Page 1


EL HOMBRE TEMPRANO EN AMÉRICA y SUS IMPLICACIONES

EN EL POBLAMIENTO

DE LA CUENCA DE MÉXICO PRIMER SIMPOSIO INTERNACIONAL


COLECCIÓN CIENTÍFICA SERIE ANTROPOLOGÍA FÍSICA


EL HOMBRE TEMPRANO EN AMÉRICA y SUS IMPLICACIONES EN EL POBLAMIENTO DE LA CUENCA DE MÉXICO PRIMER SIMPOSIO INTERNACIONAL José Concepción Jiménez López Silvia González José Antonio Pompa y Padilla Francisco Ortiz Pedraza Coordinadores

INSTITUTO NACIONAL DE ANTROPOLOGÍA E HISTORIA


El hombre temprano en América y sus implicaciones en el poblamiento de la Cuenca de México: Primer Simposio Internacional/coordinadores José Concepción Jiménez López, Silvia González, José Antonio Pompa y Padilla, Francisco Ortiz Pedraza. - México: Instituto Nacional de Antropología e Historia, 2006. p. : 26 cm.-(CoIección Científica; 500. Serie Antropología) ISBN: 968-03-0195-8 1. Hombre primitivo - América. 2. Mesoamérica - Civilización. 1. Simposio Internacional El Hombre temprano en América y sus implicaciones en el poblamiento de la Cuenca de México (lo: 2002 Agosto 7-9: México).II.Jiménez López,José Concepción, coord. IIl. González, Silvia, coord. IV. Pompa y Padilla, José Antonio, coord. V. Ortiz Pedraza, Francisco, coord. VI serie. LC: E61 H65

Primera edición: 2006

D.R. ©Instituto Nacional de Antropología

e Historia

Córdoba 45, Col. Roma, 06700, México, D.F. sub_fomento.cncpbs@inah.gob.mx ISBN: 968-03-0195-8

Todos los derechos obra por cualquier informático,

reservados.

Queda prohibida

medio o procedimiento,

la fotocopia

o la grabación,

titulares de los derechos de esta edición. Impreso y hecho en México

la reproducción

comprendidos

total o parcial de esta

la reprografia

sin la previa autorización

y el tratamiento

por escrito de los


~

INDICE

Agradecimientos

13

Prólogo

15

Joaquín Arroyo Los antiguos pobladores de México: evidencia osteológica José Anlonio Pompa y Padilla

17

Apuntes sobre las investigaciones y América Luis F. Bale y Alejandro Terrazas

23

prehistóricas

en México

La Mujer del Peñón III José Concepción Jiménez López, Rodo Hernández FLores, / GLoriaMarlínez Sosa y GabrieLSaucedo Arleaga Early Humans in Mexico: New Chronological Data SiLvia González, José Concepción Jiménez López, Roberl Hedges,

49

67

José Anlonio Pompa y Padilla and David Huddarl A Review of Environmental Change in the Basin of Mexico (40000-10 000 BP): Implications for Early Humans David Huddarl and SiLvia González Momificación artificial y patrón de residencia de las poblaciones Chinchorro. Indicadores de una temprana ocupación de cazadores recolectores que habitaron de Atacama lván R Muñoz OvaLle y Bernardo Arriaza

el desierto costero

77

107


ÍNDICE

Fechamiento mediante

de restos óseos de la cuenca del valle de México técnicas calorimétricas

145

Luis Lozano Aguirre Beltrán, Alejandro Heredia Barbero, Miguel Ángel Peña Rico, Eduardo Villarreal Ramírez, José Ocotlán Flores, Eligio Orozco Mendoza y Lauro Bucio Galindo Approximate Dating ofTephra Using the Microscope "Seat-of-the-Pants" Methods to Roughly Date Quaternary Archaeological and Paleontological Sites by Associated Pumice and Volcanic Ash Layers

155

Virginia Steen-McIntyre The Search for Evidence of the Coastal Entry Route in Baja California Alan L. Bryan and Ruth Gruhn

167

La diversidad pleistoceno-holocénica del valle de México, ¿puede ser explicada por evolución selectiva? Héctor M. Pucciarelli, Marina L. Sardi, Carlos Serrano Sánchez y Fernando Ramírez Rozzi

175

Patrón de desgaste dento-oclusal mexicanos

185

en dos cráneos

precerámicos

Ricardo Lascuráin Ledesma, Carlos Serrano Sánchez, Raúl Chávez Sánchez, José Luis Críales Cortés y Ximena Chávez Balderas Análisis molecular del ADNmt en restos óseos de los primeros pobladores de la cuenca de México Adrián Martínez-Meza, Miguel Moreno Galeana, Álvaro Díaz-Badillo y María de Lourdes Muñoz Moreno

193

Reconstrucción facial escultórica de un cráneo de México (Peñón I1I) Lorena Valencia y María Villanueva

205

precerámico

Buhl Revisited: Thee-Dimensional Photographic Reconstruction and Morphometric Re-Evaluation Nicholas P. Herrmann, Richard L. Jantz and Douglas W Owsiey

211

Agrilocalidades

221

y territorialidad

en el Pleistoceno

tardío del norte

de Sudamérica Cristóbal Gnecco Climate, Environment, and Carne Animal Resources of the Late Pleistocene Mexican Crassland EileenJhonson, Joaquín Arroyo-Cabrales and Óscar J. Polaco

231


ÍNDICE

A Preliminary

Report of the McMinnville Mammoth,

Oregon:

247

A Taphonomic Approach Robson Bonnichsen, Michael Full and Marvin Reken Mammoths from the Basin of Mexico: Stratigraphy and Radiocarbon Dating Silvia Gonz.ález, Luis Morett Alatorre, David Huddart and Joaquín Arroyo-Cabrales

263


De todos los animales, el hombre es el único que se pregunta de dónde viene y a dónde va. El futuro constituye una perspectiva aterradora; es incierto y los profetas se sienten consternados ante él. En cambio tenemos una visión más serena de nuestro pasado, porque ya dispone más de una seria acumulación de datos. Desde luego estamos sumidos en la mayor perplejidad respecto a los orígenes de la vida y las razones de nuestra existencia, problemas que han tratado de interpretar tanto los filósofos como los fabricantes de mitos. Pero sabemos aproximadamente lo que sucedió a lo largo del camino, y ésta es la historia de la evolución humana ... HOWELLS,

1946


AGRADECIMIENTOS

El comité organizador agradece el apoyo y la co-

a la página de internet del equipo Naya de Argentina. Por último, a todas las personas que desarrollando diversas actividades colaboraron para la realización del Primer Simposio Internacional "El hombre temprano en América y

laboración que le han brindado algunas dependencias del INAH, como la Secretaría Técnica, la Coordinación Nacional de Antropología, el Museo Nacional de Antropología, la Dirección de Salvamento Arqueológico, el Museo Nacional de las Culturas, la Subdirección de Museografía

sus implicaciones en el poblamiento ca de México".

del MNA y la Dirección de Medios de Comunicación. Asimismo, al Departamento de Multimedia del Centro Nacional de las Artes, Conaculta, al Canal 11 del Instituto Politécnico Nacional y a algunos medios de comunicación escrita de México. A la revista Mammoth Trumpet de EVA y

de la cuen-

Agradecemos al biólogo Óscar Polaco por haber revisado la obra. De manera especial agradecemos a Rocío Hernández Flores y Gloria Martínez Sosa su empeño y dedicación para que este trabajo llegara a buen término.

13


PRÓLOGO Joaquín Arroyo

El Instituto Nacional de Antropología e Historia, a través de la Dirección de Antropología Física, organizó el Primer Simposio Internacional "El hombre temprano en América y sus implicaciones co", el Torres gía, en

Esta memoria difunde parte de los trabajos presentados en el encuentro; en México, las investigaciones sobre poblamiento temprano, han sido esporádicas y casi nulas desde hace por lo menos dos lustros. Las razones son muchas: una es que la mayoría de los antropólogos ha enfocado sus estudios a zonas con un notable desarrollo cultural y de una arquitectura monumental de la época prehispánica, del periodo virreinal y moderno. Por tal motivo, existe un vacío de información sobre el conocimiento de

en el poblamiento de la cuenca de Méxicual tuvo como sede el Auditorio Jaime Bodet del Museo Nacional de Antropolola ciudad de México, del 7 al 9 de agosto

de 2002. Un aspecto relevante en este simposio fue la presentación de los resultados obtenidos en los fechamientos directos por medio del método del CI4 de siete especímenes humanos precerámicos de México, los cuales sorprendieron a la comunidad académica debido a que en uno de ellos, la "Mujer del Peñón 111",se determinó la antigüedad más alta de cualquier espécimen humano reportado hasta el momento en el continente americano.

la presencia de los primeros grupos humanos que llegaron a esta parte del continente americano. Estos resultados de alguna manera llenan los espacios vacíos sobre el conocimiento del hombre paleoamericano. Gracias a la excelente respuesta que mereció la convocatoria emitida por el comité organizador fue posible llevar a buen término este simposio, en el que participaron investigadores especializados de México, Estados Unidos, Canadá, Argentina, Colombia, Chile, Brasil e Inglaterra.

El simposio tuvo como objetivo principal reunir a especialistas nacionales e internacionales, para que presentaran los resultados y avances de sus investigaciones sobre el origen del hombre americano, antigüedad, migración, medio ambiente, megafauna, pinturas rupestres, entre

En esta reunión académica se presentaron 33 conferencias, cuya temática se relacionó en lo

otros temas de interés sobre el poblamiento de América. La finalidad de este tipo de eventos

general con el poblamiento temprano de América y, en lo particular, con la cuenca de México. La memoria de este primer simposio están conformadas por 18 artículos referentes a los siguientes temas: datación de esqueletos humanos con una antigüedad que va de 12700 a 3500 a.P.,

académicos es que a través de los trabajos presentados se generen debates que enriquezcan el conocimiento del poblamiento temprano no sólo en México, sino en toda América.

15


PRÓLOGO

considerados los más antiguos del continente; la megafauna, principalmente de la cuenca de Mé-

ción nueva sobre la presencia temprana de los humanos en América. En esta forma se deja un

xico; el análisis molecular de los primeros pobladores de la cuenca de México; la reconstrucción facial de algunos especímenes humanos precerámicos de América; la agricolaridad y la territorialidad en el Pleistoceno tardío en Sudamérica, la momificación artificial de una temprana ocu-

registro escrito sobre la prehistoria de América. Esperamos que estos trabajos generen, entre los lectores interesados en el tema, discusiones a partir de nueva información y que las nuevas generaciones se interesen y continúen con innovadoras líneas de investigación.

pación de cazadores recolectores que habitaron el desierto costero de Atacama, etcétera.

Para finalizar incluimos los nombres de cuatro destacados investigadores fallecidos en los últimos cinco años y que dedicaron parte de su

Este primer simposio cumplió su propósito, ya que fue un foro abierto donde se presentaron los resultados de varios estudios sobre las primeras migraciones y su antigüedad, así como el

vida a la búsqueda de las huellas de los primeros hombres en América: Luis Aveleyra Arroyo de Andat Leonardo Manrique Castañedat Francisco González Rult

proceso que se sigue para entender la diversificación biológica y cultural y su entorno natural.

Robson Bonnichsent

Todo ello se expuso para dar a conocer informa-

16


Los

ANTIGUOS POBLADORES DE MÉXICO: EVIDENCIA OSTEOLÓGICA José Antonio Pompa y Padilla*

RESUMEN

INTRODUCCIÓN

La intención del autor de este trabaJo es presentar una visión general sobre el poblamiento temprano del continente americano y un resumen

Nos referimos en forma general al origen y a la migración del hombre hacia América, y en par-

de carácter histórico sobre los hallazgos de los restos óseos humanos que conforman la colección con que cuenta la Dirección de Antropolo-

día tenemos de los primeros hombres que llegaron al actual territorio mexicano. Sabemos que el hombre no es originario de América y que desde el siglo XVI, después de los primeros contactos entre Europa y América, surgió una gran curiosidad respecto a la procedencia de los indígenas americanos, puesto que no se tenía noticia de la existencia del continente y menos aún de que estuviera habitado. Para

ticular a las evidencias óseas y dentales que hoy

gía Física del Instituto Nacional de Antropología e Historia (INAH) en México.

ABSTRACT The ip.tention of this work is the one of presen-

1590 José de Acosta (1962; Lorenzo, 1967: 29) sugiere que había un paso por tierra desde otro continente, ya que menciona:

ting a general view on the topic of the early peopling of the American continent and a summary of historical character to near the discoveries of the human skeletal remains that conform the collection with which is preserved at the Dirección de Antropología Física del Instituto Nacional de Antropología e Historia (INAH) in Mexico.

el nuevo que llaman Indias no está tan lejos del otro, del conocido [... ] más por camino de tierra que por mar. [ ... ]

Más diciendo verdad, yo estoy de muy diferente opinión, y no me puedo persuadir que hayan venido los primeros indios a este nuevo mundo por navegación ordenada y hecha de propósito ...

PALABRAS CLAVE: Poblamiento,

historia, restos humanos. Tenía razón: la navegación a distancia no es cosa fácil y la posibilidad de contactos transoceánicos con América era extremadamente ba-

*Dirección de Antropología Física del

ja para épocas muy tempranas. Doran (1973: 117)

INAH.

17


-------------

JOSÉ ANTONIO

POMPA y PADILLA

refiere que en Egipto hay evidencia de embarcaciones con vela hacia 3000 años antes de Cris-

la agricultura; hoy día contamos con los correspondientes a cuarenta y nueve individuos, aun-

to y en China 1000 años a.C.; ahora sabemos que el poblamiento de América se inició mucho antes. Esto no niega que algunos llegaron al nuevo continente por vía marítima y de hecho siguen llegando, pero no fueron los primeros; si alguien arribó por mar, debió haber encontrado habitantes en el nuevo mundo. Podemos preguntar ¿por qué de Asia? La cercanía geográfica al norte de los continentes en el Estrecho de Bering, las exploraciones arqueológicas, los estudios de características biológico-genéticas, los datos lingüísticos, etc., nos demues-

que representados de diferentes maneras que van desde una pieza dentaria, como es el caso del molar de la cueva de los Grifos, Ocozocoautia, Chiapas, y el de Tepexpan (II), Estado de México, hasta un esqueleto completo como el de Chimalhuacán, Estado de México. Todos ellos fueron producto de veinticuatro hallazgos, de 103 cuales ocho fueron accidentales y dieciséis resultantes de exploraciones. La gran mayoría de ellos se localizaron en el centro de la República Mexicana. Los reportes de hallazgos son a partir de 1884 con el hombre del Peñón I (Genovés el al., 1982) y el último fue en 1985 con el hallazgo del hombre de Chimalhuacán (Pompa, 1988). Presentamos aquí de manera simple algunos datos generales de dichos hallazgos ordenados cronológicamente del más antiguo al más reciente.

tran que de ahí vinieron, pero ¿de qué región de Asia? Siberia, China, río Amur, río Lena, Kamtchatka, Chukotka, etc., son nombres que nos resultan familiares, ya que varios investigadores han escrito sobre el tema (Turner, 1989; Meltzer, 1989; Owen, 1984; Shapiro, 1964, etc.) y coinciden en expresar que los primeros pobladores de América provienen del noreste asiático. Sobre el origen y la migración del hombre al continente americano contamos con diversas hipótesis, como la planteada por Mendes Correa en 1925. Para él, América se había poblado cuando grupos de migrantes pasaron de Australia a Tasmania durante una glaciación, tomando esta ruta; otra hipótesis la planteó Ameghino, cuya posición fue monogenista, ya que consideraba que el hombre no surgió en el viejo mundo sino en América y de ahí pasó a otros continentes; en cambio, Ajes Hrdlicka supone que el hombre llegó por el noroeste de América, de ahí su afinidad asiática "mongoloide"; calcula que la antigüedad del hombre americano es de 15000 años; posteriormente él mismo se corrige y su-

Conforme a las investigaciones de lingüistas, genetistas, antropólogos físicos y geólogos, los grupos que ingresaron al continente fueron esencialmente tres: el primero llegó hace aproximadamente 14000 años, el de los paleoindios (que dio origen a la población amerindia). El segundo fue el grupo de los Na-Dene, que migró poco después y se le calcula una temporalidad de ± 10000 años; se estableció en la costa noroeste de Canadá. Por último llegó el grupo de los esquimales, que tienen una temporalidad de ± 4500 años y habitan dentro del Círculo Polar Ártico americano (Turner II, 1989).

giere que fue hace 10000 años. Para Paul Rivet, el origen debió ser múltiple; en sus conclusiones advierte la afinidad con los australianos, mala-

Las primeras evidencias de la presencia del hombre en México fueron publicadas por Mariano Bárcenas en 1882. Describe el hueso sacro

yos, polinesios, asiáticos y uralios; por último, Pablo Martínez del Río acepta que el poblamiento de América llegó por el Estrecho de Bering (Comas, 1966: 567-587, y 1974).

de un camélido fósil (¿llama?), que fue tallado para que adquiriera la apariencia de un cochino o coyote. Fue localizado el 4 de febrero

ANTECEDENTES HISTÓRICOS

de 1870 en la formación del Tajo de Tequixquiac que contenía fauna extinta; se encontró a doce metros de profundidad cuando se reali-

En México denominamos precerámicos a los restos más antiguos, previos a la cerámica y

18


Los ANTIGUOSPOBLADORES DEMÉXICO zaban las obras para el desagüe de la cuenca de México. Posteriormente, en el año de 1884, Bárcenas y Del Castillo anunciaron haber encontra-

gó a la conclusión de que son muy parecidos; de ahí que se tomaran como parámetro para establecer la antigüedad de los esqueletos, datándolos alrededor de 9000 años. Durante el año de 1955 los campesinos del pueblo de San Vicente Chicoloapan de Juárez, Estado de México, cavaron un pozo para extraer agua y allí encontraron el esqueleto humano de un individuo adulto joven, al cual no le dieron

do un esqueleto humano empotrado en la toba caliza del Peñón de los Baños; fue marcado como el Hombre del Peñón I y sus características son las de un individuo adulto. Hay opiniones diversas respecto a su antigüedad: unas apoyan y otras niegan su gran antigüedad.

importancia. Fue en el año de 1958 cuando algunos investigadores del INAH que efectuaban trabajos de exploración en el lugar encontraron un fragmento de costilla humana a una profundidad de 3.40 m, y muy cerca de ésta se halló

En el año de 1893 se reportó que una mandíbula de un individuo infantil fue encontrada muy cerca de un cráneo de équido fósil de edad pleistocénica en la localidad de Xico, Estado de México. En este espécimen se realizó por primera vez la cuantificación del flúor y se concluyó

una serie de elementos culturales que manifestaban claramente que correspondían a un nivel precerámico. Tras el análisis de hidratación de la

que contenía 1.94, elementos que utilizaron para determinar su antigüedad. Es muy lamentable que tanto la mandíbula como el cráneo hayan desaparecido (Arellano, 1946a y 1946b). En el año de 1947 se dio la noticia del hallazgo de un esqueleto casi completo que fue denominado Hombre de Tepexpan, localizado en los

obsidiana se obtuvo un fechamiento que oscila entre 5600 y 7000 años a.P. (Romano, 1963, 1970 Y 1974). En el mes de junio de 1957 unos trabajadores del Departamento del Distrito Federal descubrieron los fragmentos del cráneo de un ser humano, que fue denominado Peñón Il y que se hallaba dentro de un travertino a una pro-

limos lacustres que están muy cerca del poblado de Tepexpan, en el Estado de México; se calculó que su antigüedad era de 11000 años (Romano, 1972).

fundidad de 3 m en las calles de Morelos y Nayarit, en la colonia Peñón de los Baños, Distrito Federal. El material fue entregado a los investigadores del INAHen el año de 1959, cuando los

En 1953 se informó sobre tres esqueletos que fueron localizados en Santa María Astahuacán (Rom¡mo, 1955), población ubicada al sureste de la ciudad de México; se trata de individuos adultos, dos de sexo masculino y uno femenino,

trabajos efectuados en el lugar ya habían terminado (Romano, 1970 y 1974). Para el año de 1959 se cavó un pozo a una profundidad de 2 m entre las calles de Emilia-

que muestran un proceso de mineralización muy marcado. Al realizar el análisis químico se obtuvo 0.08 de nitrógeno y 1.988 de flúor. En

no Zapata y Bolívar, en la colonia Peñón de los Baños, Distrito Federal. Allí se encontró un travertino, en donde estaban los restos óseos humanos muy mineralizados de un individuo adulto joven, de sexo femenino, que se conoce como el Peñón IIl.De acuerdo con los estudios

estos entierros se encontró una obsidiana asociada a ellos, de la cual se obtuvo por hidratación 6.7 micrones, dato que fue comparado con el fechamiento de la obsidiana que estaba asociada al mamut que se localizó en San Bartola Atepehuacan, D.F; y que había dado un por-

de tefrocronología, este hallazgo corresponde a la fase final del Pleistoceno superior. Loren-

centaje de 6.5 micras, que posteriormente fue fechado por medio del C14 y arrojó una antigüedad de 9640 ± 400 años a.P. (Romano, 1974).

zo (1967) considera que este ejemplar corresponde al horizonte Cenolítico superior (7000 a 5000 años a.c.) (Romano, 1970 y 1974).

Al comparar los resultados obtenidos en ambas obsidianas por el método de hidratación se lIe-

En el año de 1959 se exploró la Cueva del Tecolote, localizada en el área de Huapalcalco,

19


JOSÉANTONIOPOMPAy PADILLA Hidalgo, donde se hallaron dos individuos adultos de sexo masculino. Estos especímenes fue-

ra 29 especímenes. Anderson (1967) reporta 56 individuos de ambos sexos y de diferentes eda-

ron situados cronológicamente en el horizonte Cenolítico superior (7000 a 5000 años a.C.) (Romano, 1974).

des y les asigna una antigüedad de entre 6500 a 2000 años a.C. En el año de 1968, entre las calles de Inde-

Durante los meses de octubre y noviembre de 1961 se exploró en Tepexpan, Estado de México, a 400 m al este del Museo de Prehistoria; se

pendencia yJuárez, en el Distrito Federal, se localizó un cráneo humano que fue denominado Hombre del Metro Balderas (Romano, 1974).

encontró la osamenta de un mamut y en asociación directa una pieza dentaria humana entre dos vértebras lumbares del animal cubiertas por el ilíaco derecho, a una profundidad de 2.13 m. La pieza dentaria es un canino superior izquierdo que muestra un desgaste casi total de la corona y que además presenta un proceso intenso de mineralización. No se sabe dónde se encuentra actualmente dicha pieza dentaria (Romano, 1964). En noviembre de 1962 se reportó el hallazgo de una osamenta humana perteneciente a un

En el año de 1978 se reporta un segundo molar que fue producto de las excavaciones en la cueva Los Grifos, en Ocozocoautla, estado de Chiapas. No se sabe dónde se encuentra actualmente dicha pieza. El último hallazgo reportado hasta esta fecha es el del Hombre de Chimalhuacán, que fue encontrado en el año de 1984 en la localidad del mismo nombre, en el Estado de México (Pompa, 1988). Éstos son los hallazgos reportados hasta el momento; conforman la colección de restos óseos humanos precerámicos que se encuéntra bajo resguardo de la Dirección de Antropología Física del INAH,en la ciudad de México.

individuo adulto de sexo femenino; fue designado como el Hombre del Peñón IV por encontrarse en el área correspondiente al Peñón de los Baños; de este espécimen no se menciona más información.

En el año 2000, dentro del proyecto de reestructuración de las salas del Museo Nacional de Antropología de México, se iniciaron los traba-

En la temporada 11de 1964 se exploró en la cueva de Texcal, Valsequillo, Puebla, un sitio donde fueron encontrados tres esqueletos humanos: uno de ellos corresponde a un individuo adulto de sexo masculino (Romano, 1974),

jos para poner al día la entonces

llamada Sala

de los Orígenes, ahora Sala del Poblamiento de América. Varias acciones fueron consideradas TABLAI NUEVOS FECHAMIENTOS DE J?RECERÁMICOS MEXICANOS (2003)

cuya an tigüedad se calculó en 4500 a 3 500 a.C., tomando como referencia la capa estratigráfica donde fue localizado. En 1965, durante las excavaciones realiza-

Individuo

das por investigadores del INAHen el cerro de Tlapacoya, Estado de México (Mirambell y Lorenzo, 1986) se encontró una calota humana a la que se dio el nombre de Hombre de Tlapacoya 1, quien es el objeto principal de este estudio. En esta misma área, sólo que años más

Peñón III Metro' Chimalhuacánb Tlapacoya 1 Cueva del Texcal (3) San Vicente Chico loa pan (Calota) Tepexpan

tarde, en 1975, fue hallado otro cráneo humano. Este ejemplar se ha marcado como el crá" neo de Tlapacoya 11. Durante el proyecto de Tehuacán, Puebla, donde se exploraron tres cuevas, se hicieron algunos hallazgos y se han cuantificado hasta aho-

Antigüedad sin caliúrar

Año del hallazgo

10755 ±75 a.P. 10500 a.P. 10500 a.P. 10200±65 a.P. 7480±55 a.P.

1959 1968 1984 1965 1964

441O±50 a.P.

1955

11 000-2290 a.P.

1947

(Esq)b

• Fechamiento b Fechamiento

20

indirecto. no confiable

por contaminación.


Los ANTIGUOS

POBLADORES DE MÉXICO

Oficial del INAH), nueva época, México, INAH, núm. 28, pp. 1-16. Doran Jr., Edwin (1973), 'The Sailing Raft as a Great Tradition", Man Across The"Sea. Problems

indispensables y necesarias, entre ellas la de gestionar el cálculo de fechamientos actualizados y confiables de la mayoría de los especímenes que conforman la colección de precerámicos mexicanos; para ello fue seleccionado el material a muestrear y se envió al laboratorio de

o/ Pre-columbian Contacts, Austin y Londres, University ofTexas Press, pp. 115-138. Genovés et al. (1982), "El hombre temprano en México. Panorama general", Actas del X Congreso de la Unión Internacional de Ciencias Prehistóricas y Protohistóricas, México, pp. 370-

la Universidad de Oxford, en Inglaterra, previo acuerdo de colaboración para fechamientos. En la tabla 1 se presentan los resultados que hasta ahora ha sido posible obtener (González et al.,

399. González, Silvia, José Concepción Jiménez, Robert Hedges, José Antonio Pompa y David Huddart (2002), "New Carbon-14 Dates for Early Humans in Mexico", Mammoth Trumpet, EU, Center for the Study of First Americans,

2002 y 2003).

BIBLIOGRAFÍA Acosta,Joseph (1962), Histana natural y rrwralde las Indias. "En que se trata de las cosasnotables del culto I elementos I metales I plantas y animales de ellos I y los ritos y cermwnias I leyes y gobierno de los

Departrnent of Anthropology, Texas A & M University, vol. 17, núm. 3, p. 20. González, Silvia, José Concepción Jiménez, Robert Hedges, David Huddart, James C.

indios", México, Fondo de Cultura Económica. Anderson, EJ. (1967), 'The Human Skeletons", The Prehistory o/ the Tehuacán Valley: Environment and Subsislence, Austin, The University

Ohman, Alan Turner yJosé Antonio Pompa (2003), "Earliest Humans in the Americas: New Evidence from Mexico", ¡oumal o/ Hu-

ofTexas Press, vol. I, pp. 91-113. Arellano, Alberto R.v. (1946a), "Datos geológi-

man Evolution, núm. 44, pp. 379-387. Lorenzo, José Luis (1967), La etapa lítica en México, México, INAH, Departamento de Pre-

cos sobre la antigüedad del hombre en la cuenca de México", Memoria del 2º Congreso Mexicano de Ciencias Sociales, México, tomo 5,

---

pp. 213-219.

minario), México, SEP, pp. 21-37 (Cien de México). Meltzer, David]. (1989), "Why don't we Know

--/(1946b), "El elefante fósil de Tepexpan y el hombre primitivo", Revista Mexicana de Estudios Antropológicos, México, Sociedad Mexicana de Antropología, tomo 8, núms. 1,

when the First People Carne to North America?", American Antiquity, Society for American Archaeology, vol. 54, núm. 3, pp. 471-

2 Y 3, pp. 89-94. Bárcenas, Mariano (1882), "Descripción de un hueso labrado de llama fósil encontrado en los terrenos post-terciarios de Tequixquiac", Anales del Museo Nacional de México, l' época, México, vol. 2, pp. 439-444.

490. Mirambell, Lorena y José Luis Lorenzo (1986), Tlapacoya: 35000 años de historia del lago de Chalco, México, INAH (Colección Científica, 155). Owen, Roger C. (1984), 'The Americas: The

Comas, Juan (1966), Manual de antropología física, México, UNAM, Instituto de Investigaciones Históricas, Sección Antropología. --(1974), El poblamiento de América. Época ---

historia. (1988), "Historia de la prehistoria en México", Origenes del Hombre Americano (Se-

Case Against an Ice-Age Human Po pulations","en Fred Smith y Frank Spencer (eds.), The Origin o/ Modern Humans a World Survey o/ the Fosil Evidence, Nueva York, Alan R. Liss,

Prehispánica, México, SEP IINAH. (1987), "Fechamiento de la Mujer de Tepexpan ", Antropología (suplemento del Boletín

Ine., pp. 517-563.

21


-------------

JOSÉ ANTONIO POMPA y PADILLA

Pompa, josé Antonio (1988), "Nueva evidencia

---

en México: datos preliminares del Hombre de Chimalhuacán ", Orígenes rielHombre Ameri-

Austin, University of Texas Press (Physical Anthropology) . --(1972), "Cráneo precerámico con deformación intencional", Boletín del INAH, 2ª

cano (seminario), México, SEP, pp. 177-207 (Cien de México). Romano Pacheco, Arturo (1955), "Nota preliminar sobre los restos humanos subfósiles de Santa María Aztahuacán, D.F.", Anales del

---

INAH, México, tomo VII, pp. 65-74.

--de

(1970), "Preceramic Human Remains", Handbook of Middle American Indians, núm. 9,

(1963), "Breve informe de los hallazgos San Vicente Chicoloapan, México",

época, abriljunio, pp. 35-36. (1974), "Restos óseos humanos precerámicos de México", Antropología física. Época

prehispánica, México, SEP /INAH. Shapiro, Harry L. (1964), The Peopling ofthe Pacific Rim, EU, American Museum ofNatural History (The Thomas Burke Memorial Lecture Series). Turner II, Christy G. (1989), ''Teeth and Prehistory in Asia", Scientific American, febrero, pp.

Anales del INAH, México, tomo XV, pp. 245249. --(1964), "Restos humanos precerámicos", Actas y Memorias del XXXV Congreso Internacional de Americanistas, México, pp. 61-64.

70-77.

22


APUNTES SOBRE LAS INVESTIGACIONES PREHISTÓRICAS EN MÉXICO y AMÉRICA Luis F. Bate* y Alejandro Terrazas** Donde no hay teoría no hay ciencia MARIo BUNGEI

... 0

sea, el mareo teárieo: ¡eso es una mierda! JOSÉ LUIS LORENZ02

RESUMEN

¿QUÉ TAN CIENTÍFICA ES NUESTRA PREHISTORIA?

Se trata, de manera muy general, un par de aspectos del estado actual de las investigaciones sobre prehistoria en el continente americano, específicamente en torno a los procesos de poblamiento del mismo. Uno de ellos se refiere a la casi total ausencia de teorías explícitas que conformen concepciones explicativas in tegradoras de los distintos aspectos relevantes de las estructuras y procesos sociales, por lo cual las investigaciones tienden a carecer notablemente de orientación y articulación coherente, manteniéndose sometidas a la exaltación del empirismo más

En México, como en otros países americanos, se ha usado el término "prehistoria" para referirse a la historia de las sociedades cazadoras recolectoras y aun para la de las sociedades preestatales productoras de alimentos. Hoy, el término resulta algo anticuado, también cuando se refiere a la disciplina científica que estudia dichas sociedades y tiende a hablarse más bien de arqueología de sociedades cazadoras recolectoras. Ésta es sólo una cuestión de modas terminológicas, pero también puede deberse, en parte, al desarrollo de las investigaciones.

ramplón. En cuanto a las orientaciones temáticas, se apuntan algunas consideraciones acerca del supuesto debate "pre-Clovis/Clovis first", a propósito de lo cual se esbozan las bases para una hipótesis acerca del poblamiento americano.

En este texto queremos limitarnos a esbozar algunos apuntes orientados a evaluar qué tan desarrolladas se encuentran las investigaciones arqueológicas americanas en cuanto al estudio de las sociedades cazadoras recolectoras y, en particular, en relación con el problema del

* Profesor investigador de la Escuela Nacional de Antropología e Historia. ** Investigador del Instituto de Investigaciones Antropológicas de la UNAM. 1 Bunge, 1969: 417. 2 Dirección de Salvamento Arqueológico del INAH: "Arqueología de mi corazón", documental de entrevistas videograbadas, México, 1995.

poblamiento del continente. No pretendemos nacer una revisión general del "estado de la cuestión" y nuestros comentarios serán parciales, pues no nos centraremos en los aspectos del nivel de acumulación de información empírica alcanzado, ni del desarrollo de las técnicas o procedimientos metodológicos aplicados en las investigaciones sobre el tema. Sin lugar a dudas puede decirse que, desde hace unos veinte años, ha habido un aumento explosivo de

23


LUISF. BATEy ALEJANDRO TERRAZAS la producción

de información,

y hay que decir que el desarrollo

particularmente

en algunas regiones, como el área andina, el Brasil o el Extremo Sur desde Uruguay (Pampas, Patagonia y Tierra del Fuego). Mientras en otras, como en México o el Caribe, si bien no puede hablarse de un estancamiento absoluto, los avances han sido bastante más modestos.3 Por su parte, los avances tecnológicos y de pro-

en la elevación de la calidad de las investigaciones, tal vez porque permiten incrementar cuantitativamente la producción de resultados, ahorrando trabajo humano, sobre todo el de las neuronas. Como advertía con claridad Di-

cedimientos también han afectado favorablemente el desarrollo de las investigaciones, elevando la calidad de los trabajos de prospeción, localización, excavación, registros y dataciones, hasta el análisis y la ordenación de la información realizada en los gabinetes o laboratorios. En este sentido, puede mencionarse el impacto de la generalización del uso de computadoras personales que, además de hacer mucho más eficiente el

llehay (1988: 12), refiriéndose

el aumento de la cantidad parece siempre llevar a la inevitable reducción del promedio de la calidad (y probablemente no aumenta finalmente, en términos absolutos, el número de buenos trabajos). El proceso de publicación ha dejado también de actuar como mecanismo de control de calidad. Nada lo ha reemplazado. En síntesis, parece que la arqueología ha estado preocupándose más con la cantidad y son la difusión de información, que con la comunicación real.

de los recur-

sos económicos que implica la posibilidad de utilizar estos medios es desigual; y la brecha mayor se establece entre Norteamérica y el resto del continente.

Concordamos plenamente con el autor haciendo notar que, en este aspecto, México sí se ha puesto al día en cuanto a la prevalencia de criterios cuantitativos para la evaluación del

En estos desarrollos también ha incidido el considerable aumento del número de practicantes de la arqueología con formación profesional y de las instancias académicas de comunicación de información, pero sobre todo -aunque ha ocurrido en menor medidala apertura de

rendimiento académico. El tema en que centraremos nuestros comentarios es el que se refiere al desarrollo y uso de las

foros que abren la posibilidad de entablar diálogos y debates, en lo cual también se advierten desigualdades que se reflejan en el estado de la

teorías, en la medida

en que, de acuerdo

con

Bunge:5 Es una peculiaridad de la ciencia contemporánea el que la actividad científica más importante -la más profunda y la más fecunda- se centre en torno a teorías, y no en torno a la recolección de datos, las clasificaciones de los mismos o hipótesis sueltas. Los datos se obtienen a la luz de teorías y con la esperanza de

investigación. Así, por ejemplo, las 'Jornadas de Arqueología de la Patagonia" se vienen llevando a cabo con regularidad desde 1984, convocando a un gran número de investigadores, mientras en México no se realizaba un evento de esta naturaleza

al "exceso de

arqueólogos con el grado de doctorado y un incremento de los fondos para investigaciones y publicaciones":

procesamiento de información, ha contribuido notablemente a agilizar el intercambio de la misma. Por supuesto, la disponibilidad

tecnoló-

gico y la abundancia de medios de comunicación no siempre han resultado necesariamente

desde hace quince años.4

3 Entretanto, hay que registrar la desaparición del antiguo Departamento de Prehistoria del INAH de México,circunstancia que pasó más o menos inadvertida, pues no causó ningún impacto en las investigaciones sobre el tema. 4 Seminario "Orígenes del hombre americano", realizado en 1987 en el Museo Nacional de Antropología, entonces bajo la dirección de Eduardo Matos.

5 Bunge, 1969: 413. Hemos tomado varias referencias de la obra La investigación científica de Mario Bunge, autor que no puede calificarsede marxista-concepción de la que participa la posición que adoptamos--, por cuanto sus opiniones encontrarán mayor aceptación en los medios académicos. Por supuesto, las citas que tomamos de él se refieren a afirmaciones con las cuales concordamos.

24


APUNTES SOBRE LAS INVESTIGACIONES PREHISTÓRICAS EN MÉXICO y AMÉRICA

concebir nuevas hipótesis que puedan a su vez ampliarse o sintetizarse en teorías. [...] lo que caracteriza a la ciencia moderna es la insistencia en la teoría -en la teoría empíricamente contrastable, desde luego- y no el interés primordial por la experiencia en bruto. y, más adelante:

gías procesuales, tanto desde la Gran Bretaña (Clarke, Renfrew) como desde Estados Unidos (Binford, Flannery, Schiffer). Sus planteamientos vinieron a cuestionar las bases de las arqueologías ya tradicionales, instaladas en una "normalidad" kuhniana, donde coexistían las orientaciones teóricas englobadas en el con-

"La dimensión y la adecua-

ción relativas del trabajo teorético el grado de progreso de una ciencia".6

cepto de particularismo histórico. Tanto el difusionismo como el relativismo cultural -representados en América por algu-

miden, pues,

En primer lugar, distinguiremos entre posiciones teóricas y teorías sustantivas. Las posiciones teóricas son concepciones generales acerca

nos de sus máximos exponentes, como Menghin o Boas, respectivamenteconformaron posiciones teóricas literalmente reaccionarias: una

de cómo es la realidad y cuáles son los procedimientos científicos adecuados para conocerla. Las teorías sustantivas forman parte de las posiciones teóricas, constituyendo los componentes

respuesta contra el evolucionismo del siglo XIX. Reacción creacionista y clerical por parte del difusionismo histórico-eultural y contra la justificación de la "vanguardia de la historia" -frente a la emergencia exitosa de los movimientos socialistas-8 por parte del relativismo. Claramente se transparenta el fondo ideoló-

ontológicos referidos a campos particulares de las realidades estudiadas. Además del área ontológica, una posición teórica incluye el conjunto de planteamientos expresos o implícitos respecto a los juicios de valor que orientan la investigación, los enunciados epistemológicos y las propuestas metodológicas con los cuales la ontología está

gico de la disputa en torno al área valorativa, desde la cual se definen los objetivos cognitivos que cada posición propone para la ciencia. Una maniobra de traspaso de la ideología de una burguesía industrial del siglo XIX, vanguardista y anticlerical -disputando el poder ideológico

necesariamente interrelacionada, con diversos niveles de consistencia.7 Aquí nos referiremos a las teorizaciones relativas al objeto sustantivo de investigación, esto es, sobre las sociedades cazadoras recolectoras y su dinámica histórica. No nos ocuparemos centralmente, por el momento, de las teorías media-

político a una burguesía terrateniente apoyada en la institucionalidad y en la ideología re ligioso-feudal-, a la burguesía industrial financiera del siglo xx, triunfante e instalada en el poder político y económico que descubre la efectividad de la ideología religiosa como instrumento de dominación, esta vez a su servicio. El meca-

doras, indispensables para conectar la realidad de la información disponible y los datos observables con la existencia de las sociedades que investigamos (Bate, 1998: 106).

nismo de ocultamiento de tal maniobra se dio a través de la imposición de otro mito ideológico,

UN POCO DE HISTORIA: SOBRE EL EMPIRlSMO PREDOMINANTE

absolutamente falso pero eficiente: el de que la "objetividad científica" se garantiza prescin-

Desde de la mente tonces

diendo de juicios de valor, de modo que el científico "objetivo" no permite que sus juicios de valor interfieran en la diáfana transparencia de sus observaciones empíricas, base de una

hace ya unas cuatro décadas, el mundo arqueología, en general, fue saludableimpactado por el surgimiento de la enllamada "new archaeology" o arqueolo-

ciencia veraz. ¡bid: 416. Cursiva nuestras. 7 Nos estamos refiriendo al concepto de posición teórica acuñado por Gándara (1993 y 1994), como un instrumento de evaluación que permitiría una opción racional entre teorías. Véase también Bate (1998: 24-30). 6

8 En este sentido, la versión estalinista de la sucesión de modos de producción -adoptada por los "marxismos oficiales"- asume una postura claramente evolucionista decimonónica, en pleno siglo xx.

25


LUIS F. BATE y ALEJANDRO TERRAZAS

Debido a ello, el desplazamiento del evolucionismo se dio con el pretexto de que constituía una concepción "especulativa" y "abstracta". La alternativa: no arriesgar generalizaciones antes de disponer de toda la información empírica que, algún día, permitiría formular explicaciones adecuadas para cada caso, para cada cultura singular e irrepetible, donde la cultura es la categoría que alude a la totalidad social. La tarea central de la ciencia arqueológica viene así a definir, de hecho, su objetivo cognitivo: la descripción. Aun cuando el planteamiento resultara inconsistente con el hecho de estar orientado a fundamentar la existencia de entidades abs-

alternativa radical, históricamente

más relevan-

te que las posturas super críticas y radicales posteriores, del posmodernismo, por ejemplo. Abrió el terreno a una época de fecundas discusiones teóricas, que cobraron auge en los ochenta, polemizando con las propias posiciones de las arqueologías procesuales de la ya entonces "vieja nueva arqueología" (Gándara, 1980 y 1981). No obstante, el número de arqueólogos que se ocupan de temas teóricos, a través de propuestas o críticas, sigue siendo mínimo y la proporción de colegas que son usuarios de las teorías actualmente en competencia, aplicándolas a sus trabajos de investigación, aún muy escasa. Por supuesto, no podría esperarse que la mayoría se dedicara a la producción teórica, dado que el espectro de temas y problemas a cubrir es amplísimo y tan variado como las vo-

tractas preconcebidas y preestablecidas, como "círculos culturales',g o "universales de la cultura", levitan tes en el mundo de las ideas o de la unidad psíquica de la humanidad. El rescate de la racionalidad científica "que amenazaba con ahogarse en el mar de la empiria", por parte del neoevolucionismo de v.G. Childe o L. White, no escapo a la influencia

caciones y posibilidades reales de trabajo de los arqueólogos. Pero resulta notable el hecho de que la gran mayoría de las investigaciones arqueológicas que se llevan a cabo a lo largo y ancho del con-

arrasadora del empirismo entre los practicantes americanos de la arqueología. Se trataba de fundamentar, en una sólida base empírica, los particulares procesos de evolución a nivel re-

tinente americano siguen siendo inspiradas, sin mayor conciencia crítica por parte de los investigadores, en los lineamientos derivados de las antiguas posiciones particularistas históricas. y, a pesar de la vitalidad de los debates teórico-metodológicos que se dan en la disciplina, nuestra

gional, para evitar el riesgo de ser calificados como "especulativos abstractos". y, en el caso de los estudios de las sociedades cazadoras recolectoras en América, tanto difusionistas como culturalistas, ambientalistas y neoevolucionistas coincidieron en cuanto al objetivo de la arqueología: el establecimiento de secuencias cronológico-eulturales, en las que los mismos planteamientos evolutivos se reducían a referencias

arqueología real sigue siendo abrumadoramente "tradicional" y su aparente modernización es el resultado de la mayor sofisticación de las técnicas y procedimientos de obtención y análisis inmediato de la información empírica. Es decir, aún predomina un empirismo, por lo demás, bastante rudimentario que se presenta, en los mejores casos, "técnicamente sofisticado". Otra circunstancia que vino a reforzar esta

generales simplistas y esquemáticas pero, eso sí, con muchos más datos e información. Es el caso de las propuestas generales o regionales de periodización, por ejemplo, de Krieger, Willey, MacNeish, Lanning, Rouse o Lorenzo. Frente a esa situación, no puede dejar de considerarse a la "new archaeology", particularmente en la versión de Binford, como una

situación en varios países de Centro y Sudamérica fue la instalación de dictaduras militares, cuya aversión a las ciencias sociales era abierta y sus métodos represivos brutales. 10 En ese con-

9 O ciclos culturales entendidos como "sistemas de isoidas", en el caso de Bormida (1956).

10 Como dijo el 11 de septiembre de 1973 uno de los oficiales que allanaron la Universidad Técnica del Estado

26


APUNTES

SOBRE LAS INVESTIGACIONES

PREHISTÓRJCAS

texto, el temor a la teoría se convirtió, literal y

y AMÉRJCA

Hasta en Estados Unidos se le perdió antes el miedo al marxismo, reestablecido el mito de la democracia después de un macartismo más

explicablemente, en terror. Del marxismo, desde luego, ni oír hablar. La reducción de las in-

distante y convenientemente 0lvidado.13 En suma, compartimos la apreciación general de Politis sobre Latinoamérica, en cuanto al

vestigaciones al manejo de datos y producción o procesamiento de información empírica se convirtió en el refugio donde los arqueólogos podían aparentar su total "objetividad" y "neutralidad" como científicos. Con la supuesta restauración de las "democracias", el temor a la teorización no se ha perdido. y, otra vez, se presentan

EN MÉxICO

predominio

notable del empirismo:

Firstly, Latin American archaeology is largely empiricist. Although there are a few original theoretical approaches, such as Latin American social archaeology (oo.) and serious attempts have been made to incorporate and develop North American and European methodological and theoretical perspectives(oo.), the practice of archaeology within the region remains heavily empirically grounded.14

distintas reaccio-

nes. En Brasil, por ejemplo, que comprende la mitad del territorio de Sudamérica, hay una profusión espectacular de publicaciones de información desde fines de los setenta, pero, ignoramos por qué, a diferencia de lo que ocurre en otras disciplinas de la ciencia social, la ausen-

El hecho es que, por razones diversas, predomina en la arqueología americana un empirismo que hace que los siguientes comentarios de Bunge, a propósito de las ciencias humanas, nos resulten cercanamente familiares:

cia de producción o uso directo de teorías en la arqueología es casi total. Bastan los dedos de una mano para contar a los autores interesados en esa temática (Funari, Lima).11 En Argentina o Chile, en cambio, donde hay investigadores trabajando sobre cazadores recolectores, bien informados y usuarios de algunas de las teorías disponibles (p. ej., Politis, Mena y otros), la atención se ha centrado mayoritariamentel2 en posiciones evolucionistas, ambientalistas o adaptacionistas, desplazándose los intereses y la especialización más bien al campo de las ciencias

la teorización se considera frecuentemente como un lujo, y no se admite como ocupación decente más que la recolección de datos, o sea, la descripción. Yesto hasta el punto de que está de moda en esas ciencias oponer la teoría (como especulación) a la investigación (entendida como acarreo de datos). Esta actitud paleocientífica, sostenida por un tipo primitivo defilosofia empirista, es en gran parte la causa del atraso de las ciencias del homúre. En realidad, ese punto de vista ignora que los datos no tienen sentido ni pueden ser relevantes más que en un contexto teorético, y que la acumulación al azar de datos, e incluso las generalizaciones, queno son más que condensaciones de datos, son en gran parte pura pérdida de tiempo si no van acompañadas por una elaboración teorética capaz de manipular esos resultados brutos y de orientar la investigación. 15

naturaJes, evitándose el involucramiento directo con los temas específicamente sociales. Y nadie arriesga la menor conjetura generalizadora sin la referencia compulsiva a los datos -considerados "la evidencia"por temor a ser tachado de "especulativo", adjetivo entendido como algo poco serio.

en Santiagode Chile (donde fueron asesinadascerca de 400 personas),metralleta en mano frente al Departamen-

to de Ciencias Sociales de la Facultad de Ingenieros Industriales:"se acabó esta huevadade las cienciassociales,acá hayque enseñar historiaygeografia"(historiaoficialde las "gloriasmilitares",por supuesto.Comunicación personal, doctor GuillermoYáñez). 11 J.A. dos Reis, 1999. 12 Con algunas excepciones, como Llamazares y Slavutzki(1990), ÁIvarezy Fiore (1993), ZarankinyAcuto

13 Para la Tierra del Fuegochileno-argentina,hayque mencionar la síntesisde la etnografia sobre los selk'nam publicada en España por Anne Chapman (1990), quien adopta el materialismo histórico como sistema conceptual de referencia. l' GustavoPolitis (1999: 2). 15 Bunge, 1969: 416; cursivasnuestras.Cabe notar que utilizamosel término dato para referirnos a la realidad

(1999).

27


LUIS F. BATE y ALEJANDRO

LA PRODUCCIÓN

La arqueología

TERRAZAS

Variables para el análisis

TEÓRICA

americana no carece de investi-

En cuanto a la producción

gadores que trabajen en la generación de propuestas teóricas para explicar distintos aspectos de las sociedades cazadoras recolectoras. Por

teórica disponible

acerca de las sociedades cazadoras recolectoras, usada o potencialmente utilizable en la investigación de los procesos de poblamiento de América, nos limitaremos a sugerir algunas

el contrario, algunos de los más destacados investigadores en el tema son americanos o trabajan en instituciones americanas, como Bin-

variables para su análisis y a anotar un par de ejemplos, ya que es una tarea que excedería

ford, Wobst, Painter, Gilman y otros. Sin embargo, paradójicamente, la mayoría de ellos no

largamente la extensión de una ponencia. 1) De acuerdo con el nivel de generalidad distinguiremos entre:

se ocupa, en sus investigaciones concretas, de la arqueología de los cazadores americanos, sino de los problemas del "paleolítico" del Viejo Mundo, aunque algunos de ellos sí utilizan la etnografía americana como apoyo para la formulación de sus propuestas. Por los comentarios que haremos sobre el uso de las teorías, queremos aclarar de antemano que no consideramos que esto sea un defecto, pues estamos lejos de sostener un chauvinismo disciplinario o geográfico. Lo importante es contar con teorías disponibles y utilizables en la investigación y no es relevante el que las propuestas provengan de la antropología, la socio-

a. Metateorías, para designar a aquellas que se formulan para un campo de realidad más amplio que el de la existencia de las sociedades humanas. Algunas de ellas explicitan formalizaciones particulares para el campo social. Entre las metateorías podríamos mencionar la Teoría General de la Evolución, la Teoría General de Sistemas o la Dialéctica Materialista. b. Teorías sociales, formalizadas explícitamente para dar cuenta de la organización y/o proéesos de desarrollo de las sociedades humanas. Algunas se plantean como apartados particulares de metateorías, como el materialismo cultural o el materialismo histórico; otras se refieren sólo a este campo de la realidad, como el funcionalismo o el estructuralismo. c. Teorías particulares sobre las sociedades cazadoras recolectoras. Por lo general, aunque no necesariamente, son propuestas en el contex-

logía o la historia, ni en qué lugar del planeta sean formuladas, pues tampoco podemos dejar de considerar a los investigadores de instituciones no americanas que trabajan en o sobre América, realizando interesantes propuestas teóricas.16 Lo que sí es preocupante es que, habiendo teorías disponibles, el encasillamiento disciplinario sirva de pretexto para ignorarlas y prescindir de ellas en la realización de las investiga-

to de una teoría general de la sociedad. Aquí habrá que hacer un par de distinciones. En algunos casos, quedan comprendidas en un concepto que abarca a otros tipos de sociedades, como el de Modo de Producción Doméstico de Sahlinsl7 o el de Comunismo Primitivo (salvajismo y barbarie) en algunas versiones marxistas, que incluyen también a sociedades productoras de alimentos. En otros casos, no todas las sociedades con tecnoeconomía basada en la caza y

ciones arqueológicas específicas sobre la mayor parte de nuestra historia o "prehistoria", que fue protagonizada por esas sociedades concretas.

observable, existente con independencia de nuestro conocimiento, y entendemos que la infcnmación es el conocimiento empírico elaborado a partir de la observación, es decir, el resultado comunicable de nuestra subjetiva experiencia sensible. Teniendo clara esta distinción, Bunge, como otros autores, usa el término dato para referirse a nuestro concepto de información empírica. 16 Como Estévez y Vila (1998).

recolección corresponderían a un mismo tipo de sociedad. Testart, por ejemplo, reserva el concepto de comunismo primitivo para sociedades de cazadores recolectores 17

28

M. Sahlins,

1977.

nómadas

sin


APUNTES SOBRE LAS INVESTIGACIONES PREHISTÓRICAS EN MÉXICO y AMÉRICA

almacenamiento y los distingue del modo de producción de aquellos sedentarios o semisedentarios con almacenamiento. lB

te en variables medioambientales, Williams funda su modelo en la articulación, principalmente, de las variables socioculturales concep-

2) De acuerdo con la cobertura explicativa, podríamos distinguir: a. Teorías integrales, aquellas que dan cuenta de la totalidad social integrando las diversas esferas de la vida social: la economía, las relaciones sociales, la reproducción, la instituciona-

tualmente sistematizadas. Infortunadamente es un texto poco utilizado por los interesados en el tema. 3) Otro aspecto que es necesario considerar es que hay concepciones teóricas en cuyo interior se han desarrollado diferentes corrientes de pensamiento que pueden llegar a ser incompati-

lidad, las concepciones

o sistemas de ideas, etc.

bles entre sí frente a determinados temas. En este sentido no es lo mismo el funcionalismo de Parsons, Buckley o Luhman, o los planteamientos marxistas de McGuire, de Testart,21 de los arqueólogos de la Universitat Autónoma de Barcelona o de la llamada Arqueología Social

Teorías de este tipo pueden ser consideradas las propuestas de Service o de Testart.19 b. Teorías parciales, formuladas para explicar determinadas esferas o niveles de relaciones de la estructura social, como la tecnoeconomía, el intercambio de bienes, el intercambio de información, las relaciones de parentesco, la

Latinoamericana,

para no hablar del que se ha

cosmovisión, etc. No por ello son menos importantes, ya que hay algunas que constituyen aportes cruciales para buscar respuestas a pro-

denominado estructuralismo marxista de autores como Godelier o Rey. 4) También suele hacerse una distinción

blemas determinados. Unas están formuladas como una concepción general (que se refiere a aspectos comunes a distintos tipos de sociedad) y otras son específicas para las sociedades cazadoras. Ejemplos de importantes contribuciones de este tipo son los trabajos de Wobst, en la definición de las "redes mínimas de apareamiento" o las conductas de intercambio de información, las distinciones de Meillassoux entre adhesión

referida a los niveles de la teoría y que también se distinguirían por el grado de generalidad y abstracción. Así, se han considerado teorías

laboral J parentesco~ acoplamiento y filiación o patrones de movilidad y residencia.2o También hay algunas teorías que, privile-

que explicarían la organización general de la sociedad. y, entre ambas, autores como Binford

de bajo nivel las que se refieren a lo que, en los estudios etnográficos, serían las conductas más cercanas a la observación empírica y que explicarían, entre otras cosas, los procesos deposicionales. Las teorías de alto nivel serían aquellas referidas a la abstracción de las regularidades

han propuesto la necesidad de inducir una "teoría de rango medio", concepto tomado de Robert Merton (1992).

giando sólo algunas dimensiones de la sociedad, limitan la explicación de la totalidad social a las mismas, aun cuando no pretendan explícitamente hacerlo. Es el caso de la propuesta de BJ. Williams (1974), que formula proposiciones para explicar aspectos relevantes de la demografía de las sociedades cazadoras recolectoras. Aunque, a diferencia de otros autores que basan sus explicaciones casi exc1usivamen-

Un par de casos A propósito de esto, sólo mencionaremos un par de ejemplos, por cuanto el objetivo de esta 21 La línea de McGuire, que incluye a otros autores como Marquardt o Crumley, se autodenomina marxista hegeliana, adjetivo que destaca la necesidad de retomar la dialéctica, aunque no deja de incurrir en planteamientos idealistas (véase Bate y Nocete [1993]). Testart, en cambio, se considera hegeliano, aunque en su análisis notablemente preciso y detallado de la economía de las sociedades cazadoras recolectoras muestra un manejo fluido de las categorías del materialismo histórico (Testart, 1985).

Yéase Alain Testart (1982 Y 1985). 19Yéase, por ejemplo, Service (1973) o Testart (1985), aunque sus propuestas no se reducen sólo a estos trabajos. 20 M. Wobst (1974, 1976a y 1976b) Y C. Meillassoux (1977). 18

29


LUIS F. BATE y ALEJANDRO TERRAZAS

to a la teoría general de la sociedad, participa de la ecología cultural así como del funcionalismo, lo cual se expresa en distintos textos, como el

ponencia no es el de realizar el análisis de la producción y uso de las teorías en las investigaciones prehistóricas americanas, sino solamente llamar la atención sobre la necesidad de reflexionar sobre el problema. a. La arqueología procesual binjordiana. Como hemos señalado en otro lugar,22 a pesar de la indiscutible relevancia de la obra de Binford en

siguiente: Una de las mayores confusiones que ha plagado a las ciencias sociales es la confusión entre las regularidades en la dinámica interna de los sistemas culturales (sincrónicas y funcionales-internas) y la naturaleza de las dinámicas que condicionan los cambios en la organización de los sistemas mismos y su diversificación y cambio evolutivo (diacrónicos y ecológico-externos).23

el desarrollo de la arqueología en las últimas décadas, no ha llegado a conformar una posición teórica consistente, debido tal vez a la falta de una sistematización general que le habría permitido advertir incompatibilidades lógicas entre distintas afirmaciones expresadas a lo

Aquí nos referiremos

largo de su abundante producción científica, así como de algunos vacíos -a veces intencionalesque impiden la articulación coherente de sus diversas propuestas. No por ello deja de constituir una posición teórica que debe ser considerada. En este sentido nos remitimos

al poriiJ.eno-

rizado análisis realizado hace unos veinte años por Gándara, en el contexto de la discusión de la "nueva arqueología", en el cual concluye, respecto a nuestro autor, que: resulta ser una posición teórica altamente incongruente a todos los niveles: mezcla metodologías con objetivos distintos, confunde confirmación con corroboración, adopta posiciones relativistas autorrefutantes y las mezcla con una epistemología ecléctica en donde el sustrato final es el idealismo subjetivo. Al parecer, existe también una confusión sobre lo que las explicaciones nomológicas realmente son y sobre la naturaleza de las leyes que forman parte de ella (Gándara, 1981: 59). Posteriormente,

a sus propuestas

res-

pecto a la ontología de las sociedades cazadoras recolectoras, en las que ha centrado la mayor parte de sus investigaciones. Como es sabido, ha promovido reiteradamente la necesidad urgente de la arqueOlogía de construir una teoría propia, "de rango medio", que debería referirse a las actividades características de las sociedades cazadoras recolectoras y que permitiría explicar, de hecho, la formación de los contextos arqueológicos. Para lo cual habría que proceder a través de una estrategia nomológico-deductiva, la cual debería consistir en partir de formulaciones generalizadoras, de las cuales se derivan implicaciones de prueba a ser contrastadas con la información empírica. No obstante, en su obra de 1983, In Pursuit oj the Past: Decoding the Archaeological Record,24 nos dice que su manera de proceder consiste "en observar datos, reconocer modelos, tener intuiciones o ideas brillantes o aun simplemente revivir viejas nociones ya gastadas pero que sobrevivieron durante años ..." (1988: 115), las que luego deben ser evaluadas con métodos científicos. Por esa vía se podía anticipar, como lo hiciera Flannery, que sólo se conseguiría una colección de "leyes de Mickey Mouse" que difícilmente integrarían una teoría general. No obs-

Binford (1989) clarifica ade-

cuadamente su concepto de materialismo filosófico, pero no advierte que ello lo habría obligado a revisar y reformular muchos de sus planteamientos anteriores. A nivel de las metateorías, comparte planteamientos tanto evolucionistas como de la teoría de sistemas. En cuan-

23 Binford (1982: 97), en sus comentarios al ensayo de R. White. 24 Manejaremos la traducción al español como En busca del pasado, de 1988.

22 '''Del registro estático al pasado dinámico': entre un salto mortal y un milagrodialéctico"(Bate, 1992b).

30


APUNTES

SOBRE lAS INVESTIGACIONES

PREHISTÓRICAS

EN MÉXICO

y AMÉRICA

tan te, no dejó de descalificar a quienes no respondieron a su convocatoria para elaborar la

tigación rigurosa".26 Luego, mediante diversos procedimientos de correlación estadística, se da

"teoría de rango medio", a través de los procedimientos por él propuestos, afirmando que quienes se abocaron a otros temas incurrían en "un pasatiempo inútil", que "no contienen pro-

a la tarea de identificación de patrones, que le permitirán establecer marcos de referencia sobre la variabilidad medioambiental, que le servirán para la contrastación de diversas variables socia-

puestas serias dentro de una disciplina científica" u otras consideraciones similares. Ahora nos ofrece una nueva e importante obra que contiene un conjunto de propuestas

les a través de las cuales analizará su base de información sobre 339 grupos de cazadores recolectores documentados etnográficamente. De esta manera irá induciendo múltiples generalizaciones, planteando problemas y generando proposiciones que permitirán la explicación de la variabilidad y los cambios en distintos aspectos del sistema social. La contrastación sucesiva de marcos de referencia medioambientales y culturales le permite ir integrando patrones derivativos de segundo o tercer orden, accediendo a mayores niveles de generalización. No llega a integrar una formalización teórica

teóricas y metodológicas, que se puede prever que será un modelo a seguir para muchos investigadores. Constructing rrames of Reference (2001) es un modelo de cómo se hace la "buena ciencia".25Por lo pronto, su libro "... is unapologetticalIy wri tten from a scien tific perspective. 11is largely an exercise in inductive reasoning, in that it asks questions regarding the character of the world of organized variability among ethnographically documented hunter-gatherers groups" (p. 3, cursivas nuestras). De hecho, desarrolla una estrategia metodo-

explicativa general acerca de las sociedades cazadoras recolectoras, pero ofrece una larga lista de proposiciones y explicaciones que deberían servir precisamente para lo que se propone:

lógica explícita, paralelamente a la exposición de los resultados progresivos de su investigación. Comienza con un interesante análisis crítico del conocimiento previo aportado por al-

proporcionar marcos de referencia para que los arqueólogos puedan deducir implicaciones explicativas a contrastar con los registros arqueológicos. Suponemos que también a quienes estén interesados en continuar esa tarea de construcción teórica.

gunos de los fundadores de la antropología a los que reconoce contribuciones pertinentes al tratamiento del tema, como Mauss, Steward, Servic~ Lee y De Vore, Sahlins o Kaplan, entre otros, lo cual le permite seleccionar tópicos y conceptos que considera relevantes para orien-

En lo general es consistente con sus premisas en cuanto a que la explicación funcionalinterna de la variabilidad y los cambios en los sistemas socioculturales se basaría fundamen-

tar la búsqueda de patrones que conduzcan a generar explicaciones de la variabilidad interna de los sistemas sociales. Entre ellos, los conceptos de banda, compartir (sharing), cooperación, tamaño del grupo, patrones espaciales de asentamiento y movilidad, mutualismo, manejo del riesgo y varios otros, que "demandan

talmente en variables medioambientales (ecológico-externas), como las características del hábitat y los cambios climáticos (principalmente niveles de pluviosidad e irradiación solar). Es interesante anotar que ha tomado un par de

una inves26 Curiosamente, aunque está citado en la bibliografía, no examina en el texto más que de paso la relevancia de la obra de Testan, para quien las variables de reducción de movitidad y almacenamiento son fundamen tales en la distinción entre dos modos de producción diferentes entre los cazadores recolectores y que desempeñarán un papel crucial en su explicación de los procesos de intensificación productiva y emergencia de los "sistemas complejos" en estas sociedades.

Quedamos advertidos de que "Theory building is not for sissies! It is a rigorous, time-consuming process, and there is no guarantee that a comprehensive, defensible theory will result from the effon that has been invested in its development. Thankfully, intellectual tactics do exist that can make the process less daunting, as a review of the sequence of steps I have taken in this study far will illustrate" (p. 243). 25

31


LUIS F. BATE y ALEJANDRO TERRAZAS

ideas importantes de algunos autores "posmodemos" de las nuevas teorías de la complejidad,27 como los conceptos de dependencia sensible de las condiciones iniciales y emergencia de la complejidad, que adecua a su propia conceptualización. b. La arqueología social latinoamericana. Aunque no compartimos

esta designación,

sicas y la introducción de conceptos tanto a través de la categoría general

nuevos, de socie-

dad concreta, como de una propuesta general de periodización histórica.29 La categoría de sociedad concreta, entre otras cosas, integra los distintos "niveles" de la teoría, en una concepción unitaria de las distintas dimensiones de la existencia social expresada en la relación

se trata

de una serie de propuestas desarrolladas inicialmente por un grupo de investigadores latinoamericanos que se estructuran en torno a una

entre los conceptos de formación social, modo de vida y cultura, de la cual se deriva congruentemente una propuesta de periodización tridimen-

línea particular de desarrollo de la teoría materialista de la historia, de orientación marxista.

sional. Por lo que respecta a la teoría particular, en su artículo "La arqueología de cazadores reco-

Probablemente para muchos no es una posición importante. Como dice Politis (1999: 7):

lectores en América Latina", Lanata y Borrero opinan que

Outside Latin America the theoretical production of Latin American social archaeology has been largely ignored; only recently has it been discussed in Spain, Portugal and, to a much lesser extent, Creat Britain. However, for the North American Marxist archaeologists, the development of social archaeology has been an impressive achievement of the last twenty years and they attribute an important role to this school of thought in the recent history of the archaeology of Latin America (e.g. McCuire, 1992; Patterson, 1994).

The languaje is different but, as far as huntergatherers are concerned, the result is a purely theoretical stance which is difficult to reconcile with the archaeological record. ArchaeoJogical interpretation by such researchers is, in addition, more in line with a Kulturkreiss mode of research than with anything else (see Bate, 1983; Vargas Arenas and Sanoja Obediente, 1992). [...] Developments in relation to hunter gatherers adaptations were keept lO a minimum, as Ardila Calderón (1992) has noted.

Pero, como se trata de la posición de la que participamos, abusaremos de los lectores haciendo una breve reseña de la misma. Se plan-

Con ello denotan un entendimiento notablemente limitado y erróneo, si no calumnioso, del texto citado, además de un desconocimiento de las propuestas específicas sobre el tema.30 Hemos hecho una distinción entre las formaciones de cazadores recolectores pretribales y tribales, basada en el contenido de las relaciones sociales de producción. Y hemos desarrollado una propuesta particular sobre el modo de

tea como una posición teórica que pretende ser menos inconsistente que otras e integrar, en lo general, los distintos temas y problemas que atañen a la investigación arqueológica.28 Asume la dialéctica materialista como metateoría y, respecto a la teoría social, desarrolla una versión propia del materialismo histórico a partir de la formalización de sus categorías bá-

29 Véase una síntesis general en Bate (1998). 'o Por supuesto, estos comentarios merecerán oportunamen te un análisis que acá no cabría. Por lo que se refiere a la opinión de Ardila, está en lo cierto: no somos adaptacionistas. Pero el estudio de las "adaptaciones" no es lo único que hay en la arqueología, si es lo que supone (veánse nuestros comentarios al respecto en Bate [1992: 81]). Igual podríamos decir que sus contribuciones respecto a los modos de producción o formaciones sociales de los cazadores recolectores se reducen al mínimo, lo cual no tendría caso.

27 Cita expresamente a autores como Prigogine, Gleick, Lewin o Waldrop. 28 Como afirma Eli de Gortari al referirse a los criterios de compatibilidad y completud: "... estos dos requisitos no pueden ser cumplidos plenamente por sistema alguno, ni siquiera dentro del más estricto formalismo lógico, porque las consecuencias deducibles de los elementos ya determinados de un sistema siempre son infinitas e inagotables" (1970: 19).

32


APUNTES SOBRE LAS INVESTIGACIONES PREHISTÓRICAS EN MÉXICO y AMÉRICA

producción de las sociedades pretribales (Bate, 1986). Ésta, al igual que la de Binford -con quien compartimos una ontología y una heurística materialistas-, es aún una teorización parcial, referida a los aspectos básicos de la economía y las relaciones sociales de los cazadores reco-

históricas. No obstante, tampoco puede decirse que la ausencia del uso de teorías es total, si bien en la mayor parte de las investigaciones concretas teóricamente orientadas se hace un uso parcial de las teorías disponibles o se manejan teorías parciales acerca de las sociedades en estudio.

lectores. Consecuentes con la categoría general de formación social, actualmente trabajamos en la formalización de una concepción integral

Préstamos y retazos de teorías Son diversos los casos en que las teorías cien-

de las formaciones cazadoras recolectoras, que comprenda no sólo la instancia del modo de producción, sino también sus conexiones con el modo de reproducción, que integrarían la base del ser social, así como con las instancias superestructurales de la institucionalidad y la psicología

tíficas empleadas con el fin de proponer explicaciones para los fenómenos que son objeto de estudio de la arqueología han sido tomadas de escuelas de pensamiento derivadas de otras ciencias, comenzando por el evolucionismo del siglo XIX. Este intercambio teórico entre disci-

social. También nos ocupamos

plinas científicas es sin duda necesario y puede ser fructífero. Sin embargo, toda transferencia de postulados teóricos debe ser cuidadosamente

complejas interacciones

del tema de las

biosociales.

analizada, puesto que generalmente una posición teórica determinada se desarrolla con el fin de explicar aspectos muy definidos de la realidad, y sus enunciados básicos no siempre pue-

USUARIOS DE TEORÍAS

En la mayoría de nuestros países ocurre lo que, siguiendo a Politis, señalan Lanata y Borrero (1999: 77) para Sud amé rica: 'The development of archaeological theory was slow. in South America, with most of the practitioners in archaeology relying at best on schemes developed elsewhere".

den aplicarse a otra clase de fenómenos. Los conceptos derivados de determinadas posiciones teóricas suelen migrar hacia otras disciplinas de diferentes maneras: 1) En la forma más "blanda", suele tratarse de la adquisición de términos o conceptos sola-

Como hemos visto, sería absurdo esperar que todos los investigadores tuvieran que producir ~oría para poder llevar a cabo sus investigaciones. Ésta es una cuestión de división del trabajo en el interior de la disciplina. y, así como

mente como metáforas, en cuyo caso sirven más a la reflexión filosófica que a una explicación estricta. 2) En otros casos, algunos procedimientos, conceptos "duros" o ideas clave, de una teoría son utilizados en un contexto disciplinar diferente. 3) La tercera posibilidad es que algunos cuerpos teóricos completos sean aplicados a fenómenos para los cuales no habían sido enunciados inicialmente. Un ejemplo de migración de conceptos

hay una gran diversidad de orientaciones temáticas, hay también quienes prefieren el trabajo de campo, el de laboratorio, el trabajo interpretativo-explicativo, el desarrollo de aplicaciones metodológicas o de proposiciones teóricas. La mayoría de los investigadores trabaJan preferencialmente en algunos de esos ámbitos, lo cual es perfectamente válido. Pero lo importante sería procurar la articulación de las distintas instancias de la investigación con posiciones teóricas o concepciones teórico-metodológicas consisten-

entre disciplinas en forma de metáfora es el uso de la noción de caos, definido en forma dura para los estudios de fenómenos de turbulencia

temente integradas. Probablemente ésta sea una de las mayores deficiencias de nuestras investigaciones pre-

en fluidos, pero que, como metáfora, se encuentra en la mayoría de los discursos de corte

33


LUISF. BATEy ALEJANDRO TERRAZAS posmoderno de la década de los noventa. Como caso de un cuerpo teórico trasladado de mane-

avance el que se multipliquen los estudios que desarrollan implicaciones de prueba para contrastar hipótesis derivadas de diversas propuestas teóricas. Aunque, como dice Bunge: (1969: 415):

ra íntegra a una nueva disciplina, podemos pensar en la aplicación que hace la primera sociobiología de la teoría neodarwiniana al estudio de las sociedades humanas. La alterna-

Un manojo de hipótesis sin coordinar, aunque siempre es mejor que la completa falta de hipótesis, puede compararse con un acúmulo de protoplasmas sin sistema nervioso. Es ineficaz, no ilumina nada y, además, no da razón de las efectivas interrelaciones que se dan entre algunas de las estructuras reales (leyes objetivas). El progreso de la ciencia supone siempre, en mayor o menor medida y entre otras cosas, un aumento de la sistematicidad o coordinación.

tiva intermedia, en que algunos conceptos o elementos teóricos son trasladados a un contexto disciplinario completamente distinto, se encuentra en el desarrollo de los pocos modelos explicativos sobre las sociedades cazadoras recolectoras del continente americano. En su nivel más pedestre, en los últimos veinticinco a treinta años se ha puesto profusamente de moda un préstamo terminológico que, sin contenido teórico real (es decir, explicativo), se ha empleado como comodín para organizar espacialmente la información arqueológica: las "adaptaciones": "More often than not the adopted approaches confused theoretical innova-

Merecen una mayor atención otras propuestas teóricas de mayor alcance, debido a que no sólo se han incorporado unos cuantos retazos de teoría, sino que se ha pretendido aplicar todo un corpus teórico generado en otras disciplinas a la resolución de los "proble-

tions with technical advances, or with the use of ajargon. As a result, what were previously known as 'traditions' were updated and renamed

mas planteados por los materiales arqueológicos". Recordemos que, contrario a lo que mu-

'adaptative systems'" (Lanata y Barrero, 1999: 82), de lo cual hay innúmeros ejemplos,31 en los que el término "adaptación" -con variantes

chos colegas opinan, los materiales no pueden proponer nada, son cosas dadas; es sólo desde el área de las valoraciones de la sociedad, del

a gusto del consumidor, como "sistema adaptativo", "patrón adaptativo", "estrategia adaptativa"- no implica más que la perogrullada (que bien puede ser falsa) de que si un grupo humano habitó un ámbito geográfico o ambien-

investigador y, en el mejor de los casos, la posición teórica, donde se plantean los problemas de investigación pertinentes. Tal es el caso de la aplicación de algunos principios de la ecología evolutiva y la ecología de poblaciones, campos de investigación desarrollados inicialmente para el estudio de gran-

tal, es porque se adaptó a él y que, cualesquiera que sean los artefactos o patrones del registro arqueológico, evidenciarían dicha adaptación a los recursos del medio.32 Por supuesto, no todas las propuestas son de ese nivel. De cualquier modo, representa un

des conjuntos de poblaciones animales y vegetales, que han sido empleados, con diferentes grados de éxito, en la interpretación de la relación del ser humano con el entorno en que vive. Cuando estas teorías, aunadas a la biología evolutiva, se han empleado para comprender procesos biológicos de largo alcance, han pro-

Una de las pocas propuestas generalizadorassobre los cazadores sudamericanos en la pasada década (Dillehay,Politis,Ardilay Beltrao, 1992) no escapó a esa moda. S2 Lo cual nos puede llevar a descubrimientos notables, como que las redes, anzuelos y arpones de la costa del Pacífico muestran "adaptaciones marítimas", o las ~untas de proyectil, cuchillos, raederas y raspadores donde había camélidos evidencian "adaptaciones de altura". En casosmás complicados,la ausencia de puntas líticasbifacialesen algunaszonasselváticasse debe a que 31

ducido notables avances en el conocimiento del proceso de evolución humana. Como ejemse les hacía de madera o hueso, materiales perecederos que no aparecen en los registros, pero indican "adaptaciones a las selvas tropicales". Creemos que resultaría odioso abundar en citas de ejemplos concretos.

34


APUNTES

SOBRE

LAS INVESTIGACIONES

PREHISTÓRICAS

EN MÉXICO

y AMÉRICA

plos, podemos anotar los estudios sobre adaptaciones morfológicas y fisiológicas de las poblaciones humanas a las grandes alturas de la región andina, la relación existente entre clima, dieta y braquicefalización, los patrones de morfolología corporal en relación con la temperatura y la humedad, etc. Todos éstos son procesos microevolutivos en los que la adaptación se explica por un proceso de selección natural.

artefactos líticos podrían explicarse en términos de dispersión, vicariancia, variación y selección entre cazadores recolectores, como los autores citados sostienen: "Functionalist views interpret diversity as adaptation to a changing resource base" (ibid.: 81).33

Existe una variedad de rasgos biológicos que se presentan en una población que son condicionados no por la selección natural, sino por

se trata de teorías que se encuentran en debate en el propio campo de la teoría biológica y ecológica, precisamente porque resultan insufi-

deriva génica. Estos mecanismos explicativos resultan importantes e ineludibles cuando estudiamos características biológicas de las poblacio-

cientes para explicar la diversidad de la vida y, en segundo lugar, porque carecen de una definición de la sociedad humana y de la cultura

nes humanas, aunque cada día es más evidente que la teoría biológica no es en modo alguno suficiente para explicar todas las pautas en evolución biológica que caracterizan al ser huma-

que corresponda a la realidad. En efecto, los enfoques clásicos de la ecología evolutiva sostienen que la estructura de las comunidades ecológicas y su evolución a lo

no (véase Terrazas, 1992 y 2001). Se hace, por lo tanto, necesario explicar los procesos evolutivos y revolucionarios de la organización de las

largo del tiempo es tan sólo un producto pasivo de los procesos de adaptación y evolución que operan en cada una de sus poblaciones, como

sociedades humanas y sus manifestaciones culturales, en el corto y en el largo plazos, por sus

respuesta a los cambios ambientales, básicamente los climáticos (Foley, 1984). Desde esta perspectiva resultaría normal considerar que la evolución de las características culturales humanas produciría modificaciones como respuestas totalmente pasivas a los cambios del entorno. Sin

Nos parece que estos modelos adolecen de dos grandes problemas que los hacen inoperantes para el estudio de los procesos de poblamiento temprano en América. El primero es que

propiedades internas. Algunos autores han considerado de manera explícita que los principios de la teoría biológica, o alguna modificación funcionalista de la misma?on suficientes para explicar el desarro-

embargo, se ha encontrado que las comunidades ecológicas son capaces de una autoorganización mucho mayor de la que anteriormente se había supuesto. La evolución de las comunidades ecológicas no es una respuesta simple a los cambios del clima, sino que se trata de un proceso de interacción múltiple entre las poblaciones componentes. La capacidad de respuesta de una comunidad depende de su estructura interna y no de la direccionalidad impuesta por el ambiente. Es en el interior de la comu-

llo de la cultura humana. Tal es el caso de la definición de la cultura como un conjunto de adaptaciones extrasomáticas al medio ambiente, comportamientos adquiridos por medios cognitivos (no hereditarios genéticamente) que forman parte de la adaptación de una población a su entorno ecológico. Esta postura clásica de la antropología funcionalista ha sido llevada a su extremo por autores que sostienen que los elementos de la cultura material (léanse evidencias arqueológicas) constituyen verdaderos compo-

nidad donde tenemos que buscar las causas de su evolución (Margulis, 1995). Incluso se ha pos-

nentes del fenotipo humano, por lo cual estarían sujetas a los mismos principios de mutación y selección natural que los órganos biológicos (cfr. Lanata y Borrero, 1999). Por lo tanto, los patrones de distribución

tulado que la estructura de las comunidades bio-

33 En realidad, la variabilidad se origina de manera aleatoria y la selección opera reduciendo la diversidad.

regional de diferentes

35


LUIS F. BATE y ALEJANDRO

lógicas es capaz de modificar las condiciones del clima, llegando a una escala planetaria, formulada bajo el concepto teórico de Gaia (Lovelock, 1998). Esta conclusión nos remite a la segunda pro-

TERRAZAS

Black box societies. Desde hace un tiempo, hemos venido usando la metáfora de la "caja negra" para referirnos a uno de los usos más frecuentes de las teorías por parte de nuestros colegas evolucionistas y adaptacionistas. y, en un típi-

blemática, que consiste en la inadecuada definición de la sociedad y la cultura humana en los enfoques funcionalistas. Principalmente en los que

co caso de "redescubrimiento", encontramos a nuestro "predescubridor"34 en el uso de tal analogía, nada menos que en Edmund Leach, hace treinta años. Hace las mismas analogías que nosotros, aunque llega a conclusiones diferentes. Dejemos que sea el mismo Leach quien nos

el reduccionismo biológico es rampante se presenta a la sociedad como un sistema cuya función es reproducirse y, para hacerlo, debe responder adecuadamente a los cambios del ambiente. Cuando sostienen que la cultura es la manera como estas sociedades se adaptan de manera pasiva a las presiones exteriores, olvidan que la capacidad de respuesta, de cambio o permanencia cultural, depende no de las supuestas condiciones "modeladoras" del ambiente, sino de las características internas del sistema social (lo que hoy día se conoce como capacidad autopoiética).

resuma el concepto de "caja negra": A Black Box is any imaginary mechanism, the workings of which cannot be investigated. Notionnally we can observe the input (x) to the Black Box and also the output (y). This may show us that the relationship between x and y is ordered and not random, Le. that y = F (x). In such circumstances we cannot infere with any confidence whatsoever what goes on inside the Black Box (Leach, 1973: 675).

Olvidan que es en el interior de las sociedades y en su estrecha relación con las características biológicas de las poblaciones (la relación biosocial)

Tal relación es esquematizada en la figura 1, mostrando cómo operaría en el caso de las investigaciones antropológicas y arqueológicas en la figura 2 (tomadas de Leach, pp. 765 y 766, respectivamente) . Anotaremos alguno de sus comentarios, que son pertinentes a nuestro tema

que sustentan esas sociedades donde debemos encontrar las explicaciones de sus características históricas. Por otra parte, los modelos funcionalistas hacen caso omiso de la principal característica de la cultura humana: que las sociedades humanas no se ad'aptan al ambiente, sino que se orga-

...these same "new" archaeologists -and I am thinking here of Professor Binford's contributions to our present discussions- give the impression that they are naively optimistie. They appear to believe that, given sufficient scientific ingenuity and sufficient wealth of ethnographic parallels, they will not only be able to make inferences about x from a study of y, but further they will then be able to extend the study of x to a point at which they can reconstruet the structure of the internal organization of the Black Box itself. This is an iIIusion. There are alwaysan indefinitely large number of alternative ways in which particular human social systems might be adapted to meet particular ecological and

nizan para modificar este entorno de acuerdo con sus necesidades. Aun en el caso de los grupos de cazadores recolectores de tecnología más simple, encontramos que su manejo cultural produce efectos de transformación a diversas escalas en el ecosistema en que viven. Esta capacidad transformadora, que ocurre de manera no intencional, pero que también implica una planeación por parte de los seres humanos (característica inexistente en la teoría biológica y, por lo visto, también en los modelos biologicistas de algunos colegas), es uno de los problemas centrales que deben explicar las ciencias humanas, pero los modelos funcionalistas y "adaptacionistas" la ocultan haciendo lucir a la sociedad como una verdadera "caja negra", como veremos.

34

36

Véanse estos conceptos en R. Merton (1992: 25 y ss.).


APUNTES

Input

·1

x

SOBRE

LAS INVESTIGACIONES

PREHISTÓRICAS

x y=F(x)

tamente.3S Si así fuera, es posible que uno de los primeros americanos fuera un Newton, ya que, seguramente, desde hace muchos miles de años los primeros sapiens observaban diariamente una multitud de manifestaciones de la existencia de la ley de gravedad. Del mismo modo, ni la estructura del parentesco ni las relaciones de producción o las conexiones en-

Figura 1.

Primary focusofsocial anthropological interest Work interface Prehistoric between environment society andits environment

~

(information flow)

Prehistoric social system incorporating numerous subsystems

l-

---'

x

Patterned material residue ofwork Output~

tre institucionalidad e ideología se revelan a la observación del sociólogo ni del antropólogo. Se

x

trata de regularidades que sólo pueden conocerse a través de inferencias racionales, las que no se derivan espontánea ni necesariamente de la

Primary focusofarchaeological (energy fiow)

Figura 2.

observación. En lo que tiene razón Leach, específicamente en su crítica a Binford, es en cuanto al error

demographic situations. It is quite untrue that forms of social organization are sorne "determined" by the environmental situation and the cultural repertoire with which a particular group is equipped to encounter that environment (ibid.: 767).

de las premisas bajo las cuales se pretende elaborar una teoría social --de cualquier rangosobre las sociedades cazadoras recolectoras consideradas ahistóricamente ...1 appreciate your difficulty as archaeologists; you would like to use the data of ethnography to give flesh and blood to your archaeological remnants. Used with great discretion, I believe that ethnographic evidence can help you to do this; but too far many of the participants at the Seminar seemed to think that the analogies between the ethnographic society and archaeological society are direct... i.e. that the "primitive" societies from the 20th century can be treated as fossillised survivals from proto-historical or even palaeolithic times. This is a very 19th century idea (idem: 761).

Pero pensamos que Leach incurre en un pesimismo poco sustentable al suponer que los sistemas sociales no son inferibles para los arqueólogos. Y exhibe, por su parte, un optimismo notablemente ingenuo al argumentar que, si bien Pilra la arqueología ...the contents of the Black Box, social organization as the social anthropologist understands that term, must for ever remain a mistery. In contrast, the ethnographer-social anthropologist has no Black Box problem; he can observe the workings of the system at first hand, and that is a1waysthe focal point of his interest. And, which forms the data of archaeology, does not fall within the purview of social anthropologist at a11 (idem).

En efecto, la diferencia

entre el etnógrafo

y AMÉRICA

gularidades del "sistema" o de la "estructura" que rigen en los distintos campos de la realidad se observan, ni "de primera mano" ni direc-

,Out

'BlackBox'

EN MÉXICO

Volviendo al tema que nos interesa -acerca del uso que se está haciendo de los préstamos teóricos entre los prehistoriadores americanos- hay que decir que no se trata de que busquen inferir x (las condiciones paleoambientales) a partir de y (el registro arqueológico).

y

el arqueólogo consiste en que el primero puede observar directamente las manifestaciones fenoménicas del sistema social y el arqueólogo debe inferirlas. Pero en ninguna ciencia las re-

bien se opera al revés: se pretende

Más

que, dadas

" El mismo Leach ha hecho esta distinción a través de los conceptos de "cultura"y "estructurasocial".

37


LUIS F. BATE y ALEJANDRO TERRAZAS

determinadas condiciones ambientales x, conocidas gracias a las disciplinas pertinentes (paleo-

LAS ''TEORÍAS'' SOBRE EL POBlAMIENTO

climatología, arqueozoología, etc.) se podría explicar y, es decir, las características del registro arqueológico, conforme al supuesto de que éstas son el efecto de un "sistema adaptativo" que es el que opera como una verdadera "caja negra", es decir, no se sabe cómo. Y, en el supuesto

AMERICANO

Tal vez resultaría demasiado grandilocuente hablar, como se hace con mucha frecuencia, acerca de las "teorías" sobre e! poblamiento americano. La mayor parte de las propuestas son conjeturas mejor o peor fundamentadas acerca de quiénes fueron, cuándo, cómo o por dónde ingresaron los primeros pobladores del Nuevo Mundo,

de que lo que interesa es explicar la variabilidad y el cambio, lo más común es que se nos presenten correlaciones que nos muestran que "en la época tal cambió el clima, se modificó la composición y distribución espacial de la flora y la fauna, los cursos o niveles de las aguas y, como consecuencia, se modificó e! patrón de asentamiento, o la distribución y composición porcentual de los artefactos". Se sobreentiende

aunque escasean las tentativas de respuestas a preguntas de tipo por qué.36 Por lo demás, las caracterizaciones hipotéticas de esos pueblos se limitan a su posible filiación racial o a sus acervos artefactuales, fundamentalmente su industria lítica. Y no es que se trate de información poco relevante, sino del hecho de que no se sobrepasa el nivel de lo empíricamente observable. No hay hipótesis acerca de sus posibles formas de organización social, por ejemplo. Para una síntesis del estado actual de los conocimientos y desconocimientos en torno al tema no nos remitiremos a las preclaras intuiciones de! padre Joseph de Acosta, y sólo mencionaremos de manera abusivamente breve los problemas que han orientado las investigacio-

que algo tuvo que ver la organización social, pero no se sabe qué, ni por qué. Es una buena manera de eludir el compromiso de tratar los temas específicamente sociales. Lo que nos interesa es llamar la atención acerca de la notable falta de uso de teorías sociales que expliquen no sólo las supuestas "adaptaciones" sino, en general, los distintos aspectos de los procesos sustantivamente históricosociales. Se supone que la arqueología estudia "pueblos", "culturas" o "sociedades", y es precisamente sobre lo cual se carece de teorías explícitas. De manera que los agentes del cambio no resultan ser los pueblos ni las sociedades, sino, como lo diría explícitamente Binford, se trata de agentes "ecológicos externos", con la diferencia de que este investigador sí asume, al

nes desde los comienzos de los trabajos "científicos" sobre la cuestión, para reseñar los aspectos más relevantes de los debates de las tres últimas décadas, que configuran la situación presente. Para un análisis más amplio de la historia de las propuestas, nos remitimos a trabajos anteriores renzo, 1986).

menos y a su manera, la tarea de explicar las relaciones "funcionales internas" de las sociedades cazadoras recolectoras.

(Bate, 1983, 1990 Y 1992a; Lo-

EL "HOMBRE FÓSIL" AMERICANO

Para sintetizar este punto, podemos decir que, en cuanto a la "prehistoria" en México, como en e! resto de América, los muy abundantes

La primera etapa de estas investigaciones se remonta a la primera mitad del siglo XIX, cuando e! naturalista danés P.W. Lund reporta e!

estudios empíricos guardan una notable desconexión con la producción teórica que deberían servir para orientar e integrar la investigación

hallazgo en Lagóa Santa, Brasil, de osamentas humanas junto con restos de animales desapa-

sobre el tema. Y las excepciones, no muy numerosas, muestran en general una subutilización y retraso respecto a esa producción.

36 A lo más, se limitan a explicaciones del tipo de que ingresaron por la costa o por un posible corredor lauréntido porque el resto del continente habría estado cubierto por casquetes glaciares.

38


APUNTES SOBRE LAS INVESTIGACIONES PREHISTÓRICAS EN MÉXICO y AMÉRICA

(1988), los Estadios 1 y 11 de R.

recidos que mostrarían "haber pertenecido a una creación distinta de la que se presenta hoy a nuestra vista", asociación estratigráfica que

de J. Schobinger

confirma en 1843. Fue la etapa de búsquedas del "hombre fósil'.' americano, en que la cues-

acuerdo con Lanning y Patterson (1967), o el Arqueolítico de J.L. Lorenzo (1967 y 1986), entre

tión en debate era si el hombre llegó a coexistir con fauna pleistocénica extinta en este continente. Polémica que alcanza un punto culminante con la propuesta de F. Ameghino -publicada en 1880, en París, en La antigüedad del hombre en El

otros. La debilidad capital de esas propuestas es que respondían a una interpretación errónea de las industrias líticas y carecían de con fiabilidad de registros arqueológicos y cronológicos, implican-

Plata-, rechazada por Ales Hrdlicka en 1911, quien no aceptaba ocupaciones del final del periodo glacial. Ambos planteamientos ya están

do la imposibilidad de sostener la existencia real de esas supuestas entidades culturales, tal como

MacN eish (1976, 1987), las tradiciones de lascas, de buriles y de bifaces de G. Willey (1971), de

habían sido definidas. Tema que, en su oportunidad, criticamos detalladamente para Sudamérica, aceptando unos cuantos registros confiables anteriores al 12000 a.P., que incluyen a

largamente superados. Esa fase se cierra a fines de los años veinte y principios de los treinta del siglo xx, al aceptarse los hallazgos que confirman dicha coexistencia en el que se llamó "complejo Clovis-Portales" en Norteamérica y el "Periodo !" de Bird, registrado en las cuevas de Fell y Pali Aike, en el extremo sur de la Patagonia.

Monte Verde (Bate, 1983). Hacia comienzos de la década de los ochenta, las mencionadas secuencias pierden peso como sistemas de referencia, principalmente porque el desarrollo de investigaciones regionales con mejores técnicas y registros más confiables no las toman en cuenta. Pero son muy escasas las nuevas propuestas de alcance general (p. ej., Dillehay, Ardila, Politis y Beltrao

CULTURAS "PRIMITIVAS" Y "MODERNAS"

Luego, desde mediados del siglo xx, se genera una serie de propuestas que, aunque se fundan en distintas orientaciones, comparten el objetivo particularista histórico de culminar con la

[1992]) Y la discusión se vuelca hacia el tema más puntual de la cronología, posible proveniencia y rutas de ingreso de los primeros americanos.

elaboración de secuencias cronológico-culturales. Prácticamente todos los autores que formulan secuencias generales -de escala continental- c<!inciden en la distinción entre culturas de cazadores de tipo "primitivo" o "moderno", basadas fundamentalmente en la morfología de las industrias líticas. La pregunta central a la que responden tales planteamientos se refiere a si los primeros habitantes de América fueron pueblos atribuibles al Paleolítico superior del Viejo Mundo o anteriores a él, del Paleolítico inferior o medio, cuestión sin duda más relevante y de implicaciones más interesantes que el "debate Pre Clovis/Clovis First" (véase Bryan, 2000). Y, en torno a ella, la

EL "DEBATE PRE-CLOVlS/CLOVlS

FIRST":

UNA FARSA MERCADOTÉCNICA

La obra general más reciente sobre este tOplco es "The Settlement of the Americas", de Thomas Dillehay (2000), director de las acuciosas investigaciones sobre el sitio de Monte Verde, en el sur de Chile. Ésta nos da una buena idea de la orientación que ha seguido la mayoría de las publicaciones de divulgación científica en los últimos años y de cómo se plantea la problemática en la actualidad. Se ha puesto como centro de la "polémica"

mayoría de los autores proponía la presencia americana de poblaciones de tipo Paleolítico inferior-medio y, por lo tanto, anteriores a Clovis. Se trata del Pre-projectile Point de A. Krieger (1964), del Protolítico de o. Menghin (1963) y

una controversia parroquial estadounidense acerca de si los primeros habitantes del Nuevo Mundo fueron los "paleoindios" que iniciarían con la cultura Clovis, o poblaciones anteriores a

39


LUIS F. BATE y ALEJANDRO TERRAZAS

ella (el debate Pre-Clovis/Clovis First). Donde Dillehay aparece como el adalid de la "nueva

se pueden haber creído el mito de "Clovis first", sino que él mismo presenta la cuestión como si fuera un debate de alcance continental.4o Lo único que llega a decir es que: "Because many South American archaeologists did not see the North American Clovis theory as applicable to the Southern Hemisphere, they developed different and exiting ideas about the peopling of the Americas that are largely unknown in the English-speaking world".41 Y, líneas más adelante: "Only in recent years have North American

teoría", echando por tierra a las ''viejas teorías", que suponían que los primeros pobladores de América habrían sido" los portadores de la cultura Clovis, de supuesta filiación mongoloide,37 extendiéndose a una velocidad vertiginosa por todo el continente y arrasando con la megafauna, hasta el extremo austral. Esto no corresponde a la realidad histórica de las últimas décadas de la arqueología americana -menos aún en Sudaméricay tiene más apariencia de ser un buen recurso mercadotécnico, presentado como si fuera el centro de la gran polémica "teórica" en toda América. Es posible que haya servido para sensibilizar a las instituciones financian tes, pero, de hecho,

archaeologists looked seriously beyond North America to study the origins of the first Americans" (idem). Esto ya no corresponde a la verdad, desde que varios autores estadounidenses ocupados del tema, como Krieger, WiIley, Rouse, Lann-

la pregunta a que responde es mucho menos relevante que las cuestiones planteadas por las "teorías" anteriores.

ing y Patterson o MacNeish, siempre incluyeron la información latinoamericana disponible. Los últimos desarrollaron incluso algunos

Ocurre que la hipótesis de que la población Clovis fuera la primera de América nunca tuvo

de los más importantes proyectos regionáles en Perú, Chile, Ecuador o México, con respaldo de la Universidad de Columbia o la Peabody Foundation.

mayor trascendencia fuera de EVA y, fuera de ese país, muy pocos autores fueron conocidos por haberla sustentado, como V. Haynes, P.

Pero otra afirmación errónea aparece desde la primera página del Prefacio (DiIlehay, 2000: XIII): "Many books have been written about the

Martin o Th. Lynch. Tal propuesta nunca llegó a ser predominante en el resto de América. En los hechos, como hemos visto, la gran mayoría de las "viejas teorías", es decir, las que estaban en boga cuando se dan a conocer las primeras publicaciones sobre Monte Verde,38 proponían la existencia de poblaciones turas" pre-Clovis.

archaeology of the first North American and the processes that led to their arrival and dispersion throghout the Americas. No such book exists for South Amenca" (cursivas nuestras). Dificilmente Dillehay desconoce la obra de Schobinger, Prehistoria de Sudamérica (1988), que

o "cul-

Por supuesto, todo esto es algo que Dillehay sabe muy bien.39 No obstante, no sólo no se ha ocupado de aclarar las cosas a sus colegas estadounidenses que serían, en todo caso, quienes

acepta Monte Verde, no porque sea un converso a "la nueva teoría", pues sus planteamientos estaban ya claros en el libro anterior, de 1969. O nuestro trabajo "Comunidades primitivas de cazadores recolectores en Sudamérica" (1983), para el cual tuvo la gentileza de enviarnos las

37 Hoy en día, gracias a los importantes avances en los estudios genéticos, se sostiene que las poblaciones atribuidas al "paleoindio" no compartirían las características mongoloides de las poblaciones "amerindias", las cuales se generalizarían después del 9 000 a.P. (como Powell, Neves, Ozolins y Pucciariarelli, 1999). 38 DiIlehay (1981) y Collins (1981). 39 Dillehay, comunicación personal, en reunión de convivencia con arqueólogos asistentes al XlII Congreso Nacional de Arqueología Argentina en Córdoba, 1999.

fotos que ilustran Monte Verde. Creo que fui-

40 Tal vez no está demás aclarar que cuando usamos el adjetivo americano, entendemos que América se extiende desde Alaska hasta Tierra del Fuego (además de la Antártida), y cuando nos referimos al continente se trata de toda América. 41 Dillehay (2000: XIV).

40


APUNTES

SOBRE

LAS INVESTIGACIONES

PREHISTÓRICAS

EN MÉXICO

y AMÉRICA

tanto de los registros como de las interpretaciones.42 De manera que no faltó el capítulo de "Monte Verde under fire", resistiendo los múltiples ataques de los fundamentalistas "Clovis first". Ni el del "gran jurado" que acaba por absolver a Dillehay de toda sospecha, con lo cual la "nueva teoría" triunfa finalmente sobre las "viejas teorías". Y mientras tanto, han proliferado en casi todas las revistas de información

mas de los primeros en aceptar, en una obra general sobre los cazadores recolectores sudamericanos (sin haberlo cuestionado antes), al sitio de Monte Verde --con una fecha de 12500 años a.P.- como el más temprano del área meridional andina, seguido por Quereo y Taguatagua, para no remontarnos al volumen sobre Sudamérica de An Introduction to American Archaeology, de Cardan Willey (1971). y el mito se construye, al buen estilo estadounidense, pasando de la modesta historia del ciudadano común al protagonismo continental:

científica, en la páginas de internet o en las revistas y programas televisivos de divulgación, los apóstoles de la "nueva teoría".43

1 thought Monte Verde probably dated in the late Ice Age, sometime between 11000 and 10000 years ago. My colleages and 1 were startled, however, when radiocarbon tests on the bone, charcoal from firepits, and wooden artifacts consistently yielded dates of more than 12000 years ago. These dates were simply impossible. As a graduate student, 1 had been trained to believe (and never seriously question) that the first culture in the New World was the Clovis culture ... (Dillehay, 2000: XV).

Si todo esto ha permitido obtener buenos apoyos para la investigación, habrán sido, al fin y al cabo, recursos bien invertidos.44 Pero es poco justo que Dillehay, exceptuando a Bryan y Krieger, no cite a ninguno de los investigadores que, desde siempre, han propuesto el

42 Véase Bate (1982, 1983 Y 1990), donde quedará, además, suficientemente claro que nunca sustentamos la idea de que la primera población americana fuera Clovis. Desde un principio aceptábamos fechas anteriores a 12000 a.P. para El Abra, El Jobo (Taimataima), Huargo, Sitio do Meio, Santana do Riacho o Los Toldos, para mencionar algunas. 43 Hasta en una revista para pasajeros de una línea aérea sudamericana, el traductor(a) de un artículo publicado originalmente en Discover Magazine -seguramente alguien más o menos informado sobre el tema- se toma la libertad de destacar el punto a su manera: "un grupo de arqueólogos llegaron a un punto de consenso de que el cercano sitio de Monte Verde tenía 12500 años de antigüedad. Esa concordancia de opiniones invalidó la vieja teoría de que los primeros americanos fueron los pobladores de Clovis..." y, más adelan te, "hasta los más acérrimos enemigos de la nueva teoría quedaron atraídos con los hallazgos" (Shanti Menon: "Los primeros del continente/First settlers on the continent", Ladeco Magazine, pp. 57-63, enero-febrero de 2000). La versión original en inglés dice: "...a dozen archeologists toasted the passing of a paradigm. They have finally accepted that the nearby site of Monte Verde was 12.500 years old. In doing so, they put to rest the longstanding theory that the first American were the Clovis people". Luego "...even the staunchest skeptic was converted". 44 Sin lugar a duda, mucho mejor invertidos y menos costosos que cada misil "inteligente" con los que se está asesinando "colateralmente" a miles de civiles afganos. Sirva esta comparación desproporcionada para evaluar la importancia que las instituciones otorgan a la investigación arqueológica.

Donde, de paso, nos informa de la mala formación que reciben los graduados estadounidenses en arqueología. Pero, ya en la siguiente página, no es sólo un defecto de la enseñanza local, pues se trata de que .....Clovis represented one- o/ the most deeply entrenched archaeological theories in the New World" (p. XVI, cursivas nuestras). Lo cual, como resulta evidente, es simplemente falso. Y cuando resume, más adelante: "What aH this boils down to is the politics of science and the replacement of one paradigm by another" (p. XVIII), se trata de una aseveración que probablemente sea válida para el medio estadounidense, pero de ninguna manera para todo el Nuevo Mundo. Lo que ocurrió con Monte Verde fue lo mismo que pasó con la mayoría de las "viejas teorías" que proponían que sí hubo poblaciones pre-Clovis: que fueron sometidas a rigurosos cuestionamien-' tos fácticos, debido a que la información en que se sustentaban las supuestas entidades culturales más antiguas carecían de confiabilidad,

41


LUIS F. BATE y ALEJANDRO TERRAZAS

poblamiento de América por poblaciones preClovis en el contexto de dicha polémica.45 Con esto

... The environment should not, of course, be emphasized unduly: A1though people's natural world is important, it is not so important that it overshadows their history. Phisiography and c1imate can force people to change their mode of life, but even so these factors remain external to the history ofa people (p. 45).

aparece, al menos ante sus lectores estadounidenses, como el gran precursor radical de la "nueva teoría", de la gran revolución paradigmática. Yel pretender poner el tema en el centro del gran debate del Nuevo Mundo tiene todos los visos de ser una nueva modalidad de

-que, por lo demás, seguramente compartirían muchos colegas en su línea-,47 en los hechos sus planteamientos asumen eclécticamen-

lo que, en su tiempo y en otras circunstancias, Evans y Meggers (1973) calificaban como "imperialismo" de la arqueología estadounidense en América Latina.

te aportes diversos, predominando un enfoque marcadamente ambientalista y adaptacionista. Es, con todo, la mejor síntesis actualizada de la información relativa a los cazadores recolecto-

Por lo demás, el libro comentado contiene una buena síntesis actualizada de la información relevante sobre el tema. El argumento básico es correcto y está bien sostenido: hace unos 11000 años ya existía en Sudamérica una tal

res sudamericanos. En realidad, si hemos considerado pertinente opinar -en tono impertinente-48 sobre este

diversidad cultural que resulta absolutamente inexplicable a través de una colonización relámpago que se hubiera iniciado en Alaska unos 280 años atrás. Por lo tanto, compartimos su opinión de que el tema de la fecha del ingreso de los primeros grupos humanos a América queda abierto y bien puede remontarse a varios milenios antes de Clovis.

"debate", es principalmente para destacar el hecho de que ha incidido en desviar la atención de las investigaciones sobre los temas más importantes que ya estaban planteados en la pretíistoria americana, aun cuando fuera desde posiciones empírica y teóricamente bastante precarias. LA PROBLEMÁTICA DEL POBLAMIENTO AMERICANO

Se incorporan también a la obra los aportes relevantes proporcionados por otras disciplinas,

Dado que la cuestión de la existencia de ocupaciones pre-Clovis en América debería considerarse una cuestión definitivamente resuelta,

como la antropología fisica, los estudios genéticos o lingüísticos, como ya lo están haciendo otros autores (p. ej., Dixon, 1999). Y, ponien-

se trata de ver cuáles son los problemas que hoy debería enfrentar la investigación del tema.

do el ejemplo en cuanto a la necesidad de superación del empirismo llano predominante,46 incorpora la discusión de aspectos teóricos y de orientaciones temáticas más recientes. Pero,

Muchos de ellos estaban esbozados ya, implícita o expresamente, antes del episodio poco relevante del debate en torno a Clovis, el cual, por lo demás, no es un debate teórico, sino estrictamente empírico: se trata de determinar si existen o no existen datos confiables de ocupaciones humanas anteriores a las más antiguas datacio-

aunque hace aseveraciones como la de que 45 A. Schobinger, por ejemplo, sólo lo menciona en la larga lista de colegas sudamericanos a los cuales agradece la oportunidad de haber discutido o conocido de primera mano la información sobre el registro arqueológico del Pleistoceno tardío. 46 Inquietud manifiesta en textos anteriores, como el ya citado de 1988, en que participa de las críticas de la corriente ontologista de la arqueología posprocesual, frente al reduccionismo metodológico de la "new archaeology", aunque toma de Kaplan (1984) los planteamientos sostenidos por investigadores del RATS (Radical Archaeology Theory Seminar) en el libro editado por Keene y Moore (1983).

nes asociadas a Clovis, cuestión que se resuelve simplemente con un par de registros bien documentados y fechados. Estas cuestiones tienen que ver con la explicación tanto de problemas

de los procesos de

47 También nosotros estamos de acuerdo con tal afirmación. 48 Esperamos que se entienda que no tiene más intención que la de ser un recurso polémico.

42


APUNTES

SOBRE

LAS INVESTIGACIONES

PREHISTÓRICAS

desarrollo y cambios en la historia de la evolución humana, como del tipo de sociedades que

EN MÉXICO

y AMÉRICA

En la dimensión cultural, dos de esos modos de vida, los de los "antiguos cazadores recolectores panandinos" y los "cazadores recolectores australes", considerando las enormes distancias geográficas implicadas, aceptarían -como los materiales de Meadowcroft o Cactus HiIl y de

podrían estar implicadas en los procesos de poblamiento de nuestro continente. Ésto conlleva un cuestionamiento de la concepción general sobre el desarrollo de las sociedades. En lo general, nos parece adecuada la forma en que Bryan (2000) ha situado el problema. Se ponen en discusión afirmaciones acerca de qué tipo de Homo sapiens habría integrado las poblaciones que alcanzan hasta el Nuevo Mundo, y

las posteriores poblaciones del llamado "complejo El Llano", incluyendo a Clovis- comparaciones tipológicas con algunas variantes musteroides que podrían estar en la base de las secuencias euroasiáticas de los paleolíticos medio y superior. Una tercera población, la de los "cazadores del trópico americano" -que, de

no sólo el hecho de si éstos correspondieron tecnológicamente a "culturas paleolíticas" en su estadio inferior-medio o superior, sino incluso si esas clasificaciones corresponden a una secuencia histórica de validez universal.

acuerdo con la información actual, poseería los registros más antiguos en Sudaméricapresenta en cambio una tipología artefactual y una racionalidad en la explotación del medio notablemente diferente. Donde la apariencia de mayor simplicidad y "generalidad" no correspon-

Como tampoco cabría aquí una caracterización general del "estado de la cuestión", para lo cual existen varias síntesis recientes (p. ej., Dixon, 1999; DiIlehay, 2000, o Chatters, 2001), nos remitiremos a una síntesis de las alternativas abiertas a la discusión que hemos resumido en trabajos anteriores, subrayando aquellas que nos parecen más probables.49 Nos basamos -al igual que DiIlehay- en una síntesis de la información arqueológica sobre cazadores recolectores sudamericanos, de donde concluimos que hace unos 12000 años todo el continente meridional estaba ya ocupado por ,tres poblaciones culturalmente diferenciadas, que correspondían a distintos modos de vida. Entendidos éstos como desarrollos particulares de formaciones sociales pretribales, que implicaban distintas estrategias de utilización y trans-

de a una menor eficiencia económica. Habría que esperar a que se contrastaran adecuadamente las hipótesis acerca de un sapiens moderno situado hace unos setenta y cinco milenios en el noreste de África (la "Eva africana"), extendiéndose por el sureste asiático (hacia la hipotética "Sundaland"), por una parte; pero también otra población -originalmente la misma o distinta- avanzando hacia el norte y noreste y que podría estar igualmente involucrada en el desarrollo de la "revolución del Paleolítico superior" europeo (Gilman, 1984). De ser así, tendríamos dos poblaciones en posibilidad de haber ingresado a América por Beringia. Nos parece más probable -aunque no tendría que ser necesariamente así- que la primera población proviniera del sureste asiático

formación de una diversidad de medioambientes y de organización de sus relaciones sociales.

sin poder argumentar claramente una cronología aproximada, aunque bien pudiera ser cercana o algo superior a cuarenta milenios. La otra podría corresponder a una población relacionada con una "tradición musteroide"-"paleolítico superior". La caracterización de la or-

Bate (1992a). Propuesta que retomamos y actualizamos para un proyecto de investigación (Bate y Terrazas, 2001) que presentamos a Conaeyt y que fue categóricamente rechazado, con el argumento principal de que era "muy ambicioso y, por lo tanto, inviable". Independientemente de la calidad del proyecto, de tal argumento deberíamos deducir que nuestras instituciones están más bien interesadas en promover la mediocridad, o que las ir¡stancias evaluadoras de la principal institución promotora de la investigación científica en México reflejan una situación de las investigaciones prehistóricas más deplorable que lo que queremos imaginar. 49

ganización social que éstas habrían tenido al poblar el Nuevo Mundo dependería de las fechas de su ingreso a América y de la temporalidad de los procesos que habrían tenido

43


LUIS F. BATE y ALEJANDRO

TERRAZAS

lugar en el centro-noreste asiático, pues una de las implicaciones de la discusión sobre las fe-

ra un proceso resuelto en el Viejo o en el Nuevo Mundo.52 Y las alternativas podrían ser distintas

chas de tal evento sería saber si se trataba de cazadores del "Paleolítico" medio o superior. y,

en el caso -que nos parece más probablede que hubiera ocurrido más de una inmigración

aunque ya no estaría ligado directamente a esa secuencia,5o queda pendiente el problema de cómo caracterizar al tipo de sapiens que fuera el primer ancestro americano. Lo que parece claro es que, aun los antecesores de las diversas poblaciones contemporáneas de Clovis, habrían entrado antes de la rea-

pleistocénica.

BIBLIOGRAFÍA Álvarez y Fiore (1993), "La arqueología como ciencia social: apuntes para un enfoque teórico epistemológico", Boletín de Antropología Americana, núm. 27, pp. 21-38. Anderson y Gillam (2000), "Paleoindian Colonization of the Americas: Implications from an Examination of Phisiography Demography and Artifact Distribution", American An-

pertura del corredor lauréntido-cordillerano. En cualquier caso, tanto la hipótesis del ingreso costero (Fladmark, Dixon, Bryan) como la del puente continental requerirán de mayores argumentaciones y apoyos empíricos.51 Hemos sostenido que la tradicional secuen-

tiquity, vol. 61, núm. 1, pp. 43-66. Bate, Luis Felipe (1982), "Sobre el poblamiento temprano de Sudamérica", Actas del X Congreso de la UISPP (1981), México, pp. 423-427. /

cia centroeuropea de los paleolíticos inferiormedio-superior no puede ser sustentada como una periodización histórica universal, tanto por las variables que se han manejado en su formulación, como por no permitir dar cuenta empíricamente de las "anomalías" asiáticas o ame-

---

ricanas. Pensamos que es necesario replantear teóricamente los sistemas de hipótesis que permitirían explicar, como una totalidad, las estructuras y procesos de desarrollo de las socie-

(1983), "Comunidades primitivas de cazadores-recolectores en Sudamérica", Historia General de América, tomos 2-1 y 2-II, Caracas, Ediciones de la Presidencia de la República.

---

(1986), "El modo de producción cazador recolector o la economía del 'sa1v~ismo''', Boletín de Antropología Americana, núm. 13, pp. 5-31. --(1990), "Culturas y modos de vida de los

dades antiguas de cazadores recolectores. y, aunque aún no contamos con elementos de juicio suficientes para afirmar desde qué momento quedaron claramente estructuradas las formaciones sociales que hemos denomina-

cazadores recolectores en el poblamiento de América del Sur", Revista de Arqueología Ame-

do pretribales, proponemos que todas las sociedades concretas americanas para las cuales

---

tenemos algo de información a partir de hace unos doce milenios -y que, claramente, no corresponden al primer momento del pobla---

miento americano-, ya podrían ser categorizadas de esa manera, por lo que queda abierta la posibilidad de que su constitución como tal fue-

ricana, núm. 2, pp. 89-153. (1992a), "Las sociedades cazadorasrecolectoras pretribales o el 'paleolítico superior' visto desde Sudamérica", Boletín de Antropología Americana, núm. 25, pp. 105-155. (1992b), "Del registro estático al pasado dinámico: entre un salto mortal y un milagro dialéctico", Boletín de Antropología Americana, núm. 26, pp. 49-67.

50 Y,por lo tanto, no se estaría implicando la eventual participación de neandertales. 51 Por ahora nos parecen bastante razonables los argumentos de Strauss (2000) respecto a la hipótesis de la "conexión solutrense" por vía atlántica, aunque habrá que esperar la publicación que estarían preparando Stanford y Bradley.

52 José Ramos Muñoz (1999) opina que, en Europa, ya las poblaciones neandertales, al menos al final del Paleolítico medio, presentarían algunas características de organización como cazadores recolectores pretribales.

44


APUNTESSOBRELASINVESTIGACIONES PREHISTÓRICAS EN MÉXICOy AMÉRICA----frew (ed.), The Explanation of Culture Change: Models in Prehistory, Liverpool, Duckworth,

(1998), El proceso de investigación en arqueología, Barcelona, Ed. Crítica. --(1999), "Comunidades andinas pretribales: los orígenes de la diversidad", en L. Lumbreras (ed.), Historia de América Andina, vol. 1, Las sociedades aborigenes, Quito, Universidad Andina Simón Bolívar, cap.

n, pp.

pp. 93-102. Cavalli-Sforza, Luca (1998), Genes, pueblos y lenguas, Barcelona, Editorial Crítica (Drakontos). Chapman, Anne (1990), "Economía y estructura social de la sociedad Selk'nam (Tierra del Fuego)", enJ.R. Bárcenas (ed.), Culturas indígenas de la Patagonia, Madrid, Quinto Centenario, Turner, pp. 171-199. Chatters, James (2001), Ancient Encounters. Kennewick Man and the First Americans, Nueva

77-

108.

---

Y Nocete (1993), "Un fantasma recorre la arqueología (no sólo en Europa) ", Arqcritica, núm. 6, Madrid, Librería Tipo.

Bender y Morris (1990), "Veinte años de historia, evolución y cambio social en los estudios

York, Simon & Schuster. Collins, Michael (1981), "The Implications of the Lithic Assamblage from Monte Verde", X Congreso de la UISPP, Comisión XII: El poblamiento de América, México. Dillehay, Thomas (1981), "Early Man in SouthCentral Andes: Monte Verde", X Congreso

sobre cazadores-recolectores", Gens, Boletín de la Sociedad Venezolana de Arqueólogos, vol. 4, núm. 2, Caracas. Binford, Lewis (1988), En busca del pasado, Barcelona, Ed. Crítica. (1989), Debating Archaeology, San Diego, Academic Press. --(2001), Constructing Frames of Reference. An Analytical Method far Archaeological Theory Building Using Ethnographic and Environmen. tal Data Sets, Berkeley, The University of Cali---

de la UISPP, Comisión XII: El poblamiento de América, México. --(1988), "Un ensayo sobre el reduccionismo metodológico y la 'ley del instrumento' en la arqueología norteamericana", Revista Etnia, núm. 33, pp. 3-16. -(2000), "The Settlement of the Ame-

fornia Press. Bonnichsen y Steele (eds.) (1994), Methods and

ricas. A New York, Perseus Dillehay, Ardila, Hunters and

Theory for Investigating the Peopling of the Americas, Corvallis, Oregon State University. Bryan, Alan (ed.) (1978), "Early Man in America/from a Circum Pacific Perspective", Archaeological ResearchesInternationa~ Edmonton. --(1986), New Evidence far the Pleistocene Peopling of the Americas, Orono, Center for ---

Journal of World Prehistary, vol. 6, núm. 2, pp. 145-202. Dixon,James (1999), Bones, Boats and Bison, Albuquerque, University ofNew Mexico Press. Estévez y Vila (1998), "Tierra del Fuego, lugar de encuentros", Revista de Arqueología Ameri-

the Study of Early Man. (2000), "The Original Peopling of Latin América", en Historia General de América Latina,

vol. 1, Las sociedades originarias,

cana, núm. 15, pp. 187-219. Evans y Meggers (1973), "United States 'Imperialism' and Latin American Archaeology", American Antiquity, vol. 38, núm. 3, pp. 257-

cap. 2, UNESCO,versión online: http://www. unesco .org/ cul ture /latinamerica/html_

eng

/ chapter.htm Bunge, Mario (1969), La investigación científica. Su estrategia y su filosofia, Barcelona, Ariel.

Prehistory", Basic Books, Nueva Books Group. Politis y Beltrao (1992), "Early Gatherers of South America",

258. Foley, Robert (1984), "Putting People into Perspective: An Introduction to Community Evolution an Ecology", en HominidEvolution and

Editorial

Burnham, Philip (1973), "The Explanatory Value of the Concept of Adaptation in Studies of Culture Change", en Colin Ren-

Community Ecology, Nueva York, Academic Press.

45


LUIS F. BATE y ALEJANDRO

TERRAZAS

Frison, George (1990), "The North High Plains Paleoindian: An Overview", Revista de Arqueo-

Lee y De Vore (1968), Man the Hunter, Chicago, Aldine Publishing Co.

logía Americana, núm. 2, pp. 9-54. Gándara, Manuel (1980), "La vieja 'nueva arqueología' [primera parte]", Boletín de Antropología Americana, núm. 2, pp. 7-45.

Llamazares, Ana María y Ricardo Slavutzky (1990), "Paradigmas estilísticos en perspectiva histórica: del normativismo culturalista a las alternativas possistémicas", Boletín de Antropología Americana, núm. 22, pp. 21-45. Lorenzo, José Luis (1986), "La etapa lítica en Norte y Centroamérica. Sobre los orígenes del hombre americano", Historia General de Amé-

---

(1981), "La vieja 'nueva arqueología' [segunda parte]", Boletín de Antropología Americana, núm. 2, pp. 7-70.

---

(1993), "El análisis de posiciones teóricas: aplicaciones a la arqueología social", Boletín¡ de Antropología Americana, núm. 27, pp. 5-20. --(1994), "Consecuencias de la adopción

rica, t. 5, Caracas, Ediciones de la Presidencia de la República. ---

de una ontología de la cultura: una perspectiva desde la arqueología", en González y Galindo (eds.), Metodología y cultura, México, Conaculta (Pensar la Cultura). Gilman, Antonio (1984), "Explaining the Upper

(1994), "La premiére colonization du Noveau Monde", Bulletin de la Société PréhistoriqueFranfaise, t. 91, núm. 4-5, pp. 342-346.

Lovelock, James Tusquetes.

(1998),

Caia,

Barcelona,

Lynch, Thomas (1974), 'The Antiquity of Man in South America", Quaternary Research, núm. 4, pp. 356-377.

Palaeolithic Revolution", en M. Spriggs (ed.), Marxist Perspectives in Archaeology, Cambridge, Cambridge University Press. --(1989), "Marxism in American Archaeo-

---

logy", en Langberg-Karlowsky (ed.), Archaeological Thought in America, Cambridge, Cambridge University Press, p. xxx. Haynes, Vance (1969), "The Earliest Americans", Science, núm. 166, pp. 709-715. Keene y Moore (1983), AnthropologicalHammers and Theories, Albuquerque, University ofNew Mexico Press.

Margulis, Lynn (1995), "La vida temprana. Los microbios tienen la palabra", Caia, implicaciones de la nueva biología, Barcelona, Kairós. Martin, Paul (1973), "The Discovery of America", Science, vol. 179, pp. 969-974. MacNeish, Richard (1976), "Early Man in the New World", American Scientist, vol. 64, pp. 316-327.

Kelly, Robert (2000), "Elements of a Behavioral Ecological Paradigm for the Study of Prehistoric Hunter-Gatherers", en M. Schiffer (ed.), Social Theory in Archaeology, Salt Lake City, FAl, University of Utah Press, cap. 5, pp. 63-78. Lanata y Borrero (1999), 'The Archaeology of Hunter-Gatherers in South America", en Politis y Alberti (eds.), Archaeology in Latin America, Londres y Nueva York, Routledge, pp. 76-89.

---

(1978), "Late Pleistocene Adaptations: a New Look at Early Peopling of the New World as of 1976", Journal o/ Anthropological Researeh, vol. 34, núm. 4, pp. 475-496.

---

(1987), "La importancia de los primeros doce sitios del Nuevo Mundo", en A. González (comp.), Origenes del hombre americano, México, SEP, pp. 57-67 (Cien de México).

McGuire, Randall (1992), A Marxist Archaeology, San Diego, Academic Press. Meillassoux, Claude (1977), Mujeres, graneros y capitales, México, Siglo XXI.

Lanning y Patterson (1967), Scientific American, vol. 217, núm. 5, pp. 44-50. Leach, Edmund

(1990), "El hombre de edad glacial en Sudamérica: una perspectiva europea", Revista de Arqueología Americana, núm. 1, pp. 141-185.

(1973), "Conc\uding Address",

en Colin Renfrew (ed.), The Explanation o/ Culture Change: Models in Prehistory, Liverpool, Duckworth, pp. 761-771.

Mena, Francisco (1989), "Cazadores recolectores y arqueología", Boletín de Antropología Americana, núm. 19, pp. 31-47.

46


APUNTES

SOBRE

LAS INVESTIGACIONES

PREHISTÓRICAS

EN MÉXICO

y AMÉRICA

Menghin, Osvaldo (1963), "Industrias de morfología protolítica en Sudamérica", Anales de la Universidad del Norte, Antofagasta, núm. 2,

http://www.archaeology.org/online/features/ clovis/rosel.html Sahlins, Marshall (1977), La economía de la edad

pp. 69-77. Merton, Robert (1992), Teoría y estructura sociales [3' ed. en español, traducción de la 3' edición en inglés, de 1968], México, Fondo de Cultura Económica. Mirambel, Lorena (1994), "Recherches récentes sur le stade lithique au Mexique", Bulletin

de piedra, Madrid, Akal Editor. Schiffer, Michael (2000), "Social Theory in Archaeology. Building Bridges", en M. Schiffer (ed.), Social Theory in Archaeology, Salt Lake

de la Société Préhistorique Francaise, t. 91, núm. 4-5, pp. 240-245. Montané,Julio (1981), "Sociedades igualitarias y modo de producción", Boletín de Antropologia Americana, núm. 3, pp. 71-89.

rica. Culturas precerámicas. Alianza América, Madrid, Alianza Editorial (Col. Quinto

City, FA!, University ofUtah Press, cap. 1, pp. 1-13. Schobinger, Juan (1988), Prehistoria de Sudamé-

---

Nichols, J. (1995), Linguistic Diversity and the Peopling ofthe Americas, Berkeley, The University of California Press. Orquera, Luis Abel (1984), "Specialization

Centenario). (1990), "La Patagonia en el marco de la más antigua prehistoria americana", en J.R. Bárcenas (ed.), Culturas indígenas de la Patagonia, Madrid, Turner, pp. 151-168 (Quinto

Centenario) . Service, Elman (1973), Los cazadores, Barcelona, Nueva Colección Labor.

and

the Middle/Upper Paleolithic Transition", Current Anthropology, vol. 25, núm. 1, pp. 75-

Steward, Julian (1936), "The Economic and Social Basis of Primitive Bandas", Essais in Honor of AL Kroeber, Berkeley, University of

98. Plumet, Patrick (1994), "Le premier peuplement de I'Amerique et de I'Arctique", Bulletin de la Société Préhistorique Francaise, t. 91, núms. 4-5, pp. 228-239.

California Press, pp. 331-350. (1955), Theory of Culture Change, Urbana, University of Illinois Press. Straus, Lawrence Guy (2000), "Solutrean Settlement of North America? A Review of Reality", Scientific American, vol. 65, núm. 2, ---

Politis, Gustavo (1999), "Introduction. Latin American Archaeology: an Inside View", en Politis y Alberti (eds.), Archaeology in Latin America, Londres y Nueva York, Routledge,

pp. 219-226. Surowell, Todd (2000), "Early Paleoindian Woman, Children, Mobility and Fertility", American Antiquity, vol. 65, núm. 3, pp. 493-508.

pp. 1-13. Powell, Neves, Ozolins y Pucciariarelli (1999), "Afinidades biológicas extracontinentales de los dos esqueletos más antiguos de América:

Terrazas, Alejandro (1992), "Bases para la elaboración de una teoría paleoantropológica", Boletín de Antropologia Americana, núm. 25,

implicaciones para el poblamiento del Nuevo Mundo", Antropologia Física Latinoamericana, núm. 2, pp. 7-22.

---

Price, Barbara (1985), "Intensificación y transición en el modo de producción: implicaciones teóricas", Boletín de Antropologia America-

pp. 5-18. (2001), "Teoría de coevolución humana. Una posición teórica en antropología física",

tesis de maestría, México, Facultad de Filosofía y Letras, UNAM. Testart, Alain (1982a), 'The Significan ce of Food Storage among Hunter-Gatherers: Residence Patterns, Population Densities and Social Inequalities", Current Anthropology, vol. 23, pp. 523-537.

na, núm. 12, pp. 17-37. Ramos Muñoz, José (1999), Europa prehistórica. Cazadores recolectores,Madrid, Sílex. Rose, Mark (1999), "The Importance ofMonte Verde", Archaeology Magazine, Archaeological Institute of America. Online features:

47


LUIS F. BATE y ALEJANDRO

---

---

(1982b), Les chasseurs-cueilleurs ou l'origine des inégalités, Nanterre, Societé d'Ethno-

---

(1976b), formation

graphie, Université de Paris X. (1985), Le communisme primitif 1. Eco-

"Stylistic Behaviour

Exchange",

en

C.E.

and InCleland,

Cultural Change and Continuity, Essais in Honour of j.B. Griffin, Nueva York, Academic

nomie et idéologie, París, Éditions de la maison des sciences de I'homme. ---

TERRAZAS

Press. --

(1978), "The Archaeol-ethnology of Hunter-gatherers or the Tyrany of the Ethnographic Record in Archaeology", American Antiquity, vol. 43, núm. 2, pp. 303-309.

---

(1989), 'The Origination of Horno Sapiens, or the Invention, Control and Manipulation of Modern Human Nature", Wenner Gren Foundation Symposium, Critical Approaches

(1986), "Essai sur les fondements de la division sexuelle du travail chez les chas-

seurs-cueilleurs", Cahiers de l'Homme, núm. XXV, París, Éditions de I'École des Hautes Études en Sciences Sociales. Williams, BJ. (1974), "A ModeI of Band Society", American Antiquity, vol. 39, núm. 4, p.2. Wobst, Martin (1974), "Boundary Conditions for Paleolithic Social Systems: A Simulation Approach", American Antiquity, vol. 39, núm. 2, pp. 147-177.

in Archaeology, Cascais, núm. 108. Zarankin y Acuto (eds.) (1999), "Sed non satiata", Teoria social en la arqueologia latinoameri-

---

Zilhao, Joao (1990), 'Theoretical Paradigms and Practical Research", en TJ. Gamito (ed.), Arqueología hoje, Faro.

cana contemporánea, Buenos Aires, Ediciones El Tridente (Col. Científica).

(1976a), "Locational Relationships in Paleolithic Society", Journal of Human Evolution, vol. 5, pp. 49-58.

48


LA

MUJER DEL PEÑÓN

III

José Concepción Jiménez López, * Rocío Hemández Flores, * Gloria Martínez Sosa * y Gaúriel Saucedo Arteaga**

American Continent.

RESUMEN Los resultados obtenidos del análisis morfométrico y la determinación de la antigüedad de la Mujer del Peñón III esclarecen algunos datos en torno a la antigüedad y la migración del hombre en el continente americano. Con esta información podemos plantear una serie de aseveraciones en relación con las hipótesis formuladas anteriormente en cuanto a la presencia del hombre temprano en la cuenca de México. Hoy día, gracias al fechamiento de la Mujer del Peñón III, se ha podido establecer en por lo menos 12700 años a.P. Este fechamiento se sum)l a los reportados para otros especímenes paleoamericanos, lo que permite enlazar la información para reconstruir los antecedentes sobre el origen, la migración y la antigüedad de

With this information

we

can outline a series of asseverations, in relation to the hypotheses formulated previously for the early human presence in the Basin of Mexico. Today thanks to the dating of the Woman of the Peñón III it has been possible to determine that human presence in this region was established at least 12 700 years BP. This dating add to those reported of other specimens paleoamericans, what allows to connect the information to reconstruct antecedents about origin, migra'-tion and antiquity of the first human groups that arrived in America and in particular, to the Basin of Mexico. -

PAlABRAS CLAVE: Fechamiento,

los primeros grupos humanos que llegaron a América, y en particular a la cuenca de México.

cuenca de México, morfología,

métrica.

INTRODUCCIÓN

ABSTRACT

El objetivo de este trabajo es dar a conocer el fechamiento y los estudios morfológico y mé-

The obtained results of the analysis morfometric and the antiquity of the Woman of the Peñón III, have allowed to clarify sorne data

trico del esqueleto de la Mujer del Peñón III. A partir de los resultados obtenidos, este espécimen se considera uno de los más importantes no sólo de México, sino de toda América. Tal información contribuye al conocimiento del

around the early human and migration in the * Dirección de Antropología Física del INAH, ** Instituto Nacional de Nutrición "Salvador Zubirán",

49


-----

JOSÉJIMÉNEZ,

ROCÍO HERNÁNDEZ, GLORIA MARTíNEZ V GABRIEL SAUCEDa

origen, la migración y la antigüedad del hombre en la cuenca de México; Jos resultados permiten formular una serie de aseveraciones que

cación estratigráfica, y con ella es factible asignarles una cronología de manera indirecta. b) La mayoría de los restos humanos precerámicos de México se han localizado accidentalmente. Por las características del hallazgo no es factible asignarles una antigüedad, ya que no se cuenta con elementos arqueológicos y geológicos que sirvan como base para asignarles un fechamien to ten tativo.

refutan algunas hipótesis anteriores y corroboran otras tan taso Las investigaciones

que se han ocupado de

buscar las huellas que dejaron los primeros grupos humanos en el continente americano han generado una serie de teorías que se han venido desarrollando desde el descubrimiento de América. De ellas han surgido múltiples interrogantes, entre otras: 1) ¿En qué periodo hombre?;

Por esta razón se decidió seleccionar una muestra de 14 esqueletos considerados los más antiguos de México para fecharlos directamente utilizando el método de C14; de éstos sólo se obtuvieron resultados positivos de siete, entre

ingresó a América el

2) ¿Su paso a América fue por vía terrestre o marítima?;

los cuales se encontraba la Mujer del Peñón In. Cinco de ellos fueron fechados de manera

3) ¿Su origen es de ascendencia asiática, africana o de Oceanía?

directa por colágeno y dos más fueron datados en forma indirecta, por medio del sedimento adherido al cráneo.

Algunas de estas preguntas

europea,

aún no se han

podido responder del todo; sin embargo, ya se cuenta con estudios enfocados desde la óptica de la arqueología, la antropología física, la geología, la palinología, la química, la genética y la lingüística, por mencionar algunas disciplinas. Éstos pueden contribuir de manera directa para explicar el origen y la antigüedad del hombre en América.

ANTECEDENTES En 1959 fue descubierto

accidentalmente

el es-

queleto de la Mujer del Peñón In cuando el señor Tereso Hernández cavaba un pozo en el patio de su casa, ubicada entre las calles de

En México surgió el interés por conocer la antigüedad y las características morfológicas de los primeros hombres desde mediados del siglo

Emiliano Zapata y Bolívar, manzana 78, lote 2, en la colonia Peñón de los Baños, muy cerca del Aeropuerto Internacional Benito Juárez en la Ciudad de México.

XIX. Sin embargo,

fue apenas a partir del descubrimiento del Hombre de Tepexpan en 1947 cuando se intensificaron las investigaciones dirigidas a buscar rastros de la presencia de Jos

Dichos restos fueron entregados al entonces Departamento de Prehistoria del INAH. Para verificar el lugar en donde fue encontrado el espécimen se comisionó al arqueólogo Francisco González Rul, quien realizó allí una serie de pozos de sondeo con la finalidad de verificar la estratigrafía del área donde se localizó el esqueleto y revisar si había otros más.

primeros grupos humanos que llegaron a territorio nacional, principalmente a la cuenca de México. De entonces a la actualidad se han hallaClo restos de 47 individuos de ambos sexos y diversas edades. Han sido recuperados en diversas formas:

Aveleyra (1964) menciona que Romano y González Rul (1959) especificaron que el es-

a) Algunos fueron encontrados gracias a la exploración con una técnica arqueológica, la cual proporciona información relativa al lugar

queleto de la Mujer del Peñón In se encontró en la parte inferior de un sedimento con características de toba volcánica, intensamente hu-

del hallazgo y del esqueleto, como su posición anatómica, orientación, la profundidad y ubi-

mítica, de posición subacuática y sellada por una capa de roca travertínica de cerca de dos me-

50


LA MUJERDELPEÑÓNIII En 1961 Bopp informa sobre los perfiles palinológicos, valiéndose de una gráfica en que muestra un aumento progresivo de actividad agrícola de gramillas, a partir de los depósitos donde fue localizado el esqueleto de la Mujer del Peñón In. Esto indica que vivió durante la etapa de cultivadores

incipientes.3

TABLA1 FECHAMIENTOS DE LA MUJER DEL PEÑÓN m Figura 1. Un grupo de investigadores supervisa el sitio del hallazgo de la Mujer del Pellón (fotografia de González Rul, 1959)'*

tros de espesor. El depósito en que se hallaba el espécimen era totalmente acerámico.\ Mooser y González (1961) ubicaron cronológicamente a la Mujer del Peñón In en el Pleistoceno terminal, basándose en una serie de estudios estratigráficos realizados en algunos

Año

Cronología

1953

Romano

1964

Genovés el aL Salas el aL

1985 1984 1994

Pleistoceno superior Más reciente que el Hombre de Tepexpan 7000-5000 a.P. 7000-5000 a.P.

Faulhaber Pompa el aL

puntos de la cuenca de México. Argumentaron que fue contemporánea del mamut de Santa Gertrudis y del de Santa Isabel, y más reciente que el Hombre

Autor Romano

2001

7000-5500 8700-3000

Los autores que se mencionan

a.P. a.P.

en la tabla 1 le

asignan antigüedades diferentes. Esto indica que su datación se realizó indirectamente, tomando

de Tepexpan.2

como referencia algunos elementos estratigráficos o comparándola con algunos otros especímenes localizados en la cuenca de México. Posiblemente por ello calcularon fechamientos distintos y provocaron confusiones sobre la antigüedad de la Mujer del Peñón

m.

MATERIAL Y MÉTODO El esqueleto de la Mujer del Peñón In está marcado con el número de inventario MIP Iml 07 11959 IDAF IINAH/México y forma parte de la serie esquelética denominada Hombres Pre-

Figura 2. Pozo donde se localizó la Mujer del Peñón III (fotografia de González Rul, 1959).

cerámicos de México, perteneciente a la Dirección de Antropología Física del Instituto Nacio* Las fotos de este artículo son propiedad de la Dirección de Antropolpgía Físicadel INAH. 1 Aveleyra,1964. 2 Moosery González, 1961.

nal de Antropología 3

51

Bopp (1961).

e Historia.


JOSÉ JIMÉNEZ, ROCÍO HERNÁNDEZ, GLORIA MARTÍNEZ y GABRIEL SAUCEDa

Calzada de Tlalpan Mts

o

Aeropuerto

Peñón

Nonoalco

Gertrudis Sánchez

Santa 1. Iztapan

Tepexpan 8

7

1

2

3

4 Clave R 5

S Sa

C Ac

Relleno moderno Suelo Suelo arqueológico Caliche Arenas consolidadas

Figura 3. Gráfica de estudios estratigráficos

T B Cc F Fh

Travertino Bentonita Concreciones calizas Fósil mamut Fósil humano

Horizontes Pumíticos / / /:

/ffi

Horizontes Cineríticos

realizada por Mooser y González Rul, 1961.

Se tomó una tomografia

Para llevar a cabo la datación del esqueleto de la Mujer del Peñón I1I, con el método del C14 a partir del análisis de AMS se tomó una

computarizada

al

cráneo y la mandíbula, con la finalidad de verificar si el cráneo presentaba alguna patología en la parte end<.;craneal y para valorar si se

muestra de 5 gramos de hueso del húmero derecho del tercio inferior de la diáfisis. El estudio de fechamiento se practicó en el año 2000

encontraban en la mandíbula las piezas dentarias que no brotaron. Este estudio se llevó a cabo en el laboratorio Scaner de México.

en el Research Laboratory for Archaeology and the History of Art, Oxford University Radiocarbon Accelerator Unit, R.U. Se realizó la descripción morfológica del

RESULTADOS

cráneo en sus seis normas, la de la mandíbula, y la de cada uno de los segmentos del esqueleto postcraneal.

Éste es un esqueleto incompleto que pertenece a un individuo adulto joven cuya edad oscilaba

Fueron tomadas 22 medias en el neurocráneo y 17 en el cráneo-facial, en la mandíbula nueve y en el esqueleto postcraneal cuatro, y con esta información se calcularon 14 índices. Se determinaron la edad y el sexo de acuerdo con los indicadores morfológicos del esqueleto.

entre 24 y 26 años al morir, según se determinó con base en la morfología de la carilla auricular del ilíaco, y el comportamiento morfológico de las suturas craneales, como la coronal, la sagital y la lambdoidea, que se encuentran abiertas, a diferencia de la esfeno-basilar, que está total-

52


LA MUJER DEL PEÑÓN III

MORFOLOGÍA

mente cerrada. También se valoró el tercer molar del maxilar, que no presenta desgaste alguno. En la mandíbula no brotó el tercer molar en

El cráneo se encuentra en buen estado de conservación; está casi completo, sólo le falta la apófisis mastoides derecha y parte del arco cigomático del mismo lado.

ambos lados, posiblemente por falta de espacio. El esqueleto pertenece a un individuo de sexo femenino; esto se determinó utilizando los indicadores anatómicos de los siguientes segmentos esqueléúcos: el cráneo presenta el frontal ligeramente abombado, los bordes supraorbitarios son cortantes, las apófisis mastoides son

NORMA FRONTAL

El frontal es un poco abombado, las eminencias frontales son prominentes, presenta una quilla a lo largo de lo que sería la sutura me tópica, las crestas laterales son muy prominentes y escabrosas y están marcadas las líneas curvas en la región del parietal. El torus orbitario es poco prominente al igual que la glabela. Los bordes supraorbitarios son fuertes y cortantes, y presen-

de tamaño regular y la bóveda palatina es profunda. El ilíaco presenta la escotadura ciática mayor muy abierta y el agujero obturador forma triangular.

es de

ta el agujero supraorbitario derecho; en el lado izquierdo se observan dos escotaduras frontales yen el lado contrario sólo presenta una. Se aprecian ligeramente los vestigios de la sutura me tópica y la sutura fronto-nasal está abierta. El hueso nasal se encuentra incompleto,

Figura 4. Esqueleto

Figura 5. Norma frontal.

de la Mujer del Peñón III.

53


-----

JOSÉJIMÉNEZ,

ROCÍO HERNÁNDEZ, GLORIA MARTÍNEZ V GABRIEL SAUCEDa

las apófisis ascendentes son amplias, los agujeros infraorbitarios son grandes, presenta un pe-

perficie del hueso se encuentra

queño agujero sobre el margen infraorbitario izquierdo y las órbitas son redondeadas. Los malares son amplios y robustos, los surcos infraorbitarios son marcados y profundos, siendo más amplio el izquierdo, la fosa nasal es amplia, la espina es prominente y las fosas de los incisivos centrales, caninos y primeros premolares son marcadas. En el caso de los caninos la raíz se encuentra expuesta.

NORMA LATERAL IZQUIERDA

El frontal es abombado,

es

arco cigomático es fuerte y las líneas temporales son marcadas. La región ptérica está en forma de H. Le

el fron-

tal es abombado, se observa la quilla que presenta en la línea que corresponde a la sutura metópica, las crestas laterales del frontal son prominentes. La sutura coronal está abierta en los tercios medios y es de forma dentada, se

falta al temporal parte de la concha, dejando expuesto el borde escamoso inferior del parietal. La cresta supramastoidea es prominente, la apófisis mastoides es grande y robusta. El conducto auditivo externo es amplio de forma ovalada, la porción del borde externo del hueso timpánico es pequeña y se encuentra ití.com-

observan ligeramente las líneas curvas superiores del parietal. La sutura sagital está abierta y es de forma dentada, siendo menos acentuada en el primer cuarto, las eminencias parietales son pocos prominentes

el torus orbitario

poco prominente, se aprecia un ligero prognatismo en el maxilar. La suturas fronto-cigomática y coronal se encuentran abiertas, la apófisis marginal del hueso malar es prominente y presenta una pequeña escotadura, el orificio anterior es doble, el ángulo inferior es robusto, el

NORMA SUPERIOR

El torus orbitario es poco prominente,

un poco apla-

nada. Además presenta hiperostosis porótica.

pleta. El parietal es poco abombado,. en la parte inferior de la línea temporal se aprecia un surco cerca del ángulo mastoideo, y presenta un marcado reborde óseo ocasionado por una fuerte inserción muscular. La sutura lambdoidea se encuentra abierta y es de forma dentada; en ella se

y por arriba de ellas la su-

Figura 6. Norma superior.

Figura 7. Norma lateral izquierda.

54


LA MUJER DEL PEÑÓN III

observan

un hueso wormiano

sutura lambdoidea está abierta y es de forma dentada, el occipital es abombado y la protuberancia occipital externa es poco marcada.

y el occipital

abombado. NORMA LATERAL DERECHA

NORMA POSTERIOR

El frontal es abombado, la quilla se observa ligeramente, la cresta lateral es marcada, la sutura coronal se encuentra abierta y en su tercio medio es dentada, la región ptérica es en forma de H. El malar es amplio y fuerte. El borde posterior del hueso majar está destruido, presenta dos

La sutura sagital se encuentra

orificios anteriores al conducto malar, el ángulo inferior es prominente y robusto. El arco cigomático fue restaurado

abierta y es de

forma dentada, los parietales son poco abombados y se vuelven planos en su parte inferior, no se observa ningún agujero nutricio, su superficie es porosa, abarcando hasta la línea curva superior del occipital, la sutura lambdoidea se encuentra abierta, es dentada, presenta huesos wormianos, uno de ellos es de tamaño considerable y presenta uno en la región donde se interceptan ambos parietales con el occipital, este último es muy abombado, la protuberancia

y se en-

cuentra semidestruido, la sutura temporoparietal no ha cerrado, tiene algunos desprendimientos de la concha, por lo que se observa el borde escamoso del parietal. La cresta supramastoi-

externa es poco marcada y las líneas curvas son

dea es prominente. La apófisis cigomática se encuentra muy separada de la pared del cráneo.

marcadas; en esta zona también presenta pequeños desprendimientos de periostio y en am-

Cerca del ángulo mastoideo presenta un reborde óseo menor que el del lado izquierdo. La apófisis mastoides está destruida y presenta desprendimiento del periostio. El conducto auditivo ex-

bas suturas occipitomastoideas

NORMA INFERIOR

terno es amplio, en su interior tiene impregnado sedimento y se desprendió parte del borde externo del hueso timpánico. La eminencia parietal

El ángulo de los malares es prominente y robusto y al del lado izquierdo le falta una pequeña porción. Los arcos cigomáticos son escabrosos,

es poco pronunciada y se observa ligeramente marcada la línea curva temporal superior. La

la bóveda palatina es profunda y presenta dos tubérculos óseos, uno en cada lado de la sutura

Figura 8. Norma lateral derecha.

Figura 9. Norma posterior.

presenta un hue-

so wormiano.

55


JOSÉJIMÉNEZ,

palatina

sobre la porción

ROCÍO HERNÁNDEZ, GLORIA MARTÍNEZ YGABRJEL SAuCEDa

horizontal.

El con-

segundo molar. El tercer molar presenta una caries y no se observa desgaste en él. En todas

ducto palatino posterior del lado derecho presenta dos pequeños agujeros accesorios, en el lado izquierdo sólo tiene uno. La apófisis piramidal del hueso palatino es pequeña.

las piezas en que se encuentra la dentina al descubierto, ésta es de color café oscuro. No presenta la tuberosidad del maxilar. Los orificios posteriores de las fosas nasales son largos y estrechos, al igual que los internos de las apófisis pterigoideas. La porción basilar es fuerte y escabrosa. El tubérculo faringeo es poco prominente. Los cóndilos son grandes; sin embargo, el del lado izquierdo es más corto. Los agujeros

Conserva 11 piezas dentarias y algunas raíces, los dientes faltantes fueron perdidos posmortem: del lado derecho conserva el incisivo lateral, el cual presenta un desgaste sobre su cara oclusal, proyectándose ligeramente hacia su cara distal; en el alvéolo del canino se encuentran tres tercios de la raíz y en el primer premolar sólo una de las raíces. En el segundo premolar el desgaste abarca toda la cara oclusal, dejando expuesta la dentina, en el primer molar es menos acentuado el desgaste y se dirige hacia sus caras mesial y lingual, en el segundo molar presenta dos caries y en el tercero sólo una; en estas dos últimas piezas el desgaste no llegó hasta la dentina. Del lado izquierdo

rasgados son grandes (amplios) y ambos peñascos son fuertes y robustos. Los conductos caro tideos son grandes y semi ovalados. Las fosas yugulares son grandes. Las apófisis estiloides están incompletas. Los agujeros condíleos posteriores son grandes y amplios. Las fosas mandibulares son amplias, grandes y poco profundas, la ranura mastoidea izquierda es más profunda que la derecha, el agujero mastoideo del lado derecho es más grande que el izquierdo~ La sutura occipitomastoidea se encuentra abierta. La cresta occipital externa es prominente, la línea curva inferior es marcada y la protuberancia occipital externa es muy prominente y escabrosa.

está el canino, con un desgaste sobre su cara oclusal que se proyecta hacia su cara labial; lo mismo sucede con el primer premolar; en cambio, en el segundo premolar y el primero y segundo molares el desgaste se proyecta hacia su cara lingual; en todos deja expuesta la dentina, que es de color café oscuro, excepto en el

MANDÍBULA

Vista anterior El cuerpo de la mandíbula se torna grácil, la sínfisis es pequeña y poco prominente; por debajo de la sínfisis se localiza un pequeño agujero nutricio; los tubérculos laterales son muy pequeños; por arriba de éstos se forman dos pequeñas fositas y se pueden apreciar los agujeros mentonianos. El borde anterior de la rama es cortante, la línea oblicua externa es poco visible, ambos cóndilos se proyectan ligeramente hacia adentro, las apófisis coronoides

son poco elevadas y

los gonios son pequeños. Vista lateral izquierda La protuberancia mentoniana

es pequeña,

al

igual que el tubérculo del mismo nombre; la base es un poco recta y presenta huellas de

Figura 10. Norma inferior.

56


LA

MUJER DEL PEÑÓN

III

inserciones musculares muy marcadas; el agujero mentoniano es pequeño, se encuentra dirigido hacia atrás y hacia arriba; el borde inferior de la rama es pequeño, el borde posterior de la rama es casi recto, la rama es amplia, el borde anterior de la rama es cortante, la apófisis coronoides es poco elevada, el cóndilo es de forma oval y la escotadura poco profunda.

mandibular

es amplia y

Vista lateral derecha La sínfisis es poco elevada, la base es recta y presenta huellas de inserciones musculares, el

. Figura 11. Vista anterior.

agujero mentoniano es grande y se encuentra dirigido hacia atrás, el borde inferior de la rama es pequeño, el borde posterior de la rama es casi recto, la rama es amplia con huellas de inserciones musculares marcadas, el borde anterior de la rama es cortante, la apófisis coronoides es poco elevada, el cóndilo es de forma oval, la escotadura mandibular es amplia y poco profunda.

Vista posterior Vista en esta posición da la apariencia

de "V";

las fosillas sublinguales son muy poco visibles, las apófisis genis son pequeñas, las fositas digástricas son amplias y poco profundas, las fositas submaxilares son poco marcadas, la línea oblicua

Figura 12. Vista lateral izquierda.

derecha se marca más que la izquierda, el canal milohioideo es pequeño, los orificios superiores del conducto dentario son grandes, la espina de Spix es pequeña, siendo aún más la del lado izquierdo y los cóndilos se encuentran invertidos hacia adentro.

Figura 14. Vista posterior.

Figura 13. Vista lateral derecha.

57


-----

JOSÉJIMÉNEZ,

RocÍO

HERNÁNDEZ, GLORIA MARTÍNEZ y GABRIEL SAUCEDa

Vista superior

y quinta vértebras les falta una pequeña porción, que es la que limita los agujeros transver-

Nuevamente se observa, como ya se ha mencionado, que la mandíbula da la apariencia de ser una "V"; cuenta con 13 piezas dentarias, las cuales se encuentran con un grado de desgaste avanzado, sobre todo en los incisivos, los caninos y los primeros premolares, siendo menos acentuado en los segundos premolares y los cuatro molares. Cabe mencionar que sólo cuenta con tres incisivos, ya que uno de ellos no

sos de ambos lados, y además una parte de la apófisis espinosa. La séptima vértebra cervical fue reconstruida a nivel del cuerpo y le faltan las apófisis transversas, la carilla articular superior derecha y los tubérculos de la apófisis espinosa. De éstas sólo falta la sexta vértebra. Dorsales

brotó, quizá por falta de espacio y esté encapsulado; así sucedió con los terceros molares, que no brotaron. En el caso de los tres incisivos,

Conserva seis, dos completas, cuatro incompletas y dos fragmentos, uno que corresponde al cuerpo y el otro a la lámina izquierda y la carilla articular superior.

su desgaste es oclusal. Los caninos y premolares presentan desgaste en su cara oclusal y se proyecta hacia su cara labial. En los premolares el desgaste es hacia su cara vestibular; lo mismo

Lumbares Se tienen cuatro incompletas; a la primera le faltan ambas apófisis transversas y parte de la

sucede en los molares y se acentúan más en el primer molar izquierdo. En todas las piezas dentarias se encuentra expuesta la dentina.

apófisis espinosa, a la tercera le falta una pequeña porción de las apófisis transversas y a la cuarta y quinta les faltan ambas apófisis transversas.

VÉRTEBRAS

Sacro Cervicales

Se encuentra incompleto, está restaurado a nivel del promontorio, en la porción lateral izquierda a nivel de la segunda y tercera vértebras y del segundo agujero sacro; le faltan el primero y el segundo agujeros sacros del lado izquierdo y el vértice de ambos lados; también le falta la quinta vértebra y en su cara posterior le faltan ambas crestas sacras laterales, la apófisis espi-

Se encontraron cinco vértebras; se observa que el atlas fue reconstruido: le falta una parte de los agujeros transversos junto con las apófisis, el axis se encuentra completo, sólo le faltan una pequeña porción de la parte inferior de la lámina izquierda y los tubérculos de la apófisis espinosa; a la tercera vértebra cervical también le falta parte de la apófisis espinosa; a la cuarta

nosa de la vértebra y los primeros agujeros sacros posteriores. En general este segmento es de longitud corta, ancho y curvo. COSTILLAS

Del lado derecho se encuentran ocho incompletas y tres fragmentos. Cinco de las incompletas se componen por el cuerpo y la extremidad posterior; a dos de ellas les falta una pequeña porción de la superficie articular de la cabeza y una parte del cuerpo y una de ellas sólo tiene una porción del cuerpo a nivel del ángulo costovertebral. En cuanto a los fragmentos, forman parte del cuerpo. Del lado izquierdo se encuentran nueve costillas incompletas; a siete de ellas les falta una

Figura 15. Vista superior.

58


LA MUJER DEL PEÑÓN III porción del cuerpo y la extremidad anterior, y a dos más les faltan la cabeza y el cuello, y sólo

restaurado con un material de coloración café, al igual que en las zonas del troquín, la corre-

carece de una parte del cuerpo en su extremidad anterior; una de ellas fue restaurada. También se encuentran cinco fragmentos, cuatro corresponden al cuerpo y uno a la extremidad

dera bicipital, el cuello y el troquíter. Los labios anterior y posterior de la corredera bicipital son pronunciados; en medio de ambos se for-

posterior.

ma una especie de canal que se prolonga hasta la cresta supratroclear; el borde anterior es muy

ESTERNÓN

pronunciado; no se observa claramente la depresión deltoidea por la restauración que presenta; al

la cresta supracondilar es un poco cortante, pre-

manubrio, se trata de la escotadura costal primera del lado derecho, con una pequeña parte de la superficie.

senta desprendimiento de periostio en el cóndilo y en la tróclea; la fosa olecraneana se encuentra

Sólo se halló un fragmento

que corresponde

perforada y es poco profunda. El del lado izquierdo podemos considerarlo completo; sólo le falta la porción del troquíter y del cuello anatómico; en esta zona también

OMÓPLATO

Se encuentran ambos omóplatos incompletos: el del lado derecho conformado por la cavidad glenoidea, una porción del borde externo, la cual se encuentra en dos partes, también conserva una parte de la espina y de la fosa supraespinosa. Este segmento se observa fuerte y robusto; aún tiene impregnado sedimento. El del lado izquierdo se compone por la cavi-

presenta restauración. El troquín es pronunciado, el labio anterior también es más fuerte y pronunciado que el labio posterior; en este segmento también podemos observar el canal que se forma en esta zona, sólo que menos marcado que el del lado derecho; el borde anterior es pronunciado, la impresión deltoidea es marca-

dad glenoidea, la cual es de superficie un poco rugosa debido al sedimento que tiene impregnado; también tiene parte de la apófisis cora-

da y no presenta un acentuado eje de torsión; en la cresta supracondilar presenta pequeños desprendimientos de hueso; en el tercio infe-

coides, el borde externo y parte de la espina; en ésta, el ángulo acromial es robusto y conserva parte de la fosa supraespinosa. También se encuentran pequeños fragmentos parte de la fosa supraescapular.

que forman

,

CLAVÍCULA

Sólo se encuentra la izquierda incompleta; le falta parte de la línea trapezoide y de la superficie acromial, también parte del cuerpo y el extremo esternal. En ella se observa desarrollado el tubérculo coronoides y también en la región donde se inserta el músculo deltoides, en el cual se formó un reborde óseo. HÚMEROS

Se encuentran ambos; el del lado derecho está incompleto; le faltan algunas porciones del hueso a nivel del tercio medio de la diáfisis, en sus caras anterior y laterales; en esta zona fue

Figura 16. Zona donde se hizo la extracción para su fechamiento.

59

de hueso


-----

JOSÉJIMÉNEZ,

ROCÍO HERNÁNDEZ, GLORIA MARTÍNEZ Y GABRIEL SAUCEDO

rior de la diáfisis, visto en su cara posterior presenta una perforación de forma circular, la cual

cual le falta una pequeña porción; la tuberosidad isquiática es un poco lisa, la rama del is-

fue hecha de manera intencional para su datación; la fosa olecraneana es ligeramente más profunda y la perforación que presenta es mucho más pequeña que la del lado contrario.

quión es estrecha y a nivel de la unión de la rama del isquión y la rama inferior del pubis se encuentra restaurado. PERONÉ

RADIO

Sólo se encuentra

el izquierdo completo,

Sólo se encuentra el del lado izquierdo incompleto, al cual le falta la epífisis proximal; en esta

que

presenta pequeños desprendimientos de hueso en el contorno de la cabeza y fue restaurado en el extremo distal. En general, el hueso es robusto, la tuberosidad es poco pronunciada y la línea oblicua anterior es marcada y de contorno re-

zona presenta material de restauración, el borde anterior es pronunciado y de contorno cortante; entre éste y el borde posterior la superficie de la diáfisis es convexa, la cresta media es muy pronunciada y en el maléolo externo presenta desprendimiento de hueso.

dondeado; por debajo de ella se forma una pequeña cavidad; el reborde interóseo es pronunciado y de contorno cortante y los surcos no se

HUESOS DEL PIE

pueden apreciar por el material que presenta. Lado derecho Tarso

HUESOS DE LA MANO

Se encuentran cinco: el calcáneo, el astrágálo, el escafoides y dos cuneiformes; cuatro están completos y uno incompleto: se trata del calcáneo,

Carpos Sólo se encuentra uno completo del lado izquierdo: se trata del hueso ganchoso.

al cual le falta parte de su cara lateral externa.

Metacarpos

Falanges

Conserva uno completo del lado derecho: se trata del tercer metacarpiano, el cual presenta sedimento impregnado en el extremo proximal.

Hay seis completas, tres de las cuales corresponden a las primeras: se trata de la primera, tercera y cuarta falanges, dos que corresponden a las segundas falanges y una a las terceras falanges.

Falanges Se encuentran dos completas del lado izquierdo, que corresponden a las segundas falanges y se trata de la segunda y quinta. Hay un hueso sesamoideo, el cual no se pudo lateralizar.

Lado izquierdo Tarso Se encuentran tres de ellos; dos están completos: el cuboides y la primera cuneiforme, y uno incompleto: el escafoides.

ILÍACOS

Conserva el del lado derecho incompleto, le falta parte de la fosa ilíaca, la tuberosidad y parte de la cresta. También la espina ilíaca anterosu-

Metatarso Se encuentran los cinco, que están completos; sólo el quinto de ellos tiene desprendimiento

perior y parte del pubis. La tuberosidad ilíaca presenta una superficie granular, la escotadura ciática mayor es abierta, el agujero obturador es

de periostio en la cabeza; en general son poco robustos.

de forma algo triangular, el acetábulo es un poco ovalado, la espina ilíaca anteroinferior es prominente al igual que la espina ciática, a la

Falanges Hay siete falanges, seis completas y una incompleta; tres de ellas corresponden a las primeras

60


LA

MUJER DEL PEÑÓN

III TABLA

2

(continuación)

Craneofacial

Figura 17. Hueso de pelícano.

mm

109 68 134* 108 98 26 102* 47 24 36 35 39 38 67 53 38

Altura de la cara (na-gn) Altura de la cara supo (na-pr) Diámetro bicigomático Anchura de la cara superior Anchura biorbital Anchura interorbitaria Anchura bimalar Altura de la nariz Anchura de la nariz Altura de la órbita izquierda Altura de la órbita derecha Anchura de la órbita izquierda Anchura de la órbita derecha Anchura de la arcada alveolar Longitud de la arcada alveolar Anchura de la bóveda palatina Longitud de la bóveda palatina

falanges, a una le falta parte de la cavidad glenoidea, una más corresponde a las segundas falanges y tres a las terceras falanges.

OBSERVACIONES

Reportan que este individuo tenía sobre la pelvis fragmentos de posibles hilos y un hueso largo, que al parecer corresponde al ala de un pelícano. El hueso presenta 14 pequeños círculos a lo largo de la superficie de la diáfisis, que posiblemente pertenecen a las inserciones musculares.

*Zona reconstruida.

mm 70.05 68.44 97.70 67.37 80.90 67.93

Índices del neurocráneo TABLA

Índice Índice Índice Índice Índice Índice

2

MEDIDAS Neurocráneo

mm

Diámetro anteroposterior máximo Diámetro transverso máximo Diámetro frontal mínimo Diámetro frontal máximo Diámetro porion-porion Diámetro prostion-porion izquierdo Diámetro prostion-porion derecho Diámetro bregma-porion derecho Diámetro bregma-porion izquierdo Diámetro basion-bregma Diámetro nasion-opistión Diámetro nasion-bregma Diámetro bregma-Iambda Diámetro lambda-opistion Curva transversal Curva horizontal máxima Curva nasion-inion Curva frontal Curva parietal Curva occipital Curva ~agital EspesÓ[ del parietal izquierdo

187 131 89 110 116 119 120 124 126 128 187 115 119 90 291 504 311 128 133 113 374 5

craneal horizontal vértico-Iongitudinal vértico-transversal aurículo-vertical transversal de la (rente transversal frontoparietal

mm 81.34 50.74 92.30 51.06 76

Índices del craneofacial Índice Índice Índice Índice Índice

facial total superior de la cara orbital nasal palatino

mm Mandíbula

Izq.

Der.

Altura de la rama ascendente Anchura de la rama ascendente Anchura bicondilar Anchura bigonial Longitud cóndilo sinfisiano en proyección Ángulo de la mandíbula

65 49

64 47

Índices Índice de la rama ascendente

61

117 91 98.5 106

107

mm 75.38


JOSÉJIMÉNEZ,ROCÍOHERNÁNDEZ, GLORIAMARTÍNEZY GABRIELSAuCEDa TABLA2

DATACIÓN

(continuación)

Esqueleto poscraneal

Húmero izq.

der:

Radio izq.

der:

Longitud máxima Circunferencia del cen tro de la diáfisis Diámetro sagital del centro de la diáfisis Diámetro transversal de la diáfisis

289 60

284 40

215* 43

18

II

15

21

15

II

Índices

mm

mm

Índice de 20.76 robusticidad Índice 85.71 transverso-sagital

mm

mm

La antigüedad obtenida del esqueleto de la Mujer del Peñón III fue de 10 755 + 75 a.P. (OxA-I0112), sin calibrar. Calibrado tiene una

Peroné izq.

mm

der:

antigüedad de 12700 años a.P., con un valor de isótopos estables de carbono de & C13 = 11.6, & N15 = 13.6, C:N = 3.5, Collagen mg/g = 50.3.

TOMOGRAFÍA Esta imagen indica que la Mujer del Peñón III presenta un caso de hipodontia, es decir, el incisivo del lado izquierdo de la mandíbula se encuentra ausente (figura 18).

mm

18.60 73.33

136.3 COMENTARlOS

La información

obtenida

FINALES

1) Los estudios anteriores sobre la antigüedad de la Mujer del Peñón III presentan diferentes fechamientos, posiblemente porque se realizaron en forma indirecta. El que aquí se ofrece es directo y cuenta con un número de registro de su datación de acuerdo con la norma internacional sobre fechamiento de fósiles. Podemos

de las medidas del

neurocráneo indican que el cráneo de la Mujer del Peñón III es alargado (dolicocráneo); visto en norma lateral es de altura baja (camecráneo), en norma posterior es de altura media (metriocráneo) y su capacidad craneana es alta. Respecto a las medidas tomadas al craneofacial, se trata de un individuo de cara ancha (euriprosopo), sus órbitas son altas (hipsiconco), es de nariz ancha (camerino), paladar estrecho (leptostafilino) y presenta un prognatismo medio (mesognato). Por medio del cálculo de la estatura fue posible determinar que medía 1.51 metros. Si se compara con la estatura de la población actual mexicana se encuentra en un rango de estatura media. Con esta información podemos formular una hipótesis: que la estatura de la población femenina mexicana en la cuenca de México se ha mantenido desde hace 12000 años.

constante

Figura 18. Tomografía computarizada de la mandíbula de la Mujer del Peñón IlI.

62


LA MUJER

DEL PEÑÓN

asegurar que los datos proporcionados por el laboratorio tienen una confiabilidad de 95% sobre su antigüedad.

III

grupos humanos con características morfológicas diferentes. La mayoría de los individuos del grupo tenía el cráneo largo, otros medio y algunos otros lo tenían corto. Además podemos suponer que ocupaban sitios distintos de la cuenca de México, y es probable que no existiera ninguna relación biológica ni social entre ellos. 7) La ausencia de instrumentos de caza en los sitios donde se han localizado los esqueletos de los primeros individuos que habitaron la

2) Tras el cálculo de la antigüedad del esqueleto de la Mujer del Peñón IlI, la cuenca de México se convierte en uno de los sitios prehistóricos más importantes de México. Este espécimen humano ha arrojado un fechamiento de 12700 años a.P., el más alto conocido hasta hoy para cualquier espécimen humano en México y el continente americano. 3) De acuerdo con el análisis morfológico, este cráneo pertenece a un individuo de sexo

cuenca de México permite inferir que su alimentación se basaba en vegetales como calabaza, quintonil, quelite, epazote, tomate verde,

femenino con una edad de 24 a 26 años a la muerte. La información recabada sobre la edad de otros especímenes humanos americanos in-

algunas raíces, semillas y frutos como tejocote y capulín, por mencionar una de las tantas variedades, sin descartar el consumo de animales

dica que su promedio de vida era de 24.8 años, de lo cual inferimos que la Mujer del Peñón III alcanzó su plena madurez quizá porque era sana, ya que no presenta patología en ningún segmento

pequeños. 8) Podemos suponer que los grupos humanos que habitaron en la cuenca de México, en la mayoría de los casos cazaban animales pequeños con dos propósitos: 1) para obtener carne como complemento en su alimentación,

del esqueleto. 4) La métrica indica que el cráneo es dolicocéfalo, con un índice craneal de 70.05. Esta ca-

y 2) para hacerse de pieles con las que elaborarían algunas prendas personales o cubrirían sus chozas y los protegerían de las inclemencias del tiempo (fríos extremosos, lluvias, calores) cuan-

racterística apoya la hipótesis sobre el origen de los primeros pobladores americanos que asegura que tenían el cráneo largo y que estuvieron presen tes por lo menos de 12000 a 5000 años a.P.; esto se confirma con el resultado de fechamiento por el método del C14 AMS de los seis esqueleJos humanos que proceden de la cuenca de México.

do no tenían cuevas.

la posibilidad

de acceder

a las

9) Las muestras de esqueletos de los primeros pobladores indican que los grupos humanos que habitaron la cuenca de México eran muy pequeños. Si estamos en lo cierto, podemos inferir que los productos alimentarios no esca-

5) La antigüedad de la Mujer del Peñón III y las características morfológicas que presenta nos indican que formó parte de los primeros grupos humanos que llegaron a la cuenca de México.

seaban, ya que no había sobrepoblación. Es muy probable que el cambio de su dieta se debiera a factores climáticos como las sequías, las heladas, la erupción de volcanes, las inundaciones, etc., sin olvidar su constante movimiento migratorio. 10) Tras analizar las piezas dentarias de los

6) De acuerdo con los resultados obtenidos del fechamiento del C14, de la morfología del cráneo y de lo que indica la métrica de cada uno de los especímenes que se han examinado, como la Mujer del Peñón IlI, el Hombre Tla-

individuos que tienen una antigüedad entre 12000 Y 5000 años, podemos asegurar que desempeñaron un papel muy importante en la elaboración de sus instrumentos, dada la forma de desgaste tan peculiar que presentan. Esto sólo pudo ocasionarlo el constante contacto con materiales tan fuertes como pieles de animales,

pacoya 1, el Hombre de la Cueva de Texcal, el Hombre de San Vicente Chicoloapan, el Hombre de Chimalhuacán, el Hombre del Metro Balderas y el Hombre de Tepexpan, se puede inferir que en la cuenca de México habitaron tres

63


-----

JOSÉJIMÉNEZ,ROCÍOHERNÁNDEZ, GLORIAMARTÍNEZy GABRlELSAUCEDa

raíces, fibras, etc. Posiblemente la mayor parte de su alimentación consistía en productos de consistencia dura, como semillas diversas.

Bárcenas,

11) Es muy importante dar a conocer los resultados de este estudio porque escasea el material humano directamente fechado, y no sólo en México, sino en toda América. La antigüedad de la Mujer del Peñón III ha sido una de las más altas conocidas hasta la fecha, lo que permite inferir que la presencia del hombre en el continente americano no es mayor de 25000 años

carbon

antes del presente.

---

--

rican Antiquity, núm. 65, pp. 291-316. De Terra, Romero y Stewart (1949), Tepexpan Man, Nueva York, Viking Fund Publications in Anthropology.

núms. 1, 2, y 3, pp. 89-94'.

---

(1951), "Some New Aspects of the Tepexpan Man Case", Bulletin of the Texas Archaeological and Paleontological Society, núm. 22, pp. 217-224. (1964), "Restos humanos precerámicos", Actas y memorias del 35 CongresoInternacional de Americanistas, México, núm. 3, pp. 61-64.

---

(1946), "Discovery of an Uppet Pleistocene Human Fossil at Tepexpan, Valley of Mexico", Revista Mexicana de Estudios Antropológicos, México, Sociedad Mexicana de Antropología, vol. 8, núms. 1,2 y 3, pp. 287-288. (1946), "New Evidence for the Antiquity of Early Man in Mexico", Revista Mexicana de Estudios Antropológicos, México, Sociedad Mexicana de Antropología, vol. 8, núms. 1, 2 Y 3, pp. 69-88.

(1970), "Preceramic Human Remains", Handbook of Middle American Indians, Austin, ---

de México, México, Ediciones Mexicanas. (1955), Contemporaneidad del hombre con fauna e)tinguida en el Pleistocenosuperior de Méxi-

---

co, México, INAH/SEP. (1962), "Antigüedad del hombre en México y Centroamérica: catálogo razonado de localidades y bibliográfica selecta (18671961); ponencia presentada en el XXXV

---

(1946), "Preliminary Note on the Discovery of Fossil Man at Tepexpan in the Valley of Mexico", American Antiquity, núm. 13, pp. 40-44. (1949), "EarlyMan in Mexico", Tepexpan Man. Viking Fund Publications in A nthropology, Nueva York, núm. 11, pp. 13-86.

(1957), Man and Mammoth in Mexico, Londres, Hutchinson and Co. Ltd. --(1959), "A Successor ofTepexpan Man in the Valley of Mexico", Science, vol. 129, núm. 3348, pp. 563-564.

Congreso Internacional de Americanistas", Cuadernos del Instituto de Historia de la UNAM, México (Serie Antropológica, 14). ---

Date from the Oxford AMS System.

de Tepexpan y el hombre primitivo", Revista Mexicana de Estudios Antropológicos, México, Sociedad Mexicana de Antropología, vol. 8

University ofTexas Press, núm. 9, pp. 22-34. Aveleyra Arrollo de Anda, L. (1950), Prehistoria --

"Noti-

Analysis of an Early Holocene Human Skeleton from Kennewick, Washington", Ame-

Arellano, Alberto R.v. (1946), "El elefante fósil

---

(1887),

Archaeometry Datelist 30", Archaeometry, núm. 42, pp. 459-479. Chatters, J.C. (2000), 'The Recovery and F'irst

BIBLIOGRAFÍA

---

M. Y A. del Castillo

cia acerca del hallazgo de restos humanos prehistóricos en el Valle de México", La Naturaleza, México, la serie, núm. 7, pp. 257264. Bopp-Oeste, Mónika G. (1961), "La investigación palinológica en México", Tlatoani, 2a época, octubre, México, ENAH. Bronk-Rimsey, c., P.B. Pettitt, R.E.M. Hedges, G.w.L. Hodgins y D.C. Owen (2000), "Radio-

Dixon, James (1999), Bones, Boats, and Bison. Archeology and the First Colonization of Western North América, Albuquerque, The University of New Mexico Press.

(1897), "El hombre prehistórico en México", Congreso Internacional de Americanistas, Actas de la Xl reunión, México, pp. 73-78.

64


LA MUJER DEL PEÑÓN III Anales del Museo Nacional, 1900, México, vol.

Faulhaber, Johanna (1994), "Antropología biológica de las sociedades prehispánicas", Historia antigua de México, vol. 1, México, Conaculta/INAH/UNAM/

VII, pp. 75-92.) --(1901), "A Painted Skeleton from Nor-

Miguel Ángel Po-

thern Mexico, with Notes on Bone Painting Among the American Aborigines", American Anthropology, vol. III, pp. 701-725.

rrúa. Foly, R (1998), Humanas Before Humanity, Oxford, RU., Publishers Blackwell.

Hrdlicka, Ales (1916), The Most Ancients Skeletal

Genovés, S., C. Pijón y M.E. Salas (1982), "El hombre temprano en México: panorama general", Actas del IX Congreso de la Unión

Remains of Man, Washington, Government Printing Office. Jantz, RL. y D.W. Owsley (2001), "Variation Among

Internacional de Ciencias Prehistóricas y Protohistóricas, México, pp. 370-379. González, S., L.J.C.Jiménez, RE.M. Hedges, D. Huddart, CJ. Ohman, A Turner y A. Pompa y P. (2003), "Earliest Humans in the Americas: New Evidence from Mexico",]ournal of

pp. 230-235. Hedges, RE.M., RA Hously, C.R. Bronk y Klinken GJ. (1992), "Radiocarbon Dates from the Oxford AMS System: Archaeometry Datelist

Martínez del Río, Pablo (1947), "El hombre fósil de Tepexpan", Cuadernos Americanos, vol.

17-56. (1892), "Descripción de un antiguo esqueleto humano anormal del Valle de México", Memorias de la Sociedad Científica Antonio Alzate,

---

34, núm. 4, pp. 139-150. (1952), "El mamut de Santa Isabel Iztapan", Cuadernos Americanos, vol. 64, núm.

---

4, pp. 149-170. (1987), "Historia de la prehistoria en México", Orígenes del Hombre Americano (seminario), México, SEP, pp. 21-37 (Cien de México).

México, núm. 7, pp. 75-92. --(1897), "Marked Human Bones from a Prehistoric Tarasco Indian Burial Place in the State of Michoacán, Mexico", Bulletin of the American Museum of Natural History, vol. X, pp. 61-79. "Description

Crania",

descubrimiento del hombre de Tepexpan", Anthropos, vol. 1, núm. 1, pp. 33-36.

15", Archaeometry, núm. 34, pp. 337-357. Herrera, Alfonso (1893), "El hombre prehistórico en México", Memorias de la Sociedad Cierj,tífica Antonio Alzate, México, núm. 7, pp.

(1899),

American

FESZ/ENTS/CNCA/INAH/Delegación Iztapalapa del Distrito Federal. Lahr, M.M. (1995), "Patterms of Modern Human Diversification: Implications for Amerindian Origins", Yearbook of Physical Anthropology, núm. 38, pp. 163-198. Lorenzo, José Luis (1947), "Antecedentes del

indian Mitochondrial DNA Lineages in Ancient Maya From Xcaret, Quintana Roo", American ]ournal of Anthropology, núm. 116,

---

North

Jiménez, LJ.C., F.R Hernández, S.G. Martínez y PJ. Pompa (2002), Los primeros pobladores de Santa Maria Aztahuacán, México, UNAM/

Evolution, núm. 44, pp. 379-387. González, AO., M.L. Márquez, LJ.C. Jiménez y A. Torre Blanco (2001), "Founding Amer-

---

Early

American ]ournal of Physical Anthropology, núm. 114, pp. 146-155.

---

(1978), "Poblamiento del Continente Americano", Historia de México, tomo 1, México, Salvar.

Meindl, R.S., C.O. Lovenjoy y RP. Mensforth (1985), "A Revised Method of Age Determination Using the Os Pubis, with a Review and

of an Ancient

Tests of Accuracy of Other Current Methods ofPubic Syrnphyseal Ring", American]ournal of Physical Anthropology, núm. 68, pp. 29-45. Mooser, F. y RF. González (1961), "Erupciones

Anomalous Skeleton from the Valley of Mexico, with Especial Reference to Supernumerary and Bicipital Ribs in Man", Bulletin of the American Museum of National History, vol. XlI, pp. 81-107. (Traducción al español en

volcánicas y el hombre primitivo en la cuenca

65


-----

JOSÉJIMÉNEZ,Rocío HERNÁNDEZ, GLORIAMARTÍNEZV GABRIELSAucEDa

de México", Homenaje a Pablo Martínez del Rio en el XXV aniversario de la edición de Los Orígenes Americanos, México, INAH,pp. 137-141.

---

Munford, D., M.C. Zaini y WA Neves (1995), "Human Cranial Variation in South Ame-

---

rica: Implications for the SettIement of the New World", BrazilianJoumal ofGenetics, vol.

Analysis Based on Early South

American Human Remains", Joumal man Evolution, núm. 21.

les delINAH, tomo XV, pp. 245-249. (1970), "Preceramic Human Remais", Handbook of Middle American Indians, Austin,

Physical Anthropology, University of Texas Press, núm. 9. --(1972), "Cráneo precerámico con deformación intencional", Boletín del INAH,

18, núm. 4, pp. 673-688. Neves, WA y H.M. Pucciarelli (1991), "MorphologicaI Affinities ofthe FirstAmerican: an Exploratory

(1963), "Breve informe de los hallazgos de San Vicente Chicoloapan, México", Ana-

---

of Hu-

2a época, núm. 11, abriljunio, pp. 35-36 .. (1974), "Restos óseos humanos precerámicos de México", Antropología Física, Época Prehispánica, México, SEP/INAH. (1977), "Restos óseos humanos prehistóricos procedentes del ejido La Torrecilla, municipio de Conzález, estado de Tamaulipas", en Cuy Stresser-Péan, San Antonio

Olson, Steve (2003), Mapping Human History Unravelling the Mystery of Adan and Eve, Londres, Bloomsbury. Pucciarelli, M.H., M.L. Sardi, LJ.C. Jiménez y C.

---

Serrano (2003), "Early Peopling and Evolutionary Diversification in América", Quaternary International, núms. 109-110, pp. 123-132. Pompa y P., A. Y C.E. Serrano (2001), "Los más

Nogalar, Mission Archeologique et Etnologique fran{:aise au Mexique, Collection Études Mesoamericaines, tomo 1, núm. 3, pp. 633-646. Salas C., M.E., A.C. Pijoan y M.R. Carda (1987),

antiguos americanos", vol. IX, núm. 52.

Arqueología Mexicana,

"Estudio comparativo de los restos fósiles humanos localizados en México", Orígenes del hombre americano (seminario), México, SEP. Turner, Ch. (1983), "Dental Evidence for the Peopling of the Americas", en R. SchutIer

Powell,J.F., WA Neves y H.M. Pucciarelli (1999), "Afinidades biológicas extracontinentales de los dos esqueletos más antiguos de América: implicaciones para el poblamiento del Nuevo Mundo", Antropología Física Latinoamericana, núm. 2. Romano, Arturo (1955), "Nota preliminar

Jr., Early Man in the New World, Beverley Hills, ---

sobre los restos humanos subfósiles de Santa María Astahuacán, D.F.", Anales del INAH, tomo VII, pp. 65-74. --(1962), "Restos humanos precerámicos",

Sage PubJications. (1986), ''The First Americans: The Dental Evidence", National Geographic Research,

núm. 2, pp. 37-46. Villada, Manuel (1902), "Hombre prehistórico en el Valle de México", Anales del Museo Nacional de México, la época, núm. 7, pp. 455458.

XXXV Congreso Internacional de Americanistas, México.

66


EARLY HUMANS IN MEXICO: NEW CHRONOLOGICAL

DATA

Silvia González, *José Concepción Jiménez López, ** Robert Hedges, *** José Antonio Pompa y Padilla** and David Huddart*

RESUMEN

Mujer del Peñón IlI, que hasta este momento es la mexicana más antigua, y de 10200 ± 65 años a.P. para el cráneo del Hombre de Tlapacoya 1. En contraste, el cráneo del Hombre de la Cueva del Texcal es redondo y corto (I;>raquicefálico), con una edad de 7480 ± 55 años a.P. Por otra parte, el cráneo de San Vicente Chicoloapan sugiere que la población dolicocefálica existió por lo menos hasta hace 4410 ± 50 años a.P. Los nuevos fechamientos con C14 dejan en claro que hubo por lo menos dos oleadas de

México es importante en el debate sobre la presencia humana temprana en América debido a su posición geográfica. Los humanos deben haber transitado por una de las siguientes rutas: viniendo del Norte, por el Estrecho de Bering, con edades de ocupación de alrededor de 11 500 años para el grupo Clovis en el suroeste de Estados Unidos; o posiblemente desde Sudamérica, como muestra la evidencia del sitio de Monte Verde en Chile, donde se ha calculado la edad mínima de ocupación 12500 años.

migración humana que transitó por México. Uno de los principales problemas que enfrenta quien trata de obtener edades con C14

humana de

En Amsrica hay muy pocos restos humanos tempranos fechados directamente. Sin embargo, los primeros fechamientos directos con C14 en hueso corresponden a cinco especímenes mexicanos de la colección de humanos precerámicos de la Dirección de Antropología Física delINAH. Los dos cráneos más antiguos tienen una edad del Pleistoceno superior, es decir, más de 10000 años, y se caracterizan por ser largos y estrechos (dolicocéfalos) con edades precisas de 10755 ± 75 años a.P. para el cráneo de la

en huesos humanos antiguos es la carencia de preservación de colágeno. En México es bastante común que los huesos se encuentren muy mineralizados, lo cual muchas muchas veces hace imposible determinar su antigüedad mediante el método de C14. Son ejemplos de especímenes humanos con este tipo de problemas el Hombre del Metro y el Hombre de Chimalhuacán. Sin embargo, junto con estos dos cráneos nos fue posible obtener cenizas volcánicas que se encontraron en su interior, y tras analizarlas usando geoquímica se determinó que provienen de dos erupciones volcánicas conocidas. En el caso del Hombre del Metro, el cráneo estaba embebido en una ceniza volcánica que se corre-

* School of Biological and Earth Sciences, Li~erpool ]ohn Moores University. ** Dirección de Antropología Física del Instituto Nacional de Antropologia e Historia, México. *** Research Laboratory for Archaeology and the History of Art, Oxford University, Reino Unido.

laciona con la Pómez Toluca Superior (Tripartita) proveniente del volcán Nevado de Toluca,

67


SILVIA GONZÁLEZ, JOSÉ JIMÉNEZ, ROBERT HEDGES, JOSÉ POMPA AND DAVID HUDDART

con una edad de 10500 años. En el caso del Hombre de Chimalhuacán se encontró una mezcla de sedimentos de lago, diatomeas y ceniza volcánica de la Pómez Toluca Superior. Por esta razón, su edad indirecta se estimó en 10 500 años a.P. y no en 33000 años a.P., como se había sugerido con antelación.

the skulls and in both cases found volcanic ashes from .known volcanic eruptions. In the case of Metro Man, the skull was found embedded in an ash that is correlated with the Upper Toluca Pumice, with an age of 10500 years BP. In the case of Chimalhuacan Man, there is a mixture of lake sediments, diatoms and volcanic ash from the Upper Toluca Pumice. For this reason it has an age of around 10 500 years BP and therefore it is not 33000 years old as has been suggested previously.

ABSTRACT Mexico is important in the debate on eariy human presence in the Americas due to its geographical position. Humans must have arrived

KEYWORDS

by one of the following routes: entering from the North via the Bering Strait, indicated by Clovis dates of around 11 500 years BP in the

Humans, Late Pleistocene,

Southwesterns United States or possibly from the South as is shown in the evidence from Monte Verde, Chile, where a minimum age of occupation has been placed at 12500 years BP. There are very few directly-dated early Americans. But here we report new radiocarbon determinations on bone from five Mexican specimens. The two oldest human skulls are Late Pleistocene in age and are long and narrowheaded (dolicocepha!ic) with age determina-

directly-dated.

INTRODUCTION Mexico plays an important role in the' debate on early human presence in America because ofits geographical position in the middle ofthe continent. Humans must have passed through its territory, either from the North after passing the Bering Straits or conceivably from South America based on evidence from the Monte

tions of 10755 ± 75 years BP for Peñón III Woman, which is the oldest directly-dated Mexican and 10 200 ± 65 years BP for Tlapacoya Man. In contrast the Texcal Man skull is short and broad (brachicephalic), with an age of 7480 ± 55 years BP. The San Vicente Chicoloapan skull

Verde site in Chile with a minimum occupation date of 12500 years BP (Dillehay, 1989). In 1997 we started an ongoing study of prehistoric sites around the Basin of Mexico. The work concentrated on two main areas:

One of the main problems when trying to obtain radiocarbon dates on human bone can be the lack of collagen preservation. In Mexico

1) A major programme of radiocarbon dating on bone material of known prehistoric specimens, including humans and megafauna (mainly mammoths). The human material carne from the Pre-Ceramic Humans Collection from the Physical Anthropology Department at INAH and the results are the focus of the present papero

it is quite often the case that the bones are highIy mineralised, making impossible an age determination of the skeleton by C14. Examples of eariy human s with this type ofproblem include:

2) Excavation in severa! important prehistoric sites around the Basin of Mexico to re-evaluate the stratigraphic and pa!aeoenvironmental information and to complement the informa-

Metro Man and Chimalhuacan Man. However, we were able to analyse sediments from inside

tion from the radiocarbon dating programme. The sites included: Tepexpan, Tlapacoya, Santa

suggests that the dolicocephalic population existed as late as 4410 ± 50 years BP. The new radiocarbon dates imply at least two waves of human dispersion within Mexico.

68


EARLY HUMANS IN MEXICO: NEW CHRONOLOGlCAL DATA

Isabel Iztapan and Tocuila. These results will be reported elsewhere.

Bone samples were taken in the first sampling stage on the following human specimens: a) Chimalhuacan Man b) Tepexpan Man c) Tlapacoya Man d) Metro Balderas Man Radiocarbon dates were obtained

RADIOCARBON DATING PROGRAMME A grant was obtained from the Natural Environ-

for two

specimens: Tepexpan and Tlapacoya Men (See table 1, all the dates are given uncalibrated). Samples from the Chimalhuacan and Metro Balderas specimens had very low collagen protein content and for this reason cannot be dated at the present time using the AMS radio-

ment Research Council (NERC) from the United Kingdom to try to obtain radiocarbon dates, directly on bone on sorne of the specimens that were considered most important in the PreCeramic Humans Collection from the Physical Anthropology Department at INAH. The method used was AMS (Accelerator Mass Spectrometer) which required only a very small amount of dense, well preserved bone (Iess than 2 grams) and the samples reported in here

carbon method. To assess the reliability of the results, a series of chemical tests were applied to the dated samples, incJuding the carbon to nitrogen ratio (C:N). It was detected for example, that the sample 01:>-

were measured at the Research Laboratory for Archaeology and the History of Art at Oxford

tained from Tepexpan Man has a very high C:N ratio of 15, whereas "good" uncontaminated

University, England.

TABLE

1

AMS RADIOCARBON DATES (UNCALIBRATED) AND BONE CHEMISTRY OF MEXICAN BONE SAMPLES. SAMPLES FROM CHIMALHUACAN MAN FEMUR (H/CH/15-1984/DAF/INAH/MEX) AND METRO BALDERAS MAN SKULL (H/B/14-1970/DAF/INAH/MEX) WERE ALSO TAKEN FORAMS DATING BUT WITHOUT SUCCESS DUE TO THE VERYLOW COLLAGEN CONTENT «0.15 MG/G) Radiocarbon date

Laboratory number

1. Peñón III Woman, Mexico, D.F., Left humeros 2. Tlapacoya 1, Mexico State, Skull

10755 ± 75

OxA 10112

10200 ± 65

3. Texcal Cave ValsequiJIo, Puebla State, Skull 4. San Vicente Chicoloapan, México State, Calvarium.

Specimen,

5. Tepexpan

Man,

Mexico State, Rib.

dl5N

C:N

Collagen mg/g

Cranial index

-11.6

13.6

3.5

50.3

OxA10225

-15.4

10.6

3.5

10.9

7480 ± 55

OxA10113

-14.4

11.0

3.5

12.3

4410 ± 50

OxA10111

-14.6

9.7

2.6

16.5

70.05 Dolicocephalic 67.67 Dolicocephalic 80.66 Braquicephalic 72.67 Dolicocephalic

2290 but with C:N

P8919

-19.8

d13C

15

0.4

79.44 Mesocephalic

=15 => Contaminated

69


SILVIAGONZÁLEZ, JOSÉJIMÉNEZ,ROBERTHEDGES,JOSÉ POMPAANODAVIDHUDDART samples should be between 2.5 to 3.0. For this reason it is believed that the skeleton has been

the Museo Nacional de Antropologia in Mexico City new bone samples were taken from other human specimens, this time with the economic

contaminated at the molecular level by preservatives applied during the conservation of the

support of the Physical Anthropology Direction of INAH. The new specimens included: Peñón

specimen using lacquers and white glue. This mean s that the specimen is contaminated with younger material and the date of 2 290 years BP we obtained is not the real one, leaving open

III Woman, Texcal Man, San Vicente Chicoloapan, Tecolote Cave, Santa Maria Astahuacan, and the Peñón del Marques. The specimens were this time taken by the curator of the col-

the question of the true age of Tepexpan Man. A similar resuIt of 1980 ± 330 BP (AA-2667) in

lection, José Concepción Jiménez to the Oxford University Radiocarbon Accelerator Unit

XAD-2 purified weak HCl insoluble collagen hydrolysate was obtained by Stafford (1991). At the moment looks that this specimen cannot be dated using the current radiocarbon

in the United Kingdom to be sampled under controlled conditions.

methods.

On the other hand, a preliminary date of 9730 ± 65 BP (OxA-7557) was obtained for the Tlapacoya Man skull. However, given the im-

On this occasion a new screening test using the CO2 content was applied to the specimens. So, a very small sample of bone was taken to determine the CO2 value and only bone samples

portance of the date, a second determination was obtained using more stringent laboratory methods to "clean" the sample ofany potential contamination and a final date of 10 200 ± 65 BP

with the higher contents were finally sampled for radiocarbon dating (6 samples in total). This increased the possibility of obtaining "good" and reliable radiocarbon dates (see table 2). /

was finally obtained in purified collagen gelatin. UnfortuI}ately, our preliminary date of 9730 ± 65 BP is wrongly quoted by Dixon (1999) as the true age of the Tlapacoya Man specimen. Moreover, he gives this age for the wrong specimen as there have been two human skulls from this

RADIOCARBON DATING RESULTS/METHODOLOGY During the second sampling stage, dates were obtained for the following specimens: Peñón III Woman, Tlapacoya Man, Texcal Man and San Vicente Chicoloapan (table.1, all the dates are given uncalibrated). These were the samples with the highest content of CO2 (table 2). This is the first time that ancient human bone has been directly dated using the AMSra-

site. The one that is dated here is specimen number 16-1968/DAF/INAH orTlapacoya 1,which was an unstratified skull discovered and reburied by roadcrews and later rediscovered (Lorenzo and Mirambell, 1986). Dixon (1999) quotes our preliminary date for specimen number 10-196162/DAF/INAH, a stratified skull from Tlapacoya XVIII (Lorenzo and Mirambell, 1986). This is wrong as this specimen has not been directly dated by us as we considered that it was poorly

diocarbon method on Mexican samples. Of particular importan ce is the presence of two Late Pleistocene Humans (Peñón III Woman and Tlapacoya Man).

preserved and completely covered by preservatives and that we would not get a true date. However, this skull has been associated to an

The dates reported here were on bones preselected to contain a reasonable amount of sur-

age of9920 ± 250 BP (1-6897) given in Lorenzo and Mirambell (1986) from the horizon of the Upper Toluca Pumice but exactly what material was dated is not stated.

viving extractable collagen, the levels of which (after purification) are given in table 1. Typical modern levels are 200 mg/g, and the great majority of Pleistocene-Early Holocene bones from Mexico, both human and animal that we had examined have extractable collagen at levels of

Encouraged by the results and due to the reorganization of the Human Origins Hall, at

70


EARLYHUMANSIN MEXICO:NEWCHRONOLOGICAL DATA TABLE2 CONTENT OF CO2 IN SOME MEXICAN HUMAN BONE, SEE TEXT FOR EXPLANATION

Name l. Tepexpan Man mandible 2. Tepexpan Man cubit 3. Sta. Maria Astahuacan mandible 4. Sta. Maria Astahuacan burial 3, humerus 5. San Vicente Chicoloapan calvarium 6. Peñón III humerus 7. Peñón IV, fragments of skull 8. Cueva del Tecolote, Hidalgo, mandible obtained

9. Texcal-Valsequillo, Puebla, mandible 10. Metro Balderas, DF, mandible

11. Chimalhuacan, mandible 12. Chimalhuacan, femur 13. Peñón del Marques, left mandible 14. Peñón del Marques, right mandible

CO2 Content (gms.)

age can persist through the extraction and purification procedures. Our procedure for collagen extraction and purification was standard (Bronk-Ramsey et al., 2000). It included a non-polar solvent extraction (50% W/V methanol/chloroform) to remove additives during museum conservation followed by decalcification in hydrochloric acid, filtration, gelatinisation of the insoluble collagen in the residue, and subsequent ultrafiltration to

SampledJor C4 dating?

0.94

No

1.20 0.55

No No

0.70

No

retain the > 30 KD soluble fraction. However, this does not guarantee that the product contains only pristine collagen; indeed collagen in bone degrades over time and loses chemical definition. More specific methods require more sampled material than is available. We used two

16.20

Ves (dated)

21.30 0.20

Ves (dated) No

methods to check on the chemical integrity of the product: the ratio of carbon to nitrogen (C:N) and infrared spectrometry.

4.70

Ves, but no date

The quantity of contamination that is significant depends on its age; 3% of modern carbon would be sufficient to make a 10000 BP date a

23.10 0.83

due to low collagen content Ves (dated)

0.37

Ves, but no date obtained due to lack of collagen. No

0.30

No

12.8

No

14.5

Ves, but no date obtained duetolow collagen

thousand years too young, while 10% of a geologically ancient contaminant would make it a thousand years too old. A 10% addition of nonproteinaceous material should be detectable by either anomalous C/N values (normal values are between 2.9 to 3.6, see table 1), or by the presence of additional peaks in the infrared spectrum. We are confident that non-protein contamination is not generally present at such levels. The exception appears to be the Tepexpan skeleton, where the visual impression of extensive treatment with preservatives is confirmed by the C:N ratio value of 15 (table 1), and we therefore believe that the determination of 2 290 BP cannot be accepted as a true indication of age. In fact most potential environmental contaminants are likely to have an intermediate age, and so have a lesser effect on changing the radiocarbon age. This is evident in the case of the Tlapacoya Man specimen (table 1). Although this finally gave a date of 10200 ± 65 BP (OxA10 225), it had previously been investigated using a less elaborate procedure (no solvent extraction

1mg/g or less. The specimens reponed here are therefore unusually well preserved examples. We find in general that when collagen, the levels fall below 2-5mg/g there is a significant probability that contaminating material of different C14

71


SILVIA GONZÁLEZ, JOSÉ JIMÉNEZ, ROBERT HEDGES, JOSÉ POMPA ANO DAVID HUDDART

and no ultrafiltration). The date obtained (9730 ±65 BP, OxA-7557) is significantly, but not gross-

fill a geographical gap and help to explain the way human s migrated across the Americas at

Iy,younger than OxA-10 225. It therefore appears than even when less stringent methods are used the basic antiquity of the date is still obtained,

the end of the Pleistocene. Moreover, the fact that Peñón III and Tlapacoya skulls are dolicocephalic (table 1) adds to the controversy over the origins of the first Americans, because the new dates imply the presence in Mexico of an early human population of long and narrow-

implying that there may be sorne younger contamination in the sample but that it is relatively easily removed by the additional processing. This do es not necessarily apply to all the bone measured, but does help to confirm the early date. Here, contamination post-excavation by unre-

headed people by at least 10000 BP. The San Vicente Chicoloapan specimen suggests that a dolicocephalic population existed until at least as late as 4450 BP. In contrast the Texcal specimen indicates the presence of braquicephalic individuals by around 7500 BP, and together

corded petroleum-based preservatives may be suspected; fortunately, such additives are rather easily detected by infra-red spectrometry and their absence in the samples we measured, increases our confidence that the dates are not affected by significant levels of contamination.

these dates would imply at least two pre-Columbian human migration waves passing through Mexico at the end of the Pleistocene-Early Holocene.

IMPLICATIONS OF THE NEW RADIOCARBON DATES

INDIRECT DATINC OF OTHER HUMAN SPECIMENS

In North America there are very few directly dated Late Pleistocene/Early Holocene humans; examples inc1ude the Arlington Springs femora from Santa Rosa Island (California) at 10960 ± SO BP on XDA-decalcified collagen (Johnson el al., 2000); Buhl Woman (Idaho) at 10675 ± 95 BP; Spirit Cave Man at 9 415 BP., Wizards Beach Man at 9225 BP (Dansie, 1997; Jantz el. al., 2001; Creen el al., 1995), and Kennewick Man at S 410 ± 60 BP (Chatters, 2000). However, the Buhl specimen is now lost to science due to reburial of the specimen, while the Arlington material obviously lacks the crania! element on which so much debate about early origins tends to concentrate.

One of the main problems we found in Mexican samples when trying to obtain radiocarbon dates in ancient human and anima! bone has be en the process of bone presCrvation associated with the taphonomy and the site developmento In fact, from the experience of the Accelerator Dating Laboratory in Oxford, with hundreds of samples, it seems that bone samples coming from "hot" countries, like, for example, Spain, Italy, and Mexico very often give no dates, creating a serious problem when trying to establish long chronological sequences. The problem is perhaps associated with the presence of high

The dates for El Peñón III Woman and Tlapacoya Man specimens represent sorne of the earliest directly dated human remains in the Ame-

temperatures that very quickly "bu m " the organic matter (collagen) in the samples.

rican Continent, confirming human presence in Central Mexico by the Late Pleistocene. The Mexican specimens are therefore important in the discussion of early human presen ce in America. Not only do they add to the total number of dated individuals, but they also

sites around the Basin ofMexico are highly mineralised, normally.associated with the presence

Very often the bones found around the lake

of a very black color. This could be perhaps due to: 1) the presence of large amounts of volcanic material in the layers where the bones are

72


EARLYHUMANSIN MEXICO:NEWCHRONOLOGICAL DATA found, that accelerates sation;

Metro Balderas Station in the centre of Mexico City. Volcanic ash samples taken from the interior of the skull gave values of silica of 70-71 % which are associated with the Upper Toluca Pumice (UTP) ash (table 3). Chimalhuacan Man skeleton was found in 1986, but there are not published record s'of the stratigraphy associated with the find. Samples taken from the skull interior showed a mixture of lake sediments, diatoms and volcanic ash.

the process of minerali-

2) beca use they were exposed to the natural elements for a long period of time before subsequent burial. In both cases this makes it almost impossible obtain an age determination using C14 dating methods due to the lack of collagen preservation. On the other hand the bone samples that we are reporting here, gave "good" radiolO

The microprobe analysis of the chemical composition of the ash (table 3), indicate silica values of 65-75% which indicate a mixture of

carbon results with excellent collagen preservation, and are generally associated with very rapid burial. In many cases these are associated with catastrophic deposits, like volcanic ash layers and volcanic mud flows (lahars). As was mentioned befo re neither the Metro

ashes, with the latest belonging to the Upper Toluca Pumice (table 3). For this re aso n it has an age of around 10 500 years BP and therefore

Balderas skull or the Chimalhuacan Man femur gave radiocarbon dates due to the lack of collagen. This means that at presento they cannot be

is not 33000 years BP old as has been suggested previously using obsidian hydration dates (Pompa, 1988). Using tephrachronology (volcanic ash) stud-

dated using the standard AMS radiocarbon method. However during detailed examination inside the two skulls, volcanic ash samples were obtained and analyzed using the electron microprobe unit at Edinburgh University, United Kingdom. The geochemistry of the ash particles

ies we were therefore able to date the deposits in which Metro Balderas and Chimalhuacan Men were found. These two individuals are

TABLE3 CEOCHEMICAL ANALYSIS OF VOLCANIC ASH (TEPHRA SHARDS) ASSOCIATED WITH PLEISTOCENE HUMANS FROM THE BASIN OF MEXICO. THE UPPER TOLUCA PUMICE (UTP) WAS PRODUCED BYTHE NEVADO DE TOLUCA VOLCANO AT 10500 BP (Arce eL al., 2003)

was obtained and compared against other major known volcanic eruptions that took place during the Late Pleistocene-Early Holocene in the Basin 9fMexico to try to date these human specimens indirectly using Lephrachronology meLhods. During this period volcanic activity played a major role in the palaeoenvironment of the Basin of Mexico. Three major volcanic eruptions of Plinian type (veryexplosive) have been identified, producing volcanic ash (tephra) marker

Chemical composition (Main oxides)

horizons in the area: a) Creat Basaltic Ash (GRA) at - 29000 years

SiOz TiOz A1z03 FeO MnO MgO CaO NazO I\.zO

BP (Mooser, 1997) b) Pumice with Andesite (PWA) at - 14450 years BP (Mooser eL. al., 1961; Mooser, 1967) c) Upper Toluca Pumice (UTP) at years BP (Arce eL. al., 2003). The Metro Man skull was found in 3.10 m depth, completely embedded canic ash, during construction work

-10500 1970 at in volfor the

Total

73

Upper Toluca Upper Toluca Pumice (UT?) at Pumice (UT?) the Tlapacoya sample from Prehistaric Si/e inside Metro (Sample TC-9) BaĂşJeras Skull

Upper Toluca Pumice (UT?) samplefrom inside Chimalhuacan Man Skull

70.38 0.24 13.94 1.75

70.37 0.21 14.05 1.82

70.58 0.25 13.99 1.91

0.03 0.44 1.91

0.05 0.44 1.93

0.05 0.39 1.84

4.30 2.71 95.74

3.83 2.99 95.72

4.03 2.67 95.74


SILVIAGONZÁLEZ,JOSÉjIMÉNEZ, ROBERTHEDGES,JOSÉ POMPAANO DAV1DHUDDART associated with the Upper Toluca Pumice ash that was deposited at the end of the Pleistocene, causing major changes in the palaeoenvironment of the Basin of Mexico (see Huddart and González, this volume). So, they must be added to the sample ofPleistocene inhabitants, together with Peñón III Woman, and Tlapacoya Man. A total of six human during the present Human Collection

specimens

CONCLUSIONS This is the first time that prehistoric human bone has been directly dated in Mexico using the AMS radiocarbon method, using the most recent chemical techniques to assess the reliability of the results. A total of four human s where directly dated (aH the dates quoted are uncalibrated): 1) Peñón III Woman with 10 755 ± years BP, currently the oldest Mexican.

were dated

study from the Pre-Ceramic in the Physical Anthropolo-

2) Tlapacoya Man wi th 10200 ± 65 years BP. 3) Texcal Man with 7480 ± 55 years BP. 4) San Vicente Chicoloapan Man with 4,410 ± 50 years BP.

gy department at INAH. Their location around the Basin ofMexico is shown in figure 1and their skulls are illustrated in figure 2.

N

A Lago Lago Xaltocan

Volcanes Limite Ciudad de México y Área Metropolitana

,, ,, , le

o

10

20 km. I

b

\Lago Texcoco \,

Ciudad de MéX~O-",~

4e

~

Iztlaccíhuatl

~

Popocatépetl

Figure 1. Location of directly dated human especimens with radicarbon from the Basin of Mexico: 1) Peñón Woman III; 2) Tlapacoya Man; 3) Texcal Cave Man, Valsequillo. Puebla (not included in this map); 4) San Vicente Chicoloapan Man; 5) Tepexpan Man (not a reliable date was obtained for this specimen. due to contamination with younger material).

74


EARLY HUMANS

IN MEXICO:

NEW CHRONOLOGlCAL

DATA

It is vital when applying dating methods in general to be able to analyze critically, the results to decide ifthe dates obtained are reliable.

The new radiocarbon dates may imply at least two waves of human dispersion within Mexico. The oldest Pleistocene population has long and narrow skulls (dolicocephalic), with no mongoloid affinity similar to the morphology of other early Arnericans, Iike Kennewick Man (Chat-

A good example of the problems faced is the Tepexpan Man radiocarbon resulto The analysis gave us a result of 2 290 years BP, similar to the date reponed by Stafford (1991); but the chem-

ters, 2000) adding controversy over the origins of the first Arnericans.

istry of the bones with very high values of the carbon to nitrogen ratio (C:N), together with a low collagen percentage (table 1) indicates that

Two additional dolicocephalic human skulls were dated indirectIy using tephrachronology:

the dates obtained are not a true indication of age and that the specimen has suffered considerable contamination with younger material during conservation treatment. So, the question about the true age of this controversial specimen remains open. On the other hand, all the four radiocarbon

Metro Balderas Man and Chimalhuacan Man, which were both associated with the Upper Toluca Pumice (UTP) volcanic ash deposited around 10500 years BP. The skull of Metro Balderas Man was completely embedded in a layer of volcanic ash and it is possible that the specimen represents one of the earliest victims of volcanic activity in the Basin of Mexico.

dates on human

bone

presented

here

have

b: Tlapacoya I

a: Pe帽贸n III

c: Texcal

d: San Vicente Chico loa pan

e: Tepexpan Figure 2. Photograps of the five dated human skulls: Pe帽贸n 111,Tlapacoya 1, Texcal Cave and San Vicente Chicoloapan specimens were successful using radiocarbon dating. Tepexpan gave an unreliable young result of around 2290 years old due to contamination with younger material.

75


SILVIAGONZÁLEZ,JOSÉJIMÉNEZ,ROBERTHEDGES,JOSÉ POMPAANDDAVIDHUDDART passed the most rigorous chemical tests and we are confident in the reliability of the results.

Jantz y Owsley (2001), "Variation Among Early North American Crania", American Journal o/ Physical Anthropology, núm. 114, p. 146. Johnson, Stafford, Ajie, Morris (2000), "Pro ceedings of the Fifth California Islands Symposium", en D.R. Brown, K.c. Mitchell y

BIBLIOGRAPHY Arce, Macías y Selem Vázquez (2003), 'The 10.5

H.W. Chaney (eds.), Approaches to The Social Dimensions o/ Mortuory Practices, Society for American Archaeology Memoirs, pp. 541-

KA Plinian Eruption of Nevado de Toluca VoIcano, Mexico: Stratigraphy and Hazard Implications", Bulletin o/ the Geological Society o/ America, vol. 115, núm. 2, pp. 230-248.

545 (US Department of the Interior OCS Study MMS99-0038). Lorenzo J.L. y Mirambell, L. (1986), Mamutes

Bronk-Ramsey, Pettitt, Hedges, Hodgins, Owen (2000), "Radiocarbon Date from the Oxford

excavados en la cuenca de México, México, INAH, pp. 1-151 (cuadernos de trabajo del Departamento de Prehistoria, 32).

AMS System. Archaeometry Datelist 30", Archaeometry, núm. 42, p. 459. Chatters, J.C. (2000), 'The Recovery and First Analysis of an Early Holocene Human Ske-

Mooser, F. (1967), 'Tefracronología de la cuenca de México para los últimos 30000 años", Boletín del Instituto Nacional de Antropología e Histtr ria de México, núm. 30, pp. 12-15.

leton from Kennewick, Washington", American Antiquity, vol. 65, núm. 2, pp. 291-316. Dansie, AJ. (1997), "Early Holocene Burials in Nevada: Overview of Localities, Research and Legal Issues", Nevada Historical Society Q}larterly, vol. 40, núm. 1, pp. 1-14.

---

Dillehay, T.D. (1989), Monte Verde: a Late Pleistocene Settlement in Chile, vol. 1, Palaeoenvironment and Site Context, Washington, nian Institution Press.

(1996), "Nueva fecha para la tefracronología de la cuenca de México", en Margarita Carballal Staedtler (coord.), A propósito del Cuaternario, México, INAH, Dirección de Salvamento Arqueológico, pp. 19-23.

---

YGonzález Rul (1961), "Erupciones volcánicas y el hombre primitivo en la cuenca de México", Homenaje a Pablo Martínez del Rio en el XXV aniversario de la edición de Los orígenes americanos, México, INAH, pp. 137-141. Pompa, José Antonio (1970), "Nueva evidencia

Smithso-

---

(1997), Monte Verde: A Late Pleistocene Settlement in Chile, Washington, D.C., Smithsonian Series in Archaeological Inquiry. Dixon, EJ. (1999), Bones, Boats and Bison: Archaeology and the First Colonization o/ Western North America, A1buquerque, The University of New Mexico Press.

en México: datos preliminares del hombre de Chimalhuacán", en Alba González Jácome (ed.), Orígenes del Hombre Americano (Seminario), México, SEP.

Green, Cochran, Fenton, Woods, Titmus, Tieszen, Davis y Miller (1996), 'The Buhl Burial: A Paleoindian Woman from Southern Idaho", American Antiquity, núm. 63, pp. 437-456.

Stafford, Hare, Currie, Jull y D. Donahue (1989), "Accelerator Radiocarbon Dating at the Molecular Level",journal o/ Archaeological Science, núm. 18, pp. 35-72.

76

.


A

REVIEW OF ENVIRONMENTAL CHANGE

IN THE BASIN OF MEXICO

(40000-10 000

BP):

IMPLICATIONS FOR EARLY HUMANS David Huddart* and Silvia González*

RESUMEN

mano. La evidencia para determinar los cambios climáticos se ha basado en la sedimentología, las secuencias de polen y las diatomeas; la cronología se deriva de secuencias de tefras (cenizas volcánicas) y fechamientos con C14. Se

Durante el Pleistoceno superior-Holoceno temprano, la cuenca de México sufrió cambios climáticos mayores, incluyendo los efectos de grandes erupciones volcánicas de tipo pliniano de los volcanes Telapon/Tláloc, Nevado de Tolu-

asume una edad mucho más temprana para las erupciones mayores de los volcanes Tláloc/Te-

ca y Popocatépetl, los cuales produjeron flujos piroclásticos, lahares y lluvias de ceniza; estos fenómenos están asociados además con otras lluvias de ceniza producidas por volcanes más pe-

lapon del Cuaternario superior y no del Terciario superior. La evidencia proviene del estudio de los ambientes paleolacustres de los lagos de Chalco y Texcoco, así como de las secuencias de la parte este del pie de monte a lo largo de la cuenca de México.

queños monogenéticos dentro de la cuenca. Los efectos de cambio climático han sido superimpuestos a estos procesos volcánicos, incluyendo fases <te climas más fríos, secos o más húmedos que el presente régimen. Estos cambios volcánicos y climáticos afectaron el desarrollo de procesos geomorfológicos, el paisaje, el desarrollo

ABSTRACT In the Late Pleistocene-Early Holocene the Basin ofMexico underwent major environmental change which included the effects of Plinian eruptions from the Telapon/Tláloc, the Nevado de Toluca and Popocatépetl volcanoes, which produced pyroclastic flows, lahars and ash falls, as well as other ash falls from monogenetic volcanoes within the basin. Superimposed on these voIcanic processes have been the effects of c1imatic change, including phases of colder, drier

de diferentes tipos y zonas de vegetación, así como los procesos de formación de suelos, aunque es dificil evaluar la importancia relativa de los dos tipos de cambios. Aquí se presenta y examina una compilación de textos referentes a la cronología de estos cambios ambientales, sus efectos en el paisaje, así como sus implicaciones para los diferentes tipos de vegetación y fauna, con especial interés en sus efectos potenciales sobre el género hu-

and wetter c1imates than the current regime. These voIcanic and c1imatic changes affected the development of geomorphological processes and landforms, the vegetation development

* School of Biological and Earth Sciences, Liverpool John Moores University.

77


DAVID HUDDART AND SILVIA GONZÁLEZ

and zonation and soil processes, although it is difficult to assess the relative importance of both

pecially human populations. The evidence for this environmental change is based on sedimentology, the pollen and diatom record, and the chronology from tephra and radiocarbon dating. The evidence described comes from the palaeolacustrine environments in the Chalco

sets of changes. A review of the chronology of this environmental change, its likely effects on the landscape and the implications for vegetation and fauna, especially human s is discussed. The evidence for the environmental change is based on sedimentology, the pollen and diatom record

and Texcoco basins and the piedmont fringe along the eastern mountain front. However, a recent review of Late Pleistocene-Holocene climatic change in the whole of Mexico has been presented by Metcalfe el al. (2000) who base their reconstructions on a range of evidence from the Yucatan, Northern Mexico and Central Mexico.

and the chronology from tephra and C14 dating. A much younger age for the major Plinian eruptions from Telapon/Tlaloc is suggested in the Late Quaternary. The evidence is taken from palaeolacustrine environments in the Chalco and Texcoco basins and the eastern piedmont fringe along the mountain front.

Hence the review in this paper, based solely on evidence from the Basin of Mexico, must be looked at in a wider context for Mexico as a whole. It appears from the available Mexican data that over the Late Pleistocene and Holocene, although there have been appreciable climatic changes, these appear to have been of smaller magnitude than in other parts óf the northern hemisphere tropics and subtropics. In a wide ranging review like the one presented in this paper, inevitably detail is missing but readers who require further evidence, or a discussion of the finer points of an argument, must go to the original sources. Furthermore, the ma-

KEYWORDS Environmental,

Basin of Mexico, eruptions.

INTRODUCTION In the Late Pleistocene and the Early Holocene the Basin ofMexico underwent major environmental change from volcanic processes which included the effects of major Plinian eruptions from the Tlaloc/Telapon, Popocatépetl and the Nevado de Toluca volcanoes. These processes produced pyroclastic flows, lahars, mass avalanches, and ash falls. Superimposed on these volcanic changes were the effects of climatic

jor aim of this paper is not to present a wealth of detail but to give sufficient information for the reader to be able to consider the implications of this environmental change for early human populations in this region.

change, including phases of colder, drier and wetter climates than today. The volcanic and climatic changes affected the developmen t of geomorphological processes and landforms, the vegetation development and zonation and soil processes. However, it is difficult to assess the relative importance of both sets of changes at

THE BASIN OF MEXICO: ENVIRONMENTAL SETTING The Basin of Mexico, located in the Central Plateau, at an altitude of between 2230 and 2250 m aboye sea level, is a hydrologically-elosed,

any time periodo The aim of this paper is to review the chronology and scale of this environmental change, presenting sorne new information and radiocarbon dating, to give an assessment of the likely effects on the landscape and the implications for vegetation and fauna, es-

geomorphological basin situated in the centraleastern part of the Trans-Mexican Volcanic belt. This basin is surrounded by volcanic mountains active in the Tertiary and Quaternary, such as Pachuca to the north; Telapon, Tlaloc, Río Frio and Calpulalpan to the east; the Sierra Nevada

78


A REVlEW

OF ENVlRONMENTAL

CHANGE

IN THE BA5IN OF MEXICO

(40000-10000

BP)

to the south-east; Chichinautzin to the south and Las Cruces to the west. In this basin a Quaternary lake system, with several sub-basins,

ern basin than in the northern one and marked altitudinal c1imatic variation from the lake plain to the summits of Tlaloc (4120 m), IztaccĂ­huatl

deve10ped because lava flows blocked the drainage (figure 1), probably as early as the Pliocene.

(5 239 m) and PopocatĂŠpetl (5465 m). This variability in c1imate is reflected in the vegetation (table 1) and the soil deve1opment.

At the time ofthe Spanish Conquest (1521) these lakes were separated into several shallow lakes, for example ChaIco in the southern section (figure 2). Generally it is considered that the lakes were not deep and sorne were saline. The basin contains sediments up to 3500 m thick but these

POSTULATED LINKS BETWEEN CLIMATE, VOLCANISM, PAlAEOECOLOGY, AND HUMAN ACTlVlTY

have never been systematically described and the Quaternary history prior to the late Pleistocene is not well understood. The modern c1imate is subtropical but moderated by altitude, with minimal temperature variationannually, although there is a rainy sea-

The first work in the Basin ofMexico on palaeoc1imatic change by Sears (1952) and Sears and Clisby (1955) was based on the earlier deterministic views ofHuntingdon (1913, 1914) who speculated on the relationships between envi-

son from May to October, with occasional Polar Fronts creatingwinter rain. The c1imate though

ronmental change and cultural development. These researchers aimed to establish a link between c1imate, palaeoecology and human activity.

shows marked N-S and relief differences which is reflected in a higher humidity in the south-

Sears (1951) for example believed that Mexican c1imate change had been significant and that

99' W

I

6','0

iOKM

Figure 1. Quaternary

lakes in the Basin of Mexico.

79


DAVID HUDDART AND SILVIA GONZÁLEZ

Figure 2. ChaIco lake in the south of the Basin of Mexico in 1891, painting by José María Velasco.

'The rise and fall of populations within the Basin of Mexico has been profoundly influ-

conditions

of intense

volcanic actlVlty during

enced by the changing availability of moisture." However, it was not until the 1990s that it was realised that volcanic processes could have a role

the Pleistocene and Holocene in several parts of the Transmexican Volcanic Belt is difficult because of the distortion of the climatic records due to this volcanism. Nevertheless, evidence

to play in the interpretation of palaeoclimatic records in central Mexico too (Metcalfe el al., 1991; Caballero Miranda, 1995; Lozano García

from such volcanic processes can be extremeiy useful in helping to date and correlate sorne events across the basin. Although there is much

and Ortega Guerrero, 1997). So for example, Lozano García and Ortega Guerrero (1997) sugested that determining landscape change under

recent evidence to suggest that volcanic processes on the scale that is apparent around the basin can affeet climate, it is difficult to estab-

TABLE 1 VEGETATI0N ZONES IN THE BASIN OF MEXICO (after Rzedowski and Rzedowski, 1979, 1985)

Juniper forest in the N 2450-2800 m 600-800 mm of rainfall Oak Forest in gullies in Sierra Nevada/ Las Cruces 2 350-3 100 m Grassland widespread 2250-4300 m

Xerophytic shrubs 2250-2700 m 400-700 mm of rainfall Silver fir forest 2700-3500m 1000-1400 mm of rainfall Subalpine grassland 3300-4000 m

so

Pine forests 2350-4000 m 700-1200 mm of rainfall Cloud forest 2500-3000 m very humid


A REVIEW üF ENVlRüNMENTAL CHANGE IN THE BASIN üF MEXICü (40000-10000 BP) populations

lish by how much and for how long. These processes also cause deforestation, changes in the hydrology, slope stability, and geomorphic systems, and changes in soil development and soil erosiono However, there is a suggestion that such change can also be stimulated too by intense human impact on the region, with significant disturbance of plant communities along the lakeshores and in the pine-oak forests at mid-elevations around the basin (Lozano García and Ortega Guerrero, 1998). For example,

with its sub-tropical climate made

equable by altitude, rich, and variable vegetation zones, fresh water supplies, abundant megafauna such as mammoth, bison, and camel and a rich and varied source of animal protein from the lakes (fish, birds, amphibians, snakes, mammals, and turtles). Cornwall (1971) suggested that several of the deeply eroded Tertiary volcanic mountains formed islands in the widespread shallow lakes which were admirable sites for human hunter-fishers and collectors living on their rich vertebrate fauna. This is also emphasised from the work of Niederberger (1979)

apparent early human presence at Tlapacoya was indicated by lithic tools, dated to 21 700 ± 500 and 24040 ± 320 BP (Mirambell, 1978; García Bárcenas, 1986) and hearths. Other lithic tools associated with Mammalhus have been found within Lake Texcoco sediments, for exam-

who, although working from a later time period (c. 7500 BP), emphasises the seasonal and perennial food resources available from the ancient Cha1co-Xochimi1co basin (table 2). A

pie at Santa Isabel Ixtapan and Tocuila. However, whether there was significant disturban ce is

richer variety must have been available earlier with the addition of the megafauna, such as

debatable, certainly in comparison with the likely effects of vo1canism. It is only with the later Holocene change that human impact is really thought to outweigh the effects ofvo1canic pro-

Columbian mammoth, camel, deer, and bison. Hence at first sight this location had certain advantages for human populations. This view will be modified after a discussion of the vol-

cesses and even here there is plenty of evidence that vo1canic processes had a major role to play in cultural development. (Siebe el al., 1996; Cór-

canic processes in the basin.

ENVIRONMENTAL CHANGE IN THE PERlOD 40000-8000 BP. AND

dova, 1997; Panfil el al., 1999; González el al., 2000; Plunket and Uruñuela, 2000; Siebe, 2000). The authors agree with Córdova (1997) that "Vo1capic eruptions are one of the geological factors that provoke rapid ecological crisis in which there is a fast production of sediments because of the removal of pyroclasts by the

THE CHRONOLOGY OF THIS CHANGE We will document the vo1canic eruptions in this period, which resulted in ash falls (tephras), pyroclastic flows and vo1canic mudflows (lahars). In the same time frame, there is evi-

eruption itself or by the elimination of vegetation ... vo1canic eruptions and human presen ce are two factors that create a great deal of noise and obscure the real effects of climatic fluctuations".

dence from the pollen and diatom records for a changing climate, which resulted in colder, wetter and drier climate phases than the current climate. The combination of these volcanic and clima tic processes has affected the geomorphic processes and landforms, the vegetational zonation and the soil processes. The chronology of such changes has been obtained by both conventional and AMS radiocarbon dating of organics and tephrachronology, where distinct geochemical signatures from tephras, such as the Gran Ceniza Basaltica (CeB), the

WAS THE BASIN OF MEXICO A GOOD PLACE TO UVE FOR ANY LATE PLEISTOCENE HUMAN POPULATIONS? There seems to be a view that the Basin of Mexico was an ideal location for early human

81


DAVIDHUDDARTANDSILVIAGONZÁLEZ

SEASONAL AND PERENNIAL Early food resources recovered at the site of Zohapilco (about 5500 B. C. Ducks Aythyaspp. Spatula clypeata Anas acuta Anas platyrhynchos Qy.terquedula sp. Anas diazi Grebes Podiceps caspicus Podilymbus podiceps Aechmaphorus sp. Geese Brantaspp. Coots Fulica americana Amphibians AmÚJstoma Turtles and snakes Kinosternon Thamnaphis Fish Chirostoma spp. Girardinichthys sp. Cyprinids Mammals Odocoileus virginianus Sylvifagus cunicularius Canids Rodents Plants from alluvial soils Zea Amaranthus Cucurbita Physalis Leafy vegetables

TABLE 2 FOOD RESOURCES AVAllABLE (after Niederberger, 1979)

IN THE BASIN OF MEXICO

Month of availability Dry season Nov.

Dec.

Jan.

Feb.

• • •

• • •

• •

• • • •

Rainy season Mar:

Apr:

May. June.

July.

Aug.

Sept.

Oct.

• •

o

o

o

o

o

o

o

o

o

o

• •

• •

• •

• •

o

• •

• • •

• o

Seasonal and perennial food resources available in the ancient ChaJco-Xochimilco lacustrine basin. Closed circles indicate maximum availability; open circles represent minimum availability [see (52)].

82


A REVIEWOF ENVIRONMENTAL CHANGEIN THE BASINOF MEXICO(40000-10000 BP)

00

o

o

oo

o o o o •••'P 'P 'P

o

~lt?-

"''P'P'P~

Malinche

~

/jJ"

• ·0

Quaternary volcanoes Neogene volcanoes

Figure 3. Volcanoes in the Basin ofMexico (after Mooser, 1975).

VOLCANICPROCESSESIN THIS TIME PERlOD

Pomez gruesa con fragmentos de andesita (PCA) and the Upper Toluca Pum ice (UTP) have been noted. Examples will be taken from previous work as in the Chalco basin (for example, by

Inlroduclion The Basin of Mexico has be en the site of volcanic processes since the Late Oligocene (Vázquez-Sánchez and Jaimes-Palomera, 1989) and fig. 3 from Mooser (1975) illustrates the most important of the volcanoes and the large number. However, the basin has also been influenced by volcanic processes from outside the basin too,

González Quintero, 1986; Bradbury, 1989; Lozano García el al., 1993; Lozano García and Ortega Guerrero, 1994), from example by Bradbury, 1971; and Fuentes, 1980; Lozano Guerrero, 1997) and from

Lake Texcoco (for González Quintero García and Ortega fieldwork carried

particularly from the Nevado de Toluca (Bloomfield and Valastro, 1977; Arce el al., in press). The geological setting of the Quaternary vol-

out by the authors at Tepexpan, Tocuila, Tlapacoya, and at sites along the piedmont fringe along the eastern border of the basin, such as San Vicente Chicoloapan and La Joya. The eviden ce for volcanic processes will be reviewed initially, followed by the evidence for climatic change indicated by the pollen and di ato m

canism and a geochemical characterization of the tephras produced has be en reviewed by Ortega Guerrero and Newton (1998). The stratovolcanoes of the Sierra Nevada, especially Iztaccíhuatl and Popocatépetl (fig. 2, 4b), dominate

records.

83


DAVID HUDDART ANO SILVIA GONZÁLEZ

the basin. Their histories are relative1y well known, but other large volcanoes such as Tlaloc

these deposits were considered

and Telapon have not really been studied. Iztaccihuatl is composed of andesites and dacites

by Mooser

el al. (1996)

they

to be mainly of Pleistocene

age. None of these deposits has been dated, until those dates given in this paper, except for dates on wood from a deposit of nuée ardente in the Río Frio Pass that was derived from Telapon that gave ages of older than 35000 years and older than 40000 BP (Cornwall, 1971). It is apparent that the relationships between these deposits and their ages was poorly understood.

that accumulated from 0.9 myr until the Late Pleistocene (Nixon, 1989), whereas Popocatépetl's history can be divided into two main periods. There is an earlier phase of deve10pment between 1.2 and 0.6 myr ago when andesites and dacites erupted to form the original edifice, and a later period when lava flows and pyroclastics of dacitic and rhyodacitic composition built the present cone. This cone developed abouat at 23000-22000 BP after a parox-

TEPHRAS

ysmal eruption caused the older stucture to collapse and huge debris avalanches to occur (figure 4a) about 23000-22000 BP (Siebe el al., 1997). The Chichinautzin Range though is composed of an extensive monogenetic volcanic field and geomorphic and stratigraphic studies

(VOLCANIC ASH LAYERS)

The Gran Ceniza Basallica (ceB) Is the oldest of the tephra markers in the Basin of Mexico. At Tlapacoya its maximum thick-

years BP. The Nevado de Toluca has been active since the Late Pleistocene and is composed mainly of dacitic lava flows and several explosive phases have be en dated to between about

ness is about 55 cm and wood below was dated to 33500 ± 3200/2300 and although a tree fragment within the tephra layer was dated to 23150 ± 950 BP (Mirambell, 1978), Brádbury (1989) considered the dated tree to have penetrated the deposit at a later time. In core B at Lake Chalco this ash, at 18.58 m, has an estimated age of over 34000 BP and was previousIy described as tephra XII (Urrutia Fucugauchi el al., 1995). Ortega Guerrero and Newton

28000 and 11600 BP (Bloornfield and Valastro, 1977), although Arce el al. (in press) suggest that the youngest Plinian eruption is firmly dated at 10500 BP. The Tlaloc and Te1apon volcanoes

(1998) called this tephra the Tlahuac tephra as the composition ranges from basal tic-ande site to andesite. They are strictly correct in suggesting that the term GCB should be not used but it

however, were always thought to be Tertiary in age (Mooser, 1975), although the dacitic lavas and pyroclasts with large quantities of pumice

may be too embedded in the literature for this to happen. The source is not known, although

(Martín del Pozzo, 1982) and radiocarbon dates (Bloomfield, 1975; Kirianov el al., 1990) suggest that the exposed rocks span the last 40000

Mooser (1967) suggested that its source could be Popacatépetl as its conspicuous thickness may indicate a large eruption and its thinning toward the northwest may support this assumption. However, Mooser el al. (1996) more recently has suggested the Santa Catarina Range as a possible source for this tephra. We have

that together form the Tlaloc Formation were thought by Vázquez-8ánchez and Jaimes-Palomera (1989) to be probably between 0.6-0.7 Ma. The piedmont fringe below these two volcanoes have been the result of continuous deposition of pyroclastic deposits, interbedded with lava flows and fluvial sediments. There have been no dates for the deposits forming the piedmont but they have been mapped as the Tarango Formation (Mooser, 1975; Vázquez-Sánchez and Jaimes-Palomera, 1989) with a tentative age given

found thicknesses of 36 cm., for this tephra at Tocuila (% Si02 between 55.89 and 60.26) where it shows multiple phases of ash deposition into the lake and 17 cm, at Santa Isabel Iztapan. It is 55 cm, thick at Tlapacoya (Lambert, 1986).

as Pliocene. However, in a stratigraphic study of

84


A REVlEW OF ENVIRONMENTAL CHANGE IN THE BASIN OF MEXICO (40000-10000 BP)

Figure 4. Examples of Volcanic landforms and sediments in the study area: a) Popocatépetl mass avalanche deposits. b) Popocatépetl and Iztaccíhuatl volcanoes. c) Pyroclastic flow at La Joya, with incised lahar channel and fill. d) San Vicente Chicoloapan lahar and lacustrine sediments, with location of dated charcoal fragments. e) Pyroclastic flow at La Joya, with the location of the dated charcoal log.

14470 ± 280,14430 ± 190 and 15020 ± 450 BP (Niederberger, 1976; García, 1986) and is succeeded by a lacustrine silt dated to 13180 ± 290, 14450 ± 100 and 14540 ± 90 BP (García-Bár-

The Pumice with Andesite (PCA) Is a common tephra marker throughout the basin and has been dated to about 14600 years BP, although a set of two tephras have been described from Tlapacoya (Mooser, 1967; Lambert, 1986). The older of the two is dated to

cena, 1986). The younger tephra that overlies this silt is the PCA and is about 25 cm, thick at

85


DAVIDHUDDARTANOSILVIAGONZÁLEZ Tlapacoya, 16 cm, at Tocuila. There are pockets of this ash in lacustrine clay at Santa Isabel Iz-

it is usually extremely difficult to pin-point the exact changes that particular vo1canic events

tapan. Mooser (1967) suggested this tephra originated from Popocatépetl.

were responsible foro However, studies of modern vo1canic eruptions such as Pinatubo in the Philippines, or Mount StoHelens have illustrated

The Upper Toluca Pumice Was deposited from a Plinian eruption from the Nevado de Toluca and there has been much controversy as to its correet age (Bloomfield and Valastro, 1977; Arce el al., in press). The latter authors discuss in detail the develop-

the total disequilibrium in the ecosystem and ecological crisis caused by such events. In the Basin ofMexico it has been recognised that these eruptions cause impacts in the interpretations of the palaeoclimatic record, although it has been

ment of the UTP eruption and its correet age which they consider to be around 10 500 BP. This date seems to be confirmed by the authors'

suggested that because most of the changes seem to be synchronous events in the Texcoco-Chalco sub-basins then these changes are caused by climate events and not vo1canic activity (Lozano

work at Tocuila (González el aL, 2001) where we suggest that a lahar event was associated with the UTP, with an age no older than 10600 ± 75

García and Ortega Guerrero, 1997). However, the vegetation is likely to have been destroyed over wide areas which is likely to have affected

BP, and not a PCAseries of lahars as first suggested by Siebe el al. (1997). In the Basin of Mexico

the grazing animals, the equilibrium of the lakes must have been totally disrupted with the rapid deposition of vo1canic ash and the remobilisa-

the eruptive plume produced um to fine sand pumice.

50 cm, of medi-

tion of the ash deposited on the basin slopes in the form ofvo1canic mudf10ws (lahars) into the lakes and the changes in pH that this would cause. The paroxysmal eruption of Popocaté-

Table 3 illustrates the main tephra layers from the Basin ofMexico but this is by no means comprehensive. For example, González el al. (2001) noted a rhyolitic ash (Si02 76-78%) from

ped around 23000 BP caused major avalan che deposits from f1ank collapse, which also generated the deposition of laharic fans tens of kilo-

the upper piedmont at the Tequexquinahuac site which does not correspond with any of the known tephra markers and a similar ash forms the matrix for the pyroclastic f10ws at La Joya. It seems likely that this ash was produced from one of the nearby rhyolitic domes found to the southeast around the Quetzaltepec Sierra (Telapon), but it may not be in silu and be reworked from older ash by rill wash and other slope processes.

metres away. It seems possible that the Upper Toluca Pumice eruption was the final "push" in the extinction process of the mammoth and other megafauna on the Mexican grasslands around the lake basin and it is tantalising to think that because UTPash was found inside the skulls at El Metro and Chimalhuacan then these humans were victims too of this evento At the very least human populations would have to migrate away from parts of the basin at least for

Reworking of ashes has not been considered in detail in the tephrachrological studies in the Basin of Mexico to date but we have noted significant reworking processes at several sites such as Tocuila, Tlapacoya and Santa Isabel Iztapan, affecting the PCAand UTP ashes.

several years and possibly decades. Apart from the deposition of the vo1canic ash fall deposits and the recent recognition of lahars in the lacustrine record the authors have recognised pyroclastic f10w deposits along the piedmont fringe of Tlaloc and Telapon vo1canoes which spread out to form major pyroclastic fans. These have been eroded by lahar channels which are filled by lahars and the lahars are

WHATHASBEENTHE IMPACTOF THESE VOLCANICPROCESSES? Sorne of these Plinian eruptions must have caused considerable changes in the environmental conditions, even if only for several decades, but

86


A REVIEW üF ENVIRüNMENTAL CHANGE IN THE BASIN üF MEXICü (40000-10000

BP)

TABLE 3 MAlN TEPHRA

LAYERS IN THE BASIN OF MEXICO

(after Ortega Thickness (cm)

Sample

Loca/ity

Huitzilzingo

Chalco core E Chalco core D

2-10

Chalco coreD Chalco core D

11-15

Chalco core E Chalco core E Chalco core E

5

11 V

Chimalpa San Martin Tlapacoya 2

30

7

25

Tlahuac

Chalco core B

47

Texcoco

34

*References:

(1) Niedeberger

interbedded

late rally

sequences Examples next

section

from

14C age (yr B.P.)

context

with

from

fluvial/lacustrine

deposits

are described

LaJoya,

east ofTexcoco.

9395 ± 255

GX16969

3

12520 ± 135

GX16965

3

ca. 14000

AA13348

4

13990 ± 100

AA13344

4

13180 14295 14450 14540 14430 14770 15020

TX1784 AA13342 TX1914 TX1913 15185 GX0878 GX1361

2 4 2 2 2 1 2

± 290

90 100 90 190 280 450

± ± ± ± ± ±

*

3

14015 ± 130

ca. 16000

4

34000

3

are older

pyroclastic

developed

between

figure

here

La Joya from a stratigraphic

sequence

date

4

of

pyroclastic

This

in table 4 from

37 220

tree trunk

thought

illustrated

clastic

± 890 comes

87

in the pyroclastic

the youngest

in this valley (figure

in the

FRINGE ON VOLCANICLASTIC SEDIMENTS New C14 dates are reported

oldest

AA17046

a carbonised

the

5. The

References

55

2645 ±

flow and this dates

sequences.

NEW DATES FROM THE EASTERN PIEDMONT

in fig.

Laboratory code

(1976); (2) García (1986); (3) Lozano et al. (1993); (4) this study (all ams dates).

and fluvial/volcaniclastic of these

1998)

Black ash. Covered by silt, upper con tact irregular. Yellow lapilli, clasts 2-50 mm in diameter, and black ash. Lower contact sharp. Analyses on glass shards smaller than 250 \lm. Gray ash. Lower contact irregular. Immediately covered by TIapacoya 2. but in other sections covered by silts up to 2 cm thick. Black ash Lower contact Irregular. Samples analyzed at 15 (Miahuacanb) and 4 cm (Miahuacana) from the bottom. Black ash. Samples analysed at 46 (Tlahuac,). 19 (Tlahuacb)' and 19 cm (Tlahuaca) trom the bottom Black ash. Lower contact transicional, interbedded with silt up to 5 mm thick. Samples analyzed at 20 (Tx4b) and 2 cm (Tx4a) from the bottom.

4

Chalco core E

and Newton,

Creamy white ash. Variable thickness, lower contaet irregular. Black ash. Lower contact sharp, interbedded on black organic sediments. Black ash. Lower contact irregular. Black ash Lower contaet sharp. Samples analysed at the top (Vb) and the bottom (Va). Black ash Covered by silt.

5

Miahuacan

Tx4

Stratigraphic

2

Chalco core E

Tlapacoya 1

Guerrero

pyroclastic

4d). Further

flow

upvalley

flows with organic

there

paleosols

the flows. Characteristics

flows are shown

in table

of

5

and

4c and 4d. date

is much

for these fan

surface

younger

deposits has

than

previously

and the upper

been

principally

pyrobeen


DAVIDHUDDARTANDSILVIAGONZÁLEZ TABLE4 NEW RADIOCARBON DATES FROM LAJOYAAND SAN VICENTE CHICOLOAPAN, EASTERN PIEDMONT FRINGE (UNCALIBRATED YEARS BP) AA43489 San Vicente Chicoloapan

AA43490 LaJoya-l08:

Beta 165980 LaJoya:J:

ger in age. The date obtained from La Joya:J from a stratigraphically younger voIcanic ash/ fluviolacustrine sequence which is lateral to the main pyrocIastic flow succession, is younger than La Joya-108. AH these La Joya sequences are extremeIy rhyolitic in composition. The third new

34000 ± 340 charcoal from fluvial-Iacustrine sequence beIow lahar, stratigraphically older than mammoth bones found aboye the lahar 37220 ± 890 charcoal from pyrocIastic flow which dates that flow 34380 ± 500 charcoal from voIcanic ash fluvial/lacustrine sequen ce stratigraphically later than 2

date comes from a high lake stand ofLake Texcoco at approximately 220 m at San Vicente Chicoloapan in a delta/nearshore sequence ofthe lake (figure 4e, 6). This location is the site of a mammoth find, reponed by González eL aL (this volume). The date comes from charcoal fragments from sediments beIow the lahar (figure 4e) which indicates pan of the voIcanic events associated with the Late Quaternary Tlaloc eruptions. The date gives an approximate age for both the lahar and the mammoth as both are stratigraphically younger yet the sequence must have been deposited fairly rapidly and there are no breaks in deposition. The sequence is capped by the CCBash.

built up by Late Quaternary flows of this kind of age from muItiple flows, with no evidence

CUMATEFROMTHE POLLENRECORD There has been a long history of pollen studies from the Basin of Mexico since the work of Deevey (1944), Sears (1952) and Sears and Clisby (1955). Although the latter authors attempted palaeocIimatic interpretation a satisfactory pol-

of breaks in sedimentation. Córdova (1997), although having no dates for these piedmont sediments, considered that a change in base rever caused two generations of deposits. One formed the upper piedmont and consisted of pyrocIastic flows and ashes that are indurated. The other member forms the lower piedmont deposited by a thick series of lahars which he thought were younger, or at least contemporary with, the younger deposits of the upper piedmonto The geomorphic and stratigraphic relationships between these two members suggest that the youngest lahars that form the lower piedmont flowed through the valleys that dissected the upper piedmont pyrocIastics and were ejected out onto the plains. He thought that discrete terraces of pink lahar are found a10ng sorne of the barrancas. From our new work, which will

len zonation is not possible because the percentage frequencies of the major taxa are variable throughout the core (e.g. the Madero core from Mexico City, figure 7), the percentages show a monotonous distribution when plotted as percentages of total pollen rather than relative percentages of tree pollen alone and in addition the pollen in the coarser sediments was scarce and poorly preserved. Pollen abundance q)rreIates with the cIay units. Maxima in the percentages of oak, fir and a1der pollen as opposed to pine pollen were considered to indicate warm-moist periods. However, the sampling interval was too coarse in this early work and its value now seems limited. The later work is much better and examples will be discussed

be reponed eIsewhere in de tail , it is apparent that Cordova's pink lahars are in fact pyrocIastic flows. The lahars that we report are eroded into the pyrocIastic flows as can be seen from figure 4c, and they are stratigraphically slightly youn-

from Cruz del Lago, other parts of Lake Texcoco, the ChaIco basin and from Tlapacoya on the shores of former Lake ChaIco.

88


A REVlEW Of ENVlRONMENTAL

CHANGE

IN THE BASIN Of MEXICO

(40000-10000

BP)

â&#x20AC;˘

Figure 5. Stratigraphy at La Joya and surrounding valley in volcanic1astic sediments: a) the fan is built up from pyroc1astic flows, lahars and ashfalls from the eastern piedmont fringe. The mountains in the western Basin of Mexico can be seen. b) Thick pyroc1astic flow sequences and the fan surface.

89


DAVID HUDDART AND SILVIA GONZÁLEZ TABLE 5 CHARACTERISTICS OF PYROCLASTIC FLOWS FROM tAJOYA AND THEIR INTERPRETATION

Sediment type

nological control of this sequence is given by three radiocarbon dates that became available after the original work (Brown, 1985; Bradbury, 1989). Despite the criticism, the summary of the c1imate is given in table 6.

Struetures

Pumice, up to cobble Sheets or wide gravel in size, with fine channel-fills, fining sand matrix; Iithics upwards in individual especially porphyritic units andesite Varying c1ast Grey-blue in colour, concentrations upper layer pink Charcoal fragments, Vertical pipes formed carbonised logs as gas escape included structures Interpretation Formed from hot, ground-hugging pyroclastic flows as fast-flowing currents, up to several hundred km/ hour, which usually followed the topography down the valley but could overtop any ridges. MuItiple phases separated by palaeosols in the valleys on the piedmont fringe indicating probable long continued Late -Middle Quaternary activity from Plinian eruptions on Tlaloc.

Lake Texeoeo Lozano Garda and Ortega Guerrero (1997) described a 10.5 m, from Texcoco where the chronology was given by five AMS C14 dates and tephra correlation. The c1imate record from the core is summarised in table 7. The base of the core was thought to be over 34000 BP based on the presence of the Tlahuac (CCB) tephra. The pollen data indicates that up to c. 23000 BP the c1imate was cool and hum id, with high percentages of pine and abundant quillwort (lsoetes). There was an abrupt change in the pollen assemblage at c. 23000 BP which was thought to be due to a major PopocatépetI eruption which occurred sorne time between 23600-22000 BP. Conditions around the Last Glacial Maximum (2300010000 BP) were dry and cold, pollen concentrations were low, with pine dominant. An hiatus is indicated for the time period between 14000 and a C14 date of 6140 ± 60 BP. Chaleo The Chalco sub-basin in the south of the Basin of Mexico has given poli en data from the top 8 m, ofa 26.5 m, core (Lozano Garda et al., 1993) and the upper 10 m, of an 11.27 m, core (Lozano Garda and Ortega Guerrero, 1994). Dating control carne from four C14 dates from the first core and eight from the second. Both showed similar changes so the c1imatic record interpreted from the second core because of its longer time span has been used in table 8.

Cruz del Lago González Quintero and Fuentes Mata (1980) studied a 7.2 m, core from the centre of Lake Texcoco where they divided the pine pollen

At Tlapacoya from the archaeological site on the shores of the former Lake Chalco, González

into several morphological groups, corresponding to different pine species. However, this approach has been strongly criticised by sorne palynologists who believe that pine species can-

Quintero (1986) attempted to determine variations in temperature and precipitation based on what he thought were the most important fluctuations in the pollen record. He divided

not be identified form their pollen (Brown, 1985; Lozano and Xelhuantzi, 1997). The chro-

the 33000 year pollen record into seven phases. In the lower sediments the presence of a trunk

90


A REVIEWOF ENVIRONMENTAL CHANGEINTHE BASINOF MEXICO(40000-10000 BP)

Figure 6. Stratigraphy

at San Vicente Chicoloapan

in a delta/lacustrine/lahar

sequen ce (N-S face).

tive diatom assemblage zones. In 1989 in a review of late Quaternary lacustrine palaeoenvironments in the Basin of Mexico, he discussed, amongst others, the Tepexpan witness section and the Tlapacoya archaeological section in terms of their diatom stratigraphy (fig. 8) and from this he gave an environmental interpreta-

of Taxodium tree was taken as major evidence for temperate, humid conditions with annual precipitation of about 1500 mm, and mean annual temperature of about 20 oc between 3300023000:BP (phase 1). A trend towards lower pine abundance was taken as indicating lower temperatures and precipitation values, to 18 oc and

tion. He suggested that no major changes have occurred over the last 30000 years, although .sorne periods of minor lake expansion seem to have coincided with glacier advances on the nearby volcanoes (e.g. at 33000-27000 and 14000-

500 mm, respectively (phase 11), from 23000 to 14000 years BP. A slight amelioration to a milder and wetter c1imate between 14000 and 8000 years BP is inferred from an in crease in pine pollen and more abundant aquatics (phase 111). THE DIATOMRECORDASAN INDICATOR OF ENVIRONMENTAL CHANGE

9000 BP). The palaeolimnological stages for the last 35000 years as interpreted from Bradbury's (1989) diatom stratigraphy are iIIustrated in figure 9. None of the records reviewed con-

The work of Bradbury (1971, 1982, and 1989) was pioneering in using ?iatoms as an indicator of environmental change. For example, in 1971

tained evidence of long-lived, deep saline or fresh lakes, although Bradbury (1989) thought that the basal pari: of the Tlapacoya and Tex-

he produced a detailed diatom stratigraphy for Lake Texcoco and he delineated fifteen distinc-

coco sections may represent the final stages of such a lake at about 34000 BP.

91


DAVID HUDDART AND SILVIA GONZÁLEZ

>-'"'"

a.~

'" - E .s::; ~ o~ a.

VI

u.

a'"

"t§

'"e a::"

u

~~

a:: « 0«

'" ·E

"

.!! 10

"O

O

l!!

E

O

.1:

O

«

\.:l

VI

C"

e l!!

e

~ " '" ~ .E

N

-5'"

'"'"

'"

Ol

., -

'" '" '" '"" e l!l o§ « " a. '" '" Oi eu ~ o E '" >'" a. c.. :;; '" .~ ~

u

'"e

~ e .Ol", , E

'"

'" '"'"

.1:0\

I

~-i ~L J J r~ r¡ .f. i ,

~.I

~ I .H.

I

I 24

,

~

I

28

J

32

~

.lB..~

I

:

;1

~-

i"

l

~

r

t

~ ~

i

.12. -:- --

I

J

it

POLLEN DIAGRAM MADEROCORE MEXICO CITY. MEXICO Percentages oftotal pollen (Clisby & 5ears 1955 )

~

l l ~II I l II ~

.2ll..

v

r

l

~

I ~

26

AA

;

:

I

VlU

¡.

r

f

I

Explanation

B

II

"

Weathered ash and clay

~ Ostrocod mar

D

~

i

~

52 •

"

5and and sill

¡ No pollen

:-

~:-

". ... ni~l'il-. "r¡ •. e8 :

:

~:

Pollen types in counts less than 90

~

;:

i

i ¡Ir

Ii

i

60 20 20 20

1

i

rI"""""""T""""

20400 300

Percent Pollen

Figure 7. Pollen diagram [rom the Madero Core, Mexico City (after Sears and Clisby, 1955).

92


A REVlEWüF ENVlRüNMENTALCHANGEIN THE BASINüF MEXICü (40000-10000 BP) TABLE 8 SUMMARY OF THE CLIMATE FROM THE POLLEN RECORD IN THE CHALCO SUB-BASIN (after Lozano Garda et al., 1993 and Lozano Garda and Ortega Guerrero, 1994)

TABLE 6 SUMMARY OF THE CLIMATE FROM THE POLLEN RECORD AT CRUZ DEL LAGO (after González Quintero and Fuentes Mata, 1980) Time (Uncalibrated Years BP)

Climate Interpretation

c. 26500-24000

cold, dry with abundant pine cold, moist, lower pine with more aquatics transition towards dry, temperate, an increase in pine cool, moist, fluctuations in oak, alder and dominance ofpine. an hiatus dry, warm, spruce disappears, oak

c. 24000-21000

21000-19000

19000-14500

c. 14 500-11 500 11,50-8000

Age (Uncalibrated Years BP)

Climate Interpretation

33000-23000

Glaciers retreat; open pine forests and grasslands Drier, desertic climate but water fluctuations (alder, bulrush and Cyperaceae increases) Cool dry, mixed pine, oak forests and grasslands Warmer and drier; Mimosa and Bursera Wetter; ash, hornbeam, hazel, cypress, juni per increases Cooler, more humid; tree pollen increase; pine, oak, alder; emergent vegetation like Cyperaceae, herbs important and in crease in spores Temperate sub humid, maximum values of tree pollen, pine (50-90%), oak, silver fir, alder; pollen of liquidambar, elm, beech, ash and walnut (under 1 %). Increase in water into the lake

23000-14000

20 600-19 000

19000-16500 16500-14500

14500-12500 TABLE 7 SUMMARY OF THE CLIMA TE FROM THE POLLEN RECORD FROM LAKE TEXCOCO (after Lozano Garda and Ortega Guerrero, 1997) 35000-23000

c. 23000

23000-18000

18000-14000

14 000-6 140

cool/humid high tree pollen (pine 60-80%); meadow rue 5-30%; grasses up to 20%; quillwort (up to 40% of the aquatics) pine reduces by 20%, probably caused by a Popocatépetl eruption cold and dry, pine up to 90%; grasses 1-6%; scarce wetland taxa: low lake stand. lower pine (43-73%); higher grasses (4-20%); saline wetland Hiatus

12500-8000

Work on the well dated cores from the Chalco Basin cover the last glacial phase in full (Lozano Garda et aL, 1993; Caballero Miranda, 1997 and Caballero Miranda and Ortega Guerrero, 1998). A relatively deep saline lake is indicated by about 45000 BP and was present until about 39000 BP.

93


DAVID HUDDART

AND SILVIA GONZรLEZ

150 200 250 300 350 400 E 450 u 500

a

T 11.6 ka

PCA 14.5 ka

550 600 650 700 750 800 850 900

~

tronco 23.150+150 GCB 33.500 + 3200 -2300

o

60 Percent

O

16

O

20 O

25

O

lO

O

lO

O

15

TIapacoya

150 200 250 300 350 400 ยง 450 .<: 500 Q. Q) 550 Cl 600

Lithology T1 1.6 ka

650 700 750 800 850 900

tronco 23.150+150 GCB 33.500 + 3200 -2300 O

20 O

15 O

25 O

45

O

15 O lO O lO O 5 O lO O lO O lO O

15 O

15

Percent Stratigraphy of shallow, fresh-and alkaline-water diatoms atTlapacoya, Mexico.

Figure Sa. Diatom Stratigraphy

at Tepexpan

witness section and Tlapacoya

94

(after Bradbury,

1971).


A REVIEW OF ENVIRONMENTAL CHANGE IN THE BASIN OF MEXICO (40000-10000

o c: o

'c :c Z' c:

~ Qj

'8.¡::'"

E

"

.ec:

E

E!

:c

•.

El

~ ~ ~ u

BP)

o

i

I

•n n nTl n n Diatom

rTTTT1

O

percent stratigraphy

n

rTTTT1

n n n

n

n n n n n r1

rTTTTT'1

20

of the Tepexpan

witness

section.

Mexico.

PCA

= pómez

con andesita

"-c.

.s:

El

~ a .~'"

.s:

•.

o

SALlNE BENTHIC

ALKALlNE MARSH

.Oenticulo

Iií

~

¡-

SALlNE PLANKTONIC

elegons.Chaetoceros

~

-----¡

Nittschiafrustulum

F~~af¡~~e

511

z

loQ

x UJ

l5Q

1t c..

Enviromental interpretation Marsh Saline Marsh

UJ

1-

20Q

ransitiona

25Q

aline Lak

~

D

Mari

Sand

Figure 8b. Diatom Stratigraphy

D [ll] Silt

at Tepexpan

Cloy

D Ash

o Ostrocod

D Coquina

Diatomite

witness section and Tlapacoya (after Bradbury,

95

1971).


DAVID HUDDART

AND SILVIA GONZÁLEZ

TLAPACOYA

Aproximate (ka)

t§rt_E_C

__

T_EX_C_O_C_O T_EP_E_X_P¿1

~hihl

::~,

hllll 11II 111111111~

"""

8

.~

::E CIJ "O

Gc: CIJ

.3 CIJ

f; 'O

5 -5i

~"""

"",jl

'1"'1"

'"''

"'~ 13-15

a.

'"

'8' ~

-.

~

~~

]

o".,: ~YL1.IlI..'l)IL

...l!""'\L----

~

~

10-12

]

~

Paleolimnological stages in the Cuenca de Mexico during the last 35 ka interpreted from diatom stratigraphy of sites in the Chalco and Texcoco subbasins. The interpretive profiles summarize considerable limnological variability through time at individual sites.

Figure 9. Palaeolimnological

stages for the last 35000 years as interpreted

96

fram Bradbury's

1989 diatom record.


A REVIEW OF ENVIRONMENTAL Ci-lANGE IN THE BASIN OF MEXlCO (40000-10000

Lake levels were generally low until about 22 SOO BP when the most important environmental change occurred when the previously

much evidence for climatic change. However, there has be en much dispute over basic interpretations of landforms and sediments and as a result the picture is not as clear as it should be (see discussion, for example, in White and Valastro, 1984; White, 1986; White el aL, 1990; Heine, 1988,1994; Vázquez Selem, 1997, and Metcalfe el aL, 2000). Heine (1988 and 1994) presents a comprehensive palaeoclimatic interpretation where he suggests that during the past 36000 years, three major phases of climatically induced high erosion intensities and glacier advances can be distinguished. These ~)Ccurred at 36000- > 32000

saline-alkaline lake became a freshwater system. This coincides with the Popacatépetl eruption discussed earlier. The climate was probably quite dry and rapid fluctuations between fresh and acidic water conditions occurred through to about 14000 BP and were probably associated with the effects of continuing volcanic activity. Between 14000 and 10 000 BP, Chalco expanded from a shallow marsh into an open pond which correlates with wetter conditions from the pollen record (Lozano Garda el al., 1993). GlACIAL

AND PERIGlACIAL

years BP, around 12000 years BP, and 10 000-8 800 years BP. These periods coincided with climatic changes from relative aridity to greater humidity.

EVIDENCE

His scheme (figure 10) shows no synchroneity of the temperature and humidity trends, although Metcalfe el aL (2000) questioned how these trends

FOR CLlMATIC CHANGE

This type of evidence from the high volcanoes around the Basin of Mexico should provide

WARM

BP)

------==-----===::::,....~.".-------------=--===----====------=--~-

j=-""""TRE;::a----""'F

¡

TEMPERATURE

~

~l

"'----

COLO

<O(

~

>

= <:::=:>

-=

u

'!!: HUMIOITY

ALmu'''O,,------------------------------------------

IN METRE 5000

4500

4000

3500

1

2

./-·~~~~NE I

11

'O'

3

4

5

6

7

8

9

10

11

12

13

16

17

18

19

~ ~:~~~ALES ··~::~INE1 ~~R

PERIGLAClALAlnnJDlNAL DEBRIS FlOW, VERTICAL CUTTlNG, SOltFLUCTJON J

l. ZONE (ROCK fAll,

LACUSTRINE

SEDIMENTS IN BASINS

21

8 DEBRIS 13 FLQW

n EROSION DEBRIS ACCUMULATlON

ATTHE ENO OF GORGES ~ (NOT DATED)

20

22

23

24

25

llNTENSIVE BARRANCA

26

EIIDSION.

t

TRANSPORT AND ACCUMULATlON OF RUBBlE

~~~NC~~~~ ANDVALLEYS

BY WIND

T • toba' SEDIMENT FORMATlON

Figure 10. Palaeoenvironmental reconstruction of the central Mexican highlands (after Heine, 1988, 1994) _G refers to glacial phases.

97

~t

FOAA\AT10N.

__ --

=

DfVELOMENT OFeARROSOIt5 (ANDVERT1SOLS)

SOIlEROSION (AUSED BY MAN

during the Late Quaternary


DAVID HUDDART ANO SILVIA CONZÁLEZ

had been obtained. Further work is required to reconcile the all too apparent differences cussed in detail in the aboye papers.

the original excavations are considered to have been introduced by rodent burrowing from

dis-

aboye and the two "worked" bone fragments are consideredjust to be broken bone (Alan Turner pers. com.) The lake beach gravels and hearths from the original excavations are thought to be local angular pebbles, scree, and burnt vegetation respectively. Waters (1985) had earlier sug-

NEW ENVIRONMENTAL EVIDENCE FROM TLAPACOYA

Although much work has been published on the important Tlapacoya prehistoric site (for exampie, by Mirambell, 1978; Lorenzo and Mirambell,

gested that the circular hearth-like areas may have been created by trees "rooting" in the sediment and this may be an alternative. The length

1986) there have been consistent doubts about sorne of the conclusions regard to the age of the archaeological evidence and indeed the archaeological evidence itself (for example, Haynes, 1967, Waters, 1985). New excavations were com-

of fetch in the shallow lake would not be capable of producing lake beach gravels of the size indicated and the suggestion by Mirambell (1978)

pleted in 1998 (Conzález el al., in prep.) to try to resolve sorne of the questions still posed from this site. The stratigraphy from the 1998 work is

that many of the andesite flakes had rounded edges is unsubstantiated by shape analyses in her publications. There was evidence of reworking of the Pumice with Andesite (PWA) tephra at several locations from the slopes aboye,

given in fig. 11 where a complex succession of clays, silts, volcanic ashes and reworked ash, organic-rich sediments and lahars was exposed.

which emphasises the importance of slope processes in the nearshore area at TlapacoYa. The Upper Toluca Pumice (UTP) tephra, dated recen tly to 10500 BP (Arce el al., 2003) had the "stratified" cranium found in 1971. This layer

From this new work sorne of the conclusions are given below. There is no new evidence to support the presence of human activity at 24000 BP, and the original C14 dates (Carcía Bárcena, 1986) have large standard deviations which could make them as young as 16000 BP. There was no evidence for a lithic assemblage and it is consid-

had been dated to 9920 ± 250 BP (Carcía Bárcena, 1986) which agrees well with the new AMS C14 date for the unstratified cranium

ered that the 2500 andesite flakes from the original excavations must be derived from the local bedrock, which fractures into naturally sharp

which is 10200 ± 65 (Conzález el al., 2003) Thus based on the evidence from the new fieldwork humans were only present at Tlapacoya around 10500-10000 BP.

flakes. The small number of obsidian flakes from

o ~I ~~~~~I

5Distance (metres)

I I I I I I I I

" Bedrock Andesite

I

Figure 11. Straúgraphy

from lhe 1998 Tlapacoya excavaúons.

98


A REVlEWOF ENVlRONMENTAL CHANGEIN THE BASINOF MEXICO(40000-10000 BP) On the other hand there were times when there were better opportunities for human s in the Basin ofMexico (table 10), particularly those

PERlODS OF TIME WHENA) IT WASDlFFICULT FOR HUMANSIN THE BASINANDWHEN B) THEREWEREBETTEROPPORTUNITIES This review of environmental change in the

phases when the environment was more stable, with no evidence for large scale volcanic process-

Basin of Mexico suggests that there were certain time periods when it would have been extreme-

es, when human s could have taken advantage of the basin's resources.

Iy difficult for human s to have occupied large parts of the basin (table 9). Certainly volcanic processes have dominated the landscape for most of the period of time in question and the

IMPLICATIONSOF ENVlRONMENTAL CHANCE FOR HUMANPOPULATIONS. It is possible to draw sorne conclusions from this review of environmental change in the basin in terms of the implications for human populations. For example, the association of prehistoric human skulls with volcanic ash (see also González el al., this volume) allows the tempting suggestion that El Metro and Chimalhuacan man

large Plinian eruptions from the Tlaloc-Telapon area in the period dated from the earlier part of this time must have been devastating in terms of environmental damage, with large scale ecological changes. Humans could not have survived along the piedmont fringe. In the period around 30000 BP the CCB (Tlahuac) tephra whose original source is not known for certain, which in the Basin of Mexico was very thick, in multiple eruption phases. There were further large scale

were directly affected by the UTP evento However, most of the implications must be indirect in nature using examples from recent volcanic eruptions and later prehistoric and historical events. We can only make sorne suggestions for

Plinian eruptions from Popocatépetl around 22500 BP and around 14500 BP with the PCA ash and subsequent lahars. Finally the Plinian

this time periodo The resource implications for any humans in the basin during a major volcanic eruption

eruption from the Nevado de Toluca in the period around 10 500 BP, with thick ash and lahar deposition in the Basin of Mexico, must again have caused a widespread ecological crisis in the

must have been significant and we can use a recent example to illustrate the range of possible implications. For example, the biological effects of the 1912 Katmai eruption have been reviewed by Riehle el al. (2000). They emphasised the effects of tephra deposition on animals and vegetation which was of major importance

basin.

TABLE9 PERIODS OF TIME WHEN IT WAS DIFFICULT FOR HUMANS TO OCCUPY lARGE PARTS OF THE BASIN OF MEXICO 1) 40000-33000: Plinian eruptions from Tlaloc/Telapon, pyroclastic flows, lahars, ash falls 3) c. 23000: major eruptions from Popocatépetl 5) c. 14500-14000: Pumice with Andesite (PWA) ash and lahars from Popocatépetl

TABLE10 PERIODS OF TIME WHEN THERE WERE BETTER OPPORTUNITIES FOR HUMANS IN THE BASIN OF MEXICO

2) c. 30000: Gran Ceniza Basaltica (CBA) ash

a) c. 29000-23000: cool-temperate and generally humid

4) 23000-15000 four tephras in this time period 6) c. 10500 Upper Toluca Pumice (utp) ash fall and lahars from Nevado de Toluca

c) c. 14000-11 000: cool and wetter

99

b) c. 21000-14500: colder and drier but fluctuations and sorne volcanic eruptions, although the ashes are thin d) 9000 and later: warmer and generally drier.


DAVID HUDDART ANO SILVIA GONZĂ LEZ

to a subsistence culture who lived in the area. The effects depended critically on the tephra thickness and the particular species. Virtually all animals either died or left the areas of heaviest tephra fall and these areas did not show recovery until three to seven years latero The effects on salmon were complicated because different species have different life cycles and spawning ages and require different types of spawning beds. However, the areas of heaviest tephra deposition were unsuitable for spawning

Riehle et al. (2000) argue the variability of each particular eruption. In general though recovery in Alaska was rapid in areas of under 10 cm, ashfall. The implications for the Basin of Mexico are nevertheless obvious. The human populations' resources would have been affected in a maJor way in certain areas and certain resources would have been affected more than others. The resources in the lake nearshore environment would have been affected as there is evidence of major changes in lake acidity due to volcanism

for five years after the eruption (Griggs, 1922). Survival partly depended on the food supply which affected sorne non-migratory species like

and likely lake depth due to tephra deposition which would have affected molluscan, fish, bird and lakeshore mammal/reptile resources. The grasslands adjacent to the lakeshore would have been covered by tephra up to 50 cm, thick on occasions and the effects on the megafauna may have been disastrous, especially for grazers, like the mammoth. Animal populations which may have been in decline due climatic chan-

the trout as sorne areas were devoid of fish food ayear after the eruption. The impact on salmon was not felt until severa! years after the eruption, for example the sockeye returns on Kodiak Island began to decline in 1915 and continued to decline until 1920 (Eicher and Rounsefell, 1957). Additional marine shellfish were killed in significant numbers in areas of heavy tephra deposition and cod were reported to have left traditional fishing grounds near Kodiak Island. The details of vegetation recovery varied. In areas

ge may have been pushed into extinction 15ythe effects of the UTP, although man may have had sorne effects too. Other prehistoric and historical eruptions which seem to have major impacts on human

of heavy tephra deposition, trees were broken, grasses and shrubs buried and landslides and

populations could be used as examples of their effects on resources and human populations, like the well known Late Bronze age, Santorini eruption and its effects on Minoan Crete (Cioni et al., 2000; Driessen and MacDonald, 2000). The Laki eruption of AD 1783 and the historic

floods excavated and/or deeply buried vegetation growing a floodplains and at the foot of steep slopes. Grasses and shrubs had recovered on Kodiak Island within three years from shoots from the existing root systems. Sorne plants survived as much as three years of burial and sorne

eruptions of Hekla in Iceland are useful exampies here too (Thorarinsson, 1971, 1979, 1981; Brayshay and Grattan, 1999; Dodgson et al.,

willows survived even deep burlal by sending out adventitious shoots just below the new ground surface. After a relatively minor eruption of Amiakchak Crater (Alaska) in 1931, caribou abraded their teeth on the volcanic ash to the point of starvation and many new born calves were lost as the herd migrated from the ashfall area (Trowbridge, 1976). Moose however, were not affeeted so much as they browse on shrubs and young trees which were more easily cleared of tephra

2000). The direct and indirect downwind effects of noxious and toxic volatile materials and gases on subsistence farmers and fishermen were recognised, including medical and veterinary symptoms and problems as a result of deposition, inhalation or ingestion of sulphuric, hydrochloric and hydrofluoric acids, which affected cows, sheep, crops, fodder and grazing as well as people, their well-being, economies and society. A specific example of the Hekla

by wind and rain. Hence this has implications for ancient subsisten ce populations, although

eruptions studied by Thorarinsson (1971) show that farm abandonment depended on the

100


A REVIEWOF ENVIRONMENTAL CHANGEIN THEBASINOF MEXICO(40000-]0000 BP) have been radically changed. So volcanic processes must have had major implications for the human populations in this basin: it was far from

tephra thickness and the general pattern was that a burial by 10 cm, tephra caused abando nment for up to one year, 15cm for periods of one to five years and 20 cm, for periods of sorne decades. The vast majority of farms abandoned after the Hekla (AD1104) erupúon were found within 25 km, of the volcano, although one site

the paradise it is someúmes described.

BIBLIOGRAPHY

60 km, distant was never resettled. There is also later prehistoric evidence from the Basin of Mexico that volcanic erupúons had

Arce,J-L.,J-L. Macías y L. Vázquez Selem (2003), 'The 10.5 ka Plinian Erupúon

of Nevado de

m~or effects on the cultural development of the populaúons. For example, González et aL (2000) and Siebe (2000) show that the erupúon ofXitle

Toluca Volcano, Mexico: Stratigraphy and Hazard lmplications", Geological Society oJ America Bulletin, vol. 115, núm. 2, pp. 230-248.

resulúng in tephra and lava flows caused the abandonment of Cuicuilo pyramid at about 1670 BP and this with the Popocatépetl eruption of c. 2200-2000 BP caused human migrations in

Bioornfield, K. (1975), "A Late Quaternary Monogeneúc Volcano Field in Central Mexico", GeologischenRundschau, núm. 64, pp. 476-497. --

the Amecameca-Chalco region and is an explanation for major populaúon shift to the north and the rise in importance of Teotihuacan. Sanders et al. (1979) menúon that between 100 BC and AD 100 about 80-90% of the population of the entire Basin of Mexico had nucleated in

America Bulletin, núm. 46, pp. 1-15. Bradbury, J-P. (1971), "Palaeolimnology of Lake Texcoco, Mexico. Evidence from Diatoms", Limnology and Oceanography, núm. 16, pp. 180-

the northeast and that the population in the southern part of the basin had been reduced substanúally. The two volcanic eruptions are

Y S. Valastro (1977), "Late Quaternary Tephrachronology of Nevado de Toluca Volcano, Central Mexico", Geological Society oJ

200.

likely to have had a role in this process. A similar example can be taken from a Plinian eruption of Popocatépetl between AD 50 and 100 when tp.e Tetimpa region was devastated and abruptlyabandoned (Siebe et al., 1996; Panfil el aL, 1999). It took about 400 years for recolonisa-

---

(1982), "Holocene Stratigraphy of Mexico and Central America", Stnae, núm. 16, pp. 46-48.

---

(1989), "Late Quaternary Lacustrine Palaeoenvironments in the cuenca de México", Qy,aternary Science Reviews, núm. 8, pp.

97-110. Brayshay, B. y J- Grattan (1999), "Environmental and Social Responses in Europe to the

úon and probably about 2-3 000 people migrated and contributed to the emerging urban centre of Cholula (Plunket and Uruñuela, 2000). The implications for any human populations

183 Eruption of the Laki Fissure Volcano in Iceland: a Consideration of Contemporary Documentary Evidence", en C.R Firth yWJ.

at an earlier period, and there seems at the moment only to be evidence for populations in the period 11 000 years and later, is that the

McGuire (eds.), Volcanoes in the Quaternary, Londres, Geological Society of London, pp. 173-187 (Special Publication, 161).

major Plinian eruption from Nevado de Toluca Volcano that occurred at 10500 BP would have

Brown, RB. (1985), "A Summary of Late-Quaternary Pollen Records from Mexico West of the Isthmus of Tehuantepec", en V.M.

had a devastaúng effect on the prehistoric population, causing death, at the best migration away from the basin and major impacts on the ecology. The resources of the lake, its nearshore and upland are as around the basin would

Bryant y RG. Holloway (eds.), Pollen Records oJ North American Sedimenls, American Association of Stratigraphic Palynologists, pp. 7193.

]01


DAVIDHUDDARTANDSILVIAGONZÁLEZ Caballero Miranda, M.E. (1995), "Late Quaternary Palaeolimnology

Driessen, j. y C.F. MacDonald

of Lake Chalco, the

Eruption

Basin of Mexico: New Evidence for Paleoenvironmental Change and Palaeoclimatic Change in Central Mexico During the Last 45000 Years", tesis de doctorado, University of Hull, mimeo. ---

(2000),

'The

Volcano and its

Effects on Minoan Crete", en WJ. McGuire, D.R Griffith, P.L. Hancock e I.S. Stewart (eds.), TheArehaeology ofGeolog;iealCatastrophes, Geological Society of London, pp. 81-93 (Special Publication, 171). Eicher, GJ. Jr. y GA Rounsefell (1957), "Effeets of Lake Fertilization by Volcanic Activity on

(1997), 'The Last Glacial Maximum in the Basin ofMexico: the Diatom Record between 34000 and 15000 years BP from Lake Chalco", Q;taternary 1nternational, núm. 43/ 44, pp. 125-136.

Abundance of Salmon", Limnology and Oeeanography, núm. 2, pp. 70-78. Flores-Díaz, A (1986), "Fluctuaciones del lago de Chalco desde hace 35000 años al presente", en j.L. Lorenzo y L. Mirambell (eds.), Tlapa-

--

Y B. Ortega Guerrero (1998), "Lake Leveis since about 40000 Years ago at Lake Chalco, near Mexico City", Quaternary Research, núm. 50, pp. 69-79. Cioni, R, L. Gurioli, A Sbrana y G. Vongionkalakis (2000), "Precursory Phenomena and Destructive Events Related to the Late Bronze

eoya: 35000 años de historia en el Lago de Chaleo, México, INAH, pp. 109-156 (Colección Científica, 115, serie Prehistoria). García-Bárcena,j. (1986), "Algunos aspectos cronológicos", en j.L., Lorenzo y L. Miram-

Age Minoan (Thera, Grecia) and AD. 79 (Vesubio, Italia) Plinian Eruptions; Inferences from the Stratigraphy in the Archaeological Areas", en WJ. McGuire, D.R Griffiths, P.L.

bell (eds.), Tlapaeoya: 35 000 años de historia en el lago de Chaleo, México, INAH, pp. '219-224 (Colección Científica, 115, serie Prehistoria). González, S., A Pastrana, C. Siebe y G. Duller

Hancock e I.S. Stewart (eds.), The Archaeology

(2000), 'Timing of the Prehistoric Eruption of Xitle Volcano and the Abandonment of Cuicuilco Pyramid, Southern Basin of México", en WJ. McGuire, D.R Griffiths, P.L.

of Geolog;icalCatastrophes, Londres, Geological Society of London, pp. 123-141 (Special Publication, 171). Córdova, C. (1997), "Landscape Transformation in Aztec and Spanish Colonial Texcoco, Mexico", tesis de doctorado, Cornwall, The University of Texas at Austin. --

of the Santorini

Hancock e I.S. Stewart (eds.), The Archaeology of Geolog;ieal Catastrophes, Geological Society of London, pp. 205-224 (Special Publication,l71).

(1971), "Geology and Early Man in Central Mexico", Proeeedings of the Geolog;ists Association, núm. 82, pp. 379-391.

---,

Deevey, E.S. (1944), "Pollen Analysis and Mexican Archaeology. An Attempt to Apply the Method", Ameriean Antiquity, núm. 10, pp. 135-149.

D. Huddart, L. Morett-Alatorre,j. yo-Cabrales y OJ. Polaco (2001),

Arro"Mam-

moths, Volcanism and Early Humans

in the

Basin of Mexico During the Late Pleistocene/Early Holocene. The World of Elephants", en G. Cavarretta, P. Gioia, M. Mussi y M.R Palambo (eds.), Proeeedings of the 1st 1nternational Congress, Roma, pp. 704-706.

Dodgshon, RA, D.D. Gilbertson y j.P. Grattan (2000), "Endemic Stress, Farming Communities and the Influence of Icelandic Volcanic Eruptions in the Scottish Highlands", en WJ. McGuire, D.R Griffiths, P.L. Hancock e I.S.

---,

Stewart (eds.), The Archaeology of Geolog;iealCa-

C. Jiménez López, R Hedges, D. Huddart,j. Ohman, A Turner y JA Pompa y Padilla (2003), "Earliest Humans in America: New Evidence from Mexico",journal of

Human Evolution, núm. 44, pp. 379-387. González Quintero, L. y L. Fuentes Mata (1980), "El Holoceno de la porción central de la

tastrophes, Londres, Geological Society of London, pp. 267-280 (Special Publication, 171).

102


A REVIEWüF ENVIRüNMENTAL CHANGEIN THE BASINüF MEXlCü (40000-10000 BP) cuenca de México", en F. Sánchez (ed.), Memorias del 111 Coloquio sobre Paleobotánica y Palinología, México, INAH, pp. 113-132 (Colección Científica). Griggs, R.F. (1922), The Valley of Ten Thousand Smokes, Washington, phic Society.

D.C., National

of Lake Chalco, Central Mexico", Palaeogel}graphy, Palaeoclimatology, Palaeoecology, núm. 109, pp. 177-19I.

--

Geogra-

Y B. Ortega Guerrero (1997), "Late Quaternary Environmental Changes of the Central Part of the Basin of Mexico; Correlation between Texcoco and Chalco Basins", R.eview of Palaeobotany and Palynology, núm. 99,

Haynes, C.v. (1967), "Muestras de C14 de Tlapacoya, Estado de México", Boletín del INAH, núm. 20, México, INAH, pp. 49-52. Heine, K. (1988), "Late Quaternary Glacial Chronology of the Mexican Volcanoes", Geowissenschaften, núm. 6, pp. 197-205.

pp. 77-93. Martín del Pozzo, A.L. (1982), "Monogenetic Vulcanism in Sierra Chichinautzin, Mexico", Bulletin Volcanologique, núm. 45, pp. 9-24. Metcalfe, S.E., FA. Street-Perrott, R.A Street-

---

(1994) "Past and Present Geocryogenic Processes in Mexico", Permafrost and Periglacial Processes, núm. 5, pp. 1-12. Huntingdon, E. (1913), '''Yhe Shifting Climatic

Perrott y D.D. Harkness (1991), "Palaeolimnology of the Upper Lerma Basin, Central Mexico: A Record of Climatic Change and An thropogenic

Zones as Illustrated in Mexico", Bulletin of the American Geographical Society, núm. 45, pp.

Disturbance

since 11 600 yr

BP", Journal of Palaeolimnology, núm. 5, pp. 197-218. --, S.L. O'Hara, M. Caballero y SJ. Davies

1-12 Y 107-116. (1914), The ClimaticFactoras Illustrated in Arid America, Washington, Carnegie lnstitu-

tion of Washington (Publication 192). Kirianov, v., A Kiloskov, S. de la Cruz y A.L.

(2000), "Records of Late Pleistocene-Holocene Climatic Change in Mexico; a Review", Qyaternary Science R.eviews, núm. 19, pp. 69972I.

Martín (1990), '''Yhe Major Stages of Manifestation of Recent Volcanism in the Chichi-

Mirambell, L. (1978), "Tlapacoya: a Late Pleistocene Site in Central Mexico", en AL.

---

nautzin Zone", URSS Academy Geology, núm. 311, pp. 430-434. Lambert, W. (1986), "Descripción

of Sciences-

Bryan

preliminar

Circum-Pacific Perspective, Canadá, Department of Anthropology, University of Alberta (Occasional Paper, 1).

de lps estratos de tefra en Tlapacoya 1", en j.L. Lorenzo y L. Miram bell (eds.), Tlapacoya:

Mooser, F. (1967), '''Yefracronología de la cuenca de México para los últimos 30000", Boletín del INAH, núm. 30, México, INAH, pp.

35000 años de historia en el lago de Chalco, México, INAH, pp. 77-100 (Colección Científica, 115, serie Prehistoria). Lorenzo,j.L. y L. Mirambell (eds.) (1986), Tla-

---

pacoya: 35000 años de historia en el lago de Chalco, México, INAH (Colección Científica, 115, serie Prehistoria). Lozano Garda, M.A, B. Ortega Guerrero, M. Caballero Miranda y j. Urrutia Fucagauchi (1993), "Late Pleistocene and Holocene Palaeoenvironments of Chalco Lake, Central

--

(ed.), Early Man in America from a

12-15. (1975), "Historia geológica de la cuenca de México", en Departamento del Distrito Federal, Memoria de las obras del sistema de drenaje profundo

del Distrito Federal, México,

núm. 1, pp. 7-38. -A Montiel y A Zúniga (1996), Nuevo mapa geológico de las cuencas de México, Toluca y Puebla, México, Comisión Federal de Electricidad. Niederberger, C.B. (1976), Fechas de radiocarbono, México, INAH, pp. 12-15 (Colección Científica, 30, serie Arqueología).

Mexico", Quaternary Research, núm. 40, pp. 332-342. Y B. Ortega Guerrero (1994), "Palynological and Magnetic Susceptibility Records

103


DAVID HUDDART ANO SILVIA GONZÁLEZ

--

(1979), "Early Sedentary Economy in the Basin of Mexico", Science, núm. 203, pp. 131-142. Nixon, G.T. (1989), "The Geology of Iztaccíhuatl Volcano and Adjacent Areas of the Sierra

Sears, P.B. (1951), "Pollen Profiles and Cultural Horizons in the Basin of Mexico", 29th lnternational Congress o/ Americanists, Chicago, University ofChicago Press, vol. 1, pp. 57-61. --

Nevada and Valley ofMexico", Geological Society o/ America Special Paper, núm. 219, pp. 1-58. Ortega Guerrero, B. y AJ. Newton (1998), "Geochemical Characterization of Late Pleistocene and Holocene Tephra Layers from the Basin of Mexico, Central Mexico", Quaternary Research, núm. 50, pp. 90-106. Panfil, M.S., T.w. Gardner y RG. Hirth (1999), "Late Holocene

Stratigraphy

--

of Tetimpa Ar-

Basin of Mexico-City", Journal o/ Volcanology and Geothermal Research, núm. 104, pp. 45-64. --, M. Abrams, J.L. Macías y J. Obenholzner (1996), "Repeated Volcanic Disasters in Prehispanic Time at Popocatepetl, Central Mexico; Past Key to the Future?", Geology, núm. 24, pp. 399-402. ---, J.L. Macías, M. Abrams, S. Rodríguez-

(2000), ''The Archaeo-

logy of a Plinian Eruption of the Popocatépetl Volcano", en WJ. McGuire, D.R Griffiths, P.L. Hancock e LS. Stewart (eds.), TIte Archaeology o/ Geological Catastrophes, Londres, Geological Society of London, pp. 195-203 (Special Publication, 171). Riehle, J.R, D.E. Dumond, C.E. Meyer y J.M.

Elizarrarás y R Castro (1997), "Catastrophic Prehistoric Eruptions at Popocatépetl and Quaternary Explosive Volcanism in the Serdán-Oriental Basin, East-Central Mexico", Pre-Meeting Field Trip Guidebook IAVCEI, Puerto Vallarta, México, núm. 4, pp. 1-88. --, P. SchaafyJ. Urrutia-Fucugauchi (1999), "Mammoth Bones Embedded in a Late Pleistocen e Lahar from Popocatepétl Volcano, Near Tocuila, Central Mexico", Bulletin o/ the Geological Society o/ America, núm. 111, pp. 1550-1562.

Schaaf (2000), ''Tephrachronology of the Brooks River Archaeological District, Katmai National Park and Preserve: What Can and Cannot be Done with Tephra Deposits", en WJ. McGuire, D.R Griffiths, P.L. Hancock e LS. Stewart (eds.), The A rchaeology o/ Geological Catastrophes, Londres, Geological Society of London, pp. 245-266 (Special Publication, 171). Rzedowski, J. y c.G. Rzedowski (1979), Flora /anerogámica del Valle, vol. 1, México, CECSA, 403 p. --y

Basin of Mexico", Bulletin o/ the Geological Society o/ America, núm. 66, pp. 521-530. Y K.H. Clisby (1955) "Palynology in

Southern North America, 4: Pleistocene Climate in Mexico", Bulletin o/ the Geological Society o/ America, núm. 66, pp. 521-530. Siebe, C. (2000), "Age and Archaeological Implications of Xitle Volcano, Southwestern

chaeological Sites, Northeast Flank of Popocatépetl Volcano, Central Mexico", Bulletin o/ the Geological Society o/ America, núm. 111, pp. 204-218. Plunket, P. y G. Uruñuela

(1952) "Palynology in Southern North America, 1: Archaeological Horizons in the

Thorarinsson, S. (1971), "Damage Caused by Tephra Fall in Sorne Big Icelandic Eruptions and its Relations to the Thickness ofTephra Layers", en A. Kaloyeropoytoy (ed.), Acta o/ the pt International Scientific Congress on the Volcano Thera, septiembre de 1969, pp. 213-236.

C.G. Rzedowski (1985), Flora/anerogámica del Valle de México, vol. 11, México, Es-

cuela Nacional de Ciencias Biológicas del IPN, Instituto Ecológicas, 74 p. Sanders, W.T.,J.R Parsons y RS. Stanley (1979),

--

(1979), "On the Damage Caused by Volcanic Eruptions with Special Reference to Tephra and Gases", en P.D. Sheets y D.K.

The Basin o/ Mexico. Ecological Processes in the

Grayson (eds.), Volcanic Activity

Evolution o/ a Civilization, demic Press, 561 p.

Ecology, Nueva York, Academic 125-159.

Nueva York, Aca-

104

and Human Press, pp.


A REVIEW OF ENVlRONMENTAL CHANGE IN THE BASIN OF MEXlCO (40000-10000

Trowbridge, T. (1976),

"Aniakchak Crater", en

BP)

Geographic, núm. 4, pp. 70-73. Urrutia Fucugauchi,j., M.S. Lozano Garda, B. Ortega Guerrero y M. Caballero Miranda (1995), "Palaeomagnetic and Palaeoenviron-

and Extinctions: Man in the Late Glacial North America, Center for the Study of Early Man, University of Maine at Orono, pp. 125-143. White, S.E. (1986), "Quaternary Glacial Stratigraphy and Chronology of Mexico", Quaternary Science Reviews, núm. 5, pp. 201-205. ---, j. Reyes Cortés, j. Ortega Ramírez y S.

mental Studies in the Southern Basin of Mexico 11. Late Pleistocene-Holocene Chalco Lacustrine Record", Geofisica Internacio-

Valastro Jr. (1990), El Ajusco: geomorfología volcánica y acontecimientos glaciares durante el Pleistoceno superior y comparación con las series

nal, núm. 34, pp. 33-53. Vázquez-Sánchez, E. y R. Jaimes-Palomera (1989), "Geología de la cuenca de México",

glaciales mexicanas y las de las Montañas Rocallosas, México, INAH, 77 p. (Colección Científica, serie Arqueología).

Rennick y Perry (eds.), Alaska's Volcanoes: Northern Link in the Ring of Fire, Alaska

--

Geofisica Internacional, núm. 28, pp. 133-190. Waters, M.R. (1985), "Early Man in the New World: An Evaluation of the Radiocarbon Dated Pre-Clovis Sites in the Americas", en

y S. Valastro Jr. (1984), "Pleistocene Glaciation of Volcano Ajusco, Central Mexico and Comparison with the Standard Mexican Glacial Sequence", núm. 21, pp. 21-35.

j.I. Mead y DJ. Me1tzer (eds.), Environments

105

Quaternary

Research,


MOMIFICACIÓN ARTIFICIAL Y PATRÓN DE RESIDENCIA DE lAS POBLACIONES CHINCHORRO. INDICADORES RECOLECTORES

DE UNA TEMPRANA OCUPACIÓN DE CAZADORES

QUE HABITARON EL DESIERTO COSTERO DE ATACAMN Iván R. Muñoz Ovalle y Bernardo Arriaza*

RESUMEN Se describen y comentan nuevas evidencias de carácter bioantropológico y cultural de las poblaciones arcaicas. Estos antecedentes permiter ahondar en las estructuras organizativas de los cazadores recolectores que poblaron la costa desértica del extremo norte de Chile entre el

seventh and fourth millenia before Christ. The discussion is based on the evidence of the Chinchorro tradition which is characterized by artificially mummified remains and evidences from camps distributed between the coast and the lowland valleys along the Pacific.

PAIABRAS CLAVE

séptimo y el cuarto milenios antes de Cristo. La exposición se centra en las evidencias de la traEnterramientos,

dición Chinchorro que se caracteriza por cuerpos momificados artificialmente y restos de campamentos distribuidos entre el litoral y los valles

momificación,

cadores, recolectores

población,

pes-

y cronología.

bajos del Pacífico. IMPORTANCIA DEL MAR La información arqueológica especifica que 10000 a.C. la costa del Pacífico, en Sudamérica, era un ecosistema productivo que permitía una temprana adaptación humana. Según Lanning (1967), esta potencialidad del mar ayudó a que se establecieran asentamientos que sirvieron de base para la estructuración de niveles socioculturales complejos como los que se hallan en la costa central y norte de Perú. Moseley (1975) ha

ABSTRACT This article describes and discusses new bioanthropological and cultural evidence of archaic populations. These antecedents investigation of the organizational

permit the structures of

hunter-gatherering groups who lived along the coast of the far north of Chile between the 1 En este trabajo se presenta una síntesis de los usos funerarios y habitacionales de los cazadores, pescadores y recolectores asentados en la costa norte de Chile. La investigación se realizó con la colaboración del doctor Bernardo Arríaza y del licenciado Juan Chacama. Se contó con el apoyo para dibujar y fotografiar de José R. Rocha y con el apoyo computacional de Sandra Pickert. * Universidad de Tarapacá, Arica, Chile.

planteado que este ecosistema proveyó la base de sustentación de tempranos desarrollos culturales, entre ellos, por ejemplo, los de la costa norte del Perú como Huaca Prieta, las Haldas, etc., a pesar de las alteraciones climáticas producidas por la corriente de El niño cada cierto tiempo.

107


IvÁN R. MuÑoz

OVALLE

y

En el norte de Chile, la explotación del mar

BERNARDO

ARRiAZA

En el presente trabajo se analiza la adaptación de los grupos cazadores recolectores en el desierto costero; para tal efecto se aborda en primer lugar el sistema de momificación artificial practicado a los miembros fallecidos de las

llevada a efecto por los cazadores recolectores se remonta según datación de radiocarbono a 7000 a.C.; dicha actividad se complementaba con los recursos provenientes de la caza y la recolección terrestre. Esta prolongada adaptación a la vida marina les permitió alcanzar desde muy

tempranas poblaciones arcaicas conocidas como Chinchorro. En segundo lugar se evalúan los campamentos y residencias tempranas, y con tal información se intenta explicar el modelo de explotación sobre la base de la complementariedad del espacio. Mediante el análisis de estos dos indicadores pretendemos conocer el

temprano un conocimiento tecnológico especializado, como en la elaboración de anzuelos de espinas de cactáceas, conchas y en la confección de arpones con barbas trabajadas en hueso, instrumentos de los 'cuales se valieron para subsistir en forma conveniente (Llagosteras, 1989; Muñoz,1993).

proceso de asentamiento alcanzaron las poblaciones costa desértica de Atacama.

En un medio donde la explotación de los recursos naturales era compleja, las poblaciones de la costa tuvieron que haber estado integra-

y desarrollo que Chinchorro en la

das, por lo cual se había formado la unidad del grupo. Posiblemente los cuerpos momificados artificialmente sean un testimonio de esta inte-

RITUAL Y PRÁCTICAS

gración social: aparecen enterrados colectivamente, constituyéndose en posibles testimonios de grupos de familias, estructura social sobre la cual se habrían organizado estas tempranas poblaciones de pescadores y recolectores marinos.

Comas (1975) señala que diversos pueblos en distintas partes del mundo y en variadas épocas han practicado la momificación y que estas prácticas responden a finalidades de orden psíquico. Sostiene que para una determinada comu-

Figura 1. Momia Chinchorro procedente de la costa de Camarones y que presenta máscara de barro recubierta por hilados de lana y fibra vegetal.

Figura 2. Momia Chinchorro procedente de la costa de Arica, recubierta con barro y arena.

DE MOMIFICACIÓN

108


MOMIFICACIÓN

Figura 3. Recreación Chinchorro.

ARTIFICIAL

Y PATRÓN DE RESIDENCIA

artística de la elaboración

DE LAS POBLACIONES

de una momia de preparación

nidad humana no se puede hablar de una única y exclusiva técnica de momificación. El hombre

CHINCHORRO

---

complicada de la cultura

manera de peluca; cubrían el cuerpo con la misma pasta que se usaba para el relleno y sobre ella moldeaban los órganos sexuales, la nariz, los ojos y la boca; superficialmente se aplicaba una pintura negra de manganeso obtenida de arena mezclada con agua; finalmente, e) las

ha recurrido al uso de distintos materiales y variadas técnicas sin exclusividad espacial ni temporal. En el continente americano tal rasgo tiene una an)igüedad de 3000 años a.e. y se relaciona con los hallazgos del norte de Chile, lo cual constituiría, según Comas, un rasgo de creación independiente muy propio de las culturas costeras precerámicas. Al respecto Uhle (1919) planteó las primeras discusiones en torno a la momificación artificial. Denominó a las poblaciones que practicaban dicho ritual aborígenes de Arica. En estos grupos encontró tres tipos de momias: a) las de tipo simple, sin tratamiento interno del cuerpo; b) las de preparación complicada: el cráneo era rellenado con arcilla y ceniza y luego se le amarraba la mandíbula con cordeles de caña de totora; con maderas articulaban las extremida-

Figura 4. Esquema de la tipología de momias Chinchorro. De izquierda a derecha, negro, vendada, roja y con patina de barro.

des al tronco; luego, semejando una venda, colocaban la piel y adherían el pelo al cráneo a

109


IVÁN R. MUÑoz

cubiertas de barro sin tratamiento los cuerpos.

interno

OVALLE y BERNARDO ARR1AZA

de

terrazas

de las desembocaduras

de los ríos.

Uno de los aspectos culturales más interesantes es su complejo sistema funerario: alrededor de 5000 años a.C. comenzaron a momificar artificialmente a sus muertos.

Posteriores estudios como los .de Álvarez (1969, 1995-1996), Aufderheide et al. (1993), Bittman (1982), Focacci (1974), Guillén (1993), Munizaga (1980), Muñoz et al. (1993), Núñez (1969,1983), Rivera (1975, 1992), Schiappacasse y Niemeyer (1984), Standen (1991,1997) y Vera (1982) aportan nuevas evidencias sobre las prácticas de momificación, patologías, características físicas, tecnologías, recursos alimentarios,

Manufacturaron

variados

instrumentos

de

pesca, como anzuelos de conchas y cactáceas, pesas líticas y tejidos de fibra vegetal confeccionados con técnicas de malla. Además fabricaron cestas tejidas en junquillos y totora, y esteras, con las cuales en algunas ocasiones cubrieron

campamentos, fechados, etc. Analizan quiénes fueron, dónde se ubicaban y cómo era la cultura material de estos tempranos pescadores. En la mayoría de estos trabajos se asume que la gente de Chinchorro habitaba la costa del desierto de Atacama desde el sur de Perú hasta Antofagasta, al norte de Chile.

los cuerpos de sus difuntos y en otras las ramadas o chozas donde vivían. Allison et al. (1984), basándose en la clasificación propuesta por Uhle (1919), definen en el cementerio de la costa de Arica Morro 1 varias subcategorías de los tres tipos básicos relacionados con el método de momificación. En el tipo o grupo 1 distinguen tres subtipos según presenten los cuerpos una o varias cubiertas de fibra vegetal; hay asimismo cuerpos cu15iertos

La costa de Arica-Camarones, espacio que abarca una extensión de 80 km, estaba habitada por gente que se ubicaba cerca de los afloramientos de aguas dulces en la costa o en las

por piel y lana de camélidos, y también por piel y plumas de pelícanos. El grupo 2 incluye cuatro subgrupos de cuerpos que fueron descuerados y se les extrajeron las vísceras y los huesos fueron descarnados. En el subtipo 2.1 hay reforzamiento de palos, envueltos en fibra vegetal; los cuerpos se rellenaban con material orgánico compuesto por fibras vegetales, plumas, cenizas, arena y cueros de mamíferos marinos; finalmente se modelaban con arcilla y se pintaban con manganeso negro. El subtipo 2.2 lo constituyen cuerpos pintados con ocre rojo, cuyo cráneo se rellenaba con fibra vegetal, arcilla y material orgánico diverso (cenizas, plumas y fibra vegetal). En el subtipo 2.3 están los cuerpos vendados: la piel se cortaba en tiras de 1 a 2 cm de ancho y se reponía a modo de vendaje en todo el cuerpo, se le recubría con arcilla negra y se colocaba una mascarilla facial. En el subtipo 2.4, los cuerpos presentan incisión abdominal; las extremidades fueron tratadas parcialmente y se usaron pelucas y mascarillas faciales de color negro. El grupo 3, según Allison et al. (1984), estaba constituido por dos subtipos que presentan

Figura 5. Estructura interior de una momia Chinchorro, procedente de Arica.

110


---

MOMIFICACIÓN ARTIFICIAL Y PATRÓN DE RESIDENCIA DE LAS POBLACIONES CHINCHORRO

cuerpos rellenados con arena blanca sin reforzamiento de maderos; algunos fueron secados con fuego sin remoción de pie! ni de huesos. Para Allison el al. (1984), Schiappacasse y Niemeyer (1984), Standen (1991) y Arriaza (1994), tanto las momias Chinchorro de la costa de Arica como las de la desembocadura de Camarones fueron inhumadas después de un complejo proceso que comprendía meticulosas incisiones para extraer los órganos internos. El cerebro de los cadáveres se extraía por la base del cráneo y e! cuerpo seco se envolvía cuidadosamente en esteras de junquillos. El trabajo hecho en el moldeado de arcilla sobre el cuerpo y el rostro esculpido otorgaba a estos cadáveres la apariencia de un ser vivo. Esto hace suponer a Arriaza (1995) que tales momias fueron objeto de culto; piensa que permanecían junto a sus descendientes vivos para que se les venerara en ocasiones especiales; supone que tal vez fueron el puente que unía a los vivos con el mundo de los espíritus adonde entran los muertos. Muchas momias presentan arreglos elaborados para tenerlas presentables ante e! entierro final. Según Arriaza (1994), la veneración de las momias fue un fenómeno

Figura 7. Momia Chinchorro procedente de la costa de Arica (foto de Enrico Ferorelli de la revista Nalional Geographic).

bajo comunitario: se iniciaba separando la cabeza del cuerpo y extrayendo las vísceras; luego, usando algún instrumento filoso, removían la

conocido en los An-

des en época tardía. Los incas, por ejemplo, veneraban los cuerpos desecados de los ancestros. Las momias se consideJaban huacas o entes poderosos que tenían el poder de dar fertilidad, buenas cosechas y felicidad. Desde el punto de vista mágico religioso, las momias conectaban al mundo real con el sobrenatural de los espíritus. La momificación, según Arriaza (1995), fue un tra-

piel, el cerebro y los ojos, pero dejaban intactos los pies y las manos. Respecto al color empleado en el modelaje del cuerpo, Arriaza (1994) asegura que las momias negras fueron las más antiguas y las más complejas; este estilo comenzó alrededor de 5000 a.C. y perduró casi dos milenios. Se trata

Figura 6. Vista de perfil de una momia recubierta vegetales y arcilla roja.

111

por fibras


IVÁNR. MuÑoz OVALLEy BERNARDO ARR1AZA can las técnicas de momificación: los cuerpos comenzaron a cubrirse simplemente con una pátina de barro hecha de arena y extracto de pescado que al endurecerse quedaba como cemento y ayudaba a prevenir la descomposición. Hacia 1500 a.C., las poblaciones costeras abandonaron la práctica de la momificación artificial y la remplazaron por un nuevo patrón de entierro, en el cual los cuerpos se enterraban con las piernas flexionadas y se momificaban naturalmente debido a la acción desecante del desierto.

NUEVAS EVIDENCIAS DE ENTIERROS COLECTIVOS MOMIFICADOS EN LA COSTA DE ARICA Y CAMARONES La costa de Arica y Camarones se ubica en las coordenadas geográficas 19° 12 de latitud sur y 70° 17 longitud oeste; específicamente /corresFigura 8. Momia Chinchorro procedente Morro 1, Arica (foto de Enrico Ferorelli).

del sitio

de cuerpos reensamblados casi como una estatua, es decir, un cuerpo rígido con una estructura interna confeccionada con palos, cuerdas de totora y una pasta de ceniza para el modelado final. Arriaza (1994) supone que alrededor de 2800 a.C. el color negro que cubría la superficie de los cuerpos fue remplazado por el rojo; a partir de entonces y por cerca de mil años fueron pintados de color rojo ocre. El tratamiento de las momias rojas se realizaba sin una gran destrucción del cuerpo; en general, los órganos se removían por medio de incisiones. Para proporcionar rigidez al cuerpo se deslizaban maderos puntiagudos debajo de la piel y luego se rellenaban las cavidades y se añadía una larga peluca de pelo humano que se aseguraba con un casquete de arcilla. Después de cerrar las incisiones, el cuerpo era pintado con ocre rojo. Este estilo rojo aparece cerca de 2000 a.C. y perdura por casi mil años. Después del estilo rojo se simplifi-

Figura 9. Fase inicial del tratamiento de momificación (A1lison el aL, 1984).

112


---

MOMIFICACIÓN ARTIFICIAL Y PATRÓN DE RESIDENCIA DE LAS POBLACIONES CHINCHORRO

ponde al área costera en donde desembocan los ríos San José y Camarones, territorio que comprende actualmente el extremo norte de Chile. Estos espacios ofrecieron un ambiente favorable para el desempeño de las actividades manufac-

Los cuerpos corresponden a dos infantes de aproximadamente tres y cuatro años de edad y un neonato (edad fijada por su dentadura); su sexo no pudo ser determinado. El cuerpo 1, de tres años de edad, fue envuelto en una piel de camélido y llevaba puesto un faldellín ela-

tureras y alimentarias de las poblaciones cazadoras, pescadoras y recolectoras del litoral. Allí hemos hallado recientemente varios entierros asociados al complejo Chinchorro que presentan las siguien tes características. ENTERRAMIENTO

CHINCHORRO

---

borado con lana. El cuerpo 2 corresponde a un párvulo de cuatro años de edad y estaba sin vestimenta. En algunos sectores del cuerpo se aprecian sobre la capa externa de pintura negra que cubre la momia manchones de un color verdoso, mezcla de arcilla con óxido de cobre.

1

En este entierro colectivo se hallaban tres cuer-

El cuerpo 3 corresponde a un neonato y estaba a un costado del cuerpo 2; no presenta evidencias de vestimenta.

pos cubiertos por una capa de arena de 30 cm de espesor. No hay registros de ofrendas asociadas. Los tres presentaban una posición en decúbito dorsal orientado de norte a sur, adosados unos a otros; estaban depositados sobre una estera de fibra vegetal y mostraban momificación artificial correspondiente al tipo 2.1 definido

Cronología

por Allison eL al. (1984). El entierro estaba rodeado por un círculo de piedras, quizá' como indicador simbólico.

Dos fechamientos radiocarbónicos sitúan temporalmente a los cuerpos exhumados del sitio Chinchorro 1. Un fechado proveniente de un madero del cuerpo 1 indicó una datación de 6070 ± 285 a.P. Un segundo fechado proveniente de un madero del cuerpo 2 dio una fecha de

Figura 10. Cabeza de momia Chinchorro revestida por una mascarilla de barro con peluca, proveniente del sitio Chinchorro, costa de Arica.

Figura 11. Cabeza de momia Chinchorro revestida por una mascarilla de barro con óxido de cobre, en el sitio Chinchorro, costa de Arica.

113


IvÁNR. MuÑoz

OVALLE

y BERNARDO

5560 ± 175 a.P. Estos fechados fueron procesados en el laboratorio Krueger Enterprise Inc. (1989). Los fechados por radiocarbónicos obtenidos para los infantes del sitio Chinchorro 1, así como las técnicas de momificación son similares a lo observado en el sitio Morro I y denominado por AIlison el al. (1984) subtipo 2.1. Se trata de cuerpos manipulados

ARRIAZA

te compleja, cuyo resultado final es practIcamente un esqueleto modelado con arcilla y piel. Externamente están pintados de negro con óxido de manganeso. A su vez, son similares a los descritos por Uhle (1919), que fueron hallados en las faldas del Morro de Arica. En su descripción hace referencia a la evisceración de las cavidades del cuerpo y de la masa encefálica, al relleno de arcilla y sustancias orgánicas, y final-

en forma extremadamen-

e

f

U g

h

a

b

a) Dardo y estólica b) Arpón para mamíferos marinos c) Arpón para peces d) Potera para cefalópodos y cardúmenes e) Instrumento mariscador (Chope) f) Anzuelo compuesto g) Anzuelo simple h) Instrumentos líticos para faenar mariscos, peces mamíferos

y

Figura 12. Equipo técnico usado por pescadores de los periodos Arcaico y Formativo, del norte de Chile. Información tomada de Cultura de Chile, Prehistoria, p. 62, fig. 2, 1989.

114


---

MOMIFICACIÓN

ARTIFICIAL

Y PATRÓN

DE RESIDENCIA

DE LAS POBLACIONES

CHINCHORRO

---

mente al remodelado del cuerpo y de la cara. Esta descripción concuerda con lo observado por Allison el al. (1984) en el mismo sitio y tam-

los contextos de Chinchorro 1 evidencian que entre el cuarto y el tercer milenio antes de Cristo la momificación artificial alcanzó el más

bién a los hallazgos descritos por Núñez (1969) para el área de Pisagua, cuyas fechas radiocarbónicas alcanzan 3000 a.e. Otros cuerpos con

alto grado de desarrollo (Muñoz, 1985). A este complejo sistema de momificación, Rivera y Rothhammer (1986) le denominan fase II; sin

similar tipo de momificación corresponden a las descritas por Vera (1982), cuyos hallazgos provienen de la costa sur de Arica. En síntesis,

embargo, este planteamiento nos parece demasiado débil, puesto que carece de un análisis cuantitativo y cualitativo que permita evaluar si

Figura 13. Recreación de enterramiento colectivo. Adultos y nil10s rodeados de ofrendas trabajadas en fibra vegetal, totora y osamentas de cetáceos. Sitio Morro 1, Arica (foto del Laboratorio de Antropología Física, Museo Arqueológico San Miguel de Azapa, Arica, Chile).

115


IvÁN R. MUÑOZ OVALLE y BERNARDO ARR1AZA

hay diferencias culturales creación de estas fases. ENTERRAMIENTO

significativas para la

Cronología Dos fechados radiocarbónicos sitúan temporalmente el hallazgo de Camarones 17. Uno, provenien te del cuerpo 3, dio una fecha de 6780 ± 110 a.P. El otro fechado, proveniente del cuerpo 4, dio una datación de 6930 a.P. Ambos fechados fueron obtenidos de maderos utilizados en el proceso de momificación; éstos fueron procesados en Krueger Enterprise lne. (1989).

CAMARONES 17

En la base del depósito del sitio Camarones 17 fue hallado a una profundidad de 2 metros un fardo funerario que contenía el cuerpo de un adulto de sexo femenino y los de tres lactantes. La estera que los cubría fue confeccionada en fibras vegetales (twining). El cuerpo del adulto se hallaba en el centro del fardo, con la cabeza alte-

El enterramiento Camarones 17 corresponde a la unidad de entierros descritos por Schiap-

rada probablemente posmortem. Los cuerpos de los lactantes estaban ubicados de la siguiente manera: orientado hacia el lado sur del cuer-

pacasse y Niemeyer (1984) para la desembocadura del río Camarones, específicamente a las inhumaciones múltiples que conforman los en-

po del adulto se halla el cuerpo del lactante 1; su ubicación más exacta es a la altura del pecho del adulto; presenta un hilado de algodón en la frente a modo de cintillo. Orientados hacia el

el adulto no fue pro-

tierros 8, 9, 13, 15, 19, 20, 21 y 22 del Cementerio Camarones 14. Estos entierros múltiples probablemente consistieron en grupos familiares (Schiappacasse y Niemeyer, 1984: 8790). Una datación obtenida del entierro número 21 arrojó una fecha de 5050 a.C. El entierro Camarones 17, al igual que los h41lados en Camarones 14, forma parte de las inhumaciones primarias según la denominación de Schiappacasse y Niemeyer, en la cual los individuos jóvenes y adultos se hallan envueltos en esteras o sus cuerpos yacen en posición extendida. En cambio, a los neonatos o lactantes se les practicó un tratamiento diferente antes de

cesado de la misma manera; sin embargo, este cuerpo está cubierto por piel de mamífero marino.

su entierro, con un procedimiento elaborado y complejo de preparación del cuerpo. Rivera y Rothhammer (1986) atribuyen el tipo

Los cuerpos corresponden a: ella una mujer adulta de 39 a 40 años (cuerpo 1), edad basada en la sínfisis púbica. Los huesos se ven osteoporóticos y las cicatrices de parto que muestran los huesos coxales no son muy pronunciadas. La dentadura presenta un fuerte desgaste como consecuencia de una dieta abrasiva y tal vez de su uso en la manufactura de artículos domésticos. El cuerpo 2, lactante 1, es un neo-

de entierro de los neonatos o lactantes a la fase 1, de acuerdo con el desarrollo evolutivo que alcanzó la cultura Chinchorro a través del tiempo. Integraron además esta fase el nivel temprano de Morro 1, denominado por Allison et al. (1984) tipo 2 (subtipos 2.1 Y2.2). En este tipo se practicó un tratamiento interno y externo al cuerpo en las cavidades torácica, abdominal, pélvica y craneana y en las extremidades. Otros entierros vincu-

nato de nueve meses de edad cuyo sexo no pudo ser determinado. El cuerpo 3, lactante 2, es un recién nacido de sexo masculino (basado en genitales); su estatura reconstruida es de

lados con esta primera fase serían los cuerpos descritos por Bird (1943) en Pisagua y Arica (sector de Quiani) correspondientes al segundo periodo precerámico; son cuerpos momificados con la técnica de preparación complicada, que frecuentemente se practica en lactantes e infantes.

lado norte del cuerpo del adulto se hallan dos cuerpos de lactantes igualmente ubicados a la altura del pecho. Estos cuerpos llevan mascarillas faciales de color rojo. Las mascarillas de los lactantes presentan diseños de los ojos, la nariz y la boca que las convierten en verdaderas manifestaciones artísticas. A diferencia de los tres lactantes, que presentan momificación artificial del tipo 2.2 de Allison et al. (1984),

46 cm. El cuerpo 4, lactante 3, es un recién nacido, cuyo sexo no pudo ser determinado.

116


---

MOMIFICACIÓN

ARTIFICIAL

PROCESO LIMPIEZA ENllERRO

Y PATRÓN

DE RESIDENCIA

DE lAS POBLACIONES

CHINCHORRO

---

1. DEPOSITO CAMARONES

17 ~------------,

Cuerpo núm. 3 niño

Cuerpo núm. 4 niño

Pies

b

PERFIL ESTRATIGRÁFICO DEPOSITO CAMARONES SE

PARED SUR

17

SO

Entierro 2

o

Entierro 1

1

IiLiiI!!!!5;;;;1!!!!5;;;;1!!!!!'!"'!!!'!"'!!!'!"'!!"!!!!!1

Figura 14. Entierro

colectivo y estratigrafía

117

m

en un depósito del sitio Camarones

17.


IvÁNR. MuÑOZOVALLEy BERNARDO ARRIAZA ENTERRAMIENTO CNv.ARONES8

pos de la desembocadura

En la base del estrato 6 del depósito Camarones 8 fue hallado a una profundidad de 1 m el cuerpo extendido de un infante de 87 cm de largo en posición de decúbito dorsal. Esta inhu-

como consecuencia de que algunas poblaciones. más conservadoras pudieron haber seguido prac-

del río Camarones

ticando la momificación, a diferencia de otros que fueron modificando el ritual de la muerte, cambio que pudo obedecer a la adopción de una concepción ideológica distinta.

mación corresponde a la momia de un niño de dos años de sexo masculino (basado en genitales). El tipo de momificación fue natural, es decir, debido a las condiciones medioambientales de sequedad y sanidad del suelo. Desde los pies hasta las rodillas, sus extremidades aparecieron envueltas por dobles hilados manufactu-

La expresión final de este complejo sistema de momificación tiene sus antecedentes en el cementerio Camarones 15, sectores C y D, donde se han encontrado cuerpos en posición extendida que aún conservan mascarillas de barro

rados en lana. La cavidad torácica estaba destruida y presentaba restos de plumas de especies marinas. El rostro y parte del cráneo estaban

en el rostro (Rivera et al., 1974; Muñoz et al., 1991), con fechas que corresponden al primer milenio antes de Cristo. Con posterioridad apa-

cubiertos por una capa de pigmentación roja y el cráneo conservaba el cuero cabelludo. Este cuerpo llevaba como ofrenda a la altura del crá-

recen nuevos rasgos funerarios y ofrendas cuya característica es la posición de decúbito lateral o dorsal con las piernas flexionadas, asociada a

neo un dardo de madera de 40 cm de largo ornamentado con plumas y embarrilados con hilados de lana. Además se encontró una aguja de espina de cactácea.

un ajuar funerario que ya durante el primer milenio antes de Cristo presenta nuevas manufacturas (cerámica, metales, etc.) , la incorporación de productos vegetales a la dieta alimentaria

Datación

(maíz, mandioca, camote) y la presencia de nuevas prácticas rituales que evidencia el uso del

Un fechado radiocarbónico proveniente de la muestra de músculo sitúa temporalmente al cuerpo en 4635 a.P. Este fechado fue procesado por Krueger Enterprise Inc. (1989).

complejo alucinógeno. Esta situación refleja un nuevo modelo de vida que a la larga se traducirá en la emergencia del poblamiento aldeano con un cambio del modelo económico apropiatorio hacia otro básicamente productivo (Muñoz, 1980, 1983).

El entierro de Camarones 8 debe formar parte de la fase final de la momificación artificial, puesto que el cuerpo no tiene un grado de sofisticación semejante a los de los sitios Chinchorro 1 y Camarones 17, aunque presenta envolturas en las piernas con hilados de lana y

FORMAS DE ORGANIZACIÓN GRUPAL QUE SE INFIEREN DEL ESTUDIO

una capa de pigmentación roja en el rostro. Este cuerpo no tuvo momificación artificial y las ofrendas asociadas son un dardo y una aguja de cactácea. Similares evidencias a las de este entierro, aunque con fechas más tardías, se hallaron en la costa de Arica en el cementerio Morro

DE LOS ENTIERROS SIMBOLISMOEN LOS ENTIERROS DE LOS RECIÉNNACIDOSY PÁRVULOS El enterramiento de Camarones 17 ofrece en primera instancia una posibilidad de análisis sobre las evidencias funerarias y de simbolismo

6 y en Playa Miller 8 (Focacci y Chacón, 1989). Sin embargo, en algunos entierros de este último cementerio aún está presente el tratamiento de momificación artificial. Esto nos lleva a

que encierra y permite conocer una parte de las concepciones de estas tempranas poblaciones. Está constituido por una mujer adulta (de 39 a 40 años) y tres lactantes. Esta unidad es bastante particular porque los tres lactantes están

suponer que en la costa de Arica el proceso de momificación perduró más que entre los gru-

118


---

MOMIFICACIÓN

ARTIFICIAL

Y PATRÓN DE RESIDENCIA

DE LAS POBLACIONES

CHINCHORRO

PLANTA DEPÓSITOCAMARONES8 N

NO EXCAVADO

NO EXCAVADO

cll

o __

.pc.)....l -----i-'=c2"------j-'=c3'---~--=.r_t::....,,:::_::iIIIIIII.

--'---+----E o O

<

c26

i<' !;;! LU

O Z

NO EXCAVADO

as

o i;;;¡¡¡iiiiiiiil!!! ••••

s

1 !!!!!!!!!l'm

PERFIL ESTRATIGRÁFICO, CORTEEJEESTE- OESTE

o

Concesión

de ceniza

ml

Entierro 1 Fogón

Restos calcáreos

Figura 15. Planta y perfil del depósito sitio Camarones

119

S.

de camarón

---


IvÁN R.

MuÑOz

OVALLE

y

dispuestos sobre los brazos de la mujer, a mane-

BERNARDO ARRIAZA

tica hubiese una madre ceremonial, a quien llama "madre adoptiva", que se encarga seria-

ra de abrazo; los tres aparecen dirigiendo sus rostros hacia el tórax de ella, es decir, hacia la

mente de los deberes que libremente puesto (Gusinde, 1982).

zona de los pechos, lo cual da un carácter simbólico a la postura y alude al concepto de maternidad.

se ha im-

Al margen de que el hallazgo resulta interesante en su aspecto físico, estas inhumaciones colectivas implican indudablemente una con-

Se puede pensar que el grupo constituya un grupo familiar "simbólico" compuesto por la

cepción de unidad de grupo en la que tal vez las mujeres de edad avanzada desempeñaban un papel preponderante y así se constituían en individuos con cierto estatus dentro de su co-

madre y sus hijos; este tipo de entierro colectivo es similar a otros hallados eñ la misma desembocadura de Camarones (Schiappacasse y Niemeyer, 1984) yen la zona del Morro de Arica

munidad, pues en ellas recaía la responsabilidad de atender los partos y la consecuente preparación de los infantes para incorporarlos al mundo y a la socialización. En lo que respecta a los lactantes e infantes, es probable que el proceso de momificación al que fueron sometidos haya estado vinculado con el ritual de la muerte como una forma de

(Standen, 1991). Los análisis antropológicos físicos indican que las cicatrices de parto en la pelvis de la mujer son muy pronunciadas, lo que indica que pudo haber tenido uno o dos partos. Cabe preguntar al respecto sobre la relación genética o social que pudo existir entre ellos;

evidenciar lo que ellos representaban: 1", continuidad de la existencia de la banda o infancia protegida a perpetuidad por los vivos. La presencia de lactantes y párvulos momificados es una constante en varias de las poblaciones estudiadas, incluida la momificación de fetos (Munizaga y Martínez, 1961; Álvarez, 1969; Standen,

sin embargo, aún no es posible determinar su parentesco. Desde el punto de vista social, la hipótesis necesariamente nos lleva al campo de las estructuras del parentesco que pudieron haberse generado en las poblaciones arcaicas de la costa del Pacífico. La edad de la mujer nos lleva a pensar en la posibilidad de que mujeres de edad avanzada en las poblaciones Chinchorro desempeñaran un papel de enseñanza sobre la crianza y cuidado de los niños. Esta relación habría permitido que se fortaleciera un paren-

1997). Sobre ello Standen

(1997) refiere que

en el sitio Morro 1, estos procesos se habrían iniciado alrededor de 5000 a.e. con el tratamiento de los cuerpos de fetos, neonatos, lactantes y niños, y habrían concluido con un tratamiento semejante de la población infantil después de 2000 a.e., lo cual manifiesta la importancia que tuvieron estas prácticas a lo largo de tres milenios en la población infantil de los Chinchorro.

tesco de tipo ceremonial entre la población infantil y las madres adoptivas, concepto que probablemente fue simbolizado en entierros como el de Camarones 17. Para reforzar esta hipótesis hemos tomado algunos antecedentes etnográficos referidos a las poblaciones Yámanas, ubicadas en el extremo sur del continente americano, estudiadas acuciosamente por el etnógrafo Martín Gusinde

A pesar de que aún falta evaluar y estudiar mejor los antecedentes en relación con las primeras prácticas de momificación, supone-

y descritas en su obra Habitantes de Tierra del

mos que en el caso de la desembocadura del río Camarones este proceso de momificación pudo haberse realizado inicialmente sólo en los lactantes y párvulos, ya que los cuerpos de los adultos hallados en estos entierros no presentan dicho tratamiento. El éxito material y espiritual logrado en la unidad y en la satisfacción de las

Fuego (1982). Es un referente adecuado porque su actividad económica giraba en torno a la pesca, la caza y la recolección marítima y terrestre, al igual que la de los grupos Chinchorro. Gusinde menciona que era costumbre entre los grupos yámanas que además de la madre gené-

120


___

MOMIFICACIÓN ARTIFICIAL Y PATRÓN DE RESIDENCIA DE LAS POBLACIONES CHINCHORRO

necesidades del grupo con la momificación de los niños debió influir para que con el tiempo esta práctica cultural se hiciera masiva, expandiéndose a todo el grupo y transformándose así en algo común, obra de especialistas que debieron interactuar en los diferentes grupos de pescadores que practicaban la momificación artificial a lo largo de la costa del norte de Chile.

EL CASO CHINCHORRO Uhle (1919) Y Mostny (1944), tras analizar los enterramientos de los aborígenes de Arica, suponen que esa población debió haberse organizado en clanes o familias y plantean que la momificación artificial es un claro testimonio de la fuerte cohesión social de los tempranos grupos de cazadores recolectores que poblaron la costa de Arica, ya que el embalsamiento de los

EL RITUAL DE LA MOMIFICACIÓN COMO ELEMENTO DE IDENTIDAD

cuerpos permitía la conservación del cadáver, al cual rendían culto, fortaleciendo de esta mane-

DE LOS GRUPOS CHINCHORRO

ra las relaciones sociales de los miembros del grupo. A su vez, Núñez (1969), Álvarez (1969) y Focacci (1974) conjeturan que estos tempranos grupos debieron haber conformado una población reducida donde resaltaba la función de especialistas en el tratamiento de la momificación artificial.

CONCEPTOS

GENERALES

DEL RITO DE LA MUERTE

Toda la sociedad lamenta la muerte de uno de sus integrantes, pero el tratamiento funerario y el del cuerpo responden a los conceptos propios de las creencias y cosmovisión sobre la otra vida que cada grupo puede tener. La práctica de la preservación del cuerpo parece muestra inequívoca de la creencia en un mundo espiritual y eterno para el cuerpo y el alma (Malinoski, 1955; Binford, 1971); tan es así que los 4000 años que duraron los ritos y prácticas de momificación en Chinchorro refuerzan la idea de que esta práctica cultural pudo ser producto de una verdadera doctrina escatológica para la cual el tratamiento del cuerpo físico (momificación) era un elemento fundamental para alcanzar la inmortalidad, y además un rito necesario para lograr la identificación total con el grupo, elemento cultural básico en el desarrollo integral del individuo como persona social (Arriaza,

Si bien, tales observaciones son de carácter deductivo e hipotéticos, cabe dastacar estos primeros 'intentos de análisis de la organización de estas sociedades, puesto que las características de los hallazgos y la forma en que aparecen llevan a reflexionar sobre el comportamiento social de los grupos arcaicos. Posteriormente se ha mantenido el interés en el problema y se ha planteado dentro de un marco teórico donde caben, entre otros, los trabajos de Binford (1971) y Tainer (1979), quienes, apoyados por las fuentes clásicas de la literatura antropológica y las evidencias etnográficas, aseguran que en las culturas arqueológicas el ritual mortuorio está directamente en función de la diferenciación social de los difuntos, es decir, la cantidad de energía gastada dependerá de la posición social que ocupe el individuo. Sin embargo, es más fácil apreciar tal modelo en las sociedades com-

1995). Por otro lado, también se debe considerar el impacto que tiene la muerte de uno de los integrantes de una sociedad arcaica de tamaño reducido como la de Chinchorro. El fallecimiento de uno de los miembros amenaza la cohesión y

plejas que en las igualitarias. Basándose en los estudios citados y tomando como referencia la cultura Chinchorro, Bittman (1982) observa que el tiempo y la energía empleados en la preparación de los cuerpos momificados son indicativos de que en el interior de estos grupos de pescadores había especialistas dedicados a efectuar el tratamiento de la

la solidaridad de todo el grupo, su existencia misma; por tanto, el acto funerario actúa en contra del miedo y de la desmoralización al producir una fuerte reunificación social (Malinoski, 1955).

121


IVÁN R. MuÑoz OVALLE y BERNARDO ARRIAZA

momificación, de tal manera que esta práctica sería un elemento de marcada significación en

EL MODELO HABITACIONAL DE LA CULTURA CHINCHORRO. ANÁLISIS DE DOS CASOS SOBRE

la cultura Chinchorro y, al mismo tiempo, un mecanismo muy importante para la interacción social.

EXPLOTACIÓN Y COMPLEMENTARIEDAD DEL ESPACIO

Schiappacasse y Niemeyer (1984) plantean la hipótesis de una temprana interacción social

Para estudiar el patrón habitacional y las formas de adaptación de las tempranas bandas de

de dos agrupaciones: una de cazadores recolectores marinos y otra de cazadores de pumas de los andes, ambos grupos asentados en un mismo espacio territorial en la desembocadura del río Camarones. Suponen que dicha interacción probablemente se dio en una situación de control social de territorialidad. Uno de estos grupos lo habrían conformado las poblaciones Camarones 14, cuya base eran las familias nucleares; el otro pudo haberlo constituido el asentamiento Camarones Punta Norte, caracterizado por poblaciones que no practicaban la momificación de los cuerpos y en cuya industria lítica

pescadores y recolectores Chinchorro a lo largo del litoral y las desembocaduras de ríos, hemos considerado dos fuentes de análisis: la primera se relaciona con el hallazgo de un campamento de pescadores arcaico, Quiane 9, ubicado en la costa sur de Arica, asentamiento que tiene nexos con el campamento Acha 2, ubicado en la confluencia del valle de Azapa con la quebrada seca de Acha; la segunda fuente corresponde al campamento Camarones 8 ubicado en la desembocadura del río Camarones y vinculado con el emplazamiento habitacional Conanoxa W-b, que se sitúa en la quebí-ada de

predominan las puntas de forma lanceolada asociadas a la caza de camélidos (Dauelsberg et al., 1971).

Camarones y está a 28 km de la desembocadura de Camarones. Para suponer esta relación en los asenta-

Rivera y Rothamer (1986) plantean que la organización sociopolítica de la tradición Chin-

mientos hemos considerado los componentes culturales encontrados en ellos y las dataciones radiocarbónicas obtenidas de los pisos de

chorro pudo haber estado conformada por cuatro o cinco familias nucleares con un jefe local; observan que las zonas de mayor concentración de población fueron las desembocaduras de los ríos. Rivera (1992) asegura que el significado de la momificación respondió a un "sentimiento espiritual" muy arraigado unidad del grupo. Podemos

concluir

que permitió

que la organización

ocupación. CARACTERÍSTICAS DE LOS CAMPAMENTOS Y UNIDADES DOMÉSTICAS TEMPRANAS

la

EN LA COSTA DESÉRTICA DE ATACAMA

Con la intención de entender el patrón habitacional de los tempranos pescadores, cazadores

de

estos tempranos cazadores y recolectores sugiere que se reunieron en grupos que mantuvieron una fuerte interacción, ejercieron control terri-

y recolectore~ marinos haremos una breve síntesis de las formas y de los materiales utilizados por las poblaciones de la costa y de los valles bajos del norte de Chile y el sur de Perú; pretendemos demostrar que a los 7000 años a.C., dicho espacio costero del Pacífico ya estaba po-

torial en las zonas de la costa y las desembocaduras; probablemente coexistieron con otros grupos de tradición cazadora y recolectora altoandina, y practicaron la momificación de los cuerpos desde temprana época, en un comienzo sobre los recién nacidos y después en todos los

blado por cazadores y recolectores. Uno de los campamentos más tempranos que se han reconocido es el sitio Las Conchas, ubicado en la costa norte de la ciudad de Anto-

miembros del grupo. Seguramente hubo especialistas con conocimientos en la manipulación de cadáveres y el arte de momificar.

fagasta, Chile. Este asentamiento data de 7700 a.e. y presenta una marcada orientación marí-

122


---

MOMIFICACIÓN

ARTIFICIAL

Y PATRÓN

DE RESIDENCIA

tima, basado en la pesca y en la recolección oceánica. Debido a esta especialización, sus moradas fueron construidas en terrazas cercanas al mar. Según Llagosteras (1979), su estructura habitacional fue muy rudimentaria, construida con una cubierta de cuero de mamíferos marinos y soportes de hueso tanto de cachalote como de lobos marinos. Este asentamiento es de carácter superficial; presenta una serie de elementos culturales probablemente de carácter simbólico, como los

DE lAS POBLACIONES

CHINCHORRO

---

quebrada de Jazpampa, Pisagua, cuyas fechas se acercan a 6710 a.C. (Núñez y Zlodar, 1978). Schiappacasse y Niemeyer (1984) describieron estructuras habitacionales con fechas que oscilan entre 2800 Y3000 a.C. en la quebrada de Camarones, a 28 km de la costa. Se trata del campamento Cananoxa Wb, constituido por estructuras de planta circular delimitada por una base de piedra. En el interior de estas estructuras hay registros de postación y fogones, lo cual constituye evidencia clara de que fue un área de asentamiento de cazadores y recolectores. En la desembocadura del río Camarones, igual que en la costa de Arica, los cementerios Chinchorro se hallan asociados a restos de ocupación doméstica, evidencias que llevan a suponer que los lugares habitacionales y los de entie-

litos geométricos, las puntas de proyectil y las pesas, confeccionados en material de arenisca. Por la materia prima utilizada, según Llagosteras (1979), estos artefactos pudieron haber estado relacionados con expresiones ideológicas más que haber servido como elementos funcionales. En la desembocadura del río Loa fueron encontradas algunas estructuras de forma semicircular en depósitos semisubterráneos. Su acceso consiste en estrechas entradas. Estas estructuras están recubiertas por cantos rodados, colocados en forma vertical. La datación de

rro ocuparon una misma área de asentamiento. El sitio Camarones 14 está conformado por densos estratos, entre los que se entremezcla una gran cantidad de fogones asociados con morteros y manos de moler, indicadores de actividad doméstica. Sin embargo, en estos estratos fueron

este sitio arrojó una fecha de 2200 a.C. (Núñez, 1971). El elevado número de estructuras encontradas, treinta, llevó a Núñez a suponer que corresponderían a un complejo semialdeano. Evidencias similares han sido halladas en Caleta Chacaya y Playa los Canastos, al norte de la ciudad de Antofagasta (Bustos,

hallados entierros Chinchorro, en que se hizo un tratamiento artificial a los cuerpos. En el extremo sur de Perú los antecedentes habitacionales del periodo arcaico se hallan representados en la quebrada de Osmore, Moquegua, específicamente en el sitio Asana. Allí Aldenderfer (1990) definió varios niveles en lo que

1974). )'or la variedad de pisos que presentan estas estructuras es posible pensar que fueron reocupadas periódicamente e incluso que en

llamó "arquitectura doméstica". Especifica que entre 8000 Y 7800 a.C. la arquitectura residencial se caracteriza por estructuras circulares de

algunas de ellas se depositaron entierros humanos, los cuales eran sellados con una gruesa y compacta capa de ceniza y restos orgánicos. Núñez y Moraga (1977- 1978) refieren que en la quebrada de Tiliviche, a 35 km de la costa, bajo el depósito de desperdicio del sitio Tiliviche 1b, se reconocieron pisos de ocupación que evidenciaban agujeros de postación y depósitos semisubterráneos (grandes bolsones) aso-

2 a 2.8 m de diámetro con postes exteriores y, en algunos casos, con un poste central; en el interior de las viviendas aparece un piso compacto con preparación intencional. Advierte que estas estructuras son similares a las de Acha 2 (Muñoz el al., 1993). Los fogones externos tienen un espesor de 2 a 4 cm. Entre 7800 Y 6800 a. C. predominan las viviendas de forma rectangular,

ciados a restos de fogón. Para dichos autores, estas habitaciones constituyen los primeros eventos ocupacionales en los sectores bajos de la quebrada de Tiliviche. Similares a éstos podrían ser los campamentos hallados en Aragón 1 en la

aunque hay también estructuras circulares y ovaladas. En algunos casos aparecen pequeños postes espaciados de manera irregular dentro y fuera de estas estructuras. Los pisos son de arena coluvial compactada. Ninguna de estas estructu-

123


IvÁN R. MuÑOZ ÜVALLE y BERNARDO

ARR1AZA

....... .-o-~ ...o ,',,'

~\

, ,,,

a,

,,

\......

",,,/ "'-----'"

~ O

Figura 16. Planta del sitio Acha-2. Reconstrucción

hipótetica

ras posee fogones, basurales o manchas de cenizas en su interior, pues estas evidencias sólo aparecen en el exterior de las estructuras.

2.5m

de una vivienda (Muñoz y Chacama,

nas estructuras

que funcionaron

1993).

como corra-

les, lo cual se reconoce porque hay postes espaciados ampliamente y una tierra mezclada con estiércol de camélido en forma compacta. En la costa de 110se halla un tempran6 asentamiento humano que data de 10 000 a.e. apro-

Entre 6800 y 4500 a.C., las estructuras se construyen de manera más cuidadosa; Aldenderfer (1990) detalla que las formas son circulares u ovales, con pisos de arcillas preparadas con o sin arena. Entre 4500 y 4000 a.e., las estructuras mantienen las formas circular y oval;

ximadamente, y que corresponde al sitio Sting Ring o Anillo. Richarson el al. (1990) aseguran que se trata de un asentamiento de cazadores recolectores marinos y que probablemente las moradas se construyeron en los mismos depósi-

los pisos son de arena, pero no compactados ni preparados; las estructuras están rodeadas por postes de forma irregular; en su interior encontramos poca acumulación de basuras. Entre 3000 y 2400 a.C. las estructuras son de forma rectangular o semiovales, cubren un área de 9 a

tos de basura, en forma similar a los de Quiani 9, Camarones 8 y Tiliviche lb, sobre la base de un foso u hondonada que fue recubierto con piedras lajas o cantos rodados a manera de muros y colocada una techumbre de cueros de mamíferos marinos o esteras de fibra vegetal. En la costa central de Perú, en el sitio Asia,

9.5 m2 y constituyen, a partir de este momento, las habitaciones más grandes del asentamiento. Estas estructuras se distinguen porque presentan dos alineaciones de postes. Añade Aldenderfer que es probable que estas estructuras tuvieran paredes y techos de ramas; las piedras utilizadas para preparar cocinas son frecuentes en el interior y muchas de ellas aparecen con la superficie quemada con restos de hollín. En el

se han encontrado estructuras de forma circular de 3 m de diámetro con postes y esteras de totora. Estos hallazgos llevaron a Engel (1963) a reconstruir

un patrón

de viviendas tipo cho-

zas cónicas, muy cercano a las formas que pudieron haber tenido las viviendas de Acha 2

exterior se han hallado fogones, restos de huesos y acumulación de cenizas. Entre 2400 Y 2000 a.C., las estructuras tienen formas irregu-

(Muñoz y Chacama, 1982). Las viviendas encontradas en el sitio La Paloma pudieron ser similares a las descritas por Engel; allí Benfer (1982) ha estudiado un temprano asentamiento carac-

lares y están rodeadas por postes y piedras; asociadas a ellas hay fogones exteriores, manchas de basura, amontonamientos de cenizas y algu-

terizado por chozas de planta circular. Las cubiertas de estas chozas al parecer estarían cons-

124


___

MOMIFICACiÓN

ARTIFICIAL

Y PATRÓN

DE RESIDENCIA

DE LAS POBLACIONES

CHINCHORRO

---

miento de esas tempranas poblaciones de la Quebrada de los Burros entre el mar y la cordillera. Otros asentamientos tempranos reciente-

truidas con fibra vegetal. Al igual que en Acha 2, en el sitio La Paloma los entierros fueron depositados en el mismo lugar donde se levantaron las viviendas. Este rito mortuorio reflejaría que desde muy temprano existió la concepción de la vida después de la muerte entre estos

mente datados corresponden a Quebrada Jaguay 280, sitio ubicado al norte de Camaná datado en 9105 ± 260 a.C. Según Sandweiss el al. (1998), corresponde a una ocupación de pes-

primeros pescadores recolectores. Recientemente Lavallée el al. (1999) han estudiado un asentamiento de pescadores recolectores correspondiente al periodo arcaico ubi-

cadores recolectores cuyo origen podría remontarse al Pleistoceno terminal. Otro sitio similar se halla en Quebrada Tacahuay, situado al sur

cado en la costa del extremo sur de Perú en la Quebrada de los Burros (Tacna, Perú). Allí fueron halladas varias áreas de combustión estruc-

de 110;los niveles inferiores de este depósito han sido datados en 8770 ± 150 a.C (Keefer el al., 1998). Según Lavallée el al. (1999), ambos sitios

turadas, junto a una amplia concentración de desechos líticos, evidencias residuales de instalaciones sucesivas dejadas por un grupo humano que llevó a cabo actividades domésticas. Estos

fueron fechados con muestras de carbón; sin embargo, a pesar de que tienen fechas tempranas similares Acha 2, Tiliviche lb y Aragón 1, aún falta por definir con mayor precisión las evidencias culturales y el patrón habitacional. Del análisis de estas estructuras habitaciona-

grupos se sitúan entre 7800 Y2 000 años a.C. La ocupación corresponde a una extensa área donde se hallan fogones, abundante material lítico tallado, acumulaciones de conchas marinas, vértebras y espinas de pescados. Si bien esta información es relevante para analizar los primeros

les que aparece en la literatura arqueológica podemos inferir que durante el periodo arcaico se estructuró un tipo de patrón de asentamiento constituido por viviendas de material ligero, cuyas características constructivas estuvieron determinadas por el medio donde se levantaban: en hondonadas cuando se encontraban en laderas de cerros y depósitos (conchales), y de base

eventos humanos en estos valles occidentales del área centro sur andina, aún es incierto si se trata de pescadores estables o si esos sitios eran paraderos dentro del circuito regular de desplaza-

Figura 17. Estructura

de cajeta HueJé42.

Reconstrucción

125

ideal de una estructura

(Llagosteras, 1989).


IvÁN R. MUÑoz

OVALLE y BERNARDO ARR1AZA

plana en las terrazas. Se utilizaban preferentemente cubiertas o esteras de vegetales en los

la terraza de Quiani, que cae abruptamente al mar. Las estructuras habitacionales fueron construidas en densos depósitos de basura; tienen una forma semicircular con una abertura orientada en dirección al mar. El sitio está pro-

valles y cueros de mamífero marino en la costa. Tal patrón habitacional fue una respuesta al modo de vida de estas poblaciones, las cuales se desplazaban constantemente entre los espacios costeros y los valles, logrando así un complemento de su dieta alimentaria y la obtención de diversas

tegido en su parte posterior por una cubierta ligera, dispuesta en un plano más alto, dando la espalda al cerro. Se trata de estructuras simples, abrigadas por paravientos hechos en cuero de mamíferos marinos. En el centro de éstas encontramos densos fogones con restos orgánicos de procedencia marina. Las unidades habitacionales aparecen separadas unas de otras, lo cual nos sugiere que se trató de un modelo habitacional

materias primas. Este patrón de viviendas que utilizó material perecedero, como fibras vegetales, huesos, piedras y cuero de mamíferos marinos, perduró durante todo el periodo arcaico y siguió arraigado en las caletas de pescadores hasta tiempos históricos, como lo describe Bibar (1566) al referirse a las viviendas tipo chozas construidas con huesos y cueros de lobos marinos por las poblaciones llamadas changos, que se

disperso. Este campamento en sus niveles iniciales presenta una datación radiocarbónica de 4500 a.e.

desplazaban a lo largo del litoral de lo que hoy en día es el norte de Chile.

AsENTAMIENTOS CIRCUITO

Objetos culturales. En los niveles primarios de ocupación fueron hallados en el interior de las estructuras varios tipos de artefactos culturales: anzuelos confeccionados en cactáceas y conchas, hilados y cordelería de fibra vegetal, puntas de proyectil de formas lanceoladas, raederas y raspadores. Estos artefactos líticos se trabajaron en calcedonia y, en menor grado, en obsidiana. También se hallaron morteros de lava volcánica y manos para golpear

y EXPLOTACIÓN DEL MEDIO.

DE MOVILIDAD ENTRE VALLE Y COSTA;

ANÁLISIS DE DOS CASOS

Primer caso El asentamiento Quiani 9 ubicado en el litoral de Arica, y en Acha 2 en la confluencia del valle de Azapa y la quebrada seca de Acha. Extensión total del territorio: 230 km2 (se incluye la caja del río, hasta el kilómetro 40 del

Restos económicos. El análisis de la flora y la fauna indica una mayor frecuencia de productos de recolección del mar, como moluscos y crustáceos, además de vértebras y otolitos; fue posible identificar especies como jurel, bonito y corvina. La presencia de mamíferos marinos que se aprecia en los restos de lobo marino, nutria y cachalote es indicadora de una actividad de

valle de Azapa). Cambio de altitud: de Oa 2000 msnm. Áreas ecológicas complementarias: costa, valle, cabecera del valle y sierra. Quiani 9. Según Muñoz y Chacama (1982), este sitio corresponde a un campamento ubicado en

8

KM.40

g

u

~ o z «

Vetas de obsidiana caza de camélidos

<U

u

o

Qda. de Acha

N

A

126


---

MOMIFICACIÓN ARTIFICIAL Y PATRÓN DE RESIDENCIA DE LAS POBIACIONES CHINCHORRO

caza, evidencia que se sustenta en otros elementos, como los arpones con que cazaron a dichos animales. Complementan las evidencias

turas de plantas de forma circular con agrupamientos de cantos rodados y palique tos marinos; tales agrupamientOs habitacionales se

de subsistencia algunos restos de caracoles, algas y palique tos marinos. Los vestigios de flora y fauna terrestre identificados corresponden a: totora, junquillos, caña, cactáceas, grama salada y cola de caballo. De la fauna terrestre se identificaron restos de pelaje de zorros, huesos de carné lid os y vizcachas, plumas y huesos de

distribuyen en forma dispersa, superficialmente se caracterizan por pequeños montículos de basura y en algunas estructuras aparecen restos de postación de maderos de sauce y molle. Una reconstrucción hipotética de estas viviendas las define como estructuras formadas por una cubierta o toldo de fibra vegetal. En la parte cen-

aves.

tral se hallan restos de los fogones utilizados para preparar la alimentación. Al igual que en Quiani 9, el patrón habitacional se caracteriza por la construcción de viviendas dispersas. Dataciones obtenidas de un fogón adosado a la estructura 11 sitúan cronológicamente el cam-

Circuito de movilidad. Tras el examen del sitio Quiani 9 podemos deducir que se trató de un asentamiento de pescadores recolectores y cazadores marinos que tuvieron acceso a una economía apropiatoria del valle de Azapa en su

pamento en 7020 a.C.

búsqueda de recursos de la fauna (camélidos, zorros, vizcachas, etc.) y la vegetación (totora,

Objetos culturales. Fueron hallados un cabezal de

junquillos, cañas, etc.). Además incursionaron hacia el interior del valle de Azapa tratando de encontrar calcedonia y obsidiana para elaborar artefactos. En este desplazamiento hacia el

arpón, ros de los de puntas

valle, la confluencia del valle de Azapa con la quebrada seca de Acha fue un paradero; allí se halla el campamento Acha 2, donde hubo una gran laguna, según las observaciones realizadas por Vázquez de Espinosa en 1617 (1948). Tal vez la explotación de esta laguna les habría

donia y en menor grado en obsidiana; algunos tipos muestran una forma triangular de base pedunculada, otros una forma romboidal; las pun-

permi~do desarrollar actividades de caza y recolección terrestre, como sugieren los artefac-

un individuo joven, cuyo cráneo estaba cubierto externamente por una estera de fibra vegetal e internamente presentaba una cubierta de piel de camélido; en el interior del cuerpo se encontraron otolitos, conchas de Choromithilus y fragmentos de lascas de obsidiana. La datación obtenida del músculo deL cuerpo arrojó una

tas sin pedúnculos

son lanceoladas y su base es

redonda. En este campamento

tos encontrados. Acha 2. Según ñoz (1993), el la terraza del de la costa de

una pesa de hueso para la pesca, mortelava volcánica de forma cónica, anzueespina de cactáceas, y variados tipos de de proyectil confeccionadas en calce-

Muñoz y Chacama (1982) y Mucampamento Acha 2, ubicado en mismo nombre, se halla a 6 km Arica. Allí se han hallado estruc-

se halló el entierro de

fecha de 7000 a.C.

N

1'\.

8 ¡¡:

KM. 40

ü

Cf. o Z <1:

'UJ

U

o

~taci6n recursos de flora y fauna terrestre

etas de obsidiana caza de camélidos

127


IvÁN R. MUÑoz

OVALLE

y BERNARDO

ARR1AzA

Restos económicos. En los restos de basura que conformaron los pisos habitacionales hallamos

tituir dos campamentos insertos en un circuito de complementación económica de caza y reco-

una alta proporción de restos de productos del mar, entre los cuales destacan los locos, lapas, caracoles, almejas, chiton es, choros, señoritas y

lección durante el periodo Arcaico, que comprendió la costa de Arica y la parte baja del valle de Azapa. Ambos sitios se encuentran a 6 km de

erizos, además de vértebras y espinas de pescado y plumas de aves marinas. Por otra parte, el estudio de componente químico que se realizó

distancia. En cuanto a su función, Acha 2 posiblemente fue un paradero, es decir, un campamento estacional, a diferencia de Quiani 9, al

sobre el hombre de Acha para determinar su dieta definió un consumo mayoritario de pescado y moluscos (Aufderheide, 1993). Estos antecedentes son indicadores de que el hombre de Acha aprovechó el litoral para la caza y la recolección. A esto se suma su empleo de productos del espacio del valle, documentado por la presencia de fibras vegetales (totora yjunquillos) y restos de piel de camélidos, probablemente guanacos. A la explotación del mar y del valle se aúna la del interior del valle para obtener materias primas como la calcedonia y la oh-

parecer más estable porque el mar era su fuente básica de recursos.

sidiana, que empleaban material lítico.

en la confección

Segundo caso El asentamiento Camarones 8, ubicado en la desembocadura de Camarones, y el de Conanoxa Wb, situado en el sector medio de la quebrada de Camarones. Extensión total del territorio: 200 km2 (se incluye la caJa del río). Cambio de altitud: de O a 1800 msnm. Áreas ecológicas complementarias: costa, valle y sierra. /

de

Circuito de movilidad. El campamento Acha 2 fue un asentamiento probablemente estacional, cuyos objetivos eran la caza y la obtención de vegetales en un sector del valle de Azapa, donde había recursos hídricos permanentes (vertientes) que favorecían un ecosistema propicio para las actividades apropiatorias; además era una estación clave para incursionar en el interior del valle en busca de canteras, de calcedonia y de obsidiana para la confección de artefactos. Con el interés de contemplar su economía, la población de Acha 2 debió incursionar hacia la costa, donde el sector de Quiani resultó un espacio adecuado para la explotación de los recursos marinos, ya que sus acantilados rocosos favorecen la extracción de mariscos y la pesca, Además, es el único lugar de la costa sur de Arica en donde se ha documentado la existencia de una aguada. Tras considerar las fechas que otorgan cierta contemporaneidad al rango más temprano de Quiani 9 y Acha 2, así como la similitud de la cultura material y sistemas constructivos de ambos asentamientos, pensamos que pudieron con s-

Figura 18. Basural o depósito de pescadores arcaicos. Acantilado sur en la desembocadura de Camarones, Primera Región Chile.

128


MOMIFICACIÓN

Sitios precerámicos

ARTIFICIAL

Y PATRÓN

DE RESIDENCIA

1. Acha17. Morro 1 ARICA 2. Quiani-

---

bría allí 2000 cuerpos (sin considerar los entierros en estratigrafía); sin embargo, debemos considerar los desaparecidos y accidentados y los grupos que se trasladaron o se enterraron en otro lugar de la costa, cuyo número sería similar o mayor que el de los que posiblemente se enterraron, es decir, aproximadamente 2500 personas.

y conchal de Pisagua

IQUIQUE 9. Caramucho 10.Cáñam

8

g

CHINCHORRO

estas evidencias alcanza 5%. Esto implica que si hipotéticamente toda el área fue ocupada, ha-

costa norte de chile PERÚ

8. Cementerio

DE LAS POBLACIONES

y

~ O

z

;::,

Dicha suma de individuos, que hipotéticamente habría alcanzado 4500, ocupó este espacio durante 3000 años (de 5000 a 2000 a.C). Ahora bien, si consideramos que cada individuo tuvo un promedio de vida de 50 años, en 3000 años se sucedieron 60 generaciones, lo que daría

u O

un número de 75 personas por generación. Este cálculo tendrá que irse modificando al efectuar nuevos hallazgos, o bien considerar otro tipo de análisis. Hasta el momento constituye una primera aproximación en relación con el número de personas que pudieron haber habitado este espacio de valle costero.

CHILE

»

'"

Cl m Z

--<

Z

»

O_=::JI-=:::520~m.

Figura 19. Mapa que muestra del norte de Chile

Camarones 8. Según Muñoz el al. (1993), este espacio corresponde a un extenso depósito de basura ubicado en una terraza fluvial en la ladera sur de la desembocadura del río Camarones. En los estratos precerámicos hemos definido un campamento cuyas estructuras son hondonadas revestidas con grandes cantos rodados a manera de paredes. Este sistema de construc-

los sitios precerámicos

Población aproximada. Hasta el momento

se han

hallado ,cementerios en tres sectores determinados de la costa o cordón litoral: Terraza sur (Schipapacasse y Niemeyer, 1984; Muñoz el al., 1993), Acantilados sur (Rivera el al. 1974, y Mu-

ción en forma semisubterránea se ideó como una manera de protección contra los agentes naturales, especialmente el viento, que en la

ñoz el al., 1988), YPunta Norte (Dauelsberg el al., 1971). El total de cuerpos recuperados llega a 100, incluyendo los perturbados. El total excavado en relación con el terreno donde se hallan

8 ¡¡:

costa de Camarones sopla muy fuerte al atardecer. Junto a estas estructuras -que aparecen

QUEBRADA DE CAMARONES

ü CE

o z « u o

Exploración de flora y fauna terrestre

'W

KM. 28

Exploración de calcedonia N

A

CAMARONES 8 Asentamiento

129


IvÁN R. MUÑoZ ÜVALLE y BERNARDO

ARR1AZA

separadas unas de otras, lo que sugiere un patrón más disperso que aglutinadoencontra-

mente las algas, que fueron consumidas y utilizadas como combustible. De los mamíferos ma-

mos una gran cantidad de morteros asociados a fogones. La datación obtenida del cuerpo de un niño que se ubicaba en los estratos iniciales de

rinos se han reconocido restos de hueso y pelaje de lobo marino, además de huesos de cachalote y nutria. De las aves marinas hay numerosos huesos y plumas. La flora terrestre que emplearon incluye un variado número de especies, entre ellas el sauce, molle, algodón, cola de zorro,

este campamento de 2600 a.C.

basural

arrojó

una fecha

Objetos culturales. Las evidencias culturales mues-

totora, junquillo, grama salada y cactáceas. La fauna terrestre está representada por pelaje y huesos de zorro, huesos de camélidos y de viscacha. Los rasgos culturales presentes, sumados a la variedad de restos de especies marinas y terrestres reconocidas en los estratos de basura, reafirman la máxima utilización de los recursos costeros y vegetacionales por parte de las poblaciones del litoral de Camarones. Su interés por

tran que estas poblaciones tuvieron un amplio conocimiento de la cordelería confeccionada en algodón; asimismo, hacían hilados y cordelillos de totora yjunquillos. La vestimenta consistía en faldellines, cobertores púbicos y esteras, todos confeccionados en fibra vegetal. Los instrumentos de caza que se hallaron fueron dardos y arpones confeccionados en madera y calcedonia. La industria lítica de puntas se caracteriza por sus formas lanceoladas; además, se encontraron otros artefactos, como raederas, perfora-

la recolección de plantas (madera, cactáceas y fibra vegetal) para la confección de instrumen-

dores y varias preformas, como lascas y láminas. Había artefactos de molienda, como manos y morteros. Para la pesca confeccionaron anzuelos de espina de cactácea. U tilizaron cueros de lobo marino como cubierta para sus viviendas, lo que se confirma al observar varios fragmentos zurcidos en sus extremos. Elaboraron encen-

tos de caza y manufacturas, como vestimentas, esteras funerarias y toldos para cubrir sus moradas, permite sugerir que éste fue un recurso importante de la cultura de los grupos costeros; asimismo, para el trabajo de caza marina y terrestre los instrumentos de piedra cumplieron una función relevante. Fueron también impor-

dedores (yesqueros) y extractores de mariscos en madera. Construyeron la estructura de las viviendas con los huesos obtenidos de la caza de mamíferos marinos. Hilaron y confeccionaron bolsas de lana utilizando la técnica de malla. Con los huesos de camélidos elaboraron artefactos para actividades pesqueras, como barbas para arpones, pesas, anzuelos, etc. De las plumas de aves confeccionaron adornos y camadas revestidas con fibras de totora yjunquillo. Finalmente, elaboraron adornos y collares de concha que depositaron como ofrendas a los difuntos.

tantes los artefactos en conchas y hueso de mamíferos marinos, ya como objetos de ornamentación o como instrumentos de trabajo; estos

Restos económicos. Las evidencias señalan que en este depósito la mayor proporción de restos orgánicos corresponde a una economía maríti-

Circuito de movilidad. Es posible que el campamento Camarones 8, como Camarones 1 y Camaro-

últimos cumplieron una trascedental función en el trabajo pesquero como anzuelos y chopes para extraer mariscos. La variada utilización de los recursos que tomaron de los mamíferos marinos al utilizar sus huesos para levantar chozas, sus vejigas para almacenar agua, sus cueros para abrigarse y su carne para alimentarse demuestran su importancia en la economía de dichas poblaciones.

nes 2 descritos por Schiappacasse (1984), localizados en la terraza sur nes, constituyan asentamientos de desembocadura del río Camarones.

ma; hay conchas de moluscos y bivalvos, además de restos de crustáceos y erizos. La flora marina también tuvo una función importante, especial-

130

y Niemeyer de Camarobase en la Los rasgos


---

MOMIFICACIÓN

ART1FICIAL

y PATRÓN

DE RESIDENCIA

DE LAS POBLACIONES

CHINCHORRO

---

culturales hallados en el perímetro de los objetos fechados vincularían estos campamentos con Conanoxa Wb, ubicado en el interior del valle a 28 km de la desembocadura del río Camarones. La presencia de un cuerpo momificado con rasgos de la tradición Chinchorro sugiere que el ritual de la momificación aún estaba

varios tipos de maderos con uno de los extremos quemados, artefactos que pudieron haber servido para hacer fuego. Finalmente se halló

presente en el tratamiento del modelaje de la cara, si bien parece ausente la intervención del cuerpo.

co, la yerba del platero, el carrizo y la cola de zorro; estas fibras vegetales probablemente fueron usadas para confeccionar vestimenta y este-

un fragmento de estera confeccionada vegetal. Restos económicos. Predominan

en fibra

la totora, el jun-

el asentamiento precerámico de Cananoxa Wb se ubica en una terraza fluvial, en la quebrada de Camarones, localidad de Conanoxa, a unos 28 km de la desembocadura del río Camarones.

ras funerarias, elaborar cubiertas vegetales para cubrir sus chozas y fabricar artefactos para las labores pesqueras, de caza y recolección. Entre los restos de origen marino predominan las conchas de moluscos muy fragmentadas y carbonizadas; de los bivalvos predominan el charo y las

Lo integran varios pisos de ocupación superpuestos unos sobre otros que supuestamente fueron áreas de residencia temporal repetidas sucesivamente. En Cananoxa Wb se localizaron varias fosas, en cuyo interior había restos de postes de sauce amargo, molle y yaros. Los fechados obtenidos de los primeros estratos de este cam-

machas; la fauna gastrópoda está constituida por locos y caracoles; de los crustáceos aparecen caparazones de camarón de río. Los restos de peces son escasos, aunque se identificaron el jurel y el bonito. También se hallaron restos de huesos y cueros de camélidos y mamíferos marinos, y de la fauna avícola se encontraron frag-

pamento lo sitúan entre (Niemeyer et al., 1964).

mentos de huesos y plumas de aves marinas y terrestres.

Conanoxa Wb. Según Schiappacasse et al. (1993),

3000 Y 2800 a.C.

Objetos culturales. El material más representativo

Circuito de movilidad. De acuerdo con el análisis del sitio, éste debió haber tenido la función de un campamento estacional: allí los grupos de cazadores y recolectores se reunían con el propósito de explotar las canteras de cuarzo o calcedonia para obtener la materia prima con que elaboraban sus artefactos líticos. Es posible que

son los artefactos de guijarros y de lascas. Entre los artefactos líticos destacan las raederas, los raspadores y las puntas de proyectil de base pedunculada, todos confeccionados en calcedonia. Otros tipos de punta tienen formas triangulares pedunculadas de limbo elongado y base redonda, confeccionadas en basalto; asimismo, se hallaron cuchillos de limbo asimétrico o semilunar, también un fragmento de tejido de malla, además de restos de cordelería y

o

u ¡¡:

Ü

en el talud de la quebrada se procediera al proceso de reducción primaria de la roca. Posteriormente las lascas matrices ya modificadas en preformas

se llevaban al campamento

de

KM.2B QUEBRADA DE CAMARONES

~ o z

CONANOXAWb Campamento temprano. Explotación de vetas de cacedonia

-o:: u

'W

o

Recursos vegetales y fauna

131

Recursos de caza N

1'\


IvÁN R. MuÑoz OVALLE y BERNARDO ARR1AZA

Conanoxa Wb para hacer instrumentos. Esta actividad debió haber sido realizada por grupos específicos de personas en periodos relativamente cortos, para lo cual llevaban sus alimentos desde el litoral y complementaban su dieta con recursos del área, como aves, camélidos y vizcachas. Este campamento estuvo constituido por moradas muy rudimentarias que se modificaban periódicamente, según lo demuestran evidencias estratigráficas.

las

ANÁLISIS DE LOS CIRCUITOS DE MOVILIDAD Y ESTRATEGIAS DE ORGANIZACIÓN COMPLEMENTARlEDAD

ECOLÓGICA COMO

MODELO TEMPRANO DE SUBSISTENCIA

Las evidencias obtenidas de los campamentos arcaicos en sus periodos temprano (como el caso 1) y tardío (como el caso 2) permiten inferir que sus ocupantes fueron hombres cuya economía se había adaptado a la explotación marítima y terrestre. El conocimiento de instrumentos como chopes, anzuelos, arpones y pesas evidencia una tecnología especializada, cuyo uso permitió la captura de diversas especies en tareas de recolección y de pesca o caza

con manejo longitudinal (a lo largo de la costa) y batitudinal (profundidad). El mar, fuente permanente de recursos, favoreció una actividad económica y alimentaria constante, organizada en torno a campamentos o bases estables, estructurados con viviendas tipo chozas o ramadas construidas con material propio del medio (maderos, fibras vegetales, costillas de cetáceos, cueros y huesos de lobo marino y camélidos, etcétera) . Asimismo, estos hombres tuvieron acceso a los recursos propios de los valles costeros, pues buscaban algunos recursos alimenticios complementarios y ciertas materias primas que eran . necesarias para optimizar su modo de vida. De esta manera incursionaron en los valles y llegaron a la cabecera de éstos. Los valles aportaron los recursos vegetales que ellos utilizaron para elaborar su vestimenta (totora), para la construcción de viviendas (troncos de sauce), complemento alimentario (raíces y frutas) e incluso en el ajuar del ritual mortuorio (confección de esteras de totora y junquillo). Otros recursos explotados fueron las vetas de calcedonia que utilizaron en la industria lítica de pesca y caza. También fueron de interés económico los ambientes con recursos hídricos, como las lagunas y ciénagas distribuidas a lo largo del valle, donde se concentraban algunos mamíferos terrestres (camélidos) que cazaban para utilizarlos como complemento alimenticio. No hay registros claros para discutir sobre la presencia de poblaciones de cazadores recolectores asentadas en las quebradas interiores y que explotaron la costa; más bien la hipótesis concluye que se trataría de poblaciones costeras que explotaban temporalmente los valles, pues así se desprende de las evidencias Conanoxa Wb, Acha 2 y Tiliviche lb. Se conjetura que los restos de productos marinos hallados en estos sitios quedaron allí debido a que las poblaciones costeras habrían penetrado hacia las quebradas interiores por cortos periodos con el propósito de explotar algunos recursos de subsistencia al cazar mamíferos terrestres, especialmente camélidos y vizcachas, recolectar

132


---

MOMIFICACiÓN ARTIFICIAL Y PATRÓN DE RESIDENCIA DE LAS POBLACIONES CHINCHORRO

Figura 21. Cabezas trofeos deshuesadas

o tshathas de origen jíbaro

camarones y fibras vegetales y obtener calcedo-

---

(Comas, 1975).

Este proceso de seminomadismo estacional por el litoral vino a sentar las bases de un pro-

nia y obsidiana para elaborar instrumentos de piedra. Para apoyar su permanencia transportaban productos de la costa, especialmente pescados y moluscos secos. Tras cumplir sus objetivos, los grupos de cazadores se movilizaban hacia la costa, donde tenían sus campamentos de base. Esto explicaría que los ejes conductivos para OI;:ganizar la economía se situaran más en el litoral que en los valles interiores. Su dependencia del mar como fuente básica de alimentos llevó a las poblaciones a organizar la explotación de este espacio, manteniendo sus campamentos a lo largo del litoral con marcado interés por las desembocaduras de los ríos. Estas zonas eran explotadas periódicamente y además facilitando su ingreso al interior de los valles en busca de recursos complementarios. El clima de los valles y la costa del norte de Chile no muestra grandes cambios entre la estación de verano y la de invierno, de ahí que la movilidad de los

ceso más estable y sedentario a partir del año 1000 a.c., cuando el hombre logró explotar la tierra, fortaleciendo así la estructura económica de las poblaciones del Pacífico y generando una organización más estable. EL SISTEMA ORGANlZATIVO DE LAS POBLACIONES

Aunque los antecedentes disponibles aún son escasos para discutir el tipo de organización de estas tempranas poblaciones, es posible reunir algunos antecedentes al respecto. Homogeneidad de hábitos Lo primero que salta a la vista es la recurrencia y homogeneidad de hábitos. Los depósitos de residuos marítimos procesados y acumulados en sucesivas capas (conchales) revelan el uso de un mismo lugar para igual función durante miles de años. Por ejemplo, en el depósito Quiani 1, ubicado 5 km al sur de la desemboca-

cazadores recolectores durante el periodo arcaico pudiera haber correspondido más bien a una concepción territorial de tipo nómada que de carácter trashumante.

dura del río San José de Azapa, se advierte un uso casi continuo durante casi 6000 años (Bird,

133


IvÁN R. MuÑoz OVALLE y BERNARDO ARR!AZA

Figura 22. Adulto con tratamiento de máscara y peinado. Sitio Morro 1, tumba 1, cuerpo 6 (fotografía de Raúl Rocha Urbina, MASMA).

Figura 23. Testimonio de dos técnicas de momificación artificial: negro/rojo y negro. Niños del sitio Morro 1 (fotografía de Raúl Rocha Urbina, MASMA).

Figura 24. Párvulo con cuerpo tratado en técnica de vendaje pintada con óxido ferroso. Morro 1, tumba 23, cuerpo la (fotografía de Raúl Rocha Urbina, MASMA).

Figura 25. Nonato humano momificado artificialmente. Sitio Playa Miller 8 (fotografía de Raúl Rocha Urbina, MASMA).

]34


---

MOMIFICACIÓN ARTIFICIAL Y PATRÓN DE RESIDENCIA DE LAS POBLACIONES CHINCHORRO

1943); algo similar se percibe en los conchales ubicados en la desembocadura del río Camarones, al norte de Chile (Schiappacasse y Niemeyer, 1984, y Muñoz et al., 1993). Tales depósitos, ubicados en costas rocosas con abundancia de moluscos y crustáceos, sirvieron como lugares destinados a la faena y muchos de ellos fueron utilizados a la vez como residencias.

de hay anzuelos de concha, instrumental que asimismo se halla en Quiani 1. El lugar de residencia estuvo constituido por campamentos cuyas viviendas se ajustaban a un patrón común disperso, pues estaban separadas unas de otras. Este modelo habitacional simple es un antecedente que nos lleva a suponer que su espacio habitacional tenía un carácter temporal, especialmente en los valles, aun cuando ciertos

t:'spacio social

espacios en la costa fueron destinados a residencias estables y otros a ritos, como el de la momificación del cuerpo antes de sepultarlo.

Tanto las áreas de procesamiento de moluscos como las zonas de residencia e incluso las áreas funerarias se encuentran cercanos unos de otros, espacio social del grupo. en la costa sur de Arica

---

en espacios integrados, y con ello se define el En el sector de Quiani, y junto a una antigua

Uso de hálJitats complementarios Se ha hecho referencia a un modelo de subsistencia con uso de áreas ecológicas complementarias. De dicho modelo se infiere que había

aguada, se han detectado asentamientos precerámicos de diversa naturaleza. Aunque hasta hoy las investigaciones han entregado datos diacrónicos, es posible inferir que en algún momento de su historia dichos asentamientos debieron coexistir. El sitio de depósito de residuos marítimos Quiani 1 presentó dataciones C14 de 4200 a.C. en sus niveles iniciales (Bird, 1943); Quiani 9 corresponde a un campamento habitacional y presentó dataciones iniciales de 4500 a.e. (Muñoz y Chacama, 1982). Los dos yacimientos tienen en común el estar asociados a poblaciones de pescadores y cazadores

campamentos estables en el litoral que contaban con acceso a recursos permanentes, y campamentos ocasionales o estacionales en distintas zonas ecológicas, especialmente en los sectores bajos de los valles costeros que llegan al Pacífico (Salomón, 1985; Santoro, 1993). Esta situación se sustenta al constatar que en sitios costeros era frecuente el uso de fibras

arcaic9s; en Quiani 9 destaca la presencia de estructuras habitacionales semiaglutinadas, don-

vegetales provenientes de los valles, recurso que se empleaba en la confección de implementos de pesca y esteras funerarias; asimismo, se advierte en los sitios de los valles el uso frecuente de conchas de moluscos y restos de vértebras de pescado, recursos destinados a la alimentación,

Figura 26. Modelo de asentamiento del periodo arcaico costero; vivienda en el sitio Quiane 9, Playa Brava (fotografía de Raúl Rocha Urbina, MASMA).

Figura 27. Actividad de pesca y caza de lobo marino; sitio Quiane 1 (fotografía de Raúl Rocha Urbina, MASMA).

135


IvÁNR. MuÑoz OVALLEy BERNARDO ARRJAZA cionado con sus orígenes y primeros eventos tienen cierta similitud en cuanto a la importancia del medio ambiente. El conocimiento del espacio determinó la existencia de diversos sistemas de organización, que se ven reflejados en manifestaciones culturales como el tratamiento de los cuerpos momificados de las poblaciones Chinchorro en la costa norte de Chile y el sistema arquitectónico de formas escalonadas, cuyos orígenes se remontan al periodo arcaico en asentamientos de la costa norte y centro de Perú, como Huaca Prieta, Gagaray, Las Haldas, etcétera.

Figura 28. Recolección y procesamiento de especies malacológicas obtenidas en la costa del Pacífico; sitios Quiane 1 y 9 (fotografia de Raúl Rocha Urbina, MASMA).

la confección de instrumentos tos de ornamento.

Las evidencias descritas nos permiten dar un panorama acerca de la organización social de los tempranos pescadores de las poblaciones Chinchorro; se trataría de grupos más bien reducidos, organizados en torno al hábitat costero, que les proporcionaba lo indispensable para su subsistencia. En dicho espacio transcurría la mayor parte de su vida y allí llevaban a cabo actividades económicas, domésticas y de tipo ritual (funerario). El grupo o parte de él se desplazaba periódicamente hacia el interior de los valles

de pesca y obje-

Patrón habitacional sectonzado. El espacio ocupado por las poblaciones arcaicas está definido por un espacio de abrigo (viviendas) y un espacio de trabajo. Dentro y fuera del espacio de viviendas se hallaron áreas de preparación de alimentos y de desperdicios. El espacio de trab,yo -áreas de talla Iítica- corres-

en busca de recursos complementarios, como fibras, vegetales (totoras, junquillos), camarones, roedores (vizcachas), camélidos y vetas de

ponde a sectores abiertos asociados a extensos fogones. En el caso específico de las viviendas de Acha 2, la presencia de poliquetos marinos en la delimitación de las viviendas muestra elemen-

calcedonia, entre otros. Este temprano proceso cultural perduró por 5000 años y refleja una condición conservadora en cuanto a su modo de vida.

tos transportados de la costa tal vez con la intención de señalar el dominio de un territorio con recursos potenciales para su subsistencia

Durante el primer periodo de adaptación a la vida costera, desarrollaron una serie de estrategias de sobrevivencia y diseñaron tecnología de anzuelos confeccionados en concha y espinas de cactáceas adecuada para la pesca, una organización territorial estructurada en campa-

(Muñoz, 1995; Chacama y Muñoz, 2001).

COMENTARIOS FINALES:

mentos base situados en la costa, y residencias temporales construidas en los valles. Además,

EL CONOCIMIENTO DEL PAISAJE YLOS RITOS DE LA MUERTE COMO ELEMENTOS DE PRIMER ORDEN PARA DEFINIR EL PROCESO DE ADAPTACIÓN AL DESIERTO COSTERO DE ATACAMA

crearon un sistema de enterramiento que se fundamentaba en la momificación artificial de los cuerpos, práctica que al inicio se aplicó exclusivamente sobre los recién nacidos o infantes de corta edad.

Los estudios sobre el poblamiento de la costa del Pacífico sur del continente americano rela-

Llagosteras (1989) supone respecto a los orígenes de estas poblaciones que constituyeron

136


MOMIFICACiÓNARTIFICIALYPATRÓNDE RESIDENCIADE lAS POBLACIONESCHINCHORRO

OaANO

ATLÁNTICO

OC~ANO PAcIFICO

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22.

Santa María La Paloma Jaguay Asana Tacahuay (ILO) El Anillo (Ring site) (TACNA) Vara (ILO) Villa del Mar (ILO) Km 4 (ILO) Quebrada de los Burros (TACNA) Acha 2, 3 Nueva Esperanza (ARlCA) Morro 1 (ARlCA) Quiane (ARlCA) Camarones 14 Camarones 17 Camarones Punta Norte Conchal Sur (Camarones 9) Tiliviche lB Aragón 1 (PISAGUA) Cobija 13 (ANTOFAGASTA) Las Conchas (ANTOFAGASTA) La Fundición (COPlAPÓ)

Figura 29. Ubicación de sitios costeros tempranos vinculados con la tradición Chinchorro, área centro sur andina.

inicialmente

un núcleo de poblaciones

la limitación de los recursos hídricos, que reduce el carácter mismo del sistema a la produc-

de caza-

dores y recolectores de la puna y al bajar a la costa del Pacífico, aproximadamente 7000 años a.C., aprovecharon los productos del mar en forma longitudinal, es decir, recolectando ma-

ción marítima, pues este espacio es una zona árida sin agricultura, lo cual hizo que se constituyeran en una organización de "pescadores puros" incapaz de alcanzar rangos socioeconó-

riscos y peces en las orillas. Posteriormente, de manera batitudinal aprendieron las técnicas

micos de desarrollo El conocimiento

de pesca y caza en las profundidades de las aguas; la elaboración del anzuelo les permitió

más complejo. del espacio y la explotación

de éste ayudaron a que los grupos se organizaran socialmente. Un elemento que debió coadyuvar a la coexistencia y unidad de los grupos Chinchorro es el ritual de la momificación; la

obtener un recurso permanente sin agotar la fauna ictiológica. El aporte de esta tecnología, la riqueza que ofrecía el mar y los pocos pero eficientes focos de agua dulce fueron factores básicos para que se asentara el hombre temprano a lo largo del litoral. Sin embargo, a pesar de que contaban con tales potencialidades, las poblaciones de estas costas del área centro sur andina no llegaron a desarrollar sociedades

conservación del cadáver habría desempeñado un importante papel en su vida social y religio-

complejas, como las que florecieron a partir de 2000 a.C. en la costa norte de Perú, sino que su

sa. Comas (1975) observa sobre el tema que en sociedades como Egipto la momificación estaba ligada a la redención futura, pues el cuerpo fue durante la vida terrestre albergue del espíritu del alma. Es un culto a los ancestros, perpetuación de la identidad personal del difunto; es un

estructura se basó en tareas simples como la caza y la recolección. Llagosteras lo atribuye a

elemento para alcanzar paz y felicidad en el más allá. Tal vez toda esta concepción de ideas

137


IvÁN R. MuÑoZ OVALLE y BERNARDO

ARRJAZA

TABLA I LISTA DE ELEMENTOS MÁS COMUNES: HABITACIONES y DEPÓSITOS FRENTE A CEMENTERIOS

Elementos

Viviendas y depósitos

Cementerios

• • • • • • • • • • • •

• • • • • • • •

Fibras vegetales Ocre Manganeso Cenizas Maderos Restos de aves marinas Cabezales de arpones Peces Conchas Anzuelos Pun tas líticas Pesas

relacionada con el culto de la muerte motivó a las poblaciones Chinchorro a preservar el cuerpo de sus difuntos, a quienes rendían culto periódicamente. Ahora bien, desde el punto de vista social, el ritual de la momificación habría ayudado a fortalecerlos en varios aspectos: a) favoreciendo su fuerte cohesión social, lo cual pudo haber aminorado las tensiones en el interior de los grupos Chinchorro; b) identidad respecto al grupo

occipucio para luego separar el cuero cabelludo y extraer totalmente los huesos del cráneo; posteriormente, y luego de un paciente proceso de conservación de las facciones y de la epidermis, se cierran los labios con varias puntadas para que el muerto no hable ni haga daño. Terminado el tratamiento de reducción, las cabezas se guardan en la casa del jefe o del shaman, pues son tabú para todas las personas menos para ellos y para quien hizo la reducción, únicos que pueden tocarlas, pues se les

de parte de terceros, y e) conceptuar territorialmente el espacio ocupado por las poblaciones Chinchorro. Para avalar este planteamiento referiremos algunos apuntes etnográficos de Girard (1958) en torno a ciertos rituales relacionados con las prácticas de reducción de cabezas y con las ceremonias conmemorativas de los

considera objetos sagrados y se les tiene un gran respeto. En este ritual interesa considerar dos aspectos: a) el sacrificio del guerrero y la reducción de su cabeza están relacionados con creencias sobre la productividad o abundancia de frutos;

grupos Shapra, indios selváticos de la Amazonia peruana. Si bien estos grupos no momifican a sus muertos, cabe destacar algunos elementos

b) el proceso de captura, muerte y ablación de la cabeza del prisionero es largo y complejo, y participa en él toda la comunidad, incluso los

interesantes: a) son cazadores y recolectores, es decir, corresponden a sociedades cuya economía

niños, con ceremonias de danzas y cantos: es una festividad que se refleja en los rostros ale-

apropiatoria

gres de los danzantes. Dichas ceremonias comunitarias podían durar de dos a siete días, dependiendo de los grupos celebrantes. Estos dos aspectos del ritual de reducción de cabezas -la creencia en que propiciaba una mayor abundancia de alimentos y la participación total de la comunidadconstituyen ele-

es igual a la de los Chinchorro;

b) son pequeños grupos organizadas en torno a un jefe y curandero, y e) la práctica de la reducción de cabezas demuestra cierto grado de conocimiento de la anatomía del cuerpo humano. El informante principal de Girard, Tairiri, refiere que primero practican un corte en el

138


___

MOMIFICACIÓN

ARTIFICIAL

Y PATRÓN

DE RESIDENCIA

CHINCHORRO

---

cionara una abundante producción de peces y mariscos, y que debieron participar en él todos los miembros del grupo y tal vez otras poblaciones externas de la comunidad, lo que favo-

mentos fundamentales en la estructura del rito. Si los trasladamos al ritual de la momificación practicado por los grupos Chinchorro, podremos suponer que dicho ritual pudo haberse realizado con la finalidad de que el mar propor-

reció sus alianzas y lazos de solidaridad.

2

TABLA

Tipo de sitio

Invesligadores

Silio

DE LAS POBLACIONES

Fechado más anliguo (sin catiúrar a.P.)

Desembocadura de Camarones Camarones

14

Schiappacasse y Niemeyer, 1984

Depósito y entierro

7420

Camarones

17

Muñoz, Arriaza y Aufderhaide, 1993

Depósito y entierro

6930

Camarones

Sur

Rivera, 1984

Depósito

5690

Depósito y entierro

6320

Dauelsberg

Punta norte

el al., 1971

Costa de Arica, incluye la Quebrada Seca de Acha y la desembocadura del Tia San José Quiani 1

Bird, 1943

Quiani 9

Muñoz y Chacama,

1982

Depósito

6170

Depósito y habitacional

6379

y entierro

9020 Y8900

Acha 2

Muñoz y Chacama, 1993

Campamento

Acha 3

Standen el al., por publicar

Entierro

8000

Morro 1

Allison el al., 1984, y Standen, 1991

Cementerio

7810

Quebrada de los Burros (desembocadura del Caplina, costa de Tacna) Lavallée el at., 1999

Depósito

7880

El Anillo o Ring Site

Sandweiss el al., 1998

Depósito

10575

Quebrada

Keefer el al., 1998

Depósito

10770

Villa del Mar

Wise,1991

Depósito y entierro

7800

Vara

Rasmussen,

Depósito

7880

Kilómetro 4

Wise, Clark el al., 1994

Depósito

4620

Carrizal

Wise, 1990

Depósito

4690

Sandweiss el. a~ 1998

Depósito

Quebrada

de los Burros

Costa sur de Ilo de Tacahuay

1998

Costa norte de Camana Quebrada

de Jaguay 280

ll105

Sitios tempranos conectados con la economía del mar Quebrada de Tiliviche Tiliviche lb

Núñez y Moraga, 1977-1978 Depósito y campamento

Valle de Moquegua Asana

Aldenderfer,

Campamento

1990

139

9760 9800


IvÁN R. MUÑOZ OVALLE y BERNARDO ARR1AZA TABLA 3 DEPÓSITOS

CON ENTERRAMIENTOS

A LAS POBLACIONES

CHINCHORRO

SíNTESIS Tumba núm.

Sitio

Y CAMPAMENTOS DEL ÁREA CENTRO

DE LOS CUERPOS

Cuerpo

Edad

ASOCIADOS SUR ANDINA.

ESTUDIADOS

Fechado por Sexo

Radiocarbono

Tipo de Muestra

Momificación*

Chinchorro

1

1

3 años

6070 a.C. ± 285

madero

2.1

Chinchorro

1

2

3 años

5560a.C.±175

madero

2.1

Chinchorro

1

3

6 meses

1

Camarones

17

1

39 a 40 años

F

1

Camarones

17

2

6 meses

1

2.2

2.1

Camarones

17

3

6 meses

M

6780 a.C. ± 110

madero

2.2

Camarones

17

4

3 meses

M

6930 a.C. ± 140

madero

2.2

Camarones

8

1

2 años

M

4635 a.C. ± 90

músculo

1

* Tipos de momificación según Allison et al. (1984). El 1 corresponde a una momificación natural, el 2 a una artificial. 1 = indefinido; M = masculino; F = femenino. Laboratorio de procesamiento: Krueger Enterprise, Inc., 1989, Cambridge, Massachusetts. Fuente: W. Crom, 1993, p. 20. Nota: Tomada de Muñoz (1993: 120).

Estas poblaciones momificaban artificialmen-

recursos, el hombre llegó a conocer su espacio, con lo cual pudo resolver los problemas alimentarios, de vivienda, vestimenta, instrumen-

te los cuerpos de sus deudos y practicaban también la deformación del cráneo con una forma tipo anular. Munizaga (1980) sostiene que también realizaban ciertas cirugías o trepanaciones en cráneos, tal vez con el objetivo de extraer el

tos de trabajo, etc. Además, en este espacio natural supo vincularse con el mundo sobrenatural y para tal efecto desarrolló un complejo ritual de momificación, cuyo tratamiento refleja su conocimiento de la anatomía del cuerpo humano. Esto nos hace pensar finalmente que sólo una sociedad que concedía gran importancia al rito de la muerte pudo llegar a elaborar este particular sistema de tratamiento mortuorio al cuerpo humano y organizarse en torno a él.

cerebro durante el proceso de momificación. Estas prácticas corroboran que tenían conocimientos anatómicos del cuerpo humano, pues sólo así podrían haber practicado tales tratamientos y operaciones. Estos rasgos, según Munizaga (1980), son evidencias novedosas y únicas para América al considerar su antigüedad. El panorama que presenta la cultura Chinchorro en el periodo arcaico americano es tan importante como el de la Cultura Machalilla, en Ecuador, dentro del periodo formativo en nuestro continente. En síntesis, la combinación de recursos marítimos y terrestres permitió la instalación de

REFLEXIONES

FINALES

LAS POBLACIONES

sucesivas poblaciones que no presentan grandes cambios en su estructura organizativa; más bien reflejan una condición conservadora en términos económicos y sociales. En este escenario de condiciones ambientales complejas por la aridez del medio, pero con un mar rico en

SOBRE

TEMPRANAS

Considerando la importancia del poblamiento de caza y recolección, plantearemos algunas ideas relacionadas con el enfoque de estudio sobre estas tempranas poblaciones. Consideramos que los antecedentes presentados en el presente trabajo son importantes

140


---

MOMIFICACIÓN

para entender

ARTIFICIAL

Y PATRÓN

los sistemas organizativos

DE RESIDENCIA

de las

--

poblaciones tempranas que se asentaron en América. La prometedora perspectiva que ofrece la investigación sobre el hombre temprano evidencia la necesidad de diseñar programas integrales que permitan identificar los procesos

DE LAS POBLACIONES

CHINCHORRO

---

(1995-1996), "Tras las huellas de Max Uhle: homenaje a Percy Dauelsberg Hahmann ", Diálogo Andino, Arica, Chile, núms.

14/15, pp. 39-50. Allison, Focacci, Arriaza, Standen, wenstein (1984), "Chinchorro,

Rivera y Lomomias de

preparación complicada: métodos de momificación 155", Revista Chungará, Arica, Chile,

comunes en las diferentes áreas arqueológicas estudiadas. Tales programas debieran sustentarse en un enfoque metodológico cuyo resultado debiera ser el análisis de la organización

núm. 13, p. 173. Arriaza, B. (1994), "Tipologías de momias Chinchorro y evolución de las prácticas de momificación", Revista Chungará, vol. 26, núm. 1,

económica y social de estos tempranos grupos de cazadores recolectores. Para tal efecto es importante abordar estos

Arica, Chile, pp. 11-24. (1995), "Chinchorro Bioarchaeology; Chronology and Mummy Seriation", Latin American Antiquity, vol. 6, núm. l.

estudios valiéndose de programas que articulen diversas disciplinas en el contexto de una investigación interdisciplinaria. Por ejemplo, que inclu-

---,

yan estudios sobre complementariedad ecológica, dieta, tecnología, cronología, caracterización física de las poblaciones-, condiciones de salud y

Aufderheide,

A. (1993), "Reconstrucción

quí-

mica de la dieta del hombre de Acha", en Muñoz, Arriaza y Aufderheide (eds.), Acha 2 y los orígenes del poblamiento humano en Arica, Arica, Chile, Ediciones Universidad de Tarapacá. --, I. Muñoz Y B. Arriaza (1993), "Seven

reconstrucción de paleoambiente, entre otras, con la idea de reconstruir el hábitat, el tipo físico y la cultura junto con los modelos de interacción del hombre temprano en América. En una primera fase, estos estudios debieran resolver problemas de carácter regional, examinando las distintas áreas culturales que caracte-

Chinchorro Mummies and the Prehistory of Northern Chile", AmericanJournal o/ Physiail Anthropology, núm. 9l.

rizan el poblamiento temprano, para luego resumir esta información y plantear propuestas de carácter macrorregional. Al correlacionar la

Benfer, R. (1982), "El proyecto La paloma de la Universidad de Missouri y el Centro de Investigaciones de las Zonas Áridas", Revista C.J.Z.A., Lima.

información de las distintas áreas estudiadas de Sudamérica, Mesoamérica y Norteamérica, será posible elaborar propuestas con mayor contenido en relación con la información de los hallazgos, que a la fecha ha recibido poca atención.

Bibar, G. (1966) [1558], Crónica y relación del reino de Chile, Santiago, Fondo Histórico José Toribio Medina. Binford, R. (1971), "Mortuary Practices: Their Studies and their Potencial", en Brown (ed.), Approaches to The Social Dimensions o/ Mortuory Practices, Society for American Archaeology

BIBLIOGRAFÍA

Memoirs. Bird,j. (1943), "Excavation in Northern Chile", Anthropological Papers o/ the American Museum o/ Natural History, vol. XXXVIII, parte IV,

Aldenderfer, M. (1990), "Cronología y definición de fases arcaicas en el sur del Perú", Revista Chungará, Arica, Chile, núms. 24/25, pp. 13-35. Álvarez, L. (1969), "Un cementerio precerámi-

Nueva York. Bittman, B. (1982), "Revisión del problema Chinchorro", Revista Chungará, núm. 9, Arica, Chile, pp. 46-79. Bustos, V. (1974), Chacaya JI: una aldea temprana

co con momias de preparación complicada", Rehue 2: Actas del IV Congreso Nacional de Arqueología, Concepción.

141


IvÁN R. MUÑoz

OVALLE

y

sin agricultura y sin cerámica, Antofagasta, Universidad del Norte (Serie Arqueológica, 2). Comas, J. (1975), Origen de las culturas precolombinas, México, Secretaría de Educación PÚ-

BERNARDO

Keefer, De France, Moseley, Richardson IlI, Satterlee y Day-Lewis (1998), "Early Maritime Economy and El Niño Events at Quebrada Tacahuay, Perú", Science,núm. 281, pp. 1833-1835. Lanning, E. (1967), Perú Before the Incas, Nueva

blica, 160 p. Crom, W. (1993), "Medio ambiente del sitio Acha 2", en Muñoz, Arriaza y Aufderheide (eds.), Acha 2 y los orígenes del poblamiento humano en Arica, Arica, Chile, Ediciones

Jersey, Englewood Cliff, Prentice Hall. Lavallée, Julien, Béarez, Usselmann, Fontugne y Bolaños (1999), "Pescadores-recolectores arcaicos del extremo sur peruano. Excavaciones en la Quebrada de los Burros (Tacna,

Universidad de Tarapacá. Chacama y Muñoz (2001), "Patrón funerario

Perú)", Bull. Institute Francaise Études Andines, vol. 28, núm. 1.

pre Chinchorro en un contexto de seminomadismo y complementariedad ecológica.

Llagosteras, A. (1979), "Ocupación

Álvarez y Chacón (1971), "Comusobre el sitio Punta Norte", VI

--

Congreso I de Arqueología Chilena, Santiago. --(1974), "Excavaciones arqueológicas en Quiani", Revista Chungará, núm. 4, Arica, Chile. Engel, F. (1963), "Asia unidad 1: Preceramic Settlement in Perú", Transactions o/ the American Philosophical Society, vol. 53, núm. 3. Focacci, G. (1974), "Excavaciones en playa Miller 7, Arica (Chile)", Revista Chungará, ---

---

humana

en

la costa norte de Chile asociada a peces local-extintos y a litos geométricos 9 680 a.C., Actas del VIII Congreso de Arqueología Chilena, Santiago, Editorial Kultrún.

El sitio Acha 2, extremo norte de Chile, ca. 9500-10000 años a.C.", Revista Chungará, vol. 33, núm. 1, Arica, Chile. Dauelsberg, nicación

ARRiAZA

(1989), "Caza y pesca marítima (9000 a 1000 a.c.), cultura de Chile", en Muñoz, Arriaza y Aufderheide (eds.), Prehistoria. Des-

de sus orígenes hasta los albores de la Conquista, Santiago, Editorial Andrés Bello. Malinoski, B. (1955), Magic, Science and Religion, Nueva York, Daubleday, Garden City. Moseley, M. (1975), The Maritime Foudations o/ Andean Civilization, California, Comming Publishing Company Meblo Park. Mostny, G. (1944), "Excavaciones en Arica", Boletín del Museo Nacional de Historia Natural, núm. 21, Santiago. Munizaga y Martínez (1961), "La colección arqueológica A. Nielsen de Iquique. Su significación e informe sobre algunas piezas importantes", Revista Chilena de Historia y

núm. 3, Arica, Chile. (1980), "Síntesis de la arqueología del extremo norte de Chile", Revista Chungará, núm. 6, Arica, Chile, pp. 3-23. Y S. Chacón (1989), "Excavaciones arqueológicas en los faldeos del Morro de Arica. Sitios Morro 1/6 y 2/2", Revista Chun-

Geografia, Santiago. (1980), "Esquema de la antropología física del norte de Chile", Revista Chungará, núm. 6, Arica, Chile. --, H. Niemeyer y V. Schiappacasse (1964), "Investigaciones arqueológicas en las terra-

gará, núm. 22, Arica, Chile, pp. 15-62. Girard, R. (1958), Indios selváticos de la Amazonia Peruana, México, Mex. Editores. Gusinde, M. (1982), Los indios de Tierra del Fuego, tomo Il, Buenos Aires, Centro Argentino de Etnología Americana, Consejo Nacional

---

de Investigaciones Científicas y Técnicas. Guillén, S. (1993), 'The Chinchorro Culture: Mummies and Crania in the Reconstruction

zas de Conanoxa, valle de Camarones (Provincia de Tarapacá)", Revista Universitaria, 26, año 48, Santiago, Anales de la Academia Chilena de Ciencias Naturales. Muñoz, I. (1980), 'Túmulos funerarios: evidencias del proceso de agriculturación en los

of Preceramic Coastal Adaptation in the South Central Ande", tesis de doctorado, University of Michigan.

142


---

MOMIFICACIÓN

ARTIFICIAL

Y PATRÓN DE RESIDENCIA

valles bajos de Arica", tesis de licenciatura en arqueología, Antofagasta. --(1982), "Las· sociedades

---

costeras en el

---

asentamientos humanos de la desembocadura del río Loa, norte de Chile", Boletín

(1983), "La fase Alto Ramírez en los valles del extremo norte de Chile", Documentos de Trabajo, núm. 3, Arica, Chile, Universidad

---

de Tarapacá. (1985), "In troducción

---

de la Universidad de Chile, núm. 112, Santiago. (1983), Paleoindio y arcaico en Chile: diversidad, secuencia y proceso, México, Editoral Cuicuilco.

al estudio de las

poblaciones costeras durante la etapa arcaica en el norte de Chile", Antropológica, Lima. ---

(1993), Spatial Dimensions of Complementary Resource Utilization at Acha 2 and San Lorenzo. Domestic Architectura, Ethnicity and Complementary in the South Central Andes, Iowa Press. --(1995), "El poblamiento prehispánico costero en la costa de Arica y desembocadu-

(1989), "Los primeros pobladores (20000-9000 a.e.) culturas de Chile", Prehistoria. Desde sus orígenes hasta los albores de la Conquista, Santiago, Editorial Andrés Bello, pp. 13-3I.

--

Y Moraga (1977-1978), "Ocupación arcaica temprana en Tiliviche, norte de Chile (1 región)", Boletín del Museo Arqueológico de La Serena, núm. 16, Chile, La Serena. ---y Santoro (1990), "Primeros poblamientos en el Cono Sur de América (XII-IX Milenio a.P.)", Revista de Arqueologia Americana, núm. 1, México. -y Saltar (1978), "Radio me tría de Aragón 1 y su implicancia en el precerámico costero del norte de Chile", Actas y Memorias del IX Congreso Nacional de Arqueología Argentina, parte 1, Mendoza. Ravines, R. (1972), "Secuencia y cambio en los artefactos líticos del sur del Perú", Revista del Museo Nacional, vol. XXVIII, Lima.

ra del río Camarones", Actas del XIII Congreso Nacional de Arqueología Chilena, tomo 1, Antofagasta.

---

y Chacama (1982), "Investigaciones arqueológicas en las poblaciones precerámicas de la costa de Arica", Documentos de Trabajo, núm. 2, Arica, Chile. --y (1993), "Patrón de asentamien to y cronología de Acha 2", en Muñoz, Arriaza y Aufd~rheide (eds.), Acha 2 y los orígenes del poblamiento humano en Arica, Arica, Chile, Ediciones Universidad de Tarapacá, pp. 21-46.

Richardson

III, J.B. (1983), "The Chira Beach

Ridges, Sea Level Change and the Origins of Maritime Economies on the Peruvian Coast", Annals of Carnegie Museum, vol. 52, núm. l. ---, D. Sandweiss, R. Feldman, J. Hsu, y E.

Rocha y Chacón (1991), "Camarones 15: asentamiento de pescadores correspondiente a los periodos Arcaico y Formativo", Actas del XI Congreso de Arqueología Chilena, Santiago, Chile. --, Arriaza y Aufderheide (1993), "El poblamiento Chinchorro: nuevos indicadores

---,

Reitz, (1990), Tempranas adaptaciones marítimas en los Andes. &tudio preliminar en el sitio Sting o Anillo, vol. 1, Ilo, Perú. Trabajos arqueológicos de Moquegua, Perú, pp. 139-176. Rivera, M. (1975), "Una hipótesis sobre movi-

bioantropológicos y discusión en torno a su organización social", en Muñoz, Arriaza y Aufderheide (eds.), Acha 2 y los orígenes del poblamiento humano en Arica, Arica, Ediciones Universidad de Tarapacá. Núñez, L. (1969), "Sobre los complejos culturales Chinchorro

CHINCHORRO

de Chile. Rehue 2", Actas del N CongresoNacional de Arqueología, Concepción, pp. 111-142. --(1971), "Secuencia y cambios en los

litoral de Arica durante el periodo arcaico tardío y sus vinculaciones con la costa peruana", Revista Chungará, núm. 9, Arica, Chile. ---

DE LAS POBlACIONES

mientos poblacionales altiplánicos y transaltiplánicos en las costas del norte de Chile", Revista Chungará, núm. 57, Arica, Chile, p. 3I. --(1992), "Antiguas manifestaciones de momificación humana en América. La tradición Chinchorro del norte de Chile", Beitrage

y Faldas del Morro del Norte

143


lvÁN R. MUÑoZ

OVALLE y BERNARDO

zur Allgemeinen und Vergleichenden Archaeologie Band, núm. 12, pp. 337-359. ---

ARRiAZA

---,

Chacama, Muñoz y Niemeyer (1993), "Dispersión del depósito arqueológico en un yacimiento de recoiectores arcaicos, con énfasis en el microdepósito", Actas del XlI Congreso Nacional de Arqueología Chilena 1991, tomo 1, Santiago. Soto, P. (1987), "Evolución de deformaciones intencionales, peinados, tocados y prácticas funerarias en la prehistoria de Arica", Revista

Y Rothhammer (1986), "Evaluación biológica y cultural de poblaciones Chinchorro: nuevos elementos para la hipótesis de contactos transaltiplánicos, cuenca Amazónica-costas del Pacífico", Revista Chungará, núms. 16-17, Arica, Chile.

Rivera, Soto, Ulloa y Kushner (1974), "Aspecto sobre el desarrollo tecnológico en el proceso de agriculturación en el norte prehispánico, especialmente Arica (Chile) ", Revista

Chungará, núm. 19, Arica, Chile, pp. 129-214. Standen, V. (1991), "El cementerio Morro 1: nuevas evidencias de la tradición funeraria Chinchorro (periodo arcaico, norte de Chi-

Chungará, núm. 3, Arica, Chile. Salomón, F. (1985), 'The Dinamic Potential of

le) ", tesis de maestría en arqueología, Lima, Pontificia Universidad Católica del Perú. --(1997), 'Temprana complejidad funeraria de la cultura Chinchorro (norte de Chile) ", Latin American Antiquity, vol. 8, núm. 2.

the Complementary Concept", en S. Mazuda, 1. Shimada y C. Morris (eds.), Andean Ecology and Civilization, University of Tokio, pp. 5Il-53l. Sandweiss, McInnis, Burger, Cano, Ojeda, Paredes, Sandweiss y Glascock (1998), "Quebrada Jaguay: Early South American Maritime Adaptations", Science, núm. 28l.

Tainer, J. (1979),

"Mortuary Practices and the

Studies of Prehistoric Social Systems", en M. Schiffer (ed.), Advances in Archaeological Method and Theory, vol. 1, Nueva York, Academy Press. Uhle, M. (1919), "La arqueología de Arica y Tacna", Boletín de la Sociedad Ecuatoriana de &tudios Históricos Americanos, Quito. Vázquez de Espinosa (1948), Compendio y des. cripción de las indias occidentales, Washington,

Santoro y Chacama (1982), "Secuencia cultural de las tierras altas del área centro sur andina", Revista Chungará, núm. 9, Arica, Chile. --(1993), "Complementariedad ecológica en sociedades arcaicas del área centro sur andina 2", en Muñoz, Arriaza y Aufderheide (eds.), Acha 2 y los origenes del poblamiento humano en Arica, Ediciones Universidad de

Smithsonian Institution. Vera, J. (1982), "Momias Chinchorro

Tarapacá. Schiappacasse y Niemeyer (1984), Descripción y análisis interpretativo de un sitio arcaico tempra-

de prepa-

ración complicada del Museo de Historia Natural de Valparaíso: 3290 y 3060 a.C.", Anales del Museo de Historia Natural de Valparaíso, núm. 14, Valparaíso.

no en la quebrada de Camarones, Santiago, Chile, Museo Nacional de Historia Natural (Publicación Ocasional, 41).

144


FECHAMIENTO DE RESTOS ÓSEOS DE LA CUENCA DEL VALLE DE MÉXICO MEDIANTE TÉCNICAS CALORIMÉTRICAS Luis Lozano Aguirre Beltrán.

* Alejandro

Heredia Barbero, **

Miguel Ángel Peña Rico, *** Eduardo Villarreal Ramírez., **** José Ocotlán Flores, ***** Eligio Orozco Mendoza** y Lauro Bucio Galindo**

RESUMEN

sobre la degradación

Mediante técnicas calorimétricas, principalmente calorimetría de barrido diferencial (CBD) se realizó el estudio de un conjunto de restos óseos hallados en la cuenca del valle de México. Las muestras óseas provienen de distintas localidades: Cuicuilco, Oztoyohualco, Tlalocan, Xochimilco, Tlatelolco, el templo de San Pedro y

ABSTRACT

San Pablo y el Ex convento de San Jerónimo, que corresponden a diferentes tipos de enterramientos con antigüedades que van desde 185 hasta 3150 años. Mediante la calorimetría se obtuvo la entalpía (H) de combustión del colágeno presente en el tejido óseo, y con relación

A calorimetric study was realized by the use of Differential Scanning Calorimetry on a set of human bone remains found in the Mexican Valley Basin. The samples analized carne from different localities: Cuicuilco, Oztoyohualco, Tlalocan, Xochimilco, Tlatelolco, Ex-convento

a su antigüedad se ajustaron varias curvas de decaimiento exponencial que representan diferentes ritmos de pérdida de la materia orgánica respecto al tiempo. La técnica empleada se comparó con resultados obtenidos mediante difracción de rayos X y PIXE (técnica nuclear) para estas mismas muestras. Se concluyó que la calorimetría es una técnica más sensible para determinar la presencia de materia orgánica (colá-

de San Jerónimo and Templo San Pedro y San Pablo; these bone remains have different burail conditions and their antiquity range from 185 to 3150 years old. With the present calorimetric approach, the enthalpy (?H) of combustion of the Type 1 Collagen present in bone was ohtained and with the knowledge of each bone remain antiquity, various exponential decayrnent

geno) y se plantea que podría ser capaz de dar información del efecto de distintos ambientes

* Instituto de Biotecnología, UNAM. ** Instituto de Física, UNAM. *** Instituto de Química, UNAM. **** Instituto de Investigaciones en Materiales, ***** Centro de Instrumentos, UNAM.

del colágeno. Por otro la-

do, la calorimetría de barrido diferencial abre la posibilidad de dar un fechamiento aproximado para distintas muestras arqueológicas que provengan de una región donde las condiciones climáticas sean semejantes.

curves were obtained. The curves represent the loss rate of the organic phase (collagen) for all the bone samples in the different localities. The Differential Scanning Calorimetry results were compared with X-Ray Diffraction and PIXE (nuclear techniques) analyses results for the

UNAM.

same bone samples. It was found that calorime-

145


LOZANO, HEREDIA, PEÑA, VILLARREAL, OCOTLÁN, OROZCO y BUCIO

try is a more sensible technique for detecting the presence of organic matter in bone remains and by the way, this sensibility make us pro pose this specific technique for obtaining information of the effect of the burial conditions in which the bone was placed. The Differential Scanning Calorimetry can be use for dating pro poses of different bone remains found in a same burial conditions because of its capacity for detecting specifically the organic matter (collagen) in arqueological skeletal tissue.

FECHAMIENTO

que proporcionan fechas aproximadas muy confiables para el fechamiento de restos óseos; posiblemente el caso más conocido sea el de fechamiento por carbono 14. Varios factores afectan el fechamiento; uno de los más importantes es la contaminación que puede sufrir el material óseo durante el tiempo de enterramiento, que depende sobre todo del tipo de ambiente que rodee al tejido. Ello afecta a la mayoría de las técnicas de fechamiento, si no es que a todas, por lo cual es recomendable emplear varias técnicas y hacer una buena caracterización del error estándar.

PAlABRAS CLAVE Fechamiento, calorimetría, terramiento y entalpía.

DE RESTOS ÓSEOS

Hoy día se emplea un gran número de técnicas

colágeno tipo 1, en-

En el presente trabajo se propone emplear la calorimetría diferencial de barrido como técnica de fechamiento cuando se examina material óseo, pues es grande su sensibilidad respecto al colágeno. Esta técnica permite no sólo

INTRODUCCiÓN

evaluar la cantidad de proteína por unidad de masa -lo cual estaría relacionado con la antigüedad aproximada-, sino que además ofrece información sobre el tipo de ambiente durante el cual permaneció en su entierro. Por otro lado requiere una pequeña cantidad de muestra (-1.0 mg) y arroja resultados reproducibles con rapidez.

El origen de las poblaciones humanas, y en particular el proceso de poblamiento de distintas regiones, es de vital importancia para la antropología. Las migraciones, o los procesos de colonización que llevan a cabo distintas especies, ocasionan en ciertos casos la modificación del medio en donde se establecen. Para conocer las características biológicas y antropológicas que permitieron el establecimiento de poblaciones

La calorimetría se ha empleado como técnica de caracterización en el estudio de proteínas

a lo largo del continente americano y específicamente en México y en la cuenca de México, se requieren diversos estudios que deben abarcar desde los aspectos meramente ambientales

con el propósito de conocer su estabilidad térmica en solución, y la mayoría de las investigaciones se ha centrado en el proceso de desnaturalización en el intervalo de temperatura de

de cada región como los conductuales y sociales de los primeros pobladores. Actualmente se cuenta con información proveniente de los entierros hallados en distintas localidades, y es principalmente a partir de los restos óseos que se encontraron en varios si-

20 a 80 oC; sin embargo, ha sido poco empleada en el estudio de la degradación y combustión de diferentes biomoléculas, por no decir sólo proteínas. En el Instituto de Física ya se han llevado a cabo estudios del proceso de degradación y combustión del colágeno mediante calorimetría, técnica que ofrece la posibilidad de conocer la relación que guarda el colágeno con la hidroxiapatita, debido a que la estabilidad térmica de una proteína tiene una estrecha

tios, cuando hemos podido conocer sus costumbres funerarias, su paleodieta y muchas otras carcaterísticas, e incluso dar un fechamiento aproximado de la presencia de las respectivas poblaciones que fueron habitando la cuenca de México.

relación con sus características estructurales, como son las interacciones químicas que esta-

146


FECHAMIENTO DE RESTOS ÓSEOS DE LA CUENCA DEL VALLE DE MÉXICO

Hidroxiprolina

Triple hélice

L

Glicina Hélice sencilla Prolina

Figura 1. Colágeno

tipo 1.

bilizan a la molécula, así como el ambiente que la rodea.

orgamca bajo control celular se conforman principalmente de calcio y fosfatos en la forma

En las regiones ecuatoriales, la pé\dida del colágeno es mayor, de ahí que el análisis del hombre temprano en América y el proceso de poblamiento en distintas zonas se podrían ver afectados por este factor, y por ende resulta necesario emplear una técnica capaz de determinar un

de carbonato de hidroxiapatita. El colágeno tipo 1es la proteína extracelular más abundante en el tejido óseo; su característica distintiva es que consiste en una extensa y continua triple hélice que se organiza en fibrilIas y fibras. Éstas poseen una fuerza de tensión

ritmo de pérdida del colágeno respecto a las condiciones ambientales del sitio en cuestión

muy alta y proporcionan la base estructural del hueso, la piel, las arterias y venas, los intestinos

para así obtener un fechamiento relativo de varias muestras y comparar muestras de distintas regiones. A este respecto, el obtener conocimientos sobre cómo se lleva a cabo la pérdida de colj-geno para varios grupos de muestras óseas permitiría evaluar en distintas regiones las condiciones que afectan la pérdida de colágeno, así como distir~guir si el resto óseo en cuestión estuvo sujeto antes del enterramiento a un proceso que afectara su fechamiento.

y las cápsulas fibrosas de algunos órganos. El colágeno tipo 1 es la proteína más abundante en los vertebrados, ya que se encuentra en sus huesos, tendones, ligamentos y piel. El colágeno tipo 1 tiene una alta estabilidad térmica debido principalmente a su arreglo estructural y a los enlaces químicos, débiles y fuertes, como son los puentes de hidrógeno mediados por las moléculas de agua. Los puentes de hidrógeno se encuentran entre las cadenas que forman la triple hélice, formados entre los grupos amino y carboxilos del esqueleto de la cadena polipeptídica. Existen enlaces covalentes entre las triples hélices adyacentes, cuando forman fibrillas, y en la región de los espacios ubicados entre el final de una triple hélice y el inicio de la siguiente.

CARACTERÍSTICAS DEL MATERIAL ÓSEO

El hueso es una forma especializada

de tejido

conectivo en el cual la matriz extracelular se encuentra mineralizada; está compuesto por una matriz orgánica en donde se depositan sales de calcio. El colágeno tipo 1 constituye aproximadamente 95% de dicha matriz y el 5% restante está integrado por proteoglicanos y diferentes tipos de proteínas distintas al colágeno. Las sales cristalinas que se depositan sobre la matriz

Respecto a la estructura molecular y la nuc1eación de cristales de carbonato de hidroxiapatita, se parte de la estructura atómica de la hidroxiapatita (HAp) , de la cual se postula que por

147


LOZANO, HEREDIA, PEÑA, VILlARREAL, OCOTLÁN, OROZCO y BUCIO

DEL COLÁGENO DE HUESO ANTIGUO

noácidos libres. De estas proteínas, la que se encuentra en mayor proporción es el colágeno, si bien hay también una menor cantidad de proteínas diferentes al colágeno que pueden preservarse, así como otras proteínas que se incorporan al hueso durante el proceso diagenético y no son originarias de dicho tejido (Grupe, 1995). También es necesario mencionar el papel que desempeña el cristal al proteger a las moléculas orgánicas del tejido óseo y retardando la degradación de las mismas, de ahí que la disolución de la fase mineral y el aumento de

El tejido óseo es en la gran mayoría de los casos la estructura de origen biológico mejor preserva-

la porosidad del hueso tengan un efecto negativo sobre la permanencia de las proteínas,

da respecto al tiempo. Se han realizado diversos estudios sobre los restos óseos para conocer su estado de preservación y obtener información

principalmente de aquellas que presenten mayor solubilidad. Por esta razón dificilmente se encuentran las moléculas orgánicas solubles en

relativa a su antigüedad. Estos estudios van desde aspectos macro estructurales hasta análisis de los cambios químicos, tanto en la fase orgánica (colágeno) como en la inorgánica (hidroxiapatita). A este conjunto de cambios se le denomina proceso diagenético y es resultado de las características propias del hueso al sobrevenir la muerte del organismo, junto con las condiciones ambientales (condiciones de enterramiento) a las cuales se encuentra sujeto durante determinado tiempo. El proceso diagenético varía de un ambiente a otro y depende de gran variedad de interacciones, que incluyen factores biológi-

los huesos fósiles. El factor inicial de la degradación del colágeno es la descomposición que originan múlti-

cos, químicos y fisicos. Hay parámetros cuantificables que muestran el estado de preservación del tejido óseo y posi-

den acceder al tejido óseo debido a la presencia de la fase mineral, se origina un segundo mecanismo de degradación, donde el colágeno se va hidrolizando lentamente hasta que las cadenas son de un tamaño suficientemente pequeño para ir saliendo de la estructura del hueso (Collins et aL, 1995). Este segundo mecanismo se

medio de sustituciones de distintos grupos se origina el carbonato de HAp; la fórmula de la HAp es CalO(P04)6(OHh y su estructura se obtiene a partir de análisis de patrones de difracción de rayos x. Se ha planteado que la nucleación de los cristales de HAp puede darse a partir de precipitación directa o mediada por cristales de fosfato octocálcico (CagH2 (P04)6' H20), los cuales presentan gran similitud con los de HAp. CARACTERÍSTICAS GENERALES

ples organismos presentes en el suelo pfóximo al tejido, que son capaces de secretar distintas proteasas y peptidasas que atacan específicamente a las proteínas. Esto se debe a que ciertas moléculas como el colágeno no pueden ser introducidas a través de la membrana de dichos organismos descomponedores, por lo que requieren de exoenzimas para degradar ese tipo de polímeros en moléculas de menor tamaño (Child, 1995). Cuando estas exoenzimas no pue-

bilitan dilucidar a qué condiciones ha estado sujeto el hueso y establecer su antigüedad relativa. Estos parámetros son principalmente la integridad histológica del tejido, la pérdida de colágeno, el aumento de la cristalinidad y el cambio de la porosidad (Hedges y Millard, 1995). Para entender los cambios que presenta el

lleva a cabo durante largos periodos, de miles a millones de años, y depende de la humedad relativa del medio donde se encuentra el tejido. Por esta razón se asegura que la pérdida de colágeno se debe más a la química del suelo circundante al hueso que a la acción de los microorganismos, los cuales sólo podrían actuar sobre

colágeno en muestras arqueológicas es importante tomar en cuenta los factores que participan en mayor proporción en su degradación. Las proteínas presentes en huesos fósiles suelen ir en remanentes o fragmentos de la estructura original; pueden ser desde péptidos hasta ami-

las moléculas superficiales más expuestas.

148

que se encuentran


FECHAMIENTO DERESTOSÓSEOSDELACUENCA DELVALLE DEMÉXICO Durante la diagénesis del hueso no todos los procesos son deletéreos para las proteínas, puesto que se han descrito algunos tipos de reacciones que introducen entrecruzamientos en las moléculas del colágeno. La formación de entrecruzamientos no específicos se genera mediante diversos mecanismos químicos (Van Klinken y Hedges, 1995). Una clase se lleva a cabo con compuestos húmicos exógenos. Los compuestos húmicos son moléculas complejas,

condiciones climáticas, de humedad y temperatura para evitar variaciones que interfirieran en los resultados. Por consiguiente, Heju Jang limitó el muestreo de restos óseos a una sola región climática bien definida: la cuenca de México, un área en donde se han efectuado estudios climatológicos completos y que fue

predominantemente aromáticas, hidrofílicas, que presentan pesos moleculares de cientos a miles de daltones; se forman a partir de carbo-

hispánica y colonial se efectuaron entierros. Menciona en su tesis que, lamentablemente,

ocupada por el hombre desde una época muy temprana, y además porque hay en ella un gran número de sitios donde durante las épocas pre-

algunos de los restos óseos no cumplen con los requisitos de selección; sin embargo, fueron analizados para tener un número suficiente de muestras que resultaran representativas; otras

hidratos de origen animal y vegetal, mediante una reacción amino-carbonil de azúcares reducidos con grupos aminos libres de diferentes

definitivamente no fueron estudiadas. Obtuvo algunos resultados no esperados, los cuales pueden estar relacionados específicamente con el origen de los ejemplares. Las muestras habían

proteínas. Se ha planteado que los compuestos húmicos también se pueden generar in situ con el colágeno del tejido óseo de huesos antiguos, aunque no se tiene bien claro el tipo de entrecruzamiento que ocurre entre ambos, por lo que pueden estar presentes interacciones del

sido limpiadas previamente por HejuJang, por lo que se encontraban en perfectas condiciones para su análisis. Corresponden a las siguientes

tipo hidrofóbicos y Van der Waals, así como uniones iónicas y covalentes, pero éstas deben ser tan fuertes como las que estabilizan las interacciones entre las triples hélices de coláge-

localidades: 1) Cuicuilco: pertenece al Preclásico tardío (hace 2250 ± 350 años). Se encuentra al sur de la cuidad de México, junto a la Vil\a Olímpica. 2) Oztoyohualco: pertenece al Clásico tardío (hace 1450 ± 100 años). Se encuentra ubicado en el margen noroeste de la ciudad de Teoti-

no (Van Klinken y Hedges, 1995). MUESTRASÓSEASPROVENIENTES DE LA<;;UENCA DE MÉXICO Las muestras óseas fueron obtenidas del Instituto de Investigaciones Antropológicas de la

huacan. 3) Tlalocan: pertenece al Clásico tardío (hace 1 300 ± 100 años). Es un conjunto de cuevas

UNAM,cedidas por Heju Jang, quien las seleccionó de acuerdo con determinados criterios

que se encuentra al oriente de la Pirámide del Sol, que al parecer servía de cementerio o era sitio donde se realizaban actividades rituales. 4) Xochimilco: pertenece del Preclásico tardío

en su tesis de maestría Uang, 2000), donde refiere la aplicación de un método de fechamiento por colágeno residual. Establece asimismo un criterio para la selección de muestras, que

hasta el Posclásico tardío (de$de 614.5 ± 135.5 hasta 2 250). Se encuentra en el área central del Foro Cultural Quetzalcóatl, en el Centro Histórico de Xochimilco.

analizó con el fin de obtener un margen de error mínimo en el cálculo de la tasa de pérdida del colágeno en las muestras óseas y formular, con esa medida, un método de fechamiento relativo. Los requisitos para seleccionar una muestra fueron: la ausencia de patología, que perteneciera a una persona adulta, el tipo de enterramiento, así como que tuviera las mismas

5) Tlatelolco: pertenece al Posclásico tardío (hace 614.5 ± 135.5 años). Se ubica entre el Eje Central Lázaro Cárdenas y Manuel González, junto a la iglesia de Santiago Tlatelolco, en la zona denominada Plaza de las Tres Culturas.

149


LOZANO, HEREDIA, PEÑA, VILLARREAL, OCOTLÁN, OROZCO y BUCIO

1) Cuicuilco 2) Oztoyohualco 3)Tlalocan 4) Xochimilco 5) Tlatelolco 6) Templo de San Pedro y San Pablo 7) Ex convento de San Jerónimo

Figura 2. Mapa de la cuenca del valle de México.

6) Templo de San Pedro y San Pablo: fechado entre 1790 y 1840 (hace 185 ± 25 años). Se encuentra en el perímetro "A" de la zona del Centro Histórico de la ciudad de México, en la

cuando las adquirió el laboratorio. P6steriormente se les pulverizó en un molino utilizando un mortero de ágata y se les tamizó mediante una malla del 325 para obtener partículas de

esquina de la calle San I1defonso, 3" del Carmen y 2" de Venezuela. 7) Ex convento de San Jerónimo: fechado

un tamaño homogéneo, alrededor de 40 micrómetros. El material óseo se puede tratar de distintas

entre 1626 y 1850 (hace 274.5 ± 99.5 años). Se encuentra en el Centro Histórico de la ciudad de México en la cuadra limitada por las calles de San Jerónimo, 5 de Febrero, Izazaga e Isabel La Católica; también es llamado Claustro de Sor

formas, dependiendo del tipo de análisis al que va a ser sometido para obtener resultados que reflejen las características del mismo y que no favorezcan la aparición de distintos tipos de señales cada vez que se analice una misma muestra, es decir, para obtener resultados reproducibles e interpretables. En el caso de la calorimetría de

Juana. 8) Xcambó y Bonampak: muestras no anali-

barrido diferencial (CBD) , es preferible que la muestra tenga un contacto superficial amplio con el crisol de aluminio, por lo que la mejor for-

zadas por Jang Cho provenientes de los respectivos sitios arqueológicos; su antigüedad se calcula alrededor de 1350 ± 150 años. El interés por analizar esta~ muestras es compararlas con las de su misma antigüedad.

ma de asegurarse de ello es trabajar con la muestra en polvo, de modo que se distribuya homogéneamente sobre toda la superficie del crisol. Si se trabaja con la muestra en forma de trozo, se sugiere que tenga la mayor superficie de contacto, y debe presentar una alta difusión de calor a través de su estructura para que el termograma represente en mejor forma el proceso que se esté analizando. El crisol de aluminio

METODOLOGÍA

Se limpiaron las muestras para eliminar las impurezas externas, ya fuera polvo, arena, tierra, restos de detritus, etc., que pudieran traer

150


FECHAMIENTO DE RESTOS ÓSEOS DE LA CUENCA DEL VALLE DE MÉXICO

MUESTRAS OSEAS

MORTERO

Las muestras óseas se limpian de impurezas externas y se corta un fragmento.

DE ÁGATA

El fragmento de hueso se pulveriza y posteriormente se tamiza para obtener un tamaño de partícula homogéneo

j

TERMOGRAMA

MÓDULO

DEL CAlORfMETRO

r:--..c.

~~'IFJ'.

(11~11~1 I

•• , ••

. t1

Tiempo (s)

..

'

,

t2

Se obtiene un termograma en el cual el área bajo la curva representa la energía (entalpía) que se liberó durante la combustión del colágeno del hueso. Esta energía es proporcional a la cantidad de colágeno del material óseo.

Figura 3. Metodología

la muestra (-1.0 mg) se analiza en el calorímetro. Se utiliza un ritmo de calentamiento de 10 °C/min.

de análisis de material óseo.

se puede utilizar en el módulo con o sin tapa de aluminio. Experimentalmente se encontró que en ciertos casos, al estar tapado, el gas producto de la degradación y combustión de la proteína genera una presión de vapor que provoca ruido en la señal. Debido a ello se hizo el análi-

se utilizó una velocidad de calentamiento de 10 °C/min, desde temperatura ambiente hasta 600 oC, temperatura máxima que el diseño del

sis sin tapa. La calorimetría se realizó en el equipo Thermal Analysis System 9900, Du Pont 910 Módulo

ANÁLISIS DE MUESTRAS ÓSEAS

módulo permite alcanzar.

Prácticamente

todos los termogramas

de las

muestras óseas son semejantes entre sí en lo que respecta a su forma y a la presencia de picos exotérmicos y endotérmicos. En la gráfica 1 se comparan los termogramas de todas las muestras y se observa la presencia de un primer pico

DSC. Las muestras

de hueso se colocan en un crisol de aluminio; se introducen en el analizador térmico las muestras de interés, así como la referencia. La cantidad de muestra consistió en 2.0 mg de hueso en polvo. En todos los casos

151


LOZANO, HEREDIA, PEÑA, VILLARREAL, OCOTLÁN, OROZCO y BUCIO GRÁFICA 1. TERMO GRAMAS DE MUESTRAS ARQUEOLÓGICAS. A LA DERECHA SE MUESTRA LA ANTIGÜEDAD DE LAS DISTINTAS MUESTRAS ÓSEAS

En la gráfica 2 se observa la relación entre la entalpía de los huesos analizados y su respectiva antigüedad. Cada barra representa el promedio del valor de entalpía de un conjunto de muestras de un mismo periodo. Se puede observar el comportamiento general ilustrado por una curva de decaimiento exponencial.

3150 3150 2250 2250

CONCLUSIONES

2250

-

1450

La estabilidad térmica de distintas proteínas, en especial la del colágeno tipo I, se ha estudiado ampliamente en lo referente al proceso de desnaturalización (Komsa-Penkova el al., 1999; Rochdi el al., 2000; Miles el al., 1995, y Miles el al., 1998) mediante el uso del calorímetro en un

1350 1350 1300 1300 1250 825 614 ---

614

---

614

---

614

intervalo de temperatura de 20 a 80 OC. En dichos trabajos la estabilidad térmica se determina a partir de la Tmax a la cual se origina la desnaturalización, que se presenta alredeaor de 60 oc. En lo concerniente al proceso de degradación y combustión del colágeno tipo I, en el

274 274 274 185 185 185 185 I

I

I

200

400

600

Temperatura (OC)

presente trabajo se ha empleado el mismo criterio para establecer la estabilidad térmica mediante la Tmax del pico exotérmico de mayor intensidad. En todos los casos estudiados la Tmax se encuentra alrededor de 350 oC. En algunos casos, principalmente de las mues. tras más antiguas, existe una disminución del segundo pico que aparece como un hombro, el cual no se presenta bien definido, mientras que en las más recientes sí se llega a observar más claramente. Otra diferencia entre los mismos

exotérmico de mayor intensidad (Tmax) alrededor de 350 oC y un hombro, en algunos casos muy disminuido, alrededor de 440 oc. Se puede observar claramente que algunas muestras presentan picos exotérmicos más pronunciados; de ellas se obtiene un mayor valor de la entalpía de combustión (energía asociada a la pérdida de colágeno debido al tratamiento térmico). A una mayor cantidad de colágeno en el hueso corres-

huesos es la intensidad (mW) de cada uno en sus respectivas curvas termoanalíticas, lo cual se refleja en los valores del área bajo la curva y por ende en los valores de entalpía, y es dependiente de la cantidad de materia orgánica, en este caso colágeno, que se conserva en su estructura (Lozano el al., 2002).

ponde un mayor valor de entalpía. El valor de la entalpía se obtuvo utilizando la masa total (2.0 mg) empleada en el calorímetro para poder compararlas. Cabe mencionar que todas las muestras fueron analizadas utilizando la misma masa.

A partir de estos resultados se observa una mayor pérdida de colágeno en los huesos más antiguos, mismo resultado que se obtuvo en la tesis de Jang, aunque también se observa claramente que algunas muestras presentan una

152


FECHAMIENTO DE RESTOS ÓSEOS DE LA CUENCA DEL VALLE DE MÉXICO

GRÁFICA

2

RELACIÓN ENTRE LA ENTALPÍA YLA ANTIGÜEDAD

Muestras

actuales

Siglos XVII-XIX

Posclásico tardío

cantidad de colágeno distinta de la esperada, dada su antigüedad, lo cual lleva a suponer que no tuvieron el mismo proceso de degradación que las demás muestras.

Clásico tardío

Preclásico

correspondan

11DO a.e.

tardío

a distintas características de ente-

rramiento; asimismo es necesario evitar trabajar con muestras que presenten patologías y tener un amplio conocimiento de la química del

Es importante mencionar que Jang no empleó en su estudio todas las muestras que se analizaron en el presente trabajo porque a dos no las consideró adecuadas (las de Tlatilco y Xochimilco ent. 9, véase la tabla 1) y otras (Xcambó y Bonampak) se salían del contexto arqueológico de)a cuenca del Valle de México. Aun así, en sus resultados encontró también algunas discrepancias respecto al modelo de degrada-

suelo donde se hayan encontrado los restos óseos. El propósito de obtener diferentes curvas que muestren distintos ritmos de degradación del colágeno es encontrar una relación entre dicho ritmo y las características químicas del suelo, y posteriormente predecir, a partir de las características fisicas del hueso, de sus valores de entalpía y de su antigüedad estimada dependiendo del estrato del cual proviene, las carac-

ción propuesto, en particular con las muestras de Xochimilco, San Pedro y San Pablo y San Jerónimo. En los resultados del presente trabajo se ad-

terísticas de enterramiento y los factores que afectaron principalmente su estructura y provocaron su degradación. Sólo teniendo en claro lo anterior se podría predecir la antigüedad de un resto óseo mediante las técnicas utilizadas en el presente trabajo. Cabe mencionar que cuantas más sean las técnicas empleadas que aporten diferentes datos en lo que se refiere a las características del

vierte asimismo que algunas muestras estudiadas y no estudiadas por Jang tienen discrepancias respecto a la tendencia esperada del decaimiento exponencial que, en teoría, presenta la pérdida de colágeno en huesos antiguos, bajo las mismas condiciones tafonómicas (o de enterramiento) . Por otro lado hay que considerar que se requiere contar con un mayor número de muestras analizadas para poder ajustar las curvas que

colágeno y la relación entre la fase orgánica y la inorgánica, mejor será la estimación de la antigüedad de un resto, puesto que la diagénesis del tejido óseo es un proceso multifactorial.

153


LOZANO, HEREDlA, PEÑA, VIllARREAL, OCOTLÁN, OROZCO y BUCIO

BIBLIOGRAFÍA

Komsa-Penkova, R., R. Koynova, G. Kostov y B. Tenchov (1999), "Discrete Reduction of Type

Collins, M., M. Riley, A. Child y G. Turner-Walker (1995), "A Basic Mathematical Simulation of the Chemical Degradation of Ancient Collagen", ¡oumal of Archaeological Science, núm. 22, pp. 175-183. Child, A. (1995), "Towards an Understanding of the Microbial Decomposition of Archaeo-

1 Collagen Thermal Stability upon Oxidation ", Biophysical Chemistry, núm. 83, pp. 185-195. Lozano, L.F., MA Peña-Rico,]. Jang-Cho, A. Heredia, E. Villarreal,].

of Collagen in

Bone From Dry, Sandy Soil", ¡oumal of Archaeological Science, núm. 22, pp. 193-199. Hedges, E.M. y A. MiIlard (1995), "Bones and

of Collagen in Unrestrained Rat Tail Tendon Determined by Differential Scanning Calorimetry", ¡oumal of Molecular Biology, núm.

Groundwater: Towards the Modelling of Diagenetic Processes", ¡oumal of Archaeological Science, núm. 22, pp. 155-164. ---y A. MiIlard (1995), "Measurements and Relationships

of Diagenetic

Alteration

AL.

Mineralized and Non Mineralized Type I Collagen in Bone", Materials Research Science Symposium Proceedings, vol. 274, núm. 7.6.1, Materials Research Society. Miles, CA, T. Burjanadze y A Bailey (1995), 'The Kinetics of the Thermal Denaturation

logical Bone in the Burial Environment", ¡oumal of Archaeological Science, núm. 22, pp. 165-174. Grupe, G. (1995), "Preservation

Ocotlán-Flores,

Gómez-Cortés, FJ. Aranda-Manteca, E. Orozco y L. Bucio (2002), "Thermal Properties of

--,

245, pp. 437-446. L. Knott, I.G. Sumner y A Bailey (1998),

"Differences between the Thermal Stabilities of the Three Triple-helical Domains 'of the Type IX Collagen", ¡oumal of Molecular Biolagy, núm. 277, pp. 135-144. Rochdi, A, L. Foucat y]. Renou (2000), "NMR

of

Bone from Three Archaeological Sites", ¡oumal of Archaeological Science, núm. 22, pp. 201-209. Heredia, A. (2000), .estudio de huesos antiguos y modernos: morfologia, estructura y aportaciones al estudio de biomateriales, México, UNAM, Facultad de Ciencias.

and OSC Studies During Thermal Denaturation of Collagen ", Food Chemistry, núm. 69, pp. 295-299. Van Klinken, G. y E.M. Hedges (1995), "Expe-

Jang Cho, H. (2000), El método defechamiento por colágeno residual aplicado en siete sitios arqueológicos de la cuenca de México, México, UNAM, Facultad de Filosofía y Letras.

riments on Collagen-humic Interactions: Speed of Humic Uptake, and Effects of Diverse Chemical Treatments", ¡oumal of Archaeological Science, núm. 22, pp. 263-270.

154


APPROXlMATE THE MICROSCOPE

DATING OF TEPHRA USING "SEAT-OF-THE-PANTS" METHODS

TO ROUGHLY DATE QUATERNARY ARCHAEOLOGICAL AND PALEONTOLOGlCAL

SITES BY AsSOCIATED

PUMICE

AND VOLCANIC AsH LAYERS Virginia Steen-McIntyre*

RESUMEN

clay with time, and heavy mineral phenocrysts are etched in place forming "picket fence" or "saw tooth" structures. Noting the extent of these weathering phenomena can give a rough age estimate for the tephra layer ofinterest. Evidence for Mid-Pleistocene Puebla Man is reviewed.

La hidratación en los fragmentos de vidrio del pómez y en las cenizas volcánicas silícicas es la misma que en la obsidiana. El agua tarda miles de años para entrar en el vidrio. Una vez dentro, tarda millones de años en penetrar las burbujas del vidrio, formando así una gran hidratación. Los fenocristales de feldespatos se alteran con el tiempo y se transforman en arcilla. Los fenocristales de minerales pesados se transforman en el

KEYWORDS Tephra, volcanic ash, early man, Mexico.

mismo sitio y se van estructurando en parte en forma de sierra. Al observar con el microscopio se puede saber, aproximadamente, la edad de las partículas de tefra según la alteración de los fragmentos. En este texto se incluyen también algunas evidencias, ya conocidas, de la presen-

INTRODUCTION There can be no doubt that the Basin of Mexico and the adjacent Puebla-Tlaxcala Basin

cia del "Hombre de Puebla", que debe haber vivido en el Pleistoceno medio.

offer exciting potential for the study of Early Man. Here He isolated remnants of a thick blanket of Quaternary sediment, containing countless layers of volcanic ejecta and rich in buried

ABSTRACT

soils, carbonate layers, fossil pollen, fresh-water diatoms, shell, bone, and human artifacts all waiting to be studied. It is also true that there has been much erosion here, and archaeologists and paleontologists often find themselves excavating at isolat-

Glassy fragments

of pumice and silicic volcanic

ash hydrate in the same way as does obsidian. They then "superhydrate" as, over millions of years, water slowly accumulates in the enclosed bubble cavities. Feldspar phenocrysts weather to

*

ed outcrops without a clue, at least at first, as to the age of the deposits they are uncovering. This can be costly. For example, assume you have

Idaho Springs, Colorado, USA.

opened a new site in sediments ofunknown

155

age


VIRGINIA STEEN-McINTYRE

and have found an interesting human skull. It proved to be undatable by the radiocarbon

shards hydrate (absorb water) the way an obsidian artifact does at first, but then go on to

method. Was the problem due to an exotic groundwater chemistry, or was it undatable because the actual age lies far beyond the limits of carbon-14 method? lf the latter is true, then

superhydrate, with water collecting in the enclosed bubble cavities molecule by molecule over millions of years (Steen-McIntyre, 1975 and cited references). It also can turn to clay. The feldspar phenocrysts turn to clay with time. The heavy-mineral phenocrysts, those that sink in the laboratory liquid called bromo-

scarce research funds would have been better spent if the uranium-series dating methods had been chosen instead. They can give actual numbers for these old bones.

form while the others float, selectively etch in place due to intrastratal solution to form shaggy ends and what 1 call "picket-fence" or "saw tooth" structures. The mineral hypersthene is attacked first, then augite, then hornblende (Steen-McIntyre, 1977).

In this paper 1 would like to share with you how one could make a preliminary age estimate of a new excavation in Mid- 'or Late-Quaternary sediments using the tephra layers exposed there. We will be looking at weathering phenomen a as seen through the microscope.

1 will be comparing weathering characteristics of young tephra versus old tephra. By "young" 1 mean vo1canic fragments of Late

TEPHRA DEFINED

Pleistocene and Holocene age: by "old" those of late Mid-Pleistocene age, around a quartermillion years. The latter were collected' from overlying, younger sediments at the Hueyatlaco archaeologic site east of here, south of the city of Puebla. Pie ase keep in mind that 1 will be dealing with broad generalizations. There are other factors besides time that can affeet the extent of weathering of tephra fragments, and

'Tephra" is a generic term for pyroclastic or fire-broken rock fragments of any size or type that have been ejected through the air by a volcanic eruption. The term comes from the classical Greek word for "ash" and was introduced in 1944 by the Icelandic geologist Sigurdur Thorarinsson, and later defined by him as "collective term for all the clastic vo1canic material which during an eruption is transported from the crater through the air, corresponding to the term "lava" to signify all the molten material flowing from the crater. (Thorarinsson, 1954) Tephra fragments from a liquid magma are

I've covered many of them elsewhere (1977, 1981, 1985 and cited references) . We willlook specifically at the heavy mineral phenocryst canic.

hypersthene

and at silica-rich vol-

composed of various amounts of mineral crystals of several varieties, collectively called phenocrysts, and usually a large volume ofvo1canic glass. The phenocrysts were growing in the magma at the time of the eruption; the vo1canic glass, with or without bubble cavities frozen in place, is the chilled magma itself.

Hypersthene phenocrysts from various dated eruptions are shown in figure l. AlI crystals are small, roughly the size of grains of table salt.

WEATHERING OF TEPHRA FRAGMENTS

Figure la shows hypersthene crystals from the 12000 year old Glacier Peak tephra, Washington State, USA. They are mounted in a

WEATHERING OF HYPERSTHENE PHENOCRYSTS

refractive index oil near that for the feldspar crystals and vo1canic glass and viewed through

Weathering affects the various tephra components in different ways. Silicic vo1canic glass

the microscope. AlI have opaque inclusions. No

156


Al'PROXIMATE DATING OF TEPHRA USING THE MICROSCOPE "SEAT-oF-THE-PANTS"

a weathered area in a large pumiee clast. The adhering clay has been removed by ultrasonie cleaning, revealing the shaggy ends and sawtooth strueture of a hypersthene crystal being eaten away in place by intrastratal solution. Zireons from the pumice have been dated by the fission-traek method at 600000 Âą 340000 years, 2 sigma (Steen-Mclntyre et al., 1981). Hypersthene grains from an un-named, undated tephra unit sorne nine metres lower in the seetion than the Tetela brown mud is shown in figure Id. lt oeeurs as a small ehannel in beds that contain bifacial tools. In this view, the weathering of hypersthene erystals is quite advaneed, with tiny, slender spikes that eertainly would be broken off if they had been transported any dis-

Figure 1a-d. Hypersthene phenocrysts [rom various dated units as seen through the microscope: a) 12000 years; b) 10 000 years; e) and d) roughly 250000 years.

sign of shaggy ends or picket-fenee weathering.

tanee by geologie proeesses. This tephra unit is less silicie than the Tetela brown mud pumiee, which may help explain the highly altered state

Tephra fragments from the Tlapaeoya arehaeologie site south of Mexieo City, roughly 10000 years old, are shown in figure lb. To the right is a brown hornblende crystal, looking rather fresh. To the upper left, barely in sight, a hypersthene grain, looking rather melted. Again, no

of the hypersthene phenoerysts. No zircon phenoerysts were present in this tephra, so it eould not be dated direetly by that method. See table 1.Does your hypothetical new exea-

sign of shaggy ends. We now move to the Hueyatlaeo site on the north shore of the Valsequillo Reservoir and jump far baek in time to the late Mid-Pleisto-

vation contain a primary tephra layer, and does that tephra include hypersthene phenoerysts? If the erystals are fresh in appearanee eonsider a Holoeene age; if frayed at the ends, perhaps Late Pleistoeene; if shaggy with picket-fenee struetures you may possibly have a Late MidPleistoeene site, or older.

cene. First, a hypersthene grain from the Tetela brown mud unit exposed at the top of the seetion, and roughly ten me tres aboye the artifaetbeariiJg beds (figure le). It was eolleeted from

TABLE

1

WEATHERING EXTENT OF SELECTED TEPHRA COMPONENTS Fragments

Possible Age

Appearance

Holoeene Late Pleistoeene Lated Mid-Pleistoeene

Hypersthene Phenoerysts

Fresh grains Frayed (shaggy) ends "pieket-fenee" struetures

Siliea-rich Volcanie

Glass partly hydrated Vesicles empty ofwater

Holoeene

Glass eompletely hydrated Sorne vesicles with trace water

Late Pleistoeene

Glass completely hydrated Most vesicles 10% or more water

Late Mid-Pleistoeene or earlier

Glass Shards

157

(sawtooth)


VIRGINIA STEEN-McINTYRE

WEATHERING OF SILICA-RICH VOLCANIC GLASS SHARDS

SHARDof incompletely-hydrated

glass will have

a large refractive index range. The third view (c) occurs at about 12000 years, at least in cool temperate climates (The rate of hydration would be faster in southern

We will turn now to the silicic volcanic glass shards and their uptake of water with time. It occurs in two steps: first hydration, then superhydration. The hydration/superhydration concept can be ilIustrated by the diagram in fig-

Mexieo because the soil temperature is warmer). Here, hydration has proceeded until only a small volume of glass, located in the thickest

ure 2. It follows the history of a small shard of platy, rhyolitie glass as it passes through various stages of water accumulation . In view (a) at the upper left we have our first look at the shard, shortly after birth. It has an enclosed bubble cavity or vesicle, represented

portion of the shard, remains unhydrated. Volume of the low-index, non-hydrated glass becomes smaller as time passes, until at about 15000-20000 years (in a cool temperate climate) none is left. Mter the shard has hydrated, water continues to diffuse through the glass structure and begins to collect as tiny menisci in the tape red ends of closed vesicles (d). This process of superhydration is extremely slow,

by the spindle-shaped form, and sorne thickness, represented by the ridge line running across its upper surface. The shard has not yet begun to hydrate. It has a single refractive index value representing the non-hydrated glass, and the enclosed vesicle is liquid free.

and it may take over ten million years for all the cavities to fill. The remaining views (e-h) show water progressively filling the vesicle until, in the last one, it is full.

View (b) occurs approximately 2 000 years later. Water of hydration has penetrated the glass from all exposed surfaces, raising the refractive index of the glass 0.01. On wedge-

Figure 3a-f shows various the stages of hydration and superhydration as seen through the microscope. AlI fragments are tiny silica-rich volca-

shaped surfaces such as occur around the perimeter of the shard, the hydration rinds

nie glass shards from dated eruptions: (a) Mount Sto Helens, 3000-4000 years; (b) Tlapacoya, ca.

have merged, and appear through the microscope as a high refractive index rim of glass surrounding a low refractive index coreo EACH

10 000 years; (c) Río Frío ashf1ow, > 35000 years; (d) Hueyatlaco ash, 370000 ± 200000 years, 2 sigma (zircon fission track date, Steen-Mclntyre el al., 1981); (e) a Yellowstone tephra, 1200000 years; (f) Bidahochi ash; Pliocene age. A platy glass shard from one of the StoHelens eruptions is seen in figure 3a. The lighter narrow rim in focus at the upper right is the hydration rind (arrow). It concentrates the light because it has a refractive index higher than the non-hydrated glass coreo With the various focal masking methods of microscope ilIumination, the rind shows brilliant colors and is easy to recognize (Steen-Mclntyre, 1977; Wilcox, 1962 and cited references). Now for the bubble cavities or vesicles. See figure 3b for sorne enclosed ones from a glass

Figure 2. Diagram of a tiny volcanic glass shard of rhyolitic composition (high silica) as it passes through various stages of hydration and superhydration. It can take millions ofyears for this double process ofwater absorption to be completed.

shard ofTlapacoya tephra, roughly 10 000 years old. The cavities are outlined in black; a sign that there is essentially no water in them. A

158


AJ'PROXlMATE

DATING OF TEPHRA

USING THE MICROSCOPE

"SEAT-OF-THE-PANTS"

A shard from one of the tephra layers in a series of eruptions fram vents located in Yellowstone NationaI Park, USA (3e). This one is dated at 1 200000 years. Still more water. And finally, a shard ofBidahochi ash, Pliocene in age (3f). At the top is a bubble cavity open to the shard surface and filled with immersion oil. Beneath it, a spherical cavity completely filled with water. At right center is a larger vesicle that is not yet completely filled. See table l. ls the tephra layer in your hypothetical excavation silica rich? Does it contain glass shards with bubble cavities? If the glass is partially hydrated and the bubbles are empty, it is probably Holocene in age. If the glass is completely hydrated and a few vesicles also contain traces ofwater in the tips, it could be Late Pleistocene. If it contains an appreciable amount of water, think Mid-Pleistocene or older.

SUPERHYDRATION CURVES COMPARED, MEXICO Figure 3a-f:Silica-richvolcanic glass shards from dated tephra eruptions showing various hydration and superhydration features: a. hydration rind; b-f. progressive stages of superhydration.

Extent of superhydration can be plotted as we see in graph 1. For each dated sample, 100 shards with spindle-shaped cavities 10-50 micrometers long were examined for water by visual estima-

shard yf Río Frío glass from an ashflow deposit half-way between Mexico City and Puebla is shown in figure 3c. Charcoal logs from the ash flow dated beyond the limits of the radiocarbon

GRAPH 1

EXTENT SUPERHYDRATION OF SILICEOUS VOLCANIC GLASS SHARDS. CUMULATIVE CURVES FOR DATED TEPHRA UNITS FROM SOUTH CENTRAL MEXICO AND YELLOWSTONE NATIONAL PARK, USA

method back in the 60's, at least 35000 years. Look cIosely at the upper ends of the elongate vesicles (arrows): they are beginning to fill with water. Another glass shard (3d), this fram the HueyatIaco ash, a metre-thick, flat-lying unit exposed in the trenches at the HueyatIaco site. Direct tracing ofbeds places the ash bed roughly 3 metres aboye the layers with bifacial tools. It has a

Number of Shards 100,-----_---_--..-----__;;¡

zircon fission track date of 370000 ± 200000 years (Steen-McIntyre el al., 1981). The two small vesicles (arrows) contain definitely more than a

25

75

50

\0 ~8X10'

>2~OXxl~~'

'tfl ,

>35 x 10lyears

,

Yellowstone Tephra (2S1,OOOyears)

O 0.1

trace of water.

10 Percent Water in Vesicles

159

33 67100


VIRGINIA

STEEN-MCINTYRE

tion, and the result plotted as a eumulative curve. The method is most sensitive for the

that should be of interest to archaeologists earth scientists working in this area.

younger samples. Clustered in the upper left corner are curves for samples of La Malinche tephra (8000 years), Tlapacoya (lO 000 years), another tephra from La Malinche (>24000 years) , and the Río Frío ash flow (>35000 years). In the middle of the graph, lying close to the curve for

Fifty years ago, a long, continuous sediment core, the belles artes eore, was taken in Mexico city (Barghoorn el aL, 1954 and cited references). At approximately 70 metres, palynologists found several grains of maize pollen (figure 4). It eaused quite a stir back then. One scientist

a Yellowstone tephra dated at 251 000 years are two of the tephra layers fram above the artifactbearing sediments at Hueyatlaco, the Hueyatla-

thought the sediment was essentially modern, and that there had been a lot of deposition in the area in the recent past (Sears, 1982). Others

co ash and the Buena Vista lapilli. There's a large gap between these two clusters of curves, representing the great differenee in age.

offered different explanations (Beadle 1978, 1981, and cited references). I don't believe the problem was ever resolved.

I would now like to add to graph 1 a curve that represents a tephra layer of unknown age

In the mid-70's, I was given tephra samples from the core to study, including a small sample of a 20 cm tephra layer associated with the maize grains. I eheeked the glass shards from that layer for water of superhydration in the vesicles and plotted the resulto

Maize Teosinte? /'

The curve is shown in graph 2. It seems to indicate that the 70 m tephra horizon and the associated maize pollen grains are not "young". Rather, they are possibly Mid-Pleistocene in age and may have been deposited at roughly the same time as Puebla Man was hunting big game a few tens of kilometers to the east.

Tripsacum

~=======1"

Maize

15-~

45-

~========~

GRAPH2 EXTENT SUPERHYDRATION OF SILICEOUS VOLCANIC GLASS SHARDS. CUMULATIVE CURVES FOR DATED UNITS PLUS UN-DATED BELLES ARTES TEPHRA LAYER, 70 M DEPTH

Tripsacum

60-

Belles Artes

) Tephra-

75M-

and

~~~~~~~S-

Maize

100 r------_t_---_t_--+-j

Tripsacum

75

Maize

•. -----::;o

50

Tripsacum 25

Figure 4: Belles Artes sediment core, Mexico City, with position of maize grains and the ca 70 m tephra layer (Modified from Barghoorn el al., 1954: 234).

O 0.1

10 Percent Water in Vesicles

160

33

67 100


APPROXIMATE

DATlNG

OF TEPHRA

USING

THE MICROSCOPE

"SEAT-OF-THE-PANTS"

EVIDENCE FOR PUEBLA MAN REVIEWED What do we know about this early man? The late Professor Juan Armenta Camacho of Puebla studied the evidence of his presence in the Valsequillo area for 30 years and reported on his finds (1957,1978, and cited references). Our ancient friend actively hunted mastodon and mammoth, he was possibly a great artist, and he didn't loo k like uso Figure 5: Ostrander skull, reported to have been collected at the Hueyatlaco Site in the late 60's or early 70's. The skull is to the right, a modern skull for comparison to the ยกeft. Photo provided by the late Dr. Charles Ostrander.

SKULLS We have references to two primitive-looking human skulls from the Valsequillo area. The first is the Dorenberg skull. It was collected south of the City of Puebla over 100 years ago (Reichelt, 1899 and 1900) and was put on display at a museum in Leipzig. It was destroyed during the

California, where it has been sto red all these years does not answer my letters of inquiry concerning it. Rumor has it (personal communica-

bombings of WW 11. We are still looking for a picture of it. Fortunately, the skull cavities were filled with

tion, anonymous) that they have given the skull to a Native American tribe for reburial without attempting to date it. The Dorenberg and Ostrander skulls now both may be beyond recall, but at least we know where to look to find others! The Valsequillo Reservoir area south of the City of Puebla 100 km east of here.

a diatomite deposit, and a sample of it ended up in the reference collection of the California Academy of Sciences in San Francisco. Here diatomist Dr. Sam Van Landingham examined it several years ago and tracked its history (Van Landingham, 2000, 2002 in press, and cited referenc~s). He noted that the slide contained diatom species extinct by the end of the Sangamon Interglacial 80000 years ago, and realized the implication. He also discovered recently that the suite of fossil diatoms from the Dorenberg skull is essentially identical to that collected from the upper artifact zone at Hueyatlaco, the one that produced bifacial tools. This would give a minimum age for both skull and bifacial tools, using diatom stratigraphy, of 80 000 years. The second skull, the Ostrander skull apparently was collected by someone at Hueyatlaco in the late 60's or early 70's (personal commu-

ARTIFACTS From the artifacts exposed at Hueyatlaco, we know that Puebla Man was an excellent tool maker. Figure 6a shows one of the unifacial artifacts from a lower, older leve!; figure 6b a bifacial tool from one of the upper artifact-bearing horizons, this one dated by diatom stratigraphy to be at least 80000 years old (Van Landingham, 2000; 2002 in press). Until very recently, such a date for a bifacial tool would have been considered "impossible". However, dates and reports coming out of Africa indicate that such

nication, anonymous). I have only one photo of it, sent to me by the late Professor Ostrander in the mid-70's (fig. 5). Note the thick brow

tools were being made there 230000 years ago (McBrearty and Brooks, 2000). Figure 7 shows a possible bit of his art work (Canby, 1979). This engraved fragment of mas-

ridges, the low brain case. Merced College in

161


VIRGINIA

STEEN-MCINTYRE

Figure 6a,b. Representative artifacts from the Hueyatlaco site, Valsequillo area, State of Puebla, Mexico. a. edge-trimmed projectile point from unit 11; b. bifacial bipointed projectile point from unit lE (Irwin-Williams, 1967). Photos by H.S. Rice.

Figure 7. Engraved fragment of a mastodon pelvis, 'Tetela 1" (Armen ta, 1978: 95-11 O). Photo from the Armenta estate collection.

todon pelvis was found in 1959 by Professor Armenta, one of several engraved bones mentioned in his monograph (1978). lt was firmly embedded in the indurated Valsequillo Gravels, 50 metres north of what was to become the principie Hueyatlaco excavation. In the center is a profile view of a double-tusked mastodon, probably Ryncotherium tlascalae. (Armenta, 1978: 110). Above it, also in profile, a cat-like creature. Prof. Armenta's drawings of the engravings, using the method of Breuil, are shown in Figure 8.

THE VALSEQUILLO AREA There can be little doubt that well made stone tools and ancient human bones can be found in the Valsequillo are a, including the Hueyatlaco site. Add to that the modified bone tools and hundred-plus butchered mammoth and mastodon kill sites reported by Professor Armenta in his monograph, and the region becomes even more interesting. The problem is not a lack of artifaets, the problem is to correctly date them.

TETELA

O

1

2

I

And this requires the focus to be shifted from archaeology to geology. Unfortunately, the principal investigator at Hueyatlaco, archaeologist Dr. Cynthia IrwinWilliams died before she could complete her

Figure 8. Professor Armenta's drawings of the engravings on 'Te teta 1", using the Breuil method of reproduction (Armenta, 1978: 105). Photo from the Al-menta estate collection.

162


APPROXIMATE

DATING OF TEPHRA

USING THE MICROSCOPE

Barghoorn,

final site reports, and much of the geological information that was to appear in them is still

"SEAT-OF-THE-PANTS"

E.S., M.K. Wolfe y K.H. Clisby

(1954), "Fossil Maize from the Valley of Mexico", Botanical Museum Leaflets, Harvard

in manuscript form (Malde 1968a, b; SteenMcIntyre 1968, 1970, 1972, 1975a) or buried in the literature (Steen-McIntyre, 1977; Malde and Steen-McIntyre, 1981). Irwin-Williarns' Valsequi-

University, núm. 16, pp. 229-240. Beadle, G.w. (1978), "Th~ Origin of Zea Mays", en D.L. Browman (ed.), Cultural Continuity in Mesoamerica, La Haya, París, Mouton Pu-

110data have disappeared from her USA files, but summaries of her results do exist in print and as progre ss reports (Irwin-Wi11iams, 1967a, b, 1969, 1978, 1981, and cited references). The

--

blishers, pp. 23-42. (1981), "Origin of Corn: Pollen dence", Science, núm. 213, pp. 890-892.

Evi-

evidence presented there makes it clear that the artifacts at Hueyatlaco were truly found in situ and were examined by prominent profes-

Can by, T.Y (1979), 'ihe Search for the First Americans", National Geographic, núm. 156, pp. 350-352.

sional colleagues vation.

Irwin-Williams, C. (1967a), "Associations of Early Man with Horse, Carnel, and Mastodon at Hueyatlaco, Valsequillo (Puebla, México)", en P.S. Martin yH.E. Wright,Jr. (eds.), Pleistocene Extinctions, the Search for a Cause, New Haven y Londres, Yale University Press,

during

the process of exca-

That being true, we geologists can now proceed with confidence to use methods common to our discipline to date ancient sites like Hueyatlaco with its thick overburden ofyounger sediment diatom stratigraphy, zircon fission track dating, uranium-series methods on fossil bone to name a few old standbys, with other, newer dating methods in progre ss.

---

search at Valsequillo, Puebla", Nuevo México, Paleoindian Institute, Eastern New Mexico University, Portales, 7p. (Misce11aneous Publications) . --(1969), "Comments on the Associations of Archaeological Materials and Extinct Fauna in the Valsequillo Region, Puebla, Mexico", American Antiquity, núm. 34, pp. 82-83.

CONCLUSION There's exciting times ahead! The eyes of the world will be on south-central Mexico as the age of earJy man in the Americas is pushed further and further back into time. And the lowly tephra layers and their weathering characteristics will playa major part in the drama, helping scientists to identify these old sites when they first encounter them in new excavations.

--

(1957), Hallazgos prehistó-

ricos en el Valle de Puebla, Puebla, Centro de ---

Estudios Históricos de Puebla. (1978), Vestigios de labor humana en huesos de animales extintos de Valsequillo, Puebla, México, Puebla, American Philosophical Society/ Mary StreetJenkins

(1978), "Summary of Archaeological Evidence from the Valsequillo Region, Puebla, Mexico", en D.L. Browman (ed.),

Cultural Continuity in Mesoamerica, La Haya, París, Mouton Publishers, pp. 7-22. --(1981), "Commentary on Geologic Evidence for Age of Deposits at Hueyatlaco Archaeological Site, Valsequillo, Mexico", Quaternary Research, núm. 16, p. 258. Malde, H.E. (1968a), "Stratigraphy of Valsequi110 Region (Except Valsequillo Gravel, Volcanic ash Stratigraphy, etc.) ", versión preliminar, 157 p., mimeo. -(1968b), "Geologic Map of Valsequillo Area (98°05' to 98°30' West Latitude by 18° 52' to 19°05' North Longitude) with Unit

BIBLIOGRAPHY Armenta Camacho,j.

pp. 337-347. (1967b), "Comments on A1legations by j.L. Lorenzo Concerning Archaeological Re-

Foundation.

163


VIRGINIA

STEEN-MCINTYRE

Descriptions. Unpublished Open File Map, Several Scales, Field Records Library", --

NATO Advanced Study Institutes, Dordrecht, Reidel, pp. 49-63 (serie C). --y H.E. Malde (1970), "Status ofVoicanic

Denver, Colorado (U.S. Geological Survey). y V. Steen-McIntyre (1981), "Reply to Comments by C.• Irwin-Williams: Archaeologic Site, Valsequillo, Mexico, Letters to the Editor", Qyaternary Research, núm. 16, pp. 418-425.

Ash Chronology at Valsequillo Archaeological Sites, Puebla, Mexico", po-nencia presentada en la 35th Annual Meeting, Society for American Archaeology, México, 30 de abril a 2 de mayo, mimeo, 19 p. --, R. Fryxell y RE. Malde (1981), "Geolo-

McBrearty, S. y A.S. Brooks (2000), "The Revolution that Wasn't", Journal of Human lution, núm. 39, pp. 453-563.

Evo-

gic Evidence for Age ofDeposits at Hueyatiaco Archaeological Site, Valsequillo, Mexico",

Reichelt, H. (1899-1900), "Fossile Bacillariaceen eines Kalktuffes aus México", Zeitschrift für

Qyaternary Research, núm. 16, pp. 1-17. Szabo, BJ., H.E. Malde y C. Irwin-Williams

Angewandte Mikroskopie, núm. 5, pp. 3-10. Sears, P.B. (1982), "Fossil Maize Pollen in Mexico", Science, núm. 216, pp. 932 Y 934. Steen-McIntyre, V. (1968), "Petrography of Sorne

(1969), "Dilemma Posed by Uranium-series Dates of Archaeologically Significant Bones from Valsequillo, Puebla, Mexico", Earth and Planetary Science Letters, núm. 6, pp. 237-244. Thorarinsson, S. (1954), ''The Tephra-fall from Hekla on March 29th, 1947: The Eruption of Hecla 1947-1948", Acta Naturalia Islandica JI, Reykiavik, pp. 1-68.

Late Quaternary Pyroclastic Deposits at La Malinche and Valsequillo Early Man Sites, Puebla, Mexico. Abstracts with Programs, Annual Meeting, Mexico City", Geological Society of America, núm. 189, mimeo (20 p., incluyendo figuras y apéndices). --(1972), "Petrographic Variation Within a[n 8 000] Years Old Pyroclastic Deposit, La Malinche Voicano, Mexico (with a Section on the Age of Hueyatiaco

Van Landingham, S. (2000), "Sangamonian Interglacial (Middle Pleistocene) Environments of Deposition of Artifacts at the Valsequillo Archeological Site, Puebla, Mexico", Transactions of the 35th Regional Archeolo-

Early Man Artifacts,

gical Symposium for Southeastern New Mexico and Western Texas, Southwest Federation of Archaeological Societies Annual Meeting, 9 a 11 de abril de 1999, pp. 81-98.

Valsequillo Reservoir, Puebla, Mexico) ", estudio preliminar, mimeo, 32 p. ---(1975a), "Holocene and Pleistocene Vólcanic Ash Beds Exposed at Archaeological

---

Sites -Tephra Hydration Dating may Give Approximate age", mimeo, 35 p. -(1975b), "Hydration and Superhydration of Tephra Glass a Potential Tool for Estimating Age of Holocene and Pleistocene Ash Beds", en R.P. Suggate y M.M. Cresswell

Means of Paleoecology and Biostratigraphy of Chrysophyta Cysts", Transactions of the 37th Regional Archaeological Symposium for Southeastern New Mexico and Western Texas. Southwestern Federation of Archeological Societies Annual Meeting, 6 a 7 de abril de 2001, pp. 1-14. -(2002b), "Correlation of Artifact Horizons at the Hueyatiaco Archaeological Site with Sangamonian (sensu lato = 80000 to ca.

(eds.), Qyaternary Studies, Wellington, Royal Society of New Zealand, pp. 271·-278. -(1977), "A Manual for Tephrochronology: Collection, Preparation, Petrographic Description and Approximate Dating of Tephra (Voicanic Ash) ", tesis de doctorado, Idaho Springs, University ofIdaho, --

(2002a), "Corroboration of Sangamonian Interglacial Age Artifacts at the Valsequillo Archaeological Area, Puebla, Mexico, by

mimeo, 167 p.

220000 yr BP) Age Diatomaceous Samples, Cores, and Measured Sections from the Valsequillo Region South of Puebla, Mexico",

(1981), "Approximate Dating ofTephra", en S. Selfy R.SJ. Sparks (eds.), Tephra Studies,

164


APPROXlMATE DATING OF TEPHRA USING THE MICROSCOPE "SEAT-DF-THE-PANTS"

Microscopy Symposium, 1960, Chicago, McCrone Associates, pp. 160-165. [Con notas suplementarias acerca de, 1964, modificado de YA. Cherkasov, 1957 (en ruso), traducci贸n de International GeologyReview, n煤m. 2, p. 218, 1960.]

Southwest Federation of Archaeological Societies. Wi1cox, R.E. (1962), "Cherkasov's 'Focal Screening' for Determination of Refractive Index by the Immersion Method", en W.C. McCrone (ed.), Proceedings o/ the International

165


THE SEARCH FOR EVIDENCE OF THE COASTAL ENTRY ROUTE IN BAJA CALIFORNIA Alan L. Bryan

antiguos

RESUMEN

que evidencien

* and

Ruth Gruhn

tal tecnología

*

en la

costa de Alaska y el norte de la costa noroeste debido al helamiento extensivo en el Pleistoceno tardío, aunque había refugios libres de hielo

Las investigaciones recientes han mostrado que hay errores garrafales en el modelo "Clovis primero" para la prehistoria más temprana de las Américas. Evidencia geológica fechada muestra que el hipotético "corredor libre de hielo" al este de las Montañas Rocosas fue cerrado entre

que deben ser examinados. Otro problema que afectó la mayor parte de las zonas costeras fue el ascenso mundial del nivel del mar al final del Pleistoceno, con la inundación de la mayor parte de los sitios arqueológicos de la costa o su destrucción por la acción de las olas. Este factor, además del intensivo desarrollo moderno a lo largo de la costa, dificulta el descubrimiento de sitios antiguos. Por suerte, algunas porciones de la costa del Pacífico en Baja California se han levantado por movimientos tectónicos, lle-

30000 y 11000 RCYBP, durante la época en que se suponía que entraron los cazadores de megafauna. Los sitios arqueológicos fechados en América del Sur indican que los principales ámbitos al sur del continente fueron ocupados al mismo tiempo o antes del desarrollo de Clovis en ~érica del Norte por grupos con tecnologías diversas. Nos interesa particularmente la arqueología de Baja California porque pretendemos probar una hipótesis alternativa sobre el poblamiento original de las Américas. Apoyamos la hipótesis de que los americanos más antiguos eran simples cazadores recolectores adaptados a la costa, que usaban naves simples y que se extendieron a lo largo de la costa del Pacífico norte y hacia al sur, a Sud-

vado el paso con el levantamiento holocénico del nivel del mar; de esta manera es más probable que sean preservados que algunos sitios antiguos. Otra ventaja es que en la parte noroeste de la península de Baja California el margen de la escala continental está muy próximo a la costa actual en algunas tareas. Por eso hemos centrado nuestra búsqueda de sitios arqueológicos muy antiguos en las secciones levantadas tectónicamente, donde la escala continental se baja no muy lejos de la costa actual. Pensamos que la gente antigua, siguiendo la línea de la

américa, en el Pleistoceno tardío. Esta gente había desarrollado una industria lítica simple valiéndose de la parte no perecedera de una tecnología de hueso, concha, cuero y materiales vegetales. Ha sido imposible descubrir restos

costa del Pleistoceno tardío, acampó en los terrenos elevados cercanos. Nuestra experiencia nos ha mostrado que los antiguos pobladores solían buscar entre las rocas y hemos realizado

* University of Alberta, Edmonton, Canada.

167


ALAN L. BRYAN AND RUTH GRUHN

excavaciones en un abrigo grande que debe haber estado sobre el nivel del mar en el Pleis-

zone. Fortunately, portions of the Pacific Coast of Baja California have risen tectonically in step

toceno tard铆o. En este texto referimos los resultados de tres temporadas de excavaci贸n en los dep贸sitos profundos del Abrigo de los Escorpiones.

with the postglacial rise in sea level, so early sites are more Iikely to be preserved. Another advantage is that in the northwestern part of the Baja California peninsula, the edge of the continental shelf is very c10se to the present coast in sorne areas. We have therefore concentrated our search for really early archaeological

ABSTRACT

sites in tectonically uplifted sections where the continental shelf drops off not far from the present coastline. We reason that early people following the late Pleistocene coast would have camped at nearby upland localities. As our experience has shown us that early people regularly occupied rockshelters, we have undertaken excavations at a large rockshelter that should have remained aboye sea level in late Pleistocene times. The results of three seasons of excavation in the deep deposits of the Abrigo de los Escorpiones will be described in our presentatlon.

Recent research has revealed fatal flaws in the "Clovis-first" model of earliest American prehistory. Dated geological evidence shows that the hypothetical "ice-free corridor" east of the Canadian Rocky Mountains was c10sed between 30000 and 11000 RCYBP, during the time when the Clovis big-game hunters were supposed to have entered; and dated archaeological sites in South America show that all major environmental zQnes of the southern continent were already occupied by groups with distinctive technologies at the same time or even earlier than the Clovis development in North America. Our interest in Baja California archaeology is to test an alternative hypothesis concerning the original peopling of the Americas.

KEYWORDS Megafauna, Geological, Pleistocene.

We support the hypothesis that the earliest Americans were coastally-adapted hunter-gatherers with simple watercraft who spread along the north Pacific rim and down the Pacific Coast to South America in the late Pleistocene.

Fundamental questions related to the original peopling of the Americas have proven to be among the most contentious in world prehistory, and they remain unresolved after more than a century of research. The questions can succinctly be stated as (l) what population carne

These people used a simple lithic flake industry as the non-perishable part of a technology of bone, shell, hide, and vegetal materials. Discovery of early sites with such a technology in coastal A1aska and the northern Northwest Coast is hampered by extensive glaciation in the late Pleistocene, although known ice-free

first, (2) by what route, (3) what technology did they bring with them, and (4) when did these first people arrive? Definite answers to these questions may elude researchers for many more years, as they continue the search for concrete evidence in the form of artifacts and human

refugia should be carefully examined. The other m<tior handicap in most coastal areas is the worldwide postglacial rise in sea level which

skeletal remains. Important discoveries will continue to be made by chance, but we believe that directed archaeological research based on logical inference will yield most significant

inundated most early coastal sites, or destroyed them by wave-cutting. This factor plus intensive modern development along the coastline makes it difficult to discover early sites even in Alta California, well south of the glaciated

results. This research should be based on what is already known about the biology of Native

168


THE SEARCH FOR EVlDENCE OF THE COA5TAL ENTRY ROUTE IN BAJA CALIFORNIA

Americans,

the archaeology

of the Americas,

and related evidence from those parts of the world which most likeIy contributed the early humans and their artifacts. The inferences should lead to well-formulated hypotheses which should be subjected to testing, and not be based simply on ad hoc hypotheses that may seem to be reasonable but are really untested assumptions. We may never find out for certain what

gion need not include bifacial stone projectile points. Because shaped bifacial projectile points are ubiquitous in most archaeological contexts in the United States and southern Canada, North American archaeologists have come to believe that people always used them. True, distinctive bifacial projectile points where they exist are very important keys to interpreting the age of a site, even if found only on the surface. For example, a Clovis fluted point found on the surface is often assumed to be ca. 11 000 radiocarbon years old. A1so, a fluted point found deeply buried is often assumed to be evidence of the earliest occupants of the site, so the archaeologist may consider it unnecessary to dig deeper. Not only do we feel that excavated archaeological contexts are essential for proper understanding, but we insist on digging deeper, to bedrock if at all possible, befo re concluding that we have all the evidence of the earliest

group first discovered America because it is unlikely that definite skeletal and archaeological evidence of the very first venture still exists. PresentIy, comparative osteology and genetics point to east Asia as the source are a of the original population; but archaeological evidence for the very first people who ricas may be very faint indeed, oked. Recently Jon Erlandson how, out of curiosity, he sent

entered the Ameand easily overlo(2000) described off a radiocarbon

occupation. Clearly the Americas were among the last parts of the world to be occupied by humans, as only skeIetal remains of modern Horno sapiens have been found in the Americas. Australia is another continent that was occupied relatively late in the Pleistocene (Mulvaneyand Kamminga, 1999). In searching for early sites, Australian archaeologists do not look for nicely shaped lithic points (which are known only

sample from a very small inconspicuous shell midden exposed in the bank of an arroyo on San Miguel Island off the southern California coast; and got a date of ca. 9380 RCYBP, one of the oldest known from the Channel Islands. The lesson he stressed is that the earliest people in any particular region may have left very Iittle material evidence of their presence. In their search for early sites, archaeologists are gr.eatly hampered by the fact that only very unusual circumstances allow preservation of most of material culture. If early people flaked or otherwise worked stone, archaeologists should have the expertise to recognize these simple lithic artifacts and distinguish them from

from the northwest corner of the continent, and date to the late Holocene), but rather for simple flake tools and core tools which characterise sites dating as far back as 40000 years. We believe that if American archaeologists stopped expecting that the earliest Americans used

naturefacts (geofacts). Bone and shell may be preserved as well; but wood, skin, sinew, basketry, cordage, and other articles made ofvegetal materials are very rarely preserved. If there are no non-perishable artifacts left at an early campsite, taphonomy and even chemical analysis of sediments, particularly associated with hearthlike features, may be required

to demonstrate

diagnostic bifacial points, and instead paid more attention to early stratigraphic contexts containing only simple flakes and cores, we might find that the earliest American sites are just as old as the early Australian sites. Thus far we have briefly considered

the

questions of the source population of the first Americans, and the technology they brought with them. We have al so hinted that, in our view, the date of the initial entry was well back

a

human presence. It is necessary to emphasize the point that the earliest artifact assemblages in any given re-

169


ALAN L. BRYAN AND RUTH GRUHN

in the late Pleistocene, even 40000 years ago, as suggested by the two South American sites of Monte Verde I (ca. 34000 RCYBP) (Dillehayand Collins, 1988) and Pedro Furada (>40000 RCYBP) (cf. Pessis, 1996); but we must leave this question now, as this paper is to focus on the question of the route of the initial entry. Until very recently it had been assumed that the first Americans were big game hunters who entered Alaska from Siberia over the Bering Land Bridge and then expanded southward through a convenient ice-free corridor that

Ainu-like people who had non-mongoloid features (Steele and Powell, 2002); thus a north Asian littoral-oriented population may have expanded along the north Pacific coast, over the southern shore of the land bridge, and down the west coast of North America (cf. Fladmark, 1979; Gruhn, 1994, 1997; Dixon, 2001; Erlandson, 2002). We support early people around the Pacific, who had developed to reach Australia and

the hypothesis that western rim of the watercraft adequate New Guinea, the

Solomon Islands, the Ryukus, and islands offshore of Honshu, by late Pleistocene times (cf. Erlandson, 2002) were capable of navigating the north Pacific shoreline and arriving in the Americas.

opened east of the Rocky Mountains as the Laurentide ice mass melted back eastward (Haynes, 1964; Fagan, 1987). This route is now very doubtfu\. It has been shown that the corridor began to open from the south probably befo re 18000 years ago; but it remained a very inhospitable cold, windy, and barren environment until after 11500 RCYBP (Mandryk eL al., 2001) . As well, geologists have determined that the northern portion of the corridor, in the western NWT, was closed by ice or large proglacial lakes from about 30000 RCYBP until about 11500 RCYBP (Lemmen eL al., 1994), perhaps opening just in time for specialized big game hunters to rush south onto the Great Plains,

The challenge for this hypothesis is to discover very early coastal archaeological sites, given the changes in the coastline resulting from glaciation and destructive fluctuations in sea level, If the earliest population entered the ArrĂ­ericas before the height of the last glaciation, as we believe, the only places to search for the earliest archaeological sites on the northwest coast of North America would be in ice-free refugia, such as on Kodiak Island, the Alexander archipelago in southeast Alaska, and the Queen Charlotte islands in northern British Columbia. The best possibilities here would be in caves and large rockshelters high aboye the line of

but surely not in time to allow for the peopling of the rest of the Americas by 11 000 RCYBP; as we now know that all the major environmental zones of South America were already occupied by well-adapted populations with diverse nonClovis technological traditions by that time (Dillehay, 2000, LavallZe, 2000). Thus the long-

the postglacial rise in sea leve\. We are happy to note that a concerted search for early sites in southern Alaska and unglaciated regions of the coast of British Columbia is now being undertaken by various researchers (Fedje and Josenhans, 2000, Dixon eL al., 1997).

he Id hypothesis that the earliest Americans were Clovis hunters who entered through the ice-free corridor as late as 11 500 RCYBP has been disproven by abundant facts.

Farther south, beyond the glaciers, the combined effects of rising sea level and destructive wave action have also destroyed most early coastal sites. However, geologists have indicated that

Although the ice-free corridor hypothesis has foundered, we still believe that the Bering Land Bridge was the place of initial entry; but the earliest population most likely passed along the south shore of the land bridge and not across the Bering Straits and through central Alaska as usually proposed. Present osteological evidence suggests that the first Americans were

sorne parts of the California coast have risen tectonically (Orme, 1980). Certainly, these areas, which may have escaped the brunt of rising sea level and storm erosion, may yield early sites. To date, diligent search on the Channel Islands well offshore from southern California has yiel-

170


THE SEARCH FOR EVIDENCE OF THE COASTAL ENTRY ROUTE IN BAJA CALIFORNIA

ded evidence of several early Holocene occupations, and suggestive evidence of a late Pleisto-

vered, evidently the remains of pellets deposited by avian raptors which for thousands of years have perched in crevices in the rock face

cen.e arrival (Erlandson el al., 1996) Thus when we learned that parts of the northwest coast of B,ya California had risen tectonically, we decided to concentrate our rese-

aboye the midden. Sorne small fish bones were a1so recovered, but fish remains were never common in the midden deposits at the site. Five radiocarbon dates from this upper midden zone

arch in these are as. A survey of the zone in which the continental shelf drops off within a kilometer of the present shoreline resulted in discovery of a large rockshelter, which we named

ranged from 1610 ± 90 RCYBP at a depth of 50-55 cm below surface to 4550 ± 50 RCYBP at 270-280 cm depth. A distinctive stratigraphic zone of compact black/brown ashy silt with abundant shell, about 1.5 meters thick, comprised the middle

the Abrigo de los Escorpiones, situated high in a prominent volcanic outcrop overlooking the Pacific shore. We reasoned that anyone traver-

zone ofthe midden. The shell is predominantly mussel, in a dark oily matrix of ashy silt. Sorne

sing the coast at any time would have seen this un usual feature, explored it, and camped there at least overnight, exploiting the rich Iittoral

abalone, small gastropods, and limpets were also present; and in the lower levels of the zone appeared plates of giant chiton, an indicator of cold water, and c1ams, suggesting a lower sea level with sandy beaches (c1ams are not to be

resources within easy access. Certainly over the millennia the site was intensively occupied. Our excavations have shown that the western part of the original rockshelter has become completely filled with shell midden, to a depth of five and a half meters below the present surface. The

found in the vicinity of the site at the present time). Small bones continued abundant, and butchered sea mammal bones were notable. Lithic artifacts were predominantly large flakes, flaked cobbles, cores, choppers, hammerstones, and manos and milling stones. There was a notable increase in flaking debitage as compared to the upper midden zone. This middle zone of the midden was the only zone to produce bifacial stone points, and the specimens collected varied in form: lanceolate, leaf-shaped and serrated, or small teardrop-shaped. Two bone fish lures and several fragments of bone points were a1so recovered; a1so a socketed bone haft. Four radiocarbon dates from the middle

midden deposits dipped down toward the present rear wall of the shelter; and with continued excavation we discovered a deep inner chamber. In fact, we have not yet succeeded in reaching the rear wall of the inner chamber, which extends over six meters north of the presentlyexposed rear wall of the rockshelter. Tlj,e stratified sediments within the rockshelter were readily divisible into four major strata, the upper three of which are midden deposits composed of multiple lenses of shell, ash, and charcoal. The upper zone of the midden, comprised ofshell in a brown silt matrix, extended tú a maximum depth of 280 cm below the present surface. The shell was predominantly California mussel, found in abundance on the rocky shore below the site at the present time. The upper zone of the midden yielded large flakes, flaked cobbles, cores, choppers, hammerstones, and manos and metates. Modified abalone shells evidently used as scrapers, a few Olivella beads, and rare shell discs were recovered. Bone artifacts were very rare, although many small mammal and bird bones were reco-

zone of the midden ranged from 6340 ± 100 RCYBP in its upper level to 8040 ± 70 RCYBP near its base. The lower zone of the midden, about one meter thick, is a distinctive brown loamy silt with shell. It featured remains of a variety of shellfish: mussels, c1ams, giant chiton, Iimpets, and small conical gastropods. Small bones continued abundant, and there were butchered bones of sea mammals. This zone was also productive of Iithic artifacts, with much flaking

171


-------------

A1AN 1. BRYAN AND RUTH GRUHN

detritus. Large flakes were often retouched into scrapers, and there were many choppers as well as flaked cobbles and cores. An incised bone point base was also recovered. Milling stone fragments and manos were present. Six radiocarbon dates ranging between 8240 ± 160 RCYBP and 8870 ± 60 RCYBP were obtained on the lower midden zone, indicating an early Holocene age for the beginning of accumulation of the shell midden.

Southeast Alaska Karst: A Progress Repon", Geoarchaeology, núm. 61, pp. 689-712. Erlandson, John M. (2000), "A Stratified As~ociation of Mammoth Remains and Archaeological Materials at Running Springs, San Miguel Island, California", Current Research in the Pleistocene, núm. 17, pp. 22-23. --(2002), "Anatomically Modern Humans, Maritime Voyaging, and the Pleistocene Colonization of the Americas", en N.Jablonski (ed.), The First Americans: The Pleistocene Colonization oJ the New World, Los Ángeles,

Beneath the midden deposits is a thick deposit of reddish-brown loamy silt with abundant rock rubble, which continues to bedrock at over eight meters' depth below the present sur-

Memoirs of the California Sciences, núm 27, pp. 59-92.

Academy

of

face. Within the rubble, dispersed thin lenses of shell fragments, charcoal, and flakes have been noted. Most are obvious rodent holes, but others

Fagan, Brian M. (1987), The Creat Journey: The Peopling oJ Ancient America, Nueva York, Thames and Hudson.

could mark occasional early occupations. The rockshelter is very large and deep; and it may be, as Jon Erlandson concIuded for his small and inconspicuous early shell midden on the Channel Islands, that the very earliest occupants of the coastal zone left very Iittle material evidence of their passing. As bedrock has not yet been reached in most of our excavation units, we intend to pursue this possibility in future excavations at the site, as we continue to search the basal rubble zone for evidence of a late Pleistocene arrivaI.

Fedje, Darryl y Heiher Josenhans (2000), "Drowned Forests and Archaeology on the Continental Shelf, British Columbia, Canada", Geology, núm. 28, pp. 99-102. Fladmark, Knut R. (1979), "Routes: Alternate Migration Corridors for Early Man in North America", American Antiquity, núm. 44, pp. 55-69. Gruhn, Ruth (1994), 'The Pacific Coast Route of Initial Entry: An Overview", en R. Bonnichsen

the First Americans, Oregon State University, pp. 249-256. --(1997), "Language Classification and the Models of the Peopling of the Americas",

BIBLIOGRAPHY Dillehay, Tom D. (2000), The Settlement oJ the Americas: a New Prehistory, Nueva York, Basic Books.

en P. McConvell y N. Evans (eds.), Archaeology and Linguistics: Aboriginal Australia in Global

--

y Michael B. Collins (1988), "Early Cultural Evidence from Monte Verde in Chile", Nature, núm. 332, pp. 150-152. Dixon, E. James (2001), "Human Colonization

Perspective, Melbourne, Press, pp. 99-110.

Regional

Geoarchaeology

Oxford

Haynes, C. Vance Jr. (1964),

University

"Fluted

Points:

their Age and Dispersion", Science, núm. 145, pp. 1408-1413. LavallZe, Danizle (2000), The First South Americans, Salt Lake City, University of Utah Press. Mandryk, C., H. Josenhans, D.W. Fedje y R.w.

of the Americas: Timing, Technology, and Process", Quaternary Science Reviews, núm. 20, pp. 277-299. ---, TH. Heaton, TE. Fifield, TD. Hamilton, D.E. Putnam y F. Grady (1997), "Late Quaternary

y D.G. Steele (eds.), Method and

Theory Jor Investigating the Peopling oJ the Americas, Corvallis, Center for the Study of

Mathewes (2001), "Late Quaternary Paleoenvironments of Northwestern North America:

of

172


THE SEARCH FOR EVIDENCE OF THE COASTAL ENTRY ROUTE IN BAJA CALIFORNIA

Homen Americano, Sao Raimundo vol. 1, núm. 1.

Implications for Island Versus Coastal Migration Routes", Qy,aternary Science Reviews, núm. 20, pp. 301-314. Mulvaney, John y Johan Kamminga (1999), Prehistory 01 Australia, Washington, Smithsonian Institution Press. Orme, Anthony R. (1980), "Marine Terraces

Nonato,

Steele, D. Gentry y Joseph F. Powell (2002), "Facing the Past: a View of the North American Human Fossil Record", en N.G. Jablonski (ed.), The First Americans: The Pleistocene Colonization 01 the New World, Memoirs of the California Academy of Sciences, núm. 27, pp. 93-122. Tveskov, G., J. West y P. Walker (1996), "An

and Quaternary Tectonism, Northwest Baja California, Mexico", Physical Geography, vol. 1, núm. 2, pp. 138-161. Pessis, Anne-Marie (ed.) (1996), "Proceedings of the International Meeting on the Peopling of the Americas, Sao Raimundo Nonato,

Archaeological

and Paleontological

Chrono-

logy for Daisy Cave (ca-SMI-261), San Miguel Island, California", Radiocarbon, núm. 38,

Piau', Brasil", Revista da Funda 'o Museu do

pp. 355-373.

173


LA

DIVERSIDAD PLEISTOCENO-HOLOCÉNICA DEL VALLE DE MÉXICO,

¿PUEDE SER EXPLICADA POR EVOLUCIÓN SELECTIVA? Héctor M. Pucciarelli*'** Marina L. Sardi, * Carlos Serrano Sánchez*** y Fernando Ramírez Rozzi****

RESUMEN Con el análisis craneofuncional aparecen nuevas perspectivas explicatorias sobre la diversidad

gan a desechar la hipótesis de nulidad, y para explicar la similitud europeo-americana observada se proponen tres hipótesis alternativas: 1) fue resultado de un proceso multirregional;

existente en paleoamericanos y amerindios. En este estudio se emplearon muestras de los paleoamericanos (Valle, Lagoa Santa) y arcaicos (Tlatilco) del valle de México y Sudamérica que

2) existió un origen común, con posterior diversificación adaptativa; 3) se debió a un proceso de convergencia evolutiva entre Europa y América. No existe aún evidencia terminante

fueron comparadas con las de poblaciones antiguas del norte de África (Afalou, Taforalt) y de Europa occidental (Teviec, Sebazac, Orrouy, Homme Mort) mediante pruebas de análisis discriminante, que incluyeron las distancias multivariadas D2 de Mahalanobis y los craneograma.s de ordenamiento con referente central

en favor de una de ellas, pero la tercera hipótesis es hasta el momento la más probable porque: a) en ambas regiones hubo un efecto de reducción en tamaño; b) los componentes funcionales más diferenciados fueron el posteroneural, el masticatorio y el alveolar, que corresponden a variaciones en las estructuras neurocraneana

(Valle). El propósito fue examinar la hipótesis de nulidad: "las poblaciones del paleoamericano y arcaico meso y sudamericano conforman una unidad independiente de las poblaciones europeas, por cuanto, según las teorías actuales sobre poblamiento, América habría sido receptor, por vía transberingea o alterna, de poblaciones de origen asiático". Los resultados obli-

y facial debidas a los procesos de adaptación a la caza recolección que caracterizaron la evolución humana de fines del Pleistoceno.

ABSTRACT Because of the Cranial Functional analysis, new explanatory viewpoints about the diversity of Paleoamericans and Amerindians carne into light. In the present study, samples from Paleoamericans (Valley, Lagoa Santa), and Archaics (Tlatilco) from Mexico Valley and Brazil were compared against ancient populations from North-Africa (Afalou, Taforalt), and from Western Europe (Teviec, Sebazac, Orrouy,

* División Antropología del Museo de La Plata, Facultad de Ciencias Naturales y Museo, Universidad Nacional de La Plata, Argentina. ** Consejo Nacional de Investigaciones Científicas y Técnicas (Conicet), Buenos Aires, Argentina. *** Instituto de Investigaciones Antropológicas, UNAM, México. **** UPR 2147 Centre National de la Recherche Scientifique (CNRS) , París, Francia.

175


H.M. PUCClARELLI, M.L. SARDI,C. SERRANO SÁNCHEZy F. RAMÍREZROZZI Homme Mort) with the discriminant analysis, including Mahalanobis D2 distances. The object

dera cinemática de la variación, entendida

ésta

was to examine the null hypothesis: "The Central and South-American Paleoamerican and Archaic populations conformed an independent unity with respect to those of the Old World, since -according to the currentiy accepted theories about peoplingthe Americas wO,uld

tuales en relación con aspectos genéticos con/o particularidades del medio. Se sitúan en esta línea los métodos y técnicas propuestos por varios autores que tomaron como base la teoría funcional del cráneo propuesta por Van der Klaauw entre los cuarenta y los cincuenta (Klaauw, 1948-

have been a receptor of populations mainly coming from Asia". The present results showed cranial functional similitudes between Valley and European -mainly Orrouy, and Homme Mort- samples. The null hypothesis was rejected, and three alternative ones were proposed in order to explain the similitude found: 1) it was evoked by a multiregional process; 2) the populations had a single origin, with subsequent migration and adaptative diversification; 3) a late Pleistocenic European-American evolutive convergence process. There is still not a con-

1952). El principal postulado de dicha teoría es que el cráneo humano debe ser tomado no como un complejo único y solidario, sino como un sis-

como la deducción de procesos generales o pun-

tema dinámico en el cual cada componente varía con relativa libertad y en funci.ón de las demandas requeridas por el propio desarrollo biológico y por su interacción con el medio biofísicocultural propio de la especie humana. Un primer nivel de análisis corresponde a las distribuciones intra e interpoblacionales (Pucciarelli el al., 1999) que se obtienen con las seis variables de los componentes mayores o con

clusive evidence in favor of one of them, but the third is the strongest, beca use a) both regions there was an active process of overall size reduction; and b) most differentiated functional cranial components in both continents were the postneural, the masticatory, and the alveolar, which belonged to the neurocranial and the facial changes; which respectively, were associated with the well developed -in space and time- hunter-gathering way of subsistence in the late Pleistocene.

las 24 de los componentes menores. El ségundo nivel requiere de craneogramas intergrupales (Pucciarelli el al., 1990 y 1999) por medio de los cuales puede ser deducida la evolución de uno o varios componentes en función de presuntos procesos adaptativos (Pucciarelli el al., 1999, 2002a y 2002b). En un estudio previo fueron construidos grupos o cluslers con las variables de los componentes menores, cruda y debidamente estandarizadas. Los cluslers fueron realizados agregando una muestra de Hamo sapiens fossilis (HsF) anatómicamente moderno (entre 100000-20000 años, de Europa, Asia y África (Hublin y Tillier, 1991).

PALABRAS ClAVE

Con los datos estandarizados para eliminar sólo el efecto escala, fue observada la distribución que se presenta en la figura 1, donde en un primer subcluslerse unen los tres grupos de HSF,junto con las muestras del Paleolítico norafricano (Afalou, Taforalt), mientras que en un segundo

Evolución humana, adaptación y craneometría.

INTRODUCCIÓN Los estudios morfológicos del esqueleto craneofacial vienen sufriendo en los últimos años importantes cambios tanto en lo técnico como en lo

subclusler se unen los cuatro grupos europeos del Paleolítico y del Mesolítico, más los tres americanos. Eliminado el efecto tamaño, la si-

conceptual, en respuesta a las necesidades de obtener un tipo de información que trascienda la mera descripción para internarse en una verda-

tuación no varió en cuanto a su tipología, siendo lo más importante el acortamiento general de las distancias (véase la figura 1).

176


LA DIVERSIDAD PLEISTOCENO-HOLOCÉNICA DEL VALLE DE MÉXICO Cluster Tree

poblaciones del viejo mundo, por cuanto, según las teorías actuales sobre poblamiento, América habría sido receptor, por vía transbe-

Afric.H.sJ ------,

ringea o alterna, de poblaciones damentalmente asiático.

Europ.H.sJ -----, Asiat.H.sJ --_-' Afalou -----, Taforalt

de origen fun-

1-----'

Homme Mort -------,

MATERIAL Y MÉTODOS

Sebaczac -----, Teviec ---

....•

Fueron empleados 79 cráneos humanos con an-

Orrouy ------'

tigüedades aproximadas de 5000 a 10000 años. Corresponden a paleo americanos de Lagoa Santa (Brasil) y de la cuenca de México (Tlati1co) y

Lagoa Santa Tlatilco Valley

-==::::::;:==::::;:=---_-.-_---.

1-

1

O

4

a grupos antiguos del Paleolítico del norte de África (Afalou, Taforalt) y Europa (Teviec), junto con europeos mesolíticos (Sebazac, Orrouy,

Distances

Homme Mort). Todos fueron medidos según la metodología craneofuncional, que fue diseñada para evaluar la variación dentro de los com-

Figura 1. Cluster jerárquico construido con los escores canónicos del análisis discriminante efectuado con las variables craneofuncionales menores, estandarizadas para efecto escala (fueron incorporadas muestras de Homo sapiens anatómicamente moderno). Obsérvese que estos úlúmos se agrupan en un sube/uster junto con las poblaciones norafricanas, mientras que las americanas se asocian a los europeos occidentales.

Estos resultados

contradicen

ponentes y entre ellos, la cual consiste en determinar la longitud, el ancho y la altura de los dos componentes funcionales mayores y de los ocho componentes funcionales menores previstos por el método. Con estas variables se definen primero los índices de los dos componentes mayores que informan sobre sus variaciones en tamaño. Son los índices volumétricos neurocraneano (VNI) y facial (VFI). Las variaciones de la forma craneofacial se evalúan valiéndose del índice neurofa-

10 previsto de

acuerdo con los cánones formales de mayor aceptación, pues hubiera debido esperarse un agrupamiento tal que las muestras HSF, con an tigyedades de por 10 menos 20000-30000 años involucren morfológicamente a los grupos más modernos, con 10 cual Afalou o Taforalt no deberían estar más cercanos a HSF que Teviec, Valle o Lagoa Santa. En vista de tales resultados fueron modificados los objetivos originales de esta presentación para responder a las relaciones planteadas por el segundo subcluster, donde se sitúan las muestras paleoamericanas y la arcaica, objeto del presente estudio, junto con las europeas. Se tomaron como referencia las muestras norafricanas y las de HSFse reservaron para un análisis El propósito nar la hipótesis paleoamericano conforman una

cial (NFI) , que las expresa en términos de volumen neurocraneano por unidad de volumen facial. Una disrupción neurofacial implica una diferencia significativa del NFI entre dos muestras. Cuanto mayor es el valor del NFI, mayor es el grado de encefalización -en la especie humana sería más apropiado minos de menor facialización-

referirse en térdel grupo estu-

diado. Un segundo nivel de análisis está dado por los componentes menores de neurocráneo y faz.

posterior. del presente trabajo es examide nulidad: las poblaciones del y arcaico meso y sudamericano unidad independiente de las

La variación volumétrica de cada componente mayor debe ser por definición una proyección a escala de la variación volumétrica de los componentes menores que contiene; se considera repetitiva la información dada por

177


H.M. PUCCIARELLI,M.L. SARDI,C. SERRANOSÁNCHEZy F. RAMÍREZROZZI dichos índices volumétricos menores. No así la proporcionada por la variación de sus índices

D2 libres del efecto tamaño fueron menores, pero conservaron un patrón de distribución

morfométricos, por cuanto expresan las variaciones de crecimiento relativo entre ellos y definen parte de los cambios de forma del componente mayor que los contiene. Los índices morfométricos de los componentes menores son anteroneural (ANMI), mesoneural (MNMI), posteroneural (PNMI), óptico (OTMI), respiratorio (RMI), masticatorio (MMI) y alveolar (AMI). Fueron calculadas las distancias intergrupales D2 de Mahalanobis en forma general y para

similar (figura 3). El hecho sobresaliente es la incorporación de Valle a las distancias no significativas con Sebazac (figura 3d), Orrouy (figura 3e) y Homme

Mort (figura 3f).

CRANEOGRAMAS Se realizaron comparaciones por componentes funcionales (craneogramas) tomando a Valle como referencia (figura 4). Se observa

la en los componentes mayores y el efecto tamaño en los componentes menores. Con las D2 generales se construyeron gráficas de barras que expresan las distancias de cada grupo respecto a los demás (figuras 2 y 3). Con las D2 específicas se construyeron los craneogramas correspondientes a las comparaciones de Valle contra

una disminución progresiva de componentes significativos, que van desde 7 en la comparación con Afalou (figura 4a) hasta 1 en la comparación con Homme Mort (figura 4f). El preponderante efecto tamaño neural y facial sin presencia de -excepto en Orrouyde disrupción neurofacial explica que las principales diferencias con Valle obedecieron a variación estatural, acompañada de adaptaciones especí-

los grupos europeos (figura 4). El análisis estadístico fue realizado con el Programa Systat 9 en la División de Antropología del Museo de

ficas, preponderantes en los compónentes faciales (23%) respecto de los neurales (16%). El hecho más notable es la ausencia casi total

La Plata.

de significación en los componentes de forma en Orrouy (figura 4e) y total en Homme Mort (figura 4f).

cada componente,

eliminando

el efecto

esca-

RESULTADOS DISTANCIASD2 Las distancias D2 obtenidas

CONCLUSIONES para tamaño

y forLos resultados

ma entre las poblaciones antiguas (figura 2) indicaron una gran diferenciación de Tlatilco y

obtenidos

nos llevan a rechazar

la hipótesis de nulidad que se ha planteado, por cuanto con ese modelo resulta imposible explicar la proximidad morfofuncional hallada

Orrouy respecto de Afalou, mientras que Teviec, Sebazac y Lagoa Santa se diferenciaron

entre las poblaciones del paleoneolítico europeo y los paleoamericanos del valle de México.

con menores valores, siendo Tlatilco la única muestra mayor que Afalou (figura 2a). Respecto de TaforaIt, las diferencias se acentuaron,

Las relaciones craneofuncionales estudiadas sobre los grupos antiguos del norte de África, Europa occidental y América permiten con-

aunque observando el mismo patrón anterior (figura 2b). La comparación con Teviec originó diferencias no significativas en Sebazac y Orrouy (figura 2c), que se extendieron a Teviec y Homme Mort en las comparaciones con Sebazac (figura 2d) y Orrouy (figura 2e). Homme Mort sólo superó en tamaño a Lagoa

cluir que existen dos tipos de comportamiento: aquellos que se diferencian entre sí por efectos de tamaño y forma (Tlatilco) y los que mantienen sus diferencias aun en ausencia del efecto tamaño (Afalou, TaforaIt, Tlatilco y Lagoa

Santa y mantuvo diferencias no significativas con Sebazac y Orrouy (figura 2f). Las distancias

Santa). Esto implica que dos grandes grupos de factores selectivos actuaron en esta secuencia

178


LA

DNERSIDAD

PLEISTOCENO-HOLOCÉNlCA

DEL VALLE DE MÉXICO

100

50 75 100- ••.••-

••.•._

.••.•_"'-

100•..•••...•. _

••.••.••••••.•. _ .••.•---'

••. _

..••.•_

•..•••...•. _

••. _

..••.•••..••

100 75 50 25 O 25

25

50

50 75

75 1001-..~-

••.

_..I-_L-~_ .•._..I---'

100-....I_

••.

_..I-_L-~_ .•._..I---'

~¡:,,"-e" V'

\)..,:lJoc, .1'1'-0 •••... ('\«ov'l ~!i>" '!>-p ""'

\Y

~7-\\e'l.<,'.a.\.\\c.o ~')~~ fr' 1v'>'

(e) Orrouy

100

100

75

75

50 25 01-....1.---1-25 50 75

75

-~_L- ...•. _~_ .•.......•. _~

100L•.••• _ •.•..• _ •..•••.••• _ •.•..••.....••..•••.••• ---'

1001-..••••.

~e.j\e(, ~'3J-')(, ~o(\ V ~!i>" '!>-".

,..o'

s..,.\\e'I

(0\.\'1

\Y

~e.¡\e(. :u'llfr".1 ~,o ••\.. n't1:o\l.i ~..,.\\e'l .<w.-ov,P S..,.\'>~ V "'<;< '!>-p ""' \Y fr' 1V~'

\j\C-0 S'b-\'>~ fr~' 1V~'

(1) Hornrne Mort

(e) Teviee

Figura 2. Distancias D2 interpoblacionales, calculadas con las variables de los componentes menores, estandarizadas para eliminar el efecto escala. Las barras claras muestran diferencias significativas; las oscuras, diferencias no significativas; las -barras superiores indican una referencia mayor que el sustraendo y las inferiores un sustraendo mayor que la referencia.

179


H.M. PUCCIARELLI, M.L. SARDI, C. SERRANO SÁNCHEZ

y

F. RAMÍREZ ROZZI

100

'"t:

'" ~ ;¡;

'0

'0

.E "O

75

75

100

100 ~e-i'e(.

\~e'~e~.sc-':í~~y.)l\O~ arO~~oú"\ ~'\l~\\~~~\.t~~~<¡,5'P'~

\-

~~(.

~Ji,<

-:(\y..ot\. "'..O('(o\)"'\

.,.

~~\\e"l ~~\.t\(P ~~.;). 1.\fi>·

"....

(d) Sebazae

(a) Afalou

100

100

75

75

50

'"t: ~

25

'"t: ~

'0

'0

'6

O

'6

25 50

50

75

75

100

100 ~~e(,

\-

~,

~Ji,<

~~o'(\.

bPtto\\'l

.,.

:"J~\\e'i ';\\.",,\.t\Cp ~:f~"'.;). 1.\fi>·

\~e •••. e~~\1?~\\",o'(\.AP'('(o\)i f;y";¡"'\\~'\'\',).\).~~~5~~

"....

(b) Taforalt

'"t: ~

(e) Orrouy

100

100

75

75

50

50

25

'"t: ~

'6

25

'0

'0

O

'6

25

O 25 50

50 75

75

100

100 ;:'\e••••e" ~~(, ~~o{\. \. ~Ji,< .,.

.!P'«o\\"!

';\\.'b-\).\(.o ••• 1~'

~".\\ei

".

s7J5"'"

\~ei'e~~\1~~y."'o'(\

,~.O'('(o"''i f;y'\l1o\\~'\'\"'\).~~~""

(1) Homme

(e) Teviee

Mort

Figura 3. Distancias D2 interpoblacionales, calculadas con las variables de los componentes menores, estandarizadas para eliminar el efecto tamaño. Las barras claras muestran diferencias significativas; las oscuras, diferencias no significativas; las barras superiores indican una referencia mayor que el sustraendo y las inferiores un sustraendo mayor que la referencia.

180


LA

DIVERSIDAD

PLEISTOCEN0-HOLOCÉNlCA

DEL VALLE DE MÉXICO

24 20 16 12 8

'" 4 O

'0

~

:a

4 8 12 16 20 24 •.••••

-'--'--'-...1-....•...•.•.....•......•.......•......•.•...••......•......•

\~\.~•.. ,,~ ~""t~t~"tb-<;"'\.o't~~~»'ti,~"'\

\~\.~•.. "~ ~""t,¡."t~"tb~~\.o't~~~·"''ti,~\

(a) Valle-Afalou

(d) Valle-Teviee

\~\.~ •..,,~ ~""t'¡'''1:,'~"tb-<;,A\.o't~~~»'ti,~\

\'~'l.-~ ••. ,,~

~""t,¡."t~"tb-<;,A\.o't~~~»'ti,~\ (e) Valle-orrouy

(b) Valle-Taforalt

24 /20 16 12 8 '"

4

'0

O

~

4 8

:a

12 16 20 24 •.••••

-'--'-...1-..••..•.•.....•......•......•..•...••......•.....•.....•.....• \~\~ •..,,~ ~~,¡."1:,'~,,tb-<;"'\.o~~~~~·"''ti,~\ \~V'\·,,~~""t,¡."t~"tb-<;,A\.o't~~~»'ti,~\ (e) Valle-Sebazae

(1) Valle-Homme

Mort

Figura 4. Craneogramas construidos entre Valle (referencia) y las poblaciones norafricanas y europeas. Se muestra el efecto tamaño entre los componentes funcionales mayores (dos primeras barras del extremo izquierdo), el efecto forma (NFI) entre componentes mayores (tercera barra desde la izquierda) y el efecto forma entre los componentes menores del neurocráneo (las cuatro barras siguientes) y del esplacnocráneo (las cuatro barras del extremo derecho). Las barras claras muestran diferencias significativas; las oscuras, diferencias no significativas; las barras superiores indican una referencia mayor que el sustraendo.y las inferiores un sustraendo mayor que la referencia.

181


H.M. PUCCIARELLI, M.L. SARDI,C. SERRANOSÁNCHEZ y F. RAMÍREZ ROZZI espacio-temporal: una variación estatural que afectó a las muestras norafricanas y americanas,

b) los componentes funcionales más diferenciados fueron el posteroneural, el masticatorio y el

pero no al conjunto europeo (Teviec-SebazacOrrouy-Homme Mort) y un efecto libre de tamaño que asoció a Tlatilco principalmente con

alveolar, que corresponden a variaciones en las estructuras neurocraneana y facial, craneofuncionalmente atribuidas al proceso de adaptación a la caza recolección que caracterizó a la evolución humana a partir de la transición

Homme Mort (Roudesli, 1990), secundariamente con Orrouy (Trouette, 1955) e indirectamente con Tlatilco, en virtud de la nula significación

pleistoceno-holocénica.

de la cuenca de México (Tlatilco) hallada en análisis anteriormente al., 2002a y b).

efectuados

(Pucciarelli et BIBLIOGRAFÍA

La asociación entre la cuenca de México y las muestras europeas es por demás sugerente y puede ser explicada mediante varias hipótesis: 1) fue resultado de un proceso multirregional (no polifilético) de diferenciación; 2) existió un

Cann, R.L. (1987), "Mitochondrial

DNAand Hu-

origen común, con posterior diversificación adaptativa; 3) se debió a un proceso de convergencia evolutiva ocurrido en Europa y América. No existe aún evidencia terminante en favor de

man Evolution", Nature, núm. 325, pp. 31-36. Hublin, JJ. y A.M. Tillier (1991), Aux origines d'Homo sapiens, París, Presses Universitaires de France. K1aauw, CJ. van der (1948-1952), "Size and Position of the Functional Components of the Skull", Archeology Neerland Zoology, núm.

una de ellas. La primera hipótesis se basa en los supuestos de la teoría multirregional (Thorne y Wolpoff,

9, pp. 1-559. Lahr, M.M. (1995), "Patterns ofModern Human Diversification: Implications for Amerindian

1992; Wolpoff y Caspari, 1997; Wolpoff et al., 2000) y requiere para su aprobación de dos secuencias evolutivas situadas en ambos continen-

Origins", Year Book o/ Physical Anthrcrpology, núm. 38, pp. 163-198. -(1996), The Evolution o/ Modern Human Diversity, Cambridge, Cambridge University Press. Pucciarelli, H.M., V. Dressino y M.H. Niveiro

tes y que partan de una época posterior a la formación del HSF tardío (20000 a 30000 años) y anterior al fechado más antiguo de la cuenca de México y Teviec (10000 años). La segunda hipótesis brinda una explicación

(1990), "Changes in Skull Components of the Squirrel Monkey Evoked by Growth and Nutrition: An Experimental Study", American

más plausible que la anterior y se basa en un principio similar al de la teoría "Out of Africa", con el segundo proceso migratorio ocurrido

Joumal o/ Physical Anthropology, núm. 81, pp. 535-543. --, M.L. Sardi y LJ.C. Jiménez (2002a), "Poblamiento temprano de América y diversificación evolutiva", Antropología Física Latinoamericana (en prensa). --, yS.C. Serrano (2002b), ''EarlyPeoplingand Evolutionary Diversification in America",

hacia 180000-200000 años (Cann, 1987; Stoneking, 1993); pero con las antigüedades actualmente conocidas se trataría más bien de un modelo "Out of Mexico" puesto que los de la cuenca de México son por lo menos 5 000 años más antiguos que lo conocido para Sebazac,

---,

Orrouy u Homme Mort. La tercera hipótesis es hasta el momento la más plausible porque: a) en ambas regiones hubo un efecto de reducción general de tamaño -acorde con el proceso de gracilización postulado entre otros por Lahr (1995, 1996)-, Y

Quaternary international (en prensa). MA Luis, A.L. Lustig, p.v. Ponce, M.C. Zanini y WA Neves (1999), "Posición de los araucanos en un contexto asiático-europeo 1: Metodología craneofuncional", Revista Argentina de Antropología y Biología, vol. 2, núm. 1, pp. 163-185.

182


LA DNERSIDAD PLEI5TOCENO-HOLOCÉNlCA DEL VALLE DE MÉXICO

Roudesli,

S. (1990),

"Contribution

a I'étude

Trouette, L. (1995), "Les ossements préhistoriques d'Orrouy", Bulletin et Mémoires de la Societé d'Anthropologie de Pans, 8' serie, núm.

anthropologique des populations néolithiques du Sud de la France. Comparisons avec les populations néolithiques d'Ítalie et d'Espagne", tesis inédita. Stoneking, M. (1993), "ONA and Recent Human

6, pp. 311-372. Wolpoff, M.H. y R. Caspari (1997), Race and Human Evolution, Nueva York, Simon y

Evolution", Evolution 01Anthropology, núm. 2, pp. 607-673. Thorne, A.G., M.H. Wolpoff (1992), "The Multiregional Evolution of Humans", Scien-

Schuster. --,j. Hawks y R. Caspari (2000), "Multiregional, Not Multiple Origins", American Journal 01 Physic Anthropology, núm. 112, pp. 129-136.

tific American, núm. 266, pp. 28-33.

183


PATRÓN DE DESGASTE DENTO-OCLUSAL EN DOS CRÁNEOS PRECERÁMICOS MEXICANOS Ricardo Lascuráin Ledesma,

* Carlos Serrano

Sánchez., **

Raúl Chávez. Sánchez., *José Luis Criales Corlés*** y Ximena Chávez. Balderas****

PAlABRAS CLAVE

RESUMEN Se describe el patrón de desgaste dentario en dos cráneos de la época precerámica de la cuenca de México, Chimalhuacán y Metro Balderas. Esta información contrasta con los datos consignados en la literatura en grupos humanos de cultura o nivel cronológico seme-

Desgaste dental, arcada y grados.

jantes, y se examinan las implicaciones bioculturales de la evidencia presentada, principalmente en relación con la dieta y las actividades

de manera recurrente un desgaste dental intenso. Tal fenómeno suele presentarse también en

de los antiguos grupos cazadores y recolectores de esta región del actual territorio mexicano.

ABSTRACT We describe the dental wear-pattern of two Preceramic crania of the Mexican Basin: Chimalhuacán and Metro Balderas. We contrast the obtained information with data from the literature of human remains of same cultural or chronological leve!. We discuss the biocultural implications of the found evidence, in relation to diet and daily activities of ancient hunter-

INTRODUCCIÓN En el hombre

ha sido observado

las poblaciones humanas contemporáneas que viven aún como cazadores recolectores. El uso pronunciado de las piezas dentarias en muchas de las poblaciones esqueléticas prehistóricas se considera evidencia del valor de supervivencia del complejo oro-facial (Molnar, 1971). Los cambios que ha presentado la dentición a partir del neolítico, tanto en sus rasgos morfológicos como en el tipo e intensidad del desgaste, pueden relacionarse con la cultura. Algunos estudios han mostrado que el desgaste dental decrece al aumentar la urbanización (Davies y Pedersen, 1955, Greene el al., 1967) y que la disminución de la exposición de la dentina en los grupos que habitan en ambientes secos y arenosos, donde este fenómeno ocurre más comúnmente, se correlaciona con el incremento de su desarrollo cultural

gatherers in the present Mexican territory.

* Facultad de Medicina, UNAM. ** Instituto de Investigaciones Antropológicas, *** CT Scaner, México. **** Museo del Templo Mayor, INAH.

prehistórico

(Brothwell,1963). El desgaste dental es resultado de una combinación de varios factores, entre ellos los rela-

UNAM.

185


R. LAsCURÁIN, C. SERRANO, R. CHÁVEZ,j.L.CRÍALES YX. CHÁVEZ cionados con la dieta y la forma de preparación de los alimentos, pero también con el uso de

gráficos. Es el caso de las propuestas de Broca y Hdrlicka, basadas en la elaboración de series

los dientes como herramienta, factor muy significativo a lo largo de la evolución humana. Tras plantear las consideraciones anteriores, nos pareció de interés registrar las manifestaciones del desgaste dentario en algunos especímenes precerámicos de la cuenca de México

graduadas del desgaste de la cara oclusal de los molares, o las de Brothwell (1963) Y Greene el aL, (1967), que establecen series numéricas para el registro del desgaste en los diferentes tipos de dientes, hasta las más utilizadas de Molnar (1971) y Schmucker (1985), que tienen en cuenta los gradientes de la exposición de la dentina.

como una primera aproximación al conocimiento de este fenómeno, que tiene implicaciones relacionadas con la tecnología, las con-

MATERIAL

En este caso examinamos sólo dos ejemplares de gran interés por su antigüedad, y como una primera referencia sobre el tema hemos procedido a realizar una descripción cualitativa aplicando sólo los criterios que se han utilizado en los últimos estudios mencionados. Grado de uso en los diferentes tipos de dientes, con base en examen de la exposición de la dentina, desde un desgaste apenas apreciable como facetas de uso, pasando por la exposición parcial o extensiva de la dentina, hasta la destrucción de la corona con las raíces funCIonando como superficie oclusal.

Se examinaron dos cráneos de la colección precerámica de la Dirección de Antropología Física del INAH: el cráneo de Chimalhuacán, Estado de México, y el del Metro Balderas del

Dirección de planos de uso (orientación de la superficie oclusal). Forma de la superficie oclusal (plana y suave o cóncava). Adicionalmente se registraron la pérdida ante mortem de piezas dentarias, las lesiones patológicas en

diciones ambientales, las actividades humanas y otros aspectos de la vida social de los primeros grupos que habitaron el país. Esto ofrecerá, además, una referencia para los estudios posteriores de colecciones esqueléticas más recientes, que habrán de documentar los cambios acaecidos en el paso de los pueblos de cazadores y recolectores a los de economía agrícola.

Distrito Federal, ambos considerados hasta hace poco tiempo los más antiguos de México. Su datación más precisa, que fue divulgada en este

el hueso alveolar, las caries dentales y la mala posición dentaria. Además de los procedimientos de examen macroscópico descritos, se aplicó un estudio de tomografia axial computariza-

simposio, confirma su carácter de representantes de los antiguos grupos cazadores recolectores de la cuenca de México, entre 10000 y 11 000 años a.P.

da para precisar algunas observaciones lo requerían.

que así

Ambos ejemplares han sido descritos en otros trabajos, por lo que nos limitaremos a reseñar las observaciones de sus rasgos dentales, objeto

DESCRIPCIÓNDENTAL

del presente texto.

Segundo premolar superior derecho. Se observa sólo la mitad de la corona anatómica con exposición

Chimalhuacán

de la dentina debido al desgaste. La superficie METODOLOGÍA

oclusal no presenta cúspides, sino un desgaste ligeramente cóncavo con inclinación de 45° hacia el lado palatino.

Se han diseñado diversas metodologías para evaluar el desgaste dentario, útiles sobre todo para estudios transculturales que abarcan poblaciones de diferentes cronologías o ámbitos geo-

Primer premolar superior derecho. El desgaste en la superficie vestibular abarca hasta la mitad del diente. En la superficie oclusal no se observan

186


PATRÓN

DE DESGASTE

DENTO-oCLUSAL

EN DOS CRÁNEOS

PRECERÁMICOS

MEXICANOS

ña foseta central, así como un tercio de la raíz dental. Las superficies mesial y distal del diente no hacen contacto con los dientes adyacentes. Incisivo central superior derecho. Este diente sobresale hacia el lado vestibular aproximadamente 1 mm de la arcada dental. La superficie vestibular es semiconvexa en su periferia y plana en el centro, con los rebordes de esmalte ligeramente prominentes en los lados mesial y distal. El borde incisal presenta desgaste ondulado hasta la mitad del tercio medio del diente; Figura 1. Arcada dentaria Chimalhuacán.

en la parte distal es semiplano. En la superficie palatina se aprecia el reborde distal prominente

del maxilar del cráneo de

formando una foseta triangular (no se observan fisuras ni cingulum) con la raíz dental expuesta aproximadamente un tercio de su longitud. La superficie lateral distal no hace contacto con el diente incisivo lateral derecho. Incisivo central superior izquierdo. La superficie

cúspides, sino un desgaste ondulado que forma dos planos. Cada plano tiene depresión en el centro y bordes resaltados; el primer plano es casi horizontal; el segundo tiene una inclinación de 30 hacia el lado palatino. Las superficies mesial y distal hacen contacto con los dientes adyacentes. La superficie palatina tiene una

vestibular es ligeramente convexa en sentido del tercio cervical a incisal y plana con bordes convexos de mesial a distal. El borde incisal presen-

0

ta un desgaste que abarca hasta la mitad del tercio medio del diente con inclinación oblicua: el desgaste en el borde distal es más marcado hacia la región vestibular y en el borde mesial es hacia el palatino. En la superficie palatina no se

quinta parte de la corona. Canino superior derecho. La superficie vestibular está drásticamente desgastada: es menor a la quinta parte del diente, lo cual no permite conocer en detalle sus características anatómicas. El desgaste tiene dos planos; en el primero la incJinación es de 45 hacia la superficie vesti-

aprecian los rebordes de esmalte debido al desgaste; tampoco se observan fosetas ni cingulum. Canino superior izquierdo. El patrón de desgaste es semejante al del canino derecho. El desgaste tiene una inclinación de 45 y abarca casi toda la superficie vestibular de la corona anatómica. El desgaste no es plano, sino que presenta ondulación hacia la superficie palatina y está ligeramente deprimido en el centro. En la superficie palatina sólo se observa una pequeña prominencia central.

0

bular; en este plano se observa la dentina con el conducto pul par. El segundo constituye 10 por ciento del desgaste total, tiene una inclinación contraria y forma una media luna sobre la superficie palatina. La superficie palatina tiene la mitad del tercio cervical y una cuarta parte

0

de la raíz dental expuesta. Incisivo lateral superior derecho. La superficie vestibular tiene la prominencia de esmalte dental dirigida hacia la superficie mesial. El desgaste del borde incisal afecta dos tercios de la corona

Primer premolar superior izquierdo. No se aprecia la superficie vestibular debido al desgaste oclusal. El desgaste de la superficie oclusal tiene una inclinación de 40 sobre la superficie 0

anatómica, es muy peculiar y tiene una inclinación aproximada de 30 en sentido de distal a mesial y discretamente de vestibular a palatino. En la superficie palatina se observa parte del reborde mesial de esmalte dental y una peque-

vestibular (el desgaste es menos inclinado que en el canino del mismo lado) llegando hasta el borde de la superficie palatina; está ligeramen-

0

te deprimido

187

en el centro.


R. LAsCURÁIN, C. SERRANO, R. CHÁVEZ,J.L.

CRÍALES YX. CHÁVEZ

Canino inferior izquierdo. El diente está totalmente girado hacia la superficie mesial y muestra casi la totalidad de la raíz. El desgaste oclusal que ha destruido la corona anatómica tiene dos planos con depresión en el centro y bordes resaltados; uno de los planos está inclinado hacia la superficie vestibular y parte del centro del diente; el otro plano es casi horizontal. Incisivo lateral inferior derecho. La superficie Figura 2. Arcada dentaria de la mandíbula de Chimalhuacán.

vestibular está desgastada hacia la mitad de la corona; sin embargo, se logra apreciar la con-

del cráneo

vexidad de la superficie en sentido de mesial a distal. El borde incisal tiene un desgaste con inclinación de 10° que afecta la superficie vesti-

Segundo molar inferior izquierdo. La superficie oclusal conserva las cúspides linguales, las cuales son de tipo metacónida y entocónida (ambas planas con depresiones en el centro) delimitadas por un surco. También se observa el surco mesiodistal, y en sitio de las cúspides vestibulares hay una concavidad formada por desgaste y

bular. La superficie lingual está completa. El diente; se aprecia ligeramente girado hacia el lado distal.

delimitada por el esmalte vestibular. La superficie lingual está completa, pero la superficie vestibular sólo conserva el tercio cervical. Este

tibular está desgastada hasta el tercio cetvical del diente. En la superficie lingual no se aprecia la unión del esmalte con el cemento radicular y la raíz se encuentra poco expuesta. La superficie mesiolateral tiene una fractura que afecta el borde incisolateral. No se observa la cúspide del canino; en cambio, el desgaste ha formado dos ligeras inclinaciones que convergen en el centro, dando origen a una superficie oclusal cóncava. Primer premolar inferior derecho. No tiene su-

Canino inferior derecho. Se halla ligeramente girado hacia el lado distal y tiene expuestos tres cuartos de la raíz dental. La superficie ves-

diente ha sobresalido del plano oclusal, lo que sugiere que en vida ya se había perdido el diente antagonista (segundo molar superior izquierdo) en la arcada opuesta. Primer molar inferior izquierdo. En la superficie vestibular se observan las dos raíces vestibulares, expuestas tres cuartas partes de su longitud; no hay corona anatómica. La superficie oclusal presenta una concavidad con elevación en el borde lingual, formando un filo de esmalte

perficie vestibular debido al desgaste. La superficie oclusal presenta dos planos de desgaste, uno que parte más allá de la mitad del diente y se inclina hacia el lado vestibular, y un segundo plano casi horizontal. Se observa la totalidad

muy agudo. La superficie lingual está completa. Segundo premolar inferior izquierdo. No hay superficie vestibular debido al desgaste del diente. La superficie oclusal no tiene cúspides, pre-

de la raíz con un granuloma apical de origen infeccioso. Segundo molar inferior derecho. La superficie

senta un desgaste con un solo plano de inclinación que parte de la superficie lingual con ángulo de 45° y termina hacia la superficie ves-

oclusal conserva las cúspides linguales, que son de tipo metacónido y entocónido, delimitadas por un surco. Los ángulos de estas cúspides son de 0°, es decir, son planas con depresiones en el centro. El resto del área está sumamente desgastado y conforma una concavidad que parte de la mitad de la superficie oclusal, se inclina

tibular. Primer premolar inferior izquierdo. Este diente carece de corona anatómica y tiene una fractura que afecta el ángulo oclusolingual; sin embargo, se aprecia un desgaste con inclinación hacia la superficie vestibular.

188


PATRÓN

DE DESGASTE

DENTO-OCLUSAL

EN DOS CRÁNEOS

45° Y luego sigue un plano casi horizontal, el cual ha destruido la superficie vestibular. La superficie lingual, semejante a la del primer molar inferior, es de forma de cono invertido aun-

MEXICANOS

palatino, la raíz está expuesta dos tercios de su longitud y sobresale de su alvéolo y del plano oclusal. Segundo premolar superior derecho. En la superficie vestibular se observa una cuarta parte de la corona anatómica. El diente está girado hacia el lado distal y sobresale de la arcada hacia ella-

que con los bordes ligeramente convexos de oclusal a cervical y con el surco que divide a las cúspides linguales. Tercer molar inferior derecho. Presenta una inclinación hacia el lado lingual; la superficie oclusal tiene un desgaste poco profundo en

do palatino, lo cual sugiere que la pérdida del primer molar superior derecho ocurrió cuando el individuo tenía vida. Las superficies mesial

forma de media luna.

y distal no hacen contacto con los dientes adyacentes. Primer premolar superior derecho. En la superfi-

Metro Balderas Tercer molar superior derecho. Diente completo, la superficie vestibular es convexa de mesial a distal, la superficie oclusal tiene forma ovalada y conserva cúspides tipo metacónida

PRECERÁMICOS

cie vestibular se observa solamente la quinta parte del diente con la mitad de la raíz expuesta. La superficie oclusal es cóncava debido al

y entocóni-

ligeramente girado hacia el lado mesial. En la superficie vestibular, las raíces se hallan expuestas hasta el ápice. La superficie oclusal es lige-

desgaste. Canino superior derecho. El eje del diente está fuera del plano oclusal; sobresale hacia el lado vestibular. En la superficie vestibular se observa una quinta parte de la corona anatómica, lo cual no permite conocer detalladamente sus características anatómicas. El desgaste en la superficie oclusal es cóncavo y se observa el conducto pulpar. Incisivo lateral superior derecho. Presen ta una

ramente cóncava; se observa un desgaste en forma triangular con bordes redondeados sobre el área de la cúspide palatina y abarca la cuart~ parte de la superficie oclusal. En el lado

fractura al nivel de la corona anatómica. Tiene desgaste tipo cóncavo hacia el lado vestibular. Incisivo lateral superior izquierdo. El eje del diente está inclinado hacia el lado vestibular y

da (planas con depresiones en el centro) delimitadas por un surco. Se observa una foseta entre las cúspides vestibulares. En la superficie palatina, la raíz está expuesta hasta dos tercios de su longitud. Segundo molar superior derecho. El diente está

sobresale de la arcada. El diente presenta un desgaste que lo abarca casi todo, quedando sólo la quinta parte de la corona anatómica. El desgaste es ligeramente cóncavo hacia el lado vestibular. En la superficie oclusal se observa el conducto radicular cerrado. La superficie vestibular presenta pequeñas fisuras debido a fracturas del esmalte. Canino superior izquierdo. El patrón de desgaste es ligeramente cóncavo hacia el lado vestibular y tiene forma de cazuela con aristas de esmalte.

Figura 3. Arcada Metro Balderas.

dentaria

Primer premolar superior izquierdo. La superficie oclusal presenta un desgaste oblicuo con ángulo de aproximadamente 45° hacia el lado palatino. El diente sufrió una fractura cuando

del maxilar del cráneo

189


R. LASCURÁlN, C. SERRANO, R. CHÁVEZ,j.L. el individuo tenía vida, quedando la mitad de la porción hacia el lado me sial. En su lado distal

CRÍALES vX. CHÁVEZ

que va de oclusal a vestibular con inclinación de 30°, Yel segundo que tiene un ángulo de 90° respecto al primer plano y que se dirige de modo oclusal hacia el lado lingual. Canino inferior izquierdo. El diente está total-

se observa desgaste en la arista palatina formada por la fractura. El desgaste es ligeramente cóncavo. Segundo molar superior izquierdo. La superficie oclusal presenta desgaste de 45° oblicuo hacia el lado vestibular, mostrando la cámara pul par.

mente desgastado y queda sólo una quinta parte. La superficie oclusal es ligeramente cóncava con una arista en el lado vestibular. Se observa el conducto radicular cerrado. Incisivo lateral inferior izquierdo. Fractura pos-

La superficie vestibular es muy convexa y no se observa el surco entre las cúspides vestibulares. Tercer molar superior izquierdo. La forma de la

mortem en la corona anatómica. Incisivo central inferior izquierdo. Fractura pos-

superficie oclusal es ovalada y casi no se notan las cúspides. En el área de la cúspide palatina hay un pequeño desgaste en forma triangular con bordes redondeados. Las otras cúspides son de tipo metacónida y entocónida (ambas casi planas con depresiones en el centro). Tercermolar inferior izquierdo. La superficie oclu-

mortem en la corona anatómica. Incisivo central inferior derecho. La superficie oclusal tiene un desgaste muy peculiar: es convexo y los bordes del desgaste llegan hasta la unión con el cemento radicular. Incisivo lateral inferior derecho. El diente tiene fractura, la superficie oclusal muestra desgaste

sal presenta desgaste inclinado con ángulo de 45° hacia el lado vestibular; abarca la mitad

tipo convexo. Canino inferior derecho. La superficie

de la superficie oclusal. El desgaste es ligeramente cóncavo con un surco en sentido de me sial a distal. En la superficie lingual el esmalte presenta una fractura posmortem. Segundo molar inferior izquierdo. La superficie oclusal tiene un desgaste en forma de cazuela, quedando sólo la cúspide mesiolingual, la cual

lfngual

es ligeramente convexa en dos fases. Primer premolar inferior derecho. La superficie oclusal tiene desgaste con inclinación de 45° hacia el lado vestibular. Este desgaste llega hasta la unión de la corona con la raíz. El desgaste sobre la superficie oclusal es convexo. Se obser-

presenta en el centro una foseta circular (cóncava con aristas). En la superficie vestibular el desgaste llega hasta la unión de la corona con la raíz (unión del esmalte con el cemento radicular). Se observa la cámara pul par. Primer molar inferior izquierdo. La superficie oclusal está totalmente desgastada; el desgaste es cóncavo con aristas de esmalte, tiene inclinación hacia el lado distal y llega hasta el cemento radicular. En la superficie lingual se observa una fractura posmortem en el esmalte. Segundo premolar inferior izquierdo. La superficie oclusal es ligeramente cóncava con aristas y

va el conducto radicular. Segundo premolar inferior derecho. La superficie oclusal tiene desgaste ligeramente cóncavo.

queda la quinta parte de la corona anatómica. Presenta fractura posmortem en el esmalte de la superficie lingual. Primer premolar inferior izquierdo. Este diente tiene desgaste en toda la superficie oclusal. El desgaste tiene dos planos de inclinación: uno

Figura 4. Arcada dentaria de la mandíbula Metro Balderas.

190

del cráneo


PATRÓN

DE DESGASTE

DENTO-oCLUSAL

EN DOS CRÁNEOS

Primer molar inferior derecho. La superficie oclu-

PRECERÁMICOS

MEXICANOS

algunos dientes, una manifestación aparente de enfermedad periodontal (Chimalhuacán) y la presencia de una caries dental (cráneo del Metro Balderas). Estas observaciones configuran condiciones muy precarias del aparato dentario, que si bien tienen relación con el género de vida, como se ha comentado, pueden estar vinculadas con el factor edad. Ambos especímenes corresponden a sujetos adultos de más de 30 años, edad avan-

sal tiene desgaste en forma cóncava con aristas de esmalte. Segundo molar inferior derecho. La superficie oclusal tiene desgaste inclinado hacia el lado vestibular, se observan las dos cúspides linguales, que son de tipo metacónida y entocónida (planas con depresiones en el centro). La superficie lingual está completa. Tercer molar inferior derecho. No se observa superficie vestibular. La superficie oclusal tiene las cúspides linguales planas con depresiones en el centro; muestra desgaste hacia el lado vestibular con inclinación hacia la cúspide mesiovestibular.

zada para la época, y por ello denota los estragos del tiempo en sus personas. En nuestro estudio no se puede valorar el

CONSIDERACIONES FINALES

Convendría proseguir así con el examen de otros especímenes. Al observar las ilustraciones

El patrón de desgaste dentario que muestran los dos ejemplares estudiados se caracteriza por un grado muy pronunciado de desgaste dentario, que llega hasta la destrucción de la corona, lo cual se puede relacionar con la forma de subsistencia de esta población.

del cráneo del Peñón I1I, femenino, de 25 a 30 años de edad a la muerte, puede constatarse que tenía una mejor salud dental, sin pérdida

factor sexo, que conforme a otros trabajos se constituye como un factor indicativo de diferentes tasas de desgaste y uso dentario diferencial en actividades de trabajo.

antemortem de piezas, con un desgaste intenso pero en un plano horizontal, lo que podría orientar a constatar las diferencias. por sexo en la población de la época precerámica. En estos cráneos existen variaciones esperables que conviene precisar. Aun con una muy

Se observaron planos de desgaste oblicuos, pero no con una misma orientación en ambas arcadas dentarias, lo cual puede atribuirse al uso de los órganos dentarios para propósitos que j.ban más allá de la alimentación, es decir, hay un uso probable herramienta.

de la dentadura

escasa bibliografia al respecto, con información de carácter muy general, se puede al menos citar el caso de los cráneos de Tehuacán, estudiados por Anderson, que presentan también un fuerte desgaste dentario, con planos de desgaste inclinados de manera regular y uniforme, en una forma diferente de los descritos en este trabajo.

como

En este sentido el patrón de desgaste asimétrico sugiere que tal vez los dientes se utilizaban para sujetar utensilios o ejercer presión sobre material fibroso con desplazamiento hacia adelante. Este desgaste peculiar de los dientes quizá conserve la forma del material que sujetaba. La forma de la superficie oclusal en los molares no es plana sino excavada, con una concavidad neta que podría no haber sido producida por una masticación dietaria normal.

Convendría comparar este tipo de observaciones con las que deriven de estudios en grupos del Preclásico: el contraste en el patrón de desgaste dentario, manifestaciones patológicas yen general salud dental revelará seguramente una información valiosa acerca de la relación entre el hombre y la naturaleza en el proceso de adaptación y desarrollo cultural de los pue-

Puede advertirse además, en ambos casos, la pérdida antemortem de piezas dentarias, la recesión alveolar con denudación de las raíces de

blos que, en un recorrido milenario, tado la cuenca de México.

191

han habi-


R. LAsCURÁIN, C. SERRANO, R. CHÁVEZ,j.L.

AGRADECIMIENTOS

CRÍALES YX. CHÁVEZ -------

Davies, T.G.H. Y P.O. Pedersen

(1953),

'"{he

Degree of Attrition of the Desiduous Teeth and First Ermanent Molars of Primitive and Urbanized Greenland Natives", British Dent

Agradecemos el apoyo de la Dirección de Antropología Física del Instituto Nacional de Antropología e Historia para la realización de este trabajo. Expresamos también nuestro reconocimiento al antropólogo José Concepción Jiménez por su valiosa colaboración.

Journal, 99, pp. 35-43. Greene, D.L., G.H. Ewing y GJ. Armelagos (1967), "Dentition of Mesolithic Population from Wadi Haifa, Sudán", AmericanJournal o/

BIBLIOGRAFÍA

Physical Antropology, 27, pp. 41-56. Molnar, S. (1971), "Human Tooth Wear, Tooth Function and Cultural Variability", American Journal o/ Physic Antropology, 34, pp. 175-190. Schmucker, BJ. (1985), "Dental Attrition: a Correlative Study ofDietary and Subsistence

Anderson, J.E. (1965), "Human Skeletons of Tehuacán", Science, núm. 148, pp. 496-497. Brothwell, D.R. (1963), '"{he Macroscopic Den-

Patterns in California and New México Indians", en C.F. Merbs y J.R. Miller (eds.),

tal Pathology of sorne Earlier Populations", en D.R. Brothwell (ed.), Dental Anthropology, Nueva York, Pergamon

Healt and Disease in the Prehistoric Southwest, Arizona, Arizona State University Anthropo-

Press, McMillan Co.,

logical Research Papers, pp. 275-323.

pp. 271-285.

192


ANÁLISIS MOLECULAR DEL ADNMT EN RESTOS ÓSEOS DE LOS PRIMEROS POBLADORES DE LA CUENCA DE MÉXICO Adrián Martínez-Meza,

* Miguel

M(ffeno Galeana, **

Álvaro Díaz-Badillo** y María de Lourdes Muñoz Moreno**

RESUMEN

ABSTRACT.

Las investigaciones de antropología molecular se han visto beneficiadas en los últimos años por

The research in molecular anthropology has been enriched in the last years, as result of the

la posibilidad de recuperar ADN mitocondrial (ADNmt) contenido en material óseo humano antiguo. El desconocimiento del origen de las poblaciones americanas antiguas ha llevado a

possibility in ancient sue. The American

formular múltiples hipóte~s que intentan explicar la diversidad de los primeros asentamientos humanos en México. En el desarrollo de la presente investigación se analizaron tres esqueletos

hypothesis, to try to explain the diversity of the first populations seated in Mexico. In this investigation were analyzed three burials whose skele ton is in "Fossil" state named as: Chimalhua-

de edad adulta de sexo masculino que se encontraron en la cuenca de México: el hombre de

cán, Tepexpan and Santa María Aztahuacán. The three skeletons belong to adult individuals

Chim<Jlhuacán, el de Tepexpan y el de Santa María Aztahuacán, que hoy día están en la Dirección de Antropología Física del Instituto Nacional de

of the masculine sex, and they are in custody of the Physical Anthropology Direction of the National Institute of Anthropology and History (Preceramics Collection). Ir is known that the native populations of America have four specific haplogroups (A, B, C, and D) that arises from unique sequences recognized by restriction

Antropología e Historia y forman parte de la colección de hombres precerámicos de México. Sabemos que las poblaciones nativas de amerindios presentan cuatro haplogrupos específicos (A, B, C y D) que surgen de secuencias únicas reconocidas por enzimas de restricción; confor-

to recover mitochondrial DNA(mtDNA) human material like bone or soft tissearch of the origin of the old populations has given origin to the

enzymes. In this perspective, the present study, was consider an attempt to know about the genetics marks of the first populations in the Mexican territory.

me a esta perspectiva, se plantea el presente estudio con el objeto de dar a conocer los marcadores genéticos de los primeros pobladores del territorio mexicano.

PALABRAS CLAVE

del

* Dirección de Anu'opología Física del lNAH. ** Departamento de Genética y Biología Molecular

Precerámicos,

poblamiento

CINVESTAV-IPN.

hipervariable

I y 11,Ygenética de poblaciones.

193

de América, región


A. MARTÍNEZ-MEZA, M. MORENOG., A. DÍAz-BADILLO y M. DEL. MuÑoz INTRODUCCIÓN

los restos óseos humanos explorados en asentamientos precerámicos prehispánicos, como es el caso de los especímenes utilizados en la presente investigación, que proceden de la cuenca de México, se consideran los primeros pobladores y han sido denominados Hombres Precerámicos de México, hoy día parte del acervo perteneciente a la Dirección de Antropología

La antropología molecular forma parte de un proceso histórico en el que se considera que el ADNcontiene información genética de los seres vivos que ha acumulado cambios al azar, ya que pueden ser escogidos o no por la selección natural; la reconstrucción de este proceso genera información de gran utilidad para la antropología física y para las investigaciones de filogenia y dinámica de poblaciones; en este sentido, el análisis del ADNmitocondrial ha contribuido con importantes aportaciones para el estudio de la evolución humana. Los trabajos de antro-

Física del Instituto Nacional de Antropología e Historia. Las muestras óseas fueron tomadas de los esqueletos del hombre de Tepexpan, del de Chimalhuacán y del de Aztahuacán. Estas variables nos permitirán comprender mejor el pasado al brindarnos la posibilidad de determinar el grado de interacción biológica y cultural de los primeros pobladores, ya que pese a los numerosos avances aún son muchas

pología molecular han podido llevarse a cabo gracias a las particularidades y características del ADNmt, que junto con las técnicas más recientes de extracción de ADNen restos óseos antiguos y su amplificación por la PCR (Reac-

nuestras incógnitas; por lo mismo es importante que los estudios de antropología física se abran a nuevas perspectivas, entre ellas las técnicas de biología molecular y otras disciplinas afines que son idóneas para enriquecer el conocimiento sobre los primeros hombres que poblaron el continente americano, y en particular

ción en Cadena de la Polimerasa) brindan la posibilidad de obtener resultados más precisos acerca del origen y movimientos migratorios de las poblaciones americanas. Los descubrimientos generados por la biología molecular, y en particular por el estudio del ADNmt, han contribuido al conocimiento de las relaciones de parentesco entre las poblaciones antiguas (Paiibo el al., 1988; Torroni el aL, 1994), de ahí que investigadores de diversas disciplinas científicas se hayan abocado, partiendo de muy distintas perspectivas e intereses particulares, al estudio del origen del hombre y su amplia distribución geográfica. La mayoría de los estudios

Tepexpan

LAG DE TEXC

ca

de este tipo tiende a englobar las teorías y los postulados al respecto que surgen de la antropología y aborda temas relacionados con la evolución, los cambios socioculturales, los movi-

ESTADO DE M~Xlca D.F.

11

mientos migratorios y las líneas y sistemas de parentesco (Greenberg el al., 1986; Merriwether el al., 1995).

Chimalhuacán

Santa María Aztachuacán

La información genética del ADN que ha sido recuperado en restos óseos humanos de culturas antiguas ha contribuido a la formu-

IZTAPALAPA

lación de teorías en torno al poblamiento de América, muchas de las cuales se basan en los estudios arqueológicos y antropofísicos de

Figura 1. Ubicación de los sitios: Santa María Aztahuacán, Chimalhuacán y Tepexpan, tomando como referencia la ciudad de México (Pompa, 1988).

194


ANÁLISIS MOLECUlAR DEL ADNMT EN RESTOS ÓSEOS DE LOS PRIMEROS POBlADORES

de

mación" genética vía materna que es esencial para la herencia de los seres vivos y cuya secuencia se conoce en su totalidad, se encuentra en múltiples copias con un promedio de varios cientos de moléculas en cada célula, y evoluciona acumulando cambios de bases en

de la evolución a través a los mecanismos que de donde se intentará pudiera existir entre las

un promedio de 5 a 10 veces más rápido que el ADN nuclear (Chomyn eL al., 1985). Para el estudio de los tejidos óseos antiguos se utiliza la técnica de PCR (reacción en cadena de la

macromoléculas. y la construcción de la historia evolutiva de los organismos. Conocida también como "filo-

polimerasa) . En los restos antiguos el ADNha sido modi-

el territorio mexicano. Ahora bien, se sabe que la evolución molecular está constituida por dos áreas de estudio: La evolución de las macromoléculas. Se refiere a la cantidad de patrones de cambios ocurridos en el material genético ADN) y los productos del tiempo, así como generan los cambios, inferir la relación que

(secuencias

genia molecular", permite conocer la historia evolutiva de los organismos y las macromoléculas a partir de datos moleculares (Giles eL al.,

ficado por algunos factores que producen su reducción de tamaño, debido posiblemente a cambios y pérdidas de bases pirimidinas, al entrecruzamiento entre las bases, y también a pro-

1980). Los primeros estudios que se realizaron sobre"la evolución molecular de restos antiguos se centraron en las proteínas y se denominaron "marcos genéticos clásicos"; ejemplo de ellos es el estudio del colágeno, proteína más abundante en los tejidos, incluido el hueso (Lehninger,

cesos oxidativos, que traen como consecuencia daños estructurales y transformaciones en su información genética, además de la pérdida de sitios de reconocimiento por enzimas de restricción (Stonecking eL al., 1991; Ward eL al.,

1982). Es sabido que toda la información de un organismo está codificada en el ADN,de ahí que tras las innovaciones en las técnicas de la biología molecular se emprendiera el estudio de los restos antiguos, ya que el ADNmt mantiene parte de su estructura, aun cuando se degrade

gen, al igual que en otros lugares, a partir de marcos genéticos clásicos, pero fue en los años setenta cuando se planteó el análisis de la filogenia molecular partiendo de datos genéticos obtenidos de restos humanos. En la década de los ochenta se investigaron las características

en fr9gmentos que fluctúan entre 200 y 3800 pb, dependiendo del medio ambiente donde se encuentre el resto óseo (Paabo eL al., 1988;

afines y los factores que influyeron en las poblaciones aborígenes del norte de América. Afortunadamente este tipo de análisis se ha promovido en los últimos años; así se ha tomado a ciertas comunidades como punto de partida y se les ha comparado con ciertos grupos asiáticos y polinesios. Los primeros resultados, obtenidos por comparación de secuencias de ADNmt, confirman el origen asiático de las poblaciones

1991; Paabo, 1991). Las poblaciones de América tuvieron su ori-

Horai eL al., 1991; Muñoz eL al., 2003). La secuencia del ADNmt contiene regiones conservadas y regiones variables, de ahí que sea factible realizar estudios de genética de poblaciones. Con el análisis del ADNde restos óseos humanos se pueden determinar el ADNnuclear y el ADNmitocondrial; en los estudios de genéti-

amerindias. Es indudable la importancia de sentar las bases sobre nuestro origen, sobre la variabilidad genética de las poblaciones prehispánicas mexicanas, sobre su flujo genético y sobre el número de migraciones (Merriwether eL al., 1995; Torroni eL al., 1992; Horai eL al., 1993). Hoy día es factible lograrlo valiéndose de este tipo

ca de poblaciones en restos óseos antiguos se emplea el ADNmt porque ofrece las siguientes ventajas: a) tiene un genoma circular de aproximadamente 16500 pb que codifica para 13 polipéptidos diferentes, para las dos subunidades de rRNA (ácido ribosomal) y los 22 tRNA (ácido de transferencia), y b) transporta infor-

195


A. MARTÍNEZ-MEZA, M. MORENO G., A. DÍAz-BADILLO y M. DE L. MuÑOz de análisis y contando con las colecciones de muestras de restos óseos prehispánicos, prece-

do el cadáver se depositó en el fondo del limo lacustre. El esqueleto fue encontrado a una profundidad de -1.17 metros de la superficie y a 32 centímetros de un sello formado por un suelo de caliche. En la misma capa se hallaron numerosos huesos de megafauna, el más próximo de los cuales se encontró al excavar a 300 metros de distancia.

rámicos y modernos, de ahí que los resultados podrán compararse con los estudios de las poblaciones indígenas actuales y así se creará un banco de datos para el futuro.

ANTECEDENTES Se cuenta con restos óseos que evidencian

El esqueleto incompleto y evidentemente mineralizado (cristalizado), tras haber permanecido miles de años en ese lugar, pertenece a un individuo adulto de 55 a 60 años de edad a su

que

el territorio mexicano estuvo poblado desde hace miles de años; muestra de esto son los fósiles de Santa María Aztahuacán, del hombre

muerte, de sexo masculino, lo que lleva a pensar que no se trata de un entierro intencional,

de Tepexpan y los de Chimalhuacán (Aveleyra, 1950; Romano, 1955; Pompa, 1988).

sino que posiblemente el hombre de Tepexpan murió de modo accidental durante una cacería

En el año de. 1945 fueron descubiertos los restos del hombre de Tepexpan por el doctor Helmut de Terra, de la Viking Fund, quien trabajó con el antropólogo Javier Romero del Instituto Nacional de Antropología e Historia (INAH), quien se encargó de llevar a cabo su descripción y estudio anatómico. Tepexpan se localiza en el kilómetro 7 de la carretera Venta de Carpio-Teotihuacan en el actual Estado de México; el lugar preciso del hallazgo debió ser un sitio pantanoso y de aguas superficiales cuan-

y posteriormente su cuerpo fue devorado por fieras o aves que diseminaron algunos de sus huesos (Aveleyra, 1950). En un estudio posterior, Genovés (1960) asegura que el esqueleto corresponde a una mujer joven y no a un hombre viejo, como se concluyó en la monografía previa (De Terra el al., 1949), por lo que la determinación del sexo de este individuo está en discusión. En investigaciones realizadas últimamente respecto a su fechamiento se calcula que data de 10000 años a.e. (Pompa y Serrano, 2001). El segundo esqueleto de nuestra muestra es el que fue localizado en el pueblo de Santa Ma-

@ Tepexpan

ría Aztahuacán, lugar ubicado al sureste de la ciudad de México entre las carreteras de Puebla e Iztapalapa. Las excavaciones fueron llevadas a cabo en enero de 1953 por el maestro Arturo Romano, del INAH, a quien se comisionó para explorar dichos restos. El esqueleto se halló en un antiguo manantial y aparentemente se trataba de un entierro de dos individuos adultos jóvenes en posición de decúbito lateral derecho, ligeramente superpuestos, a los cuales les

@i Chimalhuacán @ Santa María Aztahuacán

N

~

faltaban las extremidades inferiores y los huesos pélvicos debido a los cortes efectuados en los bordes del manantial. La orientación general del entierro

fue de oeste a este y se localiza-

ron a una profundidad media de 1.30 metros; los restos óseos se encontraron fragmentados,

Figura 2. Sitios de recuperación de las muestras de Tepexpan, Chimalhuacán y Santa María Aztahuacán.

196


ANÁLISIS MOLECULAR DEL ADNMT EN RESTOS ÓSEOS DE LOS PRIMEROS POBLADORES

incluyendo los cráneos, cuyas regiones témporo-parietales izquierdas se hallaban hundidas en parte, y el resto disperso sobre el área ocupada por los esqueletos (Romano, 1955). Los individuos fueron numerados según el nivel en que se hallaron.

MATERIALES Y MÉTODOS Los materiales utilizados para este estudio fueron las siguientes muestras: un gramo de hueso esponjoso del trocánter del peroné izquierdo en el caso del hombre de Tepexpan. En el de Chimalhuacán, un gramo de hueso de la cabeza del fémur izquierdo, y en el de Santa María Aztahuacán 1, un gramo de hueso del cuerpo de una vértebra dorsal.

Lo más notable. de estos fósiles era el peculiar color café oscuro que presentaban, además de la avanzada mineralización en que se encontraban (Romano, 1955). Las pruebas de flúor, C14 e hidratación de obsidiana asociada a los huesos proporcionaron elementos para asignarles una antigüedad de 9000 años a.P. (Ro-

Cabe mencionar que los tres individuos proceden de la cuenca de México y que en cierta manera son especímenes que se conservaron

mano, 1974). Recientemente se les asignó una edad de 7000 años a.C. (Pompa y Serrano, 2001), coincidiendo así con el fechamiento anterior.

durante miles de años en el sedimento de lo que fue el lago de Texcoco hasta su fortuito encuentro. Asimismo, conviene aclarar que el ma-

El tercer esqueleto objeto de nuestro estudio se end'intró a finales de marzo de 1984 cuando se construía una fosa séptica en la colonia Embarcadero, municipio de Chimalhuacán, Estado de México; los huesos humanos se hallaban asociados con huesos de animal y una punta de proyectil.

terial denominado óseo ya ha desaparecido, dejando "los huesos" mineralizados (fósiles). En estas muestras óseas se realizó la obtención de ADN con la técnica tomada del manual de laboratorio de Maniatis el al., (1982) y modificada por Muñoz el al. (2003). Para el aislamiento del ADN a partir de los restos óseos se empleó 1 gramo de hueso esponjoso, eligiendo el peroné, el fémur y una vértebra de los individuos, ya que estas partes suelen ser una buena fuente de obtención de ADN en el esqueleto. Durante el proceso conviene usar guantes estériles para evitar al máximo la contaminación del material genético.

El análisis de los restos estuvo a cargo del antropólogo físico José Antonio Pompa, del Departamento de Antropología Física del INAH, quien determinó que pertenecieron a un individuo de sexo masculino de 30 a 35 años a su muerte (Pompa, 1988). Al realizar los análisis de laboratorio se identificó a este espécimen como miembro del gran tronco mongoloide, específicamente relacionado con el noroeste de Asia (Mizoguchi, 1985; Turner, 1986), lo cual confirma que el origen del hombre americano temprano está en dicha región. La presencia de los primeros molares

El fragmento de hueso se limpia de polvo y otros contaminantes, raspando la cara externa del hueso con una navaja desechable, luego se someten los huesos a congelación a -70 oC durante 24 horas, para después ser pulverizados en un mortero estéril. Antes de trabajar en una muestra es necesario lavar y esterilizar el mortero. Se pesa un gramo en la balanza analítica y se deposita en un tubo estéril previamente eti-

inferiores con dos raíces nos sugiere que tiene mayor afinidad con el grupo de los llamados "indios americanos" (agrupación general) que con el de Na-Dene o Aleuto Esquimales (Turner y Christy, 1983). Otro rasgo de apoyo para esta determinación es la dolicocrania, forma que ha sido considerada característica de los pobladores más antiguos y que está presente en poco más de la mitad de los cráneos precerámicos (Comas, 1974).

quetado. Por cada gramo de material óseo se adicionan 10 mI de regulador de extracción (Buffer de lisis Tris 10 mM, pH 8.0; EDTA 0.1 M, pH 8.0; SDS 0.5%) y 1 mi de chelex al 20% para incubarse a 37 oC durante 60 minutos; se traslada a un baño de 56 oC y se deja incubando durante 2 horas más. Transcurrido el perio-

197


A. MARTÍNEZ-MEZA, M. MORENOG., A. DÍAz-BADILLO y M. DEL. MuÑoz do de incubación se transfieren las muestras a tubos corex de 30 mi y se adicionan 5 mi de

Para concentrar el ADN se precipitan 100 III de cada muestra con 10 III de acetato de amonio y 1 mI de alcohol isopropílico absoluto por 15 minutos a -20 oC y se centrifugan a 10 000 rpm durante 10 minutos. Los tubos se decantan, recuperando el precipitado en un tubo limpio para resuspenderlo en 20 III de agua estéril. En un gel de agarosa a 1% se deposita todo el contenido de la muestra en cada uno de los pozos; se corre el gel en una cámara para electroforesis a 100 volts hasta obtener fragmentos alrede-

fenol saturado de Tris 0.1 M, pH 8.0; se agita durante 10 minutos y se centrifuga a 10000 rpm durante 10 minutos. La fase acuosa se recupera en tubos corex limpios y se le adicionan 10 mi de la mezcla de fenol-cloroformo-isoamílico (25:24:1) con el propósito de desnaturalizar los componentes proteicos de la muestra. Se centrifuga en las mismas condiciones y se vuelve a recuperar la fase superior acuosa, que es la que contiene los ácidos nucléicos. Los tubos se colocan en un

dor de 10 y 15 kb (kilo bases). Se corta el gel a la altura de las muestras y se traslada cada fragmento a tubos Eppendorf de 1.5 mi previamen-

contenedor con hielo y se adicionan 2.5 volúmenes de alcohol isopropílico, más 0.1 volúmenes respecto al volumen original de acetato de sodio 3 M para dejar precipitando por 12 horas a -20 oc. El precipitado se recupera por centri-

te etiquetados. Se adicionan 500 III de yoduro de sodio a cada tubo con el fragmento de gel y se calientan a 55 oC durante 20 minutos para disolver la agarosa. Se adicionan 5'1l1 de "Glass Milk" re suspendida en agua (resina incluida en el kit de purificación que une al ADN), se agita y se mantiene a 4 oC de 5 a 10 mino

fugación a 10000 rpm durante 10 minutos y se resuspende en 500 III de agua estéril. El producto de la extracción se separa en alícuotas y se almacena a -70 oc hasta su uso posterior. Algunos estudios para extraer el ADNde restos óseos antiguos (Paabo, 1989; Merriwether el

Posteriormente se centrifugan a 5000 rpm durante 3 minutos; se decanta el sobrenadan te y se lava la resina con 250 III de "New Wash" (NaCi, Tris EDTA). Nuevamente se centrifuga a 5000 rpm durante 3 minutos. Se repite el lavado con "New Wash" y se centrifuga en las mis-

al., 1994) reportan que existen ciertas moléculas que pueden inhibir la actividad de la Taq polimerasa en la reacción de PCR (reacción en cadena de la polimerasa); por esta razón es primordial el proceso de purificación dentro de la técnica. Ninguno de los dos métodos utilizados garantiza la eliminación del inhibidor, pues

mas condiciones. Se le adicionan 50 III de agua y se coloca a 55 oC durante 10 minutos con el objetivo de que el ADNse separe de la resina. Se centrifuga a 5000 rpm durante 5 minutos y se recupera el sobrenadante en tubos limpios, procurando no tocar la resina. Una vez más se repite el paso anterior y el sobrenadan te obtenido se adiciona al anterior. Finalmente el ADN purificado se separa en alícuotas y se almacena a -70 oC hasta su uso. La resina inhibe la PCRy

siempre se pueden acarrear algunas de estas moléculas no visibles. A continuación se sugieren dos protocolos de purificación de acuerdo con las condiciones en que se presenta el ADNen su estado inicial. PURIFICACIÓNDELADNPOR GENE CLEAN

las reacciones de secuenciación, de ahí que se deba tener cuidado de no contaminar la muestra con éstos.

Se emplea cuando el ADN se observa notoriamente adherido a contaminantes en el gel de agarosa. Los inhibidores migran más rápido en el gel, fluoresciendo en tono azul, dependiendo del color de la muestra, en la parte inferior del mismo. Este método nos permite seleccionar la fracción del gel en donde se encuentra el ADNy apartarlo de gran parte de los contaminantes.

PURIFICACIÓNPOR COLUMNASWIZARD Consiste en el filtrado del ADNdirectamente

de

la extracción a través de una membrana que lo "atrapa" y lo aísla de la mayoría de las parúculas inhibidoras. Este método se emplea prefe-

198


ANÁLISISMOLECUlARDELADNMT EN RESTOSÓSEOSDELOSPRIMEROS POBLADORES rentemente cuando la preparación de ADN no tiene contaminantes en altas concentraciones en el gel de agarosa. . Antes de comenzar se agita la resina incluida

Al A2

tiene ADNcontemporáneo y nos permite corroborar que las temperaturas y los reactivos son adecuados, y otro negativo, en el que el ADN está ausente y verifica que el proceso esté libre de contaminación. Las condiciones de reacción y amplificación son las mismas para ambos fragmentos. Las soluciones utilizadas en la amplificación son las siguientes: BSA 3% con una concentración de 30 pg, Buffer 10X concentración de IX, DNTPs (10

friar a temperatura ambiente para que pueda ser utilizada. El volumen mínimo de la muestra debe ser de 50 pI; en caso contrario, deberá ser ajustado con agua estéril. Por cada muestra se emplea una jeringa de 3 mI sin émbolo, a la cual se le ensambla una columna que se sitúa en un tubo Eppendorf de 1.5 mI y se le agrega la muestra junto con 1 mI de la resina incluida en el kit (Wizard) DNA Clean-Up Resin 5.4 M Tiocianato de Guanidina.

mM) concentración

Se coloca en el émbolo y se espera a que la muestra se mezcle por inmersión. Se retira la columna de la jeringa y posteriormente el émbolo; si este último se retira primero, se correrá el riesgo de desprender la membrana de la columna, la cual se lava adicionando 2 mI de al-

lada estéril y se agrega la diferencia que resta de la suma de los reactivos. El perfil de amplificación es el siguiente: 1) 5 mino a 94 oC para la desnaturalización 2) 1 mino a 94 oC para la desnaturalización 2.1) 1 minuto a 59 oC para el alineamiento 2.2) 1 minuto a 72 oC

40 ciclos

para el alargamiento 3) 7 minutos a 72 oC

ma velocidad; posteriormente el ADNya puede ser almacenado a -20 oC (digestión del fragmento de PCRpara tipificar el haplotipo A). Para am-

para el alargamiento final 4) Almacenamiento a 4 oC

plificar la región control 1 del ADNmt, los aligas específicos que se emplearon fueron los publicados por Ward y sus colaboradores en 1991:

Los fragmentos obtenidos se corren en geles de agarosa 1.5% (Saiki el al., 1988). Los marcadores que se emplearon en este estudio comprenden uno de bajo peso molecular (figura 3) y otro de alto peso molecular (figura 4).

15996 5'GAAGCAGATTTGGGTACCAC 3' (182)

H 16401 5' GTGGGTAGGTITGTTGGTAT 3' (184) para el haplotipo

de 200 pM, Taq (poI) con-

centración de 2. U, aligo concentración de 50 pM, aligo, ADNconcentrado 100 ng. El volumen final se ajusta con agua bidesti-

cohol isopropílico al 80% y nuevamente se coloca el émbolo ejerciendo una presión suave. La columna se traslada a un tubo Eppendorf de 1.5 mi limpio y se centrifuga durante 2 minutos a máxima velocidad para secar la resina. Nuevamente se transfiere la columna a un tubo limpio y se agregan 100 pI de agua estéril precalen~da a 65 oC; se deja reposar durante 1 minuto para que el ADNse desprenda de la resina y se centrifuga durante 20 segundos a máxi-

Los primeros siguientes:

(590) (765)

Se prepara una mezcla de reacción con un volumen total de 50 pI; en cada reacción se incluyen dos controles: uno positivo, que con-

en el kit Y en caso de que presente cristales se calienta a 37 oc durante 10 minutos. Se deja en-

L

TGGCGGTATGCACTTTTAACAG GTGCTTGATGCTTGTCCT

RESULTADOS Se amplificó la región control 1 del ADNde las muestras de los restos óseos de los hombres

"A" son los

199


A. MARTÍNEZ-MEZA, M. MORENOe., A. DÍAz-BADILLO y M. DE L. MuÑoz

-23,130

·1,353

·9416 -6557

-1,076 ·672

·4361 ·603 ·2322 -2027 ·310 >261 271 ·234 -194 ·116 ·72

-564

·125

Figura 3. Marcador X174 DNA- Rae III. Marcador con bajo peso molecular que puede estimar fragmentos desde 72 pb hasta 1353 pb. Este marcador se obtiene de fago lambda digerido o cortado con Rae III (BioLabs).

Figura 4. DNA/ Rind III Fragments. Marcador de alto peso molecular diseñado para estimar el ÁND de doble cadena en un rango de 125 pb a 23.1 kb (Invitrogén). Se obtiene de fago lambda cortado con Rind 1lI.

de Tepexpan, de Chimalhuacán y de Santa María Aztahuacán con los aligas específicos reportados por Ward y sus colaboradores (1991). Se emplearon dos controles, uno positivo con ADN contemporáneo, y otro negativo, en el que no se adicionó ADN. Los resultados se pueden ver en la figura 5, donde observamos un fragmen-

mento de nuestro

to de 250 pb. Para determinar que el producto de amplificación era el correcto fue necesario secuenciar este fragmento o darle tratamiento con una enzima de restricción, misma que permite determinar el haplotipo "A". Para establecer este haplotipo se amplificó la región de los nucleótidos: Al A2

TGGCGeTATGCACTTTTAACAe GTGCTTGATGCTTGTCCT

amplificado

corresponde

al

tamaño esperado. Para determinar la presencia o ausencia de dicho haplotipo en esta muestra se hizo una restricción con la enzima Hae III. Se observan también los productos

de digestión

del fragmento de ADN que corresponden a los tamaños esperados con y sin restricción. Al haber restricción nos indica la presencia del haplotipo "A", el control positivo del ADN contemporáneo y el negativo sin ADN, carriles 7 y 8 de la figura, respectivamente.

CONCLUSIÓN

(590) (765)

En esta investigación con nuestra técnica,

hemos comprobado que desarrollada en México

por la Dirección de Antropología Esto en teoría nos lo debe dar un fragmento de 176 pb. En la figura 6 vemos que el frag-

Física del INAH

(DAF-INAH)Yel Centro de Investigación y Estudios Avanzados del IPN (Cinvestav-IPN) (Muñoz

200


ANÁLISIS

MOLECUlAR

------'.~

DEL ADNMT

EN RESTOS

M 1 2 3 4 5

6

ÓSEOS

DE LOS PRIMEROS

POBLADORES

7 8 9 10 11

M l. 2. 3. 4. 5. 6. 7. 8. 9.

Palenque Chimalhuacán Santa María .Aztahuacán Tepexpan Palenque Chimalhuacán Santa María Aztahuacán Tepexpan Palenque 10. (+) M

250 pb

11. H M

M

1

2

3

4

567

8

9 M 1. Tepexpan

con restricción

2. Tepexpan

sin restricción

3. Chimalhuacán

con restricción

4. Chimalhuacán

sin restricción

5. Santa María Aztahuacán

176 pb

con

restricción 6. Santa María Aztahuacán

sin

restricción

7. (+) M 8. (-) M

Figura 6. Haplotipo

A con restricción y sin restricción.

En los resultados obtenidos hasta el momento se detecta la presencia del haplotipo "A" en las tres muestras; ahora nos encontramos en el

el al., 2003), es posible realizar extracciones

de humano en restos óseos fosilizados, como es el caso de los restos de los hombres de Tepexpan, Chimalhuacán y Aztahuacán.

ADN

proceso de determinar la presencia o ausencia de los haplotipos "B", "c" y "D". La existencia de estos cuatro marcadores ha sido demostrada en grupos de poblaciones nativas de América y parte de Asia. La secuenciación de la región control

Cabe mencionar que las piezas óseas que se utilizaron se consideran las indicadas (vértebras dorsales y cabeza de fémur) y principalmente la parte que corresponde al hueso "esponjoso".

201


A. MARTÍNEZ-MEZA, M. MORENOG., A. DÍAZ-BADILLO y M. DEL. MUÑOZ 'T' nos permitirá estudiar la filogenia y corroborar la existencia del haplotipo "A" presente en los individuos objeto de este estudio. Con estas

(1985), "Functional Assignment of the Products of the Unidentified Reading Frames of Human Mitochondrial DNA",en E. Quagliarello, E.C. Slater, F. Plamieri, C. Saccone,

pruebas podemos asegurar que se está extrayendo ADNhumano de restos óseos antiguos.

AM. Kroon, Elsevier Sciences, Ed. Amsterdam,

Consideramos que los análisis realizados en estas muestras son de gran importancia, pues demuestran que el ADNse conserva en los restos óseos fosilizados, que es posible purificarlo y amplificarlo, y con ello conocer el origen

pp. 259-275. De Terra, H.,]. Romero y T. D. Stewart (1949), 'Tepexpan Man, Viking Found", Anthropology, núm. 11, Nueva York. Forster, P., R Harding, A Torroni y HJ. Bandelt (1996), "Origin and Evolution ofNative

genético de los primeros pobladores del territorio mexicano y, en un futuro, reunir resulta-

American mtDNA Variation: a Reappraisal", AmericanJournal 01Human Genetics, núm. 59, pp. 935-945. Genovés, S. (1960), "Revaluation of Age, Stature

dos de diferentes análisis moleculares de restos óseos precerámicos para dilucidar, en la medida de lo posible, las teorías arqueológicas y lingüísticas sobre el poblamiento del continente americano. Estamos conscientes de que si bien

and Sex of the Tepexpan Remains, México", American Journal 01 Physical Anthropology, vol.

éste es un primer paso para la biología molecular mexicana, constituye un gran avance de la antropología física para abordar pectivas de investigación.

18, núm. 3, Filadelfia, pp. 205-218. Giles, R.E., H. Blanc, H.M. Cann y D.C. Fallace

nuevas pers-

(1980),

BIBLIOGRAFÍA

lnheritance

of Human

'The Settlement of the Americas: a Comparison of the Linguistic, Dental and Genetic Evidence", Current Anthropology, vol. 27, núm. 5, pp. 477-497. Horai, S., R Kondo, K. Murayama, S. Hayashi,

Anderson, S., AT. Bankier, B.G. Barrell, M.H.L. Bruijn, AR Coulson,]. Brouin, LC. Eperon, D.P. Nierlich, B.A. Roe, F. Sanger, P.H. Schreier, AJ.H. Smith, R Staden y Young (1981), "Sequence and Organization of the Human Mitochondrial Genome", Nature, núm. 290, pp. 457-465. Aveleyra, A de A.L. (1950), El hombre de Tepex-

H. Koike y N. Nakai (1991), "Phylogenetic Affiliation of Ancient and Contemporary Humans lnferred from Mitochondrial DNA", Philosophical Transactions 01 the Royal Society 01 London {Biological Sciences}, núm. 333, pp. 409-417.

pan: historia de su descubrimiento. Prehistoria de México. "Revisión de prehistoria mexicana: el hombre de Tepexpan y sus problemas", México, Ediciones Mexicanas, pp. 53-58. --(1964), 'The Primitive Hunters", Handbook 01 Middle American Indians, Science Foundation, pp. 384-412.

"Maternal

Mitochondrial DNA", Proceeding 01 National Academy Sciences USA, núm. 77, pp. 6715-6719. Greenberg,].H., C. Turner y S. Zegura (1986),

---,

Nakagawa-Hattori, S. Hayashi, S. Sonoda y K. Tajima (1993), "Peopling of the Americas, Founded by Four Major Lineages of Mitochondrial DNA", Molecular Biology and Evolution, núm. 10, pp. 23-47. Lehninger, AL. (1982), Bioquímica, Barcelona,

National

Comas,juan (1974), "El poblamiento de América", Antropología fisica: época prehispánica, México, INAH,pp. 7-27 (panorama histórico y cultural).

Omega. Lisker, R (1994), Introducción a la genética humana, México, UNAM/Talleres de ediciones Copilco. Lorenz,].G. y D.G. Smith (1994), "Distribution

Chomyn, A, P. Mariottini, M.WJ. Cleeter, C.L Ragan, RF. Doolittle y A. Matsuno-Yagi

of the Four Founding

202

mtDNA Haplogroups


ANÁLISISMOLECUlARDELADNMT EN RESTOSÓSEOSDE LOSPRIMEROSPOBLADORES---among

Native North

Americans",

Journal ofPhysicalAnthropology,

(comp.),

American

307-323. Maniatis, T.E., E.F. Frisch y J. Sam Brook (1982),

"Los más anti-

guos americanos", Arqueología Mexicana, vol. IX, núm. 52, pp. 36-45. Romano, P.A (1955), "Nota preliminar sobre

Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Nueva York. Merriwether, D.A, F. Rothhammer y RE. Ferrell

los restos humanos sub-fósiles de Santa María Aztahuacán, D.F.", Anales del Instituto Nacional de Antropología e Historia, núm. 56,

(1994), Genetic Variation in the New World: Theet, Bone and Tissue as Sources of DNA, pp. 592-60l.

pp. 65-74. (1974), "Restos óseos humanos precerámicos de México", en Comas, Antropología

---

---

(1995), "Distribution of the Four Founding Lineage Haplotypes in Native Americans Suggests a Single Wave for the New World", AmericanJournal of Physical Anthropology, vol. 9, núm. 8, pp. 411-430. Mizoguchi, Yuji (1985), Shovelling a Statistical Analysis ofits Morphology, Tokio, University of

jisica: época prehispánica, México,

INAH, pp.

29-79. Saiki, RK, D.H. Gelfand, S. Stoffel y SJ. Scharf (1988), "Primer Direct Enzyrnatic Amplification of DNA with a Thermo Stable DNA Polymeraze", Science, núm. 239, pp. 487-49l.

Tokyo Press. Muñoz, M.M.L., G.M. Moreno, B.A. Díaz Loza, J.V.M. Macias, M.M.L. Márquez, LJ.C. Jimé-

Stonecking, Mark, D. Hedgecock, RG. Higuchi, KL. Vigilant y H.A. Erlich (1991), "Population Variation of Human mtDNA Control Region Sequen ces Detected by Enzyrnatic Amplification and Sequence - Specific Oligo-

nez y A. Martínez Meza (2003), Análisis del mitocondrial de una población prehispánica de Monte Albán, Oaxaca, México, Barcelona,

ADN

nucleotide Probes", American Journal of Human Genetics, núm. 48, pp. 370-382. --(2000), "Hipervariable Sites in the

Ediciones Bellaterra. Páábo, S. (1987), "Ancient DNA:Extraction, Characterization, Molecular Cloning and Enzymatic Amplification", Proceeding of National Academy Sciences USA, núm. 86, pp. 619tHJ200. --, J.A Gifford y ABan Wilson (1988),

mtDNA Control Region are Mutational Hotspots", American Journal of Human Genetics, núm. 67, pp. 1029-1032. Torroni, A., T.G Schurr, C.C. Yang, EJ. Szathmary, RC. Williams, M.S. Schanfield, G.A. Troup, W.C. Knowler, D.N. Lawrence, KM. Weiss y D.G. Walace (1992), "Native

"Mitochondrial DNA Sequence from a 7000 Years Old Brain", Nucleic Acids Research, vol. ---

'Origenes del hombre americano (semi-

nario), México, SEP. --Y C.E. Serrano (2001),

núm. 101, pp.

16, núm. 20, pp. 9775-9787. (1989), "Ancient DNA and Polymerase

Chain Reaction. The Emerging Field of Molecular Archaeology", Journal of Biology Chemistry, núm. 264, pp. 9707-9712. --, K Dew, B.S. FraizeryR.H. Ward (1990), "Mitochondrial Evolution and Peopling of

American Mitochondrial DNA Analysis Indicates the Amerind and Na-dene Populations were Founded by Two Independent Migrations", Genetics, núm. 130, pp. 153-162. --, M.F. Cabell, M.D. Brown, J.v. Neel, M.

Americas", Journal of Physical Antkropology, núm. 81, p. 277. -(1991), Amplifying Ancient DNA, PCR Pro-

Larsen, D.G. Smith, C.M. Vullo y D.C. Walace (1993), "Asian Affinities and Continental Radiation of the Four Founding Native American mtDNAS", American Journal

tocols. A Cuide to Method an Amplifications, Academic Press, pp. 159-166. Pompa, JA (1988), "Nueva evidencia en México: datos preliminares del hombre de Chimalhuacán", en Alba González Jácome

---,

203

of Human Genetics, núm. 53, pp. 563-590. S. Chen, O. Semino y AS. SantachiaraBeneceretti (1994), "MtDNA and Y Chromosorne Polyrnorphisms in Four Native Ame-


A. MARTÍNEZ-MEZA, M. MORENO G., A. DÍAZ-BADILLO y M. DE L. MuÑoZ rican Population from Southern México", AmericanJournal o/ Human Genetics, núm. 54, pp. 303-318. Turner, 1.,y G. Christy (1983), "Dental Evidence for the Peopling of the Americas", en Richard Shutler (ed.), Early Man in New World, Beverly HiUs/Londres/Nueva Delhi, Sage Publications, pp. 147-157.

---

(1986), "The FirstAmericans: the Dental Evidence", National Geographic Research, vol.

2, núm. 1, pp. 37-46. Ward, R.H., B.L. Frazier, K. Drew:Jager

y S.

Paabo (1991), "Extensive Mitochondrial Diversity within a Single Amerindian Tribe", Proceedings o/ the National Academic o/ Science USA, núm. 88, pp. 8720-8724.

204


RECONSTRUCCIÓN FACIAL ESCULTÓRICA DE UN CRÁNEO PRECERÁMICO DE MÉXICO (PEÑÓN III) Lorena Valencia* y María Villanueva**

RESUMEN

skull, the specimen Peñon IlI, located in the site Peñon de los Baños, México City in the year ofl959. Antropometric technic used and developed

En este trabajo se presenta un ensayo de reconstrucción facial escultórica de un cráneo femenino precerámico tomando como base el espécimen Peñón III localizado en el Peñón de los Baños, ciudad de México, en el año de 1959. Se emplearon las técnicas antropométricas

in the physical anthropology are used in the sculptural facial reconstruction (Taylor,2001), using the charts of thickness of the facial soft tissues of Villanueva, et al. in press. Also they took the morfoscpic features of the face of the mexican (Serrano, et al., 1996 and 2000). The physical anthropologist's combined work and of the plastic artist, allowed to obtain a satisfactory result in the facial reconstruction of the skull that occupies uso Our work offers the posibilities for forensic technique of the facial reconstruction applied to cranial copies of archaeological origino

desarrolladas en la antropología física y las que se suele utilizar en la reconstrucción facial escultórica (Taylor, 2001), aplicando las tablas de grosores del tejido blando facial de Villanueva et al. (2002) y tomando los rasgos morfoscópicos de La cara del mexicano (Serrano et al., 1996). Ettrabajo conjunto del antropólogo físico y del artista plástico dio un resultado satisfactorio en la reconstrucción facial del cráneo que nos ocupa. Ello habla de las posibilidades que ofrece la técnica forense de la reconstrucción facial aplicada a los cráneos de procedencia arqueológica.

PAlABRAS CLAVE Reconstrucción

facial, escultórico y cráneo.

ABSTRACT In this work we present a rehearsal of sculptural facial reconstruction of a preceramic female

Al aplicar la técnica de reconstrucción facial escultórica a los restos procedentes de contextos arqueológicos o forenses, es posible simular el tejido blando que debió cubrir un cráneo, partiendo del análisis morfoscópico y morfométrico de su estructura ósea. Así se obtiene buena parte de los elementos necesarios

*

Posgrado en antropología, Facultad de Filosofía y Letras e Instituto de Investigaciones Antropológicas de la UNAM.

**

Instituto de Investigaciones Antropológicas de la

UNAM.

205


LORENAVALENCIA y MARÍA VILlANUEVA para modelar un rostro con el propósito de conocer la apariencia que tenía en vida ese individuo.

tante mencionar que no brotaron el incisivo lateral inferior izquierdo ni los terceros molares inferiores.

Alrededor del mundo se han practicado muchísimas reconstrucciones faciales artísticas con distintos propósitos y desde tiempos remotos. Gran número de antropólogos fisicos, anatomistas y escultores se ha preocupado por realizar cuidadosas reconstrucciones de los pithecanthropus (hamo erectus), los neandertales, los hombres del paleolítico, etc. Han sido muchos

Recientemente se hizo una tomografia del cráneo y se pudo observar que los molares estaban sin erupcionar y que el incisivo lateral nunca existió. Conforme a los datos proporcionados por el estudio tomográfico (Lascurain et al., en prensa) se le asignó una edad de 27 años ± 2.

los investigadores de Rusia, Estados Unidos, Polonia, Bélgica y Francia, entre otros, que han ejecutado exitosas reconstrucciones empleando diversas técnicas y procedimientos (Prag y Neave, 1997).

debajo de una capa de roca caliza de casi dos metros de espesor. De acuerdo con los estudios tefrocronológicos (fechamiento por cenizas volcánicas) que se practicaron entonces, los restos pertenecían a la fase final del Pleistoceno superior (Mooser y González Rul, 1961); Lorenzo (1967) lo situó en el horizonte Cenolítico superior (7000 a 5000 a.C.).

El hallazgo se produjo al cavar un pozo por

En el Instituto de Investigaciones Antropológicas de la UNAMiniciamos la reconstrucción facial escultórica en cráneos de contexto arqueológico con un ejemplar maya procedente de un cenote de Yucatán (San Antonio), que fue extra-

Ahora bien, un nuevo y reciente fechamiento (González et al., 2002) calcula que la Mujer del Peñón tiene una antigüedad de 10755 ± 75 RCYBP(años de radio carbón antes del presente), aproximadamente 12700 CALYBP (años calibrados antes del presente). Tal fechamiento determina que este espécimen sea, por ahora, el más antiguo encontrado en México. .

ído por los arqueólogos de la Subdirección de Arqueología Subacuática del INAHy que ya ha sido mostrado en un documental Channel: Los misterios de Yucatán.

de Discovery

En el presente trabajo mostramos la reconstrucción facial escultórica del cráneo de la Mujer del Peñón III, atendiendo a la solicitud de la Dirección de Antropología Física del INAH.

Romano (1970 y 1974) publicó las medidas y los principales índices del cráneo, que es un dolicocráneo con un índice craneal horizontal de 70.59; en norma lateral es bajo (camecráneo: 68.45) yen norma posterior de altura media (metriocráneo: 96.97). La anchura de la frente es media (metriometopo: 67.42),

ANTECEDENTES En el año de 1959 se encontraron en la colonia Peñón de los Baños los restos muy mineralizados de una joven mujer adulta. Su cráneo, en muy buen estado de conservación excepto por la falta de una parte de la apófisis cigomática derecha y de algunas piezas dentarias (incisivos centrales superiores, incisivo lateral izquierdo

lo mismo que el prognatismo por el índice de Flower que arrojó la cifra de 102.13 (mesognato); la anchura de la cara es media (meseno: 50.76), las órbitas son altas (hipsiconco: 95.94), el paladar ancho, el índice nasal es de 51.06 (nariz ancha) y su capacidad craneana

superior, canino superior izquierdo y primer premolar superior derecho), se halla en condiciones propicias para intentar su reconstrucción facial escultórica.

es alta (aristencéfalo: 1340 c. c.). Además, se le calculó una estatura de 1.51 metros, o sea, una talla media tratándose de un individuo de sexo femenino. Las fotografias 1 a 4 del cráneo, en distintas normas, fueron tomadas de Romano (1974).

Por la importancia que tiene el dato para la estimación de la edad a la muerte, es impor-

206


RECONSTRUCCIÓN

FACIAL ESCULTÓRICA

(Pellón I1I).

Figura 4. Norma superior

lA RECONSTRUCCIÓN El trabajo de reconstrucción

PRECERÁMICO

Figura 2. Norma lateral izquierda

Figura 1. Norma frontal (Peñón I1I).

Figura 3. Norma posterior

DE UN CRÁNEO

(Pellón I1I).

(Pellón I1I).

Para realizar una tarea de esta naturaleza se requiere primeramente contar con parámetros del grosor del tejido blando facial que puedan ser aplicados al caso en estudio. A este respecto habíamos efectuado ya una investigación (Villanueva el al., 2002) que nos llevó a cuantificar dichos parámetros para la población mexicana actual, gracias a la colaboración que obtuvimos del Servicio Médico Forense del Distrito Federal.

facial escultórica

del cráneo del Peñón III fue realizado gracias a los métodos y las técnicas de la antropología física y a los conocimientos de los artistas plásticos. La colaboración entre miembros de ambas disciplinas es indispensable para lograr un rostro cuya apariencia es lo más objetiva posible.

207


LORENA

VALENCIA

y MARíA V¡UANUEVA

nantes en la población

A grandes rasgos, los pasos que se siguieron para la reconstrucción facial que aquí presentamos fueron los siguientes. 1. Se llevó a cabo un análisis osteológico (morfométrico y morfoscópico) y una observación de las impresiones musculares que presenta el cráneo con el propósito de realizar un moldeado muscular correcto. 2. Se hizo el molde del cráneo y se vació en yeso para trabajar

posteriormente

a la que pertenecía

el

cráneo, en este caso la denominada mongoloide. Para los rasgos morfoscópicos se consideraron los consignados en el sistema que proponen Serrano y sus colaboradores en La cara del mexicano. También se decidieron el color de piel que se daría al rostro y la forma y profundidad de las arrugas faciales, según edad, sexo y características musculares. 5. Se fueron cubriendo con plastilina los espacios entre los puntos craneométricos siguiendo las profundidades ya establecidas y se detalló la superficie.

sólo en la

réplica. 3. Ya en la réplica, se marcaron los puntos craneométricos establecidos para los grosores del tejido blando facial. Sobre ellos se coloca-

6. Se hizo una réplica en resina y se pintó el rostro con el color de piel convenido. En la figura 6 se presenta una fotografía de perfil que le fue tomada a la réplica que se hizo del cráneo y la figura 7 corresponde a la reconstrucción en plastilina de la Mujer del Peñón III.

ron unos pivotitos con las medidas milimétricas correspondientes a cada punto, según los datos promedio recabados entre la población cuyos parámetros fueron escogidos (véase la figura 5). 4. Se decidió cuáles serían el tamaño y la forma de los distintos rasgos faciales que se mode-

Por último, en la figura 8 se presenta una superposición lateral del cráneo y la reconStrucción facial que se hizo a partir del cráneo de la

larían: ojos, cejas, nariz, boca y orejas, siguiendo las características peculiares de la estructura ósea del cráneo, así como las formas predomi-

Mujer del Peñón 1Il.

11---",'4 12-"";1Ih

13--"':--

14--+':'"':'':-'

.:;:~~N~

10

Figura 5. Puntos craneométricos Taylor, 2001: 353).

para la medición

en cadáver del grosor del tejido blando facial (tomado de

208


RECONSTRUCCIÓN

FACIAL ESCULTÓRICA

DE UN CRÁNEO

PRECERÁMICO

te), conocido como la Mujer del Peñón III, fue un intento satisfactorio por muchas razones. En primer lugar cabe mencionar que, salvo la reconstrucción facial de carácter puramente escultórico del Hombre de Tepexpan que se llevó a cabo en Estados Unidos (véase De Terra el al., 1949), no hay otro antecedente para un cráneo precerámico de México. En segundo lugar pudimos poner a prueba los parámetros de grosor de tejido blando facial obtenidos recientemente en la población mexicana contemporánea, y consideramos que pueden ser aplicados eficientemente a cráneos de origen arqueológico. Con ello las técnicas forenses de reconstrucción facial hallan una aplicación útil en los ámbitos didáctico y museográfico, como una forma provechosa de aplicación social.

Figura 6. Molde del cráneo.

CONCLUSIONES

AGRADECIMIENTO

La reconstrucción facial escultórica que logramos a partir del cráneo precéramico más anti-

Agradecemos al artista plástico Juan Carlos Ramos su trabajo en el modelado de la reconstrucción facial del cráneo.

guo de México (12700 años antes del presen-

Figura 7. Perfil.

Figura 8. Superposición

209

lateral.


LORENA VALENCIA y MARÍA VILLANUEVA

Romano, A. (1970), "Preceramic Human Remains", Handbook of Middle American Indians

BIBLIOGRAFÍA De Terra, H., R Javier y T.D. Stewart (1949), 'Tepexpan man", Viking Fund Publications in Anthropology, núm. 11, Nueva York. González, S., LJ.C. Jiménez y j.A. Pompa (2002), "New Carbon-14 Dates for Early Humans in México", Mammoth Trumpet, vol. 17, núm. 3, p. 16. Lascurain, R, C. Serrano,

Physical Anthropology, University Press, Austin, vol. 9, pp. 22-34. ---

of Texas

(1974), "Restos óseos humanos precerámicos de México", México: panorama histórico

y cultural. Antropología fisica. Época prehispánica, México, SEP/INAH, pp. 29-8l. Serrano, C., M. Villanueva, j. Luy y K.F. Link

R Chávez, j.L.

(1996), La cara del mexicano. Identificador de rasgos faciales para la población mexicana.

Críales y j. Chávez (en prensa), Estudio com-

Sistema de retrato hablado asistido por computadora, México, IlA, UNAM/PGJDF. --(2000), "Sistema computarizado de identificación personal con rasgos morfológicos faciales", Antropología Física Latinoamericana,

parativo del patrón de desgaste dento-oclusal en dos especímenes mexicanos. Lorenzo,j.L. (1967), La etapa lítica en México, México, INAH (Publicaciones del Departamento de Prehistoria, 20). Mooser, F. y R González (1961), "Erupciones volcánicas y el hombre primitivo en la cuenca de México", Homenaje a Pablo Martínez. del Rio en el XXV aniversario de la edición de Los orígenes americanos, México, INAH, pp. 137-14l. Prag, j. y R Neave (1997), Making Faces, Austin, Texas A & M (University Athropology

México, IlA, UNAM, núm. 2, pp. 119-134. Taylor, K. (2001), Forensic Art and Illustration, Nueva York, CRC Press. Villanueva M., L. Escorcia,

L. Valencia

y C.

Serrano (2002), "Grosor del tejido blándo facial en una serie mexicana", Antropología Física Latinoamericana, México, IIA, UNAM.

Series, 1).

210


BUHL REVISITED: THEE-DIMENSIONAL RECONSTRUCTION

PHOTOGRAPHIC

AND MORPHOMETRIC RE-EVALUATION Nicholas P. Herrmann, * Richard L. Janlz and Douglas W Owsley**

RESUMEN

ABSTRACT

El esqueleto Buhl es hasta la fecha uno de los más antiguos enterramientos de Norteamérica.

The Buhl skeleton represents one of the most ancient North American burials analyzed to date.

Creen y sus colaboradores (1998) calculan que data de 10675 ± 95 a.P. Estos investigadores consideran que sus características están dentro del rango correspondiente a la población indígena. Esta conclusión se basa en el análisis craneométrico y en la morfología dental. El esqueleto de Buhl fue enterrado de nuevo, de ahí

Creen el aL (1998) report a data of 10675 ± 95BP. These researchers consider the skeleton to be within the range of American Indian population. This conclusion is based on the examination of craniometric, cranial non-metric and dental morphology. The Buhl skeleton has since be en reburied and is no longer available to researchers and several of the cranial measurements are not directly comparable to the Howells (1973), standard measurements. In this paper, we present a method for the recovery of two and three-climensional coordinate data from a series of photographs of the Buhl cranium. These new measurements are consistent with

que no esté a la disposición de los investigadores, quienes no pueden comparar varias de las medidas del cráneo con las medidas estándar de Howell (1973). En este artículo presentamos un método para recuperar los datos coordinados de dos y tres dimensiones de una serie de fotografías del cráneo Buhl. Estas nuevas medidas se conforman con las medidas de Howell y ofrecen la oportunidad de comparar el cráneo del Buhl con otros del paleoindio y tres poblaciones relacionadas, basándonos en el análisis craneométrico. Las nuevas medidas evidencian

Howells measurements and offer the opportunity to compare the Buhl cranium to other Paleoindian crania and three reference populations. Based on a canonical analysis of the new cranial measurements, it is evident that the Buhl cranium is quite different from both modern American Indian and Archaic Pe-

que el cráneo de Buhl es muy diferente del de los indígenas modernos y de los del periodo arcaico.

riod populations.

* Departament of Anthropology, the Vniversity of Tennessee, Knoxville, TN, EVA. ** Departament of Anthropology, National Museum of Natural History, Washington OC, EVA.

KEYWORDS Bulh, craniometric,

211

three-dimensional.


NICHOLASP. HERRMANN, RICHARDL.JANTZANDDOUGLASW. OWSLEY The Buhl skeleton from southern Idaho in the United States represents one of the earliest inhabitants of the Western Hemisphere. The skeleton and associated artifacts were discovered in 1989 within Lake Bonneville flood gravel deposits south of the Snake River near Buhl,

performed an osteological analysis and these data are ineluded in the Green el al., (1998) publication. The skeleton was in fair condition. The skull was complete and the post-eranial skeleton was well represented. The osteological analysis of the Buhl skeleton indicated that the individual

Idaho (figure 1). Given the geomorphological context of the remains, researchers from the Idaho State Historical Society and the Herrett

was a young female. Slight posmortem damage is present evidenced by a fracture along the base

Center for Arts and Sciences at the Collage of Southern Idaho suspected that the remains represented an early inhabitant of the region. An accelerator mass spectrometry (AMS) radiocarbon date of 10675 ± 95B.P. (Green el al., 1998) obtained from two bone fragments confirmed their suspicions. Given this data, the Buhl skeleton represented one of the oldest Paleo indians recovered in the continental United States. Following Idaho state law, the Shoshone-Bannock tribes elaimed the skeleton, and it was reburied in 1991. Prior to reburial Todd Fenton

300 O R*••••

of the cranium. In their analysis of the skeletal remains, Green and colleagues describe the Buhl skeleton as "within the range of American Indian or East Asian populations" (Green el al., 1998) and within the endnotes they state "the Buhl cranium shows its elosest affinities with Archaic American Indian and East Asian populations" (Green el al., 1998). In a more detailed examination of the craniometric data from the Buhl skeleton, Fenton and Nelson (1997) conelude "that, in general, she is not morphologically distinct from later North American IndÍans.

300 Kilometers !M,

Figure 1. Map depicúng this study.

the locaúons of the Paleoindian

212

crania (stars) and reference samples (circles) used in


BUHL

REV1SITED:

THEE-DIMENSIONAL

PHOTOGRAPHIC

RECONSTRUCTION

the coordinate data using pholomodeler Lite by Eos

In this paper, we reexamine the conelusions of Green el al., (1998), Nelson and Fenton (1997). Using new inter-landmark metric data derived from a series of standard scaled photographs graciously provided by Dr. Todd Fenton to the second author (RLJ) , we perform a canonical analysis of the Buhl craniometric data relative to other Palioindian crania and three reference samples. The methods used to derive the new measurements from the Buhl cranium required the construction of a three-dimensio-

Systems (http://www.photomodeler.com/Lite/). The program produces a the-dimensional model of an object based on the relationships of common points within the photograph. In the case of the Buhl crania, we were strictly interested in the inter-Iandmark distances and threedimensional coordinates of the landmarks used for Howells (1973) measurements. However, we needed to digitize as many common points between as many photographs as possible to insure an accurate three-dimensional model.

nal model of the landmarks and inter-Iandmark vectors. We employ a series of freely available software programs to perform this task. The inter-Iandmark data from five other Paleoindian crania are compared to the Buhl measurements.

Therefore, we use common points located on teeth, bony projections, postmortem fractures and cranial sutures. These data were then exported from Photomodeler Lite as an AutoCAD DXF file formato Finally, the DXF file was conver-

These samples inelude Pelican Rapids, Spirit Cave, Kennewick, Horn Shelter and Gordon Creek. The reference population represent two recent American Indian populations from Arizona and South Dakota and one Archaic Period sample from Indian Knoll in Kentucky. The osteometric analysis presented by Green

ted to a text coordinate file with a program called DXF2xy 1.3 written by Paul Guthrie. (http://guthcad.com.au/freestuff.htm) . In the second phase of the analysis we converted the three-dimensional coordinate data to inter-Iandmark distan ces using a window based program Microscribe3D gelcoords written by Dr. Stephen Ousley of the Smithsonian Institution National Museum of Natural History. This program conveniently converts the coordinate data to inter-Iandmark distances and places the measurements into a formatted Paradox data table. The Microscribe3D gelcoords program also generates a Paradox database with the coordinate data that can be used in thee-dimensional morphometric analyses.

el al., (1998) is limited given the format of the artiele. These authors briefly describe the material and present the data collected from the skeleton. The morphological analysis consisted of 50 cranial inter-Iandmark measurements, 28 post-eranial measurements and a variety of dental anfl skeletal non-metric traits. In a comment on the Buhl skeleton, Neves and Blum (2000) found that only 16 of the 50 cranial measurements corresponded to Howells (1973) standard data seto Given that most of the measurements

The third phase of this project consists of the analysis of the two and three-dimensional

presented by Green el al., (1998) were not comparable to other recent metric analyses, we felt it

METHODS

data. This paper focuses on the analysis of the two-dimensional data. The statistical analysis of three-dimensional configurations from Buhl and the other reference and comparative early North American samples will be the focus of another publication. However, three-dimensional

The reanalysis ofthe Buhl cranial measurement proceeded in a thee phases. The first phase entailed scanning the scaled photographs, digitizing the craniometric landmarks, and exporting

configurations from the six Paleoindian specimens and three consensus configuration from the reference samples were grouped and a generalized procrustes analysis (Le. generalized least-squares superimposition) was performed

was imperative to attempt to recover as many measurements as possible from the photographs.

213


NICHOLAS P. HERRMANN, RICHARD L.JANTZ AND DOUGLAS W. OWSLEY

in Morpheus

et al., (Slice, 1998; http://life.bio.

samples. Indian Knoll sample represents a hunting, gathering and fishing Archaie Period

sunysb.edu/morph). This procedure by no means satisfied the three-dimensional morphometric analysis currently underway, and it is used only as visualization tool to examine the

population fram central Kentoucky. The craniometrie data used in this study from Indian Knoll has been recently collected using a Microscribe 3-F digitizer (Hermann, 2002). The inter-Iandmark data was derived fram the threedimensional data set compares well the Snow's

overall shape differences in the specimens. CRANIA

The early North American crania used in this study are listed in table 1. These skeletons range

(1948) prior measurements. The Zuni sample was excavated fram Hawikuh in New Mexico. These crania are lack cranial deformation typical

in age from 10675 B.P. for Buhl to 7840 B.P. for Pelican Rapids. Dates for the crania examined are based on conventional or accelerator mass spectrometry (AMS) radiocarbon determination. Several radiocarbon dates are available from most the individual s listed in table 1, and the

of sorne proto-historie to history period Native American populations. Finally, the Arikara sampie represents the Le Beau phase occupations at primarily the Larson and Mobridge sites in South Dakota along the Missouri River. Dr. Ashley McKeown graciously provided the three-

date reported here represents aweighted mean for those individuals (e.g. Horn, Sprit Cave and Gordon Creek). It is obvious that numeraus Paleoindian crania were exeluded from this analysis (see Steele and Powell, 1992, for a summary of Paleondian data) Selection for inelusion was based on two parameters. First the cranium had to be relatively complete, thus a majority of Howells (1973) measurements were available. Second, three-dimensional coordinate data needed to be available for the individual.

dimensional consensus configuration for the Le Beau phase Arikara material (see McKeown 2000).

MEASUREMENTS Fifty measurements were captured through the sdigitization process of the Buhl cranium. These measurements are presented in table 3, and inelude a majority of the radii and subtenses that were not collected during the Green et al., (1998) analysis. Based on a comparison with

Three reference samples were selected based on same parameters as the Paleoindian crania. These samples are listed in table 2. These samples range in age fram 4180 B.P. for Indian Knoll to ca. 1 750AD for the Arikara

the other Paleoindian crania examined in this study, 39 measurements were available for use

TABLE1 PALEOINDIAN CRANIA EXAMINED FOR THIS STUDY Si/e

Sex

Jul Cordon

Creek

Localion in United Sta les

Dale

F

Idaho

10675 B.P.

F

Colorado

9456 B.P.

Texas

10021 B.P.

Reference Creen

el al., 1998

Breternitz el al., 1971; Swedlund and Anderson, 1998.

Horn

M

Kennewick*

M

Washington

8410 B.P.

Hood,1999

Pelican Rapids

F

Minnesota

7840 B.P.

Myster and O'Connell,

Spirit Cave+

M

Nevada

9415 B.P.

Dansie,

* Measurements + Measurements

taken 00 cast. taken from stereolithografic

morle!.

214

Young el al., 1987

1997;Jantz

1997;Jenks,

and Owsley, 1997

1936


BUHL REVISITED:THEE-OIMENSIONALPHOTOGRAPHICRECONSTRUCTION

REFERENCE

TABLE 2 SAMPLES USEO IN THIS ANALYSIS NUMBER OF INDJVlDUALS

2-D Analysis

3-D Analysis

Date

Kentucky

27

84

4180 B.P.

Herrmann (2001); Morey et al. (2002); Winters (1974)

Le Beau Arikara (Larson/ Mobridge)

South Dakota

220

220

1750 A.D.

Ca. 1650-Key (1983)

Zuni (Hawikuh)

New Mexico

47

57

1680 A.O.

Ca. 1450-Hodge (1937)

Location in United Sta tes

Site Indian Knoll

in our statistical analysis (italicized

codes in

sed as deviations from means. For our purposes, considered an individual of one individual. This

table 3). The second author has possession of these data and these data were aH coHected in the same system (see lantz Owsley, 2001, for a discussion of this point).

STATISTICAL The two dimensional

the appropriate sex each fossil cranium is population consisting assumption makes it

impossible to calculate a covariance matrix for these Paleoindian samples, but we can use a variety of analytical methods to overcome this problem. Similar to lantz and Owsley (2001), we compare Paleoindian crania to each other using a pooled within sample variance-covariance matrix from the three reference sampies. In addition, we perform a discriminant ciassification of the Paleoindian crania relative

PROCEDURES inter-Iandmark

Reference

data was

analyzed according to the methods described in lantz and Owsley (2001). Sexes were pooled and standardizes z-scores were calculated for the reference samples. Fossil crania are expres-

to the three reference samples. Individuals are

TABLE 3 /INTER-LANDMARK DISTANCES CAPTURED FROM BUHL DIGITIZATION (IN MM). THE CODE TERM REFERS TO HOWELLS (1973) MEASUREMENT SYSTEM. THE CODE IN ITALICS WERE USED IN THE CANONICAL ANALYSIS (N=39) Measure

Code

Measure

Code

GOL

182

NPH

64

WNB

Code

NOL

180

NLH

47

SIS

BNL

103

JUB

112

2MB

Measure 11.3 3.4 93

Code

Measure

Code

Measure

STB

92

DKR

78

FRC

104

ZaR

83

FRS

20

FMR

77 73 74

BBH

136

NLB

25

SSS

27

PRF

51

EKR

XCB

139

MAB

66

FMB

95

PAC

108

ZMR

WFB

90

MDH

28

NAS

14

PAS

17

AVR

84

ZYB

133

OBH

32

EKB

96

PM

54

BRR"

113

AUB

128

OBB

37

DKS

6

NAR

90

VRR

116

ASB

104

DKB

21

WMH

22

SSR

100

LAR"

109

BPL

105

NOS

10

GLS

3

PRR

106

BAR"

22

* Not included in Howells system but represent bregma radius (BRR), lambda radius (LRR)and basion radius (BAR).

215


NICHOLAS P. HERRMANN, RICHARD L.JANTZ AND DOUGLAS W. OWSLEY ------

RESULTS

classified in a specific group based on the lowest calculated Mahalanobis D2 value. Mahalanobis D2 values between Paleoindian crania and the

The metric data derived from the photographic three-dimensional reconstruction of the Buhl cranium compared well with the metric data reponed in Green el al., (1998). The correlation of the common points between the two data sets is high (r2=.996). a plot of the two data

reference samples are calculated according to the following formula (see Jantz and Owsley 2001)

sets is provided in figure 2. Three data points stand out from the match line. These points include interorbital breadth (DKB) , biorbital

Where X is the vector of measurements for a fossil skull, Xj is the mean vector for reference population j, and W is the pooled within-sampIe covariance matrix. The calculated D2 can be referred to a chi-square table with p (number of

breadth (EKB) and biauricular breadth (AUB). Neves and Blum (2000) did not include these measurements in their reanalysis of Buhl because these measurements reported by Green el al. (1998) do not specifically match

variables) degrees of freedom to obtain the typicality probability (Albrecht, 1992). In a similar fashion, Mahalanobis D2 values

Howells (1973) measurement descriptions. However, these measurements may be confused with the Howells measurement if one did not refer or have access to the data collection manual. The measurements reported in table 3 conform to Howells (1973) definitions. The distan ce structure of the Paleoindian crania is presented in table 4. Of the 15 distan-

can be calculated between two fossil crania by same formula. The formula is modified in the following way:

Where Xi and Xj are the measurement vector for fossils i and j, and W is an appropriate covariance matrix. We assume that the covariance matrix derived from the three reference samples is an appropriate

ce comparison,

estimate of the cova-

10 of the measurements

are sig-

200 ~-----------------,

riance matrix. We test the significance of the distance calculated between fossil crania pairs with a method

180 160 140

developed by Difrise-Gussenhoven (1967). Distance measures between pairs of individuals

<5

120

randomly drawn from a population

<:: <:: ro

100

ยง

80

oยก

will be dis-

tributed V(2P - 1) with a variance of 1, where pis the number ofvariables. In our case we are dealing with 39 variables for the random expected distan ce between pairs of fossil crania would be 8.77 if they were from the same population. Based on a one-tail test of significan ce

(ยกj I

60 40 20 O O

20

40

60

80

100 120 140 160 180 200

Green eta/.

any distance greater than 1.96 standard deviations greater that 8.77 would be considered significant at the 0.05 level (Le. a value of

Figure 2. Plot oft the Inter-Iandmark distance comparison between the measurment drived from the current study and the inter-Iandmark measurement reported by Creen el al., (1998). Note the highlighted measurement: AUB - Biauricular breadth, EKB - Biorbital breadth, and DKB - Interorbital breadth.

10:73).

216


BUHL

REVlSITED:

MAHAlANOBIS

Buhl Cordon

Creek

Horn Kennewick Pelican

PHOTOGRAPHIC

RECONSTRUCTION

TABLE 4 DISTANCES (D) BETWEEN THE PALEOINDIAN CRANIA

Spirit Cave Spirit Cave

THEE-DIMENSIONAL

Buhl

Cardon Creek

Pelican Rapids

Kennewick

Horn

0.0 13.11 *

0.0

12.65*

10.86*

12.12*

10.31

9.80

0.0

12.36*

8.70

11.60*

12.00*

9.81

11. 73*

10.66

11.96*

0.0

0.0 13.11 *

0.0

*p < 0.05

nificant. Four out of five distances for Spirit Cave and Kennewick are significant indicating that these individual are the most distinctive.

KnoH sample and in aH cases except one (Kennewick) the posterior probability is greater than. None of the fossil crania classify within

AH the remaining crania have at least three out of five significant distances. Kennewick and Buhl exhibit the lowest dis-

either of the recent American Indian samples. Given the analysis pro ce dure the crania had to be classified into one of the three samples. However, it is critical to examine the typicality

tance measure (d=8.70), which is quite interesting given their close geographic proximity. Two pairs of crania have equivalent maximum distan ce measures (d=13.11). Buhl and Spirit Cave is one pair and Kennewick and Pelican Rapids is the other pairo The distance between Spirit Cave and Buhl is somewhat surprising given their geographic and temporal relationshipo Although this pattern does potentiaHy indicated at least two distinct populations inhabitingJhe Great Basin in the early Holocene. The Kennewick and Pelican Rapids pairing is expected given that they represent the most distinct

score for the fossil crania relative to reference samples. Typicality scores range from zero too Gordon Creek exhibits the highest typicality scores for aH reference samples but would be a reluctant member of the two recent samples (Arikara and Zuni). The remaining five fossil crania are atypical of aH reference samples. This includes the Buhl cranium which produces typicality scores of 0.0000, 0.0001, and 0.0000 for

6.0 -,-----------------, Hom o

crania in the sample. A plot of the principal coordinates of the distance matrix of Paleo-

o

Gordon Creek

3.0

indian crania is shown in figure 3. The plot clearly illustrates the relationship observed in the distance structure. The classification of the fossil crania into

~ .,; '" r::! ~ u

specific reference samples foHowed similar proce dures as presented in Jantz and Owsley (2001). Table 5 presents the distance measure, classification, posterior probability and typicality score for fossil crania relative 10 the three reference samples. The calculated Mahalanobis distan ces (D2) range from 48.6 to 116.3. The Paleoindian samples aH classify within the Indian

Pelican Rapids o

0.0

g

o

Buhl

o

Kennewick

-3.0Spirit Cave o

-6.O+--.--~~".__,._,._,__.--,.-~--r_,_r-r~_r_i -8.0

-4.0

0.0

4.0

8.0

ComĂ­ (35.6%)

Figure 3. Principal coordinate of the Paleoindian crania.

217

plot of the relationship


N¡CHOLAS P. HERRMANN, RICHARD L. JANTZ AND DOUGLAS W. OWSLEY

TABLE 5 MAHALANOBIS

Spirit

SQUARED

(D2), REFERENCE CLASSIFICATIONS, PROBABILITIES FOR THE

DISTANCES

5.75

Horn

GROUP 3.62

POSTERIOR

AND TYPlCALITY PALEOINDIAN

SCORES

'" :¡::

CRANIA

Pelican

Buhl

1.48

Kennewick

u

EXAMINED

-0.65

4.70

Distance to: Site

Classijied into:

Larson

lndian Knoll

2.26 -0.17 ~•..•• -2.61

Zuni

Spirit Cave

Indian Knoll

95.4

Buhl

Indian Knoll

87.6

89.1 81.4

95.0

Gordon Creek

Indian Knoll

67.2

48.6

116.3 66.4

Horn

Indian Knoll

84.8

104.4

Kennewick

lndian Knoll

103.0 81.4

79.6

113.4

Pelican

lndian Knoll

81.1

70.5

88.5

Posterior / Probability

Larson

lndian Knoll

Zuni

Spirit Cave

0.041

0.908

0.052

Buhl

0.042 0.000

0.958 1.000

0.000

Cordon Creek Horn

0.000

1.000

0.000

Kennewick

0.295

0.705

0.000

Pelican

0.005

0.995

0.000

lndian Knoll

Figure 4. Canonical plot of the reference samples and Paleoindian crania. The first canonical accounts for 30.0% of the variation, the second accounts for 21.3% and the tirad accounts for 17.1%.

are clustered in the middle and at the base of the plot and the fossil crania surround these samples. The first canonical reflect lateral and lower facial projection, Kennewick and Buhl rank high on this axis and Spirit Cave and Pelican Rapids rank low on the first canonical. The second canonical reflect midfacial projection and width. Kennewick and Spirit Cave rank

0.000

Typicality

Larson

Spirit Cave

0.0000

0.0000

0.0000

Buhl

0.0000

0.0001

0.0000

Cordon Creek

0.0033

0.1404

0.0040

Horn

0.0000

0.0000

0.0000

Kennewick

0.0001

0.0001

0.0000

Pelican

0.0001

0.0015

0.0000

(}'

5.43

high on axis two and Gordon Creek ranks low. The Indian Knoll rises aboye the two other reference samples on the third canonical which reflects vault dimensions to sorne degree. This pattern makes sense given that Indian Knoll is a Late Archaic period sample dating ca. 4200 B.P.

Zuni

DISCUSSION

AND CONCLUSIONS

The Buhl skeleton represented one of the oldest inhabitants of the western hemisphere. However, the skeleton and associated artifacts from this individual have been reburied and are no longer available for study. Therefore, this research attempts to capture new data from the lost skele-

the Arikara, Indian Knoll and Zuni samples respectively. Figure 4 depicts a canonical plot of the reference samples and Paleoindian crania. This plot clearly illustrates the relationships

ton. This study focuses on a series of inter-landmarks distan ces derived from a three-dimensional model of the Buhl cranium. The availability of good, high resolution photographs of the

identified between individual crania and the reference samples. The recent reference samples

Buhl specimen allowed this analysis to precede. The data from the three-dimensional model sup-

218


BUHL REVISITED:

THEE-DIMENSIONAL

PHOTOGRAPHIC

RECONSTRUCTION

plements our existing information on the Buhl skeleton and permits greater flexibility in our analysis, interpretation and comparison to other early North American crania. The data derived also fill numerous gaps in the original data collection protocol, specifically in reference to various radii and subtense measurements.

the Buhl photographs. The forensic Data Bank at the University of Tennessee provided travel funds to the conference for the firts author. The Kentucky Heritage Council provided funds for the digitization of the 1ndian Knoll series.

Counter to the conclusions drawn by Green et al., (1998) and Fenton and Ne1son (1997) our analysis clearly demonstrates that the Buhl

BIBLIOGRAPHY Albrecht, G.H. (1992), "Assessing the Affinities

crania is atypical of recent American 1ndian samples. Gordon Creek is the only Paleoindian crania examined that exhibits any similarity to the recent Arikara and Zuni samples. The Gordon Creek individual also exhibits a low to moderate typicality score relative to the 1ndian sample. AlI other early crania examined in this

of Fossils Using Canonical Variates and Generalized Distances", Human Evolution, núm. 7, pp. 49-69. Breternitz, DA, AC. Swedlund y D.C. Anderson (1971), "An Early Burial from Gordon Creek, Colorado", American Antiquity, núm. 36, pp. 170-182. Dansie, A (1997), "Early Holocene Burials in Nevada: Overview of Localities, Research

study are atypical of the recent samples and the Archaic Period 1ndian Knoll sample. These early

and Legal 1ssues", Nevada Histoncal Society crania exhibit morphological patterns that are ( Quarterly, núm. 40, pp. 4-14. quite different from modern and even later ) prehistoric samples. These differences are evi- I Defrise-Gussenhove, E. (1967), "1967 GeneraIized Distance in Genetic Studies", Act Cene/. dent in the facial structure and projection as well as cranial vault dimensions. The small Mahalanobis distance calculated between the Buhl and Kennewick individuals is interesting.

Med. Camelan, núm. 17, Roma, pp. 275-288. Systems (2002), Photomodeler Lite http:/ / www.photomode1er.com/lite/index.html Fenton, T.W. y AR. Nelson (1997), "Biological Affinities of the Buhl Woman: One of the Oldest Paleoindian Skeletons Ever Recovered", American ¡ournal of Physical AnthroEOS

However, the Spirit Cave cranium is very different from al! its geographical!y proximate sampies (Le. Buhl, Kennewick and Gordon Creek). Excluding the Spirit Cave cranium, the overal! distance structure of the Paleoindian crania

pology Supplement, núm. 26, pp. 81-82 (resumen). Green,Tj., B. Cocharan, T.w. Frenton, J.C.

does hint at potential geographic and temporal patterning. This patterning may reflect several migration groups moving into different regions of North America. Whatever the cause of this

Woods, G.L. Titumus, L. Tieszen, MA. Davis y SJ. MilIer (1998), "The Burial: A Paleoindian Woman from Southern 1daho", American Antiquity, núm. 63, pp. 437·456. Guthrie, P. (1997), dxf"xy 1.3. http://www.

patterning, the Buhl skeleton is quite different from recent and later Archaic Native American groups.

guthcad,com.ua/freestuff.htm Hermann, N.P. (1997a), "New Radiocarbon Dates from Three Archaic Middens in

ACKNOWLEDGEMENTS

Western Kentucky: 1ndian Knoll (150h2), Ward (15McLl1) and Barrett (15McL4)", Current Research in Kentucky, vol. 8, Lexington.

We would like to thank Museo Nacional de Antropología and the Organizers of the sympo---

sium for the invitation to present a papero We also wish to thank Dr. Todd Fenton for providing

219

(1997b), "1s There Any Craniometric Variation at 1ndian Knoll?", ponencia pre-


NrCHOLAS P. HERRMANN, RICHARD L. JANTZ AND DOVGLAS W. OWSLEY ------

sentada en la Nineteenth Annual Kentucky Heritage Council Conference, Frankfort, Kentucky. Hodge, F.W. (1937), Hislory o/ Hawikuh, New México, One o/lhe So-called o/ Cibola, Los Ángeles, The Southwest Museum. Silice, D.E. (1998), Morpheus el al.: Software

the First Americans, Oregon State University, pp. 141-164. Swedlund, A.C. y D.C. Anderson (1998), "Gordo n Creek Woman Meets Kennewick Man: New Interpretations and Protocols Regarding the Peopling of the Americas", American Anliquily, núm. 64, pp. 569-576. Webb, W.S. (1946), "Indian Knoll, Site Oh2,

for Morphometric Research. Resision 01-3098. Departament of Ecology and Evolution, Nueva York, State University of New York,

Ohio Country, Kentucky", The University o/ Kenlucky &Porls in Anlhropology and Archaeology, vol. IV, parte 1.

Stony Brook, http://life.bio.synysb.edu/ morph Snow, C.E. (1948), "Indian Knoll Skeletons",

Winters, H.D. (1974), "Introduction to New Edition", en W.S. Webb, Indian Knoll, Knoxville, The University of Tennessee Press, pp. V-XXVII. Young, D., S. Patrick y D.G. Steele (1987), "An

The University o/ Kenlucky &porls in Anlhropology 'nd Archaeology, vol. IV, parte II. Steele, G.D. yJ.F. Powell (1992), "Paleobiological Evidence of the Peopling of the Americas: a Morphometric

View", R Bonnichsen R

Analysis of the Paleoindian Double Burial from Horn Shelter núm. 2, in Central Texas", Plains Anlhropologisl, núm. 32, pp. 275-297.

and

Theory /or Invesligaling lhe Peopling o/ lhe Americas, Corvallis, Center for the Study of

220


ACRILOCALIDADES

y TERRITORIALIDAD

EN EL PLEISTOCENO TARDÍO DEL NORTE DE SUDAMÉRICA Cristóbal Gnecco*

durante esa época en el norte de Sudamérica, a partir de evidencias arqueológicas y paleobo-

RESUMEN David Rindos (1984) acuñó el concepto de agrilocalidad para referirse a las culturas responsables de la domesticación especializada, las cuales muestran patrones espacio-temporales regulares que permiten el surgimiento y desarrollo de la agroecología. Esos patrones están estrechamente relacionados con la territorialidad y, por lo tanto, con una movilidad restringida y con la centralización del uso de los recursos, factores responsables de la transformación definitiva de la estructura de la mayoría de los ecosistemas. La concepción "nomádica" de los cazadofes recolectores que está vigente en la arqueología mundial desde hace 30 años supone la ausencia de territorialidad, ya que se considera que la mejor forma de enfrentar la variabilidad en la distribución de los recursos es mediante el movimiento de una región a otra, y la defensa territorial atentaría contra las posibilidades de sobreviven cia. Esta concepción nomádica domina la arqueología de los cazadores recolectores americanos de la transición del Pleistoceno al Holoceno, miento de agrilocalidades

tánicas.

ABSTRACT Rindos (1984) coined the term "agrilocality" to refer to the cultures responsible for specialized domestication showing regular spatio-temporal patterns which permitted the emergence and development of agroecology. Those patterns are Iinked to territoriality and, this, to restricted mobility and the focalized use of resources; these factors are in the source of the definite structural transformations of most ecosystems. The "nomadic" conception of hunter-gatherers in vogue in world archaeology for the last thirty years imp'lies the lack of territoriality because it has been suggested that the best way of facing the variable distribution of resources is through mobility from one regio n to the other; thus territoriality would militate against survival. This conception dominates the archaeology of pleistocene-holocene hunter-gatherers in the Americas, making the development of agroeco-

por lo que el surgientre ellos resultaría

casi impensable. Sin embargo, en el presente texto se sugiere la existencia de agrilocalidades

logies among them unthinkable. However, this paper indicates the existence of agroecologies during that time in northern South America

* Departamento Cauca.

from archaeological mation.

de Antropología, Universidad del

221

and paleoecological

infor-


CRISTÓBAL

GNECCO

ocuparon

PAlABRAS CLAVE Pleistoceno, poblamiento, localidades, Sudamérica.

territorialidad,

agri-

1991), pues modificaron los ecosistemas habitados al establecer un patrón temprano de explotación antes insospechado. La existencia incuestionable de agricultura y vida aldeana en muchas áreas de América hace unos 5000 años

Hace pocos años se inició la investigación arqueológica sobre las ocupaciones de cazadores y recolectores en una variedad de ecosistemas tropicales o semi tropicales, pese a que se había olvidado debido a una típica ortodoxia paradigmática. Por un lado se supuso que un modo de vida basado en la caza y la recolección no pudo desarrollarse en los bosques tropicales antes de que comenzaran las interacciones históricas con grupos de agricultores (Lynch, 1978; Bailey el al., 1989), Y específicamente para América se pensó que los primeros pobladores fueron cazadores de megamamíferos especiali-

una gran variedad de biomas, desde

franjas costeras áridas hasta bosques tropicales de tierras bajas, y que esas ocupaciones estuvieron asociadas con notables diferencias que no fueron solamente tecnológicas (v. g., Brayan,

nos ha hecho olvidar que la precedió el manejo de especies vegetales y animales silvestres, I menos visible por medios tradicionales. Las investigaciones sobre el impacto antrópico en varios ecosistemas, sobre todo en los bosques tropicales, y su incidencia en el manejo de las especies vegetales y animales que forman parte de ellos empiezan a arrojar información que difiere y rebasa la identificación segura de macrorrestos de cultígenos. En la América tropical existe información relevante en ese sentidó. En

zados y que, por lo tanto, sólo ocuparon y se desplazaron a través de las biomas abiertas en donde vivían esos animales (d. Willey, 1971). La ocupación de las selvas del neotrópico,

la secuencia sedimentaria del lago La Yeguada, en Panamá, apareció súbitamente hace 11 000 años un horizonte de fuego e intervención antrópica (Piperno el al., 1991), que se intensi-

que según esos argumentos fue privativa de los agricultores, habría ocurrido varios milenios después debido a las presiones demográficas y estaría inicialmente restringida a las áreas ribereñas;

ficó entre 11000 Y 10000 a.P. (Piperno el al., 1991). El aumento de especies colonizadoras que se observa hoy día, tanto en polen como en fitolitos, apoya la hipótesis de que ese fuego estuvo asociado con la apertura intencional del

los cazadores recolectores contemporáneos de los bosques tropicales fueron considerados, por lo tanto, "un accidente de sociedades agrícolas evolucionadas que fueron obligada a vivir en

bosque (Piperno, 1990a; Cooke y Piperno, 1993); es más, los restos quemados de polen y fitolitos de especies colonizadoras como Cecropia y Heliconia indican que los claros no sola-

un medio ambiente incapaz de sostener el patrón económico básico" (Lathrap, 1968). Aunque la ortodoxia sustentada en esas dos ideas parece superada, en la arqueología de los cazadores recolectores tempranos de América perviven aún varios elementos que tienen su origen

mente fueron abiertos, sino mantenidos, lo que atestigua una práctica evidentemente humana (Piperno 1990a; Piperno velt y sus colaboradores

en ella, que no se han analizado suficientemente y sobre los que existe poco consenso. En este trabajo me referiré a algunos de ellos, sobre todo a la consideración esencialista de la caza, de la recolección y de la agricultura, y la existencia temprana de las agrilocalidades y la terri-

al., 1991b). Roose(1989) encontraron

el

especies vegetales que proliferan en medios que han sido intervenidos, posiblemente por agentes humanos, en contextos arqueológicos 1 Este manejo, que incluye el cultivo de plantas morfológicamente silvestres, ha empezado a conocerse con el nombre genérico de protoagricultura. Otros términos también usados, pero menos precisos semánticamente (véase Leach, 1997). son preagricultura, cultivo y horticultura.

torialidad. Varios investigadores aseguran que los cazadores recolectores tempranos del continente

222


ACRILOCALIDADES

y TERRITORIALIDAD

fechados en más de 10000 años a.P. en la amazonia brasileña. Una evidencia semejante, aunque posterior, proviene del lago Ayauch, en Ecuador (Piperno, 1990a). Cabe mencionar que la documentación etnográfica sobre protoagricultores indica que la quema de la vegetación natural para estimular el crecimiento de especies útiles, generalmente pioneras, es un procedimiento muy característico de los grupos interesados en la intensificación artificial de los

EN EL PLEISTOCENO

TARDÍO

especies pioneras. Todavía es difícil determinar con certeza si esta apertura fue creada naturalmente o por agentes humanos; sin embargo, no parece una coincidencia que un espacio abierto esté en los alrededores de un sitio arqueológico; además, vale la pena mencionar un hecho circunstancial: que uno de los objetos encontrados en San Isidro es un artefacto biselado (véase la figura 1 A), aunque sin huellas de utilización ni residuos orgánicos.

recursos, sobre todo de semillas, nueces y raíces (Keeley,1995). Es numerosa la evidencia de que existieron

El análisis polínico de San Isidro revela otro asunto de suma importancia: la asociación de especies que ahora son alopátricas. Aunque este fenómeno puede explicarse aduciendo que la formación vegetal en la que se encontraba el sitio en la época de la frontera del

paisajes antropogénicos en Colombia desde 2000 años a.P. hasta la Conquista (Bray, 1991), pero ya contamos con información que muestra que la intervención y el manejo humano, sobre todo en los bosques tropicales, puede remontarse hasta la frontera entre el Pleisto-

Pleistoceno y el Holoceno no tiene análogos contemporáneos (Gnecco, 1995), también es posible que las especies útiles de tierras bajas representadas en el polen de San Isidro, especialmente Virola, fueran transportadas -y cultivadas, tal vez- desde su hábitat natural. De hecho, la asociación no natural de ciertas espe-

ceno y el Holoceno. La evidencia encontrada de San Isidro, un sitio precerámico monocomponente localizado en el valle de Popayán (Gnecco, 2000), sugiere la intervención y probablemente la modificación que hiciera el hombre en el ecosistema por lo menos hace

cies, no necesariamente domesticadas, puede indicar manipulación humana del ecosistema (Posey, 1984). También contamos con evidencia indirecta de la acción humana sobre los ecosistemas en San Isidro y en Peña Roja (Gnecco y Mora,

10000 años.2 Una muestra de polen asociada al componente precerámico de San Isidro incluye vegetación secundaria, como árboles y plantas herbáceas y malezas (Gramineae, Cyperaceaey dos esp~cies colonizadoras de espacios abiertos, Planlago y Trema), entre una mayoría de especies de bosque primario maduro. Esto sugiere la existencia en el sitio o en sus inmediaciones de un espacio abierto o parcialmente abierto en el bosque durante el tiempo de ocupación humana. La prevalencia de especies de bosque primario muestra con claridad que el fenómeno registrado no fue de tala total o deforestación, sino de creación de un espacio suficientemente abierto para permitir el crecimiento de

e

B

A

= o t

2

D

-= I 2

o

Figura 1. Artefactos y semilla carbonizada encontrados en San Isidro, Colombia. A: artefacto biselado; B: canto con bordes desbastados del cual se recuperaron fitolitos de la familia Maran/acea; C: semilla de Persea americana; D: semilla de Ery/hrina edulis.

2 Dos fechamientos convencionales con 04 sobre carbón encontrado en la mitad del depósito arqueológico arrojaron los siguientes resultados: 9.530 ± 100 a.P. (8-65877) y 10050 ± 100 a.P. (8-65878). Además, una semilla carbonizada datada con AMS dio una fecha de 10030 ± 60 a.P. (8-93275).

223


CRISTÓBAL

GNECCO

estos lugares, que Politis llama huertos silvestres (wild orchards), son visitados y aprovechados pe-

1997), un sitio del Medio Caquetá con un componente precerámico fechado en 9000 años3 (Cavelier et al., 1995). La dominancia (92%) de restos de Lagenaria en San Isidro y de restos de palma (más de 99%) en Peña Roja puede representar simplemente preferencias alimenticias o alta disponibilidad natural -como en las "islas de recursos" reportadas por Posey (1984) en el Amazonas-, pero también puede indicar una concentración artificial de palmas y otros frutos comestibles y de otra utilidad económica

riódicamente. De manera similar, los agricultores amazónicos siembran y cuidan claros en el bosque yaparentemente se ausentan con posterioridad; sin embargo, no los abandonan enteramente, sino que los desatienden para permitir la colonización por un sinnúmero de especies útiles, como plantas medicinales y herbáceas perennes con grandes raíces y tallos comestibles, y para la siembra intencional de otras especies de utilidad económica (Posey, 1983: 244-246 y 1984; Piperno, 1989); Posey los ha llamado campos en

inducida por agentes humanos y su explotación estacional por grupos móviles. En este sentido conviene recordar que una de las características

el bosque ([orest fields) y ha acuñado el término agricultura nómada para esta forma particular y eficiente de manejo y maximización de los re-

más notorias del trópico es la alta diversidad de especies, vegetales y animales y la consecuente baja densidad de las poblaciones (véase Meltzer y Smith, 1986) ,junto con su distribución homogénea, pero dispersa tanto en espacio como en tiempo. Por lo tanto, uno de los mecanismos de maximización previos a la domesticación fue la concentración artificial de muchas especies útiles que en condiciones naturales se encuentran

cursos silvestres. No hay que olvidar que la apertura de claros en los bosques tropicales, episódica debido a eventos naturales, e intencional debido a agentes humanos, no sólo1'avoreció la proliferación de especies vegetales útiles sino también de animales (véase Posey, 1983 y 1984; Cooke y Piperno, 1993); el aprovechamiento del aumento de biomasa animal como resultado de la intervención humana en los bosques tropicales fue llamado por Linares (1976) cacería en jardín (garden hunting). La principal característica de los huertos silvestres y de los campos en el bosque es que requieren poca o ninguna atención humana una vez que han

dispersas; esto debió haber requerido su siembra y cuidado, incluyendo el desmonte o la utilización y preservación de algunos claros producidos naturalmente. El registro etnográfico contemporáneo de grupos amazónicos, desde cazadores recolectores4 hasta agricultores plenos, es muy ilustrativo en este sentido. Por ejemplo, Politis (1996) ha

sido creados (Posey, 1993). La abundancia de plantas silvestres útiles es mucho mayor en las condiciones de regeneración que en las condiciones naturales normales, lo que pone en evidencia que la intervención humana en los bosques tropicales aumentó la capacidad reproductiva de muchas plantas útiles. Éste es el sentido exacto de lo que Rindos

mostrado que la estrategia de movilidad de los Nukak de la Amazonia colombiana propicia la concentración de especies útiles, sobre todo de palmas, en los campamentos abandonados;5 3 Para el componente precerámico de Peña Roja se han obtenido las siguientes fechas sobre carbón: 9125 ± 250 a.P. (GX-17395), 9160 ± 90 a.P. (8-52963) y 9250 ± 140 a.P. (8-52964) (Gnecco y Mora, 1997: 687). 4 Como se verá, el término cazadores recokctores resulta impreciso para referirse a individuos que no sólo cazaban y recolectaban sino que también alteraban la productividad natural de los recursos; por lo tanto, el uso que hago de ese término es puramente convencional (para una evaluación crítica del término véase Ingold, 1991, y Kelly, 1995). 5 Las semillas de las especies útiles se abandonan entre los desperdicios, ricos en nutrientes, de los campa-

mentas; en ese "campo abonado" crecen las plantas. Además, la instalación de los campamentos se hace cortando unos cuantos árboles (aunque sin crear un claro en el sentido esuicto del término), lo que en realidad resulta ser la eliminación selectiva de potenciales competidores de las plantas que habrán de crecer en pocas semanas.

224


ACRlLOCAUDADES

Y TERRITORIALIDAD

(1984) llamó coevolución:6 las estrategias de obtención de recursos que aplicaron los grupos de cazadores recolectores prehispánicos en las biomas tropicales fueron el resultado de un largo periodo de acciones coevolucionarias entre seres humanos, plantas y animales (véase Linares eL al., 1993; Pearsall, 1995a). Así, queda claro que las evidencias de intervención antró-

EN EL PLEISTOCENO

TARDío

nente precerámico de Peña Roja; en ese componente también se han encontrado fitolitos de una cucurbitacea, pero su estatus de cultígeno está aún por determinarse (Cavelier, comunicación personal), y d) fitolitos de la familia MaranLacea encontrados en uno de los cantos con bordes desbastados que se hallaron en San Isidro (véase la figura lB); es muy probable que se trate de fitolitos de la especie doméstica MaranLa arundinacea (sagú o araruta), resultan-

pica en los bosques tropicales de Colombia durante el Pleistoceno final y el Holoceno temprano no son prueba concluyente de domesticación ni de agricultura, pero sí de prácticas de intervención humana en los ecosistemas, que eventualmente conducirían tanto a una como a otra.

tes de la molienda de los rizomas de esa planta con el artefacto lítico mencionado (Piperno, comunicación personal). Aunque el estatus de domesticación de esta planta casi olvidada actualmente aún no es claro, Piperno (1991a y eL al. 1991b) creen que fue domesticada hace 8600 años en Panamá, donde se han encon-

Aunque la etnobotánica, sobre todo en el Amazonas, ha puesto de relieve que la diferencia entre plantas salvajes, semidomésticas y domésticas (así como entre bosques naturales y bosques intervenidos) es muy tenue (véase Harris, 1989), es posible determinar la existencia de cultígenos a partir de cambios genéticos qjados por procesos de selección cultural. En

trado fitolitos en un nivel fechado en esa época en la Cueva de los Vampiros (Cooke, 1992); la reconstrucción paleoambiental de ese sitio indica que es muy improbable que la planta haya crecido naturalmente en ese medio, lo que sugiere que los fitolitos encontrados en e! depósito arqueológico fueron producidos por una planta que 'se sacó de su hábitat natural y probablemente se cultivó cerca de! sitio.

este sentido, las únicas evidencias de probables cultígenos en los bosques tropicales de Colombia en la época de la frontera entre el Pleistoceno y el Holoceno son: a) seis semillas carbonizadas de Persea encontradas en San Isidro, la más grande de las cuales mide 6 centímetros de largp (véase la figura 1 C); aunque pueden ser

Aunque no es fácil investigar en qué forma manipularon e intervinieron los cazadores recolectores en el ritmo de vida natural de plantas y animales, lo cierto es que cada vez resulta más claro que nunca podremos entender el origen y la adopción de la agricultura sin conocer bien sus antecedentes. Aquí cobran inusitada vigencia dos afirmaciones de Lathrap (1977):

ejemplares silvestres, es más probable que se trate de ejemplares domésticos de la especie Persea americana (aguacate), dado que su tamaño es mayor que e! promedio de las semillas de poblaciones silvestres conocidas (Smith, 1966

por un lado pensó que las huerLas, conceptual y tecnológicamente distintas de las chacras, eran un elemento clave para entender e! proceso general de la agricultura y que debían tener antecedentes pleistocénicos; por otro lado (1987)

y 1969); b) dos semillas carbonizadas de San Isidro identificadas como EryLhrina edulis (chachafruto o poroto), una especie doméstica comestible de amplio consumo en varias partes de Colombia (véase la figura 1 D); c) fitolitos de Lagenaria siceraria encontrados en el compo-

sugirió que la aceptación del maíz por grupos distintos de aquellos que lo domesticaron en Mesoamérica no pudo ocurrir sin la existencia

6 "La coevoLución es un proceso evolutivo en el que el establecimiento de una relación simbiótica entre organismos, que aumenta la capacidad adaptativa de todos y cada uno, produce cambios en los rasgos de esos organismos" (Rindos, 1984: 99).

previa de un sistema de manejo (y probablemente de domesticación) de plantas nativas (véase Pearsall, 1995; Cooke y Ranere, 1992). Aunque

225

la evidencia

en tal sentido

en la


CRISTÓBAL

GNECCO

América tropical no es tan sólida como la que

Pero en el neo trópico los cazadores recolectores del final del Pleistoceno, como indica la

se ha encontrado en el sureste de Estados Unidos (V. g., Ford, 1985), los datos de la sabana de Bogotá parecen apoyar esta hipótesis: mientras la evidencia más temprana de maíz, que fue encontrada en Zipacón (Correal y Pinto, 1983), no es anterior a 3300 a.P., en Aguazuque aparecieron macrorrestos de zapallo, ibia y moti-

interpretación de San Isidro, ya estaban actuando y alterando el ecosistema con sus prácticas manipulatorias de los recursos para aumentar su productividad, tales como el desmonte, el cultivo selectivo y la domesticación. Rindas (1984) acuñó el concepto de agrilocalidad para referirse

lón con una fecha de 3900 años a.P. De manera similar, los resultados del análisis de isótopos radiactivos de esqueletos de Tequendama y

a los grupos responsables de la domesticación especializada, cuyos patrones espaciotemporales regulares permiten el surgimiento y desarro-

Aguazuque indican que hace 4000 años se consumían plantas probablemente cultivadas, mientras que el cambio de dieta hacia el consumo de

llo de la agroecología. Esos patrones están estrechamente relacionados con la territorialidad y, por lo tanto, con la movilidad restringida y con la focalización en el uso de recursos, factores responsables de la transformación defini-

maíz está fechado 500 años después (Correal, 1990; Vander Hammen el al., 1990). De ahí que sea muy probable que en la sabana ya existiese

tiva de la estructura de la mayoría de los ecosistemas. Como las evidencias arqueológicas y paleoecológicas recientes indican, las agrilocalidades también pudieron ser pleistocénicas y no solamente holocénicas, como generalmehte se ha sostenido. Esta constatación está muy lejos de la idea tradicional que veía a los cazadores recolectores tempranos como simples explotadores de los recursos, sobre todo animales, de manera tal que la modificación cultural de los ecosistemas sólo habría sido un fenómeno ho-

un sistema de manejo y cultivo de plantas nativas (con el previsible aumento en biomasa animal) en la época en que fue introducido el maíz. De igual manera, los datos sobre intervención y manipulación antrópica de los bosques tropicales en San Isidro y Peña Roja indican que la agricultura de cultígenos de alto rendimiento como yuca y maíz fue antecedida miles de años atrás por un agroecosistema basado en la explotación de plantas nativas y, quizá, de los animales atraídos y favorecidos por los campos de cultivo de especies útiles. Ante estas consideraciones, los cazadores recolectores del Pleistoceno final y del Holoceno

locénico, ligado al desarrollo de la agricultura. Por lo demás, el surgimiento de agrilocalidades visto desde la perspectiva de la territorialidad aparece alternativamente como su consecuen-

temprano aparecen ante nuestros ojos con las características que ahora se atribuyen a las sociedades de las selvas tropicales: no sólo como

cia y como su causa; como su consecuencia porque la disminución de la movilidad y el desarrollo de la territorialidad lo habrían forzado ante

usuarios, sino como manejadores e incluso mejoradores de recursos. Pero esta concepción arraiga con dificultad, porque en la dicotomía entre la caza recolección y la agricultura ha dominado una ontología esencialista que ha he-

la presión sobre la base de recursos, y como su causa porque es posible que ciertas exigencias sociales y políticas, como la competencia sectorial, hayan demandado estrategias de maximización de los recursos más allá de su produc-

cho que los cazadores recolectores hayan sido vistos tradicionalmente como explotadores de los recursos ecosistémicos y como dependientes directos de la oferta; con los agricultores, en cambio, habría empezado la transformación de los ecosistemas mediante la manipulación selectiva de especies animales y vegetales.

tividad natural,

resultando

en asentamientos

zonales que volvieron obsoletos y negativos los patrones de movilidad anteriores. El estereotipo del cazador móvil, direccional y extintor ha sido enfrentado con argumentos como la territorialidad y sus aspectos asociados (por ejemplo, la competencia y el surgimiento

226


AGRILOCALIDADES

Y TERRITORIALIDAD

de estrategias alternativas de ocupación) y con la afirmación de que la explotación de recursos focalizados -como en la costa sur de Perú (Keefer et al., 1998; Sandweiss et al., 1998)- y la intervención y manipulación de los recursos vegetales y animales (como en San Isidrp) pudieron ocurrir desde el momento mismo de la colonización y ocupación temprana, y no como resultado incidental de la crisis de formas previas de ocupación. La existencia de territoriali-

TARDÍO

ticos (sobre todo en cuanto al surgimiento de restricciones culturales), en territorialidad (con el desarrollo de estilos regionales) yen estrategias de reducción de riesgo (con el remplazo de mecanismos tradicionales como las alianzas intergrupales en favor de otros mecanismos, como la agricultura) milenios antes de que apareciera la agricultura en sentido estricto (véase Hayden, 1995). Todas estas consideraciones sugieren que el poblamiento temprano de! norte de Sudamérica puede ser concebido como un proceso lento de colonización y ocupación más que como una migración rápida. Esta posibilidad daría cuenta de tres de las manifestaciones arqueológicas más cuestionables para la concepción no-

dad desde finales de! Pleistoceno ha sido una posibilidad ignorada por la concepción "nomádica" de los cazadores recolectores, vigente en la arqueología mundial desde hace 30 años; una de las características básicas de ese nomadismo sería la ausencia de territorialidad, puesto que ya que se sostiene que la mejor forma de enfrentar la variabilidad en la distribución de los recursos es por medio del movimiento

mádica, direccional y démica: a) la diversidad estilística de los conjuntos del Pleistoceno tardío en el norte de Sudamérica y Panamá; b) la existencia de territorialidad y agrilocalidades, y e) las ocupaciones pre-Clovis, como Monte Verde en el sur de Chile, y Taima-Taima en el noroccidente de Venezuela.

de una región a otra, la defensa territorial atentaría contra las posibilidades de sobrevivencia (Kelly, 1995). La concepción "nomádica" es reduccionista y determinista,

EN EL PLEISTOCENO

en tanto que la for-

ma en que usarían el espacio por los cazadores recolectores dependería exclusivamente de la distribución de los recursos. El reduccionismo ecológico ha sido la posición dominante en la arqueología de cazadores recolectores del neotrópico, debido a la persuasiva influencia de la ecoJogía cultural y del materialismo cultural.

BIBLIOGRAFÍA

Bray, Warwick (1991), "¿Adónde han ido los bosques? El hombre y e! medio ambiente en la Colombia prehispánica", Boletín del Museo del Oro, núm. 30, pp. 43-65. Brayan, A.L. (1991), 'The Fluted Point Tradition

La ecología, en una perspectiva reduccionista, se entiende no como la red total de relaciones en un cronoecosistema, sino como las limitaciones impuestas sobre la cultura por variables medioambientales. La pasividad acordada a una cultura ontologizada (sensu Fabián, 1983) por el reduccionismo ecológico está dando paso a una consideración más dinámica, en virtud de la cual la cultura ya no es más el sujeto sumiso de la naturaleza, y los seres humanos ya no son más los sujetos sumisos de la cultura. Las nuevas ideas sobre el desarrollo de la agricultura y e!

in the American: One of Severa! Adaptation to Late Pleistocene American Environments", en Bonnichsen, R., Trnmire, KL. (eds.), Clovis: Origin and Adaptation. Center for the Study of the First American, Oregon State University, Corvallis, pp 15-33. Cavelier, 1., C..Rodríguez, S. Mora, L. Fernanda y G. Morcote (1995), "No sólo de caza vive e! hombre: ocupación del bosque amazónico, Holoceno temprano", en 1.Cavelier y S. Mora (eds.), Ámbito y ocupaciones tempranas de la Amé-

abandono paulatino de la caza y de la recolección destacan los significativos cambios que se presentaron al final del Pleistoceno en movilidad, en el acceso a los recursos bióticos y abió-

rica tropical, Bogotá, Instituto Colombiano de Antropología/Fundación Erigaie, pp. 27-44.

227


CRISTÓBAL

GNECCO

Cooke, R. (1992), "Etapas tempranas de la producción de alimentos vegetales en la baja

Harris,

Centroamérica y partes de Colombia (región histórica Chibcha-Chocó) ", Revista de Arqueología Americana, núm. 6, pp. 35-70. ---y D.R. Piperno (1993), "Native American Adaptations to the Tropical Forests ofCentral and South America before the European Colonization", en C.M. Hladik et al., Tropical

"An Evolutionary

Con-

Research, pp. 273-299. Ingold, T. (1991), "Notes on the Foraging Mode of Production ", en Tim Ingold, David

Y AJ. Ranere

(1992), 'The Origin of Wealth and Hierarchy in the Central Region ofPanamá (12000-2000 a.C.), with Observa-

Riches y James Woodburn (eds.), Hunters and Gatherers: History, Evolution and Social Change, vol. 1, Oxford, Berg, pp. 269-285. Keefer, D.K., S.D. de France, M.E. Moseley,].B. Richardson, D.R. Satterlee y A. Day-Lewis

tions on its Relevance to the History and Phylogeny of Chibchan-speaking Polities in Panama and Elsewhere", en Fred W. Lange (ed.), Wealth and Hierarchy in the Intermediate Area, Washington, Dumbarton Oaks, pp. 243-316. Correal, G. (1990), Aguazuque: evidencias de

(1998), "Early Maritime Economy and El Niño Events at Quebrada Tacahuay", Science, núm. 281, pp. 1833-1835. Keeley, Lawrence H. (1995), "Protoagricuitural Practices among Hunter-Gatherers: A CrossCultural Survey", en T. Douglas Price y Anne

cazadores, recolectoresy plantadores en la altiplanicie de la cordillera oriental, Bogotá, FlAN.

---

(1989),

Gebauer (eds.), Last Hunters, First Farmers: New Perspectives on the Prehistoric Transition to Agriculture, Santa Fe, School of American

Forests, People and Food, París, Unesco/Partenón, pp. 25-36. )

--

D.H.

tinuum of People-Plan t In teraction ", en D.H. Harris y G. Hillman, Foragíng and Farming: The Evolution of Plant Explotation, Londres, Unwin Hyman, pp. 11-24. Haydtn, B. (1995), "An Overview of Domestication", en T. Douglas Price y Anne B.

Y M. Pinto (1983), Investigaciones arqueológicas en el municipio de Zipacón, Cundinamarca, Bogotá, FlAN.

B. Gebauer (eds.), Last Hunters, FirstFarmers: New Perspectives on the Prehistoric Transition to Agriculture, Santa Fe, School of American

Johannes, F. (1983), Time and the Other, Nueva York, Columbia University Press. Fabián,]. (1983), "Time and the Other", Nueva

Research, pp. 243-272. Kelly, R.L. (1995), The Foraging Spectrum: Diversity

York, Columbia University Press. Ford, R.l. (1985), "Patterns ofPrehistoric Food Production in North America", en Richard 1.

in Hunter-Gatherer Lifeways, Washington, Smithsonian. Lathrap, D.W. (1968), 'The 'hunting' economies of the tropical forest zone of South America: An Attempt at Historical Perspective", en Lee, R.B., Devore,]. (eds.), Man the Hunter, Nueva York, Aldine, pp. 23-29.

Ford (ed.), PrehistoricFood Production in North America, Ann Arbor, Museum of Anthropology, University of Michigan, pp. 341-364 (Anthropological Papers, 75). Gnecco, C. (1995), "Paleoambientes, modelos individualistas y modelos colectivos en el

---

norte de los Andes", Gaceta Arqueológica Andina, núm. 24, pp. 5-1l. ---

(2000), Ocupación temprana de selvas tropicales de montaña, Popayán, Universidad del Cauca. --y S. Mora (1997), "Late Pleistocene/ Early Holocene Tropical Forest Occupations at San Isidro and Peña Roja, Colombia", Antiquity, núm. 71, pp. 683-690.

(1977), "Our Father the Cayrnan, Our Mother the Gourd: Spinden Revisited, or a Unitary Model for the Emergence of Agricuiture in the New World", en Charles A. Reed, Origins of Agriculture, Mouton, pp. 713-75l.

---

(1987), 'The Introduction

La Haya, of Maize in

Prehistoric Eastern North America: The View from Amazonia and the Santa Elena Península", en W.F. Keegan, Emergent Hor-

228


ACRILOCALIDADES y TERRITORIALIDAD EN EL PLEISTOCENO TARDÍO

ticultural Economies of the Eastern Woodlands, Carbondale, Southern IlIinois University, Center for Archaeological Investigations,

toric Transition to Agriculture, Santa Fe, School of American Research, pp. 157-192. Piperno, D.R. (1989), "Non-Affluent Foragers:

pp. 345-371 (Occasional Paper, 7). Leach, H.M. (1997), 'The Terminology of Agri-

Resource Availability, Seasonal Shortages, and the Emergence of Agriculture in Panamanian Tropical Forests", en David R. Harris y G.c. Hillman, Foraging andFarming:

cultural Origins and Food Production Systems. A Horticultural Perspective", Antiquity, núm. 271, pp. 135-148. Linares, O.F. (1976), "Garden Hunting in the American Tropics", Human Ecology, núm. 4, ---,

The Evolution of Plant Explotation, Londres, Unwin Hyman, pp. 538-554. --(1990a), "Aboriginal Agriculture and

pp. 331-349. H. PagezyyP. Grenand (1993), "Feeding Strategies in Relation to Environmental

Land Usage in the Amazon Basin",Journal of Archaeological Science, núm. 17, pp. 665-677. --(1990b), "Paleoenvironments and Hu-

Variation-Background", en C.M. Hladik et al., Tropical Forests, People and Food, París, UnescoPartenón, pp. 405-410. Lynch, Th. F. (1978), 'The South American

man Occupation in Late-Glacial Pan ama", Quaternary R.esearch, núm. 33, pp. 108-116. --(1995), "Plant Microfossils and their Application in the New World Tropics", en Peter W. Stahl (ed.), Archaeology in the Lowland American Tropics, Cambridge, Cam-

Paleoindians", en Jinnings, J. (ed.), Ancient Native American, San Francisco, W.H Freeman and Co. pp. 455-489. Meltzer, DJ. y D.S. Bruce (1986), "Paleoindian and Early Archaic Subsistence Strategies in Eastern North America", en Sarah W. Neu-

---

sius (ed.), Foraging, Collecting, and Harvesting: Archaic Period Subsisten ce and SeUlement in the

bridge University Press, pp. 130-153. Michael B. Bush y Paul A. Colinvaux (1991a), "Paleoecological Perspectives on Human Adaptation in Central Panamá. 1.

The Pleistocene", Geoarchaeology, núm. 6, pp. 201-226. --(1991 b), "Paleoecological Perspectives

Eastern Woodlands, Carbondale, Southern IlIinois University, Center for Archaeological Investigations, pp. 2-31 (Occasional Paper, 6). --y B.D. Smith (1986), "Paleoindian and Early Archai Subsistence Strategies in Eastern North América", en Neusius, S.W., Foraging

on Human Adaptation in Central Panamá. 1. The Holocene", Geoarchaeology, núm. 6, pp. 227-250. Politis, G. (1996), "Moving to Produce: Nukak Mobility and Settlement Patterns in Amazo-

(eds.), Collecting, and Harvesting: Archaic Period Subsistence and SeUlement in the Eastern Woodlands, Center for Archaeological Inves-

nia", WorldArchaeology, núm. 27, pp. 492-511. Posey, D.A. (1983), "Indigenous Ecological Knowledge and Development of the Amazon", en Emilio Morán (ed.), TheDilemma of Amazonian Development, Boulder, Westview

tigations, Occasional Paper No. 6, Carbondale, Southern Illinois University, pp. 2-31. Pearsall, D.M. (1995a), '''Doing' Paleoethnobotany in the Tropical Lowlands: Adaptation

---

and Innovation in Methodology", en Peter W. Stahl (ed.), Archaeology in the Low-land American Tropics, Cambridge, Cambridge University Press, pp. 113-129. ---, (1995b), "Domestication and Agriculture in the New World Tropics", en T.

Press, pp. 225-257. (1984), "A Preliminary Report on Diversified Management of Tropical Forests by the Kayapó Indians of the Brazilian Amazon", Advances in Economic Botany, núm. 1,

---

Douglas Price y Anne B. Gebauer, Last Hunters, First Farmers: New Perspectives on the Prehis-

pp. 112-126. (1993), ''The Importance of Semi-Domesticated Species in Post-Contact Amazonia: Effects of the Kayapó Indians on The Dispersal of Flora and Fauna", en C.M.

229


CRISTÓBAL

GNECCO

Smith, e.E. (1966), "Archaeological Evidence for Selection in Avocado", Economic Botany,

Hladik et al. (eds.), Tropical Forests, People and Food, París, Unesco-Partenón, pp. 63-71. Rindos, D. (1984), The Origins of Agriculture: An Evolutionary Perspective, San Diego, Academic

núm. 20, pp. 169-175. (1969), "Additional Notes on Pre-conquest Avocados in México", Economic Botany, núm. 23, pp. 135-140. Vander, H., T.G. Correal y GJ. van Klinken (1990), "Isótopos estables y dieta del hom-

---

Press. Roosevelt, A. C., et al. (1989) "H Hunting and gathering in tropical rain forest: is it possible?", American Anthropologist, 91, 59-82. Sandweiss, D.H., H. McInnis, R.L. Burger, A.

bre prehistórico en la sabana de Bogotá", Boletín de Arqueología, vol. 5, núm. 2, pp. 3-10.

Cano, B. Ojeda, R. Paredes, M.C. Sandweiss y M.D. Glascock (1998), "Quebrada Jaguay: Early South American Maritime Adaptations", Science, núm. 281, pp. 1830-1832.

230


CLIMATE, ENVIRONMENT, AND GAME ANIMAL RESOURCES OF THE LATE PLEISTOCENE MEXICAN GRASSLAND Joaquín Arroyo-Cabrales**

seguidos por los correspondientes grandes carnívoros (león pleistocénico, tigre dientes de sable, oso de rostro corto y lince). Diferentes géneros de venados y perezosos terrestres habitaron las pendientes de los cerros, junto con osos negros y mastodontes americanos. Varios animales ya no se hallan en la región ni coocurren con ciertas especies, lo cual indica que existieron condiciones climáticas y ambientales diferentes durante el Pleistoceno tardío de las

RESUMEN Durante el Wisconsinano tardío (de 25000 a 11 000 años a.c.) los pastizales norteamericanos se extendían desde el centro de Canadá hasta la cuenca de México. Los pastizales mexicanos formaron un corredor desde el norte de México hasta la cuenca, limitado a los lados por las montañas de la Sierra Madre. A lo largo de esta vasta extensión de tierra, el clima generalmente era más templado, con mayores precipitaciones que ocurrían en temporadas que diferían de las del presente; fue templado y húmedo hasta hace aproximadamente 18000

que imperan en el presente. Este ecosistema dominante de pastizal dentro de la región y sus recursos proporcionaron el panorama que encontraron los primeros pobladores y en el que se desarrollaron a fines del Pleistoceno.

años" y desde entonces fue frío y seco en la cuenca de México y templado y seco en el norte de México hasta el fin del Wisconsinano. Hubo fluctuaciones en estos amplios intervalos, lo

ABSTRACT

que afectó el balance de pastizales y bosques regionales debido a la precipitación, el fuego y la actividad volcánica. Hubo cuerpos de agua en toda la región, en particular lagos, ciénegas

During the late Wisconsinan (ca. 25000 to 11000 yr B.P.), the North American grasslands stretched from central Canada to the Basin of Mexico. The Mexican grassland formed a corridor from northern Mexico to the Basin and

y playas. Las manadas de herbívoros rancholabrean os típicos (mamut, bisonte, caballo y camello) se extendieron por los pastizales,

* MlIseum

Eileen Johnson, * and Óscar J. Polaco**

bounded on the sides by the Sierra Madre mountain ranges. Generally across this vast stretch of land, the climatic regime is cooler with greater precipitation and precipitation coming at different season than today. The climate was cool and moist up to ca. 18000 and then cool and dry in the Basin of Mexico

ofTexas Tech University, Lubbock, Texas,

EUA.

** Laboratorio de Arqlleozoología "M. en C. Ticlll Álvarez Solórzano", Subdirección de Laboratorios y Apoyo Académico, lNAH.

231


EILEEN JOHNSON, JOAQUÍN ARROYO-CABRALES AND ÓSCAR]. POLACO

and cool and moist in northern Mexico until the end of the Wisconsinan. Fluctuations hap-

~

pened within these broad periods and regional grassland to woodland balances were affected by precipitation, fire, and volcanic activity. Bodies

Northern grasslands

~

of water occurred throughout, in particular lakes, marshes, and playas. Typical Rancholabrean herd herbivores (mammoth, bison, horses, camel) ranged throughout the grassland along with attendant large carnivores (Pleistocene lion, saber-tooted cat, short-faced bear,

Mexican Grasslands

and lynx). Different genera of deer and ground sloth inhabited the hill slopes along with black bear and mastodon. Various animals no longer range in the region or co-occur with certain species, indicating that different c1imatic and environmental conditions existed during the late Pleistocene from those nant grassland ecosystem region, and its resources eariy peoples encountered

of today. This domiwithin a composite provide the setting and used at the end

of the PleislOcene.

Basin of Mexico

o

Late

Pleistocene,

North American Grasslands

Figure 1. The North American grasslands.

cies. Nevertheless, the grasslands composition varies across the extensive territory, generally from south to north but also from east lO west as it does today (Coupland, 1992a). In general, summer rains and periodic summer droughts characterize and promote grasslands today (Gould and Shaw, 1983). Regional grassland to woodland balances are affected by both c1imate

KEYWORDS Basin of Mexico,

"'¡¡'~

Fauna,

and disturban ce factors, with the most important variables being precipitation and fire (Wright and Bailey, 1982; Sims, 1988; Fredlund and

Landscape.

Tieszen, 1997). Bodies of water occur throughout, in the form of rivers, lakes, ponds, marshes, playas, and salinas. In general, typical Ran-

INTRODUCTION During the late Wisconsinan (ca. 25000 to 11000 yr BP), the North American grasslands

cholabrean herd herbivores (e.g., mammoth, bison, horses, camel) range throughout the grasslands extent along with attendant large carnivores (e.g., Pleistocene lion, short-faced bear, dire wolf) (Graham and Lundelius, 1987; Johnson, 1987, 1989, 2000; Arroyo-Cabrales el

stretch from central Canada lO the Basin of Mexico (figure 1). Climatic regimes across this vast stretch of land gene rally are cooler with greater precipitation and/or precipitation coming at a different season than today. Fluctuations exist, particulariy in effective mois-

al., 1998).

ture leading to periods of dryer conditions. Proxy data indicate that grasslands existed based on the presence of grassland-dependant species. Little directevidence is available on the nature of the grasslands as pollen core data and interpretation focus on fluctuations in tree spe-

CLIMATE AND ENVlRONMENT The Mexican grassland formed a corridor from northern Mexico southward to the Basin of

232


CLIMATE,

ENVlRONMENT,

AND GAME ANIMAL

RESOURCES OF THE LATE PLEISTOCENE

Mexico and bounded on the sides by the east by the Sierra Madre Oriental and the west by the Sierra Madre Occidental ranges (figure 2). This general regio n today also is termed the desert grassland (Coupland, 1992b; Schmutz el al., 1992). In general, the climatic regime is cool

but overall present a mixed pine (Pinus sp.) and oak (Quercus sp.) forest and grassland setting that expands and contracts while lake levels in the basin and water chemistry fluctuate (González-Quintero, 1986; Bradbury, 1989, 1997; Lozano-Garda el al. 1993; Lozano-Garda and

and moist up to ca. 18000 yr BP (late glacial maximum) and then cool and dry in the Basin of Mexico and cool and moist in northern Mexico until the end of the Wisconsinan (Metcalfe el al., 2000). A series of lacustrine basins occur in the volcanic highlands of central Mexico and were influenced greatly by volcanic activity

Ortega-Guerrero, 1997; Metcalfe el al., 2000). Primary study areas within the Basin of Mexico have been within two of the three lake systems, that of Lake Texcoco (central part of the Basin) and Lake Chalco (southern portion of the Basin). The Lake Chalco sub-basin is about 30 km southeast of Lake Texcoco and

throughout the late Quaternary. The Basin of Mexico is the largest of these basins and extensive paleoclimatic and paleoenvironmental

around 3 m higher (Bradbury, 1997; Caballero and Ortega Guerrero, 1998). Between ca. 39000 to 22500 years BP, Lake Chalco was a

research has focused on that basin (figure 3). Various cores and proxy data from the Basin of Mexico provide sorne conflicting information

shallow (less than 2 m), alkaline, saline body. A major eruption of the Popocatépetl volcano occurs ca. 22000 years BP (Siebe el al., 1996)

Estados Unidos de América

°L O

250 km

D Desert Grasslands .•.•.

Océano Pacífico

o

300

600

Figure 2. The Sierra Madre Oriental and Sierra Madre Occidental ranges bounds the Mexican grassland corridor, while the t.ransverse volcanic system surrounds the Basin ofMexico; modified from Tamayo (2001).

233


ErLEEN JOHNSON, JOAQUÍN

ARRoyo-CABRALES

AND ÓSCAR].

POLACO

. bury, 1989, 1997; Lozano-García el al., 1993; Caballero and Ortega Guerrero, 1998, Metcalfe el al., 2000). Prior to eruption of Popocatépetl, an extensive mixed forest dominated by pine occurs

Map detail

1----\ r )

on the slopes around Lake Texcoco between 26000 to 24500 years BP. Shallow, saline waters with fluctuating salinity characterizes the lake within a cold, dry c1imate. At 24500 years BP, the lake waters are shallow, lightly saline, and alkaline. Between 24000 to 23000 years BP mildly saline, alkaline, open waters occur. The pollen profile from 24000 to 21000 years BP, bracketing the major eruption, indicate decreasing woodlands and increasing aquatics, within a cold and moist/ humid c1imate. Quillwon (Isoetes sp.), an aquatic plant characteristic of cool, dilute, high-elevation lakes indicating c1ear,

Mean Lake Level

/_U04"'. Minimum ( ....•. /

Lake Level

Figure 3. The Basin of Mexico with boundaries paleolake system.

of the

acid, unproductive waters (Watts and Bradbury 1982; Bradbury 1997), is abundant. A transition to a dry, temperate c1imate occurs betwéen 21000 to 19000 years BP, with an increase in the mixed woodlands and a shallow, saline lake in the sub-basin. Between 19000 to 14500 years BP, the c1imate is cool and moist, with increased effective moisture and increased winter precipitation. The pollen profile indicates a dominance of pine with fluctuating leveJs of oak and

and Lake Chalco changes to a freshwater lake and deepens to 4-5 m (Caballero Miranda, 1997; Caballero and Ortega Guerrero, 1998). The lake returns to a shallow (less than 2 m), fluctuating alkaline to freshwater marsh between 18500 and 14000 years BP during another period of intense volcanic activity. The surrounding grassland is widespread and by 18000 years BP, a cold and dry c1imate developed. After 16500

alder (Alnus sp.) as the composition of the mixed forested slopes varies. By 16000, the lake is very shallow and between 14500 to 11 600 years B.P., the lake plain is dry. The c1imate by 14500 years B.P. is cool and dry (Brown 1985;

years B.P., temperature warms and moisture increases and the alkaline marsh is in transition to a freshwater pondo Between 14000 and 10000 years BP, lake levels generally were shallow (less than 3m) and waters fluctuated between fresh to slightly alkaline. From 14000 to 12500 years BP, Lake Chalco is a neutral pond, within more humid conditions than previously and rainfall

Bradbury 1989,1997; Metcalfe el al., 2000). Lake Chiconahuapan in the Upper Lerma Basin and Lake Pátzcuaro are further east in higher basins. After volcanic activity at ca. 11 600 yr BP, Lake Chiconahuapan is a shallow alkaline marsh with abundant aquatic vegetation until another volcanic event around 8200 years BP

more evenly distributed throughout the year. The woodlands on the slopes expand while the surrounding grassland is reduced. From 12500 to 10000 yr BP, Lake Chalco is again a freshwater lake, after which it changes to a shallow (less

(Metcalfe el al., 1991). A lengthier Wisconsinan record at Lake Pátzcuaro indicates fluctuating water levels and expanding and contracting pine-oak forests on the surrounding slopes with

than 1 m), alkaline, saline marsh. The grassland continues to be reduced and the woodlands expand. Humid, cold conditions continue (Brad-

a steadier presence of grasses. Juniper (Juniperus sp.), sagebrush (Arlemisia sp.), and ragweed

234


CLlMATE, ENVlRONMENT, AND GAME ANIMAL RESOURCES OF THE LATE PLEISTOCENE

(Ambrosia Sp.) constitute a distinct assemblage between 17800 to 11 000 years BP (Watts and Bradbury, 1989; Bradbury, 1997; Metcalfe el al., 2000). From about 26000 to 10 000 years BP, an open, deep lake exists. From 25000 to 13000 years BP, quillwort dominates the pollen profi-

tains with a mixed woodlands on alluvial fans. The cIimate before 12500 years BP is cooler and more moist than today (Meyer, 1973; Metcalfe el al., 2000). In the Alta Babícora basin, mountain slopes had a temperate coniferous forest after 18000 years BP. Lakes in the basin prior to

le. In general for these upper basins, the late Wisconsinan cIimate is characterized as cool with increased winter precipitation and decreased summer precipitation (Watts and Bradbury,

11 000 years BP were deep while those between 11 000 and 9500 years BP were shallower (Metcalfe el al., 1997,2000).

1982; Bradbury, 1997). In northern Mexico, few pollen cores or proxy data are available for the late Wisconsinan. Pertinent ones to the Mexican grassland are located in what today is the Chihuahuan Desert. Those data indicate in general a cool

GAME ANIMAL RESOURCES Just as the cIimate and environmental reconstructions are a synthesis of available data, the view of late Pleistocene faunal communities is

and moist cIimate with significant increase in winter precipitation, extensive lakes, and widespread pinyon-juniper woodland (Bradbury, 1997; Metcalfe el al., 1997, 2000). Fossil insect

based on a synthesis of published data. This synthesis comes from a larger study of Quaternary vertebrates for all of Mexico (Arroyo-Cabrales, 2002), similar to the faunmap compilation for the U.S.A. (Graham, 1994). The Mexican Qua-

data denote a temperate grassland from 20000 to 12000 years BP, with desert species replacing grassland ones after 12000 years BP (Elias and

ternary database records 286 species from 44 families and 13 orders. Around one third of

desert vegetation between 12 600 and 9000 years BP and the presence of a grassland that incIuded buffalo grass (Buchloe daclyloides), fluff gra~s (Erionneuron pulchellum), panic grass (Panicum sp.), and bristlegrass or bunchgrass (Selaria leucopila). Buffalo grass is characteristic of the mixed praire to short-grass steppe (Coup-

the species are extinct, mainly large mammals. Research is now beginning to verify taxonomic designations and incorporate unpublished museum specimens. It has been more than 100 years since the first report about the presence offossil bones in the basin ofMexico was documented (Cuatáparo and Ramírez, 1875; Espinosa, 1902), with a variety of extinct (e.g., horse [Equus spp.], camel [Camelops sp.]' mammoth [Mammulhus

land, 1992c; Lauenroth and MiIchunas, 1992) while fluff grass is a modern component of the desert grassland (Gould and Shaw, 1983).

spp.]' ground sloth [Paramylodon sp.]), and extant (e.g., ducks [Analidae], skunk [Mephilis sp.]' badger [Taxidea laxus]) species. Those stu-

The cIimate is marked by strong summer cooling, reduced summer monsoons, fewer winter frosts, and a substantial in crease in winter rainfall. The enhance winter precipitation

dies have increased since the beginning of the 1960s when a major emphasis on searching for the presence of early peoples in the basin was initiated in a number of localities with similar faunas (Lorenzo and Mirambell, 1986a, 1986b).

Van Devender, 1990). Packrat middens at Bolsón de Mapimí indicate woodland vegetation prior to 12600 years BP that is replaced by

patterns continues until about 9000 years BP. The playas in the Bolsón were marshes to sha1I0w lakes (Van Devender and Burgess, 1985; Van Devender, 1986, 1990; Metcalfe el al., 2000).

Other sites outside the basin, such as El Cedral, Cueva La Presita, and Mina San Antonio (state of San Luis Potosí) and materials from the Chapala-ZacoaIco basin (Downs, 1958; Lorenzo and Mirambell, 1986c; Solórzano, 1989; Torres

In the Cuatro Ciénegas basin, extensive late Wisconsinan pine forests occur in the moun-

235


EILEEN JOHNSON, JOAQUÍN ARROYO-CABRALES AND ÓSCAR].

POLACO

Martínez, 1995; Polaco and Butrón-M., 1997), while pertaining to the larger region also sup-

resembled the modern dromedary (one-hump camel) but with longer limbs (Anderson, 1984).

plement the overall picture of the landscape in the basin at the late Pleistocene. Several studies have focused on Holocene faunas (post 11000 years BP) composed of taxa that historically, if not still, occurred in the region (e.g., Niederberger, 1976; Navarro Sigüenza and Benítez Díaz, 1999). Other reports have mentioned the occurrence of several animal s at the end of the Pleistocene, but without

Smaller than the western camel, the long-legged llama was a browser favoring open shrub country and grasslands (Webb, 1974; Johnson, 1987). Ancient bison, primarily a grassland animal, also was widespread with a great lineal extent from Alaska to the Basin of Mexico (Skinner and Kaisen, 1947; Hall, 1981; McDonald, 1981). Pleistocene horse taxonomy is complex and fluid (e.g., Winans, 1985; Álvarez and Ocaña, 1987; MacFadden, 1992; Reynoso-Rosales and Montellano-Ballesteros, 1994). The range of variation within a species is unknown as is how these species divided up the grassland niches. On the Southern Plains, a small horse invariably is associated with a large horse, both non-

documentary support (Manrique and Villanueva, 1997). Lastly, several studies are of specific localities (Tequixquiac, Tlapacoya, and Tocuila) within the Estado de México (Hibbard, 1955; Álvarez, 1986; Morett el al., 2003). Characteristic of the plains in general, a Rancholabrean fauna inhabited the Mexican grassland. Large herd herbivores grazed and browsed the rangeland. Dominating the landscape were mammoth (Mammulhus columbi), camel (Camelops heslernus), llama (Hemiauchenia macrocephala), bison (Bison spp.), horses (Equus

zebrine species (Johnson, 1987; Winans, 1985). The same appears the case for the Mexican grassland where the same two species gr6ups (Equus mexicanus [large, stout-legged horse] and E. francisci [= conversidens] [small, stilt-legged horse]) occur (Alberdi el al., in press).

spp.), pronghorn antelopes (Capromeryx spp., Telrameryx spp., and Slockoceros spp.), deer (Odocoileus halli), (Álvarez, 1986), and ground sloth (Paramylodon harlani) (Arroyo-Cabrales el al., 1998). The Columbian ranged throughout

or Plains mammoth mostly the western U.S.A. and the

central plains into Mexico (Agenbroad, 1984; Anderson, 1984). A dominant member of the late Pleistocene fauna, it was a key species indicator of grassland habitat. A diet of grasses and sedges was supplemented by shrubs, parts of trees, and flowering herbs (Lister and Van, 1994). Larger and with a different conformation than the woolly mammoth nius) , the Columbian mammoth

(M. primigestood up to

4m at the shoulder and weighing up to 10 tons, with a long and broad cranium and greatly incurved tusks (Anderson, 1984; Lister and Van, 1994). Widespread throughout the southwest and plains, the western camel (figure 4) was a grazer capable of sorne browsing (Webb, 1965). It

Figure 4. The western carne] modified from Stock (1956).

236

(Camelops hesternus);


CUMATE, ENVIRONMENT, AND GAME ANIMAL RESOURCES OF THE LATE PLEISTOCENE

The pronghorn (Antilocapra americana) primarily is a browser favoring sagebrush and grasslands. Geographically widespread throughout the West and Plains into Mexico during the late Pleistocene, nevertheless, it remains rare in that record (Anderson, 1984; Johnson, 1987). Overall populations may have been low in response to competition from the extinct pronghorns browsing and grazing the Mexican grassland. Capromeryx is a small, four-horned pronghorn that stood about 56 cm high at the shoulder. Tetrameryx is a large, four-horned pronghorn about the size of the extant pronghorn antelope. Stockoceros (figure 5) is intermediate in size between Capromeryx and Tetrameryx and modern pronghorn (Anderson, 1984). Figure 5. The extinct four-pronged Stockoceros.

How specifically these extinct pronghorns divided up the grassland niches is not known. The large extinct deer (Odocoileus halli), known only from the late Pleistocene in the region, inhabited the central portion of the Basin of Mexico presumably a browser, it was more abundant than the extant white-tailed deer (O. virginianus) is today (Álvarez, 1986). Found throughout the U.S. into Mexico, Harlan's ground sloth (Paramylodon harlani) was a large (ca. 1.3 m high at the hip), powerfully built, lumbering animal with large claws on its forefeet (figure 6). Its body-build, some skeletal adaptations including the claws, and long coarse hair and dermal ossicles, were apparently a defense mechanism against the late Pleistocene carnivore guild. A grassland species inhabiting

antelope

Figure 6. Skeletal reconstruction of Harlan 's ground sloth (Pararnylodon hartani); modified from Stock (1956).

open parkland, it was a mixed browser feeding on shrubs and coarse grass (Kurtén and Anderson, 1980; Anderson, 1984). Among the large predators were the American Pleistocene \ion (Panthera atrox), sabertooth cat (Smilodon Jatalis), dire wolf (Canis dirus), and short-faced bear (Arctodus spp.). AlI were widespread throughout the North American grasslands. This amazing carnivore guild focused on the large herd animals and members were both active hunters and aggressive scavengers. The American lion (figure 7) was considerably

larger

than

the

modern

Figure 7. The American

237

¡ion (Panthera atrox).


EILEEN JOHNSON,

JOAQUÍN

ARROyo-CABRALES

AND ÓSCAR J. POLACO

African lion, weighing about 1.5 times as much but with a similar head and body length. It pro-

pical in distribution (figure 10). In North America, it was restricted to the southern U.S.A. into

bably also hunted in prides. The sabertooth cat (figure 8) was about the size of the African lion but had different body proportions, with lighter built hindquarters and heavier-built forequarters. Prey most likely was large, slow-moving species that were over-powered (Anderson, 1984).

Mexico (Dudley, 1996; Lambert, 1996). Favoring mesic coastal lowland and savanna and scrub habitats (Dudley, 1996), the gomphothere was a browser (Kurtén and Anderson, 1980).

Dire wolves were considered both hunters and scavengers. Larger than the gray wolf and heavier-built, the dire wolf had sturdy limbs with relatively short lower limb elements and a large broad head (Anderson, 1984). Kurtén (1967) called the short-face bear (figure 9) the most predaceous camivore of the Pleistocene, built for speed and killing. More than twice the size and bulk of a grizzly, this bear would have been the dominant carnivore. More recent research has underscored the highly camivorous diet of this bear but reconsideration of its derived morphology indicates it was a wide-ranging scavenger of widely dispersed large mammal carcasses. This bear was designed for efficient locomotion and intimidating other large camivores (Matheus, 1995). In either case, this bear would have been a for-

Figure 8. The sabertooth cat (Smilodonfatalis); modified from Turner and Antón (1997).

midable force on the landscape. Much less is known about small and medium animals but, nevertheless, extant species were present in the grassland. Both gray (Urocyon GÍnereoargenteus) and red (Vulpes velox) foxes, a variety of pocket gophers (Cratogeomys spp.) and

Figure 9. The late Pleistocene short-faced bear

(Arctodus simus).

voles (Pitymys sp., Microtus sp.), cottontail (Sylvilagus spp.), and rabbit (Lepus sp.)occurred. On the hill sides, either on the Sierra Madre inland flanks or on the Mexican Transvolcanic Axis, other animal assemblages typical of wooded to forested areas included gomphothere (Cuvieronius hyodon), megathere ground sloth (Eremotherium laurillardt), deer (Odocoileus virginianus), glyptodont (Glyptotherium mexicanum), black bear (Ursus americanus), moun tain lion (Puma concolor), andjaguar (Panthera onca). The gomphothere Cuvieronius (an extinct proboscidean) was endemic to the Americas and neotro-

Figure 10. The extinct proboscidean Cuvieronius; modified from Shoshani and Tassy (1996).

238


CLlMATE,

ENVIRONMENT,

AND GAME ANIMAL

While the megathere ground sloth is know [rom coastal lowlands in the U.SA. and South America (Kurtén and Anderson, 1980; Ander-

RESOURCES

OF THE LATE PLEISTOCENE

1980; Nilsson, 1983). They were browsers along quiet waterways with lush vegetation and frequentiy associated with capybaras (Gillette, 1973; Kurtén and Anderson, 1980; Anderson, 1984). Ranging from the U.S.A. Plains and southwest into Mexico, the shrub oxen (Euceratherium

son, 1984), in Mexico, most of the records are from higher elevations in the central part of the country. This ability to exploit habitats at higher elevations may reflect the more southern latitudes of the localities (McDonald, 2002). Estima-

sp.) were probable inhabitants of the foothills (figure 11). A specialized grazer and heavily built, shrub oxen were slightiy larger than the modern musk ox and had massive horn cores (Kurtén and Anderson, 1980; Anderson, 1984).

ted at over 5 m in height, this giant ground sloth is a browser (Martin and Guilday, 1967). A tropical to subtropical animal, glyptodonts (an extinct edentate) were large, slow-moving, armored marnmals. The carapace was vaulted

In the Basin of Mexico, various species are associated with the presence of permanent water. Capybara (Neochoerus sp.), otter (Lontra longicaudis), and tapir (Tapirus haysii) indicate freshwater bodies, particularly riverine habitats.

and unjointed, composed ofhundreds ofscutes, reaching a height of ca. 1.2 meters and length of 1.5 meters or greater (Kurtén and Anderson,

Several aquatic birds, such as cormorants (Phalacrocorax auritus), herons (Ardea sp., Egretta sp.), flamingo (Phoenicopterus ruber), goose (Branta spp.), and ducks (Anatidae) occur in fresh or fresh to brackish waters. The extinct giant capybara is about 40% larger than the modern form (figure 12). This rodent is semiaquatic, feeding on aquatic plants and grass. The extinct tapir is about the same size or slightly larger than the modern neotropical formo A semiaquatic animal, it is heavily built and also feeds on soft vegetation in a forested riverine habitat (Kurtén and Anderson, 1980; Anderson, 1984). Figure 11. The shrub ox Euceratherium; Hibbard (1955).

The late Pleistocene corridor fauna and particularly that of the Basin is a disharmonious fauna. Components from different c1imatic regimes are found together within this community that indicates a very different c1imate and environments than those of today. Animals that were sympatric are allopatric today, indicating that the c1imatic and environmental conditions that existed at the end of the Pleistocene do not

modified from

have a modern analog. The vole Pitymys quasiater, the shrub ox, and the tapir represent temperate, boreal, or neotropical c1imates whereas species such as the capybara, otter, double-crested cormorant, and the flamingo are humid and mild weather forms. This coexistence has been explained based on environmental factors

Figure 12. The giant capybara Neochoerus; modified from Martin and Guilday (1967).

being quite different

239

in the past that allowed


EILEEN J OHNSON, JOAQUÍN

ARROYO-CABRALES

AND ÓSCAR J. POLACO

being challenged

sorne stenotypic species to extend their range beyond narrow climatic conditions. The shif-

by recent studies indicating

late Pleistocene peoples scavenged recently dead or dying mammoths (e.g., Haynes, 1991; Saunders and Daeschler, 1994; Johnson, 2003). In the Basin, this practice could have been facili-

ting of ecological and climatic zones during the late Pleistocene is not a simple displacement or range extension. Zones do not merely shift, but rather new ecological conditions were created as zones overlapped with new faunal and floral associations. Faunas are more varied and com-

tated by extensive marshes and the increasingly unsteady environment due to volcanism (Siebe eL al., 1996; González eL al., this volume). Both hunting and scavenging mammoth, and megafauna in general, have risks. Scavenging was safer than hunting mammoth or other large animals in terms of any immediate threat from the hunted animal. However, people scavenging a mammoth carcass would have to con-

munity structure was organized differentIy to accommodate the different associations. Nevertheless, a great deal remains to be done to correlate the late Pleistocene vegetation and faunal records in order to explain the past distribution of the Mexican biotas. Curren t records show sorne differences regarding climate inferences based on the different proxy datasets and additional radiocarbon dating is needed to refine the chronology and relationships between localities, and vegetational and

tend with the large carnivore guild. Very few sites in Mexico have been investigated where the association of people and extinct animals is demonstrated. A concerted effort is needed to continue to examine known late Pleistocene localities and systematically search

faunal assemblages. Among the known mammal species that occurred in the Basin of Mexico at the end of the Pleistocene, several have been advocated

for new localities in order to gain a gréater understanding of early peoples in the Basin and the role that the diverse fauna played in their subsistence systems.

as game animals procured by late Pleistocene peoples (Álvarez, 1986; Armen ta, 1959; Armen ta Camacho, 1978; Aveleyra Arroyo de Anda, 1955, 1956; Aveleyra Arroyo de Anda and Maldonado

CONCLUDING STATEMENT

Koerdell, 1952, 1953; Garda Cook, 1968; Lorenzo and Mirambell, 1986b, 1986c). This observation is based on the association of ani-

At the end of the Pleistocene, a diverse fauna occupied the landscape that provided a potential variety of game animal resources for early peoples as well as a number of dangerous competitors for those resources. Mammoth has

mals (primarily extinct species) with artifacts at several· sites, such as Tlapacoya (Lorenzo and Mirambell, 1986b), and Santa Isabel Ixtapan

such a condition is explained by natural causes

been advocated as a primary prey species and the presence of other species (particularly the extinct forms) in archaeological sites may indicate their use by early peoples. Elsewhere on the Plains, late Pleistocene peoples are known to have had a broad-based subsistence, utilizing a number of different animals (both extinct

(Ramos Meza and Delgado, 1962; Santamaría, pers. comm., 1990; Behrensmeyer and Hill, 1980; Shipman, 1981; Weigelt, 1989 ). Whether people were actively hunting mammoth in the Basin or scavenging them is unclear yet. The view of people hunting mammoth is

and extant forms) Uohnson, 1991). Mammoth was an occasional resource and its procurement was not always for subsistence purposes Uohnson, 2003). While the faunal data available present a view of the potential game resources available,

(Aveleyra Arroyo de Anda, finding of articulated legs been mentioned as evidence i.e., directing animals close

1955, 1956). The and artifacts has of human activity, to the lake edge

where they could get stuck in the mud (Aveleyra Arroyo de Anda, 1955). However,

240


CLlMATE,

ENVIRONMENT,

AND GAME ANIMAL

only taphonomic studies of the assemblages from individual sites will be able to discern which of those re source s actually were utilized by early peoples and in what ways. Current research indicates that late Pleistocene peoples scavenged carcasses as well as being active hunters

RESOURCES Of THE LATE PLEISTOCENE

Alberdi, M.T.,]. Arroyo-Cabrales, y OJo Polaco (en prensa), "¿Cuántas especies de caballo hubo en una sola localidad del Pleistoceno mexicano?", Revista Española de Paleontologia. Álvarez, T. (1986), "Fauna pleistocénica", en José Luis Lorenzo y Lorena Mirambell (coords.), Tlapacoya: 35 000 años de historia del lago de Chalco, México, Instituto Nacional de Antropología e Historia, pp. 173-203 (Colección Científica, 155).

(Saunders and Daeschler, 1994;Johnson, 2003). Furthermore, these carcasses offered resources beyond subsistence. Small to medium species generally are underrepresented in the known late Pleistocene faunal communities. Yet, equally important may be the role these small game resources may have played in human maintenance at that time.

---y

A. Ocaña (1987), "Nomenclatura

espe-

cífica de los Equidae del Pleistoceno de México", Anales de la Escuela Nacional de Ciencias Biológicas, núm. 31, México, pp. 125-132. Anderson, E. (1984), "Who's Who in the Pleistocene: A Mammalian Bestiary", en P.S.

ACKNOWLEDGEMENTS

Martin y R.G. Klein (eds.), Quaternary Extinctions. A Prehistoric Revolution, Tucson, University of Arizona Press, pp. 40-89. Armenia,]. (1959), "Hallazgo de un artefacto

The authors appreciate the assistance of Felisa ]. Aguilar (Instituto Nacional de Antropología e Historia) with the illustrations for the presentation at the symposium and Corrine Macewen (Museum ofTexas Tech University) for the line

asociado con mamut en el Valle de Puebla", Publicaciones del Departamento de Prehistoria, núm. 7, México, INAH, pp. 7-25. Armenta Camacho,]. (1978), Vestigiosde labor hu-

drawings of the animals and Amit Shrivastava (Museum of Texas Tech University) for the corridor map for this publication; and Diana

mana en huesos de animales extintos de Valsequi110, Puebla, México, México, Consejo Editorial

Santamaría for sharing information. Also, several institutions supported parts of the research: CONABIO; the Subdirección de Laboratorios y Apoyo Académico, Instituto Nacional de Antropología e Historia, México; and the Museum of Texas Tech University. This manuscript represents part of the ongoing regional research of

del Gobierno del Estado de Puebla. Arroyo-Cabrales, ]., OJ. Polaco y E. Johnson

the Lubbock Lake Landmark into Quaternary cultural and ecological changes on the Southern Plains under the auspices of the Museum ofTexas Tech University.

---

(1998), "Late Quaternary Environments and Mammal Faunas in México", ponencia presentada en la sesión plenaria de la American Quaternary Association Meeting, Puerto Vallarta, México. (2002), "La mastofauna del Cuaternario tardío en México", en M. Montellano-Ballesteros y]. Arroyo-Cabrales (coords.), Avances

en los estudios paleomastozoológicos en México, México, INAH, pp. 103-123 (Colección Científica, 443). Aveleyra Arroyo de Anda, L. (1955), El segundo

BIBLIO GRAPHY

mamut fósil de Santa Isabel lztapan, México, y artefactos asociados, México, INAH, pp. 1-59 (Publicaciones de la Dirección de Prehistoria, 1).

Agenbroad, L.D. (1984), "NewWorld Mammoth Distribution", en P.S. Martin y R.G. Klein (eds.), Qyaternary Extinctions. A Prehistoric Revolution, Tucson, University of Arizona Press, pp. 90-108.

--

241

(1956), "The Second Mammoth and Associated Artifacts at Santa Isabel Iztapan,


El LEEN JOHNSON, JOAQUÍN ARROYO-CABRALES AND áSCAR].

tion and Western Hemisphere, Amsterdam, Elsevier, pp. 151-182. Cuatáparo,].N. y S. Ramírez (1875), "Descrip-

México", American Antiquity, vol. 22, núm. 1, --

--_.

pp. 12-28. Y M. "Asociación Pleistoceno co", Revista

Maldonado Koerdell (1952), de artefactos con mamut en el superior de la cuenca de MéxiMexicana de Estudios Antropológi-

ción de un mamífero fósil de especie desconocida perteneciente al género 'Glyptodon', encontrado entre las capas posterciarias de Tequixquiac, en el distrito de Zumpango", Boletín de la Sociedad Mexicana de Geografía y .éStadística, serie 3, núm. 2, pp. 354-362.

cos, núm. 13, pp. 3-30. Y (1953), "Association of Artifaets with Mammoth in the Valley ofMéxico", American

Downs, T (1958), "Fossil Vertebrates from Lago de Chapala, Jalisco", Congreso Geológico Internacional XX Sesión, Sección VII Paleontología, Taxonomía y Evolución, México, pp. 75-77. Dudley, ].P. (1996), "Mammoths, Gomphotheres, and the Great American Faunal Interchange", enJeheskel Shoshani y Pascal Tassy (eds.), The Proboscidea. Evolution and Palaeoeco-

Antiquity, núm. 18, pp. 332-340. Behrensmeyer, A.K. y A.P. Hill (1980), Fossils in the Making. Vertebrate Taphonomy and Paleoeco10g), Chicago, University of Chicago Press. Bradbury, ].P. (1989), "Late Quaternary Lacustrine Paleoenvironments in the Cuenca de México", Quaternary Science Reviews, núm. 8, ---

pp. 75-100. (1997), "Sources of Glacial Moisture in Mesoamerica", Quaternary International,

10g) of Elephants and Their Relatives, Oxford, Oxford University Press, pp. 289-295. Elias, S.A. y TR van Devender (1990), "Fossil

núm. 43/44, pp. 97-110. Brown, RB. (1985), "A Summary of LateQuaternary Pollen Records from México West of the Isthmus of Tehuantepec", en V.M. Bryant y RG. Holloway (eds.), Pollen

Insect Evidence for Late Quaternary Climatic Change in the Big Bend Region, Chihuahuan Desert, Texas", Quaternary Research, núm. 34, pp. 249-26l. Espinosa, L. (1902), "Descripción oro-hidrográ-

Records of Late Quaternary North American Sediments, Dalias, American Association of Stratigraphic Palynologists Foundation, pp.

fica y geológica del Valle de México", Memoria histórica, técnica y administrativa de las obras del desagüe del Valle de México, 1449-1900, vol. 1, pp. 5-28. Fredlund, G.G. y L.L. Tieszen (1997), "Phyto-

71-93. Caballero Miranda, M. (1997), 'The Last Glacial Maximum in the Basin of México: The Diatom Record Between 34000 and 15000 Years BP from Lake Cha1co", Qy.aternary --

POLACO

lith and Carbon

lsotope Evidence for Late

Quaternary Vegetation and Climate Change in the Southern Black Hills, South Dakota", Quaternary Research, núm. 47, pp. 206-217.

International, núm. 43/44, pp. 125-136. Y B. Ortega Guerrero (1998), "Lake Levels Since about 40000 Years Ago at Lake Cha1co, Near México City", Quaternary

García Cook, A. (1968), Chimalhuacán: un artefacto asociado a megafauna, México, INAH, pp. 1-38 (Publicaciones del Departamento

Research, núm. 50, pp. 69-79. Coupland, R.T (1992a), Natural Grasslands. Introduction and Western Hemisphere, Amster-

de Prehistoria, 21). Gillette, D.D. (1973), "A Review of North American Glyptodonts (Edentata, Mammalia): Osteology, Systematics, and Paleoecology", tesis de doctorado, Dalias, Southern Methodist University, mimeo. González-Quintero, L. (1986), "Análisis polínicos de los sedimentos", en].L. Lorenzo y L.

dam, EIsevier. (1992b), "Overview of the Grasslands of North America", en Robert T Coupland (ed.), Natural Grasslands. Introduction and Western Hemisphere, Amsterdam, Elsevier, pp. 147-149. --(1992c), "Mixed Prairie", en Robert T Coupland (ed.), Natural Grasslands. Introduc-

---

Mirambell

242

(coords.),

Tlapacoya: 35000

años


CLlMATE,ENVIRONMENT, ANDGAMEANIMALRESOURCES Of THE LATEPLEISTOCENE de historia del lago de Chaleo, México, INAH, pp. 157-166 (Colección Científica, 155). González, S., L. Morett Alatorre, D. Huddart y ]. Arroyo-Cabrales

Origins and Adaptations, Corvallis, Center for the Study of the First Americans, Oregon State University, pp. 215-236.

(s.f.), Mammoths fmm the

---

(2000), "Taphonomy of Late Pleistocene Mammoth in Southeastern Wisconsin", Wiscansin, Great Lakes Archaeological Center, Milwakee.

---

(2003), "Late Wisconsinan Mammoth Procurement in the North American Grasslands", en R. Bonnichsen (ed.), Clovis and

Basin of Mexico: Stratigraphy and Radiocarbon Dating (s.p.i.). Gould, F.W. y R.B. Shaw (1983), Crass Systematics, 2a ed., College Station, Texas A&M University Rress. Graham, R.w. y E.L. LundeliusJr. (1987), "Late Quaternary Mammalian Faunas and Paleoenvironments of the Southwestern Plains of the United States", en R.W. Graham, H.A. HolmesJr.

y M.A. Graham

Beyond, College Station, Texas A&M University Press. Kurtén, B. (1967), "Pleistocene Bears of North America 2. Genus Arctodus, Short-faced Bears", Acta Zoológica Fennica, núm. 117, pp. 1-60. -Y E. Anderson (1980), PleistoceneMammals

(eds.), Late Qua-

ternary Mammalian Biogeography and Environments of the Creat Plains and Prairies, II1inois, Illinois State Museum,

pp. 24-87 (Scientific

Papers, 22). --(1994), "Faunmap: A Database Documenting Late Quaternary Distributions of Mammal Species in the United States", Scientific Papers, núm. 25, Illinois, Illinois State Museum, pp. 1-690. Hall, E.R. (1981), Mammals

of North America, University Press.

York, Columbia

Lister, A. y P. Van (1994), Mammoths. Giants of the Ice Age, Londres, Marshall Publishing. Lambert, W.D. (1996), ''The Biogeography

of

the Gomphotheriid Proboscideans of North America", en]. Shoshani y P.L. Tassy (eds.),

of North America,

Nueva York, John Wiley and Sonso Haynes, G. (1991), Mammoths, Mastodonts, and Elephants. Biology, Behavior; and theFossil Record, . Cambridge, Cambridge University Press. Hibbard, c.w. (1955), "Pleistocene Vertebrates

The Pmboscidea. Evolution and Palaeoecology of Elephants and their Relatives, Oxford, Oxford University Press, pp. 143-148. Lauenroth, w.K. y D.G. Milchunas (1992), "Short-Grass Steppe", en R.T. Coupland

[rom the Upper Becerra (Becerra Superior) Formation, Valley of Tequixquiac, Mexico, with Notes on Other Pleistocene Forms", Contributions fmm the Museum of Paleontology,

(ed.),

Natural

Crasslands.

Intmduction

and

Western Hemisphere, Amsterdam, Elsevier, pp. 183-226. Lorenzo,].L. y Lorena Mirambell (1986a), "Ma-

núm. 12, Michigan, University of Michigan, pp. 47-96. Johnson, E. (1987), Lubbock Lake. Late Quaternary Studies on the College Station, Texas --(1989), "Human Early Southern Plains

Nueva

mutes excavados en la cuenca de México (1952-1980) ", México, Departamen to de Prehistoria, INAH, pp. 1-151 (Cuaderno de Trabajo, 32). -(1986b), Tlapacoya: 35 000 años de histo-

Southern High Plains, A&M University Press. Modified Bones from Sites", en R. Bonnich-

ria del lago de Chalco, México, INAH, pp. 1-297 (Colección Científica, 155). --(1986c), "Preliminary Report on

sen y M. Sorg (eds.), Bone Modification, Orono, Center for the Study of the First Americans, University ofMaine, pp. 431-472. --(1991), "Late Pleistocene Cultural Occupation on the Southern Plains", en R. Bonnichsen y K.L. Turnmire (eds.), Clovis.

Archaeological and Paleoenvironmental Studies in the Area of El Cedral, San Luis Potosí, Mexico, 1977-1980", en Alan Lyle Bryan (ed.), New Evidence for the Pleistocene Peopling of the Americas, Orono, Center for

243


EILEENJOHNSON, JOAQUÍNARROYO-CABRALES ANDÓSCAR]. POLACO ---,

the Study ofEarly Man, University ofMaine,

Monsoon/Westerly Boundary in Northern Mexico", ¡oumal of Paleolimnology, núm. 17, pp. 155-171.

Changes of the Central Part of the Basin of Mexico; Correlation Between Texcoco and Chalco Basins", Review of Palaeobotany and ---,

--,

S.L. O'Hara,

M. Caballero

y SJ. Davies

(2000), "Records of Late Pleistocene-Holocene Climatic Change in Mexico. A Review", Quaternary Science Reviews, núm. 19, pp. 699721.

Palynology, núm. 99, pp. 77-93. B. Ortega-Guerrero, M. CaballeroMiranda y j. U rrutia-Fucugauchi (1993) , "Late Pleistocene and Holo'cene Paleoen-

Meyer, E.R. (1973), "Late Quaternary

Paleoeco-

logy of the Cuatro Ciénegas Basin, Coahuila, Mexico", Ecology, núm. 54, pp. 982-985. Morett A., L., S. González, j. Arroyo-Cabrales, OJ. Polaco, GJ. Sherwood y A. Turner

vironments ofChalco Lake, Central Mexico", Qyaternary Research, núm. 40, pp. 332-342. MacFadden, BJ. (1992), Fossil Horses. Systematics, Phylogeny, and Evolution of the Family Equidae, Nueva York, Cambridge University Press. Manrique,j. y G. Villanueva (1997), "La fauna

(2003), 'The Late Pleistocene Paleoenvironment of the Basin of Mexico. Evidence from the Tocuila Mammoth Site", Deinsea, núm. 9. Navarro Sigüenza, A. y H. Benítez Díaz (1999), "Biodiversidad de la cuenca de México, pasado y presente", Revista Internacional de Arquitectura, Artes, Diseño, Creación y Cultura, vol. 1, núm. 2, pp. 57-68. Niederberger, C. (1976), Zohapilco. Cinco milenios de ocupación humana en un sitio lacustre de la cuenca de México, México, INAH, pp. 1-308 (Colección Científica, 30). Nilsson, T. (1983), The Pleistocene. Geology and

pleistocénica o ¿con quiénes se encontraron nuestros antepasados?", en M. Carballal (coord.), Homenaje al profesor Francisco Gonzátez Rul, México, Dirección de Salvamento Arqueológico, INAH, pp. 39-81. Martin, P.S. y j.E. Guilday (1967), "A Bestiary for Pleistocene Biologists", en P.S. Martin y H.E. WrightJr. (eds.), Pleistocene Extinctions. The Search for a Cause, New Haven, Yale University Press, pp. 1-62. Matheus, P.E. (1995), "Diet and Co-ecology of Pleistocene Short-Faced Bears and Brown Bears in Eastern Beringia", Quaternary Re-

Lije in the Quaternary Ice Age, Dordrecht, D. Reidel Publishing Company. Polaco, OJo y L. Butrón-M. (1997), "Mamíferos

search, núm. 44, pp. 447-453. McDonald, H.G. (2002), "Fossil Xenarthra of Mexico: a Review", en M. Montellano-Ballesteros y j. Arroyo-Cabrales (coords.), Avances

pleistocénicos de la cueva La Presita, San Luis Potosí, México", enj. Arroyo-Cabrales y OJ. Polaco (coords.), Homenaje al profesor Ticul Álvarez, México, INAH, pp. 279-296 (Colección Científica, 357). Ramos Meza, E., y D.W. Delgado (1962), "Mamu-

en los estudios paleomastozoológicos en México, México, INAH, pp. 227-248 (Colección Científica, 443). McDonald, j.N.

A. Bimpson, AJ. Courtice, S.L. O'Hara y D.M. Taylor (1997), "Climate Change at the

pp. 107-113. Lozano-García, M.S. y B. Ortega-Guerrero (1997), "Late Quaternary Environmental

tes: relación del hallazgo de un cementerio en Jalisco", Folia Universitaria, núm. 3, pp. 1-28. Reynoso-Rosales, V.H. y M. Montellano-Balles-

(1981), North American Bison.

Their Classification and Evolution, Berkeley, University of California Press. Metcalfe, S.E., FA. Street-Perrott, R.A. Perrott y D.D. Harkness (1991), "Palaeolimnology of the Upper Lerma Basin, Central Mexico: A Record of Climatic Change and Anthropogenic Disturbance since 11600 yr BP", ¡oumal of Paleolimnology, núm. 5, pp. 197-218.

teros (1994), "Revisión de los équidos de la fauna cedazo del Pleistoceno de Aguascalientes, México", Revista Mexicana de Ciencias Geológicas, núm. 11, pp. 87-105. Saunders,JJ. y E.B. Daeschler (1994), "Descriptive Analyses and Taphonomical Observa-

244


CLIMATE,

ENVlRONMENT,

AND GAME ANIMAL

tions of Culturally-Modified Mammoths Excavated at 'The Gravel Pie, Near Clovis,

vaca, México, Facultad de Ciencias Biológicas, Universidad Autónoma de Morelos. Turner, A. y M. Antón (1997), The Big Cats and

New Mexico in 1936", Proceedings oJ the Academy oJ Natural Scíences oJ Philadelphia, núm. 145, pp. 1-28. Schmutz, E.M., E.L. Smith, P.R. Ogden, M.L. Cox, J.O. KIemmedson,

JJ.

RESOURCES OF THE LATE PLEISTOCENE

Their Fossil Relatives, Nueva York, Columbia University Press. Van Devender, TR. (1986), "Pleistocene Climates and Endemism in the Chihuahuan Desert Flora", en J.e. Barlow, A.M. Powell, y

Norris y L.C.

Fierro (1992), "Desert Grassland", en R.T Coupland (ed.), Natural Grasslands. Introduction and Western Hemisphere, Amsterdam,

B.N. Timmerman (eds.), Second Symposium on Resources oJ the Chihuahuan Desert Region,

Elsevier, pp. 337-362. Shipman, P. (1981), Lije History oJ a Fossil. An

United Sta tes and Mexico, Alpine, Desert Research Institute, pp. 1-19.

Introduction to Taphonomy and Paleoecology, Cambridge, Harvard University Press. Shoshani, J. y P. Tassy (1996), The Proboscídea. Evolution and PalaeoecologyoJElephants and their Relatives, Oxford, Oxford University Press. Siebe, e., M. Abrams, J.L. Macías y J. Oben-

--

Van Devender

y P.S. Martin

Van Devender, TR. y TL. Burgess (1985), "Late Pleistocene Woodlands in the Bolson de Mapimi: A Refugium for the Chihuahuan Desert Biota?", Quaternary Research, núm. 24, pp. 346-353. Watts, WA. y J.P. Bradbury (1982), "Paleoeco-

en M.G. Bar-

bour y W.D. Billings (eds.), North American Terrestrial Vegetation, Cambridge, Cambridge University Press, pp. 265-286. Skinner, M.F. y O.e. Kaisen (1947), "The Fossil Bison of Alaska and Preliminary Revision of the Genus", Bulletin oJtheAmerican Museum oJ

logical Studies at Lake Patzcuaro on the West-central Mexican Plateau and at Chalco in the Basin of Mexico ", Quaternary Research, núm. 17, pp. 56-70.

Natural History, núm. 89, pp. 127-256. Solórzano, FA (1989), "Pleistocene Artifacts

Webb, S.D. (1965), "The Osteology of Camelops", Scíence Bulletin oJ the Los Angeles County Museum, núm. 1, pp. 1-54. --(1974), "Pleistocene Llamas of Florida with a Brief Review of the Lamini", en S.D. Webb (ed.), Pleistocene Mammals oJ Florida, Gainesville, University of Florida Press, pp. 170-213. Weigelt,J. (1989), Recent Vertebrate Carcasses and

from Jalisco, Mexico: A Comparison with Some Pre-Hispanic Artifacts", en R. Bonnichsen y M. Sorg (eds.), Bone Modification, Orono, Cen ter for the Study of the First Americans, University ofMaine, pp. 499-514. Stock, C. (1956), "Rancho La Brea, a Record of Pleistocene Life in California", Los Angeles County Museum, Scíence Series, vol. 20, núm.

their Paleobiological Implications, University of Chicago Press, Chicago. Winans, M.C. (1985), "Revision of North

11, pp. 1-76. Tamayo, J.L. (2001), Geografía moderna de México, México, Editorial Trillas. Torres Marúnez,J.e. (1995), "Fauna local Mina Pleistoceno

TR.

(eds.), Packrat Middens. The Last 40 000 Years oJ Biotic Change, Tucson, University of Arizona Press, pp. 104-133.

holzner (1996), "Repeated Volcanic Disasters

de San Antonio,

(1990), "Late Quaternary Vegetation and Climate of the Chihuahuan Desert, United States and Mexico", en J.L. Betancourt,

in Prehispanic Time at Popocatépetl, Central Mexico: Past Key to the Future?", Geology, núm. 24, pp. 399-402. Sims, P.L. (1988), "Grasslands",

Texas,

American Fossil Species of the Genus Equus (Mammalia: Perissodactyla: Equidae) ", tesis de doctorado, Austin, University ofTexas. Wright, HA. y A.w. Bailey (1982), FireEcology,

tardío de San

Luis Potosí y su significación geológico-paleontológica", tesis de licenciatura, Cuerna-

Nueva York, Wiley.

245


A

PRELIMINARY REpORT OF THE McMINNVILLE

MAMMOTH,

OREGON: A TAPHONOMIC APPROACH Robson Bonnichsen,

*

Michael Full and Marvin Reken **

RESUMEN

evidencia de que existió un patrón muy tem-

El presente texto se refiere a la investigación sobre los restos del mamut de McMinnville, que

prano de alimentación de carroña y de procuración del mamut, a semejanza de hallazgos más recientes documentados en Yukón del Norte y los Great Plains, que tienen una anti-

fue encontrado en el verano de 1991 en el sur del río Yamhill, Oregón. En la excavación, que se llevó a cabo de 1991 a 1994, se determinó que se trata de los restos desarticulados de un mamut

güedad de 12000 a 24000 a.P. determinada radiocarbono.

columbi (Mammuthus columbi). Los huesos preservados son los del lado izquierdo de un animal pequeño, adulto, probablemente una hembra. La muestra para el C14 se tomó de un fragmento de hueso del maxilar y su antigüedad se calculó en aproximadamente 46400 ± a.P. (CA}1S-77878), en XAD -fracción de gelatina-o Del análisis tafonómico del esqueleto se

por

ABSTRACT The investigation

of McMinnville Mammoth,

discovered during the summer of 1991 on the South YamhiJI River, Oregon, and subsequent excavation 1991-1994, yielded the disarticulated remains of a Columbian mammoth (Mammuthus columbi). The well-preserved bones are from the medial axis and left side of an old small animal that was probably female. A maxillary bone fragment yielded a C14 age of> 46400 ± RCYBP (CAMS-77878) on the XAD-Gelatin franion. A

desprende la probabilidad de que los animales carnívoros y los humanos se hayan alimentado con la carroña del esqueleto. Algunas marcas indican que el esqueleto fue roído por un carnívoro del tamaño del lobo. Las marcas de impacto, los patrones de fractura y el punto bruñido de una fractura en la tibia del Bison sugieren que los humanos pudieron haber cortado el animal. Si se lograra sustentar los resultados preliminares con más estudios, el mamut McMinnville constituiría la

taphonomic analysis of the skeleton indicates that both carnivores and humans may have scavenged the skeleton. Gnaw marks suggest a wolf-sized carnivore scavenged part of the skeleton. 1mpact marks, fracture patterns, and the polished end of a green bone break on a Bison

* Center for the Study of the First Americans, partment of Anthropology, Texas A&M University. ** McMinnville, Oregon.

sp. tibia suggests that humans may have either butchered or scavenged the animal. 1f preliminary results are supported by additional study, the McMinnviJIe Mammoth may represent evi-

De-

247


ROBSON BONNICHSEN, MICHAEL FULL AND MARVIN REKEN

dence for a very early mammoth scavenging/ procurement pattern that is similar to younger finds documented from northern Yukon Territory and the Great Plains that date from 12000 to 24000 RCYBP.

N

~

KEYWORDS Mammoth, taphonomic,

fracture.

INTRODUCTION

m単

The McMinnville Mammoth site occurs within the city limits of McMinnville, Oregon, on the South Yamhill River. The South Yamhill originates in the Coast Range of Oregon about 40 miles south of Portland, and is characterized by seasonal flooding and bank erosion during the fall, winter, and spring months of the years.

Map Lecation

Figure 1. Contour map ofthe McMinnville Mammoth site. Top of map is north.

Avocation paleontologists Michael Full and his colleague Marvin Reken have systematically collected, mapped, and preserved late Pleistocene Rancholabrean fauna finds from the Yamhill over the last two decades. During the spring of 1991, they discovered a recently exposed in situ

BACKGROUND

mammoth (Mammuthus columbi) tusk in vertical cut bank entombed in late Pleistocene terrace deposits. Investigations at this oxbow meander (figure 1) revealed additional remains were

Since the early 1970s, First American specialists have advocated that humans were in the Americas well before terminal Pleistocene times. An important line of evidence for an early human presence is documented in the bony remains of late Pleistocene mammals. For example, work

in place and warranted excavation before flooding and erosion removed the bone-bearing

in the Old Crow Basin, Yukon Territory by Irving and others suggest that late Pleistocene

deposito In this preliminary report, we outline important background information for understanding the potential significance of the McMinnville

hunters/scavengers butchered and processed megamammal bone from mammoth, bison, horse, muskoxen, and caribou for food and tool materials (Bonnichsen, 1979; Irving and Harington, 1973; Morlan, 1980). These early studies

Mammoth discovery. We present the circumstan ces that led to the discovery, discuss the site context; document our initial paleontological

were criticized on the grounds that: 1) many of the supposed artifacts collected from river bars

observations, present a description of remains recovered; summarize taphonomic characteristics, and discuss the significan ce of the McMinnville Mammoth. Additional geological, paleoe-

lacked stratigraphic contexts; and 2) natural and cultural bone modifications can not readily be distinguished apart from one another (Dixon and Thorson, 1984).

cological, and taphonomic presented in a later papero

Since these early reports, additional studies have focused on the study of modified Pleisto-

studies

will be

248


A PRELIMINARY REpORT OF THE McMINNVILLE MAMMOTH, OREGON

cene marnmal bones at sites with elear stratigra-

they have identified three "bone debris fields" localities that have produced Pleistocene mammal remains. Most of these locations represent places where the Yarnhill River has redeposited one or a few bones on gravel bars during annual flood events. During one of their annual surveys of the river bottom during the summer of 1991, M. Full spotted a moss-covered left tusk sheath protruding from a cut bank comprised of late Pleistocene terrace deposits. Because

phic contexts. Sorne of the most important of these sites inelude Blue Fish Caves, northern fukon Territory. Cinq-Mars and Morlan (1999) report radiocarbon dates on a marnmoth bone core and conjoined flake of 23900 RCYBP.lmmediately south the Laurentide lee Sheet, David Overstreet (Bonnichsen and Turnmire, 1999; Overstreet, 2002) has reported on mammoth bones from the Schafer and Heibor sites in eastern

Wisconsin

that

have yielded

ages from

this section of the river occurs at a steep bรกnk of an oxbow meander, it was reasoned that an immediate field investigations was warranted as

12000 to 13500 RCYBP.Holen working in the Great Plains has found a series of sites with flaked mammoth bone ineluding the LaSena (ca. 18000 RCYBP), the Shaffert site (16500 RCYBP), Jensen (13830-14830 RCYBP), Nebraska, and

annual high flood waters were likely to remove this section of the bank.

the Lovewell site, Kansas (18250 RCYBP)(Bonnichsen and Turnmire, 1999; Holen, 1996). Other important sites yielding evidence for flaked and ford site

EXCAVATION

Rancholabrean fauna inelude the Dutton Selby sites, Colorado (Stanford, 1979; Stanand Graham, 1985) and the Lamb Springs in Colorado dating between 11 735-13140

EXCAVATION PROCEDURES With the help of his wife, Reken, and friends, -Fulla highly trained police officer, established scientific excavation procedures at the site.

RCYBP(Rancier eL al., 1982; Stanford eL al., 1981). Flaked mammoth bone has also been found at Clovis age sites ineluding Owl Cave, Idaho

To gain access to the vertically cut bank from the river, the excavators drove steel fence posts into the river bottom sediments and attached a wooden platform from which excavations were initiated. As excavations proceeded, a bench was established on the terrace edge. As the excavation progressed, work was conducted from the bench as illustrated in figure 2.

(Miller, 1987) and the Lange/Fugerson site, South Dakota (Hannus, 1987). Recently, Johnson (2002) developed a syntheJ;is of sites yielding flaked and cut bones modified by humans from the North American Grasslands that extend from the southern edge of the Laurentide lee sheet to the Valley of Mexico. She has identified more than a dozen sites as candidates dating from approximately 20000 RCYBPto Clovis times.

CONTEXT LOCATION Over the last 40 years M. Full and M. Reken have systematically surveyed, collected, mapped, and preserved late Pleistocene Quaternary mam-

Figure 2. Mike FuIl (left) and Marvin Reken (center) on bench where marnmoth remains occurred in Strata IV.

mal remains from South Yamhill River drainage in northwestern Oregon (figure 1). To date

249


ROBSON BONNICHSEN, MICHAEL FULL AND MARVIN REKEN

A grid system of five-foot squares tied to a reference datum was established and used to guide excavation and specimen documentation. Field excavation procedures consisted of digging into the upper portion of Strata IV, the bone bearing strata, with trowels, screwdrivers, shovels, and picks. When bones were discovered, they were isolated and excavated with careo The excavation took place over a five-year period during summers. Recovered bones were transported to Full's home, cleaned and conserved by saturating with a solution of polyurethane to prevent decomposition. Currently, these specimens are stored in a walk in vault with temperature and humidity controls in the Full's garage. GEOLOGY

482000.00

The McMinnville Mammoth is a late Pleistocene paleontological site located in the northwestern part of the Willamette Valley. The site occurs on

484000.00

486000.00

488000.00

490000.00

Figure 3. Geomorphie map of the McMinnville Mammoth area. Top of map is north.

the northeast bank of the South Yamhill River and occurs in Yamhill County. The South Yamhill River originates in the east flank of the Coast

Of direct importan ce to understanding of the McMinnville Mammoth is its position in terrace deposits that flank the current river channe!. Professor Herbert Huddleston, soil scientist at Oregon State University, assisted with describing terrace deposit at the site location using

Range, dissects the Dayton Prairie, and flows into the WilIamette River, which in turn drains into the Columbia River. The McMinnville Mammoth site occurs near the transition from the Valley floor into the Coast Range. Late Pleistocene flooding events, including Missoula floods, impacted this area. As a result of these flooding events, the WilIamette Valley floor was altered with the introduction and deposition of nonlocal sediments and materials onto exposed surfaces that have been stripped clean of sedi-

standard soils descriptive procedures. Detailed descriptions are listed in figure 4. A summary of each stratigraphic unit is listed below. Simia 1 is approximately 2 m thick and is composed of overbank deposits. Simia 1I is comprised of 30 alternating beds of light gray silty loam, red to dark red loam,

ments by the sheer force of floods (McDowell and Roberts, 1987). These flooding events undoubtedly impacted the South Yamhill drainage system. As floodwaters subsided, pre-flood drainage systems would have re-established themselves in

and yellow brown loam. Simia Uf is com prised of stratified to massive beds ofweakly cemented sand and grave!.

old channels as suggested by the geomorphic map illustrated in figure 3. lt is not known how the cut and fill deposits of the South Yamhill

sits are: Simia 1 resulted from seasonal overbank flo-

Simia IV is blue black sandy, silty loam, with sorne clay. Our tentative interpretations of these depo-

oding during the Holocene. Siraia 1I with its characteristic

River relate to geomorphic units mapped in the Willamette Valley by Balster and Parsons

rhythmic, ban-

ded alluvial deposits are overbank flood deposits that may be associated with the Willamette

(1968).

250


A PRELlMINARY REpORT Of THE McMINNVILLE MAMMOTH, üREGON

Unconformity an erosional unconformity occurs between Strata In and Strata IV and indicates a major gap in the depositional record in this section of the South Yamhill. The age of this unconformity is not known. Stmta !Vis an anaerobic blue to black sandy loam alluvial unit indicating a low energy depo-

Formation deposited by the last Missoula floodcycle that dates to about 13000 RCYBP. Stmta lIJ, consisting of sand and grave! documents a period of greater stream flow than present and may be indicative of channel or point bar deposits. The age of this unit is not known.

0.0 meters

Ground surface 2.3 meters from top of baseline.

Full Mammoth Site Stratigraphic Profile

(baseline)

Top of Profile

Strata 1: Topsoil, overbank deposits.

Strata 11:Complex of thirty alternating strata, made up of three primary soil types. These include: 1)Light gray layer, 2.5Y3/2 (moist) 2.5Y5/2 (dry) silty loam, moderate fine subangular blocky, some dark red coatings of Fe and Mn oxides present; 2) Dark red-brown layer, 1OYR4/2 & 10YR4/4, red loam with parallel bands or 50ft masses of Fe concentrations (7.5YR5/6) throughout bands; 3) Yellow-brown layer, 2.5YR6/3 (dry), 2.5Y4/4 (moist), silt loam, weak, fine subangular blocky with Mn concentrations and Fe oxide concentrations within strata, many fine distinct 10YR5/6 pore linings.

1.0 meters

Strata III:Variably stratified A, 81, and 82layers: A) 10YR3/3 (moist) 10YR6/3 (dry), sand, massive and weakly cemented; 81) 5YR211black gravely sand, massive, weakly cemented, prominant medium sand, manganese staining present; 82) 10YR3/2, 10YR3/3, 1OYR3/4,gravely coarse sand, loose and single grained, variably stratified.

2.0 meters

Strata IVA: 8lue-black grave!.

Strata IV 8: 582.5/1 8lue-black sandy, silty loam with some c1ay present, medium texture, massive. 3.0 meters _ ••••

Figure 4. Description Huddleston.

••••

of the stratigraphic

••••••••-J

section of the McMinnvi1e Mammoth

251

site prepared

by Herbert


ROBSON BONNICHSEN, MICHAEL FULL AND MARVlN REKEN

sitional environment.

The McMinnville Mam-

The general findings study were the following:

moth was found in the -lop part of this unit.

of this preliminary .

The large fraction (500 ~m) ofthe lower three samples (30-60 cm) consisted in large part of organic matter, particularly wood fragments and sand.

CHRONOLOGY A fragment of mammoth maxillary bone in excellent condition was submitted to Stafford Labo-

The small fraction (250 ~m) from all levels (0-60 cm) was composed primarily ofwell-roun-

ratories, Boulder, Colorado for collagen dating. The bone yielded a C14 age of >46400 ± RCYBP (CAM5-77878) on the XAD-Gelatin fraction. Thus, the age of McMinnville Mammoth in excess of 50 000 calendar years.

ded sand and sorne angular quartz grains. Microscopic sized gray translucent chips, possibly obsidian, were present in all levels in both fractions. A microscopic insect wing (unidentified) curred in the 50-60 cm fraction.

oc-

A microscopic seedpod (unidentified) occurred in the 40-50 cm fraction. Individual hair fragments sorne dark and

PALEOECOLOGY The bones were found within and at the upper boundary of Strata IV below the unconformity separating Strata III and IV. The top of Strata IV has a high organic content and gives off methane gas. This layer is about 60 cm thick and contains bark, and limb and tree trunk debris.

sorne light, occurred in the coarse fraction of 20-30 cm and 50-60 cm levels. A plant fiber occurred in the coarse fraction 20-30 cm. A plant fragment (or algae) was in the 0-10 cm and 40-50 cm levels. A piece of carbonized wood was in the coarse fraction in the 30-40 cm level and what might be permineralized wood occurred in the 50-60 cm fraction.

A preliminar y paleoecological study was initiated to evaluate the potential of these sediments to yield pollen, algae, fungi, seeds, mosses, and beetles following methods outlined by Berglund (1986). This research involved the collection of bulk sediment samples in 10 cm intervals below the unconformity at the top of the Stratum IV. Each sample was approximately 10 x 10 x 20 cm (Roy, 1994). In the laboratory, 200 mi of sediment from each sample was put

In general, the microfossils are present in Strata IV are consistent with a floodplain environment rather than a pond, lake, or marsh setting. We did not find, for example, diatoms and ostracods that are typically found in standing water. Additional paleoecological work at this site has the potential to contribute additional information about the local environment, in which the McMinnville Mammoth lived and died.

into separate polyurethane bags. Two liters of hot water and 120 mi of dilute sodium hexametaphospahte solution (12:100) were added to each of these bags to break the ionic bonds in the sediments. Each sample bag was poured into

PALEONTOLOGY

a large plastic pitcher, then poured through two stacked sieves: 500 ~m on top and 250 ~m on the bottom. The residual matrix from each sieve fraction was transferred to paper towels

Paleontological methods can provide important insights into the size, age, sex, and species of an extinct fauna. M. Full, W.N. Orr (University of Oregon geologist and paleontologist), and R. Bonnichsen identified 20 bones recove¡-ed from the site (see figure 5). Ofthe 20 bone ele-

ánd dried for a day. The dry samples were then observed under a dissecting light microscope typically at 40x to search for microfossils.

252


A PRELIMINARY REpORT OF THE McMINNVILLE MAMMOTH, OREGON

McMinnvilleMammoth Site,Oregon

p015 10' 017

~

013

011

<>oc:::.

018

ĂŠ],016 N

01

012

004

007Âť CutBank

S' 30'

1

008Jg."V'0

005

25'

20'

15'

Yamhill River

10'

5'

O'

--~

Figure 5. Planview map ofmammoth bones (1-18) and bison bone (19) in situ at the McMinnvilleMammoth site. Key to bone elements: 1) Left tusk in stream; 2) Right scapula; 3) Left scapula; 4) tusk socket and part of left pallet; 5) complete rib; 6) broken rib; 7) mandible synthesis; 8) neural spine of thoracic vertebra; 8) neural spine of thoracic vertebra; 9) neural spine of thoracic vertebra; 10) lower left molar; 11) lower left molar; 12) thoracic vertebra; 13) thoracic vertebra; 14) neural spine of thoracic vertebra; 15) neural spine of thoracic vertebra; 16) sinus cavityof cranium fragment; complete right rib; 17) right proximal end of rib; 18) left proximal articular end of rib; 19) distal left bison tibia.

ments recovered from the McMinnville site, 18

of his methods.) He notes that Maglio in 1973 divided Mammuthus columbi in to a northern and southern population. The McMinnvi'lle speci-

are mammoth bones.Judging from size and age characteristics, these bones are from the same animal. The single bison (Bison sp.) tibia was

men belongs with the northern population. Epiphyseal fusion is one way to make general age determinations. Fusion is complete in Asian and African elephants between 35 and 50 years of age and provides the best available analog for determining the age of mammoths. The McMinnville scapulae were the only complete bones with epiphyses recovered from the site. Scapular fusion occurs at about 42 years in Afri-

found about below the mammoth bones. lts distal diaphysis/epiphysis suture is fused indicating that the element is from a mature animal. The bison bone may be a manuport carried to the site by humans. More will be said about this specimen latero A single rodent incisor found during the excavation has yet to be given a generic c1assification. To determine the species of the McMinnville Mammoth, 135 mm. digital photographs were taken of the lingual and buccal sides and occlusal surface of the upper and lower left teeth. These images were sent to Dr. Russell W. Graham at the Denver Museum of Natural history for identification. Graham (personal communication, May 7, 2002) indicates that he calculated the lammellar frequencies (LF) for the upper and lower teeth from the photographs. The upper tooth (specimen 11) has a LF =5 and lower tooth (specimen 10) has a LF=6 (see figure 6). See Graham 1981 and 1986 for details

Figure 6. Left lower mammoth tooth (Mammuthus cotumln) from the McMinnville mammoth.

253


ROBSON BONNICHSEN, MICHAEL FuLL AND MARVIN REKEN

can elephants (Aggenbroad and Mead, 1994). The McMinnville Mammoth may be slightly 01der judging from pathological afflictions. The glenoid fossa of the left scapula has excessive bone growth around the margins suggesting an arthritic condition. On the right scapula there is sorne signs of osteoporosis along the superior border of the spinous process. Given the disease state of these elements, it is safe to assume an age of greater than 45-years old. Agenbroad and Mead (1994) use humeri to calculate shoulder heighl. Lacking humeri, age of the animal can be inferred from the size range of the bones. On the basis of available data, it would appear that the McMinnville animal was not

SPATIAL DISTRlBUTION

When the spatial distribution of the mapped bone elements from the McMinnville Mammoth site are considered as a whole, it can be seen in figure 5 that the bones are concentrated in the center of the excavation area. Excavations were expanded outward from the central concentration of bones until no more were located. 1t can also be seen that the central part of the bone concentration is truncated by the riverbank. This suggests sorne of skeletal elements may have been lost due to bank erosion in recent times. Anticipating this is what may have happened, Full and Reken used scuba gear to dive this section of the river each summer in search of additional bones. Their monitoring efforts were rewarded by the discovery of the left com-

large for its species. The broken tusk is relatively small-indicating a small animal, possibly female. Abnormalities and pathologies provide information about animal health. The tusk had been broken toward the tip but the animallived

plete tusk, which on the basis of size, appears to be from the McMinnville Mammoth and a femur that lacks the ~ame color or pattern of permineralization as the McMinnville mammoth bones, suggesting it may be from another animal.

long enough for it to be re-sharpened through use. The mid-shaft of rib 6 indicates breakage and re-healing. A number of elements indicate the animal suffered from arthritis as noted aboye. From these indicators, it may be concluded the animal was not in good health at the

When the entire inventory of 18 mammoth bones recovered is considered, a significant pattern emerges: all mammoth bone specimens are from the front part of the animal's body.

time of death.

With the exception of the right scapula and a right rib, all other bone element are from the left side or axial part of the skeleton, including

TAPHONOMY

the skull, mandible, and vertebra. By contrast, missing elements suggest an interesting bias. Alllimb, foot, pelvic girdle, and lower vertebral

Taphonomic studies usually focus on late life and post-mortem events that alter bones and distributions of skeletal elements in bone assembla-

column are missing. Figure 7 illustrates the McMinnville Mammoth bones in anatomical order. The large femur was found on the river bottom, but the permineralization pattern of this specimen does not match the coloration of the McMinnville Mammoth bones and suggests that this specimen may be from another animal. What explanation might account for these patterns? Several possible agencies need 10 be considered. Was it fluvial transport? Was it carnivore activity? Or was it humans who removed part of the skeleton through butchering activi-

ges. R. Bonnichsen and an advanced archaeology class conducted a taphonomic analysis of bones recovered from the McMinnville excavation during the fall of 2000 and made systematic observations of each elemento Variables used in the analysis include bone, genera, species, side, portion, fracture type, dominant color, sub dominate color, weathering, puncture marks, gnaw marks, margin flaking, flake, exfoliation, and comments. For the purpose of this preliminary study, only the main conclusions of this analysis will be presented.

254


A PRELIMINARYREpORT OF THE McMINNVILLE MAMMOTH, üREGON

bones were visually inspected for modification patterns (table 1). Twelve of the 19 elements (63%) exhibit carnivore gnawing. Evidence for gnawing occurs on one scapula, the ribs, and the vertebra. The gnaw marks, scooping features, striations, and puncture marks associated with gnawing are consistent with those made by carnivores in the dog, wolf, and fox size range. For example, carnívores removed the centrums from the articulated thoracic vertebrae in figure 8 and the anterior end of the neural spines illustrated in figure 9. The only evidence of carnivore modificatíon occurs as a puncture mark in a small skull fragment (figure 10). From these data, it can be concluded that carnivores were involved in modifYing the morphological and spatial dimensions of the McMínnville Mammoth bone assemblage.

Figure 7. Layout of McMinnvile Mammoth bones in anatomical position.

ties? Or, could it be a combination more of these scenarios?

of one or

With respect to fluvial transport, as a general rule, large bones will tend to orient transverse to the current. Likewise, submerged bones generally orient parallel to the flow (cf. Marshall 1989). For example, the tusk found in the river parallels stream flow. Precise trend and plunge data were not taken at the time of the collection. Nonetheless, an inspection of bone orientation axis in figure 5 suggests that there is not a single preferred orientation. Also, the McMinnville mammoth bones do not appear to be sorted by size as might be expected in a fluvial environment. Not documented on the plan

Figure 8. Articulated thoracic vertebra that lack centrums that were removed by carnivore gnawing.

view map are dozens of small skull fragments from the mammoth skull. This observations coupled with the fact that broken bone edges do not exhibit water rounding suggest that fluvial transport was not responsible for the distribution pattern of mammoth bones. In seeking an explanation for these patterns, consideratíon will now be given to morphological information. MODIFlCATION PATIERNS

Our analysis suggests that two agents altered the McMinnville Mammoth bones: carnivores

Figure 9. Articulated thoracic vertebra illustrating removal of an terior end of spinous process by carnivore gnawing and scooping.

and possibly humans. Each of the 18 mammoth

255


ROBSON BONNICHSEN, MICHAEL FULL AND MARVIN REKEN

CARNIVORE

MODIFIED

BONES

MAMMOTH

SITE

Carnivare Modification

Element l.

TABLE 1 FROM THE MCMINNVILLE

Tusk, left, complete

2. Scapula, right, complete 3. Scapula, left, complete

Gnawed

4. Tusk socket and part of pallet, left 5. Rib, complete

Gnawed at distal end

right

6. Rib, distal 1/3 missing 7. Mandible, synthesis 8. Thoracic vertebra, neural spine

Gnaw marks and removal of right and left lateral processes.

9. Thoracic vertebra, neural spine

Gnaw marks and scopping at zypophysis

10. Molar, lower left, complete 11. Molar, upper left, complete Distal end of neural spine missing with margin flaking,

12. Thoracic Vertebra

scooping on centrum. 13. Thoracic Vertebra 14. Thoracic Vertebra

Depressed

15. Thoracic Vertebra, neural spine

Distal end of neura! spine missing with margin flaking, scooping on centrum, lateral processes missing.

16. Cranium, fragment

bone and gnawing at contact with centrum.

of sinus cavity

17. Rib, right, complete

Gnawing on distal epiphysis with sternum.

18. Rib, left, proximal articular end

Gnaw marks, at proximal end.

19. Tibia, Bison sp., distalleft 20. Rodent incisor (not identified)

But what about human s? There is evidence of bone breakage patterns and possible artifact use-wear patterns present that can not easily be subsumed by the carnivore hypothesis. For example, the mandible exhibits no carnivore

skull fragments found in the are a of bone concentration do not exhibit carnivore marks and exhibit clean green bone fracture surfaces. This

gnaw marks. The massive compact bone on both sides of the mandibular synthesis has been severed by two separate green bone breaks (figures 11 and 12). Two separate, but similar, fracture

tures. Several lines of evidence suggest that the bison (Risan sp.) tibia is a bone too!. These inclu-

suggests that the skull may have been fragmented by use of multiple high-velocity impact frac-

de: 1) It was found by the excavators in association with butchered mammoth bone. 2) the

events involving an enormous amount of force such as would be delivered by a large hammer

helical or spiral fracture of the diaphysis suggest that a blow was delivered to diaphysis while the bone was fresh. 3) A negative scar documenting an independent blow from the cortical side of the bone suggest the working edge of

would have been required to break this thick compact bone. Also, the left tusk socket exhibits a green bone fracture (figure 13). The origin of this fracture is not self-evident. It is pos-

the specimen was purposefully shaped; 4) What my be polish and rounding of the edge may have been produced by tool use; 5) the green

sible that the tusk sheath was broken to remove the tusk from the skul!. Additional evidence is found in the skull fragments. Numerous

small

256


A PRELIMINARY REpORT OF-THE McMINNVlLLE

MAMMOTH,

OREGON

Figure 12. Fracture surfaces ofthe right and left rami broken when bone was fresh. Figure 10. Mammoth skull with carnivore puncture mark.

Figure 13. Left tusk sheath illustrating green bone breakage.

figure 6) about 20 cm be10w the bottom level of the mammoth bones. It is possible that the tibia tool was lost while humans were butchering the animal and it was trampled into soft sediments. In the future, we plan to C14 date the tibia to demonstrate that it is of the same radiocarbon age as the mammoth. The green bone break (figures 14 and 15) that severed the tibia shaft was apparently initiated by a high velocity impact blow, possibly with

Figure 11. View of mandibular synthesis region with green bone breaks of the right and left ramio

bone fracture

a hammerstone, by placing the blow near the distal end of the tibial crest. Radial fracture

and negative flake scar on the

working edge of the tool are perminarlized demonstrating breakage and use-wear patterns occurred after burial and prior to excavation. The occurrence of split-line cracks running through the tibial diaphysis suggest that the tibia is poorly preserved. The tibia (figures 14-17

marks can be seen on the pointed

end of the

tool adjacent to wear the specimen was impacted (figure 16). The distal end of the pointed spiral fracture is rounded. A notch in the tool edge and negative scar on the compact bone adjacent to the initial fracture suggests that an ancient craftsman shaped and sharpened the

was found at the lower limit of the mammoth bone bearing section of Strata IV (Item 19 in

edge of the tool to make it more useful cut-

257


ROBSON BONNICHSEN, MICHAEL FULL AND MARV1N REKEN

Figure 15. Posterior viewof the distalleft tibia with a helical green bone fracture that may have been used as a tool.

Figure 14. Pc;:>sterior viewof the left tibia with a helical green bone fracture that was possiblyused as a tool.

DISCUSSION AND CONCLUS10NS

ting/ chopping edge (figure 16). The surfaces of this tool are poorly preserved, yet polish may be presento A planned microscopic examination of these surfaces will be important and necessary studies lO further access the toolusing hypothesis. Individuals processing the

We do not know how the McMinnville

could have beached on a sediment bar in a low energy depositional environment along a former channel of the Yamhill River. Alternatively, human hunters could have killed the animal as it foraged rich vegetation along the margins of the river. Without more evidence, we will never

carcass likely used the sharp-edged pointed tibia for chopping, eutting, and possibly scraping activities. The bison tibia would have been well-suited for chopping through lean meat and severing muscles and tendons. Similar bone modification

patterns

Mam-

moth died. It could have died of old age and floated down the Yamhill River as a "bloater and floater." Some time during this voyage, it

are found on tibia

.know how the McMinnville Mammoth

choppers from bison processing sites in the Great Plains (Johnson, 1982). This specimen was likely a discarded butchering implement

met its

demise. The assemblage is composed primarily of bones from the front left site of the animal and axial components from the vertebral column, skull, and broken mandible. It is possible that

brought to the site for butchering purposes from another location. Thus, the tibia is likely a manuport.

258


A PRELIMINARY REpORT OF THE McMINNVILLE

MAMMOTH,

端REGON

Incipien! radial fractures from initial impact Notch and impactscar

~

Figure 16. Close-up of the medullary side of the green bone fracture. Incipient radial fractures indicate where specimen was struck to create the spira! fracture. The notch and negative flake scar suggest the working edge of the implement was purposefully shaped.

Figure 17. Close-up of the cortical side of the distal end of the helical fracture that may have been rounded by tool use.

this was the side of the animal that was beached

fabricated

in the sand bar. If butchering was involved, there is a lack of evidence for the disarticulation sequence. No evidence was found to indi-

(Johnson, 2002). There is no logical order or relationship among the bones. Interestingly, only the thoracic vertebrae, which were spatially separated

flaked-stone

butchering

implements

cate the presence of cutmarks made by stone tools that would be indicative of human butchering. It should be noted, however, that cut-

from one another, articulate with one another (figure 8). From a human utilization perspecti-

marks made by stone tools have never been found on New World Mammoth with an antiquity ofgreater than 13000 RCYBP. Current evi-

ve, the recovered bones, e.g., skull fragments, vertebra, and ribs are elements with little meat or marrow value and likely would have been dis-

dence from a number of pre-13000-year-old mammoth scavenging or butchering sites from the Creat Plains and Yukon Territory suggest that butchering and disarticulation may have been accomplished without the benefit of pre-

card candidates at a butchering station. In respect to modification agency sequence, it is not possible to determine with certainty which of three possible scenarios occurred: 1) carnivore gnawing preceded butchering;

259


ROBSON BONNICHSEN, MICHAEL FULL AND MARVIN REKEN

In summary, the aboye discussion represents the first presentation of discoveries made at the McMinnville Mammoth site. Previous resear-

2) butchering preceded carnivore gnawing; and/or 3) carnivore gnawing and human modification occurred at the same time. Those elements showing evidence for human modification, e.g., mandibular green bone re gnawing.

chers have discussed similar finds (Bonnichsen, 1979; Bonnichsen and Sorg, 1987; Cinq-Mars and Morlan, 1999; Holen, 1994, 1995, 1996; Morlan, 1979;Johnson, 2002, and others) including more than a dozen sites with modified

skull fragments, the tusk sheath, synthesis, and bison tibia with a break, aH lack evidence for carnivoPossibly, these elements were buried

mammoth remains greater than 12500 RCYBP. These sites extend from the Old Crow Basin in the Yukon Territory in the North to the Valley of Mexico in the South. This research suggests that humans with a low visibility technology were in the Americas well before the develop-

in the river sediment bar during the butchering process and scavenging by carnivores occurred after completion of the butchering episode. The working hypothesis that bones elements from McMinnville Mammoth appear to have been altered by humans is consistent with an

ment of Clovis and other early lithic projectile point traditions. Most of the early mammoth bone sites yielding bones fractured while fresh have been found the Great Plains and Yukon Territory ofNorth America and date from about 12000 to about 24000 RCYBP. The McMinnville Mammoth suggests the possibility that ĂŠarly

expedient butchering technology postulated for a number oflate Pleistocene mammoth butchering sites in eastern Beringia and in the American grasslands region. Such a strategy would have allowed humans to process or scavenge animal s who died of natural causes or recently killed animals using an expedient butchering technology based on the use of local materials or easily transported butchering

peoples using abone breaking butchering/scavenging pattern may date back earlier than previously anticipated. As the McMinnville radiocar-

tools, e.g., the bison tibia chopper. A percussion implement, such as large hammerstones made from a locally available boulder,

bon date implies, these populations may push the date on the early peopling of the Americas back to 50000 RCYBP. Additional research is

was likely used to sever bones of the McMinnville Mammoth rather than flaked stone tools to cut through tough tendons at joints. Humans may have used a "sledge-hammer approach" to

planned to refine our understanding of the geology, paleoecology, chronology, and cultural aspects of the McMinnville Mammoth site.

open the cranium to gain access to the animal's large caloric-rich brain and to tusks. Indirect evidence for use of large hammerstone butche-

ACKNOWLEDGEMENTS

ring technology may be inferred from two different patterns in the McMinnville Mammoth bone assemblage. First, the compact bone bet-

We would like to thank the following students for their assistance with this project: Michelle Punke, who prepared the graphics; Ed MacGregor, who did the preliminary paleontological analysis; Suzie Bodman for her assistance

ween the first lower molar and mandibular synthesis was fractured on both sides of the synthesis. This breakage pattern would have mini-

with the taphonomic analysis; and Diana Roy for her assistance with the preliminary paleoecological study. We gratefully acknowledge Professor Herbert Huddlestons assistance in

mally required two fracture events initiated by high velocity blows on opposite sides of the mandible. Additionally, the skull was totally dismantled, apparently to gain access to brain, with multiple blows judging from the presence of skull, maxillary, sinus bone fragments and left tusk sheath with green bone breaks.

preparing the site profile. I would also like to thank Michael Waters for reading a draft version of the manuscript.

260


A PRELlMINARY REpORT OF THE McMINNVlLLE

BIBLIOGRAPHY Agenbroad,

MAMMOTH, OREGON

Graham, RW. (1981), "Preliminary Report on Late Pleistocene Vertebrates from the Selby and Dutton Archeological/Paleontological Sites, Yuma County, Colorado", Contributions

L.D. Y JI. Mead (eds.) (1994), The

Hot Springs Mammoth Site: A Decade of Field and Laboratory Research in Paleontology, Ceo-

Ceology University of Wyoming, núm. 20, pp. 33-56.

logy, and Paleoecology, Rapid City, Fenske Printing Company. Balster, CA. y RB. Parsons (1968), Ceomorpholo-

--

gy and Soils, Willamette Valley, Oregon Agriculture Experiment Station, Oregon State University Corvallis (Special Report, 265). Berglund, B.E. (ed.) (1986), Handbook of Holo-

(1986), "Taxonomy of North American Mammoths", en G.C. Frison y L.C. Todd (eds.), The Colffy Mammoth Site - Taphonomy and Archaeology of a Clovis Kill in Northern

Wyoming, Albuquerque, University of New Mexico Press, pp. 165-169. Hannus, A.L. (1987), "Flaked Mammoth Bone

cene Palaeoecology and Palaeohydrology, Nueva York, John Wiley & Sonso Bonnichsen, R (1979), Pleistocene Bone Technology in the Beringia Refuguim, Canadá, Archaeo-

from the Lange/Ferguson Site, White River Badlands, Area South Dakota", en R Bon-

logical Survey of Canada (Mercury Series Paper, 89). --, D. Stanford y JI. Fastook (1987), "En-

nichsen y M.H. Sorg (eds.), Bone Modification, Orono, Center for the Study of the First Americans, University of Maine, pp. 395-412.

vironmental Change and Developmental History of Human Adaptive Patterns, the Paleoindian Case", en W.F. Ruddiman y H.E. Wright Jr. (eds.), North America and

Holen, S.R (1994a), "Did Someone Eat the La Sena Mammoth? In Cellars ofTime: Paleontology and Archaeology in Nebraska", Nebraskaland Magazine, vol. 72, núm. 1, p. 88.

Adjacent Oceans During the Last Deglaciation: The Ceology of North America, Boulder, Geological Survey of America, vol. K-3, pp. 403-424.

---

--

--

Y M. Sorg (eds.) (1987), Bone Modification, Orono, University of Maine, Center for the Study of the First Americans. -y K.L. Turnmire (1999), "An Introduc-

(1994b), "Evidence of the First Humans in Nebraska", Museum Notes, Lincoln, University ofNebraska State Museum, pp. 1-6. (1994c), 'The Lovewell Mammoth: A Late Wisconsinan Site in North Central Kansas", Current Research in the Pleistocene, núm.

13, pp. 69-70. Irving W.N. y C.R Harington

tion to the Peopling of the Americas", en R Bonnichsen y K.L. Turnmire (eds.), Ice Age

(1973), "Upper

Pleistocene Radiocarbon-Dated Artefacts fram the Northern Yukon", Science, núm. 179, pp. 335-340.

Peoples of the Americas: Environments, Origins, and Adaptations, Corvallis, Oregon State University Press, pp. 1-26. Cinq-Mars, J y R.E. Morlan (1999), "Bluefish Caves and Old Crow Basin: A New Rapport", en R Bonnichsen y K.L. Turnmire (eds.), In

Johnson, E. (1982), "Paleo-indian Bone Expediency Tools; Lubbock Lake and Bonfire Shelter", Canadian joumal of Anthropology/Revue Canadienne d/Anthrapologie, núm. 2, pp. 145-157.

Ice Ages Peoples of North America: Environments, Origins, and Adaptations, Corvallis, Oregon

---

State University Press, pp. 200-212. Dixon,J y RM. Thorson (1984), "Taphonomic Analysis and Interpretation in North American Pleistocene Archaeology", Quaternary Research, núm. 22, pp. 155-159.

(2002), "Late Pleistocene Mammoth Procurement in the North American Grasslands", en R Bonnichsen, R Gruhn, D.G. Steele, C.N. Warren y D. G. Stanford (eds.), Paleoamerican Origins: Beyond Clovis, para presentarlo en la Texas A&M University Press, College Station.

261


ROBSON BONNICHSEN, MICHAEL FULL AND MARVIN REKEN

MacDowell, P.R. Y M.C. Roberts

(1987), Field

Guidebook to the Quaternary Stratigraphy, Geomorphology and Soils of the Willamette Valley, Oregon, Portland, Association of American Geographer. Miller, SJ. (1987), "Characteristics of Mammoth Bone Reduction at Owl Cave, the Wasden Site Idaho", en R. Bonnichsen y M.H. Sorg (eds.), Bone Modification, Orono, Center for the Study of the First Americans, University of Maine, pp. 381-394. Morlan, R.E. (1979), Toward the Definition of Criteria for the Recognition ~f Artificial Bone Alteration,

Rancier,

G. Haynes y D. Stanford

(1982),

Lore, núm. 48, pp. 1-17. Roy, D. (1994), "Full Mammoth Site: Draft Site Repon, Paleoecology", Term Paper for Anthropology, núm. 506, otoño de 1998, Oregon State University. On file, Center for the Study of the First Americans, Department of Anthropology,

Texas

A&M University,

College

Station, TX. Stanford, D. (1979), "The Selby and Dutton Sites; Evidence of a Possible Pre-Clovis Occupation of the High Plains", en R.L. Humphrey y D. Stanford (eds.), Pre-Llano Cultures in the Americas: Paradoxes and Possibilities, Washington, D.C., Anthropological

Quaternary Research, núm. 22, pp.

160-171. Orr, E.L., w'N. Orr y E.M. Bladwin (1992), ''Willamette Valley", Geology of Oregon, cuarta edición. Overstreet, D.F. (2002), "Late Glacial IceMarginal Adaptation in Southeast Wisconsin", en R. Bonnichsen, R. Gruhn, D.G. Steele, C.N. Warren y D.G. Stanford (eds.), Paleoamerican Origins: Beyond Clovis, para pre-

J.,

"Investigation of Lamb Spring", Southwestern

--y

Society ofWashington, pp. 101-125. R.w' Graham (1985), "Archaeological Investigations of the Selby and Dutton Mammoth Kili Sites, Yuma Colorado", National Geographic Research Reports, núm. 20, pp.h19541.

--,

sentarlo en la Texas A&M University Press, College Station.

262

w'R. Wedel y R. Scott (1981), "Archaeological Investigations ofthe Lamb Spring Site", Southwestern Lore, vol. 47, núm. 1, pp. 14-27.


MAMMOTHS FROM THE BASIN OF MEXICO: STRATIGRAPHY AND RADIOCARBON DATING Silvia González, * Luis Morett Alatorre, ** David Huddart,

nahuac y Santa Isabel Iztapan, situadas en la parte oriental de la cuenca del Valle de México. Exponemos y los datos relativos a sedimentología, tefracronología y fechamientos de carbono 14 directamente en huesos de mamut. En los sitios estudiados, la mayoría de los depósitos consisten en sedimentos de lago, cenizas volcánicas y flujos de lodo volcánico (Iahares). La actividad volcánica fue un factor impor-

La cuenca del valle de México es particularmente rica en sedimentos del Pleistoceno superior; hay indicios de la presencia de una megafauna extinta que incluye mamutes, gatos dientes de sable, bisontes, camellos, caballos, milodones y glyptodontes. En ocasiones sus restos se encuentran asociados con artefactos de manufactura humana y llegan a presentar huellas de corte posiblemente hechas por humanos. Los sitios prehistóricos se localizan en un área lacustre cuya profundidad ha fluctuado constantemente, y algunas veces se advierte que estuvieron cerca de las líneas de playa de los

tante en el paleoambiente de la cuenca de México durante el Pleistoceno superior y el Holoceno temprano: los depósitos estudiados presentan huellas de varias erupciones volcánicas de tipo explosivo (tipo pliniano) que ocurrieron entonces y produjeron horizontes marcadores de cenizas volcánicas (tefras). Estos horizontes son: a) La gran ceniza basáltica con 29000 años a.P.

lagos. Por lo menos en 30 localidades se ha reportado la existencia de huesos de mamutes (Mam-

b) Pómez con andesita con 14450 años a.P. e) Pómez marcadora superior o tripartita con 10500 años a.P. Nuestros estudios fueron realizados en el Natural Environment Research Council (NERC), Electron Microprobe Unit, de la Universidad

muthus eolumúi) y de ellas aproximadamente la mitad muestra evidencias de presencia humana (puntas de proyectil tipo Lerma/ Angostura, huellas de corte, hueso trabajado, fragmentos de obsidiana, etcétera). Presentamos aquí la estratigrafía de varias fosilíferas importantes

Arroyo-CalYrales***

ceno superior, incluyendo Tocuila, Tequexqui-

RESUMEN

localidades

* and Joaquín

de Edinburgo, Escocia, Reino Unido, y mostraron que algunos de los horizontes marcadores de ceniza volcánica se encuentran presentes en las localidades con huesos de mamutes; esto nos ayudó a elaborar una secuencia cronológica detallada de los eventos que formaron los sitios.

del Pleisto-

* School of Biological and Earth Sciences, Liverpool John Moores University, Reino Unido. ** Museo Nacional de Agricultura, Universidad Autónoma de Chapingo, Texcoco, México. *** Subdirección de Servicios Académicos, Laboratorio de Paleozoología, INAH.

263


s.

GONZÁLEZ, L. MORETIALATO~, D. HUDDARTANDJ. ARROYO-CABRALES

Los estudios sedimentológicos que llevamos a cabo indicaron que en varios sitios prehistóricos los huesos de mamut estaban embebidos en depósitos de lahar (flujos de lodos volcánicos), indicando la presencia de eventos de tipo catastrófico, los cuales produjeron acumulaciones masivas de huesos ("bone beds"), como en los sitios de Tocuila y Tequexquinahuac. Estos estudios confirman que las erupciones volcánicas tuvieron una influencia clil11'ática

Mexico during the Late Pleistocene-Early Holocene. The studied deposits indicate several major Plinian volcanic eruptions occurring at this time that produced marker tephra horizons: a) Great Basaltic Ash, 29000 years BP. b) Pumice with Andesite, 14450 years BP. e) Upper Toluca Pumice 10500 years BP. Studies made at the Natural Environment Research Council (NERC) Eleetron Microprobe Unit, at Edinburgh University, United Kingdom, have shown that sorne of the tephra marker horizons are located at several localities

muy fuerte en la cuenca del Valle de México durante la transición del Pleistoceno al Holoceno (entre 11 OOOy10000 añosa.P.). También se

with mammoth bones. This helps to build a detailed chronological sequence of events. The

trata de determinar los posibles efectos de estos eventos volcánicos catastróficos en el proceso de extinción de los mamutes y de la megafauna en general.

sedimentological studies indicate that at several sites the mammoth bones are embedded in lahar deposits (volcanic mud flows), indicating the presence of catastrophic events, that produced "palaeontological bone beds", deposits like at Tocuila and Tequexquinahuac. Our studies indicate that volcanic eruptions had a very strong influence on the paleoenvironment of the Basin of Mexico during the Late Pleistocene-Early Holocene. We will discuss the possible effects of these catastrophic volcanic events in the extinction process of mammoths and megafauna in general.

ABSTRACT The Basin of Mexico is particularly rich in Late Pleistocene sediments, with the presence of an extinct fauna that includes mammoths, sabretoothed cats, bison, camels, horse and glyptodon. Sometimes this megafauna is found in association with human artefacts or exhibits possible cut marks made by humans. The sites are in an area that had a fluctuating lake system, and at times were close to lake shorelines. There are at least 30 reported localities with

KEYWORDS Mammoths,

mammoth bones (Mammuthus columbi) and about half of the sites show evidence of human presence (cut marks, worked bone, Lerma/ An-

rachronology,

gostura types points, etc.) We present the stratigraphy of several important fossiliferous localities from the Late Pleistocene including: Tocuila, Tequexquinahuac and Santa Isabel Iztapan. The data includes: sedimentology, tephrachronology and

stratigraphy,

sedimentology,

teph-

radiocarbon.

INTRODUCTION Mexico is particularly rich in mammoth finds (Proboscidea, Elephantidae) with localities spreading from the Coahuila deserts in the North to the rainforest of Chiapas in the South (García Bárcena, 1989). We present results from an ongoing research programme looking into the relationships between palaeoenvironments, megafauna (especially mammoths), and human presence in the Late Pleistocene/

radiocarbon dates directly on mammoth bone. In these sites the majority of the deposits consist of lake sediments, volcanic ashes and derived volcanic mud flows (lahars). The volcanic activity played a very important role in the paleoenvironment of the Basin of

264


MAMMOTHS FROM THE BASIN OF MEXICO: STRATIGRAPHY AND RADIOCARBON DATING

the Basin of

We present the results of the re-evaluation of

Mexico. This area is rich in late Pleistocene sediments with the presence of an extinct megafauna that ineludes mammoths, sabre-toothed cats, bison, camels, glyptodon and human remains (Lorenzo and Mirambell, 1986; Carballal el al., 1997).

the stratigraphy in several important mammoth sites, ineluding: Tocuila, Tequexquinahuac and Santa Isabel Iztapan 2, together with the results

Early Holocene

deposits around

of a radiocarbon dating programme. Thi~ used bone samples for AMS (Accelerator Mass Spectrometry) on Mexican Pleistocene megafauna. AIl the dates in this paper are quoted uncalibrated.

The sites are in an are a that had a fluctuating lake system and at times may have been in elose proximity to water bodies. There are at least 30 localities around the Basin of Mexico where remains of mammoth and other Late Pleistocene mammals have been found. About half of these have been found in association with human artefacts (Lerma type points, obsidian blades, obsidian flakes), worked bone or bone with cut-marks suggestive of human presence.

MAMMOTH SITES STRATIGRAPHY

We present the basis of a chronological framework for the Late Pleistocene-Early Holocene of the Basin of Mexico, using stratigraphy, tephachronology and radiocarbon dating (see section B) to try to corre late some of the most important Late Pleistocene mammoth locali-

The species of mammoth in this area at the end of the Pleistocene was Mammulhus columbi or Columbian mammoth, which inhabited

tieso AIl the studied sites are located on the Eastern margin of the Basin of Mexico. In this area, volcanic activity played a very

mainly open grassland habitats. This mammoth stood between 3.6 10 4.0 m at the shoulder, with relatively short, broad molars. The molar plates are wide, with thick enamel (2.5-3.2 mm), with 16-18 plates on M3. The tusks are large, divergent and greatly curved see figure 1.

important role in the paleoenvironment, during the Late Pleistocene-Early Holocene. Three major volcanic eruptions of Plinian type (very explosive) have been identified that produced extensive volcanic ash (tephra) marker horizons: a) Great Basaltic-Andesitic Ash (GBA) at 29000 years BP (Mooser, 1997). b) Pum ice with Andesite Ash (PWA) at 14450 years BP (Mooser and Gonzรกlez-Rul, 1961; Mooser, 1967). e)Upper Toluca Pumice (UTP) at 10 500 years BP (Arce el al., in press). Using the electro n microprobe

unit at Edin-

burgh University we were able to analyse tephra shards from several mammoth localities which indicated direct association with specific volcanic eruptions. The sedimentology indicates that at several sites the mammoth bones are embedded in lahar deposits (volcanic mudflows) pointing to the presence of catastrophic mud flow events in the are a that formed "bone beds", with

examples

from

Tocuila

and

Tequex-

quinahuac. To follow we will describe the general strati-

Figure 1. The Columbian mammoth (Mammuthus columm), from the Late Pleistocene sediments around the Basin of Mexico, drawing taken from Haynes (1966).

graphy of each of the studied mammoth (see figure 2).

265

sites


S. CONZÁLEZ, L. MORETI AlATORRE, D. HUOOART ANO J. ARRoYo-CABRALES N

O Lake Xaltocan

O •••

Lake Volcanoes Limit of Mexico City Metropolitan Area

Prehistoric Locality

20 km

.01lI::I==10==~

Tx

Tláloc ••• (4120 m) ••• Telapón (4000 m)

Lake Xochimilco

--',-__

I

Ca

V'

•••

~

IztaccíhuatlJ (5272 m)

o>

Z

~ o>

oo>

••• Popocatépetl (5452 m)

Figure 2. Basin of Mexico location map showing: a) Black stars: Localities with stratigraphy: Tocuila (To), Tequexquinahuac (Tx) and Santa Isabel Iztapan 2 (Iz), b) Black circles: Localities with radiocarbon dates directly on megafauna bones: La Villa (Vi), Tocuila (To), Los Reyes-La Paz (Re), Santa Lucia I, Air Base (Lu), Carretera Federal a Puebla (Ca), Tequexquinahuac (Tx).

Tocuila The site is situated

ESE-WNW towards Texcoco Lake. Conversations with the neighbours showed that at least 15 other

about 40 km East from

findings of mammoth remains have occurred in the vicinity of the site during the past 50 years. The general stratigraphy of the deposit is presented in figure 3. At the bottom of the sequence, the oldest layer is represented by the Creat Basaltic Ash (gba), an ash fall deposit

Mexico City in the small village of San Miguel Tocuila, Texcoco, State of Mexico. This is one of the most important and interesting Late Quaternary sites around the Basin of Mexico. The remains of at least 7 mammoths (Mammulhus columbi) were discovered in July 1996, during construction work for a water cistern (Morett el al. 1998a and 1998b; Arroyo el al., in press). The mammoths were all found in an are a measuring only 30 m2, in a 5 x 6 m pit, to a depth of 3.15 m, embedded in a layer of volcanic mud flow (Jahar) that completely infilled a small river channel draining in a direction

with an age of 28600 ± 200 years BP (Mooser, 1997). On top of this layer the river channel is completely infilled by the lahar deposits in which the mammoth bones are embedded in a layer 1.7 m thick. The bones tend lO concentrate at the bottom of the lahar sediments forming a concentrated "palaeontological bone bed".

266


MAMMOTHS

FROM THE BASIN OF MEXICO:

STRATIGRAPHY

AND RADIOCARBON

DATING

Tocuila Mammoth Site

Lahar (Volcanic Mud Flow) Bone Layer "-

Palaeontological

\

/ <O

"'~

Black Basaltic Ash (GBA)

A) Cross-section of small gully infilled with lahar material.

0-,------------------, -

Beige sandy silt, occasional pum ice + lithic fragments.

-

Laminated grey silt.

]::::::::::===~====:::==;:::::..-__:--i.Jl

J\..Jl

.Jl

so

G

O o _

silts,with mammoth bones, silt and c1ay balls, pumice and ----. ch"!,rcoal with black ash pockets. 150

eO G (J G (J

o

eO

6

6. ~.

/

G

\

u u u

-

Brown silty c1ay.

I.I(

1b~o~oo~o~==~=~' ~ooo =~),/

i

G00G~GI

6"(¡b O

Pumice with Andesite Ash (PWA). Age = 14450 years BP.

í\

6 6 00

(J

Brown silty c1ay

-

,....é:==~¿=:::=t

0

0e

Pum ice fragments up to 6 cm and silt balls

-

G(J6

b06

600 G

b

(J

eG 06 (J (J O

100 Lahar sequence: dark brown sandy

-

b(J

b G (J6

White silty ash, tortoise + f1amingo bones . Olive sandy silt, convolute structures. Brown c1ayey silt convoluted,

~

(~

I

¡ '\ I

(

1)

Black fine sand. Brown silty c1ay. Black basaltic ash.

-

Brown silty c1ay.

,/

Dark orange iron-stained fine sand. Brown silty c1ay.

\1

I ~\~~~~~~~~~~~\~~( ~~~~/

-5ilty sand. Black basaltic-andesitie ash. (GBA) Age = 29,000 years BP. ........ Grey c1ay,laminated.

200

L--..L-...I--l..---L.--l..l-

........ Grey c1aywith vertical cracks.

240

O

B)

40

80

120

160

200 (cm)

Mammoths trench North wall with detailed stratigraphy of the deposits.

Figure 3. Tocuila Mammoth

267

trench stratigraphy.


S. GONZÁLEZ, L. MORETI ALATORRE, D. HUDDART AND J. ARROyo-CABRALES On the channel waJls a series of volcanic ashes and lake sediments are found, incJuding the in situ Pum ice with Andesite (PWA) airfaJl ash with

hand a mammoth skuJl in the bottom of the "bone bed" was radiocarbon dated to 11100 ± SO years BP. Another date in a mammoth rib had

an estimated age of 14450 years BP. Siebe et al. (1999) interpreted the lahar se-

an age of 11 255 ± 75. See table l. Siebe et al. (1999) tried to explain the large discrepancy of nearly 3000 years between the tephra deposition and the lahar event as due to the lack of water availabiJity during the Late Pleistocene when permafrost and glacial ice were prevalent. During the present study we have re-examined the chemical composition of the silty-sandy sediments in which the mammoths are embedded using the electron-microprobe and found that indeed there are andesitic pum ice fragments, associated with the pwa eruption, with silica values around 61%, but in the matrix

quence infiJling the channel as derived from the Pumice with Andesite tephra marker (PWA), because chemical analysis of pumice fragments found in the deposit correspond with the composition of a tephra which originated from a Plinian eruption (very explosive) at the Popocatepetl Volcano at - 14450 years BP. However radiocarbon dating of the sediments associated with the "bone bed" showed that the lahar deposit was formed not earJier than 10650 ± 75 years BP. Hence there was apparently a large discrepancy in time between the primary eruption and then subsequent lahar. On the other

there were present

TABLE 1 MEXlCAN MEGAFAUNA RADIOCARBON

as well tephra

shards

asso-

DATES Age in yean BP (uncalibrated)

Lab. No.

Specimen No.

Species

1. La Villa, Mammoth

OxA-7752

DP-SN4*

Mammuthus Columbi mandible

2. Tocuila, Mammoth

OxA7746

Toc-793,* Mammoth

Mammuthus Columbi skull

ll100

±

80

3. Tocuila, Mammoth

OxA10307

Mammuthus Columbi rib

ll255

±

75

4. Los Reyes La Paz, Mammoth

OxA-7747

DP-1940*

Mammuthus Columbi tibia

18280

5. Santa Lucia Air Base, Camel

OxA-7555

DP-2951*

Camelops Hesternus

ll395

6. Carretera Federal a Puebla, Marnmoth

OxA-7558

1GM-69-26 Geology Collection*

Mammuthus Columbi skull

7. Tequexquinahuac Mammoth

Beta-153819

Chapingo Collection

Mammuthus Columbi tusk

13450

8. Hacienda de Hornos, Viesca, Coahuila, Mammoth

OxA-7445

1GM-71-175 Geology Collection*

Mammuthus Columbi molar

10550

9. San Josecito Cave, San Luis Potosi, Groundsloth

OxA-7556

SJC-5351*

Nothrotheriops Shastensis, rib

Locality/Animal

II 300 ± 120

±

±

160 70

1eft mandib1e

*Samples hosted at the Laboratorio de Paleozoología at INAH. **Samples fram the Instituto de Geologia, UNAM Collection.

268

16380 ± 120

13450

±

±

±

40 110

40


MAMMOTHS FROM THE BASIN OF MEXICO: STRATIGRAPHY AND RAoIOCARBON DATING

ciated with the Upper Toluca Pumice (UTP), derived from the Nevado de Toluca Volcano. The silica content for the tephra shards was 7071 %. Recent volcanological studies by Arce et al. (in press) have indicated that the age of this eruption is 10 500 years BP and not 11 600 years BP as estimated previously by Bloomfield and Valastro (1974, 1977). A lahar derived from the UTP seems more plausible for the events that produced the bone

human presence at sorne point in the formation of the deposit (Arroyo-Cabrales et al., 2001). This includes mammoth bone quarrying activities with a fracture based technology. There are at least 10 bones with green fractures and sorne flakes. This type of bone technology is typical of a larger North American late Pleistocene tradition (Johnson, 2001). Several mammoth bones have evidence of malformations, like strong asymmetry in verte-

ÂĄayer. On the other hand the bones excavated at Tocuila are in general well preserved, showing minimal abrasion, which means that they have

brae and skulls, especially in sorne molars. The reasons for the presence of malformations are still debatable but include: paleoenviromental

not travel very far, perhaps because the Tocuila site was very close to the shores of Texcoco Lake at the time.

stress or interbreeding in a population close to extinction or simply a differential chewing behaviour (Lister, personal communication, 2002).

The approximately 1 000 bones found in the site belong mainly to the Columbian mammoth (Mammuthus eolumbi), with a few remains of

More research is required to answer this important question. The excavated area has been incorporated into a small museum, which can be visited. The displays include recovered bone remains and in situ mammoth bones. Future studies will search for the spatial li-

horse (Equus sp.), bison (Bison sp.), camel (Camelops hesternus) and rabbits (Sylvilagus cunicularĂ­us) in the lahar layer. On the top of the lahar deposit a white ash layer mixed with diatoms is found covering all the sequence. The bones of animals found in this white layer indicate a high lake level (Iake transgression) occuring after the lahar event, including: fishes, turtles

mits of the fossiliferous deposit, which will help to build a framework to undertake further excavations to solve sorne specific questions, including the processes that formed the deposit, the presence of cultural evidence associated with

(Kinosternon sp.) and aquatic birds like the flamingo (Phoenieopterus el Ruber) as discussed in Corona M. and Arroyo-Cabrales (1997), and ducks (Anas sp) (Corona M., personal communication,1998).

the bones, issues that causes for megafauna

and those related to osteological could contribute to understand the the Late Pleistocene extinction of in North America.

The mammoth bones belong to at least seven individuals of several ages and sexes. Their identification was made counting the minimum number of skulls present in the deposit. The majority of the bones were dispersed, except for the articulated remains of a mammoth posterior leg and part of a vertebral column. The bones show sorne evidence of weathering, which means that in sorne cases they were exposed to the environment for sorne time after the death of the animals. The evidence in general points to the fact that the animals were already dead when they were incorporated into the lahar. There are a few bones perhaps suggestive of

Figure 4. Tocuila Marnrnoths site in 1998 (Photo S. Gonzalez).

269


S. GONZÁLEZ, L. MORETI ALATORRE, D. HUDDART AND J. ARROYO-CABRALES Tequexquinahuac This is the highest of all the studied mammoth sites, in the foothills of the mountains at an altitude of2 530 m, with coordinates N: 19° 27' 45" and W: 98° 49' 08". At this site during salvage excavations in 1998, mammoth (Mammuthus calumbi) remains were found, together with horse and deer (figure 5). The stratigraphy of the site

faets (lithic points). The two sites are very close to the controversial Tepexpan Man find (see

is shown in, with the presence of several volcanic ashes and reworked volcanic material of rhyolitic composition. The animal bones where found in layer 4, embedded in a reworked volcanic ash, with very high values of silica for the tephra shards of around 76-78%. This indicates that they are associated with a totally different volcanic eruption, neither the PWA or UTP eruptions. A radio-

village of Santa Isabel Iztapan, Atenco, State of Mexico. The skeleton was completely embed-

carbon date on a mammoth tusk in the deposit gave a result of 13 450 ± 40 years BP (see table 1). It is likely that the source of the volcanic ma-

the most widely distributed artefacts of the lanceolate point horizon of the Creat Plains of USA. The other artefacts included a scraper,

terial is from one of the nearby rhyolitic domes found to the SE of the site, around the Sierra de Quetzaltepec (Tlaloc-Telapon Volcanos) but there is no known Quaternary activity documen-

knife and a fine prismatic blade, all comp6sed of obsidian, and an endscraper and a retouched blade composed of flint. Santa Isabellztapan 2: In May 1954, the construction of another ditch on the limits of the Santa Isabel Iztapan village, resulted in the find of another mammoth "kili site" in which lithics

figure 2). Santa Isabel Iztapan 1: In March 1952, following a chance find by workers opening a draining ditch, researchers from the Department of Prehistory at INAH, excavated the skeleton of a mammoth, 2 km SW of Tepexpan, close to the

ded in the green clays of the Upper Becerra Formation (Aveleyra and Maldonado, 1953). The animal bones were completely disarticulated and had been butchered in situ. Very important were six human artifacts found in direct association with the skeleton. These included a flint projectile point of Scottsbluff type, one of

ted from this regio n until recently (Huddart and Conzález, this volume)

have been used during the process of mammoth butchering (figure 6). In this case one of the posterior legs of the animal was found in anatomical position, indicating that probably the animal was trapped in the very soft, green clay of the Late Pleistocene Upper Becerra Formation (Aveleyra, 1955, 1956). The skull and

Santa Isabel Iztapan 1and 2 These are perhaps the most important mammoth sites in Mexico because of the indisputable association of the mammoths with human arte-

tusks were completely overturned during the butchering process and sorne of the bones had deep cut marks. A total of three stone artifacts were found in direct association with the mammoth bones, including a red andesitic Angostura point, a flint Lerma point and a bifadal chert knife. There are so far no radiocarbon dates available for this mammoth. We took a sample during our radiocarbon dating programme from a molar (sample DP-412), but it was unsuccessful due to the lack of collagen preservation in the bones.

Figure 5. Photograph showing the position of the dated Tequexquinahuac mammoth tusk (Photo L. Morett).

270


MAMMOTHS FROM THE BASIN OF MEXICO: STRATIGRAPHY AND RADIOCARBON DATlNG

In the summer of 2001 we excavated a new trench to re-evaluate the stratigraphy of this important site. The results are shown in figure 7. At the bottom of the sequen ce the- Creat Basaltic Ash is found, followed by a series of lake sediments and ash falls. The mammoth was found completely embedded in the green clay ('Jaboncillo "), found at a depths from 1.75 lO 2.25 m fram the surface. The green clay belongs to the Late Pleistocene Becerra Formation (Aveleyra, 1955). In this in terval there are seve-

ral ash deposits, including reworked "balls" with Pumice with Andesite fragments and a 3 cm layer of black basaltic ash. The Upper Toluca Pumice layer is not present as a recognisable ash fal!. So even now the real age of the mammoth is not very clear, but further tephrachranology studies are underway to clarify the eยกact chemical composition of the volcanic ashes found in the sequence. MEGAFAUNA RADIOCARBON DATES

Parallel to the study of the stratigraphy of several prehislOric sites around the Basin ofMexico, an intensive programme of radiocarbon dating using Accelerator Mass Spectrometer (AMS) was in place to try to obtain direct dates on bone fram sorne important megafauna remains from the Basin of Mexico. Many of the successful dated specimens were mammoths (see table 1). The majority of the samples were dated at the Oxford Radiocarbon Laboratory of the Oxford University, United Kingdom, through a grant fram the Natural Environment Research Council (nerc); only one sample (Tequexquinahuac tusk) was dated by Beta Analytic in Miami, USA. For each sample less than 2 grams of bone were taken either by: a) cutting a small piece of bone with a small saw 01' b) the bone was drilled to obtain bone powder. A total of 38 samples of different megafauna specimens were taken, but results were obtained only in 9 specimens (table 1). The main reason for the low rate of success was the lack of collagen preservation in many of the bones, together with the contamination of the bones with preservatives during conservation of the specimens. The oldest dated mammoth was the Los Reyes-La Paz tibia at 18280 years. The youngest was the Hacienda de Hornos, M2 Mammoth molar fram Viesca Coahuila, in the North of

l>,o

,p

Santa Isabellztapan

o

0.50

1.00

1.50

2

2.00 m.

the country, with a very terminal age for Columbian mammoths of 10 550 years BP, which is so far the youngest mammoth fram Mexico. The date of La Villa Mammoth at 11 300

Figure 6. Santa Isabel Iztapan 2 mammoth bone distribution plan and position of artifacts (Aveleyra, 1955).

years BP is very important

271

because the animal


S. GONZÁLEZ, L. MORETI A!..ATORRE, D. HUDDART AND J. ARROYO-CABRALES in the SW of USA with ages between 11 000, 11 500 years BP. More studies are currently

has cut marks suggestive of human presence on the mandible and tusk. This date suggests that humans were perhaps present in the Basin of Mexico at the same period as the Clovis People

underway to try to assess if the marks on the mammoth bones are real "cut marks" or noto

Santa Isabellztapan 2 (17/07/2001)

0.....-,..-...,.......,...---,-.,..........,.........,

---

Made ground, rubbish, glass

95 ---

Dark sandy siltas below

---

Pocket of ash

___

Dark sandy silt with small pebbles up to 5 mm & pottery c.130

___

Green fine c1ay(jaboncillo)

---

Dark basaltic ash lake sediments

---

Green fine c1ay(jaboncillo)

@

140

? ? ? 190 197

220

.~

-+-...,..--

• (jJ)-250

)

)

Pockets of ash-pumice-c1ay, mud balls

---

Green fine c1ay(jaboncillo)

---

Light grey ash mixed with lake sediments (chaotic)

---

Green fine c1ay(jaboncillo, root cast brown)

---

Red-brown silt (ostracop coquina)

---

Green fine c1ay(jaboncillo) with cracks

260 270

.® -290 .@-300 312 313

(í)

_(¡J.,,;,.m \ .@

353

-330

\

)

• ® -347 •

....-..;--...~""'--.'":'-..~

.~(l)" 370

j j

· ."

~ _.-1

Black ash, fine layer mixed with lake sediments, root casts (GBA)

••.•

.(j)

380

Figure 7. Santa Isabel Iztapan 2, new trench 2001 stratigraphy.

272


MAMMOTHS

FROM THE BASIN

OF MEXICO:

STRATIGRAPHY

CONCLUSIONS Our stratigraphical radiocarbon dates bone, suggests that very important role

AND RADIOCARBON

DATING

ACKNOWLEDGMENTS

studies, together with the of mammoths directly on volcanic emptions played a in the paleoenvironment of

The authors wish to tank Óscar Polaco from the

the Basin of Mexico during the Late Pleistocene/Early Pleistocene Transition (between 11000 to 10000 years BP). Several important mammoth sites are associated with volcanic deposits,

sample their palaeontological collections, together with their help and discussions on the material. Also we wish to tank nerc in the UK

Laboratorio de Paleozoología del INAH and Dra. María de Carmen Perrilliat from the Instituto de Geología de la unam for giving access to

for giving dates in fram the reported

like the Tocuila and Tequexquinahuac sites (González et al., 2001). In particular the eruption' of the Nevado de Toluca Volcano at 10500 years ago (Arce et al., in press), produced the

S. Gonzalez a grant to get radiocarbon the Oxford Radiocarbon Laboratory majority of the megafauna specimens here.

Upper Toluca Pumice ash horizon, which is widespread trough the Basin of Mexico with thickness up to 50 cm in places. After this vol-

BIBLIOGRAPHY

canic ash fall a series of lahar events (volcanic mud flows) are recorded in the stratigraphic

Arce, JL., JL Macias y L. Vázquez-Selem (en prensa), ''The 10.5 ka Plinian Eruption of

sequence, together with "palaeontological bone beds" included in them. After these volcanic events the megafauna remains are no longer found in the sequence, extinct.

the animals

Nevado

becoming

It is easy to imagine the environmental

de Toluca Volcano,

Mexico:

graphy and Hazards Implications", Society of America Bulletin. Arroyo-Cabrales,

J,

E. Johnson

Strati-

Geological

y L. Morett

(2001), "Mammoth Bone Technology at Tocuila in the Basin of Mexico", Proceedings of the 1" International Congress "The World of

chan-

ges associated with the transition from Pleistocene to Holocene, with changes in the temperatures and vegetation that transformed the habitats in which the mammoths were living.

Elephants", Roma, 16 a 20 de octubre, pp. 419-423. ---, S. González, L. Morett-A1atorre, O. Polaco, G. Sherwood y A. Turner (en pren-

On):op of those changes, a layer ofwhite sandy ash (UTP) was deposited along the whole of the Basin of Mexico, making grazing particularly difficult if not impossible. This was followed by a series ofvolcanic mud flows as rainfall washed this ash from the slopes. AlI of these environ-

Mammoth Site, Deinsea", The Scientific fournal of the Natuur Museum, Rotterdam. Aveleyra Arroyo de Anda, L. (1955), El segundo

mental changes together caused a big ecological stress in the megafauna populations. We believe that the extinction of the mam-

mamut fósil de Santa Isabel Iztapan, México y artefactos asociados, México, INAH, Dirección de Prehistoria (publicación 1).

sa), "The Late Paleoenvironment of the Basin of Mexico. Evidence from the Tocuila

moths and megafauna in general in the Basin of Mexico is linked to the presence of active vulcanism of very explosive nature (Plinian) at the end of the Pleistocene. The environmental

--

Valley of Mexico",

contributing

to their

American Antiquity, núm.

18, pp. 332-340. --(1955), ''The Second Mammoth and Associated Artifacts at Santa Isabel Iztapan, Mexico", American Antiquity, vol. 22, núm. 1,

changes together with the arrival of humans in the Basin (see González et al., this volume) were the factors tion.

y M. Maldonado-Koerdell (1953), "Association of Artifacts with Mammoth in the

final extinc-

pp. 12-28.

273


S. GONZÁLEZ, L. MORETI ALATORRE, D. HUDDART AND J. ARROyo-CABRALES Bloomfield, K. Y S. Valastro Jr. (1974), "Late Pleistocene Eruptive History of Nevado de Toluca Volcano, Central Mexico", Geological Society of America Bulletin, núm. 85, pp. 901906. ---

(1977), "Late Quaternary Tephrachronology of Nevado de Toluca Volcano, Cen-

Johnson, E. (2001), "Marnmoth Bone Quarrying on the Late Wisconsinan North American Grasslands", Proceedings of the 1'1 International Congress "The World of Elephants", Roma, 16 a 20 de octubre, pp. 439-443. Lorenzoj.L. y L. Mirambell (1986), "Mamutes excavados en la cuenca de México", Cuadernos de Trabajo del Departamento de Prehistoria, México, INAH, núm. 32, pp. 1-15l.

tral Mexico", Overseas Geology .and Mineral Resources, núm. 46, pp. 1-15. Carballal-Staedler M., R. Chávez, M. Flores, LA López, M. Moreno, FJ. Ortuno y MJ. Sán-

Mooser, F. (1966), "Tefracronología de la cuenca de México para los últimos 30 000 años",

chez (1997), "IV. Los materiales: restos óseos de la fauna pleistocénica. Región de los lagos centrales de la cuenca de México", en M. Carballal (coord.), A propósito del Cuaternario, México, INAH, Dirección de Salvamento Arqueológico, pp. 83-118. Corona, M.E. yj. Arroyo-Cabrales (1997), "New Record for the Flamingo (Phoenicopterus cf. P.

Boletín del Instituto Nacional de Antropología e Historia de México, núm. 30, pp. 12-15. --(1997), "Nueva fecha para la tefracronología de la cuenca de México", en Margarita Carballal Staedler (coord.), A propósito del Cuaternario, México, INAH, Dirección de ---

ruber Linnaeus) from Pleistocene-Holocene Transition Sediments in Mexico", Current Research in the Pleistocene, núm. 14, pp. 137-139. García Bárcena,j. (1989), "El hombre y los proboscídeos de América", en Lorena

Miram-

Salvamento Arqueológico, pp. 19-23. Y F. González-Rul (1961), "Erupciones volcánicas y el hombre primitivo en la cuenca de México", Homenaje a Pablo Martínez del Rio en el XXV aniversario de la edición de Los Orígenes Americanos, México, INAH, pp. 137-14l.

Morett-Alatorre,

bell (coord.), Homenaje a José Luis Lorenzo, México, INAH, pp. 41-79 (Colección Científica, 188). González, S., D. Huddart, L. Morett, j. ArroyoCabrales y O. Polaco (2001), "Mammoths, Volcanism and Early Humans in the Basin of Mexico During the Late Pleistocene/Early

L., j. Arroyo-Cabrales

y OJ.

Polaco (1998a), "Tocuila, a Remarkable Marnmoth Site in the Basin of Mexico", Current Research in the Pleistocene, núm. 15, pp. 118-120. ---et al. (1998b), "El sitio paleontológico de Tocuila", Arqueología Mexicana, vol. 5, núm. 30, p. 57. Siebe, C., P. Schaaf y j. Urrutia-Fucugauchi (1999), "Mammoth Bone Embedded in a

Holocene", Proceedings of the 1" 1nternational Congress "The World of Elephants ", Roma, 16 a 20 de octubre, pp. 704-706. Haynes, C.Y. Jr. (1966), "Elephant-Hunting in North America", en Richard S. MacNeish y W.F. Freeman (comps.), Early Man, Readings from Scientific American, San Francisco, pp. 44-52.

Late Pleistocene Lahar from Popocatépetl Volcano, Near Tocuila, Central Mexico", Geological Society of America Bulletin, vol. 111, núm. 10, pp. 1550-1562.

274


El homlJre temprano en América y sus implicaciones en el poblamiento de la cuenca de México. Primer Simposio Internacional -con un tiro de 1 000 ejemplaresse terminó de imprimir en septiembre de 2006 en los talleres gráficos del lnstituto Nacional de Antropología e Historia. Producción: Dirección de Publicciones de la Coordinación Nacional de Difusión.


El hombre temprano en america y sus implicaciones en el poblamiento de la cuenca de mexico  
Read more
Read more
Similar to
Popular now
Just for you