artery. The speculated pathogenesis was a structural defect in the arterial wall. Deficiencies of micronutrients, folate and cobalamine have been observed in HIV-infected patients.63 These deficiencies result in high circulating homocysteine levels that are thought to adversely affect the elastin content of the vessel wall, rendering it potentially vulnerable to a dissection.

Atherosclerosis in HIV-infected patients Evidence demonstrates that endothelial injury in HIV-infected patients occurs as a result of progression and severity of HIV infection per se.14 However, more recently, atherosclerosis has been documented following HIV infection and its management with HAART.64-70

The relationship between atherosclerosis and HIV infection Atherosclerotic disease is essentially an inflammatory event in the setting of classic cardiovascular risk factors, namely, smoking, hyperlipidaemia, family history, diabetes and hypertension. Accelerated atherosclerosis may evolve from the metabolic changes accompanying HIV infection, inclusive of hypercholesterolaemia, decreased high-density lipoprotein (HDL) cholesterol, elevated C-reactive protein levels and increased fibrinogen and plasminogen-activating inhibitor activity. Patients with these metabolic changes are more prone to coronary artery disease.64,65 In addition, cigarette smoking is a contributory factor.70

Fig. 7. Aneurysm from a patient on antiretrovirals with the metabolic syndrome: intimal inflammation (A, asterisks) (haematoxylin and eosin, 240×); and foam cells (B, arrows) (haematoxylin and eosin, 240×).

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

It has been hypothesised that atherosclerotic disease in HIV-infected patients is divided into two distinct phases.69 The first includes vessel wall inflammation (Fig. 7A, B), which cascades towards classic atheromatous features. The second includes progression of these morphological changes that are sustained by classic atheromatous risk factors.

The relationship between atherosclerosis and HAART In the current era of effective HAART, cardiovascular risk has emerged as a significant marker of morbidity and mortality among surviving HIV-positive patients. It is questionable whether HIV itself confers a significant cardiovascular risk, as some studies show conflicting results.68 Surrogate markers such as carotid intimo-medial thickness and endothelial dysfunction implicate HIV as an independent variable for cardiovascular risk. The potential mechanisms for coronary artery disease in HIV-infected patients arise from viral proteins that attract monocytes to the vessel wall, activation of which stimulates inflammation and retardation of cholesterol efflux.68 HAART acts through enzymatic inhibition of HIV. The currently available agents used to treat HIV-infected patients are classified into protease inhibitors, nucleoside and non-nucleoside analogues.64 The protease inhibitors cause metabolic complications, including hyperlipidaemia, central fat accumulation and insulin resistance, while the nucleoside inhibitors cause lipo-atrophy and mitochondrial damage. Non-nucleoside analogues cause lipid elevations. These complications are associated with a 26% risk of myocardial infarction per year on combination therapy.66 Newer agents without the risk of lipid elevation, are presently being studied. It remains to be seen whether this translates into cardiovascular risk reduction.

It is debatable, however, whether HAART contributes to endothelial injury. Studies supportive of the concept propose a triad composed of the virus, immune reconstitution and HAART, which initiates premature endothelial activation. This collaborative influence, which may affect the structural composition of arterial lesions in HIV patients, is borne out by variation in structural atheromatous changes as opposed to classical atheroma. This includes the presence of vessel wall inflammation, ultrasonographic variations and impaired flow-mediated dilatation.68 The latter reflects an inverse relation between the viral load and endotheliummediated vasodilation in association with some HAART agents.

This produces altered ankle–brachial indices (ABIs) that are regulated by the magnitude of dyslipidaemia.

The spectrum of atherogenic exposure spans short-term exposure reflected in acute impairment of brachial artery flowmediated dilatation, and long-term intimo-medial thickness in the carotid vasculature.67,71 These features are reflective of a metabolic atheromatous process that is governed by the HIV load.69 The availability of HAART has dampened the effect of opportunistic infections and promoted longevity in HIV-infected patients. As a result, HIV-infected patients have become increasingly prone to cardiovascular manifestations, particularly premature atherosclerosis, which is not associated with the conventional predisposing risk factors that are emphasised in HIV-naïve patients.64,65 HIV vasculopathy usually presents in the advanced stages of the disease.65,72 Robust data on the cardiovascular implications of viral infection is largely unknown, as most research has focused

77

on Caucasians infected with the HIV-B sub-type virus. The Hypertension in Africa Research Team73 conducted a prospective epidemiological study in 300 urban and rural patients and control subjects. In this study, the preliminary findings in untreated subjects demonstrated endothelial injury following viral invasion that resulted in endothelial inflammation and dysfunction, with elevated molecular markers and accelerated atherosclerosis that was exacerbated by low levels of HDL cholesterol. In the older patients there was evidence of rapid vascular aging, suggestive of diminishing vascular function as determined by pulse-wave velocity studies.

The treatment group on HAART demonstrated elevated systolic blood pressure without established systemic hypertension and stabilised lipid profiles with lipodystrophic changes. Soluble urokinase plasminogen activator, a soluble protein biomarker of progressive inflammation in HIV-1 infected patients, is a key mediator between inflammatory and metabolic derangements.

The levels were significantly elevated in treated, compared to untreated and control African patients, signifying a correlation with lipodystrophic changes following HAART over the threeyear follow-up study. The study results seem to suggest a deteriorating profile irrespective of HAART in the South African black population. Therefore greater insight into the adverse cardiovascular influence on the South African HIV population is necessary.73,74 Coronary artery calcium scoring, a non-invasive surrogate marker of atherosclerosis, serves as a predictor of myocardial infarction and coronary mortality. Studies in this sphere in HIV-infected patients are lacking. One reported study demonstrated a 6–8% incidence of coronary calcification.

Although HIV patients on HAART had higher calcium scores, these levels were, in effect, lower than those in untreated patients.67 A clinical manifestation of premature atherosclerosis is peripheral vascular disease (PVD). This is an emerging HIV-associated disorder with an unknown prevalence that has assumed prominence following the widespread availability of HAART. In a Swiss pilot study of 92 HIV-infected patients, Periard et al.75 detected a 20% (n = 19) incidence of subclinical atherosclerosis. Although these patients had normal resting ABIs, the exercise ankle systolic pressure (ASP) and ABI were deranged. The possible mechanisms underlying PVD relates to lifestyle-induced cardiovascular risk factors, combinations of antiretroviral therapeutic agents and HIV per se causing inflammatory lesions.

Management The medical management of HIV-associated vasculopathy includes HAART, control of hyperlipidaemia and eradication of traditional risk factors.

• The International AIDS society of USA recommends the use of HAART in asymptomatic individuals with CD4 cell counts < 350 cells/mm3. Other indications include a high viral load of > 100 000 copies/ml, active hepatitis B or C infections, and evidence of HIV nephropathy.67,76 The main objective of the initial choice of regime relates to viral suppression but adverse effects of the drug profiles should be considered in patients at high cardiovascular risk.

• Current recommendations, including lifestyle modifications such as dietary and exercise interventions, have demon-

78

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

strated decreased lipid values by 11–25% in HIV-infected patients. It is yet to be determined whether hyperlipidaemia in HIV-infected subjects should be considered a separate cardiovascular risk factor. In patients with carotid stenosis, statins have reduced intimo-medial thickness and cerebrovascular events, and have beneficial anti-inflammatory and pleiotropic properties.77 It is unknown whether these effects will materialise in HIV-infected patients beyond its lipidlowering potential.

• The classic risk factors, including smoking, diabetes, hypertension and hyperlipidaemia, are assuming greater significance in the HIV population.78 The atherosclerotic burden may be worsened under these circumstances, particularly in association with HAART. Patients should be counselled to stop smoking. Psychological and medicinal measures should be instituted, if indicated, together with medical optimisation of diabetes and hypertension, as in HIV-naïve patients.

The SMART study79 has shown that the risks outweigh the benefits in subjects on prolonged HAART who have elevated inflammatory markers. In addition, low CD4 counts were associated with increased surrogate markers for atherosclerosis and cardiovascular complications. Despite viral suppression, residual immunological effects may still confer a cardiovascular risk, which, in part, may be related to gut bacterial translocation.79 Current therapeutic options that are being explored to negate this adverse influence include novel therapies to modify T-cell activation and senescence, immunomodulation, and nutritional supplements to restore the gut flora. Although it is thought that short-term HAART may reduce cardiovascular risk, it is not known whether it will completely reverse HIV-related cardiovascular disease in the long term.

Current challenges The literature pertaining to the diverse spectrum of HIV-associated large-vessel vasculopathy has been confined to case reports,21,24,50,62,63 small patient series,26,30 and larger studies4,22,28,29,31,47,52,57-59 (Table 1).

The majority of caseloads have focused on clinical aspects of aneurysmal and occlusive disease that were observed mainly during the pre-HAART era, while, to date, the mechanisms underlying the pathological process remain theoretical without definitive isolation of an infective agent. Limitations in terms of patient numbers, inconsistencies in respect of specimen sampling for hypercoagulation, thrombophilic screens, histopathological sampling and microbiological and viral analyses have resulted in an incomplete understanding of HIV-associated vascular disease.

In future studies, attempts should be made to obtain representative diseased and juxtaposed, apparently normal, arterial wall samples to facilitate an improved understanding of the established and evolving disease spectrum, respectively.

Furthermore, molecular microbiological techniques for isolation and identification of infective organisms need ongoing development and optimisation to keep abreast with emerging technology.

Future directions The vascular endothelium and smooth muscle cell components are potential keys to unravelling some of the mysteries relating to the pathophysiology and microscopic changes in HIV-associated

AFRICA

vasculopathy. Animal models such as the transgenic mice model have been used to simulate arterial wall pathology following HIV invasion. This seems promising for improved understanding of the possible disease pathogenesis.

Various molecular markers and receptors are being studied at a cellular level with the aim of blocking the destructive biochemical pathways.80 Furthermore the availability of HAART, while offering a therapeutic solution, is not without its metabolic adversities that fuel the atherogenic process, thereby compounding risks. Newer agents with or without minimal metabolic complications are being investigated.

Presently there are no universal surgical guidelines for HIV-associated large-vessel vasculopathy. Surgical intervention remains the mainstay of therapy for aneurysmal and occlusive disease, however, with endovascular intervention reserved for a subset of patients with poor physiological reserves or who are too ill to tolerate anaesthesia. The exact role of endovascular intervention for this profile of patients requires definition and as yet there are no studies comparing surgery and endovascular intervention in HIV-infected patients. The prevalence of peripheral arterial disease in the HIV-positive population needs further investigation as asymptomatic patients manifest with subclinical atherosclerosis, as determined by deranged ABIs following exercise.81

Conclusion HIV is a pandemic with a widespread disease profile. The availability of HAART has offered a therapeutic lifeline for longevity but is negated by potential vascular complications.

As a result the incidence of vasculopathic manifestations over the last decade has increased. The challenge lies in unravelling the elusive aetiological and histopathological mysteries that surround HIV-associated large-vessel vasculopathy, and in so doing, assist with improved insight and knowledge in devising potential future therapeutic modalities that will enable improved vascular surgical practice in this context.

Table 1. Literature review of HIV-associated vasculopathy series4,22,28-31,47-48,52,57-59 Occlusive Aneurysms disease Publication MR MR year n (%) n (%) 1995 12 ND 0 N/A Marks and Kushov28 1999 10 30 0 N/A Nair, et al.29 2000 4 25 0 N/A Nair, et al.30 2000 0 N/A 22 0 Nair, et al.59 2000 28 7 0 N/A Nair, et al.31 2002 9 0 24 0 Van Marle, et al.47 2004 20 33 28 15 Lin, et al.57 2005 0 N/A 22 14 Mulaudzi, et al.22 2007 24 10.6 66 3.6 Botes and van Marle48 2009 0 N/A 91 20 Van Marle, et al.58 2010 111 9 115 11 Robbs and Paruk4 2012 22 14 0 N/A Padayachy and Robbs52 MR: mortality rate; n: patient numbers; N/A: not applicable; ND: not documented, %: patient percentage.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

Key messages • HIV infection is a multisystem disease with a diverse clinical spectrum.

• HIV-associated vasculopathy is a unique entity confined mainly to young individuals.

• The pathogenesis remains largely theoretical and entails a complex interplay between inflammatory, opportunistic infections and atherosclerotic components.

• The key histopathological findings include leucocytoclastic vasculitis of the vasa vasora, fragmentation of the internal elastic lamina, variable intimo-medial calcification, fibromuscular hyperplasia and transmural inflammation.

• The availability of HAART has altered the natural history of the disease profile, with atherosclerosis emerging as a potentially ominous therapeutic challenge.

• Patients are managed along standard vascular surgical guidelines as universal management guidelines have not reached consensus to date.

• Long-term results of intervention are uncertain because of suboptimal patient compliance.

• The exact indications for endovascular intervention require further study.

79

473–479.

12. Benjamin LA, Bryer A, Emsley HCA, Khoo S, Solomon T, Conner MD. HIV infection and stroke: current perspectives and future directions. Lancet Neurol 2012; 11(10): 878–890.

13. Guillevin L, Cohen P. Management of virus-induced systemic vasculitides. Curr Rheumatol Rep 2002; 4(1): 60–66.

14. Monseuz JJ, Charniot JC, Escaut L, et al. HIV-associated vascular diseases: structural and functional changes, clinical implications. Int J Cardiol 2009; 133(3): 293–306.

15. Nieuwhof CMG, Damoiseaux J, Tervaert JWC. Successful treatment of cerebral vasculitis in an HIV-positive patient with anti-CD25 treatment.

Ann Rheum Dis 2006; 65(12): 1677–1678.

16. Mu H, Chai H, Lin PH, Yao Q, Chen C. Current update on HIV-associated vascular disease and endothelial dysfunction. World J Surg 2007; 31(4): 632–643.

17. Maggi P, Ingrassia F, D’Annunzio M. Endothelial inflammatory disease and cardiovascular risk in HIV patients. HAART Correlated Pathol 2008; 1: 19–25.

18. Schecter AD, Berman AB, Yi L, et al. HIV envelope gp120 activates human smooth muscle cells. Proc Natl Acad Sci USA 2001; 98(18): 10142–10147.

19. Eugenin EA, Morgello S, Klotman ME, et al. Human Immunodeficiency Virus (HIV) infects human arterial smooth muscle cells in vivo and in vitro. Implications for the pathogenesis of HIV-mediated vascular disease. Am J Pathol 2008; 172(4): 1100–1111.

20. Gutierrez J, Glenn M, Isaacson RS, Marr AD, Mash D, Petito C.

We thank Mrs M Moodley for administrative support, Dr Y Sing for photographic assistance, the Bioethics Committee of the University of KwaZuluNatal for ethical approval (Protocol BF208/11) and the Medical Education Partnership Initiative (MEPI) for partial study funding.

Thinning of the arterial media layer as a possible preclinical stage in HIV vasculopathy: a pilot study. Stroke 2012; 43(4): 1156–1158.

21. Tilson MD 3rd, Withers L. Arterial aneurysms in HIV patients: molecular mimicry versus direct infection? Ann NY Acad Sci 2006; 1085(Nov): 387–391.

References 1.

Bennet NJ, Gilroy SA, Bronze MS, Glatt A, Windle ML. HIV disease. emedicine.medscape.com.2011.http://emedicine.medscape.com/ article/211316-overview. Accessed December 23/2013.

2.

Busari O, Opadijo O, Adeyemi O. Cardiac diseases in HIV and AIDS.

22. Mulaudzi TV, Robbs JV, Pillay W, et al. Thrombectomy in HIV related peripheral arterial thrombosis: a preliminary report. Eur J Vasc Endovasc Surg 2005; 30(1): 102–106.

23. Pipitone N, Salvarani C. The role of infectious agents in the pathogenesis of vasculitis. Best Pract Res Clin Rheumatol 2008; 22(5): 897–911.

24. Du Pont JR, Bonavita JA, DiGiovanni RJ, Spector HB, Nelson SC.

Internet J Cardiol 2008; 5(2): 1–13.

Acquired immunodeficiency syndrome and mycotic abdominal aneu-

3.

Mulaudzi TV. HIV-associated vasculopathy. CME 2009; 27(7): 320–322.

rysms: a new challenge? Report of a case. J Vasc Surg 1989; 10(3):

4.

Robbs JV, Paruk N. Management of HIV vasculopathy – a South African experience. Eur J Vasc Endovasc Surg 2010; 39(Suppl 1): S25– S31.

5.

26. Heikkinen MA, Dake MD, Alsac J-M, Zarins CK. Multiple HIV-related

acquired immune deficiency syndrome. Pediatr Pathol 1987; 7(3):

aneurysms: open and endovascular treatment. J Endovasc Ther 2005;

Chetty R. Vasculitides associated with HIV infection. J Clin Pathol 2001; 54(4): 275-–278.

7.

Johnson RM, Barbarini G, Barbaro G. Kawasaki-like syndromes and other vasculitic syndromes in HIV-infected patients. AIDS 2003; 17(Suppl 1): S7–S82.

8.

Naidoo NG, Beningfield SJ. Other manifestations of HIV vasculopathy.

S Afr J Surg 2009; 47(2): 46–53.

9.

J Surg 1990; 77(8): 863–868.

Joshi VV, Pawel B, Connor E, et al. Arteriopathy in children with 261–275.

6.

254–257.

25. Bayley AC. Surgical pathology of HIV infection: lessons from Africa. Br

Patel N, Patel N, Khan T, Patel N, Espinoza LR. HIV infection and clinical spectrum of associated vaculitides. Curr Rheumatol Rep 2011; 13: 506–512.

10. Stankovic K, Miailhes P, Bessis D, Ferry T, Broussolle C, Séve P. Kawasaki-like syndromes in HIV-infected adults. J Infect 2007; 55(6): 488–494.

11. Woolgar JD, Robbs JV. Vascular surgical complications of the acquired immunodeficiency syndrome. Eur J Vasc Endovasc Surg 2002; 24(6):

12(3): 405–410.

27. Kuskov SI. Arterial pseudoaneurysms as the initial clinical manifestitation of HIV Infection (Abstract). East Cent Afr J Surg 2006; 11(1): 94–98.

28. Marks C, Kuskov S. Pattern of arterial aneurysms in acquired immunodeficiency disease. World J Surg 1995; 19(1): 127–132.

29. Nair R, Abdool-Carrim ATO, Chetty R, Robbs JV. Arterial aneurysms in patients infected with human immunodeficiency virus: a distinct clinicopathology entity? J Vasc Surg 1999; 29(4): 600–607.

30. Nair R, Robbs JV, Naidoo NG. Spontaneous carotid artery aneurysms.

Br J Surg 2000; 87(2): 186–190.

31. Nair R, Robbs JV, Naidoo NG, Woolgar J. Clinical Profile of HIV– related aneurysms. Eur J Vasc Endovasc Surg 2000; 20(3): 235–240.

32. Woolgar JD, Ray R, Maharaj K, Robbs JV. Colour Doppler and grey scale ultrasound features of HIV-related vascular aneurysms. Br J Radiol 2002; 75(899): 884–888.

80

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

33. Demopoulos D, Hendson W, Technau K, Cilliers AM. Vasculopathy in HIV-infected children- a case series. SAfr J Child Health 2009; 3(1): 27–30.

34. Calabrese LH, Estes M, Yen-Lieberman B, et al. Systemic vasculitis in association with human immunodeficiency virus infection. Arthritis Rheum 1989; 32(5): 569–576.

35. Blignaut G, Loggenberg E, de Vries C. The radiological appearance of intracranial aneurysms in adults infected with the human immunodeficiency virus (HIV). S Afr J Rad 2014; 18(1): 1–4.

36. Bonkowsky JL, Christenson JC, Nixon GW, Pavia AT. Cerebral aneurysms in a child with acquired immune deficiency syndrome during rapid immune reconstitution. J Child Neurol 2002; 17: 457–460.

37. Bulsara KR, Raja A, Owen J. HIV and cerebral aneurysms. Neurosurg Rev 2005; 28: 92–95.

38. Julie AA, Erickson JC, Lowry KJ. Cerebral aneurysmal arteriopathy associated with HIV infection in an adult. Clin Infect Dis 2006; 43: e46–e50.

39. Mazzoni P, Chiriboga CA, Millar WS, Rogers A. Intracerebral aneurysms in human immunodeficiency virus infection: case report and literature review. Pediatr Neurol 2000; 23: 252–255.

40. Modi G, Ranchod K, Modi M, Mochan A. Human immunodeficiency virus associated intracranial aneurysms: report of three adult patients with an overview of the literature. J Neurol Neurosurg 2008; 79: 44–46.

41. Mnguni P. Vascular lesions associated with HIV. S Afr J Radiol 2006; 10(4): 14–17.

42. O’Charoen P, Hesselink JR, Healy JF. Cerebral aneurysmal arteriopathy in an adult patient with acquired immunodeficiency syndrome. Am J Neuroradiol 2007; 28: 938–939.

AFRICA

of multiple HIV-related aneurysms using multilayer stents. Cardiovasc Interven Radiol 2012; 35: 945–949.

56. Sfyroeras GS, Dalainas I, Giannakopoulos TG, Antonopoulos K, Kakisis JD, Liapis CD. Flow-diverting stents for the treatment of arterial aneurysms. J Vasc Surg 2012; 56: 839–846.

57. Lin PH, Bush RL, Yao Q, et al. Abdominal aortic surgery in patients with human immunodeficiency virus infection. Am J Surg 2004; 188(6): 690–697.

58. Van Marle J, Mistry PP, Botes K. HIV-occlusive vascular disease. S Afr J Surg 2009; 47(2): 36–42.

59. Nair R, Robbs JV, Chetty R, Naidoo NG, Woolgar J. Occlusive arterial disease in HIV-infected patients: a preliminary report. Eur J Vasc Endovasc Surg 2000; 20(4): 353–357.

60. Robbs JV. Pathogenesis and pathology of HIV-related large-vessel disease. S Afr J Surg 2009; 47(2): 44–45.

61. Micheletti RG, Fishbein GA, Currier JS, Singer EJ, Fishbein MC. Calcification of the internal elastic lamina of coronary arteries. Mod Pathol 2008; 21(8): 1019–1028.

62. Nair R, Chetty R, Woolgar J, Naidoo NG, Robbs JV. Spontaneous arteriovenous fistula resulting from HIV arteritis. J Vasc Surg 2000; 33(1): 186–187.

63. Felicio AC, Silva GS, dos Santos WAC, Pieri A, Gabbai AA, Massaro AR. Spontaneous artery dissection in a patient with human immunodeficiency virus (HIV) infection. Arq Neuropsiquiatr 2006; 64(2A): 306–308.

64. Barry R. The future of HIV vasculopathy when our patients are on antiretroviral therapy. S Afr J Surg 2009; 47(2): 58–60.

65. Barry R. How does vascular disease associated with retroviral infection

43. Patsalides AD, Wood LV, Atac GK, Butman JA, Patronas NJ.

differ from atherosclerosis? S Afr J Anaesthes Analg 2010; 16(1): 51–53.

Cerebrovascular Disease in HIV-infected paediatric patients: neuroim-

66. Friis-Møller N, Sabin CA, Weber R, et al. Data collection on adverse

aging findings. Am J Radiol 2002; 179: 999–1003.

44. Stanley A, Candy S, Levin C, Heckmann JM. The complexity of HIV vasculopathy. S Afr Med J 2012; 102(6): 474–476.

45. Tipping B, De Villiers L, Candy S, Wainwright H. Stroke caused by human immunodeficiency virus-associated intracranial large-vessel aneurysmal vasculopathy. Arch Neurol 2006; 63: 1640–1642.

46. Chetty R, Batitang S, Nair R. Large artery vasculopathy in HIV-positive patients: another vasculitic enigma. Hum Pathol 2000; 31(3): 374–379.

47. Van Marle J, Tudhope L, Weir G, Botes K. Vascular Disease in HIV/ AIDS patients. S Afr Med J 2002; 92(12): 74–78.

48. Botes K, van Marle J. Surgical intervention for HIV related vascular disease. Eur J Vasc Endovasc Surg 2007; 34(4): 390–396.

49. Blyth D. Human immunodeficiency virus disease and cardiac surgerywhere are we? SAHeart 2009; 6(4): 210–220.

50. George R, Przybojewski S, Theron S. Endovascular treatment of femoral artery pseudoaneurysm in a HIV positive patient – a case report. Eur J Vasc Endovasc Surg Extra 2007; 13: 79–81.

51. Piccinato CE, Cherri J, Moriya T, Souza AC. Pseudoaneurysms of large arteries associated with AIDS. Sao Paulo Med J/Rev Paul Med 1999; 117(4): 165–170.

52. Padayachy V, Robbs JV. Carotid artery aneurysms in patients with human immunodeficiency virus. J Vasc Surg 2012; 55(2): 331–337.

53. Scholtz L. Vascular manifestations of HIV/AIDS. Cardiovasc Interven Radiol 2004; 27(5): 422–426.

54. Delgado Almandoz JE, Crandall BM, Fease JL, Scholz JM, Anderson RE, Kadkhodayan Y, Tubman DE. Successful endovascular treatment

events of anti-HIV drugs (DAD) study group. Combination antiretroviral therapy and the risk of myocardial infarction. N Engl J Med 2003; 349(21); 1993–2003.

67. Ho JE, Hsue PY. Cardiovascular manifestations of HIV infection. Heart 2009; 95(14): 1193–1202.

68. Lo J, Grinspoon S. Cardiovascular disease in HIV-infected patients: does HIV infection in and of itself increase cardiovascular risk? Curr Opin HIV AIDS 2008; 3(3): 207–213.

69. Maggi P, Maserati R, Antonelli G. Atherosclerosis in HIV patients: a new face for an old disease? AIDS Rev 2006; 8(4): 204–219.

70. Niaura R, Shadel WG, Morrow K, Tashima K, Flanigan T, Abrams DB. Human immunodeficiency virus infection, AIDS, and smoking cessation: the time is now. Clin Infect Dis 2000; 31(3): 808–812.

71. Hakeem A, Bhatti S, Cilingiroglu M. The spectrum of atherosclerotic coronary artery disease in HIV patients. Curr Atheroscler Rep 2010; 12(2): 119–124.

72. Madiba TE, Muckart DJJ, Thomson SR. Human immunodeficiency disease: how should it affect surgical decision making? World J Surg 2009; 33(5): 899–909.

73. Fourie CMT, Van Rooyen JM, Schutte AE. HIV infection and cardiovascular risk in black South Africans. Cardiovasc J Afr 2011; 22(3): 117–118.

74. Fourie C, Van Rooyen J, Pieters M, Conradie K, Hoekstra T, Schutte A. Is HIV-1 infection associated with endothelial dysfunction in a population of African ancestry in South Africa? Cardiovasc J Afr 2011; 22(3): 134–140.

of three fusiform cerebral aneurysms with the pipeline embolization

75. Periard D, Cavassini M, Taffé P, et al. Swiss HIV Cohort Study. High

device in a patient with dilating HIV vasculopathy. J Neurointerv Surg

prevalence of peripheral arterial disease in HIV-infected persons. Clin

2014; 6(2): e12.

55. Euringer W, Südkamp M, Rylski B, Blanke P. Endovascular treatment

Infect Dis 2008; 46: 761–767.

76. Hammer SM, Eron JJ Jr, Reiss P, et al. International AIDS Society-

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

81

USA. Antiretroviral treatment of adult HIV infection: 2008 recom-

79. Triant VA, Grinspoon SK. Immune dysregulation and vascular risk in

mendations of the International AIDS Society-USA. J Am Med Assoc

HIV-infected patients: implications for clinical care. J Infect Dis 2011;

2008; 300(5): 555–570.

77. Paraskevas KI, Hamilton G, Mikhailidis DP. Statins: an essential component in the management of carotid artery disease. J Vasc Surg 2007; 46(2): 373–386.

78. Paraskevas KI, Katsiki N, Tzovaras AA, Koupidis SA, Mikhailidis DP. Peripheral arterial disease and HIV-positive patients. Angiology 2011; 62(1): 7–9.

203(4): 439–441.

80. Gilliam BL, Riedel DG, Redfield RR. Clinical use of CCR5 inhibitors in HIV and beyond. J Transl Med 2010; 9(Suppl): S9–S14.

81. Qaqa AY, DeBari VA, Isbitan A, et al. The role of post-exercise measurements in the diagnosis of peripheral arterial disease in HIV-infected patients. Angiology 2011; 62(1): 10–14.

82

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

AFRICA

Conference Proceedings Development of the roadmap and guidelines for the prevention and management of high blood pressure in Africa: Proceedings of the PASCAR Hypertension Task Force meeting: Nairobi, Kenya, 27 October 2014

Abstract Africa has one of the fastest growing economies in the world.

The economic changes are associated with a health transition characterised by a rise in cardiovascular risk factors and complications, which tend to affect the African population at their age of maximum productivity.

Recent data from Africa have highlighted the increasing importance of high blood pressure in this region of the world. This condition is largely underdiagnosed and poorly treated, and therefore leads to stroke, renal and heart failure, and death. Henceforth, African countries are taking steps to develop relevant policies and programmes to address the issue of blood pressure and other cardiovascular risk factors in response to a call by the World Health Organisation (WHO) to reduce premature deaths from non-communicable diseases (NCDs) by 25% by the year 2025 (25 × 25).

The World Heart Federation (WHF) has developed a roadmap for global implementation of the prevention and management of raised blood pressure using a health system approach to help realise the 25 × 25 goal set by the WHO. As the leading continental organisation of cardiovascular professionals, the Pan-African Society of Cardiology (PASCAR) aims to contextualise the roadmap framework of the WHF to the African continent through the PASCAR Taskforce on Hypertension.

The Taskforce held a workshop in Kenya on 27 October 2014 to discuss a process by which effective prevention and control of hypertension in Africa may be achieved. It was agreed that a set of clinical guidelines for the management of hypertension are needed in Africa. The ultimate goal of this work is to develop a roadmap for implementation of the prevention and management of hypertension in Africa under the auspices of the WHF. Keywords: hypertension, roadmap, guidelines, implementation, monitoring, Africa

High blood pressure (BP) is the most common single risk factor for cardiovascular-related events and deaths worldwide. Over the past decade, Africa has been characterised as the world’s fastestgrowing economy,1 but is also in a precipitous health transition.

Indeed, the estimated number of hypertensive people in Africa in 2008 was nearly four times higher than the 2005 estimate of the World Health Organisation regional office for Africa (WHO-AFRO), and it is projected to be 125.5 million by 2025.2 This increasingly high prevalence of hypertension is coupled with very poor awareness, and low treatment and control rates

across Africa.3-6 Hypertension therefore stands in this region of the world as the most common cause of stroke, congestive heart failure (HF) and chronic kidney disease, and poses additional challenges on the longstanding burden associated with communicable diseases and the ongoing HIV/AIDS pandemic.

Since the United Nations high-level meeting to raise international awareness on the fact that premature deaths from non-communicable diseases (NCDs) reduce productivity, curtail economic growth, and pose a significant social challenge in most countries,7 African governments are opening political windows that need to be used as an opportunity to develop and implement policies for the prevention and control of hypertension and other NCDs. As the leading continental organisation, the Pan-African Society of Cardiology (PASCAR) has made a real evaluation of the condition and prioritised hypertension as the highest area of priority action to reduce heart disease and stroke on the continent.8 The PASCAR roadmap on hypertension aims to develop simple and practical hypertension management guidelines, and improve health systems and policies within the World Heart Federation (WHF) hypertension roadmap framework. This implies that African needs are not just for further consensus statements reviewing the evidence, but practical guidance on how to implement strategies that translate existing knowledge into effective action and improve blood pressure control and cardiovascular (CV) health in general, as suggested by the WHF primary goal of a 25% reduction of CV mortality by the year 2025.

It is in this vein that the PASCAR Hypertension Task Force meeting was held in Nairobi, Kenya, on 27 October 2014.

This event brought together hypertension specialists, guideline methodologists and clinicians, who reviewed existing guidelines and mapped the next steps in the development of a roadmap for the control and management of hypertension in Africa.

Welcome address and review of existing guidelines Prof Bongani Mayosi, president of the PASCAR, welcomed the attendees and thanked them for the time and effort required to attend this inaugural meeting, and for their willingness to contribute to this most important programme in Africa. He said that in 2013, PASCAR identified priority interventions to ministries of health for the prevention of heart disease, diabetes and stroke in the African region, called the 10 ‘best buys’, and hypertension was identified as number one priority.8 Prof Mayosi’s address was followed by a short speech by Dr Anastase Dzudie, chair of the Task Force, who set the scene

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

for the meeting. He indicated that the meeting’s purpose was to constitute the Task Force, identify all stakeholders, define consensus on scoping, planning and method, and agree on time lines with milestones. He said that the outcome will be to develop an African hypertension roadmap, one of the key steps being the development of an African guideline for hypertension management with a monitoring and implementation strategy, taking into account the local barriers.

As co-chair of the World Heart Federation (WHF) Working Group on Hypertension, Prof Neil Poulter presented the WHF Hypertension (HT) roadmap. He reiterated that raised BP is considered to be the biggest single risk factor contributing to global death and global burden of disease, a situation that is expected to worsen if urgent action is not taken. During the WHO meeting in Geneva in May 2013, the World Health Assembly, addressing NCDs, adopted as primary goal a 25% reduction in NCD deaths by 2025 (25 × 25). Among targets to achieve this goal, reduction of high BP by 25% by 2025 is a priority aim. He further said that the priority actions to reach this target will include opportunistic screening, prevention and re-screening for high-normal BP, improved treatment for HT, and education on adherence. The WHF strategy will avoid duplication of effort in different regions of the world and seeks to be synergistic with PASCAR’s initiative.

Prof Basden Onwubere, president elect, International Forum for Hypertension Prevention and Control in Africa (IFHA) and chair, International Society of Hypertension (ISH) low- and middle-income countries committee presented the 2003 IFHA recommendations for prevention, diagnosis and management of hypertension and cardiovascular risk factors in sub-Saharan Africa.9 He indicated that these guidelines are currently under review through a committee chaired by Prof YK Seedat (South Africa). He concluded that PASCAR’s idea of a task force is commendable and that it is desirable for composition and nomenclature of the task force to reflect the partnership with already existing hypertension groups with significant efforts on high BP management in Africa.

Dr Ruth Cornick (South Africa) presented the ‘practical approach to care kit’ (PACK), a clinical practice guideline for primary adult care, including hypertension. Her presentation addressed critical issues to consider when developing clinical guidelines in order to ensure their implementability and effectiveness, which included assessing user requirements, simplicity, keeping up to date, tackling the system and choosing an effective implementation strategy.

Pof Elijah Ogola (Kenya): Kenya has embarked on an AstraZeneca-supported programme called Healthy Heart Africa (HHA), which will focus initially on primary healthcare providers. The pilot programmes, which were developed with input from local medical experts, will start at the end of 2014.

The pilot programmes will include creating public awareness and also using technology to track those at risk. The next step is to formally endorse a ‘national primary care guideline’ and expand to a more comprehensive guideline with interaction through this PASCAR initiative.

Prof Brian Rayner (South Africa) presented a comparative review of the NICE, the JNC 8 and the International Society on Hypertension in Blacks (ISHIB) consensus guidelines. The consensus points were on BP targets/goals that will be less aggressive than before. Also, there is a much closer agreement

83

on optimal drug treatment (ACE or ARB, CCB, diuretic, or all three).

Prof Abdoul Kane (Senegal) presented a comparative review of the French and the European Society of Cardiology (ESC)/European Society of Hypertension (ESH) guidelines on hypertension. He put forward that ESC/ESH guidelines were state of the art on hypertension (72 pages), while the French guidelines (four pages) were easy to read and apply to clinical practice.

Dr Marc Twagirumukiza (Rwanda) presented strategies for cardiovascular risk assessment of hypertensive patients in low-resources settings. The Framingham and other similar studies provide the basis for the equations upon which many of the existing cardiovascular risk (CVR)-score algorithms have been developed, however such risk-profiling charts lack universal applicability. Particularly in low-resource countries, the major drawbacks to existing CVR-score algorithms include the selection and definition of the risk factors to be included in given specific populations,10 but also the required laboratory tests, which are not always accessible or available in local settings.11 The Community Observational Study, Bukavu ObServ Cohort Study, which will follow a population from 2012 to 2021

Group photo. Front (left to right): Benedict Anisiuba (PASCAR Council, Nigeria), BA Serigne (PASCAR Council, Senegal), Ana Olga Mocumbi (PASCAR Council, Mozambique), Bongani Mayosi (president PASCAR), Dike Ojji (co-chair, PASCAR Hypertension Task Force), Anastase Dzudie (chair, PASCAR Task Force on Hypertension).

Middle (left to right): Toure Ali Ibrahim (PASCAR Council, Niger), Abdoul Kane (Senegal), Albertino Damasceno (Mozambique), Elijah Ogola (PASCAR Council and chair of Hypertension programme in Kenya), Basden Onwubere (president elect, IFHA), George Nel (PASCAR executive officer).

Back (left to right): Awad Mohamed (PASCAR Council, Sudan), Brian Rainer (ex-officio president, South Africa Hypertension Society), Aletta Schutte (South Africa), Marc Twagirumukiza (African Society of Hypertension Initiative), Aletta Schutte (president, Southern African Hypertension Society), and Neil Poulter (co-chair, World Heart Federation Working Group on the Hypertension roadmap).

84

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

and assess the impact of risk factors in an African population, will address these challenges and provide risk factors to be included in a tailored CVR algorithm. However this may not help for the urgent up-coming guideline process.

In recent studies, Gaziano and co-authors12 documented how we can address the lack of cholesterol levels in the Framingham score algorithm. Beyond this CVR profiling challenges, the presenter documented the role of affordability of medicines in African settings (Peer and others 2014), and within the medicines cost scope, the quality of hypertension drugs was also discussed.13,14 Finally, the crucial question to be addressed by the hypertension management guideline is to establish what the management strategy could be for hypertension in African settings within the context of limited resources, to reduce stroke, and heart and renal complications. Here the task-shifting process and the contribution of trained non-physician healthcare workers was identified as one approach among others to reliably and effectively assess cardiovascular risk in primary care settings (where there are no attending physicians) and detect subjects to be referred to qualified health facilities.14 Prof Alta Schutte (South Africa) presented the American Society of Hypertension (ASH)/International Society of Hypertension (ISH) clinical practice guidelines for management of high BP, a 12-page document published in 2014 with an easyto-follow algorithm. She made mention of the fact that these guidelines specifically consider hypertension in black patients to be common, to occur at a younger age, to tend to cause more severe complications such as stroke and renal disease, and to respond well to calcium channel blockers (CCBs) and diuretics, and that blacks have a tendency to be salt sensitive. It was however noticeable that the ASH/ISH recommendations for black patients conflicted with those from JNC 8.

Prof Albertino Damasceno (Mozambique) suggested ways to formulate recommendations in an actionable way in Africa. The best ways would include primary prevention, with integrated care for chronic diseases from primary healthcare with task shifting, use of the global risk strategy (move the curve left, reduce mortality), use of therapies that are available, cheap and effective (diuretics and CCBs), and a long-term monitoring strategy aimed at improving long-term compliance of the patients.

Prof Basden Onwubere (IFHA, Nigeria) called the attention of the group to how to resist the temptation of writing a textbook. Desirable attributes of a guideline would be validity, reproducibility, clarity, clinical applicability and flexibility.

Meticulous documentation of evidence is a key step. Guidelines should be clearly written and concise enough, without losing important evidence-based messages. Proper scoping ensures that target professional groups are guided by guidelines when developed, and not controlled or confused. Regular reviews of guidelines should be scheduled.

Prof Neil Poulter reviewed the methodology for guideline development, the act of translating evidence into recommendations, and defining the strength of recommendation.

Consideration needs to be given to the approach to be used; ‘systematic’ or ‘comprehensive’. The systematic approach is complex, time and resource consuming, and possibly duplicates what has already been done. Recommendations are then graded as high, moderate and low according to the level of evidence. It is remarkable that only two HT guidelines have really followed

AFRICA

a systematic review process, the NICE in 2011, and the JNC 8 in 2013. A pragmatic guideline addresses the majority, if not all clinical questions relevant to the topic. The pragmatic approach refers to substantial bodies of work and reflects on those areas of perceived difference (due to difference in target audience or more recent evidence). Consensus (expert opinion) is a substantial and crucial aspect that is well accepted in this methodology. A good option for PASCAR might be in between the two approaches, and to contextualise the WHF hypertension roadmap.

Overall discussion and ways forwards The group recognised the urgent need to develop a hypertension roadmap for Africa that will help improve BP control and reduce renal disease, heart disease and stroke in the region. A consensus was achieved on the practicability of the WHF global hypertension roadmap, which could be a reference guide for the PASCAR group. It was observed that due to lack of evidence, there was controversy on whether and how patients with grade 1 hypertension (systolic of 140–159 and/or diastolic of 90–99 mmHg) should be managed.

A consensus was reached on PASCAR’s commitment to design and conduct clinical trials that would answer these questions in the future, as the research element of the roadmap process. The group felt that for the urgent step of developing an African guideline for the management of hypertension, it was appropriate to focus additional effort on locally available national/international African guidelines or data rather than redoing international work (such as comprehensive guidelines).

Questions to be addressed in the African guidelines for the management of raised blood pressure would include: (1) in African adults with hypertension, does initiating antihypertensive pharmacological therapy at specific BP thresholds improve health outcomes? (2) In African adults with hypertension, does treatment with antihypertensive pharmacological therapy to a specified BP goal lead to improvements in health outcomes? (3) In African adults with hypertension, do various antihypertensive drugs or drug classes differ in comparative benefits and harms on specific health outcomes? (4) In African adults with hypertension, what is the best cost-effective antihypertensive drug in the primary care setting?

The guidelines will be a single document with a summary, targeting adult hypertension and written for primary care level of practice. The document will be valid, reproducible, clear, simple and concise enough to be easily adopted by various African countries and implemented and monitored regularly. Algorithms for primary healthcare workers will be developed and different formats of the documents are desirable in accordance with each healthcare level.

The following key stakeholders will be included in the development process: PASCAR, IFHA, AFRAN, national professional societies (HT and cardiac), WHF, WHO-AFRO (chronic disease branch), WHO-EMRO, Africa Union (social cluster of the AU), all policy makers, International Society of Hypertension in Blacks (ISHIB), World Hypertension League (WHL), ISH (low- and middle-income countries), and ESH (low- and middle-income countries). Finally, the group adopted a timeline, activities and deliverables in the development of the roadmap with guidelines that are relevant to Africa over an 18-month period.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

85

Anastase Dzudie, aitdzudie@yahoo.com Douala General Hospital and Buea Faculty of Health Sciences, Douala, Cameroon

Bongani Mayosi, Bongani.mayosi@uct.ac.za Department of Medicine, Groote Schuur Hospital and University of Cape Town, Cape Town, South Africa

Dike Ojji, dikeojji@yahoo.co.uk Department of Medicine, Faculty of Health Sciences, University of Abuja / Cardiology Unit, Department of Medicince, University of Abuja Teaching Hospital, Gwagwalada, Abuja, Nigeria

on behalf of the PASCAR Hypertension Task Force members.

Benedict Chukwuemeka Anisiuba, banisiuba@yahoo.co.uk Department of Medicine, University of Nigeria Teaching Hospital, Enugu, Nigeria

References 1.

chart/2011/01/daily_chart Accessed January 2014.

2.

BA Serigne Abdou, serigneabdou2@gmail.com Le Dantec University Teaching Hospital, Dakar, Senegal Ruth Cornick, ruth.cornick@uct.ac.za Knowledge Translation Unit, University of Cape Town Lung Institute and Department of Medicine, University of Cape Town, Cape Town, South Africa Albertino Damasceno, tino_7117@hotmail.com Faculty of Medicine, Eduardo Mondlane University, Maputo, Mozambique

sion in sub-Saharan Africa by sex, age and habitat: an estimate from population studies. J Hypertens 2011; 29(7): 1243–1252.

3.

Systematic Review and Meta-Analysis. Hypertension 2014 Nov 10.

4.

Adeloye D, Basquill C. Estimating the prevalence and awareness rates of hypertension in Africa: a systematic analysis. PLoS One 2014; 9(8): e104300.

Ogah OS, Rayner BL. Recent advances in hypertension in sub-Saharan Africa. Heart 2013; 99(19): 1390–1397.

6.

Dzudie A, Kengne AP, Muna WF, Ba H, Menanga A, Kouam Kouam C, et al. Prevalence, awareness, treatment and control of hypertension in

Awad Mohamed, awad90000@gmail.com Division of Cardiology, University of Khartoum, Sudan

Elijah Ogola, onogola@gmail.com Department of Clinical Medicine and Therapeutics, University of Nairobi, Kenya

Ataklte F, Erqou S, Kaptoge S, Taye B, Echouffo-Tcheugui JB, Kengne AP. Burden of Undiagnosed Hypertension in Sub-Saharan Africa: A

5.

George Nel, george@medsoc.co.za Executive officer, PASCAR

Twagirumukiza M, De Bacquer D, Kips JG, de Backer G, Stichele RV, van Bortel LM. Current and projected prevalence of arterial hyperten-

Abdoul Kane, abdoulkane.cardio@gmail.com Faculty of Medicine, University of Dakar, Senegal Ana Olga Mocumbi, amocumbi@yahoo.com Instituto Nacional de Saude (National Health Institute, Mozambique) and University Eduardo Mondlane, Maputo, Mozambique

Africa’s impressive growth. http://wwweconomistcom/blogs/daily-

a self-selected sub-Saharan African urban population: a cross-sectional study. Br Med J Open 2012; 2(4).

7.

World Health Organization. United Nations high-level meeting on noncommunicable disease prevention and control. . http://wwwwhoint/ nmh/events/un_ncd_summit2011/en/ Accessed January 18, 2014.

8.

Mayosi BM. The 10 ‘Best Buys’ to combat heart disease, diabetes and stroke in Africa. Heart 2013; 99(14): 973–974.

Basden Onwubere, basden.onwubere@unn.edu.ng Department of Medicine, University of Nigeria Teaching Hospital, Enugu, Nigeria Harun Otieno, africaheartmd@gmail.com Section of Cardiology, Department of Medicine, Aga Khan University Hospital, Nairobi, Kenya Brian Rainer, Brian.rayner@uct.ac.za Division of Nephrology and Hypertension, Department of Medicine, Groote Schuur Hospital and University of Cape Town, Cape Town, South Africa Aletta Schutte, Alta.Schutte@nwu.ac.za Hypertension in Africa Research Team (HART); MRC Unit for Hypertension and Cardiovascular Disease, North-West University, Potchefstroom, South Africa Ibrahim Toure Ali, pr_toure@yahoo.fr Cardiovascular Department, Faculty of Medical Sciences, University Abdou Moumouni, Niamey, Niger Marc Twagirumukiza, twamarc@gmail.com College of Medicine and Health Sciences, University of Rwanda, Kigali, Rwanda and African Society of Hypertension (AfSoH) Initiative Neil Poulter, n.poulter@imperial.ac.uk International Centre for Circulatory Health, Imperial College, London, UK [Prof Poulter is supported by the National Institute for Health Research (NIHR) Biomedical Research Centre based at the Imperial College Healthcare, NHS Trust and Imperial College London. The views expressed are those of the author and not necessarily those of the NHS, the NIHR or the Department of Health]

9.

Lemogoum D, Seedat YK, Mabadeje AF, Mendis S, Bovet P, Onwubere B, et al. Recommendations for prevention, diagnosis and management of hypertension and cardiovascular risk factors in sub-Saharan Africa.

J Hypertens 2003; 21(11): 1993–2000.

10. Modesti PA, Agostoni P, Agyemang C, Basu S, Benetos A, Cappuccio FP, et al. Cardiovascular risk assessment in low-resource settings: a consensus document of the European Society of Hypertension Working Group on Hypertension and Cardiovascular Risk in Low Resource Settings. J Hypertens 2014; 32(5): 951–960.

11. Peer N, Lombard C, Steyn K, Gaziano T, Levitt N. Comparability of total cardiovascular disease risk estimates using laboratory and nonlaboratory based assessments in urban-dwelling South Africans: the CRIBSA study. S Afr Med J 2014; 104(10): 691–696.

12. Gaziano TA, Pandya A, Steyn K, Levitt N, Mollentze W, Joubert G, et al. Comparative assessment of absolute cardiovascular disease risk characterization from non-laboratory-based risk assessment in South African populations. BMC Med 2013; 11: 170.

13. Twagirumukiza M, Cosijns A, Pringels E, Remon JP, Vervaet C, van Bortel L. Influence of tropical climate conditions on the quality of antihypertensive drugs from Rwandan pharmacies. Am J Trop Med Hyg 2009; 81(5): 776–781.

14. Twagirumukiza M, van Bortel LM. Management of hypertension at the community level in sub-Saharan Africa (SSA): towards a rational use of available resources. J Hum Hypertens 2011; 25(1): 47–56.

86

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

AFRICA

Case Reports Spontaneous coronary artery dissection associated with fibromuscular dysplasia Anthony J Dalby, Lewis J Levien

Abstract This case presentation concerns a woman known to have fibromuscular dysplasia (FMD) who presented with an acute coronary syndrome (ACS). The coronary angiogram was considered to be normal. However, as spontaneous coronary artery dissection (SCAD) has a close association with FMD, subsequent meticulous review of the angiogram revealed a dissection within the circumflex coronary artery. SCAD causes 10% of ACS seen in women under 55 years of age.

Both FMD and SCAD are underdiagnosed and SCAD may be overlooked or misdiagnosed on coronary angiography. The recommended management of SCAD differs from that of the usual presentations of ACS. For this reason, one should be alert to the possibility of SCAD when confronted by ACS in a younger woman, especially when she is known to have FMD.

exercise-induced palpitations for which she was on treatment with a beta-blocker. She was also on hormone replacement therapy with a fixed combination of estradiol and drospirenone.

Four years earlier she had undergone bilateral iliac artery angioplasties by one of us (LJL) for symptomatic FMD. At that time her angiogram showed the typical changes of iliac FMD (Fig. 1) as well as FMD involving her renal arteries. In addition both carotid arteries manifested ultrasound features, suggesting FMD. Four months prior to this presentation she had been assessed by a cardiologist (AJD) for bouts of left-sided chest pain unrelated to exertion that would last two to three hours at a time and were associated with nausea. She was a non-smoker with no history of hypertension or diabetes. Her total serum cholesterol was 5.4 mmol/l with a low-density lipoprotein cholesterol level

Keywords: acute coronary syndromes, fibromuscular dysplasia, spontaneous coronary artery dissection Submitted 30/10/14, accepted 22/1/15 Cardiovasc J Afr 2015; 26: 86–90

www.cvja.co.za

DOI: 10.5830/CVJA-2015-009

The average age of women presenting with acute coronary syndrome is 72.7 + 11.3 years.1 Acute myocardial infarction, an unusual occurrence in younger women, is more frequently associated with non-atherosclerotic conditions than the infarcts encountered in men or older women. A large number of non-atherosclerotic causes of myocardial infarction have been recognised. This case report concerns an acute myocardial infarction caused by spontaneous coronary artery dissection in a woman known to have fibromuscular dysplasia (FMD).

Case report The patient was a 51-year-old post-menopausal Caucasian woman who had been diagnosed with mitral valve prolapse and

Milpark Hospital, Johannesburg, South Africa Anthony J Dalby, FCP (SA), FACC, FESC, ajd@hot.co.za

Sunninghill Hospital, Johannesburg Lewis J Levien, MB BCh, FCS (SA), PhD Med)

Fig. 1. The patient’s iliac angiogram before angioplasty showing the ‘string of beads’ deformity of the vessel lumen with alternate stenosis and beading. Typically the beads extend beyond the normal lumen diameter.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

87

Fig. 2. T he electrocardiogram obtained on admission, showing inferolateral ST-segment elevation and ST-segment depression in the anterior leads.

of 3.5 mmol/l. Her father had died of a myocardial infarct aged 65 years. Her blood pressure was 120/75 mmHg. No clinical or electrocardiographic abnormality was detected.

She went mountain biking on the day of her presentation. She described the sudden onset of left-sided chest pain radiating to the left side of her neck, shoulder and arm, starting immediately after she had crested a hill. The pain was still present when she arrived in the emergency room 90 minutes later.

The clinical examination was unremarkable. Her pulse rate was 80 beats/min and her blood pressure was 111/71 mmHg. The resting electrocardiogram showed ST-segment elevation of 1–2 mm in S2, S3, aVF and V4–6 with ST-segment sag in V1– V3 (Fig. 2), consistent with a diagnosis of acute posterolateral myocardial infarction. She was treated with aspirin, clopidogrel

and enoxaparin and immediately thereafter transferred to the cardiac catheterisation laboratory for coronary angiography.

The left ventriculogram showed minor hypokinesia of the inferior wall. Her coronary arteries were considered to be patent with good distal run-off (Fig. 3). Her hs-troponin T had been 29 ng/l when she presented and rose to 351 ng/l over the next 150 minutes. Conservative medical treatment was continued and the patient was admitted to the coronary care unit where she ran an uneventful course.

She left hospital on day three on beta-blockade and dual antiplatelet therapy intended to be continued for 12 months.

She was advised to discontinue hormone replacement therapy.

She has remained asymptomatic in the two months since her discharge.

Fig. 3. T he coronary angiogram obtained on admission. Left coronary artery in right anterior oblique and left anterior oblique projections and right coronary artery in left anterior oblique projection.

88

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

Discussion Non-atherosclerotic coronary artery disease (NACAD) arises in a number of diverse conditions (Table 1), of which not all are associated with apparently normal appearances on the coronary angiogram. In a series reviewing a large number of coronary angiograms, it was noted that only 2.3% had been performed in women under the age of 50 years; 42.9% of this subgroup had presented with an acute coronary syndrome and 37.3% had an elevated troponin level. While slightly more than half had normal vessels, atherosclerotic disease was present in 30.5%, and 13.0% had NACAD.2 Table 1. Causes of non-atherosclerotic coronary artery disease (NACAD) Spontaneous coronary artery dissection (SCAD) Fibromuscular dysplasia (FMD) Ehlers-Danlos type IV Marfan’s syndrome Coronary FMD Ectasia Vasculitis Systemic lupus erythematosis Takayasu’s arteritis Coronary spasm Prinzmetal angina Cocaine use Embolism Any source of cardio-embolism Takotsubo or stress cardiomyopathy Congenital anomaly Myocardial bridging Uncertain aetiology

AFRICA

FMD is a disease of uncertain aetiology.3 It manifests as a non-inflammatory, non-atherosclerotic fibrous proliferation most commonly involving the arterial media (80–90%), although it may affect the intima (10%) or adventitia/peri-arterial tissue (< 5%).4,5 The condition is predominantly encountered in middleaged women (female-to-male ratio 9:1), although it may be encountered in children and adolescents.

FMD appears to have a genetic basis as 7–11% of the firstdegree relatives of patients with FMD are similarly affected.6 Hormonal influences or developmental ischaemia arising from the vasa vasorum also have been considered as a possible cause.3 The renal arteries are affected in 58–75% of cases, the carotid/ vertebral arteries in 32% and other arteries in 10%.4 FMD has been reported to be present in 2.6–4.4% of the renal arteries of transplant donors.7 FMD most commonly causes hypertension due to renal artery stenosis, accounting for approximately 10% of all cases of renovascular hypertension. The development of kidney failure is rare.4 FMD less frequently causes stroke due to carotid or vertebral artery dissection, or claudication due to involvement of the iliac arteries. Intracranial aneurysms have been observed.

The mesenteric, upper (particularly brachial) or lower limb (iliac) arteries may be affected. Coronary involvement has been regarded as uncommon.

FMD may present with any of a large variety of symptoms depending upon the location and severity of the vascular lesion/s. Hypertension, headache, pulsatile tinnitus, dizziness, a cervical bruit and neck pain are the most frequent.5 Because FMD presents with non-specific symptoms, it is perceived as a rare disease and is poorly understood by clinicians, which often results in delays in diagnosis, frequently by several years.5

Fig. 4. M agnified still-frame views (right anterior oblique, left anterior oblique and left lateral) from the patient’s initial angiogram demonstrating the long dissection within the circumflex artery (arrows indicate the dissection).

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

The diagnosis of FMD depends almost exclusively on the angiographic appearances of the affected vessel/s. The ‘string of beads’ deformity of the arterial lumen is typical, but luminal narrowing, arterial tortuosity with kinks, coils or loops, or aneurysm formation may be present.5 Phenotypic differences have been described between patients with multifocal (‘string of beads’) and unifocal (a single isolated stenosis) lesions.8 Despite the abnormal vascular architecture, the functional significance of the lesions of FMD cannot be established from the angiogram. Intravascular ultrasound imaging or measurement of the pressure gradient across the lesions is more valuable.5 The ‘string of beads’ deformity is seen infrequently in coronary FMD. More commonly, the coronary vessels may appear normal, demonstrate dissection with either an intimal tear or an intramural haematoma, an abrupt reduction in vessel calibre with a long segment narrowing distally, or an unusual tortuosity.9 Multivessel involvement of the coronary arteries has been described. Diffuse and typically smooth stenoses may be confused with atherosclerotic coronary artery disease.10 The diagnosis of coronary FMD relies upon the demonstration of the typical angiographic features in an extracardiac vascular territory.

There is a strong association between FMD and spontaneous coronary artery dissection (SCAD). SCAD is present in 10% of women under the age of 55 years who present with an ACS. Women with SCAD are younger and have fewer risk factors for atherosclerotic coronary disease than those without, and 78% have features of FMD.11 In a series reporting on 50 patients with SCAD, 98% were women. The average age was 51.0 ± 9.6 years.

Definite evidence of FMD was found in 86% of patients.12 A third study found that 60–70% of SCAD patients had extracoronary vascular abnormalities.13 The onset of SCAD has been associated with emotional distress, isometric exercise and the post-partum state.2,14 SCAD presents as an ACS, either as non-ST-segment elevation (70%) or ST-segment elevation myocardial infarction (30%).12 It has been proposed that intravascular imaging be strongly considered in patients suspected of SCAD.9 Optical coherence tomography reveals a thicker-than-normal dissection flap consisting of both intima and media.15 SCAD may recur in as many as one-sixth of patients, rising to 20% in women after a pregnancy. Although some have regarded the post-ACS course as benign,16 a subgroup analysis of the GENESIS PRAXY study found that SCAD doubled the death and rehospitalisation rates at 12 months.13 The 10-year composite rate of death, heart failure, myocardial infarction and recurrent SCAD has been estimated at 47%.17 Once the close association between FMD and SCAD was appreciated, the patient’s coronary angiogram was reviewed meticulously. A frame-by-frame analysis of various views revealed the presence of a previously undetected long dissection within the circumflex, which was only fleetingly visible when the angiogram was viewed in ciné mode (Fig. 4).

The frequent misdiagnosis of SCAD from coronary angiography has been noted previously. The dissection may be missed or incorrectly interpreted as due to atherosclerosis.

While intravascular ultrasound (IVUS) and optical coherence tomography (OCT) vividly demonstrate the presence of coronary dissection, SCAD may be overlooked in most patients when

89

depending solely on the ciné-angiogram for diagnosis.15,16 There is no specific therapy for coronary FMD nor is there consensus on the treatment of SCAD. SCAD heals spontaneously over time. In cases in which late follow-up angiography has been performed, the coronary vessels have been seen to resume a normal appearance.2 Acute intervention with balloon angioplasty or stenting of the affected segment carries the risk of extruding thrombus into the false lumen and propagating the dissection to unaffected arterial segments.14 The technical failure rate with percutaneous intervention in SCAD is 35%.17 In this setting, IVUS and/or OCT may play a valuable role in identifying the entry tear and allowing for highly localised stenting to seal the intima.15 However, given the fragility of the vessel wall in SCAD, caution is advisable when using intravascular imaging techniques. It is recommended that coronary intervention should be reserved for only those patients with reduced coronary flow or ongoing ischaemia. As our patient’s chest pain settled completely, as the ECG returned to normal and as there was unobstructed coronary flow, stenting of her dissection was deemed inappropriate.

Fibrinolysis and glycoprotein IIb/IIIa inhibitors also should be avoided during the acute presentation. In the absence of clinical trials, it is recommended that the patient receive dual antiplatelet therapy to maintain vessel patency, beta-blockade to diminish vascular wall stress, and an angiotensin converting enzyme inhibitor or angiotensin receptor blocker should the treatment of hypertension be needed. Statin treatment has no proven role in the management of FMD. Smoking should be avoided as it may aggravate FMD.5 Oestrogen therapy also should be avoided unless there is a strong indication to use it.

Women of child-bearing age who experience an ACS due to SCAD require an accurate diagnosis and counselling about the risk of future pregnancy.14 Expert opinion is that strenuous exertion should be avoided. The patient with SCAD should be investigated for the presence of FMD in the other commonly affected vascular territories, namely renal, carotid, mesenteric and iliac arteries. Treatment of these lesions is indicated when accompanied by symptoms.

Conclusion SCAD is a not-infrequent cause of acute coronary syndrome in women under the age of 55 years. The close association between SCAD and FMD strongly suggests that they are causally linked. Both FMD and SCAD are underdiagnosed and may elude detection during coronary angiography. For this reason, intravascular imaging with OCT could be considered when a diagnosis of SCAD seems likely. Despite the absence of randomised clinical trial evidence to guide management, the expert recommendations regarding the pharmaceutical and interventional treatment of SCAD differ importantly from the guidelines applicable to patients with the usual causes of ACS. Patients with SCAD should be investigated for the presence of FMD in other vascular territories. Conversely, a high index of suspicion of SCAD is warranted in patients with known FMD who present with ACS. Mr Quinton Barber of AstraZeneca is thanked for supplying certain of the references quoted.

90

References 1.

3.

10. Lempereur M, Gin K, Saw J. Multivessel spontaneous coronary artery

coronary syndrome outcomes. Coron Artery Dis 2014; Epub ahead of

dissection mimicking atherosclerosis. J Am Coll Cardiol Intv 2014; 7: 11. Cheema AN, Al Lawati H, Bagai A, et al. Spontaneous coronary artery

nary artery disease in young women. Can J Cardiol 2014; 30; 814–819.

dissection in young women presenting with acute coronary syndrome:

DOI:10.1016/j.cjca.2014.01.011.

angiographic findings from the GENESIS PRAXY Study. J Am Coll

Stanley JC, Wakefield TW. Arterial fibrodysplasia. In: Rutherford R

tion. Prevalence of predisposing conditions including fibromuscular

with renal artery stenosis due to fibromuscular dysplasia of the renal

dysplasia in a tertiary center cohort. J Am Coll Cardiol Intv 2013; 6: 44

3652.2014.02.01.

are common in patients with spontaneous coronary artery dissection:

state of the science and critical unanswered questions. A scientific

Analysis of 72 patients at a tertiary referral center. J Am Coll Cardiol

1048–1078. DOI:10.1161/01.cir.0000442577.96802.8c.

Perdu J, Boutouyrie P, Bourgain C, et al. Inheritance of arterial lesions in renal fibromuscular dysplasia. J Hum Hypertens 2007; 21; 393–400.

PMID: 17330059.

7.

Andreoni KA, Weeks SM, Gerber DA, et al. Incidence of donor renal fibromuscular dysplasia: does it justify routine angiography?

Transplantation 2002; 73; 1112–1116. PMID: 11965042.

8.

Savard S, Steichen O, Azarine A, et al. Association between 2 angiographic subtypes of renal artery fibromuscular dysplasia and clinical characteristics. Circulation 2012; 126: 3062–3069. DOI:10.1161/

9.

–52. DOI:10.1016/j.jcin.2012.08.017.

13. Prasad M, Liang J, Hayes S, et al. Extracoronary vascular abnormalities

Olin JW, Gornik HL, Bacharach JM, et al. Fibromuscular dysplasia: statement from the American Heart Association. Circulation 2014; 129:

6.

Cardiol 2014; 63: A3 (Abstract).

12. Saw J, Ricci D, Starovoytov A et al. Spontaneous coronary artery dissec-

Chrysant SG, Chrysant GS. Treatment of hypertension in patients arteries. Cardiovasc Diagn Ther 2014; 4: 36–43. DOI:10.3978/j.issn.2223-

5.

e87–88. DOI:10.1016/j.jcin.2013.12.207.

Saw J, MD, Aymong E, Mancini GBJ, et al. Nonatherosclerotic coro-

(ed). Vascular Surgery. 6th edn. Phildelphia: Elsevier, 2005: 432–452.

4.

2014; 64: 1033–1046. DOI: 10.1016/j.jacc.2014.07.014.

Perl L, Bental T, Assali A, et al. Impact of female sex on long-term acute print. PMID: 25144669.

2.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

2014; 63, A2057 (Abstract).

14. Tweet MS, Hayes S, Gulati R, et al. The risk of pregnancy after spontaneous coronary artery dissection. J Am Coll Cardiol 2014; 63, A5 (Abstract).

15. Alfonso F, MD, Paulo M, Gonzalo N, et al. Diagnosis of spontaneous coronary artery dissection by optical coherence tomography. J Am Coll Cardiol 2012; 59: 1073. DOI:10.1016/j.jacc.2011.08.082.

16. Alfonso F, Bastante T, Rivero F, et al. Spontaneous coronary artery dissection – from diagnosis to management. Circ J 2014; 78: 2099–2110.

DOI:10.1253/circj.CJ-14-0773.

17. Tweet MS, Hayes SN, Pitta SR, et al. Clinical features, management, and

CIRCULATIONAHA.112.117499.

prognosis of spontaneous coronary artery dissection. Circulation 2012;

Michelis KC, MD, Olin JW, DO, Kadian-Dodov D, et al. Coronary

126: 579–588. DOI:10.1161/CIRCULATIONAHA.112.105718/-/DC1.

artery manifestations of fibromuscular dysplasia. J Am Coll Cardiol

Erratum We regret the error in Figure 1 of the review article in Cardiovasc J Afr 25(6): 288

South African hypertension practice guideline 2014 Hypertension guideline working group: YK Seedat, BL Rayner, Yosuf Veriava This is the correct figure.

Measure BP on at least three occasions BP 140–159/ 90–99 mmHg with ≥ 3 risk factor, diabetes, TOD or complications

BP ≥ 160/ 100 mmHg*

Lifestyle modification for 3–6 months

Lifestyle modification and commence monotherapy, review in 4–6 weeks

Lifestyle modification and commence two drugs preferably in fixed-drug combination, review in 4–6 weeks

Not at goal

Not at goal

Not at goal

BP 140–159/ 90–99 mmHg with < 3 risk factors, no TOD or complications

*BP > 180/110 mmHg refer to section 9

Fig. 1. Overview of approach to treatment.

Add third drug/ optimise doses of drugs

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

91

Sudden cardiac death in low-resource settings: lessons from a resuscitated cardiac arrest Aimé Bonny, Sylvie Ndongo Amougou, Dominique Noah Noah, Marthe-Liliane Mbenoun, Kamilu Karaye Case report

Abstract We report on the case of an adult black African who was resuscitated from several cardiac arrests but suffered behavioural impairment, and discuss diagnostic pitfalls. The aetiology of coronary free lesion myocardial infarction with depressed left ventricular function was diagnosed when the patient travelled abroad. The low prevalence of recognised sudden cardiac arrest (SCA), as well as the lack of diagnostic and appropriate resuscitation facilities in parts of sub-Saharan Africa lead to the mismanagement of victims. Increased awareness of SCA and its causes is urgently needed.

Keywords: sudden cardiac arrest, resuscitation, sub-Saharan Africa Submitted 8/2/14, accepted 3/2/15 Cardiovasc J Afr 2015; 26: 91–95

www.cvja.co.za

DOI: 10.5830/CVJA-2015-020

Several cases of sudden cardiac arrest (SCA) in sub-Saharan Africa have been reported.1-5 However the real burden of sudden cardiac death (SCD) in this part of the world is unknown.

Reports of cardiopulmonary resuscitation (CPR) scenarios in these developing countries are also a matter of curiosity.

SCA management needs specific diagnostic work-up, which is not widely available in sub-Saharan Africa (SSA). Poor management of such resuscitated victims could also impact negatively on the patients’ quality of life (QoL). The following case report is on an aborted SCA with unusual clinical features, management and outcomes.

District Hospital Bonassama, Douala, Cameroon Aimé Bonny, MD, aimebonny@yahoo.fr

Centre Hospitalier Universitaire de Yaoundé, services de réanimation, Yaoundé, Cameroun Sylvie Ndongo Amougou, MD

Service de Gastroentérologie, Hospital Central de Yaoundé, Cameroun Dominique Noah Noah, MD

Centre des maladies respiratoires de Douala, Cameroun Marthe-Liliane Mbenoun, MD

Department of Medicine, Bayero University/Aminu Kano Teaching Hospital, Kano, Nigeria Kamilu Karaye, MD

A 57-year-old black African male living in Cameroon had experienced several cardiac arrests. He was rescued from his first attack by bystanders who provided basic life support (BLS) cardiopulmonary resuscitation (CPR) manoeuvres in the aircraft during a flight. The patient was on his way from Cameroon to Morocco to undergo an extensive cardiac work-up for chest pain from suspected myocardial infarction (MI).

Blood tests and coronary angiography were normal. The electrophysiological study was normal.

A few months later, he experienced another witnessed cardiac arrest and was successfully rescuscitated by bystanders. His blood pressure then was 139/84 mmHg, heart rate was 89 beats/ minute (bpm) and he had no signs of heart failure.

Fasting blood tests showed a glycaemic status of 1.06 g/l (0.59 mmol/l), potassium level of 3.5 mmol/l, creatinaemia of 11.5 mg/l (101.66 mmol/l) and C-reactive protein (CRP) of 12 mg/l.

The electrocardiogram (ECG) displayed a sinus rhythm with a heart rate of 58 bpm, narrow QRS and negative T wave in the lateral leads (Fig. 1). A two-dimensional echocardiogram (2D echo) showed moderate left ventricle dilatation (LV end-diastolic diameter of 60 mm) with a left ventricular ejection fraction (LVEF) of 50% and normal wall motion. ECG monitoring revealed repetitive non-sustained ventricular tachycardia (NSVT) (Fig. 2, top). Two days later, sustained VT (Fig. 2, bottom) was aborted by electrical cardioversion. Amiodarone, loading dose of 200 mg/day, in addition to bisoprolol 5 mg daily were administered. The patient’s discharge was decided on seven days later, with the recommendation of further investigations.

Although no event was recorded during four weeks of in-patient monitoring, the patient refused to be discharged as he was afraid of dying suddenly at home.

Finally, after an event-free period of eight weeks, the patient was referred to France for a more detailed work-up. The ECG there displayed sinus rhythm and negative T waves in the lateral leads. Blood tests were within normal limits. Two-dimensional echo showed normal LV diameter, antero-basal hypokinesia and postero-basal dyskinesia. LVEF was 50% and LV filling pressure was normal. Right ventricular and pulmonary pressures were normal.

Cardiac magnetic resonance imaging (MRI) showed normal cardiac output index (2.53 l/min/m2), antero-lateral, inferolatero-basal and mild LV akinesia, LVEF of 35%, transmural late enhancement in the akinetic segments with a thickness of < 5 mm, and sub-endocardial mild anteroseptal late enhancement, compatible with small sequelae of acute MI. Subsequently, MRI revealed two MI sizes in the territories of the circumflex and anterior interventricular arteries (Fig. 3). A coronary computed tomography angiogram (CTA) showed normal coronary arteries.

The final diagnosis was ischaemic cardiomyopathy with lesion-free coronary arteries, LV dysfunction and ventricular tachyarrhythmia-related cardiac arrest. An implantable

92

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

AFRICA

Fig. 1. E lectrocardiogram of the patient a few hours after successful cardiopulmonary resuscitation. The repolarisation pattern displays negative T waves in the lateral leads.

cardioverter-defibrillator (ICD) was placed. The short-term follow up of three months did not show any clinical event. The patient was scheduled for ICD interrogation every six months and records will be released.

Discussion Cardiac arrest is characterised by an abrupt loss of effective blow flow, sufficient to cause immediate loss of consciousness, leading immediately to death if untreated.6 This case raises several points

Table 1. Leading causes of SCA described in sub-Saharan Africa Type of Size Country publication Journal and year (patients) 1 Ivory Coast, Article J Cardiovasc Electro6 Benin, DR physiol 2008 Congo Ouali S, Clinical and electrophysiological profile of Tunisia Article Pacing Clin Electro24 et al.

Brugada syndrome in the Tunisian population physiol 2011 2 HCM Hiam I, Mort subite du sportif au Sénégal: etude Senegal Meeting PASCAR conference, 5 et al rétrospective sur 8 ans abstract Dakar 15–20 May, 2013 3 IHD Rotimi O, Sudden unexpected death from cardiac causes Nigeria Article Int J Cardiol 198l 50 et al. in Nigerians: a review of 50 autopsied cases 4 Paediatric Arthur JT, Sudden deaths: cardiac and non-cardiac in Ghana Article West Afr J 1995 16 sample et al. children in Accra 5 Schneider Causes of sudden death in Addis Ababa, Ethiopia Article Ethiop Med J 2001 63 J, et al.

Ethiopia 7 Unknown Houenassi Aspect epidémiologiques de la mort subite Benin Meeting PASCAR conference, 23 M, et al. dans la ville de Parakou abstract Dakar 15–20 May, 2013 8 Multiple causes Talle MA, SCD in sub-Saharan Africa: a 12-month Nigeria Meeting PASCAR conference, 17 (IHD, DCM, et al. review in University of Maiduguri Teaching abstract Dakar 15–20 May, 2013 LQTS, RHD) Hospital, Nigeria 9 Multiple causes Thiam I, La mort subite cardio-vasculaire au sénégalSenegal Meeting PASCAR conference, 235 (DCM, IHD, et al.

Etude rétrospective sur 7 ans abstract Dakar 15–20 May, 2013 RHD) 10 LQTS Leye M, QT long congenital syncopal évocateur de Senegal Abstract PASCAR conference, 1 et al.

Syndrome de Jervell Lange Nielsen Dakar 15–20 May, 2013 11 NCCM Kamotho A rare presentation of non-compaction Kenya Abstract PASCAR conference, 1 C, et al. cardiomyopathy in Kenya Dakar 15–20 May, 2013 BRS, Brugada syndrome; HCM, hypertrophic cardiomyopathy; IHD, ischaemic heart disease; DCM, dilated cardiomyopathy; LQTS, long QT syndrome; RHD, rheumatic heart disease; NCCM, non-compaction cardiomyopathy.

Main disease BrS

Authors Bonny A, et al.

Title Brugada syndrome in pure black Africans

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

93

Fig. 2. A pical view of cardiac magnetic resonance imaging showed antero-lateral and infero-latero-basal and mild left ventricular akinesia, in conjunction with transmural late enhancement in the akinetic segments with a thickness of < 5 mm.

of interest regarding the epidemiology and management of SCA in SSA: aetiology, ability to perform CPR, healthcare facilities, physician’s awareness to manage such patients and QoL of resuscitated victims living without complete diagnostic work-up.

Coronary artery disease (CAD) is the most common cause of SCA in western countries.7 The pathogenesis of acute coronary syndrome (ACS) has changed and more cases of MI with ‘normal’ coronaries, such as in this case report, are seen with angiography.8 Almost all leading causes of SCA have been described in sub-Saharan Africa (Table 1). However, many patients who have died suddenly and in whom the diagnosis of MI was suspected, were not fully investigated.

This case report is a typical scenario of incomplete work-up in a remote African setting. Detailed cardiac work-up including 2D echo, CT angiography, coronary angiography and cardiac MRI was possible abroad. In this framework, the diagnosis of MI-related ventricular tachycardia was confirmed. Furthermore, it is worth noting that this case of SCA due to ischaemic cardiomyopathy without coronary atherosclerosis has not been reported in SSA.

As data of SCA are limited in Africa, secondary prevention through the introduction of widespread CPR is not frequently done. Therefore resuscitated victims of cardiac arrest are rare, their long-term outcome remains unknown, and the aetiology needs to be established.

The patient in this case is still alive, courtesy of BLS manoeuvres provided by bystanders. This demonstrates that even in remote, low-resource settings, SCA can be aborted through CPR attempts.

Given the cost of diagnostic and therapeutic tools used for patients experiencing arrhythmic disorders, the management of patients is in its early stages in SSA. Although a few SSA countries now have the availability of echocardiography, stress ECG, Holter monitoring, coronary angiography, CT angiography and MRI, the majority in this part of the world cannot provide their population with such advanced healthcare facilities.

Therefore, physicians who seldom treat SCA patients are not fully competent to provide adequate treatment and

94

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

AFRICA

Fig. 3. E CG recordings showing premature ventricular contractions a few days after the patient had experienced SCA. Top: two-lead recording showing paired premature ventricular contractions. Bottom: one-lead recording registered sustained ventricular tachycardia, which was amended by external electrical cardioversion.

counselling, as this case report has shown. An experienced physician would have avoided the long in-hospital stay that this patient had without any specific management. Refusing to be discharged without medical indications is a manifestation of the patient’s altered cognitive function, which had significant cost implications. Indeed, ‘paying for care’ in low-resource settings has great financial implications.

The life-threatening conditions of the patients in three reported cases would have impacted negatively on their QoL. This would have been a source of significant stress to the family.9,10

Lessons from the guidelines The most common electrical mechanism of cardiac arrest is ventricular fibrillation or pulseless ventricular tachycardia, but substantial numbers of cases of cardiac arrest begin as severe bradyarrhythmias, asystole or ventricular tachycardia.

The guidelines6,11 state the following: • Cardiopulmonary resuscitation should be implemented after contacting a response team (class I, level of evidence A).

• For victims of ventricular tachyarrhythmic mechanisms of cardiac arrest who have recurrences after maximal defibril-

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

lating shocks (generally 360 J for monophasic defibrillators), intravenous amiodarone should be used as the preferred antiarrhythmic drug for achieving a stable rhythm (class I, level of evidence B).

• The implantable cardioverter defibrillator (ICD) is an effective therapy to reduce mortality. It reduces SCD in patients with LV dysfunction due to prior a MI, who present with haemodynamically unstable sustained VT, who are receiving chronic optimal medical therapy, and who have reasonable expectation of survival with a good functional status for more than one year (class I, level of evidence A).

The patient reported herein met all the above indications.

However, he was able to have an ICD only because his management was completed overseas. National health policies in African countries with embryonic healthcare facilities should encourage the establishment of advanced healthcare centres for the vulnerable population who cannot afford healthcare overseas.

SCD is a reality in Cameroonians and Africans in general, and the absence/shortage of qualified personnel and facilities to manage it competently calls for urgent improvement in public health policies to reduce the burden of the scourge.

References

Conclusion

7.

1.

95

Ouali S, Boughzela E, Haggui A, Haouala H, Battikh K, Ben Ameur Y, et al. Clinical and electrophysiological profile of Brugada syndrome in the Tunisian population. Pacing Clin Electrophysiol 2011; 34: 47–53.

2.

Rotimi O, Fatusi AO, Odesanmi WO. Sudden cardiac death in Nigerians – the Ile-Ife experience. West Afr J Med 2004; 23: 27–31.

3.

Schneider J, Bezabih K. Causes of sudden death in Addis Ababa, Ethiopia. Ethiop Med J 2001; 39: 323–340.

4.

Arthur JT. Sudden deaths: cardiac and non-cardiac in children in Accra.

West Afr J Med 1995; 14: 108–111

5.

Bonny A, Tonet J, Fontaine G, Lacotte J, Coignard E, Duthoit G, et al.

Brugada syndrome in pure black Africans. J Cardiovasc Electrophysiol 2008; 19: 421–426.

6.

Zipes DP, Camm AJ, Borggrefe M, et al. ACC/AHA/ESC 2006 guidelines for management of patients with ventricular arrhythmias and the prevention of sudden cardiac death: a report of the American College of Cardiology/American Heart Association Task Force and the European Society of Cardiology Committee for Practice Guidelines (writing committee to develop guidelines for management of patients with ventricular arrhythmias and the prevention of sudden cardiac death).

European Heart Rhythm Association; Heart Rhythm Society. J Am Coll Cardiol 2006; 48: e247–346.

This case report shows that coronary artery disease is a reality in Africa, with a fatal outcome in the absence of optimal healthcare facilities. Public health policies aiming to develop cardiopulmonary resuscitation, improve physician awareness, as well as provide for cardiovascular disease prevention and control are reliable approaches to reduce SCA occurrence and improve survivors’ QoL.

Engdahl J, Holmberg M, Karlson BW, Luepker R, Herlitz J. The epidemiology of out-of-hospital ‘sudden’ cardiac arrest. Resuscitation 2002; 52: 235–245.

8.

Crea F, Liuzzo G. Pathogenesis of acute coronary syndromes. J Am Coll Cardiol 2013; 61: 1–11.

9.

Nichol G, Stiell IG, Hebert P, Wells GA, Vandemheen K, Laupacis A. What is the quality of life for survivors of cardiac arrest? A prospective study. Acad Emerg Med 1999; 6: 95–102.

10. Cummins RO, Ornato JP, Thies WH, Pepe PE. Improving survival from sudden cardiac arrest: the ‘chain of survival’ concept. Circulation 1991;

This case report did not receive any grant from funding agencies in the public,

83: 1832–1847.

commercial, or not-for-profit sectors. We thank Dr Jules Ndjebet (Centre

11. Nolan JP, Soar J, Zidemanc DA, Biarent D, Bossaert LL, Deakinf C,

des maladies cardiovasculaires de Douala, Douala, Cameroun) and Dr Akli

et al. European Resuscitation Council guidelines for resuscitation 2010.

Otmani (Hôpital Européen Georges Pompidou, Département de Cardiologie,

Resuscitation 2010; 81: 1219–1276.

Paris, France) for managing the patient in Cameroon and France, respectively.

96

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

AFRICA

Two cases of cardiac sarcoidosis in pregnant women with supraventricular arrhythmia Ebru Ertekin, Sulaiman Moosa, Jolien W Roos-Hesselink, Karen Sliwa

Abstract We present two cases of cardiac sarcoidosis whose first presentation was in pregnancy. All findings confirmed the diagnosis of sarcoidosis with cardiac involvement in both patients.

The first patient, a 37-year-old, presented with dizziness and atrial fibrillation at 16 weeks’ gestation. Echocardiography revealed thickened interventricular septum with a speckled pattern. Cardiac MRI after delivery showed myocardial oedema/inflammation corresponding with the same regions with early enhancement and epicardial delayed enhancement in the basal to mid-inferoseptal and basal anterior left ventricular myocardial segments. Transbronchial biopsy revealed histology of scanty fragments of inflamed bronchial mucosa.

The second patient, a 31-year-old, was 17 weeks pregnant when she presented with daily palpitations and shortness of breath. She had prolonged episodes of supraventricular tachycardia. Echocardiography revealed a speckled septal and right ventricular wall pattern. Cardiac MRI after delivery showed basal and mid-ventricular mesocardial and epicardial enhancement, most compatible with sarcoidosis.

Keywords: cardiac sarcoidosis, pregnancy, arrhythmia Submitted 2/10/14, accepted 3/2/15 Cardiovasc J Afr 2015; 26: 96–100

www.cvja.co.za

DOI: 10.5830/CVJA-2015-022

Case 1: patient with atrial fibrillation A 37-year-old primigravida presented to our cardiac clinic at 16 weeks’ gestation with a history of dizziness and atrial fibrillation (AF) without overt heart disease. She took no regular medication, did not smoke or drink alcohol, and had no diabetes mellitus or hypertension. Her medical history included AF diagnosed six years previously, and polycystic ovarian syndrome.

There was no cardiac disease or sudden death in her family.

Physical examination revealed an irregular tachycardia of 130 beats per minute (bpm), blood pressure of 124/72 mmHg

Department of Cardiology, Erasmus University Medical Center, Rotterdam, The Netherlands Ebru Ertekin, BSc Jolien W Roos-Hesselink, MD, PhD

Department of Radiology, 2 Military Hospital, Cape Town, South Africa

and no murmur. The electrocardiogram showed ventricular ectopics, intermittent AF and irregular P-wave morphology (Fig. 1). Echocardiography revealed a normal heart with an ejection fraction of 60%. She was prescribed atenolol 25 mg daily and aspirin 75 mg daily due to the risk of a cerebrovascular accident.

Echocardiography was repeated one month later and showed a thickened speckled septum and posterior wall with good left ventricular function (left ventricular ejection fraction 61%, left atrial diameter 34 mm, aortic diameter 28 mm, left ventricular end-diastolic diameter 53 mm). These findings were suspicious for an infiltrative disease, and cardiac sarcoidosis was considered to be the most probable diagnosis. The obstetric–cardiac team made a decision at that time to perform a full work-up for cardiac sarcoidosis post delivery.

She delivered under spinal and general anaesthetia at 38 weeks of gestation by caesarean section due to breech position.

She gave birth to a healthy female baby of 2 780 g. On discharge she was prescribed aspirin 80 mg, eltroxin 100 μg and atenolol 50 mg. Three months post partum she had mild to moderate shortness of breath on effort, her blood pressure was 110/78 mmHg and her heart rate was 70–80 bpm while she was in AF. MRI was performed four months after delivery and demonstrated the following findings: preserved biventricular systolic function and volumes, myocardial oedema or inflammation corresponding to the same regions with early enhancement and epicardial delayed enhancement in the basal to mid-inferoseptal and basal anterior left ventricular myocardial segments (Fig. 2). With these MRI findings, cardiac sarcoidosis was considered to be the most probable diagnosis. However, myocarditis was a less likely differential consideration.

CT chest demonstrated multiple bilateral pulmonary nodules predominantly in a perilymphatic distribution. Transbronchial biopsy confirmed the diagnosis of sarcoidosis. Microscopic examination showed scanty fragments of inflamed bronchial mucosa. Granulomas and viral inclusions were not seen.

Additionally, serum angiotensin converting enzyme level was 23.8 U/l (normal range: 9–67 U/l).

Steroid therapy was started after the diagnosis of sarcoidosis by transbronchial biopsy. At the follow-up visit 10 months after delivery, her symptoms had improved and she was on atenolol 25 mg daily, prednisone 40 mg daily, with calcium supplementation, vitamin D, isoniazid 200 mg daily (antibiotics) and eltroxin 100 mcg daily.

All findings confirmed the diagnosis of sarcoidosis. As there was cardiac involvement, steroid therapy was prescribed. Steroid therapy was successful and improved her symptoms.

Sulaiman Moosa, MD

Hatter Institute for Cardiovascular Research in Africa, MRC Inter Cape Heart Group, Department of Medicine, University of Cape Town, South Africa Karen Sliwa, MD, PhD, karen.sliwa-hahnle@uct.ac.za

Case 2: patient with supraventricular tachycardia The second patient we saw was a 31-year-old woman who was 17 weeks pregnant with her third pregnancy. She had prolonged

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

97

Fig. 1. E CG of case 1, performed when the patient was 16 weeks pregnant, showing intermittent atrial fibrillation.

episodes of supraventricular tachycardia of unknown origin with almost daily palpitations on minimal effort. At that time she was diagnosed with NYHA functional class II failure off medication (she was not on any medication at presentation). Her mother had sarcoidosis. Her obstetric history included two threatened miscarriages and two viable births, both vaginal delivery.

Physical examination was normal and her heart rate was 78 bpm. Holter monitoring did not identify ventricular tachycardia.

Echocardiography revealed a speckled pattern at the basal segment of the septum and right ventricular wall, suspicious for an infiltrative disease. Left ventricular function was good (LVEF 53%) and no valve dysfunction was observed. In view of the clinical history, those features were highly suggestive of sarcoidosis with cardiac involvement. Verapamil 40 mg daily was started and MRI investigation was booked after pregnancy for further investigation.

One month later she presented with increased palpitations on verapamil. She had previously responded to verapamil but did not respond on atenolol or propanolol. The palpitations started without any obvious trigger and lasted one hour. Haemoglobin was 11.7 g/dl (normal range, non-pregnant woman: 12.0–15.5 g/dl) and thyroid stimulating hormone was 1.29 mU/l (normal range: 0.34–4.25 mU/l). She had normal electrocardiography.

Verapamil dosage was increased to 80 mg because of the increased complaints of palpitations.

At 30 weeks of pregnancy, she presented at the clinic with daily palpitations and shortness of breath. The palpitations

did not improve on verapamil. Her blood pressure was 108/58 mmHg, she had a regular heart rate of 104 bpm (sinus rhythm) and was not in congestive heart failure. At that time verapamil was stopped due to its possible side effects on the foetus.

She delivered at 36 weeks of gestation by emergency caesarean section due to foetal distress. She gave birth to a healthy male baby of 2 760 g. Echocardiography was repeated three months postpartum and demonstrated a speckled pattern, diastolic left ventricular dysfunction with right ventricular function of 50% and left ventricular function of 68%.

MRI was performed four months after delivery and showed a mildly enlarged left ventricle, reduced LVEF (< 50%) but no regional wall motion abnormality. The delayed gadolinium sequences showed basal and mid-ventricular mesocardial and epicardial enhancement (Fig. 3). The radiologist concluded that these features could be consistent with sarcoid-related myocardial scarring. The patient declined to have a transbronchial biopsy.

After starting steroid therapy, there was a marked improvement in her symptoms, including shortness of breath. The cardiac MRI was repeated and showed a marked increase in LVEF (from < 50% before starting steriod therapy to 70% after starting the therapy).

Discussion Our cases demonstrate that cardiac sarcoidosis may manifest for the first time during pregnancy. Reports on cardiac sarcoidosis related to pregnancy are rare.1,2 Cardiac sarcoidosis, a potentially

98

CARDIOVASCULAR JOURNAL OF AFRICA â&#x20AC;˘ Volume 26, No 2, March/April 2015

A

B

C

D

AFRICA

Fig. 2. C ardiac MRI images of case 1. A: basal short-axis T2W slice, demonstrating patchy high signal of the inferoseptal myocardium (white arrow). B: basal short-axis T1W early post-gadolinium image, revealing inhomogeneous myocardial enhancement (white arrow). C and D: basal (C) and mid-ventricular (D) short-axis phase-sensitive inversion recovery (PSIR) delayed enhancement images, demonstrating anterior basal (black arrow in C) as well as inferoseptal epicardial enhancement (white arrows in C and D).

life-threatening condition, is probably an underdiagnosed disease, as cardiac involvement is clinically apparent in only about 5% of all patients, while cardiac granulomas are found in about 25% of patients with sarcoidosis who are examined at autopsy.3 Cardiac sarcoidosis may occur without apparent disease in other organs.

It has been reported to occur most frequently in middle-aged or older women in Japan, although its incidence in Western countries was shown to have no gender difference and to be higher in the younger generation.4,5

Sarcoidosis in pregnancy The incidence of sarcoidosis in pregnancy is estimated to be 0.02 to 0.05%.6 Maternal sarcoid symptoms may improve during pregnancy but may be more severe after delivery. The changes in the severity of sarcoidosis during pregnancy are possibly due to increased serum steroid levels, which rapidly decrease after delivery.7 On the other hand, sarcoidosis can progress during pregnancy, or as our two cases show, manifest for the first time during pregnancy. Sudden death secondary to ventricular

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

A

99

B

Fig. 3. C ardiac MRI images of case 2. Basal short-axis left ventricular magnitude (A), and PSIR (B) delayed enhancement images, demonstrating mesocardial (white arrow in A) and epicardial enhancement (white arrow in B).

tachyarrhythmias or conduction abnormalities accounts for 25–65% of cardiac sarcoidosis-related deaths.8 Complicated sarcoidosis has been associated with postpartum maternal death.9 Our two patients delivered by caesarean section and had no further complications.

Diagnostic tools There are no currently accepted international guidelines for the diagnosis of cardiac sarcoidosis. The diagnosis of cardiac sarcoidosis can be difficult, as it can be asymptomatic or non-specific. Cardiac sarcoidosis is manifested clinically as a cardiomyopathy with loss of ventricular function, or tachyarrhythmias and bradyarrhythmias (palpitations, syncope and sudden death).

Both our patients presented with atrial arrhythmias. The first patient (case 1) had atrial fibrillation (more frequent and faster heart rate than before pregnancy) and the second patient (case 2) had supraventricular tachycardia. The most common location for granulomas and scars is the left ventricular free wall, followed by the interventricular septum, often with involvement of the conducting system.

Endomyocardial biopsy sample for pathological research that is positive is hard to obtain and has a low diagnostic yield (< 20%) because cardiac involvement tends to be patchy, and granulomas are more likely to be located in the left ventricle and basal part of the ventricular septum.10 A pathological diagnosis of cardiac sarcoidosis was not performed in our two patients for these reasons. Instead, we chose to perform a less-invasive cardiac MRI. Cardiac MRI with gadolinium enhancement and a 18F-FDG PET scan are valuable aids in the diagnosis of cardiac sarcoidosis.3 Since sudden death may be the first sign of cardiac sarcoidosis, electrophysiological studies to detect any conduction delays or increased risk of sustained arrhythmias should be strongly considered in all patients with suspected cardiac

sarcoidosis. Most authorities recommend placement of an electronic pacemaker for complete heart block, and an automatic implantable cardioverter–defibrillator for ventricular fibrillation or tachycardia and markedly reduced left ventricular ejection fraction.11 Sarcoidal granulomas produce angiotensin converting enzyme (ACE), and ACE levels are elevated in 60% of patients with sarcoidosis. However, a serum ACE level is an insensitive and non-specific diagnostic test and a poor therapeutic guide.3 A recently published expert consensus statement provides guidance for clinicians on the diagnosis and management of arrhythmias associated with cardiac sarcoidosis.12 Unfortunately they do not have recommendations for pregnant patients as there is limited evidence for this specific patient population.

Treatment The initial treatment of sarcoidosis is often prednisone 20–40 mg daily for six to 12 weeks, with dose reduction thereafter. As cardiac sarcoidosis is a potentially life-threatening situation, the initial dose is 1 mg/kg daily. Although a minimum of 12 months of maintenance therapy is often advised to prevent relapse, several investigators believe that treatment should be stopped as early as six months after initiation.13 Oral steroid therapy is usually performed to treat atrioventricular block due to cardiac sarcoidosis. However, its efficacy against cardiac sarcoidosis in general is only about 50%.14,15 Although cardiac sarcoidosis is a known inflammatory disease and despite more than 50 years of the use of corticosteroids for treatment, there is no proof of survival benefit from this treatment.16 As specific guidelines on cardiac sarcoidosis in pregnant women do not exist, in case of occurring relevant bradycardia or tachycardia, pacemakers and ICDs may be considered. Since there is no evidence of giving immunosuppressive therapy for pregnant women, we suggest that efforts should be made to

100

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

prevent (further) pregnancy in women with proven or suspected cardiac sarcoidosis.

6.

Our two cases demonstrate that cardiac sarcoidosis may manifest for the first time during pregnancy. Even though it is rare, especially during pregnancy, it should be considered when patients present with shortness of breath (on minimal effort) and palpitations or arrhythmias. Early institution of steroid therapy is warranted when this diagnosis is suspected due to the increased risk for rhythm or conduction system disorders and sudden death.

Agha FB, Vade A, Amendola MA, Cooper RF. Effects of pregnancy on sarcoidosis. Surg Gynecol Obstet 1982; 155: 817–822.

7.

Conclusion

AFRICA

Selroos O. Sarcoidosis and pregnancy: a review with results of a retrospective study. J Intern Med 1990; 227: 221–224.

8.

Kim JS, Judson MA, Donnino R, et al. Cardiac sarcoidosis. Am Heart J 2009; 157: 9–21.

9.

Haynes-deRegt R. Sarcoidosis and pregnancy. Obstet Gynecol 1987; 70(3 pt 1): 369–372.

10. Uemura A, Morimoto S, Hiramitsu S, et al. Histologic diagnostic rate of cardiac sarcoidosis: evaluation of endomyocardial biopsies. Am Heart J 1999; 138: 299–302.

11. Grimm W, Alter P, Maisch B. Arrhythmia risk stratification with regard to prophylactic implantable defibrillator therapy in patients with dilated cardiomyopathy: results of MACAS, DEFINITE, and SCD-HeFT.

References 1.

Seballos RJ, Mendel SG, Mirmiran-Yazdy A, et al. Sarcoid cardiomyopathy precipitated by pregnancy with cocaine complications. Chest 1994; 105: 303–305.

2.

Reuhl J, Schneider M, Sievert H, et al. Myocardial sarcoidosis as a rare cause of sudden cardiac death. Forensic Sci Int 1997; 89: 145–153.

3.

Iannuzzi, MC, Rybicki BA, Teirstein AS. Sarcoidosis. N Engl J Med 2007; 357: 2153–2165.

4.

Roberts WC, McAllister HA Jr, Ferrans VJ. Sarcoidosis of the heart. A

ment on the diagnosis and management of arrhythmias associated with cardiac sarcoidosis. Heart Rhythm 2014; 11(7): 1305.

13. Judson MA. An approach to the treatment of pulmonary sarcoidosis with corticosteroids: the six phases of treatment. Chest 1999; 115: 1158–1165.

14. 14. Sugisaki K, Yamaguchi T, Nagai S, et al. Clinical characteristics of 195 Japanese sarcoidosis patients treated with oral corticosteroids.

Sarcoidosis Vasc Diffuse Lung Dis 2003; 20: 222–226.

clinicopathologic study of 35 necropsy patients (group I) and review of

15. Hiramitsu S, Morimoto S, Uemura A, et al. National survey on status of

78 previously described necropsy patients (group II). Am J Med 1977;

steroid therapy for cardiac sarcoidosis in Japan. Sarcoidosis Vasc Diffuse

63: 86–108.

5.

Herz 2004; 29: 348–352.

12. Birnie DH, Sauer WH, Bogun F, et al. HRS expert consensus state-

Fleming HA, Bailey SM. The prognosis of sarcoid heart disease in the United Kingdom. Ann NY Acad Sci 1986; 465: 543–550.

Lung Dis 2005; 22: 210–213.

16. Grutters JC, van den Bosch JM. Corticosteroid treatment in sarcoidosis.

Eur Respir J 2006; 28: 627–636.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

e1

Case Report Application of radiofrequency ablation procedure on a morbidly obese patient with a venous ulcer and large saphenous vein Ali Ümit Yener, Özlem Yener, Hikmet Selçuk Gedik, Kemal Korkmaz, Turgut Özkan, Ayşe Lafçı, Kerim Çağlı

Abstract Venous ulcers that occur due to chronic venous insufficiency are seen on the upper medial malleol of the ankle. Treatment of venous ulcers is protracted and generally the success rate is low. Co-morbid factors play an important role in the success of treatment of venous ulcers. In this case report, we demonstrate successful venous ulcer treatment in a morbidly obese patient with co-morbid conditions.

Keywords: radiofrequency ablation, venous ulcer, chronic venous deficiency Submitted 6/5/13, accepted 20/10/14 Previously published online 16/3/15 Cardiovasc J Afr 2015; 26: e1–e2

www.cvja.co.za

DOI: 10.5830/CVJA-2014-065

Treatment of leg ulcers caused by chronic venous deficiency (CVD) is a significant issue worldwide. Data from various studies have shown the incidence of CVD-associated venous ulcer to be in the range of 0.5 to 3%.1 Of this group, 1% of patients suffer from ulcerative episodes at least once in their lives.

Venous ulcer is three times more prevalent in females than males.2 Forty per cent of all ulcers are venous-related and their

Department of Cardiovascular Surgery, Çanakkale Onsekiz Mart University, Kepez, Çanakkale, Turkey Ali Ümit Yener, MD, yener@comu.edu.tr Turgut Özkan, MD

Department of Radiology ,Turkiye Yuksek Ihtisas Education and Research Hospital, Ankara,Turkey Özlem Yener, MD

Department of Cardiovascular Surgery, Ankara Numune Research and Education Hospital, Ankara, Turkey Hikmet Selçuk Gedik, MD Kemal Korkmaz, MD Kerim Çağlı, MD

Department of Anesthesiology, Ankara Numune Research and Education Hospital, Ankara, Turkey Ayşe Lafçı, MD

prevalence increases with age. Venous ulcers are observed on average in the sixth decade of life.2 They are present for more than a year in more than half of the cases, and the ulcers recur in about two-thirds of patients.2 Risk factors affecting the formation of venous ulcer are advanced age, obesity [especially with body mass index (BMI) above 30 kg/m2],3 hypertension, diabetes mellitus, congestive heart failure, renal failure, low socio-economic level, lowerextremity trauma, and venous thrombosis of more than a year’s duration. As a result of these factors, lipodermatosclerosis occurs and venous ulcers develop on the skin.

The main objective in the treatment of these patients is to reduce venous pressure, decrease oedematous swelling, lower the ulcer diameter, heal the ulcer, and prevent its recurrence. To this end, tight compression stockings and surgical treatment are recommended.4

Case report Our case had had venous deficiency for about 14 years, with venous ulcers occasionally recurring and then recovering. He had venous deficiency according to a clinically, aetiologically and anatomo-pathologically conducted classification (CEAP = 5) and had been using class II (32 mmHg) compression stockings and venoprotective medicine for about three years. In addition, our patient had co-morbid factors such as lymphoedema, congestive heart failure (left ventricular ejection fraction in echocardiography conducted in our hospital: 40%), hypertension (he was using an angiotensin receptor antagonist and his blood pressure was regulated), type 2 diabetes mellitus and morbid obesity (174 kg, BMI: 60.2 kg/m2).

The patient’s fasting blood glucose level was approximately 178 mg/dl (9.88 mmol/l) and HbA1c value was 7.3%. He also had a history of smoking half a packet of cigarettes daily for six years.

With a history of excision surgery for a varicose cluster twice in the year 2000, the patient had high-output reflux throughout the entire Valsalva in the bilateral sapheno-femoral junction, which was revealed by Duplex ultrasonography. There was no reflux present in the femoral and popliteal veins. The right great saphoneous vein diameter was 12 mm, and the saphenous diameter measured in the right leg’s sapheno-femoral junction was 25.2 mm. The left great saphoneous vein diameter was 15 mm, and the saphenous diameter measured in the left leg’s sapheno-femoral junction was 27.4 mm.

e2

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

Fig. 1. Intra-operative photograph.

Following completion of the consultation in the relevant departments, the patient was taken to surgery. The left leg was operated on first (Fig. 1). Using local anaesthesia, a sheath through which a radiofrequency ablation catheter (ClosureFast)® would move was placed 48 cm from the left lower knee. The ablation catheter was inserted 2 cm distal to the sapheno-femoral junction so as to keep the superficial epigastric vein open.

Tumescent anaesthesia was administered throughout the vein trace to be ablated.

A section of 48 cm of the saphenous vein was ablated by applying equal power (40 W) to each centimeter. The ablation procedure was administered three times for each 7-cm segment. Following the procedure, it was confirmed by Duplex ultrasonography that the ablated saphenous vein segment was obliterated, and colour mode of Duplex ultrasonography showed no flow. In addition, two large excisions of varicose veins were conducted with phlebectomy from the left lower knee. The patient was taken to the clinic in tight bandages.

About 21 days later, the right leg was operated on, with intervention of the saphenous vein in the right lower knee. A segment of 44 cm of the saphenous vein was ablated and it was observed to be obliterated following the procedure. Duplex ultrasonography was done in the first week and first, third and sixth months after saphenous vein closure and the venous ulcer was in remission (Fig. 2).

Fig. 2. Six-month post-operative photograph.

facilitate returning to active life by increasing patient comfort and allowing them to return to work more quickly.

Radiofrequency ablation procedure produces results demonstrating that it is better, more comfortable and safer5 than procedures such as standard surgery and foam therapy.

Procedures conducted with a radiofrequency catheter have proven to be more successful in patients of all ages.6

Conclusion In this context, we believe that radiofrequency ablation, which can be implemented even for standard surgery cases, is a safe method for highly varicose and co-morbid patients.

References 1.

Podnos YD, Williams RA, Tessier DJ. Chronic venous in-sufficiency.

Available at: http://www.emedicine.com/med/topic2760.htm. Accessed October 25, 2005.

2.

Doughty D, Waldrop J, Ramundo J. Lower extremity ulcers of vascular etiology. In: Bryant R, ed. Acute and Chronic Wounds. 2nd edn. St Louis: Mosby, 2000: 265–300.

3.

NIH clinical guidelines on the identification, evaluation, and treatment of overweight and obesity in adults-the evidence report. Obesity Res 1998; 98(4083)(suppl 2): 51–209.

4.

Davis J, Gray M. Is the Unna’s boot bandage as effective as a four-layer wrap from managing venous leg ulcers? J Wound Ostomy Continence

Discussion Endovenous ablation techniques have been commonly used in recent years and have started to replace venous stripping, which was standard in surgery. High patient comfort has promoted the development of such techniques. Less pain, ecchymosis and haematoma have increased the usage of these techniques. Such techniques are being safely used on patients with a high number of accompanying co-morbid diseases, as in our case, and they

AFRICA

Nurs 2005; 32(3): 152–156.

5.

Kapoor A, Kapoor A, Mahajan G. Endovenous ablation of saphenofemoral ınsufficiency: analysis of 100 patient using RF closure fast technique. Indian J Surg 2010; 72(6): 458–462.

6.

Rasmussen LH, Lawaetz M, Bjoern L, Vennits B, Blemings A, Eklof B. Randomized clinical trial comparing endovenous laser ablation, radiofrequency ablation, foam sclerotherapy and surgical stripping for great saphenous varicose veins. Br J Surg 2011; 98(8): 1079–1087.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

e3

Case Report A case of May–Thurner syndrome with inconsistent radiological and surgical findings Fatih Akin, Serhat Aygun, Niyazi Gormus, Yeter Duzenli Kar, Hanife Tugce Susam, Ahmet Ozel

Abstract May–Thurner syndrome is the result of compression of the left common iliac vein between the right common iliac artery and the overlying vertebrae. In this case report, we describe an 11-year-old boy presenting with swelling of the left lower extremity. An iliac MR venography showed compression of the left proximal iliac vein between the vertebra and the left iliac artery. In surgery, it was seen that the left common iliac vein was connected to the postero-inferior part of the inferior vena cava, and it was compressed between the right common iliac artery and the columna vertebralis, which was inconsistent with the radiological findings. An interposition of the great saphenous vein graft between the left common iliac vein and the inferior vena cava was made, with a successful outcome. Our case is interesting in that it showed inconsistent findings between the radiological images and surgery.

Keywords: May–Thurner syndrome, child, leg swelling Submitted 18/6/13, accepted 27/1/15 Cardiovasc J Afr 2015; 26: e3–e5

www.cvja.co.za

DOI: 10.5830/CVJA-2015-013

Iliac vein compression syndrome, also known as the May– Thurner syndrome (MTS), is the result of compression of the left common iliac vein between the right common iliac artery and the overlying vertebrae. Although it was first described in 1908

by McMurrich, a detailed anatomical description was generated

by May and Thurner in 1956.1,2 This compression may cause focal intimal proliferation of the vein, and subsequently venous stasis of the left lower extremity occurs. MTS manifests as left lower extremity swelling, pain, venous stasis changes, and deep venous thrombosis (DVT).3 The usual presentation of MTS is compression of the left iliac vein by the right common iliac artery and the overlying vertebrae.4 Here we describe a case of MTS whose radiological findings showed an atypical compression of the left iliac vein by the left iliac artery.

Case report An 11-year-old boy presented to our institution with left lower extremity swelling. The swelling had first appeared two years earlier and had progressed slowly. The swelling increased after standing for a long time or walking more than 500 m. It decreased with overnight rest but did not resolve completely.

Occasionally, he had mild pain in his calf while standing. There was no history of surgery or a central venous indwelling catheter.

A review of his systems was negative for chest pain, shortness of breath, cough, fever, malaise, visual changes, headache, weakness, or pain and swelling in other areas of the body. He had no significant family history of cancer, blood clots, cardiac problems, early death or use of antithrombotic agents.

On arrival, his blood pressure was 100/60 mmHg and the pulse rate was 102 beats/min. On physical examination there was diffuse swelling of the left lower extremity, starting at the groin and progressing distally (Fig. 1). The left calf was tense and

Department of Pediatrics, Konya Training and Research Hospital, Konya, Turkey Fatih Akin, MD, drfatihakin@gmail.com Yeter Duzenli Kar, MD Hanife Tugce Susam, MD

Department of Radiology, Konya Training and Research Hospital, Konya, Turkey Serhat Aygun, MD

Department of Cardiovascular Surgery, School of Medicine, Necmettin Erbakan University, Konya, Turkey Niyazi Gormus, MD

Department of Pediatric Nephrology, Konya Training and Research Hospital, Konya, Turkey Ahmet Ozel, MD

Fig. 1. Swelling of the left lower extremity of the patient.

e4

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

tender by deep palpation and 8 cm larger in circumference than the right calf.

There was no blood pressure difference between the lower limbs and the ankle–brachial indices (ABI) were similar in both limbs. The posterior tibial and dorsalis pedis pulses were normal, and the deep tendon reflexes, strength and sensation were all normal.

Cardiac, chest and abdominal examinations were within normal limits. Head, neck and upper extremity examinations were unremarkable.

Laboratory investigations revealed a haemoglobin of 12.4 g/dl, granulocyte count of 10 650 cells/mm3 and platelet count of 428 000 cells/mm3. His prothrombin time was 13 seconds, activated prothromboplastin time was 29.3 seconds, and international normalised ratio was 1. Biochemical analyses were within normal levels.

The patient underwent abdominal and Doppler ultrasonography (DUSG) for evaluating the lower extremity venous system. Abdominal ultrasonography was normal and DUSG revealed a mildly enlarged left external iliac vein, but A

B

C

AFRICA

the proximal main iliac vein was entrapped at the level of the crossing with the left iliac artery. It did not show any thrombosis of the veins of the lower limbs.

An iliac MR venography (MRV) was performed with two-phase contrast injection, of which the second injection was just four minutes after the first, to obtain images of arterial and venous vessels in the same slice. The MRV images showed compression of the left proximal iliac vein between the vertebra and the left iliac artery (Fig. 2). The venous system caudal to the obstruction was dilated (Fig. 2C).

The patient’s physical examination and imaging findings were diagnostic of an atypical presentation of MTS. Surgical intervention was planned after consultation with the cardiovascular surgery department.

The operation was performed under general anaesthesia via a median laparotomy incision. The abdominal aorta, bilateral common iliac arteries, inferior vena cava, and left and right common iliac veins were dissected carefully. The left common iliac vein was found to be connected to the postero-inferior part of the inferior vena cava, and it was compressed between the right common iliac artery and columna vertebralis (Fig. 3A, B), which was inconsistent with the radiological findings.

The left common iliac vein was fragile and enlarged, and there were enlarged collateral veins at the posterior part of the left common iliac vein, which made complete dissection of the vein impossible. Therefore reconstruction of the left common iliac vein from the bifurcations to the inferior vena cava was thought to be impossible. The surgeons decided to make an interposition of the great saphenous vein graft between the left common iliac vein and the inferior vena cava (Fig. 4).

The postoperative period was uneventful. In order to prevent early-term thrombosis of the saphenous vein graft, we used standard heparin (1 cm3 intravenous per six hours daily, for four days). The swelling of the extremity gradually decreased and resolved.

Discussion Although the usual manifestation of MTS is compression of the left common iliac vein by the right common iliac artery, compression of the left common iliac vein by the left internal iliac artery and left common iliac artery has also been reported.5,6 Our case showed an unusual manifestation of MTS on radiological A

Fig. 2. A : Axial-plain MR angiography image showed left iliac vein compression (white arrows) by the left iliac artery (black arrow). B: Sagittal-plain reconstructed MR angiography image showed a markedly narrowed left iliac vein (white arrow). C: Oblique coronal-plain MIP (maximum intensity projection) image revealed venous compression while crossing the left iliac artery (white arrow) and dilated caudal segment iliac veins (arrow head).

B

Fig. 3. Pre-operative images. A: Connection of the left common iliac vein to the postero-inferior part of the inferior vena cava. B: The left common iliac vein was pressed between the right common iliac artery and the columna vertebralis. LCIV, left common iliac vein; RCIV, right common iliac vein; AA, abdominal aorta; IVC, inferior vena cava.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

e5

modalities and they are experienced in these treatment options.

Stenting of the iliac vein in such a young patient may result in early thrombosis of the stent. Therefore, we believe that surgical correction of the pathological anatomy was the best option in this case.

There are many reports in the literature discussing the results of MTS with endovascular treatment. Thrombosed cases can be treated with endovascular techniques. During endovascular treatment, removal of the thrombi and then stenting the compressed iliac vein segment can be done simultaneously.9,11,12 The presented case was symptomatic but did not have deep-vein thrombosis.

Conclusion Fig. 4. P ostoperative image showing saphenous vein graft between the left common iliac vein and the inferior vena cava. SFV, saphenous vein.

findings, which was compression of the left common iliac vein by the left common iliac artery. However, in surgery, it was seen that it was a usual manifestation of MTS, which was a compression by the right common iliac artery.

There are conflicting ideas about the usefulness of MRV for the diagnosis of MTS. While Wolpert et al. reported that MRV is the best modality for the diagnosis of MTS, McDermott el al. suggested that MRV alone may not be sufficient to confirm the diagnosis and could possibly lead to further investigation.3,7 The disadvantage of MRV is that the vascular regions above the bifurcations disturb non-laminar flow and can present a confusing picture.8 Although it showed misleading images on compression of the left iliac vein, MRV was successful in diagnosing MTS in our patient.

MTS is not a rare cause of venous abnormalities in the left lower extremity. The incidence of MTS in patients with left lower extremity swelling was found to be 37.5% out of 24 patients detected by MRV.3 However, it is not always symptomatic. Kibbe et al. reported that iliac vein compression is a frequent anatomical variant in asymptomatic individuals, and may represent the normal anatomical pattern. They demonstrated that 24% of 50 asymptomatic subjects had more than 50% compression of the left common iliac vein.9 Different surgical approaches for the treatment of MTS include vein-patch angioplasty with excision of the intraluminal bands, division of the right common iliac artery and relocation behind the left common iliac vein or inferior vena cava, and saphenous vein graft bypass to the inferior vena cava or ipsilateral common femoral vein.10 Saphenous graft bypass to the inferior vena cava was performed on our patient, which was successful in improving the symptoms.

Endovascular stenting of the iliac vein is another option in the treatment of MTS. However, in young patients with difficult anatomical variations, this may not be appropriate. Radiological and surgical mismatch has been mentioned in our case. The vascular surgery team also deals with endovascular treatment

MTS should be taken into account in patients presenting with swelling of the left lower extremity. Our case demonstrated inconsistent findings between MRV imaging and surgery. A surgeon should be available for such unexpected conditions.

References 1.

Mc Murrich JP. The occurrence of congenital adhesions in the common iliac veins, and their relation to thrombosis of the femoral and iliac veins. Am J Med Sci 1908; 135: 342–345.

2.

May R, Thurner J. The cause of the predominantly sinistral occurrence of thrombosis of the pelvic veins. Angiology 1957; 8: 419–427.

3.

Wolpert LM, Rahmani O, Stein B, et al. Magnetic resonance venography in the diagnosis and management of May-Thurner syndrome. Vasc Endovasc Surg 2002; 36: 51–57.

4.

Fretz V, Binkert CA. Compression of the inferior vena cava by the right iliac artery: a rare variant of May-Thurner syndrome. Cardiovasc Intervent Radiol 2010; 33: 1060–1063.

5.

Dheer S, Joseph AE, Drooz A. Retroperitoneal hematoma caused by a ruptured pelvic varix in a patient with iliac vein compression syndrome.

J Vasc Interv Radiol 2003; 14: 387–390.

6.

Molloy S, Jacob S, Buckenham T, et al. Arterial compression of the right common iliac vein; an unusual anatomical variant. Cardiovasc Surg 2002; 10: 291–292.

7.

McDermott S, Oliveira G, Ergül E, et al. May–Thurner syndrome: can it be diagnosed by a single MR venography study? Diagn Interv Radiol 2013; 19: 44–48.

8.

Evans AJ, Sostman HD, Knelson MH, et al. 1992 ARRS Executive Council Award. Detection of deep venous thrombosis: prospective comparison of MR imaging with contrast venography. Am J Roentgenol 1993; 161: 131–139.

9.

Kibbe MR, Ujiki M, Goodwin AL, et al. Iliac vein compression in an asymptomatic patient population. J Vasc Surg 2004; 39: 937–943.

10. Duran C, Rohatgi S, Wake N, et al. May-Turner syndrome: a case report. E Afr J Med 2011; 43: 129–131.

11. Popat RA, Sze DY, Kuo WT, et al. Common iliac vein stenosis and risk of symptomatic pulmonary embolism: an inverse correlation. J Vasc Interv Radiol 2011; 22: 133–141.

12. Wang Y, Zhang X, Yu W, et al. Endovascular treatment of acute proximal deep venous thrombosis secondary to iliac vein compression syndrome: a novel technique for thrombus removal. Chin Med J 2013; 126: 3184–3186.

e6

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

AFRICA

Case Report Endocardite tricuspide sub-aigue du post abortum: a propos d’un cas Léopold Houétondji Codjo, Kofi-Mensa Savi de Tove, Fanny Ahouingnan Hounkponou, Serge Hugues Mahougnon Dohou, Martin Dèdonougbo Houenassi

Abstract Tricuspid infective endocarditis is rare and represents five to 10 % of all cases of infective endocarditis. It occurs predominantly in intravenous drug users, and patients with central venous catheters or intracardiac probes. We report on the case of subacute tricuspid infective endocarditis in a girl of 17 years. She had no particular cardiovascular history. She was admitted for a persistent fever with cachexy, cough and thoracic pains, and right heart failure that appeared one month after a clandestine abortion. Transthoracic echocardiography found several vegetations on the tricuspid valve with massive tricuspid regurgitation. The chest X-ray showed bilateral excavated lung abscesses and condensation areas.

Blood culture was not done and broad-spectrum antibiotic therapy was given. She was apyretic after 10 days. However, the massive tricuspid regurgitation with right heart failure persisted. She was discharged from hospital after 40 days of treatment. Although rare, infective endocarditis is one of the more serious complications of gynaecological procedures, particularly clandestine abortion. Therefore any young girl with persistent fever must be suspected of clandestine abortion.

Keywords: infective endocarditis, tricuspid valve, clandestine abortion Submitted 4/10/14, accepted 3/2/15 Cardiovasc J Afr 2015; 26: e6–e8

www.cvja.co.za

DOI: 10.5830/CVJA-2015-023

Faculté de médecine, l’Université de Parakou, Parakou, Benin Léopold Houétondji Codjo, MD Parakou, Benin, MD, leostelles@yahoo.fr Kofi-Mensa Savi de Tove, MD Fanny Ahouingnan Hounkponou, MD

Hopital d’Instruction des Armées de Parakou, Parakou, Benin Serge Hugues Mahougnon Dohou, MD

Faculté de Médecine, l’Université d’Abomey, Calavi, Benin Martin Dèdonougbo Houenassi, PhD

L’endocardite infectieuse est une greffe microbienne sur l’endocarde. Elle survient en général sur des cœurs préalablement atteints par la maladie rhumatismale, les malformations congénitales, les maladies dégénératives….1 La localisation tricuspide est rare et représente 5 à 10% de l’ensemble des endocardites. Elle affecte habituellement le sujet toxicomane, les malades portant un cathéter central ou une sonde intracardiaque.2 Si le cas que nous rapportons est classique par son expression clinique, il met l’accent sur l’une des complications graves de l’avortement illicite. De même il révèle les problèmes posés par la prise en charge de l’endocardite dans le nord Bénin en 2014.

Observation Mademoiselle NT est âgée de 17 ans et n’a aucun antécédent cardio-vasculaire ni de toxicomanie. Elle a été admise pour une fièvre au long cours avec cachexie, toux hémoptoïque et douleurs thoraciques évoluant depuis 1mois. Ces symptômes étaient apparus 1mois après une interruption volontaire de grossesse réalisée dans des conditions septiques au domicile d’un aide soignant de son village.

A l’admission au Centre Hospitalier Départemental du Borgou (CHD-B), l’examen clinique a noté: • un syndrome infectieux avec une fièvre à 39°C, une asthénie et une cachexie (Indice de Masse Corporelle à 14 kg/m²); la fièvre était constante, en plateau et résistante au traitement antipalustre et à une antibiothérapie par voie orale • un syndrome de condensation pulmonaire bilatérale: toux avec expectoration purulente, douleurs thoraciques, polypnée et râles crépitants bilatéraux • un syndrome d’insuffisance cardiaque droite: œdème des membres inférieurs bilatéraux, hépatomégalie douloureuse avec reflux hépato-jugulaire, ascite de petite abondance, tachycardie régulière et un galop droit • une dysurie.

L’examen gynécologique était normal.

La biologie a révélé une hyperleucocytose à 21 500 leucocytes/ mm3 à prédominance neutrophile (80%), une élévation de la protéine C-réactive à 96 mg/l, une insuffisance rénale légère avec une urémie à 0.60 g/l et une créatininémie à 15.57 mg/l.

L’exploration biologique de l’ascite a révélé un liquide de type transsudatif et stérile. L’examen cytobactériologique des urines, la recherche des béta HCG à la bandelette urinaire et la sérologie HIV étaient négatifs. L’hémoculture non disponible n’a pu être réalisée.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

e7

ulaire droite (TAPSE = 13 mm) à l’échodoppler cardiaque de contrôle réalisé au 21ème jour d’antibiothérapie. Néanmoins les cavités droites sont restées dilatées avec persistance d’une insuffisance tricuspide massive.

Après 40 jours d’hospitalisation la patiente fut mise en exéat sous cefpodoxime, métronidazole et ciprofloxacine par voie orale pour 15 jours.

L’électrocardiogramme a inscrit une tachycardie sinusale régulière à 120 battements/min avec une déviation axiale droite (± 110°). La radiographie pulmonaire a montré des lésions d’âges différents: des excavations pulmonaires évoquant des foyers abcédés détergés et une plage de condensation pulmonaire d’allure évolutive. Il existait par ailleurs une cardiomégalie (Rapport cardiothoracique: 0,60) (Fig. 1). L’échographie pelvienne était normale.

L’échodoppler cardiaque trans-thoracique a objectivé la présence de plusieurs végétations pédiculées, mobiles siégeant sur la face atriale de la valve tricuspide, une dilatation du cœur droit (VD/VG: 1.5), une insuffisance tricuspide massive et une dysfonction ventriculaire droite (TAPSE: 9 mm). Il existait également une lame d’épanchement péricardique. Le cœur gauche était normal (Fig. 2).

Le diagnostic d’endocardite infectieuse tricuspide subaigüe avec emboles septiques pulmonaires a été retenu. La porte d’entrée gynécologique a été retenue sur la base des antécédents d’avortements.

Une tétra-antibiothérapie probabiliste à base d’ampicilline, gentamycine, métronidazole et ciprofloxacine par voie intraveineuse associée au furosémide intraveineuse et supplémentation potassique par voie orale a été instituée.

L’évolution a été marquée par: • une chute progressive de la fièvre avec apyrexie à partir du 10ème jour d’antibiothérapie • une régression progressive des œdèmes et des signes respiratoires (toux, dyspnée, râles crépitants). Il a persisté néanmoins une tachycardie autour de 100 battements/min avec le bruit de galop droit de même qu’une discrète hépatalgie au 21ème jour d’antibiothérapie • une amélioration de l’état général avec reprise progressive du poids • une nette réduction des végétations tricuspidiennes (en nombre et en taille) et une amélioration de la fonction ventric-

L’avortement clandestin, pratique courante en Afrique, est souvent réalisé dans des conditions à haut risque.3 Les complications dues à ces avortements sont lourdes, avec une mortalité élevée.4 L’incidence de l’endocardite infectieuse compliquant les procédures gynéco-obstétricales est faible et varie entre 0.03 et 0.14 pour mille naissances.5 Cette incidence est encore plus faible après avortement dans les séries européennes.6 Les données africaines sont très variables. En effet, dans la série de Naidoo et al. en Afrique du Sud, la porte d’entrée était gynécologique post abortive dans 20% des endocardites du cœur droit rapportés.7 En revanche, les séries sénégalaises et burkinabés, n’ont rapporté aucun cas d’endocardite du post abortum.8-10 La fièvre prolongée est le signe d’appel essentiel de l’endocardite infectieuse.2,5-10 L’association à un syndrome d’insuffisance cardiaque est très évocatrice et chez notre patiente nous a orienté vers une atteinte du cœur droit.7 La radiographie pulmonaire a aidé au diagnostic en montrant des lésions d’âges différents en faveur d’emboles septiques. Les atteintes pulmonaires consécutives à des emboles septiques d’une endocardite tricuspide bien que rares ont été chez des toxicomanes.11,12 Chez notre patiente la présence d’excavation pouvait faire évoquer des cavernes tuberculeuses et faire égarer le diagnostic surtout devant le caractère subaigu de la symptomatologie.9

Fig. 1. R adiographie pulmonaire de face: cardiomégalie, plage de condensation pulmonaire du lobe moyen droit (étoile), lame pleurale droite (flèche) et excavations à parois fines (triangles) basithoracique droite et de la linguila.

Fig. 2. Image échographique transthoracique en incidence apicale quatre cavités montrant une importante dilatation des cavités cardiaques droites et une végétation visible sur la face atriale du feuillet latéral de la tricuspide (flèche).

Discussion

e8

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

L’impossibilité de réaliser localement les hémocultures a constitué un handicap dans la gestion de ce dossier. En effet, l’hémoculture occupe une place importante dans la prise en charge d’un patient suspect d’endocardite infectieuse. Elle permet de certifier le diagnostic en isolant le germe.

Notre patiente présentait: un critère majeur (végétations tricuspidiennes) et deux critères mineurs (la fièvre > 38°C, les abcès pulmonaires) selon les critères de Duke modifiés.13 Ceci nous a permis de retenir le diagnostic d’endocardite malgré l’absence d’hémoculture. L’hémoculture permet également de redresser l’antibiothérapie probabiliste. A défaut de l’hémoculture, la suspicion du germe responsable, dans ce dossier, a été basée essentiellement sur la porte d’entrée. Chez notre patiente, elle était gynécologique.

Si les germes responsables de l’endocardite infectieuse sont prioritairement les streptocoques et les staphylocoques, le Staphylococcus aureus est le plus retrouvé dans les endocardites du cœur droit.2,7,14 Malgré ces données, devant l’évolution subaigüe du tableau de notre patiente, nous ne pouvions éliminer la responsabilité des streptocoques; les staphylocoques réalisant plutôt un tableau aigue. La grossesse tout comme l’abus d’alcool, le diabète, les maladies cancéreuses sont des conditions particulièrement favorisantes l’endocardite infectieuse à streptocoque du groupe B.15 L’endocardite à streptocoque groupe B, touche préférentiellement les valves du cœur droit, est d’évolution subaigüe et de pronostic meilleur.16 Elle reste cependant rare. Sur la période de 1985 à 2002 de pratique gynéco-obstétricale, Crespo et al ont rapporté seulement 11 cas d’endocardite infectieuse à streptocoque du groupe B dans la littérature anglophone.17 L’antibiothérapie dans l’endocardite infectieuse doit être bactéricide, synergique et prolongée. L’association pénicillineaminoside que nous avons choisie est la combinaison de première intention dans les endocardites à streptocoque de groupe B.18 Si l’évolution sur le plan infectieux a été très bonne, cette patiente a gardé une insuffisance tricuspide massive qui a entretenu une insuffisance cardiaque droite résiduelle. Un traitement chirurgical s’impose pour améliorer le pronostic fonctionnel et vital de cette jeune patiente.2 Il consistera, selon l’état valvulaire, en une annuloplastie tricuspide ou en un remplacement de la valve tricuspide par bioprothèse.

AFRICA

2000: 1506–1547.

2.

Murdoch DR, Corey GR, Hoen B, et al. Clinical presentation, etiology, and outcome of infective endocarditis in the 21st century: the international collaboration on endocarditis –prospective cohort study. Arch Intern Med 2009; 169: 463–473.

3.

World Health Organisation. Unsafe abortion. Global and regional estimates of unsafe abortion and associated mortality in 2000.

Geneva. 4th edn, 2004: 82. Accessible au whqlibdoc.who.int/publications/2004/9241591803.pdf consulté le 20 Aout 2014.

4.

Iloki LH, Zakouloulou-Massala A, Gbala-Sapoulou MV. Complications des avortements clandestins: A propos de 221 cas observés au chu de Brazzaville (Congo). Méd d’Afr Noire 1997; 44(5): 262–264.

5.

Ward H, Hickman RC. Bacterial endocarditis in pregnancy. Aust NZ Obstet Gynaecol 1971; 11: 189–191.

6.

Henshaw S, Forrest JD, Sullivan E, Tietze C. Abortion in the United States, 1978–1979. Fam Plan Perspect 1981; 13: 6–7.

7.

Naidoo DP. Right-sided endocarditis in the non-drug addict. Postgrad Med J 1993; 69: 615–620.

8.

Ndiaye MB, Diao M, Kane A, Bodian M, Mbaye A, Dia MM, et al. Endocardite infectieuse en milieu cardiologique Dakarois: étude descriptive à propos de 39 cas. Pan African Med J 2010; 7(12). Epub 2010 Nov 14.

9.

Ndiaye MB, Diao M, Pessinaba S, Bodian M, Kane A, Mbaye A, et al.

Aspects épidémiologiques, cliniques et échographiques des endocardites infectieuses du cœur droit au Sénégal: 6 observations. Méd Trop 2011; 71(5), 484–486.

10. Yameogo NV, Sondo KA, Yameogo AA, Kagambega LJ, Mandi DG, Kologo KJ, et al. Epidemiological and clinical features, ultrasound findings and prognosis of right-sided infective endocarditis in a teaching hospital in Ouagadougou: cardiovascular topics. Cardiovasc J Afr 2013; 24(5): 171–173.

11. Weymann A, Schmack B, Rosendal C, Rauch H, Karck M, Tochtermann U, et al. Tricuspid valve endocarditis with septic pulmonary emboli in a drug addict. Ann Thorac Cardiovasc Surg 2012; 18(5): 481–484.

12. Panduranga P, Al-Mukhaini M, Sulaiman K, Al-Abri S. Tricuspid valve endocarditis in an intravenous drug abuser masquerading as pulmonary tuberculosis. Heart Views 2010; 11(3): 121–124.

13. Li JS, Sexton DJ, Mick N, Nettles R, Fowler VG, Jr, Ryan T, et al.

Proposed modifications to the Duke criteria for the diagnosis of infective endocarditis. Clin Infect Dis 2000; 30(4): 633–638.

14. Butany J, Dev V, Leong SW, Soor GS, Thangaroopan M, Borger MA. Infective endocarditis of the tricuspid valve. J Card Surg 2006; 21:

Conclusion Bien que rare, l’endocardite infectieuse constitue l’une des complications graves procédures gynécologiques notamment l’avortement illicite. Ainsi la fièvre au long court chez une femme en âge de procréer doit impérativement faire rechercher une manœuvre abortive.

603–604.

15. Farley MM, Harvey RC, Stull T, et al. A population-based assessment of invasive disease due to group B Streptococcus in nonpregnant adults.

N Engl J Med 1993; 328: 1807–1811.

16. Munoz P, Llancaqueo A, Rodriguez-Creixems M, et al. Group B Streptococcus bacteremia in non pregnant adults. Arch Intern Med 1997; 157: 213–216.

17. Crespo A, Retter AS, Lorber B. Group B streptococcal endocarditis

References 1.

Karchmer AW. Endocardite infectieuse. In: Brunwald E. Traité de Medicine Cardiovasculaire. 2ème edn française. Italie: Piccin Nouva,

in obstetric and gynecologic practice. Infect Dis Obstet Gynecol 2003; 11(2), 109–115.

18. Atri ML. Group B Streptococcus endocarditis following second-trimester abortion. Arch Intern Med 1990; 150: 2579–2580.

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

e9

Case Report Removal of broken catheter piece with snare device during endovascular treatment of post-traumatic brachial artery pseudo-aneurysm Veysel Temizkan, Alper Ucak, Ibrahim Alp, Murat Fatih Can, Gokhan Arslan, Ahmet Turan Yilmaz

Abstract Post-traumatic pseudo-aneurysm is a rare complication of penetrating vascular injury. Endovascular stent implantation has become an alternative approach in the management of this pathology. In our case, we present a brachial artery pseudo-aneurysm that was treated with endovascular stent implantation, and removal of a broken catheter part with a three-dimensional snare device.

Keywords: pseudo-aneurysm, endovascular, stent, catheter Submitted 16/2/13, accepted 10/2/15 Previously published online 9/4/15 Cardiovasc J Afr 2015; 26: e9–e11

www.cvja.co.za

DOI: 10.5830/CVJA-2015-025

The aetiology of pseudo-aneurysms includes blunt or penetrating trauma, iatrogenic injury during vascular procedures, or dehiscence of a vascular graft. Pseudo-aneurysms can be treated in a variety of ways and treatment decisions often depend on their size and location.1 The frequency of peripheral artery pseudo-aneurysms is much lower in the upper than the lower extremities.2 Although gold-standard treatment is still the surgical approach, endovascular methods have become more frequently used in recent decades. The technological development of new-generation devices allows a short processing time, quick recovery and less traumatic process.3-5 Nevertheless, some complications such as rupture, dissection, catheter breakage,

Department of Cardiovascular Surgery, Haydarpasa Training Hospital, Gulhane Military Medicine Academy, Istanbul, Turkey Veysel Temizkan, MD, veyseltemizkan@gmail.com Alper Ucak, MD Ibrahim Alp, MD Murat Fatih Can, MD Ahmet Turan Yilmaz, MD

Department of Cardiovascular Surgery, Gulhane Military Medicine Academy, Ankara, Turkey Gokhan Arslan, MD

and thrombo-embolism during endovascular procedures may be seen.6-8 In this case, we present treatment of a post-traumatic brachial artery pseudo-aneurysm and the management of iatrogenic breakage of the catheter.

Case report A 20-year-old male patient was admitted to the emergency department one hour after a 9.65-mm (38-cal) gunshot bullet wound to the right arm. The entrance and exit wounds were directly one-third proximal-lateral and medial of the right upper extremity. There was no active bleeding.

Vital signs on admission included blood pressure of 130/70 mmHg in the right arm and 120/60 mmHg in the left arm, and a heart rate of 90 beats per minute. The patient had palpable brachial, radial and ulnar pulses. The Allen test for vascular integrity of the radial and ulnar arteries was normal at the extremities. Capillary filling time was two seconds. The right arm was larger than the left arm. There was a pulsatile mass and murmur on auscultation.

Colour Doppler scanning showed a brachial artery pseudoaneurysm of 14 × 13 mm in diameter in the proximal segment of the vessel (Fig. 1A). Brachial angiography was planned seven hours after hospitalisation.

A 6-Fr introducer sheath was placed in the right common femoral artery (CFA) and a 0.035-Fr guide wire was advanced through the right proximal brachial artery. A pigtail catheter was advanced over the guide wire. Angiography showed a pseudoaneurysm sac in the proximal part of the right brachial artery.

Extravasation was not observed (Fig. 1B). The pseudo-aneurysm was stented using a 6 × 50-mm stent (Gore, WL, Arizona, USA) (Fig. 1C).

Control angiography showed however that the stent could not be opened completely because of external compression of a haematoma (Fig. 1B). A 5 × 30-mm Viatrac (Abbott Vascular, Santa Clara, CA, USA) dilatation balloon over the guide wire was advanced through the guiding catheter to the target lesion.

When the lesion was reached, it was dilated successfully with a maximum of 9 atm. There was no residual stenosis afterwards.

The pseudo-aneurysm sac was observed to be closed, with normal passage of contrast distally.

During removal of the balloon catheter, the guide wire was difficult to manipulate at the level of the abdominal aorta and we had to force it. Although removal of the whole system was achieved, the distal part of the catheter was not found. We

e10

A

CARDIOVASCULAR JOURNAL OF AFRICA â&#x20AC;˘ Volume 26, No 2, March/April 2015

B

AFRICA

C

Fig. 1. A : Colour Doppler USG showing brachial artery pseudo-aneurysm sac, B: white arrow is DSA angiographically visualised brachial artery pseudo-aneurysm sac, black arrow is haematoma at the proximal segment of the sac, C: implanted stent.

checked the instruments and observed that the distal part of the balloon catheter was broken. Angiography showed the catheter tip in the abdominal aorta (Fig. 2A). In the same session, the catheter piece was successfully removed using a threedimensional snare device (Mini EN snare, Gainsville, FL, USA).

Control angiography showed the piece was removed completely (Figs 2B, C and 3).

Discussion Pseudo-aneurysms may develop when the layers of an artery are A

disrupted and a haematoma forms within the peri-arterial tissues.

The haematoma becomes a cavity of blood and thrombus, and this becomes a pseudo-aneurysm if it communicates with the true vessel lumen. There are many aetiologies but pseudoaneurysms are primarily caused by anastomosis dehiscence, vascular procedures, and blunt or penetrating trauma.1 Endovascular graft implantation is a new, minimally invasive intervention. It can be used for aneurysms and pseudoaneurysms of the peripheral arterial system and for arteriovenous fistulae. With the introduction of endovascular techniques for applications related to vascular injury, less-invasive modalities

B

Fig. 2. A : Removal of broken catheter piece, B, C: three-dimensional snare device.

C

AFRICA

CARDIOVASCULAR JOURNAL OF AFRICA • Volume 26, No 2, March/April 2015

e11

rate for removal of intravascular foreign bodies; thereafter the success rate was 96%, and surgically treated cases had only a 4% success rate.8 The use of endovascular procedures may be faster and safer for the treatment of post-traumatic vascular lesions. Studies have shown a low incidence of complications,8 however, definite indications are not clear.

Fig. 3. Broken catheter piece.

have increasingly been used in the treatment of selected patients with a variety of peripheral vascular injuries.4 Since the first report of transfemoral endovascular exclusion of an abdominal aortic aneurysm (AAA) by Parodi in 1991, significant early clinical experience using different endovascular devices for the treatment of aortic aneurysms has been accumulated. Endovascular treatment of peripheral arterial aneurysms, pseudo-aneurysms and arteriovenous fistulae has become feasible as a natural extension of the endovascular techniques initially devised for the treatment of aortic aneurysms and arterial occlusive disease.5 The potential advantages of endovascular repair of peripheral non-occlusive arterial pathology are derived from avoidance of major surgical procedures that typically require long hospital stays and are associated with significant morbidity.5 However, endovascular treatment methods are not currently seen as the gold standard.1-8 In recent years, complications of percutaneous interventions have been better defined. Some of these include displacement of the stent, catheter embolisation as a result of breakage or rupture, perforation, haematoma and dissection. Despite complication rates as low as 1% in terms of outcome of death, in a retrospective study by Motta et al. it was found that catheter rupture, fracture or migration require an intervention as soon as possible.6 The most common cause of catheter rupture is use of wornout equipment. In our case the reason for the complication was that we probably forced the guide wire too hard at the level of the abdominal aorta. The severity of acute complications requires removal of the broken parts as soon as possible.6 Complications of percutaneous approaches have led to the testing of different devices for removal of intravascular foreign bodies,7 for example, balloon catheter, forceps, guide wire, introducer and snare. Forceps and sheath are rigid and short; the balloon catheter and guide wire are seldom used due to limited space. In many cases of intravascular foreign body removal, different types of snares are preferred.7,8 In a 12-year study by Wolf et al., the snare loop initially produced an 87% success

Conclusion With rapid technological development and the appropriate use of new devices, endovascular methods should be given priority because of the short surgery time, less trauma, and safety of the procedures in elective cases. For these reasons, we chose endovascular treatment in our case instead of the surgical option, despite endovascular treatment methods not currently being seen as the gold standard.1-8

References 1.

Abrames EL, Chen SR, Jones W, Folio L. Traumatic carotid pseudoaneurysm post gunshot wound to the head/neck. Mil Med 2008; 173(5): xv–xvi.

2.

Yetkin U, Gurbuz A. Post-traumatic psoudoaneurysm of the brachial artery and its surgical treatment. Tex Heart Inst J 2003; 30(4): 293–297.

3.

O’Neill S, O’Donnell ME, Collins A, Harkin DW. Brachial artery aneurysm following open repair of post-traumatic false aneurysm and arteriovenous fistula. Vasc Endovascr Surg 2010; 44(8): 691–692. doi: 10.1177/1538574410377669. Epub 2010 Jul 30.

4.

DuBose JJ, Rajani R, Gilani R, Arthurs ZA, Morrison JJ, Clouse WD, et al. Endovascular management of axillo-subcalvian arterial injury: a review of published experience. Injury 2012; 43(11): 1785–1792. doi: 10.1016/j.injury.2012.08.028. Epub 2012 Aug 22.

5.

Criado E, Marston WA, Ligush J, Mauro MA, Keagy BA. Endovascular repair of peripheral aneurysms, pseudoaneurysms, and arteriovenous fistulas. Ann Vasc Surg 1997; 11(3): 256–263.

6.

Motta Leal Filho JM, Carnevale FC, Nasser F, Santos AC, Sousa Junior W de O, Zurstrassen CE, et al. Endovascular techniques and procedures, methods for removal of intravascular foreign bodies. Rev Bras Cir Cardiovasc 2010; 25(2): 202–208.

7.

Bonvini RF, Rastan A, Sixt S, Noory E, Beschorner U, Leppanen O, et al. Percutaneous retrieval of intravascular and intracardiac foreign bodies with a dedicated three-dimensional snare: A 3-year single center experience. Catheter Cardiovasc Interv 2009; 74(6): 939–945. doi: 10.1002/ccd.22074.

8.

Wolf F, Schernthaner RE, Dirisamer A, Schoder M, Funovics M, Kettenbach J, et al. Endovascular management of lost or misplaced intravascular objects: Experiences of 12 years. Cardiovasc Intervent Radiol 2008; 31(3): 563–568. Epub 2007 Oct 23.

www.cvja.co.za

CardioVascular Journal of Africa (official journal for PASCAR)

Why you should publish with CVJA • Increased international exposure (indexed in Pubmed, Medline, Pubmed Central, Scopus, Embase and Thompson Reuters/ISI)

• Quick return on submissions • Changing patterns of heart disease in Africa get more exposure than in other journals

• Acceptance of diabetes studies as vascular studies in CVJA • African studies are given preference • Well-illustrated interventional studies are needed for CME in Africa (full website support capability)

• Instructions for authors on www.cvja.co.za • A PowerPoint presentation for new authors: 'How to write a scientific paper'

• Submit your manuscript online at www.cvja.co.za

Contact us on info@clinicscardive.com CVJA has the capability of publishing on Pubmed Central

For further product information contact PHARMA DYNAMICS P O Box 30958 Tokai Cape Town 7966 Tel 021 707 7000 Fax 021 701 5898 Email info@pharmadynamics.co.za CUSTOMER CARE LINE 0860 PHARMA (742 762) www.pharmadynamics.co.za

BRB93/03/2015.

MARCH/APRIL 2015 VOL 26 NO 2

www.cvja.co.za

CardioVascular Journal of Africa (official journal for PASCAR)

• H pylori infection in HIV-infected Africans on HAART • Dietary salt intake among medical students in Angola • TNNI3 gene mutations in South African patients • HIV-associated large-vessel vasculopathy • PASCAR Hypertension Task Force meeting • Spontaneous coronary artery dissection • Sudden cardiac death in low-resource settings • Cardiac sarcoidosis in pregnant women with arrhythmia

From only R31.61 SEP excl. VAT per tablet.

PUBLISHED ONLINE

For further product information contact PHARMA DYNAMICS P O Box 30958 Tokai Cape Town 7966 CUSTOMER CARE LINE 0860 PHARMA (742 762) www.pharmadynamics.co.za

Tel 021 707 7000 Fax 021 701 5898 Email info@pharmadynamics.co.za

DYNAFIL 50 mg: Each film-coated tablet contains sildenafil citrate equivalent to 50 mg sildenafil. Reg. No.: RSA S4 42/7.1.5/1071. NAM NS2 13/7.1.5/0086. DYNAFIL 100 mg: Each film-coated tablet contains sildenafil citrate equivalent to 100 mg sildenafil. Reg. No.: RSA S4 42/7.1.5/1072. NAM NS2 13/7.1.5/0087. For full prescribing information refer to the package insert approved by the Medicines Control Council, September 2012. * Department of Health Website. http://www.health.gov.za – Accessed 19/02/2015. DLC94/03/2015.

Printed by Tandym Printers

Active Ingredient: Sildenafil 50 mg 4’s pack SEP excl.VAT - R126,46 100 mg 4’s pack SEP excl.VAT - R173,44

Cardiovascular Journal of Africa . Vol 26, No 2, March/April 2015

Advise your patients about THE AFFORDABLE OPTION* for Erectile Dysfunction

• Radiofrequency ablation on a morbidly obese patient • May–Thurner syndrome with inconsistent findings